US20180327863A1
2018-11-15
15/987,235
2018-05-23
Two genes, ARID1A (AT-rich interactive domain-containing protein 1A) and PPP2R1A (protein-phosphatase 2, regulatory subunit 1, alpha), can be used in methods which are useful for detecting cancer, diagnosing cancer, contributing to a diagnosis of cancer, confirming a diagnosis of cancer, identifying appropriate treatments for cancer, monitoring treatment of cancer, and evaluating treatment protocols for cancer, including ovarian clear cell carcinoma, breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, and prostate cancer.
Get notified when new applications in this technology area are published.
G01N33/5011 » CPC further
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
C12Q2600/156 » CPC further
Oligonucleotides characterized by their use Polymorphic or mutational markers
C12Q1/6886 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
A61K31/711 » CPC further
Medicinal preparations containing organic active ingredients; Carbohydrates; Sugars; Derivatives thereof; Compounds having three or more nucleosides or nucleotides Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
G01N33/50 IPC
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
A61K31/7088 » CPC further
Medicinal preparations containing organic active ingredients; Carbohydrates; Sugars; Derivatives thereof Compounds having three or more nucleosides or nucleotides
This application claims the benefit of Ser. No. 61/379,875 filed on Sep. 3, 2010, which is incorporated herein by reference in its entirety.
This invention was made with government support under OC0400600 awarded by the U.S. Department of Defense and CA121113, CA57345, CA62924, CA129080, CA134292, CA103937, and CA103938 awarded by the National Institutes of Health. The government has certain rights in the invention.
This application incorporates by reference the contents of a 200 kb text file created on Sep. 3, 2010 and named “sequencelisting.txt,” which is the sequence listing for this application.
Each reference cited in this disclosure is incorporated herein by reference in its entirety.
FIGS. 1A-D. Sequence chromatograms of examples of somatic ARID1A and PPP2R1A mutations. FIG. 1A, ARID1A mutation; FIG. 1B, ARID1A mutation; FIG. 1C, PPP2R1A mutation; FIG. 1D, PPP2R1A mutation. Arrows indicate the position of the mutation.
FIGS. 2A-D. Sequence chromatograms of examples of truncating mutations in ARID1A. FIG. 2A, gastric cancer; FIG. 2B, colon cancer; FIG. 2C, breast cancer; FIG. 2D, pancreatic cancer. Arrows indicate the position of the mutation.
This disclosure identifies mutations in two genes: ARID1A (AT-rich interactive domain-containing protein 1A) and PPP2R1A (protein-phosphatase 2, regulatory subunit 1, alpha). This disclosure also provides methods which are useful for detecting cancer, diagnosing cancer, contributing to a diagnosis of cancer, or confirming a diagnosis of cancer, particularly ovarian clear cell carcinoma (OCCC), breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, and prostate cancer. In some embodiments, nucleic acid is obtained from cells of an individual and tested to determine whether either or both of ARID1A and PPP2R1A. ARID1A mutations can be, for example, an insertion, a duplication, a missense mutation, or a deletion. PPP2R1A mutations typically are missense mutations. Examples of these mutations arc provided below. Mutations in ARID1A and PPP2R1A typically are somatic mutations, but this disclosure also encompasses corresponding germline mutations.
Cancer cells which can be detected include, but are not limited to, cells from acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related lymphoma, anal cancer, appendix cancer, grade I (anaplastic) astrocytoma, grade II astrocytoma, grade III astrocytoma, grade IV astrocytoma, atypical teratoid/rhabdoid tumor of the central nervous system, basal cell carcinoma, bladder cancer, breast cancer, breast sarcoma, bronchial cancer, bronchoalveolar carcinoma, Burkitt lymphoma, cervical cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, endometrial cancer, endometrial uterine cancer, ependymoblastoma, ependymoma, esophageal cancer, esthesioneuroblastoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, fibrous histiocytoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gestational trophoblastic tumor, gestational trophoblastic tumor, glioma, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular cancer, Hilar cholangiocarcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell tumor, Kaposi sarcoma, Langerhans cell histiocytosis, large-cell undifferentiated lung carcinoma, laryngeal cancer, lip cancer, lung adenocarcinoma, lymphoma, macroglobulinemia, malignant fibrous histiocytoma, medulloblastoma, medulloepithelioma, melanoma, Merkel cell carcinoma, mesothelioma, endocrine neoplasia, multiple myeloma, mycosis fungoides, myelodysplasia, myelodysplastic/myeloproliferative neoplasms, myeloproliferative disorders, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian clear cell carcinoma, ovarian epithelial cancer, ovarian germ cell tumor, pancreatic cancer, papillomatosis, paranasal sinus cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pineal parenchymal tumor, pincoblastoma, pituitary tumor, plasma cell neoplasm, plasma cell neoplasm, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell cancer, respiratory tract cancer with chromosome 15 changes, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sézary syndrome, small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous non-small cell lung cancer, squamous neck cancer, supratentorial primitive neuroectodermal tumor, supratentorial primitive neuroectodermal tumor, testicular cancer, throat cancer, thymic carcinoma, thymoma, thyroid cancer, cancer of the renal pelvis, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenström macroglobulinemia, and Wilms tumor.
In some embodiments, mutations detected are in ARID1A and cancer cells which can be detected include, but are not limited to, cells from adrenocortical carcinoma, AIDS-related lymphoma, anal cancer, appendix cancer, grade I (anaplastic) astrocytoma, grade II astrocytoma, grade III astrocytoma, grade IV astrocytoma, atypical teratoid/rhabdoid tumor of the central nervous system, basal cell carcinoma, bladder cancer, breast cancer, breast sarcoma, bronchial cancer, bronchoalveolar carcinoma, Burkitt lymphoma, cervical cancer, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, endometrial cancer, endometrial uterine cancer, ependymoblastoma, ependymoma, esophageal cancer, esthesioneuroblastoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, fibrous histiocytoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gestational trophoblastic tumor, gestational trophoblastic tumor, glioma, head and neck cancer, heart cancer, hepatocellular cancer, Hilar cholangiocarcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell tumor, Kaposi sarcoma, Langerhans cell histiocytosis, large-cell undifferentiated lung carcinoma, laryngeal cancer, lip cancer, lung adenocarcinoma, lymphoma, macroglobulinemia, malignant fibrous histiocytoma, medulloblastoma, medulloepithelioma, melanoma, Merkel cell carcinoma, mesothelioma, endocrine neoplasia, multiple myeloma, mycosis fungoides, myelodysplasia, myelodysplastic/myeloproliferative neoplasms, myeloproliferative disorders, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian clear cell carcinoma, ovarian epithelial cancer, ovarian germ cell tumor, pancreatic cancer, papillomatosis, paranasal sinus cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pineal parenchymal tumor, pincoblastoma, pituitary tumor, plasma cell neoplasm, plasma cell neoplasm, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell cancer, respiratory tract cancer with chromosome 15 changes, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sézary syndrome, small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous non-small cell lung cancer, squamous neck cancer, supratentorial primitive neuroectodermal tumor, supratentorial primitive neuroectodermal tumor, testicular cancer, throat cancer, thymic carcinoma, thymoma, thyroid cancer, cancer of the renal pelvis, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenström macroglobulinemia, and Wilms tumor.
In some embodiments, mutations detected are in ARID1A and cancer cells which can be detected include, but are not limited to, cells from adrenocortical carcinoma, AIDS-related lymphoma, anal cancer, appendix cancer, grade I (anaplastic) astrocytoma, grade II astrocytoma, grade III astrocytoma, grade IV astrocytoma, atypical teratoid/rhabdoid tumor of the central nervous system, basal cell carcinoma, bladder cancer, bronchial cancer, bronchoalveolar carcinoma, Burkitt lymphoma, cervical cancer, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, endometrial cancer, endometrial uterine cancer, ependymoblastoma, ependymoma, esophageal cancer, esthesioneuroblastoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, fibrous histiocytoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gestational trophoblastic tumor, gestational trophoblastic tumor, glioma, head and neck cancer, heart cancer, hepatocellular cancer, Hilar cholangiocarcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell tumor, Kaposi sarcoma, Langerhans cell histiocytosis, laryngeal cancer, lip cancer, lymphoma, macroglobulinemia, malignant fibrous histiocytoma, medulloblastoma, medulloepithelioma, melanoma. Merkel cell carcinoma, mesothelioma, endocrine neoplasia, multiple myeloma, mycosis fungoides, myelodysplasia, myelodysplastic/myeloproliferative neoplasms, myeloproliferative disorders, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian clear cell carcinoma, ovarian epithelial cancer, ovarian germ cell tumor, papillomatosis, paranasal sinus cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pineal parenchymal tumor, pineoblastoma, pituitary tumor, plasma cell neoplasm, plasma cell neoplasm, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell cancer, respiratory tract cancer with chromosome 15 changes, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sezary syndrome, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer, supratentorial primitive neuroectodermal tumor, supratentorial primitive neuroectodermal tumor, testicular cancer, throat cancer, thymic carcinoma, thymoma, thyroid cancer, cancer of the renal pelvis, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenström macroglobulinemia, and Wilms tumor.
In some embodiments, mutations detected are in ARID1A and cancer cells which can be detected include, but are not limited to, cells from adrenocortical carcinoma, AIDS-related lymphoma, anal cancer, appendix cancer, grade I (anaplastic) astrocytoma, grade II astrocytoma, grade III astrocytoma, grade IV astrocytoma, atypical teratoid/rhabdoid tumor of the central nervous system, basal cell carcinoma, bladder cancer, bronchial cancer, bronchoalveolar carcinoma, Burkitt lymphoma, cervical cancer, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, endometrial cancer, endometrial uterine cancer, ependymoblastoma, ependymoma, esophageal cancer, esthesioneuroblastoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, fibrous histiocytoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gestational trophoblastic tumor, gestational trophoblastic tumor, glioma, head and neck cancer, heart cancer, hepatocellular cancer, Hilar cholangiocarcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell tumor, Kaposi sarcoma, Langerhans cell histiocytosis, laryngeal cancer, lip cancer, lymphoma, macroglobulinemia, malignant fibrous histiocytoma, medulloepithelioma, melanoma, Merkel cell carcinoma, mesothelioma, endocrine neoplasia, multiple myeloma, mycosis fungoides, myelodysplasia, myelodysplastic/myeloproliferative neoplasms, myeloproliferative disorders, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian clear cell carcinoma, ovarian epithelial cancer, ovarian germ cell tumor, papillomatosis, paranasal sinus cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pineal parenchymal tumor, pineoblastoma, pituitary tumor, plasma cell neoplasm, plasma cell neoplasm, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell cancer, respiratory tract cancer with chromosome 15 changes, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sézary syndrome, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer, supratentorial primitive neuroectodermal tumor, supratentorial primitive neuroectodermal tumor, testicular cancer, throat cancer, thymic carcinoma, thymoma, thyroid cancer, cancer of the renal pelvis, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenström macroglobulinemia, and Wilms tumor.
In some embodiments, mutations detected are in PPP2R1A and cancer cells which can be detected include, but are not limited to, cells from acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related lymphoma, anal cancer, appendix cancer, grade I (anaplastic) astrocytoma, grade IT astrocytoma, grade III astrocytoma, grade IV astrocytoma, atypical teratoid/rhabdoid tumor of the central nervous system, basal cell carcinoma, bladder cancer, bronchial cancer, bronchoalveolar carcinoma, Burkitt lymphoma, cervical cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, endometrial cancer, endometrial uterine cancer, ependymoblastoma, ependymoma, esophageal cancer, esthesioneuroblastoma. Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, fibrous histiocytoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gestational trophoblastic tumor, gestational trophoblastic tumor, glioma, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular cancer, Hilar cholangiocarcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, islet cell tumor, Kaposi sarcoma, Langerhans cell histiocytosis, laryngeal cancer, lip cancer, macroglobulinemia, malignant fibrous histiocytoma, medulloblastoma, medulloepithelioma, Merkel cell carcinoma, mesothelioma, endocrine neoplasia, multiple myeloma, mycosis fungoides, myelodysplasia, myelodysplastic/myeloproliferative neoplasms, myeloproliferative disorders, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian clear cell carcinoma, ovarian epithelial cancer, ovarian germ cell tumor, pancreatic cancer, papillomatosis, paranasal sinus cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pineal parenchymal tumor, pineoblastoma, pituitary tumor, plasma cell neoplasm, plasma cell neoplasm, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell cancer, respiratory tract cancer with chromosome 15 changes, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sézary syndrome, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer, supratentorial primitive neuroectodermal tumor, supratentorial primitive neuroectodermal tumor, testicular cancer, throat cancer, thymic carcinoma, thymoma, thyroid cancer, cancer of the renal pelvis, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenström macroglobulinemia, and Wilms tumor.
In some embodiments nucleic acids are tested to determine whether ARID1A and/or PPP2R1A comprises a mutation. In some embodiments, ARID1A and/or PPP2R1A proteins are tested to determine whether the protein comprises a structural alteration, such as an amino acid substitution or a truncation or deletion of a portion of the protein.
The disclosed methods are useful for individuals whether suspected or not of having cancer or a predisposition to cancer. The individual tested may be healthy and free of family history, may have a family history of cancer, may have a tentative diagnosis of cancer, or may be suspected of having cancer based on a symptom or condition or a previous diagnostic test.
The described methods also are useful for, e.g.:
OCCC
The described methods are useful for detecting OCCC, diagnosing OCCC, contributing to a diagnosis of OCCC, or confirming a diagnosis of OCCC. Among ovarian cancers, OCCC is one of the most aggressive types because, unlike the more common high grade-serous type, it is refractory to standard platinum-based chemotherapy. Previous morphological and molecular studies have indicated that OCCC develops in a stepwise fashion from a common disease progenitor state, endometriosis, and proceeds through atypical endometriosis to frank malignancy (2-6). Activating mutations in PIK3CA (7) and genomic amplification of chr20q13.2 (8) are the most common molecular genetic alterations so far identified in OCCC.
In some embodiments, therefore, the cancer is OCCC. In some embodiments, ARID1A mutations useful for detecting OCCC include mutations listed in Tables 1, S3, and S5, wherein nucleotides are numbered by reference to SEQ ID NO:2.
In some embodiments, ARID1A mutations useful for detecting OCCC are 3854_3855insA; 553C>T; 903_904dupGT; 3659_3684delTGATGGGGCGCATGTCCTATGAGCCA (SEQ ID NO:7); 585C>A; 3391delC; 4001_4002dupGCA; 6828_6829delTG; 1455_1466insCCTAC; 4926_4927insTGGC; 4011_4012delTT; 4635G>A; 5202T>A; 486_492delCGCCGCC; 3575delA; 3223delG; 6718dupG; 898_899insCGTC; 6710_6711insT; 1663C>T; 782_791delCGTCGTCTTC (SEQ ID NO:8); 3634_3644delCAGCCCAGTAT (SEQ ID NO:9); 1873C>T; 2122C>T; 1804G>T; 6702delT; 1341T>G; 3442delC; 883dupC; 2868delC; 1881delT; 2179_2188delCGGCCACCCA (SEQ ID NO: 10); 608dupA; 1626_1627delGC; 3994C>T; 6791C>G; 6625delC; 289G>T; 1650dupC; and 2272delC, wherein nucleotides are numbered by reference to SEQ ID NO:2.
In some embodiments, ARID1A mutations useful for detecting OCCC are 3854_3855insA; 553C>T; 903_904dupGT; 3659_3684delTGATGGGGCGCATGTCCTATGAGCCA (SEQ ID NO:7); 585C>A; 3391delC; 4001_4002dupGCA; 6828_6829delTG; 1455_1466insCCTAC; 4926_4927insTGGC; 4011_4012delTT; 4635G>A; 5202T>A; 486_492delCGCCGCC; 3575delA; 3223delG; 6718dupG; 898_899insCGTC; 6710_6711insT; 1663C>T; 782_791delCGTCGTCTTC (SEQ ID NO:8); 3634_3644delCAGCCCAGTAT (SEQ ID NO:9); 1873C>T; 2122C>T; 1804G>T; 6702delT; 1341T>G; 3442delC; 883dupC; 2868delC; 1881delT; and 2179_2188delCGGCCACCCA (SEQ ID NO: 10), wherein nucleotides are numbered by reference to SEQ ID NO:2.
In some embodiments PPP2R12A mutations useful for detecting OCCC include mutations listed in Tables 1 and S5, wherein nucleotides are numbered by reference to SEQ ID NO:5.
In some embodiments PPP2R12A mutations useful for detecting OCCC are 547C>G, 547C>T, 547C>T, and 548G>A, wherein nucleotides are numbered by reference to SEQ ID NO:5.
In some embodiments PPP2R12A mutations useful for detecting OCCC are 547C>G, 547C>T, and 547C>T, wherein nucleotides are numbered by reference to SEQ ID NO:5.
Breast Cancer
In some embodiments the cancer is breast cancer. In some embodiments ARID1A mutations useful for detecting breast cancer include those listed in Table 2, wherein nucleotides are numbered by reference to SEQ ID NO:2.
In some embodiments ARID1A mutations useful for detecting breast cancer are 1323delC, 6259G>A, 5719A>T, and 2830C>T, wherein nucleotides are numbered by reference to SEQ ID NO:2.
Colon Cancer
In some embodiments the cancer is colon cancer. In some embodiments ARID1A mutations useful for detecting colon cancer include those listed in Table 2, wherein nucleotides are numbered by reference to SEQ ID NO:2.
In some embodiments ARID1A mutations useful for detecting colon cancer are 1014delG, 4689delC, 3281delA, 3344delC, 5548delG, 4354delC, 5548delG, 5548delG, 5548dupG, 1848delC, 2944_2946delAAC, 1657C>T, 62280C>A, 5838_5844dupACAGAGC, 5834_5835insAGCACAG, and 2467_2468dupTA, wherein nucleotides are numbered by reference to SEQ ID NO:2.
Gastric Cancer
In some embodiments the cancer is gastric cancer. In some embodiments ARID1A mutations useful for detecting gastric cancer include those listed in Table 2, wherein nucleotides are numbered by reference to SEQ ID NO:2.
In some embodiments ARID1A mutations useful for detecting gastric cancer are 879dupC, 827delG, 4743_4744delCA, 5548delG, 4972C>T, 5359G>T, 5548delG, 4524T>A, 5548delG, 6420delC, 2357dupG, 854delG, 969_975delGGGCGCC, wherein nucleotides are numbered by reference to SEQ ID NO:2.
Lung Cancer
In some embodiments the cancer is lung cancer. In some embodiments ARID1A mutations useful for detecting lung cancer include those listed in Table 2, wherein nucleotides are numbered by reference to SEQ ID NO:2.
In some embodiments ARID1A mutations useful for detecting lung cancer are 2834delG and 6403_6408delATTCTG, wherein nucleotides are numbered by reference to SEQ ID NO:2.
Brain Cancer
In some embodiments the cancer is brain cancer (e.g., medulloblastoma, grade I (anaplastic) astrocytoma, grade II astrocytoma, grade III astrocytoma, grade IV astrocytoma, atypical teratoid/rhabdoid tumor of the central nervous system, neuroblastoma).
In some embodiments ARID1A mutations useful for detecting brain cancer, particularly medulloblastoma, include those listed in Table 2, wherein nucleotides are numbered by reference to SEQ ID NO:2.
In some embodiments ARID1A mutations useful for detecting brain cancer, particularly medulloblastoma, are 1015delG, 4893_4894InsC, and 5012delG, wherein nucleotides are numbered by reference to SEQ ID NO:2.
In some embodiments ARID1A mutations useful for detecting medulloblastoma are 4893_4894InsC and 5012delG, wherein nucleotides are numbered by reference to SEQ ID NO:2.
Pancreatic Cancer
In some embodiments the cancer is pancreatic cancer. In some embodiments ARID1A mutations useful for detecting pancreatic cancer include those listed in Table 2, wherein nucleotides are numbered by reference to SEQ ID NO:2.
In some embodiments ARID1A mutations useful for detecting pancreatic cancer are 3826C>T, 5947_5948delTG, IVS10+1G>A, 1945_1946insT, 2296dupC, 5965C>T, 5965C>T, 6287C>G, 1585C>T, 5548dupG, and 2402delG, wherein nucleotides are numbered by reference to SEQ ID NO:2.
In some embodiments ARID1A mutations useful for detecting pancreatic cancer are IVS10+1G>A, 1945_1946insT, 2296dupC, 5965C>T, 5965C>T, 6287C>G, 1585C>T, 5548dupG, and 2402delG, wherein nucleotides are numbered by reference to SEQ ID NO:2.
Prostate Cancer
In some embodiments the cancer is prostate cancer. In some embodiments ARID1A mutations useful for detecting prostate cancer include those listed in Table 2, wherein nucleotides are numbered by reference to SEQ ID NO:2.
In some embodiments ARID1A mutations useful for detecting prostate cancer are 3977delC, 5548dupG, and 3999_4101delGCA, wherein nucleotides are numbered by reference to SEQ ID NO:2.
Individuals to be Tested
Individuals to be tested include those suspected of having a cancer, as well as individuals who have no apparent signs of cancer. Individuals to be tested can be asymptomatic or may have one or more symptoms of a cancer.
In some embodiments the individual has a symptom of ovarian cancer, including OCCC, such as an accumulation of ascites fluid, and/or a predisposing condition such as endometriosis.
In some embodiments the individual has a symptom of breast cancer, such as a breast lump or thickening, bloody discharge from the nipple, change in size or shape of a breast, changes to the skin over the breast (such as dimpling), inverted nipple, peeling, scaling or flaking of the nipple or breast skin; and redness or pitting of the skin over the breast.
In some embodiments the individual has a symptom of colon cancer, such as a change in bowel habits, including diarrhea or constipation, a change in stool consistency, rectal bleeding, and persistent abdominal discomfort, such as cramps, gas, or pain.
In some embodiments the individual has a symptom of gastric cancer, including abdominal fullness or pain, dark stools, difficulty swallowing, excessive belching, general decline in health, loss of appetite, nausea and vomiting, premature abdominal fullness after meals, vomiting blood, weakness or fatigue, and unintentional weight loss.
In some embodiments the individual has a symptom of lung cancer, including persistent cough, coughing up blood, shortness of breath, wheezing, chest pain, loss of appetite, and unintended weight loss.
In some embodiments the individual has a symptom of brain cancer, including headache; seizure; confusion or other changes in mental function; change in alertness (including sleepiness, unconsciousness, and coma); changes in sensory functions (hearing, taste, smell); difficulty swallowing, writing, walking, or reading; dizziness or vertigo; asymmetric pupils; uncontrollable movements; tremors; muscle weakness; numbness or tingling; personality, mood, behavioral, or emotional changes; and problems with eyesight, including decreased vision, double vision, or total loss of vision.
In some embodiments the individual has a symptom of pancreatic cancer, including pain or discomfort in the upper part of the belly or abdomen, loss of appetite and weight loss, jaundice, dark mine, clay-colored stools, fatigue, weakness, nausea, and vomiting.
In some embodiments the individual has a symptom of prostate cancer, such as delayed or slowed start of urinary stream; dribbling or leakage of urine, most often after urinating; slow urinary stream; straining when urinating, or not being able to empty out all of the urine; or blood in the urine or semen.
In some embodiments the described methods can be used to monitor an individual who has one or more risk factors for developing a cancer. One can readily identify individuals with an increased risk or family history of cancer, such as OCCC, breast cancer, colon cancer, gastric cancer, lung cancer, brain cancer (e.g., medulloblastoma), pancreatic cancer, and prostate cancer. Typically, inquiries are made about an individual's family history of the cancer. If two or more first-degree relatives (sibling-sibling or parent-child) or second-degree relatives (uncle/aunt-cousin, grandparent-grandchild, etc.) in a family have been diagnosed with the cancer, then individuals in the family can be identified as having a family history of the cancer and/or as having an increased risk of developing the cancer.
Other recognized indices of elevated risk of various cancers can be determined by standard clinical tests or medical history. For example, in some embodiments, an individual has a predisposing condition such as Helicobacter pylori infection, history of an adenomatous gastric polyp larger than 2 centimeters, history of chronic atrophic gastritis, history of pernicious anemia, or smoking, intestinal polyps, a history of smoking, exposure to second-hand smoke, high levels of air pollution, high levels of arsenic in drinking water, exposure to radon gas or asbestos, radiation therapy (e.g., to the lungs or brain), an inherited condition with an increased risk of brain tumors, such as neurofibromatosis, Von Hippel-Lindau syndrome, Li-Fraumeni syndrome, and Turcot syndrome, obesity, age, sex, exposure to agent orange or cadmium, alcohol abuse, and high fat diet.
Methods of Detecting Mutations
Methods of detecting mutations in PPP2R1A or ARID1A are useful for a variety of purposes, including, but not limited to, detecting cancer, diagnosing cancer, contributing to a diagnosis of cancer, confirming a diagnosis of cancer, identifying appropriate treatments for cancer, monitoring treatment of cancer, and evaluating treatment protocols for cancer, including ovarian clear cell carcinoma, breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, and prostate cancer.
A biological sample, i.e., tissue or fluid, can be tested for a mutation in PPP2R1A or ARID1A or for diminished expression from ARID1A or for overexpression from PPP2R1A. In non-tumor samples, a detected mutation is likely to be a germline mutation. The biological sample can be obtained by any suitable means, including biopsy, surgery, and aspiration of an appropriate fluid. Biological samples which can be tested include without limitation suspected cancerous tissues, stool, sputum, and biological fluids such as tears, saliva, blood, plasma, serum, urine, ascites, and bronchoalveolar lavage. Cells which can be tested include, but are not limited to, neurons, glia, skin, blood cells, bone cells, colorectal cells, heart cells, lung cells, stomach cells, smooth muscle cells, striated muscle cells, thymus cells, thyroid cells, ovarian cells, uterine cells, kidney cells, and breast cells.
Obtaining Cells
Cells to be tested can be obtained from individuals using methods well known in the art. For example, in some embodiments ovarian cells are obtained by biopsy (e.g., Papanicolaou or “Pap” smear). In other embodiments, ovarian cells are obtained from a fluid sample. For example, a sample of ascites fluid can be obtained using needle aspiration. Culdocentesis can be used to obtain fluid from the space surrounding the ovaries. Paracentesis can be used to remove fluid from the abdominal cavity.
Cells can be obtained from patients suspected of having breast cancer using procedures such as fine needle aspiration (FNA), core biopsy (e.g., ultrasound-guided core biopsy and stereotactic biopsy), open excisional biopsy, and sentinel node biopsy.
Cells can be obtained from patients suspected of having colon cancer by biopsy during colonoscopy, flexible sigmoidoscopy, or surgery.
Cells can be obtained from patients suspected of having gastric cancer by biopsy during endoscopy.
Cells can be obtained from patients suspected of having lung cancer by taking a biopsy during bronchoscopy or by needle biopsy.
Cells can be obtained from patients suspected of having brain cancer by biopsy during surgery or from a sample of cerebrospinal fluid.
Cells can be obtained from patients suspected of having pancreatic cancer using FNA or brush biopsy.
Cells can be obtained from patients suspected of having prostate cancer by transrectal, transurethral, or transperineal biopsy.
Reference Sequences
The reference genomic DNA sequence for ARID1A is provided in SEQ ID NO:1. The reference cDNA (coding) sequence for ARID1A is provided in SEQ ID NO:2. The reference amino acid sequence of ARID1A protein is provided in SEQ ID NO:3.
The reference genomic DNA sequence for PPP2R1A is provided in SEQ ID NO:4. The reference cDNA (coding) sequence for PPP2R1A is provided in SEQ ID NO:5. The reference amino acid sequence of PPP2R1A protein is provided in SEQ ID NO:6.
Nucleic Acids
Isolated nucleic acids (e.g., DNA) comprising a portion of an PPP2R1A or ARID1A gene sequence comprising one of the mutations identified in Tables 1, S3, S5, and 2 can be used as primers or probes for mutation detection. The isolated nucleic acids may have 17, 18, 19, 20, 21, 25 or 30 to about 100, 200, 300, 400 or 500 consecutive nucleotides of ARID1A genomic DNA or cDNA, spanning and/or containing one of the mutations identified in Tables 1, S3, S5, and 2. For example, isolated nucleic acids may have from 18, 19, 20 or 21 to about 100, 200, 300 400 or 500 nucleotides comprising at least 18, 19, 20 or 21 consecutive nucleotides spanning nucleotides 3659-3684, 3854-3855, 553, 903-904, 585, or 3391 numbered according to ARID1A cDNA (SEQ ID NO:2) or nucleotide 547 numbered according to PPP2R1A cDNA (SEQ ID NO:5). Pairs of primers can be used to amplify portions of PPP2R1A or ARID1A that comprise the disclosed mutations.
Mutations in PPP2R1A and ARID1A include deletions, insertions, duplications, substitutions (missense or nonsense mutations), etc. Such mutations, alterations, and defects can be detected inter alia by comparing to a wild type in another (non-tumor) tissue of an individual or by comparing to reference sequences, for example in databases or as provided in this disclosure. Mutations that are found in all tissues of an individual are genomic mutations, whereas those that occur only in tumor tissue are somatic mutations. Examples of PPP2R1A and ARID1A mutations include those in Table 1 and Table S3. Other examples of PPP2R1A and ARID1A mutations include those in Table S5. Other examples of ARID1A mutations include those in Table 2.
In various embodiments, mutations in the PPP2R1A and ARID1A genes, alterations in PPP2R1A and ARID1A gene expression, or structural alterations in PPP2R1A and ARID1A proteins can be analyzed in a patient sample by any suitable technique known in the art which is sufficiently sensitive. Non-limiting examples are described below.
Techniques involving genomic DNA, mRNA, or cDNA can be used. In a nucleic acid-based detection method, genomic DNA is first obtained (using any standard technique) from ovarian cells of an individual to be tested. If appropriate. cDNA can be prepared or mRNA can be obtained. In some embodiments, nucleic acids can be amplified by any known nucleic acid amplification technique such as PCR, to a sufficient quantity and purity, and further analyzed to detect mutations. For example, genomic DNA can be isolated from a sample, and all exonic sequences and the intron/exon junction regions including the regions required for exon/intron splicing can be amplified into one or more amplicons, and further analyzed for the presence or absence of mutations.
Nucleotide sequencing methods can be used to detect the presence or absence of mutations. Various sequencing techniques are generally known and widely used in the art including the Sanger method and Gilbert chemical method. Pyrosequencing monitors DNA synthesis in real time using a luminometric detection system. Pyrosequencing has been shown to be effective in analyzing genetic polymorphisms such as single-nucleotide polymorphisms and thus can also be used. See Nordstrom et al., Biotechnol. Appl. Biochem., 31(2): 107-112 (2000); Ahmadian et al., Anal. Biochem., 280:103-110 (2000). The obtained sequence is then compared to a wild-type reference sequence such as the reference sequences identified in Table S3 and provided in this disclosure.
Mutation scanning in a target gene can also be carried out using denaturing high pressure liquid chromatography (dHPLC). Specifically, the target gene is first amplified by PCR into different amplicons, and each amplicon is analyzed by dHPLC to detect the presence or absence of heterozygosity in each amplicon. The heterozygous amplicons thus identified are further sequenced to detect mutations. See, e.g., Cao et al., Breast Cancer Res Treat., 114(3):457-62 (2009).
High resolution melting analysis can also be used in the disclosed methods. Like dHPLC, PCR amplification is used to produce amplicons from the target gene, and each amplicon is analyzed by high resolution melting analysis to detect the presence or absence of heterozygosity in each amplicon. The heterozygous amplicons thus identified are further sequenced to detect mutations. See, e.g., Jiménez et al., Clin Biochem., 42(15): 1572-6 (2009).
Restriction fragment length polymorphism (RFLP) and amplified fragment length polymorphism (AFLP) methods may also be useful techniques. In particular, if a mutation in the target nucleic acid region results in the elimination or creation of a restriction enzyme recognition site, then digestion of the target DNA with that particular restriction enzyme will generate an altered restriction fragment length pattern. Thus, a detected RFLP or AFLP will indicate the presence of a mutation.
Another useful approach is the single-stranded conformation polymorphism assay (SSCA), which is based on the altered mobility of a single-stranded target DNA spanning the mutations of interest. A single nucleotide change in the target sequence can result in different intramolecular base pairing pattern, and thus different secondary structure of the single-stranded DNA, which can be detected in a non-denaturing gel. See Orita et al., Proc. Natl. Acad. Sci. USA, 86:2776-2770 (1989). Denaturing gel-based techniques such as clamped denaturing gel electrophoresis (CDGE) and denaturing gradient gel electrophoresis (DGGE) detect differences in migration rates of mutant sequences as compared to wild-type sequences in denaturing gel. See Miller et al., Biotechniques, 5:1016-24 (1999); Sheffield et al., Am. J. Hum. Genet., 49:699-706 (1991); Wartell et al., Nucleic Acids Res., 18:2699-2705 (1990); and Sheffield et al., Proc. Natl. Acad. Sci. USA, 86:232-236 (1989). In addition, the double-strand conformation analysis (DSCA) can also be useful. See Arguello et al., Nat. Genet., 18:192-194 (1998).
The presence or absence of a mutation at a particular locus in a genomic region of an individual can also be detected using the amplification refractory mutation system (ARMS) technique. See e.g., European Patent No. 0,332,435; Newton et al., Nucleic Acids Res., 17:2503-2515 (1989); Fox et al., Br. J. Cancer, 77:1267-1274 (1998); Robertson et al., Eur. Respir. J., 12:477-482 (1998). In the ARMS method, a primer is synthesized matching the nucleotide sequence immediately 5′ upstream from the locus being tested except that the 3′-end nucleotide which corresponds to the nucleotide at the locus is a predetermined nucleotide. For example, the 3′-end nucleotide can be the same as that in the mutated locus. The primer can be of any suitable length so long as it hybridizes to the target DNA under stringent conditions only when its 3′-end nucleotide matches the nucleotide at the locus being tested. Preferably the primer has at least 12 nucleotides, more preferably from about 18 to 50 nucleotides. If the individual tested has a mutation at the locus and the nucleotide therein matches the 3′-end nucleotide of the primer, then the primer can be further extended upon hybridizing to the target DNA template, and the primer can initiate a PCR amplification reaction in conjunction with another suitable PCR primer. In contrast, if the nucleotide at the locus is of wild type, then primer extension cannot be achieved. Various forms of ARMS techniques can be used. See e.g., Gibson et al., Clin. Chem. 43:1336-1341 (1997).
Similar to the ARMS technique is the mini sequencing or single nucleotide primer extension method, which is based on the incorporation of a single nucleotide. An oligonucleotide primer matching the nucleotide sequence immediately 5′ to the locus being tested is hybridized to the target DNA or mRNA in the presence of labeled dideoxyribonucleotides. A labeled nucleotide is incorporated or linked to the primer only when the dideoxyribonucleotides matches the nucleotide at the variant locus being detected. Thus, the identity of the nucleotide at the variant locus can be revealed based on the detection label attached to the incorporated dideoxyribonucleotides. See Syvanen et al., Genomics, 8:684-692 (1990); Shumaker et al., Hum. Mutat., 7:346-354 (1996); Chen et al., Genome Res., 10:549-547 (2000).
Another set of useful techniques are oligonucleotide ligation assays (OLA) in which differentiation between a wild-type locus and a mutation is based on the ability of two oligonucleotides to anneal adjacent to each other on the target DNA molecule allowing the two oligonucleotides joined together by a DNA ligase. See Landergren et al., Science, 241:1077-1080 (1988); Chen et al. Genome Res., 8:549-556 (1998); Iannone et al., Cytometry, 39:131-140 (2000). Thus, for example, to detect a single-nucleotide mutation at a particular locus in a genomic region, two oligonucleotides can be synthesized, one having the genomic sequence just 5′ upstream from the locus with its 3′ end nucleotide being identical to the nucleotide in the variant locus, the other having a nucleotide sequence matching the genomic sequence immediately 3′ downstream from the variant locus. The oligonucleotides can be labeled for the purpose of detection. Upon hybridizing to the target nucleic acid under a stringent condition, the two oligonucleotides are subject to ligation in the presence of a suitable ligase. The ligation of the two oligonucleotides would indicate that the target DNA has a mutation at the locus being detected.
Detection of mutations can also be accomplished by a variety of hybridization-based approaches. For example, allele-specific oligonucleotides are useful. See Conner et al., Proc. Natl. Acad. Sci. USA, 80:278-282 (1983); Saiki et al, Proc. Natl. Acad. Sci. USA, 86:6230-6234 (1989). Oligonucleotide probes (allele-specific) hybridizing specifically to an allele having a particular mutation at a particular locus but not to other alleles can be designed by methods known in the art. The probes can have a length of, e.g., from 10 to about 50 nucleotide bases. The target DNA and the oligonucleotide probe can be contacted with each other under conditions sufficiently stringent such that the mutations can be distinguished from the alternative variant/allele at the same locus based on the presence or absence of hybridization. The probe can be labeled to provide detection signals. Alternatively, an allele-specific oligonucleotide probe can be used as a PCR amplification primer in an “allele-specific PCR” and the presence or absence of a PCR product of the expected length would indicate the presence or absence of a particular mutation.
Other useful hybridization-based techniques allow two single-stranded nucleic acids annealed together even in the presence of mismatch due to nucleotide substitution, insertion or deletion. The mismatch can then be detected using various techniques. For example, the annealed duplexes can be subjected to electrophoresis. A mismatched duplex can be detected based on an electrophoretic mobility that is different from that of a perfectly matched duplex. See Cariello, Human Genetics, 42:726 (1988). Alternatively, in a RNase protection assay, a RNA probe can be prepared spanning the mutations site to be detected and having a detection marker. See Giunta et al., Diagn. Mol. Path., 5:265-270 (1996); Finkelstein et al., Genomics. 7:167-172 (1990); Kinzler et al., Science 251:1366-1370 (1991). The RNA probe can be hybridized to the target DNA or mRNA forming a heteroduplex that is then subject to the ribonuclease RNase A digestion. RNase A digests the RNA probe in the heteroduplex only at the site of mismatch. The digestion can be determined on a denaturing electrophoresis gel based on size variations. In addition, mismatches can also be detected by chemical cleavage methods known in the art. See e.g., Roberts et al., Nucleic Acids Res., 25:3377-3378 (1997).
A great variety of improvements and variations have been developed in the art on the basis of the above-described basic techniques, and can all be useful in detecting mutations. For example, the “sunrise probes” or “molecular beacons” utilize the fluorescence resonance energy transfer (FRET) property and give rise to high sensitivity. See Wolf et al., Proc. Nat. Acad. Sci. USA, 85:8790-8794 (1988). Typically, a probe spanning the nucleotide locus to be detected is designed into a hairpin-shaped structure and labeled with a quenching fluorophore at one end and a reporter fluorophore at the other end. In its natural state, the fluorescence from the reporter fluorophore is quenched by the quenching fluorophore due to the proximity of one fluorophore to the other. Upon hybridization of the probe to the target DNA, the 5′ end is separated apart from the 3′-end and thus fluorescence signal is regenerated. See Nazarenko et al., Nucleic Acids Res., 25:2516-2521 (1997); Rychlik et al., Nucleic Acids Res., 17:8543-8551 (1989); Sharkey et al., Bio/Technology 12:506-509 (1994); Tyagi et al., Nat. Biotechnol., 14:303-308 (1996); Tyagi et al., Nat. Biotechnol., 16:49-53 (1998). A homo-tag assisted non-dimer system (HANDS) can be used in combination with the molecular beacon methods to suppress primer-dimer accumulation. See Brownie et al., Nucleic Acids Res., 25:3235-3241 (1997).
A dye-labeled oligonucleotide ligation assay, which is a FRET-based method that combines the OLA assay and PCR, can be used. See Chen et al., Genome Res. 8:549-556 (1998). TaqMan is another FRET-based method for detecting mutations. A TaqMan probe can be an oligonucleotide designed to have the nucleotide sequence of the human nucleic acid spanning the variant locus of interest and to differentially hybridize with different alleles. The two ends of the probe are labeled with a quenching fluorophore and a reporter fluorophore, respectively. The TaqMan probe is incorporated into a PCR reaction for the amplification of a target nucleic acid region containing the locus of interest using Taq polymerase. Because Taq polymerase exhibits 5′-3′ exonuclease activity but has no 3′-5′ exonuclease activity, if the TaqMan probe is annealed to the target DNA template, the 5′-end of the TaqMan probe will be degraded by Taq polymerase during the PCR reaction thus separating the reporting fluorophore from the quenching fluorophore and releasing fluorescence signals. See Holland et al., Proc. Natl. Acad. Sci. USA, 88:7276-7280 (1991); Kalinina et al., Nucleic Acids Res., 25:1999-2004 (1997); Whitcombe et al., Clin. Chem., 44:918-923 (1998).
Chemiluminescence-based techniques can be used. For example, an oligonucleotide probe can be designed to hybridize to either the wild-type or a variant locus but not both. The probe is labeled with a highly chemiluminescent acridinium ester. Hydrolysis of the acridinium ester destroys chemiluminescence. The hybridization of the probe to the target DNA prevents the hydrolysis of the acridinium ester. Therefore, the presence or absence of a particular mutation in the target DNA is determined by measuring chemiluminescence changes. See Nelson et al., Nucleic Acids Res., 24:4998-5003 (1996).
The detection of mutations can also be based on the “base excision sequence scanning” (BESS) technique. The BESS method is a PCR-based mutation scanning method. BESS T-Scan and BESS G-Tracker are generated which are analogous to T and G ladders of dideoxy sequencing. Mutations are detected by comparing the sequence of normal and mutant DNA. See, e.g., Hawkins et al., Electrophoresis, 20:1171-1176 (1999).
Mass spectrometry can be used. See Graber et al., Curr. Opin. Biotechnol., 9:14-18 (1998). For example, in the primer oligo base extension (PROBE™) method, a target nucleic acid is immobilized to a solid-phase support. A primer is annealed to the target immediately 5′ upstream from the locus to be analyzed. Primer extension is carried out in the presence of a selected mixture of deoxyribonucleotides and dideoxyribonucleotides. The resulting mixture of newly extended primers is then analyzed by MALDI-TOF. See e.g., Monforte et al., Nat. Med., 3:360-362 (1997).
Microchip or microarray technologies are also applicable to the disclosed methods as will be apparent to a skilled artisan in view of this disclosure. For example, isolated genomic DNA can be prepared and hybridized to a DNA microchip having probes designed based on the target gene sequence.
As is apparent from the above survey of the suitable detection techniques, it may or may not be necessary to amplify the target nucleic acid, i.e., the genomic region of interest, or the corresponding cDNA or mRNA to increase the number of target molecules, depending on the detection techniques used. For example, most PCR-based techniques combine the amplification of a portion of the target and the detection of the mutations. PCR amplification is well known in the art and is disclosed in U.S. Pat. Nos. 4,683,195 and 4,800,159. For non-PCR-based detection techniques, if necessary, the amplification can be achieved by, e.g., in vivo plasmid multiplication, or by purifying the target DNA from a large amount of tissue or cell samples. See generally, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989. However, even with scarce samples, many sensitive techniques have been developed in which small genetic variations such as single-nucleotide substitutions can be detected without having to amplify the target DNA in the sample. For example, techniques have been developed that amplify the signal as opposed to the target DNA by, e.g., employing branched DNA or dendrimers that can hybridize to the target DNA. The branched or dendrimer DNAs provide multiple hybridization sites for hybridization probes to attach thereto thus amplifying the detection signals. See Detmer et al., J. Clin. Microbiol., 34:901-907 (1996); Collins et al., Nucleic Adds Res., 25:2979-2984 (1997); Horn et al., Nucleic Acids Res., 25:4835-4841 (1997); Horn et al., Nucleic Acids Res., 25:4842-4849 (1997); Nilsen et al., J. Theor. Biol., 187:273-284 (1997).
In yet another technique for detecting mutations, the INVADER® assay utilizes a novel linear signal amplification technology that improves upon the long turnaround times required of the typical PCR DNA sequenced-based analysis. See Cooksey et al., Antimicrobial Agents and Chemotherapy 44:1296-1301 (2000). This assay is based on cleavage of a unique secondary structure formed between two overlapping oligonucleotides that hybridize to the target sequence of interest to form a “flap.” Each “flap” then generates thousands of signals per hour. Thus, the results of this technique can be easily read, and the methods do not require exponential amplification of the DNA target. The INVADER® system utilizes two short DNA probes, which are hybridized to a DNA target. The structure formed by the hybridization event is recognized by a special cleavase enzyme that cuts one of the probes to release a short DNA “flap.” Each released “flap” then binds to a fluorescently-labeled probe to form another cleavage structure. When the cleavase enzyme cuts the labeled probe, the probe emits a detectable fluorescence signal. See e.g. Lyamichev et al., Nat. Biotechnol., 17:292-296 (1999).
The rolling circle method is another method that avoids exponential amplification. Lizardi et al., Nature Genetics, 19:225-232 (1998). For example, SNIPER™, a commercial embodiment of this method, is a sensitive, high-throughput SNP scoring system designed for the accurate fluorescent detection of specific variants. For each mutation, two linear, allele-specific probes are designed. The two allele-specific probes are identical with the exception of the 3′-base, which is varied to complement the variant site. In the first stage of the assay, target DNA is denatured and then hybridized with a pair of single, allele-specific, open-circle oligonucleotide probes. When the 3′-base exactly complements the target DNA, ligation of the probe will preferentially occur. Subsequent detection of the circularized oligonucleotide probes is by rolling circle amplification, whereupon the amplified probe products are detected by fluorescence. See Clark and Pickering, Life Science News 6, 2000, Amersham Pharmacia Biotech (2000).
Techniques that avoid amplification all together include, e.g., surface-enhanced resonance Raman scattering (SERRS), fluorescence correlation spectroscopy, and single-molecule electrophoresis. In SERRS, a chromophore-nucleic acid conjugate is absorbed onto colloidal silver and is irradiated with laser light at a resonant frequency of the chromophore. See Graham et al., Anal. Chem., 69:4703-4707 (1997). The fluorescence correlation spectroscopy is based on the spatio-temporal correlations among fluctuating light signals and trapping single molecules in an electric field. See Eigen et al., Proc. Natl. Acad. Sci. USA, 91:5740-5747 (1994). In single-molecule electrophoresis, the electrophoretic velocity of a fluorescently tagged nucleic acid is determined by measuring the time required for the molecule to travel a predetermined distance between two laser beams. See Castro et al., Anal. Chem., 67:3181-3186 (1995).
In addition, the allele-specific oligonucleotides (ASO) can also be used in in situ hybridization using tissues or cells as samples. The oligonucleotide probes which can hybridize differentially with the wild-type gene sequence or the gene sequence harboring a mutation may be labeled with radioactive isotopes, fluorescence, or other detectable markers. In situ hybridization techniques are well known in the art and their adaptation to the disclosed methods for detecting the presence or absence of a mutation in a genomic region of a particular individual should be apparent to a skilled artisan in view of this disclosure.
Proteins
Protein-based detection techniques may also prove to be useful, especially when the mutations causes amino acid substitutions or deletions or insertions or frameshift that affect the protein primary, secondary or tertiary structure. To detect the amino acid variations, protein sequencing techniques may be used. Alternatively, the recently developed HPLC-microscopy tandem mass spectrometry technique can be used for determining the amino acid sequence variations. See Gatlin et al., Anal. Chem., 72:757-763 (2000).
Other useful protein-based detection techniques include immunoaffinity assays based on antibodies selectively immunoreactive with mutant proteins or specifically with wild-type proteins. Antibodies can be used to immunoprecipitate specific proteins from solution samples or to immunoblot proteins separated by, e.g., polyacrylamide gels. Immunocytochemical methods can also be used in detecting specific protein in tissues or cells. Other well-known antibody-based techniques can also be used including, e.g., enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunoradiometric assays (IRMA) and immunoenzymatic assays (IEMA), including sandwich assays using monoclonal or polyclonal antibodies. See e.g., U.S. Pat. Nos. 4,376,110 and 4,486,530.
Antibodies (or fragments thereof) can be employed histologically—e.g., IHC, immunofluorescence or immunoelectron microscopy—for in situ detection of peptides encoded by nucleic acids of interest. In situ detection can be accomplished by removing a histological specimen from a patient, and applying thereto a labeled antibody. The antibody (or its fragment) is preferably applied by overlaying the labeled antibody (or fragment) onto a biological sample. Through the use of such a procedure, it is possible to determine not only the presence and amount of the expression product of a target gene, but also its distribution in the examined tissue. A skilled artisan will readily perceive that any of a wide variety of histological methods (e.g., staining procedures) can be modified to achieve such in situ detection.
U.S. Pat. No. 5,965,377 discloses an antibody-based method for determining the presence of mutated protein in cells expressing the protein, wherein the normal protein contains amino-terminus and carboxy-terminus regions and wherein the mutated protein is typically a foreshortened protein from which carboxy-terminus regions are missing. This method can be adapted to detect truncation mutations in PPP2R1A or ARID1A proteins. Specifically, an antibody reactive with the N-terminus of the target protein and an antibody reactive with the C-terminus of the target protein are used to react with a cell sample, and the ratio between the reactivity with the C-terminus and N-terminus can be obtained. If the reactivity with the C-terminus is about zero or no greater than about half of the reactivity with the N-terminus in the sample, it would indicate the presence of a truncation mutation in the gene. The antibody reactivity can be measured by any suitable immunoassays, e.g., immunohistochemistry (IHC) and ELISA.
The antibody based methods described above can also be used to determine generally the expression level of PPP2R1A and ARID1A, as will be apparent to skilled artisan.
For purposes of detecting a reduced level of gene expression, either mRNA or protein level in a sample from a patient can be determined by conventional methods known in the art. Protein expression level in a sample can be determined using an immunoassay described above. For mRNA level, typically hybridization of DNA probes or primers is utilized. For example, for mRNA expression level, qRT-PCT can be used. mRNA can be isolated from a particular sample, and the target gene mRNA, and preferably in addition, a reference gene mRNA (typically a housekeeping gene), are amplified by qRT-PCR, and the relative amount of the target gene mRNA is determined, which is compared to a predetermined reference standard level (e.g., an average level determined in a plurality of normal samples). Alternatively, digital PCR is also useful.
Additionally, gene expression levels can also be detected indirectly by determining the methylation status of the target gene. If the target gene is methylated at a greater extent than normal, then the target gene expression is usually reduced. Methods for determining gene methylation status are well known in the art.
Additional Diagnostic Tests
In some embodiments one or more other diagnostic tests can follow a disclosed method. In some embodiments one or more other diagnostic tests can be performed in conjunction with a disclosed method.
Diagnostic tests for OCCC include imaging studies (e.g., ultrasound, CT scan, endoscopic ultrasound), blood tests (e.g., CA125 testing), microscopic examination of cells obtained from fluid (e.g., ascites fluid, fluid from the space surrounding the ovaries, or fluid from the abdominal cavity) and biopsies (e.g., percutaneous needle biopsy or Papanicolaou smear).
Diagnostic tests for breast cancer include mammograms, ultrasound, MRI, CAT scans, PET scans, and biopsies.
Diagnostic tests for colon cancer include colonoscopies (including high-definition colonoscopy and virtual colonoscopy) and biopsies.
Diagnostic tests for gastric cancer include esophagogastroduodenoscopy (EGD), biopsy, and imaging studies (e.g., upper GI series).
Diagnostic tests for lung cancer include chest x-ray, sputum cytology test, CT scan, MRI, PET scan, bronchoscopy combined with biopsy, pleural biopsy, CT-scan-directed needle biopsy, mediastinoscopy with biopsy, and open lung biopsy.
Diagnostic tests for brain cancer include CT scans. EEGs, examination of cerebral spinal fluid, MRIs, and biopsy.
Diagnostic tests for pancreatic cancer include CT scan, MRI, endoscopic retrograde cholangiopancreatography (ERCP), endoscopic ultrasound, and pancreatic biopsy.
Diagnostic tests for prostate cancer include PSA testing and biopsy.
Use of Test Results
The result of the tests described herein can be recorded in a tangible medium, such as such as paper or a computer readable medium (for example, a diskette, CD-ROM, ROM, or fixed disk, memory drive, a solid state memory device, or an optical storage device). Results can be displayed on a computer screen or the screen of a hand-held device such as a smartphone.
In some embodiments, following a test as described above, a diagnosis of cancer is provided to the patient and/or to a medical professional, such as the patient's doctor. The diagnosis can be provided orally, in writing, or via electronic media.
In some embodiments, a course of treatment is recommended to the patient. “Treatment” as used in this context includes surgery and chemotherapy as well as surveillance for the cancer via biopsy or imaging techniques or by assessing levels of diagnostic markers such as prostate specific antigen (prostate cancer), MUC1 (multiple myeloma), carcinoembryonic antigen (CEA; colon cancer), and CA125 (ovarian cancer). Administration of a therapy to a patient in treatment does not require any particular effect or cure. In some embodiments, appropriate treatments for OCCC, breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, or prostate cancer are identified. In some embodiments, treatments for OCCC, breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, or prostate cancer are modified.
Cancer tissues can be categorized on the basis of which, if any, PPP2R1A and/or ARID1A mutation(s) they contain. Somatic mutations arc identified on the basis of a difference between an affected tissue and a normal tissue of the same individual. Categorization of the tissue can be used for stratifying patients for clinical trials, for analyzing data from clinical trials, for correlating with prognostic data (such as recurrence, metastasis, and life expectancy), as well as for selecting an appropriate course of treatment for a cancer patient Categorization can be correlated with efficacy of a therapeutic agent to enable prescription of drugs for individuals with higher probability of successful treatment. The categorization can be used in conjunction with other data, for example, histopathological data, to identify a cancer. Somatic mutation analysis can be used in any tissue or body sample to diagnose cancer. Presence of a mutant PPP2R1A and/or ARID1A protein or PPP2R1A and/or ARID1A coding sequence in a tissue or body sample indicates the presence of cancer cells, either in the sample itself, or in a tissue which drains into the sample. Thus, for example, detection of PPP2R1A and/or ARID1A mutations in a fecal sample reflects the presence of colorectal cancer cells in the individual from whom the sample was taken. Detection of PPP2R1A and/or ARID1A mutations in a sample of ovarian cells reflects the presence of ovarian cancer in the individual from whom the sample was taken.
Kits
This disclosure also provides kits for use in the disclosed methods. The kits may include a carrier for the various components of the kits. The carrier can be a container or support, in the form of. e.g., bag, box, tube, rack, and is optionally compartmentalized. The kit also includes various components useful in detecting mutations, or determining gene expression (mRNA and protein) levels, using the above-discussed detection techniques. For example, the detection kit may include one or more oligonucleotides useful as primers for amplifying all or a portion of the PPP2R1A and ARID1A genomic or cDNA. The detection kit may also include one or more oligonucleotide probes for hybridization to the PPP2R1A and ARID1A genomic or cDNA or mRNA. Optionally the oligonucleotides are affixed to a solid support, e.g., incorporated in a microchip or microarray included in the kit.
In some embodiments, a detection kit contains one or more antibodies selectively immunoreactive with PPP2R1A and ARID1A protein, for example antibodies selectively immunoreactive with the N-terminus of PPP2R1A and ARID1A protein, and/or antibodies selectively immunoreactive with the C-terminus of PPP2R1A and ARID1A protein.
Various other components useful in the detection techniques can also be included in a detection kit. Examples of such components include, but are not limited to, Taq polymerase, deoxyribonucleotides, dideoxyribonucleotides other primers suitable for the amplification of a target DNA sequence, RNase A, mutS protein, and the like. A detection kit can include instructions on using the kit for the various embodiments described above.
Therapeutic Methods
This disclosure also provides methods of inhibiting growth of cancer cells. In some embodiments a polynucleotide encoding ARID1A is administered to cancer cells, such as ovarian cancer cells. The cells can be in culture or can be in vivo, such as in an animal cancer model or a human. The polynucleotide can be administered by intratumoral injection.
Screening Methods
Test compounds can be tested to determine whether they have a differential effect in a tumor comprising a mutation in ARID1A or PPP2R1A. In some embodiments the effect of a test compound on a tumor cell is compared with the effect of the test compound on a cell that does not comprise the mutation (either a non-tumor cell or a tumor cell that does not comprise a mutation in ARID1A or PPP2R1A. The results can be recorded as described above. The differential effect can be, for example, inhibition of tumor cell growth, inhibition of tumor cell proliferation, stimulation of apoptosis, or inhibition of tumor growth. The tested cells can be in vitro or can be in an animal cancer model.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods, suitable methods and materials are described below. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
Identification of Mutations
To comprehensively explore the genetic basis of OCCC tumors, we determined the sequences of the ˜18,000 protein-encoding genes listed in the RefSeq database in tumors from eight patients (Table S1). Because these tumors are composed of a mixture of neoplastic and non-neoplastic stromal cells, we purified the neoplastic cells using epithelial cell target antibodies attached to magnetic beads (Epi-CAM, Dynal) (see the Examples, below). Staining of the cells bound to the beads revealed that >90% of them were OCCC cells. This procedure thereby maximized the sensitivity of the sequencing analyses by eliminating most of the contaminating normal cells and therefore, the normal genomes from the sample. DNA from the purified cells, as well as from normal cells obtained from the blood or uninvolved tissues of the same patients, were used to generate libraries suitable for massively parallel sequencing by synthesis (see the Examples, below). Following capture of the coding sequences of the targeted genes with a SureSelect Enrichment System, the DNA was sequenced using an Illumina GAIIx platform. The average coverage of each base in the targeted regions was 84 fold and 92.7% of these bases were represented in at least 10 reads (Tables S2A-S2D).
Using stringent criteria for analysis of these data (see the Examples, below) we identified 268 somatic mutations in 253 genes among the eight tumors. The range of mutations per tumor was 13 to 125 alterations. The tumor with 125 mutations (OCC06PT) was from a patient with recurrent disease that had previously been treated with chemotherapy. Excluding OCC06PT, there was an average of 20 mutations per tumor (Tables S2A-S2D and S3). The mutation spectrum was enriched for C to T transitions at 5′-CG base pairs, similar to diose of other tumors whose exomes have been sequenced (10-14). Only four genes were mutated in more than one of the eight tumors studied: PIK3CA, KRAS, PPP2R1A (protein phosphatase 2, regulatory subunit A, alpha) and ARID1A (AT-rich interactive domain-containing protein 1A). The mutations in each of these four genes, and their somatic nature, were confirmed by Sanger sequencing of the DNA from the tumor and normal tissues of the corresponding patients (examples in FIG. 1). The sequences of these four genes were then determined in the tumor and normal tissues of an additional 34 OCCC cases using PCR amplification and Sanger sequencing with the primers listed in Table S4. In total, PIK3CA, KRAS, PPP2R1A, and ARID1A mutations were identified in 40%, 4.7%, 7.1%, and 57% of the 42 tumors, respectively (Table 1).
We extended the analysis of these four genes in seven OCCC cell lines that were derived from tumors independent of those described above. In these seven cell lines we identified nine ARID1A mutations in five cell lines, three with PPP2R1A mutations, one with a KRAS mutation and four with PIK3CA, mutations (Table S5).
The nature of the somatic mutations in tumors can often be used to classify them as oncogenes or tumor suppressor genes (15). In particular, all bona fide oncogenes are mutated recurrently (that is, at the same codon, or clustered in few codons, in different tumors), and the mutations are nearly always missense. In contrast, all bona fide tumor suppressor genes are mutated at a variety of positions throughout the coding region of the gene and the mutations often truncate the encoded protein through production of a stop codon by a base substitution, an out-of-frame insertion or deletion (“indel”) or a splice site mutation. Moreover, tumor suppressor gene mutations generally affect both alleles while mutations in oncogenes commonly affect only one allele.
The nature of the mutations we discovered in OCCCs could thereby be used to gain insights into their likely function. PIK3CA and KRAS are well-studied oncogenes, and the 19 mutations identified in OCCC were heterozygous and clustered; fourteen of the 17 mutations in PIK3CA were at codons 381, 542 to 546, or 1047, while both mutations in KRAS were at codon 12 (Table 1). The three mutations in PPP2R1A were similarly heterozygous and clustered, suggesting it functions, when mutated, as an oncogene (Table 1). In contrast, the 32 mutations in ARID1A were distributed throughout the coding region and all were predicted to truncate the protein through a base substitution resulting in a stop codon (9 mutations), or an out-of-frame insertion or deletions (23 mutations) (Table 1). In 10 of the 24 tumors with ARID1A mutations, both ARID1A alleles were affected through either a mutation in one allele and loss of heterozygosity of the other allele, or through two mutations which were presumably biallelic. Thus, ARID1A apparently functions as a tumor suppressor gene in OCCC, and the mutations likely inactivate the gene product.
The phosphatase PP2A is a trimer composed of a common heteromeric core enzyme composed of the PPP2CA catalytic subunit and the PPP2R1A regulatory subunit acting as a scaffold to coordinate the assembly of the catalytic subunit with a variety of other regulatory subunits. Somatic mutations in PPP2R1A are not listed in the Cancer Gene Census of the COSMIC database, although a few alterations in this gene have been previously reported (16). Functional studies have shown that PP2A is involved in the control of cell growth and division. Specifically, this protein is required for proper chromosome segregation through its interactions with Bub1 and Sgo1 (17). The two arginine residues that were somatically mutated in OCCC are highly conserved and reside within one of the HEAT domains of PPP2R1A that are involved in binding regulatory subunits.
The protein encoded by ARID1A, as its name implies, can bind to AT-rich DNA sequences and is a component of the ATP-dependent chromatin modeling complex SWI/SNF. The SWI/SNF chromatin-remodeling complex allows DNA to become accessible to repair enzymes and transcription factors, thereby influencing the epigenetic regulation of a number of genes, including genes that may play a role in cancer (18, 19). ARID1A is one of the two mutually exclusive ARID1 subunits of the SWI/SNF complex and is thought to provide specificity to this complex (18). Functional studies have implicated ARID1A in the anti-proliferative properties of the complex (20). No mutations of ARID1A are listed in the Cancer Gene Census of the COSMIC database, but chromosomal translocations that involve this gene have been identified in a breast and a lung cancer (21). Knock-down of ARID1A has been shown to make a leukemia cancer cell line resistant to Fas-mediated apoptosis (22).
The results of this study emphasize two themes in modern cancer genetics. The first is that specific tumor types are characterized by mutations in “communal cancer genes” like KRAS and PIK3CA but also by “restricted cancer genes” like PPP2R1A and ARID1 A. The communal cancer genes are involved in a variety of cancers and have been extensively studied. Restricted cancer genes have been shown to play a role in specific types of leukemias and sarcomas, mainly through translocations (e.g., ABL in CML, and EWS fused to an ETS family member in Ewing's sarcoma). With the advent of whole exome sequencing, we are beginning to see similar specificity with respect to point mutations (e.g., IDH1 in gliomas (14) and GNAQ in uveal melanomas (23)). The second theme is that mutations of chromatin-modifying genes are characteristic of certain tumor types. Recent examples include the JARID1C gene in renal cell cancers (24) and now ARID1A. Epigenetic changes in cancer cells are of great interest as they are thought to open new avenues of therapeutic intervention.
Genetic inactivation of ARID1A is likely to lead to epigenetic changes in cancer cells through modifications of chromatin proteins.
Immunoaffinity Isolation of Ovarian Clear Cell Carcinoma Cells
Because the sensitivity of mutation detection in tumor tissues can be affected by the purity of the tumor DNA analyzed, we affinity purified tumor cells using Epi-CAM antibody coated beads from 26 freshly collected ovarian clear cell carcinoma samples. Briefly, tumors were minced to small fragments (1 mm×1 mm×1 mm) and digested with collagenase I (1 mg/ml in RPMI 1640 supplemented with 10% FBS) at 37° C. for 40 min. The cells were washed and incubated with 300-500 ml of Epi-CAM conjugated Dynal® (cat no: 162-03, Invitrogen) beads for 30 minutes at 2-8° C. Tumor cells that bound to the beads were separated from non-tumor cell population by a magnet and repeated sorting. Tumor cells (˜2×106-107 cells) were then collected and their genomic DNA purified using a Qiagen DNA purification kit.
Preparation of Illumina Genomic DNA Library
DNA samples were obtained from patients after informed consent as described (1, 2). Genomic DNA libraries were prepared following Illumina's (Illumina, San Diego, Calif.) suggested protocol with the following modifications. (1) 3 micrograms (μg) of genomic DNA from tumor or normal cells in 100 microliters (pi) of TE was fragmented in a Covaris sonicator (Covaris, Woburn, Mass.) to a size of 100-500 bp. DNA was purified with a PCR purification kit (Cat #28104, Qiagen, Valencia, Calif.) and eluted in 35 μl of elution buffer included in the kit. (2) Purified, fragmented DNA was mixed with 40 μl of H2O, 10 μl of 10×T4 ligase buffer with 10 mM ATP, 4 μl of 10 mM dNTP, 5 μl of T4 DNA polymerase, 1 μl of Klenow Polymerase, and 5 μl of T4 polynucleotide Kinase. All reagents used for this step and those described below were from New England Biolabs (NEB, Ipswich, Mass.) unless otherwise specified. The 100 μl end-repair mixture was incubated at 20° C. for 30 min, purified by a PCR purification kit (Cat #28104, Qiagen) and eluted with 32 μl of elution buffer (EB). (3) To A-tail, all 32 μl of end-repaired DNA was mixed with 5 μl of 10×Buffer (NEB buffer 2), 10 μl of 1 mM dATP and 3 μl of Klenow (exo). The 50 μl mixture was incubated at 37° C. for 30 min before DNA was purified with a MinElute PCR purification kit (Cat #28004, Qiagen). Purified DNA was eluted with 12.5 μl of 70° C. EB and obtained with 10 μl of EB. (4) For adaptor ligation, 10 μl of A-tailed DNA was mixed with 10 μl of PE-adaptor (Illumina), 25 μl of 2× Rapid ligase buffer and 5 μl of Rapid Ligase. The ligation mixture was incubated at room temperature (RT) or 20° C. for 15 min. (5) To purify adaptor-ligated DNA, 50 μl of ligation mixture from step (4) was mixed with 200 μl of NT buffer from NucleoSpin Extract II kit (cat#636972, Clontech, Mountain View, Calif.) and loaded into NucleoSpin column. The column was centrifuged at 14000 g in a desktop centrifuge for 1 min, washed once with 600 μl of wash buffer (NT3 from Clontech), and centrifuged again for 2 min to dry completely. DNA was eluted in 50 μl elution buffer included in the kit. (6) To obtain an amplified library, ten PCRs of 25 μl each were set up, each including 12 μl of H2O, 5 μl of 5× Phusion HE buffer, 0.5 μl of a dNTP mix containing 10 mM of each dNTP, 1.25 μl of DMSO, 0.5 μl of Illumina PE primer #1, 0.5 μl of Illumina PE primer #2, 0.25 μl of Holslart Phusion polymerase, and 5 μl of the DNA from step (5). The PCR program used was: 98° C. 1 minute; 6 cycles of 98° C. for 20 seconds, 65° C. for 30 seconds, 72° C. for 30 seconds; and 72° C. for 5 min. To purify the PCR product, 250 μl PCR mixture (from the ten PCR reactions) was mixed with 500 μl NT buffer from a NucleoSpin Extract II kit and purified as described in step (5). Library DNA was eluted with 70° C. elution buffer and the DNA concentration was estimated by absorption at 260 nm.
Exome and Targeted Subgenomic DNA Capture
Human exome capture was performed following a protocol from Agilent's SureSelect Paired-End Version 2.0 Human Exome Kit (Agilent, Santa Clara, Calif.) with the following modifications. (1) A hybridization mixture was prepared containing 25 μl of SureSelect Hyb #1, 1 μl of SureSelect Hyb #2, 10 μl of SureSelect Hyb #3, and 13 μl of SureSelect Hyb #4. (2) 3.4 μl (0.5 μg) of the PE-library DNA described above, 2.5 μl of SureSelect Block #1, 2.5 μl of SureSelect Block #2 and 0.6 μl of Block #3; was loaded into one well in a 384-well Diamond PCR plate (cat# AB-1111, Thermo-Scientific, Lafayette, Colo.), sealed with microAmp clear adhesive film (cat#4306311; AB1, Carlsbad, Calif.) and placed in GeneAmp PCR system 9700 thermocycler (Life Sciences Inc., Carlsbad Calif.) for 5 minutes at 95° C., then held at 65° C. (with the heated lid on). (3) 25-30 μl of hybridization buffer from step (1) was heated for at least 5 minutes at 65° C. in another sealed plate with heated lid on. (4) 5 μl of SureSelect Oligo Capture Library, 1 μl of nuclease-free water, and 1 μl of diluted RNase Block (prepared by diluting RNase Block 1: 1 with nuclease-free water) were mixed and heated at 65° C. for 2 minutes in another sealed 384-well plate. (5) While keeping all reactions at 65° C. 13 μl of Hybridization Buffer from Step (3) was added to the 7 μl of the SureSelect Capture Library Mix from Step (4) and then the entire contents (9 μl) of the library from Step (2). The mixture was slowly pipetted up and down 8 to 10 times. (6) The 384-well plate was sealed tightly and the hybridization mix tine was incubated for 24 hours at 65° C. with a heated lid.
After hybridization, five steps were performed to recover and amplify captured DNA library: (1) Magnetic beads for recovering captured DNA: 50 μl of Dynal M-280 Streptavidin magnetic beads (Cat #112-05D, Invitrogen) was placed in a 1.5 ml microfuge tube and vigorously resuspended on a vortex mixer. Beads were washed three times by adding 200 μl SureSelect Binding buffer, mixed on a vortex for five seconds, then removing and discarding supernatant after placing the tubes in a Dynal magnetic separator. After the third wash, beads were resuspended in 200 μl of SureSelect Binding buffer. (2) To bind captured DNA, the entire hybridization mixture described above (29 μl) was transferred directly from the thermocycler to the bead solution and mixed gently; the hybridization mix/bead solution was rotated for 30 minutes at room temperature. (3) To wash the beads, the supernatant was removed from beads after applying a Dynal magnetic separator and the beads was resuspended in 500 μl SureSelect Wash Buffer #1 by mixing on vortex mixer for 5 seconds and incubated for 15 minutes at room temperature. Wash Buffer#1 was then removed from beads after magnetic separation. The beads were further washed three times, each with 500 μl pre-warmed SureSelect Wash Buffer #2 after incubation at 65° C. for 10 minutes. After the final wash, SureSelect Wash Buffer #2 was completely removed. (4) To elute captured DNA, the beads were suspended in 50 μl SureSelect Elution Buffer, vortex-mixed and incubated for 10 minutes at room temperature. The supernatant was removed after magnetic separation, collected in a new 1.5 ml microcentrifuge tube, and mixed with 50 μl of SureSelect Neutralization Buffer. DNA was purified with a Qiagen MinElute column and eluted in 17 μl of 70° C. EB to obtain 15 μl of captured DNA library. (5) The captured DNA library was amplified in the following way: 15 PCR reactions each containing 9.5 μl of H2O, 3 μl of 5× Phusion HF buffer, 0.3 μl of 10 mM dNTP, 0.75 μl of DMSO, 0.15 μl of Illumine PE primer #1, 0.15 μl of Illumina PE primer #2, 0.15 μl of Hotstart Phusion polymerase, and 1 μl of captured exome library were set up. The PCR program used was: 98° C. for 30 seconds; 14 cycles of 98° C. for 10 seconds, 65° C. for 30 seconds, 72° C. for 30 seconds; and 72° C. for 5 min. To purify PCR products, 225 μl PCR mixture (from 15 PCR reactions) was mixed with 450 μl NT buffer from NucleoSpin Extract II kit and purified as described above. The final library DNA was eluted with 30 μl of 70° C. elution buffer and DNA concentration was estimated by OD260 measurement.
Somatic Mutation Identification by Illumina GAIIx Sequencing and Sanger Sequencing
All captured DNA libraries were sequenced with Illumina GAIIx Genome Analyzer, yielding 75 base pairs from the final library fragments. All sequencing reads were analyzed and aligned to human genome hg18 with the Eland algorithm of CASAVA 1.6 software (Illumina). A mismatched base was identified as a mutation only when (i) it was identified by more than four distinct tags; (ii) the number of distinct tags containing a particular mismatched base was at least 20% of the total distinct tags; and (iii) it was not present in >0.5% of the tags in the matched normal sample.
All somatic mutations identified by the first round of exome sequencing were subjected to conventional Sanger sequencing. PCR amplification and sequencing were performed following protocols described previously (3) using the primers listed in Table S4. SNP search databases included ncbi.nlm.nih.gov/projects/SNP/ and /browser.1000genomes.org/index.html.
Evaluation of Genes in Additional Tumors and Matched Normal Controls.
For the ARID1A, PPP2R1A, PIK3CA, and KRAS genes, the coding region was sequenced in a series of additional ovarian clear cell carcinomas and matched controls. PCR and Sanger sequencing were performed as described above using the primers listed in Table S4.
Occurrence of Somatic Mutations in AR11A in Other Tumor Types
The protein encoded by ARID1A is a key component of the highly conserved SWI-SNF chromatin remodeling complex that uses ATP-dependent helicase activities to allow access of transcriptional activators and repressors to DNA (Wang et al, 2004). The protein therefore appears to be involved in regulating processes including DNA repair, differentiation and development (Weissman et al, 2009). Functional studies by Nagl et al (2007) have demonstrated that the SW1-SNF complex suppresses proliferation. The ARID1A encoded protein, BAF250a, is one of two mutually exclusive ARID1 subunits. BAF250a has a DNA-binding domain that specifically binds to AT-rich DNA sequences and is thought to confer specificity to the complex (Wu et al, 2009).
Passenger mutations are best defined as those which do not confer a selective growth advantage to the cells in which they occur, while driver mutations are those which do confer a growth advantage. It is often difficult to distinguish driver mutations from passenger mutations when the mutations occur at low frequency. One of the best examples of this challenge is provided by IDH1 mutations. A single mutation of IDH1, R132H, was discovered in a whole exomic screen of 11 colorectal cancers (CRCs) (Sjoblom et al, 2006). This mutation was not identified in more than 200 additional colorectal cancer samples and was presumed to be a passenger mutation. However, frequent IDH1 mutations at the identical residue were found when brain tumors, such as lower grade astrocytomas and oligodendrogliomas were evaluated (Parsons et al, 2008; Yan et al, 2009). Thus the IDH1 mutation in that original CRC in retrospect was undoubtedly a driver.
This example illustrates that once a genetic alteration is identified as a driver in one tumor type, infrequent mutations of the same type in the same gene in other tumors can be more reliably interpreted. Given that it is now known that ARID1A is a bona fide tumor suppressor gene in OCCC, we applied this principle to the evaluation of ARID1A mutations in other tumor types. As described below, we studied more than 700 different neoplasms of seven different types using Sanger sequencing to determine the contribution of ARID1A alterations to tumorigenesis in general.
Samples
A total of 763 neoplasms subdivided into 119 pancreas (2 mutations among 24 samples were previously reported (Jones et al, 2008), 114 breast (0 mutations among 11 samples previously studied (Wood et al, 2007), 36 lung, 104 gastric, 34 glioblastoma (0 mutations among 22 samples previously studied) (Parsons et al, 2008), 125 medulloblastoma (1 mutation among 110 samples was previously reported) (Parsons et al, 2011), 119 colon, 23 prostate and 89 leukemias were obtained according to appropriate IRB protocols. Tumor DNA was extracted as previously described (Sjoblom et al, 2006). Of the 763 neoplasms, 103 were cell lines and the remainder were primary tumors or xenografts. As we considered only truncating mutations as drivers, and because truncating mutations of ARID1A have never been observed in the human germline (Jones et al, 2010; Wiegand et al, 2010; dbSNP (http://www.ncbi.nlm.nih.gov/projects/SNP); 1000 Genomes Consortium, 2010), we considered any truncating mutation to be somatic in origin. The somatic nature of the truncating mutations was confirmed in 100% of the cases in which matched normal DNA was available (n=17).
Amplification
The coding regions of ARID1A (CCDS285.1; NM_006015.4; OMIM603024) were amplified by the polymerase chain reaction in 5 μl reactions containing 1×PCR Buffer (67 mM Tris-HCl, pH 8.8, 6.7 mM MgCl2, 16.6 mM NH4SO4, 10 mM 2-mercaptoethanol), 1 mM dNTPs (Invitrogen, San Diego, Calif.), 1 μM forward and 1 μM reverse primers, 6% DMSO, 2 mM ATP, 0.25 U Platinum Taq (Invitrogen, San Diego, Calif.) and 3 ng DNA. The 34 pairs of primer sequences used were reported in Jones et al, 2010. PCR cycling conditions were as follows: 94° C. for 2 min; three cycles of 94° C. for 15 s, 64° C. for 30 s, 70° C. for 30 s; three cycles of 94° C. for 15 s, 61° C. for 30 s, 70° C. for 30 s; three cycles of 94° C. for 15 s, 58° C. for 30 s, 70° C. for 30 s; and 41 cycles of 94° C. for 15 s, 57° C. for 30 s, 70° C. for 30 s, followed by 70° C. for 5 min.
Sequencing
Sequencing was carried out as described in Sjoblom et al. In brief, PCR products were purified using AMPure (Agencourt Biosciences, Beverly, Mass.) and sequencing was carried out with Big Dye Terminator Kit v.3.1 (Applied Biosystems, Foster City, Calif.). One PCR primer of each pair was tagged with an M13F sequence (5′-GTAAAACGACGGCCAGT; SEQ ID NO:158) to allow Sanger sequencing with this universal primer. Sequencing reactions were purified using the CleanSEQ kit (Agencourt Biosciences, Beverly, Mass.) and run on ABI PRISM 3730 machines (Applied Biosystems, Foster City, Calif.). Mutation surveyor software (SoftGenetics, State College, Pa.) was used to visually analyze sequencing traces for mutations and all potential variants were confirmed by an independent PCR and sequencing reaction.
Microsatellite Instability Testing
Microsatellite instability was detected using the MSI Analysis System (Promega, Madison, Wis.), which contains 5 mononucleotide repeats (BAT-25, BAT-26, NR-21, NR-24 and MONO-27) and 2 pentanucleotide repeat loci, per manufacturer's instructions. Following amplification, the fluorescent PCR products were sized on an Applied Biosystems 3130 capillary electrophoresis instrument (Invitrogen, Calsbad, Calif.). Tumor samples were designated as: MSI-high if two or more mononucleotides varied in length compared to the germline DNA, MSI-low if only one locus varied, and microsatellite stable (MSS) if there was no variation compared to the germline. Pentanucleotide loci confirmed identity in all cases where normal DNA was available. For samples lacking normal DNA, tumor microsatellite length was interpreted relative to population length of these generally monomorphic alleles.
Results
Somatic mutations were identified in 43 of the 763 neoplasms studied (6%) (Table 2). Eight neoplasms contained two or three (1 case) different mutations, presumably on different alleles, so the total number of mutations was fifty-two. A relatively high frequency of mutations was observed in neoplasms of the colon (10%; 12/119), stomach (10%; 10/104), and pancreas (8%; 10/119). Though only a small number of prostate tumors was available for study, we identified 2 carcinomas with mutations among the 23 studied. Mutations were observed in three of 125 (2%) medulloblastomas, in four of 114 (4%) breast cancers, and in two of 36 (6%) lung carcinomas (Table 2; FIG. 2). No mutations were observed among 34 glioblastomas or 89 leukemias tested.
As expected for inactivating mutations of a tumor suppressor gene, the mutations were distributed throughout the gene and included nonsense variants, out of frame and in-frame small insertions and deletions, as well as a small number (three) of missense changes. Mutations were most commonly observed in a 7 base G tract around position g.chr1:26978524 (c.5548) where there were six single base pair deletions and three duplications among gastric, colon, prostate and pancreas carcinomas. This G tract is the longest mononucleotide repeat in the coding region and the probability of slippage at mononucleotide repeats clearly increases with run length (Markowitz et al, 1995; Eshleman et al, 1996). Thirty-eight of the 43 samples with somatic mutations were available for microsatellite instability (MSI) testing. Twelve tumors (6 colon, 5 gastric and 1 prostate) were shown to be MSI high, and all carried mutations at mononucleotide tracts in the ARID1A gene (Table 2). It is therefore possible that ARID1A, like TGFβRII or BAX, is associated with microsatellite instability and that the homopolymeric repeat frameshifts may result from defects in mismatch repair (Markowitz et al, 1995; Rampino et al 1997). Though the interpretation of mutations in mismatch repair deficient tumors is challenging (Kern, 2002), the fact that 40% of the colorectal cancers with ARID1A mutations did not have MSI leaves little doubt that ARID1A plays a role in this tumor type.
The identification of mutations in ARID1A in several different types of cancer indicates that this gene has a wider role in human tumorigenesis than previously appreciated. In addition, ARID1A appears to be frequently mutated in gastrointestinal tumors displaying high levels of microsatellite instability. Mutations in other members of the SWI-SNF chromatin remodeling complex have also been reported. For example, truncating mutations in SMARCA4/BRG1 were identified in three pancreatic cancers, in a medulloblastoma, and in several lung cancers (Jones et al, 2008; Parsons et al, 2011; Medina et al, 2008). More recently, 41% of renal cancers have been shown to have truncating mutations in the SWI-SNF chromatin remodeling complex gene, PBRM1 (Varela et al, 2011). In addition, a pattern of somatic mutation of genes involved more generally in chromatin remodeling is starting to appear. MLL3 appears to be involved in a small number of colon and pancreatic cancers and medulloblastomas (Wood et al, 2007; Jones et al, 2009; Parsons et al, 2011); MLL2 is mutated in 14% of medulloblastomas and a large fraction of non-Hodgkin's lymphomas (Parsons et al. 2011; Morin et al. 2011) and JARID1C is genetically altered in a small proportion of kidney cancers (Dalgliesh et al, 2010). These data collectively link genetic alterations to epigenetic changes and pave the way for a better understanding of both.
| TABLE 1 |
| Mutations in ARID14, KRAS, PIK3CA and PPP2R1A in Ovarian Clear Cell Carcinomas |
| Amino | ||||||
| Transcript | acid | Mutation | ||||
| Sample | Gene | Accession | Nucleotide (genornic)* | Nucleotide (cDNA) | (protein) | type |
| OCC01PT | ARID1A | CCDS285.1 | g.chr1: 26972561_26972562insA | c.3854_3855insA | fs | Indel |
| OCC02PT | ARID1A | CCDS285.1 | g.chr1: 26896034C > 7 | c.553C > T | p.Q185X | Nonsense |
| OCC02PT | ARID1A | CCDS285.1 | g.chr1: 26978879-26978880dupGT | c.903_904dupGT | fs | Indel |
| OCC03PT | ARID1A | CCDS285.1 | g.chr1: 26972009_26972034del | c.3659_3684delTGATGGGGCG | fs | Indel |
| GCGCATGTCCTATGAGCCA (hom) | CATGTCCTGATGGGT | |||||
| (SEQ ID NO: 7) | ATGAGCCA (SEQ ID NO: 7) | |||||
| OCC07PT | ARID1A | CCDS285.1 | g.chr1: 26896066C > A | c.585C > A | p.Y195X | Nonsense |
| OCC08PT | ARID1A | CCDS285.1 | g.chr1: 26970389delC | c.3391delC | fs | Indel |
| OCC10PT | ARID1A | CCDS285.1 | g.chr1: 26972790_26972792dupGCA | c.4001_4002dupGCA (hom) | fs | Indel |
| (hom) | ||||||
| OCC10PT | ARID1A | CCDS285.1 | g.chr1: 26979804_26979805delTG | c.6828_6829delTG (hom) | fs | Indel |
| (hom) | ||||||
| OCC11PT | ARID1A | CCDS285.1 | g.chr1: 26930334_26930335insC | c.1455_1466insCCTAC | fs | Indel |
| CTAC | ||||||
| OCC13PT | ARID1A | CCDS285.1 | g.chr1: 26974233_26974234insTGGC | c.4926_4927insTGGC | fs | Indel |
| OCC14PT | ARID1A | CCDS285.1 | g.chr1: 26972886_26972887_delTT | c.4011_4012delTT (hom) | fs | Indel |
| (hom) | ||||||
| OCC15PT | ARID1A | CCDS285.1 | g.chr1: 26973940G > A | c.4635G > A | p.W1545X | Nonsense |
| OCC15PT | ARID1A | CCDS285.1 | g.chr1: 26978178T > A | c.5202T > A | p.Y1734X | Nonsense |
| OCC16PT | ARID1A | CCDS285.1 | g.chr1: 26895967_26895973delCGC | c.486_492delCGCCGCC | fs | Indel |
| CGCC (hom) | (hom) | |||||
| OCC18PT | ARID1A | CCDS285.1 | g.chr1: 26971925delA | c.3575delA | fs | Indel |
| OCC20PT | ARID1A | CCDS285.1 | g.chr1: 26970221delG | c.3223delG | fs | Indel |
| OCC22PT | ARID1A | CCDS285.1 | g.chr1: 26979694dupG | c.6718dupG | fs | Indel |
| OCC23PT | ARID1A | CCDS285.1 | g.chr1: 26896379_2689637980_ins | c.898_899insCGTC | fs | Indel |
| CGTC | ||||||
| OCC23PT | ARID1A | CCDS285.1 | g.chr1: 26979686_26979687insT | c.6710_6711insT | fs | Ind& |
| OCC24PT | ARID1A | CCDS285.1 | g.chr1: 26930542C > T | c.1663C > T | p.Q555X | Nonsense |
| OCC27PT | ARID1A | CCDS285.1 | g.chr1: 26896263_26896272delCGT | c.782_791delCGTCGTCTTC | fs | Indel |
| CGTCTTC (SEQ ID NO: 8) | (SEQ ID NO: 8) | |||||
| OCC27PT | ARID1A | CCDS285.1 | g.chr1: 26971984_26971994delCA | c.3634_3644delCAGCCC | fs | Indel |
| GCCCAGTAT (SEQ ID NO: 9) | AGTAT (SEQ ID NO: 9) | |||||
| OCC30PT | ARID1A | CCDS285.1 | g.chr1: 26931823C > T | c.1873C > T | p.Q625X | Nonsense |
| OCC32PT | ARID1A | CCDS285.1 | g.chr1: 26960135C > T | c.2122C > T | p.Q708X | Nonsense |
| OCC34PT | ARID1A | CCDS285.1 | g.chr1: 26931754G > T | c.1804G > T | p.E602X | Nonsense |
| OCC34PT | ARID1A | CCDS285.1 | g.chr1: 26979678delT | c.6702delT | fs | Indel |
| OCC36PT | ARID1A | CCDS285.1 | g.chr1: 26928932T > G | c.1341T > G | p.Y447X | Nonsense |
| OCC36PT | ARID1A | CCDS285.1 | g.chr1: 26971613delC | c.3442delC | fs | Indel |
| OCC39PT | ARID1A | CCDS285.1 | g.chr1: 26896364dupC | c.883dupC | fs | Indel |
| OCC39PT | ARID1A | CCDS285.1 | g.chr1: 26965434delC | c.2868delC | fs | Indel |
| OCC41PT | ARID1A | CCDS285.1 | g.chr1: 26931831delT | c.1881delT | fs | Indel |
| OCC42PT | ARID1A | CCDS285.1 | g.chr1: 26960479_26960488delCG | c.2179_2188delCGGCC | fs | Indel |
| GCCACCCA (SEQ ID NO: 10) | ACCCA (SEQ ID NO: 10) | |||||
| OCC04PT | KRAS | CCDS8703.1 | g.chr12: 25289551C > T | c.35G > A | p.G12D | Missense |
| OCC05PT | KRAS | CCDS8703.1 | g.chr12: 25289551C > G | c.35G > C | p.G12A | Missense |
| OCC01PT | PIK3CA | CCDS43171.1 | g.chr3: 180418788C > A | c.1636C > A | p.0546K | Missense |
| OCC02PT | PIK3CA | CCDS43171.1 | g.chr3: 180418776G > A | c.1624G > A | p.E542K | Missense |
| OCC06PT | PIK3CA | CCDS43171.1 | g.chr3: 180418785G > A | c.1633G > A | p.E545K | Missense |
| OCC08PT | PIK3CA | CCDS43171.1 | g.chr3: 180418785G > A | c.1633G > A | p.E545K | Missense |
| OCC09PT | PIK3CA | CCDS43171.1 | g.chr3: 180434779A > T | c.31404 > T | p.H1047R | Missense |
| OCC10PT | PIK3CA | CCDS43171.1 | g.chr3: 180434779A > G | c.3140A > G | p.H1047R | Missense |
| OCC11PT | PfK3CA | CCDS43171.1 | g.chr3: 180418777A > T | c.1625A > T | p.E542V | Missense |
| OCC13PT | PIK3CA | CCDS43171.1 | g.chr3: 180434779A > G | c.31404 > G | p.H1047R | Missense |
| OCC15PT | PIK3CA | CCDS43171.1 | g.chr3: 180410152C > G | c.1221C > G | p.C407W | Missense |
| OCC20PT | PfK3CA | CCDS43171.1 | g.chr3: 180434779A > G | c.3140A > G | p.H1047R | Missense |
| OCC22PT | PIK3CA | CCDS43171.1 | g.chr3: 180434779A > G | c.3140A > G | p.H1047R | Missense |
| OCC23PT | PIK3CA | CCDS43171.1 | g.chr3: 180399648_180399649ins | c.341_342insCCTCAA | fs | Indel |
| CCTCAA | ||||||
| OCC27PT | PIK3CA | CCDS43171.1 | g.chr3: 180399638A > G | c.331A > G | p.K111E | Missense |
| OCC30PT | PIK3CA | CCDS43171.1 | g.chr3: 180434779A > G | c.3140A > G | p.H1047R | Missense |
| OCC35PT | PIK3C4 | CCDS43171.1 | g.chr3: 180418776G > A | c.1624G > A | p.E542K | Missense |
| OCC36PT | PIK3C4 | CCDS43171.1 | g.chr3: 180418785G > A | c.16336 > A | p.E545K | Missense |
| OCC42PT | PIK3CA | CCDS43171.1 | g.chr3: 180434779A > G | c.3140A > G | p.H1047R | Missense |
| OCC05PT | PPP2R1A | CCDS12849.1 | g.chr19: 57407794C > G | c.547C > G | p.R183G | Missense |
| OCC07PT | PPP2R1A | CCDS12849.1 | g.chr19: 57407794C > T | c.547C > T | p.R183W | Missense |
| OCC36PT | PPP2R1A | CCDS12849.1 | g.chr19: 57407791C > T | c.544C > T | p.R182W | Missense |
| *Coordinates refer to the human reference genome hg18 release (NCBI 36.1, March 2006). |
| TABLE S1 |
| Characteristics of ovarian clear cell carcinoma samples |
| Patient | |||||
| age | Tissue | ||||
| Sample | (years) | derivation | Stage | Sample type | Screen* |
| OCC01PT | 39 | Primary tumor | IV | Immunopurified | Discovery | ARID1A | PPP2R1A | PIK3CA | KRAS |
| Mutation | Mutation | Mutation | Mutation | ||||||
| OCC02PT | 47 | Primary tumor | IIIC | Immunopurified | Discovery | Y | N | Y | N |
| OCC03PT | 58 | Primary tumor | IC | Immunopurified | Discovery | Y | N | Y | N |
| OCC04PT | 32 | Primary tumor | IV | Immunopurified | Discovery | Y | N | N | N |
| OCC05PT | 55 | Primary tumor | IC | Immunopurified | Discovery | N | N | N | Y |
| OCC06PT | 46 | Recurrent | na** | Immunopurified | Discovery | N | Y | N | Y |
| tumor$ | |||||||||
| OCC07PT | 52 | Primary tumor | IIIC | Immunopurified | Discovery | N | N | Y | N |
| OCC08PT | 53 | Primary tumor | IC | Immunopurified | Discovery | Y | Y | N | N |
| OCC09PT | 38 | Primary tumor | IC | Immunopurified | Validation | Y | N | Y | N |
| OCC10PT | 47 | Primary tumor | IA | Immunopurified | Validation | N | N | Y | N |
| OCC11PT | 53 | Primary tumor | IIC | Immunopurified | Validation | Y | N | Y | N |
| OCC12PT | 56 | Primary tumor | IV | Bulk tumor, >80% | Validation | Y | N | Y | N |
| tumor cells | |||||||||
| OCC13PT | 49 | Recurrent | na | Immunopurified | Validation | N | N | N | N |
| tumor | |||||||||
| OCC14PT | 46 | Primary tumor | IIIC | Immunopurified | Validation | Y | N | Y | N |
| OCC15PT | 54 | Primary tumor | IIIC | Immunopurified | Validation | Y | N | N | N |
| OCC16PT | 82 | Primary tumor | IIB | Immunopurified | Validation | Y | N | Y | N |
| OCC17PT | 56 | Primary tumor | IA | Bulk tumor, >80% | Validation | Y | N | N | N |
| tumor cells | |||||||||
| OCC18PT | 63 | Primary tumor | IA | Bulk tumor, >80% | Validation | N | N | N | N |
| tumor cells | |||||||||
| OCC19PT | 45 | Primary tumor | IC | Bulk tumor, >80% | Validation | Y | N | N | N |
| tumor cells | |||||||||
| OCC20PT | 62 | Primary tumor | IC | Immunopurified | Validation | N | N | N | N |
| OCC21PT | 53 | Primary tumor | IC | Bulk tumor, >80% | Validation | Y | N | Y | N |
| tumor cells | |||||||||
| OCC22PT | 38 | Primary tumor | IC | Bulk tumor, >70% | Validation | N | N | N | N |
| tumor cells | |||||||||
| OCC23PT | 40 | Primary tumor | IC | Bulk tumor, >70% | Validation | Y | N | Y | N |
| tumor cells | |||||||||
| OCC24PT | 50 | Primary tumor | IC | Bulk tumor, >70% | Validation | Y | N | Y | N |
| tumor cells | |||||||||
| OCC25PT | 52 | Primary tumor | IC | Bulk tumor, >70% | Validation | Y | N | N | N |
| tumor cells | |||||||||
| OCC26PT | 47 | Primary tumor | IC | Bulk tumor, >70% | Validation | N | N | N | N |
| tumor cells | |||||||||
| OCC27PT | 51 | Primary tumor | IIIC | Bulk tumor, >70% | Validation | N | N | N | N |
| tumor cells | |||||||||
| OCC28PT | 62 | Primary tumor | IC | Bulk tumor, >70% | Validation | Y | N | Y | N |
| tumor cells | |||||||||
| OCC29PT | 60 | Primary tumor | IV | Immunopurified | Validation | N | N | N | N |
| OCC30PT | 53 | Primary tumor | IC | Immunopurified | Validation | N | N | N | N |
| OCC31PT | 52 | Primary tumor | IC | Immunopurified | Validation | Y | N | Y | N |
| OCC32PT | 42 | Primary tumor | IC | Immunopurified | Validation | N | N | N | N |
| OCC33PT | 55 | Primary tumor | IIIC | Immunopurified | Validation | Y | N | N | N |
| OCC34PT | 47 | Recurrent | na | Immunopurified | Validation | N | N | N | N |
| tumor | |||||||||
| OCC35PT | 46 | Primary tumor | IC | Immunopurified | Validation | Y | N | N | N |
| OCC36PT | 37 | Primary tumor | IC | Immunopurified | Validation | N | N | Y | N |
| OCC37PT | 57 | Primary tumor | IC | Immunopurified | Validation | Y | Y | Y | N |
| OCC38PT | 53 | Primary tumor | IC | Immunopurified | Validation | N | N | N | N |
| OCC39PT | 70 | Primary tumor | IIA | Bulk tumor, >70% | Validation | N | N | N | N |
| tumor cells | |||||||||
| OCC40PT | 47 | Primary tumor | IC | Bulk tumor, >70% | Validation | Y | N | N | N |
| tumor cells | |||||||||
| OCC41PT | 57 | Primary tumor | IC | Bulk tumor, >70% | Validation | N | N | N | N |
| tumor cells | |||||||||
| OCC42PT | 51 | Primary tumor | IIIC | Bulk tumor, >70% | Validation | Y | N | N | N |
| tumor cells | |||||||||
| *Discovery: the eight samples used to capture and sequence all the ~18,000 genes. | |||||||||
| Validation: additional samples used to determine the sequence of PIK3CA, KRAS, PPP21R1A, and ARID1A by Sanger sequencing. | |||||||||
| $Sample from patient with recurrent tumor previously treated with 3 cycles of cisplatin and cyclophosphamide. | |||||||||
| **na indicates not available. |
| TABLE S2A | ||
| OCC01 | OCC02 |
| Average | Normal | Tumor | Normal | Tumor | |
| Bases in target region | 37,806,033 | 37,806,033 | 37,806,033 | 37,806,033 | 37,806,033 |
| Bases sequenced (after quality filtering) | 6,511,999,219 | 5,869,322,400 | 6,039,432,975 | 7,743,998,175 | 5,887,057,800 |
| Bases mapped to genome | 5,061,811,983 | 4,697,337,900 | 4,752,944,850 | 6,092,898,975 | 4,526,013,900 |
| Bases mapped to targeted region | 3,181,949,119 | 2,951,410,606 | 2,905,106,291 | 3,938,277,117 | 2,787,699,744 |
| Average # of reads per targeted base | 84 | 78.1 | 76.8 | 104.2 | 73.7 |
| Targeted bases with at least 10 reads (%) | 92.7% | 93.5% | 91.7% | 94.5% | 91.7% |
| Known SNPs identified in targeted region | 20,037 | 19,703 | 19,519 | 19,800 | 19,504 |
| Somatic mutations identified in targeted region | 20 (excluding OCC06) | 20 | 19 |
| TABLE S2B | ||
| OCC03 | OCC04 |
| Average | Normal | Tumor | Normal | Tumor | |
| Bases in target region | 37,806,033 | 37,806,033 | 37,806,033 | 37,806,033 | 37,806,033 |
| Bases sequenced (after quality filtering) | 6,511,999,219 | 4,927,758,075 | 5,350,539,525 | 5,481,781,050 | 4,796,809,725 |
| Bases mapped to genome | 5,061,811,983 | 3,560,079,675 | 4,074,495,075 | 4,294,296,450 | 3,835,246,875 |
| Bases mapped to targeted region | 3,181,949,119 | 2,372,688,851 | 2,347,615,071 | 2,789,190,234 | 2,415,146,056 |
| Average # of reads per targeted base | 84 | 62.8 | 62.1 | 73.8 | 63.9 |
| Targeted bases with at least 10 reads (%) | 92.7% | 89.6% | 89.4% | 93.1% | 90.7% |
| Known SNPs identified in targeted region | 20,037 | 19,551 | 18,998 | 19,524 | 19,266 |
| Somatic mutations identified in targeted region | 20 (excluding OCC06) | 23 | 13 |
| TABLE S2C | ||
| OCC05 | OCC06 |
| Average | Normal | Tumor | Normal | Tumor | |
| Bases in target region | 37,806,033 | 37,806,033 | 37,806,033 | 37,806,033 | 37,806,033 |
| Bases sequenced (after quality filtering) | 6,511,999,219 | 8,072,903,325 | 6,098,389,650 | 8,784,608,625 | 10,792,972,200 |
| Bases mapped to genome | 5,061,811,983 | 6,609,351,825 | 4,836,418,575 | 7,064,921,250 | 7,611,497,100 |
| Bases mapped to targeted region | 3,181,949,119 | 4,205,386,181 | 2,944,517,632 | 4,405,093,249 | 4,716,682,489 |
| Average # of reads per targeted base | 84 | 111.2 | 77.9 | 116.5 | 124.8 |
| Targeted bases with at least 10 reads (%) | 92.7% | 94.0% | 92.8% | 95.1% | 93.5% |
| Known SNPs identified in targeted region | 20,037 | 21,391 | 21,240 | 18,907 | 18,632 |
| Somatic mutations identified in targeted region | 20 (excluding OCC06) | 24 | 125 |
| TABLE S2D | ||
| OCC07 | OCC08 |
| Average | Normal | Tumor | Normal | Tumor | |
| Bases in target region | 37,806,033 | 37,806,033 | 37,806,033 | 37,806,033 | 37,806,033 |
| Bases sequenced (after quality filtering) | 6,511,999,219 | 5,876,999,250 | 7,251,704,925 | 5,324,268,750 | 5,893,441,050 |
| Bases mapped to genome | 5,061,811,983 | 4,593,099,375 | 5,707,748,925 | 4,159,913,325 | 4,572,727,650 |
| Bases mapped to targeted region | 3,181,949,119 | 2,984,229,243 | 3,581,297,932 | 2,652,614,272 | 2,914,230,935 |
| Average # of reads per targeted base | 84 | 78.9 | 94.7 | 70.2 | 77.1 |
| Targeted bases with at least 10 reads (%) | 92.7% | 93.0% | 93.6% | 93.1% | 93.7% |
| Known SNPs identified in targeted region | 20,037 | 22,946 | 18,765 | 24,318 | 18,523 |
| Somatic mutations identified in targeted region | 20 (excluding OCC06) | 20 | 24 |
| TABLE S3 |
| Mutations identified in the discovery screen |
| Sample | Gene | Transcript Accession | Nucleotide (genomic)* | Nucleotide (cDNA) | Amino acid (protein) | Mutation type |
| OCC06PT | ABCC10 | CCDS4896.1 | g.chr6: 43523575T > G | c.3797T > G | p.F1266C | Missense |
| OCC06PT | ABCD4 | CCDS9828.1 | g.chr14: 73823213C > T | c.1696G > A | p.G566.S. | Missense |
| OCC06PT | ACADVL | CCDS11090.1 | g.chr17: 7067740G > C | c.1236G > C | p.Q412H | Missense |
| OCC04PT | ADAM7 | CCDS6045.1 | g.chr8: 24414262G > A | c.2072G > A | p.R691H | Missense |
| OCC08PT | ADNP2 | CCDS32853.1 | g.chr18: 75994633C > T | c.346C > T | p.Q116X | Nonsense |
| OCC06PT | AFF4 | CCDS4164.1 | g.chr5: 132260486G > C | c.1735C > G | p.R579G | Missense |
| OCC01PT | AICDA | CCDS41747.1 | g.chr12: 8648681G > A | c.532C > T | p.R178C | Missense |
| OCC08PT | AMPD1 | CCDS876.1 | g.chr1: 115017346delT | c.2154delA | fs | Indel |
| OCC06PT | ANKDD1A | CCDS10197.2 | g.chr15: 63021732C > G | c.883C > G | p.L295V | Missense |
| OCC02PT | ARHGAP5 | CCDS32062.1 | g.chr14: 31.631490G > A | c.1864G > A | p.E622K | Missense |
| OCC01PT | ARID1A | CCDS285.1 | g.chr1: 26972561_26972562insA | c.3854_3855insA | fs | Indel |
| OCC02PT | ARID1A | CCDS285.1 | g.chr1: 26896034C > T | c.553C > T | p.Q185X | Nonsense |
| OCC02PT | ARID1A | CCDS285.1 | g.chr1: 26978879-26978880dupGT | c.903_904dupGT | fs | Indel |
| OCC03PT | ARID1A | CCDS285.1 | g.chr1: 26972009_26972034delTGA | c.3659_3684delTGATGGGGCGCATGICCT | fs | Indel |
| TGGGGCGCATGTCCTATGAGCCA | ATGAGCCA (SEQ ID NO: 11) | |||||
| (hom) (SEQ ID NO: 11) | ||||||
| OCC07PT | ARID1A | CCDS285.1 | g.chr1: 26896066C > A | c.585C > A | p.Y195X | Nonsense |
| OCC08PT | ARID1A | CCDS285.1 | g.chr1: 26970389delC | c.3391delC | fs | Indel |
| OCC02PT | ARID1B | CCDS5251.1 | g.chr6: 157570517dupC | c.6500dupC | fs | Indel |
| OCC06PT | ARPC2 | CCDS2410.1 | g.chr2: 218822398G > A | c.743G > A | p.R248Q | Missense |
| OCC06PT | ASB2 | CCDS9915.1 | g.chr14: 93487138C > G | c.696G > C | p.Q232H | Missense |
| OCC02PT | ATP4A | CCDS12467.1 | g.chr19: 40737917C > T | c.2317G > A | p.V773M | Missense |
| OCC06PT | ATP6V0C | CCDS10470.1 | g.chr16: 2509574G > A | c.295G > A | p.V99M | Missense |
| OCC06PT | B3GALTL | CCDS9341.1 | g.chr13: 30687235C > T | c.118C > T | p.Q40X | Nonsense |
| OCC07PT | B4GALNT3 | CCDS8504.1 | g.chr12: 537114_537118delCAACA | c.2460_2464delCAACA | fs | Indel |
| OCC06PT | BCL11A | CCDS1862.1 | g.chr2: 60542953C > G | c.598G > C | p.E200Q | Missense |
| OCC06PT | BMF | CCDS10052.1 | g.chr15: 38185428delG | c.154delC | fs | Indel |
| OCC06PT | BZW2 | CCDS5362.1 | g.chr7: 16704324C > G | c.1096C > G | p.L366V | Missense |
| OCC06PT | C10orf90 | CCDS31310.1 | g.chr10: 1281831436 > A | c.616C > T | p.R206W | Missense |
| OCC08PT | C10orf91 | CCDS7668.1 | g.chr10: 134111295C > G | c.178C > G | p.Q60E | Missense |
| OCC03PT | C13orf35 | CCDS9S26.1 | g.chr13: 112381800G > T | c.106G > T | p.D36Y | Missense |
| OCC06PT | C14orf43 | CCDS9819.1 | g.chr14: 73255795G > C | c.3100C > G | p.Q1034E | Missense |
| OCC06PT | C16orf70 | CCDS10828.1 | g.chr16: 65731955C > T | c.836C > T | p.S279L | Missense |
| OCC06PT | C17orf61 | CCDS11102.1 | g.chr17: 7247227G > C | c.224C > G | p.T75R | Missense |
| OCC06PT | C1orf168 | CCDS30729.1 | g.chr1: 56989372C > G | c.1320G > C | p.M440I | Missense |
| OCC06PT | C2CD3 | CCDS31636.1 | g.chr11: 73481254C > G | c.3372G > C | p.Q1124H | Missense |
| OCC0PT | C2orf16 | CCDS42666.1 | g.chr2: 27654243G > A | c.1300G > A | p.V434I | Missense |
| OCC06PT | CC2D1B | CCDS30714.1 | g.chr1: 52593147C > G | c.2310G > C | p.K770N | Missense |
| OCC06PT | CCT2 | CCDS8991.1 | g.chr12: 68267579G > T | c.172G > T | p.D58Y | Missense |
| OCC06PT | CCT8L1 | ENST00000021776 | g.chr7: 151774819C > A | c.1325C > A | p.A442D | Missense |
| OCC06PT | CD97 | CCDS32929.1 | g.chr19: 14374516G > T | c.1291G > T | p.E431X | Nonsense |
| OCC06PT | CDH11 | CCDS10803.1 | g.chr16: 63584411G > A | c.551C > T | p.S1841 | Missense |
| OCC06PT | CDK19 | CCDS5085.1 | g.chr6: 111243029C > T | c.4G > A | p.D2N | Missense |
| OCC05PT | CELF5 | CCDS12106.1 | g.chr19: 3233451C > T | c.994C > T | p.P332S | Missense |
| OCC03PT | CELSR3 | CCDS2775.1 | g.chr3: 48660374G > A | c.7033C > T | p.R2345C | Missense |
| OCC03PT | CHD4 | CCDS85.52.1 | g.chr12: 6567814T > C | c.3376A > G | p.T1126A | Missense |
| OCC06PT | CHD5 | CCDS57.1 | g.chr1: 6110824C > G | c.37720 > C | p.D1258H | Missense |
| OCC06PT | CLCN1 | CCDS5881.1 | g.chr7: 142746776G > C | c.15220 > C | p.D508H | Missense |
| OCC08PT | CLEC4C | CCDS8583.1 | g.chr12: 7785340T > C | c.179A > G | p.E60G | Missense |
| OCC04PT | COL22A1 | CCDS6376.1 | g.chr8: 139761041C > A | IVS39 + 1G > T | Splice site | Splice site |
| OCC04PT | CRMP1 | CCDS33950.1 | g.chr4: 5881160G > A | c.1760C > T | p.A587V | Missense |
| OCC06PT | CSMD2 | CCDS380.1 | g.chr1: 33844067A > G | c.6332T > C | p.L2111P | Missense |
| OCC03PT | CSMD3 | CCDS6315.1 | g.chr8: 113718308G > A | c.3629C > T | p.S1210L | Missense |
| OCC03PT | CSNK1D | CCDS11805.1 | g.chr17: 77802635T > C | c.794A > G | p.D265G | Missense |
| OCC06PT | CYP1A1 | CCDS10268.1 | g.chr15: 72800116C > G | c.1306G > C | p.D436H | Missense |
| OCC03PT | CYP4F22 | CCDS12331.1 | g.chr19: 15509730G > A | c.597G > A | p.M199I | Missense |
| OCC05PT | DCAF12L1 | CCDS14610.1 | g.chrX: 1255131177 > A | c.1156A > T | p.R386X | Nonsense |
| OCC06PT | DDHD1 | CCDS9714.1 | g.chr14: 52610215C > 0 | c.1390G > C | p.D464H | Missense |
| OCC07PT | DDX53 | CCDS35214.1 | g.chrX: 22929339G > A | c.1244G > A | p.R415H | Missense |
| OCC02PT | DIS3L2 | CCDS42834.1 | g.chr2: 232811498G > A | c.1216G > A | p.V406M | Missense |
| OCC05PT | DMRTB1 | CCDS581.1 | g.chr1: 53697826G > A | c.112G > A | p.E38K | Missense |
| OCC03PT | DNAH8 | CCDS4838.1 | g.chr6: 38971909G > A | c.8219G > A | p.R2740H | Missense |
| OCC05PT | DNAJC13 | CCDS33857.1 | g.chr3: 133703893C > T | c.4607C > T | p.T1536I | Missense |
| OCC06PT | DNAJC14 | CCDS8894.1 | g.chr12: 54507891G > C | c.819C > G | p.I273M | Missense |
| OCC03PT | DPP8 | CCDS10207.1 | g.chr15: 63526323G > C | c.2649C > G | p.Y883X | Nonsense |
| OCC06PT | DSC2 | CCDS11892.1 | g.chr18: 26903091G > T | c.2275C > A | p.Q759K | Missense |
| OCC03PT | DYRK1A | CCDS42925.1 | g.chr21: 37799751C > T | c.1535C > T | p.S512L | Missense |
| OCC06PT | EIF5B | CCDS42721.1 | g.chr2: 99347175G > A | c.1147G > A | p.E383K | Missense |
| OCC06PT | ELP2 | CCDS11918.1 | g.chr18: 31976873C > G | c.742C > G | p.Q248E | Missense |
| OCC05PT | EML3 | CCDS8023.2 | g.chr11: 62129695_62129698delGGTC | c.del1906-1909delGACC | fs | Indel |
| OCC08PT | EPHA1 | CCDS5884.1 | g.chr7: 142801541G > C | c.2370C > G | p.I790M | Missense |
| OCC05PT | ETV6 | CCDS8643.1 | g.chr12: 11796732C > T | c.115C > T | p.R39X | Nonsense |
| OCC06PT | EXOC3L2 | CCDS12657.1 | g.chr19: 50426910G > C | c.41C > G | p.S14C | Missense |
| OCC02PT | FAM13C | CCDS7255.1 | g.chr10: 60699701G > A | c.767C > T | p.S256L | Missense |
| OCC06PT | FAM40A | CCDS30798.1 | g.chr1: 110387874G > A | c.1159G > A | p.D387N | Missense |
| OCC01PT | FAM71B | CCDS4335.1 | g.chr5: 156522716T > C | c.1138A > G | p.I380V | Missense |
| OCC01PT | FAT4 | CCDS3732.2 | g.chr4: 126631378A > G | c.13780A > G | p.I4594V | Missense |
| OCC06PT | F8XO34 | CCDS32086.1 | g.chr14: 54887408G > T | c.547G > T | p.G183C | Missense |
| OCC06PT | FILIP1 | CCDS4984.1 | g.chr6: 76081298G > C | c.970C > G | p.Q324E | Missense |
| OCC06PT | FLG2 | CCDS30861.1 | g.chr1: 150590126C > A | c.6760G > T | p.G2254C | Missense |
| OCC03PT | FNDC38 | CCDS3217.1 | g.chr3: 173578891C > T | c.3146C > T | p.T1049I | Missense |
| OCC06PT | FOLH1 | CCDS7946.1 | g.chr11: 49154047C > T | c.959G > A | p.R320K | Missense |
| OCC06PT | GADD45A | CCDS640.1 | g.chr1: 67925936_67925937delCA | c.389_390delCA | fs | Indel |
| OCC02PT | GAL3ST3 | CCDS8128.1 | g.chr11: 65567327C > T | c.523G > A | p.V175I | Missense |
| OCC03PT | GALNT8 | CCDS8533.1 | g.chr12: 4724019G > A | c.752G > A | p.R251Q | Missense |
| OCC02PT | GARNL3 | CCDS6869.1 | g.chr9: 129159326G > A | c.1889G > A | p.C630Y | Missense |
| OCC01PT | GATA3 | CCDS31143.1 | g.chr10: 8155905G > T | c.1248G > T | p.M416I | Missense |
| OCC06PT | GBA2 | CCDS6589.1 | g.chr9: 35730929T > G | c.919A > C | p.N307H | Missense |
| OCC06PT | GCN1L1 | CCDS41847.1 | g.chr12: 119063135C > T | c.5905G > A | p.E1969K | Missense |
| OCC06PT | GFI1B | CCDS6957.1 | g.chr9: 134856217G > A | c.952G > A | p.D318N | Missense |
| OCC02PT | GIMAP8 | CCDS34777.1 | g.chr7: 149805569G > A | c.1766G > A | p.R589H | Missense |
| OCC06PT | GOPC | CCDS5117.1 | g.chr6: 118006855T > G | c.351A > C | p.K117N | Missense |
| OCC06PT | GPR22 | CCDS5744.1 | g.chr7: 106903043G > C | c.1302G > C | p.X434Y | Missense |
| OCC08PT | GPR3 | CCDS303.1 | g.chr1: 27593530C > A | c.641C > A | p.A214D | Missense |
| OCC06PT | GPRIN3 | CCDS34030.1 | g.chr4: 90389594C > G | c.691G > C | p.E231Q | Missense |
| OCC01PT | GPT | CCDS6430.1 | g.chr8: 145702267G > A | c.901G > A | p.A301T | Missense |
| OCC01PT | GRN | CCDS11483.1 | g.chr17: 39782410G > A | c.229G > A | p.V77I | Missense |
| OCC06PT | H3F3B | CCDS11729.1 | g.chr17: 71286367G > C | c.315C > G | p.F105L | Missense |
| OCC05PT | HAO2 | CCDS901.1 | g.chr1: 119729197A > T | c.559A > T | p.K187X | Nonsense |
| OCC06PT | HDAC2 | CCDS43493.1 | g.chr6: 114384509C > G | c.607G > C | p.E203Q | Missense |
| OCC06PT | HEATR4 | CCDS9815.1 | g.chr14: 73059203A > C | c.266T > G | p.V89G | Missense |
| OCC07PT | HECTD1 | CCDS41939.1 | g.chr14: 30645942delA | c.6887delA | fs | Indel |
| OCC06PT | HIBADH | CCDS5414.1 | g.chr7: 27655756G > C | c.113C > G | p.S38X | Nonsense |
| OCC06PT | HIST1H4B | CCDS4572.1 | g.chr6: 26135340C > A | c.120G > T | p.R40S | Missense |
| OCC06PT | HIST1H4B | CCDS4572.1 | g.chr6: 26135341C > A | c.119G > T | p.R40M | Missense |
| OCC08PT | HSP90B1 | CCDS9094.1 | g.chr12: 102851919G > A | c.467G > A | p.R156K | Missense |
| OCC05PT | HSPA14 | CCDS7103.1 | g.chr10: 14937857A > C | c.902A > C | p.E301A | Missense |
| OCC05PT | IGSF10 | CCDS3160.1 | g.chr3: 152647246delC | c.3213delG | fs | Indel |
| OCC01PT | IL1RAP | CCDS3298.1 | g.chr3: 191804683A > T | c.137A > T | p.K46M | Missense |
| OCC06PT | ITGA1 | CCDS3955.1 | g.chr5: 52269009C > T | c.2986C > T | p.P996S | Missense |
| OCC06PT | ITGB2 | CCDS13716.1 | g.chr21: 45136197C > T | c.1367G > A | p.R456H | Missense |
| OCC06PT | KCNT2 | CCDS1384.1 | g.chr1: 194843995C > A | c.68G > T | p.G23V | Missense |
| OCC03PT | KCNV2 | CCDS6447.1 | g.chr9: 2707998G > A | c.259G > A | p.E87K | Missense |
| OCC06PT | KCTD3 | CCDS1515.1 | g.chr1: 213818978G > A | c.410G > A | p.R137H | Missense |
| OCC01PT | KIAA0247 | CCDS9796.1 | g.chr14: 69195186dupT | IVS1 + 2dupT | Splice site | Splice site |
| OCC06PT | KIAA0649 | CCDS6988.1 | g.chr9: 137516929A > C | c.752A > C | p.K251T | Missense |
| OCC07PT | KIAA1109 | CCDS43267.1 | g.chr4: 123387357C > T | c.5254C > T | p.H1752Y | Missense |
| OCC05PT | KIAA1539 | CCDS6578.1 | g.chr9: 35097703_35097704delAA | c.568_569delTT | fs | Indel |
| OCC06PT | KIAA1715 | CCDS33332.1 | g.chr2: 176520535C > G | c.625G > C | p.E209Q | Missense |
| OCC01PT | KLHL28 | CCDS9680.1 | g.chr14: 44484193C > T | c.689G > A | p.S230N | Missense |
| OCC04PT | KRAS | CCDS8703.1 | g.chr12: 25289551C > T | c.35G > A | p.G12D | Missense |
| OCC05PT | KRAS | CCDS8703.1 | g.chr12: 25289551C > G | c.35G > C | p.G12A | Missense |
| OCC01PT | LAMA5 | CCDS33502.1 | g.chr20: 60332924C > A | c.5611G > T | p.D1871Y | Missense |
| OCC07PT | LECT1 | CCDS9437.1 | g.chr13: 52175897C > T | c.839G > A | p.G280E | Missense |
| OCC06PT | LGALS4 | CCDS12521.1 | g.chr19: 43984294C > A | c.922G > T | p.D308Y | Missense |
| OCC06PT | LIFR | CCDS3927.1 | g.chr5: 38566445_38566452dupCTCATTCT | c.55_62dupAGAATGT | fs | Indel |
| OCC05PT | LRP1B | CCDS2182.1 | g.chr2: 141175367G > A | c.6320C > T | p.S2107F | Missense |
| OCC05PT | LRP1B | CCDS2182.1 | g.chr2: 141175868A > T | c.6319T > A | p.S2107T | Missense |
| OCC06PT | LRRC7 | CCDS645.1 | g.chr1: 70277630G > A | c.3421G > A | p.D1141N | Missense |
| OCC08PT | LRRK2 | CCDS31774.1 | g.chr12: 38995283G > A | c.4741G > A | p.V1581I | Missense |
| OCC06PT | MARCH6 | CCDS34135.1 | g.chr5: 10447235G > A | c.808G > A | p.E270K | Missense |
| OCC03PT | MARK1 | CCDS31029.2 | g.chr1: 218892093G > A | c.1714G > A | p.G572S | Missense |
| OCC03PT | MARK3 | CCDS41993.1 | g.chr14: 103039093C > T | c.1966C > T | p.R656C | Missense |
| OCC08PT | MAS1 | CCDS5272.1 | g.chr6: 160248330C > T | c.353C > T | p.T118M | Missense |
| OCC02PT | MCF2L2 | CCDS3243.1 | g.chr3: 184408211C > T | c.2591G > A | p.R864Q | Missense |
| OCC06PT | MDGA2 | CCDS41948.1 | g.chr14: 46413127C > A | c.1570G > T | p.G524C | Missense |
| OCC06PT | MED13L | CCDS9177.1 | g.chr12: 115159803G > T | c.163C > A | p.P55T | Missense |
| OCC08PT | MFSD5 | CCDS8851.1 | g.chr12: 51933584C > G | c.698C > G | p.S233X | Nonsense |
| OCC06PT | MLL3 | CCDS5931.1 | g.chr7: 151509027G > T | c.6851C > A | p.S2284X | Nonsense |
| OCC06PT | MLL3 | CCDS5931.1 | g.chr7: 151522533G > A | c.4432C > T | p.Q1478X | Nonsense |
| OCC05PT | MRI1 | CCDS32923.1 | g.chr19: 13740712A > G | c.799A > G | p.I267V | Missense |
| OCC06PT | MTO1 | CCDS4979.1 | g.chr6: 74246564C > T | c.1123C > T | p.Q375X | Nonsense |
| OCC06PT | MYH11 | CCDS10565.1 | g.chr16: 15777493C > T | c.832G > A | p.E278K | Missense |
| OCC03PT | MYO16 | CCDS32008.1 | g.chr13: 108502685C > A | c.2843C > A | p.S948X | Nonsense |
| OCC04PT | MYO1G | CCDS34629.1 | g.chr7: 44971978G > A | c.2164C > T | p.R722W | Missense |
| OCC06PT | MYO3B | CCDS42773.1 | g.chr2: 170764100_170764101delAA | c.139_140delAA | fs | Indel |
| OCC01PT | MYO5B | CCDS42436.1 | g.chr18: 45660823G > A | c.3046C > T | p.R1016X | Nonsense |
| OCC06PT | MYST3 | CCDS6124.1 | g.chr8: 41919512C > G | c.2392G > C | p.E798Q | Missense |
| OCC07PT | NDRG2 | CCDS9565.1 | g.chr14: 20558829A > G | c.422T > C | p.I141T | Missense |
| OCC06PT | NDUFAF4 | CCDS5037.1 | g.chr6: 97445894C > T | c.335G > A | p.G112D | Missense |
| OCC06PT | NFKBIL2 | CCDS34968.1 | g.chr8: 145630246C > T | c.2833G > A | p.D945N | Missense |
| OCC06PT | NFKBIL2 | CCDS34968.1 | g.chr8: 145630291C > T | c.2788G > A | p.E930K | Missense |
| OCC06PT | NGRN | CCDS32329.1 | g.chr15: 88615882G > C | c.734G > C | p.R245T | Missense |
| OCC06PT | NIPBL | CCDS3920.1 | g.chr5: 37007894C > A | c.862C > A | p.P288T | Missense |
| OCC04PT | NLGN4X | CCDS14126.1 | g.chrX: 5837139C > A | c.767G > T | p.G256V | Missense |
| OCC06PT | NLRP3 | CCDS1632.1 | g.chr1: 245654152C > T | c.784C > T | p.R262X | Nonsense |
| OCC06PT | NOS1 | CCDS41842.1 | g.chr12: 116142349C > T | c.4084G > A | p.D1362N | Missense |
| OCC06PT | NR1I2 | CCDS2995.1 | g.chr3: 121014470G > A | c.884G > A | p.S295N | Missense |
| OCC02PT | NR2F2 | CCDS10375.1 | g.chr15: 94681704T > C | c.1094T > C | p.L365P | Missense |
| OCC03PT | NR6A1 | CCDS35137.1 | g.chr9: 126326955C > G | c.1220G > C | p.S407T | Missense |
| OCC08PT | NUP98 | CCDS7746.1 | g.chr11: 3671072G > C | c.4277C > G | p.S1426C | Missense |
| OCC02PT | OR4D1 | CCDS42365.1 | g.chr17: 53587855dupT | c.342dupT | fs | Indel |
| OCC05PT | OR51I2 | CCDS31383.1 | g.chr11: 5431563G > A | c.269G > A | p.R90H | Missense |
| OCC05PT | OR52J3 | CCDS31370.1 | g.chr11: 5024450C > T | c.119C > T | p.A40V | Missense |
| OCC06PT | OR5D16 | CCDS31512.1 | g.chr11: 55363314C > T | c.511C > T | p.H171Y | Missense |
| OCC05PT | OR6C75 | CCDS31820.1 | g.chr12: 54045519C > T | c.358C > T | p.R120C | Missense |
| OCC05PT | OXCT1 | CCDS3937.1 | g.chr5: 41843189C > A | IVS8 + 1G > T | Splice site | Splice site |
| OCC06PT | PALMD | CCDS758.1 | g.chr1: 99927932G > A | c.1528G > A | p.E510K | Missense |
| OCC07PT | PAPSS1 | CCDS3676.1 | g.chr4: 108794150G > A | c.1183C > T | p.Q395X | Nonsense |
| OCC04PT | PCDH10 | CCDS34063.1 | g.chr4: 134303647A > C | c.2863A > C | p.M955L | Missense |
| OCC06PT | PCDH17 | CCDS31986.1 | g.chr13: 57105042G > C | c.361G > C | p.E121Q | Missense |
| OCC04PT | PCDHA3 | CCDS34248.1 | g.chr5: 140162411C > T | c.1445C > T | p.A482V | Missense |
| OCC07PT | PCDHA7 | CCDS34252.1 | g.chr5: 140195657G > A | c.1505G > A | p.R502H | Missense |
| OCC07PT | PCDHA8 | CCDS34253.1 | g.chr5: 140202604C > T | c.1514C > T | p.S505L | Missense |
| OCC06PT | PCDHB7 | CCDS4249.1 | g.chr5: 140534794C > T | c.2194C > T | p.R732X | Nonsense |
| OCC01PT | PDE4DIP | CCDS30824.1 | g.chr1: 143590779C > T | c.4028G > A | p.R1343Q | Missense |
| OCC06PT | PDE9A | CCDS13690.1 | g.chr21: 43058674G > C | IVS15 + 1G > C | Splice site | Splice site |
| OCC05PT | PDZD7 | CCDS31269.1 | g.chr10: 102773205A > G | c.520T > C | p.F174L | Missense |
| OCC06PT | PEPD | CCDS42544.1 | g.chr19: 38594443G > A | c.793C > T | p.R265X | Nonsense |
| OCC02PT | PFKM | CCDS8760.1 | g.chr12: 46817867C > T | c.1033C > T | p.R345C | Missense |
| OCC05PT | PGM1 | CCDS625.1 | g.chr1: 63886821C > T | c.1190C > T | p.A397V | Missense |
| OCC06PT | PHF3 | CCDS4966.1 | g.chr6: 64480931G > C | c.5488G > C | p.G1830R | Missense |
| OCC06PT | PHLPP2 | CCDS32479.1 | g.chr16: 70270185C > T | c.1242G > A | p.M414I | Missense |
| OCC06PT | PIAS2 | CCDS32824.1 | g.chr18: 42649287G > T | c.1672C > A | p.P558T | Missense |
| OCC01PT | PIK3CA | CCDS43171.1 | g.chr3: 180418788C > A | c.1636C > A | p.Q546K | Missense |
| OCC02PT | PIK3CA | CCDS43171.1 | g.chr3: 180418776G > A | c.1624G > A | p.E542K | Missense |
| OCC06PT | PIK3CA | CCDS43171.1 | g.chr3: 180418785G > A | c.1633G > A | p.E545K | Missense |
| OCC08PT | PIK3CA | CCDS43171.1 | g.chr3: 180418785G > A | c.1633G > A | p.E545K | Missense |
| OCC06PT | PKD1L1 | CCDS34633.1 | g.chr7: 47835604G > A | c.6679C > T | p.R2227C | Missense |
| OCC06PT | PLD5 | CCDS1621.1 | g.chr1: 240343918T > G | c.691A > C | p.S231R | Missense |
| OCC08PT | PLEKHA6 | CCDS1444.1 | g.chr1: 202484579G > A | c.1817C > T | p.A606V | Missense |
| OCC06PT | PLIN2 | CCDS6490.1 | g.chr9: 19116246G > T | c.92C > A | p.S31X | Nonsense |
| OCC06PT | PLS1 | CCDS3125.1 | g.chr3: 143885798G > T | c.759G > T | p.L253F | Missense |
| OCC07PT | PMFBP1 | CCDS32483.1 | g.chr16: 70727871T > G | c.1180A > C | p.K394Q | Missense |
| OCC06PT | PMM1 | CCDS14020.1 | g.chr22: 40315716C > G | c.40G > C | p.V14L | Missense |
| OCC07PT | POLRMT | CCDS12036.1 | g.chr19: 572222C > G | c.2476G > C | p.E826Q | Missense |
| OCC08PT | PPL | CCDS10526.1 | g.chr16: 4875813C > G | c.2844G > C | p.E948D | Missense |
| OCC06PT | PPP1R12C | CCDS12916.1 | g.chr19: 60315966C > T | c.331G > A | p.D111N | Missense |
| OCC05PT | PPP2R1A | CCDS12849.1 | g.chr19: 57407794C > G | c.547C > G | p.R183G | Missense |
| OCC07PT | PPP2R1A | CCDS12849.1 | g.chr19: 57407794C > T | c.547C > T | p.R183W | Missense |
| OCC07PT | PTPRM | CCDS11840.1 | g.chr18: 7945226C > G | c.946C > G | p.R316G | Missense |
| OCC06PT | R3HDM2 | CCDS8937.1 | g.chr12: 55935044G > C | c.1693C > G | p.Q565E | Missense |
| OCC06PT | RAB8B | CCDS10183.1 | g.chr15: 61328957G > A | c.246G > A | p.M82I | Missense |
| OCC04PT | RAI2 | CCDS14183.1 | g.chrX: 17729307G > A | c.745C > T | p.P249S | Missense |
| OCC06PT | RCBTB1 | CCDS9418.1 | g.chr13: 49006380A > C | c.1475T > G | p.F492C | Missense |
| OCC06PT | RETSAT | CCDS1972.1 | g.chr2: 85431542C > G | c.469G > C | p.V157L | Missense |
| OCC06PT | REV3L | CCDS5091.2 | g.chr6: 111759634C > G | c.7972G > C | p.D2658H | Missense |
| OCC08PT | RHBDD3 | CCDS13850.1 | g.chr22: 27986387G > A | c.911C > T | p.S304L | Missense |
| OCC06PT | RIPK2 | CCDS6247.1 | g.chr8: 90871585G > A | c.1423G > A | p.E475K | Missense |
| OCC06PT | ROPN1L | CCDS3879.1 | g.chr5: 10518033G > C | c.667G > C | p.E223Q | Missense |
| OCC06PT | RPAP2 | CCDS740.1 | g.chr1: 92561809G > T | c.744G > T | p.M248I | Missense |
| OCC07PT | RRAS | CCDS12774.1 | g.chr19: 54830656C > T | c.646G > A | p.V216I | Missense |
| OCC03PT | SAGE1 | CCDS14652.1 | g.chrX: 134818022C > A | c.1258C > A | p.A423D | Missense |
| OCC03PT | SALL3 | CCDS12013.1 | g.chr18: 74853658C > T | c.679C > T | p.R227C | Missense |
| OCC06PT | SEL1L2 | CCDS42852.1 | g.chr20: 13798816G > C | c.1138C > G | p.L380V | Missense |
| OCC06PT | SENP7 | CCDS2941.2 | g.chr3: 102539043G > A | c.2480C > T | p.S827L | Missense |
| OCC01PT | SERPINB3 | CCDS11986.1 | g.chr18: 59457541G > T | c.626C > A | p.5209Y | Missense |
| OCC04PT | SFRP1 | CCDS34886.1 | g.chr8: 41285481G > C | c.355C > G | p.P119A | Missense |
| OCC06PT | SLC12A2 | CCDS4144.1 | g.chr5: 127531402G > C | c.2667G > C | p.K889N | Missense |
| OCC03PT | SLC12A7 | CCDS34129.1 | g.chr5: 1129308C > T | c.1792G > A | p.V598M | Missense |
| OCC01PT | SLC18A3 | CCDS7231.1 | g.chr10: 50490297G > A | c.1505G > A | p.R502H | Missense |
| OCC07PT | SLC30A1 | CCDS1499.1 | g.chr1: 209818351C > A | c.227G > T | p.R76L | Missense |
| OCC06PT | SLC38A6 | CCDS9751.1 | g.chr14: 60519109G > A | c.236G > A | p.S79N | Missense |
| OCC02PT | SLC4A3 | CCDS2446.1 | g.chr2: 220212528G > T | c.3185G > T | p.G1062V | Missense |
| OCC02PT | SLITRK2 | CCDS14680.1 | g.chrX: 144712029G > A | c.394G > A | p.G132S | Missense |
| OCC07PT | SMAD3 | CCDS10222.1 | g.chr15: 65269917A > G | c.1267A > G | p.S423G | Missense |
| OCC06PT | SMARCA4 | CCDS12253.1 | g.chr19: 10999550C > G | c.3306C > G | p.F1102L | Missense |
| OCC04PT | SOCS3 | CCDS11756.1 | g.chr17: 73866491C > A | c.281G > T | p.R94L | Missense |
| OCC06PT | SOLH | CCDS10410.1 | g.chr16: 539033delC | c.1491delC | fs | Indel |
| OCC07PT | SON | CCDS13629.1 | g.chr21: 33848740G > T | c.5333G > T | p.R1778I | Missense |
| OCC04PT | SPACA3 | CCDS11275.1 | g.chr17: 28348073G > A | c.443G > A | p.R148Q | Missense |
| OCC06PT | SPARCL1 | CCDS3622.1 | g.chr4: 88622650C > A | c.1618G > T | p.E540X | Nonsense |
| OCC08PT | SPATA5L1 | CCDS10123.1 | g.chr15: 43489979G > T | c.1393G > T | p.E465X | Nonsense |
| OCC05PT | SPOP | CCDS11551.1 | g.chr17: 45054368C > T | c.139G > A | p.E47K | Missense |
| OCC06PT | SPTBN1 | CCDS33198.1 | g.chr2: 54727813C > G | c.4908C > G | p.I1636M | Missense |
| OCC06PT | ST6GAL2 | CCDS2073.1 | g.chr2: 106825995G > A | c.871C > T | p.R291C | Missense |
| OCC06PT | STAG3 | CCDS34703.1 | g.chr7: 99637885G > A | c.2549G > A | p.G850E | Missense |
| OCC06PT | TAF1 | CCDS14412.1 | g.chrX: 70559765C > T | c.4586C > T | p.S1529F | Missense |
| OCC06PT | TAF1 | CCDS14412.1 | g.chrX: 70559773C > G | c.4594C > G | p.L1532V | Missense |
| OCC06PT | TANK | CCDS2215.1 | g.chr2: 161769509G > C | c.286G > C | p.D96H | Missense |
| OCC06PT | TCERG1 | CCDS4282.1 | g.chr5: 145843332delA | c.2060delA | fs | Indel |
| OCC05PT | TCN1 | CCDS7978.1 | g.chr11: 59377272C > G | c.1220G > C | p.G407A | Missense |
| OCC06PT | TCP11L2 | CCDS9104.1 | g.chr12: 105239560G > A | c.581G > A | p.R194Q | Missense |
| OCC05PT | TENC1 | CCDS8842.1 | g.chr12: 51734479G > C | c.539G > C | p.R180P | Missense |
| OCC06PT | TFAP2A | CCDS4510.1 | g.chr6: 10518385G > C | c.215C > G | p.P72R | Missense |
| OCC01PT | THBS1 | CCDS32194.1 | g.chr15: 37666969C > T | c.1250C > T | p.S417L | Missense |
| OCC06PT | THBS2 | CCDS34574.1 | g.chr6: 169371666C > G | c.2185G > C | p.E729Q | Missense |
| OCC08PT | TKTL2 | CCDS3805.1 | g.chr4: 164613564G > A | c.773C > T | p.A258V | Missense |
| OCC01PT | TNNT3 | CCDS7727.1 | g.chr11: 1912711C > T | c.667C > T | p.R223C | Missense |
| OCC03PT | TOP1 | CCDS13312.1 | g.chr20: 39174872C > T | c.1345C > T | p.R449W | Missense |
| OCC04PT | TP53 | CCDS11118.1 | g.chr17: 7518978C > A | c.596G > T | p.G199V | Missense |
| OCC07PT | TPO | CCDS1643.1 | g.chr2: 1478811C > T | c.2050C > T | p.R684C | Missense |
| OCC08PT | TRIM7 | CCDS4462.1 | g.chr5: 180555122G > A | c.1186C > T | p.R396W | Missense |
| OCC03PT | TRPV6 | CCDSS874.1 | g.chr7: 142282824C > T | c.1241G > A | p.R414H | Missense |
| OCC06PT | TSHZ2 | CCDS33490.1 | g.chr20: 51304068G > A | c.664G > A | p.A222T | Missense |
| OCC07PT | TXLNB | CCDS34545.1 | g.chr6: 139651330C > T | c.400G > A | p.E134K | Missense |
| OCC03PT | UBE3A | CCDS32177.1 | g.chr15: 23167713T > C | c.641A > G | p.D214G | Missense |
| OCC01PT | UHRF1BP1L | CCDS31882.1 | g.chr12: 98990653G > T | c.1477C > A | p.L493I | Missense |
| OCC06PT | UTRN | CCDS34547.1 | g.chr6: 144837577C > T | c.3325C > T | p.L1109F | Missense |
| OCC06PT | VPS33B | CCDS10369.1 | g.chr15: 89362068C > G | c.148G > C | p.D50H | Missense |
| OCC02PT | WARS2 | CCDS900.1 | g.chr1: 119377335G > A | c.805C > T | p.R269C | Missense |
| OCC02PT | YEATS2 | CCDS43175.1 | g.chr3: 184959448G > C | IVS12 + 1G > C | Splice site | Splice site |
| OCC08PT | ZHX3 | CCDS13315.1 | g.chr20: 39265364C > G | c.1607G > C | p.R536T | Missense |
| OCC08PT | ZNF223 | CCDS12635.1 | g.chr19: 49262723C > T | c.902C > T | p.S301L | Missense |
| OCC08PT | ZNF318 | CCDS4895.2 | g.chr6: 43414988C > A | c.4726G > T | p.G1576C | Missense |
| OCC06PT | ZNF454 | CCDS4441.1 | g.chr5: 178324711C > T | c.700C > T | p.H234Y | Missense |
| OCC06PT | ZNF7 | CCDS6435.1 | g.chr8: 146038269C > T | c.973C > T | p.Q325X | Nonsense |
| OCC08PT | ZP4 | CCDS1615.1 | g.chr1: 236117373G > C | c.665C > G | p.A222G | Missense |
| OCC06PT | ZSCAN1 | CCDS12969.1 | g.chr19: 63257154G > A | c.1150G > A | p.V384I | Missense |
| OCC08PT | ZZEF1 | CCDS11043.1 | g.chr17: 3882226A > C | c.6835T > G | p.F2279V | Missense |
| *All coordinates refer to the human reference genome hg18 release (NCBI 36.1, March 2006). |
| TABLE S4 |
| Primers used for PCR amplification and sequencing |
| Gene | Coding Exon | SEQ ID | |||||
| Symbol | Transcript IDs | No. | Genomic Region of interest* | M13 PCR primer sequence† | SEQ ID NO: | PCR primer sequence | NO: |
| ARID1A | ENST00000324856 | 1 | chr1: 26895478-26895713 | CCCGTTCGAGTTGTCAGGT | 12 | GCAGAAAGCGGAGAGTCACA | 85 |
| ARID1A | ENST00000324856 | 1 | chr1: 26895714-26896145 | GGGAAAGGAGCTGCAGGA | 13 | ACCTCTCGGGGAGCTCAG | 86 |
| ARID1A | ENST00000324856 | 1 | chr1: 26896146-26896381 | CAGCAGAACTCTCACGACCA | 14 | CCCACTCAGCTGTGTACCTG | 87 |
| ARID1A | ENST00000324856 | 1 | chr1: 26896382-26896622 | GAGAAGAGCCAGACAATGGC | 15 | ACCCTCAACCAACTGCTCAC | 88 |
| ARID1A | ENST00000324856 | 2 | chr1: 26928725-26928945 | TTGGAAGCCAAGGATACATTC | 16 | AGGTTGGTCTCATTGCTCTTTC | 89 |
| ARID1A | ENST00000324856 | 3 | chr1: 26930226-26930491 | ACCCTGGGCCTCCTAAGTATG | 17 | ATATCTTACCTGCGGTGGAGG | 90 |
| ARID1A | ENST00000324856 | 3 | chr1: 26930492-26930686 | TGCACGTTAGAGAACCACTCTG | 18 | ACAACCAGCAAAGTCCTCACC | 91 |
| ARID1A | ENST00000324856 | 4 | chr1: 26931750-26931874 | CAGTCCCATAACCCTTTCACAG | 19 | CTGGGCAGGGAGACAGAAC | 92 |
| ARID1A | ENST00000324856 | 5 | chr1: 26959930-26960178 | GAAACTATGCAGGCATGAGCC | 20 | AAAGAACGTGTG7GATGTATTTGC | 93 |
| ARID1A | ENST00000324856 | 6 | chr1: 26960458-26960555 | TTGGCTGGATCTCTTTGTGTG | 21 | TTCATGGTCAAACAGCTCTCC | 94 |
| ARID1A | ENST00000324856 | 7 | chr1: 26961226-26961401 | TCCCAGGATAAGGATGGAGAG | 22 | GGACAGCCCTTCTCTCACAAG | 95 |
| ARID1A | ENST00000324856 | 8 | chr1: 26962047-26962367 | TTGAATGACATTGTTTGGTGTTC | 23 | GGTCCAGAAGCATCTCAATAATC | 96 |
| ARID1A | ENST00000324856 | 9 | chr1: 26965295-26965448 | ATCATCTCTGGGCTGGCTG | 24 | CACAGCACTATTTGGCTCCAG | 97 |
| ARID1A | ENST00000324856 | 10 | chr1: 26965531-26965648 | GGCTGGGATCTTGTCACTCTC | 25 | GCCAACAATTCTGCAGGTAAG | 98 |
| ARID1A | ENST00000324856 | 11 | chr1: 26966864-26967081 | CAAGAGACTTCTGAGACCCTTAGC | 26 | CATGGTACCACATGAAGCCAG | 99 |
| ARID1A | ENST00000324856 | 12 | chr1: 26970193-26970408 | ATCCTTGGCATATCCTGTTGG | 27 | GAATACCTTACAGCCTGATGGG | 100 |
| ARID1A | ENST00000324856 | 13 | chr1: 26971574-26971714 | AACAAAGGACACGCAGGAGTC | 28 | GGCCTTAGGAAGAACTTTCCC | 101 |
| ARID1A | ENST00000324856 | 14 | chr1: 26971886-26972069 | GGCTGAAGATAAGTGCATGGG | 29 | CAAGAACCCTGAGCCATTCTC | 102 |
| ARID1A | ENST00000324856 | 15 | chr1: 26972420-26972578 | GAACTCTGAAGAGGGCCTGG | 30 | AATTGGAGAGGCAGATTGAGC | 103 |
| ARID1A | ENST00000324856 | 16 | chr1: 26972654-26972799 | CAGAGTGAGGTAAGCATGACCC | 31 | CCTTGGGTGGAGAACTGATTG | 104 |
| ARID1A | ENST00000324856 | 17 | chr1: 26972876-26972980 | GTGAGTAAAGCCTGGTCTCGG | 32 | ATTGAGGACGTGGCTCTTCAG | 105 |
| ARID1A | ENST00000324856 | 18 | chr1: 26973403-26973673 | GGAAGAAAGAGTGGTGGTTGC | 33 | CCAAACTGGAATGGAAATTGG | 106 |
| ARID1A | ENST00000324856 | 18 | chr1: 26973674-26973835 | GGAGATGTACAGCGTGCCATA | 34 | TCGGTTCACGCCATGATAG | 107 |
| ARID1A | ENST00000324856 | 18 | chr1: 26973836-26974028 | GCTATGTGCGAGGCAGGTACT | 35 | GCTCAGCAAGGCACCATGT | 108 |
| ARID1A | ENST00000324856 | 18 | chr1: 26974029-26974302 | ATTGCATGGCAATGAAGGAG | 36 | CCTCCATCTAACTACCAGCCC | 109 |
| ARID1A | ENST00000324856 | 19 | chr1: 26974651-26974789 | TGGCTAAAGATGAGACATTCCC | 37 | AGACAGAAACTGCCTTCCACC | 110 |
| ARID1A | ENST00000324856 | 20 | chr1: 26978097-26978514 | GTCTTGCTCTCGAAGTGGGTC | 38 | GGAGAACCTTTGGGAAAGGAG | 111 |
| ARID1A | ENST00000324856 | 20 | chr1: 26978515-26978778 | GGCTTCGAA7GGTATTGGACA | 39 | CAGGCAAGGACAAGCCAG | 112 |
| ARID1A | ENST00000324856 | 20 | chr1: 26978779-26979042 | GGCGAGTGTAACCAAGGTGTT | 40 | GCTAAGAGTTCAGAGGCCATCA | 113 |
| ARID1A | ENST00000324856 | 20 | chr1: 26979043-26979306 | GCTAAGAGTTCAGAGGCCATCA | 41 | CCGCATCATGTCCACACTA | 114 |
| ARID1A | ENST00000324856 | 20 | chr1: 26979307-26979580 | CCTTGGTTACACTCGCCAAC | 42 | CAGCCGTGATTCGTACAGAGTA | 115 |
| ARID1A | ENST00000324856 | 20 | chr1: 26979581-26979838 | GAGGTGGAAGGAGGAGAGAGA | 43 | CTCAGTGACCGAAAGAACCC | 116 |
| KRAS | ENST00000311936 | 1 | chr12: 25253992-25254116 | TCAGTTGCCTGAAGAGAAACATAA | 44 | TAACAGTCTGCATGGAGCAGG | 117 |
| KRAS | ENST00000395977 | 1 | chr12: 25259638-25259765 | AGTGGTTGCCACCTTGTTACC | 45 | GAACAAACCAGGATTCTAGCCC | 118 |
| KRAS | ENST00000395977 | 2 | chr12: 25269811-25269978 | TGGATTAAGAAGCAATGCCCT | 46 | TGGTGTAGTGGAAACTAGGAATTACAT | 119 |
| KRAS | ENST00000395977 | 3 | chr12: 25271431-25271617 | ATGCATGGCATTAGCAAAGAC | 47 | CGTCATCTTTGGAGCAGGAAC | 120 |
| KRAS | ENST00000395977 | 4 | chr12: 25289471-25289589 | TTGAAACCCAAGGTACATTTCAG | 48 | TCTTAAGCGTCGATGGAGGAG | 121 |
| PIK3CA | ENST00000263967 | 1 | chr3: 180399304-180399543 | TCTGCTTTGGGACAACCATAC | 49 | CAACAGTTAAGCTTTATGGTTATTTGC | 122 |
| PIK3CA | ENST00000263967 | 1 | chr3: 180399544-180399663 | GCCTCCGTGAGGCTACATTA | 50 | GCAATTTAGAGCAAAGGCAGC | 123 |
| PIK3CA | ENST00000263967 | 2 | chr3: 180400168-180400385 | AAATCTACAGAGTTCCCTGTTTGC | 51 | TCAGTATAAGCAGTCCCTGCC | 124 |
| PIK3CA | ENST00000263967 | 3 | chr3: 180401768-180402026 | TGAATACTTGTTGAAATTTCTCCCT | 52 | GCAGAGCCTGCAGTGAGC | 125 |
| PIK3CA | ENST00000263967 | 4 | chr3: 180404022-180404275 | CGGAGATTTGGATGTTCTCCT | 53 | TGATTGATCTTGTGCTTCAACG | 126 |
| PIK3CA | ENST00000263967 | 5 | chr3: 180404981-180405074 | CAAACTCCGACTTCGTGATCC | 54 | TTAGTGGATGAAGGCAGCAAC | 127 |
| PIK3CA | ENST00000263967 | 6 | chr3: 180410073-180410185 | TTGGTTGATCTTTGTCTTCGTG | 55 | ATGAACCAAAGCAAGCATGAG | 128 |
| PIK3CA | ENST00000263967 | 7 | chr3: 180410664-180410824 | TGAATTTTCCTTTTGGGGAAG | 56 | GAGAGAAGGTTTGACTGCCATAA | 129 |
| PIK3CA | ENST00000263967 | 8 | chr3: 180410909-180411051 | ATGAATGAAGGCAAGCTAGGG | 57 | GATTTGCTGAACCCTATTGGTG | 130 |
| PIK3CA | ENST00000263967 | 9 | chr3: 180418688-180418820 | TGCTGAGATCAGCCAAATTCA | 58 | TCAGCAGTTACTATTCTGTGACTGG | 131 |
| PIK3CA | ENST00000263967 | 10 | chr3: 180419674-180419763 | AAAGCTAGTAATGTAAGAAGTTTGGGA | 59 | GGGAAAGATAGTTGTGAATGAGC | 132 |
| PIK3CA | ENST00000263967 | 11 | chr3: 180420049-180420221 | ATAGACTAATAGTAATATAGTGT | 60 | AAGGAAGTTGTATGGATCTAG | 133 |
| PIK3CA | ENST00000263967 | 12 | chr3: 180420427-180420538 | CGGGAGTTTGACATTGTTCTGA | 61 | CGGCCATGCAGAAACTGAC | 134 |
| PIK3CA | ENST00000263967 | 13 | chr3: 180421464-180421643 | GGCCACCTTCTATGTTCCAA | 62 | CAAGAAGCATAGGCGTGTGTC | 135 |
| PIK3CA | ENST00000263967 | 14 | chr3: 180424559-180424673 | TTTGAGGGTAGGAGAATGAGAGA | 63 | TCTGAGTGTTGCTGCTCTGTG | 136 |
| PIK3CA | ENST00000263967 | 15 | chr3: 180425178-180425307 | TCTGTTACCATAGGATAAGAAATGGA | 64 | GCTAAATTCATGCATCATAAGCTC | 137 |
| PIK3CA | ENST00000263967 | 16 | chr3: 180426440-180426526 | CATGTGATGGCGTGATCC | 65 | GGTGACACTCCAGAGGCAGTAG | 138 |
| PIK3CA | ENST00000263967 | 17 | chr3: 180429750-180429928 | GGAAAGGCAGTAAAGGTCATGC | 66 | GAGGAATACACAAACACCGACAG | 139 |
| PIK3CA | ENST00000263967 | 18 | chr3: 130430482-180430607 | TAAATGGAAACTTGCACCCTG | 67 | AAACAAATGGCACACGTTCTC | 140 |
| PIK3CA | ENST00000263967 | 19 | chr3: 180430703-180430862 | TACCCAGGCTGGTTTCAATTC | 68 | TGGTGAAAGACGATGGACAAG | 141 |
| PIK3CA | ENST00000263967 | 20 | chr3: 180434572-180434850 | GACATTTGAGCAAAGACCTGAAG | 69 | TGGATTGTGCAATTCCTATGC | 142 |
| PPP2R1A | ENST00000322088 | 1 | chr19: 57385158-57385243 | ATAAGAGACGCACGCTGATTG | 70 | ACCAAAGAAACGCGAGCTTAG | 143 |
| PPP2R1A | ENST00000322088 | 2 | chr19: 57397005-57397103 | GCTGACTGGGTTGAGAGCTG | 71 | TCCCTTTCACCATCTGTCTCC | 144 |
| PPP2R1A | ENST00000322088 | 3 | chr19: 57401024-57401132 | GTCCATGTGTTCTGAGCTTGG | 72 | TGTTGGATTAAAGCGGATGTC | 145 |
| PPP2R1A | ENST00000322088 | 4 | chr19: 57406321-57406561 | AAGGTCGGGATGGGTAATAGG | 73 | TGGGAGTGGAGAGAGTTCAGG | 146 |
| PPP2R1A | ENST00000322088 | 5 | chr19: 57407747-57407902 | TGCTGAGCTCTGGGATTCTC | 74 | AACTGCAGAGTCTGTGCTTGC | 147 |
| PPP2R1A | ENST00000322088 | 6 | chr19: 57408016-57408179 | GGTTCCTGCCCATGAAAGAG | 75 | GATCTTATTGCTCAAACGCCC | 148 |
| PPP2R1A | ENST00000322088 | 7 | chr19: 57410840-57410962 | TTTAGCACTGCTTCCAAGGC | 76 | TGATGTGCTAGTTCCACCTCC | 149 |
| PPP2R1A | ENST00000322088 | 8 | chr19: 57411065-57411143 | CTCCCACAAGGTCAAAGGTTG | 77 | AACTGCTTGAAACCCAAGAGC | 150 |
| PPP2R1A | ENST00000322088 | 9 | chr19: 57411590-57411732 | TCAGCAGATTCCTGGTCAATC | 78 | GGGCAGAAGCAGGTTATTGTC | 151 |
| PPP2R1A | ENST00000322088 | 10 | chr19: 57414752-57414933 | CCACTAAGCCTTCAAAGCCC | 79 | AGCTCTTTCCATCCTGTCCTG | 152 |
| PPP2R1A | ENST00000322088 | 11 | chr19: 57415250-57415318 | GTGTCCGGTCTTTCTAGGGTG | 80 | GATCTGTTTCGTCCTCCTCCC | 153 |
| PPP2R1A | ENST00000322088 | 12 | chr19: 57416040-57416202 | GAACCCTCTAGCATCCCTCC | 81 | TAAGCCATGGTGAGTGTGACC | 154 |
| PPP2R1A | ENST00000322088 | 13 | chr19: 57417160-57417310 | TGAGTCACCCGTATTGCTCAG | 82 | CTGACCCTGGGCTCTACCTTC | 155 |
| PPP2R1A | ENST00000322088 | 14 | chr19: 57420778-57420877 | ACAATGCCAAGGTACCTCCC | 83 | CTTGAGACTCCTCCCACCTTG | 156 |
| PPP2R1A | ENST00000322088 | 15 | chr19: 57421026-57421050 | TGGACAGTGAGACATCTTCCC | 84 | CTAGCAGGAGGGTGGACTTTG | 157 |
| *Coordinates refer to the human reference genome hg18 release (NCBI 36.1, March 2006). | |||||||
| *Coordinates refer to the human reference genome hg18 release (NCBI 36.1, March 2006). | |||||||
| †M13 denotes the universal sequencing primer 5′-GTAAAACGACGGCCAGT-3′ (SEQ ID NO: 158). |
| TABLE S5 |
| Mutations in ARID1A, KRAS, PIK3CA and PPP2R1A in Human Ovarian Clear Cell Carcinoma Cell lines |
| Transcript | Nucleotide | Amino acid | Mutation | |||
| Sample | Gene | Accession | Nucleotide (genomic)* | (cDNA) | (protein) | type |
| OV207 | ARID1A | CCDS285.1 | g.chr1:26973940G>A | c.4635G>A | p.W1545X | Nonsense |
| OVISE | ARID1A | CCDS285.1 | g.chr1:26896089dupA | c.608dupA | fs | Indel |
| OVISE | ARID1A | CCDS285.1 | g.chr1:26930505_26930506delGC | c.1626_1627delGC | fs | Indel |
| OVMANA | ARID1A | CCDS285.1 | g.chr1:26972785C>T | c.3994C>T | p.Q1332X | Nonsense |
| OVMANA | ARID1A | CCDS285.1 | g.chr1:26979767C>G | c.6791C>G | p.S2264X | Nonsense |
| OVTOKO | ARID1A | CCDS285.1 | g.chr1:26979601het_delC | c.6625delC | fs | Indel |
| OVTOKO | ARID1A | CCDS285.1 | g.chr1:26895770G>T | c.289G>T | P.E97X | Nonsense |
| TOV 21G | ARID1A | CCDS285.1 | g.chr1:26930529dupC | c.1650dupC | fs | Indel |
| TOV 21G | ARID1A | CCDS285.1 | g.chr1: 269611250delC | c.2272delC | fs | Indel |
| TOV 21G | KRAS | CCDS8703.1 | g.chr12:25289549C>A | c.38G>T | p.G13C | Missense |
| KK | PIK3CA | CCDS43171.1 | g.chr3:180418794A>C | c.1634A>C | P.E545A | Missense |
| OVCA429 | PIK3CA | CCDS43171.1 | g.chr3:180418793G>A | c.1633G>A | p.E545K | Missense |
| OVMANA | PIK3CA | CCDS43171.1 | g.chr3:180418794A>T | c.1634A>T | p.E545V | Missense |
| TOV 21G | PIK3CA | CCDS43171.1 | g.chr3:180434778C>CT | c.3139C>T | p.H1047Y | Missense |
| KK | PPP2R1A | CCDS12849.1 | g.chr19:57407795G>A | c.548G>A | p.R183Q | Missense |
| OVISE | PPP2R1A | CCDS12849.1 | g.chr19:57407794C>T | c.547C>T | p.R183W | Missense |
| OVTOKO | PPP2R1A | CCDS12849.1 | g.chr19:57407794C>G | c.547C>G | p.R183G | Missense |
| *Coordinates refer to the human reference genome hg18 release (NCBI 36.1, March 2006). |
| TABLE 2 |
| Mutations in the chromatin remodeling gene, ARID1A |
| Nucleotide | Amino acid | Mutation | MSI | |||
| Sample | Tumor type | Nucleotide (genomic)# | (cDNA)$ | (protein) | type | Status |
| 399 | Breast | g.chr1:26928914delC | c.1323delC | fs | Indel | MSS |
| 3814 | Breast | g.chr1:26979235G>A | c.6259G>A | p.G2087R | Missense | MSS |
| 5887 | Breast | g.chr1:26978695A>T | c.5719A>T | p.I1907F | Missense | MSS |
| C-122 | Breast | g.chr1:26965396C>T | c.2830C>T | p.Q944X | Nonsense | MSS |
| Co001 | Colon | g.chr1:26396495delG | c.1014delG | fs | Indel | MSI- |
| High | ||||||
| Co001 | Colon | g.chr1:26973994delC | c.4689delC | fs | Indel | MSI- |
| High | ||||||
| Co014 | Colon | g.chr1:26970279delA | c.3281delA | fs | Indel | MSI- |
| High | ||||||
| Co024 | Colon | g.chr1:26970342delC | c.3344delC | fs | Indel | MSI- |
| High | ||||||
| Co024 | Colon | g.chr1:26978524delG | c.5548delG | fs | Indel | MSI- |
| High | ||||||
| Co038 | Colon | g.chr1:26973659delC | c.4354delC | fs | Indel | MSI- |
| High | ||||||
| Co038 | Colon | g.chr1:26978524delG | c.5548delG | fs | Indel | MSI- |
| High | ||||||
| Co083 | Colon | g.chr1:26978524delG | c.5548delG | fs | Indel | MSI- |
| High | ||||||
| Co097 | Colon | g.chr1:26978524dupG | c.5548dupG | fs | Indel | MSI- |
| High | ||||||
| Hx132 | Colon | g.chr1:26931798delC | c.1848delC | fs | Indel | ND |
| Hx132 | Colon | g.chr1:26965600_26965602delAAC | c.2944_2946delAAC | in-frame | Indel | ND |
| del | ||||||
| Hx164 | Colon | g.chr1:26930536C>T | c.1657C>T | p.Q553X | Nonsense | MSS |
| Hx245 | Colon | g.chr1:26979204C>A | c.6228C>A | p.Y2076X | Nonsense | MSS |
| Hx290 | Colon | g.chr1:26978814_26978820dupACAGAGC | c.5838_5844dupACAGAGC | fs | Indel | MSS |
| (hom) | ||||||
| Hx308 | Colon | g.chr1:26978810_26978811insAGCACAG | c.5834_5835insAGCACAG | fs | Indel | ND |
| Hx326 | Colon | g.chr1:26962098_26962099dupTA | c.2467_2468dupTA | fs | Indel | MSS |
| G07 | Gastric | g.chr1:26896360dupC | c.879dupC | fs | Indel | MSI- |
| High | ||||||
| G08 | Gastric | g.chr1:26896308delG | c.827delG | fs | Indel | MSI- |
| High | ||||||
| G13 | Gastric | g.chr1:26974048_26974049delCA | c.4743_4744delCA | fs | Indel | MSI- |
| High | ||||||
| G13 | Gastric | g.chr1:26978524delG | c.5548delG | fs | Indel | MSI- |
| High | ||||||
| G13 | Gastric | g.chr1:26974277C>T | c.4972C>T | p.R1658W | Missense | MSI- |
| High | ||||||
| G18 | Gastric | g.chr1:26978335G>T | c.5359G>T | p.E1787X | Nonsense | MSS |
| G21 | Gastric | g.chr1:26978524delG | c.5548delG | fs | Indel | MSI- |
| High | ||||||
| G24 | Gastric | g.chr1:26973829T>A | c.4524T>A | p.Y1508X | Nonsense | MSI- |
| High | ||||||
| G61 | Gastric | g.chr1:26978524delG | c.5548delG | fs | Indel | ND |
| G61 | Gastric | g.chr1:26979396delC | c.6420delC | fs | Indel | ND |
| G84 | Gastric | g.chr1:26961335dupG | c.2357dupG | fs | Indel | MSS |
| G144 | Gastric | g.chr1:26896335delG | c.854delG | fs | Indel | MSS |
| G280 | Gastric | g.chr1:26896450_26896456delGGGCGCC | c.969_975delGGGCGCC | fs | Indel | MSS |
| L11C | Lung | g.chr1:26965400delG | c.2834delG | fs | Indel | ND |
| L17C | Lung | g.chr1:26979379_26979384delATTCTG | c.6403_6408delATTCTG | in-frame | Indel | MSS |
| del | ||||||
| MB118PT* | Medulloblastoma | g.chr1:26896496delG | c.1015delG | fs | Indel | MSS |
| MB155PT | Medulloblastoma | g.chr1:26974198_26974199InsC | c.4893_4894InsC | fs | Indel | MSS |
| MB156PT | Medulloblastoma | g.chr1:26974673delG | c.5012delG | fs | Indel | MSS |
| Pa07C** | Pancreas | g.chr1:26972534C>T | c.3826C>T | p.R1276X | Nonsense | MSS |
| Pa37X** | Pancreas | g.chr1:26978923_26978924delTG | c.5947_5948delTG | fs | Indel | MSS |
| Pa102C | Pancreas | g.chr1:26965645G>A | IVS10+1G>A | Splice site | Splice site | MSS |
| Pa144X | Pancreas | g.chr1:26959958_26959959insT | c.1945_1946insT | fs | Indel | MSS |
| Pa158X | Pancreas | g.chr1:26961274dupC | c.2296dupC | fs | Indel | MSS |
| Pa166X | Pancreas | g.chr1:26978941C>T | c.5965C>T | p.R1989X | Nonsense | MSS |
| Pa194X | Pancreas | g.chr1:26978941C>T | c.5965C>T | p.R1989X | Nonsense | MSS |
| Pa194X | Pancreas | g.chr1:26979263C>G | c.6287C>G | p.S2096X | Nonsense | MSS |
| Pa197X | Pancreas | g.chr1:26930464C>T | c.1585C>T | p.Q529X | Nonsense | MSS |
| Pa198X | Pancreas | g.chr1:26978524dupG | c.5548dupG | fs | Indel | MSS |
| Pa216X | Pancreas | g.chr1:26961380delG | c.2402delG | is | Indel | MSS |
| SW32 | Prostate | g.chr1:26972768delC | c.3977delC | fs | Indel | ND |
| SW32 | Prostate | g.chr1:26978524dupG | c.5548dupG | fs | Indel | ND |
| Pr04PT | Prostate | g.chr1:26972790_26972792het_delGCA | c.3999_4101delGCA | in-frame | Indel | MSI- |
| del | High | |||||
| *Mutation previously reported in Parsons et al, Science 2011 Jan. 28; 331(6016): 435-9; | ||||||
| **Mutation previously reported in Jones et al., Science 2008 Sep. 26; 321(5897); 1801-6; | ||||||
| #Genomic co-ordinates refer to hg18; | ||||||
| $Reference sequence CCDS285.1; | ||||||
| MSI, microsatellite instability; | ||||||
| MSS, microsatellite stable; | ||||||
| ND, not determined |
1. A method of detecting cancer cells, comprising:
(a) testing a biological sample of an individual to detect a mutation in an PPP2R1A GENE; AND
(b) identifying the biological sample as containing cancer cells if the PPP2R1A gene comprises the mutation,
Wherein the mutation is selected from the group consisting of 547C>G, 547C>T, and 544C>T, wherein the nucleotides are numbered by reference to SEQ ID NO:5.