US20170022575A1
2017-01-26
15/287,940
2016-10-07
Various methods and compositions are provided for identifying and/or selecting soybean plants or soybean germplasm with tolerance or improved tolerance to Phytophthora infection. In certain embodiments, the method comprises detecting at least one marker locus that is associated with tolerance to Phytophthora infection. In other embodiments, the method further comprises detecting at least one marker profile or haplotype associated with tolerance to Phytophthora infection. In further embodiments, the method comprises crossing a selected soybean plant with a second soybean plant. Further provided are markers, primers, probes and kits useful for identifying and/or selecting soybean plants or soybean germplasm with tolerance or improved tolerance to Phytophthora infection.
Get notified when new applications in this technology area are published.
C12Q1/6895 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
C12Q2600/13 » CPC further
Oligonucleotides characterized by their use Plant traits
C12Q2600/156 » CPC further
Oligonucleotides characterized by their use Polymorphic or mutational markers
C12Q2600/172 » CPC further
Oligonucleotides characterized by their use Haplotypes
C12Q1/68 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
A01H1/04 » CPC further
Processes for modifying genotypes ; Plants characterised by associated natural traits Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
This application is a Divisional of U.S. application Ser. No. 13/782,013, filed Mar. 1, 2013, which claims the benefit of U.S. Provisional Application No. 61/740,262, filed Dec. 20, 2012, all of which are hereby incorporated herein in its entirety by reference.
This invention relates to methods of identifying and/or selecting soybean plants or germplasm that display tolerance or improved tolerance to Phytophthora infection.
The official copy of the sequence listing is submitted concurrently with the specification as a text file via EFS-Web, in compliance with the American Standard Code for Information Interchange (ASCII), with a file name of 20161006_3170USDIV_SeqLst.txt, a creation date of Oct. 6, 2016 and a size of 785 KB. The sequence listing filed via EFS-Web is part of the specification and is hereby incorporated in its entirety by reference herein.
Soybeans (Glycine max L. Merr.) are a major cash crop and investment commodity in North America and elsewhere. Soybean oil is one of the most widely used edible oils, and soybeans are used worldwide both in animal feed and in human food production. Additionally, soybean utilization is expanding to industrial, manufacturing, and pharmaceutical applications.
Phytophthora is a major soybean fungal pathogen that induces stem and root rot in infected plants, causing severe losses in soybean viability and overall yield. Phytophthora root rot is caused by a pathogenic infection of Phytophthora sojae. Resistance to Phytophthora infection is conditioned by naturally occurring variation at the Resistance to Phytophthora sojae (Rps) loci. As races of Phytophthora in the fields shift, previously effective resistance sources are breaking down, causing damage and compromised yields in grower fields.
There remains a need for soybean plants with tolerance or improved tolerance to Phytophthora infection and methods for identifying and selecting such plants.
Various methods and compositions are provided for identifying and/or selecting soybean plants or soybean germplasm with tolerance or improved tolerance to Phytophthora infection. In certain embodiments, the method comprises detecting at least one marker locus that is associated with tolerance to Phytophthora infection. In other embodiments, the method further comprises detecting at least one marker profile or haplotype associated with tolerance to Phytophthora infection. In further embodiments, the method comprises crossing a selected soybean plant with a second soybean plant. Further provided are markers, primers, probes and kits useful for identifying and/or selecting soybean plants or soybean germplasm with tolerance or improved tolerance to Phytophthora infection.
FIG. 1 A-C provides a genetic map for loci on linkage group (LG) N.
FIG. 2 A-D provides a genetic map for loci on LG F.
FIG. 3 A-C provides a genetic map for loci on LG J.
FIG. 4 A-E provides a genetic map for loci on LG G.
Before describing the present invention in detail, it is to be understood that this invention is not limited to particular embodiments, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
Certain definitions used in the specification and claims are provided below. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given such terms, the following definitions are provided:
As used in this specification and the appended claims, terms in the singular and the singular forms āa,ā āan,ā and āthe,ā for example, include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to āplant,ā āthe plant,ā or āa plantā also includes a plurality of plants; also, depending on the context, use of the term āplantā can also include genetically similar or identical progeny of that plant; use of the term āa nucleic acidā optionally includes, as a practical matter, many copies of that nucleic acid molecule; similarly, the term āprobeā optionally (and typically) encompasses many similar or identical probe molecules.
Additionally, as used herein, ācomprisingā is to be interpreted as specifying the presence of the stated features, integers, steps, or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps, or components, or groups thereof. Thus, for example, a kit comprising one pair of oligonucleotide primers may have two or more pairs of oligonucleotide primers. Additionally, the term ācomprisingā is intended to include examples encompassed by the terms āconsisting essentially ofā and āconsisting of.ā Similarly, the term āconsisting essentially ofā is intended to include examples encompassed by the term āconsisting of.ā
āAgronomics,ā āagronomic traits,ā and āagronomic performanceā refer to the traits (and underlying genetic elements) of a given plant variety that contribute to yield over the course of a growing season. Individual agronomic traits include emergence vigor, vegetative vigor, stress tolerance, disease resistance or tolerance, insect resistance or tolerance, herbicide resistance, branching, flowering, seed set, seed size, seed density, standability, threshability, and the like.
āAlleleā means any of one or more alternative forms of a genetic sequence. In a diploid cell or organism, the two alleles of a given sequence typically occupy corresponding loci on a pair of homologous chromosomes. With regard to a SNP marker, allele refers to the specific nucleotide base present at that SNP locus in that individual plant.
The term āamplifyingā in the context of nucleic acid amplification is any process whereby additional copies of a selected nucleic acid (or a transcribed form thereof) are produced. An āampliconā is an amplified nucleic acid, e.g., a nucleic acid that is produced by amplifying a template nucleic acid by any available amplification method.
An āancestral lineā is a parent line used as a source of genes, e.g., for the development of elite lines.
An āancestral populationā is a group of ancestors that have contributed the bulk of the genetic variation that was used to develop elite lines.
āBackcrossingā is a process in which a breeder crosses a progeny variety back to one of the parental genotypes one or more times.
The term āchromosome segmentā designates a contiguous linear span of genomic DNA that resides in planta on a single chromosome. āChromosome intervalā refers to a chromosome segment defined by specific flanking marker loci.
āCultivarā and āvarietyā are used synonymously and mean a group of plants within a species (e.g., Glycine max) that share certain genetic traits that separate them from other possible varieties within that species. Soybean cultivars are inbred lines produced after several generations of self-pollinations. Individuals within a soybean cultivar are homogeneous, nearly genetically identical, with most loci in the homozygous state.
An āelite lineā is an agronomically superior line that has resulted from many cycles of breeding and selection for superior agronomic performance. Numerous elite lines are available and known to those of skill in the art of soybean breeding.
An āelite populationā is an assortment of elite individuals or lines that can be used to represent the state of the art in terms of agronomically superior genotypes of a given crop species, such as soybean.
An āexotic soybean strainā or an āexotic soybean germplasmā is a strain or germplasm derived from a soybean not belonging to an available elite soybean line or strain of germplasm. In the context of a cross between two soybean plants or strains of germplasm, an exotic germplasm is not closely related by descent to the elite germplasm with which it is crossed. Most commonly, the exotic germplasm is not derived from any known elite line of soybean, but rather is selected to introduce novel genetic elements (typically novel alleles) into a breeding program.
A āgenetic mapā is a description of genetic association or linkage relationships among loci on one or more chromosomes (or linkage groups) within a given species, generally depicted in a diagrammatic or tabular form.
āGenotypeā is a description of the allelic state at one or more loci.
āGermplasmā means the genetic material that comprises the physical foundation of the hereditary qualities of an organism. As used herein, germplasm includes seeds and living tissue from which new plants may be grown; or, another plant part, such as leaf, stem, pollen, or cells, that may be cultured into a whole plant. Germplasm resources provide sources of genetic traits used by plant breeders to improve commercial cultivars.
An individual is āhomozygousā if the individual has only one type of allele at a given locus (e.g., a diploid individual has a copy of the same allele at a locus for each of two homologous chromosomes). An individual is āheterozygousā if more than one allele type is present at a given locus (e.g., a diploid individual with one copy each of two different alleles). The term āhomogeneityā indicates that members of a group have the same genotype at one or more specific loci. In contrast, the term āheterogeneityā is used to indicate that individuals within the group differ in genotype at one or more specific loci.
āIntrogressionā means the entry or introduction of a gene, QTL, haplotype, marker profile, trait, or trait locus from the genome of one plant into the genome of another plant.
The terms ālabelā or ādetectable labelā refer to a molecule capable of detection. A detectable label can also include a combination of a reporter and a quencher, such as are employed in FRET probes or TaqMan⢠probes. The term āreporterā refers to a substance or a portion thereof which is capable of exhibiting a detectable signal, which signal can be suppressed by a quencher. The detectable signal of the reporter is, e.g., fluorescence in the detectable range. The term āquencherā refers to a substance or portion thereof which is capable of suppressing, reducing, inhibiting, etc., the detectable signal produced by the reporter. As used herein, the terms āquenchingā and āfluorescence energy transferā refer to the process whereby, when a reporter and a quencher are in close proximity, and the reporter is excited by an energy source, a substantial portion of the energy of the excited state non-radiatively transfers to the quencher where it either dissipates non-radiatively or is emitted at a different emission wavelength than that of the reporter.
A ālineā or āstrainā is a group of individuals of identical parentage that are generally inbred to some degree and that are generally homozygous and homogeneous at most loci (isogenic or near isogenic). A āsublineā refers to an inbred subset of descendants that are genetically distinct from other similarly inbred subsets descended from the same progenitor. Traditionally, a subline has been derived by inbreeding the seed from an individual soybean plant selected at the F3 to F5 generation until the residual segregating loci are āfixedā or homozygous across most or all loci. Commercial soybean varieties (or lines) are typically produced by aggregating (ābulkingā) the self-pollinated progeny of a single F3 to F5 plant from a controlled cross between 2 genetically different parents. While the variety typically appears uniform, the self-pollinating variety derived from the selected plant eventually (e.g., F8) becomes a mixture of homozygous plants that can vary in genotype at any locus that was heterozygous in the originally selected F3 to F5 plant. Marker-based sublines that differ from each other based on qualitative polymorphism at the DNA level at one or more specific marker loci are derived by genotyping a sample of seed derived from individual self-pollinated progeny derived from a selected F3-F5 plant. The seed sample can be genotyped directly as seed, or as plant tissue grown from such a seed sample. Optionally, seed sharing a common genotype at the specified locus (or loci) are bulked providing a subline that is genetically homogenous at identified loci important for a trait of interest (e.g., yield, tolerance, etc.).
āLinkageā refers to the tendency for alleles to segregate together more often than expected by chance if their transmission was independent. Typically, linkage refers to alleles on the same chromosome. Genetic recombination occurs with an assumed random frequency over the entire genome. Genetic maps are constructed by measuring the frequency of recombination between pairs of traits or markers, the lower the frequency of recombination, and the greater the degree of linkage.
āLinkage disequilibriumā is a non-random association of alleles at two or more loci and can occur between unlinked markers. It is based on allele frequencies within a population and is influenced by but not dependent on linkage.
āLinkage groupā (LG) refers to traits or markers that generally co-segregate. A linkage group generally corresponds to a chromosomal region containing genetic material that encodes the traits or markers.
āLocusā is a defined segment of DNA.
A āmap locationā or āmap positionā is an assigned location on a genetic map relative to linked genetic markers where a specified marker can be found within a given species. Map positions are generally provided in centimorgans (cM), unless otherwise indicated, genetic positions provided are based on the Glycine max consensus map v 4.0 as provided by Hyten et al. (2010) Crop Sci 50:960-968. A āphysical positionā or āphysical locationā or āphysical map locationā is the position, typically in nucleotides bases, of a particular nucleotide, such as a SNP nucleotide, on a chromosome. Unless otherwise indicated, the physical position within the soybean genome provided is based on the Glyma 1.0 genome sequence described in Schmutz et al. (2010) Nature 463:178-183, available from the Phytozome website (phytozome-dot-net/soybean).
āMappingā is the process of defining the association and relationships of loci through the use of genetic markers, populations segregating for the markers, and standard genetic principles of recombination frequency.
āMarkerā or āmolecular markerā or āmarker locusā is a term used to denote a nucleic acid or amino acid sequence that is sufficiently unique to characterize a specific locus on the genome. Any detectable polymorphic trait can be used as a marker so long as it is inherited differentially and exhibits linkage disequilibrium with a phenotypic trait of interest.
āMarker assisted selectionā refers to the process of selecting a desired trait or traits in a plant or plants by detecting one or more nucleic acids from the plant, where the nucleic acid is linked to the desired trait, and then selecting the plant or germplasm possessing those one or more nucleic acids.
āHaplotypeā refers to a combination of particular alleles present within a particular plant's genome at two or more linked marker loci, for instance at two or more loci on a particular linkage group. For instance, in one example, two specific marker loci on LG-N are used to define a haplotype for a particular plant. In still further examples, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more linked marker loci are used to define a haplotype for a particular plant.
As used herein, a āmarker profileā means a combination of particular alleles present within a particular plant's genome at two or more marker loci which are not linked, for instance two or more loci on two or more different linkage groups or two or more chromosomes. For instance, in one example, a particular combination of marker loci or a particular combination of haplotypes define the marker profile of a particular plant.
The term āplantā includes reference to an immature or mature whole plant, including a plant from which seed or grain or anthers have been removed. Seed or embryo that will produce the plant is also considered to be the plant.
āPlant partsā means any portion or piece of a plant, including leaves, stems, buds, roots, root tips, anthers, seed, grain, embryo, pollen, ovules, flowers, cotyledons, hypocotyls, pods, flowers, shoots, stalks, tissues, tissue cultures, cells and the like.
āPolymorphismā means a change or difference between two related nucleic acids. A ānucleotide polymorphismā refers to a nucleotide that is different in one sequence when compared to a related sequence when the two nucleic acids are aligned for maximal correspondence.
āPolynucleotide,ā āpolynucleotide sequence,ā ānucleic acid,ā ānucleic acid molecule,ā ānucleic acid sequence,ā ānucleic acid fragment,ā and āoligonucleotideā are used interchangeably herein to indicate a polymer of nucleotides that is single- or multi-stranded, that optionally contains synthetic, non-natural, or altered RNA or DNA nucleotide bases. A DNA polynucleotide may be comprised of one or more strands of cDNA, genomic DNA, synthetic DNA, or mixtures thereof.
āPrimerā refers to an oligonucleotide which is capable of acting as a point of initiation of nucleic acid synthesis or replication along a complementary strand when placed under conditions in which synthesis of a complementary strand is catalyzed by a polymerase. Typically, primers are about 10 to 30 nucleotides in length, but longer or shorter sequences can be employed. Primers may be provided in double-stranded form, though the single-stranded form is more typically used. A primer can further contain a detectable label, for example a 5ā² end label.
āProbeā refers to an oligonucleotide that is complementary (though not necessarily fully complementary) to a polynucleotide of interest and forms a duplexed structure by hybridization with at least one strand of the polynucleotide of interest. Typically, probes are oligonucleotides from 10 to 50 nucleotides in length, but longer or shorter sequences can be employed. A probe can further contain a detectable label.
āQuantitative trait lociā or āQTLā refer to the genetic elements controlling a quantitative trait.
āRecombination frequencyā is the frequency of a crossing over event (recombination) between two genetic loci. Recombination frequency can be observed by following the segregation of markers and/or traits during meiosis.
āTolerance and āimproved toleranceā are used interchangeably herein and refer to any type of increase in resistance or tolerance to, or any type of decrease in susceptibility. A ātolerant plantā or ātolerant plant varietyā need not possess absolute or complete tolerance. Instead, a ātolerant plant,ā ātolerant plant variety,ā or a plant or plant variety with āimproved toleranceā will have a level of resistance or tolerance which is higher than that of a comparable susceptible plant or variety.
āSelf-crossingā or āself-pollinationā or āselfingā is a process through which a breeder crosses a plant with itself; for example, a second generation hybrid F2 with itself to yield progeny designated F2:3.
āSNPā or āsingle nucleotide polymorphismā means a sequence variation that occurs when a single nucleotide (A, T, C, or G) in the genome sequence is altered or variable. āSNP markersā exist when SNPs are mapped to sites on the soybean genome.
The term āyieldā refers to the productivity per unit area of a particular plant product of commercial value. For example, yield of soybean is commonly measured in bushels of seed per acre or metric tons of seed per hectare per season. Yield is affected by both genetic and environmental factors.
As used herein, an āisolatedā or āpurifiedā polynucleotide or polypeptide, or biologically active portion thereof, is substantially or essentially free from components that normally accompany or interact with the polynucleotide or polypeptide as found in its naturally occurring environment. Typically, an āisolatedā polynucleotide is free of sequences (optimally protein encoding sequences) that naturally flank the polynucleotide (i.e., sequences located at the 5ā² and 3ā² ends of the polynucleotide) in the genomic DNA of the organism from which the polynucleotide is derived. For example, the isolated polynucleotide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide is derived. A polypeptide that is substantially free of cellular material includes preparations of polypeptides having less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of contaminating protein culture media or other chemical components.
Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter āSambrookā).
Methods are provided for identifying and/or selecting a soybean plant or soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection. The method comprises detecting in the soybean plant or germplasm, or a part thereof, at least one marker locus associated with tolerance to Phytophthora infection. Also provided are isolated polynucleotides and kits for use in identifying and/or detecting a soybean plant or soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection, and soybean plants, cells, and/or seeds comprising at least one marker locus conferring improved tolerance to Phytophthora.
Provided herein, marker loci associated with tolerance to Phytophthora infection have been identified and mapped to genomic loci on linkage groups F, G, J and N.
The marker loci provided herein are associated with various Phytophthora multi-race resistance genes. In some embodiments, the marker loci are associated with the Rps1a, Rps1c, Rps1d or Rps1k loci on linkage group N. In another embodiment, the marker loci are associated with the Rps2 locus on linkage group J. In other embodiments, the marker loci are associated with the Rps3a or Rps3c loci on linkage group F. In yet another embodiment, the marker loci are associated with the Rps6 loci on linkage group G.
These findings have important implications for soybean production, as identifying markers that can be used for selection of Phytophthora tolerance will greatly expedite the development of Phytophthora tolerance into elite cultivars.
Marker loci, haplotypes and marker profiles associated with tolerance or improved tolerance to Phytophthora infection, are provided. Further provided are genomic loci that are associated with soybean tolerance or improved tolerance to Phytophthora.
In certain embodiments, soybean plants or germplasm are identified that have at least one favorable allele, marker locus, haplotype or marker profile that positively correlates with tolerance or improved tolerance to Phytophthora infection. However, in other embodiments, it is useful for exclusionary purposes during breeding to identify alleles, marker loci, haplotypes, or marker profiles that negatively correlate with tolerance, for example, to eliminate such plants or germplasm from subsequent rounds of breeding.
In one embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps1a, Rps1c or Rps1d loci on linkage group N. In a specific embodiment, the marker locus comprises one or more of S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N.
In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps1k locus on linkage group N. In a specific embodiment, the marker locus comprises one or more of S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N.
In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps2 locus on linkage group J. In a specific embodiment, the marker locus comprises one or more of S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J.
In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps3a or Rps3c loci on linkage group F. In a specific embodiment, the marker locus comprises one or more of S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F.
In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps6 locus on linkage group G. In a specific embodiment, the marker locus comprises one or more of S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
Non-limiting examples of marker loci located within, linked to, or closely linked to these genomic loci are provided in Tables 1A and 1B and in FIG. 1 A-C, FIG. 2 A-D, FIG. 3 A-C and FIG. 4 A-D.
Table 1: Marker Positions for Marker Loci Associated with Tolerance to Phytophthora.
| TABLE 1A | |||||||||
| Flanking | Physical | ||||||||
| Gene/ | Linkage | Public | Region | Genetic | Position | Physical | Allele | ||
| Marker ID | Locus | Group | Markers* | (CM)* | (cM)* | Region** | Position** | (R/S) | Source |
| S08291-1 | Rps1a | N | satt009 | 22.58 | 3905604 | G/A | |||
| S07292-1 | Rps1c | N | satt641 | 23.17 | 4464524 | T/G | |||
| S08242-1 | Rps1c | N | 23.05 | 4343399 | C/T | Arksoy | |||
| S16592-001 | Rps1d | N | 22.58 | ā3927035-37377161 | 3904033 | A/T | |||
| S07963-2 | Rps1k | N | satt009 | 22.63 | 3951705 | T/C | |||
| S07372-1 | Rps1k | N | satt530 | 24.46 | 5227883 | C/T | |||
| S00009-01 | Rps1k | N | satt009 | 22.61 | 3927056 | C/T | Kingwa | ||
| S08013-1 | Rps1k | N | 23.17 | 4458273 | C/T | ||||
| S06862-1 | Rps2 | J | satt431 | 81-90 | 83.71 | 36085130-37377161 | 36085130 | T/G | CNS, L76- |
| 1988 | |||||||||
| S06863-1 | Rps2 | J | 81-90 | 86.53 | 36085130-37377161 | 36692217 | G/A | CNS, L76- | |
| 1988 | |||||||||
| S06864-1 | Rps2 | J | 81-90 | 88.83 | 36085130-37377161 | 37262813 | T/C | CNS, L76- | |
| 1988 | |||||||||
| S06865-1 | Rps2 | J | 81-90 | 89.27 | 36085130-37377161 | 37377161 | G/A | CNS, L76- | |
| 1988 | |||||||||
| S11652-1 | Rps2 | J | sat_395 | 81-90 | 86.95 | 36085130-37377161 | 36775973 | G/T | CNS, L76- |
| 1988 | |||||||||
| S11682-1 | Rps2 | J | sat_395 | 81-90 | 85.69 | 36085130-37377161 | 36563064 | G/T | CNS, L76- |
| 1988 | |||||||||
| S09018-1 | Rps3a | F | satt334 | 51.85 | 29110641 | C/G | PI171442 | ||
| S08342-1 | Rps3a | F | 51.79 | 29049150 | [T/A]/ | PI171442 | |||
| [T/C]/ | |||||||||
| [C/A] | |||||||||
| S07163-1 | Rps3c | F | satt334 | 51.79 | 29049184 | T/C | PI340046 | ||
| S08442-1 | Rps6 | G | sat_064 | 102.18 | 60745556 | T/C | Archer | ||
| S08341-1 | Rps6 | G | 102.27 | 60777851 | [A/T]/ | Archer | |||
| [G/T] | |||||||||
| TABLE 1B | |||||
| Physical | Allele | ||||
| Marker ID | Locus | LG | Position | [R/S] | Source |
| Gm03:3915646 | Rps1k | N | 3915646 | [A/T] | Kingwa |
| Gm03:3917778 | Rps1k | N | 3917778 | [A/C] | Kingwa |
| Gm03:3918853 | Rps1k | N | 3918853 | [T/C] | Kingwa |
| Gm03:3920367 | Rps1k | N | 3920367 | [A/G] | Kingwa |
| Gm03:3926721 | Rps1k | N | 3926721 | [T/G] | Kingwa |
| Gm03:3926775 | Rps1k | N | 3926775 | [A/G] | Kingwa |
| Gm03:3927474 | Rps1k | N | 3927474 | [T/A] | Kingwa |
| Gm03:3927724 | Rps1k | N | 3927724 | [G/T] | Kingwa |
| Gm03:3929330 | Rps1k | N | 3929330 | [A/G] | Kingwa |
| Gm03:3929383 | Rps1k | N | 3929383 | [A/G] | Kingwa |
| Gm03:3930408 | Rps1k | N | 3930408 | [A/C] | Kingwa |
| Gm03:3930551 | Rps1k | N | 3930551 | [T/C] | Kingwa |
| Gm03:3930806 | Rps1k | N | 3930806 | [T/C] | Kingwa |
| Gm03:3932629 | Rps1k | N | 3932629 | [T/G] | Kingwa |
| Gm03:3932974 | Rps1k | N | 3932974 | [T/C] | Kingwa |
| Gm03:3933370 | Rps1k | N | 3933370 | [A/T] | Kingwa |
| Gm03:3933900 | Rps1k | N | 3933900 | [G/A] | Kingwa |
| Gm03:3933945 | Rps1k | N | 3933945 | [C/T] | Kingwa |
| Gm03:3934403 | Rps1k | N | 3934403 | [G/A] | Kingwa |
| Gm03:3934964 | Rps1k | N | 3934964 | [G/A] | Kingwa |
| Gm03:3935036 | Rps1k | N | 3935036 | [G/A] | Kingwa |
| Gm03:3935832 | Rps1k | N | 3935832 | [G/A] | Kingwa |
| Gm03:3935884 | Rps1k | N | 3935884 | [T/C] | Kingwa |
| Gm03:3939831 | Rps1k | N | 3939831 | [C/G] | Kingwa |
| Gm03:3939836 | Rps1k | N | 3939836 | [G/A] | Kingwa |
| Gm03:3939936 | Rps1k | N | 3939936 | [T/A] | Kingwa |
| Gm03:3939939 | Rps1k | N | 3939939 | [G/T] | Kingwa |
| Gm03:3940174 | Rps1k | N | 3940174 | [T/C] | Kingwa |
| Gm03:3940396 | Rps1k | N | 3940396 | [C/T] | Kingwa |
| Gm03:3940836 | Rps1k | N | 3940836 | [T/C] | Kingwa |
| Gm03:3941262 | Rps1k | N | 3941262 | [A/G] | Kingwa |
| Gm03:3941484 | Rps1k | N | 3941484 | [A/G] | Kingwa |
| Gm03:3941769 | Rps1k | N | 3941769 | [T/G] | Kingwa |
| Gm03:3942973 | Rps1k | N | 3942973 | [C/G] | Kingwa |
| Gm03:3943092 | Rps1k | N | 3943092 | [A/G] | Kingwa |
| Gm03:3944671 | Rps1k | N | 3944671 | [T/C] | Kingwa |
| Gm03:3944738 | Rps1k | N | 3944738 | [C/A] | Kingwa |
| Gm03:3945112 | Rps1k | N | 3945112 | [A/T] | Kingwa |
| Gm03:3945208 | Rps1k | N | 3945208 | [T/C] | Kingwa |
| Gm03:3947836 | Rps1k | N | 3947836 | [T/C] | Kingwa |
| Gm03:3947860 | Rps1k | N | 3947860 | [G/T] | Kingwa |
| Gm03:3949250 | Rps1k | N | 3949250 | [C/T] | Kingwa |
| Gm03:3949680 | Rps1k | N | 3949680 | [A/C] | Kingwa |
| Gm03:3951187 | Rps1k | N | 3951187 | [G/A] | Kingwa |
| Gm03:3951201 | Rps1k | N | 3951201 | [G/A] | Kingwa |
| Gm03:3951485 | Rps1k | N | 3951485 | [C/G] | Kingwa |
| Gm03:3951603 | Rps1k | N | 3951603 | [C/T] | Kingwa |
| Gm03:3951705 | Rps1k | N | 3951705 | [A/G] | Kingwa |
| Gm03:3951715 | Rps1k | N | 3951715 | [G/C] | Kingwa |
| Gm03:3952778 | Rps1k | N | 3952778 | [T/A] | Kingwa |
| Gm03:3952811 | Rps1k | N | 3952811 | [T/A] | Kingwa |
| Gm03:3955716 | Rps1k | N | 3955716 | [T/A] | Kingwa |
| Gm03:3956414 | Rps1k | N | 3956414 | [T/C] | Kingwa |
| Gm03:3958402 | Rps1k | N | 3958402 | [A/G] | Kingwa |
| Gm03:3960626 | Rps1k | N | 3960626 | [T/C] | Kingwa |
| Gm03:3962904 | Rps1k | N | 3962904 | [A/G] | Kingwa |
| Gm03:3967880 | Rps1k | N | 3967880 | [T/G] | Kingwa |
| Gm03:3968334 | Rps1k | N | 3968334 | [G/A] | Kingwa |
| Gm03:3971607 | Rps1k | N | 3971607 | [C/T] | Kingwa |
| Gm03:3971640 | Rps1k | N | 3971640 | [C/A] | Kingwa |
| Gm03:3971692 | Rps1k | N | 3971692 | [T/C] | Kingwa |
| Gm03:3975817 | Rps1k | N | 3975817 | [T/C] | Kingwa |
| Gm03:3975824 | Rps1k | N | 3975824 | [T/A] | Kingwa |
| Gm03:3976645 | Rps1k | N | 3976645 | [T/C] | Kingwa |
| Gm03:3980566 | Rps1k | N | 3980566 | [T/A] | Kingwa |
| Gm03:3981623 | Rps1k | N | 3981623 | [A/G] | Kingwa |
| Gm03:3981822 | Rps1k | N | 3981822 | [A/G] | Kingwa |
| Gm03:3982138 | Rps1k | N | 3982138 | [C/T] | Kingwa |
| Gm03:3982678 | Rps1k | N | 3982678 | [A/C] | Kingwa |
| Gm03:3984554 | Rps1k | N | 3984554 | [C/T] | Kingwa |
| Gm03:3986094 | Rps1k | N | 3986094 | [T/C] | Kingwa |
| Gm03:3987393 | Rps1k | N | 3987393 | [C/T] | Kingwa |
| Gm03:3990954 | Rps1k | N | 3990954 | [T/G] | Kingwa |
| Gm03:3992071 | Rps1k | N | 3992071 | [C/A] | Kingwa |
| Gm03:3995556 | Rps1k | N | 3995556 | [C/T] | Kingwa |
| Gm03:3996269 | Rps1k | N | 3996269 | [C/A] | Kingwa |
| Gm03:3996600 | Rps1k | N | 3996600 | [T/A] | Kingwa |
| Gm03:3997028 | Rps1k | N | 3997028 | [C/T] | Kingwa |
| Gm03:3998157 | Rps1k | N | 3998157 | [G/C] | Kingwa |
| Gm03:3998162 | Rps1k | N | 3998162 | [G/A] | Kingwa |
| Gm03:3998381 | Rps1k | N | 3998381 | [T/C] | Kingwa |
| Gm03:3998421 | Rps1k | N | 3998421 | [T/C] | Kingwa |
| Gm03:3999241 | Rps1k | N | 3999241 | [T/G] | Kingwa |
| Gm03:3999386 | Rps1k | N | 3999386 | [C/A] | Kingwa |
| Gm03:3999666 | Rps1k | N | 3999666 | [A/G] | Kingwa |
| Gm03:4000684 | Rps1k | N | 4000684 | [C/G] | Kingwa |
| Gm03:4001327 | Rps1k | N | 4001327 | [A/G] | Kingwa |
| Gm03:4001783 | Rps1k | N | 4001783 | [A/T] | Kingwa |
| Gm03:4002016 | Rps1k | N | 4002016 | [C/T] | Kingwa |
| Gm03:4005770 | Rps1k | N | 4005770 | [T/C] | Kingwa |
| Gm03:4008187 | Rps1k | N | 4008187 | [G/A] | Kingwa |
| Gm03:4008673 | Rps1k | N | 4008673 | [A/G] | Kingwa |
| Gm03:4008687 | Rps1k | N | 4008687 | [A/G] | Kingwa |
| Gm03:4010191 | Rps1k | N | 4010191 | [C/T] | Kingwa |
| Gm03:4018588 | Rps1k | N | 4018588 | [A/G] | Kingwa |
| Gm03:4019384 | Rps1k | N | 4019384 | [T/C] | Kingwa |
| Gm03:4019896 | Rps1k | N | 4019896 | [A/G] | Kingwa |
| Gm03:4020751 | Rps1k | N | 4020751 | [T/C] | Kingwa |
| Gm03:4021281 | Rps1k | N | 4021281 | [G/A] | Kingwa |
| Gm03:4021291 | Rps1k | N | 4021291 | [A/G] | Kingwa |
| Gm03:4022234 | Rps1k | N | 4022234 | [T/A] | Kingwa |
| Gm03:4022275 | Rps1k | N | 4022275 | [T/C] | Kingwa |
| Gm03:4022530 | Rps1k | N | 4022530 | [A/T] | Kingwa |
| Gm03:4022872 | Rps1k | N | 4022872 | [A/G] | Kingwa |
| Gm03:4022934 | Rps1k | N | 4022934 | [A/G] | Kingwa |
| Gm03:4023283 | Rps1k | N | 4023283 | [T/C] | Kingwa |
| Gm03:4023522 | Rps1k | N | 4023522 | [C/T] | Kingwa |
| Gm03:4024184 | Rps1k | N | 4024184 | [C/A] | Kingwa |
| Gm03:4024294 | Rps1k | N | 4024294 | [T/C] | Kingwa |
| Gm03:4024485 | Rps1k | N | 4024485 | [A/G] | Kingwa |
| Gm03:4024630 | Rps1k | N | 4024630 | [T/C] | Kingwa |
| Gm03:4024844 | Rps1k | N | 4024844 | [T/C] | Kingwa |
| Gm03:4025056 | Rps1k | N | 4025056 | [A/G] | Kingwa |
| Gm03:4026652 | Rps1k | N | 4026652 | [T/A] | Kingwa |
| Gm03:4028481 | Rps1k | N | 4028481 | [G/T] | Kingwa |
| Gm03:4028849 | Rps1k | N | 4028849 | [A/G] | Kingwa |
| Gm03:4028961 | Rps1k | N | 4028961 | [A/G] | Kingwa |
| Gm03:4029068 | Rps1k | N | 4029068 | [A/G] | Kingwa |
| Gm03:4029809 | Rps1k | N | 4029809 | [T/G] | Kingwa |
| Gm03:4031277 | Rps1k | N | 4031277 | [G/T] | Kingwa |
| Gm03:4031983 | Rps1k | N | 4031983 | [C/A] | Kingwa |
| Gm03:4031997 | Rps1k | N | 4031997 | [G/C] | Kingwa |
| Gm03:4032705 | Rps1k | N | 4032705 | [T/C] | Kingwa |
| Gm03:4035600 | Rps1k | N | 4035600 | [T/C] | Kingwa |
| Gm03:4035918 | Rps1k | N | 4035918 | [A/G] | Kingwa |
| Gm03:4036376 | Rps1k | N | 4036376 | [A/C] | Kingwa |
| Gm03:4040874 | Rps1k | N | 4040874 | [A/G] | Kingwa |
| Gm03:4041301 | Rps1k | N | 4041301 | [T/C] | Kingwa |
| Gm03:4041795 | Rps1k | N | 4041795 | [A/G] | Kingwa |
| Gm03:4042572 | Rps1k | N | 4042572 | [G/A] | Kingwa |
| Gm03:4042679 | Rps1k | N | 4042679 | [T/C] | Kingwa |
| Gm03:4042697 | Rps1k | N | 4042697 | [A/G] | Kingwa |
| Gm03:4043007 | Rps1k | N | 4043007 | [A/G] | Kingwa |
| Gm03:4043140 | Rps1k | N | 4043140 | [A/G] | Kingwa |
| Gm03:4043823 | Rps1k | N | 4043823 | [T/G] | Kingwa |
| Gm03:4043978 | Rps1k | N | 4043978 | [C/T] | Kingwa |
| Gm03:4044534 | Rps1k | N | 4044534 | [T/C] | Kingwa |
| Gm03:4044555 | Rps1k | N | 4044555 | [T/C] | Kingwa |
| Gm03:4044972 | Rps1k | N | 4044972 | [A/G] | Kingwa |
| Gm03:4045630 | Rps1k | N | 4045630 | [A/G] | Kingwa |
| Gm03:4046313 | Rps1k | N | 4046313 | [C/A] | Kingwa |
| Gm03:4049555 | Rps1k | N | 4049555 | [T/C] | Kingwa |
| Gm03:4049791 | Rps1k | N | 4049791 | [T/C] | Kingwa |
| Gm03:4049877 | Rps1k | N | 4049877 | [T/C] | Kingwa |
| Gm03:4050197 | Rps1k | N | 4050197 | [A/G] | Kingwa |
| Gm03:4053685 | Rps1k | N | 4053685 | [T/C] | Kingwa |
| Gm03:4053838 | Rps1k | N | 4053838 | [T/C] | Kingwa |
| Gm03:4054927 | Rps1k | N | 4054927 | [T/C] | Kingwa |
| Gm03:4055100 | Rps1k | N | 4055100 | [A/G] | Kingwa |
| Gm03:4055384 | Rps1k | N | 4055384 | [A/G] | Kingwa |
| Gm03:4055427 | Rps1k | N | 4055427 | [T/C] | Kingwa |
| Gm03:4055483 | Rps1k | N | 4055483 | [A/G] | Kingwa |
| Gm03:4062751 | Rps1k | N | 4062751 | [A/C] | Kingwa |
| Gm03:4062885 | Rps1k | N | 4062885 | [A/T] | Kingwa |
| Gm03:4064351 | Rps1k | N | 4064351 | [T/C] | Kingwa |
| Gm03:4064592 | Rps1k | N | 4064592 | [A/G] | Kingwa |
| Gm03:4064759 | Rps1k | N | 4064759 | [T/G] | Kingwa |
| Gm03:4064811 | Rps1k | N | 4064811 | [T/C] | Kingwa |
| Gm03:4064957 | Rps1k | N | 4064957 | [C/T] | Kingwa |
| Gm03:4065083 | Rps1k | N | 4065083 | [T/C] | Kingwa |
| Gm03:4066234 | Rps1k | N | 4066234 | [A/T] | Kingwa |
| Gm03:4066331 | Rps1k | N | 4066331 | [A/T] | Kingwa |
| Gm03:4067099 | Rps1k | N | 4067099 | [A/T] | Kingwa |
| Gm03:4067514 | Rps1k | N | 4067514 | [T/A] | Kingwa |
| Gm03:4069037 | Rps1k | N | 4069037 | [T/G] | Kingwa |
| Gm03:4069603 | Rps1k | N | 4069603 | [T/A] | Kingwa |
| Gm03:4070422 | Rps1k | N | 4070422 | [G/A] | Kingwa |
| Gm03:4072567 | Rps1k | N | 4072567 | [T/C] | Kingwa |
| Gm03:4074190 | Rps1k | N | 4074190 | [T/C] | Kingwa |
| Gm03:4075232 | Rps1k | N | 4075232 | [G/A] | Kingwa |
| Gm03:4076404 | Rps1k | N | 4076404 | [T/A] | Kingwa |
| Gm03:4078299 | Rps1k | N | 4078299 | [T/C] | Kingwa |
| Gm03:4078902 | Rps1k | N | 4078902 | [C/T] | Kingwa |
| Gm03:4080136 | Rps1k | N | 4080136 | [A/T] | Kingwa |
| Gm03:4081056 | Rps1k | N | 4081056 | [T/A] | Kingwa |
| Gm03:4081889 | Rps1k | N | 4081889 | [A/G] | Kingwa |
| Gm03:4082200 | Rps1k | N | 4082200 | [G/A] | Kingwa |
| Gm03:4082590 | Rps1k | N | 4082590 | [C/G] | Kingwa |
| Gm03:4082701 | Rps1k | N | 4082701 | [A/C] | Kingwa |
| Gm03:4082781 | Rps1k | N | 4082781 | [G/C] | Kingwa |
| Gm03:4082871 | Rps1k | N | 4082871 | [A/G] | Kingwa |
| Gm03:4083114 | Rps1k | N | 4083114 | [T/C] | Kingwa |
| Gm03:4084001 | Rps1k | N | 4084001 | [G/T] | Kingwa |
| Gm03:4084095 | Rps1k | N | 4084095 | [A/G] | Kingwa |
| Gm03:4085042 | Rps1k | N | 4085042 | [T/A] | Kingwa |
| Gm03:4085524 | Rps1k | N | 4085524 | [T/G] | Kingwa |
| Gm03:4086286 | Rps1k | N | 4086286 | [A/T] | Kingwa |
| Gm03:4086887 | Rps1k | N | 4086887 | [T/C] | Kingwa |
| Gm03:4087383 | Rps1k | N | 4087383 | [T/C] | Kingwa |
| Gm03:4088310 | Rps1k | N | 4088310 | [T/G] | Kingwa |
| Gm03:4090188 | Rps1k | N | 4090188 | [C/T] | Kingwa |
| Gm03:4092799 | Rps1k | N | 4092799 | [A/C] | Kingwa |
| Gm03:4092928 | Rps1k | N | 4092928 | [T/C] | Kingwa |
| Gm03:4093195 | Rps1k | N | 4093195 | [G/A] | Kingwa |
| Gm03:4093240 | Rps1k | N | 4093240 | [T/C] | Kingwa |
| Gm03:4097291 | Rps1k | N | 4097291 | [T/A] | Kingwa |
| Gm03:4097563 | Rps1k | N | 4097563 | [A/G] | Kingwa |
| Gm03:4097729 | Rps1k | N | 4097729 | [A/G] | Kingwa |
| Gm03:4098328 | Rps1k | N | 4098328 | [A/T] | Kingwa |
| Gm03:4100831 | Rps1k | N | 4100831 | [A/T] | Kingwa |
| Gm03:4101257 | Rps1k | N | 4101257 | [A/T] | Kingwa |
| Gm03:4103342 | Rps1k | N | 4103342 | [C/T] | Kingwa |
| Gm03:4103449 | Rps1k | N | 4103449 | [T/C] | Kingwa |
| Gm03:4103450 | Rps1k | N | 4103450 | [G/C] | Kingwa |
| Gm03:4103515 | Rps1k | N | 4103515 | [T/C] | Kingwa |
| Gm03:4103547 | Rps1k | N | 4103547 | [T/C] | Kingwa |
| Gm03:4103633 | Rps1k | N | 4103633 | [T/C] | Kingwa |
| Gm03:4104502 | Rps1k | N | 4104502 | [T/C] | Kingwa |
| Gm03:4106406 | Rps1k | N | 4106406 | [C/A] | Kingwa |
| Gm03:4109228 | Rps1k | N | 4109228 | [A/C] | Kingwa |
| Gm03:4110012 | Rps1k | N | 4110012 | [C/T] | Kingwa |
| Gm03:4110449 | Rps1k | N | 4110449 | [A/G] | Kingwa |
| Gm03:4110821 | Rps1k | N | 4110821 | [G/A] | Kingwa |
| Gm03:4111538 | Rps1k | N | 4111538 | [T/C] | Kingwa |
| Gm03:4113757 | Rps1k | N | 4113757 | [A/G] | Kingwa |
| Gm03:4116726 | Rps1k | N | 4116726 | [T/A] | Kingwa |
| Gm03:4117330 | Rps1k | N | 4117330 | [T/G] | Kingwa |
| Gm03:4117375 | Rps1k | N | 4117375 | [G/A] | Kingwa |
| Gm03:4117779 | Rps1k | N | 4117779 | [C/G] | Kingwa |
| Gm03:4117890 | Rps1k | N | 4117890 | [C/G] | Kingwa |
| Gm03:4117986 | Rps1k | N | 4117986 | [G/A] | Kingwa |
| Gm03:4120433 | Rps1k | N | 4120433 | [T/C] | Kingwa |
| Gm03:4120705 | Rps1k | N | 4120705 | [G/A] | Kingwa |
| Gm03:4122180 | Rps1k | N | 4122180 | [C/T] | Kingwa |
| Gm03:4129251 | Rps1k | N | 4129251 | [T/C] | Kingwa |
| Gm03:4129479 | Rps1k | N | 4129479 | [T/C] | Kingwa |
| Gm03:4129635 | Rps1k | N | 4129635 | [T/C] | Kingwa |
| Gm03:4130393 | Rps1k | N | 4130393 | [T/C] | Kingwa |
| Gm03:4131257 | Rps1k | N | 4131257 | [T/G] | Kingwa |
| Gm03:4132032 | Rps1k | N | 4132032 | [C/A] | Kingwa |
| Gm03:4132192 | Rps1k | N | 4132192 | [A/G] | Kingwa |
| Gm03:4133520 | Rps1k | N | 4133520 | [C/T] | Kingwa |
| Gm03:4134606 | Rps1k | N | 4134606 | [A/G] | Kingwa |
| Gm03:4134679 | Rps1k | N | 4134679 | [A/G] | Kingwa |
| Gm03:4136487 | Rps1k | N | 4136487 | [T/C] | Kingwa |
| Gm03:4136724 | Rps1k | N | 4136724 | [T/G] | Kingwa |
| Gm03:4136742 | Rps1k | N | 4136742 | [T/C] | Kingwa |
| Gm03:4136791 | Rps1k | N | 4136791 | [A/T] | Kingwa |
| Gm03:4136972 | Rps1k | N | 4136972 | [T/A] | Kingwa |
| Gm03:4137137 | Rps1k | N | 4137137 | [T/G] | Kingwa |
| Gm03:4137521 | Rps1k | N | 4137521 | [C/T] | Kingwa |
| Gm03:4137540 | Rps1k | N | 4137540 | [G/A] | Kingwa |
| Gm03:4137645 | Rps1k | N | 4137645 | [A/G] | Kingwa |
| Gm03:4138435 | Rps1k | N | 4138435 | [T/C] | Kingwa |
| Gm03:4138980 | Rps1k | N | 4138980 | [A/G] | Kingwa |
| Gm03:4139156 | Rps1k | N | 4139156 | [A/G] | Kingwa |
| Gm03:4139395 | Rps1k | N | 4139395 | [C/A] | Kingwa |
| Gm03:4140035 | Rps1k | N | 4140035 | [C/T] | Kingwa |
| Gm03:4140071 | Rps1k | N | 4140071 | [T/G] | Kingwa |
| Gm03:4140976 | Rps1k | N | 4140976 | [A/G] | Kingwa |
| Gm03:4141074 | Rps1k | N | 4141074 | [T/C] | Kingwa |
| Gm03:4141090 | Rps1k | N | 4141090 | [A/T] | Kingwa |
| Gm03:4141251 | Rps1k | N | 4141251 | [T/C] | Kingwa |
| Gm03:4141363 | Rps1k | N | 4141363 | [T/C] | Kingwa |
| Gm03:4141488 | Rps1k | N | 4141488 | [A/G] | Kingwa |
| Gm03:4142353 | Rps1k | N | 4142353 | [A/G] | Kingwa |
| Gm03:4142380 | Rps1k | N | 4142380 | [C/T] | Kingwa |
| Gm03:4142693 | Rps1k | N | 4142693 | [T/C] | Kingwa |
| Gm03:4142800 | Rps1k | N | 4142800 | [T/C] | Kingwa |
| Gm03:4142810 | Rps1k | N | 4142810 | [T/C] | Kingwa |
| Gm03:4143060 | Rps1k | N | 4143060 | [A/C] | Kingwa |
| Gm03:4143112 | Rps1k | N | 4143112 | [A/T] | Kingwa |
| Gm03:4143113 | Rps1k | N | 4143113 | [T/G] | Kingwa |
| Gm03:4144137 | Rps1k | N | 4144137 | [T/C] | Kingwa |
| Gm03:4144350 | Rps1k | N | 4144350 | [T/C] | Kingwa |
| Gm03:4144639 | Rps1k | N | 4144639 | [T/C] | Kingwa |
| Gm03:4145737 | Rps1k | N | 4145737 | [A/G] | Kingwa |
| Gm03:4145959 | Rps1k | N | 4145959 | [C/G] | Kingwa |
| Gm03:4145974 | Rps1k | N | 4145974 | [G/C] | Kingwa |
| Gm03:4146284 | Rps1k | N | 4146284 | [A/G] | Kingwa |
| Gm03:4147289 | Rps1k | N | 4147289 | [C/G] | Kingwa |
| Gm03:4147425 | Rps1k | N | 4147425 | [C/T] | Kingwa |
| Gm03:4148248 | Rps1k | N | 4148248 | [A/G] | Kingwa |
| Gm03:4148643 | Rps1k | N | 4148643 | [C/T] | Kingwa |
| Gm03:4148732 | Rps1k | N | 4148732 | [A/G] | Kingwa |
| Gm03:4149880 | Rps1k | N | 4149880 | [A/G] | Kingwa |
| Gm03:4149919 | Rps1k | N | 4149919 | [A/G] | Kingwa |
| Gm03:4150189 | Rps1k | N | 4150189 | [C/T] | Kingwa |
| Gm03:4150330 | Rps1k | N | 4150330 | [T/C] | Kingwa |
| Gm03:4151366 | Rps1k | N | 4151366 | [A/G] | Kingwa |
| Gm03:4152106 | Rps1k | N | 4152106 | [T/C] | Kingwa |
| Gm03:4153221 | Rps1k | N | 4153221 | [A/T] | Kingwa |
| Gm03:4153413 | Rps1k | N | 4153413 | [A/T] | Kingwa |
| Gm03:4153505 | Rps1k | N | 4153505 | [C/T] | Kingwa |
| Gm03:4153885 | Rps1k | N | 4153885 | [C/T] | Kingwa |
| Gm03:4154059 | Rps1k | N | 4154059 | [A/C] | Kingwa |
| Gm03:4156891 | Rps1k | N | 4156891 | [A/G] | Kingwa |
| Gm03:4158622 | Rps1k | N | 4158622 | [G/T] | Kingwa |
| Gm03:4159661 | Rps1k | N | 4159661 | [C/G] | Kingwa |
| Gm03:4160698 | Rps1k | N | 4160698 | [C/T] | Kingwa |
| Gm03:4162268 | Rps1k | N | 4162268 | [A/G] | Kingwa |
| Gm03:4163423 | Rps1k | N | 4163423 | [G/A] | Kingwa |
| Gm03:4164061 | Rps1k | N | 4164061 | [T/C] | Kingwa |
| Gm03:4164065 | Rps1k | N | 4164065 | [T/C] | Kingwa |
| Gm03:4164142 | Rps1k | N | 4164142 | [A/G] | Kingwa |
| Gm03:4164401 | Rps1k | N | 4164401 | [A/G] | Kingwa |
| Gm03:4164507 | Rps1k | N | 4164507 | [T/C] | Kingwa |
| Gm03:4164719 | Rps1k | N | 4164719 | [A/G] | Kingwa |
| Gm03:4164807 | Rps1k | N | 4164807 | [A/G] | Kingwa |
| Gm03:4166307 | Rps1k | N | 4166307 | [C/A] | Kingwa |
| Gm03:4166432 | Rps1k | N | 4166432 | [G/A] | Kingwa |
| Gm03:4167439 | Rps1k | N | 4167439 | [C/T] | Kingwa |
| Gm03:4167591 | Rps1k | N | 4167591 | [C/T] | Kingwa |
| Gm03:4167701 | Rps1k | N | 4167701 | [A/G] | Kingwa |
| Gm03:4168907 | Rps1k | N | 4168907 | [T/A] | Kingwa |
| Gm03:4169729 | Rps1k | N | 4169729 | [A/G] | Kingwa |
| Gm03:4169784 | Rps1k | N | 4169784 | [A/G] | Kingwa |
| Gm03:4169863 | Rps1k | N | 4169863 | [G/A] | Kingwa |
| Gm03:4169950 | Rps1k | N | 4169950 | [T/C] | Kingwa |
| Gm03:4169995 | Rps1k | N | 4169995 | [G/C] | Kingwa |
| Gm03:4171393 | Rps1k | N | 4171393 | [C/T] | Kingwa |
| Gm03:4171766 | Rps1k | N | 4171766 | [A/T] | Kingwa |
| Gm03:4172171 | Rps1k | N | 4172171 | [A/C] | Kingwa |
| Gm03:4173195 | Rps1k | N | 4173195 | [A/G] | Kingwa |
| Gm03:4173316 | Rps1k | N | 4173316 | [A/G] | Kingwa |
| Gm03:4173405 | Rps1k | N | 4173405 | [T/C] | Kingwa |
| Gm03:4173524 | Rps1k | N | 4173524 | [A/C] | Kingwa |
| Gm03:4175127 | Rps1k | N | 4175127 | [A/G] | Kingwa |
| Gm03:4177056 | Rps1k | N | 4177056 | [A/T] | Kingwa |
| Gm03:4177689 | Rps1k | N | 4177689 | [A/G] | Kingwa |
| Gm03:4177690 | Rps1k | N | 4177690 | [G/A] | Kingwa |
| Gm03:4178958 | Rps1k | N | 4178958 | [A/G] | Kingwa |
| Gm03:4179972 | Rps1k | N | 4179972 | [T/C] | Kingwa |
| Gm03:4180458 | Rps1k | N | 4180458 | [A/G] | Kingwa |
| Gm03:4182337 | Rps1k | N | 4182337 | [G/A] | Kingwa |
| Gm03:4184380 | Rps1k | N | 4184380 | [T/G] | Kingwa |
| Gm03:4184951 | Rps1k | N | 4184951 | [T/G] | Kingwa |
| Gm03:4184971 | Rps1k | N | 4184971 | [T/A] | Kingwa |
| Gm03:4185234 | Rps1k | N | 4185234 | [A/G] | Kingwa |
| Gm03:4185400 | Rps1k | N | 4185400 | [G/A] | Kingwa |
| Gm03:4185863 | Rps1k | N | 4185863 | [T/C] | Kingwa |
| Gm03:4187256 | Rps1k | N | 4187256 | [A/G] | Kingwa |
| Gm03:4188732 | Rps1k | N | 4188732 | [T/C] | Kingwa |
| Gm03:4189845 | Rps1k | N | 4189845 | [C/T] | Kingwa |
| Gm03:4189964 | Rps1k | N | 4189964 | [T/C] | Kingwa |
| Gm03:4190679 | Rps1k | N | 4190679 | [G/C] | Kingwa |
| Gm03:4191313 | Rps1k | N | 4191313 | [A/G] | Kingwa |
| Gm03:4191519 | Rps1k | N | 4191519 | [T/C] | Kingwa |
| Gm03:4192359 | Rps1k | N | 4192359 | [T/C] | Kingwa |
| Gm03:4192478 | Rps1k | N | 4192478 | [A/G] | Kingwa |
| Gm03:4192513 | Rps1k | N | 4192513 | [T/C] | Kingwa |
| Gm03:4192621 | Rps1k | N | 4192621 | [C/T] | Kingwa |
| Gm03:4192738 | Rps1k | N | 4192738 | [G/A] | Kingwa |
| Gm03:4193009 | Rps1k | N | 4193009 | [T/C] | Kingwa |
| Gm03:4193030 | Rps1k | N | 4193030 | [G/T] | Kingwa |
| Gm03:4193039 | Rps1k | N | 4193039 | [G/T] | Kingwa |
| Gm03:4193483 | Rps1k | N | 4193483 | [T/C] | Kingwa |
| Gm03:4196188 | Rps1k | N | 4196188 | [T/C] | Kingwa |
| Gm03:4196542 | Rps1k | N | 4196542 | [T/C] | Kingwa |
| Gm03:4197697 | Rps1k | N | 4197697 | [T/A] | Kingwa |
| Gm03:4197774 | Rps1k | N | 4197774 | [A/T] | Kingwa |
| Gm03:4198285 | Rps1k | N | 4198285 | [A/G] | Kingwa |
| Gm03:4198508 | Rps1k | N | 4198508 | [C/A] | Kingwa |
| Gm03:4198711 | Rps1k | N | 4198711 | [A/C] | Kingwa |
| Gm03:4198914 | Rps1k | N | 4198914 | [A/G] | Kingwa |
| Gm03:4199748 | Rps1k | N | 4199748 | [G/A] | Kingwa |
| Gm03:4200094 | Rps1k | N | 4200094 | [A/C] | Kingwa |
| Gm03:4203253 | Rps1k | N | 4203253 | [G/C] | Kingwa |
| Gm03:4203462 | Rps1k | N | 4203462 | [G/A] | Kingwa |
| Gm03:4203594 | Rps1k | N | 4203594 | [C/T] | Kingwa |
| Gm03:4203626 | Rps1k | N | 4203626 | [C/G] | Kingwa |
| Gm03:4204747 | Rps1k | N | 4204747 | [A/G] | Kingwa |
| Gm03:4204867 | Rps1k | N | 4204867 | [A/G] | Kingwa |
| Gm03:4205828 | Rps1k | N | 4205828 | [C/G] | Kingwa |
| Gm03:4205953 | Rps1k | N | 4205953 | [T/C] | Kingwa |
| Gm03:4206870 | Rps1k | N | 4206870 | [G/A] | Kingwa |
| Gm03:4207703 | Rps1k | N | 4207703 | [G/A] | Kingwa |
| Gm03:4215115 | Rps1k | N | 4215115 | [C/T] | Kingwa |
| Gm03:4215690 | Rps1k | N | 4215690 | [T/G] | Kingwa |
| Gm03:4215950 | Rps1k | N | 4215950 | [A/G] | Kingwa |
| Gm03:4217736 | Rps1k | N | 4217736 | [G/T] | Kingwa |
| Gm03:4218032 | Rps1k | N | 4218032 | [C/A] | Kingwa |
| Gm03:4218527 | Rps1k | N | 4218527 | [C/A] | Kingwa |
| Gm03:4218716 | Rps1k | N | 4218716 | [G/A] | Kingwa |
| Gm03:4218990 | Rps1k | N | 4218990 | [G/T] | Kingwa |
| Gm03:4219539 | Rps1k | N | 4219539 | [A/T] | Kingwa |
| Gm03:4219667 | Rps1k | N | 4219667 | [A/G] | Kingwa |
| Gm03:4221288 | Rps1k | N | 4221288 | [T/C] | Kingwa |
| Gm03:4222312 | Rps1k | N | 4222312 | [A/C] | Kingwa |
| Gm03:4223122 | Rps1k | N | 4223122 | [A/G] | Kingwa |
| Gm03:4223821 | Rps1k | N | 4223821 | [T/C] | Kingwa |
| Gm03:4224501 | Rps1k | N | 4224501 | [T/C] | Kingwa |
| Gm03:4225137 | Rps1k | N | 4225137 | [G/A] | Kingwa |
| Gm03:4225960 | Rps1k | N | 4225960 | [A/C] | Kingwa |
| Gm03:4226471 | Rps1k | N | 4226471 | [T/A] | Kingwa |
| Gm03:4227488 | Rps1k | N | 4227488 | [C/G] | Kingwa |
| Gm03:4228931 | Rps1k | N | 4228931 | [A/G] | Kingwa |
| Gm03:4229006 | Rps1k | N | 4229006 | [C/T] | Kingwa |
| Gm03:4229247 | Rps1k | N | 4229247 | [A/C] | Kingwa |
| Gm03:4230412 | Rps1k | N | 4230412 | [A/G] | Kingwa |
| Gm03:4230665 | Rps1k | N | 4230665 | [A/G] | Kingwa |
| Gm03:4230768 | Rps1k | N | 4230768 | [C/T] | Kingwa |
| Gm03:4231904 | Rps1k | N | 4231904 | [G/A] | Kingwa |
| Gm03:4231979 | Rps1k | N | 4231979 | [G/A] | Kingwa |
| Gm03:4233068 | Rps1k | N | 4233068 | [T/C] | Kingwa |
| Gm03:4233431 | Rps1k | N | 4233431 | [G/C] | Kingwa |
| Gm03:4233493 | Rps1k | N | 4233493 | [G/C] | Kingwa |
| Gm03:4233550 | Rps1k | N | 4233550 | [T/C] | Kingwa |
| Gm03:4234109 | Rps1k | N | 4234109 | [C/T] | Kingwa |
| Gm03:4234194 | Rps1k | N | 4234194 | [A/G] | Kingwa |
| Gm03:4234277 | Rps1k | N | 4234277 | [A/G] | Kingwa |
| Gm03:4234310 | Rps1k | N | 4234310 | [T/A] | Kingwa |
| Gm03:4235089 | Rps1k | N | 4235089 | [G/A] | Kingwa |
| Gm03:4235183 | Rps1k | N | 4235183 | [T/C] | Kingwa |
| Gm03:4235519 | Rps1k | N | 4235519 | [T/C] | Kingwa |
| Gm03:4235634 | Rps1k | N | 4235634 | [A/C] | Kingwa |
| Gm03:4235844 | Rps1k | N | 4235844 | [G/A] | Kingwa |
| Gm03:4236123 | Rps1k | N | 4236123 | [T/C] | Kingwa |
| Gm03:4236298 | Rps1k | N | 4236298 | [C/T] | Kingwa |
| Gm03:4239026 | Rps1k | N | 4239026 | [T/C] | Kingwa |
| Gm03:4242434 | Rps1k | N | 4242434 | [G/T] | Kingwa |
| Gm03:4243529 | Rps1k | N | 4243529 | [C/T] | Kingwa |
| Gm03:4244201 | Rps1k | N | 4244201 | [T/C] | Kingwa |
| Gm03:4244338 | Rps1k | N | 4244338 | [A/C] | Kingwa |
| Gm03:4244497 | Rps1k | N | 4244497 | [T/G] | Kingwa |
| Gm03:4245348 | Rps1k | N | 4245348 | [G/A] | Kingwa |
| Gm03:4245390 | Rps1k | N | 4245390 | [T/C] | Kingwa |
| Gm03:4245678 | Rps1k | N | 4245678 | [A/G] | Kingwa |
| Gm03:4246770 | Rps1k | N | 4246770 | [A/G] | Kingwa |
| Gm03:4246837 | Rps1k | N | 4246837 | [T/G] | Kingwa |
| Gm03:4247592 | Rps1k | N | 4247592 | [A/G] | Kingwa |
| Gm03:4247726 | Rps1k | N | 4247726 | [C/T] | Kingwa |
| Gm03:4252413 | Rps1k | N | 4252413 | [A/T] | Kingwa |
| Gm03:4252569 | Rps1k | N | 4252569 | [G/A] | Kingwa |
| Gm03:4252894 | Rps1k | N | 4252894 | [G/A] | Kingwa |
| Gm03:4252928 | Rps1k | N | 4252928 | [G/A] | Kingwa |
| Gm03:4253518 | Rps1k | N | 4253518 | [T/C] | Kingwa |
| Gm03:4257596 | Rps1k | N | 4257596 | [A/C] | Kingwa |
| Gm03:4257995 | Rps1k | N | 4257995 | [G/C] | Kingwa |
| Gm03:4258161 | Rps1k | N | 4258161 | [T/G] | Kingwa |
| Gm03:4258545 | Rps1k | N | 4258545 | [T/C] | Kingwa |
| Gm03:4260785 | Rps1k | N | 4260785 | [A/G] | Kingwa |
| Gm03:4260901 | Rps1k | N | 4260901 | [C/T] | Kingwa |
| Gm03:4261372 | Rps1k | N | 4261372 | [T/A] | Kingwa |
| Gm03:4261626 | Rps1k | N | 4261626 | [A/T] | Kingwa |
| Gm03:4262516 | Rps1k | N | 4262516 | [C/G] | Kingwa |
| Gm03:4262869 | Rps1k | N | 4262869 | [G/A] | Kingwa |
| Gm03:4263876 | Rps1k | N | 4263876 | [A/G] | Kingwa |
| Gm03:4264709 | Rps1k | N | 4264709 | [C/T] | Kingwa |
| Gm03:4265916 | Rps1k | N | 4265916 | [A/G] | Kingwa |
| Gm03:4266927 | Rps1k | N | 4266927 | [A/G] | Kingwa |
| Gm03:4267296 | Rps1k | N | 4267296 | [A/G] | Kingwa |
| Gm03:4268640 | Rps1k | N | 4268640 | [C/G] | Kingwa |
| Gm03:4268852 | Rps1k | N | 4268852 | [G/A] | Kingwa |
| Gm03:4295832 | Rps1k | N | 4295832 | [A/G] | Kingwa |
| Gm03:4302907 | Rps1k | N | 4302907 | [G/C] | Kingwa |
| Gm03:4302936 | Rps1k | N | 4302936 | [A/T] | Kingwa |
| Gm03:4306709 | Rps1k | N | 4306709 | [T/C] | Kingwa |
| Gm03:4307835 | Rps1k | N | 4307835 | [C/A] | Kingwa |
| Gm03:4307996 | Rps1k | N | 4307996 | [G/A] | Kingwa |
| Gm03:4308161 | Rps1k | N | 4308161 | [T/A] | Kingwa |
| Gm03:4308286 | Rps1k | N | 4308286 | [C/T] | Kingwa |
| Gm03:4308323 | Rps1k | N | 4308323 | [G/T] | Kingwa |
| Gm03:4308522 | Rps1k | N | 4308522 | [T/A] | Kingwa |
| Gm03:4313900 | Rps1k | N | 4313900 | [C/T] | Kingwa |
| Gm03:4314212 | Rps1k | N | 4314212 | [G/T] | Kingwa |
| Gm03:4314464 | Rps1k | N | 4314464 | [G/C] | Kingwa |
| Gm03:4315256 | Rps1k | N | 4315256 | [A/G] | Kingwa |
| Gm03:4317574 | Rps1k | N | 4317574 | [G/C] | Kingwa |
| Gm03:4318530 | Rps1k | N | 4318530 | [A/G] | Kingwa |
| Gm03:4319271 | Rps1k | N | 4319271 | [C/G] | Kingwa |
| Gm03:4320841 | Rps1k | N | 4320841 | [A/G] | Kingwa |
| Gm03:4321243 | Rps1k | N | 4321243 | [C/T] | Kingwa |
| Gm03:4321515 | Rps1k | N | 4321515 | [T/G] | Kingwa |
| Gm03:4328502 | Rps1k | N | 4328502 | [G/T] | Kingwa |
| Gm03:4329219 | Rps1k | N | 4329219 | [C/G] | Kingwa |
| Gm03:4329504 | Rps1k | N | 4329504 | [T/C] | Kingwa |
| Gm03:4330121 | Rps1k | N | 4330121 | [A/G] | Kingwa |
| Gm03:4330318 | Rps1k | N | 4330318 | [T/C] | Kingwa |
| Gm03:4331246 | Rps1k | N | 4331246 | [A/G] | Kingwa |
| Gm03:4331889 | Rps1k | N | 4331889 | [A/G] | Kingwa |
| Gm03:4337173 | Rps1k | N | 4337173 | [G/A] | Kingwa |
| Gm03:4338377 | Rps1k | N | 4338377 | [G/C] | Kingwa |
| Gm03:4338505 | Rps1k | N | 4338505 | [A/G] | Kingwa |
| Gm03:4338559 | Rps1k | N | 4338559 | [T/A] | Kingwa |
| Gm03:4339885 | Rps1k | N | 4339885 | [T/A] | Kingwa |
| Gm03:4341064 | Rps1k | N | 4341064 | [A/G] | Kingwa |
| Gm03:4342692 | Rps1k | N | 4342692 | [T/C] | Kingwa |
| Gm03:4342727 | Rps1k | N | 4342727 | [A/T] | Kingwa |
| Gm03:4343201 | Rps1k | N | 4343201 | [A/G] | Kingwa |
| Gm03:4343212 | Rps1k | N | 4343212 | [T/C] | Kingwa |
| Gm03:4348211 | Rps1k | N | 4348211 | [T/C] | Kingwa |
| Gm03:4350556 | Rps1k | N | 4350556 | [A/T] | Kingwa |
| Gm03:4350658 | Rps1k | N | 4350658 | [A/G] | Kingwa |
| Gm03:4350767 | Rps1k | N | 4350767 | [G/A] | Kingwa |
| Gm03:4351326 | Rps1k | N | 4351326 | [T/G] | Kingwa |
| Gm03:4351612 | Rps1k | N | 4351612 | [T/G] | Kingwa |
| Gm03:4351617 | Rps1k | N | 4351617 | [T/G] | Kingwa |
| Gm03:4351674 | Rps1k | N | 4351674 | [A/C] | Kingwa |
| Gm03:4352353 | Rps1k | N | 4352353 | [T/G] | Kingwa |
| Gm03:4353932 | Rps1k | N | 4353932 | [T/C] | Kingwa |
| Gm03:4354036 | Rps1k | N | 4354036 | [C/G] | Kingwa |
| Gm03:4355046 | Rps1k | N | 4355046 | [C/G] | Kingwa |
| Gm03:4362911 | Rps1k | N | 4362911 | [A/G] | Kingwa |
| Gm03:4363385 | Rps1k | N | 4363385 | [A/T] | Kingwa |
| Gm03:4363855 | Rps1k | N | 4363855 | [T/C] | Kingwa |
| Gm03:4364133 | Rps1k | N | 4364133 | [A/G] | Kingwa |
| Gm03:4364176 | Rps1k | N | 4364176 | [G/T] | Kingwa |
| Gm03:4364200 | Rps1k | N | 4364200 | [A/C] | Kingwa |
| Gm03:4364469 | Rps1k | N | 4364469 | [A/G] | Kingwa |
| Gm03:4385480 | Rps1k | N | 4385480 | [G/A] | Kingwa |
| Gm03:4385781 | Rps1k | N | 4385781 | [A/G] | Kingwa |
| Gm03:4386327 | Rps1k | N | 4386327 | [A/G] | Kingwa |
| Gm03:4386398 | Rps1k | N | 4386398 | [G/C] | Kingwa |
| Gm03:4386633 | Rps1k | N | 4386633 | [G/A] | Kingwa |
| Gm03:4386927 | Rps1k | N | 4386927 | [C/T] | Kingwa |
| Gm03:4387264 | Rps1k | N | 4387264 | [T/C] | Kingwa |
| Gm03:4388736 | Rps1k | N | 4388736 | [A/T] | Kingwa |
| Gm03:4388954 | Rps1k | N | 4388954 | [T/C] | Kingwa |
| Gm03:4388982 | Rps1k | N | 4388982 | [A/G] | Kingwa |
| Gm03:4389208 | Rps1k | N | 4389208 | [T/C] | Kingwa |
| Gm03:4389211 | Rps1k | N | 4389211 | [A/G] | Kingwa |
| Gm03:4389280 | Rps1k | N | 4389280 | [A/C] | Kingwa |
| Gm03:4389696 | Rps1k | N | 4389696 | [T/A] | Kingwa |
| Gm03:4390074 | Rps1k | N | 4390074 | [G/A] | Kingwa |
| Gm03:4390738 | Rps1k | N | 4390738 | [A/T] | Kingwa |
| Gm03:4390827 | Rps1k | N | 4390827 | [C/T] | Kingwa |
| Gm03:4390979 | Rps1k | N | 4390979 | [C/A] | Kingwa |
| Gm03:4392217 | Rps1k | N | 4392217 | [A/T] | Kingwa |
| Gm03:4392314 | Rps1k | N | 4392314 | [C/G] | Kingwa |
| Gm03:4392891 | Rps1k | N | 4392891 | [G/A] | Kingwa |
| Gm03:4392913 | Rps1k | N | 4392913 | [G/T] | Kingwa |
| Gm03:4394477 | Rps1k | N | 4394477 | [C/G] | Kingwa |
| Gm03:4394831 | Rps1k | N | 4394831 | [A/G] | Kingwa |
| Gm03:4395386 | Rps1k | N | 4395386 | [T/C] | Kingwa |
| Gm03:4395962 | Rps1k | N | 4395962 | [A/C] | Kingwa |
| Gm03:4397872 | Rps1k | N | 4397872 | [A/G] | Kingwa |
| Gm03:4398299 | Rps1k | N | 4398299 | [A/T] | Kingwa |
| Gm03:4398919 | Rps1k | N | 4398919 | [T/C] | Kingwa |
| Gm03:4399399 | Rps1k | N | 4399399 | [G/A] | Kingwa |
| Gm03:4400461 | Rps1k | N | 4400461 | [C/G] | Kingwa |
| Gm03:4404444 | Rps1k | N | 4404444 | [C/T] | Kingwa |
| Gm03:4410393 | Rps1k | N | 4410393 | [A/G] | Kingwa |
| Gm03:4410565 | Rps1k | N | 4410565 | [T/C] | Kingwa |
| Gm03:4411187 | Rps1k | N | 4411187 | [T/C] | Kingwa |
| Gm03:4412149 | Rps1k | N | 4412149 | [A/T] | Kingwa |
| Gm03:4412417 | Rps1k | N | 4412417 | [A/G] | Kingwa |
| Gm03:4412774 | Rps1k | N | 4412774 | [A/G] | Kingwa |
| Gm03:4413415 | Rps1k | N | 4413415 | [C/T] | Kingwa |
| Gm03:4446891 | Rps1k | N | 4446891 | [T/C] | Kingwa |
| Gm03:4447988 | Rps1k | N | 4447988 | [A/C] | Kingwa |
| Gm03:4448825 | Rps1k | N | 4448825 | [C/A] | Kingwa |
| Gm03:4449634 | Rps1k | N | 4449634 | [T/A] | Kingwa |
| Gm03:4449956 | Rps1k | N | 4449956 | [T/G] | Kingwa |
| Gm03:4450328 | Rps1k | N | 4450328 | [C/T] | Kingwa |
| Gm03:4450331 | Rps1k | N | 4450331 | [G/A] | Kingwa |
| Gm03:4450888 | Rps1k | N | 4450888 | [T/A] | Kingwa |
| Gm03:4451295 | Rps1k | N | 4451295 | [A/T] | Kingwa |
| Gm03:4451491 | Rps1k | N | 4451491 | [A/C] | Kingwa |
| Gm03:4451503 | Rps1k | N | 4451503 | [T/G] | Kingwa |
| Gm03:4451847 | Rps1k | N | 4451847 | [T/A] | Kingwa |
| Gm03:4452060 | Rps1k | N | 4452060 | [A/G] | Kingwa |
| Gm03:4452118 | Rps1k | N | 4452118 | [A/G] | Kingwa |
| Gm03:4452820 | Rps1k | N | 4452820 | [T/A] | Kingwa |
| Gm03:4456305 | Rps1k | N | 4456305 | [T/C] | Kingwa |
| Gm03:4458273 | Rps1k | N | 4458273 | [G/A] | Kingwa |
| Gm03:4458399 | Rps1k | N | 4458399 | [A/T] | Kingwa |
| Gm03:4461465 | Rps1k | N | 4461465 | [T/A] | Kingwa |
| Gm03:4462225 | Rps1k | N | 4462225 | [A/C] | Kingwa |
| Gm03:4471412 | Rps1k | N | 4471412 | [T/C] | Kingwa |
| Gm03:4474352 | Rps1k | N | 4474352 | [A/G] | Kingwa |
| Gm03:4477946 | Rps1k | N | 4477946 | [A/G] | Kingwa |
| Gm03:4477947 | Rps1k | N | 4477947 | [C/G] | Kingwa |
| Gm03:4478247 | Rps1k | N | 4478247 | [C/T] | Kingwa |
| Gm03:4478479 | Rps1k | N | 4478479 | [G/C] | Kingwa |
| Gm03:4478554 | Rps1k | N | 4478554 | [A/T] | Kingwa |
| Gm03:4478921 | Rps1k | N | 4478921 | [A/G] | Kingwa |
| Gm03:4479127 | Rps1k | N | 4479127 | [T/A] | Kingwa |
| Gm03:4506056 | Rps1k | N | 4506056 | [A/G] | Kingwa |
| Gm03:4506139 | Rps1k | N | 4506139 | [A/G] | Kingwa |
| Gm03:4506147 | Rps1k | N | 4506147 | [T/C] | Kingwa |
| Gm03:4507198 | Rps1k | N | 4507198 | [A/T] | Kingwa |
| Gm03:4525141 | Rps1k | N | 4525141 | [A/G] | Kingwa |
| Gm03:4525736 | Rps1k | N | 4525736 | [C/T] | Kingwa |
| Gm03:4526278 | Rps1k | N | 4526278 | [C/T] | Kingwa |
| Gm03:4526393 | Rps1k | N | 4526393 | [C/T] | Kingwa |
| Gm03:4526446 | Rps1k | N | 4526446 | [G/C] | Kingwa |
| Gm03:4527054 | Rps1k | N | 4527054 | [A/T] | Kingwa |
| Gm03:4533559 | Rps1k | N | 4533559 | [A/T] | Kingwa |
| Gm03:4539866 | Rps1k | N | 4539866 | [A/G] | Kingwa |
| Gm03:4541294 | Rps1k | N | 4541294 | [A/G] | Kingwa |
| *Gm composite 2003 Genetic Map | |||||
| ** Physical positions are based on Public JGI Glyma1 Williams82 reference. |
In certain embodiments, multiple marker loci that collectively make up a Phytophthora tolerance haplotype of interest are investigated. For example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the various marker loci provided herein can comprise a Phytophthora tolerance haplotype. In some embodiments, the haplotype comprises: (a) two or more marker loci associated with the Rps1a, Rps1c, Rps1d or Rps1k loci found on linkage group N; (b) two or more marker loci comprising S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B, or a closely linked marker on linkage group N; (c) two or more marker loci associated with the Rps2 locus found on linkage group J; (d) two or more marker loci comprising S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J; (e) two or more marker loci associated with the Rps3a or Rps3c loci found on linkage group F; (f) two or more marker loci comprising S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; (g) two or more marker loci associated with the Rps6 locus found on linkage group G; or (h) two or more marker loci comprising S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
In one embodiment, the method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection comprises detecting in the genome of the first soybean plant or in the genome of the first soybean germplasm at least one haplotype that is associated with the tolerance, wherein the at least one haplotype comprises at least two of the various marker loci provided herein.
In certain embodiments, two or more marker loci or haplotypes can collectively make up a marker profile. The marker profile can comprise any two or more marker loci comprising: (a) any marker loci associated with the Rps1a, Rps1c, Rps1d or Rps1k loci found on linkage group N; (b) marker loci comprising S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B, or a closely linked marker on linkage group N; (c) any marker loci associated with the Rps2 locus found on linkage group J; (d) marker loci comprising S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J; (e) any marker loci associated with the Rps3a or Rps3c loci found on linkage group F; (f) marker loci comprising S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; (g) any marker loci associated with the Rps6 locus found on linkage group G; and/or (h) marker loci comprising S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
Any marker loci associated with Phytophthora tolerance can be combined in the marker profile with any of the marker loci disclosed herein. For example, the marker profile can comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more marker loci or haplotypes associated with tolerance to Phytophthora infection provided herein (i.e. the various marker loci provided in Tables 1A and 1B and in FIGS. 1-4).
In one embodiment, a method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection comprises detecting in the genome of the first soybean plant or in the genome of the first soybean germplasm at least one marker profile that is associated with the tolerance, wherein the at least one marker profile comprises at least two of the various marker loci provided herein. In some embodiments, the marker profile comprises any combination of two or more marker loci from any of the various Rps loci, for example, Rps1, Rps2, Rps3, Rps4, Rps5, Rps6, Rps7 or Rps8.
Not only can one detect the various markers provided herein, it is recognized that one could detect any markers that are closely linked to the various markers discussed herein. Non-limiting examples of markers closely linked the various markers discussed herein are provided in Tables 1A and 1B and in FIGS. 1-4.
In addition to the markers discussed herein, information regarding useful soybean markers can be found, for example, on the USDA's Soybase website, available at www.soybase.org. One of skill in the art will recognize that the identification of favorable marker alleles may be germplasm-specific. The determination of which marker alleles correlate with tolerance (or susceptibility) is determined for the particular germplasm under study. One of skill will also recognize that methods for identifying the favorable alleles are routine and well known in the art, and furthermore, that the identification and use of such favorable alleles is well within the scope of the invention.
Various methods are provided to identify soybean plants and/or germplasm with tolerance or improved tolerance to Phytophthora infection. In one embodiment, the method of identifying comprises detecting at least one marker locus associated with tolerance to Phytophthora. The term āassociated withā in connection with a relationship between a marker locus and a phenotype refers to a statistically significant dependence of marker frequency with respect to a quantitative scale or qualitative gradation of the phenotype. Thus, an allele of a marker is associated with a trait of interest when the allele of the marker locus and the trait phenotypes are found together in the progeny of an organism more often than if the marker genotypes and trait phenotypes segregated separately.
Any combination of the marker loci provided herein can be used in the methods to identify a soybean plant or soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection. Any one marker locus or any combination of the markers set forth in Table 1, or any closely linked marker can be used to aid in identifying and selecting soybean plants or soybean germplasm with tolerance or improved tolerance to Phytophthora infection.
In one embodiment, a method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection is provided. The method comprises detecting in the genome of the first soybean plant or first soybean germplasm at least one marker locus that is associated with tolerance. In such a method, the at least one marker locus: (a) can be associated with the Rps1a, Rps1c, Rps1d or Rps1k loci found on linkage group N; (b) can comprise one or more of the marker loci S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B, or a closely linked marker on linkage group N; (c) can be associated with the Rps2 locus found on linkage group J; (d) can comprise one or more of the marker loci S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J; (e) can be associated with the Rps3a or Rps3c loci found on linkage group F; (f) can comprise one or more of the marker loci S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; (g) can be associated with the Rps6 locus found on linkage group G; and/or (h) can comprise one or more of the marker loci S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
In other embodiments, two or more marker loci are detected in the method. In a specific embodiment, the germplasm is a soybean variety.
In other embodiments, the method further comprises crossing the selected first soybean plant or first soybean germplasm with a second soybean plant or second soybean germplasm. In a further embodiment of the method, the second soybean plant or second soybean germplasm comprises an exotic soybean strain or an elite soybean strain.
In specific embodiments, the first soybean plant or first soybean germplasm comprises a soybean variety. Any soybean line known to the art or disclosed herein may be used. Non-limiting examples of soybean varieties and their associated Phytophthora tolerance alleles encompassed by the methods provided herein include, for example, those listed in Table 1.
In another embodiment, the detection method comprises amplifying at least one marker locus and detecting the resulting amplified marker amplicon. In such a method, amplifying comprises (a) admixing an amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm such that the primer or primer pair is complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template; and (b) extending the primer or primer pair in a DNA polymerization reaction comprising a DNA polymerase and a template nucleic acid to generate at least one amplicon. In such a method, the primer or primer pair can comprise a variant or fragment of one or more of the genomic loci provided herein.
In one embodiment, the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rps1a, Rps1c, Rps1d, or Rps1k loci comprising SEQ ID NOS: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 883, 884, 885, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 902, 903, 904, 905, 906, 907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919, 920, 921, 922, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, 953, 954, 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 965, 966, 967, 968, 969, 970, 971, 972, 973, 974, 975, 976, 977, 978, 979, 980, 981, 982, 983, 984, 985, 986, 987, 988, 989, 990, 991, 992, 993, 994, 995, 996, 997, 998, 999, 1000, 1001, 1002, 1003, 1004, 1005, 1006, 1007, 1008, 1009, 1010, 1011, 1012, 1013, 1014, 1015, 1016, 1017, 1018, 1019, 1020, 1021, 1022, 1023, 1024, 1025, 1026, 1027, 1028, 1029, 1030, 1031, 1032, 1033, 1034, 1035, 1036, 1037, 1038, 1039, 1040, 1041, 1042, 1043, 1044, 1045, 1046, 1047, 1048, 1049, 1050, 1051, 1052, 1053, 1054, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 1077, 1078, 1079, 1080, 1081, 1082, 1083, 1084, 1085, 1086, 1087, 1088, 1089, 1090, 1091, 1092, 1093, 1094, 1095, 1096, 1097, 1098, 1099, 1100, 1101, 1102, 1103, 1104, 1105, 1106, 1107, 1108, 1109, 1110, 1111, 1112, 1113, 1114, 1115, 1116, 1117, 1118, 1119, 1120, 1121, 1122, 1123, 1124, 1125, 1126, 1127, 1128, 1129, 1130, 1131, 1132, 1133, 1134, 1135, 1136, 1137, 1138, 1139, 1140, 1141, 1142, 1143, 1144, 1145, 1146, 1147, 1148, 1149, 1150, 1151, 1152, 1153, 1154, 1155, 1156, 1157, 1158, 1159, 1160, 1161, 1162, 1163, 1164, 1165, 1166, 1167, 1168, 1169, 1170, 1171, 1172, 1173, 1174, 1175, 1176, 1177, 1178, 1179, 1180, 1181, 1182, 1183, 1184, 1185, 1186, 1187, 1188, 1189, 1190, 1191, 1192, 1193, 1194, 1195, 1196, 1197, 1198, 1199, 1200, 1201, 1202, 1203, 1204, 1205, 1206, 1207, 1208, 1209, 1210, 1211, 1212, 1213, 1214, 1215, 1216, 1217, 1218, 1219, 1220, 1221, 1222, 1223, 1224, 1225, 1226, 1227, 1228, 1229, 1230, 1231, 1232, 1233, 1234, 1235, 1236, 1237, 1238, 1239, 1240, 1241, 1242, 1243, 1244, 1245, 1246, 1247, 1248, 1249, 1250, 1251, 1252, 1253, 1254, 1255, 1256, 1257, 1258, 1259, 1260, 1261, 1262, 1263, 1264, 1265, 1266, 1267, 1268, 1269, 1270, 1271, 1272, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1286, 1287, 1288, 1289, 1290, 1291, 1292, 1293, 1294, 1295, 1296, 1297, 1298, 1299, 1300, 1301, 1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or variants or fragments thereof. It is recognized that reference to any one of SEQ ID NOS: 191-1302 explicitly denotes each of the SEQ ID NOS recited above.
In one embodiment, the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or complements thereof. In specific embodiments, the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 1339, 1340 or variants or fragments thereof. In a further embodiment, the primer pair comprises SEQ ID NO: 1 and SEQ ID NO:2; SEQ ID NO: 9 and SEQ ID NO:10; SEQ ID NO: 20 and SEQ ID NO:21; SEQ ID NO: 22 and SEQ ID NO: 23; SEQ ID NO: 24 and SEQ ID NO: 25; SEQ ID NO: 36 and SEQ ID NO: 37; SEQ ID NO: 38 and SEQ ID NO: 39; or SEQ ID NO: 1339 and SEQ ID NO: 1340.
In another embodiment, the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rps2 locus comprising SEQ ID NOS: 173, 174, 175, 176, 177, 178, 179, 180 or variants or fragments thereof. In one embodiment, the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof. In specific embodiments, the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or variants or fragments thereof. In a further embodiment, the primer pair comprises SEQ ID NO: 40 and SEQ ID NO: 41; SEQ ID NO: 46 and SEQ ID NO: 47; SEQ ID NO: 52 and SEQ ID NO: 53; SEQ ID NO: 58 and SEQ ID NO: 59; SEQ ID NO: 64 and SEQ ID NO: 65; or SEQ ID NO: 75 and SEQ ID NO: 76.
In another embodiment, the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rps3a or Rps3c loci comprising SEQ ID NOS: 181, 182, 183, 184, 185, 186 or variants or fragments thereof. In one embodiment, the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 181, 182, 183, 184, 185, 186 or complements thereof. In specific embodiments, the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 or variants or fragments thereof. In a further embodiment, the primer pair comprises SEQ ID NO: 81 and SEQ ID NO: 82; SEQ ID NO: 89 and SEQ ID NO: 90; or SEQ ID NO: 91 and SEQ ID NO: 92.
In yet another embodiment, the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rps6 locus comprising SEQ ID NOS: 187, 188, 189, 190 or variants or fragments thereof. In one embodiment, the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 187, 188, 189, 190 or complements thereof. In specific embodiments, the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104 or variants or fragments thereof. In a further embodiment, the primer pair comprises SEQ ID NO: 95 and SEQ ID NO: 96; or SEQ ID NO: 101 and SEQ ID NO: 102.
The method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified. In such a method, the labeled nucleic acid probe can comprise a sequence comprising a variant or fragment of one or more of the genomic loci provided herein.
In one embodiment, the labeled nucleic acid probe can comprise a sequence associated with the Rps1a, Rps1c, Rps1d or Rps1k loci comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or complements thereof. In specific embodiments, the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341, 1342 or variants or fragments thereof.
In another embodiment, the labeled nucleic acid probe can comprise a sequence associated with the Rps2 locus comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof. In specific embodiments, the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139 or variants or fragments thereof.
In another embodiment, the labeled nucleic acid probe can comprise a sequence associated with the Rps3a or Rps3c loci comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 181, 182, 183, 184, 185, 186 or complements thereof. In specific embodiments, the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 140, 141, 142, 143, 144, 145, 146, 147, 148, 149 or variants or fragments thereof.
In yet another embodiment, the labeled nucleic acid probe can comprise a sequence associated with the Rps6 locus comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 187, 188, 189, 190 or complements thereof. In specific embodiments, the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 150, 151, 152, 153, 154 or variants or fragments thereof.
Non-limiting examples of primers, probes, genomic loci and amplicons that can be used in the methods and compositions provided herein are summarized in Tables 2, 3, 4 and 5, respectively.
| TABLEā2 |
| Non-LimitingāExamplesāofāPrimerāSequences. |
| TaqMan | ||||||||
| Marker | Gene/ | Assay | Primer | SEQ | Allele | |||
| position* | Locus | LG | Locus | Name | Name | IDāNO | PrimerāSequence | (R/S) |
| 3905604 | Rps1a | N | S08291-1 | Q5 | S08291-F3 | 1 | AAAAATGCCTCGTGGAGAGA | G/A |
| Q5 | S08291-R3 | 2 | GAAAATATGTAAAAGAAGAACTGCCAGA | G/A | ||||
| Q1 | S08291-F1 | 3 | TGGAGAGACAAAACAGGAGATTT | G/A | ||||
| Q1 | S08291-R1 | 4 | ATACACAATGGAAGATTGTTTAGCA | G/A | ||||
| Q4 | S08291-F2 | 5 | GAAAGAGAAACTGGGATTCTGG | G/A | ||||
| Q4 | S08291-R2 | 6 | TATACACAATGGAAGATTGTTTAGCA | G/A | ||||
| Q6 | S08291-F4 | 7 | CCTCGTGGAGAGACAAAACAG | G/A | ||||
| Q6 | S08291-R4 | 8 | CGAGAAAATATGTAAAAGAAGAACTGC | G/A | ||||
| 4464524 | Rps1c | N | S07292-1 | Q7 | S07292-F5 | 9 | AGATTCAAGGAGTCCAGACGAT | T/G |
| Q7 | S07292-R6 | 10 | CTCCAGCGGGAGATTTGC | T/G | ||||
| Q1,āQ2 | S07292-F1 | 11 | TCAAGGAGTCCAGACGATGC | T/G | ||||
| Q1,āQ2 | S07292-R1 | 12 | YGTCATGCTCAAGCTGTTCG | T/G | ||||
| Q3,āQ4 | S07292-F2 | 13 | AAGCTGCCAAGGGACAATTA | T/G | ||||
| Q3 | S07292-R2 | 14 | CGGGAGATTTGCTTCTTCAA | T/G | ||||
| Q4 | S07292-R3 | 15 | CAAGCTAGTAAGGCCATTTTGC | T/G | ||||
| Q5 | S07292-F3 | 16 | CTGCCAAGGGACAATTAGACTT | T/G | ||||
| Q5 | S07292-R4 | 17 | CCAGCGGGAGATTTGCTT | T/G | ||||
| Q6 | S07292-F4 | 18 | ATTCAAGGAGTCCAGACGATG | T/G | ||||
| Q6 | S07292-R5 | 19 | CTAGTAAGGCCATTTTGCTTCAG | T/G | ||||
| 4343399 | Rps1c | N | S08242-1 | Primerā1 | 20 | CTTGCATTCTGGAGGTGCTA | C/T | |
| Primerā2 | 21 | CCATCCCCTATTCTTTGGTG | C/T | |||||
| 3904033 | Rps1d | N | S16592-001 | S16592-F001 | 1339 | GGGAAGAATCCCAGTTGGAG | A/T | |
| S16592-R001 | 1340 | CAAACAAACTTGCGTTGCAG | A/T | |||||
| 3951705 | Rps1k | N | S07963-2 | Q1 | S07963-F2 | 22 | ATGAGGACACAATGCCATGA | T/C |
| Q1 | S07963-R2 | 23 | TGAGAAGGCCAATCCTATGC | T/C | ||||
| 5227883 | Rps1k | N | S07372-1 | Q11,āQ6, | S07372-F5 | 24 | ATTTTGGGCAAATGATGAAGC | C/T |
| Q8,āQ12 | ||||||||
| Q11,āQ8, | S07372-R4 | 25 | CTCAGCTAAAGACACCCTGCAAT | C/T | ||||
| Q12 | ||||||||
| Q2,āQ7 | S07372-F1 | 26 | TTGGGCAAATGATGAAGCTA | C/T | ||||
| Q2,āQ3, | S07372-R2 | 27 | GAGGGCTCATCAGCACAAA | C/T | ||||
| Q4 | ||||||||
| Q3 | S07372-F2 | 28 | AAATGGTTTGTGGGAGGTTAGA | C/T | ||||
| Q4 | S07372-F3 | 29 | AGAATAAATGGTTTGTGGGAGGTTA | C/T | ||||
| Q5 | S07372-F4 | 30 | TGAAGATATGCAAATTCTTTTCAAATTA | C/T | ||||
| Q5 | S07372-R3 | 31 | ACCATGGAGGGCTCATCA | C/T | ||||
| Q6 | S07372-R4 | 32 | CTCAGCTAAAGACACCCTGCAAT | C/T | ||||
| Q7 | S07372-R1 | 33 | CAAAAGGGCATCCTCAAAAG | C/T | ||||
| 86061 | 34 | TGGGAGGTTAGATTTTCTGAACGAAGA | C/T | |||||
| 82582 | 35 | CATCAGCACAAAAGGGCATCCTCA | C/T | |||||
| 3927056 | Rps1k | N | S00009-01 | Primerā1 | 36 | TGACACGTGGTGCGTTAGGAATTTT | C/T | |
| Primerā2 | 37 | TGAAACGCATTAGTTCAGGTGGTAACTTCT | C/T | |||||
| 4458273 | Rps1k | N | S08013-1 | Q1 | S08013-F1 | 38 | GAAAACGAAAATTGTAAGAGCAACTT | C/T |
| Q1 | S08013-R1 | 39 | ATGGAATGAGTTTGGGATGG | C/T | ||||
| 36085130 | Rps2 | J | S06862-1 | Q1 | S06862-1-Q1F | 40 | CCAAAGCTGTCTTGGAGGAA | T/G |
| Q1 | S06862-1-Q1R | 41 | CAAAACAGATGCTTTTAACATGAAC | T/G | ||||
| Q2 | S06862-1-Q2F | 42 | GCTGTCTTGGAGGAACTTGAA | T/G | ||||
| Q2 | S06862-1-Q2R | 43 | TTTCACAACACGAGGCTGTC | T/G | ||||
| Q3 | S06862-1-Q3F | 44 | GTTGCCAAAGCTGTCTTGGA | T/G | ||||
| Q3 | S06862-1-Q3R | 45 | CACGAGGCTGTCTACTCTCTTCA | T/G | ||||
| 36692217 | Rps2 | J | S06863-1 | Q1 | S06863-1-Q1F | 46 | TCACACAAGGAAATTTAACACTACAT | G/A |
| Q1 | S06863-1-Q1R | 47 | TTCTCACCTTCTGTTGTATTGGA | G/A | ||||
| Q2 | S06863-1-Q2F | 48 | CGCCAAATGGCTTACTTCTC | G/A | ||||
| Q2 | S06863-1-Q2R | 49 | ACCAATGAATCACACAAGGAAA | G/A | ||||
| Q3 | S06863-1-Q3F | 50 | GGCGCCAAATGGCTTACT | G/A | ||||
| Q3 | S06863-1-Q3R | 51 | TGAATCACACAAGGAAATTTAACACT | G/A | ||||
| 37262813 | Rps2 | J | S06864-1 | Q1 | S06864-1-Q1F | 52 | AACCATGCCCTTGAACAGTC | T/C |
| Q1 | S06864-1-Q1R | 53 | TTTGTGAAGGACATTTTGATTTG | T/C | ||||
| Q2 | S06864-1-Q2F | 54 | TGAACAGTCTGCCCTCAGAA | T/C | ||||
| Q2 | S06864-1-Q2R | 55 | TCTCAAAATCGGCATGAGGT | T/C | ||||
| Q3 | S06864-1-Q3F | 56 | CCTTGAACAGTCTGCCCTCA | T/C | ||||
| Q3 | S06864-1-Q3R | 57 | TGAACTTTGTGAAGGACATTTTGA | T/C | ||||
| 37377161 | Rps2 | J | S06865-1 | Q1 | S06865-1-Q1F | 58 | 59 | G/A |
| Q1 | S06865-1-Q1R | 59 | TTTGTGCAATTCTCCCATCA | G/A | ||||
| Q2 | S06865-1-Q2F | 60 | TGTTTACACGTTCTCCAATCAAA | G/A | ||||
| Q2 | S06865-1-Q2R | 61 | TGTGCAATTCTCCCATCAAA | G/A | ||||
| Q3 | S06865-1-Q3F | 62 | CAAGTGTTGTTTACACGTTCTCCA | G/A | ||||
| Q3 | S06865-1-Q3R | 63 | TTCCATAGGTGCTGTTTGTGC | G/A | ||||
| 36775973 | Rps2 | J | S11652-1 | Q1 | S11652-F1 | 64 | TTTCACTGCAAGAGGGAAGG | G/T |
| Q1,āQ4 | S11652-R1 | 65 | ATTCCTGCAGCTTCTCCATC | G/T | ||||
| Q2 | S11652-F2 | 66 | GAAGGGCTGTTGGTTATACCG | G/T | ||||
| Q2 | S11652-R2 | 67 | CATCTTATCTTTGAACCTTTCCTGA | G/T | ||||
| Q3 | S11652-F3 | 68 | AGGGAAGGGCTGTTGGTT | G/T | ||||
| Q3 | S11652-R3 | 69 | TCCATCTTATCTTTGAACCTTTCC | G/T | ||||
| Q4 | S11652-F4 | 70 | GCAAGAGGGAAGGGCTGTT | G/T | ||||
| 36563064 | Rps2 | J | S11682-1 | Q1 | S11682-F1 | 71 | ACAACACCTCCAGAGCATCC | G/T |
| Q1 | S11682-R1 | 72 | GCTTGTCAACATCATCTAAAATCAA | G/T | ||||
| Q2 | S11682-F2 | 73 | GGTTACAACACCTCCAGAGCA | G/T | ||||
| Q2 | S11682-R2 | 74 | TGCTTGTCAACATCATCTAAAATCA | G/T | ||||
| Q3 | S11682-F3 | 75 | CTCCAGAGCATCCTTCTTCG | G/T | ||||
| Q3 | S11682-R3 | 76 | TCATGCTTGTCAACATCATCTAAA | G/T | ||||
| Q4 | S11682-F4 | 77 | CAACACCTCCAGAGCATCC | G/T | ||||
| Q4 | S11682-R4 | 78 | GATGATGACTCTACTGCCTGGA | G/T | ||||
| 29110641 | Rps3a | F | S09018-1 | Q1 | S09018-F1 | 79 | AAGTGGCAGAGTGAACAGCA | C/G |
| Q1 | S09018-R1 | 80 | TAAGCGCATTTTCAAAGCTG | C/G | ||||
| Q2 | S09018-F2 | 81 | GACCGTAGAGAAAGTGGCAGA | C/G | ||||
| Q2 | S09018-R2 | 82 | AATAAGCGCATTTTCAAAGCTG | C/G | ||||
| Q3 | S09018-F3 | 83 | GGAGGAAAGGACCGTAGAGAA | C/G | ||||
| Q3 | S09018-R3 | 84 | AGCGCATTTTCAAAGCTGA | C/G | ||||
| Q4 | S09018-F4 | 85 | TGTTGCTCTTCCAAAAGATGAC | C/G | ||||
| Q4 | S09018-R4 | 86 | TGCATAACGTTTCAGAAGGAAA | C/G | ||||
| Q5 | S09018-F5 | 87 | CCAGTGAACTATGTTGCTCTTCC | C/G | ||||
| Q5 | S09018-R5 | 88 | CCAAATTTACAATGCATAACGTTTC | C/G | ||||
| 29049150 | Rps3a | F | S08342-1 | Primerā1 | 89 | AAAGAAGTTTAATTTGCAAATAGCTTGAAT | [T/A]/ | |
| TTTTCAAA | [T/C]/[C/A] | |||||||
| Primerā2 | 90 | TACTCCAATCAGAGTTTCCATGGCAAAGTT | [T/A]/ | |||||
| AG | [T/C]/[C/A] | |||||||
| 29049184 | Rps3c | F | S07163-1 | Q1-Q4 | S07163-1-F1 | 91 | CAGGAAAGTTGAATTGCTTTATCC | T/C |
| Q1-Q4 | S07163-1-R1 | 92 | CAGAGTTTCCATGGCAAAGTTA | T/C | ||||
| 60745556 | Rps6 | G | S08442-1 | Q5 | S08442-F3 | 93 | GGCCTTTTGTTATTTCTTCAGC | T/C |
| Q5 | S08442-R4 | 94 | GAGTATGGAGACAGCCCACAA | T/C | ||||
| Q4 | S08442-F1 | 95 | CACATTATAGGGGCCTTTTGTTA | T/C | ||||
| Q4 | S08442-R3 | 96 | TTGCATATTTTCTCCCACCTG | T/C | ||||
| Q1 | S08442-F1 | 97 | CACATTATAGGGGCCTTTTGTTA | T/C | ||||
| Q1 | S08442-R1 | 98 | TTAGCTTGTGTAGAGTATGGAGACAG | T/C | ||||
| Q2 | S08442-F2 | 99 | AGGGGCCTTTTGTTATTTCTTC | T/C | ||||
| Q2 | S08442-R2 | 100 | TTTCTCCCACCTGTGCATTT | T/C | ||||
| 60777851 | Rps6 | G | S08341-1 | p10792-6-F2 | 101 | CGTCCGAGATTGGAAATTGT | [A/T]/[G/T] | |
| p10792-6-R4 | 102 | TGGACTTTGGAATTGAACCAG | [A/T]/[G/T] | |||||
| p10792-6-R2 | 103 | TGTGAGACAAACTCCTGCATAAA | [A/T]/[G/T] | |||||
| p10792-6-R3 | 104 | TTATTGTGAGACAAACTCCTGCAT | [A/T]/[G/T] | |||||
| * Physical positions are based on Public JGI Glyma1 Williams82 reference. |
| TABLEā3 |
| Non-LimitingāExamplesāofāProbeāSequences. |
| Probeā1 | Probeā2 | ||||||||
| Marker | Gene/ | Marker | Probeā1 | SEQāID | Probeā1 | Probeā2 | SEQāID | Probeā2 | |
| Position* | Locus | LG | Name | Name | NO | Sequence | Name | NO | Sequence |
| 3905604 | Rps1a | N | S08291-1 | S08291- | 105 | 6FAM- | S08291- | 106 | VIC- |
| 1-PB1 | CCTCACA | 1-PB2 | CCTCACA | ||||||
| TACACAT | TACACAT | ||||||||
| CAG | TAG | ||||||||
| 3905604 | Rps1a | N | S08291-1 | S08291- | 107 | 6FAM- | S08291- | 108 | VIC- |
| 1-PB3 | ACATACA | 1-PB4 | ACACATT | ||||||
| CATCAGC | AGCAAC | ||||||||
| AAC | CC | ||||||||
| 3905604 | Rps1a | N | S08291-1 | S08291- | 109 | 6FAM- | S08291- | 110 | VIC- |
| 1-PB5 | TCACATA | 1-PB6 | TCACATA | ||||||
| CACATCA | CACATTA | ||||||||
| GCA | GCA | ||||||||
| 4464524 | Rps1c | N | S07292-1 | S07292- | 111 | 6FAM- | S07292- | 112 | VIC- |
| 1-PB1 | TTGCCAA | 1-PB2 | CCAACCT | ||||||
| CCTGATA | GATCGA | ||||||||
| GA | GA | ||||||||
| 4464524 | Rps1c | N | S07292-1 | S07292- | 113 | 6FAM- | S07292- | 114 | VIC- |
| 1-PB3 | TTCTCTAT | 1-PB4 | TTGCACA | ||||||
| CAGGTTG | TCTTCTC | ||||||||
| GC | GAT | ||||||||
| 4343399 | Rps1c | N | S08242-1 | Probeā1 | 115 | 6FAM- | Probeā2 | 116 | VIC- |
| TTCCCTGT | TTCCCTG | ||||||||
| GTTTGC | CGTTTGC | ||||||||
| 3904033 | Rps1d | N | S16592- | S16592- | 1341 | 6FAM- | S16592- | 1342 | VIC- |
| 001 | 001- | tcatcTgt | 001- | tcatcAg | |||||
| X001 | cccgatcc | X002 | tcccgat | ||||||
| cc | |||||||||
| 3951705 | Rps1k | N | S07963-2 | S07963- | 117 | CCAGATC | S07963- | 118 | CAGATC |
| 2-PB1 | ATATATC | 2-PB2 | ACATATC | ||||||
| GC | GC | ||||||||
| 5227883 | Rps1k | N | S07372-1 | S07372- | 119 | 6FAM- | S07372- | 120 | VIC- |
| 1-PBS | CTCCTTAA | 1-PB4 | AGCACTC | ||||||
| GGTAATT | CTTAAGA | ||||||||
| AA | TAA | ||||||||
| 5227883 | Rps1k | N | S07372-1 | 102408 | 121 | 6FAM- | 102409 | 122 | VIC- |
| CACTCCTT | CACTCCT | ||||||||
| AAGGTAA | TAAGAT | ||||||||
| T | AAT | ||||||||
| 5227883 | Rps1k | N | S07372-1 | S07372- | 119 | 6FAM- | 148644 | 123 | VIC- |
| 1-PBS | CTCCTTAA | AGCACTC | |||||||
| GGTAATT | CTTAAGA | ||||||||
| AA | TAA | ||||||||
| 3927056 | Rps1k | N | S00009- | Probeā1 | 124 | 6FAM- | Probeā2 | 125 | VIC- |
| 01 | CATGTGG | CATGTGG | |||||||
| CTCAATTT | CTTAATT | ||||||||
| T | |||||||||
| 4458273 | Rps1k | N | S08013-1 | S08013- | 126 | TCATCTTT | S08013- | 127 | ATCTTTT |
| 1-PB1 | TCATCCA | 1-PB2 | CATTCAG | ||||||
| GTGC | TGCAT | ||||||||
| 36085130 | Rps2 | J | S06862-1 | S06862- | 128 | 6FAM- | S06862- | 129 | VIC- |
| 1-FAM | CTTACTTT | 1-VIC | TAGCTTG | ||||||
| TGCACAT | TTGGTTG | ||||||||
| GTA | CAC | ||||||||
| 36692217 | Rps2 | J | S06863-1 | S06863- | 130 | 6FAM- | S06863- | 131 | VIC- |
| 1-FAM | TTTGGAA | 1-VIC | TTTGGAA | ||||||
| CTGCACC | TTGCACC | ||||||||
| TC | TCA | ||||||||
| 37262813 | Rps2 | J | S06864-1 | S06864- | 132 | 6FAM- | S06864- | 133 | VIC- |
| 1-FAM | CTGCTGT | 1-VIC | CTGCTGT | ||||||
| ACTAATC | ACTAGTC | ||||||||
| ATAT | ATAT | ||||||||
| 37377161 | Rps2 | J | S06865-1 | S06865- | 134 | 6FAM- | S06865- | 135 | VIC- |
| 1-FAM | ATGCAAATT | 1-VIC | ATGCAAAT | ||||||
| TCTATCTTG | TTTTATCTT | ||||||||
| GC | |||||||||
| 36775973 | Rps2 | J | S11652-1 | S11652- | 136 | 6FAM- | S11652- | 137 | VIC- |
| 1-PB1 | CAAAGTCGA | 1-PB2 | CTTTTACAA | ||||||
| TCCTTC | AGTAGATC | ||||||||
| CT | |||||||||
| 36563064 | Rps2 | J | S11682-1 | S11682- | 138 | 6FAM- | S11682- | 139 | VIC- |
| 1-PB1 | CAACATCGG | 1-PB2 | ACAACATA | ||||||
| CTTCA | GGCTTCA | ||||||||
| 29110641 | Rps3a | F | S09018-1 | S09018- | 140 | 6FAM- | S09018- | 141 | VIC- |
| 1-PB1 | CTAATTTGA | 1-PB2 | CTAATTTG | ||||||
| CTCCTGAAT | ACTCGTGA | ||||||||
| C | ATC | ||||||||
| 29049150 | Rps3a | F | S08342-1 | Probeā1 | 142 | 6FAM- | Probeā2 | 143 | VIC- |
| ACCATACTA | ACCATACT | ||||||||
| AAAAATT | CAAAAAT | ||||||||
| 29049184 | Rps3c | F | S07163-1 | S07163- | 144 | 6FAM- | S07163- | 145 | VIC- |
| 1-P1 | GGAACGTTA | 1-P2 | TGGAACAT | ||||||
| CCGGA | TACCGGAC | ||||||||
| 29049184 | Rps3c | F | S07163-1 | S07163- | 146 | 6FAM- | S07163- | 147 | VIC- |
| 1-PB1 | TGGGTCCGG | 1-PB2 | TCCGGTAA | ||||||
| TAACGT | TGTTCC | ||||||||
| 29049184 | Rps3c | F | S07163-1 | S07163- | 148 | 6FAM- | S07163- | 149 | VIC- |
| 1-PB3 | TGGAACGTT | 1-PB4 | CGTGGAAC | ||||||
| ACCGGAC | ATTACC | ||||||||
| 60745556 | Rps6 | G | S08442-1 | S08442- | 150 | 6FAM- | S08442- | 151 | VIC- |
| 1-PB1 | CAAATTAAC | 1-PB2 | CAAATTAA | ||||||
| ACATCAACA | CACGTCAA | ||||||||
| CA | |||||||||
| 60777851 | Rps6 | G | S08341-1 | 102379 | 152 | 6FAM- | 102380 | 153 | VIC- |
| (alleleā1) | ATCTTTTTGG | (alleleā2) | TCTTTTTGG | ||||||
| AAGTTATAC | AAGATATA | ||||||||
| C | |||||||||
| 60777851 | Rps6 | G | S08341-1 | 102381 | 154 | 6FAM- | |||
| (alleleā3) | CATCTTTTTG | ||||||||
| GAATATATA | |||||||||
| C | |||||||||
| *Physical positions are based on Public JGI Glyma1 Williams82 reference. |
| TABLEā4 |
| Non-LimitingāExamplesāofāGenomic |
| LociāComprisingātheāVariousāMarkerāLoci |
| ProvidedāHerein.* |
| Ref.āSeq. | ||||
| Marker | Gene/ | SEQāID | ||
| Name | Locus | LG | NOā(R/S) | ReferenceāSequence |
| S08291-1 | Rps1a | N | 155/156 | TYSRWAATGGGGCCACCCATATTATTTTGCTACCGAAATAGAATA |
| CGAAAATGGGGGTAGTGACCTTRTGGCCATAGAGTTGAAGCAAGC | ||||
| TAATTCTGACWCGTGGCTTCCCATGCAGCGTTCATGGGGTGCAAG | ||||
| GTGGGCTTTGAATTTAGGTTTACAATTACAAGCACCATTATCTAT | ||||
| TAAGCTCACAGAACAAGGCAAGGGCTATTACAAGACAATTGTGGC | ||||
| TGATAGTGTAATTCCACATGGCTGGCAACCTGGCCAAGTTTATCG | ||||
| ATCTGTTGTTAATTTTTAAACTCTGTTTAAAATCATGACATCAAT | ||||
| CGAGAAAATATGTAAAAGAAGAACTGCCAGATTATATAAATAAGT | ||||
| TTATCCTTGTCAGTTCATATATATATACACAATGGAAGATTGTTT | ||||
| AGCAATAWTTCTTTGCATTTCTTTTATGTGATAAAAAGTATGTGT | ||||
| AATAATATGGGGGTTGCT[G/A]ATGTGTATGTGAGGTTGTGAAA | ||||
| CTTTGTTTTTAAATAAAAATAATTCAAATCTCCTGTTTTGTCTCT | ||||
| CCACGAGGCATTTTTTCCTAATAAYCCAGAATCCCAGTTTCTCTT | ||||
| TCCCRTGAACACTTCCTTCTTCTTGGTTTGCAGTTTTTTAAAATA | ||||
| AAAGGTTATTATTTTCTATAAAAAAAATGAAAAGCAATCACCTGC | ||||
| AAGACATGGTCATAGCCKKTT | ||||
| S07292-1 | Rps1c | N | 157/158 | ATTGKTKGTSTGKKCCTVSMYRTTTGAAGCTGAATTTGTTTGCTG |
| CTCTGTTATCAAGCTAGTAAGGCCATTTTGCTTCAGRTAGGTCTC | ||||
| CAGCGGGAGATTTGCTTCTTCAAGAAGACTYGTCATGCTCAAGCT | ||||
| GTTCGGCCCAGCTTGCACATCTTCTC[T/G]ATCAGGTTGGCAAT | ||||
| TCAAGTCTAATTGTCCCTTGGCAGCTTCAGCCACCGCATCGTCTG | ||||
| GACTCCTTGAATCTAATTCATTTTGCACCCTTACTTCATTCTCCA | ||||
| AACCGTCAACTGGAGTTAAATGGCGAGAGGTGCTATCTACTTCTG | ||||
| ATTCATCTTTCGTCCGCCATGATAACTGATTTCTCTGAGCAATCT | ||||
| CTGCTTCACGTTCRGATTGCYGCTTCTYCTTTCGCAKCATCAGGG | ||||
| TTTTAAACCGACGTTTAACTGTCATGCACACATTGCAGGTGCATG | ||||
| TAGGTTTGTGTTTGCCCTTCCCACTTGGTGGCTGGATACARACAA | ||||
| TGCAAGAGCACCCAGGTCTATGCCGAGGATGTTTTGTGGTGGTAA | ||||
| CAACTGGTGTTCTGCCAGAGTCACTTGCATCATCTCCCAGTATTG | ||||
| CTGCATTTGCCATGGTCATAG | ||||
| S08242-1 | Rps1c | N | 159/160 | GCAAGCCTGCTTCAAGGACTTGCGTGGTGCACGTATGAAGAATAG |
| TGGCGTGAATGGGAGCTAACCTGGATTGTGAAAATGGAATACAAA | ||||
| TTGCAAAATCATCAATGATTTYTAGAATATTTCCTTTATACAAAA | ||||
| TGACAAATTCTATTATTAGGGAAGTGGTATAAATAAAAGCATTTG | ||||
| TAAACCATTGAGGGATATGAATGAACAAAATACAAGCTTCCTTTC | ||||
| CTTCRGTGCCTTTTTCTCTCTTCTTCTTCCTTGCATTCTGGAGGT | ||||
| GCTAGTCCCGAATCCAGCAATTTCCCTG[C/T]GTTTGCACGTAA | ||||
| CATAGTTTCTAGTATTAGTTAAAGGGCAAAACTAAAAAATATGTG | ||||
| CACCAAAGAATAGGGGATGGTTAGTTTTTATGTTAGAATCTTACG | ||||
| ACAATTTGAACCTACTATCTCTTCTACTTTTTCTTTTAACACTTA | ||||
| ATTTTTTTTTYKATCATTAAATTAATTTTATATCTTTGGATATTT | ||||
| TATTTATTATTATTAATTATTAAAAGAAAGWGCAGAGAGTATTGT | ||||
| TAGCATTTCTATTATAATTAATCTGAAATTGAACAATGTATGTAT | ||||
| TCAACAAAACAGTGAAGCAGTGAATTTGAAGATGGAAGGAATCAA | ||||
| GAAAGTACAAGTG | ||||
| S16592-001 | Rps1d | N | 1343 | CRCCGGAGTGTCCAYKGGTGTTGAGTCCTAATATTTCTTTGTGSC |
| TCTAGGTCATGATTTAAATACTTAAAGACCCTTGAAAATTTACAA | ||||
| ACAAACTTGCGTTGCAGATATATTTCAAAACCCTAGCATACRTCT | ||||
| AGCATGGGAGGGGTGCAACCAGTCACTACAAAAATCATTTGAAAA | ||||
| AATTAATTGCGGATCGGGACWGATGACAACTGTGCGTACCTTAAA | ||||
| GGGAAYCAGCRAATGAGAGGGTACATATAAAATTGAAGGTGTGAA | ||||
| ACTCCTAGCCTCCAACTGGGATTCTTCCCRCAAGTGTCGTTTGAA | ||||
| GTTAAGCCGCAAAAGAAGCTATGACTGGCTATGGYTGGCTATGGG | ||||
| GGGTTGTGCACGTTGTCCTGGGTTAGGGTATATATTGTATA | ||||
| S07963-2 | Rps1k | N | 161/162 | CTTTCTYYTTNGCTTTTcnGAGAAGAAGAGATAAGATCAACCAAA |
| GAATGAAGGAATTGCAAAAGCTGGTCCCAAATTCCAGTAAGGTAA | ||||
| AGAAAGAATGGTTGTAACTTAGCCAAGTTTTTGGTATAAAATTAT | ||||
| GTTCCCAATCTTTTTTCAAATTCTCTATTATGTAAGAAAGTGGCC | ||||
| ATACGTAACATGATAAAGCTGCAACATTGATCCTCTCTTTAATTT | ||||
| CTTTCCCTGTTCACCAATTAATCGGTTCAGTGGTCCCATGAGGAC | ||||
| ACAATGCCATGAASCCCAGATCA[T/C]ATATCGCATCTCCWTAT | ||||
| AGTATATGTTTCATTTTGTGTCTGCATAGGATTGGCCTTCTCATA | ||||
| AAGCAAACGCATTTCAGAAATCAATTGGAATCCTTTTATRTCTCT | ||||
| TTGAAGAACTTCTTAAAGGAATATGTGCCTAAATGACAAAATTCA | ||||
| GTTTCAATCTTTAAGTTTGYTCGAAATAAAAAGGTTTCACTTTTG | ||||
| ATTAATAATTGAGTTACTAACASAAAGACAATTAGACTCTATGTC | ||||
| TACACATCTTGGTGAGAATCCTCTACTGACTACTGATAAGATAAT | ||||
| ACTTTTAGATCCGATTGATACATTGTTGTAGTTTAATTATCATTC | ||||
| TCGAGTTTAAGTTTTTGATATGAATTACATTATATTGCAAAGWAA | ||||
| ATTTTGTCTAGTATTATATGATTACTCGAWAATATTAATATTGGA | ||||
| GAGAAAATTGCCYYTCACATGGTCATA | ||||
| S07372-1 | Rps1k | N | 163/164 | CTGCAGTGTTGTCTCTCGGAGTTGCTTCAATTGCTCATACTCTTT |
| GGGATAACCACTCATTTCAAAGATGTACTAGTTTAAAACATGCAA | ||||
| AAAGA:TAAAGTTAATGTGTATTTTGTATGTTGTAGGGAAGCACA | ||||
| AAGTATCTTGATTGAATTAGGAAGATTACACGAGCCGTATGCATC | ||||
| AGAATAAATGGTTTGTGGGAGGTTAGATTTTCTGAACGAAGATGA | ||||
| AGATATGCAAATTCTTTTCAAATTAATTTTGGGCAAATGATGAAG | ||||
| CTAGACTGATAATTGATTAATTTTGGGCAAATAATATTATATTAC | ||||
| ATGTATGAGATTGATTTTAAGTGTATATGCATACATGAAGCAATA | ||||
| GACTTAATTTAATTA[C/T]CTTAAGGAGTGCTGGACTTTTGAGG | ||||
| ATGCCCTTTTGTGCTGATGAGCCCTCCATGGTTGACATACAAAGC | ||||
| AAATTGCAGGGTGTCTTTAGCTGAGGTTTTTGCTGCTTCGAAGTG | ||||
| GCAATTGAATCAGCTCCGTTGGACAGTGACATGGTGATGGTGGTG | ||||
| ATAATTAATTCGGCTTAAGGGTAAGTACAACTTCTTAGCTCTGTA | ||||
| AGCAAAGGATGCCTTGTGGAGTTGGTTCATCTAATCCACGTATAT | ||||
| ATAGGGCTGAACGAGGGAACAAGAGTTTTCAATCAATGATTACAA | ||||
| TTCCACACTCTCGCCTCTAAAGTGCATCCCTCACATTGAAGCATC | ||||
| CTCCAAATCCCAAAATATTATTATTACCACTTAAAGCTATTACAA | ||||
| ATCAGAAAACACTGCAG | ||||
| S00009-01 | Rps1k | N | 165/166 | TCAAAGTANNNNAAGTTATTAGACATGAAATTGTTTAWGATAAAT |
| AATCTATTGTAATTAAGCAAGCCATGTTGGGCTAGGAACACTATC | ||||
| AACTAGTAGGATTTAAGTCTAGTCTCTTTAAGCGAATTTACAAGT | ||||
| TTATGGATAGCATTCAATGTATTTCTTAAGGTGGTATCACCCTCG | ||||
| WTGATMATTTTCACAAATTGACACGTGGTGCGTTAGGAATTTTGT | ||||
| TTTTAATAATTTTCCACAYTAAAAAGTGATTTTCATGTGGCT[C/ | ||||
| T]AATTTTTTTTTAAAAAAAAAATTGAATTAACACTMATGTGACA | ||||
| TTTTTATGTGGAACATGTCAACCTATATAAGTAATAATTTAGAAG | ||||
| TTACCACCTGAACTAATGCGTTTCAAATTCAAATGATAATATATG | ||||
| ATTTATGTGACTGYTAGTTCATTTTATTTAAAAAATATTMAMAAR | ||||
| ATCACWAGAMAYTRKMAATTGTCAATTCACKATTTGATAATGATA | ||||
| TGACAAATAATTCCATATTAGTAAATTWTTTCAAAATAATTCCCT | ||||
| TGTAATATTTCAAAATAGGATAAAYTACCATATTTGAGTCATTAA | ||||
| TTGTGTAAGCGTGGTCGCATTAATCC | ||||
| S08013-1 | Rps1k | N | 167/168 | YYCTNANANTTGTTTACATCTTATACAGAACTTGAGTTTGAAAAC |
| GAAAATTGTAAGAGCAACTTTTAATCATCTTTTCAT[C/T]CAGT | ||||
| GCATGCTTGAAAACTTTGTCAGAAGACAAATTAGTGKAAGCATAT | ||||
| ATATTAATTTCAATAATTTATTATGGAATTATCATATGATACCAT | ||||
| CCCAAACTCATTCCATGTTTCCCAAACAGAATGAATAATGATATT | ||||
| ASGCACCGTTCAAATTCAACATGATTTTGACAATARAAATCCAGC | ||||
| CAGATTAAATTTTTGTTCCACTATATCTCACACAAGCTTTACAAT | ||||
| CGGACAAACTGGTTACTATACAACTACTATGTTTTTTCTTTTCTT | ||||
| TTCTTTTAATCTCTGTTCCCATTTTATCACAAGTATTTCTTTTTT | ||||
| GTCATTTATWAAAAAAAANGTAAGRAAAATTAATACTGTAAATTA | ||||
| TAAAYACATGCCATATAAAANTTGTGTAAAAAAANNAAATAAACG | ||||
| CATNGCCATATNNAAAAACACATGTCATAAANCAANCGTTTTAAA | ||||
| TTGTGGTNCTCTNGGTCAGCAGCCACWTGG | ||||
| S06862-1 | Rps2 | J | 169/170 | TGTTTTGTTACGCTTCTTTTTTGTACACAGTTATGCCAATTTTGA |
| TTTCTTGTTTTAATTATGTGTTGTGTGGCTTGGTTTTGTGTTTCA | ||||
| GTGACTCGTGCTATTGTTCCGAGAATGAACTTGGACGAGCTGTTT | ||||
| GAGCAGAAGGGTGAGGTTGCCAAAGCTGTCTTGGAGGAACTTGAA | ||||
| AAGGTATCTTACTTCTTTTATTTAAGTAAGTTCTGGCATTCTTGA | ||||
| ATTAAATATGTAAGAAAAGTGAAGAGAAGCTTAGTATTAGTTGTT | ||||
| GTTCACAAAATATCAAATTATTTCATTTCCTTTTAAAATTATACT | ||||
| AGCTTGTTGAGTACTGGTGAAGAGAGTAGACAGCCTCGTGTTGTG | ||||
| AAAAGGGTTGGGGGAGGGGGGGGTGGACTAAGAAGGACTTTGGAG | ||||
| GAAATTGTTAAAAGGGACCTCGTCTTAANTNNTNTTCCNGAAANT | ||||
| TGGNNNTNNCNTNNCNCANNGATNTCNNGTGNNTNNNGNNNNTGG | ||||
| S06863-1 | Rps2 | J | 171/172 | GCGGCAGATGGGCGTCTAGAGATATGTGGTATGATATATATATAA |
| ATATATAATATGTAGCCCCGAAATAACTTCACTTGATTTTTATCC | ||||
| CATTCACGAGAGTAGCTAGATTGAAACAACATTGTCCGTTGGCCT | ||||
| AAGTTCAAATAGTCAACCAGAATAAAATGCAGGCTGATCATATCT | ||||
| ATTTTTGATTTTGACTATTTACCAAAACCAATCAAATGGAAGTTG | ||||
| TCTAGCTAGTCTATTCTGGCGCCAAATGGCTTACTTCTCACCTTC | ||||
| TGTTGTATTGGAGTAAGTATGAGGTGCA[G/A]TTCCAAATCTCA | ||||
| TAGAAGTGAGAAAAAAAACATATAAAATGAGTAAAAGATTCATAA | ||||
| ACCTAATCTTTGAAGTTTTGAATTAAAATGTAGTGTTAAATTTCC | ||||
| TTGTGTGATTCATTGGTATAAATCTTTAGTTCAGTGAAATGGGAC | ||||
| CAGGGTTATGATGTTACTGCTCATTTTCTTGACTATTAGCAGATG | ||||
| AGGGATGGTTACAGTGATCAACTCTTTGTTCAGTTACTGGGAAAA | ||||
| GCAGTTTATCAGCTTTGGCAAGACTACAAGGCTAAGTATGGCACC | ||||
| AGTTAAGAGGCTATGAGAGCTTTGCATGTTATTTTTTAAAAATAT | ||||
| AAGCGAGTATATATGTCGCAATCTATTTGTATATAGGTTAATTTG | ||||
| TATTAATTCTATGTTTATTCAGCGGAATGGCATGGTCATAGCCTG | ||||
| TT | ||||
| S06864-1 | Rps2 | J | 173/174 | GTACACTTTGCTTAACCAACTCAACTCAACTTTTTAGTGCCTTTA |
| AAAGTAGAAAAAGGAAGTCGTGTTTGAGAGAAAAAGATAAACTTG | ||||
| AAACTGAAGAAAAAGCTAAGAGCTTAACCTCTCTCCTAAAAGCTA | ||||
| ACTAAAACTAACAGAATGTGCACCCTCGCATGTGGCAACCCCACT | ||||
| AAGCTCCTACATGTCAGTTCCCTCCTAACCAACTCCCTGCTCATC | ||||
| AGGGTTGATTTTCTTCTCTTTCAAAGGCTTTCAGCCTTTGTTCTG | ||||
| ACTAAACTAAGCCCAATTTCTATCTGCTAGCCTGGTCTAACAGAA | ||||
| GGGGATATGATWTAACATCGTATTCTCAAAATTGGCACGGATAGA | ||||
| TCCTATTATTTAATCTTAAACTTGTTAAAGGATATAATCTTATAT | ||||
| TCTCAAAATCGGCATGAGGTGGTCCTATTATTTACACTTGAACTT | ||||
| TGTGAAGGACATTTTGATTTGTATCTTTGAACTTTATAATATGA | ||||
| [T/C]TAGTACAGCAGTATGGAATTTGTGAAGATATTTTCTGAGG | ||||
| GCAGACTGTTCAAGGGCATGGTTTTAATTTTTTTATGTATGAACC | ||||
| CCATAGTTTCTGTCCACATCATCATGCCCATGGTCATAGCYKKTT | ||||
| S06865-1 | Rps2 | J | 175/176 | TATCGTACCTGATAAWTGTCAAAAACCTTTCCAACTCCATGGTAT |
| AGACATCAACAGCTTGTTCCAAGACGGTGATTTGTTCCATTTTTC | ||||
| TATCAAATTATACCCAGAGAGAGAAGATAAAGTGTTACAAAAATC | ||||
| CTCCATGTTCTAAAAGACTACCAAAACACCACATCTTCCATGGAA | ||||
| GGAAATTAAAAAGCCTCTCAATCTCTCTAAAAAATAGAACAAGTC | ||||
| CCATAAACAGCTTGTGAGCTGACACCAAATGGAAGCAAGATGTCC | ||||
| AATTCTGTATCATGATAAAATGATGGGCAAAACTTATATAAGGTT | ||||
| CCATAGGTGCTGTTTGTGCAATTCTCCCATCAAAATTGGAGTTTT | ||||
| AACTTGGCAATTTGCAAGATA[G/A]AAATTTGCATTAAAGGATT | ||||
| ATGCAAATTACCTTGGTGAAACTCCAATTTTGATTGGAGAACGTG | ||||
| TAAACAACACTTGAGGAACTGTAAACAAGTTATTTCCTAAAATAA | ||||
| CCTTCTAGCTCAAATGAGTTCTAAAACATCACTTAACCGAAGCGC | ||||
| CAAATAAAAGAAAACAAGGAACATCTCAACAAGACGACCCTTGTT | ||||
| CTCAGTTCCATGATATGCACACGATTCCATGGTCATAGCYKKKT | ||||
| S11652-1 | Rps2 | J | 177/178 | TCCYYGACATAYTYCCAATAAACTYGTATTCATATGMRYCTCTGT |
| TTCAAACAAACAAAAAAGTTCTGATGAAGTCAGCCTAAAATCCTT | ||||
| GCATCCATGTCTTGATAGGTACATTAATTGTCAAGGTTAACAAGA | ||||
| GCATTTCTTTTCTATTTAAATTTKACTAGTTAAATCAATMGACAA | ||||
| GTAAAACCTAATCCAATAAAAACCATAAAGTAAAWTATATTAGTA | ||||
| TGATTGTATACCCATCTTTGAAATGAGAGCCAGACAAGTCAGCTA | ||||
| CTTGTTTCAAAGCCATCCTCCATTCCTGCAGCTTCTCCATCTTAT | ||||
| CTTTGAACCTTTCCTGATGCTTAGTCATTGCTTCTCCATAACTAC | ||||
| CTTTCTGGTGTCTGACATAAGAAGGATC[G/T]ACTTTGTAAAAG | ||||
| ACCGGTATAACCAACAGCCCTTCCCTCTTGCAGTGAAAGATGGTT | ||||
| ACAAGTTCATCTAAACAAAATGAGGAAAAAGCATAGTTTTCAGAA | ||||
| AGCACAATAATAGCAACCCTGGAATCTTGAATTGCCTTCAAAAGT | ||||
| GCAGGTGTTATTTCCTCTCCGCTGTGAAGCTTGTCTTCGTCAAAG | ||||
| AAGGTATGAAATCCCTTGTCACAAAGAGCCTTGTAGAGATWGCCA | ||||
| GTAAAACCATAGCGTGTGTCTGTCCCTCTGA | ||||
| S11682-1 | Rps2 | J | 179/180 | TKGGACCTATCACTTCCAAAGCTAATGGAAGGCCAGAAGCATAAA |
| TWACTACATCATTCAAGACCTCCTTATAACTTGGATCAACCTTTT | ||||
| CGGTTTTAAAAGATTTCCATGTAAGCAATTGAAGAGCATTGTTCT | ||||
| CATTCAATAGTTCCACTTCATATGTTCTTTTAACCCCATGAGATG | ||||
| CTAGCAGTTGTTTGTCCCGAGTGGTGATGATGACTCTACTGCCTG | ||||
| GACCAAACCAACAAGGTCTTCCAACAATAGCCTGTAATTGTTCAT | ||||
| GCTTGTCAACATCATCTAAAATCAAGAGAACCTTCTTTCGCTGAA | ||||
| GCC[G/T]ATGTTGTATAATTGAAGCTCCTTGTTCAACACTTGCT | ||||
| AAGTTGATTTCCTTCTCTCCAAKTATTTCCCGAAGAAGGATGCTC | ||||
| TGGAGGTGTTGTAACCCCTTCTTGTTTGATTTTTCTCTCAAATCT | ||||
| TTAAGAAAACATGAACCATCAAAATGRCAAGCAATCAAATTATAA | ||||
| ACTGCTATAGCAAGTGTTGATTTTCCTATCCCACCAATTCCATGG | ||||
| ATCCCTATCATGTAGACACCAWCATCAGATTCAACATCCAAAAGC | ||||
| TTTGTTACTTCTAGKAATCTTGATTCTAGTCCAACCGGGTAATCC | ||||
| CATGGTCAWAGCYKKTT | ||||
| S09018-1 | Rps3a | F | 181/182 | TTTTTGGTTcaGGTCTGCAACAAAAAAGCCTCTGGGTCAGAGCAC |
| TCATGCTAACACCATACTTGGGACACCAACTGGGCGTCGAATGCT | ||||
| TTCGACGCCTTCTGGCCGCCATGGAAACTCAGGAGGAAAGGACCG | ||||
| TAGAGAAAGTGGCAGAGTGAACAGCATAATTCCAGTGAACTATGT | ||||
| TGCTCTTCCAAAAGATGACTMTGTTTCTAGGGGGAATTAAGGGCT | ||||
| GCCCTCTAATTTGACTC[C/G]TGAATCAGTCAGCTTTGAAAATG | ||||
| CGCTTATTSTACAAGCTCTATTATGTTTCCTTCTGAAACGTTATG | ||||
| CATTGTAAATTTGGTAAATGACAAATGAATGACCCATTCTAGGCT | ||||
| TGATATAGAAGATTGTACAAGTCACGGGCTAAATAGATTACAAAT | ||||
| ATAAAAAGAAGTCATTCTTGTTCTTTCATGTGTGTAAGTTGTCTG | ||||
| ATTTGATTCTTCAAAAATGAGGTGTACTTTAGAGAATAAAGGGTA | ||||
| CTTATAATTAATTTATCAGAAAATTAATAGTTGAGAAGTTTGATA | ||||
| AAATTAGATACATATATGRCAATTTAGAKWTRAYRWTYTARWKTW | ||||
| WAW | ||||
| S08342-1 | Rps3a | F | 183/184 | TTAAGTGACTTTAAAATATGACACATTGAAATGACCTGTTTGGAT |
| ATTAAATTTAAAGAATTTTCAAAAATGATGAGAAATTTATTGGAA | ||||
| TTTTTTTTTAAAATAAAATAGAATTACAAAACGCTGACAAGGTGT | ||||
| TTTGGTAGGGAGAGATTCTTTTCAATTTCTTAGAAATCTTGGAAG | ||||
| TGTTAAATTCCTATATTTGATATAACTATTTTAATGATCATTTTC | ||||
| ATAAATCTAAAATTCACAAGAATCATTTTTGAATAAGTCTTCTAC | ||||
| TAAACGTGGTTCGGTGGAGAGACTCTACAAAATGAGGTCAGACAT | ||||
| CGTAGGATGTTAGTCAAGCATCGGCCAAACCAGTAAATACTTCAT | ||||
| ATCATATCAATCATATGATGATAAAAAAACGCTTTCTTAAGACAC | ||||
| CGTGAACTCTAGAAAACACATAAAATGAAATCTGCACAAGCTTAA | ||||
| AGCACATGACTAAATAACTTTATCAAAATAAAAAACTAAAATACA | ||||
| GGAAAGTTGAATTGCTTTATCCAAATAAAATTTAAAAAACGAAAG | ||||
| AAGTTTAATTTGCAAATAGCTTGAATTTTTCAAATACCATAC[T/ | ||||
| C][C/A]AAAAATTACCTTGATTTTTCTGGGTCCGGTAA[C/T]G | ||||
| TTCCACGTTGGGCTTAAACTAACTTTGCCATGGAAACTCTGATTG | ||||
| GAGTAACGGAGGATGCACACATCATACCATAGGATAGCGGTAACA | ||||
| CTGTCAGGACACAGCCGAGAGATTTCATTGACAGCAGTGGTGAGA | ||||
| CAGAACTGGCAGAAGTATCCTGTGATGTCGTATCTGCAG | ||||
| S07163-1 | Rps3c | F | 185/186 | GAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCTCTAGAT |
| GCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCG | ||||
| CCCTTCAGGAAAGTTGAATTGCTTTATCCAAATAAAATTTAAAAA | ||||
| ACGAAAGAAGTTTAATTTGCAAATAGCTTGAATTTTTCAAATACC | ||||
| ATACTCAAAAATTACCTTGATTTTTCTGGGTCCGGTAA[T/C]GT | ||||
| TCCACGTTGGGCTTAAACTAACTTTGCCATGGAAACTCTGAAGGG | ||||
| CGAATTCCAGCACACTGGCGGCCGTTACTAGTGGATCCGAGCTCG | ||||
| GTACCAAGCTTGGCGTAAT | ||||
| S08442-1 | Rps6 | G | 187/188 | KTKRATTGGCTACTAAAACAAATGCTATATTTGTAAATATATACC |
| AATATAGCAATACAGGGGTAATTGAAAATTCTGATTAACTGTTRA | ||||
| TCTACAGGTTAACAGTCTTCGGCAGGAACTACAACTTCTTGCTAG | ||||
| AGATAGATCAATCACTATTGTAAATGCAAGTGGAACAGGTACTGG | ||||
| TTAGCTACTTTCTTATACACATTATAGGGGCCTTTTGTTATTTCT | ||||
| TCAGCAATTTAATAAATGTTGA[T/C]GTGTTAATTTGCAAACCC | ||||
| ATGATAACTGGTTTTAATTGTGGGCTGTCTCCATACTCTRCACAA | ||||
| GCTAAMCAATGTTTCCTTATTATTTTTTACTCCTKTTTTATTTTC | ||||
| TGACTTGTTTGGGAAATGCACAGGTGGGAGAAAATATGCAACAGT | ||||
| GATTGTTATTGTTGTGGTAGGATATGGATACGTTTGGTGGAAGGT | ||||
| AATGYCTTTTCTCTCTCAATTKTTGATTTAAGTAACAGGATGCTG | ||||
| TAGTGATACATTCTTRTTGGAAGCTTTATGGCTAATTTGAATTTR | ||||
| AATATTGGTGCTTWTAACGAGTGCCATCTGCTCTTTGCACAYGGA | ||||
| TACTCTCCACTTAA | ||||
| S08341-1 | Rps6 | G | 189/190 | TTGATGGAAATTCATTTGAAGGGAATATTCCGTCCGAGATTGGAA |
| ATTGTAGCTCTCTTTACTTGCTGTATGCATCCTATTTCTCAAGCT | ||||
| CTAGTGTCATTTCTYTTAACACATCTTTTTGGA[A/T][G/T]AT | ||||
| ATACTAATTCCTATCTATTTTATGCAGGAGTTTGTCTCACAATAA | ||||
| TTTGACTGGTTCAATTCCAAAGTCCATGTCAAAGCTAAACAAGCT | ||||
| CAAAATCCTCAAGCTGGAATTCAATGAACTAAGTGGANANATACC | ||||
| AATGGAGCTTGGAATGCTTCAGAGTCTTCTTGCTGTAAACATATC | ||||
| ATACAACAGGCTCACAGGAAGGCTTCCTACAAGTAGCATATTTCA | ||||
| GAACTTGGACAAAAGTTCCTTGGAAGGAAACCTGGGTCTTTGTTC | ||||
| ACCCTTGTTGAAGGGTCCATGTAANATGAATGTCCCCAAACCACT | ||||
| WGTGCTTGACCCAAATGCCTATAACAACCAAATAAGTCCTCAAAG | ||||
| GCAAACAAACNAATCATCTGAGTCTGGCCCAGTCCATCGCCACAG | ||||
| GTTCCTTAGTGTATCTGCTATTGTAGCAATATCTGCATCCTTTGT | ||||
| CATTGTATTAGGAGTGATTGCTGTTAGCCTACTTAATGTTTCTGT | ||||
| AAGGANAAGCTAACATTTTTGGATAATG | ||||
| *The reference sequences for the remaining Rps1k markers are summarized in Table 8. |
| TABLEā5 |
| Non-limitingāExamplesāofāAmplicons |
| ComprisingātheāVariousāMarkerāLoci |
| ProvidedāHerein |
| Amplicon | ||||
| Marker | Gene/ | SEQāIDāNO | ||
| Name | Locus | LG | (R/S) | AmpliconāSequence |
| S08291-1 | Rps1a | N | 1303/1304 | GAAAATATGTAAAAGAAGAACTGCCAGATTATATA |
| AATAAGTTTATCCTTGTCAGTTCATATATATATACAC | ||||
| AATGGAAGATTGTTTAGCAATATTTCTTTGCATTTCT | ||||
| TTTATGTGATAAAAAGTATGTGTAATAATATGGGGG | ||||
| TTGCT[G/A]ATGTGTATGTGAGGTTGTGAAACTTTGT | ||||
| TTTTAAATAAAAATAATTCAAATCTCCTGTTTTGTCT | ||||
| CTCCACGAGGCATTTTT | ||||
| S07292-1 | Rps1c | N | 1305/1306 | CTCCAGCGGGAGATTTGCTTCTTCAAGAAGACTCGT |
| CATGCTCAAGCTGTTCGGCCCAGCTTGCACATCTTCT | ||||
| C[T/G]ATCAGGTTGGCAATTCAAGTCTAATTGTCCCT | ||||
| TGGCAGCTTCAGCCACCGCATCGTCTGGACTCCTTG | ||||
| AATCT | ||||
| S08242-1 | Rps1c | N | 1307/1308 | CTTGCATTCTGGAGGTGCTAGTCCCGAATCCAGCAA |
| TTTCCCTG[C/T]GTTTGCACGTAACATAGTTTCTAGT | ||||
| ATTAGTTAAAGGGCAAAACTAAAAAATATGTGCACC | ||||
| AAAGAATAGGGGATGG | ||||
| S16592-001 | Rps1d | N | 1344 | CAAACAAACTTGCGTTGCAGATATATTTCAAAACCC |
| TAGCATACRTCTAGCATGGGAGGGGTGCAACCAGTC | ||||
| ACTACAAAAATCATTTGAAAAAATTAATTGCGGATC | ||||
| GGGACWGATGACAACTGTGCGTACCTTAAAGGGAA | ||||
| YCAGCRAATGAGAGGGTACATATAAAATTGAAGGT | ||||
| GTGAAACTCCTAGCCTCCAACTGGGATTCTTCCC | ||||
| S07963-2 | Rps1k | N | 1309/1310 | ATGAGGACACAATGCCATGAACCCCAGATCA[T/C]A |
| TATCGCATCTCCTTATAGTATATGTTTCATTTTGTGT | ||||
| CTGCATAGGATTGGCCTTCTCA | ||||
| S07372-1 | Rps1k | N | 1311/1312 | ATTTTGGGCAAATGATGAAGCTAGACTGATAATTGA |
| TTAATTTTGGGCAAATAATATTATATTACATGTATGA | ||||
| GATTGATTTTAAGTGTATATGCATACATGAAGCAAT | ||||
| AGACTTAATTTAATTA[C/T]CTTAAGGAGTGCTGGAC | ||||
| TTTTGAGGATGCCCTTTTGTGCTGATGAGCCCTCCAT | ||||
| GGTTGACATACAAAGCAAATTGCAGGGTGTCTTTAG | ||||
| CTGAG | ||||
| S00009-01 | Rps1k | N | 1313/1314 | TGACACGTGGTGCGTTAGGAATTTTGTTTTTAATAAT |
| TTTCCACAYTAAAAAGTGATTTTCATGTGGCT[C/T]A | ||||
| ATTTTTTTTTAAAAAAAAAATTGAATTAACACTMAT | ||||
| GTGACATTTTTATGTGGAACATGTCAACCTATATAA | ||||
| GTAATAATTTAGAAGTTACCACCTGAACTAATGCGT | ||||
| TTCA | ||||
| S08013-1 | Rps1k | N | 1315/1316 | GAAAACGAAAATTGTAAGAGCAACTTTTAATCATCT |
| TTTCAT[C/T]CAGTGCATGCTTGAAAACTTTGTCAGA | ||||
| AGACAAATTAGTGKAAGCATATATATTAATTTCAAT | ||||
| AATTTATTATGGAATTATCATATGATACCATCCCAA | ||||
| ACTCATTCCAT | ||||
| S06862-1 | Rps2 | J | 1317/1318 | CCAAAGCTGTCTTGGAGGAACTTGAAAAGGTATCTT |
| ACTTCTTTTATTTAAGTAAGTTCTGGCATTCTTGAAT | ||||
| TAAATATGTAAGAAAAGTGAAGAGAAGCTTAGTATT | ||||
| AGTTGTTGTTCACAAAATATCAAATTATTTCATTTCC | ||||
| TTTTAAAATTATACTAGCTTGTTG[T/G]TTGCACATG | ||||
| TAAAAGAGTTCATGTTAAAAGCATCTGTTTTG | ||||
| S06863-1 | Rps2 | J | 1319/1320 | TTCTCACCTTCTGTTGTATTGGAGTAAGTATGAGGTG |
| CA[G/A]TTCCAAATCTCATAGAAGTGAGAAAAAAAA | ||||
| CATATAAAATGAGTAAAAGATTCATAAACCTAATCT | ||||
| TTGAAGTTTTGAATTAAAATGTAGTGTTAAATTTCCT | ||||
| TGTGTGA | ||||
| S06864-1 | Rps2 | J | 1321/1322 | TGAACTTTGTGAAGGACATTTTGATTTGTATCTTTGA |
| ACTTTATAATATGA[T/C]TAGTACAGCAGTATGGAAT | ||||
| TTGTGAAGATATTTTCTGAGGGCAGACTGTTCAAGG | ||||
| S06865-1 | Rps2 | J | 1323/1324 | TGTGCAATTCTCCCATCAAAATTGGAGTTTTAACTTG |
| GCAATTTGCAAGATA[G/A]AAATTTGCATTAAAGGA | ||||
| TTATGCAAATTACCTTGGTGAAACTCCAATTTTGATT | ||||
| GGAGAACGTGTAAACA | ||||
| S11652-1 | Rps2 | J | 1325/1326 | ATTCCTGCAGCTTCTCCATCTTATCTTTGAACCTTTC |
| CTGATGCTTAGTCATTGCTTCTCCATAACTACCTTTC | ||||
| TGGTGTCTGACATAAGAAGGATC[G/T]ACTTTGTAAA | ||||
| AGACCGGTATAACCAACAGCCCTTCCCTCTTGCAGT | ||||
| GAAA | ||||
| S11682-1 | Rps2 | J | 1327/1328 | TCATGCTTGTCAACATCATCTAAAATCAAGAGAACC |
| TTCTTTCGCTGAAGCC[G/T]ATGTTGTATAATTGAAG | ||||
| CTCCTTGTTCAACACTTGCTAAGTTGATTTCCTTCTC | ||||
| TCCAAGTATTTCCCGAAGAAGGATGCTCTGGAG | ||||
| S09018-1 | Rps3a | F | 1329/1330 | GACCGTAGAGAAAGTGGCAGAGTGAACAGCATAAT |
| TCCAGTGAACTATGTTGCTCTTCCAAAAGATGACTCT | ||||
| GTTTCTAGGGGGAATTAAGGGCTGCCCTCTAATTTG | ||||
| ACTC[C/G]TGAATCAGTCAGCTTTGAAAATGCGCTTA | ||||
| TT | ||||
| S08342-1 | Rps3a | F | 1331/1332 | AAAGAAGTTTAATTTGCAAATAGCTTGAATTTTTCA |
| AATACCATAC[T/C][C/A]AAAAATTACCGATTTTTCT | ||||
| GGGTCCGGTAA[C/T]GTTCCACGTTGGGCTTAAACTA | ||||
| ACTTTGCCATGGAAACTCATTGGAGTA | ||||
| S07163-1 | Rps3c | F | 1333/1334 | CAGGAAAGTTGAATTGCTTTATCCAAATAAAATTTA |
| AAAAACGAAAGAAGTTTAATTTGCAAATAGCTTGAA | ||||
| TTTTTCAAATACCATACTCAAAAATTACCTTGATTTT | ||||
| TCTGGGTCCGGTAA[T/C]GTTCCACGTTGGGCTTAAA | ||||
| CTAACTTTGCCATGGAAACTCTG | ||||
| S08442-1 | Rps6 | G | 1335/1336 | CACATTATAGGGGCCTTTTGTTATTTCTTCAGCAATT |
| TAATAAATGTTGA[T/C]GTGTTAATTTGCAAACCCAT | ||||
| GATAACTGGTTTTAATTGTGGGCTGTCTCCATACTCT | ||||
| ACACAAGCTAAACAATGTTTCCTTATTATTTTTTACT | ||||
| CCTGTTTTATTTTCTGACTTGTTTGGGAAATGCACAG | ||||
| GTGGGAGAAAATATGCAA | ||||
| S08341-1 | Rps6 | G | 1337/1338 | CGTCCGAGATTGGAAATTGTAGCTCTCTTTACTTGCT |
| GTATGCATCCTATTTCTCAAGCTCTAGTGTCATTTCT | ||||
| YTTAACACATCTTTTTGGA[A/T][G/T]ATATACTAA | ||||
| TTCCTATCTATTTTATGCGGAGTTTGTCTCACA | ||||
In another embodiment, the method of detecting comprises DNA sequencing of at least one of the marker loci provided herein. As used herein, āsequencingā refers to sequencing methods for determining the order of nucleotides in a molecule of DNA. Any DNA sequencing method known in the art can be used in the methods provided herein. Non-limiting examples of DNA sequencing methods useful in the methods provided herein include Next Generation Sequencing (NGS) technologies, for example, as described in Egan, A. N, et al. (2012) American Journal of Botany 99(2):175-185; genotyping by sequencing (GB S) methods, for example, as described in Elshire, R. J., et al. (2011) PLoS ONE 6(5):e19379; Molecular Inversion Probe (MIP) genotyping, as described, for example, in Hardenbol, P., et al. (2003) Nature Biotechnology 21(6):673-678; or high throughput genotyping by whole-genome resequencing, as described, for example in Huang, X et al., (2009) Genome Research 19:1068-1076. Each of the above references is incorporated by reference in their entirety herein.
An active variant of any one of SEQ ID NOS: 1-1394 can comprise a polynucleotide having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NOS: 1-1394 as long as it is capable of amplifying and/or detecting the marker locus of interest. By āfragmentā is intended a portion of the polynucleotide. A fragment or portion can comprise at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 75, 100, 150, 200, 250, 300, 350, 400 contiguous nucleotides of SEQ ID NOS: 1-1394 as long as it is capable of amplifying and/or detecting the marker locus of interest.
Unless otherwise stated, sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 using the following parameters: % identity and % similarity for a nucleotide sequence using GAP Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; or any equivalent program thereof. By āequivalent programā is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.
Traits or markers are considered to be linked if they co-segregate. A 1/100 probability of recombination per generation is defined as a map distance of 1.0 centiMorgan (1.0 cM). Genetic elements or genes located on a single chromosome segment are physically linked. Two loci can be located in close proximity such that recombination between homologous chromosome pairs does not occur between the two loci during meiosis with high frequency, e.g., such that linked loci co-segregate at least about 90% of the time, e.g., 91%, 92%, 93, 94, 95, 96%, 97, 98%, 99, 99.5%, 99.75%, or more of the time. Genetic elements located within a chromosome segment are also genetically linked, typically within a genetic recombination distance of less than or equal to 50 centimorgans (cM), e.g., about 49, 40, 30, 20, 10, 5, 4, 3, 2, 1, 0.75, 0.5, or 0.25 cM or less. That is, two genetic elements within a single chromosome segment undergo recombination during meiosis with each other at a frequency of less than or equal to about 50%, e.g., about 49%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, or 0.25% or less. Closely linked markers display a cross over frequency with a given marker of about 10% or less (the given marker is within about 10 cM of a closely linked marker). In specific embodiments, a closely linked marker is with 10 cM, 9 cM, 8 cM, 7 cM, 6 cM, 5 cM, 4 cM, 3 cM, 2 cM or 1 cM of any given marker disclosed herein. In further embodiments, a marker associated with one of the markers disclosed herein can be within 75 Kb, 60 Kb, 50 Kb, 40 Kb, 30 Kb, 20K, 10 Kb, 5 Kb or less of the disclosed marker. Put another way, closely linked loci co-segregate at least about 90% of the time. Genetic linkage as evaluated by recombination frequency is impacted by the chromatin structure of the region comprising the loci. Typically, the region is assumed to have a euchromatin structure during initial evaluations. However, some regions, such are regions closer to centrosomes, have a heterochromatin structure. Without further information, the predicted physical distance between genetic map positions is based on the assumption that the region is euchromatic, however if the region comprises heterochromatin the markers may be physically closer together. With regard to physical position on a chromosome, closely linked markers can be separated, for example, by about 1 megabase (Mb; 1 million nucleotides), about 500 kilobases (Kb; 1000 nucleotides), about 400 Kb, about 300 Kb, about 200 Kb, about 100 Kb, about 50 Kb, about 25 Kb, about 10 Kb, about 5 Kb, about 2 Kb, about 1 Kb, about 500 nucleotides, about 250 nucleotides, or less.
When referring to the relationship between two genetic elements, such as a genetic element contributing to tolerance and a proximal marker, ācouplingā phase linkage indicates the state where the āfavorableā allele at the tolerance locus is physically associated on the same chromosome strand as the āfavorableā allele of the respective linked marker locus. In coupling phase, both favorable alleles are inherited together by progeny that inherit that chromosome strand. In ārepulsionā phase linkage, the āfavorableā allele at the locus of interest (e.g., a QTL for tolerance) is physically linked with an āunfavorableā allele at the proximal marker locus, and the two āfavorableā alleles are not inherited together (i.e., the two loci are āout of phaseā with each other).
Markers are used to define a specific locus on the soybean genome. Each marker is therefore an indicator of a specific segment of DNA, having a unique nucleotide sequence. Map positions provide a measure of the relative positions of particular markers with respect to one another. When a trait is stated to be linked to a given marker it will be understood that the actual DNA segment whose sequence affects the trait generally co-segregates with the marker. More precise and definite localization of a trait can be obtained if markers are identified on both sides of the trait. By measuring the appearance of the marker(s) in progeny of crosses, the existence of the trait can be detected by relatively simple molecular tests without actually evaluating the appearance of the trait itself, which can be difficult and time-consuming because the actual evaluation of the trait requires growing plants to a stage and/or under environmental conditions where the trait can be expressed. Molecular markers have been widely used to determine genetic composition in soybeans.
Favorable genotypes associated with at least trait of interest may be identified by one or more methodologies. In some examples one or more markers are used, including but not limited to AFLPs, RFLPs, ASH, SSRs, SNPs, indels, padlock probes, molecular inversion probes, microarrays, sequencing, and the like. In some methods, a target nucleic acid is amplified prior to hybridization with a probe. In other cases, the target nucleic acid is not amplified prior to hybridization, such as methods using molecular inversion probes (see, for example Hardenbol et al. (2003) Nat Biotech 21:673-678). In some examples, the genotype related to a specific trait is monitored, while in other examples, a genome-wide evaluation including but not limited to one or more of marker panels, library screens, association studies, microarrays, gene chips, expression studies, or sequencing such as whole-genome resequencing and genotyping-by-sequencing (GB S) may be used. In some examples, no target-specific probe is needed, for example by using sequencing technologies, including but not limited to next-generation sequencing methods (see, for example, Metzker (2010) Nat Rev Genet 11:31-46; and, Egan et al. (2012) Am J Bot 99:175-185) such as sequencing by synthesis (e.g., Roche 454 pyrosequencing, Illumina Genome Analyzer, and Ion Torrent PGM or Proton systems), sequencing by ligation (e.g., SOLiD from Applied Biosystems, and Polnator system from Azco Biotech), and single molecule sequencing (SMS or third-generation sequencing) which eliminate template amplification (e.g., Helicos system, and PacBio RS system from Pacific BioSciences). Further technologies include optical sequencing systems (e.g., Starlight from Life Technologies), and nanopore sequencing (e.g., GridION from Oxford Nanopore Technologies). Each of these may be coupled with one or more enrichment strategies for organellar or nuclear genomes in order to reduce the complexity of the genome under investigation via PCR, hybridization, restriction enzyme (see, e.g., Elshire et al. (2011) PLoS ONE 6:e19379), and expression methods. In some examples, no reference genome sequence is needed in order to complete the analysis.
The use of marker assisted selection (MAS) to select a soybean plant or germplasm which has a certain marker locus, haplotype or marker profile is provided. For instance, in certain examples a soybean plant or germplasm possessing a certain predetermined favorable marker locus or haplotype will be selected via MAS. In certain other examples, a soybean plant or germplasm possessing a certain predetermined favorable marker profile will be selected via MAS.
Using MAS, soybean plants or germplasm can be selected for markers or marker alleles that positively correlate with Phytophthora tolerance, without actually raising soybean and measuring for tolerance (or, contrawise, soybean plants can be selected against if they possess markers that negatively correlate with tolerance). MAS is a powerful tool to select for desired phenotypes and for introgressing desired traits into cultivars of soybean (e.g., introgressing desired traits into elite lines). MAS is easily adapted to high throughput molecular analysis methods that can quickly screen large numbers of plant or germplasm genetic material for the markers of interest and is much more cost effective than raising and observing plants for visible traits.
In some embodiments, the molecular markers or marker loci are detected using a suitable amplification-based detection method. In these types of methods, nucleic acid primers are typically hybridized to the conserved regions flanking the polymorphic marker region. In certain methods, nucleic acid probes that bind to the amplified region are also employed. In general, synthetic methods for making oligonucleotides, including primers and probes, are well known in the art. For example, oligonucleotides can be synthesized chemically according to the solid phase phosphoramidite triester method described by Beaucage and Caruthers (1981) Tetrahedron Letts 22:1859-1862, e.g., using a commercially available automated synthesizer, e.g., as described in Needham-VanDevanter, et al. (1984) Nucleic Acids Res. 12:6159-6168. Oligonucleotides, including modified oligonucleotides, can also be ordered from a variety of commercial sources known to persons of skill in the art.
It will be appreciated that suitable primers and probes to be used can be designed using any suitable method. It is not intended that the invention be limited to any particular primer, primer pair or probe. For example, primers can be designed using any suitable software program, such as LASERGENEĀ® or Primer3.
It is not intended that the primers be limited to generating an amplicon of any particular size. For example, the primers used to amplify the marker loci and alleles herein are not limited to amplifying the entire region of the relevant locus. In some embodiments, marker amplification produces an amplicon at least 20 nucleotides in length, or alternatively, at least 50 nucleotides in length, or alternatively, at least 100 nucleotides in length, or alternatively, at least 200 nucleotides in length.
Non-limiting examples of polynucleotide primers useful for detecting the marker loci provided herein are provided in Table 2 and include, for example, SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 1339, 1340 or variants or fragments thereof.
PCR, RT-PCR, and LCR are in particularly broad use as amplification and amplification-detection methods for amplifying nucleic acids of interest (e.g., those comprising marker loci), facilitating detection of the markers. Details regarding the use of these and other amplification methods are well known in the art and can be found in any of a variety of standard texts. Details for these techniques can also be found in numerous journal and patent references, such as Mullis, et al. (1987) U.S. Pat. No. 4,683,202; Arnheim & Levinson (Oct. 1, 1990) C&EN 36-47; Kwoh, et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173; Guatelli, et al., (1990) Proc. Natl. Acad. Sci. USA87:1874; Lomell, et al., (1989) J. Clin. Chem. 35:1826; Landegren, et al., (1988) Science 241:1077-1080; Van Brunt, (1990) Biotechnology 8:291-294; Wu and Wallace, (1989) Gene 4:560; Barringer, et al., (1990) Gene 89:117, and Sooknanan and Malek, (1995) Biotechnology 13:563-564.
Such nucleic acid amplification techniques can be applied to amplify and/or detect nucleic acids of interest, such as nucleic acids comprising marker loci. Amplification primers for amplifying useful marker loci and suitable probes to detect useful marker loci or to genotype SNP alleles are provided. For example, exemplary primers and probes are provided in SEQ ID NOS: 1-154, 1339-1342 and in Tables 2 and 3, and the genomic loci comprising the various marker loci provided herein are provided in SEQ ID NOS: 155-1302, 1343, 1345-1394 and in Table 4. Non-limiting examples of amplicon sequences comprising the marker loci provided herein are provided in SEQ ID NOS: 1303-1338, 1344 and in Table 5. However, one of skill will immediately recognize that other primer and probe sequences could also be used. For instance primers to either side of the given primers can be used in place of the given primers, so long as the primers can amplify a region that includes the allele to be detected, as can primers and probes directed to other SNP marker loci. Further, it will be appreciated that the precise probe to be used for detection can vary, e.g., any probe that can identify the region of a marker amplicon to be detected can be substituted for those examples provided herein. Further, the configuration of the amplification primers and detection probes can, of course, vary. Thus, the compositions and methods are not limited to the primers and probes specifically recited herein.
In certain examples, probes will possess a detectable label. Any suitable label can be used with a probe. Detectable labels suitable for use with nucleic acid probes include, for example, any composition detectable by spectroscopic, radioisotopic, photochemical, biochemical, immunochemical, electrical, optical, or chemical means. Useful labels include biotin for staining with labeled streptavidin conjugate, magnetic beads, fluorescent dyes, radiolabels, enzymes, and colorimetric labels. Other labels include ligands, which bind to antibodies labeled with fluorophores, chemiluminescent agents, and enzymes. A probe can also constitute radiolabelled PCR primers that are used to generate a radiolabelled amplicon. Labeling strategies for labeling nucleic acids and corresponding detection strategies can be found, e.g., in Haugland (1996) Handbook of Fluorescent Probes and Research Chemicals Sixth Edition by Molecular Probes, Inc. (Eugene Oreg.); or Haugland (2001) Handbook of Fluorescent Probes and Research Chemicals Eighth Edition by Molecular Probes, Inc. (Eugene Oreg.).
Detectable labels may also include reporter-quencher pairs, such as are employed in Molecular Beacon and TaqMan⢠probes. The reporter may be a fluorescent organic dye modified with a suitable linking group for attachment to the oligonucleotide, such as to the terminal 3Ⲡcarbon or terminal 5Ⲡcarbon. The quencher may also be an organic dye, which may or may not be fluorescent, depending on the embodiment. Generally, whether the quencher is fluorescent or simply releases the transferred energy from the reporter by non-radiative decay, the absorption band of the quencher should at least substantially overlap the fluorescent emission band of the reporter to optimize the quenching. Non-fluorescent quenchers or dark quenchers typically function by absorbing energy from excited reporters, but do not release the energy radiatively.
Selection of appropriate reporter-quencher pairs for particular probes may be undertaken in accordance with known techniques. Fluorescent and dark quenchers and their relevant optical properties from which exemplary reporter-quencher pairs may be selected are listed and described, for example, in Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd ed., Academic Press, New York, 1971, the content of which is incorporated herein by reference. Examples of modifying reporters and quenchers for covalent attachment via common reactive groups that can be added to an oligonucleotide in the present invention may be found, for example, in Haugland, Handbook of Fluorescent Probes and Research Chemicals, Molecular Probes of Eugene, Oreg., 1992, the content of which is incorporated herein by reference.
