US20180271438A1
2018-09-27
16/002,515
2018-06-07
A bioinformatics process which provides an improved means to detect TGF-β cellular signaling pathway in a subject, such as a human, based on the expression levels of one or more unique target gene(s) of the TGF-β cellular signaling pathway measured in a sample. The invention includes an apparatus comprising a digital processor configured to perform such a method, a non-transitory storage medium storing instructions that are executable by a digital processing device to perform such a method, and a computer program comprising program code means for causing a digital processing device to perform such a method. Kits are also provided for measuring expression levels of unique sets of TGF-β cellular signaling pathway target genes.
Get notified when new applications in this technology area are published.
A61B5/4839 » CPC main
Measuring for diagnostic purposes ; Identification of persons; Other medical applications; Diagnosis combined with treatment in closed-loop systems or methods combined with drug delivery
C12Q1/6886 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
C12Q2600/16 » CPC further
Oligonucleotides characterized by their use Primer sets for multiplex assays
C12Q2600/158 » CPC further
Oligonucleotides characterized by their use Expression markers
A61B5/00 IPC
Measuring for diagnostic purposes ; Identification of persons
This application is a Divisional of application Ser. No. 14/922,561, filed on Oct. 26, 2015, which claims the benefit of European Patent Application No. EP14190270.0, filed Oct. 24, 2014, the entirety of the specification and claims thereof is hereby incorporated by reference for all purposes.
A Sequence Listing associated with this application is provided in text format in lieu of a paper copy, and is hereby incorporated by reference into the specification. The name of the text file containing the Sequence Listing is 2014PF00582_2015-10-26_sequencelisting_ST25.txt. The text file is 295 KB, was created on Oct. 26, 2015, and is being submitted electronically via EFS-Web.
The present invention is in the field of systems biology, bioinformatics, genomic mathematical processing and proteomic mathematical processing. In particular, the invention includes a systems-based mathematical process for determining the activity of a TGF-3 cellular signaling pathway in a subject based on expression levels of a unique set of selected target gene(s) in a subject. The invention further provides an apparatus that includes a digital processor configured to perform such a method, a non-transitory storage medium storing instructions that are executable by a digital processing device to perform such a method, and a computer program comprising a program code means for causing a digital processing device to perform such a method. The present invention also includes kits for the determination of expression levels of the unique combinations of target genes.
As knowledge of tumors including cancers evolve, it becomes more clear that they are extraordinarily heterogeneous and multifactorial. Tumors and cancers have a wide range of genotypes and phenotypes, they are influenced by their individualized cell receptors (or lack thereof), micro-environment, extracellular matrix, tumor vascularization, neighboring immune cells, and accumulations of mutations, with differing capacities for proliferation, migration, stem cell properties and invasion. This scope of heterogeneity exists even among same classes of tumors. See generally: Nature Insight: Tumor Heterogeneity (entire issue of articles), 19 Sep. 2013 (Vol. 501, Issue 7467); Zellmer and Zhang, “Evolving concepts of tumor heterogeneity”, Cell and Bioscience 2014, 4:69.
Traditionally, physicians have treated tumors, including cancers, as the same within class type (including within receptor type) without taking into account the enormous fundamental individualized nature of the diseased tissue. Patients have been treated with available chemotherapeutic agents based on class and receptor type, and if they do not respond, they are treated with an alternative therapeutic, if it exists. This is an empirical approach to medicine.
There has been a growing trend toward taking into account the heterogeneity of tumors at a more fundamental level as a means to create individualized therapies, however, this trend is still in its formative stages. What is desperately needed are approaches to obtain more metadata about the tumor to inform therapeutic treatment in a manner that allows the prescription of approaches more closely tailored to the individual tumor, and perhaps more importantly, avoiding therapies destined to fail and waste valuable time, which can be life-determinative.
A number of companies and institutions are active in the area of classical, and some more advanced, genetic testing, diagnostics, and predictions for the development of human diseases, including, for example: Affymetrix, Inc.; Bio-Rad, Inc; Roche Diagnostics; Genomic Health, Inc.; Regents of the University of California; Illumina; Fluidigm Corporation; Sequenom, Inc.; High Throughput Genomics; NanoString Technologies; Thermo Fisher; Danaher; Becton, Dickinson and Company; bioMerieux; Johnson & Johnson, Myriad Genetics, and Hologic.
Several companies have developed technology or products directed to gene expression profiling and disease classification. For example, Genomic Health, Inc. is the assignee of numerous patents pertaining to gene expression profiling, for example: U.S. Pat. Nos. 7,081,340; 8,808,994; 8,034,565; 8,206,919; 7,858,304; 8,741,605; 8,765,383; 7,838,224; 8,071,286; 8,148,076; 8,008,003; 8,725,426; 7,888,019; 8,906,625; 8,703,736; 7,695,913; 7,569,345; 8,067,178; 7,056,674; 8,153,379; 8,153,380; 8,153,378; 8,026,060; 8,029,995; 8,198,024; 8,273,537; 8,632,980; 7,723,033; 8,367,345; 8,911,940; 7,939,261; 7,526,637; 8,868,352; 7,930,104; 7,816,084; 7,754,431 and 7,208,470, and their foreign counterparts.
U.S. Pat. No. 9,076,104 to the Regents of the University of California titled “Systems and Methods for Identifying Drug Targets using Biological Networks” claims a method with computer executable instructions by a processor for predicting gene expression profile changes on inhibition of proteins or genes of drug targets on treating a disease, that includes constructing a genetic network using a dynamic Bayesian network based at least in part on knowledge of drug inhibiting effects on a disease, associating a set of parameters with the constructed dynamic Bayesian network, determining the values of a joint probability distribution via an automatic procedure, deriving a mean dynamic Bayesian network with averaged parameters and calculating a quantitative prediction based at least in part on the mean dynamic Bayesian network, wherein the method searches for an optimal combination of drug targets whose perturbed gene expression profiles are most similar to healthy cells.
Affymetrix has developed a number of products related to gene expression profiling. Non-limiting examples of U.S. Patents to Affymetrix include: U.S. Pat. Nos. 6,884,578; 8,029,997; 6,308,170; 6,720,149; 5,874,219; 6,171,798; and 6,391,550.
Likewise, Bio-Rad has a number of products directed to gene expression profiling. Illustrative examples of U.S. Patents to Bio-Rad include: U.S. Pat. Nos. 8,021,894; 8,451,450; 8,518,639; 6,004,761; 6,146,897; 7,299,134; 7,160,734; 6,675,104; 6,844,165; 6,225,047; 7,754,861 and 6,004,761.
Koninklijke Philips N.V. (NL) has filed a number of patent applications in the general area of assessment of cellular signaling pathway activity using various mathematical models, including U.S. Ser. No. 14/233,546 (WO 2013/011479), titled “Assessment of Cellular Signaling Pathway Using Probabilistic Modeling of Target Gene Expression”; U.S. Ser. No. 14/652,805 (WO 2014/102668) titled “Assessment of Cellular Signaling Pathway Activity Using Linear Combinations of Target Gene Expressions; WO 2014/174003 titled “Medical Prognosis and Prediction of Treatment Response Using Multiple Cellular Signaling Pathway Activities; and WO 2015/101635 titled “Assessment of the PI3K Cellular Signaling Pathway Activity Using Mathematical Modeling of Target Gene Expression.
Despite this progress, more work is needed to definitively characterize tumor cellular behavior. In particular, there is a critical need to determine which pathways have become pathogenic to the cell. However, it is difficult to identify and separate abnormal cellular signaling from normal cellular pathway activity.
Transforming growth factor-β (TGF-β) is a cytokine that controls various functions in many cell types in humans, such as proliferation, differentiation, and wound healing. In pathological disorders, such as cancer (e.g., colon, breast, prostate), the TGF-β cellular signaling pathway can play two opposing roles, either as a tumor suppressor or as a tumor promoter. TGF-β may act as a tumor suppressor in the early phases of cancer development, however in more progressed cancerous tissue TGF-β can act as a tumor promoter by acting as a regulator of invasion and metastasis (see Padua D. and Massagué J., “Roles of TGF-β in metastasis”, Cell Research, Vol. 19, No. 1, 2009, pages 89 to 102).
TGF-β exists in three isoforms (gene names: TGF-β1, TGF-β2, TGF-β3). It is secreted as an inactive precursor homodimeric protein, which is known to be increased in cancer cells compared to their normal counterparts (see Massagué J., “How cells read TGF-β signals”, Nature Reviews Molecular Cell Biology, Vol. 1, No. 3, 2000, pages 169 to 178).
The TGF-β precursor can be proteolytically activated, after which it binds to an extracellular TGF-β receptor that initiates an intracellular “SMAD” signaling pathway. Various SMAD proteins (receptor-regulated or R-SMADs (SMAD 1, 2, 3, 5 and 8) and SMAD4) form a heterocomplex that enters the nucleus where it acts as a transcription factor, inducing the expression of a range of proteins which affect tumor growth (see FIG. 1; L. TGF-β=Latent TGF-β; PR=Proteasome; PH=Phosphatase; Co-R=Co-repressors; Co-A=Co-activators). The term “TGF-β cellular signaling pathway” herein refers to a signaling process triggered by TGF-β binding to the extracellular TGF receptor causing the intracellular SMAD cascade, which ultimately leads to the formation of a SMAD complex that acts as a transcription factor.
A number of anti-TGF-β therapies are in preclinical or clinical development (see Yingling J. M. et al., “Development of TGF-β signaling inhibitors for cancer therapy”, Nature Reviews Drug Discovery, Vol. 3, No. 12, 2004, pages 1011 to 1022; Nacif and Shaker, “Targeting Transforming Growth Factor-B (TGF-β) in Cancer and Non-Neoplastic Diseases”; Journal of Cancer Therapy, 2014, 5, 735-747).
However, physicians must use caution in administering an anti-TGF-β drug to a patient with a tumor, including cancer, because in some tumors, TGF-β is playing a tumor suppressing role. It is therefore important to be able to more accurately assess the functional state of the TGF-βcellular signaling pathway at specific points in disease progression. For example, the TGF-β cellular signaling pathway, with respect to cancer, is more likely to be tumor-promoting in its active state and tumor-suppressing in its passive state. Notwithstanding, it can be difficult to discern the difference in a diseased cell.
It is therefore an object of the invention to provide a more accurate process to determine the tumorigenic propensity of the TGF-β cellular signaling pathway in a cell, as well as associated methods of therapeutic treatment, kits, systems, etc.
The present invention includes methods and apparatuses for determining the activity level of a TGF-β cellular signaling pathway in a subject, typically a human with diseased tissue such as a tumor or cancer, wherein the activity level of the TGF-β cellular signaling pathway is determined by calculating a level of TGF-β transcription factor element in a sample of the involved tissue isolated from the subject, wherein the level of the TGF-β transcription factor element in the sample are determined by measuring the expression levels of a unique set of target genes controlled by the TGF-β transcription factor element using a calibrated pathway model that compares the expression levels of the target genes in the sample with expression levels of the target genes in the calibrated pathway model.
In particular, the unique set of target genes whose expression level is analyzed in the model includes at least three target genes, at least four target genes, at least five target genes, at least six target genes, at least seven target genes, at least eight target genes, at least nine target genes, at least ten target genes or more selected from ANGPTL4, CDC42EP3, CDKN1A, CDKN2B, CTGF, GADD45A, GADD45B, HMGA2, ID1, IL11, SERPINE1, INPP5D, JUNB, MMP2, MMP9, NKX2-5, OVOL1, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI1, SNAI2, TIMP1, and VEGFA. In one embodiment, the unique set of target genes whose expression level is analyzed in the model includes ANGPTL4 and CDC42EP3, and at least one or more, for example, two, three, four, five, six, seven or more of CDKN1A, CTGF, GADD45A, GADD45B, HMGA2, ID1, IL11, SERPINE1, JUNB, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI2, and VEGFA. In one embodiment, the unique set of target genes is ANGPTL4 and CDC42EP3, and at least one or more, for example, two, three, four, five, six, seven, eight, nine, or ten target genes selected from CDKN1A, CTGF, GADD45B, ID1, IL11, JUNB, PDGFB, SKIL, SMAD7, and SNAI2. In one embodiment, the unique set of target genes is ANGPTL4 and CDC42EP3, and at least one or more, for example, two, three, four, five, six, seven, eight, nine, or ten of target genes selected from CDKN1A, CTGF, GADD45B, ID1, SERPINE1, JUNB, VEGFA, SKIL, SMAD7, and SNAI2. In one embodiment, the target genes analyzed include at least ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, and SMAD7.
Using this invention, health care providers will be able to more accurately assess the functional state of the TGF-β cellular signaling pathway at specific points in disease progression. Without being bound by any particular theory, it is believed that the identified target genes of the present invention in combination with the analytical methods described herein reduces the noise associated with the use of large subsets of target genes as previously described in the literature. Furthermore, as described and exemplified below, the use of specific combinations of select target genes allows for the precise determination of cellular signaling activity, and allows for an increased accuracy in the determination of disease state and prognosis. Accordingly, such cellular signaling pathway status can be used to, for example but not limited to, identify the presence or absence of disease and/or particular disease state or advancement, identify the presence or absence of a disorder or disease state, identify a particular subtype within a disease or disorder based one the activity level of the TGF-β cellular signaling pathway, derive a course of treatment based on the presence or absence of TGF-β signaling activity for example by administering a TGF-β inhibitor, and/or monitor disease progression in order to, for example, adjust therapeutic protocols based on a predicted drug efficacy in light of the determined activity of the TGF-β cellular signaling pathway in the sample.
The term “TGF-β transcriptional factor element” or “TGF-β TF element” or “TF element” refers to either a protein or protein complex transcriptional factor triggered by the binding of TGF-β to its receptor or an intermediate downstream signaling agent between the binding of TGF-β to its receptor and the final transcriptional factor protein or protein complex. It is known that TGF-β binds to an extracellular TGF-β receptor that initiates an intracellular “SMAD” signaling pathway and that various SMAD proteins (receptor-regulated or R-SMADs (SMAD 1, 2, 3, 5 and 8) and SMAD4) can form a heterocomplex.
The present invention is based on the realization of the inventors that a suitable way of identifying effects occurring in the TGF-β cellular signaling pathway can be based on a measurement of the signaling output of the TGF-β cellular signaling pathway, which is—amongst others—the transcription of the unique target genes described herein by a TGF-β transcription factor (TF) element controlled by the TGF-β cellular signaling pathway. This realization by the inventors assumes that the TF level is at a quasi-steady state in the sample which can be detected by means of—amongst others—the expression values of the target genes. The TGF-β cellular signaling pathway targeted herein is known to control many functions in many cell types in humans, such as proliferation, differentiation and wound healing. Regarding pathological disorders, such as cancer (e.g., colon, pancreatic, lung, brain or breast cancer), the TGF-β cellular signaling pathway plays two opposite roles, either as a tumor suppressor or as a tumor promoter, which is detectable in the expression profiles of the target genes and thus exploited by means of a mathematical model.
The present invention makes it possible to determine the activity level of the TGF-β cellular signaling pathway in a subject by (i) determining a level of a TGF-β TF element in a sample from the subject, wherein the determining is based at least in part on evaluating a mathematical model relating expression levels of one or more target gene(s) of the TGF-β cellular signaling pathway, the transcription of which is controlled by the TGF-β TF element, to the level of the TGF-β TF element, and by (ii) calculating the activity of the TGF-β cellular signaling pathway in the subject based on the determined level of the TGF-β TF element in the sample of the subject. In certain embodiments, the calculated activity level of the TGF-β cellular signaling pathway is indicative of an active TGF-β cellular signaling pathway. This, for example, allows improving the possibilities of characterizing subjects that have a particular disease or disease subtype, for example a cancer, e.g., a colon, pancreatic, lung, brain, or breast cancer, which is at least partially driven by a tumor-promoting activity of the TGF-β cellular signaling pathway, and that are therefore likely to respond to inhibitors of the TGF-β cellular signaling pathway or other appropriate treatments for the classified disorder. In particular embodiments, treatment determination can be based on specific TGF-β activity. In a particular embodiment the TGF-β cellular signaling status can be set at a cutoff value of odds of the TGF-β cellular signaling pathway being activate of, for example, 10:1, 5:1, 4:1, 2:1, 1:1, 1:2, 1:4, 1:5, or 1:10.
In one aspect of the invention, provided herein is a method of determining a TGF-β cellular signaling pathway activity in a subject, for example a human, comprising the steps of:
In one embodiment, the method further comprises assigning a TGF-β cellular signaling pathway activity status to the calculated activity level of the TGF-β cellular signaling pathway in the sample wherein the activity status is indicative of either an active TGF-β cellular signaling pathway or a passive TGF-β cellular signaling pathway. In one embodiment, the status of the TGF-β cellular signaling pathway is established by establishing a specific threshold for activity as described further below. In one embodiment, the threshold is set as a probability that the cellular signaling pathway is active, for example, a 10:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:4, 1:5, or 1:10. In one embodiment, the activity status is based, for example, on a minimum calculated activity. In one embodiment, the method further comprises assigning to the calculated TGF-β cellular signaling in the sample a probability that the TGF-β cellular signaling pathway is active.
As contemplated herein, the level of the TGF-β transcription factor element is determined using a calibrated pathway model executed by one or more computer processors, as further described below. The calibrated pathway model compares the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the calibrated pathway model which define a level of a TGF-β transcription factor element. In one embodiment, the calibrated pathway model is a probabilistic model incorporating conditional probabilistic relationships that compare the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the model which define a level of a TGF-β transcription factor element to determine the level of the TGF-β transcription factor element in the sample. In one embodiment, the probabilistic model is a Bayesian network model. In an alternative embodiment, the calibrated pathway model can be a linear or pseudo-linear model. In an embodiment, the linear or pseudo-linear model is a linear or pseudo-linear combination model.
As contemplated herein, the expression levels of the unique set of target genes can be determined using standard methods known in the art. For example, the expression levels of the target genes can be determined by measuring the level of mRNA of the target genes, through quantitative reverse transcriptase-polymerase chain reaction techniques, using probes associated with a mRNA sequence of the target genes, using a DNA or RNA microarray, and/or by measuring the protein level of the protein encoded by the target genes. Once the expression level of the target genes is determined, the expression levels of the target genes within the sample can be utilized in the model in a raw state or, alternatively, following normalization of the expression level data. For example, expression level data can be normalized by transforming it into continuous data, z-score data, discrete data, or fuzzy data.
As contemplated herein, the calculation of TGF-β signaling in the sample is performed on a computerized device having a processor capable of executing a readable program code for calculating the TGF-β signaling in the sample according to the methods described above. Accordingly, the computerized device can include means for receiving expression level data, wherein the data is expression levels of at least three target genes derived from the sample, a means for calculating the level of a TGF-β transcription factor element in the sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the model which define a level a TGF-β transcription factor element; a means for calculating the TGF-β cellular signaling in the sample based on the calculated levels of a TGF-β transcription factor element in the sample; and a means for assigning a TGF-β cellular signaling pathway activity probability or status to the calculated TGF-β cellular signaling in the sample, and, optionally, a means for displaying the TGF-β signaling pathway activity probability or status.
In accordance with another disclosed aspect, further provided herein is a non-transitory storage medium capable of storing instructions that are executable by a digital processing device to perform the method according to the present invention as described herein. The non-transitory storage medium may be a computer-readable storage medium, such as a hard drive or other magnetic storage medium, an optical disk or other optical storage medium, a random access memory (RAM), read only memory (ROM), flash memory, or other electronic storage medium, a network server, or so forth. The digital processing device may be a handheld device (e.g., a personal data assistant or smartphone), a notebook computer, a desktop computer, a tablet computer or device, a remote network server, or so forth.
Further contemplated herein are methods of treating a subject having a disease or disorder associated with an activated TGF-β cellular signaling pathway, or a disorder whose advancement or progression is exacerbated or caused by, wether partially or wholly, an activated TGF-β cellular signaling pathway, wherein the determination of the TGF-β cellular signaling pathway activity is based on the methods described above, and administering to the subject a TGF-β inhibitor if the information regarding the activity level of TGF-β cellular signaling pathway is indicative of an active TGF-β cellullar signaling pathway. In one embodiment, the disorder is one of an auto-immune and other immune disorders, cancer, bronchial asthma, heart disease, diabetes, hereditary hemorrhagic telangiectasia, Marfan syndrome, Vascular Ehlers-Danlos syndrome, Loeys-Dietz syndrome, Parkinson's disease, Chronic kidney disease, Multiple Sclerosis, fibrotic diseases such as liver, Ing, or kidney fibrosis, Dupuytren's disease, or Alzheimer's disease. In a particular embodiment, the subject is suffering from a cancer, for example, a breast cancer, lung cancer, a colon cancer, pancreatic cancer, brain cancer, or breast cancer. In a more particular embodiment, the cancer is a breast cancer.
Also contemplated herein is a kit for measuring the expression levels of at least three or more TGF-β cellular signaling pathway target genes, for example, four, five, six, seven, eight, nine, ten, eleven, twelve, or more target genes as described herein. In one embodiment, the kit includes one or more components, for example probes, for example labeled probes, and/or PCR primers, for measuring the expression levels of at least three target genes, at least four target genes, at least five target genes, or at least six or more target genes selected from ANGPTL4, CDC42EP3, CDKN1A, CDKN2B, CTGF, GADD45A, GADD45B, HMGA2, ID1, IL11, SERPINE1, INPP5D, JUNB, MMP2, MMP9, NKX2-5, OVOL1, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI1, SNAI2, TIMP1, and VEGFA. In one embodiment, the kit includes one or more components for measuring the expression levels of the target genes ANGPTL4 and CDC42EP3, and at least one or more, for example, two, three, four, five, six, seven, or more of CDKN1A, CTGF, GADD45A, GADD45B, HMGA2, ID1, IL11, SERPINE1, JUNB, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI2, and VEGFA. In one embodiment, the kit includes one or more components for measuring the expression levels of the target genes ANGPTL4 and CDC42EP3, and at least one or more, for example, two, three, four, five, six, seven, eight, nine, or ten target genes selected from CDKN1A, CTGF, GADD45B, ID1, IL11, JUNB, PDGFB, SKIL, SMAD7, and SNAI2.
In one embodiment, the kit includes one or more components for measuring the expression levels of the target genes ANGPTL4 and CDC42EP3, and at least one or more, for example, two, three, four, five, six, seven, eight, nine, or ten of target genes selected from CDKN1A, CTGF, GADD45B, ID1, SERPINE1, JUNB, VEGFA, SKIL, SMAD7, and SNAI2. In one embodiment, the kit includes one or more components for measuring the expression levels of at least the target genes ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, and SMAD7.
