Patent application title:

INTEGRIN HETERODIMER AND A SUBUNIT THEREOF

Publication number:

US20180079795A9

Publication date:
Application number:

14/552,308

Filed date:

2014-11-24

Abstract:

A recombinant or isolated integrin heterodimer comprising a novel subunit α10 in association with a subunit β is described. The α10 integrin may be purified from bovine chondrocytes on a collagen-type-II affinity column. The integrin or the subunit of α10 can be used as a marker or target of all types of cells, e.g. of chondrocytes, osteoblasts, and fibroblasts. The integrin or the subunit α10 thereof can be used as a marker or target in different physiological or therapeutic methods. They can also be used as active ingredients in pharmaceutical compositions and vaccines.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C07K14/70546 »  CPC main

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans; Receptors; Cell surface antigens; Cell surface determinants Integrin superfamily

C07K14/705 IPC

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans Receptors; Cell surface antigens; Cell surface determinants

Description

CROSS REFERENCE TO RELATED APPLICATIONS

This application is a continuation of U.S. application Ser. No. 13/651,602, filed 15 Oct. 2012, which is a continuation of U.S. application Ser. No. 13/226,323, filed Sep. 6, 2011, now abandoned, which is a continuation of U.S. application Ser. No. 11/347,179, filed Feb. 6, 2006, now U.S. Pat. No. 8,048,991, which is a continuation of U.S. application Ser. No. 09/647,544, filed Oct. 26, 2000, now U.S. Pat. No. 7,029,858, which is a national stage filing under 35 U.S.C. §371 of International Application No. PCT/SE99/00544, which claims benefit of Swedish Application Nos. 9801164-6 filed Apr. 2, 1998 and 9900319-6 filed Jan. 28, 1999.

FIELD OF THE INVENTION

The present invention relates to a recombinant or isolated integrin heterodimer comprising a subunit α10 and a subunit β, the subunit α10 thereof, homologues and fragments of said integrin and of said subunit α10 having similar biological activity, processes of producing the same, polynucleotides and oligonucleotides encoding the same, vectors and cells comprising the same, binding entities binding specifically to the same, and the use of the same.

BACKGROUND OF THE INVENTION

The integrins are a large family of transmembrane glycoproteins that mediate cell-cell and cell-matrix interactions (1-5). All known members of this superfamily are non-covalently associated heterodimers composed of an α- and a β-subunit. At present, 8 B-subunits (β1-β8) (6) and 16 α-subunits (α1-α9, αv, αM, αL, αX, αIIb, αE and αD) have been characterized (6-21), and these subunits associate to generate more than 20 different integrins. The β1-subunit has been shown to associate with ten different α-subunits, α1-α9 and αv, and to mediate interactions with extracellular matrix proteins such as collagens, laminins and fibronectin. The major collagen binding integrins are α1β1 and α2β1 (22-25). The integrins α3β1 and α9β1 have also been reported to interact with collagen (26, 27) although this interaction is not well understood (28). The extracellular N-terminal regions of the α and β integrin subunits are important in the binding of ligands (29, 30). The N-terminal region of the α-subunits is composed of a seven-fold repeated sequence (12, 31) containing PG and GAP consensus sequences. The repeats are predicted to fold into a β-propeller domain (32) with the last three or four repeats containing putative divalent cation binding sites. The α-integrin subunits α1, α2, αD, αE, αL, αM and αX contain a ˜200 amino acid inserted domain, the I-domain (A-domain), which shows similarity to sequences in von Willebrand factor, cartilage matrix protein and complement factors C2 and B (33, 34). The I-domain is localized between the second and third FG-GAP repeats, it contains a metal ion-dependent adhesion site (MIDAS) and it is involved in binding of ligands (35-38).

Chondrocytes, the only type of cells in cartilage, express a number of different integrins including α1β1, α2β1, α3β1, α5β1, α6β1, αvβ3, and αvβ5 (39-41). It has been shown that α1β1 and α2β1 mediate chondrocyte interactions with collagen type II (25) which is one of the major components in cartilage. It has also been shown that α2β1 is a receptor for the cartilage matrix protein chondroadherin (42).

SUMMARY OF THE INVENTION

The present invention relates to a novel collagen type II binding integrin, comprising a subunit α10 in association with a subunit β, especially subunit β1, but also other β-subunits may be contemplated. In preferred embodiments, this integrin has been isolated from human or bovine articular chondrocytes, and human chondrosarcoma cells.

The invention also encompasses integrin homologues of said integrin, isolated from other species, such as bovine integrin heterodimer comprising a subunit α10 in association with a subunit β, preferably β1, as well as homologues isolated from other types of human cells or from cells originating from other species.

The present invention relates in particular to a recombinant or isolated integrin subunit α10 comprising the amino acid sequence shown in SEQ ID No. 4, and homologues and or fragments thereof having the same biological activity.

The invention further relates to a process of producing a recombinant integrin subunit α10 comprising the amino acid sequence shown in SEQ ID No. 4 or SEQ ID No. 5, or homologues or fragments thereof having similar biological activity, which process comprises the steps of

    • a) isolating a polynucleotide comprising a nucleotide sequence coding for a integrin subunit α10, or homologues or fragments thereof having similar biological activity,
    • b) constructing an expression vector comprising the isolated polynucleotide,
    • c) transforming a host cell with said expression vector,
    • d) culturing said transformed host cell in a culture medium under conditions suitable for expression of integrin subunit α10, or homologues or fragments thereof having similar biological activity, in said transformed host cell, and, optionally,
    • e) isolating the integrin subunit α10, or homologues or fragments thereof having the same biological activity, from said transformed host cell or said culture medium.

The integrin subunit α10, or homologues or fragments thereof having the same biological activity, can also be provided by isolation from a cell in which they are naturally present.

The invention also relates to an isolated polynucleotide comprising a nucleotide coding for an integrin subunit α10, or homologues or fragments thereof having similar biological activity, which polynucleotide comprises the nucleotide sequence shown in SEQ ID No. 1 or SEQ ID No. 2, or parts thereof.

The invention further relates to an isolated polynucleotide or oligonucleotide which hybridises to a DNA or RNA encoding an integrin subunit α10, having the amino acid sequence shown in SEQ ID No. 4 or SEQ ID No. 5, or homologues or fragments thereof, wherein said polyoligo nucleotide or oligonucleotide fails to hybridise to a DNA or RNA encoding the integrin subunit α1.

