Patent application title:

GENETIC POLYMORPHISMS ASSOCIATED WITH STROKE, METHODS OF DETECTION AND USES THEREOF

Publication number:

US20180312923A1

Publication date:
Application number:

15/790,581

Filed date:

2017-10-23

Abstract:

The present invention provides compositions and methods based on genetic polymorphisms that are associated with vascular diseases such as stroke. In particular, the present invention relates to genetic polymorphisms that have utility for such uses as predicting disease risk or predicting an individual's response to a treatment such as statins, including groups of polymorphisms that may be used as a signature marker set for such uses, as well as nucleic acid molecules containing the polymorphisms, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods of using the nucleic acid and proteins as well as methods of using reagents for their detection.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q2600/172 »  CPC further

Oligonucleotides characterized by their use Haplotypes

C12Q2600/118 »  CPC further

Oligonucleotides characterized by their use Prognosis of disease development

C12Q2600/156 »  CPC further

Oligonucleotides characterized by their use Polymorphic or mutational markers

C12Q1/6883 »  CPC main

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material

A61K31/22 »  CPC further

Medicinal preparations containing organic active ingredients; Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin

A61K31/35 »  CPC further

Medicinal preparations containing organic active ingredients; Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom

A61K31/435 »  CPC further

Medicinal preparations containing organic active ingredients; Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom

A61K31/404 »  CPC further

Medicinal preparations containing organic active ingredients; Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole Indoles, e.g. pindolol

A61K31/40 »  CPC further

Medicinal preparations containing organic active ingredients; Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a continuation application of U.S. non-provisional application Ser. No. 14/886,595, filed on Oct. 19, 2015, which is a continuation of U.S. non-provisional application Ser. No. 13/655,905, filed on Oct. 19, 2012, which is a continuation application of U.S. non-provisional application Ser. No. 12/389,313, filed on Feb. 19, 2009, which claims priority to U.S. provisional application Ser. No. 61/066,584, filed on Feb. 20, 2008, the contents of each of which are hereby incorporated by reference in their entirety into this application.

FIELD OF THE INVENTION

The present invention is in the field of vascular disease, particularly stroke, and drug response, particularly response to statin treatment. In particular, the present invention relates to specific single nucleotide polymorphisms (SNPs) in the human genome, and their association with vascular disease, including but not limited to cerebrovascular diseases such as stroke, and/or variability in responsiveness to statin treatment (including preventive treatment) between different individuals. The SNPs disclosed herein can be used, for example, as targets for diagnostic/prognostic reagents as well as for therapeutic agents. In particular, the SNPs of the present invention are useful for identifying an individual who is at an increased or decreased risk of having a stroke, for early detection of stroke risk, for providing clinically important information for the prevention and/or treatment of stroke, for predicting the seriousness or consequences of stroke in an individual, for determining the prognosis of an individual's recovery from stroke, for screening and selecting therapeutic agents, and for predicting a patient's response to therapeutic agents such as evaluating the likelihood of an individual responding positively to statins, particularly for the treatment or prevention of stroke. The SNPs disclosed herein are also useful for human identification applications. Methods, assays, kits, and reagents for detecting the presence of these polymorphisms and their encoded products are provided.

BACKGROUND OF THE INVENTION

Stroke and Other Vascular Diseases

Vascular diseases encompass a number of related pathologies including cerebrovascular diseases such as stroke, as well as carotid artery disease, coronary artery disease, peripheral artery disease, aortic aneurysm, and vascular dementia.

Stroke is a prevalent and serious cerebrovascular disease. It affects 4.7 million individuals in the United States, with 500,000 first attacks and 200,000 recurrent cases yearly. Approximately one in four men and one in five women aged 45 years will have a stroke if they live to their 85th year. About 25% of those who have a stroke die within a year. In fact, stroke is the third leading cause of mortality in the United States and is responsible for 170,000 deaths a year. Among those who survive a stroke attack, 30 to 50% do not regain functional independence. Stroke therefore is the most common cause of disability and the second leading cause of dementia (Heart Disease and Stroke Statistics—2004 Update, American Heart Association).

Stroke occurs when an artery bringing oxygen and nutrients to the brain either ruptures, causing hemorrhagic stroke, or gets occluded, causing ischemic stroke. Ischemic stroke can be caused by thrombi formation at the site of an atherosclerotic plaque rupture (this type of ischemic stroke is interchangeably referred to as thrombotic or atherothrombotic stroke) or by emboli (clots) that have travelled from another part of the vasculature (this type of ischemic stroke is referred to as embolic stroke), often from the heart (this type of embolic stroke may be referred to as cardioembolic stroke). In both ischemic and hemorrhagic stroke, a cascade of cellular changes due to ischemia or increased cranial pressure leads to injuries or death of the brain cells. In the United States, the majority (about 80-90%) of stroke cases are ischemic (Rathore, et al., Stroke 33:2718-2721 ((2002)), including 30% large-vessel thrombotic (also referred to as large-vessel occlusive disease), 20% small-vessel thrombotic (also referred to as small-vessel occlusive disease), and 30% embolic or cardiogenic (caused by a clot originating from elsewhere in the body, e.g., from blood pooling due to atrial fibrillation, or from carotid artery stenosis). The ischemic form of stroke results from obstruction of blood flow in cerebral blood vessels, and it shares common pathological etiology with atherosclerosis and thrombosis.

About 10-20% of stroke cases are of the hemorrhagic type (Rathore, et al., Stroke 33:2718-2721 ((2002)), involving bleeding within or around the brain. Bleeding within the brain is known as cerebral hemorrhage, which is often linked to high blood pressure. Bleeding into the meninges surrounding the brain is known as a subarachnoid hemorrhage, which could be caused by a ruptured cerebral aneurysm, an arteriovenous malformation, or a head injury. The hemorrhagic stroke, although less prevalent, poses a greater danger. Whereas about 8% of ischemic stroke cases result in death within 30 days, about 38% of hemorrhagic stroke cases result in death within the same time period (Collins, et al., J. Clin. Epidemiol. 56:81-87 (2003)).

Known risk factors for stroke can be divided into modifiable and non-modifiable risk factors. Older age, male sex, black or Hispanic ethnicity, and family history of stroke are non-modifiable risk factors. Modifiable risk factors include hypertension, smoking, increased insulin levels, asymptomatic carotid disease, cardiac vessel disease, and hyperlipidemia.

Multiple reports based on twin studies (Brass et al., Stroke. 1992; 23:221-223 and Bak et al., Stroke. 2002; 33:769-774) and family studies (Welin L, et al. N Engl J Med. 1987; 317:521-526 and Jousilahti et al., Stroke. 1997; 28:1361-136) have shown that genetics contributes to risk of stroke independently of traditional risk factors. A number of genetic markers have been reported to be associated with stroke and some examples of stroke-related markers include MTHFR, ACE, NOTCH3, IL-6, PON1, fibrinogen-beta, and lipoprotein lipase (Casas, et al., Arch. Neural., 61:1652-1661 (2004)).

The acute nature of stroke leaves physicians with little time to prevent or lessen the devastation of brain damage. Strategies to diminish the impact of stroke include prevention and treatment with thrombolytic and, possibly, neuroprotective agents. The success of preventive measures will depend on the identification of risk factors in individual patients and means to modulate their impact.

Although some risk factors for stroke are not modifiable, such as age and family history, other underlying pathology or risk factors of stroke such as atherosclerosis, hypertension, smoking, diabetes, aneurysm, and atrial fibrillation, are chronic and amenable to effective life-style changes, pharmacological, and interventional as well as surgical treatments. Early recognition of patients with informative risk factors, and especially those with a family history, using a non-invasive test of genetic markers associated with stroke will enable physicians to target the highest risk individuals for aggressive risk reduction.

Thus, there is a need for the identification of new genetic markers that are predictive of an individual's predisposition to the development of stroke and other vascular diseases. Furthermore, the discovery of genetic markers which are useful in identifying individuals who are at an increased risk of having a stroke may lead to, for example, better preventive and therapeutic strategies, economic models, and health care policy decisions.

Reduction of coronary and cerebrovascular events and total mortality by treatment with HMG-CoA reductase inhibitors (statins) has been demonstrated in a number of randomized, double blinded, placebo-controlled prospective trials (Waters, D. D., Clin Cardiol, 2001. 24(8 Suppl): p. III3-7, Singh, B. K. and J. L. Mehta, Curr Opin Cardiol, 2002. 17(5): p. 503-11). These drugs have their primary effect through the inhibition of hepatic cholesterol synthesis, thereby upregulating LDL receptors in the liver. The resultant increase in LDL catabolism results in decreased circulating LDL, a major risk factor for vascular disease.

In addition to LDL-lowering, a variety of potential non-lipid lowering effects have been suggested to play a role in cardiovascular risk reduction by statins. These include anti-inflammatory effects on various vascular cell types including foam cell macrophages, improved endothelial responses, inhibition of platelet reactivity thereby decreasing hypercoaguability, and many others (Puddu, P., G. M. Puddu, and A. Muscari, Acta Cardiol, 2001. 56(4): p. 225-31, Albert, M. A., et al., JAMA, 2001. 286(1): p. 64-70, Rosenson, R. S., Curr Cardiol Rep, 1999. 1(3): p. 225-32, Dangas, G., et al., Thromb Haemost, 2000. 83(5): p. 688-92, Crisby, M., Drugs Today (Barc), 2003. 39(2): p. 137-43, Liao, J. K., Int J Clin Pract Suppl, 2003(134): p. 51-7). However, because hypercholesterolemia is a factor in many of these additional pathophysiologic mechanisms that are reversed by statins, many of these statin benefits may be a consequence of LDL lowering.

Statins can be divided into two types according to their physicochemical and pharmacokinetic properties. Statins such as lovastatin, simvastatin, atorvastatin, and cerevastatin are hydrophobic in nature and, as such, diffuse across membranes and thus are highly cell permeable. Hydrophilic statins such as pravastatin are more polar, such that they utilize specific cell surface transporters for cellular uptake (Ziegler, K. and W. Stunkel, Biochim Biophys Acta, 1992. 1139(3): p. 203-9, Yamazaki, M., et al., Am J Physiol, 1993. 264(1 Pt 1): p. G36-44, Komai, T., et al., Biochem Pharmacol, 1992. 43(4): p. 667-70). The latter statin utilizes a transporter, OATP2, the tissue distribution of which is confined to the liver and, therefore, they are relatively hepato-specific inhibitors (Hsiang, B., et al., J Biol Chem, 1999. 274(52): p. 37161-8). The former statins, which do not utilize specific transport mechanisms, are available to all cells and they can directly impact a much broader spectrum of cells and tissues. These differences in properties may influence the spectrum of activities that each statin possesses. Pravastatin, for instance, has a low myopathic potential in animal models and myocyte cultures compared to other hydrophobic statins (Masters, B. A., et al., Toxicol Appl Pharmacol, 1995. 131(1): p. 163-74. Nakahara, K., et al., Toxicol Appl Pharmacol, 1998. 152(1): p. 99-106, Reijneveld, J. C., et al., Pediatr Res, 1996. 39(6): p. 1028-35).

Evidence from gene association studies is accumulating to indicate that responses to drugs are, indeed, at least partly under genetic control. As such, pharmacogenetics—the study of variability in drug responses attributed to hereditary factors in different populations—may significantly assist in providing answers toward meeting this challenge (Roses, A. D., Nature, 2000. 405(6788): p. 857-65, Mooser, V., et al., J Thromb Haemost, 2003. 1(7): p. 1398-1402, Humma, L. M. and S. G. Terra, Am. J. Health Syst Pharm, 2002. 59(13): p. 1241-52). Numerous associations have been reported between selected genotypes, as defined by SNPs and other sequence variations, and specific responses to cardiovascular drugs. Polymorphisms in several genes have been suggested to influence responses to statins including CETP (Kuivenhoven, J. A., et al., N Engl J Med, 1998. 338(2): p. 86-93), beta-fibrinogen (de Maat, M. P., et al., Arterioscler Thromb Vasc Biol, 1998. 18(2): p. 265-71), hepatic lipase (Zambon, A., et al., Circulation, 2001. 103(6): p. 792-8), lipoprotein lipase (Jukema, J. W., et al., Circulation, 1996. 94(8): p. 1913-8), glycoprotein IIIc (Bray, P. F., et al., Am J Cardiol, 2001. 88(4): p. 347-52), stromelysin-1 (de Maat, M. P., et al., Am J Cardiol, 1999. 83(6): p. 852-6), and apolipoprotein E (Gerdes, L. U., et al., Circulation, 2000. 101(12): p. 1366-71, Pedro-Botet, J., et al., Atherosclerosis, 2001. 158(1): p. 183-93). Some of these variants were shown to effect clinical events while others were associated with changes in surrogate endpoints.

Thus, there is also a need to identify genetic markers for stratifying stroke patients based on their likelihood of responding to drug therapy, particularly statin treatment.

SNPs

The genomes of all organisms undergo spontaneous mutation in the course of their continuing evolution, generating variant forms of progenitor genetic sequences (Gusella, Ann. Rev. Biochem. 55, 831-854 (1986)). A variant form may confer an evolutionary advantage or disadvantage relative to a progenitor form or may be neutral. In some instances, a variant form confers an evolutionary advantage to the species and is eventually incorporated into the DNA of many or most members of the species and effectively becomes the progenitor form. Additionally, the effects of a variant form may be both beneficial and detrimental, depending on the circumstances. For example, a heterozygous sickle cell mutation confers resistance to malaria, but a homozygous sickle cell mutation is usually lethal. In many cases, both progenitor and variant forms survive and co-exist in a species population. The coexistence of multiple forms of a genetic sequence gives rise to genetic polymorphisms, including SNPs.

Approximately 90% of all polymorphisms in the human genome are SNPs. SNPs are single base positions in DNA at which different alleles, or alternative nucleotides, exist in a population. The SNP position (interchangeably referred to herein as SNP, SNP site, SNP locus, SNP marker, or marker) is usually preceded by and followed by highly conserved sequences of the allele (e.g., sequences that vary in less than 1/100 or 1/1000 members of the populations). An individual may be homozygous or heterozygous for an allele at each SNP position. A SNP can, in some instances, be referred to as a “cSNP” to denote that the nucleotide sequence containing the SNP is an amino acid coding sequence.

A SNP may arise from a substitution of one nucleotide for another at the polymorphic site. Substitutions can be transitions or transversions. A transition is the replacement of one purine nucleotide by another purine nucleotide, or one pyrimidine by another pyrimidine. A transversion is the replacement of a purine by a pyrimidine, or vice versa. A SNP may also be a single base insertion or deletion variant referred to as an “indel” (Weber et al., “Human diallelic insertion/deletion polymorphisms”, Am J Hum Genet 2002 October; 71(4):855-82).

A synonymous codon change, or silent mutation/SNP (terms such as “SNP”, “polymorphism”, “mutation”, “mutant”, “variation”, and “variant” are used herein interchangeably), is one that does not result in a change of amino acid due to the degeneracy of the genetic code. A substitution that changes a codon coding for one amino acid to a codon coding for a different amino acid (i.e., a non-synonymous codon change) is referred to as a missense mutation. A nonsense mutation results in a type of non-synonymous codon change in which a stop codon is formed, thereby leading to premature termination of a polypeptide chain and a truncated protein. A read-through mutation is another type of non-synonymous codon change that causes the destruction of a stop codon, thereby resulting in an extended polypeptide product. While SNPs can be bi-, tri-, or tetra-allelic, the vast majority of the SNPs are bi-allelic, and are thus often referred to as “bi-allelic markers”, or “di-allelic markers”.

As used herein, references to SNPs and SNP genotypes include individual SNPs and/or haplotypes, which are groups of SNPs that are generally inherited together. Haplotypes can have stronger correlations with diseases or other phenotypic effects compared with individual SNPs, and therefore may provide increased diagnostic accuracy in some cases (Stephens et al. Science 293, 489-493, 20 Jul. 2001). As used herein, the term “haplotype” refers to a set of two or more alleles on a single chromosome. The term “diplotype” refers to a combination of two haplotypes that a diploid individual carries. The term “double diplotype”, also called “two-locus diplotype”, refers to a combination of diplotypes at two distinct loci for an individual.

Causative SNPs are those SNPs that produce alterations in gene expression or in the expression, structure, and/or function of a gene product, and therefore are most predictive of a possible clinical phenotype. One such class includes SNPs falling within regions of genes encoding a polypeptide product, i.e. cSNPs. These SNPs may result in an alteration of the amino acid sequence of the polypeptide product (i.e., non-synonymous codon changes) and give rise to the expression of a defective or other variant protein. Furthermore, in the case of nonsense mutations, a SNP may lead to premature termination of a polypeptide product. Such variant products can result in a pathological condition, e.g., genetic disease. Examples of genes in which a SNP within a coding sequence causes a genetic disease include sickle cell anemia and cystic fibrosis.

Causative SNPs do not necessarily have to occur in coding regions; causative SNPs can occur in, for example, any genetic region that can ultimately affect the expression, structure, and/or activity of the protein encoded by a nucleic acid. Such genetic regions include, for example, those involved in transcription, such as SNPs in transcription factor binding domains, SNPs in promoter regions, in areas involved in transcript processing, such as SNPs at intron-exon boundaries that may cause defective splicing, or SNPs in mRNA processing signal sequences such as polyadenylation signal regions. Some SNPs that are not causative SNPs nevertheless are in close association with, and therefore segregate with, a disease-causing sequence. In this situation, the presence of a SNP correlates with the presence of, or predisposition to, or an increased risk in developing the disease. These SNPs, although not causative, are nonetheless also useful for diagnostics, disease predisposition screening, and other uses.

An association study of a SNP and a specific disorder involves determining the presence or frequency of the SNP allele in biological samples from individuals with the disorder of interest, such as stroke and related pathologies and comparing the information to that of controls (i.e., individuals who do not have the disorder; controls may be also referred to as “healthy” or “normal” individuals) who are preferably of similar age and race. The appropriate selection of patients and controls is important to the success of SNP association studies. Therefore, a pool of individuals with well-characterized phenotypes is extremely desirable.

A SNP may be screened in diseased tissue samples or any biological sample obtained from a diseased individual, and compared to control samples, and selected for its increased (or decreased) occurrence in a specific pathological condition, such as stroke. Once a statistically significant association is established between one or more SNP(s) and a pathological condition (or other phenotype) of interest, then the region around the SNP can optionally be thoroughly screened to identify the causative genetic locus/sequence(s) (e.g., causative SNP/mutation, gene, regulatory region, etc.) that influences the pathological condition or phenotype. Association studies may be conducted within the general population and are not limited to studies performed on related individuals in affected families (linkage studies).

Clinical trials have shown that patient response to treatment with pharmaceuticals is often heterogeneous. There is a continuing need to improve pharmaceutical agent design and therapy. In that regard, SNPs can be used to identify patients most suited to therapy with particular pharmaceutical agents (this is often termed “pharmacogenomics”). Similarly, SNPs can be used to exclude patients from certain treatment due to the patient's increased likelihood of developing toxic side effects or their likelihood of not responding to the treatment. Pharmacogenomics can also be used in pharmaceutical research to assist the drug development and selection process. (Linder et al. (1997), Clinical Chemistry, 43, 254; Marshall (1997), Nature Biotechnology, 15, 1249; International Patent Application WO 97/40462, Spectra Biomedical; and Schafer et al. (1998), Nature Biotechnology, 16: 3).

SUMMARY OF THE INVENTION

The present invention relates to the identification of SNPs, unique combinations of SNPs, and haplotypes or diplotypes of SNPs, that are associated with stroke (e.g., an increased or decreased risk of having a stroke), and/or with drug response, particularly response to statin treatment (including preventive treatment) such as for the treatment or prevention of stroke. The polymorphisms disclosed herein are directly useful as targets for the design of diagnostic and prognostic reagents and the development of therapeutic and preventive agents, such as for use in determining an individual's predisposition to having a stroke, and for treatment or prevention of stroke and related pathologies such as other vascular diseases, as well as for predicting a patient's response to therapeutic agents such as statins, particularly for the treatment or prevention of stroke. Furthermore, the polymorphisms disclosed herein may also be used for predicting an individual's responsiveness to statins for the treatment or prevention of disorders other than stroke, such as cancer, and may also be used for predicting an individual's responsiveness to drugs other than statins that are used to treat or prevent stroke.

Based on the identification of SNPs associated with stroke, and/or response to statin treatment, the present invention also provides methods of detecting these variants as well as the design and preparation of detection reagents needed to accomplish this task. The invention specifically provides, for example, SNPs associated with stroke, and/or responsiveness to statin treatment, isolated nucleic acid molecules (including DNA and RNA molecules) containing these SNPs, variant proteins encoded by nucleic acid molecules containing such SNPs, antibodies to the encoded variant proteins, computer-based and data storage systems containing the novel SNP information, methods of detecting these SNPs in a test sample, methods of identifying individuals who have an altered (i.e., increased or decreased) risk of having a first or recurrent stroke, methods for prognosing the severity or consequences of stroke, methods of treating an individual who has an increased risk for stroke, and methods for identifying individuals (e.g., determining a particular individual's likelihood) who have an altered (i.e., increased or decreased) likelihood of responding to statin treatment (or more or less likely to experience undesirable side effects from a treatment), particularly statin treatment of stroke, based on the presence or absence of one or more particular nucleotides (alleles) at one or more SNPs disclosed herein or the detection of one or more encoded variant products (e.g., variant mRNA transcripts or variant proteins), methods of screening for compounds useful in the treatment or prevention of a disorder associated with a variant gene/protein, compounds identified by these methods, methods of treating or preventing disorders mediated by a variant gene/protein, etc. The present invention also provides methods for identifying individuals who possess SNPs that are associated with an increased risk of stroke, and yet can benefit from being treated with statin because statin treatment can lower their risk of stroke.

The exemplary utilities described herein for the stroke-associated SNPs and statin response-associated SNPs disclosed herein apply to both first (primary) and recurrent stroke. For example, the SNPs disclosed herein can be used for determining the risk for a first stroke in an individual who has never had a stroke in the past, and can also be used for determing the risk for a recurrent stroke in an individual who has previously had a stroke.

The present invention further provides methods for selecting or formulating a treatment regimen (e.g., methods for determining whether or not to administer statin treatment to an individual who has previously had a stroke, or who is at risk for having a stroke in the future, methods for selecting a particular statin-based treatment regimen such as dosage and frequency of administration of statin, or a particular form/type of statin such as a particular pharmaceutical formulation or statin compound, methods for administering an alternative, non-statin-based treatment to individuals who are predicted to be unlikely to respond positively to statin treatment, etc.), and methods for determining the likelihood of experiencing toxicity or other undesirable side effects from statin treatment, etc. The present invention also provides methods for selecting individuals to whom a statin or other therapeutic will be administered based on the individual's genotype, and methods for selecting individuals for a clinical trial of a statin or other therapeutic agent based on the genotypes of the individuals (e.g., selecting individuals to participate in the trial who are most likely to respond positively from the statin treatment and/or excluding individuals from the trial who are unlikely to respond positively from the statin treament). The present invention further provides methods for reducing an individual's risk of having a stroke by administering statin treatment, including preventing a first or recurrent stroke by administering statin treatment, when said individual carries one or more SNPs identified herein as being associated with stroke risk or stroke statin response.

In certain exemplary embodiments of the invention, the SNP is selected from the group consisting of the following (the name of the gene, or chromosome, that contains the SNP is indicated in parentheses): rs3900940/hCV7425232 (MYH15), rs3814843/hCV11476411 (CALM1), rs2200733/hCV16158671 (chromosome 4q25), and rs10757274/hCV26505812 (chromosome 9p21), and combinations of any number of these SNPs, as well as any of these SNP in combination with other genetic markers. Exemplary embodiments of the invention provide compositions (e.g., detection reagents and kits) and methods of using these SNPs for stroke-related utilities, such as for determining an individual's risk of having a stroke or whether an individual will benefit from treatment with statins or other therapies. For example, certain embodiments provide methods of using any of rs3900940/hCV7425232 (MYH15), rs3814843/hCV11476411 (CALM1), rs2200733/hCV16158671 (chromosome 4q25), and/or rs10757274/hCV26505812 (chromosome 9p21) for determining stroke risk in an individual, and methods of using rs10757274/hCV26505812 (chromosome 9p21) for determining whether an individual will benefit from statin treatment.

In Tables 1-2, the present invention provides gene information, transcript sequences (SEQ ID NOS:1-80), encoded amino acid sequences (SEQ ID NOS:81-160), genomic sequences (SEQ ID NOS:260-435), transcript-based context sequences (SEQ ID NOS:161-259) and genomic-based context sequences (SEQ ID NOS:436-1566) that contain the SNPs of the present invention, and extensive SNP information that includes observed alleles, allele frequencies, populations/ethnic groups in which alleles have been observed, information about the type of SNP and corresponding functional effect, and, for cSNPs, information about the encoded polypeptide product. The transcript sequences (SEQ ID NOS:1-80), amino acid sequences (SEQ ID NOS:81-160), genomic sequences (SEQ ID NOS:260-435), transcript-based SNP context sequences (SEQ ID NOS:161-259), and genomic-based SNP context sequences (SEQ ID NOS:436-1566) are also provided in the Sequence Listing.

In certain exemplary embodiments, the invention provide methods for identifying an individual who has an altered risk for having a first or recurrent stroke, in which the method comprises detecting a single nucleotide polymorphism (SNP) in any of the nucleotide sequences of SEQ ID NOS:1-80 and 161-1566, particularly as represented by any of the genomic context sequences of SEQ ID NOS:436-1566, in said individual's nucleic acids, wherein the SNP is specified in Table 1 and/or Table 2, and the presence of the SNP is indicative of an altered risk for stroke in said individual. In certain exemplary embodiment of the present invention, SNPs that occur naturally in the human genome are provided as isolated nucleic acid molecules. These SNPs are associated with stroke and related pathologies such as other vascular diseases. Other vascular diseases include, but are not limited to, cerebrovascular disease, carotid artery disease, coronary artery disease, peripheral artery disease, aortic aneurysm, and vascular dementia. In particular the SNPs are associated with either an increased or decreased risk of having a stroke. As such, they can have a variety of uses in the diagnosis and/or treatment of stroke and related pathologies. One aspect of the present invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence in which at least one nucleotide is a SNP that is propriatory to Applera, or Celera. In an alternative embodiment, a nucleic acid of the invention is an amplified polynucleotide, which is produced by amplification of a SNP-containing nucleic acid template. In another embodiment, the invention provides for a variant protein that is encoded by a nucleic acid molecule containing a SNP disclosed herein.

In yet another embodiment of the invention, a reagent for detecting a SNP in the context of its naturally-occurring flanking nucleotide sequences (which can be, e.g., either DNA or mRNA) is provided. In particular, such a reagent may be in the form of, for example, a hybridization probe or an amplification primer that is useful in the specific detection of a SNP of interest. In an alternative embodiment, a protein detection reagent is used to detect a variant protein that is encoded by a nucleic acid molecule containing a SNP disclosed herein. A preferred embodiment of a protein detection reagent is an antibody or an antigen-reactive antibody fragment.

Various embodiments of the invention also provide kits comprising SNP detection reagents, and methods for detecting the SNPs disclosed herein by employing detection reagents. In a specific embodiment, the present invention provides for a method of identifying an individual having an increased or decreased risk of having a stroke by detecting the presence or absence of one or more SNP alleles disclosed herein. Preferably, the SNP allele can be an allele of a SNP selected from the group consisting of the following (the name of the gene, or chromosome, that contains the SNP is indicated in parentheses): rs3900940/hCV7425232 (MYH15), rs3814843/hCV11476411 (CALM1), rs2200733/hCV16158671 (chromosome 4q25), and rs10757274/hCV26505812 (chromosome 9p21), and combinations of any number of these SNPs, as well as any of these SNP in combination with other genetic markers.

In another embodiment, a method for diagnosing stroke or related pathologies by detecting the presence or absence of one or more SNPs or SNP alleles disclosed herein is provided. In another embodiment, the invention provides a method of identifying an individual having an altered (either increased or decreased) risk of having a stroke by detecting the presence or absence of one or more SNPs or SNP alleles disclosed herein. Thus, an exemplary embodiment of the invention provides a method of identifying an individual who has an increased risk of having a stroke by determining which nucleotide (allele) is present at one or more SNPs disclosed herein. An alternative exemplary embodiment of the invention provides a method of identifying an individual who has a decreased risk of having a stroke by determining which nucleotide (allele) is present at one or more SNPs disclosed herein.

The nucleic acid molecules of the invention can be inserted in an expression vector, such as to produce a variant protein in a host cell. Thus, the present invention also provides for a vector comprising a SNP-containing nucleic acid molecule, genetically-engineered host cells containing the vector, and methods for expressing a recombinant variant protein using such host cells. In another specific embodiment, the host cells, SNP-containing nucleic acid molecules, and/or variant proteins can be used as targets in a method for screening and identifying therapeutic agents or pharmaceutical compounds useful in the treatment of stroke and related pathologies such as other vascular diseases.

An aspect of this invention is a method for treating or preventing a first or recurrent stroke in a human subject wherein said human subject harbors a SNP, gene, transcript, and/or encoded protein identified in Tables 1-2, which method comprises administering to said human subject a therapeutically or prophylactically effective amount of one or more agents (e.g., statins) counteracting the effects of the disease, such as by inhibiting (or stimulating) the activity of the gene, transcript, and/or encoded protein identified in Tables 1-2.

Another aspect of this invention is a method for identifying an agent useful in therapeutically or prophylactically treating stroke and related pathologies in a human subject wherein said human subject harbors a SNP, gene, transcript, and/or encoded protein identified in Tables 1-2, which method comprises contacting the gene, transcript, or encoded protein with a candidate agent (e.g., a statin) under conditions suitable to allow formation of a binding complex between the gene, transcript, or encoded protein and the candidate agent and detecting the formation of the binding complex, wherein the presence of the complex identifies said agent.

Another aspect of this invention is a method for treating stroke and related pathologies in a human subject, which method comprises:

(i) determining that said human subject harbors a SNP, gene, transcript, and/or encoded protein identified in Tables 1-2, and

(ii) administering to said subject a therapeutically or prophylactically effective amount of one or more agents (e.g., statins) counteracting the effects of the disease.

Yet another aspect of this invention is a method for evaluating the suitability of a patient for stroke treatment comprising determining the genotype of said patient with respect to a particular set of SNP markers, said SNP markers comprising a plurality of individual SNPs (e.g., about 2-7 SNPs) in Tables 1-2, and calculating a score using an appropriate algorithm based on the genotype of said patient, the resulting score being indicative of the suitability of said patient undergoing stroke treatment.

Another aspect of the invention is a method of treating a stroke patient comprising administering an appropriate drug in a therapeutically effective amount to said stroke patient whose genotype has been shown to contain a plurality of SNPs as described in Table 1 or Table 2.

Another aspect of the invention is a method for identifying a human who is likely to benefit from statin treatment (as used herein, “treatment” includes preventive as well as therapeutic treatment), in which the method comprises detecting the presence of a statin response-associated SNP (e.g., an allele associated with increased statin benefit) disclosed herein in said human's nucleic acids, wherein the presence of the SNP indicates that said human is likely to benefit from statin treatment.

Another aspect of the invention is a method for identifying a human who is likely to benefit from statin treatment, in which the method comprises detecting the presence of a SNP that is in LD with a statin response-associated SNP disclosed herein in said human's nucleic acids, wherein the presence of the SNP indicates that said human is likely to benefit from statin treatment.

Exemplary embodiments of the invention include methods of using a statin response-associated SNP disclosed herein for determining whether an individual will benefit from statin treatment (e.g., determining whether an individual should be administered statin to reduce their likelihood of having a stroke). The statin response-associated SNPs disclosed here can be used for predicting response to any statin (HMG-CoA reductase inhibitors), including but not limited to, pravastatin (Pravachol®), atorvastatin (Lipitor®), storvastatin, rosuvastatin (Crestor®), fluvastatin (Lescol®), lovastatin (Mevacor®), and simvastatin (Zocor®), as well as combination therapies that include a statin such as simvastatin+ezetimibe (Vytorin®), lovastatin+niacin extended-release (Advicor®), and atorvastatin+amlodipine besylate (Caduet®).

In certain exemplary embodiments of the invention, methods are directed to the determination of which patients would have greater protection against stroke when they are given an intensive statin treatment as compared to a standard statin treatment. In certain embodiments, the statin can comprise a statin selected from the group consisting of atorvastatin, pravastatin, and storvastatin. In certain embodiments, intensive statin treatment comprises administering higher doses of a statin and/or increasing the frequency of statin administration as compared with standard statin treatment. In certain further embodiments, intensive statin treatment can utilize a different type of statin than standard statin treatment; for example, atorvastatin can be used for intensive statin treatment and pravastatin can be used for standard statin treatment.

Many other uses and advantages of the present invention will be apparent to those skilled in the art upon review of the detailed description of the preferred embodiments herein. Solely for clarity of discussion, the invention is described in the sections below by way of non-limiting examples.

Description of the File Contained on the CD-R Named CD000022ORD-CDR

The CD-R named CD000022ORD-CDR contains the following text (ASCII) file:

1) File SEQLIST_CD000022ORD.txt provides the Sequence Listing. The Sequence Listing provides the transcript sequences (SEQ ID NOS:1-80) and protein sequences (SEQ ID NOS:81-160) as shown in Table 1, and genomic sequences (SEQ ID NOS:260-435) as shown in Table 2, for each stroke-associated gene that contains one or more SNPs of the present invention. Also provided in the Sequence Listing are context sequences flanking each SNP, including both transcript-based context sequences as shown in Table 1 (SEQ ID NOS:161-259) and genomic-based context sequences as shown in Table 2 (SEQ ID NOS:436-1566). The context sequences generally provide 100 bp upstream (5′) and 100 bp downstream (3′) of each SNP, with the SNP in the middle of the context sequence, for a total of 200 bp of context sequence surrounding each SNP.

File SEQLIST_CD000022ORD.txt is 21,295 KB in size, and was created on Feb. 18, 2009. A computer readable format of the sequence listing is also submitted herein on a separate CDR labeled CRF. The information recorded in the CRF CDR is identical to the sequence listing as provided on the CDR Duplicate Copy 1 and Duplicate Copy 2.

The material contained on the CD-R labeled CRF is hereby incorporated by reference pursuant to 37 CFR 1.77(b)(4).

Description of Table 1 and Table 2

Table 1 and Table 2 disclose the SNP and associated gene/transcript/protein information of the present invention. For each gene, Table 1 and Table 2 each provide a header containing gene/transcript/protein information, followed by a transcript and protein sequence (in Table 1) or genomic sequence (in Table 2), and then SNP information regarding each SNP found in that gene/transcript.

NOTE: SNPs may be included in both Table 1 and Table 2; Table 1 presents the SNPs relative to their transcript sequences and encoded protein sequences, whereas Table 2 presents the SNPs relative to their genomic sequences (in some instances Table 2 may also include, after the last gene sequence, genomic sequences of one or more intergenic regions, as well as SNP context sequences and other SNP information for any SNPs that lie within these intergenic regions). SNPs can readily be cross-referenced between Tables based on their hCV (or, in some instances, hDV) identification numbers.

The gene/transcript/protein information includes:

    • a gene number (1 through n, where n=the total number of genes in the Table)
    • a Celera hCG and UID internal identification numbers for the gene
    • a Celera hCT and UID internal identification numbers for the transcript (Table 1 only)
    • a public Genbank accession number (e.g., RefSeq NM number) for the transcript (Table 1 only)
    • a Celera hCP and UID internal identification numbers for the protein encoded by the hCT transcript (Table 1 only)
    • a public Genbank accession number (e.g., RefSeq NP number) for the protein (Table 1 only)
    • an art-known gene symbol
    • an art-known gene/protein name
    • Celera genomic axis position (indicating start nucleotide position-stop nucleotide position)
    • the chromosome number of the chromosome on which the gene is located
    • an OMIM (Online Mendelian Inheritance in Man; Johns Hopkins University/NCBI) public reference number for obtaining further information regarding the medical significance of each gene
    • alternative gene/protein name(s) and/or symbol(s) in the OMIM entry

NOTE: Due to the presence of alternative splice forms, multiple transcript/protein entries can be provided for a single gene entry in Table 1; i.e., for a single Gene Number, multiple entries may be provided in series that differ in their transcript/protein information and sequences.

Following the gene/transcript/protein information is a transcript sequence and protein sequence (in Table 1), or a genomic sequence (in Table 2), for each gene, as follows:

    • transcript sequence (Table 1 only) (corresponding to SEQ ID NOS:1-80 of the Sequence Listing), with SNPs identified by their IUB codes (transcript sequences can include 5′ UTR, protein coding, and 3′ UTR regions). (NOTE: If there are differences between the nucleotide sequence of the hCT transcript and the corresponding public transcript sequence identified by the Genbank accession number, the hCT transcript sequence (and encoded protein) is provided, unless the public sequence is a RefSeq transcript sequence identified by an NM number, in which case the RefSeq NM transcript sequence (and encoded protein) is provided. However, whether the hCT transcript or RefSeq NM transcript is used as the transcript sequence, the disclosed SNPs are represented by their IUB codes within the transcript.)
    • the encoded protein sequence (Table 1 only) (corresponding to SEQ ID NOS:81-160 of the Sequence Listing)
    • the genomic sequence of the gene (Table 2 only), including 6 kb on each side of the gene boundaries (i.e., 6 kb on the 5′ side of the gene plus 6 kb on the 3′ side of the gene) (corresponding to SEQ ID NOS:260-435 of the Sequence Listing).

After the last gene sequence, Table 2 may include additional genomic sequences of intergenic regions (in such instances, these sequences are identified as “Intergenic region:” followed by a numerical identification number), as well as SNP context sequences and other SNP information for any SNPs that lie within each intergenic region (and such SNPs are identified as “INTERGENIC” for SNP type).

NOTE: The transcript, protein, and transcript-based SNP context sequences are provided in both Table 1 and in the Sequence Listing. The genomic and genomic-based SNP context sequences are provided in both Table 2 and in the Sequence Listing. SEQ ID NOS are indicated in Table 1 for each transcript sequence (SEQ ID NOS:1-80), protein sequence (SEQ ID NOS:81-160), and transcript-based SNP context sequence (SEQ ID NOS:161-259), and SEQ ID NOS are indicated in Table 2 for each genomic sequence (SEQ ID NOS:260-435), and genomic-based SNP context sequence (SEQ ID NOS:436-1566).

The SNP information includes:

    • context sequence (taken from the transcript sequence in Table 1, and taken from the genomic sequence in Table 2) with the SNP represented by its IUB code, including 100 bp upstream (5′) of the SNP position plus 100 bp downstream (3′) of the SNP position (the transcript-based SNP context sequences in Table 1 are provided in the Sequence Listing as SEQ ID NOS:161-259; the genomic-based SNP context sequences in Table 2 are provided in the Sequence Listing as SEQ ID NOS:436-1566).
    • Celera hCV internal identification number for the SNP (in some instances, an “hDV” number is given instead of an “hCV” number)
    • SNP position [position of the SNP within the given transcript sequence (Table 1) or within the given genomic sequence (Table 2)]
    • SNP source (may include any combination of one or more of the following five codes, depending on which internal sequencing projects and/or public databases the SNP has been observed in: “Applera”=SNP observed during the re-sequencing of genes and regulatory regions of 39 individuals, “Celera”=SNP observed during shotgun sequencing and assembly of the Celera human genome sequence, “Celera Diagnostics”=SNP observed during re-sequencing of nucleic acid samples from individuals who have a disease, “dbSNP”=SNP observed in the dbSNP public database, “HGBASE”=SNP observed in the HGBASE public database, “HGMD”=SNP observed in the Human Gene Mutation Database (HGMD) public database, “HapMap”=SNP observed in the International HapMap Project public database, “CSNP”=SNP observed in an internal Applied Biosystems (Foster City, Calif.) database of coding SNPS (cSNPs)) (NOTE: multiple “Applera” source entries for a single SNP indicate that the same SNP was covered by multiple overlapping amplification products and the re-sequencing results (e.g., observed allele counts) from each of these amplification products is being provided).

For the following SNPs provided in Table 1 and/or 2, the SNP source falls into one of the following three categories: 1) SNPs for which the SNP source is only “Applera” and none other, 2) SNPs for which the SNP source is only “Celera Diagnostics” and none other, and 3) SNPs for which the SNP source is both “Applera” and “Celera Diagnostics” but none other (the hCV identification number and SEQ ID NO for the SNP's genomic context sequence in Table 2 are indicated): hCV22275299 (SEQ ID NO:482), hCV25615822 (SEQ ID NO:639), hCV25651109 (SEQ ID NO:840), hCV25951678 (SEQ ID NO:1013), and hCV25615822 (SEQ ID NO:1375). These SNPs have not been observed in any of the public databases (dbSNP, HGBASE, and HGMD), and were also not observed during shotgun sequencing and assembly of the Celera human genome sequence (i.e., “Celera” SNP source).

    • Population/allele/allele count information in the format of [population1(first_allele,countlsecond_allele,count)population2(first_allele,countlsecond_allele,count) total (first_allele,total countlsecond_allele,total count)]. The information in this field includes populations/ethnic groups in which particular SNP alleles have been observed (“cau”=Caucasian, “his”=Hispanic, “chn”=Chinese, and “afr”=African−American, “jpn”=Japanese, “ind”=Indian, “mex”=Mexican, “ain”=“American Indian, “cra”=Celera donor, “no_pop”=no population information available), identified SNP alleles, and observed allele counts (within each population group and total allele counts), where available [“-” in the allele field represents a deletion allele of an insertion/deletion (“indel”) polymorphism (in which case the corresponding insertion allele, which may be comprised of one or more nucleotides, is indicated in the allele field on the opposite side of the “|”); “-” in the count field indicates that allele count information is not available]. For certain SNPs from the public dbSNP database, population/ethnic information is indicated as follows (this population information is publicly available in dbSNP): “HISP1”=human individual DNA (anonymized samples) from 23 individuals of self-described HISPANIC heritage; “PAC1”=human individual DNA (anonymized samples) from 24 individuals of self-described PACIFIC RIM heritage; “CAUL 1”=human individual DNA (anonymized samples) from 31 individuals of self-described CAUCASIAN heritage; “AFR1”=human individual DNA (anonymized samples) from 24 individuals of self-described AFRICAN/AFRICAN AMERICAN heritage; “P1”=human individual DNA (anonymized samples) from 102 individuals of self-described heritage; “PA130299515”; “SC_12_A”=SANGER 12 DNAs of Asian origin from Corielle cell repositories, 6 of which are male and 6 female; “SC_12_C”=SANGER 12 DNAs of Caucasian origin from Corielle cell repositories from the CEPH/UTAH library. Six male and 6 female; “SC_12_AA”=SANGER 12 DNAs of African-American origin from Corielle cell repositories 6 of which are male and 6 female; “SC_95_C”=SANGER 95 DNAs of Caucasian origin from Corielle cell repositories from the CEPH/UTAH library; and “SC_12_CA”=Caucasians−12 DNAs from Corielle cell repositories that are from the CEPH/UTAH library (six male and six female).

NOTE: For SNPs of “Applera” SNP source, genes/regulatory regions of 39 individuals (20 Caucasians and 19 African Americans) were re-sequenced and, since each SNP position is represented by two chromosomes in each individual (with the exception of SNPs on X and Y chromosomes in males, for which each SNP position is represented by a single chromosome), up to 78 chromosomes were genotyped for each SNP position. Thus, the sum of the African-American (“afr”) allele counts is up to 38, the sum of the Caucasian allele counts (“cau”) is up to 40, and the total sum of all allele counts is up to 78.

(NOTE: semicolons separate population/allele/count information corresponding to each indicated SNP source; i.e., if four SNP sources are indicated, such as “Celera”, “dbSNP”, “HGBASE”, and “HGMD”, then population/allele/count information is provided in four groups which are separated by semicolons and listed in the same order as the listing of SNP sources, with each population/allele/count information group corresponding to the respective SNP source based on order; thus, in this example, the first population/allele/count information group would correspond to the first listed SNP source (Celera) and the third population/allele/count information group separated by semicolons would correspond to the third listed SNP source (HGBASE); if population/allele/count information is not available for any particular SNP source, then a pair of semicolons is still inserted as a place-holder in order to maintain correspondence between the list of SNP sources and the corresponding listing of population/allele/count information)

    • SNP type (e.g., location within gene/transcript and/or predicted functional effect) [“MIS-SENSE MUTATION”=SNP causes a change in the encoded amino acid (i.e., a non-synonymous coding SNP); “SILENT MUTATION”=SNP does not cause a change in the encoded amino acid (i.e., a synonymous coding SNP); “STOP CODON MUTATION”=SNP is located in a stop codon; “NONSENSE MUTATION”=SNP creates or destroys a stop codon; “UTR 5”=SNP is located in a 5′ UTR of a transcript; “UTR 3”=SNP is located in a 3′ UTR of a transcript; “PUTATIVE UTR 5”=SNP is located in a putative 5′ UTR; “PUTATIVE UTR 3”=SNP is located in a putative 3′ UTR; “DONOR SPLICE SITE”=SNP is located in a donor splice site (5′ intron boundary); “ACCEPTOR SPLICE SITE”=SNP is located in an acceptor splice site (3′ intron boundary); “CODING REGION”=SNP is located in a protein-coding region of the transcript; “EXON”=SNP is located in an exon; “INTRON”=SNP is located in an intron; “hmCS”=SNP is located in a human-mouse conserved segment; “TFBS”=SNP is located in a transcription factor binding site; “UNKNOWN”=SNP type is not defined; “INTERGENIC”=SNP is intergenic, i.e., outside of any gene boundary]
    • Protein coding information (Table 1 only), where relevant, in the format of [protein SEQ ID NO:#, amino acid position, (amino acid-1, codon1) (amino acid-2, codon2)]. The information in this field includes SEQ ID NO of the encoded protein sequence, position of the amino acid residue within the protein identified by the SEQ ID NO that is encoded by the codon containing the SNP, amino acids (represented by one-letter amino acid codes) that are encoded by the alternative SNP alleles (in the case of stop codons, “X” is used for the one-letter amino acid code), and alternative codons containing the alternative SNP nucleotides which encode the amino acid residues (thus, for example, for missense mutation-type SNPs, at least two different amino acids and at least two different codons are generally indicated; for silent mutation-type SNPs, one amino acid and at least two different codons are generally indicated, etc.). In instances where the SNP is located outside of a protein-coding region (e.g., in a UTR region), “None” is indicated following the protein SEQ ID NO.

Description of Table 3

Table 3 provides sequences (SEQ ID NOS:1567-1914) of exemplary primers that can be used to assay certain SNPs by allele-specific PCR, such as for stroke-related uses.

Table 3 provides the following:

    • the column labeled “Marker” provides an hCV identification number for each SNP that can be detected using the corresponding primers.
    • the column labeled “Alleles” designates the two alternative alleles (i.e., nucleotides) at the SNP site. These alleles are targeted by the allele-specific primers (the allele-specific primers are shown as Primer 1 and Primer 2). Note that alleles may be presented in Table 3 based on a different orientation (i.e., the reverse complement) relative to how the same alleles are presented in Tables 1-2.
    • the column labeled “Primer 1 (Allele-Specific Primer)” provides an allele-specific primer that is specific for an allele designated in the “Alleles” column.
    • the column labeled “Primer 2 (Allele-Specific Primer)” provides an allele-specific primer that is specific for the other allele designated in the “Alleles” column.
    • the column labeled “Common Primer” provides a common primer that is used in conjunction with each of the allele-specific primers (i.e., Primer 1 and Primer 2) and which hybridizes at a site away from the SNP position.

All primer sequences are given in the 5′ to 3′ direction.

Each of the nucleotides designated in the “Alleles” column matches or is the reverse complement of (depending on the orientation of the primer relative to the designated allele) the 3′ nucleotide of the allele-specific primer (i.e., either Primer 1 or Primer 2) that is specific for that allele.

Description of Table 4

Table 4 provides a list of LD SNPs that are related to and derived from certain interrogated SNPs. The interrogated SNPs, which are shown in column 1 (which indicates the hCV identification numbers of each interrogated SNP) and column 2 (which indicates the public rs identification numbers of each interrogated SNP) of Table 4, are statistically significantly associated with stroke as shown in the tables. These LD SNPs are provided as an example of SNPs which can also serve as markers for disease association based on their being in LD with an interrogated SNP. The criteria and process of selecting such LD SNPs, including the calculation of the r2 value and the r2 threshold value, are described in Example Eight, below.

In Table 4, the column labeled “Interrogated SNP” presents each marker as identified by its unique hCV identification number. The column labeled “Interrogated rs” presents the publicly known identifier rs number for the corresponding hCV number. The column labeled “LD SNP” presents the hCV numbers of the LD SNPs that are derived from their corresponding interrogated SNPs. The column labeled “LD SNP rs” presents the publicly known rs number for the corresponding hCV number. The column labeled “Power” presents the level of power where the r2 threshold is set. For example, when power is set at 0.51, the threshold r2 value calculated therefrom is the minimum r2 that an LD SNP must have in reference to an interrogated SNP, in order for the LD SNP to be classified as a marker capable of being associated with a disease phenotype at greater than 51% probability. The column labeled “Threshold r2” presents the minimum value of r2 that an LD SNP must meet in reference to an interrogated SNP in order to qualify as an LD SNP. The column labeled “r2” presents the actual r2 value of the LD SNP in reference to the interrogated SNP to which it is related.

Description of Tables 5-38

Table 5 provides baseline characteristics of ARIC participants in the ischemic stroke study.

Table 6 provides SNPs associated with incident ischemic stroke in the ARIC study.

See Example One for further information relating to Tables 5-6.

Tables 7, 8, and 9 provide SNPs, identified from among the 51 SNPs analyzed in ARIC participants, that predict ischemic stroke risk that were identified by Cox proportional hazard analysis as each having a two-sided p-value of <0.2 after adjusting for age and sex and also a hazard ratio (HRR)>1.0 in whites (Table 7), blacks (Table 8), and both whites and blacks (Table 9) (the p-values shown in Tables 7-9 are two-sided p-values; thus, the one-sided p-values for these SNPs are half of these two-sided p-values). See “Supplemental Analysis of SNPs in the ARIC Study” section for further information relating to Tables 7-9.

Table 10 provides baseline characteristics of CHS participants in the ischemic stroke study.

Table 11 provides SNPs associated with incident ischemic stroke in white participants of CHS.

Table 12 provides SNPs associated with incident ischemic stroke in African American participants of CHS.

Table 13 shows that Val allele homozygotes of ABCG2 Val12Met, compared with the Met allele carriers, are associated with increased risk of incident ischemic stroke in both white and African American Participants of CHS.

See Example Two for further information relating to Tables 10-13.

Table 14 provides three SNPs that predict ischemic stroke risk that were identified by Cox proportional hazard analysis as each having one-sided p-values of <=0.05 in whites after adjusting for age and sex, and also after adjusting for traditional risk factors. See “Supplemental Analysis of SNPs in the CHS Study” section for further information relating to Table 14.

Table 15 provides characteristics of noncardioembolic stroke cases and healthy controls in the Vienna Stroke Registry (VSR) study.

Table 16 provides characteristics of six SNPs tested for association with noncardioembolic stroke in VSR.

Table 17 provides results of analysis for association of six SNPs with noncardioembolic stroke in VSR. In Table 17, individuals with missing genotype or traditional risk factor information were excluded from case and control counts; Model 1 was adjusted for age and sex; Model 2 was adjusted for age, sex, smoking, hypertension, diabetes, dyslipidemia, and BMI; and “q” is the false discovery rate q value.

See Example Three for further information relating to Tables 15-17.

Table 18 provides SNPs associated (2-sided p-value of <0.2) with ischemic stroke (labeled “ischemic” in the “outcome” column), atherothrombotic stroke (labeled “athero” in the “outcome” column), and/or early-onset stroke (labeled “early-onset” in the “outcome” column) in the VSR study either before or after adjustment for traditional risk factors (results after adjustment are labeled “yes” and results before adjustment are labeled “no” in the “adjust?” column) (the p-values shown in Table 18 are two-sided p-values; thus, the one-sided p-values for these SNPs are half of these two-sided p-values). See “Supplemental Analysis of SNPs in the Vienna Stroke Registry” section for further information relating to Table 18.

Table 19 (provided as Tables 19A-C to reduce the table width, thus the order of the rows corresponds to the same markers and studies across each of Tables 19A-C) provides 61 SNPs that were associated with stroke risk in the UCSF/CCF study (1-sided p<0.05 or 2-sided p<0.1) and had the same risk allele as in the VSR study. Table 19 provides the stroke association data in both the UCSF/CCF and the VSR studies. In Table 19A, the column labeled “RefAllele” refers to the major allele and the column labeled “Allele” refers to the alternative (minor) allele. Where the “OR” (in Table 19C) is greater than one, carrying the minor allele has greater stroke risk compared to carrying the major (reference) allele, so the minor allele would be the risk allele. Where the “OR” (in Table 19C) is less than one, the major allele would be the risk allele. See Example Four below for further information relating to Table 19.

Tables 20-21 provide SNPs that showed significant association with stroke risk in the German West Study (which may be interchangeably referred to herein as the “Muenster” Stroke Study). Table 20 provides SNPs associated with stroke risk that have the same risk allele and 2-sided p-values that are less than 0.1 (equivalent to 1-sided p-values that are less than 0.05), and Table 21 provides SNPs associated with stroke risk that have the same risk allele and 2-sided p-values that are between 0.1 and 0.2 (equivalent to 1-sided p-values that are between 0.05 and 0.1). In Tables 20-21, the following abbreviations are used for the endpoints in the column labeled “outcome”: “ischemic_stk”=ischemic stroke, “nonce_stk”=noncardioembolic stroke (ischemic strokes that were not cardioembolic in origin), “CE_stk”=cardioembolic stroke, “athero_stk”=atherothrombotic stroke, “lacunar_stk”=Lacunar stroke, “nohd_stk”=no heart disease stroke (ischemic stroke cases excluding those with a history of heart disease), “recurrent_stk”=recurrent stroke (stroke cases that also had a prior history of stroke), and “EO_stk”=early onset stroke (cases that are younger than the median age of all cases, and controls that were older than the median age of all controls). See Example Five below for further information relating to Tables 20-21.

Tables 22-32 and 37-38 provide SNPs associated with stroke risk or stroke statin response (SSR) in two pravastatin trials: CARE (“Cholesterol and Recurrent Events” study, which is comprised of individuals who have had an MI) and PROSPER (“Prospective Study of Pravastatin in the Elderly at Risk” study, which is comprised of elderly individuals with or without a history of cardiovascular disease). SNPs that were significantly associated with stroke risk in CARE are provided in Tables 22, 24, and 26. SNPs that were significantly associated with SSR in CARE are provided in Tables 23, 25, and 27. Results of the analysis of the MYH15 SNP (rs3900940/hcv7425232) for association with stroke risk in CARE are provided in Table 28. SNPs that were significantly associated with stroke risk in PROSPER are provided in Table 29 (which lists SNPs having P_all<0.2, which is the p-value based on the entire study cohort) and Table 30 (which lists SNPs having P_placebo<0.2, which is the p-value based on just the placebo group). SNPs that were significantly associated with SSR in PROSPER are provided in Table 31 (which lists SNPs having Pint<0.1) and Table 32 (which lists SNPs having Pint<0.2), which provide results of analyses of pravastatin-treated versus placebo-treated individuals. Tables 37-38 provide the results of further analyses of the chromosome 9p21 SNP rs10757274 (hCV26505812) for association with SSR in CARE (Table 37) and PROSPER (Table 38), including both unadjusted and adjusted analyses (adjusted for factors such as age, gender, smoking status, hypertension, diabetes, BMI, and LDL and HDL levels). Table 37 provides results in CARE, and Table 38 provides results in PROSPER (whether each analysis is unadjusted or adjusted is indicated in the “adjust” column in Table 37, or by “unadj” and “adj” column labels in Tables 38).

With respect to Tables 22-32 and 37-38, the columns labeled “Genotype” (in Tables 22-28 and 37), “Geno_Placebo” (in Tables 29-30 and 38), and “Geno_Resp” (in Tables 31-32 and 38) indicate the genotype which the given stroke risk or SSR results correspond to. All the p-values (including Pint values) provided in Tables 22-32 and 37-38 are two-sided p-values (two-sided p-value cutoffs of 0.1 and 0.2 are equivalent to one-sided p-value cutoffs of 0.05 and 0.1, respectively). In Tables 23, 25, 27, 31-32, and 37-38 (which include results pertaining to SSR), the p-value (which is labeled “p-value” in Tables 23, 25, 27, and 37, and labeled “p_resp” in Tables 31-32 and 38) refers to the significance of the statin benefit (i.e., the HR of pravastatin-treated versus placebo-treated carriers of a given genotype), whereas the Pint value (which is labeled as “pval_intx” in Tables 23, 25, 27, and 37, and labeled “p_int_resp” in Tables 31-32 and 38) refers to the significance of the genotype by treatment interaction, i.e., the significance of the difference in statin response among three groups defined by the three genotypes (homozygotes of each of the two alternative alleles, plus heterozygotes, as indicated in the column labeled “Genotype” or “Geno”) or two groups defined by the carriers and noncarriers of one or the other allele (“Dom” or “Rec”, as indicated in the column labeled “Mode”). In Tables 29-32 and 38, the columns labeled “LOWER_PLACEBO” and “UPPER_PLACEBO” (Tables 29-30 and 38), and “LOWER_RESP” and “UPPER_RESP” (Tables 31-32 and 38), refer to the lower and upper 95% confidence intervals for the hazard ratios. See Example Six below for further information relating to Tables 22-32 and 37-38.

Tables 33-36 provide SNPs that showed significant association with stroke risk in the Cardiovascular Health Study (CHS). Specifically, SNPs that are associated with stroke risk in white or black individuals with 2-sided p-values less than 0.1 (equivalent to 1-sided p-values less than 0.05) are provided in Table 33 (white individuals) and Table 34 (black individuals), and SNPs that are associated with stroke risk in white or black individuals with 2-sided p-values between 0.1 and 0.2 (equivalent to 1-sided p-values between 0.05 and 0.1) are provided in Table 35 (white individuals) and Table 36 (black individuals). Association was analyzed for three related stroke end points, which are indicated in Tables 33-36 by the following abbreviations in the column labeled “endpt”: “stroke”=stroke (all subtypes), “ischem”=ischemic stroke (excludes hemorrhagic stroke), and “athero”=atherothrombotic stroke (excludes hemorrhagic stroke and cardioembolic stroke). See Example Seven below for further information relating to Tables 33-36.

In the tables, the following abbreviations may be used: “ProbChiSq”=p-value, “PVALUE_2DF” or “2DF P-VALUE”=p-value with two degrees of freedom, “PVAL_INTX” or “P_INT_RESP”=Pint (the significance of the genotype by treatment interaction—see description of Tables 23, 25, 27, 31-32, and 37-38 above), “std.ln(OR)”=the standard deviation of the natural log of the OR, “Hom”=homozygotes, “Het”=heterozygotes, “cnt”=count, “frq”=frequency, “dom”=dominant, “rec”=recessive, “gen”=genotypic, “add”=additive, “HW”=Hardy-Weinberg, “TIA”=transient ischemic stroke (also known as a mini stroke), “events”=number of strokes (including TIA) in the study cohort, “DIAB”, “DIABADA”, or “DIABETES_1”=diabetes, “HTN” or “HYPERTEN_1”=hypertension, “ENDPT4F1”=endpoint of stroke or TIA (offical endpoint of the CARE Study), “TIMEVAR”=length of time from baseline to the time of event/endpoint, “TIMETO_EP4F1”=length of time from baseline to the time of endpoint ENDPT4F1 (stroke or TIA), “TRF”=traditional risk factors, “BMI”=body mass index, “AGEBL”=age, “GEND01”=gender, “PRESSM” or “CURRSMK”=smoking status, “LDLADJBL” or “BASE_LDL”=low-density lipoprotein (LDL) cholesterol, and “HDL44BL” or “BASE_HDL”=high-density lipoprotein (HDL) cholesterol (“BASE_LDL” and “BASE_HDL” adjustments are based on continuous variables rather than discrete cutoffs). Two-“sided” p-values may be interchangeably referred to as two-“tailed” p-values.

Throughout the tables, “HR” or “HRR” refers to the hazard ratio, “OR” refers to the odds ratio, terms such as “90% CI” or “95% CI” refer to the 90% or 95% confidence interval (respectively) for the hazard ratio or odds ratio (“CI”/“confidence interval” and “CL”/“confidence limit” may be used herein interchangeably), and terms such as “OR99CI.L” and “OR99CI.U” refer to the lower and upper 99% confidence intervals (respectively) for the odds ratio. Hazard ratios (“HR” or “HRR”) or odds ratios (OR) that are greater than one indicate that a given allele (or combination of alleles such as a haplotype, diplotype, or two-locus diplotype) is a risk allele (which may also be referred to as a susceptibility allele), whereas hazard ratios or odds ratios that are less than one indicate that a given allele is a non-risk allele (which may also be referred to as a protective allele). For a given risk allele, the other alternative allele at the SNP position (which can be derived from the information provided in Tables 1-2, for example) may be considered a non-risk allele. For a given non-risk allele, the other alternative allele at the SNP position may be considered a risk allele.

Thus, with respect to disease risk (e.g., stroke), if the risk estimate (odds ratio or hazard ratio) for a particular allele at a SNP position is greater than one, this indicates that an individual with this particular allele has a higher risk for the disease than an individual who has the other allele at the SNP position. In contrast, if the risk estimate (odds ratio or hazard ratio) for a particular allele is less than one, this indicates that an individual with this particular allele has a reduced risk for the disease compared with an individual who has the other allele at the SNP position.

With respect to drug response (e.g., response to a statin), if the risk estimate (odds ratio or hazard ratio) of those treated with pravastatin compared with those treated with a placebo within a particular genotype is less than one, this indicates that an individual with this particular genotype would benefit from the drug (an odds ratio or hazard ratio equal to one would indicate that the drug has no effect). As used herein, the term “benefit” (with respect to a preventive or therapeutic drug treatment) is defined as achieving a reduced risk for a disease that the drug is intended to treat or prevent (e.g., stroke) by administrating the drug treatment, compared with the risk for the disease in the absence of receiving the drug treatment (or receiving a placebo in lieu of the drug treatment) for the same genotype. The term “benefit” may be used herein interchangeably with terms such as “respond positively” or “positively respond”.

For stroke risk and statin response associations based on samples from the CARE and PROSPER trials described herein, stroke risk is assessed by comparing the risk of stroke for a given genotype with the risk of stroke for a reference genotype either in the placebo arm of the trial or in the whole study population of the trial, and statin response is assessed by comparing the risk of stroke in the pravastatin arm of the trial with the risk of stroke in the placebo arm of the trial for the same genotype.

BRIEF DESCRIPTION OF THE FIGURES

FIGS. 1a-1b show a comparison of Kaplan-Meier estimates of the cumulative incidence of ischemic stroke among Val allele homozygotes of the AB CG2 Val12Met SNP (rs2231137/hCV15854171) and among Met allele carriers in white (FIG. 1a) and in African American (FIG. 1b) participants of CHS (see Example Two).

DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS OF THE INVENTION

The present invention provides SNPs associated with stroke risk, and SNPs that are associated with an individual's responsiveness to therapeutic agents, particularly statins, which may be used for the treatment (including preventive treatment) of stroke. The present invention further provides nucleic acid molecules containing SNPs, methods and reagents for the detection of the SNPs disclosed herein, uses of these SNPs for the development of detection reagents, and assays or kits that utilize such reagents. The SNPs disclosed herein are useful for diagnosing, prognosing, screening for, and evaluating predisposition to stroke and related pathologies in humans. The drug response-associated SNPs disclosed herein are particularly useful for predicting, screening for, and evaluating response to statin treatment, particularly treatment or prevention of stroke using statins, in humans. Furthermore, such SNPs and their encoded products are useful targets for the development of therapeutic and preventive agents.

A large number of SNPs have been identified from re-sequencing DNA from 39 individuals, and they are indicated as “Applera” SNP source in Tables 1-2. Their allele frequencies observed in each of the Caucasian and African-American ethnic groups are provided. Additional SNPs included herein were previously identified during shotgun sequencing and assembly of the human genome, and they are indicated as “Celera” SNP source in Tables 1-2. Furthermore, the information provided in Table 1-2, particularly the allele frequency information obtained from 39 individuals and the identification of the precise position of each SNP within each gene/transcript, allows haplotypes (i.e., groups of SNPs that are co-inherited) to be readily inferred. The present invention encompasses SNP haplotypes, as well as individual SNPs.

Thus, the present invention provides individual SNPs associated with stroke, and/or drug response (particularly statin response), as well as combinations of SNPs and haplotypes in genetic regions associated with stroke, polymorphic/variant transcript sequences (SEQ ID NOS:1-80) and genomic sequences (SEQ ID NOS:260-435) containing SNPs, encoded amino acid sequences (SEQ ID NOS: 81-160), and both transcript-based SNP context sequences (SEQ ID NOS:161-259) and genomic-based SNP context sequences (SEQ ID NOS:436-1566) (transcript sequences, protein sequences, and transcript-based SNP context sequences are provided in Table 1 and the Sequence Listing; genomic sequences and genomic-based SNP context sequences are provided in Table 2 and the Sequence Listing), methods of detecting these polymorphisms in a test sample, methods of determining the risk of an individual of having a stroke, methods of determining if an individual is likely to respond to a particular treatment such as statins (particularly for treating or preventing stroke), methods of screening for compounds useful for treating disorders associated with a variant gene/protein such as stroke, compounds identified by these screening methods, methods of using the disclosed SNPs to select a treatment/preventive strategy or therapeutic agent (e.g., a statin), methods of treating or preventing a disorder associated with a variant gene/protein, and methods of using the SNPs of the present invention for human identification.

For example, certain embodiments provide methods of using any of rs3900940/hCV7425232 (MYH15), rs3814843/hCV11476411 (CALM1), rs2200733/hCV16158671 (chromosome 4q25), and/or rs10757274/hCV26505812 (chromosome 9p21) for determining stroke risk in an individual, and methods of using rs10757274/hCV26505812 (chromosome 9p21) for determining whether an individual will benefit from statin treatment.

Since vascular disorders/diseases share certain similar features that may be due to common genetic factors that are involved in their underlying mechanisms, the SNPs identified herein as being particularly associated with stroke may be used as diagnostic/prognostic markers or therapeutic targets for other vascular diseases such as coronary heart disease (CHD), atherosclerosis, cardiovascular disease, congestive heart failure, congenital heart disease, and pathologies and symptoms associated with various heart diseases (e.g., angina, hypertension), as well as for predicting responses to drugs such as statins that are used to treat cardiovascular diseases.

The present invention further provides methods for selecting or formulating a treatment regimen (e.g., methods for determining whether or not to administer statin treatment to an individual who has previously had a stroke, or who is at risk for having a stroke in the future, methods for selecting a particular statin-based treatment regimen such as dosage and frequency of administration of statin, or a particular form/type of statin such as a particular pharmaceutical formulation or statin compound, methods for administering an alternative, non-statin-based treatment to individuals who are predicted to be unlikely to respond positively to statin treatment, etc.), and methods for determining the likelihood of experiencing toxicity or other undesirable side effects from statin treatment, etc. The present invention also provides methods for selecting individuals to whom a statin or other therapeutic will be administered based on the individual's genotype, and methods for selecting individuals for a clinical trial of a statin or other therapeutic agent based on the genotypes of the individuals (e.g., selecting individuals to participate in the trial who are most likely to respond positively from the statin treatment and/or excluding individuals from the trial who are unlikely to respond positively from the statin treatment).

The present invention provides novel SNPs associated with stroke and related pathologies, as well as SNPs that were previously known in the art, but were not previously known to be associated with stroke or response to statin treatment. Accordingly, the present invention provides novel compositions and methods based on the novel SNPs disclosed herein, and also provides novel methods of using the known, but previously unassociated, SNPs in methods relating to evaluating an individual's likelihood of having a first or recurrent stroke, prognosing the severity of stroke in an individual, or prognosing an individual's recovery from stroke, and methods relating to evaluating an individual's likelihood of responding to statin treatment (particularly statin treatment, including preventive treatment, of stroke). In Tables 1-2, known SNPs are identified based on the public database in which they have been observed, which is indicated as one or more of the following SNP types: “dbSNP”=SNP observed in dbSNP, “HGBASE”=SNP observed in HGBASE, and “HGMD”=SNP observed in the Human Gene Mutation Database (HGMD).

Particular SNP alleles of the present invention can be associated with either an increased risk of having a stroke (or related pathologies), or a decreased risk of having a stroke. SNP alleles that are associated with a decreased risk of having a stroke may be referred to as “protective” alleles, and SNP alleles that are associated with an increased risk of having a stroke may be referred to as “susceptibility” alleles, “risk” alleles, or “risk factors”. Thus, whereas certain SNPs (or their encoded products) can be assayed to determine whether an individual possesses a SNP allele that is indicative of an increased risk of having a stroke (i.e., a susceptibility allele), other SNPs (or their encoded products) can be assayed to determine whether an individual possesses a SNP allele that is indicative of a decreased risk of having a stroke (i.e., a protective allele). Similarly, particular SNP alleles of the present invention can be associated with either an increased or decreased likelihood of responding to a particular treatment or therapeutic compound (e.g., statins), or an increased or decreased likelihood of experiencing toxic effects from a particular treatment or therapeutic compound. The term “altered” may be used herein to encompass either of these two possibilities (e.g., an increased or a decreased risk/likelihood).

Those skilled in the art will readily recognize that nucleic acid molecules may be double-stranded molecules and that reference to a particular site on one strand refers, as well, to the corresponding site on a complementary strand. In defining a SNP position, SNP allele, or nucleotide sequence, reference to an adenine, a thymine (uridine), a cytosine, or a guanine at a particular site on one strand of a nucleic acid molecule also defines the thymine (uridine), adenine, guanine, or cytosine (respectively) at the corresponding site on a complementary strand of the nucleic acid molecule. Thus, reference may be made to either strand in order to refer to a particular SNP position, SNP allele, or nucleotide sequence. Probes and primers, may be designed to hybridize to either strand and SNP genotyping methods disclosed herein may generally target either strand. Throughout the specification, in identifying a SNP position, reference is generally made to the protein-encoding strand, only for the purpose of convenience.

References to variant peptides, polypeptides, or proteins of the present invention include peptides, polypeptides, proteins, or fragments thereof, that contain at least one amino acid residue that differs from the corresponding amino acid sequence of the art-known peptide/polypeptide/protein (the art-known protein may be interchangeably referred to as the “wild-type”, “reference”, or “normal” protein). Such variant peptides/polypeptides/proteins can result from a codon change caused by a nonsynonymous nucleotide substitution at a protein-coding SNP position (i.e., a missense mutation) disclosed by the present invention. Variant peptides/polypeptides/proteins of the present invention can also result from a nonsense mutation, i.e., a SNP that creates a premature stop codon, a SNP that generates a read-through mutation by abolishing a stop codon, or due to any SNP disclosed by the present invention that otherwise alters the structure, function/activity, or expression of a protein, such as a SNP in a regulatory region (e.g. a promoter or enhancer) or a SNP that leads to alternative or defective splicing, such as a SNP in an intron or a SNP at an exon/intron boundary. As used herein, the terms “polypeptide”, “peptide”, and “protein” are used interchangeably.

As used herein, an “allele” may refer to a nucleotide at a SNP position (wherein at least two alternative nucleotides are present in the population at the SNP position, in accordance with the inherent definition of a SNP) or may refer to an amino acid residue that is encoded by the codon which contains the SNP position (where the alternative nucleotides that are present in the population at the SNP position form alternative codons that encode different amino acid residues). An “allele” may also be referred to herein as a “variant”. Also, an amino acid residue that is encoded by a codon containing a particular SNP may simply be referred to as being encoded by the SNP.

A phrase such as “as represented by”, “as shown by”, “as symbolized by”, or “as designated by” may be used herein to refer to a SNP within a sequence (e.g., a polynucleotide context sequence surrounding a SNP), such as in the context of “a polymorphism as represented by position 101 of SEQ ID NO:X or its complement”. Typically, the sequence surrounding a SNP may be recited when referring to a SNP, however the sequence is not intended as a structural limitation beyond the specific SNP position itself. Rather, the sequence is recited merely as a way of referring to the SNP (in this example, “SEQ ID NO:X or its complement” is recited in order to refer to the SNP located at position 101 of SEQ ID NO:X, but SEQ ID NO:X or its complement is not intended as a structural limitation beyond the specific SNP position itself). A SNP is a variation at a single nucleotide position and therefore it is customary to refer to context sequence (e.g., SEQ ID NO:X in this example) surrounding a particular SNP position in order to uniquely identify and refer to the SNP. Alternatively, a SNP can be referred to by a unique identification number such as a public “rs” identification number or an internal “hCV” identification number, such as provided herein for each SNP (e.g., in Tables 1-2).

With respect to an individual's risk for a disease or predicted drug responsiveness (e.g., based on the presence or absence of one or more SNPs disclosed herein in the individual's nucleic acid), terms such as “assigning” or “designating” may be used herein to characterize the individual's risk for the disease.

As used herein, the term “benefit” (with respect to a preventive or therapeutic drug treatment) is defined as achieving a reduced risk for a disease that the drug is intended to treat or prevent (e.g., stroke) by administrating the drug treatment (e.g., a statin), compared with the risk for the disease in the absence of receiving the drug treatment (or receiving a placebo in lieu of the drug treatment) for the same genotype. The term “benefit” may be used herein interchangeably with terms such as “respond positively” or “positively respond”.

As used herein, the terms “drug” and “therapeutic agent” are used interchangeably, and may include, but are not limited to, small molecule compounds, biologics (e.g., antibodies, proteins, protein fragments, fusion proteins, glycoproteins, etc.), nucleic acid agents (e.g., antisense, RNAi/siRNA, and microRNA molecules, etc.), vaccines, etc., which may be used for therapeutic and/or preventive treatment of a disease (e.g., stroke).

The statin response-associated SNPs disclosed herein are useful with respect to any statin (HMG-CoA reductase inhibitor), including but not limited to pravastatin (Pravachol®), atorvastatin (Lipitor®), storvastatin, rosuvastatin (Crestor®), fluvastatin (Lescol®), lovastatin (Mevacor®), and simvastatin (Zocor®), as well as combination therapies that include a statin such as simvastatin+ezetimibe (Vytorin®), lovastatin+niacin extended-release (Advicor®), and atorvastatin+amlodipine besylate (Caduet®).

Furthermore, the drug response-associated SNPs disclosed herein may also be used for predicting an individual's responsiveness to drugs other than statins that are used to treat or prevent stroke, and these SNPs may also be used for predicting an individual's responsiveness to statins for the treatment or prevention of disorders other than stroke, particularly cancer. For example, the use of statins in the treatment of cancer is reviewed in: Hindler et al., “The role of statins in cancer therapy”, Oncologist. 2006 March; 11(3):306-15; Demierre et al., “Statins and cancer prevention”, Nat Rev Cancer. 2005 December; 5(12):930-42; Stamm et al., “The role of statins in cancer prevention and treatment”, Oncology. 2005 May; 19(6):739-50; and Sleijfer et al., “The potential of statins as part of anti-cancer treatment”, Eur J Cancer. 2005 March; 41(4):516-22, each of which is incorporated herein by reference in their entirety.

Drug response with respect to statins may be referred to herein as “stroke statin response” or “SSR”.

The various methods described herein, such as correlating the presence or absence of a polymorphism with an altered (e.g., increased or decreased) risk (or no altered risk) for stroke (and/or correlating the presence or absence of a polymorphism with the predicted response of an individual to a drug such as a statin), can be carried out by automated methods such as by using a computer (or other apparatus/devices such as biomedical devices, laboratory instrumentation, or other apparatus/devices having a computer processor) programmed to carry out any of the methods described herein. For example, computer software (which may be interchangeably referred to herein as a computer program) can perform the step of correlating the presence or absence of a polymorphism in an individual with an altered (e.g., increased or decreased) risk (or no altered risk) for stroke for the individual. Computer software can also perform the step of correlating the presence or absence of a polymorphism in an individual with the predicted response of the individual to a therapeutic agent (such as a statin) or other treatment. Accordingly, certain embodiments of the invention provide a computer (or other apparatus/device) programmed to carry out any of the methods described herein.

Reports, Programmed Computers, Business Methods, and Systems

The results of a test (e.g., an individual's risk for stroke or an individual's predicted drug responsiveness such as statin response, based on assaying one or more SNPs disclosed herein, and/or an individual's allele(s)/genotype at one or more SNPs disclosed herein, etc.), and/or any other information pertaining to a test, may be referred to herein as a “report”. A tangible report can optionally be generated as part of a testing process (which may be interchangeably referred to herein as “reporting”, or as “providing” a report, “producing” a report, or “generating” a report).

Examples of tangible reports may include, but are not limited to, reports in paper (such as computer-generated printouts of test results) or equivalent formats and reports stored on computer readable medium (such as a CD, USB flash drive or other removable storage device, computer hard drive, or computer network server, etc.). Reports, particularly those stored on computer readable medium, can be part of a database, which may optionally be accessible via the internet (such as a database of patient records or genetic information stored on a computer network server, which may be a “secure database” that has security features that limit access to the report, such as to allow only the patient and the patient's medical practioners to view the report while preventing other unauthorized individuals from viewing the report, for example). In addition to, or as an alternative to, generating a tangible report, reports can also be displayed on a computer screen (or the display of another electronic device or instrument).

A report can include, for example, an individual's risk for stroke, or may just include the allele(s)/genotype that an individual carries at one or more SNPs disclosed herein, which may optionally be linked to information regarding the significance of having the allele(s)/genotype at the SNP (for example, a report on computer readable medium such as a network server may include hyperlink(s) to one or more journal publications or websites that describe the medical/biological implications, such as increased or decreased disease risk, for individuals having a certain allele/genotype at the SNP). Thus, for example, the report can include disease risk or other medical/biological significance (e.g., drug responsiveness, etc.) as well as optionally also including the allele/genotype information, or the report may just include allele/genotype information without including disease risk or other medical/biological significance (such that an individual viewing the report can use the allele/genotype information to determine the associated disease risk or other medical/biological significance from a source outside of the report itself, such as from a medical practioner, publication, website, etc., which may optionally be linked to the report such as by a hyperlink).

A report can further be “transmitted” or “communicated” (these terms may be used herein interchangeably), such as to the individual who was tested, a medical practitioner (e.g., a doctor, nurse, clinical laboratory practitioner, genetic counselor, etc.), a healthcare organization, a clinical laboratory, and/or any other party or requester intended to view or possess the report. The act of “transmitting” or “communicating” a report can be by any means known in the art, based on the format of the report. Furthermore, “transmitting” or “communicating” a report can include delivering a report (“pushing”) and/or retrieving (“pulling”) a report. For example, reports can be transmitted/communicated by various means, including being physically transferred between parties (such as for reports in paper format) such as by being physically delivered from one party to another, or by being transmitted electronically or in signal form (e.g., via e-mail or over the internet, by facsimile, and/or by any wired or wireless communication methods known in the art) such as by being retrieved from a database stored on a computer network server, etc.

In certain exemplary embodiments, the invention provides computers (or other apparatus/devices such as biomedical devices or laboratory instrumentation) programmed to carry out the methods described herein. For example, in certain embodiments, the invention provides a computer programmed to receive (i.e., as input) the identity (e.g., the allele(s) or genotype at a SNP) of one or more SNPs disclosed herein and provide (i.e., as output) the disease risk (e.g., an individual's risk for stroke) or other result (e.g., disease diagnosis or prognosis, drug responsiveness, etc.) based on the identity of the SNP(s). Such output (e.g., communication of disease risk, disease diagnosis or prognosis, drug responsiveness, etc.) may be, for example, in the form of a report on computer readable medium, printed in paper form, and/or displayed on a computer screen or other display.

In various exemplary embodiments, the invention further provides methods of doing business (with respect to methods of doing business, the terms “individual” and “customer” are used herein interchangeably). For example, exemplary methods of doing business can comprise assaying one or more SNPs disclosed herein and providing a report that includes, for example, a customer's risk for stroke (based on which allele(s)/genotype is present at the assayed SNP(s)) and/or that includes the allele(s)/genotype at the assayed SNP(s) which may optionally be linked to information (e.g., journal publications, websites, etc.) pertaining to disease risk or other biological/medical significance such as by means of a hyperlink (the report may be provided, for example, on a computer network server or other computer readable medium that is internet-accessible, and the report may be included in a secure database that allows the customer to access their report while preventing other unauthorized individuals from viewing the report), and optionally transmitting the report. Customers (or another party who is associated with the customer, such as the customer's doctor, for example) can request/order (e.g., purchase) the test online via the internet (or by phone, mail order, at an outlet/store, etc.), for example, and a kit can be sent/delivered (or otherwise provided) to the customer (or another party on behalf of the customer, such as the customer's doctor, for example) for collection of a biological sample from the customer (e.g., a buccal swab for collecting buccal cells), and the customer (or a party who collects the customer's biological sample) can submit their biological samples for assaying (e.g., to a laboratory or party associated with the laboratory such as a party that accepts the customer samples on behalf of the laboratory, a party for whom the laboratory is under the control of (e.g., the laboratory carries out the assays by request of the party or under a contract with the party, for example), and/or a party that receives at least a portion of the customer's payment for the test). The report (e.g., results of the assay including, for example, the customer's disease risk and/or allele(s)/genotype at the assayed SNP(s)) may be provided to the customer by, for example, the laboratory that assays the SNP(s) or a party associated with the laboratory (e.g., a party that receives at least a portion of the customer's payment for the assay, or a party that requests the laboratory to carry out the assays or that contracts with the laboratory for the assays to be carried out) or a doctor or other medical practitioner who is associated with (e.g., employed by or having a consulting or contracting arrangement with) the laboratory or with a party associated with the laboratory, or the report may be provided to a third party (e.g., a doctor, genetic counselor, hospital, etc.) which optionally provides the report to the customer. In further embodiments, the customer may be a doctor or other medical practitioner, or a hospital, laboratory, medical insurance organization, or other medical organization that requests/orders (e.g., purchases) tests for the purposes of having other individuals (e.g., their patients or customers) assayed for one or more SNPs disclosed herein and optionally obtaining a report of the assay results.

In certain exemplary methods of doing business, kits for collecting a biological sample from a customer (e.g., a buccal swab for collecting buccal cells) are provided (e.g., for sale), such as at an outlet (e.g., a drug store, pharmacy, general merchandise store, or any other desirable outlet), online via the internet, by mail order, etc., whereby customers can obtain (e.g., purchase) the kits, collect their own biological samples, and submit (e.g., send/deliver via mail) their samples to a laboratory which assays the samples for one or more SNPs disclosed herein (such as to determine the customer's risk for stroke) and optionally provides a report to the customer (of the customer's disease risk based on their SNP genotype(s), for example) or provides the results of the assay to another party (e.g., a doctor, genetic counselor, hospital, etc.) which optionally provides a report to the customer (of the customer's disease risk based on their SNP genotype(s), for example).

Certain further embodiments of the invention provide a system for determining an individual's stroke risk, or whether an individual will benefit from statin treatment (or other therapy) in reducing stroke risk. Certain exemplary systems comprise an integrated “loop” in which an individual (or their medical practitioner) requests a determination of such individual's stroke risk (or drug response, etc.), this determination is carried out by testing a sample from the individual, and then the results of this determination are provided back to the requestor. For example, in certain systems, a sample (e.g., blood or buccal cells) is obtained from an individual for testing (the sample may be obtained by the individual or, for example, by a medical practitioner), the sample is submitted to a laboratory (or other facility) for testing (e.g., determining the genotype of one or more SNPs disclosed herein), and then the results of the testing are sent to the patient (which optionally can be done by first sending the results to an intermediary, such as a medical practioner, who then provides or otherwise conveys the results to the individual), thereby forming an integrated loop system for determining an individual's stroke risk (or drug response, etc.). The portions of the system in which the results are transmitted (e.g., between any of a testing facility, a medical practitioner, and/or the individual) can be carried out by way of electronic or signal transmission (e.g., by computer such as via e-mail or the internet, by providing the results on a website or computer network server which may optionally be a secure database, by phone or fax, or by any other wired or wireless transmission methods known in the art).

Isolated Nucleic Acid Molecules and SNP Detection Reagents & Kits

Tables 1 and 2 provide a variety of information about each SNP of the present invention that is associated with stroke, including the transcript sequences (SEQ ID NOS:1-80), genomic sequences (SEQ ID NOS:260-435), and protein sequences (SEQ ID NOS:81-160) of the encoded gene products (with the SNPs indicated by IUB codes in the nucleic acid sequences). In addition, Tables 1 and 2 include SNP context sequences, which generally include 100 nucleotide upstream (5′) plus 100 nucleotides downstream (3′) of each SNP position (SEQ ID NOS:161-259 correspond to transcript-based SNP context sequences disclosed in Table 1, and SEQ ID NOS:436-1566 correspond to genomic-based context sequences disclosed in Table 2), the alternative nucleotides (alleles) at each SNP position, and additional information about the variant where relevant, such as SNP type (coding, missense, splice site, UTR, etc.), human populations in which the SNP was observed, observed allele frequencies, information about the encoded protein, etc.

Isolated Nucleic Acid Molecules

The present invention provides isolated nucleic acid molecules that contain one or more SNPs disclosed Table 1 and/or Table 2. Preferred isolated nucleic acid molecules contain one or more SNPs identified as Applera or Celera proprietary. Isolated nucleic acid molecules containing one or more SNPs disclosed in at least one of Tables 1-2 may be interchangeably referred to throughout the present text as “SNP-containing nucleic acid molecules”. Isolated nucleic acid molecules may optionally encode a full-length variant protein or fragment thereof. The isolated nucleic acid molecules of the present invention also include probes and primers (which are described in greater detail below in the section entitled “SNP Detection Reagents”), which may be used for assaying the disclosed SNPs, and isolated full-length genes, transcripts, cDNA molecules, and fragments thereof, which may be used for such purposes as expressing an encoded protein.

As used herein, an “isolated nucleic acid molecule” generally is one that contains a SNP of the present invention or one that hybridizes to such molecule such as a nucleic acid with a complementary sequence, and is separated from most other nucleic acids present in the natural source of the nucleic acid molecule. Moreover, an “isolated” nucleic acid molecule, such as a cDNA molecule containing a SNP of the present invention, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or chemical precursors or other chemicals when chemically synthesized. A nucleic acid molecule can be fused to other coding or regulatory sequences and still be considered “isolated”. Nucleic acid molecules present in non-human transgenic animals, which do not naturally occur in the animal, are also considered “isolated”. For example, recombinant DNA molecules contained in a vector are considered “isolated”. Further examples of “isolated” DNA molecules include recombinant DNA molecules maintained in heterologous host cells, and purified (partially or substantially) DNA molecules in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the isolated SNP-containing DNA molecules of the present invention. Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically.

Generally, an isolated SNP-containing nucleic acid molecule comprises one or more SNP positions disclosed by the present invention with flanking nucleotide sequences on either side of the SNP positions. A flanking sequence can include nucleotide residues that are naturally associated with the SNP site and/or heterologous nucleotide sequences. Preferably the flanking sequence is up to about 500, 300, 100, 60, 50, 30, 25, 20, 15, 10, 8, or 4 nucleotides (or any other length in-between) on either side of a SNP position, or as long as the full-length gene or entire protein-coding sequence (or any portion thereof such as an exon), especially if the SNP-containing nucleic acid molecule is to be used to produce a protein or protein fragment.

For full-length genes and entire protein-coding sequences, a SNP flanking sequence can be, for example, up to about 5 KB, 4 KB, 3 KB, 2 KB, 1 KB on either side of the SNP. Furthermore, in such instances, the isolated nucleic acid molecule comprises exonic sequences (including protein-coding and/or non-coding exonic sequences), but may also include intronic sequences. Thus, any protein coding sequence may be either contiguous or separated by introns. The important point is that the nucleic acid is isolated from remote and unimportant flanking sequences and is of appropriate length such that it can be subjected to the specific manipulations or uses described herein such as recombinant protein expression, preparation of probes and primers for assaying the SNP position, and other uses specific to the SNP-containing nucleic acid sequences.

An isolated SNP-containing nucleic acid molecule can comprise, for example, a full-length gene or transcript, such as a gene isolated from genomic DNA (e.g., by cloning or PCR amplification), a cDNA molecule, or an mRNA transcript molecule. Polymorphic transcript sequences are provided in Table 1 and in the Sequence Listing (SEQ ID NOS:1-80), and polymorphic genomic sequences are provided in Table 2 and in the Sequence Listing (SEQ ID NOS:260-435). Furthermore, fragments of such full-length genes and transcripts that contain one or more SNPs disclosed herein are also encompassed by the present invention, and such fragments may be used, for example, to express any part of a protein, such as a particular functional domain or an antigenic epitope.

Thus, the present invention also encompasses fragments of the nucleic acid sequences provided in Tables 1-2 (transcript sequences are provided in Table 1 as SEQ ID NOS:1-80, genomic sequences are provided in Table 2 as SEQ ID NOS:260-435, transcript-based SNP context sequences are provided in Table 1 as SEQ ID NO:161-259, and genomic-based SNP context sequences are provided in Table 2 as SEQ ID NO:436-1566) and their complements. A fragment typically comprises a contiguous nucleotide sequence at least about 8 or more nucleotides, more preferably at least about 12 or more nucleotides, and even more preferably at least about 16 or more nucleotides. Further, a fragment could comprise at least about 18, 20, 22, 25, 30, 40, 50, 60, 80, 100, 150, 200, 250 or 500 (or any other number in-between) nucleotides in length. The length of the fragment will be based on its intended use. For example, the fragment can encode epitope-bearing regions of a variant peptide or regions of a variant peptide that differ from the normal/wild-type protein, or can be useful as a polynucleotide probe or primer. Such fragments can be isolated using the nucleotide sequences provided in Table 1 and/or Table 2 for the synthesis of a polynucleotide probe. A labeled probe can then be used, for example, to screen a cDNA library, genomic DNA library, or mRNA to isolate nucleic acid corresponding to the coding region. Further, primers can be used in amplification reactions, such as for purposes of assaying one or more SNPs sites or for cloning specific regions of a gene.

An isolated nucleic acid molecule of the present invention further encompasses a SNP-containing polynucleotide that is the product of any one of a variety of nucleic acid amplification methods, which are used to increase the copy numbers of a polynucleotide of interest in a nucleic acid sample. Such amplification methods are well known in the art, and they include but are not limited to, polymerase chain reaction (PCR) (U.S. Pat. Nos. 4,683,195; and 4,683,202; PCR Technology: Principles and Applications for DNA Amplification, ed. H. A. Erlich, Freeman Press, NY, NY, 1992), ligase chain reaction (LCR) (Wu and Wallace, Genomics 4:560, 1989; Landegren et al., Science 241:1077, 1988), strand displacement amplification (SDA) (U.S. Pat. Nos. 5,270,184; and 5,422,252), transcription-mediated amplification (TMA) (U.S. Pat. No. 5,399,491), linked linear amplification (LLA) (U.S. Pat. No. 6,027,923), and the like, and isothermal amplification methods such as nucleic acid sequence based amplification (NASBA), and self-sustained sequence replication (Guatelli et al., Proc. Natl. Acad. Sci. USA 87: 1874, 1990). Based on such methodologies, a person skilled in the art can readily design primers in any suitable regions 5′ and 3′ to a SNP disclosed herein. Such primers may be used to amplify DNA of any length so long that it contains the SNP of interest in its sequence.

As used herein, an “amplified polynucleotide” of the invention is a SNP-containing nucleic acid molecule whose amount has been increased at least two fold by any nucleic acid amplification method performed in vitro as compared to its starting amount in a test sample. In other preferred embodiments, an amplified polynucleotide is the result of at least ten-fold, fifty-fold, one hundred-fold, one thousand-fold, or ten thousand-fold increase as compared to its starting amount in a test sample. In a typical PCR amplification, a polynucleotide of interest is often amplified at least fifty thousand-fold in amount over the unamplified genomic DNA, but the precise amount of amplification needed for an assay typically depends on the sensitivity of the subsequent detection method used.

Generally, an amplified polynucleotide is at least about 16 nucleotides in length. More typically, an amplified polynucleotide is at least about 20 nucleotides in length. In a preferred embodiment of the invention, an amplified polynucleotide is at least about 30 nucleotides in length. In a more preferred embodiment of the invention, an amplified polynucleotide is at least about 32, 40, 45, 50, or 60 nucleotides in length. In yet another preferred embodiment of the invention, an amplified polynucleotide is at least about 100, 200, 300, 400, or 500 nucleotides in length. While the total length of an amplified polynucleotide of the invention can be as long as an exon, an intron or the entire gene where the SNP of interest resides, an amplified product is typically up to about 1,000 nucleotides in length (although certain amplification methods may generate amplified products greater than 1000 nucleotides in length). More preferably, an amplified polynucleotide is not greater than about 600-700 nucleotides in length. It is understood that irrespective of the length of an amplified polynucleotide, a SNP of interest may be located anywhere along its sequence.

In a specific embodiment of the invention, the amplified product is at least about 201 nucleotides in length, comprises one of the transcript-based context sequences or the genomic-based context sequences shown in Tables 1-2. Such a product may have additional sequences on its 5′ end or 3′ end or both. In another embodiment, the amplified product is about 101 nucleotides in length, and it contains a SNP disclosed herein. Preferably, the SNP is located at the middle of the amplified product (e.g., at position 101 in an amplified product that is 201 nucleotides in length, or at position 51 in an amplified product that is 101 nucleotides in length), or within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, or 20 nucleotides from the middle of the amplified product (however, as indicated above, the SNP of interest may be located anywhere along the length of the amplified product).

The present invention provides isolated nucleic acid molecules that comprise, consist of, or consist essentially of one or more polynucleotide sequences that contain one or more SNPs disclosed herein, complements thereof, and SNP-containing fragments thereof.

Accordingly, the present invention provides nucleic acid molecules that consist of any of the nucleotide sequences shown in Table 1 and/or Table 2 (transcript sequences are provided in Table 1 as SEQ ID NOS:1-80, genomic sequences are provided in Table 2 as SEQ ID NOS:260-435, transcript-based SNP context sequences are provided in Table 1 as SEQ ID NO:161-259, and genomic-based SNP context sequences are provided in Table 2 as SEQ ID NO:436-1566), or any nucleic acid molecule that encodes any of the variant proteins provided in Table 1 (SEQ ID NOS:81-160). A nucleic acid molecule consists of a nucleotide sequence when the nucleotide sequence is the complete nucleotide sequence of the nucleic acid molecule.

The present invention further provides nucleic acid molecules that consist essentially of any of the nucleotide sequences shown in Table 1 and/or Table 2 (transcript sequences are provided in Table 1 as SEQ ID NOS:1-80, genomic sequences are provided in Table 2 as SEQ ID NOS:260-435, transcript-based SNP context sequences are provided in Table 1 as SEQ ID NO:161-259, and genomic-based SNP context sequences are provided in Table 2 as SEQ ID NO:436-1566), or any nucleic acid molecule that encodes any of the variant proteins provided in Table 1 (SEQ ID NOS:81-160). A nucleic acid molecule consists essentially of a nucleotide sequence when such a nucleotide sequence is present with only a few additional nucleotide residues in the final nucleic acid molecule.

The present invention further provides nucleic acid molecules that comprise any of the nucleotide sequences shown in Table 1 and/or Table 2 or a SNP-containing fragment thereof (transcript sequences are provided in Table 1 as SEQ ID NOS:1-80, genomic sequences are provided in Table 2 as SEQ ID NOS:260-435, transcript-based SNP context sequences are provided in Table 1 as SEQ ID NO:161-259, and genomic-based SNP context sequences are provided in Table 2 as SEQ ID NO:436-1566), or any nucleic acid molecule that encodes any of the variant proteins provided in Table 1 (SEQ ID NOS:81-160). A nucleic acid molecule comprises a nucleotide sequence when the nucleotide sequence is at least part of the final nucleotide sequence of the nucleic acid molecule. In such a fashion, the nucleic acid molecule can be only the nucleotide sequence or have additional nucleotide residues, such as residues that are naturally associated with it or heterologous nucleotide sequences. Such a nucleic acid molecule can have one to a few additional nucleotides or can comprise many more additional nucleotides. A brief description of how various types of these nucleic acid molecules can be readily made and isolated is provided below, and such techniques are well known to those of ordinary skill in the art (Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY).

The isolated nucleic acid molecules can encode mature proteins plus additional amino or carboxyl-terminal amino acids or both, or amino acids interior to the mature peptide (when the mature form has more than one peptide chain, for instance). Such sequences may play a role in processing of a protein from precursor to a mature form, facilitate protein trafficking, prolong or shorten protein half-life, or facilitate manipulation of a protein for assay or production. As generally is the case in situ, the additional amino acids may be processed away from the mature protein by cellular enzymes.

Thus, the isolated nucleic acid molecules include, but are not limited to, nucleic acid molecules having a sequence encoding a peptide alone, a sequence encoding a mature peptide and additional coding sequences such as a leader or secretory sequence (e.g., a pre-pro or pro-protein sequence), a sequence encoding a mature peptide with or without additional coding sequences, plus additional non-coding sequences, for example introns and non-coding 5′ and 3′ sequences such as transcribed but untranslated sequences that play a role in, for example, transcription, mRNA processing (including splicing and polyadenylation signals), ribosome binding, and/or stability of mRNA. In addition, the nucleic acid molecules may be fused to heterologous marker sequences encoding, for example, a peptide that facilitates purification.

Isolated nucleic acid molecules can be in the form of RNA, such as mRNA, or in the form DNA, including cDNA and genomic DNA, which may be obtained, for example, by molecular cloning or produced by chemical synthetic techniques or by a combination thereof (Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY). Furthermore, isolated nucleic acid molecules, particularly SNP detection reagents such as probes and primers, can also be partially or completely in the form of one or more types of nucleic acid analogs, such as peptide nucleic acid (PNA) (U.S. Pat. Nos. 5,539,082; 5,527,675; 5,623,049; 5,714,331). The nucleic acid, especially DNA, can be double-stranded or single-stranded. Single-stranded nucleic acid can be the coding strand (sense strand) or the complementary non-coding strand (anti-sense strand). DNA, RNA, or PNA segments can be assembled, for example, from fragments of the human genome (in the case of DNA or RNA) or single nucleotides, short oligonucleotide linkers, or from a series of oligonucleotides, to provide a synthetic nucleic acid molecule. Nucleic acid molecules can be readily synthesized using the sequences provided herein as a reference; oligonucleotide and PNA oligomer synthesis techniques are well known in the art (see, e.g., Corey, “Peptide nucleic acids: expanding the scope of nucleic acid recognition”, Trends Biotechnol. 1997 June; 15(6):224-9, and Hyrup et al., “Peptide nucleic acids (PNA): synthesis, properties and potential applications”, Bioorg Med Chem. 1996 January; 4(1):5-23). Furthermore, large-scale automated oligonucleotide/PNA synthesis (including synthesis on an array or bead surface or other solid support) can readily be accomplished using commercially available nucleic acid synthesizers, such as the Applied Biosystems (Foster City, Calif.) 3900 High-Throughput DNA Synthesizer or Expedite 8909 Nucleic Acid Synthesis System, and the sequence information provided herein.

The present invention encompasses nucleic acid analogs that contain modified, synthetic, or non-naturally occurring nucleotides or structural elements or other alternative/modified nucleic acid chemistries known in the art. Such nucleic acid analogs are useful, for example, as detection reagents (e.g., primers/probes) for detecting one or more SNPs identified in Table 1 and/or Table 2. Furthermore, kits/systems (such as beads, arrays, etc.) that include these analogs are also encompassed by the present invention. For example, PNA oligomers that are based on the polymorphic sequences of the present invention are specifically contemplated. PNA oligomers are analogs of DNA in which the phosphate backbone is replaced with a peptide-like backbone (Lagriffoul et al., Bioorganic & Medicinal Chemistry Letters, 4: 1081-1082 (1994), Petersen et al., Bioorganic & Medicinal Chemistry Letters, 6: 793-796 (1996), Kumar et al., Organic Letters 3(9): 1269-1272 (2001), WO96/04000). PNA hybridizes to complementary RNA or DNA with higher affinity and specificity than conventional oligonucleotides and oligonucleotide analogs. The properties of PNA enable novel molecular biology and biochemistry applications unachievable with traditional oligonucleotides and peptides.

Additional examples of nucleic acid modifications that improve the binding properties and/or stability of a nucleic acid include the use of base analogs such as inosine, intercalators (U.S. Pat. No. 4,835,263) and the minor groove binders (U.S. Pat. No. 5,801,115). Thus, references herein to nucleic acid molecules, SNP-containing nucleic acid molecules, SNP detection reagents (e.g., probes and primers), oligonucleotides/polynucleotides include PNA oligomers and other nucleic acid analogs. Other examples of nucleic acid analogs and alternative/modified nucleic acid chemistries known in the art are described in Current Protocols in Nucleic Acid Chemistry, John Wiley & Sons, N.Y. (2002).

The present invention further provides nucleic acid molecules that encode fragments of the variant polypeptides disclosed herein as well as nucleic acid molecules that encode obvious variants of such variant polypeptides. Such nucleic acid molecules may be naturally occurring, such as paralogs (different locus) and orthologs (different organism), or may be constructed by recombinant DNA methods or by chemical synthesis. Non-naturally occurring variants may be made by mutagenesis techniques, including those applied to nucleic acid molecules, cells, or organisms. Accordingly, the variants can contain nucleotide substitutions, deletions, inversions and insertions (in addition to the SNPs disclosed in Tables 1-2). Variation can occur in either or both the coding and non-coding regions. The variations can produce conservative and/or non-conservative amino acid substitutions.

Further variants of the nucleic acid molecules disclosed in Tables 1-2, such as naturally occurring allelic variants (as well as orthologs and paralogs) and synthetic variants produced by mutagenesis techniques, can be identified and/or produced using methods well known in the art. Such further variants can comprise a nucleotide sequence that shares at least 70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with a nucleic acid sequence disclosed in Table 1 and/or Table 2 (or a fragment thereof) and that includes a novel SNP allele disclosed in Table 1 and/or Table 2. Further, variants can comprise a nucleotide sequence that encodes a polypeptide that shares at least 70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with a polypeptide sequence disclosed in Table 1 (or a fragment thereof) and that includes a novel SNP allele disclosed in Table 1 and/or Table 2. Thus, an aspect of the present invention that is specifically contemplated are isolated nucleic acid molecules that have a certain degree of sequence variation compared with the sequences shown in Tables 1-2, but that contain a novel SNP allele disclosed herein. In other words, as long as an isolated nucleic acid molecule contains a novel SNP allele disclosed herein, other portions of the nucleic acid molecule that flank the novel SNP allele can vary to some degree from the specific transcript, genomic, and context sequences shown in Tables 1-2, and can encode a polypeptide that varies to some degree from the specific polypeptide sequences shown in Table 1.

To determine the percent identity of two amino acid sequences or two nucleotide sequences of two molecules that share sequence homology, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In a preferred embodiment, at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more of the length of a reference sequence is aligned for comparison purposes. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein, amino acid or nucleic acid “identity” is equivalent to amino acid or nucleic acid “homology”). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.

The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. (Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part 1, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). In a preferred embodiment, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch algorithm (J. Mol. Biol. (48):444-453 (1970)) which has been incorporated into the GAP program in the GCG software package, using either a Blossom 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.

In yet another preferred embodiment, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (Devereux, J., et al., Nucleic Acids Res. 12(1):387 (1984)), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. In another embodiment, the percent identity between two amino acid or nucleotide sequences is determined using the algorithm of E. Myers and W. Miller (CABIOS, 4:11-17 (1989)) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4.

The nucleotide and amino acid sequences of the present invention can further be used as a “query sequence” to perform a search against sequence databases to, for example, identify other family members or related sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (J. Mol. Biol. 215:403-10 (1990)). BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to the proteins of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (Nucleic Acids Res. 25(17):3389-3402 (1997)). When utilizing BLAST and gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. In addition to BLAST, examples of other search and sequence comparison programs used in the art include, but are not limited to, FASTA (Pearson, Methods Mol. Biol. 25, 365-389 (1994)) and KERR (Dufresne et al., Nat Biotechnol 2002 December; 20(12):1269-71). For further information regarding bioinformatics techniques, see Current Protocols in Bioinformatics, John Wiley & Sons, Inc., N.Y.

The present invention further provides non-coding fragments of the nucleic acid molecules disclosed in Table 1 and/or Table 2. Preferred non-coding fragments include, but are not limited to, promoter sequences, enhancer sequences, intronic sequences, 5′ untranslated regions (UTRs), 3′ untranslated regions, gene modulating sequences and gene termination sequences. Such fragments are useful, for example, in controlling heterologous gene expression and in developing screens to identify gene-modulating agents.

SNP Detection Reagents

In a specific aspect of the present invention, the SNPs disclosed in Table 1 and/or Table 2, and their associated transcript sequences (provided in Table 1 as SEQ ID NOS:1-80), genomic sequences (provided in Table 2 as SEQ ID NOS:260-435), and context sequences (transcript-based context sequences are provided in Table 1 as SEQ ID NOS:161-259; genomic-based context sequences are provided in Table 2 as SEQ ID NOS:436-1566), can be used for the design of SNP detection reagents. As used herein, a “SNP detection reagent” is a reagent that specifically detects a specific target SNP position disclosed herein, and that is preferably specific for a particular nucleotide (allele) of the target SNP position (i.e., the detection reagent preferably can differentiate between different alternative nucleotides at a target SNP position, thereby allowing the identity of the nucleotide present at the target SNP position to be determined). Typically, such detection reagent hybridizes to a target SNP-containing nucleic acid molecule by complementary base-pairing in a sequence specific manner, and discriminates the target variant sequence from other nucleic acid sequences such as an art-known form in a test sample. An example of a detection reagent is a probe that hybridizes to a target nucleic acid containing one or more of the SNPs provided in Table 1 and/or Table 2. In a preferred embodiment, such a probe can differentiate between nucleic acids having a particular nucleotide (allele) at a target SNP position from other nucleic acids that have a different nucleotide at the same target SNP position. In addition, a detection reagent may hybridize to a specific region 5′ and/or 3′ to a SNP position, particularly a region corresponding to the context sequences provided in Table 1 and/or Table 2 (transcript-based context sequences are provided in Table 1 as SEQ ID NOS:161-259; genomic-based context sequences are provided in Table 2 as SEQ ID NOS:436-1566). Another example of a detection reagent is a primer which acts as an initiation point of nucleotide extension along a complementary strand of a target polynucleotide. The SNP sequence information provided herein is also useful for designing primers, e.g. allele-specific primers, to amplify (e.g., using PCR) any SNP of the present invention.

In one preferred embodiment of the invention, a SNP detection reagent is an isolated or synthetic DNA or RNA polynucleotide probe or primer or PNA oligomer, or a combination of DNA, RNA and/or PNA, that hybridizes to a segment of a target nucleic acid molecule containing a SNP identified in Table 1 and/or Table 2. A detection reagent in the form of a polynucleotide may optionally contain modified base analogs, intercalators or minor groove binders. Multiple detection reagents such as probes may be, for example, affixed to a solid support (e.g., arrays or beads) or supplied in solution (e.g., probe/primer sets for enzymatic reactions such as PCR, RT-PCR, TaqMan assays, or primer-extension reactions) to form a SNP detection kit.

A probe or primer typically is a substantially purified oligonucleotide or PNA oligomer. Such oligonucleotide typically comprises a region of complementary nucleotide sequence that hybridizes under stringent conditions to at least about 8, 10, 12, 16, 18, 20, 22, 25, 30, 40, 50, 55, 60, 65, 70, 80, 90, 100, 120 (or any other number in-between) or more consecutive nucleotides in a target nucleic acid molecule. Depending on the particular assay, the consecutive nucleotides can either include the target SNP position, or be a specific region in close enough proximity 5′ and/or 3′ to the SNP position to carry out the desired assay.

Other preferred primer and probe sequences can readily be determined using the transcript sequences (SEQ ID NOS:1-80), genomic sequences (SEQ ID NOS:260-435), and SNP context sequences (transcript-based context sequences are provided in Table 1 as SEQ ID NOS:161-259; genomic-based context sequences are provided in Table 2 as SEQ ID NOS:436-1566) disclosed in the Sequence Listing and in Tables 1-2. It will be apparent to one of skill in the art that such primers and probes are directly useful as reagents for genotyping the SNPs of the present invention, and can be incorporated into any kit/system format.

In order to produce a probe or primer specific for a target SNP-containing sequence, the gene/transcript and/or context sequence surrounding the SNP of interest is typically examined using a computer algorithm which starts at the 5′ or at the 3′ end of the nucleotide sequence. Typical algorithms will then identify oligomers of defined length that are unique to the gene/SNP context sequence, have a GC content within a range suitable for hybridization, lack predicted secondary structure that may interfere with hybridization, and/or possess other desired characteristics or that lack other undesired characteristics.

A primer or probe of the present invention is typically at least about 8 nucleotides in length. In one embodiment of the invention, a primer or a probe is at least about 10 nucleotides in length. In a preferred embodiment, a primer or a probe is at least about 12 nucleotides in length. In a more preferred embodiment, a primer or probe is at least about 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length. While the maximal length of a probe can be as long as the target sequence to be detected, depending on the type of assay in which it is employed, it is typically less than about 50, 60, 65, or 70 nucleotides in length. In the case of a primer, it is typically less than about 30 nucleotides in length. In a specific preferred embodiment of the invention, a primer or a probe is within the length of about 18 and about 28 nucleotides. However, in other embodiments, such as nucleic acid arrays and other embodiments in which probes are affixed to a substrate, the probes can be longer, such as on the order of 30-70, 75, 80, 90, 100, or more nucleotides in length (see the section below entitled “SNP Detection Kits and Systems”).

For analyzing SNPs, it may be appropriate to use oligonucleotides specific for alternative SNP alleles. Such oligonucleotides which detect single nucleotide variations in target sequences may be referred to by such terms as “allele-specific oligonucleotides”, “allele-specific probes”, or “allele-specific primers”. The design and use of allele-specific probes for analyzing polymorphisms is described in, e.g., Mutation Detection A Practical Approach, ed. Cotton et al. Oxford University Press, 1998; Saiki et al., Nature 324, 163-166 (1986); Dattagupta, EP235,726; and Saiki, WO 89/11548.

While the design of each allele-specific primer or probe depends on variables such as the precise composition of the nucleotide sequences flanking a SNP position in a target nucleic acid molecule, and the length of the primer or probe, another factor in the use of primers and probes is the stringency of the condition under which the hybridization between the probe or primer and the target sequence is performed. Higher stringency conditions utilize buffers with lower ionic strength and/or a higher reaction temperature, and tend to require a more perfect match between probe/primer and a target sequence in order to form a stable duplex. If the stringency is too high, however, hybridization may not occur at all. In contrast, lower stringency conditions utilize buffers with higher ionic strength and/or a lower reaction temperature, and permit the formation of stable duplexes with more mismatched bases between a probe/primer and a target sequence. By way of example and not limitation, exemplary conditions for high stringency hybridization conditions using an allele-specific probe are as follows: Prehybridization with a solution containing 5× standard saline phosphate EDTA (SSPE), 0.5% NaDodSO4 (SDS) at 55° C., and incubating probe with target nucleic acid molecules in the same solution at the same temperature, followed by washing with a solution containing 2×SSPE, and 0.1% SDS at 55° C. or room temperature.

Moderate stringency hybridization conditions may be used for allele-specific primer extension reactions with a solution containing, e.g., about 50 mM KCl at about 46° C. Alternatively, the reaction may be carried out at an elevated temperature such as 60° C. In another embodiment, a moderately stringent hybridization condition suitable for oligonucleotide ligation assay (OLA) reactions wherein two probes are ligated if they are completely complementary to the target sequence may utilize a solution of about 100 mM KCl at a temperature of 46° C.

In a hybridization-based assay, allele-specific probes can be designed that hybridize to a segment of target DNA from one individual but do not hybridize to the corresponding segment from another individual due to the presence of different polymorphic forms (e.g., alternative SNP alleles/nucleotides) in the respective DNA segments from the two individuals. Hybridization conditions should be sufficiently stringent that there is a significant detectable difference in hybridization intensity between alleles, and preferably an essentially binary response, whereby a probe hybridizes to only one of the alleles or significantly more strongly to one allele. While a probe may be designed to hybridize to a target sequence that contains a SNP site such that the SNP site aligns anywhere along the sequence of the probe, the probe is preferably designed to hybridize to a segment of the target sequence such that the SNP site aligns with a central position of the probe (e.g., a position within the probe that is at least three nucleotides from either end of the probe). This design of probe generally achieves good discrimination in hybridization between different allelic forms.

In another embodiment, a probe or primer may be designed to hybridize to a segment of target DNA such that the SNP aligns with either the 5′ most end or the 3′ most end of the probe or primer. In a specific preferred embodiment which is particularly suitable for use in a oligonucleotide ligation assay (U.S. Pat. No. 4,988,617), the 3′most nucleotide of the probe aligns with the SNP position in the target sequence.

Oligonucleotide probes and primers may be prepared by methods well known in the art. Chemical synthetic methods include, but are limited to, the phosphotriester method described by Narang et al., 1979, Methods in Enzymology 68:90; the phosphodiester method described by Brown et al., 1979, Methods in Enzymology 68:109, the diethylphosphoamidate method described by Beaucage et al., 1981, Tetrahedron Letters 22:1859; and the solid support method described in U.S. Pat. No. 4,458,066.

Allele-specific probes are often used in pairs (or, less commonly, in sets of 3 or 4, such as if a SNP position is known to have 3 or 4 alleles, respectively, or to assay both strands of a nucleic acid molecule for a target SNP allele), and such pairs may be identical except for a one nucleotide mismatch that represents the allelic variants at the SNP position. Commonly, one member of a pair perfectly matches a reference form of a target sequence that has a more common SNP allele (i.e., the allele that is more frequent in the target population) and the other member of the pair perfectly matches a form of the target sequence that has a less common SNP allele (i.e., the allele that is rarer in the target population). In the case of an array, multiple pairs of probes can be immobilized on the same support for simultaneous analysis of multiple different polymorphisms.

In one type of PCR-based assay, an allele-specific primer hybridizes to a region on a target nucleic acid molecule that overlaps a SNP position and only primes amplification of an allelic form to which the primer exhibits perfect complementarity (Gibbs, 1989, Nucleic Acid Res. 17 2427-2448). Typically, the primer's 3′-most nucleotide is aligned with and complementary to the SNP position of the target nucleic acid molecule. This primer is used in conjunction with a second primer that hybridizes at a distal site. Amplification proceeds from the two primers, producing a detectable product that indicates which allelic form is present in the test sample. A control is usually performed with a second pair of primers, one of which shows a single base mismatch at the polymorphic site and the other of which exhibits perfect complementarity to a distal site. The single-base mismatch prevents amplification or substantially reduces amplification efficiency, so that either no detectable product is formed or it is formed in lower amounts or at a slower pace. The method generally works most effectively when the mismatch is at the 3′-most position of the oligonucleotide (i.e., the 3′-most position of the oligonucleotide aligns with the target SNP position) because this position is most destabilizing to elongation from the primer (see, e.g., WO 93/22456). This PCR-based assay can be utilized as part of the TaqMan assay, described below.

In a specific embodiment of the invention, a primer of the invention contains a sequence substantially complementary to a segment of a target SNP-containing nucleic acid molecule except that the primer has a mismatched nucleotide in one of the three nucleotide positions at the 3′-most end of the primer, such that the mismatched nucleotide does not base pair with a particular allele at the SNP site. In a preferred embodiment, the mismatched nucleotide in the primer is the second from the last nucleotide at the 3′-most position of the primer. In a more preferred embodiment, the mismatched nucleotide in the primer is the last nucleotide at the 3′-most position of the primer.

In another embodiment of the invention, a SNP detection reagent of the invention is labeled with a fluorogenic reporter dye that emits a detectable signal. While the preferred reporter dye is a fluorescent dye, any reporter dye that can be attached to a detection reagent such as an oligonucleotide probe or primer is suitable for use in the invention. Such dyes include, but are not limited to, Acridine, AMCA, BODIPY, Cascade Blue, Cy2, Cy3, Cy5, Cy7, Dabcyl, Edans, Eosin, Erythrosin, Fluorescein, 6-Fam, Tet, Joe, Hex, Oregon Green, Rhodamine, Rhodol Green, Tamra, Rox, and Texas Red.

In yet another embodiment of the invention, the detection reagent may be further labeled with a quencher dye such as Tamra, especially when the reagent is used as a self-quenching probe such as a TaqMan (U.S. Pat. Nos. 5,210,015 and 5,538,848) or Molecular Beacon probe (U.S. Pat. Nos. 5,118,801 and 5,312,728), or other stemless or linear beacon probe (Livak et al., 1995, PCR Method Appl. 4:357-362; Tyagi et al., 1996, Nature Biotechnology 14: 303-308; Nazarenko et al., 1997, Nucl. Acids Res. 25:2516-2521; U.S. Pat. Nos. 5,866,336 and 6,117,635).

The detection reagents of the invention may also contain other labels, including but not limited to, biotin for streptavidin binding, hapten for antibody binding, and oligonucleotide for binding to another complementary oligonucleotide such as pairs of zipcodes.

The present invention also contemplates reagents that do not contain (or that are complementary to) a SNP nucleotide identified herein but that are used to assay one or more SNPs disclosed herein. For example, primers that flank, but do not hybridize directly to a target SNP position provided herein are useful in primer extension reactions in which the primers hybridize to a region adjacent to the target SNP position (i.e., within one or more nucleotides from the target SNP site). During the primer extension reaction, a primer is typically not able to extend past a target SNP site if a particular nucleotide (allele) is present at that target SNP site, and the primer extension product can be detected in order to determine which SNP allele is present at the target SNP site. For example, particular ddNTPs are typically used in the primer extension reaction to terminate primer extension once a ddNTP is incorporated into the extension product (a primer extension product which includes a ddNTP at the 3′-most end of the primer extension product, and in which the ddNTP is a nucleotide of a SNP disclosed herein, is a composition that is specifically contemplated by the present invention). Thus, reagents that bind to a nucleic acid molecule in a region adjacent to a SNP site and that are used for assaying the SNP site, even though the bound sequences do not necessarily include the SNP site itself, are also contemplated by the present invention.

SNP Detection Kits and Systems

A person skilled in the art will recognize that, based on the SNP and associated sequence information disclosed herein, detection reagents can be developed and used to assay any SNP of the present invention individually or in combination, and such detection reagents can be readily incorporated into one of the established kit or system formats which are well known in the art. The terms “kits” and “systems”, as used herein in the context of SNP detection reagents, are intended to refer to such things as combinations of multiple SNP detection reagents, or one or more SNP detection reagents in combination with one or more other types of elements or components (e.g., other types of biochemical reagents, containers, packages such as packaging intended for commercial sale, substrates to which SNP detection reagents are attached, electronic hardware components, etc.). Accordingly, the present invention further provides SNP detection kits and systems, including but not limited to, packaged probe and primer sets (e.g., TaqMan probe/primer sets), arrays/microarrays of nucleic acid molecules, and beads that contain one or more probes, primers, or other detection reagents for detecting one or more SNPs of the present invention. The kits/systems can optionally include various electronic hardware components; for example, arrays (“DNA chips”) and microfluidic systems (“lab-on-a-chip” systems) provided by various manufacturers typically comprise hardware components. Other kits/systems (e.g., probe/primer sets) may not include electronic hardware components, but may be comprised of, for example, one or more SNP detection reagents (along with, optionally, other biochemical reagents) packaged in one or more containers.

In some embodiments, a SNP detection kit typically contains one or more detection reagents and other components (e.g., a buffer, enzymes such as DNA polymerases or ligases, chain extension nucleotides such as deoxynucleotide triphosphates, and in the case of Sanger-type DNA sequencing reactions, chain terminating nucleotides, positive control sequences, negative control sequences, and the like) necessary to carry out an assay or reaction, such as amplification and/or detection of a SNP-containing nucleic acid molecule. A kit may further contain means for determining the amount of a target nucleic acid, and means for comparing the amount with a standard, and can comprise instructions for using the kit to detect the SNP-containing nucleic acid molecule of interest. In one embodiment of the present invention, kits are provided which contain the necessary reagents to carry out one or more assays to detect one or more SNPs disclosed herein. In a preferred embodiment of the present invention, SNP detection kits/systems are in the form of nucleic acid arrays, or compartmentalized kits, including microfluidic/lab-on-a-chip systems.

SNP detection kits/systems may contain, for example, one or more probes, or pairs of probes, that hybridize to a nucleic acid molecule at or near each target SNP position. Multiple pairs of allele-specific probes may be included in the kit/system to simultaneously assay large numbers of SNPs, at least one of which is a SNP of the present invention. In some kits/systems, the allele-specific probes are immobilized to a substrate such as an array or bead. For example, the same substrate can comprise allele-specific probes for detecting at least 1; 10; 100; 1000; 10,000; 100,000 (or any other number in-between) or substantially all of the SNPs shown in Table 1 and/or Table 2.

The terms “arrays”, “microarrays”, and “DNA chips” are used herein interchangeably to refer to an array of distinct polynucleotides affixed to a substrate, such as glass, plastic, paper, nylon or other type of membrane, filter, chip, or any other suitable solid support. The polynucleotides can be synthesized directly on the substrate, or synthesized separate from the substrate and then affixed to the substrate. In one embodiment, the microarray is prepared and used according to the methods described in U.S. Pat. No. 5,837,832, Chee et al., PCT application WO95/11995 (Chee et al.), Lockhart, D. J. et al. (1996; Nat. Biotech. 14: 1675-1680) and Schena, M. et al. (1996; Proc. Natl. Acad. Sci. 93: 10614-10619), all of which are incorporated herein in their entirety by reference. In other embodiments, such arrays are produced by the methods described by Brown et al., U.S. Pat. No. 5,807,522.

Nucleic acid arrays are reviewed in the following references: Zammatteo et al., “New chips for molecular biology and diagnostics”, Biotechnol Annu Rev. 2002; 8:85-101; Sosnowski et al., “Active microelectronic array system for DNA hybridization, genotyping and pharmacogenomic applications”, Psychiatr Genet. 2002 December; 12(4):181-92; Heller, “DNA microarray technology: devices, systems, and applications”, Annu Rev Biomed Eng. 2002; 4:129-53. Epub 2002 Mar. 22; Kolchinsky et al., “Analysis of SNPs and other genomic variations using gel-based chips”, Hum Mutat. 2002 April; 19(4):343-60; and McGall et al., “High-density genechip oligonucleotide probe arrays”, Adv Biochem Eng Biotechnol. 2002; 77:21-42.

Any number of probes, such as allele-specific probes, may be implemented in an array, and each probe or pair of probes can hybridize to a different SNP position. In the case of polynucleotide probes, they can be synthesized at designated areas (or synthesized separately and then affixed to designated areas) on a substrate using a light-directed chemical process. Each DNA chip can contain, for example, thousands to millions of individual synthetic polynucleotide probes arranged in a grid-like pattern and miniaturized (e.g., to the size of a dime). Preferably, probes are attached to a solid support in an ordered, addressable array.

A microarray can be composed of a large number of unique, single-stranded polynucleotides, usually either synthetic antisense polynucleotides or fragments of cDNAs, fixed to a solid support. Typical polynucleotides are preferably about 6-60 nucleotides in length, more preferably about 15-30 nucleotides in length, and most preferably about 18-25 nucleotides in length. For certain types of microarrays or other detection kits/systems, it may be preferable to use oligonucleotides that are only about 7-20 nucleotides in length. In other types of arrays, such as arrays used in conjunction with chemiluminescent detection technology, preferred probe lengths can be, for example, about 15-80 nucleotides in length, preferably about 50-70 nucleotides in length, more preferably about 55-65 nucleotides in length, and most preferably about 60 nucleotides in length. The microarray or detection kit can contain polynucleotides that cover the known 5′ or 3′ sequence of a gene/transcript or target SNP site, sequential polynucleotides that cover the full-length sequence of a gene/transcript; or unique polynucleotides selected from particular areas along the length of a target gene/transcript sequence, particularly areas corresponding to one or more SNPs disclosed in Table 1 and/or Table 2. Polynucleotides used in the microarray or detection kit can be specific to a SNP or SNPs of interest (e.g., specific to a particular SNP allele at a target SNP site, or specific to particular SNP alleles at multiple different SNP sites), or specific to a polymorphic gene/transcript or genes/transcripts of interest.

Hybridization assays based on polynucleotide arrays rely on the differences in hybridization stability of the probes to perfectly matched and mismatched target sequence variants. For SNP genotyping, it is generally preferable that stringency conditions used in hybridization assays are high enough such that nucleic acid molecules that differ from one another at as little as a single SNP position can be differentiated (e.g., typical SNP hybridization assays are designed so that hybridization will occur only if one particular nucleotide is present at a SNP position, but will not occur if an alternative nucleotide is present at that SNP position). Such high stringency conditions may be preferable when using, for example, nucleic acid arrays of allele-specific probes for SNP detection. Such high stringency conditions are described in the preceding section, and are well known to those skilled in the art and can be found in, for example, Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.

In other embodiments, the arrays are used in conjunction with chemiluminescent detection technology. The following patents and patent applications, which are all hereby incorporated by reference, provide additional information pertaining to chemiluminescent detection: U.S. patent application Ser. Nos. 10/620,332 and 10/620,333 describe chemiluminescent approaches for microarray detection; U.S. Pat. Nos. 6,124,478, 6,107,024, 5,994,073, 5,981,768, 5,871,938, 5,843,681, 5,800,999, and 5,773,628 describe methods and compositions of dioxetane for performing chemiluminescent detection; and U.S. published application US2002/0110828 discloses methods and compositions for microarray controls.

In one embodiment of the invention, a nucleic acid array can comprise an array of probes of about 15-25 nucleotides in length. In further embodiments, a nucleic acid array can comprise any number of probes, in which at least one probe is capable of detecting one or more SNPs disclosed in Table 1 and/or Table 2, and/or at least one probe comprises a fragment of one of the sequences selected from the group consisting of those disclosed in Table 1, Table 2, the Sequence Listing, and sequences complementary thereto, said fragment comprising at least about 8 consecutive nucleotides, preferably 10, 12, 15, 16, 18, 20, more preferably 22, 25, 30, 40, 47, 50, 55, 60, 65, 70, 80, 90, 100, or more consecutive nucleotides (or any other number in-between) and containing (or being complementary to) a novel SNP allele disclosed in Table 1 and/or Table 2. In some embodiments, the nucleotide complementary to the SNP site is within 5, 4, 3, 2, or 1 nucleotide from the center of the probe, more preferably at the center of said probe.

A polynucleotide probe can be synthesized on the surface of the substrate by using a chemical coupling procedure and an ink jet application apparatus, as described in PCT application WO95/251116 (Baldeschweiler et al.) which is incorporated herein in its entirety by reference. In another aspect, a “gridded” array analogous to a dot (or slot) blot may be used to arrange and link cDNA fragments or oligonucleotides to the surface of a substrate using a vacuum system, thermal, UV, mechanical or chemical bonding procedures. An array, such as those described above, may be produced by hand or by using available devices (slot blot or dot blot apparatus), materials (any suitable solid support), and machines (including robotic instruments), and may contain 8, 24, 96, 384, 1536, 6144 or more polynucleotides, or any other number which lends itself to the efficient use of commercially available instrumentation.

Using such arrays or other kits/systems, the present invention provides methods of identifying the SNPs disclosed herein in a test sample. Such methods typically involve incubating a test sample of nucleic acids with an array comprising one or more probes corresponding to at least one SNP position of the present invention, and assaying for binding of a nucleic acid from the test sample with one or more of the probes. Conditions for incubating a SNP detection reagent (or a kit/system that employs one or more such SNP detection reagents) with a test sample vary. Incubation conditions depend on such factors as the format employed in the assay, the detection methods employed, and the type and nature of the detection reagents used in the assay. One skilled in the art will recognize that any one of the commonly available hybridization, amplification and array assay formats can readily be adapted to detect the SNPs disclosed herein.

A SNP detection kit/system of the present invention may include components that are used to prepare nucleic acids from a test sample for the subsequent amplification and/or detection of a SNP-containing nucleic acid molecule. Such sample preparation components can be used to produce nucleic acid extracts (including DNA and/or RNA), proteins or membrane extracts from any bodily fluids (such as blood, serum, plasma, urine, saliva, phlegm, gastric juices, semen, tears, sweat, etc.), skin, hair, cells (especially nucleated cells), biopsies, buccal cells (e.g., as obtained by buccal swabs), or tissue specimens. The test samples used in the above-described methods will vary based on such factors as the assay format, nature of the detection method, and the specific tissues, cells or extracts used as the test sample to be assayed. Methods of preparing nucleic acids, proteins, and cell extracts are well known in the art and can be readily adapted to obtain a sample that is compatible with the system utilized. Automated sample preparation systems for extracting nucleic acids from a test sample are commercially available, and examples are Qiagen's BioRobot 9600, Applied Biosystems' PRISM™ 6700 sample preparation system, and Roche Molecular Systems' COBAS AmpliPrep System.

Another form of kit contemplated by the present invention is a compartmentalized kit. A compartmentalized kit includes any kit in which reagents are contained in separate containers. Such containers include, for example, small glass containers, plastic containers, strips of plastic, glass or paper, or arraying material such as silica. Such containers allow one to efficiently transfer reagents from one compartment to another compartment such that the test samples and reagents are not cross-contaminated, or from one container to another vessel not included in the kit, and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another or to another vessel. Such containers may include, for example, one or more containers which will accept the test sample, one or more containers which contain at least one probe or other SNP detection reagent for detecting one or more SNPs of the present invention, one or more containers which contain wash reagents (such as phosphate buffered saline, Tris-buffers, etc.), and one or more containers which contain the reagents used to reveal the presence of the bound probe or other SNP detection reagents. The kit can optionally further comprise compartments and/or reagents for, for example, nucleic acid amplification or other enzymatic reactions such as primer extension reactions, hybridization, ligation, electrophoresis (preferably capillary electrophoresis), mass spectrometry, and/or laser-induced fluorescent detection. The kit may also include instructions for using the kit. Exemplary compartmentalized kits include microfluidic devices known in the art (see, e.g., Weigl et al., “Lab-on-a-chip for drug development”, Adv Drug Deliv Rev. 2003 Feb. 24; 55(3):349-77). In such microfluidic devices, the containers may be referred to as, for example, microfluidic “compartments”, “chambers”, or “channels”.

Microfluidic devices, which may also be referred to as “lab-on-a-chip” systems, biomedical micro-electro-mechanical systems (bioMEMs), or multicomponent integrated systems, are exemplary kits/systems of the present invention for analyzing SNPs. Such systems miniaturize and compartmentalize processes such as probe/target hybridization, nucleic acid amplification, and capillary electrophoresis reactions in a single functional device. Such microfluidic devices typically utilize detection reagents in at least one aspect of the system, and such detection reagents may be used to detect one or more SNPs of the present invention. One example of a microfluidic system is disclosed in U.S. Pat. No. 5,589,136, which describes the integration of PCR amplification and capillary electrophoresis in chips. Exemplary microfluidic systems comprise a pattern of microchannels designed onto a glass, silicon, quartz, or plastic wafer included on a microchip. The movements of the samples may be controlled by electric, electroosmotic or hydrostatic forces applied across different areas of the microchip to create functional microscopic valves and pumps with no moving parts. Varying the voltage can be used as a means to control the liquid flow at intersections between the micro-machined channels and to change the liquid flow rate for pumping across different sections of the microchip. See, for example, U.S. Pat. No. 6,153,073, Dubrow et al., and U.S. Pat. No. 6,156,181, Parce et al.

For genotyping SNPs, an exemplary microfluidic system may integrate, for example, nucleic acid amplification, primer extension, capillary electrophoresis, and a detection method such as laser induced fluorescence detection. In a first step of an exemplary process for using such an exemplary system, nucleic acid samples are amplified, preferably by PCR. Then, the amplification products are subjected to automated primer extension reactions using ddNTPs (specific fluorescence for each ddNTP) and the appropriate oligonucleotide primers to carry out primer extension reactions which hybridize just upstream of the targeted SNP. Once the extension at the 3′ end is completed, the primers are separated from the unincorporated fluorescent ddNTPs by capillary electrophoresis. The separation medium used in capillary electrophoresis can be, for example, polyacrylamide, polyethyleneglycol or dextran. The incorporated ddNTPs in the single nucleotide primer extension products are identified by laser-induced fluorescence detection. Such an exemplary microchip can be used to process, for example, at least 96 to 384 samples, or more, in parallel.

Uses of Nucleic Acid Molecules

The nucleic acid molecules of the present invention have a variety of uses, especially in the diagnosis and treatment of stroke and related pathologies. For example, the nucleic acid molecules are useful as hybridization probes, such as for genotyping SNPs in messenger RNA, transcript, cDNA, genomic DNA, amplified DNA or other nucleic acid molecules, and for isolating full-length cDNA and genomic clones encoding the variant peptides disclosed in Table 1 as well as their orthologs.

A probe can hybridize to any nucleotide sequence along the entire length of a nucleic acid molecule provided in Table 1 and/or Table 2. Preferably, a probe of the present invention hybridizes to a region of a target sequence that encompasses a SNP position indicated in Table 1 and/or Table 2. More preferably, a probe hybridizes to a SNP-containing target sequence in a sequence-specific manner such that it distinguishes the target sequence from other nucleotide sequences which vary from the target sequence only by which nucleotide is present at the SNP site. Such a probe is particularly useful for detecting the presence of a SNP-containing nucleic acid in a test sample, or for determining which nucleotide (allele) is present at a particular SNP site (i.e., genotyping the SNP site).

A nucleic acid hybridization probe may be used for determining the presence, level, form, and/or distribution of nucleic acid expression. The nucleic acid whose level is determined can be DNA or RNA. Accordingly, probes specific for the SNPs described herein can be used to assess the presence, expression and/or gene copy number in a given cell, tissue, or organism. These uses are relevant for diagnosis of disorders involving an increase or decrease in gene expression relative to normal levels. In vitro techniques for detection of mRNA include, for example, Northern blot hybridizations and in situ hybridizations. In vitro techniques for detecting DNA include Southern blot hybridizations and in situ hybridizations (Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y.).

Probes can be used as part of a diagnostic test kit for identifying cells or tissues in which a variant protein is expressed, such as by measuring the level of a variant protein-encoding nucleic acid (e.g., mRNA) in a sample of cells from a subject or determining if a polynucleotide contains a SNP of interest.

Thus, the nucleic acid molecules of the invention can be used as hybridization probes to detect the SNPs disclosed herein, thereby determining whether an individual with the polymorphisms is at risk for stroke and related pathologies. Detection of a SNP associated with a disease phenotype provides a diagnostic tool for an active disease and/or genetic predisposition to the disease.

Furthermore, the nucleic acid molecules of the invention are therefore useful for detecting a gene (gene information is disclosed in Table 2, for example) which contains a SNP disclosed herein and/or products of such genes, such as expressed mRNA transcript molecules (transcript information is disclosed in Table 1, for example), and are thus useful for detecting gene expression. The nucleic acid molecules can optionally be implemented in, for example, an array or kit format for use in detecting gene expression.

The nucleic acid molecules of the invention are also useful as primers to amplify any given region of a nucleic acid molecule, particularly a region containing a SNP identified in Table 1 and/or Table 2.

The nucleic acid molecules of the invention are also useful for constructing recombinant vectors (described in greater detail below). Such vectors include expression vectors that express a portion of, or all of, any of the variant peptide sequences provided in Table 1. Vectors also include insertion vectors, used to integrate into another nucleic acid molecule sequence, such as into the cellular genome, to alter in situ expression of a gene and/or gene product. For example, an endogenous coding sequence can be replaced via homologous recombination with all or part of the coding region containing one or more specifically introduced SNPs.

The nucleic acid molecules of the invention are also useful for expressing antigenic portions of the variant proteins, particularly antigenic portions that contain a variant amino acid sequence (e.g., an amino acid substitution) caused by a SNP disclosed in Table 1 and/or Table 2.

The nucleic acid molecules of the invention are also useful for constructing vectors containing a gene regulatory region of the nucleic acid molecules of the present invention.

The nucleic acid molecules of the invention are also useful for designing ribozymes corresponding to all, or a part, of an mRNA molecule expressed from a SNP-containing nucleic acid molecule described herein.

The nucleic acid molecules of the invention are also useful for constructing host cells expressing a part, or all, of the nucleic acid molecules and variant peptides.

The nucleic acid molecules of the invention are also useful for constructing transgenic animals expressing all, or a part, of the nucleic acid molecules and variant peptides. The production of recombinant cells and transgenic animals having nucleic acid molecules which contain the SNPs disclosed in Table 1 and/or Table 2 allow, for example, effective clinical design of treatment compounds and dosage regimens.

The nucleic acid molecules of the invention are also useful in assays for drug screening to identify compounds that, for example, modulate nucleic acid expression.

The nucleic acid molecules of the invention are also useful in gene therapy in patients whose cells have aberrant gene expression. Thus, recombinant cells, which include a patient's cells that have been engineered ex vivo and returned to the patient, can be introduced into an individual where the recombinant cells produce the desired protein to treat the individual.

SNP Genotyping Methods

The process of determining which specific nucleotide (i.e., allele) is present at each of one or more SNP positions, such as a SNP position in a nucleic acid molecule disclosed in Table 1 and/or Table 2, is referred to as SNP genotyping. The present invention provides methods of SNP genotyping, such as for use in determining predisposition to stroke or related pathologies, or determining responsiveness to a form of treatment, or in genome mapping or SNP association analysis, etc.

Nucleic acid samples can be genotyped to determine which allele(s) is/are present at any given genetic region (e.g., SNP position) of interest by methods well known in the art. The neighboring sequence can be used to design SNP detection reagents such as oligonucleotide probes, which may optionally be implemented in a kit format. Exemplary SNP genotyping methods are described in Chen et al., “Single nucleotide polymorphism genotyping: biochemistry, protocol, cost and throughput”, Pharmacogenomics J. 2003; 3(2):77-96; Kwok et al., “Detection of single nucleotide polymorphisms”, Curr Issues Mol Biol. 2003 April; 5(2):43-60; Shi, “Technologies for individual genotyping: detection of genetic polymorphisms in drug targets and disease genes”, Am J Pharmacogenomics. 2002; 2(3):197-205; and Kwok, “Methods for genotyping single nucleotide polymorphisms”, Annu Rev Genomics Hum Genet 2001; 2:235-58. Exemplary techniques for high-throughput SNP genotyping are described in Marnellos, “High-throughput SNP analysis for genetic association studies”, Curr Opin Drug Discov Devel. 2003 May; 6(3):317-21. Common SNP genotyping methods include, but are not limited to, TaqMan assays, molecular beacon assays, nucleic acid arrays, allele-specific primer extension, allele-specific PCR, arrayed primer extension, homogeneous primer extension assays, primer extension with detection by mass spectrometry, pyrosequencing, multiplex primer extension sorted on genetic arrays, ligation with rolling circle amplification, homogeneous ligation, OLA (U.S. Pat. No. 4,988,167), multiplex ligation reaction sorted on genetic arrays, restriction-fragment length polymorphism, single base extension-tag assays, and the Invader assay. Such methods may be used in combination with detection mechanisms such as, for example, luminescence or chemiluminescence detection, fluorescence detection, time-resolved fluorescence detection, fluorescence resonance energy transfer, fluorescence polarization, mass spectrometry, and electrical detection.

Various methods for detecting polymorphisms include, but are not limited to, methods in which protection from cleavage agents is used to detect mismatched bases in RNA/RNA or RNA/DNA duplexes (Myers et A, Science 230:1242 (1985); Cotton et al., PNAS 85:4397 (1988); and Saleeba et A, Meth. Enzymol. 217:286-295 (1992)), comparison of the electrophoretic mobility of variant and wild type nucleic acid molecules (Orita et al., PNAS 86:2766 (1989); Cotton et A, Mutat. Res. 285:125-144 (1993); and Hayashi et al., Genet. Anal. Tech. Appl. 9:73-79 (1992)), and assaying the movement of polymorphic or wild-type fragments in polyacrylamide gels containing a gradient of denaturant using denaturing gradient gel electrophoresis (DGGE) (Myers et al., Nature 313:495 (1985)). Sequence variations at specific locations can also be assessed by nuclease protection assays such as RNase and 51 protection or chemical cleavage methods.

In a preferred embodiment, SNP genotyping is performed using the TaqMan assay, which is also known as the 5′ nuclease assay (U.S. Pat. Nos. 5,210,015 and 5,538,848). The TaqMan assay detects the accumulation of a specific amplified product during PCR. The TaqMan assay utilizes an oligonucleotide probe labeled with a fluorescent reporter dye and a quencher dye. The reporter dye is excited by irradiation at an appropriate wavelength, it transfers energy to the quencher dye in the same probe via a process called fluorescence resonance energy transfer (FRET). When attached to the probe, the excited reporter dye does not emit a signal. The proximity of the quencher dye to the reporter dye in the intact probe maintains a reduced fluorescence for the reporter. The reporter dye and quencher dye may be at the 5′ most and the 3′ most ends, respectively, or vice versa. Alternatively, the reporter dye may be at the 5′ or 3′ most end while the quencher dye is attached to an internal nucleotide, or vice versa. In yet another embodiment, both the reporter and the quencher may be attached to internal nucleotides at a distance from each other such that fluorescence of the reporter is reduced.

During PCR, the 5′ nuclease activity of DNA polymerase cleaves the probe, thereby separating the reporter dye and the quencher dye and resulting in increased fluorescence of the reporter. Accumulation of PCR product is detected directly by monitoring the increase in fluorescence of the reporter dye. The DNA polymerase cleaves the probe between the reporter dye and the quencher dye only if the probe hybridizes to the target SNP-containing template which is amplified during PCR, and the probe is designed to hybridize to the target SNP site only if a particular SNP allele is present.

Preferred TaqMan primer and probe sequences can readily be determined using the SNP and associated nucleic acid sequence information provided herein. A number of computer programs, such as Primer Express (Applied Biosystems, Foster City, Calif.), can be used to rapidly obtain optimal primer/probe sets. It will be apparent to one of skill in the art that such primers and probes for detecting the SNPs of the present invention are useful in assays for determining predisposition to stroke and related pathologies, and can be readily incorporated into a kit format. The present invention also includes modifications of the Taqman assay well known in the art such as the use of Molecular Beacon probes (U.S. Pat. Nos. 5,118,801 and 5,312,728) and other variant formats (U.S. Pat. Nos. 5,866,336 and 6,117,635).

Another preferred method for genotyping the SNPs of the present invention is the use of two oligonucleotide probes in an OLA (see, e.g., U.S. Pat. No. 4,988,617). In this method, one probe hybridizes to a segment of a target nucleic acid with its 3′ most end aligned with the SNP site. A second probe hybridizes to an adjacent segment of the target nucleic acid molecule directly 3′ to the first probe. The two juxtaposed probes hybridize to the target nucleic acid molecule, and are ligated in the presence of a linking agent such as a ligase if there is perfect complementarity between the 3′ most nucleotide of the first probe with the SNP site. If there is a mismatch, ligation would not occur. After the reaction, the ligated probes are separated from the target nucleic acid molecule, and detected as indicators of the presence of a SNP.

The following patents, patent applications, and published international patent applications, which are all hereby incorporated by reference, provide additional information pertaining to techniques for carrying out various types of OLA: U.S. Pat. Nos. 6,027,889, 6,268,148, 5,494,810, 5,830,711, and 6,054,564 describe OLA strategies for performing SNP detection; WO 97/31256 and WO 00/56927 describe OLA strategies for performing SNP detection using universal arrays, wherein a zipcode sequence can be introduced into one of the hybridization probes, and the resulting product, or amplified product, hybridized to a universal zip code array; U.S. application Ser. No. 01/17,329 (and Ser. No. 09/584,905) describes OLA (or LDR) followed by PCR, wherein zipcodes are incorporated into OLA probes, and amplified PCR products are determined by electrophoretic or universal zipcode array readout; U.S. applications 60/427,818, 60/445,636, and 60/445,494 describe SNPlex methods and software for multiplexed SNP detection using OLA followed by PCR, wherein zipcodes are incorporated into OLA probes, and amplified PCR products are hybridized with a zipchute reagent, and the identity of the SNP determined from electrophoretic readout of the zipchute. In some embodiments, OLA is carried out prior to PCR (or another method of nucleic acid amplification). In other embodiments, PCR (or another method of nucleic acid amplification) is carried out prior to OLA.

Another method for SNP genotyping is based on mass spectrometry. Mass spectrometry takes advantage of the unique mass of each of the four nucleotides of DNA. SNPs can be unambiguously genotyped by mass spectrometry by measuring the differences in the mass of nucleic acids having alternative SNP alleles. MALDI-TOF (Matrix Assisted Laser Desorption Ionization—Time of Flight) mass spectrometry technology is preferred for extremely precise determinations of molecular mass, such as SNPs. Numerous approaches to SNP analysis have been developed based on mass spectrometry. Preferred mass spectrometry-based methods of SNP genotyping include primer extension assays, which can also be utilized in combination with other approaches, such as traditional gel-based formats and microarrays.

Typically, the primer extension assay involves designing and annealing a primer to a template PCR amplicon upstream (5′) from a target SNP position. A mix of dideoxynucleotide triphosphates (ddNTPs) and/or deoxynucleotide triphosphates (dNTPs) are added to a reaction mixture containing template (e.g., a SNP-containing nucleic acid molecule which has typically been amplified, such as by PCR), primer, and DNA polymerase. Extension of the primer terminates at the first position in the template where a nucleotide complementary to one of the ddNTPs in the mix occurs. The primer can be either immediately adjacent (i.e., the nucleotide at the 3′ end of the primer hybridizes to the nucleotide next to the target SNP site) or two or more nucleotides removed from the SNP position. If the primer is several nucleotides removed from the target SNP position, the only limitation is that the template sequence between the 3′ end of the primer and the SNP position cannot contain a nucleotide of the same type as the one to be detected, or this will cause premature termination of the extension primer. Alternatively, if all four ddNTPs alone, with no dNTPs, are added to the reaction mixture, the primer will always be extended by only one nucleotide, corresponding to the target SNP position. In this instance, primers are designed to bind one nucleotide upstream from the SNP position (i.e., the nucleotide at the 3′ end of the primer hybridizes to the nucleotide that is immediately adjacent to the target SNP site on the 5′ side of the target SNP site). Extension by only one nucleotide is preferable, as it minimizes the overall mass of the extended primer, thereby increasing the resolution of mass differences between alternative SNP nucleotides. Furthermore, mass-tagged ddNTPs can be employed in the primer extension reactions in place of unmodified ddNTPs. This increases the mass difference between primers extended with these ddNTPs, thereby providing increased sensitivity and accuracy, and is particularly useful for typing heterozygous base positions. Mass-tagging also alleviates the need for intensive sample-preparation procedures and decreases the necessary resolving power of the mass spectrometer.

The extended primers can then be purified and analyzed by MALDI-TOF mass spectrometry to determine the identity of the nucleotide present at the target SNP position. In one method of analysis, the products from the primer extension reaction are combined with light absorbing crystals that form a matrix. The matrix is then hit with an energy source such as a laser to ionize and desorb the nucleic acid molecules into the gas-phase. The ionized molecules are then ejected into a flight tube and accelerated down the tube towards a detector. The time between the ionization event, such as a laser pulse, and collision of the molecule with the detector is the time of flight of that molecule. The time of flight is precisely correlated with the mass-to-charge ratio (m/z) of the ionized molecule. Ions with smaller m/z travel down the tube faster than ions with larger m/z and therefore the lighter ions reach the detector before the heavier ions. The time-of-flight is then converted into a corresponding, and highly precise, m/z. In this manner, SNPs can be identified based on the slight differences in mass, and the corresponding time of flight differences, inherent in nucleic acid molecules having different nucleotides at a single base position. For further information regarding the use of primer extension assays in conjunction with MALDI-TOF mass spectrometry for SNP genotyping, see, e.g., Wise et al., “A standard protocol for single nucleotide primer extension in the human genome using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry”, Rapid Commun Mass Spectrom. 2003; 17(11):1195-202.

The following references provide further information describing mass spectrometry-based methods for SNP genotyping: Bocker, “SNP and mutation discovery using base-specific cleavage and MALDI-TOF mass spectrometry”, Bioinformatics. 2003 July; 19 Suppl 1:144-153; Storm et al., “MALDI-TOF mass spectrometry-based SNP genotyping”, Methods Mol Biol. 2003; 212:241-62; Jurinke et al., “The use of Mass ARRAY technology for high throughput genotyping”, Adv Biochem Eng Biotechnol. 2002; 77:57-74; and Jurinke et al., “Automated genotyping using the DNA MassArray technology”, Methods Mol Biol. 2002; 187:179-92.

SNPs can also be scored by direct DNA sequencing. A variety of automated sequencing procedures can be utilized ((1995) Biotechniques 19:448), including sequencing by mass spectrometry (see, e.g., PCT International Publication No. WO94/16101; Cohen et al., Adv. Chromatogr. 36:127-162 (1996); and Griffin et al., Appl. Biochem. Biotechnol. 38:147-159 (1993)). The nucleic acid sequences of the present invention enable one of ordinary skill in the art to readily design sequencing primers for such automated sequencing procedures. Commercial instrumentation, such as the Applied Biosystems 377, 3100, 3700, 3730, and 3730x1 DNA Analyzers (Foster City, Calif.), is commonly used in the art for automated sequencing.

Other methods that can be used to genotype the SNPs of the present invention include single-strand conformational polymorphism (SSCP), and denaturing gradient gel electrophoresis (DGGE) (Myers et al., Nature 313:495 (1985)). SSCP identifies base differences by alteration in electrophoretic migration of single stranded PCR products, as described in Orita et al., Proc. Nat. Acad. Single-stranded PCR products can be generated by heating or otherwise denaturing double stranded PCR products. Single-stranded nucleic acids may refold or form secondary structures that are partially dependent on the base sequence. The different electrophoretic mobilities of single-stranded amplification products are related to base-sequence differences at SNP positions. DGGE differentiates SNP alleles based on the different sequence-dependent stabilities and melting properties inherent in polymorphic DNA and the corresponding differences in electrophoretic migration patterns in a denaturing gradient gel (Erlich, ed., PCR Technology, Principles and Applications for DNA Amplification, W.H. Freeman and Co, New York, 1992, Chapter 7).

Sequence-specific ribozymes (U.S. Pat. No. 5,498,531) can also be used to score SNPs based on the development or loss of a ribozyme cleavage site. Perfectly matched sequences can be distinguished from mismatched sequences by nuclease cleavage digestion assays or by differences in melting temperature. If the SNP affects a restriction enzyme cleavage site, the SNP can be identified by alterations in restriction enzyme digestion patterns, and the corresponding changes in nucleic acid fragment lengths determined by gel electrophoresis

SNP genotyping can include the steps of, for example, collecting a biological sample from a human subject (e.g., sample of tissues, cells, fluids, secretions, etc.), isolating nucleic acids (e.g., genomic DNA, mRNA or both) from the cells of the sample, contacting the nucleic acids with one or more primers which specifically hybridize to a region of the isolated nucleic acid containing a target SNP under conditions such that hybridization and amplification of the target nucleic acid region occurs, and determining the nucleotide present at the SNP position of interest, or, in some assays, detecting the presence or absence of an amplification product (assays can be designed so that hybridization and/or amplification will only occur if a particular SNP allele is present or absent). In some assays, the size of the amplification product is detected and compared to the length of a control sample; for example, deletions and insertions can be detected by a change in size of the amplified product compared to a normal genotype.

SNP genotyping is useful for numerous practical applications, as described below. Examples of such applications include, but are not limited to, SNP-disease association analysis, disease predisposition screening, disease diagnosis, disease prognosis, disease progression monitoring, determining therapeutic strategies based on an individual's genotype (“pharmacogenomics”), developing therapeutic agents based on SNP genotypes associated with a disease or likelihood of responding to a drug, stratifying a patient population for clinical trial for a treatment regimen, predicting the likelihood that an individual will experience toxic side effects from a therapeutic agent, and human identification applications such as forensics.

Analysis of Genetic Association Between SNPs and Phenotypic Traits

SNP genotyping for disease diagnosis, disease predisposition screening, disease prognosis, determining drug responsiveness (pharmacogenomics), drug toxicity screening, and other uses described herein, typically relies on initially establishing a genetic association between one or more specific SNPs and the particular phenotypic traits of interest.

Different study designs may be used for genetic association studies (Modern Epidemiology, Lippincott Williams & Wilkins (1998), 609-622). Observational studies are most frequently carried out in which the response of the patients is not interfered with. The first type of observational study identifies a sample of persons in whom the suspected cause of the disease is present and another sample of persons in whom the suspected cause is absent, and then the frequency of development of disease in the two samples is compared. These sampled populations are called cohorts, and the study is a prospective study. The other type of observational study is case-control or a retrospective study. In typical case-control studies, samples are collected from individuals with the phenotype of interest (cases) such as certain manifestations of a disease, and from individuals without the phenotype (controls) in a population (target population) that conclusions are to be drawn from. Then the possible causes of the disease are investigated retrospectively. As the time and costs of collecting samples in case-control studies are considerably less than those for prospective studies, case-control studies are the more commonly used study design in genetic association studies, at least during the exploration and discovery stage.

In both types of observational studies, there may be potential confounding factors that should be taken into consideration. Confounding factors are those that are associated with both the real cause(s) of the disease and the disease itself, and they include demographic information such as age, gender, ethnicity as well as environmental factors. When confounding factors are not matched in cases and controls in a study, and are not controlled properly, spurious association results can arise. If potential confounding factors are identified, they should be controlled for by analysis methods explained below.

In a genetic association study, the cause of interest to be tested is a certain allele or a SNP or a combination of alleles or a haplotype from several SNPs. Thus, tissue specimens (e.g., whole blood) from the sampled individuals may be collected and genomic DNA genotyped for the SNP(s) of interest. In addition to the phenotypic trait of interest, other information such as demographic (e.g., age, gender, ethnicity, etc.), clinical, and environmental information that may influence the outcome of the trait can be collected to further characterize and define the sample set. In many cases, these factors are known to be associated with diseases and/or SNP allele frequencies. There are likely gene-environment and/or gene-gene interactions as well. Analysis methods to address gene-environment and gene-gene interactions (for example, the effects of the presence of both susceptibility alleles at two different genes can be greater than the effects of the individual alleles at two genes combined) are discussed below.

After all the relevant phenotypic and genotypic information has been obtained, statistical analyses are carried out to determine if there is any significant correlation between the presence of an allele or a genotype with the phenotypic characteristics of an individual. Preferably, data inspection and cleaning are first performed before carrying out statistical tests for genetic association. Epidemiological and clinical data of the samples can be summarized by descriptive statistics with tables and graphs. Data validation is preferably performed to check for data completion, inconsistent entries, and outliers. Chi-squared tests and t-tests (Wilcoxon rank-sum tests if distributions are not normal) may then be used to check for significant differences between cases and controls for discrete and continuous variables, respectively. To ensure genotyping quality, Hardy-Weinberg disequilibrium tests can be performed on cases and controls separately. Significant deviation from Hardy-Weinberg equilibrium (HWE) in both cases and controls for individual markers can be indicative of genotyping errors. If HWE is violated in a majority of markers, it is indicative of population substructure that should be further investigated. Moreover, Hardy-Weinberg disequilibrium in cases only can indicate genetic association of the markers with the disease (Genetic Data Analysis, Weir B., Sinauer (1990)).

To test whether an allele of a single SNP is associated with the case or control status of a phenotypic trait, one skilled in the art can compare allele frequencies in cases and controls. Standard chi-squared tests and Fisher exact tests can be carried out on a 2×2 table (2 SNP alleles×2 outcomes in the categorical trait of interest). To test whether genotypes of a SNP are associated, chi-squared tests can be carried out on a 3×2 table (3 genotypes×2 outcomes). Score tests are also carried out for genotypic association to contrast the three genotypic frequencies (major homozygotes, heterozygotes and minor homozygotes) in cases and controls, and to look for trends using 3 different modes of inheritance, namely dominant (with contrast coefficients 2, −1, −1), additive (with contrast coefficients 1, 0, −1) and recessive (with contrast coefficients 1, 1, −2). Odds ratios for minor versus major alleles, and odds ratios for heterozygote and homozygote variants versus the wild type genotypes are calculated with the desired confidence limits, usually 95%.

In order to control for confounders and to test for interaction and effect modifiers, stratified analyses may be performed using stratified factors that are likely to be confounding, including demographic information such as age, ethnicity, and gender, or an interacting element or effect modifier, such as a known major gene (e.g., APOE for Alzheimer's disease or HLA genes for autoimmune diseases), or environmental factors such as smoking in lung cancer. Stratified association tests may be carried out using Cochran-Mantel-Haenszel tests that take into account the ordinal nature of genotypes with 0, 1, and 2 variant alleles. Exact tests by StatXact may also be performed when computationally possible. Another way to adjust for confounding effects and test for interactions is to perform stepwise multiple logistic regression analysis using statistical packages such as SAS or R. Logistic regression is a model-building technique in which the best fitting and most parsimonious model is built to describe the relation between the dichotomous outcome (for instance, getting a certain disease or not) and a set of independent variables (for instance, genotypes of different associated genes, and the associated demographic and environmental factors). The most common model is one in which the logit transformation of the odds ratios is expressed as a linear combination of the variables (main effects) and their cross-product terms (interactions) (Applied Logistic Regression, Hosmer and Lemeshow, Wiley (2000)). To test whether a certain variable or interaction is significantly associated with the outcome, coefficients in the model are first estimated and then tested for statistical significance of their departure from zero.

In addition to performing association tests one marker at a time, haplotype association analysis may also be performed to study a number of markers that are closely linked together. Haplotype association tests can have better power than genotypic or allelic association tests when the tested markers are not the disease-causing mutations themselves but are in linkage disequilibrium with such mutations. The test will even be more powerful if the disease is indeed caused by a combination of alleles on a haplotype (e.g., APOE is a haplotype formed by 2 SNPs that are very close to each other). In order to perform haplotype association effectively, marker-marker linkage disequilibrium measures, both D′ and R2, are typically calculated for the markers within a gene to elucidate the haplotype structure. Recent studies (Daly et al, Nature Genetics, 29, 232-235, 2001) in linkage disequilibrium indicate that SNPs within a gene are organized in block pattern, and a high degree of linkage disequilibrium exists within blocks and very little linkage disequilibrium exists between blocks. Haplotype association with the disease status can be performed using such blocks once they have been elucidated.

Haplotype association tests can be carried out in a similar fashion as the allelic and genotypic association tests. Each haplotype in a gene is analogous to an allele in a multi-allelic marker. One skilled in the art can either compare the haplotype frequencies in cases and controls or test genetic association with different pairs of haplotypes. It has been proposed (Schaid et al, Am. J. Hum. Genet., 70, 425-434, 2002) that score tests can be done on haplotypes using the program “haplo.score”. In that method, haplotypes are first inferred by EM algorithm and score tests are carried out with a generalized linear model (GLM) framework that allows the adjustment of other factors.

An important decision in the performance of genetic association tests is the determination of the significance level at which significant association can be declared when the p-value of the tests reaches that level. In an exploratory analysis where positive hits will be followed up in subsequent confirmatory testing, an unadjusted p-value <0.2 (a significance level on the lenient side), for example, may be used for generating hypotheses for significant association of a SNP with certain phenotypic characteristics of a disease. It is preferred that a p-value <0.05 (a significance level traditionally used in the art) is achieved in order for a SNP to be considered to have an association with a disease. It is more preferred that a p-value <0.01 (a significance level on the stringent side) is achieved for an association to be declared. When hits are followed up in confirmatory analyses in more samples of the same source or in different samples from different sources, adjustment for multiple testing will be performed as to avoid excess number of hits while maintaining the experiment-wise error rates at 0.05. While there are different methods to adjust for multiple testing to control for different kinds of error rates, a commonly used but rather conservative method is Bonferroni correction to control the experiment-wise or family-wise error rate (Multiple comparisons and multiple tests, Westfall et al, SAS Institute (1999)). Permutation tests to control for the false discovery rates, FDR, can be more powerful (Benjamini and Hochberg, Journal of the Royal Statistical Society, Series B 57, 1289-1300, 1995, Resampling-based Multiple Testing, Westfall and Young, Wiley (1993)). Such methods to control for multiplicity would be preferred when the tests are dependent and controlling for false discovery rates is sufficient as opposed to controlling for the experiment-wise error rates.

In replication studies using samples from different populations after statistically significant markers have been identified in the exploratory stage, meta-analyses can then be performed by combining evidence of different studies (Modern Epidemiology, Lippincott Williams & Wilkins, 1998, 643-673). If available, association results known in the art for the same SNPs can be included in the meta-analyses.

Since both genotyping and disease status classification can involve errors, sensitivity analyses may be performed to see how odds ratios and p-values would change upon various estimates on genotyping and disease classification error rates.

It has been well known that subpopulation-based sampling bias between cases and controls can lead to spurious results in case-control association studies (Ewens and Spielman, Am. J. Hum. Genet. 62, 450-458, 1995) when prevalence of the disease is associated with different subpopulation groups. Such bias can also lead to a loss of statistical power in genetic association studies. To detect population stratification, Pritchard and Rosenberg (Pritchard et al. Am. J. Hum. Gen. 1999, 65:220-228) suggested typing markers that are unlinked to the disease and using results of association tests on those markers to determine whether there is any population stratification. When stratification is detected, the genomic control (GC) method as proposed by Devlin and Roeder (Devlin et al. Biometrics 1999, 55:997-1004) can be used to adjust for the inflation of test statistics due to population stratification. GC method is robust to changes in population structure levels as well as being applicable to DNA pooling designs (Devlin et al. Genet. Epidem. 20001, 21:273-284).

While Pritchard's method recommended using 15-20 unlinked microsatellite markers, it suggested using more than 30 biallelic markers to get enough power to detect population stratification. For the GC method, it has been shown (Bacanu et al. Am. J. Hum. Genet. 2000, 66:1933-1944) that about 60-70 biallelic markers are sufficient to estimate the inflation factor for the test statistics due to population stratification. Hence, 70 intergenic SNPs can be chosen in unlinked regions as indicated in a genome scan (Kehoe et al. Hum. Mol. Genet. 1999, 8:237-245).

Once individual risk factors, genetic or non-genetic, have been found for the predisposition to disease, the next step is to set up a classification/prediction scheme to predict the category (for instance, disease or no-disease) that an individual will be in depending on his genotypes of associated SNPs and other non-genetic risk factors. Logistic regression for discrete trait and linear regression for continuous trait are standard techniques for such tasks (Applied Regression Analysis, Draper and Smith, Wiley (1998)). Moreover, other techniques can also be used for setting up classification. Such techniques include, but are not limited to, MART, CART, neural network, and discriminant analyses that are suitable for use in comparing the performance of different methods (The Elements of Statistical Learning, Hastie, Tibshirani & Friedman, Springer (2002)).

Disease Diagnosis and Predisposition Screening

Information on association/correlation between genotypes and disease-related phenotypes can be exploited in several ways. For example, in the case of a highly statistically significant association between one or more SNPs with predisposition to a disease for which treatment is available, detection of such a genotype pattern in an individual may justify immediate administration of treatment, or at least the institution of regular monitoring of the individual. Detection of the susceptibility alleles associated with serious disease in a couple contemplating having children may also be valuable to the couple in their reproductive decisions. In the case of a weaker but still statistically significant association between a SNP and a human disease, immediate therapeutic intervention or monitoring may not be justified after detecting the susceptibility allele or SNP. Nevertheless, the subject can be motivated to begin simple life-style changes (e.g., diet, exercise) that can be accomplished at little or no cost to the individual but would confer potential benefits in reducing the risk of developing conditions for which that individual may have an increased risk by virtue of having the susceptibility allele(s).

The SNPs of the invention may contribute to stroke and related pathologies in an individual in different ways. Some polymorphisms occur within a protein coding sequence and contribute to disease phenotype by affecting protein structure. Other polymorphisms occur in noncoding regions but may exert phenotypic effects indirectly via influence on, for example, replication, transcription, and/or translation. A single SNP may affect more than one phenotypic trait. Likewise, a single phenotypic trait may be affected by multiple SNPs in different genes.

As used herein, the terms “diagnose”, “diagnosis”, and “diagnostics” include, but are not limited to any of the following: detection of a vascular disease that an individual may presently have, predisposition/susceptibility screening (i.e., determining an individual's risk of having a stroke, such as whether an individual has an increased or decreased risk of having a stroke in the future), determining a particular type or subclass of vascular disease or stroke in an individual who has a vascular disease or who has had a stroke, confirming or reinforcing a previously made diagnosis of stroke or vascular disease, pharmacogenomic evaluation of an individual to determine which therapeutic or preventive agent or strategy that individual is most likely to benefit from or to predict whether a patient is likely to benefit from a particular therapeutic or preventive agent or strategy, predicting whether a patient is likely to experience toxic or other undesirable side effects from a particular therapeutic or preventive agent or strategy, evaluating the future prognosis of an individual who has had a stroke or who has a vascular disease, and determining the risk that an individual who has already had a stroke will have one or more strokes again in the future (i.e., re-occurring strokes). Such diagnostic uses may be based on the SNPs individually or in combination or SNP haplotypes of the present invention.

Haplotypes are particularly useful in that, for example, fewer SNPs can be genotyped to determine if a particular genomic region harbors a locus that influences a particular phenotype, such as in linkage disequilibrium-based SNP association analysis.

Linkage disequilibrium (LD) refers to the co-inheritance of alleles (e.g., alternative nucleotides) at two or more different SNP sites at frequencies greater than would be expected from the separate frequencies of occurrence of each allele in a given population. The expected frequency of co-occurrence of two alleles that are inherited independently is the frequency of the first allele multiplied by the frequency of the second allele. Alleles that co-occur at expected frequencies are said to be in “linkage equilibrium”. In contrast, LD refers to any non-random genetic association between allele(s) at two or more different SNP sites, which is generally due to the physical proximity of the two loci along a chromosome. LD can occur when two or more SNPs sites are in close physical proximity to each other on a given chromosome and therefore alleles at these SNP sites will tend to remain unseparated for multiple generations with the consequence that a particular nucleotide (allele) at one SNP site will show a non-random association with a particular nucleotide (allele) at a different SNP site located nearby. Hence, genotyping one of the SNP sites will give almost the same information as genotyping the other SNP site that is in LD.

Various degrees of LD can be encountered between two or more SNPs with the result being that some SNPs are more closely associated (i.e., in stronger LD) than others. Furthermore, the physical distance over which LD extends along a chromosome differs between different regions of the genome, and therefore the degree of physical separation between two or more SNP sites necessary for LD to occur can differ between different regions of the genome.

For diagnostic purposes and similar uses, if a particular SNP site is found to be useful for determining predisposition to stroke and related pathologies (e.g., has a significant statistical association with the condition and/or is recognized as a causative polymorphism for the condition), then the skilled artisan would recognize that other SNP sites which are in LD with this SNP site would also be useful for diagnosing the condition. Thus, polymorphisms (e.g., SNPs and/or haplotypes) that are not the actual disease-causing (causative) polymorphisms, but are in LD with such causative polymorphisms, are also useful. In such instances, the genotype of the polymorphism(s) that is/are in LD with the causative polymorphism is predictive of the genotype of the causative polymorphism and, consequently, predictive of the phenotype (e.g., stroke) that is influenced by the causative SNP(s). Therefore, polymorphic markers that are in LD with causative polymorphisms are useful as diagnostic markers, and are particularly useful when the actual causative polymorphism(s) is/are unknown.

Examples of polymorphisms that can be in LD with one or more causative polymorphisms (and/or in LD with one or more polymorphisms that have a significant statistical association with a condition) and therefore useful for diagnosing the same condition that the causative/associated SNP(s) is used to diagnose, include, for example, other SNPs in the same gene, protein-coding, or mRNA transcript-coding region as the causative/associated SNP, other SNPs in the same exon or same intron as the causative/associated SNP, other SNPs in the same haplotype block as the causative/associated SNP, other SNPs in the same intergenic region as the causative/associated SNP, SNPs that are outside but near a gene (e.g., within 6 kb on either side, 5′ or 3′, of a gene boundary) that harbors a causative/associated SNP, etc. Such useful LD SNPs can be selected from among the SNPs disclosed in Table 4, for example.

Linkage disequilibrium in the human genome is reviewed in the following references: Wall et al., “Haplotype blocks and linkage disequilibrium in the human genome,”, Nat Rev Genet. 2003 August; 4(8):587-97 (August 2003); Garner et al. et al., “On selecting markers for association studies: patterns of linkage disequilibrium between two and three diallelic loci,”, Genet Epidemiol. 2003 January; 24(1):57-67 (January 2003); Ardlie et al. et al., “Patterns of linkage disequilibrium in the human genome,”, Nat Rev Genet. 2002 April; 3(4):299-309 (April 2002); (erratum in Nat Rev Genet 2002 July; 3(7):566 (July 2002); and Remm et al., “High-density genotyping and linkage disequilibrium in the human genome using chromosome 22 as a model,”; Curr Opin Chem Biol. 2002 February; 6(1):24-30 (February 2002); J. B. S. Haldane, “J B S (1919) The combination of linkage values, and the calculation of distances between the loci of linked factors,”. J Genet 8:299-309 (1919); G. Mendel, G. (1866) Versuche über Pflanzen-Hybriden. Verhandlungen des naturforschenden Vereines in Brünn [(Proceedings of the Natural History Society of Brünn)] (1866); Lewin B (1990) Genes IV, B. Lewin, ed., Oxford University Press, N.Y. New York, USA (1990); D. L. Hartl D L and A. G. Clark A G (1989) Principles of Population Genetics 2nd ed., Sinauer Associates, Inc., Ma Sunderland, Mass., USA (1989); J. H. Gillespie J H (2004) Population Genetics: A Concise Guide. 2nd ed., Johns Hopkins University Press. (2004) USA; R. C. Lewontin, “RC (1964) The interaction of selection and linkage. I. General considerations; heterotic models,”. Genetics 49:49-67 (1964); P. G. Hoel, P G (1954) Introduction to Mathematical Statistics 2nd ed., John Wiley & Sons, Inc., N.Y. New York, USA (1954); R. R. Hudson, R R “(2001) Two-locus sampling distributions and their application,”. Genetics 159:1805-1817 (2001); A. P. Dempster AP, N. M. Laird, D. B. N M, Rubin, “D B (1977) Maximum likelihood from incomplete data via the EM algorithm,”. J R Stat Soc 39:1-48 (1977); L. Excoffier L, M. Slatkin, M “(1995) Maximum-likelihood estimation of molecular haplotype frequencies in a diploid population,”. Mol Biol Evol 12(5):921-927 (1995); D. A. Tregouet D A, S. Escolano S, L. Tiret L, A. Mallet A, J. L. Golmard, J L “(2004) A new algorithm for haplotype-based association analysis: the Stochastic-EM algorithm,”. Ann Hum Genet 68(Pt 2):165-177 (2004); A. D. Long AD and C. H. Langley C H, “(1999) The power of association studies to detect the contribution of candidate genetic loci to variation in complex traits,”. Genome Research 9:720-731 (1999); A. Agresti, A (1990) Categorical Data Analysis, John Wiley & Sons, Inc., N.Y. New York, USA (1990); K. Lange, K (1997) Mathematical and Statistical Methods for Genetic Analysis, Springer-Verlag New York, Inc., N.Y. New York, USA (1997); The International HapMap Consortium, “(2003) The International HapMap Project,”. Nature 426:789-796 (2003); The International HapMap Consortium, “(2005) A haplotype map of the human genome,”. Nature 437:1299-1320 (2005); G. A. Thorisson G A, A. V. Smith AV, L. Krishnan L, L. D. Stein LD (2005), “The International HapMap Project Web Site,”. Genome Research 15:1591-1593 (2005); G. McVean, C. C. A. G, Spencer CCA, R. Chaix R (2005), “Perspectives on human genetic variation from the HapMap project,”. PLoS Genetics 1(4):413-418 (2005); J. N. Hirschhorn J N, M. J. Daly, M J “(2005) Genome-wide association studies for common diseases and complex traits,”. Nat Genet 6:95-108 (2005); S. J. Schrodi, “S J (2005) A probabilistic approach to large-scale association scans: a semi-Bayesian method to detect disease-predisposing alleles,”. SAGMB 4(1):31 (2005); W. Y. S. Wang W Y S, B. J. Barratt B J, D. G. Clayton DG, J. A. Todd, “J A (2005) Genome-wide association studies: theoretical and practical concerns,”. Nat Rev Genet 6:109-118 (2005); J. K. Pritchard J K, M. Przeworski, “M (2001) Linkage disequilibrium in humans: models and data,”. Am J Hum Genet 69:1-14 (2001).

As discussed above, one aspect of the present invention is the discovery that SNPs which are in certain LD distance with the interrogated SNP can also be used as valid markers for identifying an increased or decreased risks of having or developing stroke. As used herein, the term “interrogated SNP” refers to SNPs that have been found to be associated with an increased or decreased risk of disease using genotyping results and analysis, or other appropriate experimental method as exemplified in the working examples described in this application. As used herein, the term “LD SNP” refers to a SNP that has been characterized as a SNP associating with an increased or decreased risk of diseases due to their being in LD with the “interrogated SNP” under the methods of calculation described in the application. Below, applicants describe the methods of calculation with which one of ordinary skilled in the art may determine if a particular SNP is in LD with an interrogated SNP. The parameter r2 is commonly used in the genetics art to characterize the extent of linkage disequilibrium between markers (Hudson, 2001). As used herein, the term “in LD with” refers to a particular SNP that is measured at above the threshold of a parameter such as r2 with an interrogated SNP.

It is now common place to directly observe genetic variants in a sample of chromosomes obtained from a population. Suppose one has genotype data at two genetic markers located on the same chromosome, for the markers A and B. Further suppose that two alleles segregate at each of these two markers such that alleles A1 and A2 can be found at marker A and alleles B1 and B2 at marker B. Also assume that these two markers are on a human autosome. If one is to examine a specific individual and find that they are heterozygous at both markers, such that their two-marker genotype is A1A2B1B2, then there are two possible configurations: the individual in question could have the alleles A1B1 on one chromosome and A2B2 on the remaining chromosome; alternatively, the individual could have alleles A1B2 on one chromosome and A2B1 on the other. The arrangement of alleles on a chromosome is called a haplotype. In this illustration, the individual could have haplotypes A1B1/A2B2 or A1B2/A2B1 (see Hartl and Clark (1989) for a more complete description). The concept of linkage equilibrium relates the frequency of haplotypes to the allele frequencies.

Assume that a sample of individuals is selected from a larger population. Considering the two markers described above, each having two alleles, there are four possible haplotypes: A1B1, A1B2, A2B1 and A2B2. Denote the frequencies of these four haplotypes with the following notation.


P11=freq(A1B1)  (1)


P12=freq(A1B2)  (2)


P21=freq(A2B1)  (3)


P22=freq(A2B2)  (4)

The allele frequencies at the two markers are then the sum of different haplotype frequencies, it is straightforward to write down a similar set of equations relating single-marker allele frequencies to two-marker haplotype frequencies:


p1=freq(A1)=P11+P12  (5)


p2=freq(A2)=P21+P22  (6)


q1=freq(B1)=P11+P21  (7)


q2=freq(B2)=P12+P22  (8)

Note that the four haplotype frequencies and the allele frequencies at each marker must sum to a frequency of 1.


P11+P12+P21+P22=1  (9)


p1+p2=1  (10)


q1+q2=1  (11)

If there is no correlation between the alleles at the two markers, one would expect that the frequency of the haplotypes would be approximately the product of the composite alleles. Therefore,


P11≈p1q1  (12)


P12≈p1q2  (13)


P21≈p2q1  (14)


P22≈p2q2  (15)

These approximating equations (12)-(15) represent the concept of linkage equilibrium where there is independent assortment between the two markers—the alleles at the two markers occur together at random. These are represented as approximations because linkage equilibrium and linkage disequilibrium are concepts typically thought of as properties of a sample of chromosomes; and as such they are susceptible to stochastic fluctuations due to the sampling process. Empirically, many pairs of genetic markers will be in linkage equilibrium, but certainly not all pairs.

Having established the concept of linkage equilibrium above, applicants can now describe the concept of linkage disequilibrium (LD), which is the deviation from linkage equilibrium. Since the frequency of the A1B1 haplotype is approximately the product of the allele frequencies for A1 and B1 under the assumption of linkage equilibrium as stated mathematically in (12), a simple measure for the amount of departure from linkage equilibrium is the difference in these two quantities, D,


D=P11−p1q1  (16)

D=0 indicates perfect linkage equilibrium. Substantial departures from D=0 indicates LD in the sample of chromosomes examined. Many properties of D are discussed in Lewontin (1964) including the maximum and minimum values that D can take. Mathematically, using basic algebra, it can be shown that D can also be written solely in terms of haplotypes:


D=P11P22−P12P21  (17)

If one transforms D by squaring it and subsequently dividing by the product of the allele frequencies of A1, A2, B1 and B2, the resulting quantity, called r2, is equivalent to the square of the Pearson's correlation coefficient commonly used in statistics (e.g. Hoel, 1954).

r 2 = D 2 p 1  p 2  q 1  q 2 ( 18 )

As with D, values of r2 close to 0 indicate linkage equilibrium between the two markers examined in the sample set. As values of r2 increase, the two markers are said to be in linkage disequilibrium. The range of values that r2 can take are from 0 to 1. r2=1 when there is a perfect correlation between the alleles at the two markers.

In addition, the quantities discussed above are sample-specific. And as such, it is necessary to formulate notation specific to the samples studied. In the approach discussed here, three types of samples are of primary interest: (i) a sample of chromosomes from individuals affected by a disease-related phenotype (cases), (ii) a sample of chromosomes obtained from individuals not affected by the disease-related phenotype (controls), and (iii) a standard sample set used for the construction of haplotypes and calculation pairwise linkage disequilibrium. For the allele frequencies used in the development of the method described below, an additional subscript will be added to denote either the case or control sample sets.


p1,cs=freq(A1 in cases)  (19)


p2,cs=freq(A2 in cases)  (20)


q1,cs=freq(B1 in cases)  (21)


q2,cs=freq(B2 in cases)  (22)

Similarly,


p1,ct=freq(A1 in controls)  (23)


p2,ct=freq(A2 in controls)  (24)


q1,ct=freq(B1 in controls)  (25)


q2,ct=freq(B2 in controls)  (26)

As a well-accepted sample set is necessary for robust linkage disequilibrium calculations, data obtained from the International HapMap project (The International HapMap Consortium 2003, 2005; Thorisson et al, 2005; McVean et al, 2005) can be used for the calculation of pairwise r2 values. Indeed, the samples genotyped for the International HapMap Project were selected to be representative examples from various human sub-populations with sufficient numbers of chromosomes examined to draw meaningful and robust conclusions from the patterns of genetic variation observed. The International HapMap project website (hapmap.org) contains a description of the project, methods utilized and samples examined. It is useful to examine empirical data to get a sense of the patterns present in such data.

Haplotype frequencies were explicit arguments in equation (18) above. However, knowing the 2-marker haplotype frequencies requires that phase to be determined for doubly heterozygous samples. When phase is unknown in the data examined, various algorithms can be used to infer phase from the genotype data. This issue was discussed earlier where the doubly heterozygous individual with a 2-SNP genotype of A1A2B1B2 could have one of two different sets of chromosomes: A1B1/A2B2 or A1B2/A2B1. One such algorithm to estimate haplotype frequencies is the expectation-maximization (EM) algorithm first formalized by Dempster et al. (1977). This algorithm is often used in genetics to infer haplotype frequencies from genotype data (e.g., Excoffier and Slatkin (1995); Tregouet et al., (2004)). It should be noted that for the two-SNP case explored here, EM algorithms have very little error provided that the allele frequencies and sample sizes are not too small. The impact on r2 values is typically negligible.

As correlated genetic markers share information, interrogation of SNP markers in LD with a disease-associated SNP marker can also have sufficient power to detect disease association (Long and Langley (1999)). The relationship between the power to directly find disease-associated alleles and the power to indirectly detect disease-association was investigated by Pritchard and Przeworski (2001). In a straight-forward derivation, it can be shown that the power to detect disease association indirectly at a marker locus in linkage disequilibrium with a disease-association locus is approximately the same as the power to detect disease-association directly at the disease-association locus if the sample size is increased by a factor of

1 r 2

(the reciprocal of equation 18) at the marker in comparison with the disease-association locus.

Therefore, if one calculated the power to detect disease-association indirectly with an experiment having N samples, then equivalent power to directly detect disease-association (at the actual disease-susceptibility locus) would necessitate an experiment using approximately r2N samples. This elementary relationship between power, sample size and linkage disequilibrium can be used to derive an r2 threshold value useful in determining whether or not genotyping markers in linkage disequilibrium with a SNP marker directly associated with disease status has enough power to indirectly detect disease-association.

To commence a derivation of the power to detect disease-associated markers through an indirect process, define the effective chromosomal sample size as

n = 4  N cs  N ct N cs + N ct ; ( 27 )

where Ncs and Nct are the numbers of diploid cases and controls, respectively. This is necessary to handle situations where the numbers of cases and controls are not equivalent. For equal case and control sample sizes, Ncs=Nct=N, the value of the effective number of chromosomes is simply n=2N—as expected. Let power be calculated for a significance level α (such that traditional P-values below α will be deemed statistically significant). Define the standard Gaussian distribution function as Φ(·). Mathematically,

Φ  ( x ) = 1 2  π  ∫ - ∞ x  e θ 2 2  d   θ ( 28 )

Alternatively, the following error function notation (Erf) may also be used,

Φ  ( x ) = 1 2  [ 1 + Erf  ( x 2 ) ] ( 29 )

For example, Φ(1.644854)=0.95. The value of r2 may be derived to yield a pre-specified minimum amount of power to detect disease association though indirect interrogation. Noting that the LD SNP marker could be the one that is carrying the disease-association allele, therefore that this approach constitutes a lower-bound model where all indirect power results are expected to be at least as large as those interrogated.

Denote by β the error rate for not detecting truly disease-associated markers. Therefore, 1−β is the classical definition of statistical power. Substituting the Pritchard-Pzreworski result into the sample size, the power to detect disease association at a significance level of α is given by the approximation

1 - β ≅ Φ [  q 1 , cs - q 1 , ct  q 1 , cs  ( 1 - q 1 , cs ) + q 1 , ct  ( 1 - q 1 , ct ) r 2  n - Z 1 - α 2 ] ; ( 30 )

where Zu is the inverse of the standard normal cumulative distribution evaluated at u (u∈(0,1)). Zu−1(u), where Φ(Φ−1(u))=Φ−1(Φ(u))=u. For example, setting α=0.05, and therefore 1−α/2=0.975, Z0.975=1.95996 is obtained. Next, setting power equal to a threshold of a minimum power of T,

T = Φ [  q 1 , cs - q 1 , ct  q 1 , cs  ( 1 - q 1 , cs ) + q 1 , ct  ( 1 - q 1 , ct ) r 2  n - Z 1 - α 2 ] ( 31 )

and solving for r2, the following threshold r2 is obtained:

r T 2 = ⌊ q 1 , cs  ( 1 - q 1 , cs ) + q 1 , ct  ( 1 - q 1 , ct ) ⌋ n  ( q 1 , cs - q 1 , ct ) 2  [ Φ - 1  ( T ) + Z 1 - α 2 ] 2 ( 32 )

Or,

r T 2 = ( Z T + Z 1 - α 2 ) 2 n  [ q 1 , cs  ( q 1 , cs ) 2 + q 1 , ct  ( q 1 , ct ) 2 ( q 1 , cs - q 1 , ct ) 2 ] ( 33 )

Suppose that r2 is calculated between an interrogated SNP and a number of other SNPs with varying levels of LD with the interrogated SNP. The threshold value rT2 is the minimum value of linkage disequilibrium between the interrogated SNP and the potential LD SNPs such that the LD SNP still retains a power greater or equal to T for detecting disease-association. For example, suppose that SNP rs200 is genotyped in a case-control disease-association study and it is found to be associated with a disease phenotype. Further suppose that the minor allele frequency in 1,000 case chromosomes was found to be 16% in contrast with a minor allele frequency of 10% in 1,000 control chromosomes. Given those measurements one could have predicted, prior to the experiment, that the power to detect disease association at a significance level of 0.05 was quite high—approximately 98% using a test of allelic association. Applying equation (32) one can calculate a minimum value of r2 to indirectly assess disease association assuming that the minor allele at SNP rs200 is truly disease-predisposing for a threshold level of power. If one sets the threshold level of power to be 80%, then rT2=0.489 given the same significance level and chromosome numbers as above. Hence, any SNP with a pairwise r2 value with rs200 greater than 0.489 is expected to have greater than 80% power to detect the disease association. Further, this is assuming the conservative model where the LD SNP is disease-associated only through linkage disequilibrium with the interrogated SNP rs200.

The contribution or association of particular SNPs and/or SNP haplotypes with disease phenotypes, such as stroke, enables the SNPs of the present invention to be used to develop superior diagnostic tests capable of identifying individuals who express a detectable trait, such as stroke, as the result of a specific genotype, or individuals whose genotype places them at an increased or decreased risk of developing a detectable trait at a subsequent time as compared to individuals who do not have that genotype. As described herein, diagnostics may be based on a single SNP or a group of SNPs. Combined detection of a plurality of SNPs (for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 24, 25, 30, 32, 48, 50, 64, 96, 100, or any other number in-between, or more, of the SNPs provided in Table 1 and/or Table 2) typically increases the probability of an accurate diagnosis. For example, the presence of a single SNP known to correlate with stroke might indicate a probability of 20% that an individual is at risk of having a stroke, whereas detection of five SNPs, each of which correlates with stroke, might indicate a probability of 80% that an individual is at risk of having a stroke. To further increase the accuracy of diagnosis or predisposition screening, analysis of the SNPs of the present invention can be combined with that of other polymorphisms or other risk factors of stroke, such as disease symptoms, pathological characteristics, family history, diet, environmental factors or lifestyle factors.

It will, of course, be understood by practitioners skilled in the treatment, prevention, or diagnosis of stroke that the present invention generally does not intend to provide an absolute identification of individuals who are at risk (or less at risk) of having a stroke, and/or pathologies related to stroke such as other vascular diseases, but rather to indicate a certain increased (or decreased) degree or likelihood of developing the disease (e.g., having a stroke) based on statistically significant association results. However, this information is extremely valuable as it can be used to, for example, initiate preventive treatments or to allow an individual carrying one or more significant SNPs or SNP haplotypes to foresee warning signs such as minor clinical symptoms, or to have regularly scheduled physical exams to monitor for appearance of a condition in order to identify and begin treatment of the condition at an early stage. Particularly with diseases that are extremely debilitating or fatal if not treated on time, the knowledge of a potential predisposition, even if this predisposition is not absolute, would likely contribute in a very significant manner to treatment efficacy.

The diagnostic techniques of the present invention may employ a variety of methodologies to determine whether a test subject has a SNP or a SNP pattern associated with an increased or decreased risk of developing a detectable trait or whether the individual suffers from a detectable trait as a result of a particular polymorphism/mutation, including, for example, methods which enable the analysis of individual chromosomes for haplotyping, family studies, single sperm DNA analysis, or somatic hybrids. The trait analyzed using the diagnostics of the invention may be any detectable trait that is commonly observed in pathologies and disorders related to stroke.

Another aspect of the present invention relates to a method of determining whether an individual is at risk (or less at risk) of developing one or more traits or whether an individual expresses one or more traits as a consequence of possessing a particular trait-causing or trait-influencing allele. These methods generally involve obtaining a nucleic acid sample from an individual and assaying the nucleic acid sample to determine which nucleotide(s) is/are present at one or more SNP positions, wherein the assayed nucleotide(s) is/are indicative of an increased or decreased risk of developing the trait or indicative that the individual expresses the trait as a result of possessing a particular trait-causing or trait-influencing allele.

In another embodiment, the SNP detection reagents of the present invention are used to determine whether an individual has one or more SNP allele(s) affecting the level (e.g., the concentration of mRNA or protein in a sample, etc.) or pattern (e.g., the kinetics of expression, rate of decomposition, stability profile, Km, Vmax, etc.) of gene expression (collectively, the “gene response” of a cell or bodily fluid). Such a determination can be accomplished by screening for mRNA or protein expression (e.g., by using nucleic acid arrays, RT-PCR, TaqMan assays, or mass spectrometry), identifying genes having altered expression in an individual, genotyping SNPs disclosed in Table 1 and/or Table 2 that could affect the expression of the genes having altered expression (e.g., SNPs that are in and/or around the gene(s) having altered expression, SNPs in regulatory/control regions, SNPs in and/or around other genes that are involved in pathways that could affect the expression of the gene(s) having altered expression, or all SNPs could be genotyped), and correlating SNP genotypes with altered gene expression. In this manner, specific SNP alleles at particular SNP sites can be identified that affect gene expression.

Pharmacogenomics and Therapeutics/Drug Development

The present invention provides methods for assessing the pharmacogenomics of a subject harboring particular SNP alleles or haplotypes or diplotypes to a particular therapeutic agent or pharmaceutical compound, or to a class of such compounds. Pharmacogenomics deals with the roles which clinically significant hereditary variations (e.g., SNPs) play in the response to drugs due to altered drug disposition and/or abnormal action in affected persons. See, e.g., Roses, Nature 405, 857-865 (2000); Gould Rothberg, Nature Biotechnology 19, 209-211 (2001); Eichelbaum, Clin. Exp. Pharmacol. Physiol. 23(10-11):983-985 (1996); and Linder, Clin. Chem. 43(2):254-266 (1997). The clinical outcomes of these variations can result in severe toxicity of therapeutic drugs in certain individuals or therapeutic failure of drugs in certain individuals as a result of individual variation in metabolism. Thus, the SNP genotype of an individual can determine the way a therapeutic compound acts on the body or the way the body metabolizes the compound. For example, SNPs in drug metabolizing enzymes can affect the activity of these enzymes, which in turn can affect both the intensity and duration of drug action, as well as drug metabolism and clearance.

The discovery of SNPs in drug metabolizing enzymes, drug transporters, proteins for pharmaceutical agents, and other drug targets has explained why some patients do not obtain the expected drug effects, show an exaggerated drug effect, or experience serious toxicity from standard drug dosages. SNPs can be expressed in the phenotype of the extensive metabolizer and in the phenotype of the poor metabolizer. Accordingly, SNPs may lead to allelic variants of a protein in which one or more of the protein functions in one population are different from those in another population. SNPs and the encoded variant peptides thus provide targets to ascertain a genetic predisposition that can affect treatment modality. For example, in a ligand-based treatment, SNPs may give rise to amino terminal extracellular domains and/or other ligand-binding regions of a receptor that are more or less active in ligand binding, thereby affecting subsequent protein activation. Accordingly, ligand dosage would necessarily be modified to maximize the therapeutic effect within a given population containing particular SNP alleles or haplotypes.

As an alternative to genotyping, specific variant proteins containing variant amino acid sequences encoded by alternative SNP alleles could be identified. Thus, pharmacogenomic characterization of an individual permits the selection of effective compounds and effective dosages of such compounds for prophylactic or therapeutic uses based on the individual's SNP genotype, thereby enhancing and optimizing the effectiveness of the therapy. Furthermore, the production of recombinant cells and transgenic animals containing particular SNPs/haplotypes allow effective clinical design and testing of treatment compounds and dosage regimens. For example, transgenic animals can be produced that differ only in specific SNP alleles in a gene that is orthologous to a human disease susceptibility gene.

Pharmacogenomic uses of the SNPs of the present invention provide several significant advantages for patient care, particularly in treating stroke. Pharmacogenomic characterization of an individual, based on an individual's SNP genotype, can identify those individuals unlikely to respond to treatment with a particular medication and thereby allows physicians to avoid prescribing the ineffective medication to those individuals. On the other hand, SNP genotyping of an individual may enable physicians to select the appropriate medication and dosage regimen that will be most effective based on an individual's SNP genotype. This information increases a physician's confidence in prescribing medications and motivates patients to comply with their drug regimens. Furthermore, pharmacogenomics may identify patients predisposed to toxicity and adverse reactions to particular drugs or drug dosages. Adverse drug reactions lead to more than 100,000 avoidable deaths per year in the United States alone and therefore represent a significant cause of hospitalization and death, as well as a significant economic burden on the healthcare system (Pfost et. al., Trends in Biotechnology, August 2000.). Thus, pharmacogenomics based on the SNPs disclosed herein has the potential to both save lives and reduce healthcare costs substantially.

It is also well known in the art that markers that are diagnostically useful in distinguishing patients at higher risk of developing a disease (such as stroke) from those who are at a decreased risk of developing the disease can be useful in identifying those patients who are more likely to respond to drug treatments targeting those pathways involving genes where the diagnostic SNPs reside. See references Gerdes, et al., Circulation, 2000; 101:1366-1371, Kuivenhoven, et al., N Engl J Med 1998; 338:86-93, Stolarz, et al., Hypertension 2004; 44:156-162, Chartier-Harlin, et al., Hum. Mol. Genet. 1994 April; 3(4):569-74, Roses, et al., The Pharmacogenomics Journal 2006, 1-19.

In that regard, embodiments of the present invention can be very useful in assisting clinicians to select individuals who are more likely to have a stroke and who are therefore good candidates for receiving therapy for the prevention or treatment of stroke, thus warranting administration of the above-mentioned drug treatments to such individuals. On the other hand, individuals who are deemed to have a low risk of having a stroke, using SNP markers discovered herein, can be spared the aggravation and wastefulness of the drug treatment due to the reduced benefit of such treatment in view of its cost and potential side effects.

Pharmacogenomics in general is discussed further in Rose et al., “Pharmacogenetic analysis of clinically relevant genetic polymorphisms”, Methods Mol Med. 2003; 85:225-37. Pharmacogenomics as it relates to Alzheimer's disease and other neurodegenerative disorders is discussed in Cacabelos, “Pharmacogenomics for the treatment of dementia”, Ann Med. 2002; 34(5):357-79, Maimone et al., “Pharmacogenomics of neurodegenerative diseases”, Eur J Pharmacol. 2001 Feb. 9; 413(1):11-29, and Poirier, “Apolipoprotein E: a pharmacogenetic target for the treatment of Alzheimer's disease”, Mol Diagn. 1999 December; 4(4):335-41. Pharmacogenomics as it relates to cardiovascular disorders is discussed in Siest et al., “Pharmacogenomics of drugs affecting the cardiovascular system”, Clin Chem Lab Med. 2003 April; 41(4):590-9, Mukherjee et al., “Pharmacogenomics in cardiovascular diseases”, Prog Cardiovasc Dis. 2002 May-June; 44(6):479-98, and Mooser et al., “Cardiovascular pharmacogenetics in the SNP era”, J Thromb Haemost. 2003 July; 1(7):1398-402. Pharmacogenomics as it relates to cancer is discussed in McLeod et al., “Cancer pharmacogenomics: SNPs, chips, and the individual patient”, Cancer Invest. 2003; 21(4):630-40 and Watters et al., “Cancer pharmacogenomics: current and future applications”, Biochim Biophys Acta. 2003 Mar. 17; 1603(2):99-111.

The SNPs of the present invention also can be used to identify novel therapeutic targets for stroke. For example, genes containing the disease-associated variants (“variant genes”) or their products, as well as genes or their products that are directly or indirectly regulated by or interacting with these variant genes or their products, can be targeted for the development of therapeutics that, for example, treat the disease or prevent or delay disease onset. The therapeutics may be composed of, for example, small molecules, proteins, protein fragments or peptides, antibodies, nucleic acids, or their derivatives or mimetics which modulate the functions or levels of the target genes or gene products.

The SNP-containing nucleic acid molecules disclosed herein, and their complementary nucleic acid molecules, may be used as antisense constructs to control gene expression in cells, tissues, and organisms. Antisense technology is well established in the art and extensively reviewed in Antisense Drug Technology: Principles, Strategies, and Applications, Crooke (ed.), Marcel Dekker, Inc.: New York (2001). An antisense nucleic acid molecule is generally designed to be complementary to a region of mRNA expressed by a gene so that the antisense molecule hybridizes to the mRNA and thereby blocks translation of mRNA into protein. Various classes of antisense oligonucleotides are used in the art, two of which are cleavers and blockers. Cleavers, by binding to target RNAs, activate intracellular nucleases (e.g., RNaseH or RNase L) that cleave the target RNA. Blockers, which also bind to target RNAs, inhibit protein translation through steric hindrance of ribosomes. Exemplary blockers include peptide nucleic acids, morpholinos, locked nucleic acids, and methylphosphonates (see, e.g., Thompson, Drug Discovery Today, 7 (17): 912-917 (2002)). Antisense oligonucleotides are directly useful as therapeutic agents, and are also useful for determining and validating gene function (e.g., in gene knock-out or knock-down experiments).

Antisense technology is further reviewed in: Lavery et al., “Antisense and RNAi: powerful tools in drug target discovery and validation”, Curr Opin Drug Discov Devel. 2003 July; 6(4):561-9; Stephens et al., “Antisense oligonucleotide therapy in cancer”, Curr Opin Mol Ther. 2003 April; 5(2):118-22; Kurreck, “Antisense technologies. Improvement through novel chemical modifications”, Eur J Biochem. 2003 April; 270(8):1628-44; Dias et al., “Antisense oligonucleotides: basic concepts and mechanisms”, Mol Cancer Ther. 2002 March; 1(5):347-55; Chen, “Clinical development of antisense oligonucleotides as anti-cancer therapeutics”, Methods Mol Med. 2003; 75:621-46; Wang et al., “Antisense anticancer oligonucleotide therapeutics”, Curr Cancer Drug Targets. 2001 November; 1(3):177-96; and Bennett, “Efficiency of antisense oligonucleotide drug discovery”, Antisense Nucleic Acid Drug Dev. 2002 June; 12(3):215-24.

The SNPs of the present invention are particularly useful for designing antisense reagents that are specific for particular nucleic acid variants. Based on the SNP information disclosed herein, antisense oligonucleotides can be produced that specifically target mRNA molecules that contain one or more particular SNP nucleotides. In this manner, expression of mRNA molecules that contain one or more undesired polymorphisms (e.g., SNP nucleotides that lead to a defective protein such as an amino acid substitution in a catalytic domain) can be inhibited or completely blocked. Thus, antisense oligonucleotides can be used to specifically bind a particular polymorphic form (e.g., a SNP allele that encodes a defective protein), thereby inhibiting translation of this form, but which do not bind an alternative polymorphic form (e.g., an alternative SNP nucleotide that encodes a protein having normal function).

Antisense molecules can be used to inactivate mRNA in order to inhibit gene expression and production of defective proteins. Accordingly, these molecules can be used to treat a disorder, such as stroke, characterized by abnormal or undesired gene expression or expression of certain defective proteins. This technique can involve cleavage by means of ribozymes containing nucleotide sequences complementary to one or more regions in the mRNA that attenuate the ability of the mRNA to be translated. Possible mRNA regions include, for example, protein-coding regions and particularly protein-coding regions corresponding to catalytic activities, substrate/ligand binding, or other functional activities of a protein.

The SNPs of the present invention are also useful for designing RNA interference reagents that specifically target nucleic acid molecules having particular SNP variants. RNA interference (RNAi), also referred to as gene silencing, is based on using double-stranded RNA (dsRNA) molecules to turn genes off. When introduced into a cell, dsRNAs are processed by the cell into short fragments (generally about 21, 22, or 23 nucleotides in length) known as small interfering RNAs (siRNAs) which the cell uses in a sequence-specific manner to recognize and destroy complementary RNAs (Thompson, Drug Discovery Today, 7 (17): 912-917 (2002)). Accordingly, an aspect of the present invention specifically contemplates isolated nucleic acid molecules that are about 18-26 nucleotides in length, preferably 19-25 nucleotides in length, and more preferably 20, 21, 22, or 23 nucleotides in length, and the use of these nucleic acid molecules for RNAi. Because RNAi molecules, including siRNAs, act in a sequence-specific manner, the SNPs of the present invention can be used to design RNAi reagents that recognize and destroy nucleic acid molecules having specific SNP alleles/nucleotides (such as deleterious alleles that lead to the production of defective proteins), while not affecting nucleic acid molecules having alternative SNP alleles (such as alleles that encode proteins having normal function). As with antisense reagents, RNAi reagents may be directly useful as therapeutic agents (e.g., for turning off defective, disease-causing genes), and are also useful for characterizing and validating gene function (e.g., in gene knock-out or knock-down experiments).

The following references provide a further review of RNAi: Reynolds et al., “Rational siRNA design for RNA interference”, Nat Biotechnol. 2004 March; 22(3):326-30. Epub 2004 Feb. 1; Chi et al., “Genomewide view of gene silencing by small interfering RNAs”, PNAS 100(11):6343-6346, 2003; Vickers et al., “Efficient Reduction of Target RNAs by Small Interfering RNA and RNase H-dependent Antisense Agents”, J. Biol. Chem. 278: 7108-7118, 2003; Agami, “RNAi and related mechanisms and their potential use for therapy”, Curr Opin Chem Biol. 2002 December; 6(6):829-34; Lavery et al., “Antisense and RNAi: powerful tools in drug target discovery and validation”, Curr Opin Drug Discov Devel. 2003 July; 6(4):561-9; Shi, “Mammalian RNAi for the masses”, Trends Genet 2003 January; 19(1):9-12), Shuey et al., “RNAi: gene-silencing in therapeutic intervention”, Drug Discovery Today 2002 October; 7(20):1040-1046; McManus et al., Nat Rev Genet 2002 October; 3(10):737-47; Xia et al., Nat Biotechnol 2002 October; 20(10):1006-10; Plasterk et al., Curr Opin Genet Dev 2000 October; 10(5):562-7; Bosher et al., Nat Cell Biol 2000 February; 2(2):E31-6; and Hunter, Curr Biol 1999 Jun. 17; 9(12):R440-2).

A subject suffering from a pathological condition, such as stroke, ascribed to a SNP may be treated so as to correct the genetic defect (see Kren et al., Proc. Natl. Acad. Sci. USA 96:10349-10354 (1999)). Such a subject can be identified by any method that can detect the polymorphism in a biological sample drawn from the subject. Such a genetic defect may be permanently corrected by administering to such a subject a nucleic acid fragment incorporating a repair sequence that supplies the normal/wild-type nucleotide at the position of the SNP. This site-specific repair sequence can encompass an RNA/DNA oligonucleotide that operates to promote endogenous repair of a subject's genomic DNA. The site-specific repair sequence is administered in an appropriate vehicle, such as a complex with polyethylenimine, encapsulated in anionic liposomes, a viral vector such as an adenovirus, or other pharmaceutical composition that promotes intracellular uptake of the administered nucleic acid. A genetic defect leading to an inborn pathology may then be overcome, as the chimeric oligonucleotides induce incorporation of the normal sequence into the subject's genome. Upon incorporation, the normal gene product is expressed, and the replacement is propagated, thereby engendering a permanent repair and therapeutic enhancement of the clinical condition of the subject.

In cases in which a cSNP results in a variant protein that is ascribed to be the cause of, or a contributing factor to, a pathological condition, a method of treating such a condition can include administering to a subject experiencing the pathology the wild-type/normal cognate of the variant protein. Once administered in an effective dosing regimen, the wild-type cognate provides complementation or remediation of the pathological condition.

The invention further provides a method for identifying a compound or agent that can be used to treat or prevent stroke. The SNPs disclosed herein are useful as targets for the identification and/or development of therapeutic agents. A method for identifying a therapeutic agent or compound typically includes assaying the ability of the agent or compound to modulate the activity and/or expression of a SNP-containing nucleic acid or the encoded product and thus identifying an agent or a compound that can be used to treat a disorder characterized by undesired activity or expression of the SNP-containing nucleic acid or the encoded product. The assays can be performed in cell-based and cell-free systems. Cell-based assays can include cells naturally expressing the nucleic acid molecules of interest or recombinant cells genetically engineered to express certain nucleic acid molecules.

Variant gene expression in a stroke patient can include, for example, either expression of a SNP-containing nucleic acid sequence (for instance, a gene that contains a SNP can be transcribed into an mRNA transcript molecule containing the SNP, which can in turn be translated into a variant protein) or altered expression of a normal/wild-type nucleic acid sequence due to one or more SNPs (for instance, a regulatory/control region can contain a SNP that affects the level or pattern of expression of a normal transcript).

Assays for variant gene expression can involve direct assays of nucleic acid levels (e.g., mRNA levels), expressed protein levels, or of collateral compounds involved in a signal pathway. Further, the expression of genes that are up- or down-regulated in response to the signal pathway can also be assayed. In this embodiment, the regulatory regions of these genes can be operably linked to a reporter gene such as luciferase.

Modulators of variant gene expression can be identified in a method wherein, for example, a cell is contacted with a candidate compound/agent and the expression of mRNA determined. The level of expression of mRNA in the presence of the candidate compound is compared to the level of expression of mRNA in the absence of the candidate compound. The candidate compound can then be identified as a modulator of variant gene expression based on this comparison and be used to treat a disorder such as stroke that is characterized by variant gene expression (e.g., either expression of a SNP-containing nucleic acid or altered expression of a normal/wild-type nucleic acid molecule due to one or more SNPs that affect expression of the nucleic acid molecule) due to one or more SNPs of the present invention. When expression of mRNA is statistically significantly greater in the presence of the candidate compound than in its absence, the candidate compound is identified as a stimulator of nucleic acid expression. When nucleic acid expression is statistically significantly less in the presence of the candidate compound than in its absence, the candidate compound is identified as an inhibitor of nucleic acid expression.

The invention further provides methods of treatment, with the SNP or associated nucleic acid domain (e.g., catalytic domain, ligand/substrate-binding domain, regulatory/control region, etc.) or gene, or the encoded mRNA transcript, as a target, using a compound identified through drug screening as a gene modulator to modulate variant nucleic acid expression. Modulation can include either up-regulation (i.e., activation or agonization) or down-regulation (i.e., suppression or antagonization) of nucleic acid expression.

Expression of mRNA transcripts and encoded proteins, either wild type or variant, may be altered in individuals with a particular SNP allele in a regulatory/control element, such as a promoter or transcription factor binding domain, that regulates expression. In this situation, methods of treatment and compounds can be identified, as discussed herein, that regulate or overcome the variant regulatory/control element, thereby generating normal, or healthy, expression levels of either the wild type or variant protein.

The SNP-containing nucleic acid molecules of the present invention are also useful for monitoring the effectiveness of modulating compounds on the expression or activity of a variant gene, or encoded product, in clinical trials or in a treatment regimen. Thus, the gene expression pattern can serve as an indicator for the continuing effectiveness of treatment with the compound, particularly with compounds to which a patient can develop resistance, as well as an indicator for toxicities. The gene expression pattern can also serve as a marker indicative of a physiological response of the affected cells to the compound. Accordingly, such monitoring would allow either increased administration of the compound or the administration of alternative compounds to which the patient has not become resistant. Similarly, if the level of nucleic acid expression falls below a desirable level, administration of the compound could be commensurately decreased.

In another aspect of the present invention, there is provided a pharmaceutical pack comprising a therapeutic agent (e.g., a small molecule drug, antibody, peptide, antisense or RNAi nucleic acid molecule, etc.) and a set of instructions for administration of the therapeutic agent to humans diagnostically tested for one or more SNPs or SNP haplotypes provided by the present invention.

The SNPs/haplotypes of the present invention are also useful for improving many different aspects of the drug development process. For instance, an aspect of the present invention includes selecting individuals for clinical trials based on their SNP genotype. For example, individuals with SNP genotypes that indicate that they are likely to positively respond to a drug can be included in the trials, whereas those individuals whose SNP genotypes indicate that they are less likely to or would not respond to the drug, or who are at risk for suffering toxic effects or other adverse reactions, can be excluded from the clinical trials. This not only can improve the safety of clinical trials, but also can enhance the chances that the trial will demonstrate statistically significant efficacy. Furthermore, the SNPs of the present invention may explain why certain previously developed drugs performed poorly in clinical trials and may help identify a subset of the population that would benefit from a drug that had previously performed poorly in clinical trials, thereby “rescuing” previously developed drugs, and enabling the drug to be made available to a particular stroke patient population that can benefit from it.

SNPs have many important uses in drug discovery, screening, and development. A high probability exists that, for any gene/protein selected as a potential drug target, variants of that gene/protein will exist in a patient population. Thus, determining the impact of gene/protein variants on the selection and delivery of a therapeutic agent should be an integral aspect of the drug discovery and development process. (Jazwinska, A Trends Guide to Genetic Variation and Genomic Medicine, 2002 March; S30-S36).

Knowledge of variants (e.g., SNPs and any corresponding amino acid polymorphisms) of a particular therapeutic target (e.g., a gene, mRNA transcript, or protein) enables parallel screening of the variants in order to identify therapeutic candidates (e.g., small molecule compounds, antibodies, antisense or RNAi nucleic acid compounds, etc.) that demonstrate efficacy across variants (Rothberg, Nat Biotechnol 2001 March; 19(3):209-11). Such therapeutic candidates would be expected to show equal efficacy across a larger segment of the patient population, thereby leading to a larger potential market for the therapeutic candidate.

Furthermore, identifying variants of a potential therapeutic target enables the most common form of the target to be used for selection of therapeutic candidates, thereby helping to ensure that the experimental activity that is observed for the selected candidates reflects the real activity expected in the largest proportion of a patient population (Jazwinska, A Trends Guide to Genetic Variation and Genomic Medicine, 2002 March; S30-S36).

Additionally, screening therapeutic candidates against all known variants of a target can enable the early identification of potential toxicities and adverse reactions relating to particular variants. For example, variability in drug absorption, distribution, metabolism and excretion (ADME) caused by, for example, SNPs in therapeutic targets or drug metabolizing genes, can be identified, and this information can be utilized during the drug development process to minimize variability in drug disposition and develop therapeutic agents that are safer across a wider range of a patient population. The SNPs of the present invention, including the variant proteins and encoding polymorphic nucleic acid molecules provided in Tables 1-2, are useful in conjunction with a variety of toxicology methods established in the art, such as those set forth in Current Protocols in Toxicology, John Wiley & Sons, Inc., N.Y.

Furthermore, therapeutic agents that target any art-known proteins (or nucleic acid molecules, either RNA or DNA) may cross-react with the variant proteins (or polymorphic nucleic acid molecules) disclosed in Table 1, thereby significantly affecting the pharmacokinetic properties of the drug. Consequently, the protein variants and the SNP-containing nucleic acid molecules disclosed in Tables 1-2 are useful in developing, screening, and evaluating therapeutic agents that target corresponding art-known protein forms (or nucleic acid molecules). Additionally, as discussed above, knowledge of all polymorphic forms of a particular drug target enables the design of therapeutic agents that are effective against most or all such polymorphic forms of the drug target.

Pharmaceutical Compositions and Administration Thereof

Any of the stroke-associated proteins, and encoding nucleic acid molecules, disclosed herein can be used as therapeutic targets (or directly used themselves as therapeutic compounds) for treating or preventing stroke and related pathologies, and the present disclosure enables therapeutic compounds (e.g., small molecules, antibodies, therapeutic proteins, RNAi and antisense molecules, etc.) to be developed that target (or are comprised of) any of these therapeutic targets.

In general, a therapeutic compound will be administered in a therapeutically effective amount by any of the accepted modes of administration for agents that serve similar utilities. The actual amount of the therapeutic compound of this invention, i.e., the active ingredient, will depend upon numerous factors such as the severity of the disease to be treated, the age and relative health of the subject, the potency of the compound used, the route and form of administration, and other factors.

Therapeutically effective amounts of therapeutic compounds may range from, for example, approximately 0.01-50 mg per kilogram body weight of the recipient per day; preferably about 0.1-20 mg/kg/day. Thus, as an example, for administration to a 70 kg person, the dosage range would most preferably be about 7 mg to 1.4 g per day.

In general, therapeutic compounds will be administered as pharmaceutical compositions by any one of the following routes: oral, systemic (e.g., transdermal, intranasal, or by suppository), or parenteral (e.g., intramuscular, intravenous, or subcutaneous) administration. The preferred manner of administration is oral or parenteral using a convenient daily dosage regimen, which can be adjusted according to the degree of affliction. Oral compositions can take the form of tablets, pills, capsules, semisolids, powders, sustained release formulations, solutions, suspensions, elixirs, aerosols, or any other appropriate compositions.

The choice of formulation depends on various factors such as the mode of drug administration (e.g., for oral administration, formulations in the form of tablets, pills, or capsules are preferred) and the bioavailability of the drug substance. Recently, pharmaceutical formulations have been developed especially for drugs that show poor bioavailability based upon the principle that bioavailability can be increased by increasing the surface area, i.e., decreasing particle size. For example, U.S. Pat. No. 4,107,288 describes a pharmaceutical formulation having particles in the size range from 10 to 1,000 nm in which the active material is supported on a cross-linked matrix of macromolecules. U.S. Pat. No. 5,145,684 describes the production of a pharmaceutical formulation in which the drug substance is pulverized to nanoparticles (average particle size of 400 nm) in the presence of a surface modifier and then dispersed in a liquid medium to give a pharmaceutical formulation that exhibits remarkably high bioavailability.

Pharmaceutical compositions are comprised of, in general, a therapeutic compound in combination with at least one pharmaceutically acceptable excipient. Acceptable excipients are non-toxic, aid administration, and do not adversely affect the therapeutic benefit of the therapeutic compound. Such excipients may be any solid, liquid, semi-solid or, in the case of an aerosol composition, gaseous excipient that is generally available to one skilled in the art.

Solid pharmaceutical excipients include starch, cellulose, talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, dried skim milk and the like. Liquid and semisolid excipients may be selected from glycerol, propylene glycol, water, ethanol and various oils, including those of petroleum, animal, vegetable or synthetic origin, e.g., peanut oil, soybean oil, mineral oil, sesame oil, etc. Preferred liquid carriers, particularly for injectable solutions, include water, saline, aqueous dextrose, and glycols.

Compressed gases may be used to disperse a compound of this invention in aerosol form. Inert gases suitable for this purpose are nitrogen, carbon dioxide, etc.

Other suitable pharmaceutical excipients and their formulations are described in Remington's Pharmaceutical Sciences, edited by E. W. Martin (Mack Publishing Company, 18th ed., 1990).

The amount of the therapeutic compound in a formulation can vary within the full range employed by those skilled in the art. Typically, the formulation will contain, on a weight percent (wt %) basis, from about 0.01-99.99 wt % of the therapeutic compound based on the total formulation, with the balance being one or more suitable pharmaceutical excipients. Preferably, the compound is present at a level of about 1-80 wt %.

Therapeutic compounds can be administered alone or in combination with other therapeutic compounds or in combination with one or more other active ingredient(s). For example, an inhibitor or stimulator of a stroke-associated protein can be administered in combination with another agent that inhibits or stimulates the activity of the same or a different stroke-associated protein to thereby counteract the affects of stroke.

For further information regarding pharmacology, see Current Protocols in Pharmacology, John Wiley & Sons, Inc., N.Y.

Human Identification Applications

In addition to their diagnostic, risk assessment, preventive, and therapeutic uses in stroke and related pathologies, the SNPs provided by the present invention are also useful as human identification markers for such applications as forensics, paternity testing, and biometrics (see, e.g., Gill, “An assessment of the utility of single nucleotide polymorphisms (SNPs) for forensic purposes”, Int J Legal Med. 2001; 114(4-5):204-10). Genetic variations in the nucleic acid sequences between individuals can be used as genetic markers to identify individuals and to associate a biological sample with an individual. Determination of which nucleotides occupy a set of SNP positions in an individual identifies a set of SNP markers that distinguishes the individual. The more SNP positions that are analyzed, the lower the probability that the set of SNPs in one individual is the same as that in an unrelated individual. Preferably, if multiple sites are analyzed, the sites are unlinked (i.e., inherited independently). Thus, preferred sets of SNPs can be selected from among the SNPs disclosed herein, which may include SNPs on different chromosomes, SNPs on different chromosome arms, and/or SNPs that are dispersed over substantial distances along the same chromosome arm.

Furthermore, among the SNPs disclosed herein, preferred SNPs for use in certain forensic/human identification applications include SNPs located at degenerate codon positions (i.e., the third position in certain codons which can be one of two or more alternative nucleotides and still encode the same amino acid), since these SNPs do not affect the encoded protein. SNPs that do not affect the encoded protein are expected to be under less selective pressure and are therefore expected to be more polymorphic in a population, which is typically an advantage for forensic/human identification applications. However, for certain forensics/human identification applications, such as predicting phenotypic characteristics (e.g., inferring ancestry or inferring one or more physical characteristics of an individual) from a DNA sample, it may be desirable to utilize SNPs that affect the encoded protein.

For many of the SNPs disclosed in Tables 1-2 (which are identified as “Applera” SNP source), Tables 1-2 provide SNP allele frequencies obtained by re-sequencing the DNA of chromosomes from 39 individuals (Tables 1-2 also provide allele frequency information for “Celera” source SNPs and, where available, public SNPs from dbEST, HGBASE, and/or HGMD). The allele frequencies provided in Tables 1-2 enable these SNPs to be readily used for human identification applications. Although any SNP disclosed in Table 1 and/or Table 2 could be used for human identification, the closer that the frequency of the minor allele at a particular SNP site is to 50%, the greater the ability of that SNP to discriminate between different individuals in a population since it becomes increasingly likely that two randomly selected individuals would have different alleles at that SNP site. Using the SNP allele frequencies provided in Tables 1-2, one of ordinary skill in the art could readily select a subset of SNPs for which the frequency of the minor allele is, for example, at least 1%, 2%, 5%, 10%, 20%, 25%, 30%, 40%, 45%, or 50%, or any other frequency in-between. Thus, since Tables 1-2 provide allele frequencies based on the re-sequencing of the chromosomes from 39 individuals, a subset of SNPs could readily be selected for human identification in which the total allele count of the minor allele at a particular SNP site is, for example, at least 1, 2, 4, 8, 10, 16, 20, 24, 30, 32, 36, 38, 39, 40, or any other number in-between.

Furthermore, Tables 1-2 also provide population group (interchangeably referred to herein as ethnic or racial groups) information coupled with the extensive allele frequency information. For example, the group of 39 individuals whose DNA was re-sequenced was made-up of 20 Caucasians and 19 African-Americans. This population group information enables further refinement of SNP selection for human identification. For example, preferred SNPs for human identification can be selected from Tables 1-2 that have similar allele frequencies in both the Caucasian and African-American populations; thus, for example, SNPs can be selected that have equally high discriminatory power in both populations. Alternatively, SNPs can be selected for which there is a statistically significant difference in allele frequencies between the Caucasian and African-American populations (as an extreme example, a particular allele may be observed only in either the Caucasian or the African-American population group but not observed in the other population group); such SNPs are useful, for example, for predicting the race/ethnicity of an unknown perpetrator from a biological sample such as a hair or blood stain recovered at a crime scene. For a discussion of using SNPs to predict ancestry from a DNA sample, including statistical methods, see Frudakis et al., “A Classifier for the SNP-Based Inference of Ancestry”, Journal of Forensic Sciences 2003; 48(4):771-782.

SNPs have numerous advantages over other types of polymorphic markers, such as short tandem repeats (STRs). For example, SNPs can be easily scored and are amenable to automation, making SNPs the markers of choice for large-scale forensic databases. SNPs are found in much greater abundance throughout the genome than repeat polymorphisms. Population frequencies of two polymorphic forms can usually be determined with greater accuracy than those of multiple polymorphic forms at multi-allelic loci. SNPs are mutationaly more stable than repeat polymorphisms. SNPs are not susceptible to artefacts such as stutter bands that can hinder analysis. Stutter bands are frequently encountered when analyzing repeat polymorphisms, and are particularly troublesome when analyzing samples such as crime scene samples that may contain mixtures of DNA from multiple sources. Another significant advantage of SNP markers over STR markers is the much shorter length of nucleic acid needed to score a SNP. For example, STR markers are generally several hundred base pairs in length. A SNP, on the other hand, comprises a single nucleotide, and generally a short conserved region on either side of the SNP position for primer and/or probe binding. This makes SNPs more amenable to typing in highly degraded or aged biological samples that are frequently encountered in forensic casework in which DNA may be fragmented into short pieces.

SNPs also are not subject to microvariant and “off-ladder” alleles frequently encountered when analyzing STR loci. Microvariants are deletions or insertions within a repeat unit that change the size of the amplified DNA product so that the amplified product does not migrate at the same rate as reference alleles with normal sized repeat units. When separated by size, such as by electrophoresis on a polyacrylamide gel, microvariants do not align with a reference allelic ladder of standard sized repeat units, but rather migrate between the reference alleles. The reference allelic ladder is used for precise sizing of alleles for allele classification; therefore alleles that do not align with the reference allelic ladder lead to substantial analysis problems. Furthermore, when analyzing multi-allelic repeat polymorphisms, occasionally an allele is found that consists of more or less repeat units than has been previously seen in the population, or more or less repeat alleles than are included in a reference allelic ladder. These alleles will migrate outside the size range of known alleles in a reference allelic ladder, and therefore are referred to as “off-ladder” alleles. In extreme cases, the allele may contain so few or so many repeats that it migrates well out of the range of the reference allelic ladder. In this situation, the allele may not even be observed, or, with multiplex analysis, it may migrate within or close to the size range for another locus, further confounding analysis.

SNP analysis avoids the problems of microvariants and off-ladder alleles encountered in STR analysis. Importantly, microvariants and off-ladder alleles may provide significant problems, and may be completely missed, when using analysis methods such as oligonucleotide hybridization arrays, which utilize oligonucleotide probes specific for certain known alleles. Furthermore, off-ladder alleles and microvariants encountered with STR analysis, even when correctly typed, may lead to improper statistical analysis, since their frequencies in the population are generally unknown or poorly characterized, and therefore the statistical significance of a matching genotype may be questionable. All these advantages of SNP analysis are considerable in light of the consequences of most DNA identification cases, which may lead to life imprisonment for an individual, or re-association of remains to the family of a deceased individual.

DNA can be isolated from biological samples such as blood, bone, hair, saliva, or semen, and compared with the DNA from a reference source at particular SNP positions. Multiple SNP markers can be assayed simultaneously in order to increase the power of discrimination and the statistical significance of a matching genotype. For example, oligonucleotide arrays can be used to genotype a large number of SNPs simultaneously. The SNPs provided by the present invention can be assayed in combination with other polymorphic genetic markers, such as other SNPs known in the art or STRs, in order to identify an individual or to associate an individual with a particular biological sample.

Furthermore, the SNPs provided by the present invention can be genotyped for inclusion in a database of DNA genotypes, for example, a criminal DNA databank such as the FBI's Combined DNA Index System (CODIS) database. A genotype obtained from a biological sample of unknown source can then be queried against the database to find a matching genotype, with the SNPs of the present invention providing nucleotide positions at which to compare the known and unknown DNA sequences for identity. Accordingly, the present invention provides a database comprising novel SNPs or SNP alleles of the present invention (e.g., the database can comprise information indicating which alleles are possessed by individual members of a population at one or more novel SNP sites of the present invention), such as for use in forensics, biometrics, or other human identification applications. Such a database typically comprises a computer-based system in which the SNPs or SNP alleles of the present invention are recorded on a computer readable medium (see the section of the present specification entitled “Computer-Related Embodiments”).

The SNPs of the present invention can also be assayed for use in paternity testing. The object of paternity testing is usually to determine whether a male is the father of a child. In most cases, the mother of the child is known and thus, the mother's contribution to the child's genotype can be traced. Paternity testing investigates whether the part of the child's genotype not attributable to the mother is consistent with that of the putative father. Paternity testing can be performed by analyzing sets of polymorphisms in the putative father and the child, with the SNPs of the present invention providing nucleotide positions at which to compare the putative father's and child's DNA sequences for identity. If the set of polymorphisms in the child attributable to the father does not match the set of polymorphisms of the putative father, it can be concluded, barring experimental error, that the putative father is not the father of the child. If the set of polymorphisms in the child attributable to the father match the set of polymorphisms of the putative father, a statistical calculation can be performed to determine the probability of coincidental match, and a conclusion drawn as to the likelihood that the putative father is the true biological father of the child.

In addition to paternity testing, SNPs are also useful for other types of kinship testing, such as for verifying familial relationships for immigration purposes, or for cases in which an individual alleges to be related to a deceased individual in order to claim an inheritance from the deceased individual, etc. For further information regarding the utility of SNPs for paternity testing and other types of kinship testing, including methods for statistical analysis, see Krawczak, “Informativity assessment for biallelic single nucleotide polymorphisms”, Electrophoresis 1999 June; 20(8):1676-81.

The use of the SNPs of the present invention for human identification further extends to various authentication systems, commonly referred to as biometric systems, which typically convert physical characteristics of humans (or other organisms) into digital data. Biometric systems include various technological devices that measure such unique anatomical or physiological characteristics as finger, thumb, or palm prints; hand geometry; vein patterning on the back of the hand; blood vessel patterning of the retina and color and texture of the iris; facial characteristics; voice patterns; signature and typing dynamics; and DNA. Such physiological measurements can be used to verify identity and, for example, restrict or allow access based on the identification. Examples of applications for biometrics include physical area security, computer and network security, aircraft passenger check-in and boarding, financial transactions, medical records access, government benefit distribution, voting, law enforcement, passports, visas and immigration, prisons, various military applications, and for restricting access to expensive or dangerous items, such as automobiles or guns (see, for example, O'Connor, Stanford Technology Law Review and U.S. Pat. No. 6,119,096).

Groups of SNPs, particularly the SNPs provided by the present invention, can be typed to uniquely identify an individual for biometric applications such as those described above. Such SNP typing can readily be accomplished using, for example, DNA chips/arrays. Preferably, a minimally invasive means for obtaining a DNA sample is utilized. For example, PCR amplification enables sufficient quantities of DNA for analysis to be obtained from buccal swabs or fingerprints, which contain DNA-containing skin cells and oils that are naturally transferred during contact. Further information regarding techniques for using SNPs in forensic/human identification applications can be found in, for example, Current Protocols in Human Genetics, John Wiley & Sons, N.Y. (2002), 14.1-14.7.

Variant Proteins, Antibodies, Vectors & Host Cells, & Uses Thereof

Variant Proteins Encoded by SNP-Containing Nucleic Acid Molecules

The present invention provides SNP-containing nucleic acid molecules, many of which encode proteins having variant amino acid sequences as compared to the art-known (i.e., wild-type) proteins. Amino acid sequences encoded by the polymorphic nucleic acid molecules of the present invention are provided as SEQ ID NOS:81-160 in Table 1 and the Sequence Listing. These variants will generally be referred to herein as variant proteins/peptides/polypeptides, or polymorphic proteins/peptides/polypeptides of the present invention. The terms “protein”, “peptide”, and “polypeptide” are used herein interchangeably.

A variant protein of the present invention may be encoded by, for example, a nonsynonymous nucleotide substitution at any one of the cSNP positions disclosed herein. In addition, variant proteins may also include proteins whose expression, structure, and/or function is altered by a SNP disclosed herein, such as a SNP that creates or destroys a stop codon, a SNP that affects splicing, and a SNP in control/regulatory elements, e.g. promoters, enhancers, or transcription factor binding domains.

As used herein, a protein or peptide is said to be “isolated” or “purified” when it is substantially free of cellular material or chemical precursors or other chemicals. The variant proteins of the present invention can be purified to homogeneity or other lower degrees of purity. The level of purification will be based on the intended use. The key feature is that the preparation allows for the desired function of the variant protein, even if in the presence of considerable amounts of other components.

As used herein, “substantially free of cellular material” includes preparations of the variant protein having less than about 30% (by dry weight) other proteins (i.e., contaminating protein), less than about 20% other proteins, less than about 10% other proteins, or less than about 5% other proteins. When the variant protein is recombinantly produced, it can also be substantially free of culture medium, i.e., culture medium represents less than about 20% of the volume of the protein preparation.

The language “substantially free of chemical precursors or other chemicals” includes preparations of the variant protein in which it is separated from chemical precursors or other chemicals that are involved in its synthesis. In one embodiment, the language “substantially free of chemical precursors or other chemicals” includes preparations of the variant protein having less than about 30% (by dry weight) chemical precursors or other chemicals, less than about 20% chemical precursors or other chemicals, less than about 10% chemical precursors or other chemicals, or less than about 5% chemical precursors or other chemicals.

An isolated variant protein may be purified from cells that naturally express it, purified from cells that have been altered to express it (recombinant host cells), or synthesized using known protein synthesis methods. For example, a nucleic acid molecule containing SNP(s) encoding the variant protein can be cloned into an expression vector, the expression vector introduced into a host cell, and the variant protein expressed in the host cell. The variant protein can then be isolated from the cells by any appropriate purification scheme using standard protein purification techniques. Examples of these techniques are described in detail below (Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).

The present invention provides isolated variant proteins that comprise, consist of or consist essentially of amino acid sequences that contain one or more variant amino acids encoded by one or more codons which contain a SNP of the present invention.

Accordingly, the present invention provides variant proteins that consist of amino acid sequences that contain one or more amino acid polymorphisms (or truncations or extensions due to creation or destruction of a stop codon, respectively) encoded by the SNPs provided in Table 1 and/or Table 2. A protein consists of an amino acid sequence when the amino acid sequence is the entire amino acid sequence of the protein.

The present invention further provides variant proteins that consist essentially of amino acid sequences that contain one or more amino acid polymorphisms (or truncations or extensions due to creation or destruction of a stop codon, respectively) encoded by the SNPs provided in Table 1 and/or Table 2. A protein consists essentially of an amino acid sequence when such an amino acid sequence is present with only a few additional amino acid residues in the final protein.

The present invention further provides variant proteins that comprise amino acid sequences that contain one or more amino acid polymorphisms (or truncations or extensions due to creation or destruction of a stop codon, respectively) encoded by the SNPs provided in Table 1 and/or Table 2. A protein comprises an amino acid sequence when the amino acid sequence is at least part of the final amino acid sequence of the protein. In such a fashion, the protein may contain only the variant amino acid sequence or have additional amino acid residues, such as a contiguous encoded sequence that is naturally associated with it or heterologous amino acid residues. Such a protein can have a few additional amino acid residues or can comprise many more additional amino acids. A brief description of how various types of these proteins can be made and isolated is provided below.

The variant proteins of the present invention can be attached to heterologous sequences to form chimeric or fusion proteins. Such chimeric and fusion proteins comprise a variant protein operatively linked to a heterologous protein having an amino acid sequence not substantially homologous to the variant protein. “Operatively linked” indicates that the coding sequences for the variant protein and the heterologous protein are ligated in-frame. The heterologous protein can be fused to the N-terminus or C-terminus of the variant protein. In another embodiment, the fusion protein is encoded by a fusion polynucleotide that is synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and re-amplified to generate a chimeric gene sequence (see Ausubel et al., Current Protocols in Molecular Biology, 1992). Moreover, many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST protein). A variant protein-encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the variant protein.

In many uses, the fusion protein does not affect the activity of the variant protein. The fusion protein can include, but is not limited to, enzymatic fusion proteins, for example, beta-galactosidase fusions, yeast two-hybrid GAL fusions, poly-His fusions, MYC-tagged, HI-tagged and Ig fusions. Such fusion proteins, particularly poly-His fusions, can facilitate their purification following recombinant expression. In certain host cells (e g, mammalian host cells), expression and/or secretion of a protein can be increased by using a heterologous signal sequence. Fusion proteins are further described in, for example, Terpe, “Overview of tag protein fusions: from molecular and biochemical fundamentals to commercial systems”, Appl Microbiol Biotechnol. 2003 January; 60(5):523-33. Epub 2002 Nov. 7; Graddis et al., “Designing proteins that work using recombinant technologies”, Curr Pharm Biotechnol. 2002 December; 3(4):285-97; and Nilsson et al., “Affinity fusion strategies for detection, purification, and immobilization of recombinant proteins”, Protein Expr Purif. 1997 October; 11(1):1-16.

The present invention also relates to further obvious variants of the variant polypeptides of the present invention, such as naturally-occurring mature forms (e.g., alleleic variants), non-naturally occurring recombinantly-derived variants, and orthologs and paralogs of such proteins that share sequence homology. Such variants can readily be generated using art-known techniques in the fields of recombinant nucleic acid technology and protein biochemistry. It is understood, however, that variants exclude those known in the prior art before the present invention.

Further variants of the variant polypeptides disclosed in Table 1 can comprise an amino acid sequence that shares at least 70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with an amino acid sequence disclosed in Table 1 (or a fragment thereof) and that includes a novel amino acid residue (allele) disclosed in Table 1 (which is encoded by a novel SNP allele). Thus, an aspect of the present invention that is specifically contemplated are polypeptides that have a certain degree of sequence variation compared with the polypeptide sequences shown in Table 1, but that contain a novel amino acid residue (allele) encoded by a novel SNP allele disclosed herein. In other words, as long as a polypeptide contains a novel amino acid residue disclosed herein, other portions of the polypeptide that flank the novel amino acid residue can vary to some degree from the polypeptide sequences shown in Table 1.

Full-length pre-processed forms, as well as mature processed forms, of proteins that comprise one of the amino acid sequences disclosed herein can readily be identified as having complete sequence identity to one of the variant proteins of the present invention as well as being encoded by the same genetic locus as the variant proteins provided herein.

Orthologs of a variant peptide can readily be identified as having some degree of significant sequence homology/identity to at least a portion of a variant peptide as well as being encoded by a gene from another organism. Preferred orthologs will be isolated from non-human mammals, preferably primates, for the development of human therapeutic targets and agents. Such orthologs can be encoded by a nucleic acid sequence that hybridizes to a variant peptide-encoding nucleic acid molecule under moderate to stringent conditions depending on the degree of relatedness of the two organisms yielding the homologous proteins.

Variant proteins include, but are not limited to, proteins containing deletions, additions and substitutions in the amino acid sequence caused by the SNPs of the present invention. One class of substitutions is conserved amino acid substitutions in which a given amino acid in a polypeptide is substituted for another amino acid of like characteristics. Typical conservative substitutions are replacements, one for another, among the aliphatic amino acids Ala, Val, Leu, and Be; interchange of the hydroxyl residues Ser and Thr; exchange of the acidic residues Asp and Glu; substitution between the amide residues Asn and Gln; exchange of the basic residues Lys and Arg; and replacements among the aromatic residues Phe and Tyr. Guidance concerning which amino acid changes are likely to be phenotypically silent are found in, for example, Bowie et al., Science 247:1306-1310 (1990).

Variant proteins can be fully functional or can lack function in one or more activities, e.g. ability to bind another molecule, ability to catalyze a substrate, ability to mediate signaling, etc. Fully functional variants typically contain only conservative variations or variations in non-critical residues or in non-critical regions. Functional variants can also contain substitution of similar amino acids that result in no change or an insignificant change in function. Alternatively, such substitutions may positively or negatively affect function to some degree. Non-functional variants typically contain one or more non-conservative amino acid substitutions, deletions, insertions, inversions, truncations or extensions, or a substitution, insertion, inversion, or deletion of a critical residue or in a critical region.

Amino acids that are essential for function of a protein can be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham et al., Science 244:1081-1085 (1989)), particularly using the amino acid sequence and polymorphism information provided in Table 1. The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as enzyme activity or in assays such as an in vitro proliferative activity. Sites that are critical for binding partner/substrate binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al., J. Mol. Biol. 224:899-904 (1992); de Vos et al. Science 255:306-312 (1992)).

Polypeptides can contain amino acids other than the 20 amino acids commonly referred to as the 20 naturally occurring amino acids. Further, many amino acids, including the terminal amino acids, may be modified by natural processes, such as processing and other post-translational modifications, or by chemical modification techniques well known in the art. Accordingly, the variant proteins of the present invention also encompass derivatives or analogs in which a substituted amino acid residue is not one encoded by the genetic code, in which a substituent group is included, in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (e.g., polyethylene glycol), or in which additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence for purification of the mature polypeptide or a pro-protein sequence.

Known protein modifications include, but are not limited to, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent crosslinks, formation of cystine, formation of pyroglutamate, formylation, gamma carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination.

Such protein modifications are well known to those of skill in the art and have been described in great detail in the scientific literature. Several particularly common modifications, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation, for instance, are described in most basic texts, such as Proteins—Structure and Molecular Properties, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York (1993); Wold, F., Posttranslational Covalent Modification of Proteins, B. C. Johnson, Ed., Academic Press, New York 1-12 (1983); Seifter et al., Meth. Enzymol. 182: 626-646 (1990); and Rattan et al., Ann. N.Y. Acad. Sci. 663:48-62 (1992).

The present invention further provides fragments of the variant proteins in which the fragments contain one or more amino acid sequence variations (e.g., substitutions, or truncations or extensions due to creation or destruction of a stop codon) encoded by one or more SNPs disclosed herein. The fragments to which the invention pertains, however, are not to be construed as encompassing fragments that have been disclosed in the prior art before the present invention.

As used herein, a fragment may comprise at least about 4, 8, 10, 12, 14, 16, 18, 20, 25, 30, 50, 100 (or any other number in-between) or more contiguous amino acid residues from a variant protein, wherein at least one amino acid residue is affected by a SNP of the present invention, e.g., a variant amino acid residue encoded by a nonsynonymous nucleotide substitution at a cSNP position provided by the present invention. The variant amino acid encoded by a cSNP may occupy any residue position along the sequence of the fragment. Such fragments can be chosen based on the ability to retain one or more of the biological activities of the variant protein or the ability to perform a function, e.g., act as an immunogen. Particularly important fragments are biologically active fragments. Such fragments will typically comprise a domain or motif of a variant protein of the present invention, e.g., active site, transmembrane domain, or ligand/substrate binding domain. Other fragments include, but are not limited to, domain or motif-containing fragments, soluble peptide fragments, and fragments containing immunogenic structures. Predicted domains and functional sites are readily identifiable by computer programs well known to those of skill in the art (e.g., PROSITE analysis) (Current Protocols in Protein Science, John Wiley & Sons, N.Y. (2002)).

Uses of Variant Proteins

The variant proteins of the present invention can be used in a variety of ways, including but not limited to, in assays to determine the biological activity of a variant protein, such as in a panel of multiple proteins for high-throughput screening; to raise antibodies or to elicit another type of immune response; as a reagent (including the labeled reagent) in assays designed to quantitatively determine levels of the variant protein (or its binding partner) in biological fluids; as a marker for cells or tissues in which it is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in a disease state); as a target for screening for a therapeutic agent; and as a direct therapeutic agent to be administered into a human subject. Any of the variant proteins disclosed herein may be developed into reagent grade or kit format for commercialization as research products. Methods for performing the uses listed above are well known to those skilled in the art (see, e.g., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Sambrook and Russell, 2000, and Methods in Enzymology: Guide to Molecular Cloning Techniques, Academic Press, Berger, S. L. and A. R. Kimmel eds., 1987).

In a specific embodiment of the invention, the methods of the present invention include detection of one or more variant proteins disclosed herein. Variant proteins are disclosed in Table 1 and in the Sequence Listing as SEQ ID NOS:81-160. Detection of such proteins can be accomplished using, for example, antibodies, small molecule compounds, aptamers, ligands/substrates, other proteins or protein fragments, or other protein-binding agents. Preferably, protein detection agents are specific for a variant protein of the present invention and can therefore discriminate between a variant protein of the present invention and the wild-type protein or another variant form. This can generally be accomplished by, for example, selecting or designing detection agents that bind to the region of a protein that differs between the variant and wild-type protein, such as a region of a protein that contains one or more amino acid substitutions that is/are encoded by a non-synonymous cSNP of the present invention, or a region of a protein that follows a nonsense mutation-type SNP that creates a stop codon thereby leading to a shorter polypeptide, or a region of a protein that follows a read-through mutation-type SNP that destroys a stop codon thereby leading to a longer polypeptide in which a portion of the polypeptide is present in one version of the polypeptide but not the other.

In another specific aspect of the invention, the variant proteins of the present invention are used as targets for diagnosing stroke or for determining predisposition to stroke in a human (e.g., determining whether an individual has an increased or decreased risk of having a stroke). Accordingly, the invention provides methods for detecting the presence of, or levels of, one or more variant proteins of the present invention in a cell, tissue, or organism. Such methods typically involve contacting a test sample with an agent (e.g., an antibody, small molecule compound, or peptide) capable of interacting with the variant protein such that specific binding of the agent to the variant protein can be detected. Such an assay can be provided in a single detection format or a multi-detection format such as an array, for example, an antibody or aptamer array (arrays for protein detection may also be referred to as “protein chips”). The variant protein of interest can be isolated from a test sample and assayed for the presence of a variant amino acid sequence encoded by one or more SNPs disclosed by the present invention. The SNPs may cause changes to the protein and the corresponding protein function/activity, such as through non-synonymous substitutions in protein coding regions that can lead to amino acid substitutions, deletions, insertions, and/or rearrangements; formation or destruction of stop codons; or alteration of control elements such as promoters. SNPs may also cause inappropriate post-translational modifications.

One preferred agent for detecting a variant protein in a sample is an antibody capable of selectively binding to a variant form of the protein (antibodies are described in greater detail in the next section). Such samples include, for example, tissues, cells, and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject.

In vitro methods for detection of the variant proteins associated with stroke that are disclosed herein and fragments thereof include, but are not limited to, enzyme linked immunosorbent assays (ELISAs), radioimmunoassays (RIA), Western blots, immunoprecipitations, immunofluorescence, and protein arrays/chips (e.g., arrays of antibodies or aptamers). For further information regarding immunoassays and related protein detection methods, see Current Protocols in Immunology, John Wiley & Sons, N.Y., and Hage, “Immunoassays”, Anal Chem. 1999 Jun. 15; 71(12):294R-304R.

Additional analytic methods of detecting amino acid variants include, but are not limited to, altered electrophoretic mobility, altered tryptic peptide digest, altered protein activity in cell-based or cell-free assay, alteration in ligand or antibody-binding pattern, altered isoelectric point, and direct amino acid sequencing.

Alternatively, variant proteins can be detected in vivo in a subject by introducing into the subject a labeled antibody (or other type of detection reagent) specific for a variant protein. For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.

Other uses of the variant peptides of the present invention are based on the class or action of the protein. For example, proteins isolated from humans and their mammalian orthologs serve as targets for identifying agents (e.g., small molecule drugs or antibodies) for use in therapeutic applications, particularly for modulating a biological or pathological response in a cell or tissue that expresses the protein. Pharmaceutical agents can be developed that modulate protein activity.

As an alternative to modulating gene expression, therapeutic compounds can be developed that modulate protein function. For example, many SNPs disclosed herein affect the amino acid sequence of the encoded protein (e.g., non-synonymous cSNPs and nonsense mutation-type SNPs). Such alterations in the encoded amino acid sequence may affect protein function, particularly if such amino acid sequence variations occur in functional protein domains, such as catalytic domains, ATP-binding domains, or ligand/substrate binding domains. It is well established in the art that variant proteins having amino acid sequence variations in functional domains can cause or influence pathological conditions. In such instances, compounds (e.g., small molecule drugs or antibodies) can be developed that target the variant protein and modulate (e.g., up- or down-regulate) protein function/activity.

The therapeutic methods of the present invention further include methods that target one or more variant proteins of the present invention. Variant proteins can be targeted using, for example, small molecule compounds, antibodies, aptamers, ligands/substrates, other proteins, or other protein-binding agents. Additionally, the skilled artisan will recognize that the novel protein variants (and polymorphic nucleic acid molecules) disclosed in Table 1 may themselves be directly used as therapeutic agents by acting as competitive inhibitors of corresponding art-known proteins (or nucleic acid molecules such as mRNA molecules).

The variant proteins of the present invention are particularly useful in drug screening assays, in cell-based or cell-free systems. Cell-based systems can utilize cells that naturally express the protein, a biopsy specimen, or cell cultures. In one embodiment, cell-based assays involve recombinant host cells expressing the variant protein. Cell-free assays can be used to detect the ability of a compound to directly bind to a variant protein or to the corresponding SNP-containing nucleic acid fragment that encodes the variant protein.

A variant protein of the present invention, as well as appropriate fragments thereof, can be used in high-throughput screening assays to test candidate compounds for the ability to bind and/or modulate the activity of the variant protein. These candidate compounds can be further screened against a protein having normal function (e.g., a wild-type/non-variant protein) to further determine the effect of the compound on the protein activity. Furthermore, these compounds can be tested in animal or invertebrate systems to determine in vivo activity/effectiveness. Compounds can be identified that activate (agonists) or inactivate (antagonists) the variant protein, and different compounds can be identified that cause various degrees of activation or inactivation of the variant protein.

Further, the variant proteins can be used to screen a compound for the ability to stimulate or inhibit interaction between the variant protein and a target molecule that normally interacts with the protein. The target can be a ligand, a substrate or a binding partner that the protein normally interacts with (for example, epinephrine or norepinephrine). Such assays typically include the steps of combining the variant protein with a candidate compound under conditions that allow the variant protein, or fragment thereof, to interact with the target molecule, and to detect the formation of a complex between the protein and the target or to detect the biochemical consequence of the interaction with the variant protein and the target, such as any of the associated effects of signal transduction.

Candidate compounds include, for example, 1) peptides such as soluble peptides, including Ig-tailed fusion peptides and members of random peptide libraries (see, e.g., Lam et al., Nature 354:82-84 (1991); Houghten et al., Nature 354:84-86 (1991)) and combinatorial chemistry-derived molecular libraries made of D- and/or L-configuration amino acids; 2) phosphopeptides (e.g., members of random and partially degenerate, directed phosphopeptide libraries, see, e.g., Songyang et al., Cell 72:767-778 (1993)); 3) antibodies (e.g., polyclonal, monoclonal, humanized, anti-idiotypic, chimeric, and single chain antibodies as well as Fab, F(ab′)2, Fab expression library fragments, and epitope-binding fragments of antibodies); and 4) small organic and inorganic molecules (e.g., molecules obtained from combinatorial and natural product libraries).

One candidate compound is a soluble fragment of the variant protein that competes for ligand binding. Other candidate compounds include mutant proteins or appropriate fragments containing mutations that affect variant protein function and thus compete for ligand. Accordingly, a fragment that competes for ligand, for example with a higher affinity, or a fragment that binds ligand but does not allow release, is encompassed by the invention.

The invention further includes other end point assays to identify compounds that modulate (stimulate or inhibit) variant protein activity. The assays typically involve an assay of events in the signal transduction pathway that indicate protein activity. Thus, the expression of genes that are up or down-regulated in response to the variant protein dependent signal cascade can be assayed. In one embodiment, the regulatory region of such genes can be operably linked to a marker that is easily detectable, such as luciferase. Alternatively, phosphorylation of the variant protein, or a variant protein target, could also be measured. Any of the biological or biochemical functions mediated by the variant protein can be used as an endpoint assay. These include all of the biochemical or biological events described herein, in the references cited herein, incorporated by reference for these endpoint assay targets, and other functions known to those of ordinary skill in the art.

Binding and/or activating compounds can also be screened by using chimeric variant proteins in which an amino terminal extracellular domain or parts thereof, an entire transmembrane domain or subregions, and/or the carboxyl terminal intracellular domain or parts thereof, can be replaced by heterologous domains or subregions. For example, a substrate-binding region can be used that interacts with a different substrate than that which is normally recognized by a variant protein. Accordingly, a different set of signal transduction components is available as an end-point assay for activation. This allows for assays to be performed in other than the specific host cell from which the variant protein is derived.

The variant proteins are also useful in competition binding assays in methods designed to discover compounds that interact with the variant protein. Thus, a compound can be exposed to a variant protein under conditions that allow the compound to bind or to otherwise interact with the variant protein. A binding partner, such as ligand, that normally interacts with the variant protein is also added to the mixture. If the test compound interacts with the variant protein or its binding partner, it decreases the amount of complex formed or activity from the variant protein. This type of assay is particularly useful in screening for compounds that interact with specific regions of the variant protein (Hodgson, Bio/technology, 1992, Sep. 10(9), 973-80).

To perform cell-free drug screening assays, it is sometimes desirable to immobilize either the variant protein or a fragment thereof, or its target molecule, to facilitate separation of complexes from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay. Any method for immobilizing proteins on matrices can be used in drug screening assays. In one embodiment, a fusion protein containing an added domain allows the protein to be bound to a matrix. For example, glutathione-S-transferase/125I fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtitre plates, which are then combined with the cell lysates (e.g., 35S-labeled) and a candidate compound, such as a drug candidate, and the mixture incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads can be washed to remove any unbound label, and the matrix immobilized and radiolabel determined directly, or in the supernatant after the complexes are dissociated. Alternatively, the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the level of bound material found in the bead fraction quantitated from the gel using standard electrophoretic techniques.

Either the variant protein or its target molecule can be immobilized utilizing conjugation of biotin and streptavidin. Alternatively, antibodies reactive with the variant protein but which do not interfere with binding of the variant protein to its target molecule can be derivatized to the wells of the plate, and the variant protein trapped in the wells by antibody conjugation. Preparations of the target molecule and a candidate compound are incubated in the variant protein-presenting wells and the amount of complex trapped in the well can be quantitated. Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies reactive with the protein target molecule, or which are reactive with variant protein and compete with the target molecule, and enzyme-linked assays that rely on detecting an enzymatic activity associated with the target molecule.

Modulators of variant protein activity identified according to these drug screening assays can be used to treat a subject with a disorder mediated by the protein pathway, such as stroke. These methods of treatment typically include the steps of administering the modulators of protein activity in a pharmaceutical composition to a subject in need of such treatment.

The variant proteins, or fragments thereof, disclosed herein can themselves be directly used to treat a disorder characterized by an absence of, inappropriate, or unwanted expression or activity of the variant protein. Accordingly, methods for treatment include the use of a variant protein disclosed herein or fragments thereof.

In yet another aspect of the invention, variant proteins can be used as “bait proteins” in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Pat. No. 5,283,317; Zervos et al. (1993) Cell 72:223-232; Madura et al. (1993) J. Biol. Chem. 268:12046-12054; Bartel et al. (1993) Biotechniques 14:920-924; Iwabuchi et al. (1993) Oncogene 8:1693-1696; and Brent WO94/10300) to identify other proteins that bind to or interact with the variant protein and are involved in variant protein activity. Such variant protein-binding proteins are also likely to be involved in the propagation of signals by the variant proteins or variant protein targets as, for example, elements of a protein-mediated signaling pathway. Alternatively, such variant protein-binding proteins are inhibitors of the variant protein.

The two-hybrid system is based on the modular nature of most transcription factors, which typically consist of separable DNA-binding and activation domains. Briefly, the assay typically utilizes two different DNA constructs. In one construct, the gene that codes for a variant protein is fused to a gene encoding the DNA binding domain of a known transcription factor (e.g., GAL-4). In the other construct, a DNA sequence, from a library of DNA sequences, that encodes an unidentified protein (“prey” or “sample”) is fused to a gene that codes for the activation domain of the known transcription factor. If the “bait” and the “prey” proteins are able to interact, in vivo, forming a variant protein-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ) that is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the cloned gene that encodes the protein that interacts with the variant protein.

Antibodies Directed to Variant Proteins

The present invention also provides antibodies that selectively bind to the variant proteins disclosed herein and fragments thereof. Such antibodies may be used to quantitatively or qualitatively detect the variant proteins of the present invention. As used herein, an antibody selectively binds a target variant protein when it binds the variant protein and does not significantly bind to non-variant proteins, i.e., the antibody does not significantly bind to normal, wild-type, or art-known proteins that do not contain a variant amino acid sequence due to one or more SNPs of the present invention (variant amino acid sequences may be due to, for example, nonsynonymous cSNPs, nonsense SNPs that create a stop codon, thereby causing a truncation of a polypeptide or SNPs that cause read-through mutations resulting in an extension of a polypeptide).

As used herein, an antibody is defined in terms consistent with that recognized in the art: they are multi-subunit proteins produced by an organism in response to an antigen challenge. The antibodies of the present invention include both monoclonal antibodies and polyclonal antibodies, as well as antigen-reactive proteolytic fragments of such antibodies, such as Fab, F(ab)′2, and Fv fragments. In addition, an antibody of the present invention further includes any of a variety of engineered antigen-binding molecules such as a chimeric antibody (U.S. Pat. Nos. 4,816,567 and 4,816,397; Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851, 1984; Neuberger et al., Nature 312:604, 1984), a humanized antibody (U.S. Pat. Nos. 5,693,762; 5,585,089; and 5,565,332), a single-chain Fv (U.S. Pat. No. 4,946,778; Ward et al., Nature 334:544, 1989), a bispecific antibody with two binding specificities (Segal et al., J. Immunol. Methods 248:1, 2001; Carter, J. Immunol. Methods 248:7, 2001), a diabody, a triabody, and a tetrabody (Todorovska et al., J. Immunol. Methods, 248:47, 2001), as well as a Fab conjugate (dimer or trimer), and a minibody.

Many methods are known in the art for generating and/or identifying antibodies to a given target antigen (Harlow, Antibodies, Cold Spring Harbor Press, (1989)). In general, an isolated peptide (e.g., a variant protein of the present invention) is used as an immunogen and is administered to a mammalian organism, such as a rat, rabbit, hamster or mouse. Either a full-length protein, an antigenic peptide fragment (e.g., a peptide fragment containing a region that varies between a variant protein and a corresponding wild-type protein), or a fusion protein can be used. A protein used as an immunogen may be naturally-occurring, synthetic or recombinantly produced, and may be administered in combination with an adjuvant, including but not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substance such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and the like.

Monoclonal antibodies can be produced by hybridoma technology (Kohler and Milstein, Nature, 256:495, 1975), which immortalizes cells secreting a specific monoclonal antibody. The immortalized cell lines can be created in vitro by fusing two different cell types, typically lymphocytes, and tumor cells. The hybridoma cells may be cultivated in vitro or in vivo. Additionally, fully human antibodies can be generated by transgenic animals (He et al., J. Immunol., 169:595, 2002). Fd phage and Fd phagemid technologies may be used to generate and select recombinant antibodies in vitro (Hoogenboom and Chames, Immunol. Today 21:371, 2000; Liu et al., J. Mol. Biol. 315:1063, 2002). The complementarity-determining regions of an antibody can be identified, and synthetic peptides corresponding to such regions may be used to mediate antigen binding (U.S. Pat. No. 5,637,677).

Antibodies are preferably prepared against regions or discrete fragments of a variant protein containing a variant amino acid sequence as compared to the corresponding wild-type protein (e.g., a region of a variant protein that includes an amino acid encoded by a nonsynonymous cSNP, a region affected by truncation caused by a nonsense SNP that creates a stop codon, or a region resulting from the destruction of a stop codon due to read-through mutation caused by a SNP). Furthermore, preferred regions will include those involved in function/activity and/or protein/binding partner interaction. Such fragments can be selected on a physical property, such as fragments corresponding to regions that are located on the surface of the protein, e.g., hydrophilic regions, or can be selected based on sequence uniqueness, or based on the position of the variant amino acid residue(s) encoded by the SNPs provided by the present invention. An antigenic fragment will typically comprise at least about 8-10 contiguous amino acid residues in which at least one of the amino acid residues is an amino acid affected by a SNP disclosed herein. The antigenic peptide can comprise, however, at least 12, 14, 16, 20, 25, 50, 100 (or any other number in-between) or more amino acid residues, provided that at least one amino acid is affected by a SNP disclosed herein.

Detection of an antibody of the present invention can be facilitated by coupling (i.e., physically linking) the antibody or an antigen-reactive fragment thereof to a detectable substance. Detectable substances include, but are not limited to, various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 125I, 131I, 35S or 3H.

Antibodies, particularly the use of antibodies as therapeutic agents, are reviewed in: Morgan, “Antibody therapy for Alzheimer's disease”, Expert Rev Vaccines. 2003 February; 2(1):53-9; Ross et al., “Anticancer antibodies”, Am J Clin Pathol. 2003 April; 119(4):472-85; Goldenberg, “Advancing role of radiolabeled antibodies in the therapy of cancer”, Cancer Immunol Immunother. 2003 May; 52(5):281-96. Epub 2003 Mar. 11; Ross et al., “Antibody-based therapeutics in oncology”, Expert Rev Anticancer Ther. 2003 February; 3(1):107-21; Cao et al., “Bispecific antibody conjugates in therapeutics”, Adv Drug Deliv Rev. 2003 Feb. 10; 55(2):171-97; von Mehren et al., “Monoclonal antibody therapy for cancer”, Annu Rev Med. 2003; 54:343-69. Epub 2001 Dec. 3; Hudson et al., “Engineered antibodies”, Nat Med. 2003 January; 9(1):129-34; Brekke et al., “Therapeutic antibodies for human diseases at the dawn of the twenty-first century”, Nat Rev Drug Discov. 2003 January; 2(1):52-62 (Erratum in: Nat Rev Drug Discov. 2003 March; 2(3):240); Houdebine, “Antibody manufacture in transgenic animals and comparisons with other systems”, Curr Opin Biotechnol. 2002 December; 13(6):625-9; Andreakos et al., “Monoclonal antibodies in immune and inflammatory diseases”, Curr Opin Biotechnol. 2002 December; 13(6):615-20; Kellermann et al., “Antibody discovery: the use of transgenic mice to generate human monoclonal antibodies for therapeutics”, Curr Opin Biotechnol. 2002 December; 13(6):593-7; Pini et al., “Phage display and colony filter screening for high-throughput selection of antibody libraries”, Comb Chem High Throughput Screen. 2002 November; 5(7):503-10; Batra et al., “Pharmacokinetics and biodistribution of genetically engineered antibodies”, Curr Opin Biotechnol. 2002 December; 13(6):603-8; and Tangri et al., “Rationally engineered proteins or antibodies with absent or reduced immunogenicity”, Curr Med Chem. 2002 December; 9(24):2191-9.

Uses of Antibodies

Antibodies can be used to isolate the variant proteins of the present invention from a natural cell source or from recombinant host cells by standard techniques, such as affinity chromatography or immunoprecipitation. In addition, antibodies are useful for detecting the presence of a variant protein of the present invention in cells or tissues to determine the pattern of expression of the variant protein among various tissues in an organism and over the course of normal development or disease progression. Further, antibodies can be used to detect variant protein in situ, in vitro, in a bodily fluid, or in a cell lysate or supernatant in order to evaluate the amount and pattern of expression. Also, antibodies can be used to assess abnormal tissue distribution, abnormal expression during development, or expression in an abnormal condition, such as stroke. Additionally, antibody detection of circulating fragments of the full-length variant protein can be used to identify turnover.

Antibodies to the variant proteins of the present invention are also useful in pharmacogenomic analysis. Thus, antibodies against variant proteins encoded by alternative SNP alleles can be used to identify individuals that require modified treatment modalities.

Further, antibodies can be used to assess expression of the variant protein in disease states such as in active stages of the disease or in an individual with a predisposition to a disease related to the protein's function, particularly stroke. Antibodies specific for a variant protein encoded by a SNP-containing nucleic acid molecule of the present invention can be used to assay for the presence of the variant protein, such as to screen for predisposition to stroke as indicated by the presence of the variant protein.

Antibodies are also useful as diagnostic tools for evaluating the variant proteins in conjunction with analysis by electrophoretic mobility, isoelectric point, tryptic peptide digest, and other physical assays well known in the art.

Antibodies are also useful for tissue typing. Thus, where a specific variant protein has been correlated with expression in a specific tissue, antibodies that are specific for this protein can be used to identify a tissue type.

Antibodies can also be used to assess aberrant subcellular localization of a variant protein in cells in various tissues. The diagnostic uses can be applied, not only in genetic testing, but also in monitoring a treatment modality. Accordingly, where treatment is ultimately aimed at correcting the expression level or the presence of variant protein or aberrant tissue distribution or developmental expression of a variant protein, antibodies directed against the variant protein or relevant fragments can be used to monitor therapeutic efficacy.

The antibodies are also useful for inhibiting variant protein function, for example, by blocking the binding of a variant protein to a binding partner. These uses can also be applied in a therapeutic context in which treatment involves inhibiting a variant protein's function. An antibody can be used, for example, to block or competitively inhibit binding, thus modulating (agonizing or antagonizing) the activity of a variant protein. Antibodies can be prepared against specific variant protein fragments containing sites required for function or against an intact variant protein that is associated with a cell or cell membrane. For in vivo administration, an antibody may be linked with an additional therapeutic payload such as a radionuclide, an enzyme, an immunogenic epitope, or a cytotoxic agent. Suitable cytotoxic agents include, but are not limited to, bacterial toxin such as diphtheria, and plant toxin such as ricin. The in vivo half-life of an antibody or a fragment thereof may be lengthened by pegylation through conjugation to polyethylene glycol (Leong et al., Cytokine 16:106, 2001).

The invention also encompasses kits for using antibodies, such as kits for detecting the presence of a variant protein in a test sample. An exemplary kit can comprise antibodies such as a labeled or labelable antibody and a compound or agent for detecting variant proteins in a biological sample; means for determining the amount, or presence/absence of variant protein in the sample; means for comparing the amount of variant protein in the sample with a standard; and instructions for use.

Vectors and Host Cells

The present invention also provides vectors containing the SNP-containing nucleic acid molecules described herein. The term “vector” refers to a vehicle, preferably a nucleic acid molecule, which can transport a SNP-containing nucleic acid molecule. When the vector is a nucleic acid molecule, the SNP-containing nucleic acid molecule can be covalently linked to the vector nucleic acid. Such vectors include, but are not limited to, a plasmid, single or double stranded phage, a single or double stranded RNA or DNA viral vector, or artificial chromosome, such as a BAC, PAC, YAC, or MAC.

A vector can be maintained in a host cell as an extrachromosomal element where it replicates and produces additional copies of the SNP-containing nucleic acid molecules. Alternatively, the vector may integrate into the host cell genome and produce additional copies of the SNP-containing nucleic acid molecules when the host cell replicates.

The invention provides vectors for the maintenance (cloning vectors) or vectors for expression (expression vectors) of the SNP-containing nucleic acid molecules. The vectors can function in prokaryotic or eukaryotic cells or in both (shuttle vectors).

Expression vectors typically contain cis-acting regulatory regions that are operably linked in the vector to the SNP-containing nucleic acid molecules such that transcription of the SNP-containing nucleic acid molecules is allowed in a host cell. The SNP-containing nucleic acid molecules can also be introduced into the host cell with a separate nucleic acid molecule capable of affecting transcription. Thus, the second nucleic acid molecule may provide a trans-acting factor interacting with the cis-regulatory control region to allow transcription of the SNP-containing nucleic acid molecules from the vector. Alternatively, a trans-acting factor may be supplied by the host cell. Finally, a trans-acting factor can be produced from the vector itself. It is understood, however, that in some embodiments, transcription and/or translation of the nucleic acid molecules can occur in a cell-free system.

The regulatory sequences to which the SNP-containing nucleic acid molecules described herein can be operably linked include promoters for directing mRNA transcription. These include, but are not limited to, the left promoter from bacteriophage X, the lac, TRP, and TAC promoters from E. coli, the early and late promoters from SV40, the CMV immediate early promoter, the adenovirus early and late promoters, and retrovirus long-terminal repeats.

In addition to control regions that promote transcription, expression vectors may also include regions that modulate transcription, such as repressor binding sites and enhancers. Examples include the SV40 enhancer, the cytomegalovirus immediate early enhancer, polyoma enhancer, adenovirus enhancers, and retrovirus LTR enhancers.

In addition to containing sites for transcription initiation and control, expression vectors can also contain sequences necessary for transcription termination and, in the transcribed region, a ribosome-binding site for translation. Other regulatory control elements for expression include initiation and termination codons as well as polyadenylation signals. A person of ordinary skill in the art would be aware of the numerous regulatory sequences that are useful in expression vectors (see, e.g., Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).

A variety of expression vectors can be used to express a SNP-containing nucleic acid molecule. Such vectors include chromosomal, episomal, and virus-derived vectors, for example, vectors derived from bacterial plasmids, from bacteriophage, from yeast episomes, from yeast chromosomal elements, including yeast artificial chromosomes, from viruses such as baculoviruses, papovaviruses such as SV40, Vaccinia viruses, adenoviruses, poxviruses, pseudorabies viruses, and retroviruses. Vectors can also be derived from combinations of these sources such as those derived from plasmid and bacteriophage genetic elements, e.g., cosmids and phagemids. Appropriate cloning and expression vectors for prokaryotic and eukaryotic hosts are described in Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

The regulatory sequence in a vector may provide constitutive expression in one or more host cells (e.g., tissue specific expression) or may provide for inducible expression in one or more cell types such as by temperature, nutrient additive, or exogenous factor, e.g., a hormone or other ligand. A variety of vectors that provide constitutive or inducible expression of a nucleic acid sequence in prokaryotic and eukaryotic host cells are well known to those of ordinary skill in the art.

A SNP-containing nucleic acid molecule can be inserted into the vector by methodology well-known in the art. Generally, the SNP-containing nucleic acid molecule that will ultimately be expressed is joined to an expression vector by cleaving the SNP-containing nucleic acid molecule and the expression vector with one or more restriction enzymes and then ligating the fragments together. Procedures for restriction enzyme digestion and ligation are well known to those of ordinary skill in the art.

The vector containing the appropriate nucleic acid molecule can be introduced into an appropriate host cell for propagation or expression using well-known techniques. Bacterial host cells include, but are not limited to, E. coli, Streptomyces, and Salmonella typhimurium. Eukaryotic host cells include, but are not limited to, yeast, insect cells such as Drosophila, animal cells such as COS and CHO cells, and plant cells.

As described herein, it may be desirable to express the variant peptide as a fusion protein. Accordingly, the invention provides fusion vectors that allow for the production of the variant peptides. Fusion vectors can, for example, increase the expression of a recombinant protein, increase the solubility of the recombinant protein, and aid in the purification of the protein by acting, for example, as a ligand for affinity purification. A proteolytic cleavage site may be introduced at the junction of the fusion moiety so that the desired variant peptide can ultimately be separated from the fusion moiety. Proteolytic enzymes suitable for such use include, but are not limited to, factor Xa, thrombin, and enterokinase. Typical fusion expression vectors include pGEX (Smith et al., Gene 67:31-40 (1988)), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.) which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein. Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et al., Gene 69:301-415 (1988)) and pET 11d (Studier et al., Gene Expression Technology: Methods in Enzymology 185:60-89 (1990)).

Recombinant protein expression can be maximized in a bacterial host by providing a genetic background wherein the host cell has an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 119-128). Alternatively, the sequence of the SNP-containing nucleic acid molecule of interest can be altered to provide preferential codon usage for a specific host cell, for example, E. coli (Wada et al., Nucleic Acids Res. 20:2111-2118 (1992)).

The SNP-containing nucleic acid molecules can also be expressed by expression vectors that are operative in yeast. Examples of vectors for expression in yeast (e.g., S. cerevisiae) include pYepSec1 (Baldari, et al., EMBO J. 6:229-234 (1987)), pMFa (Kurjan et al., Cell 30:933-943 (1982)), pJRY88 (Schultz et al., Gene 54:113-123 (1987)), and pYES2 (Invitrogen Corporation, San Diego, Calif.).

The SNP-containing nucleic acid molecules can also be expressed in insect cells using, for example, baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g., Sf 9 cells) include the pAc series (Smith et al., Mol. Cell Biol. 3:2156-2165 (1983)) and the pVL series (Lucklow et al., Virology 170:31-49 (1989)).

In certain embodiments of the invention, the SNP-containing nucleic acid molecules described herein are expressed in mammalian cells using mammalian expression vectors. Examples of mammalian expression vectors include pCDM8 (Seed, B. Nature 329:840 (1987)) and pMT2PC (Kaufman et al., EMBO J. 6:187-195 (1987)).

The invention also encompasses vectors in which the SNP-containing nucleic acid molecules described herein are cloned into the vector in reverse orientation, but operably linked to a regulatory sequence that permits transcription of antisense RNA. Thus, an antisense transcript can be produced to the SNP-containing nucleic acid sequences described herein, including both coding and non-coding regions. Expression of this antisense RNA is subject to each of the parameters described above in relation to expression of the sense RNA (regulatory sequences, constitutive or inducible expression, tissue-specific expression).

The invention also relates to recombinant host cells containing the vectors described herein. Host cells therefore include, for example, prokaryotic cells, lower eukaryotic cells such as yeast, other eukaryotic cells such as insect cells, and higher eukaryotic cells such as mammalian cells.

The recombinant host cells can be prepared by introducing the vector constructs described herein into the cells by techniques readily available to persons of ordinary skill in the art. These include, but are not limited to, calcium phosphate transfection, DEAE-dextran-mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, lipofection, and other techniques such as those described in Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).

Host cells can contain more than one vector. Thus, different SNP-containing nucleotide sequences can be introduced in different vectors into the same cell. Similarly, the SNP-containing nucleic acid molecules can be introduced either alone or with other nucleic acid molecules that are not related to the SNP-containing nucleic acid molecules, such as those providing trans-acting factors for expression vectors. When more than one vector is introduced into a cell, the vectors can be introduced independently, co-introduced, or joined to the nucleic acid molecule vector.

In the case of bacteriophage and viral vectors, these can be introduced into cells as packaged or encapsulated virus by standard procedures for infection and transduction. Viral vectors can be replication-competent or replication-defective. In the case in which viral replication is defective, replication can occur in host cells that provide functions that complement the defects.

Vectors generally include selectable markers that enable the selection of the subpopulation of cells that contain the recombinant vector constructs. The marker can be inserted in the same vector that contains the SNP-containing nucleic acid molecules described herein or may be in a separate vector. Markers include, for example, tetracycline or ampicillin-resistance genes for prokaryotic host cells, and dihydrofolate reductase or neomycin resistance genes for eukaryotic host cells. However, any marker that provides selection for a phenotypic trait can be effective.

While the mature variant proteins can be produced in bacteria, yeast, mammalian cells, and other cells under the control of the appropriate regulatory sequences, cell-free transcription and translation systems can also be used to produce these variant proteins using RNA derived from the DNA constructs described herein.

Where secretion of the variant protein is desired, which is difficult to achieve with multi-transmembrane domain containing proteins such as G-protein-coupled receptors (GPCRs), appropriate secretion signals can be incorporated into the vector. The signal sequence can be endogenous to the peptides or heterologous to these peptides.

Where the variant protein is not secreted into the medium, the protein can be isolated from the host cell by standard disruption procedures, including freeze/thaw, sonication, mechanical disruption, use of lysing agents, and the like. The variant protein can then be recovered and purified by well-known purification methods including, for example, ammonium sulfate precipitation, acid extraction, anion or cationic exchange chromatography, phosphocellulose chromatography, hydrophobic-interaction chromatography, affinity chromatography, hydroxylapatite chromatography, lectin chromatography, or high performance liquid chromatography.

It is also understood that, depending upon the host cell in which recombinant production of the variant proteins described herein occurs, they can have various glycosylation patterns, or may be non-glycosylated, as when produced in bacteria. In addition, the variant proteins may include an initial modified methionine in some cases as a result of a host-mediated process.

For further information regarding vectors and host cells, see Current Protocols in Molecular Biology, John Wiley & Sons, N.Y.

Uses of Vectors and Host Cells, and Transgenic Animals

Recombinant host cells that express the variant proteins described herein have a variety of uses. For example, the cells are useful for producing a variant protein that can be further purified into a preparation of desired amounts of the variant protein or fragments thereof. Thus, host cells containing expression vectors are useful for variant protein production.

Host cells are also useful for conducting cell-based assays involving the variant protein or variant protein fragments, such as those described above as well as other formats known in the art. Thus, a recombinant host cell expressing a variant protein is useful for assaying compounds that stimulate or inhibit variant protein function. Such an ability of a compound to modulate variant protein function may not be apparent from assays of the compound on the native/wild-type protein, or from cell-free assays of the compound. Recombinant host cells are also useful for assaying functional alterations in the variant proteins as compared with a known function.

Genetically-engineered host cells can be further used to produce non-human transgenic animals. A transgenic animal is preferably a non-human mammal, for example, a rodent, such as a rat or mouse, in which one or more of the cells of the animal include a transgene. A transgene is exogenous DNA containing a SNP of the present invention which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal in one or more of its cell types or tissues. Such animals are useful for studying the function of a variant protein in vivo, and identifying and evaluating modulators of variant protein activity. Other examples of transgenic animals include, but are not limited to, non-human primates, sheep, dogs, cows, goats, chickens, and amphibians. Transgenic non-human mammals such as cows and goats can be used to produce variant proteins which can be secreted in the animal's milk and then recovered.

A transgenic animal can be produced by introducing a SNP-containing nucleic acid molecule into the male pronuclei of a fertilized oocyte, e.g., by microinjection or retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal. Any nucleic acid molecules that contain one or more SNPs of the present invention can potentially be introduced as a transgene into the genome of a non-human animal.

Any of the regulatory or other sequences useful in expression vectors can form part of the transgenic sequence. This includes intronic sequences and polyadenylation signals, if not already included. A tissue-specific regulatory sequence(s) can be operably linked to the transgene to direct expression of the variant protein in particular cells or tissues.

Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described in, for example, U.S. Pat. Nos. 4,736,866 and 4,870,009, both by Leder et al., U.S. Pat. No. 4,873,191 by Wagner et al., and in Hogan, B., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Similar methods are used for production of other transgenic animals. A transgenic founder animal can be identified based upon the presence of the transgene in its genome and/or expression of transgenic mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene can further be bred to other transgenic animals carrying other transgenes. A transgenic animal also includes a non-human animal in which the entire animal or tissues in the animal have been produced using the homologously recombinant host cells described herein.

In another embodiment, transgenic non-human animals can be produced which contain selected systems that allow for regulated expression of the transgene. One example of such a system is the cre/loxP recombinase system of bacteriophage P1 (Lakso et al. PNAS 89:6232-6236 (1992)). Another example of a recombinase system is the FLP recombinase system of S. cerevisiae (O'Gorman et al. Science 251:1351-1355 (1991)). If a cre/loxP recombinase system is used to regulate expression of the transgene, animals containing transgenes encoding both the Cre recombinase and a selected protein are generally needed. Such animals can be provided through the construction of “double” transgenic animals, e.g., by mating two transgenic animals, one containing a transgene encoding a selected variant protein and the other containing a transgene encoding a recombinase.

Clones of the non-human transgenic animals described herein can also be produced according to the methods described in, for example, Wilmut, I. et al. Nature 385:810-813 (1997) and PCT International Publication Nos. WO 97/07668 and WO 97/07669. In brief, a cell (e.g., a somatic cell) from the transgenic animal can be isolated and induced to exit the growth cycle and enter Go phase. The quiescent cell can then be fused, e.g., through the use of electrical pulses, to an enucleated oocyte from an animal of the same species from which the quiescent cell is isolated. The reconstructed oocyte is then cultured such that it develops to morula or blastocyst and then transferred to pseudopregnant female foster animal. The offspring born of this female foster animal will be a clone of the animal from which the cell (e.g., a somatic cell) is isolated.

Transgenic animals containing recombinant cells that express the variant proteins described herein are useful for conducting the assays described herein in an in vivo context. Accordingly, the various physiological factors that are present in vivo and that could influence ligand or substrate binding, variant protein activation, signal transduction, or other processes or interactions, may not be evident from in vitro cell-free or cell-based assays. Thus, non-human transgenic animals of the present invention may be used to assay in vivo variant protein function as well as the activities of a therapeutic agent or compound that modulates variant protein function/activity or expression. Such animals are also suitable for assessing the effects of null mutations (i.e., mutations that substantially or completely eliminate one or more variant protein functions).

For further information regarding transgenic animals, see Houdebine, “Antibody manufacture in transgenic animals and comparisons with other systems”, Curr Opin Biotechnol. 2002 December; 13(6):625-9; Petters et al., “Transgenic animals as models for human disease”, Transgenic Res. 2000; 9(4-5):347-51; discussion 345-6; Wolf et al., “Use of transgenic animals in understanding molecular mechanisms of toxicity”, J Pharm Pharmacol. 1998 June; 50(6):567-74; Echelard, “Recombinant protein production in transgenic animals”, Curr Opin Biotechnol. 1996 October; 7(5):536-40; Houdebine, “Transgenic animal bioreactors”, Transgenic Res. 2000; 9(4-5):305-20; Pirity et al., “Embryonic stem cells, creating transgenic animals”, Methods Cell Biol. 1998; 57:279-93; and Robl et al., “Artificial chromosome vectors and expression of complex proteins in transgenic animals”, Theriogenology. 2003 Jan. 1; 59 (1):107-13.

EXAMPLES

The following examples are offered to illustrate, but not to limit the claimed invention.

Example One: SNPs Associated with Stroke in the Atherosclerosis Risk in Communities (ARIC) Study

Overview

51 SNPs associated with coronary heart disease (CHD) in multiple antecedent studies (Bare et al. 2007) were analyzed to determine whether these SNPs are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. To carry out this analysis, 495 validated ischemic strokes were identified from the multi-ethnic ARIC cohort of 14,215 individuals by following the cohort for an average of 13.5 years for potential cerebrovascular events. Risk alleles for 51 SNPs were specified based on the results from at least two antecedent studies in which these SNPs were associated with CHD. As a result of this analysis, Cox proportional hazards models, adjusted for age and gender, identified three SNPs in whites/Caucasians (these terms are used herein interchangeably) and two SNPs in blacks/African Americans (these terms are used herein interchangeably) that were associated (p≤0.05) with incident stroke and had the same risk allele as specified by the antecedent studies. The rs11628722 polymorphism in SERPINA9 was associated with incident ischemic stroke in both whites and blacks. Thus, genetic variation in SERPINA9 was associated with incident stroke in both whites and blacks, even after taking into account traditional risk factors.

Subjects and Methods

The Atherosclerosis Risk in Communities (ARIC) Study

Study participants were selected from the ARIC Study, a prospective investigation of atherosclerosis and its clinical sequelae involving 15,792 individuals aged 45-64 years at recruitment (1986-1989). Subjects were selected by probability sampling from four communities: Forsyth County, N.C.; Jackson, Miss. (blacks only); Northwestern suburbs of Minneapolis, Minn.; and Washington County, Md. The initial clinical exams included a home interview to ascertain cardiovascular risk factors, socioeconomic factors and family medical history, clinical examination and blood drawing for laboratory determinations. A detailed description of the ARIC study design and methods has been published elsewhere (ARIC Investigators (1989) “The Atherosclerosis Risk in Communities (ARIC) Study: design and objectives”. American Journal of Epidemiology 129: 687-702).

Incident Ischemic Stroke

Ischemic stroke was determined by contacting participants annually to identify hospitalizations during the previous year, and by surveying discharge lists from local hospitals and death certificates from state vital statistics offices for potential cerebrovascular events (ARIC Investigators (1989) American Journal of Epidemiology 129: 687-702; Rosamond et al. (1999) Stroke 30: 736-743). Hospital records were obtained, abstracted and classified by computer algorithm and physician review. Details on quality assurance for ascertainment and classification of ischemic stroke events have been published elsewhere (Rosamond et al. (1999) Stroke 30: 736-743). Ischemic stroke events were defined as validated definite or probable hospitalized embolic or thrombotic brain infarctions. Participants were excluded from this analysis if they had a positive or unknown history of prevalent stroke; transient ischemic attack/stroke symptoms or CHD at the initial visit; ethnic background other than white or black; an ethnic background of black but were not from Jackson, Miss.; restrictions on use of their DNA; or missing data for any of the traditional cardiovascular or cerebrovascular risk factors. The remaining 14,215 participants were followed for incident ischemic stroke for a mean of 13.5 years and 495 incident ischemic stroke cases were identified.

Examination and Laboratory Measures

Cardiovascular risk factors considered in this study were measured at baseline and included age, gender, waist-to-hip ratio, diabetes, hypertension, and smoking status. The ratio of waist (umbilical level) and hip (maximum buttocks) circumference was calculated as a measure of fat distribution. Diabetes was defined by a fasting glucose level ≥126 mg/dl, a nonfasting glucose level ≥200 mg/dl, or a self-reported physician diagnosis of diabetes or use of diabetes medication. Seated blood pressure was measured three times with a random-zero sphygmomanometer and the last two measurements were averaged. An interviewer-administered questionnaire was used to assess use of antihypertensive medications. Hypertension was defined as systolic blood pressure ≥140 mmHg or diastolic blood pressure ≥90 mmHg or current use of antihypertensive medication. Cigarette smoking status was classified as current or not current. The study protocol was approved by the Institutional Review Boards of the collaborating institutions, and informed written consent was obtained from each participant.

SNP Selection and Genotype Determination

Fifty-one functional SNPs associated with CHD in multiple antecedent studies, other than the ARIC study, were considered in this study. A detailed description of the antecedent studies is presented elsewhere (Bare et al., Genetics in Medicine. 2007 October; 9(10):682-9). Briefly, risk alleles for 49 SNPs were specified based on significant association with myocardial infarction in at least two antecedent case-control studies. These studies involved myocardial infarction cases and controls recruited by either the Cleveland Clinic Foundation Heart Center, Cleveland, Ohio (CCF) or the Genomic Resource in Arteriosclerosis at the University of California, San Francisco (UCSF). All cases in these two studies had a history of myocardial infarction and the controls did not, and all subjects were self-described, non-Hispanic Caucasians. The risk alleles for two additional SNPs were specified based on an association with CHD in the placebo arms of two CHD prevention trials: the Cholesterol and Recurrent Events (CARE) study (Sacks et al. (1996) New England Journal of Medicine 335: 1001-1009) and the West of Scotland Coronary Prevention Study (WOSCOPS) (Packard et al. (2000) New England Journal of Medicine 343: 1148-1155). One of these SNPs (rs20455 in KIF6) was significantly associated with CHD after correction for multiple testing (Iakoubova et al., Journal of the American College of Cardiology. 2008; 51:435-43). The second SNP associated with CHD in CARE and WOSCOPS was rs11666735 in FCAR (Iakoubova et al. (2006) Arteriosclerosis, Thrombosis and Vascular Biology 26: 2763-2768).

Genotyping of the 51 SNPs in the ARIC study was carried out using PCR-based amplification of genomic DNA followed by an allele-specific oligonucleotide ligation assay similar to a previously described procedure (Iannone et al. (2000) Cytometry 39: 131-140).

Statistical Analyses

Agreement of genotype frequencies with Hardy-Weinberg equilibrium expectations was tested separately in whites and blacks using a χ2 goodness-of-fit test in non-cases, stratified by ethnicity. Deviation from Hardy-Weinberg equilibrium was determined by a p-value less than 0.05. Cox proportional hazards models were used to model time to incident ischemic stroke. The follow-up time interval was defined as the time between the initial clinical visit and the end of follow-up, which for cases was the date of the first ischemic stroke event and for non-cases was Dec. 31, 2002, the date of death, or the date of last contact if lost to follow-up. Each model was evaluated separately in whites and blacks and included a given SNP (modeled as the additive effect of the pre-specified risk allele), age and gender. Additional risk factors evaluated as potential confounders in the Cox proportional hazards models included waist-to-hip ratio, diabetes, hypertension, and smoking status (Folsom et al., (1999) Diabetes Care 22: 1077-1083). SNPs and risk factors were assessed for statistical significance in the models by the Wald statistic. A two-sided p-value of 0.05 was used to assess statistical significance with ischemic stroke and no attempt was made to adjust for multiple comparisons within this study.

Results

Race-specific proportions, means and standard deviations for the traditional risk factors are presented in Table 5. Mean values and proportions differed significantly (p<0.03) between incident ischemic stroke cases and non-cases for all risk factors.

Three SNPs in whites (in SERPINA9, PALLD and IER2) and two SNPs in blacks (in SERPINA9 and EXOD1) were associated (p≤0.05) with ischemic stroke, after adjusting for age and gender, and had the same risk allele as specified by the antecedent studies (Table 6, Model 1). One additional SNP in EIF2AK2 was associated with ischemic stroke in whites, but the risk allele in the ARIC study differed from the risk allele identified in the antecedent CHD studies. The rs11628722 polymorphism in SERPINA9 was associated with incident ischemic stroke in both ethnicities (whites HRR=1.31, 95% CI: 1.00-1.70; blacks HRR=1.26, 95% CI: 1.03-1.53).

For the four SNPs that were associated in either ethnic group, traditional cardiovascular risk factors were included in the Cox proportional hazards models to evaluate possible confounding. The observed hazards ratios were essentially unchanged with addition of these risk factors to the prediction models (Table 6, Model 2).

Discussion

This study investigated whether 51 putative functional SNPs associated with CHD in multiple antecedent studies predict ischemic stroke among white and black individuals from the large prospective ARIC study. Three SNPs in whites and two SNPs in blacks were associated with incident ischemic stroke, even after taking into account established risk factors. The rs11628722 polymorphism in SERPINA9 was associated with ischemic stroke in both whites and blacks from the ARIC study.

It is noteworthy that the association between SERPINA9 and stroke was observed in both whites and blacks in this study. This SNP has been associated with myocardial infarction in two case-control studies and this study shows an association with stroke in both whites and blacks from the ARIC study. SERPINA9 is a member of Glade A of the large superfamily of serine peptidase inhibitors known as serpins. Serpins are protease inhibitors that use a conformational change to inhibit target enzymes, and are involved in many cellular processes, such as coagulation, fibrinolysis, complement fixation, matrix remodeling and apoptosis (Law et al. (2006) Genome Biology 7: 216). A recent study indicated that SERPINA9 was significantly upregulated in the hippocampal tissues from Alzheimer's disease transgenic mice versus age-matched controls (Jee et al (2006) Neurochemistry Research 31: 1035-1044). This study suggests that SERPINA9 may also be expressed in the human brain, consistent with the findings described herein of an association between polymorphic variation in this gene and ischemic stroke.

In addition to SERPINA9, polymorphisms in palladin (PALLD) and immediate early response 2 (IER2) were associated with ischemic stroke in whites and a polymorphism in exonuclease domain containing 1 (EXOD1) was associated in blacks. PALLD encodes a component of the cytoskeleton that controls cell shape and motility. Vascular remodeling may lead to atherosclerosis, and the shape and cytoskeletal organization of endothelial cells is an important part of this process. Mechanical stress and strain also plays a role in atherosclerotic vascular remodeling and immediate early response genes have been shown to mediate the mechanical stress-induced pathological process in the blood vessel (Liu et al. (1999) Critical Reviews in Biomedical Engineering 27: 75-148). Although little is known about EXOD1, exonucleases have been shown to play a role in both myocardial infarction and stroke. Given their functional roles, PALLD, IER2 and EXOD1 potentially play a role in the atherosclerotic pathway. Additionally, PALLD, IER2 and EXOD1 are all expressed in the heart and brain.

A strength of this study is the prospective cohort design. The large sample size allows for the assessment of exposures (e.g. genetic factors) of modest effect. All analyses for this study were performed separately in whites and blacks.

Thus, a small subset of gene variants previously associated with CHD in antecedent studies were found to also be associated with incident ischemic stroke in ARIC. In particular, SERPINA9 was associated with stroke in both whites and blacks and this association does not appear to be mediated by traditional risk factors.

Supplemental Analysis of SNPs in the ARIC Study

In a further analysis of the 51 SNPs in the ARIC participants, SNPs that predict ischemic stroke risk were identified by Cox proportional hazard analysis and included SNPs with a two-sided p-value of <0.2 after adjusting for age and sex and a hazard ratio (HRR) >1.0. These SNPs are shown in Tables 7-9 (the p-values shown in Tables 7-9 are two-sided p-values; thus, the one-sided p-values for these SNPs are half of these two-sided p-values). SNPs that predict ischemic stroke after adjusting for age and sex (two-sided p-value <0.2 and HRR >1.0) in the white ARIC participants and separately in the black ARIC participants are shown in Table 7 (whites) and Table 8 (blacks). SNPs that predict ischemic stroke after adjusting for age and sex in both the black and the white ARIC populations with the same risk alleles are listed in Table 9.

Example Two: SNPs Associated with Stroke in the Cardiovascular Health Study (CHS)

Overview

74 SNPs, which had been associated with coronary heart disease (CHD) (Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-9, incorporated herein by reference in its entirety), were analyzed to determine whether these SNPs are associated with incident ischemic stroke. To carry out this analysis, the risk allele was prespecified for each of the 74 SNPs based on antecedent studies of CHD. Cox proportional hazards models were used that adjusted for traditional risk factors to estimate the associations of these SNPs with incident ischemic stroke during 14 years of follow-up in a population-based study of older adults referred to as the Cardiovascular Health Study (CHS). As a result of this analysis, the prespecified risk alleles of 7 of the 74 SNPs (in HPS1, ITGAE, ABCG2, MYH15, FSTL4, CALM1, and BAT2) were associated with increased risk of stroke in white CHS participants (1-sided P<0.05, false discovery rate (FDR)=0.42). In African American participants, the prespecified risk alleles of 5 SNPs (in KRT4, LY6G5B, EDG1, DMXL2, and ABCG2) were associated with stroke (1-sided P<0.05, FDR=0.55). The Val12Met SNP in ABCG2 was associated with stroke in both white (hazard ratio 1.46, 90% CI 1.05 to 2.03) and African American (hazard ratio 3.59, 90% CI 1.11 to 11.6) participants of CHS. Kaplan-Meier estimates of the 10 year cumulative incidence of stroke were greater among Val allele homozygotes than among Met allele carriers in both white (10% versus 6%) and African American (12% versus 3%) participants of CHS. Thus, the Val12Met SNP in ABCG2 (encoding a transporter of sterols and xenobiotics) was associated with incident ischemic stroke in white and African American participants of CHS.

Materials and Methods

Cardiovascular Health Study

CHS is a prospective population-based study of risk factors for cardiovascular disease, including CHD and stroke, in older adults. Men and women aged 65 years and older were recruited from random samples of individuals on Medicare eligibility lists in four U.S. communities (Sacramento County, Calif.; Washington County, Md.; Forsyth County, N.C.; and Pittsburgh, Allegheny County, Pennsylvania) and from age-eligible members of the same households. Potential participants were excluded if they were institutionalized, not ambulatory at home, under hospice care, receiving radiation or chemotherapy for cancer, not expected to remain in the area for at least three years, or unable to be interviewed. CHS enrolled 5201 participants in 1989-90. An additional 687 African American participants entered the cohort in 1992-93. Participants who did not donate DNA or who did not consent to the use of their DNA for studies by private companies (n=514) as well as participants for whom the amount of DNA samples were insufficient (n=130) were excluded, leaving 5244 participants available for a genetic study. The institutional review board at each site approved the study methods, and all participants gave written informed consent. Details of CHS design7 and recruitment8 have been reported.

Participants completed a baseline clinic examination that included a medical history interview, physical examination, and blood draw.9 Baseline self-reported myocardial infarction (MI) or stroke was confirmed by information from the clinic examination or by review of medical records or physician questionnaires.10 Cardiovascular events during follow-up were identified at semi-annual contacts, which alternated between clinic visits and telephone calls. Suspected events were adjudicated according to standard criteria by a physician review panel using information from medical records, brain imaging studies11 and, in some cases, interviews with the physician, participant, or a proxy informant.12 Medicare utilization files were searched to ascertain events that may have been missed.13

At baseline, 722 of the 5244 participants available for a genetic study had a history of stroke or MI. Since the risk of incident ischemic stroke might be influenced by whether a patient had had a prior stroke or MI, these 722 participants were excluded from the analysis, leaving 4522 (3849 white and 673 African American) participants in this genetic study of first incident ischemic stroke. Baseline characteristics of these 4522 participants are presented in Table 10. During follow-up, 642 participants had an incident non-procedure-related stroke, and 47 of these 642 had an MI before their stroke, leaving 595 stroke events. Of these 595 stroke events, 72 (12%) were hemorrhagic, 46 (8%) were not classified for type, and the remaining 477 stroke events were classified as ischemic stroke events: the end point for this analysis.

Covariates

Risk estimates for ischemic stroke were adjusted for the following traditional risk factors: diabetes mellitus (defined by fasting serum glucose levels of at least 126 mg/dL or the use of either insulin or oral hypoglycemic medications), impaired fasting glucose (defined as fasting glucose levels between 110 and 125 mg/dL14), hypertension (defined by systolic blood pressure of at least 140 mmHg, diastolic blood pressure of at least 90 mmHg, or a physician's diagnosis of hypertension plus the use of anti-hypertensive medications10), current smoking, LDL-cholesterol, HDL-cholesterol, and body mass index (BMI). Other covariates included atrial fibrillation, carotid intima-media thickness (IMT), and genotypes. Atrial fibrillation was identified on the basis of 12-lead resting ECGs performed at the baseline examination. Tracings were read for atrial fibrillation or flutter at the CHS Electrocardiography Reading Center.15 Ultrasonography of the common and internal carotid arteries was also performed at baseline. The IMT was defined as the mean of the maximum IMTs of the near and far walls of the left and right carotid arteries.16 Genotypes of the CHS participants were determined by a multiplex method that combines PCR, allele-specific oligonucleotide ligation assays, and hybridization to oligonucleotides coupled to Luminex®100TM xMAP microspheres (Luminex, Austin, Tex.), followed by detection of the spectrally distinct microsphere on a Luminex 100 instrument (Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-9).

Prespecification of Risk Alleles for 74 SNPs Investigated in CHS

For each of the 74 SNPs that were genotyped in CHS, a risk allele was prespecified based on antecedent data (Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-9). For 14 of the 74 SNPs, genetic associations with CHD have been previously published.17-21 The remaining 60 SNPs were associated with MI in one or more antecedent studies of MI as described (Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-9).

Statistics

Since the risk estimate for gene variants can differ between whites and African Americans, the association of SNPs with incident ischemic stroke in CHS was investigated in each race separately. Analyses of time to primary end point were conducted. Follow-up began at CHS enrollment and ended on the date of incident stroke of any type, incident MI, death, loss to follow-up, or Jun. 30, 2004, whichever occurred first. The median follow-up time was 11.2 years (11.9 years for the 1989-90 cohort and 10.7 years for the African American cohort).

Cox regression models were used to estimate hazard ratios of each SNP. In Model 1, Cox models were adjusted for baseline age (continuous) and sex. In Model 2, Cox models were adjusted for baseline age (continuous), sex, body mass index (continuous), current smoking, diabetes, impaired fasting glucose, hypertension, LDL-cholesterol (continuous), and HDL-cholesterol (continuous). Risk estimates were also further adjusted for two additional risk factors of ischemic stroke: atrial fibrillation and carotid IMT. The SNP variable in the Cox models was coded as 0 for the non-risk homozygote, 1 for those who carried 1 copy of the risk allele and 2 for those who carried 2 copies of the risk allele. Thus, the hazard ratios represent the log-additive increase in risk for each additional copy of the risk allele a subject carried, compared with the non-risk homozygotes. Because the hypotheses that the allele associated with increased risk of CHD would also be associated with increased risk of ischemic stroke was being testing, a 1-sided P-value was used to test the significance of the Cox model coefficients. Correspondingly, 90% confidence intervals were estimated for the hazard ratios (for hazard ratios greater than one, there is 95% confidence that a true risk estimate is greater than the lower bound of a 90% confidence interval). In white participants, this study had 80% or more power to detect associations between SNPs and incident ischemic stroke for SNPs that have relative risks of 1.3 and 1.5 (in an additive model) and risk allele frequencies of 0.13 and 0.05, respectively, assuming an alpha level of 0.05 and a 1-sided test. In African American participants, this study had 80% or more power to detect associations between SNPs and incident ischemic stroke for SNPs that have relative risks of 1.6 and 1.8 (in an additive model) and risk allele frequencies of 0.3 and 0.14, respectively. The cumulative incidence of stroke was estimated by the method of Kaplan and Meier. Data were analyzed using Stata Statistical Software.22 The influence of multiple testing was evaluated using the false discovery rate (FDR)23 to estimate the expected fraction of false positives in a group of SNPs with P values below a given threshold. FDR calculations were performed with R Statistical Software.24

Results

The baseline characteristics of the 3,849 white and 673 African American participants of CHS in this genetic study of ischemic stroke are presented in Table 10. There were 407 first incident ischemic stroke events in the white participants and 70 in the African American participants during follow-up (median of 11.2 years). The association between incident ischemic stroke and 74 SNPs that had previously been found to be associated with coronary heart disease (CHD) in one or more antecedent studies (Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-9) was investigated. Specifically, for each SNP, it was determined whether the allele that had been associated with increased risk of CHD (the risk allele) was also associated with increased risk of stroke.

In white participants of CHS, it was found that the risk alleles of 7 of these 74 SNPs were associated (P<0.05) with increased risk of stroke after adjusting for traditional risk factors (age, sex, body mass index, smoking, diabetes, impaired fasting glucose, hypertension, LDL-cholesterol, and HDL-cholesterol). These 7 SNPs were in HPS1, ITGAE, ABCG2, MYH15, FSTL4, CALM1, and BAT2. The additive (per allele) hazard ratios for stroke ranged from 1.15 to 1.49 (Table 11). In African American participants of CHS, it was found that the risk alleles of 5 SNPs (in KRT4, LY6G5B, EDG1, DMXL2, and ABCG2) were associated (P<0.05) with increased risk of stroke after adjusting for traditional risk factors. The hazard ratios for these 5 SNPs ranged from 1.40 to 3.59 (Table 12). The risk estimates for the 11 SNPs that were associated with stroke in either whites or African Americans (Tables 11 and 12) were essentially unchanged when further adjusted for atrial fibrillation and internal carotid artery IMT (data not shown).

To account for multiple comparisons, the FDR23 was estimated for the set of SNPs found to be associated with incident ischemic stroke in CHS participants. These FDRs were 0.42 for the 7 SNPs in white participants and 0.55 for the 5 SNPs in African American participants of CHS.

ABCG2 Val12Met (rs2231137) was associated with incident ischemic stroke in both white and African American participants of CHS. The risk of ischemic stroke was higher in Val allele homozygotes than in Met allele carriers. The adjusted hazard ratio for Val allele homozygotes, compared with Met allele carriers, was 1.50 (90% CI 1.06 to 2.12) in white participants and 3.62 (90% CI 1.11 to 11.9) in African American participants (Table 13). The 10-year cumulative incidence of ischemic stroke was greater in Val allele homozygotes than in Met allele carriers in both the white (10% versus 6%) and African American (12% versus 3%, FIGS. 1a-1b) participants of CHS.

Discussion

Among 74 genetic variants tested in CHS, it was found that 7 were associated with incident ischemic stroke in white participants and 5 were associated with incident ischemic stroke in African American participants. In particular, an association between the Val allele of ABCG2 Val12Met and increased risk of incident ischemic stroke was identified, and this association was consistent in both whites and African Americans.

Three of the 11 gene variants associated with incident ischemic stroke in CHS had particularly notable associations with CHD in the antecedent studies. The first of these 3 gene variants was the Val allele of ABCG2 Val12Met (rs2231137). This gene variant had previously been found to be associated with angiographically defined severe coronary artery disease (CAD) in two case-control studies.20 ABCG2 encodes ATP-binding cassette, subfamily G, member 2, which is a protein that belongs to a large family of transporters. It is expressed on the cell surface of stem cells in bone marrow and skeletal muscle,25 progenitor endothelial cells that are capable of vasculogenesis in adipose tissue,26 and endothelial cells in blood vessels of the heart27 and brain28. The ABCG2 protein has been reported recently to transport sterols.29, 30 It is interesting to note that the related ATP-binding cassette proteins ABCA1,31 ABCGS, and ABCG832 are transporters of lipids: variants of these transporters have been shown to cause lipid disorders such as Tangier disease31 and sitosterolemia.32 However, a well known function of the ABCG2 protein is to act as a multi-drug transporter of anticancer drugs, and the ABCG2 protein is over-expressed in drug-resistant cancer cells.33 The Met variant of ABCG2 has been reported to confer lower drug resistance and has an altered pattern of localization when compared with the Val variant.34 It is possible that the Met variant of the ABCG2 protein may function in the vascular endothelium and have an altered function as a transporter. Homozygotes of the Val allele of ABCG2 (88% of whites and 88% of African Americans) were at higher risk of stroke than carriers of the Met allele in CHS. Since there were only 16 homozygotes of the Met allele, the Met homozygotes were pooled with heterozygotes and used as the reference group. The Met allele could also be considered to be a protective allele in that the Met allele carriers had a lower risk of incident ischemic stroke than the Val allele homozygotes.

The second of the 3 gene variants with notable findings in antecedent studies is the Ala allele of MYH15 Thr1125Ala (rs3900940). In addition to being associated with MI in two antecedent association studies,6 it was associated with increased risk of incident CHD in the white participants of the Atherosclerosis Risk in Communities Study.21 MYH15 encodes myosin heavy polypeptide 15 and the Thr1125Ala SNP is located in the tail domain of the MYH15 protein.35

The third gene variant with notable findings in antecedent studies is the G allele of rs3814843 in the 3′untranslated region in CALM1. This SNP was associated with angiographically defined severe CAD in two case-control studies.20 CALM1 encodes calmodulin 1 which binds calcium and functions in diverse signaling pathways, including those involved in cell division,36 membrane trafficking,37 and platelet aggregation.38

Thus, a small subset of gene variants previously associated with CHD in antecedent studies were found to also be associated with incident ischemic stroke in CHS. Notably, the Val allele of the Val12Met SNP in ABCG2 (which encodes a transporter of sterols and anticancer drugs) was associated with increased risk of incident ischemic stroke in both white and African American participants of CHS.

REFERENCES (CORRESPONDING TO EXAMPLE TWO)

  • 1. Brass L M, Isaacsohn J L, Merikangas K R, Robinette C D. A study of twins and stroke. Stroke. 1992; 23:221-223
  • 2. Bak S, Gaist D, Sindrup S H, Skytthe A, Christensen K. Genetic liability in stroke: a long-term follow-up study of Danish twins. Stroke. 2002; 33:769-774
  • 3. Welin L, Svardsudd K, Wilhelmsen L, Larsson B, Tibblin G. Analysis of risk factors for stroke in a cohort of men born in 1913. N Engl J Med. 1987; 317:521-526
  • 4. Jousilahti P, Rastenyte D, Tuomilehto J, Sarti C, Vartiainen E. Parental history of cardiovascular disease and risk of stroke. A prospective follow-up of 14371 middle-aged men and women in Finland. Stroke. 1997; 28:1361-1366
  • 5. Rosamond W, Flegal K, Friday G, Furie K, Go A, Greenlund K, Haase N, Ho M, Howard V, Kissela B, Kittner S, Lloyd-Jones D, McDermott M, Meigs J, Moy C, Nichol G, O'Donnell C J, Roger V, Rumsfeld J, Sorlie P, Steinberger J, Thom T, Wasserthiel-Smoller S, Hong Y. Heart disease and stroke statistics—2007 update: a report from the American Heart Association Statistics Committee and Stroke Statistics Subcommittee. Circulation. 2007; 115:e69-171
  • 6. Shiffman D, O'Meara E S, Bare L A, Rowland C M, Louie J Z, Arellano A R, Lumley T, Rice K, Iakoubova O, Luke M M, Young B A, Malloy M J, Kane J P, Ellis S G, Tracy R P, Devlin J J, Psaty B M. Association of gene variants with incident myocardial infarction in the Cardiovascular Health Study. Arterioscler Thromb Vasc Biol. 2008; 28:173-179
  • 7. Fried L P, Borhani N O, Enright P, Furberg C D, Gardin J M, Kronmal R A, Kuller L H, Manolio T A, Mittelmark M B, Newman A, et al. The Cardiovascular Health Study: design and rationale. Ann Epidemiol. 1991; 1:263-276
  • 8. Tell G S, Fried L P, Hermanson B, Manolio T A, Newman A B, Borhani N O. Recruitment of adults 65 years and older as participants in the Cardiovascular Health Study. Ann Epidemiol. 1993; 3:358-366
  • 9. Cushman M, Cornell E S, Howard P R, Bovill E G, Tracy R P. Laboratory methods and quality assurance in the Cardiovascular Health Study. Clin Chem. 1995; 41:264-270
  • 10. Psaty B M, Kuller L H, Bild D, Burke G L, Kittner S J, Mittelmark M, Price T R, Rautaharju P M, Robbins J. Methods of assessing prevalent cardiovascular disease in the Cardiovascular Health Study. Ann Epidemiol. 1995; 5:270-277
  • 11. Longstreth W T, Jr., Bernick C, Fitzpatrick A, Cushman M, Knepper L, Lima J, Furberg C D. Frequency and predictors of stroke death in 5,888 participants in the Cardiovascular Health Study. Neurology. 2001; 56:368-375
  • 12. Price T R, Psaty B, O'Leary D, Burke G, Gardin J. Assessment of cerebrovascular disease in the Cardiovascular Health Study. Ann Epidemiol. 1993; 3:504-507
  • 13. Ives D G, Fitzpatrick A L, Bild D E, Psaty B M, Kuller L H, Crowley P M, Cruise R G, Theroux S. Surveillance and ascertainment of cardiovascular events. The Cardiovascular Health Study. Ann Epidemiol. 1995; 5:278-285
  • 14. American Diabetes Association. Report of the Expert Committee on the Diagnosis and Classification of Diabetes Mellitus. Diabetes Care. 1997; 20:1183-1197
  • 15. Rautaharju P M, MacInnis P J, Warren J W, Wolf H K, Rykers P M, Calhoun H P. Methodology of ECG interpretation in the Dalhousie program; NOVACODE ECG classification procedures for clinical trials and population health surveys. Methods Inf Med. 1990; 29:362-374
  • 16. O'Leary D H, Polak J F, Wolfson S K, Jr., Bond M G, Bommer W, Sheth S, Psaty B M, Sharrett A R, Manolio T A. Use of sonography to evaluate carotid atherosclerosis in the elderly. The Cardiovascular Health Study. CHS Collaborative Research Group. Stroke. 1991; 22:1155-1163
  • 17. Shiffman D, Ellis S G, Rowland C M, Malloy M J, Luke M M, Iakoubova O A, Pullinger C R, Cassano J, Aouizerat B E, Fenwick R G, Reitz R E, Catanese J J, Leong D U, Zellner C, Sninsky J J, Topol E J, Devlin J J, Kane J P. Identification of four gene variants associated with myocardial infarction. Am J Hum Genet. 2005; 77:596-605
  • 18. Shiffman D, Rowland C M, Louie J Z, Luke M M, Bare L A, Bolonick J I, Young B A, Catanese J J, Stiggins C F, Pullinger C R, Topol E J, Malloy M J, Kane J P, Ellis S G, Devlin J J. Gene variants of VAMP8 and HNRPUL1 are associated with early-onset myocardial infarction. Arterioscler Thromb Vasc Biol. 2006; 26:1613-1618
  • 19. Iakoubova O A, Tong C H, Chokkalingam A P, Rowland C M, Kirchgessner T G, Louie J Z, Ploughman L M, Sabatine M S, Campos H, Catanese J J, Leong D U, Young B A, Lew D, Tsuchihashi Z, Luke M M, Packard C J, Zerba K E, Shaw P M, Shepherd J, Devlin J J, Sacks F M. Asp92Asn polymorphism in the myeloid IgA Fc receptor is associated with myocardial infarction in two disparate populations: CARE and WOSCOPS. Arterioscler Thromb Vasc Biol. 2006; 26:2763-2768
  • 20. Luke M M, Kane J P, Liu D M, Rowland C M, Shiffman D, Cassano J, Catanese J J, Pullinger C R, Leong D U, Arellano A R, Tong C H, Movsesyan I, Naya-Vigne J, Noordhof C, Feric N T, Malloy M J, Topol E J, Koschinsky M L, Devlin J J, Ellis S G. A polymorphism in the protease-like domain of apolipoprotein(a) is associated with severe coronary artery disease. Arterioscler Thromb Vasc Biol. 2007; 27:2030-2036
  • 21. Bare L A, Morrison A C, Rowland C M, Shiffman D, Luke M M, Iakoubova O A, Kane J P, Malloy M J, Ellis S G, Pankow J S, Willerson J T, Devlin J J, Boerwinkle E. Five common gene variants identify elevated genetic risk for coronary heart disease. Genet Med. 2007; 9:682-689
  • 22. StataCorp. Stata Statistical Software: Release 9. 2005
  • 23. Benjamini Y, Hochberg Y. Controlling the false discovery rate: A new and powerful approach to multiple testing. Journal of the Royal Statistical Society. 1995; Serials B:1289-1300
  • 24. R Development Core Team. R: A language and environment for statistical computing, reference index version 2.3.0. 2005
  • 25. Zhou S, Schuetz J D, Bunting K D, Colapietro A M, Sampath J, Morris J J, Lagutina I, Grosveld G C, Osawa M, Nakauchi H, Sorrentino B P. The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the side-population phenotype. Nat Med. 2001; 7:1028-1034
  • 26. Miranville A, Heeschen C, Sengenes C, Curat C A, Busse R, Bouloumie A. Improvement of postnatal neovascularization by human adipose tissue-derived stem cells. Circulation. 2004; 110:349-355
  • 27. Meissner K, Heydrich B, Jedlitschky G, Meyer Zu Schwabedissen H, Mosyagin I, Dazert P, Eckel L, Vogelgesang S, Warzok R W, Bohm M, Lehmann C, Wendt M, Cascorbi I, Kroemer H K. The ATP-binding cassette transporter ABCG2 (BCRP), a marker for side population stem cells, is expressed in human heart. J Histochem Cytochem. 2006; 54:215-221
  • 28. Zhang W, Mojsilovic-Petrovic J, Andrade M F, Zhang H, Ball M, Stanimirovic D B. The expression and functional characterization of ABCG2 in brain endothelial cells and vessels. Faseb J. 2003; 17:2085-2087
  • 29. Janvilisri T, Venter H, Shahi S, Reuter G, Balakrishnan L, van Veen H W. Sterol transport by the human breast cancer resistance protein (ABCG2) expressed in Lactococcus lactis. J Biol Chem. 2003; 278:20645-20651
  • 30. Janvilisri T, Shahi S, Venter H, Balakrishnan L, van Veen H W. Arginine-482 is not essential for transport of antibiotics, primary bile acids and unconjugated sterols by the human breast cancer resistance protein (ABCG2). Biochem J. 2005; 385:419-426
  • 31. Oram J F. Tangier disease and ABCA1. Biochim Biophys Acta. 2000; 1529:321-330
  • 32. Schmitz G, Langmann T, Heimerl S. Role of ABCG1 and other ABCG family members in lipid metabolism. J Lipid Res. 2001; 42:1513-1520
  • 33. Maliepaard M, van Gastelen M A, de Jong L A, Pluim D, van Waardenburg R C, Ruevekamp-Helmers M C, Floot B G, Schellens J H. Overexpression of the BCRP/MXR/ABCP gene in a topotecan-selected ovarian tumor cell line. Cancer Res. 1999; 59:4559-4563
  • 34. Mizuarai S, Aozasa N, Kotani H. Single nucleotide polymorphisms result in impaired membrane localization and reduced atpase activity in multidrug transporter ABCG2. Int J Cancer. 2004; 109:238-246
  • 35. Desjardins P R, Burkman J M, Shrager J B, Allmond L A, Stedman H H. Evolutionary implications of three novel members of the human sarcomeric myosin heavy chain gene family. Mol Biol Evol. 2002; 19:375-393
  • 36. Moisoi N, Erent M, Whyte S, Martin S, Bayley P M. Calmodulin-containing substructures of the centrosomal matrix released by microtubule perturbation. J Cell Sci. 2002; 115:2367-2379
  • 37. Tyteca D, van Ijzendoorn S C, Hoekstra D. Calmodulin modulates hepatic membrane polarity by protein kinase C-sensitive steps in the basolateral endocytic pathway. Exp Cell Res. 2005; 310:293-302
  • 38. Oury C, Sticker E, Cornelissen H, De Vos R, Vermylen J, Hoylaerts M F. ATP augments von Willebrand factor-dependent shear-induced platelet aggregation through Ca2+-calmodulin and myosin light chain kinase activation. J Biol Chem. 2004; 279:26266-26273.
  • Supplemental Analysis of SNPs in the CHS Study

In a further analysis of 77 SNPs, which include the SNPs analyzed in the CHS study described herein in Example Two along with additional SNPs found to be associated with CHD risk in a Cholesterol and Recurrent Event (CARE) trial and a WOSCOPS trial (Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-977), three additional SNPs that predict ischemic stroke risk were identified by Cox proportional hazard analysis that had one-sided p-values of <=0.05 in whites after adjusting for age and sex, and also after adjusting for all traditional risk factors including smoking, diabetes, hypertension, HDL-C, LDL-C, and BMI (similar to what was described in Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-9). These three SNPs are shown in Table 14. Also, as shown in Table 14, the hazard ratios were consistent in blacks and whites for SNPs rs2243682/hCV1624173 and rs34868416/hCV25951678.

Example Three: SNPs Associated with Noncardioembolic Stroke in the Vienna Stroke Registry

Overview

For SNPs that had been associated with coronary heart disease (CHD) in previous studies such as Atherosclerosis Risk in Communities (ARIC) (e.g., Bare, et al. (2007), Genet Med 9(10):682-9 and McPherson, et al. (2007), Science 316(5830):1488-91), carriers of the CHD risk alleles for each SNP were analyzed for increased risk of noncardioembolic stroke in the Vienna Stroke Registry (VSR). In a case-control study, 562 noncardioembolic stroke cases from VSR7 and 815 healthy controls from the city of Vienna8 were genotyped for each of the SNPs. The allele previously associated with CHD risk was pre-specified as the risk allele, and this risk allele was tested for association with noncardioembolic stroke.

It was determined that carriers of the CHD risk allele of the following four SNPs had increased risk of noncardioembolic stroke (the name of the gene or chromosome that contains each SNP is indicated in parentheses): rs3900940 (MYH15), rs20455 (KIF6), rs1010 (VAMP8), and rs10757274 (chromosome 9p21) (characteristics of these SNPs are presented in Table 16). The odds ratios (OR) for the associations of these SNPs with noncardioembolic stroke were as follows: 1.20 (90% confidence interval 0.95-1.50) for rs10757274 on chromosome 9p21, 1.24 (1.01-1.5) for rs20455 in KIF6, 1.31 (1.07-1.60) for rs3900940 in MYH15, and 1.21 (0.99-1.49) for rs1010 in VAMP8.

Subjects and Methods

Study Population

The stroke cases in VSR are consecutive Caucasian patients admitted to stroke units in Vienna within 72 hours of onset of acute ischemic stroke between October 1998 and June 2001. All patients underwent cranial CT or MRI and were documented according to a standardized protocol including stroke severity, risk factors, and medical history7. Only patients with noncardioembolic stroke were included as cases in this study. Controls were unrelated Caucasian participants in a health care program in Vienna, 45 years old or older, free of arterial vascular disease, and reported no arterial vascular diseases in first degree relatives8. Genotypes were determined as described previously9. This study complied with the Declaration of Helsinki and was approved by the Ethics Committee of Medical University Vienna. All subjects gave written informed consent.

Statistics

Differences in traditional risk factors between cases and controls were assessed by the Wilcoxon rank sum test (continuous variables) or by the chi-square test (discrete variables). Odds ratios estimated from logistic regression models were adjusted for traditional risk factors including age (at the index stroke event for cases, at enrollment for controls), sex, current smoker (versus not), diabetes mellitus (defined by a physician's diagnosis or the use of either insulin or oral hypoglycemic medications), hypertension (defined by systolic blood pressure >140 mmHg, diastolic blood pressure >90 mmHg, a physician's diagnosis of hypertension, or the use of anti-hypertensive medications), dyslipidemia (defined by a total cholesterol ≥240 mg/dL (6.2 mmol/L), LDL-C ≥160 mg/dL (4.1 mmol/L), HDL-C <40 mg/dL (1.0 mmol/L), or the use of lipid lowering medications), and body mass index (BMI). Since the purpose of this study was to determine if the same alleles found to be associated with increased risk of CHD in previous studies would be associated with increased risk of noncardioembolic stroke in VSR, one-sided p values and 90% confidence intervals (because there was 95% confidence that the true risk estimates were greater than the lower bounds of the 90% confidence intervals) were used. All other p values are two-sided. Effect sizes for carriers of the CHD risk alleles, compared with noncarriers, detectable with 90% power were calculated using QUANTO10 assuming a one-sided test and an alpha of 0.05. To account for multiple hypothesis testing, the false discovery rate q values were estimated by the method of Benjamini and Hochberg11 using the p values for CHD risk allele carrier status from the age and sex adjusted models. The q value of a given SNP represents the expected proportion of false positives among the set of SNPs with equal or lower q values.

Structure software was used to estimate both the number of subpopulations (due to ancestry) in this study and the degree of ancestry admixture for each individual subject12 based on genotypes of 130 SNPs whose minor allele frequencies ranged from 0.95% to 49.8%. The probable degree of admixture was included as a covariate in logistic regression models to adjust risk estimates for potential confounding due to population structure. Models that assumed one, two, three, or four subpopulations were tested, and replicate runs of the Structure program were performed for each model with a burn-in of 20,000 repetitions followed by 10,000 repetitions using the admixture model with independent allele frequencies and default values for other parameters.

Results

The clinical characteristics of the cases and controls are presented in Table 15. It was determined whether carriers of the alleles of SNPs that had previously been associated with increased risk of CHD2,3 were also associated with increased risk of noncardioembolic stroke. The genotype distribution of these SNPs did not deviate from Hardy Weinberg equilibrium (p >0.17). To account for multiple testing, false discovery rate q values were estimated for the SNPs. Four of the SNPs were found to be associated with noncardioembolic stroke with false discovery rate q values at or below 0.15. For these four SNPs, carriers of the CHD risk allele, compared with noncarriers, had increased risk of noncardioembolic stroke after adjusting for age and sex: the odds ratios were 1.20 (90% confidence interval (CI) 0.95-1.50) for the C9p21 SNP, 1.24 (CI 1.01-1.52) for the KIF6 SNP, 1.31 (CI 1.07-1.60) for the MYH15 SNP, and 1.21 (CI 0.99-1.49) for the VAMP8 SNP (Model 1, Table 17). On examination of the homozygous and heterozygous carriers separately, it was found that for the C9p21 SNP, the homozygous carriers (OR=1.59) in particular had increased risk (OR of heterozygous carriers=1.05). These odds ratios decreased somewhat after adjustment for additional risk factors (smoking, hypertension, diabetes, dyslipidemia, and BMI) with the exception of the odds ratio for the VAMP8 SNP which increased (Model 2, Table 17). Removal of all cases with a history of myocardial infarction (n=40) from the analysis did not appreciably change the fully adjusted odds ratios for the C9p21 homozygotes (1.45, CI 1.05-1.99), MYH15 carriers (1.24, CI 0.99-1.55), and VAMP8 carriers (1.28, CI 1.01-1.61). However, removal of cases with a history of myocardial infarction reduced the odds ratio for KIF6 carriers to 1.15 (CI 0.91-1.45).

Population structure was investigated in this study using a Bayesian clustering approach12 to evaluate models that assumed one, two, three, or four distinct subpopulations. A model assuming two subpopulations was found to result in the highest estimated log likelihood. Using the two subpopulation model, the degree of ancestry admixture was estimated for individual subjects. The fully adjusted odds ratios of the SNPs shown in Table 17 were not appreciably changed (the largest change was a decrease of 0.01 in the odds ratio for C9p21 homozygotes) when further adjusted for the ancestry of the subjects.

Discussion

It was determined that four SNPs were associated with noncardioembolic stroke after adjusting for age and sex when controlling the false discovery rate at 0.15. For these four SNPs, carriers of the CHD risk allele (G of rs10757274 on C9p21, Arg of Trp719Arg (rs20455) in KIF6, Ala of Thr1125Ala (rs3900940) in MYH15, and C of rs1010 in VAMP8) also had increased risk of noncardioembolic stroke.

MYH15 encodes myosin heavy polypeptide 15, a motor protein of the class-II sarcomeric myosin heavy chain family. The Thr1125Ala SNP is located in the coiled-coil rod domain of the MYH15 protein, and the Thr1125 residue has been shown to be phosphorylated13,14. Since the Ala1125 residue could not be phosphorylated, this substitution could affect the function of the MYH15 protein.

VAMP8 encodes vesicle associated membrane protein 8 which functions in platelet degranulation pathways15. The rs1010 SNP is located in the 3′ untranslated region of VAMP8 in a potential microRNA binding site16.

Thus, this Example demonstrates that carriers of the CHD risk allele of SNPs rs20455 in KIF6, rs3900940 in MYH15, rs1010 in VAMP8, and rs10757274 on chromosome 9p21 had increased risk of noncardioembolic stroke in VSR.

REFERENCES (CORRESPONDING TO EXAMPLE THREE)

  • 1. Rosamond W, Flegal K, Furie K, Go A, Greenlund K, Haase N, Hailpern S M, Ho M, Howard V, Kissela B, Kittner S, Lloyd-Jones D, McDermott M, Meigs J, Moy C, Nichol G, O'Donnell C, Roger V, Sorlie P, Steinberger J, Thom T, Wilson M, Hong Y: Heart disease and stroke statistics—2008 update: a report from the American Heart Association Statistics Committee and Stroke Statistics Subcommittee. Circulation 2008; 117:e25-146.
  • 2. Bare L A, Morrison A C, Rowland C M, Shiffman D, Luke M M, Iakoubova O A, Kane J P, Malloy M J, Ellis S G, Pankow J S, Willerson J T, Devlin J J, Boerwinkle E: Five common gene variants identify elevated genetic risk for coronary heart disease. Genet Med 2007; 9:682-689.
  • 3. McPherson R, Pertsemlidis A, Kavaslar N, Stewart A, Roberts R, Cox D R, Hinds D A, Pennacchio L A, Tybjaerg-Hansen A, Folsom A R, Boerwinkle E, Hobbs H H, Cohen J C: A common allele on chromosome 9 associated with coronary heart disease. Science 2007; 316:1488-1491.
  • 4. Morrison A C, Bare L A, Luke M M, Pankow J S, Mosley T H, Devlin J J, Willerson J T, Boerwinkle E: Single nucleotide polymorphisms associated with coronary heart disease predict incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. Cerebrovascular Disease 2008; 26:420-424.
  • 5. Zee R Y, Ridker P M: Two common gene variants on chromosome 9 and risk of atherothrombosis. Stroke 2007; 38:e111.
  • 6. Luke M M, O'Meara E S, Rowland C M, Shiffman D, Bare L A, Arellano A R, Longstreth W T, Jr., Lumley T, Rice K, Tracy R P, Devlin J J, Psaty B M: Gene Variants Associated With Ischemic Stroke. The Cardiovascular Health Study. Stroke 2008.
  • 7. Lang W: The Vienna Stroke Registry—objectives and methodology. The Vienna Stroke Study Group. Wien Klin Wochenschr 2001; 113:141-147.
  • 8. Lalouschek W, Lang W, Mullner M: Current strategies of secondary prevention after a cerebrovascular event: the Vienna stroke registry. Stroke 2001; 32:2860-2866.
  • 9. Shiffman D, Ellis S G, Rowland C M, Malloy M J, Luke M M, Iakoubova O A, Pullinger C R, Cassano J, Aouizerat B E, Fenwick R G, Reitz R E, Catanese J J, Leong D U, Zellner C, Sninsky J J, Topol E J, Devlin J J, Kane J P: Identification of four gene variants associated with myocardial infarction. Am J Hum Genet 2005; 77:596-605.
  • 10. QUANTO: Release 1.1 A computer program for power and sample size calculations for genetic epidemiology studies. Gauderman WJMJ. 2006.
  • 11. Benjamini Y, Hochberg Y: Controlling the false discovery rate: A new and powerful approach to multiple testing. Journal of the Royal Statistical Society 1995; Serials B:1289-1300.
  • 12. Pritchard J K, Stephens M, Donnelly P: Inference of population structure using multilocus genotype data. Genetics 2000; 155:945-959.
  • 13. Gnad F, Ren S, Cox J, Olsen J V, Macek B, Oroshi M, Mann M: PHOSIDA (phosphorylation site database): management, structural and evolutionary investigation, and prediction of phosphosites. Genome Biol 2007; 8:R250.
  • 14. Olsen J V, Blagoev B, Gnad F, Macek B, Kumar C, Mortensen P, Mann M: Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell 2006; 127:635-648.
  • 15. Polgar J, Chung S H, Reed G L: Vesicle-associated membrane protein 3 (VAMP-3) and VAMP-8 are present in human platelets and are required for granule secretion. Blood 2002; 100:1081-1083.
  • 16. Shiffman D, Rowland C M, Louie J Z, Luke M M, Bare L A, Bolonick J I, Young B A, Catanese J J, Stiggins C F, Pullinger C R, Topol E J, Malloy M J, Kane J P, Ellis S G, Devlin J J: Gene variants of VAMP8 and HNRPUL1 are associated with early-onset myocardial infarction. Arterioscler Thromb Vasc Biol 2006; 26:1613-1618.
  • 17. Helgadottir et al.: The same sequence variant on 9p21 associates with myocardial infarction, abdominal aortic aneurysm and intracranial aneurysm. Nat Genet 2008; 40:217-224.

Supplemental Analysis of SNPs in the Vienna Stroke Registry

In a further analysis, the genotype of 19 SNPs (which were previously found to be associated with incident CHD in white or black participants of the ARIC study) were determined in the cases and controls of the Vienna Stroke Registry (“VSR”, approximately 764 ischemic stroke cases which included 562 atherothrombotic stroke cases, and 815 controls who were 45 or older from the same region).

As shown in Table 18, the risk alleles (which were associated with CHD in ARIC) for certain of these 19 SNPs were found to be associated (2-sided p-value of <0.2) with ischemic stroke (labeled “ischemic” in the “outcome” column of Table 18), atherothrombotic stroke (labeled “athero” in the “outcome” column of Table 18), and/or early-onset stroke (labeled “early-onset” in the “outcome” column of Table 18) in VSR before and/or after adjustment for traditional risk factors such as age, sex, body mass index, smoking, diabetes, impaired fasting glucose, hypertension, LDL-cholesterol, and HDL-cholesterol (results after adjustment are labeled “yes” and results before adjustment are labeled “no” in the “adjust?” column of Table 18) (the p-values shown in Table 18 are two-sided p-values; thus, the one-sided p-values for these SNPs are half of these two-sided p-values).

Early-onset stroke is ischemic stroke that occurs early in life. As used herein, early-onset stroke is defined as those stroke events that happened before the median stroke age of the ischemic cases. The controls for these early-onset cases are those controls who were at ages above the median age of all controls in the study (i.e., young cases versus old controls was the study design).

Example Four: SNPs Associated with Stroke in the UCSF/CCF Study

The allele frequencies of 25,878 putative functional SNPs were determined in atherothrombotic stroke cases and healthy controls of the Vienna Stroke Registry (“VSR”, about 562 cases and 815 controls, Study ID V0031), and the allele frequencies of about 3,300 of these 25,878 SNPs were found to be associated with atherothrombotic (noncardioembolic) stroke (2-sided p value of less than or equal to 0.05). These 3,300 SNPs were then further tested in a stroke study of cases with a history of stroke and controls with no history of stroke or myocardial infarction from the UCSF and the CCF sample sets (Study ID GS41). The allele frequencies of 292 of these 3,300 SNPs were again associated with stroke risk (1-sided p<0.05) in the UCSF/CCF stroke study (approximately 570 cases and 1604 controls), and the risk alleles were the same in VSR and in UCSF/CCF studies. These stroke associations were then confirmed by individually genotyping the 292 SNPs in VSR subjects, and 101 of these SNPs were again found to be associated with stroke risk (p<0.05 in allelic, additive, dominant, or recessive mode). These 101 SNPs were then genotyped in the UCSF/CCF stroke study and it was determined that 61 of these SNPs were still associated with stroke in the UCSF/CCF study (1-sided p<0.05 or 2-sided p<0.1) and have the same risk allele as in the VSR study.

These 61 SNPs and the stroke association data in both the UCSF/CCF and the VSR studies are provided in Table 19. These SNPs were further analyzed in additional sample sets, as discussed below in Examples Five, Six, and Seven.

Example Five: SNPs Associated with Stroke in the German West Study

The identification of 61 SNPs that are associated with stroke in both of two case-control studies (Vienna Stroke Registry and the UCSF/CCF Stroke Study) is described in Example Four above. Here, Example Five describes the analysis of these 61 SNPs, plus 17 additional SNPs, in the German West Study (which may be interchangeably referred to herein as the “Muenster” Stroke Study).

The German West Study, which is a stroke case-control study, included 1,300 ischemic stroke cases and 1,000 healthy controls. The ischemic stroke cases were further classified by TOAST criteria into several stroke subtypes, allowing analyses of the association of genotypes of the tested SNPs with the following endpoints: 1) ischemic stroke (outcome: “ischemic_stk” in Tables 20-21), 2) noncardioembolic stroke (outcome: “nonce_stk” in Tables 20-21; ischemic stroke that were not cardioembolic in origin), 3) cardioembolic stroke (outcome: “CE_stk” in Tables 20-21), 4) atherothrombotic stroke (outcome: “athero_stk” in Tables 20-21), 5) Lacunar stroke (outcome: “lacunar_stk” in Tables 20-21), 6) no heart disease stroke (outcome: “nohd_stk” in Tables 20-21; ischemic stroke cases excluding those with a history of heart disease), 7) recurrent stroke (outcome: “recurrent_stk” in Tables 20-21; stroke cases that also had a prior history of stroke), and 8) early onset stroke (outcome: “EO_stk” in Tables 20-21; cases that are younger than the median age of all cases, and controls that were older than the median age of all controls).

Potential population stratification was also adjusted for (in addition to traditional risk factors) in assessing the risk estimates of the SNPs. The risk allele of each of the SNPs tested in this study was pre-specified to be the same as in antecedent studies, and a 2-sided p-value of less than 0.1 (equivalent to 1-sided p-values less than 0.05) or a 2-sided p-value less than 0.2 (equivalent to 1-sided p-values less than 0.1) were used as cutoffs for statistical significance.

SNPs that showed significant association with stroke risk in the German West Study are provided in Tables 20-21. Table 20 provides SNPs associated with stroke that have the same risk allele and 2-sided p-values that are less than 0.1 (equivalent to 1-sided p-values that are less than 0.05), and Table 21 provides SNPs associated with stroke that have the same risk allele and 2-sided p-values that are between 0.1 and 0.2 (equivalent to 1-sided p-values that are between 0.05 and 0.1).

Supplemental Analysis of SNPs in the German West Study

Overview and Results

Also in the German West Study, SNPs were identified that are associated with noncardioembolic stroke in three large study populations (the German West Study, as well as in the Vienna and UCSF/CCF Studies described above). A case-control study design was used: the Vienna Study, the UCSF/CCF Study, and the German West Study (728 noncardioembolic stroke cases, 1,041 controls). It was determined whether the alleles of those SNPs that were associated with increased risk in both the Vienna and UCSF/CCF studies were also associated with increased risk in the German West Study (thus, 1-sided tests of significance were used). Logistic regression analysis adjusting for age, sex, hypertension, and diabetes was performed.

Four SNPs were determined to be associated with noncardioembolic stroke (p<0.05) in the German West Study (before correcting for multiple testing—46 SNPs and 3 genetic models), as well as also being associated with noncardioembolic stroke in the UCSF/CCF and Vienna studies described above. These four SNPs (and the genes which they are in or near) are as follows: rs544115 in NEU3, rs1264352 near DDR1, rs10948059 in GNMT, and rs362277 in HD. An increased risk for noncardioembolic stroke was observed for carriers of the following genotypes, compared with noncarriers, for each of these four SNPs (with carrier frequency in controls, odds ratio, and 90% confidence interval indicated): CT or CC carriers of rs544115 (96.0% of controls, OR 2.39, CI 1.31-4.36), CG or CC carriers of rs1264352 (23.9% of controls, OR 1.38, CI 1.08-1.76), CT or CC carriers of rs10948059 (77% of controls, OR 1.38, CI 1.06-1.79), and CC carriers of rs362277 (80.0% of controls, OR 1.39, CI 1.05-1.84). After correcting for multiple testing, this set of 4 SNPs had a false discovery rate (FDR) of 0.67.

Subjects and Methods

Study Subjects

Subjects in all three studies (the German West Study, as well as the Vienna and UCSF/CCF Studies) were unrelated men and women of European decent and have given written informed consent. In the Vienna Study, the noncardioembolic stroke cases (defined as ischemic stroke cases that are not of cardioembolic origin, and included large vessel and small vessel stroke) were drawn from the Vienna Stroke Registry (VSR). Stroke cases in VSR were consecutive Caucasian patients admitted to stroke units in Vienna within 72 hours of onset of acute ischemic stroke between October 1998 and June 2001. All patients underwent cranial CT or MRI and were documented according to a standardized protocol including stroke severity, risk factors, and medical history. Controls were unrelated Caucasian participants in a health care program in Vienna, 45 years old or older, free of arterial vascular disease, and reported no arterial vascular diseases in first degree relatives. This study complied with the Declaration of Helsinki and was approved by the Ethics Committee of Medical University Vienna.

The UCSF/CCF study included 416 cases and 977 controls drawn from Genomic Resource at University of California San Francisco (UCSF) as well as 154 cases and 627 controls drawn from the Genebank of Cleveland Clinic Foundation (CCF). Cases in the UCSF/CCF study did not have stroke subtype information. To enrich for noncardioembolic stroke cases, patients with a history of stroke were excluded who also had a history of heart rhythm or heart valve diseases that could have lead to cardioembolic stroke. Cases from UCSF had a history of stroke and no history of abnormal heart rhythm, heart valve disease or surgery. Controls from UCSF did not have a history of stroke, atherectomy, or CHD (including coronary stenosis, myocardial infarction, or coronary revascularization procedures). Cases and controls from CCF were patients who have had coronary angiography. Cases had a history of stroke and no history of atrial fibrillation, heart valve disease, or surgery. Controls did not have a history of stroke or CHD (including myocardial infarction, coronary stenosis greater than 50%, peripheral vascular disease, or revascularization procedures).

The German West Study included 728 noncardioembolic cases (ischemic strokes that were not of cardioembolic origin) from Westphalia Stroke Registry and 1,041 controls from the same region of Germany recruited by the Dortmund Health Study for the noncardioembolic stroke analysis. For the cardioembolic stroke analysis, 462 cardioembolic stroke cases (ischemic strokes of cardioembolic origin), also enrolled in the Westphalia Stroke Registry, were compared with the same 1401 controls from the Dortmund Health Study.

Statistics

Differences in traditional risk factors between cases and controls were assessed by the Wilcoxon rank sum test (continuous variables) or by the chi-square test (discrete variables). Odds ratios for the Vienna Study or the UCSF/CCF Study were not adjusted, and odds ratios for the German West Study were estimated from logistic regression models and adjusted for traditional risk factors including age (at the index stroke event for cases, at enrollment for controls), sex, diabetes mellitus (defined by a physician's diagnosis or the use of either insulin or oral hypoglycemic medications), hypertension (defined by systolic blood pressure >140 mmHg, diastolic blood pressure >90 mmHg, a physician's diagnosis of hypertension, or the use of anti-hypertensive medications). To account for multiple hypothesis testing, the false discovery rate (FDR) q values were estimated by the method of Benjamini and Hochberg (Journal of the Royal Statistical Society 1995; Serials B:1289-1300) using the p-values for risk genotype carrier status from the model adjusted for age, sex, hypertension, and diabetes.

Example Six: SNPs Associated with Stroke or Statin Response in CARE or PROSPER Studies

The identification of 61 SNPs that are associated with stroke in both of two case-control studies (Vienna Stroke Registry and the UCSF/CCF Stroke Study) is described in Example Four above. Example Five above describes the analysis of these 61 SNPs plus 17 additional SNPs in the German West Study. Here, Example Six describes the analysis of SNPs for association with stroke risk and stroke statin response (SSR) in two pravastatin trials: CARE (“Cholesterol and Recurrent Events” study, which is comprised of individuals who have previously had an MI) and PROSPER (“Prospective Study of Pravastatin in the Elderly at Risk” study, which is comprised of elderly individuals with or without a history of cardiovascular disease (CVD)).

In CARE, SNPs were analyzed for association with stroke risk or SSR. SNPs that were significantly associated with stroke risk or SSR in CARE (which were also associated with stroke risk in the German West Study described above in Example Five) are provided in Table 22 (stroke risk) and Table 23 (SSR). Additional SNPs that were significantly associated with stroke risk or SSR in CARE are provided in Table 24 (stroke risk) and Table 25 (SSR). Further SNPs that were significantly associated with stroke risk or SSR in CARE are provided in Table 26 (stroke risk) and Table 27 (SSR).

Table 26 shows that, for example, individuals in CARE who were G/G homozygotes at the CALM1 SNP (rs3814843/hCV11474611) had an increased risk for stroke (HR=7.54 with a 2-sided p-value of 0.0441 for genotypic mode and adjusted for statin use; HR=7.43 with a 2-sided p-value of 0.0455 for recessive mode and adjusted for statin use; HR=6.64 with a 2-sided p-value of 0.0606 for genotypic mode and unadjusted; and HR=6.67 with a 2-sided p-value of 0.0599 for recessive mode and unadjusted).

Results of the analysis of the MYH15 SNP (rs3900940/hcv7425232) for association with stroke risk in CARE are provided in Table 28. Table 28 shows that, for example, individuals in CARE who were C/C homozygotes at the MYH15 SNP (rs3900940/hcv7425232) had an increased risk for stroke (HR=1.403 with a 2-sided p-value of 0.153 when adjusted for statin use; HR=1.51 with a 2-sided p-value of 0.086 when adjusted for traditional risk factors, BMI, and statin use; and HR=1.49 with a 2-sided p-value of 0.094 when adjusted for CHD, traditional risk factors, BMI, and statin use). All the p-values (including Pint values) provided in Tables 22-28 are two-sided p-values.

In PROSPER, SNPs were analyzed for association with stroke risk or SSR, in the whole study cohort (strata: “ALL”), or in the subgroup with a history of CVD (strata: “hist”) or without a CVD history (strata: “no hist”). SNPs were considered significantly associated with stroke risk if they met the p-value cutoffs and had the same risk allele as in antecedent studies (e.g., as described herein in Examples Four, Five, and Six), and these SNPs that are significantly associated with stroke risk are provided in Tables 29-30. Specifically, Table 29 lists SNPs associated with stroke risk that have P_all <0.2 (which is the p-value based on the entire study cohort), and Table 30 lists SNPs associated with stroke risk that have P_placebo <0.2 (which is the p-value based on just the placebo arm of the trial). For SSR, the results of the analyses of pravastatin-treated versus placebo-treated individuals are provided in Table 31 (which lists SNPs having Pint<0.1) and Table 32 (which lists SNPs having Pint<0.2). All the p-values (including Pint values) provided in Tables 29-32 are two-sided p-values (two-sided p-value cutoffs of 0.1 and 0.2 are equivalent to one-sided p-value cutoffs of 0.05 and 0.1, respectively).

Table 30 shows that, for example, individuals in PROSPER who were A/G heterozygotes at the chromosome 9p21 SNP (rs1075727/hCV26505812) had an increased risk for stroke (HR=1.464 with a 2-sided p-value of 0.035 based on the placebo group; see the first row for rs10757274/hCV26505812 in Table 30).

Table 30 also shows that, for example, individuals in PROSPER who were T/T homozygotes at the chromosome 4q25 SNP (rs2200733/hCV16158671) had an increased risk for stroke (HR=3.711 with a 2-sided p-value of 0.025 based on the placebo group).

Also in the CARE and PROSPER trials, the chromosome 9p21 SNP rs10757274 (hCV26505812) was analyzed further for association with SSR, including unadjusted and adjusted analysis. Adjusted analysis in CARE (Table 37) was adjusted for age, gender, smoking status, hypertension, diabetes, body mass index (BMI), and LDL and HDL levels, and adjusted analysis in PROSPER (Table 38) was adjusted for country, gender, age, LDL, HDL, smoking status (current vs. past or never), history of hypertension, and diabetes. Table 37 provides results in CARE, and Table 38 provides results in PROSPER (whether each analysis is unadjusted or adjusted is indicated in the “adjust” column in Table 37, or by “unadj” and “adj” column labels in Tables 38). All the p-values (including Pint values) provided in Tables 37-38 are two-sided p-values.

In CARE, among the three genotypes of SNP rs1075727 (homozygous carriers of each of the two alternative alleles plus heterozygous carriers), the heterozygous carriers of SNP rs10757274 (49% genotype frequency) had the greatest reduction in the number of stroke events (HR=0.61) upon pravastatin treatment after adjusting for traditional risk factors (2-sided p-value=0.034, and the genotype by treatment interaction had a 2-sided p-interaction value (“pval_intx” or Pint)=0.44; see the 13th row under the column headings in Table 37). In PROSPER, heterozygous carriers of the G allele (risk allele) at SNP rs1075727 in the placebo arm had an increased stroke risk (for example, see the first row for rs10757274/hCV26505812 in Table 30), as indicated above. Furthermore, in PROSPER, after stratifying by rs10757274 genotype, heterozygous carriers of this SNP (51% of the population) also had the greatest reduction in the number of stroke events (unadjusted HR=0.777) in the pravastatin-treated versus the placebo-treated arms of the trial (2 sided p-value=0.066; see the 3rd row under the column headings in Table 38), whether unadjusted or adjusted for traditional risk factors.

Example Seven: SNPs Associated with Stroke in the Cardiovascular Health Study (CHS)

The identification of 61 SNPs that are associated with stroke in both of two case-control studies (Vienna Stroke Registry and the UCSF/CCF Stroke Study) is described in Example Four above. Example Five above describes the analysis of these 61 SNPs plus 17 additional SNPs in the German West Study. Here, Example Seven describes the analysis of SNPs previously found to be associated with stroke (e.g., in Examples Four, Five, and/or Six above) for association with incident stroke events in the Cardiovascular Health Study (CHS), which is a population-based study of elderly white or black participants in the United States. Association was analyzed for three related stroke end points: stroke (all subtypes) (endpoint: “stroke” in Tables 33-36), ischemic stroke (excludes hemorrhagic stroke) (endpoint: “ischem” in Tables 33-36), and atherothrombotic stroke (excludes hemorrhagic stroke and cardioembolic stroke) (endpoint: “athero” in Tables 33-36).

The results in the CHS Study are provided in Tables 33-36. Specifically, SNPs that are associated with stroke risk in white or black individuals with 2-sided p-values less than 0.1 (equivalent to 1-sided p-values less than 0.05) are provided in Table 33 (white individuals) and Table 34 (black individuals), and SNPs that are associated with stroke in white or black individuals with 2-sided p-values between 0.1 and 0.2 (equivalent to 1-sided p-values between 0.05 and 0.1) are provided in Table 35 (white individuals) and Table 36 (black individuals).

Example Eight: Additional LD SNPs Associated with Stroke

Another investigation was conducted to identify SNPs in linkage disequilibrium (LD) with certain “interrogated SNPs” which have been found to be associated with stroke, as described herein and shown in the tables. The interrogated SNPs are shown in column 1 (which indicates the hCV identification numbers of each interrogated SNP) and column 2 (which indicates the public rs identification numbers of each interrogated SNP) of Table 4. The methodology is described earlier in the instant application. To summarize briefly, the power threshold (T) was set at an appropriate level, such as 51%, for detecting disease association using LD markers. This power threshold is based on equation (31) above, which incorporates allele frequency data from previous disease association studies, the predicted error rate for not detecting truly disease-associated markers, and a significance level of 0.05. Using this power calculation and the sample size, a threshold level of LD, or r2 value, was derived for each interrogated SNP (rT2, equations (32) and (33) above). The threshold value rT2 is the minimum value of linkage disequilibrium between the interrogated SNP and its LD SNPs possible such that the non-interrogated SNP still retains a power greater or equal to T for detecting disease association.

Based on the above methodology, LD SNPs were found for the interrogated SNPs. Several exemplary LD SNPs for the interrogated SNPs are listed in Table 4; each LD SNP is associated with its respective interrogated SNP. Also shown are the public SNP IDs (rs numbers) for the interrogated and LD SNPs, when available, and the threshold r2 value and the power used to determine this, and the r2 value of linkage disequilibrium between the interrogated SNP and its corresponding LD SNP. As an example in Table 4, the interrogated, stroke-associated SNP rs11580249 (hCV11548152) was calculated to be in LD with rs12137135 (hCV30715059) at an r2 value of 0.4781, based on a 51% power calculation, thus establishing the latter SNP as a marker associated with stroke as well.

In general, the threshold rT2 value can be set such that one of ordinary skill in the art would consider that any two SNPs having an r2 value greater than or equal to the threshold rT2 value would be in sufficient LD with each other such that either SNP is useful for the same utilities, such as determining an individual's risk for stroke. For example, in various embodiments, the threshold rT2 value used to classify SNPs as being in sufficient LD with an interrogated SNP (such that these LD SNPs can be used for the same utilities as the interrogated SNP, for example, such as determining stroke risk) can be set at, for example, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 0.96, 0.97, 0.98, 0.99, 1, etc. (or any other r2 value in-between these values). Threshold rT2 values may be utilized with or without considering power or other calculations.

All publications and patents cited in this specification are herein incorporated by reference in their entirety. Various modifications and variations of the described compositions, methods and systems of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments and certain working examples, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the above-described modes for carrying out the invention that are obvious to those skilled in the field of molecular biology, genetics and related fields are intended to be within the scope of the following claims.

TABLE 3
Marker Alleles Primer 1 (Allele-specific Primer) Primer 2 (Allele-specific Primer) Common Primer
hCV1022614 C/T CTGCAGCCTCTCCTACG (SEQ ID NO: 1567) CCTGCAGCCTCTCCTACA (SEQ ID NO: 1568) GATTCCCCATCGGTCATAA (SEQ ID NO: 1569)
hCV1053082 C/T TTGCAGAGAAGCGTTCC (SEQ ID NO: 1570) CTTTGCAGAGAAGCGTTCT (SEQ ID NO: 1571) CTGAGCTTTGTGAAGAGAAACTGA (SEQ ID
NO: 1572)
hCV1116757 C/T GACAAACTGAGGGACAACG (SEQ ID NO: 1573) GACAAACTGAGGGACAACA (SEQ ID NO: 1574) CCTCTGACAGACGCTTCTTGA (SEQ ID NO: 1575)
hCV1116793 C/T GGAAGGTCATCCTGGG (SEQ ID NO: 1576) GGAAGGTCATCCTGGA (SEQ ID NO: 1577) CGAAGAGTTTCTGTGTGGTACAG (SEQ ID NO: 1578)
hCV11354788 C/T TGAGACGGGTGGTAACC (SEQ ID NO: 1579) TTGAGACGGGTGGTAACT (SEQ ID NO: 1580) CAGCTTTGAAGGGCATCCATATGA (SEQ ID
NO: 1581)
hCV11425801 C/T TCCCACACCACCTGC (SEQ ID NO: 1582) CTCCCACACCACCTGT (SEQ ID NO: 1583) GCCACCACAATGTCTCTCAATAC (SEQ ID NO: 1584)
hCV11425842 C/T CCGCTCCGCACTTAAAG (SEQ ID NO: 1585) CCGCTCCGCACTTAAAA (SEQ ID NO: 1586) CCTGCAGCTGGACAGACTC (SEQ ID NO: 1587)
hCV11450563 G/T TAAAGAATGCATAAATTAGTGTGG TTAAAGAATGCATAAATTAGTGTGT GATCCTAATTGGATTTGAAGACTTA
(SEQ ID NO: 1588) (SEQ ID NO: 1589) (SEQ ID NO: 1590)
hCV11474611 G/T ATCGCCCATGTGCTG (SEQ ID NO: 1591) CATCGCCCATGTGCTT (SEQ ID NO: 1592) TCAAACCAGGAACCCTATCT (SEQ ID NO: 1593)
hCV11548152 G/T CTGTAAACGCTGGTCTGG (SEQ ID NO: 1594) ACTGTAAACGCTGGTCTGT (SEQ ID NO: 1595) CCTTGTCCCTGATTGCTTCTTCA (SEQ ID NO: 1596)
hCV11738775 C/T CCCCGCTTCAACACG (SEQ ID NO: 1597) TCCCCGCTTCAACACA (SEQ ID NO: 1598) AACTTCATTCGGCACTTGCTACAA
(SEQ ID NO: 1599)
hCV11758801 C/G AGTACCTCTTGGTCTCTCTCC AGTACCTCTTGGTCTCTCTCG GCATGTTGTGTTTCTGATTGTAC (SEQ ID NO: 1602)
(SEQ ID NO: 1600) (SEQ ID NO: 1601)
hCV11861255 A/G AAAGGGCCGAGCTGATA (SEQ ID NO: 1603) AGGGCCGAGCTGATG (SEQ ID NO: 1604) GGGAGGTTTGGAGAGAGAGTAT (SEQ ID NO: 1605)
hCV12071939 G/T GACCGTGGTCCCTTG (SEQ ID NO: 1606) TGACCGTGGTCCCTTT (SEQ ID NO: 1607) CGCCCGGAGACAGAA (SEQ ID NO: 1608)
hCV1209800 G/T TAGCAACTGCTATCAATGACAG TAGCAACTGCTATCAATGACAT AGTGAAGGAGTTAACTGAGTGTGTA
(SEQ ID NO: 1609) (SEQ ID NO: 1610) (SEQ ID NO: 1611)
hCV1262973 A/G TGGGTCCCAAGCTCAT (SEQ ID NO: 1612) TGGGTCCCAAGCTCAC (SEQ ID NO: 1613) GGCTCGCCGACACTG (SEQ ID NO: 1614)
hCV1305848 A/G ACATTTATACCATTTCCCGAGT (SEQ ID ACATTTATACCATTTCCCGAGC GCCTAACAACAGTACCTACTCCATAGG
NO: 1615) (SEQ ID NO: 1616) (SEQ ID NO: 1617)
hCV1348610 A/G CATTTGTCCTAAAAGTACCTCTCT CATTTGTCCTAAAAGTACCTCTCC CAAGGCTAAGCATGCTGAACACA (SEQ ID NO: 1620)
(SEQ ID NO: 1618) (SEQ ID NO: 1619)
hCV1408483 C/T TGCTAAGGCCTGTGAAC (SEQ ID NO: 1621) TTGCTAAGGCCTGTGAAT (SEQ ID NO: 1622) TCTGTTTTCGCTGGAGTCTT (SEQ ID NO: 1623)
hCV1452085 A/C ACACCCTGACACCTCTTTTACT (SEQ ID NO: 1624) ACCCTGACACCTCTTTTACG (SEQ ID NO: 1625) CGTTCCAGTCCATATTCACAT (SEQ ID NO: 1626)
hCV1463226 C/T ATTTCCTCCCTCACATGATAC (SEQ ID NO: 1627) ATTTCCTCCCTCACATGATAT TCAAAGAATGAAGAGTGAAGACA (SEQ ID NO: 1629)
(SEQ ID NO: 1628)
hCV15752716 C/T ACGCTGCTGTTCCG (SEQ ID NO: 1630) ACGCTGCTGTTCCA (SEQ ID NO: 1631) CAGACAGACAACAATTCAGAAGAA
(SEQ ID NO: 1632)
hCV15770510 G/T TGAAGACTGATTGTTGTACTTGC CTGAAGACTGATTGTTGTACTTGA TGGTGGAGAGGGTTGTAGAA (SEQ ID NO: 1635)
(SEQ ID NO: 1633) (SEQ ID NO: 1634)
hCV15851766 A/G GAGTTTTCGCCATCCACT (SEQ ID NO: 1636) GTTTTCGCCATCCACC (SEQ ID NO: 1637) GAATCTGCTTCATTTGAATCTCT (SEQ ID NO: 1638)
hCV15854171 C/T TTGGTGTTTCCTTGTGACAC (SEQ ID NO: 1639) TTGGTGTTTCCTTGTGACAT (SEQ ID NO: 1640) CCTAGTGTTTGCAATCTCATTTATC (SEQ
ID NO: 1641)
hCV15857769 C/T CACTCCTAAGTGAGCAGC (SEQ ID NO: 1642) ATCACTCCTAAGTGAGCAGT (SEQ ID NO: 1643) CTGCTTCAGTGTTATCTCAGTCTT
(SEQ ID NO: 1644)
hCV15879601 C/T CCACCAGGATGTAACAGTCC (SEQ ID NO: 1645) CCCACCAGGATGTAACAGTCT TGTGGATGCAGCAGTGAC (SEQ ID NO: 1647)
(SEQ ID NO: 1646)
hCV16093418 A/G CAAGAAGTTCACAGCTGAAGA (SEQ ID NO: 1648) AAGAAGTTCACAGCTGAAGG (SEQ ID NO: 1649) CCTGCTGGAGAGACAGAGTG (SEQ ID NO: 1650)
hCV16134786 A/G GGCAGGGGTGAGATTGA (SEQ ID NO: 1651) GGCAGGGGTGAGATTGG (SEQ ID NO: 1652) GTCGTGAGGTCAGATGCTATGAG (SEQ ID NO: 1653)
hCV16158671 C/T CTTAAATATTACCTGTTCTAATTTTCTCTG (SEQ ID CCTTAAATATTACCTGTTCTAATTTTCTCTA  GAAATGCTGTGGGAACATAAACTAACTAGG
NO: 1654) (SEQ ID NO: 1655) (SEQ ID NO: 1656)
hCV16164743 A/C GAGCAATAGTAAGTATACACAATGAAATAA (SEQ ID GAGCAATAGTAAGTATACACAATGAAATAC (SEQ GATCACGGGCCTCTAGATTGATTACA
NO: 1657) ID NO: 1658) (SEQ ID NO: 1659)
hCV1619596 A/G GAGGAGCCCGTTGCA (SEQ ID NO: 1660) AGGAGCCCGTTGCG (SEQ ID NO: 1661) TCACCATGCACAAGGACA (SEQ ID NO: 1662)
hCV1624173 A/G TGGACAACAGCACCTTAT (SEQ ID NO: 1663) TGGACAACAGCACCTTAC (SEQ ID NO: 1664) TTCCAGAGGTTCCTTCAATC (SEQ ID NO: 1665)
hCV16336 C/T CCCCTCAAGCACTCTGAC (SEQ ID NO: 1666) CCCCTCAAGCACTCTGAT (SEQ ID NO: 1667) TCTGCCCCTCGTCTTTCTCT (SEQ ID NO: 1668)
hCV1690777 A/G GGCTTTACAGAAGGAAATGCT (SEQ ID NO: 1669) GCTTTACAGAAGGAAATGCC (SEQ ID NO: 1670) GCATGCGCTGAATTTTATATAG (SEQ ID NO: 1671)
hCV1723718 A/G CAGCCGTTTCTTCATATAATCCA AGCCGTTTCTTCATATAATCCG CTTGCTAATTCATTCTGTGACCTCAAT
(SEQ ID NO: 1672) (SEQ ID NO: 1673) (SEQ ID NO: 1674)
hCV1746715 A/G GCGCCTTTCTGTGTAGTT (SEQ ID NO: 1675) GCGCCTTTCTGTGTAGTC (SEQ ID NO: 1676) CACAACAGTTGTTAAGTTGTTAGCAAACC
(SEQ ID NO: 1677)
hCV1754669 A/G TTCAGGCCATCTTGCAAAT (SEQ ID NO: 1678) TCAGGCCATCTTGCAAAC (SEQ ID NO: 1679) CTCATGGCCCGATGATTTTCAGTTA
(SEQ ID NO: 1680)
hCV1846459 C/T CAGGCTCGTCTTGAACTC (SEQ ID NO: 1681) CAGGCTCGTCTTGAACTT (SEQ ID NO: 1682) CAAGAGTGGGAACTGCAGGTTT (SEQ ID NO: 1683)
hCV1958451 G/T GTGGGAGTCTTATGTTTGTAGATG GTGGGAGTCTTATGTTTGTAGATT GCTTGACAATGCGCAGTTGT (SEQ ID NO: 1686)
(SEQ ID NO: 1684) (SEQ ID NO: 1685)
hCV2091644 C/T TTCTGGGGCATACAACG (SEQ ID NO: 1687) CTTCTGGGGCATACAACA (SEQ ID NO: 1688) AGGGACAACCCTCCATAAA (SEQ ID NO: 1689)
hCV2121658 A/G AGTGGAGATTTAGCACCAGA (SEQ ID NO: 1690) GTGGAGATTTAGCACCAGG (SEQ ID NO: 1691) GTACATTTTGGATTGGGAGAGGATAT
(SEQ ID NO: 1692)
hCV2169762 G/T CGAGTCGGTCTGCTGC (SEQ ID NO: 1693) CGAGTCGGTCTGCTGA (SEQ ID NO: 1694) TGCCTACCTCATTCCATCTG (SEQ ID NO: 1695)
hCV2192261 C/T CCTACCTTGAATTCACCTATCTG CCTACCTTGAATTCACCTATCTA CATTTCCAAATCAGAAACATGA (SEQ ID NO: 1698)
(SEQ ID NO: 1696) (SEQ ID NO: 1697)
hCV22275299 C/G GCAACTTGTTGAATGCCAG (SEQ ID NO: 1699) GCAACTTGTTGAATGCCAC (SEQ ID NO: 1700) GTGCTGTCACACCCAAGAAGTAC (SEQ ID NO: 1701)
hCV2358247 A/G GGTTGGGCGTAAGGGTT (SEQ ID NO: 1702) GGTTGGGCGTAAGGGTC (SEQ ID NO: 1703) CCCTAGCTTTGCATAAATCATAC (SEQ ID NO: 1704)
hCV2390937 A/C GTGGAAATGCAAGCTCTTCA (SEQ ID NO: 1705) TGGAAATGCAAGCTCTTCC (SEQ ID NO: 1706) CCAGATCGCTTTGGTAAAGGATTAA
(SEQ ID NO: 1707)
hCV2442143 C/T ATTTAAGCATCATAGCATACCAC ATTTAAGCATCATAGCATACCAT  TGGTACACCATAAATCTTGACTTAC
(SEQ ID NO: 1708) (SEQ ID NO: 1709) (SEQ ID NO: 1710)
hCV25473186 C/T ATCTTCACAGTGTTCCACATC (SEQ ID ATCTTCACAGTGTTCCACATT TTCTGACCTCCAGGTTCTTT (SEQ ID NO: 1713)
NO: 1711) (SEQ ID NO: 1712)
hCV25596936 C/T GGCAGGCGAAGAGTCAC (SEQ ID NO: 1714) GGCAGGCGAAGAGTCAT (SEQ ID NO: 1715) GGGTCAATCCACAGTCTAGATG (SEQ ID NO: 1716)
hCV25609987 A/G TGAGCAGGTAGCCTGTATTT (SEQ ID NO: 1717) TGAGCAGGTAGCCTGTATTC (SEQ ID NO: 1718) TGCTGCCTTGGTTGTGA (SEQ ID NO: 1719)
hCV25615822 C/T CGGATCTTCTCCAGCG (SEQ ID NO: 1720) CCGGATCTTCTCCAGCA (SEQ ID NO: 1721) TGAAGCCACATCCTTCTTTAT (SEQ ID NO: 1722)
hCV25623804 A/G TTTCAAGCTGTCTCCTACCAT (SEQ ID NO: 1723) TTTCAAGCTGTCTCCTACCAC GGAGAGAAGGGAAGGACTAAAG (SEQ ID NO: 1725)
(SEQ ID NO: 1724)
hCV25637605 A/G GCGGCTCTGCACAT (SEQ ID NO: 1726) GCGGCTCTGCACAC (SEQ ID NO: 1727) GCGGGTGGCTCCTTTAA (SEQ ID NO: 1728)
hCV25651109 C/G GGTCCTGCTTGATGCG (SEQ ID NO: 1729) AGGTCCTGCTTGATGCC (SEQ ID NO: 1730) CGACCATGGACATTCACAT (SEQ ID NO: 1731)
hCV25742059 A/G CTGCCTCTTCTGCATTAGA (SEQ ID NO: 1732) TGCCTCTTCTGCATTAGG (SEQ ID NO: 1733) CCTTCACTGCCTGTTTCTCT (SEQ ID NO: 1734)
hCV25924894 A/G GGGAAGTTCTTTCTTGTATATTCAA GGGAAGTTCTTTCTTGTATATTCAG TGCTGTCTTTGCCTCACTAAT (SEQ ID NO: 1737)
(SEQ ID NO: 1735) (SEQ ID NO: 1736)
hCV25925481 A/G AATCAGCATTTTTGTCAAAGA (SEQ ID NO: 1738) ATCAGCATTTTTGTCAAAGG (SEQ ID NO: 1739) GGCTTGTGACCTCATTGTTT (SEQ ID NO: 1740)
hCV25951678 A/G AATGCAGCTGCTCAAAGA (SEQ ID NO: 1741) ATGCAGCTGCTCAAAGG (SEQ ID NO: 1742) GTTCCCGGGCTCACA (SEQ ID NO: 1743)
hCV25952089 A/C CCCTGCCTCTGTCTGACTA (SEQ ID NO: 1744) CCCTGCCTCTGTCTGACTC (SEQ ID NO: 1745) AAGACAAGCCCAGGTTCA (SEQ ID NO: 1746)
hCV25983294 G/T CCATCATTTACTCCTACCGC (SEQ ID NO: 1747) CCCATCATTTACTCCTACCGT GCCGAGCGGTCTGAG (SEQ ID NO: 1749)
(SEQ ID NO: 1748)
hCV2637554 C/T ACATCCCAATAAAAGAGCAGG (SEQ ID NO: 1750) AAACATCCCAATAAAAGAGCAGA ACTTTGTTTCTTTCAGTATTTATGGCAGTGG
(SEQ ID NO: 1751) (SEQ ID NO: 1752)
hCV26478797 A/G GAAATCCTCCCACTGATGA (SEQ ID NO: 1753) AAATCCTCCCACTGATGG (SEQ ID NO: 1754) GCCAGATAGAATGACTTTATTGTAGA
(SEQ ID NO: 1755)
hCV26505812 A/G GTCAAATCTAAGCTGAGTGTTGA TCAAATCTAAGCTGAGTGTTGG GCTTTCCCAGATGCACTGTATTGT
(SEQ ID NO: 1756) (SEQ ID NO: 1757) (SEQ ID NO: 1758)
hCV26682080 A/G TCTCGGGTAGACCACACT (SEQ ID NO: 1759) CTCGGGTAGACCACACC (SEQ ID NO: 1760) GGCCCAGAGAGGTGAAGTTACT (SEQ ID NO: 1761)
hCV26881276 A/G GAGTTGCTCACAAAAGGCA (SEQ ID NO: 1762) AGTTGCTCACAAAAGGCG (SEQ ID NO: 1763) GCAGGCCATGTGAATAGACATAC (SEQ ID NO: 1764)
hCV27077072 C/T ATCCTGGTATGGCCCC (SEQ ID NO: 1765) CATCCTGGTATGGCCCT (SEQ ID NO: 1766) GTCACACAAGCCAAGAAGAATTAGA
(SEQ ID NO: 1767)
hCV2741051 C/T GCAGCCAGTTTCTCCC (SEQ ID NO: 1768) TGCAGCCAGTTTCTCCT (SEQ ID NO: 1769) CATGAAATGCTTCCAGGTATT (SEQ ID NO: 1770)
hCV27473671 C/T CTGACCTCCTGAATAATCCATC (SEQ ID NO: 1771) TCTGACCTCCTGAATAATCCATT CAGGGCTTCCCTAGCAGATAG (SEQ ID NO: 1773)
(SEQ ID NO: 1772)
hCV27494483 C/T AACAGCCATTCCTTGTCC (SEQ ID NO: 1774) GAACAGCCATTCCTTGTCT (SEQ ID NO: 1775) CCAGAAGCAGATGAAATGAGTAC (SEQ ID NO: 1776)
hCV27504565 C/G GCTCCCAACACTGGACAG (SEQ ID NO: 1777) GCTCCCAACACTGGACAC (SEQ ID NO: 1778) GGTGGCAGAGCTCTCCT (SEQ ID NO: 1779)
hCV27511436 C/T GGCCCCCATACATTACAAC (SEQ ID NO: 1780) GGCCCCCATACATTACAAT (SEQ ID NO: 1781) TGGAGGAAAGTTCTGGACAGTTA (SEQ ID NO: 1782)
hCV2769503 A/G GGATTCGAGCCGACATCT (SEQ ID NO: 1783) GATTCGAGCCGACATCC (SEQ ID NO: 1784) TTGAGGATTAGCCTAGAACCACACA
(SEQ ID NO: 1785)
hCV27830265 A/G CGACCCATGAGAGAATCAGA (SEQ ID NO: 1786) CGACCCATGAGAGAATCAGG (SEQ ID NO: 1787) GCAGGTCCAGCCAGTGAA (SEQ ID NO: 1788)
hCV27892569 C/T ATGTGAAATTGCATGCACTTAG (SEQ ID GTATGTGAAATTGCATGCACTTAA TGTGTGTACAACACCTATACATGTGTGT
NO: 1789) (SEQ ID NO: 1790) (SEQ ID NO: 1791)
hCV28036404 A/T CATGAGACTCAACTTCTTAGGAAA CATGAGACTCAACTTCTTAGGAAT GCACCAGCCAAGGTTTACTTTATAG
(SEQ ID NO: 1792) (SEQ ID NO: 1793) (SEQ ID NO: 1794)
hCV2851380 C/G CTTGCTACCAATTCCATTTTCC (SEQ ID CTTGCTACCAATTCCATTTTCG (SEQ ID NO: GGATCTCAGGGGCAAGTCTT (SEQ ID NO: 1797)
NO: 1795) 1796)
hCV2862873 C/T TCAACAAATGTATTGATCAGCAAAC CTCAACAAATGTATTGATCAGCAAAT (SEQ CAGACAGGAGGAGTGGGATTCAT (SEQ ID NO: 1800)
(SEQ ID NO: 1798) ID NO: 1799)
hCV2930693 A/C GAAGAAGTACAACCCACAT (SEQ ID NO: 1801) GAAGAAGTACAACCCACAG (SEQ ID NO: 1802) GACACATGTAAGTTCCACTCATATG
(SEQ ID NO: 1803)
hCV29401764 C/T AAGGTGAGCTTGCCAATC (SEQ ID NO: 1804) AAGGTGAGCTTGCCAATT (SEQ ID NO: 1805) CATGGCGAGGAAGACACATAT (SEQ ID NO: 1806)
hCV29480044 C/T GGTGGGCCTTTTGAAATAAAC (SEQ ID NO: 1807) TGGTGGGCCTTTTGAAATAAAT (SEQ ID CTTGAAGTGAAGGCACCTGTCAT (SEQ ID NO: 1809)
NO: 1808)
hCV29537898 C/T ACCACAGCTGTCCCTC (SEQ ID NO: 1810) TACCACAGCTGTCCCTT (SEQ ID NO: 1811) GCCTCCCAGTGGGAATCT (SEQ ID NO: 1812)
hCV29539757 A/C TCCAGTTAGGGATAAAGAAAGGA CCAGTTAGGGATAAAGAAAGGC (SEQ CCAGGCTGATCTCGAACTTCT (SEQ ID NO: 1815)
(SEQ ID NO: 1813) ID NO: 1814)
hCV29566897 C/T GAAGATAGATTCTGCCAAATCATTC GAAGATAGATTCTGCCAAATCATTT (SEQ GGTAAACTCCTGTTGCCTCAGTA (SEQ ID NO: 1818)
(SEQ ID NO: 1816) ID NO: 1817)
hCV2959482 A/G ACACCTGCGGTTAGATTGA (SEQ ID NO: 1819) CACCTGCGGTTAGATTGG (SEQ ID NO: 1820) CGAAGCTTCACAGATGACATC (SEQ ID NO: 1821)
hCV29881864 C/G CTTTCTTGACATCAGTGCTTC (SEQ ID NO: 1822) CTTTCTTGACATCAGTGCTTG (SEQ ID CAAAGTCCTCCTTTTCCTTGACTCTG
NO: 1823) (SEQ ID NO: 1824)
hCV302629 A/G AGCTGCTGCTTGCTAAATAT (SEQ ID NO: 1825) AGCTGCTGCTTGCTAAATAC (SEQ ID NO: 1826) CCTGGAAAGGTCATGCTACTCATACT
(SEQ ID NO: 1827)
hCV30308202 C/G TGGCAGGAGATGGATGTAC (SEQ ID NO: 1828) TGGCAGGAGATGGATGTAG (SEQ ID NO: 1829) CCAGTTACTTGACTTTTGGCGTTTCT
(SEQ ID NO: 1830)
hCV30454150 C/T TCTAGCAGATTTGTATCAGAACC TAATCTAGCAGATTTGTATCAGAACT (SEQ GCGACCCTCTCTGGTTAAACA (SEQ ID NO: 1833)
(SEQ ID NO: 1831) ID NO: 1832)
hCV3054550 C/T TCCTGTCTCTGTCCCTTTC (SEQ ID NO: 1834) ATCCTGTCTCTGTCCCTTTT (SEQ ID NO: 1835) CGGAGTGCCCTCTTGTCT (SEQ ID NO: 1836)
hCV3054799 A/G TGACTCCCAGCATGAAT (SEQ ID NO: 1837) TGACTCCCAGCATGAAC (SEQ ID NO: 1838) TGGCTTATCAAGAGACATGAGA (SEQ ID NO: 1839)
hCV3082219 A/G AGAGATAGTGGAAGCTTTGACA (SEQ ID GAGATAGTGGAAGCTTTGACG (SEQ ID CCTGCAGCACACTTTGTAATCTAC
NO: 1840) NO: 1841) (SEQ ID NO: 1842)
hCV31137507 C/G CCTGGGCAACAAAGTCAC (SEQ ID NO: 1843) CCTGGGCAACAAAGTCAG (SEQ ID NO: 1844) CAAGAATATTGGCCTGCTTCAAACTAG
(SEQ ID NO: 1845)
hCV31227848 C/T CCTTGGGGTAGTCCCC (SEQ ID NO: 1846) TCCTTGGGGTAGTCCCT (SEQ ID NO: 1847) GCTGGAGTCCCACTGAGA (SEQ ID NO: 1848)
hCV31573621 C/T TGTAATTGGCCCAGAACAC (SEQ ID NO: 1849) ATGTAATTGGCCCAGAACAT (SEQ ID NO: 1850) CCTTCCAGGCTTCTCTCTGAT (SEQ ID NO: 1851)
hCV31705214 A/T GTTGGTGAAGAAGGATTTGTAGT GTTGGTGAAGAAGGATTTGTAGA (SEQ GCTGGAAGCTTGACACTTGTTGAA
(SEQ ID NO: 1852) ID NO: 1853) (SEQ ID NO: 1854)
hCV32160712 A/T TGTGCCTTCCACATCTCA (SEQ ID NO: 1855) TGTGCCTTCCACATCTCT (SEQ ID NO: 1856) CAGGCTTTGGTCTGGGTTAAA (SEQ ID NO: 1857)
hCV3216551 A/G GCATACATCACATTTTCTTTACCT GCATACATCACATTTTCTTTACCC (SEQ GTTCATTGCAGCATTTTCCCCAATAC
(SEQ ID NO: 1858) ID NO: 1859) (SEQ ID NO: 1860)
hCV323071 A/G AAACCAGGATATCAGAACATTTTA ACCAGGATATCAGAACATTTTG (SEQ ID GGTCTTAGGAATTATCTGACATCTT
(SEQ ID NO: 1861) NO: 1862) (SEQ ID NO: 1863)
hCV435733 C/G CAACTACTCGGGAGACAG (SEQ ID NO: 1864) CAACTACTCGGGAGACAC (SEQ ID NO: 1865) CCTCTCAGCCCTCTCTCCATAAAG
(SEQ ID NO: 1866)
hCV454333 C/T GTATGGGCTTGAGGAAATCAC (SEQ ID NO: 1867) GTATGGGCTTGAGGAAATCAT (SEQ ID TGCACAGATGGCTTCTGTATGT (SEQ ID NO: 1869)
NO: 1868)
hCV540056 C/T AACTACTTCTGGATGGTCAGC (SEQ ID NO: 1870) AAACTACTTCTGGATGGTCAGT (SEQ GGGTCCTGCAAGTAGACACTAAG (SEQ ID NO: 1872)
ID NO: 1871)
hCV7425232 C/T TCAAAATTATTTCTTGCTACAGG GTCAAAATTATTTCTTGCTACAGA (SEQ TCCTCCAGCCTCTCATTC (SEQ ID NO: 1875)
(SEQ ID NO: 1873) ID NO: 1874)
hCV7917138 A/G CAGTAGCAATGGTAAAGATTTGAAT CAGTAGCAATGGTAAAGATTTGAAC (SEQ TTCCACTGTATAGACTCTCCTGTACAGAT
(SEQ ID NO: 1876) ID NO: 1877) (SEQ ID NO: 1878)
hCV8147903 A/G GGCTCTCTCGTGAGCA (SEQ ID NO: 1879) GGCTCTCTCGTGAGCG (SEQ ID NO: 1880) GAAGGGGCACAGTGCCTTTTAG (SEQ ID NO: 1881)
hCV8754449 C/T GCAGCTGAGGATTTAGCAC (SEQ ID NO: 1882) GCAGCTGAGGATTTAGCAT (SEQ ID NO: 1883) CAGAGCAAGACCCTGTCTCTAA (SEQ ID NO: 1884)
hCV8757333 C/T CGTCAGCTCCTTTTGACAC (SEQ ID NO: 1885) CGTCAGCTCCTTTTGACAT (SEQ ID NO: 1886) CCCCAGAGGGTCCAAATTTCT (SEQ ID NO: 1887)
hCV8820007 A/T CTTGGATAGCCTGAACCAATAA (SEQ ID CTTGGATAGCCTGAACCAATAT (SEQ ID CGTGAATAGGGTCCAGAGTCTA (SEQ ID NO: 1890)
NO: 1888) NO: 1889)
hCV8942032 G/G TTTGGACATGGGCAAGC (SEQ ID NO: 1891) CTTTGGACATGGGCAAGG (SEQ ID NO: 1892) CCCTGCATGGAAAGGTAAGAAAGT
(SEQ ID NO: 1893)
hCV9296529 A/G CTCATCCITAATATTGTTTACTTGTGAT CTCATCCTTAATATTGTTTACTTGTGAC CAAGACAGCCGCCTACAAGA (SEQ ID NO: 1896)
(SEQ ID NO: 1894 (SEQ ID NO: 1895
hCV9324316 C/T GCAGGGGTTTCTCACC (SEQ ID NO: 1897) TGCAGGGGTTTCTCACT (SEQ ID NO: 1898) CCCTCCGGCTCAATGTCA (SEQ ID NO: 1899)
hCV9326822 C/T CTCGGGACCAGTCCAG (SEQ ID NO: 1900) CTCGGGACCAGTCCAA (SEQ ID NO: 1901) CCGACAGCCGAGGAGA (SEQ ID NO: 1902)
hCV945276 G/T CGCCACAAACACATACCTG (SEQ ID NO: 1903) CGCCACAAACACATACCTT (SEQ ID NO: 1904) CCGCTGCTTGGAACAG (SEQ ID NO: 1905)
hCV9473891 C/T AGACTTTGATGCCAACGAG (SEQ ID NO: 1906) CAGACTTTGATGCCAACGAA (SEQ ID NO: 1907) CCAAGCACATTTATTGAGCACTCAA
(SEQ ID NO: 1908)
hDV70959216 G/T CAAACAGTGATGCAAATCAATTTC ACAAACAGTGATGCAAATCAATTTA (SEQ GAAGGGGGACGAAGAAGCTAGAA (SEQ ID NO: 1911)
(SEQ ID NO: 1909) ID NO: 1910)
hDV77718013 C/T GGGACCCTATAGGAGCTTC (SEQ ID NO: 1912) GGGACCCTATAGGAGCTTT (SEQ ID NO: 1913) TCATTCTTGGGGGAGAGGCTATTC
(SEQ ID NO: 1914)

TABLE 4
Interrogated SNP Interrogated rs LD SNP LD SNP rs Power Threshold r2 r2
hCV11548152 rs11580249 hCV30715059 rs12137135 0.51 0.477953358 0.4781
hCV11548152 rs11580249 hCV31574252 rs12128312 0.51 0.477953358 0.6764
hCV11738775 rs6754561 hCV27153776 rs10164837 0.51 0.66106443 0.8444
hCV11738775 rs6754561 hCV3232568 rs3795880 0.51 0.66106443 0.8552
hCV11758801 rs11841997 hCV30023295 rs9591381 0.51 0.58648249 1
hCV1408483 rs17070848 hCV1408479 rs12961976 0.51 0.685992147 0.8832
hCV1408483 rs17070848 hCV1408480 rs11663275 0.51 0.685992147 0.8379
hCV1408483 rs17070848 hCV1408481 rs11152374 0.51 0.685992147 0.8946
hCV1408483 rs17070848 hCV1408515 rs12967026 0.51 0.685992147 0.7306
hCV1408483 rs17070848 hCV29202466 rs7234941 0.51 0.685992147 0.8379
hCV1408483 rs17070848 hCV31494763 rs7242542 0.51 0.685992147 0.9429
hCV1408483 rs17070848 hCV31494861 rs12970840 0.51 0.685992147 0.8379
hCV15857769 rs2924914 hCV1379455 rs2942805 0.51 0.948384617 1
hCV15857769 rs2924914 hCV1379456 rs2978341 0.51 0.948384617 1
hCV15857769 rs2924914 hCV15857755 rs2924920 0.51 0.948384617 0.9584
hCV15857769 rs2924914 hCV15857780 rs2924912 0.51 0.948384617 0.9584
hCV15857769 rs2924914 hCV15878591 rs2978339 0.51 0.948384617 0.9594
hCV15857769 rs2924914 hCV15878604 rs2978352 0.51 0.948384617 0.9594
hCV15857769 rs2924914 hCV16167752 rs2930285 0.51 0.948384617 1
hCV15857769 rs2924914 hCV27184738 rs2942808 0.51 0.948384617 1
hCV15857769 rs2924914 hCV29765690 rs9644266 0.51 0.948384617 0.9582
hCV15879601 rs2275769 hCV11396361 rs9370261 0.51 0.394289193 0.6541
hCV15879601 rs2275769 hCV15879602 rs2275770 0.51 0.394289193 1
hCV15879601 rs2275769 hCV16113165 rs2792634 0.51 0.394289193 1
hCV15879601 rs2275769 hCV2140762 rs2792638 0.51 0.394289193 1
hCV15879601 rs2275769 hCV2140766 rs1340667 0.51 0.394289193 1
hCV15879601 rs2275769 hCV2140769 rs1150875 0.51 0.394289193 1
hCV15879601 rs2275769 hCV2140770 rs2792635 0.51 0.394289193 1
hCV15879601 rs2275769 hCV2140772 rs11963558 0.51 0.394289193 1
hCV15879601 rs2275769 hCV25929027 rs6934690 0.51 0.394289193 1
hCV15879601 rs2275769 hCV25930618 rs10484648 0.51 0.394289193 1
hCV15879601 rs2275769 hCV26548331 rs2145761 0.51 0.394289193 1
hCV15879601 rs2275769 hCV26548343 rs2754795 0.51 0.394289193 1
hCV15879601 rs2275769 hCV26548347 rs2754798 0.51 0.394289193 1
hCV15879601 rs2275769 hCV29161504 rs6914051 0.51 0.394289193 0.5561
hCV15879601 rs2275769 hCV29161551 rs6924913 0.51 0.394289193 1
hCV15879601 rs2275769 hCV29649198 rs9885975 0.51 0.394289193 1
hCV15879601 rs2275769 hCV29649199 rs9474772 0.51 0.394289193 1
hCV15879601 rs2275769 hCV29667033 rs9474754 0.51 0.394289193 1
hCV15879601 rs2275769 hCV29703373 rs9474766 0.51 0.394289193 1
hCV15879601 rs2275769 hCV29703374 rs9283919 0.51 0.394289193 1
hCV15879601 rs2275769 hCV29721486 rs9370254 0.51 0.394289193 0.5549
hCV15879601 rs2275769 hCV29721492 rs9474762 0.51 0.394289193 1
hCV15879601 rs2275769 hCV29811423 rs10484647 0.51 0.394289193 1
hCV15879601 rs2275769 hCV29902056 rs9464034 0.51 0.394289193 1
hCV15879601 rs2275769 hCV30082095 rs9357788 0.51 0.394289193 0.5896
hCV15879601 rs2275769 hCV30136287 rs9367551 0.51 0.394289193 0.5567
hCV15879601 rs2275769 hCV30154225 rs10155669 0.51 0.394289193 1
hCV15879601 rs2275769 hCV30190199 rs9474748 0.51 0.394289193 0.7432
hCV15879601 rs2275769 hCV30225881 rs9370259 0.51 0.394289193 0.5567
hCV15879601 rs2275769 hCV30225882 rs9283918 0.51 0.394289193 0.5567
hCV15879601 rs2275769 hCV30298175 rs9382281 0.51 0.394289193 0.5567
hCV15879601 rs2275769 hCV30298180 rs10080252 0.51 0.394289193 1
hCV15879601 rs2275769 hCV30370722 rs9942457 0.51 0.394289193 1
hCV15879601 rs2275769 hCV30370723 rs9474771 0.51 0.394289193 1
hCV15879601 rs2275769 hCV30388486 rs9382285 0.51 0.394289193 0.6552
hCV15879601 rs2275769 hCV30424487 rs9296737 0.51 0.394289193 0.5553
hCV15879601 rs2275769 hCV30514288 rs10484649 0.51 0.394289193 1
hCV15879601 rs2275769 hCV30586618 rs4329099 0.51 0.394289193 1
hCV15879601 rs2275769 hCV31341134 rs10948793 0.51 0.394289193 0.5567
hCV15879601 rs2275769 hCV31341182 rs11969948 0.51 0.394289193 1
hCV15879601 rs2275769 hCV31341185 rs9474746 0.51 0.394289193 1
hCV15879601 rs2275769 hCV31341188 rs6905950 0.51 0.394289193 1
hCV15879601 rs2275769 hCV31341214 rs9474774 0.51 0.394289193 1
hCV15879601 rs2275769 hCV3248104 rs1340664 0.51 0.394289193 1
hCV15879601 rs2275769 hCV3248105 rs7751241 0.51 0.394289193 1
hCV15879601 rs2275769 hCV7807314 rs9382274 0.51 0.394289193 0.5564
hCV15879601 rs2275769 hCV7807316 rs9357783 0.51 0.394289193 0.5567
hCV15879601 rs2275769 hCV7807392 rs9349691 0.51 0.394289193 0.5567
hCV15879601 rs2275769 hCV7807393 rs9349692 0.51 0.394289193 0.6541
hCV15879601 rs2275769 hCV7807402 rs1325821 0.51 0.394289193 0.5567
hCV15879601 rs2275769 hCV7807421 rs9395899 0.51 0.394289193 0.7931
hCV15879601 rs2275769 hCV7807440 rs12662586 0.51 0.394289193 0.7931
hCV15879601 rs2275769 hCV8767722 rs1342831 0.51 0.394289193 1
hCV15879601 rs2275769 hCV8768817 rs1325833 0.51 0.394289193 0.5567
hCV15879601 rs2275769 hCV8768819 rs991199 0.51 0.394289193 0.5564
hCV15879601 rs2275769 hCV8768954 rs1150884 0.51 0.394289193 1
hCV15879601 rs2275769 hCV8768992 rs1299293 0.51 0.394289193 1
hCV15879601 rs2275769 hCV8769017 rs1150874 0.51 0.394289193 1
hCV15879601 rs2275769 hCV8769025 rs1340665 0.51 0.394289193 1
hCV15879601 rs2275769 hDV70700190 rs16869492 0.51 0.394289193 1
hCV15879601 rs2275769 hDV70710884 rs16884761 0.51 0.394289193 1
hCV15879601 rs2275769 hDV70711006 rs16884943 0.51 0.394289193 1
hCV15879601 rs2275769 hDV70711009 rs16884946 0.51 0.394289193 1
hCV15879601 rs2275769 hDV70711130 rs16885091 0.51 0.394289193 1
hCV15879601 rs2275769 hDV71001425 rs17755375 0.51 0.394289193 1
hCV15879601 rs2275769 hDV77036921 rs4715443 0.51 0.394289193 0.7436
hCV16134786 rs2857595 hCV15896673 rs2596430 0.51 0.570810789 0.6215
hCV16134786 rs2857595 hCV26778946 rs2734583 0.51 0.570810789 0.6706
hCV16134786 rs2857595 hCV27300892 rs2922994 0.51 0.570810789 0.6198
hCV16134786 rs2857595 hCV27300895 rs2156874 0.51 0.570810789 0.6215
hCV16134786 rs2857595 hCV27301030 rs2844531 0.51 0.570810789 0.5926
hCV16134786 rs2857595 hCV27301032 rs2596565 0.51 0.570810789 0.6215
hCV16134786 rs2857595 hCV27452303 rs3094005 0.51 0.570810789 0.6706
hCV16134786 rs2857595 hCV27455402 rs3099844 0.51 0.570810789 0.6706
hCV16134786 rs2857595 hCV27462380 rs3130614 0.51 0.570810789 0.6592
hCV16134786 rs2857595 hCV27463679 rs3132472 0.51 0.570810789 0.6706
hCV16134786 rs2857595 hCV30109416 rs4143332 0.51 0.570810789 0.6084
hCV16134786 rs2857595 hCV30127488 rs3132473 0.51 0.570810789 0.7159
hCV16134786 rs2857595 hCV30319025 rs3093988 0.51 0.570810789 0.95
hCV16134786 rs2857595 hCV30589567 rs3093975 0.51 0.570810789 0.9498
hCV16134786 rs2857595 hCV50000055 rs1800629 0.51 0.570810789 0.8562
hCV16134786 rs2857595 hDV75435585 rs3134792 0.51 0.570810789 0.6582
hCV16336 rs362277 hCV1084102 rs363141 0.51 0.668699498 0.83
hCV16336 rs362277 hCV1084108 rs363100 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV1084110 rs363101 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV1084117 rs363106 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV11764409 rs6834455 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV11764411 rs6843895 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV2229297 rs362303 0.51 0.668699498 0.6732
hCV16336 rs362277 hCV2229306 rs362310 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV2231776 rs363091 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV2231787 rs363124 0.51 0.668699498 0.8176
hCV16336 rs362277 hCV2231788 rs363125 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV2231789 rs363093 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV2231797 rs363095 0.51 0.668699498 0.8023
hCV16336 rs362277 hCV2231805 rs363097 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV2231808 rs363098 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV2231925 rs362274 0.51 0.668699498 0.8911
hCV16336 rs362277 hCV2231935 rs362276 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV2231937 rs362323 0.51 0.668699498 0.8486
hCV16336 rs362277 hCV2231938 rs362325 0.51 0.668699498 1
hCV16336 rs362277 hCV2231953 rs362338 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV2484952 rs363094 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV29284939 rs6839081 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV29284940 rs6446725 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV29284943 rs6839274 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV29726333 rs10021254 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV29816351 rs10155264 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV30627341 rs10488840 0.51 0.668699498 0.7513
hCV16336 rs362277 hCV31758114 rs7688390 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV3266236 rs7654034 0.51 0.668699498 0.8413
hCV16336 rs362277 hCV3266250 rs7665816 0.51 0.668699498 0.8413
hCV16336 rs362277 hDV70681393 rs16844026 0.51 0.668699498 0.8413
hCV16336 rs362277 hDV70681394 rs16844028 0.51 0.668699498 0.8413
hCV16336 rs362277 hDV71057631 rs7683309 0.51 0.668699498 0.8294
hCV1958451 rs2985822 hCV11288054 rs3008858 0.51 0.59989501 1
hCV1958451 rs2985822 hCV11288055 rs1886686 0.51 0.59989501 1
hCV1958451 rs2985822 hCV11728590 rs2065002 0.51 0.59989501 0.6298
hCV1958451 rs2985822 hCV11731325 rs1925411 0.51 0.59989501 1
hCV1958451 rs2985822 hCV118052 rs6673462 0.51 0.59989501 0.9559
hCV1958451 rs2985822 hCV11863077 rs12137403 0.51 0.59989501 1
hCV1958451 rs2985822 hCV11864627 rs4620509 0.51 0.59989501 1
hCV1958451 rs2985822 hCV11864638 rs4486425 0.51 0.59989501 0.6247
hCV1958451 rs2985822 hCV12102654 rs1925413 0.51 0.59989501 1
hCV1958451 rs2985822 hCV1464018 rs2985826 0.51 0.59989501 1
hCV1958451 rs2985822 hCV1464019 rs2985825 0.51 0.59989501 1
hCV1958451 rs2985822 hCV15755638 rs3008853 0.51 0.59989501 1
hCV1958451 rs2985822 hCV15755654 rs3008871 0.51 0.59989501 1
hCV1958451 rs2985822 hCV16119992 rs2815349 0.51 0.59989501 0.6298
hCV1958451 rs2985822 hCV16120003 rs2815359 0.51 0.59989501 1
hCV1958451 rs2985822 hCV16120009 rs2815361 0.51 0.59989501 1
hCV1958451 rs2985822 hCV16120017 rs2815370 0.51 0.59989501 1
hCV1958451 rs2985822 hCV16120018 rs2815371 0.51 0.59989501 1
hCV1958451 rs2985822 hCV16186149 rs2985797 0.51 0.59989501 1
hCV1958451 rs2985822 hCV16186183 rs2182143 0.51 0.59989501 1
hCV1958451 rs2985822 hCV16186204 rs2985821 0.51 0.59989501 1
hCV1958451 rs2985822 hCV16186205 rs2985824 0.51 0.59989501 1
hCV1958451 rs2985822 hCV16286251 rs2755256 0.51 0.59989501 1
hCV1958451 rs2985822 hCV1958424 rs1925408 0.51 0.59989501 1
hCV1958451 rs2985822 hCV1958425 rs1925409 0.51 0.59989501 0.6298
hCV1958451 rs2985822 hCV1958426 rs1925410 0.51 0.59989501 0.6141
hCV1958451 rs2985822 hCV1958427 rs1118392 0.51 0.59989501 0.6632
hCV1958451 rs2985822 hCV1958436 rs3008854 0.51 0.59989501 1
hCV1958451 rs2985822 hCV1958439 rs4655658 0.51 0.59989501 1
hCV1958451 rs2985822 hCV1958440 rs3736905 0.51 0.59989501 0.6247
hCV1958451 rs2985822 hCV1958441 rs3929738 0.51 0.59989501 0.6298
hCV1958451 rs2985822 hCV1958444 rs2985818 0.51 0.59989501 1
hCV1958451 rs2985822 hCV1958449 rs1570838 0.51 0.59989501 0.6298
hCV1958451 rs2985822 hCV1958456 rs10789219 0.51 0.59989501 0.6298
hCV1958451 rs2985822 hCV1958457 rs2025608 0.51 0.59989501 1
hCV1958451 rs2985822 hCV2142099 rs2065000 0.51 0.59989501 1
hCV1958451 rs2985822 hCV2142100 rs2755253 0.51 0.59989501 0.9196
hCV1958451 rs2985822 hCV2142101 rs2755254 0.51 0.59989501 0.6247
hCV1958451 rs2985822 hCV2142106 rs2755271 0.51 0.59989501 0.6182
hCV1958451 rs2985822 hCV2142112 rs2815351 0.51 0.59989501 1
hCV1958451 rs2985822 hCV2142114 rs2755242 0.51 0.59989501 0.6379
hCV1958451 rs2985822 hCV2142122 rs2755244 0.51 0.59989501 1
hCV1958451 rs2985822 hCV2142125 rs2065001 0.51 0.59989501 1
hCV1958451 rs2985822 hCV2142126 rs2755245 0.51 0.59989501 1
hCV1958451 rs2985822 hCV2142127 rs2755246 0.51 0.59989501 1
hCV1958451 rs2985822 hCV2142133 rs2815360 0.51 0.59989501 0.6273
hCV1958451 rs2985822 hCV2142134 rs2755250 0.51 0.59989501 1
hCV1958451 rs2985822 hCV2142135 rs2755251 0.51 0.59989501 0.6298
hCV1958451 rs2985822 hCV2142137 rs2815363 0.51 0.59989501 0.6467
hCV1958451 rs2985822 hCV2142138 rs1535365 0.51 0.59989501 0.6298
hCV1958451 rs2985822 hCV2142160 rs2815380 0.51 0.59989501 0.7025
hCV1958451 rs2985822 hCV2142162 rs1024229 0.51 0.59989501 0.7254
hCV1958451 rs2985822 hCV2142163 rs1024230 0.51 0.59989501 0.7254
hCV1958451 rs2985822 hCV2142165 rs2208577 0.51 0.59989501 0.6618
hCV1958451 rs2985822 hCV26465724 rs12044278 0.51 0.59989501 1
hCV1958451 rs2985822 hCV26465735 rs12131222 0.51 0.59989501 1
hCV1958451 rs2985822 hCV27868373 rs4582760 0.51 0.59989501 0.6141
hCV1958451 rs2985822 hCV27996044 rs4655662 0.51 0.59989501 0.6298
hCV1958451 rs2985822 hCV287782 rs11208979 0.51 0.59989501 1
hCV1958451 rs2985822 hCV30441499 rs4655663 0.51 0.59989501 1
hCV1958451 rs2985822 hCV3144208 rs912797 0.51 0.59989501 1
hCV1958451 rs2985822 hCV3144211 rs2985794 0.51 0.59989501 1
hCV1958451 rs2985822 hCV3144213 rs3008873 0.51 0.59989501 1
hCV1958451 rs2985822 hCV3144214 rs2985795 0.51 0.59989501 1
hCV1958451 rs2985822 hCV79872 rs12132532 0.51 0.59989501 1
hCV1958451 rs2985822 hCV92092 rs12041926 0.51 0.59989501 1
hCV1958451 rs2985822 hCV9510886 rs1137656 0.51 0.59989501 1
hCV1958451 rs2985822 hDV70961073 rs17497828 0.51 0.59989501 1
hCV2121658 rs1187332 hCV1050736 rs726433 0.51 0.493100715 0.8585
hCV2121658 rs1187332 hCV1050741 rs1001904 0.51 0.493100715 0.7897
hCV2121658 rs1187332 hCV1050742 rs1001905 0.51 0.493100715 0.7897
hCV2121658 rs1187332 hCV11868553 rs2378669 0.51 0.493100715 0.914
hCV2121658 rs1187332 hCV11930968 rs1837305 0.51 0.493100715 0.7769
hCV2121658 rs1187332 hCV16035227 rs2579375 0.51 0.493100715 0.7769
hCV2121658 rs1187332 hCV16094752 rs2378670 0.51 0.493100715 1
hCV2121658 rs1187332 hCV16094754 rs2799484 0.51 0.493100715 1
hCV2121658 rs1187332 hCV2121649 rs17087514 0.51 0.493100715 1
hCV2121658 rs1187332 hCV2121666 rs1187326 0.51 0.493100715 0.5394
hCV2121658 rs1187332 hCV26567602 rs17087497 0.51 0.493100715 1
hCV2121658 rs1187332 hCV26567643 rs1187370 0.51 0.493100715 0.5824
hCV2121658 rs1187332 hCV29169653 rs7468983 0.51 0.493100715 0.8585
hCV2121658 rs1187332 hCV29169655 rs7045967 0.51 0.493100715 1
hCV2121658 rs1187332 hCV3237574 rs1211443 0.51 0.493100715 1
hCV2121658 rs1187332 hCV3237587 rs1187333 0.51 0.493100715 1
hCV2121658 rs1187332 hCV3237592 rs1147193 0.51 0.493100715 0.5562
hCV2121658 rs1187332 hCV7423840 rs1443441 0.51 0.493100715 0.5299
hCV2121658 rs1187332 hCV7423871 rs1209068 0.51 0.493100715 0.5284
hCV2121658 rs1187332 hCV7424026 rs1307279 0.51 0.493100715 0.5562
hCV2121658 rs1187332 hCV7424033 rs1659412 0.51 0.493100715 0.7897
hCV2121658 rs1187332 hCV7424042 rs1147198 0.51 0.493100715 0.5562
hCV2121658 rs1187332 hCV7424057 rs1147195 0.51 0.493100715 0.7897
hCV2121658 rs1187332 hCV7424077 rs1201364 0.51 0.493100715 0.7897
hCV2121658 rs1187332 hCV7424082 rs1659415 0.51 0.493100715 1
hCV2121658 rs1187332 hCV7424093 rs1147190 0.51 0.493100715 1
hCV2121658 rs1187332 hCV7424099 rs1332894 0.51 0.493100715 1
hCV2121658 rs1187332 hCV7424100 rs1332893 0.51 0.493100715 0.8585
hCV2121658 rs1187332 hDV70859017 rs17087470 0.51 0.493100715 0.8585
hCV2121658 rs1187332 hDV70859019 rs17087472 0.51 0.493100715 0.8585
hCV2121658 rs1187332 hDV70859037 rs17087496 0.51 0.493100715 1
hCV2358247 rs415989 hCV26338105 rs1013561 0.51 0.799037114 1
hCV2358247 rs415989 hCV29881294 rs6073814 0.51 0.799037114 0.826
hCV2358247 rs415989 hCV30007459 rs10485460 0.51 0.799037114 1
hCV2358247 rs415989 hCV7499352 rs1516579 0.51 0.799037114 1
hCV2358247 rs415989 hDV70786842 rs16990761 0.51 0.799037114 1
hCV2358247 rs415989 hDV72026194 rs800683 0.51 0.799037114 1
hCV2390937 rs739719 hCV2390936 rs739718 0.51 0.633865259 1
hCV25473186 rs2880415 hCV11313256 rs1947069 0.51 0.877072532 1
hCV25473186 rs2880415 hCV11313258 rs1947067 0.51 0.877072532 1
hCV25473186 rs2880415 hCV16209365 rs2342652 0.51 0.877072532 1
hCV25473186 rs2880415 hCV26159412 rs2342653 0.51 0.877072532 1
hCV25473186 rs2880415 hCV29013151 rs7688639 0.51 0.877072532 1
hCV25473186 rs2880415 hCV29987400 rs4234915 0.51 0.877072532 1
hCV25473186 rs2880415 hCV30852132 rs7673498 0.51 0.877072532 1
hCV25473186 rs2880415 hCV7427258 rs1047214 0.51 0.877072532 1
hCV25473186 rs2880415 hCV7428282 rs1444792 0.51 0.877072532 1
hCV25473186 rs2880415 hCV7428284 rs1444799 0.51 0.877072532 1
hCV25596936 rs6967117 hCV25596967 rs7800937 0.51 0.9709961 1
hCV25596936 rs6967117 hCV485060 rs1804527 0.51 0.9709961 1
hCV25983294 rs3739709 hCV1316797 rs1043128 0.51 0.483483129 0.9447
hCV25983294 rs3739709 hCV1316809 rs12555590 0.51 0.483483129 0.8857
hCV25983294 rs3739709 hCV27503139 rs3936868 0.51 0.483483129 0.7051
hCV25983294 rs3739709 hCV27883057 rs4978964 0.51 0.483483129 0.5049
hCV25983294 rs3739709 hCV31956059 rs10980596 0.51 0.483483129 0.5434
hCV25983294 rs3739709 hCV31956067 rs10980602 0.51 0.483483129 0.6012
hCV25983294 rs3739709 hCV31956070 rs10980605 0.51 0.483483129 0.6847
hCV25983294 rs3739709 hCV31956071 rs10980607 0.51 0.483483129 0.898
hCV25983294 rs3739709 hCV31956076 rs10817101 0.51 0.483483129 0.6835
hCV25983294 rs3739709 hCV31959065 rs10980575 0.51 0.483483129 0.7051
hCV25983294 rs3739709 hCV613577 rs551517 0.51 0.483483129 0.6445
hCV25983294 rs3739709 hCV8780367 rs1061548 0.51 0.483483129 1
hCV2637554 rs3205421 hCV11704313 rs2041149 0.51 0.586104829 0.706
hCV2637554 rs3205421 hCV11704321 rs1811338 0.51 0.586104829 0.6624
hCV2637554 rs3205421 hCV2411030 rs741645 0.51 0.586104829 1
hCV2637554 rs3205421 hCV2637556 rs2041150 0.51 0.586104829 0.5966
hCV2637554 rs3205421 hCV2637560 rs9669539 0.51 0.586104829 1
hCV2637554 rs3205421 hCV2637565 rs10860779 0.51 0.586104829 1
hCV2637554 rs3205421 hCV2637574 rs730013 0.51 0.586104829 0.6624
hCV2637554 rs3205421 hCV2637576 rs3817305 0.51 0.586104829 1
hCV2637554 rs3205421 hCV2637583 rs4764813 0.51 0.586104829 1
hCV2637554 rs3205421 hCV2637585 rs10492085 0.51 0.586104829 0.6624
hCV2637554 rs3205421 hCV27278316 rs10778146 0.51 0.586104829 0.6395
hCV2637554 rs3205421 hCV27480555 rs3764973 0.51 0.586104829 0.7373
hCV2637554 rs3205421 hCV2905213 rs11832844 0.51 0.586104829 0.7378
hCV2637554 rs3205421 hCV29407507 rs7957655 0.51 0.586104829 0.6624
hCV2637554 rs3205421 hCV29407514 rs7960795 0.51 0.586104829 0.7391
hCV2637554 rs3205421 hCV29407573 rs7965541 0.51 0.586104829 0.7373
hCV2637554 rs3205421 hCV32176762 rs7135472 0.51 0.586104829 0.7602
hCV2637554 rs3205421 hCV32176795 rs4764814 0.51 0.586104829 0.6624
hCV2637554 rs3205421 hCV8698769 rs919214 0.51 0.586104829 0.6391
hCV26478797 rs2015018 hCV2553995 rs10057898 0.51 0.783014529 0.8829
hCV26478797 rs2015018 hCV2554001 rs6861345 0.51 0.783014529 0.8487
hCV26478797 rs2015018 hCV2554006 rs1557759 0.51 0.783014529 0.8487
hCV26478797 rs2015018 hCV2557450 rs42250 0.51 0.783014529 1
hCV26478797 rs2015018 hCV29134287 rs6878107 0.51 0.783014529 0.7886
hCV26478797 rs2015018 hCV30441646 rs6883532 0.51 0.783014529 0.8098
hCV27473671 rs3750465 hCV11265714 rs12686736 0.51 0.86047945 1
hCV27473671 rs3750465 hCV15849807 rs2900481 0.51 0.86047945 0.962
hCV27473671 rs3750465 hCV15961264 rs2271878 0.51 0.86047945 0.962
hCV27473671 rs3750465 hCV1751510 rs11789624 0.51 0.86047945 0.9259
hCV27473671 rs3750465 hCV1751522 rs11792861 0.51 0.86047945 0.9259
hCV27473671 rs3750465 hCV1751524 rs10512391 0.51 0.86047945 0.962
hCV27473671 rs3750465 hCV1751537 rs11788825 0.51 0.86047945 0.962
hCV27473671 rs3750465 hCV1751538 rs11794648 0.51 0.86047945 0.9259
hCV27473671 rs3750465 hCV1751568 rs11788904 0.51 0.86047945 0.9207
hCV27473671 rs3750465 hCV1751573 rs7870597 0.51 0.86047945 0.962
hCV27473671 rs3750465 hCV25805845 rs3750451 0.51 0.86047945 0.962
hCV27473671 rs3750465 hCV27507261 rs3829084 0.51 0.86047945 0.9259
hCV27473671 rs3750465 hCV27511474 rs3750454 0.51 0.86047945 0.922
hCV27473671 rs3750465 hCV29343287 rs7855282 0.51 0.86047945 0.962
hCV27473671 rs3750465 hCV29343294 rs7470160 0.51 0.86047945 0.962
hCV27473671 rs3750465 hCV8779898 rs1333344 0.51 0.86047945 0.962
hCV27473671 rs3750465 hDV70967853 rs17552292 0.51 0.86047945 1
hCV27473671 rs3750465 hDV70979148 rs17628095 0.51 0.86047945 1
hCV27473671 rs3750465 hDV70997039 rs17729523 0.51 0.86047945 0.9617
hCV27473671 rs3750465 hDV74776655 rs1044905 0.51 0.86047945 0.962
hCV27494483 rs3748743 hCV12084456 rs1935829 0.51 0.567281167 0.5874
hCV27494483 rs3748743 hCV12085551 rs1994830 0.51 0.567281167 1
hCV27494483 rs3748743 hCV12085641 rs699753 0.51 0.567281167 0.881
hCV27494483 rs3748743 hCV12085820 rs815124 0.51 0.567281167 0.881
hCV27494483 rs3748743 hCV15752023 rs2995522 0.51 0.567281167 1
hCV27494483 rs3748743 hCV16027831 rs2488452 0.51 0.567281167 1
hCV27494483 rs3748743 hCV16052590 rs1689088 0.51 0.567281167 0.881
hCV27494483 rs3748743 hCV16250228 rs2486081 0.51 0.567281167 1
hCV27494483 rs3748743 hCV16250229 rs2486080 0.51 0.567281167 0.881
hCV27494483 rs3748743 hCV25763709 rs2488429 0.51 0.567281167 1
hCV27494483 rs3748743 hCV26680298 rs4839049 0.51 0.567281167 0.7078
hCV27494483 rs3748743 hCV26680430 rs2488433 0.51 0.567281167 0.881
hCV27494483 rs3748743 hCV26680450 rs2488449 0.51 0.567281167 1
hCV27494483 rs3748743 hCV26681176 rs11810230 0.51 0.567281167 1
hCV27494483 rs3748743 hCV29197202 rs1775518 0.51 0.567281167 1
hCV27494483 rs3748743 hCV29723037 rs1775698 0.51 0.567281167 0.7927
hCV27494483 rs3748743 hCV31476567 rs10923675 0.51 0.567281167 0.6429
hCV27494483 rs3748743 hCV31476715 rs10923964 0.51 0.567281167 0.6807
hCV27494483 rs3748743 hCV31477547 rs10923969 0.51 0.567281167 1
hCV27494483 rs3748743 hCV31477571 rs10923965 0.51 0.567281167 1
hCV27494483 rs3748743 hCV8690513 rs1342718 0.51 0.567281167 1
hCV27494483 rs3748743 hCV8690516 rs1418656 0.51 0.567281167 0.8808
hCV27494483 rs3748743 hCV8690521 rs1767265 0.51 0.567281167 0.881
hCV27494483 rs3748743 hCV8691661 rs815105 0.51 0.567281167 0.881
hCV27494483 rs3748743 hCV8691672 rs815107 0.51 0.567281167 0.881
hCV27494483 rs3748743 hCV8691697 rs815118 0.51 0.567281167 0.881
hCV27494483 rs3748743 hCV8691711 rs1281540 0.51 0.567281167 0.881
hCV27494483 rs3748743 hCV8692279 rs1466812 0.51 0.567281167 0.8673
hCV27494483 rs3748743 hCV8692280 rs815102 0.51 0.567281167 0.6071
hCV27494483 rs3748743 hCV8692287 rs864175 0.51 0.567281167 0.7078
hCV27494483 rs3748743 hCV8692304 rs1767259 0.51 0.567281167 1
hCV27494483 rs3748743 hCV8692310 rs1775519 0.51 0.567281167 0.7078
hCV27494483 rs3748743 hCV8692311 rs1767258 0.51 0.567281167 0.7078
hCV27494483 rs3748743 hCV8701061 rs1689087 0.51 0.567281167 0.7498
hCV27494483 rs3748743 hCV8701081 rs1775702 0.51 0.567281167 0.881
hCV27494483 rs3748743 hCV8701111 rs1281693 0.51 0.567281167 0.642
hCV27494483 rs3748743 hCV8701127 rs1798109 0.51 0.567281167 0.881
hCV27494483 rs3748743 hCV8701139 rs1798110 0.51 0.567281167 0.881
hCV27494483 rs3748743 hCV8701140 rs699768 0.51 0.567281167 0.881
hCV27494483 rs3748743 hCV8701141 rs1689096 0.51 0.567281167 0.8808
hCV27494483 rs3748743 hCV8701148 rs699766 0.51 0.567281167 0.7917
hCV27494483 rs3748743 hCV8701153 rs699765 0.51 0.567281167 0.8668
hCV27494483 rs3748743 hCV8701160 rs699761 0.51 0.567281167 0.881
hCV27494483 rs3748743 hCV8701179 rs699755 0.51 0.567281167 0.881
hCV27494483 rs3748743 hCV8701181 rs699754 0.51 0.567281167 1
hCV27494483 rs3748743 hCV8701183 rs699752 0.51 0.567281167 0.881
hCV27494483 rs3748743 hCV8701197 rs699748 0.51 0.567281167 0.881
hCV27494483 rs3748743 hCV8701213 rs1342719 0.51 0.567281167 0.881
hCV27494483 rs3748743 hDV70820092 rs17034936 0.51 0.567281167 0.867
hCV27494483 rs3748743 hDV70820421 rs17035363 0.51 0.567281167 0.6589
hCV27504565 rs3219489 hCV148812 rs2153608 0.51 0.960429702 1
hCV27504565 rs3219489 hCV16138635 rs2153609 0.51 0.960429702 1
hCV27504565 rs3219489 hCV16154820 rs2185549 0.51 0.960429702 1
hCV27504565 rs3219489 hCV16188158 rs2298018 0.51 0.960429702 1
hCV27504565 rs3219489 hCV27913398 rs4660853 0.51 0.960429702 1
hCV27504565 rs3219489 hCV27967653 rs4660854 0.51 0.960429702 1
hCV27504565 rs3219489 hCV27968738 rs4660849 0.51 0.960429702 1
hCV27504565 rs3219489 hCV27989232 rs4660852 0.51 0.960429702 1
hCV27504565 rs3219489 hCV29054909 rs4520450 0.51 0.960429702 1
hCV27504565 rs3219489 hCV29482894 rs9326141 0.51 0.960429702 1
hCV27504565 rs3219489 hCV29609344 rs9429160 0.51 0.960429702 1
hCV27504565 rs3219489 hCV29681797 rs9429072 0.51 0.960429702 1
hCV27504565 rs3219489 hCV29736116 rs3219472 0.51 0.960429702 1
hCV27504565 rs3219489 hCV30258653 rs9429076 0.51 0.960429702 1
hCV27504565 rs3219489 hCV30456994 rs9429158 0.51 0.960429702 1
hCV27504565 rs3219489 hCV30874754 rs11211101 0.51 0.960429702 1
hCV27504565 rs3219489 hCV32304101 rs4660851 0.51 0.960429702 1
hCV27504565 rs3219489 hCV469305 rs7543428 0.51 0.960429702 1
hCV27504565 rs3219489 hCV519782 rs2492840 0.51 0.960429702 1
hCV27511436 rs3750145 hCV106815 rs11771236 0.51 0.469307594 0.555
hCV27511436 rs3750145 hCV188768 rs10953041 0.51 0.469307594 0.653
hCV27511436 rs3750145 hCV27170501 rs12533378 0.51 0.469307594 0.7892
hCV27511436 rs3750145 hCV2835970 rs12540728 0.51 0.469307594 0.764
hCV27511436 rs3750145 hCV2835987 rs10953044 0.51 0.469307594 0.8598
hCV27511436 rs3750145 hCV29373899 rs7781027 0.51 0.469307594 0.686
hCV27511436 rs3750145 hCV32068681 rs11761729 0.51 0.469307594 0.8598
hCV27511436 rs3750145 hCV8315224 rs1052015 0.51 0.469307594 0.8598
hCV27511436 rs3750145 hDV72086373 rs34899057 0.51 0.469307594 0.8598
hCV2769503 rs4787956 hCV2769507 rs3024685 0.51 0.516261595 0.7057
hCV2769503 rs4787956 hCV8903080 rs1029489 0.51 0.516261595 0.7456
hCV2769503 rs4787956 hCV8903085 rs8832 0.51 0.516261595 0.5477
hCV2769503 rs4787956 hCV8903086 rs1049631 0.51 0.516261595 0.5278
hCV2769503 rs4787956 hDV70776992 rs16976728 0.51 0.516261595 0.7051
hCV27892569 rs4903741 hCV27198279 rs4903749 0.51 0.955713817 1
hCV27892569 rs4903741 hDV71062438 rs8006711 0.51 0.955713817 1
hCV2851380 rs12445805 hCV11667261 rs12446178 0.51 0.45310779 1
hCV2851380 rs12445805 hCV11667266 rs12448204 0.51 0.45310779 1
hCV2851380 rs12445805 hCV1565864 rs12447158 0.51 0.45310779 0.6364
hCV2851380 rs12445805 hCV26981883 rs12447735 0.51 0.45310779 1
hCV2851380 rs12445805 hCV2851355 rs12446298 0.51 0.45310779 1
hCV2851380 rs12445805 hCV2851356 rs12449083 0.51 0.45310779 0.8182
hCV2851380 rs12445805 hCV2851359 rs12446840 0.51 0.45310779 1
hCV2851380 rs12445805 hCV2851368 rs12447812 0.51 0.45310779 1
hCV2851380 rs12445805 hCV29564089 rs9924583 0.51 0.45310779 0.5385
hCV2851380 rs12445805 hCV31815677 rs12446340 0.51 0.45310779 1
hCV2851380 rs12445805 hCV31815680 rs12448935 0.51 0.45310779 1
hCV2851380 rs12445805 hCV31815681 rs12448739 0.51 0.45310779 1
hCV2851380 rs12445805 hCV31815709 rs12927043 0.51 0.45310779 0.5898
hCV29537898 rs6073804 hCV2358247 rs415989 0.51 0.552444046 0.7016
hCV29537898 rs6073804 hCV26338105 rs1013561 0.51 0.552444046 0.7016
hCV29537898 rs6073804 hCV26534413 rs544055 0.51 0.552444046 0.6811
hCV29537898 rs6073804 hCV27947632 rs4812932 0.51 0.552444046 1
hCV29537898 rs6073804 hCV27947633 rs4812930 0.51 0.552444046 1
hCV29537898 rs6073804 hCV27947636 rs4812923 0.51 0.552444046 1
hCV29537898 rs6073804 hCV29610044 rs6073808 0.51 0.552444046 1
hCV29537898 rs6073804 hCV29827054 rs6073795 0.51 0.552444046 1
hCV29537898 rs6073804 hCV29881294 rs6073814 0.51 0.552444046 0.8494
hCV29537898 rs6073804 hCV29899344 rs4812922 0.51 0.552444046 1
hCV29537898 rs6073804 hCV29935270 rs6073796 0.51 0.552444046 1
hCV29537898 rs6073804 hCV30007459 rs10485460 0.51 0.552444046 0.7016
hCV29537898 rs6073804 hCV30133494 rs6073819 0.51 0.552444046 1
hCV29537898 rs6073804 hCV30169599 rs6073794 0.51 0.552444046 1
hCV29537898 rs6073804 hCV30187505 rs6065834 0.51 0.552444046 0.6134
hCV29537898 rs6073804 hCV30241248 rs6073789 0.51 0.552444046 1
hCV29537898 rs6073804 hCV30259333 rs10485458 0.51 0.552444046 1
hCV29537898 rs6073804 hCV30259338 rs6073797 0.51 0.552444046 1
hCV29537898 rs6073804 hCV30277376 rs6073810 0.51 0.552444046 1
hCV29537898 rs6073804 hCV30349417 rs6032347 0.51 0.552444046 0.6134
hCV29537898 rs6073804 hCV30511464 rs6073791 0.51 0.552444046 1
hCV29537898 rs6073804 hCV30529696 rs6073813 0.51 0.552444046 1
hCV29537898 rs6073804 hCV30601833 rs6073793 0.51 0.552444046 1
hCV29537898 rs6073804 hCV30601834 rs6073792 0.51 0.552444046 1
hCV29537898 rs6073804 hCV7499352 rs1516579 0.51 0.552444046 0.7016
hCV29537898 rs6073804 hDV70786611 rs16990423 0.51 0.552444046 1
hCV29537898 rs6073804 hDV70786630 rs16990452 0.51 0.552444046 1
hCV29537898 rs6073804 hDV70786842 rs16990761 0.51 0.552444046 0.7016
hCV29537898 rs6073804 hDV72026194 rs800683 0.51 0.552444046 0.6545
hCV29539757 rs10110659 hCV16018696 rs2116465 0.51 0.486011754 0.5448
hCV29539757 rs10110659 hCV1894171 rs2469505 0.51 0.486011754 0.5448
hCV29539757 rs10110659 hCV1894196 rs9642905 0.51 0.486011754 0.5894
hCV29539757 rs10110659 hCV29774726 rs10108362 0.51 0.486011754 0.8046
hCV29539757 rs10110659 hCV29991301 rs10111409 0.51 0.486011754 0.5523
hCV29539757 rs10110659 hCV30513298 rs9297840 0.51 0.486011754 0.8063
hCV29539757 rs10110659 hCV31233524 rs10956635 0.51 0.486011754 0.6776
hCV29539757 rs10110659 hCV3218376 rs959003 0.51 0.486011754 0.5698
hCV29539757 rs10110659 hDV70983393 rs17652451 0.51 0.486011754 1
hCV302629 rs9284183 hCV11491432 rs7992229 0.51 0.476125719 0.827
hCV302629 rs9284183 hCV11697373 rs7332672 0.51 0.476125719 0.5308
hCV302629 rs9284183 hCV16091979 rs2182885 0.51 0.476125719 0.4929
hCV302629 rs9284183 hCV1619929 rs9300542 0.51 0.476125719 0.901
hCV302629 rs9284183 hCV1619953 rs9517704 0.51 0.476125719 0.9036
hCV302629 rs9284183 hCV1619954 rs912130 0.51 0.476125719 0.9514
hCV302629 rs9284183 hCV1619955 rs912131 0.51 0.476125719 0.9036
hCV302629 rs9284183 hCV1619962 rs1923895 0.51 0.476125719 0.9512
hCV302629 rs9284183 hCV2028227 rs9517637 0.51 0.476125719 0.4953
hCV302629 rs9284183 hCV2028228 rs9517638 0.51 0.476125719 0.9512
hCV302629 rs9284183 hCV2028233 rs9517642 0.51 0.476125719 0.8581
hCV302629 rs9284183 hCV2028235 rs9517644 0.51 0.476125719 0.9514
hCV302629 rs9284183 hCV2028239 rs11069357 0.51 0.476125719 0.9473
hCV302629 rs9284183 hCV2028241 rs2296860 0.51 0.476125719 0.9514
hCV302629 rs9284183 hCV2028245 rs7995524 0.51 0.476125719 0.9496
hCV302629 rs9284183 hCV26560448 rs7983491 0.51 0.476125719 0.9514
hCV302629 rs9284183 hCV26560464 rs7335403 0.51 0.476125719 0.8573
hCV302629 rs9284183 hCV2699349 rs7999348 0.51 0.476125719 0.9041
hCV302629 rs9284183 hCV28038226 rs4772201 0.51 0.476125719 0.5153
hCV302629 rs9284183 hCV29166806 rs7999077 0.51 0.476125719 0.4956
hCV302629 rs9284183 hCV2950553 rs7322572 0.51 0.476125719 0.533
hCV302629 rs9284183 hCV3042329 rs4511390 0.51 0.476125719 0.9457
hCV302629 rs9284183 hCV3042331 rs2181502 0.51 0.476125719 0.9514
hCV302629 rs9284183 hCV3042333 rs9517686 0.51 0.476125719 1
hCV302629 rs9284183 hCV3042336 rs7339230 0.51 0.476125719 0.9514
hCV302629 rs9284183 hCV3042337 rs7338726 0.51 0.476125719 0.9514
hCV302629 rs9284183 hCV3042339 rs1887704 0.51 0.476125719 0.7119
hCV302629 rs9284183 hCV31358927 rs9554573 0.51 0.476125719 0.9514
hCV302629 rs9284183 hCV31358982 rs11842736 0.51 0.476125719 0.9465
hCV302629 rs9284183 hCV3193760 rs9585021 0.51 0.476125719 0.9514
hCV302629 rs9284183 hCV3193775 rs7338177 0.51 0.476125719 0.5308
hCV302629 rs9284183 hCV3193777 rs7139964 0.51 0.476125719 0.9514
hCV302629 rs9284183 hCV3193779 rs731955 0.51 0.476125719 0.5137
hCV302629 rs9284183 hCV3193781 rs984477 0.51 0.476125719 0.509
hCV302629 rs9284183 hCV3193783 rs9513584 0.51 0.476125719 0.8558
hCV302629 rs9284183 hCV3193794 rs2296911 0.51 0.476125719 0.9514
hCV302629 rs9284183 hCV3193798 rs6491493 0.51 0.476125719 0.9514
hCV302629 rs9284183 hCV8698973 rs927989 0.51 0.476125719 0.8886
hCV302629 rs9284183 hDV70984009 rs17655647 0.51 0.476125719 0.9512
hCV30308202 rs9482985 hCV11200332 rs9492268 0.51 0.712481366 0.7376
hCV30308202 rs9482985 hCV11200405 rs6569582 0.51 0.712481366 1
hCV30308202 rs9482985 hCV11692112 rs1979404 0.51 0.712481366 1
hCV30308202 rs9482985 hCV15796613 rs2448013 0.51 0.712481366 1
hCV30308202 rs9482985 hCV15886692 rs2494937 0.51 0.712481366 1
hCV30308202 rs9482985 hCV15967216 rs2279165 0.51 0.712481366 0.955
hCV30308202 rs9482985 hCV16163318 rs2219787 0.51 0.712481366 1
hCV30308202 rs9482985 hCV1889342 rs899350 0.51 0.712481366 1
hCV30308202 rs9482985 hCV1889343 rs1478800 0.51 0.712481366 0.7698
hCV30308202 rs9482985 hCV1889344 rs9492240 0.51 0.712481366 1
hCV30308202 rs9482985 hCV1889345 rs1382515 0.51 0.712481366 1
hCV30308202 rs9482985 hCV1889346 rs2448012 0.51 0.712481366 1
hCV30308202 rs9482985 hCV1889347 rs7751112 0.51 0.712481366 1
hCV30308202 rs9482985 hCV1889348 rs17056825 0.51 0.712481366 0.8924
hCV30308202 rs9482985 hCV1889349 rs9492243 0.51 0.712481366 1
hCV30308202 rs9482985 hCV1889355 rs11751534 0.51 0.712481366 1
hCV30308202 rs9482985 hCV1889357 rs11756052 0.51 0.712481366 0.955
hCV30308202 rs9482985 hCV1889358 rs11758207 0.51 0.712481366 1
hCV30308202 rs9482985 hCV1889359 rs9492248 0.51 0.712481366 0.9525
hCV30308202 rs9482985 hCV1889367 rs2876021 0.51 0.712481366 1
hCV30308202 rs9482985 hCV1889371 rs6925197 0.51 0.712481366 1
hCV30308202 rs9482985 hCV1889378 rs9492271 0.51 0.712481366 0.7467
hCV30308202 rs9482985 hCV1889383 rs265334 0.51 0.712481366 0.7778
hCV30308202 rs9482985 hCV1889389 rs265332 0.51 0.712481366 0.7776
hCV30308202 rs9482985 hCV1889390 rs265380 0.51 0.712481366 0.7778
hCV30308202 rs9482985 hCV26000215 rs17056847 0.51 0.712481366 0.7765
hCV30308202 rs9482985 hCV27442718 rs7744609 0.51 0.712481366 1
hCV30308202 rs9482985 hCV27442721 rs10499150 0.51 0.712481366 1
hCV30308202 rs9482985 hCV27480203 rs3778132 0.51 0.712481366 0.7698
hCV30308202 rs9482985 hCV27480208 rs3778137 0.51 0.712481366 0.7391
hCV30308202 rs9482985 hCV27480211 rs3778141 0.51 0.712481366 0.955
hCV30308202 rs9482985 hCV27499807 rs3778134 0.51 0.712481366 1
hCV30308202 rs9482985 hCV27499808 rs3778135 0.51 0.712481366 1
hCV30308202 rs9482985 hCV29433849 rs6569585 0.51 0.712481366 0.955
hCV30308202 rs9482985 hCV29433859 rs7756786 0.51 0.712481366 1
hCV30308202 rs9482985 hCV29433860 rs7738316 0.51 0.712481366 1
hCV30308202 rs9482985 hCV29496377 rs6569583 0.51 0.712481366 1
hCV30308202 rs9482985 hCV29532686 rs9492262 0.51 0.712481366 0.7698
hCV30308202 rs9482985 hCV30020211 rs9492237 0.51 0.712481366 1
hCV30308202 rs9482985 hCV30056140 rs7748051 0.51 0.712481366 1
hCV30308202 rs9482985 hCV30092368 rs9492241 0.51 0.712481366 1
hCV30308202 rs9482985 hCV30092369 rs6941264 0.51 0.712481366 1
hCV30308202 rs9482985 hCV30110237 rs9492245 0.51 0.712481366 0.955
hCV30308202 rs9482985 hCV30128317 rs9492253 0.51 0.712481366 1
hCV30308202 rs9482985 hCV30182412 rs9482989 0.51 0.712481366 0.9548
hCV30308202 rs9482985 hCV30200320 rs6569584 0.51 0.712481366 0.955
hCV30308202 rs9482985 hCV30308200 rs9492263 0.51 0.712481366 1
hCV30308202 rs9482985 hCV30308204 rs9492238 0.51 0.712481366 0.9537
hCV30308202 rs9482985 hCV30398657 rs9492247 0.51 0.712481366 0.955
hCV30308202 rs9482985 hCV30452477 rs9492265 0.51 0.712481366 1
hCV30308202 rs9482985 hCV30470292 rs9492234 0.51 0.712481366 1
hCV30308202 rs9482985 hCV30506242 rs9492264 0.51 0.712481366 1
hCV30308202 rs9482985 hCV30560754 rs9492254 0.51 0.712481366 1
hCV30308202 rs9482985 hCV30632610 rs7762236 0.51 0.712481366 1
hCV30308202 rs9482985 hCV32245443 rs12210504 0.51 0.712481366 0.7521
hCV30308202 rs9482985 hCV32245454 rs6569586 0.51 0.712481366 1
hCV30308202 rs9482985 hCV32245465 rs12179603 0.51 0.712481366 1
hCV30308202 rs9482985 hCV8922745 rs1478804 0.51 0.712481366 1
hCV30308202 rs9482985 hCV8922746 rs1478803 0.51 0.712481366 1
hCV30308202 rs9482985 hCV8922755 rs1478802 0.51 0.712481366 1
hCV30308202 rs9482985 hCV8922768 rs1478798 0.51 0.712481366 1
hCV30308202 rs9482985 hCV8922785 rs1478793 0.51 0.712481366 1
hCV30308202 rs9482985 hCV8922791 rs1478792 0.51 0.712481366 0.955
hCV30308202 rs9482985 hCV8922793 rs1478808 0.51 0.712481366 0.9509
hCV30308202 rs9482985 hCV923718 rs727183 0.51 0.712481366 1
hCV30308202 rs9482985 hCV923730 rs265361 0.51 0.712481366 0.8035
hCV30308202 rs9482985 hCV923731 rs265360 0.51 0.712481366 0.7371
hCV30308202 rs9482985 hCV923753 rs265382 0.51 0.712481366 0.7778
hCV30308202 rs9482985 hCV923754 rs265381 0.51 0.712481366 0.7778
hCV30308202 rs9482985 hCV923758 rs265388 0.51 0.712481366 0.7778
hCV30308202 rs9482985 hCV923759 rs265387 0.51 0.712481366 0.7778
hCV30308202 rs9482985 hCV923761 rs265385 0.51 0.712481366 0.7778
hCV30308202 rs9482985 hCV923762 rs265384 0.51 0.712481366 0.7778
hCV30308202 rs9482985 hDV70836483 rs17056909 0.51 0.712481366 1
hCV30308202 rs9482985 hDV71969667 rs7767990 0.51 0.712481366 0.955
hCV3054550 rs1559599 hCV11208814 rs4896640 0.51 0.580062034 0.8025
hCV3054550 rs1559599 hCV11208823 rs9403478 0.51 0.580062034 0.83
hCV3054550 rs1559599 hCV1649763 rs11155286 0.51 0.580062034 0.6394
hCV3054550 rs1559599 hCV1649764 rs11155287 0.51 0.580062034 0.6113
hCV3054550 rs1559599 hCV1649774 rs11754096 0.51 0.580062034 0.8482
hCV3054550 rs1559599 hCV1649776 rs4896633 0.51 0.580062034 0.8482
hCV3054550 rs1559599 hCV1649777 rs11752523 0.51 0.580062034 0.8482
hCV3054550 rs1559599 hCV1649778 rs11753048 0.51 0.580062034 0.8482
hCV3054550 rs1559599 hCV1649779 rs11755477 0.51 0.580062034 0.8476
hCV3054550 rs1559599 hCV1649780 rs4896636 0.51 0.580062034 0.8463
hCV3054550 rs1559599 hCV1649781 rs4896637 0.51 0.580062034 0.8482
hCV3054550 rs1559599 hCV1649782 rs9496565 0.51 0.580062034 0.8025
hCV3054550 rs1559599 hCV1649784 rs11753012 0.51 0.580062034 0.8481
hCV3054550 rs1559599 hCV1649785 rs967633 0.51 0.580062034 0.8482
hCV3054550 rs1559599 hCV1649786 rs9376741 0.51 0.580062034 0.8463
hCV3054550 rs1559599 hCV1649787 rs11754065 0.51 0.580062034 0.8482
hCV3054550 rs1559599 hCV27888181 rs4896650 0.51 0.580062034 1
hCV3054550 rs1559599 hCV27888182 rs4896635 0.51 0.580062034 0.8476
hCV3054550 rs1559599 hCV27888183 rs4896634 0.51 0.580062034 0.8476
hCV3054550 rs1559599 hCV27888184 rs4895606 0.51 0.580062034 0.8482
hCV3054550 rs1559599 hCV27937623 rs4895607 0.51 0.580062034 0.8476
hCV3054550 rs1559599 hCV28024244 rs4896653 0.51 0.580062034 0.6324
hCV3054550 rs1559599 hCV2867272 rs11758932 0.51 0.580062034 1
hCV3054550 rs1559599 hCV29604750 rs9390074 0.51 0.580062034 0.8482
hCV3054550 rs1559599 hCV29930123 rs9496561 0.51 0.580062034 0.8482
hCV3054550 rs1559599 hCV29947932 rs9496594 0.51 0.580062034 0.9498
hCV3054550 rs1559599 hCV30146228 rs9403485 0.51 0.580062034 0.9438
hCV3054550 rs1559599 hCV30217924 rs9399434 0.51 0.580062034 0.6673
hCV3054550 rs1559599 hCV30272167 rs9390075 0.51 0.580062034 0.8476
hCV3054550 rs1559599 hCV30344162 rs9390076 0.51 0.580062034 0.8482
hCV3054550 rs1559599 hCV30398541 rs9285499 0.51 0.580062034 0.6394
hCV3054550 rs1559599 hCV30524360 rs9403486 0.51 0.580062034 0.9498
hCV3054550 rs1559599 hCV3054531 rs6937858 0.51 0.580062034 0.894
hCV3054550 rs1559599 hCV3054542 rs9399439 0.51 0.580062034 1
hCV3054550 rs1559599 hCV3054556 rs11751030 0.51 0.580062034 1
hCV3054550 rs1559599 hCV32241095 rs11757293 0.51 0.580062034 1
hCV3054550 rs1559599 hCV32241106 rs11753058 0.51 0.580062034 0.8737
hCV3054550 rs1559599 hCV32404557 rs4896632 0.51 0.580062034 0.8482
hCV3054550 rs1559599 hCV7576514 rs9908 0.51 0.580062034 0.95
hCV3054550 rs1559599 hCV9783869 rs4896639 0.51 0.580062034 0.8476
hCV3082219 rs1884833 hCV1781515 rs13218371 0.51 0.822864328 1
hCV3082219 rs1884833 hCV1802750 rs13213246 0.51 0.822864328 0.9393
hCV3082219 rs1884833 hCV1802756 rs13216434 0.51 0.822864328 1
hCV3082219 rs1884833 hCV3082214 rs17208849 0.51 0.822864328 1
hCV3082219 rs1884833 hCV3082227 rs2180621 0.51 0.822864328 1
hCV31137507 rs7660668 hCV11746020 rs1979605 0.51 0.891437139 1
hCV31137507 rs7660668 hCV11746021 rs1979604 0.51 0.891437139 1
hCV31137507 rs7660668 hCV15809632 rs2101476 0.51 0.891437139 1
hCV31137507 rs7660668 hCV16072560 rs2130040 0.51 0.891437139 1
hCV31137507 rs7660668 hCV26406027 rs4336288 0.51 0.891437139 1
hCV31137507 rs7660668 hCV27941642 rs4865012 0.51 0.891437139 1
hCV31137507 rs7660668 hCV29101714 rs6851971 0.51 0.891437139 1
hCV31137507 rs7660668 hCV29101718 rs7665846 0.51 0.891437139 1
hCV31137507 rs7660668 hCV29882171 rs9993599 0.51 0.891437139 1
hCV31137507 rs7660668 hCV30440588 rs6554291 0.51 0.891437139 1
hCV31137507 rs7660668 hCV30494157 rs10012559 0.51 0.891437139 1
hCV31137507 rs7660668 hCV31137533 rs6853506 0.51 0.891437139 1
hCV31137507 rs7660668 hCV31137546 rs11732481 0.51 0.891437139 0.9502
hCV31137507 rs7660668 hCV31137548 rs6554290 0.51 0.891437139 0.9594
hCV31137507 rs7660668 hCV31137562 rs6830728 0.51 0.891437139 1
hCV31137507 rs7660668 hCV31137564 rs6842960 0.51 0.891437139 0.9183
hCV31137507 rs7660668 hCV769774 rs550144 0.51 0.891437139 1
hCV31137507 rs7660668 hCV8746676 rs880358 0.51 0.891437139 1
hCV31137507 rs7660668 hCV8746701 rs6802 0.51 0.891437139 1
hCV31137507 rs7660668 hCV8746719 rs1801260 0.51 0.891437139 1
hCV31137507 rs7660668 hCV8746730 rs11240 0.51 0.891437139 1
hCV31137507 rs7660668 hCV8746755 rs1021307 0.51 0.891437139 1
hCV31137507 rs7660668 hCV8746756 rs1021306 0.51 0.891437139 1
hCV31137507 rs7660668 hCV8746776 rs972446 0.51 0.891437139 1
hCV31137507 rs7660668 hDV70995909 rs17722979 0.51 0.891437139 1
hCV31137507 rs7660668 hDV71005355 rs17776975 0.51 0.891437139 1
hCV31137507 rs7660668 hDV71953492 rs7698022 0.51 0.891437139 1
hCV31137507 rs7660668 hDV75174888 rs17721497 0.51 0.891437139 1
hCV31137507 rs7660668 hDV75209995 rs2070062 0.51 0.891437139 1
hCV31227848 rs11809423 hCV11874240 rs12731266 0.51 0.290800579 0.2996
hCV31227848 rs11809423 hCV15842490 rs2181276 0.51 0.290800579 0.355
hCV31227848 rs11809423 hCV1654102 rs12740722 0.51 0.290800579 0.2996
hCV31227848 rs11809423 hCV3056582 rs12757352 0.51 0.290800579 0.2996
hCV31227848 rs11809423 hDV70662612 rs17363472 0.51 0.290800579 0.2988
hCV31227848 rs11809423 hDV71039510 rs6600383 0.51 0.290800579 0.2996
hCV31705214 rs12804599 hCV107313 rs10833000 0.51 0.618581044 0.8531
hCV31705214 rs12804599 hCV11594063 rs11024880 0.51 0.618581044 0.7562
hCV31705214 rs12804599 hCV1950266 rs11024863 0.51 0.618581044 1
hCV31705214 rs12804599 hCV1950274 rs10833015 0.51 0.618581044 1
hCV31705214 rs12804599 hCV1950287 rs12787111 0.51 0.618581044 1
hCV31705214 rs12804599 hCV29267415 rs7948997 0.51 0.618581044 0.8406
hCV31705214 rs12804599 hCV31705227 rs11024850 0.51 0.618581044 1
hCV31705214 rs12804599 hCV31705248 rs7931749 0.51 0.618581044 0.8479
hCV31705214 rs12804599 hDV74880995 rs10832987 0.51 0.618581044 0.6552
hCV31705214 rs12804599 hDV74888902 rs11024797 0.51 0.618581044 0.8369
hCV31705214 rs12804599 hDV75065597 rs12275926 0.51 0.618581044 0.8191
hCV32160712 rs11079160 hCV11616144 rs11656978 0.51 0.436836227 0.6753
hCV32160712 rs11079160 hCV1388786 rs11079157 0.51 0.436836227 0.6444
hCV32160712 rs11079160 hCV1388790 rs955734 0.51 0.436836227 0.5822
hCV32160712 rs11079160 hCV1388795 rs11651545 0.51 0.436836227 0.7495
hCV32160712 rs11079160 hCV1388815 rs12453442 0.51 0.436836227 0.7267
hCV32160712 rs11079160 hCV1388823 rs9895713 0.51 0.436836227 0.8877
hCV32160712 rs11079160 hCV1388832 rs12453544 0.51 0.436836227 0.8868
hCV32160712 rs11079160 hCV27267033 rs11079158 0.51 0.436836227 0.5822
hCV32160712 rs11079160 hCV29495159 rs9903045 0.51 0.436836227 1
hCV32160712 rs11079160 hCV30379482 rs9895210 0.51 0.436836227 0.8507
hCV32160712 rs11079160 hCV32160720 rs11656169 0.51 0.436836227 0.5822
hCV32160712 rs11079160 hCV32160723 rs11654125 0.51 0.436836227 0.6208
hCV32160712 rs11079160 hCV7595955 rs1465353 0.51 0.436836227 0.7565
hCV32160712 rs11079160 hCV7595964 rs2010671 0.51 0.436836227 1
hCV32160712 rs11079160 hCV8675361 rs7223639 0.51 0.436836227 0.5555
hCV32160712 rs11079160 hDV70999843 rs17746075 0.51 0.436836227 0.942
hCV32160712 rs11079160 hDV70999855 rs17746146 0.51 0.436836227 1
hCV32160712 rs11079160 hDV71012207 rs17818816 0.51 0.436836227 1
hCV454333 rs10916581 hCV31711080 rs10916583 0.51 0.908108083 1
hCV540056 rs346802 hCV31556699 rs12165049 0.51 0.491985177 1
hCV540056 rs346802 hCV540057 rs346801 0.51 0.491985177 1
hCV540056 rs346802 hCV540061 rs346816 0.51 0.491985177 1
hCV540056 rs346802 hCV540062 rs346817 0.51 0.491985177 1
hCV540056 rs346802 hCV540063 rs453116 0.51 0.491985177 1
hCV540056 rs346802 hCV540071 rs443112 0.51 0.491985177 1
hCV540056 rs346802 hCV540074 rs369654 0.51 0.491985177 0.8251
hCV540056 rs346802 hCV7446926 rs495055 0.51 0.491985177 0.6606
hCV7917138 rs9822460 hCV11538341 rs9848078 0.51 0.404318811 0.4871
hCV7917138 rs9822460 hCV11538354 rs11708509 0.51 0.404318811 1
hCV7917138 rs9822460 hCV11556848 rs4857380 0.51 0.404318811 0.9027
hCV7917138 rs9822460 hCV130955 rs9862953 0.51 0.404318811 0.5658
hCV7917138 rs9822460 hCV159392 rs1497530 0.51 0.404318811 1
hCV7917138 rs9822460 hCV246831 rs7640341 0.51 0.404318811 0.6769
hCV7917138 rs9822460 hCV246832 rs7640257 0.51 0.404318811 0.6769
hCV7917138 rs9822460 hCV26005059 rs13093620 0.51 0.404318811 0.6769
hCV7917138 rs9822460 hCV26008835 rs9821488 0.51 0.404318811 0.4212
hCV7917138 rs9822460 hCV26158969 rs4630981 0.51 0.404318811 1
hCV7917138 rs9822460 hCV26158970 rs7616504 0.51 0.404318811 0.4212
hCV7917138 rs9822460 hCV26922520 rs9869161 0.51 0.404318811 0.5455
hCV7917138 rs9822460 hCV26922587 rs13069360 0.51 0.404318811 0.9026
hCV7917138 rs9822460 hCV26922590 rs7646920 0.51 0.404318811 0.6769
hCV7917138 rs9822460 hCV29281482 rs6439825 0.51 0.404318811 0.6202
hCV7917138 rs9822460 hCV29644396 rs9877169 0.51 0.404318811 0.4212
hCV7917138 rs9822460 hCV30212818 rs9826529 0.51 0.404318811 0.6346
hCV7917138 rs9822460 hCV30320887 rs9289589 0.51 0.404318811 0.6346
hCV7917138 rs9822460 hCV362321 rs9847827 0.51 0.404318811 0.4777
hCV7917138 rs9822460 hCV362323 rs13068323 0.51 0.404318811 0.5932
hCV7917138 rs9822460 hCV362326 rs9289587 0.51 0.404318811 0.9027
hCV7917138 rs9822460 hCV362328 rs6799469 0.51 0.404318811 0.9027
hCV7917138 rs9822460 hCV362329 rs9844815 0.51 0.404318811 0.9027
hCV7917138 rs9822460 hCV362331 rs13086478 0.51 0.404318811 0.6305
hCV7917138 rs9822460 hCV362335 rs6439823 0.51 0.404318811 0.6769
hCV7917138 rs9822460 hCV362337 rs7630351 0.51 0.404318811 0.6769
hCV7917138 rs9822460 hCV50572 rs11721164 0.51 0.404318811 0.5526
hCV7917138 rs9822460 hCV50573 rs10433345 0.51 0.404318811 0.5526
hCV7917138 rs9822460 hCV7917329 rs904143 0.51 0.404318811 0.6276
hCV7917138 rs9822460 hDV77184830 rs6796827 0.51 0.404318811 0.6769
hCV7917138 rs9822460 hDV77231044 rs7638805 0.51 0.404318811 0.6769
hCV8147903 rs680014 hCV11785233 rs2460397 0.51 0.400661237 1
hCV8147903 rs680014 hCV11788458 rs2460386 0.51 0.400661237 1
hCV8147903 rs680014 hCV11788468 rs553352 0.51 0.400661237 1
hCV8147903 rs680014 hCV11788533 rs4799084 0.51 0.400661237 0.6566
hCV8147903 rs680014 hCV12091565 rs629084 0.51 0.400661237 0.5434
hCV8147903 rs680014 hCV1731571 rs580675 0.51 0.400661237 1
hCV8147903 rs680014 hCV26871521 rs12605631 0.51 0.400661237 1
hCV8147903 rs680014 hCV2744994 rs2510276 0.51 0.400661237 1
hCV8147903 rs680014 hCV2745000 rs2680752 0.51 0.400661237 1
hCV8147903 rs680014 hCV2745001 rs1788659 0.51 0.400661237 1
hCV8147903 rs680014 hCV27516223 rs3786238 0.51 0.400661237 0.7292
hCV8147903 rs680014 hCV27877725 rs4799077 0.51 0.400661237 0.8788
hCV8147903 rs680014 hCV29779584 rs4799081 0.51 0.400661237 0.9183
hCV8147903 rs680014 hCV3068685 rs3859321 0.51 0.400661237 0.7991
hCV8147903 rs680014 hCV3068718 rs673590 0.51 0.400661237 1
hCV8147903 rs680014 hCV3068726 rs685665 0.51 0.400661237 1
hCV8147903 rs680014 hCV3068731 rs522723 0.51 0.400661237 0.9587
hCV8147903 rs680014 hCV3068735 rs517479 0.51 0.400661237 1
hCV8147903 rs680014 hCV3068736 rs485400 0.51 0.400661237 1
hCV8147903 rs680014 hCV3068738 rs503615 0.51 0.400661237 1
hCV8147903 rs680014 hCV3068739 rs603957 0.51 0.400661237 1
hCV8147903 rs680014 hCV3068757 rs3826573 0.51 0.400661237 0.4225
hCV8147903 rs680014 hCV3068760 rs585571 0.51 0.400661237 0.8509
hCV8147903 rs680014 hCV805999 rs649763 0.51 0.400661237 1
hCV8147903 rs680014 hCV806002 rs681631 0.51 0.400661237 1
hCV8147903 rs680014 hCV806008 rs655609 0.51 0.400661237 0.8402
hCV8147903 rs680014 hCV806012 rs671424 0.51 0.400661237 0.4335
hCV8147903 rs680014 hCV806021 rs618342 0.51 0.400661237 0.4335
hCV8147903 rs680014 hCV8155000 rs605183 0.51 0.400661237 1
hCV8147903 rs680014 hCV8155010 rs570029 0.51 0.400661237 1
hCV8147903 rs680014 hCV8155011 rs589394 0.51 0.400661237 1
hCV8147903 rs680014 hCV8831345 rs529195 0.51 0.400661237 1
hCV8147903 rs680014 hCV8831346 rs1239783 0.51 0.400661237 1
hCV8147903 rs680014 hCV8831352 rs500795 0.51 0.400661237 0.4335
hCV8942032 rs1264352 hCV11196362 rs3129820 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV11690723 rs886424 0.51 0.674510346 0.9461
hCV8942032 rs1264352 hCV15885725 rs2532923 0.51 0.674510346 0.8224
hCV8942032 rs1264352 hCV15947385 rs2233980 0.51 0.674510346 0.7828
hCV8942032 rs1264352 hCV16027870 rs2517578 0.51 0.674510346 0.8297
hCV8942032 rs1264352 hCV2437063 rs3131060 0.51 0.674510346 0.9468
hCV8942032 rs1264352 hCV2437065 rs3129985 0.51 0.674510346 0.9468
hCV8942032 rs1264352 hCV2437122 rs3095337 0.51 0.674510346 0.7947
hCV8942032 rs1264352 hCV2437158 rs2284174 0.51 0.674510346 0.8428
hCV8942032 rs1264352 hCV2452431 rs3132625 0.51 0.674510346 0.6845
hCV8942032 rs1264352 hCV25606044 rs7750641 0.51 0.674510346 0.6923
hCV8942032 rs1264352 hCV25606244 rs3130247 0.51 0.674510346 0.7442
hCV8942032 rs1264352 hCV25966128 rs9262135 0.51 0.674510346 0.7934
hCV8942032 rs1264352 hCV26544258 rs1634726 0.51 0.674510346 0.7745
hCV8942032 rs1264352 hCV26546104 rs8233 0.51 0.674510346 0.7955
hCV8942032 rs1264352 hCV26546345 rs2535332 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV26546351 rs2263298 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV27452306 rs3094032 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27452307 rs3094036 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27452310 rs3094057 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27452312 rs3094061 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27452313 rs3094064 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27452317 rs3094034 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27452321 rs3094031 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27452331 rs3094086 0.51 0.674510346 0.8942
hCV8942032 rs1264352 hCV27452332 rs3094035 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27452369 rs3094127 0.51 0.674510346 0.7955
hCV8942032 rs1264352 hCV27452387 rs3094222 0.51 0.674510346 0.7571
hCV8942032 rs1264352 hCV27452568 rs3094703 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27452590 rs3094717 0.51 0.674510346 0.6845
hCV8942032 rs1264352 hCV27452726 rs3095329 0.51 0.674510346 0.7945
hCV8942032 rs1264352 hCV27452728 rs3095336 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV27452739 rs3095330 0.51 0.674510346 0.8339
hCV8942032 rs1264352 hCV27452751 rs3095338 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV27452792 rs3095153 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV27452821 rs3095340 0.51 0.674510346 0.8428
hCV8942032 rs1264352 hCV27462338 rs3130353 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27462341 rs3130374 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27462390 rs3130660 0.51 0.674510346 0.7934
hCV8942032 rs1264352 hCV27462600 rs3131050 0.51 0.674510346 0.942
hCV8942032 rs1264352 hCV27462601 rs3131064 0.51 0.674510346 0.9485
hCV8942032 rs1264352 hCV27462862 rs3131788 0.51 0.674510346 0.7415
hCV8942032 rs1264352 hCV27462962 rs3129812 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27462963 rs3129815 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27462964 rs3129818 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27462981 rs3129973 0.51 0.674510346 0.8435
hCV8942032 rs1264352 hCV27462982 rs3129984 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV27462996 rs3130123 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27463014 rs3130352 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27463047 rs3130782 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV27463445 rs3131783 0.51 0.674510346 0.7423
hCV8942032 rs1264352 hCV27463454 rs3131934 0.51 0.674510346 0.7955
hCV8942032 rs1264352 hCV27463630 rs3130557 0.51 0.674510346 0.7415
hCV8942032 rs1264352 hCV27463637 rs3130641 0.51 0.674510346 0.942
hCV8942032 rs1264352 hCV27463692 rs3132580 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV27463694 rs3132610 0.51 0.674510346 0.7442
hCV8942032 rs1264352 hCV27463813 rs3131044 0.51 0.674510346 0.9447
hCV8942032 rs1264352 hCV27464298 rs3132600 0.51 0.674510346 0.7998
hCV8942032 rs1264352 hCV27464300 rs3132605 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV27464304 rs3132630 0.51 0.674510346 0.6845
hCV8942032 rs1264352 hCV27464305 rs3132631 0.51 0.674510346 0.6845
hCV8942032 rs1264352 hCV27464307 rs3132645 0.51 0.674510346 0.7345
hCV8942032 rs1264352 hCV27465359 rs3129978 0.51 0.674510346 0.8905
hCV8942032 rs1264352 hCV27465360 rs3129980 0.51 0.674510346 0.942
hCV8942032 rs1264352 hCV27465386 rs3130350 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27465389 rs3130364 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27465407 rs3130544 0.51 0.674510346 0.7218
hCV8942032 rs1264352 hCV27465417 rs3130673 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV27465853 rs3132634 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV27465855 rs3132649 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV29486333 rs3132584 0.51 0.674510346 0.7955
hCV8942032 rs1264352 hCV29504305 rs3094712 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV29522452 rs3095334 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV29540580 rs3094067 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV29558680 rs3132599 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV29594803 rs9262204 0.51 0.674510346 0.9398
hCV8942032 rs1264352 hCV29666963 rs3130363 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV29666973 rs9262130 0.51 0.674510346 0.7768
hCV8942032 rs1264352 hCV29703261 rs3095155 0.51 0.674510346 0.8696
hCV8942032 rs1264352 hCV29721426 rs3132616 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV29775548 rs3132647 0.51 0.674510346 0.6952
hCV8942032 rs1264352 hCV29847742 rs3129809 0.51 0.674510346 0.7345
hCV8942032 rs1264352 hCV29883892 rs3132581 0.51 0.674510346 0.8865
hCV8942032 rs1264352 hCV29992126 rs3094627 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV29992140 rs9262200 0.51 0.674510346 0.9468
hCV8942032 rs1264352 hCV30028026 rs3130372 0.51 0.674510346 0.6845
hCV8942032 rs1264352 hCV30045930 rs3095326 0.51 0.674510346 0.8435
hCV8942032 rs1264352 hCV30045931 rs3131055 0.51 0.674510346 0.8951
hCV8942032 rs1264352 hCV30172261 rs3130365 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV30190135 rs3094621 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV30262083 rs3094050 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV30262102 rs3130665 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV30280013 rs3094024 0.51 0.674510346 0.7442
hCV8942032 rs1264352 hCV30352101 rs3129821 0.51 0.674510346 0.6845
hCV8942032 rs1264352 hCV30424437 rs9262143 0.51 0.674510346 0.7934
hCV8942032 rs1264352 hCV30442461 rs9262141 0.51 0.674510346 0.7768
hCV8942032 rs1264352 hCV30496055 rs3130117 0.51 0.674510346 0.7442
hCV8942032 rs1264352 hCV30622443 rs3129823 0.51 0.674510346 0.6845
hCV8942032 rs1264352 hCV3273752 rs3130370 0.51 0.674510346 0.6845
hCV8942032 rs1264352 hCV7926405 rs3130126 0.51 0.674510346 0.6961
hCV8942032 rs1264352 hCV8692767 rs1264376 0.51 0.674510346 0.9468
hCV8942032 rs1264352 hCV8692768 rs1264377 0.51 0.674510346 0.8951
hCV8942032 rs1264352 hCV8692796 rs1059612 0.51 0.674510346 0.7934
hCV8942032 rs1264352 hCV8692806 rs1064627 0.51 0.674510346 0.7955
hCV8942032 rs1264352 hCV8941738 rs1634721 0.51 0.674510346 0.8435
hCV8942032 rs1264352 hCV8941879 rs1264308 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV8941918 rs1049633 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV8941930 rs886422 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV8941940 rs1264322 0.51 0.674510346 0.8905
hCV8942032 rs1264352 hCV8941988 rs2535340 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV8942006 rs1264341 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV8942015 rs1264347 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV8942025 rs1264349 0.51 0.674510346 0.8946
hCV8942032 rs1264352 hCV8942026 rs1264350 0.51 0.674510346 0.8812
hCV8942032 rs1264352 hCV8942038 rs1264353 0.51 0.674510346 0.9427
hCV8942032 rs1264352 hCV9481170 rs886423 0.51 0.674510346 1
hCV8942032 rs1264352 hDV75255684 rs2517546 0.51 0.674510346 0.6985

TABLE 5
Baseline Characteristics of ARIC Participants in Ischemic Stroke Study
Whites (N = 10401) Blacks(N = 3814)
Cases Non-cases Cases Non-cases
(N = 275) (N = 10126) (N = 220) (N = 3594)
Characteristics Mean (SD) Mean (SD) p-value* Mean (SD) Mean (SD) p-value*
Age 57.59 (5.32)   54.10 (5.69) <0.01 55.21 (5.79)   53.25 (5.79) <0.01
Waist-to-hip ratio 0.96 (0.07)  0.92 (0.08) <0.01 0.94 (0.07)  0.92 (0.08) <0.01
N (%) N (%) p-value* N (%) N (%) p-value*
Male 162 (59)  4569 (45) <0.01 97 (44) 1318 (37)  0.03
Hypertensive 137 (50)  2516 (25) <0.01 168 (77)  1903 (53) <0.01
Diabetic 55 (20) 799 (8) <0.01 94 (44)  596 (17) <0.01
Smoker 90 (33) 2455 (24) <0.01 81 (37) 1036 (29)  0.01
*p-value represents a comparison between cases and non-cases within an ethnic group

TABLE 6
SNPs Associated with Incident Ischemic Stroke in the ARIC Study
Risk- Risk-
raising lowering Model 1 Model 2
allele allele p- p-
Gene Symbol SNP ID Function* (frequency) (frequency) HRR 95% CI value HRR 95% CI value
Whites
SERPINA9 rs11628722 Nonsynonymous G (0.84) A (0.16) 1.31 1.00-1.70 0.05 1.32 1.02-1.72 0.03
Ala348Val
PALLD rs7439293 Intronic A (0.62) G (0.38) 1.24 1.03-1.49 0.02 1.21 1.01-1.46 0.04
IER2 rs1042164 Nonsynonymous T (0.17) C (0.83) 1.38 1.12-1.71 0.003 1.39 1.12-1.72 0.003
Val133Ala
Blacks
SERPINA9 rs11628722 Nonsynonymous G (0.45) A (0.55) 1.26 1.03-1.53 0.02 1.27 1.04-1.54 0.02
Ala348Val
EXOD1 rs3213646 Intronic C (0.16) T (0.84) 1.29 1.01-1.64 0.04 1.29 1.01-1.65 0.04
*First amino acid corresponds to risk raising allele for nonsynonymous SNPs.
†Model 1 was adjusted for age and gender.
‡Model 2 was adjusted for age, gender, waist-to-hip ratio and diabetes, hypertension and smoking status.

TABLE 7
p-value p-value
Risk White (two- Black (two-
hCV number rs number Gene Symbol Allele HRR 95% CI sided) HRR 95% CI sided)
hCV2091644 rs1010 VAMP8 C 1.16 0.97-1.38 0.1 0.9 0.74-1.10 0.3
hCV25925481 rs11628722 SERPINA9 G 1.31 1.00-1.70 0.05 1.26 1.03-1.53 0.02
hCV323071 rs7439293 PALLD A 1.24 1.03-1.49 0.02 1.2 0.93-1.56 0.16
hCV7425232 rs3900940 MYH15 C 1.18 0.98-1.42 0.08 1.1 0.85-1.43 0.49
hCV9326822 rs1042164 IER2 T 1.38 1.12-1.71 0 0.54 0.27-1.09 0.08
hCV15770510 rs3027309 ALOX12B T 1.17 0.95-1.46 0.14 1.25 0.88-1.77 0.21
hCV9626088 rs943133 LOC391102 A 1.13 0.94-1.36 0.19 1 0.69-1.45 1

TABLE 8
p-value p-value
Gene Risk White (two- Black (two-
hCV number rs number Symbol Allele HRR 95% CI sided) HRR 95% CI sided)
hCV25924894 rs17090921 SERPINA9 A 1.12 0.93-1.35 0.23 1.19 0.92-1.52 0.18
hCV1690777 rs12684749 NFIB G 0.99 0.64-1.53 0.97 1.68 0.90-3.13 0.1
hCV25925481 rs11628722 SERPINA9 G 1.31 1.00-1.70 0.05 1.26 1.03-1.53 0.02
hCV323071 rs7439293 PALLD A 1.24 1.03-1.49 0.02 1.2 0.93-1.56 0.16
hCV25609987 rs10817479 WDR31 A 0.93 0.65-1.32 0.67 5.15  0.72-36.78 0.1
hCV2192261 rs3213646 EXOD1 C 0.98 0.82-1.17 0.82 1.29 1.01-1.64 0.04

TABLE 9
p-value p-value
Risk White (two- Black (two-
hCV number rs number Gene Symbol Allele HRR 95% CI sided) HRR 95% CI sided)
hCV25924894 rs17090921 SERPINA9 A 1.12 0.93-1.35 0.23 1.19 0.92-1.52 0.18
hCV25925481 rs11628722 SERPINA9 G 1.31 1.00-1.70 0.05 1.26 1.03-1.53 0.02
hCV323071 rs7439293 PALLD A 1.24 1.03-1.49 0.02 1.2 0.93-1.56 0.16

TABLE 10
Baseline Characteristics of CHS
Participants in Ischemic Stroke Study
African
Characteristic Whites Americans
Number of individuals in this analysis 3849 673
Male 1575 (41) 243 (36)
Age, mean (SD), y 72.7 (5.6) 72.9 (5.7)
BMI, mean (SD), kg/m2 26.3 (4.5) 28.5 (5.6)
Smoking,current 423 (11) 113 (17)
Diabetes 511 (13) 151 (23)
Impaired fasting glucose 522 (14) 92 (14)
Hypertension 2110 (55) 490 (73)
LDL cholesterol, mean (SD), mg/dL 130 (36) 129 (36)
HDL cholesterol, mean (SD), mg/dL 54 (16) 58 (15)
Total cholesterol, mean (SD), mg/dL 212 (39) 210 (39)
Data presented as number of participants (%) unless otherwise indicated.

TABLE 11
SNPs Associated with Incident Ischemic Stroke in
White Participants of CHS
Prespecified Risk Allele
Gene dbSNP Risk Allele Frequency HR (90% CI)* P
HPS1 rs1804689  T 0.30 1.23 (1.09-1.40) 0.003
ITGAE rs220479  C 0.82 1.26 (1.08-1.48) 0.008
ABCG2 rs2231137  C 0.95 1.46 (1.05-2.03) 0.03
MYH15 rs3900940  C 0.29 1.15 (1.02-1.31) 0.03
FSTL4 rs13183672 A 0.76 1.17 (1.01-1.35) 0.04
CALM1 rs3814843  G 0.05 1.31 (1.02-1.68) 0.04
BAT2 rs11538264 G 0.97 1.49 (1.02-2.16) 0.04
*Hazard ratios (HR) are adjusted for baseline age, sex, body mass index, current smoking, diabetes, impaired fasting glucose, hypertension, LDL-cholesterol, and HDL-cholesterol at baseline. Hazard ratios are per copy of the risk allele.

TABLE 12
SNPs Associated with Incident Ischemic Stroke in
African American Participants of CHS
Pre- Risk
specified Allele
Risk Fre-
Gene dbSNP Allele quency HR (90% CI)* P
KRT4 rs89962   T 0.11 2.08 (1.48-2.94) <0.001
LY6G5B rs11758242 C 0.89 2.28 (1.20-4.33) 0.02
EDG1 rs2038366  G 0.73 1.59 (1.08-2.35) 0.02
DMXL2 rs12102203 G 0.47 1.40 (1.03-1.90) 0.04
ABCG2 rs2231137  C 0.95 3.59 (1.11-11.7) 0.04
*Hazard ratios (HR) are adjusted for baseline age, sex, body mass index, current smoking, diabetes, impaired fasting glucose, hypertension, LDL-cholesterol, and HDL-cholesterol at baseline. Hazard ratios are per copy of the risk allele.

TABLE 13
The Val Allele Homozygotes of ABCG2 Val12Met (rs2231137), Compared with
the Met Allele Carriers, are Associated With Increased Risk of Incident
Ischemic Stroke in Both White and African American Participants of CHS
ABCG2 Events Total Model 1* Model 2*
Genotype n n HR (90% CI) P HR (90% CI) P
White ValVal 370 3398 1.58 (1.12-2.23) 0.02 1.50 (1.06-2.12) 0.03
ValMet + MetMet 24 335 1 (Reference) 1 (Reference)
ValMet 23 321
MetMet 1 14
Af. Am. ValVal 66 592 3.80 (1.16-12.4) 0.03 3.62 (1.11-11.9) 0.04
ValMet + MetMet 2 70 1 (Reference) 1 (Reference)
ValMet 2 69
MetMet 0 1
*Model 1 was adjusted for baseline age and sex. Model 2 was adjusted for baseline age, sex, body mass index, current smoking, diabetes, impaired fasting glucose, hypertension, LDL-cholesterol, and HDL-cholesterol.

TABLE 14
HR (90% p- HR (90% p- HR (90% p- HR (90% p-
risk CI) AgeSex value CI) Full value CI) AgeSex value CI) Full value
gene rs # hCV# allele mode (whites) (whites) (whites) (whites) (blacks) (blacks) (blacks) (blacks)
CENPE rs2243682 hCV1624173 A dom 1.2 (1.02, 0.034 1.2 (1.01, 0.037 .98 (.51, 0.517 1.17 (.6, 0.352
1.42) 1.42) 1.9) 2.28)
FCRLB rs34868416 hCV25951678 A rec 2.01 (1.07, 0.034 2.18 (1.16, 0.021 1.52 (.84, 0.122 1.82 (.97, 0.06
3.76) 4.09) 2.74) 3.44)
FSTL4 rs3749817 hCV25637605 G dom 2.04 (1.2, 0.013 2.04 (1.2, 0.013
3.45) 3.46)
“HR (90% CI) AgeSex” = hazard ratio (with 90% confidence intervals) adjusted for age and sex
“HR (90% CI) Full” = hazard ratio (with 90% confidence intervals) fully adjusted for all traditional risk factors including smoking, diabetes, hypertension, HDL-C, LDL-C, and BMI

TABLE 15
Characteristics of noncardioembolic stroke cases
and healthy controls in VSR
Cases Controls
Characteristics n = 562 n = 815 p
Age (SD) 66.0 (14) 58.8 (8.5) <0.0001
Male 326 (58.0) 397 (48.7) 0.0007
Smoking 172 (32.0) 147 (18.7) <0.0001
Hypertension 400 (71.2) 403 (49.5) <0.0001
Diabetes 191 (34.0) 36 (4.4) <0.0001
Dyslipidemia 347 (61.7) 464 (56.9) 0.07
BMI (SD) 26.8 (4.9) 26.0 (3.8) 0.004
Age and BMI are presented as means (standard deviation, SD) Other risk factors are presented as counts (%) having the risk factor

TABLE 16
Characteristics of six SNPs tested for association with noncardioembolic stroke in VSR.
CHD Risk Frequency in Frequency in Chrom
Gene Allele VSR Controls ARIC Whites* Loc SNP ID SNP Type SNP Source
MYH15 C 0.29 0.30 3q13.13 rs3900940 Thr1125Ala Bare et al
KIF6 G 0.37 0.36 6p21.2 rs20455 Trp719Arg Bare et al
VAMP8 C 0.38 0.42 2p12 rs1010 3′UTR Bare et al
Chr9p21 G 0.46 0.49 9p21 rs10757274 Intergenic McPherson et al

TABLE 17
Adjusted association of six SNPs with noncardioembolic stroke in VSR
Locus Case Control Model 1 Model 2
Genotype n (%) n (%) OR (90% CI) p q OR (90% CI) p
C9p21
GG + GA 386 (76.7) 568 (72.4) 1.20 (0.95-1.50) 0.10 0.15 1.14 (0.89-1.46) 0.20
GG 139 (27.6) 154 (19.6) 1.59 (1.20-2.11) 0.004 1.45 (1.06-1.98) 0.03
GA 247 (49.1) 414 (52.8) 1.05 (0.82-1.34) 0.38 1.02 (0.78-1.33) 0.45
AA 117 (23.3) 216 (27.6) ref ref
KIF6
GG + GA 327 (64.8) 475 (60.7) 1.24 (1.01-1.52) 0.05 0.12 1.23 (0.98-1.54) 0.07
GG  73 (14.5) 102 (13.0) 1.24 (0.91-1.69) 0.13 1.30 (0.93-1.83) 0.10
GA 254 (50.3) 373 (47.7) 1.24 (1.00-1.53) 0.05 1.20 (0.95-1.53) 0.10
AA 178 (35.3) 307 (39.3) ref ref
MYH15
CC + CT 281 (55.6) 390 (49.8) 1.31 (1.07-1.60) 0.01 0.06 1.25 (1.00-1.56) 0.05
CC  56 (11.1) 72 (9.2) 1.50 (1.06-2.11) 0.03 1.19 (0.80-1.75) 0.24
CT 225 (44.5) 318 (40.6) 1.27 (1.03-1.56) 0.03 1.26 (1.00-1.59) 0.05
TT 225 (44.5) 394 (50.3) ref ref
VAMP8
CC + CT 326 (64.4) 483 (61.6) 1.21 (0.99-1.49) 0.06 0.12 1.33 (1.06-1.67) 0.02
CC  77 (15.2) 112 (14.3) 1.27 (0.93-1.72) 0.10 1.37 (0.98-1.91) 0.06
CT 249 (49.2) 371 (47.3) 1.20 (0.96-1.49) 0.09 1.32 (1.04-1.68) 0.03
TT 180 (35.6) 301 (38.4) ref ref

TABLE 18
p-value
OR Lower OR Upper (two-
SNP Gene OUTCOME ADJUST? MODE GENOTYPE OR 90% CI 90% CI sided)
hCV1116793 ZNF132 ISCHEMIC NO GEN TC 0.83 0.69375216 0.992667515 0.0869
hCV1116793 ZNF132 ISCHEMIC NO ADD T 0.84 0.724853655 0.974320962 0.053
hCV1116793 ZNF132 ISCHEMIC NO DOM TC or TT 0.819 0.689223622 0.973935207 0.0578
hCV16093418 LOC646377 ISCHEMIC NO GEN AA 1.483 0.912916828 2.408756165 0.1815
hCV16093418 LOC646377 ISCHEMIC NO ADD A 1.16 0.992191149 1.356678591 0.118
hCV16093418 LOC646377 ISCHEMIC NO DOM AG or AA 1.161 0.968083437 1.392968387 0.1766
hCV1754669 Chr 9 ISCHEMIC NO GEN AG 0.849 0.694898144 1.0380978 0.1806
hCV1754669 Chr 9 ISCHEMIC NO GEN AA 0.704 0.553438026 0.894406866 0.016
hCV1754669 Chr 9 ISCHEMIC NO ADD A 0.839 0.744293003 0.946031417 0.0161
hCV1754669 Chr 9 ISCHEMIC NO DOM AG or AA 0.802 0.663035663 0.970180153 0.0566
hCV1754669 Chr 9 ISCHEMIC NO REC AA 0.785 0.643446754 0.957447873 0.0451
hCV25637605 FSTL4 ISCHEMIC NO DOM AG or AA 1.141 0.96474641 1.349440416 0.1959
hCV26505812 Chr 9 ISCHEMIC NO GEN GG 1.434 1.126756329 1.825140554 0.0139
hCV26505812 Chr 9 ISCHEMIC NO ADD G 1.193 1.057688641 1.345699564 0.0159
hCV26505812 Chr 9 ISCHEMIC NO DOM GA or GG 1.175 0.971230942 1.421611376 0.1636
hCV26505812 Chr 9 ISCHEMIC NO REC GG 1.362 1.115126666 1.663679973 0.0111
hCV7425232 MYH15 ISCHEMIC NO GEN CT 1.207 1.013056501 1.437676114 0.0772
hCV7425232 MYH15 ISCHEMIC NO ADD C 1.138 1.002467038 1.290637136 0.0933
hCV7425232 MYH15 ISCHEMIC NO DOM CT or CC 1.207 1.022059286 1.424442487 0.0628
hCV1116793 ZNF132 ISCHEMIC YES GEN TC 0.703 0.562477582 0.877572242 0.0091
hCV1116793 ZNF132 ISCHEMIC YES ADD T 0.75 0.624608329 0.899631989 0.0093
hCV1116793 ZNF132 ISCHEMIC YES DOM TC or TT 0.701 0.565686919 0.867894166 0.0063
hCV16093418 LOC646377 ISCHEMIC YES GEN AA 1.866 1.045328301 3.330322013 0.0766
hCV16093418 LOC646377 ISCHEMIC YES ADD A 1.162 0.960599702 1.404663117 0.1948
hCV16093418 LOC646377 ISCHEMIC YES REC AA 1.841 1.034539603 3.275411467 0.0815
hCV1754669 Chr 9 ISCHEMIC YES GEN AA 0.76 0.568372651 1.01549685 0.1192
hCV1754669 Chr 9 ISCHEMIC YES ADD A 0.87 0.752699651 1.006107576 0.1151
hCV1754669 Chr 9 ISCHEMIC YES DOM AG or AA 0.805 0.638680148 1.014657888 0.1232
hCV2091644 VAMP8 ISCHEMIC YES GEN CT 1.401 1.120353768 1.751995633 0.0131
hCV2091644 VAMP8 ISCHEMIC YES GEN CC 1.38 1.009559907 1.885674346 0.0901
hCV2091644 VAMP8 ISCHEMIC YES ADD C 1.221 1.052766014 1.416485778 0.0267
hCV2091644 VAMP8 ISCHEMIC YES DOM CT or CC 1.396 1.129256555 1.725713348 0.0096
hCV26505812 Chr 9 ISCHEMIC YES GEN GG 1.388 1.036839351 1.858599041 0.0645
hCV26505812 Chr 9 ISCHEMIC YES ADD G 1.171 1.011727737 1.355459485 0.0756
hCV26505812 Chr 9 ISCHEMIC YES REC GG 1.398 1.096801262 1.782473489 0.0232
hCV945276 KRT5 ISCHEMIC YES REC TT 1.232 0.957897979 1.585681051 0.1725
hCV1116793 ZNF132 ATHERO NO GEN TC 0.787 0.646590569 0.95833488 0.0454
hCV1116793 ZNF132 ATHERO NO ADD T 0.819 0.696165402 0.962297139 0.0419
hCV1116793 ZNF132 ATHERO NO DOM TC or TT 0.784 0.648664594 0.947280056 0.0344
hCV1754669 Chr 9 ATHERO NO GEN AG 0.833 0.670269439 1.034455809 0.165
hCV1754669 Chr 9 ATHERO NO GEN AA 0.676 0.520352663 0.878840811 0.014
hCV1754669 Chr 9 ATHERO NO ADD A 0.823 0.72208458 0.937642062 0.0141
hCV1754669 Chr 9 ATHERO NO DOM AG or AA 0.782 0.636551788 0.960683278 0.0493
hCV1754669 Chr 9 ATHERO NO REC AA 0.764 0.614147286 0.950963593 0.043
hCV26505812 Chr 9 ATHERO NO GEN GG 1.571 1.210420113 2.038944965 0.0044
hCV26505812 Chr 9 ATHERO NO ADD G 1.251 1.097125415 1.426047313 0.005
hCV26505812 Chr 9 ATHERO NO DOM GA or GG 1.218 0.987731875 1.501018684 0.1217
hCV26505812 Chr 9 ATHERO NO REC GG 1.485 1.199236975 1.839906031 0.0024
hCV7425232 MYH15 ATHERO NO GEN CT 1.291 1.06621554 1.562183465 0.028
hCV7425232 MYH15 ATHERO NO GEN CC 1.36 0.995974126 1.856019239 0.1044
hCV7425232 MYH15 ATHERO NO ADD C 1.209 1.05488262 1.385651602 0.0221
hCV7425232 MYH15 ATHERO NO DOM CT or CC 1.304 1.087542975 1.562799868 0.0161
hCV945276 KRT5 ATHERO NO GEN TT 1.226 0.944746161 1.589848931 0.1986
hCV1116793 ZNF132 ATHERO YES GEN TC 0.639 0.501790288 0.814951237 0.0024
hCV1116793 ZNF132 ATHERO YES ADD T 0.698 0.570892416 0.853128157 0.0032
hCV1116793 ZNF132 ATHERO YES DOM TC or TT 0.64 0.507110931 0.808823546 0.0017
hCV16093418 LOC646377 ATHERO YES GEN AA 1.762 0.928367604 3.34386559 0.1459
hCV16093418 LOC646377 ATHERO YES REC AA 1.74 0.920040581 3.292138982 0.1527
hCV1754669 Chr 9 ATHERO YES GEN AA 0.765 0.558483335 1.046582925 0.1596
hCV1754669 Chr 9 ATHERO YES ADD A 0.874 0.746743893 1.022073084 0.1568
hCV2091644 VAMP8 ATHERO YES GEN CT 1.322 1.038739023 1.682015035 0.0569
hCV2091644 VAMP8 ATHERO YES GEN CC 1.366 0.976758835 1.910405456 0.126
hCV2091644 VAMP8 ATHERO YES ADD C 1.2 1.023536718 1.407388698 0.0592
hCV2091644 VAMP8 ATHERO YES DOM CT or CC 1.332 1.06021742 1.673849394 0.0388
hCV26505812 Chr 9 ATHERO YES GEN GG 1.449 1.059805605 1.98082713 0.0512
hCV26505812 Chr 9 ATHERO YES ADD G 1.201 1.025903307 1.405546929 0.056
hCV26505812 Chr 9 ATHERO YES REC GG 1.431 1.106229626 1.851215592 0.022
hCV3054799 KIF6 ATHERO YES ADD G 1.156 0.984174559 1.356831226 0.1385
hCV3054799 KIF6 ATHERO YES DOM GA or GG 1.226 0.976764207 1.538041725 0.1403
hCV323071 PALLD ATHERO YES GEN GA 0.822 0.647104489 1.044405162 0.178
hCV7425232 MYH15 ATHERO YES GEN CT 1.263 1.002774843 1.590469093 0.0961
hCV7425232 MYH15 ATHERO YES ADD C 1.152 0.973983418 1.361464556 0.1655
hCV7425232 MYH15 ATHERO YES DOM CT or CC 1.248 1.002130266 1.555305517 0.0966
hCV1116793 ZNF132 EARLY-ONSET NO GEN TC 0.721 0.555259615 0.93717945 0.0401
hCV1116793 ZNF132 EARLY-ONSET NO ADD T 0.742 0.596550429 0.9231085 0.0246
hCV1116793 ZNF132 EARLY-ONSET NO DOM TC or TT 0.709 0.550475956 0.912444516 0.025
hCV16093418 LOC646377 EARLY-ONSET NO GEN AA 2.279 1.165213696 4.458870577 0.0434
hCV16093418 LOC646377 EARLY-ONSET NO REC AA 2.283 1.172006222 4.448126516 0.0417
hCV1754669 Chr 9 EARLY-ONSET NO GEN AA 0.638 0.449570543 0.904532087 0.0342
hCV1754669 Chr 9 EARLY-ONSET NO ADD A 0.805 0.677020314 0.957005634 0.0392
hCV1754669 Chr 9 EARLY-ONSET NO REC AA 0.657 0.491043284 0.880225636 0.0181
hCV26505812 Chr 9 EARLY-ONSET NO GEN GG 1.454 1.031679957 2.049942 0.0727
hCV26505812 Chr 9 EARLY-ONSET NO ADD G 1.205 1.015074491 1.431092302 0.0737
hCV26505812 Chr 9 EARLY-ONSET NO DOM GA or GG 1.257 0.954270123 1.654681429 0.1722
hCV26505812 Chr 9 EARLY-ONSET NO REC GG 1.308 0.984656431 1.736831541 0.1199
hCV3054799 KIF6 EARLY-ONSET NO GEN GA 1.256 0.968081501 1.629118384 0.1499
hCV3054799 KIF6 EARLY-ONSET NO DOM GA or GG 1.215 0.949308931 1.553982515 0.1942
hCV7425232 MYH15 EARLY-ONSET NO GEN CC 1.411 0.92477899 2.153297741 0.18
hCV7425232 MYH15 EARLY-ONSET NO ADD C 1.188 0.989106766 1.42696955 0.1219
hCV7425232 MYH15 EARLY-ONSET NO DOM CT or CC 1.227 0.964448349 1.560176569 0.1624
hCV1116793 ZNF132 EARLY-ONSET YES GEN TC 0.569 0.383972632 0.843482605 0.0184
hCV1116793 ZNF132 EARLY-ONSET YES GEN TT 0.257 0.07724157 0.857115583 0.0635
hCV1116793 ZNF132 EARLY-ONSET YES ADD T 0.551 0.390357614 0.77793835 0.0045
hCV1116793 ZNF132 EARLY-ONSET YES DOM TC or TT 0.536 0.36534707 0.78765705 0.0076
hCV1116793 ZNF132 EARLY-ONSET YES REC TT 0.312 0.09554036 1.01979997 0.1057
hCV1754669 Chr 9 EARLY-ONSET YES GEN AA 0.531 0.310682745 0.90627091 0.0515
hCV1754669 Chr 9 EARLY-ONSET YES ADD A 0.754 0.582569376 0.975219212 0.071
hCV1754669 Chr 9 EARLY-ONSET YES REC AA 0.471 0.300175493 0.740364979 0.0061
hCV26505812 Chr 9 EARLY-ONSET YES GEN GA 1.613 1.036095685 2.50964297 0.0756
hCV26505812 Chr 9 EARLY-ONSET YES GEN GG 1.607 0.955315621 2.704490393 0.1335
hCV26505812 Chr 9 EARLY-ONSET YES ADD G 1.267 0.980473167 1.638072097 0.129
hCV26505812 Chr 9 EARLY-ONSET YES DOM GA or GG 1.611 1.056911526 2.455300114 0.0627
hCV3054799 KIF6 EARLY-ONSET YES GEN GA 1.469 0.997042382 2.16444072 0.1027
hCV3054799 KIF6 EARLY-ONSET YES DOM GA or GG 1.423 0.980591812 2.063903309 0.1192
hCV323071 PALLD EARLY-ONSET YES GEN GA 0.722 0.490060464 1.064203359 0.1673
hCV323071 PALLD EARLY-ONSET YES DOM GA or GG 0.74 0.515454368 1.061949638 0.1704

TABLE 19A
Ref Case Case Control Control Control Control
Study Marker Gene rs Allele Allele ALL cnt ALL frq cnt frq cnt frq Allele ALL cnt ALL frq Case cnt Case frq cnt frq
UCSFCCF hCV1053082 NEU3 rs544115 C T 884 0.2039 216 0.1898 668 0.2089 C 3452 0.796 922 0.8102 2530 0.7911
VSR hCV1053082 NEU3 rs544115 C T 500 0.1836 177 0.1615 323 0.1984 C 2224 0.816 919 0.8385 1305 0.8016
UCSFCCF hCV1116757 rs3794971 T C 844 0.1946 206 0.181 638 0.1994 T 3494 0.805 932 0.819 2562 0.8006
VSR hCV1116757 rs3794971 T C 454 0.1695 164 0.1513 290 0.1819 T 2224 0.831 920 0.8487 1304 0.8181
UCSFCCF hCV11425801 PEX6 rs3805953 T C 2068 0.4763 570 0.5009 1498 0.4675 T 2274 0.524 568 0.4991 1706 0.5325
VSR hCV11425801 PEX6 rs3805953 T C 1320 0.4857 554 0.5064 766 0.4717 T 1398 0.514 540 0.4936 858 0.5283
UCSFCCF hCV11425842 GNMT rs10948059 C T 2048 0.4723 513 0.4516 1535 0.4797 C 2288 0.528 623 0.5484 1665 0.5203
VSR hCV11425842 GNMT rs10948059 C T 1258 0.4618 485 0.4425 773 0.4748 C 1466 0.538 611 0.5575 855 0.5252
UCSFCCF hCV11548152 rs11580249 G T 707 0.1631 210 0.1845 497 0.1555 G 3627 0.837 928 0.8155 2699 0.8445
VSR hCV11548152 rs11580249 G T 413 0.1513 184 0.1673 229 0.1405 G 2317 0.849 916 0.8327 1401 0.8595
UCSFCCF hCV11738775 rs6754561 T C 1616 0.3725 394 0.3462 1222 0.3819 T 2722 0.628 744 0.6538 1978 0.6181
VSR hCV11738775 rs6754561 T C 1025 0.3766 387 0.3531 638 0.3924 T 1697 0.623 709 0.6469 988 0.6076
UCSFCCF hCV11758801 GUCY1B2 rs11841997 C G 131 0.0302 44 0.0387 87 0.0272 C 4207 0.97 1092 0.9613 3115 0.9728
VSR hCV11758801 GUCY1B2 rs11841997 C G 87 0.0319 44 0.04 43 0.0264 C 2643 0.968 1056 0.96 1587 0.9736
UCSFCCF hCV11861255 GRIK3 rs529407 A G 1038 0.2392 260 0.2285 778 0.243 A 3302 0.761 878 0.7715 2424 0.757
VSR hCV11861255 GRIK3 rs529407 A G 674 0.2506 245 0.226 429 0.2671 A 2016 0.749 839 0.774 1177 0.7329
UCSFCCF hCV12071939 rs1950943 G T 929 0.2142 221 0.1942 708 0.2212 G 3409 0.786 917 0.8058 2492 0.7788
VSR hCV12071939 rs1950943 G T 532 0.1952 193 0.1755 339 0.2085 G 2194 0.805 907 0.8245 1287 0.7915
UCSFCCF hCV1209800 CLIC5 rs35067690 G T 207 0.0477 38 0.0335 169 0.0527 G 4133 0.952 1098 0.9665 3035 0.9473
VSR hCV1209800 CLIC5 rs35067690 G T 111 0.0406 34 0.0309 77 0.0472 G 2621 0.959 1068 0.9691 1553 0.9528
UCSFCCF hCV1262973 PLEKHG3 rs229653 G A 382 0.088 114 0.1002 268 0.0837 G 3958 0.912 1024 0.8998 2934 0.9163
VSR hCV1262973 PLEKHG3 rs229653 G A 277 0.1024 127 0.118 150 0.0921 G 2427 0.898 949 0.882 1478 0.9079
UCSFCCF hCV1348610 C9orf46 rs3739636 G A 2013 0.4645 559 0.4921 1454 0.4547 G 2321 0.536 577 0.5079 1744 0.5453
VSR hCV1348610 C9orf46 rs3739636 G A 1223 0.4567 512 0.4794 711 0.4416 G 1455 0.543 556 0.5206 899 0.5584
UCSFCCF hCV1408483 BCL2 rs17070848 C T 719 0.1657 209 0.1837 510 0.1594 C 3619 0.834 929 0.8163 2690 0.8406
VSR hCV1408483 BCL2 rs17070848 C T 526 0.1931 232 0.2117 294 0.1806 C 2198 0.807 864 0.7883 1334 0.8194
UCSFCCF hCV1452085 TRIM22 rs12223005 C A 468 0.1078 111 0.0975 357 0.1115 C 3872 0.892 1027 0.9025 2845 0.8885
VSR hCV1452085 TRIM22 rs12223005 C A 279 0.1021 98 0.0889 181 0.111 C 2453 0.898 1004 0.9111 1449 0.889
UCSFCCF hCV15851766 APC rs2229995 G A 87 0.0201 14 0.0123 73 0.0228 G 4245 0.98 1122 0.9877 3123 0.9772
VSR hCV15851766 APC rs2229995 G A 59 0.022 15 0.0139 44 0.0274 G 2621 0.978 1061 0.9861 1560 0.9726
UCSFCCF hCV15857769 rs2924914 C T 1314 0.3029 368 0.3234 946 0.2956 C 3024 0.697 770 0.6766 2254 0.7044
VSR hCV15857769 rs2924914 C T 786 0.2883 331 0.3015 455 0.2795 C 1940 0.712 767 0.6985 1173 0.7205
UCSFCCF hCV15879601 C6orf142 rs2275769 C T 333 0.0767 70 0.0615 263 0.0821 C 4009 0.923 1068 0.9385 2941 0.9179
VSR hCV15879601 C6orf142 rs2275769 C T 171 0.0628 59 0.0537 112 0.0689 C 2553 0.937 1039 0.9463 1514 0.9311
UCSFCCF hCV16134786 rs2857595 G A 774 0.1785 226 0.1989 548 0.1712 G 3562 0.822 910 0.8011 2652 0.8288
VSR hCV16134786 rs2857595 G A 510 0.1868 227 0.2064 283 0.1736 G 2220 0.813 873 0.7936 1347 0.8264
UCSFCCF hCV1619596 FKBP1A rs1048621 G A 1198 0.2764 337 0.2961 861 0.2694 G 3136 0.724 801 0.7039 2335 0.7306
VSR hCV1619596 FKBP1A rs1048621 G A 675 0.2474 297 0.27 378 0.2322 G 2053 0.753 803 0.73 1250 0.7678
UCSFCCF hCV16336 HD rs362277 C T 469 0.108 107 0.094 362 0.113 C 3873 0.892 1031 0.906 2842 0.887
VSR hCV16336 HD rs362277 C T 294 0.1079 97 0.0885 197 0.121 C 2430 0.892 999 0.9115 1431 0.879
UCSFCCF hCV1723718 UMODL1 rs12481805 G A 1336 0.3081 377 0.3313 959 0.2999 G 3000 0.692 761 0.6687 2239 0.7001
VSR hCV1723718 UMODL1 rs12481805 G A 779 0.2858 336 0.306 443 0.2721 G 1947 0.714 762 0.694 1185 0.7279
UCSFCCF hCV1958451 MIER1 rs2985822 G T 1073 0.2475 256 0.225 817 0.2555 G 3263 0.753 882 0.775 2381 0.7445
VSR hCV1958451 MIER1 rs2985822 G T 676 0.2487 248 0.2271 428 0.2632 G 2042 0.751 844 0.7729 1198 0.7368
UCSFCCF hCV2121658 rs1187332 G A 534 0.1232 120 0.1058 414 0.1294 G 3800 0.877 1014 0.8942 2786 0.8706
VSR hCV2121658 rs1187332 G A 331 0.1226 119 0.1104 212 0.1307 G 2369 0.877 959 0.8896 1410 0.8693
UCSFCCF hCV2358247 SPINT4 rs415989 A G 290 0.0669 88 0.0775 202 0.0631 A 4046 0.933 1048 0.9225 2998 0.9369
VSR hCV2358247 SPINT4 rs415989 A G 150 0.0549 77 0.0699 73 0.0448 A 2582 0.945 1025 0.9301 1557 0.9552
UCSFCCF hCV2390937 LOC441108 rs739719 C A 318 0.0733 70 0.0615 248 0.0775 C 4022 0.927 1068 0.9385 2954 0.9225
VSR hCV2390937 LOC441108 rs739719 C A 185 0.0678 60 0.0545 125 0.0767 C 2545 0.932 1040 0.9455 1505 0.9233
UCSFCCF hCV25473186 NPY2R rs2880415 T C 2044 0.4708 566 0.4974 1478 0.4613 T 2298 0.529 572 0.5026 1726 0.5387
VSR hCV25473186 NPY2R rs2880415 T C 1181 0.4336 509 0.4653 672 0.4123 T 1543 0.566 585 0.5347 958 0.5877
UCSFCCF hCV25596936 EPHA1 rs6967117 C T 308 0.0709 92 0.0808 216 0.0674 C 4034 0.929 1046 0.9192 2988 0.9326
VSR hCV25596936 EPHA1 rs6967117 C T 241 0.0884 118 0.1073 123 0.0756 C 2485 0.912 982 0.8927 1503 0.9244
UCSFCCF hCV25615822 DHODH NONE C T 114 0.0263 35 0.0308 79 0.0247 C 4224 0.974 1101 0.9692 3123 0.9753
VSR hCV25615822 DHODH NONE C T 113 0.0414 56 0.0508 57 0.035 C 2617 0.959 1046 0.9492 1571 0.965
UCSFCCF hCV25983294 EDG2 rs3739709 G A 821 0.1892 190 0.1673 631 0.1969 G 3519 0.811 946 0.8327 2573 0.8031
VSR hCV25983294 EDG2 rs3739709 G A 541 0.1988 197 0.1794 344 0.2118 G 2181 0.801 901 0.8206 1280 0.7882
UCSFCCF hCV2637554 CHPT1 rs3205421 T C 1293 0.2985 368 0.3245 925 0.2892 T 3039 0.702 766 0.6755 2273 0.7108
VSR hCV2637554 CHPT1 rs3205421 T C 842 0.3109 363 0.3336 479 0.2957 T 1866 0.689 725 0.6664 1141 0.7043
UCSFCCF hCV26478797 CHSY-2 rs2015018 G A 1100 0.2537 266 0.2337 834 0.2608 G 3236 0.746 872 0.7663 2364 0.7392
VSR hCV26478797 CHSY-2 rs2015018 G A 721 0.2653 270 0.2473 451 0.2774 G 1997 0.735 822 0.7527 1175 0.7226
UCSFCCF hCV26881276 C11orf47 rs2344829 A G 1429 0.3297 392 0.3451 1037 0.3243 A 2905 0.67 744 0.6549 2161 0.6757
VSR hCV26881276 C11orf47 rs2344829 A G 963 0.3527 418 0.38 545 0.3344 A 1767 0.647 682 0.62 1085 0.6656
UCSFCCF hCV27077072 rs8060368 C T 1429 0.3293 353 0.3102 1076 0.336 C 2911 0.671 785 0.6898 2126 0.664
VSR hCV27077072 rs8060368 C T 911 0.3339 346 0.3145 565 0.3471 C 1817 0.666 754 0.6855 1063 0.6529
UCSFCCF hCV27473671 C9orf4 rs3750465 T C 1270 0.2925 357 0.3137 913 0.285 T 3072 0.708 781 0.6863 2291 0.715
VSR hCV27473671 C9orf4 rs3750465 T C 738 0.2709 324 0.2945 414 0.2549 T 1986 0.729 776 0.7055 1210 0.7451
UCSFCCF hCV27494483 SLC22A15 rs3748743 C T 226 0.0521 72 0.0633 154 0.0481 C 4114 0.948 1066 0.9367 3048 0.9519
VSR hCV27494483 SLC22A15 rs3748743 C T 127 0.0466 63 0.0573 64 0.0394 C 2599 0.953 1037 0.9427 1562 0.9606
UCSFCCF hCV27504565 MUTYH rs3219489 C G 1135 0.2618 277 0.2434 858 0.2683 C 3201 0.738 861 0.7566 2340 0.7317
VSR hCV27504565 MUTYH rs3219489 C G 594 0.2174 213 0.1933 381 0.2337 C 2138 0.783 889 0.8067 1249 0.7663
UCSFCCF hCV27511436 FZD1 rs3750145 T C 687 0.1592 157 0.1389 530 0.1665 T 3627 0.841 973 0.8611 2654 0.8335
VSR hCV27511436 FZD1 rs3750145 T C 474 0.1736 173 0.1573 301 0.1847 T 2256 0.826 927 0.8427 1329 0.8153
UCSFCCF hCV2769503 rs4787956 A G 1495 0.3445 426 0.3743 1069 0.3339 A 2845 0.656 712 0.6257 2133 0.6661
VSR hCV2769503 rs4787956 A G 891 0.3317 393 0.3666 498 0.3086 A 1795 0.668 679 0.6334 1116 0.6914
UCSFCCF hCV27892569 NRXN3 rs4903741 T C 1022 0.2364 289 0.2544 733 0.2299 T 3302 0.764 847 0.7456 2455 0.7701
VSR hCV27892569 NRXN3 rs4903741 T C 626 0.23 268 0.2432 358 0.221 T 2096 0.77 834 0.7568 1262 0.779
UCSFCCF hCV28036404 RBL1 rs4812768 T A 875 0.2017 216 0.1905 659 0.2057 T 3463 0.798 918 0.8095 2545 0.7943
VSR hCV28036404 RBL1 rs4812768 T A 511 0.1879 182 0.1667 329 0.2021 T 2209 0.812 910 0.8333 1299 0.7979
UCSFCCF hCV2851380 rs12445805 G C 450 0.1037 99 0.0871 351 0.1096 G 3890 0.896 1037 0.9129 2853 0.8904
VSR hCV2851380 rs12445805 G C 320 0.1173 113 0.1027 207 0.1271 G 2408 0.883 987 0.8973 1421 0.8729
UCSFCCF hCV29401764 LOC646588 rs7793552 C T 1402 0.3233 347 0.3049 1055 0.3299 C 2934 0.677 791 0.6951 2143 0.6701
VSR hCV29401764 LOC646588 rs7793552 C T 913 0.3357 337 0.3086 576 0.3538 C 1807 0.664 755 0.6914 1052 0.6462
UCSFCCF hCV29537898 rs6073804 C T 393 0.0907 120 0.1056 273 0.0854 C 3941 0.909 1016 0.8944 2925 0.9146
VSR hCV29537898 rs6073804 C T 216 0.0796 100 0.0921 116 0.0713 C 2496 0.92 986 0.9079 1510 0.9287
UCSFCCF hCV29539757 KCNQ3 rs10110659 C A 1311 0.3022 312 0.2746 999 0.312 C 3027 0.698 824 0.7254 2203 0.688
VSR hCV29539757 KCNQ3 rs10110659 C A 870 0.3191 318 0.2896 552 0.3391 C 1856 0.681 780 0.7104 1076 0.6609
UCSFCCF hCV302629 UBAC2 rs9284183 A G 1247 0.2876 359 0.316 888 0.2775 A 3089 0.712 777 0.684 2312 0.7225
VSR hCV302629 UBAC2 rs9284183 A G 763 0.2815 319 0.2932 444 0.2737 A 1947 0.719 769 0.7068 1178 0.7263
UCSFCCF hCV30308202 LAMA2 rs9482985 G C 917 0.2115 219 0.1924 698 0.2183 G 3419 0.789 919 0.8076 2500 0.7817
VSR hCV30308202 LAMA2 rs9482985 G C 549 0.2017 200 0.1828 349 0.2144 G 2173 0.798 894 0.8172 1279 0.7856
UCSFCCF hCV3054550 AIG1 rs1559599 C T 641 0.1476 189 0.1661 452 0.1411 C 3701 0.852 949 0.8339 2752 0.8589
VSR hCV3054550 AIG1 rs1559599 C T 434 0.1589 189 0.1715 245 0.1503 C 2298 0.841 913 0.8285 1385 0.8497
UCSFCCF hCV3082219 RFXDC1 rs1884833 G A 505 0.1164 148 0.1301 357 0.1115 G 3835 0.884 990 0.8699 2845 0.8885
VSR hCV3082219 RFXDC1 rs1884833 G A 344 0.127 159 0.147 185 0.1138 G 2364 0.873 923 0.853 1441 0.8862
UCSFCCF hCV31137507 CLOCK rs7660668 G C 1165 0.2683 328 0.2882 837 0.2612 G 3177 0.732 810 0.7118 2367 0.7388
VSR hCV31137507 CLOCK rs7660668 G C 741 0.272 317 0.2892 424 0.2604 G 1983 0.728 779 0.7108 1204 0.7396
UCSFCCF hCV31227848 HIVEP3 rs11809423 C T 172 0.0396 61 0.0536 111 0.0347 C 4168 0.96 1077 0.9464 3091 0.9653
VSR hCV31227848 HIVEP3 rs11809423 C T 120 0.044 64 0.0583 56 0.0344 C 2608 0.956 1034 0.9417 1574 0.9656
UCSFCCF hCV31573621 SKAP1 rs11079818 T C 1223 0.2817 295 0.2592 928 0.2896 T 3119 0.718 843 0.7408 2276 0.7104
VSR hCV31573621 SKAP1 rs11079818 T C 739 0.2751 276 0.2575 463 0.2869 T 1947 0.725 796 0.7425 1151 0.7131
UCSFCCF hCV31705214 LOC645397 rs12804599 A T 984 0.2266 283 0.2487 701 0.2188 A 3358 0.773 855 0.7513 2503 0.7812
VSR hCV31705214 LOC645397 rs12804599 A T 596 0.2183 266 0.2418 330 0.2025 A 2134 0.782 834 0.7582 1300 0.7975
UCSFCCF hCV32160712 rs11079160 A T 743 0.1713 221 0.1942 522 0.1631 A 3595 0.829 917 0.8058 2678 0.8369
VSR hCV32160712 rs11079160 A T 432 0.1595 191 0.1752 241 0.1489 A 2276 0.841 899 0.8248 1377 0.8511
UCSFCCF hCV435733 rs10276935 C G 1346 0.3103 383 0.3366 963 0.3009 C 2992 0.69 755 0.6634 2237 0.6991
VSR hCV435733 rs10276935 C G 819 0.3004 345 0.3142 474 0.2912 C 1907 0.7 753 0.6858 1154 0.7088
UCSFCCF hCV454333 NVL rs10916581 C T 590 0.136 139 0.1224 451 0.1408 C 3748 0.864 997 0.8776 2751 0.8592
VSR hCV454333 NVL rs10916581 C T 324 0.1194 110 0.0998 214 0.1328 C 2390 0.881 992 0.9002 1398 0.8672
UCSFCCF hCV540056 SPHK1 rs346802 C T 163 0.0376 32 0.0281 131 0.0409 C 4177 0.962 1106 0.9719 3071 0.9591
VSR hCV540056 SPHK1 rs346802 C T 90 0.033 26 0.0237 64 0.0394 C 2634 0.967 1072 0.9763 1562 0.9606
UCSFCCF hCV7917138 OR5H8P rs9822460 A G 860 0.1984 255 0.2241 605 0.1893 A 3474 0.802 883 0.7759 2591 0.8107
VSR hCV7917138 OR5H8P rs9822460 A G 538 0.1981 231 0.2115 307 0.189 A 2178 0.802 861 0.7885 1317 0.811
UCSFCCF hCV8147903 FLJ25715 rs680014 G A 971 0.2237 225 0.1977 746 0.233 G 3369 0.776 913 0.8023 2456 0.767
VSR hCV8147903 FLJ25715 rs680014 G A 577 0.2124 214 0.1963 363 0.2232 G 2139 0.788 876 0.8037 1263 0.7768
UCSFCCF hCV8754449 TESK2 rs781226 C T 1126 0.2596 277 0.2434 849 0.2653 C 3212 0.74 861 0.7566 2351 0.7347
VSR hCV8754449 TESK2 rs781226 C T 606 0.2226 218 0.1989 388 0.2386 C 2116 0.777 878 0.8011 1238 0.7614
UCSFCCF hCV8820007 rs938390 T A 1055 0.2432 265 0.2333 790 0.2467 T 3283 0.757 871 0.7667 2412 0.7533
VSR hCV8820007 rs938390 T A 651 0.2399 234 0.2135 417 0.2577 T 2063 0.76 862 0.7865 1201 0.7423
UCSFCCF hCV8942032 DDR1 rs1264352 G C 610 0.1406 179 0.1573 431 0.1347 G 3728 0.859 959 0.8427 2769 0.8653
VSR hCV8942032 DDR1 rs1264352 G C 366 0.1343 165 0.1505 201 0.1233 G 2360 0.866 931 0.8495 1429 0.8767

TABLE 19B
ALL Case Case Control Control ALL Case Case
Study Marker rs Genot cnt ALL frq cnt frq cnt frq Genot cnt ALL frq cnt frq
UCSFCCF hCV1053082 rs544115 T T 98 0.0452 17 0.0299 81 0.0507 T C 688 0.3173 182 0.3199
VSR hCV1053082 rs544115 T T 52 0.0382 16 0.0292 36 0.0442 T C 396 0.2907 145 0.2646
UCSFCCF hCV1116757 rs3794971 C C 85 0.0392 24 0.0422 61 0.0381 C T 674 0.3107 158 0.2777
VSR hCV1116757 rs3794971 C C 41 0.0306 13 0.024 28 0.0351 C T 372 0.2778 138 0.2546
UCSFCCF hCV11425801 rs3805953 C C 499 0.2298 143 0.2513 356 0.2222 C T 1070 0.4929 284 0.4991
VSR hCV11425801 rs3805953 C C 319 0.2347 140 0.2559 179 0.2204 C T 682 0.5018 274 0.5009
UCSFCCF hCV11425842 rs10948059 T T 486 0.2242 111 0.1954 375 0.2344 T C 1076 0.4963 291 0.5123
VSR hCV11425842 rs10948059 T T 283 0.2078 104 0.1898 179 0.2199 T C 692 0.5081 277 0.5055
UCSFCCF hCV11548152 rs11580249 T T 52 0.024 15 0.0264 37 0.0232 T G 603 0.2783 180 0.3163
VSR hCV11548152 rs11580249 T T 34 0.0249 17 0.0309 17 0.0209 T G 345 0.2527 150 0.2727
UCSFCCF hCV11738775 rs6754561 C C 279 0.1286 57 0.1002 222 0.1388 C T 1058 0.4878 280 0.4921
VSR hCV11738775 rs6754561 C C 201 0.1477 65 0.1186 136 0.1673 C T 623 0.4578 257 0.469
UCSFCCF hCV11758801 rs11841997 G G 4 0.0018 2 0.0035 2 0.0012 G C 123 0.0567 40 0.0704
VSR hCV11758801 rs11841997 G G 2 0.0015 2 0.0036 0 0 G C 83 0.0608 40 0.0727
UCSFCCF hCV11861255 rs529407 G G 144 0.0664 27 0.0475 117 0.0731 G A 750 0.3456 206 0.362
VSR hCV11861255 rs529407 G G 95 0.0706 30 0.0554 65 0.0809 G A 484 0.3599 185 0.3413
UCSFCCF hCV12071939 rs1950943 T T 94 0.0433 15 0.0264 79 0.0494 T G 741 0.3416 191 0.3357
VSR hCV12071939 rs1950943 T T 61 0.0448 25 0.0455 36 0.0443 T G 410 0.3008 143 0.26
UCSFCCF hCV1209800 rs35067690 T T 4 0.0018 0 0 4 0.0025 T G 199 0.0917 38 0.0669
VSR hCV1209800 rs35067690 T T 4 0.0029 0 0 4 0.0049 T G 103 0.0754 34 0.0617
UCSFCCF hCV1262973 rs229653 A A 29 0.0134 11 0.0193 18 0.0112 A G 324 0.1493 92 0.1617
VSR hCV1262973 rs229653 A A 16 0.0118 5 0.0093 11 0.0135 A G 245 0.1812 117 0.2175
UCSFCCF hCV1348610 rs3739636 A A 474 0.2187 135 0.2377 339 0.212 A G 1065 0.4915 289 0.5088
VSR hCV1348610 rs3739636 A A 301 0.2248 137 0.2566 164 0.2037 A G 621 0.4638 238 0.4457
UCSFCCF hCV1408483 rs17070848 T T 56 0.0258 14 0.0246 42 0.0262 T C 607 0.2799 181 0.3181
VSR hCV1408483 rs17070848 T T 50 0.0367 22 0.0401 28 0.0344 T C 426 0.3128 188 0.3431
UCSFCCF hCV1452085 rs12223005 A A 28 0.0129 3 0.0053 25 0.0156 A C 412 0.1899 105 0.1845
VSR hCV1452085 rs12223005 A A 17 0.0124 7 0.0127 10 0.0123 A C 245 0.1794 84 0.1525
UCSFCCF hCV15851766 rs2229995 A A 0 0 0 0 0 0 A G 87 0.0402 14 0.0246
VSR hCV15851766 rs2229995 A A 0 0 0 0 0 0 A G 59 0.044 15 0.0279
UCSFCCF hCV15857769 rs2924914 T T 212 0.0977 65 0.1142 147 0.0919 T C 890 0.4103 238 0.4183
VSR hCV15857769 rs2924914 T T 106 0.0778 53 0.0965 53 0.0651 T C 574 0.4211 225 0.4098
UCSFCCF hCV15879601 rs2275769 T T 13 0.006 2 0.0035 11 0.0069 T C 307 0.1414 66 0.116
VSR hCV15879601 rs2275769 T T 8 0.0059 0 0 8 0.0098 T C 155 0.1138 59 0.1075
UCSFCCF hCV16134786 rs2857595 A A 72 0.0332 22 0.0387 50 0.0312 A G 630 0.2906 182 0.3204
VSR hCV16134786 rs2857595 A A 53 0.0388 22 0.04 31 0.038 A G 404 0.296 183 0.3327
UCSFCCF hCV1619596 rs1048621 A A 186 0.0858 54 0.0949 132 0.0826 A G 826 0.3812 229 0.4025
VSR hCV1619596 rs1048621 A A 83 0.0609 37 0.0673 46 0.0565 A G 509 0.3732 223 0.4055
UCSFCCF hCV16336 rs362277 T T 31 0.0143 7 0.0123 24 0.015 T C 407 0.1875 93 0.1634
VSR hCV16336 rs362277 T T 15 0.011 2 0.0036 13 0.016 T C 264 0.1938 93 0.1697
UCSFCCF hCV1723718 rs12481805 A A 199 0.0918 61 0.1072 138 0.0863 A G 938 0.4327 255 0.4482
VSR hCV1723718 rs12481805 A A 123 0.0902 53 0.0965 70 0.086 A G 533 0.391 230 0.4189
UCSFCCF hCV1958451 rs2985822 T T 135 0.0623 30 0.0527 105 0.0657 T G 803 0.3704 196 0.3445
VSR hCV1958451 rs2985822 T T 90 0.0662 27 0.0495 63 0.0775 T G 496 0.365 194 0.3553
UCSFCCF hCV2121658 rs1187332 A A 23 0.0106 6 0.0106 17 0.0106 A G 488 0.2252 108 0.1905
VSR hCV2121658 rs1187332 A A 18 0.0133 3 0.0056 15 0.0185 A G 295 0.2185 113 0.2096
UCSFCCF hCV2358247 rs415989 G G 14 0.0065 2 0.0035 12 0.0075 G A 262 0.1208 84 0.1479
VSR hCV2358247 rs415989 G G 5 0.0037 5 0.0091 0 0 G A 140 0.1025 67 0.1216
UCSFCCF hCV2390937 rs739719 A A 12 0.0055 2 0.0035 10 0.0062 A C 294 0.1355 66 0.116
VSR hCV2390937 rs739719 A A 3 0.0022 1 0.0018 2 0.0025 A C 179 0.1311 58 0.1055
UCSFCCF hCV25473186 rs2880415 C C 488 0.2248 135 0.2373 353 0.2203 C T 1068 0.4919 296 0.5202
VSR hCV25473186 rs2880415 C C 246 0.1806 109 0.1993 137 0.1681 C T 689 0.5059 291 0.532
UCSFCCF hCV25596936 rs6967117 T T 13 0.006 2 0.0035 11 0.0069 T C 282 0.1299 88 0.1547
VSR hCV25596936 rs6967117 T T 15 0.011 7 0.0127 8 0.0098 T C 211 0.1548 104 0.1891
UCSFCCF hCV25615822 NONE T T 1 0.0005 1 0.0018 0 0 T C 112 0.0516 33 0.0581
VSR hCV25615822 NONE T T 2 0.0015 1 0.0018 1 0.0012 T C 109 0.0799 54 0.098
UCSFCCF hCV25983294 rs3739709 A A 75 0.0346 19 0.0335 56 0.035 A G 671 0.3092 152 0.2676
VSR hCV25983294 rs3739709 A A 64 0.047 23 0.0419 41 0.0505 A G 413 0.3035 151 0.275
UCSFCCF hCV2637554 rs3205421 C C 190 0.0877 64 0.1129 126 0.0788 C T 913 0.4215 240 0.4233
VSR hCV2637554 rs3205421 C C 139 0.1027 63 0.1158 76 0.0938 C T 564 0.4165 237 0.4357
UCSFCCF hCV26478797 rs2015018 A A 122 0.0563 31 0.0545 91 0.0569 A G 856 0.3948 204 0.3585
VSR hCV26478797 rs2015018 A A 95 0.0699 28 0.0513 67 0.0824 A G 531 0.3907 214 0.3919
UCSFCCF hCV26881276 rs2344829 G G 250 0.1154 66 0.1162 184 0.1151 G A 929 0.4287 260 0.4577
VSR hCV26881276 rs2344829 G G 183 0.1341 86 0.1564 97 0.119 G A 597 0.4374 246 0.4473
UCSFCCF hCV27077072 rs8060368 T T 237 0.1092 60 0.1054 177 0.1106 T C 955 0.4401 233 0.4095
VSR hCV27077072 rs8060368 T T 152 0.1114 54 0.0982 98 0.1204 T C 607 0.445 238 0.4327
UCSFCCF hCV27473671 rs3750465 C C 183 0.0843 54 0.0949 129 0.0805 C T 904 0.4164 249 0.4376
VSR hCV27473671 rs3750465 C C 103 0.0756 51 0.0927 52 0.064 C T 532 0.3906 222 0.4036
UCSFCCF hCV27494483 rs3748743 T T 12 0.0055 4 0.007 8 0.005 T C 202 0.0931 64 0.1125
VSR hCV27494483 rs3748743 T T 3 0.0022 2 0.0036 1 0.0012 T C 121 0.0888 59 0.1073
UCSFCCF hCV27504565 rs3219489 G G 138 0.0637 39 0.0685 99 0.0619 G C 859 0.3962 199 0.3497
VSR hCV27504565 rs3219489 G G 67 0.049 13 0.0236 54 0.0663 G C 460 0.3367 187 0.3394
UCSFCCF hCV27511436 rs3750145 C C 55 0.0255 5 0.0088 50 0.0314 C T 577 0.2675 147 0.2602
VSR hCV27511436 rs3750145 C C 47 0.0344 16 0.0291 31 0.038 C T 380 0.2784 141 0.2564
UCSFCCF hCV2769503 rs4787956 G G 253 0.1166 74 0.1301 179 0.1118 G A 989 0.4558 278 0.4886
VSR hCV2769503 rs4787956 G G 146 0.1087 65 0.1213 81 0.1004 G A 599 0.446 263 0.4907
UCSFCCF hCV27892569 rs4903741 C C 113 0.0523 35 0.0616 78 0.0489 C T 796 0.3682 219 0.3856
VSR hCV27892569 rs4903741 C C 88 0.0647 34 0.0617 54 0.0667 C T 450 0.3306 200 0.363
UCSFCCF hCV28036404 rs4812768 A A 99 0.0456 17 0.03 82 0.0512 A T 677 0.3121 182 0.321
VSR hCV28036404 rs4812768 A A 39 0.0287 13 0.0238 26 0.0319 A T 433 0.3184 156 0.2857
UCSFCCF hCV2851380 rs12445805 C C 32 0.0147 4 0.007 28 0.0175 C G 386 0.1779 91 0.1602
VSR hCV2851380 rs12445805 C C 21 0.0154 7 0.0127 14 0.0172 C G 278 0.2038 99 0.18
UCSFCCF hCV29401764 rs7793552 T T 223 0.1029 62 0.109 161 0.1007 T C 956 0.441 223 0.3919
VSR hCV29401764 rs7793552 T T 159 0.1169 58 0.1062 101 0.1241 T C 595 0.4375 221 0.4048
UCSFCCF hCV29537898 rs6073804 T T 23 0.0106 10 0.0176 13 0.0081 T C 347 0.1601 100 0.1761
VSR hCV29537898 rs6073804 T T 6 0.0044 5 0.0092 1 0.0012 T C 204 0.1504 90 0.1657
UCSFCCF hCV29539757 rs10110659 A A 192 0.0885 49 0.0863 143 0.0893 A C 927 0.4274 214 0.3768
VSR hCV29539757 rs10110659 A A 136 0.0998 46 0.0838 90 0.1106 A C 598 0.4387 226 0.4117
UCSFCCF hCV302629 rs9284183 G G 185 0.0853 68 0.1197 117 0.0731 G A 877 0.4045 223 0.3926
VSR hCV302629 rs9284183 G G 111 0.0819 55 0.1011 56 0.0691 G A 541 0.3993 209 0.3842
UCSFCCF hCV30308202 rs9482985 C C 101 0.0466 17 0.0299 84 0.0525 C G 715 0.3298 185 0.3251
VSR hCV30308202 rs9482985 C C 66 0.0485 25 0.0457 41 0.0504 C G 417 0.3064 150 0.2742
UCSFCCF hCV3054550 rs1559599 T T 50 0.023 17 0.0299 33 0.0206 T C 541 0.2492 155 0.2724
VSR hCV3054550 rs1559599 T T 36 0.0264 14 0.0254 22 0.027 T C 362 0.265 161 0.2922
UCSFCCF hCV3082219 rs1884833 A A 27 0.0124 7 0.0123 20 0.0125 A G 451 0.2078 134 0.2355
VSR hCV3082219 rs1884833 A A 21 0.0155 11 0.0203 10 0.0123 A G 302 0.223 137 0.2532
UCSFCCF hCV31137507 rs7660668 C C 162 0.0746 47 0.0826 115 0.0718 C G 841 0.3874 234 0.4112
VSR hCV31137507 rs7660668 C C 101 0.0742 46 0.0839 55 0.0676 C G 539 0.3957 225 0.4106
UCSFCCF hCV31227848 rs11809423 T T 4 0.0018 1 0.0018 3 0.0019 T C 164 0.0756 59 0.1037
VSR hCV31227848 rs11809423 T T 2 0.0015 1 0.0018 1 0.0012 T C 116 0.085 62 0.1129
UCSFCCF hCV31573621 rs11079818 C C 164 0.0755 36 0.0633 128 0.0799 C T 895 0.4123 223 0.3919
VSR hCV31573621 rs11079818 C C 100 0.0745 30 0.056 70 0.0867 C T 539 0.4013 216 0.403
UCSFCCF hCV31705214 rs12804599 T T 116 0.0534 41 0.0721 75 0.0468 T A 752 0.3464 201 0.3533
VSR hCV31705214 rs12804599 T T 71 0.052 31 0.0564 40 0.0491 T A 454 0.3326 204 0.3709
UCSFCCF hCV32160712 rs11079160 T T 57 0.0263 17 0.0299 40 0.025 T A 629 0.29 187 0.3286
VSR hCV32160712 rs11079160 T T 37 0.0273 20 0.0367 17 0.021 T A 358 0.2644 151 0.2771
UCSFCCF hCV435733 rs10276935 G G 226 0.1042 65 0.1142 161 0.1006 G C 894 0.4122 253 0.4446
VSR hCV435733 rs10276935 G G 132 0.0968 46 0.0838 86 0.1057 G C 555 0.4072 253 0.4608
UCSFCCF hCV454333 rs10916581 T T 42 0.0194 6 0.0106 36 0.0225 T C 506 0.2333 127 0.2236
VSR hCV454333 rs10916581 T T 25 0.0184 5 0.0091 20 0.0248 T C 274 0.2019 100 0.1815
UCSFCCF hCV540056 rs346802 T T 2 0.0009 1 0.0018 1 0.0006 T C 159 0.0733 30 0.0527
VSR hCV540056 rs346802 T T 0 0 0 0 0 0 T C 90 0.0661 26 0.0474
UCSFCCF hCV7917138 rs9822460 G G 94 0.0434 29 0.051 65 0.0407 G A 672 0.3101 197 0.3462
VSR hCV7917138 rs9822460 G G 53 0.039 29 0.0531 24 0.0296 G A 432 0.3181 173 0.3168
UCSFCCF hCV8147903 rs680014 A A 118 0.0544 25 0.0439 93 0.0581 A G 735 0.3387 175 0.3076
VSR hCV8147903 rs680014 A A 66 0.0486 21 0.0385 45 0.0554 A G 445 0.3277 172 0.3156
UCSFCCF hCV8754449 rs781226 T T 137 0.0632 37 0.065 100 0.0625 T C 852 0.3928 203 0.3568
VSR hCV8754449 rs781226 T T 73 0.0536 15 0.0274 58 0.0713 T C 460 0.338 188 0.3431
UCSFCCF hCV8820007 rs938390 A A 143 0.0659 29 0.0511 114 0.0712 A T 769 0.3545 207 0.3644
VSR hCV8820007 rs938390 A A 94 0.0693 28 0.0511 66 0.0816 A T 463 0.3412 178 0.3248
UCSFCCF hCV8942032 rs1264352 C C 46 0.0212 14 0.0246 32 0.02 C G 518 0.2388 151 0.2654
VSR hCV8942032 rs1264352 C C 34 0.0249 16 0.0292 18 0.0221 C G 298 0.2186 133 0.2427
Control Control ALL ALL Case Case Control Control
Study Marker rs cnt frq Genot cnt frq cnt frq cnt frq
UCSFCCF hCV1053082 rs544115 506 0.3164 C C 1382 0.6375 370 0.6503 1012 0.6329
VSR hCV1053082 rs544115 251 0.3084 C C 914 0.6711 387 0.7062 527 0.6474
UCSFCCF hCV1116757 rs3794971 516 0.3225 T T 1410 0.6501 387 0.6801 1023 0.6394
VSR hCV1116757 rs3794971 234 0.2936 T T 926 0.6916 391 0.7214 535 0.6713
UCSFCCF hCV11425801 rs3805953 786 0.4906 T T 602 0.2773 142 0.2496 460 0.2871
VSR hCV11425801 rs3805953 408 0.5025 T T 358 0.2634 133 0.2431 225 0.2771
UCSFCCF hCV11425842 rs10948059 785 0.4906 C C 606 0.2795 166 0.2923 440 0.275
VSR hCV11425842 rs10948059 415 0.5098 C C 387 0.2841 167 0.3047 220 0.2703
UCSFCCF hCV11548152 rs11580249 423 0.2647 G G 1512 0.6977 374 0.6573 1138 0.7121
VSR hCV11548152 rs11580249 195 0.2393 G G 986 0.7223 383 0.6964 603 0.7399
UCSFCCF hCV11738775 rs6754561 778 0.4862 T T 832 0.3836 232 0.4077 600 0.375
VSR hCV11738775 rs6754561 366 0.4502 T T 537 0.3946 226 0.4124 311 0.3825
UCSFCCF hCV11758801 rs11841997 83 0.0518 C C 2042 0.9414 526 0.9261 1516 0.9469
VSR hCV11758801 rs11841997 43 0.0528 C C 1280 0.9377 508 0.9236 772 0.9472
UCSFCCF hCV11861255 rs529407 544 0.3398 A A 1276 0.588 336 0.5905 940 0.5871
VSR hCV11861255 rs529407 299 0.3724 A A 766 0.5695 327 0.6033 439 0.5467
UCSFCCF hCV12071939 rs1950943 550 0.3438 G G 1334 0.615 363 0.638 971 0.6069
VSR hCV12071939 rs1950943 267 0.3284 G G 892 0.6544 382 0.6945 510 0.6273
UCSFCCF hCV1209800 rs35067690 161 0.1005 G G 1967 0.9065 530 0.9331 1437 0.897
VSR hCV1209800 rs35067690 69 0.0847 G G 1259 0.9217 517 0.9383 742 0.9104
UCSFCCF hCV1262973 rs229653 232 0.1449 G G 1817 0.8373 466 0.819 1351 0.8438
VSR hCV1262973 rs229653 128 0.1572 G G 1091 0.807 416 0.7732 675 0.8292
UCSFCCF hCV1348610 rs3739636 776 0.4853 G G 628 0.2898 144 0.2535 484 0.3027
VSR hCV1348610 rs3739636 383 0.4758 G G 417 0.3114 159 0.2978 258 0.3205
UCSFCCF hCV1408483 rs17070848 426 0.2662 C C 1506 0.6943 374 0.6573 1132 0.7075
VSR hCV1408483 rs17070848 238 0.2924 C C 886 0.6505 338 0.6168 548 0.6732
UCSFCCF hCV1452085 rs12223005 307 0.1918 C C 1730 0.7972 461 0.8102 1269 0.7926
VSR hCV1452085 rs12223005 161 0.1975 C C 1104 0.8082 460 0.8348 644 0.7902
UCSFCCF hCV15851766 rs2229995 73 0.0457 G G 2079 0.9598 554 0.9754 1525 0.9543
VSR hCV15851766 rs2229995 44 0.0549 G G 1281 0.956 523 0.9721 758 0.9451
UCSFCCF hCV15857769 rs2924914 652 0.4075 C C 1067 0.4919 266 0.4675 801 0.5006
VSR hCV15857769 rs2924914 349 0.4287 C C 683 0.5011 271 0.4936 412 0.5061
UCSFCCF hCV15879601 rs2275769 241 0.1504 C C 1851 0.8526 501 0.8805 1350 0.8427
VSR hCV15879601 rs2275769 96 0.1181 C C 1199 0.8803 490 0.8925 709 0.8721
UCSFCCF hCV16134786 rs2857595 448 0.28 G G 1466 0.6762 364 0.6408 1102 0.6888
VSR hCV16134786 rs2857595 221 0.2712 G G 908 0.6652 345 0.6273 563 0.6908
UCSFCCF hCV1619596 rs1048621 597 0.3736 G G 1155 0.533 286 0.5026 869 0.5438
VSR hCV1619596 rs1048621 286 0.3514 G G 772 0.566 290 0.5273 482 0.5921
UCSFCCF hCV16336 rs362277 314 0.196 C C 1733 0.7982 469 0.8243 1264 0.789
VSR hCV16336 rs362277 171 0.2101 C C 1083 0.7952 453 0.8266 630 0.774
UCSFCCF hCV1723718 rs12481805 683 0.4271 G G 1031 0.4756 253 0.4446 778 0.4866
VSR hCV1723718 rs12481805 303 0.3722 G G 707 0.5187 266 0.4845 441 0.5418
UCSFCCF hCV1958451 rs2985822 607 0.3796 G G 1230 0.5673 343 0.6028 887 0.5547
VSR hCV1958451 rs2985822 302 0.3715 G G 773 0.5688 325 0.5952 448 0.551
UCSFCCF hCV2121658 rs1187332 380 0.2375 G G 1656 0.7642 453 0.7989 1203 0.7519
VSR hCV2121658 rs1187332 182 0.2244 G G 1037 0.7681 423 0.7848 614 0.7571
UCSFCCF hCV2358247 rs415989 178 0.1112 A A 1892 0.8727 482 0.8486 1410 0.8812
VSR hCV2358247 rs415989 73 0.0896 A A 1221 0.8939 479 0.8693 742 0.9104
UCSFCCF hCV2390937 rs739719 228 0.1424 C C 1864 0.859 501 0.8805 1363 0.8513
VSR hCV2390937 rs739719 121 0.1485 C C 1183 0.8667 491 0.8927 692 0.8491
UCSFCCF hCV25473186 rs2880415 772 0.4819 T T 615 0.2833 138 0.2425 477 0.2978
VSR hCV25473186 rs2880415 398 0.4883 T T 427 0.3135 147 0.2687 280 0.3436
UCSFCCF hCV25596936 rs6967117 194 0.1211 C C 1876 0.8641 479 0.8418 1397 0.872
VSR hCV25596936 rs6967117 107 0.1316 C C 1137 0.8342 439 0.7982 698 0.8585
UCSFCCF hCV25615822 NONE 79 0.0493 C C 2056 0.9479 534 0.9401 1522 0.9507
VSR hCV25615822 NONE 55 0.0676 C C 1254 0.9187 496 0.9002 758 0.9312
UCSFCCF hCV25983294 rs3739709 519 0.324 G G 1424 0.6562 397 0.6989 1027 0.6411
VSR hCV25983294 rs3739709 262 0.3227 G G 884 0.6495 375 0.6831 509 0.6268
UCSFCCF hCV2637554 rs3205421 673 0.4209 T T 1063 0.4908 263 0.4638 800 0.5003
VSR hCV2637554 rs3205421 327 0.4037 T T 651 0.4808 244 0.4485 407 0.5025
UCSFCCF hCV26478797 rs2015018 652 0.4078 G G 1190 0.5489 334 0.587 856 0.5353
VSR hCV26478797 rs2015018 317 0.3899 G G 733 0.5394 304 0.5568 429 0.5277
UCSFCCF hCV26881276 rs2344829 669 0.4184 A A 988 0.4559 242 0.4261 746 0.4665
VSR hCV26881276 rs2344829 351 0.4307 A A 585 0.4286 218 0.3964 367 0.4503
UCSFCCF hCV27077072 rs8060368 722 0.451 C C 978 0.4507 276 0.4851 702 0.4385
VSR hCV27077072 rs8060368 369 0.4533 C C 605 0.4435 258 0.4691 347 0.4263
UCSFCCF hCV27473671 rs3750465 655 0.4089 T T 1084 0.4993 266 0.4675 818 0.5106
VSR hCV27473671 rs3750465 310 0.3818 T T 727 0.5338 277 0.5036 450 0.5542
UCSFCCF hCV27494483 rs3748743 138 0.0862 C C 1956 0.9014 501 0.8805 1455 0.9088
VSR hCV27494483 rs3748743 62 0.0763 C C 1239 0.909 489 0.8891 750 0.9225
UCSFCCF hCV27504565 rs3219489 660 0.4128 C C 1171 0.5401 331 0.5817 840 0.5253
VSR hCV27504565 rs3219489 273 0.335 C C 839 0.6142 351 0.637 488 0.5988
UCSFCCF hCV27511436 rs3750145 430 0.2701 T T 1525 0.707 413 0.731 1112 0.6985
VSR hCV27511436 rs3750145 239 0.2933 T T 938 0.6872 393 0.7145 545 0.6687
UCSFCCF hCV2769503 rs4787956 711 0.4441 A A 928 0.4276 217 0.3814 711 0.4441
VSR hCV2769503 rs4787956 336 0.4164 A A 598 0.4453 208 0.3881 390 0.4833
UCSFCCF hCV27892569 rs4903741 577 0.362 T T 1253 0.5796 314 0.5528 939 0.5891
VSR hCV27892569 rs4903741 250 0.3086 T T 823 0.6047 317 0.5753 506 0.6247
UCSFCCF hCV28036404 rs4812768 495 0.309 T T 1393 0.6422 368 0.649 1025 0.6398
VSR hCV28036404 rs4812768 277 0.3403 T T 888 0.6529 377 0.6905 511 0.6278
UCSFCCF hCV2851380 rs12445805 295 0.1841 G G 1752 0.8074 473 0.8327 1279 0.7984
VSR hCV2851380 rs12445805 179 0.2199 G G 1065 0.7808 444 0.8073 621 0.7629
UCSFCCF hCV29401764 rs7793552 733 0.4584 C C 989 0.4562 284 0.4991 705 0.4409
VSR hCV29401764 rs7793552 374 0.4595 C C 606 0.4456 267 0.489 339 0.4165
UCSFCCF hCV29537898 rs6073804 247 0.1545 C C 1797 0.8293 458 0.8063 1339 0.8374
VSR hCV29537898 rs6073804 114 0.1402 C C 1146 0.8451 448 0.825 698 0.8585
UCSFCCF hCV29539757 rs10110659 713 0.4453 C C 1050 0.4841 305 0.537 745 0.4653
VSR hCV29539757 rs10110659 372 0.457 C C 629 0.4615 277 0.5046 352 0.4324
UCSFCCF hCV302629 rs9284183 654 0.4088 A A 1106 0.5101 277 0.4877 829 0.5181
VSR hCV302629 rs9284183 332 0.4094 A A 703 0.5188 280 0.5147 423 0.5216
UCSFCCF hCV30308202 rs9482985 530 0.3315 G G 1352 0.6236 367 0.645 985 0.616
VSR hCV30308202 rs9482985 267 0.328 G G 878 0.6451 372 0.6801 506 0.6216
UCSFCCF hCV3054550 rs1559599 386 0.2409 C C 1580 0.7278 397 0.6977 1183 0.7385
VSR hCV3054550 rs1559599 201 0.2466 C C 968 0.7086 376 0.6824 592 0.7264
UCSFCCF hCV3082219 rs1884833 317 0.198 G G 1692 0.7797 428 0.7522 1264 0.7895
VSR hCV3082219 rs1884833 165 0.203 G G 1031 0.7614 393 0.7264 638 0.7847
UCSFCCF hCV31137507 rs7660668 607 0.3789 G G 1168 0.538 288 0.5062 880 0.5493
VSR hCV31137507 rs7660668 314 0.3857 G G 722 0.5301 277 0.5055 445 0.5467
UCSFCCF hCV31227848 rs11809423 105 0.0656 C C 2002 0.9226 509 0.8946 1493 0.9325
VSR hCV31227848 rs11809423 54 0.0663 C C 1246 0.9135 486 0.8852 760 0.9325
UCSFCCF hCV31573621 rs11079818 672 0.4195 T T 1112 0.5122 310 0.5448 802 0.5006
VSR hCV31573621 rs11079818 323 0.4002 T T 704 0.5242 290 0.541 414 0.513
UCSFCCF hCV31705214 rs12804599 551 0.3439 A A 1303 0.6002 327 0.5747 976 0.6092
VSR hCV31705214 rs12804599 250 0.3067 A A 840 0.6154 315 0.5727 525 0.6442
UCSFCCF hCV32160712 rs11079160 442 0.2762 A A 1483 0.6837 365 0.6415 1118 0.6988
VSR hCV32160712 rs11079160 207 0.2559 A A 959 0.7083 374 0.6862 585 0.7231
UCSFCCF hCV435733 rs10276935 641 0.4006 C C 1049 0.4836 251 0.4411 798 0.4988
VSR hCV435733 rs10276935 302 0.371 C C 676 0.496 250 0.4554 426 0.5233
UCSFCCF hCV454333 rs10916581 379 0.2367 C C 1621 0.7473 435 0.7658 1186 0.7408
VSR hCV454333 rs10916581 174 0.2159 C C 1058 0.7797 446 0.8094 612 0.7593
UCSFCCF hCV540056 rs346802 129 0.0806 C C 2009 0.9258 538 0.9455 1471 0.9188
VSR hCV540056 rs346802 64 0.0787 C C 1272 0.9339 523 0.9526 749 0.9213
UCSFCCF hCV7917138 rs9822460 475 0.2972 A A 1401 0.6465 343 0.6028 1058 0.6621
VSR hCV7917138 rs9822460 259 0.319 A A 873 0.6429 344 0.63 529 0.6515
UCSFCCF hCV8147903 rs680014 560 0.3498 G G 1317 0.6069 369 0.6485 948 0.5921
VSR hCV8147903 rs680014 273 0.3358 G G 847 0.6237 352 0.6459 495 0.6089
UCSFCCF hCV8754449 rs781226 649 0.4056 C C 1180 0.544 329 0.5782 851 0.5319
VSR hCV8754449 rs781226 272 0.3346 C C 828 0.6084 345 0.6296 483 0.5941
UCSFCCF hCV8820007 rs938390 562 0.351 T T 1257 0.5795 332 0.5845 925 0.5778
VSR hCV8820007 rs938390 285 0.3523 T T 800 0.5895 342 0.6241 458 0.5661
UCSFCCF hCV8942032 rs1264352 367 0.2294 G G 1605 0.74 404 0.71 1201 0.7506
VSR hCV8942032 rs1264352 165 0.2025 G G 1031 0.7564 399 0.7281 632 0.7755

TABLE 19C
DomGe DomGen RecGe RecGeno
HW(Control) allelicA allelicAsc allelicAsc notAsc otAsc notAsc tAsc
Study Marker rs pExact sc chi2 pAsym pExact chi2 pAsym chi2 pAsym
UCSFCCF hCV1053082 rs544115 9.57E−02 1.8813 1.70E−01 1.84E−01 0.5478 4.59E−01 4.1986 4.05E−02
VSR hCV1053082 rs544115 3.79E−01 5.9535 1.47E−02 1.54E−02 5.1272 2.36E−02 2.0145 1.56E−01
UCSFCCF hCV1116757 rs3794971 7.54E−01 1.8049 1.79E−01 1.91E−01 3.0663 7.99E−02 0.1832 6.69E−01
VSR hCV1116757 rs3794971 7.21E−01 4.3026 0.0381 0.0407 3.8015 0.0512 1.3504 0.2450
UCSFCCF hCV11425801 rs3805953 5.81E−01 3.7417 5.31E−02 5.74E−02 2.959 8.54E−02 2.008 1.56E−01
VSR hCV11425801 rs3805953 8.33E−01 3.1552 7.57E−02 7.83E−02 1.9414 1.64E−01 2.2927 1.30E−01
UCSFCCF hCV11425842 rs10948059 5.15E−01 2.6567 1.03E−01 1.04E−01 0.6196 4.31E−01 3.6571 5.58E−02
VSR hCV11425842 rs10948059 5.74E−01 2.7491 9.73E−02 9.99E−02 1.9136 1.67E−01 1.8051 1.79E−01
UCSFCCF hCV11548152 rs11580249 8.49E−01 5.1795 2.29E−02 2.49E−02 5.9849 1.44E−02 0.1844 6.68E−01
VSR hCV11548152 rs11580249 7.72E−01 3.669 5.54E−02 5.68E−02 3.1002 7.83E−02 1.3657 2.43E−01
UCSFCCF hCV11738775 rs6754561 2.44E−01 4.5652 3.26E−02 3.52E−02 1.902 1.68E−01 5.5721 1.82E−02
VSR hCV11738775 rs6754561 1.22E−01 4.301 3.81E−02 3.97E−02 1.223 2.69E−01 6.1599 1.31E−02
UCSFCCF hCV11758801 rs11841997 3.28E−01 3.8274 5.04E−02 5.52E−02 3.307 6.90E−02 1.1756 2.78E−01
VSR hCV11758801 rs11841997 1.00E+00 3.9487 4.69E−02 5.84E−02 3.133 7.67E−02 2.968 8.49E−02
UCSFCCF hCV11861255 rs529407 2.74E−03 0.9704 3.25E−01 3.32E−01 0.0198 8.87E−01 4.4502 3.49E−02
VSR hCV11861255 rs529407 1.76E−01 5.8243 1.58E−02 1.62E−02 4.2314 3.97E−02 3.2296 7.23E−02
UCSFCCF hCV12071939 rs1950943 9.42E−01 3.6497 5.61E−02 5.84E−02 1.7131 1.91E−01 5.3616 2.06E−02
VSR hCV12071939 rs1950943 9.15E−01 4.558 3.28E−02 3.42E−02 6.5586 1.04E−02 0.0106 9.15E−01
UCSFCCF hCV1209800 rs35067690 1.00E+00 6.8747 8.74E−03 9.31E−03 6.4426 1.11E−02 1.4208 2.33E−01
VSR hCV1209800 rs35067690 9.86E−02 4.5292 3.33E−02 3.77E−02 3.5355 6.01E−02 2.7122 9.96E−02
UCSFCCF hCV1262973 rs229653 3.31E−02 2.8401 9.19E−02 9.99E−02 1.9058 1.67E−01 2.0833 1.49E−01
VSR hCV1262973 rs229653 9.20E−02 4.7235 2.98E−02 3.25E−02 6.5217 1.07E−02 0.4932 4.82E−01
UCSFCCF hCV1348610 rs3739636 3.92E−01 4.7184 2.98E−02 3.18E−02 4.9229 2.65E−02 1.6159 2.04E−01
VSR hCV1348610 rs3739636 3.18E−01 3.6947 5.46E−02 5.73E−02 0.7744 3.79E−01 5.1413 2.34E−02
UCSFCCF hCV1408483 rs17070848 7.80E−01 3.5792 5.85E−02 6.33E−02 4.9851 2.56E−02 0.0452 8.31E−01
VSR hCV1408483 rs17070848 7.23E−01 4.0633 4.38E−02 4.77E−02 4.5874 3.22E−02 0.306 5.80E−01
UCSFCCF hCV1452085 rs12223005 2.06E−01 1.6991 1.92E−01 2.01E−01 0.8011 3.71E−01 3.5259 6.04E−02
VSR hCV1452085 rs12223005 1.00E+00 3.5065 6.11E−02 6.21E−02 4.2302 3.97E−02 0.005 9.36E−01
UCSFCCF hCV15851766 rs2229995 1.00E+00 4.7105 3.00E−02 3.54E−02 4.8091 2.83E−02
VSR hCV15851766 rs2229995 1.00E+00 5.444 1.96E−02 2.19E−02 5.5693 1.83E−02
UCSFCCF hCV15857769 rs2924914 4.01E−01 3.0613 8.02E−02 8.41E−02 1.8442 1.74E−01 2.3797 1.23E−01
VSR hCV15857769 rs2924914 8.13E−02 1.5429 2.14E−01 2.27E−01 0.2055 6.50E−01 4.5155 3.36E−02
UCSFCCF hCV15879601 rs2275769 8.69E−01 5.0195 2.51E−02 2.73E−02 4.7726 2.89E−02 0.7923 3.73E−01
VSR hCV15879601 rs2275769 4.68E−02 2.5557 1.10E−01 1.26E−01 1.3012 2.54E−01 5.4341 1.97E−02
UCSFCCF hCV16134786 rs2857595 5.97E−01 4.3847 3.63E−02 3.81E−02 4.3936 3.61E−02 0.7309 3.93E−01
VSR hCV16134786 rs2857595 1.14E−01 4.6354 3.13E−02 3.54E−02 5.9503 1.47E−02 0.0339 8.53E−01
UCSFCCF hCV1619596 rs1048621 4.21E−02 2.9988 8.33E−02 8.94E−02 2.857 9.10E−02 0.809 3.68E−01
VSR hCV1619596 rs1048621 6.94E−01 5.0407 2.48E−02 2.67E−02 5.6219 1.77E−02 0.6652 4.15E−01
UCSFCCF hCV16336 rs362277 3.82E−01 3.1329 7.67E−02 8.47E−02 3.2376 7.20E−02 0.2141 6.44E−01
VSR hCV16336 rs362277 7.41E−01 7.1876 7.34E−03 8.10E−03 5.5815 1.82E−02 4.5646 3.26E−02
UCSFCCF hCV1723718 rs12481805 5.13E−01 3.8839 4.88E−02 5.19E−02 2.9562 8.56E−02 2.1993 1.38E−01
VSR hCV1723718 rs12481805 9.24E−02 3.6917 5.47E−02 5.72E−02 4.3047 3.80E−02 0.444 5.05E−01
UCSFCCF hCV1958451 rs2985822 9.48E−01 4.1971 4.05E−02 4.14E−02 3.9539 4.68E−02 1.2038 2.73E−01
VSR hCV1958451 rs2985822 2.40E−01 4.5604 3.27E−02 3.35E−02 2.6009 1.07E−01 4.153 4.16E−02
UCSFCCF hCV2121658 rs1187332 3.41E−02 4.3002 3.81E−02 4.02E−02 5.1465 2.33E−02 0.0001 9.61E−01
VSR hCV2121658 rs1187332 7.57E−01 2.4843 1.15E−01 1.20E−01 1.3947 2.38E−01 4.1148 4.25E−02
UCSFCCF hCV2358247 rs415989 3.03E−02 2.7624 9.65E−02 9.75E−02 4.0243 4.48E−02 1.0344 3.09E−01
VSR hCV2358247 rs415989 4.00E−01 7.9749 4.74E−03 6.00E−03 5.853 1.56E−02 7.4228 6.44E−03
UCSFCCF hCV2390937 rs739719 8.61E−01 3.1417 7.63E−02 8.49E−02 2.9448 8.62E−02 0.5694 4.50E−01
VSR hCV2390937 rs739719 2.18E−01 5.0969 2.40E−02 2.44E−02 5.414 2.00E−02 0.0605 8.05E−01
UCSFCCF hCV25473186 rs2880415 2.28E−01 4.3841 3.63E−02 3.81E−02 6.3063 1.20E−02 0.6889 4.07E−01
VSR hCV25473186 rs2880415 8.85E−01 7.4863 6.22E−03 6.51E−03 8.5136 3.52E−03 2.1489 1.43E−01
UCSFCCF hCV25596936 rs6967117 1.59E−01 2.2975 1.30E−01 1.39E−01 3.2629 7.09E−02 0.7923 3.73E−01
VSR hCV25596936 rs6967117 1.24E−01 8.1435 4.32E−03 4.78E−03 8.6432 3.28E−03 0.2513 6.16E−01
UCSFCCF hCV25615822 NONE 6.23E−01 1.2345 2.67E−01 2.80E−01 0.9387 3.33E−01 2.82 9.31E−02
VSR hCV25615822 NONE 1.00E+00 4.1369 4.20E−02 4.98E−02 4.2329 3.96E−02 0.0772 7.81E−01
UCSFCCF hCV25983294 rs3739709 3.85E−01 4.819 2.81E−02 3.07E−02 6.2248 1.26E−02 0.0285 8.65E−01
VSR hCV25983294 rs3739709 3.44E−01 4.3198 3.77E−02 3.98E−02 4.5466 3.30E−02 0.5404 4.62E−01
UCSFCCF hCV2637554 rs3205421 3.62E−01 4.974 2.57E−02 2.85E−02 2.2274 1.36E−01 6.0734 1.37E−02
VSR hCV2637554 rs3205421 3.99E−01 4.3776 3.64E−02 3.80E−02 3.793 5.15E−02 1.707 1.91E−01
UCSFCCF hCV26478797 rs2015018 2.31E−02 3.2424 7.18E−02 7.43E−02 4.5232 3.34E−02 0.0466 8.29E−01
VSR hCV26478797 rs2015018 4.32E−01 3.0398 8.12E−02 8.40E−02 1.1134 2.91E−01 4.8681 2.74E−02
UCSFCCF hCV26881276 rs2344829 7.67E−02 1.6418 2.00E−01 2.12E−01 2.7694 9.61E−02 0.0052 9.35E−01
VSR hCV26881276 rs2344829 3.46E−01 5.9931 1.44E−02 1.60E−02 3.9019 4.82E−02 3.9451 4.70E−02
UCSFCCF hCV27077072 rs8060368 6.95E−01 2.5397 1.11E−01 1.14E−01 3.68 5.51E−02 0.1126 7.37E−01
VSR hCV27077072 rs8060368 1.00E+00 3.1185 7.74E−02 8.22E−02 2.4362 1.19E−01 1.6353 2.01E−01
UCSFCCF hCV27473671 rs3750465 9.51E−01 3.3546 6.70E−02 6.87E−02 3.1234 7.72E−02 1.1247 2.89E−01
VSR hCV27473671 rs3750465 9.27E−01 5.2115 2.24E−02 2.50E−02 3.367 6.65E−02 3.8604 4.94E−02
UCSFCCF hCV27494483 rs3748743 2.72E−02 3.9163 4.78E−02 5.21E−02 3.7863 5.17E−02 0.3155 5.74E−01
VSR hCV27494483 rs3748743 1.00E+00 4.7395 2.95E−02 3.30E−02 4.4302 3.53E−02 0.865 3.52E−01
UCSFCCF hCV27504565 rs3219489 4.17E−02 2.6893 1.01E−01 1.07E−01 5.3732 2.04E−02 0.3093 5.78E−01
VSR hCV27504565 rs3219489 6.37E−02 6.3249 1.19E−02 1.22E−02 2.0298 1.54E−01 12.829 3.41E−04
UCSFCCF hCV27511436 rs3750145 2.79E−01 4.7174 2.99E−02 2.96E−02 2.1238 1.45E−01 8.5394 3.48E−03
VSR hCV27511436 rs3750145 4.85E−01 3.434 6.39E−02 7.13E−02 3.2092 7.32E−02 0.7905 3.74E−01
UCSFCCF hCV2769503 rs4787956 9.55E−01 6.0949 1.36E−02 1.50E−02 6.7483 9.38E−03 1.3572 2.44E−01
VSR hCV2769503 rs4787956 5.09E−01 9.7933 1.75E−03 1.95E−03 11.821 5.86E−04 1.4515 2.28E−01
UCSFCCF hCV27892569 rs4903741 3.97E−01 2.7801 9.54E−02 9.57E−02 2.2605 1.33E−01 1.3606 2.43E−01
VSR hCV27892569 rs4903741 4.12E−03 1.8263 1.77E−01 1.79E−01 3.3443 6.74E−02 0.1334 7.15E−01
UCSFCCF hCV28036404 rs4812768 3.21E−02 1.2024 2.73E−01 2.82E−01 0.1544 6.94E−01 4.3224 3.76E−02
VSR hCV28036404 rs4812768 1.28E−01 5.3749 2.04E−02 2.13E−02 5.6716 1.72E−02 0.7758 3.78E−01
UCSFCCF hCV2851380 rs12445805 2.89E−02 4.529 3.33E−02 3.60E−02 3.185 7.43E−02 3.1432 7.62E−02
VSR hCV2851380 rs12445805 7.53E−01 3.7815 5.18E−02 5.25E−02 3.776 5.20E−02 0.433 5.11E−01
UCSFCCF hCV29401764 rs7793552 1.57E−01 2.3924 1.22E−01 1.30E−01 5.7341 1.66E−02 0.3114 5.77E−01
VSR hCV29401764 rs7793552 9.39E−01 5.9882 1.44E−02 1.46E−02 6.9627 8.32E−03 1.0087 3.15E−01
UCSFCCF hCV29537898 rs6073804 6.31E−01 4.1761 4.10E−02 4.70E−02 2.8557 9.10E−02 3.5835 5.84E−02
VSR hCV29537898 rs6073804 1.14E−01 3.821 5.06E−02 5.96E−02 2.7919 9.47E−02 4.704 3.01E−02
UCSFCCF hCV29539757 rs10110659 1.46E−01 5.5454 1.85E−02 1.97E−02 8.6151 3.33E−03 0.0484 8.25E−01
VSR hCV29539757 rs10110659 6.39E−01 7.379 6.60E−03 7.33E−03 6.8624 8.80E−03 2.6171 1.06E−01
UCSFCCF hCV302629 rs9284183 4.55E−01 6.072 1.37E−02 1.46E−02 1.5552 2.12E−01 11.66 6.39E−04
VSR hCV302629 rs9284183 4.28E−01 1.2194 2.69E−01 2.76E−01 0.0616 8.04E−01 4.4477 3.49E−02
UCSFCCF hCV30308202 rs9482985 2.71E−01 3.3551 6.70E−02 6.92E−02 1.5017 2.20E−01 4.8497 2.76E−02
VSR hCV30308202 rs9482985 4.66E−01 4.0472 4.42E−02 4.58E−02 4.8822 2.71E−02 0.1543 6.94E−01
UCSFCCF hCV3054550 rs1559599 8.36E−01 4.1733 4.11E−02 4.60E−02 3.5169 6.07E−02 1.6062 2.05E−01
VSR hCV3054550 rs1559599 3.36E−01 2.2114 1.37E−01 1.50E−01 3.0804 7.92E−02 0.0322 8.57E−01
UCSFCCF hCV3082219 rs1884833 1.00E+00 2.8129 9.35E−02 9.54E−02 3.4024 6.51E−02 0.0012 9.55E−01
VSR hCV3082219 rs1884833 1.00E+00 6.4474 1.11E−02 1.33E−02 6.0815 1.37E−02 1.3727 2.41E−01
UCSFCCF hCV31137507 rs7660668 4.76E−01 3.1157 7.75E−02 7.98E−02 3.147 7.61E−02 0.7113 3.99E−01
VSR hCV31137507 rs7660668 1.00E+00 2.7419 9.77E−02 1.04E−01 2.2328 1.35E−01 1.279 2.58E−01
UCSFCCF hCV31227848 rs11809423 4.36E−01 7.9108 4.91E−03 6.04E−03 8.4827 3.59E−03 0.0031 9.45E−01
VSR hCV31227848 rs11809423 1.00E+00 8.9352 2.80E−03 3.13E−03 9.2748 2.32E−03 0.0792 7.78E−01
UCSFCCF hCV31573621 rs11079818 4.66E−01 3.8384 5.01E−02 5.05E−02 3.2818 7.01E−02 1.663 1.97E−01
VSR hCV31573621 rs11079818 5.47E−01 2.7923 9.47E−02 1.03E−01 1.0148 3.14E−01 4.4251 3.54E−02
UCSFCCF hCV31705214 rs12804599 8.84E−01 4.2814 3.85E−02 3.94E−02 2.0882 1.48E−01 5.2885 2.15E−02
VSR hCV31705214 rs12804599 1.58E−01 5.9636 1.46E−02 1.60E−02 7.0819 7.79E−03 0.3533 5.52E−01
UCSFCCF hCV32160712 rs11079160 7.14E−01 5.7112 1.69E−02 1.94E−02 6.367 1.16E−02 0.3901 5.32E−01
VSR hCV32160712 rs11079160 8.90E−01 3.3547 6.70E−02 6.90E−02 2.1431 1.43E−01 3.0135 8.26E−02
UCSFCCF hCV435733 rs10276935 5.73E−02 4.9763 2.57E−02 2.77E−02 5.5811 1.82E−02 0.833 3.61E−01
VSR hCV435733 rs10276935 4.96E−03 1.658 1.98E−01 2.02E−01 6.059 1.38E−02 1.7917 1.81E−01
UCSFCCF hCV454333 rs10916581 4.08E−01 2.4396 1.18E−01 1.31E−01 1.3942 2.38E−01 3.1385 7.65E−02
VSR hCV454333 rs10916581 9.04E−02 6.7538 9.35E−03 9.52E−03 4.7879 2.87E−02 4.4834 3.42E−02
UCSFCCF hCV540056 rs346802 5.17E−01 3.8011 5.12E−02 5.63E−02 4.3627 3.67E−02 0.5851 4.44E−01
VSR hCV540056 rs346802 6.30E−01 5.0445 2.47E−02 2.84E−02 5.223 2.23E−02
UCSFCCF hCV7917138 rs9822460 2.21E−01 6.3815 1.15E−02 1.21E−02 6.4489 1.11E−02 1.0708 3.01E−01
VSR hCV7917138 rs9822460 3.02E−01 2.0808 1.49E−01 1.55E−01 0.6537 4.19E−01 4.8306 2.80E−02
UCSFCCF hCV8147903 rs680014 4.01E−01 6.0117 1.42E−02 1.45E−02 5.5927 1.80E−02 1.6351 2.01E−01
VSR hCV8147903 rs680014 3.63E−01 2.8258 9.28E−02 9.42E−02 1.9048 1.68E−01 1.996 1.58E−01
UCSFCCF hCV8754449 rs781226 1.09E−01 2.0954 1.48E−01 1.56E−01 3.6323 5.67E−02 0.0453 8.31E−01
VSR hCV8754449 rs781226 2.62E−02 5.9675 1.46E−02 1.46E−02 1.7282 1.89E−01 12.467 4.14E−04
UCSFCCF hCV8820007 rs938390 2.66E−02 0.8237 3.64E−01 3.76E−01 0.0782 7.79E−01 2.764 9.64E−02
VSR hCV8820007 rs938390 2.72E−02 7.008 8.11E−03 8.99E−03 4.5349 3.32E−02 4.7099 3.00E−02
UCSFCCF hCV8942032 rs1264352 5.20E−01 3.55 5.95E−02 6.61E−02 3.5971 5.79E−02 0.4287 5.13E−01
VSR hCV8942032 rs1264352 7.41E−02 4.1819 4.09E−02 4.49E−02 3.9886 4.58E−02 0.6813 4.09E−01
AddGe AddGeno OR.Ho OR.Ho
notAsc tAsc OR.Ho m.95CI. m.95CI. OR.Het. OR.Het. G
Study Marker rs chi2 pAsym m L U OR.Het 95CI.L 95CI.U Statistic
UCSFCCF hCV1053082 rs544115 1.8401 1.75E−01 0.574 0.3358 0.9814 0.9838 0.7998 1.2101 4.5688
VSR hCV1053082 rs544115 5.7805 1.62E−02 0.6052 0.331 1.1065 0.7867 0.617 1.003 5.8263
UCSFCCF hCV1116757 rs3794971 1.7897 1.81E−01 1.04 0.6394 1.6918 0.8094 0.654 1.0017 3.9968
VSR hCV1116757 rs3794971 4.246 0.0393 0.6353 0.3249 1.2422 0.8069 0.63 1.0336 4.2673
UCSFCCF hCV11425801 rs3805953 3.6971 5.45E−02 1.3012 0.993 1.7051 1.1705 0.9281 1.4761 3.7602
VSR hCV11425801 rs3805953 3.1695 7.50E−02 1.3231 0.9724 1.8004 1.1361 0.873 1.4785 3.1782
UCSFCCF hCV11425842 rs10948059 2.6452 1.04E−01 0.7846 0.5948 1.035 0.9826 0.7858 1.2287 3.7537
VSR hCV11425842 rs10948059 2.8113 9.36E−02 0.7654 0.5589 1.0482 0.8793 0.6833 1.1315 2.8121
UCSFCCF hCV11548152 rs11580249 5.2806 2.16E−02 1.2336 0.6694 2.273 1.2948 1.0496 1.5973 5.8774
VSR hCV11548152 rs11580249 3.6121 5.74E−02 1.5744 0.7942 3.1213 1.2111 0.9447 1.5526 3.5834
UCSFCCF hCV11738775 rs6754561 4.7722 2.89E−02 0.664 0.4783 0.9219 0.9308 0.759 1.1414 6.296
VSR hCV11738775 rs6754561 4.1958 4.05E−02 0.6577 0.4674 0.9255 0.9663 0.7646 1.2211 6.3672
UCSFCCF hCV11758801 rs11841997 3.7093 5.41E−02 2.8821 0.405 20.513 1.389 0.9403 2.0517 3.3582
VSR hCV11758801 rs11841997 3.892 4.85E−02 1.4137 0.906 2.2057
UCSFCCF hCV11861255 rs529407 0.9239 3.36E−01 0.6456 0.4172 0.9991 1.0594 0.8647 1.2979 5.0497
VSR hCV11861255 rs529407 5.5905 1.81E−02 0.6196 0.3928 0.9773 0.8306 0.6583 1.0482 5.7533
UCSFCCF hCV12071939 rs1950943 3.7053 5.42E−02 0.5079 0.2887 0.8937 0.9289 0.7575 1.1392 6.4
VSR hCV12071939 rs1950943 4.3724 3.65E−02 0.9271 0.5472 1.5708 0.715 0.561 0.9113 7.4172
UCSFCCF hCV1209800 rs35067690 6.9406 8.43E−03 0 0.6399 0.4432 0.9239
VSR hCV1209800 rs35067690 4.3855 3.62E−02 0 0.7072 0.462 1.0826
UCSFCCF hCV1262973 rs229653 2.6543 1.03E−01 1.7717 0.8307 3.7788 1.1497 0.8834 1.4962 2.9516
VSR hCV1262973 rs229653 4.6556 3.10E−02 0.7375 0.2545 2.1377 1.4832 1.1222 1.9602 7.9944
UCSFCCF hCV1348610 rs3739636 4.6621 3.08E−02 1.3385 1.019 1.7582 1.2518 0.9947 1.5753 5.2978
VSR hCV1348610 rs3739636 3.4678 6.26E−02 1.3555 1.0033 1.8313 1.0083 0.7811 1.3017 5.0887
UCSFCCF hCV1408483 rs17070848 3.6225 5.70E−02 1.0089 0.5449 1.8681 1.286 1.0429 1.5858 5.472
VSR hCV1408483 rs17070848 4.0784 4.34E−02 1.2739 0.7171 2.263 1.2807 1.0131 1.619 4.5423
UCSFCCF hCV1452085 rs12223005 1.6769 1.95E−01 0.3303 0.0993 1.0993 0.9415 0.7362 1.2039 4.3881
VSR hCV1452085 rs12223005 3.431 6.40E−02 0.98 0.3703 2.5937 0.7304 0.5467 0.9759 4.5378
UCSFCCF hCV15851766 rs2229995 4.8091 2.83E−02 0.5279 0.2956 0.9429
VSR hCV15851766 rs2229995 5.5693 1.83E−02 0.4941 0.2721 0.8972
UCSFCCF hCV15857769 rs2924914 2.9769 8.45E−02 1.3315 0.9638 1.8396 1.0992 0.8971 1.3468 3.1352
VSR hCV15857769 rs2924914 1.5844 2.08E−01 1.5203 1.0085 2.2918 0.9801 0.781 1.23 4.4526
UCSFCCF hCV15879601 rs2275769 5.012 2.52E−02 0.4899 0.1082 2.2181 0.7379 0.5516 0.9872 5.1115
VSR hCV15879601 rs2275769 2.4744 1.16E−01 0 0.8893 0.6304 1.2545
UCSFCCF hCV16134786 rs2857595 4.3449 3.71E−02 1.3321 0.7957 2.23 1.2299 0.9978 1.5159 4.4069
VSR hCV16134786 rs2857595 4.5185 3.35E−02 1.1581 0.6598 2.0327 1.3513 1.0658 1.7133 6.1591
UCSFCCF hCV1619596 rs1048621 2.8638 9.06E−02 1.243 0.8815 1.7527 1.1655 0.9517 1.4273 2.9745
VSR hCV1619596 rs1048621 5.0508 2.46E−02 1.3369 0.8468 2.1107 1.2959 1.032 1.6274 5.6095
UCSFCCF hCV16336 rs362277 3.0502 8.07E−02 0.7861 0.3365 1.8365 0.7982 0.6189 1.0296 3.2722
VSR hCV16336 rs362277 7.2354 7.15E−03 0.214 0.048 0.9528 0.7564 0.5717 1.0007 9.0123
UCSFCCF hCV1723718 rs12481805 3.9421 4.71E−02 1.3593 0.9742 1.8965 1.1481 0.9381 1.4051 3.9209
VSR hCV1723718 rs12481805 3.5428 5.98E−02 1.2553 0.8516 1.8502 1.2585 1.0007 1.5826 4.2931
UCSFCCF hCV1958451 rs2985822 4.174 4.10E−02 0.7389 0.4833 1.1295 0.835 0.6812 1.0236 4.2666
VSR hCV1958451 rs2985822 4.4562 3.48E−02 0.5908 0.3682 0.948 0.8855 0.7035 1.1145 5.3527
UCSFCCF hCV2121658 rs1187332 4.49 3.41E−02 0.9373 0.3672 2.3922 0.7548 0.594 0.959 5.3775
VSR hCV2121658 rs1187332 2.5241 1.12E−01 0.2903 0.0835 1.009 0.9012 0.6911 1.1752 5.1433
UCSFCCF hCV2358247 rs415989 2.6772 1.02E−01 0.4876 0.1087 2.1862 1.3805 1.0441 1.8253 5.9832
VSR hCV2358247 rs415989 7.8768 5.01E−03 1.4217 1.0009 2.0194
UCSFCCF hCV2390937 rs739719 3.1343 7.67E−02 0.5441 0.1188 2.4919 0.7875 0.5878 1.0551 3.1758
VSR hCV2390937 rs739719 5.2977 2.14E−02 0.7047 0.0637 7.7934 0.6756 0.4839 0.9432 5.0842
UCSFCCF hCV25473186 rs2880415 4.3289 3.75E−02 1.3219 1.0048 1.7391 1.3253 1.0508 1.6714 6.4292
VSR hCV25473186 rs2880415 7.7174 5.47E−03 1.5155 1.0992 2.0894 1.3927 1.0842 1.789 8.9051
UCSFCCF hCV25596936 rs6967117 2.2646 1.32E−01 0.5303 0.1171 2.401 1.3229 1.0074 1.7373 4.7012
VSR hCV25596936 rs6967117 7.8335 5.13E−03 1.3912 0.501 3.8636 1.5454 1.1505 2.0759 8.4034
UCSFCCF hCV25615822 NONE 1.2457 2.64E−01 1.1906 0.7838 1.8085
VSR hCV25615822 NONE 4.1629 4.13E−02 1.5282 0.0954 24.49 1.5004 1.0137 2.2209 3.6716
UCSFCCF hCV25983294 rs3739709 4.8577 2.75E−02 0.8777 0.515 1.4958 0.7576 0.6112 0.9391 6.5483
VSR hCV25983294 rs3739709 4.1249 4.23E−02 0.7614 0.4492 1.2907 0.7823 0.615 0.9951 4.5596
UCSFCCF hCV2637554 rs3205421 5.0067 2.52E−02 1.5451 1.1091 2.1524 1.0848 0.8856 1.3286 6.3881
VSR hCV2637554 rs3205421 4.2587 3.90E−02 1.3827 0.9553 2.0013 1.2089 0.96 1.5224 4.2815
UCSFCCF hCV26478797 rs2015018 3.3871 6.57E−02 0.8731 0.5698 1.3378 0.8019 0.6554 0.9812 4.6697
VSR hCV26478797 rs2015018 3.047 8.09E−02 0.5897 0.3705 0.9388 0.9527 0.759 1.1958 5.2035
UCSFCCF hCV26881276 rs2344829 1.5938 2.07E−01 1.1057 0.8058 1.5173 1.198 0.9771 1.4689 3.0209
VSR hCV26881276 rs2344829 5.7504 1.65E−02 1.4926 1.0675 2.087 1.1799 0.9339 1.4906 5.8097
UCSFCCF hCV27077072 rs8060368 2.5305 1.12E−01 0.8622 0.6234 1.1924 0.8208 0.67 1.0055 3.7499
VSR hCV27077072 rs8060368 3.1197 7.74E−02 0.7411 0.5123 1.072 0.8675 0.6898 1.0909 3.1285
UCSFCCF hCV27473671 rs3750465 3.3751 6.62E−02 1.2873 0.9103 1.8204 1.169 0.9561 1.4294 3.4061
VSR hCV27473671 rs3750465 5.1535 2.32E−02 1.5933 1.0529 2.4111 1.1634 0.926 1.4617 5.4661
UCSFCCF hCV27494483 rs3748743 3.7048 5.43E−02 1.4521 0.4354 4.843 1.3469 0.9846 1.8425 3.5554
VSR hCV27494483 rs3748743 4.7363 2.95E−02 3.0675 0.2774 33.922 1.4595 1.0039 2.122 4.3507
UCSFCCF hCV27504565 rs3219489 2.7588 9.67E−02 0.9997 0.6757 1.4792 0.7652 0.6244 0.9376 7.0162
VSR hCV27504565 rs3219489 6.2596 1.24E−02 0.3347 0.1799 0.6227 0.9523 0.7558 1.2 14.186
UCSFCCF hCV27511436 rs3750145 4.7125 2.99E−02 0.2692 0.1066 0.6798 0.9205 0.7397 1.1455 10.955
VSR hCV27511436 rs3750145 3.3344 6.78E−02 0.7158 0.3861 1.3267 0.8181 0.6402 1.0455 3.3771
UCSFCCF hCV2769503 rs4787956 6.1512 1.31E−02 1.3545 0.9929 1.8479 1.2811 1.0429 1.5738 6.9114
VSR hCV2769503 rs4787956 9.8523 1.70E−03 1.5046 1.0422 2.1723 1.4676 1.1624 1.853 11.864
UCSFCCF hCV27892569 rs4903741 2.8366 9.21E−02 1.3419 0.8828 2.0397 1.135 0.9281 1.3881 2.8209
VSR hCV27892569 rs4903741 1.7125 1.91E−01 1.005 0.6399 1.5785 1.277 1.0116 1.612 4.3397
UCSFCCF hCV28036404 rs4812768 1.1665 2.80E−01 0.5774 0.3379 0.9867 1.0241 0.8322 1.2603 4.7358
VSR hCV28036404 rs4812768 5.6186 1.78E−02 0.6777 0.3437 1.3363 0.7634 0.6022 0.9676 5.7808
UCSFCCF hCV2851380 rs12445805 4.3423 3.72E−02 0.3863 0.1348 1.1071 0.8341 0.6447 1.0792 5.5293
VSR hCV2851380 rs12445805 3.7227 5.37E−02 0.6993 0.28 1.7468 0.7736 0.5881 1.0174 3.8106
UCSFCCF hCV29401764 rs7793552 2.411 1.20E−01 0.956 0.6916 1.3214 0.7552 0.6161 0.9257 7.6343
VSR hCV29401764 rs7793552 5.8764 1.53E−02 0.7291 0.5084 1.0456 0.7503 0.5955 0.9452 6.9627
UCSFCCF hCV29537898 rs6073804 4.0584 4.40E−02 2.2489 0.9794 5.1638 1.1836 0.9169 1.528 4.7982
VSR hCV29537898 rs6073804 3.9237 4.76E−02 7.7902 0.9071 66.901 1.23 0.9105 1.6616 6.3117
UCSFCCF hCV29539757 rs10110659 5.6203 1.78E−02 0.837 0.5894 1.1886 0.7331 0.5986 0.8979 9.1106
VSR hCV29539757 rs10110659 7.4502 6.34E−03 0.6495 0.4404 0.9579 0.772 0.6145 0.97 7.5953
UCSFCCF hCV302629 rs9284183 5.9952 1.43E−02 1.7394 1.2525 2.4155 1.0205 0.8322 1.2514 10.938
VSR hCV302629 rs9284183 1.2037 2.73E−01 1.4837 0.993 2.2169 0.951 0.7559 1.1966 4.5406
UCSFCCF hCV30308202 rs9482985 3.3181 6.85E−02 0.5432 0.3182 0.9273 0.9368 0.7625 1.151 5.6664
VSR hCV30308202 rs9482985 3.8598 4.95E−02 0.8294 0.4955 1.3882 0.7642 0.6007 0.9721 4.9764
UCSFCCF hCV3054550 rs1559599 4.1327 4.21E−02 1.5351 0.8458 2.7861 1.1966 0.9619 1.4885 4.0552
VSR hCV3054550 rs1559599 2.193 1.39E−01 1.0019 0.5064 1.9825 1.2611 0.9878 1.6101 3.4557
UCSFCCF hCV3082219 rs1884833 2.8432 9.18E−02 1.0336 0.434 2.4615 1.2484 0.9921 1.5709 3.4741
VSR hCV3082219 rs1884833 6.4841 1.09E−02 1.7858 0.7515 4.2435 1.3479 1.0403 1.7465 6.3282
UCSFCCF hCV31137507 rs7660668 3.0745 7.95E−02 1.2488 0.8674 1.798 1.1779 0.9633 1.4403 3.228
VSR hCV31137507 rs7660668 2.7397 9.79E−02 1.3436 0.8834 2.0436 1.1512 0.9168 1.4454 2.724
UCSFCCF hCV31227848 rs11809423 7.8545 5.07E−03 0.9777 0.1015 9.4209 1.6482 1.1797 2.3027 7.5344
VSR hCV31227848 rs11809423 9.0359 2.65E−03 1.5638 0.0976 25.061 1.7955 1.2252 2.6312 8.0196
UCSFCCF hCV31573621 rs11079818 3.9118 4.79E−02 0.7276 0.4915 1.0772 0.8585 0.7027 1.0489 3.9481
VSR hCV31573621 rs11079818 2.8097 9.37E−02 0.6118 0.3888 0.9627 0.9547 0.7597 1.1997 4.7176
UCSFCCF hCV31705214 rs12804599 4.2313 3.97E−02 1.6316 1.0929 2.436 1.0888 0.8875 1.3357 5.6238
VSR hCV31705214 rs12804599 5.8152 1.59E−02 1.2917 0.7918 2.1071 1.36 1.0787 1.7147 7.0676
UCSFCCF hCV32160712 rs11079160 5.8369 1.57E−02 1.3018 0.7291 2.3242 1.2959 1.0527 1.5953 6.2375
VSR hCV32160712 rs11079160 3.3083 6.89E−02 1.8402 0.9516 3.5585 1.141 0.8916 1.4602 4.0086
UCSFCCF hCV435733 rs10276935 4.7987 2.85E−02 1.2836 0.9311 1.7695 1.2548 1.0241 1.5376 5.6002
VSR hCV435733 rs10276935 1.6077 2.05E−01 0.9114 0.6167 1.347 1.4275 1.1357 1.7943 11.119
UCSFCCF hCV454333 rs10916581 2.4218 1.20E−01 0.4544 0.1901 1.086 0.9136 0.7266 1.1488 4.1171
VSR hCV454333 rs10916581 6.4961 1.08E−02 0.343 0.1278 0.921 0.7886 0.5993 1.0378 7.7331
UCSFCCF hCV540056 rs346802 3.8532 4.97E−02 2.7342 0.1707 43.792 0.6359 0.4223 0.9575 4.7627
VSR hCV540056 rs346802 5.223 2.23E−02 0.5818 0.3639 0.9302
UCSFCCF hCV7917138 rs9822460 6.2249 1.26E−02 1.3762 0.8737 2.1676 1.2793 1.0412 1.5718 6.4455
VSR hCV7917138 rs9822460 2.0835 1.49E−01 1.8582 1.0639 3.2454 1.0272 0.8116 1.3 4.742
UCSFCCF hCV8147903 rs680014 5.8658 1.54E−02 0.6906 0.437 1.0914 0.8028 0.6521 0.9885 6.0203
VSR hCV8147903 rs680014 2.7684 9.61E−02 0.6562 0.3841 1.1213 0.886 0.7007 1.1204 3.0613
UCSFCCF hCV8754449 rs781226 2.1424 1.43E−01 0.9571 0.6428 1.425 0.8091 0.6607 0.9907 4.2677
VSR hCV8754449 rs781226 5.8303 1.58E−02 0.3621 0.2018 0.6495 0.9676 0.7676 1.2199 13.591
UCSFCCF hCV8820007 rs938390 0.7944 3.73E−01 0.7088 0.4627 1.0857 1.0262 0.8379 1.2569 2.9617
VSR hCV8820007 rs938390 6.5843 1.03E−02 0.5681 0.3573 0.9033 0.8364 0.662 1.0567 7.1036
UCSFCCF hCV8942032 rs1264352 3.5083 6.11E−02 1.3006 0.6871 2.4618 1.2231 0.9811 1.5249 3.5479
VSR hCV8942032 rs1264352 3.947 4.70E−02 1.408 0.7097 2.7931 1.2768 0.9839 1.6567 3.9974
G
Statistic OR99C OR99C OR95C OR95C
Study Marker rs pAsym OR std.In(OR) I.L I.U I.L I.U
UCSFCCF hCV1053082 rs544115 1.02E−01 0.8873 0.0872 0.7088 1.1108 0.7479 1.0527
VSR hCV1053082 rs544115 5.43E−02 0.7782 0.103 0.5969 1.0145 0.636 0.9521
UCSFCCF hCV1116757 rs3794971 1.36E−01 0.8876 0.0888 0.7061 1.1157 0.7458 1.0563
VSR hCV1116757 rs3794971 1.18E−01 0.8016 0.1068 0.6088 1.0553 0.6502 0.9881
UCSFCCF hCV11425801 rs3805953 1.53E−01 1.1429 0.0691 0.9566 1.3654 0.9982 1.3085
VSR hCV11425801 rs3805953 2.04E−01 1.1491 0.0783 0.9393 1.4059 0.9857 1.3397
UCSFCCF hCV11425842 rs10948059 1.53E−01 0.8932 0.0693 0.7471 1.0678 0.7797 1.0232
VSR hCV11425842 rs10948059 2.45E−01 0.878 0.0785 0.7173 1.0747 0.7528 1.024
UCSFCCF hCV11548152 rs11580249 5.29E−02 1.2289 0.0907 0.9729 1.5522 1.0288 1.4679
VSR hCV11548152 rs11580249 1.67E−01 1.2289 0.1077 0.9311 1.622 0.995 1.5179
UCSFCCF hCV11738775 rs6754561 4.29E−02 0.8572 0.0722 0.7118 1.0323 0.7442 0.9874
VSR hCV11738775 rs6754561 4.14E−02 0.8453 0.0811 0.686 1.0416 0.7211 0.9909
UCSFCCF hCV11758801 rs11841997 1.87E−01 1.4427 0.1883 0.8882 2.3432 0.9974 2.0867
VSR hCV11758801 rs11841997 1.5378 0.2181 0.8769 2.6969 1.0029 2.3579
UCSFCCF hCV11861255 rs529407 8.01E−02 0.9226 0.0817 0.7474 1.1389 0.786 1.083
VSR hCV11861255 rs529407 5.63E−02 0.8012 0.0919 0.6322 1.0153 0.669 0.9594
UCSFCCF hCV12071939 rs1950943 4.08E−02 0.8483 0.0862 0.6794 1.0592 0.7164 1.0044
VSR hCV12071939 rs1950943 2.45E−02 0.8078 0.1001 0.6243 1.0453 0.664 0.9829
UCSFCCF hCV1209800 rs35067690 0.6215 0.183 0.388 0.9957 0.4342 0.8896
VSR hCV1209800 rs35067690 0.6421 0.2097 0.3741 1.102 0.4257 0.9685
UCSFCCF hCV1262973 rs229653 2.29E−01 1.2188 0.1176 0.9004 1.6498 0.968 1.5346
VSR hCV1262973 rs229653 1.84E−02 1.3186 0.1276 0.9493 1.8315 1.0269 1.6932
UCSFCCF hCV1348610 rs3739636 7.07E−02 1.162 0.0692 0.9724 1.3886 1.0147 1.3307
VSR hCV1348610 rs3739636 7.85E−02 1.1644 0.0792 0.9495 1.4278 0.997 1.3598
UCSFCCF hCV1408483 rs17070848 6.48E−02 1.1866 0.0905 0.9398 1.4982 0.9937 1.417
VSR hCV1408483 rs17070848 1.03E−01 1.2184 0.0981 0.9464 1.5685 1.0053 1.4766
UCSFCCF hCV1452085 rs12223005 1.11E−01 0.8613 0.1146 0.6411 1.1571 0.688 1.0783
VSR hCV1452085 rs12223005 1.03E−01 0.7814 0.132 0.5562 1.0978 0.6033 1.0121
UCSFCCF hCV15851766 rs2229995 0.5338 0.2938 0.2504 1.1379 0.3001 0.9495
VSR hCV15851766 rs2229995 0.5012 0.3016 0.2305 1.0901 0.2775 0.9053
UCSFCCF hCV15857769 rs2924914 2.09E−01 1.1387 0.0743 0.9404 1.3788 0.9845 1.3172
VSR hCV15857769 rs2924914 1.08E−01 1.1125 0.0859 0.8918 1.388 0.9402 1.3165
UCSFCCF hCV15879601 rs2275769 7.76E−02 0.7329 0.1392 0.5121 1.0489 0.558 0.9628
VSR hCV15879601 rs2275769 0.7676 0.1658 0.5008 1.1767 0.5546 1.0624
UCSFCCF hCV16134786 rs2857595 1.10E−01 1.2019 0.0879 0.9584 1.5073 1.0117 1.4278
VSR hCV16134786 rs2857595 4.60E−02 1.2376 0.0991 0.9587 1.5977 1.0191 1.5031
UCSFCCF hCV1619596 rs1048621 2.26E−01 1.141 0.0762 0.9377 1.3884 0.9827 1.3248
VSR hCV1619596 rs1048621 6.05E−02 1.2231 0.0898 0.9706 1.5413 1.0258 1.4584
UCSFCCF hCV16336 rs362277 1.95E−01 0.8148 0.1159 0.6045 1.0982 0.6492 1.0226
VSR hCV16336 rs362277 1.10E−02 0.7053 0.1307 0.5037 0.9876 0.5459 0.9113
UCSFCCF hCV1723718 rs12481805 1.41E−01 1.1566 0.0739 0.9562 1.399 1.0007 1.3368
VSR hCV1723718 rs12481805 1.17E−01 1.1795 0.086 0.9452 1.4719 0.9966 1.396
UCSFCCF hCV1958451 rs2985822 1.18E−01 0.8459 0.0818 0.6853 1.0442 0.7206 0.9929
VSR hCV1958451 rs2985822 6.88E−02 0.8225 0.0916 0.6496 1.0413 0.6873 0.9842
UCSFCCF hCV2121658 rs1187332 6.80E−02 0.7964 0.11 0.5999 1.0572 0.642 0.9879
VSR hCV2121658 rs1187332 7.64E−02 0.8253 0.122 0.6028 1.1299 0.6498 1.0481
UCSFCCF hCV2358247 rs415989 5.02E−02 1.2462 0.1327 0.8855 1.754 0.9609 1.6163
VSR hCV2358247 rs415989 1.6023 0.1682 1.0388 2.4713 1.1522 2.2281
UCSFCCF hCV2390937 rs739719 2.04E−01 0.7807 0.14 0.5444 1.1196 0.5934 1.0272
VSR hCV2390937 rs739719 7.87E−02 0.6946 0.1622 0.4575 1.0547 0.5055 0.9545
UCSFCCF hCV25473186 rs2880415 4.02E−02 1.1555 0.0691 0.9672 1.3806 1.0092 1.3231
VSR hCV25473186 rs2880415 1.16E−02 1.2404 0.0788 1.0126 1.5194 1.0629 1.4475
UCSFCCF hCV25596936 rs6967117 9.53E−02 1.2167 0.1296 0.8714 1.6988 0.9438 1.5685
VSR hCV25596936 rs6967117 1.50E−02 1.4683 0.1352 1.0364 2.0802 1.1264 1.914
UCSFCCF hCV25615822 NONE 1.2567 0.2061 0.7391 2.1366 0.8391 1.882
VSR hCV25615822 NONE 1.59E−01 1.4756 0.1923 0.8991 2.4217 1.0121 2.1512
UCSFCCF hCV25983294 rs3739709 3.78E−02 0.819 0.0911 0.6477 1.0355 0.6851 0.979
VSR hCV25983294 rs3739709 1.02E−01 0.8136 0.0994 0.6298 1.0509 0.6696 0.9885
UCSFCCF hCV2637554 rs3205421 4.10E−02 1.1805 0.0745 0.9745 1.4301 1.0202 1.366
VSR hCV2637554 rs3205421 1.18E−01 1.1927 0.0843 0.96 1.4817 1.0111 1.4068
UCSFCCF hCV26478797 rs2015018 9.68E−02 0.8647 0.0808 0.7022 1.0647 0.738 1.013
VSR hCV26478797 rs2015018 7.41E−02 0.8558 0.0894 0.6798 1.0773 0.7182 1.0196
UCSFCCF hCV26881276 rs2344829 2.21E−01 1.098 0.073 0.9099 1.325 0.9517 1.2667
VSR hCV26881276 rs2344829 5.48E−02 1.2202 0.0813 0.9896 1.5046 1.0404 1.4311
UCSFCCF hCV27077072 rs8060368 1.53E−01 0.8885 0.0742 0.7339 1.0756 0.7682 1.0276
VSR hCV27077072 rs8060368 2.09E−01 0.8634 0.0832 0.6968 1.0698 0.7334 1.0163
UCSFCCF hCV27473671 rs3750465 1.82E−01 1.147 0.0749 0.9457 1.3912 0.9904 1.3285
VSR hCV27473671 rs3750465 6.50E−02 1.2203 0.0873 0.9746 1.5279 1.0284 1.448
UCSFCCF hCV27494483 rs3748743 1.69E−01 1.3368 0.1471 0.9151 1.9528 1.0019 1.7837
VSR hCV27494483 rs3748743 1.14E−01 1.4827 0.1819 0.928 2.3692 1.038 2.118
UCSFCCF hCV27504565 rs3219489 3.00E−02 0.8774 0.0798 0.7144 1.0776 0.7504 1.0259
VSR hCV27504565 rs3219489 8.31E−04 0.7854 0.0962 0.6131 1.0062 0.6505 0.9483
UCSFCCF hCV27511436 rs3750145 4.18E−03 0.808 0.0983 0.6273 1.0408 0.6664 0.9797
VSR hCV27511436 rs3750145 1.85E−01 0.824 0.1046 0.6294 1.0787 0.6713 1.0114
UCSFCCF hCV2769503 rs4787956 3.16E−02 1.1938 0.0718 0.9922 1.4364 1.0371 1.3743
VSR hCV2769503 rs4787956 2.65E−03 1.2971 0.0832 1.0469 1.607 1.1019 1.5268
UCSFCCF hCV27892569 rs4903741 2.44E−01 1.1428 0.0801 0.9298 1.4046 0.9768 1.337
VSR hCV27892569 rs4903741 1.14E−01 1.1328 0.0923 0.8931 1.4367 0.9453 1.3574
UCSFCCF hCV28036404 rs4812768 9.37E−02 0.9087 0.0873 0.7256 1.138 0.7657 1.0784
VSR hCV28036404 rs4812768 5.56E−02 0.7897 0.102 0.6072 1.0269 0.6466 0.9644
UCSFCCF hCV2851380 rs12445805 6.30E−02 0.776 0.1194 0.5705 1.0555 0.614 0.9807
VSR hCV2851380 rs12445805 1.49E−01 0.7859 0.1241 0.5709 1.0819 0.6163 1.0023
UCSFCCF hCV29401764 rs7793552 2.20E−02 0.8911 0.0746 0.7354 1.0798 0.7699 1.0313
VSR hCV29401764 rs7793552 3.08E−02 0.8152 0.0835 0.6574 1.0109 0.6921 0.9603
UCSFCCF hCV29537898 rs6073804 9.08E−02 1.2655 0.1154 0.94 1.7036 1.0093 1.5867
VSR hCV29537898 rs6073804 4.26E−02 1.3202 0.1425 0.9147 1.9055 0.9986 1.7455
UCSFCCF hCV29539757 rs10110659 1.05E−02 0.835 0.0766 0.6854 1.0172 0.7185 0.9703
VSR hCV29539757 rs10110659 2.24E−02 0.7947 0.0847 0.639 0.9884 0.6732 0.9381
UCSFCCF hCV302629 rs9284183 4.22E−03 1.203 0.075 0.9915 1.4595 1.0384 1.3936
VSR hCV302629 rs9284183 1.03E−01 1.1006 0.0868 0.8801 1.3764 0.9284 1.3047
UCSFCCF hCV30308202 rs9482985 5.88E−02 0.8535 0.0865 0.683 1.0666 0.7204 1.0113
VSR hCV30308202 rs9482985 8.31E−02 0.8199 0.0988 0.6356 1.0575 0.6755 0.9951
UCSFCCF hCV3054550 rs1559599 1.32E−01 1.2126 0.0944 0.9507 1.5465 1.0076 1.4592
VSR hCV3054550 rs1559599 1.78E−01 1.1702 0.1058 0.8911 1.5368 0.9511 1.4399
UCSFCCF hCV3082219 rs1884833 1.76E−01 1.1914 0.1045 0.9102 1.5593 0.9707 1.4621
VSR hCV3082219 rs1884833 4.23E−02 1.3418 0.1161 0.995 1.8094 1.0688 1.6846
UCSFCCF hCV31137507 rs7660668 1.99E−01 1.1451 0.0768 0.9396 1.3957 0.9851 1.3312
VSR hCV31137507 rs7660668 2.56E−01 1.1555 0.0873 0.9227 1.447 0.9737 1.3713
UCSFCCF hCV31227848 rs11809423 2.31E−02 1.5772 0.1633 1.0357 2.4017 1.1453 2.172
VSR hCV31227848 rs11809423 1.81E−02 1.7397 0.1873 1.0738 2.8185 1.2051 2.5114
UCSFCCF hCV31573621 rs11079818 1.39E−01 0.8583 0.0781 0.7019 1.0494 0.7365 1.0001
VSR hCV31573621 rs11079818 9.45E−02 0.862 0.0889 0.6855 1.0839 0.7241 1.0261
UCSFCCF hCV31705214 rs12804599 6.01E−02 1.1819 0.0808 0.9598 1.4553 1.0087 1.3847
VSR hCV31705214 rs12804599 2.92E−02 1.2564 0.0936 0.9873 1.5989 1.0459 1.5094
UCSFCCF hCV32160712 rs11079160 4.42E−02 1.2364 0.0889 0.9833 1.5546 1.0387 1.4718
VSR hCV32160712 rs11079160 1.35E−01 1.2139 0.1059 0.924 1.5948 0.9863 1.4941
UCSFCCF hCV435733 rs10276935 6.08E−02 1.1784 0.0736 0.9748 1.4245 1.02 1.3613
VSR hCV435733 rs10276935 3.85E−03 1.1155 0.0849 0.8964 1.388 0.9445 1.3173
UCSFCCF hCV454333 rs10916581 1.28E−01 0.8504 0.1038 0.6509 1.1111 0.6938 1.0423
VSR hCV454333 rs10916581 2.09E−02 0.7244 0.1244 0.5257 0.9981 0.5676 0.9245
UCSFCCF hCV540056 rs346802 9.24E−02 0.6783 0.2003 0.4049 1.1362 0.4581 1.0044
VSR hCV540056 rs346802 0.5919 0.2359 0.3224 1.0869 0.3728 0.9399
UCSFCCF hCV7917138 rs9822460 3.98E−02 1.2368 0.0842 0.9956 1.5364 1.0486 1.4587
VSR hCV7917138 rs9822460 9.34E−02 1.1509 0.0975 0.8953 1.4796 0.9507 1.3933
UCSFCCF hCV8147903 rs680014 4.93E−02 0.8113 0.0854 0.6512 1.0109 0.6863 0.9591
VSR hCV8147903 rs680014 2.16E−01 0.85 0.0968 0.6625 1.0905 0.7032 1.0275
UCSFCCF hCV8754449 rs781226 1.18E−01 0.8909 0.0798 0.7253 1.0943 0.7618 1.0418
VSR hCV8754449 rs781226 1.12E−03 0.7922 0.0955 0.6195 1.013 0.6571 0.9552
UCSFCCF hCV8820007 rs938390 2.27E−01 0.9289 0.0813 0.7535 1.1452 0.7922 1.0893
VSR hCV8820007 rs938390 2.87E−02 0.7818 0.0931 0.6152 0.9937 0.6515 0.9383
UCSFCCF hCV8942032 rs1264352 1.70E−01 1.1992 0.0965 0.9353 1.5375 0.9925 1.4488
VSR hCV8942032 rs1264352 1.36E−01 1.26 0.1132 0.9414 1.6865 1.0093 1.5729

TABLE 20
95% 95% ProbChi
Low- Up- Sq (2-
GENO- Odds er per sided p- PVAL-
hCV # rs # Gene OUTCOME ADJUST MODE TYPE Ratio CL CL value) UE_2DF
hCV1958451 rs2985822 MIER1 EO_STK AGE MALE GEN GT 1.753 0.99 3.106 0.0543 0.15583
DIAB HTN
hCV1958451 rs2985822 MIER1 EO_STK AGE MALE DOM GT or 1.676 0.974 2.884 0.0623 .
DIAB HTN GG
hCV1958451 rs2985822 MIER1 EO_STK GEN GT 1.565 0.952 2.573 0.0775 0.15311
hCV1958451 rs2985822 MIER1 EO_STK AGE MALE GEN GG 1.628 0.935 2.835 0.0852 0.15583
DIAB HTN
hCV1958451 rs2985822 MIER1 LACUNAR_STK GEN GT 1.932 0.987 3.781 0.0546 0.06739
hCV27494483 rs3748743 SLC22A15 CE_STK GEN TC 1.575 1.084 2.287 0.0171 0.05794
hCV27494483 rs3748743 SLC22A15 CE_STK DOM TC or 1.564 1.081 2.263 0.0176 .
TT
hCV27494483 rs3748743 SLC22A15 CE_STK ADD T 1.522 1.065 2.175 0.0211 .
hCV27494483 rs3748743 SLC22A15 ISCHEMIC_STK DOM TC or 1.307 0.967 1.765 0.0814 .
TT
hCV27494483 rs3748743 SLC22A15 ISCHEMIC_STK ADD T 1.291 0.966 1.725 0.0847 .
hCV27494483 rs3748743 SLC22A15 ISCHEMIC_STK GEN TC 1.306 0.963 1.771 0.0859 0.21896
hCV27504565 rs3219489 MUTYH ATHERO_STK AGE MALE GEN CG 2.619 1.242 5.524 0.0115 0.04076
DIAB HTN
hCV27504565 rs3219489 MUTYH ATHERO_STK AGE MALE DOM CG or 2.434 1.184 5.002 0.0155 .
DIAB HTN CC
hCV27504565 rs3219489 MUTYH ATHERO_STK AGE MALE GEN CC 2.336 1.127 4.841 0.0225 0.04076
DIAB HTN
hCV27504565 rs3219489 MUTYH ATHERO_STK GEN CG 1.922 1.077 3.43 0.027 0.08635
hCV27504565 rs3219489 MUTYH ATHERO_STK DOM CG or 1.858 1.06 3.256 0.0306 .
CC
hCV27504565 rs3219489 MUTYH ATHERO_STK GEN CC 1.821 1.032 3.212 0.0385 0.08635
hCV27504565 rs3219489 MUTYH ISCHEMIC_STK GEN CG 1.416 0.957 2.095 0.0819 0.13029
hCV27504565 rs3219489 MUTYH NOHD_STK GEN CG 1.527 0.985 2.369 0.0585 0.11469
hCV27504565 rs3219489 MUTYH NOHD_STK AGE MALE GEN CG 1.706 0.952 3.055 0.0725 0.18169
DIAB HTN
hCV27504565 rs3219489 MUTYH NONCE_STK AGE MALE GEN CG 1.811 0.973 3.371 0.061 0.10231
DIAB HTN
hCV27504565 rs3219489 MUTYH NONCE_STK GEN CG 1.487 0.943 2.346 0.0877 0.12763
hCV27504565 rs3219489 MUTYH RECURRENT_STK AGE MALE GEN CG 2.79 0.968 8.046 0.0575 0.15677
DIAB HTN
hCV27504565 rs3219489 MUTYH RECURRENT_STK AGE MALE DOM CG or 2.47 0.893 6.833 0.0817 .
DIAB HTN CC
hCV8754449 rs781226 TESK2 ATHERO_STK AGE MALE GEN CT 2.155 1.043 4.452 0.0381 0.11587
DIAB HTN
hCV8754449 rs781226 TESK2 ATHERO_STK AGE MALE DOM CT or 2.021 1.004 4.065 0.0486 .
DIAB HTN CC
hCV8754449 rs781226 TESK2 ATHERO_STK GEN CT 1.768 1.002 3.119 0.049 0.1425 
hCV8754449 rs781226 TESK2 ATHERO_STK DOM CT or 1.724 0.995 2.986 0.0521 .
CC
hCV8754449 rs781226 TESK2 ATHERO_STK GEN CC 1.698 0.974 2.96 0.0619 0.1425 
hCV8754449 rs781226 TESK2 ATHERO_STK AGE MALE GEN CC 1.949 0.96 3.955 0.0647 0.11587
DIAB HTN
hCV8754449 rs781226 TESK2 RECURRENT_STK AGE MALE GEN CT 2.615 0.909 7.524 0.0747 0.20413
DIAB HTN
hCV8754449 rs781226 TESK2 RECURRENT_STK AGE MALE DOM CT or 2.421 0.876 6.693 0.0883 .
DIAB HTN CC
hCV2091644 rs1010 VAMP8 CE_STK REC CC 1.275 0.956 1.699 0.0984 .
hCV8820007 rs938390 ATHERO_STK GEN TA 1.597 0.953 2.678 0.0757 0.18574
hCV8820007 rs938390 ISCHEMIC_STK GEN TA 1.387 0.953 2.02 0.0876 0.11797
hCV8820007 rs938390 ISCHEMIC_STK AGE MALE GEN TA 1.511 0.927 2.463 0.0975 0.21063
DIAB HTN
hCV8820007 rs938390 NOHD_STK GEN TA 1.624 1.065 2.478 0.0243 0.01745
hCV8820007 rs938390 NOHD_STK AGE MALE GEN TA 1.751 1.027 2.984 0.0396 0.07825
DIAB HTN
hCV8820007 rs938390 NOHD_STK AGE MALE DOM TA or 1.543 0.929 2.564 0.094 .
DIAB HTN TT
hCV8820007 rs938390 NOHD_STK DOM TA or 1.404 0.937 2.102 0.0998 .
TT
hCV11354788 rs12644625 LOC729065 ATHERO_STK AGE MALE ADD T 1.379 1.016 1.871 0.0394 .
DIAB HTN
hCV11354788 rs12644625 LOC729065 ATHERO_STK AGE MALE DOM TC or 1.419 1.012 1.99 0.0423 .
DIAB HTN TT
hCV11354788 rs12644625 LOC729065 ATHERO_STK AGE MALE GEN TC 1.397 0.987 1.977 0.0592 0.11826
DIAB HTN
hCV11354788 rs12644625 LOC729065 ATHERO_STK DOM TC or 1.274 0.99 1.639 0.0597 .
TT
hCV11354788 rs12644625 LOC729065 ATHERO_STK GEN TC 1.275 0.984 1.653 0.066 0.16972
hCV11354788 rs12644625 LOC729065 ATHERO_STK ADD T 1.231 0.982 1.542 0.0711 .
hCV11354788 rs12644625 LOC729065 CE_STK ADD T 1.501 1.205 1.869 0.0003 .
hCV11354788 rs12644625 LOC729065 CE_STK DOM TC or 1.56 1.216 2.002 0.0005 .
TT
hCV11354788 rs12644625 LOC729065 CE_STK AGE MALE ADD T 1.633 1.215 2.196 0.0011 .
DIAB HTN
hCV11354788 rs12644625 LOC729065 CE_STK AGE MALE DOM TC or 1.712 1.227 2.39 0.0016 .
DIAB HTN TT
hCV11354788 rs12644625 LOC729065 CE_STK GEN TC 1.51 1.166 1.956 0.0018 0.00137
hCV11354788 rs12644625 LOC729065 CE_STK AGE MALE GEN TC 1.652 1.17 2.332 0.0043 0.00498
DIAB HTN
hCV11354788 rs12644625 LOC729065 CE_STK GEN TT 2.198 1.061 4.556 0.0341 0.00137
hCV11354788 rs12644625 LOC729065 CE_STK REC TT 1.996 0.966 4.125 0.0619 .
hCV11354788 rs12644625 LOC729065 CE_STK AGE MALE GEN TT 2.533 0.921 6.962 0.0716 0.00498
DIAB HTN
hCV11354788 rs12644625 LOC729065 EO_STK AGE MALE ADD T 1.432 1.068 1.922 0.0165 .
DIAB HTN
hCV11354788 rs12644625 LOC729065 EO_STK DOM TC or 1.413 1.06 1.883 0.0184 .
TT
hCV11354788 rs12644625 LOC729065 EO_STK ADD T 1.365 1.053 1.768 0.0186 .
hCV11354788 rs12644625 LOC729065 EO_STK AGE MALE DOM TC or 1.466 1.057 2.032 0.0217 .
DIAB HTN TT
hCV11354788 rs12644625 LOC729065 EO_STK GEN TC 1.396 1.038 1.876 0.0273 0.05898
hCV11354788 rs12644625 LOC729065 EO_STK AGE MALE GEN TC 1.423 1.017 1.991 0.0396 0.0564 
DIAB HTN
hCV11354788 rs12644625 LOC729065 ISCHEMIC_STK DOM TC or 1.356 1.113 1.652 0.0025 .
TT
hCV11354788 rs12644625 LOC729065 ISCHEMIC_STK ADD T 1.309 1.097 1.563 0.0029 .
hCV11354788 rs12644625 LOC729065 ISCHEMIC_STK GEN TC 1.346 1.099 1.65 0.0041 0.0099 
hCV11354788 rs12644625 LOC729065 ISCHEMIC_STK AGE MALE ADD T 1.367 1.077 1.735 0.0102 .
DIAB HTN
hCV11354788 rs12644625 LOC729065 ISCHEMIC_STK AGE MALE DOM TC or 1.404 1.077 1.831 0.0122 .
DIAB HTN TT
hCV11354788 rs12644625 LOC729065 ISCHEMIC_STK AGE MALE GEN TC 1.376 1.047 1.809 0.022 0.03661
DIAB HTN
hCV11354788 rs12644625 LOC729065 NOHD_STK ADD T 1.31 1.083 1.585 0.0053 .
hCV11354788 rs12644625 LOC729065 NOHD_STK DOM TC or 1.345 1.086 1.666 0.0065 .
TT
hCV11354788 rs12644625 LOC729065 NOHD_STK GEN TC 1.321 1.059 1.647 0.0135 0.02034
hCV11354788 rs12644625 LOC729065 NOHD_STK AGE MALE ADD T 1.354 1.052 1.743 0.0188 .
DIAB HTN
hCV11354788 rs12644625 LOC729065 NOHD_STK AGE MALE DOM TC or 1.375 1.036 1.825 0.0275 .
DIAB HTN TT
hCV11354788 rs12644625 LOC729065 NOHD_STK AGE MALE GEN TC 1.332 0.995 1.784 0.0544 0.06231
DIAB HTN
hCV11354788 rs12644625 LOC729065 NONCE_STK GEN TC 1.248 0.99 1.573 0.0613 0.17362
hCV11354788 rs12644625 LOC729065 NONCE_STK DOM TC or 1.233 0.984 1.545 0.0692 .
TT
hCV11354788 rs12644625 LOC729065 NONCE_STK AGE MALE DOM TC or 1.295 0.953 1.758 0.0982 .
DIAB HTN TT
hCV11354788 rs12644625 LOC729065 RECURRENT_STK AGE MALE GEN TC 2.096 1.252 3.509 0.0049 0.01709
DIAB HTN
hCV11354788 rs12644625 LOC729065 RECURRENT_STK AGE MALE DOM TC or 1.962 1.187 3.243 0.0086 .
DIAB HTN TT
hCV11354788 rs12644625 LOC729065 RECURRENT_STK AGE MALE ADD T 1.701 1.072 2.7 0.0241 .
DIAB HTN
hCV11354788 rs12644625 LOC729065 RECURRENT_STK DOM TC or 1.383 0.979 1.955 0.066 .
TT
hCV11354788 rs12644625 LOC729065 RECURRENT_STK GEN TC 1.382 0.968 1.973 0.075 0.1844 
hCV11354788 rs12644625 LOC729065 RECURRENT_STK ADD T 1.321 0.972 1.796 0.0752 .
hCV16158671 rs2200733 ATHERO_STK AGE MALE ADD T 1.415 1.045 1.915 0.0248 .
DIAB HTN
hCV16158671 rs2200733 ATHERO_STK AGE MALE DOM TC or 1.442 1.028 2.023 0.0339 .
DIAB HTN TT
hCV16158671 rs2200733 ATHERO_STK DOM TC or 1.304 1.013 1.679 0.039 .
TT
hCV16158671 rs2200733 ATHERO_STK ADD T 1.257 1.005 1.573 0.0456 .
hCV16158671 rs2200733 ATHERO_STK GEN TC 1.302 1.003 1.69 0.047 0.11865
hCV16158671 rs2200733 ATHERO_STK AGE MALE GEN TC 1.397 0.986 1.98 0.06 0.07966
DIAB HTN
hCV16158671 rs2200733 CE_STK ADD T 1.509 1.213 1.879 0.0002 .
hCV16158671 rs2200733 CE_STK DOM TC or 1.585 1.235 2.035 0.0003 .
TT
hCV16158671 rs2200733 CE_STK GEN TC 1.543 1.191 1.999 0.001 0.00106
hCV16158671 rs2200733 CE_STK AGE MALE ADD T 1.631 1.216 2.189 0.0011 .
DIAB HTN
hCV16158671 rs2200733 CE_STK AGE MALE DOM TC or 1.733 1.241 2.42 0.0012 .
DIAB HTN TT
hCV16158671 rs2200733 CE_STK AGE MALE GEN TC 1.684 1.192 2.381 0.0032 0.00458
DIAB HTN
hCV16158671 rs2200733 CE_STK GEN TT 2.083 1.015 4.275 0.0454 0.00106
hCV16158671 rs2200733 CE_STK REC TT 1.883 0.92 3.853 0.0832 .
hCV16158671 rs2200733 CE_STK AGE MALE GEN TT 2.319 0.869 6.191 0.093 0.00458
DIAB HTN
hCV16158671 rs2200733 EO_STK DOM TC or 1.426 1.069 1.901 0.0156 .
TT
hCV16158671 rs2200733 EO_STK ADD T 1.364 1.055 1.763 0.0178 .
hCV16158671 rs2200733 EO_STK AGE MALE ADD T 1.409 1.052 1.887 0.0215 .
DIAB HTN
hCV16158671 rs2200733 EO_STK GEN TC 1.415 1.051 1.905 0.022 0.05284
hCV16158671 rs2200733 EO_STK AGE MALE DOM TC or 1.448 1.044 2.008 0.0267 .
DIAB HTN TT
hCV16158671 rs2200733 EO_STK AGE MALE GEN TC 1.409 1.006 1.975 0.0461 0.07117
DIAB HTN
hCV16158671 rs2200733 ISCHEMIC_STK DOM TC or 1.376 1.13 1.677 0.0015 .
TT
hCV16158671 rs2200733 ISCHEMIC_STK ADD T 1.324 1.11 1.579 0.0018 .
hCV16158671 rs2200733 ISCHEMIC_STK GEN TC 1.365 1.113 1.674 0.0028 0.00631
hCV16158671 rs2200733 ISCHEMIC_STK AGE MALE ADD T 1.375 1.085 1.742 0.0083 .
DIAB HTN
hCV16158671 rs2200733 ISCHEMIC_STK AGE MALE DOM TC or 1.413 1.083 1.843 0.0109 .
DIAB HTN TT
hCV16158671 rs2200733 ISCHEMIC_STK AGE MALE GEN TC 1.378 1.047 1.813 0.0222 0.03074
DIAB HTN
hCV16158671 rs2200733 NOHD_STK ADD T 1.327 1.099 1.603 0.0032 .
hCV16158671 rs2200733 NOHD_STK DOM TC or 1.366 1.103 1.691 0.0042 .
TT
hCV16158671 rs2200733 NOHD_STK GEN TC 1.337 1.072 1.668 0.0101 0.01299
hCV16158671 rs2200733 NOHD_STK AGE MALE ADD T 1.366 1.063 1.754 0.0147 .
DIAB HTN
hCV16158671 rs2200733 NOHD_STK AGE MALE DOM TC or 1.384 1.042 1.838 0.0247 .
DIAB HTN TT
hCV16158671 rs2200733 NOHD_STK AGE MALE GEN TC 1.33 0.992 1.783 0.0569 0.04871
DIAB HTN
hCV16158671 rs2200733 NOHD_STK AGE MALE GEN TT 2.103 0.891 4.961 0.0896 0.04871
DIAB HTN
hCV16158671 rs2200733 NONCE_STK DOM TC or 1.251 0.998 1.568 0.0518 .
TT
hCV16158671 rs2200733 NONCE_STK GEN TC 1.259 0.998 1.588 0.0525 0.14733
hCV16158671 rs2200733 NONCE_STK ADD T 1.206 0.985 1.475 0.0696 .
hCV16158671 rs2200733 NONCE_STK AGE MALE ADD T 1.274 0.967 1.679 0.0852 .
DIAB HTN
hCV16158671 rs2200733 NONCE_STK AGE MALE DOM TC or 1.297 0.954 1.761 0.0967 .
DIAB HTN TT
hCV16158671 rs2200733 RECURRENT_STK AGE MALE GEN TC 2.087 1.24 3.512 0.0056 0.01904
DIAB HTN
hCV16158671 rs2200733 RECURRENT_STK AGE MALE DOM TC or 1.943 1.171 3.225 0.0102 .
DIAB HTN TT
hCV16158671 rs2200733 RECURRENT_STK AGE MALE ADD T 1.671 1.053 2.652 0.0294 .
DIAB HTN
hCV16158671 rs2200733 RECURRENT_STK DOM TC or 1.375 0.971 1.948 0.0728 .
TT
hCV16158671 rs2200733 RECURRENT_STK GEN TC 1.38 0.964 1.975 0.0786 0.19939
hCV16158671 rs2200733 RECURRENT_STK ADD T 1.307 0.961 1.776 0.0879 .
hCV16336 rs362277 HD ATHERO_STK REC CC 1.377 1.032 1.837 0.0298 .
hCV16336 rs362277 HD ATHERO_STK ADD C 1.315 1.013 1.707 0.0399 .
hCV16336 rs362277 HD ATHERO_STK AGE MALE REC CC 1.39 0.96 2.013 0.0812 .
DIAB HTN
hCV16336 rs362277 HD CE_STK ADD C 1.523 1.147 2.022 0.0036 .
hCV16336 rs362277 HD CE_STK REC CC 1.525 1.126 2.066 0.0065 .
hCV16336 rs362277 HD CE_STK AGE MALE ADD C 1.49 1.033 2.148 0.0328 .
DIAB HTN
hCV16336 rs362277 HD CE_STK AGE MALE REC CC 1.52 1.028 2.247 0.036 .
DIAB HTN
hCV16336 rs362277 HD CE_STK GEN CC 3.625 0.825 15.926 0.0881 0.01511
hCV16336 rs362277 HD EO_STK AGE MALE REC CC 1.659 1.156 2.381 0.0061 .
DIAB HTN
hCV16336 rs362277 HD EO_STK AGE MALE ADD C 1.559 1.11 2.188 0.0103 .
DIAB HTN
hCV16336 rs362277 HD EO_STK REC CC 1.389 1.014 1.904 0.0407 .
hCV16336 rs362277 HD EO_STK ADD C 1.355 1.01 1.819 0.0427 .
hCV16336 rs362277 HD ISCHEMIC_STK ADD C 1.379 1.127 1.686 0.0018 .
hCV16336 rs362277 HD ISCHEMIC_STK REC CC 1.41 1.131 1.758 0.0023 .
hCV16336 rs362277 HD ISCHEMIC_STK AGE MALE ADD C 1.377 1.052 1.803 0.0198 .
DIAB HTN
hCV16336 rs362277 HD ISCHEMIC_STK AGE MALE REC CC 1.417 1.056 1.901 0.0203 .
DIAB HTN
hCV16336 rs362277 HD NOHD_STK ADD C 1.227 0.99 1.521 0.0619 .
hCV16336 rs362277 HD NOHD_STK REC CC 1.248 0.986 1.581 0.0658 .
hCV16336 rs362277 HD NONCE_STK REC CC 1.345 1.046 1.73 0.0211 .
hCV16336 rs362277 HD NONCE_STK ADD C 1.3 1.035 1.633 0.0244 .
hCV16336 rs362277 HD NONCE_STK AGE MALE REC CC 1.39 0.999 1.935 0.0508 .
DIAB HTN
hCV16336 rs362277 HD NONCE_STK AGE MALE ADD C 1.346 0.997 1.816 0.0521 .
DIAB HTN
hCV26478797 rs2015018 CHSY-2 CE_STK REC GG 1.205 0.965 1.505 0.099 .
hCV11425801 rs3805953 PEX6 ATHERO_STK AGE MALE GEN CT 1.99 1.402 2.824 0.0001 0.0005 
DIAB HTN
hCV11425801 rs3805953 PEX6 ATHERO_STK AGE MALE DOM CT or 1.726 1.251 2.38 0.0009 .
DIAB HTN CC
hCV11425801 rs3805953 PEX6 ATHERO_STK GEN CT 1.539 1.183 2.002 0.0013 0.00531
hCV11425801 rs3805953 PEX6 ATHERO_STK DOM CT or 1.481 1.159 1.892 0.0017 .
CC
hCV11425801 rs3805953 PEX6 ATHERO_STK ADD C 1.179 1.019 1.363 0.0271 .
hCV11425801 rs3805953 PEX6 ATHERO_STK GEN CC 1.385 1.028 1.865 0.0323 0.00531
hCV11425801 rs3805953 PEX6 ATHERO_STK AGE MALE ADD C 1.18 0.974 1.429 0.0913 .
DIAB HTN
hCV11425801 rs3805953 PEX6 EO_STK GEN CT 1.639 1.226 2.192 0.0009 0.00345
hCV11425801 rs3805953 PEX6 EO_STK AGE MALE GEN CT 1.718 1.229 2.4 0.0015 0.00399
DIAB HTN
hCV11425801 rs3805953 PEX6 EO_STK DOM CT or 1.484 1.135 1.939 0.0038 .
CC
hCV11425801 rs3805953 PEX6 EO_STK AGE MALE DOM CT or 1.483 1.092 2.015 0.0116 .
DIAB HTN CC
hCV11425801 rs3805953 PEX6 ISCHEMIC_STK AGE MALE GEN CT 1.617 1.235 2.116 0.0005 0.00176
DIAB HTN
hCV11425801 rs3805953 PEX6 ISCHEMIC_STK AGE MALE DOM CT or 1.453 1.135 1.86 0.003 .
DIAB HTN CC
hCV11425801 rs3805953 PEX6 ISCHEMIC_STK GEN CT 1.321 1.082 1.612 0.0062 0.02335
hCV11425801 rs3805953 PEX6 ISCHEMIC_STK DOM CT or 1.276 1.062 1.534 0.0094 .
CC
hCV11425801 rs3805953 PEX6 ISCHEMIC_STK ADD C 1.104 0.985 1.236 0.0889 .
hCV11425801 rs3805953 PEX6 LACUNAR_STK AGE MALE GEN CT 1.826 1.186 2.811 0.0063 0.01078
DIAB HTN
hCV11425801 rs3805953 PEX6 LACUNAR_STK AGE MALE DOM CT or 1.51 1.014 2.25 0.0427 .
DIAB HTN CC
hCV11425801 rs3805953 PEX6 LACUNAR_STK GEN CT 1.368 0.973 1.923 0.0715 0.11508
hCV11425801 rs3805953 PEX6 NOHD_STK AGE MALE GEN CT 1.641 1.229 2.19 0.0008 0.00304
DIAB HTN
hCV11425801 rs3805953 PEX6 NOHD_STK AGE MALE DOM CT or 1.472 1.13 1.916 0.0041 .
DIAB HTN CC
hCV11425801 rs3805953 PEX6 NOHD_STK DOM CT or 1.276 1.043 1.559 0.0176 .
CC
hCV11425801 rs3805953 PEX6 NOHD_STK GEN CT 1.295 1.041 1.61 0.0201 0.05622
hCV11425801 rs3805953 PEX6 NOHD_STK ADD C 1.12 0.991 1.266 0.07 .
hCV11425801 rs3805953 PEX6 NOHD_STK GEN CC 1.244 0.973 1.591 0.0821 0.05622
hCV11425801 rs3805953 PEX6 NONCE_STK AGE MALE DOM CT or 1.689 1.268 2.251 0.0003 .
DIAB HTN CC
hCV11425801 rs3805953 PEX6 NONCE_STK GEN CT 1.48 1.176 1.862 0.0008 0.00363
hCV11425801 rs3805953 PEX6 NONCE_STK DOM CT or 1.393 1.125 1.725 0.0023 .
CC
hCV11425801 rs3805953 PEX6 NONCE_STK ADD C 1.126 0.989 1.282 0.0732 .
hCV11425801 rs3805953 PEX6 NONCE_STK GEN CC 1.249 0.96 1.625 0.0971 0.00363
hCV11425801 rs3805953 PEX6 RECURRENT_STK AGE MALE GEN CT 1.636 0.988 2.71 0.0556 0.12066
DIAB HTN
hCV11425801 rs3805953 PEX6 RECURRENT_STK GEN CT 1.368 0.951 1.967 0.091 0.22257
hCV11425842 rs10948059 GNMT ATHERO_STK AGE MALE DOM CT or 1.483 1.042 2.111 0.0286 .
DIAB HTN CC
hCV11425842 rs10948059 GNMT ATHERO_STK AGE MALE GEN CT 1.508 1.036 2.195 0.032 0.08825
DIAB HTN
hCV11425842 rs10948059 GNMT ATHERO_STK DOM CT or 1.281 0.979 1.676 0.0707 .
CC
hCV11425842 rs10948059 GNMT ATHERO_STK AGE MALE GEN CC 1.445 0.961 2.172 0.077 0.08825
DIAB HTN
hCV11425842 rs10948059 GNMT ATHERO_STK GEN CT 1.292 0.972 1.717 0.0777 0.19224
hCV11425842 rs10948059 GNMT EO_STK GEN CT 1.44 1.056 1.965 0.0214 0.06697
hCV11425842 rs10948059 GNMT EO_STK DOM CT or 1.4 1.047 1.871 0.0232 .
CC
hCV11425842 rs10948059 GNMT EO_STK AGE MALE GEN CT 1.497 1.048 2.138 0.0267 0.08575
DIAB HTN
hCV11425842 rs10948059 GNMT EO_STK AGE MALE DOM CT or 1.418 1.016 1.978 0.0399 .
DIAB HTN CC
hCV11425842 rs10948059 GNMT EO_STK GEN CC 1.338 0.953 1.878 0.0927 0.06697
hCV11425842 rs10948059 GNMT ISCHEMIC_STK AGE MALE GEN CT 1.334 0.998 1.785 0.0518 0.1427 
DIAB HTN
hCV11425842 rs10948059 GNMT ISCHEMIC_STK AGE MALE DOM CT or 1.309 0.997 1.719 0.0525 .
DIAB HTN CC
hCV11425842 rs10948059 GNMT NONCE_STK AGE MALE GEN CT 1.435 1.028 2.005 0.0341 0.10566
DIAB HTN
hCV11425842 rs10948059 GNMT NONCE_STK AGE MALE DOM CT or 1.379 1.008 1.886 0.0444 .
DIAB HTN CC
hCV1209800 rs35067690 CLIC5 CE_STK REC GG 1.54 0.995 2.384 0.0529 .
hCV1209800 rs35067690 CLIC5 CE_STK ADD G 1.497 0.985 2.277 0.059 .
hCV16134786 rs2857595 EO_STK ADD A 1.287 1.044 1.587 0.018 .
hCV16134786 rs2857595 EO_STK GEN AA 1.967 1.08 3.581 0.0269 0.0477 
hCV16134786 rs2857595 EO_STK REC AA 1.845 1.02 3.336 0.0428 .
hCV16134786 rs2857595 EO_STK DOM AG or 1.283 0.999 1.65 0.0513 .
AA
hCV16134786 rs2857595 LACUNAR_STK GEN AA 2.149 1.196 3.86 0.0105 0.0372 
hCV16134786 rs2857595 LACUNAR_STK REC AA 2.114 1.189 3.76 0.0108 .
hCV16134786 rs2857595 LACUNAR_STK ADD A 1.243 0.98 1.578 0.073 .
hCV16134786 rs2857595 NONCE_STK ADD A 1.158 0.984 1.363 0.0777 .
hCV16134786 rs2857595 NONCE_STK GEN AA 1.501 0.953 2.365 0.0799 0.16516
hCV25651109 rs35690712 SLC39A7 ISCHEMIC_STK GEN GG 8.255 1.015 67.158 0.0484 0.13989
hCV25651109 rs35690712 SLC39A7 ISCHEMIC_STK DOM GC or 8.232 1.012 66.954 0.0487 .
GG
hCV25651109 rs35690712 SLC39A7 ISCHEMIC_STK GEN GC 7.978 0.963 66.101 0.0542 0.13989
hCV25651109 rs35690712 SLC39A7 NOHD_STK GEN GC 6.169 0.743 51.25 0.0921 0.2415 
hCV25651109 rs35690712 SLC39A7 NOHD_STK DOM GC or 5.892 0.724 47.938 0.0973 .
GG
hCV25651109 rs35690712 SLC39A7 NOHD_STK GEN GG 5.866 0.721 47.736 0.0981 0.2415 
hCV30308202 rs9482985 LAMA2 RECURRENT_STK ADD G 1.354 1.016 1.803 0.0384 .
hCV30308202 rs9482985 LAMA2 RECURRENT_STK AGE MALE GEN GG 3.706 1.016 13.521 0.0473 0.12903
DIAB HTN
hCV30308202 rs9482985 LAMA2 RECURRENT_STK AGE MALE DOM GC or 3.537 0.978 12.795 0.0542 .
DIAB HTN GG
hCV30308202 rs9482985 LAMA2 RECURRENT_STK REC GG 1.349 0.975 1.868 0.0712 .
hCV30308202 rs9482985 LAMA2 RECURRENT_STK AGE MALE GEN GC 3.204 0.854 12.028 0.0845 0.12903
DIAB HTN
hCV30308202 rs9482985 LAMA2 RECURRENT_STK GEN GG 2.419 0.856 6.839 0.0956 0.11116
hCV3082219 rs1884833 RFXDC1 EO_STK ADD A 1.273 0.982 1.65 0.0681 .
hCV3082219 rs1884833 RFXDC1 LACUNAR_STK ADD A 1.399 1.049 1.867 0.0225 .
hCV3082219 rs1884833 RFXDC1 LACUNAR_STK DOM AG or 1.424 1.035 1.959 0.03 .
AA
hCV3082219 rs1884833 RFXDC1 LACUNAR_STK GEN AG 1.391 1.003 1.93 0.0483 0.07365
hCV3082219 rs1884833 RFXDC1 NONCE_STK ADD A 1.213 0.991 1.485 0.0608 .
hCV3082219 rs1884833 RFXDC1 NONCE_STK DOM AG or 1.227 0.984 1.529 0.0688 .
AA
hCV3082219 rs1884833 RFXDC1 NONCE_STK GEN AG 1.214 0.969 1.52 0.0917 0.17242
hCV8942032 rs1264352 DDR1 EO_STK DOM CG or 1.484 1.127 1.954 0.0049 .
CC
hCV8942032 rs1264352 DDR1 EO_STK GEN CG 1.488 1.12 1.978 0.0062 0.01912
hCV8942032 rs1264352 DDR1 EO_STK ADD C 1.394 1.092 1.78 0.0077 .
hCV8942032 rs1264352 DDR1 EO_STK AGE MALE GEN CG 1.513 1.09 2.101 0.0134 0.04543
DIAB HTN
hCV8942032 rs1264352 DDR1 EO_STK AGE MALE DOM CG or 1.486 1.083 2.038 0.0142 .
DIAB HTN CC
hCV8942032 rs1264352 DDR1 EO_STK AGE MALE ADD C 1.37 1.037 1.81 0.0265 .
DIAB HTN
hCV8942032 rs1264352 DDR1 ISCHEMIC_STK AGE MALE GEN CG 1.383 1.056 1.811 0.0183 0.061 
DIAB HTN
hCV8942032 rs1264352 DDR1 ISCHEMIC_STK AGE MALE DOM CG or 1.341 1.035 1.737 0.0262 .
DIAB HTN CC
hCV8942032 rs1264352 DDR1 ISCHEMIC_STK AGE MALE ADD C 1.241 0.991 1.554 0.0604 .
DIAB HTN
hCV8942032 rs1264352 DDR1 ISCHEMIC_STK GEN CG 1.208 0.988 1.476 0.0658 0.17422
hCV8942032 rs1264352 DDR1 ISCHEMIC_STK DOM CG or 1.178 0.972 1.428 0.0949 .
CC
hCV8942032 rs1264352 DDR1 LACUNAR_STK AGE MALE DOM CG or 1.803 1.207 2.694 0.004 .
DIAB HTN CC
hCV8942032 rs1264352 DDR1 LACUNAR_STK AGE MALE ADD C 1.64 1.165 2.307 0.0046 .
DIAB HTN
hCV8942032 rs1264352 DDR1 LACUNAR_STK AGE MALE GEN CG 1.77 1.166 2.689 0.0074 0.01502
DIAB HTN
hCV8942032 rs1264352 DDR1 LACUNAR_STK DOM CG or 1.418 1.036 1.942 0.0294 .
CC
hCV8942032 rs1264352 DDR1 LACUNAR_STK ADD C 1.328 1.023 1.725 0.0333 .
hCV8942032 rs1264352 DDR1 LACUNAR_STK GEN CG 1.405 1.01 1.954 0.0435 0.09148
hCV8942032 rs1264352 DDR1 NOHD_STK AGE MALE GEN CG 1.358 1.021 1.807 0.0355 0.09951
DIAB HTN
hCV8942032 rs1264352 DDR1 NOHD_STK AGE MALE DOM CG or 1.309 0.994 1.723 0.0554 .
DIAB HTN CC
hCV8942032 rs1264352 DDR1 NOHD_STK GEN CG 1.218 0.98 1.513 0.0749 0.10394
hCV8942032 rs1264352 DDR1 NONCE_STK AGE MALE GEN CG 1.419 1.047 1.923 0.0242 0.07825
DIAB HTN
hCV8942032 rs1264352 DDR1 NONCE_STK AGE MALE DOM CG or 1.377 1.027 1.845 0.0323 .
DIAB HTN CC
hCV8942032 rs1264352 DDR1 NONCE_STK GEN CG 1.244 0.992 1.559 0.0585 0.1603 
hCV8942032 rs1264352 DDR1 NONCE_STK AGE MALE ADD C 1.269 0.983 1.637 0.0672 .
DIAB HTN
hCV8942032 rs1264352 DDR1 NONCE_STK DOM CG or 1.211 0.975 1.504 0.0833 .
CC
hCV8942032 rs1264352 DDR1 RECURRENT_STK AGE MALE DOM CG or 1.953 1.219 3.129 0.0054 .
DIAB HTN CC
hCV8942032 rs1264352 DDR1 RECURRENT_STK AGE MALE GEN CG 1.965 1.206 3.201 0.0067 0.02072
DIAB HTN
hCV8942032 rs1264352 DDR1 RECURRENT_STK AGE MALE ADD C 1.728 1.15 2.594 0.0084 .
DIAB HTN
hCV8942032 rs1264352 DDR1 RECURRENT_STK GEN CG 1.415 1.001 2.001 0.0494 0.14433
hCV8942032 rs1264352 DDR1 RECURRENT_STK DOM CG or 1.384 0.992 1.931 0.0561 .
CC
hCV8942032 rs1264352 DDR1 RECURRENT_STK ADD C 1.269 0.959 1.68 0.0956 .
hCV25596936 rs6967117 EPHA1 ATHERO_STK GEN TC 1.432 1.071 1.913 0.0153 0.03518
hCV25596936 rs6967117 EPHA1 ATHERO_STK DOM TC or 1.345 1.017 1.779 0.038 .
TT
hCV25596936 rs6967117 EPHA1 ISCHEMIC_STK GEN TC 1.263 0.997 1.601 0.0533 0.04107
hCV25596936 rs6967117 EPHA1 LACUNAR_STK GEN TC 1.433 0.981 2.092 0.0627 0.15123
hCV25596936 rs6967117 EPHA1 NOHD_STK GEN TC 1.302 1.01 1.679 0.0419 0.06504
hCV25596936 rs6967117 EPHA1 NONCE_STK GEN TC 1.438 1.108 1.865 0.0063 0.01473
hCV25596936 rs6967117 EPHA1 NONCE_STK DOM TC or 1.352 1.052 1.736 0.0183 .
TT
hCV25596936 rs6967117 EPHA1 NONCE_STK ADD T 1.224 0.981 1.526 0.0731 .
hCV27511436 rs3750145 FZD1 ATHERO_STK GEN TC 2.706 1.389 5.271 0.0034 0.00764
hCV27511436 rs3750145 FZD1 ATHERO_STK AGE MALE GEN TC 2.877 1.272 6.508 0.0111 0.03448
DIAB HTN
hCV27511436 rs3750145 FZD1 ATHERO_STK DOM TC or 2.231 1.18 4.22 0.0136 .
TT
hCV27511436 rs3750145 FZD1 ATHERO_STK GEN TT 2.105 1.11 3.993 0.0227 0.00764
hCV27511436 rs3750145 FZD1 ATHERO_STK AGE MALE DOM TC or 2.397 1.108 5.184 0.0263 .
DIAB HTN TT
hCV27511436 rs3750145 FZD1 ATHERO_STK AGE MALE GEN TT 2.271 1.046 4.93 0.0381 0.03448
DIAB HTN
hCV27511436 rs3750145 FZD1 CE_STK GEN TC 2.392 1.294 4.422 0.0054 0.00015
hCV27511436 rs3750145 FZD1 CE_STK AGE MALE GEN TC 3.084 1.383 6.875 0.0059 0.00609
DIAB HTN
hCV27511436 rs3750145 FZD1 CE_STK AGE MALE DOM TC or 2.257 1.055 4.828 0.0359 .
DIAB HTN TT
hCV27511436 rs3750145 FZD1 CE_STK AGE MALE GEN TT 2.025 0.943 4.352 0.0705 0.00609
DIAB HTN
hCV27511436 rs3750145 FZD1 CE_STK DOM TC or 1.647 0.917 2.958 0.0946 .
TT
hCV27511436 rs3750145 FZD1 EO_STK GEN TC 5.062 2.211 11.593 0.0001 0.00053
hCV27511436 rs3750145 FZD1 EO_STK DOM TC or 4.226 1.901 9.394 0.0004 .
TT
hCV27511436 rs3750145 FZD1 EO_STK AGE MALE GEN TC 4.83 1.964 11.882 0.0006 0.00223
DIAB HTN
hCV27511436 rs3750145 FZD1 EO_STK GEN TT 3.983 1.786 8.882 0.0007 0.00053
hCV27511436 rs3750145 FZD1 EO_STK AGE MALE DOM TC or 3.916 1.653 9.279 0.0019 .
DIAB HTN TT
hCV27511436 rs3750145 FZD1 EO_STK AGE MALE GEN TT 3.668 1.542 8.725 0.0033 0.00223
DIAB HTN
hCV27511436 rs3750145 FZD1 ISCHEMIC_STK AGE MALE GEN TC 3.449 1.798 6.618 0.0002 0.00063
DIAB HTN
hCV27511436 rs3750145 FZD1 ISCHEMIC_STK DOM TC or 2.217 1.397 3.521 0.0007 .
TT
hCV27511436 rs3750145 FZD1 ISCHEMIC_STK AGE MALE DOM TC or 2.78 1.498 5.158 0.0012 .
DIAB HTN TT
hCV27511436 rs3750145 FZD1 ISCHEMIC_STK AGE MALE GEN TT 2.59 1.392 4.82 0.0027 0.00063
DIAB HTN
hCV27511436 rs3750145 FZD1 ISCHEMIC_STK GEN TT 2.033 1.277 3.236 0.0028 0.00001
hCV27511436 rs3750145 FZD1 LACUNAR_STK AGE MALE GEN TC 12.63 2.356 67.742 0.0031 0.00773
DIAB HTN
hCV27511436 rs3750145 FZD1 LACUNAR_STK GEN TC 8.049 1.905 34.008 0.0046 0.00667
hCV27511436 rs3750145 FZD1 LACUNAR_STK AGE MALE DOM TC or 9.88 1.896 51.473 0.0065 .
DIAB HTN TT
hCV27511436 rs3750145 FZD1 LACUNAR_STK AGE MALE GEN TT 9.1 1.743 47.499 0.0088 0.00773
DIAB HTN
hCV27511436 rs3750145 FZD1 LACUNAR_STK DOM TC or 6.318 1.528 26.128 0.0109 .
TT
hCV27511436 rs3750145 FZD1 LACUNAR_STK GEN TT 5.858 1.413 24.288 0.0148 0.00667
hCV27511436 rs3750145 FZD1 NOHD_STK GEN TC 2.83 1.661 4.824 0.0001 0.00002
hCV27511436 rs3750145 FZD1 NOHD_STK AGE MALE GEN TC 3.231 1.612 6.479 0.001 0.00243
DIAB HTN
hCV27511436 rs3750145 FZD1 NOHD_STK DOM TC or 2.088 1.258 3.467 0.0044 .
TT
hCV27511436 rs3750145 FZD1 NOHD_STK AGE MALE DOM TC or 2.586 1.334 5.012 0.0049 .
DIAB HTN TT
hCV27511436 rs3750145 FZD1 NOHD_STK AGE MALE GEN TT 2.4 1.235 4.665 0.0098 0.00243
DIAB HTN
hCV27511436 rs3750145 FZD1 NOHD_STK GEN TT 1.891 1.135 3.149 0.0144 0.00002
hCV27511436 rs3750145 FZD1 NONCE_STK AGE MALE GEN TC 3.955 1.807 8.657 0.0006 0.00244
DIAB HTN
hCV27511436 rs3750145 FZD1 NONCE_STK DOM TC or 2.827 1.555 5.142 0.0007 .
TT
hCV27511436 rs3750145 FZD1 NONCE_STK GEN TT 2.657 1.457 4.843 0.0014 0.00023
hCV27511436 rs3750145 FZD1 NONCE_STK AGE MALE DOM TC or 3.312 1.571 6.985 0.0017 .
DIAB HTN TT
hCV27511436 rs3750145 FZD1 NONCE_STK AGE MALE GEN TT 3.137 1.483 6.636 0.0028 0.00244
DIAB HTN
hCV29401764 rs7793552 LOC646588 ATHERO_STK AGE MALE GEN CT 1.633 0.952 2.798 0.0746 0.17293
DIAB HTN
hCV15857769 rs2924914 ATHERO_STK ADD T 1.187 1.011 1.394 0.0361 .
hCV15857769 rs2924914 ATHERO_STK DOM TC or 1.255 1.011 1.557 0.0391 .
TT
hCV15857769 rs2924914 ATHERO_STK GEN TC 1.23 0.979 1.545 0.0756 0.1026 
hCV15857769 rs2924914 ATHERO_STK AGE MALE GEN TT 1.532 0.946 2.48 0.0827 0.21882
DIAB HTN
hCV15857769 rs2924914 ATHERO_STK GEN TT 1.36 0.947 1.952 0.096 0.1026 
hCV15857769 rs2924914 CE_STK GEN TC 1.295 1.029 1.63 0.0275 0.0333 
hCV15857769 rs2924914 CE_STK DOM TC or 1.209 0.97 1.507 0.0919 .
TT
hCV15857769 rs2924914 ISCHEMIC_STK GEN TC 1.252 1.05 1.493 0.0124 0.04329
hCV15857769 rs2924914 ISCHEMIC_STK DOM TC or 1.219 1.031 1.441 0.0203 .
TT
hCV15857769 rs2924914 ISCHEMIC_STK ADD T 1.117 0.983 1.27 0.0904 .
hCV15857769 rs2924914 NOHD_STK GEN TC 1.263 1.043 1.53 0.0167 0.05587
hCV15857769 rs2924914 NOHD_STK DOM TC or 1.228 1.024 1.474 0.0271 .
TT
hCV15857769 rs2924914 NONCE_STK DOM TC or 1.226 1.013 1.483 0.0365 .
TT
hCV15857769 rs2924914 NONCE_STK GEN TC 1.224 1.001 1.497 0.0489 0.11225
hCV15857769 rs2924914 NONCE_STK ADD T 1.149 0.996 1.327 0.057 .
hCV15857769 rs2924914 RECURRENT_STK GEN TC 1.788 1.299 2.463 0.0004 0.00102
hCV15857769 rs2924914 RECURRENT_STK DOM TC or 1.641 1.203 2.238 0.0018 .
TT
hCV15857769 rs2924914 RECURRENT_STK AGE MALE GEN TC 1.733 1.112 2.701 0.0151 0.04261
DIAB HTN
hCV15857769 rs2924914 RECURRENT_STK AGE MALE DOM TC or 1.596 1.042 2.443 0.0315 .
DIAB HTN TT
hCV15857769 rs2924914 RECURRENT_STK ADD T 1.259 1.003 1.58 0.0471 .
hCV29539757 rs10110659 KCNQ3 NONCE_STK GEN CA 1.401 0.977 2.009 0.0671 0.0978 
hCV1348610 rs3739636 C9orf46 ISCHEMIC_STK AGE MALE GEN AG 1.307 1.014 1.685 0.0389 0.11763
DIAB HTN
hCV1348610 rs3739636 C9orf46 ISCHEMIC_STK AGE MALE DOM AG or 1.262 0.993 1.602 0.0567 .
DIAB HTN AA
hCV1348610 rs3739636 C9orf46 NOHD_STK AGE MALE GEN AG 1.285 0.981 1.683 0.0688 0.15881
DIAB HTN
hCV1348610 rs3739636 C9orf46 NONCE_STK AGE MALE GEN AG 1.283 0.96 1.714 0.0923 0.22581
DIAB HTN
hCV26505812 rs10757274 C9P21 ATHERO_STK AGE MALE REC GG 1.363 0.956 1.943 0.0866 .
DIAB HTN
hCV26505812 rs10757274 C9P21 NONCE_STK AGE MALE REC GG 1.32 0.959 1.818 0.0886 .
DIAB HTN
hCV2169762 rs1804689 HPS1 CE_STK GEN TG 1.479 1.172 1.866 0.001 0.00436
hCV2169762 rs1804689 HPS1 CE_STK DOM TG or 1.422 1.139 1.774 0.0018 .
TT
hCV2169762 rs1804689 HPS1 CE_STK ADD T 1.216 1.033 1.433 0.0189 .
hCV2169762 rs1804689 HPS1 CE_STK AGE MALE DOM TG or 1.401 1.046 1.876 0.0237 .
DIAB HTN TT
hCV2169762 rs1804689 HPS1 CE_STK AGE MALE GEN TG 1.41 1.038 1.916 0.0281 0.07665
DIAB HTN
hCV2169762 rs1804689 HPS1 CE_STK AGE MALE ADD T 1.25 1.003 1.559 0.0473 .
DIAB HTN
hCV2169762 rs1804689 HPS1 EO_STK AGE MALE REC TT 1.493 0.946 2.357 0.0852 .
DIAB HTN
hCV2169762 rs1804689 HPS1 ISCHEMIC_STK AGE MALE ADD T 1.246 1.052 1.476 0.0108 .
DIAB HTN
hCV2169762 rs1804689 HPS1 ISCHEMIC_STK DOM TG or 1.233 1.043 1.456 0.014 .
TT
hCV2169762 rs1804689 HPS1 ISCHEMIC_STK AGE MALE DOM TG or 1.31 1.046 1.641 0.0187 .
DIAB HTN TT
hCV2169762 rs1804689 HPS1 ISCHEMIC_STK GEN TG 1.236 1.035 1.476 0.0192 0.04864
hCV2169762 rs1804689 HPS1 ISCHEMIC_STK AGE MALE GEN TT 1.536 1.045 2.259 0.0291 0.03859
DIAB HTN
hCV2169762 rs1804689 HPS1 ISCHEMIC_STK ADD T 1.148 1.014 1.301 0.0296 .
hCV2169762 rs1804689 HPS1 ISCHEMIC_STK AGE MALE GEN TG 1.258 0.991 1.597 0.0589 0.03859
DIAB HTN
hCV2169762 rs1804689 HPS1 ISCHEMIC_STK AGE MALE REC TT 1.382 0.955 2 0.0861 .
DIAB HTN
hCV2169762 rs1804689 HPS1 LACUNAR_STK AGE MALE DOM TG or 1.362 0.949 1.955 0.0934 .
DIAB HTN TT
hCV2169762 rs1804689 HPS1 NOHD_STK DOM TG or 1.35 1.125 1.619 0.0012 .
TT
hCV2169762 rs1804689 HPS1 NOHD_STK GEN TG 1.354 1.116 1.642 0.0021 0.00545
hCV2169762 rs1804689 HPS1 NOHD_STK ADD T 1.218 1.064 1.395 0.0042 .
hCV2169762 rs1804689 HPS1 NOHD_STK AGE MALE ADD T 1.281 1.069 1.534 0.0073 .
DIAB HTN
hCV2169762 rs1804689 HPS1 NOHD_STK AGE MALE DOM TG or 1.386 1.089 1.763 0.0079 .
DIAB HTN TT
hCV2169762 rs1804689 HPS1 NOHD_STK AGE MALE GEN TG 1.347 1.044 1.737 0.0221 0.02354
DIAB HTN
hCV2169762 rs1804689 HPS1 NOHD_STK AGE MALE GEN TT 1.553 1.031 2.34 0.035 0.02354
DIAB HTN
hCV2169762 rs1804689 HPS1 NOHD_STK GEN TT 1.335 0.985 1.809 0.063 0.00545
hCV2169762 rs1804689 HPS1 NONCE_STK AGE MALE GEN TT 1.497 0.971 2.308 0.0677 0.17878
DIAB HTN
hCV2169762 rs1804689 HPS1 NONCE_STK AGE MALE ADD T 1.188 0.981 1.438 0.0774 .
DIAB HTN
hCV2169762 rs1804689 HPS1 NONCE_STK AGE MALE REC TT 1.422 0.939 2.153 0.0966 .
DIAB HTN
hCV27830265 rs12762303 ALOX5 ATHERO_STK GEN GG 2.437 1.292 4.596 0.0059 0.01855
hCV27830265 rs12762303 ALOX5 ATHERO_STK REC GG 2.354 1.254 4.421 0.0077 .
hCV27830265 rs12762303 ALOX5 ATHERO_STK AGE MALE ADD G 1.38 1.051 1.812 0.0204 .
DIAB HTN
hCV27830265 rs12762303 ALOX5 ATHERO_STK ADD G 1.256 1.027 1.535 0.0262 .
hCV27830265 rs12762303 ALOX5 ATHERO_STK AGE MALE GEN GG 2.705 1.09 6.711 0.0318 0.04449
DIAB HTN
hCV27830265 rs12762303 ALOX5 ATHERO_STK AGE MALE REC GG 2.508 1.018 6.179 0.0456 .
DIAB HTN
hCV27830265 rs12762303 ALOX5 ATHERO_STK AGE MALE DOM GA or 1.356 0.997 1.845 0.0522 .
DIAB HTN GG
hCV27830265 rs12762303 ALOX5 EO_STK AGE MALE ADD G 1.294 0.988 1.697 0.0616 .
DIAB HTN
hCV27830265 rs12762303 ALOX5 EO_STK AGE MALE DOM GA or 1.322 0.979 1.786 0.0687 .
DIAB HTN GG
hCV27830265 rs12762303 ALOX5 EO_STK AGE MALE GEN GA 1.302 0.956 1.772 0.0938 0.17365
DIAB HTN
hCV27830265 rs12762303 ALOX5 ISCHEMIC_STK GEN GG 1.909 1.098 3.32 0.0219 0.06853
hCV27830265 rs12762303 ALOX5 ISCHEMIC_STK REC GG 1.88 1.084 3.26 0.0246 .
hCV27830265 rs12762303 ALOX5 ISCHEMIC_STK AGE MALE ADD G 1.231 0.99 1.53 0.0618 .
DIAB HTN
hCV27830265 rs12762303 ALOX5 ISCHEMIC_STK AGE MALE GEN GG 2.011 0.94 4.304 0.0719 0.12112
DIAB HTN
hCV27830265 rs12762303 ALOX5 ISCHEMIC_STK AGE MALE REC GG 1.923 0.902 4.099 0.0903 .
DIAB HTN
hCV27830265 rs12762303 ALOX5 ISCHEMIC_STK ADD G 1.146 0.977 1.344 0.0941 .
hCV27830265 rs12762303 ALOX5 LACUNAR_STK AGE MALE ADD G 1.391 0.982 1.972 0.0632 .
DIAB HTN
hCV27830265 rs12762303 ALOX5 LACUNAR_STK AGE MALE DOM GA or 1.408 0.958 2.069 0.082 .
DIAB HTN GG
hCV27830265 rs12762303 ALOX5 NOHD_STK GEN GG 1.889 1.048 3.404 0.0342 0.10105
hCV27830265 rs12762303 ALOX5 NOHD_STK REC GG 1.859 1.035 3.339 0.0381 .
hCV27830265 rs12762303 ALOX5 NOHD_STK AGE MALE ADD G 1.246 0.988 1.571 0.0637 .
DIAB HTN
hCV27830265 rs12762303 ALOX5 NONCE_STK AGE MALE ADD G 1.376 1.074 1.761 0.0114 .
DIAB HTN
hCV27830265 rs12762303 ALOX5 NONCE_STK GEN GG 2.132 1.172 3.878 0.0132 0.02459
hCV27830265 rs12762303 ALOX5 NONCE_STK ADD G 1.248 1.042 1.493 0.0158 .
hCV27830265 rs12762303 ALOX5 NONCE_STK REC GG 2.037 1.124 3.693 0.019 .
hCV27830265 rs12762303 ALOX5 NONCE_STK AGE MALE DOM GA or 1.386 1.051 1.83 0.021 .
DIAB HTN GG
hCV27830265 rs12762303 ALOX5 NONCE_STK AGE MALE GEN GA 1.335 1.004 1.775 0.0472 0.03807
DIAB HTN
hCV27830265 rs12762303 ALOX5 NONCE_STK DOM GA or 1.221 0.996 1.497 0.0553 .
GG
hCV27830265 rs12762303 ALOX5 NONCE_STK AGE MALE GEN GG 2.187 0.939 5.093 0.0697 0.03807
DIAB HTN
hCV27830265 rs12762303 ALOX5 RECURRENT_STK REC GG 3.032 1.42 6.474 0.0042 .
hCV27830265 rs12762303 ALOX5 RECURRENT_STK GEN GG 2.907 1.354 6.243 0.0062 0.01156
hCV27830265 rs12762303 ALOX5 RECURRENT_STK AGE MALE REC GG 4.128 1.238 13.766 0.021 .
DIAB HTN
hCV27830265 rs12762303 ALOX5 RECURRENT_STK AGE MALE GEN GG 4.048 1.205 13.592 0.0237 0.06695
DIAB HTN
hCV1053082 rs544115 NEU3 ATHERO_STK AGE MALE DOM CT or 2.424 1.101 5.338 0.028 .
DIAB HTN CC
hCV1053082 rs544115 NEU3 ATHERO_STK AGE MALE GEN CC 2.412 1.089 5.342 0.03 0.08891
DIAB HTN
hCV1053082 rs544115 NEU3 ATHERO_STK AGE MALE GEN CT 2.452 1.079 5.571 0.0322 0.08891
DIAB HTN
hCV1053082 rs544115 NEU3 CE_STK AGE MALE GEN CC 2.519 1.057 6.004 0.0372 0.11133
DIAB HTN
hCV1053082 rs544115 NEU3 CE_STK AGE MALE DOM CT or 2.464 1.039 5.844 0.0406 .
DIAB HTN CC
hCV1053082 rs544115 NEU3 CE_STK ADD C 1.228 1.001 1.508 0.0494 .
hCV1053082 rs544115 NEU3 CE_STK AGE MALE GEN CT 2.339 0.958 5.715 0.0622 0.11133
DIAB HTN
hCV1053082 rs544115 NEU3 CE_STK REC CC 1.233 0.972 1.564 0.084 .
hCV1053082 rs544115 NEU3 EO_STK DOM CT or 2.443 1.139 5.24 0.0218 .
CC
hCV1053082 rs544115 NEU3 EO_STK GEN CC 2.453 1.139 5.282 0.0219 0.07158
hCV1053082 rs544115 NEU3 EO_STK GEN CT 2.419 1.101 5.313 0.0278 0.07158
hCV1053082 rs544115 NEU3 EO_STK AGE MALE ADD C 1.306 1.002 1.703 0.0483 .
DIAB HTN
hCV1053082 rs544115 NEU3 EO_STK AGE MALE GEN CC 2.182 0.894 5.324 0.0865 0.11774
DIAB HTN
hCV1053082 rs544115 NEU3 EO_STK AGE MALE REC CC 1.297 0.959 1.752 0.0909 .
DIAB HTN
hCV1053082 rs544115 NEU3 ISCHEMIC_STK AGE MALE DOM CT or 2.441 1.274 4.675 0.0071 .
DIAB HTN CC
hCV1053082 rs544115 NEU3 ISCHEMIC_STK AGE MALE GEN CC 2.438 1.267 4.689 0.0076 0.02673
DIAB HTN
hCV1053082 rs544115 NEU3 ISCHEMIC_STK AGE MALE GEN CT 2.449 1.249 4.801 0.0091 0.02673
DIAB HTN
hCV1053082 rs544115 NEU3 ISCHEMIC_STK GEN CC 1.695 1.052 2.732 0.0302 0.08337
hCV1053082 rs544115 NEU3 ISCHEMIC_STK DOM CT or 1.658 1.032 2.664 0.0365 .
CC
hCV1053082 rs544115 NEU3 ISCHEMIC_STK GEN CT 1.577 0.965 2.576 0.0691 0.08337
hCV1053082 rs544115 NEU3 ISCHEMIC_STK ADD C 1.152 0.989 1.343 0.0698 .
hCV1053082 rs544115 NEU3 NOHD_STK AGE MALE DOM CT or 2.225 1.109 4.465 0.0244 .
DIAB HTN CC
hCV1053082 rs544115 NEU3 NOHD_STK AGE MALE GEN CT 2.282 1.109 4.692 0.025 0.07672
DIAB HTN
hCV1053082 rs544115 NEU3 NOHD_STK AGE MALE GEN CC 2.202 1.092 4.438 0.0274 0.07672
DIAB HTN
hCV1053082 rs544115 NEU3 NOHD_STK GEN CC 1.715 1.006 2.924 0.0475 0.13875
hCV1053082 rs544115 NEU3 NOHD_STK DOM CT or 1.695 0.998 2.88 0.0509 .
CC
hCV1053082 rs544115 NEU3 NOHD_STK GEN CT 1.651 0.955 2.855 0.0727 0.13875
hCV1053082 rs544115 NEU3 NONCE_STK AGE MALE DOM CT or 2.388 1.164 4.897 0.0175 .
DIAB HTN CC
hCV1053082 rs544115 NEU3 NONCE_STK AGE MALE GEN CT 2.451 1.164 5.163 0.0183 0.05761
DIAB HTN
hCV1053082 rs544115 NEU3 NONCE_STK AGE MALE GEN CC 2.36 1.145 4.866 0.02 0.05761
DIAB HTN
hCV1053082 rs544115 NEU3 NONCE_STK DOM CT or 1.684 0.963 2.945 0.0673 .
CC
hCV1053082 rs544115 NEU3 NONCE_STK GEN CC 1.69 0.963 2.966 0.0674 0.18668
hCV1053082 rs544115 NEU3 NONCE_STK GEN CT 1.672 0.939 2.977 0.0808 0.18668
hCV1452085 rs12223005 TRIM22 ISCHEMIC_STK AGE MALE GEN CA 2.844 0.95 8.517 0.0617 0.07446
DIAB HTN
hCV1452085 rs12223005 TRIM22 LACUNAR_STK AGE MALE GEN CA 8.604 0.863 85.766 0.0666 0.00063
DIAB HTN
hCV1452085 rs12223005 TRIM22 NOHD_STK AGE MALE GEN CA 4.953 1.405 17.456 0.0128 0.01831
DIAB HTN
hCV1452085 rs12223005 TRIM22 NOHD_STK AGE MALE DOM CA or 3.875 1.132 13.267 0.031 .
DIAB HTN CC
hCV1452085 rs12223005 TRIM22 NOHD_STK AGE MALE GEN CC 3.687 1.075 12.65 0.038 0.01831
DIAB HTN
hCV1452085 rs12223005 TRIM22 NONCE_STK AGE MALE GEN CA 2.892 0.881 9.491 0.0798 0.03384
DIAB HTN
hCV1452085 rs12223005 TRIM22 RECURRENT_STK AGE MALE GEN CA 12.05 0.995 145.92 0.0505 0.02942
DIAB HTN
hCV302629 rs9284183 UBAC2 EO_STK GEN GA 1.268 0.982 1.638 0.0684 0.16605
hCV11474611 rs3814843 CALM1 ATHERO_STK GEN GT 1.408 0.962 2.061 0.0785 0.15447
hCV11474611 rs3814843 CALM1 CE_STK AGE MALE GEN GG 7.206 0.691 75.167 0.0988 0.25264
DIAB HTN
hCV11474611 rs3814843 CALM1 CE_STK AGE MALE REC GG 7.176 0.688 74.834 0.0995 .
DIAB HTN
hCV1262973 rs229653 PLEKHG3 CE_STK GEN AG 1.33 0.99 1.789 0.0586 0.03312
hCV27892569 rs4903741 NRXN3 CE_STK GEN CC 1.569 1.022 2.409 0.0394 0.11153
hCV27892569 rs4903741 NRXN3 CE_STK REC CC 1.514 0.996 2.303 0.0525 .
hCV27892569 rs4903741 NRXN3 CE_STK ADD C 1.184 0.993 1.412 0.06 .
hCV27892569 rs4903741 NRXN3 NOHD_STK ADD C 1.139 0.982 1.32 0.0847 .
hCV27077072 rs8060368 RECURRENT_STK ADD C 1.253 0.99 1.587 0.0605 .
hCV27077072 rs8060368 RECURRENT_STK REC CC 1.308 0.967 1.77 0.0816 .
hCV27077072 rs8060368 RECURRENT_STK AGE MALE GEN CC 1.952 0.901 4.23 0.0899 0.22584
DIAB HTN
hCV32160712 rs11079160 CE_STK GEN TT 1.93 1.061 3.512 0.0313 0.0843 
hCV32160712 rs11079160 CE_STK REC TT 1.872 1.034 3.391 0.0385 .
hCV32160712 rs11079160 CE_STK ADD T 1.213 0.988 1.489 0.0648 .
hCV32160712 rs11079160 EO_STK AGE MALE REC TT 2.382 1.026 5.532 0.0435 .
DIAB HTN
hCV32160712 rs11079160 EO_STK AGE MALE GEN TT 2.361 1.011 5.513 0.047 0.12823
DIAB HTN
hCV32160712 rs11079160 ISCHEMIC_STK GEN TT 1.563 0.953 2.565 0.0772 0.1756 
hCV32160712 rs11079160 ISCHEMIC_STK REC TT 1.529 0.935 2.502 0.0907 .
hCV1619596 rs1048621 SDCBP2 CE_STK AGE MALE GEN AG 1.412 1.038 1.92 0.0281 0.08963
DIAB HTN
hCV1619596 rs1048621 SDCBP2 CE_STK AGE MALE DOM AG or 1.362 1.017 1.823 0.0382 .
DIAB HTN AA
hCV1619596 rs1048621 SDCBP2 CE_STK ADD A 1.168 0.982 1.389 0.0794 .
hCV1619596 rs1048621 SDCBP2 EO_STK DOM AG or 1.314 1.03 1.677 0.0281 .
AA
hCV1619596 rs1048621 SDCBP2 EO_STK GEN AG 1.33 1.029 1.719 0.0292 0.08594
hCV1619596 rs1048621 SDCBP2 EO_STK ADD A 1.205 0.993 1.461 0.0586 .
hCV1619596 rs1048621 SDCBP2 EO_STK AGE MALE DOM AG or 1.295 0.979 1.713 0.0699 .
DIAB HTN AA
hCV1619596 rs1048621 SDCBP2 EO_STK AGE MALE GEN AG 1.298 0.967 1.741 0.0822 0.1932 
DIAB HTN
hCV1619596 rs1048621 SDCBP2 ISCHEMIC_STK AGE MALE GEN AG 1.271 1.001 1.612 0.0486 0.14298
DIAB HTN
hCV1619596 rs1048621 SDCBP2 ISCHEMIC_STK AGE MALE DOM AG or 1.239 0.989 1.554 0.0629 .
DIAB HTN AA
hCV1619596 rs1048621 SDCBP2 ISCHEMIC_STK ADD A 1.125 0.985 1.284 0.0826 .
hCV2358247 rs415989 WFDC3 RECURRENT_STK DOM GA or 1.521 0.989 2.34 0.0561 .
GG
hCV2358247 rs415989 WFDC3 RECURRENT_STK GEN GA 1.527 0.987 2.363 0.0574 0.16029
hCV2358247 rs415989 WFDC3 RECURRENT_STK ADD G 1.468 0.978 2.204 0.0636 .
hCV29537898 rs6073804 NOHD_STK GEN TC 1.303 1.011 1.679 0.0406 0.06312
hCV29537898 rs6073804 NOHD_STK DOM TC or 1.258 0.98 1.614 0.0712 .
TT
hCV29537898 rs6073804 RECURRENT_STK DOM TC or 1.866 1.288 2.703 0.001 .
TT
hCV29537898 rs6073804 RECURRENT_STK ADD T 1.749 1.25 2.448 0.0011 .
hCV29537898 rs6073804 RECURRENT_STK GEN TC 1.848 1.264 2.701 0.0015 0.00417
hCV1723718 rs12481805 UMODL1 EO_STK AGE MALE REC AA 1.543 0.928 2.565 0.0944 .
DIAB HTN
hCV1723718 rs12481805 UMODL1 LACUNAR_STK REC AA 1.773 1.119 2.809 0.0147 .
hCV1723718 rs12481805 UMODL1 LACUNAR_STK GEN AA 1.632 1.011 2.633 0.045 0.02572

TABLE 21
95% 95% ProbChi
Low- Up- Sq (2-
GENO- Odds er per sided p- PVAL-
hCV # rs # Gene OUTCOME ADJUST MODE TYPE Ratio CL CL value) UE_2DF
hCV11548152 rs11580249 EO_STK AGE MALE GEN TG 1.231 0.899 1.686 0.1947 0.43131
DIAB HTN
hCV1958451 rs2985822 MIER1 EO_STK DOM GT or 1.409 0.879 2.258 0.1545 .
GG
hCV1958451 rs2985822 MIER1 ISCHEMIC_STK GEN GT 1.279 0.909 1.8 0.1576 0.08689
hCV1958451 rs2985822 MIER1 LACUNAR_STK DOM GT or 1.638 0.857 3.131 0.1351 .
GG
hCV1958451 rs2985822 MIER1 LACUNAR_STK AGE MALE GEN GT 1.734 0.753 3.995 0.196 0.39776
DIAB HTN
hCV1958451 rs2985822 MIER1 NOHD_STK GEN GT 1.284 0.887 1.859 0.1849 0.03579
hCV1958451 rs2985822 MIER1 NONCE_STK GEN GT 1.361 0.915 2.024 0.1281 0.13834
hCV27494483 rs3748743 SLC22A15 CE_STK AGE MALE GEN TC 1.433 0.867 2.366 0.1602 0.27105
DIAB HTN
hCV27504565 rs3219489 MUTYH ISCHEMIC_STK DOM CG or 1.305 0.896 1.901 0.1656 .
CC
hCV27504565 rs3219489 MUTYH NOHD_STK GEN CC 1.339 0.872 2.055 0.1821 0.11469
hCV27504565 rs3219489 MUTYH NOHD_STK DOM CG or 1.407 0.922 2.146 0.1129 .
CC
hCV27504565 rs3219489 MUTYH NOHD_STK AGE MALE GEN CC 1.519 0.859 2.683 0.1503 0.18169
DIAB HTN
hCV27504565 rs3219489 MUTYH NOHD_STK AGE MALE DOM CG or 1.587 0.906 2.782 0.1066 .
DIAB HTN CC
hCV27504565 rs3219489 MUTYH NONCE_STK DOM CG or 1.351 0.871 2.095 0.1786 .
CC
hCV27504565 rs3219489 MUTYH NONCE_STK AGE MALE DOM CG or 1.593 0.877 2.895 0.1265 .
DIAB HTN CC
hCV27504565 rs3219489 MUTYH RECURENT_STK AGE MALE GEN CC 2.313 0.826 6.477 0.1106 0.15677
DIAB HTN
hCV31227848 rs11809423 HIVEP3 ATHERO_STK GEN TC 1.404 0.927 2.128 0.1094 0.06604
hCV31227848 rs11809423 HIVEP3 NOHD_STK GEN TC 1.284 0.889 1.853 0.1822 0.0563 
hCV31227848 rs11809423 HIVEP3 NONCE_STK GEN TC 1.327 0.908 1.939 0.1434 0.12332
hCV454333 rs10916581 NVL RECURRENT_STK GEN CT 5.03 0.664 38.1 0.1179 0.09083
hCV454333 rs10916581 NVL RECURRENT_STK GEN CC 3.778 0.504 28.32 0.1959 0.09083
hCV454333 rs10916581 NVL RECURRENT_STK DOM CT or 4.101 0.548 30.66 0.1692 .
CC
hCV8754449 rs781226 TESK2 NOHD_STK GEN CT 1.375 0.894 2.114 0.1474 0.25013
hCV8754449 rs781226 TESK2 NOHD_STK AGE MALE GEN CT 1.508 0.856 2.656 0.1552 0.34108
DIAB HTN
hCV8754449 rs781226 TESK2 NONCE_STK AGE MALE GEN CT 1.536 0.841 2.803 0.1625 0.25117
DIAB HTN
hCV8754449 rs781226 TESK2 RECURRENT_STK AGE MALE GEN CC 2.321 0.83 6.495 0.1087 0.20413
DIAB HTN
hCV2091644 rs1010 VAMP8 CE_STK GEN CC 1.287 0.933 1.776 0.1236 0.25285
hCV2091644 rs1010 VAMP8 CE_STK ADD C 1.114 0.952 1.305 0.1788 .
hCV2091644 rs1010 VAMP8 EO_STK AGE MALE GEN CT 1.238 0.912 1.682 0.1714 0.34826
DIAB HTN
hCV2091644 rs1010 VAMP8 ISCHEMIC_STK GEN CC 1.189 0.927 1.524 0.1731 0.28614
hCV2091644 rs1010 VAMP8 ISCHEMIC_STK REC CC 1.198 0.957 1.499 0.115 .
hCV2091644 rs1010 VAMP8 RECURRENT_STK AGE MALE GEN CT 1.385 0.865 2.216 0.1753 0.3581 
DIAB HTN
hCV7425232 rs3900940 MYH15 EO_STK AGE MALE DOM CT or 1.208 0.913 1.596 0.1853 .
DIAB HTN CC
hCV8820007 rs938390 ATHERO_STK GEN TT 1.428 0.865 2.359 0.1639 0.18574
hCV8820007 rs938390 ATHERO_STK DOM TA or 1.486 0.906 2.437 0.1171 .
TT
hCV8820007 rs938390 ATHERO_STK AGE MALE GEN TA 1.603 0.846 3.038 0.1475 0.28036
DIAB HTN
hCV8820007 rs938390 CE_STK GEN TA 1.389 0.846 2.282 0.194 0.14033
hCV8820007 rs938390 EO_STK GEN TA 1.523 0.889 2.609 0.1254 0.30388
hCV8820007 rs938390 EO_STK DOM TA or 1.432 0.862 2.379 0.1661 .
TT
hCV8820007 rs938390 EO_STK AGE MALE GEN TA 1.659 0.904 3.046 0.1025 0.25362
DIAB HTN
hCV8820007 rs938390 EO_STK AGE MALE GEN TT 1.463 0.818 2.616 0.1998 0.25362
DIAB HTN
hCV8820007 rs938390 EO_STK AGE MALE DOM TA or 1.525 0.861 2.704 0.1482 .
DIAB HTN TT
hCV8820007 rs938390 ISCHEMIC_STK AGE MALE DOM TA or 1.382 0.871 2.194 0.1698 .
DIAB HTN TT
hCV8820007 rs938390 NOHD_STK AGE MALE GEN TT 1.434 0.856 2.403 0.1711 0.07825
DIAB HTN
hCV8820007 rs938390 NONCE_STK GEN TA 1.386 0.897 2.142 0.1412 0.28065
hCV8820007 rs938390 NONCE_STK AGE MALE GEN TA 1.555 0.891 2.713 0.1203 0.27256
DIAB HTN
hCV8820007 rs938390 NONCE_STK AGE MALE DOM TA or 1.431 0.845 2.423 0.1829 .
DIAB HTN TT
hCV8820007 rs938390 RECURRENT_STK GEN TA 1.702 0.812 3.567 0.1592 0.19862
hCV11354788 rs12644625 LOC729065 CE_STK AGE MALE REC TT 2.249 0.823 6.145 0.1141 .
DIAB HTN
hCV11354788 rs12644625 LOC729065 EO_STK AGE MALE GEN TT 2.129 0.727 6.236 0.1683 0.0564 
DIAB HTN
hCV11354788 rs12644625 LOC729065 ISCHEMIC_STK AGE MALE GEN TT 1.8 0.759 4.269 0.1821 0.03661
DIAB HTN
hCV11354788 rs12644625 LOC729065 NOHD_STK GEN TT 1.651 0.849 3.213 0.1397 0.02034
hCV11354788 rs12644625 LOC729065 NOHD_STK REC TT 1.552 0.799 3.015 0.1942 .
hCV11354788 rs12644625 LOC729065 NOHD_STK AGE MALE GEN TT 1.985 0.81 4.86 0.1337 0.06231
DIAB HTN
hCV11354788 rs12644625 LOC729065 NOHD_STK AGE MALE REC TT 1.86 0.761 4.543 0.1733 .
DIAB HTN
hCV11354788 rs12644625 LOC729065 NONCE_STK ADD T 1.186 0.967 1.454 0.1013 .
hCV11354788 rs12644625 LOC729065 NONCE_STK AGE MALE GEN TC 1.288 0.941 1.763 0.1139 0.25236
DIAB HTN
hCV11354788 rs12644625 LOC729065 NONCE_STK AGE MALE ADD T 1.261 0.955 1.666 0.102 .
DIAB HTN
hCV15854171 rs2231137 ABCG2 CE_STK ADD C 1.357 0.865 2.129 0.184 .
hCV16158671 rs2200733 ATHERO_STK AGE MALE GEN TT 2.133 0.724 6.287 0.1696 0.07966
DIAB HTN
hCV16158671 rs2200733 CE_STK AGE MALE REC TT 2.054 0.774 5.452 0.1483 .
DIAB HTN
hCV16158671 rs2200733 EO_STK AGE MALE GEN TT 1.982 0.7 5.614 0.1976 0.07117
DIAB HTN
hCV16158671 rs2200733 ISCHEMIC_STK GEN TT 1.506 0.815 2.783 0.1916 0.00631
hCV16158671 rs2200733 ISCHEMIC_STK AGE MALE GEN TT 1.874 0.819 4.292 0.1372 0.03074
DIAB HTN
hCV16158671 rs2200733 ISCHEMIC_STK AGE MALE REC TT 1.743 0.763 3.982 0.1873 .
DIAB HTN
hCV16158671 rs2200733 NOHD_STK GEN TT 1.705 0.898 3.238 0.1031 0.01299
hCV16158671 rs2200733 NOHD_STK REC TT 1.599 0.844 3.032 0.1501 .
hCV16158671 rs2200733 NOHD_STK AGE MALE REC TT 1.973 0.839 4.643 0.1195 .
DIAB HTN
hCV16158671 rs2200733 NONCE_STK AGE MALE GEN TC 1.275 0.93 1.747 0.1316 0.22725
DIAB HTN
hCV16336 rs362277 HD ATHERO_STK AGE MALE ADD C 1.321 0.946 1.844 0.102 .
DIAB HTN
hCV16336 rs362277 HD CE_STK DOM CT or 3.411 0.777 14.97 0.104 .
CC
hCV16336 rs362277 HD ISCHEMIC_STK GEN CC 1.847 0.825 4.133 0.1354 0.00758
hCV16336 rs362277 HD ISCHEMIC_STK DOM CT or 1.751 0.783 3.914 0.1725 .
CC
hCV16336 rs362277 HD LACUNAR_STK AGE MALE ADD C 1.368 0.892 2.097 0.1507 .
DIAB HTN
hCV16336 rs362277 HD LACUNAR_STK AGE MALE REC CC 1.389 0.873 2.211 0.1656 .
DIAB HTN
hCV31137507 rs7660668 CLOCK LACUNAR_STK GEN CG 1.274 0.945 1.716 0.112 0.22027
hCV31137507 rs7660668 CLOCK LACUNAR_STK DOM CG or 1.21 0.909 1.612 0.1921 .
CC
hCV26478797 rs2015018 CHSY-2 CE_STK ADD G 1.134 0.951 1.352 0.1602 .
hCV26478797 rs2015018 CHSY-2 CE_STK AGE MALE REC GG 1.233 0.921 1.649 0.1593 .
DIAB HTN
hCV26478797 rs2015018 CHSY-2 NOHD_STK REC GG 1.132 0.944 1.358 0.1816 .
hCV26478797 rs2015018 CHSY-2 RECURRENT_STK GEN GA 1.613 0.804 3.238 0.1787 0.30867
hCV26478797 rs2015018 CHSY-2 RECURRENT_STK GEN GG 1.712 0.86 3.407 0.1255 0.30867
hCV26478797 rs2015018 CHSY-2 RECURRENT_STK DOM GA or 1.668 0.85 3.272 0.137 .
GG
hCV11425801 rs3805953 PEX6 ATHERO_STK AGE MALE GEN CC 1.372 0.929 2.025 0.1116 0.0005 
DIAB HTN
hCV11425801 rs3805953 PEX6 CE_STK AGE MALE GEN CT 1.287 0.913 1.812 0.1493 0.35182
DIAB HTN
hCV11425801 rs3805953 PEX6 EO_STK GEN CC 1.254 0.903 1.739 0.1764 0.00345
hCV11425801 rs3805953 PEX6 EO_STK ADD C 1.133 0.961 1.335 0.1372 .
hCV11425801 rs3805953 PEX6 ISCHEMIC_STK GEN CC 1.202 0.958 1.508 0.1123 0.02335
hCV11425801 rs3805953 PEX6 ISCHEMIC_STK AGE MALE ADD C 1.116 0.959 1.3 0.1556 .
DIAB HTN
hCV11425801 rs3805953 PEX6 LACUNAR_STK DOM CT or 1.235 0.897 1.7 0.1959 .
CC
hCV11425801 rs3805953 PEX6 NOHD_STK AGE MALE GEN CC 1.236 0.896 1.706 0.1968 0.00304
DIAB HTN
hCV11425801 rs3805953 PEX6 NOHD_STK AGE MALE ADD C 1.124 0.958 1.32 0.1525 .
DIAB HTN
hCV11425801 rs3805953 PEX6 NONCE_STK AGE MALE GEN CC 1.276 0.898 1.813 0.1732 0.00005
DIAB HTN
hCV11425801 rs3805953 PEX6 NONCE_STK AGE MALE ADD C 1.147 0.963 1.365 0.1237 .
DIAB HTN
hCV11425801 rs3805953 PEX6 RECURRENT_STK DOM CT or 1.28 0.912 1.798 0.1535 .
CC
hCV11425801 rs3805953 PEX6 RECURRENT_STK AGE MALE DOM CT or 1.403 0.885 2.225 0.1498 .
DIAB HTN CC
hCV11425842 rs10948059 GNMT ATHERO_STK GEN CC 1.263 0.927 1.722 0.1392 0.19224
hCV11425842 rs10948059 GNMT ATHERO_STK ADD C 1.109 0.953 1.29 0.1815 .
hCV11425842 rs10948059 GNMT ATHERO_STK AGE MALE ADD C 1.178 0.964 1.439 0.1101 .
DIAB HTN
hCV11425842 rs10948059 GNMT CE_STK AGE MALE DOM CT or 1.272 0.898 1.8 0.1751 .
DIAB HTN CC
hCV11425842 rs10948059 GNMT EO_STK ADD C 1.141 0.964 1.352 0.126 .
hCV11425842 rs10948059 GNMT EO_STK AGE MALE GEN CC 1.302 0.883 1.92 0.1827 0.08575
DIAB HTN
hCV11425842 rs10948059 GNMT ISCHEMIC_STK AGE MALE GEN CC 1.27 0.925 1.743 0.1389 0.1427 
DIAB HTN
hCV11425842 rs10948059 GNMT ISCHEMIC_STK AGE MALE ADD C 1.113 0.951 1.303 0.1836 .
DIAB HTN
hCV11425842 rs10948059 GNMT NOHD_STK AGE MALE GEN CT 1.279 0.938 1.745 0.1197 0.26094
DIAB HTN
hCV11425842 rs10948059 GNMT NOHD_STK AGE MALE GEN CC 1.266 0.905 1.772 0.1686 0.26094
DIAB HTN
hCV11425842 rs10948059 GNMT NOHD_STK AGE MALE DOM CT or 1.274 0.953 1.703 0.1015 .
DIAB HTN CC
hCV11425842 rs10948059 GNMT NONCE_STK GEN CT 1.195 0.932 1.531 0.1595 0.35697
hCV11425842 rs10948059 GNMT NONCE_STK DOM CT or 1.184 0.938 1.495 0.1556 .
CC
hCV11425842 rs10948059 GNMT NONCE_STK AGE MALE GEN CC 1.294 0.9 1.861 0.1646 0.10566
DIAB HTN
hCV16134786 rs2857595 EO_STK GEN AG 1.207 0.929 1.568 0.1593 0.0477 
hCV16134786 rs2857595 EO_STK AGE MALE ADD A 1.185 0.934 1.504 0.1629 .
DIAB HTN
hCV16134786 rs2857595 ISCHEMIC_STK GEN AA 1.406 0.933 2.119 0.103 0.26366
hCV16134786 rs2857595 ISCHEMIC_STK REC AA 1.392 0.928 2.088 0.1098 .
hCV16134786 rs2857595 ISCHEMIC_STK AGE MALE ADD A 1.154 0.949 1.402 0.1516 .
DIAB HTN
hCV16134786 rs2857595 LACUNAR_STK AGE MALE GEN AA 1.77 0.809 3.873 0.153 0.27205
DIAB HTN
hCV16134786 rs2857595 LACUNAR_STK AGE MALE ADD A 1.272 0.943 1.717 0.1157 .
DIAB HTN
hCV16134786 rs2857595 LACUNAR_STK AGE MALE DOM AG or 1.287 0.889 1.863 0.182 .
DIAB HTN AA
hCV16134786 rs2857595 NONCE_STK DOM AG or 1.151 0.947 1.399 0.1584 .
AA
hCV16134786 rs2857595 NONCE_STK REC AA 1.448 0.924 2.268 0.1062 .
hCV25651109 rs35690712 SLC39A7 EO_STK GEN GC 5.189 0.556 48.4 0.1484 0.34485
hCV25651109 rs35690712 SLC39A7 EO_STK GEN GG 4.668 0.52 41.92 0.1689 0.34485
hCV25651109 rs35690712 SLC39A7 EO_STK DOM GC or 4.709 0.525 42.28 0.1664 .
GG
hCV25651109 rs35690712 SLC39A7 ISCHEMIC_STK AGE MALE GEN GC 4.69 0.505 43.57 0.1742 0.39506
DIAB HTN
hCV25651109 rs35690712 SLC39A7 ISCHEMIC_STK AGE MALE GEN GG 4.372 0.486 39.35 0.1882 0.39506
DIAB HTN
hCV25651109 rs35690712 SLC39A7 ISCHEMIC_STK AGE MALE DOM GC or 4.398 0.489 39.56 0.1864 .
DIAB HTN GG
hCV25651109 rs35690712 SLC39A7 NONCE_STK GEN GC 4.525 0.542 37.77 0.1632 0.26183
hCV25651109 rs35690712 SLC39A7 NONCE_STK GEN GG 5.073 0.623 41.3 0.129 0.26183
hCV25651109 rs35690712 SLC39A7 NONCE_STK ADD G 1.239 0.895 1.713 0.1962 .
hCV25651109 rs35690712 SLC39A7 NONCE_STK DOM GC or 5.026 0.618 40.91 0.1312 .
GG
hCV30308202 rs9482985 LAMA2 CE_STK ADD G 1.168 0.958 1.423 0.1237 .
hCV30308202 rs9482985 LAMA2 CE_STK REC GG 1.179 0.936 1.484 0.1621 .
hCV30308202 rs9482985 LAMA2 CE_STK AGE MALE GEN GC 1.724 0.779 3.815 0.1792 0.26508
DIAB HTN
hCV30308202 rs9482985 LAMA2 CE_STK AGE MALE GEN GG 1.878 0.867 4.07 0.1103 0.26508
DIAB HTN
hCV30308202 rs9482985 LAMA2 CE_STK AGE MALE ADD G 1.19 0.92 1.54 0.1851 .
DIAB HTN
hCV30308202 rs9482985 LAMA2 CE_STK AGE MALE DOM GC or 1.825 0.848 3.929 0.124 .
DIAB HTN GG
hCV30308202 rs9482985 LAMA2 RECURRENT_STK DOM GC or 2.236 0.795 6.289 0.1272 .
GG
hCV30308202 rs9482985 LAMA2 RECURRENT_STK AGE MALE ADD G 1.379 0.94 2.022 0.1002 .
DIAB HTN
hCV3082219 rs1884833 RFXDC1 EO_STK GEN AG 1.217 0.909 1.628 0.1874 0.16147
hCV3082219 rs1884833 RFXDC1 EO_STK GEN AA 2.194 0.766 6.286 0.1434 0.16147
hCV3082219 rs1884833 RFXDC1 EO_STK DOM AG or 1.262 0.949 1.677 0.1091 .
AA
hCV3082219 rs1884833 RFXDC1 EO_STK REC AA 2.096 0.733 5.993 0.1672 .
hCV3082219 rs1884833 RFXDC1 LACUNAR_STK GEN AA 2.024 0.703 5.824 0.1911 0.07365
hCV3082219 rs1884833 RFXDC1 LACUNAR_STK AGE MALE GEN AA 2.876 0.735 11.26 0.1292 0.25425
DIAB HTN
hCV3082219 rs1884833 RFXDC1 LACUNAR_STK AGE MALE ADD A 1.288 0.89 1.865 0.18 .
DIAB HTN
hCV3082219 rs1884833 RFXDC1 LACUNAR_STK AGE MALE REC AA 2.755 0.706 10.75 0.1444 .
DIAB HTN
hCV3082219 rs1884833 RFXDC1 NOHD_STK GEN AA 1.762 0.835 3.717 0.137 0.20951
hCV3082219 rs1884833 RFXDC1 NOHD_STK ADD A 1.171 0.965 1.421 0.11 .
hCV3082219 rs1884833 RFXDC1 NOHD_STK DOM AG or 1.158 0.935 1.432 0.1783 .
AA
hCV3082219 rs1884833 RFXDC1 NOHD_STK REC AA 1.715 0.814 3.612 0.1557 .
hCV3082219 rs1884833 RFXDC1 NOHD_STK AGE MALE GEN AA 1.98 0.711 5.513 0.1912 0.41847
DIAB HTN
hCV3082219 rs1884833 RFXDC1 NOHD_STK AGE MALE REC AA 1.961 0.706 5.45 0.1964 .
DIAB HTN
hCV8942032 rs1264352 DDR1 ATHERO_STK AGE MALE GEN CG 1.315 0.937 1.846 0.1128 0.23534
DIAB HTN
hCV8942032 rs1264352 DDR1 ATHERO_STK AGE MALE DOM CG or 1.257 0.906 1.744 0.1707 .
DIAB HTN CC
hCV8942032 rs1264352 DDR1 CE_STK AGE MALE GEN CG 1.299 0.916 1.842 0.1424 0.29178
DIAB HTN
hCV8942032 rs1264352 DDR1 CE_STK AGE MALE ADD C 1.251 0.938 1.669 0.1269 .
DIAB HTN
hCV8942032 rs1264352 DDR1 CE_STK AGE MALE DOM CG or 1.307 0.935 1.826 0.1175 .
DIAB HTN CC
hCV8942032 rs1264352 DDR1 ISCHEMIC_STK ADD C 1.119 0.948 1.321 0.1832 .
hCV8942032 rs1264352 DDR1 LACUNAR_STK AGE MALE GEN CC 2.104 0.743 5.961 0.1614 0.01502
DIAB HTN
hCV8942032 rs1264352 DDR1 NOHD_STK DOM CG or 1.16 0.942 1.43 0.163 .
CC
hCV8942032 rs1264352 DDR1 NOHD_STK AGE MALE ADD C 1.211 0.951 1.541 0.1206 .
DIAB HTN
hCV8942032 rs1264352 DDR1 NONCE_STK ADD C 1.142 0.948 1.375 0.1628 .
hCV25596936 rs6967117 EPHA1 ATHERO_STK ADD T 1.215 0.95 1.552 0.1207 .
hCV25596936 rs6967117 EPHA1 ISCHEMIC_STK DOM TC or 1.181 0.941 1.482 0.1522 .
TT
hCV25596936 rs6967117 EPHA1 LACUNAR_STK DOM TC or 1.352 0.937 1.951 0.1065 .
TT
hCV25596936 rs6967117 EPHA1 NOHD_STK DOM TC or 1.226 0.961 1.566 0.1014 .
TT
hCV29401764 rs7793552 LOC646588 ATHERO_STK AGE MALE DOM CT or 1.501 0.896 2.513 0.123 .
DIAB HTN CC
hCV15857769 rs2924914 ATHERO_STK AGE MALE ADD T 1.193 0.963 1.479 0.1061 .
DIAB HTN
hCV15857769 rs2924914 ATHERO_STK AGE MALE REC TT 1.456 0.92 2.305 0.1089 .
DIAB HTN
hCV15857769 rs2924914 NOHD_STK ADD T 1.12 0.975 1.287 0.1103 .
hCV15857769 rs2924914 RECURRENT_STK AGE MALE ADD T 1.255 0.909 1.731 0.167 .
DIAB HTN
hCV29539757 rs10110659 KCNQ3 ATHERO_STK GEN CA 1.362 0.902 2.058 0.1417 0.31708
hCV29539757 rs10110659 KCNQ3 ATHERO_STK DOM CA or 1.297 0.875 1.925 0.1957 .
CC
hCV29539757 rs10110659 KCNQ3 LACUNAR_STK GEN CA 1.453 0.843 2.504 0.1789 0.08401
hCV29539757 rs10110659 KCNQ3 NONCE_STK DOM CA or 1.283 0.909 1.81 0.1572 .
CC
hCV1348610 rs3739636 C9orf46 ATHERO_STK AGE MALE GEN AG 1.304 0.945 1.799 0.1062 0.25491
DIAB HTN
hCV1348610 rs3739636 C9orf46 ATHERO_STK AGE MALE DOM AG or 1.242 0.918 1.682 0.1605 .
DIAB HTN AA
hCV1348610 rs3739636 C9orf46 CE_STK AGE MALE GEN AG 1.24 0.895 1.719 0.1962 0.39368
DIAB HTN
hCV1348610 rs3739636 C9orf46 CE_STK AGE MALE DOM AG or 1.238 0.911 1.682 0.1722 .
DIAB HTN AA
hCV1348610 rs3739636 C9orf46 NOHD_STK AGE MALE DOM AG or 1.217 0.944 1.569 0.1306 .
DIAB HTN AA
hCV1348610 rs3739636 C9orf46 NONCE_STK AGE MALE DOM AG or 1.226 0.933 1.61 0.144 .
DIAB HTN AA
hCV1754669 rs2383206 C9P21 ATHERO_STK AGE MALE REC GG 1.277 0.913 1.784 0.1528 .
DIAB HTN
hCV1754669 rs2383206 C9P21 NONCE_STK AGE MALE REC GG 1.227 0.906 1.662 0.187 .
DIAB HTN
hCV26505812 rs10757274 C9P21 ISCHEMIC_STK AGE MALE REC GG 1.207 0.912 1.599 0.1887 .
DIAB HTN
hCV26505812 rs10757274 C9P21 NOHD_STK AGE MALE REC GG 1.238 0.918 1.669 0.1611 .
DIAB HTN
hCV26505812 rs10757274 C9P21 NONCE_STK AGE MALE GEN GG 1.297 0.893 1.884 0.1714 0.23096
DIAB HTN
hCV15752716 rs2296436 HPS1 CE_STK ADD T 1.242 0.914 1.686 0.1656 .
hCV15752716 rs2296436 HPS1 CE_STK REC TT 1.284 0.928 1.778 0.1311 .
hCV2169762 rs1804689 HPS1 ATHERO_STK GEN TT 1.293 0.914 1.829 0.1461 0.33606
hCV2169762 rs1804689 HPS1 ATHERO_STK REC TT 1.282 0.92 1.787 0.1422 .
hCV2169762 rs1804689 HPS1 ATHERO_STK AGE MALE GEN TT 1.446 0.902 2.316 0.1255 0.27749
DIAB HTN
hCV2169762 rs1804689 HPS1 ATHERO_STK AGE MALE REC TT 1.447 0.92 2.276 0.1093 .
DIAB HTN
hCV2169762 rs1804689 HPS1 EO_STK AGE MALE GEN TT 1.49 0.926 2.397 0.1003 0.2272 
DIAB HTN
hCV2169762 rs1804689 HPS1 ISCHEMIC_STK GEN TT 1.22 0.921 1.617 0.1658 0.04864
hCV2169762 rs1804689 HPS1 LACUNAR_STK GEN TG 1.273 0.941 1.721 0.1172 0.29125
hCV2169762 rs1804689 HPS1 LACUNAR_STK DOM TG or 1.235 0.927 1.644 0.1491 .
TT
hCV2169762 rs1804689 HPS1 LACUNAR_STK AGE MALE GEN TG 1.345 0.919 1.97 0.1275 0.23974
DIAB HTN
hCV2169762 rs1804689 HPS1 LACUNAR_STK AGE MALE ADD T 1.246 0.953 1.63 0.1085 .
DIAB HTN
hCV2169762 rs1804689 HPS1 NOHD_STK AGE MALE REC TT 1.351 0.914 1.999 0.1317 .
DIAB HTN
hCV2169762 rs1804689 HPS1 NONCE_STK GEN TT 1.229 0.897 1.683 0.1999 0.37015
hCV2169762 rs1804689 HPS1 NONCE_STK ADD T 1.106 0.961 1.272 0.1591 .
hCV2169762 rs1804689 HPS1 NONCE_STK AGE MALE DOM TG or 1.193 0.923 1.541 0.1783 .
DIAB HTN TT
hCV27830265 rs12762303 ALOX5 ATHERO_STK DOM GA or 1.204 0.956 1.515 0.1143 .
GG
hCV27830265 rs12762303 ALOX5 ATHERO_STK AGE MALE GEN GA 1.275 0.928 1.752 0.1331 0.04449
DIAB HTN
hCV27830265 rs12762303 ALOX5 CE_STK GEN GG 1.591 0.788 3.212 0.1954 0.27948
hCV27830265 rs12762303 ALOX5 CE_STK REC GG 1.637 0.813 3.293 0.1673 .
hCV27830265 rs12762303 ALOX5 CE_STK AGE MALE REC GG 1.967 0.73 5.302 0.1811 .
DIAB HTN
hCV27830265 rs12762303 ALOX5 EO_STK GEN GG 1.724 0.758 3.92 0.1937 0.27237
hCV27830265 rs12762303 ALOX5 EO_STK ADD G 1.201 0.951 1.517 0.1236 .
hCV27830265 rs12762303 ALOX5 EO_STK DOM GA or 1.194 0.919 1.551 0.1835 .
GG
hCV27830265 rs12762303 ALOX5 ISCHEMIC_STK AGE MALE DOM GA or 1.211 0.948 1.547 0.1246 .
DIAB HTN GG
hCV27830265 rs12762303 ALOX5 LACUNAR_STK GEN GA 1.242 0.911 1.692 0.1704 0.30411
hCV27830265 rs12762303 ALOX5 LACUNAR_STK ADD G 1.237 0.944 1.621 0.1228 .
hCV27830265 rs12762303 ALOX5 LACUNAR_STK DOM GA or 1.258 0.93 1.701 0.1365 .
GG
hCV27830265 rs12762303 ALOX5 LACUNAR_STK AGE MALE GEN GA 1.371 0.924 2.032 0.1169 0.17426
DIAB HTN
hCV27830265 rs12762303 ALOX5 NOHD_STK ADD G 1.146 0.963 1.364 0.1236 .
hCV27830265 rs12762303 ALOX5 NOHD_STK AGE MALE GEN GA 1.204 0.92 1.575 0.1757 0.16102
DIAB HTN
hCV27830265 rs12762303 ALOX5 NOHD_STK AGE MALE GEN GG 1.82 0.823 4.024 0.1389 0.16102
DIAB HTN
hCV27830265 rs12762303 ALOX5 NOHD_STK AGE MALE DOM GA or 1.244 0.958 1.615 0.1015 .
DIAB HTN GG
hCV27830265 rs12762303 ALOX5 NOHD_STK AGE MALE REC GG 1.722 0.783 3.787 0.1768 .
DIAB HTN
hCV27830265 rs12762303 ALOX5 NONCE_STK GEN GA 1.16 0.94 1.432 0.166 0.02459
hCV27830265 rs12762303 ALOX5 NONCE_STK AGE MALE REC GG 1.999 0.864 4.627 0.1056 .
DIAB HTN
hCV1053082 rs544115 NEU3 ATHERO_STK GEN CC 1.629 0.864 3.07 0.1313 0.29853
hCV1053082 rs544115 NEU3 ATHERO_STK ADD C 1.139 0.935 1.387 0.1971 .
hCV1053082 rs544115 NEU3 ATHERO_STK DOM CT or 1.597 0.851 2.997 0.1454 .
CC
hCV1053082 rs544115 NEU3 CE_STK GEN CC 1.702 0.885 3.27 0.1107 0.13598
hCV1053082 rs544115 NEU3 CE_STK DOM CT or 1.618 0.845 3.097 0.1466 .
CC
hCV1053082 rs544115 NEU3 CE_STK AGE MALE ADD C 1.237 0.945 1.619 0.1224 .
DIAB HTN
hCV1053082 rs544115 NEU3 EO_STK ADD C 1.172 0.933 1.471 0.172 .
hCV1053082 rs544115 NEU3 EO_STK AGE MALE DOM CT or 2.054 0.846 4.982 0.1115 .
DIAB HTN CC
hCV1053082 rs544115 NEU3 ISCHEMIC_STK REC CC 1.125 0.942 1.344 0.1924 .
hCV1053082 rs544115 NEU3 ISCHEMIC_STK AGE MALE ADD C 1.164 0.943 1.436 0.1567 .
DIAB HTN
hCV1053082 rs544115 NEU3 LACUNAR_STK GEN CT 2.025 0.775 5.292 0.1499 0.33773
hCV1053082 rs544115 NEU3 LACUNAR_STK DOM CT or 1.895 0.742 4.839 0.1815 .
CC
hCV1053082 rs544115 NEU3 LACUNAR_STK AGE MALE GEN CT 2.148 0.723 6.38 0.1685 0.38668
DIAB HTN
hCV1053082 rs544115 NEU3 LACUNAR_STK AGE MALE DOM CT or 2.036 0.708 5.851 0.1868 .
DIAB HTN CC
hCV1053082 rs544115 NEU3 NOHD_STK ADD C 1.128 0.954 1.333 0.1577 .
hCV1452085 rs12223005 TRIM22 CE_STK GEN CA 3.193 0.705 14.47 0.1321 0.27397
hCV1452085 rs12223005 TRIM22 CE_STK GEN CC 2.843 0.638 12.66 0.1703 0.27397
hCV1452085 rs12223005 TRIM22 CE_STK DOM CA or 2.902 0.652 12.91 0.1619 .
CC
hCV1452085 rs12223005 TRIM22 CE_STK AGE MALE GEN CA 4.133 0.74 23.07 0.1058 0.25417
DIAB HTN
hCV1452085 rs12223005 TRIM22 CE_STK AGE MALE GEN CC 3.631 0.67 19.68 0.1347 0.25417
DIAB HTN
hCV1452085 rs12223005 TRIM22 CE_STK AGE MALE DOM CA or 3.711 0.686 20.07 0.1279 .
DIAB HTN CC
hCV1452085 rs12223005 TRIM22 EO_STK GEN CA 2.362 0.762 7.322 0.1364 0.26957
hCV1452085 rs12223005 TRIM22 EO_STK DOM CA or 2.075 0.691 6.232 0.1935 .
CC
hCV1452085 rs12223005 TRIM22 ISCHEMIC_STK GEN CA 1.97 0.824 4.714 0.1275 0.08218
hCV1452085 rs12223005 TRIM22 ISCHEMIC_STK AGE MALE GEN CC 2.207 0.757 6.44 0.1472 0.07446
DIAB HTN
hCV1452085 rs12223005 TRIM22 ISCHEMIC_STK AGE MALE DOM CA or 2.31 0.793 6.727 0.1247 .
DIAB HTN CC
hCV1452085 rs12223005 TRIM22 LACUNAR_STK GEN CA 4.431 0.568 34.58 0.1556 0.00441
hCV1452085 rs12223005 TRIM22 LACUNAR_STK AGE MALE DOM CA or 4.519 0.471 43.37 0.1911 .
DIAB HTN CC
hCV1452085 rs12223005 TRIM22 NOHD_STK GEN CA 2.418 0.843 6.932 0.1004 0.16487
hCV1452085 rs12223005 TRIM22 NOHD_STK GEN CC 2.082 0.739 5.866 0.1655 0.16487
hCV1452085 rs12223005 TRIM22 NOHD_STK DOM CA or 2.138 0.759 6.02 0.1502 .
CC
hCV1452085 rs12223005 TRIM22 RECURRENT_STK AGE MALE GEN CC 6.513 0.564 75.15 0.1332 0.02942
DIAB HTN
hCV1452085 rs12223005 TRIM22 RECURRENT_STK AGE MALE DOM CA or 7.075 0.618 80.97 0.1157 .
DIAB HTN CC
hCV302629 rs9284183 UBAC2 EO_STK DOM GA or 1.217 0.954 1.553 0.1137 .
GG
hCV302629 rs9284183 UBAC2 EO_STK AGE MALE GEN GA 1.219 0.91 1.633 0.1853 0.37831
DIAB HTN
hCV302629 rs9284183 UBAC2 EO_STK AGE MALE ADD G 1.156 0.927 1.442 0.1987 .
DIAB HTN
hCV302629 rs9284183 UBAC2 EO_STK AGE MALE DOM GA or 1.219 0.923 1.611 0.1632 .
DIAB HTN GG
hCV11474611 rs3814843 CALM1 ATHERO_STK DOM GT or 1.345 0.925 1.956 0.1207 .
GG
hCV11474611 rs3814843 CALM1 ISCHEMIC_STK GEN GT 1.282 0.939 1.748 0.1173 0.13174
hCV11474611 rs3814843 CALM1 ISCHEMIC_STK DOM GT or 1.222 0.902 1.656 0.1959 .
GG
hCV11474611 rs3814843 CALM1 NOHD_STK GEN GT 1.32 0.946 1.842 0.1021 0.1136 
hCV11474611 rs3814843 CALM1 NOHD_STK DOM GT or 1.251 0.902 1.735 0.1789 .
GG
hCV11474611 rs3814843 CALM1 NONCE_STK GEN GT 1.328 0.939 1.877 0.1082 0.1417 
hCV11474611 rs3814843 CALM1 NONCE_STK DOM GT or 1.261 0.898 1.772 0.1806 .
GG
hCV11474611 rs3814843 CALM1 RECURRENT_STK GEN GT 1.526 0.916 2.544 0.1047 0.2681 
hCV11474611 rs3814843 CALM1 RECURRENT_STK DOM GT or 1.429 0.86 2.374 0.168 .
GG
hCV1262973 rs229653 PLEKHG3 ISCHEMIC_STK GEN AG 1.186 0.939 1.499 0.1523 0.00405
hCV1262973 rs229653 PLEKHG3 RECURRENT_STK GEN AG 1.33 0.893 1.982 0.1605 0.3735 
hCV27892569 rs4903741 NRXN3 CE_STK DOM CT or 1.171 0.936 1.466 0.1674 .
CC
hCV27892569 rs4903741 NRXN3 LACUNAR_STK GEN CT 1.273 0.943 1.719 0.1153 0.28645
hCV27892569 rs4903741 NRXN3 LACUNAR_STK DOM CT or 1.241 0.93 1.656 0.143 .
CC
hCV27892569 rs4903741 NRXN3 NOHD_STK GEN CC 1.333 0.917 1.939 0.1323 0.22016
hCV27892569 rs4903741 NRXN3 NOHD_STK DOM CT or 1.153 0.958 1.388 0.1327 .
CC
hCV27892569 rs4903741 NRXN3 NOHD_STK REC CC 1.278 0.885 1.845 0.191 .
hCV27077072 rs8060368 RECURRENT_STK GEN CC 1.564 0.889 2.75 0.1205 0.17139
hCV27077072 rs8060368 RECURRENT_STK AGE MALE ADD C 1.308 0.947 1.806 0.1032 .
DIAB HTN
hCV27077072 rs8060368 RECURRENT_STK AGE MALE DOM CT or 1.798 0.854 3.786 0.1226 .
DIAB HTN CC
hCV2769503 rs4787956 CE_STK GEN GA 1.171 0.924 1.484 0.1909 0.3088 
hCV2769503 rs4787956 CE_STK ADD G 1.131 0.961 1.331 0.1373 .
hCV2769503 rs4787956 CE_STK DOM GA or 1.187 0.948 1.485 0.1354 .
GG
hCV2769503 rs4787956 RECURRENT_STK GEN GA 1.27 0.919 1.753 0.1471 0.27579
hCV31573621 rs11079818 SKAP1 ATHERO_STK REC TT 1.165 0.939 1.445 0.1653 .
hCV31573621 rs11079818 SKAP1 LACUNAR_STK AGE MALE GEN TC 1.614 0.78 3.341 0.1973 0.13048
DIAB HTN
hCV32160712 rs11079160 CE_STK DOM TA or 1.181 0.928 1.501 0.1761 .
TT
hCV32160712 rs11079160 CE_STK AGE MALE GEN TT 1.93 0.872 4.27 0.1047 0.26509
DIAB HTN
hCV32160712 rs11079160 CE_STK AGE MALE REC TT 1.896 0.862 4.17 0.1116 .
DIAB HTN
hCV32160712 rs11079160 EO_STK GEN TT 1.734 0.829 3.629 0.144 0.19059
hCV32160712 rs11079160 EO_STK REC TT 1.8 0.864 3.751 0.1167 .
hCV32160712 rs11079160 ISCHEMIC_STK ADD T 1.137 0.972 1.33 0.1085 .
hCV32160712 rs11079160 ISCHEMIC_STK AGE MALE GEN TT 1.675 0.848 3.308 0.1373 0.31696
DIAB HTN
hCV32160712 rs11079160 ISCHEMIC_STK AGE MALE REC TT 1.646 0.837 3.237 0.1488 .
DIAB HTN
hCV32160712 rs11079160 NOHD_STK GEN TT 1.509 0.886 2.57 0.1303 0.30893
hCV32160712 rs11079160 NOHD_STK REC TT 1.49 0.878 2.531 0.1396 .
hCV32160712 rs11079160 RECURRENT_STK GEN TT 1.887 0.865 4.117 0.1107 0.28017
hCV32160712 rs11079160 RECURRENT_STK REC TT 1.87 0.863 4.056 0.1128 .
hCV32160712 rs11079160 RECURRENT_STK AGE MALE GEN TT 2.044 0.706 5.92 0.1878 0.41924
DIAB HTN
hCV32160712 rs11079160 RECURRENT_STK AGE MALE REC TT 2.029 0.706 5.827 0.1887 .
DIAB HTN
hCV1408483 rs17070848 BCL2 ATHERO_STK GEN TT 1.514 0.894 2.564 0.1231 0.29337
hCV1408483 rs17070848 BCL2 ATHERO_STK REC TT 1.487 0.882 2.505 0.1364 .
hCV1619596 rs1048621 SDCBP2 CE_STK GEN AG 1.176 0.932 1.483 0.1731 0.21433
hCV1619596 rs1048621 SDCBP2 CE_STK GEN AA 1.35 0.888 2.055 0.1607 0.21433
hCV1619596 rs1048621 SDCBP2 CE_STK DOM AG or 1.203 0.964 1.501 0.1025 .
AA
hCV1619596 rs1048621 SDCBP2 CE_STK AGE MALE ADD A 1.204 0.959 1.51 0.109 .
DIAB HTN
hCV1619596 rs1048621 SDCBP2 EO_STK AGE MALE ADD A 1.202 0.965 1.497 0.101 .
DIAB HTN
hCV1619596 rs1048621 SDCBP2 ISCHEMIC_STK GEN AG 1.127 0.945 1.344 0.1838 0.22154
hCV1619596 rs1048621 SDCBP2 ISCHEMIC_STK GEN AA 1.261 0.909 1.748 0.1644 0.22154
hCV1619596 rs1048621 SDCBP2 ISCHEMIC_STK DOM AG or 1.148 0.97 1.357 0.1079 .
AA
hCV1619596 rs1048621 SDCBP2 ISCHEMIC_STK AGE MALE ADD A 1.139 0.954 1.36 0.1508 .
DIAB HTN
hCV1619596 rs1048621 SDCBP2 NOHD_STK GEN AA 1.267 0.89 1.804 0.1884 0.27789
hCV1619596 rs1048621 SDCBP2 NOHD_STK ADD A 1.125 0.974 1.299 0.1095 .
hCV1619596 rs1048621 SDCBP2 NOHD_STK DOM AG or 1.146 0.955 1.375 0.1442 .
AA
hCV1619596 rs1048621 SDCBP2 NOHD_STK AGE MALE GEN AG 1.217 0.944 1.569 0.1302 0.29766
DIAB HTN
hCV1619596 rs1048621 SDCBP2 NOHD_STK AGE MALE ADD A 1.14 0.944 1.376 0.1722 .
DIAB HTN
hCV1619596 rs1048621 SDCBP2 NOHD_STK AGE MALE DOM AG or 1.21 0.951 1.541 0.1208 .
DIAB HTN AA
hCV1619596 rs1048621 SDCBP2 RECURRENT_STK GEN AG 1.23 0.896 1.689 0.1998 0.42372
hCV1619596 rs1048621 SDCBP2 RECURRENT_STK DOM AG or 1.224 0.904 1.658 0.1917 .
AA
hCV1619596 rs1048621 SDCBP2 RECURRENT_STK AGE MALE GEN AG 1.334 0.86 2.07 0.1987 0.41241
DIAB HTN
hCV29537898 rs6073804 NOHD_STK ADD T 1.194 0.943 1.511 0.1415 .
hCV29537898 rs6073804 RECURRENT_STK AGE MALE GEN TT 5.809 0.6 56.26 0.1288 0.23964
DIAB HTN
hCV29537898 rs6073804 RECURRENT_STK AGE MALE REC TT 5.608 0.578 54.4 0.1369 .
DIAB HTN
hCV1723718 rs12481805 UMODL1 EO_STK REC AA 1.45 0.917 2.293 0.1118 .
hCV1723718 rs12481805 UMODL1 ISCHEMIC_STK REC AA 1.254 0.922 1.706 0.1498 .
hCV1723718 rs12481805 UMODL1 LACUNAR_STK AGE MALE REC AA 1.545 0.838 2.848 0.1633 .
DIAB HTN
hCV1723718 rs12481805 UMODL1 NOHD_STK REC AA 1.316 0.947 1.829 0.1019 .
hCV1723718 rs12481805 UMODL1 NONCE_STK REC AA 1.33 0.945 1.872 0.1017 .
hCV1723718 rs12481805 UMODL1 RECURRENT_STK AGE MALE GEN AG 1.349 0.867 2.098 0.185 0.37072
DIAB HTN
hCV1723718 rs12481805 UMODL1 RECURRENT_STK AGE MALE ADD A 1.239 0.897 1.711 0.1934 .
DIAB HTN
hCV1723718 rs12481805 UMODL1 RECURRENT_STK AGE MALE DOM AG or 1.352 0.889 2.056 0.159 .
DIAB HTN AA

TABLE 22
Gene GENO-
hCV # rs # Symbol ENDPT MODE STRATA ADJUST TYPE
hCV16336 rs362277 HD ENDPT4F1 GEN ALL STATIN TC
hCV16336 rs362277 HD ENDPT4F1 DOM ALL STATIN TC + TT
hCV16336 rs362277 HD ENDPT4F1 ADD ALL STATIN T
hCV32160712 rs11079160 ENDPT4F1 GEN ALL STATIN TT
hCV32160712 rs11079160 ENDPT4F1 REC ALL STATIN TT
hCV32160712 rs11079160 ENDPT4F1 ADD ALL STATIN T
hCV16134786 rs2857595 ENDPT4F1 REC ALL AA
hCV1619596 rs1048621 SDCBP2 ENDPT4F1 GEN ALL AA
hCV1619596 rs1048621 SDCBP2 ENDPT4F1 REC ALL AA
hCV32160712 rs11079160 ENDPT4F1 GEN ALL TT
hCV32160712 rs11079160 ENDPT4F1 DOM ALL TA + TT
hCV32160712 rs11079160 ENDPT4F1 REC ALL TT
hCV32160712 rs11079160 ENDPT4F1 ADD ALL T
95% 95%
Lower Upper
Risk CL for CL for P- 2DF P-
hCV # Genotype EVENTS TOTAL HR HR HR VALUE VALUE
hCV16336 CC 21  491  0.7 0.444 1.115 0.1341 0.3256
hCV16336 CC 23  526  0.72 0.462 1.12 0.1447 .
hCV16336 CC . . 0.76 0.507 1.14 0.1848 .
hCV32160712 TT 8 83 1.88 0.914 3.853 0.0866 0.221 
hCV32160712 TT 8 83 1.82 0.895 3.714 0.0981 .
hCV32160712 TT . . 1.21 0.918 1.604 0.1746 .
hCV16134786 AA 5 45 1.92 0.778 4.735 0.1569 .
hCV1619596 AG or 12  115  1.69 0.894 3.195 0.1065 0.1552
AA
hCV1619596 AG or 12  115  1.78 0.97 3.274 0.0627 .
AA
hCV32160712 TT 6 37 3.09 1.33 7.19 0.0088 0.0281
hCV32160712 TT 34  428  1.41 0.917 2.164 0.1172 .
hCV32160712 TT 6 37 2.87 1.253 6.585 0.0126 .
hCV32160712 TT . . 1.48 1.037 2.12 0.0308 .

TABLE 23
Risk
Gene GENO- Risk Geno- 95% Lower 95% Upper P-
hCV # rs # Symbol ENDPT TIMEVAR MODE TYPE Allele type STATIN EVENTS TOTAL HR CL for HR CL for HR VALUE PVAL_INTX
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN GG G GA or Pravastatin 0 23 0   0    . 0.9967 0.15026
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN GG G GA or Placebo 2 42 ref . . . 0.15026
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN GA G GA or Pravastatin 13 376 0.47 0.239 0.906 0.0243 0.15026
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN GA G GA or Placebo 26 351 ref . . . 0.15026
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN AA G GA or Pravastatin 54 1005 0.84 0.584 1.212 0.3548 0.15026
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN AA G GA or Placebo 62 980 ref . . . 0.15026
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 DOM GA + GG G GA or Pravastatin 13 399 0.46 0.236 0.88  0.0192 0.10233
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 DOM GA + GG G GA or Placebo 28 393 ref . . . 0.10233
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 REC GA + AA G GA or Pravastatin 67 1381 0.73 0.531 1.002 0.0514 0.24445
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 REC GA + AA G GA or Placebo 88 1331 ref . . . 0.24445
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN GG G GA or Pravastatin 0 23 0   0    . 0.9967 0.15067
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN GG G GA or Placebo 2 42 ref . . . 0.15067
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN GA G GA or Pravastatin 13 375 0.47 0.24  0.911 0.0254 0.15067
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN GA G GA or Placebo 26 352 ref . . . 0.15067
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN AA G GA or Pravastatin 54 1002 0.85 0.587 1.218 0.3671 0.15067
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN AA G GA or Placebo 62 981 ref . . . 0.15067
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 DOM GA + GG G GA or Pravastatin 13 398 0.46 0.237 0.884 0.02  0.10281
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 DOM GA + GG G GA or Placebo 28 394 ref . . . 0.10281
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 REC GA + AA G GA or Pravastatin 67 1377 0.73 0.533 1.007 0.0549 0.24354
GG
hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 REC GA + AA G GA or Placebo 88 1333 ref . . . 0.24354
GG
hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 GEN CC C CG or Pravastatin 1 36 0.86 0.054 13.71  0.9134 0.18029
CC
hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 GEN CC C CG or Placebo 1 31 ref . . . 0.18029
CC
hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 GEN CG C CG or Pravastatin 9 356 0.39 0.179 0.844 0.0169 0.18029
CC
hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 GEN CG C CG or Placebo 22 347 ref . . . 0.18029
CC
hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 GEN GG C CG or Pravastatin 57 1011 0.84 0.592 1.201 0.3442 0.18029
CC
hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 GEN GG C CG or Placebo 67 997 ref . . . 0.18029
CC
hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 DOM CG + CC C CG or Pravastatin 10 392 0.41 0.195 0.859 0.0182 0.07391
CC
hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 DOM CG + CC C CG or Placebo 23 378 ref . . . 0.07391
CC
hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 REC CG + GG C CG or Pravastatin 66 1367 0.73 0.527 0.997 0.0479 0.92551
CC
hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 REC CG + GG C CG or Placebo 89 1344 ref . . . 0.92551
CC
hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 GEN ALL AA AA Pravastatin 2 71 0.23 0.044 1.189 0.0794 0.27061
hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 GEN ALL AA AA Placebo 5 45 ref . . . 0.27061
hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 GEN ALL AG AA Pravastatin 14 403 0.67 0.342 1.293 0.2295 0.27061
hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 GEN ALL AG AA Placebo 23 442 ref . . . 0.27061
hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 GEN ALL GG AA Pravastatin 51 928 0.8  0.553 1.164 0.2463 0.27061
hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 GEN ALL GG AA Placebo 61 887 ref . . . 0.27061
hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 DOM ALL AG + AA AA Pravastatin 16 474 0.58 0.313 1.068 0.0803 0.35911
hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 DOM ALL AG + AA AA Placebo 28 487 ref . . . 0.35911
hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 REC ALL AG + GG AA Pravastatin 65 1331 0.77 0.559 1.068 0.1182 0.12065
hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 REC ALL AG + GG AA Placebo 84 1329 ref . . . 0.12065
hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 GEN ALL AA AG or Pravastatin 2 108 0.16 0.037 0.734 0.018  0.05456
AA
hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 GEN ALL AA AG or Placebo 12 115 ref . . . 0.05456
AA
hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 GEN ALL AG AG or Pravastatin 29 572 0.89 0.538 1.471 0.6494 0.05456
AA
hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 GEN ALL AG AG or Placebo 32 559 ref . . . 0.05456
AA
hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 GEN ALL GG AG or Pravastatin 36 719 0.77 0.498 1.197 0.2473 0.05456
AA
hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 GEN ALL GG AG or Placebo 45 696 ref . . . 0.05456
AA
hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 DOM ALL AG + AA AG or Pravastatin 31 680 0.69 0.438 1.098 0.1188 0.74301
AA
hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 DOM ALL AG + AA AG or Placebo 44 674 ref . . . 0.74301
AA
hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 REC ALL AG + GG AG or Pravastatin 65 1291 0.82 0.59  1.142 0.2405 0.01754
AA
hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 REC ALL AG + GG AG or Placebo 77 1255 ref . . . 0.01754
AA
hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 GEN ALL TT TT Pravastatin 2 46 0.24 0.048 1.193 0.0812 0.22268
hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 GEN ALL TT TT Placebo 6 37 ref . . . 0.22268
hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 GEN ALL TA TT Pravastatin 17 382 0.62 0.339 1.132 0.1194 0.22268
hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 GEN ALL TA TT Placebo 28 391 ref . . . 0.22268
hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 GEN ALL AA TT Pravastatin 48 972 0.86 0.582 1.267 0.4421 0.22268
hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 GEN ALL AA TT Placebo 54 942 ref . . . 0.22268
hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 DOM ALL TA + TT TT Pravastatin 19 428 0.55 0.315 0.967 0.0379 0.20087
hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 DOM ALL TA + TT TT Placebo 34 428 ref . . . 0.20087
hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 REC ALL TA + AA TT Pravastatin 65 1354 0.78 0.562 1.077 0.1301 0.13978
hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 REC ALL TA + AA TT Placebo 82 1333 ref . . . 0.13978

TABLE 24
hCV # rs # Gene/Chrom ENDPT MODE ADJUST GENOTYPE EVENTS
hCV1305848 rs6016200 ENDPT4F1 GEN STATIN AA 0
hCV1305848 rs6016200 ENDPT4F1 GEN STATIN AG 41
hCV1305848 rs6016200 ENDPT4F1 GEN STATIN GG 115
hCV1305848 rs6016200 ENDPT4F1 DOM STATIN AG + AA 41
hCV1305848 rs6016200 ENDPT4F1 DOM STATIN GG 115
hCV1305848 rs6016200 ENDPT4F1 REC STATIN AA 0
hCV1305848 rs6016200 ENDPT4F1 REC STATIN AG + GG 156
hCV1305848 rs6016200 ENDPT4F1 ADD STATIN A .
hCV1746715 rs4750628 C10orf38 ENDPT4F1 GEN STATIN AA 39
hCV1746715 rs4750628 C10orf38 ENDPT4F1 GEN STATIN AG 89
hCV1746715 rs4750628 C10orf38 ENDPT4F1 GEN STATIN GG 28
hCV1746715 rs4750628 C10orf38 ENDPT4F1 DOM STATIN AG + AA 128
hCV1746715 rs4750628 C10orf38 ENDPT4F1 DOM STATIN GG 28
hCV1746715 rs4750628 C10orf38 ENDPT4F1 REC STATIN AA 39
hCV1746715 rs4750628 C10orf38 ENDPT4F1 REC STATIN AG + GG 117
hCV1746715 rs4750628 C10orf38 ENDPT4F1 ADD STATIN A .
hCV29881864 rs10514542 ENDPT4F1 GEN STATIN CC 20
hCV29881864 rs10514542 ENDPT4F1 GEN STATIN CG 61
hCV29881864 rs10514542 ENDPT4F1 GEN STATIN GG 75
hCV29881864 rs10514542 ENDPT4F1 DOM STATIN CG + CC 81
hCV29881864 rs10514542 ENDPT4F1 DOM STATIN GG 75
hCV29881864 rs10514542 ENDPT4F1 REC STATIN CC 20
hCV29881864 rs10514542 ENDPT4F1 REC STATIN CG + GG 136
hCV29881864 rs10514542 ENDPT4F1 ADD STATIN C .
hDV70959216 rs17482753 ENDPT4F1 GEN STATIN TT 0
hDV70959216 rs17482753 ENDPT4F1 GEN STATIN TG 20
hDV70959216 rs17482753 ENDPT4F1 GEN STATIN GG 136
hDV70959216 rs17482753 ENDPT4F1 DOM STATIN TG + TT 20
hDV70959216 rs17482753 ENDPT4F1 DOM STATIN GG 136
hDV70959216 rs17482753 ENDPT4F1 REC STATIN TT 0
hDV70959216 rs17482753 ENDPT4F1 REC STATIN TG + GG 156
hDV70959216 rs17482753 ENDPT4F1 ADD STATIN T .
hCV1305848 rs6016200 ENDPT4F1 GEN AA 0
hCV1305848 rs6016200 ENDPT4F1 GEN AG 22
hCV1305848 rs6016200 ENDPT4F1 GEN GG 67
hCV1305848 rs6016200 ENDPT4F1 DOM AG + AA 22
hCV1305848 rs6016200 ENDPT4F1 DOM GG 67
hCV1305848 rs6016200 ENDPT4F1 REC AA 0
hCV1305848 rs6016200 ENDPT4F1 REC AG + GG 89
hCV1305848 rs6016200 ENDPT4F1 ADD A .
hCV1746715 rs4750628 C10orf38 ENDPT4F1 GEN AA 21
hCV1746715 rs4750628 C10orf38 ENDPT4F1 GEN AG 52
hCV1746715 rs4750628 C10orf38 ENDPT4F1 GEN GG 16
hCV1746715 rs4750628 C10orf38 ENDPT4F1 DOM AG + AA 73
hCV1746715 rs4750628 C10orf38 ENDPT4F1 DOM GG 16
hCV1746715 rs4750628 C10orf38 ENDPT4F1 REC AA 21
hCV1746715 rs4750628 C10orf38 ENDPT4F1 REC AG + GG 68
hCV1746715 rs4750628 C10orf38 ENDPT4F1 ADD A .
hCV29881864 rs10514542 ENDPT4F1 GEN CC 14
hCV29881864 rs10514542 ENDPT4F1 GEN CG 35
hCV29881864 rs10514542 ENDPT4F1 GEN GG 40
hCV29881864 rs10514542 ENDPT4F1 DOM CG + CC 49
hCV29881864 rs10514542 ENDPT4F1 DOM GG 40
hCV29881864 rs10514542 ENDPT4F1 REC CC 14
hCV29881864 rs10514542 ENDPT4F1 REC CG + GG 75
hCV29881864 rs10514542 ENDPT4F1 ADD C .
95% Lower 95% Upper P- 2DF P-
hCV # TOTAL HR CL for HR CL for HR VALUE VALUE
hCV1305848 86 0   0    1.63E+248 0.9648 0.2079
hCV1305848 875 0.72 0.507 1.035 0.0764 0.2079
hCV1305848 1806 ref . . . 0.2079
hCV1305848 961 0.66 0.46  0.938 0.0209 .
hCV1305848 1806 ref . . . .
hCV1305848 86 0   0    9.16E+246 0.9649 .
hCV1305848 2681 ref . . . .
hCV1305848 . 0.63 0.451 0.876 0.0061 .
hCV1746715 701 1.47 0.906 2.392 0.1187 0.0324
hCV1746715 1340 1.76 1.151 2.691 0.0091 0.0324
hCV1746715 726 ref . . . 0.0324
hCV1746715 2041 1.66 1.103 2.5  0.015  .
hCV1746715 726 ref . . . .
hCV1746715 701 0.99 0.688 1.42  0.9495 .
hCV1746715 2066 ref . . . .
hCV1746715 . 1.18 0.947 1.465 0.1424 .
hCV29881864 224 1.76 1.072 2.875 0.0253 0.0767
hCV29881864 1102 1.06 0.756 1.486 0.7354 0.0767
hCV29881864 1450 ref . . . 0.0767
hCV29881864 1326 1.18 0.858 1.609 0.3138 .
hCV29881864 1450 ref . . . .
hCV29881864 224 1.71 1.07  2.736 0.0249 .
hCV29881864 2552 ref . . . .
hCV29881864 . 1.24 0.975 1.564 0.08  .
hDV70959216 21 0   0    . 0.974  0.2331
hDV70959216 495 0.66 0.416 1.063 0.088  0.2331
hDV70959216 2252 ref . . . 0.2331
hDV70959216 516 0.64 0.399 1.019 0.0599 .
hDV70959216 2252 ref . . . .
hDV70959216 21 0   0    . 0.974  .
hDV70959216 2747 ref . . . .
hDV70959216 . 0.63 0.398 0.991 0.0458 .
hCV1305848 44 0   0    . 0.9823 0.3016
hCV1305848 426 0.68 0.422 1.107 0.1216 0.3016
hCV1305848 898 ref . . . 0.3016
hCV1305848 470 0.62 0.381 0.997 0.0487 .
hCV1305848 898 ref . . . .
hCV1305848 44 0   0    . 0.9823 .
hCV1305848 1324 ref . . . .
hCV1305848 . 0.59 0.379 0.929 0.0226 .
hCV1746715 349 1.34 0.699 2.568 0.3775 0.1054
hCV1746715 665 1.79 1.021 3.132 0.0421 0.1054
hCV1746715 355 ref . . . 0.1054
hCV1746715 1014 1.63 0.95  2.802 0.0763 .
hCV1746715 355 ref . . . .
hCV1746715 349 0.89 0.545 1.449 0.6359 .
hCV1746715 1020 ref . . . .
hCV1746715 . 1.13 0.844 1.501 0.4216 .
hCV29881864 115 2.28 1.238 4.187 0.0081 0.0236
hCV29881864 565 1.06 0.675 1.673 0.7927 0.0236
hCV29881864 694 ref . . . 0.0236
hCV29881864 680 1.25 0.826 1.903 0.2888 .
hCV29881864 694 ref . . . .
hCV29881864 115 2.21 1.25  3.921 0.0064 .
hCV29881864 1259 ref . . . .
hCV29881864 . 1.38 1.009 1.878 0.0438 .

TABLE 25
Gene Risk 95% Lower 95% Upper P-
hCV # rs # Symbol ENDPT TIMEVAR MODE GENOTYPE Allele STATIN EVENTS TOTAL HR CL for HR CL for HR VALUE PVAL_INTX
hDV77718013 ENDPT4F1 TIMETO_EP4F1 REC TC + CC Pravastatin 66 1359 0.74 0.539 1.022 0.0673 0.0556
hCV3216551 rs562338 ENDPT4F1 TIMETO_EP4F1 GEN GG Pravastatin 40 932 0.59 0.401 0.877 0.0089 0.04137
hCV2862873 rs780094 GCKR ENDPT4F1 TIMETO_EP4F1 DOM TC + TT Pravastatin 41 887 0.6 0.403 0.881 0.0095 0.09031
hCV9296529 rs4358307 ENDPT4F1 TIMETO_EP4F1 GEN GA Pravastatin 25 624 0.5 0.307 0.807 0.0047 0.08098
hCV29480044 rs10516433 TSPAN5 ENDPT4F1 TIMETO_EP4F1 GEN TC Pravastatin 16 454 0.46 0.255 0.832 0.0101 0.03925
hCV29480044 rs10516433 TSPAN5 ENDPT4F1 TIMETO_EP4F1 REC TC + CC Pravastatin 61 1309 0.67 0.487 0.934 0.0178 0.04698
hCV30454150 rs10516434 TSPAN5 ENDPT4F1 TIMETO_EP4F1 GEN TC Pravastatin 16 451 0.46 0.255 0.832 0.0102 0.04149
hCV30454150 rs10516434 TSPAN5 ENDPT4F1 TIMETO_EP4F1 REC TC + CC Pravastatin 61 1310 0.67 0.486 0.931 0.017 0.04884
hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 DOM CG + CC C Pravastatin 10 392 0.41 0.195 0.859 0.0182 0.07391
hCV9473891 rs1555173 ENDPT4F1 TIMETO_EP4F1 REC CT + TT Pravastatin 67 1363 0.75 0.547 1.035 0.0801 0.07415
hCV2442143 rs12544854 ASAH1 ENDPT4F1 TIMETO_EP4F1 GEN TC Pravastatin 29 713 0.55 0.35 0.877 0.0118 0.02918
hCV2442143 rs12544854 ASAH1 ENDPT4F1 TIMETO_EP4F1 DOM TC + TT Pravastatin 43 1070 0.57 0.391 0.836 0.004 0.00824
hCV2442143 rs12544854 ASAH1 ENDPT4F1 TIMETO_EP4F1 GEN TC Pravastatin 29 704 0.57 0.36 0.905 0.0172 0.04882
hCV2442143 rs12544854 ASAH1 ENDPT4F1 TIMETO_EP4F1 DOM TC + TT Pravastatin 42 1059 0.56 0.384 0.825 0.0033 0.01402
hCV1463226 rs10890 FXN ENDPT4F1 TIMETO_EP4F1 GEN TT Pravastatin 9 303 0.41 0.188 0.885 0.0233 0.02602
hCV1463226 rs10890 FXN ENDPT4F1 TIMETO_EP4F1 GEN CC Pravastatin 16 416 0.48 0.266 0.874 0.0162 0.02602
hCV2741051 rs2230806 ABCA1 ENDPT4F1 TIMETO_EP4F1 GEN TC Pravastatin 16 597 0.47 0.258 0.856 0.0136 0.09085
hCV2741051 rs2230806 ABCA1 ENDPT4F1 TIMETO_EP4F1 DOM TC + TT Pravastatin 20 709 0.47 0.272 0.801 0.0056 0.03067
hCV2741051 rs2230806 ABCA1 ENDPT4F1 TIMETO_EP4F1 GEN TC Pravastatin 17 603 0.5 0.275 0.892 0.0192 0.06908
hCV2741051 rs2230806 ABCA1 ENDPT4F1 TIMETO_EP4F1 DOM TC + TT Pravastatin 20 711 0.47 0.273 0.802 0.0057 0.02439
hCV2959482 rs3890182 ABCA1 ENDPT4F1 TIMETO_EP4F1 GEN AG Pravastatin 8 302 0.34 0.152 0.767 0.0093 0.06769
hCV2959482 rs3890182 ABCA1 ENDPT4F1 TIMETO_EP4F1 DOM AG + AA Pravastatin 8 320 0.34 0.151 0.753 0.0081 0.02862
hCV22275299 rs28927680 BUD13 ENDPT4F1 TIMETO_EP4F1 GEN GC Pravastatin 2 175 0.2 0.042 0.908 0.0372 0.0983
hCV29566897 rs10507755 ENDPT4F1 TIMETO_EP4F1 REC CT + TT Pravastatin 67 1350 0.76 0.552 1.049 0.0957 0.02347
hCV8757333 rs1800588 LIPC ENDPT4F1 TIMETO_EP4F1 DOM TC + TT Pravastatin 21 567 0.49 0.286 0.824 0.0074 0.05012
hCV16164743 rs2928932 ENDPT4F1 TIMETO_EP4F1 GEN CC Pravastatin 6 190 0.31 0.124 0.797 0.0148 0.03514
hCV16164743 rs2928932 ENDPT4F1 TIMETO_EP4F1 GEN AA Pravastatin 23 555 0.6 0.355 1.004 0.052 0.03514
hCV9324316 rs9305020 ENDPT4F1 TIMETO_EP4F1 GEN TT Pravastatin 48 963 0.7 0.482 1.016 0.0604 0.05765
hCV9324316 rs9305020 ENDPT4F1 TIMETO_EP4F1 REC CT + TT Pravastatin 67 1352 0.76 0.554 1.05 0.0968 0.02527
hCV1846459 rs4803759 ENDPT4F1 TIMETO_EP4F1 GEN TC Pravastatin 25 565 0.62 0.378 1.023 0.0613 0.05544
hCV1846459 rs4803759 ENDPT4F1 TIMETO_EP4F1 GEN CC Pravastatin 31 707 0.66 0.415 1.036 0.0707 0.05544
hCV1846459 rs4803759 ENDPT4F1 TIMETO_EP4F1 REC TC + CC Pravastatin 56 1272 0.64 0.457 0.895 0.0092 0.01624
hCV26682080 rs4420638 ENDPT4F1 TIMETO_EP4F1 GEN GG Pravastatin 2 58 0.25 0.05 1.217 0.0855 0.07632
hCV26682080 rs4420638 ENDPT4F1 TIMETO_EP4F1 GEN GA Pravastatin 15 383 0.5 0.268 0.919 0.0259 0.07632
hCV26682080 rs4420638 ENDPT4F1 TIMETO_EP4F1 DOM GA + GG Pravastatin 17 441 0.45 0.255 0.804 0.0068 0.04158

TABLE 26
95% 95%
Lower Upper
CL for CL for P-
hCV # rs # Gene MODE STRATA ADJUST GENOTYPE EVENTS TOTAL HR HR HR VALUE
hCV11474611 rs3814843 CALM1 GEN ALL STATIN GG 1 3 7.54 1.055 53.886 0.0441
hCV11474611 rs3814843 CALM1 GEN ALL STATIN GT 14 224 1.17 0.676  2.038 0.5698
hCV11474611 rs3814843 CALM1 GEN ALL STATIN TT 128 2392 ref . . .
hCV11474611 rs3814843 CALM1 REC ALL STATIN GG 1 3 7.43 1.041 53.062 0.0455
hCV11474611 rs3814843 CALM1 REC ALL STATIN GT + TT 142 2616 ref . . .
hCV11474611 rs3814843 CALM1 GEN ALL GG 1 3 6.64 0.919 47.944 0.0606
hCV11474611 rs3814843 CALM1 GEN ALL GT 6 104 0.95 0.413  2.188 0.9051
hCV11474611 rs3814843 CALM1 GEN ALL TT 70 1183 ref . . .
hCV11474611 rs3814843 CALM1 REC ALL GG 1 3 6.67 0.924 48.09  0.0599
hCV11474611 rs3814843 CALM1 REC ALL GT + TT 76 1287 ref . . .
hCV2930693 rs13183672 FSTL4 REC ALL STATIN AA 96 1498 1.51 1.07  2.14 0.0191
hCV2930693 rs13183672 FSTL4 REC ALL STATIN AC + CC 48 1122 ref . . .
hCV2930693 rs13183672 FSTL4 ADD ALL STATIN A . . 1.29 0.965  1.719 0.0859
hCV2930693 rs13183672 FSTL4 REC ALL AA 52 729 1.61 0.998 2.59 0.0512
hCV2930693 rs13183672 FSTL4 REC ALL AC + CC 25 560 ref . . .
hCV2930693 rs13183672 FSTL4 ADD ALL A . . 1.48 0.982 2.24 0.0609

TABLE 27
95% 95%
Lower Upper
CL for CL for P-
hCV # rs Gene MODE GENOTYPE STATIN EVENTS TOTAL HR HR HR VALUE PVAL_INTX
hCV1022614 rs220479 ITGAE GEN CC Pravastatin 52 973 0.89 0.609 1.295 0.5366 0.22592
hCV1022614 rs220479 ITGAE GEN CC Placebo 56 927 ref . . . 0.22592
hCV1022614 rs220479 ITGAE GEN CT Pravastatin 15 408 0.48 0.257 0.887 0.0192 0.22592
hCV1022614 rs220479 ITGAE GEN CT Placebo 30 400 ref . . . 0.22592
hCV1022614 rs220479 ITGAE GEN TT Pravastatin 3 46 0.91 0.203 4.047 0.8969 0.22592
hCV1022614 rs220479 ITGAE GEN TT Placebo 4 56 ref . . . 0.22592
hCV1022614 rs220479 ITGAE DOM CT + CC Pravastatin 67 1381 0.74 0.541 1.024 0.0696 0.79081
hCV1022614 rs220479 ITGAE DOM CT + CC Placebo 86 1327 ref . . . 0.79081
hCV1022614 rs220479 ITGAE REC CT + TT Pravastatin 18 454 0.52 0.294 0.921 0.0248 0.11998
hCV1022614 rs220479 ITGAE REC CT + TT Placebo 34 456 ref . . . 0.11998
hCV11450563 rs2038366 GEN GG Pravastatin 29 539 1.15 0.669 1.975 0.6132 0.17234
hCV11450563 rs2038366 GEN GG Placebo 24 522 ref . . . 0.17234
hCV11450563 rs2038366 GEN GT Pravastatin 28 638 0.61 0.381 0.986 0.0436 0.17234
hCV11450563 rs2038366 GEN GT Placebo 43 602 ref . . . 0.17234
hCV11450563 rs2038366 GEN TT Pravastatin 10 151 1.13 0.472 2.724 0.7789 0.17234
hCV11450563 rs2038366 GEN TT Placebo 10 167 ref . . . 0.17234
hCV11450563 rs2038366 DOM GT + GG Pravastatin 57 1177 0.81 0.567 1.148 0.2334 0.47195
hCV11450563 rs2038366 DOM GT + GG Placebo 67 1124 ref . . . 0.47195
hCV11450563 rs2038366 REC GT + TT Pravastatin 38 789 0.7  0.463 1.064 0.0954 0.15155
hCV11450563 rs2038366 REC GT + TT Placebo 53 769 ref . . . 0.15155
hCV2091644 rs1010 VAMP8 GEN CC Pravastatin 12 271 1.18 0.51  2.73  0.6997 0.48071
hCV2091644 rs1010 VAMP8 GEN CC Placebo 10 258 ref . . . 0.48071
hCV2091644 rs1010 VAMP8 GEN CT Pravastatin 31 686 0.66 0.418 1.045 0.0763 0.48071
hCV2091644 rs1010 VAMP8 GEN CT Placebo 45 666 ref . . . 0.48071
hCV2091644 rs1010 VAMP8 GEN TT Pravastatin 26 455 0.71 0.43  1.186 0.1928 0.48071
hCV2091644 rs1010 VAMP8 GEN TT Placebo 35 448 ref . . . 0.48071
hCV2091644 rs1010 VAMP8 DOM CT + CC Pravastatin 43 957 0.76 0.507 1.126 0.1678 0.87535
hCV2091644 rs1010 VAMP8 DOM CT + CC Placebo 55 924 ref . . . 0.87535
hCV2091644 rs1010 VAMP8 REC CT + TT Pravastatin 57 1141 0.68 0.487 0.961 0.0284 0.23503
hCV2091644 rs1010 VAMP8 REC CT + TT Placebo 80 1114 ref . . . 0.23503
hCV2169762 rs1804689 HPS1 GEN TT Pravastatin 4 107 0.99 0.266 3.694 0.9903 0.34901
hCV2169762 rs1804689 HPS1 GEN TT Placebo 5 131 ref . . . 0.34901
hCV2169762 rs1804689 HPS1 GEN TG Pravastatin 36 652 0.92 0.583 1.468 0.7398 0.34901
hCV2169762 rs1804689 HPS1 GEN TG Placebo 36 600 ref . . . 0.34901
hCV2169762 rs1804689 HPS1 GEN GG Pravastatin 30 668 0.59 0.372 0.924 0.0214 0.34901
hCV2169762 rs1804689 HPS1 GEN GG Placebo 49 651 ref . . . 0.34901
hCV2169762 rs1804689 HPS1 DOM TG + TT Pravastatin 40 759 0.95 0.612 1.461 0.8004 0.13433
hCV2169762 rs1804689 HPS1 DOM TG + TT Placebo 41 731 ref . . . 0.13433
hCV2169762 rs1804689 HPS1 REC TG + GG Pravastatin 66 1320 0.73 0.529 1.006 0.0547 0.65359
hCV2169762 rs1804689 HPS1 REC TG + GG Placebo 85 1251 ref . . . 0.65359
hCV2192261 rs3213646 EXOD1 GEN CC Pravastatin 27 417 1.05 0.613 1.799 0.8592 0.20384
hCV2192261 rs3213646 EXOD1 GEN CC Placebo 26 416 ref . . . 0.20384
hCV2192261 rs3213646 EXOD1 GEN CT Pravastatin 24 691 0.54 0.328 0.898 0.0175 0.20384
hCV2192261 rs3213646 EXOD1 GEN CT Placebo 41 646 ref . . . 0.20384
hCV2192261 rs3213646 EXOD1 GEN TT Pravastatin 13 245 0.64 0.316 1.278 0.2036 0.20384
hCV2192261 rs3213646 EXOD1 GEN TT Placebo 20 243 ref . . . 0.20384
hCV2192261 rs3213646 EXOD1 DOM CT + CC Pravastatin 51 1108 0.73 0.506 1.048 0.0882 0.72432
hCV2192261 rs3213646 EXOD1 DOM CT + CC Placebo 67 1062 ref . . . 0.72432
hCV2192261 rs3213646 EXOD1 REC CT + TT Pravastatin 37 936 0.57 0.379 0.857 0.007  0.07855
hCV2192261 rs3213646 EXOD1 REC CT + TT Placebo 61 889 ref . . . 0.07855
hCV7425232 rs3900940 MYH15 GEN CC Pravastatin 13 160 1.03 0.461 2.296 0.9448 0.57268
hCV7425232 rs3900940 MYH15 GEN CC Placebo 11 142 ref . . . 0.57268
hCV7425232 rs3900940 MYH15 GEN CT Pravastatin 23 561 0.61 0.365 1.022 0.0604 0.57268
hCV7425232 rs3900940 MYH15 GEN CT Placebo 39 583 ref . . . 0.57268
hCV7425232 rs3900940 MYH15 GEN TT Pravastatin 30 620 0.71 0.442 1.146 0.1618 0.57268
hCV7425232 rs3900940 MYH15 GEN TT Placebo 39 573 ref . . . 0.57268
hCV7425232 rs3900940 MYH15 DOM CT + CC Pravastatin 36 721 0.72 0.468 1.102 0.1293 0.97544
hCV7425232 rs3900940 MYH15 DOM CT + CC Placebo 50 725 ref . . . 0.97544
hCV7425232 rs3900940 MYH15 REC CT + TT Pravastatin 53 1181 0.66 0.467 0.939 0.0207 0.33623
hCV7425232 rs3900940 MYH15 REC CT + TT Placebo 78 1156 ref . . . 0.33623
hCV945276 rs89962 KRT4 GEN TT Pravastatin 9 238 0.96 0.392 2.375 0.9381 0.71864
hCV945276 rs89962 KRT4 GEN TT Placebo 10 255 ref . . . 0.71864
hCV945276 rs89962 KRT4 GEN TG Pravastatin 37 674 0.64 0.423 0.979 0.0397 0.71864
hCV945276 rs89962 KRT4 GEN TG Placebo 53 628 ref . . . 0.71864
hCV945276 rs89962 KRT4 GEN GG Pravastatin 17 443 0.65 0.349 1.196 0.1641 0.71864
hCV945276 rs89962 KRT4 GEN GG Placebo 25 426 ref . . . 0.71864
hCV945276 rs89962 KRT4 DOM TG + TT Pravastatin 46 912 0.7  0.48  1.027 0.0683 0.83505
hCV945276 rs89962 KRT4 DOM TG + TT Placebo 63 883 ref . . . 0.83505
hCV945276 rs89962 KRT4 REC TG + GG Pravastatin 54 1117 0.65 0.458 0.916 0.0141 0.42005
hCV945276 rs89962 KRT4 REC TG + GG Placebo 78 1054 ref . . . 0.42005

TABLE 28
Association of MYH15 (rs3900940/hCV7425232) with stroke endpoint in CARE
Study population:
CARE study (n = 2913)
Endpoint:
stroke or TIA (offical CARE endpoint) (“endpt4f1”)
Statistical method:
Cox model
Association of MYH15 SNP (rs3900940/hCV7425232) with stroke endpoint in CARE combined treatment arms
Adjusted1 Adjusted2 Adjusted3
Genotype HR 95% CI 2-sided p-value HR 95% CI 2-sided p-value HR 95% CI 2-sided p-value
Hom_CC 1.403 0.88-2.23 0.153 1.51 0.94-2.40 0.086 1.49 0.93-2.37 0.094
Het_CT 0.925 0.66-1.30 0.6565 0.89 0.63-1.25 0.49 0.881 0.62-1.24 0.4715
Maj_TT 1 1 1
Rec_CC 1.46 0.94-2.25 0.09 1.6 1.03-2.47 0.0358 1.58 1.02-2.45 0.039
Maj + het 1 1 1
“Adjusted1” = Adjusted for statin use
“Adjusted2” = Adjusted for traditional risk factors (TRF), body mass index (BMI), and statin use
“Adjusted3” = Adjusted for TRF, BMI, statin use, and CHD (CARE primary endpoint)
Conclusions:
1) The MYH15 SNP (rs3900940/hCV7425232) was associated with stroke in CARE.
2) The MYH15 SNP (rs3900940/hCV7425232) was associated with stroke in CARE even after adjusting for CHD. (CHD defined in accordance with CARE original endpoint - fatal CHD/definite non-fatal MI, “endpt1”)

TABLE 29
hCV # rs # Gene symbol Risk Allele MODE STRATA GENO_PLACEBO EVENTS_PLACEBO TOTAL_PLACEBO
hCV2091644 rs1010 VAMP8 C GEN ALL CC 49 521
hCV2091644 rs1010 VAMP8 C GEN hist CC 28 235
hCV2091644 rs1010 VAMP8 C GEN hist CT 58 633
hCV2442143 rs12544854 ASAH1 T GEN no hist CT 48 808
hCV8942032 rs1264352 DDR1 C GEN ALL CC 8 110
hCV2169762 rs1804689 HPS1 T GEN no hist GT 38 670
hCV16158671 rs2200733 C4 T GEN ALL CT 37 489
hCV16158671 rs2200733 C4 T GEN no hist CT 19 285
hCV16158671 rs2200733 C4 T GEN hist TT 3 10
hCV27504565 rs3219489 MUTYH C GEN hist CG 35 465
hCV27511436 rs3750145 FZD1 T GEN ALL CC 4 77
hCV27511436 rs3750145 FZD1 T GEN hist CC 1 31
hCV7425232 rs3900940 MYH15 C GEN hist CT 55 528
LOW- no
hCV # HR_PLACEBO ER_PLACEBO UPPER_PLACEBO P_PLACEBO EVENTS_ALL event HR_ALL P_ALL
hCV2091644 1.50982 1.030611 2.211844 0.0344528 88 951 1.340598 0.051104903
hCV2091644 1.503 0.897908 2.515874 0.1210805 54 428 1.633661 0.014183695
hCV2091644 1.13938 0.733208 1.770572 0.5617921 118 1136 1.344979 0.076364852
hCV2442143 1.31132 0.778332 2.209298 0.3085018 101 1535 1.326084 0.166536479
hCV8942032 1.01239 0.495766 2.067369 0.9730365 22 214 1.368996 0.190221586
hCV2169762 0.99636 0.64971 1.527967 0.9866678 85 1236 1.35397 0.062193717
hCV16158671 1.07497 0.753308 1.533975 0.6902781 80 900 1.197273 0.172251195
hCV16158671 1.2283 0.742471 2.032018 0.4233603 38 517 1.282126 0.189409128
hCV16158671 3.71145 1.175206 11.72124 0.0254095 4 18 2.311594 0.124212946
hCV27504565 0.70803 0.473602 1.0585 0.092402 69 853 0.726379 0.040276813
hCV27511436 0.65977 0.244625 1.779435 0.4113489 6 149 0.503156 0.113669409
hCV27511436 0.32028 0.044599 2.300102 0.2576826 2 64 0.307292 0.120384642
hCV7425232 1.21122 0.833465 1.760195 0.3149935 107 956 1.224954 0.171949776

TABLE 30
Gene/
Chrom Risk
hCV # rs # symbol Allele MODE STRATA GENO_PLACEBO EVENTS_PLACEBO TOTAL_PLACEBO
hCV2091644 rs1010 VAMP8 C GEN ALL CC 49 521
hCV2091644 rs1010 VAMP8 C DOM ALL CC + CT 153 1968
hCV2091644 rs1010 VAMP8 C GEN no hist CC 21 286
hCV2091644 rs1010 VAMP8 C GEN hist CC 28 235
hCV26505812 rs10757274 C9p21 G GEN ALL AG 121 1455
hCV26505812 rs10757274 C9p21 G DOM ALL GG + AG 169 2156
hCV26505812 rs10757274 C9p21 G GEN no hist GG 23 364
hCV26505812 rs10757274 C9p21 G GEN no hist AG 52 826
hCV26505812 rs10757274 C9p21 G DOM no hist GG + AG 75 1190
hCV26505812 rs10757274 C9p21 G GEN hist AG 69 629
hCV2442143 rs12544854 ASAH1 T GEN no hist TT 26 393
hCV8942032 rs1264352 DDR1 C GEN no hist CG 37 550
hCV8942032 rs1264352 DDR1 C DOM no hist CC + CG 41 616
hCV16158671 rs2200733 C4 T GEN hist TT 3 10
hCV27504565 rs3219489 MUTYH C GEN hist CG 35 465
hCV27504565 rs3219489 MUTYH C DOM hist GG + CG 41 523
hCV27511436 rs3750145 FZD1 T DOM ALL CC + CT 50 804
hCV27511436 rs3750145 FZD1 T GEN no hist CT 16 414
hCV27511436 rs3750145 FZD1 T DOM no hist CC + CT 19 460
LOW- no
hCV # HR_PLACEBO ER_PLACEBO UPPER_PLACEBO P_PLACEBO EVENTS_ALL event HR_ALL P_ALL
hCV2091644 1.509818 1.030611 2.211844 0.0344528 88 951 1.340598 0.0511049
hCV2091644 1.242162 0.916407 1.683713 0.1622853
hCV2091644 1.452091 0.820968 2.568392 0.1998539 34 523 1.033962 0.91230651
hCV2091644 1.503005 0.897908 2.515874 0.1210805 54 428 1.633661 0.0141837
hCV26505812 1.464442 1.027673 2.086842 0.0347703 215 2683 1.118574 0.41790129
hCV26505812 1.381146 0.981881 1.942766 0.0636069
hCV26505812 1.507129 0.820845 2.767193 0.1857813 47 674 1.215134 0.39336777
hCV26505812 1.482778 0.876794 2.50758 0.1417039 87 1528 0.992161 1
hCV26505812 1.489002 0.900117 2.463154 0.1210931
hCV26505812 1.372228 0.849193 2.217411 0.196237 128 1155 1.185801 0.35086569
hCV2442143 1.479057 0.825673 2.649487 0.1881955 41 704 1.173733 0.49295851
hCV8942032 1.324522 0.870367 2.015654 0.1895578 61 972 1.10852 0.55960326
hCV8942032 1.305687 0.868558 1.962816 0.1996948
hCV16158671 3.711451 1.175206 11.72124 0.0254095 4 18 2.311594 0.12421295
hCV27504565 0.708031 0.473602 1.0585 0.092402 69 853 0.726379 0.04027681
hCV27504565 0.741641 0.506363 1.08624 0.1247589
hCV27511436 0.80098 0.583058 1.100353 0.1707752
hCV27511436 0.603398 0.351722 1.035162 0.066584 42 805 0.824734 0.33847297
hCV27511436 0.646002 0.390525 1.068608 0.0888378

TABLE 31
Gene/
Chrom Risk
hCV # rs # symbol Allele MODE STRATA GENO_RESP STATIN EVENTS_RESP
hCV2091644 rs1010 VAMP8 C DOM no hist CC + CT pravastatin 50
hCV2091644 rs1010 VAMP8 C DOM no hist CC + CT placebo 67
hCV29539757 rs10110659 KCNQ3 C REC hist CC + AC pravastatin 106
hCV29539757 rs10110659 KCNQ3 C REC hist CC + AC placebo 100
hCV26505812 rs10757274 C9p21 G GEN ALL GG pravastatin 51
hCV26505812 rs10757274 C9p21 G GEN ALL GG placebo 48
hCV26505812 rs10757274 C9p21 G GEN ALL AG pravastatin 94
hCV26505812 rs10757274 C9p21 G GEN ALL AG placebo 121
hCV26505812 rs10757274 C9p21 G GEN ALL AA pravastatin 56
hCV26505812 rs10757274 C9p21 G GEN ALL AA placebo 41
hCV26505812 rs10757274 C9p21 G DOM ALL GG + AG pravastatin 145
hCV26505812 rs10757274 C9p21 G DOM ALL GG + AG placebo 169
hCV26505812 rs10757274 C9p21 G GEN no hist GG pravastatin 24
hCV26505812 rs10757274 C9p21 G GEN no hist GG placebo 23
hCV26505812 rs10757274 C9p21 G GEN no hist AG pravastatin 35
hCV26505812 rs10757274 C9p21 G GEN no hist AG placebo 52
hCV26505812 rs10757274 C9p21 G GEN no hist AA pravastatin 28
hCV26505812 rs10757274 C9p21 G GEN no hist AA placebo 19
hCV26505812 rs10757274 C9p21 G DOM no hist GG + AG pravastatin 59
hCV26505812 rs10757274 C9p21 G DOM no hist GG + AG placebo 75
hCV2169762 rs1804689 HPS1 T DOM no hist TT + GT pravastatin 57
hCV2169762 rs1804689 HPS1 T DOM no hist TT + GT placebo 47
hCV2169762 rs1804689 HPS1 T REC hist GG + GT pravastatin 109
hCV2169762 rs1804689 HPS1 T REC hist GG + GT placebo 102
no TO- LOW-
hCV # event TAL_RESP HR_RESP ER_RESP UPPER_RESP P_RESP P_INT_RESP
hCV2091644 994 1044 0.7860368 0.54496 1.13377 0.19768 0.0837336
hCV2091644 1033 1100 0.0837336
hCV29539757 1087 1193 1.0088023 0.76761 1.32578 0.94987 0.0530448
hCV29539757 1040 1140 0.0530448
hCV26505812 638 689 1.0816406 0.7293 1.60421 0.69635 0.0696553
hCV26505812 653 701 0.0696553
hCV26505812 1349 1443 0.7768621 0.59335 1.01713 0.06629 0.0696553
hCV26505812 1334 1455 0.0696553
hCV26505812 674 730 1.3304985 0.88923 1.99075 0.16486 0.0696553
hCV26505812 680 721 0.0696553
hCV26505812 1987 2132 0.8638087 0.69193 1.07838 0.1959 0.0630809
hCV26505812 1987 2156 0.0630809
hCV26505812 333 357 1.0681052 0.6028 1.89259 0.82141 0.0828923
hCV26505812 341 364 0.0828923
hCV26505812 754 789 0.6977172 0.45454 1.071 0.09971 0.0828923
hCV26505812 774 826 0.0828923
hCV26505812 395 423 1.5704654 0.87695 2.81243 0.12894 0.0828923
hCV26505812 424 443 0.0828923
hCV26505812 1087 1146 0.8131888 0.57817 1.14374 0.23474 0.0573322
hCV26505812 1115 1190 0.0573322
hCV2169762 731 788 1.2655756 0.86016 1.86208 0.23193 0.033
hCV2169762 777 824 0.033
hCV2169762 1063 1172 1.0276801 0.7845 1.34624 0.84289 0.0507564
hCV2169762 1035 1137 0.0507564

TABLE 32
Gene/
Chrom Risk no TO- LOW-
hCV # rs # symbol Allele MODE STRATA GENO_RESP STATIN EVENTS_RESP event TAL_RESP HR_RESP ER_RESP UPPER_RESP P_RESP P_INT_RESP
hCV2091644 rs1010 VAMP8 C GEN no hist CC pravastatin 13 258 271 0.635895 0.31841 1.26996 0.199563 0.1798335
hCV2091644 rs1010 VAMP8 C GEN no hist CC placebo 21 265 286 0.1798335
hCV2091644 rs1010 VAMP8 C GEN no hist CT pravastatin 37 736 773 0.850356 0.5516 1.31092 0.462931 0.1798335
hCV2091644 rs1010 VAMP8 C GEN no hist CT placebo 46 768 814 0.1798335
hCV2091644 rs1010 VAMP8 C GEN no hist TT pravastatin 36 492 528 1.358113 0.82457 2.2369 0.22925 0.1798335
hCV2091644 rs1010 VAMP8 C GEN no hist TT placebo 27 510 537 0.1798335
hCV2091644 rs1010 VAMP8 C DOM no hist CC + CT pravastatin 50 994 1044 0.786037 0.54496 1.13377 0.197677 0.0837336
hCV2091644 rs1010 VAMP8 C DOM no hist CC + CT placebo 67 1033 1100 0.0837336
hCV29539757 rs10110659 KCNQ3 C GEN hist AA pravastatin 7 96 103 0.411487 0.16926 1.00034 0.050088 0.1548877
hCV29539757 rs10110659 KCNQ3 C GEN hist AA placebo 16 92 108 0.1548877
hCV29539757 rs10110659 KCNQ3 C GEN hist AC pravastatin 44 493 537 0.994615 0.6549 1.51055 0.979793 0.1548877
hCV29539757 rs10110659 KCNQ3 C GEN hist AC placebo 44 481 525 0.1548877
hCV29539757 rs10110659 KCNQ3 C GEN hist CC pravastatin 62 594 656 1.015618 0.70762 1.45767 0.93301 0.1548877
hCV29539757 rs10110659 KCNQ3 C GEN hist CC placebo 56 559 615 0.1548877
hCV29539757 rs10110659 KCNQ3 C REC hist CC + AC pravastatin 106 1087 1193 1.008802 0.76761 1.32578 0.949874 0.0530448
hCV29539757 rs10110659 KCNQ3 C REC hist CC + AC placebo 100 1040 1140 0.0530448
hCV26505812 rs10757274 C9p21 G GEN ALL GG pravastatin 51 638 689 1.081641 0.7293 1.60421 0.696354 0.0696553
hCV26505812 rs10757274 C9p21 G GEN ALL GG placebo 48 653 701 0.0696553
hCV26505812 rs10757274 C9p21 G GEN ALL AG pravastatin 94 1349 1443 0.776862 0.59335 1.01713 0.066291 0.0696553
hCV26505812 rs10757274 C9p21 G GEN ALL AG placebo 121 1334 1455 0.0696553
hCV26505812 rs10757274 C9p21 G GEN ALL AA pravastatin 56 674 730 1.330498 0.88923 1.99075 0.164856 0.0696553
hCV26505812 rs10757274 C9p21 G GEN ALL AA placebo 41 680 721 0.0696553
hCV26505812 rs10757274 C9p21 G DOM ALL GG + AG pravastatin 145 1987 2132 0.863809 0.69193 1.07838 0.195899 0.0630809
hCV26505812 rs10757274 C9p21 G DOM ALL GG + AG placebo 169 1987 2156 0.0630809
hCV26505812 rs10757274 C9p21 G GEN no hist GG pravastatin 24 333 357 1.068105 0.6028 1.89259 0.821407 0.0828923
hCV26505812 rs10757274 C9p21 G GEN no hist GG placebo 23 341 364 0.0828923
hCV26505812 rs10757274 C9p21 G GEN no hist AG pravastatin 35 754 789 0.697717 0.45454 1.071 0.099711 0.0828923
hCV26505812 rs10757274 C9p21 G GEN no hist AG placebo 52 774 826 0.0828923
hCV26505812 rs10757274 C9p21 G GEN no hist AA pravastatin 28 395 423 1.570465 0.87695 2.81243 0.128942 0.0828923
hCV26505812 rs10757274 C9p21 G GEN no hist AA placebo 19 424 443 0.0828923
hCV26505812 rs10757274 C9p21 G DOM no hist GG + AG pravastatin 59 1087 1146 0.813189 0.57817 1.14374 0.234739 0.0573322
hCV26505812 rs10757274 C9p21 G DOM no hist GG + AG placebo 75 1115 1190 0.0573322
hCV2442143 rs12544854 ASAH1 T REC no hist CC + CT pravastatin 72 1146 1218 1.087339 0.78059 1.51463 0.620489 0.1385034
hCV2442143 rs12544854 ASAH1 T REC no hist CC + CT placebo 68 1175 1243 0.1385034
hCV2442143 rs12544854 ASAH1 T DOM hist TT + CT pravastatin 88 865 953 1.043307 0.77225 1.4095 0.78239 0.1787787
hCV2442143 rs12544854 ASAH1 T DOM hist TT + CT placebo 82 850 932 0.1787787
hCV27830265 rs12762303 ALOX5 G DOM no hist GG + AG pravastatin 25 474 499 1.479294 0.78982 2.77065 0.22133 0.1332561
hCV27830265 rs12762303 ALOX5 G DOM no hist GG + AG placebo 16 445 461 0.1332561
hCV2169762 rs1804689 HPS1 T GEN no hist TT pravastatin 10 127 137 1.27501 0.51771 3.14008 0.597269 0.102835
hCV2169762 rs1804689 HPS1 T GEN no hist TT placebo 9 145 154 0.102835
hCV2169762 rs1804689 HPS1 T GEN no hist GT pravastatin 47 604 651 1.268286 0.82701 1.94501 0.27599 0.102835
hCV2169762 rs1804689 HPS1 T GEN no hist GT placebo 38 632 670 0.102835
hCV2169762 rs1804689 HPS1 T GEN no hist GG pravastatin 30 753 783 0.65902 0.41685 1.04187 0.074354 0.102835
hCV2169762 rs1804689 HPS1 T GEN no hist GG placebo 47 763 810 0.102835
hCV2169762 rs1804689 HPS1 T DOM no hist TT + GT pravastatin 57 731 788 1.265576 0.86016 1.86208 0.231932 0.033
hCV2169762 rs1804689 HPS1 T DOM no hist TT + GT placebo 47 777 824 0.033
hCV2169762 rs1804689 HPS1 T GEN hist TT pravastatin 5 119 124 0.336546 0.11847 0.95606 0.040922 0.1254774
hCV2169762 rs1804689 HPS1 T GEN hist TT placebo 12 99 111 0.1254774
hCV2169762 rs1804689 HPS1 T GEN hist GT pravastatin 47 511 558 0.94255 0.62771 1.4153 0.775439 0.1254774
hCV2169762 rs1804689 HPS1 T GEN hist GT placebo 46 480 526 0.1254774
hCV2169762 rs1804689 HPS1 T GEN hist GG pravastatin 62 552 614 1.104484 0.76954 1.58521 0.589855 0.1254774
hCV2169762 rs1804689 HPS1 T GEN hist GG placebo 56 555 611 0.1254774
hCV2169762 rs1804689 HPS1 T REC hist GG + GT pravastatin 109 1063 1172 1.02768 0.7845 1.34624 0.842894 0.0507564
hCV2169762 rs1804689 HPS1 T REC hist GG + GT placebo 102 1035 1137 0.0507564
hCV1348610 rs3739636 C9orf46 A GEN hist AA pravastatin 24 226 250 0.986092 0.54 1.80071 0.963642 0.1842815
hCV1348610 rs3739636 C9orf46 A GEN hist AA placebo 19 186 205 0.1842815
hCV1348610 rs3739636 C9orf46 A GEN hist AG pravastatin 47 566 613 0.740596 0.50624 1.08345 0.121846 0.1842815
hCV1348610 rs3739636 C9orf46 A GEN hist AG placebo 61 545 606 0.1842815
hCV1348610 rs3739636 C9orf46 A GEN hist GG pravastatin 43 378 421 1.276897 0.81723 1.99511 0.283036 0.1842815
hCV1348610 rs3739636 C9orf46 A GEN hist GG placebo 35 392 427 0.1842815
hCV1348610 rs3739636 C9orf46 A DOM hist AA + AG pravastatin 71 792 863 0.806434 0.58581 1.11014 0.187096 0.1002517
hCV1348610 rs3739636 C9orf46 A DOM hist AA + AG placebo 80 731 811 0.1002517
hCV27511436 rs3750145 FZD1 T GEN no hist CC pravastatin 1 42 43 0.349207 0.03631 3.35808 0.362284 0.1652143
hCV27511436 rs3750145 FZD1 T GEN no hist CC placebo 3 43 46 0.1652143
hCV27511436 rs3750145 FZD1 T GEN no hist CT pravastatin 26 407 433 1.575251 0.84504 2.93645 0.152693 0.1652143
hCV27511436 rs3750145 FZD1 T GEN no hist CT placebo 16 398 414 0.1652143
hCV27511436 rs3750145 FZD1 T GEN no hist TT pravastatin 60 1035 1095 0.85237 0.60701 1.19691 0.356417 0.1652143
hCV27511436 rs3750145 FZD1 T GEN no hist TT placebo 75 1099 1174 0.1652143
hCV27511436 rs3750145 FZD1 T DOM no hist CC + CT pravastatin 27 449 476 1.387947 0.77175 2.49613 0.273626 0.1600111
hCV27511436 rs3750145 FZD1 T DOM no hist CC + CT placebo 19 441 460 0.1600111

TABLE 33
gene/chrom GENO-
hCV # rs # symbol ENDPT MODE STRATA ADJUST TYPE
hCV1348610 rs3739636 C9orf46 ATHERO GEN WHITE AGEBL GEND01 AG
hCV15857769 rs2924914 ATHERO GEN WHITE AGEBL GEND01 TT
hCV15857769 rs2924914 ATHERO REC WHITE AGEBL GEND01 TT
hCV15857769 rs2924914 ATHERO ADD WHITE AGEBL GEND01 T
hCV15857769 rs2924914 ATHERO GEN WHITE AGEBL GEND01 TT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV15857769 rs2924914 ATHERO REC WHITE AGEBL GEND01 TT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV15857769 rs2924914 ISCHEM GEN WHITE AGEBL GEND01 TT
hCV15857769 rs2924914 ISCHEM REC WHITE AGEBL GEND01 TT
hCV15857769 rs2924914 ISCHEM ADD WHITE AGEBL GEND01 T
hCV15857769 rs2924914 ISCHEM GEN WHITE AGEBL GEND01 TT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV15857769 rs2924914 ISCHEM ADD WHITE AGEBL GEND01 T
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV15857769 rs2924914 STROKE GEN WHITE AGEBL GEND01 TT
hCV16336 rs362277 HD STROKE ADD WHITE AGEBL GEND01 C
hCV30308202 rs9482985 LAMA2 ISCHEM REC WHITE AGEBL GEND01 GG
hCV30308202 rs9482985 LAMA2 ISCHEM REC WHITE AGEBL GEND01 GG
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
95% Lower 95% Upper P-VALUE
hCV # EVENTS TOTAL HR CL for HR CL for HR (2-sided) 2DF P-VALUE
hCV1348610 147  1809  1.28 0.97 1.70 0.087 0.232
hCV15857769 31 310 1.52 1.03 2.26 0.036 0.111
hCV15857769 31 310 1.47 1.01 2.13 0.046 .
hCV15857769 . . 1.19 0.99 1.43 0.066 .
hCV15857769 30 300 1.46 0.98 2.17 0.067 0.186
hCV15857769 30 300 1.4 0.96 2.06 0.083 .
hCV15857769 41 310 1.42 1.01 1.99 0.044 0.127
hCV15857769 41 310 1.36 0.98 1.88 0.064 .
hCV15857769 . . 1.16 0.99 1.35 0.060 .
hCV15857769 40 300 1.36 0.97 1.93 0.078 0.202
hCV15857769 . . 1.14 0.98 1.34 0.093 .
hCV15857769 48 310 1.32 0.96 1.80 0.084 0.220
hCV16336 . . 1.2 0.97 1.49 0.093 .
hCV30308202 280  2509  1.21 0.98 1.50 0.080 .
hCV30308202 275  2458  1.21 0.98 1.51 0.080 .

TABLE 34
gene/chrom GENO-
hCV # rs # symbol ENDPT MODE STRATA ADJUST TYPE
hCV1348610 rs3739636 C9orf46 ATHERO GEN BLACK AGEBL GEND01 AA
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1348610 rs3739636 C9orf46 ATHERO ADD BLACK AGEBL GEND01 A
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1348610 rs3739636 C9orf46 ISCHEM GEN BLACK AGEBL GEND01 AA
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1348610 rs3739636 C9orf46 ISCHEM ADD BLACK AGEBL GEND01 A
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1348610 rs3739636 C9orf46 STROKE GEN BLACK AGEBL GEND01 AA
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1348610 rs3739636 C9orf46 STROKE REC BLACK AGEBL GEND01 AA
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1348610 rs3739636 C9orf46 STROKE ADD BLACK AGEBL GEND01 A
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1619596 rs1048621 SDCBP2 ISCHEM GEN BLACK AGEBL GEND01 AA
hCV1619596 rs1048621 SDCBP2 ISCHEM REC BLACK AGEBL GEND01 AA
hCV1619596 rs1048621 SDCBP2 ISCHEM GEN BLACK AGEBL GEND01 AA
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1619596 rs1048621 SDCBP2 ISCHEM REC BLACK AGEBL GEND01 AA
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1619596 rs1048621 SDCBP2 STROKE GEN BLACK AGEBL GEND01 AA
hCV1619596 rs1048621 SDCBP2 STROKE REC BLACK AGEBL GEND01 AA
hCV1619596 rs1048621 SDCBP2 STROKE GEN BLACK AGEBL GEND01 AA
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1619596 rs1048621 SDCBP2 STROKE REC BLACK AGEBL GEND01 AA
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV16336 rs362277 HD ISCHEM GEN BLACK AGEBL GEND01 CT
hCV16336 rs362277 HD ISCHEM GEN BLACK AGEBL GEND01 CT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1723718 rs12481805 UMODL1 ATHERO GEN BLACK AGEBL GEND01 AA
hCV1723718 rs12481805 UMODL1 ATHERO REC BLACK AGEBL GEND01 AA
hCV1723718 rs12481805 UMODL1 ATHERO GEN BLACK AGEBL GEND01 AA
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1723718 rs12481805 UMODL1 ATHERO REC BLACK AGEBL GEND01 AA
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1723718 rs12481805 UMODL1 ISCHEM GEN BLACK AGEBL GEND01 AA
hCV1723718 rs12481805 UMODL1 ISCHEM REC BLACK AGEBL GEND01 AA
hCV1723718 rs12481805 UMODL1 ISCHEM GEN BLACK AGEBL GEND01 AA
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1723718 rs12481805 UMODL1 ISCHEM REC BLACK AGEBL GEND01 AA
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV25596936 rs6967117 EPHA1 STROKE GEN BLACK AGEBL GEND01 TT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV25596936 rs6967117 EPHA1 STROKE REC BLACK AGEBL GEND01 TT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV27077072 rs8060368 ATHERO REC BLACK AGEBL GEND01 CC
hCV27077072 rs8060368 ATHERO ADD BLACK AGEBL GEND01 C
hCV27077072 rs8060368 ATHERO ADD BLACK AGEBL GEND01 C
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV27077072 rs8060368 ISCHEM ADD BLACK AGEBL GEND01 C
hCV8754449 rs781226 TESK2 ATHERO GEN BLACK AGEBL GEND01 CT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV8754449 rs781226 TESK2 ISCHEM GEN BLACK AGEBL GEND01 CT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
95% Lower 95% Upper P-VALUE
hCV # EVENTS TOTAL HR CL for HR CL for HR (2-sided) 2DF P-VALUE
hCV1348610 17 151 2.03 0.93 4.40 0.074 0.203
hCV1348610 . . 1.41 0.97 2.06 0.073 .
hCV1348610 20 151 1.83 0.91 3.67 0.089 0.214
hCV1348610 . . 1.36 0.96 1.93 0.085 .
hCV1348610 25 151 1.75 0.94 3.23 0.076 0.173
hCV1348610 25 151 1.56 0.96 2.54 0.075 .
hCV1348610 . . 1.33 0.98 1.82 0.072 .
hCV1619596 6 22 2.36 1.00 5.60 0.051 0.150
hCV1619596 6 22 2.28 0.98 5.32 0.055 .
hCV1619596 5 20 2.66 1.02 6.90 0.045 0.133
hCV1619596 5 20 2.54 1.00 6.46 0.050 .
hCV1619596 7 22 2.15 0.97 4.75 0.059 0.165
hCV1619596 7 22 2.12 0.97 4.61 0.059 .
hCV1619596 6 20 2.24 0.95 5.31 0.067 0.185
hCV1619596 6 20 2.2 0.95 5.14 0.068 .
hCV16336 43 326 1.68 0.92 3.07 0.094 0.083
hCV16336 41 309 1.95 1.02 3.71 0.043 0.033
hCV1723718 3 8 3.95 1.21 12.91 0.023 0.046
hCV1723718 3 8 4.15 1.28 13.49 0.018 .
hCV1723718 3 8 3.4 1.00 11.56 0.051 0.085
hCV1723718 3 8 3.61 1.07 12.22 0.039 .
hCV1723718 3 8 3.26 1.01 10.59 0.049 0.073
hCV1723718 3 8 3.46 1.07 11.17 0.038 .
hCV1723718 3 8 3.08 0.92 10.32 0.068 0.096
hCV1723718 3 8 3.29 0.99 10.95 0.052 .
hCV25596936 1 4 7 0.80 61.25 0.079 0.170
hCV25596936 1 4 6.66 0.77 58.06 0.086 .
hCV27077072 48 444 1.78 0.96 3.29 0.066 .
hCV27077072 . . 1.82 1.03 3.24 0.041 .
hCV27077072 . . 1.64 0.91 2.95 0.097 .
hCV27077072 . . 1.56 0.94 2.59 0.087 .
hCV8754449 35 297 1.86 0.99 3.46 0.052 0.081
hCV8754449 39 297 1.8 1.01 3.24 0.048 0.085

TABLE 35
gene/chrom GENO-
hCV # rs # symbol ENDPT MODE STRATA ADJUST TYPE
hCV11425801 rs3805953 PEX6 ISCHEM GEN WHITE AGEBL GEND01 CT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV11425801 rs3805953 PEX6 STROKE GEN WHITE AGEBL GEND01 CT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1348610 rs3739636 C9orf46 ATHERO DOM WHITE AGEBL GEND01 AG + AA
hCV1348610 rs3739636 C9orf46 ATHERO GEN WHITE AGEBL GEND01 AG
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1348610 rs3739636 C9orf46 ATHERO DOM WHITE AGEBL GEND01 AG + AA
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV15857769 rs2924914 ATHERO ADD WHITE AGEBL GEND01 T
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV15857769 rs2924914 ISCHEM DOM WHITE AGEBL GEND01 TC + TT
hCV15857769 rs2924914 ISCHEM REC WHITE AGEBL GEND01 TT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV15857769 rs2924914 STROKE REC WHITE AGEBL GEND01 TT
hCV15857769 rs2924914 STROKE ADD WHITE AGEBL GEND01 T
hCV15857769 rs2924914 STROKE GEN WHITE AGEBL GEND01 TT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV15857769 rs2924914 STROKE REC WHITE AGEBL GEND01 TT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV15857769 rs2924914 STROKE ADD WHITE AGEBL GEND01 T
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV16158671 rs2200733 STROKE GEN WHITE AGEBL GEND01 TT
hCV16158671 rs2200733 STROKE REC WHITE AGEBL GEND01 TT
hCV16158671 rs2200733 STROKE GEN WHITE AGEBL GEND01 TT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV16158671 rs2200733 STROKE REC WHITE AGEBL GEND01 TT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV16336 rs362277 HD STROKE GEN WHITE AGEBL GEND01 CC
hCV16336 rs362277 HD STROKE DOM WHITE AGEBL GEND01 CT + CC
hCV16336 rs362277 HD STROKE REC WHITE AGEBL GEND01 CC
hCV16336 rs362277 HD STROKE ADD WHITE AGEBL GEND01 C
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV29401764 rs7793552 LOC646588 ISCHEM REC WHITE AGEBL GEND01 CC
hCV30308202 rs9482985 LAMA2 ISCHEM ADD WHITE AGEBL GEND01 G
hCV30308202 rs9482985 LAMA2 ISCHEM ADD WHITE AGEBL GEND01 G
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV30308202 rs9482985 LAMA2 STROKE REC WHITE AGEBL GEND01 GG
hCV32160712 rs11079160 ATHERO GEN WHITE AGEBL GEND01 TT
hCV32160712 rs11079160 ATHERO REC WHITE AGEBL GEND01 TT
hCV32160712 rs11079160 ATHERO GEN WHITE AGEBL GEND01 TT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV32160712 rs11079160 ATHERO REC WHITE AGEBL GEND01 TT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
95% Lower 95% Upper P- VALUE
hCV # EVENTS TOTAL HR CL for HR CL for HR (2-sided) 2DF P-VALUE
hCV11425801 206  1814 1.17 0.928 1.48 0.1834 0.1314
hCV11425801 254  1814 1.15 0.933 1.418 0.1894 0.1374
hCV1348610 205  2556 1.25 0.953 1.631 0.108 .
hCV1348610 143  1763 1.25 0.938 1.658 0.1286 0.3147
hCV1348610 201  2499 1.22 0.933 1.605 0.1444 .
hCV15857769 . . 1.17 0.969 1.403 0.1033 .
hCV15857769 187  1704 1.16 0.942 1.422 0.165 .
hCV15857769 40  300 1.31 0.942 1.821 0.1092 .
hCV15857769 48  310 1.28 0.947 1.723 0.1093 .
hCV15857769 . . 1.12 0.974 1.288 0.1112 .
hCV15857769 47  300 1.29 0.939 1.766 0.1172 0.2918
hCV15857769 47  300 1.26 0.928 1.702 0.1394 .
hCV15857769 . . 1.11 0.96 1.274 0.1632 .
hCV16158671 16  90 1.41 0.853 2.323 0.1811 0.4076
hCV16158671 16  90 1.4 0.85 2.306 0.1856 .
hCV16158671 16  88 1.48 0.895 2.443 0.1272 0.3047
hCV16158671 16  88 1.46 0.889 2.415 0.1345 .
hCV16336 408  3030 2.2 0.707 6.862 0.1734 0.2057
hCV16336 495  3764 2.14 0.689 6.677 0.188 .
hCV16336 408  3030 1.19 0.944 1.49 0.1428 .
hCV16336 . . 1.16 0.937 1.44 0.1709 .
hCV29401764 199  1792 1.15 0.941 1.395 0.1757 .
hCV30308202 . . 1.14 0.946 1.368 0.1694 .
hCV30308202 . . 1.14 0.949 1.374 0.1586 .
hCV30308202 342  2509 1.14 0.942 1.376 0.1802 .
hCV32160712 13  119 1.47 0.835 2.572 0.183 0.3099
hCV32160712 13  119 1.5 0.858 2.617 0.1551 .
hCV32160712 13  117 1.49 0.851 2.626 0.1621 0.2277
hCV32160712 13  117 1.54 0.883 2.698 0.1277 .

TABLE 36
gene/chrom GENO-
hCV # rs # symbol ENDPT MODE STRATA ADJUST TYPE
hCV11425801 rs3805953 PEX6 ISCHEM GEN BLACK AGEBL GEND01 CT
hCV11425801 rs3805953 PEX6 ISCHEM GEN BLACK AGEBL GEND01 CT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV11425801 rs3805953 PEX6 STROKE GEN BLACK AGEBL GEND01 CT
hCV11425801 rs3805953 PEX6 STROKE GEN BLACK AGEBL GEND01 CT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV11425842 rs10948059 GNMT ATHERO GEN BLACK AGEBL GEND01 CC
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV11425842 rs10948059 GNMT ATHERO REC BLACK AGEBL GEND01 CC
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV11425842 rs10948059 GNMT ATHERO ADD BLACK AGEBL GEND01 C
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV11425842 rs10948059 GNMT STROKE GEN BLACK AGEBL GEND01 CC
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV11425842 rs10948059 GNMT STROKE ADD BLACK AGEBL GEND01 C
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1348610 rs3739636 C9orf46 ATHERO GEN BLACK AGEBL GEND01 AA
hCV1348610 rs3739636 C9orf46 ATHERO DOM BLACK AGEBL GEND01 AG + AA
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1348610 rs3739636 C9orf46 ATHERO REC BLACK AGEBL GEND01 AA
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1348610 rs3739636 C9orf46 ISCHEM REC BLACK AGEBL GEND01 AA
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1619596 rs1048621 SDCBP2 ISCHEM ADD BLACK AGEBL GEND01 A
hCV1619596 rs1048621 SDCBP2 ISCHEM ADD BLACK AGEBL GEND01 A
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV16336 rs362277 HD ATHERO GEN BLACK AGEBL GEND01 CT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV16336 rs362277 HD ISCHEM DOM BLACK AGEBL GEND01 CT + CC
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV16336 rs362277 HD STROKE GEN BLACK AGEBL GEND01 CT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1723718 rs12481805 UMODL1 STROKE GEN BLACK AGEBL GEND01 AA
hCV1723718 rs12481805 UMODL1 STROKE REC BLACK AGEBL GEND01 AA
hCV1723718 rs12481805 UMODL1 STROKE GEN BLACK AGEBL GEND01 AA
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV1723718 rs12481805 UMODL1 STROKE REC BLACK AGEBL GEND01 AA
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV25596936 rs6967117 EPHA1 STROKE GEN BLACK AGEBL GEND01 TT
hCV25596936 rs6967117 EPHA1 STROKE REC BLACK AGEBL GEND01 TT
hCV27077072 rs8060368 ATHERO REC BLACK AGEBL GEND01 CC
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV27077072 rs8060368 ISCHEM REC BLACK AGEBL GEND01 CC
hCV27077072 rs8060368 ISCHEM ADD BLACK AGEBL GEND01 C
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV29401764 rs7793552 LOC646588 STROKE GEN BLACK AGEBL GEND01 CC
hCV29401764 rs7793552 LOC646588 STROKE REC BLACK AGEBL GEND01 CC
hCV29401764 rs7793552 LOC646588 STROKE GEN BLACK AGEBL GEND01 CC
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV29401764 rs7793552 LOC646588 STROKE REC BLACK AGEBL GEND01 CC
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV8754449 rs781226 TESK2 ATHERO GEN BLACK AGEBL GEND01 CT
hCV8754449 rs781226 TESK2 ATHERO DOM BLACK AGEBL GEND01 CT + CC
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV8754449 rs781226 TESK2 ISCHEM DOM BLACK AGEBL GEND01 CT + CC
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV8754449 rs781226 TESK2 STROKE GEN BLACK AGEBL GEND01 CT
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
hCV8942032 rs1264352 DDR1 STROKE GEN BLACK AGEBL GEND01 CG
hCV8942032 rs1264352 DDR1 STROKE GEN BLACK AGEBL GEND01 CG
BMI PRESSM
DIABADA HTN
LDLADJBL
HDL44BL
95% Lower 95% Upper P-VALUE
hCV # EVENTS TOTAL HR CL for HR CL for HR (2-sided) 2DF P-VALUE
hCV11425801 25 184 1.4 0.853 2.286 0.1849 0.4151
hCV11425801 24 177 1.47 0.882 2.446 0.1399 0.3364
hCV11425801 30 184 1.35 0.865 2.119 0.1854 0.1546
hCV11425801 29 177 1.39 0.88 2.209 0.1574 0.145 
hCV11425842 19 158 1.63 0.789 3.384 0.1864 0.3447
hCV11425842 19 158 1.5 0.857 2.628 0.1557 .
hCV11425842 . . 1.29 0.894 1.872 0.1716 .
hCV11425842 25 158 1.51 0.822 2.78 0.1837 0.4087
hCV11425842 . . 1.23 0.908 1.664 0.181 .
hCV1348610 17 157 1.64 0.769 3.515 0.1995 0.4376
hCV1348610 39 427 1.72 0.865 3.421 0.1223 .
hCV1348610 17 151 1.54 0.855 2.786 0.1497 .
hCV1348610 20 151 1.57 0.91 2.713 0.1048 .
hCV1619596 . . 1.33 0.902 1.954 0.1502 .
hCV1619596 . . 1.37 0.904 2.084 0.1373 .
hCV16336 34 309 1.61 0.832 3.118 0.1574 0.1458
hCV16336 53 469 1.6 0.853 3 0.1434 .
hCV16336 48 309 1.44 0.846 2.456 0.1788 0.1231
hCV1723718  3  8 2.45 0.763 7.88 0.1323 0.1146
hCV1723718  3  8 2.62 0.816 8.39 0.1057 .
hCV1723718  3  8 2.28 0.692 7.493 0.1755 0.1501
hCV1723718  3  8 2.44 0.746 8.015 0.1401 .
hCV25596936  1  4 4.13 0.551 31.03 0.1676 0.3443
hCV25596936  1  4 4.04 0.539 30.26 0.1741 .
hCV27077072 44 423 1.59 0.852 2.96 0.1453 .
hCV27077072 53 444 1.48 0.859 2.566 0.1567 .
hCV27077072 . . 1.51 0.891 2.567 0.125 .
hCV29401764 13  61 1.62 0.855 3.084 0.1382 0.3119
hCV29401764 13  61 1.58 0.873 2.848 0.1313 .
hCV29401764 12  57 1.62 0.836 3.15 0.1529 0.3156
hCV29401764 12  57 1.61 0.87 2.981 0.1291 .
hCV8754449 36 310 1.49 0.836 2.657 0.1758 0.1929
hCV8754449 43 414 1.61 0.879 2.966 0.1228 .
hCV8754449 49 414 1.59 0.899 2.806 0.1107 .
hCV8754449 46 297 1.39 0.847 2.289 0.192 0.1777
hCV8942032 38 244 1.34 0.867 2.058 0.1894 0.1396
hCV8942032 36 229 1.43 0.915 2.25 0.1155 0.0872

TABLE 37
hCV # (C9p21 rs # (C9p21 GENO-
SNP) SNP) ADJUST MODE TYPE STATIN EVENTS
hCV26505812 rs10757274 unadjusted GEN AA Pravastatin 17
hCV26505812 rs10757274 unadjusted GEN AA Placebo 17
hCV26505812 rs10757274 unadjusted GEN AG Pravastatin 27
hCV26505812 rs10757274 unadjusted GEN AG Placebo 48
hCV26505812 rs10757274 unadjusted GEN GG Pravastatin 23
hCV26505812 rs10757274 unadjusted GEN GG Placebo 25
hCV26505812 rs10757274 unadjusted DOM AG + AA Pravastatin 44
hCV26505812 rs10757274 unadjusted DOM AG + AA Placebo 65
hCV26505812 rs10757274 unadjusted REC AG + GG Pravastatin 50
hCV26505812 rs10757274 unadjusted REC AG + GG Placebo 73
hCV26505812 rs10757274 AGE MALE CURRSMK GEN AA Pravastatin 18
HYPERTEN_1 DIABETES_1
BMI BASE_LDL BASE_HDL
hCV26505812 rs10757274 AGE MALE CURRSMK GEN AA Placebo 17
HYPERTEN_1 DIABETES_1
BMI BASE_LDL BASE_HDL
hCV26505812 rs10757274 AGE MALE CURRSMK GEN GA Pravastatin 29
HYPERTEN_1 DIABETES_1
BMI BASE_LDL BASE_HDL
hCV26505812 rs10757274 AGE MALE CURRSMK GEN GA Placebo 50
HYPERTEN_1 DIABETES_1
BMI BASE_LDL BASE_HDL
hCV26505812 rs10757274 AGE MALE CURRSMK GEN GG Pravastatin 25
HYPERTEN_1 DIABETES_1
BMI BASE_LDL BASE_HDL
hCV26505812 rs10757274 AGE MALE CURRSMK GEN GG Placebo 26
HYPERTEN_1 DIABETES_1
BMI BASE_LDL BASE_HDL
hCV26505812 rs10757274 AGE MALE CURRSMK REC GA + AA Pravastatin 47
HYPERTEN_1 DIABETES_1
BMI BASE_LDL BASE_HDL
hCV26505812 rs10757274 AGE MALE CURRSMK REC GA + AA Placebo 67
HYPERTEN_1 DIABETES_1
BMI BASE_LDL BASE_HDL
hCV26505812 rs10757274 AGE MALE CURRSMK DOM GA + GG Pravastatin 54
HYPERTEN_1 DIABETES_1
BMI BASE_LDL BASE_HDL
hCV26505812 rs10757274 AGE MALE CURRSMK DOM GA + GG Placebo 76
HYPERTEN_1 DIABETES_1
BMI BASE_LDL BASE_HDL
95% Lower 95% Upper
Confidence Confidence
hCV # (C9p21 Limit for Limit for
SNP) TOTAL HR Hazard Ratio Hazard Ratio P-VALUE PVAL_INTX
hCV26505812 315 0.85 0.433 1.667 0.6359 0.44429
hCV26505812 262 ref . . . 0.44429
hCV26505812 666 0.58 0.361 0.927 0.0229 0.44429
hCV26505812 689 ref . . . 0.44429
hCV26505812 414 0.91 0.515 1.599 0.7377 0.44429
hCV26505812 412 ref . . . 0.44429
hCV26505812 981 0.65 0.446 0.96  0.03  0.34883
hCV26505812 951 ref . . . 0.34883
hCV26505812 1080 0.69 0.484 0.994 0.0463 0.65126
hCV26505812 1101 ref . . . 0.65126
hCV26505812 328 0.92 0.469 1.802 0.8064 0.43653
hCV26505812 272 ref . . . 0.43653
hCV26505812 690 0.61 0.384 0.963 0.0339 0.43653
hCV26505812 727 ref . . . 0.43653
hCV26505812 441 1   0.574 1.732 0.9924 0.43653
hCV26505812 425 ref . . . 0.43653
hCV26505812 1018 0.69 0.476 1.005 0.0533 0.3725
hCV26505812 999 ref . . . 0.3725
hCV26505812 1131 0.73 0.512 1.03  0.0728 0.60059
hCV26505812 1152 ref . . . 0.60059

TABLE 38
for chromosome 9p21 SNP (rs10757274/hCV26505812):
Risk no
ENDPT Allele MODE STRATA GENO_RESP STATIN EVENTS_RESP event TOTAL_RESP HR_RESP_unadj
stroke G GEN ALL GG pravastatin 51 638 689 1.082
stroke G GEN ALL GG placebo 48 653 701
stroke G GEN ALL AG pravastatin 94 1349 1443 0.777
stroke G GEN ALL AG placebo 121 1334 1455
stroke G GEN ALL AA pravastatin 56 674 730 1.330
stroke G GEN ALL AA placebo 41 680 721
stroke G DOM ALL GG + AG pravastatin 145 1987 2132 0.864
stroke G DOM ALL GG + AG placebo 169 1987 2156
stroke G REC ALL AA + AG pravastatin 150 2023 2173 0.919
stroke G REC ALL AA + AG placebo 162 2014 2176
stroke G GEN no hist GG pravastatin 24 333 357 1.068
stroke G GEN no hist GG placebo 23 341 364
stroke G GEN no hist AG pravastatin 35 754 789 0.698
stroke G GEN no hist AG placebo 52 774 826
stroke G GEN no hist AA pravastatin 28 395 423 1.570
stroke G GEN no hist AA placebo 19 424 443
stroke G DOM no hist GG + AG pravastatin 59 1087 1146 0.813
stroke G DOM no hist GG + AG placebo 75 1115 1190
stroke G REC no hist AA + AG pravastatin 63 1149 1212 0.927
stroke G REC no hist AA + AG placebo 71 1198 1269
stroke G GEN hist GG pravastatin 27 305 332 1.098
stroke G GEN hist GG placebo 25 312 337
stroke G GEN hist AG pravastatin 59 595 654 0.816
stroke G GEN hist AG placebo 69 560 629
stroke G GEN hist AA pravastatin 28 279 307 1.093
stroke G GEN hist AA placebo 22 256 278
stroke G DOM hist GG + AG pravastatin 86 900 986 0.892
stroke G DOM hist GG + AG placebo 94 872 966
stroke G REC hist AA + AG pravastatin 87 874 961 0.885
stroke G REC hist AA + AG placebo 91 816 907
ENDPT LOWER_RESP_unadj UPPER_RESP_unadj P_RESP_unadj P_INT_RESP_unadj P_RESP_adj
stroke 0.729 1.604 0.696 0.070 0.602
stroke 0.070
stroke 0.593 1.017 0.066 0.070 0.053
stroke 0.070
stroke 0.889 1.991 0.165 0.070 0.158
stroke 0.070
stroke 0.692 1.078 0.196 0.063 0.175
stroke 0.063
stroke 0.736 1.147 0.455 0.472 0.432
stroke 0.472
stroke 0.603 1.893 0.821 0.083 0.824
stroke 0.083
stroke 0.455 1.071 0.100 0.083 0.077
stroke 0.083
stroke 0.877 2.812 0.129 0.083 0.108
stroke 0.083
stroke 0.578 1.144 0.235 0.057 0.191
stroke 0.057
stroke 0.660 1.302 0.662 0.669 0.636
stroke 0.669
stroke 0.637 1.892 0.736 0.535 0.650
stroke 0.535
stroke 0.576 1.155 0.251 0.535 0.323
stroke 0.535
stroke 0.625 1.911 0.755 0.535 0.978
stroke 0.535
stroke 0.666 1.195 0.444 0.508 0.552
stroke 0.508
stroke 0.660 1.187 0.415 0.500 0.420
stroke 0.500
ENDPT P_INT_RESP_adj GENO_PLACEBO EVENTS_PLACEBO TOTAL_PLACEBO
stroke 0.050 GG 48 701
stroke 0.050
stroke 0.050 AG 121 1455
stroke 0.050
stroke 0.050 AA 41 721
stroke 0.050
stroke 0.055 GG + AG 169 2156
stroke 0.055
stroke 0.398 AA + AG
stroke 0.398
stroke 0.065 GG 23 364
stroke 0.065
stroke 0.065 AG 52 826
stroke 0.065
stroke 0.065 AA 19 443
stroke 0.065
stroke 0.049 GG + AG 75 1190
stroke 0.049
stroke 0.624 AA + AG
stroke 0.624
stroke 0.576 GG 25 337
stroke 0.576
stroke 0.576 AG 69 629
stroke 0.576
stroke 0.576 AA 22 278
stroke 0.576
stroke 0.576 GG + AG 94 966
stroke 0.576
stroke 0.450 AA + AG
stroke 0.450
ENDPT HR_PLACEBO LOWER_PLACEBO UPPER_PLACEBO P_PLACEBO
stroke 1.20631 0.79513 1.8301 0.37779
stroke
stroke 1.46444 1.02767 2.0868 0.03477
stroke
stroke ref 0 0 0
stroke
stroke 1.38115 0.98188 1.9428 0.06361
stroke
stroke
stroke
stroke 1.50713 0.82085 2.7672 0.18578
stroke
stroke 1.48278 0.87679 2.5076 0.1417
stroke
stroke ref 0 0 0
stroke
stroke 1.489  0.90012 2.4632 0.12109
stroke
stroke
stroke
stroke 0.91337 0.51499 1.6199 0.75659
stroke
stroke 1.37223 0.84919 2.2174 0.19624
stroke
stroke ref 0 0 0
stroke
stroke 1.21007 0.76069 1.9249 0.42078
stroke
stroke
stroke

Claims

1. A method of determining whether a human has an altered risk for stroke, comprising testing nucleic acid from said human for the presence or absence of a polymorphism selected from the group consisting of the polymorphisms represented by position 101 of any one of the nucleotide sequences of SEQ ID NOS:436-1566 or its complement, wherein the polymorphism indicates an altered risk for stroke.

2-3. (canceled)

4. The method of claim 1, wherein the altered risk is an increased risk.

5. The method of claim 1, wherein the altered risk is a decreased risk.

6. The method of claim 1, wherein said nucleic acid is a nucleic acid extract from a biological sample from said human.

7. The method of claim 6, wherein said biological sample is blood, saliva, or buccal cells.

8. The method of claim 6, further comprising preparing said nucleic acid extract from said biological sample prior to said testing step.

9. The method of claim 8, further comprising obtaining said biological sample from said human prior to said preparing step.

10. The method of claim 1, wherein said testing step comprises nucleic acid amplification.

11. The method of claim 10, wherein said nucleic acid amplification is carried out by polymerase chain reaction.

12. The method of claim 1, further comprising correlating the presence or absence of the polymorphism with an altered risk for stroke.

13. The method of claim 12, wherein said correlating step is performed by computer software.

14. The method of claim 1, wherein said testing is performed using sequencing, 5′ nuclease digestion, molecular beacon assay, oligonucleotide ligation assay, size analysis, single-stranded conformation polymorphism analysis, or denaturing gradient gel electrophoresis (DGGE).

15. The method of any one of claim 1, wherein said testing is performed using an allele-specific method.

16. The method of claim 15, wherein said allele-specific method is allele-specific probe hybridization, allele-specific primer extension, or allele-specific amplification.

17. The method of claim 16, wherein the method is performed using an allele-specific primer provided in Table 3.

18. (canceled)

19. The method of claim 1, further comprising correlating the presence of the polymorphism with a reduction of risk for stroke by an HMG-CoA reductase inhibitor.

20. The method of claim 19, wherein said correlating step is performed by computer software.

21. The method of claim 19, wherein said HMG-CoA reductase inhibitor is a hydrophilic statin.

22. The method of claim 19, wherein said HMG-CoA reductase inhibitor is a hydrophobic statin.

23. The method of claim 19, wherein said HMG-CoA reductase inhibitor is selected from the group consisting of pravastatin, atorvastatin, simvastatin, cerevastatin, lovastatin, storvastatin, rosuvastatin, and fluvastatin, or a combination thereof.

24-41. (canceled)

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class: