US20190264284A1
2019-08-29
16/279,245
2019-02-19
This application discloses methods for cDNA synthesis with improved reverse transcription, template switching and preamplification to increase both yield and average length of cDNA libraries generated from individual cells. The new methods include exchanging a single nucleoside residue for a locked nucleic acid (LNA) at the TSO 3′ end, using a methyl group donor, and/or a MgCl2 concentration higher than conventionally used. Single-cell transcriptome analyses incorporating these differences have full-length coverage, improved sensitivity and accuracy, have less bias and are more amendable to cost-effective automation. The invention also provides cDNA molecules comprising a locked nucleic acid at the 3′-end, compositions and cDNA libraries comprising these cDNA molecules, and methods for single-cell transcriptome profiling.
Get notified when new applications in this technology area are published.
C12Q2600/158 » CPC further
Oligonucleotides characterized by their use Expression markers
C12Q1/6883 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
C12P19/34 » CPC further
Preparation of compounds containing saccharide radicals; Preparation of nitrogen-containing carbohydrates; N-glycosides; Nucleotides Polynucleotides, e.g. nucleic acids, oligoribonucleotides
C12Q1/6809 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids Methods for determination or identification of nucleic acids involving differential detection
C12Q1/6853 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid amplification reactions using modified primers or templates
The present application is a continuation of U.S. patent application Ser. No. 14/912,556, filed Feb. 17, 2016, which is the U.S. national phase application of International Patent Application No. PCT/US2014/052233, filed Aug. 22, 2014, which in turn claims priority to U.S. Provisional Patent Application Ser. No. 61/869,220, filed Aug. 23, 2013, the contents of which are hereby incorporated by reference in their entireties.
The present invention relates to methods for synthesis of double stranded cDNA with improved yield and average length, and cDNA molecules synthesized and cDNA libraries generated from individual cells.
Single-cell gene expression analyses hold promise to characterize cellular heterogeneity, but current methods sacrifice either the coverage, sensitivity or throughput. Several methods exist for full-length cDNA construction from large amounts of RNA, including cap enrichment procedures (Maruyama, K. & Sugano, S., Gene 138, 171-174 (1994); Carninci, P. & Hayashizaki, Y., Meth. Enzymol. 303, 19-44 (1999); Das, M., et al., Physiol. Genomics 6, 57-80 (2001)), but it is still challenging to obtain full-length coverage from single-cell amounts of RNA. Existing methods use either 3′ end polyA-tailing of cDNA (e.g., Tang, F. et al., Nat Methods 6, 377-382 (2009); Sasagawa, Y. et al., Genome Biol. 14, R31 (2013)) or template switching (Zhu, Y. Y., et al., Bio Techniques 30, 892-897 (2001); Ramsköld, D. et al., Nat Biotechnol. 30, 777-782 (2012)), whereas other methods sacrifice full-length coverage altogether for early multiplexing (Islam, S. et al., Genome Res. (2011). doi:10.1101/gr.110882.110; Hashimshony, T., et al., Cell Rep. 2, 666-673 (2012)). It has recently been shown that Smart-Seq, which relies on template switching, has more even read coverage across transcripts than polyA-tailing methods (Ramsköld, D. et al., Nat. Biotechnol. 30, 777-782 (2012)), consistent with the common use of template switching in applications designed to directly capture RNA 5′ ends, including nanoCAGE (Plessy, C. et al., Nat Methods 7, 528-534 (2010)) and STRT (Islam, S. et al., Genome Res. (2011). doi:10.1101/gr.110882.110). Single-cell applications utilizing template switching are dependent upon the efficiency of the reverse transcription, the template switching reaction, and a uniform polymerase chain reaction (PCR) preamplification to obtain representative cDNA in sufficient amounts for sequencing. Despite the widespread use of these reactions, no systematic efforts to improve cDNA library yield and average length from single-cell amounts have been reported.
The present invention provides improved methods for synthesis of cDNA, in particular, in the reverse transcription, template switching and preamplification of single cell applications utilizing template switching reactions, to increase both yield and average length of cDNA libraries generated from individual cells. Single-cell transcriptome analyses incorporating these differences have improved sensitivity and accuracy, and are less biased and more amenable to cost-effective automation.
Specifically, to improve full-length transcriptome profiling from single cells, this application discloses evaluation of a large number of variations to reverse transcription, template switching oligonucleotides (TSO) and PCR preamplification, and comparison of the results to commercial Smart-Seq (hereafter called SMARTer®) in terms of cDNA library yield and length. The modifications disclosed herein surprisingly and significantly increased both the yield and length of the cDNA obtained from as little as 1 ng of starting total RNA.
In one embodiment, the present invention provides a method for preparing DNA that is complementary to an RNA molecule, the method comprising conducting a reverse transcription reaction in the presence of a template switching oligonucleotide (TSO) comprising a locked nucleic acid residue.
In another embodiment, the present invention provides a method of increasing the yield of cDNA, comprising use of an additive, such as a methyl group donor, in the cDNA synthesis. In one embodiment, the methyl group donor is betaine.
In another embodiment, the present invention provides a method of increasing the yield of cDNA, comprising use of an increased concentration of metal salt, for example, MgCl2, in the synthesis of cDNA.
In a preferred embodiment, the method comprises use of a methyl group donor in combination with an increased concentration of MgCl2 in the cDNA synthesis. In a particularly preferred embodiment, the method comprises use of methyl group donor betaine in combination with an increased concentration of MgCl2, which has shown a significant positive effect on the yields of cDNA.
In another embodiment, the present invention provides a method of increasing the average length of a preamplified cDNA, comprising administering dNTPs prior to the RNA denaturation rather than in the reverse transcriptase (RT) master mix.
In another embodiment, the present invention provides a cDNA library produced by a method according to any of the embodiments disclosed herein.
In another embodiment, the present invention provides use of a cDNA library produced according to any of the embodiments disclosed herein for single-cell transcriptome profiling.
In another embodiment, the present invention provides a method for analyzing gene expression in a plurality of single cells, comprising the steps of preparing a cDNA library according to a method according to any embodiment disclosed herein; and sequencing the cDNA library.
It has been demonstrated in accordance with the present invention that these methods performed on purified RNA are applicable to individual metazoan cells, including for example mammalian cells.
In another embodiment, the present invention provides a template switching oligonucleotide (TSO) comprising an LNA at its 3′-end.
In another embodiment, the present invention provides use of a TSO according to any of the embodiments disclosed herein for synthesis of double stranded cDNA.
These and other aspects of the present invention will be better appreciated by reference to the following drawings and detailed description.
FIG. 1 illustrates improvements in cDNA library yield and length. (A) Median yield of preamplified cDNA from 1 ng total RNA using different template switching oligonucleotides, relative to those obtained using the rG3 oligo. All oligo sequences are found in Table 1. (B) Median yield of preamplified cDNA from 1 ng total RNA in reactions with betaine (black) or without (gray) and as a function of increasing Mg2+ concentration, relative to cDNA yields obtained using SMARTer®-like conditions (betaine and 6 mM Mg2+). (C) Length of preamplified cDNA generated from 1 ng total mouse brain RNA in reactions that deployed dNTPs prior to RNA denaturation (early) or in RT master mix (late). (D) Median yield of preamplified cDNA from HEK293T cells using the LNA-G and SMARTer® IIA template switching oligos with the optimized protocol. Dashed lines indicate median yield from commercial SMARTer® reactions. (E) Median yield of preamplified cDNA from DG-75 cells in reactions with or without betaine. (F) Lengths of cDNA libraries generated from single HEK293T cells in reactions with or without bead extraction. Note that brain mRNAs are naturally longer than cell line mRNAs. (A-F) The replicate measurements are represented as boxplots with the numbers of replicates per condition indicated in parenthesis. Significant differences in mean yield or length were determined using the Student's t-test.
FIG. 2 illustrates sensitive full-length transcriptome profiling in single cells. (A) Percentage of genes reproducibly detected in replicate cells, binned according to expression level. All pair-wise comparisons were performed within replicates for the optimized protocol and SMARTer® and reported as the mean and 90% confidence interval. (B) Standard deviation in gene expression estimates within replicates in bins of genes sorted according to expression levels. Error bars, s.e.m. (n≥4). (C) The mean numbers of genes detected in HEK293T cells using SMARTer® and optimized protocol, at different RPKM cut-offs. Significant increase in gene detection in the optimized protocol was obtained at all RPKM thresholds (all with p<0.5; Student's t-test). (D) The mean fraction of genes detected as expressed (RPKM>1) in bins of genes sorted according to their GC content. The mRNA-Seq data from a human tissue was included as a no-preamplification control. Error bars denote SEM (n≥4), and the lower panel shows the GC range for genes in each bin. (E) The mean fraction of reads aligning to the 3′ most 20% of the genes, 5′ most 20% and the middle 60% for single-cell data generated using different protocols. (F) Principal component analyses of single-cell gene expression data showing the two most significant components. Cells are colored according to preamplification enzyme and protocol variant.
FIG. 3 shows cDNA yields using LNA bases in template switching oligonucleotides.
FIG. 4 illustrates single-cell RNA-Seq sensitivity and variability. (A) Percentage of genes reproducibly detected in replicate cells. (B) Standard deviation in gene expression estimates.
FIG. 5 illustrates validation of single-cell RNA-Seq results using another analysis pipeline. (A) Percentage of genes reproducibly detected in replicate cells. (B) Standard deviation in gene expression estimates. (C) The mean numbers of genes detected. (D) The mean fraction of genes detected as expressed. (E) The mean fraction of reads aligning to the 3′ most 20% of the genes, 5′ most 20% and the middle 60% for single-cell data generated using different protocols.
FIG. 6 illustrates comparison of single-cell transcriptomic data generated with Smart-Seq2, Quartz-Seq and SMARTer. (A) Percentage of genes reproducibly detected in replicate cells. All pair-wise comparisons were performed with Smart-Seq2 and Quartz-seq, and reported as the mean and 90% confidence interval. (B) Standard deviation in gene expression estimates in (A). (C) Percentage of genes reproducibly detected in replicate cells. All pair-wise comparisons were performed with Smart-Seq2 and SMARTer®, and reported as the mean and 90% confidence interval. (D) Standard deviation in gene expression estimates in (C). (E) Percentage of genes reproducibly detected in replicate cells. All pair-wise comparisons were performed with Quartz-seq, and reported as the mean and 90% confidence interval. (F) Standard deviation in gene expression estimates in (E).
FIG. 7 illustrates mapping statistics for single-cell libraries generated using SMARTer, optimized Smart-Seq and variants of the optimized protocol. (A) Fraction of uniquely aligned reads with 1 to 9 mismatches for each single-cell RNA-Seq library. (B) Percentage of reads that aligned uniquely, aligned to multiple genomic coordinates, or did not align for all single-cell RNA-Seq libraries. (C) Fraction of uniquely aligned reads that mapped to exonic, intronic or intergenic regions. (D) Number of sequenced reads per cell and library preparation protocol.
FIG. 8 illustrates gene expression and GC levels in single-cell RNA-Seq protocols.
FIG. 9 illustrates single-cell RNA-Seq sensitivity and variability. (A) Percentage of genes reproducibly detected in replicate cells. (B) Standard deviation in gene expression estimates.
FIG. 10 illustrates read coverage across genes in single-cell RNA-Seq data.
FIG. 11 illustrates read coverage across transcripts. (A) Mean fraction coverage read for all genes. (B)-(F) Transcripts grouped by length into 5 equal-sized bins.
FIG. 12 illustrates read peaks in single-cell RNA-Seq data. (A) Number of genes with one or more high density peaks per single-cell RNA-Seq library. (B) Heatmaps of read densities across genes with peaks in the highest number of libraries.
FIG. 13 illustrates assessment of the technical and biological variability in single-cell transcriptomics using Smart-Seq2. (A) Percentage of genes reproducibly detected in dilutions of HEK cells. (B) Standard deviation in gene expression estimates for (A). (C) Percentage of genes reproducibly detected in dilutions of HEK total RNA. (D) Standard deviation in gene expression estimates for (D). (E) Standard deviation in gene expression estimates for (D) with pair-wise comparisons of individual cells.
FIG. 14 illustrates comparison of libraries generated with commercial Tn5 (Nextera) to in-house produced Tn5. (A) Percentage of genes reproducibly detected using in-house conditions. (B) Standard deviation in gene expression estimates for (A). (C) Percentage of genes reproducibly detected using commercial buffers and conditions. (D) Standard deviation in gene expression estimates for (D). (E) Differences in reactions carried out in (A).
This application discloses methods for cDNA synthesis with improved reverse transcription, template switching and preamplification to increase both yield and average length of cDNA libraries generated from individual cells.
In one embodiment, the present invention provides a method for preparing DNA that is complementary to an RNA molecule, comprising the steps of:
annealing a cDNA synthesis primer to the RNA molecule and synthesizing a first cDNA strand to form an RNA-cDNA intermediate; and
conducting a reverse transcriptase reaction by contacting the RNA-cDNA intermediate with a template switching oligonucleotide (TSO), wherein the TSO comprises a locked nucleic acid (LNA) at its 3′-end, under conditions suitable for extension of the first DNA strand that is complementary to the RNA molecule, rendering it additionally complementary to the TSO.
In another embodiment of the present invention, the reverse transcription reaction is conducted in the presence of a methyl group donor and a metal salt.
In another embodiment of the present invention, the methyl group donor is betaine.
In another embodiment of the present invention, the metal salt is a magnesium salt.
In another embodiment of the present invention, the magnesium salt has a concentration of at least 7 mM, at least 8 mM, or at least 9 mM.
In another embodiment of the present invention, the template switching oligonucleotide optionally comprises one or two ribonucleotide residues.
In another embodiment of the present invention, the template switching oligonucleotide comprises at least one or two ribonucleotide residues and an LNA residue.
In another embodiment of the present invention, the at least one or two ribonucleotide residues are riboguanine.
In another embodiment of the present invention, the locked nucleic acid residue is selected from the group consisting of locked guanine, locked adenine, locked uracil, locked thymine, locked cytosine, and locked 5-methylcytosine.
In another embodiment of the present invention, the locked nucleic acid residue is locked guanine.
In another embodiment of the present invention, the locked nucleic acid residue is at the 3′-most position.
In another embodiment of the present invention, the template switching oligonucleotide comprises at the 3′-end two ribonucleotide residues and one locked nucleotide residue characterized by formula rGrG+N, wherein +N represents a locked nucleotide residue.
In another embodiment of the present invention, the template switching oligonucleotide comprises rGrG+G.
In another embodiment of the present invention, the methyl group donor is betaine, and the metal salt is MgCl2 at a concentration of at least 9 mM.
In another embodiment of the present invention, the method further comprises amplifying the DNA strand that is complementary to the RNA molecule and the template switching oligonucleotide using an oligonucleotide primer.
In another embodiment of the present invention, the template switching oligonucleotide is selected from the oligonucleotides in Table S2.
In another embodiment of the present invention, the cDNA synthesis primer is an oligo-dT primer.
In another embodiment of the present invention, the cDNA is synthesized on beads comprising an anchored oligo-dT primer.
In another embodiment of the present invention, the oligo-dT primer comprises a sequence of 5′-AAGCAGTGGTATCAACGCAGAGTACT30VN-3′ (SEQ ID NO: 1), wherein “N” is any nucleoside base, and “V” is selected from the group consisting of “A”, “C” and “G”.
In another embodiment of the present invention, the method further comprises PCR preamplification, tagmentation, and final PCR amplification.
In another embodiment of the present invention, the PCR preamplification is conducted without purifying the cDNA obtained from reverse transcription reaction.
In another embodiment of the present invention, the RNA is total RNA in a cell.
In another embodiment, the present invention provides a cDNA library produced by the method according to any embodiment disclosed herein.
In another embodiment, the present invention provides use of a cDNA library produced by the method according to any embodiment disclosed herein for single-cell transcriptome profiling.
In another embodiment, the present invention provides a method for analyzing gene expression in a plurality of single cells, the method comprising the steps of: preparing a cDNA library produced by the method according to any embodiment disclosed herein; and sequencing the cDNA library.
In another embodiment, the present invention provides a template switching oligonucleotide (TSO) comprising a locked nucleotide residue at the 3′-end. The TSOs of the present invention can be used in the synthesis of cDNA to improve yield and length.
In another embodiment, the TSO comprises three nucleotide residues at the 3′-end, wherein said three nucleotide residues are selected from the group consisting of +N+N+N, N+N+N, NN+N, rN+N+N, and rNrN+N, wherein N at each occurrence is independently a deoxyribonucleotide residue, rN at each occurrence is independently a ribonucleotide residue, and +N at each occurrence is independently a locked nucleotide residue.
In one embodiment, the portion of the TSO that is on the 5′ side of the three nucleotide residues at the 3′-end, also referred to herein as the 5′-portion, comprises an arbitrary nucleotide sequence comprised of ribonucleotides, deoxyribonucleotides, or mixtures thereof. In one preferred embodiment, the 5′-portion of the TSO comprises all ribonucleotides. In another preferred embodiment, the 5′-portion of the TSO comprises all deoxyribonucleotides.
In another embodiment, the locked nucleotide residue in the TSOs is selected from the group consisting of locked guanine, locked adenine, locked uracil, locked thymine, locked cytosine, and locked 5-methylcytosine
In another embodiment, the three nucleotide residues at the 3′-end of the TSOs are NN+G or rNrN+G, wherein N at each occurrence is independently a deoxyribonucleotide residue, and rN at each occurrence is independently a ribonucleotide residue.
In another embodiment, the three nucleotide residues at the 3′-end of the TSOs are rGrG+N, wherein +N is locked nucleotide residue.
In another embodiment, the three nucleotide residues at the 3′-end of the TSOs are rGrG+G.
The TSOs preferably have a length of from about 10 to about 50 nucleotides, or from about 15 to about 45 nucleotides, or from about 20 to about 40 nucleotides, or from about 24 to about 35 nucleotides, or about 30 nucleotides.
In another embodiment, the present invention provides use of a TSO according to any one of the embodiments disclosed herein in the synthesis of a cDNA.
Examples of metal cations useful for the present invention include, but are not limited to, Mg2+ and Mn2+, with Mg2+ preferred; and their concentrations can be in the range of 0-30 μM, inclusive, with a preferred range of 3-20 μM, and a more preferred range of 9-12 μM.
In addition to methyl donor betaine, other additives that may be added in the cDNA synthesis of the present invention include, but are not limited to, trehalose, sucrose, glucose, maltose, DMSO (dimethyl sulfoxide), formamide, non-ionic detergents, TMAC (tetramethylammonium chloride), 7-deaza-2′-deoxyguanosine (dC7GTP), bovine serum albumin (BSA), and T4 gene 32 protein.
The present invention is applicable to reactions using all reverse transcriptases that are MMLV-related and have template switching activity. MMLV-related reverse transcriptases include wild-type Moloney murine leukemia virus and its variants, including for example derivatives lacking RNase H activity such as SUPER-SCRIPT II (Invitrogen), POWER SCRIPT (BD Biosciences) and SMART SCRIBE (Clontech). TSOs useful for the present invention may comprise barcodes, including but not limited to molecular barcodes or sample barcodes.
The cDNA synthesized according to the present invention may have applications as cDNA synthesized according to any literature methods, including but not limited to construction of small quantity cDNA library, single-cell cDNA analyses, single-cell gene expression analyses, few-cell cDNA analyses, few-cell gene expression analyses, single-cell qPCR analyses (that use this preamplification step), and cap capturing based amplification.
The following non-limiting examples illustrate certain aspects of the present invention.
RNA experiments were performed using the Control Total RNA supplied with the SMARTer® Ultra Low RNA Kit for Illumina Sequencing (Clontech), extracted from mouse brain. One microliter of a 1 ng/μ1 solution was used in each experiment and mixed with 1 μl of anchored oligo-dT primer (10 mM, AAGCAGTGGTATCAACGCAGAGTACT30VN-3′ (SEQ ID NO: 1), where “N” is any base and “V” is either “A”, “C” or “G”) and 1 μl of dNTP mix (10 mM, Fermentas), denaturated at 72° C. for 3 min and immediately placed on ice afterwards. Seven μl of the first strand reaction mix containing 0.50 μl SuperScript II RT (200 U ml-1, Invitrogen), 0.25 μl RNAse inhibitor (20 U ml-1, Clontech), 2 μl Superscript II First-Strand Buffer (5×, Invitrogen), 0.25 μl DTT (100 mM, Invitrogen), 2 μl betaine (5 M, Sigma), 0.9 μl MgCl2 (100 mM, Sigma), 1 μl TSO (10 μM, the complete list of the oligos can be found in Table S1) and 0.1 μl Nuclease-free water (Gibco) were added to each sample. Reverse transcription reaction was carried out by incubating at 42° C. for 90 min, followed by 10 cycles of (50° C. for 2 min, 42° C. for 2 min). Finally, the RT was inactivated by incubation at 70° C. for 15 min.
In the original Smart-Seq protocol purification with Ampure XP beads is performed after first strand cDNA synthesis. PCR is then carried out directly on the cDNA immobilized on the beads, after adding 2 μl Advantage 2 Polymerase Mix (50×, Clontech), 5 μl Advantage 2 PCR Buffer (10×, Clontech), 2 μl dNTP mix (10 mM, Clontech), 2 μl IS PCR primer (12 μM, Clontech) and 39 μl nuclease-free water to a final reaction volume of 50 μl. In the present examples the cDNA was not purified after RT but just added the same PCR master mix, taking into account that the volume after first strand cDNA synthesis is 10 μl and adjusting the amount of water accordingly. Reaction was incubated at 95° C. 1 min, then cycled 15 times between (95° C. 15 sec, 65° C. 30 sec, 68° C. 6 min), with a final extension at 72° C. for 10 min.
A second modification that significantly improved cDNA yield was the replacement of Advantage 2 Polymerase mix with KAPA HiFi HotStart ReadyMix (KAPA Biosystems). Purification after first strand cDNA synthesis was omitted also in this case. The PCR master mix had the following composition: 25 μl KAPA HiFi HotStart ReadyMix (2×, KAPA Biosystems), 1 μl IS PCR primers (10 mM, 5′-AAGCAGTGGTATCAACGCAGAGT-3′ (SEQ ID NO: 2)) and 14 μl nuclease-free water (Gibco). The program used was as follows: 98° C. 3 min, then 15 cycles of (98° C. 15 sec, 67° C. 20 sec, 72° C. 6 min), with a final extension at 72° C. for 5 min.
Regardless of the PCR protocol used, PCR was purified using a 1:1 ratio of AMPure XP beads (Beckman Coulter), performing the final elution in 15 μl of EB solution (Qiagen). Library size distribution was checked on a High-Sensitivity DNA chip (Agilent Bioanalyzer) after a 1:5 dilution. The expected average size should be around 1.5-2.0 kb and the fraction of fragments below 300 bp should be negligible. To evaluate the performance of the different modifications introduced in the protocol, the amount of cDNA comprised in the interval 300-9000 bp in the Agilent Bioanalyzer plot was assessed.
Five nanograms of cDNA were then used for the tagmentation reaction carried out with Nextera® DNA Sample Preparation kit (Illumina), adding 25 μl of 2× Tagment DNA Buffer and 5 μl of Tagment DNA Enzyme, in a final volume of 50 μl. Tagmentation reaction was incubated at 55° C. for 5 min, followed by purification with DNA Clean & Concentrator™5 kit (Zymo Research) with a final elution in 20 μl Resuspension Buffer (RSB) from the Nextera® kit. The whole volume was then used for limited-cycle enrichment PCR, along with 15 μl of Nextera® PCR Primer Mix (NPM), 5 μl of Index 1 primers (N7xx), 5 μl of Index 2 primers (N5xx) and 5 μl of PCR Primer Cocktail (PPC). A second amplification round was performed as follows: 72° C. 3 min, 98° C. 30 sec, then 5 cycles of (98° C. 10 sec, 63° C. 30 sec, 72° C. 3 min). Purification was done with a 1:1 ratio of AMPure XP beads and samples were loaded on a High-Sensitivity DNA chip to check the quality of the library, while quantification was done with Qubit High-Sensitivity DNA kit (Invitrogen). Libraries were diluted to a final concentration of 2 nM, pooled and sequenced on Illumina HiSeq 2000.
Single-Cell cDNA Isolation
Single HEK293T (human), DG-75 (human), C2C12 (mouse) and MEF (mouse) cells were manually picked under the microscope after resuspension in PBS. Volume of liquid was kept as low as possible, usually below 0.5 μl and preferably below 0.3 μl. Cells were then transferred to a 0.2 ml thin-wall PCR tube containing 2 μl of a mild hypotonic lysis buffer composed of 0.2% Triton X-100 (Sigma) and 2 UM of RNAse inhibitor (Clontech). Cells already picked were kept on ice throughout the process or stored at −80° C. if not used immediately. All the downstream steps were the same as when using total RNA (see above), with the only exception of the quality control with the High Sensitivity DNA chip, where samples were loaded pure (without dilution), due to the limited amount of cDNA obtained from RT in single cells.
When working with total RNA it was observed that cDNA yield could be increased using a double amount of TSO or different combinations of TSOs and PCR enzymes (data not shown). To validate this finding, some experiments on HEK293T cells were repeated using different amounts of TSO (1 or 2 μl of a 10 μM solution), TSO types (rGrGrG, rGrG+G or rGrG+N) or PCR enzymes (KAPA HiFi or Advantage 2). Sequencing results for the most significant comparisons are reported in Figures S2-S7. The final protocol (i.e. “optimized”) refers to the one using only 1 μl of the 10 μM rGrG+G TSO and KAPA HiFi HotStart ReadyMix as enzyme in the first PCR (without AMPure XP bead purification).
To evaluate and compare the performance of the present method, cDNA libraries were generated with the same total RNA and single cells using the Smart-Seq protocol, following manufacturer's instructions (see Clontech manual). After PCR pre-amplification, 5 ng of cDNA were used for the tagmentation reaction and processed exactly in the same way as described above.
Statistical Analyses of cDNA Yield and Length
Performances of the different protocols were evaluated with regard to cDNA yield and average cDNA length according to the Bioanalyzer in the range of 3009,000 bp. For mouse brain total RNA samples, each experimental variable was evaluated in a pairwise manner selecting a set of experiments where all other variables are identical. Within that set of experiments, the significance for a change in yield or length, between the two variables, was evaluated using Student's t-test and Wilcoxon rank sum test (Table 1, sheet B).
In the HEK293T cell experiments each optimized experimental setting was compared to each other, as well as to the SMARTer® protocol, using Student's t-test and Wilcoxon rank sum test (Table 3, sheet B). All analyses and figures were produced with using R.
Single-cell libraries were sequenced with Nextera dual indexes (i7+i5) on an Illumina HiSeq 2000, giving 43 bp insert reads after demultiplexing and removing cellular barcodes. The reads were aligned to human (hg19) or mouse (mm10) genomes using STAR v2.2.0 (Dobin et al. Bioinformatics 2013 29(1): 15-21) with default settings and filtered for uniquely mapping reads. Gene expression values were calculated as RPKM values for each transcript in Ensembl release 69 and RefSeq (February 2013) using rpkmforgenes (Ramsköld et al. PLoS Comp Biol., 5, e1000598, 2009).
Analyses of gene detection in single HEK293T cells (FIG. 2A, FIGS. 5A, and 7A) were calculated over all possible pairs of technical replicates from each experimental setting. Genes were binned by expression level in the two samples, and were considered detected if the RPKM was above 0.1 in both samples. The mean for all possible pairs of technical replicates within a group was used together with standard deviation using the adjusted Wald method. Analyses of variation (FIG. 2B and FIGS. 5B & 7B) were also calculated on pairs of samples, binning genes by the mean of log expression, excluding genes below 0.1 RPKM in either sample. As gene expression levels across single cells are often log normally distributed (Bengtsson Genome Res 2005 15(10): 1388-1392), absolute difference in log10 expression values and s.d. were calculated by multiplying mean difference in a bin with 0.886.
Gene body coverage was calculated using the RSeQC-2.3.4 package (Wang, Wang and Li. Bioinformatics 2012; 28(16):2184-5) for the longest transcript of all protein coding genes (FIG. 2E and FIG. 8). Gene detection at different GC-content was calculated using longest transcript for all protein coding RefSeq genes that were binned by GC-content into 10 equal sized bins, and the numbers of genes with no detection, or detection at different RPKM cutoffs were calculated (FIG. 2D and FIG. 6).
Some genes displayed unexplained peaks with high density of reads within the gene body. To identify these regions, the gene bodies of each gene were divided into 101 equally sized bins and each gene with at least one bin with >5 standard deviation read density over the mean read distribution within that gene. In these analyses genes with low expressed genes (those with fewer reads than around 2,000-10,000 reads depending on the sequencing depth per cell) were discarded. The number of such genes in each cell is represented in FIG. 9A And the genes with peaks in the highest number of HEK239T cells are displayed as heatmaps in FIG. 9B illustrating that the peaks are consistently found at the same position in all experiments.
To improve full-length transcriptome profiling from single cells, a large number of variations to reverse transcription, template switching oligonucleotide (TSO) and PCR preamplification (in total 457 experiments) were evaluated, and the results were compared to commercial Smart-Seq (hereafter called SMARTer®) in terms of cDNA library yield and length (Table 1). Importantly, modifications were identified that significantly increased both cDNA yield and length obtained from 1 ng of starting total RNA (Table 1).
In particular, exchanging only a single guanylate for a locked nucleic acid (LNA) guanylate at the TSO 3′ end (rGrG+G), led to a 2-fold increase in cDNA yield relative to the SMARTer® IIA oligo used in commercial Smart-Seq (p=0.003, Student's t-test; FIG. 1a, Table 2 and FIG. 3).
Additionally, it was discovered that the methyl group donor betaine in combination with higher MgCl2 concentrations had a significant positive effect on yield (2-4 fold increase, p=0.0012, Student's t-test, for all comparisons) (FIG. 1b). The commercial Smart-Seq buffer has a final concentration of 6 mM MgCl2, but it was found herein that higher yield is obtained when increasing the concentration to 9 mM or beyond. Finally, the average length of the preamplified cDNA increased with 370 nts when administering dNTPs prior to the RNA denaturation rather than in the RT master mix (p=7.8×10−9, Student's t-test; FIG. 1c).
It was further demonstrated that these improvements obtained with purified RNA extended to cDNA reactions performed directly in lysates of individual human and mouse cells. To this end, single-cell cDNA libraries were generated from a total of 262 individual human or mouse cells (159 HEK293T, 34 DG-75, 30 C2C12 and 39 MEF cells) spanning different cell sizes and total RNA contents (Table 3). Analyses of the single-cell cDNA libraries demonstrated higher cDNA yields both with the use of the LNA-containing TSO (3-fold increase, p<0.001, Student's t-test; FIG. 1d) and with betaine together with high Mg2+ concentrations (4-fold increase, p=3.7×10−6, Student's t-test; FIG. 1e).
The sensitivity and accuracy of single-cell methods are limited by the efficiency of each sample-processing step. The SMARTer® protocol uses bead purification to remove unincorporated adaptors from the first strand cDNA reaction before the preamplification with Advantage 2 Polymerase (Adv2). However, performing bead purification in small volumes poses a significant recovery challenge for liquid handling automation. It was determined herein that KAPA HiFi Hot Start (KAPA) DNA Polymerase efficiently amplified first-strand cDNA directly after reverse transcription, with no need for prior bead purification. Libraries preamplified without bead purification had no reduction in yield, but the average cDNA length increased with 450 nts (p=2.6×10−12, Student's t-test; FIG. 10 demonstrating that KAPA preamplification improves cDNA generation and offers a viable approach for Smart-Seq automation.
To demonstrate the significance of the improved cDNA generation on downstream applications, its impact on single-cell transcriptome profiling was assessed. To this end, single HEK293T cell libraries generated both according to the commercial SMARTer (n=4) and using variations of the present protocol were sequenced (Smart-Seq2, n=35) (Table 4).
The improved conversion of RNA to cDNA should improve gene expression profiling as more original RNA molecules are accessible for sequencing. Indeed, both a significant increase in the ability to detect gene expression (FIG. 2a) and lowered technical variation for low and medium abundance transcripts were observed (FIG. 2b and FIG. 4). The improved sensitivity of the optimized protocol led to the average detection of 2,372 more genes in each cell (p<0.05 Student's t-test; FIG. 2c). All these improvements were independently validated using an alternative RNA-Seq alignment and analyses strategy (FIG. 5). Moreover, both better sensitivity and lower variability in single-cell transcriptome data generated with Smart-Seq2 than for data available for Quartz-Seq were obtained (FIG. 6). Although the sequenced libraries had similar mappings characteristics as SMARTer libraries, a 7% increase in unmapped reads was noted (FIG. 7).
Several preamplification enzymes have lower GC bias than the Advantage2 (Adv2) that is used with SMARTer®, indicating that single-cell profiling could also improve with cDNA preamplifications using KAPA. Indeed, the single-cell libraries preamplified with KAPA detected more genes at higher GC levels (FIG. 2d and FIG. 8) and improved sensitivity and accuracy (FIG. 9). When compared with the low coverage of 5′ regions in single-cell data generated through 3′ end polyA-tailing of cDNA, single-cell RNA-Seq libraries that had been preamplified with KAPA had significantly better coverage across the full length of transcripts (p<10−5, 1.6×10−3 for 5′ and 3′ ends respectively, Student's t-test), as they approached the expected fraction of reads at the 5′ and 3′ ends (FIG. 2e and FIGS. 10-11). Importantly, global gene expression profiles from cells preamplified with KAPA and Adv2 separated on the first principal component (FIG. 2f), demonstrating that preamplification bias had significant impact on absolute expression levels. Regions with artificially large number of reads aligned (i.e. peak) appearing systematically in Smart-Seq irrespectively of preamplification enzyme that necessitated filtering were sequenced (FIG. 12). Together, the data show that preamplification using KAPA improved GC tolerance and read coverage across transcripts.
To determine the extent of technical variability in the single-cell transcriptome profiling with Smart-Seq2, sequencing libraries were generated from dilution series of HEK293T cells (100, 50 and 10 cells) and total RNA (1 ng, 100 pg, 10 pg). Technical losses and variations were small when analyzing 10 cells or more, but considerable variability exists at single-cell levels, as previously observed. It is informative to contrast the technical variability with the biological variability present in cells of the same or different cell type origin (FIG. 13A-D). To this end, additional single-cell transcriptomes were sequenced from DG-75 (n=7), C2C12 (n=6) and MEF (n=7) cells. Analyzing the biological variability between and within cell populations revealed that biological variability associated with cell type specific expression exceeded technical variability at around 50 RPKM, but the exact threshold will depend on the RNA content present in the cell types studied (FIG. 13E).
This invention provides a new protocol that improves sensitivity, accuracy and coverage across transcripts and is more amenable to automation. Moreover, the new protocol costs less than 12% of the current cost per reaction and only 3% when using in-house produced Tn5 (FIG. 14).
Although these results were reached in the context of Smart-Seq single-cell gene expression analyses, these modifications are applicable other single-cell methods that rely on template switching, including those carried out on microfluidic chips (e.g. Fluidigm C1) or inside emulsion droplets.
The foregoing examples and description of the preferred embodiments should be taken as illustrating, rather than as limiting the present invention as defined by the claims. As will be readily appreciated, numerous variations and combinations of the features set forth above can be utilized without departing from the present invention as set forth in the claims. Such variations are not regarded as a departure from the spirit and script of the invention, and all such variations are intended to be included within the scope of the following claims.
All references cited herein are incorporated herein by reference in their entireties.
| TABLE S1 |
| Tables of cDNA library yield and length starting with purified total RNA |
| Worksheet A lists all 457 cDNA libraries generated from mouse brain total RNA. The general protocol followed for each sample is indicated in the “general |
| protocol” column, with specific information on the template switching oligonucleotide, RT enzyme, PCR enzyme, MgCl2 concentration, betaine, bead purification |
| and dNTPs administration timing detailed in separate columns. Worksheet B contains a list of direct comparisons of variables that effect cDNA library yield |
| and average length using replicate groups that have identical reaction parameters except for the experimental variable evaluated. |
| amount | ||||||||||||||||||
| dil. | TSO (ul | dNTPs | ||||||||||||||||
| Bio- | avg | of 10 uM | purifica- | PCR | added | |||||||||||||
| amount | PCR | ul | ana- | additional | conc | size | in 10 ul | RT | MgCl2 | RT | betaine | tion | PCR | rxn vol | in the | other | ||
| Entry | (ng) | cycles | elution | lyzer | description | (pg/ul) | (bp) | TSO | RT rxn) | enzyme | (mM) | protocol | (M) | after RT | enzyme | (ul) | beginning? | additives |
| 1 | 1 | 15 | 10 | 1:5 | SMARTer kit | 318 | 1669 | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| Oligo IIA | 42° C. | |||||||||||||||||
| 2 | 1 | 15 | 10 | 1:5 | SMARTer kit | 263 | 1857 | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| but | Oligo IIA | 42° C. | ||||||||||||||||
| replacing | ||||||||||||||||||
| ISPCR | ||||||||||||||||||
| primers | ||||||||||||||||||
| 3 | 1 | 15 | 10 | 1:5 | SMARTer kit | 172 | 1784 | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| but | Oligo IIA | 42° C. | ||||||||||||||||
| replacing | ||||||||||||||||||
| oligo dT | ||||||||||||||||||
| 4 | SMARTer kit | FAILED | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | 3 mM | |||||
| but | Oligo IIA | 42° C. | MnCl2 | |||||||||||||||
| replacing | ||||||||||||||||||
| FSB | ||||||||||||||||||
| 5 | 1 | 15 | 10 | 1:5 | modified | 393 | 1683 | SMARTer | 1 | SSRTII | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| SMARTer kit | Oligo IIA | 42° C. | ||||||||||||||||
| 6 | 1 | 15 | NA | NA | modified | 121 | 1780 | rG5 | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| SMARTer kit | 42° C. | |||||||||||||||||
| 7 | 1 | 15 | NA | NA | modified | 1038 | 1346 | rGrGrG | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| SMARTer kit | 42° C. | |||||||||||||||||
| 8 | 1 | 15 | NA | NA | modified | 90 | 1652 | rGrGrGp | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| SMARTer kit | 42° C. | |||||||||||||||||
| 9 | 1 | 15 | NA | NA | modified | 84 | 1608 | ISO | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| SMARTer kit | 42° C. | |||||||||||||||||
| 10 | 1 | 15 | NA | NA | SMARTer kit | 3628 | 1838 | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| Oligo IIA | 42° C. | |||||||||||||||||
| 11 | 1 | 15 | NA | NA | modified | 650 | 2108 | rG5 | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| SMARTer kit | 42° C. | |||||||||||||||||
| 12 | 1 | 15 | NA | NA | modified | 6423 | 1852 | rGrGrG | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| SMARTer kit | 42° C. | |||||||||||||||||
| 13 | 1 | 15 | NA | NA | modified | 666 | 2187 | rGrGrGp | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| SMARTer kit | 42° C. | |||||||||||||||||
| 14 | 1 | 15 | NA | NA | modified | 525 | 2181 | ISO | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| SMARTer kit | 42° C. | |||||||||||||||||
| 15 | 1 | 15 | NA | NA | SMARTer kit | 3366 | 1782 | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| but | Oligo IIA | 42° C. | ||||||||||||||||
| replacing | ||||||||||||||||||
| ISPCR | ||||||||||||||||||
| primers | ||||||||||||||||||
| 16 | 1 | 15 | NA | NA | modified | 435 | 1970 | ds oligos | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| SMARTer kit | 42° C. | |||||||||||||||||
| 17 | 1 | 15 | NA | NA | SMARTer kit | 1143 | 1445 | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| Oligo IIA | 42° C. | |||||||||||||||||
| 18 | 1 | 15 | NA | NA | SMARTer kit | 1504 | 1519 | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| but | Oligo IIA | 42° C. | ||||||||||||||||
| replacing | ||||||||||||||||||
| ISPCR | ||||||||||||||||||
| primers | ||||||||||||||||||
| 19 | 1 | 15 | NA | NA | SMARTer kit | 1984 | 1728 | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| but | Oligo IIA | 42° C. | ||||||||||||||||
| replacing | ||||||||||||||||||
| ISPCR | ||||||||||||||||||
| primers | ||||||||||||||||||
| 20 | 1 | 15 | NA | NA | modified | 1346 | 1543 | SMARTer | 1 | SSRTII | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| SMARTer kit | Oligo IIA | 42° C. | ||||||||||||||||
| 21 | 1 | 15 | NA | NA | modified | 1191 | 1683 | SMARTer | 1 | SSRTII | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| SMARTer kit | Oligo IIA | 42° C. | ||||||||||||||||
| 22 | 1 | 15 | NA | NA | SMARTer kit | 103 | 1420 | SMARTer | 1 | SMARTscribe | 3 | 90′ @ | — | yes | Advantage | 50 | — | — |
| but using | Oligo IIA | 42° C. | ||||||||||||||||
| Superscript | ||||||||||||||||||
| II FSB | ||||||||||||||||||
| (3 mM MgCl2) | ||||||||||||||||||
| 23 | 1 | 15 | NA | NA | SMARTer kit | 192 | 1609 | SMARTer | 1 | SMARTscribe | 3 | 90′ @ | — | yes | Advantage | 50 | — | — |
| but using | Oligo IIA | 42° C. | ||||||||||||||||
| Superscript | ||||||||||||||||||
| II FSB | ||||||||||||||||||
| (3 mM MgCl2 | ||||||||||||||||||
| 24 | SMARTer kit | FAILED | SMARTer | 1 | SMARTscribe | — | 90′ @ | — | yes | Advantage | 50 | — | 6 mM | |||||
| but using | Oligo IIA | 42° C. | MnCl2 | |||||||||||||||
| STRT buffer | ||||||||||||||||||
| 25 | 1 | 15 | NA | NA | SMARTer kit | 1573 | 2378 | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| Oligo IIA | 42° C. | |||||||||||||||||
| 26 | 1 | 15 | NA | NA | modified | 246 | 2024 | rG5 | 1 | SMARTscribe | 3 | 90′ @ | — | yes | Advantage | 50 | — | — |
| SMARTer kit | 42° C. | |||||||||||||||||
| 27 | 1 | 15 | NA | NA | modified | 1393 | 1945 | rGrGrG | 1 | SMARTscribe | 3 | 90′ @ | — | yes | Advantage | 50 | — | — |
| SMARTer kit | 42° C. | |||||||||||||||||
| 28 | 1 | 15 | NA | NA | modified | 259 | 2180 | rGrGrGp | 1 | SMARTscribe | 3 | 90′ @ | — | yes | Advantage | 50 | — | — |
| SMARTer kit | 42° C. | |||||||||||||||||
| 29 | 1 | 15 | NA | NA | modified | 776 | 1958 | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| SMARTer kit | Oligo IIA | 42° C. | ||||||||||||||||
| 30 | 1 | 15 | NA | NA | modified | 731 | 1808 | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | 2 | yes | Advantage | 50 | — | — |
| SMARTer kit | Oligo IIA | 42° C. | ||||||||||||||||
| 31 | 1 | 15 | NA | NA | modified | 1936 | 1965 | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| SMARTer kit | Oligo IIA | 42° C. | ||||||||||||||||
| 32 | modified | FAILED | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | 3 mM | |||||
| SMARTer kit | Oligo IIA | 42° C. | MnCl2 | |||||||||||||||
| 33 | modified | FAILED | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | 3 mM | |||||
| SMARTer kit | Oligo IIA | 42° C. | MnCl2, | |||||||||||||||
| 5% | ||||||||||||||||||
| DMSO | ||||||||||||||||||
| 34 | 1 | 15 | NA | NA | SMARTer kit | 580 | 2634 | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| Oligo IIA | 42° C. | |||||||||||||||||
| 35 | 1 | 15 | NA | NA | modified | 166 | 2208 | SMARTer | 1 | SMARTscribe | 3 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| SMARTer kit | Oligo IIA | 42° C. | ||||||||||||||||
| 36 | 1 | 15 | NA | NA | modified | 204 | 2016 | SMARTer | 1 | SMARTscribe | 3 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| SMARTer kit | Oligo IIA | 42° C. | ||||||||||||||||
| 37 | 1 | 15 | NA | NA | modified | 547 | 2171 | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| SMARTer kit | Oligo IIA | 42° C. | ||||||||||||||||
| 38 | 1 | 15 | NA | NA | modified | 640 | 2028 | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| SMARTer kit | Oligo IIA | 42° C. | ||||||||||||||||
| 39 | 1 | 15 | NA | NA | modified | 145 | 1938 | rGrGrG | 1 | SMARTscribe | 3 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| SMARTer kit | 42° C. | |||||||||||||||||
| 40 | 1 | 15 | NA | NA | modified | 224 | 1841 | rGrGrG | 1 | SMARTscribe | 3 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| SMARTer kit | 42° C. | |||||||||||||||||
| 41 | 1 | 15 | NA | NA | modified | 496 | 1863 | rGrGrG | 1 | SMARTscribe | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| SMARTer kit | 42° C. | |||||||||||||||||
| 42 | 1 | 15 | NA | NA | modified | 493 | 1911 | rGrGrG | 1 | SMARTscribe | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| SMARTer kit | 42° C. | |||||||||||||||||
| 43 | 1 | 15 | 20 | — | in house prot | 8431 | 2226 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 44 | 1 | 15 | 20 | — | in house prot | 8248 | 2235 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 45 | 1 | 15 | 20 | — | in house prot | 7672 | 2317 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1.5 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 46 | 1 | 15 | 20 | — | in house prot | 6562 | 2248 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1.5 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 47 | 1 | 15 | 20 | — | SMARTer kit | 8156 | 2298 | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| Oligo IIA | 42° C. | |||||||||||||||||
| 48 | 1 | 15 | 20 | — | in house prot | 1744 | 2592 | rGrGrGp | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 49 | 1 | 15 | 20 | — | in house prot | 1820 | 2585 | rGrGrGp | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 50 | 1 | 15 | 20 | — | in house prot | 1591 | 2541 | rGrGrGp | 1 | SSRTII | 6 | 90′ @ | 1.5 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 51 | 1 | 15 | 20 | — | in house prot | 1398 | 2616 | rGrGrGp | 1 | SSRTII | 6 | 90′ @ | 1.5 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 52 | 1 | 15 | 20 | — | in house prot | 2265 | 2110 | dGCGGG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 53 | 1 | 15 | 20 | — | in house prot | 2568 | 2125 | dGCGGG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 54 | 1 | 15 | 20 | — | in house prot | 2263 | 2079 | dGCGGG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 55 | 1 | 15 | 20 | — | in house prot | 691 | 2290 | dGCGGGp | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 56 | 1 | 15 | 20 | — | in house prot | 757 | 2344 | dGCGGGp | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 57 | 1 | 15 | 20 | — | in house prot | 690 | 2294 | dGCGGGp | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 58 | 1 | 15 | 20 | — | SMARTer kit | 6525 | 2295 | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| Oligo IIA | 42° C. | |||||||||||||||||
| 59 | 1 | 15 | 20 | — | SMARTer kit | 6806 | 2270 | SMARTer | 1 | SMARTscribe | 6 | 90′ @ | — | yes | Advantage | 50 | — | — |
| Oligo IIA | 42° C. | |||||||||||||||||
| 60 | 1 | 15 | 20 | — | in house prot, | 5922 | 1861 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| processed | 42° C. | |||||||||||||||||
| immediately | ||||||||||||||||||
| after adding | ||||||||||||||||||
| lysis buffer | ||||||||||||||||||
| (LB) | ||||||||||||||||||
| 61 | 1 | 15 | 20 | — | in house prot, | 5419 | 1892 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| processed | 42° C. | |||||||||||||||||
| immediately | ||||||||||||||||||
| after adding | ||||||||||||||||||
| lysis buffer | ||||||||||||||||||
| (LB) | ||||||||||||||||||
| 62 | 1 | 15 | 20 | — | in house prot, | 5664 | 1806 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| processed | 42° C. | |||||||||||||||||
| immediately | ||||||||||||||||||
| after adding | ||||||||||||||||||
| lysis buffer | ||||||||||||||||||
| (LB), 60′ | ||||||||||||||||||
| after adding | ||||||||||||||||||
| lysis buffer | ||||||||||||||||||
| (LB), stored | ||||||||||||||||||
| at RT | ||||||||||||||||||
| 63 | 1 | 15 | 20 | — | in house prot, | 5554 | 1800 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| processed | 42° C. | |||||||||||||||||
| immediately | ||||||||||||||||||
| after adding | ||||||||||||||||||
| lysis buffer | ||||||||||||||||||
| (LB), 45′ | ||||||||||||||||||
| after adding | ||||||||||||||||||
| lysis buffer | ||||||||||||||||||
| (LB), stored | ||||||||||||||||||
| at RT | ||||||||||||||||||
| 64 | 1 | 15 | 20 | — | in house prot, | 5552 | 1772 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| processed | 42° C. | |||||||||||||||||
| immediately | ||||||||||||||||||
| after adding | ||||||||||||||||||
| lysis buffer | ||||||||||||||||||
| (LB), 30′ | ||||||||||||||||||
| after adding | ||||||||||||||||||
| lysis buffer | ||||||||||||||||||
| (LB), stored | ||||||||||||||||||
| at RT | ||||||||||||||||||
| 65 | 1 | 15 | 20 | — | in house prot, | 6335 | 1824 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| processed | 42° C. | |||||||||||||||||
| immediately | ||||||||||||||||||
| after adding | ||||||||||||||||||
| lysis buffer | ||||||||||||||||||
| (LB), 10′ | ||||||||||||||||||
| after adding | ||||||||||||||||||
| lysis buffer | ||||||||||||||||||
| (LB), stored | ||||||||||||||||||
| at RT | ||||||||||||||||||
| 66 | 1 | 15 | 20 | — | in house prot, | 4904 | 1700 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| processed | 42° C. | |||||||||||||||||
| immediately | ||||||||||||||||||
| after adding | ||||||||||||||||||
| lysis buffer | ||||||||||||||||||
| (LB), 60′ | ||||||||||||||||||
| after adding | ||||||||||||||||||
| lysis buffer | ||||||||||||||||||
| (LB), stored | ||||||||||||||||||
| in the fridge | ||||||||||||||||||
| 67 | 1 | 15 | 20 | — | in house prot, | 3938 | 1544 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| processed | 42° C. | |||||||||||||||||
| immediately | ||||||||||||||||||
| after adding | ||||||||||||||||||
| lysis buffer | ||||||||||||||||||
| (LB), 45′ | ||||||||||||||||||
| after adding | ||||||||||||||||||
| lysis buffer | ||||||||||||||||||
| (LB), stored | ||||||||||||||||||
| in the fridge | ||||||||||||||||||
| 68 | 1 | 15 | 20 | — | in house prot, | 3793 | 1585 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| processed | 42° C. | |||||||||||||||||
| immediately | ||||||||||||||||||
| after adding | ||||||||||||||||||
| lysis buffer | ||||||||||||||||||
| (LB), 30′ | ||||||||||||||||||
| after adding | ||||||||||||||||||
| lysis buffer | ||||||||||||||||||
| (LB), stored | ||||||||||||||||||
| in the fridge | ||||||||||||||||||
| 69 | 1 | 15 | 20 | — | in house prot, | 5312 | 1824 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| processed | 42° C. | |||||||||||||||||
| immediately | ||||||||||||||||||
| after adding | ||||||||||||||||||
| lysis buffer | ||||||||||||||||||
| (LB), 10′ | ||||||||||||||||||
| after adding | ||||||||||||||||||
| lysis buffer | ||||||||||||||||||
| (LB), stored | ||||||||||||||||||
| in the fridge | ||||||||||||||||||
| 70 | 1 | 15 | 30 | — | in house prot, | 1024 | 1547 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | 3 mM |
| RT for | 42° C. | MnCl2 | ||||||||||||||||
| 1 h @42° C., | ||||||||||||||||||
| then added | ||||||||||||||||||
| 3 mM MnCl2 | ||||||||||||||||||
| and incubated | ||||||||||||||||||
| for 15′ | ||||||||||||||||||
| 71 | 1 | 15 | 30 | — | in house prot, | 849 | 1412 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | 3 mM |
| RT for | 42° C. | MnCl2 | ||||||||||||||||
| 1 h @42° C., | ||||||||||||||||||
| then added | ||||||||||||||||||
| 3 mM MnCl2 | ||||||||||||||||||
| and incubated | ||||||||||||||||||
| for 15′ | ||||||||||||||||||
| 72 | 1 | 15 | 30 | — | in house prot, | 558 | 1227 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | 6 mM |
| RT for | 42° C. | MnCl2 | ||||||||||||||||
| 1 h @42° C., | ||||||||||||||||||
| then added | ||||||||||||||||||
| 6 mM MnCl2 | ||||||||||||||||||
| and incubated | ||||||||||||||||||
| for 15′ | ||||||||||||||||||
| 73 | 1 | 15 | 30 | — | in house prot, | 572 | 1199 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | 6 mM |
| RT for | 42° C. | MnCl2 | ||||||||||||||||
| 1 h @42° C., | ||||||||||||||||||
| then added | ||||||||||||||||||
| 6 mM MnCl2 | ||||||||||||||||||
| and incubated | ||||||||||||||||||
| for 15′ | ||||||||||||||||||
| 74 | 1 | 15 | 30 | — | in house prot | 2105 | 2051 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 75 | 1 | 15 | 30 | — | in house prot | 1664 | 1809 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 76 | 100 | 10 | 15 | 1:5 | in house prot | 3196 | 1946 | 2OMe | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 77 | 100 | 10 | 15 | 1:5 | in house prot | 8894 | 1767 | rGrG + G | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 78 | 100 | 10 | 15 | 1:5 | in house prot | 1939 | 2054 | ddC | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 79 | 100 | 10 | 15 | 1:5 | in house prot | 1942 | 1286 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 80 | 10 | 12 | 15 | 1:5 | in house prot | 1635 | 1891 | 2OMe | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 81 | 10 | 12 | 15 | 1:5 | in house prot | 1230 | 1705 | 2OMe | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 82 | 10 | 12 | 15 | 1:5 | in house prot | 4700 | 1602 | rGrG + G | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 83 | 10 | 12 | 15 | 1:5 | in house prot | 4051 | 1717 | rGrG + G | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 84 | 10 | 12 | 15 | 1:5 | in house prot | 733 | 1904 | ddC | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 85 | 10 | 12 | 15 | 1:5 | in house prot | 637 | 1897 | ddC | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 86 | 10 | 12 | 15 | 1:5 | in house prot | 1104 | 1556 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 87 | 1 | 15 | 15 | 1:5 | in house prot | 923 | 1734 | 2OMe | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 88 | 1 | 15 | 15 | 1:5 | in house prot | 842 | 1620 | 2OMe | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 89 | 1 | 15 | 15 | 1:5 | in house prot | 3387 | 1426 | rGrG + G | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 90 | 1 | 15 | 15 | 1:5 | in house prot | 3609 | 1473 | rGrG + G | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 91 | 1 | 15 | 15 | 1:5 | in house prot | 401 | 1463 | ddC | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 92 | 1 | 15 | 15 | 1:5 | in house prot | 470 | 1661 | ddC | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 93 | 1 | 15 | 15 | 1:5 | in house prot | 1550 | 1341 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 94 | 1 | 15 | 15 | 1:5 | in house prot | 1267 | 1483 | rGrGrG | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 95 | 1 | 15 | 15 | 1:5 | in house prot | 2176 | 1438 | rGrG + G | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 96 | 1 | 15 | 15 | 1:5 | in house prot | 1469 | 1705 | rGrGrG | 1 | SSRTII | 9 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 97 | 1 | 15 | 15 | 1:5 | in house prot | 2383 | 1596 | rGrG + G | 1 | SSRTII | 9 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 98 | 1 | 15 | 15 | 1:5 | in house prot | 1431 | 1807 | rGrGrG | 1 | SSRTII | 12 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 99 | 1 | 15 | 15 | 1:5 | in house prot | 3630 | 1623 | rGrG + G | 1 | SSRTII | 12 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 100 | 1 | 15 | 15 | 1:5 | in house prot | 1277 | 1610 | rGrGrG | 1 | SSRTII | 15 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 101 | 1 | 15 | 15 | 1:5 | in house prot | 1884 | 1462 | rGrG + G | 1 | SSRTII | 15 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 102 | 1 | 15 | 15 | 1:5 | in house prot | 1123 | 1652 | SMARTer | 1 | SSRTII | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| Oligo IIA | 42° C. | |||||||||||||||||
| 103 | 1 | 15 | 15 | 1:5 | in house prot | 935 | 1593 | SMARTer | 1 | SSRTII | 15 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| Oligo IIA | 42° C. | |||||||||||||||||
| 104 | 1 | 15 | 15 | 1:5 | in house prot, | 2156 | 1767 | rGrG + G | 1 | SSRTII | 12 | 90′ @ | 1 | yes | KAPA | 50 | — | — |
| KAPA HiFi | 42° C. | HiFi HS | ||||||||||||||||
| after washing | ||||||||||||||||||
| beads 1 | ||||||||||||||||||
| 105 | 1 | 15 | 15 | 1:5 | in house prot, | 352 | 2151 | rGrGrG | 1 | SSRTII | 12 | 90′ @ | 1 | yes | KAPA | 50 | — | — |
| KAPA HiFi | 42° C. | HiFi HS | ||||||||||||||||
| after washing | ||||||||||||||||||
| beads 1 | ||||||||||||||||||
| 106 | 1 | 15 | 15 | 1:5 | in house prot, | 1729 | 1611 | rGrG + G | 1 | SSRTII | 12 | 90′ @ | 1 | yes | KAPA | 50 | — | — |
| KAPA HiFi | 42° C. | HiFi HS | ||||||||||||||||
| after washing | ||||||||||||||||||
| beads 2 | ||||||||||||||||||
| 107 | 1 | 15 | 15 | 1:5 | in house prot, | 203 | 2073 | rGrGrG | 1 | SSRTII | 12 | 90′ @ | 1 | yes | KAPA | 50 | — | — |
| KAPA HiFi | 42° C. | HiFi HS | ||||||||||||||||
| after washing | ||||||||||||||||||
| beads 2 | ||||||||||||||||||
| 108 | 1 | 15 | 15 | 1:5 | in house prot, | 1108 | 1480 | rGrG + G | 1 | SSRTII | 12 | 90′ @ | 1 | yes | KAPA | 50 | — | — |
| KAPA HiFi | 42° C. | HiFi HS | ||||||||||||||||
| after washing | ||||||||||||||||||
| beads 1 + | ||||||||||||||||||
| elution | ||||||||||||||||||
| 109 | 1 | 15 | 15 | 1:5 | in house prot, | 301 | 1903 | rGrGrG | 1 | SSRTII | 12 | 90′ @ | 1 | yes | KAPA | 50 | — | — |
| KAPA HiFi | 42° C. | HiFi HS | ||||||||||||||||
| after washing | ||||||||||||||||||
| beads 1 + | ||||||||||||||||||
| elution | ||||||||||||||||||
| 110 | 1 | 15 | 15 | 1:5 | in house prot, | 1337 | 1522 | rGrG + G | 1 | SSRTII | 12 | 90′ @ | 1 | yes | KAPA | 50 | — | — |
| KAPA HiFi | 42° C. | HiFi HS | ||||||||||||||||
| after washing | ||||||||||||||||||
| beads 2 + | ||||||||||||||||||
| elution | ||||||||||||||||||
| 112 | 1 | 15 | 15 | 1:5 | in house prot, | 383 | 1935 | rGrGrG | 1 | SSRTII | 12 | 90′ @ | 1 | yes | KAPA | 50 | — | — |
| KAPA HiFi | 42° C. | HiFi HS | ||||||||||||||||
| after washing | ||||||||||||||||||
| beads 2 + | ||||||||||||||||||
| elution | ||||||||||||||||||
| 113 | 1 | 15 | 15 | 1:5 | in house prot | 2897 | 1737 | rGrG + G | 1 | SSRTII | 12 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 114 | 1 | 15 | 15 | 1:5 | in house prot | 1853 | 1706 | rGrGrG | 1 | SSRTII | 12 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| 42° C. | ||||||||||||||||||
| 115 | 1 | 15 | 15 | 1:5 | in house prot | 1492 | 1563 | rGrG + G | 1 | Revertaid | 4 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| H− | 42° C. | |||||||||||||||||
| 116 | 1 | 15 | 15 | 1:5 | in house prot | 1236 | 1472 | rGrG + G | 1 | Revertaid | 4 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| H− | 42° C. | |||||||||||||||||
| 117 | 1 | 15 | 15 | 1:5 | in house prot | 1843 | 1450 | rGrG + G | 1 | Revertaid | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| H− | 42° C. | |||||||||||||||||
| 118 | 1 | 15 | 15 | 1:5 | in house prot | 1465 | 1346 | rGrG + G | 1 | Revertaid | 6 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| H− | 42° C. | |||||||||||||||||
| 119 | 1 | 15 | 15 | 1:5 | in house prot | 2996 | 1597 | rGrG + G | 1 | Revertaid | 9 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| H− | 42° C. | |||||||||||||||||
| 120 | 1 | 15 | 15 | 1:5 | in house prot | 2654 | 1530 | rGrG + G | 1 | Revertaid | 9 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| H− | 42° C. | |||||||||||||||||
| 121 | 1 | 15 | 15 | 1:5 | in house prot | 2159 | 1487 | rGrG + G | 1 | Revertaid | 12 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| H− | 42° C. | |||||||||||||||||
| 122 | 1 | 15 | 15 | 1:5 | in house prot | 1890 | 1412 | rGrG + G | 1 | Revertaid | 12 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| H− | 42° C. | |||||||||||||||||
| 123 | 1 | 15 | 15 | 1:5 | in house prot | 1504 | 1246 | rGrG + G | 1 | Revertaid | 15 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| H− | 42° C. | |||||||||||||||||
| 124 | 1 | 15 | 15 | 1:5 | in house prot | 1986 | 1474 | rGrG + G | 1 | Revertaid | 15 | 90′ @ | 1 | yes | Advantage | 50 | — | — |
| H− | 42° C. | |||||||||||||||||
| 125 | 1 | 15 | 15 | 1:5 | in house prot | 1109 | 1691 | rGrG + G | 1 | SSRTII | — | 60′ @42° | — | yes | Advantage | 50 | — | 0.3M |
| C., then | trehalose | |||||||||||||||||
| 90′ @60° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 126 | 1 | 15 | 15 | 1:5 | in house prot | 1090 | 1752 | rGrG + G | 1 | SSRTII | — | 60′ @42° | — | yes | Advantage | 50 | — | 0.3M |
| C., then | trehalose | |||||||||||||||||
| 90′ @60° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 127 | 1 | 15 | 15 | 1:5 | in house prot | 863 | 1565 | rGrG + G | 1 | SSRTII | — | 60′ @42° | — | yes | Advantage | 50 | — | 0.6M |
| C., then | trehalose | |||||||||||||||||
| 90′ @60° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 128 | 1 | 15 | 15 | 1:5 | in house prot | 896 | 1652 | rGrG + G | 1 | SSRTII | — | 60′ @42° | — | yes | Advantage | 50 | — | 0.6M |
| C., then | trehalose | |||||||||||||||||
| 90′ @60° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 129 | 1 | 15 | 15 | 1:5 | in house prot | 1078 | 1655 | rGrG + G | 1 | SSRTII | — | 60′ @42° | 1 | yes | Advantage | 50 | — | 0.3M |
| C., then | trehalose | |||||||||||||||||
| 90′ @60° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 130 | 1 | 15 | 15 | 1:5 | in house prot | 562 | 1517 | rGrG + G | 1 | SSRTII | — | 60′ @42° | 1 | yes | Advantage | 50 | — | 0.3M |
| C., then | trehalose | |||||||||||||||||
| 90′ @60° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 131 | 1 | 15 | 15 | 1:5 | in house prot | 998 | 1594 | rGrG + G | 1 | SSRTII | — | 60′ @42° | 0.6 | yes | Advantage | 50 | — | 0.3M |
| C., then | trehalose | |||||||||||||||||
| 90′ @60° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 132 | 1 | 15 | 15 | 1:5 | in house prot | 925 | 1545 | rGrG + G | 1 | SSRTII | — | 60′ @42° | 0.6 | yes | Advantage | 50 | — | 0.3M |
| C., then | trehalose | |||||||||||||||||
| 90′ @60° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 133 | 1 | 15 | 15 | 1:5 | in house prot | 1155 | 1618 | rGrG + G | 1 | SSRTII | 3 | 60′ @42° | 1 | yes | Advantage | 50 | — | 0.3M |
| C., then | trehalose | |||||||||||||||||
| 90′ @60° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 134 | 1 | 15 | 15 | 1:5 | in house prot | 603 | 1433 | rGrG + G | 1 | SSRTII | 3 | 60′ @42° | 1 | yes | Advantage | 50 | — | 0.3M |
| C., then | trehalose | |||||||||||||||||
| 90′ @60° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 135 | 1 | 15 | 15 | 1:5 | in house prot | 1561 | 1716 | rGrG + G | 1 | SSRTII | 3 | 60′ @42° | 0.6 | yes | Advantage | 50 | — | 0.3M |
| C., then | trehalose | |||||||||||||||||
| 90′ @60° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 136 | 1 | 15 | 15 | 1:5 | in house prot | 445 | 1575 | rGrG + G | 1 | SSRTII | — | 60′ @50° | — | yes | Advantage | 50 | — | 0.3M |
| C., then | trehalose | |||||||||||||||||
| 90′ @42° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 137 | 1 | 15 | 15 | 1:5 | in house prot | 1466 | 1698 | rGrG + G | 1 | SSRTII | — | 90′ @42° | — | yes | Advantage | 50 | — | 0.3M |
| C., | trehalose | |||||||||||||||||
| 30′ @60° | ||||||||||||||||||
| C., then | ||||||||||||||||||
| 30′ @42° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 138 | 1 | 15 | 15 | 1:5 | in house prot | 703 | 1580 | rGrG + G | 1 | SSRTII | — | 60′ @50° | — | yes | Advantage | 50 | — | 0.6M |
| C., then | trehalose | |||||||||||||||||
| 90′ @42° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 139 | 1 | 15 | 15 | 1:5 | in house prot | 1397 | 1740 | rGrG + G | 1 | SSRTII | — | 90′ @42° | — | yes | Advantage | 50 | — | 0.6M |
| C., | trehalose | |||||||||||||||||
| 30′ @60° | ||||||||||||||||||
| C., then | ||||||||||||||||||
| 30′ @42° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 140 | 1 | 15 | 15 | 1:5 | in house prot | 355 | 1425 | rGrG + G | 1 | SSRTII | — | 60′ @50° | 0.6 | yes | Advantage | 50 | — | 0.6M |
| C., then | trehalose | |||||||||||||||||
| 90′ @42° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 141 | 1 | 15 | 15 | 1:5 | in house prot | 1654 | 1598 | rGrG + G | 1 | SSRTII | — | 90′ @42° | 0.6 | yes | Advantage | 50 | — | 0.6M |
| C., | trehalose | |||||||||||||||||
| 30′ @60° | ||||||||||||||||||
| C., then | ||||||||||||||||||
| 30′ @42° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 142 | 1 | 15 | 15 | 1:5 | in house prot | 1470 | 1480 | rGrG + G | 1 | SSRTII | 12 | 60′ @50° | 0.6 | yes | Advantage | 50 | — | 0.6M |
| C., then | trehalose | |||||||||||||||||
| 90′ @42° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 143 | 1 | 15 | 15 | 1:5 | in house prot | 1389 | 1480 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 0.6 | yes | Advantage | 50 | — | 0.6M |
| C., | trehalose | |||||||||||||||||
| 30′ @60° | ||||||||||||||||||
| C., then | ||||||||||||||||||
| 30′ @42° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 144 | 1 | 15 | 15 | 1:5 | in house prot | 3959 | 1641 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10X | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 145 | 1 | 15 | 15 | 1:5 | in house prot | 3816 | 1732 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10X | ||||||||||||||||||
| (2′ @60° C.- | ||||||||||||||||||
| 2′ @42° C. | ||||||||||||||||||
| 146 | 1 | 15 | 15 | 1:5 | in house prot | 3179 | 1769 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 0.5 | yes | Advantage | 50 | — | 0.3M |
| C., then 10X | trehalose | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C. | ||||||||||||||||||
| 147 | 1 | 15 | 15 | 1:5 | in house prot | 3271 | 1828 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 0.5 | yes | Advantage | 50 | — | 0.3M |
| C., then 10X | trehalose | |||||||||||||||||
| (2′ @60° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 148 | 1 | 15 | 15 | 1:5 | in house prot | 4081 | 1706 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 5x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 149 | 1 | 15 | 15 | 1:5 | in house prot | 3858 | 1771 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 5x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 150 | 1 | 15 | 15 | 1:5 | in house prot | 3711 | 1781 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 5x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 151 | 1 | 15 | 15 | 1:5 | in house prot | 4015 | 1773 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 152 | 1 | 15 | 15 | 1:5 | in house prot | 3671 | 1753 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 153 | 1 | 15 | 15 | 1:5 | in house prot | 3498 | 1708 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 154 | 1 | 15 | 15 | 1:5 | in house prot | 3804 | 1610 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 15x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 155 | 1 | 15 | 15 | 1:5 | in house prot | 3613 | 1679 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 15x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 156 | 1 | 15 | 15 | 1:5 | in house prot | 4595 | 1630 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 15x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 157 | 1 | 15 | 15 | 1:5 | in house prot | 3457 | 1525 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 20x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 158 | 1 | 15 | 15 | 1:5 | in house prot | 2869 | 1409 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 20x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 159 | 1 | 15 | 15 | 1:5 | in house prot | 1529 | 1629 | 3rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 160 | 1 | 15 | 15 | 1:5 | in house prot | 1901 | 1728 | 3rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 161 | 1 | 15 | 15 | 1:5 | in house prot | 1785 | 1717 | 3rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 162 | 1 | 15 | 15 | 1:5 | in house prot | 1086 | 1928 | 2rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 163 | 1 | 15 | 15 | 1:5 | in house prot | 1128 | 1846 | 2rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 164 | 1 | 15 | 15 | 1:5 | in house prot | 596 | 1892 | phosphate | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 165 | 1 | 15 | 15 | 1:5 | in house prot | 579 | 1922 | phosphate | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 166 | 1 | 15 | 15 | 1:5 | in house prot | 546 | 1830 | C6 amino | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 167 | 1 | 15 | 15 | 1:5 | in house prot | 419 | 1664 | C6 amino | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 168 | 1 | 15 | 15 | 1:5 | in house prot | 3076 | 1567 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 169 | 1 | 15 | 15 | 1:5 | in house prot | 2889 | 1465 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 170 | 1 | 15 | 15 | 1:5 | in house prot | 3653 | 1735 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 171 | 1 | 15 | 15 | 1:5 | in house prot | 2152 | 1455 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 172 | 1 | 15 | 15 | 1:5 | in house prot | 1454 | 1084 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | 0.816M |
| C., then 10x | 1,2 | |||||||||||||||||
| (2′ @50° C.- | propandiol | |||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 173 | 1 | 15 | 15 | 1:5 | in house prot | 1331 | 1106 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | 0.816M |
| C., then 10x | 1,2 | |||||||||||||||||
| (2′ @50° C.- | propandiol | |||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 174 | 1 | 15 | 15 | 1:5 | in house prot | 1373 | 1089 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | 0.816M |
| C., then 10x | 1,2 | |||||||||||||||||
| (2′ @50° C.- | propandiol | |||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 175 | 1 | 15 | 15 | 1:5 | in house prot | 1904 | 1453 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | 1.075M |
| C., then 10x | ethylene | |||||||||||||||||
| (2′ @50° C.- | glycol | |||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 176 | 1 | 15 | 15 | 1:5 | in house prot | 2855 | 1390 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | 1.075M |
| C., then 10x | ethylene | |||||||||||||||||
| (2′ @50° C.- | glycol | |||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 177 | 1 | 15 | 15 | 1:5 | in house prot | 2571 | 1670 | rGrG + G | 1 | Maxima | 4 | 90′ @50° | 1 | yes | Advantage | 50 | — | — |
| H− | C. | |||||||||||||||||
| 178 | 1 | 15 | 15 | 1:5 | in house prot | 2549 | 1722 | rGrG + G | 1 | Maxima | 4 | 90′ @50° | 1 | yes | Advantage | 50 | — | — |
| H− | C. | |||||||||||||||||
| 179 | 1 | 15 | 15 | 1:5 | in house prot | 288 | 1599 | rGrG + G | 1 | Revertaid | 4 | 90′ @50° | 1 | yes | Advantage | 50 | — | — |
| Premium | C. | |||||||||||||||||
| 180 | 1 | 15 | 15 | 1:5 | in house prot | 129 | 1608 | rGrG + G | 1 | Revertaid | 4 | 90′ @50° | 1 | yes | Advantage | 50 | — | — |
| Premium | C. | |||||||||||||||||
| 181 | in house prot | FAILED | rGrG + G | 1 | Maxima | 12 | 90′ @50° | 1 | yes | Advantage | 50 | — | — | |||||
| H− | C. | |||||||||||||||||
| 182 | in house prot | FAILED | rGrG + G | 1 | Maxima | 12 | 90′ @50° | 1 | yes | Advantage | 50 | — | — | |||||
| H− | C. | |||||||||||||||||
| 183 | 1 | 15 | 15 | 1:5 | in house prot | 2633 | 1341 | rGrG + G | 1 | Revertaid | 12 | 90′ @50° | 1 | yes | Advantage | 50 | — | — |
| Premium | C. | |||||||||||||||||
| 184 | 1 | 15 | 15 | 1:5 | in house prot | 2662 | 1325 | rGrG + G | 1 | Revertaid | 12 | 90′ @50° | 1 | yes | Advantage | 50 | — | — |
| Premium | C. | |||||||||||||||||
| 185 | 1 | 15 | 15 | 1:5 | in house prot | 2814 | 1674 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 186 | in house prot | FAILED | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Long PCR | 50 | — | — | |||||
| C., then 10x | Enzyme | |||||||||||||||||
| (2′ @50° C.- | mix | |||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 187 | 1 | 15 | 15 | 1:5 | in house prot, | 3155 | 1764 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | Phusion | 100 | — | — |
| PCR w/o | C., then 10x | HS | ||||||||||||||||
| purif in | (2′ @50° C.- | |||||||||||||||||
| 100 ul | 2′ @42° C.) | |||||||||||||||||
| 188 | 1 | 15 | 15 | 1:5 | in house prot, | 2740 | 1793 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | Phusion | 100 | — | — |
| PCR w/o | C., then 10x | HS | ||||||||||||||||
| purif in | (2′ @50° C.- | |||||||||||||||||
| 100 ul | 2′ @42° C.) | |||||||||||||||||
| 189 | 1 | 15 | 15 | 1:5 | in house prot, | 1857 | 1739 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | Q5 NEB | 100 | — | — |
| PCR w/o | C., then 10x | |||||||||||||||||
| purif in | (2′ @50° C.- | |||||||||||||||||
| 100 ul | 2′ @42° C.) | |||||||||||||||||
| 190 | 1 | 15 | 15 | 1:5 | in house prot, | 1697 | 1697 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | Q5 NEB | 100 | — | — |
| PCR w/o | C., then 10x | |||||||||||||||||
| purif in | (2′ @50° C.- | |||||||||||||||||
| 100 ul | 2′ @42° C.) | |||||||||||||||||
| 191 | 1 | 15 | 15 | 1:5 | in house prot, | 3278 | 1639 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 100 | — | — |
| PCR w/o | C., then 10x | HiFi HS | ||||||||||||||||
| purif in | (2′ @50° C.- | |||||||||||||||||
| 100 ul | 2′ @42° C.) | |||||||||||||||||
| 192 | 1 | 15 | 15 | 1:5 | in house prot, | 3719 | 1590 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 100 | — | — |
| PCR w/o | C., then 10x | HiFi HS | ||||||||||||||||
| purif in | (2′ @50° C.- | |||||||||||||||||
| 100 ul | 2′ @42° C.) | |||||||||||||||||
| 193 | 1 | 15 | 15 | 1:5 | in house prot, | 3816 | 1630 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | Advantage | 50 | — | — |
| PCR w/o | C., then 10x | |||||||||||||||||
| purif in | (2′ @50° C.- | |||||||||||||||||
| 50 ul | 2′ @42° C.) | |||||||||||||||||
| 194 | 1 | 15 | 15 | 1:5 | in house prot, | 2462 | 1653 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | Advantage | 50 | — | — |
| PCR w/o | C., then 10x | |||||||||||||||||
| purif in | (2′ @50° C.- | |||||||||||||||||
| 50 ul | 2′ @42° C.) | |||||||||||||||||
| 195 | 1 | 15 | 15 | 1:5 | in house prot, | 2848 | 1588 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | Advantage | 50 | — | — |
| PCR w/o | C., then 10x | |||||||||||||||||
| purif in | (2′ @50° C.- | |||||||||||||||||
| 50 ul | 2′ @42° C.) | |||||||||||||||||
| 196 | 1 | 15 | 15 | 1:5 | in house prot, | 2012 | 1669 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | Phusion | 50 | — | — |
| PCR w/o | C., then 10x | HS | ||||||||||||||||
| purif in | (2′ @50° C.- | |||||||||||||||||
| 50 ul | 2′ @42° C.) | |||||||||||||||||
| 197 | 1 | 15 | 15 | 1:5 | in house prot, | 1836 | 1665 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | Phusion | 50 | — | — |
| PCR w/o | C., then 10x | HS | ||||||||||||||||
| purif in | (2′ @50° C.- | |||||||||||||||||
| 50 ul | 2′ @42° C.) | |||||||||||||||||
| 198 | 1 | 15 | 15 | 1:5 | in house prot, | 2542 | 1771 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 50 | — | — |
| PCR w/o | C., then 10x | HiFi HS | ||||||||||||||||
| purif in | (2′ @50° C.- | |||||||||||||||||
| 50 ul | 2′ @42° C.) | |||||||||||||||||
| 199 | 1 | 15 | 15 | 1:5 | in house prot, | 2393 | 1808 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 50 | — | — |
| PCR w/o | C., then 10x | HiFi HS | ||||||||||||||||
| purif in | (2′ @50° C.- | |||||||||||||||||
| 50 ul | 2′ @42° C.) | |||||||||||||||||
| 200 | 1 | 15 | 15 | 1:5 | in house prot, | 2200 | 1933 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | Advantage | 50 | — | — |
| PCR w/o | C., then 10x | |||||||||||||||||
| purif in | (2′ @50° C.- | |||||||||||||||||
| 50 ul | 2′ @42° C.) | |||||||||||||||||
| 201 | 1 | 15 | 15 | 1:5 | in house prot, | 2371 | 1920 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | Advantage | 50 | — | — |
| PCR w/o | C., then 10x | |||||||||||||||||
| purif in | (2′ @50° C.- | |||||||||||||||||
| 50 ul | 2′ @42° C.) | |||||||||||||||||
| 202 | 1 | 15 | 15 | 1:5 | in house prot, | 1717 | 1780 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | Q5 NEB | 50 | — | — |
| PCR w/o | C., then 10x | |||||||||||||||||
| purif in | (2′ @50° C.- | |||||||||||||||||
| 50 ul | 2′ @42° C.) | |||||||||||||||||
| 203 | 1 | 15 | 15 | 1:5 | in house prot, | 1868 | 1759 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | Q5 NEB | 50 | — | — |
| PCR w/o | C., then 10x | |||||||||||||||||
| purif in | (2′ @50° C.- | |||||||||||||||||
| 50 ul | 2′ @42° C.) | |||||||||||||||||
| 204 | 1 | 15 | 15 | 1:5 | in house prot | 40 | 1772 | rGrG + G | 1 | SSRTIII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 205 | 1 | 15 | 15 | 1:5 | in house prot | 16 | 1017 | rGrG + G | 1 | SSRTIII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 206 | 1 | 15 | 15 | 1:5 | in house prot | 88 | 1753 | rGrG + G | 1 | SSRTIII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 207 | 1 | 15 | 15 | 1:5 | in house prot | 61 | 1557 | rGrG + G | 1 | SSRTIII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 208 | 1 | 15 | 15 | 1:5 | in house prot | 182 | 1766 | rGrG + G | 1 | SSRTIII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 209 | 1 | 15 | 15 | 1:5 | in house prot | 136 | 1742 | rGrG + G | 1 | SSRTIII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 210 | 1 | 15 | 15 | 1:5 | in house prot | 279 | 1701 | rGrG + G | 1 | SSRTIII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 211 | 1 | 15 | 15 | 1:5 | in house prot | 233 | 1643 | rGrG + G | 1 | SSRTIII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 212 | 1 | 15 | 15 | 1:5 | in house prot | 447 | 1602 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 213 | 1 | 15 | 15 | 1:5 | in house prot | 363 | 1541 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 214 | 1 | 15 | 15 | 1:5 | in house prot | 1279 | 1919 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 215 | 1 | 15 | 15 | 1:5 | in house prot | 1739 | 1959 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 216 | 1 | 15 | 15 | 1:5 | in house prot | 1861 | 2063 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 217 | 1 | 15 | 15 | 1:5 | in house prot | 2329 | 2260 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| (40 u | C., then 10x | |||||||||||||||||
| SSRTII) | (2′ @50° C.- | |||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 218 | 1 | 15 | 15 | 1:5 | in house prot | 2273 | 2218 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| (40 u | C., then 10x | |||||||||||||||||
| SSRTII) | (2′ @50° C.- | |||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 219 | 1 | 15 | 15 | 1:5 | in house prot | 2013 | 2268 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| (40 u | C., then 10x | |||||||||||||||||
| SSRTII, with | (2′ @50° C.- | |||||||||||||||||
| dNTPs + | 2′ @42° C.) | |||||||||||||||||
| betaine added | ||||||||||||||||||
| in the | ||||||||||||||||||
| beginning) | ||||||||||||||||||
| 220 | 1 | 15 | 15 | 1:5 | in house prot | 1932 | 2122 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| (40 u | C., then 10x | |||||||||||||||||
| SSRTII, with | (2′ @50° C.- | |||||||||||||||||
| dNTPs + | 2′ @42° C.) | |||||||||||||||||
| betaine added | ||||||||||||||||||
| in the | ||||||||||||||||||
| beginning) | ||||||||||||||||||
| 221 | 1 | 15 | 15 | 1:5 | in house prot | 1877 | 2009 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| (40 u | C., then 10x | |||||||||||||||||
| SSRTII, with | (2′ @50° C.- | |||||||||||||||||
| dNTPs + | 2′ @42° C.) | |||||||||||||||||
| betaine + | ||||||||||||||||||
| MgCl2 added | ||||||||||||||||||
| in the | ||||||||||||||||||
| beginning) | ||||||||||||||||||
| 222 | 1 | 15 | 15 | 1:5 | in house prot | 989 | 1963 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| (40 u | C., then 10x | |||||||||||||||||
| SSRTII, with | (2′ @50° C.- | |||||||||||||||||
| dNTPs + | 2′ @42° C.) | |||||||||||||||||
| betaine + | ||||||||||||||||||
| MgCl2 added | ||||||||||||||||||
| in the | ||||||||||||||||||
| beginning) | ||||||||||||||||||
| 223 | 1 | 15 | 15 | 1:5 | in house prot | 2269 | 1316 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| (40 u | C., then 10x | |||||||||||||||||
| SSRTII, with | (2′ @50° C.- | |||||||||||||||||
| all reagents | 2′ @42° C.) | |||||||||||||||||
| except | ||||||||||||||||||
| SSRTII added | ||||||||||||||||||
| in the | ||||||||||||||||||
| beginning) | ||||||||||||||||||
| 224 | 1 | 15 | 15 | 1:5 | in house prot | 1926 | 1292 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| (40 u | C., then 10x | |||||||||||||||||
| SSRTII, with | (2′ @50° C.- | |||||||||||||||||
| all reagents | 2′ @42° C.) | |||||||||||||||||
| except | ||||||||||||||||||
| SSRTII added | ||||||||||||||||||
| in the | ||||||||||||||||||
| beginning) | ||||||||||||||||||
| 225 | 1 | 15 | 15 | 1:5 | in house prot | 1536 | 1297 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| (40 u | C., then 10x | |||||||||||||||||
| SSRTII, with | (2′ @50° C.- | |||||||||||||||||
| all reagents | 2′ @42° C.) | |||||||||||||||||
| except | ||||||||||||||||||
| SSRTII added | ||||||||||||||||||
| in the | ||||||||||||||||||
| beginning) | ||||||||||||||||||
| 226 | 1 | 15 | 15 | 1:5 | in house prot | 1604 | 1925 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 227 | 1 | 15 | 15 | 1:5 | in house prot | 1493 | 1910 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 228 | 1 | 15 | 15 | 1:5 | in house prot | 1540 | 1924 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 229 | 1 | 15 | 15 | 1:5 | in house prot | 1946 | 2143 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 230 | 1 | 15 | 15 | 1:5 | in house prot | 1620 | 2100 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 231 | 1 | 15 | 15 | 1:5 | in house prot | 1724 | 2059 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 232 | 1 | 15 | 15 | 1:5 | in house prot | 1355 | 1813 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| (no | C., then 10x | |||||||||||||||||
| denaturation | (2′ @50° C.- | |||||||||||||||||
| step @72° | 2′ @42° C.) | |||||||||||||||||
| C. for oligo-dT | ||||||||||||||||||
| (incubated | ||||||||||||||||||
| 5′ @RT)) | ||||||||||||||||||
| 233 | 1 | 15 | 15 | 1:5 | in house prot | 1330 | 1810 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| (no | C., then 10x | |||||||||||||||||
| denaturation | (2′ @50° C.- | |||||||||||||||||
| step @72° | 2′ @42° C.) | |||||||||||||||||
| C. for oligo-dT | ||||||||||||||||||
| (incubated | ||||||||||||||||||
| 5′ @RT)) | ||||||||||||||||||
| 234 | 1 | 15 | 15 | 1:5 | in house prot | 1319 | 1795 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | — | — |
| (no | C., then 10x | |||||||||||||||||
| denaturation | (2′ @50° C.- | |||||||||||||||||
| step @72° | 2′ @42° C.) | |||||||||||||||||
| C. for oligo-dT | ||||||||||||||||||
| (incubated | ||||||||||||||||||
| 5′ @RT)) | ||||||||||||||||||
| 235 | 1 | 15 | 15 | 1:5 | in house prot | 1493 | 1842 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| (no | C., then 10x | |||||||||||||||||
| denaturation | (2′ @50° C.- | |||||||||||||||||
| step @72° | 2′ @42° C.) | |||||||||||||||||
| C. for oligo-dT | ||||||||||||||||||
| (incubated | ||||||||||||||||||
| 5′ @RT)) | ||||||||||||||||||
| 236 | 1 | 15 | 15 | 1:5 | in house prot | 1332 | 1792 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| (no | C., then 10x | |||||||||||||||||
| denaturation | (2′ @50° C.- | |||||||||||||||||
| step @72° | 2′ @42° C.) | |||||||||||||||||
| C. for oligo-dT | ||||||||||||||||||
| (incubated | ||||||||||||||||||
| 5′ @RT)) | ||||||||||||||||||
| 237 | 1 | 15 | 15 | 1:5 | in house prot | 1728 | 2214 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 238 | 1 | 15 | 15 | 1:5 | in house prot | 1620 | 2283 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 239 | 1 | 15 | 15 | 1:5 | in house prot | 1563 | 2260 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 240 | 1 | 15 | 15 | 1:5 | in house prot | 1485 | 2171 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @55° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 241 | 1 | 15 | 15 | 1:5 | in house prot | 1444 | 2281 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @55° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 242 | 1 | 15 | 15 | 1:5 | in house prot | 1308 | 2231 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @55° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 243 | 1 | 15 | 15 | 1:5 | in house prot | 1618 | 2176 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @60° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 244 | 1 | 15 | 15 | 1:5 | in house prot | 1385 | 2168 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @60° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 245 | 1 | 15 | 15 | 1:5 | in house prot | 1588 | 2173 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @60° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 246 | 1 | 15 | 15 | 1:5 | in house prot | 1332 | 2096 | rGrG + G | 1 | SSRTII | 12 | 90′ @ | 1 | yes | Advantage | 50 | yes | — |
| 42° C. | ||||||||||||||||||
| 247 | 1 | 15 | 15 | 1:5 | in house prot | 1376 | 2054 | rGrG + G | 1 | SSRTII | 12 | 90′ @ | 1 | yes | Advantage | 50 | yes | — |
| 42° C. | ||||||||||||||||||
| 248 | 1 | 15 | 15 | 1:5 | in house prot | 15 | 2251 | rGrG + G | 1 | Maxima | 4 | 90′ @ | — | yes | Advantage | 50 | yes | — |
| H− | 55° C. | |||||||||||||||||
| 249 | 1 | 15 | 15 | 1:5 | in house prot | 22 | 1988 | rGrG + G | 1 | Maxima | 4 | 90′ @ | — | yes | Advantage | 50 | yes | — |
| H− | 55° C. | |||||||||||||||||
| 250 | 1 | 15 | 15 | 1:5 | in house prot | 62 | 2084 | rGrG + G | 1 | Maxima | 4 | 90′ @ | 1 | yes | Advantage | 50 | yes | — |
| H− | 55° C. | |||||||||||||||||
| 251 | 1 | 15 | 15 | 1:5 | in house prot | 84 | 1867 | rGrG + G | 1 | Maxima | 4 | 90′ @ | 1 | yes | Advantage | 50 | yes | — |
| H− | 55° C. | |||||||||||||||||
| 252 | 1 | 15 | 15 | 1:5 | in house prot | 633 | 2065 | rGrG + G | 1 | Maxima | 4 | 90′ @ | — | yes | Advantage | 50 | yes | — |
| H− | 55° C. | |||||||||||||||||
| 253 | in house prot | FAILED | rGrG + G | 1 | Maxima | 4 | 90′ @ | — | yes | Advantage | 50 | yes | — | |||||
| (+extra DTT) | H− | 60° C. | ||||||||||||||||
| 254 | in house prot | FAILED | rGrG + G | 1 | Maxima | 4 | 90′ @ | 1 | yes | Advantage | 50 | yes | — | |||||
| (+extra DTT) | H− | 60° C. | ||||||||||||||||
| 255 | in house prot | FAILED | rGrG + G | 1 | Maxima | 12 | 90′ @ | 1 | yes | Advantage | 50 | yes | — | |||||
| (+extra DTT) | H− | 60° C. | ||||||||||||||||
| 256 | 1 | 15 | 15 | 1:5 | in house prot | 80 | 1933 | rGrG + G | 1 | Maxima | 12 | 90′ @ | 1 | yes | Advantage | 50 | yes | — |
| (+extra DTT) | H− | 60° C. | ||||||||||||||||
| 257 | 1 | 15 | 15 | 1:5 | in house prot | 634 | 2177 | rGrG + G | 1 | Maxima | 4 | 90′ @ | — | yes | Advantage | 50 | yes | — |
| (+extra DTT) | H− | 50° C. | ||||||||||||||||
| 258 | 1 | 15 | 15 | 1:5 | in house prot | 684 | 2195 | rGrG + G | 1 | Maxima | 4 | 90′ @ | — | yes | Advantage | 50 | yes | — |
| (+extra DTT) | H− | 50° C. | ||||||||||||||||
| 259 | 1 | 15 | 15 | 1:5 | in house prot | 1013 | 2142 | rGrG + G | 1 | Maxima | 4 | 90′ @ | 1 | yes | Advantage | 50 | yes | — |
| (+extra DTT) | H− | 50° C. | ||||||||||||||||
| 260 | 1 | 15 | 15 | 1:5 | in house prot | 1195 | 2100 | rGrG + G | 1 | Maxima | 4 | 90′ @ | 1 | yes | Advantage | 50 | yes | — |
| (+extra DTT) | H− | 50° C. | ||||||||||||||||
| 261 | 1 | 15 | 15 | 1:5 | in house prot | 2192 | 1858 | rGrG + G | 1 | Maxima | 12 | 90′ @ | 1 | yes | Advantage | 50 | yes | — |
| (+extra DTT) | H− | 50° C. | ||||||||||||||||
| 262 | 1 | 15 | 15 | 1:5 | in house prot | 2209 | 1837 | rGrG + G | 1 | Maxima | 12 | 90′ @ | 1 | yes | Advantage | 50 | yes | — |
| (+extra DTT) | H− | 50° C. | ||||||||||||||||
| 263 | 1 | 15 | 15 | 1:5 | in house prot | 647 | 2117 | rGrG + G | 1 | Maxima | 4 | 90′ @ | — | yes | Advantage | 50 | yes | — |
| (NO | H− | 50° C. | ||||||||||||||||
| extra DTT) | ||||||||||||||||||
| 264 | 1 | 15 | 15 | 1:5 | in house prot | 613 | 2147 | rGrG + G | 1 | Maxima | 4 | 90′ @ | — | yes | Advantage | 50 | yes | — |
| (NO | H− | 50° C. | ||||||||||||||||
| extra DTT) | ||||||||||||||||||
| 265 | 1 | 15 | 15 | 1:5 | in house prot | 1442 | 1989 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 266 | 1 | 15 | 15 | 1:5 | in house prot | 1496 | 2105 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 267 | 1 | 15 | 15 | 1:5 | in house prot | 1228 | 2677 | rGrG + G | 1 | Maxima | 4 | 90′ @ | — | — | KAPA | 50 | yes | — |
| H− | 50° C. | HiFi HS | ||||||||||||||||
| 268 | 1 | 15 | 15 | 1:5 | in house prot | 882 | 2283 | rGrG + G | 1 | Maxima | 4 | 90′ @ | — | — | Advantage | 50 | yes | — |
| H− | 50° C. | |||||||||||||||||
| 269 | 1 | 15 | 15 | 1:5 | in house prot | 2475 | 2558 | rGrG + G | 1 | Maxima | 4 | 90′ @ | 1 | — | KAPA | 50 | yes | — |
| H− | 50° C. | HiFi HS | ||||||||||||||||
| 270 | 1 | 15 | 15 | 1:5 | in house prot | 1557 | 2201 | rGrG + G | 1 | Maxima | 4 | 90′ @ | 1 | — | Advantage | 50 | yes | — |
| H− | 50° C. | |||||||||||||||||
| 271 | 1 | 15 | 15 | 1:5 | in house prot | 4074 | 2185 | rGrG + G | 1 | Maxima | 12 | 90′ @ | 1 | — | KAPA | 50 | yes | — |
| H− | 50° C. | HiFi HS | ||||||||||||||||
| 272 | 1 | 15 | 15 | 1:5 | in house prot | 2927 | 2330 | rGrG + G | 1 | Maxima | 12 | 90′ @ | 1 | — | Advantage | 50 | yes | — |
| H− | 50° C. | |||||||||||||||||
| 273 | 1 | 15 | 15 | 1:5 | in house prot | 3213 | 2524 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 50 | yes | — |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 274 | 1 | 15 | 15 | 1:5 | in house prot | 3359 | 2662 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 275 | 1 | 15 | 15 | 1:5 | in house prot | 819 | 2069 | rGrG + G | 1 | Maxima | 4 | 90′ @ | — | yes | Advantage | 50 | yes | — |
| H− | 50° C. | |||||||||||||||||
| 276 | 1 | 15 | 15 | 1:5 | in house prot | 737 | 2202 | rGrG + G | 1 | Maxima | 4 | 90′ @ | — | yes | Advantage | 50 | yes | — |
| H− | 50° C. | |||||||||||||||||
| 277 | 1 | 15 | 15 | 1:5 | in house prot | 1375 | 1937 | rGrG + G | 1 | Maxima | 4 | 90′ @ | 1 | yes | Advantage | 50 | yes | — |
| H− | 50° C. | |||||||||||||||||
| 278 | 1 | 15 | 15 | 1:5 | in house prot | 1426 | 2008 | rGrG + G | 1 | Maxima | 4 | 90′ @ | 1 | yes | Advantage | 50 | yes | — |
| H− | 50° C. | |||||||||||||||||
| 279 | 1 | 15 | 15 | 1:5 | in house prot | 2773 | 1848 | rGrG + G | 1 | Maxima | 12 | 90′ @ | 1 | yes | Advantage | 50 | yes | — |
| H− | 50° C. | |||||||||||||||||
| 280 | 1 | 15 | 15 | 1:5 | in house prot | 2987 | 1916 | rGrG + G | 1 | Maxima | 12 | 90′ @ | 1 | yes | Advantage | 50 | yes | — |
| H− | 50° C. | |||||||||||||||||
| 281 | 1 | 15 | 15 | 1:5 | in house prot | 2155 | 2266 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 282 | 1 | 15 | 15 | 1:5 | in house prot | 2240 | 2271 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | — |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 283 | 1 | 15 | 15 | 1:5 | in house prot | 694 | 2244 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | — | yes | Advantage | 50 | yes | 1M |
| C., then 10x | proline | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 284 | 1 | 15 | 15 | 1:5 | in house prot | 682 | 2361 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | — | yes | Advantage | 50 | yes | 1M |
| C., then 10x | proline | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 285 | 1 | 15 | 15 | 1:5 | in house prot | 745 | 2264 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | — | yes | Advantage | 50 | yes | 1M |
| C., then 10x | proline | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 286 | 1 | 15 | 15 | 1:5 | in house prot | 766 | 2311 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | — | yes | Advantage | 50 | yes | 1M |
| C., then 10x | proline | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 287 | 1 | 15 | 15 | 1:5 | in house prot | 685 | 2304 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | — | yes | Advantage | 50 | yes | 1M |
| C., then 10x | proline | |||||||||||||||||
| (2′ @50° C. | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 288 | 1 | 15 | 15 | 1:5 | in house prot | 642 | 2226 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | — | yes | Advantage | 50 | yes | 1M |
| C., then 10x | proline | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 289 | 1 | 15 | 15 | 1:5 | in house prot | 1133 | 1873 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 290 | 1 | 15 | 15 | 1:5 | in house prot | 1443 | 2148 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 291 | 1 | 15 | 15 | 1:5 | in house prot | 1147 | 2066 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 292 | 1 | 15 | 15 | 1:5 | in house prot | 1322 | 2084 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 293 | 1 | 15 | 15 | 1:5 | in house prot | 1013 | 2095 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 294 | 1 | 15 | 15 | 1:5 | in house prot | 960 | 2125 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 295 | 1 | 15 | 15 | 1:5 | in house prot | 1296 | 2129 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| with | C., then 10x | |||||||||||||||||
| SMARTer | (2′ @50° C.- | |||||||||||||||||
| dT30 | 2′ @42° C.) | |||||||||||||||||
| (unanchored | ||||||||||||||||||
| oligo) | ||||||||||||||||||
| 296 | 1 | 15 | 15 | 1:5 | in house prot | 1390 | 2194 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| with | C., then 10x | |||||||||||||||||
| SMARTer | (2′ @50° C.- | |||||||||||||||||
| dT30 | 2′ @42° C.) | |||||||||||||||||
| (unanchored | ||||||||||||||||||
| oligo) | ||||||||||||||||||
| 297 | 1 | 15 | 15 | 1:5 | in house prot | 1419 | 2084 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| with | C., then 10x | |||||||||||||||||
| SMARTer | (2′ @50° C.- | |||||||||||||||||
| dT30 | 2′ @42° C.) | |||||||||||||||||
| (unanchored | ||||||||||||||||||
| oligo) | ||||||||||||||||||
| 298 | 1 | 18 | 15 | 1:20 | in house prot | 5456 | 2293 | rGrG + G | 2 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 299 | 1 | 18 | 15 | 1:20 | in house prot | 5753 | 2334 | rGrG + G | 2 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 300 | 1 | 18 | 15 | 1:20 | in house prot | 5341 | 2365 | rGrG + G | 2 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 301 | 1 | 18 | 15 | 1:20 | in house prot | 2266 | 1750 | rGrG + G | 2 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 302 | 1 | 18 | 15 | 1:20 | in house prot | 1530 | 1850 | rGrG + G | 2 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 303 | 1 | 18 | 15 | 1:20 | in house prot | 1883 | 1703 | rGrG + G | 2 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 304 | 1 | 18 | 15 | 1:20 | in house prot | 2856 | 1731 | rGrG + G | 2 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 305 | 1 | 18 | 15 | 1:20 | in house prot | 3150 | 2371 | rGrG + N | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 306 | 1 | 18 | 15 | 1:20 | in house prot | 2889 | 2393 | rGrG + N | 1 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 307 | 1 | 18 | 15 | 1:20 | in house prot | 3773 | 2302 | rGrG + N | 2 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 308 | 1 | 18 | 15 | 1:20 | in house prot | 3744 | 2318 | rGrG + N | 2 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 309 | 1 | 18 | 15 | 1:20 | in house prot | 4113 | 2390 | rGrG + N | 2 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 310 | 1 | 18 | 15 | 1:20 | in house prot | 3903 | 2309 | rGrG + N | 2 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 311 | 1 | 18 | 15 | 1:20 | in house prot | 2649 | 2436 | rGrG + N | 2 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 312 | 1 | 18 | 15 | 1:20 | in house prot | 2856 | 2422 | rGrG + N | 2 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 313 | 1 | 18 | 15 | 1:20 | in house prot | 2674 | 2412 | rGrG + N | 2 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 314 | 1 | 18 | 15 | 1:20 | in house prot | 2641 | 2427 | rGrG + N | 2 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 315 | 1 | 18 | 15 | 1:20 | in house prot | 5251 | 2272 | rGrG + G | 2 | SSRTII | 12 | 90′ @42° | 1 | yes | Advantage | 50 | yes | |
| C., then 10x | ||||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 316 | 1 | 15 | 15 | 1:5 | in house prot | 1255 | 2057 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 317 | 1 | 15 | 15 | 1:6 | in house prot | 1135 | 2123 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 318 | 1 | 15 | 15 | 1:7 | in house prot | 925 | 2224 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 319 | 1 | 15 | 15 | 1:8 | in house prot | 790 | 2326 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 320 | 1 | 15 | 15 | 1:9 | in house prot | 9 | 2866 | rGrG + G | 1 | SSRTII | 12 | 30′ @42° | 1 | — | KAPA | 50 | yes | 1M |
| C., | HiFi HS | sorbitol + | ||||||||||||||||
| 10′ @50° | 0.3M | |||||||||||||||||
| C., | trehalose | |||||||||||||||||
| 10′ @55° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 321 | 1 | 15 | 15 | 1:10 | in house prot | 17 | 2648 | rGrG + G | 1 | SSRTII | 12 | 30′ @42° | 1 | — | KAPA | 50 | yes | 1M |
| C., | HiFi HS | sorbitol + | ||||||||||||||||
| 10′ @50° | 0.3M | |||||||||||||||||
| C., | trehalose | |||||||||||||||||
| 10′ @55° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 322 | 1 | 15 | 15 | 1:11 | in house prot | 18 | 2744 | rGrG + G | 1 | SSRTII | 12 | 30′ @42° | 1 | — | KAPA | 50 | yes | 1M |
| C., | HiFi HS | sorbitol + | ||||||||||||||||
| 10′ @50° | 0.3M | |||||||||||||||||
| C., | trehalose | |||||||||||||||||
| 10′ @55° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 323 | 1 | 15 | 15 | 1:12 | in house prot | 14 | 2844 | rGrG + G | 1 | SSRTII | 12 | 30′ @42° | 1 | — | KAPA | 50 | yes | 1M |
| C., | HiFi HS | sorbitol + | ||||||||||||||||
| 10′ @50° | 0.3M | |||||||||||||||||
| C., | trehalose | |||||||||||||||||
| 10′ @55° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 324 | 1 | 15 | 15 | 1:13 | in house prot | 24 | 2546 | rGrG + G | 1 | SSRTII | 12 | 30′ @42° | 1 | — | KAPA | 50 | yes | 0.75M |
| C., | HiFi HS | sorbitol + | ||||||||||||||||
| 10′ @50° | 0.15M | |||||||||||||||||
| C., | trehalose | |||||||||||||||||
| 10′ @55° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 325 | 1 | 15 | 15 | 1:14 | in house prot | 30 | 2478 | rGrG + G | 1 | SSRTII | 12 | 30′ @42° | 1 | — | KAPA | 50 | yes | 0.75M |
| C., | HiFi HS | sorbitol + | ||||||||||||||||
| 10′ @50° | 0.15M | |||||||||||||||||
| C., | trehalose | |||||||||||||||||
| 10′ @55° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 326 | 1 | 15 | 15 | 1:15 | in house prot | 40 | 2609 | rGrG + G | 1 | SSRTII | 12 | 30′ @42° | 1 | — | KAPA | 50 | yes | 0.75M |
| C., | HiFi HS | sorbitol + | ||||||||||||||||
| 10′ @50° | 0.15M | |||||||||||||||||
| C., | trehalose | |||||||||||||||||
| 10′ @55° | ||||||||||||||||||
| C. | ||||||||||||||||||
| 327 | 1 | 18 | 15 | 1:10 | in house prot | 3197 | 2061 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 328 | 1 | 18 | 15 | 1:10 | in house prot | 3085 | 2065 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 329 | 1 | 18 | 15 | 1:10 | in house prot | 2627 | 2134 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 330 | 1 | 18 | 15 | 1:10 | in house prot | 2750 | 2035 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 331 | 1 | 18 | 15 | 1:10 | in house prot | 980 | 1920 | rGrG + G | 1 | SSRTII | 3 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 332 | 1 | 18 | 15 | 1:10 | in house prot | 997 | 1863 | rGrG + G | 1 | SSRTII | 3 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 333 | 1 | 18 | 15 | 1:10 | in house prot | 1055 | 1925 | rGrG + G | 1 | SSRTII | 3 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 334 | 1 | 18 | 15 | 1:10 | in house prot | 938 | 1931 | rGrG + G | 1 | SSRTII | 3 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 335 | 1 | 18 | 15 | 1:10 | in house prot | 2192 | 2119 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 336 | 1 | 18 | 15 | 1:10 | in house prot | 2122 | 2046 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 337 | 1 | 18 | 15 | 1:10 | in house prot | 2408 | 2079 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 338 | 1 | 18 | 15 | 1:10 | in house prot | 1836 | 2109 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 339 | 1 | 18 | 15 | 1:10 | in house prot | 2861 | 2098 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 340 | 1 | 18 | 15 | 1:10 | in house prot | 2518 | 2086 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 341 | 1 | 18 | 15 | 1:10 | in house prot | 2289 | 2135 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 342 | 1 | 18 | 15 | 1:10 | in house prot | 2553 | 2168 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 343 | 1 | 18 | 15 | 1:10 | in house prot | 2571 | 2134 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 344 | 1 | 18 | 15 | 1:10 | in house prot | 2691 | 2115 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 345 | 1 | 18 | 15 | 1:10 | in house prot | 2348 | 2121 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 346 | 1 | 18 | 15 | 1:10 | in house prot | 2046 | 2162 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 50 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 347 | 1 | 15 | 15 | 1:5 | in house prot | 37 | 1918 | rGrG + G | 1 | SSRTII | 3 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 348 | 1 | 15 | 15 | 1:5 | in house prot | 65 | 1888 | rGrG + G | 1 | SSRTII | 3 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 349 | 1 | 15 | 15 | 1:5 | in house prot | 46 | 1976 | rGrG + G | 1 | SSRTII | 3 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 350 | 1 | 15 | 15 | 1:5 | in house prot | 39 | 1966 | rGrG + G | 1 | SSRTII | 3 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 351 | 1 | 15 | 15 | 1:5 | in house prot | 44 | 1784 | rGrG + G | 1 | SSRTII | 3 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 352 | 1 | 15 | 15 | 1:5 | in house prot | 95 | 1791 | rGrG + G | 1 | SSRTII | 3 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 353 | 1 | 15 | 15 | 1:5 | in house prot | 80 | 1897 | rGrG + G | 1 | SSRTII | 3 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 354 | 1 | 15 | 15 | 1:5 | in house prot | 281 | 1685 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 355 | 1 | 15 | 15 | 1:5 | in house prot | 348 | 1753 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 356 | 1 | 15 | 15 | 1:5 | in house prot | 204 | 1734 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 357 | 1 | 15 | 15 | 1:5 | in house prot | 210 | 1840 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 358 | 1 | 15 | 15 | 1:5 | in house prot | 207 | 1853 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 359 | 1 | 15 | 15 | 1:5 | in house prot | 285 | 1801 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 360 | 1 | 15 | 15 | 1:5 | in house prot | 120 | 1942 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 361 | 1 | 15 | 15 | 1:5 | in house prot | 201 | 1732 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 362 | 1 | 15 | 15 | 1:5 | in house prot | 395 | 1808 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 363 | 1 | 15 | 15 | 1:5 | in house prot | 558 | 1887 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 364 | 1 | 15 | 15 | 1:5 | in house prot | 429 | 1792 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 365 | 1 | 15 | 15 | 1:5 | in house prot | 340 | 1779 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 366 | 1 | 15 | 15 | 1:5 | in house prot | 511 | 1797 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 367 | 1 | 15 | 15 | 1:5 | in house prot | 353 | 1783 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 368 | 1 | 15 | 15 | 1:5 | in house prot | 365 | 1785 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 369 | 1 | 15 | 15 | 1:5 | in house prot | 333 | 1840 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 370 | 1 | 15 | 15 | 1:5 | in house prot | 477 | 1818 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 371 | 1 | 15 | 15 | 1:5 | in house prot | 517 | 1754 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 372 | 1 | 15 | 15 | 1:5 | in house prot | 265 | 1917 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 373 | 1 | 15 | 15 | 1:5 | in house prot | 349 | 1815 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 374 | 1 | 15 | 15 | 1:5 | in house prot | 255 | 1763 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 375 | 1 | 15 | 15 | 1:5 | in house prot | 388 | 1760 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 376 | 1 | 15 | 15 | 1:5 | in house prot | 387 | 1816 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 377 | 1 | 15 | 15 | 1:5 | in house prot | 635 | 1928 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 378 | 1 | 15 | 15 | 1:5 | in house prot | 515 | 1873 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 379 | 1 | 15 | 15 | 1:5 | in house prot | 658 | 1989 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 380 | 1 | 15 | 15 | 1:5 | in house prot | 602 | 1905 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 381 | 1 | 15 | 15 | 1:5 | in house prot | 412 | 1896 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 382 | 1 | 15 | 15 | 1:5 | in house prot | 476 | 1958 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 383 | 1 | 15 | 15 | 1:5 | in house prot | 422 | 1853 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 384 | 1 | 15 | 15 | 1:5 | in house prot | 551 | 1876 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 385 | 1 | 15 | 15 | 1:5 | in house prot | 1736 | 1698 | rGrG + G | 1 | SSRTII | 20 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 386 | 1 | 15 | 15 | 1:5 | in house prot | 1294 | 1750 | rGrG + G | 1 | SSRTII | 20 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 387 | 1 | 15 | 15 | 1:5 | in house prot | 1160 | 1736 | rGrG + G | 1 | SSRTII | 20 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 388 | 1 | 15 | 15 | 1:5 | in house prot | 1245 | 1786 | rGrG + G | 1 | SSRTII | 20 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 389 | 1 | 15 | 15 | 1:5 | in house prot | 1234 | 1733 | rGrG + G | 1 | SSRTII | 25 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 390 | 1 | 15 | 15 | 1:5 | in house prot | 1654 | 1684 | rGrG + G | 1 | SSRTII | 25 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 391 | 1 | 15 | 15 | 1:5 | in house prot | 1327 | 1696 | rGrG + G | 1 | SSRTII | 25 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C. | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 392 | 1 | 15 | 15 | 1:5 | in house prot | 1713 | 1596 | rGrG + G | 1 | SSRTII | 25 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 393 | 1 | 15 | 15 | 1:5 | in house prot | 1428 | 1667 | rGrG + G | 1 | SSRTII | 30 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 394 | 1 | 15 | 15 | 1:5 | in house prot | 1274 | 1711 | rGrG + G | 1 | SSRTII | 30 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 395 | 1 | 15 | 15 | 1:5 | in house prot | 1471 | 1651 | rGrG + G | 1 | SSRTII | 30 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 396 | 1 | 15 | 15 | 1:5 | in house prot | 1362 | 1653 | rGrG + G | 1 | SSRTII | 30 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 397 | 1 | 15 | 15 | 1:5 | in house prot | 86 | 1996 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 398 | 1 | 15 | 15 | 1:5 | in house prot | 66 | 2002 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 399 | 1 | 15 | 15 | 1:5 | in house prot | 92 | 1941 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 400 | 1 | 15 | 15 | 1:5 | in house prot | 86 | 1898 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 401 | 1 | 15 | 15 | 1:5 | in house prot | 85 | 2071 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 402 | 1 | 15 | 15 | 1:5 | in house prot | 75 | 2078 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 403 | 1 | 15 | 15 | 1:5 | in house prot | 120 | 2081 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 404 | 1 | 15 | 15 | 1:5 | in house prot | 150 | 1984 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 405 | 1 | 15 | 15 | 1:5 | in house prot | 132 | 2088 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 406 | 1 | 15 | 15 | 1:5 | in house prot | 101 | 2139 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 407 | 1 | 15 | 15 | 1:5 | in house prot | 131 | 2221 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 408 | 1 | 15 | 15 | 1:5 | in house prot | 149 | 2083 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 409 | 1 | 15 | 15 | 1:5 | in house prot | 169 | 2105 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 410 | 1 | 15 | 15 | 1:5 | in house prot | 195 | 2020 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 411 | 1 | 15 | 15 | 1:5 | in house prot | 141 | 2042 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 412 | 1 | 15 | 15 | 1:5 | in house prot | 196 | 2077 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 413 | 1 | 15 | 15 | 1:5 | in house prot | 123 | 2133 | rGrG + G | 1 | SSRTII | 20 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 414 | 1 | 15 | 15 | 1:5 | in house prot | 136 | 2042 | rGrG + G | 1 | SSRTII | 20 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 415 | 1 | 15 | 15 | 1:5 | in house prot | 153 | 2008 | rGrG + G | 1 | SSRTII | 20 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 416 | 1 | 15 | 15 | 1:5 | in house prot | 166 | 2111 | rGrG + G | 1 | SSRTII | 20 | 90′ @42° | 1 | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 417 | 1 | 15 | 15 | 1:5 | in house prot | 259 | 2484 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 418 | 1 | 15 | 15 | 1:5 | in house prot | 255 | 2505 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 419 | 1 | 15 | 15 | 1:5 | in house prot | 231 | 2493 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 420 | 1 | 15 | 15 | 1:5 | in house prot | 258 | 2469 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 421 | 1 | 15 | 15 | 1:5 | in house prot | 226 | 2529 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 422 | 1 | 15 | 15 | 1:5 | in house prot | 280 | 2402 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 423 | 1 | 15 | 15 | 1:5 | in house prot | 270 | 2449 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 424 | 1 | 15 | 15 | 1:5 | in house prot | 249 | 2557 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 425 | 1 | 15 | 15 | 1:5 | in house prot | 423 | 1680 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 426 | 1 | 15 | 15 | 1:5 | in house prot | 433 | 2537 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 427 | 1 | 15 | 15 | 1:5 | in house prot | 504 | 2571 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 428 | 1 | 15 | 15 | 1:5 | in house prot | 483 | 2002 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 429 | 1 | 15 | 15 | 1:5 | in house prot | 585 | 2409 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 430 | 1 | 15 | 15 | 1:5 | in house prot | 502 | 2591 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 431 | 1 | 15 | 15 | 1:5 | in house prot | 541 | 2533 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 432 | 1 | 15 | 15 | 1:5 | in house prot | 554 | 2555 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 433 | 1 | 15 | 15 | 1:5 | in house prot | 677 | 2368 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 434 | 1 | 15 | 15 | 1:5 | in house prot | 792 | 2287 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 435 | 1 | 15 | 15 | 1:5 | in house prot | 842 | 2325 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 436 | 1 | 15 | 15 | 1:5 | in house prot | 737 | 2312 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 437 | 1 | 15 | 15 | 1:5 | in house prot | 831 | 2233 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 438 | 1 | 15 | 15 | 1:5 | in house prot | 780 | 2468 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 439 | 1 | 15 | 15 | 1:5 | in house prot | 41 | 2536 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 440 | 1 | 15 | 15 | 1:5 | in house prot | 28 | 2646 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 441 | 1 | 15 | 15 | 1:5 | in house prot | 44 | 2702 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 442 | 1 | 15 | 15 | 1:5 | in house prot | 30 | 2504 | rGrG + G | 1 | SSRTII | 6 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 443 | 1 | 15 | 15 | 1:5 | in house prot | 47 | 2664 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 444 | 1 | 15 | 15 | 1:5 | in house prot | 54 | 2652 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 445 | 1 | 15 | 15 | 1:5 | in house prot | 70 | 2502 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 446 | 1 | 15 | 15 | 1:5 | in house prot | 80 | 2555 | rGrG + G | 1 | SSRTII | 9 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 447 | 1 | 15 | 15 | 1:5 | in house prot | 122 | 2374 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 448 | 1 | 15 | 15 | 1:5 | in house prot | 138 | 2368 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 449 | 1 | 15 | 15 | 1:5 | in house prot | 105 | 2441 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 450 | 1 | 15 | 15 | 1:5 | in house prot | 108 | 2377 | rGrG + G | 1 | SSRTII | 12 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 451 | 1 | 15 | 15 | 1:5 | in house prot | 128 | 2113 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 452 | 1 | 15 | 15 | 1:5 | in house prot | 147 | 2049 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 453 | 1 | 15 | 15 | 1:5 | in house prot | 101 | 2127 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 454 | 1 | 15 | 15 | 1:5 | in house prot | 108 | 2251 | rGrG + G | 1 | SSRTII | 15 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 455 | 1 | 15 | 15 | 1:5 | in house prot | 128 | 2007 | rGrG + G | 1 | SSRTII | 20 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 456 | 1 | 15 | 15 | 1:5 | in house prot | 86 | 2104 | rGrG + G | 1 | SSRTII | 20 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 457 | 1 | 15 | 15 | 1:5 | in house prot | 98 | 2147 | rGrG + G | 1 | SSRTII | 20 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| 458 | 1 | 15 | 15 | 1:5 | in house prot | 94 | 1963 | rGrG + G | 1 | SSRTII | 20 | 90′ @42° | — | — | KAPA | 25 | yes | |
| C., then 10x | HiFi HS | |||||||||||||||||
| (2′ @50° C.- | ||||||||||||||||||
| 2′ @42° C.) | ||||||||||||||||||
| B. Analyses of experimental variables effecting cDNA library yield and length |
| To evaluate the effect on cDNA yield and length of each component of the protocol, we compiled groups of replicates |
| from different experiments that only differed in the experimental variable evaluated (column A). These experiments were |
| used to compute Student t-test p-values and Wilcoxon rank sum test p-values for both cDNA yield and cDNA average length. |
| Experi- | cDNA Yield | cDNA length |
| mental | Wilcoxon- | mean | mean | t-test | wilcoxon- | mean | mean | ||||
| Variable | t-test | test | yield | yield | cDNA | test cDNA | length | length | Number of | ||
| Tested | Variant 1 | Variant 2 | Yield | Yield | (Var1) | (Var2) | length | length | (Var1) | (Var2) | replicates |
| elution | 20 | 30 | 2.69E−02 | 3.33E−01 | 166.79 | 56.535 | 2.43E−01 | 3.33E−01 | 2230.5 | 1930 | 2 |
| volume | |||||||||||
| (ul) | |||||||||||
| TSO | 2rGrG + G | 3rGrG + G | 3.01E−02 | 3.33E−01 | 83.025 | 138.225 | 1.50E−01 | 3.33E−01 | 1887 | 1722.5 | 2 |
| TSO | 2rGrG + G | C6 amino | 4.43E−02 | 3.33E−01 | 83.025 | 36.1875 | 3.11E−01 | 3.33E−01 | 1887 | 1747 | 2 |
| TSO | 2rGrG + G | rGrG + G | 2.56E−04 | 3.33E−01 | 83.025 | 299.025 | 1.71E−01 | 3.33E−01 | 1887 | 1707 | 2 |
| TSO | 2rGrG + G | phosphate | 1.12E−02 | 3.33E−01 | 83.025 | 44.0625 | 7.13E−01 | 1.00E+00 | 1887 | 1907 | 2 |
| TSO | 2OMe | ddC | 2.00E−01 | 9.52E−02 | 117.39 | 62.7 | 8.95E−01 | 8.41E−01 | 1779.2 | 1795.8 | 5 |
| TSO | 2OMe | rGrG + G | 2.59E−02 | 7.94E−03 | 117.39 | 369.615 | 7.72E−02 | 1.51E−01 | 1779.2 | 1597 | 5 |
| TSO | 2OMe | rGrGrG | 7.68E−01 | 8.86E−01 | 123.675 | 109.9313 | 8.19E−03 | 2.86E−02 | 1797.75 | 1416.5 | 4 |
| TSO | 2OMe | SMARTer | — | — | 69.225 | 84.225 | — | — | 1734 | 1652 | 1 |
| Oligo IIA | |||||||||||
| TSO | 3rGrG + G | C6 amino | 4.11E−03 | 3.33E−01 | 138.225 | 36.1875 | 8.17E−01 | 1.00E+00 | 1722.5 | 1747 | 2 |
| TSO | 3rGrG + G | rGrG + G | 1.36E−03 | 1.00E−01 | 130.375 | 285.775 | 6.09E−01 | 1.00E+00 | 1691.3333 | 1646.3333 | 3 |
| TSO | 3rGrG + G | phosphate | 2.63E−02 | 3.33E−01 | 138.225 | 44.0625 | 3.09E−02 | 3.33E−01 | 1722.5 | 1907 | 2 |
| TSO | C6 amino | rGrG + G | 3.25E−03 | 3.33E−01 | 36.1875 | 299.025 | 7.44E−01 | 6.67E−01 | 1747 | 1707 | 2 |
| TSO | C6 amino | phosphate | 3.42E−01 | 3.33E−01 | 36.1875 | 44.0625 | 2.97E−01 | 3.33E−01 | 1747 | 1907 | 2 |
| TSO | ddC | rGrG + G | 1.36E−02 | 7.94E−03 | 62.7 | 369.615 | 1.53E−01 | 2.22E−01 | 1795.8 | 1597 | 5 |
| TSO | ddC | rGrGrG | 2.16E−01 | 2.00E−01 | 66.4313 | 109.9313 | 6.64E−02 | 1.14E−01 | 1770.5 | 1416.5 | 4 |
| TSO | ddC | SMARTer | — | — | 30.075 | 84.225 | — | — | 1463 | 1652 | 1 |
| Oligo IIA | |||||||||||
| TSO | dGCGGG | dGCGGGp | 2.63E−03 | 1.00E−01 | 47.3067 | 14.2533 | 9.78E−04 | 1.00E−01 | 2104.6667 | 2309.3333 | 3 |
| TSO | dGCGGG | rGrGrG | 2.21E−02 | 1.00E−01 | 47.3067 | 150.6733 | 9.85E−01 | 7.00E−01 | 2104.6667 | 2107.3333 | 3 |
| TSO | dGCGGG | rGrGrGp | 1.32E−01 | 3.33E−01 | 48.33 | 35.64 | 2.38E−03 | 3.33E−01 | 2117.5 | 2588.5 | 2 |
| TSO | dGCGGGp | rGrGrG | 1.37E−02 | 1.00E−01 | 14.253 | 150.6733 | 2.41E−01 | 1.00E−01 | 2309.3333 | 2107.3333 | 3 |
| TSO | dGCGGGp | rGrGrGp | 2.47E−03 | 3.33E−01 | 14.48 | 35.64 | 5.93E−02 | 3.33E−01 | 2317 | 2588.5 | 2 |
| TSO | rGrG + G | phosphate | 2.41E−03 | 3.33E−01 | 299.025 | 44.0625 | 1.89E−01 | 3.33E−01 | 1707 | 1907 | 2 |
| TSO | rGrG + G | rGrGrG | 6.55E−03 | 4.96E−04 | 235.7125 | 82.075 | 1.71E−01 | 2.14E−01 | 1588.8333 | 1713 | 12 |
| TSO | rGrG + G | SMARTer | 2.74E−01 | 3.33E−01 | 197.6625 | 77.175 | 5.20E−02 | 3.33E−01 | 1444 | 1622.5 | 2 |
| Oligo IIA | |||||||||||
| TSO | rGrGrG | rGrGrGp | 4.64E−04 | 2.86E−02 | 154.565 | 32.765 | 2.56E−05 | 2.86E−02 | 2256.5 | 2583.5 | 4 |
| TSO | rGrGrG | SMARTer | 1.62E−01 | 3.33E−01 | 106.0125 | 77.175 | 4.67E−01 | 6.67E−01 | 1475.5 | 1622.5 | 2 |
| Oligo IIA | |||||||||||
| MgCl2 | 0 | 3 | 5.27E−01 | 4.00E−01 | 65.95 | 82.975 | 9.97E−01 | 1.00E+00 | 1588.6667 | 1589 | 3 |
| concentra- | |||||||||||
| tion (mM) | |||||||||||
| MgCl2 | 0 | 12 | 6.31E−01 | 1.00E+00 | 75.3375 | 107.2125 | 7.78E−01 | 1.00E+00 | 1511.5 | 1480 | 2 |
| concentra- | |||||||||||
| tion (mM) | |||||||||||
| MgCl2 | 4 | 6 | 3.46E−01 | 6.67E−01 | 102.3 | 124.05 | 2.28E−01 | 3.33E−01 | 1517.5 | 1398 | 2 |
| concentra- | |||||||||||
| tion (mM) | |||||||||||
| MgCl2 | 4 | 9 | 2.52E−02 | 3.33E−01 | 102.3 | 211.875 | 5.08E−01 | 6.67E−01 | 1517.5 | 1563.5 | 2 |
| concentra- | |||||||||||
| tion (mM) | |||||||||||
| MgCl2 | 4 | 12 | 9.44E−05 | 1.30E−04 | 91.395 | 198.795 | 3.07E−01 | 2.47E−01 | 1918.8 | 1753.9 | 10 |
| concentra- | |||||||||||
| tion (mM) | |||||||||||
| MgCl2 | 4 | 15 | 3.32E−01 | 3.33E−01 | 102.3 | 130.875 | 3.81E−01 | 6.67E−01 | 1517.5 | 1360 | 2 |
| concentra- | |||||||||||
| tion (mM) | |||||||||||
| MgCl2 | 6 | 9 | 5.94E−01 | 6.86E−01 | 154.5938 | 178.1625 | 3.80E−03 | 2.86E−02 | 1390.75 | 1607 | 4 |
| concentra- | |||||||||||
| tion (mM) | |||||||||||
| MgCl2 | 6 | 12 | 8.77E−01 | 7.30E−01 | 127.0167 | 132.9417 | 4.77E−01 | 2.58E−01 | 1709.7778 | 1845.8889 | 9 |
| concentra- | |||||||||||
| tion (mM) | |||||||||||
| MgCl2 | 6 | 15 | 4.50E−01 | 8.41E−01 | 140.52 | 113.79 | 7.04E−01 | 5.48E−01 | 1443 | 1477 | 5 |
| concentra- | |||||||||||
| tion (mM) | |||||||||||
| MgCl2 | 9 | 12 | 8.71E−01 | 6.86E−01 | 178.1625 | 170.8125 | 8.05E−01 | 8.86E−01 | 1607 | 1582.25 | 4 |
| concentra- | |||||||||||
| tion (mM) | |||||||||||
| MgCl2 | 9 | 15 | 1.17E−01 | 2.00E−01 | 178.1625 | 124.7062 | 1.24E−01 | 2.00E−01 | 1607 | 1448 | 4 |
| concentra- | |||||||||||
| tion (mM) | |||||||||||
| MgCl2 | 12 | 15 | 2.94E−01 | 3.43E−01 | 170.8125 | 124.7062 | 2.87E−01 | 3.43E−01 | 1582.25 | 1448 | 4 |
| concentra- | |||||||||||
| tion (mM) | |||||||||||
| betaine | 0 | 0.6 | 7.74E−01 | 6.86E−01 | 80.6063 | 73.725 | 3.70E−02 | 1.14E−01 | 1690.75 | 1540.5 | 4 |
| concentra- | |||||||||||
| tion (M) | |||||||||||
| betaine | 0 | 1 | 1.61E−01 | 1.65E−01 | 51.93 | 81.2025 | 3.55E−01 | 2.18E−01 | 2127.8 | 2006.9 | 10 |
| concentra- | |||||||||||
| tion (M) | |||||||||||
| betaine | 0.6 | 1 | 4.49E−01 | 1.00E+00 | 87.1 | 69.875 | 7.58E−01 | 1.00E+00 | 1618.3333 | 1596.6667 | 3 |
| concentra- | |||||||||||
| tion (M) | |||||||||||
| betaine | 1 | 1.5 | 7.73E−01 | 3.43E−01 | 101.215 | 86.115 | 8.82E−01 | 6.86E−01 | 2409.5 | 2430.5 | 4 |
| concentra- | |||||||||||
| tion (M) | |||||||||||
| RT | Maxima | Revertaid | 1.92E−02 | 3.33E−01 | 192 | 15.6375 | 1.66E−01 | 3.33E−01 | 1696 | 1603.5 | 2 |
| enzyme | H− | Premium | |||||||||
| RT | Revertaid | SSRTII | 2.47E−02 | 4.11E−02 | 148.2125 | 222.375 | 9.03E−02 | 1.32E−01 | 1423 | 1552.8333 | 6 |
| enzyme | H− | ||||||||||
| RT | SMARTscribe | SSRTII | — | — | 15.9 | 19.65 | — | — | 1669 | 1683 | 1 |
| enzyme | |||||||||||
| RT | SSRTII | SSRTIII | 1.21E−06 | 1.55E−04 | 252.3094 | 9.7031 | 8.59E−01 | 6.74E−01 | 1637.125 | 1618.875 | 8 |
| enzyme | |||||||||||
| RT | 60@42 C., | 60@50 C., | 1.47E−01 | 3.33E−01 | 73.95 | 43.05 | 5.70E−01 | 1.00E+00 | 1628 | 1577.5 | 2 |
| protocol | then | then | |||||||||
| 90@60 C. | 90@42 C. | ||||||||||
| RT | 60@42 C., | 90@42 C., | 1.50E−01 | 3.33E−01 | 73.95 | 107.3625 | 3.70E−01 | 3.33E−01 | 1628 | 1719 | 2 |
| protocol | then | 30@60 C., | |||||||||
| 90@60 C. | then | ||||||||||
| 30@42 C. | |||||||||||
| RT | 60@50 C., | 90@42 C., | 5.90E−02 | 2.00E−01 | 55.7437 | 110.7375 | 1.58E−01 | 1.46E−01 | 1515 | 1629 | 4 |
| protocol | then | 30@60 C., | |||||||||
| 90@42 C. | then | ||||||||||
| 30@42 C. | |||||||||||
| RT | 90@42 C. | 90@42 C., | 3.09E−01 | 3.43E−01 | 173.1562 | 235.8 | 6.43E−01 | 4.86E−01 | 1877.5 | 1973 | 4 |
| protocol | then 10x | ||||||||||
| (2@50 C.- | |||||||||||
| 2@42 C.) | |||||||||||
| RT | 90@42 C. | 90@42 C., | 6.72E−02 | 3.33E−01 | 101.55 | 109.8375 | 1.90E−01 | 3.33E−01 | 2075 | 2226 | 2 |
| protocol | then 10x | ||||||||||
| (2@55 C.- | |||||||||||
| 2@42 C.) | |||||||||||
| RT | 90@42 C. | 90@42 C., | 8.90E−01 | 4.00E−01 | 158.45 | 170.475 | 6.57E−01 | 4.00E−01 | 1924.3333 | 2025.3333 | 3 |
| protocol | then 10x | ||||||||||
| (2@60 C.- | |||||||||||
| 2@42 C.) | |||||||||||
| RT | 90@42 C. | 90@42 C., | 4.30E−01 | 6.67E−01 | 244.7625 | 278.1375 | 6.57E−01 | 6.67E−01 | 1680 | 1644.5 | 2 |
| protocol | then 15x | ||||||||||
| (2@50 C.- | |||||||||||
| 2@42 C.) | |||||||||||
| RT | 90@42 C. | 90@42 C., | 8.51E−01 | 6.67E−01 | 244.7625 | 237.225 | 1.20E−01 | 3.33E−01 | 1680 | 1467 | 2 |
| protocol | then 20x | ||||||||||
| (2@50 C.- | |||||||||||
| 2@42 C.) | |||||||||||
| RT | 90@42 C. | 90@42 C., | 2.86E−01 | 3.33E−01 | 244.7625 | 297.7125 | 4.87E−01 | 6.67E−01 | 1680 | 1738.5 | 2 |
| protocol | then 5x | ||||||||||
| (2@50 C.- | |||||||||||
| 2@42 C.) | |||||||||||
| RT | 90@42 C., | 90@42 C., | 5.04E−03 | 1.00E−01 | 165.375 | 105.925 | 5.96E−01 | 1.00E+00 | 2248.6667 | 2227.6667 | 3 |
| protocol | then 10x | then 10x | |||||||||
| (2@50 C.- | (2@55 C.- | ||||||||||
| 2@42 C.) | 2@42 C.) | ||||||||||
| RT | 90@42 C., | 90@42 C., | 5.23E−01 | 4.21E−01 | 206.295 | 175.17 | 9.27E−01 | 5.48E−01 | 2031.2 | 2015.4 | 5 |
| protocol | then 10x | then 10x | |||||||||
| (2@50 C.- | (2@60 C.- | ||||||||||
| 2@42 C.) | 2@42 C.) | ||||||||||
| RT | 90@42 C., | 90@42 C., | 7.32E−01 | 1.00E+00 | 291.125 | 300.3 | 1.71E−01 | 2.00E−01 | 1722.3333 | 1639.6667 | 3 |
| protocol | then 10x | then 15x | |||||||||
| (2@50 C.- | (2@50 C.- | ||||||||||
| 2@42 C.) | 2@42 C.) | ||||||||||
| RT | 90@42 C., | 90@42 C., | 4.97E−01 | 4.00E−01 | 246.875 | 196.375 | 7.32E−02 | 1.00E−01 | 1714 | 1521 | 3 |
| protocol | then 10x | then 20x | |||||||||
| (2@50 C.- | (2@50 C.- | ||||||||||
| 2@42 C.) | 2@42 C.) | ||||||||||
| RT | 90@42 C., | 90@42 C., | 9.92E−01 | 1.00E+00 | 291.125 | 291.25 | 5.65E−01 | 7.00E−01 | 1722.3333 | 1752.6667 | 3 |
| protocol | then 10x | then 5x | |||||||||
| (2@50 C.- | (2@50 C.- | ||||||||||
| 2@42 C.) | 2@42 C.) | ||||||||||
| RT | 90@42 C., | 90@42 C., | 2.69E−01 | 4.00E−01 | 105.925 | 114.775 | 2.23E−01 | 4.00E−01 | 2227.6667 | 2172.3333 | 3 |
| protocol | then 10x | then 10x | |||||||||
| (2@55 C.- | (2@60 C.- | ||||||||||
| 2@42 C.) | 2@42 C.) | ||||||||||
| RT | 90@42 C., | 90@42 C., | — | — | 286.2 | 285.3 | — | — | 1732 | 1610 | 1 |
| protocol | then 10x | then 15x | |||||||||
| (2@60 C.- | (2@50 C.- | ||||||||||
| 2@42 C.) | 2@42 C.) | ||||||||||
| RT | 90@42 C., | 90@42 C., | — | — | 286.2 | 259.275 | — | — | 1732 | 1525 | 1 |
| protocol | then 10x | then 20x | |||||||||
| (2@60 C.- | (2@50 C.- | ||||||||||
| 2@42 C.) | 2@42 C.) | ||||||||||
| RT | 90@42 C., | 90@42 C., | — | — | 286.2 | 306.075 | — | — | 1732 | 1706 | 1 |
| protocol | then 10x | then 5x | |||||||||
| (2@60 C.- | (2@50 C.- | ||||||||||
| 2@42 C.) | 2@42 C.) | ||||||||||
| RT | 90@42 C., | 90@42 C., | 2.94E−01 | 3.33E−01 | 278.1375 | 237.225 | 1.47E−01 | 3.33E−01 | 1644.5 | 1467 | 2 |
| protocol | then 15x | then 20x | |||||||||
| (2@50 C.- | (2@50 C.- | ||||||||||
| 2@42 C.) | 2@42 C.) | ||||||||||
| RT | 90@42 C., | 90@42 C., | 7.35E−01 | 1.00E+00 | 300.3 | 291.25 | 2.30E−02 | 1.00E−01 | 1639.6667 | 1752.6667 | 3 |
| protocol | then 15x | then 5x | |||||||||
| (2@50 C.- | (2@50 C.- | ||||||||||
| 2@42 C.) | 2@42 C.) | ||||||||||
| RT | 90@42 C., | 90@42 C., | 1.90E−01 | 3.33E−01 | 237.225 | 297.7125 | 8.13E−02 | 3.33E−01 | 1467 | 1738.5 | 2 |
| protocol | then 20x | then 5x | |||||||||
| (2@50 C.- | (2@50 C.- | ||||||||||
| 2@42 C.) | 2@42 C.) | ||||||||||
| RT | 90@50 C. | 90@55 C. | 3.50E−03 | 7.94E−03 | 62.595 | 12.24 | 2.09E−01 | 1.51E−01 | 2146.2 | 2051 | 5 |
| protocol | |||||||||||
| RT | 90@50 C. | 90@60 C. | — | — | 164.4 | 6 | — | — | 1858 | 1933 | 1 |
| protocol | |||||||||||
| PCR | Advantage 2 | KAPA | 6.44E−01 | 7.55E−01 | 186.6375 | 171.0125 | 5.18E−01 | 5.90E−01 | 1929.4167 | 2029.5 | 12 |
| enzyme | Pol. | HiFi HS | |||||||||
| PCR | Advantage 2 | Phusion | 4.33E−01 | 4.86E−01 | 212.3625 | 182.6813 | 8.11E−01 | 3.43E−01 | 1701 | 1722.75 | 4 |
| enzyme | Pol. | HS | |||||||||
| PCR | Advantage 2 | Q5 NEB | 5.85E−02 | 2.86E−02 | 212.3625 | 133.8562 | 6.29E−01 | 3.43E−01 | 1701 | 1743.75 | 4 |
| enzyme | Pol. | ||||||||||
| PCR | KAPA | Phusion | 2.60E−01 | 3.43E−01 | 223.725 | 182.6813 | 7.49E−01 | 8.86E−01 | 1702 | 1722.75 | 4 |
| enzyme | HiFi HS | HS | |||||||||
| PCR | KAPA | Q5 NEB | 2.99E−02 | 2.86E−02 | 223.725 | 133.8562 | 4.93E−01 | 8.86E−01 | 1702 | 1743.75 | 4 |
| enzyme | HiFi HS | ||||||||||
| PCR | Phusion | Q5 NEB | 1.25E−01 | 1.14E−01 | 182.6813 | 133.8562 | 5.99E−01 | 8.86E−01 | 1722.75 | 1743.75 | 4 |
| enzyme | HS | ||||||||||
| purifica- | 0 | yes | 6.77E−01 | 6.05E−01 | 186.85 | 203.225 | 3.44E−01 | 3.87E−01 | 2022.2222 | 1875.4444 | 9 |
| tion. | |||||||||||
| dNTPs | 0 | yes | 4.55E−03 | 1.37E−02 | 193.6781 | 134.3812 | 3.44E−04 | 5.55E−05 | 1709.4167 | 2008.0833 | 24 |
| added in | |||||||||||
| the | |||||||||||
| beginning | |||||||||||
| other | 0 | 0.816M | 6.89E−04 | 1.00E−01 | 291.125 | 103.95 | 3.50E−03 | 1.00E−01 | 1722.3333 | 1093 | 3 |
| additives | 1,2 | ||||||||||
| propandiol | |||||||||||
| other | 0 | 1.075M | 1.82E−01 | 3.33E−01 | 299.025 | 178.4625 | 9.93E−02 | 3.33E−01 | 1707 | 1421.5 | 2 |
| additives | ethylene | ||||||||||
| glycol | |||||||||||
| other | 0 | 3 mM | 1.10E−01 | 3.33E−01 | 56.535 | 28.095 | 1.13E−01 | 3.33E−01 | 1930 | 1479.5 | 2 |
| additives | MnCl2 | ||||||||||
| other | 0 | 6 mM | 1.05E−01 | 3.33E−01 | 56.535 | 16.95 | 1.03E−01 | 3.33E−01 | 1930 | 1213 | 2 |
| additives | MnCl2 | ||||||||||
| other | 0.3M | 0.6M | 8.18E−01 | 6.86E−01 | 77.0625 | 72.3563 | 4.45E−01 | 4.86E−01 | 1679 | 1634.25 | 4 |
| additives | trehalose | trehalose | |||||||||
| other | 0.816M | 1.075M | 2.82E−01 | 3.33E−01 | 104.4375 | 178.4625 | 3.99E−02 | 3.33E−01 | 1095 | 1421.5 | 2 |
| additives | 1,2 | ethylene | |||||||||
| propandiol | glycol | ||||||||||
| other | 3 mM | 6 mM | 1.45E−01 | 3.33E−01 | 28.095 | 16.95 | 1.46E−01 | 3.33E−01 | 1479.5 | 1213 | 2 |
| additives | MnCl2 | MnCl2 | |||||||||
| TABLE S2 |
| List of all template switching oligonucleotides tested. |
| 5′-end | 3′-end | ||||
| TSO | Sequence | blocking | 5′-end | 3′-end | blocking |
| name | (5′ → 3′) | groups | modifications | modifications | groups |
| 2OMe | AAGCAGTGGTATCAACGCAGAGT | — | — | 3 Riboguanosines + | 2O′-Methyl |
| ACrGrGrGmG | 1 Guanosine | ||||
| C6 | AAGCAGTGGTATCAACGCAGAGT | — | — | 3 Riboguanosines | Aminolink |
| Amino | ACATrGrGrG | C6 | |||
| ddC | AAGCAGTGGTATCAACGCAGAGT | — | — | 4 Riboguanosines + 1 | — |
| ACrGrGrGrGddC | Dideoxycytosine | ||||
| dGCG | AAGCAGTGGTATCAACGCAGAGT | — | — | 1 Guanosine + 1 Cytosine + | — |
| GG | ACGCGGG | 3 Guanosines | |||
| dGCG | AAGCAGTGGTATCAACGCAGAGT | — | — | 1 Guanosine + 1 Cytosine + | Phosphate |
| GGp | ACGCGGG | 3 Guanosines | |||
| ISO | iGiCiGAAGCAGTGGTATCAACGCA | Methyl | isoGuanosine- | 1 Riboguanosine + 1 | Phosphate |
| GAGTACrGrCrGrGrG | C5 | isoCytosine- | Ribocytosine + | ||
| 3 Riboguanosines | |||||
| rGr | AAGCAGTGGTATCAACGCAGAGT | — | — | 2 Riboguanosines + 1 LNA- | — |
| G + G | ACrGrG + G | modified Guanosine | |||
| rGr | AAGCAGTGGTATCAACGCAGAGT | — | — | 2 Riboguanosines + 1 LNA- | — |
| G + N | ACrGrG + N | modified nucleotide (any) | |||
| + G + | AAGCAGTGGTATCAACGCAGAGT | — | — | 3 LNA-modified Guanosines | — |
| G + G | AC + G + G + G | ||||
| rG + | AAGCAGTGGTATCAACGCAGAGT | — | — | 2 LNA-modified Guanosines | — |
| G + G | ACrG + G + G | ||||
| rGrGr | AAGCAGTGGTATCAACGCAGAGT | — | — | 3 Riboguanosines | — |
| G | ACATrGrGrG | ||||
| rG3p | AAGCAGTGGTATCAACGCAGAGT | — | — | 3 Riboguanosines | Phosphate |
| ACATrGrGrGp | |||||
| rG5 | AAGCAGTGGTATCAACGCAGAGT | — | — | 5 Riboguanosines | — |
| ACrGrGrGrGrG | |||||
| avg | amount TSO | PCR | ||||||||||||
| conc | size | (ul of 10 uM | RT | oligo | MgCl2 | betaine | purification | PCR | rxn vol | |||||
| sample | cell type | species | (ng/ul) | (bp) | TSO | solution in 10 ul RT rxn) | enzyme | dT | (mM) | (M) | after RT? | enzyme | (ul) | notes |
| HEK_2 | HEK293T | H. sapiens | 10.778 | 1099 | rGrG + G | 1 | SSRTII | SMARTer | 13 | 1 | yes | Advantage | 50 | Could be a cell aggregate |
| dT30VN | ||||||||||||||
| HEK_3 | HEK293T | H. sapiens | 9.596 | 1142 | rGrG + G | 1 | SSRTII | SMARTer | 14 | 1 | yes | Advantage | 50 | Could be a cell aggregate |
| dT30VN | ||||||||||||||
| HEK_4 | HEK293T | H. sapiens | 1.160 | 1098 | rGrG + G | 1 | SSRTII | SMARTer | 15 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_5 | HEK293T | H. sapiens | 0.590 | 1203 | rGrG + G | 1 | SSRTII | SMARTer | 16 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_6 | HEK293T | H. sapiens | 2.210 | 1175 | rGrG + G | 1 | SSRTII | SMARTer | 17 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_7 | HEK293T | H. sapiens | 0.410 | 1136 | rGrG + G | 1 | SSRTII | SMARTer | 18 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_8 | HEK293T | H. sapiens | 4.184 | 1146 | rGrG + G | 1 | SSRTII | SMARTer | 19 | 1 | yes | Advantage | 50 | Could be a cell aggregate |
| dT30VN | ||||||||||||||
| HEK_9 | HEK293T | H. sapiens | 0.840 | 1141 | rGrG + G | 1 | SSRTII | SMARTer | 20 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_10 | HEK293T | H. sapiens | 1.130 | 1088 | rGrG + G | 1 | SSRTII | SMARTer | 21 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_12 | HEK293T | H. sapiens | 9.095 | 1106 | rGrG + G | 1 | SSRTII | SMARTer | 23 | 1 | yes | Advantage | 50 | Could be a cell aggregate |
| dT30VN | ||||||||||||||
| HEK_13 | HEK293T | H. sapiens | 0.490 | 1017 | rGrG + G | 1 | SSRTII | SMARTer | 24 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_14 | HEK293T | H. sapiens | 3.640 | 1046 | rGrG + G | 1 | SSRTII | SMARTer | 25 | 1 | yes | Advantage | 50 | Could be a cell aggregate |
| dT30VN | ||||||||||||||
| HEK_16 | HEK293T | H. sapiens | 17.225 | 1072 | rGrG + G | 1 | SSRTII | SMARTer | 27 | 1 | yes | Advantage | 50 | Could be a cell aggregate |
| dT30VN | ||||||||||||||
| HEK_SMRT_1 | HEK293T | H. sapiens | 0.760 | 1429 | SMARTer | 1 | SMARTscribe | SMARTer | 6 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| HEK_SMRT_2 | HEK293T | H. sapiens | 2.304 | 1411 | SMARTer | 1 | SMARTscribe | SMARTer | 6 | 1 | yes | Advantage | 50 | Could be a cell aggregate |
| Oligo IIA | dT30VN | |||||||||||||
| HEK_SMRT_3 | HEK293T | H. sapiens | 1.544 | 1424 | SMARTer | 1 | SMARTscribe | SMARTer | 6 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| HEK_SMRT_4 | HEK293T | H. sapiens | 0.422 | 1457 | SMARTer | 1 | SMARTscribe | SMARTer | 6 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| HEK_18 | HEK293T | H. sapiens | 0.208 | 1384 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | 40 u SSRT II |
| dT30VN | ||||||||||||||
| HEK_19 | HEK293T | H. sapiens | 0.512 | 1541 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | 40 u SSRT II |
| dT30VN | ||||||||||||||
| HEK_20 | HEK293T | H. sapiens | 0.550 | 1614 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | 40 u SSRT II |
| dT30VN | ||||||||||||||
| HEK_21 | HEK293T | H. sapiens | 0.240 | 1492 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | 40 u SSRT II |
| dT30VN | ||||||||||||||
| HEK_22 | HEK293T | H. sapiens | 0.957 | 1222 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | 40 u SSRT II |
| dT30VN | ||||||||||||||
| HEK_23 | HEK293T | H. sapiens | 0.872 | 1392 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | 40 u SSRT II |
| dT30VN | ||||||||||||||
| HEK_24 | HEK293T | H. sapiens | 0.315 | 1326 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | 40 u SSRT II |
| dT30VN | ||||||||||||||
| HEK_25 | HEK293T | H. sapiens | 0.462 | 1474 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_26 | HEK293T | H. sapiens | 0.248 | 1441 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_27 | HEK293T | H. sapiens | 0.244 | 1487 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_28 | HEK293T | H. sapiens | 0.262 | 1496 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_29 | HEK293T | H. sapiens | 0.761 | 1402 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_31 | HEK293T | H. sapiens | 0.594 | 1583 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_32 | HEK293T | H. sapiens | 0.457 | 1347 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_33 | HEK293T | H. sapiens | 0.473 | 1507 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_34 | HEK293T | H. sapiens | 0.315 | 1501 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_35 | HEK293T | H. sapiens | 0.744 | 1917 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_37 | HEK293T | H. sapiens | 1.531 | 1626 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_38 | HEK293T | H. sapiens | 0.344 | 1870 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_39 | HEK293T | H. sapiens | 0.453 | 1968 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_40 | HEK293T | H. sapiens | 0.580 | 1958 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_41 | HEK293T | H. sapiens | 0.382 | 1202 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_42 | HEK293T | H. sapiens | 0.392 | 1288 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_43 | HEK293T | H. sapiens | 0.844 | 1319 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_44 | HEK293T | H. sapiens | 0.582 | 1452 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_45 | HEK293T | H. sapiens | 0.682 | 1312 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_46 | HEK293T | H. sapiens | 0.692 | 1411 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_47 | HEK293T | H. sapiens | 0.716 | 1337 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_48 | HEK293T | H. sapiens | 0.578 | 1391 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_49 | HEK293T | H. sapiens | 2.681 | 1440 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | Could be a cell aggregate |
| dT30VN | ||||||||||||||
| HEK_50 | HEK293T | H. sapiens | 1.158 | 1507 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_51 | HEK293T | H. sapiens | 0.710 | 1389 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_52 | HEK293T | H. sapiens | 1.050 | 1463 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_53 | HEK293T | H. sapiens | 0.714 | 1384 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_54 | HEK293T | H. sapiens | 0.637 | 1509 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_55 | HEK293T | H. sapiens | 1.338 | 1873 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_56 | HEK293T | H. sapiens | 1.258 | 1846 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_57 | HEK293T | H. sapiens | 3.012 | 1798 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_58 | HEK293T | H. sapiens | 1.763 | 1734 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_59 | HEK293T | H. sapiens | 2.837 | 1833 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_60 | HEK293T | H. sapiens | 1.889 | 1758 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_61 | HEK293T | H. sapiens | 3.733 | 1841 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_62 | HEK293T | H. sapiens | 2.430 | 1849 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_63 | HEK293T | H. sapiens | 0.758 | 1845 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_64 | HEK293T | H. sapiens | 0.948 | 1907 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_65 | HEK293T | H. sapiens | 1.364 | 1837 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_66 | HEK293T | H. sapiens | 1.897 | 1821 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_67 | HEK293T | H. sapiens | 2.721 | 1746 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_68 | HEK293T | H. sapiens | 5.123 | 1699 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | Could be a cell aggregate |
| dT30VN | HiFi HS | |||||||||||||
| HEK_69 | HEK293T | H. sapiens | 2.499 | 1892 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_70 | HEK293T | H. sapiens | 1.632 | 1715 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_71 | HEK293T | H. sapiens | 2.614 | 1438 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_72 | HEK293T | H. sapiens | 1.343 | 1535 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_73 | HEK293T | H. sapiens | 2.618 | 1570 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_74 | HEK293T | H. sapiens | 2.037 | 1611 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_75 | HEK293T | H. sapiens | 1.862 | 1494 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_76 | HEK293T | H. sapiens | 0.560 | 1567 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_77 | HEK293T | H. sapiens | 1.609 | 1604 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_78 | HEK293T | H. sapiens | 0.748 | 1392 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_79 | HEK293T | H. sapiens | 2.876 | 2093 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_80 | HEK293T | H. sapiens | 6.017 | 1975 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | Could be a cell aggregate |
| dT30VN | ||||||||||||||
| HEK_81 | HEK293T | H. sapiens | 5.110 | 1834 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | Could be a cell aggregate |
| dT30VN | ||||||||||||||
| HEK_82 | HEK293T | H. sapiens | 2.659 | 1912 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_83 | HEK293T | H. sapiens | 3.820 | 1848 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | Could be a cell aggregate |
| dT30VN | HiFi HS | |||||||||||||
| HEK_84 | HEK293T | H. sapiens | 1.875 | 1941 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_85 | HEK293T | H. sapiens | 4.477 | 2003 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | Could be a cell aggregate |
| dT30VN | HiFi HS | |||||||||||||
| HEK_86 | HEK293T | H. sapiens | 4.162 | 1784 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | Could be a cell aggregate |
| dT30VN | ||||||||||||||
| HEK_87 | HEK293T | H. sapiens | 0.539 | 1964 | rGrG + G | 1 | Maxima | SMARTer | 12 | 1 | — | KAPA | 50 | |
| H minus | dT30VN | HiFi HS | ||||||||||||
| HEK_88 | HEK293T | H. sapiens | 0.526 | 1860 | rGrG + G | 1 | Maxima | SMARTer | 12 | 1 | — | KAPA | 50 | |
| H minus | dT30VN | HiFi HS | ||||||||||||
| HEK_89 | HEK293T | H. sapiens | 0.288 | 1881 | rGrG + G | 1 | Maxima | SMARTer | 12 | 1 | — | KAPA | 50 | |
| H minus | dT30VN | HiFi HS | ||||||||||||
| HEK_90 | HEK293T | H. sapiens | 0.650 | 1560 | rGrG + G | 1 | Maxima | SMARTer | 12 | 1 | — | KAPA | 50 | |
| H minus | dT30 | HiFi HS | ||||||||||||
| HEK_91 | HEK293T | H. sapiens | 0.341 | 1852 | rGrG + G | 1 | Maxima | SMARTer | 12 | 1 | — | KAPA | 50 | |
| H minus | dT30 | HiFi HS | ||||||||||||
| HEK_92 | HEK293T | H. sapiens | 0.354 | 1783 | rGrG + G | 1 | Maxima | SMARTer | 12 | 1 | — | KAPA | 50 | |
| H minus | dT30 | HiFi HS | ||||||||||||
| HEK_93 | HEK293T | H. sapiens | 1.520 | 1939 | rGrG + N | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_94 | HEK293T | H. sapiens | 1.722 | 1740 | rGrG + N | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_95 | HEK293T | H. sapiens | 0.485 | 1740 | rGrG + N | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_96 | HEK293T | H. sapiens | 1.090 | 1833 | rGrG + N | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_97 | HEK293T | H. sapiens | 2.856 | 1731 | rGrG + N | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_98 | HEK293T | H. sapiens | 2.776 | 1881 | rGrG + N | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_99 | HEK293T | H. sapiens | 1.954 | 1730 | rGrG + N | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_100 | HEK293T | H. sapiens | 2.836 | 1909 | rGrG + N | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_101 | HEK293T | H. sapiens | 2.266 | 1750 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_102 | HEK293T | H. sapiens | 1.530 | 1850 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_103 | HEK293T | H. sapiens | 1.883 | 1703 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_105 | HEK293T | H. sapiens | 4.105 | 1929 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | Could be a cell aggregate |
| dT30VN | HiFi HS | |||||||||||||
| HEK_106 | HEK293T | H. sapiens | 2.580 | 2009 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_107 | HEK293T | H. sapiens | 2.572 | 1910 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_108 | HEK293T | H. sapiens | 1.496 | 1973 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_109 | HEK293T | H. sapiens | 3.459 | 1908 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | Could be a cell aggregate |
| dT30VN | HiFi HS | |||||||||||||
| HEK_110 | HEK293T | H. sapiens | 4.591 | 1921 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | Could be a cell aggregate |
| dT30VN | ||||||||||||||
| HEK_111 | HEK293T | H. sapiens | 3.841 | 1972 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | Could be a cell aggregate |
| dT30VN | ||||||||||||||
| HEK_112 | HEK293T | H. sapiens | 4.279 | 1916 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | Could be a cell aggregate |
| dT30VN | ||||||||||||||
| HEK_113 | HEK293T | H. sapiens | 2.123 | 1648 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_114 | HEK293T | H. sapiens | 2.526 | 1845 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_115 | HEK293T | H. sapiens | 2.084 | 1569 | rGrG + N | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_116 | HEK293T | H. sapiens | 0.511 | 1628 | rGrG + N | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_117 | HEK293T | H. sapiens | 2.690 | 1823 | rGrG + N | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_118 | HEK293T | H. sapiens | 1.454 | 1774 | rGrG + N | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_119 | HEK293T | H. sapiens | 0.361 | 1598 | rGrG + N | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_120 | HEK293T | H. sapiens | 1.215 | 1935 | rGrG + N | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_121 | HEK293T | H. sapiens | 0.434 | 1682 | rGrG + N | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_122 | HEK293T | H. sapiens | 0.739 | 1553 | rGrG + N | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_123 | HEK293T | H. sapiens | 1.599 | 1688 | rGrG + N | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_124 | HEK293T | H. sapiens | 2.301 | 1617 | rGrG + N | 2 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_135 | HEK293T | H. sapiens | 0.784 | 1810 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | 2x dCTP |
| dT30VN | HiFi HS | |||||||||||||
| HEK_136 | HEK293T | H. sapiens | 1.311 | 1990 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | 2x dCTP |
| dT30VN | HiFi HS | |||||||||||||
| HEK_137 | HEK293T | H. sapiens | 0.895 | 1829 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | 2x dCTP |
| dT30VN | HiFi HS | |||||||||||||
| HEK_138 | HEK293T | H. sapiens | 1.318 | 1948 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | 2x dCTP |
| dT30VN | HiFi HS | |||||||||||||
| HEK_139 | HEK293T | H. sapiens | 1.853 | 1704 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | 2x dCTP |
| dT30VN | HiFi HS | |||||||||||||
| HEK_140 | HEK293T | H. sapiens | 4.009 | 1833 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | 2x dCTP (NOT SINGLE CELL) |
| dT30VN | HiFi HS | |||||||||||||
| HEK_141 | HEK293T | H. sapiens | 5.230 | 1820 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | Could be a cell aggregate |
| dT30VN | HiFi HS | |||||||||||||
| HEK_144 | HEK293T | H. sapiens | 4.803 | 1766 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | Could be a cell aggregate |
| dT30VN | ||||||||||||||
| HEK_145 | HEK293T | H. sapiens | 2.166 | 1619 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_146 | HEK293T | H. sapiens | 2.283 | 1552 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_147 | HEK293T | H. sapiens | 2.099 | 1316 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_148 | HEK293T | H. sapiens | 2.191 | 1339 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | HEDGEHOG PATTERN |
| dT30VN | ||||||||||||||
| HEK_149 | HEK293T | H. sapiens | 1.560 | 1426 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_150 | HEK293T | H. sapiens | 2.830 | 1508 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| HEK_151 | HEK293T | H. sapiens | 2.220 | 1220 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30 | ||||||||||||||
| HEK_152 | HEK293T | H. sapiens | 2.654 | 1534 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | HEDGEHOG PATTERN |
| dT30 | ||||||||||||||
| HEK_153 | HEK293T | H. sapiens | 2.039 | 1655 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30 | ||||||||||||||
| HEK_154 | HEK293T | H. sapiens | 3.001 | 1837 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30 | ||||||||||||||
| HEK_155 | HEK293T | H. sapiens | 1.378 | 1846 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30 | ||||||||||||||
| HEK_156 | HEK293T | H. sapiens | 1.065 | 1853 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30 | ||||||||||||||
| HEK_157 | HEK293T | H. sapiens | 1.621 | 1772 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30 | ||||||||||||||
| HEK_158 | HEK293T | H. sapiens | 2.418 | 1706 | rGrG + G | 2 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30 | ||||||||||||||
| HEK_SMRT_5 | HEK293T | H. sapiens | 0.128 | 1495 | SMARTer | 1 | SMARTscribe | SMARTer | 6 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| HEK_SMRT_6 | HEK293T | H. sapiens | 0.042 | 1469 | SMARTer | 1 | SMARTscribe | SMARTer | 6 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| HEK_SMRT_7 | HEK293T | H. sapiens | 0.207 | 1359 | SMARTer | 1 | SMARTscribe | SMARTer | 6 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| HEK_SMRT_8 | HEK293T | H. sapiens | 0.246 | 1340 | SMARTer | 1 | SMARTscribe | SMARTer | 6 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| HEK_SMRT_9 | HEK293T | H. sapiens | 0.152 | 1455 | SMARTer | 1 | SMARTscribe | SMARTer | 6 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| HEK_SMRT_10 | HEK293T | H. sapiens | 0.256 | 1228 | SMARTer | 1 | SMARTscribe | SMARTer | 6 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| HEK_SMRT_11 | HEK293T | H. sapiens | 0.072 | 1238 | SMARTer | 1 | SMARTscribe | SMARTer | 6 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| HEK_SMRT_12 | HEK293T | H. sapiens | 0.256 | 1292 | SMARTer | 1 | SMARTscribe | SMARTer | 6 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| C_1 | C2C12 | M. musculus | 3.003 | 1696 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | Could be a cell aggregate |
| dT30VN | HiFi HS | |||||||||||||
| C_2 | C2C12 | M. musculus | 1.110 | 1772 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| C_3 | C2C12 | M. musculus | 1.157 | 1660 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| C_4 | C2C12 | M. musculus | 1.965 | 1674 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| C_5 | C2C12 | M. musculus | 2.884 | 1708 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | Could be a cell aggregate |
| dT30VN | HiFi HS | |||||||||||||
| C_6 | C2C12 | M. musculus | 2.325 | 1646 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| C_7 | C2C12 | M. musculus | 1.941 | 1577 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| C_8 | C2C12 | M. musculus | 2.248 | 1666 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| C_9 | C2C12 | M. musculus | 1.379 | 1614 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| C_10 | C2C12 | M. musculus | 1.832 | 1809 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| C_11 | C2C12 | M. musculus | 3.644 | 1735 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | Could be a cell aggregate |
| dT30VN | HiFi HS | |||||||||||||
| C_12 | C2C12 | M. musculus | 1.245 | 1735 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| C_13 | C2C12 | M. musculus | 1.913 | 1896 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| C_14 | C2C12 | M. musculus | 1.703 | 1836 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| C_15 | C2C12 | M. musculus | 1.588 | 1937 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| C_16 | C2C12 | M. musculus | 1.730 | 1937 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_1 | MEF | M. musculus | 0.999 | 1397 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_2 | MEF | M. musculus | 2.862 | 1710 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_3 | MEF | M. musculus | 1.571 | 1577 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_4 | MEF | M. musculus | 1.120 | 1489 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_5 | MEF | M. musculus | 2.121 | 1672 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_6 | MEF | M. musculus | 5.025 | 1610 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | Could be a cell aggregate |
| dT30VN | HiFi HS | |||||||||||||
| MEF_7 | MEF | M. musculus | 5.874 | 1065 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | Could be a cell aggregate |
| dT30VN | HiFi HS | |||||||||||||
| MEF_8 | MEF | M. musculus | 1.272 | ? | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_9 | MEF | M. musculus | 1.650 | ? | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_10 | MEF | M. musculus | 2.071 | ? | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_11 | MEF | M. musculus | 0.755 | ? | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_12 | MEF | M. musculus | 7.528 | ? | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | Could be a cell aggregate |
| dT30VN | HiFi HS | |||||||||||||
| MEF_13 | MEF | M. musculus | 2.271 | ? | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_14 | MEF | M. musculus | 2.327 | ? | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_15 | MEF | M. musculus | 3.149 | ? | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | Could be a cell aggregate |
| dT30VN | HiFi HS | |||||||||||||
| MEF_16 | MEF | M. musculus | 2.045 | ? | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_17 | MEF | M. musculus | 0.497 | 1803 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_18 | MEF | M. musculus | 0.427 | 1879 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_19 | MEF | M. musculus | 0.406 | 1873 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_20 | MEF | M. musculus | 0.680 | 1984 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_21 | MEF | M. musculus | 0.429 | 1738 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_22 | MEF | M. musculus | 0.634 | 2089 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_23 | MEF | M. musculus | 0.722 | 2019 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_24 | MEF | M. musculus | 0.397 | 1881 | rGrGrG | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_25 | MEF | M. musculus | 0.981 | 2007 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| MEF_26 | MEF | M. musculus | 0.626 | 1827 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| MEF_28 | MEF | M. musculus | 0.656 | 1979 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| MEF_29 | MEF | M. musculus | 1.356 | 2143 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| MEF_30 | MEF | M. musculus | 1.242 | 2137 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| MEF_31 | MEF | M. musculus | 2.240 | 2015 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| MEF_32 | MEF | M. musculus | 0.781 | 1817 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | Advantage | 50 | |
| dT30VN | ||||||||||||||
| MEF_33 | MEF | M. musculus | 0.603 | 1781 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_34 | MEF | M. musculus | 5.014 | 1894 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | Could be a cell aggregate |
| dT30VN | HiFi HS | |||||||||||||
| MEF_35 | MEF | M. musculus | 1.651 | 2064 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_36 | MEF | M. musculus | 1.017 | 1773 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_37 | MEF | M. musculus | 1.119 | 1783 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_38 | MEF | M. musculus | 0.681 | 1659 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_39 | MEF | M. musculus | 1.444 | 1469 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| MEF_40 | MEF | M. musculus | 0.845 | 1401 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| SMRT_1 | C2C12 | M. musculus | 0.063 | 1170 | SMARTer | 1 | SMARTscribe | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| SMRT_2 | C2C12 | M. musculus | 0.165 | 1127 | SMARTer | 1 | SMARTscribe | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| SMRT_3 | C2C12 | M. musculus | 0.130 | 1169 | SMARTer | 1 | SMARTscribe | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| SMRT_4 | C2C12 | M. musculus | 0.091 | 1325 | SMARTer | 1 | SMARTscribe | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| SMRT_5 | C2C12 | M. musculus | 0.036 | 1282 | SMARTer | 1 | SMARTscribe | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| SMRT_6 | C2C12 | M. musculus | 0.135 | 1373 | SMARTer | 1 | SMARTscribe | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| SMRT_7 | C2C12 | M. musculus | 0.161 | 1525 | SMARTer | 1 | SMARTscribe | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| SMRT_8 | C2C12 | M. musculus | 0.178 | 1314 | SMARTer | 1 | SMARTscribe | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| SMRT_9 | C2C12 | M. musculus | 0.036 | 1363 | SMARTer | 1 | SMARTscribe | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| SMRT_10 | C2C12 | M. musculus | 0.129 | 1261 | SMARTer | 1 | SMARTscribe | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| SMRT_11 | C2C12 | M. musculus | 0.080 | 1234 | SMARTer | 1 | SMARTscribe | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| SMRT_12 | C2C12 | M. musculus | 0.111 | 1447 | SMARTer | 1 | SMARTscribe | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| SMRT_14 | C2C12 | M. musculus | 0.081 | 1408 | SMARTer | 1 | SMARTscribe | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| SMRT_16 | C2C12 | M. musculus | 0.074 | 1280 | SMARTer | 1 | SMARTscribe | SMARTer | 12 | 1 | yes | Advantage | 50 | |
| Oligo IIA | dT30VN | |||||||||||||
| BC_1 | B-cells | H. sapiens | 0.826 | 1657 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_3 | B-cells | H. sapiens | 1.091 | 1659 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_4 | B-cells | H. sapiens | 0.401 | 1649 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_5 | B-cells | H. sapiens | 0.501 | 1547 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_6 | B-cells | H. sapiens | 0.573 | 1534 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_7 | B-cells | H. sapiens | 0.328 | 1343 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_8 | B-cells | H. sapiens | 0.661 | 1607 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_9 | B-cells | H. sapiens | 0.500 | 1605 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_10 | B-cells | H. sapiens | 0.840 | 1782 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_11 | B-cells | H. sapiens | 0.829 | 1813 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_12 | B-cells | H. sapiens | 0.648 | 1642 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_13 | B-cells | H. sapiens | 0.297 | 1815 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_15 | B-cells | H. sapiens | 0.982 | 1825 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_159 | HEK293T | H. sapiens | 3.057 | 1464 | rGrG + G | 1 | SSRTII | SMARTer | 15 | 1 | — | KAPA | 25 | Could be a cell aggregate |
| dT30VN | HiFi HS | |||||||||||||
| HEK_160 | HEK293T | H. sapiens | 3.506 | 1799 | rGrG + G | 1 | SSRTII | SMARTer | 15 | 1 | — | KAPA | 25 | Could be a cell aggregate |
| dT30VN | HiFi HS | |||||||||||||
| HEK_161 | HEK293T | H. sapiens | 2.027 | 1611 | rGrG + G | 1 | SSRTII | SMARTer | 15 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_162 | HEK293T | H. sapiens | 2.513 | 1714 | rGrG + G | 1 | SSRTII | SMARTer | 15 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_163 | HEK293T | H. sapiens | 0.558 | 909 | rGrG + G | 1 | SSRTII | SMARTer | 20 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_164 | HEK293T | H. sapiens | 1.490 | 1397 | rGrG + G | 1 | SSRTII | SMARTer | 20 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_165 | HEK293T | H. sapiens | 0.606 | 1334 | rGrG + G | 1 | SSRTII | SMARTer | 20 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| HEK_166 | HEK293T | H. sapiens | 1.203 | 1515 | rGrG + G | 1 | SSRTII | SMARTer | 20 | 1 | — | KAPA | 25 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_17 | B-cells | H. sapiens | 0.393 | 1603 | rGrG + G | 1 | SSRTII | SMARTer | 12 | — | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_19 | B-cells | H. sapiens | 0.216 | 1730 | rGrG + G | 1 | SSRTII | SMARTer | 12 | — | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_20 | B-cells | H. sapiens | 0.074 | 1131 | rGrG + G | 1 | SSRTII | SMARTer | 12 | — | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_21 | B-cells | H. sapiens | 0.126 | 1445 | rGrG + G | 1 | SSRTII | SMARTer | 12 | — | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_22 | B-cells | H. sapiens | 0.325 | 1702 | rGrG + G | 1 | SSRTII | SMARTer | 12 | — | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_23 | B-cells | H. sapiens | 0.183 | 1756 | rGrG + G | 1 | SSRTII | SMARTer | 12 | — | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_24 | B-cells | H. sapiens | 0.097 | 1338 | rGrG + G | 1 | SSRTII | SMARTer | 12 | — | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_25 | B-cells | H. sapiens | 0.826 | 1657 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_26 | B-cells | H. sapiens | 1.091 | 1659 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_27 | B-cells | H. sapiens | 0.401 | 1649 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_28 | B-cells | H. sapiens | 0.501 | 1547 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_29 | B-cells | H. sapiens | 0.573 | 1534 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_30 | B-cells | H. sapiens | 0.328 | 1343 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_31 | B-cells | H. sapiens | 0.661 | 1607 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_32 | B-cells | H. sapiens | 0.500 | 1605 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_33 | B-cells | H. sapiens | 0.840 | 1782 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_34 | B-cells | H. sapiens | 0.829 | 1813 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_35 | B-cells | H. sapiens | 0.648 | 1642 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_36 | B-cells | H. sapiens | 0.297 | 1815 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_37 | B-cells | H. sapiens | 0.982 | 1825 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| BC_38 | B-cells | H. sapiens | 0.853 | 1795 | rGrG + G | 1 | SSRTII | SMARTer | 12 | 1 | — | KAPA | 50 | |
| dT30VN | HiFi HS | |||||||||||||
| TABLE S4 |
| Detailing variants of the Smart-seq2 protocol |
| Bead | ||||
| purification | ||||
| Protocol | amount TSO | before pre- | ||
| name | TSO | (ul) | amplification? | DNA Polymerase |
| Smart- | rGrG + G | 1 ul (10 uM) | no | KAPA HiFi |
| seq2 | HotStart | |||
| ReadyMix | ||||
| Variant 1 | rGrG + G | 2 ul (10 uM) | no | KAPA HiFi |
| HotStart | ||||
| ReadyMix | ||||
| Variant 2 | rGrG + N | 2 ul (10 uM) | no | KAPA HiFi |
| HotStart | ||||
| ReadyMix | ||||
| Variant 3 | rGrG + G | 1 ul (10 uM) | no | Advantage 2 |
| Variant 4 | rGrGrG | 1 ul (10 uM) | no | KAPA HiFi |
| HotStart | ||||
| ReadyMix | ||||
| SMARTer | SMARTer | 1 ul (12 uM) | yes | Advantage 2 |
| Oligo IIA | ||||
1-20. (canceled)
21. A cDNA library produced by a method of comprising the steps of:
annealing a cDNA synthesis primer to said RNA molecule and synthesizing a first cDNA strand to form an RNA-cDNA intermediate; and
conducting a reverse transcriptase reaction by contacting said RNA-cDNA intermediate with a template switching oligonucleotide (TSO), wherein the TSO comprises a locked nucleic acid (LNA) at its 3′-end, under conditions suitable for extension of the first DNA strand that is complementary to the RNA molecule, rendering it additionally complementary to the TSO.
22-30. (canceled)
31. The cDNA library of claim 21, wherein said reverse transcription reaction is conducted in the presence of a methyl group donor and a metal salt.
32. The cDNA library of claim 31, wherein said methyl group donor is betaine.
33. The cDNA library of claim 31, wherein said metal salt is magnesium salt.
34. The cDNA library of claim 33, wherein said magnesium salt has a concentration of at least 7 mM, at least 8 mM, or at least 9 mM.
35. The cDNA library of claim 21, wherein said template switching oligonucleotide comprises at least one or two ribonucleotide residues and said LNA residue.
36. The cDNA library of claim 35, wherein said at least one or two ribonucleotide residues are riboguanine.
37. The cDNA library of claim 21, wherein said locked nucleic acid residue is selected from the group consisting of locked guanine, locked adenine, locked uracil, locked thymine, locked cytosine, and locked 5-methylcytosine.
38. The cDNA library of claim 21, wherein said locked nucleic acid residue is locked guanine.
39. The cDNA library of claim 21, wherein said locked nucleic acid residue is at the 3′-most position.
40. The cDNA library of claim 21, wherein said template switching oligonucleotide comprises at the 3′-end three nucleotide residues characterized by formula rGrG+N, wherein +N represents a locked nucleotide residue.
41. The cDNA library of claim 40, wherein said template switching oligonucleotide comprises rGrG+G.
42. The cDNA library of claim 31, wherein said methyl group donor is betaine, and said metal salt is MgCl2 at a concentration of at least 9 mM.
43. The cDNA library of claim 21, wherein the method further comprises amplifying said DNA strand that is complementary to said RNA molecule and said template switching oligonucleotide using an oligonucleotide primer.
44. The cDNA library of claim 21, wherein said template switching oligonucleotide is selected from the oligonucleotides in Table S2.
45. The cDNA library of claim 21, wherein the cDNA is synthesized on beads comprising an anchored oligo-dT primer.
46. The cDNA library of claim 45, wherein said oligo-dT primer comprises a sequence of 5″-AAGCAGTGGTATCAACGCAGAGTACT30VN-3″, wherein “N” is any nucleoside base, and “V” is selected from the group consisting of “A”, “C” and “G”.
47. The cDNA library of claim 42, wherein the method further comprises PCR preamplification, tagmentation, and final PCR amplification.
48. The cDNA library of claim 47, wherein the PCR preamplification is conducted without purifying the cDNA obtained from reverse transcription reaction.
49. The cDNA library of claim 21, wherein said RNA is total RNA in a cell.