Patent application title:

Production of Vectors for Non-Dividing Host Cells

Publication number:

US20160097060A1

Publication date:
Application number:

14/862,731

Filed date:

2015-09-23

Abstract:

A high-volume gene therapy vector manufacturing process, entailing using a recombinant baculovirus to transform a producer cell, which producer cell in turn produces a recombinant gene therapy vector which is able to transform host cells even when they are not dividing.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N2710/14051 »  CPC further

dsDNA viruses; Details; Baculoviridae Methods of production or purification of viral material

A61K48/00 »  CPC further

Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

C12N15/86 »  CPC main

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for animal cells Viral vectors

Description

FIELD OF THE INVENTION

The invention relates to methods for the production of lentiviral vectors.

BACKGROUND OF THE INVENTION

Lentiviruses, such as Human Immunodeficiency Virus I, are promising tools for gene therapy due to their ability to transduce and integrate into genome of both dividing and non-dividing cells. Lentiviral vectors can be pseudotyped by various viral surface proteins such the envelope glycoprotein G of the vesicular stomatitis virus (VSV-G). Pseudotyping broadens the transduction range of lentiviruses and long-term transgene expression has been obtained in many different cells and tissues (Delenda, 2004). Pseudotyping also strengthens fragile lentiviruses and enables concentration to high titers by ultrasentrifugation (Burns et al., 1993).

The third generation lentiviral vector particles are commonly prepared by transient plasmid transfection in the 293T human embryonic kidney (HEK 293T) cells. Transfection is made by cotransfecting i) packaging plasmid containing gag-pol, ii) the self-inactivating transfer vector plasmid iii) envelope glycoprotein expressing plasmid and iv) rev expressing plasmid (Follenzi and Naldini, 2002). In vivo experiments in preclinical large animal models and human clinical trials require large amounts of viral particles. Currently there is no optimal large scale packaging system available for lentiviruses. Stable large scale vector production systems have been developed but the toxicity of the lentiviral enzymes and the fusogenic VSV-G prohibit constitutive expression and only possibilities at the moment is to use inducible cell lines (Pacchia et al., 2001; Farson et al., 2001) or replace the most toxic VSV-G with other less-toxic glycoprotein (Kumar et al., 2003). Stable cell lines suffer from the gene silencing that occurs during the long culture periods needed for sequential addition of packaging constructs. On the contrary, transient plasmid-based production systems are very laborious and inefficient, and suffer from batch-to-batch variation. None of these systems have proven to be ideal for the large scale production of lentiviruses and, therefore, there is clear need for efficient new methods.

SUMMARY OF THE INVENTION

In this study we have constructed four recombinant baculoviruses BAC-transfer, BAC-gag-pol, BAC-VSVg and BAC-rev, derived from Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV) expressing all elements needed for the lentivirus vector generation in mammalian cells. By transducting 293T cells with these baculoviruses we were able to produce functional lentivirus. Preferably, all the elements needed for the production of functional lentiviruses are cloned into three baculoviruses. More preferably, they are cloned into two baculoviruses, and most preferably, they are cloned into one baculovirus. This may be achieved by combining the features of BAC-transfer, BAC-gag-pol, BAS-VSVg and BAG-rev into three or fewer baculoviruses.

Baculovirus-produced lentiviruses transduced mammalian cells as efficient as conventionally produced lentiviruses. Different baculovirus concentrations were used to find optimal baculovirus concentration for lentivirus production. The un-concentrated lentiviral titers in cell culture mediums were on avarege 1.21×108 TU/ml which are comparable to titers of the lentivirus produced by conventional four plasmid method. Lentivirus transduced Hela cells were grown three months without loosing the GFP expression. Our results show for the first time that baculoviruses can be used for the production of lentiviruses in mammalian cells. Baculovirus technology offers an attractive possibility to scalable virus production as a result of ease production and concentration of baculovirses, efficient transduction of suspension mammalian cells in serum free conditions and safety of the baculoviruses. The lentiviral vector may also be produced with the baculovirus capsid-displaying viral protein rev, tat, net, vit or vpu, by fusing the viral protein to a baculovirus protein. The baculovirus protein may be the capsid protein, vp39. Further, the lentivirus may be produced using a transgene or transgene cassette.

