NUCLEIC ACID PROBE WITH SINGLE FLUOROPHORE LABEL BOUND TO INTERNAL CYTOSINE FOR USE IN LOOP MEDIATED ISOTHERMAL AMPLIFICATION

Description

FIELD OF THE INVENTION

The present invention relates to a probe for the detection of a nucleic acid, a method using said probe and a kit of parts. Preferably the probe of the invention is useful in a method for the detection of nucleic acids derived from Chlamydia trachomatis and/or Neisseria gonorrhoeae and may be used in the diagnosis of Chlamydia and/or Gonorrhoea infections.

REFERENCE TO SEQUENCE LISTING

A Sequence Listing submitted as an ASCII text file via EFS-Web is hereby incorporated by reference in accordance with 35 U.S.C. §1.52(e). The name of the ASCII text file for the Sequence Listing is 23109675_1. TXT, the date of creation of the ASCII text file is Apr. 12, 2016, and the size of the ASCII text file is 17.3 KB.

BACKGROUND OF THE INVENTION

Nucleic acid amplification is one of the most valuable tools in the life sciences field, including application-oriented fields such as clinical medicine, in which diagnosis of infectious diseases, genetic disorders and genetic traits is particularly benefited. In addition to the widely used PCR-based detection (Saiki R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn, G. T., Erlich, H. A. and Arnheim, N. (1985) Science, 230, 1350-1354), several amplification methods have been invented. Examples include nucleic acid sequence-based amplification (NASBA), self-sustained sequence replication (3SR) and loop-mediated isothermal amplification (LAMP). PCR uses heat denaturation of double-stranded DNA products to promote the next round of DNA synthesis. 3SR and NASBA eliminate heat denaturation by using a set of transcription and reverse transcription reactions to amplify the target sequence.

These methods can amplify target nucleic acids to a similar magnitude, all with a detection limit of less than 10 copies and within an hour or so. They require either a precision instrument for amplification or an elaborate method for detection of the amplified products due to poor specificity of target sequence selection. Despite the simplicity and the obtainable magnitude of amplification, the requirement for a high precision thermal cycler in PCR prevents this powerful method from being widely used, such as in private clinics as a routine diagnostic tool. In contrast, LAMP is a method that can amplify a few copies of DNA to over 100 in less than an hour under isothermal conditions and with greater specificity.

As with other molecular-probe based technologies identified above, loop-mediated isothermal amplification (LAMP) assays can be used to detect the presence of specific microorganisms in a sample. However, the detection methods are based on direct visual detection, turbidity or via a non-specific DNA intercalating dye. Direct visual measurement is end point measurement and is unable to provide real time analysis. Turbidity and non-specific intercalating dyes do provide real time analysis of amplification which occurs however this is non-specific i.e. all amplification is detected whether this is true positive amplification or false amplification due to mis-priming, cross specificity.

SUMMARY OF THE INVENTION

In accordance with a first aspect of the present invention there is provided a probe for isothermal nucleic acid amplification comprising an oligonucleotide probe sequence complementary to a region of a target nucleic acid sequence, wherein said oligonucleotide probe sequence has only one fluorophore ligand and which ligand is bound to an internal cytosine base and wherein said oligonucleotide probe sequence does not have a 3′ end terminator.

In a preferred embodiment to oligonucleotide probe sequence is a DNA sequence and the target nucleic acid sequence is a DNA sequence.

Preferably, fluorescence increases to indicate the presence of the target nucleic acid in a sample.

The cytosine base is preferably substantially centrally disposed along the oligonucleotide's length. There are particular benefits associated with labeling the probe internally at a cytosine base. The specificity of the DNA product amplified in an isothermal reaction may be confirmed using a melt curve analysis. However due to a large number of product variants generated in this reaction and a low resolution of melt curve analysis, using intercalating dyes like V13, it is very difficult to distinguish between specific and unspecific DNA products generated under isothermal conditions. Commonly used probes such as TaqMan® probe are not compatible with LAMP technology due to the strand displacement activity of BST polymerase. The probe of the invention is elongated and becomes incorporated into a DNA product during isothermal amplification, which allows for performing a melt curve analysis on the generated product. In the probe of the invention, the fluorophore is conjugated to an internal cytosine complementary to guanine in the antisense strand. Guanine affects the excitation state of many fluorophores resulting in a formation of unique melt curve signatures and allows distinguishing between specific and unspecific products generated under isothermal conditions.

The oligonucleotide does not contain a ddNTP at its 3′ end which enables incorporation of the labelled oligonucleotide into the amplicon. Thus, the 3′ end of the probe is not “blocked”.

The fluorophore may comprise any one or more selected from the following: FAM, JOE, TET, HEX, TAMRA, ROX, ALEXA and ATTO.

The probe may comprise the following sequence:

5′ Xn C*Xm 3′

Where n is >1, m is >3, X is nucleotide base; and * is a fluorophore. Preferably, the nucleotide base is selected from A, T, C and G. Preferably, n is more than 1 to 20 or less, more preferably more than 1 to 10 or less. Preferably, m is more than 3 to 20 or less, more preferably more than 3 to 10 or less. It is contemplated that all combinations of lengths of probe covered by the possible number of nucleotides that n or m make take by the preceding ranges are disclosed.