The invention relates in a further aspect to vectors comprising the above polynucleotides, and to cells containing said vectors and cells that have polynucleotides or oligonucleotides as shown in SEQ ID No. 1 or SEQ ID No. 2 integrated in their genome.

The invention also relates to binding entities having the capability of binding specifically to the integrin subunit α10 or to homologues or fragments thereof, such as proteins, peptides, carbohydrates, lipids, natural ligands, polyclonal antibodies or monoclonal antibodies.

In a further aspect, the invention relates to a recombinant or isolated integrin heterodimer comprising a subunit α10 and a subunit β, in which the subunit α10 comprises the amino acid sequence shown in SEQ ID No. 4 or SEQ ID No. 5, or homologues or fragments thereof having similar biological activity.

In a preferred embodiment thereof, the subunit β is β1.

The invention also relates to a process of producing a recombinant integrin heterodimer comprising a subunit α10 and a subunit β, in which the subunit α10 comprises the amino acid sequence shown in SEQ ID No. 4 or SEQ ID No. 5, which process comprises the steps of

    • a) isolating one polynucleotide comprising a nucleotide sequence coding for a subunit α10 of an integrin heterodimer and, optionally, another polynucleotide comprising a nucleotide sequence coding for a subunit β of an integrin heterodimer, or for homologues or fragments thereof having similar biological activity,
    • b) constructing an expression vector comprising said isolated polynucleotide coding for said subunit α10 in combination with an expression vector comprising said isolated nucleotide coding for said subunit β,
    • c) transforming a host cell with said expression vectors,
    • d) culturing said transformed host cell in a culture medium under conditions suitable for expression of an integrin heterodimer comprising a subunit α10 and a subunit β, or homologues or fragments thereof having similar biological activity, in said transformed host cell, and, optionally,
    • e) isolating the integrin heterodimer comprising a subunit α10 and a subunit β, or homologues or fragments thereof having the same biological activity, from said transformed host cell or said culture medium.

The integrin heterodimer, or homologues or fragments thereof having similar biological activity, can also be provided by isolation from a cell in which they are naturally present.

The invention further relates to a cell containing a first vector, said first vector comprising a polynucleotide coding for a subunit α10 of an integrin heterodimer, or for homologues or parts thereof having similar biological activity, which polynucleotide comprises the nucleotide sequence shown in SEQ ID No. 1 or SEQ ID No. 2 or parts thereof, and, optionally, a second vector, said second vector comprising a polynucleotide coding for a subunit β of an integrin heterodimer, or for homologues or fragments thereof.

In still another aspect, the invention relates to binding entities having the capability of binding specifically to the integrin heterodimer comprising a subunit α10 and a subunit β, or to homologues or fragments thereof having similar biological activity, preferably wherein the subunit β is β1. Preferred binding entities are proteins, peptides, carbohydrates, lipids, natural ligands, polyclonal antibodies and monoclonal antibodies.

In a further aspect, the invention relates to a fragment of the integrin subunit α10, which fragment is a peptide chosen from the group comprising peptides of the cytoplasmic domain, the I-domain and the spliced domain.

In one embodiment, said fragment is a peptide comprising the amino acid sequence KLGFFAHKKIPEEEKREEKLEQ (SEQ ID No: 7).

In another embodiment, said fragment comprises the amino acid sequence from about amino acid no. 974 to about amino acid no. 1008 of SEQ ID No. 4.

In a further embodiment, said fragment comprises the amino acid sequence from about amino acid No. 162 to about amino acid No. 359 in SEQ ID No. 4.

Another embodiment of the invention relates to a polynucleotide or oligonucleotide coding for a fragment of the human integrin subunit α10. In one embodiment this polynucleotide of oligonucleotide codes for a fragment which is a peptide chosen from the group comprising peptides of the cytoplasmic domain, the I-domain and the spliced domain. In further embodiments the polynucleotide or oligonucleotide codes for the fragments defined above.

The invention also relates to binding entities having the capability of binding specifically to a fragment of the integrin subunit α10 as defined above.

The invention also relates to a process of using an integrin subunit α10 comprising the amino acid sequence shown in SEQ ID No. 4 or SEQ ID No. 5, or an integrin heterodimer comprising said subunit α10 and a subunit β, or a homologue or fragment of said integrin or subunit having similar biological activity, as a marker or target molecule of cells or tissues expressing said integrin subunit α10, which cells or tissues are of animal including human origin.

In an embodiment of this process the fragment is a peptide chosen from the group comprising peptides of the cytoplasmic domain, the I-domain and the spliced domain.

In further embodiments of said process the fragment is a peptide comprising the amino acid sequence KLGFFAHKKIPEEEKREEKLEQ (SEQ ID No: 7), or a fragment comprising the amino acid sequence from about amino acid No. 974 to about amino acid No. 1008 of SEQ ID No. 4, or a fragment comprising the amino acid sequence from about amino acid no. 162 to about amino acid no. 359 of SEQ ID No. 4.

The subunit β is preferably β1. The cells are preferably chosen from the group comprising chondrocytes, smooth muscle cells, endothelial cells, osteoblasts and fibroblasts.

Said process may be used during pathological conditions involving said subunit α10, such as pathological conditions comprising damage of cartilage, or comprising trauma, rheumatoid arthritis and osteoarthritis.

Said process may be used for detecting the formation of cartilage during embryonal development, or for detecting physiological or therapeutic reparation of cartilage.

Said process may also be used for selection and analysis, or for sorting, isolating or purification of chondrocytes.

A further embodiment of said process is a process for detecting regeneration of cartilage or chondrocytes during transplantation of cartilage or chondrocytes.

A still further embodiment of said process is a process for in vitro studies of differentiation of chondrocytes.

The invention also comprises a process of using binding entities having the capability of binding specifically to an integrin subunit α10 comprising the amino acid sequence shown in SEQ ID No. 4 or SEQ ID No. 5, or an integrin heterodimer comprising said subunit α10 and a subunit β, or to homologues or fragments thereof having similar biological activity, as markers or target molecules of cells or tissues expressing said integrin subunit α10, which cells or tissues are of animal including human origin.

The fragment in said process may be a peptide chosen from the group comprising peptides of the cytoplasmic domain, the I-domain and the spliced domain. In preferred embodiments said fragment is a peptide comprising the amino acid sequence (SEQ ID No: 7), or a fragment comprising the amino acid sequence from about amino acid No. 974 to about amino acid No. 1008 of SEQ ID No. 4, or a fragment comprising the amino acid sequence from about amino acid No. 162 to about amino acid no. 359 of SEQ ID No. 4.

The process may also be used for detecting the presence of an integrin subunit α10 comprising the amino acid sequence shown in SEQ ID No. 4 or SEQ ID No. 5, or of an integrin heterodimer comprising said subunit α10 and a subunit β, or of homologues or fragments thereof having similar biological activity.

In a further embodiment said process is a process for determining the differentiation-state of cells during embryonic development, angiogenesis, or development of cancer.

In a still further embodiment this process is a process for detecting the presence of an integrin subunit α10, or of a homologue or fragment of said integrin subunit having similar biological activity, on cells, whereby a polynucleotide or oligonucleotide chosen from the group comprising a polynucleotide or oligonucleotide chosen from the nucleotide sequence shown in SEQ ID No. 1 is used as a marker under hybridisation conditions wherein said polynucleotide or oligonucleotide fails to hybridise to a DNA or RNA encoding an integrin subunit α1. Said cells may be chosen from the group comprising chondrocytes, smooth muscle cells, endothelial cells, osteoblasts and fibroblasts. Said integrin fragment may be a peptide chosen from the group comprising peptides of the cytoplasmic domain, the I-domain and the spliced domain, such as a peptide comprising the amino acid sequence (SEQ ID No: 7), or a fragment comprising the amino acid sequence from about amino acid no. 974 to about amino acid no. 1008 of SEQ ID No. 4, or a fragment comprising the amino acid sequence from about amino acid No. 162 to about amino acid no. 359 of SEQ ID No. 4.

In a still further embodiment the process is a process for determining the differentiation-state of cells during development, in pathological conditions, in tissue regeneration or in therapeutic and physiological reparation of cartilage. The pathological conditions may be any pathological conditions involving the integrin subunit α10, such as rheumatoid arthritis, osteoarthritis or cancer. The cells may be chosen from the group comprising chondrocytes, smooth muscle cells, endothelial cells, osteoblasts and fibroblasts.

The invention also relates to a process for determining the differentiation-state of cells during development, in pathological conditions, in tissue regeneration and in therapeutic and physiological reparation of cartilage, whereby a polynucleotide or oligonucleotide chosen from the nucleotide sequence shown in SEQ ID No. 1 is used as a marker under hybridization conditions wherein said polynucleotide or oligonucleotide fails to hybridise to a DNA or RNA encoding an integrin subunit α1. Embodiments of this aspect comprise a process, whereby said polynucleotide or oligonucleotide is a polynucleotide or oligonucleotide coding for a peptide chosen from the group comprising peptides of the cytoplasmic domain, the I-domain and the spliced domain, such as a polynucleotide or oligonucleotide coding for a peptide comprising the amino acid sequence (SEQ ID No: 7), or comprising the amino acid sequence from about amino acid No. 974 to about amino acid no. 1008 of SEQ ID No. 4, or the amino acid sequence from about amino acid No. 162 to about amino acid No. 359 of SEQ ID No. 4. Said pathological conditions may be any pathological conditions involving the integrin subunit α10, such as rheumatoid arthritis, osteoarthritis or cancer, or atherosclerosis or inflammation. Said cells may be chosen from the group comprising chondrocytes, smooth muscle cells, endothelial cells, osteoblasts and fibroblasts.

In a further aspect the invention relates to a pharmaceutical composition comprising as an active ingredient a pharmaceutical agent or an antibody which is capable of using an integrin heterodimer comprising a subunit α10 and a subunit β, or the subunit α10 thereof, or a homologue or fragment of said integrin or subunit α10 having similar biological activity, as a target molecule. An embodiment of said pharmaceutical composition is intended for use in stimulating, inhibiting or blocking the formation of cartilage, bone or blood vessels. A further embodiment comprises a pharmaceutical composition for use in preventing adhesion between tendon/ligaments and the surrounding tissue after infection, inflammation and after surgical intervention where adhesion impairs the function of the tissue.

The invention is also related to a vaccine comprising as an active ingredient an integrin heterodimer comprising a subunit α10 and a subunit β, or the subunit α10 thereof, or a homologue or fragment of said integrin or subunit α10, or DNA or RNA coding for said integrin subunit α10.

A further aspect of the invention is related to the use of the integrin subunit α10 as defined above as a marker or target in transplantation of cartilage or chondrocytes.

A still further aspect of the invention is related to a method of using binding entities having the capability of binding specifically to an integrin subunit α10 comprising the amino acid sequence shown in SEQ ID No. 4 or SEQ ID No. 5, or an integrin heterodimer comprising said subunit α10 and a subunit β, or to homologues or fragments thereof having similar biological activity, for promoting adhesion of chondrocytes and/or osteoblasts to surfaces of implants to stimulate osseointegration.

The invention is also related to the use of an integrin subunit α10 or an integrin heterodimer comprising said subunit α10 and a subunit β as a target for anti-adhesive drugs or molecules in tendon, ligament, skeletal muscle or other tissues where adhesion impairs the function of the tissue.

The invention also relates to a method of stimulating, inhibiting or blocking the formation of cartilage or bone, comprising administration to a subject a suitable amount of a pharmaceutical agent or an antibody which is capable of using an integrin heterodimer comprising a subunit α10 and a subunit β, or the subunit α10 thereof, or a homologue or fragment of said integrin or subunit α10 having similar biological activity, as a target molecule.

In another embodiment the invention is related to a method of preventing adhesion between tendon/ligaments and the surrounding tissue after infection, inflammation and after surgical intervention where adhesion impairs the function of the tissue, comprising administration to a subject a suitable amount of a pharmaceutical agent or an antibody which is capable of using a integrin heterodimer comprising a subunit α10 and a subunit β, or the subunit α10 thereof, or a homologue or fragment of said integrin or subunit α10 having similar biological activity, as a target molecule.

The invention also relates to a method of stimulating extracellular matrix synthesis and repair by activation or blockage of an integrin heterodimer comprising a subunit α10 and a subunit β, or of the subunit α10 thereof, or of a homologue or fragment of said integrin or subunit α10 having similar biological activity.

In a further aspect the invention relates to a method of in vitro detecting the presence of integrin binding entities, comprising interaction of an integrin heterodimer comprising a subunit α10 and a subunit β, or the subunit α10 thereof, or a homologue or fragment of said integrin or subunit, with a sample, thereby causing said integrin, subunit α10, or homologue or fragment thereof having similar biological activity, to modulate the binding to its natural ligand or other integrin binding proteins present in said sample.

The invention also relates to a method of in vitro studying consequences of the interaction of a human heterodimer integrin comprising a subunit α10 and a subunit β, or the subunit α10 thereof, or a homologue or fragment of said integrin or subunit, with an integrin binding entity and thereby initiate a cellular reaction. Said consequences may be measured as alterations in cellular functions.

A still further aspect of the inventions relates to a method of using DNA or RNA encoding an integrin subunit α10 or homologues or fragments thereof as a molecular target. In an embodiment of this aspect, a polynucleotide or oligonucleotide hybridises to the DNA or RNA encoding an integrin subunit α10 or homologues or fragments thereof, whereby said polynucleotide or oligonucleotide fails to hybridise to a DNA or RNA encoding en integrin subunit α1.

The invention also relates to a method of using a human heterodimer integrin comprising a subunit α10 and a subunit β, or the subunit α10 thereof, or a homologue or fragment of said integrin or subunit, or a DNA or RNA encoding an integrin subunit α10 or homologues or fragments thereof, as a marker or target molecule during angiogenesis.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 Affinity purification of the α10 integrin subunit on collagen type II-Sepharose.

FIG. 2. Amino acid sequences of peptides from the bovine α10 integrin subunit (SEQ ID Nos: 26-31, respectively, in order of appearance).

FIG. 3A. Affinity purification and immunoprecipitation of the integrin subunit α10 from bovine chondrocytes.

FIG. 3B. Affinity purification and immunoprecipitation of the integrin subunit α10 from human chondrocytes.

FIG. 3C. Affinity purification and immunoprecipitation of the integrin subunit α10 from human chondrosarcoma cells.

FIG. 4. A 900 bp PCR-fragment corresponding to the bovine integrin subunit α10.

FIG. 5. Schematic map of the three overlapping α10 clones.

FIG. 6. Nucleotide sequence (SEQ ID No: 1) and deduced amino acid sequence (SEQ ID No: 4) of the human α10 integrin subunit.

FIG. 7. Northern blot of integrin α10 mRNA.

FIG. 8A: Immunoprecipitation of the α10 integrin subunit from human chondrocytes using antibodies against the cytoplasmic domain of α10. FIG. 8B: Western blot of the α10 associated β-chain.

FIGS. 9A, 9B and 9C. Immunostaining of α10 integrin in human articular cartilage.

FIGS. 10A and 10B. Immunostaining of α10 integrin in 3 day mouse limb cartilage.

FIGS. 11A, 11B, and 11C. Immunostaining of α10 integrin in (3.5 day mouse embryo.

FIG. 12. Hybridisation of α10 mRNA in various human tissues.

FIGS. 13A, 13B and 13C. Immunostaining of fascia around tendon (FIG. 13A), skeletal muscle (FIG. 13B), and heart valves (FIG. 13C) in 3 day mouse limb.

FIGS. 14A and 14B. PCR fragments corresponding to α10 integrin subunit from human chondrocytes, human endothelial cells, human fibroblasts and rat tendon.

FIGS. 15A-F. Partial genomic nucleotide sequence (SEQ ID No: 32) of the human integrin subunit α10 (Top protein sequence disclosed as SEQ ID Nos: 33-127; middle protein sequence disclosed as SEQ ID Nos: 128-206; bottom protein sequence disclosed as SEQ ID Nos: 207-299).

FIG. 16. Upregulation of α10 integrin subunit in chondrocytes cultured in alginate.

FIG. 17. Immunoprecipitation of the α10 integrin subunit from human smooth muscle cells.

DETAILED DESCRIPTION OF THE INVENTION

The present invention demonstrates that human and bovine chondrocytes express a novel, collagen type II-binding integrin in the β1-family. An earlier study presented some evidence for that human chondrosarcoma cells also express this integrin (25). Immunoprecipitation experiments using antibodies against the integrin subunit β1 revealed that this novel α-integrin subunit had an apparent molecular weight (Mr) of approximately 160 kDa under reducing conditions, and was slightly larger than the α2 integrin subunit. To isolate this α-subunit collagen type IT-binding proteins were affinity purified from bovine chondrocytes. The chondrocyte lysate was first applied to a fibronectin-Sepharose precolumn and the flow through was then applied to a collagen type II-Sepharose column. A protein with Mr of approximately 160 kD was specifically eluted with EDTA from the collagen column but not from the fibronectin column. The Mr of this protein corresponded with the Mr of the unidentified β1-related integrin subunit. The 160 kD protein band was excised from the SDS-PAGE gel, digested with trypsin and the amino acid sequences of the isolated peptides were analysed.

Primers corresponding to isolated peptides amplified a 900 bp PCR-fragment from bovine cDNA which was cloned, sequenced and used for screening of a human articular chondrocyte λZapII cDNA library to obtain the human integrin α-subunit homologue. Two overlapping clones, hc1 and hc2 were isolated, subcloned and sequenced. These clones contained ⅔ of the nucleotide sequence including the 3′ end of the cDNA. A third clone which contained the 5′ end of the α10 cDNA, was obtained using the RACE technique. Sequence analysis of the 160 kD protein sequence showed that it was a member of the integrin α-subunit family and the protein was named α10.

The deduced amino acid sequence of α10 was found to share the general structure of the integrin α subunits described in previously published reports (6-21). The large extracellular N-terminal part of α10 contains a seven-fold repeated sequence which was recently predicted to fold into a β-propeller domain (32). The integrin subunit α10 contains three putative divalent cation-binding sites (DxD/NxD/NxxxD) (53), a single spanning transmembrane domain and a short cytoplasmic domain. In contrast to most α-integrin subunits the cytoplasmic domain of α10 does not contain the conserved sequence KXGFF(R/K)R. The predicted amino acid sequence in α10 is KLGFFAH (SEQ ID No. 8). Several reports indicate that the integrin cytoplasmic domains are crucial in signal transduction (54) and that membrane-proximal regions of both α- and β-integrin cytoplasmic domains are involved in modulating conformation and affinity state of integrins (55-57). It is suggested that the GFFKR motif in α-chains are important for association of integrin subunits and for transport of the integrin to the plasma membrane (58). The KXGFFKR domain has been shown to interact with the intracellular protein calreticulin (59) and interestingly, calreticulin-null embryonic stem cells are deficient in integrin-mediated cell adhesion (60). It is therefore possible that the sequence (SEQ ID No. 8) in α10 has a key function in regulating the affinity between α10β1 and matrix proteins.

Integrin α subunits are known to share an overall identity of 20-40% (61). Sequence analysis showed that the α10 subunit is most closely related to the I-domain containing α-subunits with the highest identity to a α1 (37%) and α2 (35%). The integrins α1β1 and α2β1 are known receptors for both collagens and laminins (24; 62; 63) and we have also recently demonstrated that α211 interacts with the cartilage matrix protein chondroadherin (42). Since α10β1 was isolated on a collagen type II-Sepharose, we know that collagen type II is a ligand for α10β1. We have also shown by affinity purification experiments that α10β1 interacts with collagen type I but it remains to be seen whether laminin or chondroadherin are also ligands for this integrin.

The α10 associated β-chain migrated as the β1 integrin subunit both under reducing and non-reducing conditions. To verify that the α10 associated β-chain indeed is β1, chondrocyte lysates were immunoprecipitated with antibodies against α10 or β1 followed by Western blot using antibodies against the β1-subunit. These results clearly demonstrated that α10 is a member of the β1-integrin family. However, the possibility that α10 combine also with other β-chains can not be excluded.

A polyclonal peptide antibody raised against the cytoplasmic domain of α10 precipitated two protein bands with Mr of approximately 160 kD (α10) and 125 kD (β1) under reducing conditions. Immunohistochemistry using the α10-antibody showed staining of the chondrocytes in tissue sections of human articular cartilage. The antibody staining was clearly specific since preincubation of the antibody with the α10-peptide completely abolished the staining. Immunohistochemical staining of mouse limb sections from embryonic tissue demonstrated that α10 is upregulated during condensation of the mesenchyme. This indicates that the integrin subunit α10 is important during the formation of cartilage. In 3 day old mice α10 was found to be the dominating collagen binding integrin subunit which point to that α10 has a key function in maintaining normal cartilage functions.

Expression studies on the protein and mRNA level show that the distribution of α10 is rather restrictive. Immunohistochemistry analyses have shown that α10 integrin subunit is mainly expressed in cartilage but it is also found in perichondrium, periosteum, ossification groove of Ranvier, in fascia surrounding tendon and skeletal muscle and in the tendon-like structures in the heart valves. This distribution point to that α10 integrin subunit is present also on fibroblasts and osteoblasts. PCR amplification of cDNA from different cell types revealed the presence of an alternatively spliced α10 integrin subunit. This spliced α10 was dominating in fibroblasts which suggests that α10 in fibro-blasts may have a different function compared to α10 present on chondrocytes.

Expression of the integrin subunit α10 was found to decrease when chondrocytes were cultured in monolayer. In contrast, the expression of α10 was found to increase when the cells were cultured in alginate beads. Since the latter culturing model is known to preserve the phenotype of chondrocytes the results suggest that α10 can function as marker for a differentiated chondrocyte.

Adhesion between tendon/ligaments and the surrounding tissue is a well-known problem after infection, injury and after surgical intervention. Adhesion between tendon and tendon sheets impairs the gliding function and cause considerable problems especially during healing of tendons in e.g. the hand and fingers leading to functional incapacity. The localisation of the α10 integrin subunit in the fascia of tendon and skeletal muscle makes α10 a possible target for drugs and molecules with anti-adhesive properties that could prevent impairment of the function of tendon/ligament. The integrin subunit α10 can also be a target for drugs or molecules with anti-adhesive properties in other tissues where adhesion is a problem.

EXAMPLES

Example 1

Affinity Purification of the α10 Integrin Subunit on Collagen Type II-Sepharose.

Materials and Methods

Bovine chondrocytes, human chondrocytes or human chondrosarcoma cells were isolated as described earlier [Holmvall et al, Exp Cell Res, 221, 496-503 (1995), Camper et al, JBC, 273, 20383-2D389 (1998)]. A Triton X-100 lysate of bovine chondrocytes was applied to a fibronectin-Sepharose precolumn followed by a collagen type II-Sepharose column and the integrin subunit α10 was eluted from the collagen type II-column by EDTA (Camper et al, JBC, 273, 20383-20389 (1998). The eluted proteins were precipitated by methanol/chloroform, separated by SDS-PAGE under reducing conditions and stained with Coomassie blue. (Camper et al, JBC, 273, 20383-2D389 (1998). Peptides from the α10 protein band were isolated by in-gel digestion with a trypsin and phase liquid chromatography and sequenced by Edman degradation (Camper et al, JBC, 273, 20383-20389 (1998).

Results

FIG. 1 shows EDTA-eluted proteins from the fibronectin-Sepharose (A), flowthrough from the collagen type II-Sepharose column (B) and EDTA-eluted proteins from the collagen type II-Sepharose (C). The α10 integrin subunit (160 kDa) which was specifically eluted from the collagen type II column is indicated with an arrow. FIG. 2 shows the amino acid sequences of six peptides that were isolated from the bovine integrin subunit α10. FIGS. 3 a, b, and c show that the α10 integrin subunit is present on bovine chondrocytes (3a), human chondrocytes (3b) and human chondrosarcoma cells (3c). The affinity for collagen type II, the coprecipitation with β1-integrin subunit and the molecular weight of 160 kDa under reducing conditions identify the α10 integrin subunit on the different cells. These results show that α10 can be isolated from chondrocytes and from chondrosarcoma cells.

Example 2

Amplification of PCR Fragment Corresponding to Bovine α10 Integrin Subunit.

Materials and Methods

The degenerate primers (SEQ ID No: 9) ((SEQ ID No: 10), forward) and (SEQ ID No: 11) ((SEQ ID No: 12) reverse) were used in PCR (Camper et al, JBC, 273, 2038320389 (1998) to amplify the nucleotide sequence corresponding to the bovine peptide 1 (FIG. 2). A 900 bp PCR-fragment was then amplified from bovine, cDNA using an internal specific primer (SEQ ID No: 13) (SEQ ID No: 14), forward) corresponding to the cloned nucleotide sequence of peptide 1 together with the degenerate primer (SEQ ID No: 15) ((SEQ ID No: 16) PGHWDR, reverse) corresponding to the bovine peptide 2 (FIG. 2). Mixed bases were used in positions that were twofold degenerate and inosines were used in positions that are three- or fourfold degenerate. mRNA isolation and CDNA synthesis was done as earlier described (Camper et al, JBC, 273, 20383-20389 (1998)). The purified fragment was cloned, purified and sequenced as earlier described (Camper et al, JBC, 273, 20383-20389 (1998)).

Results

The nucleotide sequence of peptide 1 (FIG. 2) was obtained by PCR-amplification, cloning and sequencing of bovine cDNA. From this nucleotide sequence an exact primer was designed and applied in PCR-amplification with degenerate primers corresponding to peptides 2-6 (FIG. 2). Primers corresponding to peptides 1 and 2 amplified a 900 bp PCR-fragment from bovine cDNA (FIG. 4).

Example 3

Cloning and Sequence Analysis of the Human α10 Integrin Subunit

Material and Methods

The cloned 900 bp PCR-fragment, corresponding to bovine α10-integrin, was digoxigenin-labelled according to the DIG DNA label-ling kit (Boehringer Mannheim) and used as a probe for screening of a human articular chondrocyte λZapII cDNA library (provided by Michael Bayliss, The Royal Veterinary Basic Sciences, London, UK) (52). Positive clones containing the pBluescript SK+ plasmid with the cDNA insert were rescued from the ZAP vector by in vivo excision as described in the ZAP-cDNA® synthesis kit (Stratagene). Selected plasmids were purified and sequenced as described earlier (Camper et al, JBC, 273, 20383-20389 (1998)) using T3, T7 and internal specific primers. To obtain CDNA that encoded the 5′ end of α10 we designed the primer (SEQ ID No: 17) (reverse; residue 1254-1280 in α10 CDNA) and used it for rapid amplification of the CDNA 5′ end (RACE) as described in the Marathon™ cDNA Amplification kit (Clontech INC., Palo Alto, Calif.).

Results

Two overlapping clones, hc1 and hc2 (FIG. 5), were isolated, subcloned and sequenced. These clones contained ⅔ of the nucleotide sequence including the 3′ end of the cDNA. A third clone (race1; FIG. 5), which contained the 5′ end of the α10 cDNA, was obtained using the RACE technique. From these three overlapping clones of α10 cDNA, 3884 nucleotides were sequenced The nucleotide sequence and deduced amino acid sequence is shown in FIG. 6. The sequence contains a 3504-nucleotide open reading frame that is predicted to encode a 1167 amino acid mature protein. The signal peptide cleavage site is marked with an arrow, human homologues to bovine peptide sequences are underlined and the I-domain is boxed. Metal ion binding sites are indicated with a broken underline, potential N-glycosylation sites are indicated by an asterisk and the putative transmembrane domain is double underlined. The normally conserved cytoplasmic sequence is indicated by a dot and dashed broken underline.

Sequence analysis demonstrate that α10 is a member of the integrin α-subunit family.

Example 4

Identification of a Clone Containing a Splice Variant of α10

One clone which was isolated from the human chondrocyte library (see Example 3) contained a sequence that was identical to the sequence of α10 integrin subunit except that the nucleotides between nt positions 2942 and 3055 were deleted. The splice variant of α10 was verified in PCR experiment using primers flanking the splice region (see FIGS. 14A-B).

Example 5

Identification of α10 Integrin Subunit by Northern Blot

Material and Methods

Bovine chondrocyte mRNA was purified using a QuickPrep®Micro mRNA Purification Kit (Pharmacia Biotech, Uppsala, Sweden), separated on a 1 agarose-formaldehyde gel, transferred to nylon membranes and immobilised by UV crosslinking. cDNA-probes were 32P labelled with Random Primed DNA Labeling Kit (Boehringer Mannheim). Filters were prehybridised for 2-4 hours at 42° C. in 5×SSE, 5×Denharts solution, 0.1% SDS, 50 μg/ml salmon sperm DNA and 50% formamide and then hybridized over night at 42° C. with the same solution containing the specific probe (0.5-1×106 cpm/ml). Specifically bound cDNA probes were analysed using the phosphoimager system (Fuji). Filters were stripped by washing in 0.1% SDS, for 1 hour at 8000 prior to re-probing. The α10-integrin cDNA-probe was isolated from the race1-containing plasmid using the restriction enzymes BamHI (GIBCO BRL) and NcoI (Boehringer Mannheim). The rat β1-integrin cDNA probe was a kind gift from Staffan Johansson, Uppsala, Sweden.

Results

Northern blot analysis of mRNA from bovine chondrocytes showed that a human α10 cDNA-probe hybridised with a single mRNA of approximately 5.4 kb (FIG. 7). As a comparison, a cDNA-probe corresponding to the integrin subunit α1 was used. This cDNA-probe hybridised a mRNAband of approximately 3.5 kb on the same filter. These results show that a cDNA-probe against α10 can be used to identify the α10 integrin subunit on the mRNA level.

Example 6

Preparation of Antibodies Against the Integrin Subunit α10

A peptide corresponding to part of the α10 cytoplasmic domain, Ckkipeeekreekle (SEQ ID No: 25, see FIG. 6) was synthesized and conjugated to keyhole limpet hemocyanin (KLH). Rabbits were immunized with the peptide-KLH conjugate to generate antiserum against the integrin subunit α10. Antibodies recognizing α10 were affinity purified on an peptide-coupled column (Innovagen AB).

Example 7

Immunoprecipitation of the Integrin Subunit α10 from Chondrocytes

Material and Methods

Human chondrocytes were 125I . . . labelled, lyzed with Triton X-100 and immunoprecipitated as earlier described (Holmvall et al, Exp Cell Res, 221, 496-503 (1995), Camper et al, JBC, 273, 20383-20389 (1998)). Triton X-100 lysates of 125I-labeled human chondrocytes were immunoprecipitated with polyclonal antibodies against the integrin subunits β1, α1, α2, α3 or α10. The immunoprecipitated proteins were separated by SDS-PAGE (4-12%) under non-reducing conditions and visualised using a phosphoimager. Triton X-100 lysates of human chondrocytes immunoprecipitated with α10 or β1 were separated by SDS-PAGE (8%) under non-reducing conditions and analysed by Western blot using the polyclonal β1 antibody and chemiluminescent detection as described in Camper et al, JBC, 273, 20383-20389 (1998).

Results

The polyclonal peptide antibody, raised against the cytoplasmic domain of α10, precipitated two protein bands with Mr of approximately 160 kD (α10) and 125 kD (β1) under reducing conditions. The α10 associated β-chain migrated as the β1 integrin subunit (FIG. 8a). To verify that the α10 associated β-chain in choridrocytes indeed is β1, chondrocyte lysates were immunoprecipitated with antibodies against α10 orb β1 followed by Western blot using antibodies against the β1-subunit (FIG. 8b). These results clearly demonstrated that α10 is a member of the β1-integrin family. However, the results do not exclude the possibility that α10 can associate with other β-chains in other situations.

Example 8

Immunohistochemical Staining of the Integrin Subunit α10 in Human and Mouse Cartilage

Material and Methods

Frozen sections of adult cartilage (trochlear groove) obtained during surgery (provided by Anders Lindahl, Salgrenska Hospital, Gothenburg, Sweden and frozen sections from of 3 day old mouse limb were fixed and prepared for immunohistochemistry as earlier described (Camper et al, JBC, 273, 20383-20389 (1998)). Expression of α10 integrin subunit was analysed using the polyclonal antibody against the cytoplasmic domain as a primary antibody (see Example 6) and a secondary antibody conjugated to peroxidase.

Results

FIG. 9 show immunostaining of human adult articular cartilage.

The α10-antibody recognising the cytoplasmic domain of α10 stained the chondrocytes in tissue sections of human articular cartilage (A). The staining was depleted when the antibody was preincubated with the α10-peptide (B). A control antibody recognizing the α9 integrin subunit did not bind to the chondrocyte (C).

FIG. 10 shows that the α10 antibody stain the majority of chondrocytes in the growing bone anlage (a and b). The α10 antibody also recognised cells in the ossification groove of Ranvier (b), especially the osteoblast in the bone bark which are lining the cartilage in the metaphys are highly positive for α10. The cells in the ossification groove of Ranvier are believed to be important for the growth in diameter of the bone. The integrin subunit α10 is also highly expressed in perichondrium and periosteum. Cell in these tissues are likely important in the repair of the cartilage tissue. The described localisation of the integrin subunit α10 suggest that this integrin is important for the function of the cartilage tissue.

Example 9

Immunohistochemical Staining of the Integrin Subunit α10 During Mouse Development

Material and Methods

Frozen sections from mouse embryos (13.5 days) were investigated for expression of α10 by immunhistochemistry as described in Camper et al, JBC, 273, 20383-20389 (1998). Expression of α10 integrin subunit was analysed using the polyclonal antibody against the cytoplasmic domain as a primary antibody (see Example 6) and a secondary antibody conjugated to peroxidase. The embryo sections were also investigated for expression of integrin subunit α1 (monoclonal antibody from Pharmingen) and collagen type II (monoclonal antibody, kind gift from Dr John Mo, Lund University, Sweden).

Results

FIG. 11 show that α10 integrin subunit is unregulated in the limb when the mesenchymal cells undergo condensation to form cartilage (a). Especially the edge of the newly formed cartilage has high expression of α10. The formation of cartilage is verified by the high expression of the cartilage specific collage type II (b). The control antibody against α1 integrin subunit showed only weak expression on the cartilage (c). In other experiments expression of α10 was found in all cartilage containing tissues in the 3 day old mouse including limbs, ribs and vertebrae. The upregulation of α10 during formation of cartilage suggest that this integrin subunit is important both in the development of cartilage and bone and in the repair of damaged cartilage tissue.

Example 10

mRNA Expression of α10 in Tissues Other than Articular Cartilage

Material and Methods

Expression of α10 integrin subunit was examined on the mRNA level in different human tissues. A Northern dot blot with immobilised mRNA from the listed tissues in FIG. 12 was hybridised with an α10 integrin cDNA probe isolated from the race 1-containing plasmid using the restriction enzymes BamHI and NcoI. The degree of hybridisation was analysed using a phospho imager. The following symbols denote mRNA level in increasing order: −, ++, +++, ++++.

Results

Analysis of the hybridised mRNA showed that α10 was expressed in aorta, trachea, spinal cord, heart, lung, and kidney (FIG. 12). All other tissues appeared negative for α10 expression. These results point to a restricted distribution of the α10 integrin subunit.

Example 11

Immunohistochemical Staining of α10 in Fascia Around Tendon and Skeletal Muscle and in Tendon Structures in Heart Valves.

Materials and Methods

Frozen sections of adult cartilage (trochlear groove) obtained during surgery (provided by Anders Lindahl, Salgrenska Hospital, Gothenburg, Sweden and frozen sections from of 3 day old mouse limb were fixed and prepared for immunohistochemistry as earlier described (Camper et al, JBC, 273, 20383-20389 (1998)). Expression of α10 integrin subunit was analysed using the polyclonal antibody against the cytoplasmic domain as a primary antibody (see Example 6) and a secondary antibody conjugated to peroxidase.

Results

As shown in FIG. 13 expression of α10 was found in the fascia surrounding tendon (a) and skeletal muscle (b) and in the tendon structures in the heart valves (c). This localisation suggest that α10 can bind to other matrix molecules in addition to the cartilage specific collagen type II. The localisation of the integrin α10 on the surface of tendons indicate that α10 can be involved in unwanted adhesion that often occurs between tendon/ligaments and the surrounding tissue after infection, injury or after surgery.

Example 12

mRNA Expression of α10 Integrin Subunit in Chondrocytes, Endothelial Cells and Fibroblasts.

Material and Methods

Isolation of mRNA, synthesis of cDNA and PCR amplification was done as earlier described (Camper et al, JBC, 273, 20383-20389 (1998))

Results

FIGS. 14A-B show PCR amplification of α10 cDNA from human articular chondrocytes (lanes A6 and B1), human umbilical vein endothelial cells (lane A2), human fibroblasts (lane A4) and rat tendon (FIG. 14b, lane B2). Lanes 1, 3, and 5 in FIG. 14A show amplified fragments corresponding to the integrin subunit α2 in endothelial cells, fibroblasts and chondrocytes, respectively. cDNA-primers corresponding to the α10 sequence positions nt 2919-2943 (forward) and nt 3554-3578 (reverse) (see FIG. 6) were used to amplify α10 cDNA from the different cells. The figure shows that α10 was amplified in all three cell types. Two fragments of α10 was amplified which represent the intact form of α10 (larger fragment) and a splice variant (smaller fragment). The larger fragment was dominating in chondrocytes while the smaller fragment was more pronounced in tendon (B2).

Example 13

Construction of α10 mammalian expression vector. The full length protein coding sequence of α10 (combined from 3 clones, see FIG. 6) was inserted into the mammalian expression vector, pcDNA3.1/Zeo (Invitrogen). The vector contains SV40 promoter and Zeosin selection sequence. The α10 containing expression vector was transfected into cells that express the β1-integrin subunit but lack expression of the α10 subunit. Expression of the α10 integrin subunit on the cell surface can be analysed by immunoprecipitation and/or flow cytometry using antibodies specific for α10. The ligand binding capacity and the function of the inserted α10 integrin subunit can be demonstrated in cell adhesion experiment and in signalling experiments.

Example 14

Construction of Mammalian Expression Vector Containing a Splice Variant of α10.

The full length protein coding sequence of the splice variant of α10 (nt 2942-nt3055 deleted) was inserted into the mammalian expression vector pcDNA3 (see Example 13). Expression and function of the splice variant can be analysed as described in example 13 and compared with the intact α10 integrin subunit.

Example 15

Partial Isolation and Characterisation of the α10 Integrin Genomic DNA

Material and Methods

Human α10 cDNA, isolated from the race1-containing plasmid using the restriction enzymes BamHI (GIBCO BRL) and NcoI (Boehringer Mannheim), was 32P-labelled and used as a probe for screening of a mouse 129 cosmid library (provided by Reinhard Fässler, Lund University). Positive clones were isolated and subcloned. Selected plasmids were purified and sequenced as described earlier (Camper et al, JBC, 273, 20383-20389 (1998)) using T3, T7 and internal specific primers. Primers corresponding to mouse genomic DNA were then constructed and used in PCR to amplify and identify the genomic sequence of α10 from the cosmid clones.

Results

FIG. 15 shows 7958 nt of the α10 gene. This partial genomic DNA sequence of α10 integrin contains 8 exons, and a Kozak sequence. The mouse genomic α10 sequence was used to generate a targeting vector for knockout experiments.

Example 16

Upregulation of α10 Integrin Subunit in Chondrocytes Cultured in Alginate Beads

Material and Methods

Human chondrocytes cultured in monolayer for 2 weeks were detached with trypsin-EDTA and introduced into alginate beads. Chondrocytes cultured in alginate are known to preserve their phenotype while chondrocytes cultured in monolayer are dedifferentiated. After 11 days chondrocytes cultured either in alginate or on monolayer were isolated and surface labelled with 125I. The α10 integrin subunit was then immunoprecipitated with polyclonal antibodies recognising the cytoplasmic domain of α10 (see Example 6 and Camper et al, JBC, 273, 20383-20389 (1998))

Results

As shown in FIG. 16 chondrocytes cultured in alginate beads (lanes 3 and 4) upregulated their protein expression of α10β1. This was in contrast to chondrocytes cultured in monolayer (lanes 1 and 2) which had a very low expression of α10β1. Immunoprecipitation with ab control antibody is shown in lanes 1 and 3. It is known that chondrocytes preserve their cartilage specific matrixproduction in alginate cultures but not in monolayer culture which point to that alginate preserve the phenotype of chondrocytes. These results support that α10 integrin subunit can be used as a marker for differentiated chondrocytes.

Example 17

Immunoprecipitation of the α10 Integrin Subunit from Human Smooth Muscle Cells.

Material and Methods

Human smooth muscle cells were isolated from human aorta. After one week in culture the cells were 125I-labelled, lysed and immunoprecipitated with antibodies against the integrin subunit β1 (lane 1), α1 (lane 2), α2 (lane 3), α10 (lane 4), α3 (lane 5), control (lane 6) (FIG. 17). The experiment was done as described in Example 7.

Results

The α10 antibody precipitated two bands from the smooth muscle cells corresponding to the α10 and the β1 integrin subunit (FIG. 17).

Example 18

Construction of Bacterial Expression Vector Containing Sequence for α10 Splice Region.

A plasmid for intracellular expression in E. coli of the alternatively spliced region (amino acid pos. 974-1008, SEQ ID No. 4) was constructed as described. The alternatively spliced region were back-translated using the E. coli high frequency codon table, creating a cDNA sequence of 96% identity with the original sequence (SEQ ID No. 1, nucleotide pos 2940-3044). Using sequence overlap extension (Horton et al., Biotechniques 8:528, 1990) primer α10pfor (tab. I) and α10pfor (tab. I) was used to generate a double stranded fragment encoding the α10 amino acid sequence. This fragment was used as a PCR template with primers α10pfor2 (tab. I) and α10prev2 (tab. I) in order to generate restriction enzyme site for sub-cloning in a pET vector containing the Z-domain of staphylococcal protein A, creating a fusion of the α10 spliced region with the amino terminal of the Z-domain with thrombin cleavage site residing in-between. The fragment generated in the second PCR reaction is shown (SEQ ID No. 3; amino acid sequence disclosed as SEQ ID No: 6) also indicating the unique restriction enzymes used for sub-cloning in the expression vector.

TABLE I
(SEQ ID Nos: 18-21, respectively,
in order of appearance)
α10pfor 5′-GTTCAGAACCTGGGTTGCTACGTTG
(SEQ ID No: 18) TTTCCGGTCTGATCATCTCCGCTCTGCT
GCCGGCTGT-3′
α10pfor2 5′-GGGGCATATGGTTCAGAACCTGGGT
(SEQ ID No: 19) TGCTACGTTG-3′
α10prev 5′-GATAACCTGGGACAAGCTTAGGAAG
(SEQ ID No: 20) TAGTTACCACCGTGAGCAACAGCCGGCA
GCAGAGCGGA-3′
α10prev2 5′-GGGGGGATCCGCGCGGCACCAGGCC
(SEQ ID No: 21) GCTGATAACCTGGGACAAGCTTAGGAAG
T-3′

Claims

1. A purified recombinant cDNA comprising the sequence of SEQ ID NO:1.

2. A recombinant nucleic acid vector comprising the cDNA of claim 1.

3. The vector of claim 2, which comprises a plasmid.

4. A recombinant cell comprising the plasmid of claim 3.

5. A recombinant cell comprising the vector of claim 2.

6. A recombinant cell comprising the cDNA of claim 1.

7. A purified recombinant cDNA comprising the sequence of SEQ ID NO:2.

8. A recombinant nucleic acid vector comprising the cDNA of claim 7.

9. The vector of claim 8, which comprises a plasmid.

10. A recombinant cell comprising the plasmid of claim 9.

11. A recombinant cell comprising the vector of claim 8.

12. A recombinant cell comprising the cDNA of claim 7.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class: