Patent application title:

CHIMERIC PESTIVIRUSES

Publication number:

US20170151321A1

Publication date:
Application number:

15/430,837

Filed date:

2017-02-13

Abstract:

The present invention relates to chimeric pestiviruses having utility as immunogenic compositions and vaccines. Also described herein are methods and kits for treating or preventing the spread of bovine viral diarrhea virus infection, as well as methods and kits for differentiating between vaccinated and wild-type infected animals.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C07K16/1081 »  CPC further

Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses, e.g. hepatitis E virus Togaviridae, e.g. flavivirus, rubella virus, hog cholera virus

G01N33/6854 »  CPC further

Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids Immunoglobulins

A61K2039/552 »  CPC further

Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies Veterinary vaccine

A61K39/12 »  CPC main

Medicinal preparations containing antigens or antibodies Viral antigens

G01N33/68 IPC

Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids

C12N7/00 »  CPC further

Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof

C07K14/005 »  CPC further

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses

C07K16/10 IPC

Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses, e.g. hepatitis E virus

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

The present application is a continuation of U.S. application Ser. No. 12/624,473, filed Nov. 24, 2009, an allowed application, and claims the benefit under 35 U.S.C. 119(e) of U.S. Provisional Application Nos. 61/119,594, filed Dec. 3, 2008, and 61/173,363, filed Apr. 28, 2009. The complete disclosure of each of the aforementioned applications is incorporated by reference herein, as if fully set forth.

FIELD OF THE INVENTION

The present invention relates to novel chimeric pestiviruses and their use in immunogenic compositions and vaccines. It also relates to methods and kits for treating or preventing the spread of bovine viral diarrhea virus infection. The present invention further relates to the use of the chimeric pestiviruses in methods and kits for differentiating between vaccinated animals and animals infected with a wild-type virus.

BACKGROUND

Pestiviruses, including bovine viral diarrhea virus (BVD virus, or BVDV), have been isolated from several species of animals, both domestic and wild. Identified hosts for BVDV include buffalo, antelope, reindeer and various deer species, while unique pestivirus species have been identified in giraffes and pronghorn antelope. BVDV is a small RNA virus of the family Flaviviridae. It is closely related to other pestiviruses which are the causative agents of border disease in sheep and classical swine fever in pigs. Recently a divergent pestivirus named Bungowannah pestivirus was identified as an etiologic agent of fetal infection of piglets in Australia.

Disease caused by BVDV particularly in cattle is widespread, and can be economically devastating. BVDV infection in cattle can result in breeding problems, and can cause abortions or premature births. BVDV is capable of crossing the placenta of pregnant cattle, and may result in the birth of persistently infected (PI) calves that are immunotolerant to the virus and persistently viremic for the rest of their lives. Infected cattle can also exhibit “mucosal disease”, characterized by elevated temperature, diarrhea, coughing and ulcerations of the alimentary mucosa. These persistently infected animals provide a source for dissemination of virus within the herd for further outbreaks of mucosal disease and are highly predisposed to infection with microorganisms responsible for causing enteric diseases or pneumonia.

BVDV is classified into one of two biotypes. Those of the “cp” biotype induce a cytopathic effect on cultured cells, whereas viruses of non-cytopathic, or “ncp”, biotype do not. In addition, two major genotypes (type 1 and 2) are recognized, both of which have been shown to cause a variety of clinical syndromes.

BVDV virions are 40 to 60 nm in diameter. The nucleocapsid of BVDV consists of a single molecule of RNA and the capsid protein C. The nucleocapsid is surrounded by a lipid membrane with two glycoproteins anchored in it, E1 and E2. A third glycoprotein, Erns, is loosely associated to the envelope. The genome of BVDV is approximately 12.5 kb in length, and contains a single open reading frame located between the 5′ and 3′ non-translated regions (NTRs). A polyprotein of approximately 438 kD is translated from this open reading frame, and is processed by cellular and viral proteases into at least eleven viral structural and nonstructural (NS) proteins (Tautz, et al., J. Virol. 71:5415-5422 (1997); Xu, et al., J. Virol. 71:5312-5322 (1997); Elbers, et al., J. Virol. 70:4131-4135 (1996); and Wiskerchen, et al., Virology 184:341-350 (1991)). The genomic order of BVDV is p20/Npro, p14/C, gp48/Erns, gp25/E1, gp53/E2, p54/NS2, p80/NS3, p10/NS4A, p32/NS4B, p58/NS5A and p75/NS5B. The three envelope proteins, gp48/Erns, gp25/E1 and gp53/E2, are heavily glycosylated. Erns (formerly referred to as E0 or gp48) forms homodimers, covalently linked by disulfides. The absence of a hydrophobic membrane anchor region suggests that Erns is loosely associated with the envelope. Erns induces high antibody titers in infected cattle, but the antisera has limited virus-neutralizing activity.

Among the BVDV vaccines currently available are those which contain chemically-inactivated wild-type virus. These vaccines typically require the administration of multiple doses, and result in a short-lived immune response; they also do not protect against fetal transmission of the virus. In sheep, a subunit vaccine based on a purified E2 protein has been reported. Although this vaccine appears to protect fetuses from becoming infected, protection is limited to only the homologous strain of virus, and there is no correlation between antibody titers and protection.

Modified live (ML) BVDV vaccines have been produced using virus that has been attenuated by repeated passaging in bovine or porcine cells, or by chemically-induced mutations that confer a temperature-sensitive phenotype on the virus. A single dose of a MLV BVDV vaccine has proven sufficient for providing protection from infection, and the duration of immunity can extend for years in vaccinated cattle. In addition, cross-protection has been reported using MLV vaccines (Martin, et al., In “Proceedings of the Conference of Research Workers in Animal Diseases”, 75:183 (1994)). However, existing MLV vaccines do not allow for the differentiation between vaccinated and naturally-infected animals.

Thus, it is clear that a need exists for new vaccines for controlling the spread of BVDV. Such a vaccine(s) could be invaluable in future national or regional BVDV eradication programs, and could also be combined with other cattle vaccines, representing a substantial advance in the industry. A more effective vaccine for controlling and monitoring the spread of BVDV would be a “marked” vaccine. Such a vaccine could either contain an additional antigenic determinant which is not present in wild-type virus, or lack an antigenic determinant which is present in wild-type virus. With respect to the former, vaccinated animals mount an immune response to the “marker” immunogenic determinant, while non-vaccinated animals do not. Through the use of an immunological assay directed against the marker determinant, vaccinated animals could be differentiated from non-vaccinated, naturally-infected animals by the presence of antibodies to the marker determinant. In the case of the latter strategy, animals infected with the wild-type virus mount an immune response to the marker determinant, while non-infected, vaccinated animals do not, as a result of the determinant not being present in the marked vaccine. Through the use of an immunological assay directed against the marker determinant, infected animals could be differentiated from vaccinated, non-infected animals. In both scenarios, by culling out the infected animals, the herd could, over time, become BVDV-free. In addition to the benefit of removing the threat of BVDV disease, certification of a herd as BVDV-free has direct freedom of trade economic benefits.

SUMMARY

In one embodiment, the present invention provides a chimeric pestivirus, wherein said chimeric pestivirus comprises a bovine viral diarrhea virus which does not express its homologous Erns protein, further wherein said chimeric pestivirus expresses a heterologous Erns protein derived from another pestivirus, or a natural, synthetic or genetic variant of said heterologous Erns protein.

In another embodiment, the present invention provides the chimeric pestivirus as described above, wherein the heterologous Erns protein of said chimeric pestivirus, or the natural, synthetic or genetic variant of said heterologous Erns protein, is derived from a pestivirus selected from the group consisting of a reindeer pestivirus, a giraffe pestivirus, and a pronghorn antelope pestivirus.

In a different embodiment, the present invention provides the chimeric pestivirus as described above, wherein the heterologous Erns protein of said chimeric pestivirus has at least one Erns epitope which is not present in wild-type bovine viral diarrhea virus.

In a separate embodiment, the present invention provides the chimeric pestivirus as described above, wherein the heterologous Erns protein of said chimeric pestivirus lacks at least one Erns epitope which is present in wild-type bovine viral diarrhea virus.

In one embodiment, the present invention provides a culture of the chimeric pestivirus as described above.

In another embodiment, the present invention provides a cell line or host cell comprising the chimeric pestivirus as described above.

In yet another embodiment, the present invention provides a polynucleotide molecule encoding for the chimeric pestivirus as described above.

In a different embodiment, the present invention provides an immunogenic composition comprising the chimeric pestivirus as described above and a veterinarily-acceptable carrier.

In a separate embodiment, the present invention provides the immunogenic composition as described above, wherein the veterinarily-acceptable carrier is an adjuvant.

In yet another embodiment, the present invention provides the immunogenic composition as described above, wherein said chimeric pestivirus is live attenuated.

In still another embodiment, the present invention provides the immunogenic composition as described above, wherein said chimeric pestivirus is inactivated.

In a different embodiment, the present invention provides the immunogenic composition as described above, further comprising one or more additional antigens useful for treating or preventing the spread of one or more additional pathogenic microorganisms in an animal.

In a separate embodiment, the present invention provides an immunogenic composition comprising the polynucleotide molecule encoding for the chimeric pestivirus as described above and a veterinarily-acceptable carrier.

In one embodiment, the present invention provides a vaccine comprising the chimeric pestivirus as described above and a veterinarily-acceptable carrier.

In another embodiment, the present invention provides the vaccine as described above, wherein the veterinarily-acceptable carrier is an adjuvant.

In a different embodiment, the present invention provides the vaccine as described above, wherein said chimeric pestivirus is live attenuated.

In yet another embodiment, the present invention provides the vaccine as described above, wherein said chimeric pestivirus is inactivated.

In still another embodiment, the present invention provides the vaccine as described above, further comprising one or more additional antigens useful for treating or preventing the spread of one or more additional pathogenic microorganisms in an animal.

In a separate embodiment, the present invention provides a vaccine comprising a polynucleotide molecule encoding for the chimeric pestivirus as described above and a veterinary acceptable carrier.

In one embodiment, the present invention provides a kit comprising, in at least one container, a vaccine comprising the chimeric pestivirus as described above.

In another embodiment, the present invention provides a method of treating or preventing the spread of bovine viral diarrhea virus infection, wherein a vaccine comprising the chimeric pestivirus as described above is administered to an animal.

In a different embodiment, the present invention provides method of vaccinating an animal, wherein a DIVA pestivirus vaccine is administered to said animal, and wherein said DIVA pestivirus vaccine comprises the chimeric pestivirus as described above, further wherein said chimeric pestivirus has at least one Erns epitope which is not present in wild-type bovine viral diarrhea virus.

In a separate embodiment, the present invention provides method of vaccinating an animal, wherein a DIVA pestivirus vaccine is administered to said animal, and wherein said DIVA vaccine comprises the chimeric pestivirus as described above, further wherein said chimeric pestivirus lacks at least one Erns epitope which is present in wild-type bovine viral diarrhea virus. In yet another embodiment, the present invention provides method of differentiating between an animal vaccinated with a vaccine comprising the chimeric pestivirus as described above and an animal infected with wild type bovine viral diarrhea virus, wherein the animal vaccinated with said vaccine generates antibodies to at least one Erns epitope which is present in the chimeric pestivirus of said vaccine, but which is not present in wild-type bovine viral diarrhea virus, said method comprising the steps of:

    • a) obtaining a serum sample from the animals;
    • b) assaying said samples for the presence or absence of the antibodies;
    • c) identifying the animal having said antibodies as having been vaccinated with said vaccine; and
    • d) identifying the animal lacking said antibodies as having been infected with the wild type BVDV.

In still another embodiment, the present invention provides method of differentiating between an animal infected with wild-type bovine viral diarrhea virus and an animal vaccinated with a vaccine comprising the chimeric pestivirus as described above, wherein the animal infected with wild type bovine viral diarrhea virus generates antibodies to at least one Erns epitope which is present in wild-type bovine viral diarrhea virus, but which is not present in the chimeric pestivirus of said vaccine, said method comprising the steps of:

    • a) obtaining a serum sample from the animals;
    • b) assaying said samples for the presence or absence of the antibodies;
    • c) identifying the animal having said antibodies as having been infected with the wild type BVDV; and
    • d) identifying the animal lacking said antibodies as having been vaccinated with said vaccine.

In one embodiment, the present invention provides diagnostic kit for differentiating between an animal vaccinated with a vaccine comprising the chimeric pestivirus as described above and an animal infected with wild type bovine viral diarrhea virus, said kit comprising reagents capable of detecting antibodies to at least one Erns epitope which is present in the chimeric pestivirus of the vaccine, but which is not present in wild-type bovine viral diarrhea virus.

In another embodiment, the present invention provides diagnostic kit for differentiating between an animal infected with wild type bovine viral diarrhea virus and an animal vaccinated with a vaccine comprising the chimeric pestivirus as described above, said kit comprising reagents capable of detecting antibodies to at least one Erns epitope which is present in wild-type bovine viral diarrhea virus, but which is not present in the chimeric pestivirus of the vaccine.

In yet another embodiment, the present invention provides an antibody which recognizes an epitope of Erns which is present in the chimeric pestivirus as described above, but which epitope is not present in wild-type bovine viral diarrhea virus.

In a different embodiment, the present invention provides an antibody which recognizes an epitope present in wild-type bovine viral diarrhea virus, but which epitope is not present in the chimeric pestivirus as described above.

In another embodiment, a chimeric pestivirus as described herein is used in the preparation of a medicament for the prevention or treatment of infections caused by BVDV.

DETAILED DESCRIPTION

The following definitions may be applied to terms employed in the description of embodiments of the invention. The following definitions supercede any contradictory definitions contained in each individual reference incorporated herein by reference.

Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

The term “amino acid,” as used herein, refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, for example, hydroxyproline, carboxyglutamate, and O-phosphoserine. Stereoisomers (e.g., D-amino acids) of the twenty conventional amino acids, unnatural amino acids such as α and α-disubstituted amino acids, N-alkyl amino acids, lactic acid, and other unconventional amino acids may also be suitable components for polypeptides of the present invention. Examples of unconventional amino acids include: 4-hydroxyproline, γ-carboxyglutamate, ε-N,N,N-trimethyllysine, ε-N-acetyllysine, O-phosphoserine, N-acetylserine, N-formylmethionine, 3-methylhistidine, 5-hydroxylysine, σ-N-methylarginine, and other similar amino acids and imino acids.

Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group. Exemplary amino acid analogs include, for example, homoserine, norleucine, methionine sulfoxide, and methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same essential chemical structure as a naturally occurring amino acid. Amino acid mimetics refer to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that function in a manner similar to a naturally occurring amino acid.

Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.

The term “animal” as used herein, is meant to include any animal that is susceptible to BVDV infections, including but not limited to bovine, ovine, caprine and porcine species, both domesticated and wild.

The term “antibody” or “antibodies”, as used herein, refers to an immunoglobulin molecule able to bind to an antigen by means of recognition of an epitope. Antibodies can be a polyclonal mixture or monoclonal. Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources, or can be immunoreactive portions of intact immunoglobulins. Antibodies can exist in a variety of forms including, for example, as, Fv, Fab′, F(ab′)2, as well as in single chains.

The term “antigen” as used herein refers to a molecule that contains one or more epitopes (linear, conformational or both) that upon exposure to a subject will induce an immune response that is specific for that antigen. The term “antigen” can refer to attenuated, inactivated or modified live bacteria, viruses, fungi, parasites or other microbes. The term “antigen” as used herein can also refer to a subunit antigen, which is separate and discrete from a whole organism with which the antigen is associated in nature. The term “antigen” can also refer to antibodies, such as anti-idiotype antibodies or fragments thereof, and to synthetic peptide mimotopes that can mimic an antigen or antigenic determinant (epitope). The term “antigen” can also refer to an oligonucleotide or polynucleotide that expresses an antigen or antigenic determinant in vivo, such as in DNA immunization applications.

The terms “BVDV”, “BVDV isolates” or “BVDV strains” as used herein refer to bovine viral diarrhea viruses, including but not limited to type I and type II, that consist of the viral genome, associated proteins, and other chemical constituents (such as lipids). A number of type I and type II bovine viral diarrhea viruses are known to those skilled in the art and are available through, e.g., the American Type Culture Collection (ATCC®). The bovine viral diarrhea virus has a genome in the form of RNA. RNA can be reverse transcribed into DNA for use in cloning. Thus, references made herein to nucleic acid and bovine viral diarrhea virus sequences encompass both viral RNA sequences and DNA sequences derived from the viral RNA sequences.

The term “cell line” or “host cell”, as used herein means a prokaryotic or eukaryotic cell in which a virus can replicate and/or be maintained.

The term “chimeric” or “chimera” as used herein means a microorganism, for example a virus, containing genetic or physical components derived from more than one progenitor.

The term “culture” as used herein means a population of cells or microorganisms growing in the absence of other species or types.

The term “DIVA” as used herein means a vaccine which is able to differentiate infected from vaccinated animals.

An “epitope” is the specific site of the antigen which binds to a T-cell receptor or specific antibody, and typically comprises from about 3 amino acid residues to about 20 amino acid residues.

The term “heterologous”, as used herein, means derived from a different species or strain.

The term “homologous”, as used herein, means derived from the same species or strain.

The term “immunogenic composition”, as used herein, means a composition that generates an immune response (i.e., has immunogenic activity) when administered alone or with a pharmaceutically acceptable carrier, to an animal. The immune response can be a cellular immune response mediated primarily by cytotoxic T-cells, or a humoral immune response mediated primarily by helper T-cells, which in turn activates B-cells leading to antibody production.

The term “pathogen” or “pathogenic microorganism” as used herein means a microorganism—for example a virus, bacterium, fungus, protozoan, or helminth—which is capable of inducing or causing a disease, illness, or abnormal state in its host animal.

The term “pestivirus” as used herein means a RNA virus from the genus Pestivirus, of the family Flaviviridae. Pestiviruses include, but are not limited to, BVDV (type 1 and type 2), Classical Swine Fever Virus (CSFV), and Border Disease Virus (BDV), as well as pestiviruses isolated from species such as wild boar, buffalo, eland, bison, alpaca, pudu, bongo, various deer species, giraffe, reindeer, chamois and pronghorn antelope (Vilcek and Nettleton; Vet Microbiol. 116:1-12 (2006))

The term “polynucleotide molecule” as used herein means an organic polymer molecule composed of nucleotide monomers covalently bonded in a chain. DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are examples of polynucleotides with distinct biological function.

The terms “prevent”, “preventing” or “prevention”, and the like, as used herein, mean to inhibit the replication of a microorganism, to inhibit transmission of a microorganism, or to inhibit a microorganism from establishing itself in its host. These terms and the like as used herein can also mean to inhibit or block one or more signs or symptoms of infection.

The term “therapeutically effective amount” as used herein means an amount of a microorganism, or a subunit antigen, or polypeptides, or polynucleotide molecules, and combinations thereof, sufficient to elicit an immune response in the subject to which it is administered. The immune response can comprise, without limitation, induction of cellular and/or humoral immunity.

The terms “treat”, “treating” or “treatment”, and the like, as used herein mean to reduce or eliminate an infection by a microorganism. These terms and the like as used herein can also mean to reduce the replication of a microorganism, to reduce the transmission of a microorganism, or to reduce the ability of a microorganism to establish itself in its host. These terms and the like as used herein can also mean to reduce, ameliorate, or eliminate one or more signs or symptoms of infection by a microorganism, or accelerate the recovery from infection by a microorganism.

The terms “vaccine” and “vaccine composition,” as used herein, mean a composition which prevents or reduces an infection, or which prevents or reduces one or more signs or symptoms of infection. The protective effects of a vaccine composition against a pathogen are normally achieved by inducing in the subject an immune response, either a cell-mediated or a humoral immune response or a combination of both. Generally speaking, abolished or reduced incidences of infection, amelioration of the signs or symptoms, or accelerated elimination of the microorganism from the infected subjects are indicative of the protective effects of a vaccine composition. The vaccine compositions of the present invention provide protective effects against infections caused by BVDV.

The term “variant,” as used herein, refers to a derivation of a given protein and/or gene sequence, wherein the derived sequence is essentially the same as the given sequence, but for mutational differences. Said differences may be naturally-occurring, or synthetically- or genetically-generated.

The term “veterinarily-acceptable carrier” as used herein refers to substances, which are within the scope of sound medical judgment, suitable for use in contact with the tissues of animals without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit-to-risk ratio, and effective for their intended use.

The following description is provided to aid those skilled in the art in practicing the present invention. Even so, this description should not be construed to unduly limit the present invention as modifications and variations in the embodiments discussed herein can be made by those of ordinary skill in the art without departing from the spirit or scope of the present inventive discovery.

Viruses, Immunogenic Compositions, and Vaccines

The present invention provides immunogenic compositions and vaccines comprising one or more chimeric pestiviruses, wherein said chimeric pestiviruses comprise a bovine viral diarrhea virus which does not express its homologous Erns protein, but wherein said chimeric pestivirus expresses a heterologous Erns protein derived from another pestivirus, or a natural, synthetic or genetic variant of said heterologous Erns protein. The chimeric pestivirus can be selected from, but is not limited to, the group consisting of BVDV/reindeer pestivirus, BVDV/giraffe pestivirus, and BVDV/pronghorn antelope pestivirus chimeras.

In one embodiment, the BVDV/giraffe chimeric pestivirus is the strain deposited as UC 25547 with American Type Culture Collection (ATCCÂŽ), 10801 University Boulevard, Manassas, Va. 20110-2209, USA, and given the ATCCÂŽ deposit designation of PTA-9938. In one embodiment, the BVDV/pronghorn antelope chimeric pestivirus is the strain deposited as UC 25548 with ATCCÂŽ and given the ATCCÂŽ deposit designation of PTA-9939. In one embodiment, the BVDV/reindeer chimeric pestivirus is the strain deposited as UC 25549 with ATCCÂŽ and given the ATCCÂŽ deposit designation of PTA-9940.

Chimeric pestiviruses of the present invention can be propagated in cells, cell lines and host cells. Said cells, cell lines or host cells may be for example, but not limited to, mammalian cells and non-mammalian cells, including insect and plant cells. Cells, cell lines and host cells in which chimeric pestiviruses of the present invention may be propagated are readily known and accessible to those of ordinary skill in the art.

The chimeric pestiviruses of the present invention can be attenuated or inactivated prior to use in an immunogenic composition or vaccine. Methods of attenuation and inactivation are well known to those skilled in the art. Methods for attenuation include, but are not limited to, serial passage in cell culture on a suitable cell line, ultraviolet irradiation, and chemical mutagenesis. Methods for inactivation include, but are not limited to, treatment with formalin, betapropriolactone (BPL) or binary ethyleneimine (BEI), or other methods known to those skilled in the art.

Inactivation by formalin can be performed by mixing the virus suspension with 37% formaldehyde to a final formaldehyde concentration of 0.05%. The virus-formaldehyde mixture is mixed by constant stirring for approximately 24 hours at room temperature. The inactivated virus mixture is then tested for residual live virus by assaying for growth on a suitable cell line.

Inactivation by BEI can be performed by mixing the virus suspension of the present invention with 0.1 M BEI (2-bromo-ethylamine in 0.175 N NaOH) to a final BEI concentration of 1 mM. The virus-BEI mixture is mixed by constant stirring for approximately 48 hours at room temperature, followed by the addition of 1.0 M sodium thiosulfate to a final concentration of 0.1 mM. Mixing is continued for an additional two hours. The inactivated virus mixture is tested for residual live virus by assaying for growth on a suitable cell line.

Immunogenic compositions and vaccines of the present invention can include one or more veterinarily-acceptable carriers. As used herein, a “veterinarily-acceptable carrier” includes any and all solvents, dispersion media, coatings, adjuvants, stabilizing agents, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption delaying agents, and the like. Diluents can include water, saline, dextrose, ethanol, glycerol, and the like. Isotonic agents can include sodium chloride, dextrose, mannitol, sorbitol, and lactose, among others known to those skilled in the art. Stabilizers include albumin, among others known to the skilled artisan. Preservatives include merthiolate, among others known to the skilled artisan.

Adjuvants include, but are not limited to, the RIBI adjuvant system (Ribi Inc.), alum, aluminum hydroxide gel, oil-in water emulsions, water-in-oil emulsions such as, e.g., Freund's complete and incomplete adjuvants, Block co polymer (CytRx, Atlanta Ga.), SAF-M (Chiron, Emeryville Calif.), AMPHIGENÂŽ adjuvant, saponin, Quil A, QS-21 (Cambridge Biotech Inc., Cambridge Mass.), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, Ala.) or other saponin fractions, monophosphoryl lipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin from E. coli (recombinant or otherwise), cholera toxin, or muramyl dipeptide, among many others known to those skilled in the art. The amounts and concentrations of adjuvants and additives useful in the context of the present invention can readily be determined by the skilled artisan. In one embodiment, the present invention contemplates immunogenic compositions and vaccines comprising from about 50 Îźg to about 2000 Îźg of adjuvant. In another embodiment adjuvant is included in an amount from about 100 Îźg to about 1500 Îźg, or from about 250 Îźg to about 1000 Îźg, or from about 350 Îźg to about 750 Îźg. In another embodiment, adjuvant is included in an amount of about 500 Îźg/2 ml dose of the immunogenic composition or vaccine.

The immunogenic compositions and vaccines can also include antibiotics. Such antibiotics include, but are not limited to, those from the classes of aminoglycosides, carbapenems, cephalosporins, glycopeptides, macrolides, penicillins, polypeptides, quinolones, sulfonamides, and tetracyclines. In one embodiment, the present invention contemplates immunogenic compositions and vaccines comprising from about 1 Îźg/ml to about 60 Îźg/ml of antibiotic. In another embodiment, the immunogenic compositions and vaccines comprise from about 5 Îźg/ml to about 55 Îźg/ml of antibiotic, or from about 10 Îźg/ml to about 50 Îźg/ml of antibiotic, or from about 15 Îźg/ml to about 45 Îźg/ml of antibiotic, or from about 20 Îźg/ml to about 40 Îźg/ml of antibiotic, or from about 25 Îźg/ml to about 35 Îźg/ml of antibiotic. In yet another embodiment, the immunogenic compositions and vaccines comprise less than about 30 Îźg/ml of antibiotic.

Immunogenic compositions and vaccines of the invention can further include one or more other immunomodulatory agents such as, e.g., interleukins, interferons, or other cytokines, suitable amounts of which can be determined by the skilled artisan.

Immunogenic compositions and vaccines of the present invention can include one or more polynucleotide molecules encoding for a chimeric pestivirus. Either DNA or RNA molecules encoding all of the chimeric pestivirus genome, or one or more open reading frames, can be used in immunogenic compositions or vaccines. The DNA or RNA molecule can be administered absent other agents, or it can be administered together with an agent facilitating cellular uptake (e.g., liposomes or cationic lipids). Total polynucleotide in the immunogenic composition or vaccine will generally be between about 0.1 Îźg/ml and about 5.0 mg/ml. In another embodiment, the total polynucleotide in the immunogenic composition or vaccine will be from about 1 Îźg/ml and about 4.0 mg/ml, or from about 10 Îźg/ml and about 3.0 mg/ml, or from about 100 Îźg/ml and about 2.0 mg/ml. Vaccines and vaccination procedures that utilize nucleic acids (DNA or mRNA) have been well described in the art, for example, U.S. Pat. No. 5,703,055, U.S. Pat. No. 5,580,859, U.S. Pat. No. 5,589,466, all of which are incorporated herein by reference.

Immunogenic compositions and vaccines of the present invention can also include additional BVDV antigens, for example, those described in U.S. Pat. No. 6,060,457, U.S. Pat. No. 6,015,795, U.S. Pat. No. 6,001,613, and U.S. Pat. No. 5,593,873, all of which are herein incorporated by reference.

In addition to one or more chimeric pestiviruses, immunogenic compositions and vaccines can include other antigens. Antigens can be in the form of an inactivated whole or partial preparation of the microorganism, or in the form of antigenic molecules obtained by genetic engineering techniques or chemical synthesis. Other antigens appropriate for use in accordance with the present invention include, but are not limited to, those derived from pathogenic bacteria such as Haemophilus somnus, Haemophilus parasuis, Bordetella bronchiseptica, Bacillus anthracis, Actinobacillus pleuropneumonie, Pasteurella multocida, Mannhemia haemolytica, Mycoplasma bovis, Mycobacterium bovis, Mycobacterium paratuberculosis, Clostridial spp., Streptococcus uberis, Staphylococcus aureus, Erysipelothrix rhusopathiae, Chlamydia spp., Brucella spp., Vibrio spp., Salmonella enterica serovars and Leptospira spp. Antigens can also be derived from pathogenic fungi such as Candida, protozoa such as Cryptosporidium parvum, Neospora canium, Toxoplasma gondii, Eimeria spp., Babesia spp., Giardia spp., or helminths such as Ostertagia, Cooperia, Haemonchus, and Fasciola. Additional antigens include pathogenic viruses such as bovine coronavirus, bovine herpesviruses-1,3,6, bovine parainfluenza virus, bovine respiratory syncytial virus, bovine leukosis virus, rinderpest virus, foot and mouth disease virus, rabies virus, and influenza virus.

Forms, Dosages, Routes of Administration

Immunogenic compositions and vaccines of the present invention can be administered to animals to induce an effective immune response against BVDV. Accordingly, the present invention provides methods of stimulating an effective immune response against BVDV, by administering to an animal a therapeutically effective amount of an immunogenic composition or vaccine of the present invention described herein.

Immunogenic compositions and vaccines of the present invention can be made in various forms depending upon the route of administration. For example, the immunogenic compositions and vaccines can be made in the form of sterile aqueous solutions or dispersions suitable for injectable use, or made in lyophilized forms using freeze-drying techniques. Lyophilized immunogenic compositions and vaccines are typically maintained at about 4° C., and can be reconstituted in a stabilizing solution, e.g., saline or and HEPES, with or without adjuvant. Immunogenic compositions and vaccines can also be made in the form of suspensions or emulsions.

Immunogenic compositions and vaccines of the present invention include a therapeutically effective amount of one or more of the above-described chimeric pestiviruses. Purified viruses can be used directly in an immunogenic composition or vaccine, or can be further attenuated, or inactivated. Typically, an immunogenic composition or vaccine contains between about 1×102 and about 1×1012 virus particles, or between about 1×103 and about 1×1011 virus particles, or between about 1×104 and about 1×1010 virus particles, or between about 1×105 and about 1×109 virus particles, or between about 1×106 and about 1×108 virus particles. The precise amount of a virus in an immunogenic composition or vaccine effective to provide a protective effect can be determined by a skilled artisan.

The immunogenic compositions and vaccines generally comprise a veterinarily-acceptable carrier in a volume of between about 0.5 ml and about 5 ml. In another embodiment the volume of the carrier is between about 1 ml and about 4 ml, or between about 2 ml and about 3 ml. In another embodiment, the volume of the carrier is about 1 ml, or is about 2 ml, or is about 5 ml. Veterinarily-acceptable carriers suitable for use in immunogenic compositions and vaccines can be any of those described hereinabove.

Those skilled in the art can readily determine whether a virus needs to be attenuated or inactivated before administration. In another embodiment of the present invention, a chimeric pestivirus can be administered directly to an animal without additional attenuation. The amount of a virus that is therapeutically effective can vary depending on the particular virus used, the condition of the animal and/or the degree of infection, and can be determined by a skilled artisan.

In accordance with the methods of the present invention, a single dose can be administered to animals, or, alternatively, two or more inoculations can take place with intervals of from about two to about ten weeks. Boosting regimens can be required and the dosage regimen can be adjusted to provide optimal immunization. Those skilled in the art can readily determine the optimal administration regimen.

Immunogenic compositions and vaccines can be administered directly into the bloodstream, into muscle, or into an internal organ. Suitable means for parenteral administration include intravenous, intraarterial, intraperitoneal, intrathecal, intraventricular, intraurethral, intrasternal, intracranial, intramuscular and subcutaneous. Suitable devices for parenteral administration include needle (including microneedle) injectors, needle-free injectors and infusion techniques.

Parenteral formulations are typically aqueous solutions which can contain excipients such as salts, carbohydrates and buffering agents (preferably to a pH of from about 3 to about 9, or from about 4 to about 8, or from about 5 to about 7.5, or from about 6 to about 7.5, or about 7 to about 7.5), but, for some applications, they can be more suitably formulated as a sterile non-aqueous solution or as a dried form to be used in conjunction with a suitable vehicle such as sterile, pyrogen-free water.

The preparation of parenteral formulations under sterile conditions, for example, by lyophilisation, can readily be accomplished using standard pharmaceutical techniques well known to those skilled in the art.

The solubility of compounds used in the preparation of parenteral solutions can be increased by the use of appropriate formulation techniques known to the skilled artisan, such as the incorporation of solubility-enhancing agents including buffers, salts, surfactants, liposomes, cyclodextrins, and the like.

Formulations for parenteral administration can be formulated to be immediate and/or modified release. Modified release formulations include delayed, sustained, pulsed, controlled, targeted and programmed release. Thus compounds of the invention can be formulated as a solid, semi-solid, or thixotropic liquid for administration as an implanted depot providing modified release of the active compound. Examples of such formulations include drug-coated stents and poly(dl-lactic-coglycolic)acid (PGLA) microspheres.

Immunogenic compositions and vaccines of the present invention can also be administered topically to the skin or mucosa, that is, dermally or transdermally. Typical formulations for this purpose include gels, hydrogels, lotions, solutions, creams, ointments, dusting powders, dressings, foams, films, skin patches, wafers, implants, sponges, fibres, bandages and microemulsions. Liposomes can also be used. Typical carriers include alcohol, water, mineral oil, liquid petrolatum, white petrolatum, glycerin, polyethylene glycol and propylene glycol. Penetration enhancers can be incorporated. See, for example, Finnin and Morgan, J. Pharm Sci, 88 (10):955-958 (1999).

Other means of topical administration include delivery by electroporation, iontophoresis, phonophoresis, sonophoresis and microneedle or needle-free (e.g. Powderject™, Bioject™, etc.) injection.

Formulations for topical administration can be formulated to be immediate and/or modified release. Modified release formulations include delayed, sustained, pulsed, controlled, targeted and programmed release.

Immunogenic compositions and vaccines can also be administered intranasally or by inhalation, typically in the form of a dry powder (either alone or as a mixture, for example, in a dry blend with lactose, or as a mixed component particle, for example, mixed with phospholipids, such as phosphatidylcholine) from a dry powder inhaler or as an aerosol spray from a pressurized container, pump, spray, atomizer (preferably an atomizer using electrohydrodynamics to produce a fine mist), or nebulizer, with or without the use of a suitable propellant, such as 1,1,1,2-tetrafluoroethane or 1,1,1,2,3,3,3-heptafluoropropane. For intranasal use, the powder can comprise a bioadhesive agent, for example, chitosan or cyclodextrin.

The pressurized container, pump, spray, atomizer, or nebulizer contains a solution or suspension of the compound(s) of the invention comprising, for example, ethanol, aqueous ethanol, or a suitable alternative agent for dispersing, solubilizing, or extending release of the active, a propellant(s) as solvent and an optional surfactant, such as sorbitan trioleate, oleic acid, or an oligolactic acid.

Prior to use in a dry powder or suspension formulation, the drug product is generally micronized to a size suitable for delivery by inhalation (typically less than about 5 microns). This can be achieved by any appropriate comminuting method, such as spiral jet milling, fluid bed jet milling, supercritical fluid processing to form nanoparticles, high pressure homogenization, or spray drying.

Capsules (made, for example, from gelatin or hydroxypropylmethylcellulose), blisters and cartridges for use in an inhaler or insufflator can be formulated to contain a powder mix of the compound of the invention, a suitable powder base such as lactose or starch and a performance modifier such as l-leucine, mannitol, or magnesium stearate. The lactose can be anhydrous or in the form of the monohydrate. Other suitable excipients include dextran, glucose, maltose, sorbitol, xylitol, fructose, sucrose and trehalose.

A suitable solution formulation for use in an atomizer using electrohydrodynamics to produce a fine mist can contain from about 1 Îźg to about 20 mg of the compound of the invention per actuation and the actuation volume can vary from about 1 Îźl to about 100 Îźl. In another embodiment, the amount of compound per actuation can range from about 100 Îźg to about 15 mg, or from about 500 Îźg to about 10 mg, or from about 1 mg to about 10 mg, or from about 2.5 Îźg to about 5 mg. In another embodiment, the actuation volume can range from about 5 Îźl to about 75 Îźl, or from about 10 Îźl to about 50 Îźl, or from about 15 Îźl to about 25 Îźl. A typical formulation can comprise the compound of the invention, propylene glycol, sterile water, ethanol and sodium chloride. Alternative solvents which can be used instead of propylene glycol include glycerol and polyethylene glycol.

Formulations for inhaled/intranasal administration can be formulated to be immediate and/or modified release using, for example, PGLA. Modified release formulations include delayed, sustained, pulsed, controlled, targeted and programmed release.

In the case of dry powder inhalers and aerosols, the dosage unit is generally determined by means of a valve which delivers a metered amount. Units in accordance with the invention are typically arranged to administer a metered dose or “puff” containing from about 10 ng to about 100 μg of the compound of the invention. In another embodiment, the amount of compound administered in a metered dose is from about 50 ng to about 75 μg, or from about 100 ng to about 50 μg, or from about 500 ng to about 25 μg, or from about 750 ng to about 10 μg, or from about 1 μg to about 5 μg. The overall daily dose will typically be in the range from about 1 μg to about 100 mg which can be administered in a single dose or, more usually, as divided doses throughout the day. In another embodiment, the overall daily dose can range from about 50 μg to about 75 mg, or from about 100 μg to about 50 mg, or from about 500 μg to about 25 mg, or from about 750 μg to about 10 mg, or from about 1 mg to about 5 mg.

Immunogenic compositions and vaccines of the present invention can also be administered orally or perorally, that is into a subject's body through or by way of the mouth and involves swallowing or transport through the oral mucosa (e.g., sublingual or buccal absorption) or both. Suitable flavors, such as menthol and levomenthol, or sweeteners, such as saccharin or saccharin sodium, can be added to those formulations of the invention intended for oral or peroral administration.

Immunogenic compositions and vaccines of the present invention can be administered rectally or vaginally, for example, in the form of a suppository, pessary, or enema. Cocoa butter is a traditional suppository base, but various alternatives can be used as appropriate. Formulations for rectal/vaginal administration can be formulated to be immediate and/or modified release. Modified release formulations include delayed, sustained, pulsed, controlled, targeted and programmed release.

Immunogenic compositions and vaccines of the present invention can also be administered directly to the eye or ear, typically in the form of drops of a micronized suspension or solution in isotonic, pH-adjusted, sterile saline. Other formulations suitable for ocular and aural administration include ointments, biodegradable (e.g. absorbable gel sponges, collagen) and non-biodegradable (e.g. silicone) implants, wafers, lenses and particulate or vesicular systems, such as niosomes or liposomes. A polymer such as crossed-linked polyacrylic acid, polyvinylalcohol, hyaluronic acid, a cellulosic polymer, for example, hydroxypropylmethylcellulose, hydroxyethylcellulose, or methyl cellulose, or a heteropolysaccharide polymer, for example, gelan gum, can be incorporated together with a preservative, such as benzalkonium chloride. Such formulations can also be delivered by iontophoresis.

Formulations for ocular/aural administration can be formulated to be immediate and/or modified release. Modified release formulations include delayed, sustained, pulsed, controlled, targeted and programmed release.

The immunogenic compositions and vaccines of the present invention can be used in the preparation of a medicament for treating or preventing the spread of bovine viral diarrhea virus infection in an animal.

The immunogenic compositions and vaccines of the present invention can be used in the preparation of a medicament for administering to an animal, wherein the medicament is a DIVA pestivirus vaccine comprising a chimeric pestivirus comprising a bovine viral diarrhea virus which does not express its homologous Erns protein, and wherein said chimeric pestivirus expresses a heterologous Erns protein derived from another pestivirus, or a natural, synthetic or genetic variant of said heterologous Erns protein. In one embodiment, the chimeric pestivirus has at least one Erns epitope which is not present in wild-type bovine viral diarrhea virus. In another embodiment the chimeric pestivirus lacks at least one Erns epitope which is present in wild-type bovine viral diarrhea virus.

Detection, Diagnostic Methods

The present invention provides methods of determining the origin of a pestivirus present in an animal subject.

Vaccination which utilizes a DIVA vaccine—one which is able to differentiate infected from vaccinated animals—provides a means for determining the origin of a pestivirus present in an animal subject. This differentiation can be accomplished via any of various diagnostic methods, including but not limited to ELISA, Western blotting and PCR. These and other methods are readily recognized and known to one of ordinary skill in the art.

The chimeric pestiviruses of the present invention can be distinguished from wild-type BVDV strains in both their genomic composition and proteins expressed. Such distinction allows for discrimination between vaccinated and infected animals. For example, a determination can be made as to whether an animal testing positive for BVDV in certain laboratory tests carries a wild-type BVDV strain, or carries a chimeric pestivirus of the present invention previously obtained through vaccination.

A variety of assays can be employed for making the determination. For example, virus can be isolated from the animal testing positive for BVDV, and nucleic acid-based assays can be used to determine the presence of a chimeric pestivirus genome, indicative of prior vaccination. The nucleic acid-based assays include Southern or Northern blot analysis, PCR, and sequencing. Alternatively, protein-based assays can be employed. In protein-based assays, cells or tissues suspected of an infection can be isolated from the animal testing positive for BVDV. Cellular extracts can be made from such cells or tissues and can be subjected to, e.g., Western Blot, using appropriate antibodies against viral proteins that can distinctively identify the presence of either the chimeric pestivirus previously inoculated, or wild-type BVDV.

The extent and nature of the immune responses induced in the animal can be assessed by using a variety of techniques. For example, sera can be collected from the inoculated animals and tested for the presence or absence of antibodies specific for the chimeric virus, e.g., in a conventional virus neutralization assay. Detection of responding cytotoxic T-lymphocytes (CTLs) in lymphoid tissues can be achieved by assays such as T cell proliferation, as indicative of the induction of a cellular immune response. The relevant techniques are well described in the art, e.g., Coligan et al. Current Protocols in Immunology, John Wiley & Sons Inc. (1994).

KITS

Inasmuch as it may be desirable to administer an immunogenic composition or vaccine in combination with additional compounds, for example, for the purpose of treating a particular disease or condition, it is within the scope of the present invention that an immunogenic composition or vaccine can conveniently be included in, or combined in, the form of a kit suitable for administration or co-administration of the compositions.

Thus, kits of the present invention can comprise one or more separate pharmaceutical compositions, at least one of which is an immunogenic composition or vaccine in accordance with the present invention, and a means for separately retaining said compositions, such as a container, divided bottle, or divided foil packet. An example of such a kit is a syringe and needle, and the like. A kit of the present invention is particularly suitable for administering different dosage forms, for example, oral or parenteral, for administering the separate compositions at different dosage intervals, or for titrating the separate compositions against one another. To assist one administering a composition of the present invention, the kit typically comprises directions for administration.

Another kit of the present invention can comprise one or more reagents useful for the detection of and differentiation between a BVDV-infected animal and a chimeric pestivirus-vaccinated animal. The kit can include reagents for analyzing a sample for the presence of whole BVDV, or BVDV polypeptides, epitopes or polynucleotide sequences which are not present in the chimeric pestivirus of the immunogenic composition or vaccine. Alternatively, kits of the present invention can include reagents for analyzing a sample for the presence of a chimeric pestivirus, or polypeptides, epitopes or polynucleotide sequences which are not present in wild-type BVDV. The presence of virus, polypeptides, or polynucleotide sequences can be determined using antibodies, PCR, hybridization, and other detection methods known to those of skill in the art.

Another kit of the present invention can provide reagents for the detection of antibodies against particular epitopes. The epitopes are either present in the chimeric pestivirus of the present invention and not present in wild type BVDV, or alternatively, are present in wild-type BVDV and not present in the chimeric pestivirus of the present invention. Such reagents are useful for analyzing a sample for the presence of antibodies, and are readily known and available to one of ordinary skill in the art. The presence of antibodies can be determined using standard detection methods known to those of skill in the art.

In certain embodiments, the kits can include a set of printed instructions or a label indicating that the kit is useful for the detection and differentiation of BVDV-infected animals from chimeric pestivirus-vaccinated animals.

Antibody, Antibodies

Antibodies can either be monoclonal, polyclonal, or recombinant. Conveniently, the antibodies can be prepared against the immunogen or a portion thereof. For example, a synthetic peptide based on the amino acid sequence of the immunogen, or prepared recombinantly by cloning techniques or the natural gene product and/or portions thereof can be isolated and used as the immunogen. Immunogens can be used to produce antibodies by standard antibody production technology well known to those skilled in the art, such as described generally in Harlow and Lane, “Antibodies: A Laboratory Manual”, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., (1988) and Borrebaeck, “Antibody Engineering—A Practical Guide”, W.H. Freeman and Co. (1992). Antibody fragments can also be prepared from the antibodies, and include Fab, F(ab′)2, and Fv, by methods known to those skilled in the art.

In the production of antibodies, screening for the desired antibody can be accomplished by standard methods in immunology known in the art. Techniques not specifically described are generally followed as in Stites, et al. (eds), “Basic and Clinical Immunology” (8th Edition), Appleton and Lange, Norwalk, Conn. (1994) and Mishell and Shiigi (eds), “Selected Methods in Cellular Immunology”, W.H. Freeman and Co., New York (1980). In general, ELISAs and Western blotting are the preferred types of immunoassays. Both assays are well known to those skilled in the art. Both polyclonal and monoclonal antibodies can be used in the assays. The antibody can be bound to a solid support substrate or conjugated with a detectable moiety or be both bound and conjugated as is well known in the art. (For a general discussion of conjugation of fluorescent or enzymatic moieties, see Johnstone and Thorpe, “Immunochemistry in Practice”, Blackwell Scientific Publications, Oxford (1982).) The binding of antibodies to a solid support substrate is also well known in the art. (For a general discussion, see Harlow and Lane (1988) and Borrebaeck (1992).) The detectable moieties contemplated for use in the present invention can include, but are not limited to, fluorescent, metallic, enzymatic and radioactive markers such as biotin, gold, ferritin, alkaline phosphatase, b-galactosidase, peroxidase, urease, fluorescein, rhodamine, tritium, 14C and iodination.

The present invention is further illustrated by, but by no means limited to, the following examples.

Example 1. Construction and Serological Characterization of Chimeric Pestiviruses

E. coli K12 GM2163 [F-ara-14, leuB6, thi-1, fhuA31, lacY1, tsx-78, galK2, galT22, supE44, hisG4, rpsL136, (Strr), xyl-5, mtl-1, dam13::Tn9(Camr), dcm-6, mcrB1, hsdR2(rk−mk−), mcrA] harbors a plasmid containing the full length genomic cDNA of bovine viral diarrhea virus strain NADL (BVDV-NADL), obtained from Dr. R. Donis, University of Nebraska.

RD cells (bovine testicular cells transformed with SV40; obtained from Dr. R. Donis) were maintained in OptiMEM supplemented with 3% horse serum, 1% non-essential amino acids (NEAA) in modified Eagle's medium (MEM), 2 mM GlutaMax and 10 ug/ml Gentamicin. BK-6 cells were obtained from Pfizer Global Manufacturing (PGM). Cells were grown in Dulbecco's modified Eagles' medium (DMEM) supplemented with 5% horse serum or donor calf serum (PGM), 2 mM Glutamax, and 1% Antibiotic and Antimycotic. All medium components except where indicated were purchased from Invitrogen (Carlsbad, Calif.). All cells were maintained at 37° C. in a 5% CO2 environment.

Monoclonal antibody (MAb) 15C5 specific to BVDV Erns was purchased from IDEXX (Westbrook, Me.). MAb 20.10.6 against BVDV NS3 was provided by Dr. E. Dubovi (Cornell University). MAbs WS 363, WS 373 and WS 371, having specificity for the Border Disease virus (BDV) Erns protein, were obtained from Veterinary Laboratories Agency (Surrey, UK). Bovine serum samples #77, #816, #1281, and #1434 were obtained internally at Pfizer. Chimeric pestiviruses were generated by replacing the Erns gene of the BVDV-NADL strain with the Erns gene of giraffe (G-Erns), reindeer (R-Erns), or pronghorn antelope (P-Erns) pestivirus using an overlapping PCR method. Either PfuUltra™ II fusion HS DNA polymerase (Stratagene; La Jolla, Calif.) or Platinum® Taq DNA Polymerase High Fidelity (Invitrogen) was used. The oligonucleotide primers (with accompanying SEQ ID NOs) for overlapping PCRs and for generating a full length viral DNA are listed in Table 1.

TABLE 1
Oligonucleotide primers used for PCR amplification
SEQ ID Primer Binding Site
NO Name Origin Sequences (5′-3′) (underlined sequence)
1 Oligo B-5 T7 + NADL GTGTTAATACGACTCACTATAG T7 promoter
TATACGAGAATTAGAAAAGGC
2 Oligo 84 NADL GGGGGCTGTTAGAGGTCTTCC
3 Oligo 127 G-Erns + NADL AATTCCACTGGGTGATGTTCTCTC G-Erns N-terminus
CCATTGTAACTTGAAACAAAACT
4 Oligo 128 G-Erns GAGAACATCACCCAGTGGAA
5 Oligo 129 G-Erns TGCGTGGGCTCCAAACCATGT
6 Oligo 130 G-Erns + NADL AACATGGTTTGGAGCCCACGCA G-Erns C-terminus
GCTTCCCCTTACTGTGATGTCG
7 Oligo 131 R-Erns + NADL GGTTCCACTGTGTTATATTCTCTC R-Erns N-terminus
CCATTGTAACTTGAAACAAAACT
8 Oligo 132 R-Erns GAGAATATAACACAGTGGAACC
9 Oligo 133 R-Erns TGCATTAGCTCCGAACCACGTT
10 Oligo 134 R-Erns + NADL AACGTGGTTCGGAGCTAATGCA R-Erns C-terminus
GCTTCCCCTTACTGTGATGTCG
11 Oligo 135 P-Erns + NADL GGTTCCACTGAGTTATATTCAC P-Erns N-terminus
TCCCATTGTAACTTGAAACA
12 Oligo 136 P-Erns GTGAATATAACTCAGTGGAACC
13 Oligo 137 P-Erns TGCCTGTGCCCCAAACCATGT
14 Oligo 138 P-Erns + NADL AACATGGTTTGGGGCACAGGCA P-Erns C-terminus
GCTTCCCCTTACTGTGATGTCG
15 Oligo 175 NADL GTTATCAATAGTAGCCACAGAAT
16 Oligo 177 NADL TCCACCCTCAATCGACGCTAAA
17 Oligo 237 CM5960 CCCTGAGGCCTTCTGTTCTGAT
18 Oligo P7 CM5960 CACTTGTCGGAGGTACTACTACT
19 Oligo P8 CM5960 CTTGTCTATCTTATCTCTTATTGC
20 Oligo P3 CM5960 ACTATCTGAACAGTTGGACAGG
21 Oligo 296-1 T7 + GTGTTAATACGACTCACTATA T7 promoter
CM53637 GTATACGAGATTAGCTAAAG
22 Oligo 297 P- CCAGGTTCCACTGAGTTATATTCAC P-Erns N-terminus
Erns + CM53637 TCCTGTTACCAGCTGAAGCAGAA
23 Oligo 298 P- AACATGGTTTGGGGCACAGGCA P-Erns C-terminus
Erns + CM53637 GCAAGTCCATACTGTAAAGTG
24 Oligo 299 CM53637 TTAATGCCCTCCCTGTCTCTACCACCT
25 Oligo 300 CM53637 AGGATGAGGATCTAGCAGTGGATCT
26 Oligo 303 CM53637 CCATAGCCATCTGCTCAGACAGTA
27 Oligo 92-1 CM53637 GGGGCTGTCAGAGGCATCCTCTAGTC
28 Oligo 321 CM53637 AGCCACTACACCTGTCACGAGAAG
29 Oligo 250 NADL CACCATGAAAATAGTGCCCAAAGAATC NADL-C C terminus
30 Oligo 252 NADL TTAAGCGTATGCTCCAAACCACGTC NADL-Erns C terminus

Plasmid containing the full length cDNA of BVDV-NADL was extracted from dam-E. coli K12 GM2163. The plasmid was methylated in vitro with dam methyltransferase and S-adenosylmethionine (New England Biolabs; Ipswich, Mass.). G-Erns, R-Erns, and P-Erns genes (GenBank accession numbers NC_003678, NC_003677, and AY781152, respectively) were synthesized and cloned into a cloning vector.

For construction of chimeric BVDV-NADL/G-Erns DNA, a fragment of BVDV-NADL encoding for the 5′UTR to the 3′ end of C gene was amplified by PCR from methylated plasmid with primers Oligo B-5 and Oligo 127. The G-Erns gene was amplified by PCR from the plasmid DNA containing the G-Erns gene with Oligo 128 and Oligo 129. A BVDV fragment encoding for E1 to the 3′UTR was amplified by PCR from methylated plasmid with Oligo 130 and Oligo 84. The PCR products were gel purified using QIAquick Gel Extraction Kit (Qiagen; Valencia, Calif.). The purified PCR products were treated with Dpn I and Exonuclease 1 (New England Biolabs). The treated PCR products were assembled to create a full length chimeric BVDV-NADL/G-Erns genome by PCR using Oligo B-5 and Oligo 84.

For construction of chimeric BVDV-NADL/R-Erns DNA, a fragment of BVDV-NADL encoding for the 5′UTR to the 3′ end of C gene was amplified by PCR from methylated plasmid with primers Oligo B-5 and Oligo 131. The R-Erns gene was amplified by PCR from the plasmid containing R-Erns gene with Oligo 132 and Oligo 133. A BVDV fragment encoding for E1 to the 3′UTR was amplified by PCR from methylated plasmid with Oligo 134 and Oligo 84. The PCR products were gel purified with QIAquick Gel Extraction Kit. The purified PCR products were treated with Dpn I and Exonuclease 1. The treated PCR products were assembled to create a full length chimeric BVDV-NADL/R-Erns genome by PCR with Oligo B-5 and Oligo 84.

For construction of chimeric BVDV-NADL/P-Erns DNA, a fragment of BVDV-NADL encoding for the 5′UTR to the 3′ end of C gene was amplified by PCR from methylated plasmid with primers Oligo B-5 and Oligo 135. The P-Erns gene was amplified by PCR from the plasmid DNA containing P-Erns gene with Oligo 136 and Oligo 137. A BVDV fragment encoding for E1 to the 3′UTR was amplified by PCR from methylated plasmid with Oligo 138 and Oligo 84. The PCR products were gel purified with QIAquick Gel Extraction Kit. The purified PCR products were treated with Dpn I and Exonuclease 1. The treated PCR products were assembled to create a full length chimeric BVDV-NADL/P-Erns genome by PCR with Oligo B-5 and Oligo 84.

For sequence confirmation of the chimeric Erns regions, a fragment corresponding to the 5′ UTR to the E1 region of each assembled full length chimeric genome was amplified by PCR using Oligo B-5 and Oligo 175, and the PCR products were sequenced and analyzed.

Full length viral genomic RNA transcripts were generated from plasmid containing the full-length cDNA of BVDV-NADL or chimeric BVDV-NADL/Erns DNAs using mMessage mMachine T7 Ultra kit (Ambion; Austin, Tex.). Quality and quantity of each RNA transcript was determined on an RNA gel and a Nanodrop spectrophotometer (Nanodrop; Wilmington, Del.). Overnight cultures of RD cells in wells of 6-well plates were transfected with viral RNA using Lipofectin reagent (Invitrogen) according to the manufacturer's instructions. Following transfection, the cells were incubated at 37° C. for 3 days. The supernatants were harvested and stored at −80° C.

Viral RNAs from harvested supernatants were extracted using MagMax™ AI/ND Viral RNA Isolation Kit (Ambion) according to the manufacturer's instructions. The RNAs were reverse transcribed and the region of each chimera encoding Npro to E1 was amplified using primers Oligo 177 and Oligo 175 (Table 1), and the ThermoScript™ RT-PCR System (Invitrogen) according to the manufacturer's instructions. The RT-PCR products were then sequenced.

Cell monolayers from either a viral RNA transfection or virus infection were fixed in 80% acetone. BVDV- or BDV-specific monoclonal antibodies (Mabs) were used in conjunction with the anti-mouse IgG peroxidase ABC Elite kit (Vector Laboratories; Burlingame, Calif.). Color was developed using VIP peroxidase substrate (Vector Laboratories).

Chimeric virus titers were determined by a limiting dilution method. Viral samples were 10-fold serially diluted and transferred to 96-well plates (100 Οl per well), with 4-6 replicates per dilution. 100 Οl of a suspension of BK-6 cells were then added to each well, and the plates incubated at 37° C. for 4-5 days. Virus infection was determined by both cytopathic effect (CPE) and MAb staining. Virus titers were calculated using the Spearman-Karber method.

To obtain the biological clones of each chimera, virus samples were first diluted 100-fold and followed by a 10-fold dilution series. 100 μl of the diluted viruses were transferred to each well of a 96 well plate, 4 replicates per dilution. 100 μl of BK-6 cells were then added to each well, and the plates incubated at 37° C. for 4 days. The supernatants were harvested and transferred to new plates and stored at −80° C. The cells were fixed and stained. The supernatants from wells containing single virus foci were harvested and expanded as virus stocks.

Growth kinetics studies were carried out in T-25 flasks containing BK-6 cells. When the cells reached approximately 90% confluency, they were infected with each chimera at MOI of 0.02. After adsorption for 1 hr, the inoculum was removed. Cells were washed 3× with PBS, and 3 ml of fresh growth medium was then added. Samples were then collected at various time points from 0 to 144 hrs for titer determinations.

For the virus neutralization test, frozen stocks of the three BVDV-NADL/Erns chimeras, parental BVDV-NADL, and BVDV-CM5960 (BVDV type I) were diluted in DMEM to about 4,000 TCID50/ml. Sera from cattle immunized with Bovi-Shield Gold (Pfizer; New York, N.Y.), with pre-determined titers against both BVDV type I and II, were 2-fold serially diluted with DMEM. 50 Οl of virus (200 TCID50) were mixed with an equal volume of diluted cattle serum in 96-well tissue culture plates (4 replicates/dilution), and incubated at 37° C. for 60 min. 100 Οl of BK-6 cells were then added to each well, and the plates were incubated at 37° C. for 3-6 days. Serum negative for BVDV antibodies was also included in each plate as a control. End point neutralization titers of the sera were determined by both CPE and by immunohistochemistry (IHC) at day 3 and day 6.

Results. Chimeric BVDV-NADL/Erns DNAs in which the NADL Erns gene/protein was replaced by Erns of giraffe (G-Erns), reindeer (R-Erns) or pronghorn antelope (P-Erns) pestivirus, were constructed. Plasmid DNA containing each of the chimeric Erns regions was sequenced to confirm sequence authenticity. The following chimeric pestiviruses were deposited with the American Type Culture Collection (ATCCÂŽ), 10801 University Blvd., Manassas, Va., 20110, USA on Apr. 2, 2009, and confirmed viable by the ATCCÂŽ on Apr. 23, 2009: BVDV-NADL/G-Erns (PTA-9938), BVDV-NADL/P-Erns (PTA-9939), and BVDV-NADL/R-Erns (PTA-9940).

BVDV-NADL/Erns chimeric viruses were rescued from RD cells after transfection with in vitro-transcribed viral RNA. Extensive cytopathic effect (CPE) in RD cells was observed 48-72 hours after transfection with BVDV-NADL/G-Erns or BVDV-NADL/R-Erns RNA transcripts. CPE was not obvious with the BVDV-NADL/P-Erns virus, however. Culture supernatants were harvested from each well, and the remaining cells were fixed and stained with BVDV NS3-specific MAb antibody 20.10.6. Cells infected with one of the three chimeric pestiviruses were incubated with the MAb. Viral RNAs were extracted from the harvested supernatants, and sequenced to confirm the Erns genes of all three chimeras.

The three BVDV-NADL/Erns chimeras were tested for their reactivity to each of several Erns MAbs specific for BVDV or BDV. The results are shown in Table 2. The BVDV-NADL/R-Erns chimera reacted to all three BDV Erns Mabs, while neither BVDV-NADL/G-Erns, BVDV-NADL/P-Erns nor BVDV-NADL parental virus were recognized by BDV Erns MAbs. BVDV-NADL/G-Erns BVDV-NADL/R-Erns, and NADL parental virus reacted to a pan-BVDV Erns MAb 15C5. MAbs specific to either Erns of BDV or BVDV did not react with the BVDV-NADL/P-Erns chimera.

TABLE 2
Reactivity of BVDV-NADL/Erns chimeras to MAbs
Chimera reactivity
BVDV- BVDV- BVDV-
NADL/ NADL/ NADL/ BVDV-
MAb Specificity G-Erns R-Erns P-Erns NADL
WS 371 BDV Erns − +++ − −
WS 373 BDV Erns − +++ − −
WS 363 BDV Erns − +++ − −
15C5 BVDV Erns +++ +++ − +++
20.10.6 Pestivirus +++ +++ ++ +++
NS3

In order to determine whether the chimeric Erns proteins in the viruses had any impact on the recognition of viral neutralizing epitopes by antibodies from BVDV-vaccinated cattle, a virus neutralization assay was performed with the three BVDV-NADL/Erns chimeras, BVDV-NADL, and BVDV-CM5960 (BVDV type I). Sera from 4 cows with neutralizing antibody titers ranging from 0 to greater than 40,000 (determined previously against BVDV-CM5960) were utilized. The results (Table 3) indicate that titers against all three chimeras were generally comparable to those for parental BVDV-NADL and BVDV-CM5960. The neutralization titers against BVDV-NADL/P-Erns were slightly lower than those against the other two chimeras, BVDV-NADL and BVDV-CM5960.

TABLE 3
Neutralization titers of bovine antisera
against BVDV-NADL/Erns chimeras
Neutralization titers
BVDV- BVDV- BVDV-
Cattle NADL/ NADL/ NADL/ BVDV-
Sera # G-Erns R-Erns P-Erns NADL CM5960
816 <10 <10 <10 <10 <10
77 320 320 320 160 320
1281 6400 12800 3200 3200 25600
1434 51200 25600 6400 25600 51200

The three BVDV-NADL/Erns chimeras were biologically cloned two times by limiting dilution. Three clones of BVDV-NADL/G-Erns, four of BVDV-NADL/R-Erns, and three of BVDV-NADL/P-Erns were obtained. These clones were each expanded between 1-3 times. Titration results indicated that expanded BVDV-NADL/G-Erns clone 1, BVDV-NADL/R-Erns clones 3 and 5, and BVDV-NADL/P-Erns clone 2 yielded the highest titers.

Growth kinetics studies were performed with BVDV-NADL/G-Erns clone 1, BVDV-NADL/R-Erns clone 3, BVDV-NADL/P-Erns clone 2, and uncloned BVDV-NADL/P-Erns. Growth curves generated from these clones were compared to the parental BVDV-NADL. BVDV-NADL/G-Erns and BVDV-NADL/R-Erns chimeras had growth kinetics similar to the parental BVDV-NADL, while BVDV-NADL/P-Erns grew slower and had lower titers at each time point than the parental virus and other two chimeras.

Three BVDV-NADL/Erns chimeric viruses were created, in which the NADL Erns gene/protein was replaced by Erns of a giraffe, reindeer or pronghorn antelope pestivirus. All three chimeras were viable and infectious in both RD and BK-6 cells. In vitro data demonstrated that the chimeric Erns proteins did not affect neutralization of the chimeras by antisera from BVDV-vaccinated cattle. This suggests that neutralizing epitopes on the chimeric viruses, regardless of where they are located, were not affected by the Erns substitutions.

The chimeric viruses had different growth kinetics and reacted differently to BVDV or BDV Erns monoclonal antibodies. BVDV-NADL/G-Erns and BVDV-NADL/R-Erns had similar growth kinetics to the parental virus, while BVDV-NADL/P-Erns grew slower and to a lower titer than the parental virus. Both BVDV-NADL/G-Erns and BVDV-NADL/R-Erns reacted to BVDV Erns monoclonal antibody 15C5, while BVDV-NADL/P-Erns did not. Sequence comparison results showed that G-Erns and R-Erns had higher sequence similarities to BVDV NADL (75.8% and 76.2%, respectively) than P-Erns(59%). These data, taken together with the MAb reactivity results, suggest that G-Erns and R-Erns may be antigenically more similar to the parental Erns than P-Erns.

Example 2. Construction and Serological Characterization and Efficacy Testing of Chimeric Pestivirus Vaccine Candidates

Type 1 BVDV strain CM5960 and Type 2 BVDV strain CM53637 were obtained from Pfizer Global Manufacturing. The viral RNAs were extracted using MagMax™ AI/ND Viral RNA Isolation Kit (Ambion) according to the manufacturer's instructions. The RNAs were reverse transcribed to generate cDNAs using ThermoScript™ RT-PCR System (Invitrogen) according to the manufacturer's instructions. Chimeric pestiviruses were generated by replacing the Erns gene of CM5960 and CM53637 with the Erns gene of pronghorn antelope pestivirus (P-Erns) using an overlapping PCR method. The oligonucleotide primers used for PCRs are listed in Table 1.

For construction of chimeric CM5960/P-Erns DNA, a fragment of CM5960 cDNA between the 5′UTR and the 3′ end of C gene was amplified by PCR from CM5960 cDNA with primers Oligo B-5 and Oligo 135. The P-Erns gene was amplified by PCR from the plasmid DNA containing P-Erns gene with Oligo 136 and Oligo 137. A third fragment between the beginning of E1 and the 3′ end of E2 was amplified by PCR from CM5960 cDNA with primers Oligo 138 and Oligo 237.

The above-described fragments were gel purified using a QIAquick Gel Extraction Kit (Qiagen), and assembled by PCR to create one fragment with Oligo B-5 and Oligo 237. A fragment between E1 region and NS5B region was amplified by PCR from CM5960 cDNAs with primers Oligo P7 and Oligo P8. Another fragment between NS5A region and the end of 3′UTR was amplified by PCR from CM5960 cDNAs with primers Oligo P3 and Oligo 84. These three fragments were then gel purified, and assembled by PCR with Oligo B-5 and Oligo 84 to create a full length chimeric CM5960L/P-Erns genome.

For construction of chimeric CM53637/P-Erns DNA, a fragment of CM53637 cDNA between the 5′UTR and the 3′ end of C gene was amplified by PCR from CM53637 cDNA with primers Oligo 296-1 and Oligo 297. A second fragment between the beginning of E1 and the 3′ end of E2 was amplified by PCR from CM53637 cDNA with primers Oligo 298 and Oligo 303. These two fragments were gel purified, and together with a fragment encoding for the P-Erns gene (see above), were assembled by PCR to create one fragment using Oligo 296-1 and Oligo 303.

A fragment between E1 region and NS3 region was then amplified by PCR from CM53637 cDNA with primers Oligo 298 and Oligo 299. Another fragment between NS3 region and the end of 3′UTR was also amplified by PCR from CM53637 cDNA with primers Oligo 300 and Oligo 92-1. These two fragments and the one above were gel purified, and assembled by PCR with Oligo 296-1 and Oligo 92-1 to create a full length chimeric CM53637/P-Erns genome.

Full length viral genomic RNA transcripts were generated from chimeric CM5960/P-Erns and chimeric CM53637/P-Erns DNAs using mMessage mMachine T7 Ultra kit (Ambion). Quality and quantity of each RNA transcript was determined on an RNA gel. Overnight cultures of RD cells in wells of 6-well plates were transfected with viral RNA using Lipofectin reagent (Invitrogen) according to the manufacturer's instructions. Following transfection, the cells were incubated at 37° C. for 3 days. The cells plus the supernatants were passed one to several times in RD and/or BK-6 cells. The supernatants were then serially passed in BK-6 cells. The supernatants were harvested and stored at −80° C.

To confirm the identity of rescued recombinant virus, viral RNAs from harvested supernatants were extracted using MagMax™ AI/ND Viral RNA Isolation Kit (Ambion) according to the manufacturer's instructions. The RNAs were reverse transcribed using ThermoScript™ RT-PCR System (Invitrogen) according to the manufacturer's instructions and the region of each chimera between 5′ UTR and E2 or p7 was amplified by PCR using primers Oligo B-5 and Oligo 237 (for CM5960/P-Erns chimera) or Oligo 296-1 and Oligo 321 (for CM53637/P-Erns chimera) (Table 1), The RT-PCR products were then sequenced.

Cell monolayers from either a viral RNA transfection or virus infection were fixed in 80% acetone. BVDV specific MAbs were used in conjunction with the anti-mouse IgG peroxidase ABC Elite kit (Vector Laboratories) for immunohistochemistry. Color was developed using VIP peroxidase substrate (Vector Laboratories).

Results.

Chimeric CM5960/P-Erns and CM53637/P-Erns viruses were constructed and rescued. The 5′UTR to E2 regions, including the chimeric pronghorn-Erns regions, were confirmed by sequencing. Both chimeras were viable and infectious in both RD and BK-6 cells. Both chimeras were not reactive to BVDV Erns specific MAb 15C5, but reactive to BVDV NS3 specific MAb 20.10.6 in immunohistochemistry staining.

The sequence for the chimeric pestivirus (BVDV-CM5960 (BVDV type I)/P-Erns) is presented in the sequence listing as SEQ ID NO: 31. The sequence for the chimeric pestivirus (BVDV-CM53637 (BVDV type II)/P-Erns) is presented in the sequence listing as SEQ ID NO: 32.

The CM5960/P-Erns chimera was biologically cloned by limited dilution (see above Example 1 for methodology).

Example 3. Efficacy Testing of Chimeric Pestivirus Vaccine Candidates in a Calf Respiratory Disease Model

BVDV negative healthy calves are obtained, randomly assigned to study groups, and maintained under supervision of an attending veterinarian. The test vaccine is combined with a sterile adjuvant, and administered by either intramuscular (IM) or subcutaneous (SC) injection, or by intranasal (IN) inoculation. The vaccine is given either as one or two doses. Two doses of vaccine are administered, 21 to 28 days apart. The animals are subsequently challenged at 21 to 28 days following the final vaccination with a Type 1 or Type 2 strain of BVDV. Challenge inoculum is given intranasally in a 4 ml divided dose, 2 ml per nostril. Control groups consisting of unvaccinated, unchallenged animals and/or unvaccinated, challenged animals are also maintained throughout the study.

Clinical parameters are monitored daily, including rectal temperature, depression, anorexia, and diarrhea. Serum neutralization titers are determined by a constant-virus, decreasing-serum assay in bovine cell culture, using serial dilutions of serum combined with a BVDV Type 1 or 2 strain. Post-challenge isolation of BVDV in bovine cell culture is attempted from peripheral blood. A BVDV-positive cell culture is determined by indirect immunofluorescence. To demonstrate protection following challenge, a reduction in incidence of infection is demonstrated in vaccinated groups versus the control groups.

Example 4. Chimeric Pestivirus Vaccine Efficacy Testing in a Pregnant Cow-Calf Model

BVDV-negative cows and heifers of breeding age are obtained and randomly assigned to a vaccination test group or a placebo (control) group. Cows are inoculated twice by intramuscular (IM) or subcutaneous (SC) injection, with either vaccine or placebo, 21 to 28 days apart. Following the second vaccination, all cows receive an IM prostaglandin injection to synchronize estrus. Cows displaying estrus are bred by artificial insemination with certified BVDV-negative semen. At approximately 60 days of gestation, the pregnancy status of cows is determined by rectal palpation.

Approximately 6 weeks later, cows with confirmed pregnancies are randomly selected from each test group. Each of these cows is challenged by intranasal inoculation of BVDV Type 1 or 2. Blood samples are collected on the day of challenge and at multiple postchallenge intervals for purposes of BVDV isolation.

Twenty-eight days after challenge, left flank laparotomies are performed and amniotic fluid is extracted from each cow. Immediately prior to surgery, a blood sample is collected from each cow for serum neutralization assays. Following caesarian delivery, a blood sample is collected from each fetus. Fetuses are then euthanized, and tissues are aseptically collected for purposes of BVDV isolation. In cases where spontaneous abortions occur, blood samples are taken from the dam when abortion is detected and two weeks later. The paired blood samples and aborted fetuses are subjected to serologic testing and virus isolation. Vaccine efficacy is demonstrated by a lack or decrease of fetal infection and late-term abortion.

Example 5. Diagnostic Assays for Differentiation Between Vaccinated and Naturally Infected Cattle

Cattle vaccinated with a vaccine of the present invention can be compared with cattle naturally infected with a wild type BVDV. Cattle of various ages are vaccinated with either a live or inactivated chimeric pestivirus vaccine according to instructions provided. Serum samples are collected 2-3 weeks or later following vaccination. To differentiate between cattle which received the chimeric pestivirus vaccine versus those infected by a field (wild-type) strain of BVDV, serum samples are tested via a differential diagnostic assay. The chimeric pestivirus elicits the production of specific antibodies which bind to the Erns protein of the chimeric pestivirus, but not to the Erns protein present on wild-type BVDV. In the context of wild-type BVDV, the opposite is true. Specific antibodies are generated which recognize the Erns protein present on wild-type BVDV, but not the Erns protein present on the chimeric pestivirus. Methods of assaying for antibody binding specificity and affinity are well known in the art, and include but are not limited to immunoassay formats such as competitive ELISA, direct peptide ELISA, Western blots, indirect immunofluorescent assays, and the like.

For a competitive ELISA, whole or partial wild-type or chimeric pestivirus viral antigens, including the Erns protein (naturally, synthetically or recombinantly derived), are used as an antigen source. Following coating of the ELISA plate with antigen under alkaline conditions, cattle serum samples and dilutions are added together with an optimized dilution of a MAb specific for either Erns protein of the wild type BVDV or the Erns protein of the chimeric pestivirus, and incubated for 30-90 min. Either horseradish peroxidase or alkaline phosphatase is conjugated to the MAb to allow for colorimetric detection of binding. Following washing of the plates, an enzyme-specific chromogenic substrate is added, and after a final incubation step, the optical density of each well is measured at a wavelength appropriate for the substrate used. The degree of inhibition of binding of the labeled mAb is dependent on the level of antibodies in the cattle serum that specifically recognize the protein coating the plate.

In the case of chimeric Erns protein (e.g. pronghorn Erns) present on the chimeric pestivirus being the test antigen, a lack of binding by the chimeric pestivirus Erns-specific mAb indicates the presence of antibodies in the cattle serum that recognize the chimeric pestivirus-specific epitope, indicative of vaccination. In contrast, serum from cattle not immunized, but naturally infected, will not contain antibodies which will bind to the chimeric pestivirus Erns protein coating the plate. Therefore, the chimeric pestivirus Erns-specific mAb will bind to the bound protein, and result in subsequent color development.

In the case of Erns protein present on wild-type BVDV being the test antigen, a lack of binding by the wild type BVDV Erns-specific mAb indicates the presence of antibodies in the cattle serum that recognize the wild-type BVDV-specific epitope, indicative of a natural (wild-type) infection. In contrast, serum from cattle immunized with the chimeric pestivirus vaccine will not contain antibodies which will bind to the wild-type BVDV Erns protein coating the plate. Therefore, the wild type BVDV Erns-specific mAb will bind to the bound protein, and result in subsequent color development.

For development of such an assay, the following methods were carried out. First, a recombinant baculovirus expressing BVDV-NADL Erns was constructed. A portion of the C protein of BVDV, plus the full length Erns gene, were amplified by PCR from a plasmid containing full length of BVDV-NADL cDNA with primers Oligo 250 (SEQ ID NO: 29; 5′-CACCATGAAAATAGTGCCCAAAGAATC-3′) and Oligo 252 (SEQ ID NO: 30; 5′-TTAAGCGTATGCTCCAAACCACGTC-3′). The PCR product was cloned into pENTR™/D-TOPO (Invitrogen) and transformed into One Shot® Competent E. coli (Invitrogen) according to the manufacturer's instructions. The recombinant plasmid was extracted and the insert was confirmed by sequencing. This plasmid was designated pENTR-Erns. pENTR-Erns and BaculoDirect™ Baculovirus Expression System (Invitrogen) were used to construct recombinant baculovirus expressing BVDV-NADL Erns according to the manufacturer's instructions. The recombinant baculovirus expressing BVDV-NADL Erns was generated, plaque purified, expanded, and stored at both 4° C. and -80° C. The expression of BVDV-NADL Erns in the recombinant baculovirus was confirmed by immunofluorescent staining and Western blotting against BVDV Erns specific MAb 15C5 following conventional Western Blot methods.

For production of the ELISA antigen, SF21 cells in 100 ml suspension culture were infected with 0.5 ml of the recombinant baculovirus stock. The cells were harvested after 4 days incubation at 27° C. The cells were centrifuged at low speed (about 800 g) for 10 min to collect the cells and washed once with PBS. The cells were lysed with 150 mM NaCl, 50 mM Tris HCl pH 8.0, and 1% IGEPAL CA-630. The mixture was first incubated on ice for 10 minutes and then at −80° C. for 1 hour. After thawing, the mixture was clarified by centrifugation at 1000 g for 15 minutes. The supernatant was further clarified by centrifuge at 8000 g for 20 minutes at 4° C. The final supernatant, designated Baculo-Erns lysate, was aliquoted and stored at −80° C.

In carrying out the assay, the ELISA plates were coated overnight at 4° C. with 100 Οl/well of MAb WB210 (Veterinary Laboratory Agency; Type 1 BVDV Erns specific), diluted 1:1000 in carbonate/bicarbonate buffer (pH 9.0). The next day, the plates were washed three times and blocked with blocking buffer (PBS containing 1% casein sodium salt and 0.05% Tween 20) at 37° C. for 1 hour. The plates were subsequently washed three times with blocking buffer, and 100 Οl of Baculo-Erns lysate (1:3200 diluted in PBS) was added to each well, and the plates were incubated at 37° C. for 1 hour. Following three washes with blocking buffer, 100 Οl of undiluted cattle serum samples were added to the wells, except for one column of wells (to serve as non-competing 15C5-HRP controls), and incubated at 37° C. for 1 hour. Following three more washes with blocking buffer, 100 Οl of MAb 15C5-HRP conjugate (BVDV Erns specific, 1:20,000 diluted in blocking buffer) was added to each well, and incubated at 37° C. for 1 hour. Following three washes with blocking buffer, 100 Οll of ABTS substrate (Peroxidase substrate solutions A+B; KPL, USA) was added to each well, and incubated at room temperature for 20-60 minutes for color development. The optical density (OD) was measured at the wavelength of 405 nm. The percentage of OD reduction for each serum sample is calculated by following formula:


[1−(OD of Sample÷Mean OD of 15C5-HRP Controls)]×100%.

Results:

All of the serum samples that tested positive by the virus neutralization (VN) test had over 82% O.D. reduction, except sample ID#13851 (Table 4). All of the serum samples that tested negative by the virus neutralization test had less than 17% O.D. reduction, except sample ID#5150 (Table 4). The discrepancy might be explained by the differences in how the assays are carried out, as they are measuring different antibodies, and the proportion of specific antibodies varies among animals.

TABLE 4
BVDV positive and negative serum samples
in a MAb15C5 competition ELISA.
O.D. of Average O.D. of
Row # Sample ID Sample No Serum Column % Reduction
1 40021 0.0615 0.907013 93.21950182
2 40014 0.0965 0.907013 89.36068171
3 40422 0.0639 0.907013 92.95489701
4 40372 0.0754 0.907013 91.68699897
5 40222 0.0634 0.907013 93.01002301
6 40152 0.0894 0.907013 90.14347093
7 13461 0.0663 0.907013 92.6902922
8 13851 0.641 0.907013 29.32846607
9 13801 0.1599 0.907013 82.37070472
10 13904 0.073 0.907013 91.95160378
11 40504 0.0625 0.907013 93.10924981
12 40471 0.0914 0.907013 89.92296693
13 35037 0.0639 0.907013 92.95489701
14 13690 0.159 0.907013 82.46993152
15 13797 0.0859 0.907013 90.52935294
16 6127 0.0886 0.907013 90.23167253
17 5138 0.7434 0.907013 18.03866097
18 5139 0.8423 0.907013 7.13473787
19 5141 0.7732 0.907013 14.75315128
20 5142 0.7475 0.907013 17.58662776
21 5144 0.8293 0.907013 8.568013909
22 5145 0.9488 0.907013 −4.607100449
23 5146 0.9451 0.907013 −4.199168038
24 5147 1.0138 0.907013 −11.77348064
25 5148 0.9322 0.907013 −2.7769172
26 5149 0.9794 0.907013 −7.980811741
27 5150 0.1157 0.907013 87.24384325
Rows 1-16: Positive cattle serum samples
Rows 17-27: Negative cattle serum samples
All serum samples are used undiluted in the ELISA

Although the present invention has been described in considerable detail with reference to certain versions thereof, other versions are possible. Therefore, the scope of the appended claims should not be limited to the description of the versions contained herein.

Claims

1. A chimeric pestivirus, wherein said chimeric pestivirus comprises a bovine viral diarrhea virus which does not express its homologous Erns protein, further wherein said chimeric pestivirus expresses a heterologous Erns protein derived from another pestivirus, or a natural, synthetic or genetic variant of said heterologous Erns protein.

2. The chimeric pestivirus of claim 1, wherein the heterologous Erns protein of said chimeric pestivirus, or the natural, synthetic or genetic variant of said heterologous Erns protein, is derived from a pestivirus selected from the group consisting of a reindeer pestivirus, a giraffe pestivirus, and a pronghorn antelope pestivirus.

3. The chimeric pestivirus of claim 1, wherein the heterologous Erns protein of said chimeric pestivirus has at least one Erns epitope which is not present in wild-type bovine viral diarrhea virus.

4. The chimeric pestivirus of claim 1, wherein the heterologous Erns protein of said chimeric pestivirus lacks at least one Erns epitope which is present in wild-type bovine viral diarrhea virus.

5. A culture of the chimeric pestivirus of claim 1.

6. A cell line or host cell comprising the chimeric pestivirus of claim 1.

7. A polynucleotide molecule encoding for the chimeric pestivirus of claim 1.

8. An immunogenic composition comprising the chimeric pestivirus of claim 1, and a veterinarily-acceptable carrier.

9. The immunogenic composition of claim 8, wherein the veterinarily-acceptable carrier is an adjuvant.

10. The immunogenic composition of claim 8, wherein said chimeric pestivirus is live attenuated.

11. The immunogenic composition of claim 8, wherein said chimeric pestivirus is inactivated.

12. The immunogenic composition of claim 8, further comprising one or more additional antigens useful for treating or preventing the spread of one or more additional pathogenic microorganisms in a bovine.

13. An immunogenic composition comprising the polynucleotide molecule of claim 7 and a veterinarily-acceptable carrier.

14. A vaccine comprising the chimeric pestivirus of claim 1 and a veterinarily-acceptable carrier.

15. The vaccine of claim 14, wherein the veterinarily-acceptable carrier is an adjuvant.

16. The vaccine of claim 14, wherein said chimeric pestivirus is live attenuated.

17. The vaccine of claim 14, wherein said chimeric pestivirus is inactivated.

18. A vaccine comprising the polynucleotide molecule of claim 7 and a veterinary acceptable carrier.

19. The vaccine of claim 14, further comprising one or more additional antigens useful for treating or preventing the spread of one or more additional pathogenic microorganisms in a bovine.

20. A kit comprising, in at least one container, the vaccine of claim 14.

21. A method of treating or preventing the spread of bovine viral diarrhea virus infection, wherein the vaccine of claim 14 is administered to an animal.

22. A method of vaccinating an animal, wherein a DIVA pestivirus vaccine is administered to said animal, and wherein said DIVA pestivirus vaccine comprises the chimeric pestivirus of claim 1, further wherein said chimeric pestivirus has at least one Erns epitope which is not present in wild-type bovine viral diarrhea virus.

23. A method of vaccinating an animal, wherein a DIVA pestivirus vaccine is administered to said animal, and wherein said DIVA vaccine comprises the chimeric pestivirus of claim 1, further wherein said chimeric pestivirus lacks at least one Erns epitope which is present in wild-type bovine viral diarrhea virus.

24. A method of differentiating between an animal vaccinated with the vaccine of claim 14 and an animal infected with wild type bovine viral diarrhea virus, wherein the animal vaccinated with said vaccine generates antibodies to at least one Erns epitope which is present in the chimeric pestivirus of said vaccine, but which is not present in wild-type bovine viral diarrhea virus, said method comprising the steps of:

a) obtaining a serum sample from the animals;

b) assaying said samples for the presence or absence of the antibodies;

c) identifying the animal having said antibodies as having been vaccinated with said vaccine; and

d) identifying the animal lacking said antibodies as having been infected with the wild type BVDV.

25. A method of differentiating between an animal infected with wild-type bovine viral diarrhea virus and an animal vaccinated with the vaccine of claim 14, wherein the animal infected with wild type bovine viral diarrhea virus generates antibodies to at least one Erns epitope which is present in wild-type bovine viral diarrhea virus, but which is not present in the chimeric pestivirus of said vaccine, said method comprising the steps of:

a) obtaining a serum sample from the animals;

b) assaying said samples for the presence or absence of the antibodies;

c) identifying the animal having said antibodies as having been infected with the wild type BVDV; and

d) identifying the animal lacking said antibodies as having been vaccinated with said vaccine.

26. A diagnostic kit for differentiating between an animal vaccinated with a vaccine comprising the chimeric pestivirus of claim 1 and an animal infected with wild type bovine viral diarrhea virus, said kit comprising reagents capable of detecting antibodies to at least one Erns epitope which is present in the chimeric pestivirus of the vaccine, but which is not present in wild-type bovine viral diarrhea virus.

27. A diagnostic kit for differentiating between an animal infected with wild type bovine viral diarrhea virus and an animal vaccinated with a vaccine comprising the chimeric pestivirus of claim 1, said kit comprising reagents capable of detecting antibodies to at least one Erns epitope which is present in wild-type bovine viral diarrhea virus, but which is not present in the chimeric pestivirus of the vaccine.

28. An antibody which recognizes an epitope of Erns which is present in the chimeric pestivirus of claim 1, but which epitope is not present in wild-type bovine viral diarrhea virus.

29. An antibody which recognizes an epitope present in wild-type bovine viral diarrhea virus, but which epitope is not present in the chimeric pestivirus of claim 1.