Patent application title:

Development of Protein-Based Biotherapeutics That Penetrates Cell-Membrane and Induces Anti-Hepatocellular Carcinoma Effect - Improved Cell-Permeable Suppressor of Cytokine Signaling (iCP-SOCS3) Proteins, Polynucleotides Encoding the Same, and Anti-Hepatocellular Carcinoma Compositions Comprising the Same

Publication number:

US20160060310A1

Publication date:
Application number:

14/838,260

Filed date:

2015-08-27

Abstract:

Protein transduction exploits the ability of some cell-penetrating peptide (CPP) sequences to enhance the uptake of proteins and other macromolecules by mammalian cells. Previously developed hydrophobic CPPs, named membrane translocating sequence (MTS), membrane translocating motif (MTM) and macromolecule transduction domain (MTD), are able to deliver biologically active proteins into a variety of cells and tissues. Various cargo proteins fused to these CPPs have been used to test the functional and/or therapeutic efficacy of protein transduction. For example, recombinant proteins consisting of suppressor of cytokine signaling 3 protein (CP-SOCS3) fused to the fibroblast growth factor (FGF) 4-derived MTM were developed to inhibit inflammation and apoptosis. However, CP-SOCS3 fusion proteins expressed in bacteria were hard to purify in soluble form. To address these critical limitations, CPP sequences called advanced MTDs (aMTD) have been developed in this art. This is accomplished by (i) analyzing previous developed hydrophobic CPP sequences to identify specific critical factors (CFs) that affect intracellular delivery potential and (ii) constructing artificial aMTD sequences satisfied for each critical factor. In addition, solubilization domains (SDs) have been incorporated into the aMTD-fused SOCS3 recombinant proteins to enhance solubility with corresponding increases in protein yield and cell-/tissue-permeability. These recombinant SOCS3 proteins fused to aMTD/SD having much higher solubility/yield and cell-/tissue-permeability have been named as improved cell-permeable SOCS3 (iCP-SOCS3) proteins. Previously developed CP-SOCS3 proteins fused to MTM were only tested or used as anti-inflammatory agents to treat acute liver injury. In the present art, iCP-SOCS3 proteins have been tested for use as anti-cancer agents in the treatment of hepatocellular carcinoma. Since SOCS3 is frequently deleted in and loss of SOCS3 in hepatocytes promotes resistance to apoptosis and proliferation, we reasoned that iCP-SOCS3 could be used as a protein-based intracellular replacement therapy for the treatment of hepatocellular carcinoma. The results support this reasoning: treatment of hepatocellular carcinoma cells with iCP-SOCS3 results in reduced cancer cell viability, enhanced apoptosis and loss of cell migration/invasion potential. Furthermore, iCP-SOCS3 inhibits the growth of hepatocellular carcinoma in a subcutaneous xenografts model. In the present invention with iCP-SOCS3 fused to an empirically determined combination of newly developed aMTD and customized SD, macromolecule intracellular transduction technology (MITT) enabled by the advanced MTD may provide novel protein therapy against hepatocellular carcinoma.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C07K14/4703 »  CPC main

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used; Regulators; Modulating activity Inhibitors; Suppressors

C07K2319/10 »  CPC further

Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22

A61K38/00 »  CPC further

Medicinal preparations containing peptides

C07K14/47 IPC

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

C07K7/08 »  CPC further

Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof; Linear peptides containing only normal peptide links having 12 to 20 amino acids

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of the filing date of U.S. Provisional Application No. 62/042,493, filed on Aug. 27, 2014, in the United States Patent and Trademark Office, the disclosure of which is incorporated herein in its entirety by reference.

TECHNICAL FIELD

The present invention pertains to have (i) improved cell-permeable SOCS3 (iCP-SOCS3) proteins as protein-based biotherapeutics, which are well-enhanced in their ability to transport biologically active SOCS3 proteins across the plasma membrane, to increase in its solubility and manufacturing yield, and to induce anti-hepatocellular carcinoma effect; (ii) polynucleotides that encode the same, and (iii) anti-hepatocellular carcinoma compositions that comprise the same.

BACKGROUND ART

Hepatocellular carcinoma (HCC) is one of the most common cancers with high mobility/mortality rate and the tumor often develops after liver cirrhosis and advanced fibrosis. Cytokines including IL-6 and interferon-gamma (IFN-γ) activate the Janus kinase (JAK)/signal transducers and activators of transcription (STAT) signaling pathway, a vital role promoting the inflammation, fibrosis and carcinogenesis in the liver. STAT3, which functions as an oncogene downstream of IL-6/gp130, is hyper-activated in hepatocellular carcinoma contributes to increase cell proliferation and inhibits apoptosis by inducing c-MYC, Cyclin-D1, and Bcl-XL.

Cytokine signaling is strictly regulated by the SOCS family proteins induced by different classes of agonists, including cytokines, hormones and infectious agents. Among them, SOCS1 and SOCS3 are relatively specific to STAT1 and STAT3, respectively. SOCS1 inhibits JAK activation through its N-terminal kinase inhibitory region (KIR) by the direct binding to the activation loop of JAKs, while SOCS3 binds to janus kinases (JAKs)-proximal sites on the receptor through its SH2 domain and inhibits JAK activity that blocks recruitment of STAT3. Both promote anti-inflammatory effects due to the suppression of inflammation-inducing cytokine signaling. Furthermore, the SOCS box, another domain in SOCS proteins, interacts with E3 ubiquitin ligases and/or couples the SH2 domain-binding proteins to the ubiquitin-proteasome pathway. Therefore, SOCSs inhibit cytokine signaling by suppressing JAK kinase activity and degrading the activated cytokine receptor complex.

In connection with SOCSs and HCC, the SOCS1 gene has been implicated as an anti-oncogene in the HCC development. Previous studies have reported that aberrant methylation in the CpG island of SOCS1 induces its transcriptional silencing in HCC cell lines, and SOCS1 heterozygous mice are hypersensitive to hepatocellular carcinogenesis. In addition, abnormalities of SOCS3 are also associated with the hepatocellular carcinoma. Hypermethylation of CpG islands in the SOCS3 promoter is correlated with its transcriptional silencing in tumors and in HCC cell lines. SOCS3 overexpression down-regulates active STAT3, induces apoptosis, and suppresses growth in cancer cells. The importance of STAT3 to inflammation-associated hepatocellular carcinogenesis is underlined by the previous study that hepatocyte-specific deletion of SOCS3 in a mouse hepatocellular carcinoma model results in larger and more numerous tumors. This means that SOCS3 plays a major role in the negative regulation of the JAK/STAT pathway in hepatocarcinogenesis and contributes to the suppression of HCC development by protecting the liver cells.

To negatively control JAK/STAT signaling, recombinant SOCS3 proteins that contain a cell-penetrating peptide (CPP)—membrane-translocating motif (MTM) from fibroblast growth factor (FGF)-4 has been reported. These recombinant SOCS3 proteins inhibited STAT phosphorylation, inflammatory cytokines production and MHC-II expression in cultured and primary macrophages. In addition, SOCS3 fused to MTM protected mice challenged with a lethal dose of the SEB super-antigen, by suppressing apoptosis and hemorrhagic necrosis in multiple organs. However, the SOCS3 proteins fused to FGF4-derived MTM displayed extremely low solubility, poor yields and relatively low cell- and tissue-permeability. Therefore, the MTM-fused SOCS3 proteins were not suitable for further clinical development as therapeutic agents. To overcome these limitations, improved SOCS3 recombinant proteins (iCP-SOCS3) fused to the combination of novel hydrophobic CPPs, namely advanced macromolecule transduction domains (aMTDs) to greatly improve the efficiency of membrane penetrating ability in vitro and in vivo with solubilization domains to increase in their solubility and manufacturing yield when expressed and purified from bacteria cells.

In this new art of invention, aMTD/SD-fused iCP-SOCS3 recombinant proteins (iCP-SOCS3), much improved physicochemical characteristics (solubility & yield) and functional activity (cell-/tissue-permeability) compared with the protein fused only to FGF-4-derived MTM. In addition, the newly developed iCP-SOCS3 proteins have now been demonstrated to have therapeutic application in treating hepatocellular carcinoma, exploiting the ability of SOCS3 to suppress JAK/STAT signaling. The present invention represents that macromolecule intracellular transduction technology (MITT) enabled by the new hydrophobic CPPs that are aMTD may provide novel protein therapy through SOCS3-intracellular protein replacement against the hepatocellular carcinoma. These findings suggest that restoration of SOCS3 by replenishing the intracellular SOCS3 with iCP-SOCS3 protein creates a new paradigm for anti-cancer therapy, and the intracellular protein replacement therapy with the SOCS3 recombinant protein fused to the combination of aMTD and SD pair may be useful to treat the HCC.

SUMMARY

An aspect of the present invention relates to improved cell-permeable SOCS3 (iCP-SOCS3) recombinant proteins capable of mediating the transduction of biologically active macromolecules into live cells.

According to an aspect of the present invention, iCP-SOCS3 recombinant proteins fused to novel hydrophobic CPPs—namely advanced macromolecule transduction domains (aMTDs)—greatly improve the efficiency of membrane penetrating ability in vitro and in vivo of the recombinant proteins.

According to an aspect of the present invention, iCP-SOCS3 recombinant proteins fused to solubilization domains (SDs) greatly increase in their solubility and manufacturing yield when they are expressed and purified in the bacteria system.

An aspect of the present invention also, relates to its therapeutic application for delivery of a biologically active molecule to a cell, involving a cell-permeable SOCS3 recombinant protein, where the aMTD is attached to a biologically active cargo molecule.

Other aspects of the present invention relate to an efficient use of aMTD sequences for drug delivery, protein therapy, intracellular protein therapy, protein replacement therapy and peptide therapy.

The present invention provides improved cell-permeable SOCS3 as a biotherapeutics having improved solubility/yield and cell-/tissue-permeability and anti-hepatocellular carcinoma effects. Therefore, this would allow their practically effective applications in drug delivery and protein therapy including intracellular protein therapy and protein replacement therapy.

BRIEF DESCRIPTION OF DRAWINGS

The above and other objects, features and other advantages of the present invention will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings.

FIG. 1 shows the structure of SOCS3 recombinant proteins. A schematic diagram of the His-tagged SOCS3 recombinant protein is illustrated and constructed according to an aspect of the present invention. The his-tag for affinity purification (white), aMTD165 (black), SOCS3 (gray) and solubilization domain A and B (SDA & SDB, hatched) are shown.

FIG. 2 shows the construction of expression for SOCS3 recombinant proteins. FIG. 2 shows the agarose gel electrophoresis analysis showing plasmid DNA fragments encoding SOCS3, aMTDs fused SOCS3 and SD cloned into the pET28 (+) vector according to an aspect of the present invention.

FIG. 3 shows the inducible expression and purification of SOCS3 recombinant proteins. Expression of SOCS3 recombinant proteins in E. coli before (−) and after (+) induction with IPTG and purification by Ni2+ affinity chromatography (P) were monitored by SDS-PAGE, and stained with Coomassie blue.

FIG. 4 shows the improvement of solubility/yield with aMTD/SD-fusion. The solubility, yield and recovery (in percent) of soluble form from denatured form are indicated (left). Relative yield of recombinant proteins is normalized to the yield of HS3 protein (Right).

FIG. 5 shows aMTD-mediated cell-permeability of SOCS3 recombinant proteins. RAW264.7 cells were exposed to FITC-labeled SOCS3 recombinant proteins (10 μM) for 1 hr, treated with proteinase K to remove cell-associated but non-internalized proteins and analyzed by flow cytometry. Untreated cells (gray) and equimolar concentration of unconjugated FITC (FITC only, green)-treated cells were served as control.

FIG. 6 shows aMTD-mediated intracellular delivery and localization of SOCS3 recombinant proteins. Each of NIH3T3 cells was incubated for 1 hour at 37° C. with 10 μM FITC-labeled SOCS3 protein. Cell-permeability of SOCS3 recombinant proteins was visualized by utilizing confocal microscopy LSM700 version.

FIG. 7 shows the systemic delivery of aMTD/SD-fused SOCS3 recombinant proteins in vivo. Cryosections of saline-perfused organs were prepared from mice 1 hr after intraperitoneal injection of FITC only or 600 μg FITC-conjugated recombinant SOCS3 proteins, and were analyzed by fluorescence microscopy.