The resulting lentiviruses may be pseutotyped with heterologous proteins or other ligands, such VSV-g, gp64, avidin, streptavidin or biotin.

DESCRIPTION OF THE DRAWINGS

The following drawings illustrate embodiments of the invention.

FIG. 1 shows cloned baculovirus donor plasmids, BAC-transfer, BAC-gag-pol, BAC-VSVg and BAC-rev.

FIG. 2 is a schematic picture about baculovirus-mediated lentivirus production.

FIG. 3 shows the effect of baculovirus (MOI) on the titers of the produced lentiviral particles. Titers were determined by measuring the number of transduced GFP positive cells after different dilutions of the virus using FACS (A).

DESCRIPTION OF THE PREFERRED EMBODIMENTS

Materials and Methods

Constructs needed for the HIV-1 based lentivirus vector production were subcloned to baculovirus donor vectors pFastBac1 (Invitrogen, Carlsbad, Calif., USA) driven by the human cytomegalovirus (CMV) promoter. Lentivirus transfer construct was a third-generation self-inactivating vector expressing GFP marker gene driven by the phosphoglycerate kinase (PGK) promoter. Transfer construct was isolated from plasmid LV1-GFP in two parts and subcloned into pBAC-transfer donor vector polylinker. This PmlI/NheI/PstI/SalI/AfllI/PacI/SpeI/MluI/PmeI/EcoRI/ApaI/SwaI/AscI-polylinker was earlier cloned to the AvrlI site of pFastBac1. The sequence of the polylinker was 5′CACGTGGCTAGCCTGCAGGTCGACCTTAAGTTAATTAAACTAGTACGCGTGTTTA AACGAATTCGGGCCCATTTAAATGGCGCGCC-3′. The donor vector had also red marker gene DsRed cloned under polyhedrin promoter for easy baculovirus tittering (Mähönen et al. unpublished data). First part of the transfer construct was digested by BsrBI and AscI and subcloned to the SwaI/AscI site of the donor vector polylinker. Second part of the insert was digested by AscI and AvrlI and cloned to the AscI and Avr lI site of the modified plasmid.

Packaging construct cassette expressing gag and pot driven by CMV was cut from plasmid pMDLg/pRRE by ApaLI digestion and subcloned into the SmlI site of the pBAC-gag-pot donor vector polylinker. ApaLI ends were blunted by T4 DNA Polymerase (Finnzymes, Helsinki, Finland) before ligation.

VSV-G expressed envelope construct from plasmid pCMV-G was subcloned in two parts to the pBAC-VSV-g donor vector. First part was digested by NotI and EcoRI. NotI end was blunted before EcoRI digestion by T4 DNA Polymerase. This part was subcloned to Smll/EcoRI site of the polylinker. Second part of the construct was digested from pCMV-G by EcoRI and subcloned to the polylinker EcoRI site.

HIV-1 rev protein is essential in production of lentiviruses. Rev cDNA was synthesized by polymerase chain reaction (PCR) from vector pRSV-REV and subcloned to pBAC-rev donor vector under CMV promoter. CMV promoter was earlier digested with NruI and EcoRI from vector pcDNA3 and subcloned to SwaI/EcoRI site of the polylinker. The Rev cDNA is totally 349 bp. The forward primer was 5′CGAAGGAATTCGTCGCCACCATGGCAGGAAGAAGCGGA-3′ (sequence tor nucleotides 1-18 of rev gene in bold, Kozak consensus sequence in italic, EcoRI site underlined) and the reverse primer was 5′AGCTAGCTAGCGTATTCTCCTGACTCCAATATTGT-3′ (sequence 349-325 for nucleotides of rev gene, NheI site underlined). The amplified fragment was then digested with EcoRI and NheI, purified using a Wizard Cleanup kit (Promega, Madison, Wis. USA) and subcloned to EcoRI/NheI site of the polylinker.

Recombinant baculovirus delivery vectors were constructed by Bac-to-bac method according to the manufacturer's instruction (Invitrogen). Viruses were concentrated at high titers and purified as described. The virus titering was determined by end-point dilution assay using sf9 cells (Airenne et al., 2000).

293T were cultured in DMEM suplemented with 10% fetal bovine serum (FBS). Cells were plated 24 h before transduction. Transduction was performed with varying virus concentrations, MOIs (multiplicity of infections) were between 250-1000 pfu per cell. The baculoviruses 8AV-transfer, BAC-gag-poi, BAC-VSVg and BAG-rev were added in the serum-free DMEM. After 4 h incubation at +37° C. fresh medium was changed. The cell supernatant was collected 48 h after transduction and centrifuged at 1500 rpm for 10 min. at room temperature. As a control we prepared lentiviruses also by conventional transient plasmid trasfection into 293T cell (Kankkonen et al., 2004).

The unconcentrated viral supernatant after collection was used to transduce Hela cells with different dilutions. The functional titers of lentiviruses were determined by analysing the number of virus particles able to transduce cells. Titering was performed by FACS analysis (FACS Calibur) as described earlier (Follenzi and Naldini, 2002). The comparison of different production method was done by comparing functional titers of the lentivirus preps. To follow up the lentivirus transgene expression the transduced Hela-cells were cultured 3 months to follow up the GFP expression.

Results

With four baculoviruses at MOI 500, lentivirus titers were on average 6.0×105 TU/ml. Higher titers were obtained with higher baculovirus concentrations. The optimal baculovirus concentration turned out MOI 750 and the lentivirus titers were on average 1.2×108 TU/ml. These results are in line to titers by the commonly used transient calsium-chloride transfection method of four plasmid (average 3.9×106 TU/ml). Decrease of the titer was seen after high baculovirus concentration of MOI 1000, possible due to increased toxicity of the VSVG protein (FIG. 3). To exclude the possibility that the GFP expression comes from the baculovirus expressing the transfer construct the lentivirus transduced cells were grown three months without loosing the GFP expression. Baculovirus is not an integrative vector and gene expression from baculovirus vectors is usually lost after two weeks (Airenne et at. 2000) whereas transgene expression from the integrated lentivirus was stable if no silencing of the transgene cassette occurs Delenda, 2004)

Discussion

In vivo experiments in preclinical large animal models and human clinical trials require large amounts of viral particles. Currently, there is no optimal large scale packaging system available for lentiviruses. Stable large scale vector production systems have been developed but the toxicity of the lentiviral enzymes and the fusogenic VSV-G prohibit constitutive expression and only possible at this moment is to use inducible cell lines (Pacchia et al., 2001; Farson et al., 2001) or replace the most toxic VSV-G with other non-toxic glycoprotein (Kumar et al., 2003). Stable cell lines suffer from the gene silencing that occurs during the long culture periods necessary for sequential addition of packaging constructs. On the contrary, transient plasmid-based production systems are very laborious. Hence none of these systems have proved ideal for the large scale production of lentiviruses and, therefore, new methods are needed.

Baculoviruses have several advantages for vector production. They have a large insert capasity, and are capable of transducing many mammalian cell lines with high efficiency. However, baculoviruses are not able to replicate in mammalian cells and viruses are easy to produce in high titers (Hofmann et at, 1995). Baculoviruses have been widely used In large scale protein production in insect cells and for the production of viral-like particles (VLP), like influence virus-like particles (Galarza et al., 2005), rotavirus-like particles (Shuttleworth et al., 2005) and papillomavirus-like particles (Zheng et al., 2004) in insect cells and hepatitis VLP in mammalian cells (Chen et al., 2005). The goal in VLP production has been vaccine development. Functional intact viruses have also been produced with hybrid baculoviruses in insect cells as well as in mammalian cells: AAV vectors were produced in insect cells and were comparable to 293 mammalian cell-produced AAV (Urabe et al., 2002). In mammalian cells baculovirus-mediated production has been developed for recombinant influence viruses (Poomputsa et al., 2003), AAV (Sollerbrant et al., 2001) and adenoviruses (Cheshenko et al., 2001).

Some attempts have been reported to use hybrid viruses in lentiviral production Lentiviruses have been produced earlier by hybrid adenoviruses in mammalian cells (Kuate et al., 2004). Baculovirus mediated production of lentivirus-like particles in insect cells has also been achieved (Gheysen et al., 1989; Morikawa et al., 1998; Nermut et al., 1994) but the production of functional lentiviruses in insect cells is demanding since the presence of active proteases leads to immature formation of VLPs. Presumably premature protease activity results the degrading the intracellular pool of Gag precursor before particle assembly (Adamson et al., 2003).

In the current study we demonstrate for the first time the generation of functional lentiviruses using hybrid baculoviruses. This study was performed using four recombinant baculoviruses with equal amount of each virus during the transduction. Lentivirus titers produce to baculoviruses were comparable to lentivirus titers produced with conventional four plasmid transfection methods. The method may be improved by optimizing further the amount of each baculovirus in the transduction as is usually done with plasmid transfections. The boor condition of the producing cells was observed when very high doses of baculovirses were used. This was probably due to the VSV-G toxicity since no problems were detected when VSV-G expressing baculovirus was left out and the total number of baculovirus particles were kept the same (data not shown). Baculoviruses used in this study were based on the basic non-modified baculovirus vectors. By using improved 2nd generation baculoviruses together with further optimized transduction conditions should enable the use of less MOI for the lentivirus production. This could include modification of the baculovirus envelope with pseudotyping, adding e.g. WPRE to enhance the transcription or to optimize further medium conditions (Mähönen et al. unpublished data).

Baculoviruses have a large cloning capacity up to 50 kb allowing the possibility to transfering all the elements required for the lentivirus production into one or two baculoviruses. An efficient lentivirus vector production system by a single helper-dependent adenovirus (Kubo and Mitani, 2003) and a retrovirus vector production system by single vaccinia virus (Konetschny et al., 2003) have already been described. However, one of the main problems associated with the use of lentiviral vectors is the possibility for the generation of a pathogenic human viruses and a major concern is how to minimize the risk for the formation of replication-competent lentivirus.

To avoid these problems, all non-essential factors needed for the pathogenesis of lentivirus diseases have been deleted and only the necessary elements required for the transferring of the virus genetic elements (gag, pol and rev) are present in the latest third generation vectors (Dull et al., 1998; Miyoshi et al., 1998). Originally to minimize the risk for the generation of replication-competent lentivirus through recombination the constructs were divided in to four separate plasmids.

However, no replication competent lentivirus was detected in a single virus based production (Kubo and Mitani, 2003). Scott el at recently demonstrated that baculovirseses are efficient in transducing suspension 293-based HEK-F cells in serum-free conditions and production of proteins was even increased in optimized large scale conditions (Scott et al., 2007). The production of lentiviruses via single baculovirus in serum-free large scale conditions should be considered.

In conclusion, our study demonstrates that hybrid baculoviruses may be very useful to solve the problems regarding large scale production of lentivirus vectors. Baculovirus technology offers an attractive possibility to scalable lentivirus production as a result of ease production and concentration of baculoviruses, efficient transduction of suspension mammalian cells in serum free conditions and safety of the baculoviruses.

REFERENCE LIST

  • Adamson, C. S., M. Nermut, and I. M. Jones. 2003. Control of human immunodeficiency virus type-1 protease activity in insect cells expressing Gag-Pol rescues assembly of immature but not mature virus-like particles. Virology 308: 157-165.
  • Airenne, K. J., M .O. Hiltunen, M. P. Turunen, A. M. Turunen, O. H. Laitinen, M. S. Kulomaa, and S. Yla-Herttuala. 2000. Baculovirus-mediated periadventitial gene transfer to rabbit carotid artery. Gene Ther. 7: 1499-1504.
  • Burns, J .C., T. Friedmann, W. Driever, M. Burrascano, and J. K. Yee. 1993. Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors: concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells. Proc. Natl. Acad. Sci. U.S.A. 90: 8033-8037.
  • Chen, Y. H., J. C. Wu, K. C. Wang, Y. W. Chiang, C. W. Lai, Y. C. Chung, and Y. C. Hu. 2005. Baculovirus-mediated production of HDV-like particles in BHK cells using a novel oscillating bioreactor. J. Biotechnol. 118: 135-147.
  • Cheshenko, N., N. Krougliak, R. C. Eisensmith, and V. A. Krougliak. 2001. A novel system for the production of fully deleted adenovirus vectors that does not require helper adenovirus. Gene Ther. 8! 846-854.
  • Delenda, C. 2004. Lentiviral vectors: optimization of packaging, transduction and gene expression. J. Gene Med. 6 Suppl 1: S125-S138.
  • Dull, T., R. Zufferey, M. Kelly, R. J. Mandel, M. Nguyen. D. Trono, and L. Naldini. 1998. A third-generation lentivirus vector with a conditional packaging system. J. Virol. 72; 8463-8471.
  • Farson, D., R. Witt, R. McGuinness, T. Dull, M. Kelly, J. Song, R. Radeke, A. Bukovsky, A. Consiglio, and L. Naldini. 2001. A new-generation stable inducible packaging cell line for lentiviral vectors. Hum. Gene Ther. 12: 981-997.
  • Follenzi, A. and L. Naldini. 2002. Generation of HIV-1 derived lentiviral vectors. Methods Enzymol. 346: 454-465.
  • Galarza, J. M., T. Latham, and A. Cupo. 2005. Virus-like particle vaccine conferred complete protection against a lethal influenza virus challenge. Viral Immunol. 18: 365-372.
  • Gheysen, D., E. Jacobs, F. F. de, C. Thiriart, M. Francotte, D. Thines, and W. M. De. 1989. Assembly and release of HIV-1 precursor Pr55gag virus-like particles from recombinant baculovirus-infected insect cells. Cell 59: 103-112.
  • Hofmann, C., V. Sandig, G. Jennings, M. Rudolph, P. Schlag, and M. Strauss. 1995. Efficient gene transfer into human hepatocytes by baculovirus vectors. Proc. Natl. Acad. Sci. U.S.A. 92: 10099-10103.
  • Kankkonen, H. M., E. Vahakangas, R. A. Marr, T. Pakkanen, A. Laurema, P. Leppanen, J. Jalkanen, I. M. Verma, and S. Yia-Herttuala. 2004. Long-term lowering of plasma cholesterol levels in LDL-receptor-deficient WHHL rabbits by gene therapy. Mol. Ther. 9: 548-556.
  • Konetschny, C., G. W. Holzer, C. Urban, T. Hammerle, J. Mayrhofer, and F. G. Falkner. 2003. Generation of transduction-competent retroviral vectors by infection with a single hybrid vaccinia virus. J. Virol. 77: 7017-7025.
  • Kuate, S., D. Stefanou, D. Hoffmann, O. Wildner, and K. Uberla. 2004. Production of lentiviral vectors by transient expression of minimal packaging genes from recombinant adenoviruses. J. Gene Med. 6: 1197-1205.
  • Kubo, S. and K. Mitani. 2003. A new hybrid system capable of efficient lentiviral vector production and stable gene transfer mediated by a single helper-dependent adenoviral vector. J. Virol. 77: 2964-2971.
  • Kurnar, M., B. P. Bradow, and J. Zimmerberg. 2003. Large-scale production of pseudotyped lentiviral vectors using baculovirus GP64. Hum. Gene Ther. 14: 67-77.
  • Miyoshi, H., U. Blomer, M. Takahashi, F. H. Gage, and I. M. Verma. 1998. Development of a self-inactivating lentivirus vector. J. Virol. 72: 8150-8157.
  • Morikawa, Y., W. H. Zhang, D. J. Hockley, M. V. Nermut, and I. M. Jones. 1998. Detection of a trimeric human immunodeficiency virus type 1 Gag intermediate is dependent on sequences in the matrix protein, p17. J. Virol. 72; 7659-7663.

Nermut, M. V., D. J. Hockley, J. B. Jowett, I. M. Jones, M. Garreau, and D. Thomas. 1994. Fullerene-like organization of HIV gag-protein shell in virus-like particles produced by recombinant baculovirus. Virology 198: 288-296.

  • Pacchia, A. L., M. E. Adlelson, M. Kaul, Y. Ron, and J. P. Dougherty. 2001. An inducible packaging cell system for safe, efficient lentiviral vector production in the absence of HIV-1 accessory proteins. Virology 282: 77-86.
  • Poomputsa, K., G. Kittel, A. Egorov, W. Ernst, and R. Grabherr. 2003. Generation of recombinant influenza virus using baculovirus delivery vector. J. Virol., Methods 110: 111-114.
  • Scott, M. J., S. S. Modha, A. D. Rhodes, N. M. Broadway, P. I. Hardwicke, H. J. Zhao, K. M. Kennedy-Wilson, S. M. Sweitzer, and S. L. Martin. 2007. Efficient expression of secreted proteases via recombinant. BacMam virus. Protein Expr. Purif. 52: 104-116.
  • Shuttleworth, G., D. C. Eckery, and P. Awram. 2005. Oral and intraperitoneal immunization with rotavirus 2/6 virus-like particles stimulates a systemic and mucosal immune response in mice. Arch. Virol. 150: 341-349.
  • Sollerbrant, K., J. Elmen, C. Wahlestedt, J. Acker, H. Leblois-Prehaud, M. Latta-Mahieu, P. Yeh, and M. Perricaudet. 2001. A novel method using baculovirus-mediated gene transfer for production of recombinant adeno-associated virus vectors. J. Gen. Viral. 82: 2051-2060.
  • Urabe, M., C. Ding, and R. M. Kotin. 2002. Insect cells as a factory to produce adeno-associated virus type 2 vectors. Hum. Gene Ther. 13:1935-1943.
  • Zheng, J., J. Ma, X. F. Yang, H. L. Liu, H. W. Cheng, L. S. Si, and Y. L. Wang. 2004. Highly efficient and economical baculovirus expression system for preparing human papillomavirus type 16 virus-like particle. Acta Biochim. Biophys. Sin. (Shanghai) 36: 548-552.

Claims

We claim:

1. A method comprising:

a. Transducing a mammalian cell with a baculovirus to make a transduced mammalian producer cell; and then

b. Culturing said transduced mammalian producer cell in culture media, and harvesting from said transduced mammalian producer cell and/or culture media a second virus having a therapeutic transgene.

2. The method of claim 1, wherein said harvesting comprises harvesting at about 144 hours after said transduction.

3. The method of claim 1, wherein said second virus is derived from a virus which in its wild state has a single-stranded genome.

4. The method of claim 1, wherein said second virus is able to transduce a human cell which is not actively dividing.

5. The method of claim 1, wherein said second virus is replication deficient.

6. The method of claim 1, wherein said second virus can integrate in host genome at specific site and can produce stable long-term expression.

7. The method of claim 1, wherein said second virus is non-immunogenic.

8. A recombinant baculovirus having at least one nucleic acid sequence coding for a second virus derived from a virus which in its wild state has a single stranded genome, said second virus being replication-deficient and having a therapeutic transgene.

9. The recombinant baculovirus of claim 8, wherein said second virus is able to transduce a human cell which is not actively dividing.

10. The recombinant baculovirus of claim 8, wherein said second virus can integrate in the human genome and can produce stable long-term expression in a transduced human cell.

11. A method comprising:

a. Obtaining the recombinant baculovirus of claim 8; and then

b. Transducing a mammalian producer cell with said recombinant baculovirus to make a transduced mammalian producer cell; and then

c. Culturing said transduced mammalian producer cell in culture media, and harvesting said second virus from said transduced mammalian producer cell and/or culture media.

12. A viral vector able to transfect a human cell which is not actively dividing, said viral vector produced by a mammalian producer cell transduced with a recombinant baculovirus.

13. The viral vector of claim 12, wherein said viral vector has a therapeutic transgene.

14. The viral vector of claim 12, said viral vector comprises virus derived from a virus which in its wild state has a single stranded genome.

15. A method comprising:

a. Obtaining the viral vector of claim 12; and

b. Transducing a human patient's cells with said viral vector.

16. A method comprising:

a. Obtaining the viral vector of claim 13; and

b. Transducing a human patient's cells with said viral vector.

17. A method comprising:

a. Obtaining the viral vector of claim 14; and

b. Transducing a human patient's cells with said viral vector.