US20190264222A1
2019-08-29
16/409,172
2019-05-10
Provided are novel polynucleotide compositions for enhancing the herbicidal activity of glyphosate. Specifically provided are methods and compositions for modulating 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) in plant species. The present compositions and methods are useful in controlling glyphosate resistant weeds.
Get notified when new applications in this technology area are published.
A01N37/40 » CPC further
Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids containing at least one carboxylic group or a thio analogue, or a derivative thereof, and a singly bound oxygen or sulfur atom attached to the same carbon skeleton, this oxygen or sulfur atom not being a member of a carboxylic group or of a thio analogue, or of a derivative thereof, e.g. hydroxy-carboxylic acids having at least one oxygen or sulfur atom attached to an aromatic ring system having at least one carboxylic group or a thio analogue, or a derivative thereof, and one oxygen or sulfur atom attached to the same aromatic ring system
C12N15/8261 » CPC further
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs); Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
C12N15/82 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
A01N57/20 » CPC further
Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-carbon bonds containing acyclic or cycloaliphatic radicals
This application is a continuation of U.S. patent application Ser. No. 15/111,729, filed on Jul. 14, 2017, which is a 371 National Stage Application of PCT/US2015/011408, filed on Jan. 14, 2015, which claims the benefit of U.S. Provisional Application No. 61/927,682, filed on Jan. 15, 2014, which are incorporated by reference herein in their entireties.
A computer readable form of a sequence listing is filed with this application by electronic submission and is incorporated into this application by reference in its entirety. The sequence listing is contained in the file named P34158US02 SEQ.txt, which is 16,959 bytes in size (measured in operating system MS windows) and was created on May 10, 2019.
The embodiments relate generally to the field of weed management. More specifically, embodiments relate compositions and methods for controlling weed species utalizing polynucleotide molecules. Further provided are compositions containing polynucleotide molecules and methods of utilizing such compositions for altering the physiology of plants and modulating the effect of herbicide treatment.
Weeds are plants that are unwanted in a particular environment. For example, in an agronomic environment, weeds are plants that compete with cultivated plants. Weeds can also serve as hosts for crop diseases and insect pests. In agricultural production environments, weeds can cause decreases in crop yield, reduced crop quality, increased irrigation costs, increased harvesting costs, reduced land value, injury to livestock, and crop damage from insects and diseases harbored by the weeds. The principal means by which weeds cause these effects are: 1) competing with crop plants for water, nutrients, sunlight and other essentials for growth and development, 2) production of toxic or irritant chemicals that cause human or animal health problems, 3) production of immense quantities of seed or vegetative reproductive parts or both that contaminate agricultural products and perpetuate the weed species in agricultural lands, and 4) production on agricultural and nonagricultural lands of vast amounts of vegetation requiring disposal. Weeds cost farmers billions of dollars annually in crop losses and weed control expenses.
Chemical herbicides are often used to control the growth and spread of weeds. Chemical herbicides are active at one or more target sites within a plant where they interrupt normal plant functions. For example, the herbicide N-phosphonomethyl glycine, also known as glyphosate, targets EPSPS (5-enolpyruvylshikimate-3-phosphate synthase), the enzyme that catalyzes the conversion of shikimate-3-phosphate into 5-enolpyruvyl-shikimate-3-phosphate, which is an intermediate in the biochemical pathway for creating three essential aromatic amino acids (tyrosine, phenylalanine, and tryptophan).
One limitation on the use of chemical herbicides to control weeds is the emergence of herbicide-resistant weeds. Herbicide resistance is the ability of a plant to survive and reproduce following exposure to a dose of herbicide that would normally be lethal. In weeds, herbicide resistance may occur naturally as the result of random and infrequent mutations. Where chemical herbicide application provides selection pressure, herbicide resistant plants survive to reproduce without competition from herbicide-susceptible plants. This selective pressure can lead to the appearance of increasing numbers of herbicide resistant weeds in a weed population. Herbicide tolerant weeds have been observed for nearly all herbicides in use. There are over 365 weed biotypes currently identified as being herbicide resistant to one or more herbicides by the Herbicide Resistance Action Committee (HRAC), the North American Herbicide Resistance Action Committee (NAHRAC), and the Weed Science Society of America (WSSA). There is a need to effectively manage these herbicide resistant weeds and to provide new compositions and techniques for weed management.
The present embodiments relate to compositions and methods useful for sensitizing weeds to herbicides targeting 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) for the purpose of enhancing control of weeds and for the management of herbicide resistant weeds.
Several embodiments relate to a bioactive trigger polynucleotide comprising a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NOs: 3, 5, or 9-66, or a fragment thereof. The bioactive trigger polynucleotide may be a single-stranded DNA, a single-stranded RNA, a double-stranded RNA, a double-stranded DNA, or a double-stranded DNA/RNA hybrid. In several embodiments, the bioactive trigger polynucleotide comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO 3 or SEQ ID NO 5. In some embodiments, the bioactive trigger polynucleotide comprises a nucleotide sequence that is essentially identical or essentially complementary to a sequence selected from the group consisting of SEQ ID NO: 36, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 65, SEQ ID NO: 66, or a fragment thereof. In some embodiments, the bioactive trigger polynucleotide is double-stranded RNA and the double-stranded RNA comprises SEQ ID NOs: 3 and 4. In some embodiments, the bioactive trigger polynucleotide is double-stranded RNA and the double-stranded RNA comprises SEQ ID NOs: 5 and 6. Several embodiments relate to plant cell comprising a bioactive trigger polynucleotide as described herein. Several embodiments relate to plant comprising a bioactive trigger polynucleotide as described herein.
Several embodiments relate to a composition comprising one or more bioactive trigger polynucleotides and a transfer agent, wherein one or more bioactive trigger polynucleotides comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO: 3, 5, or 9-66, or a fragment thereof. The one or more bioactive trigger polynucleotides may each, independently, be selected from the group consisting of single-stranded DNA, single-stranded RNA, double-stranded RNA, double-stranded DNA, and double-stranded DNA/RNA hybrids. In some embodiments, the composition comprises one or more bioactive trigger polynucleotides comprising a nucleotide sequence that is essentially identical or essentially complementary to a sequence selected from the group consisting of SEQ ID NO: 36, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 65, SEQ ID NO: 66, or a fragment thereof. In some embodiments, the composition comprises one or more bioactive trigger polynucleotides comprising a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO: 3 or SEQ ID NO: 5, or a fragment thereof. In some embodiments, the composition comprises one or more bioactive double-stranded RNA trigger polynucleotides comprising SEQ ID NOs: 3 and 4, or fragments thereof. In some embodiments, the composition comprises one or more bioactive double-stranded RNA trigger polynucleotides comprising SEQ ID NOs: 5 and 6, or fragments thereof. In some embodiments, the composition comprises a first bioactive trigger polynucleotide and one or more additional bioactive trigger polynucleotides that comprise a different nucleotide sequence than the first bioactive trigger polynucleotide. In some embodiments, the composition comprises a bioactive trigger polynucleotides that comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO: 3, 5, or 9-66 and a bioactive trigger molecule that is not essentially identical or essentially complementary to an EPSPS gene sequence, or to the RNA transcript of the EPSPS gene sequence. The composition can include various components. For example, the composition can include one or more of bioactive trigger polynucleotides, transfer agents, and non-polynucleotide herbicides. In some embodiments, the transfer agent is selected from the group consisting of a surfactant, such as an organosilicone surfactant, a cationic liposomal reagent and a plant hormone, such as Brassinosteroid. Examples of organosilicone surfactants include, but are not limited to, BREAK-THRUÂŽ S 321, BREAK-THRUÂŽ S 200, BREAK-THRUÂŽ OE 441, BREAK-THRUÂŽ S 278, BREAK-THRUÂŽ S 243, SILWET L-77ÂŽ, SILWETÂŽ HS 429, SILWETÂŽ HS 312, and BREAK-THRUÂŽ S 233. In some embodiments, the composition comprises an organosilicone surfactant and ammonium sulfate. In some embodiments, the composition comprises DOTAP. In some embodiments, the composition comprises a cationic lipid. In some embodiments, the composition comprises nucleic acid lipid particles. In some embodiments, the composition comprises an EPSPS-inhibitor herbicide, such as glyphosate. In some embodiments, the composition comprises a non-EPSPS-inhibitor herbicide, such as dicamba or 2,4-D.
Several embodiments relate to a method of plant control, comprising applying a bioactive trigger polynucleotide comprising a nucleotide sequence that is essentially identical or essentially complementary to an EPSPS gene sequence, or to the RNA transcript of the EPSPS gene sequence, to an external surface of a plant, plant part or seed, wherein the plant is not mechanically permiabilized and the bioactive trigger polynucleotide is incorporated into the interior of a plant cell. Examples of plants that may be controlled by such methods include, but are not limited to, Amaranthus palmeri, Amaranthus rudis, Amaranthus albus, Amaranthus chlorostachys, Amaranthus graecizans, Amaranthus hybridus, Amaranthus lividus, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis, Lolium multiflorum, Lolium rigidium, Ambrosia artemisiifolia, Ambrosia trifida, Euphorbia heterophylla, Kochia scoparia, Abutilon theophrasti, Sorghum halepense, Chenopodium album, Commelina diffusa, Convulvulus arvensis, Conyza candensis, Digitaria sanguinalis, and Xanthium strumarium. In some embodiments, the EPSPS gene sequence is selected from SEQ ID NOs: 1 or 2, or a fragment thereof. In some embodiments, the EPSPS gene sequence is selected from SEQ ID NOs: 9-66. In some embodiments, the EPSPS gene sequence is selected from SEQ ID NO 36, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 65, and SEQ ID NO 66. In some embodiments, the bioactive trigger polynucleotide comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO: 3, 5, or 9-66, or a fragment thereof. In some embodiments, the bioactive trigger polynucleotide is selected from the group consisting of single-stranded DNA, single-stranded RNA, double-stranded RNA, double-stranded DNA, and double-stranded DNA/RNA hybrids. In some embodiments, the bioactive trigger polynucleotide comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO 3 or SEQ ID NO 5, or a fragment thereof. In some embodiments, the bioactive trigger polynucleotide is double-stranded RNA comprising SEQ ID NOs: 3 and 4, or fragments thereof. In some embodiments, the bioactive trigger polynucleotide is double-stranded RNA comprising SEQ ID NOs: 5 and 6, or fragments thereof. In some embodiments of the method, a first bioactive trigger polynucleotide and one or more additional bioactive trigger polynucleotides that comprise a different nucleotide sequence than the first bioactive trigger polynucleotide is applied to the plant. In some embodiments, a bioactive trigger polynucleotide that comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO: 3, 5, or 9-66 and a bioactive trigger molecule that is not essentially identical or essentially complementary to an EPSPS gene sequence, or to the RNA transcript of the EPSPS gene sequence is applied to the plant. The method may further comprise applying one or more of a transfer agent, an EPSPS-inhibitor herbicide and other non-polynucleotide herbicides. Examples of transfer agents include, but are not limited to, surfactants, such as organosilicone surfactants, cationic lipid reagents, and plant hormones, such as Brassinosteroid. In some embodiments, the composition further comprises a non-polynucleotide herbicide. In some embodiments, the non-polynucleotide herbicide is glyphosate. In some embodiments, the non-polynucleotide herbicide is applied separately from the bioactive trigger polynucleotide. In some embodiments, the non-polynucleotide herbicide is applied concurrently with the bioactive trigger polynucleotide.
Several embodiments relate to a method of controlling growth, development or reproductive ability of a plant by topically treating the plant with a composition comprising a bioactive trigger polynucleotide and a transfer agent, wherein the bioactive trigger polynucleotide comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO: 3, 5, or 9-66, or a fragment thereof, whereby the growth, development or reproductive ability of the plant is reduced. In some embodiments, the bioactive trigger polynucleotide is selected from the group consisting of single-stranded DNA, single-stranded RNA, double-stranded RNA, double-stranded DNA, and double-stranded DNA/RNA hybrids. In some embodiments, the bioactive trigger polynucleotide comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO 3 or SEQ ID NO 5, or a fragment thereof. In some embodiments, the bioactive trigger polynucleotide comprises a nucleotide sequence that is essentially identical or essentially complementary to a sequence selected from the group consisting of SEQ ID NO 36, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 65, SEQ ID NO 66, or a fragment thereof. In some embodiments, the bioactive trigger polynucleotide is double-stranded RNA comprising SEQ ID NOs: 3 and 4, or fragments thereof. In some embodiments, the bioactive trigger polynucleotide is double-stranded RNA comprising SEQ ID NOs: 5 and 6, or fragments thereof. In some embodiments of the method, the plant is treated with a first bioactive trigger polynucleotide and one or more additional bioactive trigger polynucleotides that comprise a different nucleotide sequence than the first bioactive trigger polynucleotide. In some embodiments, the plant is treated with a bioactive trigger polynucleotide that comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO: 3, 5, or 9-66 and a bioactive trigger molecule that is not essentially identical or essentially complementary to an EPSPS gene sequence, or to the RNA transcript of the EPSPS gene sequence. The method may further comprise treating the plant with one or more of a transfer agent, an EPSPS-inhibitor herbicide and other non-polynucleotide herbicides. Examples of transfer agents include, but are not limited to, surfactants, such as organosilicone surfactants, cationic lipid reagents, and plant hormones, such as Brassinosteroid. In some embodiments, the plant is treated with a non-polynucleotide herbicide. In some embodiments, the non-polynucleotide herbicide is glyphosate. In some embodiments, the non-polynucleotide herbicide is applied separately from the bioactive trigger polynucleotide. In some embodiments, the non-polynucleotide herbicide is applied concurrently with the bioactive trigger polynucleotide.
Several embodiments relate to a method of sensitizing a weed to an EPSPS-inhibitor herbicide, comprising treating the weed with a bioactive trigger polynucleotide that is essentially identical or essentially complementary to a nucleotide sequence selected from the group consisting of SEQ ID NO:3, 5, and 9-66, or a fragment thereof, whereby the weed is more sensitive to an EPSPS-inhibitor herbicide relative to a weed not treated with the bioactive trigger polynucleotide. In some embodiments, the bioactive trigger polynucleotide is essentially identical or essentially complementary to a nucleotide sequence selected from the group consisting of SEQ ID NO 36, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 65, SEQ ID NO 66, or a fragment thereof. In some embodiments, the method further comprises treating the plant with an EPSPS-inhibitor herbicide. In some embodiments, the weed is resistant to one or more of glyphosate, dicamba and sulfonylurea. In some embodiments, the weed is selected from the group consisting of Amaranthus palmeri, Amaranthus rudis, Amaranthus albus, Amaranthus chlorostachys, Amaranthus graecizans, Amaranthus hybridus, Amaranthus lividus, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis, Lolium multiflorum, Lolium rigidium, Ambrosia artemisiifolia, Ambrosia trifida, Euphorbia heterophylla, Kochia scoparia, Abutilon theophrasti, Sorghum halepense, Chenopodium album, Commelina diffusa, Convulvulus arvensis, Conyza candensis, Digitaria sanguinalis, and Xanthium strumarium. In some embodiments, the weed is growing in a field of herbicide-resistant crop plants. The bioactive trigger polynucleotide may be single-stranded DNA, single-stranded RNA, double-stranded RNA, double-stranded DNA, or a double-stranded DNA/RNA hybrid. In some embodiments, the bioactive trigger polynucleotide is double-stranded RNA and the double-stranded RNA comprises SEQ ID NOs: 3 and 4. In some embodiments, the bioactive trigger polynucleotide is double-stranded RNA and the double-stranded RNA comprises SEQ ID NOs: 5 and 6. In several embodiments, the bioactive trigger polynucleotide is provide with a transfer agent. In some embodiments, the transfer agent is an organosilicone surfactant. For example, the organosilicone surfactant may be BREAK-THRUÂŽ S 321, BREAK-THRUÂŽ S 200, BREAK-THRUÂŽ OE 441, BREAK-THRUÂŽ S 278, BREAK-THRUÂŽ S 243, SILWET L-77ÂŽ, SILWETÂŽ HS 429, SILWETÂŽ HS 312, BREAK-THRUÂŽ S 233, or any combination thereof. In some embodiments, the transfer agent is a cationic liposomal reagent, for example, N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl-sulfate (DOTAP). In some embodiments, the transfer agent is a plant hormone, for example, Brassinosteroid. In some embodiments, the method further comprises treating the weed with an auxin-like herbicide, such as dicamba or 2,4-D.
Several embodiments relate to a method of controlling one or more plants of the following species: Amaranthus, Ambrosia, Lolium, Digitaria, Euphorbia, Kochia, Sorghum, Conyza, Chloris, Echinochola, Eleusine, Poa, Plantago, Avena, Chenopodium, Setaria, Abutilon, Ipomoea, Sesbania, Cassia, Sida, Brachiaria and Solanum by applying a bioactive trigger molecule as described herein.
