US20160060313A1
2016-03-03
14/838,295
2015-08-27
In principle, protein-based biotherapeutics offers a way to control biochemical processes in living cells under non-steady state conditions and with fewer off-target effects than conventional small molecule therapeutics. However, systemic protein delivery in vivo has been proven difficult due to poor tissue penetration and rapid clearance. Protein transduction exploits the ability of some cell-penetrating peptide (CPP) sequences to enhance the uptake of proteins and other macromolecules by mammalian cells. Previously developed hydrophobic CPPs—named membrane translocating sequence (MTS), membrane translocating motif (MTM) and macromolecule transduction domain (MTD)—are able to deliver biologically active proteins into a variety of cells and tissues. Various cargo proteins fused to these CPPs have been used to test the functional and/or therapeutic efficacy of protein transduction. Previously, recombinant proteins consisting of suppressor of cytokine signaling 3 (SOSC3) fused to the fibroblast growth factor (FGF) 4-derived MTM were developed to inhibit inflammation and apoptosis. However, this SOCS3 fusion proteins expressed in bacteria cells were hard to be purified in soluble form. To address these critical limitations, CPP sequences called advanced MTDs (aMTDs) have been developed in this art. The development of this art has been accomplished by (i) analyzing previous developed hydrophobic CPP sequences to identify specific critical factors (CFs) that affect intracellular delivery potential and (ii) constructing artificial aMTD sequences that satisfy each critical factor. Furthermore, solubilization domains (SDs) have been incorporated into the aMTD-fused SOCS3 recombinant proteins to enhance solubility with corresponding increases in protein yield and cell-/tissue-permeability. These recombinant SOCS3 proteins fused to aMTD/SD having much higher solubility/yield and cell-/tissue-permeability have been named as improved cell-permeable SOCS3 (iCP-SOCS3) proteins. Previously developed SOCS3 recombinant proteins fused to MTM were only tested or used as anti-inflammatory agents to treat acute liver injury. In the present art, iCP-SOCS3 proteins have been tested for use as anti-angiogenic agents. Since SOCS3 is known to be an endogenous inhibitor of pathological angiogenesis, we reasoned that iCP-SOCS3 could be used as a protein-based intracellular replacement therapy for inhibiting angiogenesis in tumor cells. The results demonstrated in this art support this following reasoning: Cancer treatment with iCP-SOCS3 results in reduced endothelial cell viability, loss of cell migration potential and suppressed vascular sprouting potentials. In the present invention with iCP-SOCS3, where SOCS3 is fused to an empirically determined combination of newly developed aMTD and customized SD, macromolecule intracellular transduction technology (MITT) enabled by the advanced MTDs may provide novel protein therapy against cancer cell-mediated angiogenesis.
Get notified when new applications in this technology area are published.
C07K14/4703 » CPC main
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used; Regulators; Modulating activity Inhibitors; Suppressors
A61K38/00 » CPC further
Medicinal preparations containing peptides
C07K14/47 IPC
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
C07K7/08 » CPC further
Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof; Linear peptides containing only normal peptide links having 12 to 20 amino acids
This application claims the benefit of the filing date of U.S. Provisional Application No. 62/042,493, filed on Aug. 27, 2014, in the United States Patent and Trademark Office, the disclosure of which is incorporated herein in its entirety by reference.
The present invention pertains to have (i) improved cell-permeable SOCS3 (iCP-SOCS3) proteins as protein-based biotherapeutics, which are well-enhanced in their ability to transport biologically active SOCS3 proteins across the plasma membrane, to increase in its solubility and manufacturing yield, and to induce anti-angiogenic effect; (ii) polynucleotides that encode the same, and (iii) anti-angiogenesis compositions that comprise the same.
Tumor cells have the ability to spread to adjacent or distant organs, penetrate blood or lymphatic vessels, circulate through the intravascular stream, and then proliferate at another site: metastasis. For the metastatic spread of cancer tissue, growth of the vascular network is important. The processes whereby new blood and lymphatic vessels form are called angiogenesis, resulting in the excessive proliferation of cancer cells through the formation of a new vascular network to supply nutrients, oxygen and immune cells and also to remove waste products.
Cytokines including IL-6 and interferon-gamma (IFN-γ) activate the Janus kinase (JAK)/signal transducers and activators of transcription (STAT) signaling pathway, a vital role promoting the inflammation, carcinogenesis and angiogenesis. Cytokine signaling is strictly regulated by the SOCS family proteins induced by different classes of agonists, including cytokines, hormones and infectious agents. Among them, SOCS1 and SOCS3 are relatively specific to STAT1 and STAT3, respectively. SOCS1 inhibits JAK activation through its N-terminal kinase inhibitory region (KIR) by the direct binding to the activation loop of JAKs, while SOCS3 binds to janus kinases (JAKs)-proximal sites on the receptor through its SH2 domain and inhibits JAK activity that blocks recruitment of STAT3. Both SOCS1 and SOCS3 promote anti-inflammaory effects due to the suppression of inflammation-inducing cytokine signaling. Furthermore, the SOCS box, another domain in SOCS proteins, interacts with E3 ubiquitin ligases and/or couples the SH2 domain-binding proteins to the ubiquitin—proteasome pathway. Therefore, SOCSs inhibit cytokine signaling by suppressing JAK kinase activity and degrading the activated cytokine receptor complex.
In connection with SOCSs and angiogenesis, the SOCS3 gene has been implicated as an angiogenesis inhibitor in the cancer development. Previous studies have reported that SOCS3 is transiently induced by inflammatory mediators and inhibits cytoplasmic effectors such as the JAK/STAT kinases. In addition, SOCS3 deactivates tyrosine kinase receptor signaling, including the IGF-1 receptor, resulting in the suppression of apoptosis and vascular sprouting of the endothelial cells (ECs). This means that SOCS3 plays a important role in the negative regulation of the JAK/STAT pathway and contributes to the suppression of angiogenesis by regulating the angiogenic potentials of endothelial cells.
In the previous study, recombinant SOCS3 proteins that contain a cell-penetrating peptide (CPP), membrane-translocating motif (MTM) from fibroblast growth factor (FGF)-4, has been reported to negatively control JAK/STAT signaling. These recombinant SOCS3 proteins inhibited STAT phosphorylation, inflammatory cytokines production and MHC-II expression in cultured and primary macrophages. In addition, SOCS3 fused to MTM protected mice challenged with a lethal dose of the SEB super-antigen by suppressing apoptosis and hemorrhagic necrosis in multiple organs. However, the SOCS3 proteins fused to FGF4-derived MTM displayed extremely low solubility, poor yields and relatively low cell- and tissue-permeability. Therefore, the MTM-fused SOCS3 proteins were not suitable for further clinical development as therapeutic agents. To overcome these limitations, improved SOCS3 recombinant proteins (iCP-SOCS3) fused to the combination of novel hydrophobic CPPs, namely advanced macromolecule transduction domains (aMTDs), to greatly improve the efficiency of membrane penetrating ability in vitro and in vivo with solubilization domains to increase their solubility and manufacturing yield when expressed and purified from bacteria cells.
In this new art of invention, aMTD/SD-fused iCP-SOCS3 recombinant proteins (iCP-SOCS3) have much improved physicochemical characteristics (solubility & yield) and functional activity (cell-/tissue-permeability) compared to the protein fused only to FGF-4-derived MTM. In addition, the newly developed iCP-SOCS3 proteins have now been demonstrated to have therapeutic application in treating angiogenesis, exploiting the ability of SOCS3 to suppress JAK/STAT signaling. The present invention represents that macromolecule intracellular transduction technology (MITT) enabled by the new hydrophobic CPPs that are aMTDs may provide novel protein therapy through SOCS3-intracellular protein replacement against the angiogenesis in tumor. These findings suggest that restoration of SOCS3 by replenishing the intracellular SOCS3 with iCP-SOCS3 protein creates a new paradigm for anti-angiogenesis in tumor, and the intracellular protein replacement therapy with the SOCS3 recombinant protein fused to the combination of aMTD and SD pair may be useful to treat the cancer-associated angiogenesis.
An aspect of the present invention relates to improved cell-permeable SOCS3 (iCP-SOCS3) recombinant proteins capable of mediating the transduction of biologically active macromolecules into live cells.
iCP-SOCS3 recombinant proteins fused to novel hydrophobic CPPs—namely advanced macromolecule transduction domains (aMTDs)—greatly improve the efficiency of membrane penetrating ability in vitro and in vivo of the recombinant proteins.
iCP-SOCS3 recombinant proteins fused to solubilization domains (SDs) greatly increase in their solubility and manufacturing yield when they are expressed and purified in the bacteria system.
An aspect of the present invention also relates to its therapeutic application for delivery of a biologically active molecule to a cell involving a cell-permeable SOCS3 recombinant protein, where the aMTD is attached to a biologically active cargo molecule.
Other aspects of the present invention relate to an efficient use of aMTD sequences for drug delivery, protein therapy, intracellular protein therapy, protein replacement therapy and peptide therapy.
The present invention provides improved cell-permeable SOCS3 as a biotherapeutics having improved solubility/yield, cell-/tissue-permeability and anti-angiogenic effects. Therefore, this would allow their practically effective applications in drug delivery and protein therapy, including intracellular protein therapy and protein replacement therapy.
The above and other objects, features and other advantages of the present invention will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings.
FIG. 1 shows the structure of SOCS3 recombinant proteins. A schematic diagram of the His-tagged SOCS3 recombinant protein is illustrated and constructed according to the present invention. The his-tag for affinity purification (white), aMTD165 (black), SOCS3 (gray) and solubilization domain A and B (SDA & SDB, hatched) are shown.
FIG. 2 shows the construction of expression for SOCS3 recombinant proteins These figures show the agarose gel electrophoresis analysis showing plasmid DNA fragments encoding SOCS3, aMTDs fused SOCS3 and SD cloned into the pET28 (+) vector according to the present invention.
FIG. 3 shows the inducible expression and purification of SOCS3 recombinant proteins. Expression of SOCS3 recombinant proteins in E.coli before (−) and after (+) induction with IPTG and purification by Ni2+ affinity chromatography (P) were monitored by SDS-PAGE, and stained with Coomassie blue.
FIG. 4 shows the improvement of solubility/yield with aMTD/SD-fusion. The solubility, yield and recovery (in percent) of soluble form from denatured form are indicated (left). Relative yield of recombinant proteins is normalized to the yield of HS3 protein (Right).
FIG. 5 shows aMTD-mediated cell-permeability of SOCS3 recombinant proteins. RAW264.7 cells were exposed to FITC-labeled SOCS3 recombinant proteins (10 μM) for 1 hr, treated with proteinase K to remove cell-associated but non-internalized proteins and analyzed by flow cytometry. Untreated cells (gray) and equimolar concentration of unconjugated FITC (FITC only, green)-treated cells were served as control.
FIG. 6 shows aMTD-mediated intracellular delivery and localization of SOCS3 recombinant proteins. Each of NIH3T3 cells was incubated for 1 hour at 37° C. with 10 μM FITC-labeled SOCS3 protein. Cell-permeability of SOCS3 recombinant proteins was visualized by utilizing confocal microscopy LSM700 version.
FIG. 7 shows the systemic delivery of aMTD/SD-fused SOCS3 recombinant proteins in vivo. Cryosections of saline-perfused organs were prepared from mice 1 hr after intraperitoneal injection of FITC only or 600 μg FITC-conjugated recombinant SOCS3 proteins, and were analyzed by fluorescence microscopy.
FIG. 8 shows the structure of SDB-fused SOCS3 recombinant protein. A schematic diagram of the SOCS3 recombinant protein is illustrated and constructed according to the present invention. The his-tag for affinity purification (white), SOCS3 (gray) and solubilization domain B (SDB, hatched) are shown.
FIG. 9 shows the expression, purification and determination of solubility/yield of SD-fused SOCS3 protein. Expression of SOCS3 recombinant proteins in E.coli before (−) and after (+) induction with IPTG and purification by Ni2+ affinity chromatography (P) were monitored by SDS-PAGE, and stained with Coomassie blue (Left, top). The solubility, yield and recovery (in percent) of soluble form from denatured form are indicated (Left, bottom). Relative yield of recombinant proteins is normalized to the yield of HS3 protein (Right).
FIG. 10 shows the mechanism of aMTD-mediated SOCS3 protein uptake into cells. (A-D) RAW264.7 cells were treated with 100 mM EDTA for 3 hrs (A), 5 mg/ml Proteinase K for 10 mins (B), 20 mM taxol for 30 mins (C), or 10 μM antimycin for 2 hrs either without or with 1 mM supplemental ATP for 3 hrs. Cells were exposed for 1 hr to 10 μM FITC-labeled HS3 (black), -HS3B (blue) or -HM165S3B (red), treated with proteinase K for 20 mins, and analyzed by flow cytometry. Untreated cells (gray) and equimolar concentration of unconjugated FITC (FITC only, green)-treated cells were served as control. (E) RAW264.7 cells were exposed for the indicated times to 10 μM FITC-labeled HS3 (black), -HS3B (blue) or -HM165S3B (red), treated with proteinase K, and analyzed by flow cytometry.
FIG. 11 shows aMTD-mediated cell-to-cell delivery. RAW264.7 cells exposed to 10 μM FITC-HS3B or FITC-HM165S3B for 2 hrs, were mixed with non-treated RAW264.7 cells pre-stained with Cy5.5 labeled anti-CD14 antibody, and analyzed by flow cytometry (left, top). The top (right) panel shows a mixture of double negative cells (cells exposed to FITC-HS3B that did not incorporate the protein) and single positive Cy5.5 labeled cells; whereas, second panel from the left contains FITC-Cy5.5 double-positive cells generated by the transfer of FITC-HM165S3B to Cy5.5 labeled cells and the remaining FITC and Cy5.5 single-positive cells. The bottom panels show FITC fluorescence profiles of cell populations before mixing (coded as before) and 1 hr after the same cells were mixed with Cy5.5-labeled cells.
FIG. 12 shows the inhibition of STAT Phosphorylation Induced by IFN-y. Inhibition of STAT1 phosphorylation detected by immunoblotting analysis. The levels of phosphorylated STAT1 and STAT3 untreated and treated with IFN-y were compared to the levels in IFN-γ-treated RAW 264.7 cells that were pulsed with 10 μM of indicated proteins.
FIG. 13 shows the inhibition of Cytokines Secretion Induced by LPS. Inhibition of TNF-α and IL-6 expression by recombinant SOCS3 proteins in primary macrophages isolated from peritoneal exudates of C3H/HeJ mice. Error bars indicate+s.d. of the mean value derived from each assay done in triplicate.
FIG. 14 shows the inhibition of proliferation in endothelial cells with iCP-SOCS3. HUVECs were seeded in 96 well plates and then treated with DMEM (vehicle) or SOCS3 recombinant proteins. Cell viability was evaluated with the CellTiter-Glo Cell Viability Assay. *, p<0.01
FIG. 15 shows the inhibition of migration in endothelial cells with iCP-SOCS3. HUVECs were treated with SOCS3 recombinant proteins for 2 hrs, and cell migration were measured by Transwell assay. *, p<0.01
FIG. 16 shows the inhibition of tube formation in endothelial cells with iCP-SOCS3. HUVECs were treated with 10 μM of SOCS3 recombinant protein for 8 hrs and then the trypsinized cells (5×104/well) were seeded on the surface of the Matrigel. Tube formation is monitored after 24 hrs and the images were analyzed using a service provided by Wimasis. The data shown are representative of three independent experiments. *, p<0.01.
In this invention, it has been hypothesized that exogenously administered SOCS3 proteins could compensate for the apparent inability of endogenously expressed members of this physiologic regulator to interrupt constitutively active cancer-initiating JAK/STAT signaling and excessive cell cycle, resulting in the inhibition of the tumorigenesis. To prove our hypothesis, the SOCS3 recombinant proteins were fused to novel hydrophobic CPPs called aMTDs to improve their cell-/tissue-permeability and additionally adopted solubilization domains to increase their solubility/yield in physiological condition. Then, they were tested for their exogenous administration for the reconstitution of their endogenous stores and restoration of their basic function as the negative feedback regulator that attenuates JAK/STAT signaling. This art of invention has demonstrated “intracellular protein therapy” by designing and introducing cell-permeable form of SOCS3 that has a great potential of anti-cancer therapeutic applicability as an angiogenesis inhibitor.
To address the limitation of previously developed hydrophobic CPPs, novel sequences have been developed. To design new hydrophobic CPPs for intracellular delivery of cargo proteins such as SOCS3, identification of optimal common sequence and/or homologous structural determinants, namely critical factors (CFs), had been crucial. To do it, the physicochemical characteristics of previously published hydrophobic CPPs were analyzed. To keep the similar mechanism on cellular uptake, all CPPs analyzed were hydrophobic region of signal peptide (HRSP)-derived CPPs (e.g. MTS and MTD).
These 17 hydrophobic CPPs published from 1995 to 2014 have been analyzed for their 11 different characteristics—sequence, amino acid length, molecular weight, pI value, bending potential, rigidity/flexibility, structural feature, hydropathy, residue structure, amino acid composition, and secondary structure of the sequences. Two peptide/protein analysis programs were used (ExPasy: http://web.expasy.org/protparam/, SoSui: http://harrier.nagahama-i-bio.ac.jp/sosui/sosui_submit.html) to determine various indexes, structural features of the peptide sequences and to design new sequence. Followings are important factors analyzed.
Average length, molecular weight and pl value of the peptides analyzed were 10.8±2.4, 1,011±189.6 and 5.6±0.1, respectively.
Bending potential (Bending or No-Bending) was determined based on the fact whether proline (P) exists and/or where the amino acid(s) providing bending potential to the peptide in recombinant protein is/are located. Proline differs from the other common amino acids in that its side chain is bonded to the backbone nitrogen atom as well as the alpha-carbon atom. The resulting cyclic structure markedly influences protein architecture which is often found in the bends of folded peptide/protein chain. Eleven out of 17 were determined as ‘Bending’ peptide which means that proline should be present in the middle of sequence for peptide bending and/or located at the end of the peptide for protein bending. As indicated above, peptide sequences could penetrate the plasma membrane in a “bent” configuration. Therefore, bending or no-bending potential is considered as one of the critical factors for the improvement of current hydrophobic CPPs.
Since one of the crucial structural features of any peptide is based on the fact whether the motif is rigid or flexible, which is an intact physicochemical characteristic of the peptide sequence, instability index (II) of the sequence was determined. The index value representing rigidity/flexibility of the peptide was extremely varied (8.9-79.1), but average value was 40.1±21.9 which suggested that the peptide should be somehow flexible, but not too rigid or flexible.
Alanine (V), valine (V), leucine (L) and isoleucine (I) contain aliphatic side chain and are hydrophobic—that is, they have an aversion to water and like to cluster. These amino acids having hydrophobicity and aliphatic residue enable them to pack together to form compact structure with few holes. Analyzed peptide sequence showed that all composing amino acids were hydrophobic (A, V, L and I) except glycine (G) in only one out of 17 and aliphatic (A, V, L,
I, and P). Their hydropathic index (Grand Average of Hydropathy: GRAVY) and aliphatic index (Al) were 2.5±0.4 and 217.9±43.6, respectively.
As explained above, the CPP sequences may be supposed to penetrate the plasma membrane directly after inserting into the membranes in a “bent” configuration with hydrophobic sequences adopting an a-helical conformation. In addition, our analysis strongly indicated that bending potential was crucial. Therefore, structural analysis of the peptides conducted to determine whether the sequence was to form helix or not. Nine peptides were helix and 8 were not. It seems to suggest that helix structure may not be required.
In the 11 characteristics analyzed, the following 6 are selected namely “Critical Factors (CFs)” for the development of new hydrophobic CPPs—advanced MTDs: i) amino acid length, ii) bending potential (proline presence and location), iii) rigidity/flexibility (instability index: II), iv) structural feature (aliphatic index: AI), v) hydropathy (GRAVY) and vi) amino acid composition/residue structure (hydrophobic and aliphatic A/a) .
Since the analyzed data of the 17 different hydrophobic CPPs (analysis A) previously developed during the past 2 decades showed high variation and were hard to make common- or consensus—features, additional analysis B and C was also conducted to optimize the critical factors for better design of improved CPPs—aMTDs.
In analysis B, 8 CPPs used with each cargo in vivo were selected. Length was 11±3.2, but 3 out of 8 CPPs possessed little bending potential. Rigidity/Flexibility was 41±15, but removing one [MTD85: rigid, with minimal (II: 9.1)] of the peptides increased the overall instability index to 45.6±9.3. This suggested that higher flexibility (40 or higher II) is potentially be better. All other characteristics of the 8 CPPs were similar to the analysis A, including structural feature and hydropathy.
To optimize the ‘Common Range and/or Consensus Feature of Critical Factor’ for the practical design of aMTDs and the random peptides, which were to prove that the ‘Critical Factors’ determined in the analysis A, B and C were correct to improve the current problems of hydrophobic CPPs—protein aggregation, low solubility/yield, and poor cell/tissue-permeability of the recombinant proteins fused to the MTS/MTM or MTD, and non-common sequence and non-homologous structure of the peptides, empirically selected peptides were analyzed for their structural features and physicochemical factor indexes.
The peptides which did not have a bending potential, rigid or too flexible sequences (too low or too high Instability Index), or too low or too high hydrophobic CPP were unselected, but secondary structure was not considered because helix structure of sequence was not required. 8 selected CPP sequences that could provide a bending potential and higher flexibility were finally analyzed. Common amino acid length is 12 (11.6±3.0). Proline should be presence in the middle of and/or the end of sequence. Rigidity/Flexibility (II) is 45.5-57.3 (Avg: 50.1±3.6). Al and GRAVY representing structural feature and hydrophobicity of the peptide are 204.7±37.5 and 2.4±0.3, respectively. All peptides are consisted with hydrophobic and aliphatic amino acids (A, V, L, I, and P). Therefore, analysis C was chosen as a standard for the new design of new hydrophobic CPPs (TABLE 1).
1. Amino Acid Length: 9-13
2. Bending Potential (Proline Position: PP)
: Proline presences in the middle (from 5′ to 8′ amino acid) and at the end of sequence
3. Rigidity/Flexibility (Instability Index: II): 40 - 60
4. Structural Feature (Aliphatic Index: AI): 180 - 220
5. Hydropathy (Grand Average of Hydropathy: GRAVY): 2.1-2.6
6. Amino Acid Composition: Hydrophobic and Aliphatic amino acids—A, V, L, I and P
| TABLE 1 |
| [Universal Structure of Newly Develop Hydrophobic CPPs] |
| Summarized Critical Factors of aMTD |
| Analysis of Experimental Results | |
| Critical Factor | Range |
| Bending Potential | Proline presences in the middle (5′, 6′, 7′ or 8′) |
| (Proline Position: PP) | and at the end (12′) of peptides |
| Rigidity/Flexibility | 41.3-57.3 |
| (Instability Index: II) | |
| Structural Feature | 187.5-220.0 |
| (Aliphatic Index: AI) | |
| Hydropathy | 2.2-2.6 |
| (Grand Average of | |
| Hydropathy GRAVY) | |
| Length | 12 |
| (Number of Amino Acid) | |
| Amino acid Composition | A, V, I, L, P |
For confirming the validity of 6 critical factors providing the optimized cell-/tissue-permeability. All 240 aMTD sequences have been designed and developed based on six critical factors (TABLES 2-1 to 2-6). (The aMTD amino sequences are SEQ ID NOS: 1 to 240, and the aMTD nucleotide sequences are SEQ ID NOS: 241 to 480.) All 240 aMTDs (hydrophobic, flexible, bending, aliphatic and helical 12 a/a-length peptides) were practically confirmed by their quantitative and visual cell-permeability. To determine the cell-permeability of aMTDs and random peptides which do not satisfy one or more critical factors have also been designed and tested. Relative cell-permeability of 240 aMTDs to the negative control (random peptide, hydrophilic & non-alipatic 12A/a length peptide) was significantly increased by up to 164 fold, with average increase of 19.6±1.6. Moreover, compared with reference CPPs (MTM and MTD), novel 240 aMTDs averaged of 13±1.1 (maximum 109.9) and 6.6±0.5 (maximum 55.5) fold higher cell-permeability, respectively. As a result, there were vivid association of cell-permeability of the peptides and critical factors. According to the result from the newly designed and tested novel 240 aMTDs, the empirically optimized critical factors are provided below.
1. Amino Acid Length: 12
2. Bending Potential (Proline Position: PP)
: Proline presences in the middle (from 5′ to 8′ amino acid) and at the end of sequence
3. Rigidity/Flexibility (Instability Index: II): 41.3-57.3
4. Structural Feature (Aliphatic Index: AI): 187.5-220.0
5. Hydropathy (Grand Average of Hydropathy: GRAVY): 2.2-2.6
6. Amino Acid Composition: Hydrophobic and Aliphatic amino acids—A, V, L, I and P
| TABLE 2-1 |
| [Newly Developed Hydrophobic CPPs-240 aMTDs That All Critical Factors Are |
| Considered and Satisfied (Sequence ID No. 1-46)] |
| TABLE 2-2 |
| [Newly Developed Hydrophobic CPPs-240 aMTDs That All Critical Factors Are |
| Considered and Satisfied (Sequence ID No. 47-92)] |
| TABLE 2-3 |
| [Newly Developed Hydrophobic CPPs-240 aMTDs That All Critical Factors Are |
| Considered and Satisfied (Sequence ID No. 93-138)] |
| TABLE 2-4 |
| [Newly Developed Hydrophobic CPPs-240 aMTDs That All Critical Factors Are |
| Considered and Satisfied (Sequence ID No. 139-184)] |
| TABLE 2-5 |
| [Newly Developed Hydrophobic CPPs-240 aMTDs That All Critical Factors Are |
| Considered and Satisfied (Sequence ID No. 185-230)] |
| TABLE 2-6 |
| [Newly Developed Hydrophobic CPPs-240 aMTDs That All Critical Factors Are |
| Considered and Satisfied (Sequence ID No. 231-240)] |
These examined critical factors are within the range that we have set for our critical factors; therefore, we were able to confirm that the aMTDs that satisfy these critical factors have much higher cell-permeability (TABLE 3) and intracellular delivery potential compared to reference hydrophobic CPPs reported during the past two decades.
| TABLE 3 |
| [Summarized Critical Factors of aMTD After In-Depth Analysis of |
| Experimental Results] |
| Summarized Critical Factors of aMTD |
| Analysis of Experimental Results | |
| Critical Factor | Range |
| Bending Potential | Proline presences in the middle (5′, 6′, 7′ or 8′) |
| (Proline Position: PP) | and at the end (12′) of peptides |
| Rigidity/Flexibility | 41.3-57.3 |
| (Instability Index: II) | |
| Structural Feature | 187.5-220.0 |
| (Aliphatic Index: AI) | |
| Hydropathy | 2.2-2.6 |
| (Grand Average of | |
| Hydropathy GRAVY) | |
| Length | 12 |
| (Number of Amino Acid) | |
| Amino acid Composition | A, V, I, L, P |
Based on these six critical factors proven by experimental data, newly designed advanced macromolecule transduction domains (aMTDs) have been developed, and optimized for their practical therapeutic usage to facilitate protein translocation across the membrane. For this present invention, cell-permeable SOCS3 recombinant proteins have been developed by adopting aMTD165 (TABLE 4) that satisfied all 6 critical factors (TABLE 5).
| TABLE 4 |
| [Amino Acid and Nucleotide Sequence of |
| Newly Developed Advanced MTD |
| 165 Which Follow All Critical Factors] |
| Amino Acid | ||
| ID | Sequence | Nucleotide Sequence |
| 165 | ALAVPVALAIVP | GCG CTG GCG GTG CCG GTG |
| GCG CTG GCG ATT GTG CCG | ||
| TABLE 5 |
| [Critical Factors of aMTD165] |
| Bending Potential | Rigidity/ | Sturctural | ||||
| Theoretical | M.W. | Prolin Position | Flexibility | Feature | Hydropathy |
| ID | Length | pl | (Da) | 5′ | 6′ | 12′ | (II) | (Al) | (GRAVY) |
| 165 | 12 | 5.57 | 1133.4 | — | 1 | 1 | 50.2 | 195.8 | 2.2 |
In the previous study, recombinant cargo (SOCS3) proteins fused to hydrophobic CPP could be expressed in bacteria system and purified with single-step affinity chromatography; however, protein dissolved in physiological buffers (e.q. PBS, DMEM or RPMI1640 etc.) was highly insoluble and had extremely low. Therefore, an additional non-functional protein domain (solubilization domain: SD; TABLE 6) has been fused to the recombinant proteins at their C terminus to improve low solubility/yield and to enhance relative cell-/tissue-permeability.
According to the specific aim, solubilization domain A (SDA) and B (SDB) were first selected. We hypothesize that fusion of SOCS3 with SDs and novel hydrophobic CPP, aMTD, would greatly increase solubility/yield and cell-/tissue-permeability of recombinant cargo proteins—SOCS3—for the clinical application. SDA is a soluble tag, a tandem repeat of 2 N-terminal domain (NTD) sequences of CP—000113.1, which is a very stable soluble protein present in a spore surface coat of Myxococcus xanthus. SDB, a heme-binding part of cytochrome, provides a visual aid for estimating expression level and solubility. Bacteria expressing SDB containing fusion proteins appears red when the fused proteins are soluble.
| TABLE 6 |
| [Information of Solublization Domains] |
| Protein | Instability | |||||
| SD | Genbank ID | Origin | (kDa) | pl | Index (II) | GRAVY |
| A | CP000113.1 | Bacteria | 23 | 4.6 | 48.1 | −0.1 |
| B | BC086945.1 | Pansy | 11 | 4.9 | 43.2 | −0.9 |
| C | CP012127.1 | Human | 12 | 5.8 | 30.7 | −0.1 |
| D | CP012127.1 | Bacteria | 23 | 5.9 | 26.3 | −0.1 |
| E | CP011550.1 | Human | 11 | 5.3 | 44.4 | −0.9 |
| F | NG_034970 | Human | 34 | 7.1 | 56.1 | −0.2 |
Histidine-tagged human SOCS3 proteins were designed (FIG. 1) and constructed by amplifying the SOCS3 cDNA (225 amino acids) from nt 4 to 678 using primers [TABLE 7] for SOCS3 cargo fused to aMTD. The PCR products were subcloned with NdeI (5′) and BamHl (3′) into pET-28a(+). Coding sequences for SDA or SDB were fused to the C terminus of his-tagged aMTD-fused SOCS3 and cloned at between the BamHl (5′) and Sall (3′) sites in pET-28a(+) (FIG. 2).
| TABLE 7 |
| [PCR Primers for His-Tagged SOCS3 Proteins] |
| aMTD | Recombinant | |||
| Cargo | ID | Protein | 5′ Primers | 3′ Primers |
| SOCS3 | — | HS3 | 5′-GGAATTCCATATGGTCA | 5′-CCCGGATCCTTAAAGCGGGGC |
| CCCACAGCAAGTTTCCCGC | ATCGTACTGGTCCAGGAA-3′ | |||
| CGCC-3′ | ||||
| 165 | HM165S3 | 5′-GGAATTCCATATGGCGC | ||
| 165 | HM165S3A | TGGCGGTGCCGGTGGCGCTG | 5′-CCGGATCCAAGCGGGGCATCG | |
| 165 | HM165S3B | GCGATTGTGCCGGTCACCCA | TACTGGTCCAGGAA-3′ | |
| CAGCAAGTTTC-3′ | ||||
| — | HS3B | 5′-GGAATTCCATATGGTCA | ||
| CCCACAGCAAGTTTCCCGCC | ||||
| GCC-3′ | ||||
| TABLE 8 |
| [PCR Primers for aMTD/SDA-Fused SOCS3 Proteins] |
| Recombinant | ||||
| Cargo | SD | Protein | 5′ Primers | 3′ Primers |
| SOCS3 | SDA | HM165S3A | 5′-CCCGGATCC | 5′-CGCGTCGA |
| ATGGCAAATATT | CTTACCTCGGC | |||
| ACCGTTTTCTAT | TGCACCGGCAC | |||
| AACGAA-3′ | GGCGATGAC-3′ | |||
| TABLE 9 |
| [PCR Primers for aMTD/SDB-Fused SOCS3 Proteins] |
| Recombinant | ||||
| Cargo | SD | Protein | 5′ Primers | 3′ Primers |
| SOCS3 | SDB | HM165S3B | 5′-CCCGGATCC | 5′-CGCGTCGAC |
| HS3B | GCAGAACAAAGC | TTAAAGGGTTTC | ||
| GACAAGGATGTG | CGAAGGCTTGGC | |||
| AAG-3′ | TATCTT-3′ | |||
PCR primers for SOCS3 and SDA and/or SDB fused to SOCS3 are summarized in TABLES 7, 8 and 9, respectively. The cDNA and amino acid sequences of histidine tag are provided in SEQ ID NO: 481 and 482, and cDNA and amino acid sequences of aMTDs are indicated in SEQ ID NO: 483 and 484, respectively. The cDNA and amino acid sequences are displayed in SEQ ID NO: 485 and 486 (SOC53); SEQ ID NO: 487 and 488 (SDA); and SEQ ID NO: 489 and 450 (SDB), respectively.
The SOCS3 recombinant proteins were expressed in E. coli BL21-CodonPlus (DE3) cells, grown to an OD600 of 0.6 and induced for 3 hrs with 0.6 mM isopropyl-β-D-thiogalactopyranoside (IPTG). The proteins were purified by Ni2+ affinity chromatography and dissolved in a physiological buffer such as DMEM medium.
| [cDNA Sequence of Histidine Tag] | |
| SEQ ID NO: 481 | |
| ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGC | |
| [Amino Acid Sequence of Histidine Tag] | |
| SEQ ID NO: 482 | |
| Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro Arg Gly Ser | |
| [cDNA Sequences of aMTDs] | |
| SEQ ID NO: 483 | |
| Please see TABLE 4 | |
| [Amino Acid Sequences of aMTDs] | |
| SEQ ID NO: 484 | |
| Please see TABLE 4 | |
| [cDNA Sequence of human SOCS3] | |
| SEQ ID NO: 485 | |
| ATGGTCACCC ACAGCAAGTT TCCCGCCGCC GGGATGAGCC GCCCCCTGGA CACCAGCCTG | |
| CGCCTCAAGA CCTTCAGCTC CAAGAGCGAG TACCAGCTGG TGGTGAACGC AGTGCGCAAG | |
| CTGCAGGAGA GCGGCTTCTA CTGGAGCGCA GTGACCGGCG GCGAGGCGAA CCTGCTGCTC | |
| AGTGCCGAGC CCGCCGGCAC CTTTCTGATC CGCGACAGCT CGGACCAGCG CCACTTCTTC | |
| ACGCTCAGCG TCAAGACCCA GTCTGGGACC AAGAACCTGC GCATCCAGTG TGAGGGGGGC | |
| AGCTTCTCTC TGCAGAGCGA TCCCCGGAGC ACGCAGCCCG TGCCCCGCTT CGACTGCGTG | |
| CTCAAGCTGG TGCACCACTA CATGCCGCCC CCTGGAGCCC CCTCCTTCCC CTCGCCACCT | |
| ACTGAACCCT CCTCCGAGGT GCCCGAGCAG CCGTCTGCCC AGCCACTCCC TGGGAGTCCC | |
| CCCAGAAGAG CCTATTACAT CTACTCCGGG GGCGAGAAGA TCCCCCTGGT GTTGAGCCGG | |
| CCCCTCTCCT CCAACGTGGC CACTCTTCAG CATCTCTGTC GGAAGACCGT CAACGGCCAC | |
| CTGGACTCCT ATGAGAAAGT CACCCAGCTG CCGGGGCCCA TTCGGGAGTT CCTGGACCAG | |
| TACGATGCCC CGCTT | |
| [Amino Acid Sequence of human SOCS3] | |
| SEQ ID NO: 486 | |
| Met Val Thr His Ser Lys Phe Pro Ala Ala Gly Met Ser Arg Pro Leu Asp Thr Ser Leu Arg Leu Lys | |
| Thr Phe Ser Ser Lys Ser Glu Tyr Gln Leu Val Val Asn Ala Val Arg Lys Leu Gln Glu Ser Gly Phe Tyr | |
| Trp Ser Ala Val Thr Gly Gly Glu Ala Asn Leu Leu Leu Ser Ala Glu Pro Ala Gly Thr Phe Leu Ile Arg | |
| Asp Ser Ser Asp Gln Arg His Phe Phe Thr Leu Ser Val Lys Thr Gln Ser Gly Thr Lys Asn Leu Arg Ile | |
| Gln Cys Gly Gly Gly Ser Phe Ser Leu Gln Ser Asp Pro Arg Ser Thr Gln Pro Val Pro Arg Phe Asp | |
| Cys Val Leu Lys Leu Val His His Tyr Met Pro Pro Pro Gly Ala Pro Ser Phe Pro Ser Pro Pro Thr Glu | |
| Pro Ser Ser Glu Val Pro Glu Gln Pro Ser Ala Gln Pro Leu Pro Gly Ser Pro Pro Arg Arg Ala Tyr Tyr | |
| Ile Tyr Ser Gly Gly Glu Lys Ile Pro Leu Val Leu Ser Arg Pro Leu Ser Ser Asn Val Ala Thr Leu Gln | |
| His Leu Cys Arg Lys Thr Val Asn Gly His Leu Asp Ser Tyr Glu Lys Val Thr Gln Leu Pro Gly Pro Ile | |
| Arg Glu Phe Leu Asp Gln Tyr Asp Ala Pro Leu | |
| [cDNA Sequences of SDA] | |
| SEQ ID NO: 487 | |
| ATGGCAAATATT ACCGTTTTCTAT AACGAAGACTTC CAGGGTAAGCAG GTCGATCTGCCG | |
| CCTGGCAACTAT ACCCGCGCCCAG TTGGCGGCGCTG GGCATCGAGAAT AATACCATCAGC | |
| TCGGTGAAGGTG CCGCCTGGCGTG AAGGCTATCCTG TACCAGAACGAT GGTTTCGCCGGC | |
| GACCAGATCGAA GTGGTGGCCAAT GCCGAGGAGTTG GGCCCGCTGAAT AATAACGTCTCC | |
| AGCATCCGCGTC ATCTCCGTGCCC GTGCAGCCGCGC ATGGCAAATATT ACCGTTTTCTAT | |
| AACGAAGACTTC CAGGGTAAGCAG GTCGATCTGCCG CCTGGCAACTAT ACCCGCGCCCAG | |
| TTGGCGGCGCTG GGCATCGAGAAT AATACCATCAGC TCGGTGAAGGTG CCGCCTGGCGTG | |
| AAGGCTATCCTC TACCAGAACGAT GGTTTCGCCGGC GACCAGATCGAA GTGGTGGCCAAT | |
| GCCGAGGAGCTG GGTCCGCTGAAT AATAACGTCTCC AGCATCCGCGTC ATCTCCGTGCCG | |
| GTGCAGCCGAGG | |
| [Amino Acid Sequences of SDA] | |
| SEQ ID NO: 488 | |
| Met Ala Asn Ile Thr Val Phe Tyr Asn Glu Asp Phe Gln Gly Lys Gln Val Asp Leu Pro Pro Gly Asn | |
| Tyr Thr Arg Ala Gln Leu Ala Ala Leu Gly Ile Glu Asn Asn Thr Ile Ser Ser Val Lys Val Pro Pro Gly | |
| Val Lys Ala Ile Leu Tyr Gln Asn Asp Gly Phe Ala Gly Asp Gln Ile Glu Val Val Ala Asn Ala Glu Glu | |
| Leu Gly Pro Leu Asn Asn Asn Val Ser Ser Ile Arg Val Ile Ser Val Pro Val Gln Pro Arg Met Ala Asn | |
| Ile Thr Val Phe Tyr Asn Glu Asp Phe Gln Gly Lys Gln Val Asp Leu Pro Pro Gly Asn Tyr Thr Arg Ala | |
| Gln Leu Ala Ala Leu Gly ile Glu Asn Asn Thr Ile Ser Ser Val Lys Val Pro Pro Gly Val Lys Ala Ile | |
| Leu Tyr Gln Asn Asp Gly Phe Ala Gly Asp Gln Ile Glu Val Val Ala Asn Ala Glu Glu Leu Gly Pro Leu | |
| Asn Asn Asn Val Ser Ser Ile Arg Val Ile Ser Val Pro Val Gln Pro Arg | |
| [cDNA Sequences of SDB] | |
| SEQ ID NO: 489 | |
| ATGGCA GAACAAAGCG ACAAGGATGT GAAGTACTAC ACTCTGGAGG AGATTCAGAA | |
| GCACAAAGAC AGCAAGAGCA CCTGGGTGAT CCTACATCAT AAGGTGTACG ATCTGACCAA | |
| GTTTCTCGAA GAGCATCCTG GTGGGGAAGA AGTCCTGGGC GAGCAAGCTG GGGGTGATGC | |
| TACTGAGAAC TTTGAGGACG TCGGGCACTC TACGGATGCA CGAGAACTGT CCAAAACATA | |
| CATCATCGGG GAGCTCCATC CAGATGACAG ATCAAAGATA GCCAAGCCTT CGGAAACCCT T | |
| [Amino Acid Sequences of SDB] | |
| SEQ ID NO: 490 | |
| Met Ala Glu Gln Ser Asp Lys Asp Val Lys Tyr Tyr Thr Leu Glu Glu Ile Gln Lys His Lys Asp Ser Lys | |
| Ser Thr Trp Val Ile Leu His His Lys Val Tyr Asp Leu Thr Lys Phe Leu Glu Glu His Pro Gly Gly Glu | |
| Glu Val Leu Gly Glu Gln Ala Gly Gly Asp Ala Thr Glu Asn Phe Glu Asp Val Gly His Ser Thr Asp Ala | |
| Arg Glu Leu Ser Lys Thr Tyr Ile Ile Gly Glu Leu His Pro Asp Asp Arg Ser Lys Ile Ala Lys Pro Ser | |
| Glu Thr Leu |
The histidine-tagged SOCS3 proteins were expressed, purified, and prepared in soluble form (FIG. 3). The yield of each soluble SOCS3 recombinant proteins was determined by measuring absorbance (A450).
SOCS3 recombinant proteins containing aMTD165 and solubilization domain (HM165S3A and HM165S3B) had little tendency to precipitate whereas recombinant SOCS3 proteins lacking a solubilization domain (HS3 and HM165S3) were largely insoluble. Solubility of aMTD/SD-fused SOCS3 proteins was scored on a 5 point scale compared with that of SOCS3 proteins lacking the solubilization domain (FIG. 4).
Yields per L of E.coli for each recombinant protein (mg/L) ranged from 1 to 47 mg/L (FIG. 4). Yields of SOCS3 proteins containing an aMTD and SDB (HM165S3B) were 50% higher than his-tagged SOCS3 protein (HS3).
3. aMTD/SD-Fused SOCS3 Recombinant Proteins Significantly Increase Cell- and Tissue-Permeability
3-1. aMTD/SD-Fused SOC53 Recombinant Proteins Are Cell-Permeable
To examine protein uptake, SOCS3 recombinant proteins were conjugated to 5/6-fluorescein isothiocyanate (FITC). RAW 264.7 (FIG. 5) or NIH3T3 cells (FIG. 6) were treated with 10 μM FITC-labeled SOCS3 recombinant proteins. The cells were washed three times with ice-cold PBS and treated with proteinase K to remove surface-bound proteins, and internalized proteins were measured by flow cytometry (FIG. 5) and visualized by confocal laser scanning microscopy (FIG. 6). SOCS3 proteins containing aMTD165 (HM165S3, HM165S3A and HM165S3B) efficiently entered the cells (FIGS. 5 and 6) and were localized to various extents in cytoplasm (FIG. 6). In contrast, SOCS3 protein (HS3) containing lacking aMTD did not appear to enter cells. While all SOCS3 proteins containing aMTD165 transduced into the cells, HM165S3B displayed more uniform cellular distribution, and protein uptake of HM165S3B was also very efficient.
3-2. aMTD/SD-Fused SOCS3 Recombinant Proteins Enhance the Systemic Delivery to a Variety of Tissues
To further investigate in vivo delivery of SOCS3 recombinant proteins, FITC-labeled SOCS3 proteins were monitored following intraperitoneal (IP) injections in mice. Tissue distributions of fluorescence-labeled-SOCS3 proteins in different organs was analyzed by fluorescence microscopy (FIG. 7). SOCS3 recombinant proteins fused to aMTD165 (HM165S3, HM165S3A and HM165S3B) were distributed to a variety of tissues (liver, kidney, spleen, lung, heart and, to a lesser extent, brain). Predictably, liver showed highest levels of fluorescent cell-permeable SOCS3 since intraperitoneal administration favors the delivery of proteins to this organ via the portal circulation. SOCS3 containing aMTD165 was detectable to a lesser degree in lung, spleen and heart. aMTD/SDB-fused SOCS3 recombinant protein (HM165S3B) showed the highest systemic delivery of SOCS3 protein to the tissues comparable to the SOCS3 containing only aMTD (HM165S3) or aMTD/SDA (HM165S3A) proteins. These data suggest that SOCS3 protein containing both of aMTD165 and SDB leads to higher cell-/tissue-permeability due to the increase in solubility and stability of the protein, and it displayed a dramatic synergic effect on cell-/tissue-permeability.
3-3. aMTD-Mediated Intracellular Delivery is Bidirectional Mode
SOCS3 recombinant proteins lacking SD (HS3 and HM165S3) were less soluble, produced lower yields, and showed tendency to precipitate when they were expressed and purified in E. coli. Therefore, we additionally designed (FIG. 8) and constructed SOCS3 recombinant protein containing only SDB (without aMTD165: HS3B) as a negative control. As expected, its solubility and yield increased compared to that of SOCS3 proteins lacking SDB (HS3; FIG. 9). Therefore, HS3B proteins were used as a control protein.
We next investigated how aMTD165-mediated intracellular delivery was occurred. The aMTD-mediated intracellular delivery of SOCS3 protein did not require protease-sensitive protein domains displayed on the cell surface (FIG. 10B), microtubule function (FIG. 10C), or ATP utilization (FIG. 10D), since aMTD165-dependent uptake [compare to HS3 (black) and HS3B (blue)] was essentially unaffected by treating cells with proteinase K, taxol, or the ATP depleting agent, antimycin. Conversely, aMTD165-fused SOCS3 proteins uptake was blocked by treatment with EDTA and low temperature (FIGS. 10A and 10E), indicating the importance of membrane integrity and fluidity for aMTD-mediated protein transduction. Moreover, we also tested whether cells treated with aMTD165-fused SOCS3 protein could transfer the protein to neighboring cells. For this, cells transduced with FITC-HM165S3B (green) were mixed with CD14-labeled cells (red), and cell-to-cell protein transfer was assessed by flow cytometry, scoring for CD14/FITC double-positive cells. Efficient cell-to-cell transfer of HM165S3B, but not HS3 or HS3B (FIG. 11), suggesting that SOCS3 recombinant proteins containing aMTD165 are capable of bidirectional passage across the plasma membrane.
4. aMTD/SD-Fused SOCS3 Protein Efficiently Inhibits Cellular Processes
4-1. aMTD/SD-Fused SOCS3 Protein Inhibits the Activation of STATs Induced by INF-γ
The ultimate test of cell-penetrating efficiency is a determination of intracellular activity of SOCS3 proteins transported by aMTD. Since endogenous SOCS3 are known to block phosphorylation of STAT1 and STAT3 by IFN-γ-mediated JAK1 and JAK2 activation, we demonstrated whether cell-permeable SOCS3 inhibits the phosphorylation of STATs. All SOCS3 recombinant proteins containing aMTD (HM165S3, HM165S3A and HM165S3B), suppressed IFN-γ-induced phosphorylation of STAT1 and STAT3 (FIG. 12). In contrast, STAT phosphorylation was readily detected in cells exposed to HS3, which lacks the aMTD motif required for membrane penetration (FIG. 12), indicating that HS3, which lacks an MTD sequence and did not enter the cells, has no biological activity.
4-2. aMTD/SD-Fused SOCS3 Recombinant Protein Inhibits the Secretion of Inflammatory Cytokines TNF-α and IL-6
We next investigated the effect of cell-permeable SOCS3 proteins on cytokines secretion. Treatment of C3H/HeJ primary peritoneal macrophages with SOCS3 proteins containing aMTD165 suppressed TNF-α and IL-6 secretion induced by the combination of IFN-γ and LPS by 50-90% during subsequent 9 hrs of incubation (FIG. 13). In particular, aMTD165/SDB-fused SOCS3 recombinant protein showed the greatest inhibitory effect on cytokine secretion. In contrast, cytokine secretion in macrophages treated with non-permeable SOCS3 protein (HS3) was unchanged, indicating that recombinant SOCS3 lacking the aMTD doesn't affect intracellular signaling. Therefore, we conclude that differences in the biological activities of HM165S3B as compared to HS3B are due to the differences in protein uptake mediated by the aMTD sequence.
In light of solubility/yield, cell-/tissue-permeability and biological effect, SOCS3 recombinant protein containing aMTD and SDB (HM165S3B) is a prototype of a new generation of improved cell-permeable SOCS3 (iCP-SOCS3), and will be selected for further evaluation as a potential anti-angiogenic agent.
5. iCP-SOCS3 Suppresses Pro-Angiogenic Functions in Endothelial Cells
5-1. iCP-SOC53 Inhibits Cell Viability in Endothelial Cells
Since endogenous SOCS3 regulates cell proliferation in endothelial cell as an angiogenesis inhibitor, we have investigated whether iCP-SOCS3 inhibit cell viability through SOCS3 intracellular delivery in endothelial cell. As shown in FIG. 14, SOCS3 recombinant proteins containing aMTD165 and solubilization domain (HM165S3B) significantly suppressed cell proliferation—over 60% in 10 μM treatment (p<0.01)—than other proteins, including HS3B or vehicle alone (i.e. exposure of cells to culture media without recombinant proteins) in human umbilical vein endothelial cells (HUVECs). This result suggests that iCP-SOCS3 proteins would have a great ability to inhibit cell survival-associated phenotypes in endothelial cell as an anti-angiogenic biotherapeutics.
5-2. iCP-50053 Inhibits Migration of Endothelial Cells
We next examined the ability of iCP-SOCS3 to influence cell migration. HUVECs were treated with 10 μM SOCS3 recombinant proteins for 2 hrs, and cell migration was measure by Transwell migration assay (FIG. 15). Cell migration was markedly suppressed in HUVECs treated with HM165S3B (iCP-SOCS3) protein although SOCS3 protein lacking aMTD165 (HS3B) had no effect on the cell migration.
5-3. iCP-SOCS3 Protein Inhibits Vasculogenic Activity of Endothelial Cells
To determine whether the morphogenesis of the endothelial cells into capillary tube structures was regulated by iCP-SOCS3 through proteins transduction, endothelial cell tube-forming assays were performed in 24-well Matrigel coated plates. HUVECs were treated with 5 μM of SOCS3 recombinant protein for 8 hrs and tube-formation was monitored after 24 hrs. As a result, HUVECs treated with HM165S3B proteins significantly suppressed the tube formation compared with negative controls including HS3B or vehicle (FIG. 16). Taken together, these results suggest that iCP-SOCS3 directly plays an important role in the inhibition of angiogenesis and may provide the way for the development of novel therapies aimed at reducing the angiogenesis.
The following examples are presented to aid practitioners of the invention, to provide experimental support for the invention, and to provide model protocols. In no way are these examples to be understood to limit the invention.
H-regions of signal sequences (HRSP)-derived CPPs (MTM, MTS and MTD) do not have a common sequence, a sequence motif, and/or a common structural homologous feature. In this invention, the aim is to develop improved hydrophobic CPPs formatted in the common sequence and structural motif that satisfy newly determined ‘critical factors’ to have a ‘common function’, to facilitate protein translocation across the membrane with similar mechanism to the analyzed CPPs. 6 critical factors have been selected to artificially develop novel hydrophobic CPP, namely advanced macromolecule transduction domain (aMTD). These 6 critical factors include the followings: amino acid length of the peptides (ranging from 9 to 13 amino acids), bending potentials (dependent with the presence and location of proline in the middle of sequence (at 5′, 6′, 7′ or 8′ amino acid) and at the end of peptide (at 12′)), instability index (II) for rigidity/flexibility (II: 40-60), grand average of hydropathy (GRAVY) for hydropathy (GRAVY: 2.1-2.4), and aliphatic index (Al) for structural features (AI: 180-220). Based on these standardized critical factors, new hydrophobic peptide sequences, namely advanced macromolecule transduction domain peptides (aMTDs), in this invention have been developed and selected to be fused with the cargo protein, SOCS3, to develop improved cell-permeable SOCS3 recombinant protein (iCP-SOCS3).
Histidine-tagged human SOCS3 proteins were constructed by amplifying the SOCS3 cDNA (225 amino acids) for aMTD fused to SOCS3 cargo. The PCR reactions (100 ng genomic DNA, 10 pmol each primer, each 0.2 mM dNTP mixture, 1X reaction buffer and 2.5 U Pfu(+) DNA polymerase (Doctor protein, Korea)) were digested on the restriction enzyme site between Nde I (5′) and Sal I (3′) involving 35 cycles of denaturing (95° C.), annealing (62° C.), and extending (72° C.) for 45 sec each. For the last extension cycle, the PCR reactions remained for 10 min at 72° C. The PCR products were subcloned into 6x His expression vector, pET-28a(+) (Novagen). Coding sequence for SDA or SDB fused to C terminus of his-tagged aMTD-SOCS3 was cloned at BamHl (5′) and Sall (3′) in pET-28a(+) from PCR-amplified DNA segments and confirmed by DNA sequence analysis of the resulting plasmids.
The recombinant proteins were purified from E. coli BL21-CodonPlus (DE3) cells grown to an A600 of 0.6 and induced for 3 hrs with 0.6 mM IPTG. Denatured recombinant proteins were purified by Ni2+ affinity chromatography as directed by the supplier (Qiagen, Hilden, Germany). After purification, they were dialyzed against a refolding buffer (0.55 M guanidine HCl, 0.44 M L-arginine, 50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 100 mM NDSB, 2 mM reduced glutathione, and 0.2 mM oxidized glutathione) and changed to a physiological buffer such as DMEM medium.
For quantitative cell-permeability, recombinant SOCS3 proteins were conjugated to 5/6-fluorescein isothiocyanate (FITC) according to the manufacturer's instructions (Sigma-Aldrich, St. Louis, Mo.). RAW 264.7 cells were treated with 10 μM FITC-labeled recombinant proteins for 1 hr at 37° C., washed three times with cold PBS, and treated with proteinase K (10 μg/mL) for 20 min at 37° C. to remove cell-surface bound proteins. Cell-permeability of these recombinant proteins was analyzed by flow cytometry (Guava, Millipore, Darmstadt, Germany) using the Flowio cytometric analysis software.
For visual cell permeability, NIH3T3 cells were cultured on coverslips in 24-well plates and with 10 μM FITC-conjugated recombinant proteins for 1 hr at 37° C. These cells on coverslips were washed with PBS, fixed with 4% formaldehyde for 10 min, and washed three times with PBS at room temperature. Coverslips were mounted with VECTASHIELD Mounting Medium (Vector laboratories, Burlingame, Calif.) with DAPI (4′,6-diamidino-2-phenylindole) for nuclear staining. Intracellular localization of fluorescent signal was determined by confocal laser scanning microscopy (LM700, Zeiss, Germany).
ICR mice (6-week-old, female) were injected intraperitoneally (600 μg/head) with either FITC only or FITC-conjugated SOCS3 recombinant proteins. After 2 hrs, the liver, kidney, spleen, lung, heart, and brain were isolated, washed with an O.C.T. compound (Sakura), and frozen on dry ice. Cryosections (20 μm) were analyzed by fluorescence microscopy (Carl Zeiss, Gottingen, Germany).
RAW264.7 cells were pretreated with different agents to assess the effect of various conditions on protein uptake: (i) 5 μg/ml proteinase K for 10 min, (ii) 20 μM Taxol for 30 min, (iii) 10 μM antimycin in the presence or absence of 1 mM ATP for 2 hrs, (iv) incubation on ice (or maintained at 37 ° C.) for 60 min, and (v) 100 mM EDTA for 3 hrs. These agents were used at concentrations known to be active in other applications. The cells were then incubated with 10 μM FITC-labeled proteins for 1 hr at 37° C., washed three times with ice-cold phosphate-buffered saline, treated with proteinase K (10 μg/ml for 5 min at 37° C.) to remove cell-surface bound proteins, and analyzed by flow cytometry. To assess cell-to-cell protein transfer, RAW264.7 cells containing FITC-conjugated protein were prepared in the same way and mixed with untreated cells labeled with PreCP-Cy5.5-CD14 antibody for 2 hrs. Cell-to-cell protein transfer, resulting in FITC-Cy5.5 double-positive cells, was monitored by flow cytometry.
PANC-1 cells (Korean Cell Line Bank, Seoul, Korea) were cultured in modified Eagle's medium (DMEM; Welgene, Daege, Korea) supplemented with 10% (v/v) FBS, penicillin (100 units/ml), and streptomycin (10 μg/ml, Gibco BRL) and pretreated with 10 μM of SOCS3 recombinant proteins for 2 hrs followed by exposing the cells to agonists (100 ng/ml IFN-γ) for 15 min. Cells were lysed with RIPA lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1% Nonidet P-40, 0.1% SDS, 0.5% sodium deoxycholate, 10 mM NaF, and 2 mM Na3VO4) containing a protease inhibitor cocktail and then centrifuged at 13,000×g for 15 min at 4° C. Equal amounts of lysates were resolved by SDS-PAGE, transferred onto PVDF membranes, and probed with phospho (pY701)-specific STAT1 (Cell Signaling, Danvers, Mass.).
Peritoneal macrophages were obtained from C3H/HeJ mice. Peritoneal macrophages were incubated with 10 μM recombinant proteins (1:HS3, 2:HM165S3, 3:HM165S3A and 4:HM165S3B, respectively) for 1 hr at 37° C. and then stimulated them with LPS (500 ng/ml) and/or IFN-γ (100 U/ml) without removing iCP-SOCS3 proteins for 3, 6, or 9 hrs. The culture media were collected, and the extracellular levels of cytokine were measured by a cytometric bead array (BD Biosciences, Pharmingen) according to the manufacturer's instructions.
HUVECs were purchased (ATCC, Manassas, Va.) and maintained as recommended by the supplier. These cells (3×103/well) were seeded in 96 well plates. The next day, cells were treated with DMEM (vehicle) or recombinant SOCS3 proteins for 96 hrs in the presence of serum (2%). Proteins were replaced daily. Cell growth and survival were evaluated with the CellTiter-Glo Cell Viability Assay (Promega, Madison, Wis.). Measurements using a Luminometer (Turner Designs, Sunnyvale, Calif.) were conducted following the manufacturer's protocol.
Cells were treated with either DMEM (vehicle) or 10 μM SOCS3 recombinant proteins, lysed in RIPA lysis buffer containing proteinase inhibitor cocktail, incubated for 15 min at 4° C., and centrifuged at 13,000 rpm for 10 min at 4° C. Equal amounts of lysates were separated on 15% SDS-PAGE gels and transferred to a nitrocellulose membrane. The membranes were blocked using 5% skim milk or 5% Albumin in TBST and incubated with the following antibodies: anti-Bcl-2 (Santa Cruz biotechnology) and anti-Cleaved Caspase 3 (Cell Signaling Technology), then HRP conjugated anti-mouse or anti-rabbit secondary antibody.
The lower surface of Transwell inserts (Costar) was coated with gelatin (10 μg/ml), and the membranes were allowed to dry for 1 hr at room temperature. The Transwell inserts were assembled into a 24-well plate, and the lower chamber was filled with growth media containing 10% FBS and FGF2 (10 μg/ml). Cells (5×105) were added to each upper chamber, and the plate was incubated at 37° C. in a 5% CO2 incubator for 24 hrs. Migrated cells were stained with 0.6% hematoxylin and 0.5% eosin and counted.
Endothelial cell tube-forming assays are performed in 24-well Matrigel (BD Bioscience) coated plates. Human umbilical-vein endothelial cells (HUVECs) are treated with 10 μM of recombinant SOCS3 protein for 8 hrs and then the trypsinized cells were seeded on the surface of the Matrigel (5×104/well). Tube formation is monitored after 24 hrs and the images were analyzed using a service provided by Wimasis.
All data are presented as mean±s.d. Differences between groups were tested for statistical significance using Student's t-test and were considered significant at p<0.05 or p<0.01.
It will be apparent to those skilled in the art that various modifications can be made to the above-described exemplary embodiments of the present invention without departing from the spirit or scope of the invention. Thus, it is intended that the present invention covers all such modifications provided that they come within the scope of the appended claims and their equivalents.
1. The list of amino acid sequences of SOCS3 recombinant proteins fused to newly invented hydrophobic cell-penetrating peptides (CPPs)—advanced macromolecule transduction domains (aMTDs) and solubilization domain (SD)
2. The list of cDNA sequences of SOCS3 recombinant proteins fused to newly invented hydrophobic cell-penetrating peptides (CPPs), namely advanced macromolecule transduction domains (aMTDs) and solubilization domain (SD)
3. A list of 240 aMTD amino acid sequences according to claim 1 that satisfy all six critical factors as shown in TABLE 3
4. Varied numbers and locations of solubilization domain (SD) according to claim 1 that are fused to SOCS3 recombinant proteins for high solubility and yield
5. The result of therapeutic applicability in lung cancer with SOCS3 recombinant proteins fused to newly invented hydrophobic cell-penetrating peptides (CPPs), namely advanced macromolecule transduction domains (aMTDs) and solubilization domain (SD)