Preferably, the probe may comprise a sequence selected from any one of the following sequences:

SEQ ID NO. 2:

TAAGATAAC[C-FAM]CCGCACGTG (CT PB1-FAM internal)

SEQ ID NO. 4:

GCGAACATA [C-ALEXA546] CAGCTATGATCAA (GC porA7-

joe loopF)

or

SEQ ID NO. 5:

ATGTTCA [C-JOE] CATGGCGGAG (GC glnA7-ALEXA546

loopB).

The fluorescence is preferably increased when the oligonucleotide is incorporated into the target nucleic acid sequence which results in a change in the configuration of the amplicon-probe complex leading to an alteration of the fluorophore excitation state.

The cytosine bound to the fluorophore ligand is not disposed at or proximate to the 5′ or 3′ end. More preferably it is not disposed in the first 3 bases from either the 5′ or 3′ end. Preferably the cytosine bound to the fluorophore is disposed at the middle base of the probe.

In accordance with a further aspect of the present invention, there is provided an isothermal nucleic acid amplification probe as described hereinabove.

In accordance with a further aspect of the present invention, there is provided a loop-mediated isothermal amplification probe as described above.

Methods and compositions for determining at least one target nucleic acid in a mixture of nucleic acids generally employ a probe, a hybridizing reagent, and one or more phosphate bond-forming enzymes associated with any required nucleotide triphosphates to form a nucleic acid chain.

These methods usually involve amplification, such as including the use of a promoter in conjunction with a RNA polymerase, a restriction site where only one strand is cleaved and is then displaced by extension with a DNA polymerase, or a circular hybridizing reagent, where concatenated repeats are produced. Detection of the amplified nucleic acid may take many forms but preferably via a fluorophore.

In accordance with a further aspect of the present invention, there is provided a method of detecting a target nucleic acid in a sample comprising:

a. amplifying a target nucleic acid in the sample to provide an amplified nucleic acid;
b. probing the amplified nucleic acid with a probe as described hereinabove; and
c. detecting the presence of a single or multiple target nucleic acids.

The target nucleic acid may be that from a micro-organism, fungi, yeast, virus, human, animal, plant etc. The target nucleic acid for LAMP is known to enable LAMP primers and appropriately specific probes to be synthesised. Thus, the presence or absence of said micro-organism, fungi, yeast, virus, human, animal or plant in a sample can be determined. Preferably the target nucleic acid is from Chlamydia trachomatis or Neisseria gonorrhoeae.

Preferably, fluorescence increases to indicate the presence of the target nucleic acid in a sample.

The process is isothermal, and allows for amplification in a single stage or sequential stages in a single vessel, where all of the reagents are compatible.

In a further aspect, the present invention provides a method of diagnosing Chlamydia and/or Gonorrhea in a patient, comprising

• • providing a sample derived from the patient;
  • adding one or more probes of the present invention to the sample; and
  • detecting the presence of a nucleic acid derived from Chlamydia trachomatis and/or Neisseria gonorrhoeae wherein an increase in the fluorescence of the probe indicates the presence of a Chlamydia trachomatis and/or Neisseria gonorrhoeae infection.

The sample may be treated by routine methods to enable the probe to bind with any target nucleotide present in the sample. Such treatment may include centrifuging and lysing the sample to release any target nucleic from the infecting microorganism.

In one embodiment, a single type of probe specific for a nucleic acid from either Chlamydia trachomatis or Neisseria gonorrhoeae is used in the method such that either only Chlamydia trachomatis or only Neisseria gonorrhoeae is detected in the sample.

In a preferred embodiment, at least two different probes are added to the sample wherein a first probe is labelled with a first fluorescent label and is specific for probing Chlamydia trachomatis nucleic acid and a second probe is labelled with a different fluorescent label to the first probe and is specific for probing Neisseria gonorrhoeae nucleic acid. In this embodiment, it is possible to simultaneously detect a Chlamydia and a Gonorrhea infection in a single sample derived from a patient.

In one aspect of the method of the invention, the sample from the patient may be a blood sample, urine sample, serum sample or saliva sample.

In accordance with a further aspect of the present invention there is provided a kit comprising a probe as described hereinabove, LAMP reaction buffer containing a polymerase enzyme, dNTPS and LAMP primers for the target.

In one embodiment a positive and negative control may be included in the kit. The reagents may be presented as wet reagents or in lyophilised form.

The buffer used in the method or kit of the invention comprises dNTPs at a concentration of from 1-10 mM, one or more salts at a concentration of from 2-20 mM, Tris pH8.8 at a concentration of from 10-100 mM, Trehalose at a concentration of from 10-100 mM, BST polymerase at an amount of from 1 U-12 U and 0.01%-1% 1,2 propanediol.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a schematic of DNA probe of the invention.

FIGS. 2A to 2F shows amplification plots generated with the CT PB1 (FIG. 2A and FIG. 2D), GC glnA7 (FIG. 2B and FIG. 2E) and GC porA7 (FIG. 2C and FIG. 2F) primers in V6.21 buffer containing V13 (FIGS. 2A, 2B and 2C) or V6.21p buffer without V13 dye (FIGS. 2D, 2E and 2F).

FIGS. 3A and 3B are melt curve analyses of LAMP products generated with CT PB1 primers in the presence of CT PB1 internal probe conjugated with FAM. 100 pg per reaction of ATTC CT DNA standard was used as a positive control. A—normalized reporter plot, B—derivative reporter plot.

FIGS. 4A and B are melt curve analyses of LAMP product generated with GC glnA7 primers in the presence of GC glnA7 loop probe conjugated with JOE.

FIGS. 5A and 5B are melt curve analyses of LAMP product generated with GC porA7 primers in the presence of GC porA7 loop probe conjugated with ALEXA546. 100 pg per reaction of ATTC GC DNA standard was used as a positive control.

FIGS. 6A to 6D show the results of a test to confirm the DNA product specificity with a probe of the invention in loop mediated isothermal amplification.

FIG. 7 shows amplification plots generated with CT PB1 primers in V6.21 buffer containing V13 or V6.21p buffer without V13 dye but in the presence of CT PB1 terminal probe (complementary to loop region) with an internal C conjugated with FAM and 3′ terminator (3′ddC).

FIGS. 8A and 8B shows the amplification plots generated in V6.21p buffer containing ROX in the presence of CT PB1 primers and CT PB1 terminal probe with an internal cytosine conjugated with FAM (FIG. 8A), and universal primers and 3′UP probe with 3′ terminal cytosine conjugated with FAM (FIG. 8B).

FIGS. 9A to 9C show the amplification plots generated with CT PB1 primers in V6.21p buffer without V13 in the presence of CT PB1 internal probe with an internal C conjugated with FAM and a reference dye (ROX).

FIGS. 10A to 10C show the validation of CT PB1-FAM probe specificity. FIG. 10A shows amplification plots generated with CT PB1-FAM probe in the presence of CT DNA and CT primers.

FIGS. 11A and 11B shows the validation of CT PB1-FAM probe against APTIMA CT assay.

FIGS. 12A and 12B show the amplification plots generated in CT/GC multiplex with CT PB1-FAM+GC porA7-Alexa546 probes.

DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS OF THE INVENTION

Abbreviations

CT—Chlamydia trachomatis
GC—Neisseria gonorrhoeae
GlnA7—Glutamine synthetase
PorA7—porin protein A7
LAMP—loop mediated isothermal amplification
PCR—polymerase chain reaction.

The present invention will now be described, by way of example only, with reference to the following examples and figures.

LAMP Reaction

V13 based detection of the target CT and GT DNA by LAMP was performed using LAMP V6.21 reaction buffer developed by the Applicant. Probe based detection of the target DNA was performed in V6.21p (without V13). The LAMP primer concentrations were as follows: CT PB1-0.8 μM FIP & BIP primer, 0.2 μM F3 & B3 and 0.4 μM Loop primers, GC porA7 and GC glnA7—2 μM FIP & BIP primer, 0.25 μM F3 & B3 and 0.5 μM Loop primers. All probes were used at a final concentration of 0.625 μM. LAMP reactions were run for 60 mins at a constant temperature of 63 C using AB17500 real-time PCR machine. Readouts of the fluorescent signal were obtained in SybrGreen/FAM, Joe or Cy3 channel as appropriate.

Probe Sequences

SEQ ID NO. 1:

GTGCACGC[C-FAM]CCAATAGAAT

SEQ ID NO. 2:

TAAGATAAC[C-FAM]CCGCACGTG (CT PB1-FAM internal)

SEQ ID NO. 3:

TCGAGCAA[C-FAM]CGCTGTGAC[ddC] (CT PB1-FAM

terminal)

SEQ ID NO. 4:

GCGAACATA [C-ALEXA546] CAGCTATGATCAA (GC porA7-

joe loopF)

SEQ ID NO. 5:

ATGTTCA [C-JOE] CATGGCGGAG (GC glnA7-ALEXA546

loopB)

or

SEQ ID NO. 6:

CCA GGG TAT CTA ATC CTG TTT G [C-FAM].

Target Sequences

The target DNA sequences used in the Examples are

SEQ ID No. 7: Chlamydia trachomatis G/SotonG1 plasmid pSotonG1
complete sequence (GenBank: HE603235.1)

1	tttgcaactc ttggtggtag actttgcaac tcttggtggt agactttgca actcttggtg
61	gtagacttgg tcataatgga cttttgttaa aaaatttctt aaaatcttag agctccgatt
121	ttgaatagct ttggttaaga aaatgggctc gatggctttc cataaaagta gattgttctt
181	aacttttggg gacgcgtcgg aaatttggtt atctacttta tctcatctaa ctagaaaaaa
241	ttatgcgtct gggattaact ttcttgtttc tttagagatt ctggatttat cggaaacctt
301	gataaaggct atttctcttg accacagcga atctttgttt aaaatcaagt ctctagatgt
361	ttttaatgga aaagtcgttt cagaggcctc taaacaggct agagcggcat gctacatatc
421	tttcacaaag tttttgtata gattgaccaa gggatatatt aaacccgcta ttccattgaa
481	agattttgga aacactacat tttttaaaat ccgagacaaa atcaaaacag aatcgatttc
541	taagcaggaa tggacagttt tttttgaagc gctccggata gtgaattata gagactattt
601	aatcggtaaa ttgattgtac aagggatccg taagttagac gaaattttgt ctttgcgcac
661	agacgatcta ttttttgcat ccaatcagat ttcctttcgc attaaaaaaa gacagaataa
721	agaaaccaaa attctaatca catttcctat cagcttaatg gaagagttgc aaaaatacac
781	ttgtgggaga aatgggagag tatttgtttc taaaataggg attcctgtaa caacaagtca
841	ggttgcgcat aattttaggc ttgcagagtt ccatagtgct atgaaaataa aaattactcc
901	cagagtactt cgtgcaagcg ctttgattca tttaaagcaa ataggattaa aagatgagga
961	aatcatgcgt atttcctgtc tctcatcgag acaaagtgtg tgttcttatt gttctgggga
1021	agaggtaagt cctctagtac aaacacccac aatattgtga tataattaaa attatattca
1081	tattctgttg ccagaaaaaa cacctttagg ctatattaga gccatcttct ttgaagcgtt
1141	gtcttctcga gaggatttat cgtacgcaaa tatcatcttt gcggttgcgt gtcccgtgac
1201	cttcattatg tcggagtctg agcaccctag gcgtttgtac tccgtcacag cggttgctcg
1261	aagcacgtgc ggggttatct taaaagggat tgcagcttgt agtcctgctt gagagaacgt
1321	gcgggcgatt tgccttaacc ccaccatttt tccggagcga gttacgaaga caaaacctct
1381	tcgttgaccg atgtactctt gtagaaagtg cataaacttc tgaggataag ttataataat
1441	cctcttttct gtctgacggt tcttaagctg ggagaaagaa atggtagctt gttggaaaca
1501	aatctgacta atctccaagc ttaagacttc agaggagcgt ttacctcctt ggagcattgt
1561	ctgggcgatc aaccaatccc gggcgttgat tttttttagc tcttttagga aggatgctgt
1621	ttgcaaactg ttcatcgcat ccgtttttac tatttccctg gttttaaaaa atgttcgact
1681	attttcttgt ttagaaggtt gcgctatagc gactattcct tgagtcatcc tgtttaggaa
1741	tcttgttaag gaaatatagc ttgctgctcg aacttgttta gtaccttcgg tccaagaagt
1801	cttggcagag gaaacttttt taatcgcatc taggattaga ttatgattta aaagggaaaa
1861	ctcttgcaga ttcatatcca aagacaatag accaatcttt tctaaagaca aaaaagatcc
1921	tcgatatgat ctacaagtat gtttgttgag tgatgcggtc caatgcataa taacttcgaa
1981	taaggagaag cttttcatgc gtttccaata ggattcttgg cgaattttta aaacttcctg
2041	ataagacttt tcgctatatt ctaacgacat ttcttgctgc aaagataaaa tccctttacc
2101	catgaaatcc ctcgtgatat aacctatccg caaaatgtcc tgattagtga aataatcagg
2161	ttgttaacag gatagcacgc tcggtatttt tttatataaa catgaaaact cgttccgaaa
2221	tagaaaatcg catgcaagat atcgagtatg cgttgttagg taaagctctg atatttgaag
2281	actctactga gtatattctg aggcagcttg ctaattatga gtttaagtgt tcccatcata
2341	aaaacatatt catagtattt aaatacttaa aagacaatgg attacctata actgtagact
2401	cggcttggga agagcttttg cggcgtcgta tcaaagatat ggacaaatcg tatctcgggt
2461	taatgttgca tgatgcttta tcaaatgaca agcttagatc cgtttctcat acggttttcc
2521	tcgatgattt gagcgtgtgt agcgctgaag aaaatttgag caatttcatt ttccgctcgt
2581	ttaatgagta caatgaaaat ccattgcgta gatctccgtt tctattgctt gagcgtataa
2641	agggaaggct tgatagtgct atagcaaaga ctttttctat tcgcagcgct agaggccggt
2701	ctatttatga tatattctca cagtcagaaa ttggagtgct ggctcgtata aaaaaaagac
2761	gagcagcgtt ctctgagaat caaaattctt tctttgatgg cttcccaaca ggatacaagg
2821	atattgatga taaaggagtt atcttagcta aaggtaattt cgtgattata gcagctaggc
2881	catctatagg gaaaacagct ttagctatag acatggcgat aaatcttgcg gttactcaac
2941	agcgtagagt tggtttccta tctctagaaa tgagcgcagg tcaaattgtt gagcggattg
3001	ttgctaattt aacaggaata tctggtgaaa aattacaaag aggggatctc tctaaagaag
3061	aattattccg agtggaagaa gctggagaaa cagttagaga atcacatttt tatatctgca
3121	gtgatagtca gtataagctt aatttaatcg cgaatcagat ccggttgctg agaaaagaag
3181	atcgagtaga cgtaatattt atcgattact tgcagttgat caactcatcg gttggagaaa
3241	atcgtcaaaa tgaaatagca gatatatcta gaaccttaag aggtttagcc tcagagctaa
3301	acattcctat agtttgttta tcccaactat ctagaaaagt tgaggataga gcaaataaag
3361	ttcccatgct ttcagatttg cgagacagcg gtcaaataga gcaagacgca gatgtgattt
3421	tgtttatcaa taggaaggaa tcgtcttcta attgtgagat aactgttggg aaaaatagac
3481	atggatcggt tttctcttcg gtattacatt tcgatccaaa aattagtaaa ttctccgcta
3541	ttaaaaaagt atggtaaatt atagtaactg ccacttcatc aaaagtccta tccaccttga
3601	aaatcagaag tttggaagaa gacctggtca atctattaag atatctccca aattggctca
3661	aaatgggatg gtagaagtta taggtcttga ttttctttca tctcattacc atgcattagc
3721	agctatccaa agattactga ccgcaacgaa ttacaagggg aacacaaaag gggttgtttt
3781	atccagagaa tcaaatagtt ttcaatttga aggatggata ccaagaatcc gttttacaaa
3841	aactgaattc ttagaggctt atggagttaa gcggtataaa acatccagaa ataagtatga
3901	gtttagtgga aaagaagctg aaactgcttt agaagccttg taccatttag gacatcaacc
3961	gtttttaata gtggcaacta gaactcgatg gactaatgga acacaaatag tagaccgtta
4021	ccaaactctt tctccgatca ttaggattta cgaaggatgg gaaggtttaa ctgacgaaga
4081	aaatatagat atagacttaa caccttttaa ttcaccatct acacggaaac ataaaggatt
4141	cgttgtagag ccatgtccta tcttggtaga tcaaatagaa tcctactttg taatcaagcc
4201	tgcaaatgta taccaagaaa taaaaatgcg tttcccaaac gcatcaaagt atgcttacac
4261	atttatcgac tgggtgatta cagcagctgc gaaaaagaga cgaaaattaa ctaaggataa
4321	ttcttggcca gaaaacttgt tattaaacgt taacgttaaa agtcttgcat atattttaag
4381	gatgaatcgg tacatctgta caaggaactg gaaaaaaatc gagttagcta tcgataaatg
4441	tatagaaatc gccattcagc ttggctggtt atctagaaga aaacgcattg aatttctgga
4501	ttcttctaaa ctctctaaaa aagaaattct atatctaaat aaagagcgct ttgaagaaat
4561	aactaagaaa tctaaagaac aaatggaaca agaatctatt aattaatagc aggcttgaaa
4621	ctaaaaacct aatttattta aagctcaaaa taaaaaagag ttttaaaatg ggaaattctg
4681	gtttttattt gtataacact gaaaactgcg tctttgctga taatatcaaa gttgggcaaa
4741	tgacagagcc gctcaaggac cagcaaataa tccttgggac aaaatcaaca cctgtcgcag
4801	ccaaaatgac agcttctgat ggaatatctt taacagtctc caataattca tcaaccaatg
4861	cttctattac aattggtttg gatgcggaaa aagcttacca gcttattcta gaaaagttgg
4921	gaaatcaaat tcttgatgga attgctgata ctattgttga tagtacagtc caagatattt
4981	tagacaaaat cacaacagac ccttctctag gtttgttgaa agcttttaac aactttccaa
5041	tcactaataa aattcaatgc aacgggttat tcactcccag taacattgaa actttattag
5101	gaggaactga aataggaaaa ttcacagtca cacccaaaag ctctgggagc atgttcttag
5161	tctcagcaga tattattgca tcaagaatgg aaggcggcgt tgttctagct ttggtacgag
5221	aaggtgattc taagccctgc gcgattagtt atggatactc atcaggcgtt cctaatttat
5281	gtagtctaag aaccagcatt actaatacag gattgactcc aacaacgtat tcattacgtg
5341	taggcggttt agaaagcggt gtggtatggg ttaatgccct ttctaatggc aatgatattt
5401	taggaataac aaatacttct aatgtatctt ttttggaagt aatacctcaa acaaacgctt
5461	aaacaatttt tattggattt ttcttatagg ttttatattt agagaaaaca gttcgaatta
5521	cggggtttgt tatgcaaaat aaaagaaaag tgagggacga ttttattaaa attgttaaag
5581	atgtgaaaaa agatttcccc gaattagacc taaaaatacg agtaaacaag gaaaaagtaa
5641	ctttcttaaa ttctccctta gaactctacc ataaaagtgt ctcactaatt ctaggactgc
5701	ttcaacaaat agaaaactct ttaggattat tcccagactc tcctgttctt gaaaaattag
5761	aggataacag tttaaagcta aaaaaggctt tgattatgct tatcttgtct agaaaagaca
5821	tgttttccaa ggctgaatag acaacttact ctaacgttgg agttgatttg cacaccttag
5881	ttttttgctc ttttaaggga ggaactggaa aaacaacact ttctctaaac gtgggatgca
5941	acttggccca atttttaggg aaaaaagtgt tacttgctga cctagacccg caatccaatt
6001	tatcttctgg attgggggct agtgtcagaa ataaccaaaa aggcttgcac gacatagtat
6061	acaaatcaaa cgatttaaaa tcaatcattt gcgaaacaaa aaaagatagt gtggacctaa
6121	ttcctgcatc atttttatcc gaacagttta gagaattgga tattcataga ggacctagta
6181	acaacttaaa gttatttctg aatgagtact gcgctccttt ttatgacatc tgcataatag
6241	acactccacc tagcctagga gggttaacga aagaagcttt tgttgcagga gacaaattaa
6301	ttgcttgttt aactccagaa cctttttcta ttctagggtt acaaaagata cgtgaattct
6361	taagttcggt cggaaaacct gaagaagaac acattcttgg aatagctttg tctttttggg
6421	atgatcgtaa ctcgactaac caaatgtata tagacattat cgagtctatt tacaaaaaca
6481	agcttttttc aacaaaaatt cgtcgagata tttctctcag ccgttctctt cttaaagaag
6541	attctgtagc taatgtctat ccaaattcta gggccgcaga agatattctg aagttaacgc
6601	atgaaatagc aaatattttg catatcgaat atgaacgaga ttactctcag aggacaacgt
6661	gaacaaacta aaaaaagaag cggatgtctt ttttaaaaaa aatcaaactg ccgcttctct
6721	agattttaag aagacacttc cttccattga actattctca gcaactttga attctgagga
6781	aagtcagagt ttggatcgat tatttttatc agagtcccaa aactattcgg atgaagaatt
6841	ttatcaagaa gacatcctag cggtaaaact gcttactggt cagataaaat ccatacagaa
6901	gcaacacgta cttcttttag gagaaaaaat ctataatgct agaaaaatcc tgagtaagga
6961	tcacttctcc tcaacaactt tttcatcttg gatagagtta gtttttagaa ctaagtcttc
7021	tgcttacaat gctcttgcat attacgagct ttttataaac ctccccaacc aaactctaca
7081	aaaagagttt caatcgatcc cctataaatc cgcatatatt ttggccgcta gaaaaggcga
7141	tttaaaaacc aaggtcgatg tgatagggaa agtatgtgga atgtcgaact catcggcgat
7201	aagggtgttg gatcaatttc ttccttcatc tagaaacaaa gacgttagag aaacgataga
7261	taagtctgat ttagagaaga atcgccaatt atctgatttc ttaatagaga tacttcgcat
7321	catatgttcc ggagtttctt tgtcctccta taacgaaaat cttctacaac agctttttga
7381	actttttaag caaaagagct gatcctccgt cagctcatat atatatttat tatatatata
7441	tttatttagg gatttgattt tacgagagag a

SEQ ID No. 8: Neisseria gonorrhoeae partial porA gene for class
1 outer membrane protein, isolate GC3 (GenBank: HE681886.1)

1	gccggcggcg gcgcgacccg ttggggcaat agggaatcct ttgtcggctt ggcaggcgaa
61	ttcggcacgc tgcgcgccgg ccgcgttgcg aatcagtttg acgatgccag ccaagccatt
121	gatccttggg acagcaacaa tgatgtggct tcgcaattgg gtattttcaa acgccacgac
181	gatatgccgg tttccgtacg ctacgactcc ccggactttt ccggtttcag cggcagcgtc
241	caattcgttc cggctcaaaa cagcaagtcc gcctatacgc cggctcattg gactactgtg
301	tataacacta acggtactac tactactttc gttccggctg ttgtcggcaa gcccggatcg
361	gatgtgtatt atgccggtct gaattacaaa aatggcggtt ttgccgggaa ctatgccttt
421	aaatatgcga gacacgccaa tgtcggacgt aatgcttttg agttgttctt gctcggcagt
481	gggagtgatg aagccaaagg taccgatccc ttgaaaaacc atcaggtaca ccgcctgacg
541	ggcggctatg gggaaggcgg cttgaatctc gccttggcgg ctcagttgga tttgtctgaa
601	aatgccgaca aaaccaaaaa cagtacgacc gaaattgccg ccactgcttc ctaccgcttc
661	ggtaatacag tcccgcgcat cagctatgcc catggtttcg actttgtcga acgcagtcag
721	aaacgcgaac ataccagcta tga

SEQ ID No. 9: Neisseria gonorrhoeae glutamine synthetase (glnA)
gene, glnA-14 allele, partial cds (GenBank: AF520262.1)

1	cccgctttgt cgatttgcgc ttcaccgata ccaaaggcaa gcagcaccac tttaccgtgc
61	ctgcgcgcat cgtgttggaa gaccccgaag agtggtttga aaacggaccg gcgtttgacg
121	gctcgtccat cggcggctgg aaaggcattg aggcttccga tatgcagctg cgtcccgatg
181	cgtccacagc cttcgtcgat cctttttatg atgatgttac cgtcgtcatt acctgcgacg
241	tcatcgaccc tgccgacggt cagggttacg accgcgaccc gcgctccatc gcacgccgcg
301	ccgaagccta tttgaaatct tccggtatcg gcgacaccgc ctatttcggc cccgaacccg
361	aattcttcgt cttcgacggc gtagaatttg aaaccgacat gcacaaaacc cgttacgaaa
421	tcacgtccga aagcggcgcg tgggcaagcg gcctgcatat ggacggtcaa aacaccggcc
481	accgccccgc cgtcaaaggc ggctacgcgc ccgtcgcgcc gattgactgc ggtcaagatt
541	tgcgctccgc catggtgaac attttggaag gactcggcat cgaagtcgaa gtccaccaca
601	gcgaagtcgg taccggcagc caaatggaaa tcggcacccg tttcgccact ttggtcaaac
661	gcgccgacca aacccaagat atgaaatacg tcatccaaaa cgttgcccac aatttcggca
721	aaaccgccac ctttatgccc aaaccgatta tgggcgacaa cggcagcggt atgcacgtcc
781	accaatccat ttggaaagac ggtcaaaacc tgttcgcagg cgacggctat gccggtttgt
841	ccgataccgc gctctactac atcggcggca tcatcaaaca cgccaaagcc ctgaacgcga
901	ttaccaatcc gtccaccaac tcctacaaac gcctcgtgcc gcactttgaa gcaccgacca
961	aattggccta ttccgccaaa aaccgttccg cttccatccg tatcccgtct gtgaacagca
1021	gcaaggcgcg ccgcatcgaa gcgcgtttcc ccgacccgac cgccaacccg tatttggcat
1081	ttgccgccct gctgatggcc ggtttggacg gcattcaaaa caaaatccat ccgggcgacc
1141	ctgccgataa aaacctgtac gacctgccgc cggaagaaga cgcgctcgtc ccgaccgtct
1201	gcgcttcttt ggaagaagca cttgccgccc tcaaggtcga ccacgaattc ctgctgcgcg
1261	gcggcgtgtt cagcaaagac tggatcgaca gctacatcgc ctttaaagag gaagatgtcc
1321	gccgcatccg tatggcgccg cacccgctgg aatttg

The primer sequences used in the LAMP reaction are as follows:

CT Plasmid

(SEQ ID No. 10)

	F3	TCTACAAGAGTACATCGGTCA

(SEQ ID No. 11)

	B3	TGAAGCGTTGTCTTCTCG

(SEQ ID No. 12)

	FIP	GCAGCTTGTAGTCCTGCTTGAGTCTTCGTAACTCGCTCC

(SEQ ID No. 13)

	BIP	TCGAGCAACCGCTGTGACCCTTCATTATGTCGGAGTCTG

(SEQ ID No. 14)

	LF1	CGGGCGATTTGCCTTAAC

(SEQ ID No. 15)

LB1

TACAAACGCCTAGGGTGC

GC porA7

(SEQ ID No. 16)

F3	ACCAAAAACAGTACGACCGA

(SEQ ID No. 17)

B3	AAGTGCGCTTGGAAAAATCG

(SEQ ID No. 18)

	FIPATGGGCATAGCTGATGCGCGAATTGCCGCCACTGCTTC

(SEQ ID No. 19)

BIP	TCGACTTTGTCGAACGCAGTCAAATCGACACCGGCGATGA

(SEQ ID No. 20)

LoopF1

GCGAACATACCAGCTATGATCAA

GC glnA7

(SEQ ID No. 21)

	F3	TCATATCTTGGGTTTGGTCG

(SEQ ID No. 22)

	B3	CTGCATATGGACGGTCAAA

(SEQ ID No. 23)

	FiP	CGAAGTCCACCACAGCGAATTTGACCAAAGTGGCGAA

(SEQ ID No. 24)

	BiP	CTTCGATGCCGAGTCCTTCCGATTGACTGCGGTCAAGAT

(SEQ ID No. 25)

	LF	CAAATGGAAATCGGCACCC

(SEQ ID No. 26)

LB

ATGTTCACCATGGCGGAG

Buffer

The Applicant has developed a buffer system for use with the probes of the invention and is designated V6.21 (or V6.21p without V13 dye present) in the following Examples. The concentrations of the buffer components are after buffer reconstitution:

V6.21

4-10 mM dNTP's, 10 mM salt, 30 mM Tris pH8.8, 30 mM Trehalose, 1-8 U Bst polymerase, Dye and 0.05% propanediol.

V6.21p

4-10 mM dNTP's, 10 mM salt, 30 mM Tris pH8.8, 30 mM Trehalose, 1-8 U Bst polymerase, and 0.05% propanediol.

PCR

CT/GC detection in clinical samples by real-time PCR was performed using APTIMA CT/GC multiplex (Gen-Probe) according to the manufacturer's instructions.

Agarose Gel Electrophoresis

DNA electrophoresis was conducted in 1% agarose gel 1×TAE buffer at 100V. LAMP DNA products were vitalized with GelRed (Invitrogen) with transilluminator.

V6.21 and V6.21p buffer were developed by the Applicant. LAMP primers were obtained from Eurofins. Fluorophore-labelled oligonucleotides were purchased from Integrated DNA technologies. Tris buffer, agarose gel and PCR grade water were purchased from Sigma. CT and GC DNA standards were obtained from ATCC.

FIGURES

FIG. 1 is a schematic of DNA probe of the invention. The probe consists of an oligonucleotide with an internal cytosine conjugated with a defined fluorophore. The probe may be complementary to the internal region of the amplicon flanked by Flp and Blp primers or it may be a modified LoopF or LoopB primer internally labeled with a fluorophore.

Example 1

FIGS. 2A to 2F shows amplification plots generated with the CT PB1 (FIG. 2A and FIG. 2D), GC glnA7 (FIG. 2B and FIG. 2E) and GC porA7 (FIG. 2C and FIG. 2F) primers in V6.21 buffer containing V13 (FIGS. 2A, 2B and 2C) or V6.21p buffer without V13 dye (FIGS. 2D, 2E and 2F). The target sequences shown in SEQ ID NOs. 7 to 9 with CT PB1 internal probe conjugated with FAM, GC glnA7 loop probe conjugated with Joe and GC porA7 loop probe conjugated with Alexa546 respectively. All reactions were performed for 60 mins at a constant temperature of 63 C with AB17500 machine.

Example 2

FIGS. 3A and 3B are melt curve analyses of LAMP products generated with CT PB1 primers in the presence of CT PB1 internal probe conjugated with FAM. 100 pg per reaction of ATTC CT DNA standard was used as a positive control. A—normalized reporter plot, B—derivative reporter plot. Melt curve plots were generated based on the readouts in FAM channel with AB17500 machine.

Example 3

FIGS. 4A and B are melt curve analyses of LAMP product generated with GC glnA7 primers in the presence of GC glnA7 loop probe conjugated with JOE. 100 pg per reaction of ATTC GC DNA standard was used as a positive control. FIG. 4A shows a normalized reporter plot and FIG. 4B shows a derivative reporter plot. Melt curve plots were generated based on the readouts in JOE channel with AB17500 machine.

Example 4

FIGS. 5A and 5B are melt curve analyses of LAMP product generated with GC porA7 primers in the presence of GC porA7 loop probe conjugated with ALEXA546. 100 pg per reaction of ATTC GC DNA standard was used as a positive control. FIG. 5A shows a normalized reporter plot, FIG. 4B shows a derivative reporter plot. Melt curve plots were generated based on the readouts in Cy3 channel with AB17500 machine.

Example 5

FIGS. 6A to 6D show the results of a test to confirm the DNA product specificity with a probe of the invention in loop mediated isothermal amplification. The late amplification time of the false positives (more than 30 mins after the lowest target DNA concentration detectable in the LAMP reaction (100 fg GC DNA) indicates that the unspecific amplification may be a result of primer dimer formation. The standard melt curve analysis does not allow to distinguish between the specific and unspecific product in this LAMP reaction, but the unspecific product may be recognized with the probe of the invention. GC DNA was amplified with GC porA7 primers and visualized with V13 dye or GC porA7-ALEXA546 probe as appropriate.

Example 6

FIG. 7 shows the amplification plots generated with CT PB1 primers in V6.21 buffer containing V13 or V6.21p buffer without V13 dye but in the presence of CT PB1 terminal probe (complementary to loop region) with an internal C conjugated with FAM and 3′ terminator (3′ddC). Despite a successful amplification of the target DNA confirmed by excitation of the V13 dye in the control reaction, CT PB1 probe with 3′ terminator did not generate a positive signal.

Example 7

FIGS. 8A and 8B shows the amplification plots generated in V6.21p buffer containing ROX in the presence of CT PB1 primers and CT PB1 terminal probe with an internal cytosine conjugated with FAM (FIG. 8A), and universal primers and 3′UP probe with 3′ terminal cytosine conjugated with FAM (FIG. 8B). The first line represents signals generated by ROX, and the second line corresponds to the signal generated in the FAM channel. Binding of the probe with an internally labeled C to the target DNA results in FAM excitation. Binding of the probe with a 3′ end C labeled to the target does not alter the FAM excitation state.

Example 8

FIGS. 9A to 9C show the amplification plots generated with CT PB1 primers in V6.21p buffer without V13 in the presence of CT PB1 internal probe with an internal C conjugated with FAM and a reference dye (ROX). FIG. 9A show raw data, readouts from the FAM channel in the first line and from the ROX channel in a second line. FIG. 9B shows amplification plots (generated in FAM channel) normalized to ROX. FIG. 9C shows derivative reporter melt curve plots.

Example 9

FIGS. 10A to 10C show the validation of CT PB1-FAM probe specificity. FIG. 10A shows amplification plots generated with CT PB1-FAM probe in the presence of CT DNA and CT primers. As a control, two sets of reactions were performed where unspecific genes, GC glnA7 and GC porA7 were amplified with the corresponding LAMP primers in the presence of CT PB1-FAM probe. In V6.21p buffer the amplification plots in the presence of CT PB1 probe in the FAM channel were generated only when CT DNA was present in the reaction and no signal was generated when unspecific genes (GC glnA7 and GC porA7) were amplified. No signal was also generated when an unspecific probe was used in a reaction where CT DNA was amplified with CT primers. FIG. 10C shows data obtained in an analogous experiment but conducted in V6.21 buffer containing an intercalating dye V31. FIG. 10C shows DNA products generated in the experiment described in FIG. 10A.

Example 10

FIGS. 11A and 11B shows the validation of CT PB1-FAM probe against APTIMA CT assay. Fifty clinical samples confirmed to be positive (n=29) (FIG. 11A) or negative (n=21) (FIG. 11B) for CT were tested in V6.21p buffer with CT PB1-FAM probe. Out of 50 samples 24 tested negative (FIG. 11A) and 26 tested positive (FIG. 11B) for CT with CT PB1-FAM probe. There was 86% agreement between the Aptima and CT PB-FAM tests.

Example 11

FIGS. 12A and 12B show the amplification plots generated in CT/GC multiplex with CT PB1-FAM+GC porA7-Alexa546 probes. CT and GC DNA was amplified in separate reactions or in conjugation in V6.21p buffer in the presence of CT PB1-FAM and GC porA7-Alexa546 probes. The readouts were taken in Cy3 (FIG. 12A) and FAM (FIG. 12B) channels. The experiment revealed that two DNA targets may be amplified and detected in a simultaneous reaction with FAM and Alexa546 labeled probes and that there was no cross reactivity between CT PB1 and GC porA7 primers and probes.

Example 12

Table1 shows a comparison between V13 LAMP for CT and GC, CT/GC Aptima and CT/GC multiplex (CT PB1-FAM+GC porA7-Alexa546). DNA extracted from 136 clinical samples was tested with CT/GC Aptima multiplex, CT PB1 and GC porA7 primers in V6.21 buffer containing V13 or in a multiplex reaction in v6.21p buffer in the presence of CT PB1 and GC porA7 primers and CT PB1-FAM and GC porA7-Alexa546 probes. In a control experiment the samples were also tested in a simplex reaction with GC glnA7-joe probe. The table shows the agreement scores between the tests.

TABLE 1
Comparison between V13-based LAMP for CT and GC, CT/GC
Aptima multiplex and CT/GC MAST multiplex (CT PB1-FAM +
GC porA7-Alexa546). (Test on 136 clinical samples)

Tests compared	Agreement score
CT LAMP vs CT PB1-FAM in multiplex	92%
GC LAMP vs. GC porA7-Alexa546 in multiplex	94%
CT in multiplex vs CT Aptima	83%
GC in multiplex vs GC Aptima	86%