FIG. 8 shows the structure of SDB-fused SOCS3 recombinant protein. A schematic diagram of the SOCS3 recombinant protein is illustrated and constructed according to the present invention. The his-tag for affinity purification (white), SOCS3 (gray) and solubilization domain B (SDB, hatched) are shown.

FIG. 9 shows the expression, purification and determination of solubility/yield of SD-fused SOCS3 protein. Expression of SOCS3 recombinant proteins in E. coli before (−) and after (+) induction with IPTG and purification by Ni2+ affinity chromatography (P) were monitored by SDS-PAGE, and stained with Coomassie blue (Left, top). The solubility, yield and recovery (in percent) of soluble form from denatured form are indicated (Left, bottom). Relative yield of recombinant proteins is normalized to the yield of HS3 protein (Right).

FIG. 10 shows the mechanism of aMTD-mediated SOCS3 protein uptake into cells. (A-D) RAW264.7 cells were treated with 100 mM EDTA for 3 hrs (A), 5 mg/ml Proteinase K for 10 mins (B), 20 mM taxol for 30 mins (C), or 10 μM antimycin for 2 hrs either without or with 1 mM supplemental ATP for 3 hrs. Cells were exposed for 1 hr to 10 μM FITC-labeled HS3 (black), -HS3B (blue) or -HM165S3B (red), treated with proteinase K for 20 mins, and analyzed by flow cytometry. Untreated cells (gray) and equimolar concentration of unconjugated FITC (FITC only, green)-treated cells were served as control. (E) RAW264.7 cells were exposed for the indicated times to 10 μM FITC-labeled HS3 (black), -HS3B (blue) or -HM165S3B (red), treated with proteinase K, and analyzed by flow cytometry.

FIG. 11 shows aMTD-mediated cell-to-cell delivery. RAW264.7 cells exposed to 10 μM FITC-HS3B or FITC-HM165S3B for 2 hrs, were mixed with non-treated RAW264.7 cells pre-stained with Cy5.5 labeled anti-CD14 antibody, and analyzed by flow cytometry (left, top). The top (right) panel shows a mixture of double negative cells (cells exposed to FITC-HS3B that did not incorporate the protein) and single positive Cy5.5 labeled cells; whereas, second panel from the left contains FITC-Cy5.5 double-positive cells generated by the transfer of FITC-HM165S3B to Cy5.5 labeled cells and the remaining FITC and Cy5.5 single-positive cells. The bottom panels show FITC fluorescence profiles of cell populations before mixing (coded as before) and 1 hr after the same cells were mixed with Cy5.5-labeled cells.

FIG. 12 shows the inhibition of STAT phosphorylation Induced by IFN-γ. Inhibition of STAT1 phosphorylation detected by immunoblotting analysis. The levels of phosphorylated STAT1 and STAT3 untreated and treated with IFN-γ were compared to the levels in IFN-γ-treated RAW 264.7 cells that were pulsed with 10 μM of indicated proteins.

FIG. 13 shows the inhibition of cytokines secretion induced by LPS. Inhibition of TNF-α and IL-6 expression by recombinant SOCS3 proteins in primary macrophages isolated from peritoneal exudates of C3H/HeJ mice. Error bars indicate+s.d. of the mean value derived from each assay done in triplicate.

FIG. 14 shows the cell-permeability of iCP-SOCS3 (HM165S3B) in hepatocellular carcinoma cell. RAW264.7 cells were exposed to FITC-labeled SOCS3 recombinant proteins (10 μM) for 1 hr, treated with proteinase K to remove cell-associated proteins for 20 mins, and analyzed by flow cytometry. Untreated cells (gray) and equimolar concentration of unconjugated FITC (FITC only, green)-treated cells were served as control.

FIG. 15 shows the tissue distribution of iCP-SOCS3 (HM165S3B) into liver. Cryosections of saline-perfused organs were prepared from mice 1 hr after intraperitoneal injection of FITC only or 600 μg FITC-conjugated recombinant SOCS3 proteins, and were analyzed by fluorescence microscopy.

FIG. 16 shows the inhibition of cancer cell proliferation with iCP-SOCS3 recombinant protein. Hep3B2.1-7 HCC cell was seeded in 96 well plates. Next day, cells were treated with DMEM (V), HS3 (1), HM165S3 (2), HM165S3A (3) or HM165S3B (4) recombinant proteins for 96 h in the presence of serum (2%). Cell viability was evaluated with the CellTiter-Glo Cell Viability Assay.

FIG. 17 shows the induction of apoptosis in hepatocellular carcinoma cell with iCP-SOCS3. HepG2 cells were treated for 24 hr with 10 μM HS3B or HM165S3B proteins and apoptotic cells were visualized by TUNEL staining.

FIG. 18 shows the stimulation of apoptosis in hepatocellular carcinoma cell with iCP-SOCS3. HepG2 cells were treated for 24 hr with 10 μM HS3B or HM165S3B proteins and analyzed by flow cytometry of cells stained with annexin-V and 7-AAD.

FIG. 19 shows the alternation of molecular mechanism in hepatocellular carcinoma Cell with iCP-SOCS3. HepG2 cells were treated for 24 hr with 10 μM HS3B or HM165S3B proteins and lysed. The expression of each protein was determined by immunoblotting with indicated antibodies. An antibody against -actin was used as a loading control.

FIG. 20 shows the inhibition of hepatocellular carcinoma cell migration with iCP-SOCS3. HepG2 cells were grown to 100% confluence and these procedures were performed on wound-healing assays The wound areas were examined and photographed at 0 and 72 hrs post-wounding.

FIG. 21 shows the inhibition of migration/invasion in hepatocellular carcinoma cell with iCP-SOCS3. HepG2 cells were treated with SOCS3 recombinant proteins for 24 hrs, and migration/invasion were measured by Transwell assay. The data shown are representative of three independent experiments. **, p<0.01.

FIG. 22 shows the inhibition of tumor growth of human hepatocellular carcinoma in a mouse Xenograft model treated with iCP-SOCS3. Female Balb/c nu/nu mice were subcutaneously implanted with Hep3B2.1-7 tumor block (1 mm3) into the left side of the back. After tumors reached a size of 50-80 mm3 (start), the mice were injected daily (I.V.) for 3 w with diluent alone (black) or with HS3B (blue) or HM165S3B (iCP-SOCS3, red) and observed for 2 w following the termination of the treatment. Representative mice treated with diluent alone or with SOCS3 proteins were photographed on day 1, 21 and 35 after starting protein therapy.

FIG. 23 shows the inhibition of primary tumor on experimental in vivo model treated with iCP-SOCS3. Female Balb/c nu/nu mice were subcutaneously implanted with Hep3B2.1-7 tumor block (1 mm3) into the left side of the back. After tumors reached a size of 50-80 mm3 (start), the mice were injected daily (I.V.) for 3 w with diluent alone (black) or with HS3B (blue) or HM165S3B (iCP-SOCS3, red) and observed for 2 w following the termination of the treatment. Tumor weight (left) and volume (right) were measured in the indicated day.

FIG. 24 shows the changes in biomarker expression linked to SOCS3 signaling in tumor Xenograft. Female Balb/c nu/nu mice were subcutaneously implanted with Hep3B2.1-7 tumor block (1 mm3) into the left side of the back. After tumors reached a size of 50-80 mm3 (start), the mice were injected daily (I.V.) for 3 w with diluent alone (black) or with HS3B (blue) or HM165S3B (iCP-SOCS3, red) and observed for 2 w following the termination of the treatment. Tumor weight (left) and volume (right) were measured in the indicated day. The expression of each protein was determined by immunoblotting with anti-p21 or Bax antibodies in protein-treated tumors at day 35. An antibody against -actin was used as a loading control. Tumor tissues from mice treated daily for 3 w with indicated proteins and observed for 2 w following the termination of the treatment were sectioned and immunostained with antibodies against Bax or VEGF.

DETAILED DESCRIPTION

It has been hypothesized that exogenously administered SOCS3 proteins could compensate for the apparent inability of endogenously expressed members of this physiologic regulator to interrupt constitutively active cancer-initiating JAK/STAT signaling and excessive cell cycle, resulting in the inhibition of the tumorigenesis. To prove our hypothesis, the SOCS3 recombinant proteins fused to novel hydrophobic CPPs called aMTDs to improve their cell-/tissue-permeability and additionally adopted solubilization domains to increase their solubility/yield in physiological condition, and then tested whether exogenous administration of SOCS3 proteins can reconstitute their endogenous stores and restore their basic function as the negative feedback regulator that attenuates JAK/STAT signaling. This art of invention has demonstrated “intracellular protein therapy” by designing and introducing cell-permeable form of SOCS3 has a great potential of anti-cancer therapeutic applicability in hepatocellular carcinoma.

1. Novel Hydrophobic Cell-Penetrating Peptides—Advanced Macromolecule Transduction Domains

To address the limitation of previously developed hydrophobic CPPs, novel sequences have been developed. To design new hydrophobic CPPs for intracellular delivery of cargo proteins such as SOCS3, identification of optimal common sequence and/or homologous structural determinants, namely critical factors (CFs), had been crucial. To do it, the physicochemical characteristics of previously published hydrophobic CPPs were analyzed. To keep the similar mechanism on cellular uptake, all CPPs analyzed were hydrophobic region of signal peptide (HRSP)-derived CPPs (e.g. MTS and MTD).

(1) Basic Characteristics of CPPs Sequence.

These 17 hydrophobic CPPs published from 1995 to 2014 have been analyzed for their 11 different characteristics—sequence, amino acid length, molecular weight, pI value, bending potential, rigidity/flexibility, structural feature, hydropathy, residue structure, amino acid composition, and secondary structure of the sequences. Two peptide/protein analysis programs were used (ExPasy: http://web.expasy.org/protparam/, SoSui: http://harriernagahama-i-bio.ac.jp/sosui/sosui_submit.html) to determine various indexes, structural features of the peptide sequences and to design new sequence. Followings are important factors analyzed.

Average length, molecular weight and pI value of the peptides analyzed were 10.8±2.4, 1,011±189.6 and 5.6±0.1, respectively.

(2) Bending Potential (Proline Position: PP)

Bending potential (Bending or No-Bending) was determined based on the fact whether proline (P) exists and/or where the amino acid(s) providing bending potential to the peptide in recombinant protein is/are located. Proline differs from the other common amino acids in that its side chain is bonded to the backbone nitrogen atom as well as the alpha-carbon atom. The resulting cyclic structure markedly influences protein architecture which is often found in the bends of folded peptide/protein chain. Eleven out of 17 were determined as ‘Bending’ peptide which means that proline should be present in the middle of sequence for peptide bending and/or located at the end of the peptide for protein bending. As indicated above, peptide sequences could penetrate the plasma membrane in a “bent” configuration. Therefore, bending or no-bending potential is considered as one of the critical factors for the improvement of current hydrophobic CPPs.

(3) Rigidity/Flexibility (Instability Index: II)

Since one of the crucial structural features of any peptide is based on the fact whether the motif is rigid or flexible, which is an intact physicochemical characteristic of the peptide sequence, instability index (II) of the sequence was determined. The index value representing rigidity/flexibility of the peptide was extremely varied (8.9-79.1), but average value was 40.1±21.9 which suggested that the peptide should be somehow flexible, but not too rigid or flexible.

(4) Hydropathy (Grand Average of Hydropathy: GRAVY) and Structural Feature (Aliphatic Index: AI)

Alanine (V), valine (V), leucine (L) and isoleucine (I) contain aliphatic side chain and are hydrophobic—that is, they have an aversion to water and like to cluster. These amino acids having hydrophobicity and aliphatic residue enable them to pack together to form compact structure with few holes. Analyzed peptide sequence showed that all composing amino acids were hydrophobic (A, V, L and I) except glycine (G) in only one out of 17 and aliphatic (A, V, L, I, and P). Their hydropathic index (Grand Average of Hydropathy: GRAVY) and aliphatic index (AI) were 2.5±0.4 and 217.9±43.6, respectively.

(5) Secondary Structure (a-Helix)

As explained above, the CPP sequences may be supposed to penetrate the plasma membrane directly after inserting into the membranes in a “bent” configuration with hydrophobic sequences adopting an a-helical conformation. In addition, our analysis strongly indicated that bending potential was crucial. Therefore, structural analysis of the peptides conducted to determine whether the sequence was to form helix or not. Nine peptides were helix and 8 were not. It seems to suggest that helix structure may not be required.

(6) Determination of Critical Factors (CFs)

In the 11 characteristics analyzed, the following 6 are selected namely “Critical Factors (CFs)” for the development of new hydrophobic CPPs—advanced MTDs: i) amino acid length, ii) bending potential (proline presence and location), iii) rigidity/flexibility (instability index: II), iv) structural feature (aliphatic index: AI), v) hydropathy (GRAVY) and vi) amino acid composition/residue structure (hydrophobic and aliphatic A/a).

1-2. Analysis of Selected Hydrophobic CPPs to Optimize ‘Critical Factors’

Since the analyzed data of the 17 different hydrophobic CPPs (analysis A) previously developed during the past 2 decades showed high variation and were hard to make common- or consensus-features, additional analysis B and C was also conducted to optimize the critical factors for better design of improved CPPs-aMTDs.

In analysis B, 8 CPPs used with each cargo in vivo were selected. Length was 11±3.2, but 3 out of 8 CPPs possessed little bending potential. Rigidity/Flexibility was 41±15, but removing one [MTD85: rigid, with minimal (II: 9.1)] of the peptides increased the overall instability index to 45.6±9.3. This suggested that higher flexibility (40 or higher II) is potentially be better. All other characteristics of the 8 CPPs were similar to the analysis A, including structural feature and hydropathy.

To optimize the ‘Common Range and/or Consensus Feature of Critical Factor’ for the practical design of aMTDs and the random peptides, which were to prove that the ‘Critical Factors’ determined in the analysis A, B and C were correct to improve the current problems of hydrophobic CPPs—protein aggregation, low solubility/yield, and poor cell/tissue-permeability of the recombinant proteins fused to the MTS/MTM or MTD, and non-common sequence and non-homologous structure of the peptides, empirically selected peptides were analyzed for their structural features and physicochemical factor indexes.

The peptides which did not have a bending potential, rigid or too flexible sequences (too low or too high Instability Index), or too low or too high hydrophobic CPP were unselected, but secondary structure was not considered because helix structure of sequence was not required. 8 selected CPP sequences that could provide a bending potential and higher flexibility were finally analyzed. Common amino acid length is 12 (11.6±3.0). Proline should be presence in the middle of and/or the end of sequence. Rigidity/Flexibility (II) is 45.5-57.3 (Avg: 50.1±3.6). AI and GRAVY representing structural feature and hydrophobicity of the peptide are 204.7±37.5 and 2.4±0.3, respectively. All peptides are consisted with hydrophobic and aliphatic amino acids (A, V, L, I, and P). Therefore, analysis C was chosen as a standard for the new design of new hydrophobic CPPs (TABLE 1).

    • 1. Amino Acid Length: 9-13
    • 2. Bending Potential (Proline Position: PP): Proline presences in the middle (from 5′ to 8′ amino acid) and at the end of sequence
    • 3. Rigidity/Flexibility (Instability Index: II): 40-60
    • 4. Structural Feature (Aliphatic Index: AI): 180-220
    • 5. Hydropathy (Grand Average of Hydropathy: GRAVY): 2.1-2.6
    • 6. Amino Acid Composition: Hydrophobic and Aliphatic amino acids—A, V, L, I and P

TABLE 1
[Universal structure of newly Develop Hydrophobic]
Summarized Critical Factors of aMTD
Newly Designed CPPs
Critical Factor Range
Bending Potential Proline presences in the middle (5′, 6′, 7′ or 8′)
(Proline Position: PP) and at the end (12′) of peptides
Rigidity/Flexibility 40-60
(Instability Index: II)
Structural Feature 180-220
(Aliphatic Index: AI)
Hydropathy 2.1-2.6
(Grand Average of
Hydropathy GRAVY)
Length  9-13
(Number of Amino Acid)
Amino acid Composition A, V, I, L, P

1-3. Determination of Critical Factors for Development of aMTDs

For confirming the validity of 6 critical factors providing the optimized cell-/tissue-permeability. All 240 aMTD sequences have been designed and developed based on six critical factors (TABLES 2-1 to 2-6). The aMTD amino sequences are SEQ ID NOS: 1 to 240, and the aMTD nucleotide sequences are SEQ ID NOS: 241 to 480.

All 240 aMTDs (hydrophobic, flexible, bending, aliphatic and helical 12 a/a-length peptides) were practically confirmed by their quantitative and visual cell-permeability. To determine the cell-permeability of aMTDs and random peptides which do not satisfy one or more critical factors have also been designed and tested. Relative cell-permeability of 240 aMTDs to the negative control (random peptide, hydrophilic & non-alipatic 12A/a length peptide) was significantly increased by up to 164 fold, with average increase of 19.6±1.6. Moreover, compared with reference CPPs (MTM and MTD), novel 240 aMTDs averaged of 13±1.1 (maximum 109.9) and 6.6±0.5 (maximum 55.5) fold higher cell-permeability, respectively. As a result, there were vivid association of cell-permeability of the peptides and critical factors. According to the result from the newly designed and tested novel 240 aMTDs, the empirically optimized critical factors are provided below.

    • 1. Amino Acid Length: 12
    • 2. Bending Potential (Proline Position: PP): Proline presences in the middle (from 5′ to 8′ amino acid) and at the end of sequence
    • 3. Rigidity/Flexibility (Instability Index: II): 41.3-57.3
    • 4. Structural Feature (Aliphatic Index: AI): 187.5-220.0
    • 5. Hydropathy (Grand Average of Hydropathy: GRAVY): 2.2-2.6
    • 6. Amino Acid Composition: Hydrophobic and Aliphatic amino acids—A, V, L, I and P

TABLE 2-1
[Summarized Critical Factor of aMTD After In-Depth
Analysis of Experimental Result (aMTD 1-184)]
Sequence Rigidity/ Structural
ID Flexibility Feature Hydropathy Residue
Number aMTD Sequences Length (II) (AI) (GRAVY) Structure
 1   1 AAALAPVVLALP 12 57.3 187.5 2.1 Aliphatic
 2   2 AAAVPLLAVVVP 12 41.3 195.0 2.4 Aliphatic
 3   3 AALLVPAAVLAP 12 57.3 187.5 2.1 Aliphatic
 4   4 ALALLPVAALAP 12 57.3 195.8 2.1 Aliphatic
 5   5 AAALLPALVAP 12 57.3 187.5 2.1 Aliphatic
 6  11 VVALAPALAALP 12 57.3 187.5 2.1 Aliphatic
 7  12 LLAAVPAVLLAP 12 57.3 211.7 2.3 Aliphatic
 8  13 AAALVPVVALLP 12 57.3 203.3 2.3 Aliphatic
 9  21 AVALLPALLAVP 12 57.3 211.7 2.3 Aliphatic
10  22 AVVLVPVLAAAP 12 57.3 195.0 2.4 Aliphatic
11  23 VVLVLPAAAAVP 12 57.3 195.0 2.4 Aliphatic
12  24 IALAAPALIVAP 12 50.2 195.8 2.2 Aliphatic
13  25 IVAVAPALVALP 12 50.2 203.3 2.4 Aliphatic
14  42 VAALPVVAVVAP 12 57.3 186.7 2.4 Aliphatic
15  43 LLAAPLVVAAVP 12 41.3 187.5 2.1 Aliphatic
16  44 ALAVPVALLVAP 12 57.3 203.3 2.3 Aliphatic
17  61 VAALPVLLAALP 12 57.3 211.7 2.3 Aliphatic
18  62 VALLAPVALAVP 12 57.3 203.3 2.3 Aliphatic
19  63 AALLVPALVAVP 12 57.3 203.3 2.3 Aliphatic
20  64 AIVALPVAVLAP 12 50.2 203.3 2.4 Aliphatic
21  65 IAIVAPVVALAP 12 50.2 203.3 2.4 Aliphatic
22  81 AALLPALAALLP 12 57.3 204.2 2.1 Aliphatic
23  82 AVVLAPVAAVLP 12 57.3 195.0 2.4 Aliphatic
24  83 LAVAAPLALALP 12 41.3 195.8 2.1 Aliphatic
25  84 AAVAAPLLLALP 12 41.3 195.8 2.1 Aliphatic
26  85 LLVLPAAALAAP 12 57.3 195.8 2.1 Aliphatic
27 101 LVALAPVAAVLP 12 57.3 203.3 2.3 Aliphatic
28 102 LALAPAALALLP 12 57.3 204.2 2.1 Aliphatic
29 103 ALIAAPILALAP 12 57.3 204.2 2.2 Aliphatic
30 104 AVVAAPLVLALP 12 41.3 203.3 2.3 Aliphatic
31 105 LLALAPAALLAP 12 57.3 204.1 2.1 Aliphatic
32 121 AIVALPALALAP 12 50.2 195.8 2.2 Aliphatic
33 123 AAIIVPAALLAP 12 50.2 195.8 2.2 Aliphatic
34 124 IAVALPALIAAP 12 50.3 195.8 2.2 Aliphatic
35 141 AVIVLPALAVAP 12 50.2 203.3 2.4 Aliphatic
36 143 AVLAVPAVLVAP 12 57.3 195.0 2.4 Aliphatic
37 144 VLAIVPAVALAP 12 50.2 203.3 2.4 Aliphatic
38 145 LLAVVPAVALAP 12 57.3 203.3 2.3 Aliphatic
39 161 AVIALPALIAAP 12 57.3 195.8 2.2 Aliphatic
40 162 AVVALPAALIVP 12 50.2 203.3 2.4 Aliphatic
41 163 LALVLPAALAAP 12 57.3 195.8 2.1 Aliphatic
42 164 LAAVLPALLAAP 12 57.3 195.8 2.1 Aliphatic
43 165 ALAVPVALAIVP 12 50.2 203.3 2.4 Aliphatic
44 182 ALIAPVVALVAP 12 57.3 203.3 2.4 Aliphatic
45 183 LLAAPVVIALAP 12 57.3 211.6 2.4 Aliphatic
46 184 LAAIVPAIIAVP 12 50.2 211.6 2.4 Aliphatic

TABLE 2-2
[Summarized Critical Factor of aMTD After In-Depth
Analysis of Experimental Result (aMTD 185-401)]
Sequence Rigidity/ Structural
ID Flexibility Feature Hydropathy Residue
Number aMTD Sequences Length (II) (AI) (GRAVY) Structure
47 185 AALVLPLIIAAP 12 41.3 220.0 2.4 Aliphatic
48 201 LALAVPALAALP 12 57.3 195.8 2.1 Aliphatic
49 204 LIAALPAVAALP 12 57.3 195.8 2.2 Aliphatic
50 205 ALALVPAIAALP 12 57.3 195.8 2.2 Aliphatic
51 221 AAILAPIVALAP 12 50.2 195.8 2.2 Aliphatic
52 222 ALLIAPAAVIAP 12 57.3 195.8 2.2 Aliphatic
53 223 AILAVPIAVVAP 12 57.3 203.3 2.4 Aliphatic
54 224 ILAAVPIALAAP 12 57.3 195.8 2.2 Aliphatic
55 225 VAALLPAAAVLP 12 57.3 187.5 2.1 Aliphatic
56 241 AAAVVPVLLVAP 12 57.3 195.0 2.4 Aliphatic
57 242 AALLVPALVAAP 12 57.3 187.5 2.1 Aliphatic
58 243 AAVLLPVALAAP 12 57.3 187.5 2.1 Aliphatic
59 245 AAALAPVLALVP 12 57.3 187.5 2.1 Aliphatic
60 261 LVLVPLLAAAAP 12 41.3 211.6 2.3 Aliphatic
61 262 ALIAVPAIIVAP 12 50.2 211.6 2.4 Aliphatic
62 263 ALAVIPAAAILP 12 54.9 195.8 2.2 Aliphatic
63 264 LAAAPVVIVIAP 12 50.2 203.3 2.4 Aliphatic
64 265 VLAIAPLLAAVP 12 41.3 211.6 2.3 Aliphatic
65 281 ALIVLPAAVAVP 12 50.2 203.3 2.4 Aliphatic
66 282 VLAVAPALIVAP 12 50.2 203.3 2.4 Aliphatic
67 283 AALLAPALIVAP 12 50.2 195.8 2.2 Aliphatic
68 284 ALIAPAVALIVP 12 50.2 211.7 2.4 Aliphatic
69 285 AIVLLPAAVVAP 12 50.2 203.3 2.4 Aliphatic
70 301 VIAAPVLAVLAP 12 57.3 203.3 2.4 Aliphatic
71 302 LALAPALALLAP 12 57.3 204.2 2.1 Aliphatic
72 304 AIILAPIAAIAP 12 57.3 204.2 2.3 Aliphatic
73 305 IALAAPILLAAP 12 57.3 204.2 2.2 Aliphatic
74 321 IVAVALPALAVP 12 50.2 203.3 2.3 Aliphatic
75 322 VVAIVLPALAAP 12 50.2 203.3 2.3 Aliphatic
76 323 IVAVALPVALAP 12 50.2 203.3 2.3 Aliphatic
77 324 IVAVALPAALVP 12 50.2 203.3 2.3 Aliphatic
78 325 IVAVALPAVALP 12 50.2 203.3 2.3 Aliphatic
79 341 IVAVALPAVLAP 12 50.2 203.3 2.3 Aliphatic
80 342 VIVALAPAVLAP 12 50.2 203.3 2.3 Aliphatic
81 343 IVAVALPALVAP 12 50.2 203.3 2.3 Aliphatic
82 345 ALLIVAPVAVAP 12 50.2 203.3 2.3 Aliphatic
83 361 AVVIVAPAVIAP 12 50.2 195.0 2.4 Aliphatic
84 363 AVLAVAPALIVP 12 50.2 203.3 2.3 Aliphatic
85 364 LVAAVAPALIVP 12 50.2 203.3 2.3 Aliphatic
86 365 AVIVVAPALLAP 12 50.2 203.3 2.3 Aliphatic
87 381 VVAIVLPAVAAP 12 50.2 195.0 2.4 Aliphatic
88 382 AAALVIPAILAP 12 54.9 195.8 2.2 Aliphatic
89 383 VIVALAPALLAP 12 50.2 211.6 2.3 Aliphatic
90 384 VIVAIAPALLAP 12 50.2 211.6 2.4 Aliphatic
91 385 IVAIAVPALVAP 12 50.2 203.3 2.4 Aliphatic
92 401 AALAVIPAAILP 12 54.9 195.8 2.2 Aliphatic

TABLE 2-3
[Summarized Critical Factor of aMTD After In-Depth
Analysis of Experimental Result (aMTD 402-602)]
Sequence Rigidity/ Structural
ID Flexibility Feature Hydropathy Residue
Number aMTD Sequences Length (II) (AI) (GRAVY) Structure
 93 402 ALAAVIPAAILP 12 54.9 195.8 2.2 Aliphatic
 94 403 AAALVIPAAILP 12 54.9 195.8 2.2 Aliphatic
 95 404 LAAAVIPAAILP 12 54.9 195.8 2.2 Aliphatic
 96 405 LAAAVIPVAILP 12 54.9 211.7 2.4 Aliphatic
 97 421 AAILAAPLIAVP 12 57.3 195.8 2.2 Aliphatic
 98 422 VVAILAPLLAAP 12 57.3 211.7 2.4 Aliphatic
 99 424 AVVVAAPVLALP 12 57.3 195.0 2.4 Aliphatic
100 425 AVVAIAPVLALP 12 57.3 203.3 2.4 Aliphatic
101 442 ALAALVPAVLVP 12 57.3 203.3 2.3 Aliphatic
102 443 ALAALVPVALVP 12 57.3 203.3 2.3 Aliphatic
103 444 LAAALVPVALVP 12 57.3 203.3 2.3 Aliphatic
104 445 ALAALVPALVVP 12 57.3 203.3 2.3 Aliphatic
105 461 IAAVIVPAVALP 12 50.2 203.3 2.4 Aliphatic
106 462 IAAVLVPAVALP 12 57.3 203.3 2.4 Aliphatic
107 463 AVAILVPLLAAP 12 57.3 211.7 2.4 Aliphatic
108 464 AVVILVPLAAAP 12 57.3 203.3 2.4 Aliphatic
109 465 IAAVIVPVAALP 12 50.2 203.3 2.4 Aliphatic
110 481 AIAIAIVPVALP 12 50.2 211.6 2.4 Aliphatic
111 482 ILAVAAIPVAVP 12 54.9 203.3 2.4 Aliphatic
112 483 ILAAAIIPAALP 12 54.9 204.1 2.2 Aliphatic
113 484 LAVVLAAPAIVP 12 50.2 203.3 2.4 Aliphatic
114 485 AILAAIVPLAVP 12 50.2 211.6 2.4 Aliphatic
115 501 VIVALAVPALAP 12 50.2 203.3 2.4 Aliphatic
116 502 AIVALAVPVLAP 12 50.2 203.3 2.4 Aliphatic
117 503 AAIIIVLPAALP 12 50.2 220.0 2.4 Aliphatic
118 504 LIVALAVPALAP 12 50.2 211.7 2.4 Aliphatic
119 505 AIIIVIAPAAAP 12 50.2 195.8 2.3 Aliphatic
120 521 LAALIVVPAVAP 12 50.2 203.3 2.4 Aliphatic
121 522 ALLVIAVPAVAP 12 57.3 203.3 2.4 Aliphatic
122 524 AVALIVVPALAP 12 50.2 203.3 2.4 Aliphatic
123 525 ALAIVVAPVAVP 12 50.2 195.0 2.4 Aliphatic
124 541 LLALIIAPAAAP 12 57.3 204.1 2.1 Aliphatic
125 542 ALAIIIVPAVAP 12 50.2 211.6 2.4 Aliphatic
126 543 LLAALIAPAALP 12 57.3 204.1 2.1 Aliphatic
127 544 IVALIVAPAAVP 12 43.1 203.3 2.4 Aliphatic
128 545 VVLVLAAPAAVP 12 57.3 195.0 2.3 Aliphatic
129 561 AAVAIVLPAVVP 12 50.2 195.0 2.4 Aliphatic
130 562 ALIAAIVPALVP 12 50.2 211.7 2.4 Aliphatic
131 563 ALAVIVVPALAP 12 50.2 203.3 2.4 Aliphatic
132 564 VAIALIVPALAP 12 50.2 211.7 2.4 Aliphatic
133 565 VAIVLVAPAVAP 12 50.2 195.0 2.4 Aliphatic
134 582 VAVALIVPALAP 12 50.2 203.3 2.4 Aliphatic
135 583 AVILALAPIVAP 12 50.2 211.6 2.4 Aliphatic
136 585 ALIVAIAPALVP 12 50.2 211.6 2.4 Aliphatic
137 601 AAILIAVPIAAP 12 57.3 195.8 2.3 Aliphatic
138 602 VIVALAAPVLAP 12 50.2 203.3 2.4 Aliphatic

TABLE 2-4
[Summarized Critical Factor of aMTD After In-Depth
Analysis of Experimental Result (aMTD 603-809)]
Sequence Rigidity/ Sturctural
ID Flexibility Feature Hydropathy Residue
Number aMTD Sequences Length (II) (AI) (GRAVY) Structure
139 603 VLVALAAPVIAP 12 57.3 203.3 2.4 Aliphatic
140 604 VALIAVAPAVVP 12 57.3 195.0 2.4 Aliphatic
141 605 VIAAVLAPVAVP 12 57.3 195.0 2.4 Aliphatic
142 622 ALIVLAAPVAVP 12 50.2 203.3 2.4 Aliphatic
143 623 VAAAIALPAIVP 12 50.2 187.5 2.3 Aliphatic
144 625 ILAAAAAPLIVP 12 50.2 195.8 2.2 Aliphatic
145 643 LALVLAAPAIVP 12 50.2 211.6 2.4 Aliphatic
146 645 ALAVVALPAIVP 12 50.2 203.3 2.4 Aliphatic
147 661 AAILAPIVAALP 12 50.2 195.8 2.2 Aliphatic
148 664 ILIAIAIPAAAP 12 54.9 204.1 2.3 Aliphatic
149 665 LAIVIAAPVAVP 12 50.2 203.3 2.3 Aliphatic
150 666 AAIAIIAPAIVP 12 50.2 195.8 2.3 Aliphatic
151 667 LAVAIVAPALVP 12 50.2 203.3 2.3 Aliphatic
152 683 LAIVLAAPAVLP 12 50.2 211.7 2.4 Aliphatic
153 684 AAIVLALPAVLP 12 50.2 211.7 2.4 Aliphatic
154 685 ALLVAVLPAALP 12 57.3 211.7 2.3 Aliphatic
155 686 AALVAVLPVALP 12 57.3 203.3 2.3 Aliphatic
156 687 AILAVALPLLAP 12 57.3 220.0 2.3 Aliphatic
157 703 IVAVALVPALAP 12 50.2 203.3 2.4 Aliphatic
158 705 IVAVALLPALAP 12 50.2 211.7 2.4 Aliphatic
159 706 IVAVALLPAVAP 12 50.2 203.3 2.4 Aliphatic
160 707 IVALAVLPAVAP 12 50.2 203.3 2.4 Aliphatic
161 724 VAVLAVLPALAP 12 57.3 203.3 2.3 Aliphatic
162 725 IAVLAVAPAVLP 12 57.3 203.3 2.3 Aliphatic
163 726 LAVAIIAPAVAP 12 57.3 187.5 2.2 Aliphatic
164 727 VALAIALPAVLP 12 57.3 211.6 2.3 Aliphatic
165 743 AIAIALVPVALP 12 57.3 211.6 2.4 Aliphatic
166 744 AAVVIVAPVALP 12 50.2 195.0 2.4 Aliphatic
167 746 VAIIVVAPALAP 12 50.2 203.3 2.4 Aliphatic
168 747 VALLAIAPALAP 12 57.3 195.8 2.2 Aliphatic
169 763 VAVIIAVPALAP 12 57.3 203.3 2.3 Aliphatic
170 764 AVALAVLPAVVP 12 57.3 195.0 2.3 Aliphatic
171 765 AVALAVVPAVLP 12 57.3 195.0 2.3 Aliphatic
172 766 IVVIAVAPAVAP 12 50.2 195.0 2.4 Aliphatic
173 767 IVVAAVVPALAP 12 50.2 195.0 2.4 Aliphatic
174 783 IVALVPAVAIAP 12 50.2 203.3 2.5 Aliphatic
175 784 VAALPAVALVVP 12 57.3 195.0 2.4 Aliphatic
176 786 LVAIAPLAVLAP 12 41.3 211.7 2.4 Aliphatic
177 787 AVALVPVIVAAP 12 50.2 195.0 2.4 Aliphatic
178 788 AIAVAIAPVALP 12 57.3 187.5 2.3 Aliphatic
179 803 AIALAVPVLALP 12 57.3 211.7 2.4 Aliphatic
180 805 LVLIAAAPIALP 12 41.3 220.0 2.4 Aliphatic
181 806 LVALAVPAAVLP 12 57.3 203.3 2.3 Aliphatic
182 807 AVALAVPALVLP 12 57.3 203.3 2.3 Aliphatic
183 808 LVVLAAAPLAVP 12 41.3 203.3 2.3 Aliphatic
184 809 LIVLAAPALAAP 12 50.2 195.8 2.2 Aliphatic

TABLE 2-5
[Summarized Critical Factor of aMTD After In-Depth
Analysis of Experimental Result (aMTD 810-900)]
Sequence Rigidity/ Structural
ID Flexibility Feature Hydropathy Residue
Number aMTD Sequences Length (II) (AI) (GRAVY) Structure
185 810 VIVLAAPALAAP 12 50.2 187.5 2.2 Aliphatic
186 811 AVVLAVPALAVP 12 57.3 195.0 2.3 Aliphatic
187 824 LIIVAAAPAVAP 12 50.2 187.5 2.3 Aliphatic
188 825 IVAVIVAPAVAP 12 43.2 195.0 2.5 Aliphatic
189 826 LVALAAPIIAVP 12 41.3 211.7 2.4 Aliphatic
190 827 IAAVLAAPALVP 12 57.3 187.5 2.2 Aliphatic
191 828 IALLAAPIIAVP 12 41.3 220.0 2.4 Aliphatic
192 829 AALALVAPVIVP 12 50.2 203.3 2.4 Aliphatic
193 830 IALVAAPVALVP 12 57.3 203.3 2.4 Aliphatic
194 831 IIVAVAPAAIVP 12 43.2 203.3 2.5 Aliphatic
195 832 AVAAIVPVIVAP 12 43.2 195.0 2.5 Aliphatic
196 843 AVLVLVAPAAAP 12 41.3 219.2 2.5 Aliphatic
197 844 VVALLAPLIAAP 12 41.3 211.8 2.4 Aliphatic
198 845 AAVVIAPLLAVP 12 41.3 203.3 2.4 Aliphatic
199 846 IAVAVAAPLLVP 12 41.3 203.3 2.4 Aliphatic
200 847 LVAIVVLPAVAP 12 50.2 219.2 2.6 Aliphatic
201 848 AVAIVVLPAVAP 12 50.2 195.0 2.4 Aliphatic
202 849 AVILLAPLIAAP 12 57.3 220.0 2.4 Aliphatic
203 850 LVIALAAPVALP 12 57.3 211.7 2.4 Aliphatic
204 851 VLAVVLPAVALP 12 57.3 219.2 2.5 Aliphatic
205 852 VLAVAAPAVLLP 12 57.3 203.3 2.3 Aliphatic
206 863 AAVVLLPIIAAP 12 41.3 211.7 2.4 Aliphatic
207 864 ALLVIAPAIAVP 12 57.3 211.7 2.4 Aliphatic
208 865 AVLVIAVPAIAP 12 57.3 203.3 2.5 Aliphatic
209 867 ALLVVIAPLAAP 12 41.3 211.7 2.4 Aliphatic
210 868 VLVAAILPAAIP 12 54.9 211.7 2.4 Aliphatic
211 870 VLVAAVLPIAAP 12 41.3 203.3 2.4 Aliphatic
212 872 VLAAAVLPLVVP 12 41.3 219.2 2.5 Aliphatic
213 875 AIAIVVPAVAVP 12 50.2 195.0 2.4 Aliphatic
214 877 VAIIAVPAVVAP 12 57.3 195.0 2.4 Aliphatic
215 878 IVALVAPAAVVP 12 50.2 195.0 2.4 Aliphatic
216 879 AAIVLLPAVVVP 12 50.2 219.1 2.5 Aliphatic
217 881 AALIVVPAVAVP 12 50.2 195.0 2.4 Aliphatic
218 882 AIALVVPAVAVP 12 57.3 195.0 2.4 Aliphatic
219 883 LAIVPAAIAALP 12 50.2 195.8 2.2 Aliphatic
220 885 LVAIAPAVAVLP 12 57.3 203.3 2.4 Aliphatic
221 887 VLAVAPAVAVLP 12 57.3 195.0 2.4 Aliphatic
222 888 ILAVVAIPAAAP 12 54.9 187.5 2.3 Aliphatic
223 889 ILVAAAPIAALP 12 57.3 195.8 2.2 Aliphatic
224 891 ILAVAAIPAALP 12 54.9 195.8 2.2 Aliphatic
225 893 VIAIPAILAAAP 12 54.9 195.8 2.3 Aliphatic
226 895 AIIIVVPAIAAP 12 50.2 211.7 2.5 Aliphatic
227 896 AILIVVAPIAAP 12 50.2 211.7 2.5 Aliphatic
228 897 AVIVPVAIIAAP 12 50.2 203.3 2.5 Aliphatic
229 899 AVVIALPAVVAP 12 57.3 195.0 2.4 Aliphatic
230 900 ALVAVIAPVVAP 12 57.3 195.0 2.4 Aliphatic

TABLE 2-6
[Summarized Critical Factor of aMTD After In-Depth
Analysis of Experimental Result (aMTD 901-912)]
Sequence Rigidity/ Structural
ID Flexibility Feature Hydropathy Residue
Number aMTD Sequences Length (II) (AI) (GRAVY) Structure
231 901 ALVAVLPAVAVP 12 57.3 195.0 2.4 Aliphatic
232 902 ALVAPLLAVAVP 12 41.3 203.3 2.3 Aliphatic
233 904 AVLAVVAPVVAP 12 57.3 186.7 2.4 Aliphatic
234 905 AVIAVAPLVVAP 12 41.3 195.0 2.4 Aliphatic
235 906 AVIALAPVVVAP 12 57.3 195 0 2.4 Aliphatic
236 907 VAIALAPVVVAP 12 57.3 195.0 2.4 Aliphatic
237 908 VALALAPVVVAP 12 57.3 195.0 2.3 Aliphatic
238 910 VAALLPAVVVAP 12 57.3 195.0 2.3 Aliphatic
239 911 VALALPAVVVAP 12 57.3 195.0 2.3 Aliphatic
240 912 VALLAPAVVVAP 12 57.3 195.0 2.3 Aliphatic
52.6 ± 5.1 201.7 ± 7.8 2.3 ± 0.1

These examined critical factors are within the range that we have set for our critical factors; therefore, we were able to confirm that the aMTDs that satisfy these critical factors have much higher cell-permeability (TABLE 3) and intracellular delivery potential compared to reference hydrophobic CPPs reported during the past two decades.

TABLE 3
[Summarized Critical Factors of aMTD After In-Depth
Analysis of Experimental Results]
Summarized Critical Factors of aMTD
Analysis of Experimental Results
Critical Factor Range
Bending Potential Proline presences in the middle (5′, 6′, 7′ or 8′)
(Proline Position: PP) and at the end (12′) of peptides
Rigidity/Flexibility 41.3-57.3
(Instability Index: II)
Structural Feature 187.5-220.0
(Aliphatic Index: AI)
Hydropathy 2.2-2.6
(Grand Average of
Hydropathy GRAVY)
Length 12
(Number of Amino Acid)
Amino acid Composition A, V, I, L, P

2. Development of SOCS3 Recombinant Proteins Fused to aMTD and Solubilization Domain
2-1. Design of Novel Hydrophobic CPPs—aMTDs for Development of Recombinant SOCS3 Proteins

Based on these six critical factors proven by experimental data, newly designed advanced macromolecule transduction domains (aMTDs) have been developed, and optimized for their practical therapeutic usage to facilitate protein translocation across the membrane. For this present invention, cell-permeable SOCS3 recombinant proteins have been developed by adopting aMTD165 (TABLE 4) that satisfied all 6 critical factors (TABLE 5).

TABLE 4
[Amino Acid and Nucleotide Sequence of Newly
Developed Advanced MTD 165 Which Follow All
Critical Factors]
Amino Acid
ID Sequence Nucleotide Sequence
165 ALAVPVALAIVP GCG CTG GCG GTG CCG GTG 
GCG CTG GCG ATT GTG CCG

TABLE 5
[Critical Factors of aMTD165]
Bending Potential Rigidity/ Sturctural
Theoretical M.W. Prolin Position Flexibility Feature Hydropathy
ID Length pI (Da) 5′ 6′ 12′ (II) ( Al) (GRAVY)
165 12 5.57 1133.4 1 1 50.2 195.8 2.2

2-2. Selection of Solubilization Domain (SD) for SOCS3 Recombinant Proteins

In the previous study, recombinant cargo (SOCS3) proteins fused to hydrophobic CPP could be expressed in bacteria system and purified with single-step affinity chromatography; however, protein dissolved in physiological buffers (e.g. PBS, DMEM or RPMI1640 etc.) was highly insoluble and had extremely low. Therefore, an additional non-functional protein domain (solubilization domain: SD; TABLE 6) has been fused to the recombinant proteins at their C terminus to improve low solubility/yield and to enhance relative cell-/tissue-permeability.

TABLE 6
[Information of Solublization Domains]
Protein Instability
SD Genbank ID Origin (kDa) pI Index (II) GRAVY
A CP000113.1 Bacteria 23 4.6 48.1 −0.1
B BC086945.1 Pansy 11 4.9 43.2 −0.9
C CP012127.1 Human 12 5.8 30.7 −0.1
D CP012127.1 Bacteria 23 5.9 26.3 −0.1
E CP011550.1 Human 11 5.3 44.4 −0.9
F NG_034970 Human 34 7.1 56.1 −0.2

According to the specific aim, solubilization domain A (SDA) and B (SDB) were first selected. We hypothesize that fusion of SOCS3 with SDs and novel hydrophobic CPP, aMTD, would greatly increase solubility/yield and cell-/tissue-permeability of recombinant cargo proteins -SOCS3—for the clinical application. SDA is a soluble tag, a tandem repeat of 2 N-terminal domain (NTD) sequences of CP 000113.1, which is a very stable soluble protein present in a spore surface coat of Myxococcus xanthus. SDB, a heme-binding part of cytochrome, provides a visual aid for estimating expression level and solubility. Bacteria expressing SDB containing fusion proteins appears red when the fused proteins are soluble.

2-3. Preparation of SOCS3 Recombinant Proteins

Histidine-tagged human SOCS3 proteins were designed (FIG. 1) and constructed by amplifying the SOCS3 cDNA (225 amino acids) from nt 4 to 678 using primers [TABLE 7] for SOCS3 cargo fused to aMTD. The PCR products were subcloned with NdeI (5′) and BamHI (3′) into pET-28a(+). Coding sequences for SDA or SDB were fused to the C terminus of his-tagged aMTD-fused SOCS3 and cloned at between the BamHI (5′) and SalI (3′) sites in pET-28a(+) (FIG. 2).

4PCR primers for SOCS3 and SDA and/or SDB fused to SOCS3 are summarized in TABLES 7, 8 and 9, respectively. The cDNA and amino acid sequences of histidine tag are provided in SEQ ID NO: 481 and 482, and cDNA and amino acid sequences of aMTDs are indicated in SEQ ID NOs: 483 and 484, respectively. The cDNA and amino acid sequences are displayed in SEQ ID NOs: 485 and 486 (SOCS3); SEQ ID NOs: 487 and 488 (SDA); and SEQ ID NOs: 489 and 450 (SDB), respectively.

SEQ ID NO: 481 [cDNA Sequence of Histidine
Tag]
atgggcagcagccatcatcatcatcatcacagcagcggcctggtgccgcg
cggcagc
SEQ ID NO: 482 [Amino Acid Sequence of
Histidine Tag]
Met Gly Ser Ser His His His His His His Ser
Ser Gly Leu Val Pro Arg Gly Ser
SEQ ID NO: 483 [cDNA Sequences of aMTDs]
Please see TABLE 4
SEQ ID NO: 484 [Amino Acid Sequences of aMTDs]
Please see TABLE 4
SEQ ID NO: 485 [cDNA Sequence of human SOCS3]
ATGGTCACCC ACAGCAAGTT TCCCGCCGCC GGGATGAGCC
GCCCCCTGGA CACCAGCCTG CGCCTCAAGA CCTTCAGCTC
CAAGAGCGAG TACCAGCTGG TGGTGAACGC AGTGCGCAAG
CTGCAGGAGA GCGGCTTCTA CTGGAGCGCA GTGACCGGCG
GCGAGGCGAA CCTGCTGCTC AGTGCCGAGC CCGCCGGCAC
CTTTCTGATC CGCGACAGCT CGGACCAGCG CCACTTCTTC
ACGCTCAGCG TCAAGACCCA GTCTGGGACC AAGAACCTGC
GCATCCAGTG TGAGGGGGGC AGCTTCTCTC TGCAGAGCGA
TCCCCGGAGC ACGCAGCCCG TGCCCCGCTT CGACTGCGTG
CTCAAGCTGG TGCACCACTA CATGCCGCCC CCTGGAGCCC
CCTCCTTCCC CTCGCCACCT ACTGAACCCT CCTCCGAGGT
GCCCGAGCAG CCGTCTGCCC AGCCACTCCC TGGGAGTCCC
CCCAGAAGAG CCTATTACAT CTACTCCGGG GGCGAGAAGA
TCCCCCTGGT GTTGAGCCGG CCCCTCTCCT CCAACGTGGC
CACTCTTCAG CATCTCTGTC GGAAGACCGT CAACGGCCAC
CTGGACTCCT ATGAGAAAGT CACCCAGCTG CCGGGGCCCA
TTCGGGAGTT CCTGGACCAG TACGATGCCC CGCTT
SEQ ID NO: 486 [Amino Acid Sequence of
human SOCS3]
Met Val Thr His Ser Lys Phe Pro Ala Ala Gly
Met Ser Arg Pro Leu Asp Thr Ser Leu Arg Leu
Lys Thr Phe Ser Ser Lys Ser Glu Tyr Gln Leu
Val Val Asn Ala Val Arg Lys Leu Gln Glu Ser
Gly Phe Tyr Trp Ser Ala Val Thr Gly Gly Glu
Ala Asn Leu Leu Leu Ser Ala Glu Pro Ala Gly
Thr Phe Leu Ile Arg Asp Ser Ser Asp Gln Arg
His Phe Phe Thr Leu Ser Val Lys Thr Gln Ser
Gly Thr Lys Asn Leu Arg Ile Gln Cys Gly Gly
Gly Ser Phe Ser Leu Gln Ser Asp Pro Arg Ser
Thr Gln Pro Val Pro Arg Phe Asp Cys Val Leu
Lys Leu Val His His Tyr Met Pro Pro Pro Gly
Ala Pro Ser Phe Pro Ser Pro Pro Thr Glu Pro
Ser Ser Glu Val Pro Glu Gln Pro Ser Ala Gln
Pro Leu Pro Gly Ser Pro Pro Arg Arg Ala Tyr
Tyr Ile Tyr Ser Gly Gly Glu Lys Ile Pro Leu
Val Leu Ser Arg Pro Leu Ser Ser Asn Val Ala
Thr Leu Gln His Leu Cys Arg Lys Thr Val Asn
Gly His Leu Asp Ser Tyr Glu Lys Val Thr Gln
Leu Pro Gly Pro Ile Arg Glu Phe Leu Asp Gln
Tyr Asp Ala Pro Leu
SEQ ID NO: 487 [cDNA Sequences of SDA]
ATGGCAAATATT ACCGTTTTCTAT AACGAAGACTTC CAGGGTAAGCAG
GTCGATCTGCCG CCTGGCAACTAT ACCCGCGCCCAG TTGGCGGCGCTG
GGCATCGAGAAT AATACCATCAGC TCGGTGAAGGTG CCGCCTGGCGTG
AAGGCTATCCTG TACCAGAACGAT GGTTTCGCCGGC GACCAGATCGAA
GTGGTGGCCAAT GCCGAGGAGTTG GGCCCGCTGAAT AATAACGTCTCC
AGCATCCGCGTC ATCTCCGTGCCC GTGCAGCCGCGC ATGGCAAATATT
ACCGTTTTCTAT AACGAAGACTTC CAGGGTAAGCAG GTCGATCTGCCG
CCTGGCAACTAT ACCCGCGCCCAG TTGGCGGCGCTG GGCATCGAGAAT
AATACCATCAGC TCGGTGAAGGTG CCGCCTGGCGTG AAGGCTATCCTC
TACCAGAACGAT GGTTTCGCCGGC GACCAGATCGAA GTGGTGGCCAAT
GCCGAGGAGCTG GGTCCGCTGAAT AATAACGTCTCC AGCATCCGCGTC
ATCTCCGTGCCG GTGCAGCCGAGG
SEQ ID NO: 488 [Amino Acid Sequences of SDA]
Met Ala Asn Ile Thr Val Phe Tyr Asn Glu Asp
Phe Gln Gly Lys Gln Val Asp Leu Pro Pro Gly
Asn Tyr Thr Arg Ala Gln Leu Ala Ala Leu Gly
Ile Glu Asn Asn Thr Ile Ser Ser Val Lys Val
Pro Pro Gly Val Lys Ala Ile Leu Tyr Gln Asn
Asp Gly Phe Ala Gly Asp Gln Ile Glu Val Val
Ala Asn Ala Glu Glu Leu Gly Pro Leu Asn Asn
Asn Val Ser Ser Ile Arg Val Ile Ser Val Pro
Val Gln Pro Arg Met Ala Asn Ile Thr Val Phe
Tyr Asn Glu Asp Phe Gln Gly Lys Gln Val Asp
Leu Pro Pro Gly Asn Tyr Thr Arg Ala Gln Leu
Ala Ala Leu Gly Ile Glu Asn Asn Thr Ile Ser
Ser Val Lys Val Pro Pro Gly Val Lys Ala Ile
Leu Tyr Gln Asn Asp Gly Phe Ala Gly Asp Gln
Ile Glu Val Val Ala Asn Ala Glu Glu Leu Gly
Pro Leu Asn Asn Asn Val Ser Ser Ile Arg Val
Ile Ser Val Pro Val Gln Pro Arg
SEQ ID NO: 489 [cDNA Sequences of SDB]
ATGGCA GAACAAAGCG ACAAGGATGT GAAGTACTAC
ACTCTGGAGG AGATTCAGAA GCACAAAGAC AGCAAGAGCA
CCTGGGTGAT CCTACATCAT AAGGTGTACG ATCTGACCAA
GTTTCTCGAA GAGCATCCTG GTGGGGAAGA AGTCCTGGGC
GAGCAAGCTG GGGGTGATGC TACTGAGAAC TTTGAGGACG
TCGGGCACTC TACGGATGCA CGAGAACTGT CCAAAACATA
CATCATCGGG GAGCTCCATC CAGATGACAG ATCAAAGATA
GCCAAGCCTT CGGAAACCCT T
SEQ ID NO: 490 [Amino Acid Sequences of SDB]
Met Ala Glu Gln Ser Asp Lys Asp Val Lys Tyr
Tyr Thr Leu Glu Glu Ile Gln Lys His Lys Asp
Ser Lys Ser Thr Trp Val Ile Leu His His Lys
Val Tyr Asp Leu Thr Lys Phe Leu Glu Glu His
Pro Gly Gly Glu Glu Val Leu Gly Glu Gln Ala
Gly Gly Asp Ala Thr Glu Asn Phe Glu Asp Val
Gly His Ser Thr Asp Ala Arg Glu Leu Ser Lys
Thr Tyr Ile Ile Gly Glu Leu His Pro Asp Asp
Arg Ser Lys Ile Ala Lys Pro Ser Glu Thr Leu

TABLE 7
[PCR Primers for His-tagged SOCS3 Proteins]
aMTD Recombinant 
Cargo ID Protein 5′ Primers 3′ Primers
SOCS3 HS3 5′-GGAATTCCATATGGTCACCCA 5′-CCCGGATCCTTAAAGCGGGG
CAGCAAGTTTCCCGCCGCC-3′ CATCGTACTGGTCCAGGAA-3′
165 HM165S3 5′-GGAATTCCATATGGCGCTGG
CGGTGCCGGTGGCGCTGGCGA
165 HM165S3A TTGTGCCGGTCACCCACAGCAA
GTTTC-3′
165 HM165S3B 5′-CCGGATCCAAGCGGGGCATC
GTACTGGTCCAGGAA-3′
HS3B 5′-GGAATTCCATATGGTCACCC
ACAGCAAGITTCCCGCCGCC-3′

TABLE 8
[PCR Primers for aMTD/SDA-Fused SOCS3 Proteins]
Recombinant
Cargo SD Protein 5′ Primers 3′ Primers
SOCS3 SDA HM165S3A 5′-CCCGGATCCATGGCAAATAT 5′-CGCGTCGACTTACCTCGGC
TACCGTTTTCTATAACGAA-3′ TGCACCGGCACGGCGATGAC-3′

TABLE 9
[PCR Primers for aMTD/SDB-Fused SOCS3 Proteins]
Recombinant
Cargo SD Protein 5′ Primers 3′ Primers
SOCS3 SDB HM165S3B 5′-CCCGGATCCGCAGAACAAA 5′-CGCGTCGACTTAAAGGGTTT
HS3B GCGACAAGGATGTGAAG-3′ CCGAAGGCTTGGC TATCTT-3′

The SOCS3 recombinant proteins were expressed in E. coli BL21-CodonPlus (DE3) cells, grown to an OD600 of 0.6 and induced for 3 hrs with 0.6 mM isopropyl-D-thiogalactopyranoside (IPTG). The proteins were purified by Ni2+ affinity chromatography and dissolved in a physiological buffer such as DMEM medium.

2-4 Determination of Solubility and Yield of Each SOCS3 Recombinant Protein

The histidine-tagged SOCS3 proteins were expressed, purified, and prepared in soluble form (FIG. 3). The yield of each soluble SOCS3 recombinant proteins was determined by measuring absorbance (A450).

SOCS3 recombinant proteins containing aMTD165 and solubilization domain (HM165S3A and HM165S3B) had little tendency to precipitate whereas recombinant SOCS3 proteins lacking a solubilization domain (HS3 and HM165S3) were largely insoluble. Solubility of aMTD/SD-fused SOCS3 proteins was scored on a 5 point scale compared with that of SOCS3 proteins lacking the solubilization domain (FIG. 4).

Yields per L of E. coli for each recombinant protein (mg/L) ranged from 1 to 47 mg/L (FIG. 4). Yields of SOCS3 proteins containing an aMTD and SDB (HM165S3B) were 50% higher than his-tagged SOCS3 protein (HS3).

3. aMTD/SD-Fused SOCS3 Recombinant Proteins Significantly Increase Cell- and Tissue-Permeability
3-1. aMTD/SD-Fused SOCS3 Recombinant Proteins are Cell-Permeable

To examine protein uptake, SOCS3 recombinant proteins were conjugated to 5/6-fluorescein isothiocyanate (FITC). RAW 264.7 (FIG. 5) or NIH3T3 cells (FIG. 6) were treated with 10 μM FITC-labeled SOCS3 recombinant proteins. The cells were washed three times with ice-cold PBS and treated with proteinase K to remove surface-bound proteins, and internalized proteins were measured by flow cytometry (FIG. 5) and visualized by confocal laser scanning microscopy (FIG. 6). SOCS3 proteins containing aMTD165 (HM165S3, HM165S3A and HM165S3B) efficiently entered the cells (FIGS. 5 and 6) and were localized to various extents in cytoplasm (FIG. 6). In contrast, SOCS3 protein (HS3) containing lacking aMTD did not appear to enter cells. While all SOCS3 proteins containing aMTD165 transduced into the cells, HM165S3B displayed more uniform cellular distribution, and protein uptake of HM165S3B was also very efficient.

3-2. aMTD/SD-Fused SOCS3 Recombinant Proteins Enhance the Systemic Delivery to a Variety of Tissues

To further investigate in vivo delivery of SOCS3 recombinant proteins, FITC-labeled SOCS3 proteins were monitored following intraperitoneal (IP) injections in mice. Tissue distributions of fluorescence-labeled-SOCS3 proteins in different organs was analyzed by fluorescence microscopy (FIG. 7). SOCS3 recombinant proteins fused to aMTD165 (HM165S3, HM165S3A and HM165S3B) were distributed to a variety of tissues (liver, kidney, spleen, lung, heart and, to a lesser extent, brain). Predictably, liver showed highest levels of fluorescent cell-permeable SOCS3 since intraperitoneal administration favors the delivery of proteins to this organ via the portal circulation. SOCS3 containing aMTD165 was detectable to a lesser degree in lung, spleen and heart. aMTD/SDB-fused SOCS3 recombinant protein (HM165S3B) showed the highest systemic delivery of SOCS3 protein to the tissues comparable to the SOCS3 containing only aMTD (HM165S3) or aMTD/SDA (HM165S3A) proteins. These data suggest that SOCS3 protein containing both of aMTD165 and SDB leads to higher cell-/tissue-permeability due to the increase in solubility and stability of the protein, and it displayed a dramatic synergic effect on cell-/tissue-permeability.

3-3. aMTD-Mediated Intracellular Delivery is Bidirectional Mode

SOCS3 recombinant proteins lacking SD (HS3 and HM165S3) were less soluble, produced lower yields, and showed tendency to precipitate when they were expressed and purified in E. coli. Therefore, we additionally designed (FIG. 8) and constructed SOCS3 recombinant protein containing only SDB (without aMTD165: HS3B) as a negative control. As expected, its solubility and yield increased compared to that of SOCS3 proteins lacking SDB (HS3; FIG. 9). Therefore, HS3B proteins were used as a control protein.

We next investigated how of aMTD165-mediated intracellular delivery was occurred. The aMTD-mediated intracellular delivery of SOCS3 protein did not require protease-sensitive protein domains displayed on the cell surface (FIG. 10B), microtubule function (FIG. 10C), or ATP utilization (FIG. 10D), since aMTD165-dependent uptake [compare to HS3 (black) and HS3B (blue)] was essentially unaffected by treating cells with proteinase K, taxol, or the ATP depleting agent, antimycin. Conversely, aMTD165-fused SOCS3 proteins uptake was blocked by treatment with EDTA and low temperature (FIGS. 10A and E), indicating the importance of membrane integrity and fluidity for aMTD-mediated protein transduction.

Moreover, we also tested whether cells treated with aMTD165-fused SOCS3 protein could transfer the protein to neighboring cells. For this, cells transduced with FITC-HM165S3B (green) were mixed with CD14-labeled cells (red), and cell-to-cell protein transfer was assessed by flow cytometry, scoring for CD14/FITC double-positive cells. Efficient cell-to-cell transfer of HM165S3B, but not HS3 or HS3B (FIG. 11), suggests that SOCS3 recombinant proteins containing aMTD165 are capable of bidirectional passage across the plasma membrane.

4. aMTD/SD-Fused SOCS3 Protein Efficiently Inhibits Cellular Processes
4-1. aMTD/SD-Fused SOCS3 Protein Inhibits the Activation of STATs Induced by INF-γ

The ultimate test of cell-penetrating efficiency is a determination of intracellular activity of SOCS3 proteins transported by aMTD. Since endogenous SOCS3 are known to block phosphorylation of STAT1 and STAT3 by IFN-γ-mediated Janus kinases (JAK) 1 and 2 activation, we demonstrated whether cell-permeable SOCS3 inhibits the phosphorylation of STATs. All SOCS3 recombinant proteins containing aMTD (HM165S3, HM165S3A and HM165S3B), suppressed IFN-γ-induced phosphorylation of STAT1 and STAT3 (FIG. 12). In contrast, STAT phosphorylation was readily detected in cells exposed to HS3, which lacks the aMTD motif required for membrane penetration (FIG. 12), indicating that HS3, which lacks an MTD sequence and did not enter the cells, has no biological activity.

4-2. aMTD/SD-Fused SOCS3 Recombinant Protein Inhibits the Secretion of Inflammatory Cytokines TNF-α and IL-6

We next investigated the effect of cell-permeable SOCS3 proteins on cytokines secretion. Treatment of C3H/HeJ primary peritoneal macrophages with SOCS3 proteins containing aMTD165 suppressed TNF-α and IL-6 secretion induced by the combination of IFN-γ and LPS by 50-90% during subsequent 9 hrs of incubation (FIG. 13). In particular, aMTD165/SDB-fused SOCS3 recombinant protein showed the greatest inhibitory effect on cytokine secretion. In contrast, cytokine secretion in macrophages treated with non-permeable SOCS3 protein (HS3) was unchanged, indicating that recombinant SOCS3 lacking the aMTD doesn't affect intracellular signaling. Therefore, we conclude that differences in the biological activities of HM165S3B as compared to HS3B are due to the differences in protein uptake mediated by the aMTD sequence. In light of solubility/yield, cell-/tissue-permeability, and biological effect, SOCS3 recombinant protein containing aMTD and SDB (HM165S3B) is a prototype of a new generation of improved cell-permeable SOCS3 (iCP-SOCS3), and will be selected for further evaluation as a potential anti-tumor agent.

5. iCP-SOCS3 Suppresses Pro-Tumorigenic Functions in Hepatocellular Carcinoma Cells
5-1. iCP-SOCS3 Enhances the Penetration into Hepatocellular Carcinoma Cells and Systemic Delivery to Liver

Although hepatocellular carcinoma (HCC) is one of the most common cancers with a high mortality rate, there are few drugs for treating this lethal disorder. Since constitutive activation of STAT3 is found in various types of tumors and SOCS3 is closely related to the development of hepatocellular carcinoma, we first chose the hepatocellular carcinoma as a primary indication of the iCP-SOCS3 as an anti-cancer agent.

To determine the cell-permeability of iCP-SOCS3 in the hepatocellular carcinoma cells, cellular uptake of FITC-labeled SOCS3 recombinant proteins was quantitatively evaluated by flow cytometry. FITC-HM165S3B recombinant protein (iCP-SOCS3) promoted the transduction into cultured HCC HepG2 cells (FIG. 14). In addition, iCP-SOCS3 proteins enhanced the systemic delivery to liver after intraperitoneal injection (FIG. 15). Therefore, these data indicate that iCP-SOCS3 protein could be intracellularly delivered and distributed to the hepatocytes and liver tissue, contributing for beneficial biotherapeutic effects.

5-2. iCP-SOCS3 Inhibits Hepatocellular Carcinoma Cell Viability

Since the endogenous level of SOCS3 protein is reduced in hepatocellular carcinoma patient, and SOCS3 negatively regulates cell growth and motility in cultured HCC cells, we investigated whether iCP-SOCS3 inhibits cell viability through SOCS3 intracellular replacement in HCC cells. As shown in FIG. 16, SOCS3 recombinant proteins containing aMTD165 significantly suppressed cancer cell proliferation. HM165S3B (iCP-SOCS3) protein was the most cytotoxic to Hep3B2.1-7 hepatocellular carcinoma cells—over 80% in 10 μM treatment (p<0.01)—especially compared to vehicle alone (i.e. exposure of cells to culture media without recombinant proteins; FIG. 16, left). However, neither cell-permeable SOCS3 protein adversely affected the cell viability of non-cancer cells (NIH3T3) even after exposing these cells to equal concentrations (10 μM) of protein over 4 days (FIG. 16, right). These results suggest that the iCP-SOCS3 protein is not overly toxic to normal cells and selectively kills tumor cells, and would have a great ability to inhibit cell survival-associated phenotypes in hepatocellular carcinoma without any severe aberrant effects as a protein-based biotherapeutics.

5-3. iCP-SOCS3 Protein Induces Apoptosis in Hepatocellular Carcinoma Cells

To further determine the effect of iCP-SOCS3 on the tumorigenicity of hepatocellular carcinoma cells, we subsequently investigated whether iCP-SOCS3 regulates apoptosis in HepG2 cells. HM165S3B protein (iCP-SOCS3) was a considerably efficient inducer of apoptosis in HepG2 cells, as assessed either by a fluorescent terminal dUTP nick-end labeling (TUNEL) assay (FIG. 17) and Annexin V staining (FIG. 18). Consistently, no changes in TUNEL and Annexin V staining were observed in HepG2 cells treated with HS3B compared to untreated cell (Vehicle). In addition, HepG2 cells treated with HM165S3B protein (iCP-SOCS3) dramatically reduced the expression of anti-apoptotic protein such as B-cell lymphoma 2 (Bcl-2) and increased the level of cleaved cysteine-aspartic acid protease (caspase-3; FIG. 19). These results indicate that iCP-SOCS3 induces apoptosis of hepatocellular carcinoma cells and may suppress the cancer progression by this pathway.

5-4. iCP-SOCS3 Inhibits Migration/Invasion of Hepatocellular Carcinoma Cells

We next examined the ability of iCP-SOCS3 to influence cell migration. HepG2 cells were treated with recombinant proteins for 2 hrs, the monolayers were wounded, and cell migration in the wound was monitored after 72 hrs (FIG. 20). HM165S3B protein (iCP-SOCS3) suppressed the repopulation of wounded monolayer although SOCS3 protein lacking aMTD165 (HS3B) had no effect on the cell migration. Consistent with this, HepG2 cells treated with HM165S3B recombinant protein (iCP-SOCS3) also showed significant inhibitory effect on their Transwell migration compared with untreated cells (Vehicle) and non-permeable SOCS3 protein-treated cells (HS3B; FIG. 21). In addition, HepG2 cells treated with HM165S3B recombinant protein (iCP-SOCS3) caused remarkable decrease in invasion compared with the control proteins (HS3B; FIG. 21). Taken together, these data indicate that iCP-SOCS3 contributes to inhibit tumorigenic activities of hepatocellular carcinoma cells.

6. iCP-SOCS3 Suppresses Pro-Tumorigenic Functions in Hepatocellular Carcinoma Cells
6-1. iCP-SOCS3 Suppresses the HCC Xenograft

We assessed the anti-tumor activity of iCP-SOCS3 against human cancer xenografts. Balb/c nu/nu mice were subcutaneously implanted with tumor block (1 mm3) of hepatocellular carcinoma cells into the left side of the back. Tumor-bearing mice were intravenously administered HM165S3B or control proteins (HS3B; 600 μg/head, respectively) for 21 days and observed for 2 weeks following the termination of the treatment (FIG. 22). HM165S3B protein significantly suppressed the tumor growth (p<0.05) during the treatment and the effect persisted for at least 2 weeks after the treatment was terminated (80% inhibition at day 21; 70% at day 35, respectively). Whereas, the growth of HS3B-treated tumors increased, matching the rates observed in control mice (Vehicle; FIGS. 22 and 23). These results suggest that iCP-SOCS3 inhibits the growth of established tumors as well as the tumor growth of hepatocellular carcinoma cells.

6-2. iCP-SOCS3 Regulates the Expression of Tumor-Associated Proteins in Human Tumor Xenograft

The anti-tumor activity of HM165S3B at day 35 was accompanied by changes in the expression of biomarkers linked to SOCS3 signaling, including p21, Bax and VEGF (FIG. 24). Expression of tumor suppressors (p21 and Bax) was dramatically enhanced in tumor tissues treated with HM165S3B recombinant protein (FIG. 24), suggesting that iCP-SOCS3 inhibits tumor growth by regulating tumor-specific protein expression in vivo. In addition, the levels of vascular endothelial growth factor (VEGF), a pro-angiogenic factor, were inhibited in HM165S3B-treated tumors. In contrast, tumor biomarker expression was not affected in mice treated with the HS3B control protein, which lacks aMTD sequence. These in vivo results suggest that iCP-SOCS3 targets tumor cells directly and may be developed for use as novel therapy against hepatocellular carcinoma.

Example

The following examples are presented to aid practitioners of the invention, to provide experimental support for the invention, and to provide model protocols. In no way are these examples to be understood to limit the invention.

Example 1

Development of Novel Advanced Macromolecule Transduction Domain (aMTD)

H-regions of signal sequences (HRSP)-derived CPPs (MTM, MTS and MTD) do not have a common sequence, a sequence motif, and/or a common structural homologous feature. In this invention, the aim is to develop improved hydrophobic CPPs formatted in the common sequence and structural motif that satisfy newly determined ‘critical factors’ to have a ‘common function’, to facilitate protein translocation across the membrane with similar mechanism to the analyzed CPPs. 6 critical factors have been selected to artificially develop novel hydrophobic CPP, namely advanced macromolecule transduction domain (aMTD). These 6 critical factors include the followings: amino acid length of the peptides (ranging from 9 to 13 amino acids), bending potentials (dependent with the presence and location of proline in the middle of sequence (at 5′, 6′, 7′ or 8′ amino acid) and at the end of peptide (at 12′)), instability index (II) for rigidity/flexibility (II: 40-60), grand average of hydropathy (GRAVY) for hydropathy (GRAVY: 2.1-2.4), and aliphatic index (AI) for structural features (AI: 180-220). Based on these standardized critical factors, new hydrophobic peptide sequences, namely advanced macromolecule transduction domain peptides (aMTDs), in this invention have been developed and selected to be fused with the cargo protein, SOCS3, to develop improved cell-permeable SOCS3 recombinant protein (iCP-SOCS3).

Example 2

Construction of Expression Vectors for Recombinant SOCS3 Proteins

Histidine-tagged human SOCS3 proteins were constructed by amplifying the SOCS3 cDNA (225 amino acids) for aMTD fused to SOCS3 cargo. The PCR reactions (100 ng genomic DNA, 10 μmol each primer, each 0.2 mM dNTP mixture, lx reaction buffer and 2.5 U Pfu(+) DNA polymerase (Doctor protein, Korea)) were digested on the restriction enzyme site between Nde I (5′) and Sal I (3′) involving 35 cycles of denaturing (95° C.), annealing (62° C.), and extending (72° C.) for 45 sec each. For the last extension cycle, the PCR reactions remained for 10 min at 72° C. The PCR products were subcloned into 6×His expression vector, pET-28a(+) (Novagen). Coding sequence for SDA or SDB fused to C terminus of his-tagged aMTD-SOCS3 was cloned at BamHI (5′) and SalI (3′) in pET-28a(+) from PCR-amplified DNA segments and confirmed by DNA sequence analysis of the resulting plasmids.

Example 3

Inducible Expression, Purification, and Preparation of Recombinant Proteins

The recombinant proteins were purified from E. coli BL21-CodonPlus (DE3) cells grown to an A600 of 0.6 and induced for 3 hrs with 0.6 mM IPTG. Denatured recombinant proteins were purified by Ni2+ affinity chromatography as directed by the supplier (Qiagen, Hilden, Germany). After purification, they were dialyzed against a refolding buffer (0.55 M guanidine HCl, 0.44 M L-arginine, 50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 100 mM NDSB, 2 mM reduced glutathione, and 0.2 mM oxidized glutathione) and changed to a physiological buffer such as DMEM medium.

Example 4

Determination of Quantitative Cell-Permeability of Recombinant Proteins

For quantitative cell-permeability, recombinant SOCS3 proteins were conjugated to 5/6-fluorescein isothiocyanate (FITC) according to the manufacturer's instructions (Sigma-Aldrich, St. Louis, Mo.). RAW 264.7 cells were treated with 10 μM FITC-labeled recombinant proteins for 1 hr at 37° C., washed three times with cold PBS, and treated with proteinase K (10 μg/mL) for 20 min at 37° C. to remove cell-surface bound proteins. Cell-permeability of these recombinant proteins was analyzed by flow cytometry (Guava, Millipore, Darmstadt, Germany) using the FlowJo cytometric analysis software.

Example 5

Determination of Intracellular Localization of SOCS3 Recombinant Proteins

For visual cell permeability, NIH3T3 cells were cultured on coverslips in 24-well plates and with 10 μM FITC-conjugated recombinant proteins for 1 hr at 37° C. These cells on coverslips were washed with PBS, fixed with 4% formaldehyde for 10 min, and washed three times with PBS at room temperature. Coverslips were mounted with VECTASHIELD Mounting Medium (Vector laboratories, Burlingame, Calif.) with DAPI (4′,6-diamidino-2-phenylindole) for nuclear staining. Intracellular localization of fluorescent signal was determined by confocal laser scanning microscopy (LM700, Zeiss, Germany).

Example 6

Determination of Tissue Distribution of Recombinant SOCS3 Proteins

ICR mice (6-week-old, female) were injected intraperitoneally (600 μg/head) with either FITC only or FITC-conjugated SOCS3 recombinant proteins. After 2 hrs, the liver, kidney, spleen, lung, heart, and brain were isolated, washed with an O.C.T. compound (Sakura), and frozen on dry ice. Cryosections (20 μm) were analyzed by fluorescence microscopy (Carl Zeiss, Gottingen, Germany).

Example 7

Mechanism of aMTD-Mediated Intracellular Delivery

RAW264.7 cells were pretreated with different agents to assess the effect of various conditions on protein uptake: (i) 5 μg/ml proteinase K for 10 min, (ii) 20 μM Taxol for 30 min, (iii) 10 μM antimycin in the presence or absence of 1 mM ATP for 2 hrs, (iv) incubation on ice (or maintained at 37° C.) for 60 min, and (v) 100 mM EDTA for 3 hrs. These agents were used at concentrations known to be active in other applications. The cells were then incubated with 10 μM FITC-labeled proteins for 1 hr at 37° C., washed three times with ice-cold phosphate-buffered saline, treated with proteinase K (10 μg/ml for 5 min at 37° C.) to remove cell-surface bound proteins, and analyzed by flow cytometry. To assess cell-to-cell protein transfer, RAW264.7 cells containing FITC-conjugated protein were prepared in the same way and mixed with untreated cells labeled with PreCP-Cy5.5-CD14 antibody for 2 hrs. Cell-to-cell protein transfer, resulting in FITC-Cy5.5 double-positive cells, was monitored by flow cytometry.

Example 8

STAT Phosphorylation: Western Blot Analysis

PANC-1 cells (Korean Cell Line Bank, Seoul, Korea) were cultured in modified Eagle's medium (DMEM; Welgene, Daege, Korea) supplemented with 10% (v/v) FBS, penicillin (100 units/ml), and streptomycin (10 μg/ml, Gibco BRL) and pretreated with 10 μM of SOCS3 recombinant proteins for 2 hrs followed by exposing the cells to agonists (100 ng/ml IFN-γ) for 15 min. Cells were lysed with RIPA lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1% Nonidet P-40, 0.1% SDS, 0.5% sodium deoxycholate, 10 mM NaF, and 2 mM Na3VO4) containing a protease inhibitor cocktail and then centrifuged at 13,000×g for 15 min at 4° C. Equal amounts of lysates were resolved by SDS-PAGE, transferred onto PVDF membranes, and probed with phospho (pY701)-specific STAT1 (Cell Signaling, Danvers, Mass.).

Example 9

Cytokine Measurement: Cytometric Bead Array (CBA) Assay

Peritoneal macrophages were obtained from C3H/HeJ mice. Peritoneal macrophages were incubated with 10 μM recombinant proteins (1:HS3, 2:HM165S3, 3:HM165S3A and 4:HM165S3B, respectively) for 1 hr at 37° C. and then stimulated them with LPS (500 ng/ml) and/or IFN-γ (100 U/ml) without removing iCP-SOCS3 proteins for 3, 6, or 9 hrs. The culture media were collected, and the extracellular levels of cytokine were measured by a cytometric bead array (BD Biosciences, Pharmingen) according to the manufacturer's instructions.

Example 10

Cell Proliferation: CellTiter-Glo Cell Viability Assay

Cells originated from human hepatocellular carcinoma cell and mouse fibroblast (NIH3T3) were purchased (ATCC, Manassas, Va.) and maintained as recommended by the supplier. These cells (3×103/well) were seeded in 96 well plates. The next day, cells were treated with DMEM (vehicle) or recombinant SOCS3 proteins for 96 hrs in the presence of serum (2%). Proteins were replaced daily. Cell growth and survival were evaluated with the CellTiter-Glo Cell Viability Assay (Promega, Madison, Wis.). Measurements using a Luminometer (Turner Designs, Sunnyvale, Calif.) were conducted following the manufacturer's protocol.

Example 11

Apoptosis: TUNEL Assay

Apoptotic cells were analyzed using terminal dUTP nick-end labeling (TUNEL) assay with In Situ Cell Death Detection kit TMR red (Roche, 4056 Basel, Switzerland). Cells were treated with either 10 μM SOCS3 recombinant protein or buffer alone for 16 hrs with 2% fetal bovine serum. Treated cells were washed with cold PBS two times, fixed in 4% paraformaldehyde (PFA, Junsei, Tokyo, Japan) for 1 hr at room temperature, and incubated in 0.1% Triton X-100 for 2 min on the ice. Cells were washed with cold PBS twice, and treated TUNEL reaction mixture for 1 hr at 37° C. in dark, washed cold PBS three times and observed by fluorescence microscopy (Nikon, Tokyo, Japan).

Example 12

Apoptosis: Annexin V/7-AAD Staining

Annexin V/7-Aminoactinomycin D (7-AAD) staining was performed using flow cytometry according to the manufacturer's guidelines. Briefly, 1×106 cells were washed three times with ice-cold PBS. The cells were then resuspended in 100 μl of binding buffer and incubated with 1 μl of 7-AAD and 1 μl of annexin V-PE for 30 min in the dark at 37° C. Flow cytometric analysis was immediately performed using a guava easyCyte™ 8 Instrument (Merck Millipore).

Example 13

Molecular Mechanism: Western Blot Analysis

Cells were treated with either DMEM (vehicle) or 10 μM SOCS3 recombinant proteins, lysed in RIPA lysis buffer containing proteinase inhibitor cocktail, incubated for 15 min at 4° C., and centrifuged at 13,000 rpm for 10 min at 4° C. Equal amounts of lysates were separated on 15% SDS-PAGE gels and transferred to a nitrocellulose membrane. The membranes were blocked using 5% skim milk or 5% Albumin in TBST and incubated with the following antibodies: anti-Bcl-2 (Santa Cruz biotechnology) and anti-Cleaved Caspase 3 (Cell Signaling Technology), then HRP conjugated anti-mouse or anti-rabbit secondary antibody.

Example 14

Cell Migration: Wound-Healing Assay

Cells were seeded into 12-well plates, grown to 90% confluence, and incubated with 10 μM HS3, HM165S3, HM165S3A or HM165S3B in serum-free medium for 2 hrs prior to changing the growth medium. The cells were washed twice with PBS, and the monolayer at the center of the well was “wounded” by scraping with a pipette tip. Cells were cultured for an additional 72 hrs and cell migration was observed by phase contrast microscopy. The migration is quantified by counting the number of cells that migrated from the wound edge into the clear area.

Example 15

Transwell Migration Assay

The lower surface of Transwell inserts (Costar) was coated with gelatin (10 μg/ml), and the membranes were allowed to dry for 1 hr at room temperature. The Transwell inserts were assembled into a 24-well plate, and the lower chamber was filled with growth media containing 10% FBS and FGF2 (10 μg/ml). Cells (5×105) were added to each upper chamber, and the plate was incubated at 37° C. in a 5% CO2 incubator for 24 hrs. Migrated cells were stained with 0.6% hematoxylin and 0.5% eosin and counted.

Example 16

Invasion Assay

The lower surface of Transwell inserts (Costar) was coated with gelatin (10 μg/ml), the upper surface of Transwell inserts was coated with matrigel (40 μg per well; BD Biosciences), and the membranes were allowed to dry for 1 hr at room temperature. The Transwell inserts were assembled into a 24-well plate, and the lower chamber was filled with growth media containing 10% FBS and FGF2 (10 μg/ml). Cells (5×105) were added to each upper chamber, and the plate was incubated at 37° C. in a 5% CO2 incubator for 24 hrs. Migrated cells were stained with 0.6% hematoxylin and 0.5% eosin and counted.

Example 17

Xenograft Animal Models

Female Balb/c nu/nu mice were subcutaneously implanted with Hep3B2.1-7 tumor block (1 mm3) into the left back side of the mouse. Tumor-bearing mice were intravenously administered with iCP-SOCS3 or the control proteins (600 μg/head) for 21 days and observed for 2 weeks following the termination of the treatment. Tumor size was monitored by measuring the longest (length) and shortest dimensions (width) once a day with a dial caliper, and tumor volume was calculated as width2×length×0.5.

After protein treatment, mice were killed, and six organs (brain, heart, lung, liver, kidney, and spleen) from each were collected and kept in a suitable fixation solution until the next step.

Example 18

Immunohistochemistry (IHC)

Tissue samples were fixed in 4% Paraformaldehyde (Duksan) for 3 days, dehydrated, cleared with xylene and embedded in Paraplast. Sections (6 μm thick) of tumor were placed onto poly-L-lysine coated slides. To block endogenous peroxidase activity, sections were incubated for 15 min with 3% H2O2 in methanol. After washing three times with PBS, slides were incubated for 30 min with blocking solution (5% fetal bovine serum in PBS). Rabbit anti-p21 antibody (sc-397, SantaCruz), mouse anti-Bax antibody (sc-7480, SantaCruz) and rabbit anti-VEGF (ab46154, abcam) were diluted 1:1000 (to protein concentration 0.1 μg/ml) in blocking solution, applied to sections, and incubated at 4° C. for 24 hrs. After washing three times with PBS, sections were incubated with biotinylated mouse and rabbit IgG (Vector Laboratories) at a 1:1000 dilution for 1 hr at room temperature, then incubated with avidin-biotinylated peroxidase complex using a Vectorstain ABC Kit (Vector Laboratories) for 30 min at room temperature. After the slides are reacted with oxidized 3,3-diaminobenzidine as a chromogen, they were counterstained with Harris hematoxylin (Sigma-Aldrich). Permanently mounted slides were observed and photographed using a microscope equipped with a digital imaging system (ECLIPSE Ti, Nikon, Japan).

Example 19

Statistical Analysis

All data are presented as mean±s.d. Differences between groups were tested for statistical significance using Student's t-test and were considered significant at p<0.05 or p<0.01.

It will be apparent to those skilled in the art that various modifications can be made to the above-described exemplary embodiments of the present invention without departing from the spirit or scope of the invention. Thus, it is intended that the present invention covers all such modifications provided that they come within the scope of the appended claims and their equivalents.

Claims

What is claimed is:

1. A SOCS3 recombinant protein fused to hydrophobic cell-penetrating peptides (CPPs)—advanced macromolecule transduction domains (aMTDs) and solubilization domain (SD).

2. A cDNA sequence of SOCS3 recombinant protein fused to newly invented hydrophobic cell-penetrating peptides (CPPs), namely advanced macromolecule transduction domains (aMTDs) and solubilization domain (SD)

3. aMTD amino acid sequences according to claim 1 that satisfy all six critical factors as shown in TABLE 3.

4. Varied numbers and locations of solubilization domain (SD) according to claim 1 that are fused to SOCS3 recombinant proteins for high solubility and yield.

5. The result of therapeutic applicability in hepatocellular carcinoma with SOCS3 recombinant proteins fused to newly invented hydrophobic cell-penetrating peptides (CPPs), namely advanced macromolecule transduction domains (aMTDs) and solubilization domain (SD)