US20200032352A1
2020-01-30
16/595,564
2019-10-08
Described herein are biomarkers for HPV-associated pre-cancers and cancers such as cervical cancer and cervical intraepithelial neoplasia. The RNA binding protein (RBP) and long-noncoding RNA (lnc-RNA) biomarkers can be detected and used to diagnose HPV-associated pre-cancers and cancers. In addition, early diagnosis of HPV-associated pre-cancers and cancers can facilitate therapeutic intervention in patients, particularly in the pre-cancer stage which can delay or prevent progression to cancer.
Get notified when new applications in this technology area are published.
C12Q2600/158 » CPC further
Oligonucleotides characterized by their use Expression markers
C12Q2600/112 » CPC further
Oligonucleotides characterized by their use Disease subtyping, staging or classification
C12Q1/6886 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
This application is a continuation of U.S. application Ser. No. 15/270,774 filed on Sep. 20, 2016, which is incorporated herein by reference in its entirety.
This invention was made in part with government support from the National Institutes of Health. The government has certain rights in this invention.
The present disclosure is related to novel polynucleotide biomarkers which can be detected and can be used for the diagnosis of HPV-associated pre-cancers and HPV-associated cancers such as cervical cancer and cervical intraepithelial neoplasia as well as methods of treatment of HPV-associated pre-cancers and HPV-associated cancers.
High-risk HPV persistent infection leads to the development of certain types of cancers in the cervix, anus, and oropharynx, for example. Fifteen mucosal HPV types are identified as oncogenic or high-risk (HR) HPVs, with HPV16 and HPV18 being particularly associated with invasive cervical cancer. Cervical cancer is the second most common cancer among women worldwide. Approximately 500,000 incident cases of cervical cancer and approximately 320,000 cervical cancer deaths are estimated each year and more than 80% of the cases arise in developing countries.
There is a need for diagnostic markers that can be detected and used for early diagnosis of high-risk HPV infection, HPV-associated pre-cancer and HPV-associated cancer and for the development of intervention strategies for treatment of HPV-induced cancers.
In one aspect, a method of determining if a test patient has stage 1, stage 2, or stage 3 cervical intraepithelial neoplasia or cervical cancer comprises
In another aspect, the method of determining if a test patient has stage 1, stage 2, or stage 3 cervical intraepithelial neoplasia or cervical cancer comprises
In a further aspect, a method of quantitating an expression level of a first polynucleotide biomarker in a sample containing cells from a test patient's cervix with one or more first polynucleotides that hybridizes to the first polynucleotide biomarker comprises
In a yet further aspect, a method of treating a test patient in need of treatment for stage 1, stage 2, or stage 3 cervical intraepithelial neoplasia or cervical cancer comprises
In a still further aspect, a method of determining if a test patient has an HPV-associated pre-cancer or an HPV-associated cancer comprises
In another aspect, a method of quantitating an expression level of a first polynucleotide biomarker in a sample containing cells from a tissue of the test patient with one or more first polynucleotides that hybridizes to the first polynucleotide biomarker comprises
In a yet further aspect, a method of treating a test patient in need of treatment for an HPV-associated pre-cancer or an HPV-associated cancer comprises
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon receipt and payment of the necessary fee.
FIG. 1 is a flowchart of the RNA-sequencing (RNA-Seq) analyses for RNA-binding proteins (RBPs).
FIG. 2 shows Venn diagrams showing 95 differentially expressed RBP genes being identified from two separate RNA-seq analyses of cervical cancer, pre-cancer to normal cervical tissues.
FIG. 3 shows a heat map comparing 95 differentially expressed RBP genes in cervical cancer to normal cervical tissues.
FIG. 4 shows the TaqMan® RT-qPCR validation of the 8 selected RBPs.
FIG. 5 shows that high-risk HPV16 infection affects the expression of RBPs. Total RNA extracted from human vaginal keratinocyte (HVK)-derived raft cultures with (HVK16) or without (HVK) productive HPV16 infection and human foreskin keratinocyte (HFK) derived raft cultures with (HFK16) or without (HFK) productive HPV16 infection were examined by TaqMan® RT-qPCR for the expression of 8 RBPs.
FIG. 6 shows that high-risk HPV18 infection affects the expression of RBPs. Total RNA extracted from human vaginal keratinocyte (HVK)-derived raft cultures with (HVK18) or without (HVK) productive HPV18 infection and human foreskin keratinocyte (HFK) derived raft cultures with (HFK18) or without (HFK) productive HPV18 infection were examined by TaqMan® RT-qPCR for the expression of 8 RBPs.
FIG. 7 shows that both HPV16 and HPV18 increase the expression of CDKN2A and RNASEH2A, but decrease the expression of NOVA1 in HFK- and HVK-derived rafts.
FIG. 8 shows that HPV18 infection and viral E6 and/or E7 affect the expression of RNASEH2A and Nova1. The expression of RNASEH2A and NOVA1 in primary human keratinocytes (PHK)-derived raft tissues with or without HPV18 infection on day 8, day 12, and day 16 or PHK rafts transduced with a retrovirus expression HPV18 E6, E7 or E6E7 or with an empty control retrovirus were further validated by TaqMan® RT-qPCR.
FIG. 9 shows that knockdown or overexpression of RNASEH2A in HeLa or CaSki cells affects cell proliferation. Specific-siRNA knockdown or ectopic expression of RNASEH2A from a mammalian expression vector in HeLa or CaSki cells on cell proliferation was evaluated by Cell Counting Kit-8 (CCK-8) assay
FIG. 10 shows HPV oncoprotein E7 regulates the expression of RNASEH2A via E2F1. Specific-siRNA knockdown or ectopic expression of E2F1 from a mammalian expression vector in HeLa or CaSki cells on RNASEH2A was evaluated by Western blot.
FIG. 11 is a flowchart of the RNA-Seq analyses for long-noncoding RNAs (lnc-RNAs).
FIG. 12 is a heat map showing 209 overlapped, differentially expressed lnc-RNAs from cervical cancer, pre-cancer to normal cervical tissues.
FIG. 13 shows an increase of lnc-FANCI-2, and decrease of lnc-GLB1L2-1 expression along with the cervical lesion progression from normal cervix. Lnc-FANCI-2 and lnc-GLB1L2-1 RNA expression was examined by RT-qPCR in 24 normal, 25 CIN 2-3, and 23 cancer tissues.
FIG. 14 shows that HPV infection increases lnc-FANCI-2 expression in HVK- and PHK-derived rafts and viral E7 or E6 is responsible for the increase. The expression of lnc-FANCI-2 in human vaginal keratinocytes (HVK)-derived raft tissues without (HVK) or with HPV16 (HVK16) or HPV18 (HVK18) infection or primary human keratinocytes (PHK)-derived raft tissues without or with HPV18 infection.
The above-described and other features will be appreciated and understood by those skilled in the art from the following detailed description, drawings, and appended claims.
Using an RNA-sequencing (RNA-Seq) approach, the inventors of the present application examined seven normal cervical tissues and seven cervical cancer tissues for their expression landscapes of approximately 19,000 coding and 113,513 noncoding RNAs. 614 differentially expressed coding transcripts enriched in cancer related pathways were identified, with 95 of them encoding RNA-binding proteins (RBPs) from the analyzed 1502 human RBPs. Moreover, 209 differentially, abundantly expressed long-noncoding RNAs (lnc-RNAs) from normal cervix to cervical cancer were identified. Validation of the altered expression of 26 candidates, including 8 RBP genes by using TaqMan® real-time PCR in a cohort of 47 human cervical tissue samples, including 24 normal cervical tissues and 23 cervical cancer tissues, showed that they are broadly involved in cervical carcinogenesis. Many of the identified RBP candidates had not been previously reported. Using human vaginal keratinocyte-derived raft culture tissues with or without HPV16 and HPV18 infection, it was further corroborated that these RBP candidates, including CDKN2A, ELAVL2, GRB7, HSPB1, KHSRP, PTBP1, RNASEH2A, and NOVA1, are regulated by HPV infection. Further, the inventors found that lnc-FANCI-2 was increasingly expressed along with cervical lesion progression from cervical intraepithelial neoplasia (CIN) to cervical cancer, when compared to the normal tissues. In contrast, lncGLB1L2-1 was gradually decreased along with the lesion progression, when compared to the normal tissues. In addition, FAM83A, SEMA3F, CLDN10, ASRGL1, which are not RBPs, were also found to have altered expression in cervical cancer compared to normal tissue, with FAM83A and SEMA3F being increased in cervical cancer and CLDN10 and ASRGL1 being decreased in cervical cancer. The results presented herein provide the first comprehensive expression atlas of RBPs and lnc-RNAs in normal cervix and cervical cancer, which can be detected to provide better diagnosis and treatment of patients with cervical cancer.
More specifically, an increase of lnc-FANCI-2 RNA, including all of its 35 isoforms, and a decrease of lnc-GLB1L2-1, including its 21 isoforms, were identified in cervical cancer. Fanconi anemia (FA) frequently develops squamous cell carcinoma at sites that are associated with HPV-driven cancer including the female reproductive tract, and is caused by mutations in one of 15 genes in the FA pathway (including FANCA, FANCD2, and FANCI). Loss of FA pathway components FANCA and FANCD2 stimulates E7 protein accumulation in human keratinocytes, and loss of FANCD2 stimulates HPV DNA replication. Both FANCI and lnc-FANCI-2 are expressed from the same location at chromosome 15q26.1. Further, both GLB1L2 (galactosidase, beta 1-like 2) and lnc-GLB1L2-1 are expressed from Chromosome 11q25, with unknown function in cancer development. By using TaqMan® qRT-PCR validation of lnc-FANCI-2 and lnc-GLB1L2-1 in 24 normal, 25 CIN 2-3, and 23 cervical cancer tissues, it was confirmed that altered expression of these lnc-RNAs is remarkably related to cervical lesion progression from CIN to cancer. Moreover, the altered changes of lnc-FANCI-2 could be attributed to HPV16 and HPV18 infection in raft cultures and viral E7 expression. These lnc-RNAs are biomarkers for early diagnosis of high-risk HPV infection with high risk of progression and for development of intervention strategies to treat HPV-induced cancers.
As used herein, a non-coding RNA (ncRNA) is an RNA transcript that does not encode a protein. ncRNAs include short ncRNAs and long ncRNAs (lnc-RNAs). Short ncRNAs are ncRNAs that are generally 18-200 nucleotides (nt) in length. Examples of short ncRNAs include, but are not limited to, microRNAs (miRNAs), piwi-associated RNAs (piRNAs), short interfering RNAs (siRNAs), promoter-associated short RNAs (PASRs), transcription initiation RNAs (tiRNAs), termini-associated short RNAs (TASRs), antisense termini associated short RNAs (aTASRs), small nucleolar RNAs (snoRNAs), transcription start site antisense RNAs (TSSa-RNAs), small nuclear RNAs (snRNAs), retroposon-derived RNAs (RE-RNAs), 3′UTR-derived RNAs (uaRNAs), x-ncRNA, human Y RNA (hY RNA), unusually small RNAs (usRNAs), small NF90-associated RNAs (snaRs), vault RNAs (vtRNAs), small Cajal body-specific RNAs (scaRNAs), and telomere specific small RNAs (tel-sRNAs). lnc-RNAs are cellular RNAs, exclusive of rRNAs, greater than 200 nucleotides in length and having no obvious protein-coding capacity. Lnc-RNAs include, but are not limited to, large or long intergenic ncRNAs (lincRNAs), transcribed ultraconserved regions (T-UCRs), pseudogenes, GAA-repeat containing RNAs (GRC-RNAs), long intronic ncRNAs, antisense RNAs (aRNAs), promoter-associated long RNAs (PALRs), promoter upstream transcripts (PROMPTs), and long stress-induced non-coding transcripts (LSINCTs).
An RNA-binding protein is a protein that binds single or double stranded RNA to form ribonucleoprotein complexes. RBPs contain conserved structural motifs such as the RNA recognition motif (RRM), dsRNA binding domain, zinc finger domain, and others.
The biomarkers for detection and diagnosis of CIN and cervical cancer include the RBP and lnc-RNA biomarkers of Tables 1-3:
| TABLE 1 |
| RBP biomarkers |
| SEQ ID | ||||||
| NO: | chr | start | end | refseqID | Symbol | description |
| 1 | chr9 | 21967750 | 21975132 | NM_000077 | CDKN2A | cyclin-dependent kinase inhibitor 2A (CDKN2A), |
| transcript variant 1, mRNA. | ||||||
| 2 | chr9 | 21967750 | 21975132 | NM_001195132 | CDKN2A | Homo sapiens cyclin-dependent kinase |
| inhibitor 2A (CDKN2A), transcript variant 5, | ||||||
| mRNA. | ||||||
| 3 | chr9 | 21967750 | 21994490 | NM_058195 | CDKN2A | cyclin-dependent kinase inhibitor 2A (CDKN2A), |
| transcript variant 4, mRNA. | ||||||
| 4 | chr9 | 21967750 | 21974826 | NM_058197 | CDKN2A | cyclin-dependent kinase inhibitor 2A (CDKN2A), |
| transcript variant 3, mRNA. | ||||||
| 5 | chr9 | 23690102 | 23821843 | NM_001171195 | ELAVL2 | Homo sapiens ELAV (embryonic lethal, |
| abnormal vision, Drosophila)-like 2 (Hu antigen | ||||||
| B) (ELAVL2), transcript variant 2, mRNA. | ||||||
| 6 | chr9 | 23690102 | 23821478 | NM_001171197 | ELAVL2 | Homo sapiens ELAV (embryonic lethal, |
| abnormal vision, Drosophila)-like 2 (Hu antigen | ||||||
| B) (ELAVL2), transcript variant 3, mRNA. | ||||||
| 7 | chr9 | 23690102 | 23826063 | NM_004432 | ELAVL2 | ELAV (embryonic lethal, abnormal vision, |
| Drosophila)-like 2 (Hu antigen B) (ELAVL2), | ||||||
| transcript variant 1, mRNA. | ||||||
| 8 | chr17 | 37894575 | 37903538 | NM_001030002 | GRB7 | growth factor receptor-bound protein 7 |
| (GRB7), transcript variant 2, mRNA. | ||||||
| 9 | chr17 | 37895023 | 37903538 | NM_001242442 | GRB7 | Homo sapiens growth factor receptor-bound |
| protein 7 (GRB7), transcript variant 4, mRNA. | ||||||
| 10 | chr17 | 37896219 | 37903538 | NM_001242443 | GRB7 | Homo sapiens growth factor receptor-bound |
| protein 7 (GRB7), transcript variant 3, mRNA. | ||||||
| 11 | chr17 | 37894161 | 37903538 | NM_005310 | GRB7 | growth factor receptor-bound protein 7 |
| (GRB7), transcript variant 1, mRNA. | ||||||
| 94 | chr17 | NM_001330207.1 | GRB7 | growth factor receptor-bound protein 7 | ||
| (GRB7), transcript variant 5, mRNA. | ||||||
| 12 | chr7 | 75931874 | 75933614 | NM_001540 | HSPB1 | heat shock 27 kDa protein 1 (HSPB1), mRNA. |
| 13 | chr19 | 6413118 | 6424822 | NM_003685 | KHSRP | KH-type splicing regulatory protein (KHSRP), |
| mRNA. | ||||||
| 14 | chr14 | 26915088 | 27066960 | NM_002515 | NOVA1 | neuro-oncological ventral antigen 1 (NOVA1), |
| transcript variant 1, mRNA. | ||||||
| 15 | chr14 | 26915088 | 27066960 | NM_006489 | NOVA1 | neuro-oncological ventral antigen 1 (NOVA1), |
| transcript variant 2, mRNA. | ||||||
| 95 | chr14 | NM_006491.2 | NOVA1 | neuro-oncological ventral antigen 1 (NOVA1), | ||
| transcript variant 3, mRNA. | ||||||
| 16 | chr19 | 797391 | 812327 | NM_002819 | PTBP1 | polypyrimidine tract binding protein 1 (PTBP1), |
| transcript variant 1, mRNA. | ||||||
| 17 | chr19 | 797391 | 812327 | NM_031990 | PTBP1 | polypyrimidine tract binding protein 1 (PTBP1), |
| transcript variant 2, mRNA. | ||||||
| 18 | chr19 | 797391 | 812327 | NM_031991 | PTBP1 | polypyrimidine tract binding protein 1 (PTBP1), |
| transcript variant 3, mRNA. | ||||||
| 19 | chr19 | 12917427 | 12924462 | NM_006397 | RNASEH2A | ribonuclease H2, subunit A (RNASEH2A), |
| mRNA. | ||||||
| TABLE 2 |
| lnc-FANCI-2 isoforms |
| Transcript ID | SEQ ID NO: | Location (hg19) | Length |
| lnc-FANCI-2:1 | 20 | chr15: 89904810-89938553 | 1613 |
| lnc-FANCI-2:10 | 21 | chr15: 89921280-89938544 | 606 |
| lnc-FANCI-2:11 | 22 | chr15: 89921331-89938354 | 551 |
| lnc-FANCI-2:12 | 23 | chr15: 89921347-89939471 | 1877 |
| lnc-FANCI-2:13 | 24 | chr15: 89921362-89938500 | 561 |
| lnc-FANCI-2:14 | 25 | chr15: 89921794-89931745 | 786 |
| lnc-FANCI-2:15 | 26 | chr15: 89922355-89938350 | 569 |
| lnc-FANCI-2:16 | 27 | chr15: 89922468-89941720 | 3779 |
| lnc-FANCI-2:17 | 28 | chr15: 89922495-89941719 | 3670 |
| lnc-FANCI-2:18 | 29 | chr15: 89923111-89941720 | 3784 |
| lnc-FANCI-2:19 | 30 | chr15: 89925731-89938271 | 779 |
| lnc-FANCI-2:2 | 31 | chr15: 89904810-89938551 | 1611 |
| lnc-FANCI-2:20 | 32 | chr15: 89929827-89939471 | 2718 |
| lnc-FANCI-2:21 | 33 | chr15: 89930671-89941720 | 3723 |
| lnc-FANCI-2:22 | 34 | chr15: 89904810-89941718 | 4778 |
| lnc-FANCI-2:23 | 35 | chr15: 89911330-89941718 | 4113 |
| lnc-FANCI-2:24 | 36 | chr15: 89911399-89941721 | 3936 |
| lnc-FANCI-2:25 | 37 | chr15: 89912393-89941683 | 4026 |
| lnc-FANCI-2:26 | 38 | chr15: 89921102-89941708 | 4334 |
| lnc-FANCI-2:27 | 39 | chr15: 89921273-89941718 | 3868 |
| lnc-FANCI-2:28 | 40 | chr15: 89922232-89941683 | 3978 |
| lnc-FANCI-2:29 | 41 | chr15: 89923021-89941683 | 3837 |
| lnc-FANCI-2:3 | 42 | chr15: 89905705-89922463 | 571 |
| lnc-FANCI-2:30 | 43 | chr15: 89929880-89941721 | 4915 |
| lnc-FANCI-2:31 | 44 | chr15: 89930027-89941721 | 4687 |
| lnc-FANCI-2:32 | 45 | chr15: 89930389-89931372 | 706 |
| lnc-FANCI-2:33 | 46 | chr15: 89930557-89941683 | 3922 |
| lnc-FANCI-2:34 | 47 | chr15: 89931724-89941721 | 3690 |
| lnc-FANCI-2:35 | 48 | chr15: 89932071-89941708 | 4093 |
| lnc-FANCI-2:4 | 49 | chr15: 89905718-89938562 | 957 |
| lnc-FANCI-2:5 | 50 | chr15: 89911330-89941718 | 2124 |
| lnc-FANCI-2:6 | 51 | chr15: 89912386-89931074 | 576 |
| lnc-FANCI-2:7 | 52 | chr15: 89918593-89941720 | 6547 |
| lnc-FANCI-2:8 | 53 | chr15: 89921220-89941692 | 3814 |
| lnc-FANCI-2:9 | 54 | chr15: 89921273-89941718 | 4198 |
| TABLE 3 |
| lnc-GLB1L2-1 isoforms |
| SEQ ID | |||
| Transcript ID | NO: | Location (hg19) | Length |
| lnc-GLB1L2-1:1 | 55 | chr11: 134306367-134337169 | 1402 bp |
| lnc-GLB1L2-1:10 | 56 | chr11: 134350719-134372941 | 295 bp |
| lnc-GLB1L2-1:11 | 57 | chr11: 134352524-134373110 | 374 bp |
| lnc-GLB1L2-1:12 | 58 | chr11: 134306376-134375555 | 2737 bp |
| lnc-GLB1L2-1:13 | 59 | chr11: 134339378-134360125 | 15706 bp |
| lnc-GLB1L2-1:14 | 60 | chr11: 134339400-134373384 | 744 bp |
| lnc-GLB1L2-1:15 | 61 | chr11: 134339400-134375553 | 1129 bp |
| lnc-GLB1L2-1:16 | 62 | chr11: 134343291-134373078 | 1843 bp |
| lnc-GLB1L2-1:17 | 63 | chr11: 134344051-134375009 | 1160 bp |
| lnc-GLB1L2-1:18 | 64 | chr11: 134346572-134375009 | 572 bp |
| lnc-GLB1L2-1:19 | 65 | chr11: 134349193-134375555 | 4435 bp |
| lnc-GLB1L2-1:2 | 66 | chr11: 134306469-134308558 | 374 bp |
| lnc-GLB1L2-1:20 | 67 | chr11: 134349983-134375009 | 1245 bp |
| lnc-GLB1L2-1:21 | 68 | chr11: 134350411-134401542 | 537 bp |
| lnc-GLB1L2-1:3 | 69 | chr11: 134306629-134374934 | 1863 bp |
| lnc-GLB1L2-1:4 | 70 | chr11: 134336079-134357809 | 3679 bp |
| lnc-GLB1L2-1:5 | 71 | chr11: 134336079-134357809 | 3620 bp |
| lnc-GLB1L2-1:6 | 72 | chr11: 134344060-134350796 | 720 bp |
| lnc-GLB1L2-1:7 | 73 | chr11: 134349193-134375507 | 4387 bp |
| lnc-GLB1L2-1:8 | 74 | chr11: 134349731-134352843 | 1398 bp |
| lnc-GLB1L2-1:9 | 75 | chr11: 134350086-134367700 | 939 bp |
In additional aspects, the biomarker includes FAM83A (SEQ ID NO: 86; KJ895067.1), SEMA3F (SEQ ID NOs: 87-89; NM_004186.4; NM_001318800.1; NM_001318798.1), CLDN10 (SEQ ID NO: 90-91; NM_182848.3; NM_006984.4), ASRGL1 (SEQ ID NO: 92, 93; NM_001083926.1; NM_025080.3), or a combination thereof.
An RBP, lnc-RNA, or additional RNA biomarker is differentially expressed between two samples if the amount of the RBP, lnc-RNA, or additional RNA biomarker in one sample is statistically significantly different from the amount of the RBP, lnc-RNA, or additional RNA biomarker in the other sample. The expression level of an RBP, lnc-RNA, or additional RNA biomarker can be increased or decreased in a test sample relative to a reference sample. For example, an RBP gene, lnc-RNA, or additional RNA biomarker is differentially expressed in two samples if it is present at least about 120%, at least about 130%, at least about 150%, at least about 180%, at least about 200%, at least about 300%, at least about 500%, at least about 700%, at least about 900%, or at least about 1000% greater than it is present in the other sample, or if it is detectable in one sample and not detectable in the other.
Alternatively or additionally, an RBP gene, lnc-RNA, or additional RNA biomarker is differentially expressed in two sets of samples if the frequency of detecting the RBP gene, lnc-RNA, or additional RNA biomarker in samples is statistically significantly higher or lower than in the control samples. For example, an RBP gene, lnc-RNA, or additional RNA biomarker is differentially expressed in two sets of samples if it is detected at least about 120%, at least about 130%, at least about 150%, at least about 180%, at least about 200%, at least about 300%, at least about 500%, at least about 700%, at least about 900%, or at least about 1000% more frequently or less frequently observed in one set of samples than the other set of samples.
A test amount and a control amount of a biomarker can be either an absolute amount (e.g., number of copies/ml, nanogram/ml or microgram/ml) or a relative amount (e.g., relative intensity of signals).
Diagnostic samples for use in the methods described herein comprise nucleic acids suitable for providing polynucleotide, e.g., RNA, expression information. The sample contains cells from a tissue of the test patient. For example, when the HPV-associated pre-cancer or HPV-associated cancer is anal cancer, the tissue of the test patient contains anal cells; when the HPV-associated pre-cancer or HPV-associated cancer is vulvovaginal cancer, the tissue of the test patient contains vulvovaginal cells; when the HPV-associated pre-cancer or HPV-associated cancer is penile cancer, the tissue of the test patient contains penal cells; or when the HPV-associated pre-cancer or HPV-associated cancer is oropharyngeal cancer, the tissue of the test patient contains oropharyngeal cells.
In one aspect, samples for the methods disclosed herein contain cells from a patient's cervix. Exemplary test samples include a PAP smear, a vaginal wash, or a cervical biopsy sample. In certain aspects, the methods described herein include obtaining from the test patient the sample containing cells from the test patient's cervix.
In certain aspects, the test patient is a patient at risk for an HPV-associated pre-cancer or an HPV-associated cancer, such as a patient diagnosed with HPV infection or a patient at high risk for HPV infection.
In certain aspects, the test patient is a patient at high risk for cervical cancer such as a woman at high risk for HPV infection, a woman with a diagnosed HPV infection, a woman with a history of DES exposure, a woman with a previous history of gynecological cancer, a woman with an abnormal PAP test, a woman immunosuppressed due to AIDS or therapy following organ transplantation, or a woman with abnormal endometrial cells.
In certain aspects, the methods disclosed herein comprise detecting the expression level of one or more biomarkers as disclosed herein.
In addition, the methods disclosed herein include the comparison/correlation of the expression levels of biomarkers in the diagnostic sample from the test patient to a reference sample. Exemplary reference samples include a control sample from a patient or patients with no evidence of HPV-associated pre-cancer or HPV-associated cancer, a control sample from a patient or patients with HPV-associated pre-cancer, and a control sample from a patient or patients with HPV-associated cancer. Additional exemplary reference samples include a control sample from a patient or patients with no evidence of cervical cancer, a control sample from a cervical cancer patient or patients, or a control sample from a patient or patients with stage 1, stage 2, or stage 3 cervical intraepithelial neoplasia. The reference sample can be a single sample from a control patient with a known disease state, or preferably samples from a plurality of subjects such that the reference expression level is averaged over the expression levels for a population of known disease state. Useful population sizes for a reference population are greater than 100 subjects, specifically about 500 subjects for each reference group (CIN 1, 2, 3 and cervical cancer), for example.
RNA can be extracted and purified from biological samples using suitable techniques that are known in the art, and several are commercially available (e.g., FormaPure® nucleic acid extraction kit, Agencourt® Biosciences, Beverly Mass., High Pure FFPE RNA Micro Kit, Roche Applied Science, Indianapolis, Ind.). RNA can be extracted from frozen tissue sections using TRIzol® (Invitrogen, Carlsbad, Calif.) and purified using RNeasy® Protect kit (Qiagen, Valencia, Calif.). RNA can be further purified using DNase I treatment (Ambion, Austin, Tex.) to eliminate any contaminating DNA. RNA concentrations can be made using a NanoDrop ND-1000 spectrophotometer (NanoDdrop Technologies, Rockland, Del.). RNA can be further purified to eliminate contaminants that interfere with cDNA synthesis by cold sodium acetate precipitation. RNA integrity can be evaluated by running electropherograms, and RNA integrity number (RIN, a correlative measure that indicates intactness of mRNA) can be determined using the RNA 6000 PicoAssay for the Bioanalyzer 2100 (Agilent Technologies, Santa Clara, Calif.).
Following sample collection and nucleic acid extraction, the nucleic acid portion of the sample comprising RNA that is or can be used to prepare the target polynucleotide(s) of interest can be subjected to one or more preparative reactions. These preparative reactions can include in vitro transcription (IVT), labeling, fragmentation, amplification, and other reactions. mRNA can first be treated with reverse transcriptase and a primer to create cDNA prior to detection, quantitation, or amplification; this can be done in vitro with purified mRNA or in situ, e.g., in cells or tissues affixed to a slide.
By “amplification” is meant a process of producing at least one copy of a nucleic acid, in this case an expressed RNA, and in many cases produces multiple copies. An amplification product can be RNA or DNA, and may include a complementary strand to the expressed target sequence. DNA amplification products can be produced initially through reverse transcription and then optionally from further amplification reactions. The amplification product may include all or a portion of a target sequence, and may optionally be labeled. A variety of amplification methods are suitable for use, including polymerase-based methods and ligation-based methods.
The expression level of a polynucleotide biomarker can be determined by reverse transcriptase-polymerase chain reaction (RT-PCR) methods, quantitative real-time RT-PCR (RT-qPCR), microarray, serial analysis of gene expression (SAGE), next-generation RNA sequencing (deep sequencing), gene expression analysis by massively parallel signature sequencing (MPSS), immunoassays such as ELISA, in situ hybridization (ISH) formulations that allow histopathological analysis, mass spectrometry (MS) methods, transcriptomics, RNA pull-down and chromatin isolation by RNA purification (ChiRP), proteomics-based identification of lncRNA, detection of single nucleotide polymorphisms (SNPs), measurement of DNA methylation or unmethylation, measurement of siRNA silencing or miRNA silencing, or measurement of downstream targets.
As used herein, the terms “quantitative real time polymerase chain reaction,” “real-time polymerase chain reaction,” and “qPCR” are synonymous and refer to a laboratory technique based on a polymerase chain reaction used to amplify and simultaneously quantify a targeted DNA molecule. Frequently, real-time PCR is combined with reverse transcription to quantify messenger RNA and non-coding RNA in cells or tissues, e.g., RT-qPCR.
Additional methods for detecting and/or quantifying a polynucleotide biomarker can comprise single-molecule sequencing (e.g., Illumina®, PacBio, ABI SOLID™), in situ hybridization, bead-array technologies (e.g., Luminex xMAP®, Illumina® BeadChips), branched DNA technology (e.g., Affymetrix®, Genisphere®), and Ion Torrent™. In some instances, methods for detecting and/or quantifying a target sequence comprise transcriptome sequencing techniques. Transcription sequencing (e.g., RNA-seq, “Whole Transcriptome Shotgun Sequencing” (WTSS)) may comprise the use of high-throughput sequencing technologies to sequence cDNA in order to get information about a sample's RNA content. Transcriptome sequencing can provide information on differential expression of genes, including gene alleles and differently spliced transcripts, non-coding RNAs, post-transcriptional mutations or editing, and gene fusions.
Included herein is a method for measuring the expression levels of biomarkers for HPV-associated pre-cancers and cancers as described herein. The methods optionally include identifying HPV-associated pre-cancer or cancer status of a test subject (e.g., cervical cancer). The data obtained from the expression profiles of a population (e.g., normal, CIN1-3, or cervical cancer) can be evaluated using one or more pattern recognition algorithms. In addition, the results of imaging tests or histological evaluation may optionally be combined with expression profiles generated using the genes disclosed herein.
In one aspect, the methods include
In another aspect, the methods comprise
In a further aspect, the methods include
In one aspect, the methods include
In another aspect, the methods comprise
In a further aspect, the methods include
Analysis methods may be used to form a predictive model, and then the predictive model may be used to classify test data. For example, one convenient and particularly effective method of classification employs multivariate statistical analysis modeling, first to form a model (a “predictive mathematical model”) using data (“modeling data”) from samples of known class (e.g., from subjects known to have, or not have, a particular grade of CIN or cervical cancer), and second to classify an unknown sample (e.g., “test data”), according to HPV-associated (e.g., cervical) cancer status.
Pattern recognition (PR) is the use of multivariate statistics, both parametric and non-parametric, to analyze spectroscopic data, and hence to classify samples and to predict the value of some dependent variable based on a range of observed measurements. There are two main approaches. One set of methods is termed “unsupervised” and these simply reduce data complexity in a rational way and also produce display plots which can be interpreted by the human eye. The other approach is termed “supervised” whereby a training set of samples with known class or outcome is used to produce a mathematical model and is then evaluated with independent validation data sets.
Unsupervised PR methods are used to analyze data without reference to any other independent knowledge. Examples of unsupervised pattern recognition methods include principal component analysis (PCA), hierarchical cluster analysis (HCA), and non-linear mapping (NLM).
Alternatively, and in order to develop automatic classification methods, it has proved efficient to use a “supervised” approach to data analysis. Here, a “training set” of biomarker expression data is used to construct a statistical model that predicts correctly the “class” of each sample. This training set is then tested with independent data (referred to as a test or validation set) to determine the robustness of the computer-based model. These models are sometimes termed “expert systems,” but may be based on a range of different mathematical procedures. Supervised methods can use a data set with reduced dimensionality (for example, the first few principal components), but typically use unreduced data, with all dimensionality. In all cases the methods allow the quantitative description of the multivariate boundaries that characterize and separate each class, for example, each class of cervical cancer in terms of its biomarker expression profile. It is also possible to obtain confidence limits on any predictions, for example, a level of probability to be placed on the goodness of fit. The robustness of the predictive models can also be checked using cross-validation, by leaving out selected samples from the analysis.
It is often useful to pre-process data, for example, by addressing missing data, translation, scaling, weighting, etc. Multivariate projection methods, such as principal component analysis (PCA) and partial least squares analysis (PLS), are so-called scaling sensitive methods. By using prior knowledge and experience about the type of data studied, the quality of the data prior to multivariate modeling can be enhanced by scaling and/or weighting. Adequate scaling and/or weighting can reveal important and interesting variation hidden within the data, and therefore make subsequent multivariate modeling more efficient. Scaling and weighting may be used to place the data in the correct metric, based on knowledge and experience of the studied system, and therefore reveal patterns already inherently present in the data.
The methods described herein may be implemented and/or the results recorded using a device capable of implementing the methods and/or recording the results. Examples of devices that may be used include but are not limited to electronic computational devices, including computers of all types. When the methods described herein are implemented and/or recorded in a computer, the computer program that may be used to configure the computer to carry out the steps of the methods may be contained in any computer readable medium capable of containing the computer program. Examples of computer readable medium that may be used include but are not limited to diskettes, CD-ROMs, DVDs, ROM, RAM, and other memory and computer storage devices. The computer program that may be used to configure the computer to carry out the steps of the methods and/or record the results may also be provided over an electronic network, for example, over the internet, an intranet, or other network.
The process of comparing a measured value and a reference value can be carried out in a convenient manner appropriate to the type of measured value and reference value for the discriminative gene at issue. “Measuring” can be performed using quantitative or qualitative measurement techniques, and the mode of comparing a measured value and a reference value can vary depending on the measurement technology employed. For example, when a qualitative colorimetric assay is used to measure expression levels, the levels may be compared by visually comparing the intensity of the colored reaction product, or by comparing data from densitometric or spectrometric measurements of the colored reaction product (e.g., comparing numerical data or graphical data, such as bar charts, derived from the measuring device). However, it is expected that the measured values used in the methods will most commonly be quantitative values. In other examples, measured values are qualitative. As with qualitative measurements, the comparison can be made by inspecting the numerical data, or by inspecting representations of the data (e.g., inspecting graphical representations such as bar or line graphs).
The process of comparing may be manual (such as visual inspection by the practitioner of the method) or it may be automated. For example, an assay device (such as a luminometer for measuring chemiluminescent signals) may include circuitry and software enabling it to compare a measured value with a reference value for a biomarker. Alternately, a separate device (e.g., a digital computer) may be used to compare the measured value(s) and the reference value(s). Automated devices for comparison may include stored reference values for the biomarker(s) being measured, or they may compare the measured value(s) with reference values that are derived from contemporaneously measured reference samples (e.g., samples from control subjects).
As will be apparent to those of skill in the art, when replicate measurements are taken, the measured value that is compared with the reference value is a value that takes into account the replicate measurements. The replicate measurements may be taken into account by using either the mean or median of the measured values as the “measured value.”
When it has been determined that the test patient has HPV—pre-cancer or cancer, the methods optionally include HPV detection and or typing.
When it has been determined that the test patient has CIN 1, 2, or 3 cervical cancer, the methods optionally include HPV detection and or typing, for example, using the cobas® HPV test marketed by Roche Diagnostics.
Also included herein are methods of treating the test patient with an interventional strategy for HPV-associated pre-cancer or cancer.
Interventional therapies for anal, vulvovaginal, penile, and oropharyngeal cancer include radiation therapy, surgery, and chemotherapy.
Further included herein are methods of treating the test patient with an interventional strategy for CIN or cervical cancer. When the patient is determined to have stage 1 CIN, the interventional strategy may include screening for further cervical changes, screening the patient for HPV infection, HPV typing, or a combination thereof. Exemplary tests for the detection of HPV infection include detection of HPV infection via DNA/RNA amplification with PCR using, for example, the cobas® HPV test marketed by Roche Diagnostics. Advantageously, early identification of CIN 1 optionally coupled with determining the HPV infection type will provide critical information regarding the type of intervention required to treat the patient. Early diagnosis and treatment at stage CIN 1 could prevent or slow progression to later disease stages.
When the patient is determined to have stage 2 or stage 3 CIN, interventional strategies may include, in addition to monitoring, cryosurgery to freeze abnormal cells, laser therapy to remove abnormal tissue, loop electrosurgical procedure excision, surgery to remove abnormal tissue, or hysterectomy. At early stages, for example, low cost outpatient procedures such as loop electrosurgical excision are 90-95% effective. Thus, a benefit to the methods disclosed herein is the ability to use minor surgical intervention before CIN progresses to cervical cancer.
Interventional strategies for the treatment of cervical cancer include surgery, radiation therapy, chemotherapy, targeted therapy, or a combination thereof. Surgery involves removal of the cancer and may include conization to remove tissue from the cervix and/or cervical canal or hysterectomy such as total, radical, modified radical hysterectomy. Radiation therapy includes internal and external radiation therapy in addition to intensity-modulated radiation therapy. Chemotherapy involves the use of drugs to inhibit the growth of cancer calls and can involve systemic or regional chemotherapy. Drugs approved for the treatment of cervical cancer include bleomycin, cisplatin, topotecan hydrochloride, and gemcitabine-cisplatin. Targeted therapy involves the use of drugs that identify and attack specific cancer cells without harming normal cells. Targeted therapy includes antibody therapy such as bevacizumab therapy.
Further disclosed herein, is a probe set for diagnosing, predicting, and/or monitoring cervical cancer in a subject. The probe set comprises a plurality of polynucleotide probes capable of detecting an expression level of at least one biomarker for CIN or cervical cancer, wherein the expression level determines the CIN or cervical cancer status of the subject.
In one aspect, a probe set comprises
In certain aspects, the probe set is attached to a solid support, and/or each member of the probe set comprises a detectable moiety.
One skilled in the art understands that the nucleotide sequence of the polynucleotide probe need not be identical to its target sequence in order to specifically hybridize thereto. The polynucleotide probes, therefore, comprise a nucleotide sequence that is at least about 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more identical to a region of the coding target or non-coding target. Methods of determining sequence identity are known in the art and can be determined, for example, by using the BLASTN program of the University of Wisconsin Computer Group (GCG) software or provided on the NCBI website. The nucleotide sequence of the polynucleotide probes may exhibit variability by differing (e.g. by nucleotide substitution, including transition or transversion) at one, two, three, four or more nucleotides from the sequence of the coding target or non-coding target.
Primers/probes based on the nucleotide sequences of target sequences can be used in amplification of the target sequences. For use in amplification reactions such as PCR, a pair of primers can be used. The exact composition of the primer sequences is selected so that the primers hybridize to specific sequences of the probe set under stringent conditions, particularly under conditions of high stringency. The pairs of primers are usually chosen so as to generate an amplification product of at least about 50 nucleotides, more usually at least about 100 nucleotides. Algorithms for the selection of primer sequences are generally known, and are available in commercial software packages. These primers may be used in standard quantitative or qualitative PCR-based assays to assess transcript expression levels of RNAs defined by the probe set. Alternatively, these primers may be used in combination with probes, such as molecular beacons in amplifications using real-time PCR.
The polynucleotide probes or primers can incorporate moieties useful in detection, isolation, purification, or immobilization, if desired. Such moieties are detectable labels, such as radioisotopes, fluorophores, chemiluminophores, enzymes, colloidal particles, and fluorescent microparticles, as well as antigens, antibodies, haptens, avidin/streptavidin, biotin, haptens, enzyme cofactors/substrates, enzymes, and the like. A label can optionally be attached to or incorporated into a probe or primer polynucleotide to allow detection and/or quantitation of a target polynucleotide representing the target sequence of interest.
In some embodiments, one or more polynucleotide probes/primers provided herein can be provided on a substrate. The substrate can comprise a wide range of material, either biological, nonbiological, organic, inorganic, or a combination of any of these. For example, the substrate may be a polymerized Langmuir Blodgett film, functionalized glass, Si, Ge, GaAs, GaP, SiO2, SiN4, modified silicon, or any one of a wide variety of gels or polymers such as (poly)tetrafluoroethylene, (poly)vinylidenedifluoride, polystyrene, cross-linked polystyrene, polyacrylic, polylactic acid, polyglycolic acid, poly(lactide coglycolide), polyanhydrides, poly(methyl methacrylate), poly(ethylene-co-vinyl acetate), polysiloxanes, polymeric silica, latexes, dextran polymers, epoxies, polycarbonates, or combinations thereof. Conducting polymers and photoconductive materials can be used.
Substrates can be planar crystalline substrates such as silica based substrates (e.g., glass, quartz, or the like), or crystalline substrates used in, e.g., the semiconductor and microprocessor industries, such as silicon, gallium arsenide, indium doped GaN and the like, and include semiconductor nanocrystals.
The substrate can take the form of an array, a photodiode, an optoelectronic sensor such as an optoelectronic semiconductor chip or optoelectronic thin-film semiconductor, or a biochip. The location(s) of probe(s) on the substrate can be addressable; this can be done in highly dense formats, and the location(s) can be microaddressable or nanoaddressable.
The substrate can be a plate, slide, bead, pellet, disk, particle, microparticle, nanoparticle, strand, precipitate, optionally porous gel, sheets, tube, sphere, capillary, film, chip, multiwell plate or dish, optical fiber, etc. The substrate can be a form that is rigid or semi-rigid. The substrate may contain raised or depressed regions on which an assay component is located. The surface of the substrate can be etched using known techniques to provide for desired surface features, for example trenches, v-grooves, mesa structures, or the like.
Surfaces on the substrate can be composed of the same material as the substrate or can be made from a different material, and can be coupled to the substrate by chemical or physical means. Such coupled surfaces may be composed of any of a wide variety of materials, for example, polymers, plastics, resins, polysaccharides, silica or silica-based materials, carbon, metals, inorganic glasses, membranes, or any of the above-listed substrate materials. The surface can be optically transparent and can have surface Si—OH functionalities, such as those found on silica surfaces.
The substrate and/or its optional surface can be chosen to provide appropriate characteristics for the synthetic and/or detection methods used. The substrate and/or surface can be transparent to allow the exposure of the substrate by light applied from multiple directions. The substrate and/or its surface is generally resistant to, or is treated to resist, the conditions to which it is to be exposed in use, and can be optionally treated to remove any resistant material after exposure to such conditions.
The substrate or a region thereof may be encoded so that the identity of the sensor located in the substrate or region being queried may be determined. A suitable coding scheme can be used, for example optical codes, RFID tags, magnetic codes, physical codes, fluorescent codes, and combinations of codes.
The invention is further illustrated by the following non-limiting examples.
Human patient samples: Samples for RNA sequencing, containing 7 normal cervical tissues, 7 pre-cancer tissues and 7 cervical cancer tissues, and samples for validation, including 24 normal cervical tissues, 25 CIN 2-3 tissues, and 23 cervical cancer tissues, were all collected from the Women's Hospital, School of Medicine, Zhejiang University. All the human samples were used in accordance with the Institutional Review Board procedures of the hospital. Informed consent was obtained from each participant prior to the study. Samples were snap-frozen and stored at −80° C. until use.
RNA isolation: RNA was isolated from each human tissue sample by TRIzol® (Invitrogen, CA, USA) according to the instructions provided by the manufacturer. Total RNA quality and quantity were verified spectrophotometrically (NanoDrop ND-1000 spectrometer; Thermo Scientific, DE, USA) and electrophoretically (Bioanalyzer 2100; Agilent Technologies, CA, USA).
RNA sequencing and mapping: RNA-seq libraries were prepared using TruSeq® Stranded Total RNA Sample Preparation Kit with Ribo-Zero™ depletion and sequenced on an Illumina® HiSeq™-2500 platform as paired-end reads. In brief, high-quality of human total RNA (1 μg) was Ribo-Zero™ depleted, fragmented, and then reverse transcribed. The double-stranded cDNA were A-tailed and ligated with Illumia® sequencing adapters. Subsequently, the ligated products were enriched by PCR and size-selected by agarose gel electrophoresis. The products of approximately 200-400-bp in size were sequenced by the Illumina® HiSeq™-2500 platform. The raw data in fastq format were mapped to the human reference genome (hg19, GRCh37) by Tophat v2.0.11(-g 1), which had the aligner Bowtie (v2.2.1.0) with the parameter settings (-N 0, -L 20, -i S,1,1.25, -n-ceil L,0,0.15 and -gbar 4). The mapping results were further sorted in coordination position by samtools (v0.1.19.0) (Robinson MD, Oshlack A., “A scaling normalization method for differential expression analysis of RNA-seq data,” Genome Biology, 11:R25 (2010); Robinson MD, McCarthy DJ and Smyth GK., “edgeR: a Bioconductor package for differential expression analysis of digital gene expression data,” Bioinformatics, 26, pp. 139-140 (2010)). The latest annotation of LncRNA was downloaded from the publicly available lncipedia database version 3.0. The mapped reads in individual lncRNA region of each sample were counted by bedtools (v2.19.0). The R Bioconductor edgeR package was used to normalize raw reads by the scaling method. Differentially expressed lncRNAs were identified by one-way ANOVA method with 10% false discovery rate (FDR) and four-fold changes between the conditions. The FDR was controlled by the Benjamini-Hochberg (BH) procedure. RNA-binding protein genes were compiled from the literature (Alfredo Castello, et al., “Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins,” Cell, 149, pp. 1393-1406 (2012); Alfredo Castello, et al., “RNA-binding proteins in Mendelian disease,” Trends in Genetics, 29, pp. 318-327 (2013)). The normalized reads from the multiple transcripts of each gene were averaged to represent composite gene expression. The expression results were clustered using unsupervised hierarchical clustering analysis, in which the Euclidean Distance is used as the similarity measure.
Human primary keratinocytes and organotypic (raft) epithelial cultures: Total RNA extracted from various raft tissues were leftovers from previous studies (Wang, X. et al., “Oncogenic HPV infection interrupts the expression of tumor-suppressive miR-34a through viral oncoprotein E6,” RNA, 15, pp. 637-647 (2009); Wang, X., et al., “microRNAs are biomarkers of oncogenic human papillomavirus infections,” Proc. Natl. Acad. Sci. USA, 111, pp. 4262-4267 (2014)). Briefly, primary human foreskin keratinocytes (HFK) and primary human vaginal keratinocytes (HVK) were isolated from newborn circumcision and adult vaginectomy tissue specimens, respectively, as previously described (Meyers, C., Mayer, T. J., and Ozbun, M. A., “Synthesis of infectious human papillomavirus type 18 in differentiating epithelium transfected with viral DNA,” J. Virol., 71, pp, 7381-7386 (1997)). Keratinocytes were grown in monolayer culture by using epithelial (E) medium plus epidermal growth factor (5 ng/ml) in the presence of mitomycin C (4 μg/ml)-treated J2 3T3 feeder cells. Keratinocyte lines stably maintaining HPV16 and HPV18 DNA following electroporation were subcloned by limiting dilutions of cells. Organotypic (raft) epithelial culture tissues derived from HPV16 and HPV18-immortalized HFK or HVK were prepared as described previously (McLaughlin-Drubin, M. E. and Meyers, C., “Propagation of infectious, high-risk HPV in organotypic “raft” culture,” Methods Mol. Med., 119, pp. 171-186 (2005)). The stratified and differentiated raft culture epidermal tissues were collected free from collagen (no fibroblasts) on day 10 and frozen on dry ice for total cell RNA preparation. Additional productive HPV18 raft cultures of HFKs were obtained by Cre-loxP—mediated recombination as described (Wang, H. K., Duffy, A. A., Broker, T. R., and Chow, L. T., “Robust production and passaging of infectious HPV in squamous epithelium of primary human keratinocytes”, Genes Dev., 23, pp. 181-194 (2009)), and the derived raft cultures were collected on day 8, day 12, and day 16.
Plasmid pLJd-HPV-18URR-E6, pLC-HPV-18URR-E7, and pLJd-HPV-18URR-E6E7 have been described (Cheng, S., Schmidt-Grimminger, D. C., Murant, T., Broker, T. R., and Chow, L. T., “Differentiation-dependent up-regulation of the human papillomavirus E7 gene reactivates cellular DNA replication in suprabasal differentiated keratinocytes.,” Genes Dev., 9, pp. 2335-2349 (1995); Genovese, N. J., Banerjee, N. S., Broker, T. R., and Chow, L. T., “Casein kinase II motif-dependent phosphorylation of human papillomavirus E7 protein promotes p130 degradation and S-phase induction in differentiated human keratinocytes,” J. Virol., 82, pp. 4862-4873 (2008)). Retroviruses derived from the above vectors were prepared as described (Banerjee, N. S., Chow, L. T., and Broker, T. R., “Retrovirus-mediated gene transfer to analyze HPV gene regulation and protein functions in organotypic “raft” cultures,” Methods Mol. Med., 119, pp. 187-202 (2005)). Primary HFKs were acutely infected with the retroviruses and selected with G-418 (300 μg/mL). The selected HFKs were used to establish epithelial raft cultures and harvested on day 11.
TaqMan® real-time quantitative PCR assays: Quantitative validation of genes in clinical samples and raft tissues was analyzed by real-time PCR TaqMan® gene expression assays (Applied Biosystems). In brief, 2 μg of total RNA from each sample was reversely transcribed using Superscript® First-stand Synthesis kit (Invitrogen) according to the manufacturer's instructions. TaqMan® gene expression assays for RNA-binding protein gene expression were obtained from life technologies and lncRNA primers for RT-qPCR were designed as given in Example 2.
The TaqMan® assay probes that span over exon-exon junctions were designed to amplify spliced RNA products to avoid detection of any contaminated residual genomic DNA in our RNA samples. After reverse transcription, PCR products were amplified from the cDNA samples using TaqMan® gene expression Master Mix (Applied Biosystems) together with TaqMan® gene expression assays on a StepOne Plus™ Real-Time PCR system (Applied Biosystems). Gene enrichment was calculated using the 2−ΔΔCt method in relation to the housekeeping gene GAPDH. The mean Ct value of a given gene from 24 normal cervical tissues after normalization was served as a basal level to calculate a relative level of the gene detected in each clinical sample. Data are presented as a bar graph with mean ±SE for each group. Significance of mRNA levels among clinical tissue groups was analyzed using the nonparametric Mann-Whitney U-test, while significance of the mRNA levels between raft culture tissue groups was analyzed by Student t-test.
Using RNA-sequencing (RNA-Seq) approach, seven normal cervical tissues and seven cervical cancer tissues were examined for their expression landscapes of approximately 19,000 coding and 113,513 noncoding RNAs. We identified 614 differentially expressed coding transcripts enriched in cancer related pathways and 95 of them encoding RNA-binding proteins (RBPs) from the analyzed 1502 human RBPs. Moreover, we identified 34 differentially, abundantly expressed lnc-RNAs from normal cervix to cervical cancer. Table 4 shows the two RNA-Seq analyses of 14 different clinical cervical tissues with two different RNA-seq platforms, each containing normal cervical tissues without HPV infection and cervical cancer tissues with HPV infection. The right column of the table shows the raw reads of individual samples from each RNA-Seq platform.
| TABLE 4 |
| RNA-Seq detection from 14 cervical tissue samples |
| Sample No. | Age (yr) | Pathology | HPV infection | Total reads |
| RNA-Seq-1 | ||||
| 1 | 27 | N | No | 13,171,863 |
| 2 | 38 | N | No | 12,028,762 |
| 3 | 42 | N | No | 31,143,321 |
| 4 | 40 | SCC | Yes | 12,422,476 |
| 5 | 42 | SCC | Yes | 11,425,454 |
| 6 | 24 | SCC | Yes | 22,302,605 |
| RNA-Seq-2 | ||||
| 7 | 42 | N | No | 85,255,279 |
| 8 | 37 | N | No | 83,376,820 |
| 9 | 52 | N | No | 80,265,055 |
| 10 | 44 | N | No | 81,954,460 |
| 11 | 48 | SCC | Yes | 66,982,821 |
| 12 | 45 | SCC | Yes | 74,819,347 |
| 13 | 47 | SCC | Yes | 93,579,886 |
| 14 | 49 | SCC | Yes | 66,891,722 |
FIG. 1 is a flowchart of the RNA-Seq analyses. FIG. 2 shows Venn diagrams and FIG. 3 shows a heat map showing 95 differentially expressed RNA-binding protein genes in cervical cancer (n=7) compared to normal cervical tissues (n=7). Table 5 summarizes the 8 RBPs with expression changes between normal and cancer tissues by RNA-Seq. (CPM: Counts per Million)
| TABLE 5 |
| RNA-Seq data of the 8 RBP genes between normal and cancer tissues |
| RNA-binding | Normal (log2 CPM, | Cancer (log2 CPM, | |
| protein genes | Description | mean ± SD) | mean ± SD) |
| CDKN2A | Cyclin-dependent kinase | −0.24 ± 0.88 | 6.3 ± 1.12 |
| inhibitor 2A | |||
| ELAVL2 | ELAV like neuron-specific RNA | −3.38 ± 1.89 | 0.17 ± 3.54 |
| binding protein 2 | |||
| GRB7 | Growth factor receptor-bound | 0.9 ± 0.96 | 4.07 ± 1.22 |
| protein 7 | |||
| HSPB1 | Heat shock 27 kDa protein 1 | 5.74 ± 1.09 | 8.84 ± 2.49 |
| KHSRP | KH-type splicing regulatory | 4.35 ± 0.18 | 5.85 ± 0.78 |
| protein | |||
| NOVA1 | Neuro-oncological ventral | 2.82 ± 0.55 | 0.1 ± 1.55 |
| antigen 1 | |||
| PTBP1 | Polypyrimidine tract binding | 5.74 ± 0.21 | 7.18 ± 0.83 |
| protein 1 | |||
| RNASEH2A | Ribonuclease H2, subunit A | 2.32 ± 0.47 | 5.01 ± 0.72 |
Table 6 provides the TaqMan® probe information of each RBP.
| TABLE 6 |
| TaqMan ® probe information of each RBP |
| Company | Order name | Cat No | ID No |
| Applied | Single Tube TaqMan ® Assay for | Cat. # 4331182 | Hs00918009_g1 |
| Biosystems ® | GRB7 | ||
| Applied | Single Tube TaqMan ® Assay for | Cat. # 4331182 | Hs00270011_m1 |
| Biosystems ® | ELAVL2 | ||
| Applied | Single Tube TaqMan ® Assay for | Cat. # 4331182 | Hs00958451_g1 |
| Biosystems ® | RNASEH2A | ||
| Applied | Single Tube TaqMan ® Assay for | Cat. # 4351372 | Hs01100863_g1 |
| Biosystems ® | KHSRP | ||
| Applied | Single Tube TaqMan ® Assay for | Cat. # 4351372 | Hs01103130_m1 |
| Biosystems ® | NOVA1 | ||
| Applied | Single Tube TaqMan ® Assay for | Cat. # 4351372 | Hs00914687_g1 |
| Biosystems ® | PTBP1 | ||
| Applied | Single Tube TaqMan ® Assay for | Cat. # 4331182 | Hs00923894_m1 |
| Biosystems ® | CDKN2A | ||
| Applied | Single Tube TaqMan ® Assay for | Cat. # 4331182 | Hs03044127_g1 |
| Biosystems ® | HSPB1 | ||
FIG. 4 shows the TaqMan® RT-qPCR validation confirming that all 8 RBPs significantly increased (7 RBPs) or decreased (1 RBP) in cervical cancer tissues (n=23), compared to normal cervical tissues (n=24). 7 increased RBP genes in cervical cancer were also shown higher expression in pre-cancerous lesions (CIN 2-3, n=25) when compared to the normal tissues, indicating these changes appear even at the early stage of cervical carcinogenesis. **, P<0.01; ***, P<0.001; NS, no statistics significance.
FIGS. 5 and 6 show that high-risk HPV16 and HPV18 infection affects the expression of RBPs. FIG. 5 shows Total RNA extracted from human vaginal keratinocyte (HVK)-derived raft cultures with (HVK16) or without (HVK) productive HPV16 infection and human foreskin keratinocyte (HFK) derived raft cultures with (HFK16) or without (HFK) productive HPV16 infection were examined by TaqMan® RT-qPCR for the expression of 8 RBPs. *, P<0.05; **, P<0.01; ***, P<0.001; NS, no statistics significance. FIG. 6 shows Total RNA extracted from human vaginal keratinocyte (HVK)-derived raft cultures with (HVK18) or without (HVK) productive HPV18 infection and human foreskin keratinocyte (HFK) derived raft cultures with (HFK18) or without (HFK) productive HPV18 infection were examined by TaqMan® RT-qPCR for the expression of 8 RBPs. *, P<0.05; ***, P<0.001; NS, no statistics significance. FIG. 7 shows that both HPV16 and HPV18 increase the expression of CDKN2A and RNASEH2A, but decrease the expression of NOVA1 in HFK- and HVK-derived rafts. In this experiment, total RNA was used to determine the relative levels of individual proteins by TaqMan® RT-qPCR. FIG. 8 shows that HPV18 infection and viral E6 and/or E7 affect the expression of RNASEH2A and Nova1. The expression of RNASEH2A and NOVA1 in primary human keratinocytes (PHK)-derived raft tissues with or without HPV18 infection on day 8, day 12, and day 16 or PHK rafts transduced with a retrovirus expression HPV18 E6, E7 or E6E7 or with an empty control retrovirus were further validated by TaqMan® RT-qPCR. These results demonstrate that RNASEH2A and NOVA1 respond to HPV18 infection and their altered expression in cervical cancer could be attributed to viral oncoprotein E6 and/or E7. *, P<0.05; ***, P<0.001; NS, no statistics significance.
FIG. 9 shows that knockdown or overexpression of RNASEH2A in HeLa or CaSki cells affects cell proliferation. Specific-siRNA knockdown or ectopic expression of RNASEH2A from a mammalian expression vector in HeLa or CaSki cells on cell proliferation was evaluated by Cell Counting Kit-8 (CCK-8) assay at time indicated. si-NS, non-specific siRNA; siRNASEH2A, RNASEH2A-specific siRNA; P, control vector; p-RNASEH2A, RNASEH2A-expression vector. FIG. 10 shows HPV oncoprotein E7 regulates the expression of RNASEH2A via E2F1. Specific-siRNA knockdown or ectopic expression of E2F1 from a mammalian expression vector in HeLa or CaSki cells on RNASEH2A was evaluated by Western blot using anti-RNASEH2A antibody. si-NS, non-specific siRNA; si-E2F1, E2F1-specific siRNA; P, control vector; p-E2F1, E2F1-expression vector.
RNA was extracted from each sample using Trizol® reagent (Life technologies). RNAseq libraries were prepared using TruSeq® Stranded Total RNA Kit with Ribo-Zero depletion and sequenced on an Illumina HiSeq™ 2000 platform as paired-end reads. The fastq data were mapped to human reference genome (hg19, GRCh37) by Bowtie (v2.2.1.0), and the mapping results were further filtered by samtools (v0.1.19.0). The latest annotation of LncRNA was downloaded from lncipedia database version 3.0. We counted the mapped reads in individual lncRNA region of each sample by bedtools (v2.19.0). The R Bioconductor edgeR package was used to normalize raw reads by the scaling method. The differentially expressed lncRNAs were detected by one-way ANOVA method with 10% false discovery rate (FDR) and four fold changes between the conditions. FIG. 11 is a flow chart of the RNA-Seq analysis. FIG. 12 is a heat map showing 34 overlapped, differentially expressed lnc-RNAs in cervical cancer compared to normal cervical tissues. lnc-FANCI-2 and lnc-GLB1L2-1 were specifically identified as associated with cervical cancer. Tables 2 and 3 list all of the isoforms of these two lnc-RNAs.
| Taqman ® primer design for lnc-FANCI-2 |
| Exon 6: |
| (SEQ ID NO: 76) |
| CTGGAAAGGAGGAGAACATGAAACATTGCTTGAAGACAATGGCCGAGACAG |
| CAGGTCCCACCCTGCACAGCCACCAGCATCTCTCCCCTCAGCCCTGTCTCC |
| TCTTCTGCAGTTGGGATCTGCACATTTAAGCCTGAA |
| Exon 7: |
| (SEQ ID NO: 77) |
| ATTGTCCTGTGAAGTGAAGTATGATCGGACAGCCTCTTTTCAGCTTTTATG |
| ACAATGGAGACAGAGGAATTGTGGCTCTTGCCAAGGTCACAGGATTGGAAT |
| ACAGAGCCAAGCCACCCCAGGACATGCAAGAGCCTCAGAAGGGAA |
| Primers for RT-qPCR |
| Forward: |
| (SEQ ID NO: 78) |
| 5′-ACAGCCACCAGCATCTCTC-3′ |
| Probe: |
| (SEQ ID NO: 79) |
| 5′-TGAAGTGAAGTATGATCGGACAGCCTC-3′ |
| Reverse: |
| (SEQ ID NO: 80) |
| 5′-CCACAATTCCTCTGTCTCCATT-3′ |
| TaqMan ® primer design for lnc-GLB1L2-1: |
| Last Exon 3: |
| (SEQ ID NO: 81) |
| TCTCTCATCTGTGTTTTCAGGGCATGGACTGGAACTCCCAATACCCCTGAC |
| ATGGGCTGAGTCAACGTGGTCATGAACATGTGACAGGAG |
| Last Exon 2: |
| (SEQ ID NO: 82) |
| GCAGCAGAAGTTGCAGAGAAGAGTGAGGCACGTTTGAAAAAGGCTGAAAAA |
| TGTTTCTGTCCAGGCAAGGGTGTGTGCTGAATGACTCAAGGATTTTTTGG |
| Primers for RT-qPCR |
| Forward: |
| (SEQ ID NO: 83) |
| 5′-CATGGACTGGAACTCCCAATA-3′ |
| Probe: |
| (SEQ ID NO: 84) |
| 5′-TGCAGAGAAGAGTGAGGCACGTTTG-3′ |
| Reverse: |
| (SEQ ID NO: 85) |
| 5′-CCTTGCCTGGACAGAAACATT-3′ |
FIG. 13 shows an increase of lnc-FANCI-2, and decrease of lnc-GLB1L2-1 expression along with the cervical lesion progression from normal cervix. Lnc-FANCI-2 and lnc-GLB1L2-1 RNA expression was examined by RT-qPCR in 24 normal, 25 CIN 2-3, and 23 cancer tissues. FIG. 14 shows that HPV infection increases lnc-FANCI-2 expression in HVK- and PHK-derived rafts and viral E7 or E6 is responsible for the increase. The expression of lnc-FANCI-2 in human vaginal keratinocytes (HVK)-derived raft tissues without (HVK) or with HPV16 (HVK16) or HPV18 (HVK18) infection or primary human keratinocytes (PHK)-derived raft tissues without or with HPV18 infection on day 8, day 12, and day 16 or PHK rafts transduced with a retrovirus expressing HPV18 E6, E7 or E6E7 or with an empty control retrovirus were further validated by RT-qPCR. These results demonstrate that lnc-FANCI-2 expression responds to HPV18 infection and viral oncoprotein E6 and/or E7.
In data not shown, lnc-FANCI-2 was upregulated in isolated keratinocyte lines infected by high-risk HPVs, but not low risk HPV11 and epidermodysplasia verruciformis-associated HPVS and 10.
The term “polynucleotide” as used herein refers to a polymer of greater than one nucleotide in length of ribonucleic acid (RNA), deoxyribonucleic acid (DNA), hybrid RNA/DNA, modified RNA or DNA, or RNA or DNA mimetics, including peptide nucleic acids (PNAs). The polynucleotides may be single- or double-stranded. The term includes polynucleotides composed of naturally-occurring nucleobases, sugars, and covalent internucleoside (backbone) linkages as well as polynucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted polynucleotides are well known in the art and are referred to as “analogues.”
“Complementary” or “substantially complementary” refers to the ability to hybridize or base pair between nucleotides or nucleic acids, such as, for instance, between a sensor peptide nucleic acid or polynucleotide and a target polynucleotide. Complementary nucleotides are, generally, A and T (or A and U), or C and G. Two single-stranded polynucleotides or PNAs are said to be substantially complementary when the bases of one strand, optimally aligned and compared and with appropriate insertions or deletions, pair with at least about 80% of the bases of the other strand, usually at least about 90% to 95%, and more preferably from about 98 to 100%.
Alternatively, substantial complementarity exists when a polynucleotide may hybridize under selective hybridization conditions to its complement. Typically, selective hybridization may occur when there is at least about 65% complementarity over a stretch of at least 14 to 25 bases, for example at least about 75%, or at least about 90% complementarity.
The term “homologous region” refers to a region of a nucleic acid with homology to another nucleic acid region. Whether a “homologous region” is present in a nucleic acid molecule is determined with reference to another nucleic acid region in the same or a different molecule.
Hybridization conditions typically include salt concentrations of less than about 1M, more usually less than about 500 mM, for example, less than about 200 mM. In the case of hybridization between a peptide nucleic acid and a polynucleotide, the hybridization can be done in solutions containing little or no salt. Hybridization temperatures can be as low as 5° C., but are typically greater than 22° C., and more typically greater than about 30° C., for example in excess of about 37° C. Longer fragments may require higher hybridization temperatures for specific hybridization as is known in the art. Other factors may affect the stringency of hybridization, including base composition and length of the complementary strands, presence of organic solvents and extent of base mismatching, and the combination of parameters used is more important than the absolute measure of any one alone. Other hybridization conditions which may be controlled include buffer type and concentration, solution pH, presence and concentration of blocking reagents to decrease background binding such as repeat sequences or blocking protein solutions, detergent type(s) and concentrations, molecules such as polymers which increase the relative concentration of the polynucleotides, metal ion(s) and their concentration(s), chelator(s) and their concentrations, and other conditions known in the art.
As used herein, a “probe” is a polynucleotide capable of selectively hybridizing to a target sequence, a complement thereof, a reverse complement thereof, or to an RNA version of the target sequence, the complement thereof, or the reverse complement thereof. A probe may comprise ribonucleotides, deoxyribonucleotides, peptide nucleic acids, and combinations thereof. A probe may optionally comprise one or more labels. In some embodiments, a probe may be used to amplify one or both strands of a target sequence or an RNA form thereof, acting as a sole primer in an amplification reaction or as a member of a set of primers. In one aspect, probes include nucleotide sequences of 10 to 1,000 nucleotides. In other embodiments, the probes are 10-200, 10-30, 10-40, 20-50, 40-80, 50-150, or 80-120 nucleotides in length.
The use of the terms “a” and “an” and “the” and similar referents (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms first, second etc. as used herein are not meant to denote any particular ordering, but simply for convenience to denote a plurality of, for example, layers. The terms “comprising”, “having”, “including”, and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to”) unless otherwise noted. Recitation of ranges of values are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. The endpoints of all ranges are included within the range and independently combinable. All methods described herein can be performed in a suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”), is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention as used herein.
While the invention has been described with reference to an exemplary embodiment, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention. In addition, many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof. Therefore, it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this invention, but that the invention will include all embodiments falling within the scope of the appended claims. Any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
1. A method of quantitating an expression level of a lnc-FANCI-2 polynucleotide in a sample containing cells from a test patient's cervix with one or more first polynucleotides that hybridizes to the lnc-FANCI-2 polynucleotide, the method comprising
contacting the sample containing cells from the test patient's cervix with the one or more first polynucleotides, and
detecting the level of hybridization of the one or more first polynucleotides to the lnc-FANCI-2polynucleotide,
comparing the level of hybridization in the sample containing cells from the test patient's cervix to a control level of hybridization in a control sample of normal cervical tissues, and
determining differential expression of the lnc-FANCI-2polynucleotidein the sample containing cells from the test patient's cervix when the level of hybridization for the sample containing cells from the test patient's cervix is at least about 300% of the control level of hybridization in the control sample,
wherein the one or more first polynucleotides comprises a forward primer comprising 10-40 nucleotides of SEQ ID NO: 76, a probe comprising 10-40 nucleotides of SEQ ID NO: 77, and a reverse primer complementary to 10-40 nucleotides of SEQ ID NO: 77, wherein the probe and the reverse primer comprise non-overlapping sequences.
2. The method of claim 1, wherein detecting the level of hybridization of the one or more first polynucleotides to the lnc-FANCI-2polynucleotide is done with real-time RT-PCR.
3. The method of claim 1, wherein the sample containing cells from the test patient's cervix comprises a PAP smear, a vaginal wash, or a cervical biopsy sample.
4. A method of classifying a patient as having a normal cervix, having stage 2-3 CIN, or having cervical cancer, the method comprising
contacting a sample containing cells from the test patient's cervix with one or more first polynucleotides that hybridizes to the lnc-FANCI-2polynucleotide, and
detecting the level of hybridization of the one or more first polynucleotides to the lnc-FANCI-2polynucleotide,
comparing the level of hybridization in the sample containing cells from the test patient's cervix to a control level of hybridization in a control sample of normal cervical tissues, and
determining a normal cervix in the subject when the level of hybridization is comparable to the control sample of normal cervical tissues,
determining stage 2-3 CIN in the subject when the level of hybridization is at least about 300% to at least about 700% of the control level of hybridization in the control sample, and
determining stage 2-3 CIN in the subject when the level of hybridization is at least about 1000% of the control level of hybridization in the control sample,
wherein the one or more first polynucleotides comprises a forward primer comprising 10-40 nucleotides of SEQ ID NO: 76, a probe comprising 10-40 nucleotides of SEQ ID NO: 77, and a reverse primer complementary to 10-40 nucleotides of SEQ ID NO: 77, wherein the probe and the reverse primer comprise non-overlapping sequences.
5. The method of claim 4, wherein detecting the level of hybridization of the one or more first polynucleotides to lnc-FANCI-2polynucleotide is done with real-time RT-PCR.
6. The method of claim 4, wherein the sample containing cells from the test patient's cervix comprises a PAP smear, a vaginal wash, or a cervical biopsy sample.