US20190388584A1
2019-12-26
16/422,086
2019-05-24
Compositions and methods of transplanting cells by grafting strategies into solid organs (especially internal organs) are provided. These methods and compositions can be used to repair diseased organs or to establish models of disease states in experimental hosts. The method involves attachment onto the surface of a tissue or organ, a patch graft, containing the donor cells. The donor cells may be a mixture of stem cells/progenitors with supporting early lineage stage mesenchymal cells. The patch graft promotes migration of the donor cells into the host organ and supports the successful integration of donor cells with host cells to repair the diseased organ.
Get notified when new applications in this technology area are published.
A61L27/3886 » CPC main
Materials for prostheses or for coating prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells comprising two or more cell types
C12N5/067 » CPC further
Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor; Animal cells or tissues; Human cells or tissues; Vertebrate cells Hepatocytes
C12N2506/1346 » CPC further
Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells
G01N33/56966 » CPC further
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses Animal cells
C12N5/0676 » CPC further
Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor; Animal cells or tissues; Human cells or tissues; Vertebrate cells Pancreatic cells
A61L27/38 IPC
Materials for prostheses or for coating prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells
G01N33/569 IPC
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
A61L27/52 » CPC further
Materials for prostheses or for coating prostheses; Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials Hydrogels or hydrocolloids
This application is a continuation-in-part of International Patent Application No. PCT/US2018/036960, filed Jun. 11, 2018, which claims priority from U.S. Provisional Patent Application Nos. 62/518,380, filed Jun. 12, 2017, and 62/664,694, filed Apr. 30, 2018. The contents of these applications are incorporated herein by reference in their entirety.
The instant application contains a Sequence Listing which has been filed electronically in ASCII format and is hereby incorporated by reference in its entirety.
The present invention is directed generally to the field of transplantation of cells or tissue engrafting. More specifically, from solid organs into solid organs, especially to internal organs. The invention concerns compositions and methods providing strategies for the rapid transplantation, engraftment and integration of cells into tissues of solid organs to treat diseases of solid organs or to establish model systems of a disease. Representative of this potential are cell therapies for treatment of hepatic or pancreatic diseases.
There is an unmet need for grafting strategies involving cells derived from solid organs, strategies distinct from those used for transplantation of hemopoietic cells, mesenchymal stem cells or for skin. Transplantation of hemopoietic cells and mesenchymal cells, usually from single cell suspensions, is done routinely via a vascular channel and is dependent on activation of adhesion molecules in relevant target sites because of micro-environmental signaling, a process referred to as “homing”. Methods used for skin employ grafting methods with cells and/or tissues applied directly to target sites. Transplantation of cells from solid organs other than skin have been delivered traditionally via a vascular route or injected directly into the tissue. This approach is not logical, since adhesion molecules on cells from solid organs are always activated and result in rapid (seconds) cell aggregation that can generate life-threatening emboli. Even if emboli are managed successfully to minimize health risks, the efficiency of cell engraftment is low, only ˜20% or less for adult cells and even lower (<5%) for stem/progenitors. Most transplanted cells either die or are transported to ectopic sites, where they can live for months, creating tissue in inappropriate sites resulting in possible adverse effects clinically. The small percentage of cells that engraft into target sites slowly integrate, requiring weeks to months to reconstitute a significant portion of the tissue.
There is improvement in engraftment in liver and minimizing of ectopic cell delivery if cells are coated with hyaluronans and delivered via a vascular route due to the tissue's (e.g. liver's) clearance of hyaluronans. However, this improvement is still less efficient than that with grafting strategies and, importantly, still allows for some (albeit less) delivery of cells to ectopic sites.
Grafts for solid organs are challenging to design because of concerns with respect to size, shape, and complexity in the structure of organs in addition to the dynamic mechanical forces. Accordingly, there remains a need for improved methods of cell engraftment into solid organs. This disclosure fulfills this need and provides related advantages.
Described herein are novel patch graft compositions and methods for transplantation of cells into tissues and solid organs.
In one aspect, the present disclosure relates to a method of engrafting cells into a solid organ of a subject in need thereof, comprising:
In some embodiments, demonstrating comprises measuring a level of a secretion from the solid organ, or a metabolic effect of the solid organ, in a biological sample obtained from the subject to demonstrate that at least a portion of said epithelial cells have engrafted among the cells of the solid organ.
In another aspect, the present disclosure relates to a method of engrafting cells into a solid organ of a subject in need thereof, comprising:
In some embodiments, demonstrating comprises measuring a parameter or a change in same, which indicates a physiological effect in the subject resulting from the migrated cells.
In some embodiments, the patch graft further comprises a backing that promotes a migration of at least a portion of the mixture of epithelial cells and mesenchymal cells towards the solid organ.
In some embodiments, at least a portion of the mixture of epithelial cells and mesenchymal cells migrates over the substantial width of the solid organ and distributes throughout the solid organ.
In some embodiments, the solid organ is an endodermal organ.
In some embodiments, the solid organ is an endodermal organ comprising liver, pancreas, intestine, lung, bile duct, thymus, thyroid, parathyroid and the urogenital sinus region of the prostate and vagina.
In some embodiments, the endodermal organ comprises liver, and engraftment involves a remodeling of Glisson's Capsules.
In some embodiments, the present disclosure provides methods which further gives rise to a combination of (i) engrafted epithelial cells and mesenchymal cells and (ii) host cells.
In some embodiments, the methods of the present disclosure gives rise to functional hepatic parenchymal cells.
In some embodiments, the parenchymal cells comprise hepatocytes and cholangiocytes.
In some embodiments, the endodermal organ comprises pancreas, and engraftment involves a remodeling of pancreatic capsules and pancreatic tissue near to the graft site.
In some embodiments, the methods of the present disclosure gives rise to functional pancreatic cells.
In some embodiments, the functional pancreatic cells comprise acinar cells and islets.
In some embodiments, the pancreas secretes increased levels of at least one of insulin, c-peptide, glucagon, somatostatin, or pancreatic polypeptide.
In some embodiments, the pancreas exhibits a metabolic effect of reduced blood sugar levels.
In some embodiments, the pancreas exhibits a metabolic effect of increased glucose tolerance.
In some embodiments, the pancreas secretes increased levels of a digestive enzyme or bicarbonate fluid.
In some embodiments, the digestive enzyme comprises amylase, lipase, peptidase, ribonuclease, deoxyribonuclease, gelatinase, elastase, or combinations thereof.
In some embodiments, the methods of the present disclosure results in increased levels of a metabolic product derived from a digestive enzyme secreted by the pancreas.
In some embodiments, the digestive enzyme comprises amylase, lipase, peptidase, ribonuclease, deoxyribonuclease, gelatinase, elastase, or combinations thereof.
In some embodiments, the methods of the present disclosure results in improved digestion.
In some embodiments, the liver secretes urea, bile acids, phospholipids, lipoproteins, bilirubin, bicarbonate-rich fluids, or blood-clotting factors.
In some embodiments, a biological sample obtained from the subject indicates reduced levels of at least one of cholesterol, blood sugar, alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, albumin, ammonia, gamma-glutamyltransferase, or L-lactate dehydrogenase.
In some embodiments, the patch includes a backing positioned over the hydrogel containing of the mixture of epithelial cells and mesenchymal cells.
In some embodiments, the backing is used to tether the hydrogel layer to the host organ.
In some embodiments, at least one of the epithelial cells, mesenchymal cells, or both are early lineage stage cells.
In some embodiments, the early lineage stage mesenchymal cells (ELSMCs) comprise angioblasts, precursors of endothelia, stellate cells, or combinations thereof.
In some embodiments, the early lineage stage epithelial cells (ELSEs), ELSMCs, or both are derived from embryonic stem (ES) cells or from induced pluripotent stem cells (iPS).
In some embodiments, the epithelial cells are mature and the mesenchymal cells are ELSMCs.
In another aspect, the present disclosure relates to a method of introducing, restoring, increasing, or improving functionality of a diseased, impaired, or malfunctioning solid organ of a subject, comprising contacting the diseased, impaired, or malfunctioning solid organ with a patch graft comprising a mixture of epithelial cells and mesenchymal cells under conditions that promote engraftment of the epithelial cells and mesenchymal cells; demonstrating an introduction, restoration, increase, or improvement of a functionality in the diseased, impaired, or malfunctioning solid organ.
In some embodiments, demonstrating comprises measuring in a biological sample obtained from the subject a level of a secretion or metabolic product or effect.
In some embodiments, the methods of the present disclosure further comprises demonstrating that a least a portion of the mixture of epithelial cells and mesenchymal cells has distributed among the cells of the host organ.
In some embodiments, an exposed surface of the patch graft includes a coating that inhibits adhesion of the patch graft to organs and tissues in the vicinity of the patch graft.
In some embodiments, the solid organ comprises an endodermal organ.
In some embodiments, the endodermal organ comprises liver, pancreas, intestine, lung, bile duct, thymus, thyroid, parathyroid or the regions from the urogenital sinus of the prostate or vagina.
In some embodiments, the solid organ comprises a pancreas and in which an increased level of the secretion of at least one of insulin, c-peptide glucagon, somatostatin, or pancreatic polypeptide is measured.
In some embodiments the solid organ comprises a pancreas and in which a reduced blood sugar level is measured.
In some embodiments, the solid organ comprises a pancreas and in which increased glucose tolerance is demonstrated.
In some embodiments, the solid organ comprises a pancreas and in which increased levels of a digestive enzyme or bicarbonate fluid is demonstrated.
In some embodiments, the digestive enzyme comprises amylase, lipase, peptidase, ribonuclease, deoxyribonuclease, gelatinase, or elastase.
In some embodiments, the solid organ comprises a pancreas and in which increased levels of a product from a digestive enzyme secreted by the pancreas is measured.
In some embodiments, the digestive enzyme comprises amylase, lipase, peptidase, ribonuclease, deoxyribonuclease, gelatinase, or elastase.
In some embodiments, the solid organ comprises a pancreas and in which improved digestion is demonstrated.
In some embodiments, the solid organ comprises liver, and in which a secretion comprises urea, bile acids, phospholipids, lipoproteins, bilirubin, bicarbonate-rich fluids, blood-clotting factors, or combinations thereof.
In some embodiments, the solid organ comprises liver, and in which a metabolic effect is a reduced level of one or more of cholesterol, blood sugar, alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, albumin, ammonia, gamma-glutamyltransferase, or L-lactate dehydrogenase.
In some embodiments, the solid organ comprises a liver, and the subject suffers from type 1 tyrosinemia.
In some embodiments, a metabolic effect is a decrease in levels of tyrosine or alpha-fetoprotein.
In another aspect, the present disclosure relates to a method of treating a subject diagnosed with a pathological condition attributable at least in part to having a diseased, impaired, or malfunctioning solid organ, comprising
In some embodiments, demonstrating comprises measuring in a biological sample obtained from the subject a level of a secretion or a metabolic product or effect.
In some embodiments, the migration and distribution steps lead to an alleviation of the disease, impairment, or malfunction.
In some embodiments, the solid organ is an endodermal organ.
In some embodiments, the endodermal organ comprises liver, pancreas, intestine, lung, bile duct, thymus, thyroid, parathyroid, and the urogenital sinus regions of the prostate or vagina.
In some embodiments, the endodermal organ is pancreas and in which the subject suffers from diabetes.
In some embodiments, increased levels of at least one of insulin, c-pcptide, glucagon, somatostatin, or pancreatic polypeptide is measured.
In some embodiments, reduced blood sugar levels are demonstrated.
In some embodiments, increased glucose tolerance is demonstrated.
In some embodiments, the subject comprises a mammal.
In some embodiments, the mammal is human.
In another aspect, the present disclosure relates to a patch graft comprising a mixture of epithelial cells and mesenchymal cells and one or more biomaterial layers including, at least:
In some embodiments, the epithelial cells comprise early lineage stage epithelia cells (ELSEs) and the mesenchymal cells comprise early lineage stage mesenchymal cells (ELSMCs), or in which the epithelial and mesenchymal cells are of later lineage stages but are of comparable lineage stages as each other.
In some embodiments, the ELSMCs comprises angioblasts, precursors of endothelia, stellate cells, or combinations thereof.
In some embodiments, the ELSEs and/or the ELSMCs are derived from embryonic stem (ES) cells or from induced pluripotent stem cells (iPS).
In some embodiments, the epithelial cells are of a later lineage stage and the mesenchymal cells are early lineage stage mesenchymal cells (ELSMCs), or the mesenchymal cells are of a later lineage stage and the epithelial cells are early lineage stage epithelial cells (ELSEs).
In some embodiments, the second viscoelastic property (expressed in Pa) has a greater value than the first viscoelastic property.
In some embodiments, the one or more biomaterial layers comprise a hydrogel, which further comprises minimally sulfated or non-sulfated glycosaminoglycans.
In some embodiments, the non-sulfated glycosaminoglycans comprise hyaluronans.
In some embodiments, the hyaluronans comprise a thiol-modified hyaluronan, whose gelation by disulfide bridge formation is triggered in the presence of polyethylene glycol diacrylate (PEGDA).
In some embodiments, the rheological traits are determined, at least in part, by a starting concentration and rigidity of thiol-modified hyaluronan and PEGDA prior to gelation, a final rigidity of hydrogel post-gelation achieved by the precise ratios of the volumes of thiol-modified hyaluronan and PEGDA.
In some embodiments, the first, inner layer exhibits a first viscoelasticity of from about 50 Pa to about 150 Pa.
In some embodiments, the optional backing contains a hyaluronan hydrogel layer that exhibits a viscoelasticity from about 600 to about 800 Pa.
In some embodiments, the optional third, outer layer comprises a hyaluronan hydrogel layer with viscoelasticity properties of from about 200 to about 300 Pa.
In some embodiments, the backing comprises silk.
In some embodiments, the silk backing comprises a purified fibroin ofBombyx™ moth silk knitted into a scaffold, including Seri-Silk™ or Contour Seri Silk™.
In some embodiments, the epithelial cells comprise biliary tree stem cells (BTSCs) and the mesenchymal cells comprise early-lineage-stage mesenchymal cells (ELSMCs).
In some embodiments, the ELSMCs comprise angioblasts and their immediate descendants, precursors to endothelia cells, precursors to stellate cells, or combinations thereof.
In some embodiments, the angioblasts express CD117, CD133, VEGFr, but do not express CD31.
In some embodiments, the precursors to endothelia cells express CD133, VEGFr, CD31 and Van Willebrand Factor.
In some embodiments, the precursors to stellate cells express CD146, ICAM-1, alpha-smooth muscle actin (ASMA) and are negative for vitamin A.
In some embodiments, the mixture of epithelial cells and mesenchymal cells is produced by depleting cell suspensions of mature mesenchymal cells, optionally, by repeated panning procedures to remove cells that attach within from about 15 minutes to about 30 minutes on tissue culture dishes or surfaces at 37° C.
In some embodiments, a culturing of the remaining cell suspensions is performed on low-attachment dishes and in a serum-free medium until a plurality of organoids is formed by self-assembly of epithelial cells and mesenchymal cells.
In some embodiments, the serum-free medium comprises a basal medium (with no copper, low calcium (0.3 mM), 1 nM selenium, 0.1% bovine serum albumin (purified, fatty-acid-free; fraction V), 4.5 mM nicotinamide, 0.1 nM zinc sulfate heptahydrate, 5 Cpg/ml transferrin/Fe, 5 μg/ml insulin, and a mixture of purified free fatty acids that are presented complexed with fatty acid free highly purified albumin.
In some embodiments, in which the serum-free medium further comprises 10 pig/ml high density lipoprotein.
In some embodiments, in which the plurality of organoids is formed after about 2 hours, after about 4 hours, after about 6 hours, after about 8 hours, after about 10 hours, after about 12 hours, after about 14 hours, after about 16 hours, after about 18 hours, after about 20 hours, after about 22 hours, or after about 24 hours.
In some embodiments, the plurality of organoids comprises BTSCs positive for:
In some embodiments, the one or more biomaterial layers comprise recombinant MMPs.
In some embodiments, the one or more biomaterial layers comprise cells engineered to express MMPs.
The patent or application file contains drawings executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of necessary fee.
FIGS. 1A-1D depicts A) Schematic of the process and estimates of the time required for preparing organoids, assembling patch grafts and doing the surgeries. B) Donor cells for the stem cell patch grafts were isolated from cell suspensions of biliary tree tissue from transgenic pigs with green fluorescent protein (GFP) linked to the H-2B (ACTB-IRES-pH2B-eGFP). The cells were prepared as organoids (floating aggregates of epithelial and their mesenchymal cell partners) in serum-free Kubota's Medium and on low attachment culture dishes. Organoids of biliary tree stem cells (BTSCs) and of their early lineage stage mesenchymal cell (ELSMCs) partners (angioblasts and precursors to endothelia and to stellate cells) are shown in a phase micrograph versus one demonstrating expression of the transgene, GFP69. Histology of the stem cell organoids that were paraffin embedded, sectioned and stained with hematoxylin/eosin. (d) Magnified image of an organoid of BTSC and ELSMCs. C) Immunofluorescence (IF) demonstrating expression of stem cell, hepatic and pancreatic markers indicating that these cells are precursors to both liver and to pancreas as shown in multiple prior articles and summarized in reviews. D) Representative qRT-PCR assays assessing expression of various genes in the organoids and indicating that cells are stem cells or early progenitors. The controls were mature hepatocytes from piglet livers.
FIGS. 2A-2E depicts A) A schematic of a patch graft affixed to the liver of a pig, and below, the composition of the grafts. Early lineage stage cells, both the epithelia and mesenchymal cells, are required for production of matrix metallo-proteinases (MMPs), key regulators of cell motility, migration and engraftment. Structure of the graft consist of layers of biomaterials and cells tethered to the target site. For the cells to engraft, the matrix components of the graft biomaterials located adjacent to the target site must be soft (˜100 Pa), such as hyaluronan hydrogels. The medium components must be devoid of serum, growth factors and cytokines influential to differentiation of the donor cells and should be ones tailored for survival and expansion of early lineage stage cells such as stem/progenitors. The backing must have sufficient tensile strength to be used in surgical procedures but be neutral in its effects on the differentiation of the donor cells (ones with type I collagen should be avoided). The backing is impregnated or coated with a more rigid 10× hydrogel (˜700 Pa) to serve as a barrier to orient the migration of donor cells towards the target tissue and to minimize adhesions. After attachment to the target site, a 2×HA hydrogel, one that is sufficiently fluid to be coated or painted onto the outside surface, is added and used to further minimize adhesions. X indicated the stiffness of the crosslinked hydrogel. B) Graft affixed to the livers of the hosts. C) Schematic of the graft demonstrating the layers constituting the graft composition. D) Assays empirically assessing the rheological properties (shear and compressive mechanical forces) of the specific hydrogel layers. E) Analysis of the rheological properties of the 3 layers of hyaluronan hydrogels.
FIGS. 3A-3C depicts A) Masson's Trichrome Staining of the patch graft at one week. Masson's Trichrome identifies collagens (blue), cytoplasm (red) and nuclei (dark purple). It was used to identify Glisson's capsule (normally adjacent to the liver lobules) and adhesions on outside surface of the grafts. In the low magnification image (1), Trichrome staining highlighted the frequently observed separation of the host tissue from the backing and graft in the first week post-transplantation due, it is assumed, to the secretion of MMPs. The liver lobules next to the graft show blanching found subsequently to be caused by penetration of hyaluronans into the tissue. In a higher magnification image (2) of a subsequent section to that in (1), and stained with Hematoxylin/Eosin, there is evidence of a broad region of remodeling region in which the Glisson Capsule is altered and seemingly absent. Higher magnification images of two areas within the remodeling zone make evident the inflammatory responses (a) and the remodeling of the liver lobules (b). B) Trichrome staining of the patch graft at three weeks. The hyaluronans were resorbed enabling maturation of donor cells accompanied by muting of expression of MMPs. Inflammation was markedly decreased leaving a band of tissue between the graft and liver parenchyma (2) and restoration of the liver histology. C) Graft of porcine BTSCs/ELSMCs tethered to the liver of a NRG/FAH mouse that was maintained for 30 days without Nitisinone. Hematoxylin/eo sin staining.
FIGS. 4A-4E depicts A) low magnification image of the patch graft on the surface of a pig liver after one week. The region in black constitutes that of the hyaluronans of the graft. Donor GFP±cells (with pink nuclei; white arrows note areas with large numbers of the donor GFP-BTSC/ELSMCs) were visualized by labeling with an antibody to GFP and secondarily with one coupled to Alexa594, a red fluoroprobe. Host nuclei were stained blue with 4,6-Diamidino-2-phenylindole (DAPI). Host tissue (a) extends into the hyaluronans (HA, the black background) of the graft; tissue by the backing contains occasional organoids but with most donor cells dispersed into cells that are readily identified as one with pink nuclei. There is no evidence for the usual structure of the Glisson's capsule in this area that constitutes the region of remodeling. B) Engraftment and migration of donor cells was rapid. Within a week, all identified donor cells were within the host liver, both near the graft site and also on the opposite side of the liver lobe (estimated distance from the graft site is ˜1.5 cm, a significant distance for the donor cells to have migrated in a week). Shown are donor cells (pink nuclei) near lobules of host mature hepatocytes (forest green color from auto-fluorescence of lipofuscins) on the distant side of the liver lobe from that of the graft site, a distance that is approximately 1.5 cm. C) Maturation of donor cells to adult fates occurred in parallel with HAs being resorbed. Enlargement of a region containing donor GFP+ cells (single cells with pink nuclei) near to host hepatocytes (a), forest green in color (autofluorescence of lipofuscins), and readily distinguished from mature donor (b) hepatocytes (pink nuclei) and lineage restricted from donor GFP+ stem cells. Some cytoplasmic staining of the GFP label was observed especially in the first week after transplantation but became increasingly nuclear staining by the second week (See FIG. 4D-4E). With other IHC assays (data not shown), the spring green color of cells amidst the plates of both host and donor hepatocytes proved by IHC assays to be a mix of mesenchymal cells (endothelia and stellate cells). The bright, spring green autofluorescence from these cells was readily distinguishable from that of the dark, forest green of the lipofuscins. D) Examination of porcine liver at 1 week after patch grafting. We used Sirius red stain, an azo dye staining collagens; did immunohistochemistry for pan-cytokeratin (pCK) and Sox9; and immunofluorescence (IF) stains performed on serial 3-μm sections. At the patch graft site, grafted donor cells merged with liver lobules. In the upper panels (original magnification=5×), patch grafts are composed of mesenchymal and epithelial pCK+ cells (arrows). In middle panels, a higher magnification is provided (20×). Epithelial cells show an immuno-phenotype that is typical of biliary tree stem cells (BTSCs) expressing biliary cytokeratins (pCK) and the endodermal stem cell marker Sox9. The GFP label in these cells was clearly nuclear. BTSCs within the patch graft are arranged in cell strings reassembling bile ductules (arrows) and are in direct continuity with hepatocyte plates of the adjacent liver lobule (arrowheads). Hepatocytes in lobules are pCK and Sox9 negative. In lower panels (Original magnification=20×), the immunofluorescence for GFP allows one to identify individual grafted cells and their progeny. Hepatocytes in lobules adjacent to the patch graft were GFP positive, some in nucleus and some cytoplasmically, indicating that these were donor cells that had integrated amidst host liver parenchyma. At the interface between patch graft and liver lobules, pCK+/GFP+ ductules were in direct continuity with GFP+/pCK− cells within the lobules (arrowheads) suggesting a maturation of grafting cells towards an hepatocyte fate. E) Examination of porcine livers 2 weeks after patch grafting. IF stains reveal that GFP+ cells are present within lobules distant to the graft site and co-express mature hepatocyte markers such as Hepatocyte Nuclear Factor (HNF) 4a and albumin. The GFP label was primarily nuclear in the donor cells. Separate or merged channels were included. Nuclei were displayed in blue (DAPI). Original Magnification: 40×
FIGS. 5A-5P depicts rescue of NRG/FAH mice from type I tyrosinemia with a patch graft of porcine BTSCs/ELSMCs. The proof of entry of the donor cells into the liver is provided in FIG. 3C. Patch grafts of porcine BTSCs/ELSMCs were applied surgically to the liver of NRG/FAH mice and then provided with regular water (weaning them from Nitisinone). FIG. 11 shows a survival chart of the mice along with the body weights of the animals. Whereas the experimentals, provided patch grafts, were alive and increasing in body weight after 30 days, the controls began declining after 2 weeks and had to be euthanized by day 17. The kidneys of the animals provided patch grafts with cells were normal (FIG. 5N). FIGS. 5A-5B) depict positive control NRG/FAH mouse liver in host treated with Nitisone (NTBC) as visualized by low and high magnification image of H&E stained section of the liver. FIGS. 5C-5D) depict negative control mice with patch graft with no cells as visualized by low and high magnification image of H&E stained section of NRG/FAH mouse liver weaned from NTBC treatment and evaluated at day 16. FIGS. 5E-5F) depict low and high magnification images of section of liver of NRG/FAH mouse liver patch grafted with porcine BTSCs/ELSMCs (see also FIG. 3C). FIGS. 5G-5H) depict low and high magnification images of grafted liver stained for GFP (using antibody to GFP and coupled to Novo Red). Note that the GFP+ cells are present throughout the liver and the GFP is localized primarily to the nucleus (FIG. 5H). FIG. 5I depict images showing localization of GFP linked to Histone H2B. Note that expression of GFP (linked to Histone H2B) is present both in the nucleus and in the cytoplasm of some cells. FIG. 5P depicts immunofluorescence images showing faint cytoplasmic labelling with antibody to histone H2B. FIGS. 5J-5K) depicts low and high magnification image of control sections prepared without the primary antibody. FIGS. 5L-5M) depict controls for the studies on murine liver (NRH/FAH) patch grafted with porcine BTSCs/ELSMCs. FIG. 5L depicts a negative control for goat antibodies; FIG. 5M depicts a aegative control for rabbit antibodies. FIG. 5N depicts images of Kidney from a NRH/FAH mouse with patch graft onto the liver with (1) being the graft with no cells and (2) being one with BTSCs/ELSMCs. FIG. 5O depicts murine liver (NRH/FAH) patch grafted with porcine BTSCs/ELSMCs for porcine furamyl-aceto-acetate hydrolase (FAH), and for histone H2B as shown in FIG. 5P. Note that the histone, H2B, is found predominantly in the nucleus but is also found cytoplasmically in some cells.
FIGS. 6A-6H depicts isoforms of secreted and membrane-associated MMPs expressed by both epithelial stem/progenitors and their partner ELSMCs versus that in various mature cells in liver. Quantitation of the expression levels indicated that the membrane-associated forms were similar for both stem/progenitors/ELMCs and for mature epithelial/mesenchymal partners. Note the comparisons in (D). By contrast, secreted forms were expressed at very high levels in stem/progenitors/ELMCs and at low or negligible levels in mature cell types. The cell populations of adult cells analyzed were isolated from suspensions of piglet livers and biliary tree tissue and comprised of CD45+ cells (hemopoietic cells), CD146+ cells (stellate cells), CD31+ cells (endothelia), EpCAM+/CD45− cells (committed progenitors and diploid hepatocytes and cholangiocytes). The BTSCs were isolated from the biliary tree by the protocols given in the Methods. FIG. 6A) shows MMP expression in BTSCs. FIG. 6B) shows MMP expression in stellate cells and endothelia. FIG. 6C) shows MMP expression in 2N (diploid) hepatocytes. FIG. 6D) shows representative MMPs in Adult Cell Types versus BTSCs. FIG. 6E) shows representative MMP expression in regions of remodeling with a BTSC/ELSMCs graft. In a section adjacent to the patch graft of BTSCs/ELSMCs was stained with Trichrome indicating the region (bracketed) of remodeling. FIG. 6F) shows representative images of IHC assays for MMP1 (Novo-red+). Methyl green as the background stain. FIG. 6G) Section stained for MMP2 (Novo-red+). Hematoxylin as background stain. Within the liver lobules, the remodeling process included plates or fingers of MMP2+ cells (rust colored) that transitioned to a complete loss of lobular structures. With clearance of HAs, the lobular structures reappeared.
FIG. 7 depicts a schematic demonstration of the engraftment and integration phenomena in the liver and of the pancreas. Patch grafts were tethered to the liver via sutures at the corners of the patch. To minimize adverse reactions (e.g. autolysis) by the pancreas, the patch grafts tethered to the pancreas were done entirely with surgical glue at the corners of the patch (mice) or were done with sutures to the duodenum on one end of the patch and using surgical glue on the corners on the other end, that over the pancreas (pigs)
FIGS. 8A-8B depicts controls of transgenic pig liver versus wild type pig liver. Both are unstained frozen sections and imaged for green fluorescence. High magnification images of a frozen section of liver from a transgenic pig (8A), with GFP+-H2B fluorescence that is punctate due to nuclear localization. However, note the variations in the levels of fluorescence among different cells. By contrast, a frozen section from the liver of a wild type pig (8B) demonstrates green fluorescence derived from autofluorescence of lipofuscins and other components and is clearly cytoplasmic.
FIGS. 9A-9B depicts the remodeling zone near to graft site. In the first two weeks after transplantation, the region adjacent to the graft undergoes extensive remodeling of the Glisson Capsule and of the subjacent lobular architecture of the liver parenchyma. See also FIG. 3. Images made at one week (9A) and two weeks (9B) after grafting and with higher magnification images of specific regions of the remodeling zone. Stain: hematoxylin/eosin.
FIG. 10 depicts adverse conditions with patch grafts with certain backings. The adverse reactions included necrosis, adhesions, and sites of cholestasis found to occur when grafts were placed too close to some ducts such that the swelling caused occlusion of the ducts.
FIG. 11 depicts viability and weight chart of NRG/FAH mice patch grafted with porcine BTSCs/ELSMCs and then weaned from the drug, Nitisinone (NTBC). The chart begins with animals after weaning from the drug. The animals (n3) with patch grafts were stable and, indeed gained weight over the 30 days of the study. By contrast, the controls (n2) were stable temporarily but by about two weeks began to decline. They had to be euthanized by day 16.
FIGS. 12A-12E depicts adverse conditions with patch grafts with certain backings. The adverse reactions included necrosis (12A), discoloration (12B), and adhesions (12C). Difficulties that proved independent of the graft biomaterials and composition were skin infections (12D, 12E). The skin infections proved a common problem due to the immunosuppression. The infections were not observed within the peritoneum or associated with the grafts, but only in association with the skin.
FIGS. 13A-13C shows a frozen section from the liver of a NRG/FAH mouse given a patch graft of porcine GFP+ BTSCs/ELSMCs (FIG. 13A). The mice were evaluated one month after transplantation. The section was stained with DAPI but not with a primary antibody. The generalized pale green background is from autofluorescence of various components in liver. Bar: 500 μm. Mice subjected to patch grafts of porcine BTSCs/ELSMCs and evaluated one month later. FIG. 13B depicts a frozen section showing the occasional host cells (blue nuclei and yellow/green cytoplasm) in tissue dominated by donor cells (red/purplish nuclei). Bar: 500 μm. FIG. 13C depicts a higher magnification image of 13B and with labeling to indicate the occasional mouse cell in tissue dominated by donor (porcine, GFP+) cells. Bar: 100 μm
FIG. 14 depicts the rapid distribution and integration of the donor cells throughout the host tissue. The schematic figure indicates the regions of the liver of a piglet and that were sampled a week after a patch graft of GFP+ BTSCs was surgically applied to the piglet liver. The different regions of the piglet liver were used to prepare DNA PCR Assays for GFP expression in each region. The agarose gel shows the results of the DNA PCR assay for GFP expression in each of these zones
FIGS. 15A-15D depicts data are from serological studies in mice provided patch grafts with murine organoids of BTSCs/ELSMCs from DS-red mice. Controls received grafts without cells. The patch grafts were attached to the pancreas of NRG/Akita mice, a murine model of type I diabetes. The number of mice for the control groups (untreated or treated with biomaterial without cells) were 3; those for the diabetic mice treated with patch graft were 4 and 5. A) depicts the blood glucose levels in untreated diabetic mice (circle), diabetic mice treated with graft biomaterial only (square), and diabetic mice treated with a patch graft containing cells (triangle). B) depicts the serum levels of C-peptide in untreated diabetic mice (see first column under D0, D7, D14, and D21), diabetic mice treated with graft biomaterial only (see second column under D0, D7, D14, and D21), and diabetic mice treated with a patch graft containing cells (see third column under D0, D7, D14, and D21). C) depicts serum insulin levels in untreated diabetic mice (see first column under D21 and D28), diabetic mice treated with graft biomaterial only (see second column under D21 and D28), and diabetic mice treated with a patch graft containing cells (see third column under D21 and D28). D) depicts blood glucose levels in normal mice (triangles), diabetic mice treated with graft biomaterial only (circles), and diabetic mice treated with a patch graft containing cells (squares).
FIGS. 16A-16B shows representative light micrographs of sections of murine pancreas stained with antibodies to insulin (brown) and counterstained with hematoxylin (same magnification, bar=100 μm). (A) Diabetic mice treated with patch graft containing organoids of BTSC/ELSMCs prepared from DS-red mice. (B) Diabetic mice treated with a graft without cells. Note that there are many cells not expressing insulin. Even though the insulin protein is evident in the controls, it was not functional as noted in the serological assays (FIG. 15). The immunohistochemistry was prepared on tissues one month after transplantation with patch grafts.
FIGS. 17A-17C depicts Akita/NRG mice given patch grafts of organoids of BTSCs/ELSMCs prepared from DS-red mice. A) depicts representative photomicrographs show islets or patch area with immunoperoxidase (brown)-stained Neurogenin-3 (NGN3), counterstained with hematoxylin, initial magnification 40×, bar=100 μm), diabetic mice treated with organoids in patch graft. B) depicts antibody-positive organoids in and around the patch region (arrows). C) depicts an islet in Akita/NRG diabetic mice treated with a patch graft without cells. Note that there is minimal or no expression of NGN3.
FIGS. 18A-18B depicts representative photomicrographs show islets or patch area with immunoperoxidase (brown)-stained Neurogenin-3, counterstained with hematoxylin, initial magnification 40×, bar=100 μm. (A) depicts diabetic mice given patch graft with organoids of BTSCs/ELSMCs prepared from DS-red mice. A few DS-red-positive staining cells (indicative of donor cells) can be observed in the pancreatic parenchyma (black arrows). (B) some antibody-positive organoids can be seen as indicated by the narrow (brown arrows). Note: The wider (blue) arrows point to the silk fibers in the graft.
FIGS. 19A-19B shows evidence for Engraftment of organoids of BTSCs/ELMCs from GFP+ transgenic pigs into the pancreas of wild type pigs by a week after the surgery. The image shows low magnification images of a pig pancreas section stained with DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride) and for immunofluorescent staining for insulin (A) versus amylase (B) in a section of piglet pancreas and surrounding tissues a week after attaching a patch graft containing organoids of porcine GFP+ BTSCs/ELSMCs onto the pancreas of a wild type piglet. The staining for insulin was done with an antibody coupled to a red fluoroprobe and that for GFP with one with a green fluoroprobe. Note that cells have migrated also into the submucosa of the duodenum, the location of Brunner's Glands. A) depicts large number of GFP+ donor-derived cells are visible in the proximity of the area where the patch graft was placed. Nuclei were stained with DAPI and appear blue. Insulin expression, characteristic of pancreatic islet beta cells, was identified with an anti-insulin antibody coupled to a red fluoroprobe. Endogenous (host) islet beta cells of the recipient pancreas appear red, in the upper portion of the pancreas. Donor-derived islet beta cells have nuclei that are red/purple from the merge of DAPI's blue and the GFP's green and have cytoplasm that is red/yellow from staining for insulin. They are observed in the lower portion of the pancreas, proximal to the site of placement of the patch graft. This low magnification image demonstrates the extent of engraftment into the pancreas, as well as the engraftment into the submucosal region of the duodenum, the location of Brunner's Glands (hypothesized to be the starting point of the network of cells contributing to organogenesis of the liver and pancreas). Bar: 1 mm. B) shows immunofluorescent staining for amylase in a sequential section from the same tissue block as that in FIG. 18A. Amylase (green) is detected predominantly in pancreatic acinar tissue, as well as in the mucosal layer and in the lumen of the duodenum. Insulin (red) does not overlap with Amylase (green). This staining, in combination with that of FIG. 19A, suggests that a large portion of GFP+ donor-derived cells are committed to a pancreatic acinar-like fate. Bar: 1 mm.
FIGS. 20A-20C depicts sections stained with DAPI (blue) and immunofluorescent staining for insulin and other islet hormones and for GFP in pancreas sections from 3 recipients of GFP+ BTSCs/ELSMCs patch grafts (day 7 post transplantation). We observed GFP+ cells in the parenchyma of the pancreas, in the proximity of the patch graft site in all recipients. Notably, GFP+ cells appear at a considerable distance from the patch graft site and appear to be well integrated into the parenchyma of the recipient pancreas. Patch graft material (SERI silk) presents a degree of autofluorescence in different channels and is still visible at day 7 post transplantation. Bar: 2 mm. FIG. 20A is a higher magnification of FIG. 19A.
FIGS. 21A-21C show higher magnification images, corresponding to the sections in FIGS. 20A-20C. FIGS. 21A-21C depicts evidence showing the co-existence of endogenous host islet-beta cells (Insulin+/GFP−: red cytoplasm) and donor-derived beta cells (Insulin+/GFP+: purplish colored nuclei and red/orange cytoplasm) in the pancreas at 7 days post-transplantation of GFP+ BTSCs/ELSMCs patch graft. We observed donor-derived as well as endogenous host islet-beta cells in all cases. The majority of GFP+ cells present a phenotype consistent with that of pancreatic acinar cells. GFP+ cells organized to form a ductal structure are visible in the lower portion of FIG. 21A. Although the islet cells show GFP expression nuclearly even at a week, GFP expression in the acinar cells at a week was cytoplasmic. As was observed in FIGS. 4A-4E in the first week after attaching patch grafts onto liver, there is cytoplasmic staining for GFP; in these images, there is GFP staining cytoplasmically in the acinar cells (blue nuclei and green cytoplasm). In the liver, this resolved to entirely nuclear staining for GFP by about 2 weeks post-transplantation. Ongoing studies are assessing if this occurs also in the acinar cells in the pancreas. Bar: 50 μm.
FIG. 22 shows a graphical outline of different stem cell subpopulations.
Described herein are novel patch graft compositions and methods for transplantation of cells into tissue and solid organs.
Embodiments according to the present disclosure will be described more fully hereinafter. Aspects of the disclosure may, however, be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art. The terminology used in the description herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety.
Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the present application and relevant art and should not be interpreted in an idealized or overly formal sense unless expressly so defined herein. While not explicitly defined below, such terms should be interpreted according to their common meaning.
The practice of the present technology will employ, unless otherwise indicated, conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology, and recombinant DNA, which are within the skill of the art. See, e.g., Sambrook and Russell eds. (2012) Molecular Cloning: A Laboratory Manual, 4rd edition; the series Ausubel et al. eds. (2012) Current Protocols in Molecular Biology; the series Methods in Enzymology (Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach; Harlow and Lane eds. (2014) Antibodies, A Laboratory Manual, 2d edition; Freshney (2011) Culture of Animal Cells: A Manual of Basic Technique, 6th edition; Gait ed. (1984) Oligonucleotide Synthesis; U.S. Pat. No. 4,683,195; Hames and Higgins eds. (1985) Nucleic Acid Hybridization; Anderson (1999) Nucleic Acid Hybridization; Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. eds (1996) Weir's Handbook of Experimental Immunology.
Unless the context indicates otherwise, it is specifically intended that the various features of the invention described herein can be used in any combination. Moreover, the disclosure also contemplates that in some embodiments, any feature or combination of features set forth herein can be excluded or omitted. To illustrate, if the specification states that a complex comprises components A, B and C, it is specifically intended that any of A, B or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination.
All numerical designations, e.g., pH, temperature, time, concentration, and molecular weight, including ranges, are approximations which are varied (+) or (−) by increments of 1.0 or 0.1, as appropriate, or alternatively by a variation of +/−15%, or alternatively 10%, or alternatively 5%, or alternatively 2%. It is to be understood, although not always explicitly stated, that all numerical designations are preceded by the term “about.” It also is to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art.
As used in the description of the invention and the appended claims, the singular forms “a,” “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise.
The term “about,” as used herein when referring to a measurable value such as an amount or concentration and the like, is meant to encompass variations of 20%, 10%, 5%, 1%, 0.5%, or even 0.1% of the specified amount.
The terms or “acceptable,” “effective,” or “sufficient” when used to describe the selection of any components, ranges, dose forms, etc. disclosed herein intend that said component, range, dose form, etc. is suitable for the disclosed purpose.
Also as used herein, “and/or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).
As used herein, the term “comprising” is intended to mean that the compositions and methods include the recited elements, but do not exclude others. As used herein, the transitional phrase “consisting essentially of” (and grammatical variants) is to be interpreted as encompassing the recited materials or steps “and those that do not materially affect the basic and novel characteristic(s)” of the recited embodiment. See, In re Herz, 537 F.2d 549, 551-52, 190 U.S.P.Q. 461, 463 (CCPA 1976) (emphasis in the original); see also MPEP § 2111.03. Thus, the term “consisting essentially of” as used herein should not be interpreted as equivalent to “comprising.” “Consisting of” shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions disclosed herein. Aspects defined by each of these transition terms are within the scope of the present disclosure.
As used herein the term “amount effective” or “effective amount” refers to an amount that is sufficient to treat disease states or conditions (e.g. liver or pancreatic diseases). An effective amount can be administered in one or more administrations, applications or dosages. Such delivery is dependent on a number of variables including the time period during which the individual dosage unit is to be used, the bioavailability of the composition, the route of administration, etc. It is understood, however, that specific amounts of the compositions for any particular patient depends upon a variety of factors including the activity of the specific agent employed, the age, body weight, general health, sex, and diet of the patient, the time of administration, the rate of excretion, the composition combination, severity of the particular disease (e.g. liver or pancreatic disease) being treated and form of administration.
The terms “equivalent” or “biological equivalent” are used interchangeably when referring to a particular molecule, biological, or cellular material and intend those having minimal homology while still maintaining desired structure or functionality.
As used herein, the term “expression” refers to the process by which polynucleotides are transcribed into mRNA and/or the process by which the transcribed mRNA is subsequently being translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. The expression level of a gene may be determined by measuring the amount of mRNA or protein in a cell or tissue sample; further, the expression level of multiple genes can be determined to establish an expression profile for a particular sample.
As used herein, the term “functional” may be used to modify any molecule, biological, or cellular material to intend that it accomplishes a particular, specified effect.
The terms “nucleic acid,” “polynucleotide,” and “oligonucleotide” are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides or analogs thereof. Polynucleotides can have any three dimensional (3D) structure and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: a gene or gene fragment (for example, a probe, primer, EST or SAGE tag), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, RNAi, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers.
A polynucleotide can comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be imparted before or after assembly of the polynucleotide. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component. The term also refers to both double and single stranded molecules. Unless otherwise specified or required, any aspect of this technology that is a polynucleotide encompasses both the double stranded form and each of two complementary single stranded forms known or predicted to make up the double stranded form.
The term “protein”, “peptide” and “polypeptide” are used interchangeably and in their broadest sense to refer to a compound of two or more subunit amino acids, amino acid analogs or peptidomimetics. The subunits may be linked by peptide bonds. In another aspect, the subunit may be linked by other bonds, e.g., ester, ether, etc. A protein or peptide must contain at least two amino acids and no limitation is placed on the maximum number of amino acids which may comprise a protein's or peptide's sequence. As used herein the term “amino acid” refers to either natural and/or unnatural or synthetic amino acids, including glycine and both the D and L optical isomers, amino acid analogs and peptidomimetics.
The term “gene” as used herein is meant to broadly include any nucleic acid sequence transcribed into an RNA molecule, whether the RNA is coding (e.g., mRNA) or non-coding (e.g., ncRNA). The term “isolated” as used herein refers to molecules or biologicals or cellular materials being substantially free from other materials.
Definitions of other terms used herein will be provided below in the context in which they are used.
Patch Graft Compositions and Strategies
In another aspect, the present disclosure relates to a patch graft comprising a mixture of epithelial cells and mesenchymal cells and one or more biomaterial layers including, at least:
As used herein, the term “patch graft” refers to a composition of cells embedded in an appropriate biomaterial that allows for transplanting donor cells to the host. In some embodiments, the term refers to a composition of cells embedded in an appropriate biomaterial that allows for transplanting donor cells to the host. Biomaterials are ones that can be prepared under wholly defined conditions (e.g., basal medium of nutritional factors, vitamins, amino acids, carbohydrates, minerals, insulin, transferrin/Fe, and/or lipids) and solidified into a soft gel (about 100 Pa), and covered with a backing that has sufficient tensile strength to enable surgical attachment to a tissue or organ of the host and yet be of a chemistry with minimal effects on the differentiation of the donor cells and minimal adverse effects to the host tissues.
As used herein, the term “backing” refers to a material which (i) is biocompatible with the subject into which it is being transplanted, (ii) exhibits mechanical resilience to withstand the compressive and shear forces that occur on organs and tissues (especially internal ones), which in turn enables this material to function as a surgical tissue, and (iii) has a neutral or minimal effect on the differentiation status of cells that come in contact with the material. In this regard, suitable materials include but are not limited to Seri-Silk™ (or derivatives of it) and/or a patch comprised of PGA and/or PLLA. Non-limiting examples of suitable patches of synthetic materials include a woven patch comprised of 91% PGA-co-9% PLLA, a knit patch comprised of 91% PGA-co-9% PLLA, or a non-woven patch comprised of 100% PGA. Other possibilities include amnions or matrix extracts of amnions or omentum or matrix extracts of omentum. In some embodiments, the backing comprises silk. In some embodiments, the backing comprises silk. In some embodiments, the silk backing comprises a purified fibroin of Bombyx™ moth silk knitted into a scaffold, including Seri-Silk™ or Contour Seri Silk™.
In some embodiments, the backing is also bioresorbable. As used herein, “bioresorbable” refers to a material that can be broken down by the body of a host or recipient of the graft and does not require mechanical removal. In some embodiments, the bioresorbable backing is bioresorbable within a span of about 2 to about 10 weeks, about 2 to about 20 weeks, about 2 to about 52 weeks, about 4 to about 16 weeks, about 4 to about 12 weeks, or about 4 to about 8 weeks.
As used herein, the biomaterials of the graft, and independent of the backing, include ones that can form hydrogels. The term “gel” refers to a solid jelly-like material that can have properties ranging from soft and weak to hard and tough. Gels are defined as a substantially dilute cross-linked system, which exhibits no flow when in the steady-state. By weight, gels are mostly liquid, yet they behave like solids due to a three-dimensional cross-linked network within the liquid. It is the crosslinking within the fluid that gives a gel its structure (hardness) and contributes to its adhesiveness. In this way gels are a dispersion of molecules of a liquid within a solid in which the solid is the continuous phase and the liquid is the discontinuous phase. A “hydrogel” is a non-limiting example of a gel comprised of a macromolecular polymer gel constructed of a network of polymer chains. Hydrogels are synthesized from hydrophilic monomers or hydrophilic dimers (e.g. in the case of hyaluronan) by either chain or step growth, along with network formation. A net-like structure along with void imperfections enhance the hydrogel's ability to absorb large amounts of water via hydrogen bonding. As a result, hydrogels develop characteristic firm yet elastic mechanical properties. They are able to undergo spontaneous formation of new bonds when old bonds are broken within a material. The structure of the hydrogels along with electrostatic attraction forces drive new bond formation through non-covalent hydrogen bonding. One successful material for the hydrogels is thiol-modified hyaluronan that can be triggered to form hydrogels when exposed to oxygen and/or to poly (ethylene glycol) diacrylate (PEGDA) and readily “tunable” by the precise ratios of hyaluronan and PEGDA concentrations (and/or oxygen levels). The hydrogel's viscoelastic properties can be determined by measuring rheological traits and expressed in Pascals (Pa).
In some embodiments, the second viscoelastic property (expressed in Pa) has a greater value than the first viscoelastic property. In some embodiments, the one or more biomaterial layers comprise a hydrogel, which further comprises minimally sulfated or non-sulfated glycosaminoglycans. In some embodiments, the non-sulfated glycosaminoglycans comprise hyaluronans. In some embodiments, the hyaluronans comprise a thiol-modified hyaluronan, whose gelation by disulfide bridge formation is triggered in the presence of polyethylene glycol diacrylate (PEGDA). In some embodiments, the rheological traits are determined, at least in part, by a starting concentration and rigidity of thiol-modified hyaluronan and PEGDA prior to gelation, a final rigidity of hydrogel post-gelation achieved by the precise ratios of the volumes of thiol-modified hyaluronan and PEGDA.
In some embodiments. the rheological trails of the patch graft are also determined by the temperature for achieving the cross-linking process. Temperatures for forming about 50 Pa to about 150 Pa inner layer hydrogel can be room temperature (RT) or 37° C. Temperatures for forming about 200 to about 300 Pa hydrogel can be 4° C. or room temperature (RT). Temperatures for forming about 600 to about 800 Pa can be room temperature (RT) or 37° C.
As used herein, the term “hyaluronan,” or “hyaluronic acid,” refers to a polymer of disaccharide units comprised of glucosamine and glucuronic acid [1-3] linked by (31-4, (31-3 bonds and salts thereof. Thus, the term hyaluronan refers to both natural and synthetic forms of hyaluronans. The naturally occurring hyaluronan (HA), water-soluble polysaccharide comprising disaccharide units of D-glucuronic acid (GlcUA) and N-acetyl-D-glucosamine (GlcNAc), which are alternately linked, forming a linear polymer. High molecular weight HA may comprise 100 to 10,000 disaccharide units. HAs often occur naturally as the sodium salt, sodium hyaluronate. HA; sodium hyaluronate, and preparations of either HA or sodium hyaluronate are often referred to as “hyaluronan.” Non-limiting examples of acceptable hyaluronate salts, include potassium hyaluronate, magnesium hyaluronate, and calcium hyaluronate.
Other glycosaminoglycans (GAGs) can also be used in the hydrogel. These include forms of chondroitin sulfate (CSs) and dermatan sulfates (DSs), polymers of glucuronic acid and galactosamine, and heparan sulfates (HSs) and heparins (HPs), polymers of glucuronic acid and glucosamine. The extent and pattern of sulfation of these GAGs is critical, since the sulfation patterns dictate the formation of complexes with multiple families of proteins (e.g. coagulation proteins, growth factors, cytokines, neutrophilic enzymes). See, e.g., Powell A K, Yates E A, Fernig D G, Turnbull J E. Interactions of heparin/heparan sulfate with proteins: appraisal of structural factors and experimental approaches. Glycobiology. 2004 April; 14(4):17R-30R. Those appropriate for patch grafts that optimize engraftment comprise hyaluronans, non-sulfated GAGs, and ones with minimal sulfation such as forms of chondroitin sulfates found in stem cell niches, as shown in Karumbaiah L, et al. Chondroitin Sulfate Glycosaminoglycan Hydrogels Create Endogenous Niches for Neural Stem Cells. Bioconjug Chem. 2015 Dec. 16; 26(12):2336-49 and Hayes A J, et al. Chondroitin sulfate sulfation motifs as putative biomarkers for isolation of articular cartilage progenitor cells. J Histochem Cytochem. 2008 February; 56(2):125-38 (incorporated herein by reference).
The hydrogel's viscoelastic property may be from about 10 Pa to about 50 Pa, from about 50 Pa to about 100 Pa, from about 100 Pa to about 150 Pa, from about 150 Pa to about 200 Pa, from about 200 Pa to about 250 Pa, from about 250 Pa to about 300 Pa, from about 300 Pa to about 350 Pa, from about 350 Pa to about 400 Pa, from about 400 Pa to about 450 Pa, from about 450 Pa to about 500 Pa, from about 500 Pa to about 550 Pa, from about 550 Pa to about 600 Pa, from about 600 Pa to about 650 Pa, from about 650 Pa to about 700 Pa, from about 700 Pa to about 750 Pa, from about 750 Pa to about 800 Pa, from about 800 Pa to about 850. In some embodiments, the viscoelastic property of the hydrogel is about 50 Pa, about 100 Pa, about 150 Pa, about 200 Pa, about 250 Pa, about 300 Pa, about 350 Pa, about 400 Pa, about 450 Pa, about 500, Pa, about 550 Pa, about 600 Pa, about 650 Pa, about 700 Pa, about 750 Pa, or about 800 Pa.