Several embodiments relate to a method of controlling one or more of Alopecurus myosuroides, Avena sterilis, Avena sterilis ludoviciana, Brachiaria plantaginea, Bromus diandrus, Bromus rigidus, Cynosurus echinatus, Digitaria ciliaris, Digitaria ischaemum, Digitaria sanguinalis, Echinochloa oryzicola, Echinochloa phyllopogon, Eriochloa punctata, Hordeum glaucum, Hordeum leporinum, Ischaemum rugosum, Leptochloa chinensis, Lolium persicum, Phalaris minor, Phalaris paradoxa, Rottboellia exalta, Setaria faberi, Setaria viridis var, robusta-alba schreiber, Setaria viridis var, robusta-purpurea, Snowdenia polystachea, Sorghum sudanese, Alisma plantago-aquatica, Amaranthus lividus, Amaranthus quitensis, Ammania auriculata, Ammania coccinea, Anthemis cotula, Apera spica-venti, Bacopa rotundifolia, Bidens pilosa, Bidens subalternans, Brassica tournefortii, Bromus tectorum, Camelina microcarpa, Chrysanthemum coronarium, Cuscuta campestris, Cyperus difformis, Damasonium minus, Descurainia sophia, Diplotaxis tenuifolia, Echium plantagineum, Elatine triandra var, pedicellate, Euphorbia heterophylla, Fallopia convolvulus, Fimbristylis miliacea, Galeopsis tetrahit, Galium spurium, Helianthus annuus, Iva xanthifolia, Ixophorus unisetus, Ipomoea indica, Ipomoea purpurea, Ipomoea sepiaria, Ipomoea aquatic, Ipomoea triloba, Lactuca serriola, Limnocharis flava, Limnophila erecta, Limnophila sessiliflora, Lindernia dubia, Lindernia dubia var, major, Lindernia micrantha, Lindernia procumbens, Mesembryanthemum crystallinum, Monochoria korsakowii, Monochoria vaginalis, Neslia paniculata, Papaver rhoeas, Parthenium hysterophorus, Pentzia suffruticosa, Phalaris minor, Raphanus raphanistrum, Raphanus sativus, Rapistrum rugosum, Rotala indica var, uliginosa, Sagittaria guyanensis, Sagittaria montevidensis, Sagittaria pygmaea, Salsola iberica, Scirpus juncoides var, ohwianus, Scirpus mucronatus, Setaria lutescens, Sida spinosa, Sinapis arvensis, Sisymbrium orientale, Sisymbrium thellungii, Solanum ptycanthum, Sonchus aspen, Sonchus oleraceus, Sorghum bicolor, Stellaria media, Thlaspi arvense, Xanthium strumarium, Arctotheca calendula, Conyza sumatrensis, Crassocephalum crepidiodes, Cuphea carthagenenis, Epilobium adenocaulon, Erigeron philadelphicus, Landoltia punctata, Lepidium virginicum, Monochoria korsakowii, Solanum americanum, Solanum nigrum, Vulpia bromoides, Youngia japonica, Hydrilla verticillata, Carduus nutans, Carduus pycnocephalus, Centaurea solstitialis, Cirsium arvense, Commelina diffusa, Convolvulus arvensis, Daucus carota, Digitaria ischaemum, Echinochloa crus-pavonis, Fimbristylis miliacea, Galeopsis tetrahit, Galium spurium, Limnophila erecta, Matricaria perforate, Papaver rhoeas, Ranunculus acris, Soliva sessilis, Sphenoclea zeylanica, Stellaria media, Nassella trichotoma, Stipa neesiana, Agrostis stolonifera, Polygonum aviculare, Alopecurus japonicus, Beckmannia syzigachne, Bromus tectorum, Chloris inflate, Echinochloa erecta, Portulaca oleracea, and Senecio vulgaris by applying a bioactive trigger polynucleotide as described herein.
The following drawings form part of the specification and are included to further demonstrate certain aspects of the disclosed embodiments:
FIG. 1 shows glyphosate-tolerant Palmer plants treated with trigger polynucleotides for SEQ ID NOs: 7 and 8 and glyphosate (panel A), treated with trigger polynucleotides for SEQ ID NOs: 3 and 4 and glyphosate (panel B), or treated with trigger polynucleotides for SEQ ID NOs: 5 and 6 and glyphosate (panel C).
FIG. 2 shows a graph of % EPSPS mRNA reduction vs. control in Palmer protoplasts in response to 6 ug of SEQ ID NOs: 3 and 4 or SEQ ID NOs: 5 and 6 trigger.
FIG. 3 shows glyphosate-tolerant Waterhemp plants treated with SEQ ID NOs: 7 and 8 trigger polynucleotides and glyphosate (panel A), treated with trigger polynucleotides for SEQ ID NOs: 3 and 4 and glyphosate (panel B), or treated with trigger polynucleotides for SEQ ID NOs: 5 and 6 and glyphosate (panel C).
FIG. 4 shows the fresh weight (in grams) of plants treated with trigger polynucleotides for SEQ ID NOs: 3, 5, 7 and SEQ ID NOs: 36-64 and glyphosate.
Provided are methods and compositions containing a trigger polynucleotide that provide for regulation, repression or delay of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene expression and enhanced control of weeds. In some embodiments, the methods and compositions disclosed herein provide for increased sensitivity to an EPSPS-inhibitor herbicide. In some embodiments, the methods and compositions disclosed herein provide for regulation, repression or delay of EPSPS gene expression in glyphosate-resistant weed biotypes. Aspects of the methods and compositions disclosed herein can be applied to manage various weeds in agronomic and other cultivated environments.
The following terms are used throughout the present disclosure and the following definitions are provided to help guide those of ordinary skill in the art. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art. Where a term is provided in the singular, the plural of that term is also contemplated unless otherwise noted.
As used herein, âaâ or âanâ may mean one or more than one.
As used herein, the term âaboutâ indicates that a value includes the inherent variation or error for the device or method being employed to determine the value, or the variation that exists among the studied organism.
As used herein, the terms âDNAâ, âDNA moleculeâ, and âDNA polynucleotide moleculeâ refer to a polymer of deoxyribonucleotide bases of genomic or synthetic origin. DNA may be wholly or partially single-stranded (ssDNA) or wholly or partially double-stranded (dsDNA). In some embodiments, a DNA molecule may comprise single-stranded and double-stranded regions.
As used herein, the terms âRNAâ, âRNA moleculeâ, and âRNA polynucleotide moleculeâ refer to a polymer of ribonucleotide bases of cellular or synthetic origin. RNA may be wholly or partially single-stranded (ssRNA) or wholly or partially double-stranded (dsRNA). In some embodiments, a RNA molecule may comprise single-stranded and double-stranded regions.
As used herein, the terms âsequenceâ, ânucleotide sequenceâ or âpolynucleotide sequenceâ refer to the nucleotide sequence of a DNA molecule, an RNA molecule or a portion thereof. Unless otherwise stated, nucleotide sequences in the text of this specification are given, when read from left to right, in the 5Ⲡto 3Ⲡdirection. It is understood that any Sequence Identification Number (SEQ ID NO) disclosed in the instant application can refer to either a DNA sequence or a RNA sequence, depending on the context where that SEQ ID NO is mentioned, even if that SEQ ID NO is expressed only in a DNA sequence format or a RNA sequence format. Further, disclosure of a nucleic acid sequence discloses the sequence of its reverse complement, as one necessarily defines the other, as is known by one of ordinary skill in the art.
The term âpolynucleotideâ refers to any polymer of mononucleotides that are linked by internucleotide bonds. Polynucleotides may be composed of naturally-occurring ribonucleotides, naturally-occurring deoxyribonucleotides, analogs of naturally-occurring nucleotides (e.g., enantiomeric forms of naturally-occurring nucleotides), or any combination thereof. Where a polynucleotide is single-stranded, its length can be described in terms of the number of nucleotides. Where a polynucleotide is double-stranded, its length can be described in terms of the number of base pairs.
As used herein, the term ânon-transcribable polynucleotideâ refers to a polynucleotide that does not comprise a complete polymerase II transcription unit.
As used herein, the term âtriggerâ or âtrigger polynucleotideâ refers to a bioactive polynucleotide molecule that is substantially homologous or complementary to a polynucleotide sequence of a target gene or an RNA expressed from the target gene or a fragment thereof and functions to suppress the expression of the target gene or produce a knock-down phenotype. Trigger polynucleotides are generally described in relation to their âtarget sequence.â Trigger polynucleotides may be single-stranded DNA (ssDNA), single-stranded RNA (ssRNA), double-stranded RNA (dsRNA), double-stranded DNA (dsDNA), or double-stranded DNA/RNA hybrids. Trigger polynucleotides may comprise naturally-occurring nucleotides, modified nucleotides, nucleotide analogues or any combination thereof. In some embodiments, a trigger polynucleotide may be incorporated within a larger polynucleotide, for example in a pri-miRNA molecule. In some embodiments, a trigger polynucleotide may be processed into a small interfering RNA (siRNA).
As used herein, the term âtarget sequenceâ refers to a nucleotide sequence that occurs in a gene or gene product against which a trigger polynucleotide is directed. In this context, the term âgeneâ means a locatable region of genomic sequence, corresponding to a unit of inheritance, which includes regulatory regions, such as promoters, enhancers, 5Ⲡuntranslated regions, intron regions, 3Ⲡuntranslated regions, transcribed regions, and other functional sequence regions that may exist as native genes or transgenes in a plant genome. Depending upon the circumstances, the term target sequence can refer to the full-length nucleotide sequence of the gene or gene product targeted for suppression or the nucleotide sequence of a portion of the gene or gene product targeted for suppression. Disclosure of a target sequence necessarily discloses the sequence of its corresponding trigger polynucleotide, as one necessarily defines the other, as is known by one of ordinary skill in the art.
The term âgene expressionâ refers to the process of converting genetic information encoded in genomic DNA into RNA (e.g., mRNA, rRNA, tRNA, or snRNA) through transcription of the gene via the enzymatic action of an RNA polymerase, and into protein, through translation of mRNA. Gene expression can be regulated at many stages in the process.
As used herein, the phrases âinhibition of gene expressionâ or âgene suppressionâ or âsilencing a target geneâ and similar terms and phrases refer to the absence or observable reduction in the level of protein and/or mRNA product from the target gene. The consequences of inhibition, suppression, or silencing can be confirmed by examination of the outward properties of a cell or organism or by biochemical techniques.
As used herein, the term âsequence identityâ, âsequence similarityâ or âhomologyâ is used to describe the degree of similarity between two or more nucleotide sequences. The percentage of âsequence identityâ between two sequences is determined by comparing two optimally aligned sequences over a comparison window, such that the portion of the sequence in the comparison window may comprise additions or deletions (gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity. A sequence that is identical at every position in comparison to a reference sequence is said to be identical to the reference sequence and vice-versa. An alignment of two or more sequences may be performed using any suitable computer program. For example, a widely used and accepted computer program for performing sequence alignments is CLUSTALW v1.6 (Thompson, et al. Nucl. Acids Res., 22: 4673-4680, 1994).
As used herein âsolutionâ refers to homogeneous mixtures and non-homogeneous mixtures such as suspensions, colloids, micelles, and emulsions.
As used herein, the term âweedâ refers to any plant that is not valued where it is growing. Weeds usually exhibit vigorous growth and tend to overgrow or choke out more desirable plants. Weeds include volunteer plants, which grow on their own, rather than being planted by a farmer or gardener. For example, corn plants growing in a soybean field.
Weedy plants include, but are not limited to, important invasive and noxious weeds and herbicide resistant biotypes in crop production, such as: Amaranthus species, e.g., A. albus, A. blitoides, A. hybridus, A. palmeri, A. powellii, A. retroflexus, A. spinosus, A. tuberculatus, and A. viridis; Ambrosia species, e.g., A. trifida, and A. artemisifolia; Lolium species, e.g., L. multiflorum, L. rigidium, and L. perenne; Digitaria species, e.g., D. insularis; Euphorbia species, e.g., E. heterophylla; Kochia species, e.g., K. scoparia; Sorghum species, e.g., S. halepense; Conyza species, e.g., C. bonariensis, C. canadensis, and C. sumatrensis; Clitoris species, e.g., C. truncate; Echinochola species, e.g., E. colona and E. crus-galli; Eleusine species, e.g., E. indica; Poa species, e.g., P. annua; Plantago species, e.g., P. lanceolata; Avena species, e.g., A. fatua; Chenopodium species, e.g., C. album; Setaria species, e.g., S. viridis; Abutilon theophrasti; Ipomoea species; Sesbania species; Cassia species; Sida species; Brachiaria species and Solanum species.
Additional weedy plant species found in cultivated areas include Alopecurus myosuroides, Avena sterilis, Avena sterilis ludoviciana, Brachiaria plantaginea, Bromus diandrus, Bromus rigidus, Cynosurus echinatus, Digitaria ciliaris, Digitaria ischaemum, Digitaria sanguinalis, Echinochloa oryzicola, Echinochloa phyllopogon, Eriochloa punctata, Hordeum glaucum, Hordeum leporinum, Ischaemum rugosum, Leptochloa chinensis, Lolium persicum, Phalaris minor, Phalaris paradoxa, Rottboellia exalta, Setaria faberi, Setaria viridis var, robusta-alba schreiber, Setaria viridis var, robusta-purpurea, Snowdenia polystachea, Sorghum sudanese, Alisma plantago-aquatica, Amaranthus lividus, Amaranthus quitensis, Ammania auriculata, Ammania coccinea, Anthemis cotula, Apera spica-venti, Bacopa rotundifolia, Bidens pilosa, Bidens subalternans, Brassica tournefortii, Bromus tectorum, Camelina microcarpa, Chrysanthemum coronarium, Cuscuta campestris, Cyperus difformis, Damasonium minus, Descurainia sophia, Diplotaxis tenuifolia, Echium plantagineum, Elatine triandra var, pedicellate, Euphorbia heterophylla, Fallopia convolvulus, Fimbristylis miliacea, Galeopsis tetrahit, Galium spurium, Helianthus annuus, Iva xanthifolia, Ixophorus unisetus, Ipomoea indica, Ipomoea purpurea, Ipomoea sepiaria, Ipomoea aquatic, Ipomoea triloba, Lactuca serriola, Limnocharis flava, Limnophila erecta, Limnophila sessiliflora, Lindernia dubia, Lindernia dubia var, major, Lindernia micrantha, Lindernia procumbens, Mesembryanthemum crystallinum, Monochoria korsakowii, Monochoria vaginalis, Neslia paniculata, Papaver rhoeas, Parthenium hysterophorus, Pentzia suffruticosa, Phalaris minor, Raphanus raphanistrum, Raphanus sativus, Rapistrum rugosum, Rotala indica var, uliginosa, Sagittaria guyanensis, Sagittaria montevidensis, Sagittaria pygmaea, Salsola iberica, Scirpus juncoides var, ohwianus, Scirpus mucronatus, Setaria lutescens, Sida spinosa, Sinapis arvensis, Sisymbrium orientale, Sisymbrium thellungii, Solanum ptycanthum, Sonchus aspen, Sonchus oleraceus, Sorghum bicolor, Stellaria media, Thlaspi arvense, Xanthium strumarium, Arctotheca calendula, Conyza sumatrensis, Crassocephalum crepidiodes, Cuphea carthagenenis, Epilobium adenocaulon, Erigeron philadelphicus, Landoltia punctata, Lepidium virginicum, Monochoria korsakowii, Solanum americanum, Solanum nigrum, Vulpia bromoides, Youngia japonica, Hydrilla verticillata, Carduus nutans, Carduus pycnocephalus, Centaurea solstitialis, Cirsium arvense, Commelina diffusa, Convolvulus arvensis, Daucus carota, Digitaria ischaemum, Echinochloa crus-pavonis, Fimbristylis miliacea, Galeopsis tetrahit, Galium spurium, Limnophila erecta, Matricaria perforate, Papaver rhoeas, Ranunculus acris, Soliva sessilis, Sphenoclea zeylanica, Stellaria media, Nassella trichotoma, Stipa neesiana, Agrostis stolonifera, Polygonum aviculare, Alopecurus japonicus, Beckmannia syzigachne, Bromus tectorum, Chloris inflate, Echinochloa erecta, Portulaca oleracea, and Senecio vulgaris. The embodiments disclosed herein may be utilized to control any of these species.
As used herein, the term âherbicideâ refers to molecules that affect plant growth, development and/or reproductive ability. Herbicides may be polynucleotide or non-polynucleotide. Glyphosate is an example of a non-polynucleotide herbicide that inhibits EPSPS.
âGlyphosateâ (N-phosphonomethylglycine) herbicide inhibits the shikimic acid pathway, which leads to the biosynthesis of aromatic compounds including amino acids, plant hormones and vitamins. Specifically, glyphosate curbs the conversion of phosphoenolpyruvic acid (PEP) and 3-phosphoshikimic acid to 5-enolpyruvyl-3-phosphoshikimic acid by inhibiting the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (referred to herein as EPSP synthase or EPSPS). The term âglyphosateâ should be considered to include any herbicidally effective form of N-phosphonomethylglycine (including any salt thereof) and other forms which result in the production of the glyphosate anion in planta. Glyphosate is commercially available in numerous formulations. Examples of these formulations of glyphosate include, without limitation, those sold by Monsanto Company (St. Louis, Mo.) as ROUNDUPÂŽ, ROUNDUPÂŽ ULTRA, ROUNDUPÂŽ ULTRAMAX, ROUNDUPÂŽ CT, ROUNDUPÂŽ EXTRA, ROUNDUPÂŽ BIACTIVE, ROUNDUPÂŽ BIOFORCE, RODEOÂŽ, POLARISÂŽ, SPARKÂŽ and ACCORDÂŽ herbicides, all of which contain glyphosate as its isopropylammonium salt; ROUNDUPÂŽ WEATHERMAX, which contains glyphosate as its potassium salt; ROUNDUPÂŽ DRY and RIVALÂŽ herbicides, which contain glyphosate as its ammonium salt; ROUNDUPÂŽ GEOFORCE, which contains glyphosate as its sodium salt. Other examples include TOUCHDOWNÂŽ herbicide (Syngenta, Greensboro, N.C.), which contains glyphosate as its trimethylsulfonium salt. Various other salts of glyphosate are available for example, dimethylamine salt, isopropylamine salt, trimesium salt, potassium salt, monoammonium salt, and diammonium salt. Commerical formulations and application rates thereof are often defined in terms of acid equivalent pounds per acre (a.e. lb/ac).
Several embodiments described herein relate to compositions comprising a bioactive trigger polynucleotide targeting an EPSPS gene. Such compositions and methods of their use are useful for modulating the expression of endogenous EPSPS genes or transgenic EPSPS genes (for example, CP4 EPSPS, U.S. Pat. No. RE39,247 and 2mEPSPS, U.S. Pat. No. 6,040,497) in a plant cell. In various embodiments, a targeted EPSPS gene includes coding (protein-coding or translatable) sequence, non-coding (non-translatable) sequence, or both coding and non-coding sequence. A plant treated with a bioactive EPSPS trigger polynucleotide is more sensitive to an EPSPS-inhibitor herbicide relative to a plant that has not been treated with a bioactive EPSPS trigger polynucleotide. It is contemplated that in some embodiments the composition may contain multiple bioactive trigger polynucleotides. Where multiple bioactive trigger polynucleotides are used, the bioactive trigger polynucleotides can target multiple consecutive segments of a target gene, multiple non-consecutive segments of a target gene, multiple alleles of a target gene, or multiple different target genes from one or more species. For example, in some embodiments the composition may comprise two or more bioactive EPSPS trigger polynucleotides that are capable of binding to different EPSPS target sequences. In some embodiments, the different EPSPS target sequences may be from different plant species. In some embodiments, the different EPSPS target sequences may be from different different regions of an EPSPS gene. In some embodiments, the EPSPS target sequences may be selected from the group consisting of SEQ ID NOs: 9-66.
Several embodiments described herein relate to compositions comprising one or more bioactive trigger polynucleotides targeting an EPSPS gene and one or more bioactive trigger polynucleotides that modulate the expression of a gene other than EPSPS. In some embodiments, compositions can include one or more bioactive trigger polynucleotides targeting essential genes. Essential genes are genes in a plant that provide key enzymes or other proteins that are essential to the growth, survival, development or reproduction of the plant (Meinke, et al., Trends Plant Sci. 2008:13(9):483-91). Examples of essential genes include, but are not limited to, genes encoding biosynthetic enzymes, metabolizing enzymes, receptors, signal transduction proteins, structural proteins, transcription factors, transport proteins and regulatory RNAs, such as, microRNAs. In some embodiments, the suppression of an essential gene enhances the effect of a herbicide that affects the function of a gene product different than the suppressed essential gene.
Bioactive trigger polynucleotides used in the various embodiments may comprise single-stranded RNA, double-stranded RNA, single-stranded DNA, double-stranded DNA, RNA/DNA hybrids, chemically modified polynucleotides or any mixture thereof. In some embodiments, the bioactive trigger polynucleotide may comprise a combination of ribonucleotides and deoxyribonucleotides, for example, synthetic polynucleotides consisting mainly of ribonucleotides but with one or more terminal deoxyribonucleotides or synthetic polynucleotides consisting mainly of deoxyribonucleotides but with one or more terminal dideoxyribonucleotides. In some embodiments, the bioactive trigger polynucleotide includes non-canonical nucleotides such as inosine, thiouridine, or pseudouridine. In some embodiments, the bioactive trigger polynucleotide includes chemically modified nucleotides. For example, the naturally occurring phosphodiester backbone of a bioactive trigger polynucleotide can be partially or completely modified with phosphorothioate, phosphorodithioate, or methylphosphonate internucleotide linkage modifications, modified nucleoside bases or modified sugars can be used in the synthesis of bioactive trigger polynucleotides, and trigger polynucleotides can be labeled with a fluorescent moiety (for example, fluorescein or rhodamine) or other label (for example, biotin). Examples of chemically modified oligonucleotides or polynucleotides are well known in the art; see, for example, US Patent Publication 20110171287, US Patent Publication 20110171176, and US Patent Publication 20110152353, US Patent Publication, 20110152346, US Patent Publication 20110160082, herein incorporated in its entirety by reference hereto.
Several embodiments relate to bioactive trigger polynucleotides that modulate an endogenous EPSPS gene in a plant. In some embodiments, the bioactive EPSPS trigger polynucleotides comprise a nucleotide sequence that is essentially identical or essentially complementary to at least 10 contiguous nucleotides of an endogenous EPSPS gene of a plant, or an RNA transcribed therefrom. In some embodiments, the bioactive EPSPS trigger polynucleotides comprise a nucleotide sequence that is essentially identical or essentially complementary to 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 or more contiguous nucleotides of an endogenous EPSPS gene of a plant, or an RNA transcribed therefrom. In some embodiments, the endogenous EPSPS gene is an Abutilon theophrasti, Amaranthus graecizans, Amaranthus hybrid, Amaranthus lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus thunbergii, Amaranthus viridis, Ambrosia trifida, Chenopodium album, Convolvulus arvensis, Conyza Canadensis, Digitaria sanguinalis, Echinochloa colona, Echinochloa crus-galli, Euphorbia heterophylla, Ipomoea hederacea, Lolium multiflorum, Senna obtusifolia, Sorghum halepense, or Xanthium strumarium gene. In some embodiments, the sequence of the endogenous EPSPS gene is selected from SEQ ID NOs: 1 and 2.
By âessentially identicalâ or âessentially complementaryâ is meant that the bioactive trigger polynucleotide (or at least one strand of a double-stranded polynucleotide or portion thereof, or a portion of a single strand polynucleotide) hybridizes under physiological conditions to the endogenous gene, an RNA transcribed therefrom, or a fragment thereof, to effect regulation or suppression of the endogenous gene. For example, in some embodiments, a bioactive trigger polynucleotide has 100 percent sequence identity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity when compared to a sequence of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In some embodiments, a bioactive trigger polynucleotide has 100 percent sequence complementarity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence complementarity when compared to a sequence of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In some embodiments, a bioactive trigger polynucleotide has 100 percent sequence identity with or complementarity to one allele or one family member of a given target gene (coding or non-coding sequence of a gene). In some embodiments, a bioactive trigger polynucleotide has at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity with or complementarity to multiple alleles or family members of a given target gene. In some embodiments, a bioactive trigger polynucleotide has 100 percent sequence identity with or complementarity to multiple alleles or family members of a given target gene.
Embodiments include bioactive trigger polynucleotides having a length of 40-60 nucleotides (40-mers, 41-mers, 42-mers, 43-mers, 44-mers, 45-mers, 46-mers, 47-mers, 48-mers, 49-mers, 50-mers, 51-mers, 52-mers, 53-mers, 54-mers, 55-mers, 56-mers, 57-mers, 58-mers, 59-mers, or 60-mers). Several embodiments relate to a bioactive EPSPS trigger polynucleotide that comprises a nucleotide sequence that is substantially homologous or substantially complementary to one or more of SEQ ID NOs: 9-66 and suppresses, represses or otherwise delays the expression of a targeted EPSPS gene in one or more plant species. In some embodiments, the bioactive EPSPS trigger polynucleotide comprises a nucleotide sequence that is identical or complementary to one or more of SEQ ID NOs: 9-66. In some embodiments, the bioactive EPSPS trigger polynucleotide comprises a sequence selected from SEQ ID NOs: 3-6.
Bioactive trigger polynucleotides can be single- or double-stranded RNA or single- or double-stranded DNA or double-stranded DNA/RNA hybrids or modified analogues thereof. In some embodiments, the trigger polynucleotides are selected from the group consisting of (a) a single-stranded RNA molecule (ssRNA), (b) a ssRNA molecule that self-hybridizes to form a double-stranded RNA molecule, (c) a double-stranded RNA molecule (dsRNA), (d) a single-stranded DNA molecule (ssDNA), (e) a ssDNA molecule that self-hybridizes to form a double-stranded DNA molecule, and (f) a single-stranded DNA molecule including a modified Pol III gene that is transcribed to an RNA molecule, (g) a double-stranded DNA molecule (dsDNA), (h) a double-stranded DNA molecule including a modified Pol III gene that is transcribed to an RNA molecule, (i) a double-stranded, hybridized RNA/DNA molecule, or combinations thereof. In some embodiments these polynucleotides include chemically modified nucleotides or non-canonical nucleotides.
In some embodiments, double-stranded trigger polynucleotides may be blunt-ended or may comprise a 3Ⲡor 5Ⲡoverhang of one, two, three, four, five, or more nucleotides on one or both sides of the double-stranded region. In some embodiments, the overhang has identity or complementarity to the target gene. In some embodiments, the overhang does not have identity or complementarity to the target gene. In some embodiments, the overhang may comprise one, two, three, four, or more nucleotides such as 2â˛-deoxy (21H) nucleotides. In some embodiments, the overhang may comprise deoxythymidine (dT) nucleotides.
Double-stranded bioactive trigger polynucleotides may be formed by intramolecular hybridization or intermolecular hybridization. In some embodiments, the bioactive trigger polynucleotide may comprise single-stranded DNA or single-stranded RNA that self-hybridizes to form a hairpin structure having an at least partially double-stranded structure including at least one segment that will hybridize to an RNA transcribed from the gene targeted for suppression. In some embodiments, the bioactive trigger polynucleotide may be contained in a longer polynucleotide sequence, for example a in a pri-miRNA. Other configurations of the bioactive trigger polynucleotides are known in the field and are contemplated herein.
Methods of making bioactive trigger polynucleotides are well known in the art. For example, bioactive trigger polynucleotides can be can be expressed in host cells from a vector, chemically synthesized using known methods, or they can be transcribed in vitro by conventional enzymatic synthetic methods using, for example, the bacteriophage T7, T3 or SP6 RNA polymerases. Commercial preparation of oligonucleotides often provides two deoxyribonucleotides on the 3Ⲡend of the sense strand. Polynucleotide molecules can be synthesized from commercially available kits, for example, kits from Applied Biosystems/Ambion (Austin, Tex.) have DNA ligated on the 5Ⲡend in a microbial expression cassette that includes a bacterial T7 polymerase promoter that makes RNA strands that can be assembled into a dsRNA and kits provided by vaious manufacturers that include T7 RiboMax Express (Promega, Madison, Wis.), AmpliScribe T7-Flash (Epicentre, Madison, Wis.), and TranscriptAid T7 High Yield (Fermentas, Glen Burnie, Md.). dsRNA molecules can be produced from microbial expression cassettes in bacterial cells (Ongvarrasopone et al. ScienceAsia 33:35-39; Yin, Appl. Microbiol. Biotechnol 84:323-333, 2009; Liu et al., BMC Biotechnology 10:85, 2010) that have regulated or deficient RNase III enzyme activity or the use of various viral vectors to produce sufficient quantities of dsRNA. EPSPS gene fragments are inserted into the microbial expression cassettes in a position in which the fragments are expressed to produce ssRNA or dsRNA useful in the methods described herein to regulate expression on a target EPSPS gene. Several embodiments relate to expression constructs encoding bioactive trigger polynucleotides as described herein.
Following synthesis, the trigger polynucleotides may optionally be purified. For example, polynucleotides can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof. Alternatively, trigger polynucleotides may be used with no, or a minimum of, purification to avoid losses due to sample processing. The trigger polynucleotides may be dried for storage or dissolved in an aqueous solution. The solution may contain buffers or salts to promote annealing, and/or stabilization of the duplex strands.
Bioactive trigger polynucleotides may be provided to a plant at any dose effective to modulate the expression of the target gene or produce a knock-down phenotype. While there is no upper limit on the concentrations and dosages of bioactive trigger polynucleotides used in the compositions and methods disclosed herein, several embodiments relate to a minimum effective concentration or dosage of bioactive trigger polynucleotide. The concentration of bioactive trigger polynucleotide provided to a plant can be adjusted in consideration of the volume of spray or treatment applied to plant leaves or other plant part surfaces, such as flower petals, stems, tubers, fruit, anthers, pollen, or seed. In one embodiment, a treatment for herbaceous plants comprises providing bioactive trigger polynucleotides at about 1 nanomole (nmol) per plant. In some embodiments, a treatment for herbaceous plants comprises providing from about 0.05 to 1 nmol of bioactive trigger polynucleotide per plant. Several embodiments for herbaceous plants include ranges of about 0.05 to about 100 nmol, or about 0.1 to about 20 nmol, or about 1 nmol to about 10 nmol of bioactive trigger polynucleotides per plant. In some embodiments, a treatment for herbaceous plants comprises providing 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, or 20 nmol of bioactive trigger polynucleotides per plant.
To illustrate embodiments, the factor 1Ă, when applied to oligonucleotide molecules is arbitrarily used to denote a treatment of 0.8 nmol of bioactive trigger polynucleotide molecule per plant; 10Ă, 8 nmol of bioactive trigger polynucleotide molecule per plant; and 100Ă, 80 nmol of bioactive trigger polynucleotide molecule per plant. The amount of bioactive trigger polynucleotide provided can vary based upon the size of the treated plant. For example, for very large plants, trees, or vines a correspondingly larger amount of bioactive trigger polynucleotide may be used; while for smaller plants, a correspondingly smaller amount of bioactive trigger polynucleotide may be used. In some embodiments where long dsRNA molecules, which are processed into multiple oligonucleotides, are used, the effective concentration or dosage of bioactive trigger polynucleotide may be lower.
In several embodiments, bioactive trigger polynucleotides are incorporated into a plant cell following topical application of the bioactive trigger polynucleotides to a surface of the plant, for example, by spraying the plant with the bioactive trigger polynucleotides. In some embodiments, bioactive trigger polynucleotides are applied without wounding plant tissue and cells, such as, by mechanical-type wounding or particle bombardment. In some embodiments, bioactive trigger polynucleotides are incorporated into a plant cell without infection with viral vector.
Several embodiments relate to compositions comprising an effective amount of a bioactive trigger polynucleotide, alone or in combination with other components, for example, one or more non-polynucleotide herbicide molecules, and/or one or more transfer agents. In some embodiments, one or more bioactive trigger polynucleotides are provided in the same composition as a transfer agent. In other embodiments, the bioactive trigger polynucleotides and the transfer agent are separately applied. In some embodiments, one or more bioactive trigger polynucleotides and one or more non-polynucleotide herbicide molecules are provided in the same composition. In other embodiments, one or more bioactive trigger polynucleotides and one or more non-polynucleotide herbicide molecules are provided in separately applied compositions. In some embodiments, the transfer agent and non-polynucleotide herbicide are provided in the same composition. Several embodiments relate to a composition comprising one or more bioactive trigger polynucleotides, one or more transfer agents and one or more non-polynucleotide herbicides. In some embodiments, one or more of the bioactive trigger polynucleotide, the non-polynucleotide herbicide and the transfer agent is provided in a liquid composition.
Non-polynucleotide herbicides may be applied concomitantly with a bioactive trigger polynucleotide or the bioactive trigger polynucleotide and the non-polynucleotide herbicide may be applied at different times. In some embodiments, a composition comprising a bioactive trigger polynucleotide is provided to a plant prior to providing a composition comprising a non-polynucleotide herbicide. In some embodiments, a composition comprising a bioactive trigger polynucleotide is provided to a plant subsequent to providing a non-polynucleotide herbicide. In some embodiments, bioactive trigger polynucleotides may be applied concomitantly with a transfer agent. In other embodiments, the bioactive trigger polynucleotides and the transfer agent are applied at different times. In some embodiments, a composition comprising a bioactive trigger polynucleotide is provided to a plant prior to providing a composition comprising a transfer agent. In some embodiments, a composition comprising a bioactive trigger polynucleotide is provided to a plant subsequent to providing a transfer agent.
Several embodiments relate to compositions and methods that provide multi-species weed control. Numerous non-polynucleotide herbicides are known and can be added, either alone or in combination with one or more non-polynucleotide herbicides having similar or different modes of action (herein referred to as co-herbicides), to a composition comprising a bioactive EPSPS trigger polynucleotide or can be used in conjunction with a bioactive EPSPS trigger polynucleotide to control weeds. For example, members of the herbicide families include, but are not limited to: amide herbicides, aromatic acid herbicides, arsenical herbicides, benzothiazole herbicides, benzoylcyclohexanedione herbicides, benzofuranyl alkylsulfonate herbicides, carbamate herbicides, cyclohexene oxime herbicides, cyclopropylisoxazole herbicides, dicarboximide herbicides, dinitroaniline herbicides, dinitrophenol herbicides, diphenyl ether herbicides, dithiocarbamate herbicides, halogenated aliphatic herbicides, imidazolinone herbicides, inorganic herbicides, nitrile herbicides, organophosphorus herbicides, oxadiazolone herbicides, oxazole herbicides, phenoxy herbicides, phenylenediamine herbicides, pyrazole herbicides, pyridazine herbicides, pyridazinone herbicides, pyridine herbicides, pyrimidinediamine herbicides, pyrimidinyloxybenzylamine herbicides, quaternary ammonium herbicides, thiocarbamate herbicides, thiocarbonate herbicides, thiourea herbicides, triazine herbicides, triazinone herbicides, triazole herbicides, triazolone herbicides, triazolopyrimidine herbicides, uracil herbicides, and urea herbicides. Representative herbicides of the families include but are not limited to acetochlor, acifluorfen, acifluorfen-sodium, aclonifen, acrolein, alachlor, alloxydim, allyl alcohol, ametryn, amicarbazone, amidosulfuron, aminopyralid, amitrole, ammonium sulfamate, anilofos, asulam, atraton, atrazine, azimsulfuron, BCPC, beflubutamid, benazolin, benfluralin, benfuresate, bensulfuron, bensulfuron-methyl, bensulide, bentazone, benzfendizone, benzobicyclon, benzofenap, bifenox, bilanafos, bispyribac, bispyribac-sodium, borax, bromacil, bromobutide, bromoxynil, butachlor, butafenacil, butamifos, butralin, butroxydim, butylate, cacodylic acid, calcium chlorate, cafenstrole, carbetamide, carfentrazone, carfentrazone-ethyl, CDEA, CEPC, chlorflurenol, chlorflurenol-methyl, chloridazon, chlorimuron, chlorimuron-ethyl, chloroacetic acid, chlorotoluron, chlorpropham, chlorsulfuron, chlorthal, chlorthal-dimethyl, cinidon-ethyl, cinmethylin, cinosulfuron, cisanilide, clethodim, clodinafop, clodinafop-propargyl, clomazone, clomeprop, clopyralid, cloransulam, cloransulam-methyl, CMA, 4-CPB, CPMF, 4-CPP, CPPC, cresol, cumyluron, cyanamide, cyanazine, cycloate, cyclosulfamuron, cycloxydim, cyhalofop, cyhalofop-butyl, 2,4-D, 3,4-DA, daimuron, dalapon, dazomet, 2,4-DB, 3,4-DB, 2,4-DEB, desmedipham, dicamba, dichlobenil, ortho-dichlorobenzene, para-dichlorobenzene, dichlorprop, dichlorprop-P, diclofop, diclofop-methyl, diclosulam, difenzoquat, difenzoquat metilsulfate, diflufenican, diflufenzopyr, dimefuron, dimepiperate, dimethachlor, dimethametryn, dimethenamid, dimethenamid-P, dimethipin, dimethylarsinic acid, dinitramine, dinoterb, diphenamid, diquat, diquat dibromide, dithiopyr, diuron, DNOC, 3,4-DP, DSMA, EBEP, endothal, EPTC, esprocarb, ethalfluralin, ethametsulfuron, ethametsulfuron-methyl, ethofumesate, ethoxyfen, ethoxysulfuron, etobenzanid, fenoxaprop-P, fenoxaprop-P-ethyl, fentrazamide, ferrous sulfate, flamprop-M, flazasulfuron, florasulam, fluazifop, fluazifop-butyl, fluazifop-P, fluazifop-P-butyl, flucarbazone, flucarbazone-sodium, flucetosulfuron, fluchloralin, flufenacet, flufenpyr, flufenpyr-ethyl, flumetsulam, flumiclorac, flumiclorac-pentyl, flumioxazin, fluometuron, fluoroglycofen, fluoroglycofen-ethyl, flupropanate, flupyrsulfuron, flupyrsulfuron-methyl-sodium, flurenol, fluridone, fluorochloridone, fluoroxypyr, flurtamone, fluthiacet, fluthiacet-methyl, fomesafen, foramsulfuron, fosamine, glufosinate, glufosinate-ammonium, glyphosate, halosulfuron, halosulfuron-methyl, haloxyfop, haloxyfop-P, HC-252, hexazinone, imazamethabenz, imazamethabenz-methyl, imazamox, imazapic, imazapyr, imazaquin, imazethapyr, imazosulfuron, indanofan, iodomethane, iodosulfuron, iodosulfuron-methyl-sodium, ioxynil, isoproturon, isouron, isoxaben, isoxachlortole, isoxaflutole, karbutilate, lactofen, lenacil, linuron, MAA, MAMA, MCPA, MCPA-thioethyl, MCPB, mecoprop, mecoprop-P, mefenacet, mefluidide, mesosulfuron, mesosulfuron-methyl, mesotrione, metam, metamifop, metamitron, metazachlor, methabenzthiazuron, methylarsonic acid, methyldymron, methyl isothiocyanate, metobenzuron, metolachlor, S-metolachlor, metosulam, metoxuron, metribuzin, metsulfuron, metsulfuron-methyl, MK-66, molinate, monolinuron, MSMA, naproanilide, napropamide, naptalam, neburon, nicosulfuron, nonanoic acid, norflurazon, oleic acid (fatty acids), orbencarb, orthosulfamuron, oryzalin, oxadiargyl, oxadiazon, oxasulfuron, oxaziclomefone, oxyfluorfen, paraquat, paraquat dichloride, pebulate, pendimethalin, penoxsulam, pentachlorophenol, pentanochlor, pentoxazone, pethoxamid, petrolium oils, phenmedipham, phenmedipham-ethyl, picloram, picolinafen, pinoxaden, piperophos, potassium arsenite, potassium azide, pretilachlor, primisulfuron, primisulfuron-methyl, prodiamine, profluazol, profoxydim, prometon, prometryn, propachlor, propanil, propaquizafop, propazine, propham, propisochlor, propoxycarbazone, propoxycarbazone-sodium, propyzamide, prosulfocarb, prosulfuron, pyraclonil, pyraflufen, pyraflufen-ethyl, pyrazolynate, pyrazosulfuron, pyrazosulfuron-ethyl, pyrazoxyfen, pyribenzoxim, pyributicarb, pyridafol, pyridate, pyriftalid, pyriminobac, pyriminobac-methyl, pyrimisulfan, pyrithiobac, pyrithiobac-sodium, quinclorac, quinmerac, quinoclamine, quizalofop, quizalofop-P, rimsulfuron, sethoxydim, siduron, simazine, simetryn, SMA, sodium arsenite, sodium azide, sodium chlorate, sulcotrione, sulfentrazone, sulfometuron, sulfometuron-methyl, sulfosate, sulfosulfuron, sulfuric acid, tar oils, 2,3,6-TBA, TCA, TCA-sodium, tebuthiuron, tepraloxydim, terbacil, terbumeton, terbuthylazine, terbutryn, thenylchlor, thiazopyr, thifensulfuron, thifensulfuron-methyl, thiobencarb, tiocarbazil, topramezone, tralkoxydim, tri-allate, triasulfuron, triaziflam, tribenuron, tribenuron-methyl, tricamba, triclopyr, trietazine, trifloxysulfuron, trifloxysulfuron-sodium, trifluralin, triflusulfuron, triflusulfuron-methyl, trihydroxytriazine, tritosulfuron, [3-[2-chloro-4-fluoro-5-(-methyl-6-trifluoromethyl-2,4-dioxo-,2,3,4-t-etrahydropyrimidin-3-yl)phenoxy]-2-pyridyloxy]acetic acid ethyl ester (CAS RN 353292-3-6), 4-[(4,5-dihydro-3-methoxy-4-methyl-5-oxo)-H-,2,4-triazol-1-ylcarbonyl-sulfamoyl]-5-methylthiophene-3-carboxylic acid (BAY636), BAY747 (CAS RN 33504-84-2), topramezone (CAS RN 2063-68-8), 4-hydroxy-3-[[2-[(2-methoxyethoxy)methyl]-6-(trifluoro-methyl)-3-pyridi-nyl]carbonyl]-bicyclo[3.2.]oct-3-en-2-one (CAS RN 35200-68-5), and 4-hydroxy-3-[[2-(3-methoxypropyl)-6-(difluoromethyl)-3-pyridinyl]carbon-yl]-bicyclo[3.2.]oct-3-en-2-one. Additionally, including herbicidal compounds of unspecified modes of action as described in CN101279950A, CN101279951A, DE10000600A1, DE10116399A1, DE102004054666A1, DE102005014638A1, DE102005014906A1, DE102007012168A1, DE102010042866A1, DE10204951A1, DE10234875A1, DE10234876A1, DE10256353A1, DE10256354A1, DE10256367A1, EP1157991A2, EP1238586A1, EP2147919A1, EP2160098A2, JP03968012B2, JP2001253874A, JP2002080454A, JP2002138075A, JP2002145707A, JP2002220389A, JP2003064059A, JP2003096059A, JP2004051628A, JP2004107228A, JP2005008583A, JP2005239675A, JP2005314407A, JP2006232824A, JP2006282552A, JP2007153847A, JP2007161701A, JP2007182404A, JP2008074840A, JP2008074841A, JP2008133207A, JP2008133218A, JP2008169121A, JP2009067739A, JP2009114128A, JP2009126792A, JP2009137851A, US20060111241A1, US20090036311A1, US20090054240A1, US20090215628A1, US20100099561A1, US20100152443A1, US20110105329A1, US20110201501A1, WO2001055066A2, WO2001056975A1, WO2001056979A1, WO2001090071A2, WO2001090080A1, WO2002002540A1, WO2002028182A1, WO2002040473A1, WO2002044173A2, WO2003000679A2, WO2003006422A1, WO2003013247A1, WO2003016308A1, WO2003020704A1, WO2003022051A1, WO2003022831A1, WO2003022843A1, WO2003029243A2, WO2003037085A1, WO2003037878A1, WO2003045878A2, WO2003050087A2, WO2003051823A1, WO2003051824A1, WO2003051846A2, WO2003076409A1, WO2003087067A1, WO2003090539A1, WO2003091217A1, WO2003093269A2, WO2003104206A2, WO2004002947A1, WO2004002981A2, WO2004011429A1, WO2004029060A1, WO2004035545A2, WO2004035563A1, WO2004035564A1, WO2004037787A1, WO2004067518A1, WO2004067527A1, WO2004077950A1, WO2005000824A1, WO2005007627A1, WO2005040152A1, WO2005047233A1, WO2005047281A1, WO2005061443A2, WO2005061464A1, WO2005068434A1, WO2005070889A1, WO2005089551A1, WO2005095335A1, WO2006006569A1, WO2006024820A1, WO2006029828A1, WO2006029829A1, WO2006037945A1, WO2006050803A1, WO2006090792A1, WO2006123088A2, WO2006125687A1, WO2006125688A1, WO2007003294A1, WO2007026834A1, WO2007071900A1, WO2007077201A1, WO2007077247A1, WO2007096576A1, WO2007119434A1, WO2007134984A1, WO2008009908A1, WO2008029084A1, WO2008059948A1, WO2008071918A1, WO2008074991A1, WO2008084073A1, WO2008100426A2, WO2008102908A1, WO2008152072A2, WO2008152073A2, WO2009000757A1, WO2009005297A2, WO2009035150A2, WO2009063180A1, WO2009068170A2, WO2009068171A2, WO2009086041A1, WO2009090401A2, WO2009090402A2, WO2009115788A1, WO2009116558A1, WO2009152995A1, WO2009158258A1, WO2010012649A1, WO2010012649A1, WO2010026989A1, WO2010034153A1, WO2010049270A1, WO2010049369A1, WO2010049405A1, WO2010049414A1, WO2010063422A1, WO2010069802A1, WO2010078906A2, WO2010078912A1, WO2010104217A1, WO2010108611A1, WO2010112826A3, WO2010116122A3, WO2010119906A1, WO2010130970A1, WO2011003776A2, WO2011035874A1, WO2011065451A1, all of which are incorporated herein by reference. In some embodiments, two or more non-polynucleotide herbicides with similar modes of action are used in conjunction with a bioactive EPSPS trigger polynucleotide to control weeds. In several embodiments, compositions and methods that utilize alternative modes of action are used for difficult to control weed species. In some embodiments, two or more non-polynucleotide herbicides with different modes of action are used in conjunction with a bioactive EPSPS trigger polynucleotide to control weeds. In some embodiments, one or more non-polynucleotide herbicides with similar or different modes of action are used in conjunction with a bioactive EPSPS trigger polynucleotide and a bioactive trigger polynucleotide targeting a herbicide target gene other than EPSPS to control weeds. In some embodiments, a bioactive EPSPS trigger polynucleotide is used in conjunction with an EPSPS-inhibitor herbicide and an herbicide having a different mode of action. In some embodiments, a bioactive EPSPS trigger polynucleotide is used in conjunction with an EPSPS-inhibitor herbicide, a herbicide having a different mode of action and a bioactive trigger polynucleotide targeting a herbicide target gene other than EPSPS.
Several embodiments relate to compositions and methods that enhance the activity of non-polynucleotide herbicides. In some embodiments, the rates of use of the non-polynucleotide herbicides can be reduced in compositions comprising bioactive EPSPS trigger polynucleotides. For example, reductions in use rate of 10-25 percent, 26-50 percent, 51-75 percent or more can be achieved. In some embodiments, a bioactive EPSPS trigger polynucleotide can reduce the amount of an EPSPS-inhibitor herbicide used to effectively kill weeds by at least 10, 15, 20, 25, 30, 35, 40, 50, 55, 60, 65, 70, 75, or 80 percent.
In some embodiments, a bioactive EPSPS trigger polynucleotide is utilized in conjunction with one or more auxin-like herbicides to control weeds. Auxin-like herbicides include benzoic acid herbicide, phenoxy carboxylic acid herbicide, pyridine carboxylic acid herbicide, quinoline carboxylic acid herbicide, pyrimidine carboxylic acid herbicide, and benazolin-ethyl herbicide. Auxin-like herbicides also include phenoxy carboxylic acid compounds, pyridine carboxylic acid compounds, quinoline carboxylic acid compounds, and benazolin-ethyl compounds. Examples of phenoxy carboxylic acid compounds include, but are not limited to 2,4-dichlorophenoxyacetic acid, (4-chloro-2-methylphenoxy) acetic acid, diclorprop (2,4-DP), mecoprop (MCPP), and clomeprop. Examples of pyridine herbicides include, but are not limited to clopryalid, picloram, fluroxypyr, aminocyclopyrachlor and triclopyr. These auxin-like herbicides are useful in a tank mix, concomitantly, or pre or post treatment with the compositions. Auxin-like herbicides include commercially available formulations, for example, including but not limited to, 2,4-D, 2,4-DB (BUTYRACÂŽ 200, Albaugh, LLC, Ankeny, Iowa; Bakker), MCPA (RHONOXÂŽ, RHOMENEÂŽ, Nufarm US, Morrisville, N.C.), mecoprop, dichlorprop, 2,4,5-T, triclopyr (GARLONÂŽ, Dow AgroSciences, Indianapolis, Ind.), chloramben, dicamba (BANVELÂŽ, BASF Corporation, Ludwigshafen, Germany; CLARITYÂŽ, BASF Corporation, Ludwigshafen, Germany; ORACLEÂŽ, Gharda Chemicals Limited, Newtown, Pa.; STERLING BLUEÂŽ, Winfield Solutions, LLC, St. Paul, Minn.), 2,3,6-TBA, tricamba, clopyralid (STINGERÂŽ, Dow AgroSciences, Indianapolis, Ind.), picloram (TORDONÂŽ, Dow AgroSciences, Indianapolis, Ind.), quinmerac, quinclorac, benazolin, fenac, IAA, NAA, orthonil and fluroxypyr (VISTAÂŽ, STARANEÂŽ, Dow AgroSciences, Indianapolis, Ind.), aminopyralid (MILESTONEÂŽ, Dow AgroSciences, Indianapolis, Ind.) and aminocyclopyrachlor (Dupont, Wilmington, Del.).
In some embodiments, a bioactive EPSPS trigger polynucleotide is utilized in conjunction with one or more benzoic acid herbicides to control weeds. Benzoic acid herbicides are effective herbicides for both pre-emergence and post-emergence weed management. The benzoic acid herbicide group includes dicamba (3,6-dichloro-o-anisic acid), chloramben (3-amino-2,5-dichlorobenzoic acid), and TBA (2,3,6-trichlorobenzoic acid). Dicamba is one of the many auxin-like herbicides that is a low-cost, environmentally friendly herbicide that has been used as a pre-emergence and post-emergence herbicide to effectively control annual and perennial broadleaf weeds and several grassy weeds in corn, sorghum, small grains, pasture, hay, rangeland, sugarcane, asparagus, turf, and grass seed crops (Crop Protection Chemicals Reference, pp. 1803-1821, Chemical & Pharmaceutical Press, Inc., New York, N.Y., 11th ed., 1995). Dicamba refers to 3,6-dichloro-o-anisic acid or 3,6-dichloro-2-methoxy benzoic acid and its acids and salts. Its salts include isopropylamine, diglycoamine, dimethylamine, potassium and sodium. Examples of commercial formulations of dicamba include BANVEL⢠(as DMA salt, BASF, Research Triangle Park, N.C.), CLARITYŽ (DGA salt, BASF Corporation, Ludwigshafen, Germany), VEL-58-CS-11⢠(BASF) and VANQUISH⢠(DGA salt, BASF Corporation, Ludwigshafen, Germany). Dicamba is a useful herbicide as a tank mix, concomitantly, or pre or post treatment with the compositions.
Several embodiments relate to a method comprising providing a bioactive trigger polynucleotide to a herbicide-tolerant plant. In some embodiments, the herbicide-tolerant plant comprises a transgene that confers herbicide tolerance. Herbicides for which transgenes for plant tolerance have been demonstrated include, but are not limited to: auxin-like herbicides, glyphosate, glufosinate, sulfonylureas, imidazolinones, bromoxynil, delapon, dicamba, cyclohezanedione, protoporphyrionogen oxidase inhibitors, and 4-hydroxyphenyl-pyruvate-dioxygenase inhibitors. Transgenes and their polynucleotide molecules that encode proteins involved in herbicide tolerance are known in the art. For example, transgenes and their polynucleotide molecules that encode proteins involved in herbicide tolerance include, but are not limited to: 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), for example, as more fully described in U.S. Pat. Nos. 7,807,791, 6,248,876 B1, 5,627,061, 5,804,425, 5,633,435, 5,145,783, 4,971,908, 5,312,910, 5,188,642, 4,940,835, 5,866,775, 6,225,114 B1, 6,130,366, 5,310,667, 4,535,060, 4,769,061, 5,633,448, 5,510,471, Re. 36,449; RE 37,287 E; and 5,491,288; tolerance to sulfonylurea and/or imidazolinone, for example, as described more fully in U.S. Pat. Nos. 5,605,011, 5,013,659, 5,141,870, 5,767,361, 5,731,180, 5,304,732, 4,761,373, 5,331,107, 5,928,937, 5,378,824, and International Publication WO96/33270; tolerance to hydroxyphenylpyruvatedioxygenases inhibiting herbicides in plants, for example, as described more fully in U.S. Pat. Nos. 6,245,968 B1, 6,268,549, 6,069,115, 7,312,379, 7,935,869, 7,304,209; aryloxyalkanoate dioxygenase polynucleotides, which confer tolerance to 2,4-D and other phenoxy auxin herbicides as well as to aryloxyphenoxypropionate herbicides as described, for example, in U.S. Pat. No. 7,838,733 and International Publication WO2005/107437; and dicamba-tolerance polynucleotides as described, for example, in Herman et al. (2005) J. Biol. Chem. 280: 24759-24767. Other examples of herbicide-tolerance traits include those conferred by polynucleotides encoding an exogenous phosphinothricin acetyltransferase, such as described in U.S. Pat. Nos. 5,969,213; 5,489,520; 5,550,318; 5,874,265; 5,919,675; 5,561,236; 5,648,477; 5,646,024; 6,177,616; and 5,879,903. Plants containing an exogenous phosphinothricin acetyltransferase can exhibit improved tolerance to glufosinate herbicides, which inhibit the enzyme glutamine synthase. Additionally, herbicide-tolerance polynucleotides include those conferred by polynucleotides conferring altered protoporphyrinogen oxidase (protox) activity, as described in U.S. Pat. Nos. 6,288,306 B1; 6,282,837 B1; and 5,767,373; and International Publication WO2001/12825. Plants containing such polynucleotides can exhibit improved tolerance to any of a variety of herbicides which target the protox enzyme (also referred to as protox inhibitors). Polynucleotides encoding a glyphosate oxidoreductase and a glyphosate-N-acetyl transferase (GOX described in U.S. Pat. No. 5,463,175 and GAT described in U.S. Patent publication 20030083480, dicamba monooxygenase U.S. Pat. Nos. 7,022,896 and 7,884,262, all of which are incorporated herein by reference); a polynucleotide molecule encoding bromoxynil nitrilase (Bxn described in U.S. Pat. No. 4,810,648 for Bromoxynil tolerance, which is incorporated herein by reference); a polynucleotide molecule encoding phytoene desaturase (crtI) described in Misawa et al, (1993) Plant J. 4:833-840 and Misawa et al, (1994) Plant J. 6:481-489 for norflurazon tolerance; a polynucleotide molecule encoding acetohydroxyacid synthase (AHAS, aka ALS) described in Sathasiivan et al. (1990) Nucl. Acids Res. 18:2188-2193 for tolerance to sulfonylurea herbicides; and the bar gene described in DeBlock, et al. (1987) EMBO J. 6:2513-2519 for glufosinate and bialaphos tolerance. The transgenic coding regions and regulatory elements of the herbicide tolerance genes are targets in which bioactive polynucleotide triggers and herbicides can be included in the composition and combinations thereof to provide for enhanced methods of weed control.
Transgenic crops with one or more herbicide tolerances may need specialized methods of management to control weeds. Several embodiments enable the targeting of a transgene for herbicide tolerance to permit the treated plants to become sensitive to the herbicide. For example, an EPSPS DNA contained in a transgenic crop event can be a target for bioactive trigger polynucleotides in order to render the transgenic crop sensitive to application of the corresponding glyphosate containing herbicide. Such transgenic events are known in the art and include but are not limited to DAS-44406-6, MON883302, MON87427, FG72, HCEM485, H7-1, ASR368, J101, J163, DP-098140, GHB614, 356043, MON89788, MON88913, RT200, NK603, GTSB77, GA21, MON1445, and 40-3-2 and US patent publications: 20110126310, 20090137395, herein incorporated in their entirety by reference hereto.
Several embodiments relate to the use of a bioactive EPSPS trigger polynucleotide in conjunction with one or more transfer agents. As used herein, a âtransfer agentâ is an agent that, when combined with a polynucleotide in a composition that is topically applied to a target plant surface, enables the polynucleotide to enter a plant cell. In some embodiments, a transfer agent is an agent that conditions the surface of plant tissue, e.g., leaves, stems, roots, flowers, or fruits, to permeation by bioactive trigger polynucleotides into plant cells. In certain aspects, methods include one or more applications of a bioactive trigger polynucleotide composition and one or more applications of a transfer agent for conditioning of a plant to permeation by bioactive trigger polynucleotides. The transfer of bioactive trigger polynucleotides into plant cells can be facilitated by the prior or contemporaneous application of a polynucleotide-transferring agent to the plant tissue. In some embodiments the transferring agent is applied subsequent to the application of the polynucleotide composition. Not wishing to be bound by a particular theory, the transfer agent enables bioactive trigger polynucleotides to pass through cuticle wax barriers, stomata and/or cell wall or membrane barriers into plant cells. Suitable transfer agents to facilitate transfer of the bioactive trigger polynucleotide into a plant cell include agents that increase permeability of the exterior of the plant or that increase permeability of plant cells to oligonucleotides or polynucleotides. Such agents to facilitate transfer of the bioactive trigger polynucleotide into a plant cell include a chemical agent, or a physical agent, or combinations thereof. Chemical agents for conditioning or transfer include (a) surfactants, (b) organic solvents or an aqueous solution or aqueous mixtures of organic solvents, (c) oxidizing agents, (d) acids, (e) bases, (f) oils, (g) enzymes, or combinations thereof. Embodiments of a method of providing a bioactive polynucleotide trigger to plant cells can optionally include an incubation step, a neutralization step (e.g., to neutralize an acid, base, or oxidizing agent, or to inactivate an enzyme), a rinsing step, or combinations thereof. Embodiments of agents or treatments for conditioning of a plant to permeation by bioactive trigger polynucleotides include emulsions, reverse emulsions, liposomes, and other micellar-like compositions. Embodiments of agents or treatments for conditioning of a plant to permeation by bioactive trigger polynucleotides include counter-ions or other molecules that are known to associate with nucleic acid molecules, e.g., inorganic ammonium ions, alkyl ammonium ions, lithium ions, polyamines such as spermine, spermidine, or putrescine, and other cations. Organic solvents useful in conditioning a plant to permeation by bioactive trigger polynucleotides include DMSO, DMF, pyridine, N-pyrrolidine, hexamethylphosphoramide, acetonitrile, dioxane, polypropylene glycol, other solvents miscible with water or that will dissolve phosphonucleotides in non-aqueous systems (such as is used in synthetic reactions). Naturally derived or synthetic oils with or without surfactants or emulsifiers can be used, e.g., plant-sourced oils, crop oils (such as those listed in the 9th Compendium of Herbicide Adjuvants, publicly available on the worldwide web (internet) at herbicide.adjuvants.com) can be used, e.g., paraffinic oils, polyol fatty acid esters, or oils with short-chain molecules modified with amides or polyamines such as polyethyleneimine or N-pyrrolidine.
In several embodiments, the transfer agent is an organosilicone preparation. In certain embodiments, an organosilicone preparation that is commercially available as SILWETÂŽ L-77 surfactant having CAS Number 27306-78-1 and EPA Number: CAL.REG.NO. 5905-50073-AA, and currently available from Momentive Performance Materials, Albany, N.Y. can be used to prepare a bioactive trigger polynucleotide composition. In certain embodiments where a SILWETÂŽ L-77 organosilicone preparation is used as a pre-spray treatment of plant leaves or other plant surfaces, freshly made concentrations in the range of about 0.015 to about 2 percent by weight (wt percent) (e.g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) are efficacious in preparing a leaf or other plant surface for transfer of bioactive trigger polynucleotide molecules into plant cells from a topical application on the surface. In certain embodiments of the methods and compositions provided herein, a composition that comprises a bioactive trigger polynucleotide molecule and an organosilicone preparation comprising SILWETÂŽ L-77 in the range of about 0.015 to about 2 percent by weight (wt percent) (e.g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided.
In certain embodiments, any commercially available organosilicone preparation is used or provided. For example, one or more of the following commercially available organosilicone preparations can be used as transfer agents in a bioactive trigger polynucleotide composition or applied as a pre-spray treatment to prepare a leaf or other plant surface for transfer of bioactive trigger polynucleotide molecules into plant cells: BREAK-THRUÂŽ S 321, BREAK-THRUÂŽ S 200 Cat#67674-67-3, BREAK-THRUÂŽ OE 441 Cat#68937-55-3, BREAK-THRUÂŽ S 278 Cat #27306-78-1, BREAK-THRUÂŽ S 243, BREAK-THRUÂŽ S 233 Cat#134180-76-0, available from manufacturer Evonik Goldschmidt (Germany), SILWETÂŽ HS 429, SILWETÂŽ HS 312, SILWETÂŽ HS 508, SILWETÂŽ HS 604 (Momentive Performance Materials, Albany, N.Y.). In certain embodiments where an organosilicone preparation is used as a pre-spray treatment of plant leaves or other surfaces, freshly made concentrations in the range of about 0.015 to about 2 percent by weight (wt percent) (e.g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) are efficacious in preparing a leaf or other plant surface for transfer of bioactive trigger polynucleotide molecules into plant cells from a topical application on the surface. In certain embodiments of the methods and compositions provided herein, a composition that comprises a bioactive trigger polynucleotide molecule and an organosilicone preparation in the range of about 0.015 to about 2 percent by weight (wt percent) (e.g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided.
Organosilicone preparations used in the methods and compositions provided herein can comprise one or more effective organosilicone compounds. As used herein, the phrase âeffective organosilicone compoundâ is used to describe any organosilicone compound that is found in an organosilicone preparation that promotes internalization of a bioactive trigger polynucleotide into a plant cell. In certain embodiments, an effective organosilicone compound can enable a bioactive trigger polynucleotide to enter a plant cell in a manner permitting bioactive trigger polynucleotide mediated suppression of target gene expression in the plant cell. In general, effective organosilicone compounds include, but are not limited to, compounds that can comprise: i) a trisiloxane head group that is covalently linked to, ii) an alkyl linker including, but not limited to, an n-propyl linker, that is covalently linked to, iii) a poly glycol chain, that is covalently linked to, iv) a terminal group. Trisiloxane head groups of such effective organosilicone compounds include, but are not limited to, heptamethyltrisiloxane. Alkyl linkers can include, but are not limited to, an n-propyl linker. Poly glycol chains include, but are not limited to, polyethylene glycol or polypropylene glycol. Poly glycol chains can comprise a mixture that provides an average chain length ânâ of about â7.5â. In certain embodiments, the average chain length ânâ can vary from about 5 to about 14. Terminal groups can include, but are not limited to, alkyl groups such as a methyl group. Effective organosilicone compounds are believed to include, but are not limited to, trisiloxane ethoxylate surfactants or polyalkylene oxide modified heptamethyl trisiloxane.
(Compound I: polyalkyleneoxide heptamethyltrisiloxane, average n=7.5).
In certain embodiments, an organosilicone preparation that comprises an organosilicone compound comprising a trisiloxane head group is used in the methods and compositions provided herein. In certain embodiments, an organosilicone preparation that comprises an organosilicone compound comprising a heptamethyltrisiloxane head group is used in the methods and compositions provided herein. In certain embodiments, an organosilicone composition that comprises Compound I is used in the methods and compositions provided herein. In certain embodiments, an organosilicone composition that comprises Compound I is used in the methods and compositions provided herein. In certain embodiments of the methods and compositions provided herein, a composition that comprises a bioactive trigger polynucleotide molecule and one or more effective organosilicone compound in the range of about 0.015 to about 2 percent by weight (wt percent) (e.g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided.
In several embodiments, the transfer agent is a plant hormone. Examples of plant hormones include abscisic acid, auxin, cytokinin, gibberellin, jasmonate, ethylene, salicyclic acid, nitric oxide, a strigolactone. In some embodiments, the transfer agent is the plant hormone, Brassinosteroid.
In several embodiments, the transfer agent is a cationic lipid. As used herein, âcationic lipidâ refers to a compound that includes at least one lipid moiety and a positively charged quaternary nitrogen associated with a counterion. âLipidsâ are understood to be comprised of a hydrophobic alkyl or alkenyl moiety and a carboxylic acid or ester moiety. In some embodiments one ore more bioactive trigger molecules interact with cationic lipids to form nucleic acid lipid particles. In some embodiments, the bioactive trigger molecules are encapsulated in a liposome so that the bioactive trigger molecules is inaccessible to an aqueous medium. In some embodiments, the liposome will have a solid core comprised of bioactive trigger molecules; such liposomes encapsulating bioactive trigger molecules and having a solid core are termed âlipid nanoparticlesâ herein. In some embodiments, the bioactive trigger molecules are not encapsulated by a liposome. In such embodiments, the bioactive trigger molecules can be complexed on the outer surface of the. In these embodiments, the bioactive trigger molecules is accessible to the aqueous medium. In some embodiments, the cationic lipids can be used in combination with other lipid components such as cholesterol and PEG-lipids to form lipid nanoparticles with bioactive trigger molecules.
In several embodiments, expression of an EPSPS gene in a plant is modulated by (a) conditioning of a plant to permeation by bioactive trigger polynucleotides and (b) treatment of the plant with the bioactive trigger polynucleotides, wherein the bioactive trigger polynucleotides include at least one segment of 18 or more contiguous nucleotides cloned from or otherwise identified from the target EPSPS gene in either anti-sense or sense orientation, whereby the bioactive trigger polynucleotide molecules permeate the interior of the plant and induce modulation of the target gene. The conditioning and polynucleotide application can be performed separately or in a single step. When the conditioning and bioactive trigger polynucleotide application are performed in separate steps, the conditioning can precede or can follow the bioactive trigger polynucleotide application within minutes, hours, or days. In some embodiments more than one conditioning step or more than one application of bioactive trigger polynucleotide molecules can be performed on the same plant.
In some embodiments, ligands can be tethered to a bioactive trigger polynucleotide, for example a dsRNA, ssRNA, dsDNA or ssDNA trigger polynucleotide. Ligands in general can include modifiers, e.g., for enhancing uptake; diagnostic compounds or reporter groups e.g., for monitoring distribution; cross-linking agents; nuclease-resistance conferring moieties; and natural or unusual nucleobases. General examples include lipophiles, lipids (e.g., cholesterol, a bile acid, or a fatty acid (e.g., lithocholic-oleyl, lauroyl, docosnyl, stearoyl, palmitoyl, myristoyl oleoyl, linoleoyl), steroids (e.g., uvaol, hecigenin, diosgenin), terpenes (e.g., triterpenes, e.g., sarsasapogenin, Friedelin, epifriedelanol derivatized lithocholic acid), vitamins (e.g., folic acid, vitamin A, biotin, pyridoxal), carbohydrates, proteins, protein binding agents, integrin targeting molecules, polycationics, peptides, polyamines, and peptide mimics. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., polyethylene glycol (PEG), PEG-40K, PEG-20K and PEG-5K. Other examples of ligands include lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, glycerol (e.g., esters and ethers thereof, e.g., C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, or C20 alkyl; e.g., lauroyl, docosnyl, stearoyl, oleoyl, linoleoyl 1,3-bis-O(hexadecyl)glycerol, 1,3-bis-O(octaadecyl)glycerol), geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dodecanoyl, lithocholyl, 5β-cholanyl, N,N-distearyl-lithocholamide, 1,2-di-O-stearoylglyceride, dimethoxytrityl, or phenoxazine) and PEG (e.g., PEG-5K, PEG-20K, PEG-40K). In some embodiments, the lipophilic moieties are selected from a group consisting of lipid, cholesterols, oleyl, retinyl, and cholesteryl residues.
In some embodiments, conjugating a ligand to a bioactive trigger polynucleotide, for example dsRNA, enhances its cellular absorption. In some embodiments, a lipophilic moiety is conjugated to a bioactive trigger polynucleotide, for example dsRNA. Lipophilic compounds that may be conjugated to a bioactive trigger polynucleotide include, but are not limited to, 1-pyrene butyric acid, 1,3-bis-O-(hexadecyl)glycerol, and menthol. One example of a ligand for receptor-mediated endocytosis is folic acid. Folic acid enters the cell by folate-receptor-radiated endocytosis. Bioactive trigger polynucleotides bearing folic acid would be efficiently transported into the cell via the folate-receptor-mediated endocytosis. Other ligands that have been conjugated to polynucleotides include polyethylene glycols, carbohydrate clusters, cross-linking agents, porphyrin conjugates, delivery peptides and lipids such as cholesterol. In certain instances, conjugation of a cationic ligand to polynucleotides results in improved resistance to nucleases. Representative examples of cationic ligands are propylammonium and dimethylpropylammonium. Interestingly, antisense polynucleotides were reported to retain their high binding affinity to mRNA when the cationic ligand was dispersed, throughout the oligonucleotide. See M. Manoharan Antisense & Nucleic Acid Drug Development 2002, 12, 103 and references therein.
Delivery of bioactive trigger nucleotides to the interior of a plant cell can be accomplished by a variety of methods including, without limitation, (1) loading liposomes with a trigger polynucleotide provided herein and (2) complexing a trigger polynucleotide with lipids or liposomes to form nucleic acid-lipid or nucleic acid-liposome complexes. The liposome can be composed of cationic and neutral lipids commonly used to transfect cells in vitro. Cationic lipids can complex (e.g., charge-associate) with negatively charged, nucleic acids to form liposomes. Examples of cationic liposomes include, without limitation, LIPOFECTINŽ (Invitrogen/Life Technologies, Carlsbad, Calif.; a 1:1 (w/w) liposome formulation of the cationic lipid N-[1-(2,3-dioleyloxy)propyl]-n,n,n-trimethylammonium chloride (DOTMA)), LIPOFECTAMINEŽ (Invitrogen/Life Technologies, Carlsbad, Calif.; a cationic liposome formulation with a neutral co-lipid), LIPOFECTACEŽ (Invitrogen/Life Technologies, Carlsbad, Calif.; a 1:2.5 (w/w) formulation of dimethyldioctadecylammonium bromide and dioleoylphosphatidylethanolamine), and DOTAP. Procedures for forming liposomes are well known in the art. Liposome compositions can be formed, for example, from phosphatidylcholine, dimyristoyl phosphatidylcholine, dipalmitoyl phosphatidylcholine, dimyristoyl phosphatidyl glycerol, dioleoyl phosphatidylethanolamine or liposomes comprising dihydrosphingomyelin (DHSM). Numerous lipophilic agents are commercially available, including LIPOFECTINŽ (Invitrogen/Life Technologies, Carlsbad, Calif.) and EFFECTENE⢠(Qiagen, Valencia, Calif.; a non-liposomal lipid formulation in conjunction with a DNA-condensing enhancer). In addition, systemic delivery methods can be optimized using commercially available cationic lipids such as DDAB or DOTAP, each of which can be mixed with a neutral lipid such as DOPE or cholesterol. In some eases, liposomes such as those described by Templeton et al. (Nature Biotechnology, 15:647-652 (1997)) can be used. In other embodiments, polycations such as polyethyleneimine can be used to achieve delivery in vivo and ex vivo (Boletta et al., J. Am Soc. Nephrol. 7:1728 (1996)). Additional information regarding the use of liposomes to deliver nucleic acids can be found in U.S. Pat. No. 6,271,359, PCT Publication WO 96/40964 and Morrissey, D. et al. 2005. Nat Biotechnol. 23(8):1002-7.
In some embodiments, the bioactive trigger polynucleotide compositions may also be used as mixtures with various agricultural chemicals and/or insecticides, miticides and fungicides, pesticidal and biopesticidal agents. Examples include but are not limited to azinphos-methyl, acephate, isoxathion, isofenphos, ethion, etrimfos, oxydemeton-methyl, oxydeprofos, quinalphos, chlorpyrifos, chlorpyrifos-methyl, chlorfenvinphos, cyanophos, dioxabenzofos, dichlorvos, disulfoton, dimethylvinphos, dimethoate, sulprofos, diazinon, thiometon, tetrachlorvinphos, temephos, tebupirimfos, terbufos, naled, vamidothion, pyraclofos, pyridafenthion, pirimiphos-methyl, fenitrothion, fenthion, phenthoate, flupyrazophos, prothiofos, propaphos, profenofos, phoxime, phosalone, phosmet, formothion, phorate, malathion, mecarbam, mesulfenfos, methamidophos, methidathion, parathion, methyl parathion, monocrotophos, trichlorphon, EPN, isazophos, isamidofos, cadusafos, diamidaphos, dichlofenthion, thionazin, fenamiphos, fosthiazate, fosthietan, phosphocarb, DSP, ethoprophos, alanycarb, aldicarb, isoprocarb, ethiofencarb, carbaryl, carbosulfan, xylylcarb, thiodicarb, pirimicarb, fenobucarb, furathiocarb, propoxur, bendiocarb, benfuracarb, methomyl, metolcarb, XMC, carbofuran, aldoxycarb, oxamyl, acrinathrin, allethrin, esfenvalerate, empenthrin, cycloprothrin, cyhalothrin, gamma-cyhalothrin, lambda-cyhalothrin, cyfluthrin, beta-cyfluthrin, cypermethrin, alpha-cypermethrin, zeta-cypermethrin, silafluofen, tetramethrin, tefluthrin, deltamethrin, tralomethrin, bifenthrin, phenothrin, fenvalerate, fenpropathrin, furamethrin, prallethrin, flucythrinate, fluvalinate, flubrocythrinate, permethrin, resmethrin, ethofenprox, cartap, thiocyclam, bensultap, acetamiprid, imidacloprid, clothianidin, dinotefuran, thiacloprid, thiamethoxam, nitenpyram, chlorfluazuron, diflubenzuron, teflubenzuron, triflumuron, novaluron, noviflumuron, bistrifluoron, fluazuron, flucycloxuron, flufenoxuron, hexaflumuron, lufenuron, chromafenozide, tebufenozide, halofenozide, methoxyfenozide, diofenolan, cyromazine, pyriproxyfen, buprofezin, methoprene, hydroprene, kinoprene, triazamate, endosulfan, chlorfenson, chlorobenzilate, dicofol, bromopropylate, acetoprole, fipronil, ethiprole, pyrethrin, rotenone, nicotine sulphate, BT (Bacillus Thuringiensis) agent, spinosad, abamectin, acequinocyl, amidoflumet, amitraz, etoxazole, chinomethionat, clofentezine, fenbutatin oxide, dienochlor, cyhexatin, spirodiclofen, spiromesifen, tetradifon, tebufenpyrad, binapacryl, bifenazate, pyridaben, pyrimidifen, fenazaquin, fenothiocarb, fenpyroximate, fluacrypyrim, fluazinam, flufenzin, hexythiazox, propargite, benzomate, polynactin complex, milbemectin, lufenuron, mecarbam, methiocarb, mevinphos, halfenprox, azadirachtin, diafenthiuron, indoxacarb, emamectin benzoate, potassium oleate, sodium oleate, chlorfenapyr, tolfenpyrad, pymetrozine, fenoxycarb, hydramethylnon, hydroxy propyl starch, pyridalyl, flufenerim, flubendiamide, flonicamid, metaflumizole, lepimectin, TPIC, albendazole, oxibendazole, oxfendazole, trichlamide, fensulfothion, fenbendazole, levamisole hydrochloride, morantel tartrate, dazomet, metam-sodium, triadimefon, hexaconazole, propiconazole, ipconazole, prochloraz, triflumizole, tebuconazole, epoxiconazole, difenoconazole, flusilazole, triadimenol, cyproconazole, metconazole, fluquinconazole, bitertanol, tetraconazole, triticonazole, flutriafol, penconazole, diniconazole, fenbuconazole, bromuconazole, imibenconazole, simeconazole, myclobutanil, hymexazole, imazalil, furametpyr, thifluzamide, etridiazole, oxpoconazole, oxpoconazole fumarate, pefurazoate, prothioconazole, pyrifenox, fenarimol, nuarimol, bupirimate, mepanipyrim, cyprodinil, pyrimethanil, metalaxyl, mefenoxam, oxadixyl, benalaxyl, thiophanate, thiophanate-methyl, benomyl, carbendazim, fuberidazole, thiabendazole, manzeb, propineb, zineb, metiram, maneb, ziram, thiuram, chlorothalonil, ethaboxam, oxycarboxin, carboxin, flutolanil, silthiofam, mepronil, dimethomorph, fenpropidin, fenpropimorph, spiroxamine, tridemorph, dodemorph, flumorph, azoxystrobin, kresoxim-methyl, metominostrobin, orysastrobin, fluoxastrobin, trifloxystrobin, dimoxystrobin, pyraclostrobin, picoxystrobin, iprodione, procymidone, vinclozolin, chlozolinate, flusulfamide, dazomet, methyl isothiocyanate, chloropicrin, methasulfocarb, hydroxyisoxazole, potassium hydroxyisoxazole, echlomezol, D-D, carbam, basic copper chloride, basic copper sulfate, copper nonylphenolsulfonate, oxine copper, DBEDC, anhydrous copper sulfate, copper sulfate pentahydrate, cupric hydroxide, inorganic sulfur, wettable sulfur, lime sulfur, zinc sulfate, fentin, sodium hydrogen carbonate, potassium hydrogen carbonate, sodium hypochlorite, silver, edifenphos, tolclofos-methyl, fosetyl, iprobenfos, dinocap, pyrazophos, carpropamid, fthalide, tricyclazole, pyroquilon, diclocymet, fenoxanil, kasugamycin, validamycin, polyoxins, blasticiden S, oxytetracycline, mildiomycin, streptomycin, rape seed oil, machine oil, benthiavalicarbisopropyl, iprovalicarb, propamocarb, diethofencarb, fluoroimide, fludioxanil, fenpiclonil, quinoxyfen, oxolinic acid, chlorothalonil, captan, folpet, probenazole, acibenzolar-S-methyl, tiadinil, cyflufenamid, fenhexamid, diflumetorim, metrafenone, picobenzamide, proquinazid, famoxadone, cyazofamid, fenamidone, zoxamide, boscalid, cymoxanil, dithianon, fluazinam, dichlofluanide, triforine, isoprothiolane, ferimzone, diclomezine, tecloftalam, pencycuron, chinomethionat, iminoctadine acetate, iminoctadine albesilate, ambam, polycarbamate, thiadiazine, chloroneb, nickel dimethyldithiocarbamate, guazatine, dodecylguanidine-acetate, quintozene, tolylfluanid, anilazine, nitrothalisopropyl, fenitropan, dimethirimol, benthiazole, harpin protein, flumetover, mandipropamide and penthiopyrad.
In some embodiments, an agronomic field in need of weed control is treated by application of an agricultural chemical composition directly to the surface of the growing plants, such as by a spray. For example, a composition comprising a bioactive trigger polynucleotide and one or more of a transfer agent and a non-polynucleotide herbicide is applied to control weeds in a field of crop plants by spraying the field with the composition. The composition can be provided as a tank mix with one or more herbicidal chemicals and additional pesticidal chemicals to control pests and diseases of the crop plants in need of pest and disease control. In some embodiments, a sequential treatment of components (for example, the bioactive trigger polynucleotide-containing composition followed by the herbicide), or a simultaneous treatment or mixing of one or more of the components of the composition from separate containers is contemplated. Treatment of the field can occur as often as needed to provide weed control and the components of the composition can be adjusted to target specific weed species or weed families through utilization of specific bioactive trigger polynucleotides or bioactive trigger polynucleotide-containing compositions capable of selectively targeting the specific species or plant family to be controlled. The composition can be applied at effective use rates according to the time of application to the field, for example, preplant, at planting, post planting, and post harvest. Glyphosate can be applied to a field at rates of 11-44 ounces/acre up to 7.2875 pounds/acre. The bioactive trigger polynucleotides of the composition can be applied at rates of 1 to 30 grams per acre depending on the number of bioactive trigger polynucleotide molecules needed for the scope of weeds in the field.
Crop plants in which weed control may be needed include but are not limited to corn, soybean, cotton, canola, sugar beet, alfalfa, sugarcane, rice, and wheat; vegetable plants including, but not limited to, tomato, sweet pepper, hot pepper, melon, watermelon, cucumber, eggplant, cauliflower, broccoli, lettuce, spinach, onion, peas, carrots, sweet corn, Chinese cabbage, leek, fennel, pumpkin, squash or gourd, radish, Brussels sprouts, tomatillo, garden beans, dry beans, or okra; culinary plants including, but not limited to, basil, parsley, coffee, or tea; or fruit plants including but not limited to apple, pear, cherry, peach, plum, apricot, banana, plantain, table grape, wine grape, citrus, avocado, mango, or berry; a tree grown for ornamental or commercial use, including, but not limited to, a fruit or nut tree; ornamental plant (e.g., an ornamental flowering plant or shrub or turf grass). The methods and compositions provided herein can also be applied to plants that are not grown from seed, including fruit trees and plants that include, but are not limited to, avocados, tomatoes, eggplant, cucumber, melons, watermelons, and grapes as well as various ornamental plants. For example, methods and compositions provided herein can also be applied to plants produced by a cutting, cloning, or grafting process.
All publications, patents and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
The following Examples are presented for the purposes of illustration and should not be construed as limitations.
A major mechanism of glyphosate resistance in weeds is through amplification of the gene encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). For example, genotyping of glyphosate-resistant Palmer amaranth has revealed glyphosate-resistant plants with 4 to more than 100 copies of the EPSPS gene. Bioactive trigger polynucleotide molecules targeting the EPSPS gene for down regulation are useful in controlling herbicide resistant weeds.
As shown in Table 1, two dsRNA molecules were designed using Palmer amaranth EPSPS cDNA sequence (SEQ ID NO: 1) to comprise an anti-sense strand that is complementary to positions 398-447 (, SEQ ID NO: 4) or positions 1189-1241 (, SEQ ID NO: 6) of Amaranthus palmeri EPSPS cDNA. The Palmer amaranth EPSPS sequences targeted by the bioactive dsRNA triggers are indicated by the lowercase nucleotides. The two bioactive dsRNA trigger molecules are further capable of hybridizing with mRNA transcribed from the Amaranthus rudis (waterhemp) EPSPS gene (SEQ ID NO: 2). As shown in Table 1, SEQ ID NO: 4 complements Amaranthus rudis EPSPS at positions 398-427, 429-433, and 435-447 as indicated by the lowercase nucleotides, with two mismatches at positions 428 and 434 (underlined). SEQ ID NO: 6 complements Amaranthus rudis EPSPS at positions 1189-1202, and 1204-1241 as indicated by the lowercase nucleotides, with one mismatch at position 1203 (underlined).
| TABLEâ1 |
| EPSPSâtargetâandâtriggerâsequencesâSEQâIDâNOs:â1-8 |
| SEQâID | ||
| NO: | Description | Sequence |
| 1 | EPSPSâcDNA | ATGGCTCAAGCTACTACCATCAACAATGGTGTCCATACTGGTCAAT |
| Amaranthus | TGCACCATACTTTACCCAAAACCCAGTTACCCAAATCTTCAAAAAC | |
| palmeri | TCTTAATTTTGGATCAAACTTGAGAATTTCTCCAAAGTTCATGTCTT | |
| TAACCAATAAAAGAGTTGGTGGGCAATCATCAATTGTTCCCAAGA | ||
| TTCAAGCTTCTGTTGCTGCTGCAGCTGAGAAACCTTCATCTGTCCC | ||
| AGAAATTGTGTTACAACCCATCAAAGAGATCTCTGGTACTGTTCAA | ||
| TTGCCTGGGTCAAAGTCTTTATCCAATCGAATCCTTCTTTTAGCTGC | ||
| TTTGTCTGAGGGCACAACAGTGGTCGACAACTTGCTGTATAGTGAT | ||
| GATATTCTTTATATGTTGGACGCTCTCAgaactcttggtttaaaagtggaggatgata | ||
| gtacagccaaaagggcagtcGTAGAGGGTTGTGGTGGTCTGTTTCCTGTTGGT | ||
| AAAGATGGAAAGGAAGAGATTCAACTTTTCCTTGGTAATGCAGGA | ||
| ACAGCGATGCGCCCATTGACAGCTGCGGTTGCCGTTGCTGGAGGA | ||
| AATTCAAGTTATGTGCTTGATGGAGTACCAAGAATGAGGGAGCGC | ||
| CCCATTGGGGATCTGGTAGCAGGTCTAAAGCAACTTGGTTCAGATG | ||
| TAGATTGTTTTCTTGGCACAAATTGCCCTCCTGTTCGGGTCAATGCT | ||
| AAAGGAGGCCTTCCAGGGGGCAAGGTCAAGCTCTCTGGATCGGTT | ||
| AGTAGCCAATATTTAACTGCACTTCTCATGGCTACTCCTTTGGGTCT | ||
| TGGAGACGTGGAGATTGAGATAGTTGATAAATTGATTTCTGTACCG | ||
| TATGTTGAAATGACAATAAAGTTGATGGAACGCTTTGGAGTATCCG | ||
| TAGAACATAGTGATAGTTGGGACAGGTTCTACATTCGAGGTGGTC | ||
| AGAAATACAAATCTCCTGGAAAGGCATATGTTGAGGGTGATGCTT | ||
| CAAGTGCTAGCTACTTCCTAGCCGGAGCCGCCGTCACTGGTGGGAC | ||
| TGTCACTGTCAAGGGTTGTGGAACAAGCAGTTTACAGGGTGATGT | ||
| AAAATTTGCCGAAGTTCTTGAGAAGATGGGTTGCAAGGTCACCTG | ||
| GACAGAGAATAGTGTAACTGTTACTGGACCACCCAGGGATTCATC | ||
| TGGAAAGAAACATCTGCGTGCTATCgacgtcaacatgaacaaaatgccagatgttgct | ||
| atgactcttgcagttgttgcCTTGTATGCAGATGGGCCCACCGCCATCAGAGAT | ||
| GTGGCTAGCTGGAGAGTGAAGGAAACCGAACGGATGATTGCCATT | ||
| TGCACAGAACTGAGAAAGCTTGGGGCAACAGTTGAGGAAGGATCT | ||
| GATTACTGTGTGATCACTCCGCCTGAAAAGCTAAACCCCACCGCCA | ||
| TTGAAACTTATGACGATCACCGAATGGCCATGGCATTCTCTCTTGC | ||
| TGCCTGTGCAGATGTTCCCGTCACTATCCTTGATCCGGGATGCACC | ||
| CGTAAAACCTTCCCGGACTACTTTGATGTTTTAGAAAAGTTCGCCA | ||
| AGCATTGA | ||
| 2 | EPSPS | ATGGCTCAAGCTACTACCATCAACAATGGTGTCCAAACTGGTCAAT |
| Amaranthus | TGCACCATACTTTACCCAAAACCCACTTACCCAAATCTTCAAAAAC | |
| rudis | TGTTAATTTTGGATCAAACTTTAGAATTTCTCCAAAGTTCATGTCTT | |
| TAACCAATAAAAGAGTTGGTGGGCAATCATCAATTATTCCCAAGA | ||
| TTCAAGCTTCAGTTGCTGCTGCAGCTGAGAAACCTTCATCTGTCCC | ||
| AGAAATTGTGTTACAACCCATCAAAGAGATCTCTGGTACCATTCAA | ||
| TTGCCTGGGTCAAAGTCTCTATCTAATCGAATCCTTCTTTTAGCTGC | ||
| TTTGTCTCAGGGCACAACTGTGGTCGACAACTTGCTGTATAGTGAT | ||
| GATATTCTTTATATGTTGGACGCTCTCAgaactcttggtttaaaagtggaggatgata | ||
| AtacagAcaaaagggcagtcGTGGAGGGTTGTGGTGGTCTGTTTCCTGTTGG | ||
| TAAAGATGGAAAGGAAGAGATTCAACTTTTCCTTGGAAATGCAGG | ||
| AACAGCGATGCGCCCATTGACAGCTGCGGTTGCCGTTGCTGGAGG | ||
| AAATTCAAGCTATGTTCTTGACGGAGTACCAAGAATGAGGGAGCG | ||
| CCCCATTGGGGATCTGGTAGCAGGTCTAAAGCAACTTGGTTCAGAT | ||
| GTTGACTGTTTTCTTGGCACAAATTGCCCTCCTGTTCGGGTCAATGC | ||
| TAAAGGAGGCCTTCCAGGGGGCAAGGTCAAGCTCTCTGGATCGGT | ||
| TAGTAGCCAATATTTAACTGCACTTCTGATGGCTACTCCTTTGGGT | ||
| CTTGGAGATGTGGAGATTGAGATAGTTGATAAATTGATTTCCGTAC | ||
| CGTATGTTGAAATGACAATAAGGTTGATGGAACGCTTTGGAGTATC | ||
| TGTTGAACATAGTGATAGTTGGGACAGGTTCTTCATCCGAGGTGGT | ||
| CAGAAATACAAATCTCCTGGAAAGGCATATGTTGAGGGTGACGCT | ||
| TCAAGTGCTAGCTACTTCCTAGCTGGAGCCGCCGTCACTGGGGGGA | ||
| CTGTGACTGTCAAGGGTTGTGGAACAAGCAGTTTACAGGGTGATG | ||
| TAAAATTTGCCGAAGTTCTTGAGAAGATGGGTTGCAAGGTCACCTG | ||
| GACAGACAATAGCGTAACTGTTACTGGACCACCCAGGGAATCATC | ||
| TGGAAGGAAACATTTGCGCGCTATCgacgtcaacatgaaTaaaatgccagatgagct | ||
| atgactcttgcagttgttgcCTTGTATGCAGATGGGCCCACCGCCATTAGAGAT | ||
| GTGGCTAGCTGGAGAGTGAAGGAAACCGAACGGATGATTGCCATT | ||
| TGCACAGAACTGAGAAAGCTTGGGGCAACAGTTGAGGAAGGATCT | ||
| GATTACTGTGTGATCACTCCGCCTGAAAAGCTGATACCCACCGCCA | ||
| TCGAAACTTATGACGATCACCGAATGGCCATGGCATTCTCTCTTGC | ||
| TGCCTGTGCTGATGTTCCCGTCACTATCCTTGATCCGGGATGTACA | ||
| CGTAAAACCTTCCCGGACTACTTTGATGTCTTAGAAAAGTTCGCCA | ||
| AGCATTGA | ||
| 3 | 50merâEPSPS | GAACUCUUGGUUUAAAAGUGGAGGAUGAUAGUACAGCCAAAAG |
| Trigger | GGCAGUC | |
| 4 | Reverse | GACUGCCCUUUUGGCUGUACUAUCAUCCUCCACUUUUAAACCAA |
| Complement | GAGUUC | |
| 5 | 53merâEPSPS | GACGUCAACAUGAACAAAAUGCCAGAUGUUGCUAUGACUCUUGC |
| Trigger | AGUUGUUGC | |
| 6 | Reverse | GCAACAACUGCAAGAGUCAUAGCAACAUCUGGCAUUUUGUUCAU |
| Complement | GUUGACGUC | |
| 7 | 24merâEPSPS | AUGCCAGAUGUUGCUAUGACUCUU |
| Trigger | ||
| 8 | Reverse | AAGAGUCAUAGCAACAUCUGGCAU |
| Complement | ||
A number of plant species contain an EPSPS gene. For example, a gene encoding an EPSPS polynucleotide molecule occurs naturally in the genome of Amaranthus palmeri, Amaranthus rudis, Amaranthus albus, Amaranthus chlorostachys, Amaranthus graecizans, Amaranthus hybridus, Amaranthus lividus, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis, Lolium multiflorum, Lolium rigidium, Ambrosia artemisiifolia, Ambrosia trifida, Euphorbia heterophylla, Kochia scoparia, Abutilon theophrasti, Sorghum halepense, Chenopodium album, Commelina diffusa, Convulvulus arvensis, Conyza candensis, Digitaria sanguinalis, and Xanthium strumarium. The nucleotide sequences of SEQ ID NO 3 and SEQ ID NO 5 were compared to the EPSPS gene sequences of various plant species and target sequences having at least 85% identity or complementarity to SEQ ID NOs 3-6 were identified. EPSPS target sequences identified as having at least 85% identity or complementarity to SEQ ID NOs 3-6 are shown in Table 2 (mismatches are underlined). Bioactive trigger polynucleotides comprising a nucleotide sequence having at least 85% identity or complementarity to SEQ ID NOs: 9-35 are contemplated for down regulating EPSPS expression and controlling herbicide resistant weeds.
| TABLEâ2 |
| EPSPSâtargetânucleotideâsequencesâSEQâIDâNOs:â9-35 |
| SEQ | ||||
| ID | Corresponding | |||
| NO: | Species | to: | Sequence | Length |
| â9 | Amaranthus | SEQâIDâNO:â3 | GAGCTCTTGGTTTAAAAGTGGAGGATGAT | 49 |
| graecizans | AATACAGCCAAAAGGGCAGT | |||
| 10 | Amaranthus | SEQâIDâNO:â3 | GAACTCTTGGTTTAAAAGTGGAGGATGAT | 50 |
| hybridus | AATACAGCCAAAAGGGCAGTC | |||
| 11 | Amaranthus | SEQâIDâNO:â3 | GAACTCTTGGTTTAAAAGTGGAGGATGAT | 50 |
| palmeri | AGTACAGCCAAAAGGGCAGTC | |||
| 12 | Amaranthus | SEQâIDâNO:â3 | GAACTCTTGGTTTAAAAGTGGAGGATGAT | 50 |
| rudis | AATACAGACAAAAGGGCAGTC | |||
| 13 | Amaranthus | SEQâIDâNO:â3 | GAACTCTTGGTTTAAAAGTGGAGGATGAT | 50 |
| viridis | AATACAGCCAAAAGGGCAGTC | |||
| 14 | Abutilon | SEQâIDâNO:â5 | GATGTCAACATGAACAAAATGCCAGATGT | 53 |
| theophrasti | TGCCATGACTCTCGCTGTTGTTGC | |||
| 15 | Amaranthus | SEQâIDâNO:â5 | GACGTCAACATGAACAAAATGCCAGATGT | 53 |
| graecizans | TGCTATGACTCTTGCAGTTGTTGC | |||
| 16 | Amaranthus | SEQâIDâNO:â5 | GACGTCAACATGAACAAAATGCCAGATGT | 53 |
| hybridus | TGCTATGACTCTTGCAGTAGTTGC | |||
| 17 | Amaranthus | SEQâIDâNO:â5 | GACGTCAACATGAACAAAATGCCAGATGT | 53 |
| lividus | TGCTATGACTCTTGCAGTAGTTGC | |||
| 18 | Amaranthus | SEQâIDâNO:â5 | GACGTCAACATGAACAAAATGCCAGATGT | 53 |
| palmeri | TGCTATGACTCTTGCAGTTGTTGC | |||
| 19 | Amaranthus | SEQâIDâNO:â5 | GACGTCAACATGAATAAAATGCCAGATGT | 53 |
| rudis | TGCTATGACTCTTGCAGTTGTTGC | |||
| 20 | Amaranthus | SEQâIDâNO:â5 | GACGTCAACATGAACAAAATGCCAGATGT | 53 |
| thunbergii | TGCTATGACTCTTGCAGTAGTTGC | |||
| 21 | Amaranthus | SEQâIDâNO:â5 | GACGTCAACATGAACAAAATGCCAGATGT | 53 |
| viridis | TGCTATGACTCTTGCAGTAGTTGC | |||
| 22 | Ambrosia | SEQâIDâNO:â5 | GATGTTAACATGAACAAAATGCCAGATGT | 53 |
| trifida | TGCCATGACGCTTGCAGTCGTTGC | |||
| 23 | Chenopodium | SEQâIDâNO:â5 | GATGTCAACATGAACAAAATGCCAGATGT | 53 |
| album | CGCTATGACTCTTGCTGTTGTTGC | |||
| 24 | Convolvulus | SEQâIDâNO:â5 | GATGTCAACATGAATAAAATGCCAGATGT | 53 |
| arvensis | CGCCATGACTCTTGCTGTAGTTGC | |||
| 25 | Conyza | SEQâIDâNO:â5 | GATGTGAACATGAACAAGATGCCTGATGT | 53 |
| canadensis | TGCCATGACTCTTGCTGTGGTCGC | |||
| 26 | Digitaria | SEQâIDâNO:â5 | GATGTTAACATGAACAAAATGCCCGATGT | 53 |
| sanguinalis | TGCCATGACTCTTGCCGTGGTTGC | |||
| 27 | Digitaria | SEQâIDâNO:â5 | GACGTCAACATGAACAAAATGCCTGATGT | 53 |
| sanguinalis | CGCAATGACTCTTGCTGTGGTTGC | |||
| 28 | Echinochloa | SEQâIDâNO:â5 | GATGTCAACATGAACAAAATGCCTGATGT | 53 |
| colona | TGCCATGACTCTTGCTGTGGTCGC | |||
| 29 | Echinochloa | SEQâIDâNO:â5 | GATGTCAACATGAACAAAATGCCTGATGT | 53 |
| crus-galli | TGCCATGACTCTTGCTGTGGTCGC | |||
| 30 | Euphorbia | SEQâIDâNO:â5 | GATGTGAACATGAACAAAATGCCAGATGT | 53 |
| heterophylla | CGCTATGACATTGGCTGTGGTTGC | |||
| 31 | Ipomoea | SEQâIDâNO:â5 | GATGTCAACATGAACAAAATGCCAGATGT | 53 |
| hederacea | TGCCATGACTCTTGCTGTAGTTGC | |||
| 32 | Lolium | SEQâIDâNO:â5 | GATGTCAACATGAACAAAATGCCTGATGT | 53 |
| multiflorum | TGCCATGACTCTTGCCGTTGTTGC | |||
| 33 | Senna | SEQâIDâNO:â5 | GATGTCAACATGAACAAGATGCCAGATGT | 53 |
| obtusifolia | TGCCATGACTCTTGCTGTAGTTGC | |||
| 34 | Sorghum | SEQâIDâNO:â5 | GATGTTAACATGAACAAAATGCCTGATGT | 53 |
| halepense | TGCCATGACTCTTGCTGTGGTTGC | |||
| 35 | Xanthium | SEQâIDâNO:â5 | GATGTTAACATGAACAAAATGCCAGATGT | 53 |
| strumarium | TGCCATGACGCTTGCAGTCGTTGC | |||
The efficacies of mid-sized bioactive polynucleotide trigger molecules comprising SEQ ID NOs: 3 and 4 or SEQ ID NOs: 5 and 6 were assessed in glyphosate-resistant Palmer amaranth in relation to a 24-mer trigger comprising SEQ ID NOs: 7 and 8, which was known to sensitize glyphosate-resistant Palmer amaranth to glyphosate. Double stranded RNA (dsRNA) triggers comprising polynucleotide sequences of SEQ ID NOs: 3 and 4, SEQ ID NOs: 5 and 6, and SEQ ID NOs: 7 and 8 were produced and the triggers were formulated with 0.5% SILWETÂŽ L-77, 2% AMS, and 20 mM phosphate buffer to the desired concentration. The trigger formulations were then topically applied to the leaves of glyphosate-resistant Amaranthus palmeri plants (âR-22â). Control plants were either untreated or treated with the 0.5% SILWETÂŽ L-77, 2% AMS, and 20 mM phosphate buffer solution. One day after treatment, WEATHERMAXÂŽ brand glyphosate herbicide (RU Wmax, Monsanto, St Louis, Mo.) was applied to the plants at 1.5 lb/ac. 11 days after treatment (DAT) with EPSPS trigger polynucleotides the percent growth reduction of the dsRNA treated plants was assessed relative to untreated control plants by visual score. At 14 DAT the fresh weight of the dsRNA treated and control plants were determined. Four replications were performed per treatment. As shown in Table 3, the mid-sized polynucleotide trigger molecules corresponding to SEQ ID NOs: 3 and 4 or SEQ ID NOs: 5 and 6, showed similar activity to the trigger sequence corresponding to SEQ ID NOs: 7 and 8 in sensitizing glyphosate-resistant Amaranthus palmeri plants to glyphosate. See also FIG. 1.
| TABLE 3 |
| Activity of EPSPS trigger polynucleotides in |
| glyphosate-resistant Amaranthus palmeri |
| Fresh weight | |||
| Treatment | Concentration | visual 11-DAT | 14-DAT |
| SEQ ID NO | (nmole) | Average | Stdev | Average | Stdev |
| formulation | â | 30.0 | 11.5 | 27.7 | 13.1 |
| control |
| SEQ ID NO 7/8 | 2 | nmole | 47.5 | 5.0 | 19.0 | 7.7 |
| SEQ ID NO 7/8 | 4 | nmole | 88.8 | 12.5 | 95.3 | 8.6 |
| SEQ ID NO 7/8 | 8 | nmole | 90.0 | 7.1 | 91.8 | 5.4 |
| SEQ ID NO 7/8 | 16 | nmole | 85.8 | 11.8 | 93.7 | 6.6 |
| SEQ ID NO 5/6 | 2 | nmole | 48.8 | 17.5 | 18.2 | 10.9 |
| SEQ ID NO 5/6 | 4 | nmole | 41.3 | 4.8 | 94.0 | 5.6 |
| SEQ ID NO 5/6 | 8 | nmole | 93.8 | 2.5 | 96.2 | 2.8 |
| SEQ ID NO 5/6 | 16 | nmole | 81.3 | 13.1 | 90.7 | 9.5 |
| SEQ ID NO 3/4 | 2 | nmole | 46.3 | 18.0 | 24.0 | 3.7 |
| SEQ ID NO 3/4 | 4 | nmole | 28.8 | 10.3 | 94.7 | 5.4 |
| SEQ ID NO 3/4 | 8 | nmole | 88.3 | 10.4 | 88.4 | 9.5 |
| SEQ ID NO 3/4 | 16 | nmole | 90.0 | 13.5 | 97.0 | 2.7 |
The efficacies of mid-sized polynucleotide trigger molecules comprising SEQ ID NOs: 3 and 4 or SEQ ID NOs: 5 and 6, were assessed in glyphosate-resistant Waterhemp (Amaranthus rudis) in relation to a 24-mer trigger comprising SEQ ID NOs: 7 and 8. dsRNA triggers comprising polynucleotide sequences of SEQ ID NOs: 3 and 4, SEQ ID NOs: 5 and 6, and SEQ ID NOs: 7 and 8 were produced and the triggers were each formulated with 0.5% SILWETÂŽ L-77, 2% AMS, and 20 mM phosphate buffer to a concentration of 8 nmol. The trigger formulations were then topically applied to the leaves of glyphosate-resistant Waterhemp. Control plants were either untreated or treated with a solution of 0.5% SILWETÂŽ L-77, 2% AMS, and 20 mM phosphate buffer. One day after treatment with the trigger formulation, WEATHERMAXÂŽ brand glyphosate herbicide was applied to the plants at 1.5 lb/ac. Four replications were performed per treatment. The fresh weight of the plants was determined 14 DAT with EPSPS trigger polynucleotides and the fresh weight % compared to control plants (treated with WEATHERMAXÂŽ brand glyphosate herbicide alone) was calculated. See Table 4. As shown in Table 4, the trigger polynucleotides comprising SEQ ID NO 3/4 or SEQ ID NO 5/6 showed similar activity to trigger polynucleotides comprising SEQ ID NO 7/8 in sensitizing glyphosate-resistant Waterhemp plants to glyphosate.
| TABLE 4 |
| Activity of EPSPS trigger polynucleotides |
| in glyphosate-resistant waterhemp |
| Treatment and | % Control Fresh | ||
| SEQ ID NO | Concentration | wt. average | |
| Buffer | â | 35 | |
| SEQ ID NO 7/8 | 8 nmol | 85 | |
| SEQ ID NO 3/4 | 8 nmol | 78 | |
| SEQ ID NO 5/6 | 8 nmol | 83 | |
The activities of mid-sized bioactive polynucleotide trigger molecules corresponding to SEQ ID NOs: 3 and 4 or SEQ ID NOs: 5 and 6 were assessed in Amaranthus palmeri protoplasts. A 6 ug dose of each dsRNA trigger (SEQ ID NO 3/4 or SEQ ID NO 5/6) was added to Amaranthus palmeri protoplasts. As shown in FIG. 2, the dsRNA triggers comprising SEQ ID NOs: 3 and 4 or SEQ ID NOs: 5 and 6 reduced EPSPS mRNA levels by 69% and 84%, respectively.
The efficacies of mid-sized bioactive polynucleotide trigger molecules
comprising SEQ ID NOs 3 and 4 or SEQ ID NOs 5 and 6 were assessed in glyphosate-resistant Waterhemp (WH13) in relation to a 24-mer trigger comprising SEQ ID NOs 7 and 8, which was known to sensitize glyphosate-resistant Waterhemp to glyphosate. Double stranded RNA (dsRNA) triggers comprising polynucleotide sequences of SEQ ID NOs: 3 and 4, SEQ ID NOs: 5 and 6, and SEQ ID NOs: 7 and 8 were produced and the bioactive trigger polynucleotides were formulated with 0.5% SILWETÂŽ L-77, 2% AMS, and 20 mM phosphate buffer to a concentration of 2 nmol, 4 nmol, 8 nmol or 16 nmol. The trigger formulations were then topically applied to the leaves of glyphosate-resistant Waterhemp plants (âWH13â). Control plants were either untreated or treated with the 0.5% SILWETÂŽ L-77, 2% AMS, and 20 mM phosphate buffer solution. One day after treatment, WEATHERMAXÂŽ brand glyphosate herbicide (RU Wmax, Monsanto, St Louis, Mo.) was applied to the plants at 1.5 lb/ac. Four replications were performed per treatment. FIG. 3 shows the plants at 14 days after treatment. As shown in FIG. 3, the mid-sized bioactive trigger polynucleotide molecules comprising SEQ ID NOs: 5 and 6 or SEQ ID NOs: 3 and 4, sensitize glyphosate-resistant Waterhemp plants to glyphosate.
A composition comprising at least one bioactive trigger polynucleotide comprising a nucleotide sequence that is essentially identical and/or essentially complementary to SEQ ID NOs: 3-35 or a fragment thereof and a transfer agent that mobilizes the bioactive trigger polynucleotide into a plant cell is applied to a field of growing plants at an effective concentration. For example, an effective concentration of a bioactive trigger polynucleotide can have a use rate of about 1 to 30 grams or more per acre depending on the size of the bioactive trigger polynucleotide and the number of bioactive trigger polynucleotides in the composition. The bioactive trigger polynucleotide of the composition may be a dsRNA, ssDNA or dsDNA or a combination thereof. An effective concentration of bioactive trigger polynucleotides modulate the expression of an EPSPS gene in one or more target weed plant species to promote sensitivity of the target weed plant species to glyphosate. A glyphosate-containing herbicide is applied to control weeds in the field.
The composition optionally comprises a bioactive trigger polynucleotide that modulates the expression of an essential gene and optionally a herbicide that has a different mode of action relative to glyphosate. The composition may include one or more additional herbicides as needed to provide effective multi-species weed control. A composition comprising 1 or 2 or 3 or 4 or more of bioactive trigger polynucleotide that are essentially identical or essentially complementary to SEQ ID NOs: 3-35 or a fragment thereof would enable broad activity of the composition against the multiple weed species that occur in a field environment.
The EPSPS cDNA of SEQ ID NO: 1 was tiled across the entire length of the cDNA to identify target sequences for bioactive trigger polynucleotides covering as shown in Table 5. The target nucleotide sequence were chosen to be approximately 47-62 bp in length. Bioactive trigger polynucleotides comprising a nucleotide sequence having at least 85% identity or complementarity to SEQ ID NOs: 36-66 were tested for the ability to sensitize glyphosate-resistant Waterhemp to glyphosate.
| TABLEâ5 |
| EPSPSâtargetânucleotideâsequencesâSEQâIDâNOâ36-66 |
| SEQâID | ||
| NO | Size | Sense |
| 36 | 49 | GCTCAAGCTACTACCATCAACAATGGTGTCCATACTGGTCAATTGCACC |
| 37 | 60 | GCACCATACTTTACCCAAAACCCAGTTACCCAAATCTTCAAAAACTCTTAATTTTGGATC |
| 38 | 60 | GATCAAACTTGAGAATTTCTCCAAAGTTCATGTCTTTAACCAATAAAAGAGTTGGTGGGC |
| 39 | 48 | GCAATCATCAATTGTTCCCAAGATTCAAGCTTCTGTTGCTGCTGCAGC |
| 40 | 54 | GCTGAGAAACCTTCATCTGTCCCAGAAATTGTGTTACAACCCATCAAAGAGATC |
| 41 | 52 | GATCTCTGGTACTGTTCAATTGCCTGGGTCAAAGTCTTTATCCAATCGAATC |
| 42 | 54 | GAATCCTTCTTTTAGCTGCTTTGTCTGAGGGCACAACAGTGGTCGACAACTTGC |
| 43 | 47 | GCTGTATAGTGATGATATTCTTTATATGTTGGACGCTCTCAGAACTC |
| 44 | 61 | GCAGTCGTAGAGGGTTGTGGTGGTCTGTTTCCTGTTGGTAAAGATGGAAAGGAAGAGATTC |
| 45 | 48 | GATTCAACTTTTCCTTGGTAATGCAGGAACAGCGATGCGCCCATTGAC |
| 46 | 56 | GACAGCTGCGGTTGCCGTTGCTGGAGGAAATTCAAGTTATGTGCTTGATGGAGTAC |
| 47 | 52 | GTACCAAGAATGAGGGAGCGCCCCATTGGGGATCTGGTAGCAGGTCTAAAGC |
| 48 | 53 | GCAACTTGGTTCAGATGTAGATTGTTTTCTTGGCACAAATTGCCCTCCTGTTC |
| 49 | 56 | GTTCGGGTCAATGCTAAAGGAGGCCTTCCAGGGGGCAAGGTCAAGCTCTCTGGATC |
| 50 | 54 | GATCGGTTAGTAGCCAATATTTAACTGCACTTCTCATGGCTACTCCTTTGGGTC |
| 51 | 48 | GTCTTGGAGACGTGGAGATTGAGATAGTTGATAAATTGATTTCTGTAC |
| 52 | 58 | GTACCGTATGTTGAAATGACAATAAAGTTGATGGAACGCTTTGGAGTATCCGTAGAAC |
| 53 | 51 | GAACATAGTGATAGTTGGGACAGGTTCTACATTCGAGGTGGTCAGAAATAC |
| 54 | 55 | GTCAGAAATACAAATCTCCTGGAAAGGCATATGTTGAGGGTGATGCTTCAAGTGC |
| 55 | 51 | GCTAGCTACTTCCTAGCCGGAGCCGCCGTCACTGGTGGGACTGTCACTGTC |
| 56 | 55 | GTCAAGGGTTGTGGAACAAGCAGTTTACAGGGTGATGTAAAATTTGCCGAAGTTC |
| 57 | 56 | GTTCTTGAGAAGATGGGTTGCAAGGTCACCTGGACAGAGAATAGTGTAACTGTTAC |
| 58 | 54 | GTTACTGGACCACCCAGGGATTCATCTGGAAAGAAACATCTGCGTGCTATCGAC |
| 59 | 62 | GCCTTGTATGCAGATGGGCCCACCGCCATCAGAGATGTGGCTAGCTGGAGAGTGAAGGAAAC |
| 60 | 50 | GAAACCGAACGGATGATTGCCATTTGCACAGAACTGAGAAAGCTTGGGGC |
| 61 | 52 | GCAACAGTTGAGGAAGGATCTGATTACTGTGTGATCACTCCGCCTGAAAAGC |
| 62 | 51 | GCTAAACCCCACCGCCATTGAAACTTATGACGATCACCGAATGGCCATGGC |
| 63 | 57 | GCATTCTCTCTTGCTGCCTGTGCAGATGTTCCCGTCACTATCCTTGATCCGGGATGC |
| 64 | 54 | GCACCCGTAAAACCTTCCCGGACTACTTTGATGTTTTAGAAAAGTTCGCCAAGC |
| 65 | 50 | GAACTCTTGGTTTAAAAGTGGAGGATGATAGTACAGCCAAAAGGGCAGTC |
| 66 | 53 | GACGTCAACATGAACAAAATGCCAGATGTTGCTATGACTCTTGCAGTTGTTGC |
Double stranded RNA (dsRNA) triggers comprising polynucleotide sequences corresponding to SEQ ID NOs: 36-62 were produced and the bioactive trigger polynucleotides were formulated with 0.5% SILWETÂŽ L-77, 2% AMS, and 20 mM phosphate buffer to a final concentration of 8 nmol. The trigger formulations were then topically applied to the leaves of glyphosate-resistant Waterhemp plants (âWH13â). Control plants were either untreated or treated with the formulation 0.5% SILWETÂŽ L-77, 2% AMS, and 20 mM phosphate âbufferâ solution. Additionally dsRNA comprising SEQ ID NOs: 7 and 8 (24-mer EPSPS trigger) was applied as a control. One day after treatment, WEATHERMAXÂŽ brand glyphosate herbicide (RU Wmax, Monsanto, St Louis, Mo.) was applied to the plants at 1.5 lb/ac.
Three replications were performed per treatment. FIG. 4 shows the fresh weight (g) of the plants at 14 days after treatment. As shown in FIG. 4, several mid-sized bioactive trigger polynucleotide molecules sensitize glyphosate-resistant Waterhemp plants to glyphosate, in particular, in addition to bioactive trigger polynucleotides comprising SEQ ID NOs: 3 and 4 or SEQ ID NOs: 5 and 6, it was observed that bioactive trigger polynucleotides corresponding to SEQ ID NOs: 36, 42, 43, 44, 57, 58 and 59 had good efficacy.
1. A method of controlling growth, development or reproductive ability of a plant, comprising: topically treating the plant with a composition comprising a bioactive trigger polynucleotide and a transfer agent, wherein the bioactive trigger polynucleotide comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO: 3, 5, or 9-66, or a fragment thereof, whereby the growth, development or reproductive ability of the plant is reduced.
2. The method of claim 1, wherein the bioactive trigger polynucleotide comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO 3 or SEQ ID NO 5.
3. The method of claim 1, wherein the transfer agent is an organosilicone surfactant.
4. The method of claim 3, wherein the organosilicone surfactant is BREAK-THRUÂŽ S 321, BREAK-THRUÂŽ S 200, BREAK-THRUÂŽ OE 441, BREAK-THRUÂŽ S 278, BREAK-THRUÂŽ S 243, SILWET L-77ÂŽ, SILWETÂŽ HS 429, SILWETÂŽ HS 312, or BREAK-THRUÂŽ S 233.
5. The method of claim 1, wherein the transfer agent comprises a cationic lipid reagent.
6. The method of claim 5, wherein the cationic lipid reagent is N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl-sulfate (DOTAP).
7. The method of claim 1, wherein the transfer agent is a plant hormone and wherein the plant hormone is Brassinosteroid.
8. The method of claim 1, wherein the bioactive trigger polynucleotide is selected from the group consisting of single-stranded DNA, single-stranded RNA, double-stranded RNA, double-stranded DNA, and double-stranded DNA/RNA hybrids.
9. The method of claim 8, wherein the bioactive trigger polynucleotide is double-stranded RNA and the double-stranded RNA comprises SEQ ID NOs: 3 and 4.
10. The method of claim 8, wherein the bioactive trigger polynucleotide is double-stranded RNA and the double-stranded RNA comprises SEQ ID NOs: 5 and 6.
11. The method of claim 1, wherein the plant is selected from the group consisting of Amaranthus palmeri, Amaranthus rudis, Amaranthus albus, Amaranthus chlorostachys, Amaranthus graecizans, Amaranthus hybridus, Amaranthus lividus, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis, Lolium multiflorum, Lolium rigidum, Ambrosia artemisiifolia, Ambrosia trifida, Euphorbia heterophylla, Kochia scoparia, Abutilon theophrasti, Sorghum halepense, Chenopodium album, Commelina diffusa, Convolvulus arvensis, Conyza canadensis, Digitaria sanguinalis, and Xanthium strumarium.
12. The method of claim 1, wherein the composition further comprises an EPSPS-inhibitor herbicide.
13. The method of claim 12, wherein the composition further comprises one or more herbicides different from the EPSPS-inhibitor herbicide.
14. The method of claim 12, wherein the composition further comprises an auxin-like herbicide.
15. The method of claim 14, wherein the auxin-like herbicide is dicamba or 2,4-D.
16. The method of claim 1, wherein the composition comprises a combination of two or more different bioactive trigger polynucleotides.
17. A composition comprising: one or more bioactive trigger polynucleotides and a transfer agent, wherein one or more bioactive trigger polynucleotides comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO: 3, 5, or 9-66, or a fragment thereof.
18. The composition of claim 17, wherein one or more bioactive trigger polynucleotides comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO 3 or SEQ ID NO 5.
19. The composition of claim 17, wherein one or more bioactive trigger polynucleotides is selected from the group consisting of single-stranded DNA, single-stranded RNA, double-stranded RNA, double-stranded DNA, and double-stranded DNA/RNA hybrids.
20. The composition of claim 19, wherein one or more bioactive trigger polynucleotides is double-stranded RNA and the double-stranded RNA comprises SEQ ID NOs: 3 and 4.
21. The composition of claim 19, wherein one or more bioactive trigger polynucleotides is double-stranded RNA and the double-stranded RNA comprises SEQ ID NOs: 5 and 6.
22. The composition of claim 17, wherein the transfer agent is selected from the group consisting of an organosilicone surfactant, a cationic lipid reagent and Brassinosteroid.
23. The composition of claim 22, wherein the composition further comprises ammonium sulfate.
24. The composition of claim 22, wherein the transfer agent is an organosilicone surfactant selected from the group consisting of: BREAK-THRUÂŽ S 321, BREAK-THRUÂŽ S 200, BREAK-THRUÂŽ OE 441, BREAK-THRUÂŽ S 278, BREAK-THRUÂŽ S 243, SILWET L-77ÂŽ, SILWETÂŽ HS 429, SILWETÂŽ HS 312, and BREAK-THRUÂŽ S 233.
25. The composition of claim 22, wherein the transfer agent is DOTAP.
26. The composition of claim 17, further comprising an EPSPS-inhibitor herbicide.
27. The composition of claim 26, wherein the EPSPS-inhibitor herbicide is glyphosate.
28. The composition of claim 26, further comprising a non-EPSPS-inhibitor herbicide.
29. The composition of claim 28, wherein the non-EPSPS-inhibitor herbicide is dicamba or 2,4-D.
30. A bioactive trigger polynucleotide comprising: a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO: 3, 5, or 9-35, or a fragment thereof.
31. The bioactive trigger polynucleotide of claim 30, wherein the bioactive trigger polynucleotide comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO 3 or SEQ ID NO 5.
32. The bioactive trigger polynucleotide of claim 30, wherein the bioactive trigger polynucleotide is single-stranded DNA, single-stranded RNA, double-stranded RNA, double-stranded DNA, or a double-stranded DNA/RNA hybrid.
33. The bioactive trigger polynucleotide of claim 32, wherein the bioactive trigger polynucleotide is double-stranded RNA and the double-stranded RNA comprises SEQ ID NOs: 3 and 4.
34. The bioactive trigger polynucleotide of claim 32, wherein the bioactive trigger polynucleotide is double-stranded RNA and the double-stranded RNA comprises SEQ ID NOs: 5 and 6.
35. A plant cell comprising the bioactive trigger polynucleotide of any one of claims 30-34.
36. A growing plant comprising the bioactive trigger polynucleotide of any one of claims 30-34.
37. A seed comprising the bioactive trigger polynucleotide of any one of claims 30-34.
38. A method of sensitizing a weed plant to an EPSPS-inhibitor herbicide comprising:
treating the weed with a bioactive trigger polynucleotide that is essentially identical or essentially complementary to a nucleotide sequence selected from the group consisting of SEQ ID NO: 3, 5, and 9-66, or a fragment thereof, whereby the weed is more sensitive to an EPSPS-inhibitor herbicide relative to a weed not treated with the bioactive trigger polynucleotide.
39. The method of claim 38, wherein the EPSPS-inhibitor herbicide is glyphosate.
40. The method of claim 38, wherein the weed is resistant to one or more of glyphosate, dicamba and sulfonylurea.
41. The method of claim 40, wherein the weed is growing in a field of herbicide-resistant crop plants.
42. The method of claim 40, wherein the weed is selected from the group consisting of Amaranthus palmeri, Amaranthus rudis, Amaranthus albus, Amaranthus chlorostachys, Amaranthus graecizans, Amaranthus hybridus, Amaranthus lividus, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis, Lolium multiflorum, Lolium rigidum, Ambrosia artemisiifolia, Ambrosia trifida, Euphorbia heterophylla, Kochia scoparia, Abutilon theophrasti, Sorghum halepense, Chenopodium album, Commelina diffusa, Convolvulus arvensis, Conyza canadensis, Digitaria sanguinalis, and Xanthium strumarium.
43. The method of claim 38, wherein the bioactive trigger polynucleotide is single-stranded DNA, single-stranded RNA, double-stranded RNA, double-stranded DNA, or a double-stranded DNA/RNA hybrid.
44. The method of claim 38, wherein the bioactive trigger polynucleotide is double-stranded RNA and the double-stranded RNA comprises SEQ ID NOs: 3 and 4.
45. The method of claim 38, wherein the bioactive trigger polynucleotide is double-stranded RNA and the double-stranded RNA comprises SEQ ID NOs: 5 and 6.