In certain examples, reporter-quencher pairs are selected from xanthene dyes including fluoresceins and rhodamine dyes. Many suitable forms of these compounds are available commercially with substituents on the phenyl groups, which can be used as the site for bonding or as the bonding functionality for attachment to an oligonucleotide. Another useful group of fluorescent compounds for use as reporters are the naphthylamines, having an amino group in the alpha or beta position. Included among such naphthylamino compounds are 1-dimethylaminonaphthyl-5 sulfonate, 1-anilino-8-naphthalene sulfonate and 2-p-touidinyl-6-naphthalene sulfonate. Other dyes include 3-phenyl-7-isocyanatocoumarin; acridines such as 9-isothiocyanatoacridine; N-(p-(2-benzoxazolyl)phenyl)maleimide; benzoxadiazoles; stilbenes; pyrenes and the like. In certain other examples, the reporters and quenchers are selected from fluorescein and rhodamine dyes. These dyes and appropriate linking methodologies for attachment to oligonucleotides are well known in the art.
Suitable examples of reporters may be selected from dyes such as SYBR green, 5-carboxyfluorescein (5-FAM⢠available from Applied Biosystems of Foster City, Calif.), 6-carboxyfluorescein (6-FAM), tetrachloro-6-carboxyfluorescein (TET), 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein, hexachloro-6-carboxyfluorescein (HEX), 6-carboxy-2ā²,4,7,7ā²-tetrachlorofluorescein (6-TET⢠available from Applied Biosystems), carboxy-X-rhodamine (ROX), 6-carboxy-4ā²,5ā²-dichloro-2ā²,7ā²-dimethoxyfluorescein (6-JOE⢠available from Applied Biosystems), VIC⢠dye products available from Molecular Probes, Inc., NED⢠dye products available from Applied Biosystems, and the like. Suitable examples of quenchers may be selected from 6-carboxy-tetramethyl-rhodamine, 4-(4-dimethylaminophenylazo) benzoic acid (DABYL), tetramethylrhodamine (TAMRA), BHQ-0ā¢, BHQ-1ā¢, BHQ-2ā¢, and BHQ-3ā¢, each of which are available from Biosearch Technologies, Inc. of Novato, Calif., QSY-7ā¢, QSY-9ā¢, QSY-21⢠and QSY-35ā¢, each of which are available from Molecular Probes, Inc., and the like.
In one aspect, real time PCR or LCR is performed on the amplification mixtures described herein, e.g., using molecular beacons or TaqMan⢠probes. A molecular beacon (MB) is an oligonucleotide which, under appropriate hybridization conditions, self-hybridizes to form a stem and loop structure. The MB has a label and a quencher at the termini of the oligonucleotide; thus, under conditions that permit intra-molecular hybridization, the label is typically quenched (or at least altered in its fluorescence) by the quencher. Under conditions where the MB does not display intra-molecular hybridization (e.g., when bound to a target nucleic acid, such as to a region of an amplicon during amplification), the MB label is unquenched. Details regarding standard methods of making and using MBs are well established in the literature and MBs are available from a number of commercial reagent sources. See also, e.g., Leone, et al., (1995) Molecular beacon probes combined with amplification by NASBA enable homogenous real-time detection of RNA, Nucleic Acids Res. 26:2150-2155; Tyagi and Kramer, (1996) Molecular beacons: probes that fluoresce upon hybridization, Nature Biotechnology 14:303-308; Blok and Kramer, (1997) Amplifiable hybridization probes containing a molecular switch, Mol Cell Probes 11:187-194; Hsuih. et al., (1997) Novel, ligation-dependent PCR assay for detection of hepatitis C in serum, J Clin Microbiol 34:501-507; Kostrikis, et al., (1998) Molecular beacons: spectral genotyping of human alleles, Science 279:1228-1229; Sokol, et al., (1998) Real time detection of DNA:RNA hybridization in living cells, Proc. Natl. Acad. Sci. U.S.A. 95:11538-11543; Tyagi, et al., (1998) Multicolor molecular beacons for allele discrimination, Nature Biotechnology 16:49-53; Bonnet, et al., (1999) Thermodynamic basis of the chemical specificity of structured DNA probes, Proc. Natl. Acad. Sci. U.S.A. 96:6171-6176; Fang, et al. (1999) Designing a novel molecular beacon for surface-immobilized DNA hybridization studies, J. Am. Chem. Soc. 121:2921-2922; Marras, et al., (1999) Multiplex detection of single-nucleotide variation using molecular beacons, Genet. Anal. Biomol. Eng. 14:151-156; and Vet, et al., (1999) Multiplex detection of four pathogenic retroviruses using molecular beacons, Proc. Natl. Acad. Sci. U.S.A. 96:6394-6399. Additional details regarding MB construction and use is found in the patent literature, e.g., U.S. Pat. Nos. 5,925,517; 6,150,097; and 6,037,130.
Another real-time detection method is the 5ā²-exonuclease detection method, also called the TaqMan⢠assay, as set forth in U.S. Pat. Nos. 5,804,375; 5,538,848; 5,487,972; and 5,210,015, each of which is hereby incorporated by reference in its entirety. In the TaqMan⢠assay, a modified probe, typically 10-25 nucleic acids in length, is employed during PCR which binds intermediate to or between the two members of the amplification primer pair. The modified probe possesses a reporter and a quencher and is designed to generate a detectable signal to indicate that it has hybridized with the target nucleic acid sequence during PCR. As long as both the reporter and the quencher are on the probe, the quencher stops the reporter from emitting a detectable signal. However, as the polymerase extends the primer during amplification, the intrinsic 5ā² to 3ā² nuclease activity of the polymerase degrades the probe, separating the reporter from the quencher, and enabling the detectable signal to be emitted. Generally, the amount of detectable signal generated during the amplification cycle is proportional to the amount of product generated in each cycle.
It is well known that the efficiency of quenching is a strong function of the proximity of the reporter and the quencher, i.e., as the two molecules get closer, the quenching efficiency increases. As quenching is strongly dependent on the physical proximity of the reporter and quencher, the reporter and the quencher are preferably attached to the probe within a few nucleotides of one another, usually within 30 nucleotides of one another, more preferably with a separation of from about 6 to 16 nucleotides. Typically, this separation is achieved by attaching one member of a reporter-quencher pair to the 5ā² end of the probe and the other member to a nucleotide about 6 to 16 nucleotides away, in some cases at the 3ā² end of the probe.
Separate detection probes can also be omitted in amplification/detection methods, e.g., by performing a real time amplification reaction that detects product formation by modification of the relevant amplification primer upon incorporation into a product, incorporation of labeled nucleotides into an amplicon, or by monitoring changes in molecular rotation properties of amplicons as compared to unamplified precursors (e.g., by fluorescence polarization).
Further, it will be appreciated that amplification is not a requirement for marker detectionāfor example, one can directly detect unamplified genomic DNA simply by performing a Southern blot on a sample of genomic DNA. Procedures for performing Southern blotting, amplification e.g., (PCR, LCR, or the like), and many other nucleic acid detection methods are well established and are taught, e.g., in Sambrook, et al., Molecular CloningāA Laboratory Manual (3d ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 2000 (āSambrookā); Current Protocols in Molecular Biology, F. M. Ausubel, et al., eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (supplemented through 2002) (āAusubelā)) and PCR Protocols A Guide to Methods and Applications (Innis, et al., eds) Academic Press Inc. San Diego, Calif. (1990) (Innis). Additional details regarding detection of nucleic acids in plants can also be found, e.g., in Plant Molecular Biology (1993) Croy (ed.) BIOS Scientific Publishers, Inc.
Other techniques for detecting SNPs can also be employed, such as allele specific hybridization (ASH). ASH technology is based on the stable annealing of a short, single-stranded, oligonucleotide probe to a completely complementary single-stranded target nucleic acid. Detection is via an isotopic or non-isotopic label attached to the probe. For each polymorphism, two or more different ASH probes are designed to have identical DNA sequences except at the polymorphic nucleotides. Each probe will have exact homology with one allele sequence so that the range of probes can distinguish all the known alternative allele sequences. Each probe is hybridized to the target DNA. With appropriate probe design and hybridization conditions, a single-base mismatch between the probe and target DNA will prevent hybridization.
Real-time amplification assays, including MB or TaqMan⢠based assays, are especially useful for detecting SNP alleles. In such cases, probes are typically designed to bind to the amplicon region that includes the SNP locus, with one allele-specific probe being designed for each possible SNP allele. For instance, if there are two known SNP alleles for a particular SNP locus, āAā or āC,ā then one probe is designed with an āAā at the SNP position, while a separate probe is designed with a āCā at the SNP position. While the probes are typically identical to one another other than at the SNP position, they need not be. For instance, the two allele-specific probes could be shifted upstream or downstream relative to one another by one or more bases. However, if the probes are not otherwise identical, they should be designed such that they bind with approximately equal efficiencies, which can be accomplished by designing under a strict set of parameters that restrict the chemical properties of the probes. Further, a different detectable label, for instance a different reporter-quencher pair, is typically employed on each different allele-specific probe to permit differential detection of each probe. In certain examples, each allele-specific probe for a certain SNP locus is 11-20 nucleotides in length, dual-labeled with a florescence quencher at the 3ā² end and either the 6-FAM (6-carboxyfluorescein) or VIC (4,7,2ā²-trichloro-7ā²-phenyl-6-carboxyfluorescein) fluorophore at the 5ā² end.
To effectuate SNP allele detection, a real-time PCR reaction can be performed using primers that amplify the region including the SNP locus, for instance the sequences listed in Table 4, the reaction being performed in the presence of all allele-specific probes for the given SNP locus. By then detecting signal for each detectable label employed and determining which detectable label(s) demonstrated an increased signal, a determination can be made of which allele-specific probe(s) bound to the amplicon and, thus, which SNP allele(s) the amplicon possessed. For instance, when 6-FAM- and VIC-labeled probes are employed, the distinct emission wavelengths of 6-FAM (518 nm) and VIC (554 nm) can be captured. A sample that is homozygous for one allele will have fluorescence from only the respective 6-FAM or VIC fluorophore, while a sample that is heterozygous at the analyzed locus will have both 6-FAM and VIC fluorescence.
The KASParĀ® and IlluminaĀ® Detection Systems are additional examples of commercially-available marker detection systems. KASParĀ® is a homogeneous fluorescent genotyping system which utilizes allele specific hybridization and a unique form of allele specific PCR (primer extension) in order to identify genetic markers (e.g. a particular SNP locus associated with Phytophthora tolerance). IlluminaĀ® detection systems utilize similar technology in a fixed platform format. The fixed platform utilizes a physical plate that can be created with up to 384 markers. The IlluminaĀ® system is created with a single set of markers that cannot be changed and utilizes dyes to indicate marker detection.
These systems and methods represent a wide variety of available detection methods which can be utilized to detect markers associated with tolerance or improved tolerance to Phytophthora, but any other suitable method could also be used.
Introgression of Phytophthora tolerance into non-tolerant or less-tolerant soybean germplasm is provided. Any method for introgressing one or more marker loci into soybean plants known to one of skill in the art can be used. Typically, a first soybean germplasm that contains Phytophthora tolerance derived from a particular marker locus, haplotype or marker profile and a second soybean germplasm that lacks such tolerance derived from the marker locus, haplotype or marker profile are provided. The first soybean germplasm may be crossed with the second soybean germplasm to provide progeny soybean germplasm. These progeny germplasm are screened to determine the presence of Phytophthora tolerance derived from the marker locus, haplotype or marker profile, and progeny that tests positive for the presence of tolerance derived from the marker locus, haplotype or marker profile are selected as being soybean germplasm into which the marker locus, haplotype or marker profile has been introgressed. Methods for performing such screening are well known in the art and any suitable method can be used.
One application of MAS is to use the tolerance markers, haplotypes or marker profiles to increase the efficiency of an introgression or backcrossing effort aimed at introducing a tolerance trait into a desired (typically high yielding) background. In marker assisted backcrossing of specific markers from a donor source, e.g., to an elite genetic background, one selects among backcross progeny for the donor trait and then uses repeated backcrossing to the elite line to reconstitute as much of the elite background's genome as possible.
Thus, the markers and methods can be utilized to guide marker assisted selection or breeding of soybean varieties with the desired complement (set) of allelic forms of chromosome segments associated with superior agronomic performance (tolerance, along with any other available markers for yield, disease tolerance, etc.). Any of the disclosed marker loci, marker alleles, haplotypes, or marker profiles can be introduced into a soybean line via introgression, by traditional breeding (or introduced via transformation, or both) to yield a soybean plant with superior agronomic performance. The number of alleles associated with tolerance that can be introduced or be present in a soybean plant ranges from 1 to the number of alleles disclosed herein, each integer of which is incorporated herein as if explicitly recited.
The markers and methods provided herein can also be utilized to guide marker assisted selection or breeding of soybean varieties comprising other Phytophthora tolerance markers or alleles to create a molecular stack for Phytophthora tolerance. Any of the marker loci provided herein can be introduced into a soybean line having one or more of the Phytophthora tolerance alleles rps1, rps2, rps3, rps4, rps5, rps6, rps7 or rps8. For example, the stacked combinations can include Rps1c and Rps3; Rps1k and Rps6; Rps1k and Rps3; Rps1c, Rps1k and Rps3; or Rps1c, Rps1k and Rps6. Rps1c, Rps1k and Rps6; Rps1c and Rps1k; or any combination of one or more of Rps1a, Rps1b, Rps1c, Rps1d, Rps1k, Rps2, Rps3a, Rps3b, Rps3c, Rps4, Rps5, Rps6, Rps7, Rps8 and Rps Yu25. The Rps loci are described, for example, in Sugimoto, Takuma, et al. āPathogenic diversity of Phytophthora sojae and breeding strategies to develop Phytophthora-resistant soybeans.ā Breeding Science 61.5 (2012): 511-522; Sun, S., et al. 2011. Characterization and mapping of RpsYu25, a novel resistance gene to Phytophthora sojae. Plant Breed. 30:139-143; and Gordon, S. G., et al. 2007. Molecular marker analysis of soybean plant introductions with resistance to Phytophthora sojae. Phytopathology 97:113-118; each of which is herein incorporated by reference in their entirety.
In one embodiment, any one or more of the marker loci provided herein can be stacked with the rps1 allele. In another embodiment, any one or more of the marker loci provided herein can be stacked with the rps2 allele. In another embodiment, any one or more of the marker loci provided herein can be stacked with the rps3 allele. In yet another embodiment, any one or more of the marker loci provided herein can be stacked with the rps6 allele.
This also provides a method of making a progeny soybean plant and these progeny soybean plants, per se. The method comprises crossing a first parent soybean plant with a second soybean plant and growing the female soybean plant under plant growth conditions to yield soybean plant progeny. Methods of crossing and growing soybean plants are well within the ability of those of ordinary skill in the art. Such soybean plant progeny can be assayed for alleles associated with tolerance and, thereby, the desired progeny selected. Such progeny plants or seed can be sold commercially for soybean production, used for food, processed to obtain a desired constituent of the soybean, or further utilized in subsequent rounds of breeding. At least one of the first or second soybean plants is a soybean plant in that it comprises at least one of the marker loci or marker profiles, such that the progeny are capable of inheriting the marker locus or marker profile.
Often, a method is applied to at least one related soybean plant such as from progenitor or descendant lines in the subject soybean plants pedigree such that inheritance of the desired tolerance can be traced. The number of generations separating the soybean plants being subject to the methods provided herein will generally be from 1 to 20, commonly 1 to 5, and typically 1, 2, or 3 generations of separation, and quite often a direct descendant or parent of the soybean plant will be subject to the method (i.e., 1 generation of separation).
Genetic diversity is important for long term genetic gain in any breeding program. With limited diversity, genetic gain will eventually plateau when all of the favorable alleles have been fixed within the elite population. One objective is to incorporate diversity into an elite pool without losing the genetic gain that has already been made and with the minimum possible investment. MAS provides an indication of which genomic regions and which favorable alleles from the original ancestors have been selected for and conserved over time, facilitating efforts to incorporate favorable variation from exotic germplasm sources (parents that are unrelated to the elite gene pool) in the hopes of finding favorable alleles that do not currently exist in the elite gene pool.
For example, the markers, haplotypes, primers, probes, and marker profiles can be used for MAS in crosses involving eliteĆexotic soybean lines by subjecting the segregating progeny to MAS to maintain major yield alleles, along with the tolerance marker alleles herein.
As an alternative to standard breeding methods of introducing traits of interest into soybean (e.g., introgression), transgenic approaches can also be used to create transgenic plants with the desired traits. In these methods, exogenous nucleic acids that encode a desired marker loci, marker profile or haplotype are introduced into target plants or germplasm. For example, a nucleic acid that codes for a tolerance trait is cloned, e.g., via positional cloning, and introduced into a target plant or germplasm.
Experienced plant breeders can recognize tolerant soybean plants in the field, and can select the tolerant individuals or populations for breeding purposes or for propagation. In this context, the plant breeder recognizes ātolerantā and ānon-tolerantā or āsusceptibleā soybean plants. However, plant tolerance is a phenotypic spectrum consisting of extremes in tolerance and susceptibility, as well as a continuum of intermediate tolerance phenotypes. Evaluation of these intermediate phenotypes using reproducible assays are of value to scientists who seek to identify genetic loci that impart tolerance, to conduct marker assisted selection for tolerant populations, and to use introgression techniques to breed a tolerance trait into an elite soybean line, for example.
By āimproved toleranceā is intended that the plants show a decrease in the disease symptoms that are the outcome of plant exposure to Phytophthora. That is, the damage caused by Phytophthora infection is prevented, or alternatively, the disease symptoms caused by Phytophthora infection is minimized or lessened. Thus, improved tolerance to Phytophthora can result in reduction of the disease symptoms by at least about 2% to at least about 6%, at least about 5% to about 50%, at least about 10% to about 60%, at least about 30% to about 70%, at least about 40% to about 80%, or at least about 50% to about 90% or greater. Hence, the methods provided herein can be utilized to protect plants from Phytophthora infection.
Screening and selection of Phytophthora tolerant soybean plants may be performed, for example, by exposing plants to Phytophthora and selecting those plants showing tolerance to Phytophthora. Various assays can be used to measure tolerance or improved tolerance to Phytophthora. For example, Phytophthora tolerance can be determined by visual observations after plant exposure to a particular race of Phytophthora.
Non-limiting examples of Phytophthora tolerance phenotypic screening are described in detail below.
PHYTOPHTHORA FIELD TOLERANCE. Tolerance to Phytophthora root rot is rated on a scale of 1 to 9, with a score of 1 indicating the plants have no tolerance to Phytophthora, ranging to a score of 9 being the best or highest tolerance. PRTLAB indicates the tolerance was scored using plants in lab assay experiments. Preliminary scores are reported as double digits, for example ā55ā indicates a preliminary score of 5 on the scale of 1 to 9.
PHYTOPHTHORA RESISTANCE GENE (Rps). Various Phytophthora resistance genes are known and include but are not limited to: Rps1-a=resistance to races 1-2, 10-11, 13-8, 24; Rps1-c=resistance to races 1-3, 6-11, 13, 15, 17, 21, 23, 24, 26, 28-30, 32, 34, 36; Rps1-k=resistance to races 1-11, 13-15, 17, 18, 21-24, 26, 36, 37; Rps3-a=resistance to races 1-5, 8, 9, 11, 13, 14, 16, 18, 23, 25, 28, 29, 31-35, 39-41, 43-45, 47-52, 54; Rps3-c=resistance to races 1-4, 10-16, 18-36, 38-54; Rps6=resistance to races 1-4, 10, 12, 14-16, 18-21, 25, 28, 33-35; and, Rps8=resistance to races 1-5, 9, 13-15, 21, 25, 29, 32. RESISTANCE. As used herein, resistance is synonymous with tolerance and is used to describe the ability of a plant to withstand exposure to an insect, disease, herbicide, environmental stress, or other condition. A resistant plant variety will be able to better withstand the insect, disease pathogen, herbicide, environmental stress, or other condition as compared to a non-resistant or wild-type variety.
Genes that confer resistance to Phytophthora Root Rot, such as Rps1, Rps1-a, Rps1-b, Rps1-c, Rps1-d, Rps1-e, Rps1-k, Rps2, Rps3-a, Rps3-b, Rps3-c, Rps4, Rps5, Rps6, Rps7, Rps8, and other Rps genes. See, for example, Shoemaker et al. āPhytophthora Root Rot Resistance Gene Mapping in Soybeanā, Plant Genome IV Conference, San Diego, Calif. (1995).
Phytophthora sojae is maintained by refrigeration on agar. It is transferred to fresh agar plates to make inoculum for the test.
Test and check lines are grown in growth chambers under controlled light and controlled temperature conditions. The lines are inoculated at the seedling stage by injecting mycelium into the hypocotyl. The unclassified lines are incubated in conditions conducive for Phytophthora infection, and then evaluated when the known susceptible controls die. The plants can be inoculated with at least one of: Phytophthora race 4 (PMG04); Phytophthora race 7 (PMG07); and/or Phytophthora race 25 (PMG25). Experiments are scored 2-3 days following inoculation, depending on the reaction of susceptible and resistant checks. Infection phenotypes are classified based on the number of seedlings alive divided by the total number of seedlings inoculated. For example,
9=9 of 9 plants alive and healthy
5=5 of 9 plants alive and healthy
1=1 or 0 of 9 plants alive and healthy
M=no or poor germ (<5 seeds germinate)
The level of tolerance of soybean varieties to Phytophthora Root Rot can be evaluated and characterized in the field. Phytophthora Root Rot is well known to those skilled in the art (see, e.g., Schmitthenner and Walker, Tolerance versus resistance for control of Phytophthora root rot of soybeans. p. 35-44 In H. D. Loden and D. Wilkenson (ed.) Proceedings of the 9th Soybean Seed Research Conference, Chicago, Ill. 13-14 Dec. 1979. American Seed Trade Association, Washington, D.C.; Walker and Schmitthenner (1984) Crop Science 24:487-489; and, Schmitthenner and Bhat. 1994. Useful methods for studying Phytophthora in the laboratory. Department of Plant Pathology. Ohio Agricultural Research and Development Center. Circular 143).
For testing, seed samples from experimental and check lines are not treated with any seed treatment. A known set of differential checks is used. One or more races of Phytophthora are chosen. Normally, at least Race 25 Phytophthora sojae is used. Experimental lines and checks are sown in vermiculite in trays that are inoculated with mycelium. The trays are moved outside to a location covered with 30% sunlight block netting.
Differential checks with low tolerance show symptoms 1-2 weeks after planting. Experimental lines are scored approximately three weeks after planting by removing the plants and root mass intact from the vermiculite. The vermiculite is removed by tapping the roots, without damaging the roots. All experimental entries are scored relative to the appearance of the root system of one or more check variety(s) and the known performance chart score of each check. Scores are assigned on a scale of 1-9, and are relative to the differential checks and based upon total root mass, general appearance of plants and roots, and extent of necrosis.
1=all plants die after emerging
2=50% less root mass than 9306
3=equal to 9306
4=50% less root mass than Conrad, 25% more than 9306
5=25% less root mass than Conrad
6=equal to Conrad
7=equal to 92B38 and/or 93B67
8=equal to 93B45
9=equal to 9242
In some examples, a kit or an automated system for detecting marker loci, haplotypes, and marker profiles, and/or correlating the marker loci, haplotypes, and marker profiles with a desired phenotype (e.g., Phytophthora tolerance) are provided. As used herein, ākitā refers to a set of reagents for the purpose of performing the various methods of detecting or identifying herein, more particularly, the identification and/or the detection of a soybean plant or germplasm having tolerance or improved tolerance to Phytophthora.
In one embodiment, a kit for detecting or selecting at least one soybean plant or soybean germplasm with tolerance or improved tolerance to Phytophthora infection is provided. Such a kit comprises (a) primers or probes for detecting one or more marker loci associated with tolerance to Phytophthora infection, wherein at least one of the primers and probes in the kit are capable of detecting a marker locus, wherein the marker locus is: (i) associated with the Rps1a, Rsp1c, Rps1d or Rps1k loci on linkage group N; (ii) associated with Rps2 locus on linkage group J; (iii) associated with the Rps3a or Rps3c loci on linkage group F; or (iv) associated with the Rps6 locus on linkage group G; and (b) instructions for using the primers or probes for detecting the one or more marker loci and correlating the detected marker loci with predicted tolerance to Phytophthora infection.
In a specific embodiment, the primers and probes of the kit are capable of detecting a marker locus comprising: (a) S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N; (b) S07963-2, S07372-1, S00009-01, S08013-1, the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N, such as, for example, the markers provided in FIG. 1A-C; (c) S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J, such as, for example, the markers provided in FIG. 3 A-C; (d) S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F, such as, for example, those markers provided in FIG. 2 A-D; or (e) S08442-1, S08341-1 or a marker closely linked thereto on linkage group G, such as, for example, the markers provided in FIG. 4 A-E.
Thus, a typical kit or system can include a set of marker probes or primers configured to detect at least one favorable allele of one or more marker loci associated with tolerance to Phytophthora infection, for instance a favorable marker locus, haplotype or marker profile. These probes or primers can be configured, for example, to detect the marker loci noted in the tables and examples herein, e.g., using any available allele detection format, such as solid or liquid phase array based detection, microfluidic-based sample detection, etc. The systems and kits can further include packaging materials for packaging the probes, primers, or instructions, controls such as control amplification reactions that include probes, primers or template nucleic acids for amplifications, molecular size markers, or the like.
A typical system can also include a detector that is configured to detect one or more signal outputs from the set of marker probes or primers, or amplicon thereof, thereby identifying the presence or absence of the allele. A wide variety of signal detection apparatus are available, including photo multiplier tubes, spectrophotometers, CCD arrays, scanning detectors, phototubes and photodiodes, microscope stations, galvo-scans, microfluidic nucleic acid amplification detection appliances and the like. The precise configuration of the detector will depend, in part, on the type of label used to detect the marker allele, as well as the instrumentation that is most conveniently obtained for the user. Detectors that detect fluorescence, phosphorescence, radioactivity, pH, charge, absorbance, luminescence, temperature, magnetism or the like can be used. Typical detector examples include light (e.g., fluorescence) detectors or radioactivity detectors. For example, detection of a light emission (e.g., a fluorescence emission) or other probe label is indicative of the presence or absence of a marker allele. Fluorescent detection is generally used for detection of amplified nucleic acids (however, upstream and/or downstream operations can also be performed on amplicons, which can involve other detection methods). In general, the detector detects one or more label (e.g., light) emission from a probe label, which is indicative of the presence or absence of a marker allele. The detector(s) optionally monitors one or a plurality of signals from an amplification reaction. For example, the detector can monitor optical signals which correspond to āreal timeā amplification assay results.
System or kit instructions that describe how to use the system or kit or that correlate the presence or absence of the favorable allele with the predicted tolerance are also provided. For example, the instructions can include at least one look-up table that includes a correlation between the presence or absence of the favorable alleles, haplotypes, or marker profiles and the predicted tolerance. The precise form of the instructions can vary depending on the components of the system, e.g., they can be present as system software in one or more integrated unit of the system (e.g., a microprocessor, computer or computer readable medium), or can be present in one or more units (e.g., computers or computer readable media) operably coupled to the detector. As noted, in one typical example, the system instructions include at least one look-up table that includes a correlation between the presence or absence of the favorable alleles and predicted tolerance. The instructions also typically include instructions providing a user interface with the system, e.g., to permit a user to view results of a sample analysis and to input parameters into the system.
Isolated polynucleotides comprising the nucleic acid sequences of the primers and probes provided herein are also encompassed herein. In one embodiment, the isolated polynucleotide comprises a polynucleotide capable of detecting a marker locus of the soybean genome comprising (a) S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N; (b) S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N; (c) S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J; (d) S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; or (e) S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
In specific embodiments, the isolated polynucleotide comprises: (a) a polynucleotide comprising SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 1339 or 1340; (b) a polynucleotide comprising SEQ ID NOs: 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 1341 or 1342; (c) a polynucleotide having at least 90% sequence identity to SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 1339, 1340, 1341 or 1342; or (d) a polynucleotide comprising at least 10 contiguous nucleotides of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 1339, 1340, 1341 or 1342.
In certain embodiments, the isolated nucleic acids are capable of hybridizing under stringent conditions to nucleic acids of a soybean cultivar tolerant to Phytophthora, for instance to particular SNPs that comprise a marker locus, haplotype or marker profile.
As used herein, a substantially identical or complementary sequence is a polynucleotide that will specifically hybridize to the complement of the nucleic acid molecule to which it is being compared under high stringency conditions. A polynucleotide is said to be the ācomplementā of another polynucleotide if they exhibit complementarity. As used herein, molecules are said to exhibit ācomplete complementarityā when every nucleotide of one of the polynucleotide molecules is complementary to a nucleotide of the other. Two molecules are said to be āminimally complementaryā if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional ālow-stringencyā conditions. Similarly, the molecules are said to be ācomplementaryā if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional āhigh-stringencyā conditions.
Appropriate stringency conditions which promote DNA hybridization, for example, 6Ćsodium chloride/sodium citrate (SSC) at about 45° C., followed by a wash of 2ĆSSC at 50° C., are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. Typically, stringent conditions for hybridization and detection will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37° C., and a wash in 1Ć to 2ĆSSC (20ĆSSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55° C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37° C., and a wash in 0.5Ć to 1ĆSSC at 55 to 60° C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1ĆSSC at 60 to 65° C. Optionally, wash buffers may comprise about 0.1% to about 1% SDS. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours. The duration of the wash time will be at least a length of time sufficient to reach equilibrium.
Non-limiting examples of methods and compositions disclosed herein are as follows:
1. A method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection, the method comprising detecting in the genome of said first soybean plant or in the genome of said first soybean germplasm at least one marker locus that is associated with the tolerance, wherein:
(a) the at least one marker locus comprises S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N;
(b) the at least one marker locus comprises S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N;
(c) the at least one marker locus comprises S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J;
(d) the at least one marker locus comprises S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; or
(e) the at least one marker locus comprises S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
2. The method of embodiment 1, wherein at least two marker loci are detected.
3. The method of embodiment 2, wherein the at least two marker loci comprise a haplotype that is associated with said tolerance.
4. The method of embodiment 2, wherein the at least two marker loci comprise a marker profile that is associated with said tolerance.
5. The method of any one of embodiments 1-4, wherein the germplasm is a soybean variety.
6. The method of any one of embodiments 1-5, wherein the method further comprises selecting the first soybean plant or first soybean germplasm or a progeny thereof having the at least one marker locus.
7. The method of embodiment 6, further comprising crossing the selected first soybean plant or first soybean germplasm with a second soybean plant or second soybean germplasm.
8. The method of embodiment 7, wherein the second soybean plant or second soybean germplasm comprises an exotic soybean strain or an elite soybean strain.
9. The method of any one of embodiments 1-8, wherein the detecting comprises DNA sequencing of at least one of said marker loci.
10. The method of any one of embodiments 1-8, wherein the detecting comprises amplifying at least one of said marker loci and detecting the resulting amplified marker amplicon.
11. The method of embodiment 10, wherein the amplifying comprises:
a) admixing an amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm, wherein the primer or primer pair is complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus, and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template; and
b) extending the primer or primer pair in a DNA polymerization reaction comprising a DNA polymerase and a template nucleic acid to generate at least one amplicon.
12. The method of embodiment 11, wherein said method comprises amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs:155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393 or 1394.
13. The method of embodiment 11, wherein said primer or primer pair comprises a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393 or 1394 or complements thereof.
14. The method of embodiment 13, wherein said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 1339, 1340 or variants or fragments thereof.
15. The method of embodiment 14, wherein said primer pair comprises:
a) SEQ ID NO: 1 and SEQ ID NO:2;
b) SEQ ID NO: 9 and SEQ ID NO:10;
c) SEQ ID NO: 20 and SEQ ID NO:21;
d) SEQ ID NO: 22 and SEQ ID NO: 23;
e) SEQ ID NO: 24 and SEQ ID NO: 25;
f) SEQ ID NO: 36 and SEQ ID NO: 37;
g) SEQ ID NO: 38 and SEQ ID NO: 39; or
h) SEQ ID NO: 1339 and SEQ ID NO: 1340.
16. The method of embodiment 11, wherein said method comprises amplifying a variant or fragment of SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179 or 180.
17. The method of embodiment 11, wherein said primer or primer pair comprises a variant or fragment of SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof.
18. The method of embodiment 17, wherein said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or variants or fragments thereof.
19. The method of embodiment 18, wherein said primer pair comprises:
a) SEQ ID NO: 40 and SEQ ID NO: 41;
b) SEQ ID NO: 46 and SEQ ID NO: 47;
c) SEQ ID NO: 52 and SEQ ID NO: 53;
d) SEQ ID NO: 58 and SEQ ID NO: 59;
e) SEQ ID NO: 64 and SEQ ID NO: 65; or
f) SEQ ID NO: 75 and SEQ ID NO: 76.
20. The method of embodiment 11, wherein said method comprises amplifying a variant or fragment of SEQ ID NOs: 181, 182, 183, 184, 185 or 186.
21. The method of embodiment 11, wherein said primer or primer pair comprises a variant or fragment of SEQ ID NOs: 181, 182, 183, 184, 185, 186 or complements thereof.
22. The method of embodiment 21, wherein said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 or variants or fragments thereof.
23. The method of embodiment 22, wherein said primer pair comprises:
a) SEQ ID NO: 81 and SEQ ID NO: 82;
b) SEQ ID NO: 89 and SEQ ID NO: 90; or
c) SEQ ID NO: 91 and SEQ ID NO: 92.
24. The method of embodiment 11, wherein said method comprises amplifying a variant or fragment of SEQ ID NOs: 187, 188, 189 or 190.
25. The method of embodiment 11, wherein said primer or primer pair comprises a variant or fragment of SEQ ID NOs: 187, 188, 189, 190 or complements thereof.
26. The method of embodiment 25, wherein said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104 or variants or fragments thereof.
27. The method of embodiment 26, wherein said primer pair comprises:
a) SEQ ID NO: 95 and SEQ ID NO: 96; or
b) SEQ ID NO: 101 and SEQ ID NO: 102.
28. The method of embodiment 11, wherein the method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified.
29. The method of embodiment 28, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393 or 1394 or complements thereof.
30. The method of embodiment 29, wherein the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341 or 1342.
31. The method of embodiment 28, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof.
32. The method of embodiment 31, wherein the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138 or 139.
33. The method of embodiment 28, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of SEQ ID NOs: 181, 182, 183, 184, 185, 186 or complements thereof.
34. The method of embodiment 33, wherein the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 140, 141, 142, 143, 144, 145, 146, 147, 148 or 149.
35. The method of embodiment 28, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of SEQ ID NOs: 187, 188, 189, 190 or complements thereof.
36. The method of embodiment 35, wherein the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 150, 151, 152, 153 or 154.
37. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N.
38. The isolated polynucleotide of embodiment 37, wherein the polynucleotide comprises:
(a) a polynucleotide comprising SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 1339 or 1340;
(b) a polynucleotide comprising SEQ ID NOs: 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341 or 1342;
(c) a polynucleotide having at least 90% sequence identity to the polynucleotides set forth in parts (a) or (b); or
(d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in parts (a) or (b).
39. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J.
40. The isolated polynucleotide of embodiment 39, wherein the polynucleotide comprises:
(a) a polynucleotide comprising SEQ ID NOs: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77 or 78;
(b) a polynucleotide comprising SEQ ID NOs: 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138 or 139;
(c) a polynucleotide having at least 90% sequence identity to the polynucleotides set forth in parts (a) or (b); or
(d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in parts (a) or (b).
41. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F.
42. The isolated polynucleotide of embodiment 41, wherein the polynucleotide comprises:
(a) a polynucleotide comprising SEQ ID NOs: 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 or 92;
(b) a polynucleotide comprising SEQ ID NOs: 140, 141, 142, 143, 144, 145, 146, 147, 148 or 149;
(c) a polynucleotide having at least 90% sequence identity to the polynucleotides set forth in parts (a) or (b); or
(d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in parts (a) or (b).
43. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
44. The isolated polynucleotide of embodiment 43, wherein the polynucleotide comprises:
(a) a polynucleotide comprising SEQ ID NOs: 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103 or 104;
(b) a polynucleotide comprising SEQ ID NOs: 150, 151, 152, 153 or 154;
(c) a polynucleotide having at least 90% sequence identity to the polynucleotides set forth in parts (a) or (b); or
(d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in parts (a) or (b).
45. A kit for detecting or selecting at least one soybean plant or soybean germplasm with tolerance or improved tolerance to Phytophthora infection, the kit comprising:
(a) primers or probes for detecting one or more marker loci associated with tolerance to Phytophthora infection, wherein the primers or probes are capable of detecting a marker locus, wherein:
(b) instructions for using the primers or probes for detecting the one or more marker loci and correlating the detected marker loci with predicted tolerance to Phytophthora infection.
The following examples are offered to illustrate, but not to limit the claimed invention. It is understood that the examples and embodiments described herein are for illustrative purposes only, and persons skilled in the art will recognize various reagents or parameters that can be altered without departing from the spirit of the invention or the scope of the appended claims.
Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the Rps1 locus on linkage group N (ch 3). Markers were screened against various known resistant and susceptible parents.
A marker to locus S08291-1 was developed to identify alleles associated with the phytophthora resistance phenotype, this marker detects a G/A polymorphism associated with Rps1a. A panel of lines used for development for markers to identify Rps1c included lines with Rps1k and Rps1a, and provided information for alleles in the Rps1a genomic region. During development, this marker was validated and confirmed against a panel of about 30 resistant and susceptible varieties which included proprietary experimental lines, proprietary commercial lines, and public lines. Further development and testing was done to optimize the marker system for high throughput analysis of soybean. From this testing, S08291-1-Q5 was chosen for high throughput analysis needs, but other versions can be used to detect the polymorphism. This marker was used to fingerprint about 2000 lines.
Genomic DNA was extracted for testing using a standard CTAB protocol and exemplary amplification conditions are described below.
Cycle settings: Taqman⢠assay
| 94° C. | ā2 min | ā1 cycle | |
| 94° C. | 30 sec | 40 cycles | |
| 60° C. | 60 sec | ||
| H2O | 3.625 | |
| hottub buffer | 0.5 | |
| dNTP (2.5 mM each) | 0.375 | |
| primer1 + primer2 (10 uM each) | 0.15 | |
| primer3 + primer4 (10 uM each) | 0.15 | |
| probe 1 (10 uM) | 0.05 | |
| Probe 2 (10 uM) | 0.05 | |
| hottub enzyme | 0.025 | |
| Invitrogen rox dye (50X) | 0.075 | |
| DNA | 0.05 | |
| Total | 5.05 | |
Several populations were developed in order to identify and characterize Phytophthora resistance loci and polymorphisms for marker development. The following biparental crosses were made and phenotyped for the Phytophthora races (PMG Race) indicated, as shown in Table 6.
| TABLE 6 | ||||
| Parent 1 | Parent 2 | Gene | Entries | PMG Race(s) |
| 92M61 | 93Y13 | Deletion/Rps1c | 120 | 7 |
| 91Y20 | 93Y13 | Rps1k/Rps1c | 92 | 7 & 4 |
| 93M42 | XB18S09 | Rps1a/Rps1c | 92 | 7 & 1 |
| 92M61 | XB18S09 | Deletion/Rps1c | 92 | 7 |
Markers to the S07292-1 locus and the S08242 locus were developed to identify alleles associated with the Phytophthora resistance phenotype associated with Rps1c. During development, these markers were validated and confirmed against a panel of about 30 varieties which included proprietary experimental lines, proprietary commercial lines, and public lines. Further development and testing was done to optimize each marker system for high throughput analysis of soybean.
Rps1d was mapped near Rps1k and may be an alternate allele of the Rps1 locus (Sugimoto et al., 2008. Identification of SSR markers linked to the Phytophthora resistance gene Rps1-d in soybean (2008) Plant Breeding, 127 (2): 154-159). SNPs that could be used for marker assisted selection of Rps1d were identified near the Rps1k region through sequencing of amplicons generated using extracted DNA from EX23U07, a progeny of the Rps1d donor PI103091. EX23U07 has the minor allele at SNP, S16592-001, which was found to be at low allele frequency across a diverse set of germplasm (Ė6.2%, see table below). The Taqman assay S16592-001-Q001 was designed to assay this SNP and will be useful for MAS of Rps1d.
| TABLE 7 |
| The following lines were genotyped using the Taqman marker |
| S16592-001-Q001. Column three indicates the predicted allele |
| at the Rps1 locus within the respective line based on |
| phenotypic screens of phytophthora resistance. |
| S16592- | |||
| Sample Name | 001 | Trait | |
| EX23U07 | A | Rps1d | |
| ARKSOY | A | Rps1c | |
| Ralsoy | A | Rps1c | |
| 91Y41 | A | Rps1c | |
| 91Y92 | A | Rps1c | |
| 92M81 | A | Rps1c | |
| 93M14 | A | Rps1c | |
| 93Y80 | A | Rps1c | |
| ARKSOY | A | Rps1c | |
| Ralsoy | A | Rps1c | |
| Sheyenne | A | ā | |
| 92B38 | T | None | |
| 92M33 | T | None | |
| 92M61 | T | None | |
| 92Y70 | T | None | |
| 93Y23 | T | None | |
| 93Y30 | T | None | |
| 93Y70 | T | None | |
| 93Y72 | T | None | |
| 93Y92 | T | None | |
| 94M80 | T | None | |
| 94Y50 | T | None | |
| 94Y70 | T | None | |
| 94Y80 | T | None | |
| 94Y90 | T | None | |
| 95M50 | T | None | |
| 95Y01 | T | None | |
| 95Y20 | T | None | |
| 95Y30 | T | None | |
| 95Y31 | T | None | |
| 90M01 | T | Rps1k | |
| 90M02 | T | Rps1k | |
| 90M91 | T | Rps1k | |
| 90M92 | T | Rps1k | |
| 90Y21 | T | Rps1k | |
| 90Y41 | T | Rps1k | |
| 90Y42 | T | Rps1k | |
| 90Y50 | T | Rps1k | |
| 90Y70 | T | Rps1k | |
| 91B42 | T | Rps1k | |
| 91M01 | T | Rps1k | |
| 91M13 | T | Rps1k | |
| 91M30 | T | Rps1k | |
| 91M41 | T | Rps1k | |
| 91M51 | T | Rps1k | |
| 91M61 | T | Rps1k | |
| 91Y20 | T | Rps1k | |
| 91Y21 | T | Rps1k | |
| 91Y70 | T | Rps1k | |
| 91Y72 | T | Rps1k | |
| 91Y80 | T | Rps1k | |
| 92B12 | T | Rps1k | |
| 92M02 | T | Rps1k | |
| 92M11 | T | Rps1k | |
| 92M21 | T | Rps1k | |
| 92M72 | T | Rps1k | |
| 92M76 | T | Rps1k | |
| 92M91 | T | Rps1k | |
| 92Y10 | T | Rps1k | |
| 92Y20 | T | Rps1k | |
| 92Y21 | T | Rps1k | |
| 92Y30 | T | Rps1k | |
| 92Y51 | T | Rps1k | |
| 92Y52 | T | Rps1k | |
| 92Y54 | T | Rps1k | |
| 92Y60 | T | Rps1k | |
| 92Y61 | T | Rps1k | |
| 92Y72 | T | Rps1k | |
| 92Y80 | T | Rps1k | |
| 92Y82 | T | Rps1k | |
| 92Y90 | T | Rps1k | |
| 92Y91 | T | Rps1k | |
| 93B82 | T | Rps1k | |
| 93B86 | T | Rps1k | |
| 93M11 | T | Rps1k | |
| 93M82 | T | Rps1k | |
| 93M92 | T | Rps1k | |
| 93M96 | T | Rps1k | |
| 93Y02 | T | Rps1k | |
| 93Y04 | T | Rps1k | |
| 93Y05 | T | Rps1k | |
| 93Y10 | T | Rps1k | |
| 93Y11 | T | Rps1k | |
| 93Y15 | T | Rps1k | |
| 93Y20 | T | Rps1k | |
| 93Y21 | T | Rps1k | |
| 93Y40 | T | Rps1k | |
| 93Y50 | T | Rps1k | |
| 93Y51 | T | Rps1k | |
| 93Y60 | T | Rps1k | |
| 93Y81 | T | Rps1k | |
| 93Y90 | T | Rps1k | |
| 93Y91 | T | Rps1k | |
| 93Y93 | T | Rps1k | |
| 94B73 | T | Rps1k | |
| 94M30 | T | Rps1k | |
| 94Y01 | T | Rps1k | |
| 94Y10 | T | Rps1k | |
| 94Y20 | T | Rps1k | |
| 94Y30 | T | Rps1k | |
| 94Y40 | T | Rps1k | |
| 94Y60 | T | Rps1k | |
| 94Y91 | T | Rps1k | |
| 95Y40 | T | Rps1k | |
| 93M42 | T | 1A | |
| 93Y82 | T | 1A | |
| 95Y10 | T | 1A | |
| KINGWA | T | Rps1k | |
| 9071 | T | Rps1c | |
| 9181 | T | Rps1c | |
| 900Y71 | T | Rps1c | |
| 90B43 | T | Rps1c | |
| 90B51 | T | Rps1c | |
| 90M60 | T | Rps1c | |
| 90M80 | T | Rps1c | |
| 90Y90 | T | Rps1c | |
| 94Y21 | T | Rps1c | |
| A1564 | T | ā | |
| A2943 | T | ā | |
| A3127 | T | ā | |
| A3733 | T | ā | |
| A4715 | T | ā | |
| A5979 | T | ā | |
| A6297 | T | ā | |
| ADAMS | T | ā | |
| BAVENDERSPECIALA | T | ā | |
| BLACKHAWK | T | ā | |
| Capital | T | ā | |
| CLARK | T | ā | |
| CLARK63 | T | ā | |
| CNS | T | ā | |
| DORMAN | T | ā | |
| Dunfield | T | ā | |
| ESSEX | T | ā | |
| FC31745 | T | ā | |
| FOWLER | T | ā | |
| Haberlandt | T | ā | |
| HAROSOY | T | ā | |
| HAWKEYE | T | ā | |
| Illini | T | ā | |
| JACKSON | T | ā | |
| Kanro | T | ā | |
| KS3406 | T | ā | |
| L15 | T | ā | |
| LEE | T | ā | |
| Lincoln | T | ā | |
| LP14575198 | T | ā | |
| MT95-123720 | T | ā | |
| Mukden | T | ā | |
| OGDEN | T | ā | |
| P2981 | T | ā | |
| Palmetto | T | ā | |
| Patoka | T | ā | |
| Peking | T | ā | |
| PERRY | T | ā | |
| PI084674 | T | ā | |
| PI171442 | T | ā | |
| PI180501 | T | ā | |
| PI248404 | T | ā | |
| PI391589 | T | ā | |
| PI424195B | T | ā | |
| PI437151 | T | ā | |
| PI54610 | T | ā | |
| PI605891B | T | ā | |
| PI81041 | T | ā | |
| PI84946-2 | T | ā | |
| PI88788 | T | ā | |
| PI91110-1 | T | ā | |
| Pintado | T | ā | |
| Richland | T | ā | |
| S-100 | T | ā | |
| SENECA | T | ā | |
| ST2250 | T | ā | |
| ST2660 | T | ā | |
| Tokyo | T | ā | |
| WAYNE | T | ā | |
| Williams | T | ā | |
Markers to loci S00009-1, S07963-2, and S08013 were developed in order to characterize and identify lines having a Rps1k resistance allele. It was observed that over time marker S00009-01-A did not always identify lines known to have Rps1k. It was hypothesized that this could be due to a recombination event in the region. A new target region was selected near the Rps1k locus and sequenced. Markers S07963-2-Q1 and S08013-1Q were designed based on the SNP profile of the sequenced region. These markers were tested on a panel of public and proprietary lines which included known Rps1k lines, susceptible lines, and other test lines. The allele and haplotype data are summarized below in Table 8.
| TABLE 8 | ||||
| # | ||||
| Phenotype | lines | S00009-01-A | S07963-2-Q1 | S08013-1-Q1 |
| 1k | 5 | C | T | C |
| SUS | 17 | T | C | T |
| 1k + 3a | C | T | C | |
| 1k | 1 | ā | ā | ā |
| 1k + unknown | 1 | C | T | C |
| Unknown | 5 | T | C | T |
| 1k | 1 | T | T | C |
| SUS | 3 | C | C | T |
Markers S07963-2-Q1 and S08013-1Q were further evaluated and validated against four F3 mapping populations using the following amplification conditions.
| 94° C. | 10 min | ā1 cycle | |
| 94° C. | 30 sec | 40 cycles | |
| 60° C. | 60 sec | 40 cycles | |
| DNA (dried down) | 16 ng | |
| Water | 2.42 | |
| KlearKall Mastermix | 2.5 | |
| Forward Primer (100 μm) | 0.0375 | |
| Reverse Primer (100 μm) | 0.0375 | |
| Probe 1 (100 μm) | 0.005 | |
| Probe 2 (100 μm) | 0.005 | |
| Total | 5 | |
Using a case-control association analysis, the Rps1k locus which conditions variation in phytophthora root rot resistance, was fine-mapped between 3915646-4533559 bp on Gm03 (Lg N). A set of 581 SNPs were identified in this region that perfectly differentiate resistant from susceptible lines. These markers are ideal candidates for marker-assisted selection of resistance to phytophthora root rot from the Rps1k locus.
Phenotypic data from lab screening for Phytophthora resistance was used in the study. DNA was prepped using standard Illumina TruSeq Chemistry. Selected resistant and susceptible lines formed the case groups and were sequenced to Ė0.5-40x genome coverage on an Illumina HiSeq2000. SNPs were called using a proprietary software to automate the process, missing data was imputed using a separate proprietary software. Haploview was used to conduct a case-control association analysis on a set of 15537 SNPs identified in the region from 34000026-5085535 bp on Gm03. The case group comprised 57 proprietary soybean lines resistant to phytophthora and the control group comprised 9 proprietary susceptible lines. Following Haploview filtering using the settings noted below, 7491 SNPs remained in the analysis. Nine SNPs had all missing values in the control group and were removed from additional analysis.
The presence of haplotypes were also observed in a panel of lines not included in the association study.
A plot of chi square values from case-control analysis versus physical position of 7482 SNPs reveals a peak of SNP to trait association between 3915646-4533559 bp on Gm03, suggesting that a locus conditioning phytophthora resistance is in this region. A total of 581 SNPs have a perfect association between 9 susceptible (control) and 57 resistant (case) lines (Table 9). These markers are ideal for TaqMan⢠assay design or for evaluation by other methods, including sequencing, hybridization, or other technologies. Numerous additional SNPs analyzed here that are linked to region but are not in perfect LD with trait could be very informative markers when used in select germplasm.
| TABLE 9 | |||||||
| Ref. | Ref. | ||||||
| Sequence | Sequence | ||||||
| Assoc | Case, Control | Case, Control | Chi | SEQ ID NO | SEQ ID NO | ||
| Name | Allele | Ratio Counts | Frequencies | Square | P-value | (Res.) | (Sus.) |
| Gm03:3915646 | A | 112:0, 0:8 | 1.000, 0.000 | 120 | 6.33Eā28 | 1345 | 1346 |
| Gm03:3917778 | A | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 191 | 747 |
| Gm03:3918853 | T | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 192 | 748 |
| Gm03:3920367 | A | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 193 | 749 |
| Gm03:3926721 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 194 | 750 |
| Gm03:3926775 | A | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 195 | 751 |
| Gm03:3927474 | T | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 196 | 752 |
| Gm03:3927724 | G | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 197 | 753 |
| Gm03:3929330 | A | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 198 | 754 |
| Gm03:3929383 | A | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 199 | 755 |
| Gm03:3930408 | A | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 200 | 756 |
| Gm03:3930551 | T | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 201 | 757 |
| Gm03:3930806 | T | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 202 | 758 |
| Gm03:3932629 | T | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 203 | 759 |
| Gm03:3932974 | T | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 204 | 760 |
| Gm03:3933370 | A | 112:0, 0:8 | 1.000, 0.000 | 120 | 6.33Eā28 | 1347 | 1348 |
| Gm03:3933900 | G | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 205 | 761 |
| Gm03:3933945 | C | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 206 | 762 |
| Gm03:3934403 | G | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 207 | 763 |
| Gm03:3934964 | G | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 208 | 764 |
| Gm03:3935036 | G | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 209 | 765 |
| Gm03:3935832 | G | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 210 | 766 |
| Gm03:3935884 | T | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 211 | 767 |
| Gm03:3939831 | C | 112:0, 0:18 | 1.000, 0.000 | 130 | 4.10Eā30 | 212 | 768 |
| Gm03:3939836 | G | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 213 | 769 |
| Gm03:3939936 | T | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 214 | 770 |
| Gm03:3939939 | G | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 215 | 771 |
| Gm03:3940174 | T | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 216 | 772 |
| Gm03:3940396 | C | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 217 | 773 |
| Gm03:3940836 | T | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 218 | 774 |
| Gm03:3941262 | A | 112:0, 0:16 | 1.000, 0.000 | 128 | 1.12Eā29 | 219 | 775 |
| Gm03:3941484 | A | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 220 | 776 |
| Gm03:3941769 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 221 | 777 |
| Gm03:3942973 | C | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 222 | 778 |
| Gm03:3943092 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 223 | 779 |
| Gm03:3944671 | T | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 224 | 780 |
| Gm03:3944738 | C | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 225 | 781 |
| Gm03:3945112 | A | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 226 | 782 |
| Gm03:3945208 | T | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 227 | 783 |
| Gm03:3947836 | T | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 228 | 784 |
| Gm03:3947860 | G | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 229 | 785 |
| Gm03:3949250 | C | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 230 | 786 |
| Gm03:3949680 | A | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 231 | 787 |
| Gm03:3951187 | G | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 232 | 788 |
| Gm03:3951201 | G | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 233 | 789 |
| Gm03:3951485 | C | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 234 | 790 |
| Gm03:3951603 | C | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 235 | 791 |
| Gm03:3951705 | A | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 236 | 792 |
| Gm03:3951715 | G | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 237 | 793 |
| Gm03:3952778 | T | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 1349 | 1350 |
| Gm03:3952811 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 1351 | 1352 |
| Gm03:3955716 | T | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 238 | 794 |
| Gm03:3956414 | T | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 239 | 795 |
| Gm03:3958402 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 240 | 796 |
| Gm03:3960626 | T | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 241 | 797 |
| Gm03:3962904 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 242 | 798 |
| Gm03:3967880 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 243 | 799 |
| Gm03:3968334 | G | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 1353 | 1354 |
| Gm03:3971607 | C | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 244 | 800 |
| Gm03:3971640 | C | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 245 | 801 |
| Gm03:3971692 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 246 | 802 |
| Gm03:3975817 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 247 | 803 |
| Gm03:3975824 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 248 | 804 |
| Gm03:3976645 | T | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 249 | 805 |
| Gm03:3980566 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 250 | 806 |
| Gm03:3981623 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 251 | 807 |
| Gm03:3981822 | A | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 252 | 808 |
| Gm03:3982138 | C | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 253 | 809 |
| Gm03:3982678 | A | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 254 | 810 |
| Gm03:3984554 | C | 114:0, 0:4 | 1.000, 0.000 | 118 | 1.73Eā27 | 255 | 811 |
| Gm03:3986094 | T | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 256 | 812 |
| Gm03:3987393 | C | 114:0, 0:4 | 1.000, 0.000 | 118 | 1.73Eā27 | 257 | 813 |
| Gm03:3990954 | T | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 258 | 814 |
| Gm03:3992071 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 259 | 815 |
| Gm03:3995556 | C | 112:0, 0:18 | 1.000, 0.000 | 130 | 4.10Eā30 | 260 | 816 |
| Gm03:3996269 | C | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 261 | 817 |
| Gm03:3996600 | T | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 262 | 818 |
| Gm03:3997028 | C | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 263 | 819 |
| Gm03:3998157 | G | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 264 | 820 |
| Gm03:3998162 | G | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 265 | 821 |
| Gm03:3998381 | T | 112:0, 0:18 | 1.000, 0.000 | 130 | 4.10Eā30 | 266 | 822 |
| Gm03:3998421 | T | 110:0, 0:18 | 1.000, 0.000 | 128 | 1.12Eā29 | 267 | 823 |
| Gm03:3999241 | T | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 268 | 824 |
| Gm03:3999386 | C | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 269 | 825 |
| Gm03:3999666 | A | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 270 | 826 |
| Gm03:4000684 | C | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 1355 | 1356 |
| Gm03:4001327 | A | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 271 | 827 |
| Gm03:4001783 | A | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 272 | 828 |
| Gm03:4002016 | C | 112:0, 0:12 | 1.000, 0.000 | 124 | 8.42Eā29 | 273 | 829 |
| Gm03:4005770 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 274 | 830 |
| Gm03:4008187 | G | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 275 | 831 |
| Gm03:4008673 | A | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 276 | 832 |
| Gm03:4008687 | A | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 277 | 833 |
| Gm03:4010191 | C | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 278 | 834 |
| Gm03:4018588 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 279 | 835 |
| Gm03:4019384 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 280 | 836 |
| Gm03:4019896 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 281 | 837 |
| Gm03:4020751 | T | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 282 | 838 |
| Gm03:4021281 | G | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 283 | 839 |
| Gm03:4021291 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 284 | 840 |
| Gm03:4022234 | T | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 285 | 841 |
| Gm03:4022275 | T | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 286 | 842 |
| Gm03:4022530 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 287 | 843 |
| Gm03:4022872 | A | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 288 | 844 |
| Gm03:4022934 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 289 | 845 |
| Gm03:4023283 | T | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 290 | 846 |
| Gm03:4023522 | C | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 291 | 847 |
| Gm03:4024184 | C | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 292 | 848 |
| Gm03:4024294 | T | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 293 | 849 |
| Gm03:4024485 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 294 | 850 |
| Gm03:4024630 | T | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 295 | 851 |
| Gm03:4024844 | T | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 296 | 852 |
| Gm03:4025056 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 297 | 853 |
| Gm03:4026652 | T | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 298 | 854 |
| Gm03:4028481 | G | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 299 | 855 |
| Gm03:4028849 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 300 | 856 |
| Gm03:4028961 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 301 | 857 |
| Gm03:4029068 | A | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 302 | 858 |
| Gm03:4029809 | T | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 303 | 859 |
| Gm03:4031277 | G | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 304 | 860 |
| Gm03:4031983 | C | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 305 | 861 |
| Gm03:4031997 | G | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 306 | 862 |
| Gm03:4032705 | T | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 307 | 863 |
| Gm03:4035600 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 308 | 864 |
| Gm03:4035918 | A | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 1357 | 1358 |
| Gm03:4036376 | A | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 309 | 865 |
| Gm03:4040874 | A | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 310 | 866 |
| Gm03:4041301 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 311 | 867 |
| Gm03:4041795 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 312 | 868 |
| Gm03:4042572 | G | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 313 | 869 |
| Gm03:4042679 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 314 | 870 |
| Gm03:4042697 | A | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 315 | 871 |
| Gm03:4043007 | A | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 316 | 872 |
| Gm03:4043140 | A | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 317 | 873 |
| Gm03:4043823 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 318 | 874 |
| Gm03:4043978 | C | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 319 | 875 |
| Gm03:4044534 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 320 | 876 |
| Gm03:4044555 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 321 | 877 |
| Gm03:4044972 | A | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 322 | 878 |
| Gm03:4045630 | A | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 323 | 879 |
| Gm03:4046313 | C | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 324 | 880 |
| Gm03:4049555 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 325 | 881 |
| Gm03:4049791 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 326 | 882 |
| Gm03:4049877 | T | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 327 | 883 |
| Gm03:4050197 | A | 112:0, 0:16 | 1.000, 0.000 | 128 | 1.12Eā29 | 328 | 884 |
| Gm03:4053685 | T | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 329 | 885 |
| Gm03:4053838 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 330 | 886 |
| Gm03:4054927 | T | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 331 | 887 |
| Gm03:4055100 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 332 | 888 |
| Gm03:4055384 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 333 | 889 |
| Gm03:4055427 | T | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 334 | 890 |
| Gm03:4055483 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 1359 | 1360 |
| Gm03:4062751 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 335 | 891 |
| Gm03:4062885 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 1361 | 1362 |
| Gm03:4064351 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 336 | 892 |
| Gm03:4064592 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 337 | 893 |
| Gm03:4064759 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 338 | 894 |
| Gm03:4064811 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 339 | 895 |
| Gm03:4064957 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 340 | 896 |
| Gm03:4065083 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 341 | 897 |
| Gm03:4066234 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 342 | 898 |
| Gm03:4066331 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 343 | 899 |
| Gm03:4067099 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 344 | 900 |
| Gm03:4067514 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 345 | 901 |
| Gm03:4069037 | T | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 346 | 902 |
| Gm03:4069603 | T | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 347 | 903 |
| Gm03:4070422 | G | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 348 | 904 |
| Gm03:4072567 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 349 | 905 |
| Gm03:4074190 | T | 112:0, 0:10 | 1.000, 0.000 | 122 | 2.31Eā28 | 350 | 906 |
| Gm03:4075232 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 351 | 907 |
| Gm03:4076404 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 352 | 908 |
| Gm03:4078299 | T | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 353 | 909 |
| Gm03:4078902 | C | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 354 | 910 |
| Gm03:4080136 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 355 | 911 |
| Gm03:4081056 | T | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 356 | 912 |
| Gm03:4081889 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 357 | 913 |
| Gm03:4082200 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 358 | 914 |
| Gm03:4082590 | C | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 359 | 915 |
| Gm03:4082701 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 360 | 916 |
| Gm03:4082781 | G | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 361 | 917 |
| Gm03:4082871 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 362 | 918 |
| Gm03:4083114 | T | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 363 | 919 |
| Gm03:4084001 | G | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 364 | 920 |
| Gm03:4084095 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 365 | 921 |
| Gm03:4085042 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 366 | 922 |
| Gm03:4085524 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 367 | 923 |
| Gm03:4086286 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 368 | 924 |
| Gm03:4086887 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 369 | 925 |
| Gm03:4087383 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 370 | 926 |
| Gm03:4088310 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 371 | 927 |
| Gm03:4090188 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 372 | 928 |
| Gm03:4092799 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 373 | 929 |
| Gm03:4092928 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 374 | 930 |
| Gm03:4093195 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 375 | 931 |
| Gm03:4093240 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 376 | 932 |
| Gm03:4097291 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 377 | 933 |
| Gm03:4097563 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 378 | 934 |
| Gm03:4097729 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 379 | 935 |
| Gm03:4098328 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 380 | 936 |
| Gm03:4100831 | A | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 1363 | 1364 |
| Gm03:4101257 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 381 | 937 |
| Gm03:4103342 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 382 | 938 |
| Gm03:4103449 | T | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 383 | 939 |
| Gm03:4103450 | G | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 384 | 940 |
| Gm03:4103515 | T | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 385 | 941 |
| Gm03:4103547 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 386 | 942 |
| Gm03:4103633 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 387 | 943 |
| Gm03:4104502 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 388 | 944 |
| Gm03:4106406 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 389 | 945 |
| Gm03:4109228 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 390 | 946 |
| Gm03:4110012 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 391 | 947 |
| Gm03:4110449 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 392 | 948 |
| Gm03:4110821 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 393 | 949 |
| Gm03:4111538 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 394 | 950 |
| Gm03:4113757 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 395 | 951 |
| Gm03:4116726 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 396 | 952 |
| Gm03:4117330 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 397 | 953 |
| Gm03:4117375 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 398 | 954 |
| Gm03:4117779 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 399 | 955 |
| Gm03:4117890 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 400 | 956 |
| Gm03:4117986 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 401 | 957 |
| Gm03:4120433 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 402 | 958 |
| Gm03:4120705 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 403 | 959 |
| Gm03:4122180 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 404 | 960 |
| Gm03:4129251 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 405 | 961 |
| Gm03:4129479 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 406 | 962 |
| Gm03:4129635 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 407 | 963 |
| Gm03:4130393 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 408 | 964 |
| Gm03:4131257 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 409 | 965 |
| Gm03:4132032 | C | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 410 | 966 |
| Gm03:4132192 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 411 | 967 |
| Gm03:4133520 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 412 | 968 |
| Gm03:4134606 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 413 | 969 |
| Gm03:4134679 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 414 | 970 |
| Gm03:4136487 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 415 | 971 |
| Gm03:4136724 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 416 | 972 |
| Gm03:4136742 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 417 | 973 |
| Gm03:4136791 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 418 | 974 |
| Gm03:4136972 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 419 | 975 |
| Gm03:4137137 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 420 | 976 |
| Gm03:4137521 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 421 | 977 |
| Gm03:4137540 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 422 | 978 |
| Gm03:4137645 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 423 | 979 |
| Gm03:4138435 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 424 | 980 |
| Gm03:4138980 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 425 | 981 |
| Gm03:4139156 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 426 | 982 |
| Gm03:4139395 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 1365 | 1366 |
| Gm03:4140035 | C | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 427 | 983 |
| Gm03:4140071 | T | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 428 | 984 |
| Gm03:4140976 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 429 | 985 |
| Gm03:4141074 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 430 | 986 |
| Gm03:4141090 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 431 | 987 |
| Gm03:4141251 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 432 | 988 |
| Gm03:4141363 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 433 | 989 |
| Gm03:4141488 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 434 | 990 |
| Gm03:4142353 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 435 | 991 |
| Gm03:4142380 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 436 | 992 |
| Gm03:4142693 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 437 | 993 |
| Gm03:4142800 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 438 | 994 |
| Gm03:4142810 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 439 | 995 |
| Gm03:4143060 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 440 | 996 |
| Gm03:4143112 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 441 | 997 |
| Gm03:4143113 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 442 | 998 |
| Gm03:4144137 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 443 | 999 |
| Gm03:4144350 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 444 | 1000 |
| Gm03:4144639 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 445 | 1001 |
| Gm03:4145737 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 446 | 1002 |
| Gm03:4145959 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 447 | 1003 |
| Gm03:4145974 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 448 | 1004 |
| Gm03:4146284 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 449 | 1005 |
| Gm03:4147289 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 450 | 1006 |
| Gm03:4147425 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 451 | 1007 |
| Gm03:4148248 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 452 | 1008 |
| Gm03:4148643 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 453 | 1009 |
| Gm03:4148732 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 454 | 1010 |
| Gm03:4149880 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 1367 | 1368 |
| Gm03:4149919 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 455 | 1011 |
| Gm03:4150189 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 456 | 1012 |
| Gm03:4150330 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 457 | 1013 |
| Gm03:4151366 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 458 | 1014 |
| Gm03:4152106 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 459 | 1015 |
| Gm03:4153221 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 460 | 1016 |
| Gm03:4153413 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 461 | 1017 |
| Gm03:4153505 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 462 | 1018 |
| Gm03:4153885 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 463 | 1019 |
| Gm03:4154059 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 464 | 1020 |
| Gm03:4156891 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 465 | 1021 |
| Gm03:4158622 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 466 | 1022 |
| Gm03:4159661 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 467 | 1023 |
| Gm03:4160698 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 468 | 1024 |
| Gm03:4162268 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 469 | 1025 |
| Gm03:4163423 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 470 | 1026 |
| Gm03:4164061 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 471 | 1027 |
| Gm03:4164065 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 472 | 1028 |
| Gm03:4164142 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 473 | 1029 |
| Gm03:4164401 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 474 | 1030 |
| Gm03:4164507 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 475 | 1031 |
| Gm03:4164719 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 476 | 1032 |
| Gm03:4164807 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 477 | 1033 |
| Gm03:4166307 | C | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 478 | 1034 |
| Gm03:4166432 | G | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 479 | 1035 |
| Gm03:4167439 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 480 | 1036 |
| Gm03:4167591 | C | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 481 | 1037 |
| Gm03:4167701 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 482 | 1038 |
| Gm03:4168907 | T | 112:0, 0:12 | 1.000, 0.000 | 124 | 8.42Eā29 | 483 | 1039 |
| Gm03:4169729 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 484 | 1040 |
| Gm03:4169784 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 485 | 1041 |
| Gm03:4169863 | G | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 1369 | 1370 |
| Gm03:4169950 | T | 114:0, 0:4 | 1.000, 0.000 | 118 | 1.73Eā27 | 486 | 1042 |
| Gm03:4169995 | G | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 487 | 1043 |
| Gm03:4171393 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 488 | 1044 |
| Gm03:4171766 | A | 112:0, 0:10 | 1.000, 0.000 | 122 | 2.31Eā28 | 1371 | 1372 |
| Gm03:4172171 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 489 | 1045 |
| Gm03:4173195 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 490 | 1046 |
| Gm03:4173316 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 491 | 1047 |
| Gm03:4173405 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 492 | 1048 |
| Gm03:4173524 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 493 | 1049 |
| Gm03:4175127 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 494 | 1050 |
| Gm03:4177056 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 495 | 1051 |
| Gm03:4177689 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 496 | 1052 |
| Gm03:4177690 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 497 | 1053 |
| Gm03:4178958 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 498 | 1054 |
| Gm03:4179972 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 499 | 1055 |
| Gm03:4180458 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 500 | 1056 |
| Gm03:4182337 | G | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 501 | 1057 |
| Gm03:4184380 | T | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 502 | 1058 |
| Gm03:4184951 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 503 | 1059 |
| Gm03:4184971 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 504 | 1060 |
| Gm03:4185234 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 505 | 1061 |
| Gm03:4185400 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 506 | 1062 |
| Gm03:4185863 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 507 | 1063 |
| Gm03:4187256 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 508 | 1064 |
| Gm03:4188732 | T | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 509 | 1065 |
| Gm03:4189845 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 510 | 1066 |
| Gm03:4189964 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 511 | 1067 |
| Gm03:4190679 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 512 | 1068 |
| Gm03:4191313 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 513 | 1069 |
| Gm03:4191519 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 514 | 1070 |
| Gm03:4192359 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 515 | 1071 |
| Gm03:4192478 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 516 | 1072 |
| Gm03:4192513 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 517 | 1073 |
| Gm03:4192621 | C | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 518 | 1074 |
| Gm03:4192738 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 519 | 1075 |
| Gm03:4193009 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 520 | 1076 |
| Gm03:4193030 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 1373 | 1374 |
| Gm03:4193039 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 521 | 1077 |
| Gm03:4193483 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 522 | 1078 |
| Gm03:4196188 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 523 | 1079 |
| Gm03:4196542 | T | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 524 | 1080 |
| Gm03:4197697 | T | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 1375 | 1376 |
| Gm03:4197774 | A | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 525 | 1081 |
| Gm03:4198285 | A | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 526 | 1082 |
| Gm03:4198508 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 527 | 1083 |
| Gm03:4198711 | A | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 528 | 1084 |
| Gm03:4198914 | A | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 529 | 1085 |
| Gm03:4199748 | G | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 530 | 1086 |
| Gm03:4200094 | A | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 531 | 1087 |
| Gm03:4203253 | G | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 532 | 1088 |
| Gm03:4203462 | G | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 533 | 1089 |
| Gm03:4203594 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 534 | 1090 |
| Gm03:4203626 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 535 | 1091 |
| Gm03:4204747 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 536 | 1092 |
| Gm03:4204867 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 537 | 1093 |
| Gm03:4205828 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 538 | 1094 |
| Gm03:4205953 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 539 | 1095 |
| Gm03:4206870 | G | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 540 | 1096 |
| Gm03:4207703 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 541 | 1097 |
| Gm03:4215115 | C | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 542 | 1098 |
| Gm03:4215690 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 543 | 1099 |
| Gm03:4215950 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 544 | 1100 |
| Gm03:4217736 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 545 | 1101 |
| Gm03:4218032 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 546 | 1102 |
| Gm03:4218527 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 547 | 1103 |
| Gm03:4218716 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 548 | 1104 |
| Gm03:4218990 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 549 | 1105 |
| Gm03:4219539 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 550 | 1106 |
| Gm03:4219667 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 551 | 1107 |
| Gm03:4221288 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 552 | 1108 |
| Gm03:4222312 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 553 | 1109 |
| Gm03:4223122 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 554 | 1110 |
| Gm03:4223821 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 555 | 1111 |
| Gm03:4224501 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 556 | 1112 |
| Gm03:4225137 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 557 | 1113 |
| Gm03:4225960 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 558 | 1114 |
| Gm03:4226471 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 559 | 1115 |
| Gm03:4227488 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 560 | 1116 |
| Gm03:4228931 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 561 | 1117 |
| Gm03:4229006 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 562 | 1118 |
| Gm03:4229247 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 563 | 1119 |
| Gm03:4230412 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 564 | 1120 |
| Gm03:4230665 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 565 | 1121 |
| Gm03:4230768 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 566 | 1122 |
| Gm03:4231904 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 567 | 1123 |
| Gm03:4231979 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 568 | 1124 |
| Gm03:4233068 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 569 | 1125 |
| Gm03:4233431 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 570 | 1126 |
| Gm03:4233493 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 571 | 1127 |
| Gm03:4233550 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 572 | 1128 |
| Gm03:4234109 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 573 | 1129 |
| Gm03:4234194 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 574 | 1130 |
| Gm03:4234277 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 575 | 1131 |
| Gm03:4234310 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 576 | 1132 |
| Gm03:4235089 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 577 | 1133 |
| Gm03:4235183 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 578 | 1134 |
| Gm03:4235519 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 579 | 1135 |
| Gm03:4235634 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 580 | 1136 |
| Gm03:4235844 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 581 | 1137 |
| Gm03:4236123 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 582 | 1138 |
| Gm03:4236298 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 583 | 1139 |
| Gm03:4239026 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 584 | 1140 |
| Gm03:4242434 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 585 | 1141 |
| Gm03:4243529 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 586 | 1142 |
| Gm03:4244201 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 587 | 1143 |
| Gm03:4244338 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 588 | 1144 |
| Gm03:4244497 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 589 | 1145 |
| Gm03:4245348 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 590 | 1146 |
| Gm03:4245390 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 591 | 1147 |
| Gm03:4245678 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 592 | 1148 |
| Gm03:4246770 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 593 | 1149 |
| Gm03:4246837 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 594 | 1150 |
| Gm03:4247592 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 595 | 1151 |
| Gm03:4247726 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 596 | 1152 |
| Gm03:4252413 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 597 | 1153 |
| Gm03:4252569 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 598 | 1154 |
| Gm03:4252894 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 599 | 1155 |
| Gm03:4252928 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 600 | 1156 |
| Gm03:4253518 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 601 | 1157 |
| Gm03:4257596 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 1377 | 1378 |
| Gm03:4257995 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 602 | 1158 |
| Gm03:4258161 | T | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 603 | 1159 |
| Gm03:4258545 | T | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 604 | 1160 |
| Gm03:4260785 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 605 | 1161 |
| Gm03:4260901 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 606 | 1162 |
| Gm03:4261372 | T | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 607 | 1163 |
| Gm03:4261626 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 608 | 1164 |
| Gm03:4262516 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 609 | 1165 |
| Gm03:4262869 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 610 | 1166 |
| Gm03:4263876 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 611 | 1167 |
| Gm03:4264709 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 612 | 1168 |
| Gm03:4265916 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 613 | 1169 |
| Gm03:4266927 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 614 | 1170 |
| Gm03:4267296 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 615 | 1171 |
| Gm03:4268640 | C | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 616 | 1172 |
| Gm03:4268852 | G | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 617 | 1173 |
| Gm03:4295832 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 618 | 1174 |
| Gm03:4302907 | G | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 619 | 1175 |
| Gm03:4302936 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 620 | 1176 |
| Gm03:4306709 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 621 | 1177 |
| Gm03:4307835 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 622 | 1178 |
| Gm03:4307996 | G | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 623 | 1179 |
| Gm03:4308161 | T | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 624 | 1180 |
| Gm03:4308286 | C | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 625 | 1181 |
| Gm03:4308323 | G | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 626 | 1182 |
| Gm03:4308522 | T | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 627 | 1183 |
| Gm03:4313900 | C | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 628 | 1184 |
| Gm03:4314212 | G | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 629 | 1185 |
| Gm03:4314464 | G | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 630 | 1186 |
| Gm03:4315256 | A | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 631 | 1187 |
| Gm03:4317574 | G | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 632 | 1188 |
| Gm03:4318530 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 633 | 1189 |
| Gm03:4319271 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 634 | 1190 |
| Gm03:4320841 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 635 | 1191 |
| Gm03:4321243 | C | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 636 | 1192 |
| Gm03:4321515 | T | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 637 | 1193 |
| Gm03:4328502 | G | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 638 | 1194 |
| Gm03:4329219 | C | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 639 | 1195 |
| Gm03:4329504 | T | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 640 | 1196 |
| Gm03:4330121 | A | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 641 | 1197 |
| Gm03:4330318 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 642 | 1198 |
| Gm03:4331246 | A | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 643 | 1199 |
| Gm03:4331889 | A | 110:0, 0:12 | 1.000, 0.000 | 122 | 2.31Eā28 | 644 | 1200 |
| Gm03:4337173 | G | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 645 | 1201 |
| Gm03:4338377 | G | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 646 | 1202 |
| Gm03:4338505 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 647 | 1203 |
| Gm03:4338559 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 648 | 1204 |
| Gm03:4339885 | T | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 649 | 1205 |
| Gm03:4341064 | A | 112:0, 0:14 | 1.000, 0.000 | 126 | 3.07Eā29 | 650 | 1206 |
| Gm03:4342692 | T | 110:0, 0:8 | 1.000, 0.000 | 118 | 1.73Eā27 | 651 | 1207 |
| Gm03:4342727 | A | 112:0, 0:12 | 1.000, 0.000 | 124 | 8.42Eā29 | 652 | 1208 |
| Gm03:4343201 | A | 112:0, 0:12 | 1.000, 0.000 | 124 | 8.42Eā29 | 653 | 1209 |
| Gm03:4343212 | T | 112:0, 0:8 | 1.000, 0.000 | 120 | 6.33Eā28 | 654 | 1210 |
| Gm03:4348211 | T | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 655 | 1211 |
| Gm03:4350556 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 656 | 1212 |
| Gm03:4350658 | A | 110:0, 0:10 | 1.000, 0.000 | 120 | 6.33Eā28 | 657 | 1213 |
| Gm03:4350767 | G | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 658 | 1214 |
| Gm03:4351326 | T | 110:0, 0:10 | 1.000, 0.000 | 120 | 6.33Eā28 | 659 | 1215 |
| Gm03:4351612 | T | 112:0, 0:12 | 1.000, 0.000 | 124 | 8.42Eā29 | 660 | 1216 |
| Gm03:4351617 | T | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 661 | 1217 |
| Gm03:4351674 | A | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 662 | 1218 |
| Gm03:4352353 | T | 112:0, 0:8 | 1.000, 0.000 | 120 | 6.33Eā28 | 663 | 1219 |
| Gm03:4353932 | T | 112:0, 0:8 | 1.000, 0.000 | 120 | 6.33Eā28 | 664 | 1220 |
| Gm03:4354036 | C | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 665 | 1221 |
| Gm03:4355046 | C | 112:0, 0:8 | 1.000, 0.000 | 120 | 6.33Eā28 | 666 | 1222 |
| Gm03:4362911 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 667 | 1223 |
| Gm03:4363385 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 668 | 1224 |
| Gm03:4363855 | T | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 669 | 1225 |
| Gm03:4364133 | A | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 670 | 1226 |
| Gm03:4364176 | G | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 671 | 1227 |
| Gm03:4364200 | A | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 672 | 1228 |
| Gm03:4364469 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 673 | 1229 |
| Gm03:4385480 | G | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 674 | 1230 |
| Gm03:4385781 | A | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 675 | 1231 |
| Gm03:4386327 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 676 | 1232 |
| Gm03:4386398 | G | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 677 | 1233 |
| Gm03:4386633 | G | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 678 | 1234 |
| Gm03:4386927 | C | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 679 | 1235 |
| Gm03:4387264 | T | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 680 | 1236 |
| Gm03:4388736 | A | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 681 | 1237 |
| Gm03:4388954 | T | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 682 | 1238 |
| Gm03:4388982 | A | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 683 | 1239 |
| Gm03:4389208 | T | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 684 | 1240 |
| Gm03:4389211 | A | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 685 | 1241 |
| Gm03:4389280 | A | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 686 | 1242 |
| Gm03:4389696 | T | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 687 | 1243 |
| Gm03:4390074 | G | 114:0, 0:4 | 1.000, 0.000 | 118 | 1.73Eā27 | 1379 | 1380 |
| Gm03:4390738 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 688 | 1244 |
| Gm03:4390827 | C | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 689 | 1245 |
| Gm03:4390979 | C | 114:0, 0:4 | 1.000, 0.000 | 118 | 1.73Eā27 | 690 | 1246 |
| Gm03:4392217 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 1381 | 1382 |
| Gm03:4392314 | C | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 691 | 1247 |
| Gm03:4392891 | G | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 692 | 1248 |
| Gm03:4392913 | G | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 693 | 1249 |
| Gm03:4394477 | C | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 1383 | 1384 |
| Gm03:4394831 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 694 | 1250 |
| Gm03:4395386 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 695 | 1251 |
| Gm03:4395962 | A | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 696 | 1252 |
| Gm03:4397872 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 697 | 1253 |
| Gm03:4398299 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 698 | 1254 |
| Gm03:4398919 | T | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 699 | 1255 |
| Gm03:4399399 | G | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 700 | 1256 |
| Gm03:4400461 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 701 | 1257 |
| Gm03:4404444 | C | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 702 | 1258 |
| Gm03:4410393 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 703 | 1259 |
| Gm03:4410565 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 704 | 1260 |
| Gm03:4411187 | T | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 705 | 1261 |
| Gm03:4412149 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 706 | 1262 |
| Gm03:4412417 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 707 | 1263 |
| Gm03:4412774 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 708 | 1264 |
| Gm03:4413415 | C | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 709 | 1265 |
| Gm03:4446891 | T | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 710 | 1266 |
| Gm03:4447988 | A | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 711 | 1267 |
| Gm03:4448825 | C | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 712 | 1268 |
| Gm03:4449634 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 713 | 1269 |
| Gm03:4449956 | T | 112:0, 0:18 | 1.000, 0.000 | 130 | 4.10Eā30 | 714 | 1270 |
| Gm03:4450328 | C | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 715 | 1271 |
| Gm03:4450331 | G | 114:0, 0:6 | 1.000, 0.000 | 120 | 6.33Eā28 | 716 | 1272 |
| Gm03:4450888 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 717 | 1273 |
| Gm03:4451295 | A | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 1385 | 1386 |
| Gm03:4451491 | A | 114:0, 0:8 | 1.000, 0.000 | 122 | 2.31Eā28 | 718 | 1274 |
| Gm03:4451503 | T | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 719 | 1275 |
| Gm03:4451847 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 1387 | 1388 |
| Gm03:4452060 | A | 114:0, 0:12 | 1.000, 0.000 | 126 | 3.07Eā29 | 720 | 1276 |
| Gm03:4452118 | A | 114:0, 0:10 | 1.000, 0.000 | 124 | 8.42Eā29 | 721 | 1277 |
| Gm03:4452820 | T | 114:0, 0:14 | 1.000, 0.000 | 128 | 1.12Eā29 | 1389 | 1390 |
| Gm03:4456305 | T | 114:0, 0:16 | 1.000, 0.000 | 130 | 4.10Eā30 | 722 | 1278 |
| Gm03:4458273 | G | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 723 | 1279 |
| Gm03:4458399 | A | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 724 | 1280 |
| Gm03:4461465 | T | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 725 | 1281 |
| Gm03:4462225 | A | 114:0, 0:18 | 1.000, 0.000 | 132 | 1.50Eā30 | 726 | 1282 |
| Gm03:4471412 | T | 112:0, 0:8 | 1.000, 0.000 | 120 | 6.33Eā28 | 1391 | 1392 |
| Gm03:4474352 | A | 112:0, 0:8 | 1.000, 0.000 | 120 | 6.33Eā28 | 1393 | 1394 |
| Gm03:4477946 | A | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 727 | 1283 |
| Gm03:4477947 | C | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 728 | 1284 |
| Gm03:4478247 | C | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 729 | 1285 |
| Gm03:4478479 | G | 112:0, 0:8 | 1.000, 0.000 | 120 | 6.33Eā28 | 730 | 1286 |
| Gm03:4478554 | A | 112:0, 0:10 | 1.000, 0.000 | 122 | 2.31Eā28 | 731 | 1287 |
| Gm03:4478921 | A | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 732 | 1288 |
| Gm03:4479127 | T | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 733 | 1289 |
| Gm03:4506056 | A | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 734 | 1290 |
| Gm03:4506139 | A | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 735 | 1291 |
| Gm03:4506147 | T | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 736 | 1292 |
| Gm03:4507198 | A | 112:0, 0:8 | 1.000, 0.000 | 120 | 6.33Eā28 | 737 | 1293 |
| Gm03:4525141 | A | 112:0, 0:16 | 1.000, 0.000 | 128 | 1.12Eā29 | 738 | 1294 |
| Gm03:4525736 | C | 112:0, 0:14 | 1.000, 0.000 | 126 | 3.07Eā29 | 739 | 1295 |
| Gm03:4526278 | C | 110:0, 0:14 | 1.000, 0.000 | 124 | 8.42Eā29 | 740 | 1296 |
| Gm03:4526393 | C | 112:0, 0:16 | 1.000, 0.000 | 128 | 1.12Eā29 | 741 | 1297 |
| Gm03:4526446 | G | 112:0, 0:16 | 1.000, 0.000 | 128 | 1.12Eā29 | 742 | 1298 |
| Gm03:4527054 | A | 112:0, 0:16 | 1.000, 0.000 | 128 | 1.12Eā29 | 743 | 1299 |
| Gm03:4533559 | A | 112:0, 0:14 | 1.000, 0.000 | 126 | 3.07Eā29 | 744 | 1300 |
| Gm03:4539866 | A | 112:0, 0:12 | 1.000, 0.000 | 124 | 8.42Eā29 | 745 | 1301 |
| Gm03:4541294 | A | 112:0, 0:6 | 1.000, 0.000 | 118 | 1.73Eā27 | 746 | 1302 |
Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the Rps2 locus on linkage group J (ch 16). Markers were screened against various known resistant and susceptible parents.
Markers to loci S06862, S06863, S06864, S06865, S11652-1 and S11682-1 were developed and validated for their ability to identify the allele(s) associated with resistance at Rps2, for example alleles derived from resistant line L76-1988. Marker S06862 appeared to be within a region which is deleted in some lines, and did not amplify in several geneotypes. Therefore, genomic regions outside of the apparent deletion were targeted for marker development by sequencing 1588 regions in 25 soybean lines to develop a SNP profile. Markers to S11652 and S11682 were made based on the SNP profile and were screened and verified in known resistant and susceptible varieties. Further development and testing was done to optimize markers to these for high throughput analysis of soybean.
An F2 mapping population derived from a cross of L76-1988 X susceptible consisting 256 individuals was used to fine map QTL for Rps2 on LG-J. A total of 9 polymorphic markers were utilized to construct the linkage group and perform QTL analysis. Three Rps2 phenotypic data sets were used: Score 1, Score 2, and an average score. Phenotypic distributions of all 3 datasets were consistent. A major QTL was detected on all the three data sets. The QTL was closely linked with marker S11652-1-Q1 and flanked by markers to form an interval which explained Ė69% of phenotypic variation (averaged score).
Initial Map Manager Parameters were set to:
1) Linkage Evaluation: Intercross
2) Search Criteria: P=1eā5
3) Map Function: Kosambi
4) Cross Type: Line Cross
The permutation test simulation was done for each score established significance boundaries in order to identify QTLs as follows:
| Rps2 Score1 | Rps2 Score2 | Rps2_Avg | |
| Suggestive | 0.7 | 0.7 | 0.7 |
| Significant | 5.3 | 5.4 | 5.8 |
| Highly significant | 13.6 | 11.1 | 13.7 |
Markers 511652-1-Q1, 50683-1-Q1, and 511682-1-Q1 on LG J were identified as highly significant using Map ManagerQTX (Manly et al. (2001) Mammalian Genome 12:930-932) marker regression analysis of each of the 3 phenotypic datasets. Each had a p value of 0.00000, a % values from 56-68%, and stat values from 152.2-242.7 across the 3 regressions.
Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the Rps3 locus on linkage group F (ch 13). Markers were screened against various known resistant and susceptible varieties.
A marker to loci S07361-1, S08342-1, S09081-1 was developed to identify alleles associated with the phytophthora phenotype. Markers to S08342-1, S09081-1 detect res/sus polymorphisms for Rps3a, and markers to S07361-1 detect res/sus polymorphisms for Rps3c. During development, each marker was validated and confirmed against a panel of about 30 resistant and susceptible varieties which included proprietary experimental lines, proprietary commercial lines, and public lines. Further development and testing was done to optimize each marker system for high throughput analysis of soybean.
An F2:3 population 95Y40xExpSUS, segregating for phytophthora root rot response, was used for Rps3c marker refinement. Parental line 95Y40 carries both the Rps3c and Rps1k phytophthora resistance alleles, ExpSUS is a proprietary experimental line susceptible to Phytophthora. No significant QTLs were detected in this study. One suggestive QTL was found on each chromosome F_(13) and chromosome N_(3), however there was no significant association between the resistant phenotype and the Rps3c (S07163-1-Q3) and Rps1k (S00009-01-A) MAS markers located on the chromosomes, respectively.
The F2:3 population consisted of 90 progeny. Genomic DNA was extracted using a standard CTAB method and used for genotyping. Eight polymorphic markers were selected from LG-F, as well as 6 polymorphic markers selected from LG-N flanking and including the MAS markers S07163-1-Q1 and S00009-01-A and used to genotype the population. Phenotypic scores categorized the progeny as Resistant, Susceptible, and Heterozygous. The classes were assigned numbers 9, 1, and 5, respectively for QTL analysis. Map Manager QTX.b20 was used to construct the linkage map with the following parameters:
1) Linkage Evaluation: Intercross
2) Search Criteria: P=1eā5
3) Map Function: Kosambi
4) Cross Type: Line Cross
Marker regression (p=0.001) and interval mapping were executed using Map Manager QTX.b20 and the results were confirmed using single marker analysis and composite interval mapping in QTL Cartographer 2.5. A permutation test was run in Map Manager 1000 times (free model), and in QTL Cartographer 500 times (p=0.5) to establish the threshold for statistical significance. Preliminary analysis indicated all 14 markers showed severe segregation distortion (chi square test statistic p=0.001) using the expected F2 segregation ratios. Instead, the observed genotypic ratios fit an F3 model well. In addition, three progeny matched parental calls across all 14 markers and were removed from subsequent analysis. The allele calls were converted to the A (maternal), B (paternal), H (heterozygous) convention for mapping analysis.
The phenotypic distribution of the 87 progeny employed in this analysis was evaluated using both percent dead scores, and the distribution after grouping into classes. In each case, the distributions were essentially normal. The resistant parent's average phenotypic score was 66% dead, placing the value near the mid-point of the population phenotypic distribution rather than the tail.
In the mapping analysis markers formed two linkage groups on LG F and LG N, with one marker remaining unlinked. Marker regression (Map Manager) and single marker analysis (QTL Cartographer) were performed, each indicating two suggestive regions of interest, a region on LG F comprising S07163-1-Q3, and a region on LG N comprising S00009-01-A. Neither reached the LRS cutoff for significance in this study.
Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the Rps6 locus on linkage group G (ch 18). Markers were screened against various known resistant and susceptible parents.
A marker to locus S08442 was developed to identify alleles associated with the phytophthora phenotype. Sequencing was done to develop a SNP profile for marker development. During development, this marker was validated against Phytophthora resistant line Archer, and a susceptible line. The marker was further validated and confirmed against a panel of about 30 varieties which included proprietary experimental lines, proprietary commercial lines, and public lines. This marker was additionally used to fingerprint approximately 2000 soybean lines.
All publications and patent applications mentioned in the specification are indicative of the level of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.
1. A method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection, the method comprising detecting in the genome of said first soybean plant or in the genome of said first soybean germplasm at least one marker locus that is associated with the tolerance, wherein:
(a) the at least one marker locus comprises S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N;
(b) the at least one marker locus comprises S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N;
(c) the at least one marker locus comprises S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J;
(d) the at least one marker locus comprises S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; or
(e) the at least one marker locus comprises S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
2. The method of claim 1, wherein at least two marker loci are detected.
3. The method of claim 2, wherein the at least two marker loci comprise a haplotype or a marker profile that is associated with said tolerance.
4. The method of claim 1, wherein the germplasm is a soybean variety.
5. The method of claim 1, wherein the method further comprises selecting the first soybean plant or first soybean germplasm or a progeny thereof having the at least one marker locus.
6. The method of claim 5, further comprising crossing the selected first soybean plant or first soybean germplasm with a second soybean plant or second soybean germplasm.
7. The method of claim 6, wherein the second soybean plant or second soybean germplasm comprises an exotic soybean strain or an elite soybean strain.
8. The method of claim 1, wherein the detecting comprises DNA sequencing of at least one of said marker loci.
9. The method of claim 1, wherein the detecting comprises amplifying at least one of said marker loci and detecting the resulting amplified marker amplicon.
10. The method of claim 9, wherein the amplifying comprises:
a) admixing an amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm, wherein the primer or primer pair is complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus, and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template; and
b) extending the primer or primer pair in a DNA polymerization reaction comprising a DNA polymerase and a template nucleic acid to generate at least one amplicon.
11. The method of claim 10, wherein said method comprises
(a) amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393 or 1394;
(b) amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179 or 180;
(c) amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 181, 182, 183, 184, 185 or 186; or
(d) amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 187, 188, 189 or 190.
12. The method of claim 10, wherein said primer or primer pair comprises
(a) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or complements thereof;
(b) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof;
(c) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 181, 182, 183, 184, 185, 186 or complements thereof; or
(d) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 187, 188, 189, 190 or complements thereof.
13. The method of claim 12, wherein said primer or primer pair comprises a nucleic acid sequence comprising
(a) a nucleic acid sequence comprising SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 1339, 1340 or variants or fragments thereof;
(b) a nucleic acid sequence comprising SEQ ID NOs: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or variants or fragments thereof;
(c) a nucleic acid sequence comprising SEQ ID NOs: 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 or variants or fragments thereof; or
(d) a nucleic acid sequence comprising SEQ ID NOs: 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104 or variants or fragments thereof.
14. The method of claim 13, wherein said primer pair comprises:
a) SEQ ID NO: 1 and SEQ ID NO:2, SEQ ID NO: 9 and SEQ ID NO:10, SEQ ID NO: 20 and SEQ ID NO:21, SEQ ID NO: 22 and SEQ ID NO: 23, SEQ ID NO: 24 and SEQ ID NO: 25, SEQ ID NO: 36 and SEQ ID NO: 37, SEQ ID NO: 38 and SEQ ID NO: 39 or SEQ ID NO: 1339 and SEQ ID NO: 1340;
(b) SEQ ID NO: 40 and SEQ ID NO: 41, SEQ ID NO: 46 and SEQ ID NO: 47, SEQ ID NO: 52 and SEQ ID NO: 53, SEQ ID NO: 58 and SEQ ID NO: 59, SEQ ID NO: 64 and SEQ ID NO: 65 or SEQ ID NO: 75 and SEQ ID NO: 76;
(c) SEQ ID NO: 81 and SEQ ID NO: 82, SEQ ID NO: 89 and SEQ ID NO: 90 or SEQ ID NO: 91 and SEQ ID NO: 92; or
(d) SEQ ID NO: 95 and SEQ ID NO: 96 or SEQ ID NO: 101 and SEQ ID NO: 102.
15. The method of claim 10, wherein the method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified.
16. The method of claim 15, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising:
(a) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or complements thereof;
(b) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof;
(c) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 181, 182, 183, 184, 185, 186 or complements thereof; or
(d) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 187, 188, 189, 190 or complements thereof.
17. The method of claim 16, wherein the labeled nucleic acid probe comprises:
(a) a nucleic acid sequence comprising SEQ ID NOs: 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341 or 1342;
(b) a nucleic acid sequence comprising SEQ ID NOs: 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138 or 139;
(c) a nucleic acid sequence comprising SEQ ID NOs: 140, 141, 142, 143, 144, 145, 146, 147, 148 or 149; or
(d) a nucleic acid sequence comprising SEQ ID NOs: 150, 151, 152, 153 or 154.
18. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising:
(a) S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N;
(b) S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J;
(c) S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; or
(d) S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
19. The isolated polynucleotide of claim 18, wherein the polynucleotide comprises:
(a) a polynucleotide comprising:
(i) SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 1339 or 1340;
(ii) SEQ ID NOs: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77 or 78;
(iii) SEQ ID NOs: 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 or 92; or
(iv) SEQ ID NOs: 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103 or 104;
(b) a polynucleotide comprising:
(i) SEQ ID NOs: 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341 or 1342;
(ii) SEQ ID NOs: 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138 or 139;
(iii) SEQ ID NOs: 140, 141, 142, 143, 144, 145, 146, 147, 148 or 149; or
(iv) SEQ ID NOs: 150, 151, 152, 153 or 154;
(c) a polynucleotide having at least 90% sequence identity to the polynucleotides set forth in parts (a) or (b); or
(d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in parts (a) or (b).
20. A kit for detecting or selecting at least one soybean plant or soybean germplasm with tolerance or improved tolerance to Phytophthora infection, the kit comprising:
(a) primers or probes for detecting one or more marker loci associated with tolerance to Phytophthora infection, wherein the primers or probes are capable of detecting a marker locus, wherein:
(i) the at least one marker locus comprises S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N;
(ii) the at least one marker locus comprises S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N;
(iii) the at least one marker locus comprises S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J;
(iv) the at least one marker locus comprises S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; or
(v) the at least one marker locus comprises S08442-1, S08341-1 or a marker closely linked thereto on linkage group G; and
(b) instructions for using the primers or probes for detecting the one or more marker loci and correlating the detected marker loci with predicted tolerance to Phytophthora infection.