Patent application title:

Novel Genes Involved In Biosynthesis

Publication number:

US20160138034A1

Publication date:
Application number:

14/860,639

Filed date:

2015-09-21

Abstract:

The invention provides a novel MYB class transcription factor gene (nucleic acid sequences, protein sequences, and variants and fragments thereof) designated MYB14 by the applicants, that is useful for manipulating the production of flavonoids, specifically condensed tannins, in plants. The invention provides the isolated nucleic acid molecules encoding proteins with at least 70% identity to any one of MYB14 polypeptide sequences of SEQ ID NO: 14 and 46 to 54. The invention also provides, constructs, vectors, host cells, plant cells and plants genetically modified to contain the polynucleotide. The invention also provides methods for producing plants with altered flavonoid, specifically condensed tannin production, making use of the MYB14 nucleic acid molecules of the invention.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N15/82 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a continuation of pending U.S. application Ser. No. 13/224,720, filed Sep. 2, 2011, which is a continuation-in-part of pending U.S. application Ser. No. 12/996,117, which has a 371(c) date of Apr. 6, 2011, which is a National Stage Application filed under 35 U.S.C. §371 of PCT Application No. PCT/NZ2009/000099, filed on Jun. 5, 2009 and published in English on Dec. 10, 2009 as WO 2009/148336, which claims priority to U.S. Provisional Application 61/059,691, filed on Jun. 6, 2008, and New Zealand Application 568928, filed on Jun. 6, 2008, all of which are incorporated by reference in their entireties to the extent there is no inconsistency with the present disclosure.

TECHNICAL FIELD

The invention relates to a novel gene(s) involved in biosynthesis. In particular, the present invention relates to gene(s) encoding a regulatory factor controlling the expression of key genes involved in the production of flavonoids including condensed tannins in plants.

BACKGROUND ART

The Molecular Phenylpropanoid Pathway

The phenylpropanoid pathway (shown in FIG. 1) produces an array of secondary metabolites including flavones, anthocyanins, flavonoids, condensed tannins and isoflavonoids (Dixon et al., 1996; 2005). In particular, the condensed tannin (CT) biosynthetic pathway shares its early steps with the anthocyanin pathway before diverging to proanthocyanindin biosynthesis.

Anthocyanidins are precursors of flavan-3-ols (e.g. (−)-epicatechin), which are important building blocks for CTs. These cis-flavan-3-ols are formed from anthocyanidins by anthocyanidin reductase (ANR), which has been cloned from many species including A. thaliana and M. truncatula (Xie et al., 2003; 2004). In A. thaliana (−)-epicatechin is the exclusive CT monomer (Abrahams et al., 2002), but in many other species, including legumes, both (+)- and (−)-flavan-3-ols are polymerized to CTs. The biosynthesis of these alternate (+)-flavan-3-ols (catechins) is catalysed by leucoanthocyanidin reductase (LAR). This enzyme has been cloned and characterized from legumes including the CT-rich legume tree Desmodium uncinatum (Tanner et al., 2003), as well as from other species such as grapes and apples (Pfeiffer et al., 2006). The enzyme catalyses the reduction of leucopelargonidin, leucocyanidin, and leucodelphinidin to afzelechin, catechin, and gallocatechin, respectively. No homologues of LAR have been found in A. thaliana, consistent with the exclusive presence of (−)-epicatechin derived CT building blocks in this plant.

Whereas information on TF regulation of this pathway in Arabidopsis seeds is well defined, TFs that control leaf CT biosynthesis within the tribe of Trifolieae have yet to be identified. An important family of TF proteins, the MYB family, controls a diverse range of functions including the regulation of secondary metabolism such as the anthocyanin and CT pathways in plants. The expression of the MYB TF AtTT2 coordinately turns on or off the late structural genes in Arabidopsis thaliana, ultimately controlling the expression of the CT pathway.

An array of Arabidopsis thaliana transparent testa (TT) mutants (Winkel-Shirley, 2002; Debeaujon et al., 2001) and tannin deficient seed (TDS) mutants (Abrahams et al. 2002; 2003) have been made—all being deficient in CT accumulation in the seed coat. Molecular genetic studies of these mutants has allowed for the identification of a number of structural genes and transcription factors (TFs) that regulate the expression and tissue specificity of both anthocyanin and CT synthesis in A. thaliana (Walker et al., 1999; Nesi et al., 2000; 2002).

Although most of the structural genes within the CT pathway have been identified in a range of legumes, attempts to manipulate CT biosynthesis in leaves by engineering the expression of these individual genes has failed so far. The major reason for this is that not one (or a few) enzyme(s) are rate-limiting, but that activity of virtually all enzymes in a pathway has to be increased to achieve an overall increased flux into specific end-products such as condensed tannins.

Transcription factors (TFs) are regulatory proteins that act as repressors or activators of metabolic pathways. TFs can therefore be used as a powerful tool for the manipulation of entire metabolic pathways in plants. Many MYB TFs are important regulators of the phenylpropanoid pathway including both the anthocyanin and condensed tannin biosynthesis (Debaujon et al; 2003; Davies and Schwinn, 2003). For example, the A. thaliana TT2 (AtTT2) gene encodes an R2R3-MYB TF factor which is solely expressed in the seed coat during early stages of embryogenesis, when condensed tannin biosynthesis occurs (Nesi et al., 2001). TT2 has been shown to regulate the expression of the flavonoid late biosynthetic structural genes TT3 (DFR), TT18, TT12 (MATE protein) and ANR during the biosynthesis and storage of CTs. AtTT2 partially determines the stringent spatial and temporal expression of genes, in combination with two other TFs; namely TT8 (bHLH protein) and TTG1 (WD-40 repeat protein; Baudry et al., 2004).

Other MYB TFs in Vitis vinifera; grape (VvMYBPA1) Birdsfoot trefoil and Brassica napus (BnTT2) that are involved in the regulation of CT biosynthesis have also recently been reported (Wei et al., 2007; Bogs et al., 2007; Yoshida et al., 2008).

The AtTT2 gene has also been shown to share a degree of similarity to the rice (Oryza sativa) OsMYB3, the maize (Zea mays) ZmC1, AmMYBROSEA from Antirrhinum majus and PhMYBAN2 from Petunia hybrida, genes which have been shown to regulate anthocyanin biosynthesis (Stracke et al., 2001; Mehrtens et al., 2005).

Condensed Tannins

Condensed tannins (CTs) also called proanthocyanidins (PAs) are colourless polymers, one of several secondary plant metabolites. CTs are polymers of 2 to 50 (or more) flavonoid units (see compound (I) below) that are joined by carbon-carbon bonds which are not susceptible to being cleaved by hydrolysis. The base flavonoid structure is:

Condensed tannins are located in a range of plant parts, for example; the leaves, stem, flowers, roots, wood products, bark, buds. CTs are generally found in vacuoles or on the surface epidermis of the plant

Condensed Tannins in Forage Plants

Forage plants, such as forage legumes, are beneficial in pasture-based livestock systems because they improve both the intake and quality of the animal diet. Also, their value to the nitrogen (N) economy of pastures and to ruminant production are considerable (Caradus et al., 2000). However, while producing a cost-effective source of feed for grazing ruminants, pasture is often sub-optimal when it comes to meeting the nutritional requirements of both the rumen microflora and the animal itself. Thus the genetic potential of grazing ruminants for meat, wool or milk production is rarely achieved on a forage diet.

New Zealand pastures contain up to 20% white clover, while increasing the levels of white clover in pastures helps address this shortfall, it also exacerbates the incidence of bloat. White clover (Trifolium repens), red clover (Trifolium pretense) and lucerne (Medicago sativa) are well documented causes of bloat, due to the deficiency of plant polyphenolic compounds, such as CT, in these species. Therefore the development of forage cultivars producing higher levels of tannins in plant tissue would be a important development in the farming Industry to reduce the incidence of bloat (Burggraaf et al., 2006).

In particular, condensed tannins, if present in sufficient amounts, not only helps eliminate bloat, but also strongly influences plant quality, palatability and nutritive value of forage legumes and can therefore help improve animal performance. The animal health and productivity benefits reported from increased levels of CTs include increased ovulation rates in sheep, increased liveweight gain, wool growth and milk production, changed milk composition and improved anthelmintic effects on gastrointestinal parasites (Rumbaugh, 1985; Marten et al., 1987; Niezen et al., 1993; 1995; Tanner et al., 1994; McKenna, 1994; Douglas et al., 1995; Waghorn et al., 1998; Aerts et al., 1999; McMahon et al., 2000; Molan et al., 2001; Sykes and Coop, 2001).

A higher level of condensed tannin also represents a viable solution to reducing greenhouse gases (methane, nitrous oxide) released into the environment by grazing ruminants (Kingston-Smith and Thomas, 2003). Ruminant livestock produce at least 88% of New Zealand's total methane emissions and are a major contributor of greenhouse gas emissions (Clark, 2001). The principle source of livestock methane is enteric fermentation in the digestive tract of ruminants. Methane production, which represents an energy loss to ruminants of around 3 to 9% of gross energy intake (Blaxter and Clapperton, 1965), can be reduced by as much as 5% by improving forage quality. Forage high in CT has been shown to reduce methane emission from grazing animals (Woodward, et al 2001; Puchala, et al., 2005). Increasing the CT content of pasture plants can therefore contribute directly to reduced levels of methane emission from livestock.

Therefore, the environmental and agronomical benefits that could be derived from triggering the accumulation of even a moderate amount of condensed tannins in forage plants including white clover are of considerable importance in the protection and nutrition of ruminants (Damiani et al., 1999).

Legumes

It is the inventors understanding that the regulation of CT foliar-specific pathway in Trifolium legumes, involving the interaction of regulatory transcription factors (TFs) with the pathway, remains unknown. Modification or manipulation of this pathway to influence the amount CT has been explored but, as the process is not straightforward, there has been little firm success in understanding this pathway.

The clover genus, Trifolium, for example, is one of the largest genera in the family Leguminosae (D Fabaceae), with ca. 255 species (Ellison et al., 2006). Only two Trifolium species; T. affine (also known as Trifolium preslianum Boiss. Is) and T. arvense (also known as hare-foot clover) are known to accumulate high levels of foliar CTs (Fay and Dale, 1993). Although significant levels of CTs are present in white clover flower heads (Jones et al., 1976), only trace amounts can be detected in leaf trichomes (Woodfield et al., 1998). Several approaches including gene pool screening and random mutagenesis have failed to provide white or red clover plants with increased levels of foliar CTs (Woodfield et al., 1998).

Genetic Manipulation of Condensed Tannins

The inventors in relation to US2006/012508 created a transgenic alfalfa plant using the TT2 MYB regulatory gene and managed to surprisingly produce CTs constitutively throughout the root tissues. However, importantly, the inventors were unable to achieve CT accumulation in the leaves of this forage legume. It has been previously reported no known circumstances exist that can induce proanthocyanidins (CTs) in alfalfa forage (Ray et al., 2003). The authors of this paper assessed amongst other things whether the LC myc-like regulatory gene (TF) from maize or the C1 myb regulatory gene (TF) from maize could stimulate the flavonoid pathway in alfalfa forage and seed coat. The authors of this paper found that only the LC gene, and not C1 could stimulate anthocyanin and proanthocyanidin biosynthesis in alfalfa forage, but stimulation only occurred in the presence of an unknown stress-responsive alfalfa factor.

Studies assessing condensed tannin production in Lotus plants using a maize bHLH regulatory gene (TF) found that transformation of this TF into Lotus plants resulted in CT's only a very small (1%) increase in levels of condensed tannins in leaves (Robbins et al., 2003).

Previous attempts to alter and enhance agriculturally important compounds in white clover involved altering anthocyanin biosynthesis-derived from the phenylpropanoid pathway. Despite attermpts to activate this pathway using several heterologous myc and MYB TFs only one success has been reported, using the maize myc TF B-Peru (de Majnik et al., 2000). All other TFs investigated resulted in poor or no regenerants, implying a deleterious effect from their over-expression.

More recently, TT2 homologs derived from the high-CT legume, Lotus japonicus, have been reported (Yoshida et al., 2008). Bombardment of these genes into A. thaliana leaf cells has shown transient expression resulting in detectable expression of ANR and limited CT accumulation as detected by DMACA. However, these genes have not been transformed and analysed in any legume species.

The expression of the maize Lc gene resulted in the accumulation of PA-like compounds in alfalfa only if the plants were under abiotic stress (Ray et al., 2003). The co-expression of three transcription factors, TT2, PAP1 and Lc in Arabidopsis was required to overcome cell-type-specific expression of PAs, but this constitutive accumulation of PAs was accompanied by death of the plants (Sharma and Dixon, 2005).

Introduction of PAs into plants by combined expression of a MYB family transcription factor and anthocyanidin reductase for conversion of anthocyanidin into (epi)-flavan-3-ol has been attempted by Xie et al. (2006).

This attempt to increase the levels of proanthocyanidins (PAs) in the leaves of tobacco by co-expressing PAP1 (a MYB TF) and ANR were reported as having levels of PAs in tobacco that if translated to alfalfa may potentially provide bloat protection (Xie et al., 2006). Anthocyanin-containign leaves of transgenic M. truncatula constitutively expressing MtANR contained up to three times more PAs than those of wild-type plants at the same stage of development, and these compounds were of a specific subset of PA oligomers. Additionally, these levels of PA produced in M. truncatula fell well short of those necessary for an improved agronomic benefit. The authors state that it remained unclear which additional biosynthetic and non-biosynthetic genes will be needed for engineering of PAs in any specific plant tissue that does naturally accumulate the compounds.

Similar difficulties in expressing CTs or PAs in leaves were also encountered when the TT2 and/or BAN genes were transformed into alfalfa—refer US 2004/0093632 and US 2006/0123508.

Condensed Tannins Useful in Natural Health Products

The use of any flavonoid including proanthocyanidins to form food supplements, compositions or medicaments is also widely known. For example;

    • US patent application NO: 2003/0180406 describes a method using polyphenol compositions specifically derived from cocoa to improve cognitive function.
    • Patent publication WO 2005/044291 describes use of grape seed (Vitus genus) to prevent degenerative brain diseases including; stroke, cerebral concussion, Huntington's disease, CJD, Alzheimer's, Parkinsons, and senile dementia.
    • Patent publication WO 2005/067915 discloses a synergistic combination of flavonoids and hydroxystilbenes (synthetic or from green tea) combined with flavones, flavonoids, proanthocyanidins and anthocyanidins (synthetic or from bark extract) to reduce neuronal degeneration associated with disease states such as dementia, Alzheimer's, cerebrovascular disease, age-related cognitive impairment and depression.
    • U.S. Pat. No. 5,719,178 describes use of proanthocyanidin extract to treat ADHD.
    • PCT publication number 06/126895 describes a composition containing bark extract from the genus Pinus to improve, or prevent a decline in, human cognitive abilities or improve, or prevent symptoms of, neurological disorders in a human.

None of the above considers use of legumes as a raw material source of CT.

It would therefore be useful if there could be provided nucleic acid molecules and polypeptides useful in studying the metabolic pathways involved in flavonoids and/or condensed tannin biosynthesis.

It would also be useful if there could be provided nucleic acid molecules and polypeptides which are capable of altering levels of flavonoids and/or condensed tannins in plants or parts thereof.

In particular, it would be useful if there could be provided nucleic acid molecules which can be used to produce flavonoids and/or condensed tannins in plants or parts thereof de novo.

It is therefore one object of the invention to provide a method to increase CT levels in the leaves of forage legume species. The identification of the gene also provides a method to prevent CT accumulation in legume species which produce detrimental high levels of CT in leaves or seeds.

It would also be useful if there could be provided nucleic acid molecules which can be used alone or together with other nucleic acid molecules to produce plants, particularly forages and legumes, with enhanced levels of flavonoids and/or condensed tannins.

It is an object of the present invention to address the foregoing problems or at least to provide the public with a useful choice.

SUMMARY OF THE INVENTION

The present invention is concerned with the identification and uses of a novel MYB gene and associated polypeptide which has been termed by the inventors ‘MYB14’ which has been isolated by the applicants and shown to be involved in the production of flavonoid compounds including condensed tannins.

Throughout this specification the nucleic acid molecules and polypeptides of the present invention may be designated by the descriptor MYB14.

The present invention contemplates the use of MYB14 independently or together with other nucleic acid molecules to manipulate the flavonoid/condensed tannin biosynthetic pathway in plants.

Polynucleotides Encoding Polypeptides

In the one aspect the invention provides an isolated nucleic acid molecule encoding a MYB14 polypeptide as herein defined, or a functional variant or fragment thereof.

In one embodiment the MYB14 polypeptide comprises the sequence of SEQ ID NO: 15.

In one embodiment the MYB14 polypeptide comprises the sequence of SEQ ID NO: 17.

In one embodiment the MYB14 polypeptide comprises the sequence of SEQ ID NO: 15 and SEQ ID NO: 17, but lacks the sequence of SEQ ID NO: 16.

In a further embodiment the MYB14 polypeptide comprises a sequence with at least 70% identity to any one of SEQ ID NO: 14 and 46 to 54.

In a further embodiment the MYB14 polypeptide comprises a sequence with at least 70% identity to SEQ ID NO: 14.

In a further embodiment the MYB14 polypeptide comprises the sequence of any one of SEQ ID NO: 14 and 46 to 54.

In a further embodiment the MYB14 polypeptide comprises the sequence of SEQ ID NO: 14.

In a further embodiment the MYB14 polypeptide regulates the production of flavonoids in a plant.

In a further embodiment the flavonoids are condensed tannins.

In a further embodiment the MYB14 polypeptide regulates at least one gene in the flavonoid biosynthetic pathway in a plant.

In a further embodiment the MYB14 polypeptide regulates at least one gene in the condensed tannin biosynthetic pathway in a plant.

In a further embodiment the functional fragment has substantially the same activity as the MYB14 polypeptide.

In a further embodiment the functional fragment comprises an amino acid sequence with at least 70% identity to SEQ ID NO: 17.

In a further embodiment the functional fragment comprises the amino acid sequence of SEQ ID NO: 17.

In a further aspect invention provides a nucleic acid molecule encoding a polypeptide comprising an amino acid sequence substantially as shown in SEQ ID NO: 17.

In a further aspect invention provides a nucleic acid molecule encoding a polypeptide having an amino acid sequence substantially as shown in SEQ ID NO: 17.

In a further aspect invention provides a nucleic acid molecule encoding a polypeptide comprising an amino acid sequence substantially as shown in SEQ ID NO: 14.

In a further aspect invention provides a nucleic acid molecule encoding a polypeptide having an amino acid sequence substantially as shown in SEQ ID NO: 14.

In a further aspect invention provides an isolated nucleic acid molecule encoding a polypeptide comprising 3′ amino acid sequence motif as set forth in SEQ ID NO: 17

Polynucleotides

In a further aspect invention provides an isolated nucleic acid molecule having a nucleotide sequence selected from the group consisting of:

    • a) at least one of SEQ ID NO: 1 to 13 and 55 to 64, or a combination thereof;
    • b) a complement of the sequence(s) in a);
    • c) a functional fragment or variant of the sequence(s) in a) or b);
    • d) a homolog or an ortholog of the sequence(s) in a), b), or c);
    • e) an antisense sequence to a RNA sequence obtained from a sequence in a), b), c) or d).

In one embodiment the variant has at least 70% identity to the coding sequence of the specified sequence.

In a further embodiment the variant has at least 70% identity to the specified sequence.

In a further embodiment the fragment comprises the coding sequence of the specified sequence.

In a further aspect invention provides an isolated nucleic acid molecule having a nucleotide sequence selected from the group consisting of:

    • a) SEQ ID NO: 1, 2 or 55;
    • b) a complement of the sequence(s) in a);
    • c) a functional fragment or variant of the sequence(s) in a) or b);
    • d) a homolog or an ortholog of the sequence(s) in a), b), or c);
    • e) an antisense sequence to a RNA sequence obtained from a sequence in a), b), c) or d).

In one embodiment the variant has at least 70% identity to the coding sequence of the specified sequence.

In a further embodiment the variant has at least 70% identity to the specified sequence.

In a further embodiment the fragment comprises the coding sequence of the specified sequence.

In a further embodiment isolated nucleic acid molecule comprises the sequence of SEQ ID NO: 2.

In a further embodiment isolated nucleic acid molecule comprises the sequence of SEQ ID NO: 1.

In a further embodiment isolated nucleic acid molecule comprises the sequence of SEQ ID NO:55.

Probes

In a further aspect the invention provides a probe capable of binding to a nucleic acid of the invention

According to another aspect of the present invention there is a probe capable of binding to a 3′ domain of the MYB14 nucleic acid molecule substantially as described above.

In one embodiment the probe is capable of binding to a nucleic acid molecule that encodes the amino acid sequence of SEQ ID NO: 17, or to a complement of the nucleic acid molecule.

In one embodiment the probe is capable of binding to the nucleic acid molecule, or complement thereof under stringent hybridisation conditions.

According to a further aspect of the present invention there is provided a probe to a 3′ sequence encoding the motif as set forth in SEQ ID NO: 17.

Primers

In a further aspect the invention provides a primer capable of binding to a nucleic acid of the invention

According to another aspect of the present invention there is a primer capable of binding to a 3′ domain of the MYB14 nucleic acid molecule substantially as described above.

In one embodiment the probe is capable of binding to a nucleic acid molecule that encodes the amino acid sequence of SEQ ID NO: 15, or to a complement of the nucleic acid molecule.

In one embodiment the probe is capable of binding to the nucleic acid molecule, or complement thereof under PCR conditions.

According to a further aspect of the present invention there is provided a primer to a nucleic acid encoding a 3′ sequence encoding the motif as set forth in SEQ ID NO: 17.

Polypeptides

In the one aspect the invention provides a MYB14 polypeptide as herein defined, or a functional fragment thereof.

In one embodiment the MYB14 polypeptide comprises the sequence of SEQ ID NO: 15 and SEQ ID NO: 17, but lacks the sequence of SEQ ID NO: 16.

In a further aspect the invention provides an isolated polypeptide having an amino acid sequence selected from the group consisting of:

    • a) any one of SEQ ID NO: 14 and 46 to 54;
    • b) a functional fragment or variant of the sequence listed in a).

In a further embodiment the variant comprises a sequence with at least 70% identity to any one of SEQ ID NO: 14 and 46 to 54.

In a further embodiment the variant comprises a sequence with at least 70% identity to SEQ ID NO: 14.

In a further embodiment the MYB14 polypeptide comprises the sequence of any one of SEQ ID NO: 14 and 46 to 54.

In a further embodiment the MYB14 polypeptide comprises the sequence of SEQ ID NO: 14.

In a further embodiment the MYB14 polypeptide regulates the production of flavonoids in a plant.

In a further embodiment the flavonoids are condensed tannins.

In a further embodiment the MYB14 polypeptide regulates at least one gene in the flavonoid biosynthetic pathway in a plant.

In a further embodiment the MYB14 polypeptide regulates the condensed tannin biosynthetic pathway in a plant.

In a further embodiment the MYB14 polypeptide regulates at least one gene in the condensed tannin biosynthetic pathway in a plant.

In a further embodiment the functional fragment has substantially the same activity as the MYB14 polypeptide.

According to another aspect of the present invention there is provided an isolated polypeptide having an amino acid sequence selected from the group consisting of:

    • a) SEQ ID NO: 14;
    • b) a functional fragment or variant of the sequence listed in a).

According to another aspect of the present invention there is provided an isolated polypeptide comprising a 3′ amino acid sequence motif as set forth in SEQ ID NO: 17.

According to another aspect of the present invention there is provided an isolated polypeptide having a 3′ amino acid sequence motif as set forth in SEQ ID NO: 17.

According to a further aspect of the present invention there is provided an isolated MYB14 polypeptide or a functional fragment thereof wherein said MYB14 polypeptide includes an amino acid sequence motif of subgroup 5 as shown in SEQ ID NO: 15 as well as an amino acid sequence 3′ motif as shown in SEQ ID NO: 17 but which lacks an amino acid sequence motif of subgroup 6 as shown in SEQ ID NO: 16.

According to another aspect of the present invention there is provided an isolated polypeptide encoded by a nucleic acid molecule having a nucleotide sequence selected from those set forth in any one of SEQ ID NO:1 to 13 and 55 to 64.

According to another aspect of the present invention there is provided an isolated polypeptide encoded by a nucleic acid molecule having a nucleotide sequence as set forth in either SEQ ID NO: 1, 2 or 55.

In a further aspect the invention provides a nucleic acid molecule comprising a sequence encoding a polypeptide of the invention.

Constructs

According to a further aspect of the present invention there is provided a construct including a nucleotide sequence substantially as described above.

According to a further aspect of the present invention, there is provided a construct which includes:

    • at least one promoter; and
    • a nucleic acid molecule substantially as described above;
      wherein the promoter is operably linked to the nucleic acid molecule to control the expression of the nucleic acid molecule.

Preferably, the construct may include one or more other nucleic acid molecules of interest and/or one or more further regulatory sequences, such as inter alia terminator sequences.

Most preferably, the nucleic acid molecule in the construct may have a nucleotide sequence selected from SEQ ID NO: 1, 2 or 55.

Host Cells

According to a further aspect of the present invention there is provided a host cell which has been altered from the wild type to include a nucleic acid molecule substantially as described above.

In one embodiment the nucleic acid is part of a genetic construct of the invention.

In one embodiment the host cell does not form part of a human being.

In a further embodiment the host cell is a plant cell.

Plant Cells and Plants

According to a further aspect of the present invention there is provided a plant or plant cell transformed with a construct substantially as described above.

According to a further aspect of the present invention there is provided a plant transformed with a construct substantially as described above.

According to a further aspect of the present invention there is provided a plant or part thereof which has been altered from the wild type to include a nucleic acid molecule substantially as described above.

According to a further aspect of the present invention, there is provided a plant cell, plant or part thereof which has been manipulated via altered expression of a MYB14 gene to have increased or decreased levels of flavonoids and/or condensed tannins than a corresponding wild-type plant or part thereof.

According to a further aspect of the present invention, there is provided a plant cell, plant cell which has been manipulated via altered expression of a MYB14 gene to have increased or decreased levels of flavonoids and/or condensed tannins than a corresponding wild-type plant cell.

According to a further aspect of the present invention, there is provided a leaf of a plant which via altered expression of a MYB14 gene to have increased levels of flavonoids and/or condensed tannins than a corresponding wild-type plant or part thereof.

According to a further aspect of the present invention, there is provided the progeny of a plant cell or a plant substantially as described above which via altered expression of a MYB14 gene has increased or decreased to levels of flavonoids and/or condensed tannins than a corresponding wild-type plant cell or plant.

According to a further aspect of the present invention there is provided the seed of a transgenic plant substantially as described above.

Compositions

According to a further aspect of the present invention, there is provided a composition which includes an ingredient which is, or is obtained from, a plant and/or part thereof, wherein said plant or part thereof has been manipulated via altered expression of a MYB14 gene to have increased or decreased levels of flavonoids and/or condensed tannins compared to those of a corresponding wild type plant or part thereof.

Methods Using Polynucleotides

According to a further aspect of the present invention there is provided the use of a nucleic acid molecule substantially as described above to alter a plant or plant cell.

According to a further aspect of the present invention there is provided a method for producing an altered plant or plant cell using a nucleic acid molecule substantially as described above.

In one embodiment the plant or plant cell is altered in the production of flavonoids, or an intermediate in the production of flavonoids.

In a further embodiment the flavonoids include at least one condensed tannin.

In a further embodiment the condensed tannin is selected from catechin, epicatechin, epigallocatechin and gallocatechin.

In a preferred embodiment the alteration is an increase.

In a further embodiment the plant or plant cell is altered in expression of at least one enzyme in a flavonoid biosynthetic pathway.

In one embodiment the flavonoid biosynthetic pathway is the condensed tannin biosynthetic pathway.

In a preferred embodiment the altered expression is increased expression.

In a further embodiment the enzyme is LAR or ANR.

In a further embodiment the plant is altered in the expression of both LAR and ANR.

The plant may be any plant, and the plant cell may be from any plant.

In one embodiment the plant is a forage crop plant.

In a further embodiment the plant is a legumionous plant.

In one embodiment the altered production or expression, described above, is in substantially all tissues of the plant.

In one embodiment the altered production or expression, described above, is in the foliar tissue of the plant.

In one embodiment the altered production or expression, described above, is in the vegetative portions of the plant.

In one embodiment the altered production or expression, described above, is in the epidermal tissues of the plant.

For the purposes of this specification, the epidermal tissue refers to the outer single-layered group of cells, including the leaf, stems, and roots and young tissues of a vascular plant.

In one embodiment the altered production flavonoids, described above, is in a tissue of the plant that is substantially devoid of the flavonoids.

In one embodiment the altered production condensed tannins described above is in a tissue of the plant that is substantially devoid of the condensed tannins.

Therefore, in some embodiments of the invention, the production of flavonoids or condnesed tannins is de novo production.

In one embodiment the nucleic acid encodes a MYB14 protein as herein defined.

In a further embodiment the nucleic acid encodes a protein comprising an amino acid sequence as set forth in any one of SEQ ID NOs 1-13 and 55 to 64, or fragment or variant thereof.

In a further embodiment the nucleic acid comprises a sequence substantially as set forth in any one of SEQ ID NOs 1-13 and 55 to 64, or fragment or variant thereof.

In a further embodiment the nucleic acid comprises a sequence substantially as set forth in SEQ ID NOs 1, 2 or 55, or fragment or variant thereof.

In a further embodiment the nucleic acid is part of a construct substantially as described above.

In one embodiment the plant is altered by transforming the plant with the nucleic acid or construct.

In a further embodiment the plant is altered by manipulating the genome of a plant so as to express increase or decrease levels of the nucleic acid, or fragment or variant thereof, in the plant compared to that produced in a corresponding wild-type plant or plant thereof.

According to a further aspect of the present invention there is provided the use of a nucleic acid molecule or polypeptide of the present invention to identify other related flavonoid and/or condensed tannin regulatory genes/polypeptides.

According to a further aspect of the present invention there is provided the use of a nucleic acid molecule substantially as described above to alter a plant or plant cell wherein said plant is, or plant cell is from, a forage crop.

In one embodiment the plant is altered in production of condensed tannins.

In one embodiment the plant has increased production of condensed tannins.

Preferably, the forage crop may be a forage legume.

According to a further aspect of the present invention there is provided the use of a nucleic acid molecule substantially as described above to alter the levels of flavonoids or condensed tannins in leguminous plants or leguminous plant cells.

Preferably, the levels of condensed tannins are altered.

Preferably, the levels of condensed tannins are altered in foliar tissue.

According to a further aspect of the present invention there is provided the use of nucleic acid sequence information substantially as set forth in any one of SEQ ID NO: 1-13 and 55 to 64 to alter the flavonoid or condensed tannin biosynthetic pathway in planta.

According to a further aspect of the present invention there is provided the use of nucleic acid sequence information substantially as set forth in any one of SEQ ID NO:1, 2 and 55 to alter the flavonoid or condensed tannin biosynthetic pathway in planta.

According to a further aspect of the present invention there is provided use of a construct substantially as described above to transform a leguminous plant or plant cell to alter the levels of flavonoids and/or condensed tannins in the vegetative portions of the leguminous plant or plant cell.

According to a further aspect of the present invention, there is provided a method of altering flavonoids and/or condensed tannins production within a leguminous plant or part thereof, including the step of manipulating the genome of a plant so as to express increased or decreased levels a of leguminous MYB14 gene, or fragment or variant thereof, in the plant compared to that produced in a corresponding wild-type plant or plant thereof.

According to a further aspect of the present invention, there is provided a method of altering flavonoids and/or condensed tannins production within a leguminous plant or part thereof, including the step of manipulating the genome of a plant so as to express increased or decreased levels a of leguminous MYB14 gene, or fragment or variant thereof, in the plant compared to that produced in a corresponding wild-type plant or plant thereof.

According to a further aspect of the present invention, there is provided the use of a nucleic acid molecule to produce flavonoids or condensed tannins in planta in a leguminous plant or part thereof de novo.

According to a further aspect of the present invention, there is provided the use of a nucleic acid molecule substantially as described above to manipulate in a leguminous plant or part thereof the flavonoids and/or condensed tannin biosynthetic pathway in planta.

According to a further aspect of the present invention, there is provided the use of a construct substantially as described above, to manipulate the flavonoids and/or condensed tannin biosynthetic pathway in planta.

According to a further aspect of the present invention, there is provided the use of a MYB14 gene having a nucleic acid sequence substantially corresponding to a nucleic acid molecule of the present invention to manipulate the biosynthetic pathway in planta.

According to a further aspect of the present invention, there is provided the use of a nucleic acid molecule substantially as described above to produce a flavonoid and/or condensed tannin, enzyme, intermediate or other chemical compound associated with the flavonoid and/or condensed tannin biosynthetic pathway.

According to a further aspect of the present invention, there is provided a method of manipulating the flavonoid and/or condensed tannin biosynthetic pathway characterized by the step of altering a nucleic acid substantially as described above to produce a gene encoding a non-functional polypeptide.

According another aspect there is provided the use of an isolated nucleic acid molecule of the present invention in planta to manipulate the levels of LAR and/or ANR within a leguminous plant or plant cell.

According another aspect there is provided the use of an isolated nucleic acid molecule of the present invention in planta to manipulate the levels of catechin and/or epicatechin or other tannin monomer (epigallocatechin or gallocatechin) within a leguminous plant or plant cell.

According to a further aspect of the present invention there is provided the use of a nucleic acid molecule or polypeptide to identify other related flavonoid and/or condensed tannin regulatory genes/polypeptides.

In one embodiment, the whole of the plant tissue may be manipulated. In an alternative embodiment, the epidermal tissue of the plant may be manipulated. For the purposes of this specification, the epidermal tissue refers to the outer single-layered group of cells, the leaf, stems, and roots and young tissues of a vascular plant.

Most preferably, the levels of flavonoids and/or condensed tannins altered by the present invention are sufficient to provide a therapeutic or agronomic benefit to a subject consuming the plant with altered levels of flavonoids and/or condensed tannins.

Plants Produced Via the Methods

In a further embodiment the invention provides a plant produced by a method of the invention.

In a further embodiment the invention provides a part, seed, fruit, harvested material, propagule or progeny of a plant of any the invention.

In a further embodiment the part, seed, fruit, harvested material, propagule or progeny of the plant is genetically modified to comprise at least one nucleic acid molecule of the invention, or a construct of the invention.

In one embodiment, the transformed plant cells, plants or ancestors thereof, are transformed by any transformation method.

In a further embodiment, the transformed plant cells, plants or ancestors thereof, are transformed by agrobacterium-mediated transformation. Source of nucleic acids and proteins of the invention

The nucleic acids and proteins of the invention may derived from any plant, as described below, or may be synthetically or recombinantly produced.

Plants

The plant cells and plants of the invention, or those transformed or manipulated in methods and uses of the inventions, may be from any species.

In one embodiment the plant cell or plant, is derived from a gymnosperm plant species

In a further embodiment the plant cell or plant, is derived from an angiosperm plant species.

In a further embodiment the plant cell or plant, is derived from a from dicotyledonous plant species.

In a further embodiment the plant cell or plant, is derived from a monocotyledonous plant species.

Preferably the plants are from dicotyledonous species.

Other preferred plants are forage plant species from a group comprising but not limited to the following genera: Lolium, Festuca, Dactylis, Bromus, Thinopyrum, Trifolium, Medicago, Pheleum, Phalaris, Holcus, Lotus, Plantago and Cichorium.

Other preferred plants are leguminous plants. The leguminous plant or part thereof may encompass any plant in the plant family Leguminosae or Fabaceae. For example, the plants may be selected from forage legumes including, alfalfa, clover; leucaena; grain legumes including, beans, lentils, lupins, peas, peanuts, soy bean; bloom legumes including lupin, pharmaceutical or industrial legumes; and fallow or green manure legume species.

A particularly preferred genus is Trifolium.

Preferred Trifolium species include Trifolium repens; Trifolium arvense; Trifolium affine; and Trifolium occidentale.

A particularly preferred Trifolium species is Trifolium repens.

Another preferred genus is Medicago.

Preferred Medicago species include Medicago sativa and Medicago truncatula.

A particularly preferred Medicago species is Medicago sativa, commonly known as alfalfa.

Another preferred genus is Glycine.

Preferred Glycine species include Glycine max and Glycine wightii (also known as Neonotonia wightii)

A particularly preferred Glycine species is Glycine max, commonly known as soy bean

A particularly preferred Glycine species is Glycine wightii, commonly known as perennial soybean.

Another preferred genus is Vigna.

Preferred Vigna species include Vigna unguiculata

A particularly preferred Vigna species is Vigna unguiculata commonly known as cowpea.

Another preferred genus is Mucana.

Preferred Mucana species include Mucana pruniens

A particularly preferred Mucana species is Mucana pruniens commonly known as velvetbean.

Another preferred genus is Arachis

Preferred Mucana species include Arachis glabrata

A particularly preferred Arachis species is Arachis glabrata commonly known as perennial peanut.

Another preferred genus is Pisum

Preferred Pisum species include Pisum sativum

A particularly preferred Pisum species is Pisum sativum commonly known as pea.

Another preferred genus is Lotus

Preferred Lotus species include Lotus corniculatus, Lotus pedunculatus, Lotus glabar, Lotus tenuis and Lotus uliginosus.

A particularly preferred Lotus species is Lotus comiculatus commonly known as Birdsfoot Trefoil.

A particularly preferred Lotus species is Lotus glabar commonly known as Narrow-leaf Birdsfoot Trefoil

A particularly preferred Lotus species is Lotus pedunculatus commonly known as Big trefoil.

A particularly preferred Lotus species is Lotus tenuis commonly known as Slender trefoil.

Another preferred genus is Brassica.

Preferred Brassica species include Brassica oleracea

A particularly preferred Brassica species is Brassica oleracea, commonly known as forage kale and cabbage.

The term ‘plant’ as used herein refers to the plant in its entirety, and any part thereof, may include but is not limited to: selected portions of the plant during the plant life cycle, such as plant seeds, shoots, leaves, bark, pods, roots, flowers, fruit, stems and the like. A preferred ‘part thereof’ is leaves.

DETAILED DESCRIPTION OF THE INVENTION

In this specification where reference has been made to patent specifications, other external documents, or other sources of information, this is generally for the purpose of providing a context for discussing the features of the invention. Unless specifically stated otherwise, reference to such external documents is not to be construed as an admission that such documents, or such sources of information, in any jurisdiction, are prior art, or form part of the common general knowledge in the art.

The term “comprising” as used in this specification and claims means “consisting at least in part of”; that is to say when interpreting statements in this specification and claims which include “comprising”, the features prefaced by this term in each statement all need to be present but other features can also be present. Related terms such as “comprise” and “comprised” are to be interpreted in similar manner. However, in preferred embodiments comprising can be replaced with consisting.

The term “MYB14 polypeptide” refers to an R2R3 class MYB transcription factor.

Preferably the MYB14 polypeptide comprises a sequence with at least 70% identity to any one of SEQ ID NO: 14 and 46 to 54.

Preferably the MYB14 polypeptide comprises the sequence motif of SEQ ID NO:15

Preferably the MYB14 polypeptide comprises the sequence motif of SEQ ID NO:17

More preferably the MYB14 polypeptide comprises the sequence of SEQ ID NO: 15 and SEQ ID NO: 17, but lacks the sequence of SEQ ID NO: 16.

Preferably MYB14 polypeptide comprises a sequence with at least 70% identity to SEQ ID NO: 14.

A “MYB14 gene” is a gene, by the standard definition of gene, that encodes a MYB14 polypeptide.

The term “MYB transcription factor” is a term well understood by those skilled in the art to refer to a class of transcription factors characterised by a structurally conserved DNA binding domain consisting of single or multiple imperfect repeats.

The term “R2R3 transcription factor” or “MYB transcription with an R2R3 DNA binding domain” is a term well understood by those skilled in the art to refer to MYB transcription factors of the two-repeat class.

The terms ‘proanthocyanidins’ and ‘condensed tannins’ may be used interchangeably throughout the specification

The term “sequence motif” as used herein means a stretch of amino acids or nucleotides. Preferably the stretch of amino acids or nucleotides is contiguous.

The term “altered” with respect to a plant with “altered production” or “altered expression”, means altereded relative to the same plant, or plant of the same type, in the non-transformed state.

The term “altered” may mean increased or decreased. Preferably altered is increased

Polynucleotides and Fragments

The term “polynucleotide(s),” as used herein, means a single or double-stranded deoxyribonucleotide or ribonucleotide polymer of any length but preferably at least 15 nucleotides, and include as non-limiting examples, coding and non-coding sequences of a gene, sense and antisense sequences complements, exons, introns, genomic DNA, cDNA, pre-mRNA, mRNA, rRNA, siRNA, miRNA, tRNA, ribozymes, recombinant polypeptides, isolated and purified naturally occurring DNA or RNA sequences, synthetic RNA and DNA sequences, nucleic acid probes, primers and fragments.

The term “polynucleotide” can be used interchangably with “nucleic acid molecule”.

A “fragment” of a polynucleotide sequence provided herein is a subsequence of contiguous nucleotides that is preferably at least 15 nucleotides in length. The fragments of the invention preferably comprises at least 20 nucleotides, more preferably at least 30 nucleotides, more preferably at least 40 nucleotides, more preferably at least 50 nucleotides and most preferably at least 60 contiguous nucleotides of a polynucleotide of the invention. A fragment of a polynucleotide sequence can be used in antisense, gene silencing, triple helix or ribozyme technology, or as a primer, a probe, included in a microarray, or used in polynucleotide-based selection methods.

Preferably fragments of polynucleotide sequences of the invention comprise at least 25, more preferably at least 50, more preferably at least 75, more preferably at least 100, more preferably at least 150, more preferably at least 200, more preferably at least 300, more preferably at least 400, more preferably at least 500, more preferably at least 600, more preferably at least 700, more preferably at least 800, more preferably at least 900, more preferably at least 1000 contiguous nucleotides of the specified polynucleotide.

The term “primer” refers to a short polynucleotide, usually having a free 3′OH group, that is hybridized to a template and used for priming polymerization of a polynucleotide complementary to the template. Such a primer is preferably at least 5, more preferably at least 6, more preferably at least 7, more preferably at least 9, more preferably at least 10, more preferably at least 11, more preferably at least 12, more preferably at least 13, more preferably at least 14, more preferably at least 15, more preferably at least 16, more preferably at least 17, more preferably at least 18, more preferably at least 19, more preferably at least 20 nucleotides in length.

The term “probe” refers to a short polynucleotide that is used to detect a polynucleotide sequence, that is complementary to the probe, in a hybridization-based assay. The probe may consist of a “fragment” of a polynucleotide as defined herein. Preferably such a probe is at least 5, more preferably at least 10, more preferably at least 20, more preferably at least 30, more preferably at least 40, more preferably at least 50, more preferably at least 100, more preferably at least 200, more preferably at least 300, more preferably at least 400 and most preferably at least 500 nucleotides in length.

Polypeptides and Fragments

The term “polypeptide”, as used herein, encompasses amino acid chains of any length but preferably at least 5 amino acids, including full-length proteins, in which amino acid residues are linked by covalent peptide bonds. The polypeptides may be purified natural products, or may be produced partially or wholly using recombinant or synthetic techniques. The term may refer to a polypeptide, an aggregate of a polypeptide such as a dimer or other multimer, a fusion polypeptide, a polypeptide fragment, a polypeptide variant, or derivative thereof.

A “fragment” of a polypeptide is a subsequence of the polypeptide that performs a function that is required for the biological activity and/or provides three dimensional structure of the polypeptide. The term may refer to a polypeptide, an aggregate of a polypeptide such as a dimer or other multimer, a fusion polypeptide, a polypeptide fragment, a polypeptide variant, or derivative thereof capable of performing the above activity.

The term “isolated” as applied to the polynucleotide or polypeptide sequences disclosed herein is used to refer to sequences that are removed from their natural cellular environment. An isolated molecule may be obtained by any method or combination of methods including biochemical, recombinant, and synthetic techniques.

The term “derived from” with respect to a polynucleotide or polypeptide sequence being derived from a particular genera or species, means that the sequence has the same sequence as a polynucleotide or polypeptide sequence found naturally in that genera or species. The sequence, derived from a particular genera or species, may therefore be produced synthetically or recombinantly.

Variants

As used herein, the term “variant” refers to polynucleotide or polypeptide sequences different from the specifically identified sequences, wherein one or more nucleotides or amino acid residues is deleted, substituted, or added. Variants may be naturally occurring allelic variants, or non-naturally occurring variants. Variants may be from the same or from other species and may encompass homologues, paralogues and orthologues. In certain embodiments, variants of the inventive polynucleotides and polypeptides possess biological activities that are the same or similar to those of the inventive polynucleotides or polypeptides. The term “variant” with reference to polynucleotides and polypeptides encompasses all forms of polynucleotides and polypeptides as defined herein.

Polynucleotide Variants

Variant polynucleotide sequences preferably exhibit at least 50%, more preferably at least 51%, more preferably at least 52%, more preferably at least 53%, more preferably at least 54%, more preferably at least 55%, more preferably at least 56%, more preferably at least 57%, more preferably at least 58%, more preferably at least 59%, more preferably at least 60%, more preferably at least 61%, more preferably at least 62%, more preferably at least 63%, more preferably at least 64%, more preferably at least 65%, more preferably at least 66%, more preferably at least 67%, more preferably at least 68%, more preferably at least 69%, more preferably at least 70%, more preferably at least 71%, more preferably at least 72%, more preferably at least 73%, more preferably at least 74%, more preferably at least 75%, more preferably at least 76%, more preferably at least 77%, more preferably at least 78%, more preferably at least 79%, more preferably at least 80%, more preferably at least 81%, more preferably at least 82%, more preferably at least 83%, more preferably at least 84%, more preferably at least 85%, more preferably at least 86%, more preferably at least 87%, more preferably at least 88%, more preferably at least 89%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, and most preferably at least 99% identity to a specified polynucleotide sequence. Identity is found over a comparison window of at least 20 nucleotide positions, more preferably at least 50 nucleotide positions, more preferably at least 100 nucleotide positions, more preferably at least 200 nucleotide positions, more preferably at least 300 nucleotide positions, more preferably at least 400 nucleotide positions, more preferably at least 500 nucleotide positions, more preferably at least 600 nucleotide positions, more preferably at least 700 nucleotide positions, more preferably at least 800 nucleotide positions, more preferably at least 900 nucleotide positions, more preferably at least 1000 nucleotide positions and most preferably over the entire length of the specified polynucleotide sequence.