As contemplated herein, the one or more components or means for measuring the expression levels of the particular target genes can be selected from the group consisting of: an DNA array chip, an oligonucleotide array chip, a protein array chip, an antibody, a plurality of probes, for example, labeled probes, a set of RNA reverser-transcriptase sequencing components, and/or RNA or DNA, including cDNA, amplification primers. In one embodiment, the kit includes a set of labeled probes directed to a portion of an mRNA or cDNA sequence of the targeted genes as described herein. In one embodiment, the kit includes a set of primers and probes directed to a portion of an mRNA or cDNA sequence of the targeted genes as described further below, for example, a set of specific primers or probes selected from the sequences of Table 1 or Table 2. In one embodiment, the labeled probes are contained in a standardized 96-well plate. In one embodiment, the kit further includes primers or probes directed to a set of reference genes, for example, as represented in Table 3. Such reference genes can be, for example, constitutively expressed genes useful in normalizing or standardizing expression levels of the target gene expression levels described herein.
In one embodiment, the kit further includes a non-transitory storage medium containing instructions that are executable by a digital processing device to perform a method according to the present invention as described herein. In one embodiment, the kit includes an identification code that provides access to a server or computer network for analyzing the activity level of the TGF-β cellular signaling pathway based on the expression levels of the target genes and the methods described herein.
In one aspect of the invention, provided herein is a method for calculating activity of a TGF-β cellular signaling pathway using mathematical modelling of target gene expressions, namely a method comprising:
inferring activity of a TGF-β cellular signaling pathway in a subject based at least on expression levels of one or more target gene(s) of the TGF-β cellular signaling pathway measured in a sample of the subject, wherein the calculating comprises:
inferring a level of a TGF-β transcription factor (TF) element in the sample of the subject, the TGF-β TF element controlling transcription of the one or more target gene(s) of the TGF-β cellular signaling pathway, the determining being based at least in part on evaluating a mathematical model relating expression levels of the one or more target gene(s) of the TGF-β cellular signaling pathway to the level of the TGF-β TF element;
inferring the activity of the TGF-β cellular signaling pathway in the subject based on the determined level of the TGF-β TF element in the sample of the subject,
wherein the calculating is performed by a digital processing device using the mathematical model.
FIG. 1 shows schematically and exemplarily TGF-β signaling through the canonical cellular signaling pathway (left part) which is initiated upon binding of the TGF-β protein to the receptor. The initiated cellular signaling pathway ultimately results in the translocation of SMAD2/3 and SMAD4 to the nucleus and binding to the DNA thereby starting target gene transcription (see Sheen Y. Y. et al., “Targeting the transforming growth factor-β signaling in cancer therapy”, Biomolecules and Therapeutics, Vol. 21, No. 5, 2013, pages 323 to 331).
FIG. 2 shows schematically and exemplarily a mathematical model, herein, a Bayesian network model, useful in modelling the transcriptional program of the TGF-β cellular signaling pathway.
FIG. 3 shows an exemplary flow chart for calculating the activity level of the TGF-β cellular signaling pathway based on expression levels of target genes derived from a sample.
FIG. 4 shows an exemplary flow chart for obtaining a calibrated pathway model as described herein.
FIG. 5 shows an exemplary flow chart for calculating the Transcription Factor (TF) Element as described herein.
FIG. 6 shows an exemplary flow chart for calculating the TGF-β cellular signaling pathway activity level using discretized observables.
FIG. 7 shows an exemplary flow chart for calculating the TGF-β cellular signaling pathway activity level using continuous observables.
FIG. 8 shows an exemplary flow chart for determining Cq values from RT-qPCR analysis of the target genes of the TGF-β cellular signaling pathway.
FIGS. 9 to 12 show training results of the exemplary Bayesian network model based on the evidence curated list of target genes (FIG. 9), the 20 target genes shortlist (FIG. 10), the 12 target genes shortlist (FIG. 11), and the 7 target genes shortlist of the TGF-β cellular signaling pathway (FIG. 12) (see Tables 4 to 7), respectively. (Legend: 1—Control, 2 TGF-β stimulation with 5 ng/mL for 0.5 h; 3 TGF-β stimulation with 5 ng/mL for 1 h; 4—TGF-β stimulation with 5 ng/mL for 2 h; 5—TGF-β stimulation with 5 ng/mL for 4 h; 6—TGF-β stimulation with 5 ng/mL for 8 h; 7—TGF-β stimulation with 5 ng/mL for 16 h; 8—TGF-β stimulation with 5 ng/mL for 24 h; 9—TGF-β stimulation with 5 ng/mL for 72 h)
FIGS. 13 to 16 show TGF-β cellular signaling pathway activity predictions of the trained exemplary Bayesian network models using the evidence curated list of target genes (FIG. 13), the 20 target genes shortlist (FIG. 14), the 12 target genes shortlist (FIG. 15), and the 7 target genes shortlist (FIG. 16) (see Tables 4 to 7), respectively, for human mammary epithelial cells (HMEC-TR) from GSE28448. (Legend: 1—Control, no TGF-β; 2—Control, TGF-β; 3—siRNA SMAD4, no TGF-β; 4—siRNA SMAD4, TGF-β; 5—siRNA TIFγ, no TGF-β; 6—siRNA TIFγ, TGF-β)
FIG. 17 shows TGF-β cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 4) for ectocervival epithelial cells (Ect1) from GSE35830, which were stimulated with seminal plasma or 5 ng/mL TGF-β. (Legend: 1—Control, no TGF-β; 2—Stimulated with 10% seminal plasma; 3—stimulated with 5 ng/mL TGF-β)
FIG. 18 shows TGF-β cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 4) for patient gliomas from GSE16011. (Legend. 1—Astrocytoma (grade II); 2—Astrocytoma (grade III); 3—Control; 4—Glioblastoma multiforme (grade IV); 5—Oligoastrocytic (grade II); 6—Oligoastrocytic (grade III); 7—Oligodendroglial (grade II); 8—Oligodendroglial (grade III); 9—Pilocytic astrocytoma (grade I))
FIG. 19 shows TGF-β cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 4) for breast cancer samples from GSE21653. (Legend: 1—Luminal A; 2—Luminal B; 3—HER2; 4—Basal; 5—Normal-like)
FIGS. 20 to 23 show TGF-β cellular signaling pathway activity predictions of the trained exemplary Bayesian network models using the evidence curated list of target genes, the 20 target genes shortlist, the 12 target genes shortlist, and the 7 target genes shortlist (see Tables 4 to 7), respectively, for 2D and 3D cultures of A549 lung adenocarcinoma cell lines from GSE42373, which were stimulated with or without a 10 ng/mL TNF and 2 ng/mL TGF-β. (Legend: 1—2D control; 2—2D TGF-β and TNFα; 3—3D control; 4—3D TGF-β and TNFα)
FIG. 24 illustrates a prognosis of glioma patients (GSE16011) depicted in a Kaplan-Meier plot using the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 4).
FIG. 25 illustrates a prognosis of breast cancer patients (GSE6532, GSE9195, E-MTAB-365, GSE20685 and GSE21653) depicted in a Kaplan-Meier plot using the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 4).
FIG. 26 shows training results of the exemplary Bayesian network model based on the broad literature list of putative target genes of the TGF-β cellular signaling pathway (see Table 8). (Legend: 1—Control; 2—TGF-β stimulation with 5 ng/mL for 0.5 h; 3—TGF-β stimulation with 5 ng/mL for 1 h; 4—TGF-β stimulation with 5 ng/mL for 2 h; 5—TGF-β stimulation with 5 ng/mL for 4 h; 6—TGF-β stimulation with 5 ng/mL for 8 h; 7—TGF-β stimulation with 5 ng/mL for 16 h; 8—TGF-β stimulation with 5 ng/mL for 24 h; 9—TGF-β stimulation with 5 ng/mL for 72 h)
FIG. 27 shows TGF-β cellular signaling pathway activity predictions of the trained Bayesian network model using the broad literature list of putative target genes (see Table 8) for patient gliomas from GSE16011. (Legend: 1—Astrocytoma (grade II); 2—Astrocytoma (grade III); 3—Control; 4—Glioblastoma multiforme (grade IV); 5—Oligoastrocytic (grade II); 6—Oligoastrocytic (grade III); 7—Oligodendroglial (grade II); 8—Oligodendroglial (grade III); 9—Pilocytic astrocytoma (grade I))
FIG. 28 shows TGF-β cellular signaling pathway activity predictions of the trained Bayesian network model using the broad literature list of putative target genes (see Table 8) for breast cancer samples from GSE21653. (Legend: 1—Luminal A; 2—Luminal B; 3—HER2; 4 Basal; 5—Normal-like)
FIG. 29 shows TGF-β pathway activity predictions calculated by the ‘11-gene list’-Bayesian network on ectocervical epithelial cells (Ect1) stimulated with seminal plasma or 5 ng/mL TGF-β3 (GSE35830). (Legend. 1—Control, no TGF-β; 2—Stimulated with 10% seminal plasma; 3—stimulated with 5 ng/mL TGF-β3)
FIG. 30 shows TGF-β pathway activity predictions calculated by the ‘11-gene list+SERPINE1’-Bayesian network on ectocervical epithelial cells (Ect1) stimulated with seminal plasma or 5 ng/mL TGF-β3 (GSE35830). (Legend: 1—Control, no TGF-β; 2—Stimulated with 10% seminal plasma; 3—stimulated with 5 ng/mL TGF-β)
FIG. 31 shows TGF-β pathway activity predictions calculated by the ‘11-gene list’-Bayesian network in 2D and 3D cultures of A549 lung adenocarcinoma cell lines stimulated with or without a 10 ng/mL TNF and 2 ng/mL TGF-β (GSE42373). (Legend: 1—2D control, 2—2D TGF-β and TNFα, 3—3D control, 4—3D TGF-β and TNFα)
FIG. 32 shows TGF-β pathway activity predictions calculated by the ‘11-gene list+SERPINE1’-Bayesian network in 2D and 3D cultures of A549 lung adenocarcinoma cell lines stimulated with or without a 10 ng/mL TNF and 2 ng/mL TGF-β (GSE42373). (Legend 1—2D control, 2—2D TGF-β and TNFα, 3—3D control, 4—3D TGF-β and TNFα)
FIG. 33 shows TGF-β pathway activity predictions calculated by the ‘11-gene list’-Bayesian on glioma patients and some control samples from GSE16011. (Legend: 1—Astrocytoma (grade II); 2—Astrocytoma (grade III); 3—Control; 4—Glioblastoma multiforme (grade IV); 5—Oligoastrocytic (grade II); 6—Oligoastrocytic (grade III); 7—Oligodendroglial (grade II); 8—Oligodendroglial (grade III); 9—Pilocytic astrocytoma (grade I))
FIG. 34 shows TGF-β pathway activity predictions calculated by the ‘11-gene list+SERPINE1’-Bayesian on glioma patients and some control samples from GSE16011. (Legend: 1—Astrocytoma (grade II); 2—Astrocytoma (grade III); 3—Control; 4—Glioblastoma multiforme (grade IV); 5—Oligoastrocytic (grade II); 6—Oligoastrocytic (grade III); 7—Oligodendroglial (grade II); 8—Oligodendroglial (grade III); 9—Pilocytic astrocytoma (grade I))
Provided herein are methods and apparatuses, and in particular computer implemented methods and apparatuses, for determining the activity levels of a TGF-β cellular signaling pathway in a subject, wherein the TGF-β cellular signaling is calculated by a) calculating an activity level of TGF-β transcription factor element in a sample isolated from a subject, and wherein the activity levels of the TGF-β transcription factor element in the sample is calculated by measuring the expression levels of a unique set of target genes, wherein the TGF-β transcription factor element controls transcription of the target genes, calculating the levels of the TGF-β transcription factor element in the sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the target genes in the sample with expression levels of the target genes in the calibrated pathway model which define a level of a TGF-β transcription factor element; and calculating the TGF-β cellular signaling in the sample based on the calculated levels of TGF-β transcription factor element in the sample.
In particular, the unique set of target genes whose expression levels is analyzed in the model includes at least three or more genes, for example, three, four, five, six, or seven target genes selected from ANGPTL4, CDC42EP3, ID1, IL11, SERPINE1, JUNB, SKIL, or SMAD7. It has been discovered that analyzing a specific set of target genes as described herein in the disclosed pathway model provides for an advantageously accurate TGF-β cellular signaling pathway activity determination. Accordingly, such status can be used to, for example but not limited to, identify the presence or absence of disease and/or particular disease state or advancement, diagnose a specific disease or disease state, or diagnose the presence or absence of a particular disease, derive a course of treatment based on the presence or absence of TGF-β signaling activity, monitor disease progression in order to, for example, adjust therapeutic protocols based on a predicted drug efficacy in light of the determined activity of the TGF-β signaling pathway in the sample, or develop TGF-β targeted therapeutics.
All terms used herein are intended to have their plain and ordinary meaning as normally ascribed in the art unless otherwise specifically indicated herein.
Herein, the “level” of a TF element denotes the level of activity of the TF element regarding transcription of its target genes.
The term “subject” or “host”, as used herein, refers to any living being. In some embodiments, the subject is an animal, for example a mammal, including a human. In a particular embodiment, the subject is a human. In one embodiment, the human is suspected of having a disorder mediated or exacerbated by an active TGF-β cellular signaling pathway, for example, a cancer. In one embodiment, the human has or is suspected of having a breast cancer.
The term “sample”, as used herein, means any biological specimen isolated from a subject. Accordingly, “sample” as used herein is contemplated to encompasses the case where e.g. a tissue and/or cells and/or a body fluid of the subject have been isolated from the subject. Performing the claimed method may include where a portion of this sample is extracted, e.g., by means of Laser Capture Microdissection (LCM), or by scraping off the cells of interest from the slide, or by fluorescence-activated cell sorting techniques. In addition, the term “sample”, as used herein, also encompasses the case where e.g. a tissue and/or cells and/or a body fluid of the subject has been taken from the subject and has been put on a microscope slide, and the claimed method is performed on the slide. In addition, the term “samples,” as used herein, may also encompass circulating tumor cells or CTCs.
The term “TGF-β transcription factor element” or “TGF-β TF element” or “TF element” refers to a signaling agent downstream of the binding of TGF-β to its receptor which controls target gene expression, which may be a transcription factor protein or protein complex or a precursor of an active transcription protein complex. It can be, in embodiments, a signaling agent triggered by the binding of TGF-β to its receptor downstream of TGF-β extracellular receptor binding and upstream of the formation of the active transcription factor protein complex. For example, it is known that when TGF-β binds to an extracellular TGF-β receptor, it initiates an intracellular “SMAD” signaling pathway and that one or more SMAD proteins (for example receptor-regulated or R-SMADs (SMAD 1, 2, 3, 5 and 8) and SMAD4) participate in, and may form a heterocomplex which participates in, the TGF-β transcription signaling cascade which controls expression.
The term “target gene” as used herein, means a gene whose transcription is directly or indirectly controlled by a TGF-β transcription factor element. The “target gene” may be a “direct target gene” and/or an “indirect target gene” (as described herein).
As contemplated herein, target genes include at least ANGPTL4, CDC42EP3, CDKN1A, CDKN2B, CTGF, GADD45A, GADD45B, HMGA2, ID1, IL11, SERPINE1, INPP5D, JUNB, MMP2, MMP9, NKX2-5, OVOL1, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI1, SNAI2, TIMP1, and VEGFA.
As contemplated herein, the present invention includes:
A) A computer implemented method for determining the activity level of a TGF-β cellular signaling pathway in a subject performed by a computerized device having a processor comprising:
In one embodiment, the method further comprises assigning a TGF-β cellular signaling pathway activity status to the calculated activity level of the TGF-β cellular signaling in the sample, wherein the activity status is indicative of either an active TGF-β cellular signaling pathway or a passive TGF-β cellular signaling pathway. In one embodiment, the method further comprises displaying the TGF-β cellular signaling pathway activity status. In one embodiment, the at least three target genes are ANGPTL4, and at least two of CDC42EP3, ID1, IL11, SERPINE1, JUNB, SKIL, or SMAD7. In one embodiment, the at least three target genes are ANGPTL4, CDC42EP3, and at least one of ID1, IL11, SERPINE1, JUNB, SKIL, or SMAD7. In one embodiment, data on the expression levels of the target genes ANGPTL4, CDC42EP3, ID1, IL11, JUNB, SKIL, and SMAD7 is received. In one embodiment, data on the expression levels of the target genes ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, and SMAD7 is received. In one embodiment, data on at least one additional target gene selected from CDKN1A, CTGF, GADD45B, PDGFB, VEGFA, and SNAI2 is received. In one embodiment, data on the expression levels of the additional target genes CDKN1A, CTGF, GADD45B, PDGFB, and SNAI2 is received. In one embodiment, data on the expression levels of the additional target genes CDKN1A, CTGF, GADD45B, VEGFA, and SNAI2 is received. In one embodiment, data on at least one additional target gene selected from CDKN1A, CTGF, GADD45B, PDGFB, VEGFA, and SNAI2 is received. In one embodiment, data on the expression levels of the additional target genes CDKN1A, CTGF, GADD45B, PDGFB, and SNAI2 is received. In one embodiment, data on the expression levels of the additional target genes CDKN1A, CTGF, GADD45B, VEGFA, and SNAI2 is received. In one embodiment, data on the expression levels of the additional target genes CDKN2B, GADD45A, HMGA2, INPP5D, MMP2, MMP9, NKX2-5, OVOL1, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SNAI1, and TIMP1 is received. In one embodiment, data on the expression levels of the additional target genes CDKN2B, GADD45A, HMGA2, INPP5D, MMP2, MMP9, NKX2-5, OVOL1, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SNAI1, and TIMP1 is received. In one embodiment, data on the expression levels of the additional target genes CDKN2B, GADD45A, HMGA2, INPP5D, MMP2, MMP9, NKX2-5, OVOL1, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SNAI1, and TIMP1 is received. In one embodiment, data on the expression levels of the additional target genes CDKN2B, GADD45A, HMGA2, INPP5D, MMP2, MMP9, NKX2-5, OVOL1, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SNAI1, and TIMP1 is received. In one embodiment, the calibrated pathway model is a probabilistic model incorporating conditional probabilistic relationships that compare the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the model which define a level of TGF-β transcription factor element to determine the activity level of the TGF-β transcription factor element in the sample. In one embodiment, the probabilistic model is a Bayesian network model. In one embodiment, the calibrated pathway model is a linear model incorporating relationships that compare the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the model which define a level of TGF-β transcription factor element to determine the activity level of the TGF-β transcription factor element in the sample.
B) A computer program product for determining the activity level of a TGF-β cellular signaling pathway in a subject comprising
In one embodiment, the computer readable program code is executable by at least one processor to assign a TGF-β cellular signaling pathway activity status to the calculated activity level of the TGF-β cellular signaling in the sample, wherein the activity status is indicative of either an active TGF-β cellular signaling pathway or a passive TGF-β cellular signaling pathway. In one embodiment, the computer readable program code is executable by at least one processor to display the TGF-β signaling pathway activity status. In one embodiment, the at least three target genes are ANGPTL4, and at least two of CDC42EP3, ID1, IL11, SERPINE1, JUNB, SKIL, or SMAD7. In one embodiment, the at least three target genes are ANGPTL4, CDC42EP3, and at least one of ID1, IL11, SERPINE1, JUNB, SKIL, or SMAD7. In one embodiment, the data on the expression levels of the target genes ANGPTL4, CDC42EP3, ID1, IL11, JUNB, SKIL, and SMAD7 is received. In one embodiment, the data on the expression levels of the target genes ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, and SMAD7 is received. In one embodiment, data on at least one additional target gene selected from CDKN1A, CTGF, GADD45B, PDGFB, VEGFA, and SNAI2 is received. In one embodiment, data on the expression levels of the additional target genes CDKN1A, CTGF, GADD45B, PDGFB, and SNAI2 is received. In one embodiment, data on the expression levels of the additional target genes CDKN1A, CTGF, GADD45B, VEGFA, and SNAI2 is received. In one embodiment, data on at least one additional target gene selected from CDKN1A, CTGF, GADD45B, PDGFB, VEGFA, and SNAI2 is received. In one embodiment, data on the expression levels of the additional target genes CDKN1A, CTGF, GADD45B, PDGFB, and SNAI2 is received. In one embodiment, data on the expression levels of the additional target genes CDKN1A, CTGF, GADD45B, VEGFA, and SNAI2 is received. In one embodiment, data on the expression levels of at least one additional target gene selected from CDKN2B, GADD45A, HMGA2, INPP5D, MMP2, MMP9, NKX2-5, OVOL1, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SNAI1, and TIMP1 is received. In one embodiment, data on the expression levels of at least one additional target gene selected from CDKN2B, GADD45A, HMGA2, INPP5D, MMP2, MMP9, NKX2-5, OVOL1, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SNAI1, and TIMP1 is received. In one embodiment, data on the expression levels of at least one additional target gene selected from CDKN2B, GADD45A, HMGA2, INPP5D, MMP2, MMP9, NKX2-5, OVOL1, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SNAI1, and TIMP1 is received. In one embodiment, data on the expression levels of at least one additional target gene selected from CDKN2B, GADD45A, HMGA2, INPP5D, MMP2, MMP9, NKX2-5, OVOL1, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SNAI1, and TIMP1 is received. In one embodiment, the calibrated pathway model is a probabilistic model incorporating conditional probabilistic relationships that compare the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the model which define a level of TGF-β transcription factor element to determine the activity level of TGF-β transcription factor element in the sample. In one embodiment, the probabilistic model is a Bayesian network model. In one embodiment, the calibrated pathway model is a linear model incorporating relationships that compare the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the model which define a level of TGF-β transcription factor element to determine the activity level of a TGF-β transcription factor element in the sample.
C) A method of treating a subject suffering from a disease associated with an activated TGF-β cellular signaling pathway comprising:
In one embodiment, the at least three target genes are ANGPTL4, and at least two of CDC42EP3, ID1, IL11, SERPINE1, JUNB, SKIL, or SMAD7. In one embodiment, the at least three target genes are ANGPTL4, CDC42EP3, and at least one of ID1, IL11, SERPINE1, JUNB, SKIL, or SMAD7. In one embodiment, data on the expression levels of the target genes ANGPTL4, CDC42EP3, ID1, IL11, JUNB, SKIL, and SMAD7 is received. In one embodiment, data on the expression levels of the target genes ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, and SMAD7 is received. In one embodiment, data on at least one additional target gene selected from CDKN1A, CTGF, GADD45B, PDGFB, VEGFA, and SNAI2 is received. In one embodiment, data on the expression levels of the additional target genes CDKN1A, CTGF, GADD45B, PDGFB, and SNAI2 is received. In one embodiment, data on the expression levels of the additional target genes CDKN1A, CTGF, GADD45B, VEGFA, and SNAI2 is received. In one embodiment, data on at least one additional target gene selected from CDKN1A, CTGF, GADD45B, PDGFB, VEGFA, and SNAI2 is received. In one embodiment, data on the expression levels of the additional target genes CDKN1A, CTGF, GADD45B, PDGFB, and SNAI2 is received. In one embodiment, data on the expression levels of the additional target genes CDKN1A, CTGF, GADD45B, VEGFA, and SNAI2 is received. In one embodiment, data on the expression levels of the additional target genes CDKN2B, GADD45A, HMGA2, INPP5D, MMP2, MMP9, NKX2-5, OVOL1, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SNAI1, and TIMP1 is received. In one embodiment, data on the expression levels of the additional target genes CDKN2B, GADD45A, HMGA2, INPP5D, MMP2, MMP9, NKX2-5, OVOL1, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SNAI1, and TIMP1 is received. In one embodiment, data on the expression levels of the additional target genes CDKN2B, GADD45A, HMGA2, INPP5D, MMP2, MMP9, NKX2-5, OVOL1, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SNAI1, and TIMP1 is received. In one embodiment, data on the expression levels of the additional target genes CDKN2B, GADD45A, HMGA2, INPP5D, MMP2, MMP9, NKX2-5, OVOL1, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SNAI1, and TIMP1 is received. In one embodiment, the calibrated pathway model is a probabilistic model incorporating conditional probabilistic relationships that compare the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the model which define a level of TGF-β transcription factor element to determine the activity level of the TGF-β transcription factor element in the sample. In one embodiment, the probabilistic model is a Bayesian network model. In one embodiment, the calibrated pathway model is a linear model incorporating relationships that compare the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the model which define a level of TGF-β transcription factor element to determine the activity level of the TGF-β transcription factor element in the human cancer sample. In illustrative embodiment, the TGF-β inhibitor is Terameprocol, Fresolimumab, Sotatercept, Galunisertib, SB431542, LY2109761, LDN-193189, SB525334, SB505124, GW788388, LY364947, RepSox, LDN-193189 HCl, K02288, LDN-214117, SD-208, EW-7197, ML347, LDN-212854, DMH1, Pirfenidone, Hesperetin, Trabedersen, Lerdelimumab, Metelimumab, trx-SARA, ID11, Ki26894, or SB-431542. In one embodiment, the disease is a cancer. In one embodiment, the cancer is colon, breast, prostate, pancreatic, lung, brain, leukemia, lymphoma, or glioma. In one embodiment, the cancer is breast cancer.
D) A kit for measuring expression levels of TGF-β cellular signaling pathway target genes comprising:
In one embodiment, the at least six target genes are ANGPTL4, and at least five of CDC42EP3, ID1, IL11, SERPINE1, JUNB, SKIL, or SMAD7. In one embodiment, the at least six target genes are ANGPTL4, CDC42EP3, and at least four of ID1, IL11, SERPINE1, JUNB, SKIL, or SMAD7. In one embodiment, the target genes are ANGPTL4, CDC42EP3, ID1, IL11, JUNB, SKIL, and SMAD7. In one embodiment, the target genes are ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, and SMAD7. In one embodiment, the kit includes at least one additional set of primers and probes directed to a target gene selected from CDKN1A, CTGF, GADD45B, PDGFB, VEGFA, and SNAI2. In one embodiment, the kit includes additional sets of primers and probes directed to target genes CDKN1A, CTGF, GADD45B, PDGFB, and SNAI2. In one embodiment, the kit includes additional sets of primers and probes directed to target genes CDKN1A, CTGF, GADD45B, VEGFA, and SNAI2. In one embodiment, the kit includes at least one additional set of primers and probes directed to a target gene selected from CDKN1A, CTGF, GADD45B, PDGFB, VEGFA, and SNAI2. In one embodiment, the kit includes additional sets of primers and probes directed to target genes CDKN1A, CTGF, GADD45B, PDGFB, and SNAI2. In one embodiment, the kit includes additional sets of primers and probes directed to target genes CDKN1A, CTGF, GADD45B, VEGFA, and SNAI2. In one embodiment, the kit includes additional sets of primers and probes directed to target genes CDKN2B, GADD45A, HMGA2, INPP5D, MMP2, MMP9, NKX2-5, OVOL1, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SNAI1, and TIMP1. In one embodiment, the kit includes additional sets of primers and probes directed to target genes CDKN2B, GADD45A, HMGA2, INPP5D, MMP2, MMP9, NKX2-5, OVOL1, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SNAI1, and TIMP1. In one embodiment, the kit includes additional sets of primers and probes directed to target genes CDKN2B, GADD45A, HMGA2, INPP5D, MMP2, MMP9, NKX2-5, OVOL1, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SNAI1, and TIMP1. In one embodiment, the kit includes additional sets of primers and probes directed to target genes CDKN2B, GADD45A, HMGA2, INPP5D, MMP2, MMP9, NKX2-5, OVOL1, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SNAI1, and TIMP1. In one embodiment, the probes are labeled. In one embodiment, the set of probes are SEQ. ID. NOS. 74, 77, 80, 83, 86, 89, 92, 95, 98, 101, 104, and 107. In one embodiment, the set of primers are SEQ. ID. NOS. 72 and 73, 75 and 76, 78 and 79, 81 and 82, 84 and 85, 87 and 88, 90 and 91, 93 and 94, 96 and 97, 99 and 100, 102 and 103, and 105 and 106. In one embodiment, a computer program product for determining the activity level of a TGF-β cellular signaling pathway in the subject comprising a non-transitory computer readable storage medium having computer readable program code embodied therewith, the computer readable program code executable by at least one processor to: (i) calculate a level of TGF-β transcription factor element in the sample, wherein the level of the TGF-β transcription factor element in the sample is associated with TGF-β cellular signaling, and wherein the level of the TGF-β transcription factor element in the sample is calculated by: (1) receiving data on the expression levels of the at least six target genes derived from the sample; (2) calculating the level of the TGF-β transcription factor element in the sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the at least six target genes in the sample with expression levels of the at least six target genes in the model which define an activity level of TGF-β transcription factor element; and, (ii) calculate the activity level of the TGF-β cellular signaling pathway in the sample based on the calculated TGF-β transcription factor element level in the sample.
E) A kit for determining the activity level of a TGF-β cellular signaling pathway in a subject comprising:
The present invention provides new and improved methods and apparatuses, and in particular computer implemented methods and apparatuses, as disclosed herein, to assess the functional state or activity of the TGF-β cellular signaling pathway.
In one aspect of the invention, provided herein is a method of determining TGF-β cellular signaling in a subject comprising the steps of:
As a non-limiting generalized example, FIG. 2 provides an exemplary flow diagram used to determine the activity level of the TGF-β cellular signaling pathway based on a computer implemented mathematical model constructed of three nodes: (a) a transcription factor (TF) element (for example, but not limited to being, discretized into the states “absent” and “present” or as a continuous observable) in a first layer 1; (b) target gene(s) TG1, TG2, TGn (for example, but not limited to being, discretized into the states “down” and “up” or as a continuous observable) in a second layer 2, and; (c) measurement nodes linked to the expression levels of the target gene(s) in a third layer 3. The expression levels of the target genes can be determined by, for example, but not limited to, microarray probesets PS1,1, PS1,2, PS1,3, PS2,1, PSn,1, PSn,m (for example, but limited to being, discretized into the states “low” and “high” or as a continuous observable), but could also be any other gene expression measurements such as, for example, RNAseq or RT-qPCR. The expression of the target genes depends on the activation of the respective transcription factor element, and the measured intensities of the selected probesets depend in turn on the expression of the respective target genes. The model is used to calculate TGF-B pathway activity by first determining probeset intensities, i.e., the expression level of the target genes, and calculating backwards in the model what the probability is that the transcription factor element must be present.
The present invention makes it possible to determine the activity of the TGF-β cellular signaling pathway in a subject by (i) determining a level of a TGF-β TF element in the sample of the subject, wherein the determining is based at least in part on evaluating a mathematical model relating expression levels of one or more target gene(s) of the TGF-β cellular signaling pathway, the transcription of which is controlled by the TGF-β TF element, to the level of the TGF-β TF element, and by (ii) calculating the activity of the TGF-β cellular signaling pathway in the subject based on the determined level of the TGF-β TF element in the sample of the subject. This, for example, allows improving the possibilities of characterizing patients that have a disease, for example, cancer, e.g., a colon, pancreatic, lung, brain or breast cancer, which is at least partially driven by a tumor-promoting activity of the TGF-β cellular signaling pathway, and that are therefore likely to respond to inhibitors of the TGF-β cellular signaling pathway.
An example flow chart illustrating an exemplary calculation of the activity level of TGF-β cellular signaling from a sample isolated from a subject is provided in FIG. 3. First, the mRNA from a sample is isolated (11). Second, the mRNA expression levels of a unique set of at least three or more TGF-β target genes, as described herein, are measured (12) using methods for measuring gene expression that are known in the art. Next, the calculation of transcription factor element (13) is calculated using a calibrated pathway model (14), wherein the calibrated pathway model compares the expression levels of the at least three or more target genes in the sample with expression levels of the at least three target genes in the calibrated pathway model which have been correlated with a level of a TGF-β transcription factor element. Finally, the activity level of the TGF-β cellular signaling pathway is calculated in the sample based on the calculated levels of TGF-β transcription factor element in the sample (15). For example, the TGF-β signaling pathway is determined to be active if the activity is above a certain threshold, and can be categorized as passive if the activity falls below a certain threshold.
The present invention utilizes the analyses of the expression levels of unique sets of target genes. Particularly suitable target genes are described in the following text passages as well as the examples below (see, e.g., Tables 4-7, 9, and 11-12 below).
Thus, according to an embodiment the target gene(s) is/are selected from the group consisting of the target genes listed in Table 4, Table 5, Table 6, Table 7, Table 9, Table 11, or Table 12, below.
In particular, the unique set of target genes whose expression is analyzed in the model includes at least three or more target genes, for example, three, four, five, six, seven or more, selected from ANGPTL4, CDC42EP3, ID1, IL11, SERPINE1, JUNB, SKIL, or SMAD7.
In one embodiment, the at least three target genes are ANGPTL4, and at least two of CDC42EP3, ID1, IL11, JUNB, SKIL, or SMAD7. In one embodiment, the at least three target genes are CDC42EP3, and at least two of ANGPTL4, ID1, IL11, JUNB, SKIL, or SMAD7.
In one embodiment, the at least three target genes are ANGPTL4, and at least two of CDC42EP3, ID1, SERPINE1, JUNB, SKIL, or SMAD7. In one embodiment, the at least three target genes are CDC42EP3, and at least two of ANGPTL4, ID1, SERPINE1, JUNB, SKIL, or SMAD7.
In one embodiment, the at least three target genes are ANGPTL4, CDC42EP3, and at least one of ID1, IL11, JUNB, SKIL, or SMAD7. In one embodiment, the at least three target genes are ANGPTL4, CDC42EP3, and at least one of ID1, SERPINE1, JUNB, SKIL, or SMAD7.
In one embodiment, the expression levels of the target genes ANGPTL4, CDC42EP3, ID1, IL11, JUNB, SKIL, and SMAD7 are used in calculating the activity level of the TGF-β cellular signaling pathway.
In one embodiment, the expression levels of the target genes ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, and SMAD7 is used in calculating TGF-β cellular signaling.
In one embodiment, the expression level of at least one additional target gene selected from CDKN1A, CTGF, GADD45B, PDGFB, and SNAI2 is used in calculating TGF-β cellular signaling. In one embodiment, the expression levels of the additional target genes CDKN1A, CTGF, GADD45B, PDGFB, and SNAI2 are used in calculating TGF-β cellular signaling. In one embodiment, the expression levels of target genes ANGPTL4, CDC42EP3, ID1, IL11, JUNB, SKIL, SMAD7, CDKN1A, CTGF, GADD45B, PDGFB, and SNAI2 are used in calculating TGF-β cellular signaling.
In one embodiment, the expression level of at least one additional target gene selected from CDKN1A, CTGF, GADD45B, VEGFA, and SNAI2 is used in calculating TGF-β cellular signaling. In one embodiment, the expression levels of the additional target genes CDKN1A, CTGF, GADD45B, VEGFA, and SNAI2 are used in calculating TGF-β cellular signaling. In one embodiment, the expression levels of target genes ANGPTL4, CDC42EP3, ID1, IL11, JUNB, SKIL, SMAD7, CDKN1A, CTGF, GADD45B, VEGFA, and SNAI2 are used in calculating TGF-β cellular signaling. In one embodiment, the expression levels of target genes ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, SMAD7, CDKN1A, CTGF, GADD45B, VEGFA, and SNAI2 are used in calculating TGF-β cellular signaling.
As contemplated herein, the expression levels of other target genes, in further addition to those described above, may be included in the pathway modeling to calculate activity levels of pathway the TGF-β cellular signaling pathway, including GADD45A, HMGA2, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SMAD7, VEGFA, INPP5D, MMP2, MMP9, NKX2-5, OVOL1, and TIMP1.
In one embodiment, the method comprises:
calculating the activity of the TGF-β cellular signaling pathway in the subject based at least on expression levels of one or more, two or more, or at least three, target gene(s) of the TGF-β cellular signaling pathway measured in the sample of the subject selected from the group consisting of: ANGPTL4, CDC42EP3, CDKN1A, CDKN2B, CTGF, GADD45A, GADD45B, HMGA2, ID1, IL11, INPP5D, JUNB, MMP2, MMP9, NKX2-5, OVOL1, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI1, SNAI2, TIMP1, and VEGFA, or from the group consisting of: ANGPTL4, CDC42EP3, CDKN1A, CTGF, GADD45A, GADD45B, HMGA2, ID1, IL11, JUNB, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI2, and VEGFA, or from the group consisting of: ANGPTL4, CDC42EP3, CDKN1A, CTGF, GADD45B, ID1, IL11, JUNB, PDGFB, SKIL, SMAD7, and SNAI2, or from the group consisting of: ANGPTL4, CDC42EP3, ID1, IL11, JUNB, SKIL, and SMAD7.
It has been found by the present inventors that the genes in the successively shorter lists become more and more probative for determining the activity of the TGF-β cellular signaling pathway.
Data derived from the unique set of target genes described herein is further utilized to determine the activity level of the TGF-β cellular signaling pathway using the methods described herein.
Methods for analyzing gene expression levels in isolated samples are generally known. For example, methods such as Northern blotting, the use of PCR, nested PCR, quantitative real-time PCR (qPCR), RNA-seq, or microarrays can all be used to derive gene expression level data. All methods known in the art for analyzing gene expression of the target genes are contemplated herein.
Methods of determining the expression product of a gene using PCR based methods may be of particular use. In order to quantify the level of gene expression using PCR, the amount of each PCR product of interest is typically estimated using conventional quantitative real-time PCR (qPCR) to measure the accumulation of PCR products in real time after each cycle of amplification. This typically utilizes a detectible reporter such as an intercalating dye, minor groove binding dye, or fluorogenic probe whereby the application of light excites the reporter to fluoresce and the resulting fluorescence is typically detected using a CCD camera or photomultiplier detection system, such as that disclosed in U.S. Pat. No. 6,713,297 which is hereby incorporated by reference.
In some embodiments, the probes used in the detection of PCR products in the quantitative real-time PCR (qPCR) assay can include a fluorescent marker. Numerous fluorescent markers are commercially available. For example, Molecular Probes, Inc. (Eugene, Oreg.) sells a wide variety of fluorescent dyes. Non-limiting examples include Cy5, Cy3, TAMRA, R6G, R110, ROX, JOE, FAM, Texas Red™, and Oregon Green™. Additional fluorescent markers can include IDT ZEN Double-Quenched Probes with traditional 5′ hydrolysis probes in qPCR assays. These probes can contain, for example, a 5′ FAM dye with either a 3′ TAMRA Quencher, a 3′ Black Hole Quencher (BHQ, Biosearch Technologies), or an internal ZEN Quencher and 3′ Iowa Black Fluorescent Quencher (IBFQ).
Fluorescent dyes useful according to the invention can be attached to oligonucleotide primers using methods well known in the art. For example, one common way to add a fluorescent label to an oligonucleotide is to react an N-Hydroxysuccinimide (NHS) ester of the dye with a reactive amino group on the target. Nucleotides can be modified to carry a reactive amino group by, for example, inclusion of an allyl amine group on the nucleobase. Labeling via allyl amine is described, for example, in U.S. Pat. Nos. 5,476,928 and 5,958,691, which are incorporated herein by reference. Other means of fluorescently labeling nucleotides, oligonucleotides and polynucleotides are well known to those of skill in the art.
Other fluorogenic approaches include the use of generic detection systems such as SYBR-green dye, which fluoresces when intercalated with the amplified DNA from any gene expression product as disclosed in U.S. Pat. Nos. 5,436,134 and 5,658,751 which are hereby incorporated by reference.
Another useful method for determining target gene expression levels includes RNA-seq, a powerful analytical tool used for transcriptome analyses, including gene expression level difference between different physiological conditions, or changes that occur during development or over the course of disease progression.
Another approach to determine gene expression levels includes the use of microarrays for example RNA and DNA microarray, which are well known in the art. Microarrays can be used to quantify the expression of a large number of genes simultaneously.
As contemplated herein, the expression levels of the unique set of target genes described herein are used to calculate the level TGF-β transcription factor element using a calibrated pathway model as further described below. The calibrated pathway model compares the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the calibrated pathway model which define a level of TGF-β transcription factor element.
As contemplated herein, the calibrated pathway model is based on the application of a mathematical model. For example, the calibrated model can be based on a probabilistic model, for example a Bayesian network, or a linear or pseudo-linear model.
In one embodiment, the calibrated pathway model is a probabilistic model incorporating conditional probabilistic relationships that compare the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the calibrated pathway model which define a level TGF-β transcription factor element to determine the level of the TGF-β transcription factor element in the sample. In one embodiment, the probabilistic model is a Bayesian network model.
In an alternative embodiment, the calibrated pathway model can be a linear or pseudo-linear model. In an embodiment, the linear or pseudo-linear model is a linear or pseudo-linear combination model.
A non-limiting exemplary flow chart for a calibrated pathway model is shown in FIG. 4. As an initial step, the training data for the mRNA expression levels is collected and normalized. The data can be collected using, for example microarray probeset intensities (101), real-time PCR Cq values (102), raw RNAseq reads (103), or alternative measurement modalities (104) known in the art. The raw expression level data can then be normalized for each method, respectively, by normalization using a normalization algorithm, for example, frozen robust military analysis (fRMA) or MAS5.0 (111), normalization to average Cq of reference genes (112), normalization of reads into reads/fragments per kilobase of transcript per million mapped reads (RPKM/FPKM) (113), or normalization to w.r.t. reference genes/proteins (114). This normalization procedure leads to a normalized probeset intensity (121), normalized Cq values (122), normalized RPKM/FPKM (123), or normalized measurement (124) for each method, respectively, which indicate target gene expression levels within the training samples.
Once the training data has been normalized, a training sample ID or IDs (131) is obtained and the training data of these specific samples is obtained from one of the methods for determining gene expression (132). The final gene expression results from the training sample are output as training data (133). All of the data from various training samples are incorporated to calibrate the model (including for example, thresholds, CPTs, for example in the case of the probabilistic or Bayesian network, weights, for example, in the case of the linear or pseudo-linear model, etc) (144). In addition, the pathway's target genes and measurement nodes (141) are used to generate the model structure for example, as described in FIG. 2 (142). The resulting model structure (143) of the pathway is then incorporated with the training data (133) to calibrate the model (144), wherein the gene expression levels of the target genes is indicative of the transcription factor element activity. As a result of the transcription factor element calculations in the training samples, a calibrated pathway model (145) is calculated which assigns the TGF-β cellular signaling pathway activity level for a subsequently examined sample of interest, for example from a subject with a cancer, based on the target gene expression levels in the training samples.
A non-limiting exemplary flow chart for calculating the Transcription Factor Element activity level is provided in FIG. 5. The expression level data (test data) (163) from a sample isolated from a subject is input into the calibrated pathway model (145). The mathematical model may be a probabilistic model, for example a Bayesian network model, a linear model, or pseudo-linear model.
The mathematical model may be a probabilistic model, for example a Bayesian network model, based at least in part on conditional probabilities relating the TGF-β TF element and expression levels of the one or more target gene(s) of the TGF-β cellular signaling pathway measured in the sample of the subject, or the mathematical model may be based at least in part on one or more linear combination(s) of expression levels of the one or more target gene(s) of the TGF-β cellular signaling pathway measured in the sample of the subject. In particular, the determining of the activity of the TGF-β cellular signaling pathway may be performed as disclosed in the published international patent application WO 2013/011479 A2 (“Assessment of cellular signaling pathway activity using probabilistic modeling of target gene expression”), and incorporated herein by reference. Briefly, the data is entered into a Bayesian network (BN) inference engine call (for example, a BNT toolbox) (154). This leads to a set of values for the calculated marginal BN probabilities of all the nodes in the BN (155). From these probabilities, the transcription factor (TF) node's probability (156) is determined and establishes the TF's element activity level (157).
Alternatively, the mathematical model may be a linear model. For example, a linear model can be used as described in the published international patent application WO 2014/102668 A2 (“Assessment of cellular signaling pathway activity using linear combination(s) of target gene expressions”), the contents of which are herewith incorporated in their entirety. Further details regarding the calculating/determining of cellular signaling pathway activity using mathematical modeling of target gene expression can also be found in Verhaegh W. et al., “Selection of personalized patient therapy through the use of knowledge-based computational models that identify tumor-driving signal transduction pathways”, Cancer Research, Vol. 74, No. 11, 2014, pages 2936 to 2945. Briefly, the data is entered into a calculated weighted linear combination score (w/c) (151). This leads to a set of values for the calculated weighted linear combination score (152). From these weighted linear combination scores, the transcription factor (TF) node's weighted linear combination score (153) is determined and establishes the TF's element activity level (157).
A non-limiting exemplary flow chart for calculating the activity level of a TGF-β cellular signaling pathway as a discretized observable is shown in FIG. 6. First, the test sample is isolated and given a test sample ID (161). Next, the test data for the mRNA expression levels is collected and normalized (162). The test data can be collected using the same methods as discussed for the training samples in FIG. 5, using microarray probeset intensities (101), real-time PCR Cq values (102), raw RNAseq reads (103), or an alternative measurement modalities (104). The raw expression level data can then be normalized for each method, respectively, by normalization using an algorithm, for example fRMA or MAS5.0 (111), normalization to average Cq of reference genes (112), normalization of reads into RPKM/FPKM (113), and normalization to w.r.t. reference genes/proteins (114). This normalization procedure leads to a normalized probeset intensity (121), normalized Cq values (122), normalized RPKM/FPKM (123), or normalized measurement (124) for each method, respectively.
Once the test data has been normalized, the resulting test data (163) is analyzed in a thresholding step (164) based on the calibrated pathway model (145), resulting in the thresholded test data (165). In using discrete observables, in one non-limiting example, every expression above a certain threshold is, for example, given a value of 1 and values below the threshold are given a value of 0, or in an alternative embodiment, the probability mass above the threshold as described herein is used as a thresholded value. Based on the calibrated pathway model, this value represents the TF's element activity level (157), which is then used to calculate the pathway's activity level (171). The final output gives the pathway's activity level (172) in the test sample being examined from the subject.
A non-limiting exemplary flow chart for calculating the activity level of a TGF-β cellular signaling pathway as a continuous observable is shown in FIG. 7. First, the test sample is isolated and given a test sample ID (161). Next, the test data for the mRNA expression levels is collected and normalized (162). The test data can be collected using the same methods as discussed for the training samples in FIG. 5, using microarray probeset intensities (101), real-time PCR Cq values (102), raw RNAseq reads (103), or an alternative measurement modalities (104). The raw expression level data can then be normalized for each method, respectively, by normalization using an algorithm, for example fRMA (111), normalization to average Cq of reference genes (112), normalization of reads into RPKM/FPKM (113), and normalization to w.r.t. reference genes/proteins (114). This normalization procedure leads to a a normalized probeset intensity (121), normalized Cq values (122), normalized RPKM/FPKM (123), or normalized measurement (124) for each method, respectively.
Once the test data has been normalized, the resulting test data (163) is analyzed in the calibrated pathway model (145). In using continuous observables, as one non-limiting example, the expression levels are converted to values between 0 and 1 using a sigmoid function as described in further detail below. The transcription factor element calculation as described herein is used to interpret the test data in combination with the calibrated pathway model, the resulting value represents the TF's element activity level (157), which is then used to calculate the pathway's activity level (171). The final output then gives the pathway's activity level (172) in the test sample.
In some embodiments, the present invention utilizes kits comprising primer and probe sets for the analyses of the expression levels of unique sets of target genes (See Target Gene discussion above). Particularly suitable oligo sequences for use as primers and probes for inclusion in a kit are described in the following text passages (see, e.g., Tables 1, 2, and 3).
Also contemplated herein is a kit comprising one or more components for measuring a set of unique TGF-β target genes as described further below. In one non-limiting embodiment, the kit includes one or more components for measuring the expression levels of at least three target genes selected from ANGPTL4, and at least two of CDC42EP3, ID1, IL11, JUNB, SKIL, or SMAD7. In one embodiment, the at least three target genes are CDC42EP3, and at least two of ANGPTL4, ID1, IL11, JUNB, SKIL, or SMAD7. In one embodiment, the at least three target genes are ANGPTL4, and at least two of CDC42EP3, ID1, SERPINE1, JUNB, SKIL, or SMAD7. In one embodiment, the at least three target genes are CDC42EP3, and at least two of ANGPTL4, ID1, SERPINE1, JUNB, SKIL, or SMAD7. In one embodiment, the at least three target genes are ANGPTL4, CDC42EP3, and at least one of ID1, IL11, JUNB, SKIL, or SMAD7. In one embodiment, the at least three target genes are ANGPTL4, CDC42EP3, and at least one of ID1, SERPINE1, JUNB, SKIL, or SMAD7. In one embodiment, the kit includes one or more components for measuring the expression levels of the target genes ANGPTL4, CDC42EP3, ID1, IL11, JUNB, SKIL, and SMAD7. In one embodiment, the kit includes one or more components for measuring the expression levels of the target genes ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, and SMAD7.
In one embodiment, the kit includes one or more components for measuring the expression levels of at least three target genes, wherein the target genes are selected from ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, or SMAD7, and the one or more components is selected from the primers and probes listed in Table 1.
| TABLE 1 |
| Non-limiting example of primers and probes for a kit for |
| measuring gene expression of TGF-β target genes. |
| SEQ | |||
| Oligo Name | Sequence 5′-3′ | ID No. | Target Gene |
| SMAD7_For1 | TGCCTTCCTCCGCTGAAAC | 72 | SMAD7 |
| SMAD7_Rev2 | ACCACGCACCAGTGTGAC | 73 | SMAD7 |
| SMAD7_probe1 | TCCCAACTTCTTCTGGAGCCTGGG | 74 | SMAD7 |
| SKIL_For1 | GAAATGAAGGAGAAGTTTAGCA | 75 | SKIL |
| SKIL_Rev1 | GCTTTATAACAGGATACCATGAC | 76 | SKIL |
| SKIL_Probe1 | ACAGATGCACCATCAGGAATGGAATTACA | 77 | SKIL |
| ID1_For2 | TGAGGGAGAACAAGACCGAT | 84 | ID1 |
| ID1_Rev1 | ACTAGTAGGTGTGCAGAGA | 85 | ID1 |
| ID1_Probe1 | CACTGCGCCCTTAACTGCATCCA | 86 | ID1 |
| ANGPTL4_For3 | GCGAATTCAGCATCTGCAAAG | 87 | ANGPTL4 |
| ANGPTL4_Rev4 | CTTTCTTCGGGCAGGCTT | 88 | ANGPTL4 |
| ANGPTL4_Probe2 | ACCACAAGCACCTAGACCATGAGGT | 89 | ANGPTL4 |
| CDC42EP3_For1 | TGTGGTCAAGACTGGATGATG | 93 | CDCCDC42EP3 |
| CDC42EP3_Rev1 | CAGAAGTGGCTTCGAAATGA | 94 | CDCCDC42EP3 |
| CDC42EP3_Probe1 | TCTCTAGGAAGCCTCACTTGGCCG | 95 | CDCCDC42EP3 |
| JUNB_For2 | AATGGAACAGCCCTTCTACCA | 96 | JUNB |
| JUNB_Rev1 | GCTCGGTTTCAGGAGTTTGTA | 97 | JUNB |
| JUNB_Probe1 | TCATACACAGCTACGGGATACGG | 98 | JUNB |
| SERPINE1_For1 | CCACAAATCAGACGGCAGCA | 105 | SERPINE1 |
| SERPINE1_Rev1 | GTCGTAGTAATGGCCATCGG | 106 | SERPINE1 |
| SERPINE1_Probe1 | CCCATGATGGCTCAGACCAACAAGT | 107 | SERPINE1 |
In one embodiment, the kit includes one or more components for measuring the expression levels of at least three target genes, wherein the target genes are selected from ANGPTL4, and at least two of CDC42EP3, ID1, SERPINE1, JUNB, SKIL, or SMAD7, and the one or more components is selected from the primers and probes listed in Table 1. In one embodiment, the kit includes one or more components for measuring the expression levels of at least three target genes, wherein the target genes are CDC42EP3, and at least two of ANGPTL4, ID1, SERPINE1, JUNB, SKIL, or SMAD7, and the one or more components is selected from the PCR primers and probes listed in Table 1. In another embodiment, the kit includes one or more components for measuring the expression levels of at least three target genes, wherein the target genes are ANGPTL4, CDC42EP3, and at least one of ID1, SERPINE1, JUNB, SKIL, or SMAD7, and the one or more components is selected from the PCR primers and probes listed in Table 1. In one embodiment, the kit includes one or more components for measuring the expression levels of the target genes ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, and SMAD7, and the one or more components is selected from the PCR primers and probes listed in Table 1.
In one embodiment, the kit includes one or more components for measuring the expression level of at least one additional target gene selected from CDKN1A, CTGF, GADD45B, PDGFB, and SNAI2. In one embodiment, the kit includes one or more components for measuring the expression level of at least one additional target gene selected from CDKN1A, CTGF, GADD45B, VEGFA, and SNAI2. In one embodiment, the kit includes one or more components for measuring the expression levels of target genes ANGPTL4, CDC42EP3, ID1, IL11, JUNB, SKIL, SMAD7, CDKN1A, CTGF, GADD45B, PDGFB, and SNAI2.
In one embodiment, the kit includes one or more components for measuring the expression levels of target genes ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, SMAD7, CDKN1A, CTGF, GADD45B, VEGFA, and SNAI2. In one non-limiting embodiment, the kit includes one or more components for measuring the expression levels of target genes ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, SMAD7, CDKN1A, CTGF, GADD45B, VEGFA, and SNAI2, wherein the one or more components includes the PCR primers and probes listed in Table 2. The PCR primers for each gene are designated Forward (For) and Reverse (Rev) and the probes for detection of the PCR products for each gene are labeled Probe. In one non-limiting embodiment, the probes listed in Table 2 are labeled with a 5′ FAM dye with an internal ZEN Quencher and 3′ Iowa Black Fluorescent Quencher (IBFQ).
| TABLE 2 |
| Oligo Sequences for Target Genes |
| SEQ | Target | ||
| Oligo Name | Sequence 5′-3′ | ID No. | Gene |
| SMAD7_For1 | TGCCTTCCTCCGCTGAAAC | 72 | SMAD7 |
| SMAD7_Rev2 | ACCACGCACCAGTGTGAC | 73 | SMAD7 |
| SMAD7_probe1 | TCCCAACTTCTTCTGGAGCCTGGG | 74 | SMAD7 |
| SKIL_For1 | GAAATGAAGGAGAAGTTTAGCA | 75 | SKIL |
| SKIL_Rev1 | GCTTTATAACAGGATACCATGAC | 76 | SKIL |
| SKIL_Probe1 | ACAGATGCACCATCAGGAATGGAATTACA | 77 | SKIL |
| CTGF_For1 | GAAGCTGACCTGGAAGAGAA | 78 | CTGF |
| CTGF_Rev1 | CCACAGAATTTAGCTCGGTATG | 79 | CTGF |
| CTGF_Probe2 | CCTATCAAGTTTGAGCTTTCTGGCTG | 80 | CTGF |
| CDKN1A_For1 | GAGACTCTCAGGGTCGAAA | 81 | CDKN1A |
| CDKN1A_Rev2 | CTGTGGGCGGATTAGGGCT | 82 | CDKN1A |
| CDKN1A_Probe1 | ATTTCTACCACTCCAAACGCCGGC | 83 | CDKN1A |
| ID1_For2 | TGAGGGAGAACAAGACCGAT | 84 | ID1 |
| ID1_Rev1 | ACTAGTAGGTGTGCAGAGA | 85 | ID1 |
| ID1_Probe1 | CACTGCGCCCTTAACTGCATCCA | 86 | ID1 |
| ANGPTL4_For3 | GCGAATTCAGCATCTGCAAAG | 87 | ANGPTL4 |
| ANGPTL4_Rev4 | CTTTCTTCGGGCAGGCTT | 88 | ANGPTL4 |
| ANGPTL4_Probe2 | ACCACAAGCACCTAGACCATGAGGT | 89 | ANGPTL4 |
| GADD45B_For1 | GTCGGCCAAGTTGATGAATG | 90 | GADD45B |
| GADD45B_Rev1 | GATGAGCGTGAAGTGGATTTG | 91 | GADD45B |
| GADD45B_probe1 | CCATTGACGAGGAGGAGGAGGAT | 92 | GADD45B |
| CDC42EP3_For1 | TGTGGTCAAGACTGGATGATG | 93 | CDC42EP3 |
| CDC42EP3_Rev1 | CAGAAGTGGCTTCGAAATGA | 94 | CDC42EP3 |
| CDC42EP3_Probe1 | TCTCTAGGAAGCCTCACTTGGCCG | 95 | CDC42EP3 |
| JUNB_For2 | AATGGAACAGCCCTTCTACCA | 96 | JUNB |
| JUNB_Rev1 | GCTCGGTTTCAGGAGTTTGTA | 97 | JUNB |
| JUNB_Probe1 | TCATACACAGCTACGGGATACGG | 98 | JUNB |
| SNAI2_For1 | GTTGCTTCAAGGACACATTAG | 99 | SNAI2 |
| SNAI2_Rev1 | GCAGATGAGCCCTCAGATTT | 100 | SNAI2 |
| SNAI2_Probe1 | TGCCCTCACTGCAACAGAGCATTT | 101 | SNAI2 |
| VEGFA_For1 | GAAGGAGGAGGGCAGAATC | 102 | VEGFA |
| VEGFA_Rev1 | GTCTCGATTGGATGGCAGTA | 103 | VEGFA |
| VEGFA_Probe1 | AGTTCATGGATGTCTATCAGCGCAGC | 104 | VEGFA |
| SERPINE1_For1 | CCACAAATCAGACGGCAGCA | 105 | SERPINE1 |
| SERPINE1_Rev1 | GTCGTAGTAATGGCCATCGG | 106 | SERPINE1 |
| SERPINE1_Probe1 | CCCATGATGGCTCAGACCAACAAGT | 107 | SERPINE1 |
In one non-limiting embodiment, the kit includes one or more components for measuring the expression levels of control genes, wherein the one or more components includes a PCR primer set and probe for at least one of the control genes listed in Table 3. The PCR primers for each gene are designated Forward (F) and Reverse (R) and the probes for detection of the PCR products for each gene are labeled Probe (P or FAM). In one non-limiting embodiment, the probes listed in Table 3 are labeled with a 5′ FAM dye with an internal ZEN Quencher and 3′ Iowa Black Fluorescent Quencher (IBFQ).
| TABLE 3 |
| Oligo Sequences for Controls |
| Reference | |||
| Oligo Name | Sequence 5′-3′ | SEQ ID No. | gene |
| Hum_BACT_F1 | CCAACCGCGAGAAGATGA | 108 | ACTB |
| Hum_BACT_R1 | CCAGAGGCGTACAGGGATAG | 109 | ACTB |
| Hum_BACT_P1 | CCATGTACGTTGCTATCCAGGCT | 110 | ACTB |
| Hum_POLR2A_F1 | AGTCCTGAGTCCGGATGAA | 111 | POLR2A |
| Hum_POLR2A_R1 | CCTCCCTCAGTCGTCTCT | 112 | POLR2A |
| Hum_POLR2A_P1 | TGACGGAGGGTGGCATCAAATACC | 113 | POLR2A |
| Hum_PUM1_F2 | GCCAGCTTGTCTTCAATGAAAT | 114 | PUM1 |
| Hum_PUM1_R2 | CAAAGCCAGCTTCTGTTCAAG | 115 | PUM1 |
| Hum_PUM1_P1 | ATCCACCATGAGTTGGTAGGCAGC | 116 | PUM1 |
| Hum_TBP_F1 | GCCAAGAAGAAAGTGAACATCAT | 117 | TBP |
| Hum_TBP1_R1 | ATAGGGATTCCGGGAGTCAT | 118 | TBP |
| Hum_TBP_P1 | TCAGAACAACAGCCTGCCACCTTA | 119 | TBP |
| K-ALPHA-1_F1 | TGACTCCTTCAACACCTTCTTC | 120 | TUBA1B |
| K-ALPHA-1_R1 | TGCCAGTGCGAACTTCAT | 121 | TUBA1B |
| K-ALPHA-1_FAM1 | CCGGGCTGTGTTTGTAGACTTGGA | 122 | TUBA1B |
| ALAS1_F1 | AGCCACATCATCCCTGT | 123 | ALAS1 |
| ALAS1_R1 | CGTAGATGTTATGTCTGCTCAT | 124 | ALAS1 |
| ALAS1_FAM1 | TTTAGCAGCATCTGCAACCCGC | 125 | ALAS1 |
| Hum_HPRT1_F1 | GAGGATTTGGAAAGGGTGTTTATT | 126 | HPRT1 |
| Hum_HPRT1_R1 | ACAGAGGGCTACAATGTGATG | 127 | HPRT1 |
| Hum_HPRT1_P1 | ACGTCTTGCTCGAGATGTGATGAAGG | 128 | HPRT1 |
| Hum_RPLP0_F2 | TAAACCCTGCGTGGCAAT | 129 | RPLP0 |
| Hum_RPLP0_R2 | ACATTTCGGATAATCATCCAATAGTTG | 130 | RPLP0 |
| Hum_RPLP0_P1 | AAGTAGTTGGACTTCCAGGTCGCC | 131 | RPLP0 |
| Hum_B2M_F1 | CCGTGGCCTTAGCTGTG | 132 | B2M |
| Hum_B2M_R1 | CTGCTGGATGACGTGAGTAAA | 133 | B2M |
| Hum_B2M_P1 | TCTCTCTTTCTGGCCTGGAGGCTA | 134 | B2M |
| TPT1_F_PACE | AAATGTTAACAAATGTGGCAATTAT | 135 | TPT1 |
| TPT1_R_PACE | AACAATGCCTCCACTCCAAA | 136 | TPT1 |
| TPT1_P_PACE | TCCACACAACACCAGGACTT | 137 | TPT1 |
| EEF1A1_F_PACE | TGAAAACTACCCCTAAAAGCCA | 138 | EEF1A1 |
| EEF1A1_R_PACE | TATCCAAGACCCAGGCATACT | 139 | EEF1A1 |
| EEF1A1_P_PACE | TAGATTCGGGCAAGTCCACCA | 140 | EEF1A1 |
| RPL41_F_PACE | AAGATGAGGCAGAGGTCCAA | 141 | RPL41 |
| RPL41_R_PACE | TCCAGAATGTCACAGGTCCA | 142 | RPL41 |
| RPL41_P_PACE | TGCTGGTACAAGTTGTGGGA | 143 | RPL41 |
As contemplated herein, the one or more components for measuring the expression levels of the particular target genes can be selected from the group consisting of: an DNA array chip, an oligonucleotide array chip, a protein array chip, an antibody, a plurality of probes, for example, labeled probes, a set of RNA reverser-transcriptase sequencing components, and/or RNA or DNA, including cDNA, amplification primers. In one embodiment, the kit includes a set of labeled probes directed to the cDNA sequence of the targeted genes as described herein contained in a standardized 96-well plate. In one embodiment, the kit further includes a non-transitory storage medium containing instructions that are executable by a digital processing device to perform a method according to the present invention as described herein.
In accordance with another disclosed aspect, a kit for measuring expression levels of one or more, two or more, or at least three, target gene(s) of the TGF-β cellular signaling pathway in a sample of a subject comprises:
one or more components for determining the expression levels of the one or more, two or more, or at least three, target gene(s) of the TGF-β cellular signaling pathway,
wherein the one or more components are, for example, selected from the group consisting of: an DNA array chip, an oligonucleotide array chip, a protein array chip, an antibody, a plurality of probes, RNA sequencing and a set of primers, and
wherein the one or more, two or more, or at least three, target gene(s) of the TGF-β cellular signaling pathway is/are selected from the group consisting of: ANGPTL4, CDC42EP3, CDKN1A, CDKN2B, CTGF, GADD45A, GADD45B, HMGA2, ID1, IL11, INPP5D, JUNB, MMP2, MMP9, NKX2-5, OVOL1, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI1, SNAI2, TIMP1, and VEGFA, or ANGPTL4, CDC42EP3, CDKN1A, CDKN2B, CTGF, GADD45A, GADD45B, HMGA2, ID1, IL11, SERPINE1, INPP5D, JUNB, MMP2, MMP9, NKX2-5, OVOL1, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI1, SNAI2, TIMP1, and VEGFA, or from the group consisting of: ANGPTL4, CDC42EP3, CDKN1A, CTGF, GADD45A, GADD45B, HMGA2, ID1, IL11, JUNB, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI2, and VEGFA or ANGPTL4, CDC42EP3, CDKN1A, CTGF, GADD45A, GADD45B, HMGA2, ID1, SERPINE1, JUNB, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI2, and VEGFA, or from the group consisting of: ANGPTL4, CDC42EP3, CDKN1A, CTGF, GADD45B, ID1, IL11, JUNB, PDGFB, SKIL, SMAD7, and SNAI2, or ANGPTL4, CDC42EP3, CDKN1A, CTGF, GADD45B, ID1, SERPINE1, JUNB, VEGFA, SKIL, SMAD7, and SNAI2, or from the group consisting of: ANGPTL4, CDC42EP3, ID1, IL11, JUNB, SKIL, and SMAD7, or ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, and SMAD7.
In accordance with another disclosed aspect, a kit for measuring expression levels of two, three or more target genes of a set of target genes of the TGF-β cellular signaling pathway in a sample of a subject comprises:
one or more components for determining the expression levels of the two, three or more target genes of the set of target genes of the TGF-β cellular signaling pathway,
wherein the one or more components are, for example, selected from the group consisting of: an DNA array chip, an oligonucleotide array chip, a protein array chip, an antibody, a plurality of probes, RNA sequencing and a set of primers.
In one embodiment,
the set of target genes of the TGF-β cellular signaling pathway includes at least seven, or in an alternative, all target genes selected from the group consisting of: ANGPTL4, CDC42EP3, CDKN1A, CDKN2B, CTGF, GADD45A, GADD45B, HMGA2, ID1, IL11, INPP5D, JUNB, MMP2, MMP9, NKX2-5, OVOL1, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI1, SNAI2, TIMP1, and VEGFA, or ANGPTL4, CDC42EP3, CDKN1A, CDKN2B, CTGF, GADD45A, GADD45B, HMGA2, ID1, IL11, SERPINE1, INPP5D, JUNB, MMP2, MMP9, NKX2-5, OVOL1, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI1, SNAI2, TIMP1, and VEGFA, or from the group consisting of: ANGPTL4, CDC42EP3, CDKN1A, CTGF, GADD45A, GADD45B, HMGA2, ID1, IL11, JUNB, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI2, and VEGFA, or ANGPTL4, CDC42EP3, CDKN1A, CTGF, GADD45A, GADD45B, HMGA2, ID1, SERPINE1, JUNB, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI2, and VEGFA, or from the group consisting of: ANGPTL4, CDC42EP3, CDKN1A, CTGF, GADD45B, ID1, IL11, JUNB, PDGFB, SKIL, SMAD7, and SNAI2, or ANGPTL4, CDC42EP3, CDKN1A, CTGF, GADD45B, ID1, SERPINE1, JUNB, VEGFA, SKIL, SMAD7, and SNAI2, or from the group consisting of: ANGPTL4, CDC42EP3, ID1, IL11, JUNB, SKIL, and SMAD7, or ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, and SMAD7.
In one embodiment, the PCR cycling is performed in a microtiter or multi-well plate format. This format, which uses plates comprising multiple reaction wells, not only increases the throughput of the assay process, but is also well adapted for automated sampling steps due to the modular nature of the plates and the uniform grid layout of the wells on the plates. Common microtiter plate designs useful according to the invention have, for example 12, 24, 48, 96, 384, or more wells, although any number of wells that physically fit on the plate and accommodate the desired reaction volume (usually 10-100 μl) can be used according to the invention. Generally, the 96 or 384 well plate format can be utilized. In one embodiment, the method is performed in a 96 well plate format. In one embodiment, the method is performed in a 384 well plate format.
The present invention includes kits for measuring gene expression. Provided herein is a kit for measuring expression levels of two, three or more target genes of a set of target genes of the TGF-β cellular signaling pathway in a sample of a subject, comprising: one or more components for determining the expression levels of the two, three or more target genes of the set of target genes of the TGF-β cellular signaling pathway, wherein the set of target genes of the TGF-β cellular signaling pathway includes at least seven, or, in an alternative, all target genes selected from the group consisting of: ANGPTL4, CDC42EP3, CDKN1A, CDKN2B, CTGF, GADD45A, GADD45B, HMGA2, ID1, IL11, INPP5D, JUNB, MMP2, MMP9, NKX2-5, OVOL1, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI1, SNAI2, TIMP1, and VEGFA, or ANGPTL4, CDC42EP3, CDKN1A, CDKN2B, CTGF, GADD45A, GADD45B, HMGA2, ID1, IL11, SERPINE1, INPP5D, JUNB, MMP2, MMP9, NKX2-5, OVOL1, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI1, SNAI2, TIMP1, and VEGFA, or from the group consisting of: ANGPTL4, CDC42EP3, CDKN1A, CTGF, GADD45A, GADD45B, HMGA2, ID1, IL11, JUNB, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI2, and VEGFA, or ANGPTL4, CDC42EP3, CDKN1A, CTGF, GADD45A, GADD45B, HMGA2, ID1, SERPINE1, JUNB, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI2, and VEGFA, or from the group consisting of: ANGPTL4, CDC42EP3, CDKN1A, CTGF, GADD45B, ID1, IL11, JUNB, PDGFB, SKIL, SMAD7, and SNAI2, or ANGPTL4, CDC42EP3, CDKN1A, CTGF, GADD45B, ID1, SERPINE1, JUNB, VEGFA, SKIL, SMAD7, and SNAI2, or from the group consisting of: ANGPTL4, CDC42EP3, ID1, IL11, JUNB, SKIL, and SMAD7, or ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, and SMAD7.
In one embodiment, the kit comprises an apparatus comprising a digital processor. In another embodiment, the kit comprises a non-transitory storage medium storing instructions that are executable by a digital processing device. In yet another embodiment, the kit comprises a computer program comprising program code means for causing a digital processing device to perform the methods described herein.
In an additional embodiment, the kit contains one or more components that are for example selected from the group consisting of: a DNA array chip, an oligonucleotide array chip, a protein array chip, an antibody, a plurality of probes, RNA sequencing and a set of primers. In one embodiment, the kit contains a plurality of probes. In one embodiment, the kit contains a set of primers. In one embodiment, the kit contains a 6, 12, 24, 48, 96, or 384-well PCR plate. In one embodiment, the kit includes a 96 well PCR plate. In one embodiment, the kit includes a 384 well PCR plate.
In one embodiment, the kit for measuring the expression levels of TGF-β cellular signaling pathway genes comprises a means for measuring the expression levels of a set of TGF-β cellular signaling pathway genes, wherein the genes consist of ANGPTL4, and at least two of CDC42EP3, ID1, SERPINE1, JUNB, SKIL, or SMAD7. In one embodiment, the kit for measuring the expression levels of TGF-β cellular signaling pathway genes comprises a means for measuring the expression levels of a set of TGF-β cellular signaling pathway genes, wherein the genes consist of ANGPTL4, CDC42EP3, and at least one of ID1, SERPINE1, JUNB, SKIL, or SMAD7. In one embodiment, the kit for measuring the expression levels of TGF-β cellular signaling pathway genes comprises a means for measuring the expression levels of a set of TGF-β cellular signaling pathway genes, wherein the genes consist of ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, and SMAD7. In another embodiment, the genes further consist of at least one additional gene selected from CDKN1A, CTGF, GADD45B, PDGFB, and SNAI2. In another embodiment, the genes further consist of CDKN1A, CTGF, GADD45B, PDGFB, and SNAI2. In a further embodiment, the genes further consist of at least one additional gene selected from GADD45A, HMGA2, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SMAD7, and VEGFA. In a further embodiment, the genes further consist of GADD45A, HMGA2, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SMAD7, and VEGFA. In a further embodiment, the genes further consist of at least one additional gene selected from INPP5D, MMP2, MMP9, NKX2-5, OVOL1, and TIMP1. In a further embodiment, the genes further consist of INPP5D, MMP2, MMP9, NKX2-5, OVOL1, and TIMP1.
In one embodiment, a kit for measuring the expression levels of TGF-β cellular signaling target genes comprises a 96-well plate and a set of labeled probes for detecting expression of a set of TGF-β cellular signaling pathway genes comprising ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, or SMAD7. In one embodiment, a kit for measuring the expression levels of TGF-βcellular signaling target genes comprises a 96-well plate and a set of labeled probes for detecting expression of a set of TGF-β cellular signaling pathway genes comprising ANGPTL4, CDC42EP3, and at least one of ID1, SERPINE1, JUNB, SKIL, or SMAD7. In one embodiment, a kit for measuring the expression levels of TGF-β cellular signaling target genes comprises a 96-well plate and a set of labeled probes for detecting expression of a set of TGF-β cellular signaling pathway genes comprising ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, and SMAD7. In another embodiment, the genes further consist of at least one additional gene selected from CDKN1A, CTGF, GADD45B, PDGFB, and SNAI2. In another embodiment, the genes further consist of CDKN1A, CTGF, GADD45B, PDGFB, and SNAI2. In a further embodiment, the genes further consist of at least one additional gene selected from GADD45A, HMGA2, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SMAD7, and VEGFA. In a further embodiment, the genes further consist of GADD45A, HMGA2, PTHLH, SGK1, SMAD4, SMAD5, SMAD6, SMAD7, and VEGFA. In a further embodiment, the genes further consist of at least one additional gene selected from INPP5D, MMP2, MMP9, NKX2-5, OVOL1, and TIMP1. In a further embodiment, the genes further consist of INPP5D, MMP2, MMP9, NKX2-5, OVOL1, and TIMP1.
In one embodiment, the kit further comprises an instruction manual measuring the expression levels of TGF-β cellular signaling target genes. In another embodiment, the kit further comprises an access code to access a computer program code for calculating the TGF-β cellular signaling pathway activity in the sample. In a further embodiment, the kit further comprises an access code to access a website for calculating the TGF-β cellular signaling pathway activity in the sample according to the methods described above.
A non-limiting exemplary flow chart for deriving target gene expression levels from a sample isolated from a subject is shown in FIG. 8. In one exemplary embodiment, samples are received and registered in a laboratory. Samples can include, for example, Formalin-Fixed, Paraffin-Embedded (FFPE) samples (181) or fresh frozen (FF) samples (180). FF samples can be directly lysed (183). For FFPE samples, the paraffin can be removed with a heated incubation step upon addition of Proteinase K (182). Cells are then lysed (183), which destroys the cell and nuclear membranes which makes the nucleic acid (NA) available for further processing. The nucleic acid is bound to a solid phase (184) which could for example, be beads or a filter. The nucleic acid is then washed with washing buffers to remove all the cell debris which is present after lysis (185). The clean nucleic acid is then detached from the solid phase with an elution buffer (186). The DNA is removed by DNAse treatment to ensure that only RNA is present in the sample (187). The nucleic acid sample can then be directly used in the RT-qPCR sample mix (188). The RT-qPCR sample mixes contains the RNA sample, the RT enzyme to prepare cDNA from the RNA sample and a PCR enzyme to amplify the cDNA, a buffer solution to ensure functioning of the enzymes and can potentially contain molecular grade water to set a fixed volume of concentration. The sample mix can then be added to a multiwell plate (i.e., 96 well or 384 well plate) which contains dried RT-qPCR assays (189). The RT-qPCR can then be run in a PCR machine according to a specified protocol (190). An example PCR protocol includes i) 30 minutes at 50° C.; ii) 5 minutes at 95° C.; iii) 15 seconds at 95° C.; iv) 45 seconds at 60° C.; v) 50 cycles repeating steps iii and iv. The Cq values are then determined with the raw data by using the second derivative method (191). The Cq values are exported for analysis (192).
As contemplated herein, the calculation of TGF-β signaling in the sample is performed on a computerized device having a processor capable of executing a readable program code for calculating the TGF-β cellular signaling pathway activity in the sample according to the methods described above. Accordingly, the computerized device can include means for receiving expression level data, wherein the data is expression levels of at least three target genes derived from the sample, a means for calculating the level of TGF-β transcription factor element in the sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the model which have been correlated with a level TGF-β transcription factor element; a means for calculating the TGF-β cellular signaling in the sample based on the calculated levels of TGF-β transcription factor element in the sample; and a means for assigning a TGF-β cellular signaling pathway activity probability or status to the calculated TGF-β cellular signaling in the sample, and a means for displaying the TGF-β signaling pathway activity probability or status.
In accordance with another disclosed aspect, a non-transitory storage medium stores instructions that are executable by a digital processing device to perform a method according to the present invention as described herein. The non-transitory storage medium may be a computer-readable storage medium, such as a hard drive or other magnetic storage medium, an optical disk or other optical storage medium, a random access memory (RAM), read only memory (ROM), flash memory, or other electronic storage medium, a network server, or so forth. The digital processing device may be a handheld device (e.g., a personal data assistant or smartphone), a notebook computer, a desktop computer, a tablet computer or device, a remote network server, or so forth.
In accordance with another disclosed aspect, an apparatus comprises a digital processor configured to perform a method according to the present invention as described herein.
In accordance with another disclosed aspect, a computer program comprises program code means for causing a digital processing device to perform a method according to the present invention as described herein. The digital processing device may be a handheld device (e.g., a personal data assistant or smartphone), a notebook computer, a desktop computer, a tablet computer or device, a remote network server, or so forth.
In one embodiment, a computer program or system is provided for predicting the activity status of a TGF-β transcription factor element in a human cancer sample that includes a means for receiving data corresponding to the expression level of one or more TGF-β target genes in a sample from a host. In some embodiments, a means for receiving data can include, for example, a processor, a central processing unit, a circuit, a computer, or the data can be received through a website.
In one embodiment, a computer program or system is provided for predicting the activity status of a TGF-β transcription factor element in a human cancer sample that includes a means for displaying the TGF-β pathway signaling status in a sample from a host. In some embodiments, a means for displaying can include a computer monitor, a visual display, a paper print out, a liquid crystal display (LCD), a cathode ray tube (CRT), a graphical keyboard, a character recognizer, a plasma display, an organic light-emitting diode (OLED) display, or a light emitting diode (LED) display, or a physical print out.
In accordance with another disclosed aspect, a signal represents a determined activity of a TGF-β cellular signaling pathway in a subject, wherein the determined activity results from performing a method according to the present invention as described herein. The signal can be a digital signal or it can be an analog signal.
In one aspect of the present invention, a computer implemented method is provided for predicting the activity status of a TGF-β signaling pathway in a human cancer sample performed by a computerized device having a processor comprising: a) calculating an activity level of a TGF-β transcription factor element in a human cancer sample, wherein the level of the TGF-β transcription factor element in the human cancer sample is associated with the activity of a TGF-β cellular signaling pathway, and wherein the level of the TGF-β transcription factor element in the human cancer sample is calculated by i) receiving data on the expression levels of at least three target genes derived from the human cancer sample, wherein the TGF-β transcription factor controls transcription of the at least three target genes, and wherein the at least three target genes are ANGPTL4, and at least two of CDC42EP3, ID1, IL11, JUNB, SKIL, or SMAD7 ii) calculating the activity level of the TGF-β transcription factor element in the human cancer sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the at least three target genes in the human cancer sample with expression levels of the at least three target genes in the model which have been correlated with an activity level of a TGF-β transcription factor element; b) calculating the TGF-β cellular signaling pathway activity in the human cancer sample based on the calculated TGF-β transcription factor element activity level in the human cancer sample; c) assigning a TGF-β cellular signaling pathway activity status to the TGF-β cellular signaling pathway in the human cancer sample, wherein the activity status is indicative of either an active TGF-β cellular signaling pathway or a passive TGF-β cellular signaling pathway; and d) displaying the TGF-β signaling pathway activity status.
In one aspect of the invention, a system is provided for determining the activity level of a TGF-β cellular signaling pathway in a subject comprising a) a processor capable of calculating an activity level of TGF-β transcription factor element in a sample derived from the subject; b) a means for receiving data, wherein the data is an expression level of at least three target genes derived from the sample; c) a means for calculating the level of the TGF-β transcription factor element in the sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the model which define an activity level of TGF-β transcription factor element; d) a means for calculating the activity level of the TGF-β cellular signaling pathway in the sample based on the calculated activity level of TGF-β transcription factor element in the sample; a means for assigning a TGF-β cellular signaling pathway activity status to the calculated activity level of the TGF-β cellular signaling pathway in the sample, wherein the activity status is indicative of either an active TGF-β cellular signaling pathway or a passive TGF-β cellular signaling pathway; and f) a means for displaying the TGF-β signaling pathway activity status.
As contemplated herein, the methods and apparatuses of the present invention can be utilized to assess TGF-β cellular signaling pathway activity in a subject, for example a subject suspected of having, or having, a disease or disorder wherein the status of the TGF-β signaling pathway is probabtive, either wholly or partially, of disease presence or progression. In one embodiment, provided herein is a method of treating a subject comprising receiving information regarding the activity status of a TGF-β cellular signaling pathway derived from a sample isolated from the subject using the methods described herein and administering to the subject a TGF-β inhibitor if the information regarding the level of TGF-β cellular signaling pathway is indicative of an active TGF-β signaling pathway. In a particular embodiment, the TGF-β cellular signaling pathway activity indication is set at a cutoff value of odds of the TGF-B cellular signaling pathway being active of 10:1, 5:1, 4:1, 2:1, 1:1, 1:2, 1:4, 1:5, 1:10. TGF-β inhibitors are known and include, but are not limited to, Terameprocol, Fresolimumab, Sotatercept, Galunisertib, SB431542, LY2109761, LDN-193189, SB525334, SB505124, GW788388, LY364947, RepSox, LDN-193189 HCl, K02288, LDN-214117, SD-208, EW-7197, ML347, LDN-212854, DMH1, Pirfenidone, Hesperetin, Trabedersen, Lerdelimumab, Metelimumab, trx-SARA, ID11, Ki26894, or SB-431542.
In one embodiment, the disease or disorder is one of an auto-immune and other immune disorders, cancer, bronchial asthma, heart disease, diabetes, hereditary hemorrhagic telangiectasia, Marfan syndrome, Vascular Ehlers-Danlos syndrome, Loeys-Dietz syndrome, Parkinson's disease, Chronic kidney disease, Multiple Sclerosis, fibrotic diseases such as liver, Ing, or kidney fibrosis, Dupuytren's disease, or Alzheimer's disease.
In a particular embodiment, the subject is suffering from, or suspected to have, a cancer, for example, but not limited to, a primary tumor or a metastatic tumor, a solid tumor, for example, melanoma, lung cancer (including lung adenocarcinoma, basal cell carcinoma, squamous cell carcinoma, large cell carcinoma, bronchioloalveolar carcinoma, bronchiogenic carcinoma, non-small-cell carcinoma, small cell carcinoma, mesothelioma); breast cancer (including ductal carcinoma, lobular carcinoma, inflammatory breast cancer, clear cell carcinoma, mucinous carcinoma, serosal cavities breast carcinoma); colorectal cancer (colon cancer, rectal cancer, colorectal adenocarcinoma); anal cancer; pancreatic cancer (including pancreatic adenocarcinoma, islet cell carcinoma, neuroendocrine tumors); prostate cancer; prostate adenocarcinoma; ovarian carcinoma (ovarian epithelial carcinoma or surface epithelial-stromal tumor including serous tumor, endometrioid tumor and mucinous cystadenocarcinoma, sex-cord-stromal tumor); liver and bile duct carcinoma (including hepatocellular carcinoma, cholangiocarcinoma, hemangioma); esophageal carcinoma (including esophageal adenocarcinoma and squamous cell carcinoma); oral and oropharyngeal squamous cell carcinoma; salivary gland adenoid cystic carcinoma; bladder cancer; bladder carcinoma; carcinoma of the uterus (including endometrial adenocarcinoma, ocular, uterine papillary serous carcinoma, uterine clear-cell carcinoma, uterine sarcomas and leiomyosarcomas, mixed mullerian tumors); glioma, glioblastoma, medulloblastoma, and other tumors of the brain; kidney cancers (including renal cell carcinoma, clear cell carcinoma, Wilm's tumor); cancer of the head and neck (including squamous cell carcinomas); cancer of the stomach (gastric cancers, stomach adenocarcinoma, gastrointestinal stromal tumor); testicular cancer; germ cell tumor; neuroendocrine tumor; cervical cancer; carcinoids of the gastrointestinal tract, breast, and other organs; signet ring cell carcinoma; mesenchymal tumors including sarcomas, fibrosarcomas, haemangioma, angiomatosis, haemangiopericytoma, pseudoangiomatous stromal hyperplasia, myofibroblastoma, fibromatosis, inflammatory myofibroblastic tumor, lipoma, angiolipoma, granular cell tumor, neurofibroma, schwannoma, angiosarcoma, liposarcoma, rhabdomyosarcoma, osteosarcoma, leiomyoma, leiomysarcoma, skin, including melanoma, cervical, retinoblastoma, head and neck cancer, pancreatic, brain, thyroid, testicular, renal, bladder, soft tissue, adenal gland, urethra, cancers of the penis, myxosarcoma, chondrosarcoma, osteosarcoma, chordoma, malignant fibrous histiocytoma, lymphangiosarcoma, mesothelioma, squamous cell carcinoma; epidermoid carcinoma, malignant skin adnexal tumors, adenocarcinoma, hepatoma, hepatocellular carcinoma, renal cell carcinoma, hypernephroma, cholangiocarcinoma, transitional cell carcinoma, choriocarcinoma, seminoma, embryonal cell carcinoma, glioma anaplastic; glioblastoma multiforme, neuroblastoma, medulloblastoma, malignant meningioma, malignant schwannoma, neurofibrosarcoma, parathyroid carcinoma, medullary carcinoma of thyroid, bronchial carcinoid, pheochromocytoma, Islet cell carcinoma, malignant carcinoid, malignant paraganglioma, melanoma, Merkel cell neoplasm, cystosarcoma phylloide, salivary cancers, thymic carcinomas, and cancers of the vagina among others.
In one embodiment, the methods described herein are useful for treating a host suffering from a lymphoma or lymphocytic or myelocytic proliferation disorder or abnormality. For example, the subject suffering from a Hodgkin Lymphoma of a Non-Hodgkin Lymphoma. For example, the subject can be suffering from a Non-Hodgkin Lymphoma such as, but not limited to: an AIDS-Related Lymphoma; Anaplastic Large-Cell Lymphoma; Angioimmunoblastic Lymphoma; Blastic NK-Cell Lymphoma; Burkitt's Lymphoma; Burkitt-like Lymphoma (Small Non-Cleaved Cell Lymphoma); Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma; Cutaneous T-Cell Lymphoma; Diffuse Large B-Cell Lymphoma; Enteropathy-Type T-Cell Lymphoma; Follicular Lymphoma; Hepatosplenic Gamma-Delta T-Cell Lymphoma; Lymphoblastic Lymphoma; Mantle Cell Lymphoma; Marginal Zone Lymphoma; Nasal T-Cell Lymphoma; Pediatric Lymphoma; Peripheral T-Cell Lymphomas; Primary Central Nervous System Lymphoma; T-Cell Leukemias; Transformed Lymphomas; Treatment-Related T-Cell Lymphomas; or Waldenstrom's Macroglobulinemia.
Alternatively, the subject may be suffering from a Hodgkin Lymphoma, such as, but not limited to: Nodular Sclerosis Classical Hodgkin's Lymphoma (CHL); Mixed Cellularity CHL; Lymphocyte-depletion CHL; Lymphocyte-rich CHL; Lymphocyte Predominant Hodgkin Lymphoma; or Nodular Lymphocyte Predominant HL.
In one embodiment, the subject may be suffering from a specific T-cell, a B-cell, or a NK-cell based lymphoma, proliferative disorder, or abnormality. For example, the subject can be suffering from a specific T-cell or NK-cell lymphoma, for example, but not limited to: Peripheral T-cell lymphoma, for example, peripheral T-cell lymphoma and peripheral T-cell lymphoma not otherwise specified (PTCL-NOS); anaplastic large cell lymphoma, for example anaplastic lymphoma kinase (ALK) positive, ALK negative anaplastic large cell lymphoma, or primary cutaneous anaplastic large cell lymphoma; angioimmunoblastic lymphoma; cutaneous T-cell lymphoma, for example mycosis fungoides, Sézary syndrome, primary cutaneous anaplastic large cell lymphoma, primary cutaneous CD30+ T-cell lymphoproliferative disorder; primary cutaneous aggressive epidermotropic CD8+ cytotoxic T-cell lymphoma; primary cutaneous gamma-delta T-cell lymphoma; primary cutaneous small/medium CD4+ T-cell lymphoma. and lymphomatoid papulosis; Adult T-cell Leukemia/Lymphoma (ATLL); Blastic NK-cell Lymphoma; Enteropathy-type T-cell lymphoma; Hematosplenic gamma-delta T-cell Lymphoma; Lymphoblastic Lymphoma; Nasal NK/T-cell Lymphomas; Treatment-related T-cell lymphomas; for example lymphomas that appear after solid organ or bone marrow transplantation; T-cell prolymphocytic leukemia; T-cell large granular lymphocytic leukemia; Chronic lymphoproliferative disorder of NK-cells; Aggressive NK cell leukemia; Systemic EBV+ T-cell lymphoproliferative disease of childhood (associated with chronic active EBV infection); Hydroa vacciniforme-like lymphoma; Adult T-cell leukemia/lymphoma; Enteropathy-associated T-cell lymphoma; Hepatosplenic T-cell lymphoma; or Subcutaneous panniculitis-like T-cell lymphoma.
Alternatively, the subject may be suffering from a specific B-cell lymphoma or proliferative disorder such as, but not limited to: multiple myeloma; Diffuse large B cell lymphoma; Follicular lymphoma; Mucosa-Associated Lymphatic Tissue lymphoma (MALT); Small cell lymphocytic lymphoma; Mantle cell lymphoma (MCL); Burkitt lymphoma; Mediastinal large B cell lymphoma; Waldenstrom macroglobulinemia; Nodal marginal zone B cell lymphoma (NMZL); Splenic marginal zone lymphoma (SMZL); Intravascular large B-cell lymphoma; Primary effusion lymphoma; or Lymphomatoid granulomatosis; Chronic lymphocytic leukemia/small lymphocytic lymphoma; B-cell prolymphocytic leukemia; Hairy cell leukemia; Splenic lymphoma/leukemia, unclassifiable; Splenic diffuse red pulp small B-cell lymphoma; Hairy cell leukemia-variant; Lymphoplasmacytic lymphoma; Heavy chain diseases, for example, Alpha heavy chain disease, Gamma heavy chain disease, Mu heavy chain disease; Plasma cell myeloma; Solitary plasmacytoma of bone; Extraosseous plasmacytoma; Primary cutaneous follicle center lymphoma; T cell/histiocyte rich large B-cell lymphoma; DLBCL associated with chronic inflammation; Epstein-Barr virus (EBV)+ DLBCL of the elderly; Primary mediastinal (thymic) large B-cell lymphoma; Primary cutaneous DLBCL, leg type; ALK+ large B-cell lymphoma; Plasmablastic lymphoma; Large B-cell lymphoma arising in HHV8-associated multicentric; Castleman disease; B-cell lymphoma, unclassifiable, with features intermediate between diffuse large B-cell lymphoma and Burkitt lymphoma; B-cell lymphoma, unclassifiable, with features intermediate between diffuse large B-cell lymphoma and classical Hodgkin lymphoma; Nodular sclerosis classical Hodgkin lymphoma; Lymphocyte-rich classical Hodgkin lymphoma; Mixed cellularity classical Hodgkin lymphoma; or Lymphocyte-depleted classical Hodgkin lymphoma.
In one embodiment, the subject is suffering from a leukemia. For example, the subject may be suffering from an acute or chronic leukemia of a lymphocytic or myelogenous origin, such as, but not limited to: Acute lymphoblastic leukemia (ALL); Acute myelogenous leukemia (AML); Chronic lymphocytic leukemia (CLL); Chronic myelogenous leukemia (CML); juvenile myelomonocytic leukemia (JMML); hairy cell leukemia (HCL); acute promyelocytic leukemia (a subtype of AML); T-cell prolymphocytic leukemia (TPLL); large granular lymphocytic leukemia; or Adult T-cell chronic leukemia; large granular lymphocytic leukemia (LGL). In one embodiment, the patient suffers from an acute myelogenous leukemia, for example an undifferentiated AML (M0); myeloblastic leukemia (M1; with/without minimal cell maturation); myeloblastic leukemia (M2; with cell maturation); promyelocytic leukemia (M3 or M3 variant [M3V]); myelomonocytic leukemia (M4 or M4 variant with eosinophilia [M4E]); monocytic leukemia (M5); erythroleukemia (M6); or megakaryoblastic leukemia (M7).
In a particular embodiment, the subject is suffering, or suspected to be suffering from, a breast cancer, lung cancer, a colon cancer, pancreatic cancer, or brain cancer. In a particular embodiment, the subject is suffering from, or suspected to be suffering from, a breast cancer.
The sample(s) to be used in accordance with the present invention can be an extracted sample, that is, a sample that has been extracted from the subject. Examples of the sample include, but are not limited to, a tissue, cells, blood and/or a body fluid of a subject. It can be, e.g., a sample obtained from a cancer lesion, or from a lesion suspected for cancer, or from a metastatic tumor, or from a body cavity in which fluid is present which is contaminated with cancer cells (e.g., pleural or abdominal cavity or bladder cavity), or from other body fluids containing cancer cells, and so forth, for example, via a biopsy procedure or other sample extraction procedure. The cells of which a sample is extracted may also be tumorous cells from hematologic malignancies (such as leukemia or lymphoma). In some cases, the cell sample may also be circulating tumor cells, that is, tumor cells that have entered the bloodstream and may be extracted using suitable isolation techniques, e.g., apheresis or conventional venous blood withdrawal. Aside from blood, a body fluid of which a sample is extracted may be urine, gastrointestinal contents, or anextravasate.
In one aspect of the present invention, the methods and apparatuses described herein are used to identify an active TGF-β cellular signaling pathway in a subject suffering from a cancer, and administering to the subject an anti-cancer agent, for example a TGF-β inhibitor, selected from, but not limited to, Terameprocol, Fresolimumab, Sotatercept, Galunisertib, SB431542, LY2109761, LDN-193189, SB525334, SB505124, GW788388, LY364947, RepSox, LDN-193189 HCl, K02288, LDN-214117, SD-208, EW-7197, ML347, LDN-212854, DMH1, Pirfenidone, Hesperetin, Trabedersen, Lerdelimumab, Metelimumab, trx-SARA, ID11, Ki26894, or SB-431542. Another aspect of the present invention relates to a method (as described herein), further comprising:
determining whether the TGF-β cellular signaling pathway is operating abnormally in the subject based on the calculated activity of the TGF-β cellular signaling pathway in the subject.
Here, the term “abnormally” denotes disease-promoting activity of the TGF-β cellular signaling pathway, for example, a tumor-promoting activity.
The present invention also relates to a method (as described herein) further comprising:
recommending prescribing a drug, for example a TGF-β inhibitor, for the subject that corrects for abnormal operation of the TGF-β cellular signaling pathway,
wherein the recommending is performed if the TGF-β cellular signaling pathway is determined to be operating abnormally in the subject based on the calculated/determined activity of the TGF-β cellular signaling pathway.
The present invention also relates to a method (as described herein), wherein the calculating/determining comprises:
calculating the activity of the TGF-β cellular signaling pathway in the subject based at least on expression levels of two, three or more target genes of a set of target genes of the TGF-β cellular signaling pathway measured in the sample of the subject.
In one embodiment,
the set of target genes of the TGF-β cellular signaling pathway includes at least seven, or in an alternative, all target genes selected from the group consisting of: ANGPTL4, CDC42EP3, CDKN1A, CDKN2B, CTGF, GADD45A, GADD45B, HMGA2, ID1, IL11, INPP5D, JUNB, MMP2, MMP9, NKX2-5, OVOL1, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI1, SNAI2, TIMP1, and VEGFA, or from the group consisting of: ANGPTL4, CDC42EP3, CDKN1A, CTGF, GADD45A, GADD45B, HMGA2, ID1, IL11, JUNB, PDGFB, PTHLH, SGK1, SKIL, SMAD4, SMAD5, SMAD6, SMAD7, SNAI2, and VEGFA, or from the group consisting of: ANGPTL4, CDC42EP3, CDKN1A, CTGF, GADD45B, ID1, IL11, JUNB, PDGFB, SKIL, SMAD7, and SNAI2, or from the group consisting of: ANGPTL4, CDC42EP3, ID1, IL11, JUNB, SKIL, and SMAD7.
The present invention as described herein can, e.g., also advantageously be used in connection with:
diagnosis based on the determined activity of the TGF-β cellular signaling pathway in the subject;
prognosis based on the determined activity of the TGF-β cellular signaling pathway in the subject;
drug prescription based on the determined activity of the TGF-β cellular signaling pathway in the subject;
prediction of drug efficacy based on the determined activity of the TGF-β cellular signaling pathway in the subject;
prediction of adverse effects based on the determined activity of the TGF-β cellular signaling pathway in the subject;
monitoring of drug efficacy;
drug development;
assay development;
pathway research;
cancer staging;
enrollment of the subject in a clinical trial based on the determined activity of the TGF-β cellular signaling pathway in the subject;
selection of subsequent test to be performed; and
selection of companion diagnostics tests.
Further advantages will be apparent to those of ordinary skill in the art upon reading and understanding the attached figures, the following description and, in particular, upon reading the detailed examples provided herein below.
It shall be understood that an embodiment of the present invention can also be any combination of the dependent claims or above embodiments with the respective independent claim.
These and other aspects of the invention will be apparent from and elucidated with reference to the embodiments described hereinafter.
The following examples merely illustrate exemplary methods and selected aspects in connection therewith. The teaching provided therein may be used for constructing several tests and/or kits, e.g., to detect, predict and/or diagnose the abnormal activity of the TGF-B cellular signaling pathways. Furthermore, upon using methods as described herein drug prescription can advantageously be guided, drug response prediction and monitoring of drug efficacy (and/or adverse effects) can be made, drug resistance can be predicted and monitored, e.g., to select subsequent test(s) to be performed (like a companion diagnostic test). The following examples are not to be construed as limiting the scope of the present invention.
As described in detail in the published international patent application WO 2013/011479 A2 (“Assessment of cellular signaling pathway activity using probabilistic modeling of target gene expression”), by constructing a probabilistic model, e.g., a Bayesian network model, and incorporating conditional probabilistic relationships between expression levels of one or more target gene(s) of a cellular signaling pathway, herein, the TGF-β cellular signaling pathway, and the level of a transcription factor (TF) element, herein, the TGF-β TF element, the TF element controlling transcription of the one or more target gene(s) of the cellular signaling pathway, such a model may be used to determine the activity of the cellular signaling pathway with a high degree of accuracy. Moreover, the probabilistic model can be readily updated to incorporate additional knowledge obtained by later clinical studies, by adjusting the conditional probabilities and/or adding new nodes to the model to represent additional information sources. In this way, the probabilistic model can be updated as appropriate to embody the most recent medical knowledge.
In another easy to comprehend and interpret approach described in detail in the published international patent application WO 2014/102668 A2 (“Assessment of cellular signaling pathway activity using linear combination(s) of target gene expressions”), the activity of a cellular signaling pathway, herein, the TGF-β cellular signaling pathway, may be determined by constructing and evaluating a linear or (pseudo-)linear model incorporating relationships between expression levels of one or more target gene(s) of the cellular signaling pathway and the level of a transcription factor (TF) element, herein, the TGF-β TF element, the TF element controlling transcription of the one or more target gene(s) of the cellular signaling pathway, the model being based at least in part on one or more linear combination(s) of expression levels of the one or more target gene(s).
In both approaches, the expression levels of the one or more target gene(s) may, for example, be measurements of the level of mRNA, which can be the result of, e.g., (RT)-PCR and microarray techniques using probes associated with the target gene(s) mRNA sequences, and of RNA-sequencing. In another embodiment, the expression levels of the one or more target gene(s) can be measured by protein levels, e.g., the concentrations and/or activity of the protein(s) encoded by the target gene(s).
The aforementioned expression levels may optionally be converted in many ways that might or might not suit the application better. For example, four different transformations of the expression levels, e.g., microarray-based mRNA levels, may be:
One of the simplest linear models that can be constructed is a model having a node representing the transcription factor (TF) element, herein, the TGF-β TF element, in a first layer and weighted nodes representing direct measurements of the target gene(s) expression levels, e.g., by one probeset that is particularly highly correlated with the particular target gene, e.g., in microarray or (q) PCR experiments, in a second layer. The weights can be based either on calculations from a training data set or based on expert knowledge. This approach of using, in the case where possibly multiple expression levels are measured per target gene (e.g., in the case of microarray experiments, where one target gene can be measured with multiple probesets), only one expression level per target gene is particularly simple. A specific way of selecting the one expression level that is used for a particular target gene is to use the expression level from the probeset that is able to separate active and passive samples of a training data set the best. One method to determine this probeset is to perform a statistical test, e.g., the t-test, and select the probeset with the lowest p-value. The training data set's expression levels of the probeset with the lowest p-value is by definition the probeset with the least likely probability that the expression levels of the (known) active and passive samples overlap. Another selection method is based on odds-ratios. In such a model, one or more expression level(s) are provided for each of the one or more target gene(s) and the one or more linear combination(s) comprise a linear combination including for each of the one or more target gene(s) a weighted term, each weighted term being based on only one expression level of the one or more expression level(s) provided for the respective target gene. If the only one expression level is chosen per target gene as described above, the model may be called a “most discriminant probesets” model.
In an alternative to the “most discriminant probesets” model, it is possible, in the case where possibly multiple expression levels are measured per target gene, to make use of all the expression levels that are provided per target gene. In such a model, one or more expression level(s) are provided for each of the one or more target gene(s) and the one or more linear combination(s) comprise a linear combination of all expression levels of the one or more expression level(s) provided for the one or more target gene(s). In other words, for each of the one or more target gene(s), each of the one or more expression level(s) provided for the respective target gene may be weighted in the linear combination by its own (individual) weight. This variant may be called an “all probesets” model. It has an advantage of being relatively simple while making use of all the provided expression levels.
Both models as described above have in common that they are what may be regarded as “single-layer” models, in which the level of the TF element is calculated based on a linear combination of expression levels of the one or more probeset of the one or more target genes.
After the level of the TF element, herein, the TGF-β TF element, has been determined by evaluating the respective model, the determined TF element level can be thresholded in order to infer the activity of the cellular signaling pathway, herein, the TGF-β cellular signaling pathway. An exemplary method to calculate such an appropriate threshold is by comparing the determined TF element levels wlc of training samples known to have a passive cellular signaling pathway and training samples with an active cellular signaling pathway. A method that does so and also takes into account the variance in these groups is given by using a threshold
thr = σ wlc pas μ wlc act + σ wlc act μ wlc pas σ wlc pas + σ wlc act ( 1 )
where σ and μ are the standard deviation and the mean of the determined TF element levels wlc for the training samples. In case only a small number of samples are available in the active and/or passive training samples, a pseudocount may be added to the calculated variances based on the average of the variances of the two groups:
v ~ = v wlc act + v wlc pas 2 v ~ wlc act = x v ~ + ( n act - 1 ) v wlc act x + n act - 1 v ~ wlc pas = x v ~ + ( n pas - 1 ) v wlc pas x + n pas - 1 ( 2 )
where v is the variance of the determined TF element levels wlc of the groups, x is a positive pseudocount, e.g., 1 or 10, and nact and npas are the number of active and passive samples, respectively. The standard deviation a can next be obtained by taking the square root of the variance v.
The threshold can be subtracted from the determined TF element levels wlc for ease of interpretation, resulting in a cellular signaling pathway's activity score in which negative values correspond to a passive cellular signaling pathway and positive values correspond to an active cellular signaling pathway.
As an alternative to the above-described “single-layer” models, a “two-layer” may also be used in an example. In such a model, a summary value is calculated for every target gene using a linear combination based on the measured intensities of its associated probesets (“first (bottom) layer”). The calculated summary value is subsequently combined with the summary values of the other target genes of the cellular signaling pathway using a further linear combination (“second (upper) layer”). Again, the weights can be either learned from a training data set or based on expert knowledge or a combination thereof. Phrased differently, in the “two-layer” model, one or more expression level(s) are provided for each of the one or more target gene(s) and the one or more linear combination(s) comprise for each of the one or more target gene(s) a first linear combination of all expression levels of the one or more expression level(s) provided for the respective target gene (“first (bottom) layer”). The model is further based at least in part on a further linear combination including for each of the one or more target gene(s) a weighted term, each weighted term being based on the first linear combination for the respective target gene (“second (upper) layer”).
The calculation of the summary values can, in an exemplary version of the “two-layer” model, include defining a threshold for each target gene using the training data and subtracting the threshold from the calculated linear combination, yielding the target gene summary. Here the threshold may be chosen such that a negative target gene summary value corresponds to a down-regulated target gene and that a positive target gene summary value corresponds to an up-regulated target gene. Also, it is possible that the target gene summary values are transformed using, e.g., one of the above-described transformations (fuzzy, discrete, etc.), before they are combined in the “second (upper) layer”.
After the level of the TF element has been determined by evaluating the “two-layer” model, the determined TF element level can be thresholded in order to infer the activity of the cellular signaling pathway, as described above.
In the following, the models described above are collectively denoted as “(pseudo-) linear” models. A more detailed description of the training and use of probabilistic models, e.g., a Bayesian network model, is provided in Example 3 below.
A transcription factor (TF) is a protein complex (i.e., a combination of proteins bound together in a specific structure) or a protein that is able to regulate transcription from target genes by binding to specific DNA sequences, thereby controlling the transcription of genetic information from DNA to mRNA. The mRNA directly produced due to this action of the TF complex is herein referred to as a “direct target gene” (of the transcription factor). Cellular signaling pathway activation may also result in more secondary gene transcription, referred to as “indirect target genes”. In the following, (pseudo-)linear models or Bayesian network models (as exemplary mathematical models) comprising or consisting of direct target genes as direct links between cellular signaling pathway activity and mRNA level, are exemplified, however the distinction between direct and indirect target genes is not always evident. Herein, a method to select direct target genes using a scoring function based on available scientific literature data is presented. Nonetheless, an accidental selection of indirect target genes cannot be ruled out due to limited information as well as biological variations and uncertainties. In order to select the target genes, the MEDLINE database of the National Institute of Health accessible at “www.ncbi.nlm.nih.gov/pubmed” and herein further referred to as “Pubmed” was employed to generate a lists of target genes. Furthermore, three additional lists of target genes were selected based on the probative nature of their expression.
Publications containing putative TGF-β target genes were searched for by using queries such as (“TGF-β” AND “target gene”) in the period of fourth quarter of 2013 and the first quarter of 2014. The resulting publications were further analyzed manually following the methodology described in more detail below.
Specific cellular signaling pathway mRNA target genes were selected from the scientific literature, by using a ranking system in which scientific evidence for a specific target gene was given a rating, depending on the type of scientific experiments in which the evidence was accumulated. While some experimental evidence is merely suggestive of a gene being a direct target gene, like for example an mRNA increasing as detected by means of an increasing intensity of a probeset on a microarray of a cell line in which it is known that the TGF-β cellular signaling pathway is active, other evidence can be very strong, like the combination of an identified TGF-β cellular signaling pathway TF binding site and retrieval of this site in a chromatin immunoprecipitation (ChIP) assay after stimulation of the specific cellular signaling pathway in the cell and increase in mRNA after specific stimulation of the cellular signaling pathway in a cell line.
Several types of experiments to find specific cellular signaling pathway target genes can be identified in the scientific literature:
In the simplest form one can give every potential gene 1 point for each of these experimental approaches in which the gene was identified as being a target gene of the TGF-β family of transcription factors. Using this relative ranking strategy, one can make a list of most reliable target genes.
Alternatively, ranking in another way can be used to identify the target genes that are most likely to be direct target genes, by giving a higher number of points to the technology that provides most evidence for an in vivo direct target gene. In the list above, this would mean 8 points for experimental approach 1), 7 for 2), and going down to 1 point for experimental approach 8). Such a list may be called a “general list of target genes”.
Despite the biological variations and uncertainties, the inventors assumed that the direct target genes are the most likely to be induced in a tissue-independent manner. A list of these target genes may be called an “evidence curated list of target genes”. Such an evidence curated list of target genes has been used to construct computational models of the TGF-β cellular signaling pathway that can be applied to samples coming from different tissue sources.
The following will illustrate exemplary how the selection of an evidence curated target gene list specifically was constructed for the TGF-β cellular signaling pathway.
A scoring function was introduced that gave a point for each type of experimental evidence, such as ChIP, EMSA, differential expression, knock down/out, luciferase gene reporter assay, sequence analysis, that was reported in a publication. The same experimental evidence is sometimes mentioned in multiple publications resulting in a corresponding number of points, e.g., two publications mentioning a ChIP finding results in twice the score that is given for a single ChIP finding. Further analysis was performed to allow only for genes that had diverse types of experimental evidence and not only one type of experimental evidence, e.g., differential expression. Those genes that had more than one type of experimental evidence available were selected (as shown in Table 4).
A further selection of the evidence curated list of target genes (listed in Table 5) was made by the inventors. The target genes of the evidence curated list that were proven to be more probative in determining the activity of the TGF-β signaling pathway from the training samples were selected. Herein, samples from GSE17708 stimulated with 5 ng/mL TGF-β for 4 hours were chosen as active or tumor promoting TGF-β activity whereas the unstimulated samples were chosen as the passive or tumor suppressing TGF-β samples for training, alternatively, one can use patient samples of primary cells or other cell lines stimulated with and deprived of TGF-β, e.g. GSE6653, GSE42373 and GSE18670. All target genes that had a “soft” odds ratio (see below) between active and passive training samples of more than 2 or less than 0.5 for negatively regulated target genes were selected for the “20 target genes shortlist”. Target genes that were found to have a “soft” odds ratio of more than 10 or less than 0.1 are selected for the “12 target genes shortlist”. The “7 target genes shortlist” consists of target genes that were found to have a “soft” odds ratio of more than 15 or less than 1/15. The 20 target genes shortlist, the 12 target genes shortlist, and the 7 target genes shortlist are shown in Tables 5 to 7, respectively.
| TABLE 4 |
| ″Evidence curated list of target genes″ of the TGF-β cellular signaling |
| pathway used in the TGF-β cellular signaling pathway models and |
| associated probesets used to measure the mRNA expression level of |
| the target genes. |
| Target gene | Probeset | Target gene | Probeset |
| ANGPTL4 | 223333_s_at | OVOL1 | 206604_at |
| 221009_s_at | 229396_at | ||
| CDC42EP3 | 209286_a | PDGFB | 204200_s_at |
| 209288_s_at | 216061_x_at | ||
| 225685_at | 217112_at | ||
| 209287_s_at | 217430_x_at | ||
| CDKN1A | 202284_s_at | PTHLH | 210355_at |
| 1555186_at | 206300_s_at | ||
| CDKN2B | 236313_at | 1556773_at | |
| 207530_s_at | 211756_at | ||
| CTGF | 209101_at | SGK1 | 201739_at |
| GADD45A | 203725_at | SKIL | 206675_s_at |
| GADD45B | 207574_s_at | 225227_at | |
| 209305_s_at | 215889_at | ||
| 209304_x_at | SMAD4 | 202526_at | |
| HMGA2 | 208025_s_at | 202527_s_at | |
| 1567224_at | 1565703_at | ||
| 1568287_at | 235725_at | ||
| 1558683_a_at | SMAD5 | 225223_at | |
| 1561633_at | 235451_at | ||
| 1559891_at | 225219_at | ||
| 1558682_at | 205187_at | ||
| ID1 | 208937_s_at | 205188_s_at | |
| IL11 | 206924_at | SMAD6 | 207069_s_at |
| 206926_s_at | 209886_s_at | ||
| INPP5D | 203331_s_at | SMAD7 | 204790_at |
| 1568943_at | SNAI1 | 219480_at | |
| 203332_s_at | SNAI2 | 213139_at | |
| JUNB | 201473_at | TIMP1 | 201666_at |
| MMP2 | 1566678_at | VEGFA | 210513_s_at |
| 201069_at | 210512_s_at | ||
| MMP9 | 203936_s_at | 212171_x_at | |
| NKX2-5 | 206578_at | 211527_x_at | |
| TABLE 5 |
| ″20 target genes shortlist″ of target genes of the TGF-β cellular |
| signaling pathway based on the evidence curated list of target genes. |
| ANGPTL4 |
| CDC42EP3 |
| CDKN1A |
| CTGF |
| GADD45A |
| GADD45B |
| HMGA2 |
| ID1 |
| IL11 |
| JUNB |
| PDGFB |
| PTHLH |
| SGK1 |
| SKIL |
| SMAD4 |
| SMAD5 |
| SMAD6 |
| SMAD7 |
| SNAI2 |
| VEGFA |
| TABLE 6 |
| ″12 target genes shortlist″ of target genes of the TGF-β cellular |
| signaling pathway based on the evidence curated list of target genes. |
| ANGPTL4 |
| CDC42EP3 |
| CDKN1A |
| CTGF |
| GADD45B |
| ID1 |
| IL11 |
| JUNB |
| PDGFB |
| SKIL |
| SMAD7 |
| SNAI2 |
| TABLE 7 |
| ″7 target genes shortlist″ of target genes of the TGF-β cellular signaling |
| pathway based on the evidence curated list of target genes. |
| ANGPTL4 |
| CDC42EP3 |
| ID1 |
| IL11 |
| JUNB |
| SKIL |
| SMAD7 |
Before the mathematical model can be used to infer the activity of the cellular signaling pathway, herein, the TGF-β cellular signaling pathway, in a subject, the model must be appropriately trained.
If the mathematical model is a probabilistic model, e.g., a Bayesian network model, based at least in part on conditional probabilities relating the TGF-β TF element and expression levels of the one or more target gene(s) of the TGF-β cellular signaling pathway measured in the sample of the subject, the training may, for example, be performed as described in detail in the published international patent application WO 2013/011479 A2 (“Assessment of cellular signaling pathway activity using probabilistic modeling of target gene expression”).
If the mathematical model is based at least in part on one or more linear combination(s) of expression levels of the one or more target gene(s) of the TGF-β cellular signaling pathway measured in the sample of the subject, the training may, for example, be performed as described in detail in the published international patent application WO 2014/102668 A2 (“Assessment of cellular signaling pathway activity using linear combination(s) of target gene expressions”).
Herein, an exemplary Bayesian network model as shown in FIG. 2 was used to model the transcriptional program of the TGF-β cellular signaling pathway in a simple manner. The model consists of three types of nodes: (a) a transcription factor (TF) element (with states “absent” and “present”) in a first layer 1; (b) target gene(s) TG1, TG2, TGn (with states “down” and “up”) in a second layer 2, and; (c) measurement nodes linked to the expression levels of the target gene(s) in a third layer 3. These can be microarray probesets PS1,1, PS1,2, PS1,3, PS2,1, PSn,1, PS n,m (with states “low” and “high”), as exemplified herein, but could also be other gene expression measurements such as RNAseq or RT-qPCR.
A suitable implementation of the mathematical model, herein, the exemplary Bayesian network model, is based on microarray data. The model describes (i) how the expression levels of the target gene(s) depend on the activation of the TF element, and (ii) how probeset intensities, in turn, depend on the expression levels of the respective target gene(s). For the latter, probeset intensities may be taken from fRMA pre-processed Affymetrix HG-U133Plus2.0 microarrays, which are widely available from the Gene Expression Omnibus (GEO, www.ncbi.nlm.nih.gov/geo) and ArrayExpress (www.ebi.ac.uk/arrayexpress).
As the exemplary Bayesian network model is a simplification of the biology of a cellular signaling pathway, herein, the TGF-β cellular signaling pathway, and as biological measurements are typically noisy, a probabilistic approach was opted for, i.e., the relationships between (i) the TF element and the target gene(s), and (ii) the target gene(s) and their respective probesets, are described in probabilistic terms. Furthermore, it was assumed that the activity of the oncogenic cellular signaling pathway which drives tumor growth is not transiently and dynamically altered, but long term or even irreversibly altered. Therefore the exemplary Bayesian network model was developed for interpretation of a static cellular condition. For this reason complex dynamic cellular signaling pathway features were not incorporated into the model.
Once the exemplary Bayesian network model is built and calibrated (see below), the model can be used on microarray data of a new sample by entering the probeset measurements as observations in the third layer 3, and mathematically inferring backwards in the model what the probability must have been for the TF element to be “present”. Here, “present” is considered to be the phenomenon that the TF element is bound to the DNA and is controlling transcription of the cellular signaling pathway's target genes, and “absent” the case that the TF element is not controlling transcription. This probability is hence the primary read-out that may be used to indicate activity of the cellular signaling pathway, herein, the TGF-β cellular signaling pathway, which can next be translated into the odds of the cellular signaling pathway being active by taking the ratio of the probability of it being active vs. it being passive (i.e., the odds are given by p/(1−p), where p is the predicted probability of the cellular signaling pathway being active).
In the exemplary Bayesian network model, the probabilistic relations have been made quantitative to allow for a quantitative probabilistic reasoning. In order to improve the generalization behavior across tissue types, the parameters describing the probabilistic relationships between (i) the TF element and the target gene(s) have been carefully hand-picked. If the TF element is “absent”, it is most likely that the target gene is “down”, hence a probability of 0.95 is chosen for this, and a probability of 0.05 is chosen for the target gene being “up”. The latter (non-zero) probability is to account for the (rare) possibility that the target gene is regulated by other factors or that it is accidentally observed as being “up” (e.g. because of measurement noise). If the TF element is “present”, then with a probability of 0.70 the target gene is considered “up”, and with a probability of 0.30 the target gene is considered “down”. The latter values are chosen this way, because there can be several causes why a target gene is not highly expressed even though the TF element is present, e.g., because the gene's promoter region is methylated. In the case that a target gene is not up-regulated by the TF element, but down-regulated, the probabilities are chosen in a similar way, but reflecting the down-regulation upon presence of the TF element. The parameters describing the relationships between (ii) the target gene(s) and their respective probesets have been calibrated on experimental data. For the latter, in this example, microarray data was used from patients samples which are known to have an active TGF-β cellular signaling pathway whereas normal, healthy samples from the same dataset were used as passive TGF-β cellular signaling pathway samples, but this could also be performed using cell line experiments or other patient samples with known cellular signaling pathway activity status. The resulting conditional probability tables are given by:
A: for upregulated target genes
| PSi,j = low | PSi,j = high | |
| TGi = down | AL i , j + 1 AL i , j + AH i , j + 2 | AH i , j + 1 AL i , j + AH i , j + 2 |
| TGi = up | PL i , j + 1 PL i , j + PH i , j + 2 | PH i , j + 1 PL i , j + PH i , j + 2 |
B: for downregulated target genes
| PSi,j = low | PSi,j = high | |
| TGi = down | PL i , j + 1 PL i , j + PH i , j + 2 | PH i , j + 1 PL i , j + PH i , j + 2 |
| TGi = up | AL i , j + 1 AL i , j + AH i , j + 2 | AH i , j + 1 AL i , j + AH i , j + 2 |
In these tables, the variables ALi,j, AHi,j, PLi,j, and PHi,j indicate the number of calibration samples with an “absent” (A) or “present” (P) transcription complex that have a “low” (L) or “high” (H) probeset intensity, respectively. Dummy counts have been added to avoid extreme probabilities of 0 and 1.
To discretize the observed probeset intensities, for each probeset PSi,j a threshold ti,j was used, below which the observation is called “low”, and above which it is called “high”. This threshold has been chosen to be the (weighted) median intensity of the probeset in the used calibration dataset. Due to the noisiness of microarray data, a fuzzy method was used when comparing an observed probeset intensity to its threshold, by assuming a normal distribution with a standard deviation of 0.25 (on a log 2 scale) around the reported intensity, and determining the probability mass below and above the threshold.
If instead of the exemplary Bayesian network described above, a (pseudo-)linear model as described in Example 1 above was employed, the weights indicating the sign and magnitude of the correlation between the nodes and a threshold to call whether a node is either “absent” or “present” would need to be determined before the model could be used to infer cellular signaling pathway activity in a test sample. One could use expert knowledge to fill in the weights and the threshold a priori, but typically the model would be trained using a representative set of training samples, of which, for example, the ground truth is known, e.g., expression data of probesets in samples with a known “present” transcription factor complex (=active cellular signaling pathway) or “absent” transcription factor complex (=passive cellular signaling pathway).
Known in the field are a multitude of training algorithms (e.g., regression) that take into account the model topology and changes the model parameters, here, the weights and the threshold, such that the model output, here, a weighted linear score, is optimized. Alternatively, it is also possible to calculate the weights directly from the expression observed levels without the need of an optimization algorithm.
A first method, named “black and white”-method herein, boils down to a ternary system, in which each weight is an element of the set {−1, 0, 1}. If this is put in a biological context, the −1 and 1 correspond to target genes or probesets that are down- and up-regulated in case of cellular signaling pathway activity, respectively. In case a probeset or target gene cannot be statistically proven to be either up- or down-regulated, it receives a weight of 0. In one example, a left-sided and right-sided, two sample t-test of the expression levels of the active cellular signaling pathway samples versus the expression levels of the samples with a passive cellular signaling pathway can be used to determine whether a probe or gene is up- or down-regulated given the used training data. In cases where the average of the active samples is statistically larger than the passive samples, i.e., the p-value is below a certain threshold, e.g., 0.3, the target gene or probeset is determined to be up-regulated. Conversely, in cases where the average of the active samples is statistically lower than the passive samples, the target gene or probeset is determined to be down-regulated upon activation of the cellular signaling pathway. In case the lowest p-value (left- or right-sided) exceeds the aforementioned threshold, the weight of the target gene or probeset can be defined to be 0.
A second method, named “log odds”-weights herein, is based on the logarithm (e.g., base e) of the odds ratio. The odds ratio for each target gene or probeset is calculated based on the number of positive and negative training samples for which the probeset/target gene level is above and below a corresponding threshold, e.g., the (weighted) median of all training samples. A pseudo-count can be added to circumvent divisions by zero. A further refinement is to count the samples above/below the threshold in a somewhat more probabilistic manner, by assuming that the probeset/target gene levels are e.g. normally distributed around its observed value with a certain specified standard deviation (e.g., 0.25 on a 2-log scale), and counting the probability mass above and below the threshold. Herein, an odds ratio calculated in combination with a pseudo-count and using probability masses instead of deterministic measurement values is called a “soft” odds ratio.
Further details regarding the determining of cellular signaling pathway activity using mathematical modeling of target gene expression can be found in Verhaegh W. et al., “Selection of personalized patient therapy through the use of knowledge-based computational models that identify tumor-driving signal transduction pathways”, Cancer Research, Vol. 74, No. 11, 2014, pages 2936 to 2945.
Herein, expression data of human A549 lung adenocarcinoma cell line samples that were either treated with 5 ng/mL TGF-β, resulting in an tumor promoting activity of the TGF-β cellular signaling pathway (from now on referred to as TGF-β active), and a control experiment without TGF-β stimulation, resulting in a tumor suppressing activity of the TGF-β cellular signaling pathway (from now on referred to as TGF-β passive), was used for calibration. These microarrays are publically available under GSE17708 from the gene expression omnibus (GEO, www.ncbi.nlm.nih.gov/geo/, last accessed Mar. 5, 2014). The samples stimulated with 5 ng/mL TGF-β for 4 hours were chosen as representatives of the active or tumor promoting TGF-β cell lines based on the observed fold change of the selected genes (Table 4) compared to the unstimulated samples that were chosen as the passive or tumor suppressing TGF-β samples for training. Alternatively, one can use patient samples of primary cells or other cell lines stimulated with and deprived of TGF-β, e.g. GSE6653, GSE42373 and GSE18670.
FIGS. 9 to 12 show training results of the exemplary Bayesian network model based on the list of evidence curated target genes, the 20 target genes shortlist, the 12 target genes shortlist and the 7 target genes shortlist of the TGF-β cellular signaling pathway (see Tables 4 to 7), respectively. In the diagrams, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the TGF-β cellular signaling pathway being active resp. passive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/passive are larger than the odds that it is “present”/active. The A549 cell line samples that were stimulated with TGF-β for 4 hours (group 5) were used to represent the active or tumor promoting training samples, whereas the unstimulated samples (group 1) were used as a representation of the passive or tumor suppressing TGF-β cellular signaling pathway. The models using the different target gene lists were able to clearly separate the passive from the active training samples. In addition, one can appreciate from the results that all stimulation of 1 hour or longer resulted in the TGF-β cellular signaling pathway having tumor promoting activities for all four target gene lists. Stimulation of 0.5 h with TGF-β resulted in TGF-β activities varying from TGF-β passive to active, which is likely caused by the relatively short TGF-β stimulation. (Legend. 1—Control, 2—TGF-β stimulation with 5 ng/mL for 0.5 h; 3—TGF-β stimulation with 5 ng/mL for 1 h; 4—TGF-β stimulation with 5 ng/mL for 2 h; 5—TGF-β stimulation with 5 ng/mL for 4 h; 6—TGF-β stimulation with 5 ng/mL for 8 h; 7—TGF-β stimulation with 5 ng/mL for 16 h; 8—TGF-β stimulation with 5 ng/mL for 24 h; 9—TGF-β stimulation with 5 ng/mL for 72 h)
In the following, validation results of the trained exemplary Bayesian network model using the evidence curated list of target genes, the 20 target genes shortlist, the 12 target genes shortlist, and the 7 target genes shortlist, respectively, are shown in FIGS. 13 to 23.
FIGS. 13 to 16 show TGF-β cellular signaling pathway activity predictions of the trained exemplary Bayesian network models using the evidence curated list of target genes, the 20 target genes shortlist, the 12 target genes shortlist, and the 7 target genes shortlist (see Tables 4 to 7), respectively, for human mammary epithelial cells (HMEC-TR) from GSE28448. In the diagrams, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the TGF-β cellular signaling pathway being active resp. passive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/passive are larger than the odds that it is “present”/active. Each bar represents a sample from the dataset. Some of the samples were transfected with siRNA for TIFγ (groups 5 and 6) or SMAD4 (groups 3 and 4) and another set of samples consisted of controls (no transfection, groups 1 and 2). Samples in groups 2, 4 and 6 were stimulated with 5 ng/mL TGF-β, and those in groups 1, 3 and 5 were not stimulated. The models using the different target gene lists all correctly predicted for all four target gene lists an increased TGF-β activity in the TGF-β-stimulated samples in groups 2 (controls) and 6 (TIFγ-silenced) and no significant increase in the SMAD-silenced samples (group 4) compared to the corresponding unstimulated samples (see Hesling C. et al., “Antagonistic regulation of EMT by TIF1γ and SMAD4 in mammary epithelial cells”, EMBO Reports, Vol. 12, No. 7, 2011, pages 665 to 672). (Legend: 1—Control, no TGF-β; 2—Control, TGF-β; 3—siRNA SMAD4, no TGF-β; 4—siRNA SMAD4, TGF-β; 5—siRNA TIFγ, no TGF-β; 6—siRNA TIFγ, TGF-β)
FIG. 17 shows TGF-β cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 4) for ectocervival epithelial cells (Ect1) from GSE35830, which were stimulated with seminal plasma or 5 ng/mL TGF-β3. In the diagram, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the TGF-β cellular signaling pathway being active resp. passive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/passive are larger than the odds that it is “present”/active. Each bar represents a sample from the dataset. Seminal plasma also contains high levels of TGF-β1, TGF-β2 and TGF-β3. However, they are predominantly (between 95% and 99%) present in the latent variant, as opposed to the active form (see Sharkey D. J. et al., “TGF-βeta mediates proinflammatory seminal fluid signaling in human cervical epithelial cells”, Journal of Immunology, Vol. 189, No. 2, 2012, pages 1024 to 1035). The third and the fourth, i.e., two out of the four, TGF-β3 stimulated samples (group 3) show a strong preference for tumor promoting TGF-β activity, the other two samples, i.e., first and second samples, were found to be more similar to the third and fourth sample of the seminal fluid group (group 2) with cluster analysis. The unstimulated samples (group 1) correctly predicts a passive or tumor suppressing TGF-β activity, whereas the samples stimulated with seminal plasma were predicted to have a TGF-β activity in between which can be caused by the high fraction of latent (i.e., passive) TGF-β isoforms and thus lower stimulation of the TGF-β pathway. (Legend: 1—Control, no TGF-β; 2—Stimulated with 10% seminal plasma, 3—stimulated with 5 ng/mL TGF-β3)
FIG. 18 shows TGF-β cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 4) for patient gliomas from GSE16011. In the diagram, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the TGF-β cellular signaling pathway being active resp. passive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/passive are larger than the odds that it is “present”/active. Each bar represents a sample from the dataset. It is known from literature that gliomas produce more TGF-β (all isoforms) than normal cells (see Kaminska B. et al., “TGF beta signaling and its role in glioma pathogenesis”, Advances in Experimental Medicine and Biology, Vol. 986, 2013, pages 171 to 187). This is also visible in the predicted TGF-β activities which are negative for all controls (group 3), yet in approximately 15% of the gliomas (groups 1, 2, 4-9) a tumor promoting TGF-β was predicted expectedly due to the increased TGF-β secretion in these tumors. (Legend: 1—Astrocytoma (grade II); 2—Astrocytoma (grade III); 3—Control; 4—Glioblastoma multiforme (grade IV); 5—Oligoastrocytic (grade II); 6—Oligoastrocytic (grade III); 7—Oligodendroglial (grade II); 8—Oligodendroglial (grade III); 9—Pilocytic astrocytoma (grade I))
FIG. 19 shows TGF-β cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 4) for breast cancer samples from GSE21653. In the diagram, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the TGF-β cellular signaling pathway being active resp. passive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/passive are larger than the odds that it is “present”/active. Each bar represents a sample from the dataset. As expected, most breast cancers were predicted to have a passive TGF-β cellular signaling pathway. Also in line with expectations, the highest fraction of TGF-β active or tumor promoting TGF-β activity was found in the basal samples. (Legend. 1—Luminal A; 2—Luminal B; 3—HER2; 4—Basal; 5—Normal-like)
FIG. 20 to 23 show TGF-β cellular signaling pathway activity predictions of the trained exemplary Bayesian network models using the evidence curated list of target genes, the 20 target genes shortlist, the 12 target genes shortlist, and the 7 target genes shortlist (see Tables 4 to 7), respectively, for 2D and 3D cultures of A549 lung adenocarcinoma cell lines from GSE42373, which were stimulated with or without 10 ng/mL TNF and 2 ng/mL TGF-β. In the diagram, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the TGF-β cellular signaling pathway being active resp. passive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/passive are larger than the odds that it is “present”/active. Each bar represents a sample from the dataset. Cieslik et al., “Epigenetic coordination of signaling pathways during the epithelial-mesenchymal transition”, Epigenetics & Chromatin, Vol. 6, No. 1, 2013, demonstrated that in these experiments epithelial-mesenchymal transition (EMT) is efficiently induced in the 3D culture model. This is also demonstrated in the TGF-β cellular signaling pathway activity predictions as both samples from this group (group 4) are the only samples predicted with a tumor promoting TGF-β activity which is known to cause EMT. The control group of the 2D culture without stimulation (group 1) was correctly predicted to have no TGF-β activity, whereas the stimulated 2D culture (group 2) evidently was not able to initiate the TGF-β tumor promoting activity (no EMT), which was also found by Cieslik et al. The unstimulated 3D culture samples (group 3) are also predicted to have a passive TGF-β activity, albeit the odds are very small. (Legend. 1—2D control; 2—2D TGF-β and TNFα; 3—3D control; 4—3D TGF-β and TNFα)
FIG. 24 illustrates overall survival of 284 glioma patients (GSE16011; see also FIG. 18) depicted in a Kaplan-Meier plot. In the diagram, the vertical axis indicates the overall survival as a fraction of the patient group and the horizontal axis indicates time in years. The plot indicates that a tumor-suppressing TGF-β cellular signaling pathway (TGF-β passive, dotted line) is protective for overall survival, whereas having a tumor-promoting TGF-β pathway is associated with significantly higher risk of death (indicated by the steeper slope of the curve). (The patient group with a predicted active TGF-β TF element consisted of 37 patients (solid line), whereas the patient group with a predicted passive TGF-β TF element consisted of 235 patients (dotted line)). The prognostic value of the activity level of the TGF-β TF element is also demonstrated in the hazard ratio of the predicted probability of TGF-β activity: 2.17 (95% CI: 1.44-3.28, p=1.22e−4) and the median survival which is 0.7 years for tumor-promoting TGF-β active patients versus 1.34 years for tumor-suppressing TGF-β patients.
FIG. 25 illustrates disease free survival of a cohort of 1169 breast cancer patients (GSE6532, GSE9195, E-MTAB-365, GSE20685 and GSE21653; see also FIG. 13 above) depicted in a Kaplan-Meier plot. In the diagram, the vertical axis indicates the disease free survival as a fraction of the patient group and the horizontal axis indicates time in months. The plot indicates that a tumor-suppressing TGF-β cellular signaling pathway (TGF-β passive, dotted line) is protective for disease free survival, whereas having a tumor-promoting TGF-β pathway is associated with significantly higher risk of disease recurrence (indicated by the steeper slope of the curve). (The patient group with a predicted active TGF-β TF element consisted of 103 patients (solid line), whereas the patient group with a predicted passive TGF-β TF element consisted of 1066 patients (dotted line)). The prognostic value of the activity level of the TGF-β TF element is also demonstrated in the hazard ratio of the predicted probability of TGF-β activity: 3.66 (95% CI: 2.37-5.33, p=4.0e−10) and the 75% survival which is 2.3 years for tumor-promoting TGF-β active patients versus 6.4 years for tumor-suppressing TGF-β patients.
Instead of applying the mathematical model, e.g., the exemplary Bayesian network model, on mRNA input data coming from microarrays or RNA sequencing, it may be beneficial in clinical applications to develop dedicated assays to perform the sample measurements, for instance on an integrated platform using qPCR to determine mRNA levels of target genes. The RNA/DNA sequences of the disclosed target genes can then be used to determine which primers and probes to select on such a platform.
Validation of such a dedicated assay can be done by using the microarray-based mathematical model as a reference model, and verifying whether the developed assay gives similar results on a set of validation samples. Next to a dedicated assay, this can also be done to build and calibrate similar mathematical models using RNA sequencing data as input measurements.
The set of target genes which are found to best indicate specific cellular signaling pathway activity, e.g., Tables 4 to 7, based on microarray/RNA sequencing based investigation using the mathematical model, e.g., the exemplary Bayesian network model, can be translated into a multiplex quantitative PCR assay to be performed on a sample of the subject and/or a computer to interpret the expression measurements and/or to infer the activity of the TGF-β cellular signaling pathway. To develop such a test (e.g., FDA-approved or a CLIA waived test in a central service lab or a laboratory developed test for research use only) for cellular signaling pathway activity, development of a standardized test kit is required, which needs to be clinically validated in clinical trials to obtain regulatory approval.
The present invention relates to a method comprising determining activity of a TGF-β cellular signaling pathway in a subject based at least on expression levels of one or more target gene(s) of the TGF-β cellular signaling pathway measured in a sample of the subject. The present invention further relates to an apparatus comprising a digital processor configured to perform such a method, a non-transitory storage medium storing instructions that are executable by a digital processing device to perform such a method, and a computer program comprising program code means for causing a digital processing device to perform such a method.
The method may be used, for instance, in diagnosing an (abnormal) activity of the TGF-β cellular signaling pathway, in prognosis based on the determined activity of the TGF-β cellular signaling pathway, in the enrollment of a subject in a clinical trial based on the determined activity of the TGF-β cellular signaling pathway, in the selection of subsequent test(s) to be performed, in the selection of companion diagnostics tests, in clinical decision support systems, or the like. In this regard, reference is made to the published international patent application WO 2013/011479 A2 (“Assessment of cellular signaling pathway activity using probabilistic modeling of target gene expression”), to the published international patent application WO 2014/102668 A2 (“Assessment of cellular signaling pathway activity using linear combination(s) of target gene expressions”), and to Verhaegh W. et al., “Selection of personalized patient therapy through the use of knowledge-based computational models that identify tumor-driving signal transduction pathways”, Cancer Research, Vol. 74, No. 11, 2014, pages 2936 to 2945, which describe these applications in more detail.
The list of target genes of the TGF-β cellular signaling pathway constructed based on literature evidence following the procedure as described herein (“evidence curated list of target genes”, see Table 4) is compared here with a “broad literature list” of putative target genes of the TGF-β cellular signaling pathway constructed not following above mentioned procedure. The alternative list is a compilation of genes attributed to responding to activity of the TGF-β cellular signaling pathway provided within Thomson-Reuters's Metacore (last accessed May 14, 2013). This database was queried for genes that are transcriptionally regulated directly downstream of the family of SMAD proteins, i.e. SMAD1, SMAD2, SMAD3, SMAD4, SMAD5 and/or SMAD8. This query resulted in 217 unique genes. A further selection was made based on the number of publication references supporting the attributed transcriptional regulation of the respective gene by the SMAD family. Genes that had three or more references were selected for the broad literature list. In other words, no manual curation of the references and no calculation of an evidence score based on the experimental evidence was performed. This procedure resulted in 61 genes, of which a micro-RNA (MIR29B2) not available on the Affymetrix HG-U133Plus2.0 microarray platform and one gene (BGLAP) was not found to have a probeset available on the Affymetrix HG-U133Plus2.0 microarray platform according to the Bioconductor plugin of R. Eventually, this lead to 59 putative target genes which are shown in Table 8 with the associated probesets on the Affymetrix HG-U133Plus2.0 microarray platform.
| TABLE 8 |
| ″Broad literature list″ of putative target genes of the TGF-β cellular signaling pathway used |
| in the TGF-β cellular signaling pathway models and associated probesets used to measure |
| the mRNA expression level of the genes. |
| Gene | Probeset | Gene | Probeset | Gene | Probeset |
| ATF3 | 1554420_at | GSC | 1552338_at | PMEPA1 | 217875_s_at |
| 1554980_a_at | HAMP | 220491_at | 222449_at | ||
| 202672_s_at | HEY1 | 218839_at | 222450_at | ||
| CCL2 | 216598_s_at | 44783_s_at | PPARG | 208510_s_at | |
| CDH1 | 201130_s_at | IBSP | 207370_at | PTGS2 | 1554997_a_at |
| 201131_s_at | 236028_at | 204748_at | |||
| CDKN1A | 202284_s_at | ID1 | 208937_s_at | PTHLH | 206300_s_at |
| CDKN2B | 207530_s_at | ID2 | 201565_s_at | 210355_at | |
| 236313_at | 201566_x_at | 211756_at | |||
| COL1A2 | 202403_s_at | ID3 | 207826_s_at | SERPINE1 | 1568765_at |
| 202404_s_at | IL11 | 206924_at | 202627_s_at | ||
| 229218_at | 206926_s_at | 202628_s_at | |||
| COL3A1 | 201852_x_at | IL6 | 205207_at | SKIL | 206675_s_at |
| 211161_s_at | ITGB1 | 1553530_a_at | 215889_at | ||
| 215076_s_at | 1553678_a_at | 217591_at | |||
| 215077_at | 211945_s_at | 225227_at | |||
| 232458_at | 215878_at | 232379_at | |||
| COL7A1 | 204136_at | 215879_at | SLC25A5 | 200657_at | |
| 217312_s_at | 216178_x_at | SMAD6 | 207069_s_at | ||
| CTGF | 209101_at | 216190_x_at | 209886_s_at | ||
| CTNNB1 | 1554411_at | ITGB5 | 201124_at | 209887_at | |
| 201533_at | 201125_s_at | 213565_s_at | |||
| 223679_at | 214020_x_at | SMAD7 | 204790_at | ||
| DLX5 | 213707_s_at | 214021_x_at | SNAI1 | 219480_at | |
| EDN1 | 1564630_at | JUN | 201464_x_at | SNAI2 | 213139_at |
| 218995_s_at | 201465_s_at | SP7 | 1552340_at | ||
| 222802_at | 201466_s_at | SPP1 | 1568574_x_at | ||
| FN1 | 1558199_at | 213281_at | 209875_s_at | ||
| 210495_x_at | JUNB | 201473_at | TAGLN | 1555724_s_at | |
| 211719_x_at | LEFTY2 | 206012_at | 205547_s_at | ||
| 212464_s_at | MIXL1 | 231746_at | 226523_at | ||
| 214701_s_at | MMP13 | 205959_at | TERT | 1555271_a_at | |
| 214702_at | MMP9 | 203936_s_at | 207199_at | ||
| 216442_x_at | MSX2 | 205555_s_at | TGFBR1 | 206943_at | |
| FOXP3 | 221333_at | 205556_at | 224793_s_at | ||
| 221334_s_at | 210319_x_at | 236561_at | |||
| 224211_at | MYC | 202431_s_at | TIMP1 | 201666_at | |
| FSHB | 214489_at | NKX2-5 | 206578_at | VEGFA | 210512_s_at |
| FST | 204948_s_at | NODAL | 220689_at | 210513_s_at | |
| 207345_at | 230916_at | 211527_x_at | |||
| 226847_at | 237896_at | 212171_x_at | |||
| FSTL3 | 203592_s_at | PDGFB | 204200_s_at | VIM | 1555938_x_at |
| GNRHR | 211522_s_at | 216055_at | 201426_s_at | ||
| 211523_at | 216061_x_at | ||||
| 216341_s_at | 217112_at | ||||
Subsequently an exemplary Bayesian network model was constructed using the procedure as explained herein. Similarly to the description of the TGF-β cellular signaling pathway model based on the evidence curated list, the conditional probability tables of the edges between probesets and their respective putative target genes of this model including the broad literature list were trained using fRMA processed data from GSE17708. The training results depicted in FIG. 26 show a clear separation between passive (group 1) and active (group 5) training samples. More extreme values of pathway activity are found, especially in group 2 and 3, compared to the training results of the Bayesian model based on the evidence curated lists (see FIGS. 9 to 12). In the diagram, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the TGF-β cellular signaling pathway being active resp. passive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/passive are larger than the odds that it is “present”/active. Each bar represents a sample from the dataset. (Legend: 1—Control; 2—TGF-β stimulation with 5 ng/mL for 0.5 h; 3—TGF-β stimulation with 5 ng/mL for 1 h; 4—TGF-β stimulation with 5 ng/mL for 2 h; 5—TGF-β stimulation with 5 ng/mL for 4 h; 6—TGF-β stimulation with 5 ng/mL for 8 h; 7—TGF-β stimulation with 5 ng/mL for 16 h; 8—TGF-β stimulation with 5 ng/mL for 24 h; 9—TGF-β stimulation with 5 ng/mL for 72 h).
Next the trained exemplary network Bayesian model based on the broad literature list was tested on a number of datasets.
FIG. 27 shows TGF-β cellular signaling pathway activity predictions of the trained Bayesian network model based on broad literature list for patient gliomas from GSE16011. In the diagram, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the TGF-β cellular signaling pathway being active resp. passive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/passive are larger than the odds that it is “present”/active. Each bar represents a sample from the dataset. Although it is known from the literature that gliomas produce more TGF-β (all isoforms) than normal cells (see Kaminska B. et al., “TGF beta signaling and its role in glioma pathogenesis”, Advances in Experimental Medicine and Biology, Vol. 986, 2013, pages 171 to 187), the large fraction (>50%) of glioblastoma multiforme (grade IV) patients (group 4) is apparently an overestimation of the number of tumors with an active TGF-β cellular signaling pathway. On the other hand, the TGF-β tumor-promoting activity of all controls (group 3) are correctly predicted to be negative. (Legend: 1—Astrocytoma (grade II); 2—Astrocytoma (grade III); 3—Control; 4—Glioblastoma multiforme (grade IV); 5—Oligoastrocytic (grade II); 6—Oligoastrocytic (grade III); 7—Oligodendroglial (grade II); 8—Oligodendroglial (grade III); 9—Pilocytic astrocytoma (grade I))
FIG. 28 shows TGF-β cellular signaling pathway activity predictions of the trained Bayesian network model based on broad literature list for breast cancer samples from GSE21653. In the diagram, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the TGF-β cellular signaling pathway being active resp. passive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/passive are larger than the odds that it is “present”/active. Each bar represented a sample from the dataset. Unexpectedly, most breast cancer samples were predicted to have a tumor-promoting TGF-β cellular signaling pathway. In addition, the highest fraction of patient samples with tumor-promoting TGF-β activity is found in the luminal A subtype. Luminal A is known to have the best prognosis among the different breast cancer subtypes which does not correspond with the aggressiveness of the TGF-β tumor-promoting activity. (Legend: 1—Luminal A; 2—Luminal B; 3—HER2; 4—Basal; 5—Normal-like)
As evidenced by the above example, the selection of unique TGF-β target gene sets in combination with the mathematical models described herein for determining the activity level of TGF-β cellular signaling pathway in a sample produces a more robust, precise, and accurate activity status determination than the use of a broader literature list, despite the fact that the number of target genes is larger. By focusing on the specific target genes identified herein, a useful determination of TGF-β cellular signaling pathway activity is provided that can be further used in treatment or prognostic modalities as described herein.
A revision of the available literature evidence of TGF-β was performed in January 2015, also including all new scientific papers up to 19 Jan. 2015. Similarly, publications were found using the MEDLINE database of the National Institute of Health accessible at “www.ncbi.nlm.nih.gov/pubmed” using queries such as (“TGF-β” AND “target gene”). After manually evaluating the scientific papers for experimental evidence of a number of target genes being a putative target gene of TGF-β using the methodology as described in Example 2 above, a number of putative TGF-β target genes, unexploited in the initial evaluation during the fourth quarter of 2013 and first quarter of 2014, were found. All available experimental evidence was reevaluated and a new ranking of putative target genes was prepared based on the strength of the available experimental evidence for the putative target gene using the methodology as described in Example 2. This resulted in one additional putative TGF-β target gene, SERPINE1, achieving an experimental evidence score above the set threshold. Consequently, SERPINE1 was considered to be a bona fide direct target gene of the TGF-β pathway and tested for improved TGF-β pathway activity level calculations.
Using two Bayesian networks based on the 11 highest ranked target genes: ANGPTL4, CDC42EP3, CDKN1A, CTGF, GADD45B, ID1, JUNB, SKIL, SMAD7, SNAI2 and VEGFA plus or minus the newly selected SERPINE1 trained using the same data and methodology as described in Example 3 above, resulting in a ‘11-gene list+SERPINE1’ and a ‘11-gene list’ model, respectively.
| TABLE 9 |
| “11-gene list + SERPINE1” (or “revised 12 target genes shortlist” list |
| of target genes of the TGF-β cellular signaling pathway includes: |
| ANGPTL4 |
| CDC42EP3 |
| CDKN1A |
| CTGF |
| GADD45B |
| ID1 |
| JUNB |
| SERPINE1 |
| SKIL |
| SMAD7 |
| SNAI2 |
| VEGFA |
| TABLE 10 |
| “11-gene list” of target genes of the TGF-β cellular signaling |
| pathway includes: |
| ANGPTL4 |
| CDC42EP3 |
| CDKN1A |
| CTGF |
| GADD45B |
| ID1 |
| JUNB |
| SKIL |
| SMAD7 |
| SNAI2 |
| VEGFA |
Based on the additional inclusion of the SERPINE1 gene, the target gene lists (See Tables 5 and 7) can be revised into additional non-limiting embodiments, as described in Tables 11 and 12.
| TABLE 11 |
| The ″revised 20 target genes shortlist″ of target genes of the TGF-β |
| cellular signaling pathway includes: |
| ANGPTL4 |
| CDC42EP3 |
| CDKN1A |
| CTGF |
| GADD45A |
| GADD45B |
| HMGA2 |
| ID1 |
| JUNB |
| PDGFB |
| PTHLH |
| SERPINE1 |
| SGK1 |
| SKIL |
| SMAD4 |
| SMAD5 |
| SMAD6 |
| SMAD7 |
| SNAI2 |
| VEGFA |
| TABLE 12 |
| The ″revised 7 target genes shortlist″ of target genes of the TGF-β |
| cellular signaling pathway includes: |
| ANGPTL4 |
| CDC42EP3 |
| ID1 |
| JUNB |
| SERPINE1 |
| SKIL |
| SMAD7 |
Including one more target gene in the mathematical calculation of the pathway activity is expected to have a small effect on the predictions of the pathway activity, which is anticipated to scale the pathway activity level minutely. In the examples below, it is shown that in addition to this anticipated effect there are also markedly different pathway activity levels in several examples which can only be explained by SERPINE1 having an unexpected, advantageous effect on the pathway activity calculations.
FIGS. 29 and 30 show the predictions of TGF-β activity using both models in Ect1 cell lines stimulated with seminal plasma or 5 ng/mL TGF-β3 or without stimulation from GSE35830. It is clearly visible that including SERPINE1 as an additional target gene improves the capability of the model to detect passive samples with higher accuracy. Furthermore, the model predictions of the second group stimulated with seminal plasma and the third group stimulated with TGF-β3 are more accurate as they predict a higher activity of the TGF-β pathway.
A second example of improved TGF-β pathway activity predictions is found in A549 lung adenocarcinoma cell line samples grown in 2D and 3D cultures stimulated with or without TNF and TGF-β. The model predictions using both the ‘11-gene’ Bayesian network model and the ‘11-gene list+SERPINE1’ are shown in FIGS. 31 and 32. EMT was only efficiently induced in the 3D culture model with stimulation (group 4). This induction of EMT is diagnosed with a higher accuracy in the ‘11-gene list+SERPINE1’ model compared to the ‘11-gene list’ model, also in case the relative difference between groups 3 and 4 is considered.
A third example is the TGF-β pathway activity predictions using both models in glioma patients and some control samples from GSE16011. It is known from literature that TGF-β signaling plays a significant role in gliomas (see Kaminska B. et al., “TGF beta signaling and its role in glioma pathogenesis”, Advances in Experimental Medicine and Biology, Vol. 986, 2013, pages 171 to 187). The Bayesian network based on ‘11-gene list+SERPINE1’ improves the separation of passive from active samples compared to the ‘11-gene list’ Bayesian network. In addition, a higher fraction of patients is predicted to have an active TGF-β pathway which is more in line with scientific consensus (see e.g. Kaminska et al.). Moreover, the normal brain samples are predicted to have a passive TGF-β with higher probabilities, which is in agreement with the fact that the TGF-β signaling pathway is expected to be in its tumor-suppressive role or passive role.
The last example demonstrating the improved TGF-β pathway activity predictions by including SERPINE1 in the pathway model is shown by comparing the results of Cox's regression analysis of the 284 glioma patients from GSE16011 using the Bayesian network model based on the ‘11-gene list+SERPINE1’ and ‘11-gene list’. As shown in FIGS. 33 and 34, the hazard ratio of the probability of TGF-β activity is significantly higher in case the ‘11-gene list+SERPINE1’ is used: 2.57, p=7.87e−10 vs 2.33, p=3.06e−7.
This specification has been described with reference to embodiments, which are illustrated by the accompanying Examples. The invention can, however, be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Given the teaching herein, one of ordinary skill in the art will be able to modify the invention for a desired purpose and such variations are considered within the scope of the disclosure.
| Sequence Listing: |
| Seq. No. | Gene: | |
| Seq. 1 | ANGPTL4 | |
| Seq. 2 | ATF3 | |
| Seq. 3 | CCL2 | |
| Seq. 4 | CDC42EP3 | |
| Seq. 5 | CDH1 | |
| Seq. 6 | CDKN1A | |
| Seq. 7 | CDKN2B | |
| Seq. 8 | COL1A2 | |
| Seq. 9 | COL3A1 | |
| Seq. 10 | COL7A1 | |
| Seq. 11 | CTGF | |
| Seq. 12 | CTNNB1 | |
| Seq. 13 | DLX5 | |
| Seq. 14 | EDN1 | |
| Seq. 15 | FN1 | |
| Seq. 16 | FOXP3 | |
| Seq. 17 | FSHB | |
| Seq. 18 | FST | |
| Seq. 19 | FSTL3 | |
| Seq. 20 | GADD45A | |
| Seq. 21 | GADD45B | |
| Seq. 22 | GNRHR | |
| Seq. 23 | GSC | |
| Seq. 24 | HAMP | |
| Seq. 25 | HEY1 | |
| Seq. 26 | HMGA2 | |
| Seq. 27 | IBSP | |
| Seq. 28 | ID1 | |
| Seq. 29 | ID2 | |
| Seq. 30 | ID3 | |
| Seq. 31 | IL11 | |
| Seq. 32 | IL6 | |
| Seq. 33 | INPP5D | |
| Seq. 34 | ITGB1 | |
| Seq. 35 | ITGB5 | |
| Seq. 36 | JUN | |
| Seq. 37 | JUNB | |
| Seq. 38 | LEFTY2 | |
| Seq. 39 | MIXL1 | |
| Seq. 40 | MMP13 | |
| Seq. 41 | MMP2 | |
| Seq. 42 | MMP9 | |
| Seq. 43 | MSX2 | |
| Seq. 44 | MYC | |
| Seq. 45 | NKX2-5 | |
| Seq. 46 | NODAL | |
| Seq. 47 | OVOL1 | |
| Seq. 48 | PDGFB | |
| Seq. 49 | PMEPA1 | |
| Seq. 50 | PPARG | |
| Seq. 51 | PTGS2 | |
| Seq. 52 | PTHLH | |
| Seq. 53 | SERPINE1 | |
| Seq. 54 | SGK1 | |
| Seq. 55 | SKIL | |
| Seq. 56 | SLC25A5 | |
| Seq. 57 | SMAD4 | |
| Seq. 58 | SMAD5 | |
| Seq. 59 | SMAD6 | |
| Seq. 60 | SMAD7 | |
| Seq. 61 | SNAI1 | |
| Seq. 62 | SNAI2 | |
| Seq. 63 | SP7 | |
| Seq. 64 | SPP1 | |
| Seq. 65 | TAGLN | |
| Seq. 66 | TERT | |
| Seq. 67 | TGFBR1 | |
| Seq. 68 | TIMP1 | |
| Seq. 69 | VEGFA | |
| Seq. 70 | VIM | |
| Seq. 71 | SERPINE1 | |
1. A method of treating a subject suffering from a disease associated with an activated TGF-β cellular signaling pathway comprising:
a. receiving information regarding the activity level of a TGF-β cellular signaling pathway derived from a sample isolated from the subject, wherein the activity level of the TGF-β cellular signaling pathway is determined by:
i. calculating an activity level of TGF-β transcription factor element in a sample isolated from the subject, wherein the level of the TGF-β transcription factor element in the sample is calculated by:
1. receiving data on the expression levels of at least three target genes derived from the sample, wherein the TGF-β transcription factor element controls transcription of the at least three target genes, and wherein the at least three target genes are selected from CDC42EP3, ANGPTL4, ID1, IL11, SERPINE1, JUNB, SKIL, and SMAD7;
2. calculating the level of the TGF-β transcription factor element in the sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the model which define an activity level of TGF-β transcription factor element; and,
ii. calculating the activity level of the TGF-β cellular signaling pathway in the sample based on the calculated TGF-β transcription factor element level in the sample; and,
b. administering to the subject a TGF-β inhibitor if the information regarding the activity level of the TGF-β cellular signaling pathway is indicative of an active TGF-β cellular signaling pathway.
2. The method of claim 1, wherein the at least three target genes are ANGPTL4, CDC42EP3, and at least one of ID1, IL11, SERPINE1, JUNB, SKIL, or SMAD7.
3. The method of claim 1, wherein data on the expression levels of the target genes ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, and SMAD7 is received
4. The method of claim 3 wherein data on the expression levels of the additional target genes CDKN1A, CTGF, GADD45B, VEGFA, and SNAI2 is received.
5. The method of claim 1, wherein the calibrated pathway model is a probabilistic model incorporating conditional probabilistic relationships that compare the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the model which define a level of TGF-β transcription factor element to determine the activity level of the TGF-β transcription factor element in the sample.
6. The method of claim 1, wherein the calibrated pathway model is a linear model incorporating relationships that compare the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the model which define a level of TGF-β transcription factor element to determine the activity level of the TGF-β transcription factor element in the human cancer sample.
7. The method of claim 1, wherein the TGF-β inhibitor is Terameprocol, Fresolimumab, Sotatercept, Galunisertib, SB431542, LY2109761, LDN-193189, SB525334, SB505124, GW788388, LY364947, RepSox, LDN-193189 HCl, K02288, LDN-214117, SD-208, EW-7197, ML347, LDN-212854, DMH1, Pirfenidone, Hesperetin, Trabedersen, Lerdelimumab, Metelimumab, trx-SARA, ID11, Ki26894, or SB-431542.
8. The method of claim 1, wherein the disease is a cancer.
9. The method of claim 8, wherein the cancer is colon, breast, prostate, pancreatic, lung, brain, leukemia, lymphoma, or glioma.
10. The method of claim 9, wherein the cancer is breast cancer.
11. A kit for measuring expression levels of TGF-β cellular signaling pathway target genes comprising:
a. a set of polymerase chain reaction primers directed to at least six TGF-β cellular signaling pathway target genes from a sample isolated from a subject; and
b. a set of probes directed to the at least six TGF-β cellular signaling pathway target genes;
wherein the at least six TGF-β cellular signaling pathway target genes are selected from CDC42EP3, ANGPTL4, ID1, SERPINE1, JUNB, SKIL, and SMAD7.
12. The kit of claim 11, wherein the at least six target genes are ANGPTL4, CDC42EP3, and at least four of ID1, IL11, SERPINE1, JUNB, SKIL, or SMAD7.
13. The kit of claim 11, wherein the target genes are ANGPTL4, CDC42EP3, ID1, SERPINE1, JUNB, SKIL, and SMAD7.
14. The kit of claim 13, wherein the kit includes additional sets of primers and probes directed to target genes CDKN1A, CTGF, GADD45B, VEGFA, and SNAI2.
15. The kit of claim 11, wherein the probes are labeled.
16. The kit of claim 14, wherein the set of probes are SEQ. ID. NOS. 74, 77, 80, 83, 86, 89, 92, 95, 98, 101, 104, and 107.
17. The kit of claim 14, wherein the set of primers are SEQ. ID. NOS. 72 and 73, 75 and 76, 78 and 79, 81 and 82, 84 and 85, 87 and 88, 90 and 91, 93 and 94, 96 and 97, 99 and 100, 102 and 103, and 105 and 106.
18. The kit of claim 11, further comprising a computer program product for determining the activity level of a TGF-β cellular signaling pathway in the subject comprising
a. a non-transitory computer readable storage medium having computer readable program code embodied therewith, the computer readable program code executable by at least one processor to:
i. calculate a level of TGF-β transcription factor element in the sample, wherein the level of TGF-β transcription factor element in the sample is associated with TGF-β cellular signaling, and wherein the level of the TGF-β transcription factor element in the sample is calculated by:
1. receiving data on the expression levels of the at least six target genes derived from the sample;
2. calculating the level of the TGF-β transcription factor element in the sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the at least six target genes in the sample with expression levels of the at least six target genes in the model which define an activity level of the TGF-β transcription factor element; and,
ii. calculate the activity level of the TGF-β cellular signaling pathway in the sample based on the calculated TGF-β transcription factor element level in the sample.