In some embodiments, the first, inner layer exhibits a first viscoelasticity of from about 50 Pa to about 150 Pa. In some embodiments, the optional backing contains a hyaluronan hydrogel layer that exhibits a viscoelasticity from about 600 to about 800 Pa. In some embodiments, the optional third, outer layer comprises a hyaluronan hydrogel layer with viscoelasticity properties of from about 200 to about 300 Pa. In some embodiments of the patch graft, the viscoelasticity properties of the backing is greater than the viscoelasticity properties of the first layer. In some embodiments of the patch graft, the viscosity of the backing is about 1.5 to about 15 fold greater than the viscosity of the first layer. In some embodiments of the patch graft, the viscoelasticity properties of the backing is about 2 fold greater than the viscoelasticity properties of the first layer.
Applicants have shown that hyaluronans can influence epithelial cells, stem and/or progenitor cells to express factors that regulate critical cell adhesion molecules needed for cell attachment and cell-cell interactions and to prevent the stem and/or progenitor cells from internalization of those attachment factors following cell suspension preparations, cryopreservation, or with transplantation. Non-limiting examples of such attachment factors include integrins. Integrins are a large family of heterodimeric transmembrane glycoproteins that function to attach cells to extracellular matrix proteins of the basement membrane, ligands on other cells, and soluble ligands. Integrins contain a large and small subunit, referred to as α and β, respectively. This subunits form αβ heterodimers and at least 18 α and eight β subunits are known in humans, generating 24 heterodimers. In some embodiments, the stem and/or progenitor cells express higher levels of integrin subunits, for example, ITGα1, ITGα2, ITGα2B, ITGα3, ITGα4, ITGα5, ITGα6, ITGα7, ITGα8, ITGα9, ITGα10, ITGα11, ITGαD, ITGαE, ITGαL, ITGαM, ITGαV, ITGαX, ITGβ1, ITGβ2, ITGβ3, ITGβ4, ITGβ5, ITGβ6, ITGβ7 and ITGβ8. In one preferred embodiment, the stem and/or progenitor cells express higher levels of integrin subunit beta 1 (ITGβ1) and/or integrin subunit beta 4 (ITGβ4). Takada Y. et al. (2007) Genome Biol. 8(5): 215.
In some embodiments, the epithelial cells, stem and/or progenitor cells of the present disclosure differ from naturally occurring stem and/or progenitor cells in at least that they express an integrin subunit in an amount that is at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 200% greater than the amount of the integrin subunit in unmodified stem and/or progenitor cells. It is contemplated that an increase in an integrin subunit help the stem and/or progenitor cell to attach, and to form cell-cell interactions.
Hyaluronans (HA), major constituents of stem cell niches, are candidate coatings of stem cells used for cell therapies, since they facilitate viability, proliferation and engraftment in damaged livers. The chemical and mechanical properties of HA are conducive to essential requirements for stem cells. In addition, since the liver is a primary site for HA clearance, HA-coating represents an advantageous strategy for the selective targeting of the transplanted cells to the liver.
The stem and/or progenitor cells can be coated with hyaluronan (HA) using any method known in the field. For example, the stem and/or progenitor cells can be incubated with an amount of HA and gently mixed for a period of time, for example, about 5 minutes, 10 minutes, 15 minutes, 20 minutes, 30 minutes, 45 minutes, an hour, or longer. The HA-coated stem and/or progenitor cells can then be further incubated in a medium, for example, Kubota's medium.
In some embodiments, the HA comprises a salt of HA, for example, an alkali metal salt. HA often occurs naturally as the sodium salt, sodium hyaluronate. Non-limiting examples of acceptable additional hyaluronate salts, include, potassium hyaluronate, magnesium hyaluronate, and calcium hyaluronate. To prepare the HA for coating the stem and/or progenitor cells, the HA can be resuspended in any pharmaceutically acceptable carrier, for example, phosphate buffered saline (PBS), a basal media, Kubota's Medium, a hormonally-defined medium, or the like. In some embodiments, the pharmaceutically acceptable carrier further comprises one or more growth factors, one or more glucosaminoglycan saccharides, or combinations thereof.
In some embodiments, the amount of hyaluronan in the pharmaceutically acceptable carrier is from about 0.05% w/v to about 1% w/v hyaluronan. In one preferred embodiment, the amount of hyaluronan in the pharmaceutically acceptable carrier is about 0.1% w/v hyaluronan.
As used herein, the term “coated” means either continuous or discontinuous, i.e., the hyaluronan (HA) coating can completely cover the surface of the stem and/or progenitor cells or covers only a portion so that it forms areas of coverage (e.g. “islands”) and areas of no coverage. While the coatings of the present invention contain HA, it is contemplated that the coatings can also comprise other substances. In some embodiments, the hyaluronan coats at least a portion of a surface of said stem and/or progenitor cells or aggregates thereof, for example, at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% of a surface of said stem and/or progenitor cells or aggregates thereof. In some embodiments, at least about half of an exposed surface of said aggregates or individual stem and/or progenitor cells is coated with hyaluronan or a pharmaceutically acceptable salt thereof. In some embodiments, the stem and/or progenitor cells have been modified by the presence of externally added hyaluronan.
The size of transplanted cells may be an important factor for the success of the transplantation. If the cells are too large (e.g. polyploid hepatocytes) or if they form large aggregates, the transplantation of them via a vascular route may result in an embolus that can be life threatening. If the cells are too small, their engraftment efficiency may be very low, and the cells will have a greater propensity to distribute to ectopic sites. Both possibilities are ones of importance for cell therapy considerations. Cells used for cell therapy of liver diseases have been infused into the liver via the spleen in animal models or into the portal vein or hepatic artery in humans. The sizes in terms of the cell diameters have ranged from ˜8-10 μm for stem cells (HpSCs, BTSCs), ˜12-15 for hepatoblasts and committed progenitors, ˜17-18 μm for diploid hepatocytes dominant in neonatal livers, to ˜25-30 μm for mature hepatocytes that are dominant in adult liver.
In some embodiments, a majority of aggregates of stem and/or progenitor cells comprise between about two to about ten stem and/or progenitor cells per aggregate. Most commonly, they comprise 50-100 cells/aggregate. In one embodiment, the aggregates comprise about 90-100 cells. In one embodiment, the aggregates comprise about 80-90 cells. In one embodiment, the aggregates comprise about 70-80 cells. In one embodiment, the aggregates comprise about 60-70 cells. In one embodiment, the aggregates comprise about 50-60 cells.
In one embodiment, the aggregates comprise about five stem and/or progenitor cells and associated ELSMCs. In some embodiments the aggregates of stem and/or progenitor have an average diameter of 50 μm or less, 45 μm or less, 40 μm or less, 35 μm or less, 30 μm or less, 25 μm or less, 20 μm or less, 15 μm or less, or 10 μm or less. In one preferred embodiment, the aggregates of stem and/or progenitor cells have an average diameter of 30 μm or less.
As used herein, the term “cell” refers to one or more cells of the graft. The cells of the present disclosure are eukaryotic. In some embodiments, the epithelial cells comprise early lineage stage epithelia cells (ELSEs) and the mesenchymal cells comprise early lineage stage mesenchymal cells (ELSMCs), or in which the epithelial and mesenchymal cells are of later lineage stages but are of comparable lineage stages as each other. In some embodiments, the ELSMCs comprises angioblasts, precursors of endothelia, stellate cells, or combinations thereof. In some embodiments, the ELSEs and/or the ELSMCs are derived from embryonic stem (ES) cells or from induced pluripotent stem cells (iPS). In some embodiments, the epithelial cells are of a later lineage stage and the mesenchymal cells are early lineage stage mesenchymal cells (ELSMCs), or the mesenchymal cells are of a later lineage stage and the epithelial cells are early lineage stage epithelial cells (ELSEs). In some embodiments, this cell is of animal origin and can be a stem cell, a mature somatic cell, progenitor cell, or intermediates in the lineage stages from the stem cells to the mature cells. The term “population of cells” refers to a group of one or more cells of the same or different cell type with the same or different origin. In some embodiments, this population of cells may be derived from a cell line, from freshly isolated cells, or in some embodiments, this population of cells may be derived from a portion of an organ or tissue.
The term “stem cell” refers to cell populations that can self-replicate (produce daughter cells identical to the parent cell) and that are multipotent, i.e. can give rise to more than one type of adult cell. The term “progenitor cell” or “precursor” as used herein, is broadly defined to encompass progeny of stem cells and their descendants. Progenitors are cell populations that can be multipotent, bipotent, or unipotent but have minimal (if any) ability to self-replicate. Committed progenitors are ones that are unipotent and can differentiate into a particular lineage leading to only one mature cell type. Non-limiting examples of stem cells include but are not limited to embryonic stem (ES) cells, induced pluripotent stem (iPS) cells, germ layer stem cells, determined stem cells, perinatal stem cells, amniotic fluid-derived stem cells, mesenchymal stem cells (MSCs), and angioblasts. Intermediates between stem cells and committed progenitors include cell populations such as hepatoblasts and pancreatic ductal progenitors and other forms of transit amplifying cells that may be multipotent and have extensive proliferative potential but more limited (if any) self-replicative ability.
The cells can be any determined stem cells such as determined endodermal stem cells or progenitors derived from them. Moreover these determined stem cells or progenitors can derive from lineage restriction of embryonic stem (ES) cells or induced pluripotent stem (iPS) cells. ES cells are pluripotent stem cells derived from early embryos and can give rise to adult cells of all three germ layers. The iPS cells are postnatal cells that are reprogrammed with transcription factors or small molecules to have phenotypic traits similar to ES cells and can give rise to adult fates of all three germ layers with the caveat that they retain some molecular features in their chromatin reflecting the germ layer from which the somatic cells derived. Multipotent or bipotent progenitors and transit amplifying cells are precursors that have limited (if any) ability to self-replicate and can give rise to 2 or more adult fates. Committed progenitors are unipotent, have no self-replication capacity and give rise to only one adult cell type.
The cells from these types of stem cells/progenitors listed above and also mature cells can successfully engraft as long as there are sources, ideally cellular sources, of multiple matrix metallo-proteinases (MMPs), both secreted and membrane-associated ones. MMPs are produced by all cell types, both immature and mature cells, but they vary in which isoforms are produced and at what level of expression of particular MMPs. Representative secreted ones include MMP1, MMP2, MMP7 and MMP9. Representative membrane-associated ones include MMP14 and MMP15. Empirically it has been found that the highest production of secreted MMPs is by early lineage stage cells, stem cells and early progenitors. The biomaterials of the graft support the ability of both the epithelial and mesenchymal cells to produce these multiple forms of matrix metallo-proteinases (MMPs) that remodel capsules around organs or tissues along with remodeling the subjacent tissue to the capsules and enabling migration of cells by means of dissolution of multiple forms of extracellular matrix components.
The “rules” for engraftment are that there must be a source of MMPs, especially secreted isoforms, meaning that success occurs when
Matrix Metallo-proteinases (MMPs)
More generally, matrix metallo-proteinases (MMPS) are a large family of zinc-dependent proteinases involved in breakdown and modulation of extracellular matrix component and that are involved in implantation, invasion, angiogenesis, vascularization, and migration in normal and pathogenic processes. There are at least 24 isoforms that comprise matrixins, adamalysins, astacins, and serralysins. Their roles have been characterized in normal processes such as the implantation of the placenta as well as in pathogenic ones such as invasion and metastases of cancers. The studies described herein offer evidence for entirely new roles that contribute to engraftment, migration and integration of transplanted cells. Stem/progenitors, both epithelial ones and mesenchymal ones, express multiple MMP isoforms that are especially potent in these roles. Maturation of the cells results in muting of the expression of one or more of the potent stem/progenitor-cell-associated MMPs and so diminishing the invasion and migration processes. Adult cells also express MMPs, primarily ones that are membrane bound (MT-MMPs), and being ones shown involved in plasticity processes but not the wholesale engraftment and integration of cells into tissues. The net sum of this realization is that the graft biomaterials, backing and other conditions must be ones that optimize expression of the various MMPs, such as the secreted MMPs, enabling the grafting and migration processes to occur. Therefore, factors driving differentiation of the transplanted cells will, in parallel, mute the complex MMP responses. This realization means that factors to be avoided include serum, soluble signals that drive differentiation (e.g. certain growth factors, cytokines and hormones); extracellular matrix components that drive differentiation (e.g. collagens, adhesion molecules, highly sulfated glycosaminoglycans/proteoglycans); and mechanical forces contributing rigidity to the graft. In some embodiments, the one or more biomaterial layers comprise recombinant MMPs. In some embodiments, the one or more biomaterial layers comprise cells engineered to express MMPs.
The term “mesenchymal cells” refers to cells derived from the mesenchyme, including but not limited to mesenchymal stem cells which are multipotent stromal cells and various subpopulations of mature and progenitor mesenchymal cells of which there are at least two major categories:
Mature mesenchymal cells producing and surrounded by forms of extracellular matrix that comprise fibrillar collagens (e.g. type I, III, V) and associated matrix components and bound signals (e.g. growth factors/cytokines) that form a complex associated with cells that are typically linear (string-like) cell populations. Nonlimiting examples of such cells include stellate cells, tendon, stroma, and myofibroblasts.
Mature mesenchymal cells that produce and are surrounded by forms of extracellular matrix that comprise network collagens (e.g. type IV, type VI, VIII, X) and associated matrix molecules and bound signals (e.g. growth factors, cytokines) that together are associated with cells having more squamous or cuboidal or cobblestone morphologies. Non-limiting examples of such cells include endothelia and myoepithelial.
The precursors to these mesenchymal cell types include but are not limited to angioblasts which are multipotent and that can differentiate into lineages of endothelia (the late stages of which are fenestrated endothelia) or stellate cells (the late stages of which are myofibroblasts (stroma). The precursors also include mesenchymal stem cells (MSCs) which are multipotent cells and can differentiate into fibroblasts (stroma), osteoblasts (bone cells), chondrocytes (cartilage cells), myocytes (muscle cells) and adipocytes (fat cells).
The term “epithelial cell expansion” is correlated with the diameter of a colony of epithelial cells that typically form colonies with cuboidal or cobblestone morphologies and with estimates of growth being the composite of the diameters of the cells of the colony. By contrast, estimates of growth of mesenchymal cell colonies are correlated with the density of the colony, since the mesenchymal cells are more migratory and motile, and the colony density is a reflection of the net sum of cells that remain within the colony boundaries.
The term “epithelial cells” refers to cells derived from the epithelium, specialized cells that provide diverse functions for the tissue and/or the systemic needs of a host. They are recognized by their ability to migrate as precursors or immature cells; with maturation, they become stationary and form layers of squamous or cobblestone-like or columnar polarized cells with apical, basal and lateral sides, and that are bound to each other by an assortment of junctions (connexins, tight junctions, adherens). Their expansion potential is indicated by the diameter of a colony (not by its density). The mature epithelial cells provide diverse functions such as secretion of specialized products or of contributions to metabolism (hepatocytes, cholangiocytes), detoxification (hepatocytes), production of enzymes (acinar cells), production of endocrine factors (e.g. islets or other endocrine cells), electrical activity (neuronal cells), and absorption (intestinal cells).
As used herein, the term “supportive” is used to describe cells which are able to assist in the propagation of cells from another lineage or provide assistance to neighboring cells through the production of “paracrine signals”, factors active in their effects on neighboring cells in terms of survival, expansion, migration, differentiation, and maturation. For example, supportive mesenchymal cells may be defined by their ability to influence epithelial cells, optionally through the secretion of matrix metallo-proteinases (MMPs) and/or one or more other/or factors.
The term “lineage stage partners” refers herein to mesenchymal cells that are lineage stage appropriate for a given lineage stage of epithelia and can support engraftment of the epithelial cells. For the hepatic or biliary tree stem cells, these are comprised of angioblasts (CD117+, CD133+, VEGFr+, CD31-negative) and their immediate descendants, precursors to endothelia (CD133+, VEGFr+, CD31+) and precursors to stellate cells (CD146+, ICAM-1+, alpha-smooth muscle actin+(ASMA), vitamin A-negative). The paracrine signaling between the epithelia and the mesenchymal cells is also lineage-stage dependent, meaning that the specific paracrine signals and the levels of them are distinct in early, intermediate and late stage cells. They can be mimicked, in part, by use of mesenchymal stem cells (MSCs), ones derived from bone marrow or fat tissue. We refer to these collectively as early lineage stage mesenchymal cells (ELSMCs).
In some embodiments, the epithelial cells comprise biliary tree stem cells (BTSCs) and the mesenchymal cells comprise early-lineage-stage mesenchymal cells (ELSMCs). In some embodiments, the ELSMCs comprise angioblasts and their immediate descendants, precursors to endothelia cells, precursors to stellate cells, or combinations thereof. In some embodiments, the angioblasts express CD117, CD133, VEGFr, but do not express CD31. In some embodiments, the precursors to endothelia cells express CD133, VEGFr, CD31 and Van Willebrand Factor. In some embodiments, the precursors to stellate cells express CD146, ICAM-1, alpha-smooth muscle actin (ASMA) and are negative for vitamin A.
The term “biliary tree stem cells” (BTSCs) refers to stem cells found throughout the intrahepatic and extrahepatic biliary tree and located within peribiliary glands (PBGs), both extramural and intramural, as well as within the crypts of gallbladder villi and in Brunner's Glands. They have the ability to transition into committed hepatic and/or pancreatic progenitor cells. Thus far, at least 7 subpopulations of stem cell populations with overlapping traits and ranging from extremely primitive BTSCs to stem cell populations definable as hepatic or pancreatic stem cells have been identified in the intramural network, within the duct walls of the biliary tree.
Description of what is known for these stem cell subpopulations is given below and outlined in FIG. 22. The most primitive ones are found in both the extramural peribiliary glands—ones tethered to the surface of the bile ducts—and; the intramural peribiliary glands—ones found within the bile duct walls. The intramural peribiliary glands (PBGs) near to the fibromuscular layer in the centers of the bile duct walls can also be considered crypts (with parallels to intestinal crypts), niches in which are found the most primitive stem cell populations. The largest numbers of the PBGs within the biliary tree network are found within the hepato-pancreatic common duct and within the large intrahepatic bile ducts. No PBGs occur in the gallbladder, and instead the stem cell niches within the gallbladder are at the bottoms of the gall bladder villi and that contain intermediate to late stage stem cell populations that are precursors to hepatic stem cells.
In some embodiments, the patch graft comprises BTSCs positive for at least one marker selected from the group consisting of pluripotency genes, such as OCT4, Sox2, Sall4, Nanog, Klf5, Cdx2, and Bmi1, at least one marker selected from the group consisting of endodermal transcription factors, such as Sox9, Sox17, Pdx1, HNF4alpha and ONECUT2, at least one marker selected from the group consisting of surface markers of stem/progenitors, such as EpCAM, LGR5, NCAM, one or more isoforms of CD44, CXCR4, sodium iodide symporter (NIS), CD49 (integrin A6), CD29 (integrin B1), integrin B4. The BTSCs give rise to two stem cell subpopulations: hepatic stem cells (HpSCs) and pancreatic stem cells (PSCs), both having lower levels of expression of pluriotency genes, similar levels of expression of surface markers of stem/progenitors, and then markers defining HpSCs versus PSCs: for HpSCs, SOX9, SOX17, HNF4 alpha, ONECUT2, and constitutive expression of albumin; for PSCs, Pdx1, Ngn3, PTF1A, HNF1B, MUC6, PAX6, and constitutive expression of insulin. The BTSCs, HpSCs and PSCs are negative for markers of mature hepatic or mature pancreatic genes such as expression of P450s, aquaporin, enzymes involved in bile production, digestive enzymes produced by mature acinar cells and regulated expression of albumin or regulated expression of insulin and of islet hormones.
All of the BTSCs subpopulations express biomarkers that include endodermal transcription factors for both liver and pancreas (e.g. SOX9, SOX17, PDX1), pluripotency genes (e.g. OCT4, SOX2, NANOG, SALL4, KLF4/KLF5, BMI-1); one or more of the hyaluronan receptor isoforms (standard and/or variant isoforms) of CD44; CXCR4; and cytokeratins 8 and 18. Stem cell subpopulations within the biliary tree may include:
Intermediates in the lineage network refers to “transit amplifying cells”, cells that can be bipotent (or multipotent), have considerable proliferative potential but demonstrate little (if any) true self-replication, have low to moderate (or even no) pluripotency gene expression, and express traits indicating commitment to an hepatic (e.g. albumin, alpha-fetoprotein) or a pancreatic (e.g. insulin, MUC6) fate. These include hepatoblasts (the network giving rise to liver) and pancreatic ductal progenitors (the network giving rise to pancreas).
As used herein, the term “pancreatic ductal progenitors” refers to bipotent cells found within pancreatic ductal glands (PDGs) within the pancreas and giving rise to acinar cells and islets. In our studies, we find that they express SOX9, PDX1, HNF1f3, EpCAM, LGR5, ICAM-1, CD44, and subpopulations express NGN3 or MUC6.
As used herein, the term “hepatoblasts” refers to bipotent hepatic cells that can give rise to hepatocytic and cholangiocytic lineages and are found in or adjacent to canals of Hering or in PBGs within the large intrahepatic bile ducts. They have an extraordinary ability to proliferate (that is expand) but with less ability (if any) to self-replicate relative to that observed in hepatic stem cells. These cells are characterized by a biomarker profile that overlaps with but is distinct from hepatic stem cells. They express SOX9, low (or even negligible) levels of SOX17, high levels of LGR5, HNF4-alpha, and EpCAM, found primarily at the plasma membrane, and expressing P450A7, cytokeratin 7, secretin receptor, consistent and regulated expression of albumin in all hepatoblasts, high levels of alpha-fetoprotein (AFP), intercellular adhesion molecule (ICAM-1) but no expression of NCAM, and negligible or no expression of pluripotency genes (e.g. SALL4, KL4/KLF5, OCT4, SOX2, NANOG).) and no expression of mature hepatic parenchymal markers (e.g. P450s such as P4503A).
As used herein the term “committed progenitor” refers to a unipotent progenitor cell that gives rise to a single cell type, e.g. a committed hepatocytic progenitor cell. In some embodiments, they do not express pluripotency genes. The committed hepatocytic progenitors are recognized by expression of albumin, AFP, glycogen, ICAM-1, various enzymes involved with glycogen synthesis, and the gap junction gene, connexin 28. These give rise to hepatocytes. A committed biliary (or cholangiocytic) progenitor gives rise to cholangiocytes and is recognized by expression of EpCAM, cytokeratins 7 and 19, aquaporins, CFTR (Cystic Fibrosis Transmembrane Conductance Regulator), and membrane pumps associated with production of bile. In some embodiments, a committed islet progenitor expresses insulin, glucagon, and other islet hormones albeit at low levels; with maturation the expression levels of the islet hormones increase but with particular cells expressing preferentially certain hormones.
As used herein, the term “aggregates” refer to a plurality of cells that are amassed together. The aggregates may vary in both size and shape or may be substantially uniform in size and/or shape. The cell aggregates used herein can be of various shapes, such as, for example, a sphere, a cylinder (preferably with equal height and diameter), or rod-like among others. Although other shaped aggregates may be used, in one embodiment of the disclosure, it is generally preferable that the cell aggregates be spherical or cylindrical. The term “non-aggregated” refers to individual, or single-celled, stem and/or progenitor cells. In some embodiments, the compositions provided herein can comprise substantially aggregated cells, substantially non-aggregated cells, or a mixture thereof.
The term “organoid” refers herein to a particular cellular aggregate of donor epithelial cells with mesenchymal cells that is self-assembled by simple panning methods described herein. Organoids can be obtained from mixing of early stages of epithelia (ES cells, iPS cells, determined stem cells, transit amplifying cells, progenitors) with early stages of mesenchymal cells (angioblasts, precursors to endothelia, precursors to stellate cells).
Mixtures of adult epithelial cells with mature mesenchymal cells and chimeric mixtures of mature epithelial cells with early lineage stage mesenchymal cells (ELSMCs) do not usually generate organoids but can be used as mixtures of the cells in suspension in the graft biomaterials. If mature epithelia (e.g. hepatocytes, cholangiocytes, islets, acinar cells, enterocytes, etc.) are partnered with mature mesenchymal cells (e.g., endothelia, stellate cells, stromal cells, myofibroblasts), the mixtures will not result in successful grafts but rather in ones that persist at the surface of the organs or tissues. It is hypothesized that this is because they express plasma-membrane-associated MMPs but minimal levels of secreted MMPs. If chimeric mixtures are used (e.g. mature hepatocytes with angioblasts), then engraftment does occur, since there is a source of secreted MMPs that enable engraftment and migration of the cells.
Protocols for Establishing Organoids.
According to one embodiment disclosed herein, organoids, of biliary tree stem cells (BTSCs) and early lineage stage mesenchymal cells (ELMCs) proved the most successful method of incorporating cells in the grafts. It is disclosed herein that BTSCs and ELMCs can self-select into organoids by panning to eliminate the mature stellate/stromal cells, and this a proved more efficient and effective in establishing lineage-stage appropriate epithelial-mesenchymal partners for the grafts. In another aspect, this disclosure provides a methods of forming organoids by culturing a first type of cells with a second type of cells, wherein the second type of cells is a stage appropriate lineage partner of the first type of cells, removing mature cells that attach to the culture dish by panning, and recovering the self-assembled organoids from the suspension of the culture. The first type of cells may be epithelial stem cells or committed epithelial cells. The second type of cells may be cells of the mesenchymal lineage, mesenchymal stem cells, or early lineage stage mesenchymal cells.
In some embodiments, the mesenchymal cells are supportive mesenchymal cells. In some embodiments, the organoids are formed after culturing on low attachment dishes and under serum-free, wholly defined conditions tailored to the lineage stage(s) of the aggregated cells in suspension.
In some embodiments, the mixture of epithelial cells and mesenchymal cells is produced by depleting cell suspensions of mature mesenchymal cells, optionally, by repeated panning procedures to remove cells that attach within from about 15 minutes to about 30 minutes on tissue culture dishes or surfaces at 37° C. As used herein, the term “produced”, its equivalents (e.g. producing, produce, etc.) are used interchangeable with “generated” or “formed” and their equivalents when referring to the method steps that bring the organoid of the instant disclosure into existence. Multiple rounds (e.g. 4-5) of such a panning process enriches the cell suspension for the earlier lineage stage cells. Then the cell suspension is transferred to low attachment dishes and again in serum-free medium, one designed for the early lineage stage cells, and left for some hours or even overnight in an incubator at 37° C. In some embodiments, a culturing of the remaining cell suspensions is performed on low-attachment dishes and in a serum-free medium until a plurality of organoids is formed by self-assembly of epithelial cells and mesenchymal cells. In some embodiments, the serum-free medium comprises a basal medium (with no copper, low calcium (0.3 mM), 1 nM selenium, 0.1% bovine serum albumin (purified, fatty-acid-free; fraction V), 4.5 mM nicotinamide, 0.1 nM zinc sulfate heptahydrate, 5 μg/ml transferrin/Fe, 5 μg/ml insulin, and a mixture of purified free fatty acids that are presented complexed with fatty acid free highly purified albumin. In some embodiments, in which the serum-free medium further comprises 10 μg/ml high density lipoprotein. Additional, serum-free medium compositions are described elsewhere herein.
In some embodiments, the plurality of organoids comprises BTSCs positive for:
In some embodiments, the culturing of the remaining cell suspensions is performed on low-attachment dishes and in a serum-free medium until a plurality of organoids is formed by self-assembly of cells remaining in the cell suspension. In some embodiments, the plurality of organoids is formed after about 2 hours, after about 4 hours, after about 6 hours, after about 8 hours, after about 10 hours, after about 12 hours, after about 14 hours, after about 16 hours, after about 18 hours, after about 20 hours, after about 22 hours, or after about 24 hours.
Cell Culture Conditions.
The term “culture” or “cell culture” means the maintenance of cells in an artificial, in vitro environment. A “cell culture system” is used herein to refer to culture conditions in which a population of cells may be grown ex vivo (outside of the body).
The term “basal media” refers to buffers used for cell culture and are comprised of amino acids, sugars, lipids, vitamins, minerals, salts, trace elements, and various nutrients in compositions that mimic the chemical constituents of interstitial fluid around cells.
“Culture medium” is used herein to refer to a nutrient solution for the culturing, growth, or proliferation of cells. Culture medium may be characterized by functional properties such as, but not limited to, the ability to maintain cells in a particular state (e.g. a pluripotent state, a proliferative state, quiescent state, etc.), to mature cells—in some instances, specifically, to promote the differentiation of progenitor cells into cells of a particular lineage. Non-limiting examples of culture media are serum supplemented media (SSM) being any basal medium supplemented with serum at levels that are typically about 10% to about 20%. The serum can be autologous (the same species as the cells) or, more commonly, serum from animals that are routinely slaughtered for commercial purposes (e.g. chickens, cows, pigs, etc.).
For the grafting technologies, conditions are used to maintain the cells as stem cells or early progenitor cells; there is an avoidance of serum or any of the typical supplements that might drive the cells down a differentiation pathway and towards a mature cell fate. In addition to the customary basal media, various nutritional supplements, lipids (mixture of free fatty acids complexed with albumin and carrier molecules such as high density lipoprotein). Only two hormone/growth factors are added: insulin needed for carbohydrate metabolism, and transferrin, needed as a Fe carrier for the polymerases.
“Kubota's Medium” as used herein refers to any basal medium containing no copper, low calcium (<0.5 mM), selenium, zinc, insulin, transferrin/Fe, a mix of free fatty acids bound to purified albumin and, optionally, also high density lipoprotein (HDL). In some embodiments, Kubota's Medium comprises any basal medium (e.g., RPMI 1640 or DMEM-F12) with no copper, low calcium (e.g., 0.3 mM), ˜10−9 M selenium, ˜0.1% bovine serum albumin or human serum albumin (highly purified and fatty acid free), ˜4.5 mM nicotinamide, ˜0.1 nM zinc sulfate heptahydrate, ˜10−8 M hydrocortisone (optional component used for hepatic but not pancreatic precursors), ˜5 μg/ml transferrin/Fe, ˜5 μg/ml insulin, ˜10 μg/ml high density lipoprotein, and a mixture of purified free fatty acids that are added after binding them to purified serum albumin. The free fatty acid mixture consists of ˜100 mM each of palmitic acid, palmitoleic acid, oleic acid, linoleic acid, linolenic acid, and stearic acid. Non-limiting, exemplary methods for the preparation of this media have been published elsewhere, e.g., Kubota H, Reid L M, Proc. Nat. Acad. Scien. (USA) 2000; 97:12132-12137, the disclosure of which is incorporated herein in its entirety by reference.
Non-limiting examples of defined media to differentiate include the hormonally-defined media (HDM) used for differentiation of endodermal stem cells to adult fates. Supplements can be added to Kubota's Medium to generate a serum-free, hormonally defined medium (HDM) that will facilitate differentiation of the normal hepatic or biliary tree stem cells to specific adult fates. Non-limiting examples of defined media to differentiate endodermal stem cells to adult fates include ones supplemented with calcium to achieve at or above 0.6 mM concentration, 1 nM tri-iodothyronine (T3), 10−12 M copper, 10 nM of hydrocortisone and 20 ng/ml of basic fibroblast growth factor (bFGF). The medium conditions over and above these needed to selectively yield hepatocytes (HDM-H) versus cholangiocytes (HDM-C) versus pancreatic islets (HDM-P) are:
The HDM provided herein can be supplements with additional growth factors including, but not limited to, Wnt ligands, R-spondins, epidermal growth factors (EGFs), fibroblast growth factors (FGFs), hepatocyte growth factors (HGFs), insulin-like growth factors (IGFs), transforming growth factors (TGFs), nerve growth factors (NGFs), neurotrophic factors, various interleukins, leukemia inhibitory factors (LIFs), vascular endothelial cell growth factors (VEGFs), platelet-derived growth factors (PDGFs), stem cell factors (SCFs), colony stimulating factors (CSFs), GM-CSFs, erythropoietin, thrombopoietin, heparin binding growth factors, IGF binding proteins, and/or to placental growth factors.
The HDM provided herein can be supplemented with cytokines including, but not limited to interleukins, lymphokines, monokines, colony stimulating factors, chemokines, interferons and tumor necrosis factor (TNF).
In some embodiments the medium may be a “seeding medium” used to present or introduce cells into a given environment. In other embodiments, the medium may be a “differentiation medium” used to facilitate the differentiation of cells. Such media are comprised of a “basal medium”, a mixture of nutrients, minerals, amino acids, sugars, lipids, and trace elements and supplemented either with serum (serum supplemented media or SSM) or with a defined mix of purified hormones, growth factors and nutrients, a hormonally defined medium (HDM), and used for survival, maintenance or differentiation of cells ex vivo. As used herein, “HDM-H” is an HDM used in combination with substrata of type IV collagen and laminin to drive the differentiation of endodermal stem/progenitors to mature hepatocytes. HDM-C is an HDM used with substrata of type I collagen and fibronectin to drive the cells to mature cholangiocytes.
As used herein, the HDM can also be used with substrata of purified extracellular matrix components or extracts enriched in extracellular matrix, matrix substrata that facilitate differentiation to specific fates. An example is the use of “HDM-H” in combination with substrata of purified type IV collagen and laminin to drive the differentiation of endodermal stem/progenitors to mature hepatocytes. HDM-C is an HDM that can be used with substrata of type I collagen and fibronectin to drive the cells to mature cholangiocytes.
The HDM can be used also in combination with extracellular matrix extracts resulting from decellularization processes such as those used to isolate biomatrix scaffold. Further details on HDM can be found in WO 2012/003463, U.S. Pat. Nos. 9,102,913, 8,802,081 and WO 2012003450, incorporated herein.
Basal media are buffers used for cell culture and are comprised of amino acids, sugars, lipids, vitamins, minerals, salts, trace elements, and various nutrients in compositions that mimic the chemical constituents of interstitial fluid around cells. In addition, cell culture media are usually comprised of basal media supplemented with a small percentage (typically 2-10%) serum. For the grafting technologies, conditions are used to maintain the cells as stem cells or early progenitor cells and so there is an avoidance of serum or any of the typical supplements that might drive the cells down a differentiation pathway and towards a mature cell fate. In addition to the customary basal media, various nutritional supplements, lipids (mixture of free fatty acids complexed with albumin and carrier molecules such as high density lipoprotein). Only two hormone/growth factors are added: insulin needed for carbohydrate metabolism, and transferrin, needed as a Fe carrier for the polymerases. Kubota's medium, a serum-free medium designed for endodermal stem/progenitors is comprised of a basal medium supplemented with zinc, selenium, insulin, transferrin, lipids but no cytokines or growth factors. Other growth factors and cytokines and especially serum are to be avoided since they will induce differentiation of the donor cells and, thereby, minimize the production of MMPs, required for the engraftment and migration processes.
In some embodiments, the conditions of these patch grafts are, therefore, counter to the routine use of media supplemented with a small percentage (typically 2-10%) serum. Serum has long been added to provide requisite signaling molecules (hormones, growth factors, cytokines) needed to drive a biological process (e.g. proliferation, differentiation), but in these strategies for patch grafts serum is to be avoided to enable engraftment to occur. In some embodiments, serum is not included to avoid differentiation of the cells and/or avoid inactivating or muting secreted forms of MMPs.
In some embodiments, the serum-free medium comprises a basal medium (with no copper, low calcium (0.3 mM), 1 nM selenium, 0.1% bovine serum albumin (purified, fatty-acid-free; fraction V), 4.5 mM nicotinamide, 0.1 nM zinc sulfate heptahydrate, 5 μg/ml transferrin/Fe, 5 μg/ml insulin, and a mixture of purified free fatty acids that are presented complexed with fatty acid free highly purified albumin. In some embodiments, the serum-free medium further comprises 10 μg/ml high density lipoprotein.
Methods of Using the Patch Graft Compositions
In one aspect, the present disclosure relates method of engrafting cells into a solid organ of a subject in need thereof, comprising:
In some embodiments, demonstrating comprises measuring a level of a secretion from the solid organ, or a metabolic effect of the solid organ, in a biological sample obtained from the subject to demonstrate that at least a portion of said epithelial cells have engrafted among the cells of the solid organ.
In another aspect, the present disclosure relates to a method of engrafting cells into a solid organ of a subject in need thereof, comprising:
As used herein, the term “engraftment” refers to incorporating cells into a tissue or organ. Alternatively, the terms grafting, transplantation, engraftation, ingraftation, or ingraftment may be used interchangeably with engraftment.
The term “migrate” refers to cellular movement from site to another within a tissue or organ.
The term “integration” refers to that the cells combine with the cells of the host organ or tissue and become a part of the organ or tissue, but do not fuse with host cells.
In some embodiments, at least a portion of the mixture of epithelial cells and mesenchymal cells migrates over the substantial width of the solid organ and distributes throughout the solid organ. In some embodiments, the patch graft further comprises a backing that promotes a migration of at least a portion of the mixture of epithelial cells and mesenchymal cells towards the solid organ.
In some embodiments, the epithelial cells are early lineage stage epithelia cells (ELSEs), and the mesenchymal cells are early lineage stage mesenchymal cells (ELSMCs).
In some embodiments, the ELSMCs comprises angioblasts, precursors of endothelia, stellate cells, or a combination thereof. In some embodiments, the ELSEs and/or the ELSMCs are derived from embryonic stem (ES) cells or from induced pluripotent stem cells (iPS). In some embodiments, the epithelial cells are mature and the mesenchymal cells are ELSMCs. In some embodiments, at least one of the two categories of donor cells may be a stem/progenitor enabling capable of the production of MMPs. In a preferred embodiment, the MMPs are secreted isoforms of MMPs.
The terms “tissue” is used herein to refer to tissue of a living or deceased organism or any tissue derived from or designed to mimic a living or deceased organism. The tissue may be healthy, diseased, injured by trauma, damaged and/or have genetic mutations. The term “natural tissue” or “biological tissue” and variations thereof as used herein refer to the biological tissue as it exists in its natural or in a state unmodified from when it was derived from an organism. A “micro-organ” refers to a segment of “bioengineered tissue” that mimics “natural tissue.”
The biological tissue may include any single tissue (e.g., a collection of cells that may be interconnected) or a group of tissues making up an organ or part or region of the body of an organism. The tissue may comprise a homogeneous cellular material or it may be a composite structure such as that found in regions of the body including the thorax which for instance can include lung tissue, skeletal tissue, and/or muscle tissue. Exemplary tissues include, but are not limited to those derived from liver, pancreas, biliary tree, lung, intestine, thyroid, thymus, bladder, kidneys, prostate, uterus, breast, skin, brain, spinal cord, blood vessels (e.g. aorta, iliac vein,), heart, muscle, including any combination thereof.
In some embodiments, the mixture of stem/progenitor cells and mesenchymal cells migrates over much of or if not the entire width of the organ and distributes uniformly throughout the organ. In some embodiments, the solid organ is an endodermal organ. In some embodiments, the solid organ is an endodermal organ comprising liver, pancreas, intestine, lung, bile duct, thymus, thyroid, parathyroid and the urogenital sinus region of the prostate and vagina. In some embodiments, the endodermal organ comprises liver, and engraftment involves a remodeling of Glisson's Capsules.
As used herein, the term “remodeling” refers to histological changes in tissue initiated by the engraftment and caused, in part, by the secreted MMPs. For example, in some embodiments, the engraftment processes disclosed herein results in remodeling of the Glisson Capsule and of the host tissue near to the graft. The remodeling of tissue is transient and reverts to normal histology after the cells are fully integrated into the host organ/tissue. Remodeling can be visualized by multiple stains such as trichrome staining that identifies extracellular matrix components. These are complemented by staining with H&E.
In some embodiments, the present disclosure provides methods which further gives rise to a combination of (i) engrafted epithelial cells and mesenchymal cells and (ii) host cells. In some embodiments, the methods of the present disclosure gives rise to functional hepatic parenchymal cells. In some embodiments, the parenchymal cells comprise hepatocytes and cholangiocytes.
In some embodiments, the patch includes a backing positioned over the hydrogel containing the mixture of stem/progenitor cells and mesenchymal cells. In some embodiments, the backing is used to tether the hydrogel layer to the target organ or site. In some embodiments, the endodermal organ comprises pancreas, and engraftment involves a remodeling of pancreatic capsules and pancreatic tissue near to the graft site. In some embodiments, the methods of the present disclosure gives rise to functional pancreatic cells. In some embodiments, the functional pancreatic cells comprise acinar cells and islets.
In some embodiments, demonstrating comprises measuring a parameter or a change in same, which indicates a physiological effect in the subject resulting from the migrated cells.
In another aspect, the present disclosure relates to a method of introducing, restoring, increasing, or improving functionality of a diseased, impaired, or malfunctioning solid organ of a subject, comprising contacting the diseased, impaired, or malfunctioning solid organ with a patch graft comprising a mixture of epithelial cells and mesenchymal cells under conditions that promote engraftment of the epithelial cells and mesenchymal cells; demonstrating an introduction, restoration, increase, or improvement of a functionality in the diseased, impaired, or malfunctioning solid organ.
In some embodiments, a portion of the mixture of stem/progenitor cells and mesenchymal cells exists in combination with the cells of the target organ. In some embodiments, the patch graft used in the method of restoring organ function includes a coating that inhibits adhesion of the patch graft to organs and tissues in the vicinity of the patch graft.
In some embodiments, demonstrating comprises measuring in a biological sample obtained from the subject a level of a secretion or metabolic product or effect. In some embodiments, the methods of the present disclosure further comprises demonstrating that a least a portion of the mixture of epithelial cells and mesenchymal cells has distributed among the cells of the host organ. In some embodiments, an exposed surface of the patch graft includes a coating that inhibits adhesion of the patch graft to organs and tissues in the vicinity of the patch graft. In some embodiments, the solid organ comprises an endodermal organ. In some embodiments, the endodermal organ comprises liver, pancreas, intestine, lung, bile duct, thymus, thyroid, parathyroid or the regions from the urogenital sinus of the prostate or vagina. In some embodiments, the solid organ comprises a pancreas and in which an increased level of the secretion of at least one of insulin, c-peptide glucagon, somatostatin, or pancreatic polypeptide is measured.
In some embodiments the solid organ comprises a pancreas and in which a reduced blood sugar level is measured. In some embodiments, the solid organ comprises a pancreas and in which increased glucose tolerance is demonstrated. In some embodiments, the solid organ comprises a pancreas and in which increased levels of a digestive enzyme or bicarbonate fluid is demonstrated. In some embodiments, the digestive enzyme comprises amylase, lipase, peptidase, ribonuclease, deoxyribonuclease, gelatinase, or elastase. In some embodiments, the solid organ comprises a pancreas and in which increased levels of a product from a digestive enzyme secreted by the pancreas is measured. In some embodiments, the digestive enzyme comprises amylase, lipase, peptidase, ribonuclease, deoxyribonuclease, gelatinase, or elastase. In some embodiments, the solid organ comprises a pancreas and in which improved digestion is demonstrated.
In some embodiments, the solid organ comprises liver, and in which a secretion comprises urea, bile acids, phospholipids, lipoproteins, bilirubin, bicarbonate-rich fluids, blood-clotting factors, or combinations thereof.
In some embodiments, the solid organ comprises liver, and in which a metabolic effect is a reduced level of one or more of cholesterol, blood sugar, alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, albumin, ammonia, gamma-glutamyltransferase, or L-lactate dehydrogenase. In some embodiments, a metabolic effect is a decrease in levels of tyrosine or alpha-fetoprotein.
In another aspect, the present disclosure relates to a method of treating a subject diagnosed with a pathological condition attributable at least in part to having a diseased, impaired, or malfunctioning solid organ, comprising
In some embodiments, demonstrating comprises measuring in a biological sample obtained from the subject a level of a secretion or a metabolic product or effect. In some embodiments, the migration and distribution steps lead to an alleviation of the disease, impairment, or malfunction.
In some embodiments, the solid organ is an endodermal organ. In some embodiments, the endodermal organ comprises liver, pancreas, intestine, lung, bile duct, thymus, thyroid, parathyroid, and the urogenital sinus regions of the prostate or vagina. In some embodiments, the endodermal organ is pancreas and in which the subject suffers from diabetes. In some embodiments, increased levels of at least one of insulin, c-peptide, glucagon, somatostatin, or pancreatic polypeptide is measured. In some embodiments, reduced blood sugar levels are demonstrated. In some embodiments, increased glucose tolerance is demonstrated.
As used herein, the term “subject” and “patient” are used interchangeably and are intended to mean any animal. In some embodiments, the subject may be a mammal. In some embodiments, the mammal is bovine, equine, porcine, canine, feline, simian, murine, human, or rat. In some embodiments, the subject is a human. In some embodiments, the subject comprises a mammal. In some embodiments, the mammal is human.
As used herein, “treating” or “treatment” of a disease in a subject refers to (1) preventing the symptoms or disease from occurring in a subject that is predisposed or does not yet display symptoms of the disease; (2) inhibiting the disease or arresting its development; or (3) ameliorating or causing regression of the disease or the symptoms of the disease. As understood in the art, “treatment” is an approach for obtaining beneficial or desired results, including clinical results. For the purposes of the present technology, beneficial or desired results can include one or more, but are not limited to, alleviation or amelioration of one or more symptoms, diminishment of extent of a condition (including a disease), stabilized (i.e., not worsening) state of a condition (including disease), delay or slowing of condition (including disease), progression, amelioration or palliation of the condition (including disease), states and remission (whether partial or total), whether detectable or undetectable.
Also provided herein are methods of treating a subject with a liver disease or disorder, the methods comprising, consisting of, or consisting essentially contacting the subject's liver with a patch graft comprising multiple layers including, at least: a first layer of hydrogel comprising epithelial cells and mesenchymal cells; a second layer of hydrogel; a third layer comprising a biocompatible, biodegradable backing; and optionally a fourth layer of hydrogel. In some embodiments of the methods, the liver disease or disorder is liver fibrosis, liver cirrhosis, hemochromatosis, liver cancer, biliary atresia, nonalcoholic fatty liver disease, hepatitis, viral hepatitis, autoimmune hepatitis, fascioliasis, alcoholic liver disease, alpha 1-antitrypsin deficiency, glycogen storage disease type II, transthyretin-related hereditary amyloidoisis, Gilbert's syndrome, primary biliary cirrhosis, primary sclerosing cholangitis, Budd-Chiari syndrome, liver trauma, or Wilson disease.
In other aspects, provided herein are methods of treating a subject with a disease or disorder of the pancreas, the methods comprising, consisting of, or consisting essentially of contacting the subject's pancreas with a patch graft comprising multiple layers including, at least: a first layer of hydrogel comprising epithelial cells and mesenchymal cells; a second layer of hydrogel; a third layer comprising a biocompatible, biodegradable backing; and optionally a fourth layer of hydrogel. In some embodiments of the methods, the disease or disorder of the pancreas is diabetes mellitus, exocrine pancreatic insufficiency, pancreatitis, pancreatic cancer, sphincter of Oddi dysfunction, cystic fibrosis, pancreas divisum, annular pancreas, pancreatic trauma, or hemo succus pancreaticus.
In other aspects, provided herein are methods of treating a subject with a gastrointestinal disease or disorder, the method comprising, consisting of, or consisting essentially of contacting one or more of the subject's intestines with a patch graft comprising multiple layers including, at least: a first layer of hydrogel comprising epithelial cells and mesenchymal cells; a second layer of hydrogel; a third layer comprising a biocompatible, biodegradable backing; and optionally a fourth layer of hydrogel. In some embodiments, the gastrointestinal disease or disorder is gastroenteritis, gastrointestinal cancer, ileitis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, irritable bowel syndrome, peptic ulcer disease, celiac disease, fibrosis, angiodysplasia, Hirschsprung's disease, pseudomembranous colitis, or gastrointestinal trauma.
Modes of Carrying Out the Disclosure
The patch graft composition provided herein is directed to direct grafting of cells into the solid organ. The method is safe, avoids emboli and ectopic cell distribution, and optimizes cell number engraftment and distribution into and throughout the tissue.
Aspects of the disclosure relate to compositions and methods for engrafting cells into an organ. Efforts to transplant cells from solid organs into internal organs typically made use either of direct injection or by delivering cells via a vascular route. Lanzoni, G. et al. Stem Cells 31, 2047-2060 (2013). These methods of transplantation result in small numbers of cells being transplanted, and in risks of emboli that can be life threatening. Transplantation is improved if the cells are delivered by “injection grafting” in which the cells are suspended in hyaluronans and then co-injected with a trigger (PEGDA) that causes the hyaluronan to gel in situ. Injection grafting methodologies provide a strategy for localizing cells to a specific site, albeit in small numbers, typically 106-107 cells per injection site. This strategy eliminates or minimizes ectopic cellular distribution and optimizes the integration of the cells in the site. However, if mature functional cells are used, they may be highly immunogenic, necessitating long-term immunosuppression.
To address some of these hurdles and concerns, the challenges are overcome by “patch grafting” strategies described herein. In some embodiments, “bandaid-like” grafts are tethered surgically to the surface of an organ or tissue; the conditions of the graft are such that the cells engraft fully into the site, migrate throughout the organ/tissue, and then mature into relevant adult cell types. The potential for transplantation of large numbers of cells (e.g. >108 cells) is dictated entirely by the size of the patch, the number of cells within the graft, and the source of multiple forms of MMPs, ideally cellular sources of the MMPs. Moreover, in some embodiments the use of organoids facilitates the ability to stockpile donor cells given the ease by which the organoids can be cryopreserved under wholly defined, serum-free conditions.
The patch graft composition provided herein is directed to grafting of cells into the solid organ. The method is safe, avoids emboli and ectopic cell distribution, and optimizes cell number engraftment and distribution into and throughout the tissue.
The present disclosure provides a novel method of transplantation of cells into solid organs or tissues, including internal organs, and demonstrated herein with studies on liver. The method is safe, avoids emboli and ectopic cell distribution, and optimizes rapid engraftment and distribution of large numbers of cells throughout the host tissue. Within a week, there was engraftment of all of the donor cells (≥108th in pigs; ≥106th in mice) throughout significant portions of the liver followed by migration and integration of cells at significant distances from graft sites. Maturation to mature cell types occurred throughout regions of engrafted cells by 2 weeks, followed by restoration of Glisson's capsules and of tissue histology and architecture by 3 weeks. Importantly, patch grafts were able to rescue animals from a disease state, demonstrated here with patch grafts in mice models of type I tyrosinemia.
The strategies for transplantation of cells onto solid organs disclosed herein are radically different compared to those known in the art. The methods of transplantation of cells onto solid organs disclosed herein may in some embodiments involve placing grafts directly onto the surface of the target site/organ and using graft biomaterials designed to enable donor cells to engraft and migrate into the tissue. This parallels strategies of cell therapies for skin, but requires modifications for internal tissues, such as abdominal internal organs, to account for mechanical effects, abrasion or compression of organs near to each other, and with recognition of the unique fluid microenvironments around specific organs.
The inventors of the present disclosure demonstrated herein is some exemplary embodiments the strategy with grafts of biliary tree stem cells (BTSCs), which are determined endodermal stem/progenitors that are precursors to both liver and pancreas. In some embodiments, the BTSCs were transplanted by patch grafting onto the surface of the liver. In some embodiments, the BTSCs were transplanted by patch grafting onto the surface of the pancreas.
The animal models used in some embodiments of the present disclosure comprise mice (Mus musculus) and swine (Sus scrofa domestic) transplanted with donor cells with a transgene coupled to a fluoroprobe, green fluorescent protein (GFP), linked to a histone (H2-B) locus, thus providing a nuclear biomarker. In some embodiments, the methods of the present disclosure used a murine model, NOD-Rag1−/−IL2RgammaC-null (NRG), that is immunocompromised and also genetically (using Crispr/Cas9 technology) made deficient in fumaryl aceto-acetate hydrolase (FAH), a key enzyme in the tyrosine metabolic pathway. Its loss results in type I tyrosinemia. Mice and pigs are major animal species in translational research and are used increasingly as alternatives to non-human primates in preclinical studies.
The inventors of the present disclosure have previously reported that engraftment required co-transplantation of epithelial cells with their lineage-stage-appropriate mesenchymal cell partners. Turner, R., et al. Successful Transplantation of Human Hepatic Stem Cells With Restricted Localization to Liver Using Hyaluronan Grafts. Hepatology 57, 775-784 (2013). For hepatic and biliary tree stem cells, these mesenchymal cells are comprised of angioblasts (CD117+, CD133+, VEGFr+, CD31-negative) and their immediate descendants, precursors to endothelia (CD133+, VEGFr+, CD31+, Van Willebrand Factor+) and precursors to stellate cells (CD146+, ICAM-1+, alpha-smooth muscle actin+(ASMA), vitamin A-negative). We refer to these collectively as early-lineage-stage-mesenchymal-cells (ELSMCs).
In some embodiments, matching epithelial and mesenchymal cell partners may be isolated by using multiparametric flow cytometry to determine the ratios of lineage stage partners of epithelial and mesenchymal cells in cell suspensions and then used those ratios within grafts using immuno-selected cells. In some preferable embodiments, it may be more efficient to deplete cell suspensions of mature mesenchymal cells by repeated panning procedures (see methods) followed by culturing the remaining cell suspensions on low attachment dishes and in serum-free Kubota's Medium for ˜6-8 hours. Organoids self-assembled with each aggregate containing approximately 50-100 cells. Marker analyses indicated partnering of BTSCs with ELSMCs (FIGS. 1A-1D). As summarized in FIG. 1A, the BTSCs/ELMCs were used immediately or were cryopreserved under defined conditions and thawed as needed for grafts. Organoids of BTSCs/ELSMCs were characterized using immunofluorescence (IF), qRT-PCR and RNA-seq and shown to express classic traits of BTSCs (FIGS. 1A-1D) and of ELSMCs (data not shown). BTSCs in the organoids expressed low levels of pluripotency genes (e.g. OCT4, SOX2) and endodermal stem cell genes (e.g. EpCAM, SOX 9, SOX17, PDX1, LGR5, CXCR4, MAFA, NGN3 and NIS), but did not express mature hepatic or pancreatic genes. Representative qRT-PCR assays confirmed these findings from cells prior to transplantation (FIG. 1D). Immunohistological (IHC) assays indicated that more primitive cells (e.g. ones expressing the highest levels of pluripotency genes) were distributed to the interiors of the organoids and later maturational lineage stages were at the perimeters (FIG. 1C). The results shown in FIGS. 1A-1D are exemplary embodiments for formation of porcine organoids. In some embodiments, organoids may similarly be formed from any mammal. In some embodiments, the organoids are formed from mice, or preferably from human cells.
Patch grafts were secured to the liver surface by sutures or surgical glue as shown in FIGS. 2A-2E. The graft composition involved the use of thiol-modified hyaluronans (HA) hydrogels prepared with precise concentrations of HA and PEGDA to achieve defined levels of stiffness as determined rheologically and expressed as the dynamic shear modulus (G*) (FIG. 2C). Donor cells were embedded into a soft HA layer (less than 100 Pa) and placed against the liver surface, covered with the backing impregnated with more rigid HA (˜700 Pa), and the graft sutured or glued to the liver surface at the corners of the silk patch. The soft hydrogels into which donor cells were placed maintained stemness traits essential for production of matrix metallo-proteinases (MMPs) needed for engraftment. The silk backing impregnated with HA served as a barrier to migration in directions other than towards the target tissue. An HA hydrogel with a rigidity of ˜200-300 Pa enabling painting or coating the outside surface of grafts, was used at the time of the surgery and served to minimize adhesions with surrounding tissues.
The only variant of patch grafting attempted and then abandoned was after sharp surgical removal of the capsule. Hemorrhaging was excessive, obviating future use in hosts with altered hemostasis associated with hepatic failure or even in normal hosts given the adverse influences of serum on donor cells. Without such efforts to alter the organ capsules, patch grafts proved facile for surgical procedures.
A number of backings were tested with a focus on ones already used clinically in abdominal surgeries as shown in Table 1 and 2 below. Only the SERI Silk Surgical Scaffolds (Sofregen, Medford, Mass.), did not cause problems. The problems of other backings (Table 1, FIGS. 12A-12E) included fragility (e.g. Seprafilm, Reglyde); induction of necrosis or fibrosis and significant levels of adhesions (e.g. Surgisis, Vetrix); and severe adhesion formations with a filamentous sponge version made from reconstituted silk protein or any of the backings supplemented with carboxymethylcellulose (“belly jelly”) to the abdomen (FIGS. 12A-12E).
| TABLE 1 |
| Surgical Approaches of Applying Patch Grafting or Injection Grafting onto Pig Livers |
| Direct injection under the | ||||
| Details for | Patch graft directly on | Direct injection into liver | Periductal injection at | capsule around the bite |
| treatment | liver surface | parenchyma | ductal bifurcation | ducts (e.g. common bite duct) |
| Animal in group | N = 28 | N = 3 | N = 3 | N = 3 |
| Cells per grafts* | −5 × 107 to 108 | 0.5-1 × 107 per ml | 0.5-2 × 107 per 0.5 ml | 0.5-2 × 107 per 0.5 ml |
| approaches by multiple | ||||
| infections | ||||
| Outcomes | Good | Good | Good, but limited due to | Bad |
| (MELD Score**) | effects of swelling of the | |||
| hydrogel | ||||
| Limitations/ | Safe for normal animals | Cell numbers (dose) per | Cell numbers (dose) per | Restated to occlusion of ducts |
| contraindications | and for ones with liver | injection is limited***, | injection is limited due to | and subsequent cholestasis |
| injuroesl; efficient for | multiple injections might | limitation of proper | symptoms. | |
| delivery of a large number | address the problem. | injection sites at which | ||
| of donor cells; the | However, these would | swelling will not cause | ||
| components of patch | cause higher risk for | problems. Multiple | ||
| grafts can be adapted as | bleeding. | injections do not | ||
| needed for | compensate. | |||
| Indications for | Recommended for all | Potential to be used for | Recommended for left | Not recommended |
| Application | stages of liver | inborn errors of | lobe grafts | |
| dysfunctions | metabolism and early | |||
| stage cirrhosis | ||||
| *Cells per grafts in the study is showed as cell numbers per ml cross-linked HA | ||||
| **MELD Score (Model For End-Stage Liver Disease): Creatinine Bilirubin, INR, Sodium | ||||
| ***In this study, for 10 kg BW healthy piglet recipient, no more than 0.5 ml per injection was recommended. |
Two forms of SERI Silk (Sofregen, Medford, Mass.) provided the best combination of mechanical support and minimal adhesions (Table 2), an effect further enhanced by application of the 2×HA to the outside (the free side) surface of the silk backing after attachment to the target site. The product is a purified fibroin of Bombyx moth silk and knitted into a scaffold to provide soft-tissue support. The stiffness of the original version of Seri-Silk made it difficult to apply to sites with significant curvature. In later studies, we made use of “Contour Seri Silk” (Sofregen, Medford, Mass.) with considerably more flexibility enabling the application of grafts to target sites with any degree of curvature. In grafts at 3 weeks, SERI-Silk was enveloped by collagen bands suggesting a mild fibrosis.
| TABLE 2 |
| Comparison of Backings tested for Patch Grafts. |
| Ease in | Adverse | |||
| Backings | handling | reactions | Adhesions** | Information on backing |
| SERI ® Surgical Scaffold Silk and | Yes | No | Minimal | Bombyx Moth Silk |
| Contour Surgical Silk Scaffolds | David Kaplan (Tuft's University, Boston, MA), | |||
| Filamentous Silk Mesh | Yes | Yes | Severe | Sofregen (Boston, MA) |
| Vetrix BioSIS ECM | Yes | Tended to | 2-3 | Regenerative Medicine Tech. |
| Surgisis ®ES ™ Soft Tissue Graft | Yes | become | 2-3 | Discontinued or renamed |
| Alloderm | Yes | dislodged and | 2-3 | Decellularized tissue from human dermis |
| Vicryl Knitted Mesh | Yes | to fold over, | Severe | Ethicon |
| Necrosis, | ||||
| Discoloration, | ||||
| & Fibrosis | ||||
| Seprafilm | Too | No | 2 | https://www.seprafilm.us/ |
| fragile | ||||
| Reglyde | Too | No | 2 | http://www.biotimeinc.com/ |
| fragile | ||||
| **Adhesions: These ranged to extent of severity. We assigned a number to indicate that severity; 0 = no adhesions; 1 = thin and easily disrupted adhesions; 2 = adhesions requiring blunt force dissection to disrupt; 3 = Dense adhesions that were dispersed only with the use of considerable force, resulting in partial or total injury to the viscera. The most severe adhesions observed with any of the backings were those when used in combination with “belly jelly”, carboxymethylcellulose. Coating of serosal (outside) surface of backing with more concentrated (2X) HA reduced and minimized adhesions | ||||
| Immunosuppression: All pigs received oral dosages of the immunosuppressive drugs Tacrolimus (0.5 mg/kg) and Mycophenolate (500 mg) twice daily, beginning 24 hours prior to surgery, and continuously given thorough the post-surgical period. |
Evidence for engraftment at one week after surgery was validated with Trichrome staining (FIGS. 3A and 3B) and with hematoxylin/eosin (H&E) staining (FIGS. 3A2 and 3B2) and demonstrated a remodeling of the Glisson Capsule plus a surprisingly broad region of remodeling of the parenchymal tissue beneath the site of the graft (see also FIGS. 9A-9B). In this region, the histological structures were lost entirely or were in the process of dissolution (see also FIGS. 6E-6H). Reconstitution of the Glisson capsule and of the lobular architecture occurred by 3 weeks following resorption of HAs that led to maturation of the donor cells and muting of the MMPs expression (FIG. 3B). Engraftment into the livers of NRG/FAH mice was completed and with cells uniformly throughout the tissue by 3-4 weeks post-surgery (FIG. 3C, and FIGS. 5A-5P).
In some embodiments, donor organoids of BTSCs/ELSMCs deriving from transgenic GFP+ pigs were grafted into wild type pigs (FIGS. 3A and 3B, 4A) or into NRG/FAH mice (FIGS. 3C, 5L-5P) and were identified by GFP expression (FIGS. 3C, and 8A). In liver, autofluorescence may derive from many different molecules (e.g. aromatic amino acids, flavins, vitamin A, lipofuscins). The autofluorescence for lipofuscins peak at wavelengths overlapping with that for GFP (FIG. 8A). Therefore, identification of donor cells in livers may be performed with an antibody to GFP (Rabbit anti-GFP antibody; Novus, NB600-308) and coupled to a secondary antibody with a red fluoroprobe (Donkey anti-rabbit 555, Invitrogen) causing donor cells to have a pink nucleus (FIGS. 4A and 10), a merge of the red fluoroprobe with the blue from DAPI) in the diploid cells and a punctate pink entity associated with the blue nuclei in cells with larger nuclei (probable polyploid cells). In some embodiments, host cells were recognized given their blue nuclei but without GFP expression (FIGS. 3C, 4A, 10). Large numbers of donor GFP+ BTSCS/ELSMCs were observed in the host liver near to the graft (FIG. 4A). In some embodiments, donor GFP+ BTSCs/ELSMCs were observed also near host lobules on the cross-lobe side (FIGS. 4B and 10) that was approximately 1.5 cm from the graft site. Thus, the cells were in some embodiments able to migrate the entire width of the lobule in a week.
The liver lobules of mature hepatocytes contain lipofuscins in the cytosol with an autofluorescence green color. However, in young animals, the amount of lipofuscins is minimal and was easily distinguished from the nuclear GFP label (FIGS. 4B, 4Cii, and 8A). In some embodiments, Donor GFP+ cells that had matured were recognized as aggregates of hepatocytes with pink nuclei (FIGS. 4C, 4Ci).
In some embodiments, upon transplantation of the patch grafts of BTSCs/ELSMCs organoids resulted in remodeling of the Glisson Capsule and of tissue near to the graft site, followed by a merger of host and donor cells within a week (FIGS. 3A-3C-5A-5P, 6E-6H). Hematoxylin/Eosin (H&E) staining of the region of remodeling implicated inflammatory responses involving both donor and host cells (FIGS. 6E-6H, 9A-9B). The GFP label was found only in the nuclei of the GFP+ BGTSCs/ELSMCs in the graft and in the nuclei of the GFP+ adult cells (FIGS. 4A-4E); however, there was also some cytoplasmic staining of GFP at week one in maturing cells, transitioning into entirely or primarily nuclear within another week or two (FIGS. 4A-4E, 5A-5P).
In some embodiments, integration of the donor cells within large regions of the liver was completed by 2 weeks by which time HAs had been mostly resorbed, and some donor cells had lineage restricted into adult hepatic cell fates comprising cholangiocytes (pan cytokeratin, pCK) and hepatocytes (albumin) (FIGS. 4A-4E). In some embodiments, donor GFP+ cells were present throughout the organ and had acquired classic sinusoidal plates or ductular morphologies (FIG. 4E) and expressed intermediate (e.g. SOX9, alpha-fetoprotein, HNF4a) and adult (albumin, pCK) functions (FIG. 4E).
Engraftment efficiency by patch grafting resulted in essentially all of the donor cells transplanting into the host liver and remaining viable. They were not found in the remnants of the grafts at the liver surface of the liver, and there was no evidence of ectopic cell distribution to other organs (e.g. lung). The speed of migration of donor cells in the BTSC/ELSMC grafts through the liver resulted in donor cells in most regions of the organ (liver) by the end of a week and with uniformly dispersed cells throughout the tissue (liver) by 2-3 weeks (FIGS. 3A-3C-5A-5P).
In some embodiments, the present disclosure provides methods of rescuing hosts from a disease state by cellular engraftment. In one embodiment of the present disclosure, the method of rescuing a murine model of type I tyrosinemia due to deficiency in furmaryl-acetoacetate-hydrolase (NRG/FAH) mice were rescued by cell engraftment. NRG/FAH were obtained from Dr. Lishan Su (Department of Microbiology and Immunology at UNC). NRG/FAH mice were established using CRISPR/Cas9 technology in immunocompromised mice to achieve a murine model of type I tyrosinemia due to deficiency in furmaryl-acetoacetate-hydrolase (FAH) and, in parallel, permissive for xenografts. The mice were maintained under the routine conditions for immunocompromised hosts and were sustained with normal livers and normal kidneys by being supplied a drug, 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3-cyclohexanedione (NTBC), Nitisinone, in their water (20 μg/ml). Nitisinone has been shown to block the tyrosine pathway prior to the FAH enzymatic deficiency and so prevent the buildup of toxic intermediates affecting both the liver and the kidney. NRG/FAH mice were treated with patch grafts of organoids of porcine BTSC/ELSMCs and then weaned from Nitisinone. Controls were given patch grafts without cells and also weaned from Nitisinone.
All the animals with patch grafts of porcine BTSC/ELSMCs remained healthy for 4 weeks or more and gained weight (˜1 gm/every 2-3 days) after withdrawal of Nitisinone, whereas the controls (given patch grafts without cells and weaned from Nitisinone) began losing weight (˜1 gm/day) by day 17 post grafting (FIG. 11). The control mice with patch grafts with no cells had to be euthanized by day 17; those with patch grafts containing BTSCs/ELSMCs were euthanized on day 30. Histological assays indicated that mice with patch grafts with BTSCs/ELSMCs have livers and kidneys similar to those of animals maintained on Nitisinone (FIGS. 5A, 5B, 5N). By contrast, there were massive injuries in the livers and kidneys of animals with control grafts with no cells (FIGS. 5C, 5D, 5N). The effects on livers and kidneys are known due to toxins from tyrosine metabolism in hosts with FAH deficiency. The histological assays showed no cells or very limited number of cells remaining in the patch grafts (FIG. 5E). GFP signals from porcine donor cells were observed throughout the grafted liver (FIGS. 3C, 5G, 5H, 5I) and though there was some cytoplasmic staining of GFP, most was expressed in the nucleus; moreover, independent assays for H2B histone showed that it co-expressed with GFP whether in the nucleus or the cytoplasm (FIG. 5P). In addition to normal liver and kidney histology in animals with patch grafts with BTSCs/ELSMCs, donor cells within the host livers were shown to express porcine FAH (FIG. 5O).
In some embodiments, the patch graft of the present disclosure maintains stem cells in an immature state that maintains expression of matrix-metal-proteinases (MMPs) in the donor stem cells. The remodeling of the Glisson capsule and of the neighboring liver lobules correlated with elevated expression of multiple MMPs, enzymes known to dissolve extracellular matrix components and to be associated with cell migration. FIGS. 6A-6H summarizes data from RNA-seq studies and IHC assays on MMPs expressed by stem/progenitors versus adult cells. BTSCs expressed high levels of multiple MMPs, comprised of both secreted forms (e.g. MMP2, MMP7) as well as membrane-associated forms (e.g. MMP14, MMP15). The ELSMCs, precursors of endothelia and of stellate cells, also contributed to expression of multiple MMPs.
The findings from RNA-seq data were confirmed by IHC assays for the proteins (enzymes) encoded by MMP genes (FIGS. 6E-6H). IHC assays confirmed the presence of the secreted forms of MMPs such as MMP1, MMP2, MMP7, and MMP9, especially in the regions of remodeling. Protein expression of MMP1 was found in BTSCs/ELSMCs organoids and also in remodeling regions of grafts. However, existing data banks of RNA-seq findings do not include MMP1 because of a lack of an annotated species of porcine MMP1 to be used for the analyses. Therefore, recognition of its presence in the remodeling zones is based on the IHC assays.
Factors causing differentiation of donor cells resulted in muting of expression of secreted MMPs and, in parallel, a loss in potential for engraftment and migration (data not shown). These included serum, various soluble regulatory signals (e.g. growth factors, cytokines, hormones) known to influence differentiation of the donor cells, extracellular matrix components whether in the hydrogels or in the backings (especially type I collagen), and the stiffness of the HA hydrogels (e.g. Pascal levels above ˜0.200-300). If differentiation of ELSMCs progressed preferentially to stroma (e.g. in the presence of serum), the grafts became fibrotic; if to endothelia (in the presence of factors promoting angiogenesis), the grafts contained viable cells but remained superficial to the organ capsule (data not shown)
The present disclosure provided a novel method for transplantation of cells into solid organs or tissues, including internal organs, and demonstrated here with studies on liver. The method is safe, avoids emboli and ectopic cell distribution, and optimizes rapid engraftment and distribution of large numbers of cells throughout the host tissue. Within a week, there was engraftment of all of the donor cells (≥108th in pigs; ≥106th in mice) throughout significant portions of the liver followed by migration and integration of cells at significant distances from graft sites. Maturation to mature cell types occurred throughout regions of engrafted cells by 2 weeks, followed by restoration of Glisson's capsules and of tissue histology and architecture by 3 weeks. Importantly, patch grafts were able to rescue animals from a disease state, demonstrated here with patch grafts in mice with type I tyrosinemia.
The presently disclosed methods are superior to methods of transplanting cells into solid organs by direct injection or by delivering cells via a vascular route. These past methods of transplantation resulted in small numbers of cells being engrafted, in risks of emboli that can be life threatening, and in significant levels of ectopic cell distribution of probable but unknown significance clinically. These problems have caused cell therapies for internal solid organs to be used minimally or not at all
The present disclosure found that organoids provide the most successful arrangement for the cells for grafting to ensure appropriate, lineage-stage-specific epithelial-mesenchymal partnering. Accordingly, in some preferable embodiments, the donor cell mixture is formed by letting them self-select into organoids, after removal by panning of mature mesenchymal. In some embodiments, the donor cell mixture may be formed by co-transplanting epithelial-mesenchymal cell partners by flow cytometrically immuno-selecting the relevant cells using their distinctive surface antigens from cell suspensions and then mixing the BTSCs and the ELSMCs according to the ratios found in cells suspensions from freshly isolated tissues. Without being bound by theory, it is a hypothesis of the present disclosure that establishing lineage-stage-appropriate epithelial-mesenchymal partners with provides relevant paracrine signaling for the grafts, and yields organoids under defined (serum-free) conditions, that made them easily cultured or cryopreserved.
In one aspect, the primary design of the grafts consisted of mixing of cells with appropriate biomaterials that can form a hydrogel that keeps cells localized to the target site. The cells in the soft hydrogels were protected with a backing that is neutral regarding effects on the donor cells. A preferable embodiment of the graft biomaterials may be non-sulfated or minimally sulfated glycosaminoglycans (GAGs), such as hyaluronans (HAs), found in all stem cell niches, with receptors to HAs being classic stem cell traits. Without being bound by theory, it is a hypothesis of the present disclosure that HAs supported maintenance of cells as immature (i.e. as stem/progenitors), and optimized their expression of secreted MMPs essential for engraftment and for migration and integration into the host tissue.
In some embodiments, the present disclosure demonstrated that the disclosed methods induced engraftment processes resulting in remodeling of the Glisson Capsule and of the host tissue near to the graft (FIGS. 3A-3C, 5A-5P, and 9A-9B). To validate the findings of remodeling, Trichrome staining was used and its staining of extracellular matrix components (FIG. 3A-3C) plus staining with H&E (FIGS. 3A-3C and FIGS. 9A-9B) confirmed remodeling phenomena associated with inflammation. By 3 weeks post-surgery and following clearance of HAs, there was reconstitution of the Glisson's capsules and of the normal tissue histology. The remodeling zone (see FIGS. 3A-3C-5A-5P) was shown to involve multiple forms of MMPs (FIGS. 6A-H) and to be transient reverting to normal histology by 3 weeks.
Although there are multiple types of HAs, thiol-modified ones can be triggered with PEGDA to crosslink to form a hydrogel with precise biochemical and mechanical properties. These HA hydrogels are clinically useful for cell and molecule delivery in vivo. The properties of HAs are reproducible, stable, confer elasticity, allow access into the graft of all soluble signals in blood, lymph or interstitial fluid, and minimize the maturation of donor cells until engraftment and migration have occurred. The ability to vary the rheological factors with simple changes in HA and PEGDA concentrations enables “tuning” of the HA properties, and provides additional advantages in guiding the direction of migration of the cells and in minimizing adhesions. Soft HA hydrogels, ones mimicking properties in stem cell niches were permissive for expression of the stem/progenitor cells-associated repertoire of MMPs, especially the secreted MMPs. Thus, mechanical properties of HAs, studied for years in functions of skeletal tissues are important also in managing grafting strategies.
Patch grafts containing stem/progenitors resulted in striking phenomena of grafts “melting” into tissues within a few days, followed by a merger of donor and host cells, and a distribution of cells throughout significant regions of the organ within a week (see FIGS. 3A-3C-5A-5P). During the remodeling phase, primarily the first week post-transplantation, there was often cytoplasmic expression of the GFP label in the donor cells, especially if they had lineage restricted to an adult fate (FIG. 4C). This was concerning, since the GFP label is tagged to the H-2B histone locus meaning that it should have been found only in the nucleus. Without being bound by theory, it is an hypothesis of the present disclosure that histones can be found in the cytoplasm during inflammatory processes, and that there was abundant evidence for such inflammatory processes in the remodeling zones (FIGS. 9A-9B), but these inflammatory processes diminished with time post-transplantation resulting in reconstitution of the Glisson Capsule, stabilized histological structures, and with donor cells having primarily or entirely nuclear GFP staining by 3-4 weeks (FIGS. 4D, 4E, 5G). In control studies, antibody to histone yielded similar patterns as the one for GFP (FIG. 5P).
It is a discovery of the present disclosure that the engraftment and integration process correlated with expression of multiple MMPs, a family of calcium-dependent, zinc-containing endopeptidases that degrade extracellular matrix components.
Immature cells express express high levels of secreted forms (e.g. MMP2, MMP7) as well as membrane-associated forms (e.g. MMP14, MMP15). IHC assays indicated that protein levels of secreted MMPs (e.g. MMP1, MMP2, MMP7) were found richly expressed in areas of remodeling (FIGS. 6A-6H).
The biomaterials of the grafts, especially the HAs, have been shown ex vivo and in vivo to maintain sternness traits in cells. Since the grafts are devoid of known signals that can trigger fate determination, the findings of donor cells that had matured into distinct adult fates implicate the local microenvironment of the host tissue as the logical source of relevant factors for dictating fates in the maturational processes.
Patch graft strategies are safe and effective for transplantation of large numbers of cells into a solid organ or tissue and so offer replacement of missing functions or alleviation of disease states. The numbers of cells per patch that can be engrafted are considerable (108 in pigs; 107 in mice) and dictated by the dimensions of the patch graft and the numbers of organoids. These findings are in contrast to the limited numbers of cells (e.g. ≤106) feasible with vascular delivery or by injection grafting.
Conditions (soluble growth factors, cytokines, serum, matrix components, mechanical forces) that caused donor cells to differentiate resulted in reduction in secreted MMPs and, in parallel, abrogation of the engraftment and migration process. Complementing these findings were control studies with patch grafts of mature hepatocytes partnered with endothelia; the donor cells survived and were functional, but they did not engraft (data not shown). Therefore, engraftment requires a source of secreted MMPs, ideally a cellular source that can interact dynamically to generate the multiple forms of secreted as well as plasma membrane-associated MMPs. The mature cells are unable to do this, since they expressed only or primarily the plasma membrane-associated forms (FIGS. 6A-6H).
This approach offers alternative methods for cell therapies. It proved safe as long as biomaterials and the backing used were neutral with respect to the host tissue and collectively supportive of maintenance of the donor cells as immature and so able to produce the relevant repertoire of MMPs required for engraftment, migration, and integration.
ADHEP, adult hepatocytes; AFP, α-fetoprotein; ALB, albumin; BTSCs, biliary tree stem cells; CD, common determinant; CD44, hyaluronan receptors; CD133, prominin; Cdx2, caudal type homeobox 2; CFTR, cystic fibrosis transmembrane conductance regulator; CK, cytokeratin protein; CXCR4, CXC-chemokine receptor 4 (also called fusin or CD184; also called platelet factor 4; EGF, epidermal growth factor; ELSMCs, early lineage stage mesenchymal cells, consisting of angioblasts and their descendants, precursors to endothelia and to stellate cells; EpCAM, epithelial cell adhesion molecule; FAH, fumaryl-acetoacetate hydrolase, an enzyme critical to tyrosine metabolism (its absence results in type I tyrosinemia); FGF, fibroblast growth factor; HBs, hepatoblasts; HGF, hepatocyte growth factor; HpSCs, hepatic stem cells; KM, Kubota's Medium, a serum-free medium designed for endodermal stem cells; KRT, cytokeratin gene; LGR5, Leucine-rich repeat-containing G-protein coupled receptor 5 that binds to R-spondin; Mafa, V-Maf Musculoaponeurotic Fibrosarcoma Oncogene Homolog A; MMPs, matrix metallo-proteinases, a large family of proteinases associated with dissolution of extracellular matrix, with cell migration and with regenerative responses; NANOG, a transcription factor critically involved with self-renewal; NCAM, neural cell adhesion molecule; NGN, neurogenin; NRG, NOD-Rag1−/−IL2RgammaC-null; NIS, sodium/iodide symporter; OCT4, (octamer-binding transcription factor 4) also known as POU5F1 (POU domain, class 5, transcription factor 1), a gene expressed by stem cells; PDX1, pancreatic and duodenal homeobox 1, a transcription factor critical for pancreatic development; PBGs, peribiliary glands, stem cell niches for biliary tree stem cells; SALL4, Sal-like protein 4 found to be important for self-replication of stem cells; SOX, Sry-related HMG box; SOX2, a transcription factor that is essential for maintaining self-renewal, or pluripotency in embryonic and determined stem cells. SOX9, transcription factor associated with endodermal tissues (liver, gut and pancreas; SOX17, a transcription factor essential for differentiation of liver; VEGF, vascular endothelial cell growth factor.
This example describes an exemplary method for preparing and characterizing patch grafts.
Materials
Companies providing equipment, reagents and/or supplies: Abcam, Cambridge, Mass.; ACD Labs, Toronto, CA; Acris Antibodies, Inc), San Diego, Calif.; Advanced Bioscience Resources Inc) (ABR), Rockville, Md.; Agilent Technologies, Santa Clara, Calif.; Alpco Diagnostics, Salem, N.H.; Applied Biosystems, Foster City, Calif.; BD Pharmingen, San Jose, Calif.; Becton Dickenson, Franklin Lakes, N.J.; Bethyl Laboratories, Montgomery, Tex.; BioAssay Systems, Hayward, Calif.; Cambridge Isotope Laboratories, Tewksbury, Mass.; Biotime, Alameda, Calif.; Carl Zeiss Microscopy, Thornwood, N.Y.; Carolina Liquid Chemistries, Corp., Winston-Salem, N.C.; Charles River Laboratories International, Inc), Wilmington, Mass.; Chenomx, Alberta, Canada; Cole-Parmer, Court Vernon Hills, Ill.; DiaPharma, West Chester Township, Ohio; Fisher Scientific, Pittsburgh, Pa.; Gatan, Inc), Pleasanton, Calif.; Illumina, San Diego, Calif.; Ingenuity, Redwood City, Calif.; Life Technologies Corp., Grand Island, N.Y.; Leica, Washington, D.C.; LifeSpan Biosciences, Inc), Seattle, A; Molecular Devices, Sunnyvale, Calif.; Olympus Scientific Solutions Americas Corp., Waltham, Mass.; PhoenixSongs Biologicals (PSB), Branford, Conn.; Polysciences, Inc), Warrington, Pa.; Qiagen, Germantown, Md.; R&D Systems, Minneapolis, Minn.; RayBiotech, Norcross, Ga.; Roche Diagnostics, Mannheim, Germany; Santa Cruz Biotechnology, Inc), Dallas, Tex.; Sigma-Aldrich, St. Louis, Mo.; Sofregen, Medford, Mass.; Takara, Otsu, Japan; Tousimis Research Corp., Rockville, Md.; Triangle Research Labs (TRL), Research Triangle Park, N.C.; Umetrics, Umea, Sweden; Varian Medical Systems, Inc), Palo Alto, Calif.; Vector Laboratories, Burlingame, Calif.; VWR Scientific, Radnor, Pa.)
Animals
Location of Facilities.
Animals used as hosts or as donors for cells were maintained in facilities at the College of Veterinary Medicine at NCSU (Raleigh, N.C.). Surgeries, necropsies, and the collection of all biological fluids and tissues were performed at these facilities. All procedures were approved by the IACUC committee at NCSU.
Pig Hosts Used for the Grafts.
The pigs being used as recipients were a mixture of six different breeds: a six-way cross consisting of Yorkshires, Large Whites, Landraces (from the sows), Durocs, Spots, and Pietrans (from the boars). This highly heterogeneous genetic background is desirable in that it parallels the heterogeneous genetic constitutions of human populations. The host animals were all females, approximately six weeks of age and ˜15 kg.
Pig Donors for Cells.
There were two categories: a) transgenic donor animals carrying a GFP transgene (all of the studies in this report) and b) male pigs, approximately six weeks of age and ˜15 kg, were used as donors for cell transplantation into females (parallel studies with findings to reported in subsequent reports). The GFP+ donor animals were obtained by breeding a transgenic H2B-GFP boar with a wild type gilt by standard artificial insemination. The model was developed via CRISPR-Cas9 mediated homology-directed repair (HDR) of IRES-pH2B-eGFP into the endogenous β-actin (ACTB) locus. The transgenic animals show ubiquitous expression of pH2B-eGFP in all tissues.
Fusion of the GFP to H2B results in localization of the GFP marker to the nucleosome and allows clear nuclear visualization as well as the study of chromosome dynamics. The founder line has been analyzed extensively and ubiquitous and nuclear localized expression has been confirmed. In addition, breeding has demonstrated transmission of the H2B-GFP to the next generation. All animals were healthy, and multiple pregnancies have been established with progeny showing the expected Mendelian ratio for the transmission of the pH2B-eGFP. The male offspring were genotyped at birth, and those that were positive for the transgene were humanely euthanized for tissue collection, and isolation of donor cells.
Genotyping of Animals.
For each donor and recipient animal, the swine leucocyte antigen class I (SLA-I) and class II (SLA-II) loci have been PCR amplified using primers designed to amplify known alleles in these regions based on the PCR-sequence-specific-primer strategy. The system consists of 47 discriminatory SLA-I primer sets amplifying the SLA-1, SLA-2, and SLA-3 loci63, and 47 discriminatory SLA-II primer sets amplifying the DRB 1, DQB1, and DQA loci. These primer sets have been developed to differentiate alleles by groups that share similar sequence motifs, and have been shown easily and unambiguously to detect known SLA-I and SLA-II alleles. When used together, these primer sets effectively provided a haplotype for each animal that was tested, thus providing an assay to confirm easily a matched or mismatched haplotype in donor and recipient animals.
Breeding pairs of NRG/FAH Mice were obtained from Dr. Lishan Su (Department of Microbiology and Immunology, UNC, Chapel Hill, N.C.) and maintained in the animal facilities at UNC (Chapel Hill, N.C.) under conditions appropriate for immunocompromised hosts. These FAH mice were established by CRISPR/Cas 9 technology using NRG mice, meaning that the mice are immunocompromised and secondarily have been made deficient in fumaryl acetoacetate hydrolase (FAH). The FAH gene encodes fumaryl acetoacetate hydrolase that is the final enzyme in the tyrosine and phenylalanine catabolism pathway. FAH is expressed highly in liver and kidney cells and less so in endocrine tissues. NRG (NOD-Rag1−/− IL2RgammaC-null)/FAH (fumarylacetoacetate hydrolase) knockout mice show a progressive liver (and kidney) damage phenotype that mimics major features of hereditary tyrosinemia type 1 (HT1) in humans, including tyrosinemia, appearance of succinylacetone in blood and urine, and liver and kidney injuries The FAH deficiency complications in mice were managed by adding (20 μg/ml) of 2-(2-nitro-4-fluoromethylbenzoyl)-1,3-cyclohexanedione (NTBC; also called Nitisinone) to the water supply for the animals. NTBC suspends production of toxic metabolites in tyrosine catabolism pathway which is caused by the absence of FAH. The livers and kidneys of these mice demonstrate normal histology unless the animals are provided normal water without Nitisinone. When presented with regular water, evidence of severe tyrosinemia occurs within 2 weeks and results in a need to euthanize the mice by 3 weeks.
Media and Solutions
All media were sterile-filtered (0.22 μm filter) and kept in the dark at 4° C. before use. Basal medium and fetal bovine serum (FBS) were purchased from GIBCO/Invitrogen. All growth factors were purchased from R&D Systems. All other reagents, except those noted, were obtained from Sigma.
Cell Wash.
599 mls of basal medium (e.g. RPMI 1640; Gibco #11875-093) was supplemented with 0.5 grams of serum albumin (Sigma, # A8896-5G, fatty-acid-free), 10-9 M selenium, and 5 mis of antibiotics (Gibco #35240-062, AAS). It was used for washing tissues and cells during processing.
Collagenase Buffer.
Consists of 100 mls of cell wash supplemented with collagenase (Sigma # C5138) with a final concentration of 600 U/ml (R1451 25 mg) for biliary tree (ducts) tissue and 300 Um′ (12.5 mg) for organs (e.g. liver)
Kubota's Medium, a wholly defined, serum-free medium designed for endodermal stem/progenitors was used to prepare cell suspensions, organoids and HA hydrogels.
This medium consists of any basal medium (here being RPMI 1640) with no copper, low calcium (0.3 mM), 1 nM selenium, 0.1% bovine serum albumin (purified, fatty-acid-free; fraction V), 4.5 mM nicotinamide, 0.1 nM zinc sulfate heptahydrate, 5 μg/ml transferrin/Fe, 5 μg/ml insulin, 10 μg/ml high density lipoprotein, and a mixture of purified free fatty acids that are presented complexed with fatty acid-free, highly purified albumin. Its preparation is given in detail in a methods review67. Also, it is available commercially from PhoenixSongs Biologicals (Branford, Conn.).
Hyaluronans (HAs).
Soluble, long chain forms of HA (Sigma Catalog #52747) were used in stabilization of organoid cultures and in cryopreservation. Those used to make the hydrogels, thiol-modified HAs, were obtained from Glycosan Biosciences, a subsidiary of Biotime. The components for these thiol-modified HAs were made by a proprietary bacterial-fermentation process using Bacillus subtilis as the host in an ISO 9001:2000 process (www.biopolymer.novozymes.com/).
The components were produced by Novozymes under the trade name HyaCare® and are 100% free of animal-derived materials and residual organic solvent. No animal-derived ingredients are used in the production, and there are very low protein levels and no endotoxins. The production follows the standards set by the European Pharmacopoeia). The HA hydrogels were prepared using Glycosil (HyStem® HAs, ESI BIO-CG313), the thiol-modified HAs, that can be trigged to form disulfide bridges in the presence of oxygen, or by forming thio-ether linkages using polyethylene glycol diacrylate (PEGDA). Glycosil® is reconstituted as a 1% solution of thiolated HA in 1% phosphate buffered saline (PBS) using degassed water, or, in our case, in serum-free Kubota's Medium. Upon reconstitution, it remains liquid for several hours but can undergo some gelation if exposed to oxygen. More precise gelation occurs with no temperature or pH changes if Glycosil is treated with a cross-linker such as PEGDA causing gelation to occur within a couple of minutes.
The level of cross-linking is the main contributor to the level of stiffness, or rigidity, and can be controlled by adjusting the ratio of the thiol-modified HAs to PEGDA. In prior studies, stem cell populations were tested in HA hydrogels of varying level of rigidity and were found to remain as stem cells, both antigenically and functionally (e.g., with respect to ability to migrate), only if the level of rigidity was less than 100-200 Pa We made use of this finding to design the grafts with a very soft layer and with more rigid layers of hyaluronan hydrogels in the backing to form a barrier to migration in directions other than the target tissue as well as to minimize adhesions from cells from nearby tissues. The 3 versions of the hydrogels with distinct levels of rigidity are characterized in FIGS. 2A-2E, characterizations that included direct measurements of the rheological properties. The most rigid barrier, that of the 10×HA hydrogel (rigidity=760 Pa), was prepared on the backing ahead of time and could be cryopreserved if desired. At the time of the surgery, the donor cells were prepared in the soft, 1×HA hydrogel (rigidity=60 Pa); placed onto the more rigid 10× hydrogel (already on the backing); and the patch tethered to the target site. After tethering, the outside of the graft was coated or painted with the 2X HA hydrogel (rigidity=106 Pa) using a NORM-JECT 4010.200V0 Plastic Syringe with a BD Micro-Fine™ IV permanently attached needle.
Macro-scale rheological properties of hydrogels were determined using a stress-controlled cone-and-plate rheometer (TA Instruments, AR-G2, 40 mm cone diameter, 1° angle). Gels actively polymerized on the rheometer while oscillating at 1 rad/s frequency and 0.6 Pa stress amplitude with the modulus monitored continuously to query for sufficient completion of the cross-linking reaction.
Once equilibrated, the hydrogels were subjected to an oscillatory frequency sweep (stress amplitude: 0.6 Pa, frequency range: 0.01-100 Hz). The rheological properties of the 3 versions of hyaluronan hydrogels that were used are summarized in FIG. 2A-2E and comprised soft hydrogels (˜100 Pa), more rigid ones (˜700 Pa) and intermediate levels (˜200-300 Pa).
Donor Cells
Donor cells were derived from transgenic H2B-GFP pigs as described above. They offer a significant advantage for cell transplantation studies in that all cells are tagged with H2B-GFP fusion protein. The use of fluorescent proteins as molecular tags enabled the donor cells to be tracked in their migration and engraftment after transplantation. This fusion protein is targeted to the nucleosomes by fusing GFP with the nucleosomal H2B protein, resulting in a nuclear/chromatin GFP signal.
In the characterizations of the grafts, autofluorescence both of the silk backing (spring green color) and also of lipofuscins (forest dark green color) in mature hepatocytes presented a challenge given the overlap in wavelengths with those of GFP. Therefore, we shifted the GFP+ signal to a pink or rose color using an antibody to GFP and secondarily to an antibody with a red fluoroprobe (FIGS. 4A-4E, 10). This resulted in the stem cells being recognized as small cells with pink nuclei (merger of the nuclear blue DAPI staining with the antibody-tagged-rose colored GFP+ label). Any donor cells that matured into hepatocytes were recognized as having pink nuclei and with lipofuscin autofluorescence in the cytoplasm (FIGS. 4A-4E). In the patch grafts onto mouse livers, some cells had nuclei that were entirely pink, and some had large blue nuclei to which was associated a punctate pink entity (FIGS. 5A-5P). We hypothesize that this is due to a mixture of donor cells (diploid) with a single pink nucleus and some donor cells that were maturing into polyploid cells with larger nuclei and so may have had the GFP label localized to one region of the nucleus. Alternatively, those with discrete localization of the GFP label may represent a fusion of donor and host cells with young murine hepatocytes well known to have levels of polyploidy ranging from 4N to 32N.
Preparation of Cells.
Porcine extrahepatic biliary tree tissue (gall bladder, common duct, hepatic ducts) were obtained from transgenic pigs. Tissues were pounded with a sterilized, stainless steel mallet to eliminate the parenchymal cells, carefully keeping the linkage of the intra-hepatic and extrahepatic bile ducts. The biliary tree was then washed with the “cell wash” buffer comprised of a sterile, serum-free basal medium supplemented with antibiotics, 0.1% serum albumin, and 1 nM selenium (10-9M). It was then mechanically dissociated with crossed scalpels, and the aggregates enzymatically dispersed into a cell suspension in RPMI-1640 supplemented with 0.1% bovine serum albumin (BSA), 1 nM selenium, 300 Um′ type IV collagenase, 0.3 mg/ml deoxyribonuclease (DNAse) and antibiotics. Digestion was done at 32° C. with frequent agitation for 30-60 minutes. Most tissues required two rounds of digestions followed by centrifugation at 1100 rpm at 4° C. Cell pellets were combined and re-suspended in cell wash. The cell suspension was centrifuged at 30 G for 5 minutes at 4° C. to remove red blood cells. The cell pellets were again re-suspended in cell wash and filtered through a 40 μm nylon cell strainer (Becton Dickenson Falcon #352340) and with fresh cell wash. The cell numbers were determined and viability was assessed using Trypan Blue. Cell viability above 90-95% was routinely observed.
Mesenchymal Stem/Progenitors Needed as Partners.
In prior studies, we defined the antigenic profile of populations of mesenchymal cells that provide critical paracrine signals needed for hepatic and biliary tree stem cells versus others required for mature parenchymal cells. The mesenchymal cells needed as partners for BTSCs are subpopulations devoid of MHC antigens, with low side scatter, and identifiable as angioblasts (CD117+, CD133+, VEGF-receptor+, and negative for CD31), precursors to endothelia (CD133+, VEGF-receptor+, and CD31+), and precursors to stellate cells (CD146+, ICAM1+, VCAM+, alpha-smooth muscle actin (ASMA)+, and negative for vitamin A). We refer to these 3 subpopulations collectively as early lineage stage mesenchymal cells (ELSMCs).
By contrast, adult hepatocytes are associated with mature sinusoidal endothelia (CD31+++, type IV collagen+, VEGF-receptor+, and negative for CD117) and those for adult cholangiocytes that are associated with mature stellate and stromal cells (ICAM-1+, ASMA+, Vitamin A++, type I collagen+).
Formation of Organoids.
The cell suspensions were added to Multiwell Flat Bottom Cell Culture Plates (Corning #353043) in serum-free Kubota's Medium and incubated for—an hour at 37° C. to facilitate attachment of mature mesenchymal cells. Mature mesenchymal cells attached to the dishes within 10-15 minutes even though the medium was serum-free. The cells remaining in suspension were transferred to another dish and again incubated for up to an hour. Repeats of this resulted in depletion of a significant fraction of the mature mesenchymal cells. After depletion of mature mesenchymal cells, the remaining floating cells were seeded at ˜2×105 cells per wells in serum-free Kubota's Medium in Corning's ultralow attachment dishes (Corning #3471) and were incubated overnight at 37° C. in a CO2 incubator. Organoids comprised of the biliary tree stem cells (BTSCs) and of ELMSCs formed overnight (FIGS. 1A-1D). These organoid cultures survived for weeks in Kubota's Medium, especially if the medium was supplemented (0.1%) with soluble forms of HAs (Sigma). They could also be cryopreserved as described below. From each gram of neonatal pig biliary tree tissue, we obtained ˜1.5×107 cells. We used ˜3-6×105 cells per well of a 6-well, ultra-low attachment plate and incubated in the serum-free Kubota's Medium. The cells produced, on average, 6000 to 20,000 small organoids (˜50-100 cells/organoid/well). For the grafts, we used at least 100,000 organoids (>107 cells). Depending on the size of the backing, we were able to increase the number of organoids in the grafts up to 108 organoids (i.e. ˜109 cells) or more embedded in ˜1 ml of the soft hyaluronan hydrogel on a 3 cm×4.5 cm backing.
Cryopreservation of Stem Cell Organoids. Isolated stem cell organoids were cryopreserved in Cryostor10, an isotonic cryopreservation buffer containing antifreeze factors, dextran and DMSO (BioLife, Seattle, Wash.; https://www.stemcell.com/products/cryostor-cs10.html). The viability of the cells was improved further with supplementation with 0.1% HAs (Sigma #52747). Cryopreservation was done using CryoMed™ Controlled-Rate Freezers. The viability on thawing was greater than 90%, and cells after thawing were able to form organoids or to attach, to expand ex vivo and in vivo and to give rise to the expected mature cells in vitro and in vivo.
Composition of the Grafts (FIGS. 1A-1D and 2A-2E). Isolating the cells and assembling the grafts are characterized in a schematic in FIGS. 1A-1D and FIG. 7 and with the details summarized in FIGS. 2A-2E. The grafts were formed by using a backing (Table 1, above) onto which were placed the stem cell organoids embedded in the soft hyaluronan hydrogels. These were readily prepared ahead of time and maintained in a culture dish in an incubator overnight. The grafts proved stable at the target site for the duration of the experiments. Cryopreservation of the organoids was achieved readily, but that of the organoids when within the soft hydrogel was not. This meant that embedding the organoids in the soft hydrogel had to be done just prior to surgery.
Surgery
Surgical Procedures.
Anesthesia was induced by administering a combination of ketamine/xylazine (2-3 mg/kg weight each) injected IV or 20 mg/kg ketamine plus 2 gm/kg xylazine IM, and was maintained by isoflurane in oxygen administered via a closed-circuit gas anesthetic unit. The animals were positioned in dorsal recumbency, and the ventral abdomen was clipped from xyphoid to pubis. The skin was aseptically prepared with alternating iodinated scrub and alcohol solutions. After entry into the surgery suite, preparation of the skin was repeated using sterile technique, and the area was covered with a topical iodine solution before application of sterile surgical drapes. The surgeons used appropriate aseptic technique. A mid-ventral incision was made through the skin, through subcutaneous tissues and linea alba, starting at the xiphoid process and extending caudally 8-12 cm. The left hepatic division was exposed and a 3×4.5 cm patch graft was applied to the ventral surface of the liver and containing 1×HA (˜60 Pa) with embedded organoids placed onto the backing containing 10×HA (˜760 Pa), and the patch was placed in direct contact onto the surface of the liver capsule. The patch graft was sutured to the liver using 4-6 simple, interrupted sutures of 4-0 polypropylene. The exposed surface of the graft was then treated with 2 mls of 2×HA hydrogel (˜106 Pa), a level of rigidity that was fluid enough to permit it to be painted or coated onto the outside of the graft; it served further to minimize adhesions from neighboring tissues. Following placement of the surgical graft, the linea alba was closed with a simple continuous suture using 0-PDS. The linea was blocked with 2 mg/kg 0.5% bupivacaine, IM. The subcutaneous tissues and skin were closed with continuous 2-0 PDS and 3-0 Monocryl sutures, respectively. Tissue adhesive was placed on the skin surface.
Immunosuppression.
The graft transplants from the transgenic pigs to the wild type recipients were allogeneic and so required immunosuppression. The immune-suppression protocols used were ones established by others. All pigs received oral dosages of the immunosuppressive drugs Tacrolimus (0.5 mg/kg) and Mycophenolate (500 mg) twice daily, beginning 24 hours prior to surgery. The drugs were given continuously for the entire experimental period. These could be given to the animals easily if mixed with their favorite foods.
Necropsy Procedures.
All animals were humanely euthanized at the designated time point by sedation with Ketamine/Xylazine, and isofluorane anesthesia, followed by an intravenous injection of a lethal dose of sodium pentobarbital. Upon confirmation of death, the carcass was carefully dissected, and the target organs were removed, and placed in chilled Kubota's Medium for transportation to the lab. In addition to the liver, the lungs, heart, kidney, and spleen were collected and fixed in 10% neutral formalin.
Patch Grafts for NRG/FAH Mice.
Newborn piglet liver cells (106 H2B-GFP-cell mixture) were used to form organoids that were embedded in 100 μl of 1×HA hydrogel, transferred to 0.7 cm×1.2 cm Seri-silk contour backing impregnated with 10×HA hydrogel to form the patch graft. Patch grafts were then grafted onto the NRG/FAH mouse liver by sliding the graft between the medial and left lateral lobe. Using a micropipette, surgical glue was used on the edge of the patch to fasten the patch to the graft site. This was followed by applying 200 μl of 2×HA hydrogel as an adhesion barrier.
The muscle layer and skin were closed using sutures or clips; 400 μl saline were given to the mice for hydration; and 100 μl Buprenorphine was given as post-surgical treatment. Controls received a patch without cells. All animals were subjected to surgery recovery overnight. On day 1 post grafting, a 7-days-long-stepwise weaning process eliminating NTBC was done (reductions to 25% on day 1; to 12% on day 2 to day 3; to 6% from day 4 to day 6, and to 0% on day 7). In later studies, we learned that this gradual weaning process is not required; one can simply eliminate the drug within ˜24 hours after the surgical procedures for patch grafting. Body weight measurements were used to check for abnormalities of the animals.
Characterizations of the Grafts
Histology.
After 48+ hours of fixation, tissues samples were placed in labeled cassettes in 70% ethanol and were processed on a long cycle at 60 degrees in a Leica ASP300S Tissue Processor for approximately 10 hours. After completion of the overnight processing, samples were embedded using the Leica EG1160 Embedding Station. A mold was filled with wax and the sample was placed in the correct orientation so that desired sections could be collected. The cassette was chilled until the block and tissue sample could be removed as one unit from the mold. The block was sectioned at 5 microns using a Leica RM2235 Microtome; the sections were floated in the water bath and placed onto slides. The slides were allowed to air dry overnight before staining. Sections were stained for Haematoxylin and Eosin (H&E; Reagents #7211 and #7111) or Masson's Trichrome (Masson's Trichrome Stain: Blue Collagen Kit#87019) using Richard Allan Scientific Histology Products and following the manufacturer's recommended protocol; the protocol is programed into a Leica Autostainer XL.
Immunofluorescence (IF) of Unstained Frozen Sections of Liver. Issues of Autofluorescence Sections of livers from wild type pigs and transgenic pigs (FIG. 8) were prepared from tissue that was embedded and frozen in OCT and flash frozen at ˜200 C for frozen sectioning. Frozen sections were imaged to observe the donor cells with GFP-linked to H2B (FIG. 8). The high autofluorescence in the cytoplasm of hepatocytes (lipofuscins) and the autofluorescence of the Seri-Silk backing caused problems in visualization of the GFP+ cells. In some embodiments, by preparing paraffin sections and staining for the GFP using a rabbit polyclonal antibody to GFP (Novus Biologicals, NE600-308); the rabbit anti-GFP antibody was used in combination with a secondary antibody of donkey anti-rabbit IgG H&L (Alexa Fluor 568; ab175470, Invitrogen), while Donkey anti-Goat IgG Alexa Fluor 488 antibody was used to exclude non-specific staining of hepatic autofluorescence (FIGS. 3C, 4, and 10). For immunofluorescence of GFP following treatment with an antibody to GFP, frozen sections were thawed for 1 hour at room temperature and then fixed in 10% buffered formaldehyde, acetone or methanol. After fixation, sections were washed 3 times in 1% phosphate buffered saline (PBS), followed by blocking with 2.5% horse serum in PBS for 1 hour at room temperature. Primary antibodies diluted in 10% goat serum in PBS were added and incubated overnight at 4° C. The next morning, sections were rinsed 3 times with PBS and incubated with secondary antibodies diluted in 2.5% horse serum in PBS for 2 hours at room temperature. Images were taken using a Zeiss CLSM 710 Spectral Confocal Laser Scanning microscope (Carl Zeiss Microscopy). Antibodies are listed in Tables 3 and 4, below. Autofluorescence was reduced by quenching with the use of dyes and that included Trypan Blue. Trypan Blue was used on tissues/cells at 0.4% in PBS. This reduces the background significantly.
For the images in FIGS. 4D and E (performed at Sapienza, Rome, Italy). Sections (3 μm) were stained with hematoxylin-eosin and Sirius red, according to standard protocols. For immunohistochemistry, endogenous peroxidase activity was blocked by a 30 min incubation in methanolic hydrogen peroxide (2.5%). Antigens were retrieved, as indicated by the vendor, by applying Proteinase K (code S3020, Dako, Glostrup, Denmark) for 10 min at room temperature. Sections were then incubated overnight at 4° C. with primary antibodies (pan-Cytokeratin, Dako, code: Z0622, dilution: 1:100; Sox9, Millipore, code: AB5535, dilution: 1:200).
| TABLE 3 |
| Antibodies used for studies of organoids, in situ histology assays, and for patch grafts |
| Primary Antibodies |
| Clonality, | Catalogue | Dilution/ | |||||
| Category | Antibody | Host | [clone #] | Isotype | Supplier | Number | Application |
| Pluripotent | EpCAM | Rb | Poly, | IgG | Abcam | ab71916 | IHC-P (1:200) |
| and | nonconjugated | IF (1:200) | |||||
| Endodermal | SOX9 | Rb | Poly, | IgG | Chemicon | AB5535 | ICC (1:800) |
| transcript- | nonconjugated | IF (1:500) | |||||
| tion factor | PDX1 | Gt | Poly, | IgG | R&D | AF2419 | IHC-P/ICC (1:200) |
| genes | nonconjugated | System | IF (1:50) | ||||
| NIS | Ms | Mono, | IgG1 | Abcam | ab17795 | IHC-P/ICC (1:50) | |
| [SPM186] | |||||||
| SOX17 | Ms | Mono, | IgG1 | Abcam | ab84990 | IHC-P (1:100) | |
| [OTI3B10] | IF/ICC (1:50) | ||||||
| OCT4 | Gt | Poly, | IgG | Santa | SC-9081 | IHC-P (1:100) | |
| nonconjugated | Cruz | ||||||
| Biotechnology | |||||||
| Pig liver | Porcine | Rb | Poly, | IgG | Abcam | ab79960 | IHC-P (1:100) |
| functional | Albumin | nonconjugated | |||||
| HNFA | Ms | Mono, | IgG2a | Abcam | ab41898 | IHC-P (1:200) | |
| [K9218] | IF (1:800) | ||||||
| GFP | GFP | Rb | Poly, | IgG | Novus | NB600-308 | IHC-P (1:500) |
| nonconjugated | Biologicals | IF (1:200) | |||||
| GFP-555 | GFP Tag | Rb | Poly, | IgG | Thermo | A-31851 | IF-P/IF-F/ICC |
| Alexa-555 | Fisher | (1:350) | |||||
| Scientific | |||||||
| MMP1 | Gt | Poly, | IgG | Sigma- | M4696- | 10 μg/mL | |
| nonconjugated | Millipore | 100UG | |||||
| Matrix | MMP 2 | Ms | Mono. | IgG | Abcam | ab86607 | IHC-P (1:300) |
| Metallo- | (C- | [6E3F8] | |||||
| proteinases | terminal) | ||||||
| TABLE 4 |
| Secondary Antibodies |
| Fluorogenic | Anti-Gt- | Dk | Poly, DyLight | IgG | Thermo | SA5-10086 | 1:1000 |
| assay | 488 | 488 | (H + L) | Fisher | |||
| (Cross | Scientific | ||||||
| Adsorbed) | Anti-Rb- | Dk | Poly, DyLight | IgG | Thermo | SA5-10040 | 1:1000 |
| 594 | 594 | (H + L) | Fisher | ||||
| Scientific | |||||||
| Anti-Ms- | Dk | Poly, DyLight | IgG | Thermo | SA5-10166 | 1:1000 | |
| 488 | 488 | (H + L) | Fisher | ||||
| Scientific | |||||||
| Anti-Gt- | Dk | Poly, DyLight | IgG | Thermo | SA5-10085 | 1:1000 | |
| 350 | 350 | (H + L) | Fisher | ||||
| Scientific | |||||||
| Anti-Rb- | Dk | Poly, Alexa | IgG | Thermo | A21206 | 1:400 | |
| 488 | Fluor 488 | (H + L) | Fisher | ||||
| Scientific | |||||||
| Anti-Gp- | Dk | Poly, Alexa | IgG | Jackson | 706-605- | 1:400 | |
| 647 | Fluor 647 | (H + L) | Immuno | 148 | |||
| Research | |||||||
| Anti-Ms- | Dk | Poly, Alexa | IgG | Thermo | A21207 | 1:400 | |
| 594 | Fluor 594 | (H + L) | Fisher | ||||
| Scientific | |||||||
| Chromogenic | Anti-Rb | Hs | Micropolymer | IgG | Vector | MP-7401 | Ready-to-use |
| assay | Detection | HRP | laboratories | ||||
| Kit | |||||||
| Anti-Ms | Hs | Micropolymer | IgG | Vector | MP-7402 | Ready-to-use | |
| Detection | HRP | laboratories | |||||
| Kit | |||||||
| Anti-Gt | Hs | Micropolymer | IgG | Vector | MP-7405 | Ready-to-use | |
| Detection | HRP | laboratories | |||||
| Kit | |||||||
| Anti-Ms | Hs | Micropolymer | IgG | Vector | MP-7402 | Ready-to-use | |
| Detection | HRP | laboratories | |||||
| Kit | |||||||
Samples were rinsed twice with PBS for 5 min, incubated for 20 min at room temperature with secondary biotinylated antibody (LSAB+ System-HRP, code K0690; Dako, Glostrup, Denmark) and then with Streptavidin-HRP (LSAB+ System-HRP, code K0690, Dako, Glostrup, Denmark). Diaminobenzidine (Dako, Glostrup, Denmark) was used as substrate, and sections were counterstained with hematoxylin (PMID: 29248458). For immunofluorescence, non-specific protein binding was blocked by 5% normal goat serum. Specimens were incubated overnight at 4° C. with primary antibodies (chicken anti-GFP, Abcam, code: ab13970, dilution=1:200; rabbit anti-HNF4alpha, Abcam, code: 92378, dilution: 1:50, rabbit anti-albumin, ab2406, dilution=1:500). Specimens were washed and incubated for 1 h with labeled isotype-specific secondary antibodies (anti-chicken AlexaFluor-546, anti-mouse Alexafluor-488, anti-rabbit Alexafluor-488, Invitrogen, Life Technologies Ltd, Paisley, UK) and counterstained with 4,6-diamidino-2-phenylindole (DAPI) for visualization of cell nuclei (PMID: 26610370). For all immunoreactions, negative controls (the primary antibody was replaced with pre-immune serum) were also included. Sections were examined in a coded fashion by Leica Microsystems DM 4500 B Light and Fluorescence Microscopy (Leica Microsystems, Weltzlar, Germany), equipped with a Jenoptik Prog Res C10 Plus Videocam (Jena, Germany). Immunofluorescence stains were also analyzed by Confocal Microscopy (Leica TCS-SP2). Slides were further processed with an Image Analysis System (IAS—Delta Sistemi, Roma-Italy) and were independently evaluated by two researchers in a blind fashion. Immunofluorescence stains were scanned by a digital scanner (Aperio Scanscope FL System, Aperio Technologies, Inc, Oxford, UK) and processed by ImageScope.
Quantitative Reverse Transcription and Polymerase Chain Reaction (qRT-PCR).
Total RNA was extracted from the organoids or grafts using Trizol (Invitrogen). First-strand cDNA synthesized using the Primescript 1st strand cDNA synthesis kit (Takara) was used as a template for PCR amplification. Quantitative analyses of mRNA levels were performed using Faststart Universal Probe Master (Roche Diagnostics) with ABI PRISM 7900HT Sequence Detection System (Applied Biosystems). Primers were designed with the Universal Probe Library Assay Design Center (Roche Applied Science). Primer sequences are listed in Table 5, below. The primers were annealed at 50° C. for 2 min and 95° C. for 10 min, followed by 40 cycles of 95° C. (15 s) and 60° C. (1 min). Expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used generally as a control and a standard.
| TABLE 5 |
| Primers (qPCR) |
| Accession | Length | Tm | |||
| Category | Name | Number | Sequence (5′ to 3′) | (bp) | (° C.) |
| Housekeep- | GAPDH | NM_001206359.1 | Sense: | 473 | 60° C. |
| ing gene | ATCCTGGGCTACACTGAGGAC | ||||
| (SEQ ID NO: 1) | |||||
| Anti-sense: | |||||
| AAGTGGTCGTTGAGGGCAATG | |||||
| (SEQ ID NO: 2) | |||||
| Pluripotency | Nanog | NM_001129971.1 | Sense: | 214 | 62° C. |
| genes | TTCCTTCCTCCATGGATCTG | ||||
| (SEQ ID NO: 3) | |||||
| Anti-sense: | |||||
| ATCTGCTGGAGGCTGAGGTA | |||||
| (SEQ ID NO: 4) | |||||
| Sox2 | NM_001123197 | Sense: | 216 | 60° C. | |
| GCCCTGCAGTACAACTCCAT | |||||
| (SEQ ID NO: 5) | |||||
| Anti-sense: | |||||
| GCTGATCATGTCCCGTAGGT | |||||
| (SEQ ID NO: 6) | |||||
| Oct4 | JN633978.1 | Sense: | 176 | 60° C. | |
| CGAAGCTGGACAAGGAGAAG | |||||
| (SEQ ID NO: 7) | |||||
| Anti-sense: | |||||
| GCTGAACACCTTCCCAAAGA | |||||
| (SEQ ID NO: 8) | |||||
| Endodermal | EpCAM | NM_214419.1 | Sense: | 314 | 53° C. |
| genes | ACCAGAGAATGCTATCCAGAAC | ||||
| (SEQ ID NO: 9) | |||||
| Anti-sense: | |||||
| CTCACTCGCTCCAAACAGG | |||||
| (SEQ ID NO: 10) | |||||
| Lgr5 | NM_001315762.1 | Sense: | 110 | 60° C. | |
| CCTTGGCCCTGAACAAAATA | |||||
| (SEQ ID NO: 11) | |||||
| Anti-sense: | |||||
| ATTTCTTTCCCAGGGAGTGG | |||||
| (SEQ ID NO: 12) | |||||
| Sox9 | NM_213843.2 | Sense: | 229 | 60° C. | |
| CGGTTCGAGCAAGAATAAGC | |||||
| (SEQ ID NO: 13) | |||||
| Anti-sense: | |||||
| GTAATCCGGGTGGTCCTTCT | |||||
| (SEQ ID NO: 14) | |||||
| Bmi1 | NM_001285971.1 | Sense: | 189 | 60° C. | |
| TCATTGATGCCACAACCATT | |||||
| (SEQ ID NO: 15) | |||||
| Anti-sense: | |||||
| TGAAAAGCCCCGGAACTAAT | |||||
| (SEQ ID NO: 16) | |||||
| GI tract- | Muc2 | NC_010444.3 | Sense: | 249 | 60° C. |
| related | GGCTGCTCATTGAGAGGAGT | ||||
| genes | (SEQ ID NO: 17) | ||||
| Anti-sense: | |||||
| ATGTTCCCGAACTCCAAGG | |||||
| (SEQ ID NO: 18) | |||||
| CDX2 | NC_010453.4 | Sense: | 115 | 56° C. | |
| AGAACCCCCAGGTCTCTGTCTT | |||||
| (SEQ ID NO: 19) | |||||
| Anti-sense: | |||||
| CAGTCCGAAACACTCCCTCACA | |||||
| (SEQ ID NO: 20) | |||||
| Hepatic | AFP | NM_214317.1 | Sense: | 609 | 60° C. |
| parenchymal | CGCGTTTCTGGTTGCTTACAC | ||||
| cells related | (SEQ ID NO: 21) | ||||
| genes | Anti-sense: | ||||
| ACTTCTTGCTCTTGGCCTTGG | |||||
| (SEQ ID NO: 22) | |||||
| Albumin | AY663543.1 | Sense: | 115 | 56° C. | |
| AGTCTGCCAAGCTGCTGATA | |||||
| (SEQ ID NO: 23) | |||||
| Anti-sense: | |||||
| AGCCTTGGGAAATCTCTGGC | |||||
| (SEQ ID NO: 24) | |||||
| Pancreatic | PDX-1 | NM_001141984.2 | Sense: | 139 | 62° C. |
| endocrine- | AGTGATACTGGATTGGCGTTG | ||||
| related | (SEQ ID NO: 25) | ||||
| genes | Anti-sense: | ||||
| TAGGGAGCCTTCCAATGTGT | |||||
| (SEQ ID NO: 26) | |||||
| MAFA | NC_010446.4 | Sense: | 120 | 62° C. | |
| GCTTCAGCAAGGAGGAGGTC | |||||
| (SEQ ID NO: 27) | |||||
| Anti-sense: | |||||
| TCTCGCTCTCCAGAATGTGC | |||||
| (SEQ ID NO: 28) | |||||
RNA-sequencing and Gene Expression Analyses. RNA was purified from cells using the Qiagen Rneasy Kit. RNA integrity (RIN) analysis was performed using an Agilent 2000 Bioanalyzer. The cDNA libraries were generated using the Illumina TruSeq Stranded mRNA preparation kit and sequenced on the Illumina HiSeq 2500 platform. Two samples were sequenced per lane, occupying a total of 8 lanes for all of the samples (one flow cell). Quality control analysis was completed using FastQ. Mapping of sequence reads to the human genome (hg19) was performed with MapSplice2 using default parameters. Transcript quantification was carried out by RSEM analysis, and DESeq was used to normalize gene expression and identify differentially expressed genes. MapSplice2 was also used to detect candidate fusion transcripts. Fusion calls were based on the depth and complexity of reads spanning candidate fusion junctions. Gene expression profiles were compared using Pearson's correlation analysis and hierarchical clustering was performed in R. Hierarchical clustering was performed following Variance Stabilizing Transformation provided in the DESeq package. Pathway enrichment analysis was performed with the Ingenuity Pathway Analysis (IPA) software. Differential gene expression analysis was conducted only on genes with a minimum average normalized count >50 in at least one category.
Statistical Analyses.
Statistically significant differences between samples were calculated by using Student's 2-tailed t test and results are presented as the mean±standard deviation (SD). P values of less than 0.05 were considered statistically significant.
Representative findings from studies in which organoids of porcine GFP+ BTSCs/ELSMCs were transplanted onto the livers of wild type pigs. The findings are presented in FIGS. 3-4, 6, 8-10, 14). The cells were able to engraft within a week or less and caused remodeling of the Glisson Capsule and the subjacent tissue during the engraftment process (FIGS. 3-4, 6, 8-10). The remodeling process demonstrated parallels with inflammatory processes (FIGS. 9A-9B). By week 2-3, the engrafted cells demonstrated maturation to adult cell types comprising hepatocytes and cholangiocytes (FIGS. 4A-4E). The engraftment process proved mediated by multiple matrix metalloproteinases (FIGS. 6A-6H) that caused the dramatic remodeling of the host tissue. With clearance of the graft biomaterials, the domain of paracrine signals (matrix and soluble signals) resulted in muting of the MMPs followed by maturation of the donor cells to adult cell types. By three weeks, the host tissue had stabilized and exhibited fully integrated donor and host cells throughout. Proof of the distribution of the donor cells into all regions of the host liver was achieved with PCR analyses for DNA encoding GFP (FIG. 14). The patch grafting method proved safe for the host and for the tissue. The only difficulties proved to be skin infections at the surgery site exacerbated by immuno suppression of the pigs (FIGS. 12A-12E).
Patch grafts containing organoids of porcine GFP+ BTSCs/ELSMCs were attached surgically to the livers of FAH/NRG mice. The livers were evaluated a month after transplantation. Donor cells were found throughout the host livers (FIGS. 3C, 5A-5P, 11, 13A-13C). As for the patch grafts on pig livers, those on the mouse livers resulted in rapid engraftment and integration throughout the host liver (FIGS. 13A-13C). Indeed, by a month, the donor cells largely took over the host liver. Ongoing studies are assessing the extent of domination by donor versus host cells at varying time points following surgical attachments of the grafts.
This example describes an exemplary method for administering a patch graft to an organ, such as a pancreas. Specifically, the detailed protocols describe the administering a patch graft to the pancreas of a mutant mouse (Akita/NRG) that is immunocompromised and also has a genetic condition that makes it prone to diabetes.
Preparation of Work Area.
Surgical tools are autoclaved prior to surgery. The entire surgical procedure is conducted in a laminar flow cabinet to minimize environmental contaminants. The necessary supplies are assembled on the preparation, surgical and recovery area, using proper aseptic technique. A recirculating water heating pad is prepared. The recirculating water heating pad has a temperature of 38° C. and is used for temperature stabilization during surgery. The heating pad is covered with a sterile waterproof pad. An operating microscope, such as UB56, which is provided by UNC Animal Facility, is used during the surgical procedure. An instrument sterilizer, such as a hot bead sterilizer, is used to sterilize instruments in between surgical procedures. Lastly, a recovery area consisting of a clean cage, lined by flat paper bedding, is prepared.
Preparing the Animals for Surgery.
For patch graft surgery, 8-week old male mice were used. The 8-week old male mice were housed in standard cages and maintained on a 12-hour light/12 hour dark cycle and fed a standard rodent diet ad libitum. The mice were anesthetized by peritoneal injection of 100 mg/kg of ketamine and 10 mg/kg of xylazine. Proper anesthetization was assessed by observing gradual loss of voluntary movement and muscle relaxation. The loss of reflexes was tested by toe pinching. Ophthalmic ointment was applied to prevent dryness of the eyes while under anesthesia.
Surgical Site Preparation.
The thorax and abdomen were disinfected with antiseptic chlorhexidine solution. Fur was removed from the area of the abdomen (approximately 2.5 cm×1.5 cm) by shaving. The shaven area is disinfected using gauze soaked with chlorhexidine solution, followed by an alcohol solution, and a final application of chlorhexidine solution. The animal is positioned in the surgical area such that the prepared surgical site is facing upwards toward the surgeon. To create a sterile working field, a waterproof surgical drape is draped over the mouse such that the disinfected abdominal region is exposed while the rest of the body is covered. Prior to performing the procedure, the mouse was monitored for depth of anesthesia.
Secure Patch on Surface of Pancreas.
An upper midline incision is made in the skin extending from the xiphoid process to the umbilicus using a sterile surgical blade. The underlying linea alba and the peritoneum are separated using sterile scissors in order to expose the upper abdominal quadrant. To prevent drying-out of the internal organs, the internal organs are regular sprinkled with a sterile solution of 0.9% sodium chloride. Using sterile tweezers or swab, the stomach is retracted superiorly, exposing the spleen and the splenic lobe (the tail region) of the pancreas. A patch graft (see below for its preparation) soaked in fresh, serum-free Kubota's medium in a culture dish is placed on the surface of the pancreas. The patch corners are secured with Surgical Adhesive (Patterson Veterinary, Devens, Mass.).
Preparation of the Patch Graft.
The backing for the patch graft is prepared well in advance of the surgery. The patch graft containing the cells in a soft hydrogel and on top of the backing is prepared a few hours before the surgery. The cells and the hyaluronan mixtures yielding hydrogels are all prepared in serum-free Kubota's Medium. There are three distinct hyaluronan hydrogels used varying in level of viscoelasticity (rigidity), with rigidity levels of 1×, 2×, and 10×, achieved by varying the ratio of the concentration of the thiol-modified hyaluronan with that of the polyethylene glycol diacrylate (PEGDA). The most rigid (˜600-800 Pa) of the 3 hydrogels (the 10×) is used to impregnate the backing of silk and is prepared well in advance (e.g. the day before) of the surgical procedures. At the time of the surgery, the soft hydrogel is prepared by mixing hyaluronan with PEGDA at a 4:1 ratio (50 μl of hyaluronan of which 20% is PEGDA) and is allowed to gel for about 5 minutes. Then the organoids (1×105) are mixed into this soft hydrogel; the mixture layered onto the backing; and the hydrogel/cell mixture allowed to continue the gelation process for another 30 minutes to 2 hours. The patch graft can now be tethered to the target site. For most tissues and organs, this can be by means of sutures at the corners of the grafts. For sensitive tissues such as the pancreas, it can be with surgical glue or, if the patch graft is positioned in part over duodenum and in part over pancreas, then use of sutures for the duodenum and surgical gue for the pancreas. After attachment of the graft, the patch grafts are coated with 200 μl of a HA hydrogel (viscoelasticity=200-300 Pa) to minimize adhesions by nearby tissues and organs.
The organs are placed back into the abdominal cavity. The incision is closed using 3.0 polyglycol filamentous thread in a continuous suture pattern for the muscle/peritoneal layer and in a discontinuous suture pattern for the skin.
Post-Operational Care and Monitoring.
After the surgical procedure is complete, the mouse is placed in the recovery area, which consists of a cage placed on a heating pad and lined with flat paper bedding in order to maintain normal body temperature. To avoid post-operative hypoglycemia, nutritional support (DietGel Recovery, ordered from ClearH2O company) is provided by placing moistened food on the bottom of the cage. Moistened food is prepared by soaking standard rodent diet pellets in water until they soften. Fluid support is provided by the moistened food and administration of water ad libitum. Buprenophine is used as analgesia (0.05-0.1 mg/kg) twice daily for 3 days post-surgery. During the entire experimental follow-up, the mice are observed for occurrence of possible signs of infection, including secretion of liquid or pus from the wound, or for physical deterioration characterized by reduction in grooming behavior and activity level, lower appetite and bodyweight loss.
In this example the use of patch grafts for the treatment of diabetes was investigated.
Mouse Models.
Two mouse rr odels were used in this example, Akita mice and the NRG/Akita mice. The Akita mice (DBA-Akita Inst Akita) on the DBA background is a recently described mouse mutant model of type I diabetes mellitus. Diabetes is the result of selective pancreatic β-cell toxicity and depletion resulting from misfolding of insulin2. Mice heterozygous for the Akita spontaneous mutation (Ins2Akita) are viable and fertile. They have hyperglycemia, hypoinsulinemia, polydipsia and polyuria beginning around 3-4 weeks of age. Studies carried out by the Animal Models of Diabetic Complications Consortium (AMDCC) indicated that the DBA/2J strain is especially prone to developing diabetic, nephropathic complications. Therefore, the advantage of this model of type I diabetes is the early onset progressive, functional and structural glomerular injury, and the fact that the diabetes occurs spontaneously.
The NRG/Akita mice are immunocompromised mice that have been genetically altered to have the genetic defect of the Akita mice. Breeding pairs of the two mouse models were ordered from the Jackson Laboratory (Bar Harbor, Me.) and used to establish colonies at UNC. Eight-week-old mice were used for patch grafting studies that lasted for approximately one month after which the mice are euthanized.
Patch Graft Administration and Results.
Patch grafts were produced as described in Example 1. Patch graft surgery, in which patch grafts containing cells were administered to the pancreas of mice as described in Example 4. In controls, surgery was also performed with graft biomaterials but without cells (e.g., mice treated with graft biomaterials only).
After the surgery, blood glucose levels were obtained from mice treated with patch grafts, mice treated with graft biomaterial only, and untreated mice (e.g., mice that did not receive patch grafts nor graft biomaterials). Mice treated with patch grafts showed a progressive reduction of blood glucose levels compared with mice treated with biomaterial only and untreated mice. The levels reduced were significant by 1 week after patch grafting and the effects were sustained for up to 3-4 weeks after which the mice were euthanized. Blood glucose levels were dynamically monitored using a glucose meter every other day starting 3 days after surgery in animals, each one after a 5-hour-fast. The results showed that hyperglycemia was alleviated in diabetic mice treated with patch grafts by around 7-10 days, and a few mice were corrected to euglycemia within 3 weeks (FIG. 15A, triangle). No such alleviation in hyperglycemia was observed in untreated diabetic mice (FIG. 15A, circle) nor in diabetic mice treated with biomaterial only (FIG. 15A, square). In addition, the gradual drop in glycemia was found to correlate with significantly increasing serum levels of C-peptide, which is indicative of insulin secretion (FIG. 15B, see third column at D7, D14, and D21, which corresponds to diabetic mice treated with patch grafts). Murine serum C-peptide levels were minimal in untreated diabetic mice (FIG. 15B, first column under D0, D7, D14, and D21), diabetic mice treated with biomaterial only (FIG. 15B, second column under D0, D7, D14, and D21), and diabetic mice treated with patch grafts at day 0 (FIG. 15B, third column under D0).
Serum insulin levels also gradually increased in diabetic mice treated with patch grafts FIG. 15C, third column under D21 and D28). Serum insulin levels did not increase in untreated diabetic mice (FIG. 15C, first column under D21 and D28) or diabetic mice treated with bio material only (FIG. 15C, second column under D21 and D28).
Intraperitoneal glucose tolerance tests (IPGTT) were also performed to assess the in supra-physiological glucose-stimulated insulin release. The measurement of this glucose spike was subsequently assessed over a period of time to determine the response of insulin to increased plasma glucose. Compared with non-diabetic mice (normal mouse controls, FIG. 15D, triangle), diabetic mice treated with biomaterial only (FIG. 15D, circle) showed a high basal glycemia and an altered glucose tolerance test with sustained hyperglycemia. By contrast, the diabetic mice treated with patch grafts containing cells (FIG. 15D, square) showed normal (or near normal) basal blood glucose levels and a response to IPGTT comparable to non-diabetic control mice (FIG. 15D, triangle). The data provides additional evidence for how the patch grafts enabled these formerly diabetic mice with the ability to tolerate and manage glucose spikes. The complete return to euglycemia in organoid-transplanted mice within 240 minutes is striking evidence of the remarkable ability of the BTSC cells to respond to supra-physiological glucose spikes. However, the correction of hyperglycemia was significantly slower than the correction observed in nondiabetic control mice.
In FIGS. 16A-16B-18A-18B are given images of pancreas sections from Akita/NRG mice with patch grafts from DS-red mice. The sections were stained for insulin (FIGS. 16A-16B) or NGN3 (FIGS. 17A-17C and 18A-18B). Donor cells are depicted red in FIGS. 18A-18B as visualized by DS red staining.
In this example, the grafting of patch grafts comprising GFP+ BTSCs/ELSMCs organoids from a transgenic pig was done onto the pancreas of a wild type pig.
Patch grafts containing organoids of porcine GFP+ BTSCs/ELSMCs were tethered onto the pancreas of wild type piglets and evaluated after one week. The GFP+ donor cells engrafted within a week and were found widely dispersed throughout the pancreas (FIGS. 19A-19B-21A-21C). At the first week time point, the engrafted cells had matured into both islets and acinar cells. However, the nuclear biomarker, GFP, was observed in the nucleus of the islets but in the cytoplasm of the acinar cells. Studies are ongoing to assess if GFP stabilizes to the nucleus at later time points, as occurred with engraftment in the liver.
In FIGS. 19A-19B-21A-21C, the green cells, whether islets or acinar cells, are the donor cells. Sections were also stained for insulin (red) such that those that are red with blue nuclei are host islets, whereas those that have red/purplish nuclei and yellowish cytoplasm are donor cell-derived beta cells in the islets. The antibodies used to detect insulin, glucagon, GFP, and amylase are shown in the table below:
| Fluoro- | Host Species | Species | |||
| Antibody | chrome | and Isotype | Reactivity | Manufacturer | Catalog # |
| Anti-Insulin | Guinea Pig | Human, Pig | Abcam | ab195956 | |
| Polyclonal | |||||
| Anti- | Mouse | Human, Pig, | Sigma-Aldrich | G2654 | |
| Glucagon | Monoclonal | Rat, Guinea | |||
| IgG1 | Pig, Feline, | ||||
| Mouse, | |||||
| Canine, Rabbit | |||||
| Anti-GFP | Rabbit | Aequorea | Novus | NB600-308 | |
| Polyclonal | victoria | Biologicals | |||
| Anti- | Mouse | Human, | Santa Cruz | sc-46657 | |
| Amylase 2B | Monoclonal | Mouse, Rat | Biotechnology | ||
| IgG2A | |||||
| Anti Guinea | Alexa | Donkey | ImmunoResearch | 706-605-148 | |
| Pig IgG | Fluor 647 | Laboratories | |||
| Anti Mouse | Alexa | Donkey | ThermoFisher | A-21203 | |
| IgG | Fluor 594 | Scientific - | |||
| Invitrogen | |||||
| Anti Rabbit | Alexa | Donkey | ThermoFisher | A-21206 | |
| IgG | Fluor 488 | Scientific - | |||
| Invitrogen | |||||
Immunofluorescent staining of the porcine pancreas that has been grafted with GFP+ BTSCs/ELSMCs from transgenic pigs are shown in FIGS. 19A-19B. Immunofluorescent staining for insulin is shown as red and GFP as green. The region of the graft was harvested and analyzed at day 7 post transplantation. Nuclei were stained with DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride) and appear blue. The GFP+ cells were inherently green from the transgene linked to the H2B histone but the intensity of the green color was enhanced by staining with an antibody to GFP and that was coupled to a green fluoroprobe. Large numbers of GFP+ donor-derived cells are visible in the proximity of the area where the patch graft was placed. Insulin expression, characteristic of pancreatic islet beta cells, was identified with an anti-insulin antibody coupled to a red fluoroprobe. Endogenous (host) islet beta cells appear red and are evident in the upper portion of the pancreas. Donor-derived beta cells appear with yellowish nuclei from the merge of the blue (DAPI) and green (GFP) and a cytoplasm that is red/orange from staining for insulin in the lower portion of the pancreas, proximal to the site of placement of the patch graft. This low magnification image demonstrates the extent of engraftment into the pancreas, as well as the engraftment into the submucosal region of the duodenum, the location of Brunner's Glands (hypothesized to be the starting point of the network of cells contributing to organogenesis of the liver and pancreas).
Immunofluorescent staining for amylase and GFP in a sequential section from the same tissue block is shown in FIG. 19B. Amylase (green) is detected predominantly in pancreatic acinar tissue, as well as in the mucosal layer and in the lumen of the duodenum. Insulin (red) does not overlap with Amylase (green). This staining, in combination with that of FIG. 19A, suggests that a large portion of GFP+ donor-derived cells committed to a pancreatic acinar-like fate.
Immunofluorescent staining for insulin and GFP in pancreatic tissue sections from 3 recipients of GFP+ BTSCs/ELSMCs patch graft transplantation (day 7 post transplantation) is shown in FIGS. 20A-20C. GFP+ cells were observed in the parenchyma of the pancreas, in the proximity of the patch graft site, in all recipients. Notably, GFP+ cells appeared at several millimiters of distance from the patch material, and appeared to be well integrated into the parenchyma of the recipient pancreas. Patch material (SERI silk) presented a degree of fluorescence in different channels and is still visible at day 7 post transplantation.
FIGS. 21A-20C demonstrate the co-existence of endogenous (host) islet beta cells (Insulin+/GFP−: red cytoplasm) and donor-derived islets beta cells (Insulin+/GFP+: yellow-orange cytoplasm) in the pancreas at 7 days post transplantation of GFP+ BTSCs/ELSMCs patch graft. Donor-derived islet beta cells and endogenous (host) islet beta cells were observed in all cases. The majority of GFP+ cells presented a phenotype consistent with that of pancreatic acinar cells. GFP+ cells organized to form a ductal structure are visible in the lower portion of FIG. 21A.
This example describes the detailed protocol for an exemplary method for treating diabetes by administering patch grafts to mice made diabetic by treatment with STZ.
Animal Care and Housing.
8-14-week-old C57BL/6 (Jax Stock 000664), BALB/c (Jax stock 000651), and DsRed.MST B6 (Jax Stock 006051) are housed in standard cages, maintained on a 12 hour light/12 hour dark cycle, and fed a standard rodent diet ad libitum.
8-14-week-old immunodeficient NSG mice (Jax Stock 005557) are housed in a germ-free environment on a 12 hour light/12 hour dark cycle and fed an autoclaved diet ad libitum.
DSRed.MST B6 mice are used as donors of islets and BTSCs/ELMCs.
C57BL/6, BALB/c, and NSG mice are used as recipients.
Day −14 Diabetes Induction.
Diabetes is induced in prospective recipients via streptozotocin treatment at a dose of 250 mg/kg. After the first injection, glycemic values are monitored and an animal is considered diabetic if glycemia is found to be >350 mg/dl for 3 consecutive days. In rare cases the first dose of streptozotocin may result only partially effective (e.g., glycemic values not reaching >350 mg/dl for 3 consecutive days), hence such animals receive additional dosing(s) to complete beta cell depletion and induction of sustained hyperglycemia. Streptozotocin treatment is repeated for a maximum of 3 times, with each injection 3 days apart. 95-100% of the animals treated with streptozotocin are expected to develop diabetes.
Diabetic animals are maintained with LP insulin pellets, placed in the subdermal space. Insulin pellets will be removed at +15 days after patch graft transplantation.
Day 1:
Hyaluronic Acid (HA) hydrogel is combined with 20% polyethylene glycol diacrylate (PEGDA) linker solution. After the soft HA gel constituents are mixed, they are allowed to gel for ˜5 minutes and then are added the BTSCs/ELMCs organoids (1×105) or islets (2000 IEQ) and the gelation allowed to continue for another 30 minutes to 3 hours. This is added on top of a premade backing containing the more rigid hyaluronan layer; this was prepared a day ahead of time and allowed to complete gelatin overnight by culturing in a 37° C. 5% CO2 incubator at the air-liquid interface.
Preparation of Work Area.
Autoclave surgical tools prior to surgery. Appropriate protective covering is worn for the surgery. Multiple sets of sterile gloves are available for use in the surgical work area. The entire surgical procedure is performed in a laminar flow cabinet to minimize environmental contaminants. Necessary supplies are assembled on the preparation, surgical and recovery area, using proper aseptic technique. A heating pad at a temperature of 38° C. is prepared for temperature stabilization during surgery. Surgery is performed with the use of an operating microscope. An instrument sterilizer, such as a hot bead sterilizer, is used to sterilize instruments in between surgical procedures. A recovery area consisting of a clean cage, lined by flat paper bedding is prepared.
Preparation of the Animals for Surgery.
A set of transplantations are sex-mismatched: cells from male donors will be transplanted in female recipients, to enable Y chromosome tracing and confirmation of fluorescent tracing.
The mouse is weighed and the required dose of Ketamine (100 mg/kg) and Xylazine (10 mg/kg) is calculated. The mouse is anesthetized by intraperitoneal injection of 100 mg/kg of Ketamine and 10 mg/kg of Xylazine. Proper anesthetization is assessed by observing gradual loss of voluntary movement and muscle relaxation. The loss of reflexes is tested by toe pinching. An ophthalmic ointment is applied to prevent dryness of the eyes while under anesthesia. As an alternative, isoflurane 2% via inhalation may be used to anesthetize the mouse.
Surgical Site Preparation.
Fur is removed by shaving from the abdomen (approximately an area of 2.5 cm×1.5 cm). The thorax and abdomen are disinfected with antiseptic chlorhexidine solution. The shaved area is disinfected using gauze soaked with chlorhexidine solution, then wiped with alcohol solution, and applying again the chlorhexidine solution. The animal is positioned and secured in the surgical area, by laying the animal on its back such that the prepared surgical site in the abdominal region is upwards facing the surgeon. The mouse is draped using a waterproof surgical drape with an opening that leaves the disinfected abdominal region exposed while covering the rest of the body to create a sterile working field. The mouse is monitored prior to the procedure for depth of anesthesia.
Secure Patch on Surface of Pancreas.
An upper midline incision is made in the skin extending from the xiphoid process to the umbilicus using a sterile surgical blade. The incision in the skin is extended from the xiphoid process towards the upper limbs, 1 cm in each direction. The incision is extended from the umbilicus in both directions toward the lower limbs, 1 cm in each direction. The underlying linea alba and the peritoneum are separated using sterile scissors or scalpel in order to expose the upper abdominal quadrant. The incision is divaricated with retainer clips. To prevent drying-out of the internal organs, the internal organs are regularly sprinkled with sterile 0.9% sodium chloride. Sterile tweezers or swab are used to retract the stomach superiorly, and the intestine inferiorly, exposing the spleen and the splenic lobe (the tail region) of the pancreas. A piece of patch loaded with cells embedded in HA gel is soaked in fresh Kubota's Medium in a culture dish. The gel side is oriented such that it faces the pancreas (this patch resembles a BandAid, the gel is only on one side). The patch is laid on the surface of the body of the pancreas, such that the gel side contacts the pancreas. The two patch corners are secured with Surgical Adhesive (Patterson Veterinary, Devens, Mass.). The patch is covered with 200 μl of 2×HA hydrogel to minimize adhesions among organs. The organs are placed back into the abdominal cavity. The incision is closed using 3.0 polyglycol filamentous thread in a continuous suture pattern for the muscle/peritoneal layer and in a discontinuous suture pattern for the skin.
Post-operational Care and Monitoring.
After the surgical procedure is completed, the mouse is placed in the recovery area. The recovery area consists of a cage placed on a heating pad and lined with flat paper bedding in order to maintain normal body temperature. To avoid post-operative hypoglycemia, nutritional support (DietGel Recovery, ordered from ClearH2O company) is provided by soaking rodent diet pellets in water until they soften and placing the moistened food on the cage bottom. Fluid support is provided via the moistened food and provide water ad libitum. Buprenophine is used as analgesia (0.05-0.1 mg/kg) twice daily for 3 days post-surgery or the SR version which is 1 injection with 72 hr effect. During the entire experimental follow up, the mice are observed for occurrence of possible signs of infection, including secretion of liquid or pus from the wound, or for physical deterioration characterized by reduction in grooming behavior and activity level, lower appetite and body weight loss. A preventative antibiotic, such as Clavamox or Baytril, is placed in the drinking water for up to 14 days post op.
1. A method of engrafting cells into a solid organ of a subject in need thereof, comprising:
contacting a patch graft onto a solid organ,
the patch comprising a mixture of epithelial cells and mesenchymal cells incorporated into a biomaterial having a first viscoelasticity property, in which the biomaterial promotes an engraftment of at least a portion of said epithelial cells, mesenchymal cells, or both among the cells of the solid organ;
demonstrating that at least a portion of said epithelial cells, mesenchymal cells, or both have engrafted among the cells of the solid organ.
2. The method of claim 1 in which said demonstrating comprises measuring a level of a secretion from the solid organ, or a metabolic effect of the solid organ, in a biological sample obtained from the subject to demonstrate that at least a portion of said epithelial cells have engrafted among the cells of the solid organ.
3. A method of engrafting cells into a solid organ of a subject in need thereof, comprising:
contacting a patch graft onto a solid organ,
the patch comprising a mixture of epithelial cells and mesenchymal cells incorporated into a hydrogel layer having a first viscoelasticity property, in which the hydrogel promotes a migration of at least a portion of said epithelial cells, mesenchymal cells, or both from the patch through an outer surface of the solid organ,
demonstrating that at least a portion of said epithelial cells, mesenchymal cells, or both have migrated through an outer surface of the solid organ.
4. The method of claim 3 in which said demonstrating comprises measuring a parameter or a change in same, which indicates a physiological effect in the subject resulting from the migrated cells.
5. The method of claim 1 in which the patch graft further comprises a backing that promotes a migration of at least a portion of the mixture of epithelial cells and mesenchymal cells towards the solid organ.
6. The method of claim 5 in which at least a portion of the mixture of epithelial cells and mesenchymal cells migrates over the substantial width of the solid organ and distributes throughout the solid organ.
7. The method of claim 1 in which the solid organ is an endodermal organ.
8. The method of claim 1 in which the solid organ is an endodermal organ comprising liver, pancreas, intestine, lung, bile duct, thymus, thyroid, parathyroid and the urogenital sinus region of the prostate and vagina.
9. The method of claim 8 in which the endodermal organ comprises liver, and engraftment involves a remodeling of Glisson's Capsules.
10. The method of claim 8, which further gives rise to a combination of (i) engrafted epithelial cells and mesenchymal cells and (ii) host cells.
11. The method of claim 8, which gives rise to functional hepatic parenchymal cells.
12. The method of claim 11, in which the parenchymal cells comprise hepatocytes and cholangiocytes.
13. The method of claim 8, in which the endodermal organ comprises pancreas, and engraftment involves a remodeling of pancreatic capsules and pancreatic tissue near to the graft site.
14. The method of claim 13, which gives rise to functional pancreatic cells.
15. The method of claim 14, in which the functional pancreatic cells comprise acinar cells and islets.
16. The method of claim 14, in which the pancreas secretes increased levels of at least one of insulin, c-peptide, glucagon, somatostatin, or pancreatic polypeptide.
17. The method of claim 14, in which the pancreas exhibits a metabolic effect of reduced blood sugar levels.
18. The method of claim 14, in which the pancreas exhibits a metabolic effect of increased glucose tolerance.
19. The method of claim 14, in which the pancreas secretes increased levels of a digestive enzyme or bicarbonate fluid.
20. The method of claim 19, in which the digestive enzyme comprises amylase, lipase, peptidase, ribonuclease, deoxyribonuclease, gelatinase, elastase, or combinations thereof.
21. The method of claim 14, which results in increased levels of a metabolic product derived from a digestive enzyme secreted by the pancreas.
22. The method of claim 21, in which the digestive enzyme comprises amylase, lipase, peptidase, ribonuclease, deoxyribonuclease, gelatinase, elastase, or combinations thereof.
23. The method of claim 21, which results in improved digestion.
24. The method of claim 11, in which the liver secretes urea, bile acids, phospholipids, lipoproteins, bilirubin, bicarbonate-rich fluids, or blood-clotting factors.
25. The method of claim 4, in which a biological sample obtained from the subject indicates reduced levels of at least one of cholesterol, blood sugar, alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, albumin, ammonia, gamma-glutamyltransferase, or L-lactate dehydrogenase.
26. The method of claim 1 in which the patch includes a backing positioned over the hydrogel containing of the mixture of epithelial cells and mesenchymal cells.
27. The method of claim 26, in which the backing is used to tether the hydrogel layer to the host organ.
28. The method of claim 1, in which at least one of the epithelial cells, mesenchymal cells, or both are early lineage stage cells.
29. The method of claim 28, in which the early lineage stage mesenchymal cells (ELSMCs) comprise angioblasts, precursors of endothelia, stellate cells, or combinations thereof.
30. The method of claim 28, in which the early lineage stage epithelial cells (ELSEs), ELSMCs, or both are derived from embryonic stem (ES) cells or from induced pluripotent stem cells (iPS).
31. The method of claim 1, in which the epithelial cells are mature and the mesenchymal cells are ELSMCs.
32. A method of introducing, restoring, increasing, or improving functionality of a diseased, impaired, or malfunctioning solid organ of a subject, comprising contacting the diseased, impaired, or malfunctioning solid organ with a patch graft comprising a mixture of epithelial cells and mesenchymal cells under conditions that promote engraftment of the epithelial cells and mesenchymal cells; demonstrating an introduction, restoration, increase, or improvement of a functionality in the diseased, impaired, or malfunctioning solid organ.
33. The method of claim 32, in which said demonstrating comprises measuring in a biological sample obtained from the subject a level of a secretion or metabolic product or effect.
34. The method of claim 32, which further comprises demonstrating that a least a portion of the mixture of epithelial cells and mesenchymal cells has distributed among the cells of the host organ.
35. The method of claim 32, in which an exposed surface of the patch graft includes a coating that inhibits adhesion of the patch graft to organs and tissues in the vicinity of the patch graft.
36. The method of claim 32, in which the solid organ comprises an endodermal organ.
37. The method of claim 36, in which the endodermal organ comprises liver, pancreas, intestine, lung, bile duct, thymus, thyroid, parathyroid or the regions from the urogenital sinus of the prostate or vagina.
38. The method of claim 33, in which the solid organ comprises a pancreas and in which an increased level of the secretion of at least one of insulin, c-peptide glucagon, somatostatin, or pancreatic polypeptide is measured.
39. The method of claim 32, in which the solid organ comprises a pancreas and in which a reduced blood sugar level is measured.
40. The method of claim 32, in which the solid organ comprises a pancreas and in which increased glucose tolerance is demonstrated.
41. The method of claim 32, in which the solid organ comprises a pancreas and in which increased levels of a digestive enzyme or bicarbonate fluid is demonstrated.
42. The method of claim 41, in which the digestive enzyme comprises amylase, lipase, peptidase, ribonuclease, deoxyribonuclease, gelatinase, or elastase.
43. The method of claim 33, in which the solid organ comprises a pancreas and in which increased levels of a product from a digestive enzyme secreted by the pancreas is measured.
44. The method of claim 43, in which the digestive enzyme comprises amylase, lipase, peptidase, ribonuclease, deoxyribonuclease, gelatinase, or elastase.
45. The method of claim 32, in which the solid organ comprises a pancreas and in which improved digestion is demonstrated.
46. The method of claim 33, in which the solid organ comprises liver, and in which a secretion comprises urea, bile acids, phospholipids, lipoproteins, bilirubin, bicarbonate-rich fluids, blood-clotting factors, or combinations thereof.
47. The method of claim 33, in which the solid organ comprises liver, and in which a metabolic effect is a reduced level of one or more of cholesterol, blood sugar, alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, albumin, ammonia, gamma-glutamyltransferase, or L-lactate dehydrogenase.
48. The method of claim 32, in which the solid organ comprises a liver, and the subject suffers from type 1 tyrosinemia.
49. The method of claim 33, in which a metabolic effect is a decrease in levels of tyrosine or alpha-fetoprotein.
50. A method of treating a subject diagnosed with a pathological condition attributable at least in part to having a diseased, impaired, or malfunctioning solid organ, comprising
(i) contacting the diseased, impaired, or malfunctioning solid organ with a patch graft comprising a mixture of epithelial cells and mesenchymal cells,
(ii) allowing the epithelial cells and mesenchymal cells to migrate into and distribute among the cells of the host solid organ, and
(iii) demonstrating that a negative effect of said diseased, impaired, or malfunctioning solid organ has been alleviated in the treated subject.
51. The method of claim 50, in which said demonstrating comprises measuring in a biological sample obtained from the subject a level of a secretion or a metabolic product or effect.
52. The method of claim 50, in which the migration and distribution steps lead to an alleviation of the disease, impairment, or malfunction.
53. The method of claim 50, in which the solid organ is an endodermal organ.888888
54. The method of claim 53, in which the endodermal organ comprises liver, pancreas, intestine, lung, bile duct, thymus, thyroid, parathyroid, and the urogenital sinus regions of the prostate or vagina.
55. The method of claim 53, in which the endodermal organ is pancreas and in which the subject suffers from diabetes.
56. The method of claim 55, in which increased levels of at least one of insulin, c-peptide, glucagon, somatostatin, or pancreatic polypeptide is measured.
57. The method of claim 55, in which reduced blood sugar levels are demonstrated.
58. The method of claim 55, in which increased glucose tolerance is demonstrated.
59. The method of claim 50, in which the subject comprises a mammal.
60. The method of claim 59, in which the mammal is human.
61. A patch graft comprising a mixture of epithelial cells and mesenchymal cells and one or more biomaterial layers including, at least:
a) a first, inner layer for contacting a solid organ, the first inner layer exhibiting a first viscoelastic property, incorporating a mixture of epithelial cells and mesenchymal cells, supporting an ability of the epithelial cells and the mesenchymal cells to produce secreted matrix metallo-proteinases (MMPs) and promoting viability and immaturity of said epithelial cells and mesenchymal cells;
b) optionally, a backing that confers a barrier to the cells migrating in a direction other than towards the solid organ, the backing exhibiting a second viscoelastic property; and
c) optionally, a third, outer layer of a coating or material that minimizes is adhesions of the patch graft to internal surfaces of a body cavity, including internal walls and/or organs, in proximity to the patch graft; wherein said viscoelastic properties are determined by measuring rheological traits and expressed in Pascals (Pa).
62. The patch graft of claim 61, in which the epithelial cells comprise early lineage stage epithelia cells (ELSEs) and the mesenchymal cells comprise early lineage stage mesenchymal cells (ELSMCs), or in which the epithelial and mesenchymal cells are of later lineage stages but are of comparable lineage stages as each other.
63. The patch graft of claim 62, in which the ELSMCs comprises angioblasts, precursors of endothelia, stellate cells, or combinations thereof.
64. The patch graft of claim 62, in which the ELSEs and/or the ELSMCs are derived from embryonic stem (ES) cells or from induced pluripotent stem cells (iPS).
65. The patch graft of claim 61, in which the epithelial cells are of a later lineage stage and the mesenchymal cells are early lineage stage mesenchymal cells (ELSMCs), or the mesenchymal cells are of a later lineage stage and the epithelial cells are early lineage stage epithelial cells (ELSEs).
66. The patch graft of claim 61, in which the second viscoelastic property (expressed in Pa) has a greater value than the first viscoelastic property.
67. The patch graft of claim 61, in which the one or more biomaterial layers comprise a hydrogel, which further comprises minimally sulfated or non-sulfated glycosaminoglycans.
68. The patch graft of claim 67, in which the non-sulfated glycosaminoglycans comprise hyaluronans.
69. The patch graft of claim 68, in which the hyaluronans comprise a thiol-modified hyaluronan, whose gelation by disulfide bridge formation is triggered in the presence of polyethylene glycol diacrylate (PEGDA).
70. The patch graft of claim 69, in which the rheological traits are determined, at least in part, by a starting concentration and rigidity of thiol-modified hyaluronan and PEGDA prior to gelation, a final rigidity of hydrogel post-gelation achieved by the precise ratios of the volumes of thiol-modified hyaluronan and PEGDA.
71. The patch graft of claim 61, in which the first, inner layer exhibits a first viscoelasticity of from about 50 Pa to about 150 Pa.
72. The patch graft of claim 61, in which the optional backing contains a hyaluronan hydrogel layer that exhibits a viscoelasticity from about 600 to about 800 Pa.
73. The patch graft of claim 61, in which the optional third, outer layer comprises a hyaluronan hydrogel layer with viscoelasticity properties of from about 200 to about 300 Pa.
74. The patch graft of claim 61, in which the backing comprises silk.
75. The patch graft of claim 74, in which the silk backing comprises a purified fibroin of Bombyx™ moth silk knitted into a scaffold, including Seri-Silk™ or Contour Seri Silk™.
76. The patch graft of claim 61, in which the epithelial cells comprise biliary tree stem cells (BTSCs) and the mesenchymal cells comprise early-lineage-stage mesenchymal cells (ELSMCs).
77. The patch graft of claim 76, in which the ELSMCs comprise angioblasts and their immediate descendants, precursors to endothelia cells, precursors to stellate cells, or combinations thereof.
78. The patch graft of claim 77, in which the angioblasts express CD117, CD133, VEGFr, but do not express CD31.
79. The patch graft of claim 77, in which the precursors to endothelia cells express CD133, VEGFr, CD31 and Van Willebrand Factor.
80. The patch graft of claim 77, in which the precursors to stellate cells express CD146, ICAM-1, alpha-smooth muscle actin (ASMA) and are negative for vitamin A.
81. The patch graft of claim 61, in which the mixture of epithelial cells and mesenchymal cells is produced by depleting cell suspensions of mature mesenchymal cells, optionally, by repeated panning procedures to remove cells that attach within from about 15 minutes to about 30 minutes on tissue culture dishes or surfaces at 37° C.
82. The patch graft of claim 81, in which a culturing of the remaining cell suspensions is performed on low-attachment dishes and in a serum-free medium until a plurality of organoids is formed by self-assembly of epithelial cells and mesenchymal cells.
83. The patch graft of claim 82, in which the serum-free medium comprises a basal medium (with no copper, low calcium (0.3 mM), 1 nM selenium, 0.1% bovine serum albumin (purified, fatty-acid-free; fraction V), 4.5 mM nicotinamide, 0.1 nM zinc sulfate heptahydrate, 5 μg/ml transferrin/Fe, 5 μg/ml insulin, and a mixture of purified free fatty acids that are presented complexed with fatty acid free highly purified albumin.
84. The patch graft of claim 83, in which the serum-free medium further comprises 10 μg/ml high density lipoprotein.
85. The patch graft of claim 82, in which the plurality of organoids is formed after about 2 hours, after about 4 hours, after about 6 hours, after about 8 hours, after about 10 hours, after about 12 hours, after about 14 hours, after about 16 hours, after about 18 hours, after about 20 hours, after about 22 hours, or after about 24 so hours.
86. The patch graft of claim 82, in which the plurality of organoids comprises BTSCs positive for:
a) at least one marker selected from the group of pluripotency genes consisting of OCT4, Sox2, Sall4, Nanog, Klf5, Cdx2 and Bmi1,
b) at least one marker selected from the group of endodermal transcription factors consisting of Sox9, Sox17, Pdx1, HNF4alpha, HNFB1 and ONECUT2,
c) at least one marker selected from the group of surface markers associated with stem/progenitors consisting of EpCAM, NCAM, LGR5, one or more isoforms of CD44, CXCR4, sodium iodide symporter (NIS), CD49 (integrin A6), CD29 (integrin B1) and integrin B4;
wherein the BTSCs are negative for markers of mature hepatic or pancreatic cells, including P450s, aquaporin, enzymes involved in bile production, amylase and digestive enzymes.
87. The patch graft of claim 61, in which the one or more biomaterial layers comprise recombinant MMPs.
88. The patch graft of claim 61, in which the one or more biomaterial layers comprise cells engineered to express MMPs.