Polynucleotide sequence identity can be determined in the following manner. The subject polynucleotide sequence is compared to a candidate polynucleotide sequence using BLASTN (from the BLAST suite of programs, version 2.2.5 [November 2002]) in bl2seq (Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences—a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250), which is publicly available from NCBI (ftp<dot>ncbi<dot>nih<dot>gov/blast/). The default parameters of bl2seq are utilized except that filtering of low complexity parts should be turned off.

The identity of polynucleotide sequences may be examined using the following unix command line parameters:


bl2seq-i nucleotideseq1-j nucleotideseq2-FF-p blastn

The parameter -F F turns off filtering of low complexity sections. The parameter -p selects the appropriate algorithm for the pair of sequences. The bl2seq program reports sequence identity as both the number and percentage of identical nucleotides in a line “Identities=”.

Polynucleotide sequence identity may also be calculated over the entire length of the overlap between a candidate and subject polynucleotide sequences using global sequence alignment programs (e.g. Needleman, S. B. and Wunsch, C. D. (1970) J. Mol. Biol. 48, 443-453). A full implementation of the Needleman-Wunsch global alignment algorithm is found in the needle program in the EMBOSS package (Rice, P. Longden, I. and Bleasby, A. EMBOSS: The European Molecular Biology Open Software Suite, Trends in Genetics June 2000, vol 16, No 6. pp. 276-277) which can be obtained from www<dot>hgmp<dot>mrc<dot>ac<dot>uk/Software/EMBOSS/. The European Bioinformatics Institute server also provides the facility to perform EMBOSS-needle global alignments between two sequences on line at www<dot>ebi<dot>ac<dot>uk/emboss/align/.

Alternatively the GAP program, which computes an optimal global alignment of two sequences without penalizing terminal gaps, may be used to calculate sequence identity. GAP is described in the following paper: Huang, X. (1994) On Global Sequence Alignment. Computer Applications in the Biosciences 10, 227-235.

Sequence identity may also be calculated by aligning sequences to be compared using Vector NTI version 9.0, which uses a Clustal W algorithm (Thompson et al., 1994, Nucleic Acids Research 24, 4876-4882), then calculating the percentage sequence identity between the aligned sequences using Vector NTI version 9.0 (Sep. 2, 2003 ©1994-2003 InforMax, licenced to Invitrogen).

Polynucleotide variants of the present invention also encompass those which exhibit a similarity to one or more of the specifically identified sequences that is likely to preserve the functional equivalence of those sequences and which could not reasonably be expected to have occurred by random chance. Such sequence similarity with respect to polynucleotides may be determined using the publicly available bl2seq program from the BLAST suite of programs (version 2.2.5 [November 2002]) from NCBI (ftp<dot>ncbi<dot>nih<dot>gov/blast/).

The similarity of polynucleotide sequences may be examined using the following unix command line parameters:


bl2seq-i nucleotideseq1-j nucleotideseq2-FF-p tblastx

The parameter -F F turns off filtering of low complexity sections. The parameter -p selects the appropriate algorithm for the pair of sequences. This program finds regions of similarity between the sequences and for each such region reports an “E value” which is the expected number of times one could expect to see such a match by chance in a database of a fixed reference size containing random sequences. The size of this database is set by default in the bl2seq program. For small E values, much less than one, the E value is approximately the probability of such a random match.

Variant polynucleotide sequences preferably exhibit an E value of less than 1×10−10 more preferably less than 1×10−20, more preferably less than 1×10−30, more preferably less than 1×10−40, more preferably less than 1×10−50 more preferably less than 1×10−60 more preferably less than 1×10−70 more preferably less than 1×10−80 more preferably less than 1×10−90 and most preferably less than 1×10−100 when compared with any one of the specifically identified sequences.

Alternatively, variant polynucleotides of the present invention hybridize to a specified polynucleotide sequence, or complements thereof under stringent conditions.

The term “hybridize under stringent conditions”, and grammatical equivalents thereof, refers to the ability of a polynucleotide molecule to hybridize to a target polynucleotide molecule (such as a target polynucleotide molecule immobilized on a DNA or RNA blot, such as a Southern blot or Northern blot) under defined conditions of temperature and salt concentration. The ability to hybridize under stringent hybridization conditions can be determined by initially hybridizing under less stringent conditions then increasing the stringency to the desired stringency.

With respect to polynucleotide molecules greater than about 100 bases in length, typical stringent hybridization conditions are no more than 25 to 30° C. (for example, 10° C.) below the melting temperature (Tm) of the native duplex (see generally, Sambrook et al., Eds, 1987, Molecular Cloning, A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press; Ausubel et al., 1987, Current Protocols in Molecular Biology, Greene Publishing,). Tm for polynucleotide molecules greater than about 100 bases can be calculated by the formula Tm=81.5+0.41% (G+C-log (Na+). (Sambrook et al., Eds, 1987, Molecular Cloning, A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press; Bolton and McCarthy, 1962, PNAS 84:1390). Typical stringent conditions for polynucleotide of greater than 100 bases in length would be hybridization conditions such as prewashing in a solution of 6×SSC, 0.2% SDS; hybridizing at 65° C., 6×SSC, 0.2% SDS overnight; followed by two washes of 30 minutes each in 1×SSC, 0.1% SDS at 65° C. and two washes of 30 minutes each in 0.2×SSC, 0.1% SDS at 65° C.

With respect to polynucleotide molecules having a length less than 100 bases, exemplary stringent hybridization conditions are 5 to 10° C. below Tm. On average, the Tm of a polynucleotide molecule of length less than 100 bp is reduced by approximately (500/oligonucleotide length)° C.

With respect to the DNA mimics known as peptide nucleic acids (PNAs) (Nielsen et al., Science. 1991 Dec. 6; 254(5037):1497-500) Tm values are higher than those for DNA-DNA or DNA-RNA hybrids, and can be calculated using the formula described in Giesen et al., Nucleic Acids Res. 1998 Nov. 1; 26(21):5004-6. Exemplary stringent hybridization conditions for a DNA-PNA hybrid having a length less than 100 bases are 5 to 10° C. below the Tm.

Variant polynucleotides such as those in constructs of the invention encoding proteins to be expressed, also encompasses polynucleotides that differ from the specified sequences but that, as a consequence of the degeneracy of the genetic code, encode a polypeptide having similar activity to a polypeptide encoded by a polynucleotide of the present invention. A sequence alteration that does not change the amino acid sequence of the polypeptide is a “silent variation”. Except for ATG (methionine) and TGG (tryptophan), other codons for the same amino acid may be changed by art recognized techniques, e.g., to optimize codon expression in a particular host organism.

Polynucleotide sequence alterations resulting in conservative substitutions of one or several amino acids in the encoded polypeptide sequence without significantly altering its biological activity are also contemplated. A skilled artisan will be aware of methods for making phenotypically silent amino acid substitutions (see, e.g., Bowie et al., 1990, Science 247, 1306).

Variant polynucleotides due to silent variations and conservative substitutions in the encoded polypeptide sequence may be determined using the publicly available bl2seq program from the BLAST suite of programs (version 2.2.5 [November 2002]) from NCBI (ftp<dot>ncbi<dot>nih<dot>gov/blast/) via the tblastx algorithm as previously described.

Polypeptide Variants

The term “variant” with reference to polypeptides encompasses naturally occurring, recombinantly and synthetically produced polypeptides. Variant polypeptide sequences preferably exhibit at least 50%, more preferably at least 51%, more preferably at least 52%, more preferably at least 53%, more preferably at least 54%, more preferably at least 55%, more preferably at least 56%, more preferably at least 57%, more preferably at least 58%, more preferably at least 59%, more preferably at least 60%, more preferably at least 61%, more preferably at least 62%, more preferably at least 63%, more preferably at least 64%, more preferably at least 65%, more preferably at least 66%, more preferably at least 67%, more preferably at least 68%, more preferably at least 69%, more preferably at least 70%, more preferably at least 71%, more preferably at least 72%, more preferably at least 73%, more preferably at least 74%, more preferably at least 75%, more preferably at least 76%, more preferably at least 77%, more preferably at least 78%, more preferably at least 79%, more preferably at least 80%, more preferably at least 81%, more preferably at least 82%, more preferably at least 83%, more preferably at least 84%, more preferably at least 85%, more preferably at least 86%, more preferably at least 87%, more preferably at least 88%, more preferably at least 89%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, and most preferably at least 99% identity to a sequences of the present invention. Identity is found over a comparison window of at least 20 amino acid positions, preferably at least 50 amino acid positions, more preferably at least 100 amino acid positions, and most preferably over the entire length of a polypeptide of the invention.

Polypeptide sequence identity can be determined in the following manner. The subject polypeptide sequence is compared to a candidate polypeptide sequence using BLASTP (from the BLAST suite of programs, version 2.2.5 [November 2002]) in bl2seq, which is publicly available from NCBI (ftp<dot>ncbi<dot>nih<dot>gov/blast/). The default parameters of bl2seq are utilized except that filtering of low complexity regions should be turned off.

Polypeptide sequence identity may also be calculated over the entire length of the overlap between a candidate and subject polynucleotide sequences using global sequence alignment programs. EMBOSS-needle (available at www<dot>ebi<dot>ac<dot>uk/emboss/align/) and GAP (Huang, X. (1994) On Global Sequence Alignment. Computer Applications in the Biosciences 10, 227-235) as discussed above are also suitable global sequence alignment programs for calculating polypeptide sequence identity.

Sequence identity may also be calculated by aligning sequences to be compared using Vector NTI version 9.0, which uses a Clustal W algorithm (Thompson et al., 1994, Nucleic Acids Research 24, 4876-4882), then calculating the percentage sequence identity between the aligned polypeptide sequences using Vector NTI version 9.0 (Sep. 2, 2003 ©1994-2003 InforMax, licenced to Invitrogen).

Polypeptide variants of the present invention also encompass those which exhibit a similarity to one or more of the specifically identified sequences that is likely to preserve the functional equivalence of those sequences and which could not reasonably be expected to have occurred by random chance. Such sequence similarity with respect to polypeptides may be determined using the publicly available bl2seq program from the BLAST suite of programs (version 2.2.5 [November 2002]) from NCBI (ftp<dot>ncbi<dot>nih<dot>gov/blast/). The similarity of polypeptide sequences may be examined using the following unix command line parameters:


bl2seq-i peptideseq1-j peptideseq2-FF-p blastp

Variant polypeptide sequences preferably exhibit an E value of less than 1×10−6 more preferably less than 1×10−9, more preferably less than 1×10−12, more preferably less than 1×10−15, more preferably less than 1×10−18, more preferably less than 1×10−21, more preferably less than 1×10−30, more preferably less than 1×10−40, more preferably less than 1×10−50, more preferably less than 1×10−60, more preferably less than 1×10−70, more preferably less than 1×10−80, more preferably less than 1×10−90 and most preferably 1×10−100 when compared with any one of the specifically identified sequences.

The parameter -F F turns off filtering of low complexity sections. The parameter -p selects the appropriate algorithm for the pair of sequences. This program finds regions of similarity between the sequences and for each such region reports an “E value” which is the expected number of times one could expect to see such a match by chance in a database of a fixed reference size containing random sequences. For small E values, much less than one, this is approximately the probability of such a random match.

Conservative substitutions of one or several amino acids of a described polypeptide sequence without significantly altering its biological activity are also included in the invention. A skilled artisan will be aware of methods for making phenotypically silent amino acid substitutions (see, e.g., Bowie et al., 1990, Science 247, 1306).

Constructs, Vectors and Components Thereof

The term “genetic construct” refers to a polynucleotide molecule, usually double-stranded DNA, which may have inserted into it another polynucleotide molecule (the insert polynucleotide molecule) such as, but not limited to, a cDNA molecule. A genetic construct may contain a promoter polynucleotide including the necessary elements that permit transcribing the insert polynucleotide molecule, and, optionally, translating the transcript into a polypeptide. The insert polynucleotide molecule may be derived from the host cell, or may be derived from a different cell or organism and/or may be a synthetic or recombinant polynucleotide. Once inside the host cell the genetic construct may become integrated in the host chromosomal DNA. The genetic construct may be linked to a vector.

The term “vector” refers to a polynucleotide molecule, usually double stranded DNA, which is used to transport the genetic construct into a host cell. The vector may be capable of replication in at least one additional host system, such as E. coli.

The term “expression construct” refers to a genetic construct that includes the necessary elements that permit transcribing the insert polynucleotide molecule, and, optionally, translating the transcript into a polypeptide.

An expression construct typically comprises in a 5′ to 3′ direction:

    • a) a promoter functional in the host cell into which the construct will be transformed,
    • b) the polynucleotide to be expressed, and
    • c) a terminator functional in the host cell into which the construct will be transformed.

The term “coding region” or “open reading frame” (ORF) refers to the sense strand of a genomic DNA sequence or a cDNA sequence that is capable of producing a transcription product and/or a polypeptide under the control of appropriate regulatory sequences. The coding sequence is identified by the presence of a 5′ translation start codon and a 3′ translation stop codon. When inserted into a genetic construct, a “coding sequence” is capable of being expressed when it is operably linked to promoter and terminator sequences.

The term “operably-linked” means that the sequenced to be expressed is placed under the control of regulatory elements that include promoters, tissue-specific regulatory elements, temporal regulatory elements, enhancers, repressors and terminators.

The term “noncoding region” includes to untranslated sequences that are upstream of the translational start site and downstream of the translational stop site. These sequences are also referred to respectively as the 5′ UTR and the 3′ UTR. These sequences may include elements required for transcription initiation and termination and for regulation of translation efficiency. The term “noncoding” also includes intronic sequences within genomic clones.

Terminators are sequences, which terminate transcription, and are found in the 3′ untranslated ends of genes downstream of the translated sequence. Terminators are important determinants of mRNA stability and in some cases have been found to have spatial regulatory functions.

The term “promoter” refers to a polynucleotide sequence capable of regulating or driving the expression of a polynucleotide sequence to which the promoter is operably linked in a cell, or cell free transcription system. Promoters may comprise cis-initiator elements which specify the transcription initiation site and conserved boxes such as the TATA box, and motifs that are bound by transcription factors.

Methods for Isolating or Producing Polynucleotides

The polynucleotide molecules of the invention can be isolated by using a variety of techniques known to those of ordinary skill in the art. By way of example, such polynucleotides can be isolated through use of the polymerase chain reaction (PCR) described in Mullis et al., Eds. 1994 The Polymerase Chain Reaction, Birkhauser, incorporated herein by reference. The polynucleotides of the invention can be amplified using primers, as defined herein, derived from the polynucleotide sequences of the invention.

Further methods for isolating polynucleotides of the invention, or useful in the methods of the invention, include use of all or portions, of the polynucleotides set forth herein as hybridization probes. The technique of hybridizing labeled polynucleotide probes to polynucleotides immobilized on solid supports such as nitrocellulose filters or nylon membranes, can be used to screen the genomic. Exemplary hybridization and wash conditions are: hybridization for 20 hours at 65° C. in 5.0×SSC, 0.5% sodium dodecyl sulfate, 1×Denhardt's solution; washing (three washes of twenty minutes each at 55° C.) in 1.0×SSC, 1% (w/v) sodium dodecyl sulfate, and optionally one wash (for twenty minutes) in 0.5×SSC, 1% (w/v) sodium dodecyl sulfate, at 60° C. An optional further wash (for twenty minutes) can be conducted under conditions of 0.1×SSC, 1% (w/v) sodium dodecyl sulfate, at 60° C.

The polynucleotide fragments of the invention may be produced by techniques well-known in the art such as restriction endonuclease digestion, oligonucleotide synthesis and PCR amplification.

A partial polynucleotide sequence may be used, in methods well-known in the art to identify the corresponding full length polynucleotide sequence and/or the whole gene/and/or the promoter. Such methods include PCR-based methods, 5′RACE (Frohman M A, 1993, Methods Enzymol. 218: 340-56) and hybridization-based method, computer/database—based methods. Further, by way of example, inverse PCR permits acquisition of unknown sequences, flanking the polynucleotide sequences disclosed herein, starting with primers based on a known region (Triglia et al., 1998, Nucleic Acids Res 16, 8186, incorporated herein by reference). The method uses several restriction enzymes to generate a suitable fragment in the known region of a polynucleotide. The fragment is then circularized by intramolecular ligation and used as a PCR template. Divergent primers are designed from the known region. Promoter and flanking sequences may also be isolated by PCR genome walking using a GenomeWalker™ kit (Clontech, Mountain View, Calif.), following the manufacturers instructions. In order to physically assemble full-length clones, standard molecular biology approaches can be utilized (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987).

It may be beneficial, when producing a transgenic plant from a particular species, to transform such a plant with a sequence or sequences derived from that species. The benefit may be to alleviate public concerns regarding cross-species transformation in generating transgenic organisms. Additionally when down-regulation of a gene is the desired result, it may be necessary to utilise a sequence identical (or at least highly similar) to that in the plant, for which reduced expression is desired. For these reasons among others, it is desirable to be able to identify and isolate orthologues of a particular gene in several different plant species. Variants (including orthologues) may be identified by the methods described.

Methods for Identifying Variants

Physical Methods

Variant polynucleotides may be identified using PCR-based methods (Mullis et al., Eds. 1994 The Polymerase Chain Reaction, Birkhauser).

Alternatively library screening methods, well known to those skilled in the art, may be employed (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987). When identifying variants of the probe sequence, hybridization and/or wash stringency will typically be reduced relatively to when exact sequence matches are sought.

Computer-Based Methods

Polynucleotide and polypeptide variants may also be identified by computer-based methods well-known to those skilled in the art, using public domain sequence alignment algorithms and sequence similarity search tools to search sequence databases (public domain databases include Genbank, EMBL, Swiss-Prot, PIR and others). See, e.g., Nucleic Acids Res. 29: 1-10 and 11-16, 2001 for examples of online resources. Similarity searches retrieve and align target sequences for comparison with a sequence to be analyzed (i.e., a query sequence). Sequence comparison algorithms use scoring matrices to assign an overall score to each of the alignments.

An exemplary family of programs useful for identifying variants in sequence databases is the BLAST suite of programs (version 2.2.5 [November 2002]) including BLASTN, BLASTP, BLASTX, tBLASTN and tBLASTX, which are publicly available from (ftp<dot>ncbi<dot>nih<dot>gov/blast/) or from the National Center for Biotechnology Information (NCBI), National Library of Medicine, Building 38A, Room 8N805, Bethesda, Md. 20894 USA. The NCBI server also provides the facility to use the programs to screen a number of publicly available sequence databases. BLASTN compares a nucleotide query sequence against a nucleotide sequence database. BLASTP compares an amino acid query sequence against a protein sequence database. BLASTX compares a nucleotide query sequence translated in all reading frames against a protein sequence database. tBLASTN compares a protein query sequence against a nucleotide sequence database dynamically translated in all reading frames. tBLASTX compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database. The BLAST programs may be used with default parameters or the parameters may be altered as required to refine the screen.

The use of the BLAST family of algorithms, including BLASTN, BLASTP, and BLASTX, is described in the publication of Altschul et al., Nucleic Acids Res. 25: 3389-3402, 1997.

The “hits” to one or more database sequences by a queried sequence produced by BLASTN, BLASTP, BLASTX, tBLASTN, tBLASTX, or a similar algorithm, align and identify similar portions of sequences. The hits are arranged in order of the degree of similarity and the length of sequence overlap. Hits to a database sequence generally represent an overlap over only a fraction of the sequence length of the queried sequence.

The BLASTN, BLASTP, BLASTX, tBLASTN and tBLASTX algorithms also produce “Expect” values for alignments. The Expect value (E) indicates the number of hits one can “expect” to see by chance when searching a database of the same size containing random contiguous sequences. The Expect value is used as a significance threshold for determining whether the hit to a database indicates true similarity. For example, an E value of 0.1 assigned to a polynucleotide hit is interpreted as meaning that in a database of the size of the database screened, one might expect to see 0.1 matches over the aligned portion of the sequence with a similar score simply by chance. For sequences having an E value of 0.01 or less over aligned and matched portions, the probability of finding a match by chance in that database is 1% or less using the BLASTN, BLASTP, BLASTX, tBLASTN or tBLASTX algorithm.

Multiple sequence alignments of a group of related sequences can be carried out with CLUSTALW (Thompson, J. D., Higgins, D. G. and Gibson, T. J. (1994) CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22:4673-4680, www-igbmc<dot>u-strasbg<dot>fr/Biolnfo/ClustalW/Top <dot>html) or T-COFFEE (Cedric Notredame, Desmond G. Higgins, Jaap Heringa, T-Coffee: A novel method for fast and accurate multiple sequence alignment, J. Mol. Biol. (2000) 302: 205-217)) or PILEUP, which uses progressive, pairwise alignments. (Feng and Doolittle, 1987, J. Mol. Evol. 25, 351).

Pattern recognition software applications are available for finding motifs or signature sequences. For example, MEME (Multiple Em for Motif Elicitation) finds motifs and signature sequences in a set of sequences, and MAST (Motif Alignment and Search Tool) uses these motifs to identify similar or the same motifs in query sequences. The MAST results are provided as a series of alignments with appropriate statistical data and a visual overview of the motifs found. MEME and MAST were developed at the University of California, San Diego.

PROSITE (Bairoch and Bucher, 1994, Nucleic Acids Res. 22, 3583; Hofmann et al., 1999, Nucleic Acids Res. 27, 215) is a method of identifying the functions of uncharacterized proteins translated from genomic or cDNA sequences. The PROSITE database (www<dot>expasy<dot>org/prosite) contains biologically significant patterns and profiles and is designed so that it can be used with appropriate computational tools to assign a new sequence to a known family of proteins or to determine which known domain(s) are present in the sequence (Falquet et al., 2002, Nucleic Acids Res. 30, 235). Prosearch is a tool that can search SWISS-PROT and EMBL databases with a given sequence pattern or signature.

Function of Variants

The function of the polynucleotides/polypeptides of the invention can be tested using methods provided herein. In particular, see Example 7.

Methods for Producing Constructs and Vectors

The genetic constructs of the present invention comprise one or more polynucleotide sequences of the invention and/or polynucleotides encoding polypeptides disclosed, and may be useful for transforming, for example, bacterial, fungal, insect, mammalian or particularly plant organisms. The genetic constructs of the invention are intended to include expression constructs as herein defined.

Methods for producing and using genetic constructs and vectors are well known in the art and are described generally in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987; Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing, 1987).

Methods for Producing Host Cells Comprising Constructs and Vectors

The invention provides a host cell which comprises a genetic construct or vector of the invention. Host cells may be derived from, for example, bacterial, fungal, insect, mammalian or plant organisms.

Host cells comprising genetic constructs, such as expression constructs, of the invention are useful in methods well known in the art (e.g. Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987; Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing, 1987) for recombinant production of polypeptides. Such methods may involve the culture of host cells in an appropriate medium in conditions suitable for or conducive to expression of a polypeptide of the invention. The expressed recombinant polypeptide, which may optionally be secreted into the culture, may then be separated from the medium, host cells or culture medium by methods well known in the art (e.g. Deutscher, Ed, 1990, Methods in Enzymology, Vol 182, Guide to Protein Purification).

Methods for Producing Plant Cells and Plants Comprising Constructs and Vectors

The invention further provides plant cells which comprise a genetic construct of the invention, and plant cells modified to alter expression of a polynucleotide or polypeptide. Plants comprising such cells also form an aspect of the invention.

Methods for transforming plant cells, plants and portions thereof with polynucleotides are described in Draper et al., 1988, Plant Genetic Transformation and Gene Expression. A Laboratory Manual, Blackwell Sci. Pub. Oxford, p. 365; Potrykus and Spangenburg, 1995, Gene Transfer to Plants. Springer-Verlag, Berlin; and Gelvin et al., 1993, Plant Molecular Biol. Manual. Kluwer Acad. Pub. Dordrecht. A review of transgenic plants, including transformation techniques, is provided in Galun and Breiman, 1997, Transgenic Plants. Imperial College Press, London.

The following are representative publications disclosing genetic transformation protocols that can be used to genetically transform the following plant species: Rice (Alam et al., 1999, Plant Cell Rep. 18, 572); apple (Yao et al., 1995, Plant Cell Reports 14, 407-412); maize (U.S. Pat. Nos. 5,177,010 and 5,981,840); wheat (Ortiz et al., 1996, Plant Cell Rep. 15, 1996, 877); tomato (U.S. Pat. No. 5,159,135); potato (Kumar et al., 1996 Plant J. 9: 821); cassava (Li et al., 1996 Nat. Biotechnology 14, 736); lettuce (Michelmore et al., 1987, Plant Cell Rep. 6, 439); tobacco (Horsch et al, 1985, Science 227, 1229); cotton (U.S. Pat. Nos. 5,846,797 and 5,004,863); perennial ryegrass (Bajaj et al., 2006, Plant Cell Rep. 25, 651); grasses (U.S. Pat. Nos. 5,187,073, 6,020,539); peppermint (Niu et al., 1998, Plant Cell Rep. 17, 165); citrus plants (Pena et al., 1995, Plant Sci. 104, 183); caraway (Krens et al, 1997, Plant Cell Rep, 17, 39); banana (U.S. Pat. No. 5,792,935); soybean (U.S. Pat. Nos. 5,416,011; 5,569,834; 5,824,877; 5,563,04455 and 5,968,830); pineapple (U.S. Pat. No. 5,952,543); poplar (U.S. Pat. No. 4,795,855); monocots in general (U.S. Pat. Nos. 5,591,616 and 6,037,522); brassica (U.S. Pat. Nos. 5,188,958; 5,463,174 and 5,750,871); and cereals (U.S. Pat. No. 6,074,877); pear (Matsuda et al., 2005, Plant Cell Rep. 24(1):45-51); Prunus (Ramesh et al., 2006, Plant Cell Rep. 25(8):821-8; Song and Sink 2005, Plant Cell Rep. 2006; 25(2):117-23; Gonzalez Padilla et al., 2003, Plant Cell Rep. 22(1):38-45); strawberry (Oosumi et al., 2006, Planta; 223(6):1219-30; Folta et al., 2006, Planta. 2006 Apr. 14; PMID: 16614818), rose (Li et al., 2003, Planta. 218(2):226-32), Rubus (Graham et al., 1995, Methods Mol Biol. 1995; 44:129-33). Clover (Voisey et al., 1994, Plant Cell Reports 13: 309-314, and Medicago (Bingham, 1991, Crop Science 31: 1098). Transformation of other species is also contemplated by the invention. Suitable methods and protocols for transformation of other species are available in the scientific literature.

Methods for Genetic Manipulation of Plants

A number of strategies for genetically manipulating plants are available (e.g. Birch, 1997, Ann Rev Plant Phys Plant Mol Biol, 48, 297). For example, strategies may be designed to increase expression of a polynucleotide/polypeptide in a plant cell, organ and/or at a particular developmental stage where/when it is normally expressed or to ectopically express a polynucleotide/polypeptide in a cell, tissue, organ and/or at a particular developmental stage which/when it is not normally expressed. Strategies may also be designed to increase expression of a polynucleotide/polypeptide in response to external stimuli, such as environmental stimuli. Environmental stimuli may include environmental stresses such as mechanical (such as herbivore activity), dehydration, salinity and temperature stresses. The expressed polynucleotide/polypeptide may be derived from the plant species to be transformed or may be derived from a different plant species.

Transformation strategies may be designed to reduce expression of a polynucleotide/polypeptide in a plant cell, tissue, organ or at a particular developmental stage which/when it is normally expressed or to reduce expression of a polynucleotide/polypeptide in response to an external stimuli. Such strategies are known as gene silencing strategies.

Genetic constructs for expression of genes in transgenic plants typically include promoters, such as promoter polynucleotides of the invention, for driving the expression of one or more cloned polynucleotide, terminators and selectable marker sequences to detect presence of the genetic construct in the transformed plant.

Exemplary terminators that are commonly used in plant transformation genetic construct include, e.g., the cauliflower mosaic virus (CaMV) 35S terminator, the Agrobacterium tumefaciens nopaline synthase or octopine synthase terminators, the Zea mays zin gene terminator, the Oryza sativa ADP-glucose pyrophosphorylase terminator and the Solanum tuberosum PI-II terminator.

Selectable markers commonly used in plant transformation include the neomycin phophotransferase II gene (NPT II) which confers kanamycin resistance, the aadA gene, which confers spectinomycin and streptomycin resistance, the phosphinothricin acetyl transferase (bar gene) for Ignite (AgrEvo) and Basta (Hoechst) resistance, and the hygromycin phosphotransferase gene (hpt) for hygromycin resistance.

Use of genetic constructs comprising reporter genes (coding sequences which express an activity that is foreign to the host, usually an enzymatic activity and/or a visible signal (e.g., luciferase, GUS, GFP) which may be used for promoter expression analysis in plants and plant tissues are also contemplated. The reporter gene literature is reviewed in Herrera-Estrella et al., 1993, Nature 303, 209, and Schrott, 1995, In: Gene Transfer to Plants (Potrykus, T., Spangenberg. Eds) Springer Verlag. Berline, pp. 325-336.

Gene silencing strategies may be focused on the gene itself or regulatory elements which effect expression of the encoded polypeptide. “Regulatory elements” is used here in the widest possible sense and includes other genes which interact with the gene of interest.

Genetic constructs designed to decrease or silence the expression of a polynucleotide/polypeptide may include an antisense copy of a polynucleotide. In such constructs the polynucleotide is placed in an antisense orientation with respect to the promoter and terminator.

An “antisense” polynucleotide is obtained by inverting a polynucleotide or a segment of the polynucleotide so that the transcript produced will be complementary to the mRNA transcript of the gene, e.g.,

5′GATCTA 3′ (coding strand) 3′CTAGAT 5′
(antisense strand)
3′CUAGAU 5′ mRNA 5′GAUCUCG 3′
antisense RNA

Genetic constructs designed for gene silencing may also include an inverted repeat. An ‘inverted repeat’ is a sequence that is repeated where the second half of the repeat is in the complementary strand, e.g.,

5′-GATCTA...TAGATC-3′
3′-CTAGAT...ATCTAG-5′

The transcript formed may undergo complementary base pairing to form a hairpin structure. Usually a spacer of at least 3-5 bp between the repeated region is required to allow hairpin formation.

Another silencing approach involves the use of a small antisense RNA targeted to the transcript equivalent to an miRNA (Llave et al., 2002, Science 297, 2053). Use of such small antisense RNA corresponding to polynucleotide of the invention is expressly contemplated.

The term genetic construct as used herein also includes small antisense RNAs and other such polynucleotides useful for effecting gene silencing.

Transformation with an expression construct, as herein defined, may also result in gene silencing through a process known as sense suppression (e.g. Napoli et al., 1990, Plant Cell 2, 279; de Carvalho Niebel et al., 1995, Plant Cell, 7, 347). In some cases sense suppression may involve over-expression of the whole or a partial coding sequence but may also involve expression of non-coding region of the gene, such as an intron or a 5′ or 3′ untranslated region (UTR). Chimeric partial sense constructs can be used to coordinately silence multiple genes (Abbott et al., 2002, Plant Physiol. 128(3): 844-53; Jones et al., 1998, Planta 204: 499-505). The use of such sense suppression strategies to silence the expression of a sequence operably-linked to promoter of the invention is also contemplated.

The polynucleotide inserts in genetic constructs designed for gene silencing may correspond to coding sequence and/or non-coding sequence, such as promoter and/or intron and/or 5′ or 3′ UTR sequence, or the corresponding gene.

Other gene silencing strategies include dominant negative approaches and the use of ribozyme constructs (McIntyre, 1996, Transgenic Res, 5, 257)

Pre-transcriptional silencing may be brought about through mutation of the gene itself or its regulatory elements. Such mutations may include point mutations, frameshifts, insertions, deletions and substitutions.

Plants

The term “plant” is intended to include a whole plant or any part of a plant, propagules and progeny of a plant.

The term ‘progeny’ as used herein refers to any cell, plant or part thereof which has been obtained or derived from a cell or transgenic plant of the present invention. Thus, the term progeny includes but is not limited to seeds, plants obtained from seeds, plants or parts thereof, or derived from plant tissue culture, or cloning, techniques.

The term ‘propagule’ means any part of a plant that may be used in reproduction or propagation, either sexual or asexual, including seeds and cuttings.

A “transgenic” or transformed” plant refers to a plant which contains new genetic material as a result of genetic manipulation or transformation. The new genetic material may be derived from a plant of the same species as the resulting transgenic of transformed plant or from a different species. A transformed plant includes a plant which is either stably or transiently transformed with new genetic material.

The plants of the invention may be grown and either self-ed or crossed with a different plant strain and the resulting hybrids, with the desired phenotypic characteristics, may be identified. Two or more generations may be grown. Plants resulting from such standard breeding approaches also form part of the present invention.

BRIEF DESCRIPTION OF DRAWINGS

Further aspects of the present invention will become apparent from the following description which is given by way of example only and with reference to the accompanying drawings in which:

FIG. 1 shows the general condensed tannin pathway;

FIG. 2(A) illustrates the cDNA sequence representing the full length cDNA sequence of TaMYB14, cloned from mature T. arvense leaf tissue.

FIG. 2(B) illustrates the amino acid translation of TaMYB14.

FIG. 3 shows the transcript levels of TaMYB14 in varying tissues from Trifolium species and cultivars grown in identical glasshouse conditions. Lane 1, (ladder); Lane 2, T. repens mature leaf cDNA library (Cultivar Huia); Lane 3, T. repens mature root cDNA library (Cultivar Huia); Lane 4, T. repens mature stolon cDNA library (Cultivar Huia); Lane 5, T. repens mature floral cDNA library (Cultivar DC111); Lane 6, T. repens emerging leaf cDNA (Cultivar Huia); Lane 7, T. repens mature leaf cDNA (High anthocyanin Cultivar Isabelle); Lane 8, T. arvense immature leaf cDNA (Cultivar AZ2925); Lane 9, T. arvense mature leaf cDNA (Cultivar AZ2925); Lane 10, T. repens meristem floral cDNA (Cultivar Huia); Lane 11, T. repens meristem leaf cDNA (Cultivar Huia); Lane 12, T. repens meristem trichome only cDNA (Cultivar Huia); Lane 13, T. occidentale mature plant (leaf, root and stolon cDNA library (Cultivar Huia); Lane 14, T. repens mature nodal cDNA library (Cultivar Huia); Lane 15, cloned T. arvense MYB14cDNA clone in TOPO, Lane 16, cloned T. arvense MYB14 genomic clone in TOPO, lane 17, T. occidentale genomic DNA; lane 17, T. repens genomic DNA; lane 17, T. arvense genomic DNA; Lane 20, (ladder).

FIG. 4 shows the transcript levels of BANYULS (A) and LAR (B) in varying tissues from Trifolium species and cultivars grown in identical glasshouse conditions. Lane 1, (ladder); Lane 2, T. repens mature leaf cDNA library (Cultivar Huia); Lane 3, T. repens mature root cDNA library (Cultivar Huia); Lane 4, T. repens mature stolon cDNA library (Cultivar Huia); Lane 5, T. repens mature floral cDNA library (Cultivar DC111); Lane 6, T. repens emerging leaf cDNA (Cultivar Huia); Lane 7, T. repens mature leaf cDNA (High anthocyanin Cultivar Isabelle); Lane 8, T. arvense immature leaf cDNA (Cultivar AZ2925); Lane 9, T. arvense mature leaf cDNA (Cultivar AZ2925); Lane 10, T. repens meristem floral cDNA (Cultivar Huia); Lane 11, T. repens meristem leaf cDNA (Cultivar Huia); Lane 12, T. repens meristem trichome only cDNA (Cultivar Huia); Lane 13, T. occidentale mature plant (leaf, root and stolon cDNA library (Cultivar Huia); Lane 14, T. repens mature nodal cDNA library (Cultivar Huia); Lane 15, cloned T. arvense cDNA BAN or LAR clone in TOPO, Lane 16, cloned T. arvense BAN or LAR genomic clone in TOPO, lane 17, T. occidentale genomic DNA; lane 17, T. repens genomic DNA; lane 17, T. arvense genomic DNA; Lane 20, (ladder).

FIG. 5 shows the results of DMACA staining of transformed white clover mature leaf tissue. DMACA staining (light/dark grey colour) of mature white clover leaf tissue identifying Condensed Tannins in (A) Wild Type and (B) transformed with TaMYB14 gene.

FIG. 6 shows the plasmid vector M14ApHZBarP, used for plant transformation. E1, E2 and E3 indicate the 3 exons of the genomic allele TaMYB14-1.

FIG. 7 shows the alignment of the full-length cDNA sequences of Trifolium MYB14, top BLASTN hits and AtTT2 with similarities highlighted in light grey.

FIG. 8 shows the alignment of the translated open reading frames of Trifolium arvense TaMYB14, top BLASTP hits and AtTT2 with similarities highlighted in light grey and motifs boxed.

FIG. 9 shows the alignment of the full-length protein sequences of TaMYB14 (expressed TaMYB14FTa and silent TaMYB14-2S), ToMYB14 allele, and TrMYB14 alleles with differences highlighted in dark grey/white regions and deletion/insertion areas highlight in boxes.

FIG. 10 shows the alignment of the full-length genomic DNA sequences of Trifolium repens TrMYB14 allelles (TRM*) aligned with Trifolium arvense TaMYB14 alleles (TaM3, TaM4), with differences in exons (light grey) and introns (dark grey) highlighted.

FIG. 11 shows the alignment of the full-length genomic DNA sequences of Trifolium occidentale ToMYB14 allelles (To1, To6) aligned with Trifolium arvense TaMYB14 alleles (TaM3, TaM4), with differences in exons (light grey) and introns (dark grey) highlighted.

FIG. 12 shows the alignment of the full-length genomic DNA sequences of Trifolium arvense TaMYB14 allelles (Ta*) and Trifolium affine TafMYB14 allelles (Tar) with exons (light grey) and introns (dark grey) showing differences.

FIG. 13 shows the Vector NTI map of the construct pHZbarSMYB containing the NotI fragment from MYB14pHANNIBAL, which contains a segment of TaMYB14 cDNA from T. arvense in sense (SMYB14F) and antisense (SMYB14R) orientation flanking the pdk intron.

FIG. 14 shows the PCR reaction for the presence of M14ApHZBAR from genomic DNA isolated from putatively transformed white clover. Lanes; A1, B1 Ladder; A2-18 and B2-B15 transformed clovers, B16 non-transformed white clover, B17 plasmid control, B18 water control. Primers were 35S (promoter) and PMYBR (to 3′end of gene) amplifying a 1,244 bp fragment.

FIG. 15 shows the results of DMACA screening of wild type (A) and transgenic (B to D) T. repens leaves, transformed with TaMYB14 construct.

FIG. 16 shows oil microscopy of trichomes (E-G), epidermal cells (H) and mesophyll cell (I-K) of DMACA stained transgenic leaflets expressing the TaMyb14A gene (SEQ ID NO:2).

FIG. 17 shows Grape Seed Extract Monomers—The SRM chromatograms of the monomers in a grape seed extract are shown below. Trace A is a sum of the product ions 123, 139 and 165 m/z of the SRM of 291.3 m/z (catechin (C) and epicatechin (EC)). Trace B is a sum of the product ions 139 and 151 m/z of the SRM of 307.3 m/z (gallocatechin (GC) and epigallocatechin (EGC)).

FIG. 18 shows Grape Seed Extract Dimers and Trimers. The SRM chromatograms of the dimers and trimers in a grape seed extract are shown below. Trace A is a sum of the product ions 291, 409 and 427 m/z of the SRM of 579.3 m/z (PC:PC dimer). Trace B is a sum of the product ions 291, 307, 427 and 443 m/z of the SRM of 595.3 m/z (PC:PD dimer). Trace C is a sum of the product ions 291, 577 and 579 m/z of the SRM of 867.3 m/z (3PC trimer). The MS2 spectra of a PC:PC dimer, a PC:PD dimer, and two 3PC trimers are provided as evidence of identification of these metabolites.

FIG. 19 shows the SRM chromatograms of monomers for the control (White Clover −ve) and transgenic (White Clover +ve) plants expressing MYB14 are shown below. Trace A is a sum of the product ions 123, 139 and 165 m/z of the SRM of 291.3 m/z (PC; catechin and epicatechin). Trace B is a sum of the product ions 139 and 151 m/z of the SRM of 307.3 m/z (PD; gallocatechin and epigallocatechin). The chromatogram scales are fixed to show the appearance of monomers in the modified plant. No monomers were detected in the control plant. The MS2 spectra of epicatechin (EC) and epigallocatechin (EGC) are provided from the modified plant as evidence of identification of these metabolites.

FIG. 20 shows the SRM chromatograms of dimers for the control (White Clover −ve) and transgenic (White Clover +ve) plants expressing MYB14 are shown below. Trace A is a sum of the product ions 291, 409 and 427 m/z of the SRM of 579.3 m/z (PC:PC dimer). Trace B is a sum of the product ions 291, 307, 427 and 443 m/z of the SRM of 595.3 m/z (PC:PD dimer). Trace C is a sum of the product ions 307 and 443 m/z of the SRM of 611.3 m/z (PD:PD dimer). The chromatogram scales are fixed to show the appearance of dimers in the modified plant. No dimers were detected in the control plant. The MS2 spectra of three PD:PD dimers (1-3) and one PC:PD mixed dimer (4) are provided from the modified plant as evidence of identification of these metabolites.

FIG. 21 shows the SRM chromatograms of trimers for the control (White Clover −ve) and transgenic (White Clover +ve) plants expressing MYB14 are shown below. Trace A is a sum of the product ions 291, 577 and 579 m/z of the SRM of 867.3 m/z (3PC trimer). Trace B is a sum of the product ions 291, 307, 427, 443, 577, 579, 593, 595 and 757 m/z of the SRM of 883.3 m/z (PC:PD dimer). Trace C is a sum of the product ions 291, 307, 443, 593, 595, 611, 731, 757 and 773 m/z of the SRM of 899.3 m/z (1 PC:2PD trimer). Trace D is a sum of the product ions 307, 443, 609, 611, 747, 773 and 789 m/z of the SRM of 915.3 m/z (3PD trimer). The chromatogram scales are fixed to show the appearance of trimers in the modified plant. No trimers were detected in the control plant. The MS2 spectra of a 3PD trimer and a 1 PC:2PD mixed trimer are provided from the modified plant as evidence of identification of these metabolites.

FIG. 22 shows the PCR reaction for the presence of M14ApHZBAR from genomic DNA isolated from putatively transformed tobacco plantlets. Lanes; A1, Ladder; A2-10 transformed tobacco, A13, 14, tobacco controls, A15 plasmid control, Primers were 35S (promoter) and PMYBR (to 3′end of gene) amplifying a 1,244 bp fragment.

FIG. 23 shows the results of DMACA screening of transgenic (A to G) tobacco (Nicotiana tabacum) leaves, transformed with M14ApHZBAR construct.

FIG. 24 shows the SRM chromatograms for the control (wild type) and modified (transgenic) plants expressing MYB14 are shown below. Trace A is a sum of the product ions 123, 139 and 165 m/z of the SRM of 291.3 m/z (PC; catechin and epicatechin). Trace B is a sum of the product ions 139 and 151 m/z of the SRM of 307.3 m/z (PD; gallocatechin and epigallocatechin). Trace C is a sum of the product ions 291, 409 and 427 m/z of the SRM of 579.3 m/z (PC:PC dimer). Trace D is a sum of the product ions 291, 577 and 579 m/z of the SRM of 867.3 m/z (PC:PC:PC timer). The chromatogram scales are fixed to show the appearance of monomers, dimers and trimers in the modified plant. Note, no mixed PC:PD or 100% PD dimers or trimers were detected.

FIG. 25 shows the MS2 spectra of epicatechin (EC), gallocatechin (GC), epigallocatechin (EGC), PC:PC dimer 1 and 2, and the PC:PC:PC trimer are provided from the modified (transgenic) plants expressing MYB14, as evidence of identification of these metabolites.

FIG. 26 shows the PCR reaction for the presence of M14pHANNIBAL in genomic DNA isolated from putatively transformed T. arvense. Lanes; A1 pHANNIBAL negative control vector, A2 M14ApHZBAR containing 35S and genomic gene construct-control amplifying a 1,244 bp fragment; A3 M14pHANNIBAL positive plasmid control containing hpRNA construct, A4 pHANNIBAL containing MYB fragment in antisense orientation upstream of ocs terminator (negative control), A5 pHZBARSMYB positive plasmid control, A6 Ladder, A7-18 transformed T. arvense, A19 genomic DNA wild type T. arvense, A20 water control.

B: B1 Ladder, B2-B11 transformed T. arvense, B12 M14pHANNIBAL positive plasmid control. Primers were 35S (promoter) and PHMYBR (to 3′end of gene) amplifying a 393 bp fragment.

FIG. 27 shows the results of DMACA screening of wild type T. arvense callus (A) and plantlets (B to D) regenerated on tissue culture media. No DMACA staining occurs in callus and DMACA screening of transgenic (E to L) T. arvense plantlets regenerated on tissue culture media. Staining is greatly diminished compared to wild type plants.

FIG. 28 shows the four monomer SRM chromatograms for T. arvense control and knockout plants: Trace A is a sum of the product ions 123, 139 and 165 m/z of the SRM of 291.3 m/z (PC; catechin and epicatechin) for a control plant. B is a sum of the product ions 123, 139 and 165 m/z of the SRM of 291.3 m/z (PC; catechin and epicatechin) for a knockout plant. C is a sum of the product ions 139 and 151 m/z of the SRM of 307.3 m/z (PD; gallocatechin and epigallocatechin) for a control plant. D is a sum of the product ions 139 and 151 m/z of the SRM of 307.3 m/z (PD; gallocatechin and epigallocatechin) for a knockout plant. The MS2 spectra are provided from the control plant as evidence of catechin and gallocatechin in the control plant. The chromatogram scales for traces A, B, C and D have been fixed to show the disappearance of catechin and gallocatechin in the knockout plant.

FIG. 29 shows the dimer SRM chromatograms for the control and knockout T. arvense plants. Trace A is a sum of the product ions 291 and 427 m/z of the SRM of 579.3 m/z (PC:PC dimer). Trace B is a sum of the product ions 307, 427 and 443 m/z of the SRM of 595.3 m/z (PC:PD dimer). Trace C is a sum of the product ions 307 and 443 m/z of the SRM of 611.3 m/z (PD:PD dimer). The chromatogram scales are fixed to show the disappearance of dimers in the knockout plant. The MS2 spectra are provided from the control plant as evidence of all three types of dimers in the control.

FIG. 30 shows the PCR analysis for the presence of pTaMyb14A from genomic DNA (SEQ ID NO:2) isolated from putatively transformed alfalfa. Lanes L; ladder; 1-3, non-transformed, 4-10 transformed, 11 wild type, 12 water control, 13 plasmid control. Primers were 35S and PMYBR (to 3′end of gene).

FIG. 31 shows the PCR analysis for the presence of M14ApHZBAR from genomic DNA isolated from putatively transformed brassica plantlets. Lane 8, brassica control; Lane 18 Ladder; Lane 1-7 and 9-17 transformed brassica. Primers were 35S (promoter) and PMYBR (to 3′end of gene) amplifying a 1,244 bp fragment.

FIG. 32 shows the results of DMACA screening of wild type brassica (Brassica oleracea) (A) and transgenic (B to D) leaves, transformed with M14ApHZBARP construct.

FIG. 33 shows the SRM chromatograms of the product ions 123, 139 and 165 m/z of the SRM of 291.3 m/z (catechin (C) and epicatechin (EC)) in two controls and a transgenic brassica expressing MYB14. The MS2 spectra of the epicatechin detected in the green control and the transgenic +ve sample are provided as evidence of identification of these metabolites. No epicatechin was detected in the red control sample.

FIG. 34 shows an alignment of all the Trifolium MYB14 protein sequences identified by the applicant.

FIG. 35 shows the percent identity between the sequences aligned in FIG. 34.

FIG. 36 shows DMACA staining of leaves from wild type (A) and transgenic (B) Medicao plants transformed with a CaMV35S::TaMYB14 construct (B)

FIG. 37 shows LC-MS/MS composite extracted ion chromatograms of ions 123+139+151+165 m/z for catechin (peak #1) and epicatechin (peak #2) (traces A1-B1) from MS2 product ion scans of 291 m/z and ions 139+151 m/z for gallocatechin (not detected) and epigallocatechin (not detected) (traces A2-B2) from MS2 product ion scans of 307 m/z in A)—M. sativa wild type and B)—M. sativa transformed with CaMV35S::TaMYB14.

FIG. 38 shows LC-MS/MS composite extracted ion chromatograms of ions 291+409+427 m/z from MS2 product ion scans of 579 m/z of PC:PC dimers in leaf extracts of A)—M. sativa wild type and B)—M. sativa transformed with CaMV35S::TaMYB14.

FIG. 39 shows LC-MS/MS composite extracted ion chromatograms of ions 291+579 m/z from MS2 product ion scans of 867 m/z for PC:PC:PC trimers (traces A1-B1); ions 291+307+443+579+595+757 m/z from the MS2 product ion scans of 883 m/z for PC:PC:PD trimers (traces A2-B2); ions 291+307+443+579+595+757+773 m/z from the MS2 product ion scans of 899 m/z for PC:PD:PD trimers (traces A3-B3); ions 307+611+773+789 m/z from the MS2 product ion scans of 915 m/z for PD:PD:PD trimers (traces A4-B4) in A)—M. sativa wild type and B)—M. sativa transformed with CaMV35S::TaMYB14.

BRIEF DESCRIPTION OF SEQUENCE LISTING
SEQ ID
NO: Description Corresponding sequence
1 Polynucleotide, Trifolium arvense, TaMYB14-1 cDNA Sequence of Ta MYB14 cDNA of
expressed gene
2 Polynucleotide, Trifolium arvense, TaMYB14-1 gDNA Sequence genomic of Ta MYB14 1
from allele 1 from Trifolium
arvense.
3 Polynucleotide, Trifolium arvense, TaMYB14-2 gDNA Sequence genomic of Ta MYB14 2
from allele 2 from Trifolium
arvense.
4 Polynucleotide, Trifolium affine, TafMYB14-1 gDNA Sequence genomic of Taf MYB14 1
from allele 1 from Trifolium affine.
5 Polynucleotide, Trifolium affine, TafMYB14-1 cDNA Sequence of Taf MYB14 cDNA of
expressed gene
6 Polynucleotide, Trifolium affine, TafMYB14-2 gDNA Sequence genomic of Taf MYB14 2
from allele 2 from Trifolium affine.
7 Polynucleotide, Trifolium occidentale, ToMYB14-1 Sequence genomic of ToMYB14 1
gDNA from allele 1 from Trifolium
occidentale.
8 Polynucleotide, Trifolium occidentale, ToMYB14-2 Sequence genomic of ToMYB14 2
gDNA from allele 2 from Trifolium
occidentale.
9 Polynucleotide, Trifolium repens, TrMYB14-1 gDNA Sequence genomic of TrMYB14 1
from allele 1 from Trifolium repens.
10 Polynucleotide, Trifolium repens, TrMYB14-2 gDNA Sequence genomic of TrMYB14 2
from allele 2 from Trifolium repens.
11 Polynucleotide, Trifolium repens, TrMYB14-3 gDNA Sequence genomic of TrMYB14 3
from allele 3 from Trifolium repens.
12 Polynucleotide, Trifolium repens, TrMYB14-4 gDNA Sequence genomic of TrMYB14 4
from allele 4 from Trifolium repens.
13 Polynucleotide, Trifolium arvense, TaMYB14-1 cDNA cDNA sequence representing the
full length cDNA sequence of
TaMYB14
14 Polypeptide, Trifolium arvense, TaMYB14-1 amino acid translation of TaMYB14
15 Polypeptide, artificial, consensus motif similar to Motif of subgroup 5
(Stracke et al., 2001) common to
known CT MYB activators
16 Polypeptide, artificial, consensus motif common to known
anthocyanin MYB activators (Motif
of subgroup 6, Stracke et al., 2001)
17 Polypeptide, artificial, consensus novel MYB motif of MYB14 TFs
18 Polynucleotide, artificial, primer MYB domain hunt-MYBFX
19 Polynucleotide, artificial, primer MYB domain hunt-MYBFY
20 Polynucleotide, artificial, primer MYB domain hunt-MYBFZ
21 Polynucleotide, artificial, primer Isolation of full length-M14ATG
22 Polynucleotide, artificial, primer Isolation of full length-M14TGA
23 Polynucleotide, artificial, primer Gene walking-M14TSP1
24 Polynucleotide, artificial, primer Gene walking-M14TSP2
25 Polynucleotide, artificial, primer Gene walking-M14TSP3
26 Polynucleotide, artificial, primer Cloning into vector-M14FATG
27 Polynucleotide, artificial, primer Lotus corniculatus-MYBLF
28 Polynucleotide, artificial, primer Lotus corniculatus-MYBLR
29 Polynucleotide, artificial, primer 5′ UTR end of MYB14-MYB148N
30 Polynucleotide, artificial, primer 3′ UTR end of MYB14-MYB14RR
31 Polynucleotide, artificial, primer Primer for intron 1-I5
32 Polynucleotide, artificial, primer Primer for intron 1-I3
33 Polynucleotide, artificial, primer Gene walking-TSP4
34 Polynucleotide, artificial, primer Gene walking-TSP5
35 Polynucleotide, artificial, primer 5′start site Forward-MYB148F
36 Polynucleotide, artificial, primer 5′start site Reverse-MYB14RR
37 Polynucleotide, artificial, primer Expression analysis/
Silencing vector-MYB14F
38 Polynucleotide, artificial, primer Expression analysis/
Silencing vector-MYB14R
39 Polynucleotide, artificial, primer Gene walking-MYB14R2
40 Polynucleotide, artificial, primer Gene walking-MYB14R3
41 Polynucleotide, artificial, primer Sequencing-M13 Forward
42 Polynucleotide, artificial, primer Sequencing-M13 Reverse
43 Polynucleotide, artificial, primer cDNA production-BD SMART II ™
A Oligonucleotide
44 Polynucleotide, artificial, primer cDNA production-3′ BD SMART ™
CDS Primer II A
45 Polynucleotide, artificial, primer Amplification of mRNA-5′ PCR
Primer II A
46 Polypeptide, Trifolium arvense, TaMYB14-2
47 Polypeptide, Trifolium affine, TafMYB14-1
48 Polypeptide, Trifolium affine, TafMYB14-2
49 Polypeptide, Trifolium occidentale, ToMYB14-1
50 Polynucleotide, Trifolium occidentale, ToMYB14-2
51 Polypeptide, Trifolium repens, TrMYB14-1
52 Polypeptide, Trifolium repens, TrMYB14-2
53 Polypeptide, Trifolium repens, TrMYB14-3
54 Polypeptide, Trifolium repens, TrMYB14-4
55 Polynucleotide, Trifolium arvense, TaMYB14-1
cDNA/ORF
56 Polynucleotide, Trifolium arvense, TaMYB14-2
cDNA/ORF
57 Polynucleotide, Trifolium affine, TafMYB14-1
cDNA/ORF
58 Polynucleotide, Trifolium affine, TafMYB14-2
cDNA/ORF
59 Polynucleotide, Trifolium occidentale, ToMYB14-1
cDNA/ORF
60 Polynucleotide, Trifolium occidentale, ToMYB14-2
cDNA/ORF
61 Polynucleotide, Trifolium repens, TrMYB14-1
cDNA/ORF
62 Polynucleotide, Trifolium repens, TrMYB14-2
cDNA/ORF
63 Polynucleotide, Trifolium repens, TrMYB14-3
cDNA/ORF
64 Polynucleotide, Trifolium repens, TrMYB14-4
cDNA/ORF
65 Polynucleotide, Trifolium arvense, silencing sequence
66 Polynucleotide, artifical, primer, MYB F1
67 Polynucleotide, artifical, primer, MYB R
68 Polynucleotide, artifical, primer, MYB F
69 Polynucleotide, artifical, primer, MYB R1
70 Polynucleotide, Lotus japonicus LjTT2a from FIG. 7
71 Polynucleotide, Trifolium affine MYB14 Taf from FIG. 7
72 Polynucleotide, Glycine max MYB92Gmax from FIG. 7
73 Polynucleotide, Daucus carota MYB3 from FIG. 7
74 Polynucleotide, Gossypium hirsutum GHMYB10 from FIG. 7
75 Polynucleotide, Brassica napus BnTT2-3 from FIG. 7
76 Polynucleotide, Gossypium hirsutum GHMYB36 from FIG. 7
77 Polypeptide, Arabidopsis thaliana AtTT2 from FIG. 8
78 Polypeptide, Brassica napus BnTT2-1 from FIG. 8
79 Polypeptide, Zea mays ZMP1 from FIG. 8
80 Polypeptide, Gossypium hirsutum GHMYB10 from FIG. 8
81 Polypeptide, Vitis vinifera VvMYBPA1 from FIG. 8
82 Polypeptide, Lotus japonicus LjTT2a from FIG. 8
83 Polypeptide, Glycine max MYB185Gmax from FIG. 8
84 Polypeptide, Malus domestica MYB11 Malus from FIG. 8
85 Polypeptide, Trifolium arvense TaMYB14-25 from FIG. 9
86 Polypeptide, Trifolium repens TrMYB14f from FIG. 9
87 Polypeptide, Trifolium occidentale ToMYB14 from FIG. 9
88 Polypeptide, Artificial Consensus sequence from FIG. 9
89 Polynucleotide, Trifolium repens TRM6 from FIG. 10
90 Polynucleotide, Trifolium repens TRM14 from FIG. 10
91 Polynucleotide, Trifolium occidentale To1 from FIG. 11
92 Polynucleotide, Trifolium occidentale To6 from FIG. 11
93 Polynucleotide, Trifolium affine Taf11 from FIG. 12
94 Polynucleotide, Trifolium affine Taf2 r#2 from FIG. 12
95 Polynucleotide, Trifolium affine Taf3 from FIG. 12
96 Polynucleotide, Trifolium affine Taf7 from FIG. 12
97 Polynucleotide, Trifolium affine Taf4 from FIG. 12
98 Polynucleotide, Trifolium affine Taf10 from FIG. 12
99 Polypeptide, Trifolium occidentale ToMYB14-2 from FIG. 12
100 Polypeptide, Artificial Consensus sequence from FIG.
34
101 Polypeptide, Artificial Motif associated with MYB TFs that
regulate CT pathways
102 Polypeptide, Artificial Motif of subgroup 5 common to
previously known CT MYB
activators

The invention will now be illustrated with reference to the following non-limiting examples.

Example 1

Identification of the MYB14 Genes/Nucleic Acids/Proteins of the Invention, and Analysis of Expression Profiles

Introduction

Using primers designed to the MYB domain of legume species, the applicant has amplified sequences encoding novel MYB transcription factors (TFs) by PCR of cDNA and genomic DNA (gDNA) isolated from a range of Trifolium species. These species differ in their capacity to accumulate CTs in mature leaf tissue. Because white clover does not express CT genes in leaf tissue the applicants used an alternative strategy that allowed isolation of the expressed MYB TF from closely related Trifolium species (T. arvense; T. affine) which do accumulate CTs in all cells of foliar tissue throughout the life of the leaf. This was achieved by investigating the differential expression patterns of MYB TFs in various Trifolium leaf types; namely (a) within white clover (T. repens) leaf tissue, where CT gene expression is restricted to the leaf trichomes during meristematic development prior to leaf emergence; (b) within the closely related species (T. arvense), where CT gene expression is found within most cells of the leaf during its entire life span (except the trichome hairs); (c) with white clover mature leaf tissue where CT biosynthesis has already ceased. Such specific temporal and spatial expression requires the differential regulation by different MYB TFs specific to the CT branch pathway. Comparison of the MYB TFs from each leaf type eliminated common MYB factors that have functions other than in CT biosynthesis. Analysis of the remaining isolated MYB TFs allowed identification of those that are unique to CT accumulating tissues.

Sequencing of PCR products resulted in the identification of a previously unidentified MYB TFs from a number of Trifolium species. Full-length sequencing of these MYB genes revealed a highly dissimilar protein code when compared to the published AtTT2 sequence (NP_198405), including the presence of several deletions and insertions of bases in the genes from the different Trifolium species (FIGS. 7 and 8). Translation of the cDNA sequence revealed that the protein encoded by this MYB TF also has substantial number of amino acid deletions, insertions, and exchanges (FIG. 9). The applicants have designated this gene TaMYB14. Analysis of full-length gDNA sequences from 2 different Trifolium species revealed the presence of three exons and two introns of varying sizes in all TaMYB14 isoforms/alleles (FIGS. 10-12).

Seeds from a number of accessions representing various genotypes from four Trifolium species, respectively, were grown in a glasshouse and the presence or absence of CTs was determined in leaves using DMACA staining. Primers specific for TaMYB14 were designed and transcript levels in various tissues were determined by PCR. Expression of TaMYB14 was correlated with CT accumulation in leaf tissues. Its expression was undetectable in CT free tissues. TaMyb14 was very highly expressed in tissues actively accumulating CTs and coincided with the detectable expression of the two enzymes specifically involved in CT biosynthesis; namely ANR and LAR.

Transformation and over-expression of TaMYB14 in white clover (see Example 2) resulted in increased levels of CTs in tissues usually devoid of CTs. This shows that expression of TaMYB14 is critical for the accumulation of CTs. Overexpression of TaMYB14 in T. repens by means of transgenesis will therefore allow accumulation of significant levels of CTs in foliar tissues of various plant species, thereby providing the means to improve pasture quality for livestock.

Materials and Methods

Plant Material and Analysis of Condensed Tannin Levels

Seeds from several cultivars of four legume species differing in their levels of foliar CT were grown in glasshouses. Trifolium repens (Huia); T. arvense (AZ2925; AZ4755; AZ1353); T. affine (AZ925), and T. occidentale (AZ4270). Plant material of various ages and types were harvested and the material immediately frozen in liquid nitrogen and subsequently ground and used for isolation of DNA or RNA

DMACA Staining of Plant Material.

CTs were histochemically analysed using the acidified DMACA (4-dimethylamino-cinnamaldehyde) method essentially as described by Li et al. (1996). This method uses the DMACA (p-dimethylaminocinnamaldehyde) reagent as a rapid histochemical stain that allows specific screening of plant material for very low CT accumulation. The DMACA-HCl protocol is highly specific for proanthocyanidins. This method was preferentially used over the vanillin test as anthocyanins seriously interfere with the vanillin assay. Tissues of various ages were sampled and tested.

Selection Methods of MYB R2R3 Candidates

Two methods were used to identify legume sequences containing a MYB R2R3 DNA-binding domain: hidden Markov models (HMMs) and profiles. Both methods depend on first creating a “model” of the domain from known MYB R2R3 DNA-binding domain protein sequences, which is then used as the basis of the search. The HMM and profile models were created using known plant MYB R2R3 domains as indicated in Table 1 below. These were taken from FIG. 2 in Miyake et. al. (2003) and FIG. 4C in Nesi et. al. (2001; the human MYB sequence in this figure was excluded). The species distribution of the sequences used in constructing the model as follows:

TABLE 1
Plant MYB R2R3 domains taken from Miyake et. al.
(2003) and Nesi et. al. (2001)
Source Species Domain count
Miyake et. al. (2003) Lotus japonicus 3
Glycine max 1
Nesi et. al. (2001) Arabidopsis thaliana 10
Zea mays 3
Hordeum vulgare subsp. vulgare 2
Oryza sativa 1
Petunia x hybrida 1
Picea mariana 1

The legume sequence sets searched are listed in Table 2 below. Prior to searching, all EST and EST contig sets were translated in six frames to generate protein sequences suitable for the HMM/profile analyses. The M. truncatula protein sequences were used as-is (these are FGENESH gene predictions obtained from TIGR).

The HMMER program hmmbuild was used to create an HMM from the model DNA-binding domains, and this was searched against the legume sequence sets using the HMMER program hmmsearch (E-value cut-off=0.01). The EMBOSS program prophecy was used to create a profile from the same domains, and this was also searched against the legume sequences using the EMBOSS program profit (score cut-off=50). The numbers of hits identified by each method in each set of sequences are listed in Table 2 below:

TABLE 2
Legume sequence sets searched
Number of
Number Number hits passed
Total of hits- of hits- to
number of Profile HMM phylogenetic
Sequence set sequences method method analysis
White clover EST 17,758 18 24 17
contigs (CS35)
White clover PG NR 159,017 0 9 3
Red clover EST contigs 38,099 1 2 0
Lotus EST contigs 28,460 5 9 4
Soybean EST contigs 63,676 15 40 15
Medicago truncatula 41,315 60 80 69
predicted proteins
Medicago sativa 5,647 1 2 1
glandular trichome
ESTs
Total 353,972 100 166 109

The HMM method appeared to be more sensitive than the profile method, identifying all profile hits as well as many additional hits. For this reason the HMM method was selected as the method of choice—the HMM hit proteins were used to generate the alignments and were passed to the phylogenetic analysis. The profile hits are still quite useful: the profile method is more stringent and therefore there is a higher likelihood that the profile candidates represent true hits.

Generation of Alignments

DNA-binding domain sequences were extracted from the 166 legume MYB R2R3 candidates identified above. The protein domains were aligned using the HMMER alignment program hmmalign, which aligns the domains using information in the original HMM model. Nucleotide alignments were generated by overlaying the corresponding nucleotide sequences onto the protein alignments, thereby preserving the structure of the alignments at the protein level. This was done to obtain a more accurate alignment that better represents the domain structure.

Phylogenetic Analysis

A phylogenetic analysis was performed on plant MYB R2R3 DNA-binding domains, to see whether the resulting tree nodes could be used to identify MYB R2R3 subtypes, related to TT2 transcription factors. 109 Full length DNA-binding domains were extracted from the 166 legume MYB R2R3 candidates identified in this study, and these were combined with the known MYB R2R3 genes from Nesi et. al. (2001) and Miyake et. al. (2003), giving 130 DNA-binding domains in total. A protein alignment of these 130 domains was generated using hmmalign, and corresponding nucleotide domain sequences were aligned based on this. The nucleotide alignment was submitted to a maximum likelihood analysis to generate a phylogenetic tree based on 100 bootstrap replicates, using the programs fastDNAml and the Phylip program consensus to generate the consensus tree. This information was used to design three primers to legume MYBR2R3 domain.

Isolation of DNA and RNA, and cDNA Synthesis

Genomic DNA was isolated from fresh or frozen plant tissues (100 mg) using DNeasy® Plant Mini kit (Qiagen) following the manufacturer's instructions. DNA preparations were treated with RNAse H (Sigma) to remove RNA from the samples. Total RNA was isolated from fresh or frozen tissues using RNeasy® Plant Mini kit (Qiagen). Isolated total RNA (100 μg) was treated with RNAse free DNAse I to remove DNA from the samples during the isolation, following the manufacturer's instructions. Concentration and purity of DNA and RNA samples was assessed by determining the ratio of absorbance at 260 and 280 nm using a NanoDrop ND-100 spectrophotometer. Total RNA (1 μg) was reverse-transcribed into cDNA using SMART™ cDNA Synthesis Kit (Clontech) using the SMART™ CDS primer IIA and SMART II™ A oligonucleotides following manufacturer's instructions.

Polymerase Chain Reaction (PCR) and TOPO Cloning of PCR Products

Standard PCR reactions were carried out in a Thermal Cycler (Applied Biosystems), a quantity of approximately 5 ng DNA or 1 μl cDNA was used as template. The thermal cycle conditions were as follows: Initial reaction at 94° C. for 30 sec, 35 cycles at 94° C. for 30 sec, 50-64° C. for 30 sec (depending on the Tm of the primers), and at 72° C. for 1-2 min (1 min/kb), respectively, and a final reaction at 72° C. for 10 min.

PCR products were separated by agarose gel electrophoresis and visualised by ethidium bromide staining. Bands of interest were cut out and DNA subsequently extracted from the gel slice using the QIAquick Gel Extraction Kit (Qiagen) following the manufacturer's instructions. Extracted PCR products were cloned into TOPO 2.1 vectors (Invitrogen) and transformed into OneShot® Escherichia. coli cells by chemical transformation following the manufacturer's instructions. Bacteria were subsequently plated onto pre-warmed Luria-Bertani (LB; Invitrogen) agar plates (1% tryptone, 0.5% yeast extract, 1.0% NaCl, and 1.5% agar) containing 50 μg ml−1 kanamycin and 40 μl of 40 μg ml−1 X-gal (5-bromo-4-chloro-3-indolyl-X-D- galactopyranoside; Invitrogen) and incubated at 37° C. overnight. Positive colonies were selected using white-blue selection in combination with antibiotic selection. Colonies were picked and inoculated into 6 ml LB broth (1% tryptone, 0.5% yeast extract, 1.0% NaCl) containing 50 μg ml−1 kanamycin and incubated at 37° C. in a shaking incubator at 200 rpm.

Bacterial cultures were extracted and purified from LB broth culture using the Qiagen Prep Plasmid Miniprep Kit (Qiagen) following the manufacturer's instructions.

DNA Sequencing

Isolated plasmid DNA was sequenced using the dideoxynucleotide chain termination method (Sanger et al., 1977), using Big-Dye (Version 3.1) chemistry (Applied Biosystems). Either M13 forward and reverse primers or specific gene primers were used. The products were separated on an ABI Prism 3100 Genetic Analyser (Applied Biosystems) and sequence data were compared with sequence information published in GenBank (NCBI) using AlignX (Invitrogen).

Results

Identification and Sequencing of TaMYB14

Total RNA and genomic DNA (gDNA) were isolated from developing and mature T. arvense leaf tissue and total RNA was reverse transcribed into cDNA. Initially, primers were designed to the generic MYB region of the coding sequence and PCR performed. PCR products were separated on agarose gels and visualised by ethidium bromide staining. Bands ranging in size were cut out, DNA extracted, purified, cloned into TOPO vectors, and transformed into E. coli cells. Two hundred transformants from the cloning event were randomly chosen, plasmid DNA isolated and subsequently sequenced. Additional primers were designed to sequence the N-terminal regions where required (Table 4).

An array of partial MYBs were identified by sequencing of the isolated cDNA; >50% were unknowns, yielding no substantial hit to known MYB proteins. The remaining were identified as orthologues for MYBs expressed during abiotic stress, response to water deprivation, light stimulus, salt stress, ethylene stimulus, auxin stimulus, abscisic acid stimulus, gibberellic acid stimulus, salicylic acid stimulus, jasmonic acid stimulus, cadmium, light, stomatal movement and control, regulation, mixta-like (epidermal cell growth), down-regulation of caffeic acid O-methyl-transferase, and meristem control.

Two partial MYB cDNAs coded for a protein that fell within the correct MYB clades (NO8 and NO9) whose members include those known to activate anthocyanin or CT biosynthesis. Primers were designed to the 3′ end of the gene to isolate the remaining 5′ end and hence the entire cDNA clone. The full-length TaMYB14 contains a 942 bp coding region coding for a 314 amino acid protein. In comparison, AtTT2 codes for a 258 amino acid protein.

Blast Results for TaMYB14

The cDNA sequence of TaMYB14 from T. arvense genotype AZ2925 was blasted against the public databases. BlastN returned the following top 5 hits:

AB300033.1 Lotus japonicus LjTT2-1 mRNA for R2R3-MYB
transcription factor”, (e-value 3e−69)
AB300035.1 Lotus japonicus LjTT2-3 mRNA for R2R3-MYB
transcription factor”,. (e-value 4e−62)
AB300034.1 Lotus japonicus LjTT2-2 mRNA for R2R3-MYB
transcription factor”, (e-value 4e−59)
AF336284.1 Gossypium hirsutum GhMYB36 mRNA, (e-value 1e−40)
AB298506.1 Daucus carota DcMYB3-1 mRNA for transcription
factor, (e-value 7e−39)

While BlastX of the translated sequence of TaMYB14 from T. arvense genotype AZ2925 returned the following 5 top hits:

BAG12893.1 Lotus japonicus R2R3-MYB transcription
factor LjTT2-1”, (e-value 2e−81)
AAK19615.1AF336282_1 Gossypium hirsutum GhMYB10”,
(e-value 3e−76);
BAG12895.1 Lotus japonicus R2R3-MYB transcription
factor LjTT2-3”, (e-value 8e−74);
BAG12894.1 Lotus japonicus R2R3-MYB transcription
factor LjTT2-2”, (e-value 2e−72);
AAZ20431 .1 “MYB11” [Malus x domestica],
(e-value 2e−66)

Alignment of TaMYB14 cDNA to AtTT2 and other BLAST hits are shown in FIG. 7 with highest similarities shown in yellow. Translation of the open reading frame also showed substantial differences in the amino acid composition, sharing 52% homology to A. thaliana TT2 (FIG. 8). Moreover TaMYB14 shares the motifs common to known CT MYB activators (N09).

Alignment of TaMYB14 cDNA to AtTT2 and other BLAST hits are shown in FIG. 7. with similarities highlighted in yellow and blue. Translation of the open reading frame (FIG. 8) also showed substantial differences in the amino acid composition, sharing 52% homology to A. thaliana TT2, primarily within the MYB domain region.

TaMYB14 includes a motif similar to the motif of subgroup 5 (DExWRLxxT (SEQ ID NO:102)) according to Stracke et al., 2001, that is common to previously known CT MYB activators.

TaMYB14 lacks the motif of subgroup 6 (KPRPR[S/T, shown in SEQ ID NO:16) according to Stracke et al., 2001, that is common to previously known anthocyanin MYB activators.

Moreover this alignment has identified a novel MYB motif (VI/VRTKAxR/KxSK (SEQ ID NO:101)). This new motif (highlighted in FIG. 8) appears associated with a number of novel MYB14 TFs that regulate CT pathways.

TaMYB14 Transcript Levels

CT accumulation occurred in the species T. arvense and T. affine, where they were detectable throughout the entire leaf lamina in the abaxial and adaxial epidermal layer, and the petiole; except for the petiolule region. CTs are only detectable in T. repens and T. occidentale in the leaf trichomes on the abaxial epidermal surface, Transcript analysis using primers specific to TaMYB14 revealed that this gene was expressed only in tissues actively accumulating CTs. TaMYB14 was expressed in T. arvense mature and immature leaf tissue, but not in callus (which does not synthesise CTs). Primers designed to TaMYB14 also amplified a MYB14 in T. repens, which was expressed in meristem leaf and early meristematic trichomes, where CTs are actively accumulating, but were not detected in mature or emergent leaf tissue, stolons, internodes, roots, and petioles. MYB14 was also not detected in mature T. occidentale tissues where CTs are only present in leaf trichomes. Results of the analysis are shown in Table 3 below:

TABLE 3
The expression of MYB14 also coincides with expression of
anthocyanidin reductase (ANR; BAN) and LAR, two key
enzymes specific to CT biosynthesis in legumes.
Species Library Result Expect Pathway
T. repens Huia Mature Leaf CT?
T. repens Huia young leaf
T. repens Huia meristem leaf + +
T. repens Huia early trichome + +
T. repens Huia stolon nodes and
internodes
T. repens Huia Roots
T. repens Huia floral −+ +
T. repens Huia petioles
T. occidentale mature plant
T. repens Isabelle Mature leaf Anthocyanin
T. arvense callus CT-ve
T. arvense mature leaf + + CT
T. arvense immature leaf + +

FIGS. 3 and 4 also showed the comparison of transcript levels in various tissues in the Trifolium species; FIG. 3 shows transcript levels of TaMYB14 in varying tissues from Trifolium species and cultivars grown in identical glasshouse conditions; Lane 1, (ladder); Lane 2, T. repens mature leaf cDNA library (Cultivar Huia); Lane 3, T. repens mature root cDNA library (Cultivar Huia); Lane 4, T. repens mature stolon cDNA library (Cultivar Huia); Lane 5, T. repens mature floral cDNA library (Cultivar DC111); Lane 6, T. repens emerging leaf cDNA (Cultivar Huia); Lane 7, T. repens mature leaf cDNA (High anthocyanin Cultivar Isabelle); Lane 8, T. arvense immature leaf cDNA (Cultivar AZ2925); Lane 9, T. arvense mature leaf cDNA (Cultivar AZ2925); Lane 10, T. repens meristem floral cDNA (Cultivar Huia); Lane 11, T. repens meristem leaf cDNA (Cultivar Huia); Lane 12, T. repens meristem trichome onlycDNA (Cultivar Huia); Lane 13, T. occidentale mature plant (leaf, root and stolon cDNA library (Cultivar Huia); Lane 14, T. repens mature nodal cDNA library (Cultivar Huia); Lane 15, cloned T. arvense MYB14cDNA clone in TOPO, Lane 16, cloned T. arvense MYB14 genomic clone in TOPO, lane 17, T. occidentale genomic DNA; lane 17, T. repens genomic DNA; lane 17, T. arvense genomic DNA; Lane 20, (ladder).

While FIG. 4 shows transcript levels of BANYULS(A) and LAR (B) in varying tissues from Trifolium species and cultivars grown in identical glasshouse conditions. Lane 1, (ladder); Lane 2, T. repens mature leaf cDNA library (Cultivar Huia); Lane 3, T. repens mature root cDNA library (Cultivar Huia); Lane 4, T. repens mature stolon cDNA library (Cultivar Huia); Lane 5, T. repens mature floral cDNA library (Cultivar DC111); Lane 6, T. repens emerging leaf cDNA (Cultivar Huia); Lane 7, T. repens mature leaf cDNA (High anthocyanin Cultivar Isabelle); Lane 8, T. arvense immature leaf cDNA (Cultivar AZ2925); Lane 9, T. arvense mature leaf cDNA (Cultivar AZ2925); Lane 10, T. repens meristem floral cDNA (Cultivar Huia); Lane 11, T. repens meristem leaf cDNA (Cultivar Huia); Lane 12, T. repens meristem trichome onlycDNA (Cultivar Huia); Lane 13, T. occidentale mature plant (leaf, root and stolon cDNA library (Cultivar Huia); Lane 14, T. repens mature nodal cDNA library (Cultivar Huia); Lane 15, cloned T. arvense cDNA BAN or LAR clone in TOPO, Lane 16, cloned T. arvense BAN or LAR genomic clone in TOPO, lane 17, T. occidentale genomic DNA; lane 17, T. repens genomic DNA; lane 17, T. arvense genomic DNA; Lane 20, (ladder).

Identification and Sequencing of MYB14 from gDNA of T. arvense, T. Affine, T. occidentale and T. repens

Using primers designed to the start and stop region of TaMYB14 (see Table 4) the inventors amplified homologues of TaMYB14 by PCR of cDNA and gDNA isolated from a range of several Trifolium species; namely T. arvense, T. affine, T. repens and T. occidentale. Isolation of the genomic DNA sequence and full-length sequencing of the cloned PCR products showed T. arvense has two isoforms or alleles of this gene, one of which corresponds to the expressed cDNA sequence, the other corresponding to a previously unidentified isoform/allelic variant of TaMYB14.

Alignment of these isoform or allelic variant revealed the presence of several deletions and insertions of bases compared to the cDNA sequence of TaMYB14 (see FIG. 10). Translation of the putative cDNA sequence revealed that the protein encoded by this isoform or allelic variant also has amino acid deletions, insertions, and exchanges (see FIG. 9). The inventors designated the allelic variant as TaMYB14-2.

The corresponding full-length gDNA sequences for this gene were also isolated from three other Trifolium species; T. affine, T. repens and T. occidentale. All MYB14 alleles had three exons and two introns of varying sizes (see FIGS. 10-12). T. affine and T. occidentale both have one allele, while T. repens has two alleles. The translated sequences of MYB14 from the various species were 95% homologous to TaMYB14 with changes in amino acid composition. The majority of amino acid differences are located in the 3′ unique region downstream of the MYB domain.

TABLE 4
Primer sequences for PCR, cloning and sequencing of MYB14 from
various Trifolium species (T.arvense; T.repens; T.affine; 
T.occidentale).
Primer usage Code Primer sequence SEQ ID NO:
MYB domain hunt MYBFX GACAATGAGATAAAGAA 18
TTACTTG
MYB domain hunt MYBFY AAGAGTTGTAGACTTAG 19
MTGG
MYB domain hunt MYBFZ YTKGGSAACAGGTTGTC 20
Isolation of M14ATG ATGGGGAGAAGCCCTTG 21
full length TTGTGC
Isolation of M14TGA TCATTCTCCTAGTACTTC 22
full length CTCACTGG
Gene walking M14TSP1 CTCTTTTTGGAAGGTTTC 23
TCC 
Gene walking M14TSP2 TTCTCCATTTTCCTTCAC 24
CATGG
Gene walking M14TSP3 TCCAAGCACCTCTATTCA 25
AGCC
Cloning into vector M14FATG CTCGAGATGCAATGCTG 26
GTTGATGGTGTGGC
Lotus corniculatus MYBLF CATTGCCTGTAGATTCT 27
GTAGCC
Lotus corniculatus MYBLR TGAAGATTGTTGGACAC 28
ATTGG
5′ UTR end of MYB14 MYB148N AGGTTGGAATACAAGAC 29
AGAC
3′ UTR end of MYB14 MYB14RR TCTCCTAGTACTTCCTCA 30
CTGG
Primer for intron 1 15 ATAATCATACTAATTAAC 31
ATCAC
Primer for intron 1 13 GTGTGATAGATCATGTCATT 32
Gene walking TSP4 GCCTTCCTTTGCACAAC 33
AAGGGC
Gene walking TSP5 GCACAACAAGGGCTTCT 34
CCCC
5′start site Forward MYB148F ATGGGGAGAAGCCCTTG 35
TTGTGC
5′start site Reverse MYB14RR TCTCCTAGTACTTCCTCA 36
CTGG
Expression analysis/ MYB14F CTCGAGCAATGCTGGTT 37
Silencing vector GATGGTGTGGC
Expression analysis/ MYB14R TCTAGAGGACACATTTG 38
Silencing vector TCTCATCAGC
Gene walking MYB14R2 TCTAGATTGAGTTTGGT 39
CCGAACAAGG
Gene walking MYB14R3 TCTAGAAATCTTCTAGCA 40
AATCTGCGG
Sequencing M13 GTAAAACGACGGCCAG 41
Forward
M13 CAGGAAACAGCTATGAC 42
Reverse
cDNA production BD AAGCAGTGGTATCAACG 43
SMART CAGAGTACGCGGG
II ™ A
Oligo-
nucleotide
cDNA production 3′ BD AAGCAGTGGTATCAACG 44
SMART ™ CAGAGTACT(30)V N-3′
CDS
Primer II
A
Amplification of 5′ PCR AAGCAGTGGTATCAACG 45
mRNA Primer II CAGAGT
A

In summery the applicants have identified and isolated ten novel MYB14 proteins/genes, as summarized in Table 5 below, which also shows the SEQ ID NO: associated with each sequence in the sequence listing:

TABLE 5
Summary of MYB14 sequences of the invention.
SEQ ID NO:
Full-length
Species, and sequence reference cDNA gDNA Protein ORF
Trifolium arvense, TaMYB14-1 1, 13 2 14 55
Trifolium arvense, TaMYB14-2 3 46 56
Trifolium affine, TafMYB14-1 5 4 47 57
Trifolium affine, TafMYB14-2 6 48 58
Trifolium occidentale, ToMYB14-1 7 49 59
Trifolium occidentale, ToMYB14-2 8 50 60
Trifolium repens, TrMYB14-1 9 51 61
Trifolium repens, TrMYB14-2 10 52 62
Trifolium repens, TrMYB14-3 11 53 63
Trifolium repens, TrMYB14-4 12 54 64

An alignment of all of these MYB14 sequences is shown in FIG. 34. The applicants identified two sequence motifs common to all of the MYB14 protein sequences.

The first motif is DDEILKN (SEQ ID NO:15)

The second motif is X1VVRTX2AX3KCSK (SEQ ID NO:17), where X1=N, Y or H, X2=K or R, and X3=T or I.

The presence of either or both of these mofits appears to be diagnostic for MYB14 proteins, particulary when associated with a lack of motif of SEQ ID NO:16.

FIG. 35 shows the percent identity between each of the MYB14 proteins aligned in FIG. 34.

The applicants have also shown that spatial and temperal expression pattern of TaMYB14 is consistently correlated with production of CT in plants in vivo.

Example 2

Use of the MYB14 Nucleic Acid Sequence of the Invention to Produce Condensed Tannins in White Clover (Trifolium repens)

Materials and Methods

Genetic Constructs Used in the Transformation Protocol

The plant transformation vector, pHZBar is derived from pART27 (Gleave 1992). The pnos-nptII-nos3′ selection cassette has been replaced by the CaMV35S-BAR-OCS3′ selection cassette with the bar gene (which confers resistance to the herbicide ammonium glufosinate) expressed from the CaMV 35S promoter. Cloning of expression cassettes into this binary vector is facilitated by a unique NotI restriction site and selection of recombinants by blue/white screening for β-galactosidase. White clover was transformed using M14ApHZBarP which contains the expressed allele from Trifolium arvense. Over-expression cassettes for M14ApHZBarP were firstly cloned in pART7. The construct were then shuttled to pHZBar as a NotI fragment. T-DNAs of the genetic constructs, showing orientation of cloned genes, are represented graphically in FIG. 6.

Genetic constructs in pHZBar were transferred into Agrobacterium tumefaciens strain GV3101 as plasmid DNA using freeze-thaw transformation method (Ditta et al 1980). The structure of the constructs maintained in Agrobacterium was confirmed by restriction digest of plasmid DNA's prepared from bacterial culture. Agrobacterium cultures were prepared in glycerol and transferred to −80° C. for long term storage. Genetic constructs maintained in Agrobacterium strain GV3101 are inoculated into 25 mL of MGL broth containing spectinomycin at a concentration of 100 mg/L. Cultures are grown overnight (16 hours) on a rotary shaker (200 rpm) at 28° C. Bacterial cultures are harvested by centrifugation (3000×g, 10 minutes). The supernatant is removed and the cells resuspended in a 5 mL solution of 10 mM MgSO4.

Transformation of Cotyledonary Explants.

Clover was transformed using a modified method of Voisey et al. (1994). Seeds are weighed to provide approximately 400-500 cotyledons (ie. 200-250 seeds) for dissection (0.06 gm=100 seeds). In a centrifuge tube, seeds are rinsed with 70% ethanol for 1 minute. Seeds are surface sterilised in bleach (5% available chlorine) by shaking on a circular mixer for 15 minutes followed by four washes in sterile water. Seeds are imbibed overnight at 4° C. Cotyledons are dissected from seeds using a dissecting microscope. Initially, the seed coat and endosperm are removed. Cotyledons are separated from the radical with the scalpel by placing the blade between the cotyledons and slicing through the remaining stalk. Cotyledonary explants are harvested onto a sterile filter disk on CR7 media.

For transformation, a 3 ul aliquot of Agrobacterium suspension is dispensed on to each dissected cotyledon. Plates are sealed and cultured at 25° C. under a 16 hour photoperiod. Following a 72 hour period of co-cultivation, transformed cotyledons are transferred to plates containing CR7 medium supplemented with ammonium glufosinate (2.5 mg/L) and timentin (300 mg/L) and returned to the culture room. Following the regeneration of shoots, explants are transferred to CR5 medium supplemented with ammonium glufosinate (2.5 mg/L) and timentin (300 mg/L). Regenerating shoots are subcultured three weekly to fresh CR5 media containing selection. As root formation occurs, plantlets are transferred into tubs containing CR0 medium containing ammonium glufosinate selection. Large clumps of regenerants are divided to individual plantlets at this stage. Whole, rooted plants growing under selection are then potted into sterile peat plugs.

LCMSMS Methodology for HPLC Analysis

To extract flavonoids for HPLC analysis, leaf tissue (0.5 g fresh weight) was frozen in liquid N2, ground to a fine powder and extracted with acetic acid: methanol (80:20 v/v) for 30 mins at 4° C. The plant debris was pelleted in a microcentrifuge at 13K rpm for 10 mins. The supernatant was removed and placed at −20° C. for 30 mins. An aliquot was used for HPLC analysis. An aliquot was analysed by HPLC using both UV-PDA and MS/MS detection on a Thermo LTQ Ion Trap Mass Spectrometer System. The extracts were resolved on a Phenomonex Luna C18 reversed phase column by gradient elution with water and acetonitrile with 0.1% formic acid as the mobile phase system. Detection of the anthocyanins were by UV absorption at 550 nm, and the other metabolites were estimated by either MS1 or MS2 detection by the mass spectrometer.

The instrument used was a linear ion trap mass spectrometer (Thermo LTQ) coupled to a Thermo Finnigan Surveyor HPLC system (both San Jose, Calif., USA) equipped with a Thermo photo diode array (PDA) detector. Thermo Finnigan Xcalibur software (version 2.0) was used for data acquisition and processing.

A 5 μL aliquot of sample was injected onto a 150×2.1 mm Luna C18(2) column (Phenomenex, Torrance, Calif.) held at a constant 25° C. The HPLC solvents used were: solvent A=0.1% formic acid in H2O; solvent B=0.1% formic acid in Acetonitrile. The flow rate was 200 μL min−1 and the solvent gradient used is shown in Table 6 below. PDA data was collected across the range of 220 nm-600 nm for the entire chromatogram.

TABLE 6
HPLC gradient
Time (min) Solvent A % Solvent B %
0 95 5
6 95 5
11 90 10
26 83 17
31 77 23
41 70 30
45 50 50
52 50 50
52 3 97
59 3 97
62 95 5
70 95 5

The mass spectrometer was set for electrospray ionisation in positive mode. The spray voltage was 4.5 kV and the capillary temperature 275° C., and flow rates of sheath gas, auxiliary gas, and sweep gas were set (in arbitrary units/min) to 20, 10, and 5, respectively. The first 4 and last 11 minutes of flow from the HPLC were diverted to waste. The MS was programmed to scan from 150-2000 m/z (MS1scan), then perform data dependant MS3 on the most intense MS1 ion. The isolation windows for the data dependant MS3 method was 2 mu (nominal mass units) and fragmentation (35% CE (relative collision energy)) of the most intense ion from the MS1 spectrum was followed by the isolation (2 mu) and fragmentation (35% CE) of the most intense ion from the MS2 spectrum. The mass spectrometer then sequentially performed selected reaction monitoring (SRM) on the masses in Table 7 below, with isolation windows for each SRM of 2.5 mu and fragmentation CE of 35%. These masses listed cover the different combinations of procyanidin (catechin and/or epicatechin) and prodelphinidin (gallocatechin or epigallocatechin) masses up to trimer.

TABLE 7
SRM masses for monomers, dimers and trimers:
SRM mass (m/z) MS2 scan range (m/z) Target compound
291.3 80-700 PC monomers
307.3 80-700 PD monomers
579.3 155-2000 PC:PC dimers
595.3 160-2000 PC:PD dimers
611.3 165-2000 PD:PD dimers
867.3 235-2000 PC:PC:PC timers
883.3 240-2000 PC:PC:PD trimers
899.3 245-2000 PC:PD:PD trimers
915.3 250-2000 PD:PD:PD trimers

Results

DMACA Analysis of White Clover with MYB14 from gDNA of T. arvense

White clover cotyledons were transformed with the T. arvense allele corresponding to the expressed cDNA sequence, under the control of the CaMV 35S promoter, and regenerated as described in the methods. Leaves from all regenerated plantlets were screened for CT production with DMACA staining, as described in Example 1. A number of these transformed plants were positive for CT production, resulting in blue staining when stained with DMACA. Such staining occurred in most epidermal cells of leaf tissues, including the six middle cells of leaf trichomes. In comparison, non-transformed wild type white clover plants were negative for CT, apart from the trichomes on the abaxial leaf side (FIG. 5). CTs were also present within some root and petiolar cells of some plants. This indicates that constitutive expression of TaMYB14 alters the temporal and spatial patterning of CT accumulation in white clover plants.

Molecular Analysis, DMACA Screen and Biochemistry of Transgenic White Clover

White Clover Molecular Analysis

DNA extracted from transgenic white clover plants was tested for integration of the M14ApHZBAR vector. PCR reactions were performed using primer sets designed to amplify a product including a portion of the 35S promoter and the majority of the TaMYB14 gene. Results of this analysis indicated integration of the binary vector containing the TaMyb14A gene (SEQ ID NO:2) into the white clover genome (FIG. 14).

White Clover DMACA Analysis

The results achieved from DMACA staining of white clover leaf tissues are shown (FIG. 15). The CT specific stain, DMACA, has heavily stained the leaf blade and petiole of the transgenic clover leaves (B, C, D, G, H), compared to wild type white clover leaf (A, E, F).

In addition (FIG. 16), the trichome tier cells and apical cells were much more strongly stained (F, G) than normally seen in wild type leaves (E). The guard cells of the stomata had also strongly stained (H). There was definite staining in the nucleus of the epidermal cells as in the stalk trichome cell. Epidermal cells were more uniformly stained than normal and the basal cell of the rosette were also strongly stained (G). Leaf tears were carried out to help establish what specific cells have DMACA staining (I to K). This instance the lower epidermis (outside surface topmost) has been separated from the mesophyll layer. The epidermal cells (apart from specialised cells such as stomata and trichomes) had little activity compared to the mesophyll cell layer. The mesophyll cells showed definite strong staining throughout the cell with definite sub localization into specific vacuole-like organelles, which are obviously multiple per cell. There is therefore compartmentalization of the DMACA staining within the mesophyll cells.

White Clover HPLC/LCMS Analysis

The applicant's biochemical analysis of the transgenic tissue transformed with M14ApHZBAR provided indisputable evidence that over expression of TaMYB14 leads to the accumulation of condensed tannin monomers, dimers and trimers in foliar tissue in white clover and tobacco. It is also possible that longer chain tannins are present but resolving these are beyond the scope of our equipment.

Purified grape seed extract was used as the standard for all LCMSMS HPLC measurements because its tannin profile has been well characterised and is shown in FIGS. 17 and 18. This extract allows definite identification of catechin (C), epicatechin (EC), gallocatechin (GC) and epigallocatechin (EGC) as well as detection of PC:PC dimers, a PC:PD dimers and two 3PC trimers.

The MS2 spectra of all four monomers are provided as evidence of identication of these metabolites.

Flavonoids were extracted from transgenic and wild type control white clover plants, and processed via HPLC/LCMS. Results of these analyses confirmed the presence of CT in leaf extracts from the transgenic clover samples. The majority of monomers detected were epicatechin and epigallocatechin with traces of gallocatechin. This is consistent as clover tannins are delphinidin derived. No monomers were detected in wild type white clover leaf tissue (FIG. 19). Dimers and trimers were also detected (FIGS. 20, 21).

Example 3

Use of the MYB14 Nucleic Acid Sequence of the Invention to Produce Condensed Tannins in Tobacco (Nicotiana tabacum)

Materials and Methods

Genetic Construct Used in Transformation Protocols.

The NotI fragment from the plasmid M14ApHZBAR (FIG. 6) was isolated and cloned into pART27 (Gleave, 1992) for transformation of tobacco. This binary vector contains the nptll selection gene for kanamycin resistance under the control of the CaMV 35S promoter.

Tobacco Transformation

Tobacco was transformed via the leaf disk transformation-regeneration method (Horsch et al. 1985). Leaf disks from sterile wild type W38 tobacco plants were inoculated with an Agrobacterium tumefaciens strain containing the binary vector, and were cultured for 3 days. The leaf disks were then transferred to MS selective medium containing 100 mg/L of kanamycin and 300 mg/L of cefotaxime. Shoot regeneration occurred over a month, and the leaf explants were placed on hormone free medium containing kanamycin for root formation.

Results

Molecular Analysis, DMACA Screen and Biochemistry of Transgenic Tobacco

Tobacco Molecular Analysis

DNA extracted from transgenic tobacco plants was tested for integration of the M14ApHZBAR binary vector. PCR reactions were performed using primer sets designed to amplify a portion of the 35S promoter and the majority of the gene. Results of this analysis indicated integration of the binary vector containing the TaMyb14A gene (SEQ ID NO:2) into the white clover genome (FIG. 22).

Tobacco DMACA Analysis

DMACA analysis was performed on the tobacco plants, as described for clover in Example 1. Transgenic tobacco plantlets expressing TaMYB14A (under the control of the cauliflower mosaic virus 35S promoter) showed no significant differences in growth compared to wild-type plants. Moreover, CT was detected in leaf tissue of transgenic tobacco plantlets derived from cells of either the wild type or the transgenic tobacco (already accumulating anthocyanin) compared to wild type untransformed tobacco that does not accumulate CT in vegetative tissues. This indicates that the T. arvense MYB14 gene is able to activate all the genes of the CT pathway in tobacco, on its own. Examples of the DMACA staining of transgenic tobacco leaves are shown (FIG. 23). The CT specific stain, DMACA, heavily stained the leaf blade of the transgenic tobacco leaves (A to G) compared to wild type leaves, which are always devoid of CT.

Tobacco HPLC/LCMS Analysis

HPLC/LCMS analysis was performed for tobacco as described for clover in Example 2. Flavonoids were extracted from transgenic and wild type control tobacco plants, and processed via HPLC. Results of these analyses confirmed the presence of CT in leaf extracts from the transgenic tobacco samples. The tobacco control samples were devoid of CT units. The majority of monomers detected were epicatechin, with small amounts of epigallocatechin and gallocatechin monomers (FIG. 24). Dimers and trimers were also detected (FIG. 25).

Example 4

Use of the MYB14 Nucleic Acid Sequence of the Invention to Reduce Production Condensed Tannins in Trifolium arvense

Materials and Methods

Genetic Construct Used in Silencing Protocol

pHANNIBAL (Helliwell and Waterhouse, 2003), a hairpin RNAi plant vector, was used to transform T. arvense cotyledons with a construct expressing self-complementary portions of a sequence homologous to a portion of the cDNA of TaMYB14. The entire cDNA for the MYB14 (previously isolated from a leaf library) was used to amplify a 299 bp long fragment of the cDNA from the 3′ end of the gene (caatgctggttgatggtgtggctagtgattcaatgagtaacaacgaaatggaacacggttatggatttttgtcattttgcgatgaa gagaaagaactatccgcagatttgctagaagattttaacatcgcggatgatatttgcttatctgaacttttgaactctgatttctcaaa tgcgtgcaatttcgattacaatgatctattgtcaccttgttcggaccaaactcaaatgttctctgatgatgagattctcaagaattgga cacaatgtaactttgctgatgagacaaatgtgtcc-SEQ ID NO:65). The primers were designed to allow the cloning of the fragments into the silencing vector pHANNIBAL (Table 5). The fragment was cloned into Xhol site in the sense direction in front of the pdk intron or the Xbal sites, after the pdk intron, in the antisense direction. Direction of the cloning was determined by PCR to ensure the fragment was in the correct orientation. The NotI fragment from MYB14pHANNIBAL containing the hpRNA cassette was subcloned into pHZBar (designated pHZBARSMYB (FIG. 13) and used in transformation experiments.

TABLE 8
Primers modified to include either an XbaI re-
striction enzyme site (highlighted with italics)
or a XhoI restriction enzyme site (highlighted
with bold) at the 5′end of the primers to allow
cloning.
Primer Sequence
MYB14F1 TCTAGACAATGCTGGTTGATGGTGTGGC 
(SEQ ID NO: 66)
MYB14R TCTAGAGGACACATTTGTCTCATCAGC 
(SEQ ID NO: 67)
MYB14F CTCGAGCAATGCTGGTTGATGGTGTGGC 
(SEQ ID NO: 68)
MYB14R1 CTCGAGGGACACATTTGTCTCATCAGC 
(SEQ ID NO: 69)

T. arvense Transformation:

Cultivars of T. arvense were transformed with the pHZbarSMYB silencing binary vector, essentially as described for T. repens, with some minor modifications (Voisey et al., 1994). The ammonium glufosinate level was decreased to 1.25 mg/L; and plants were placed onto CR5 media for only a fortnight prior to placement onto CR0 medium for root regeneration.

Results

Molecular Analysis, DMACA Screen and Biochemistry of Transgenic Trifolium arvense.
T. arvense Molecular Analysis

DNA extracted from transgenic T. arvense plants was tested for integration of the M14pHANNIBAL binary vector. PCR reactions were performed using primer sets designed to amplify a portion of the 35S promoter and the 3′ end of the cDNA gene fragment. Results of this analysis indicated integration of the binary vector containing the hpRNA gene construct into the genome (FIG. 26).

T. arvense DMACA Analysis

Plant material from control T. arvense and some of the transformed plantlets have been stained using DMACA (FIG. 27) as described in Example 1. The transformed plants were compared to the wild type mature leaves also regenerated through tissue culture as tissue culture affects leaf regeneration and the onset of tannin production compared to naturally soil grown plants derived from seeds. Wild type T. arvense callus does not produce tannin (A), but cells start to accumulate tannin in tissue resembling leaves (B to D-purple colour). The transgenic plants also do not produce tannin in callus, but leaf tissue similarly stained with DMACA showed only a light blue stain (E-L), indicating the levels of CT were dramatically reduced in plants expressing the silencing construct.

T. arvense HPLC/LCMS Analysis

Flavonoids were extracted from transgenic and wild type control T. arvense plants, and processed via HPLC/LCMS, as described in Example 2. Wild type (non-transformed) T. arvense plantlets had high detectable levels of CT monomers. The majority of these monomers were catechin, with small amounts of gallocatechin monomers (FIG. 28). Dimers were also detected (FIG. 29). In contrast, only traces of these compounds were detected in the transformed plantlets, if at all. Therefore HPLC analysis of silenced T. arvense plantlets confirmed CT accumulation had been significantly reduced. These results confirm the absence of CT in leaf extracts from the transgenic T. arvense plants is associated with the presence of the vector designed to silence expression of TaMYB14.

Example 5

Use of the MYB14 Nucleic Acid Sequence of the Invention to Produce Condensed Tannins in Alfalfa (Medicago sativa)

Materials and Methods

Alfalfa Transformation by Microprojectile Bombardment

The cultivar Regen-SY was used for all transformation experiments (Bingham 1991). The transformation protocol was adapted from Samac et al (1995). Callus cultures were initiated from petiole explants and grown in the dark on Schenk and Hildebrandt media (Schenk and Hildebrandt, 1972) supplemented with 2, 4-Dichlorophenoxyacetic acid and Kinetin (SHDK). Developing cultures were passaged by regular subculture onto fresh media at four weekly intervals. Eight to twelve week old Regen Sy callus was transformed by microprojectile bombardment in a Bio-Rad PDS1000/He Biolistic® Particle Delivery System apparatus. Callus cultures were incubated for a minimum of four hours on SHDK medium supplemented with a 0.7M concentration of sorbitol and mannitol to induce cell plasmolysis. Plasmid DNA (1 μg/μl) of p35STaMyb14A (containing the NotI fragment from M14ApHZBAR) and pCW122 (which contains an nptll gene for conferring resistance to the antibiotic kanamycin; Walter et al, 1998) were precipitated to tungsten particles (M17, Bio-Rad) as described by the manufacturer. Standard parameters (27″Hg vacuum, 1100 psi rupture, and 100 mm target distance) were used for transformation according to the instruction manual. Transformed tissues were rested overnight before transfer to SHDK medium. After two days, cultures were transferred to SHDK medium containing antibiotic selection (kanamycin 50 mg/L) for selection of transformed cells. This material was sub-cultured up to three times at three weekly intervals before transfer to hormone-free SH medium or Blaydes medium (Blaydes, 1966) and placed in the light for regeneration. Germinating somatic embryos were dissected from the callus mass and transferred to a half-strength Murashige and Skoog medium (Murashige and Skoog, 1962) for root and shoot development.

Aim

Transformation experiments were undertaken to introduce a plasmid containing the TaMyb14 gene under the control of the CaMV35S promoter into alfalfa. The objective was to generate plants expressing TaMyb14 and to screen for the accumulation of condensed tannins in foliar tissues.

Results

Molecular Analysis, DMACA Screen and Biochemistry of Transgenic Alfalfa.

Alfalfa Molecular Analysis

DNA extracted from transgenic alfalfa was tested for integration of the p35STaMyb14A vector. Primer sets designed to amplify product from either the nptII gene or TaMyb14A gene (SEQ ID NO:2) were used. Results of this analysis indicated integration of both plasmid constructs into the alfalfa genome (FIG. 30).

Alfalfa DMACA Analysis

To test for accumulation of condensed-tannins, DMACA analysis can be conducted for the Alfalfa plants as described for clover in Example 1.

Alfalfa HPLC/LCMS Analysis

HPLC/LCMS analysis as described for clover in Example 2 above can be used to accurately detect the presence of tannin monomers, dimers and trimers in transgenic alfalfa. To conduct the analysis, flavonoids are extracted from transgenic and wild type control alfalfa plants, as described for clover. Wild type alfalfa accumulates (in the seed coat) mainly cyanidin derived tannins and small amounts of delphinidin derived tannins (Pang et al., 2007). The leaves of transgenic medicago lines expressing TaMYB14 can be tested for production of epicatechin, catechin and epigallocatechin, and gallocatechin monomers as well as dimer and trimer combinations of these base units.

Example 6

Use of the MYB14 Nucleic Acid Sequence of the Invention to Produce Condensed Tannins in Brassica (Brassica oleracea)

Materials and Methods

Transformation of Brassica Lines

Seeds of Brassica oleracea var. acephala cv. Coleor (red forage kale) and Gruner (green forage kale) were germinated in vitro as described in Christey et al. (1997, 2006). Hypocotyl and cotyledonary petiole explants from 4-5 day old seedlings were co-cultivated briefly with a culture of Agrobacterium tumefaciens grown overnight in LB medium containing antibiotics prior to 1:10 dilution in antibiotic-free minimal medium (7.6 mM (NH4)2SO4, 1.7 mM sodium citrate, 78.7 mM K2HPO4, 0.33 M KH2PO4, 1 mM MgSO4, 0.2% sucrose) with growth for a further 4 hrs. Explants were cultured on Murashige-Skoog (MS, Murashige and Skoog, 1962) based medium with B5 vitamins and 2.5 mg/L BA and solidified with 10 gm/L Danisco standard agar. After 3 days co-cultivation, explants were transferred to the same medium with the addition of 300 mg/L Timentin (SmithKline Beecham) and 15/L kanamycin. Explants were transferred every 3-4 weeks to fresh selection medium. Green shoots were transferred as they appeared to hormone-free Linsmaier-Skoog based medium (LS, Linsmaier and Skoog, 1965) containing 50 mg/L kanamycin and solidified with 10 gm/L Danisco standard agar. Explants were cultured in tall Petri dishes (9 cm diameter, 2 cm tall) sealed with Micropore (3M) surgical tape. Shoots were cultured in clear plastic tubs (98 mm, 250 ml, Vertex). All plant culture manipulations were conducted at 25° C. with a 16 h/day photoperiod, provided by Cool White fluorescent lights, 20 uE/m2/s.

Results

Molecular Analysis, DMACA Screen and Biochemistry of Transgenic Brassica

Brassica Molecular Analysis

DNA extracted from transgenic brassica plants was tested for integration of the M14ApHZBAR binary vector. PCR reactions were performed using primer sets designed to amplify a portion of the 35S promoter and the majority of the gene. Results of this analysis indicated integration of the binary vector containing the TaMyb14A gene (SEQ ID NO:2) into the brassica genome (shown in FIG. 31).

Brassica DMACA Analysis

DMACA analysis was performed on the Brassica plants as described for clover in Example 1. Transgenic brassica plantlets expressing TaMYB14A (under the control of the cauliflower mosaic virus 35S promoter) were indistinguishable from the wild-type plants. Wild type untransformed cabbage of either cultivar that does not naturally accumulate CT in vegetative tissues, remained unstained. However, CT was detected in leaf tissue of transgenic brassica plantlets derived from the accumulating anthocyanin cultivars, as evidenced by the positive DMACA staining. The staining was not as intense as that noted for tobacco and clovers. In contrast transgenic plantlets derived from wild type green cultivar never stained with DMACA.

This indicates that the T. arvense MYB14 gene is able to activate a portion of the genes of the CT pathway in brassica, but may require an active anthocyanin pathway for CT production. Examples of the DMACA staining of transgenic brassica leaves are shown in the pictures below (FIG. 32). The CT specific stain, DMACA, stained the leaf blade of the transgenic brassica (B to D) compared to wild type leaves (A), which are always devoid of CT.

Brassica HPLC/LCMS Analysis

Flavonoids were extracted from transgenic and wild type control Brassica plants, and processed via HPLC as described for clover in Example 2. Results of these analyses confirmed the presence of CT in leaf extracts from one transgenic brassica sample. The brassica transformation was done with both normal green coloured brassica as well as with a brassica line accumulating anthocyanin. The HPLC analysis detected epicatechin in green coloured brassica but no tannin monomers in the anthocyanin accumulating lines. The transgenic brassica overexpressing TaMYB14 that accumulated CTs in the leaf was derived from an anthocyanin accumulating line. Only epicatechin monomers were detected in this transgenic line as shown in FIG. 33.

Example 6

To Demonstrate Modification of Condensed Tannin Production by MYB14 Variants

Any variant MYB sequences, which may be identified by methods described herein, can be tested for their ability to alter condensed tannins in plants using the methods described in Examples 2 to 5.

Briefly the coding sequences (such as but not limited to those of SEQ ID NO: 56-64) of the variant sequences can be cloned into a suitable expression construct (e.g. pHZBar, as described in Example 2) and transformed into a plant cell or plant. A particularly convenient and relatively simple approach is to use tobacco as a test plant as described in Example 3. DMACA analysis can be used as a quick and convenient test for alternations in condensed tannin production as described in Example 1.

In this way the function of MYB14 variants in regulating condensed tannin production can be quickly confirmed.

More detailed analysis of the condensed tannins can also be performed using HPLC/LCMS analysis as described in Example 2.

Example 7

Use of the MYB14 Nucleic Acid Sequence of the Invention to Produce Condensed Tannins in Medicago

Materials and Methods

Plant Materials and Histochemical Analysis

Seeds of M. Sativa (Alfalfa) were obtained from the Margot Forde Forage Germplasm Centre (Palmerston North, NZ). Seeds were germinated on seed trays and plants grown in a glass house. Plant tissues were harvested at various developmental stages and either immediately processed for histochemical staining or frozen in liquid nitrogen and stored at −80° C. for subsequent DNA, RNA, and PA isolation.

Genetic Constructs, Plant Transformation and Regeneration

For over-expression of TaMYB14 in Medicago, the same construct (M14ApHZBarP) and Agrobacterium strain used for clover in Example 2.

Leaf disks of M. sativa were transformed using Agrobacterium-mediated transformation and plant regeneration protocols as described (Blaydes, 1966; An, 1985; Bingham 1991; Shetty et al., 1993; Voisey et al., 1994; Austin et al., 1995).

A genotype of alfalfa (Medicago sativa L.) derived from Regen-SY (Bingham 1991) was used for Agrobacterium-mediated transformation. Vegetatively propagated plants, as a source of leaf explant material, were maintained under a standard greenhouse environment. Leaf disks were transformed with A. tumefaciens strain GV3101 containing the TaMyb14 over-expression construct using a protocol adapted from Austin et al. 1995. Briefly, young fully expanded trifoliate leaves were surfaced sterilised, cut into pieces and floated on SHO solution (Shenk and Hildebrenk basal medium, Duchefa) before inoculation in a suspension of Agrobacterium cells and co-cultivation for two days on SH4K medium (Shetty and McKersie 1993). Following co-cultivation leaf disks were cultured on SH4K supplemented with 25 mg/L Kanamycin and 300 mg/L Cefotaxime for four weeks, then transferred to Blaydes medium (Blaydes, 1966) with antibiotic selection for induction of somatic embryogenesis. Mature green embryos developing under selection were dissected from callus and placed upright in a half strength MS salts (Murashige and Skoog 1962) supplemented with Nitsch vitamins (Nitsch and Nitsch 1969) and 3% sucrose but without kanamycin for further development. Whole rooted plants were transferred to the greenhouse and potted into a peat-based growth medium for analysis.

Medicago DMACA Analysis

Fresh tissue samples (mature leaves, flowers, roots, immature/meristematic leaves, and trichomes) were collected from plants and PAs were histochemically analysed using the acidified DMACA (4-dimethylaminocinnamaldehyde; Sigma NZ Ltd., Auckland, NZ) method essentially as described in Example 1. Briefly, tissue samples were decolorised in ethanol: acetic acid (3:1) overnight, stained with DMACA (3 mg/ml, methanol: hydrochloric acid, 1: 1), and destained with several washes of 70% ethanol. Meristematic leaves and trichomes were dissected from end tips of stolons under a microscope.

Medicago LC-MS/MS Analysis and Quantitation of PAs in Plant Tissues

LC-MS/MS analysis and quantification of CTs was as described for white clover in Example 2.

Results

Functional Analysis of TaMYB14 in Transgenic M. sativa Plants

M. sativa plants were transformed with TaMYB14 under the control of the CaMV35S promoter to test the function of TaMYB14 in this legume; presence and expression of TaMYB14 was confirmed by (RT)-PCR (data not shown).

Medicago DMACA Analysis

Leaves from regenerated plantlets were screened for PA accumulation using DMACA staining and a number of plants transformed with TaMYB14 tested positive. Leaves from non-transformed wild type plants stained positive with DMACA in the trichomes on the abaxial leaf layers only, while plants transformed with TaMYB14 stained positive in epidermal leaf cells as well (FIG. 36).

Medicago LC-MS/MS Analysis

The presence of PA monomers (epicatechin and catechin, FIG. 37), PC:PC dimers (FIG. 38), PC:PC:PC and PC:PC:PD trimers (FIG. 39), and trace levels of tetramers in leaf extracts of M. sativa plants transformed with the TaMYB14 construct was confirmed by LC-MS/MS analysis, while PAs were undetectable in control plants. A glycosylated monomer, epicatechin-glycoside (Pang et al., 2008), was also detected by LC-MS/MS (MS1 m/z 453, MS2 m/z 291, MS3 m/z 123, 139, 151, 165) in TaMYB14 transformed plants only, with levels 10-fold lower relative to free epicatechin (data not shown).

Quantification of soluble PAs in leaves of CaMV35S::TaMYB14 transformed M. sativa plants using the butanol/HCl method (Terrill et al., 1992) showed accumulation of PAs up to 2.2% DW.

Summary of Examples

The examples clearly demonstrate that the MYB14 gene of the invention is useful for manipulating the production of flavonoids, specifically condensed tannins in a range of plant genera, including tobacco (Nicotiana tabacum; Solanaceae Family), and in the legumes white clover (Trifolium repens; Fabaceae Family) and Alfalfa (Medicago sativa) and brassica (Brassica oleracea, Brassicaceae Family).

The applicants have demonstrated both increase and decrease in the production of condensed tannins using the methods and polynucloetides of the invention.

It is not the intention to limit the scope of the invention to the above mentioned examples only. As would be appreciated by a skilled person in the art, many variations are possible without departing from the scope of the invention.

REFERENCES

  • Abrahams S, Lee E, Walker A R, Tanner G J, Larkin P J, Ashton A R (2003). The Arabidopsis TDS4 gene encodes leucoanthocyanidin dioxygenase (LDOX) and is essential for proanthocyanidin synthesis and vacuole development. Plant Journal 35: 624-636.
  • Abrahams S, Tanner G J, Larkin P J, Ashton A R (2002). Identification and biochemical characterization of mutants in the proanthocyanidin pathway in Arabidopsis. Plant Physiology 130: 561-576.
  • Aerts, R J, Barry, T N and McNabb, W C (1999). Polyphenols and agriculture: beneficial effects of proanthocyanidins in forages. Agric. Ecosyst. Env. 75: 1-12.
  • Austin S., Bingham E. T., Mathews D. E., Shahan M. N., Will J., and Burgess R. R. (1995). Production and field performance of transgenic alfalfa (Medicago sativa L.) expressing alpha-amylase and manganese dependant lignin peroxidase. Euphytica 85: 381-393.
  • Baudry A, Heim M A, Dubreucq B, Caboche M, Weisshaar B, Lepiniec L (2004). TT2, TT8, and TTG1 synergistically specify the expression of BANYULS and proanthocyanidin biosynthesis in Arabidopsis thaliana. Plant J 39: 366-380.
  • Bingham, E T (1991). Registration of Alfalfa Hybrid Regen-Sy Germplasm for Tissue Culture and Transformation Research. Crop Science 31: 1098.
  • Blaydes, D F (1966). Interaction of kinetin and various inhibitors in the growth of soybean tissue. Physiologia Plantarum 19:748-753.
  • Blaxter, K. L., Clapperton, J. L. (1965). Prediction of the amount of methane produced by ruminants. British Journal of Nutrition 19: 511-522.
  • Bogs J, Downey M, Harvey J S, Ashton A R, Tanner G J, Robinson S P (2005). Proanthocyanidin synthesis and expression of genes encoding leucoanthocyanidin reductase and anthocyanidin reductase in developing grape berries and grapevine leaves. Plant Physiology 139: 652-663.
  • Bogs J, Jaffe F W, Takos A M, Walker A R, Robinson S P (2007). The grapevine transcription factor VvMYBPA1 regulates proanthocyanidin synthesis during fruit development. Plant Physiology 143:1347-1361.
  • Broun P. (2005). Transcriptional control of flavonoid biosynthesis: a complex network of conserved regulators involved in multiple aspects of differentiation in Arabidopsis. Current Opinion in Plant Biology 8:272-279.
  • Burggraaf, V. T., Woodward, S. L., Woodfield, D. R., Thom, E. R., Waghorn, G. C. and Kemp, P. D. (2006). Morphology and agronomic performance of white clover with increased flowering and condensed tannin concentration. New Zealand Journal of Agricultural Research 49: 147-155.
  • Caradus, J. R., Woodfield, D. R., Easton, H. S (2000). Improved grazing value of pasture cultivars for temperate environments. Asian-Australasian Journal of Animal Sciences 13 (SUPPL. 1), pp. 5-8.
  • Christey, M. C., Sinclair, B. K., Braun, R. H. and Wyke, L. (1997). Regeneration of transgenic vegetable brassicas (Brassica oleracea and B. campestris) via Ri-mediated transformation. Plant Cell Reports 16: 587-593.
  • Christey M C, Braun R H, Conner E L, Reader J K, White D W R, Voisey C R (2006). Cabbage white butterfly and diamond-back moth resistant Brassica oleracea plants transgenic for cry1Ba1 or cry1Ca5. Acta Horticulturae 706: 247-253.
  • Clark, H. (2001). Ruminant Methane Emissions: A Review of the Methodology Used for National Inventory Estimations. A Report Prepared for the Ministry of Agriculture and Forestry, New Zealand.
  • Choreo and Goodman, Acc. Chem. REs., (1993) 26 266-273.
  • Dairylnsight: Strategic Framework for Dairy Farming's Future, 2005-2015.
  • Damiani F, Paolocci F, Cluster P D, Arcioni S, Tanner G J, Joseph R G, Li Y G, de Majnik J, Larkin P J (1999). The maize transcription factor Sn alters proanthocyanidin synthesis in transgenic Lotus corniculatus plants Australian Journal Of Plant Physiology 26: 159-169.
  • Davies K M, Schwinn K E (2003). Transcriptional regulation of secondary metabolism. Functional Plant Biology 30:913-925.
  • de Majnik, J. Weinman, J., Djordjevic, M. Rolfe, MB. Tanner, G. Joseph, RG. Larkin P J (2000). Anthocyanin regulatory gene expression in transgenic white clover can result in an altered pattern of pigmentation. Australian Journal of Plant Physiology 27:659-667.
  • I, Nesi N, Perez P, Devic M, Grandjean O, Caboche M, Lepiniec L (2003). Proanthocyanidin-accumulating cells in Arabidopsis testa: regulation of differentiation and role in seed development. Plant Cell 15: 2514-2531.
  • Debeaujon I, Peeters A J M, Leon-Kloosterziel K M, Koornneef M (2001). The TRANSPARENT TESTA12 gene of Arabidopsis encodes a multidrug secondary transporter-like protein required for flavonoid sequestration in vacuoles of the seed coat endothelium. Plant Cell 13: 853-871.
  • Ditta, G., Stanfield, S., Corbin, D., and Helsinki, S. R. (1980). Broad host range cloning system for gram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proceedings of the National Academy of SciencesUSA 77: 7347-7351.
  • Dixon R A, Lamb C J, Masoud S, Sewalt V J H, Paiva N L (1996). Metabolic engineering: prospects for crop improvement through the genetic manipulation of phenylpropanoid biosynthesis and defense responses—a review. Gene 179: 61-71.
  • Dixon R A, Xie D Y, Sharma S B (2005). Proanthocyanidins—a final frontier in flavonoid research? New Phytologist 165: 9-28.
  • Douglas G B, Wang Y, Waghorn G C, Barry T N, Purchas R W, Foote A G, Wilson G F (1995). Liveweight Gain And Wool Production Of Sheep Grazing Lotus-Corniculatus And Lucerne (Medicago-Sativa). New Zealand Journal Of Agricultural Research 38: 95-104.
  • Ellison, N. W., Liston, A., Steiner, J. J., Williams, W. M., Taylor, N. L (2006). Molecular phylogenetics of the clover genus (Trifolium-Leguminosae) Molecular Phylogenetics and Evolution 39; 688-705.
  • Fay M F, Dale P J (1993). Condensed Tannins in Trifolium species and their significance for taxonomiy and plant breeding. Genetic resources and Crop Evolution 40:7-13.
  • Freidinger, R. M., Perlow, D. S., Veber, D. F., J. Org. Chem. 1982, 59, 104-109.
  • Gallop, M. A., Barrett, R. W., Dower, W. J., Fodor, S. P. A. and Hogan, Jr., J. C. (1997). Nature Biotechnology, 15 328-330.
  • Gleave A P (1992). A versatile binary vector system with a T-DNA organisational structure conducive to efficient integration of cloned DNA into the plant genome. Plant Molecular Biology 20: 1203-1207.
  • Helliwell, C and Waterhouse, P (2003). Constructs and methods for high-throughput gene silencing in plants. Methods 30: 289-295.
  • Horsch R B, Fry J E, Hoffmann N L, Eichholtz D, Rogers S G, Fraley R T. (1985). A simple and general method for transferring genes into plants. Science; 227:1229-1231.
  • Jones, W. T., Broadhurst, R. B. and Lyttleton, J. W. (1976) The condensed tannins of pasture legume species. Phytochemistry 15: 1407-1409.
  • Kingston-Smith A H, Thomas H M (2003). Strategies of plant breeding for improved rumen function Annals of Applied Biology 142:13-24.
  • Li, YG and Tanner G, Larkin P (1996). The DMACA-HCl Protocol and the Threshold Proanthocyanidin Content for Bloat Safety in Forage Legumes. Journal of the Science of Food and Agriculture 70 (1996) 98-101.
  • Linsmaier, E. M. and Skoog, F. (1965). Organic growth factor requirements of tobacco tissue cultures. Physiologia Plantarum. 18:100-127.
  • McKenna, P. B (1994). The occurrence of anthelminitic resistant sheep nematodes in the southern North Island of New Zealand. NZ Veterinary. Journal. 42: 151-152.
  • McMahon L R, McAllister T A, Berg B P, Majak W, Acharya S N, Popp J D, Coulman B E, Wang Y, Cheng K J (2000). A review of the effects of forage condensed tannins on ruminal fermentation and bloat in grazing cattle. Canadian Journal of Plant Science 80: 469-485.
  • Marten, G. C., Ehle, F. R. & Ristau, E. A. (1987). Performance and photosensitization of cattle related to forage quality of four legumes. Crop Science 27: 138-145.
  • Mehrtens F, Kranz H, Bednarek P, Weisshaar B (2005). The Arabidopsis transcription factor MYB12 is a flavonol-specific regulator of phenylpropanoid biosynthesis. Physiologia Plantarum. 138: 1083-1096.
  • Miyake K, Ito T, Senda M, Ishikawa R, Harada T, Niizeki M, Akada S (2003). Isolation of a subfamily of genes for R2R3-MYB transcription factors showing up-regulated expression under nitrogen nutrient-limited conditions. Plant Molecular Biology 53: 237-245.
  • Molan. A. L. Waghorn, G. C., McNabb, W. C. (2001). Effect of condensed tannins on egg hatching and larval development of Trichostrongylus colobriformis in vitro. The Veterinary Record 150: 65-69.
  • Murashige T and Skoog F (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiologia Plantarum 15(3): 473-497.
  • Nagai, U., Sato, K. Tetrahedron Lett. 1985, 26, 647-650.
  • Nesi N, Debeaujon I, Jond C, Pelletier G, Caboche M, Lepiniec L (2000). The TT8 gene encodes a basic helix-loop-helix domain protein required for expression of DFR and BAN genes in Arabidopsis siliques. Plant Cell 12: 1863-1878.
  • Nesi N, Debeaujon I, Jond C, Stewart A J, Jenkins G I, Caboche M, Lepiniec L (2002). The TRANSPARENT TESTA16 locus encodes the ARABIDOPSIS BSISTER MADS domain protein and is required for proper development and pigmentation of the seed coat. Plant Cell 14: 2463-2479.
  • Nesi N, Jond C, Debeaujon I, Caboche M, Lepiniec L (2001). The Arabidopsis TT2 gene encodes an R2R3 MYB domain protein that acts as a key determinant for proanthocyanidin accumulation in developing seed. Plant Cell 13: 2099-2114.
  • Niezen, J. H., Waghorn, T. S., Charleston, W. A. G. and Waghorn, G. C. (1995). Growth and gastrointestinal nematode parasitism in lambs grazing either lucerne (Medicago sativa) or sulla (Hedysarum coronarium) which contains condensed tannins. J. Agric. Sci. (Cam) 125, pp. 281-289.
  • Niezen, J. H., Waghorn, T. S., Waghorn, G. C. and Charleston, W. A. G. (1993) Internal parasites and lamb production—a role for plants containing condensed tannins?. Proc. NZL. Soc. Anim. Prod. 53, pp. 235-238.
  • Olson et al., (1993) J. Med. Chem., 36 3039-3049.
  • Pang Y, Peel G J, Wright E, Wang Z, Dixon R A (2007). Early steps in proanthocyanidin biosynthesis in the model legume Medicago truncatula. Plant Physiology 145(3):601-615.
  • Pfeiffer J, Kuhnel C, Brandt J, Duy D, Punyasiri PAN, Forkmann G, Fischer T C (2006). Biosynthesis of flavan 3-ols by leucoanthocyanidin 4-reductases and anthocyanidin reductases in leaves of grape (Vitis vinifera L.), apple (Malus×domestica Borkh.) and other crops. Plant Physiology and Biochemistry 44: 323-334.
  • Puchala, R., Min, B. R., Goetsch, A. L. and Sahlu, T. (2005). The effect of a condensed tannin-containing forage on methane emission by goats. Journal of. Animal Science 83:182-186.
  • Ray H, Yu M, Auser P, Blahut-Beatty L, McKersie B, Bowley S, Westcott N, Coulman B, Lloyd A, Gruber M Y (2003). Expression of Anthocyanins and Proanthocyanidins after Transformation of Alfalfa with Maize Lc. Plant Physiology, 132: 1448-1463.
  • Robbins M P, Paolocci F, Hughes J W, Turchetti V, Allison G, Arcioni S, Morris P, Damiani F (2003). Sn, a maize bHLH gene, modulates anthocyanin and condensed tannin pathways in Lotus corniculatus. Journal of Experimental Botany 54:381: 239-248. DOI: 10.1093/jxb/erg022
  • Rumbaugh, M. D. (1985). Breeding bloat-safe cultivars of bloat-causing legumes. In: Barnes, R. F., Ball, P. R., Bringham, R. W., Martin, G. C., Minson, D. J. (Eds.), Forage Legumes for Energy-Efficient Animal Production. USDA, Washington. Proc. Bilateral Workshop, Palmerston North, NZ, April 1984, pp. 238-245.
  • Samac, DA (1995). Strain specificity in transformation of alfalfa by Agrobacterium tumefaciens. Plant Cell, Tissue and Organ Culture 43: 271-277.
  • Sanger F, Nicklen S, Coulson A R (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences USA 74: 5463-5467.
  • Schenk, R U and Hildebrandt, AC (1972). Medium and techniques for induction and growth of monocotyledonous and dicotyledonous plant cell cultures. Canadian Journal of Botany 50: 199-204.
  • Sharma, S. B. and Dixon, R. A. (2005). Metabolic engineering of proanthocyanidins by ectopic expression of transcription factors in Arabidopsis thaliana. Plant Journal 44:62-75.
  • Shetty, K. and McKersie, B. D. (1993) Proline, thioproline and potassium mediated stimulation of somatic embryogenesis in Alfalfa (Medicago sativa L.) Plant Sci 88:185-193.
  • Debeaujon Smythe, M. L., von Itzstein, M., J. Am. Chem. Soc. 1994, 116, 2725-2733.
  • Stracke R, Werber M, Weisshaar B (2001). The R2R3-MYB gene family in Arabidopsis thaliana. Current Opinion in Plant Biology 4: 447-456.
  • Sykes. A. R and Coop. R. L (2001). Interaction between nutrition and gastrointestinal parasitism in sheep New Zealand Veterinary Journal. 49: 222-226.
  • Tanner G J, Francki K T, Abrahams S, Watson J M, Larkin P J, Ashton A R (2003).
  • Proanthocyanidin biosynthesis in plants—Purification of legume leucoanthocyanidin reductase and molecular cloning of its cDNA. Journal of Biological Chemistry 278:31647-31656.
  • Tanner G J, Moore A E, Larkin P J (1994). Proanthocyanidins Inhibit Hydrolysis Of Leaf Proteins By Rumen Microflora In-Vitro British Journal Of Nutrition 71: 947-958.
  • Terrill, T. H., Rowan, A. M., Douglas, G. B., and Barry, T. N. (1992). Determination of extractable and bound condensed tannin concentrations in forage plants, protein concentrate meals and cereal grains. J. Sci. Food. Agric. 58: 321-329.
  • Voisey, C. R.; White, D. W. R.; Dudas, B.; Appleby, R. D.; Ealing, P. M.; Scott, A. G. (1994). Agrobacterium-mediated transformation of white clover using direct shoot organogenesis. Plant Cell Reports 13: 309-314.
  • Waghorn, G. C., Douglas, G. B., Niezen, J. H., McNabb, W. C and Foote, A. G (1998). Forages with condensed tannins-their management and nutritive value for ruminants. Proceedings of the New Zealand Grasslands Association 60: 89-98.
  • Walker A R, Davison P A, Bolognesi-Winfield A C, James C M, Srinivasan N, Blundel T L, Esch J J, Marks M D, Gray J C (1999). The TRANSPARENT TESTA GLABRA1 locus, which regulates trichome differentiation and anthocyanin biosynthesis in Arabidopsis, encodes a WD40 repeat protein. Plant Cell 11: 1337-1349.
  • Walter C, Grace L J, Wagner A, White D W R, Walden A R, Donaldson S S, Hinton H, Gardner R C, Smith D R (1998). Stable transformation and regeneration of transgenic plants of Pinus radiata D. Don. Plant Cell Reports 17: 460-469.
  • Wei Y L, Li J N, Lu J, Tang Z L, Pu D C, Chai Y R (2007). Molecular cloning of Brassica napus TRANSPARENT TESTA 2 gene family encoding potential MYB regulatory proteins of proanthocyanidin biosynthesis. Molecular Biology Reports 34:105-120.
  • Winkel-Shirley B (2001). Flavonoid biosynthesis: a colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiology 126: 485-493.
  • Winkel-Shirley, B. (2002). A mutational approach to dissection of flavonoid biosynthesis in Arabidopsis. In Recent Advances in Phytochemistry: Proceedings of the Annual Meeting of the Phytochemical Society of North America, Vol. 36, J. T. Romeo, ed (New York: Elsevier), pp. 95-110.
  • Woodfield, D., McNabb, W., Kennedy, L., Cousins, G. and Caradus, J. (1998). Floral and foliar content in white clover. Proceedings of the 15th Trifolium Conference, P. 19.
  • Woodward, S. L., Waghorn, G. C., Ulyatt, M. J. and Lassey. K. R. (2001). Early indications that feeding Lotus will reduce methane emission from ruminants. Proceedings NewZealand Society of Animal Production 61:23-26.
  • Xie D Y, Sharma S B, Dixon R A (2004). Anthocyanidin reductases from Medicago truncatula and Arabidopsis thaliana. Archives Of Biochemistry and Biophysics 422: 91-102.
  • Xie D Y, Sharma S B, Paiva N L, Paiva N L, Ferreira D, Dixon R A (2003). Role of anthocyanidin reductase, encoded by BANYULS in plant flavonoid biosynthesis. Science 299: 396-399.
  • Xie D Y, Sharma S B, Wright E, Wang Z Y, Dixon R A (2006). Metabolic engineering of proanthocyanidins through co-expression of anthocyanidin reductase and the PAP1 MYB transcription factor. Plant Journal 45: 895-907.
  • Yoshida, K, Iwasaka, R, Kaneko T, Sato s, Tabata, S. Sakuta M (2008). Functional differentiation of Lotus japonicus TT2s, R2R3 MYB transcription factors comprising a multigene family. Plant Cell Physiology 49:157-169.

Claims

1-65. (canceled)

66. An isolated nucleic acid molecule encoding a MYB14 polypeptide comprising a sequence with at least 70% identity to SEQ ID NO: 14, or a functional fragment thereof, wherein % identity is calculated over the entire length of SEQ ID NO: 14.

67. The isolated polynucleotide of claim 66, wherein the MYB14 polypeptide comprises the sequence of SEQ ID NO: 14.

68. The isolated nucleic molecule of claim 66, wherein the MYB14 polypeptide regulates at least one of:

(a) the production of flavonoids in a plant,

(b) the production of condensed tannins in plants,

(c) at least one gene in the flavonoid biosynthetic pathway in a plant, and

(d) at least one gene in the condensed tannin biosynthetic pathway in a plant.

69. The isolated nucleic molecule of claim 66, wherein the MYB14 polypeptide, or functional fragment thereof, comprises an amino acid sequence with at least 70% identity to SEQ ID NO: 17.

70. The isolated nucleic molecule of claim 66, wherein the MYB14 polypeptide, or functional fragment thereof, comprises the amino acid sequence of SEQ ID NO: 17.

71. The isolated nucleic acid molecule of claim 66, wherein the nucleotide sequence is selected from the group consisting of:

a) SEQ ID NO: 1, 2 or 55;

b) a complement of the sequence(s) in a);

c) a functional fragment or variant of the sequence(s) in a) or b);

d) a homolog or an ortholog of the sequence(s) in a), b), or c);

e) an antisense sequence to a RNA sequence obtained from a sequence in a), b), c) or d).

72. The isolated nucleic acid molecule of claim 71, wherein the variant has at least 70% identity to the specified sequence.

73. An isolated MYB14 polypeptide comprising a sequence with at least 70% identity to SEQ ID NO: 14, or a functional fragment thereof, wherein % identity is calculated over the entire length of SEQ ID NO: 14.

74. The MYB14 polypeptide of claim 73 that comprises the sequence of SEQ ID NO: 15 and SEQ ID NO: 17, but lacks the sequence of SEQ ID NO: 16.

75. The isolated polypeptide of claim 73, wherein the MYB14 polypeptide comprises the sequence of any one of SEQ ID NO: 14 and 46 to 54.

76. The isolated polypeptide of claim 73, wherein the MYB14 polypeptide comprises the sequence of SEQ ID NO: 14.

77. An isolated polypeptide encoded by a nucleic acid molecule of claim 66.

78. An isolated nucleic acid molecule comprising a sequence encoding a polypeptide of claim 73.

79. A construct including a nucleotide sequence substantially as described in claim 66.

80. The construct of claim 79 which includes:

at least one promoter; and

the nucleic acid molecule;

wherein the promoter is operatively linked to the nucleic acid molecule to control the expression of the nucleic acid molecule.

81. A host cell which has been altered from the wild type to include a nucleic acid molecule substantially as described in claim 66.

82. A host cell comprising a genetic construct of claim 79.

83. The host cell of claim 82, wherein the host cell is a plant cell.

84. A plant cell or plant transformed with a nucleic acid molecule substantially as described in claim 66.

85. A plant cell comprising a genetic construct of claim 79.

86. The seed of a plant of claim 84.

87. A composition which includes an ingredient which is, or is obtained from, a plant of claim 84, or a part thereof.

88. Use of a nucleic acid molecule substantially as described in claim 66 to alter a plant or plant cell.

89. A method for producing an altered plant or plant cell using a nucleic acid molecule substantially as described in of claim 66 to alter the plant or plant cell, wherein the plant cell or plant is altered in at least one of:

(a) the production of flavonoids, or an intermediate in the production of flavonoids,

(b) the production of at least one condensed tannin, or monomer thereof,

(c) the production of a condensed tannin selected from catechin, epicatechin, epigallocatechin and gallocatechin,

(d) expression of at least one enzyme in a flavonoid biosynthetic pathway,

(e) expression of at least one enzyme in the condensed tannin biosynthetic pathway,

(f) altered expression of LAR and/or ANR.

90. The use or method of claim 89, wherein the altered production or expression, is increased production or expression.

91. The method of claim 89, wherein the altered production or expression, is in substantially all tissues of the plant.

92. The method of claim 89, wherein the altered production or expression is in the foliar tissue of the plant.

93. The method of claim 89, wherein the altered production or expression is in the vegetative portions of the plant.

94. The method of claim 89, wherein the altered production or expression is in the epidermal tissues of the plant.

95. The method of claim 89, wherein the altered production of flavonoids or condensed tannins, is in a tissue of the plant that is substantially devoid of the flavonoids or condensed tannins.

96. The method of claim 89, wherein the levels of flavonoids and/or condensed tannins altered by the present invention are sufficient to provide a therapeutic or agronomic benefit.

97. A plant produced by a method of claim 89.

98. A part, seed, fruit, harvested material, propagule or progeny of a plant of claim 84.

99. A part, seed, fruit, harvested material, propagule or progeny of a plant, wherein the plant, seed, fruit, harvested material, propagate or progeny is genetically modified to comprise at least one nucleic acid molecule of claim 66.

100. A part, seed, fruit, harvested material, propagule or progeny of a plant, wherein the plant, seed, fruit, harvested material, propagate or progeny is genetically modified to comprise at least one construct of claim 79.

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: