Patent application title:

Microorganism and Method for the Fermentative Production of an Organic-Chemical Compound

Publication number:

US20160244490A1

Publication date:
Application number:

15/147,885

Filed date:

2016-05-05

Abstract:

The invention relates to a microorganism which produces and/or secretes an organic-chemical compound, wherein the microorganism has increased expression, compared to the particular starting strain, of one or more protein subunits of the ABC transporter having the activity of a trehalose importer, said microorganism being capable of taking up trehalose from the medium; and to a method for the production of an organic-chemical compound, using the microorganism according to the invention, wherein accumulation of trehalose in the fermentation broth is reduced or avoided.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C07K14/34 »  CPC main

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)

C12P13/08 »  CPC further

Preparation of nitrogen-containing organic compounds; Alpha- or beta- amino acids Lysine; Diaminopimelic acid; Threonine; Valine

Description

CROSS REFERENCE TO RELATED APPLICATIONS

The present application is a continuation of U.S. Ser. No. 13/438,665, filed on Apr. 3, 2012, which claims the benefit of U.S. provisional application 61/533,783 filed on Sep. 12, 2011 and priority to German Application, DE 10 2011 006 716.7 filed on Apr. 4, 2011.

FIELD OF THE INVENTION

The invention relates to a microorganism which produces and/or secretes an organic-chemical compound, said microorganism having increased expression of a trehalose importer, and to a method of producing an organic-chemical compound by using the microorganism according to the invention.

BACKGROUND OF THE INVENTION

L-Amino acids are used in human medicine, in the pharmaceutical industry, in the food industry and very particularly in animal nutrition. It is known that L-amino acids such as, for example, L-lysine, are produced by fermentation of strains of coryneform bacteria, in particular Corynebacterium glutamicum, or of strains of the Enterobacteriaceae family, in particular Escherichia coli. Because of the great economic importance, work is continually being done on improving the production methods. Method improvements may relate to fermentation technology measures such as, for example, stirring and supplying oxygen, or to the composition of the nutrient media, for example the sugar concentration during fermentation, or to the working-up to product form by, for example, ion exchange chromatography or to the intrinsic performance properties of the microorganism itself.

The methods used for improving the performance properties of these microorganisms are those of mutagenesis, selection and choice of mutants. The strains obtained in this way are resistant to anti-metabolites or are auxotrophic for metabolites of regulatory importance, and produce L-amino acids. A known anti-metabolite is the lysine analogue S-(2-aminoethyl)-L-cysteine (AEC).

Methods of recombinant DNA technology have likewise been used for some years for strain improvement of L-amino acid-producing strains of the genus Corynebacterium, in particular Corynebacterium glutamicum, or of the genus Escherichia, in particular Escherichia coli, by modifying, i.e. enhancing or attenuating, individual amino acid biosynthesis genes and investigating the effect on amino acid production.

The nucleotide sequences of the chromosomes of numerous bacteria have been disclosed. The nucleotide sequence of the Corynebacterium glutamicum ATCC13032 genome is described in Ikeda and Nakagawa (Applied Microbiology and Biotechnology 62:99-109 (2003)), in EP 1 108 790 and in Kalinowski et al. (J. Biotechnol. 104(1-3), (2003)). The nucleotide sequence of the Corynebacterium glutamicum R genome is described in Yukawa et al. (Microbiology 153(4)1042-1058 (2007)). The nucleotide sequence of the Corynebacterium efficiens genome is described in Nishio et al. (Genome Research 13(7):1572-1579 (2003)). The nucleotide sequence of the Corynebacterium diphteriae NCTC 13129 genome has been described by Cerdeno-Tarraga et al. (Nucl. Ac. Res. 31 (22):6516-6523 (2003)). The nucleotide sequence of the Corynebacterium jeikeum genome has been described by Tauch et al. (J. Bacteriol. 187(13):4671-4682 (2005)).

A review of various aspects of the fermentative production of L-amino acids can be found in R. Faurie and J. Thommel in Advances in Biochemical Engineering Biotechnology, volume 79 (Springer-Verlag, Berlin, Heidelberg Germany (2003)).

Significant amounts of secreted trehalose are found in the supernatant of industrial fermentations of C. glutamicum. This externally accumulated trehalose is not metabolically recycled by the cells. Said externally accumulated trehalose therefore represents a significant loss in industrial fermentations, both in respect of maximally achievable product formation and with regard to the biomass concentration reached in the fermenter.

Making use of the externally accumulated trehalose is the main goal desired. Achieving this goal would have a plurality of possible positive consequences: (1) utilization of substrate carbon which otherwise remains unused at the end of the fermentation, (2) increase in the biomass achievable in the fermentation, (3) increased product yield in biotechnological production processes, e.g. in amino acid production, (4) avoidance of unwanted contamination in the product supernatant at the end of the fermentation.

SUMMARY OF THE INVENTION

The present invention provides a microorganism which produces and/or secretes an organic-chemical compound. The microorganism has increased expression, compared to the particular starting strain, of one or more protein subunits of the ABC transporter having the activity of a trehalose importer, and is capable of taking up trehalose from the medium.

The invention furthermore provides a method for the fermentative production of an organic-chemical compound, comprising the steps:

    • a) culturing the above-described microorganism according to the present invention in a suitable medium, resulting in a fermentation broth, and
    • b) accumulating the organic-chemical compound in the fermentation broth of a);

wherein accumulation of trehalose in the fermentation broth is reduced or avoided.

Preference is given to reducing the accumulation of trehalose in the fermentation broth by 50% or more, by 70% or more, by 80% or more, by 90% or more, by 95% or more, by 98% or more, by 99% or more, and most preferably by 99.5% or more, compared to the particular starting strain of the microorganism.

The present invention is advantageous in that (1) substrate carbon in the form of trehalose which otherwise remains unused in the fermentation broth at the end of the fermentation is utilized; (2) the biomass achievable in the fermentation is increased; (3) the product yield in biotechnological production processes, e.g. amino acid production, is increased and (4) unwanted contamination in the product supernatant at the end of the fermentation is avoided.

Surprisingly, a trehalose uptake system has been identified for C. glutamicum. Enhanced expression of all genes of the operon encoding the trehalose import system result in an increase in the target product (the organic-chemical compound) with the use of a corresponding producer strain. Surprisingly, a corresponding trehalose uptake has also been found when only one of the subunits (e.g. permease subunit) is expressed. The present invention thus provides microorganisms (producer strains) whose cells take up the externally accumulated trehalose through an active transport system in the plasma membrane. The fact that C. glutamicum has the metabolic capacity of metabolizing trehalose in the cytoplasm gives rise to the above advantages of the present invention. Preferably, the microorganism is capable of reducing, compared to the particular starting strain of the microorganism, or, in particular, of avoiding, accumulation of trehalose in the medium (culturing medium).

In a preferred embodiment of the microorganism, the ABC transporter having the activity of a trehalose importer is derived from Corynebacterium glutamicum. The protein subunits of the ABC transporter having the activity of a trehalose importer are as follows: integral membrane protein (permease), ATP-binding and -hydrolyzing (ATPase) protein and periplasmic (or lipoprotein) substrate-binding protein. The composition of an ABC transporter is as follows: two permeases, two ATPases and one periplasmic (or lipoprotein) substrate-binding protein. The two permeases and the ATPases may in each case have different amino acid sequences.

A preferred embodiment of the microorganism according to the present invention has increased expression, compared to the particular starting strain, of all protein subunits of the ABC transporter having the activity of a trehalose importer. This means that preferentially the permease, the ATPase and the periplasmic subunit of the ABC transporter having the activity of a trehalose importer have increased expression, i.e. are overexpressed.

In an alternative embodiment, the microorganism according to the present invention has increased expression, compared to the particular starting strain, of one or more protein subunits of the ABC transporter having the activity of a trehalose importer. Moreover, a gene of the operon coding for the subunits of the ABC transporter having the activity of a trehalose importer, which (gene) does not necessarily code for a subunit of the ABC transporter itself, may have increased expression.

Preference is furthermore given to a microorganism having, compared to the particular starting strain, increased expression of at least one polynucleotide selected from the group consisting of a) to 0:

    • a) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:2 or 14;
    • b) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:4 or 16;
    • c) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:6 or 18;
    • d) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:8 or 20;
    • e) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:10 or 22;
    • f) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:12 or 24.

Preference is furthermore given to the microorganism having, compared to the particular starting strain, increased expression of at least one polynucleotide selected from the group consisting of a), b), d), e):

    • a) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:2 or 14;
    • b) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:4 or 16;
    • d) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:8 or 20;
    • e) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:10 or 22.

In a further preferred embodiment, the microorganism has, compared to the particular starting strain, increased expression of at least one polynucleotide selected from the group consisting of b), d) and e):

    • b) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:4 or 16;
    • d) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:8 or 20;
    • e) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:10 or 22.

Particularly preferably, the microorganism has, compared to the particular starting strain, increased expression of the following polynucleotides:

    • d) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:8 or 20; and/or
    • e) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:10 or 22.

A further, preferred embodiment of the microorganism has, compared to the particular starting strain, increased expression of the polynucleotides a) and b):

    • a) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:2 or 14;
    • b) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:4 or 16;

and of the polynucleotide d) and/or e)

    • d) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:8 or 20;
    • e) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:10 or 22.

Preference is furthermore given to a microorganism having, compared to the particular starting strain, increased expression of the polynucleotides a), b) c), d) and e), and, where appropriate, f).

An organic-chemical compound means for the purposes of the invention a vitamin such as, for example, thiamine (vitamin B1), riboflavin (vitamin B2), cyanocobalamin (vitamin B12), folic acid (vitamin M), tocopherol (vitamin E) or nicotinic acid/nicotinamide, a nucleoside or nucleotide such as, for example, S-adenosyl-methionine, inosine 5â€Č-monophosphoric acid and guanosine 5â€Č-monophosphoric acid, L-amino acids, or else an amine such as cadaverin, for example. Preference is given to producing L-amino acids and products containing them.

The organic-chemical compound produced and/or secreted by the microorganism according to the invention is preferably selected from the group consisting of vitamin, nucleoside or nucleotide, L-amino acids and amine.

The term “L-amino acid” includes the proteinogenic amino acids and also L-ornithine and L-homoserine. Proteinogenic L-amino acids are to be understood to mean the L-amino acids present in natural proteins, that is in proteins of microorganisms, plants, animals and humans. Proteinogenic amino acids comprise L-aspartic acid, L-asparagine, L-threonine, L-serine, L-glutamic acid, L-glutamine, L-glycine, L-alanine, L-cysteine, L-valine, L-methionine, L-isoleucine, L-leucine, L-tyrosine, L-phenylalanine, L-histidine, L-lysine, L-tryptophan, L-arginine, L-proline and in some cases L-selenocysteine and L-pyrrolysine.

The organic-chemical compound is particularly preferably selected from the group consisting of proteinogenic L-amino acid, L-ornithine and L-homoserine. Particular preference is given to the proteinogenic L-amino acid being selected from the group consisting of L-lysine, L-methionine, L-valine, L-proline, L-glutamate and L-isoleucine, in particular L-lysine.

The term amino acids or L-amino acids, where mentioned herein, also comprises their salts, for example lysine monohydrochloride or lysine sulphate in the case of the amino acid L-lysine.

The microorganism is preferably selected from the group consisting of bacteria, yeast and fungi, particularly preferably among the bacteria from the group consisting of the genus Corynebacterium and the bacteria of the Enterobacteriaceae family, with very particular preference being given to the species Corynebacterium glutamicum.

In a further, preferred embodiment, expression of the polynucleotide coding for a protein subunit of the ABC transporter having the activity of a trehalose importer is increased by one or more measures selected from the following group:

    • a) expression of the gene is under the control of a promoter which is stronger in the microorganism used for the method than the original promoter of said gene;
    • b) increasing the copy number of the gene coding for a polypeptide having the activity of a trehalose importer; preferably by inserting said gene into plasmids with increased copy number and/or by integrating at least one copy of said gene into the chromosome of said microorganism;
    • c) the gene is expressed using a ribosome binding site which is stronger in the microorganism used for the method than the original ribosome binding site of said gene;
    • d) the gene is expressed with optimization of the codon usage of the microorganism used for the method;
    • e) the gene is expressed with reduction of mRNA secondary structures in the mRNA transcribed from said gene;
    • f) the gene is expressed with elimination of RNA polymerase terminator sequences in the mRNA transcribed from said gene;
    • g) the gene is expressed with use of mRNA-stabilizing sequences in the mRNA transcribed from said gene.

The above measures for increasing expression may be combined in a suitable manner. Preference is given to increasing expression of the polynucleotide coding for a protein subunit of the ABC transporter having the activity of a trehalose importer by combining at least two of the measures selected from the group consisting of a), b) and c), particularly preferably by combining measures a) and b).

As mentioned above, the present invention also relates to a method for the fermentative production of an organic-chemical compound, comprising the steps:

    • a) culturing the above-described microorganism according to the present invention in a suitable medium, resulting in a fermentation broth, and
    • b) accumulating the organic-chemical compound in the fermentation broth of a);

wherein accumulation of trehalose in the fermentation broth is reduced or avoided.

Preference is given to reducing the accumulation of trehalose in the fermentation broth by 50% or more, by 70% or more, by 80% or more, by 90% or more, by 95% or more, by 98% or more, by 99% or more, and most preferably by 99.5% or more, compared to the particular starting strain of the microorganism.

In a preferred method, the microorganism used for culturing has, compared to the particular starting strain, increased expression of one or more polynucleotides according to one of the following definitions I to VIII:

    • I: increased expression, compared to the particular starting strain, of a polynucleotide selected from the group consisting of a) to 0:
      • a) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:2 or 14;
      • b) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:4 or 16;
      • c) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:6 or 18;
      • d) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:8 or 20;
      • e) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:10 or 22;
      • f) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence depicted in SEQ ID NO:12 or 24;
    • II: increased expression, compared to the particular starting strain, of a polynucleotide selected from the group consisting of a), b), d) and e);
    • III: increased expression, compared to the particular starting strain, of a polynucleotide selected from the group consisting of b), d) and e);
    • IV: increased expression, compared to the particular starting strain, of the polynucleotide d) and/or e);
    • V: increased expression, compared to the particular starting strain, of any polynucleotides a), b), d) and e);
    • VI: increased expression, compared to the particular starting strain, of any polynucleotides a), b), d);
    • VII: increased expression, compared to the particular starting strain, of any polynucleotides a), b), e);
    • VIII: increased expression, compared to the particular starting strain, of any polynucleotides a) to e) and, where appropriate, f).

Preference is given to producing from the fermentation broth a product in liquid or solid form.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 depicts the arrangement of open reading frames cg0835 to cg0830. The reading frames code for the following putative proteins: cg0835: ATPase; cg0834 periplasmic substrate-binding protein; cg0832: permease subunit; cg0831 permease subunit.

FIG. 2 is a schematic representation of expression construct pXMJ19-cg0831. Table 2 below summarizes the abbreviations and names used and also the meaning thereof. The base pair numbers indicated are approximations obtained within the limits of reproducibility of measurements.

TABLE 2
cat chloramphenicol resistance gene
lacI coding for Lac repressor
Ptac tac promoter
oriCg origin of Corynebacterium glutamicum plasmid pBL1
ori pUC origin of Escherichia coli plasmid pUC
TrrnB rrnB terminator
cg0831 coding for permease subunit
cg0832 coding for permease subunit
cg0833 coding for unknown protein
cg0834 coding for periplasmic substrate-binding protein
cg0835 coding for ATPase

FIG. 3 is a schematic representation of plasmid pK18mobsacB_Pgap_cg0832 used for functionally linking ORF cg0832 to the Pgap promoter. Table 3 below summarizes the abbreviations and names used and also the meaning thereof. The abbreviations and names used have the following meanings. The base pair numbers indicated are approximations obtained within the limits of reproducibility of measurements.

TABLE 3
Kan: kanamycin resistance gene
NruI cleavage site of restriction enzyme NruI
HindIII cleavage site of restriction enzyme HindIII
ScaI cleavage site of restriction enzyme ScaI
XbaI cleavage site of restriction enzyme XbaI
Pgap_cg0832 DNA cassette for establishing functional linkage of
ORF cg0832 and the Pgap promoter
sacB: sacB-gene
RP4-mob: mob region containing the origin of replication for
transfer (oriT)
oriV: origin of replication V

DETAILED DESCRIPTION OF THE INVENTION

As mentioned above, the term microorganism comprises bacteria, yeasts and fungi. Among the bacteria, mention may be made in particular of the genus Corynebacterium and of bacteria of the Enterobacteriaceae family.

Within the genus Corynebacterium, preference is given to strains based on the following species:

    • Corynebacterium efficiens such as, for example, type strain DSM44549;
    • Corynebacterium glutamicum such as, for example, type strain ATCC13032 or strain R; and
    • Corynebacterium ammoniagenes such as, for example, strain ATCC6871;

with the species Corynebacterium glutamicum being very particularly preferred.

Some representatives of the species Corynebacterium glutamicum are known in the prior art also by different names. These include, for example:

strain ATCC13870, referred to as Corynebacterium acetoacidophilum;

strain DSM20137, referred to as Corynebacterium ilium;

strain ATCC17965, referred to as Corynebacterium melassecola;

strain ATCC14067, referred to as Brevibacterium flavum;

strain ATCC13869, referred to as Brevibacterium lactofermentum; and

strain ATCC14020, referred to as Brevibacterium divaricatum.

The term “Micrococcus glutamicus” has likewise been in use for Corynebacterium glutamicum. Some representatives of the species Corynebacterium efficiens have also been referred to as Corynebacterium thermoaminogenes in the prior art, for example the strain FERM BP-1539.

The microorganisms or strains employed for the measures of overexpressing the trehalose importer (starting strains) preferably already have the ability to concentrate the desired L-amino acids in the cell or to secrete them into the surrounding nutrient medium and accumulate them there. The expression “to produce” is also used for this hereinbelow.

More specifically, the strains employed for the measures of overexpression have the ability to concentrate in the cell or accumulate in the nutrient medium ≧(at least) ≧0.10 g/l, 0.25 g/l, ≧0.5 g/l, ≧1.0 g/l, ≧1.5 g/l, ≧2.0 g/l, ≧4 g/l or ≧10 g/l of the desired compound within ≩(no more than) 120 hours, ≩96 hours, ≩48 hours, ≩36 hours, ≩24 hours or ≩12 hours. The starting strains are preferably strains produced by mutagenesis and selection, by recombinant DNA technology or by a combination of both methods.

A person skilled in the art understands that a microorganism suitable for the measures of the invention can also be obtained by firstly overexpressing a trehalose importer in a wild strain, for example in the Corynebacterium glutamicum type strain ATCC 13032 or in the strain ATCC 14067, and then, by means of further genetic measures described in the prior art, causing the microorganism to produce the desired L-amino acid(s). Transforming the wild type only with the polynucleotide mentioned does not constitute an inventive measure.

Examples of strains of the species Corynebacterium glutamicum which secrete or produce L-lysine are:

    • Corynebacterium glutamicum MH20-22B (=DSM16835) described in Menkel, et al. (Applied and Environmental Microbiology:55(3):684-688 (1989)) and deposited as DSM16835;
    • Corynebacterium glutamicum DM1729 described in Georgi, et al. (Metabolic Engineering 7:291-301 (2005)) and in EP 1 717 616 A2 and deposited as DSM17576;
    • Corynebacterium glutamicum DSM13994 described in U.S. Pat. No. 6,783,967; and
    • Corynebacterium glutamicum DM1933 described in Blombach, et al. (Appl. Environ. Microbiol. 75(2):419-27 (January 2009).

An example of a strain of the species Corynebacterium efficiens which secretes or produces L-lysine is: Corynebacterium thermoaminogenes AJ12521 (=FERM BP-3304) described in U.S. Pat. No. 5,250,423.

L-Lysine-producing microorganisms typically have a feedback-resistant or desensitized aspartate kinase. Feedback-resistant aspartate kinases mean aspartate kinases (LysC) which, by comparison with the wild form (wild type), show less sensitivity to inhibition by mixtures of lysine and threonine or mixtures of AEC (aminoethylcysteine) and threonine or lysine alone or AEC alone. The genes or alleles coding for these aspartate kinases which are desensitized by comparison with the wild type are also referred to as lysCFBR alleles. The suitable wild type in the case of aspartate kinases of the species Corynebacterium glutamicum is the strain ATCC13032. Numerous lysCFBR alleles coding for aspartate kinase variants which have amino acid substitutions by comparison with the wild-type protein are described in the prior art. The lysC gene in bacteria of the genus Corynebacterium is also referred to as ask gene. The aspartate kinase encoded by the lysC gene in Enterobacteriaceae is also referred to as aspartokinase III.

An extensive list containing information about the amino acid substitutions in the Corynebacterium glutamicum aspartate kinase protein that result in desensitization is included inter alia in WO2009141330. Preference is given to aspartate kinase variants carrying amino acid substitutions selected from the group consisting of: L-isoleucine for L-threonine at position 380 of the amino acid sequence and optionally L-phenylalanine for L-serine at position 381, L-isoleucine for L-threonine at position 311 and L-threonine for L-alanine at position 279.

An extensive list containing information about the amino acid substitutions in the Escherichia coli aspartate kinase III protein that result in desensitization to inhibition by L-lysine is included inter alia in EP 0 834 559 A1 on page 3 (lines 29 to 41). Preference is given to an aspartate kinase variant containing L-aspartic acid instead of glycine at position 323 of the amino acid sequence and/or L-isoleucine instead of L-methionine at position 318.

An example of a strain of the species Corynebacterium glutamicum which secretes or produces L-methionine is Corynebacterium glutamicum DSM 17322 described in WO 2007/011939.

Examples of known representatives of coryneform bacterial strains that produce or secrete L-tryptophan are:

    • Corynebacterium glutamicum K76 (=Ferm BP-1847) described in U.S. Pat. No. 5,563,052;
    • Corynebacterium glutamicum BPS13 (=Ferm BP-1777) described in U.S. Pat. No. 5,605,818; and
    • Corynebacterium glutamicum Ferm BP-3055 described in U.S. Pat. No. 5,235,940.

Examples of known representatives of coryneform bacterial strains that produce or secrete L-valine are:

    • Brevibacterium lactofermentum FERM BP-1763 described in U.S. Pat. No. 5,188,948;
    • Brevibacterium lactofermentum FERM BP-3007 described in U.S. Pat. No. 5,521,074;
    • Corynebacterium glutamicum FERM BP-3006 described in U.S. Pat. No. 5,521,074; and
    • Corynebacterium glutamicum FERM BP-1764 described in U.S. Pat. No. 5,188,948.

Examples of known representatives of coryneform bacterial strains that produce or secrete L-isoleucine are:

    • Brevibacterium flavum FERM BP-760 described in U.S. Pat. No. 4,656,135;
    • Brevibacterium flavum FERM BP-2215 described in U.S. Pat. No. 5,294,547; and
    • Corynebacterium glutamicum FERM BP-758 described in U.S. Pat. No. 4,656,135.

Examples of known representatives of coryneform bacterial strains that produce or secrete L-homoserine are:

    • Micrococcus glutamicus ATCC 14296 described in U.S. Pat. No. 3,189,526; and
    • Micrococcus glutamicus ATCC 14297 described in U.S. Pat. No. 3,189,526.

Cadaverine-producing or -secreting microorganisms are described, for example, in WO 2007/113127.

An ABC transporter having the activity of a trehalose importer means a protein or a protein complex with multiple subunits which catalyzes the transport of trehalose from the surrounding area into the cell of the microorganism in question.

ABC transporters constitute one of the largest families of membrane proteins, a common structural element of which is an ATP-binding cassette and which actively transport specific substrates across a cellular membrane. The energy needed for transporting the substrates of ABC transporters against a concentration gradient is produced by binding and hydrolysis of ATP on the ATPase unit.

The structure of a prokaryotic ABC transporter normally consists of three parts: two integral membrane proteins (permease), each one having from five to seven transmembrane segments, two additional proteins which bind and hydrolyse ATP (ATPase), and a periplasmic substrate-binding protein (or membrane-anchored lipoprotein). Many of the genes for said three parts form operons. ABC transporters thus belong firstly to the primarily active transporters and secondly to the membrane-bound ATPases.

Public databases such as, for example, the UniProtKB (Universal Protein Resource Knowledgebase) database contain descriptions of ABC transporters of very different organisms. The UniProtKB database is maintained by the UniProt consortium which includes the European Bioinformatics Institute (EBI, Wellcome Trust, Hinxton Cambridge, United Kingdom), the Swiss Institute of Bioinformatics (SIB, Centre Medical Universitaire, Geneva, Switzerland) and the Protein Information Resource (PIR, Georgetown University, Washington, D.C., US).

The genes for a trehalose importer may be isolated from the organisms with the aid of the polymerase chain reaction (PCR) using suitable primers. Instructions can be found inter alia in the laboratory manual “PCR” by Newton and Graham (Spektrum Akademischer Verlag, Heidelberg, Germany, 1994) and in WO 2006/100211, pages 14 to 17.

The measures of the invention may make use of the genes of the trehalose importer from corynebacteria. Preference is given to using genes coding for polypeptides which have trehalose importer activity and whose amino acid sequence is ≧(at least) ≧50% ≧60% ≧70% ≧80% ≧90% ≧92% ≧94% ≧96% ≧97% ≧98% ≧99%, identical to the amino acid sequence selected from SEQ ID NO: 2, 4, 6, 8, 10 and, where appropriate, 12, or 14, 16, 18, 20, 22, 24. In the course of the studies resulting in the present invention, the operon coding for the trehalose importer of Corynebacterium glutamicum was identified. The operon encoding the trehalose importer in Corynebacterium glutamicum has multiple reading frames or genes.

Table 1 summarizes the information regarding the reading frames of the operon coding for the Corynebacterium glutamicum trehalose importer.

TABLE 1
The genes/reading frames of the operon coding for the
Corynebacterium glutamicum trehalose importer
Name of the Length (number
reading frame of amino acid SEQ
in the operon coding for residues) ID NO:
cg0835 ATPase 332 2
(msik2)
cg0834 periplasmic substrate- 424 4
binding protein
cg0833 unknown 151 6
cg0832 permease 344 8
cg0831 permease 278 10
cg0830 hypothetical reading 74 12
frame

The genomic arrangement of the reading frames is depicted in FIG. 1, and the sequence of the region is listed under SEQ ID NO:25.

From a chemical point of view, a gene is a polynucleotide. A polynucleotide encoding a protein/polypeptide is used herein synonymously with the term “gene”.

A preferred embodiment of the microorganism overexpresses one or more gene(s) coding for one or more polypeptide(s) selected from a) to 0 below:

a)

    • i) a polypeptide consisting of or comprising the amino acid sequence depicted in SEQ ID NO: 2;
    • ii) a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence of i), said polypeptide being a subunit of a protein complex having the activity of a trehalose importer;
    • iii) a polypeptide having an amino acid sequence containing a deletion, substitution, insertion and/or addition of from 1 to 66, 1 to 33, 1 to 17, 1 to 7, amino acid residues with respect to the amino acid sequence depicted in SEQ ID NO: 2, said polypeptide being a subunit of a protein complex having the activity of a trehalose importer;

b)

    • i) a polypeptide consisting of or comprising the amino acid sequence depicted in SEQ ID NO: 4;
    • ii) a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence of i), said polypeptide being a subunit of a protein complex having the activity of a trehalose importer;
    • iii) a polypeptide having an amino acid sequence containing a deletion, substitution, insertion and/or addition of from 1 to 85, 1 to 42, 1 to 21, 1 to 9, amino acid residues with respect to the amino acid sequence depicted in SEQ ID NO: 4, said polypeptide being a subunit of a protein complex having the activity of a trehalose importer;

c)

    • i) a polypeptide consisting of or comprising the amino acid sequence depicted in SEQ ID NO: 6;
    • ii) a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence of i), said polypeptide being a subunit of a protein complex having the activity of a trehalose importer;
    • iii) a polypeptide having an amino acid sequence containing a deletion, substitution, insertion and/or addition of from 1 to 30, 1 to 15, 1 to 6, 1 to 3, amino acid residues with respect to the amino acid sequence depicted in SEQ ID NO: 6, said polypeptide being a subunit of a protein complex having the activity of a trehalose importer;

d)

    • i) a polypeptide consisting of or comprising the amino acid sequence depicted in SEQ ID NO: 8;
    • ii) a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence of i), said polypeptide being a subunit of a protein complex having the activity of a trehalose importer;
    • iii) a polypeptide having an amino acid sequence containing a deletion, substitution, insertion and/or addition of from 1 to 69, 1 to 34, 1 to 17, 1 to 7, amino acid residues with respect to the amino acid sequence depicted in SEQ ID NO: 8, said polypeptide being a subunit of a protein complex having the activity of a trehalose importer;

e)

    • i) a polypeptide consisting of or comprising the amino acid sequence depicted in SEQ ID NO: 10;
    • ii) a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence of i), said polypeptide being a subunit of a protein complex having the activity of a trehalose importer;
    • iii) a polypeptide having an amino acid sequence containing a deletion, substitution, insertion and/or addition of from 1 to 56, 1 to 28, 1 to 14, 1 to 6, amino acid residues with respect to the amino acid sequence depicted in SEQ ID NO: 10, said polypeptide being a subunit of a protein complex having the activity of a trehalose importer;

f)

    • i) a polypeptide consisting of or comprising the amino acid sequence depicted in SEQ ID NO: 12;
    • ii) a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence of i), said polypeptide being a subunit of a protein complex having the activity of a trehalose importer;
    • iii) a polypeptide having an amino acid sequence containing a deletion, substitution, insertion and/or addition of from 1 to 15, 1 to 8, 1 to 4, 1 to 2, amino acid residues with respect to the amino acid sequence depicted in SEQ ID NO: 12, said polypeptide being a subunit of a protein complex having the activity of a trehalose importer.

Preferred embodiments comprise variants which are at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99%, identical to the above-described amino acid sequences, i.e. with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99%, of the amino acid positions being identical to those of the above-described amino acid sequences. Percentage identity is preferably calculated over the entire length of the amino acid or nucleic acid region. A person skilled in the art has a number of programs, based on a multiplicity of algorithms, available for sequence comparison. In this context, the algorithms of Needleman and Wunsch or Smith and Waterman produce particularly reliable results. The program PileUp (J. Mol. Evolution. 25:351-360 (1987); Higgins, et al., CABIOS 5:151-153 (1989)) or the programs Gap and BestFit (Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970) and Smith and Waterman, Adv. Appl. Math. 2:482-489 (1981)), which are part of the GCG software package (Genetics Computer Group, 575 Science Drive, Madison, Wis., USA 53711 (1991)), are available for the alignment of sequences. The sequence identity percentages listed above are preferably calculated over the entire sequence region using the GAP program.

Where appropriate, preference is given to conservative amino acid substitutions. In the case of aromatic amino acids, conservative substitutions are those in which phenylalanine, tryptophan and tyrosine are substituted for each other. In the case of hydrophobic amino acids, conservative substitutions are those in which leucine, isoleucine and valine are substituted for one another. In the case of polar amino acids, conservative substitutions are those in which glutamine and asparagine are substituted for one another. In the case of basic amino acids, conservative substitutions are those in which arginine, lysine and histidine are substituted for one another. In the case of acidic amino acids, conservative substitutions are those in which aspartic acid and glutamic acid are substituted for one another. In the case of the amino acids containing hydroxyl groups, conservative substitutions are those in which serine and threonine are substituted for one another.

It is furthermore possible to use polynucleotides which hybridize under stringent conditions with the nucleotide sequence complementary to SEQ ID NO: 1, 3, 5, 7, 9, 11, preferably to the coding region of SEQ ID NO: 1, 3, 5, 7, 9, 11, and code for a polypeptide which is part of a trehalose importer.

Instructions regarding the hybridization of nucleic acids or polynucleotides can be found by the skilled worker inter alia in the manual “The DIG System Users Guide for Filter Hybridization” from Boehringer Mannheim GmbH (Mannheim, Germany, 1993) and in Liebl et al. (International Journal of Systematic Bacteriology 41:255-260 (1991)). Hybridization takes place under stringent conditions, that is to say only hybrids in which the probe (i.e. a polynucleotide comprising the nucleotide sequence complementary to SEQ ID NO: 1, 3, 5, 7, 9, 11, preferably the coding region of SEQ ID NO: 1, 3, 5, 7, 9, 11) and the target sequence (i.e. the polynucleotides treated with or identified by said probe) are at least 70% identical are formed. The stringency of the hybridization, including the washing steps, is known to be influenced or determined by varying the buffer composition, temperature and salt concentration. The hybridization reaction is generally carried out with relatively low stringency compared with the washing steps (Hybaid Hybridisation Guide, Hybaid Limited, Teddington, U K, 1996).

For example, a 5×SSC buffer at a temperature of approx. 50° C.-68° C. may be employed for the hybridization reaction. Here, probes may also hybridize with polynucleotides which are less than 70% identical to the nucleotide sequence of the probe employed. Such hybrids are less stable and are removed by washing under stringent conditions. This may be achieved, for example, by lowering the salt concentration to 2×SSC or 1×SSC and, where appropriate, subsequently 0.5×SSC (The DIG System User's Guide for Filter Hybridisation, Boehringer Mannheim, Mannheim, Germany, 1995), with a temperature of approx. 50° C.-68° C., approx. 52° C.-68° C., approx. 54° C.-68° C., approx. 56° C.-68° C., approx. 58° C.-68° C., approx. 60° C.-68° C., approx. 62° C.-68° C., approx. 64° C.-68° C., approx. 66° C.-68° C. being set. Preference is given to temperature ranges of approx. 64° C.-68° C. or approx. 66° C.-68° C. It is optionally possible to lower the salt concentration to a concentration corresponding to 0.2×SSC or 0.1×SSC. The SSC buffer optionally contains sodium dodecylsulphate (SDS) at a concentration of 0.1%. By gradually increasing the hybridization temperature in steps of approx. 1-2° C. from 50° C. to 68° C., it is possible to isolate polynucleotide fragments which are at least 70%, at least 80%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, or at least 99%, where appropriate 100%, identical to the sequence or complementary sequence of the probe employed and which code for a polypeptide which is part of a trehalose importer. Further instructions regarding hybridization are obtainable on the market in the form of “kits” (e.g. DIG Easy Hyb from Roche Diagnostics GmbH, Mannheim, Germany, Catalogue No. 1603558).

For the measures of the invention, a gene coding for a part of a trehalose importer is overexpressed in a microorganism or starting or parent strain producing the desired amino acid(s). Overexpression generally means an increase in the intracellular concentration or activity of a ribonucleic acid, of a protein (polypeptide) or of an enzyme by comparison with the starting strain (parent strain) or wild-type strain, if the latter is the starting strain. A starting strain (parent strain) means the strain on which the measure leading to overexpression has been carried out.

For overexpression, preference is given to the methods of recombinant overexpression. These include all methods in which a microorganism is prepared using a DNA molecule provided in vitro. Examples of such DNA molecules include promoters, expression cassettes, genes, alleles, coding regions, etc. They are transferred by methods of transformation, conjugation, transduction or similar methods into the desired microorganism.

The measures of overexpression increase the activity or concentration of the corresponding polypeptides generally by at least 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% or 500%, preferably at most by 1000%, 2000%, 4000%, 10000% or 20000%, based on the activity or concentration of said polypeptide in the strain prior to the measure resulting in overexpression.

Overexpression is achieved by a multiplicity of methods available in the prior art. These include increasing the copy number and modifying the nucleotide sequences directing or controlling expression of the gene. The transcription of a gene is controlled inter alia by the promoter and optionally by proteins which suppress (repressor proteins) or promote (activator proteins) transcription. The translation of the RNA formed is controlled inter alia by the ribosome binding site and the start codon. Polynucleotides or DNA molecules which include a promoter and a ribosome binding site and optionally a start codon are also referred to as expression cassette.

The copy number may be increased by means of plasmids which replicate in the cytoplasm of the microorganism. To this end, an abundance of plasmids are described in the prior art for very different groups of microorganisms, which plasmids can be used for setting the desired increase in the copy number of the gene. Plasmids suitable for the genus Escherichia are described, for example, in the manual Molecular Biology, Labfax (ed.: T. A. Brown, Bios Scientific, Oxford, U K, 1991). Plasmids suitable for the genus Corynebacterium are described, for example, in Tauch, et al. (J. Biotechnology 104(1-3):27-40, (2003)), or in Stansen, et al. (Applied and Environmental Microbiology 71:5920-5928 (2005)).

The copy number may furthermore be increased by at least one (1) copy by introducing further copies into the chromosome of the microorganism. Methods suitable for the genus Corynebacterium are described, for example, in the patents WO 03/014330, WO 03/040373 and WO 04/069996. Examples of methods suitable for the genus Escherichia are insertion of a gene copy into the att site of the phage (Yu, et al., Gene 223:77-81 (1998)), chromosomal amplification with the aid of the phage Mu, as described in EP 0 332 448, or the methods of gene replacement with the aid of conditionally replicating plasmids, as described by Hamilton, et al. (J. Bacteriol. 174:4617-4622 (1989)) or Link, et al. (J. Bacteriol. 179:6228-6237 (1997)).

Gene expression may furthermore be increased by using a strong promoter which is functionally linked to the gene to be expressed. Preference is given to using a promoter which is stronger than the natural promoter, i.e., the one present in the wild type or parent strain. To this end, the prior art has an abundance of methods available. “Functionallinkage” in this context means the sequential arrangement of a promoter with a gene, resulting in expression of said gene and control thereof.

Promoters suitable for the genus Corynebacterium can be found inter alia in Morinaga, et al. (J. Biotechnol. 5:305-312, (1987)), in the patent documents EP 0 629 699 A2, US 2007/0259408 A1, WO 2006/069711, EP 1 881 076 A1 and EP 1 918 378 A1 and in reviews such as the “Handbook of Corynebacterium glutamicum” (eds.: Lothar Eggeling and Michael Bott, CRC Press, Boca Raton, US (2005)) or the book “Corynebacteria, Genomics and Molecular Biology” (Ed.: Andreas Burkovski, Caister Academic Press, Norfolk, UK (2008)). Examples of promoters which allow controlled, i.e., inducible or repressible, expression are described, for example, in Tsuchiya, et al. (Bio/Technology 6{428-430 (1988)). Such promoters or expression cassettes are typically employed at a distance of from 1 to 1000, preferably 1 to 500, nucleotides upstream of the first nucleotide of the start codon of the coding region of the gene. It is likewise possible to place a plurality of promoters upstream of the desired gene or functionally link them to the gene to be expressed and in this way achieve increased expression. Examples of this are described in the patent WO 2006/069711.

The structure of Escherichia coli promoters is well known. It is therefore possible to increase the strength of a promoter by modifying its sequence by means of one or more substitution(s) and/or one or more insertion(s) and/or one or more deletion(s) of nucleotides. Examples of this can be found inter alia in “Herder Lexikon der Biologie” (Spektrum Akademischer Verlag, Heidelberg, Germany (1994)). Examples of the modification of promoters for increasing expression in coryneform bacteria can be found in U.S. Pat. No. 6,962,805 B2 and in a publication by Vasicová et al. (Bacteriol. 1999 October; 181(19):6188-91.). Enhancing a target gene by substituting a homologous promoter is described, for example, in EP 1 697 526 B1.

The structure of the Corynebacterium glutamicum ribosome binding site is likewise well known and is described, for example, in Amador (Microbiology 145, 915-924 (1999)), and in manuals and textbooks of genetics, for example “Gene and Klone” (Winnacker, Verlag Chemie, Weinheim, Germany (1990)) or “Molecular Genetics of Bacteria” (Dale and Park, Wiley and Sons Ltd., Chichester, UK (2004)).

Overexpression can likewise be achieved by increasing the expression of activator proteins or reducing or switching off the expression of repressor proteins.

The overexpression measures mentioned may be combined with one another in a suitable manner. Thus it is possible, for example, to combine the use of a suitable expression cassette with increasing the copy number or, preferably, the use of a suitable promoter with increasing the copy number.

Instructions regarding the handling of DNA, digestion and ligation of DNA, transformation and selection of transformants can be found inter alia in the known manual by Sambrook, et al. “Molecular Cloning: A Laboratory Manual, Second Edition” (Cold Spring Harbor Laboratory Press, 1989).

The extent of expression or overexpression can be determined by measuring the amount of the mRNA transcribed from the gene, by determining the amount of the polypeptide and by determining the enzyme activity. The amount of mRNA may be determined inter alia by using the methods of “Northern blotting” and of quantitative RT-PCR. Quantitative RT-PCR involves reverse transcription preceding the polymerase chain reaction. For this, the LightCyclerℱ system from Roche Diagnostics (Boehringer Mannheim GmbH, Roche Molecular Biochemicals, Mannheim, Germany) may be used, as described, for example, in Jungwirth, et al. (FEMS Microbiology Letters 281:190-197 (2008)).

The concentration of the protein may be determined via 1- and 2-dimensional protein gel fractionation and subsequent optical identification of the protein concentration by appropriate evaluation software in the gel. A customary method of preparing protein gels for coryneform bacteria and of identifying said proteins is the procedure described by Hermann, et al. (Electrophoresis 22:1712-23 (2001)). The protein concentration may likewise be determined by Western blot hybridization using an antibody specific for the protein to be detected (Sambrook et al., Molecular cloning: a laboratory manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989) and subsequent optical evaluation using corresponding software for concentration determination (Lohaus, et al., Biospektrum 5:32-39 (1998); Lottspeich, Angewandte Chemie 321:2630-2647 (1999)).

The microorganisms produced may be cultured continuously—as described, for example, in WO 05/021772—or discontinuously in a batch process (batch cultivation) or in a fed batch or repeated fed batch process for the purpose of producing the desired organic-chemical compound. A summary of a general nature about known cultivation methods is available in the textbook by Chmiel (Bioprozesstechnik 1. EinfĂŒhrung in die Bioverfahrenstechnik (Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by Storhas (Bioreaktoren and periphere Einrichtungen (Vieweg Verlag, Brunswick/Wiesbaden, 1994)).

The culture medium or fermentation medium to be used must in a suitable manner satisfy the demands of the respective strains. Descriptions of culture media for various microorganisms are present in the “Manual of Methods for General Bacteriology” of the American Society for Bacteriology (Washington D.C., USA, 1981). The terms culture medium and fermentation medium or medium are interchangeable.

It is possible to use, as carbon source, sugars and carbohydrates such as, for example, glucose, sucrose, lactose, fructose, maltose, molasses, sucrose-containing solutions from sugar beet or sugar cane processing, starch, starch hydrolysate and cellulose, oils and fats such as, for example, soybean oil, sunflower oil, groundnut oil and coconut fat, fatty acids such as, for example, palmitic acid, stearic acid and linoleic acid, alcohols such as, for example, glycerol, methanol and ethanol, and organic acids such as, for example, acetic acid or lactic acid.

It is possible to use, as nitrogen source, organic nitrogen-containing compounds such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soybean flour and urea, or inorganic compounds such as ammonium sulphate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. The nitrogen sources can be used individually or as mixture.

It is possible to use, as phosphorus source, phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts.

The culture medium must additionally comprise salts, for example in the form of chlorides or sulphates of metals such as, for example, sodium, potassium, magnesium, calcium and iron, such as, for example, magnesium sulphate or iron sulphate, which are necessary for growth. Finally, essential growth factors such as amino acids, for example homoserine and vitamins, for example thiamine, biotin or pantothenic acid, may be employed in addition to the above-mentioned substances.

The starting materials may be added to the culture in the form of a single batch or be fed in during the cultivation in a suitable manner.

The pH of the culture can be controlled by employing basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or aqueous ammonia, or acidic compounds such as phosphoric acid or sulphuric acid in a suitable manner. The pH is generally adjusted to a value of from 6.0 to 8.5, preferably 6.5 to 8. To control foaming, it is possible to employ antifoams such as, for example, fatty acid polyglycol esters. To maintain the stability of plasmids, it is possible to add to the medium suitable selective substances such as, for example, antibiotics. The fermentation is preferably carried out under aerobic conditions. In order to maintain these conditions, oxygen or oxygen-containing gas mixtures such as, for example, air are introduced into the culture. It is likewise possible to use liquids enriched with hydrogen peroxide. The fermentation is carried out, where appropriate, at elevated pressure, for example at an elevated pressure of from 0.03 to 0.2 MPa. The temperature of the culture is normally from 20° C. to 45° C. and preferably from 25° C. to 40° C., particularly preferably from 30° C. to 37° C. In batch processes, the cultivation is preferably continued until an amount of the desired organic-chemical compound sufficient for being recovered has formed. This aim is normally achieved within 10 hours to 160 hours. In continuous processes, longer cultivation times are possible. The activity of the microorganisms results in a concentration (accumulation) of the organic-chemical compound in the fermentation medium and/or in the cells of said microorganisms.

Examples of suitable fermentation media can be found inter alia in the U.S. Pat. No. 5,770,409, U.S. Pat. No. 5,990,350, U.S. Pat. No. 5,275,940, WO 2007/012078, U.S. Pat. No. 5,827,698, WO 2009/043803, U.S. Pat. No. 5,756,345 and U.S. Pat. No. 7,138,266.

Analysis of L-amino acids to determine the concentration at one or more time(s) during the fermentation can take place by separating the L-amino acids by means of ion exchange chromatography, preferably cation exchange chromatography, with subsequent post-column derivatization using ninhydrin, as described in Spackman et al. (Analytical Chemistry 30: 1190-1206 (1958)). It is also possible to employ ortho-phthalaldehyde rather than ninhydrin for post-column derivatization. An overview article on ion exchange chromatography can be found in Pickering (LC‱GC (Magazine of Chromatographic Science 7(6):484-487 (1989)).

It is likewise possible to carry out a pre-column derivatization, for example using ortho-phthalaldehyde or phenyl isothiocyanate, and to fractionate the resulting amino acid derivates by reversed-phase chromatography (RP), preferably in the form of high-performance liquid chromatography (HPLC). A method of this type is described, for example, in Lindroth, et al. (Analytical Chemistry 51:1167-1174 (1979)). Detection is carried out photometrically (absorption, fluorescence). A review regarding amino acid analysis can be found inter alia in the textbook “Bioanalytik” by Lottspeich and Zorbas (Spektrum Akademischer Verlag, Heidelberg, Germany 1998).

The performance of the methods or fermentation processes according to the invention, in terms of one or more of the parameters selected from the group of concentration (compound formed per unit volume), yield (compound formed per unit carbon source consumed), formation (compound formed per unit volume and time) and specific formation (compound formed per unit dry cell matter or dry biomass and time or compound formed per unit cellular protein and time) or else other process parameters and combinations thereof, is increased by at least 0.5%, at least 1%, at least 1.5% or at least 2%, based on methods or fermentation processes using microorganisms containing an increased trehalose importer activity.

The fermentation measures result in a fermentation broth which contains the desired organic-chemical compound, preferably L-amino acid. A product containing the organic-chemical compound is then provided or produced or recovered in liquid or solid form.

A “fermentation broth” means a fermentation medium or nutrient medium in which a microorganism has been cultivated for a certain time and at a certain temperature. The fermentation medium or the media employed during fermentation comprise(s) all the substances or components which ensure production of the desired compound and typically propagation and viability.

When the fermentation is complete, the resulting fermentation broth accordingly comprises:

    • a) the biomass (cell mass) of the microorganism, said biomass having been produced due to propagation of the cells of said microorganism,
    • b) the desired organic-chemical compound formed during the fermentation,
    • c) the organic by-products formed during the fermentation, and
    • d) the constituents of the fermentation medium employed or of the starting materials, such as, for example, vitamins such as biotin or salts such as magnesium sulphate, which have not been consumed in the fermentation.

The organic by-products include substances which are produced and optionally secreted by the microorganisms employed in the fermentation in addition to the particular desired compound. These also include sugars such as, for example, trehalose.

The fermentation broth is removed from the culture vessel or fermentation tank, collected where appropriate, and used for providing a product containing the organic-chemical compound, preferably an L-amino acid-containing product, in liquid or solid form. The expression “recovering the L-amino acid-containing product” is also used for this. In the simplest case, the L-amino acid-containing fermentation broth itself, which has been removed from the fermentation tank, constitutes the recovered product.

One or more of the measures selected from the group consisting of:

    • a) partial (>0% to <80%) to complete (100%) or virtually complete (≧80%, ≧90%, ≧95%, ≧96%, ≧97%, ≧98%, ≧99%) removal of the water,
    • b) partial (>0% to <80%) to complete (100%) or virtually complete (≧80%, ≧90%, ≧95%, ≧96%, ≧97%, ≧98%, ≧99%) removal of the biomass, the latter being optionally inactivated before removal,
    • c) partial (>0% to <80%) to complete (100%) or virtually complete (≧80%, ≧90%, ≧95%, ≧96%, ≧97%, ≧98%, ≧99%, ≧99.3%, ≧99.7%) removal of the organic by-products formed during fermentation, and
    • d) partial (>0%) to complete (100%) or virtually complete (≧80%, ≧90%, ≧95%, ≧96%, ≧97%, ≧98%, ≧99%, ≧99.3%, ≧99.7%) removal of the constituents of the fermentation medium employed or of the starting materials, which have not been consumed in the fermentation,
      from the fermentation broth achieves concentration or purification of the desired organic-chemical compound. Products having a desired content of said compound are isolated in this way.

The partial (>0% to <80%) to complete (100%) or virtually complete (≧80% to <100%) removal of the water (measure a)) is also referred to as drying. In one variant of the method, complete or virtually complete removal of the water, of the biomass, of the organic by-products and of the unconsumed constituents of the fermentation medium employed results in pure (≧80% by weight, ≧90% by weight) or high-purity (≧95% by weight, ≧97% by weight, ≧99% by weight) product forms of the desired organic-chemical compound, preferably L-amino acids. An abundance of technical instructions for measures a), b), c) and d) are available in the prior art.

In the case of the amino acid L-lysine, essentially four different product forms are known in the prior art. One group of L-lysine-containing products includes concentrated aqueous alkaline solutions of purified L-lysine (EP-B-0534865). A further group, as described for example in U.S. Pat. No. 6,340,486 and U.S. Pat. No. 6,465,025, includes aqueous acidic biomass-containing concentrates of L-lysine-containing fermentation broths. The best-known group of solid products includes pulverulent or crystalline forms of purified or pure L-lysine, which is typically in the form of a salt such as, for example, L-lysine monohydrochloride. A further group of solid product forms is described for example in EP-B-0533039. The product form described therein comprises besides L-lysine most of the starting materials used during the fermentative production and not consumed and, where appropriate, the biomass of the microorganism employed with a proportion of >0%-100%.

A wide variety of processes appropriate for the various product forms are known for producing the L-lysine-containing product or the purified L-lysine from the fermentation broth. The methods essentially used to produce pure solid L-lysine are those of ion exchange chromatography, where appropriate with use of activated carbon, and methods of crystallization. The corresponding base or a corresponding salt such as, for example, the monohydrochloride (Lys-HCl) or lysine sulphate (Lys2-H2SO4) is obtained in this way.

EP-B-0534865 describes a process for producing aqueous basic L-lysine-containing solutions from fermentation broths. In the process described therein, the biomass is separated from the fermentation broth and discarded. A base such as, for example, sodium hydroxide, potassium hydroxide or ammonium hydroxide is used to set a pH of between 9 and 11. The mineral constituents (inorganic salts) are removed from the broth by crystallization after concentration and cooling and are either used as fertilizer or discarded.

In processes for producing lysine by using bacteria of the genus Corynebacterium, preferred processes are those resulting in products which comprise constituents of the fermentation broth. These are used in particular as animal feed additives.

Depending on requirements, the biomass can be removed wholly or partly from the fermentation broth by separation methods such as, for example, centrifugation, filtration, decantation or a combination thereof, or be left completely therein. Where appropriate, the biomass or the biomass-containing fermentation broth is inactivated during a suitable process step, for example by thermal treatment (heating) or by addition of acid.

In one procedure, the biomass is completely or virtually completely removed so that no (0%) or at most 30%, at most 20%, at most 10%, at most 5%, at most 1% or at most 0.1% biomass remains in the prepared product. In a further procedure, the biomass is not removed, or is removed only in small proportions, so that all (100%) or more than 70%, 80%, 90%, 95%, 99% or 99.9% biomass remains in the product prepared. In one method according to the invention, accordingly, the biomass is removed in proportions of from ≧0% to ≩100%.

Finally, the fermentation broth obtained after the fermentation can be adjusted, before or after the complete or partial removal of the biomass, to an acidic pH with an inorganic acid such as, for example, hydrochloric acid, sulphuric acid or phosphoric acid, or organic acids such as, for example, propionic acid (GB 1,439,728 or EP 1 331 220). It is likewise possible to acidify the fermentation broth with the complete content of biomass. Finally, the broth can also be stabilized by adding sodium bisulphite (NaHSO3, GB 1,439,728) or another salt, for example ammonium, alkali metal or alkaline earth metal salt of sulphurous acid.

During the removal of the biomass, any organic or inorganic solids present in the fermentation broth are partially or completely removed. The organic by-products dissolved in the fermentation broth, and the dissolved unconsumed constituents of the fermentation medium (starting materials), remain at least partly (>0%), preferably to an extent of at least 25%, particularly preferably to an extent of at least 50% and very particularly preferably to an extent of at least 75%, in the product. Where appropriate, they also remain completely (100%) or virtually completely, meaning >95% or >98% or greater than 99%, in the product. If a product in this sense comprises at least part of the constituents of the fermentation broth, this is also described by the term “product based on fermentation broth.”

Subsequently, water is removed from the broth, or it is thickened or concentrated, by known methods such as, for example, using a rotary evaporator, thin-film evaporator, falling-film evaporator, by reverse osmosis or by nanofiltration. This concentrated fermentation broth can then be worked up to free-flowing products, in particular to a fine powder or preferably coarse granules, by methods of freeze drying, spray drying, spray granulation or by other processes as described for example in the circulating fluidized bed according to PCT/EP2004/006655. A desired product is isolated where appropriate from the resulting granules by screening or dust removal. It is likewise possible to dry the fermentation broth directly, i.e., without previous concentration by spray drying or spray granulation. “Free-flowing” means powders which, from of a series of glass orifice vessels with orifices of different sizes, flow unimpeded at least out of the vessel with a 5 mm (millimetre) orifice (Klein: Seifen, Öle, Fette, Wachse 94, 12 (1968)). “Fine” means a powder predominantly (>50%) having a particle size of diameter from 20 to 200 ÎŒm. “Coarse” means a product predominantly (>50%) having a particle size of diameter from 200 to 2000 ÎŒm.

The particle size determination can be carried out by methods of laser diffraction spectrometry. Corresponding methods are described in the textbook on “TeilchengröÎČenmessung in der Laborpraxis” (particle size measurement in laboratory practice) by R. H. MĂŒller and R. Schuhmann, Wissenschaftliche Verlagsgesellschaft Stuttgart (1996) or in the textbook “Introduction to Particle Technology” by M. Rhodes, published by Wiley & Sons (1998).

The free-flowing, fine powder can in turn be converted by suitable compaction or granulation processes into a coarse, very free-flowing, storable and substantially dust-free product. The term “dust-free” means that the product comprises only small proportions (<5%) of particle sizes below 100 ÎŒm in diameter. “Storable” in the sense of this invention means a product which can be stored for at least one (1) year or longer, preferably at least 1.5 years or longer, particularly preferably two (2) years or longer, in a dry and cool environment without any substantial loss (at most 5%) of the respective amino acid occurring.

The invention further relates to a method described in principle in WO 2007/042363 A1. To this end, a method is carried out which uses the fermentation broth obtained according to the invention, from which the biomass has been removed completely or partially, where appropriate, and which method comprises the following steps:

    • a) the pH is reduced to 4.0 to 5.2, in particular 4.9 to 5.1, by adding sulphuric acid and a molar sulphate/L-lysine ratio of from 0.85 to 1.2, preferably 0.9 to 1.0, particularly preferably >0.9 to <0.95, is established in the broth, where appropriate by adding one or more further sulphate-containing compound(s), and
    • b) the mixture obtained in this way is concentrated by removal of water, and granulated where appropriate,
      where one or both of the following measures is/are carried out where appropriate before step a):
    • c) measurement of the molar sulphate/L-lysine ratio to ascertain the required amount of sulphate-containing compound(s)
    • d) addition of a sulphate-containing compound selected from the group of ammonium sulphate, ammonium bisulphate and sulphuric acid in appropriate ratios.

Where appropriate, furthermore, before step b), a salt of sulphurous acid, preferably alkali metal bisulphite, particularly preferably sodium bisulphite, is added in a concentration of from 0.01 to 0.5% by weight, preferably 0.1 to 0.3% by weight, particularly preferably 0.1 to 0.2% by weight, based on the fermentation broth.

Preferred sulphate-containing compounds which should be mentioned in the context of the abovementioned process steps are in particular ammonium sulphate and/or ammonium bisulphate or appropriate mixtures of ammonia and sulphuric acid and sulphuric acid itself.

The molar sulphate/L-lysine ratio V is calculated by the formula: V=2×[SO42−]/[L-lysine]. This formula takes account of the fact that the SO42− anion is doubly charged, or sulphuric acid is dibasic. A ratio of V=1 means that a stoichiometric composition Lys2-(H2SO4) is present, whereas the finding with a ratio of V=0.9 is a 10% sulphate deficit and with a ratio of V=1.1 is a 10% sulphate excess.

It is advantageous to employ during the granulation or compaction the usual organic or inorganic auxiliaries or carriers such as starch, gelatine, cellulose derivatives or similar substances, as normally used in the processing of food products or feeds as binders, gelling agents or thickeners, or further substances such as, for example, silicas, silicates (EP0743016A) or stearates.

It is further advantageous to treat the surface of the resulting granules with oils or fats as described in WO 04/054381. Oils which can be used are mineral oils, vegetable oils or mixtures of vegetable oils. Examples of such oils are soybean oil, olive oil, soybean oil/lecithin mixtures. In the same way, silicone oils, polyethylene glycols or hydroxyethylcellulose are also suitable. Treatment of the surfaces with said oils achieves an increased abrasion resistance of the product and a reduction in the dust content. The oil content in the product is 0.02 to 2.0% by weight, preferably 0.02 to 1.0% by weight, and very particularly preferably 0.2 to 1.0% by weight, based on the total amount of the feed additive.

Preferred products have a proportion of ≧97% by weight with a particle size of from 100 to 1800 ÎŒm, or a proportion of ≧95% by weight with a particle size of 300 to 1800 ÎŒm, in diameter. The proportion of dust, i.e. particles with a particle size <100 ÎŒm, is preferably >0 to 1% by weight, particularly preferably not exceeding 0.5% by weight.

However, alternatively, the product may also be absorbed on an organic or inorganic carrier known and customary in the processing of feeds, such as, for example, silicas, silicates, meals, brans, flours, starches, sugars or others, and/or be mixed and stabilized with customary thickeners or binders. Examples of use and processes therefor are described in the literature (Die MĂŒhle+Mischfuttertechnik 132 (1995) 49, page 817).

Finally, the product can also be brought, by coating processes with film-formers such as, for example, metal carbonates, silicas, silicates, alginates, stearates, starches, gums and cellulose ethers, as described in DE-C-4100920, into a state which is stable to digestion by animal stomachs, especially the stomach of ruminants.

To establish a desired L-lysine concentration in the product, it is possible, depending on requirements, to add the L-lysine during the process in the form of a concentrate or, where appropriate, of a substantially pure substance or its salt in liquid or solid form. These can be added singly or as mixtures to the resulting or concentrated fermentation broth, or else during the drying or granulation process.

The invention further relates to a method for preparing a solid lysine-containing product, which method is described in principle in US 20050220933. This involves carrying out a method which uses the fermentation broth obtained according to the invention and which comprises the following steps:

    • a) filtration of the fermentation broth, preferably with a membrane filter, to result in a biomass-containing slurry and a filtrate;
    • b) concentration of the filtrate, preferably so as to result in a solids content of from 48 to 52% by weight;
    • c) granulation of the concentrate obtained in step b), preferably at a temperature of from 50° C. to 62° C.; and
    • d) coating of the granules obtained in c) with one or more of the coating agent(s).

The concentration of the filtrate in step b) can also be carried out in such a way that a solids content of >52 to ≩55% by weight, of >55 to ≩58% by weight or of >58 to ≩61% by weight is obtained.

The coating agents preferably used for the coating in step d) are selected from the group consisting of:

    • d1) the biomass obtained in step a);
    • d2) an L-lysine-containing compound, preferably selected from the group of L-lysine hydrochloride or L-lysine sulphate;
    • d3) an essentially L-lysine-free substance with an L-lysine content of <1% by weight, preferably <0.5% by weight, preferably selected from the group of starch, carrageenan, agar, silicas, silicates, meals, brans and flours; and
    • d4) a water-repellent substance, preferably selected from the group of oils, polyethylene glycols and liquid paraffins.

The L-lysine content is adjusted to a desired value by the measures corresponding to steps d1) to d4), in particular d1) to d3).

In the production of L-lysine-containing products, the ratio of the ions is preferably adjusted so that the molar ion ratio corresponding to the following formula:


2x[SO42−]+[Cl−]−[NH4+]−[Na+]−[K+]−2x[Mg2+]−2x[Ca2+]/[L-Lys]

gives 0.68 to 0.95, preferably 0.68 to 0.90, particularly preferably 0.68 to 0.86, as described by Kushiki, et al., in US 20030152633.

In the case of L-lysine, the solid product produced in this way has, based on the fermentation broth, a lysine content (as lysine base) of from 10% by weight to 70% by weight or 20% by weight to 70% by weight, preferably 30% by weight to 70% by weight and very particularly preferably from 40% by weight to 70% by weight, based on the dry matter of the product. Maximum lysine base contents of 71% by weight, 72% by weight, 73% by weight are likewise possible.

The water content of the L-lysine-containing solid product is up to 5% by weight, preferably up to 4% by weight, and particularly preferably less than 3% by weight.

The strain DM1729 was deposited with the German collection of microorganisms and cell cultures under accession number DSM17576 on 16 Sep. 2005.

EXAMPLES

Example 1

Identification of a Trehalose Uptake System

For bacteria of the order Actinomycetales, which also includes C. glutamicum, trehalose metabolization has hitherto been described only for bacteria of the Streptomycetaceae family: Streptomyces coelicolor and Streptomyces reticuli utilize trehalose as carbon source. Gene expression analyses indicated an involvement in trehalose uptake of the components of an ABC transport system, encoded by agl3E, agl3F and agl3G, in S. coelicolor and of the ATPase subunit MsiK in S. reticuli. A Blast analysis of the C. glutamicum genomic sequence identified two open reading frames (cg2708 and cg0835) with high homology to S. reticuli msiK (GenBank accession no. CAA70125): the C. glutamicum protein encoded by cg2708 is 59% identical to S. reticuli MsiK (e-value 7e-125), but is the ATP-binding protein MusE of the MusEFGK2 maltose transporter, the deletion of which does not affect trehalose utilization. The second protein, encoded by cg0835, is, at 58%, likewise highly identical to S. reticuli MsiK (e-value 8e-112). Sequence comparisons of S. coelicolor agl3E, agl3F and agl3G (accession no. NP_631226, NP_631225, NP_631224) with the C. glutamicum genomic sequence did not yield any further meaningful hits (e.g. 25% to 32% identity to genes of the ABC uptake system UgpAEBC which catalyses the uptake of glycerol 3-phosphate, and genes of the maltose uptake system Mu5EFGK2).

Comparative sequence analysis therefore yields, as a possible trehalose uptake system in C. glutamicum, the open reading frame cg0835 and the open reading frames cg0834, cg0832 and cg0831 which are located in the immediate vicinity in the genomic sequence and which code for a substrate-binding protein and two permease components of an as yet uncharacterized ABC transporter (see FIG. 1 for arrangement).

Example 2

Construction of Vector pXMJ19_cg0831

The expression construct containing the reading frames cg0832, cg0834, cg0833, cg0832 and cg0831 was prepared by amplifying the corresponding gene region by means of a proof-reading polymerase (PRECISOR High-Fidelity DNA Polymerase, Biocat, Heidelberg, Germany) and ligating it into the pJet cloning vector (Fermentas, St. Leon-Roth, Germany). To this end, the following synthetic oligonucleotides (primers) were used:

primer cg0831for (SEQ ID No: 30):
5â€Č GCTCTAGATGCGTTCTGCTCCTGACCTT 3â€Č
primer cg0831rev (SEQ ID No: 31):
5â€Č CGGGATCCTTTGCGTTGCGATTCGGATT 3â€Č

The primers shown were synthesized by MWG Biotech (Ebersberg, Germany). In each case, the recognition sequence for the restriction enzymes XbaI and BamHI, respectively, is underlined.

The fragment obtained was then excised by the restriction enzymes XbaI and BamHI (New England Biolabs, Schwalbach, Germany) from the pJet vector and ligated into the pXMJ19 expression vector (Jakoby et al., 1999), which had previously been linearized with XbaI and BamHI and then dephosphorylated using Antarctic Phosphatase (New England Biolabs, Schwalbach, Germany). This was followed by transforming competent E. coli DH5αmcr cells with 5 Όl of the ligation mixture. The clones obtained were screened by restriction of the prepared plasmids for those containing the desired insert. The plasmid has been named pXMJ19_cg0831 (see FIG. 2).

Example 3

Preparation of C. glutamicum Strains DM1933/pXMJ19 and DM1933/pXMJ19_cg0831

The plasmids described in Example 2, pXMJ19 and pXMJ19_cg0831, were electroporated into Corynebacterium glutamicum DM1933, using the electroporation method of Liebl, et al. (FEMS Microbiological Letters 53:299-303 (1989)).

The DM1933 strain is an aminoethylcystein-resistant mutant of Corynebacterium glutamicum ATCC13032 and has been described in a publication (Blombach, et al., Appl. and Env. Microbiol. 419-427 (2009)).

Plasmid-harbouring cells were selected by plating the electroporation mixture onto LB agar (Sambrook et al., Molecular cloning: a laboratory manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989) supplemented with 7.5 mg/l chloramphenicol. Plasmid DNA was isolated from in each case one transformant by the usual methods (Peters-Wendisch et al., Microbiology 144:915-927 (1998)) and checked by restriction cleavage with subsequent agarose gel electrophoresis.

The strains obtained were named DM1933/pXMJ19 and DM1933/pXMJ19_cg0831. The pXMJ19_cg0831 construct contains the reading frames cg0832, cg0834, cg0833, cg0832 and cg0831.

Example 4

Production of L-Lysine

The C. glutamicum strains obtained in Example 3, DM1933/pXMJ19 and DM1933/pXMJ19 cg0831, were cultured in a nutrient medium suitable for lysine production, and the lysine content in the culture supernatant was determined.

For this purpose, the strains were first incubated on an agar plate containing the appropriate antibiotic (brain-heart agar with chloramphenicol (7.5 mg/1)) at 33° C. for 24 hours. Starting from this agar plate culture, a preculture was inoculated (10 ml of medium in a 100 ml conical flask). The medium used for the preculture and the main culture was MM medium to which chloramphenicol (7.5 mg/l) was added. Table 4 gives an overview of the composition of the culturing medium used.

TABLE 4
MM medium
CSL (corn steep liquor) 5 g/l
MOPS (morpholinopropanesulfonic acid) 20 g/l
Glucose (autoclaved separately) 50 g/l
Salts:
(NH4)2SO4 25 g/l
KH2PO4 0.1 g/l
MgSO4 * 7 H2O 1.0 g/l
CaCl2 * 2 H2O 10 mg/l
FeSO4 * 7 H2O 10 mg/l
MnSO4 * H2O 5.0 mg/l
Biotin (sterile-filtered) 0.3 mg/l
Thiamine * HCl (sterile-filtered) 0.2 mg/l
CaCO3 25 g/l

CSL, MOPS and the salt solution were adjusted to pH 7 with aqueous ammonia and autoclaved. The sterile substrate and vitamin solutions and the dry-autoclaved CaCO3 were then added.

The preculture was incubated on a shaker at 250 rpm and 33° C. for 24 hours. A main culture was inoculated from this preculture such that the starting OD (660 nm) of the main culture was 0.1 OD.

Culturing was carried out in 10 ml volumes in a 100 ml conical flask with baffles at a temperature of 33° C. and 80% humidity.

After 20 and 40 hours (h) the OD at a measurement wavelength of 660 nm was determined using a Biomek 1000 (Beckmann Instruments GmbH, Munich). The amount of lysine produced was determined by ion exchange chromatography and post-column derivatization with ninhydrin detection, using an amino acid analyzer from Eppendorf-BioTronik (Hamburg, Germany). The trehalose concentration was determined by means of HPLC, using an analyzer from Dionex GmbH (65510 Idstein, Germany). Table 5 depicts the result of the experiment.

TABLE 5
Production of L-lysine and trehalose concentration measurement.
All values are averages of 3 independent experiments with the
strains listed; n.d. = not determined.
L-Lysine OD Trehalose
HCl (g/l) (660 nm) (g/l)
Strain 20 h 40 h 20 h 40 h 20 h 40 h
DM1933/pXMJ19 11.84 13.65 14.04 13.12 n.d. 3.13
DM1933/pXMJ19_cg0831 11.82 14.89 14.62 13.7 n.d. 0

The result indicates that trehalose is no longer produced as a by-product when lysine is produced from trehalose using a trehalose importer-expressing strain. It is furthermore evident that the yield of the desired product (L-lysine) is increased.

Example 5

Construction of vector pK18mobsacB_Pgap_cg0832

A 1701 bp DNA fragment corresponding to the nucleotide sequence (SEQ ID No: 26) for overexpressing the genes cg0831 and cg0832 was prepared by de novo gene synthesis at GENEART AG (Regensburg, Germany).

The positions of nucleotides 613 to 1095 describe a promoter fragment from the application US20080050786 (SEQ ID NO:20), wherein a cleavage site for the NruI restriction enzyme was generated by mutating the nucleobase thymine in position 1079 to the nucleobase guanine, the nucleobase thymine in position 1080 to the nucleobase cytosine and the nucleobase thymine in position 1081 to the nucleobase guanine. In addition, a cleavage site for the Sca restriction enzyme was generated by adding a linker sequence (SEQ ID NO:28) to the 5â€Č end of the promoter sequence and is located in positions 607 to 612. The 489 bp promoter fragment obtained from this was functionally linked to the start codon of the gene cg0832.

The construct has a 600 bp flanking sequence in the downstream region (positions 1096 to 1695) and a 600 bp flanking sequence in the upstream (positions 7 to 606) region of the promoter, for integration of the promoter by means of homologous recombination.

Sequences containing cleavage sites for the restriction enzymes XbaI (positions 1 to 6) and HindIII (positions 1696 to 1701) were added to the flanking regions, thereby enabling the construct to be cloned into the exchange vector pK18mobsacB.

The 1701 bp fragment was digested with the XbaI and HindIII restriction enzymes and then subcloned into the mobilizable vector pK18mobsacB described by Schafer, et al. (Gene 145:69-73 (1994)), in order to enable the promoter to integrate upstream of the gene cg0832. To this end, pK18mobsacB was digested with the XbaI and HindIII restriction enzymes. The vector prepared in this way was mixed with the fragment, and the mixture was treated with the Ready-To-Go T4 DNA ligase kit (Amersham-Pharmacia, Freiburg, Germany).

Subsequently, the E. coli strain S17-1 (Simon, et al., Bio/Technologie 1:784-791, (1993)) was transformed with the ligation mixture (Hanahan, In. DNA cloning. A practical approach. Vol. I. ILR-Press, Cold Spring Harbor, N.Y., 1989). Plasmid-harbouring cells were selected by plating the transformation mixture onto LB agar (Sambrock, et al., Molecular Cloning: a laboratory manual. 2nd Ed. Cold Spring Habor, N.Y., 1989) supplemented with 50 mg/l kanamycin.

Plasmid DNA was isolated from a transformant with the aid of the QIAprep Spin Miniprep kit from Qiagen and checked by restriction cleavage with the XbaI and HindIII enzymes and subsequent agarose gel electrophoresis. The plasmid is referred to as pK18mobsacB_Pgap_cg0832 and is depicted in FIG. 3.

Example 6

Preparation of C. glutamicum Strain DM1933_Pgap_cg0832

The aim was to introduce the mutation Pgap_cg0832 into the strain Corynebacterium glutamicum DM1933. The DM1933 strain is an aminoethylcysteine-resistant mutant of Corynebacterium glutamicum ATCC13032 and has been described in a publication (Blombach et al., Appl. and Env. Microbiol. 419-427 (2009)).

The vector pK18mobsacB_Pgap_cg0832 described in Example 5 was transferred by conjugation according to the protocol of Schafer, et al. (J. Microbiol. 172:1663-1666 (1990)) into the C. glutamicum strain DM1933. Said vector cannot self-replicate in DM1933 and is retained in the cell only if it has integrated into the chromosome as a result of a recombination event. Transconjugants, i.e. clones with integrated pK18mobsacB_Pgap_cg0832, were selected by plating the conjugation mixture onto LB agar supplemented with 25 mg/l kanamycin and 50 mg/l nalidixic acid. Kanamycin-resistant transconjugants were then streaked out on LB-agar plates supplemented with kanamycin (25 mg/1) and incubated at 33° C. for 24 hours. Mutants in which the plasmid had been excised as a result of a second recombination event were selected by culturing the clones non-selectively in liquid LB medium for 30 hours, then streaking them out on LB agar supplemented with 10% sucrose and incubating at 33° C. for 24 hours.

Plasmid pK18mobsacB_Pgap_cg0832, like the starting plasmid pK18mobsacB, contains a copy of the sacB gene coding for Bacillus subtilis levansucrase, in addition to the kanamycin resistance gene. Sucrose-inducible expression of the sacB gene leads to the formation of levansucrase which catalyses the synthesis of the product levan which is toxic to C. glutamicum. Consequently, only those clones in which the integrated pK18mobsacB_Pgap_cg0832 has been excised as a result of a second recombination event grow on sucrose-supplemented LB agar. Depending on the location of the second recombination event in relation to the site of mutation, the mutation is incorporated during excision or the host chromosome remains in the original state.

Subsequently, a clone was identified in which the desired exchange, i.e. incorporation of the Pgap_cg0832 cassette into the chromosome, had occurred. To this end, 50 clones with the phenotype “growth in the presence of sucrose” and “no growth in the presence of kanamycin” were checked for integration of the Pgap_cg0832 cassette using the polymerase chain reaction (PCR). For this, the following synthetic oligonucleotides (primers) were used:

primer cg0832_1.p (SEQ ID NO: 28):
5â€Č GCTGGAATACGGAGTGAACC 3â€Č
primer cg0832_2.p (SEQ ID NO: 29):
5â€Č GGGATTGCCCAAGGGATAAG 3â€Č

The primers shown were synthesized by MWG Biotech (Ebersberg, Germany). The primers cg0832_1.p and cg0832_2.p enable a 570 bp DNA fragment to be amplified in the case of the wild-type arrangement. The size of the amplicon is 1059 bp in the case of integration of the Pgap_cg0832 construct into the chromosome.

The PCR reactions were carried out using the Taq PCR core kit from Quiagen (Hilden, Germany), comprising Therms aquaticus Taq DNA polymerase, in an Eppendorf Mastercycler (Hamburg, Germany). The conditions in the reaction mixture were adjusted according to the manufacturer's instructions. The PCR mixture was first subjected to an initial denaturation at 94° C. for 2 minutes. This was followed by 35 repeats of a denaturing step at 94° C. for 30 seconds, a step of binding the primers to the DNA at 57° C. for 30 seconds, and the extension step for extending the primers at 72° C. for 60 s. After the final extension step at 72° C. for 5 min, the products amplified in this way were checked by electrophoresis in an agarose gel.

In this way mutants were identified which contain the Pgap_cg0832 cassette in an integrated form, with one of the strains obtained being named C. glutamicum DM1933_Pgap_cg0832.

Example 7

Production of L-Lysine

The C. glutamicum strain DM1933 Pgap_cg0832 obtained in Example 6 and the starting strain DM1933 were cultured in a nutrient medium suitable for lysine production, and the lysine content in the culture supernatant was determined.

For this purpose, the strains were first incubated on an agar plate (brain-heart agar) at 33° C. for 24 hours. Starting from this agar plate culture, a preculture was inoculated (10 ml of medium in a 100 ml conical flask). The medium used for the preculture and the main culture was MM medium (see Table 4). CSL, MOPS and the salt solution were adjusted to pH 7 with aqueous ammonia and autoclaved. The sterile substrate and vitamin solutions and the dry-autoclaved CaCO3 were then added.

The preculture was incubated on a shaker at 250 rpm and 33° C. for 24 hours. A main culture was inoculated from this preculture such that the starting OD (660 nm) of the main culture was 0.1 OD. Culturing was carried out in 10 ml volumes in a 100 ml conical flask with baffles at a temperature of 33° C. and 80% humidity.

After 20 and 40 hours (h) the OD at a measurement wavelength of 660 nm was determined using a Biomek 1000 (Beckmann Instruments GmbH, Munich). The amount of lysine produced was determined by ion exchange chromatography and post-column derivatization with ninhydrin detection, using an amino acid analyzer from Eppendorf-BioTronik (Hamburg, Germany). The trehalose concentration was determined by means of HPLC, using an analyzer from Dionex GmbH (65510 Idstein, Germany). Table 6 depicts the result of the experiment.

TABLE 6
Production of L-lysine and trehalose concentration measurement.
All values are averages of 3 independent experiments with the
strains listed; n.d. = not determined.
L-Lysine OD Trehalose
HCl (g/l) (660 nm) (g/l)
Strain 20 h 40 h 20 h 40 h 20 h 40 h
DM1933 12.83 13.65 14.75 12.19 n.d. 3.03
DM1933_Pgap_cg0832 12.91 14.15 15.11 12.34 n.d. 0

The result indicates that trehalose is no longer produced as a by-product when lysine is produced from trehalose using a strain in which only expression of the trehalose importer subunits encoded by cg0832 and cg0831 (in both cases a permease subunit) is enhanced. It is furthermore evident that the yield of the desired product (L-lysine) is increased.

All references cited herein are fully incorporated by reference. Having now fully described the invention, it will be understood by one of skill in the art that the invention may be performed within a wide and equivalent range of conditions, parameters, and the like, without affecting the spirit or scope of the invention or any embodiment thereof

Claims

What is claimed is:

1. An isolated Corynebacterium glutamicum bacterium that has been modified from a starting strain and which produces an L-amino acid during fermentation, wherein:

a) compared to the starting strain, the bacterium comprises increased expression of a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID NO:8 or 20, wherein:

i) said polypeptide comprises a subunit of a protein complex having the activity of a trehalose importer;

ii) said polypeptide has permease activity;

b) said bacterium is capable of taking up trehalose from the medium.

2. The Corynebacterium glutamicum bacterium of claim 1, wherein, compared to the starting strain, said bacterium further comprises increased expression of at least one additional polynucleotide selected from the group consisting of a), b), c), d) and e), wherein said additional polynucleotides are as follows:

a) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID NO:2 or 14;

b) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID NO:4 or 16;

c) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID NO:6 or 18;

d) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID NO:10 or 22; and

e) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID NO:12 or 24.

3. The Corynebacterium glutamicum bacterium of claim 2, wherein, compared to the starting strain, said bacterium further comprises increased expression of at least one additional polynucleotide selected from the group consisting of polynucleotides a), b) and d).

4. The Corynebacterium glutamicum bacterium of claim 2, wherein, compared to the starting strain, said bacterium further comprises increased expression of at least one additional polynucleotide selected from the group consisting of polynucleotides b) and d).

5. The Corynebacterium glutamicum bacterium of claim 2, wherein, compared to the starting strain, said bacterium further comprises increased expression of additional polynucleotide d).

6. The Corynebacterium glutamicum bacterium of claim 2, wherein, compared to the starting strain, said bacterium further comprises, increased expression of all of the the additional polynucleotides a), b) and d).

7. The Corynebacterium glutamicum bacterium of claim 2, wherein, compared to the starting strain, said bacterium further comprises increased expression of all of the additional polynucleotides a), b), c), d) and e).

8. The Corynebacterium glutamicum bacterium of claim 1, wherein the L-amino acid is selected from the group consisting of: a proteinogenic L-amino acid; L-ornithine; and L-homoserine.

9. The Corynebacterium glutamicum bacterium of claim 1, wherein the L-amino acid is selected from the group consisting of: L-methionine; L-valine; L-proline; L-glutamate; and L-isoleucine.

10. The Corynebacterium glutamicum bacterium of claim 1, wherein the L-amino acid is L-lysine.

11. The Corynebacterium glutamicum bacterium of claim 1, wherein expression of said polynucleotide coding for an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID NO:8 or 20 is increased by one or more measures selected from the following group consisting of:

a) using a promoter to express the sequence at least 70% identical to the amino acid sequence of SEQ ID NO:8 or 20, wherein said promoter stronger in said bacterium than in said starting strain;

b) increasing the copy number of said polynucleotide by inserting the polynucleotide into a plasmid with increased copy number in said bacterium and/or by integrating at least one copy of said polynucleotide into the chromosome of said bacterium;

c) expressing the sequence coding for said polypeptide with a ribosome binding site which is stronger in the bacterium than in the starting strain;

d) optimizing the codon usage of said polynucleotide in said bacterium compared to the starting strain;

e) using a sequence that results in a reduction of secondary structures in the mRNA transcribed;

f) using a sequence that results in an elimination of RNA polymerase terminator sequences in transcribed mRNA;

g) using mRNA-stabilizing sequences in the mRNA transcribed from said polynucleotide.

12. A method for the fermentative production of an L-amino acid, comprising the steps:

a) culturing the bacterium of claim 1 in a medium to produce a fermentation broth; and

b) accumulating the L-amino acid in the fermentation broth of a).

13. The method of claim 12, wherein the accumulation of trehalose in the fermentation broth is reduced.

14. The method of claim 12, wherein, compared to said starting strain, the bacterium used for culturing comprises increased expression of at least one additional polynucleotide selected from the group consisting of a), b), c), d) and e), wherein said additional polynucleotides are as follows:

a) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID NO:2 or 14;

b) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID NO:4 or 16;

c) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID NO:6 or 18;

d) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID NO:10 or 22; and

e) a polynucleotide coding for a polypeptide with an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID NO:12 or 24.

15. The method of claim 14, wherein, compared to the starting strain, said bacterium further comprises increased expression of at least one additional polynucleotide selected from the group consisting of polynucleotides a), b) and d).

16. The method of claim 14, wherein, compared to the starting strain, said bacterium further comprises increased expression of at least one additional polynucleotide selected from the group consisting of of polynucleotides b) and d).

17. The method of claim 14, wherein, compared to the starting strain, said bacterium further comprises increased expression of additional polynucleotide d).

18. The method of claim 14, wherein, compared to the starting strain, said bacterium further comprises, increased expression of all of the the additional polynucleotides a), b) and d).

19. The method of claim 14, wherein, compared to the starting strain, said bacterium further comprises, increased expression of all of the the additional polynucleotides a), b), d) and e).

20. The method of claim 14, wherein, compared to the starting strain, said bacterium further comprises, increased expression of all of the additional polynucleotides a), b), c), d) and e).

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: