US20160220612A1
2016-08-04
14/916,963
2014-09-05
The present application is directed to compositions and methods for treating a subject with cancer and/or increasing migration of a mesenchymal stromal cells (MSCs) stimulated with a recombinant autocrine motility factor (rAMF) to a tumor or a tumor cell, e.g. hepatocellular carcinoma (HCC). In addition, methods for increasing adhesion of MSCs to endothelial cells with rAMF are disclosed. In some embodiments, the MSCs comprise a therapeutic agent, e.g., an anti-tumor agent.
Get notified when new applications in this technology area are published.
C12N5/0669 » CPC further
Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor; Animal cells or tissues; Human cells or tissues; Vertebrate cells; Cells of skeletal and connective tissues; Mesenchyme Bone marrow stromal cells; Whole bone marrow
C12N2501/40 » CPC further
Active agents used in cell culture processes, e.g. differentation Regulators of development
A61K35/28 » CPC main
Medicinal preparations containing materials or reaction products thereof with undetermined constitution; Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
The content of the electronically submitted sequence listing in ASCII text file (Name: â3181_006PC01_SequenceListing.asciiâ; Size: 10,549; and Date of Creation: Sep. 4, 2014) filed with the application is incorporated herein by reference in its entirety.
Mesenchymal stromal cells (MSCs) (also referred to as fibroblastic colony forming units or mesenchymal stem cells) constitute a heterogeneous cell population, characterized by their adherence to plastic, fibroblast-like morphology, expression of specific markers (e.g., CD105+, CD90+, CD73+), lack of hematopoietic markers (e.g., CD45, CD34, CD14 or CD11b, CD79a or CD19) and HLA class II and capability to differentiate in vitro into osteoblasts, adipocytes and chondroblasts (Dominici, M., K. Le Blanc, et al. (2006) Cytotherapy 8(4): 315-317). MSCs are most often derived from bone marrow (BM), but can also be isolated from adipose tissue (AT) or from umbilical cord; from the latter case, MSC are isolated from the Wharton's jelly (WJ-MSCs), perivascular areas (mesenchymal cells harvested from umbilical cord perivascular tissue) or umbilical cord blood (CB-MSCs) (Bernardo, M. E., F. Locatelli, et al. (2009) Ann N Y Acad Sci 1176: 101-117). MSCs show tropism for inflamed, injured or tumorigenic sites and their ability to be cultured and expanded in vitro, their self-renewal properties and low immunogenicity make these cells useful for cell therapy (Prockop, D. J. and J. Y. Oh (2012) J Cell Biochem 113(5): 1460-1469). However, the mechanisms involved in MSCs recruitment to tumors in general, and to specific tumors, e.g., hepatocellular carcinoma (HCC), are not fully understood.
Autocrine motility factor (AMF) is a 55-kDa cytokine (SEQ ID NO:1) secreted by tumors that regulates cell motility (Liotta, L. A., R. Mandler, et al. (1986) Proc Natl Acad Sci USA 83(10): 3302-3306). AMF was isolated, purified, and partially characterized from the serum-free conditioned medium of human A2058 melanoma cells (Liotta, L. A., R. Mandler, et al. (1986)). AMF exhibits sequence identity with glucose-6-phosphate isomerase (GPI) (alternatively known as phosphoglucose isomerase or phosphohexose isomerase (PHI)), a glycolytic enzyme involved in carbohydrate metabolism (Watanabe, H., K. Takehana, et al. (1996) Cancer Res 56(13): 2960-2963). The stimulation of cell motility is induced by the binding to the autocrine motility factor receptor (AMFR), a 78-kDa seven transmembrane glycoprotein with leucine zipper and RING-H2 motifs (Shimizu, K., M. Tani, et al. (1999) FEBS Lett 456(2): 295-300). AMFR is stably localized in caveolae, and caveolin-1 (Cav-1) has the ability to regulate the endocytic pathway through the stabilization of caveolae expression (Le, P. U., G. Guay, et al. (2002) J Biol Chem 277(5): 3371-3379).
AMF is secreted by different tumors such as lung (Dobashi, Y., H. Watanabe, et al. (2006) J Pathol 210(4): 431-440), gastrointestinal, kidney and mammary (Baumann, M., A. Kappl, et al. (1990) Cancer Invest 8(3-4): 351-356) as well as by hepatocellular carcinomas (Torimura, T., T. Ueno, et al. (2001) Hepatology 34(1): 62-71). Migration of hepatocellular carcinoma cells upon AMF stimulation has been associated to upregulation of metalloproteinase 3 (MMP3) (Yu, F. L., M. H. Liao, et al. (2004) Biochem Biophys Res Commun 314(1): 76-82) and activation of the small G-protein RhoC (Yanagawa, T., H. Watanabe, et al. (2004) Lab Invest 84(4): 513-522).
Hepatocellular carcinoma (HCC) is the sixth most common cancer worldwide and the third cause of cancer-related death (Ferenci, P., M. Fried, et al. (2010) J Gastrointestin Liver Dis 19(3): 311-317). Most cases of HCC are secondary to either a viral hepatitis infection (hepatitis B or C) or cirrhosis. Curative therapies such as resection or liver transplantation have been demonstrated to improve patient survival (de Lope, C. R., S. Tremosini, et al. (2012) J Hepatol 56 Suppl 1: S75-87); however, these strategies can only be applied to a minority of patients. Therefore, there is an urgent therapeutic need for patients with HCC.
The present application relates to the combined use of cellular and gene therapy to deliver therapeutic genes, e.g., an anti-tumor agent, into tumoral or peritumoral tissues. In some embodiments, the application relates to compositions and methods for treating a subject with cancer and/or increasing migration of a mesenchymal stromal cells (MSCs) to a tumor or a tumor cell, e.g. hepatocellular carcinoma (HCC), wherein the MSC comprises a therapeutic agent, e.g., an anti-tumor agent, and is stimulated with a recombinant autocrine motility factor (rAMF). In addition, methods for increasing adhesion of MSCs to endothelial cells with rAMF are disclosed.
FIG. 1A-B. Shows real-time PCR (RT-PCR) relative expression of (A) up-regulated and (B) down-regulated genes in MSCs exposed to tumor conditioned media (TCM).
FIG. 2A-G. Shows (A) detection of AMF (55 kDa) by Western blot in CCM derived from HCC cells and TCM from ex vivo HCC s.c. tumors (upper panel). Colloidal Coomassie staining was performed as loading control (lower panel). MSCs migration was analyzed using Boyden chamber assays with rAMF as chemoattractant for (B) BM-MSCs, (C) Mesenchymal cells harvested from umbilical cord perivascular tissue or (D) AT-MSCs. Results are expressed as percentage of control (DMEM)ÂąSEM. *p<0.05 and **p<0.01 vs DMEM (ANOVA and Dunnett's test). Cell migration of (E) BM-MSCs, (F) Mesenchymal cells harvested from umbilical cord perivascular tissue or (G) AT-MSCs towards TCM derived from HuH7 (gray bars) or HC-PT-5 (black bars) pretreated with anti-AMF-Ab (AMF-ab) or control isotype IgG (IgG-ab) is shown. Results are expressed as percentage of control (isotype control)ÂąSEM. *p<0.05 and **p<0.01 vs isotype control (ANOVA and Dunnett's comparison test). Results are representative of 3 independent experiments.
FIG. 3A-D. Shows (A) MMP3 expression determined by qRT-PCR in BM-MSCs (black bars), Mesenchymal cells harvested from umbilical cord perivascular tissue (white bars) or AT-MSCs (gray bars) stimulated with 1 Îźg/ml of rAMF. **p<0.01 vs unstimulated cells (DMEM, unpaired Student's t test). (B) MMP2 activity evaluated by zymography in supernatants of BM-MSCs (black bars), Mesenchymal cells harvested from umbilical cord perivascular tissue (white bars) or AT-MSCs (gray bars) pre-stimulated with 1 Îźg/mL of rAMF. Band intensity of 3 independent experiments was detected by densitometric evaluation and plotted as MMP2 relative activity. One representative image of the zymography is shown. *p<0.05, **p<0.01 and ***p<0.001 vs untreated cells (DMEM, ANOVA and Tukey's comparison test). (C) MMP2 activity was evaluated by zymography in MSCs (BM-MSCs, black bars; Mesenchymal cells harvested from umbilical cord perivascular tissue, white bars; and AT-MSCs, gray bars) culture supernatant stimulated with TCM from HuH7 cells. TCM from HuH7 cells was blocked with anti-AMF (AMF-ab) or isotype control (IgG-ab). Band intensity of 3 independent experiments was detected by densitometric evaluation and plotted as MMP2 relative activity. One representative image of the zymography is shown. *p<0.05 and **p<0.01 vs DMEM (ANOVA); # p<0.05, ## p<0.01 and ### p<0.001 vs AMF-blocked TCM from HuH7 (HuH7 TCM+/AMF-ab+, ANOVA and Tukey's comparison test). (D) Invasion capacity of untreated BM-MSCs (white bars) or BM-MSCs stimulated with rAMF (black bars) to type IV collagen using TCM from HuH7 or HC-PT-5 preincubated with different doses of the MMP inhibitor 1,10 phenantroline (Phe). ***p<0.001 vs without stimulation with rAMF and acra p<0.001 vs without preincubation with Phe (ANOVA). Results are representative of 3 independent experiments.
FIG. 4A-E. Shows (A) pretreatment of BM-MSCs with 1 Îźg/mL rAMF (black bars) increases chemotaxis towards TCM derived from HuH7 or HC-PT-5 cells compared to untreated cells (white bars). (B) Shows a wound-healing assay of MSCs after pretreatment with rAMF or control (DMEM). Representative images were taken 24 hours after scratching. (C) Adhesion to HMEC-1 endothelial cells was increased in BM-MSCs exposed to rAMF. (D) Shows expression of AMF receptor (AMFR), GDP dissociation inhibitor 2 (GDI-1), caveolin-1 (CAV-1) and caveolin-2 (CAV-2) by qRT-PCR. *p<0.05, **p<0.01 and ***p<0.001 vs untreated cells (DMEM, white bars, unpaired Student's t-test. (E) Shows increased expression of AMFR, JNK, p-JNK, c-Fos, p-c-Fos and p-CREB in AMF-treated MSCs evaluated by western blot.
FIG. 5A-G. BM-MSCs pre-stimulated with 1 Îźg/ml of rAMF were labeled with DiR and CMDiI cell trackers and i.v. injected in s.c. HuH7 tumor-bearing mice. After 3 days, tumors were removed and fluorescence imaging (FI) was performed. (A) Shows total fluorescent intensity as calculated by measuring the region of interest (ROI) for all the tissues isolated and the results were expressed as total radiant efficiency. ns, non significant. (B) Shows representative tumors images of mice inoculated with rAMF-prestimulated BM-MSCs (MSC-rAMF) or unstimulated cells (MSCs). Images represent the average radiant efficiency. Region of interest (ROI) was calculated for the isolated (C) tumor, (D) liver, (E) lung and (F) spleen and the results were expressed as the average radiant efficiency. **p<0.01 vs unstimulated BM-MSCs (unpaired Student's t-test). (G) Shows microscopic analysis of transplanted CM-DiI-labeled MSCs (red signal indicated by arrows) and DAPI staining in frozen sections of tumors. Magnification Ă200.
FIG. 6A-C. (A) Shows in vitro proliferation of HuH7 cells exposed to MSCs, AMF-pretreated MSCs (MSC-rAMF) or unexposed cells (DMEM). *p<0.05 vs DMIiM (ANOVA and Tukey's comparison test). (B) Multicellular spheroid growth composed by HCC tumor cells, hepatic stellate cells and endothelial cells (control) or also by MSCs or MSCs prestimulated with rAMF (ANOVA and Tukey's comparison test). (C) In vivo tumor growth of s.c. HuH7 (saline) and also i.v. injected with MSCs or AMF-pretreated MSCs (ANOVA and Tukey's comparison test).
FIG. 7A-B. (A) Shows in vitro migration of BM-MSCs (black bars) or HUCPVCs (grey bars) towards CCM from HCC (HuH7 and HC-PT-5), hepatic stellate cells (LX-2), fibroblasts (WI-38) or endothelial cells (HMEC-1). Bars represent the average of MSCs/field (10Ă)ÂąSEM from three representative visual fields. Results are representative of 3 independent experiments. # p<0.001 vs DMEM; ***p<0.001 vs BM-MSCs. (B) Adhesion towards endothelial cells of BM-MSCs (black bars) or HUCPVCs (grey bars) was measured. Results are representative of 3 independent experiments. ***p<0.001 vs BM-MSCs.
FIG. 8A-F. CM-DiI and DiR pre-labeled MSCs were i.v. injected in s.c. HuH7 bearing mice. At day 3, mice were sacrificed and organs were removed: (A) lungs, livers, spleen and (C) tumors were exposed to obtain fluorescent images. Images represent the average radiant efficiency. Representative images are shown. (B) Total fluorescent intensity for injected BM-MSCs or HUCPVCs was calculated by measuring the region of interest (ROI) for all the tissues isolated and results were expressed as total radiant efficiency [p/s]/[ÎźW/cm2]. ***p<0.001. (D) Signal present in the isolated liver, spleen, lungs and tumors was represented as percentage of total signal for BM-MSCs or HUCPVCs injected mice. *p<0.05 vs BM-MSCs. (E) Microscopic analysis of transplanted CM-DiI-labeled MSCs (red signal indicated by arrows) and DAPI staining in frozen sections of tumors. 200Ă magnification. (F) In vitro migration of MSCs to TCM derived from HuH7 or HC-PT-5 s.c. tumors. Bars represent the average of MSCs/field (10Ă)ÂąSEM from three representative visual fields. Results are representative of 3 independent experiments. ***p<0.001 vs BM-MSCs
FIG. 9A-B. Expression of (A) cytokines and chemokines receptors and (B) AMF/AMFR axis proteins was evaluated in BM-MSCs (black bars) or HUCPVCs (grey bars) by qPCR. ***p<0.001 vs BM-MSCs.
FIG. 10A-B. (A) In vitro migration of BM-MSCs (black bars) or HUCPVCs (grey bars) towards rAMF was measured. # p<0.05 vs DMEM (0 Îźg/ml rAMF); *p<0.05 vs BM-MSCs. (B) In vitro migration of BM-MSCs (black bars) or HUCPVCs (grey bars) towards HC-PT-5 TCM pre-incubated with anti-AMF antibody (AMF-ab) or control isotype (IgG-ab) was evaluated. # p<0.05 vs IgG-ab; *p<0.05 vs BM-MSCs. Bars represent the average of MSCs/field (10Ă)+SEM from three representative visual fields. Results are representative of 3 independent experiments.
FIG. 11A-B. Shows (A) Migration (% of control) towards CM-HuH7 of MSCs pre-incubated with anti-CXCR1, anti-CXCR2 or both (anti-CXCR1+anti-CXCR2) or isotype control (IgG) for 1 h. *p<0.05 and **p<0.01 vs IgG isotype control. (B) Migration (% of control) of MSCs towards CM-HuH7 pre-incubated with anti-HGF or anti-MCP-1 for 1 h. *p<0.05 vs DMEM. Results were expressed as percentage of control (DMEM).
To facilitate an understanding of the present invention, a number of terms and phrases are defined below:
âIsolatedâ in regard to cells, refers to a cell that is removed from its natural environment (such as in a solid tumor) and that is isolated or separated, and is at least about 30% free, about 50% free, about 75% free, about 90% free, about 95% free, or 100% free, from other cells with which it is naturally present, but which lack the marker based on which the cells were isolated.
As used herein, the term âheterologousâ refers to, e.g., a gene, polypeptide or cell that is not in its natural environment; thus, it is non-naturally-occurring. For example, a heterologous gene or polypeptide includes a gene or polypeptide from one species introduced into another species. A heterologous gene or polypeptide also includes a gene or polypeptide native to an organism that has been altered in some way (e.g., mutated, added in multiple copies, linked to non-native regulatory sequences, etc.). In another example, a heterologous cell includes a cell native to an organism that has been altered in some way (e.g., genetically modified to include a recombinant gene, protein, or virus).
âTumorâ and âneoplasmâ as used herein refer to any mass of tissue that results from excessive cell growth or proliferation, either benign (noncancerous) or malignant (cancerous) including pre-cancerous lesions.
As used herein, the terms âcancerâ and âcancerousâ refer to or describe the physiological condition in mammals in which a population of cells are characterized by unregulated cell growth. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More particular examples of such cancers include liver cancer (e.g., hepatocellular carcinoma (HCC)), colon cancer, colorectal cancer (e.g., colorectal carcinoma), gastrointestinal cancer, pancreatic cancer, lung cancer, breast cancer, and kidney cancer.
âMetastasisâ as used herein refers to the process by which a cancer spreads or transfers from the site of origin to other regions of the body with the development of a similar cancerous lesion at the new location. A âmetastaticâ or âmetastasizingâ cell is one that loses adhesive contacts with neighboring cells and migrates via the bloodstream or lymph from the primary site of disease to invade neighboring body structures.
The terms âcancer cellâ, âtumor cellâ and grammatical equivalents refer to the total population of cells derived from a tumor or a pre-cancerous lesion including both non-tumorigenic cells, which comprise the bulk of the tumor cell population, and tumorigenic cells (e.g., cancer stem cells).
As used herein, the term âsubjectâ refers to any animal (e.g., a mammal), including, but not limited to, humans, non-human primates, rodents, and the like, which is to be the recipient of a particular treatment. Typically, the terms âsubjectâ and âpatientâ are used interchangeably herein in reference to a human subject.
As used herein, the term âsubject suspected of having cancerâ refers to a subject that presents one or more symptoms indicative of a cancer (e.g., a noticeable lump or mass) or is being screened for a cancer (e.g., during a routine physical). A subject suspected of having cancer can also have one or more risk factors. A subject suspected of having cancer has generally not been tested for cancer. However, a âsubject suspected of having cancerâ encompasses an individual who has received an initial diagnosis but for whom the stage of cancer is not known. The term further includes people who once had cancer (e.g., an individual in remission).
As used herein, the term âsubject at risk for cancerâ refers to a subject with one or more risk factors for developing a specific cancer. Risk factors include, but are not limited to, gender, age, genetic predisposition, environmental exposure, previous incidents of cancer, pre-existing non-cancer diseases, and lifestyle.
As used herein, the term âsubject diagnosed with a cancerâ refers to a subject who has been tested and found to have cancerous cells. The cancer can be diagnosed using any suitable method, including but not limited to, biopsy, x-ray, blood test, and the diagnostic methods of the present invention.
As used herein, the terms âbiopsy tissueâ, âpatient sampleâ, âtumor sampleâ, and âcancer sampleâ refer to a sample of cells, tissue or fluid that is removed from a subject for the purpose of determining if the sample contains cancerous tissue, including cancer stem cells or for determining gene expression profile of that cancerous tissue. In some embodiments, biopsy tissue or fluid is obtained because a subject is suspected of having cancer. The biopsy tissue or fluid is then examined for the presence or absence of cancer, cancer stem cells, and/or cancer stem cell gene signature expression.
As used herein, the term âcharacterizing cancer in a subjectâ refers to the identification of one or more properties of a cancer sample in a subject, including but not limited to, the presence of benign, pre-cancerous or cancerous tissue, the stage of the cancer, and the subject's prognosis. Cancers can be characterized by the identification of the expression of one or more cancer marker genes, including but not limited to, any cancer markers disclosed herein.
As used herein, the term âgene expressionâ refers to the process of converting genetic information encoded in a gene into RNA (e.g., mRNA, rRNA, tRNA, or snRNA) through âtranscriptionâ of the gene (e.g., via the enzymatic action of an RNA polymerase), and for protein encoding genes, into protein through âtranslationâ of mRNA. Gene expression can be regulated at many stages in the process. âUp-regulationâ or âactivationâ refers to regulation that increases the production of gene expression products (e.g., RNA or protein), while âdown-regulationâ or ârepressionâ refers to regulation that decrease production. Molecules (e.g., transcription factors) that are involved in up-regulation or down-regulation are often called âactivatorsâ and ârepressors,â respectively.
The terms âhigh levelsâ, âincreased levelsâ, âhigh expressionâ, âincreased expressionâ, âelevated levelsâ or âup-regulated expressionâ in regard to gene expression are used herein interchangeably to refer to expression of a gene in a cell or population of cells at levels higher than the expression of that gene in a second cell or population of cells. In certain embodiments, âhigh levelsâ, âincreased levelsâ, âhigh expressionâ, âincreased expressionâ, âelevated levelsâ or âup-regulated expressionâ can be determined by detecting the amount of a polynucleotide (mRNA, cDNA, etc.) in tumor cells, for example, by quantitative RT-PCR or microarray analysis; or by detecting the amount of a protein in tumor cells, for example, by ELISA, Western blot, quantitative immunofluorescence.
As used herein, the terms âlow levelsâ, âdecreased levelsâ, âlow expressionâ, âreduced expressionâ or âdecreased expressionâ in regards to gene expression are used herein interchangeably to refer to expression of a gene in a cell or population of cells, at levels less than the expression of that gene in a second cell or population of cells. âLow levelsâ of gene expression can be determined by detecting decreased to nearly undetectable amounts of a polynucleotide (mRNA, cDNA, etc.) in tumor cells, for example, by quantitative RT-PCR or microarray analysis. Alternatively âlow levelsâ of gene expression can be determined by detecting decreased to nearly undetectable amounts of a protein in tumor cells, for example, ELISA, Western blot, or quantitative immunofluorescence.
The term âundetectable levelsâ or âloss of expressionâ in regards to gene expression as used herein refers to expression of a gene in a cell or population of cells, at levels that cannot be distinguished from background using conventional techniques such that no expression is identified. âUndetectable levelsâ of gene expression can be determined by the inability to detect levels of a polynucleotide (mRNA, cDNA, etc.) in tumor cells above background by, for example, quantitative RT-PCR or microarray analysis. Alternatively âundetectable levelsâ of gene expression can be determined by the inability to detect levels of a protein in tumor cells above background by, for example, ELISA, Western blot, or immunofluorescence.
As used herein, if the expression is âbelow the level of detectionâ for a given assay, the expression may still be detectable by another assay.
As used herein, the term ânucleic acid moleculeâ refers to any nucleic acid containing molecule, including but not limited to, DNA or RNA. The term encompasses sequences that include any of the known base analogs of DNA and RNA including, but not limited to, 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxyl-methyl) uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethyl-guanine, 2-methyladenine, 2-methylguanine, 3-methyl-cytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxy-amino-methyl-2-thiouracil, beta-D-mannosylqueosine, 5â˛-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, N-uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, and 2,6-diaminopurine.
The term âgeneâ refers to a nucleic acid (e.g., DNA) sequence that comprises coding sequences necessary for the production of a polypeptide, precursor, or RNA (e.g., rRNA, tRNA). The polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence so long as the desired activities or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, immunogenicity, etc.) of the full-length polypeptide or fragment are retained. The term also encompasses the coding region of a structural gene and the sequences located adjacent to the coding region on both the 5Ⲡand 3Ⲡends for a distance of about 1 kb or more on either end such that the gene corresponds to the length of the full-length mRNA. Sequences located 5Ⲡof the coding region and present on the mRNA are referred to as 5Ⲡnon-translated sequences. Sequences located 3Ⲡor downstream of the coding region and present on the mRNA are referred to as 3Ⲡnon-translated sequences. The term âgeneâ encompasses both cDNA and genomic forms of a gene. A genomic form or clone of a gene contains the coding region interrupted with non-coding sequences termed âintronsâ or âintervening regionsâ or âintervening sequences.â Introns are segments of a gene that are transcribed into nuclear RNA (hi RNA); introns can contain regulatory elements such as enhancers. Introns are removed or âspliced outâ from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. A cDNA form of a gene is âintron-freeâ and non-naturally-occurring.
As used herein, the term âheterologous geneâ refers to a gene that is not in its natural environment; thus, it is non-naturally-occurring. For example, a heterologous gene includes a gene from one species introduced into another species. A heterologous gene also includes a gene native to an organism that has been altered in some way (e.g., mutated, added in multiple copies, linked to non-native regulatory sequences, etc.). Heterologous genes are distinguished from endogenous genes in that the heterologous gene sequences are typically joined to DNA sequences that are not found naturally associated with the gene sequences in the chromosome or are associated with portions of the chromosome not found in nature (e.g., genes expressed in loci where the gene is not normally expressed).
As used herein, the term âgene expressionâ refers to the process of converting genetic information encoded in a gene into RNA (e.g., mRNA, rRNA, tRNA, or snRNA) through âtranscriptionâ of the gene (e.g., via the enzymatic action of an RNA polymerase), and for protein encoding genes, into protein through âtranslationâ of mRNA. Gene expression can be regulated at many stages in the process. âUp-regulationâ or âactivationâ refers to regulation that increases the production of gene expression products (e.g., RNA or protein), while âdown-regulationâ or ârepressionâ refers to regulation that decrease production. Molecules (e.g., transcription factors) That are involved in up-regulation or down-regulation are often called âactivatorsâ and ârepressors,â respectively.
In addition to containing introns, genomic forms of a gene can also include sequences located on both the 5Ⲡand 3Ⲡend of the sequences that are present on the RNA transcript. These sequences are referred to as âflankingâ sequences or regions (these flanking sequences are located 5Ⲡor 3Ⲡto the non-translated sequences present on the mRNA transcript). The 5Ⲡflanking region can contain regulatory sequences such as promoters and enhancers that control or influence the transcription of the gene. The 3Ⲡflanking region can contain sequences that direct the termination of transcription, posttranscriptional cleavage and polyadenylation.
As used herein, the terms ânucleic acid molecule encoding,â âDNA sequence encoding,â and âDNA encodingâ refer to the order or sequence of deoxyribonucleotides along a strand of deoxyribonucleic acid. The order of these deoxyribonucleotides determines the order of amino acids along the polypeptide (protein) chain. The DNA sequence thus codes for the amino acid sequence.
âPolypeptide,â âpeptideâ and âproteinâ are used interchangeably and refer to a polymeric compound comprised of covalently linked amino acid residues.
An âisolated polypeptide,â âisolated peptideâ or âisolated proteinâ refer to a polypeptide or protein that is substantially free of those compounds that are normally associated therewith in its natural state (e.g., other proteins or polypeptides, nucleic acids, carbohydrates, lipids). âIsolatedâ is not meant to exclude artificial or synthetic mixtures with other compounds, or the presence of impurities which do not interfere with biological activity, and which can be present, for example, due to incomplete purification, addition of stabilizers, or compounding into a pharmaceutically acceptable preparation.
As used herein, the term âheterologous polypeptideâ refers to a polypeptide that is not in its natural environment; thus, it is non-naturally-occurring. For example, a heterologous polypeptide includes a polypeptide from one species introduced into another species. A heterologous polypeptide also includes a polypeptide native to an organism that has been altered in some way (e.g., mutated, added in multiple copies, linked to non-polypeptide, etc.). Heterologous polypeptide are distinguished from endogenous polypeptide in that the heterologous polypeptide sequences are typically encoded by cDNA sequences that are not found naturally associated with the gene sequences in the chromosome or are associated with portions of the chromosome not found in nature (e.g., genes expressed in loci where the gene is not normally expressed).
A mutation can be made by any technique for mutagenesis known in the art, including but not limited to, in vitro site-directed mutagenesis (Hutchinson et al., J Biol. Chem. 253:6551 (1978); Zoller et al., DNA 3:479 (1984); Oliphant et al., Gene 44:177 (1986); Hutchinson et al., Proc. Natl. Acad. Sci. USA 83:710 (1986)), use of TABÂŽ linkers (Pharmacia), restriction endonuclease digestion/fragment deletion and substitution, PCR-mediated/oligonucleotide-directed mutagenesis, and the like. PCR-based techniques are preferred for site-directed mutagenesis (see Higuchi, 1989, âUsing PCR to Engineer DNAâ, in PCR Technology: Principles and Applications for DNA Amplification, H. Erlich, ed., Stockton Press, Chapter 6, pp. 61-70).
A âvariantâ of a polypeptide or protein refers to any analogue, fragment, derivative, or mutant which is derived from a polypeptide or protein and which retains at least one biological property of the polypeptide or protein. Different variants of the polypeptide or protein can exist in nature. These variants can be allelic variations characterized by differences in the nucleotide sequences of the structural gene coding for the protein, or can involve differential splicing or post-translational modification. The skilled artisan can produce non-naturally-occurring variants having single or multiple amino acid substitutions, deletions, additions, or replacements. These variants can include, inter alia: (a) variants in which one or more amino acid residues are substituted with conservative or non-conservative amino acids, (b) variants in which one or more amino acids are added to the polypeptide or protein, (c) variants in which one or more of the amino acids includes a substituent group, and (d) variants in which the polypeptide or protein is fused with another polypeptide such as serum albumin. The techniques for obtaining non-naturally-occurring variants, including genetic (suppressions, deletions, mutations, etc.), chemical, and enzymatic techniques, are known to persons having ordinary skill in the art.
The term âpercent identity,â as known h the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, âidentityâ also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. âIdentityâ and âsimilarityâ can be readily calculated by known methods, including but not limited to those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, New York (1991). Preferred methods to determine identity are designed to give the best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations can be performed using sequence analysis software such as the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Multiple alignment of the sequences can be performed using the Clustal method of alignment (Higgins et al., CABIOS. 5:151 (1989)) with the default parameters (GAP PENALTY-10, GAP LENGTH PENALTY-10). Default parameters for pairwise alignments using the Clustal method can be selected: KTUPLE 1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5.
The term âsequence analysis softwareâ refers to any computer algorithm or software program that is useful for the analysis of nucleotide or amino acid sequences. âSequence analysis softwareâ can be commercially available or independently developed. Typical sequence analysis software includes, but is not limited to, the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wis.), BLASTP, BLASTN, BLASTX (Altschul et al., J. Mol. Biol. 215:403 (1990)), and DNASTAR (DNASTAR, Inc. 1228 S. Park St. Madison, Wis. 53715 USA). Within the context of this application it will be understood that where sequence analysis software is used for analysis, that the results of the analysis will be based on the âdefault valuesâ of the program referenced, unless otherwise specified. As used herein âdefault valuesâ will mean any set of values or parameters that originally load with the soft ware when first initialized.
As used herein, the term âin vitroâ refers to an artificial environment and to processes or reactions that occur within an artificial environment. In vitro environments can consist of but are not limited to, test tubes and cell culture. The term âin vivoâ refers to the natural environment (e.g., an animal or a cell) that can be, but are not limited to, processes or reaction that occur within a natural environment.
As used herein, the term âex vivoâ refers to âoutsideâ the body. The terms âex vivoâ and âin vitroâ can be used interchangeably herein.
As used herein, the term âsampleâ is used in its broadest sense. In one sense, it is meant to include a specimen or culture obtained from any source, as well as biological and environmental samples. Biological samples can be obtained from animals (including humans) and encompass fluids, solids, tissues, and gases. Biological samples include blood products, such as plasma, serum and the like. Environmental samples include environmental material such as surface matter, soil, water, crystals and industrial samples. Such examples are not however to be construed as limiting the sample types applicable to the present invention.
In certain embodiments, terms such as âtreatingâ or âtreatmentâ or âto treatâ refer to both 1) therapeutic measures that cure, slow down, lessen symptoms of, and/or halt progression of a diagnosed pathologic condition or disorder and 2) prophylactic or preventative measures that prevent or slow the development of a targeted pathologic condition or disorder. Thus, those in need of treatment include those already with the disorder; those prone to have the disorder; those who may have had the disorder and in whom the disorder may recur; and, those in whom the disorder is to be prevented. In certain embodiments, a subject is successfully âtreatedâ if the patient shows one or more of the following: a reduction in the number of or complete absence of cancer cells; a reduction in the tumor size; inhibition of or an absence of cancer cell infiltration into peripheral organs including the spread of cancer into soft tissue and bone; inhibition of or an absence of tumor metastasis; inhibition or an absence of tumor growth; relief of one or more symptoms associate with the specific cancer; reduced morbidity and/or mortality; improvement in quality of life; a reduction in the number of or complete absence of cancer stem cells; a decrease in the proportion of cancer stem cells in a solid tumor (relative to cells in the tumor that are not cancer stem cells); inhibit the proliferation of cancer stem cells; and a delay in or an absence of relapse.
In certain embodiments, the term âtherapeutically effective amountâ refers to an amount of a therapeutic agent, e.g., an antibody, polypeptide, polynucleotide, small organic molecule, or other drug effective to âtreatâ a disease or disorder in a subject. In the case of cancer, the therapeutically effective amount of the therapeutic agent can, in certain embodiments, reduce the number of cancer cells; reduce the proportion of cancer cells in a solid tumor; reduce the tumor size; inhibit or stop cancer cell infiltration into peripheral organs; inhibit and/or stop tumor metastasis; inhibit and stop tumor growth; relieve to some extent one or more of the symptoms associated with the cancer; inhibit the proliferation of cancer cells; or result in a combination of such effects on cancer cells.
As used herein, âpharmaceutically acceptable carrierâ includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutically active substances is well knows in the art. Except insofar as any conventional media or agent is incompatible with the vectors or cells presented herein, its use it therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions.
Mesenchymal stromal cells (MSCs) (also referred to as fibroblastic colony forming units or mesenchymal stem cells) constitute a heterogeneous cell population, characterized by their adherence to plastic, fibroblast-like morphology, expression of specific markers (CD105+, CD90+, CD73+), lack of hematopoietic markers (CD45, CD34, CD14 or CD11b, CD79a or CD19) and HLA class II and capability to differentiate in vitro into osteoblasts, adipocytes and chondroblasts (Dominici, M., K. Le Blanc, et al. (2006) Cytotherapy 8(4): 315-317). MSCs are most often derived from bone marrow (BM), but can also be isolated from adipose tissue (AT) or from umbilical cord (youngest, most primitive MSCs); from the latter case, MSCs are isolated from the Wharton's jelly (WJ-MSCs), perivascular areas (Mesenchymal cells harvested from umbilical cord perivascular tissue) or umbilical cord blood (CB-MSCs) (Bernardo, M. E., F. Locatelli, et al. (2009) Ann N Y Acad Sci 1176: 101-117). Other rich sources for MSCs are the developing tooth bud of the mandibular third molar and amniotic fluid. It has also been reported that MSCs can be successfully isolated from human peripheral blood (Chong P P et al. (2012) J Orthop Res. 30(4):634-42). The MSCs can be isolated from the whole umbilical cord and in this case can be referred to as âmesenchymal cells derived from umbilical cord.â It is noted that as the umbilical cord has different structures, and the isolation of MSCs can also be made or harvested from only a âregionâ or âstructureâ such as the perivascular tissue, the Wharton's jelly, or the umbilical cord blood.
MSCs have a great capacity for self-renewal while maintaining their multipotency. A standard test to confirm multipotency is differentiation of the cells into osteoblasts, adipocytes, and chondrocytes as well as myocytes and neurons. Other attractive features of MSCs include that they are readily isolated from bone marrow by their adherence to tissue culture surfaces, they rapidly expanded in culture, they are highly clonogenic in that they efficiently generated single-cell derived colonies, and they are readily seen to differentiate in culture or in vivo into several cellular phenotypes such as osteoblasts, adipocytes, and chondrocytes. These properties are retained as the cells are expanded through 20 or so population doublings, particularly if the cells were plated at low density and passed before they reach confluency (Gregory C A, et al. (2005) Sci STKE 294:pe37). The plasticity of MSCs was also illustrated by experiments in which MSCs were cultured without fetal calf serum (Pochampally et al. (2004) Blood 103:1647-1652) or, even more dramatically, when the MSCs were subjected to environmental stress in culture to generate multi-lineage-differentiating stress-enduring MSCs or Muse cells (Wakao et al. (2011) Proc Natl Acad Sci USA 108:9875-9880). Under such circumstances, the MSCs reverted to a more primitive phenotype and expressed genes characteristic of embryonic genes.
MCSs have been observed to have anti-inflammatory effects. The disease models in which MSCs have produced beneficial effects include diabetes, stroke, spinal cord injury, Parkinsonism, Alzheimer's disease, liver disease, kidney disease, and some cancers. See Prockop, D. J. and J. Y. Oh (2012) J Cell Biochem 113(5): 1460-1469. MSCs have also been shown to contribute to cancer progression, e.g., hematological malignancies (Torsvik A. and Bjerkvig R. (2013) Cancer Treat Rev. 39(2)180-8).
MSCs have the ability to migrate and engraft tumors and it is thought that factors produced by tumor cells and their microenvironments are responsible. MSC motility in vitro has been induced after stimulation with different cytokines (Ries, Egea et al. (2007). Blood 109(9): 4055-4063), growth factors (Ponte, Marais et al. (2007) Stem Cells 25(7): 1737-1745), or chemokines such as CXCL7 (Kalwitz, Endres et al. (2009) Int J Biochem Cell Biol 41(3): 649-658) or SDF-1 (Gao, Priebe et al. (2009) Stem Cells 27(4): 857-865). However, this application is the first report demonstrating the increased MSCs in vivo migration towards HCC with a simple treatment with rAMF. Reports have demonstrated MSC migration towards a number of tumor-released factors (e.g., VEGF, PDGF, TGF-β, MCP-1, IL-8, TNF-ι, IL-1β, IL-6, SDF-1, and HGF). However, there is a lack of robust data confirming the role of any specific factors in the recruitment of MSCs towards tumors such as HCC.
MSCs show tropism for inflamed, injured or tumorigenic sites and their ability to be cultured and expanded in vitro, their self-renewal properties and low immunogenicity make these cells useful for cell therapy (Prockop, D. J. and J. Y. Oh (2012) J Cell Biochem 113(5): 1460-1469). Although there are some promising results with MSCs genetically modified as a therapeutic option for HCC (Gao, Yao et al. (2010) Oncogene 29(19): 2784-2794; Niess, Bao et al. (2011) Ann Surg 254(5): 767-774; discussion 774-765), these reports left a need to enhance the efficacy of MSCs migration towards tumor (e.g., HCC) microenvironment. The current application includes certain embodiments where MSCs, e.g., MSCs genetically modified to express an anti-tumor gene, are pretreated with rAMF to increase migration toward a tumor microenvironment.
In some embodiments a method for the genetic modification of MSCs is by chemical (e.g. Lipofectamine) or physical (e.g. electroporation) transfection or viral vectors. Afterwards stably transfected cells can be selected, where the transgene cassette has integrated by chance into the MSC genome. In another embodiment, the genetic modification of MSCs is by using non-viral vector systems derived from transposons. After flanking of an expression cassette with terminal inverted repeats, a construct can be transferred into MSC via transfection. If a transposase is expressed in trans during the transfection, the expression cassette will be stably integrated into the genome of the MSC.
A genetically modified MSC according to some embodiments of the invention can be prepared by transduction of native MSCs with pseudotyped virions, expressing foreign glycoproteins on their surface, which alter the tropism and often the titer of the virion.
A genetically modified MSC according to some embodiments can be engineered to express an oncolytic virus expressing anti-tumor genes.
Autocrine motility factor (AMF) is a 55-kDa cytokine secreted by tumors that regulates cell motility (Liotta, L. A., R. Mandler, et al. (1986) Proc Natl Acad Sci USA 83(10): 3302-3306). AMF exhibits sequence identity with glucose-6-phosphate isomerase (GPI), a glycolytic enzyme involved in carbohydrate metabolism (Watanabe, H., K. Takehana, et al. (1996) Cancer Res 56(13): 2960-2963). The stimulation of cell motility is induced by the binding to the autocrine motility factor receptor (AMFR), a 78-kDa seven transmembrane glycoprotein with leucine zipper and RING-H2 motifs (Shimizu, K., M. Tani, et al. (1999) FEBS Lett 456(2): 295-300). AMFR is stably localized in caveolae, and caveolin-1 (Cav-1) has the ability to regulate the endocytic pathway through the stabilization of caveolae expression (Le, P. U., G. Guay, et al. (2002) J Biol Chem 277(5): 3371-3379).
One of the key steps in the transmigration process across the basement membrane is dependent on the proteolytic activity of metalloproteinases. In tumor cells, AMF-induced motility is mediated by upregulation of MMP2 and MMP3 (Torimura, Ueno et al. (2001) Hepatology 34(1): 62-71; Yu, Liao et al. (2004) Biochem Biophys Res Commun 314(1): 76-82). As disclosed herein, AMF was shown to increase the expression of mRNA MMP3 in MSCs. It was previously reported that MSCs exposed to CM derived from HCC cell lines increased their MMP2 activity (Garcia, Bayo et al. (2011) Mol Pharm 8(5): 1538-1548). As disclosed herein, AMF present in the CM is, at least in part, responsible for the increased in MMP2 activity since blockage of AMF decreased MMP2 activity. In addition, stimulation with rAMF increased the invasion capacity of MSCs across collagen and the MMPs inhibitor significantly decreased the invasion capacity of MSCs.
AMF is produced by several tumors, such as lung (Dobashi, Watanabe et al. (2006) J Pathol 210(4):431-440), gastrointestinal, kidney and breast (Baumann, Kappl et al. (1990) Cancer Invest 8(3-4):351-356 as well as hepatocellular carcinomas (HCC) (Ogata, Torimura et al. (1999) Hum Pathol 30(4): 443-450). It is also reported herein that AMF is secreted in the CM from HCC s.c tumors.
AMF is not considered a typical chemotactic factor such as VEGF, PDGF, TGF-β, MCP-1, IL-8, TNF-ι, IL-1β, IL-6, SDF-1, and HGF. Instead, intracellular AMF has been shown to be involved in glucose metabolism in all types of cells and some reports have described the extracellular form of AMF as inducing tumor migration and endothelial cell migration related to angiogenesis.
AMF-induced migration has been described in tumor cells and its role in metastasis. In vitro studies have demonstrated that exogenous AMF stimulated migration of human cancer melanoma, fibrosarcoma and HCC cells as well as human umbilical vein endothelial cells (HUVECs) (Liotta, Mandler et al. (1986) Proc Natl Acad Sci USA 83(10): 3302-3306; Silletti, Watanabe et al. (1991) Cancer Res 51(13): 3507-3511; Watanabe, Carmi et al. (1991) J Biol Chem 266(20): 13442-13448; Torimura, Ueno et al. (2001) Hepatology 34(1): 62-71). Overexpression of AMF in NIH-3T3 fibroblasts was reported to induce malignant transformation (Tsutsumi, Hogan et al. (2003) Cancer Res 63(1): 242-249). In embodiments of the current application, rAMF treatment does not induce malignant transformation in MSCs or promote increased tumor development or metastasis.
In cancer cells, it has been observed that AMF-induced migration is mediated by its interaction with AMF receptor (AMFR) on cell surface (Silletti, Watanabe et al. (1991) Cancer Res 51(13): 3507-3511). AMFR has been found stably localized to caveolae at the plasma membrane caveolin-1, a caveolar coat protein that has been described as a negative regulator of caveolae-mediated endocytosis of AMFR to the endoplasmic reticulum (Le, Guay et al. (2002) J Biol Chem 277(5): 3371-3379). It is disclosed herein that rAMF treatment of MSCs induced AMFR and caveolin-1 and -2 expressions, supporting their role in the maintenance of the receptor on the cell surface. Moreover, in cancer cells AMF enhances integrin 131 activity leading to activation of mitogen activated protein kinase (MAPK) and Rho pathways (Torimura, Ueno et al. (2001) Hepatology 34(1): 62-71). Small GTPase is largely involved in motility and cell adhesion due to its role in cytoskeleton organization. GTPase activity is regulated by GTPase-activating proteins (GAPs) and GDP dissociation inhibitors (GDIs). In bladder cancer, Rho GDP dissociation inhibitor (GDI) β (GDI2) is diminished in cells with higher motility indicating its role as suppressor of migration. However other reports indicated that GDI2 is upregulated in tumors with a more aggressive phenotype (Tapper, Kettunen et al. (2001) Cancer Genet Cytogenet 128(1): 1-6; Yanagawa, Watanabe et al. (2004) Lab Invest 84(4): 513-522). As disclosed herein, rAMF treatment decreased mRNA of GDI-2, supporting its role as inhibitor of migration. In certain embodiments, rAMF is a chemoattractant factor for MSCs, e.g., MSCs comprising a therapeutic agent.
The AMF can be naturally produced or recombinant. In certain embodiments, the AMF is human AMF. In some embodiments, the AMF comprises the polypeptide sequence of SEQ ID NO:1 or a functional fragment thereof. In some embodiments, the AMF comprises a polypeptide having an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to an AMF amino acid sequence that is naturally produced in an animal (e.g., SEQ ID NO:1). In some embodiments, the AMF comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:1 or a functional fragment thereof.
Certain embodiments are directed to a composition comprising a mesenchymal stromal cell (MSC) stimulated with a recombinant autocrine motility factor (rAMF), wherein the MSC comprises a therapeutic agent and wherein the MSC of the composition has (1) increased migration to a tumor or a tumor cell after rAMF stimulation and/or (2) increased adhesion to an endothelial cell, e.g., a vascular endothelial cell, after rAMF stimulation.
Certain embodiments are directed to a composition comprising a mesenchymal stromal cell (MSC) stimulated with a recombinant autocrine motility factor (rAMF), wherein the MSC comprises a therapeutic agent and wherein the MSC of the composition has increased migration to a tumor or a tumor-derived cell. In some embodiments, the increased migration is relative to or compared to MSC without rAMF stimulation.
Certain embodiments are directed to a composition comprising a mesenchymal stromal cell (MSC) stimulated with a recombinant autocrine motility factor (AMF), wherein the MSC comprises a therapeutic agent and wherein the MSC of the composition has increased adhesion to an endothelial cell, e.g., a vascular endothelial cell. In some embodiments, the increased adhesion is relative to or compared to MSC without rAMF stimulation.
In some embodiments, the increased migration and/or adhesion is about 1.5-fold, about 2-fold, about 2.5-fold, or about 3-fold greater than migration and/or adhesion of the MSC without rAMF stimulation. In some embodiments, the increase in migration and/or adhesion is at least about 20-60%, 30-60%, 40-60%, 30-50%, or 20-40% greater than migration and/or adhesion of the MSC without rAMF stimulation.
In some embodiments, the MSC of the composition is selected from the group consisting of bone marrow MSC, adipose tissue MSC, umbilical cord MSC, and any combination thereof.
In some embodiments, the tumor is a solid tumor or cancer. In some embodiments, the tumor is a liver cancer, a colon cancer, a pancreatic cancer, a lung cancer, a gastrointestinal cancer, a kidney cancer, a breast cancer, or a combination thereof. In some embodiments, the tumor is a carcinoma, e.g., hepatocellular carcinoma (HCC) or colorectal carcinoma. In some embodiments, the tumor or the tumor cell expresses endogenous AMF.
In some embodiments, the therapeutic agent is a recombinant anti-tumor gene (e.g., an interferon (e.g., interferon ι, interferon β), an interleukin (interleukin 1, interleukin 12), a chemokine (e.g., CX3CL1), a suicide gene (e.g., thymidine kinase, IL-12, IFN-gamma, TNF-alpha), or any combination thereof), a cytotoxic drug, an antibody, or an oncolytic virus.
In some embodiments, the therapeutic agent is an oncolytic virus (OV), i.e., a virus that preferentially infects and kills cancer cells (e.g., adenovirus (e.g., H101), Reovirus, measles, herpes simplex (e.g., HSV1716), Newcastle disease virus and vaccinia). See, e.g., Nakashima et al. (2010) Cytokine Growth Factor Rev. 21(2-3):119-26. In some embodiments, the oncolytic virus is engineered to expresses a recombinant anti-tumor gene. In one embodiment, the recombinant oncolytic virus is an oncolytic adenovirus. In some embodiments, the therapeutic agent is an oncolytic virus (see, e.g., Dwyer R M et al. (2010) Stem Cell Res Ther. 1(3):25), e.g., onyx-015 (see, e.g., Khuri F R et al. (2000) Nat Med. 6(8):879-85); Ad-F512(H-N)5/3 (see, e.g., Viale D. L., et al. (2013) J Invest Dermatol doi: 10.1038/jid.2013.191 (e-publication ahead of print)). In some embodiments, the oncolytic virus can be used as a vector for delivery of anti-tumor genes, e.g., an interferon (e.g., interferon ι, interferon β) an interleukin (e.g., interleukin 1, interleukin 12), a chemokine (e.g., CX3CL1), or a suicide gene (e.g., encoding enzymes that can metabolize a separately administered non-toxic pro-drug into a potent cytotoxin, which can diffuse to and kill neighboring cells). In some embodiments, the MSC comprises a recombinant AMF receptor, CXCR1, CXCR2, or MCP-1.
Certain embodiments are directed to a method for increasing migration or anchorage of a mesenchymal stromal cell (MSC) to a tumor comprising (a) stimulating the MSC with a recombinant autocrine motility factor (rAMF), and (b) administering the stimulated MSC of (a) to the tumor, wherein the MSC comprises a therapeutic agent.
In some embodiments, the methods of the application include increasing migration or anchorage of MSCs to a tumor, e.g., a solid tumor or cancer. In some embodiments, the tumor is selected from the group consisting of a liver cancer, a colon cancer, a pancreatic cancer, a lung cancer, a gastrointestinal cancer, a kidney cancer, a breast cancer, and any combination thereof. In some embodiments, the tumor is a carcinoma, e.g., hepatocellular carcinoma (HCC) or colorectal carcinoma. In some embodiments, the tumor or the tumor cell expresses endogenous AMF.
In some embodiments, the methods of the application include increasing migration or anchorage of MSCs to a tumor wherein the MSCs comprise a therapeutic agent, e.g., a recombinant anti-tumor gene (e.g., an interferon (e.g., interferon ι, interferon β), an interleukin (interleukin 1, interleukin 12), a chemokine (e.g., CX3CL1), a suicide gene (e.g., thymidine kinase, IL-12, IFN-gamma, TNF-alpha), or any combination thereof), a cytotoxic drug, an antibody, or an oncolytic virus.
In some embodiments, the methods of the application include increasing migration or anchorage of MSCs to a tumor wherein the MSCs comprise a therapeutic agent, e.g., an oncolytic virus (OV), i.e., a virus that preferentially infects and kills cancer cells (e.g., adenovirus (e.g., H101), Reovirus, measles, herpes simplex (e.g., HSV1716), Newcastle disease virus and vaccinia). See, e.g., Nakashima et al. (2010) Cytokine Growth Factor Rev. 21(2-3):119-26. In some embodiments, the oncolytic virus is engineered to expresses a recombinant anti-tumor gene. In one embodiment, the recombinant oncolytic virus is an oncolytic adenovirus, e.g., Ad-F512(H-N)5/3 (see, e.g., Lopez, et al. (2012) Mol Ther. 20(12):2222-33) In some embodiments, the oncolytic virus can be used as a vector for delivery of anti-tumor genes, e.g., an interferon (e.g., interferon ι, interferon β), an interleukin (e.g., interleukin 1, interleukin 12), a chemokine (e.g., CX3CL1), or a suicide gene (e.g., encoding enzymes that can metabolize a separately administered non-toxic pro-drug into a potent cytotoxin, which can diffuse to and kill neighboring cells). In some embodiments, the MSC comprises a recombinant AMF receptor, CXCR1, CXCR2, or MCP-1.
Certain aspects of the application are related to cell therapies using cells genetically engineered to express a heterologous gene, e.g., an anti-cancer gene. Some embodiments are directed to a method for treating a subject with a tumor comprising administering to the subject a composition of the application.
Some embodiments are directed to a method for treating a subject with a tumor comprising (a) stimulating a mesenchymal stromal cell (MSC) comprising a therapeutic agent with a recombinant autocrine motility factor (rAMF), and (b) administering the stimulated MSC of (a) to the subject.
In some embodiments, stimulating a MSC with a recombinant protein of the application, e.g., rAMF, is accomplished by pretreatment of the MSC prior to administration to a subject. Methods for pretreating the MSC include, e.g., culturing MSCs with the recombinant protein, e.g., rAMF, for about 1-48 hours, about 6-48 hours, about 6-36 hours, about 6-24 hours, about 12-24 hours, about 12-36 hours, about 12-48 hours, about 18-48 hours, about 18-36 hours, or about 18-24 hours prior to administration of the stimulated MSC.
In some embodiments, the subject's tumor is a solid tumor or cancer. In some embodiments, the tumor is selected from the group consisting of a liver cancer, a colon cancer, a pancreatic cancer, a lung cancer, a gastrointestinal cancer, a kidney cancer, a breast cancer, and any combination thereof. In some embodiments, the tumor is a carcinoma, e.g., hepatocellular carcinoma (HCC) or colorectal carcinoma. In some embodiments, the tumor expresses endogenous AMF. In some embodiments, the tumor is metastatic and/or vascularized.
In some embodiments, the methods of the application treating a tumor wherein the MSCs comprise a therapeutic agent, e.g., a recombinant anti-tumor gene (e.g., an interferon (e.g., interferon ι, interferon β), an interleukin (interleukin 1, interleukin 12), a chemokine (e.g., CX3CL1), a suicide gene (e.g., thymidine kinase, IL-12, IFN-gamma, TNF-alpha), or any combination thereof), a cytotoxic drug, an antibody, or an oncolytic virus.
In some embodiments, the therapeutic agent is an oncolytic virus, i.e., a virus that preferentially infects and kills cancer cells (e.g., adenovirus (e.g., H101), Reovirus, measles, herpes simplex (e.g., HSV1716), Newcastle disease virus and vaccinia). See, e.g., Nakashima et al. (2010) Cytokine Growth Factor Rev. 21(2-3):119-26. In some embodiments, the oncolytic virus is engineered to expresses a recombinant anti-tumor gene. In one embodiment, the recombinant oncolytic virus is an oncolytic adenovirus, e.g., Ad-F512(H-N)5/3 (see, e.g., Lopez, et al. (2012) Mol Ther. 20(12):2222-33). In some embodiments, the oncolytic virus can be used as a vector for delivery of anti-tumor genes, e.g., an interferon (e.g., interferon ι, interferon β), an interleukin (e.g., interleukin 1, interleukin 12), a chemokine (e.g., CX3CL1), or a suicide gene (e.g., encoding enzymes that can metabolize a separately administered non-toxic pro-drug into a potent cytotoxin, which can diffuse to and kill neighboring cells). In one embodiment, the suicide gene encodes Herpes simplex viral thymidine kinase, and the subject ideally is treated with ganciclovir in a manner permitting the Herpes simplex viral thymidine kinase to render the ganciclovir cytotoxic. Another possibility is the use of cytosine deaminase as a cytotoxic protein, which converts 5-fluorocytosine to the toxic compound 5-fluorouracil.
In some embodiments, the method for treating a subject with a tumor comprises introducing into the subject's bloodstream a therapeutically effective amount of a rAMF stimulated MSC or composition of the application. In some embodiments, the administration to the subject is systemic (e.g., parenteral) or local, e.g., to an intra-hepatic artery.
In some embodiments, the therapeutically effective number of MSCs includes, without limitation, the following amounts and ranges of amounts: (i) from about 1Ă105 to about 1Ă109 cells/kg body weight; (ii) from about 1Ă106 to about 1Ă108 cells/kg body weight; (iii) from about 5Ă106 to about 2Ă107 cells/kg body weight; (iv) from about 5Ă106 to about 1Ă107 cells/kg body weight; (v) from about 1Ă107 to about 2Ă107 cells/kg body weight; (vi) from about 7Ă106 to about 9Ă106 cells/kg body weight; (vii) about 1Ă105 cells/kg body weight; (viii) about 1Ă106 cells/kg body weight; (ix) about 5Ă106 cells/kg body weight; (x) about 1Ă107 cells/kg body weight; (xi) about 6Ă106 cells/kg body weight; (xii) about 7Ă106 cells/kg body weight; (xiii) about 8Ă106 cells/kg body weight; and (ix) about 9Ă106 cells/kg body weight. Human body weights envisioned include, without limitation, about 50 kg, about 60 kg; about 70 kg; about 80 kg, about 90 kg; and about 100 kg. Therapeutically effective amounts can be based on pre-clinical animal experiments and standard protocols from the transplantation of MSCs.
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Sambrook et al., ed. (1989) Molecular Cloning A Laboratory Manual (2nd ed.; Cold Spring Harbor Laboratory Press); Sambrook et al., ed. (1992) Molecular Cloning: A Laboratory Manual, (Cold Springs Harbor Laboratory, NY); D. N. Glover ed., (1985) DNA Cloning, Volumes I and II; Gait, ed. (1984) Oligonucleotide Synthesis; Mullis et al. U.S. Pat. No. 4,683,195; Hames and Higgins, eds. (1984) Nucleic Acid Hybridization; Hames and Higgins, eds. (1984) Transcription And Translation; Freshney (1987) Culture Of Animal Cells (Alan R. Liss, Inc.); Immobilized Cells And Enzymes (IRL Press) (1986); Perbal (1984) A Practical Guide To Molecular Cloning; the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Miller and Calos eds. (1987) Gene Transfer Vectors For Mammalian Cells, (Cold Spring Harbor Laboratory); Wu et al., eds., Methods In Enzymology, Vols. 154 and 155; Mayer and Walker, eds. (1987) Immunochemical Methods In Cell And Molecular Biology (Academic Press, London); Weir and Blackwell, eds., (1986) Handbook Of Experimental Immunology, Volumes I-IV; Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1986); and in Ausubel et al. (1989) Current Protocols in Molecular Biology (John Wiley and Sons, Baltimore, Md.).
The following examples are offered by way of illustration and not by way of limitation.
Human HCC cell line HuH7 were kindly provided by Prof. Jesus Prieto (CIMA, University of Navarra, Pamplona, Spain). LX-2 cell line (human HSCs generated by spontaneous immortalization in low serum conditions) was kindly provided by Dr. Scott Friedman (Division of Liver Diseases, Mount Sinai School of Medicine, New York, N.Y., USA). Human microvascular endothelial cells (HMEC-1) were provided by CDC (Centers for Disease Control, Atlanta, Ga., USA). Cell lines were cultured in complete DMEM (2 Îźmol/L glutamine, 100 U/mL penicillin, 100 mg/mL streptomycin and 10% heat-inactivated fetal bovine serum (FBS)). Primary culture of HCC cells (HC-PT-5) was previously generated in our laboratory and cultured the eight passage in 70% DMEM/30% F12 (Invitrogen/Life Technologies) culture medium supplemented with 2 Îźmol/L glutamine, 100 units/mL penicillin, 100 mg/mL streptomycin and 10% FBS.
Isolation of MSCs, AT-MSCs and Mesenchymal Cells Harvested from Umbilical Cord Perivascular Tissue
Cells were obtained from allogeneic bone marrow transplantation of healthy donors after informed consent (Hospital Naval Pedro Mallo, Buenos Aires, Argentina). Mononuclear cells were plated in complete DMEM low glucose/20% FBS (Internegocios S.A., Argentina). After 2 h incubation, non-adherent cells were removed and adherent hMSCs were cultured and used for different experiments between passages 4 to 6. For AT-MSCs generation, cells were isolated from discarded fat from esthetical liposuctions after informed consent as described previously Zuk et al. (Zuk, Zhu et al. (2001). Tissue Eng 7(2):211-228). Briefly, discarded lipoaspirates were washed extensively with sterile phosphate-buffered saline. Washed aspirates were treated with 0.075% type collagenase (Sigma-Aldrich) in PBS for 30 min at 37° C. with agitation. The cells were centrifugated and cellular pellet was plated in complete DMEM low glucose/20% FBS (Internegocios S.A., Argentina) and used for different experiments between passages 4 to 6.
Mesenchymal cells harvested from umbilical cord perivascular tissue were isolated from discarded umbilical cord obtained from healthy donors from the Service of Gynaecology and Obstetrics after informed consent in our institution adapted from the protocol previously described in Sarugaser, Lickorish et al. (2005). Stem Cells 23(2):220-229). Umbilical cords were dissected and vessels with its surrounding Warthon's Jelly were pulled out. Then the perivascular Wharton's Jelly were removed from the vessels and mechanically disrupted. Minced fragments were plated in complete DMEM low glucose/20% FBS (Internegocios S.A., Argentina). After 7 days incubation, non-adherent cells and minced fragments were removed and adherents Mesenchymal cells harvested from umbilical cord perivascular tissue were cultured and used for different experiments between passages 4 to 6.
MSCs were characterized according to the guidelines from International society for cellular therapy (ISCT).
To obtain tumor conditioned medium (TCM), HuH7 or HC-PT-5 subcutaneous tumors (s.c.) were dissected and minced into pieces smaller than 1 mm3 and transferred into a 24 wells tissue culture plate (6 fragments/well) with 500 Îźl of DMEM supplemented with 2 Îźmol/l glutamine, 100 units/ml penicillin, and 100 mg/ml streptomycin. Cell conditioned medium (CCM) was obtained from HCC cell lines cultured as described above to 90% confluence and then were washed with PBS and cultured with DMEM without FBS. In both cases, 18 hours later conditioned medium was harvested and stored at â80° C. until use.
BM-MSCs or AMF stimulated BM-MSC were lysed with 150 mmol/L NaCl, 20 mmol/L Tris-HCl, pH 7.4, 0.1% SDS, 1.0% Nonidet P-40, 0.5% Na-deoxycholate, 0.2 mmol/L phenylmethylsulfonyl fluoride, and protease inhibitor cocktail. Lysates were centrifuged at 12,000 g for 20 min and the supernatants were used as total cell lysates. CCM and TCM were concentrated 100-fold using Vivaspin 6 centrifugal concentrator (Sartorius-Stedim Biotech). The protein concentration was determined by Bradford protein assay (Bio-Rad). Protein was separated by SDS-PAGE and transferred onto nitrocellulose membrane (Hybond-ECL, Amersham Biosciences). Blots were blocked and incubated with anti-AMF (1:700) polyclonal antibody (sc-33777, Santa Cruz Biotechnology), anti-AMFR (1:1000) polyclonal antibody (AP2162a, ABGENT), anti-JNK (1:1000) polyclonal antibody (9252, Cell Signaling), anti-phospho-INK (1:1000) polyclonal antibody (9251, Cell Signaling), anti-c-Fos (1:1000) monoclonal antibody (2250, Cell Signaling), anti-phospho-c-Fos (1:1000) monoclonal antibody (5348, Cell Signaling), anti-phospho-CREB (1:1000) monoclonal antibody (9198, Cell Signaling) or anti-Actin (1:700) polyclonal antibody (sc-1615, Santa Cruz Biotechnology) at 4° C. overnight. Finally, blots were then incubated with the corresponding HRP-conjugated IgG at room temperature for 1 hour. The reactions were visualized using the enhanced chemiluminescence (ECL) reagent (Sigma). Staining with colloidal Coomassie was performed as loading control for conditioned medium as was reported previously (Welinder, Ekblad. (2011) J Proteome Res 10(3):1416-1419). Density of each band was quantified with Scion Image software (Scion Corporation, Frederick, Md.).
In vitro migration was performed using a 48-Transwell microchemotaxis Boyden Chamber unit (Neuroprobe, Inc.). In brief, MSCs (1.2Ă103 cells/well) were placed in the upper chamber and DMEM, TCM or recombinant human AMF (rAMF) where placed in the lower chamber of the Transwell unit. Both chambers were separated by 8 van pore polycarbonate filters (Nucleopore membrane, Neuroprobe). For blocking experiments, TCM were pre-incubated for 60 min with anti-AMF polyclonal antibody (sc-33777, Santa Cruz Biotechnology) or isotype control IgG. For AMF pre-treatment BM-MSCs were incubated overnight (O.N.) with 1 Îźg/ml of rAMF in DMEM without FBS or DMEM without FBS as control.
For the invasion assay the polycarbonate filters were previously incubated with 10 mg/ml type IV collagen (Sigma-Aldrich) for 18 h at 4° C.; for MMP inhibition, BM-MSCs were preincubated with 1,10 phenantroline (0.5 or 1 mM) (Sigma-Aldrich). MSCs viability was not affected by 1,10 phenantroline (not shown). All the systems were incubated for 4 h at 37° C. in a 5% CO2 humidified atmosphere. After that, the membrane was carefully removed and cells on the upper side of the membrane were scraped off with a blade. Cells attached to the lower side of the membrane were fixed in 2% formaldehyde, and stained with 40,6-diamidino-2-phenylindole dihydrochloride (DAPI, Sigma-Aldrich). Cells were counted using fluorescent-field microscopy and a 10à objective lens: the images captured in three representative visual fields were analyzed using CellProfiler software (www.cellprofiler.com), and the mean number of cells/field+SEM was calculated.
For the wound-healing assay, Fast-DiO-stained MSCs were seeded at 2.5Ă104 cell/cm2 in DMEM with 10% PBS for 24 hours. Then, cells were preincubated overnight with 1 Îźg/ml rAMF or DMEM without FBS. The monolayers were then scratched by a 200 ml-tip, washed with PBS and incubated for 24 hours more in DMEM without FBS. Cells within the scratched area were counted under a fluorescent-field microscope at 40Ă and the number of cells/field were determined. Additionally, adherent cells were counted at the end of the experiment confirming the same number of cells in all the conditions.
To evaluate whether AMF induced gelatinolytic activity in MSCs, 5Ă104 cells were seeded in 24-well plates for 18 h. Cells were treated with 1 Îźg/ml of rAMF, TCM or serum-free DMEM as untreated control for 2 h; then, MSCs were washed with PBS and cultured in DMEM for 6 h before supernatants were collected. For blocking experiments, TCM were pre-incubated for 60 min with anti-AMF polyclonal antibody (sc-33777, Santa Cruz Biotechnology) or isotype control IgG. MMP2 activity was determined by zymography. Briefly, 20 ÎźL of MSC supernatant was run on a 10% SDS-PAGE containing 0.1% gelatin (Sigma-Aldrich). The gel was stained with Coomassie Brilliant Blue R-250 for 30 min at room temperature. Gelatinase activity was visualized by negative staining; gel images were obtained with a digital camera (Canon EOS 5D), and were subjected to densitometry analysis using Scion Image software (Scion Corporation, Frederick, Md.). Relative MMP2 activity was obtained by normalizing values to untreated samples (DMEM).
For analyses of MSC adhesion to endothelial cells, 2Ă105 HMEC-1 were seeded in 96-well microplates and cultured for 1 day prior the assay. Coated wells were incubated for 5 minutes with 0.1 ml of 5Ă104 cells/ml of Fast-DiO labeled MSCs O.N. pretreated or not with 1 Îźg/ml rAMF. The cell suspension was discarded and the cells were fixed with 2% paraformaldehyde. Cells were counted using fluorescent-field microscopy and a 20Ă objective lens: the images captured in ten representative visual fields were analyzed using CellProfiler software (cellprofiler.com) and normalizing to untreated control.
Total mRNA of BM-MSCs O.N. pretreated or not with 1 Îźg/ml rAMF was extracted using Trizol Reagent (Sigma-Aldrich Co., St. Louis, Mo.). For quantification of MMP3 mRNA level, MSCs were 24 h starved before rAMF pre-treatment. Total mRNA (4 Îźg) was reverse transcribed with 200 U of SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, Calif.) using 500 ng of Oligo (dT) primers. cDNAs were subjected to real-time polymerase chain reaction (qPCR) (Stratagene Mx3005p, Stratagene, La Jolla, Calif., USA). For qRT-PCR, the mRNA levels of metalloproteinase 3 MMP3, AMF receptor (AMFR), GDP dissociation inhibitor 2 (GDI-2), caveolin-1 (CAV-1) and caveolin-2 (CAV-2) were quantified by SYBRÂŽ Green (Invitrogen), using the following primer pairs:
| MMP3 | |
| (SEQâIDâNO:â2) | |
| 5â˛-ACGCCAGCCAACTGTGATCCT-3Ⲡ(forward), | |
| (SEQâIDâNO:â3) | |
| 5â˛-ATATGCGGCATCCACGCCTGAA-3Ⲡ(reverse); | |
| AMFR | |
| (SEQâIDâNO:â4) | |
| 5â˛-ACAAGATGTGGGCCTTGCAAGAâ-3â(forward), | |
| (SEQâIDâNO:â5) | |
| 5â˛-AAAACGCAGTGCTCCCAGGATA-3Ⲡ(reverse); | |
| GDI-2 | |
| (SEQâIDââ˛NO:â6) | |
| 5â˛-GACCAGCTTTGGAGCTCTTG-3Ⲡ(forward), | |
| (SEQâIDâNO:â7) | |
| 5â˛-TGCGGGAAATAAAGATCTGG-3Ⲡ(reverse); | |
| CAV-1 | |
| (SEQâIDâNO:â8) | |
| 5â˛-AATCCAAGCATCCCTTTGCCCA-3Ⲡ(forward), | |
| (SEQâIDâNO:â9) | |
| 5â˛-ACCAGGCAGCTTTCTGTACGAâ-3Ⲡ(reverse); | |
| CAV-2 | |
| (SEQâIDâNO:â10) | |
| 5â˛-GAGAGACAGGGGAGTTGTCAACTT-3Ⲡ(forward), | |
| (SEQâIDâNO:â11) | |
| 5â˛-âGCCCGGCCCAGAAATAATGAGATâ-3Ⲡ(reverse); | |
| CXCR1 | |
| (SEQâIDâNO:â14) | |
| 5â˛-TTTTCCGCCAGGCTTACCAT-3Ⲡ(forward), | |
| and | |
| (SEQâIDâNO:â15) | |
| 5â˛-AACACCATCCGCCATTTTGC-3Ⲡ(reverse); | |
| CXCR2 | |
| (SEQâIDâNO:â16) | |
| 5â˛-TAAGTGGAGCCCCGTGGGG-3Ⲡ(forward), | |
| and | |
| (SEQâIDâNO:â17) | |
| 5â˛-TGGGCTCAGGGGCAGGATG-3Ⲡ(reverse); | |
| CCR2 | |
| (SEQâIDâNO:â18) | |
| 5â˛-CGAGAGCGGTGAAGAAGTCA-3Ⲡ(forward), | |
| and | |
| (SEQâIDâNO:â19) | |
| 5â˛-AGCATGTTGCCCACAAAACC-3Ⲡ(reverse); | |
| IL-6R | |
| (SEQâIDâNO:â20) | |
| 5â˛-GCACTTGCTGGTGGATGTTC-3Ⲡ(forward), | |
| and | |
| (SEQâIDâNO:â21) | |
| 5â˛-AGCCTTTGTCGTCAGGGATG-3Ⲡ(reverse); | |
| IL-6ST | |
| (SEQâIDâNO:â22) | |
| 5â˛-CCCACCTCATGCACTGTTGA-3Ⲡ(forward), | |
| and | |
| (SEQâIDâNO:â23) | |
| 5â˛-TTATGTGGCGGATTCGGCTT-3Ⲡ(reverse); | |
| and | |
| IGFBP3 | |
| (SEQâIDâNO:â24) | |
| 5â˛-ACTGTGGCCATGACTGAG-3Ⲡ(forward), | |
| and | |
| (SEQâIDâNO:â25) | |
| 5â˛-AGAGTCTCCCTGAGCCTGA-3Ⲡ(reverse). |
All PCR amplifications were carried out using a cycle of 95° C. for 10 min and 45 cycles under the following parameters: 95° C. for 30 sec, 58° C. for 30 sec, 72° C. for 1 min. At the end of the PCR reaction, the temperature was increased from 60° C. to 95° C. at a rate of 2° C./min, and the fluorescence was measured every 15 sec to construct the melting curve. Values were normalized to levels of glyceraldehyde-3-phosphate dehydrogenase (GAPDH; used as housekeeping) transcript (forward 5â˛-CATCTCTGCCCCCTCTGCTG-3Ⲡ(SEQ ID NO: 12); reverse 5â˛-GCCTGCTTCACCACCTTCTTG-3Ⲡ(SEQ ID NO: 13)). Data were processed by the AACt method (Livak K J, Schmittgen T D. (2001) Methods 25(4):402-408).
The relative amount of the PCR product amplified from untreated cells was set as 1. A non-template control (NTC) was run in every assay, and all determinations were performed in triplicate in three separated experiments.
HCC cells were seeded in 96-well culture tissue plates at 3Ă104 cells/cm2 density for 1 day prior to the assay. Then cells were cultured with CM of BM-MSCs pre-treated with 1 Îźg/ml of rAMF for 48 h. DMEM and CM of untreated BM-MSCs were used as control. Cell proliferation was evaluated by [3H]-thymidine incorporation assay. Each sample was assayed in sextuplicate and normalized to DMEM control.
Ninety-six-well tissue culture plates were coated with 2% agarose in PBS. A total of 3Ă103 HuH7 cells, 1Ă103 LX-2, 1Ă103 HMEC-1 with or without 1Ă103 BM-MSC per spheroid were mixed in complete DMEM to obtain a single multicellular spheroid per well. Seventy-five microliters of supernatant was carefully removed. from each well every 2 days and replaced with fresh medium or CM from BM-MSC. Viability above 75% was confirmed by Trypan blue exclusion test in all experiments. Spheroid size was evaluated using inverted microscopy and a 4Ă objective lens: the images were captured and diameters determined using ImageJ software (National Institute of Health, NIH), finally spheroid volume was determined was calculated by the formula Ď/6Ălarger diameterĂ(smaller diameter)2 and expressed as arbitrary unity.
Six- to eight-week-old male nude BALB/c mice were purchased from CNEA (ComisiĂłn Nacional de EnergĂa AtĂłmica, Ezeiza, Buenos Aires, Argentina). The animals were maintained at our Animal Resources Facilities (School of Biomedical Sciences, Austral University) in accordance with the experimental ethical committee and the NIH guidelines on the ethical use of animals. Subcutaneous model: HuH7 cells (2Ă106) or HC-PT-5 cells (5Ă106) were inoculated subcutaneously (s.c.) into the right flank of nude mice. To evaluate the effect of BM-MSCs pre-treated with recombinant human AMF (rAMF) on tumor development, s.c. HuH7 tumors were established and after 10 days BM-MSCs or BM-MSCs pre-treated with rAMF were intravenously (i.v.) injected. Tumor growth was assessed by calliper measurement, and tumor volume (mm3) was calculated by the formula Ď/6Ălarger diameterĂ(smaller diameter)2. For in vivo migration studies, BM-MSCs or BM-MSCs pre-treated with rAMF were prestained with CMDiI for histological analysis and DiR (Molecular Probes, Invitrogen) for fluorescence imaging (FI) and were i.v. injected (5Ă105 cells/mice) 10 days after tumor inoculation. FI was performed using the Xenogen In Vivo Imaging System (IVIS; Caliper Life Sciences, Hopkinton, Mass., USA). Mice injected with CMDiI-DiR-labeled MSCs were analyzed 1 h after MSC injection and every day until the experimental end point. Images represent the radiant efficiency and were analyzed with IVIS Living Image (Caliper Life Sciences) software. Regions of interest (ROI) were automatically drawn around the isolated organs to assess the fluorescence signal emitted. Results were expressed as average radiant efficiency in units of photons/second within the region of interest [p/s/cm2/sr]/[ÎźW/cm2] or as total radiant efficiency in units of photons/second within the region of interest [p/s]/[ÎźW/cm2].
To detect CMDiI+ cells within tumors, frozen sections were mounted in mounting media with DAPI (Vector Laboratories, Inc.) and observed under a fluorescence microscope using a 20Ă objective lens.
Unpaired Student's t test, one-way analysis of variance following by post tests or Kruskal-Wallis and Dunn's post-tests (GraphPad Prism Software) were used for statistical analyses. Differences with p values lower than 0.05 were considered as statistically significant.
Factors secreted from hepatocellular carcinoma (HCC) microenvironment were identified. Tumor conditioned media (TCM) were obtained from fresh HCC samples or tumors generated from primary cultured human HCC cells (HC-PT-5) or the HuH7 cell line in BALB/c nude mice.
In vitro migratory capacity of MSCs to different TCM samples was analyzed using a 48-Transwell microchemotaxis Boyden Chamber unit (Neuroprobe, Inc.).
Factors present in the different TCM were identified using two Human Cytokine and Chemokine Antibody Arrays (RayBiotech). The factors identified are shown in Tables 1 and 2.
Changes in the gene expression patterns in MSCs exposed to TCM derived from HCC samples were also analyzed. MSCs were exposed overnight to TCM or DMEM (as control) and studied using a microarray gene expression analysis with the aim to identify genes that were differentially expressed in MSCs exposed or not to TCM. Table 3 shows 445 genes differentially expressed in MSC exposed to TCM from sample 1 in comparison with non-exposed cells. Table 4 shows 511 genes differentially expressed in MSC exposed to TCM from sample 2 in comparison with non-exposed cells. Table 5 shows 521 genes differentially expressed in MSC exposed to TCM from sample 4 in comparison with non-exposed cells. Table 6 shows 511 genes differentially expressed in MSC exposed to TCM from sample 5 in comparison with non-exposed cells.
Expression of receptors recognized by soluble factors were analyzed. Receptors with positive signal in at least two of the three replicates of microarray are listed in Table 7.
Real-time PCR (qRT-PCR) was used to analyze the expression of selected genes related to migration in MSCs exposed to TCM. FIG. 1A shows the relative mRNA expression of up-regulated genes CTGF, CYR61, GJA1, SPARC, and AMFR. Autocrine Motility Factor Receptor (AMFR) was up-regulated in MSCs exposed to all CM derived from HCC samples. FIG. 1B shows relative mRNA expression of down-regulated genes HSPA1A, HSP1B, and IGFBP3.
The tumor conditioned media (TCM) from ex vivo subcutaneous (s.c.) tumors derived from HuH7 cell line or HC-PT-5 HCC primary culture and conditioned media from cell culture monolayers (CCM) were subjected to western blot analysis according to the method described in Example 1. A 55 kDa soluble AMF was detected in CCM and TCM (FIG. 2A).
The ability of recombinant human AMF (rAMF) to induce MSCs chemotaxis in vitro was analyzed. MSCs from different sources were evaluated by in vitro migration assay with modified Boyden chambers as described in Example 1. Human MSCs derived from bone marrow (BM-MSCs), perivascular umbilical cord region (Mesenchymal cells harvested from umbilical cord perivascular tissue), or adipose tissue (AT-MSCs) were used in a modified Boyden chamber assay.
The MSCs from the different sources migrated in a dose-dependent manner towards recombinant AMF (FIG. 2B-D). The most significant migration degree was shown in the dose ranging between 0.5 Îźg/mL and 1 Îźg/mL (p<0.01) of rAMF for both BM-MSC and Mesenchymal cells harvested from umbilical cord perivascular tissue (FIG. 2B-C), while AT-MSCs migrated better at 0.75 Îźg/mL of rAMF (FIG. 2D). Interestingly, higher rAMF concentration (5 Îźg/mL or 10 Îźg/mL) were not capable of inducing migration neither in BM-MSCs nor in Mesenchymal cells harvested from umbilical cord perivascular tissue and AT-MSCs.
Next, TCM were pretreated with polyclonal antibody against AMF (anti-AMF) to examine whether HCC tumor-secreted AMF was involved in MSC migration as described in the methods of Example 1. As shown in FIG. 2E-G, antibody blocking of AMF present in the TCM from either HuH7 or HC-PT-5 reduced their capability to induce MSC migration in a dose dependent manner. At 1 Îźg/mL of anti-AMF, BM-MSCs showed a 40% reduction of migration in response to TCM derived from both HCC tumors. A similar effect was observed in Mesenchymal cells harvested from umbilical cord perivascular tissue with a reduction of 30% and 40% in the response to TCM from HuH7 and HC-PT-5, respectively. Finally, the reduction in AT-MSC migration potential was 30% and 20% towards TCM from HuH7 and HC-PT-5, respectively. These results show that AMF exerted a potent chemotactic role in HCC tumor cells.
These results show that AMF was secreted in the culture monolayers from HCC s.c tumors. Moreover, the results show for the first time that AMF produced by HCC is a chemoattractant factor for MSCs and induces migration of MSCs. The migration was shown using MSCs from different sources (i.e., bone marrow (BM), perivascular cells from umbilical cord (Mesenchymal cells harvested from umbilical cord perivascular tissue) and adipose tissue (AT-MSCs)) and the MSCs from all of he tested sources exhibited migration towards AMF in a dose-dependent manner. 1 Îźg/ml of AMF was sufficient to induce MSCs migration.
One of the key steps in the transmigration process across the basement membrane is dependent on the proteolytic activity of metalloproteinases. The effect of rAMF on the MSC metalloproteinase activity needed for cell migration was characterized.
MMP3 mRNA level in MSCs was evaluated by qRT-PCR as described in Example 1. MMP3 transcripts showed a 2.4-fold increase in BM-MSCs and Mesenchymal cells harvested from umbilical cord perivascular tissue, and 1.4-fold in AT-MSCs exposed to rAMF compared to unexposed cells (FIG. 3A).
BM-MSCs stimulated with HCC CCM had increased MMP2 activity. As previously reported (Garcia, Bayo et al. (2011). Mol Pharm 8(5):1538-1548), gelatinolytic activity corresponding to MMP2 was detected in supernatants from BM-MSCs and also from Mesenchymal cells harvested from umbilical cord perivascular tissue and AT-MSCs. In the present example, MMP2 activity was measured by zymography (as described in Example 1) in MSCs culture supernatant pre-stimulated with 1 Îźg/mL of rAMF or from un-stimulated cells as control to determine whether the induction of MMP2 was dependent on the presence of AMF in the TCM. MMP2 activity was significantly enhanced when different sources MSCs were stimulated with rAMF (FIG. 3B).
MMP2 activity was also measured in MSC culture supernatant stimulated with TCM derived from HuH7 previously blocked with polyclonal Ab anti-AMF. As a result, the increased MMP2 activity previously observed was completely abolished when MSCs were treated with AMF blocked-TCM showing a similar level of MMP2 activity than untreated cells (FIG. 3C).
Stimulation with rAMF increased the invasion capacity of MSCs across collagen and the MMPs inhibitor significantly decreased the invasion capacity of MSCs. (FIG. 3D).
These results show that MMP3 expression: and MMP2 activity was induced in MSCs by rAMF. In particular, rAMF increased the expression of mRNA MMP3 in MSCs. The results also show that AMF present in the TCM was, at least in part, responsible for the increased in MMP2 activity, which supports a critical role for AMF in MSC migration and invasion since blockage of AMF decreased MMP2 activity and inhibition of MMP2 decreased invasion in vitro.
Specific MSC migration to HCC is critical for their use as cell carriers of therapeutic genes. MSCs were pretreated with rAMF to determine the effect of MSC migration towards the HCC TCMs. In vitro migration assay was used to measure migration of MSCs as described in Example 1.
As shown in FIG. 4A, rAMF pretreatment induced a 40% increase in BM-MSCs migration to conditioned medium from ex vivo s.c. tumors (TCM) derived from HuH7 or HC-PT-5 cell lines. These results show that rAMF pretreatment influenced migration of MSCs towards TCM.
By wound-healing assay, it was observed that overnight rAMF pretreatment did not modify MSC general motility (FIG. 4B) indicating that rAMF pretreatment increases specific chemotaxis towards HCC.
Adhesion to endothelial cells is considered a crucial event for the efficient arrest of MSCs within tumor vasculature for subsequent transmigration. The effect of rAMF on cell adhesion was tested by pretreating MSCs with rAMF and measuring cell adhesion as described in Example 1. Pretreatment with rAMF resulted in a 2-fold enhancement in BM-MSCs adhesion to human endothelial cells HMEC-1 (FIG. 4C).
Genes related to the AMF-AMFR pathway were also studied. As shown in FIG. 4D, a 1.8-fold induction of AMF receptor mRNA was observed when BM-MSCs were stimulated with rAMF. Additionally, mRNA levels of caveolin-1 (CAV-1) and caveolin-2 (CAV-2) were increased in 2.4-fold and 2.3-fold respectively, while Rho GDP dissociation inhibitor (GDI) β (GDI-2) expression was reduced 10% after rAMF treatment in BM-MSCs. Moreover, rAMF treatment induced the expression of AMFR, and the proteins involved in AMF-AMFR signaling pathways such as JNK, p-JNK, c-Fos, p-c-Fos and p-CREB (FIG. 4E).
These results demonstrated that pretreatment with rAMF significantly increased MSC migration towards HCC in vitro and increased MSC adhesion to endothelial cells. Furthermore, these results show that rAMF treatment induced AMFR and caveolin-1 and -2 (genes having a possible role in maintenance of the receptor on the cell surface) expression and decreased GDI-2 (a gene having a possible role as inhibitor of migration) mRNA expression. AMFR and activation of mitogen activated protein kinase (MAPK) pathway was observed after rAMF treatment.
Enhancement of MSC migration towards HCC by rAMF stimulation was studied in vivo. Noninvasive fluorescence imaging (FI) was used to measure migration of MSCs as described in Example 1. Human MSCs derived from bone marrow (BM-MSCs) pre-stimulated with rAMF (1 Îźg/mL) or control BM-MSCs (no stimulation) were stained with cell trackers DiR and CM-DiI prior to intravenous injection in mice carrying s.c. HuH7 tumor nodules as described in Example 1. Three days later, mice were sacrificed and the fluorescence signal in the isolated tumors was analyzed. The total fluorescent intensity in both groups of animals were similar, indicating no differences in the quantity of injected ISM-MSCs (FIG. 5A). Tumors from animals injected with rAMF-pretreated BM-MSCs showed a stronger Di R. signal in comparison with control mice (FIG. 513-C) Mice that received BM-MSC pretreated with rAMF did not show increased signal in liver, lung or spleen (FIG. 5D-F), indicating a specific increased recruitment of BM-MSCs in tumor microenvironment. The presence of BM-MSCs in the isolated tumors was confirmed by cell visualization under fluorescence microscopy (FIG. 5G). rAMF increased in vivo migration to HCC tumors. These results show that stimulation of MSCs with rAMF increased in vivo migration of MSCs towards experimental HCC tumors in comparison with non-stimulated MSCs.
In vitro studies indicated that HuH7 HCC cells exposed to CCM from MSC pre-treated with rAMF did not enhance cell proliferation compared to unexposed cells or to HuH7 cells exposed to CCM from untreated MSCs (FIG. 6A). Moreover, pretreatment of MSCs with AMF did not affect the in vitro growth of multicellular spheroids composed of HuH7 HCC cells, hepatic stellate cells LX-2 and HMEC-1 endothelial cells (FIG. 6B). Finally, AMF-prestimulated MSCs did not enhance tumor growth compared to control tumor-bearing mice (saline) or to the group of mice administered with unstimulated MSCs (FIG. 6C). These studies indicated, as a whole, that AMF promoted MSC homing to the HCC niche without affecting tumor growth.
Pretreatment with rAMF was shown to significantly increase (by 30%, p0.01) MSCs migration towards HCC in vivo. This is the first report demonstrating the increased in vivo migration of MSCs towards HCC with pretreatment of MSCs with rAMF.
In vitro migration assays were performed as described in Example 1. Specifically, in vitro migration of bone marrow-derived mesenchymal stem cells (BM-MSCs) (black bars) or human umbilical cord perivascular cells (HUCPVCs) (grey bars) towards CCM from HCC (HuH7 and HC-PT-5), hepatic stellate cells (LX-2), fibroblasts (WI-38) or endothelial cells (HMEC-1) was measured (FIG. 7A), in each case, a higher migratory capacity towards all the CCM was found for HUCPVCs when compared to BM-MSCs. Moreover, in contrast to BM-MCSs, HUCPVCs showed capability to migrate to CCM derived from nontumoral components (fibroblast and endothelial cells).
Besides their capacity to migrate toward factors secreted by the arrest of MSCs within the microvasculature is considered a critical step for an efficient homing and anchorage to tumors. Therefore, cell adhesion assays were also performed as described in Example 1 to evaluate adhesion ability of MSCs In that assay, HUCPVCs showed an increased in vitro adhesion to HMEC-1 endothelial cells in comparison with BM-MSCs (FIG. 7B).
To further characterize MSC behavior in vivo, noninvasive migration assays were performed as described in Example 1. CM-DiI and DiR prelabelled BM-MSCs or HUCPVCs were i.v. injected in HCC tumor-bearing mice in order to evaluate MSC recruitment. Similar to our previous observation with BM-MSCs (FIG. 5), at 3 days after cell transplantation a positive signal corresponding to HUCPVCs was found in liver, lungs, spleen, and s.c. tumors (FIG. 8A). Despite the fact that total signal was lower in mice injected with HUCPVCs compared to those injected with BM-MSCs (FIG. 8B), the percentage of total signal corresponding to s.c. tumor locations was increased in mice administered with HUCPVCs in comparison with animals that received BM-MSCs (FIGS. 8C and 8D), indicating an enhanced engraftment of HUCPVCs into HCC tumors. In the other evaluated tissues, signal intensity was similar for BM-MSC or HUCPVCs in lung and liver and it was comparatively reduced in the spleen of HUCPVCs-injected mice (FIG. 8D). Presence of MSCs in the s.c. tumors was also confirmed by fluorescence microscopy (FIG. 8E). Finally, MSCs were evaluated for whether they might present differential migratory capacity towards CM obtained from s.c. tumors (TCM). A greater in vitro migratory capacity towards TCM from HCC was observed for HUCPVCs when compared to BM-MSCs (FIG. 8F).
In order to evaluate mechanisms partially explaining the differential migratory capacity of HUCPVCs compared to BM-MSCs towards tumor released factors, the expression of some chemokine receptors likely involved in MSC recruitment towards HCC was analyzed. Because interleukin- (IL-) 8, GRO, chemokine (C-C motif) ligand (CCL)-2, and IL-6 are among the most relevant factors in HCC (Bayo et al., Liver International 34(3):330-334 (2014)1, qPCR (as described in Example 1) was used to evaluate the expression of CXCR1, CXCR2, CCR2, IL-6R, and IL-6ST. Constitutive CXCR1 and CXCR2 mRNA expression was found to be lower and CCR2 slightly higher in HUCPVCs when compared to BM-MSCs, while IL-6R and IL-6ST expression was similar in both MSCs sources (FIG. 9A). Next, the axis of the autocrine motility factor (AMF) was evaluated. By qPCR, a significantly higher expression of the AMF receptor (AMFR) was found in HUCPVCs when compared to BM-MSCs. Similarly, genes known to be related to the availability of the receptor in the cell surface such as caveolin-1 (CAV-1) and caveolin-2 (CAV-2) were also highly expressed in HUCPVCs as well as the metalloproteinase 3 (MMP3), necessary to the transmigration process. In contrast, expression levels of insulin-like growth factor-binding protein 3 (IGFBP3), a protein that negatively regulates AMF/AMFR pathway, were found to be reduced in HUCPVCs when compared to BM-MSCs (FIG. 9B).
The in vitro migration response to the recombinant AMF (rAMF) of both BM-MSCs (black bars) or HUCPVCs (grey bars) was tested using a chemotaxis assay (FIG. 10A). A significantly higher migration to different doses of rAMF (0.5 and 0.75 Îźg/mL) was observed for HUCPVCs when compared to BM-MSCs. In spite of different types of MSCs showing similar reduction in migration levels (50% of control) towards HuH7 TCM after the blockage with anti-AMF antibody (data not shown), preincubation of HC-PT-5 TCM with anti-AMF antibody (AMF-ab) resulted in a further reduction in HUCPVCs migration capacity (54% of control) when compared to BM-MSCs (67% of control) (FIG. 10B).
Blocking experiments were performed by preincubating TCM-HuH7 or TCM-HC-PT-5 with anti-HGF (10 Îźg/ml), anti-MCP-1 (10 Îźg/ml) or isotype control IgG for 1 hour. Similarly, anti-CXCR1 (10 Îźg/ml), anti-CXCR2 (10 Îźg/ml), both anti-CXCR1/anti-CXCR2, or isotype control IgG were pre-incubated with MSC for 1 hour. In vitro migration of MSCs towards TCM-HuH7 or TCM-HC-PT-5 were evaluated using the methods described in Example 1.
Antibody inhibition of CXCR1 or CXCR2 decreased MSC migration around 30% and incubation with both anti-CXCR1 and anti-CXCR2 antibodies inhibited migration around 40% (FIG. 11A). Moreover, anti-MCP-1 inhibited MSC migration around 20%, but anti-HGF had no effect on MSC migration towards CM-HuH7 (FIG. 11B).
MSCs will be engineered to express oncolytic virus expressing or not anti-tumor genes (including e.g., an interferon (e.g., interferon Îą, interferon β), an interleukin (e.g., interleukin 1, interleukin 12), a chemokine (e.g., CX3CL1), or a suicide gene (e.g., thymidine kinase, IL-12, IFN-gamma, TNF-alpha). First, MSCs will be infected in vitro at different MOIs (multiplicity of infection) ranging from 10 to 1000 in complete DMEM without SFB during 2 hours. Then, infected MSCs will be stimulated in culture with rAMF for about 18 h and systemically injected (5Ă105) in HCC, colorectal cancer, and/or breast cancer tumor-bearing mice. Tumor growth will be assessed by calliper and tumor volume (mm3) will be calculated using the formula Ď/6Ălarger diameterĂ(smaller diameter)2.
1. A composition comprising a mesenchymal stromal cell (MSC) stimulated with a recombinant autocrine motility factor (rAMF), wherein the MSC comprises a therapeutic agent and wherein the MSC of the composition has (1) increased migration to a tumor or a tumor cell after rAMF stimulation and/or (2) increased adhesion to an endothelial cell after rAMF stimulation.
2. The composition of claim 1, wherein the endothelial cell is a vascular endothelial cell.
3. The composition of claim 1, wherein the tumor is a solid tumor.
4. The composition of 1, wherein the tumor is a cancer selected from the group consisting of a liver cancer, a colon cancer, a pancreatic cancer, a lung cancer, a gastrointestinal cancer, a kidney cancer, or a breast cancer.
5. The composition of claim 1, wherein the tumor is a carcinoma.
6. The composition of claim 5, wherein the carcinoma is hepatocellular carcinoma (HCC).
7. The composition of claim 5, wherein carcinoma is colorectal carcinoma.
8. The composition of claim 1, wherein the tumor or the tumor cell expresses endogenous AMF.
9. The composition of claim 1, wherein the increased migration and or adhesion is two-fold greater than migration and or adhesion of the MSC without rAMF stimulation.
10. The composition of claim 1, wherein the source of the MSC is selected from the group consisting of bone marrow, adipose tissue, and umbilical cord.
11. The composition of claim 10, wherein the umbilical cord MSC is harvested from human umbilical cord perivascular tissue.
12. The composition of claim 1, wherein the therapeutic agent is a recombinant anti-tumor gene.
13. The composition of claim 1, wherein the therapeutic agent is en oncolytic virus.
14. The composition of claim 13, wherein the oncolytic virus is engineered to express a recombinant anti-tumor gene.
15. The composition of claim 12, wherein the anti-tumor gene is selected from the group consisting of an interferon, an interleukin, a chemokine, a suicide gene, and any combination thereof.
16. The composition of claim 15, wherein the anti-tumor acne is selected from the group consisting of interferon ι, interferon β, interleukin 1, interleukin 12, CX3CL1, thymidine kinase, IL-12, IFN-gamma, TNF-alpha, and any combination thereof.
17. The composition of claim 1, wherein the MSC further comprises a recombinant AMF receptor.
18. The composition of claim 1, wherein the MSC stimulated with rAMF expresses increased levels of matrix metalloproteinase (MMP) after rAMF stimulation.
19. The composition of claim 18, wherein the MMP is selected from the group consisting MMP2, MMP3, or any combination thereof.
20. A method for increasing migration or anchorage of a mesenchymal stromal cell (MSC) to a tumor comprising (a) stimulating the MSC with a recombinant autocrine motility factor (rAMF), and (b) administering the stimulated MSC of (a) t the tumor, wherein the MSC comprises a therapeutic agent.
21. A method for treating a subject with a tumor comprising (a) stimulating a mesenchymal stromal cell (MSC) comprising a therapeutic agent with a recombinant autocrine motility factor (rAMF), and (b) administering the stimulated MSC of (a) to the subject.
22. The method of claim 20, wherein the tumor is a solid tumor.
23. The method of claim 20, wherein the tumor is a cancer selected from the group consisting of a liver cancer, a colon cancer, a pancreatic cancer, a lung cancer, a gastrointestinal cancer, a kidney cancer, or a breast cancer.
24. The method of claim 20, wherein the tumor is a carcinoma.
25. The method of claim 24, wherein the carcinoma is hepatocellular carcinoma (HCC).
26. The method of claim 24, wherein carcinoma is colorectal carcinoma.
27. The method of claim 20, wherein the tumor expresses endogenous AMF.
28. The method of claim 20, wherein the increased migration is two-fold greater than migration of the MSC without rAMF stimulation.
29. The method of claim 20, wherein the source of the MSC is selected from the group consisting of bone marrow, adipose tissue, and umbilical cord.
30. The method of claim 29, wherein the umbilical cord MSC is harvested from human umbilical cord perivascular tissue.
31. The method of claim 20, wherein the therapeutic agent is a recombinant anti-tumor gene.
32. The method of claim 20, wherein the therapeutic agent is an oncolytic virus.
33. The method of claim 32, wherein the oncolytic virus is engineered to express a recombinant anti-tumor gene.
34. The method of claim 31, wherein the anti-tumor gene is selected from the group consisting of an interferon, an interleukin, a chemokine, a suicide gene, and any combination thereof.
35. The method of claim 34, wherein the anti-tumor gene is selected from the group consisting of interferon ι, interferon β, interleukin 1, interleukin 12, CX3CL1, thymidine kinase, IL-12, IFN-gamma, TNF-alpha, or any combination thereof.
36. The method of claim 20, wherein the MSC further comprises a recombinant AMF receptor.
37. The method of claim 20, wherein the MSC stimulated with rAMF expresses increased levels of matrix metalloproteinase (MMP) after rAMF stimulation.
38. The method of claim 37, wherein the MMP is selected from the group consisting MMP2, MMP3, or any combination thereof.
39. The method of claim 21, wherein the administration is systemic.
40. The method of claim 21, wherein the administration is to an intra-hepatic artery.