Patent application title:

CLASSIFICATION AND ACTIONABILITY INDICES FOR CANCER

Publication number:

US20200362421A1

Publication date:
Application number:

16/863,360

Filed date:

2020-04-30

Abstract:

The disclosure provides compositions, kits, and methods for detecting a plurality of genes and associated variants in a sample from a subject with cancer (e.g., lung cancer). The compositions, kits, and methods include a set of oligonucleotides, typically primers and/or probes that can hybridize to identify a gene variant. The methods disclosed herein provide for a mutation status of a tumor to be determined and subsequently associated with a report comprising an actionable treatment recommendation (e.g., a report comprising an actionable treatment recommendation).

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q2600/158 »  CPC further

Oligonucleotides characterized by their use Expression markers

C12Q2600/118 »  CPC further

Oligonucleotides characterized by their use Prognosis of disease development

C12Q2600/106 »  CPC further

Oligonucleotides characterized by their use Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism

C12Q1/6886 »  CPC main

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a continuation-in-part application of pending U.S. application Ser. No. 15/828,333, filed Nov. 30, 2017, the entire contents of which application is incorporated by reference herein, which is a continuation application of U.S. application Ser. No. 14/212,717 filed Mar. 14, 2014, now abandoned, which claims priority to U.S. Provisional Application Nos. 61/891,224 filed Oct. 15, 2013 and 61/877,827 filed Sep. 13, 2013; and this application is a continuation-in-part application of pending U.S. application Ser. No. 15/068,011, filed Mar. 11, 2016, the entire contents of which application is incorporated by reference herein, which is a continuation application of U.S. application Ser. No. 14/212,115 filed Mar. 14, 2014, now abandoned, which claims priority to U.S. Provisional Application No. 61/799,399 filed Mar. 15, 2013.

BACKGROUND

Cancer is a broad group of diseases involving unregulated cell growth. Although the causes of cancer are diverse, our understanding of genetic alterations that are involved is increasing rapidly.

Lung cancer is the leading cause of cancer deaths among both men and women. It is a fast growing and highly fatal disease. Nearly 60% of people diagnosed with lung cancer die within one year of diagnosis and approximately 75% die within 2 years. There are two major types of lung cancer: small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC). Approximately 85% of lung cancers are NSCLC. There are 3 sub-types of NSCLC, which differ in size, shape, and biochemical make-up. Approximately 25-30% of all lung cancers are squamous cell carcinomas. Adenocarcinomas (e.g., bronchioloalveolar carcinoma) account for approximately 40% of lung cancers, and are usually found in the outer region of the lung. Large-cell undifferentiated carcinoma accounts for approximately 10-15% of all lung cancers. SCLC and NSCLC are treated very differently. SCLC is mainly treated with chemotherapy, either alone or in combination with radiation. In contrast with treatment for SCLC, surgery is the only reliable method to cure NSCLC. Lymph nodes are also removed to assess the spread of cancer. In addition to surgery, chemotherapy can be used to treat NSCLC.

A growing number of treatment regimens are available and becoming available. However, many treatment regimes are only effective against cancers (e.g., lung cancers) that have a particular genetic variation. Therefore, a test that can detect many different specific actionable genetic variations would have significant value to cancer patients (e.g., lung cancer). However, the tissue required for currently available multiple genetic variance assays far exceeds what is available from a typical tumor biopsy or resection. Furthermore, tests are not available for many of the genetic variations, and there is no tool that can recommend a treatment based on a comprehensive scan of many known, actionable genetic variations.

The disclosed compositions, kits and methods provide comprehensive genetic variance screening of a cancer (e.g., lung cancer) in a single panel utilizing a single cancer (e.g., lung cancer) sample. The genetic variants form the basis of an actionable treatment recommendation framework provided herein.

BRIEF SUMMARY

The disclosure provides methods, compositions and kits. In one embodiment, a method to determine an actionable treatment recommendation for a subject diagnosed with lung cancer is provided. In one embodiment provided method comprises: obtaining a biological sample from the subject; detecting at least one variant using a set of probes that hybridize to and amplify EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, ERRBB4, MET, RET, FGFR1, FGFR2, FGFR3, DDR2, NRAS, PTEN, MAP2K1, TP53, STK11, CTNNB1, SMAD4, FBXW7, NOTCH 1, KIT/PGDFRA, PIK3CA, AKT1, and HRAS genes to detect at least one variant; determining, based on the at least one variant detected, an actionable treatment recommendation for the subject. In another embodiment provided method comprises: obtaining a biological sample from the subject; detecting at least one variant using a set of probes that hybridize to and amplify EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, MET, RET, FGFR1, KIT/PGDFRA, PIK3CA, AKT1, BRAF, and HRAS genes to detect at least one variant; determining, based on the at least one variant detected, an actionable treatment recommendation for the subject.

In one embodiment provided method comprises: contacting a biological sample from a subject; detecting at least one variant using a set of probes that hybridize to and amplify EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, ERRBB4, MET, RET, FGFR1, FGFR2, FGFR3, DDR2, NRAS, PTEN, MAP2K1, TP53, STK11, CTNNB1, SMAD4, FBXW7, NOTCH 1, KIT/PGDFRA, PIK3CA, AKT1, BRAF, and HRAS genes to detect at least one variant; determining, based on the at least one variant detected, an actionable treatment recommendation for the subject. In another embodiment provided method comprises: contacting a biological sample from a subject; detecting at least one variant using a set of probes that hybridize to and amplify EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, MET, RET, FGFR1, KIT/PGDFRA, PIK3CA, AKT1, BRAF, and HRAS genes to detect at least one variant; determining, based on the at least one variant detected, an actionable treatment recommendation for the subject.

In another embodiment, the disclosure provides a method to determine an actionable treatment recommendation for a subject diagnosed with lung cancer, comprising: detecting in a sample from a subject, at least one variant using a set of probes that hybridize to and amplify ALK, ROS1, KRAS, BRAF, ERBB2, MET, RET, FGFR1, and KIT/PDGFRA genes to detect at least one variant, and determining, based on the at least one variant detected, an actionable treatment recommendation for the subject.

In yet other embodiments, a method to determine the likelihood of a response to a treatment in an individual afflicted with lung cancer is provided. The method comprises: determining the presence or absence of at least one gene variant in a sample obtained from the individual, wherein the at least one variant is in EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, ERRBB4, MET, RET, FGFR1, FGFR2, FGFR3, DDR2, NRAS, PTEN, MAP2K1, TP53, STK11, CTNNB1, SMAD4, FBXW7, NOTCH 1, KIT/PGDFRA, PIK3CA, AKT1, and HRAS genes, wherein the presence of at least one variant indicates the individual is likely or unlikely to respond to the treatment, wherein the treatment is selected from: crizotinib when the variant detected is an ALK fusion; ROS1 fusion (EZR, SLC34A2, CD74, and/or SDC4); MET gene amplification; EGFR tyrosine kinase inhibitor (TKI) when the variant detected is EGFR (L858R, Exon 19 del, and/or G719X); a non-EGFR TKI treatment when the variant detected is EGFR T790M; a MEK inhibitor when the variant detected is KRAS G12C/V/D/A/S/R/F, G13C, G3D and/or G12F; vermurafenib when the variant detected is BRAF V600E; an irreversible pan-erb inhibitor when the variant detected is ERBB2 exon 20 ins; and a PIC3CA inhibitor when the variant detected is PIK3CA (E545K, E545G, E545a, H1047R, E542K and/or H1047L). In other embodiments the method comprises: determining the presence or absence of at least one gene variant in a sample obtained from the individual, wherein the at least one variant is in EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, MET, RET, FGFR1, KIT/PGDFRA, PIK3CA, AKT1, BRAF, and/or HRAS genes, wherein the presence of at least one variant indicates the individual is likely or unlikely to respond to the treatment, wherein the treatment is selected from: crizotinib when the variant detected is an ALK fusion; ROS1 fusion (EZR, SLC34A2, CD74, and/or SDC4); MET gene amplification; EGFR tyrosine kinase inhibitor (TKI) when the variant detected is EGFR (L858R, Exon 19 del, and/or G719X); a non-EGFR TKI treatment when the variant detected is EGFR T790M; a MEK inhibitor when the variant detected is KRAS G12C/V/D/A/S/R/F, G13C, G13D and/or G12F; vermurafenib when the variant detected is BRAF V600E; an irreversible pan-erb inhibitor when the variant detected is ERBB2 exon 20 ins; and a PIC3CA inhibitor when the variant detected is PIK3CA (E545K, E545G, E545a, H1047R, E542K and/or H1047L).

In another embodiment, the disclosure provides a method of detecting a nucleic acid variant in a sample, comprising obtaining a biological sample, amplifying at least one gene selected from EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, ERRBB4, MET, RET, FGFR1, FGFR2, FGFR3, DDR2, NRAS, PTEN, MAP2K1, TP53, STK11, CTNNB1, SMAD4, FBXW7, NOTCH 1, KIT/PGDFRA, PIK3CA, AKT1, and HRAS genes, using primers that (a) amplifying at least one variant selected from EGFR (L858R, Exon 19 del, G719X and/or T790M), KRAS (G12C/V/D/A/S/R/F, G13C, G13D and/or G12F), BRAF (L597R, D594H/N, V600E), ERBB2 exon 20 ins, PIK3CA (E545K, E545G, E545a, H1047R, and/or H1047L); and (b) detecting at least one nucleic acid variant present in the sample.

In another embodiment, the disclosure provides a method of detecting a nucleic acid variant in a sample, comprising obtaining a biological sample, amplifying at least one gene selected from EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, MET, RET, FGFR1, KIT/PGDFRA, PIK3CA, AKT1, BRAF, and HRAS genes, using primers that (a) amplifying at least one variant selected from EGFR (L858R, Exon 19 del, G719X and/or T790M), KRAS (G12C/V/D/A/S/R/F, G13C, G13D and/or G12F), BRAF (L597R, D594H/N, V600E), ERBB2 exon 20 ins, PIK3CA (E545K, E545G, E545a, H1047R, and/or H1047L); and (b) detecting at least one nucleic acid variant present in the sample.

In yet embodiment, a method of treating lung adenocarcinoma in a patient is disclosed. The method comprises: testing for the presence of variants in at least one of ALK, ROS1, KRAS, BRAF, ERBB2, MET, RET, FGFR1, and KIT/PDGFRA genes in a lung tumor sample from the patient and administering a therapeutically effective amount a treatment to the patient, wherein the treatment is: Crizotinib when the variant detected is an ALK fusion, ROS1 fusion (EZR, SLC34A2, CD74, and/or SDC4), or MET gene amplification; EGFR tyrosine kinase inhibitor (TKI) when the variant detected is EGFR (L858R, Exon 19 del, and/or G719X); a MEK inhibitor when the variant detected is KRAS G12C/V/D/A/S/R/F, G13C, G3D and/or G12F; Vermurafenib when the variant detected is BRAF V600E; and an irreversible pan-erb inhibitor when the variant detected is ERBB2 exon 20 ins.

In yet another embodiment, the disclosure provides a method of identifying patients with lung cancer eligible for treatment with crizotnib, an EGFR TKI, or a treatment other than an EGFR TKI, a MEK inhibitor, vermurafenib, or an irreversible pan-erb inhibitor, comprising testing a lung tumor sample from the patient for the presence of a variant comprising an ALK fusion, ROS1 fusion (EZR, SLC34A2, CD74, and/or SDC4), EGFR (L858R, Exon 19 del, and/or T790M), KRAS (G12C/V/D/A), wherein the presence of at least one of said variants indicates the patient is eligible for treatment with at least one of said treatments.

The disclosure, in certain embodiments, also provides a kit comprising a set of probes, wherein the set of probes specifically recognize the genes EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, ERRBB4, MET, RET, FGFR1, FGFR2, FGFR3, DDR2, NRAS, PTEN, MAP2K1, TP53, STK11, CTNNB1, SMAD4, FBXW7, NOTCH 1, KIT/PGDFRA, PIK3CA, AKT1, and HRAS, and wherein the set of probes can recognize and distinguish one or more allelic variants of the genes EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, ERRBB4, MET, RET, FGFR1, FGFR2, FGFR3, DDR2, NRAS, PTEN, MAP2K1, TP53, STK11, CTNNB1, SMAD4, FBXW7, NOTCH 1, KIT/PGDFRA, PIK3CA, AKT1, and HRAS.

Certain embodiments of the disclosure further provide a composition comprising a set of probes, wherein the set of probes specifically recognize the genes EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, ERRBB4, MET, RET, FGFR1, FGFR2, FGFR3, DDR2, NRAS, PTEN, MAP2K1, TP53, STK11, CTNNB1, SMAD4, FBXW7, NOTCH 1, KIT/PGDFRA, PIK3CA, AKT1, and HRAS, and wherein the set of probes can recognize and distinguish one or more allelic variants of the genes EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, ERRBB4, MET, RET, FGFR1, FGFR2, FGFR3, DDR2, NRAS, PTEN, MAP2K1, TP53, STK11, CTNNB1, SMAD4, FBXW7, NOTCH 1, KIT/PGDFRA, PIK3CA, AKT1, and HRAS.

The disclosure, in certain embodiments, also provides a kit comprising a set of probes, wherein the set of probes specifically recognize the genes AKT1, ALK, BRAF, ERBB2, EGFR, FGFR1, HRAS, KIT, KRAS, MET, PIK3CA, RET and ROS, and wherein the set of probes can recognize and distinguish one or more allelic variants of the genes AKT1, ALK, BRAF, ERBB2, EGFR, HRAS, KRAS, MET, PIK3CA, RET and ROS.

Certain embodiments of the disclosure further provide a composition comprising a set of probes, wherein the set of probes specifically recognize the genes AKT1, ALK, BRAF, ERBB2, EGFR, FGFR1, HRAS, KIT, KRAS, MET, PIK3CA, RET and ROS, and wherein the set of probes can recognize and distinguish one or more allelic variants of the genes AKT1, ALK, BRAF, ERBB2, EGFR, HRAS, KRAS, MET, PIK3CA, RET and ROS.

In certain embodiments of the disclosure, the compositions can comprise a set of probes that specifically recognize the genes in Tables 13-17 and 19. Further, the methods and kits can comprise the identifying, detecting, and/or determining the presence of one or more of the genes, copy number variations, and/or gene fusions in Tables 13-17 and 19 These genes, copy number variations, and/or gene fusions can be associated with any type of cancer.

In yet another embodiment of the disclosure, a composition comprising a set of probes is provided, wherein the set of probes specifically recognizes driver gene alterations associated with a cancer. In certain embodiments, the driver gene alterations have associated actionability, such as evidence that the driver gene alteration is associated with a drug response. In certain embodiments, the driver gene alterations comprise one or more of the genes, copy number variations, and/or gene fusions in Tables 13-17 and 19.

In certain embodiments of the disclosure, the driver gene alterations are detected or identified by a method comprising next generation sequencing. The driver gene alterations can be associated with a cancer.

In yet another embodiment of the disclosure, the driver gene alterations detected or identified by a method comprising next generation sequencing are confirmed by a method comprising sanger sequencing or thermo cycle sequencing.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 a work flow, according to one embodiment of the disclosure, in which a sample is screened by NGS and a Reflex Test is conducted. A report is generated and actionability of an FDA-approved drug or additional classification with a companion diagnostic test is reported. Treatment can proceed based on the report.

FIG. 2 is workflow, according to another embodiment of the disclosure, in which a tumor sample is sequenced and a report with actionability is generated.

FIG. 3 is workflow, according to another embodiment of the disclosure, in which a tumor sample is sequenced and a report with actionability is generated.

FIG. 4 is a bioinformatics workflow in accordance with an embodiment of the disclosure, in which variants are identified and a report is generated

FIGS. 5A-5B are bioinformatics workflow according to an embodiment of the disclosure, in which a variant calls are reviewed and a report is generated.

FIG. 6 is a schematic depicting how gene content can be defined by driver analysis, according to an embodiment of the disclosure.

DETAILED DESCRIPTION

The disclosure provides compositions, kits, and methods for detecting a plurality of genes and associated variants in a subject with cancer; and compositions, kits, and methods for detecting a plurality of genes and associated variants in a subject with lung cancer. The compositions, kits, and methods include a set of oligonucleotides, typically primers and/or probes that can hybridize to identify a gene variant. The methods disclosed herein provide for a mutation status of a tumor to be determined and subsequently associated with an actionable treatment recommendation. In certain embodiments, methods for determining a treatment and treating a subject with cancer are provided. In certain embodiments, methods for determining a treatment and treating a subject with lung cancer are provided.

An advantage of the disclosed compositions, kits, and methods is the ability to recommend an actionable treatment for a subject diagnosed with cancer, by comprehensively screening a tumor sample for a variety of mutations, including driver mutations. Driver mutations can be associated with treatment response. Therefore, by determining the driver mutation status, the disclosed methods can determine and provide an actionable treatment recommendation. This comprehensive screening is performed in a single panel and therefore can be performed utilizing a single biological sample, thus preserving valuable sample.

An advantage of the disclosed compositions, kits, and methods is the ability to recommend an actionable treatment for a subject diagnosed with lung cancer, by comprehensively screening a tumor sample for a plurality of high and/or optionally low prevalence genetic variances that are most likely to have an impact on the appropriate clinical course of action for the subject. In certain embodiments, by determining the mutation status of the disclosed combination of gene variations, the methods provide an actionable treatment recommendation for greater than 50% of lung adenocarcinoma subjects. This comprehensive screening is performed in a single panel and therefore can be performed utilizing a single biological sample, thus preserving valuable sample.

Definitions

“Cancer” refers to a broad group of diseases involving unregulated cell growth. A large variety of cancers are known. Examples of known cancers are provided throughout the disclosure and are listed in Table 18.

“Lung cancer” refers generally to two main types of lung cancer categorized by the size and appearance of the malignant cells: non-small cell (approximately 80% of cases) and small-cell (roughly 20% of cases) lung cancer. Lung adenocarcinoma is the most common subtype of non-small cell lung cancer (NSCLC); other subtypes include squamous cell lung carcinoma, bronchioloalveolar carcinoma, large cell carcinoma, carcinoid, adenoid cystic carcinoma, cylindroma, and mucoepidermoid carcinoma. In one embodiment, lung cancers are staged according to stages I-IV, with I being an early stage and IV being the most advanced.

“Prognosis” refers, e.g., to overall survival, long term mortality, and disease free survival. In one embodiment, long term mortality refers to death within 5 years after diagnosis of lung cancer. Although prognosis within 1, 2, or 3 years is also contemplated as is a prognosis beyond 5 years.

Other forms of cancer include carcinomas, sarcomas, adenocarcinomas, lymphomas, leukemias, etc., including solid and lymphoid cancers, head and neck cancer, e.g., oral cavity, pharyngeal and tongue cancer, kidney, breast, kidney, bladder, colon, ovarian, prostate, pancreas, stomach, brain, head and neck, skin, uterine, testicular, esophagus, and liver cancer, including hepatocarcinoma, lymphoma, including non-Hodgkin's lymphomas (e.g., Burkitt's, Small Cell, and Large Cell lymphomas) and Hodgkin's lymphoma, leukemia, and multiple myeloma.

The term “marker” or “biomarker” refers to a molecule (typically protein, nucleic acid, carbohydrate, or lipid) that is expressed in the cell, expressed on the surface of a cancer cell or secreted by a cancer cell in comparison to a non-cancer cell, and which is useful for the diagnosis of cancer, for providing a prognosis, and for preferential targeting of a pharmacological agent to the cancer cell. Oftentimes, such markers are molecules that are overexpressed in a lung cancer or other cancer cell in comparison to a non-cancer cell, for instance, 1-fold overexpression, 2-fold overexpression, 3-fold overexpression or more in comparison to a normal cell. Further, a marker can be a molecule that is inappropriately synthesized in the cancer cell, for instance, a molecule that contains deletions, additions or mutations in comparison to the molecule expressed on a normal cell. Alternatively, such biomarkers are molecules that are underexpressed in a cancer cell in comparison to a non-cancer cell, for instance, 1-fold underexpression, 2-fold underexpression, 3-fold underexpression, or more. Further, a marker can be a molecule that is inappropriately synthesized in cancer, for instance, a molecule that contains deletions, additions or mutations in comparison to the molecule expressed on a normal cell.

It will be understood by the skilled artisan that markers may be used in combination with other markers or tests for any of the uses, e.g., prediction, diagnosis, or prognosis of cancer, disclosed herein.

“Biological sample” includes sections of tissues such as biopsy and autopsy samples, and frozen sections taken for histologic purposes. Such samples include blood and blood fractions or products (e.g., serum, platelets, red blood cells, and the like), sputum, bronchoalveolar lavage, cultured cells, e.g., primary cultures, explants, and transformed cells, stool, urine, etc. A biological sample is typically obtained from a eukaryotic organism, most preferably a mammal such as a primate e.g., chimpanzee or human; cow; dog; cat; a rodent, e.g., guinea pig, rat, Mouse; rabbit; or a bird; reptile; or fish.

A “biopsy” refers to the process of removing a tissue sample for diagnostic or prognostic evaluation, and to the tissue specimen itself. Any biopsy technique known in the art can be applied to the diagnostic and prognostic methods of the present invention. The biopsy technique applied will depend on the tissue type to be evaluated (e.g., lung etc.), the size and type of the tumor, among other factors. Representative biopsy techniques include, but are not limited to, excisional biopsy, incisional biopsy, needle biopsy, surgical biopsy, and bone marrow biopsy. An “excisional biopsy” refers to the removal of an entire tumor mass with a small margin of normal tissue surrounding it. An “incisional biopsy” refers to the removal of a wedge of tissue from within the tumor. A diagnosis or prognosis made by endoscopy or radiographic guidance can require a “core-needle biopsy”, or a “fine-needle aspiration biopsy” which generally obtains a suspension of cells from within a target tissue. Biopsy techniques are discussed, for example, in Harrison's Principles of Internal Medicine, Kasper, et al., eds., 16th ed., 2005, Chapter 70, and throughout Part V.

The terms “overexpress,” “overexpression,” or “overexpressed” interchangeably refer to a protein or nucleic acid (RNA) that is translated or transcribed at a detectably greater level, usually in a cancer cell, in comparison to a normal cell. The term includes overexpression due to transcription, post transcriptional processing, translation, post-translational processing, cellular localization (e.g., organelle, cytoplasm, nucleus, cell surface), and RNA and protein stability, as compared to a normal cell. Overexpression can be detected using conventional techniques for detecting mRNA (i.e., RT-PCR, PCR, hybridization) or proteins (i.e., ELISA, immunohistochemical techniques). Overexpression can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more in comparison to a normal cell. In certain instances, overexpression is 1-fold, 2-fold, 3-fold, 4-fold or more higher levels of transcription or translation in comparison to a normal cell.

The terms “underexpress,” “underexpression,” or “underexpressed” or “downregulated” interchangeably refer to a protein or nucleic acid that is translated or transcribed at a detectably lower level in a cancer cell, in comparison to a normal cell. The term includes underexpression due to transcription, post transcriptional processing, translation, post-translational processing, cellular localization (e.g., organelle, cytoplasm, nucleus, cell surface), and RNA and protein stability, as compared to a control. Underexpression can be detected using conventional techniques for detecting mRNA (i.e., RT-PCR, PCR, hybridization) or proteins (i.e., ELISA, immunohistochemical techniques). Underexpression can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or less in comparison to a control. In certain instances, underexpression is 1-fold, 2-fold, 3-fold, 4-fold or more lower levels of transcription or translation in comparison to a control.

The term “differentially expressed” or “differentially regulated” refers generally to a protein or nucleic acid that is overexpressed (upregulated) or underexpressed (downregulated) in one sample compared to at least one other sample, generally in a cancer patient compared to a sample of non-cancerous tissue in the context of the present invention.

“Therapeutic treatment” and “cancer therapies” refers to chemotherapy, hormonal therapy, radiotherapy, immunotherapy, and biologic and small molecule targeted therapy.

By “therapeutically effective amount or dose” or “sufficient amount or dose” herein is meant a dose that produces effects for which it is administered. The exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott, Williams & Wilkins).

The terms “polypeptide,” “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.

The term “amino acid” refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that arc later modified, e.g., hydroxyproline, γ-carboxyglutamate, and O-phosphoserine. Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.

Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.

As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a “conservatively modified variant” where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the invention.

The following eight groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serino (S), Threonine (T); and 8) Cysteine (C), Methionine (M). See, e.g., Creighton, Proteins (1984).

The phrase “specifically (or selectively) binds” when referring to a protein, nucleic acid, antibody, or small molecule compound refers to a binding reaction that is determinative of the presence of the protein or nucleic acid, such as the differentially expressed genes of the present invention, often in a heterogeneous population of proteins or nucleic acids and other biologics. In the case of antibodies, under designated immunoassay conditions, a specified antibody may bind to a particular protein at least two times the background and more typically more than 10 to 100 times background. Specific binding to an antibody under such conditions requires an antibody that is selected for its specificity for a particular protein. For example, polyclonal antibodies can be selected to obtain only those polyclonal antibodies that are specifically immunoreactive with the selected antigen and not with other proteins. This selection may be achieved by subtracting out antibodies that cross-react with other molecules. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein (see, e.g., Harlow & Lane, Antibodies, A Laboratory Manual (1988) for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity).

The phrase “functional effects” in the context of assays for testing compounds that modulate a marker protein includes the determination of a parameter that is indirectly or directly under the influence of a biomarker of the invention, e.g., a chemical or phenotypic. A functional effect therefore includes ligand binding activity, transcriptional activation or repression, the ability of cells to proliferate, the ability to migrate, among others. “Functional effects” include in vitro, in vivo, and ex vivo activities.

By “determining the functional effect” is meant assaying for a compound that increases or decreases a parameter that is indirectly or directly under the influence of a biomarker of the invention, e.g., measuring physical and chemical or phenotypic effects. Such functional effects can be measured by any means known to those skilled in the art, e.g., changes in spectroscopic characteristics (e.g., fluorescence, absorbance, refractive index); hydrodynamic (e.g., shape), chromatographic; or solubility properties for the protein; ligand binding assays, e.g., binding to antibodies; measuring inducible markers or transcriptional activation of the marker; measuring changes in enzymatic activity; the ability to increase or decrease cellular proliferation, apoptosis, cell cycle arrest, measuring changes in cell surface markers. The functional effects can be evaluated by many means known to those skilled in the art, e.g., microscopy for quantitative or qualitative measures of alterations in morphological features, measurement of changes in RNA or protein levels for other genes expressed in placental tissue, measurement of RNA stability, identification of downstream or reporter gene expression (CAT, luciferase, R-gal, GFP and the like), e.g., via chemiluminescence, fluorescence, colorimetric reactions, antibody binding, inducible markers, etc.

“Inhibitors,” “activators,” and “modulators” of the markers are used to refer to activating, inhibitory, or modulating molecules identified using in vitro and in vivo assays of cancer biomarkers. Inhibitors are compounds that, e.g., bind to, partially or totally block activity, decrease, prevent, delay activation, inactivate, desensitize, or down regulate the activity or expression of cancer biomarkers. “Activators” are compounds that increase, open, activate, facilitate, enhance activation, sensitize, agonize, or up regulate activity of cancer biomarkers, e.g., agonists. Inhibitors, activators, or modulators also include genetically modified versions of cancer biomarkers, e.g., versions with altered activity, as well as naturally occurring and synthetic ligands, antagonists, agonists, antibodies, peptides, cyclic peptides, nucleic acids, antisense molecules, ribozymes, RNAi and siRNA molecules, small organic molecules and the like. Such assays for inhibitors and activators include, e.g., expressing cancer biomarkers in vitro, in cells, or cell extracts, applying putative modulator compounds, and then determining the functional effects on activity, as described above.

Samples or assays comprising cancer biomarkers that are treated with a potential activator, inhibitor, or modulator are compared to control samples without the inhibitor, activator, or modulator to examine the extent of inhibition. Control samples (untreated with inhibitors) are assigned a relative protein activity value of 100%. Inhibition of cancer biomarkers is achieved when the activity value relative to the control is about 80%, preferably 50%, more preferably 25-0%. Activation of cancer biomarkers is achieved when the activity value relative to the control (untreated with activators) is 110%, more preferably 150%, more preferably 200-500% (i.e., two to five fold higher relative to the control), more preferably 1000-3000% higher.

The term “test compound” or “drug candidate” or “modulator” or grammatical equivalents as used herein describes any molecule, either naturally occurring or synthetic, e.g., protein, oligopeptide (e.g., from about 5 to about 25 amino acids in length, preferably from about 10 to 20 or 12 to 18 amino acids in length, preferably 12, 15, or 18 amino acids in length), small organic molecule, polysaccharide, peptide, circular peptide, lipid, fatty acid, siRNA, polynucleotide, oligonucleotide, etc., to be tested for the capacity to directly or indirectly modulate cancer biomarkers. The test compound can be in the form of a library of test compounds, such as a combinatorial or randomized library that provides a sufficient range of diversity. Test compounds are optionally linked to a fusion partner, e.g., targeting compounds, rescue compounds, dimerization compounds, stabilizing compounds, addressable compounds, and other functional moieties. Conventionally, new chemical entities with useful properties are generated by identifying a test compound (called a “lead compound”) with some desirable property or activity, e.g., inhibiting activity, creating variants of the lead compound, and evaluating the property and activity of those variant compounds. Often, high throughput screening (HTS) methods are employed for such an analysis.

In some embodiments are provided a kit that includes a set of probes. A “probe” or “probes” refers to a polynucleotide that is at least eight (8) nucleotides in length and which forms a hybrid structure with a target sequence, due to complementarity of at least one sequence in the probe with a sequence in the target region. The polynucleotide can be composed of DNA and/or RNA. Probes in certain embodiments, are detectably labeled, as discussed in more detail herein. Probes can vary significantly in size. Generally, probes are, for example, at least 8 to 15 nucleotides in length. Other probes are, for example, at least 20, 30 or 40 nucleotides long. Still other probes are somewhat longer, being at least, for example, 50, 60, 70, 80, 90 nucleotides long. Yet other probes are longer still, and are at least, for example, 100, 150, 200 or more nucleotides long. Probes can be of any specific length that falls within the foregoing ranges as well. Preferably, the probe does not contain a sequence complementary to the sequence(s) used to prime for a target sequence during the polymerase chain reaction.

The terms “complementary” or “complementarity” are used in reference to polynucleotides (that is, a sequence of nucleotides) related by the base-pairing rules. For example, the sequence “A-G-T,” is complementary to the sequence “T-C-A.” Complementarity may be “partial,” in which only some of the nucleic acids' bases are matched according to the base pairing rules. Alternatively, there may be “complete” or “total” complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands.

“Oligonucleotide” or “polynucleotide” refers to a polymer of a single-stranded or double-stranded deoxyribonucleotide or ribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.

“Amplification detection assay” refers to a primer pair and matched probe wherein the primer pair flanks a region of a target nucleic acid, typically a target gene, which defines an amplicon, and wherein the probe binds to the amplicon.

A set of probes typically refers to a set of primers, usually primer pairs, and/or detectably-labeled probes that are used to detect the target genetic variations used in the actionable treatment recommendations of the disclosure. As a non-limiting example, a set of primers that are used to detect variants of EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, ERRBB4, MET, RET, FGFR1, FGFR2, FGFR3, DDR2, NRAS, PTEN, MAP2K1, TP53, STK11, CTNNB1, SMAD4, FBXW7, NOTCH 1, KIT/PGDFRA, PIK3CA, AKT1, HRAS, KIT/PDGFRA, and/or the genes or variants in thereof in Tables 13-17, include at least one primer and typically a pair of amplification primers for each of the aforementioned genes, that are used to amplify a nucleic acid region that spans a particular genetic variant region in the aforementioned genes. As another non-limiting example, a set of amplification detection assays for EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, ERRBB4, MET, RET, FGFR1, FGFR2, FGFR3, DDR2, NRAS, PTEN, MAP2K1, TP53, STK11, CTNNB1, SMAD4, FBXW7, NOTCH 1, KIT/PGDFRA, PIK3CA, AKT1, HRAS, KIT/PDGFRA, and/or the genes in Tables 13-17 and 19, includes a set of primer pairs and matched probes for each of the aforementioned genes. The primer pairs are used in an amplification reaction to define an amplicon that spans a region for a target genetic variation for each of the aforementioned genes. The set of amplicons are detected by a set of matched probes. In an exemplary embodiment, the invention is a set of TaqMan™ (Roche Molecular Systems, Pleasanton, Calif.) assays that are used to detect a set of target genetic variations used in the methods of the invention. For example, in one embodiment, the invention is a set of Taqman assays that detect the detect EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, ERRBB4, MET, RET, FGFR1, FGFR2, FGFR3, DDR2, NRAS, PTEN, MAP2K1, TP53, STK11, CTNNB1, SMAD4, FBXW7, NOTCH 1, KIT/PGDFRA, PIK3CA, AKT1, HRAS, and/or KIT/PDGFRA genes.

In one embodiment, the set of probes are a set of primers used to generate amplicons that are detected by a nucleic acid sequencing reaction, such as a next generation sequencing reaction. In these embodiments, for example, AmpliSEQ™ (Life Technologies/Ion Torrent, Carlsbad, Calif.) or TruSEQ™ (Illumina, San Diego, Calif.) technology can be employed.

A modified ribonucleotide or deoxyribonucleotide refer to molecules that can be used in place of naturally occurring bases in nucleic acid and includes, but is not limited to, modified purines and pyrimidines, minor bases, convertible nucleosides, structural analogs of purines and pyrimidines, labeled, derivatized and modified nucleosides and nucleotides, conjugated nucleosides and nucleotides, sequence modifiers, terminus modifiers, spacer modifiers, and nucleotides with backbone modifications, including, but not limited to, ribose-modified nucleotides, phosphoramidates, phosphorothioates, phosphonamidites, methyl phosphonates, methyl phosphoramidites, methyl phosphonamidites, 5′-β-cyanoethyl phosphoramidites, methylenephosphonates, phosphorodithioates, peptide nucleic acids, achiral and neutral internucleotidic linkages.

In some embodiments are provided a kit that includes a set of probes provided wherein the set of probes specifically hybridize with polynucleotides encoding EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, ERRBB4, MET, RET, FGFR1, FGFR2, FGFR3, DDR2, NRAS, PTEN, MAP2K1, TP53, STK11, CTNNB1, SMAD4, FBXW7, NOTCH 1, KIT/PGDFRA, PIK3CA, AKT1, and HRAS or muteins thereof. In some embodiments are provided a kit that includes a set of probes provided wherein the set of probes specifically hybridize with polynucleotides encoding AKT1, ALK, BRAF, ERBB2, EGFR, FGFR1, HRAS, KIT, KRAS, MET, PIK3CA, RET and ROS or muteins thereof. In other embodiments, the kit includes a set of probes that specifically hybridize with polynucleotides encoding the genes, or muteins thereof, in Tables 13-17 and 19.

As used herein, “cleavage step” and its derivatives, generally refers to any process by which a cleavable group is cleaved or otherwise removed from a target-specific primer, an amplified sequence, an adapter or a nucleic acid molecule of the sample. In some embodiments, the cleavage step can involves a chemical, thermal, photo-oxidative or digestive process.

“Hybridize” or “hybridization” refers to the binding between nucleic acids. The conditions for hybridization can be varied according to the sequence homology of the nucleic acids to be bound. Thus, if the sequence homology between the subject nucleic acids is high, stringent conditions are used. If the sequence homology is low, mild conditions are used. When the hybridization conditions are stringent, the hybridization specificity increases, and this increase of the hybridization specificity leads to a decrease in the yield of non-specific hybridization products. However, under mild hybridization conditions, the hybridization specificity decreases, and this decrease in the hybridization specificity leads to an increase in the yield of non-specific hybridization products.

“Stringent conditions” refers to conditions under which a probe will hybridize to its target subsequence, typically in a complex mixture of nucleic acids, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Probes, “Overview of principles of hybridization and the strategy of nucleic acid assays” (1993). Generally, stringent conditions are selected to be about 5-10° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times background, preferably 10 times background hybridization. Exemplary stringent hybridization conditions can be as following: 50% formamide, 5×SSC, and 1% SDS, incubating at 42° C., or, 5×SSC, 1% SDS, incubating at 65° C., with wash in 0.2×SSC, and 0.1% SDS at 65° C.

Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides which they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. In such cases, the nucleic acids typically hybridize under moderately stringent hybridization conditions. Exemplary “moderately stringent hybridization conditions” include a hybridization in a buffer of 40% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 1×SSC at 45° C. A positive hybridization is at least twice background. Those of ordinary skill will readily recognize that alternative hybridization and wash conditions can be utilized to provide conditions of similar stringency. Additional guidelines for determining hybridization parameters are provided in numerous reference, e.g., and Current Protocols in Molecular Biology, ed.

Hybridization between nucleic acids can occur between a DNA molecule and a DNA molecule, hybridization between a DNA molecule and a RNA molecule, and hybridization between a RNA molecule and a RNA molecule.

“AKT1” or “AKT” refers to human v-akt murine thymoma viral oncogene homolog 1, transcript variant 1; a polynucleotide encoding a RAC-alpha serine/threonine-protein kinase and appears as GenBank accession NM_005163.2, as updated on 30 Apr. 2011.

“ALK” refers to anaplastic lymphoma receptor tyrosine kinase, also known as anaplastic lymphoma kinase, is a gene that encodes a receptor tyrosine kinase, which belongs to the insulin receptor superfamily. This gene has been found to be rearranged, mutated, or amplified in a series of tumors including anaplastic large cell lymphomas, neuroblastoma, and non-small cell lung cancer. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumorigenesis, including ALK (chromosome 2)/EML4 (chromosome 2), ALK/RANBP2 (chromosome 2), ALK/ATIC (chromosome 2), ALK/TFG (chromosome 3), ALK/NPM1 (chromosome 5), ALK/SQSTM1 (chromosome 5), ALK/KIF5B (chromosome 10), ALK/CLTC (chromosome 17), ALK/TPM4 (chromosome 19), and ALK/MSN (chromosome X). The translocation of ALK and EML4 results in a fusion protein. One polynucleotide encoding the fusion protein appears as GenBank accession AB274722.1, as updated on 11 Jan. 2008. Soda et al. “Identification of the transforming EML4-ALK fusion gene in non-small-cell lung cancer” (2007) Nature 448(7153):561-566. “EML” refers to “echinoderm microtubule associated protein like 4.”

“BRAF” refers to the proto-oncogene B-Raf and v-Raf, also referred to as serine/threonine-protein kinase B-Raf; a polynucleotide encoding a serine/threonine protein kinase and appears as GenBank accession NM_004333.4, as updated on 24 Apr. 2011. Variants of BRAF include polynucleotides encoding amino acid substitutions at amino acid positions 594 and 600. By “amino acid substitution” or “amino acid substitutions” is meant the replacement of an amino acid at a particular position in a parent polypeptide sequence with another amino acid. For example, the substitution D594H refers to a variant polypeptide, in which the aspartic acid at position 594 is replaced with histidine. Other variant polypeptides of BRAF include D594N and V600E.

“EGFR” or “Epidermal growth factor receptor” or “EGFR” refers to a tyrosine kinase cell surface receptor and is encoded by one of four alternative transcripts appearing as GenBank accession NM_005228.3, NM 201282.1, NM_201283.1 and NM_201284.1. Variants of EGFR include a deletion in exon 19, an insertion in exon 20, and amino acid substitutions T790M and L858R.

“ERBB2” also referred to as v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, is a member of the EGFR/ErbB family and appears as GenBank accession NM_004448.2, as updated on 1 May 2011. Variants of ERBB2 include an insertion in Exon 20.

“FGFR1” or “fibroblast growth factor receptor 1” is also referred to as fms-related tyrosine kinase-2 and CD331. The nine alternative transcripts encoding FGFR1 protein appear as GenBank accession NM_023110.2, NM_001174063.1, NM_001174064.1, NM_001174065.1, NM_001174066.1, NM_001174067.1, NM_015850.3, NM_023105.2 and NM_023106.2 all as updated as on 30 Apr. 2011.

“HRAS” or “Harvey rat sarcoma viral oncogene homolog” is encoded by a polynucleotide appearing as GenBank accession NM_005343.2, as updated 17 Apr. 2011. Variants of HRAS include the amino acid substitutions Q61L and Q61R.

“KRAS” or “Kirsten rat sarcoma viral oncogene homolog” is encoded by two alternative transcripts appearing as GenBank accession NM_004985.3 and NM_033360.2. Variants of KRAS include the amino acid substitutions G12A/C/D/F/R/V.

“MET” or “MNNG HOS transforming gene” encodes a protein referred to as hepatocyte growth factor receptor and is encoded by a polynucleotide appearing as GenBank accession NM_000245.2 and NM_001127500.1.

“PIK3CA” or “phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha” is encoded by a polynucleotide appearing as NM_006218.2, as updated on 1 May 2011. Variants of PIK3CA include the amino acid substitutions E545A/G/K and H1047L/R.

“RET” or “rearranged during transfection” encodes a receptor tyrosine kinase. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumorigenesis, including kinesin family member 5B (“KIF5B”)/RET, coiled-coil domain containing 6 (“CCDC6”)/RET and nuclear receptor coactivator 4 (“NCOA4”)/RET. A representative of the polynucleotide encoded by RET appears as NM_020630.4.

“ROS1” or “c-Ros receptor tyrosine kinase” belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. A representative of the polynucleotide encoded by ROS1 appears as NM_002944.2, as last updated on 28 Jan. 2013.

“KIT/PDGFRA” refers to two genes. “KIT,” also referred to as “proto-oncogene c-Kit” or “tyrosine-protein kinase Kit” encodes a cytokine receptor. A representative of the polynucleotide encoded by PDGFA appears as NM_000222.2. “PDGFA” is the gene encoding “alpha-type platelet-derived growth factor receptor.” A representative of the polynucleotide encoded by PDGFA appears as NM_006206.4.

A “mutein” or “variant” refers to a polynucleotide or polypeptide that differs relative to a wild-type or the most prevalent form in a population of individuals by the exchange, deletion, or insertion of one or more nucleotides or amino acids, respectively. The number of nucleotides or amino acids exchanged, deleted, or inserted can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more such as 25, 30, 35, 40, 45 or 50. The term mutein can also encompass a translocation, for example the fusion of genes encoding the polypeptides EML4 and ALK. In some embodiments there is provided a kit encompassing a set of probes provided wherein the set of probes specifically hybridize with polynucleotides encoding AKT1, ALK, BRAF, ERBB2, EGFR, FGFR1, HRAS, KIT, KRAS, MET, PIK3CA, RET and ROS or muteins thereof, wherein the set of probes distinguish between the muteins and the muteins include one or more of the polynucleotides encoding AKT1 (E17K), BRAF (L597R, D594H/N, V600E), EGFR (L858R, G719X, T790M), HRAS (Q61L/K/R, G12C/D), KRAS G12A/C/D/F/R/V) and PIK3CA (E545A/G/K, H1047L/R).

“Driver event” or “driver alteration” refers to a mutation or genetic variation that confers a growth and/or survival advantage on the cells carrying them.

“Copy number” or “copy number variation” refers to alterations of the DNA of a genome that result in a cell having an abnormal number of copies of one or more sections of DNA. Copy number variations correspond to relatively large regions of the genome that have been deleted (copy number loss) or duplicated (copy number gain) on certain chromosomes.

“Single nucleotide polymorphism” or “SNP” refers to a DNA sequence variation that occurs when a single nucleotide (A, T, G, or C) in the genome differs between members of a biological species or paired chromosomes in a human.

In other embodiments, the two or more probes are primer pairs.

A “primer” or “primer sequence” refers to an oligonucleotide that hybridizes to a target nucleic acid sequence (for example, a DNA template to be amplified) to prime a nucleic acid synthesis reaction. The primer may be a DNA oligonucleotide, a RNA oligonucleotide, or a chimeric sequence. The primer may contain natural, synthetic, or modified nucleotides. Both the upper and lower limits of the length of the primer are empirically determined. The lower limit on primer length is the minimum length that is required to form a stable duplex upon hybridization with the target nucleic acid under nucleic acid amplification reaction conditions. Very short primers (usually less than 3-4 nucleotides long) do not form thermodynamically stable duplexes with target nucleic acid under such hybridization conditions. The upper limit is often determined by the possibility of having a duplex formation in a region other than the pre-determined nucleic acid sequence in the target nucleic acid. Generally, suitable primer lengths are in the range of about 10 to about 40 nucleotides long. In certain embodiments, for example, a primer can be 10-40, 15-30, or 10-20 nucleotides long. A primer is capable of acting as a point of initiation of synthesis on a polynucleotide sequence when placed under appropriate conditions.

The primer will be completely or substantially complementary to a region of the target polynucleotide sequence to be copied. Therefore, under conditions conducive to hybridization, the primer will anneal to the complementary region of the target sequence. Upon addition of suitable reactants, including, but not limited to, a polymerase, nucleotide triphosphates, etc., the primer is extended by the polymerizing agent to form a copy of the target sequence. The primer may be single-stranded or alternatively may be partially double-stranded.

In some embodiments there is provided a kit encompassing at least 4 primer pairs and 4 detectably labeled probes, wherein the at least 4 primer pairs and the at least 4 detectably labeled probes are not any one of the four primer pairs. In these non-limiting embodiments, the 4 primer pairs and 4 detectably labeled probes form 4 amplification detection assays.

“Detection,” “detectable” and grammatical equivalents thereof refers to ways of determining the presence and/or quantity and/or identity of a target nucleic acid sequence. In some embodiments, detection occurs amplifying the target nucleic acid sequence. In other embodiments, sequencing of the target nucleic acid can be characterized as “detecting” the target nucleic acid. A label attached to the probe can include any of a variety of different labels known in the art that can be detected by, for example, chemical or physical means. Labels that can be attached to probes may include, for example, fluorescent and luminescence materials.

“Amplifying,” “amplification,” and grammatical equivalents thereof refers to any method by which at least a part of a target nucleic acid sequence is reproduced in a template-dependent manner, including without limitation, a broad range of techniques for amplifying nucleic acid sequences, either linearly or exponentially. Exemplary means for performing an amplifying step include ligase chain reaction (LCR), ligase detection reaction (LDR), ligation followed by Q-replicase amplification, PCR, primer extension, strand displacement amplification (SDA), hyperbranched strand displacement amplification, multiple displacement amplification (MDA), nucleic acid strand-based amplification (NASBA), two-step multiplexed amplifications, rolling circle amplification (RCA), recombinase-polymerase amplification (RPA)(TwistDx, Cambridg, UK), and self-sustained sequence replication (3SR), including multiplex versions or combinations thereof, for example but not limited to, OLA/PCR, PCR/OLA, LDR/PCR, PCR/PCR/LDR, PCR/LDR, LCR/PCR, PCR/LCR (also known as combined chain reaction—CCR), and the like. Descriptions of such techniques can be found in, among other places, Sambrook et al. Molecular Cloning, 3rd Edition; Ausbel et al.; PCR Primer: A Laboratory Manual, Diffenbach, Ed., Cold Spring Harbor Press (1995); The Electronic Protocol Book, Chang Bioscience (2002), Msuih et al., J Clin. Micro. 34:501-07 (1996); The Nucleic Acid Protocols Handbook, R. Rapley, ed., Humana Press, Totowa, N.J. (2002).

In some embodiments, one or more of the compositions, methods, kits and systems disclosed herein can include at least one target-specific primer and/or at least one adapter (see U.S. 2012/0295819, incorporated herein in its entirety by reference). In some embodiments, the compositions include a plurality of target-specific primers or adapters that are about 15 to about 40 nucleotides in length. In some embodiments, the compositions include one or more target-specific primers or adapters that include one or more cleavable groups. In some embodiments, one or more types of cleavable groups can be incorporated into a target-specific primer or adapter. In some embodiments, a cleavable group can be located at, or near, the 3′ end of a target-specific primer or adapter. In some embodiments, a cleavable group can be located at a terminal nucleotide, a penultimate nucleotide, or any location that corresponds to less than 50% of the nucleotide length of the target-specific primer or adapter. In some embodiments, a cleavable group can be incorporated at, or near, the nucleotide that is central to the target-specific primer or the adapter. For example, a target specific primer of 40 bases can include a cleavage group at nucleotide positions 15-25. Accordingly, a target-specific primer or an adapter can include a plurality of cleavable groups within its 3′ end, its 5′ end or at a central location. In some embodiments, the 5′ end of a target-specific primer includes only non-cleavable nucleotides. In some embodiments, the cleavable group can include a modified nucleobase or modified nucleotide. In some embodiments, the cleavable group can include a nucleotide or nucleobase that is not naturally occurring in the corresponding nucleic acid. For example, a DNA nucleic acid can include a RNA nucleotide or nucleobase. In one example, a DNA based nucleic acid can include uracil or uridine. In another example, a DNA based nucleic acid can include inosine. In some embodiments, the cleavable group can include a moiety that can be cleaved from the target-specific primer or adapter by enzymatic, chemical or thermal means. In some embodiments, a uracil or uridine moiety can be cleaved from a target-specific primer or adapter using a uracil DNA glycosylase. In some embodiments, a inosine moiety can be cleaved from a target-specific primer or adapter using hAAG or EndoV.

In some embodiments, a target-specific primer, adapter, amplified target sequence or nucleic acid molecule can include one or more cleavable moieties, also referred to herein as cleavable groups. Optionally, the methods can further include cleaving at least one cleavable group of the target-specific primer, adapter, amplified target sequence or nucleic acid molecule. The cleaving can be performed before or after any of the other steps of the disclosed methods. In some embodiments, the cleavage step occurs after the amplifying and prior to the ligating. In one embodiment, the cleaving includes cleaving at least one amplified target sequence prior to the ligating. The cleavable moiety can be present in a modified nucleotide, nucleoside or nucleobase. In some embodiments, the cleavable moiety can include a nucleobase not naturally occurring in the target sequence of interest. In some embodiments, uracil or uridine can be incorporated into a DNA-based nucleic acid as a cleavable group. In one exemplary embodiment, a uracil DNA glycosylase can be used to cleave the cleavable group from the nucleic acid. In another embodiment, inosine can be incorporated into a DNA-based nucleic acid as a cleavable group. In one exemplary embodiment, EndoV can be used to cleave near the inosine residue and a further enzyme such as Klenow can be used to create blunt-ended fragments capable of blunt-ended ligation. In another exemplary embodiment, the enzyme hAAG can be used to cleave inosine residues from a nucleic acid creating abasic sites that can be further processed by one or more enzymes such as Klenow to create blunt-ended fragments capable of blunt-ended ligation.

In some embodiments, one or more cleavable groups can be present in a target-specific primer or adapter. In some embodiments, cleavage of one or more cleavable groups in a target-specific primer or an adapter can generate a plurality of nucleic acid fragments with differing melting temperatures. In one embodiment, the placement of one or more cleavable groups in a target-specific primer or adapter can be regulated or manipulated by determining a comparable maximal minimum melting temperature for each nucleic acid fragment, after cleavage of the cleavable group. In some embodiments the cleavable group can be a uracil or uridine moiety. In some embodiments the cleavable group can be an inosine moiety. In some embodiments, at least 50% of the target-specific primers can include at least one cleavable group. In some embodiments, each target-specific primer includes at least one cleavable group.

In one embodiment, a multiplex nucleic acid amplification is performed that includes a) amplifying one or more target sequences using one or more target-specific primers in the presence of polymerase to produce an amplified target sequence, and b) ligating an adapter to the amplified target sequence to form an adapter-ligated amplified target sequence. In some embodiments, amplifying can be performed in solution such that an amplified target sequence or a target-specific primer is not linked to a solid support or surface. In some embodiments, ligating can be performed in solution such that an amplified target sequence or an adapter is not linked to a solid support or surface. In another embodiment, amplifying and ligating can be performed in solution such that an amplified target sequence, a target-specific primer or an adapter is not linked to a solid support or surface.

In some embodiments, the target-specific primer pairs do not contain a common extension (tail) at the 3′ or 5′ end of the primer. In another embodiment, the target-specific primers do not contain a Tag or universal sequence. In some embodiments, the target-specific primer pairs are designed to eliminate or reduce interactions that promote the formation of non-specific amplification.

In one embodiment, the target-specific primer pairs comprise at least one cleavable group per forward and reverse target-specific primer. In one embodiment, the cleavable group can be a uracil nucleotide. In one embodiment, the target-specific primer pairs are partially or substantially removed after generation of the amplified target sequence. In one embodiment, the removal can include enzymatic, heat or alkali treatment of the target-specific primer pairs as part of the amplified target sequence. In some embodiments, the amplified target sequences are further treated to form blunt-ended amplification products, referred to herein as, blunt-ended amplified target sequences.

According to various embodiments, there are provided methods for designing primers using a design pipeline that allows design of oligonucleotide primers across genomic areas of interest while incorporating various design criteria and considerations including amplicon size, primer composition, potential off-target hybridization, and SNP overlap of the primers. In an embodiment, the design pipeline includes several functional modules that may be sequentially executed as discussed next.

First, in an embodiment, a sequence retrieval module may be configured to retrieve sequences based on instructions of an operator regarding a final product desired by a customer. The operator may request a design of primer pairs for genomic regions which may be specified by chromosome and genome coordinates or by a gene symbol designator. In the latter case, the sequence retrieval module may retrieve the sequence based on the exon coordinates. The operator may also specify whether to include a 5′ UTR sequence (untranslated sequence).

Second, in an embodiment, an assay design module may be configured to design primer pairs using a design engine, which may be a public tool such as Primer3 or another primer design software that can generate primer pairs across the entire sequence regions retrieved by the sequence retrieval module, for example. The primers pairs may be selected to tile densely across the nucleotide sequence. The primer design may be based on various parameters, including: (1) the melting temperature of the primer (which may be calculated using the nearest neighbor algorithm set forth in John SantaLucia, Jr., “A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics,” Proc. Natl. Acad. Sci. USA, vol. 95, 1460-1465 (1998), the contents of which is incorporated by reference herein in its entirety), (2) the primer composition (e.g., nucleotide composition such as GC content may be determined and filtered and penalized by the software, as may be primer hairpin formation, composition of the GC content in the 3′ end of primer, and specific parameters that may be evaluated are stretches of homopolymeric nucleotides, hairpin formation, GC content, and amplicon size), (3) scores of forward primer, reverse primer and amplicon (the scores may be added up to obtain a probe set score, and the score may reflect how close the amplicon confirms with the intended parameters), and (4) conversion of some of the T's to U's (T's may be placed such that the predicted Tm of the T delimited fragments of a primer have a minimum average Tm.)

Third, in an embodiment, a primer mapping module may be configured to use a mapping software (e.g., e-PCR (NCBI), see Rotmistrovsky et al., “A web server for performing electronic PCR,” Nucleic Acids Research, vol. 32, W108-W112 (2004), and Schuler, “Sequence Mapping by Electronic PCR,” Genome Research, vol. 7, 541-550 (1997), which are both incorporated by reference herein in their entirety, or other similar software) to map primers to a genome. The primers mapping may be scored using a mismatch matrix. In an embodiment, a perfect match may receive a score of 0, and mismatched primers may receive a score of greater than 0. The mismatch matrix takes the position of the mismatch and the nature of the mismatch into account. For example, the mismatch matrix may assign a mismatch score to every combination of a particular motif (e.g., AA, AC, AG, CA, CC, CT, GA, GG, GT, TC, TG, TT, A-, C-, G-, T-, -A, -C, -G, and -T, where ‘-’ denotes an ambiguous base or gap) with a particular position (e.g., base at 3′ end, second base from 3′ end, third base from 3′ end, third base from 5′ end, second base from 5′ end, base at 5′ end, and positions therebetween), which may be derived empirically and may be selected to reflect that mismatches closer to the 3′end tend to weaker PCR reactions more than mismatches closer to the 5′ end and may therefore be generally larger. The mismatch scores for motifs with an ambiguous base or gap may be assigned an average of scores of other motifs consistent therewith (e.g., A- may be assigned an average of the scores of AA, AC, and AG). Based on the number of hits with a certain score threshold, an amplicon cost may be calculated.

Fourth, in an embodiment, a SNP module may be configured to determine underlying SNPs and repeat regions: SNPs may be mapped to the primers and based on the distance of a SNP from the 3′ end, primers may be filtered as potential candidates. Similarly, if a primer overlaps to a certain percentage with a repeat region, the primer might be filtered.

Fifth, in an embodiment, a tiler module may be configured to use a function based on the amplicon cost (see primer mapping) and the number of primers necessary to select a set of primers covering the target while ensuring that selection of tiling primers for a target is independent of other targets that may be in a customer's request so that the same set of primers for a target will be selected whether the customer requested only that target or additional targets and whether amplicons are to help cover on that target or additional targets.

Sixth, in an embodiment, a pooler module may be configured to use a pooling algorithm that prevents amplicon overlaps, and ensures that the average number of primers in a pool does not deviate by more than a preset value.

According to an exemplary embodiment, there is provided a method, comprising: (1) receiving one or more genomic regions or sequences of interest; (2) determining one or more target sequences for the received one or more genomic regions or sequences of interest; (3) providing one or more primer pairs for each of the determined one or more target sequences; (4) scoring the one or more primer pairs, wherein the scoring comprises a penalty based on the performance of in silico PCR for the one or more primer pairs, and wherein the scoring further comprises an analysis of SNP overlap for the one or more primer pairs; and (5) filtering the one or more primer pairs based on a plurality of factors, including at least the penalty and the analysis of SNP overlap, to identify a filtered set of primer pairs corresponding to one or more candidate amplicon sequences for the one or more genomic regions or sequences of interest.

The amount of nucleic acid material required for successful multiplex amplification can be about 1 ng. In some embodiments, the amount of nucleic acid material can be about 10 ng to about 50 ng, about 10 ng to about 100 ng, or about 1 ng to about 200 ng of nucleic acid material. Higher amounts of input material can be used, however one aspect of the disclosure is to selectively amplify a plurality of target sequence from a low (ng) about of starting material.

Analysis of nucleic acid markers can be performed using techniques known in the art including, without limitation, sequence analysis, and electrophoretic analysis. Non-limiting examples of sequence analysis include Maxam-Gilbert sequencing, Sanger sequencing, capillary array DNA sequencing, thermal cycle sequencing (Sears et al., Biotechniques, 13:626-633 (1992)), solid-phase sequencing (Zimmerman et al., Methods Mol. Cell Biol., 3:39-42 (1992)), sequencing with mass spectrometry such as matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF/MS; Fu et al., Nat. Biotechnol., 16:381-384 (1998)), and sequencing by hybridization. Chee et al., Science, 274:610-614 (1996); Drmanac et al., Science, 260:1649-1652 (1993); Drmanac et al., Nat. Biotechnol., 16:54-58 (1998). Non-limiting examples of electrophoretic analysis include slab gel electrophoresis such as agarose or polyacrylamide gel electrophoresis, capillary electrophoresis, and denaturing gradient gel electrophoresis. Additionally, next generation sequencing methods can be performed using commercially available kits and instruments from companies such as the Life Technologies/Ion Torrent PGM or Proton, the Illumina HiSEQ or MiSEQ, and the Roche/454 next generation sequencing system.

In some embodiments, the amount of probe that gives a fluorescent signal in response to an excited light typically relates to the amount of nucleic acid produced in the amplification reaction. Thus, in some embodiments, the amount of fluorescent signal is related to the amount of product created in the amplification reaction. In such embodiments, one can therefore measure the amount of amplification product by measuring the intensity of the fluorescent signal from the fluorescent indicator.

“Detectably labeled probe” refers to a molecule used in an amplification reaction, typically for quantitative or real-time PCR analysis, as well as end-point analysis. Such detector probes can be used to monitor the amplification of the target nucleic acid sequence. In some embodiments, detector probes present in an amplification reaction are suitable for monitoring the amount of amplicon(s) produced as a function of time. Such detector probes include, but are not limited to, the 5′-exonuclease assay (TAQMAN® probes described herein (see also U.S. Pat. No. 5,538,848) various stem-loop molecular beacons (see for example, U.S. Pat. Nos. 6,103,476 and 5,925,517 and Tyagi and Kramer, 1996, Nature Biotechnology 14:303-308), stemless or linear beacons (see, e.g., WO 99/21881), PNA Molecular Beacons™ (see, e.g., U.S. Pat. Nos. 6,355,421 and 6,593,091), linear PNA beacons (see, for example, Kubista et al., 2001, SPIE 4264:53-58), non-FRET probes (see, for example, U.S. Pat. No. 6,150,097), Sunrise®/Amplifluor™ probes (U.S. Pat. No. 6,548,250), stem-loop and duplex Scorpion probes (Solinas et al., 2001, Nucleic Acids Research 29:E96 and U.S. Pat. No. 6,589,743), bulge loop probes (U.S. Pat. No. 6,590,091), pseudo knot probes (U.S. Pat. No. 6,589,250), cyclicons (U.S. Pat. No. 6,383,752), MGB Eclipse™ probe (Epoch Biosciences), hairpin probes (U.S. Pat. No. 6,596,490), peptide nucleic acid (PNA) light-up probes, self-assembled nanoparticle probes, and ferrocene-modified probes described, for example, in U.S. Pat. No. 6,485,901; Mhlanga et al., 2001, Methods 25:463-471; Whitcombe et al., 1999, Nature Biotechnology. 17:804-807; Isacsson et al., 2000, Molecular Cell Probes. 14:321-328; Svanvik et al., 2000, Anal Biochem. 281:26-35; Wolffs et al., 2001, Biotechniques 766:769-771; Tsourkas et al., 2002, Nucleic Acids Research. 30:4208-4215; Riccelli et al., 2002, Nucleic Acids Research 30:4088-4093; Zhang et al., 2002 Shanghai. 34:329-332; Maxwell et al., 2002, J. Am. Chem. Soc. 124:9606-9612; Broude et al., 2002, Trends Biotechnol. 20:249-56; Huang et al., 2002, Chem. Res. Toxicol. 15:118-126; and Yu et al., 2001, J. Am. Chem. Soc 14:11155-11161.

Detector probes can also include quenchers, including without limitation black hole quenchers (Biosearch), Iowa Black (IDT), QSY quencher (Molecular Probes), and Dabsyl and Dabcel sulfonate/carboxylate Quenchers (Epoch).

Detector probes can also include two probes, wherein for example a fluor is on one probe, and a quencher is on the other probe, wherein hybridization of the two probes together on a target quenches the signal, or wherein hybridization on the target alters the signal signature via a change in fluorescence. Detector probes can also comprise sulfonate derivatives of fluorescenin dyes with SO3 instead of the carboxylate group, phosphoramidite forms of fluorescein, phosphoramidite forms of CY 5 (commercially available for example from Amersham). In some embodiments, interchelating labels are used such as ethidium bromide, SYBR® Green I (Molecular Probes), and PicoGreen® (Molecular Probes), thereby allowing visualization in real-time, or end point, of an amplification product in the absence of a detector probe. In some embodiments, real-time visualization can comprise both an intercalating detector probe and a sequence-based detector probe can be employed. In some embodiments, the detector probe is at least partially quenched when not hybridized to a complementary sequence in the amplification reaction, and is at least partially unquenched when hybridized to a complementary sequence in the amplification reaction. In some embodiments, the detector probes of the present teachings have a Tm of 63-69° C., though it will be appreciated that guided by the present teachings routine experimentation can result in detector probes with other Tins. In some embodiments, probes can further comprise various modifications such as a minor groove binder (see for example U.S. Pat. No. 6,486,308) to further provide desirable thermodynamic characteristics.

In some embodiments, detection can occur through any of a variety of mobility dependent analytical techniques based on differential rates of migration between different analyte species. Exemplary mobility-dependent analysis techniques include electrophoresis, chromatography, mass spectroscopy, sedimentation, for example, gradient centrifugation, field-flow fractionation, multi-stage extraction techniques, and the like. In some embodiments, mobility probes can be hybridized to amplification products, and the identity of the target nucleic acid sequence determined via a mobility dependent analysis technique of the eluted mobility probes, as described for example in Published P.C.T. Application WO04/46344 to Rosenblum et al., and WO01/92579 to Wenz et al. In some embodiments, detection can be achieved by various microarrays and related software such as the Applied Biosystems Array System with the Applied Biosystems 1700 Chemiluminescent Microarray Analyzer and other commercially available array systems available from Affymetrix, Agilent, IIlumina, and Amersham Biosciences, among others (see also Gerry et al., J. Mol. Biol. 292:251-62, 1999; De Bellis et al., Minerva Biotec 14:247-52, 2002; and Stears et al., Nat. Med. 9:14045, including supplements, 2003). It will also be appreciated that detection can comprise reporter groups that are incorporated into the reaction products, either as part of labeled primers or due to the incorporation of labeled dNTPs during an amplification, or attached to reaction products, for example but not limited to, via hybridization tag complements comprising reporter groups or via linker arms that are integral or attached to reaction products. Detection of unlabeled reaction products, for example using mass spectrometry, is also within the scope of the current teachings.

The kits of the present invention may also comprise instructions for performing one or more methods described herein and/or a description of one or more compositions or reagents described herein. Instructions and/or descriptions may be in printed form and may be included in a kit insert. A kit also may include a written description of an Internet location that provides such instructions or descriptions.

In some embodiments is provided a composition comprising a set of probes and a sample, wherein the set of probes specifically recognize the genes AKT1, ALK, BRAF, ERBB2, EGFR, FGFR1, HRAS, KIT, KRAS, MET, PIK3CA, RET and ROS, and wherein the set of probes can recognize and distinguish one or more allelic variants of the genes AKT1, ALK, BRAF, ERBB2, EGFR, HRAS, KRAS, MET, PIK3CA, RET and ROS.

In yet other embodiments, compositions, kits, methods and workflows disclosed herein comprise a set of probes that specifically recognize one or more genes and/or variants thereof, in Tables 13-17 and 19.

Any combination of the disclosed genes and variants can be included in the kits and compositions. For instance, the genes and variants can be selected from a combination of actionability index (AI) categories and variant prevalence, as described in more detail herein. In this regard, in varying embodiments of the disclosed compositions and kits, the gene variants can be selected from an actionability index A, A2, A3, A4, or A5. In other embodiments, gene variants can be selected from an actionability index and percentage prevalence selected from AI1+Prevalence>1%, AI2+Prevalence>1%, AI3+Prevalence>1%, AI1+Prevalence 0.1%-1%, AI2+Prevalence 0.1%-1%, AI3+Prevalence 0.1%-1%, and combinations thereof.

In certain embodiments, methods to determine an actionable treatment recommendation for a subject diagnosed with cancer are provided. Other embodiments include methods to determine the likelihood of a response to a treatment in a subject afflicted with cancer and methods for treating a patient with cancer (e.g., lung cancer).

In one embodiment of the methods, the cancer is lung cancer and the sub type is lung adenocarcinoma. In certain embodiments, the lung cancer subtype is squamous cell lung carcinoma.

The methods comprise the steps of obtaining a sample from a patient, detecting at least one variant in a gene of interest, and determining an A1 or treatment for the patient based on the gene variant detected.

The patient sample can be any bodily tissue or fluid that includes nucleic acids from the lung cancer in the subject. In certain embodiments, the sample will be a blood sample comprising circulating tumor cells or cell free DNA. In other embodiments, the sample can be a tissue, such as a lung tissue. The lung tissue can be from a tumor tissue and may be fresh frozen or formalin-fixed, paraffin-embedded (FFPE). In certain embodiments, a lung tumor FFPE sample is obtained.

Five categories of AIs are provided herein. AI1 represents a category for which there is clinical consensus on a treatment recommendation based on the genetic variant status. The data source for AI1 is the National Comprehensive Cancer Network Practice Guidelines in Oncology (NCCN Guidelines) for non-small cell lung cancer (NSCLC) (Version 2.2013). This index is assigned if the NCCN Guidelines specifically recommends a therapy based on gene and variant type.

AI2 represents a category for which there exists a clinical trial or clinical case report evidence for treatment response in patients based on genetic variant status.

AI3 is a category in which one or more clinical trials are in progress in which genetic variant status is used as an enrollment criteria, that is particular genes and variants are required as part of the clinical trial enrollment criteria (for inclusion or exclusion).

AI4 is a category for which there is preclinical evidence for treatment response based on genetic variant status. The index contains genes and events reported to show an association with preclinical treatment response.

AI5 is a category in which a targeted therapy is available for the gene that is aberrant. This index is based on the requirement for a gene and associated variant in order for the therapy to be considered actionable.

In certain embodiments, lung cancer variants are prioritized based on prevalence of greater than 0.1%. Prevalence was determined from references datasets of lung cancer by counting all of the clinical specimens tested that were found to contain one of the gene variants described in this invention, and expressing that value as a percentage relative to all of the clinical specimens tested. For example, the prevalence of 0.1% to 1% and prevalence of greater than 1% of gene variants in adenocarcinoma and squamous cell carcinoma are shown herein (see Tables 1 and 3), however any subset of the percentage range, or below or above the percentage range, can be used to represent additional genetic variants associated with an A1. The variants include but are not limited to SNPs, insertions, deletions, translocations, and copy number variation (e.g., gain or loss).

TABLE 1
Lung Adenocarcinoma
Actionabil-
ity Index Prevalence >1% Prevalence 0.1%-1%
AI1 EGFR (L858R, Exon 19 EGFR (G719X)
del, T790M, exon 20 ins) KRAS (G12S, G13C,
ALK translocation/fusion G13D, G12R, G12F)
(EML4-ALK)
ROS1 (EZR-ROS1,
SLC34A2-ROS1, CD74-
ROS1, SDC4-ROS1)
KRAS (G12C, G12V, G12D,
G12A)
AI2 BRAF (V600E) PIK3CA (E545K, E545G,
ERBB2 (Exon 20 ins) E545A, H1047R, H1047L)
MET CN gain
AI3 RET translocation AKT1 (E17K)
EGFR CN gain BRAF (L597R, D594H/N)
ERBB2 CN gain HRAS (Q61L/K/R,
FGFR1 CN gain G12C/D, G13C/S/R/V)
KIT/PDGFRA amplification PIK3CA (E542K)

As shown in Table 1, the genetic variants disclosed herein and associated AIs, provide treatment options for over 50% of all primary lung adenocarcinomas. This type of comprehensive screening of lung cancer gene variants and treatment recommendations for over 50% of the lung adenocarcinoma patient population has been heretofore unavailable. The disclosure provides a method of gene variant determination that can be performed in a single assay or panel, which allows greater variant detection using the precious little sample obtained from a typical lung tumor biopsy or surgical resection. It should be understood that the genes and variants identified herein are non-limiting examples and genes and variants can be readily added or removed identify valuable patient variants and treatment options. Further, any combination of A1 and prevalence can be detected in the methods provided herein. For example, in one embodiment, all A1 categories and variants can be determined. In another embodiment, AI1+Prevalence>1%, AI2+Prevalence>1%, AI3+Prevalence>1%, AI1+Prevalence 0.1%-1%, AI2+Prevalence 0.1%-1%, AI3+Prevalence 0.1%-1% and any combination thereof can be determined in the methods disclosed herein.

The disclosure provides treatment options for numerous subsets of the adenocarcinoma and squamous cell carcinoma population depending on the combination of the percentage prevalence of the markers chosen and the A1 categories. As shown in Tables 4-8, by choosing different combinations of AI+% prevalence, treatment options can be provided for varying percentages of the afflicted population (See Example II).

The disclosure further provides actionable treatment recommendations for a subject with lung cancer based on the subject's tumor's genetic variant status. The actionable treatment recommendations can include pharmaceutical therapeutics, surgery, photodynamic therapy (PTD), laser therapy, radiation, dietary guidance, clinical trial suggestions, etc. The actionable treatment recommendations provided herein (see Tables 2 and 3) are exemplary. Additional actionable treatment recommendations can be added or removed as additional data, publications, clinical reports, treatments, and clinical trials become available. Further, additional information can be used to provide actionable treatment recommendations, including, but not limited to, age, gender, family history, lifestyle, dietary, as well as other relevant factors.

In certain embodiments, the method comprises performing the actionable treatment recommendation. Accordingly, performing the actionable treatment recommendation can include, without limitation, administering a therapeutically effective amount of one or more therapeutic agents (chemotherapeutics, targeted therapeutics, antiangiogenics, etc), implementing a dietary regimen, administering radiation and/or enrolling in one or more clinical trials.

Examples of chemotherapeutics to treat lung cancer include: Cisplatin or carboplatin, gemcitabine, paclitaxel, docetaxel, etoposide, and/or vinorelbine. Targeted therapeutics (drugs that specifically block the growth and spread of cancer) include monoclonal antibodies such as, but not limited to, bevacizumab (AVASTIN™) and cetuximab; and tyrosine kinase inhibitors (TKIs) such as, but not limited to, gefitinib (IRESSA™), erlotinib (TARCEVA™) crizotinib and/or vemurafenib.

Additional chemotherapeutics to treat lung cancer include, but are not limited to, TKIs: vandetanib, tofacitinib, sunitinib malate, sorafenib, ruxolitinib, regorafenib, ponatinib, pazopanib, nilotinib, leflunomide, lapatinib ditosylate, imatinib mesilate, gefitinib, erlotinib, dasatinib, crizotinib, cabozantinib, bosutinib, axitinib, radotinib, tivozanib, masitinib, afatinib, XL-647, trebananib, tivantinib, SAR-302503, rilotumumab, ramucirumab, plitidepsin, pacritinib, orantinib, nintedanib, neratinib, nelipepimut-S, motesanib diphosphate, midostaurin, linifanib, lenvatinib, ibrutinib, fostamatinib disodium, elpamotide, dovitinib lactate, dacomitinib, cediranib, baricitinib, apatinib, Angiozyme, X-82, WBI-1001, VX-509, varlitinib, TSR-011, tovetumab, telatinib, RG-7853, RAF-265, R-343, R-333, quizartinib dihydrochloride, PR-610, poziotinib, PLX-3397, PF-04554878, Pablocan, NS-018, momelotinib, MK-1775, milciclib maleate, MGCD-265, linsitinib, LDK-378, KX2-391, KD-020, JNJ-40346527, JI-101, INCB-028060, icrucumab, golvatinib, GLPG-0634, gandotinib, foretinib, famitinib, ENMD-2076, danusertib, CT-327, crenolanib, BMS-911543, BMS-777607, BMS-754807, BMS-690514, bafetinib, AZD-8931, AZD-4547, AVX-901, AVL-301, AT-9283, ASP-015K, AP-26113, AL-39324, AKN-028, AE-37, AC-480, 2586184, X-396, volitinib, VM-206, U3-1565, theliatinib, TAS-115, sulfatinib, SB-1317, SAR-125844, S-49076, rebastinib, R84 antibody, Peregrine, R-548, R-348, PRT-062607, P-2745, ONO-4059, NRC-AN-019, LY-2801653, KB-004, JTE-052, JTE-051, IMC-3C5, ilorasertib, IDN-6439, HM-71224, HM-61713, henatinib, GSK-2256098, epitinib, EMD-1214063, E-3810, EOS, CUDC-101, CT-1578, cipatinib, CDX-301, CC-292, BI-853520, BGJ-398, ASP-3026, ARRY-614, ARRY-382, AMG-780, AMG-337, AMG-208, AL-3818, AC-430, 4SC-203, Z-650, X-379, WEE-1/CSN5, Tekmira Pharmaceuticals, Wee-1 kinase inhibitors, Tekmira Pharmaceuticals, VS-4718, VEGFR2 inhibitor, AB Science, VEGF/rGel, Clayton Biotechnologies, VEGF inhibitors, Interprotein, UR-67767, tyrosine kinase inhibitors, Bristol-Myers Squibb, tyrosine kinase inhibitor, Aurigene Discovery Technologies, tyrosine kinase 2 inhibitors, Sareum, TrkA ZFP TF, TrkA inhibitor, Proximagen, TP-0903, TP-0413, TKI, Allergan, Sym-013, syk kinase inhibitors, Almirall, Syk kinase inhibitors, AbbVie, SYK inhibitor programme, Ziarco, SUN-K706, SN-34003, SN-29966, SIM-930, SIM-6802, SIM-010603, SGI-7079, SEL-24-1, SCIB-2, SAR-397769, RET kinase inhibitor, Bionomics, R-256, PRT-062070, PRT-060318, PRS-110, PLX-7486, ORS-1006, ORB-0006, ORB-0004, ORB-0003, ONO-WG-307, ON-044580, NVP-BSK805, NNI-351, NMS-P948, NMS-E628, NMS-173, MT-062, MRLB-11055, MG-516, KX2-361, KIT816 inhibitor, AB Science, janus kinase inhibitor, Celgene, JAK3-inhibitor, Principia BioPharma, Jak1 inhibitor, Genentech, JAK inhibitors, Almirall, INCB-16562, hRl-derivatives, Immunomedics, HMPL-281, HM-018, GTX-186, GSK-143, GS-9973, GFB-204, gastrointestinal stromal tumour therapy, Clovis Oncology, G-801, FX-007, FLT4 kinase inhibitors, Sareum, FLT3/cKit inhibitor, Johnson & Johnson, flt-4 kinase inhibitors, Sareum, flt-3 kinase inhibitors, Sareum, FAK inhibitors, Takeda, FAK inhibitor, Verastem, EN-3351, DNX-04040, DNX-02079, DLX-521, deuterated tofacitinib, Auspex Pharmaceuticals, DCC-2721, DCC-2701, DCC-2618, CTX-0294945, CTx-0294886, CT-340, CT-053, CST-102, CS-510, CPL-407-22, CH-5451098, CG-206481, CG-026828, CFAK-C4, CCT-137690, CC-509, c-Met kinase inhibitors, Rhizen, BXL-1H5, BTK inhibitors, Mannkind, Btk inhibitor, Pharmacyclics-3, Btk inhibitor, Aurigene Discovery Technologies, BGB-324, BGB-001, Bcr-Abl/Lyn inhibitor, AB Science, aurora kinase+FLT3 kinase inhibitor, Sareum, aurora kinase+ALK inhibitor, Sareum, aurora kinase+ALK inhibitor, AstraZeneca, ASP-502D, ASP-08112, ARYY-111, AR-523, anticancer, leukemia, Critical, anticancer therapy, Agios-1, ANG-3070, ALK inhibitors, AstraZeneca, Alk inhibitor, Cephalon-3, ALK inhibitor, Aurigene Discovery Technologies, AL-2846, TrkB modulators, Hermo Pharma, TLK-60596, TLK-60404, CYC-116, ARRY-380, ZD-4190, Yissum Project No. B-1146, XL-999, XL-820, XL-228, VX-667, vatalanib, tyrosine protein kinase inhibs, tyrosine kinase inhibs, Yissum, tyrosine kinase inhibs, CSL, tyrosine kinase antags, ICRT, tozasertib lactate, TG-100-13, tandutinib, TAK-593, TAK-285, Symadex, Syk kinase inhibitor, SGX, SU-5271, SU-14813, SGX-523, semaxanib, saracatinib, RP 53801, RG-14620, RG-13291, RG-13022, R-112, PLX-647, PKI-166, Pharmaprojects No. 6085, Pharmaprojects No. 4960, Pharmaprojects No. 4923, Pharmaprojects No. 4863, Pharmaprojects No. 3624, Pharmaprojects No. 3292, Pharmaprojects No. 3054, PF-562271, PF-4217903, NVP-TAE226, mubritinib, MEDI-547, lestaurtinib, KW-2449, KSB-102, KRN-633, IMC-EB10, GW-282974, Flt3-kinase inhibitor, Lilly, FCE-26806, EphA2 vaccine, MedImmune, EMD-55900, EMD-1204831, desmal, degrasyns, CNF-201 series, CGP-57148, CEP-7055, CEP-5214, CEP-075, CE-245677, CDP-860, canertinib dihydrochloride, cancer vaccine, Ajinomoto, bscEphA2xCD3, MedImmune, brivanib alaninate, breast cancer therapy, Galapago, BIBX-1382, AZD-9935, AZD-6918, AZD-4769, AZD-1480, AVE-0950, Argos, AP-23464, AP-23451, AP-22408, anti-HER2/neu mimetic, Cyclacel, anti-HER-2/neu antisense, Tekm, amuvatinib, AG-490, AG-18, AG-13958, AEG-41174, ZM-254530, ZK-CDK, ZK-261991, ZD-1838, ZAP70 kinase inhibitors, Kinex, ZAP-70 inhibitors, Cellzome, ZAP inhibitors, Ariad, ZAP 70 inhibitors, Galapagos, ZAP 70 inhibitors, Celgene, YW327.6S2, YM-359445, YM-231146, YM-193306, XV-615, XL-019, XC-441, XB-387, Wee-1 kinase inhibitor, Banyu, VX-322, VRT-124894, VEGFR2 kinase inhibitors, Takeda, VEGFR/EGFR inhib, Amphora, VEGFR-2 kinase inhibitors, Hanmi, VEGFR-2 antagonist, Affymax, VEGF/rGel, Targa, VEGF-TK inhibitors, AstraZeneca, VEGF-R inhibitors, Novartis, VEGF modulators, 3-D, VEGF inhibitors, Onconova, VEGF inhibitor, Chugai, V-930, U3-1800, U3-1784, tyrphostins, Yissum, tyrosine kinase inhibs, Novar-2, tyrosine kinase inhibs, Sanofi, tyrosine kinase inhib, Abbott-2, tyrosine kinase inhib, Pfizer, tyrosine kinase inhib, IQB, tyrosine kinase inhib, Abbott, tyrosine kinase inhi, Abbott-3, trkB inhibitors, Amphora, TrkA inhibitors, Telik, TrkA blocker, Pfizer, TLN-232, TKM-0150, Tie-2 kinase inhibitors, GSK, TIE-2 inhibitors, Ontogen, Tie-2 inhibitors, AstraZeneca, Tie-2 inhibitors, Amgen-3, Tie-2 inhibitors, Amgen-2, Tie-2 inhibitors, Amgen, Tie-2 antagonists, Semaia, Tie-1R IFP, Receptor BioLogix, TG-101-223, TG-101-209, TG-100948, TG-100435, TG-100-96, TG-100-801, TG-100-598, TAE-684, T3-106, T-cell kinase inhibitors, Cell, syk kinase inhibitor, Bayer, Syk inhibitors, CrystalGenomics, Syk inhibitors, Astellas-2, Syk inhibitors, Amphora, SU-11657, SU-0879, SSR-106462, SRN-004, Src/Abl inhibitors, Ariad, Src non-RTK antagonists, SUGEN, Src inhibitors, Amphora, spiroindolines, Pfizer, SP-5.2, sorafenib bead, Biocompatibles, SMi-11958, SH2 inhibitors, NIH, SH-268, SGX-393, SGX-126, SGI-1252, SC-102380, SC-101080, SB-238039, SAR-131675, RWJ-64777, RWJ-540973, RPR-127963E, RP-1776, Ro-4383596, RNAi cancer therapy, Benitec Biopharma, RM-6427, rheumatoid arthritis therapy, SRI International, RET inhibitors, Cell T, RB-200h, R545, Rigel, R3Mab, R-723, R-507, R-499, R-1530, QPM5-986, QPAB-1556, PX-104.1, PS-608504, prostate cancer ther, Sequenom, prodigiosin, PRI-105, PP1, Scripps, PN-355, phenylalanine derivatives, NIH, Pharmaprojects No. 6492, Pharmaprojects No. 6291, Pharmaprojects No. 6271, Pharmaprojects No. 6267, Pharmaprojects No. 6140, Pharmaprojects No. 6138, Pharmaprojects No. 6083, Pharmaprojects No. 6059, Pharmaprojects No. 6013, Pharmaprojects No. 5330, Pharmaprojects No. 4855, Pharmaprojects No. 4597, Pharmaprojects No. 4368, Pharmaprojects No. 4164, Pharmaprojects No. 3985, Pharmaprojects No. 3495, Pharmaprojects No. 3135, PF-371989, PF-337210, PF-00120130, pelitinib, pegdinetanib, PDGFR-alpha inhibitors, Deciphera, PDGFR inhibitor, Pulmokine, PDGFR inhibitor, Array, PDGF receptor inhibitor, Kyowa, PDGF receptor inhibitor, Array, PDGF kinase inhibitors, Kinex, PD-180970, PD-173956, PD-171026, PD-169540, PD-166285, PD-154233, PD-153035, PD-0166285, PCI-31523, pazopanib hydrochloride (ophthalmic), pan-HER kinase inhib, Ambit-2, pan-HER inhibitor, SUGEN, pan-HER ACL, p56lck inhibitors, BI, OSI-930, OSI-817, OSI-632, OSI-296, ONC-101, ON-88210, ON-045270, NVP-AEW541, NVP-AAK980-NX, NV-50, NSC-242557, NNC-47-0011, NMS-P626, NL-0031, nilotinib, once-daily, nicotinamide derivatives, Bristol-Myers Squibb, neuT MAb, Philadelphia, multi-kinase inhibitors, Amphor, mullerian inhibiting subst, Ma, MS therapy, Critical Outcome Technologies, MP-371, MLN-608, MK-8033, MK-2461, Met/Ron kinase inhibs, SGX, Met/Gabl antagonist, Semaia, Met RTK antagonists, SUGEN, Met receptor inhibs, Ontogen, Met kinase inhibitor, BMS, Met inhibitors, Amphora, MEDI-548, MED-A300, ME-103, MC-2002, Lyn kinase inhibitor, CRT, Lyn B inhibitors, Onconova, lymphostin, LP-590, leflunomide, SUGEN, lck/Btk kinase inhibitors, AEgera, lck kinase inhibitors, Kinex, lck kinase inhibitors, Celgene, Lck inhibitors, Green Cross, lck inhibitors, Amphora, lck inhibitors, Amgen, lck inhibitors, Abbott, lavendustin A analogues, NIH, LAT inhibitors, NIH, L-000021649, KX-2-377, KST-638, KRX-211, KRX-123, KRN-383, KM-2550, kit inhibitor, Amphora, kinase inhibitors, SGX-2, kinase inhibitors, SGX-1, kinase inhibitors, MethylGene, kinase inhibitors, Amgen, kinase inhibitor, Cephalon, KIN-4104, Ki-8751, Ki-20227, Ki-11502, KF-250706, KDR kinase inhibs, Celltech, KDR kinase inhibitors, Merck & Co-2, KDR kinase inhibitors, Merck & Co-1, Kdr kinase inhibitors, Amgen, KDR inhibitors, Abbott, KDR inhibitor, LGLS, K252a, JNJ-38877605, JNJ-26483327, JNJ-17029259, JNJ-141, Janex-1, JAK3 inhibitors, Pharmacopeia-2, Jak3 inhibitors, Portola, JAK2 inhibitors, Merck & Co, JAK2 inhibitors, Deciphera, JAK2 inhibitors, Amgen, JAK2 inhibitors, Abbott, JAK2 inhibitor, CV, Cytopia, JAK2 inhibitor, cancer, Cytopia, JAK2 inhibitor, Astex, JAK-3 inhibitors, Cellzome, JAK inhibitors, Genentech, JAK inhibitors, BioCryst, JAK inhibitor, Pulmokine, JAK 1/3 inhibitor, Rigel, ITK inhibitors, GlaxoSmithKline, ISU-101, interleukin-2 inducible T-cell kinase inhibitors, Vertex, INSM-18, inherbins, Enkam, IMC-1C11, imatinib, sublingual, Kedem Pharmaceuticals, IGF-1R inhibitor, Allostera, IGF-1 inhibitors, Ontogen, HMPL-010, HM-95091, HM-60781, HM-30XXX series, Her2/neu & EGFR Ab, Fulcrum, HER2 vaccine, ImmunoFrontier, HER-2 binder, Borean, Her-1/Her-2 dual inhibitor, Hanmi, Her inhibitors, Deciphera, HEM-80322, HDAC multi-target inhibitors, Curis, GW-771806, GW-654652, GSK-1838705A, GNE-A, glioblastoma gene therapy, Biogen Idec, genistein, gene therapy, UCSD, focal adhesion kinase inhibitor, Kinex, FMS kinase inhibitors, Cytopia, FLT-3 MAb, ImClone, Flt-3 inhibitor, Elan, Flt 3/4 anticancer, Sentinel, FAK/JAK2 inhibitors, Cephalon, FAK inhibitors, Ontogen, FAK inhibitors, Novartis, FAK inhibitors, GlaxoSmithKline, FAK inhibitors, Cytopia, EXEL-6309, Etk/BMX kinase inhibitors, SuperGen, erbstatin, erbB-2 PNV, UAB, erbB-2 inhibitors, Cengent, ER-068224, ephrin-B4 sol receptor, VasGene, ephrin-B4 RTK inhib, VasGene, EphA2 receptor tyrosine kinase inhibitor, Pfizer, ENMD-981693, EHT-102, EHT-0101, EGFR/Her-2 kinase inhibitors, Shionogi, EGFR-CA, EGFR kinase inhibitors, Kinex, EGF-genistein, Wayne, EGF-593A, EG-3306, DX-2240, DP-4577, DP-4157, DP-2629, DP-2514, doramapimod, DNX-5000 series, DN-30 Fab, dianilinophthalimide, deuterated erlotinib, CoNCERT, dendritic cell modulators, Antisoma, DD-2, Jak inhibitors, DD-2, dual Jak3/Syk, DCC-2909, DCC-2157, D-69491, CYT-977, CYT-645, CX-4715, curcumin analogues, Onconova, CUDC-107, CT-100, CT-052923, CS-230, CP-724714, CP-673451, CP-564959, CP-292597, CP-127374, Cmpd-1, CL-387785, CKD-712, CHIR-200131, CH-330331, CGP-53716, CGP-52411, CGI-1746, CGEN-B2, CGEN-241, CFAK-Y15, CEP-37440, CEP-33779, CEP-28122, CEP-2563 dihydrochloride, CEP-18050, CEP-17940, celastrol, CDP-791, CB-173, cancer vaccine, bcr-abl, Mologen, cancer therapeutics, Cephalon, CAB-051, c-Src kinase inhibs, AstraZene, c-Met/Her inhibitors, Decipher, c-Met kinase inhibitor, Cephalon, c-Met inhibitors, Roche, c-Met inhibitor, Merck, c-kit inhibitors, Deciphera, c-kit inhibitors, Cell, c-Abl inhibitors, Plexxikon, c-Abl inhibitors, Onconova, BVB-808, Btk inhibitors, Bristol-Myers Squibb, Btk inhibitor, Pharmacyclics-2, BSF-466895, Brk/PTK6 inhibitors, Merck & Co, BreMel/rGel, BPI-703010, BPI-702001, BP-100-2.01, BMX kinase inhibitors, Amphora, BMS-817378, BMS-754807 back-up, BMS-743816, BMS-577098, BLZ-945, BIW-8556, BIO-106, Behcet's disease therapy, Cr, BAY-85-3474, AZM-475271, AZD-0424, AZ-Takl, AZ-23, Axl kinase inhibitors, SuperGen, Axl inhibitors, Deciphera, Axl inhibitors, CRT, AVL-101, AV-412, aurora/FLT3 kinase inhibs, Im, AST-6, AST-487, ARRY-872, ARRY-768, ARRY-470, ARRY-333786, apricoxib+EGFR-TKI, Tragara, AP-23994, AP-23485, anticancers, CoNCERT, anticancers, Bracco, anticancers, Avila-4, anticancers, Avila-3, anticancers, Avila-2, anticancer ZFPs, ToolGen, anticancer therapy, Ariad, anticancer MAbs, Xencor-2, anticancer MAbs, Kolltan, antiangiogenic ther, Deciphera, anti-Tie-1 MAb, Dyax, anti-PDGF-B MAbs, Mill, anti-inflammatory, Kinex, anti-inflammatory, Avila, anti-inflammatory ther, Vitae, anti-HER2neu scFv, Micromet, anti-HER2/Flt3 ligand, Symbi, anti-HER2 MAb, Abiogen, anti-Flt-1 MAbs, ImClone, anti-fak oligonucleotides, anti-ErbB-2 MAbs, Enzon, anti-EphA4 MAb, MedImmune, anti-EGFRvIII MAbs, Amgen, anti-EGFR MAb, Xencor, anti-EGFR immunotoxin, IVAX, anti-CD20/Flt3 ligand, Symbi, Anti-Cancer Ligands, Enchira, anti-ALK MAb, MedImmune, angiopoietins, Regeneron, AMG-Jak2-01, AMG-458, AMG-191, ALK inhibitors, PharmaDesign, ALK inhibitors, Lilly, ALK inhibitors, Cephalon-2, AI-1008, AHNP, Fulcrum, AGN-211745, AGN-199659, AG-957, AG-1295, AEE-788, and ADL-681.

ErbB tyrosine kinase inhibitor (ERbB) include but are not limited to; vandetanib, lapatinib ditosylate, gefitinib, erlotinib, afatinib, XL-647, neratinib, nelipepimut-S, dovitinib lactate, dacomitinib, varlitinib, RAF-265, PR-610, poziotinib, KD-020, BMS-690514, AZD-8931, AVX-901, AVL-301, AE-37, AC-480, VM-206, theliatinib, IDN-6439, HM-61713, epitinib, CUDC-101, cipatinib, Z-650, SN-34003, SN-29966, MT-062, CST-102, ARRY-380, XL-999, vatalanib, TAK-285, SU-5271, PKI-166, Pharmaprojects No. 4960, Pharmaprojects No. 3624, mubritinib, KSB-102, GW-282974, EMD-55900, CNF-201 series, canertinib dihydrochloride, cancer vaccine, Ajinomoto, breast cancer therapy, Galapago, BIBX-1382, AZD-4769, Argos, AP-23464, anti-HER2/neu mimetic, Cyclacel, anti-HER-2/neu antisense, Tekm, AG-18, ZM-254530, ZD-1838, VEGFR/EGFR inhib, Amphora, VEGF-TK inhibitors, AstraZeneca, V-930, RNAi cancer therapy, Benitec Biopharma, RM-6427, RB-200h, PX-104.1, Pharmaprojects No. 6291, Pharmaprojects No. 6271, Pharmaprojects No. 4164, Pharmaprojects No. 3985, Pharmaprojects No. 3495, pelitinib, PD-169540, PD-166285, PD-154233, PD-153035, pan-HER kinase inhib, Ambit-2, pan-HER inhibitor, SUGEN, pan-HER ACL, ON-045270, NSC-242557, NL-0031, mullerian inhibiting subst, Ma, ME-103, kinase inhibitors, Amgen, JNJ-26483327, ISU-101, INSM-18, inherbins, Enkam, HM-60781, HM-30XXX series, Her2/neu & EGFR Ab, Fulcrum, HER2 vaccine, ImmunoFrontier, HER-2 binder, Borean, Her-1/Her-2 dual inhibitor, Hanmi, Her inhibitors, Deciphera, HEM-80322, gene therapy, UCSD, erbB-2 PNV, UAB, erbB-2 inhibitors, Cengent, EHT-102, EGFR/Her-2 kinase inhibitors, Shionogi, EGFR-CA, EGFR kinase inhibitors, Kinex, EGF-593A, dianilinophthalimide, deuterated erlotinib, CoNCERT, D-69491, curcumin analogues, Onconova, CUDC-107, CP-724714, CP-292597, CL-387785, CGEN-B2, CAB-051, c-Met/Her inhibitors, Decipher, BreMel/rGel, BIO-106, AV-412, AST-6, ARRY-333786, apricoxib+EGFR-TKI, Tragara, anticancers, CoNCERT, anticancer MAbs, Xencor-2, anti-HER2neu scFv, Micromet, anti-HER2 MAb, Abiogen, anti-ErbB-2 MAbs, Enzon, anti-EGFRvIII MAbs, Amgen, anti-EGFR MAb, Xencor, anti-EGFR immunotoxin, IVAX, Anti-Cancer Ligands, Enchira, AHNP, Fulcrum, AEE-788, and ADL-681.

MEK1 or MEK2 (MEK) include, but are not limited to: Trametinib, ARRY-438162, WX-554, Selumetinib, Pimasertib, E-6201, BAY-86-9766, TAK-733, PD-0325901, GDC-0623, BI-847325, AS-703988, ARRY-704, Antroquinonol, CI-1040, SMK-17, RO-5068760, PD-98059, and ER-803064.

PIK3CA related treatments include, but are not limited to: perifosine, BKM-120, ZSTK-474, XL-765, XL-147, PX-866, PKI-587, pictilisib, PF-04691502, BYL-719, BEZ-235, BAY-80-6946, PWT-33597, PI3 kinase/mTOR inhibitor, Lilly, INK-1117, GSK-2126458, GDC-0084, GDC-0032, DS-7423, CUDC-907, BAY-1082439, WX-037, SB-2343, PI3/mTOR kinase inhibitors, Amgen, mTOR inhibitor/PI3 kinase inhibitor, Lilly-1, LOR-220, HMPL-518, HM-032, GNE-317, CUDC908, CLR-1401, anticancers, Progenics, anticancer therapy, Sphaera Pharma-1, AMG-511, AEZS-136, AEZS-132, AEZS-131, AEZS-129, pictilisib, companion diagnostic, GDC-0980, companion diagnostic, GDC-0032, companion diagnostic, AZD-8055, VEL-015, SF-2523, SF-2506, SF-1126, PX-2000, PKI-179, PI3K p110alpha inhibitors, Ast, PI3K inhibitors, Semafore-2, PI3K inhibitors, Invitrogen, PI3K inhibitor conjugate, Semaf, PI3K conjugates, Semafore, PI3-irreversible alpha inhibitors, Pathway, PI3-alpha/delta inhibitors, Pathway Therapeutics, PI3-alpha inhibitors, Pathway Therapeutics, PI3 kinase inhibitors, Wyeth, PI3 kinase inhibitors, Telik, PI3 kinase alpha selective inhibitors, Xcovery, PI-620, PF-4989216, PF-04979064, PF-00271897, PDK1 inhibitors, GlaxoSmithKline, ONC-201, KN-309, isoform-selective PI3a/B kinase inhibitors, Sanofi, inositol kinase inhibs, ICRT, HM-5016699, hepatocellular carcinoma therapy, Sonitu, GSK-1059615, glioblastoma therapy, Hoffmann-La Roche, EZN-4150, CU-906, CU-903, CNX-1351, antithrombotic, Cerylid, 4-methylpteridinones.

Treatments directed to ALK include, but are not limited to: crizotinib, companion diagnostic, AbbVie, crizotinib, TSR-011, RG-7853, LDK-378, AP-26113, X-396, ASP-3026, NMS-E628, DLX-521, aurora kinase+ALK inhibitor, Sareum, aurora kinase+ALK inhibitor, AstraZeneca, ALK inhibitors, AstraZeneca, Alk inhibitor, Cephalon-3, ALK inhibitor, Aurigene Discovery Technologies, LDK-378, companion diagnostic, crizotinib, companion diagnostic, Roche, TAE-684, kinase inhibitor, Cephalon, GSK-1838705A, EXEL-6309, Cmpd-1, CEP-37440, CEP-28122, CEP-18050, cancer therapeutics, Cephalon, anti-ALK MAb, MedImmune, ALK inhibitors, PharmaDesign, ALK inhibitors, Lilly, ALK inhibitors, and Cephalon-2.

Treatments directed to RET include, but are not limited to: vandetanib, sunitinib malate, sorafenib, regorafenib, cabozantinib, SAR-302503, motesanib diphosphate, apatinib, RET kinase inhibitor, Bionomics, NMS-173, MG-516, sorafenib bead, Biocompatibles, RET inhibitors, Cell T, MP-371, kinase inhibitors, MethylGene, JNJ-26483327, DCC-2157, and AST-487.

Accordingly, these and other agents can be used alone or in combination to treat NSCLC and can be included as an actionable treatment recommendation as disclosed herein.

Methods directed to determining a likelihood of a positive or negative response to a treatment and/or treating a subject based on the gene variant detected in the subject's sample are also provided herein. Referring to Tables 2 and 3, in certain embodiments, an actionable treatment recommendation refers to a particular treatment. For example, an EML4-ALK fusion present in a tumor sample leads to a recommendation of treatment with crizotinib. In contrast, the presence of an EGFR T790M mutation indicates that an EGFR tyrosine kinase inhibitor (TKI) would not be an appropriate treatment as this variant renders the tumor cell resistant to TKIs. The actionable treatment recommendation can be used to administer a treatment or withhold a treatment, depending on the variant status of a subject's tumor.

TABLE 2
Lung Adenocarcinoma
AI Cat- Actionable treatment
egory Genetic Variant recommendation
AI1 ALK EML4-ALK, KIF5B- Crizotinib
ALK, KLC1-ALK,
TGF-ALK fusions
AI1 EGFR L858R, Exon EGFR TKIs
19 deletion
AI1 EGFR Exon 20 insertion Resistant to EGFR
(in frame, 3-18 TKIs
base pairs)
AI1 EGFR T790M Resistant to EGFR
TKIs
AI1/AI2 KRAS G12C, G12V, G12D, Resistant to EGFR
G12A, G12S, G13C, TKI (AI1)
G13D, G12R, G12F Sensitive to MEK
inhibitors (AI2)
AI1 ROS1 EZR-ROS1, SLC34A2- Crizotinib
ROS1, CD74-ROS1,
SDC4-ROS1
AI2 BRAF V600E Vemurafenib
AI2 ERBB2 Exon 20 insertion Irreversible pan-erb
inhibitors (e.g.,
afatinib, neratinib)
AI2 MET CN gain Resistant to EGFR
TKIs
Sensitive to Crizotinib
AI2 PIK3CA E545K, E545G, E545A, PIK3CA inhibitors
H1047R, H1047L (e.g., BKM120)
AD AKT1 E17K 1 Open Phase II Trial
(Lung cancer, AKT
mutation)
AI3 BRAF L597R 3 Open Phase I trials
(solid cancer), 1 Open
Phase II trial (lung
cancer, BRAF mutation)
AI3 BRAF G469R, D594H/N 3 Open Phase I trials
(solid cancer), 1 Open
Phase II trial (lung
cancer, BRAF mutation)
AD EGFR G719X 1 Open Phase I
(NSCLC), 1 Open
Phase 1 (solid
cancer), 1 open Phase
II (NSCLC)
AD HRAS Q61L/K/R, G12C/D, 1 Open Phase II (lung
G13C/S/R/V cancer, HRAS mutations)
AD PIK3CA E542K 2 Open Phase I (solid
cancer), 1 Open Phase
II trial (NSCLC,
PIK3CA mutation)

TABLE 3
Squamous Cell Lung Carcinoma
AI Cat- Actionable treatment
egory Prevalence >1% Prevalence 0.1%-1% recommendation
AI1 EGFR (L858R, EGFR (G719X) EGFR TKIs
Exon 19 del)
AI1/AI2 KRAS (G12C, KRAS (G12A, Resistant to TKIs
G12D) G12V) (AI1); Sensitive to
MEK Inhibitors (AI2)
AI2 MET CN gain Resistant to TKIs;
Sensitive to Crizotinib
AI2 PIK3CA (E545K, PIK3CA Inhibitors
E542K, H1047R) (e.g., BKM120)
AI3 AKT1 (E17K) 1 Open Phase II Trial
(Lung cancer, AKT mutation)
AI3 HRAS (Q61, /K/R, 1 Open Phase II (Lung
G12C/D) cancer; HRAS mutation)
AI3 EGFR CN gain 1 Open Phase II (lung
cancer; EGFR amplification)
AI3 ERBB2 CN gain 2 Open Phase II
(Lung cancer; ERBB2
amplification)
AI3 FGFR1 CN gain 2 Open Phase I; Phase
II (Solid cancer;
FGFR1 amplification)
AI3 KIT/PDGFRA 1 Open Phase II
CN gain (Lung cancer;
PDGFRA amplification)
AI3 PTEN Del 4 Open Phase I/II
(NSCLC, PTEN alterations)

TABLE 4
Adenocarcinoma
AI1-AI2-AI3-Gene-Event No. Percentage
ALK- Fusion 2 1%
BRAF-Mutation 3 2%
BRAF-Mutation; PIK3CA- mutation* 1 1%
EGFR-CN Amp 3 2%
EGFR-Mutation 13 8%
EGFR-Mutation; EGFR-CN Amp* 3 2%
ERBB2-CN Amp 3 2%
ERBB2-mutation 3 2%
FGFR1-CN Amp 2 1%
HRAS-Mutation 1 1%
KIT- CN Amp 1 1%
KRAS-Mutation; PIK3CA- Mutation* 2 1%
KRAS-Mutation 39 24% 
KRAS-Mutation; EGFR-CN Amp* 1 1%
MET-CN Amp 3 2%
PIK3CA-mutation 3 2%
RET- Fusion 1 1%
ROS1- Fusion 2 1%
WT 79 48% 

TABLE 5
Adenocarcinoma
AI1-AI2-AI3-Gene-Variant No Percentage
BRAF-D594H; PIK3CA-E542K* 1 1%
BRAF-D594N 1 1%
BRAF-V600E 2 1%
CCDC6-RET Fusion 1 1%
CD74-ROS1 Fusion 1 1%
EGFR-CN Amp 3 2%
EGFR-E19Del 4 2%
EGFR-E19Del; EGFR-CN Amp* 3 2%
EGFR-G719A 1 1%
EGFR-L858R 7 4%
EGFR-L858R; EGFR-T790M* 1 1%
EML4-ALK Fusion 2 1%
ERBB2-CN Amp 3 2%
ERBB2-E20Ins 3 2%
FGFR1-CN Amp 2 1%
HRAS-Q61L 1 1%
KIT- CN Amp 1 1%
KRAS-G12A 4 2%
KRAS-G12C 21 13% 
KRAS-G12C; EGFR-CN Amp* 1 1%
KRAS-G12C; PIK3CA-E545K* 2 1%
KRAS-G12D 2 1%
KRAS-G12V 11 7%
KRAS-G13D 1 1%
MET-CN Amp 3 2%
PIK3CA-E545K 2 1%
PIK3CA-H1047R 1 1%
SLC34A2-ROS1 Fusion 1 1%
WT 79 48% 
*Double mutant genotypes

TABLE 6
Adenocarcinoma
AI1, AI2 Gene event No. Percentage
MET-CN Gain 1 1%
PIK3CA-Mutation 14 8%
PIK3CA-Mutation; MET-CN Gain* 1 1%
WT 161 91% 
*Double mutant genotypes

TABLE 7
Squamous Cell Carcinoma
AI1, AI2, AI3-Gene event No. Percentage
EGFR- CN Gain 12 7%
ERBB2-CN Gain 1 1%
FGFR1- CN Gain 23 13% 
KIT-CN Gain 1 1%
MET-CN Gain 1 1%
PIK3CA-Mutation 11 6%
PIK3CA-Mutation; EGFR- CN Gain* 1 1%
PIK3CA-Mutation; FGFR1- CN Gain* 2 1%
PIK3CA-Mutation; MET-CN Gain* 1 1%
PTEN- CN Loss 2 1%
WT 122 69% 
*Double mutant genotypes

TABLE 8
Squamous Cell Carcinoma
AI1, AI2 Gene Events No. Percentage
AI2 16  9%
WT 161 91%

TABLE 9
Highly Actionable Molecular Targets in NSCLC
Source Type Gene Target
DNA Oncogenes EGFR, ERBB2, ERBB4, MET, FGFR1,
FGFR2, FGFR3, DDR2, ALK
EGFR Pathway KRAS, NRAS, PIK3CA, BRAF,
MAP2K1, AKT1
Tumor Suppressor PTEN, TP53, CTNNB1, NOTCH1,
Genes STK11, SMED4, FBXW7
RNA Fusion Genes ALK, RET, ROS

TABLE 11
Approved Limita-
Gene Variant Level of targeted Indications and tions of
Symbol Type evidence agent uses usage
ALK Fusion 1 crizotinib Xalkori- kinase
inhibitor indicated
for treatment of
patients with
metastatic NSCLC
whose tumors are
ALK-positive as
detected by an
FDA-approved test
ALK Fusion 1
RET Fusion 2 None None None
RET Fusion 2
ROS1 Fusion 1 None None None

TABLE 13
Biomarkers
ABL1 CD274 GATA3 MLL4 RAF1
ACVRL1 CD44 GNA11 MPL RARA
AKT1 CDH1 GNAQ MYC RB1
AKT3 CDK4 GNAS MYCL1 RET
ALK CDK6 HRAS MYCN RHEB
APC CDKN2A IDH1 MYD88 RHOA
APEX1 CSNK2A1 IDH2 NCOR1 ROS1
AR CTCF IFITM1 NF1 RPS6KB1
ARHGAP35 CTNNB1 IFITM3 NFE2L2 SETD2
ARID1A DNMT3A IGF1R NKX2-1 SF3B1
ARID1B EGFR IL6 NOTCH1 SMO
ARID2 ERBB2 JAK1 NRAS SOX2
ATM ERBB3 JAK2 NSD1 SPEN
ATRX ERG JAK3 PAX5 SPOP
BCL2L1 ETV1 KIT PBRM1 STAT3
BCL9 ETV4 KRAS PDGFRA STK11
BIRC2 ETV5 MAGOH PDGFRB TERT
BIRC3 EZH2 MAP2K1 PIK3C2A TIAF1
BRAF FAT1 MAP3K1 PIK3CA TP53
BRCA1 FBXW7 MAPK1 PIK3R1 U2AF1
BRCA2 FGFR1 MAX PNP VHL
C15orf23 FGFR2 MCL1 PPARG WT1
CBL FGFR3 MDM2 PPP2R1A XPO1
CCND1 FLT3 MDM4 PTEN ZC3H13
CCND2 FOXL2 MED12 PTPN11 ZNF217
CCND3 GAS6 MET RAC1
CCNE1 GATA2 MGA

TABLE 14
Hot Spots
ABL1 GNAQ MYD88 EGFR KIT RHEB
AKT1 GNAS NFE2L2 ERBB2 KRAS RHOA
ALK HRAS NRAS ERBB3 MAGOH SF3B1
AR IDH1 PAX5 EZH2 MAP2K1 SMO
BRAF IDH2 PDGFRA FGFR2 MAPK1 SPOP
C15orf23 IFITM1 PIK3CA FGFR3 MAX SRC
CBL IFITM3 PPP2R1A FLT3 MED12 STAT3
CDK4 JAK1 PTPN11 FOXL2 MET U2AF1
CTNNB1 JAK2 RAC1 GATA2 MPL XPO1
DNMT3A JAK3 RET GNA11

TABLE 15
Copy Number Amplifications
ACVRL1 BIRC2 CD44 FGFR1 IGF1R MDM4 NKX2-1 RPS6KB1
AKT1 BIRC3 CDK4 FGFR2 IL6 MET PDGFRA SOX2
AR CCND1 CDK6 FGFR3 KIT MYC PIK3CA TERT
APEX1 CCNE1 CSNK2A1 FLT3 KRAS MYCL1 PNP TIAF1
BCL2L1 CD274 EGFR GAS6 MCL1 MYCN PPARG ZNF217
BCL9 ERBB2 MDM2

TABLE 16
Gene Fusions
AKT3 ALK BRAF CDK4 ERG ETV1 ETV4
ETV5 FGFR3 HER2 NTRK3 RAFI RET ROS1

TABLE 17
Tumor Suppressor Genes
APC ATRX FAT1 NCOR1 PTEN VHL
ARHGAP35 BRCA1 FBXW7 NF1 RB1 WT1
ARID1A BRCA2 GATA3 NOTCH1 SETD2 ZC3H13
ARID1B CDH1 MAP3K1 NSD1 SPEN
ARID2 CDKN2A MGA PBRM1 STK11
ATM CTCF MLL4 PIK3R1 TP53

TABLE 18
Types of Cancers
Adrenocortical Carcinoma Germ Cell Tumor, Extragonadal Osteosarcoma
Anal Cancer Gestational Trophoblastic Ovarian Epithelial Cancer
Tumor
Aplastic Anemia Laryngeal Cancer and Ovarian Germ Cell Tumor
Hypopharyngeal Cancer
Bile Duct Cancer Leukemia Pancreatic Cancer, Exocrine
Bladder Cancer Leukemia in Children Pancreatic Cancer, Islet Cell
Carcinoma
Blood Cancers Treatment Leukemia, Acute Parathyroid Cancer
Lymphoblastic, Adult
Bone Cancer Leukemia, Acute Penile Cancer
Lymphoblastic, Childhood
Brain/CNS Tumor, Adult Leukemia, Acute Myeloid, Pituitary Cancer
Adult
Brain/CNS Tumor, Brain Stem Leukemia, Acute Myeloid, Plasma Cell Neoplasm
Glioma, Childhood Childhood
Brain Tumor, Cerebellar Leukemia, Chronic Prostate Cancer
Astrocytoma, Childhood Lymphocytic (CLL)
Brain Tumor, Cerebral Leukemia, Chronic Rhabdomyosarcoma,
Astrocytoma, Childhood Myelogenous (CML) Childhood
Brain Tumor, Ependymoma, Lip and Oral Cavity Cancer Rectal Cancer
Childhood
Brain Tumor, Childhood Liver Cancer, Adult (Primary) Renal Cell Cancer (cancer of
(Other) the kidney)
Breast Cancer Liver Cancer, Childhood Renal Pelvis and Ureter,
(Primary) Transitional Cell
Breast Cancer, Male Lung Cancer, Non-Small Cell Rhabdomyosarcoma
Cancer in Children/Cancer of Lung Cancer, Small Cell Salivary Gland Cancer
Unknown Primary
Carcinoid Tumor, Lung Carcinoid Tumor Sarcoma - Adult Soft Tissue
Gastrointestinal Cancer
Carcinoma of Unknown Lymphoma, AIDS-Related Sezary Syndrome
Primary
Castleman Disease Lymphoma of the skin Skin Cancer
Cervical Cancer Lymphoma, Central Nervous Skin Cancer - Basal and
System (Primary) Squamous Cell
Colon Cancer Lymphoma, Cutaneous T-Cell Skin Cancer, Cutaneous T-Cell
Lymphoma
Endometrial Cancer Lymphoma, Hodgkin's Disease, Skin Cancer, Kaposi's Sarcoma
Adult
Esophageal Cancer Lymphoma, Hodgkin's Disease, Skin Cancer, Melanoma
Childhood
Extrahepatic Bile Duct Cancer Lymphoma, Non-Hodgkin's Small Intestine Cancer
Disease, Adult
Ewings Family of Tumors Lymphoma, Non-Hodgkin's Soft Tissue Sarcoma, Adult
(PNET) Disease, Childhood
Extracranial Germ Cell Tumor, Malignant Mesothelioma Soft Tissue Sarcoma, Child
Childhood
Eye Cancer, Intraocular Melanoma Stomach Cancer
Melanoma
Gallbladder Cancer Merkel Cell Carcinoma Testicular Cancer
Gastrointestinal Stromal Tumor Metasatic Squamous Neck Thymoma, Malignant
(GIST) Cancer with Occult Primary
Gastric Cancer (Stomach) Multiple Myeloma and Other Thyroid Cancer
Plasma Cell Neoplasms
Germ Cell Tumor, Mycosis Fungoides Urethral Cancer
Extragonadal
Gestational Trophoblastic Myelodysplastic Syndrome Uterine Cancer, Sarcoma
Tumor
Head and Neck Cancer Myeloproliferative Disorders Unusual Cancer of Childhood
Hypopharyngeal Cancer Nasal Cavity and Paranasal Vaginal Cancer
Sinus Cancer
Islet Cell Carcinoma Nasopharyngeal Cancer Vulvar Cancer
Kaposi Sarcoma Neuroblastoma Waldenstrom
Macroglobulinemia
Kidney Cancer (renal cell Oral Cancer Wilms' Tumor
cancer)
Gallbladder Cancer Oral Cavity Cancer
Gastric Cancer (Stomach) Oropharyngeal Cancer

SEE TABLE 19

In certain embodiments compositions, kits and methods are disclosed for detection of driver alterations for cancer. The cancer can be any type of cancer (see, for example, Table 18). In certain embodiments, the compositions, kits and methods comprise detecting driver alterations associated with a large number of cancer types. In certain embodiments, the compositions, kits and methods comprise detecting all driver mutations associated with all known cancer types.

Comprehensive screening can be performed in a single panel and therefore can be performed utilizing a single biological sample, thus preserving valuable sample. Sample input can be as low as 100 ng, 90 ng, 80 ng, 70 ng, 60 ng, 50 ng, 40 ng, 30 ng, 20 ng, 10 ng, or less. In certain embodiments, 50 ng is required. In yet other embodiments, less than 50 ng, such as 10 ng, 5 ng, 1 ng, is required.

In one embodiment, compositions and kits are provided that comprise a plurality (i.e, greater than 1) of sets of probes that specifically recognize the nucleic acids of the genes in Tables 13-17 and 19. The compositions and kits can comprise a set of probes that specifically recognize any number and combination of the genes in Tables 13-17 and 19. In certain embodiments the number of genes is greater than 5, 10, 15, 20, 50, 70, 100, 110, 120, 130, 150, 200, 250, and greater than 250, such as 300, 400, 500, 1000 or more (and each integer in between). In certain embodiments, the compositions and kits can comprise a set of probes that specifically recognize each of the genes in Tables 13-17 and 19.

Driver alterations can be any form of genetic variance that confers a growth and/or survival advantage on the cells carrying them, specifically, a cancer cell. In certain embodiments, the driver alteration provides an actionable target. That is, the driver alteration is associated with a drug response or a clinical decision support. An exemplary list of driver alterations is provided in Tables 13-17 and 19, which include cancer hotspot mutations, copy number variation, tumor suppressor genes, and gene fusions.

Table 19 provides an exemplary list of gene fusions. Referring to item 11, in which the driver gene is ALK. The 5′gene is EML4 and the 3′gene is ALK. The 5′ and 3′ Entrez Id's are provided and the source of the fusion with this particular break point is the OncoNetwork. Other sources can include NGS, Cosmic, ARUP, alone or in combination. The 5′ Exon number, in item 11, indicates that Exon 17 coding sequence (cds) of EML4 is involved in this fusion and the 3′ Exon number indicates that Exon 20 coding sequence of ALK is involved in this fusion. Additional information found in Table 19 includes: Cosmid Ids and remarks, observed or inferred, are provided (where relevant) and 5′ and 3′ breakpoint sites.

FIG. 6 provides an exemplary work flow of how gene content can be defined by cancer driver analysis. In this workflow, a cancer gene can be associated with a drug target and an actionability index determined and recommended action can be identified.

In certain embodiments, one or more driver mutations can be detected or identified by various sequencing methods. Non-limiting examples of sequence analysis include Maxam-Gilbert sequencing, Sanger sequencing, capillary array DNA sequencing, thermal cycle sequencing, solid-phase sequencing, sequencing with mass spectrometry such as matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, and sequencing by hybridization. Non-limiting examples of electrophoretic analysis include slab gel electrophoresis such as agarose or polyacrylamide gel electrophoresis, capillary electrophoresis, and denaturing gradient gel electrophoresis. Additionally, next generation sequencing methods can be performed using commercially available kits and instruments from companies such as the Life Technologies/Ion Torrent PGM or Proton, the Illumina HiSEQ or MiSEQ, and the Roche/454 next generation sequencing system.

In one embodiment a tumor sample is sequenced for at least one variant, e.g. a mutation, copy number variation, fusion, altered expression, and a combination thereof. The sample is sequenced, for example, with NGS, such as semiconductor sequencing technology. The sample is automatically analyzed for driver mutation status and a report is generated. See FIGS. 2 and 3.

In another embodiment, one or more driver mutations are detected by next generation sequencing and subsequently by confirmed by one or other additional methods disclosed above. These confirmatory methods are referred to as Reflex Tests. The Reflex Test. In certain embodiment, sequencing with NGS is followed by a non-NGS reflex test. For example, sequencing with NGS can be followed by a Reflext Test with sequence analysis methods including include Maxam-Gilbert sequencing, Sanger sequencing, capillary array DNA sequencing, thermal cycle sequencing, solid-phase sequencing, sequencing with mass spectrometry such as matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, and sequencing by hybridization. In certain embodiments, NGS is followed by a Reflex Test with Sanger sequencing or thermocycler sequencing, such as qPCR.

In certain embodiments, a treatment is determined for a patient with cancer. Multiple workflows are disclosed herein that can be used to determine the treatment. For example, a sample can be obtained from a subject with can be obtained and screened for genetic variants utilizing next generation sequencing. Depending on the variant detected with NGS, a confirmatory test can be performed using either CE or aPCR. When the genetic variant identified is confirmed, a report is generated. The report can comprise suggestions or recommendations for an FDA approved drug, a companion diagnostic assay, a clinical trial, etc. These recommendations can be based on the A1 associated with the patient's results. The recommendation is communicated in a report to an oncologist and/or the patient. The oncologist can then utilize the recommendations in the report to inform his clinical treatment plan for the patient. See FIG. 1.

In certain embodiments, the workflow from sample prep to report is complete in less than 1 week, less than 6, 5, or 4 days, less than 3 or 2 days, etc. In certain embodiments, the workflow form sample prep to report time is approximately 24 hours.

In embodiments where certain next generation sequencing methodologies are employed,

Reports

In another aspect, the invention features a report indicating a prognosis or treatment response prediction of a subject with cancer. The report can, for example, be in electronic or paper form. The report can include basic patient information, including a subject identifier (e.g., the subject's name, a social security number, a medical insurance number, or a randomly generated number), physical characteristics of the subject (e.g., age, weight, or sex), the requesting physician's name, the date the prognosis was generated, and the date of sample collection. The reported prognosis can relate to likelihood of survival for a certain period of time, likelihood of response to certain treatments within a certain period of time (e.g., chemotherapeutic or surgical treatments), and/or likelihood of recurrence of cancer. The reported prognosis can be in the form of a percentage chance of survival for a certain period of time, percentage chance of favorable response to treatment (favorable response can be defined, e.g., tumor shrinkage or slowing of tumor growth), or recurrence over a defined period of time (e.g., 20% chance of survival over a five year period). In another embodiment, the reported prognosis can be a general description of the likelihood of survival, treatment recommendations (ie, FDA approved pharmaceutical, further classification via companion diagnostic test, clinical trials, etc), response to treatment, or recurrence over a period of time. In another embodiment, the reported prognosis can be in the form of a graph. In addition to the gene expression levels and gene variants/mutations, the reported prognosis may also take into account additional characteristics of the subject (e.g., age, stage of cancer, gender, previous treatment, fitness, cardiovascular health, and mental health).

In addition to a prognosis, the report can optionally include raw data concerning the expression level or mutation status of genes of interest.

EXAMPLES

Example I

Genomic and gene variant data was obtained from Life Technologies and Compendia Bioscience's ONCOMINE™ Concepts Edition and ONCOMINE™ Power Tools, a suite of web applications and web browsers that integrates and unifies high-throughput cancer profiling data by systematic collection, curation, ontologization and analysis. In addition, mutation gene variant data was also obtained from Life Technologies and Compendia Bioscience's curation and analysis of next generation sequencing data available from The Cancer Genome Atlas (TCGA) Portal.

Data obtained from the TCGA contains mutation results from datasets processed and annotated by different genome sequencing centers. All of the mutation data characterized in TCGA was somatic mutation data containing mutation variants specific to the tumor specimen and not observed in the normal tissue specimen obtained from the same individual. To obtain consistent variant annotation, the mutations obtained from TCGA were re-annotated based on a single set of transcripts and variant classification rules. A standard annotation pipeline ensured that mutations were evaluated consistently and were subject to common interpretation during the identification of lung cancer gene variants. In the Mutation Annotation step, the mutations obtained from TCGA were re-annotated against a standard transcript set. This transcript set included RefGene transcripts from hg18 and hg19 genome builds, obtained from UCSC on Feb. 19, 2012.

Mutation data incorporated into ONCOMINE Power Tools was derived from multiple sources including the Sanger Institute's Catalogue of Somatic Mutations in Cancer (COSMIC). Mutation data sourced from COSMIC retained its original annotation.

Recurrent gene mutations in multiple clinical samples were identified based on the position of the variant in the gene coding sequence. Missense mutation variants were inferred if the mutation was a single nucleotide polymorphism (SNP) in a coding exon that changed the encoded amino acid. Such missense mutation gene variants were recurrent if the same gene contained the same SNP in multiple samples. Hotspot in frame insertion/deletion mutation variants were inferred if the nucleotide mutation was an insertion or deletion divisible by 3 nucleotides.

The frequency of recurrent hotspot missense mutation and/or hotspot in frame insertion/deletion mutation in different genes in lung cancer was characterized by counting all of the clinical specimens tested that were found to contain the gene variants and expressing that value as a percentage relative to all of the clinical specimens tested. A list of all the genes with prevalent hotspot missense mutations in lung cancer was derived.

Gene copy number data for lung cancer was obtained from the ONCOMINE DNA Copy PowerTool. A minimal common region analysis was performed to identify chromosomal regions of focal amplification in lung cancer. Contiguous chromosomal regions (common regions) containing copy gain (>0.9 log 2 copy number) in 2 or more samples were identified. Within each common region, the genes that were aberrant in the highest number of samples (n) and also those that were aberrant in one less the highest number (n−1) were identified. Alternatively, genes aberrant in 95% of the highest number of samples (n) were identified. The frequency of these peak regions was determined by calculating the number of samples with copy gain relative to the total number of samples analyzed and expressing this value as a percentage. The most prevalent peak regions in lung cancer typically contained known cancer genes such as MET, FGFR1, EGFR, ERBB2, KIT/PDGFRA.

Gene variants with prevalent hotspot missense mutations, focal amplification, or gene fusion were investigated further to determine whether they had actionability evidence associated with actionability index levels 1-3.

Gene variants associated with AI1 were identified in the National Comprehensive Cancer Network Practice Guidelines in Oncology (NCCN Guidelines) for non-small cell lung cancer (NSCLC) (Version 2.2013). Such gene variants were those that the Guidelines provided specific treatment recommendations. For example, patients with lung adenocarcinoma whose tumor specimen was found to contain EGFR L858R variants were recommended to consider treatment with an EGFR inhibitor such as erlotinib or gefitnib.

Gene variants associated with AI2 were identified in public literature sources such as the National Center for Biotechnology Information (NCBI) PubMed, a web browser containing citations for biomedical literature.

Gene variants associated with AI3 were identified by searching databases of clinical trial information such as ClinicalTrials.Gov and Citeline© TrialTrove for matching gene and variant type annotation in the enrollment criteria of ongoing clinical trials.

Referring to Tables 4-5, the methods disclosed herein provide an actionable treatment recommendation for 50% of adenocarcinoma subjects. A cohort of 165 patients with primary lung adenocarcinoma was characterized by next generation sequencing methods. The gene variants were mapped onto this population. Most patients were observed to have only a single aberration out of the entire panel. Collectively, approximately 52% of subjects were positive for at least one genetic variance. The prevalence of gene variants in combinations of the AI1, AI2, and AI3 categories are shown in Tables 4-6.

Example II

A 177 cohort of patients with lung squamous cell carcinoma were characterized by next generation sequencing methods and gene variants were mapped onto this population, according to the methods of Example I. The prevalence of gene variants in AI1, AI2, and AI3 categories in the TCGA squamous cell carcinoma 177 patient cohort are shown in Tables 7-8.

Additional genes and their levels of evidence and corresponding actionabilities are shown in Tables 9-12

13. Example III

A patient presents with late stage NSCLC. A test is conducted to determine the mutation status of highly actionable NSCLC biomarkers in Table 9 in one panel to preserve limited tumor biopsy sample. A report is generated outlining the mutation status of the sample and corresponding actionability indices. A course of treatment is determined based on the mutation status of the patient's tumor.

Example IV

Actionability content is generated based on a subject's gene variant status. An FFPE sample comprising a NSCLC tumor cell is obtained from a subject. The sample is prepared for mutation, copy number, gene fusion, and expression analysis. The sample is sequenced using NGS, in particular using semiconductor sequencing. Based on results obtained from NGS, a Reflex Test is performed to confirm variant status. A report is generated comprising an Actionability Index and recommended action associated with the variant status. In this regard, the tumor cell comprises an ALK translocation. Prescribing information includes treatment with a kinase inhibitor for locally advanced or metastatic NSCLC. The treatment is in accordance with NCCN Clinical guidelines for NSCLC, which is supported by early clinical evidence. Enrolling and pending clinical trial information is further provided in the report (See Example V).

Example V

An exemplary report. A report is generated related with content related to an ALK translocation. The report contains actionability content as follows:

ALK Translocation: Prescribing information: XALKORI (crizotinib) is a kinase inhibitor indicated for the treatment of patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) that is anaplastic lymphoma kinase (ALK)-positive as detected by an FDA approved test.1

NCCN Clinical Guidelines (NSCLC): Anaplastic lymphoma kinase (ALK) gene rearrangements represent the fusion between ALK and various partner genes, including echinoderm microtubule-associated protein like 4 (EML4). ALK fusions have been identified in a subset of patients with NSCLC and represent a unique subset of NSCLC patients for whom ALK inhibitors may represent an effective therapeutic strategy. XALKORI (crizotinib) is an oral ALK inhibitor that is approved by the FDA for patients with locally advanced or metastatic NSCLC who have the ALK gene rearrangement (i.e. ALK positive).2

Early clinical evidence: In a Phase I trial, a second-generation ALK inhibitor, LDK378, showed a marked clinical response in 78 patients with ALK positive metastatic non-small cell lung cancer (NSCLC) who had progressed during or after crizotinib therapy or had not been previously treated with crizotinib. Currently, LDK378 is in Phase II clinical trials and Phase III trials are planned.3

Clinical trials: As of 9 Jul. 2013, 10 clinical trials for ALK positive NSCLC patients were recruiting participants.4

As of 9 Jul. 2013, 3 Phase I, 2 Phase I/II, 3 Phase II and 2 Phase III clinical trials were recruiting ALK positive NSCLC patients.4

In addition, several clinical trials for investigational ALK tyrosine kinase inhibitors were recruiting patients with NSCLC and advanced cancers.4

The report further comprises references related to the actionability content reported: (1) http://www.accessdata.fda.gov/drugsatfda_docs/label/2012/202570s002lbl.pdf; (2) NCCN Guidelines Version 2.2013 Non-Small Cell Lung Cancer; (3) Shaw A, et al. J Clin Oncol 31, 2013 (suppl; abstr TPS8119); (4) http://clinicaltrials.gov/; http://www.mycancergenome.org.

It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

2TABLE 10
Trial
Phase
Row Id Gene Variant (if specified) Trial Title Disease Type(s) (s) Patient Segment(s) Primary Drugs
 2 ALK Mutations A Phase I, Non-randomized, Open- Breast I Second line or ASP-3026
label, Repeat Oral Administration Colorectal greater/Refractory/Relapsed
Study of ASP3026 in Patients With Liver Stage III
Solid Tumors Lung, Non-Small Cell Stage IV
Soft Tissue Sarcoma
Unspecified Solid Tumor
 3 ALK Positive A Phase I/IIa Open-Label, Dose Lung, Non-Small Cell I/II Aggressive TSR-011
Escalation and Cohort Expansion Trial Lymphoma, Hodgkin's Classical
of Oral TSR-011 in Patients With Lymphoma, Non-Hodgkin's First line
Advanced Solid Tumors and Pancreas Indolent
Lymphomas Thyroid Nodular lymphocyte-predominant
Second line or
greater/Refractory/Relapsed
Stage II
Stage III
Stage IV
 1 AKT1 Unspecified A Phase I, First-in-Human, Dose Breast I Aggressive MSC-2363318A
Escalation Trial of MSC2363318A, a Lung, Non-Small Cell Classical
Dual p70S6K/Akt Inhibitor, in Lymphoma, Hodgkin's HER2 positive
Subjects With Advanced Malignancies Lymphoma, Non-Hodgkin's Indolent
Unspecified Solid Tumor Nodular lymphocyte-predominant
Second line or
greater/Refractory/Relapsed
Stage III
Stage IV
 1 BRAF Unspecified An Open-Label, Phase lb Dose Breast I HER2 negative pimasertib
Escalation Trial of Oral Combination Colorectal Locally advanced XL-765
Therapy With MSC1936369B and Endometrial Metastatic
SAR245409 in Subjects With Locally Lung, Non-Small Cell Recurrent
Advanced or Metastatic Solid Tumors. Melanoma Second line or
Ovarian greater/Refractory/Relapsed
Pancreas Stage II
Renal Stage III
Thyroid Stage IV
Unspecified Solid Tumor Triple receptor negative
 2 BRAF Unspecified A Phase Ib Open-label, Multi-center, Breast I HER2 negative ARRY-438162
Dose Escalation and Expansion Study Colorectal Second line or BYL-719
of Orally Administered MEK162 Plus Esophageal greater/Refractory/Relapsed
BYL719 in Adult Patients With Lung, Non-Small Cell Stage II
Selected Advanced Solid Tumors Melanoma Stage III
Pancreas Stage IV
Unspecified Solid Tumor Triple receptor negative
 3 BRAF V600E A Phase II Study of the Selective BRAF Lung, Non-Small Cell II Second line or dabrafenib
Kinase Inhibitor GSK2118436 in greater/Refractory/Relapsed
Subjects With Advanced Non-small Stage IV
Cell Lung Cancer and BRAF Mutations
 4 BRAF inactivating Phase II Trial of Dasatinib in Subjects Lung, Non-Small Cell II First line dasatinib (tablet)
mutations or With Advanced Cancers Harboring Melanoma Second line or
uncharacterized DDR2 Mutation or Inactivating B-RAF greater/Refractory/Relapsed
mutations Mutation Stage III
Stage IV
 5 BRAF V600 mutant A Phase Ib, Open-Label Study Colorectal I First line cobimetinib
Evaluating the Safety, Tolerability, Lung, Non-Small Cell Second line or onartuzumab
and Pharmacokinetics of Melanoma greater/Refractory/Relapsed vemurafenib
Onartuzumab in Combination With Unspecified Solid Tumor Stage III
Vemurafenib and/or Cobimetinib in Stage IV
Patients with Advanced Solid
Malignancies
 1 DDR2 Unspecified Phase II Trial of Dasatinib in Subjects Lung, Non-Small Cell II First line dasatinib (tablet)
With Advanced Cancers Harboring Melanoma Second line or
DDR2Mutation or Inactivating B-RAF greater/Refractory/Relapsed
Mutation Stage III
Stage IV
32 EGFR Unspecified Ipilimumab Plus Targeted Inhibitor Lung, Non-Small Cell I First line crizotinib
(Erlotinib or Crizotinib) for EGFR or Second line or erlotinib
ALK Mutated Stage IV Non-small Cell greater/Refractory/Relapsed ipilimumab
Lung Cancer: Phase lb with Expansion Stage IV
Cohorts
33 EGFR Unspecified Phase I Trial Evaluating Safety and Lung, Non-Small Cell I First line afatinib
Tolerability of the Irreversible Second line or dasatinib
Epidermal Growth Factor Receptor greater/Refractory/Relapsed
Inhibitor Afatinib (BIBW 2992) in Stage III
Combination With the SRC Kinase Stage IV
Inhibitor Dasatinib for Patients With
Non-small Cell Lung Cancer (NSCLC)
34 EGFR T790M Phase I Trial Evaluating Safety and Lung, Non-Small Cell I First line afatinib
Tolerability of the Irreversible Second line or dasatinib
Epidermal Growth Factor Receptor greater/Refractory/Relapsed
Inhibitor Afatinib (BIBW 2992) in Stage III
Combination With the SRC Kinase Stage IV
Inhibitor Dasatinib for Patients With
Non-small Cell Lung Cancer (NSCLC)
35 EGFR G719X, exon 19 Phase I Study of INC280 Plus Erlotinib Lung, Non-Small Cell I (N/A) INCB-028060
deletion, L858R, in Patients With C-Met Expressing Second line or
L861Q Non-Small Cell Lung Cancer greater/Refractory/Relapsed
36 EGFR activating A Phase Ib Open-label Study to Lung, Non-Small Cell I Line of therapy N/A MEDI-4736
mutation Evaluate the Safety and Tolerability of Stage III Stage IV
MEDI4736 in Combination with
Tremelimumab in Subjects with
Advanced Non-small Cell Lung Cancer
37 EGFR exon 19 deletion, A Randomized Phase II Study of Lung, Non-Small Cell II First line crizotinib
L858 Individualized Combined Modality Maintenance/Consolidation erlotinib
Therapy for Stage III Non-Small Cell Stage III
Lung Cancer (NSCLC)
38 EGFR activating mutation An Open-Label, Single-Center, Dose- Lung, Non-Small Cell I Second line or RTA-408
Escalation, Phase 1 Study of the greater/Refractory/Relapsed
Safety, Tolerability, Stage III
Pharmacodynamics, and Stage IV
Pharmacokinetics of RTA 408 in the
Treatment of Patients With
Metastatic Non-Small Cell Lung
Cancer
39 EGFR activating mutation EValuation of Erlotinib as a Lung, Non-Small Cell II Neoadjuvant erlotinib
Neoadjuvant Therapy in Stage III Non- Stage III
small Cell Lung Cancer Patients With
EGFR Mutations (EVENT Trial)
 1 ERBB2 Unspecified An Open-Label, Phase Ib Dose Breast I HER2 negative pimasertib
Escalation Trial of Oral Combination Colorectal Locally advanced XL-765
Therapy With MSC1936369B and Endometrial Metastatic
SAR245409 in Subjects With Locally Lung, Non-Small Cell Recurrent
Advanced or Metastatic Solid Tumors. Melanoma Second line or
Ovarian greater/Refractory/Relapsed
Pancreas Stage II
Renal Stage III
Thyroid Stage IV
Unspecified Solid Tumor Triple receptor negative
 2 ERBB2 Activating mutation A Phase II Study of Neratinib and Lung, Non-Small Cell II Second line or neratinib
Neratinib Plus Temsirolimus in greater/Refractory/Relapsed
Patients With Non-Small Cell Lung Stage III
Cancer Carrying Known HER2 Stage IV
ActivatingMutations.
 3 ERBB2 Unspecified A Phase I, First-in-Human, Dose Breast I Aggressive MSC-2363318A
Escalation Trial of MSC2363318A, a Lung, Non-Small Cell Classical
Dual p70S6K/Akt Inhibitor, in Subjects Lymphoma, Hodgkin's HER2 positive
With Advanced Malignancies Lymphoma, Non-Hodgkin's Indolent
Unspecified Solid Tumor Nodular lymphocyte-predominant
Second line or
greater/Refractory/Relapsed
Stage III
Stage IV
 1 FGFR3 Unspecified A Phase I, Open-label, Multi-center, Bladder I Second line or BGJ-398
Dose Escalation Study of Oral Breast greater/Refractory/Relapsed
BGJ398, a Pan FGF-R Kinase Inhibitor, Gastric Stage III
in Adult Patients With Advanced Solid Lung, Non-Small Cell Stage IV
Malignancies Lung, Small Cell
Unspecified Solid Tumor
 1 KRAS Unspecified A Phase I Dose Escalation Open-Label Breast I HER2 negative GSK-2141795
Safety and Pharmacokinetic Study to Colorectal Recurrent trametinib
Determine the Recommended Phase Endometrial Second line or
II Dose of GSK1120212 Dosed in Head/Neck greater/Refractory/Relapsed
Combination With GSK2141795 in Lung, Non-Small Cell Stage III
Subjects With Solid Tumors (Part 1) Melanoma Stage IV
and in Subjects With Pancreatic Ovarian Triple receptor negative
Cancer, Endometrial Cancer or Pancreas
Colorectal Cancer (Part 2) Thyroid
Unspecified Solid Tumor
 2 KRAS Unspecified An Open-Label, Phase Ib Dose Breast I HER2 negative pimasertib
Escalation Trial of Oral Combination Colorectal Locally advanced XL-765
Therapy With MSC1936369B and Endometrial Metastatic
SAR245409 in Subjects With Locally Lung, Non-Small Cell Recurrent
Advanced or Metastatic Solid Tumors. Melanoma Second line or
Ovarian greater/Refractory/Relapsed
Pancreas Stage II
Renal Stage III
Thyroid Stage IV
Unspecified Solid Tumor Triple receptor negative
 3 KRAS Unspecified A Phase Ib Open-label, Multi-center, Breast I HER2 negative ARRY-438162
Dose Escalation and Expansion Study Colorectal Second line or BYL-719
of Orally Administered MEK162 Plus Esophageal greater/Refractory/Relapsed
BYL719 in Adult Patients With Lung, Non-Small Cell Stage II
Selected Advanced Solid Tumors Melanoma Stage III
Pancreas Stage IV
Unspecified Solid Tumor Triple receptor negative
 4 KRAS Unspecified A Phase Ib/II Study of Retaspimycin Lung, Non-Small Cell I/II Second line or retaspimycin
HCI (IPI-504) in Combination With greater/Refractory/Relapsed
Everolimus in Patients With KRAS Stage III
Mutant NSCLC Stage IV
 5 KRAS Unspecified A Phase II Randomized Open-label Lung, Non-Small Cell II Second line or tivantinib
Study of Erlotinib Plus ARQ 197 greater/Refractory/Relapsed
Versus Single Agent Chemotherapy in Stage III
Previously Treated KRAS Mutation Stage IV
Positive Subjects With Locally
Advanced or Metastatic Non-Small
Cell Lung Cancer
 6 KRAS G12D A Phase II Trial of Bortezomib in KRAS- Lung, Non-Small Cell II Second line or bortezomib (SC)
Mutant Non-Small Cell Lung Cancer in greater/Refractory/Relapsed
Never Smokers or Those With KRAS Stage III
G12D Stage IV
 7 KRAS Unspecified A Phase I/1B Trial of MEK162 in Lung, Non-Small Cell I First line binimetinib
Combination With Erlotinib in Non- Second line or
Small Cell Lung Cancer (NSCLC) greater/Refractory/Relapsed
Harboring KRAS or EGFRMutation Stage IV
 8 KRAS G12/G13/Q61 A Phase I Study of Trametinib in Lung, Non-Small Cell I Maintenance/Consolidation 3D-CRT
Combination With Chemoradiation Stage II carboplatin (iv)
for KRAS Mutant Non-Small Cell Lung Stage III intensity-
Cancer modulated
radiation
therapy
paclitaxel
 9 KRAS Unspecified A Phase Ib, Open-Label Study Colorectal I First line cobimetinib
Evaluating the Safety, Tolerability, Lung, Non-Small Cell Second line or onartuzumab
and Pharmacokinetics of Melanoma greater/Refractory/Relapsed vemurafenib
Onartuzumab in Combination With Unspecified Solid Tumor Stage III
Vemurafenib and/or Cobimetinib in Stage IV
Patients with Advanced Solid
Malignancies
10 KRAS Unspecified A Phase Ib, Open-Label, Dose- Colorectal I Second line or cobimetinib
Escalation Study of The Safety, Lung, Non-Small Cell greater/Refractory/Relapsed MEHD-7945A
Tolerability, and Pharmacokinetics Of Unspecified Solid Tumor Stage III
MEHD7945A and GDC-0973 In Stage IV
Patients with Locally Advanced or
Metastatic Solid Tumors with Mutant
Kras
11 KRAS Unspecified A Phase Ib Study of the Safety and Colorectal I Second line or cobimetinib
Pharmacology of MPDL3280A Lung, Non-Small Cell greater/Refractory/Relapsed RG-7446
Administered with Cobimetinib in Melanoma Stage III
Patients with Locally Advanced or Unspecified Solid Tumor Stage IV
Metastatic Solid Tumors
12 KRAS Unspecified Phase II Study of VS-6063, A Focal Lung, Non-Small Cell II Second line or defactinib
Adhesion Kinase (FAK) Inhibitor, in greater/Refractory/Relapsed
Patients With KRAS Mutant Non- Stage IV
Small Cell Lung Cancer
13 KRAS Unspecified A Phase III, Double-Blind, Lung, Non-Small Cell III Second line or selumetinib
Randomised, Placebo-Controlled greater/Refractory/Relapsed (capsule)
Study to Assess the Efficacy and Stage III
Safety of Selumetinib (AZD6244; Stage IV
ARRY-142886) (Hyd-Sulfate) in
Combination With Docetaxel, in
Patients Receiving Second Line
Treatment for KRASMutation-
Positive Locally Advanced or
Metastatic Non Small Cell Lung
Cancer (Stage IIIB-IV) (SELECT 1)
SELumetinib Evaluation as
Combination Therapy-1 (SELECT-1)
14 KRAS G12R, G12C, A Phase Ib Dose-Escalation Study of Breast I HER2 positive lapatinib ditosylate
G12V, G12D, the AKT Inhibitor MK-2206 (NSC# Lung, Non-Small Cell Second line or MK-2206
G13 749607) Plus Lapatinib(NSC# 727989) Lung, Small Cell greater/Refractory/Relapsed
Administered in Patients With HER2 Unspecified Solid Tumor Stage III
Positive Metastatic Breast Cancer Stage IV
15 KRAS Unspecified Phase I/II Study of the CDK4/6 Lung, Non-Small Cell I/II Second line or palbociclib
Inhibitor Palbociclib (PD-0332991) in Unspecified Solid Tumor greater/Refractory/Relapsed PD-0325901
Combination With the MEK Inhibitor Stage III
PD-0325901 for Patients With KRAS Stage IV
Mutant Non-Small Cell Lung Cancer
and Other Solid Tumors
 2 MET Unspecified Phase I/II Safety, Pharmacokinetic (N/A) I/II Aggressive crizotinib
And Pharmacodynamic Study Of PF- Bladder First line
02341066, A c-Met/HGFR Selective CNS, Glioblastoma Locally advanced
Tyrosine Kinase Inhibitor, Colorectal Metastatic
Administered Orally To Patients With Gastric Peripheral T-cell lymphoma (PTCL)
Advanced Cancer Head/Neck Second line or
Lung, Non-Small Cell greater/Refractory/Relapsed
Lymphoma, Non-Hodgkin's Stage III
Ovarian Stage IV
Pancreas
Renal
Soft Tissue Sarcoma
 3 MET Unspecified A Randomized, Phase III, Multicenter, Lung, Non-Small Cell III First line onartuzumab
Double-blind, Placebo-controlled Stage III
Study Evaluating The Efficacy And Stage IV
Safety of Onartuzumab in
Combination with Erlotinib as First-
line treatment for patients with MET-
Positive unresectable stage IIIb or IV
non-small cell lung cancer (NSCLC)
carrying an activating EGFRMutation
 4 MET Unspecified A Phase I Open-label, Non- Bladder I Second line or EMD-1214063
randomized, Dose-escalation Lung, Non-Small Cell greater/Refractory/Relapsed
First-in-man Trial to Investigate Prostate Stage III
the c-Met Kinase Inhibitor EMD Unspecified Solid Tumor Stage IV
1214063 Under Two Different
Regimens in Subjects With
Advanced Solid Tumors.
 5 MET Unspecified Phase I Study of INC280 Plus Lung, Non-Small Cell I (N/A) INCB-028060
Erlotinib in Patients With C-Met Second line or
Expressing Non-Small Cell Lung greater/Refractory/Relapsed
Cancer
 1 NRAS Unspecified An Open-Label, Phase Ib Dose Breast I HER2 negative pimasertib
Escalation Trial of Oral Combination Colorectal Locally advanced XL-765
Therapy With MSC1936369B and Endometrial Metastatic
SAR245409 in Subjects With Locally Lung, Non-Small Cell Recurrent
Advanced or Metastatic Solid Tumors. Melanoma Second line or
Ovarian greater/Refractory/Relapsed
Pancreas Stage II
Renal Stage III
Thyroid Stage IV
Unspecified Solid Tumor Triple receptor negative
 2 NRAS Unspecified A Phase Ib Open-label, Multi-center, Breast I HER2 negative ARRY-438162
Dose Escalation and Expansion Study Colorectal Second line or BYL-719
of Orally Administered MEK162 Plus Esophageal greater/Refractory/Relapsed
BYL719 in Adult Patients With Lung, Non-Small Cell Stage II
Selected Advanced Solid Tumors Melanoma Stage III
Pancreas Stage IV
Unspecified Solid Tumor Triple receptor negative
 3 NRAS Unspecified A Phase Ib, Open-label, Multi-center, Breast I/II HER2 negative ARRY-438162
Dose-escalation and Expansion Study Colorectal Line of therapy N/A buparlisib
of an Orally Administered Lung, Non-Small Cell Stage II
Combination of BKM120 Plus Melanoma Stage III
MEK162 in Adult Patients With Pancreas Stage IV
Selected Advanced Solid Tumors Unspecified Solid Tumor Triple receptor negative
 1 PIK3CA Unspecified An Open-Label, Phase Ib Dose Breast I HER2 negative pimasertib
Escalation Trial of Oral Combination Colorectal Locally advanced XL-765
Therapy With MSC1936369B and Endometrial Metastatic
SAR245409 in Subjects With Locally Lung, Non-Small Cell Recurrent
Advanced or Metastatic Solid Tumors. Melanoma Second line or
Ovarian greater/Refractory/Relapsed
Pancreas Stage II
Renal Stage III
Thyroid Stage IV
Unspecified Solid Tumor Triple receptor negative
 2 PIK3CA Unspecified A Phase Ib Open-label, Multi-center, Breast I HER2 negative ARRY-438162
Dose Escalation and Expansion Study Colorectal Second line or BYL-719
of Orally Administered MEK162 Plus Esophageal greater/Refractory/Relapsed
BYL719 in Adult Patients With Lung, Non-Small Cell Stage II
Selected Advanced Solid Tumors Melanoma Stage III
Pancreas Stage IV
Unspecified Solid Tumor Triple receptor negative
 3 PIK3CA Unspecified An Open Label Two-stage Study of Lung, Non-Small Cell II Second line or buparlisib
Orally Administered BKM120 in greater/Refractory/Relapsed
Patients With Metastatic Non-small Stage IV
Cell Lung Cancer With Activated PI3K
Pathway
 4 PIK3CA E542K, E545K, A Phase I b Dose-Escalation Study Breast I HER2 positive lapatinib
H1047R, H1047L of the AKT Inhibitor MK-2206 Lung, Non-Small Cell Second line or MK-2206
(NSC# 749607) Plus Lung, Small Cell greater/Refractory/Relapsed
Lapatinib(NSC# 727989) Unspecified Solid Tumor Stage III
Administered in Patients With Stage IV
HER2 Positive Metastatic Breast
Cancer
 5 PIK3CA Unspecified Phase I/II Study of the CNS, Glioblastoma I/II Second line or buparlisib
Combination of BKM120 and Colorectal greater/Refractory/Relapsed
Bevacizumab in Patients With Lung, Non-Small Cell Stage III
Refractory Solid Tumors (Phase Unspecified Solid Tumor Stage IV
I) and Relapsed/Refractory
Glioblastoma Multiforme
(Phase II)
 6 PIK3CA Unspecified A Phase I, First-in-Human, Dose Breast I Aggressive MSC-2363318A
Escalation Trial of Lung, Non-Small Cell Classical
MSC2363318A, a Dual Lymphoma, Hodgkin's HER2 positive
p70S6K/Akt Inhibitor, in Subjects Lymphoma, Non-Hodgkin's Indolent
With Advanced Malignancies Unspecified Solid Tumor Nodular lymphocyte-predominant
Second line or
greater/Refractory/Relapsed
Stage III
Stage IV
 2 PTEN Unspecified An Open Label Two-stage Study of Lung, Non-Small Cell II Second line or buparlisib
Orally Administered BKM120 in greater/Refractory/Relapsed
Patients With Metastatic Non-small Stage IV
Cell Lung Cancer With Activated PI3K
Pathway
 3 PTEN Unspecified A Phase I, First-in-Human, Dose Breast I Aggressive MSC-2363318A
Escalation Trial of Lung, Non-Small Cell Classical
MSC2363318A, a Dual Lymphoma, Hodgkin's HER2 positive
p70S6K/Akt Inhibitor, in Subjects Lymphoma, Non-Hodgkin's Indolent
With Advanced Malignancies Unspecified Solid Tumor Nodular lymphocyte-predominant
Second line or
greater/Refractory/Relapsed
Stage III
Stage IV
 1 STK11 Unspecified A Phase I, First-in-Human, Dose Breast I Aggressive MSC-2363318A
(LKB1) Escalation Trial of Lung, Non-Small Cell Classical
MSC2363318A, a Dual Lymphoma, Hodgkin's HER2 positive
p70S6K/Akt Inhibitor, in Subjects Lymphoma, Non-Hodgkin's Indolent
With Advanced Malignancies Unspecified Solid Tumor Nodular lymphocyte-predominant
Second line or
greater/Refractory/Relapsed
Stage III
Stage IV
 1 ALK Fusion A Phase I, Multi-center, Open Label Breast I First line LDK-378
Dose Escalation Study of LDK378, Colorectal Locally advanced
Administered Orally in Adult Patients Lung, Non-Small Cell Metastatic
With Tumors Characterized by Soft Tissue Sarcoma Second line or
Genetic Abnormalities in Anaplastic Unspecified Solid Tumor greater/Refractory/Relapsed
Lymphoma Kinase (ALK) Stage III
Stage IV
Untreated
 2 ALK Fusion A Phase I, Open-Label, Multiple- (N/A) I Hormone refractory DS-2248
Ascending-Dose Study of DS-2248, an Lung, Non-Small Cell Second line or
Orally Bioavailable Heat Shock Prostate greater/Refractory/Relapsed
Unspecified Solid Tumor Stage III
Protein 90 Inhibitor, in Subjects With
Advanced Solid Tumors Stage IV
 3 ALK Fusion Phase I/II Safety, Pharmacokinetic (N/A) I/II Aggressive crizotinib
And Pharmacodynamic Study Of PF- Bladder First line
02341066, A c-Met/HGFR Selective CNS, Glioblastoma Locally advanced
Tyrosine Kinase Inhibitor, Colorectal Metastatic
Administered Orally To Patients With Gastric Peripheral T-cell lymphoma (PTCL)
Advanced Cancer Head/Neck Second line or
Lung, Non-Small Cell greater/Refractory/Relapsed
Lymphoma, Non-Hodgkin's Stage III
Ovarian Stage IV
Pancreas
Renal
Soft Tissue Sarcoma
 4 ALK Fusion A Phase I/II Study of the Safety, (N/A) I/II Aggressive AP-26113
Tolerability, Pharmacokinetics and Colorectal Classical
Preliminary Anti-Tumor Activity of Liver Diffuse large B-cell lymphoma (DLBCL)
the Oral ALK/EG FR Inhibitor AP26113 Lung, Non-Small Cell Nodular lymphocyte-predominant
Lymphoma, Hodgkin's Peripheral T-cell lymphoma (PTCL)
Lymphoma, Non-Hodgkin's Second line or
Pancreas greater/Refractory/Relapsed
Unspecified Solid Tumor Stage II
Stage III
Stage IV
 5 ALK Fusion A Phase I/II Study of Crizotinib and Lung, Non-Small Cell I/II First line ganetespib
STA-9090 in ALK Positive Lung Cancers Second line or
greater/Refractory/Relapsed
Stage III
Stage IV
 6 ALK Fusion An open-label, non-randomized, Lung, Non-Small Cell I/II First line alectinib
multicenter phase I/II trial of Second line or
RO5424802 given orally to non - greater/Refractory/Relapsed
small cell lung cancer patients who Stage III
have ALK mutation and failed Stage IV
crizotinib treatment
 7 ALK Fusion A Single Arm, Phase II Study of Lung, Non-Small Cell II Second line or ganetespib
Ganetespib in Subjects with greater/Refractory/Relapsed
Advanced Non-Small-Cell Lung Stage III
Cancer With Anaplastic Lymphoma Stage IV
Kinase Gene Rearrangement (ALK-
Positive NSCLC) Evaluating
CHaperone Inhibition in Alk
Rearranged lung cAncer-CHIARA
 8 ALK Fusion A Phase II, Multicenter, Single-arm Lung, Non-Small Cell II Second line or LDK-378
Study of Oral LDK378 in Crizotinib greater/Refractory/Relapsed
na    Adult Patients With ALK- Stage III
activated Non-small Cell Lung Cancer Stage IV
 9 ALK Fusion A Randomized Phase II Trial of Lung, Non-Small Cell II Second line or azacitidine (oral)
Cytotoxic Chemotherapy With or greater/Refractory/Relapsed azacitidine (sc)
Without Epigenetic Priming in Stage III entinostat
Patients With Advanced Non-Small Stage IV
Cell Lung Cancer.
10 ALK Fusion An Open-label, Multi-center, Lung, Non-Small Cell II Second line or LDK-378
Expanded Treatment Protocol (ETP) greater/Refractory/Relapsed
of Oral LDK378 in Adult Patients With Stage III
Non-small Cell Lung Cancer (NSCLC) Stage IV
Characterized by ALK(+)
Rearrangements in Patients
Previously Treated With an ALK
Inhibitor
11 ALK Fusion Molecular Determinants of Acquired Lung, Non-Small Cell Other Line of therapy N/A crizotinib
Clinical Resistance to Crizotinib in
Non-small Cell Lung Cancer Harboring
a Translocation or Inversion Event
Involving the ALK Gene Locus
12 ALK Fusion A Phase Ib, Open-label, Dose Lung, Non-Small Cell I Second line or AUY-922
Escalation Study of LDK378 and greater/Refractory/Relapsed LDK-378
AUY922 in Patients With ALK- Stage III
rearranged Non-small Cell Lung Stage IV
Cancer
13 ALK Fusion A Phase I/II Study of the ALK Inhibitor Lung, Non-Small Cell I/II Second line or alectinib
CH5424802/RO5424802 in Patients greater/Refractory/Relapsed hydrochloride
With ALK-Rearranged Non-Small Cell Stage III
Lung Cancer Previously Treated With Stage IV
Chemotherapy and Crizotinib
14 ALK Fusion A Phase II, Multicenter, Single-Arm Lung, Non-Small Cell II First line RG-7446
Study of MPDL3280A in Patients with Second line or
PD-L1-Positive Locally Advanced or greater/Refractory/Relapsed
Metastatic Non-small Cell Lung Stage III
Cancer Stage IV
15 ALK Fusion Phase IB Study of Single Agent MK- (N/A) I First line lambrolizumab
3475 in Patients With Progressive Colorectal Locally advanced
Locally Advanced or Metastatic Lung, Non-Small Cell Metastatic
Carcinoma, Melanoma, and Non- Melanoma Second line or
Small Cell Lung Carcinoma Osteosarcoma greater/Refractory/Relapsed
Soft Tissue Sarcoma Stage III
16 ALK Fusion A Phase I, Non-randomized, Open- Breast I Second line or ASP-3026
label, Repeat Oral Administration Colorectal greater/Refractory/Relapsed
Study of A5P3026 in Patients With Liver Stage III
Solid Tumors Lung, Non-Small Cell Stage IV
Soft Tissue Sarcoma
Unspecified Solid Tumor
17 ALK Fusion Phase II, Open-Label Single Arm Lung, Non-Small Cell II Second line or crizotinib (tablet)
Study Of The Efficacy And Safety Of greater/Refractory/Relapsed
PF-02341066 In Patients With Non- Stage III
Small Cell Lung Cancer Harboring A Stage IV
Translocation Or Inversion Event
Involving The Anaplastic Lymphoma
Kinase (ALK) Gene
18 ALK Fusion A Randomized Phase II Study of Lung, Non-Small Cell II First line crizotinib
Individualized Combined Modality Maintenance/Consolidation erlotinib
Therapy for Stage III Non-Small Cell Stage III
Lung Cancer (NSCLC)
19 ALK Fusion A Phase I/II Study of PF- (N/A) I/II (N/A) crizotinib
02341066, an Oral Small CNS, Glioblastoma Indolent
Molecule Inhibitor of Anaplastic CNS, Medulloblastoma Pediatric or Adolescent
Lymphoma Kinase (ALK) and c- CNS, Other Peripheral T-cell lymphoma (PTCL)
Met, in Children With Lung, Non-Small Cell Second line or
Relapsed/Refractory Solid Lymphoma, Non-Hodgkin's greater/Refractory/Relapsed
Tumors, Primary CNS Tumors, Unspecified Solid Tumor
and Anaplastic Large Cell
Lymphoma

TABLE 12
Row ID Gene Symbol Accession_number COSMIC_id CDS_mut_syntax AA_mut_syntax Oncomine Gene Classification Oncomine Variant Classification
1 AKT1 ENST00000349310 33765 c.49G>A p.E17K Gain of function Missense_Mutation
2 ALK NM_004304 28059 c.3521T>G p.F1174C Gain of function Missense_Mutation
3 ALK NM_004304 28491 c.3520T>A p.F1174I Gain of function Missense_Mutation
4 ALK NM_004304 28055 c.3522C>A p.F1174L Gain of function Missense_Mutation
5 ALK NM_004304 28057 c.3520T>C p.F1174L Gain of function Missense_Mutation
6 ALK NM_004304 28061 c.3522C>G p.F1174L Gain of function Missense_Mutation
7 ALK NM_004304 28054 c.3520T>G p.F1174V Gain of function Missense_Mutation
8 ALK NM_004304 99137 c.3586C>A p.L1196M Gain of function Missense_Mutation
9 ALK NM_004304 98478 c.3452C>T p.T1151M Gain of function Missense_Mutation
10 BRAF NM_004333 26625 c.1794_1795insGTT p.A598_T599insV Gain of function In_Frame_Ins
11 BRAF NM_004333 21549 c.1793C>T p.A598V Gain of function Missense_Mutation
12 BRAF NM_004333 467 c.1781A>G p.D594G Gain of function Missense_Mutation
13 BRAF NM_004333 27639 c.1780G>A p.D594N Gain of function Missense_Mutation
14 BRAF NM_004333 466 c.1781A>T p.D594V Gain of function Missense_Mutation
15 BRAF NM_004333 1118 c.1758A>G p.E586E Gain of function Synonymous_Mutation
16 BRAF NM_004333 463 c.1756G>A p.E586K Gain of function Missense_Mutation
17 BRAF NM_004333 1116 c.1749T>C p.F583F Gain of function Synonymous_Mutation
18 BRAF NM_004333 468 c.1785T>G p.F595L Gain of function Missense_Mutation
19 BRAF NM_004333 1123 c.1784T>C p.F595S Gain of function Missense_Mutation
20 BRAF NM_004333 449 c.1391G>A p.G464E Gain of function Missense_Mutation
21 BRAF NM_004333 450 c.1391G>T p.G464V Gain of function Missense_Mutation
22 BRAF NM_004333 26506 c.1787G>A p.G596D Gain of function Missense_Mutation
23 BRAF NM_004333 469 c.1786G>C p.G596R Gain of function Missense_Mutation
24 BRAF NM_004333 1137 c.1817G>A p.G606E Gain of function Missense_Mutation
25 BRAF NM_004333 1138 c.1823A>G p.H608R Gain of function Missense_Mutation
26 BRAF NM_004333 1115 c.1746A>G p.I582M Gain of function Missense_Mutation
27 BRAF NM_004333 1119 c.1776A>G p.I592M Gain of function Missense_Mutation
28 BRAF NM_004333 1120 c.1774A>G p.I592V Gain of function Missense_Mutation
29 BRAF NM_004333 478 c.1801A>G p.K601E Gain of function Missense_Mutation
30 BRAF NM_004333 1132 c.1803A>C p.K601N Gain of function Missense_Mutation
31 BRAF NM_004333 6265 c.1803A>T p.K601N Gain of function Missense_Mutation
32 BRAF NM_004333 28010 c.1750C>T p.L584F Gain of function Missense_Mutation
33 BRAF NM_004333 1125 c.1790T>A p.L597Q Gain of function Missense_Mutation
34 BRAF NM_004333 471 c.1790T>G p.L597R Gain of function Missense_Mutation
35 BRAF NM_004333 1126 c.1789_1790CT>TC p.L5975 Gain of function Missense_Mutation
36 BRAF NM_004333 470 c.1789C>G p.L597V Gain of function Missense_Mutation
37 BRAF NM_004333 462 c.1742A>G p.N581S Gain of function Splice_Site
38 BRAF NM_004333 21492 c.1357C>A p.P453T Gain of function Missense_Mutation
39 BRAF NM_004333 6262 c.1330C>T p.R444W Gain of function Missense_Mutation
40 BRAF NM_004333 447 c.1385G>T p.R462I Gain of function Missense_Mutation
41 BRAF NM_004333 1117 c.1752T>C p.L584L Gain of function Synonymous_Mutation
42 BRAF NM_004333 1124 c.1791A>G p.L597L Gain of function Synonymous_Mutation
43 BRAF NM_004333 33729 c.1807C>T p.R603* Gain of function NonsenseMutation
44 BRAF NM_004333 1135 c.1813_1814AG>TT p.S605F Gain of function Missense_Mutation
45 BRAF NM_004333 21542 c.1813A>G p.S605G Gain of function Missense_Mutation
46 BRAF NM_004333 1136 c.1814G>A p.S605N Gain of function Missense_Mutation
47 BRAF NM_004333 144982 c.1797_1798insACA p.T599_V600insT Gain of function In_Frame_Ins
48 BRAF NM_004333 30730 c.1796_1797insTAC p.T599_V600insT Gain of function In_Frame_Ins
49 BRAF NM_004333 1128 c.1797_1797A>TACTACG p.T599_V600insTT Gain of function In_Frame_Ins
50 BRAF NM_004333 472 c.1796C>T p.T599I Gain of function Missense_Mutation
51 BRAF NM_004333 1133 c.1799_1801delTGA p.V600_K601>E Gain of function In_Frame_Del
52 BRAF NM_004333 18443 c.1799T>C p.V600A Gain of function Missense_Mutation
53 BRAF NM_004333 477 c.1799_1800TG>AT p.V600D Gain of function Missense_Mutation
54 BRAF NM_004333 6137 c.1799T>G p.V600G Gain of function Missense_Mutation
55 BRAF NM_004333 473 c.1798_1799GT>AA p.V600K Gain of function Missense_Mutation
56 BRAF NM_004333 219798 c.1798G>C p.V600L Gain of function Missense_Mutation
57 BRAF NM_004333 33808 c.1798G>T p.V600L Gain of function Missense_Mutation
58 BRAF NM_004333 1130 c.1798G>A p.V600M Gain of function Missense_Mutation
59 BRAF NM_004333 249889 c.1798_1799GT>CA p.V600Q Gain of function Missense_Mutation
60 BRAF NM_004333 474 c.1798_1799GT>AG p.V600R Gain of function Missense_Mutation
61 BRAF NM_004333 6267 c.1808_1810delGAT p.W604del Gain of function In_Frame_Del
62 BRAF NM_004333 1134 c.1810T>G p.W604G Gain of function Missense_Mutation
63 BRAF NM_004333 453 c.1397G>A p.G466E Gain of function Missense_Mutation
64 BRAF NM_004333 1112 c.1396G>C p.G466R Gain of function Missense_Mutation
65 BRAF NM_004333 451 c.1397G>T p.G466V Gain of function Missense_Mutation
66 BRAF NM_004333 460 c.1406G>C p.G469L Gain of function Missense_Mutation
67 BRAF NM_004333 460 c.1406G>C p.G469A Gain of function Missense_Mutation
68 BRAF NM_004333 461 c.1406G>A p.G469E Gain of function Missense_Mutation
69 BRAF NM_004333 457 c.1405G>A p.G469R Gain of function Missense_Mutation
70 BRAF NM_004333 458 c.1405_1406GG>TC p.G469S Gain of function Missense_Mutation
71 BRAF NM_004333 459 c.1406G>T p.G469V Gain of function Missense_Mutation
72 BRAF NM_004333 475 c.1799_1800TG>AA p.V600E Gain of function Missense_Mutation
73 BRAF NM_004333 475 c.1799_1800TG>AA p.V600E Gain of function Missense_Mutation
74 BRAF NM_004333 475 c.1799_1800TG>AA p.V600E Gain of function Missense_Mutation
75 BRAF NM_004333 476 c.1799T>A p.V600E Gain of function Missense_Mutation
76 BRAF NM_004333 476 c.1799T>A p.V600E Gain of function Missense_Mutation
77 BRAF NM_004333 476 c.1799T>A p.V600E Gain of function Missense_Mutation
78 CTNNB1 NM_001904 5747 c.37G>A p.A13T Gain of function Missense_Mutation
79 CTNNB1 NM_001904 5702 c.59C>T p.A20V Gain of function Missense_Mutation
80 CTNNB1 NM_001904 5738 c.61G>A p.A21T Gain of function Missense_Mutation
81 CTNNB1 NM_001904 5753 c.116C>G p.A39G Gain of function Missense_Mutation
82 CTNNB1 NM_001904 5762 c.115G>A p.A39T Gain of function Missense_Mutation
83 CTNNB1 NM_001904 5744 c.127G>C p.A43P Gain of function Missense_Mutation
84 CTNNB1 NM_001904 5758 c.127G>A p.A43T Gain of function Missense_Mutation
85 CTNNB1 NM_001904 5699 c.128C>T p.A43V Gain of function Missense_Mutation
86 CTNNB1 NM_001904 5690 c.95A>C p.D32A Gain of function Missense_Mutation
87 CTNNB1 NM_001904 5681 c.95A>G p.D32G Gain of function Missense_Mutation
88 CTNNB1 NM_001904 5668 c.94G>C p.D32H Gain of function Missense_Mutation
89 CTNNB1 NM_001904 5672 c.94G>A p.D32N Gain of function Missense_Mutation
90 CTNNB1 NM_001904 5691 c.95A>T p.D32V Gain of function Missense_Mutation
91 CTNNB1 NM_001904 5661 c.94G>T p.D32Y Gain of function Missense_Mutation
92 CTNNB1 NM_001904 49161 c.43G>A p.E15K Gain of function Missense_Mutation
93 CTNNB1 NM_001904 5671 c.101G>A p.G34E Gain of function Missense_Mutation
94 CTNNB1 NM_001904 5684 c.100G>C p.G34R Gain of function Missense_Mutation
95 CTNNB1 NM_001904 5686 c.100G>A p.G34R Gain of function Missense_Mutation
96 CTNNB1 NM_001904 5670 c.101G>T p.G34V Gain of function Missense_Mutation
97 CTNNB1 NM_001904 5713 c.113G>A p.G38D Gain of function Missense_Mutation
98 CTNNB1 NM_001904 5678 c.107A>C p.H36P Gain of function Missense_Mutation
99 CTNNB1 NM_001904 27378 c.107A>G p.H36R Gain of function Missense_Mutation
100 CTNNB1 NM_001904 5703 c.106C>T p.H36Y Gain of function Missense_Mutation
101 CTNNB1 NM_001904 5674 c.104T>G p.135S Gain of function Missense_Mutation
102 CTNNB1 NM_001904 13168 c.104T>C p.I35T Gain of function Missense_Mutation
103 CTNNB1 NM_001904 5721 c.91C>T p.L31L Gain of function Synonymous_Mutation
104 CTNNB1 NM_001904 13175 c.138G>A p.L46L Gain of function Synonymous_Mutation
105 CTNNB1 NM_001904 17661 c.130C>G p.P44A Gain of function Missense_Mutation
106 CTNNB1 NM_001904 5761 c.131C>T p.P44L Gain of function Missense_Mutation
107 CTNNB1 NM_001904 5704 c.130C>T p.P44S Gain of function Missense_Mutation
108 CTNNB1 NM_001904 6057 c.67_99del33 p.S23_S33del Gain of function In_Frame_Del
109 CTNNB1 NM_001904 17941 c.67A>G p.S23G Gain of function Missense_Mutation
110 CTNNB1 NM_001904 5714 c.67A>C p.S23R Gain of function Missense_Mutation
111 CTNNB1 NM_001904 5694 c.86C>T p.S29F Gain of function Missense_Mutation
112 CTNNB1 NM_001904 5683 c.97T>G p.S33A Gain of function Missense_Mutation
113 CTNNB1 NM_001904 5677 c.98C>G p.S33C Gain of function Missense_Mutation
114 CTNNB1 NM_001904 5669 c.98C>T p.S33F Gain of function Missense_Mutation
115 CTNNB1 NM_001904 6098 c.97_98TC>CT p.S33L Gain of function Missense_Mutation
116 CTNNB1 NM_001904 6099 c.97_98TC>AA p.S33N Gain of function Missense_Mutation
117 CTNNB1 NM_001904 5682 c.97T>C p.S33P Gain of function Missense_Mutation
118 CTNNB1 NM_001904 5673 c.98C>A p.S33Y Gain of function Missense_Mutation
119 CTNNB1 NM_001904 5675 c.109T>G p.S37A Gain of function Missense_Mutation
120 CTNNB1 NM_001904 5679 c.110C>G p.S37C Gain of function Missense_Mutation
121 CTNNB1 NM_001904 5662 c.110C>T p.S37F Gain of function Missense_Mutation
122 CTNNB1 NM_001904 5687 c.109T>C p.S37P Gain of function Missense_Mutation
123 CTNNB1 NM_001904 5666 c.110C>A p.S37Y Gain of function Missense_Mutation
124 CTNNB1 NM_001904 5685 c.133T>G p.S45A Gain of function Missense_Mutation
125 CTNNB1 NM_001904 5689 c.134C>G p.S45C Gain of function Missense_Mutation
126 CTNNB1 NM_001904 5667 c.134C>T p.S45F Gain of function Missense_Mutation
127 CTNNB1 NM_001904 5663 c.133T>C p.S45P Gain of function Missense_Mutation
128 CTNNB1 NM_001904 5692 c.134C>A p.S45Y Gain of function Missense_Mutation
129 CTNNB1 NM_001904 5708 c.119C>T p.T40I Gain of function Missense_Mutation
130 CTNNB1 NM_001904 6140 c.120T>C p.T40T Gain of function Synonymous_Mutation
131 CTNNB1 NM_001904 5664 c.121A>G p.T41A Gain of function Missense_Mutation
132 CTNNB1 NM_001904 5676 c.122C>T p.T41I Gain of function Missense_Mutation
133 CTNNB1 NM_001904 5730 c.122C>A p.T41N Gain of function Missense_Mutation
134 CTNNB1 NM_001904 5688 c.121A>C p.T41P Gain of function Missense_Mutation
135 CTNNB1 NM_001904 5701 c.122C>G p.T41S Gain of function Missense_Mutation
136 CTNNB1 NM_001904 5716 c.121A>T p.T41S Gain of function Missense_Mutation
137 CTNNB1 NM_001904 5717 c.123C>T p.T41T Gain of function Synonymous_Mutation
138 CTNNB1 NM_001904 29289 c.125_126delCA p.T42fs*7 Gain of function Frame_Shift_Del
139 CTNNB1 NM_001904 5696 c.125C>T p.T42I Gain of function Missense_Mutation
140 CTNNB1 NM_001904 5732 c.125C>G p.T42R Gain of function Missense_Mutation
141 CTNNB1 NM_001904 6050 c.64_114del51 p.V22_G38del Gain of function In_Frame_Del
142 CTNNB1 NM_001904 6052 c.64_99del36 p.V22_S33del Gain of function In_Frame_Del
143 CTNNB1 NM_001904 5706 c.65T>C p.V22A Gain of function Missense_Mutation
144 CTNNB1 NM_001904 22566 c.64G>A p.V22I Gain of function Missense_Mutation
145 CTNNB1 NM_001904 6064 c.74_97del24 p.W25_D32del Gain of function In_Frame_Del
146 CTNNB1 NM_001904 5749 c.74G>T p.W25L Gain of function Missense_Mutation
147 CTNNB1 NM_001904 14256 c.73_96del24 p.WQQQSYLD25? Gain of function N/A
148 CTNNB1 NM_001904 34125 c.90C>G p.Y30* Gain of function NonsenseMutation
149 CTNNB1 NM_001904 6076 c.88_99del12 p.Y30_S33del Gain of function In_Frame_Del
150 DDR2_ENS ENST00000367922 173712 c.390C>T p.I130I Unclassified Synonymous_Mutation
151 DDR2_ENS ENST00000367922 94126 c.1783C>G p.L595V Unclassified Missense_Mutation
152 DDR2 NM_006182 48314 c.1367A>G p.N456S Unclassified Missense_Mutation
153 DDR2_ENS ENST00000367922 140388 c.691C>A p.Q231K Unclassified Missense_Mutation
154 DDR2 NM_006182 12821 c.313C>A p.R105S Unclassified Missense_Mutation
155 DDR2 NM_006182 140390 c.1598C>A p.T533K Unclassified Missense_Mutation
156 DDR2_ENS ENST00000367922 140389 c.1598C>A p.T533K Unclassified Missense_Mutation
157 EGFR NM_005228 236670 c.1476C>A p.S492R Gain of function Missense_Mutation
158 EGFR NM_005228 41905 c.2092G>A p.A698T Gain of function Missense_Mutation
159 EGFR NM_005228 28508 c.2104G>T p.A702S Gain of function Missense_Mutation
160 EGFR NM_005228 13427 c.2126A>C p.E709A Gain of function Missense_Mutation
161 EGFR NM_005228 13009 c.2126A>G p.E709G Gain of function Missense_Mutation
162 EGFR NM_005228 12988 c.2125G>A p.E709K Gain of function Missense_Mutation
163 EGFR NM_005228 12371 c.2126A>T p.E709V Gain of function Missense_Mutation
164 EGFR NM_005228 41603 c.2134T>C p.F712L Gain of function Missense_Mutation
165 EGFR NM_005228 28601 c.2135T>C p.F712S Gain of function Missense_Mutation
166 EGFR NM_005228 6239 c.2156G>C p.G719A Gain of function Missense_Mutation
167 EGFR NM_005228 6239 c.2156G>C p.G719A Gain of function Missense_Mutation
168 EGFR NM_005228 6239 c.2156G>C p.G719A Gain of function Missense_Mutation
169 EGFR NM_005228 18441 c.2154_2155GG>TT p.G719C Gain of function Missense_Mutation
170 EGFR NM_005228 18441 c.2154_2155GG>TT p.G719C Gain of function Missense_Mutation
171 EGFR NM_005228 18441 c.2154_2155GG>TT p.G719C Gain of function Missense_Mutation
172 EGFR NM_005228 6253 c.2155G>T p.G719C Gain of function Missense_Mutation
173 EGFR NM_005228 6253 c.2155G>T p.G719C Gain of function Missense_Mutation
174 EGFR NM_005228 6253 c.2155G>T p.G719C Gain of function Missense_Mutation
175 EGFR NM_005228 18425 c.2156G>A p.G719D Gain of function Missense_Mutation
176 EGFR NM_005228 18425 c.2156G>A p.G719D Gain of function Missense_Mutation
177 EGFR NM_005228 18425 c.2156G>A p.G719D Gain of function Missense_Mutation
178 EGFR NM_005228 6252 c.2155G>A p.G719S Gain of function Missense_Mutation
179 EGFR NM_005228 6252 c.2155G>A p.G719S Gain of function Missense_Mutation
180 EGFR NM_005228 6252 c.2155G>A p.G719S Gain of function Missense_Mutation
181 EGFR NM_005228 28510 c.2162G>C p.G721A Gain of function Missense_Mutation
182 EGFR NM_005228 22992 c.2161G>A p.G721S Gain of function Missense_Mutation
183 EGFR NM_005228 13979 c.2170G>A p.G724S Gain of function Missense_Mutation
184 EGFR NM_005228 28511 c.2108T>C p.L703P Gain of function Missense_Mutation
185 EGFR NM_005228 12373 c.2159C>T p.S720F Gain of function Missense_Mutation
186 EGFR NM_005228 26509 c.2227G>A p.A743T Gain of function Missense_Mutation
187 EGFR NM_005228 27042 c.2282A>G p.D761G Gain of function Missense_Mutation
188 EGFR NM_005228 21984 c.2281G>T p.D761Y Gain of function Missense_Mutation
189 EGFR NM_005228 13184 c.2236G>A p.E746K Gain of function Missense_Mutation
190 EGFR NM_005228 13182 c.2203G>A p.G735S Gain of function Missense_Mutation
191 EGFR NM_005228 85993 c.2260A>G p.K754E Gain of function Missense_Mutation
192 EGFR NM_005228 24267 c.2239_2240TT>CC p.L747P Gain of function Missense_Mutation
193 EGFR NM_005228 26704 c.2240T>C p.L747S Gain of function Missense_Mutation
194 EGFR NM_005228 13181 c.2198C>T p.P733L Gain of function Missense_Mutation
195 EGFR NM_005228 53194 c.2197C>T p.P733S Gain of function Missense_Mutation
196 EGFR NM_005228 17570 c.2222C>T p.P741L Gain of function Missense_Mutation
197 EGFR NM_005228 6268 c.2257C>T p.P7535 Gain of function Missense_Mutation
198 EGFR NM_005228 29274 c.2254T>C p.S752P Gain of function Missense_Mutation
199 EGFR NM_005228 13185 c.2252C>T p.T751I Gain of function Missense_Mutation
200 EGFR NM_005228 27041 c.2213T>G p.V738G Gain of function Missense_Mutation
201 EGFR NM_005228 13432 c.2193G>A p.W731* Gain of function Nonsense_Mutation
202 EGFR NM_005228 6223 c.2235_2249del15 p.E746_A750del Gain of function In_Frame_Del
203 EGFR NM_005228 6223 c.2235_2249del15 p.E746_A750del Gain of function In_Frame_Del
204 EGFR NM_005228 6223 c.2235_2249del15 p.E746_A750del Gain of function In_Frame_Del
205 EGFR NM_005228 6225 c.2236_2250del15 p.E746_A750del Gain of function In_Frame_Del
206 EGFR NM_005228 6225 c.2236_2250del15 p.E746_A750del Gain of function In_Frame_Del
207 EGFR NM_005228 6225 c.2236_2250del15 p.E746_A750del Gain of function In_Frame_Del
208 EGFR NM_005228 28517 c.2235_2246del12 p.E746_E749del Gain of function In_Frame_Del
209 EGFR NM_005228 28517 c.2235_2246del12 p.E746_E749del Gain of function In_Frame_Del
210 EGFR NM_005228 28517 c.2235_2246del12 p.E746_E749del Gain of function In_Frame_Del
211 EGFR NM_005228 12367 c.2237_2254del18 p.E746_S752>A Gain of function In_Frame_Del
212 EGFR NM_005228 12367 c.2237_2254del18 p.E746_S752>A Gain of function In_Frame_Del
213 EGFR NM_005228 12367 c.2237_2254del18 p.E746_S752>A Gain of function In_Frame_Del
214 EGFR NM_005228 6220 c.2238_2255del18 p.E746_S752>D Gain of function In_Frame_Del
215 EGFR NM_005228 6220 c.2238_2255del18 p.E746_S752>D Gain of function In_Frame_Del
216 EGFR NM_005228 6220 c.2238_2255del18 p.E746_S752>D Gain of function In_Frame_Del
217 EGFR NM_005228 12384 c.2237_2255>T p.E746_S752>V Gain of function In_Frame_Del
218 EGFR NM_005228 12384 c.2237_2255>T p.E746_S752>V Gain of function In_Frame_Del
219 EGFR NM_005228 12384 c.2237_2255>T p.E746_S752>V Gain of function In_Frame_Del
220 EGFR NM_005228 133189 c.2236_2256del21 p.E746_S752del Gain of function In_Frame_Del
221 EGFR NM_005228 133189 c.2236_2256del21 p.E746_S752del Gain of function In_Frame_Del
222 EGFR NM_005228 133189 c.2236_2256del21 p.E746_S752del Gain of function In_Frame_Del
223 EGFR NM_005228 12678 c.2237_2251del15 p.E746_T751>A Gain of function In_Frame_Del
224 EGFR NM_005228 12678 c.2237_2251del15 p.E746_T751>A Gain of function In_Frame_Del
225 EGFR NM_005228 12678 c.2237_2251del15 p.E746_T751>A Gain of function In_Frame_Del
226 EGFR NM_005228 12386 c.2237_2252>T p.E746_T751>V Gain of function In_Frame_Del
227 EGFR NM_005228 12386 c.2237_2252>T p.E746_T751>V Gain of function In_Frame_Del
228 EGFR NM_005228 12386 c.2237_2252>T p.E746_T751>V Gain of function In_Frame_Del
229 EGFR NM_005228 12728 c.2236_2253del18 p.E746_T751del Gain of function In_Frame_Del
230 EGFR NM_005228 12728 c.2236_2253del18 p.E746_T751del Gain of function In_Frame_Del
231 EGFR NM_005228 12728 c.2236_2253del18 p.E746_T751del Gain of function In_Frame_Del
232 EGFR NM_005228 26038 c.2233_2247del15 p.K745_E749del Gain of function In_Frame_Del
233 EGFR NM_005228 26038 c.2233_2247del15 p.K745_E749del Gain of function In_Frame_Del
234 EGFR NM_005228 26038 c.2233_2247del15 p.K745_E749del Gain of function In_Frame_Del
235 EGFR NM_005228 12382 c.2239_2248TTAAGAGAAG>C p.L747_A750>P Gain of function In_Frame_Del
236 EGFR NM_005228 12382 c.2239_2248TTAAGAGAAG>C p.L747_A750>P Gain of function In_Frame_Del
237 EGFR NM_005228 12382 c.2239_2248TTAAGAGAAG>C p.L747_A750>P Gain of function In_Frame_Del
238 EGFR NM_005228 6218 c.2239_2247del9 p.L747_E749del Gain of function In_Frame_Del
239 EGFR NM_005228 6218 c.2239_2247del9 p.L747_E749del Gain of function In_Frame_Del
240 EGFR NM_005228 6218 c.2239_2247del9 p.L747_E749del Gain of function In_Frame_Del
241 EGFR NM_005228 12370 c.2240_2257del18 p.L747_P753>S Gain of function In_Frame_Del
242 EGFR NM_005228 12370 c.2240_2257del18 p.L747_P753>S Gain of function In_Frame_Del
243 EGFR NM_005228 12370 c.2240_2257del18 p.L747_P753>S Gain of function In_Frame_Del
244 EGFR NM_005228 133197 c.2239_2257>T p.L747_P753>S Gain of function In_Frame_Del
245 EGFR NM_005228 133197 c.2239_2257>T p.L747_P753>S Gain of function In_Frame_Del
246 EGFR NM_005228 133197 c.2239_2257>T p.L747_P753>S Gain of function In_Frame_Del
247 EGFR NM_005228 6255 c.2239_2256del18 p.L747_S752del Gain of function In_Frame_Del
248 EGFR NM_005228 6255 c.2239_2256del18 p.L747_S752del Gain of function In_Frame_Del
249 EGFR NM_005228 6255 c.2239_2256del18 p.L747_S752del Gain of function In_Frame_Del
250 EGFR NM_005228 12383 c.2239_2251>C p.L747_T751>P Gain of function In_Frame_Del
251 EGFR NM_005228 12383 c.2239_2251>C p.L747_T751>P Gain of function In_Frame_Del
252 EGFR NM_005228 12383 c.2239_2251>C p.L747_T751>P Gain of function In_Frame_Del
253 EGFR NM_005228 6210 c.2240_2251del12 p.L747_T751>S Gain of function In_Frame_Del
254 EGFR NM_005228 6210 c.2240_2251del12 p.L747_T751>S Gain of function In_Frame_Del
255 EGFR NM_005228 6210 c.2240_2251del12 p.L747_T751>S Gain of function In_Frame_Del
256 EGFR NM_005228 12369 c.2240_2254del15 p.L747_T751del Gain of function In_Frame_Del
257 EGFR NM_005228 12369 c.2240_2254del15 p.L747_T751del Gain of function In_Frame_Del
258 EGFR NM_005228 12369 c.2240_2254del15 p.L747_T751del Gain of function In_Frame_Del
259 EGFR NM_005228 23571 c.2238_2252del15 p.L747_T751del Gain of function In_Frame_Del
260 EGFR NM_005228 23571 c.2238_2252del15 p.L747_T751del Gain of function In_Frame_Del
261 EGFR NM_005228 23571 c.2238_2252del15 p.L747_T751del Gain of function In_Frame_Del
262 EGFR NM_005228 6254 c.2239_2253del15 p.L747_T751del Gain of function In_Frame_Del
263 EGFR NM_005228 6254 c.2239_2253del15 p.L747_T751del Gain of function In_Frame_Del
264 EGFR NM_005228 6254 c.2239_2253del15 p.L747_T751del Gain of function In_Frame_Del
265 EGFR NM_005228 13556 c.2253_2276del24 p.S752_I759del Gain of function In_Frame_Del
266 EGFR NM_005228 13556 c.2253_2276del24 p.S752_I759del Gain of function In_Frame_Del
267 EGFR NM_005228 13556 c.2253_2276del24 p.S752_I759del Gain of function In_Frame_Del
268 EGFR NM_005228 6256 c.2254_2277del24 p.S752_I759del Gain of function In_Frame_Del
269 EGFR NM_005228 6256 c.2254_2277del24 p.S752_I759del Gain of function In_Frame_Del
270 EGFR NM_005228 6256 c.2254_2277del24 p.S752_I759del Gain of function In_Frame_Del
271 EGFR NM_005228 96856 c.2252_2276>A p.T751_I759>N Gain of function In_Frame_Del
272 EGFR NM_005228 96856 c.2252_2276>A p.T751_I759>N Gain of function In_Frame_Del
273 EGFR NM_005228 96856 c.2252_2276>A p.T751_I759>N Gain of function In_Frame_Del
274 EGFR NM_005228 133207 c.2252_2275del24 p.T751_I759del Gain of function In_Frame_Del
275 EGFR NM_005228 133207 c.2252_2275del24 p.T751_I759del Gain of function In_Frame_Del
276 EGFR NM_005228 133207 c.2252_2275del24 p.T751_I759del Gain of function In_Frame_Del
277 EGFR NM_005228 26445 c.2300C>T p.A767V Gain of function Missense_Mutation
278 EGFR NM_005228 22954 c.2324G>A p.C775Y Gain of function Missense_Mutation
279 EGFR NM_005228 14068 c.2308G>A p.D770N Gain of function Missense_Mutation
280 EGFR NM_005228 22951 c.2384T>C p.F795S Gain of function Missense_Mutation
281 EGFR NM_005228 13007 c.2335_2336GG>TT p.G779F Gain of function Missense_Mutation
282 EGFR NM_005228 27568 c.2387G>C p.G796A Gain of function Missense_Mutation
283 EGFR NM_005228 133565 c.2387G>A p.G796D Gain of function Missense_Mutation
284 EGFR NM_005228 20891 c.2386G>A p.G796S Gain of function Missense_Mutation
285 EGFR NM_005228 13005 c.2318A>T p.H773L Gain of function Missense_Mutation
286 EGFR NM_005228 13433 c.2318A>G p.H773R Gain of function Missense_Mutation
287 EGFR NM_005228 13190 c.2375T>C p.L792P Gain of function Missense_Mutation
288 EGFR NM_005228 6226 c.2326C>T p.R776C Gain of function Missense_Mutation
289 EGFR NM_005228 22940 c.2327G>A p.R776H Gain of function Missense_Mutation
290 EGFR NM_005228 6241 c.2303G>T p.S768I Gain of function Missense_Mutation
291 EGFR NM_005228 13189 c.2351C>T p.S784F Gain of function Missense_Mutation
292 EGFR NM_005228 28513 c.2350T>C p.S784P Gain of function Missense_Mutation
293 EGFR NM_005228 6240 c.2369C>T p.T790M Gain of function Missense_Mutation
294 EGFR NM_005228 6240 c.2369C>T p.T790M Gain of function Missense_Mutation
295 EGFR NM_005228 6240 c.2369C>T p.T790M Gain of function Missense_Mutation
296 EGFR NM_005228 6240 c.2369C>T p.T790M Gain of function Missense_Mutation
297 EGFR NM_005228 6240 c.2369C>T p.T790M Gain of function Missense_Mutation
298 EGFR NM_005228 6240 c.2369C>T p.T790M Gain of function Missense_Mutation
299 EGFR NM_005228 28603 c.2293G>A p.V765M Gain of function Missense_Mutation
300 EGFR NM_005228 6242 c.2305G>T p.V769L Gain of function Missense_Mutation
301 EGFR NM_005228 13006 c.2320G>A p.V774M Gain of function Missense_Mutation
302 EGFR NM_005228 27110 c.2356G>A p.V786M Gain of function Missense_Mutation
303 EGFR NM_005228 12378 c.2310_2311insGGT p.D770_N771insG Gain of function In_Frame_Ins
304 EGFR NM_005228 12378 c.2310_2311insGGT p.D770_N771insG Gain of function In_Frame_Ins
305 EGFR NM_005228 12378 c.2310_2311insGGT p.D770_N771insG Gain of function In_Frame_Ins
306 EGFR NM_005228 48922 c.2311_2312insGCGTGGACA p.D770_N771insSVD Gain of function In_Frame_Ins
307 EGFR NM_005228 48922 c.2311_2312insGCGTGGACA p.D770_N771insSVD Gain of function In_Frame_Ins
308 EGFR NM_005228 48922 c.2311_2312insGCGTGGACA p.D770_N771insSVD Gain of function In_Frame_Ins
309 EGFR NM_005228 12427 c.2308_2309insGTT p.D770>GY Gain of function In_Frame_Ins
310 EGFR NM_005228 12427 c.2308_2309insGTT p.D770>GY Gain of function In_Frame_Ins
311 EGFR NM_005228 12427 c.2308_2309insGTT p.D770>GY Gain of function In_Frame_Ins
312 EGFR NM_005228 12377 c.2319_2320insCAC p.H773_V774insH Gain of function In_Frame_Ins
313 EGFR NM_005228 12377 c.2319_2320insCAC p.H773_V774insH Gain of function In_Frame_Ins
314 EGFR NM_005228 12377 c.2319_2320insCAC p.H773_V774insH Gain of function In_Frame_Ins
315 EGFR NM_005228 12675 c.2575G>A p.A859T Gain of function Missense_Mutation
316 EGFR NM_005228 13197 c.2590G>A p.A864T Gain of function Missense_Mutation
317 EGFR NM_005228 13008 c.2612C>G p.A871G Gain of function Missense_Mutation
318 EGFR NM_005228 28605 c.2611G>A p.A871T Gain of function Missense_Mutation
319 EGFR NM_005228 28607 c.2603A>G p.E868G Gain of function Missense_Mutation
320 EGFR NM_005228 14070 c.2588G>A p.G863D Gain of function Missense_Mutation
321 EGFR NM_005228 13199 c.2618G>A p.G873E Gain of function Missense_Mutation
322 EGFR NM_005228 26438 c.2620G>A p.G874S Gain of function Missense_Mutation
323 EGFR NM_005228 33725 c.2609A>G p.H870R Gain of function Missense_Mutation
324 EGFR NM_005228 53292 c.2608C>T p.H870Y Gain of function Missense_Mutation
325 EGFR NM_005228 26129 c.2572C>T p.L858L Gain of function Synonymous_Mutation
326 EGFR NM_005228 12366 c.2572C>A p.L858M Gain of function Missense_Mutation
327 EGFR NM_005228 12429 c.2573_2574TG>GT p.L858R Gain of function Missense_Mutation
328 EGFR NM_005228 12429 c.2573_2574TG>GT p.L858R Gain of function Missense_Mutation
329 EGFR NM_005228 12429 c.2573_2574TG>GT p.L858R Gain of function Missense_Mutation
330 EGFR NM_005228 6224 c.2573T>G p.L858R Gain of function Missense_Mutation
331 EGFR NM_005228 6224 c.2573T>G p.L858R Gain of function Missense_Mutation
332 EGFR NM_005228 6224 c.2573T>G p.L858R Gain of function Missense_Mutation
333 EGFR NM_005228 6213 c.2582T>A p.L861Q Gain of function Missense_Mutation
334 EGFR NM_005228 6213 c.2582T>A p.L861Q Gain of function Missense_Mutation
335 EGFR NM_005228 12374 c.2582T>G p.L861R Gain of function Missense_Mutation
336 EGFR NM_005228 12374 c.2582T>G p.L861R Gain of function Missense_Mutation
337 ERBB2 NM_004448 13170 c.2305G>C p.D769H Gain of function Missense_Mutation
338 ERBB2 NM_004448 51317 c.2301C>G p.I767M Gain of function Missense_Mutation
339 ERBB2 NM_004448 683 c.2263_2264TT>CC p.L755P Gain of function Missense_Mutation
340 ERBB2 NM_004448 14060 c.2264T>C p.L755S Gain of function Missense_Mutation
341 ERBB2 NM_004448 18609 c.2327G>T p.G776V Gain of function Missense_Mutation
342 ERBB2 NM_004448 35496 c.2330T>C p.V777A Gain of function Missense_Mutation
343 ERBB2 NM_004448 14062 c.2329G>T p.V777L Gain of function Missense_Mutation
344 ERBB2 NM_004448 12552 c.2326_2327insTTT p.G776>VC Gain of function In_Frame_Ins
345 ERBB2 NM_004448 12552 c.2326_2327insTTT p.G776>VC Gain of function In_Frame_Ins
346 ERBB2 NM_004448 12553 c.2326_2327insTGT p.G776>VC Gain of function In_Frame_Ins
347 ERBB2 NM_004448 12553 c.2326_2327insTGT p.G776>VC Gain of function In_Frame_Ins
348 ERBB2 NM_004448 26681 c.2333_2334insGGG p.G778_S779insG Gain of function In_Frame_Ins
349 ERBB2 NM_004448 26681 c.2333_2334insGGG p.G778_S779insG Gain of function In_Frame_Ins
350 ERBB2 NM_004448 21985 c.2632C>T p.H878Y Gain of function Missense_Mutation
351 ERBB2 NM_004448 14065 c.2524G>A p.V842I Gain of function Missense_Mutation
352 ERBB4 NM_005235 95705 c.421+1G>T p.? Gain of N/A
353 ERBB4 NM_005235 48364 c.1784A>T p.D595V Gain of Missense_Mutation
354 ERBB4 NM_005235 131772 c.1825G>A p.D609N Gain of Missense_Mutation
355 ERBB4 NM_005235 131765 c.949G>A p.E317K Gain of Missense_Mutation
356 ERBB4 NM_005235 170797 c.1748T>A p.F583Y Gain of Missense_Mutation
357 ERBB4 NM_005235 108015 c.2806G>A p.G936R Gain of Missense_Mutation
358 ERBB4 NM_005235 160825 c.885T>G p.H295Q Gain of Missense_Mutation
359 ERBB4 NM_005235 48363 c.1853A>C p.H618P Gain of Missense_Mutation
360 ERBB4 NM_005235 96313 c.1852C>T p.H618Y Gain of Missense_Mutation
361 ERBB4 NM_005235 131764 c.939G>A p.M313I Gain of Missense_Mutation
362 ERBB4 NM_005235 48369 c.542A>G p.N181S Gain of Missense_Mutation
363 ERBB4 NM_005235 138342 c.1856C>T p.P619L Gain of Missense_Mutation
364 ERBB4 NM_005235 48366 c.916C>A p.R3065 Gain of Missense_Mutation
365 ERBB4 NM_005235 232263 c.1835G>A p.R612Q Gain of Missense_Mutation
366 ERBB4 NM_005235 12833 c.908C>A p.S303Y Gain of Missense_Mutation
367 ERBB4 NM_005235 110095 c.1022C>T p.S341L Gain of Missense_Mutation
368 ERBB4 NM_005235 20392 c.419C>T p.T140I Gain of Missense_Mutation
369 ERBB4 NM_005235 48368 c.731C>G p.T244R Gain of Missense_Mutation
370 ERBB4 NM_005235 209862 c.803A>G p.Y268C Gain of Missense_Mutation
371 ERBB4 NM_005235 48367 c.854A>G p.Y285C Gain of Missense_Mutation
372 FBXW7 NM_033632.1 22971 c.832C>T p.R278* Loss of Function Nonsense_Mutation
373 FBXW7 NM_033632.1 22973 c.1177C>T p.R393* Loss of Function Nonsense_Mutation
374 FBXW7 NM_033632.1 22932 c.1393C>T p.R465C Loss of Function Missense_Mutation
375 FBXW7 NM_033632.1 22965 c.1394G>A p.R465H Loss of Function Missense_Mutation
376 FBXW7 NM_033632.1 33762 c.1394G>T p.R465L Loss of Function Missense_Mutation
377 FBXW7 NM_033632.1 133115 c.1393_1394CG>TA p.R465Y Loss of Function Missense_Mutation
378 FBXW7 NM_033632.1 22975 c.1513C>T p.R505C Loss of Function Missense_Mutation
379 FBXW7 NM_033632.1 99604 c.1513C>G p.R505G Loss of Function Missense_Mutation
380 FBXW7 NM_033632.1 25812 c.1514G>A p.R505H Loss of Function Missense_Mutation
381 FBXW7 NM_033632.1 23000 c.1514G>T p.R505L Loss of Function Missense_Mutation
382 FBXW7 NM_033632.1 22979 c.1745C>T p.S582L Loss of Function Missense_Mutation
383 FBXW7 NM_033632.1 27055 c.1510G>A p.V504I Loss of Function Missense_Mutation
384 FBXW7_EN ENST00000281708 170727 c.1393C>T p.R465C Loss of Function Missense_Mutation
385 FBXW7_EN ENST00000281708 117310 c.1394G>A p.R465H Loss of Function Missense_Mutation
386 FBXW7_EN ENST00000281708 108572 c.1513C>T p.R505C Loss of Function Missense_Mutation
387 FBXW7_EN ENST00000281708 99606 c.1513C>G p.R505G Loss of Function Missense_Mutation
388 FBXW7_EN ENST00000534231 170726 c.676C>T p.R226C Loss of Function Missense_Mutation
389 FBXW7_EN ENST00000534231 117309 c.677G>A p.R226H Loss of Function Missense_Mutation
390 FBXW7_EN ENST00000534231 108571 c.796C>T p.R266C Loss of Function Missense_Mutation
391 FBXW7_EN ENST00000534231 99605 c.796C>G p.R266G Loss of Function Missense_Mutation
392 FBXW7_N NM_018315.2 170725 c.1153C>T p.R385C Loss of Function Missense_Mutation
393 FBXW7_N NM_018315.2 117308 c.1154G>A p.R385H Loss of Function Missense_Mutation
394 FBXW7_N NM_018315.2 74637 c.1273C>T p.R425C Loss of Function Missense_Mutation
395 FBXW7_N NM_018315.2 99603 c.1273C>G p.R425G Loss of Function Missense_Mutation
396 FGFR1 NM_000604 98903 c.397G>A p.D133N Unclassified Missense_Mutation
397 FGFR1 NM_000604 187237 c.448C>T p.P150S Unclassified Missense_Mutation
398 FGFR1 NM_000604 12834 c.754C>A p.P252T Unclassified Missense_Mutation
399 FGFR1 NM_000604 601 c.374C>T p.S125L Unclassified Missense_Mutation
400 FGFR1 NM_000604 48380 c.422C>G p.T141R Unclassified Missense_Mutation
401 FGFR1_EN ENST00000425967 98901 c.130G>A p.D44N Unclassified Missense_Mutation
402 FGFR1_EN ENST00000425967 187239 c.181C>T p.P61S Unclassified Splice_Site
403 FGFR1_EN ENST00000447712 98902 c.397G>A p.D133N Unclassified Missense_Mutation
404 FGFR2 NM_000141.2 36906 c.1144T>C p.C382R Gain of function Missense_Mutation
405 FGFR2 NM_000141.2 36901 c.929A>G p.K310R Gain of function Missense_Mutation
406 FGFR2 NM_000141.2 36902 c.1647T>G p.N549K Gain of function Missense_Mutation
407 FGFR2 NM_000141.2 36912 c.1647T>A p.N549K Gain of function Missense_Mutation
408 FGFR2 NM_000141.2 49170 c.758C>G p.P253R Gain of function Missense_Mutation
409 FGFR2 NM_000141.2 36903 c.755C>G p.S252W Gain of function Missense_Mutation
410 FGFR2 NM_000141.2 36904 c.1124A>G p.Y375C Gain of function Missense_Mutation
411 FGFR3 NM_000142 722 c.1107G>T p.A369A Gain of function Synonymous_Mutation
412 FGFR3 NM_000142 721 c.1172C>A p.A391E Gain of function Missense_Mutation
413 FGFR3 NM_000142 29438 c.1921G>A p.D641N Gain of function Missense_Mutation
414 FGFR3 NM_000142 27139 c.2349_2350delAG p.D785fs*23 Gain of function Frame_Shift_Ins
415 FGFR3 NM_000142 724 c.1150T>C p.F384L Gain of function Missense_Mutation
416 FGFR3 NM_000142 716 c.1108G>T p.G370C Gain of function Missense_Mutation
417 FGFR3 NM_000142 24842 c.1138G>A p.G380R Gain of function Missense_Mutation
418 FGFR3 NM_000142 24802 c.2089G>T p.G697C Gain of function Missense_Mutation
419 FGFR3 NM_000142 29446 c.753C>T p.H251H Gain of function Synonymous_Mutation
420 FGFR3 NM_000142 719 c.1948A>G p.K650E Gain of function Missense_Mutation
421 FGFR3 NM_000142 720 c.1949A>T p.K650M Gain of function Missense_Mutation
422 FGFR3 NM_000142 726 c.1948A>C p.K650Q Gain of function Missense_Mutation
423 FGFR3 NM_000142 731 c.1949A>C p.K650T Gain of function Missense_Mutation
424 FGFR3 NM_000142 729 c.2381_2381T>GA p.L794fs*23 Gain of function Frame_Shift_Ins
425 FGFR3 NM_000142 725 c.2382_2421+2del42 p.P795fs*139 Gain of function Frame_Shift_Ins
426 FGFR3 NM_000142 714 c.742C>T p.R248C Gain of function Missense_Mutation
427 FGFR3 NM_000142 715 c.746C>G p.S249C Gain of function Missense_Mutation
428 FGFR3 NM_000142 17461 c.1111A>T p.S371C Gain of function Missense_Mutation
429 FGFR3 NM_000142 718 c.1118A>G p.Y373C Gain of function Missense_Mutation
430 KRAS NM_004985 87301 c.33_34insGGAGCT p.A11_612insGA Gain of function In_Frame_Ins
431 KRAS NM_004985 510 c.31G>C p.A11P Gain of function Missense_Mutation
432 KRAS NM_004985 511 c.32C>T p.A11V Gain of function Missense_Mutation
433 KRAS NM_004985 19905 c.436G>C p.A146P Gain of function Missense_Mutation
434 KRAS NM_004985 19404 c.436G>A p.A146T Gain of function Missense_Mutation
435 KRAS NM_004985 19900 c.437C>T p.A146V Gain of function Missense_Mutation
436 KRAS NM_004985 542 c.53C>A p.A18D Gain of function Missense_Mutation
437 KRAS NM_004985 547 c.176C>A p.A59E Gain of function Missense_Mutation
438 KRAS NM_004985 28518 c.176C>G p.A59G Gain of function Missense_Mutation
439 KRAS NM_004985 546 c.175G>A p.A59T Gain of function Missense_Mutation
440 KRAS NM_004985 12654 c.30_31insGGA p.G10_A11insG Gain of function In_Frame_Ins
441 KRAS NM_004985 12655 c.36_37insGGT p.G12_613insG Gain of function In_Frame_Ins
442 KRAS NM_004985 522 c.35G>C p.G12A Gain of function Missense_Mutation
443 KRAS NM_004985 522 c.35G>C p.G12A Gain of function Missense_Mutation
444 KRAS NM_004985 522 c.35G>C p.G12A Gain of function Missense_Mutation
445 KRAS NM_004985 516 c.34G>T p.G12C Gain of function Missense_Mutation
446 KRAS NM_004985 516 c.34G>T p.G12C Gain of function Missense_Mutation
447 KRAS NM_004985 516 c.34G>T p.G12C Gain of function Missense_Mutation
448 KRAS NM_004985 14209 c.35_36GT>AC p.G12D Gain of function Missense_Mutation
449 KRAS NM_004985 14209 c.35_36GT>AC p.G12D Gain of function Missense_Mutation
450 KRAS NM_004985 14209 c.35_36GT>AC p.G12D Gain of function Missense_Mutation
451 KRAS NM_004985 521 c.35G>A p.G12D Gain of function Missense_Mutation
452 KRAS NM_004985 521 c.35G>A p.G12D Gain of function Missense_Mutation
453 KRAS NM_004985 521 c.35G>A p.G12D Gain of function Missense_Mutation
454 KRAS NM_004985 519 c.35_36GT>AA p.G12E Gain of function Missense_Mutation
455 KRAS NM_004985 519 c.35_36GT>AA p.G12E Gain of function Missense_Mutation
456 KRAS NM_004985 519 c.35_36GT>AA p.G12E Gain of function Missense_Mutation
457 KRAS NM_004985 512 c.34_35GG>TT p.G12F Gain of function Missense_Mutation
458 KRAS NM_004985 512 c.34_35GG>TT p.G12F Gain of function Missense_Mutation
459 KRAS NM_004985 512 c.34_35GG>TT p.G12F Gain of function Missense_Mutation
460 KRAS NM_004985 523 c.36T>C p.G12G Gain of function Synonymous_Mutation
461 KRAS NM_004985 523 c.36T>C p.G12G Gain of function Synonymous_Mutation
462 KRAS NM_004985 523 c.36T>C p.G12G Gain of function Synonymous_Mutation
463 KRAS NM_004985 524 c.36T>A p.G12G Gain of function Synonymous_Mutation
464 KRAS NM_004985 524 c.36T>A p.G12G Gain of function Synonymous_Mutation
465 KRAS NM_004985 524 c.36T>A p.G12G Gain of function Synonymous_Mutation
466 KRAS NM_004985 34144 c.34_35GG>AT p.G12I Gain of function Missense_Mutation
467 KRAS NM_004985 34144 c.34_35GG>AT p.G12I Gain of function Missense_Mutation
468 KRAS NM_004985 34144 c.34_35GG>AT p.G12I Gain of function Missense_Mutation
469 KRAS NM_004985 514 c.34_35GG>CT p.G12L Gain of function Missense_Mutation
470 KRAS NM_004985 514 c.34_35GG>CT p.G12L Gain of function Missense_Mutation
471 KRAS NM_004985 514 c.34_35GG>CT p.G12L Gain of function Missense_Mutation
472 KRAS NM_004985 518 c.34G>C p.G12R Gain of function Missense_Mutation
473 KRAS NM_004985 518 c.34G>C p.G12R Gain of function Missense_Mutation
474 KRAS NM_004985 518 c.34G>C p.G12R Gain of function Missense_Mutation
475 KRAS NM_004985 517 c.34G>A p.G12S Gain of function Missense_Mutation
476 KRAS NM_004985 517 c.34G>A p.G12S Gain of function Missense_Mutation
477 KRAS NM_004985 517 c.34G>A p.G12S Gain of function Missense_Mutation
478 KRAS NM_004985 515 c.35_36GT>TC p.G12V Gain of function Missense_Mutation
479 KRAS NM_004985 515 c.35_36GT>TC p.G12V Gain of function Missense_Mutation
480 KRAS NM_004985 515 c.35_36GT>TC p.G12V Gain of function Missense_Mutation
481 KRAS NM_004985 520 c.35G>T p.G12V Gain of function Missense_Mutation
482 KRAS NM_004985 520 c.35G>T p.G12V Gain of function Missense_Mutation
483 KRAS NM_004985 520 c.35G>T p.G12V Gain of function Missense_Mutation
484 KRAS NM_004985 25081 c.34_35GG>TA p.G12Y Gain of function Missense_Mutation
485 KRAS NM_004985 25081 c.34_35GG>TA p.G12Y Gain of function Missense_Mutation
486 KRAS NM_004985 25081 c.34_35GG>TA p.G12Y Gain of function Missense_Mutation
487 KRAS NM_004985 219781 c.39_40insGGC p.G13_V14insG Gain of function In_Frame_Ins
488 KRAS NM_004985 533 c.38G>C p.G13A Gain of function Missense_Mutation
489 KRAS NM_004985 533 c.38G>C p.G13A Gain of function Missense_Mutation
490 KRAS NM_004985 533 c.38G>C p.G13A Gain of function Missense_Mutation
491 KRAS NM_004985 527 c.37G>T p.G13C Gain of function Missense_Mutation
492 KRAS NM_004985 527 c.37G>T p.G13C Gain of function Missense_Mutation
493 KRAS NM_004985 527 c.37G>T p.G13C Gain of function Missense_Mutation
494 KRAS NM_004985 531 c.38_39GC>AT p.G13D Gain of function Missense_Mutation
495 KRAS NM_004985 531 c.38_39GC>AT p.G13D Gain of function Missense_Mutation
496 KRAS NM_004985 531 c.38_39GC>AT p.G13D Gain of function Missense_Mutation
497 KRAS NM_004985 532 c.38G>A p.G13D Gain of function Missense_Mutation
498 KRAS NM_004985 532 c.38G>A p.G13D Gain of function Missense_Mutation
499 KRAS NM_004985 532 c.38G>A p.G13D Gain of function Missense_Mutation
500 KRAS NM_004985 87280 c.38_39GC>AA p.G13E Gain of function Missense_Mutation
501 KRAS NM_004985 87280 c.38_39GC>AA p.G13E Gain of function Missense_Mutation
502 KRAS NM_004985 87280 c.38_39GC>AA p.G13E Gain of function Missense_Mutation
503 KRAS NM_004985 535 c.39C>G p.G13G Gain of function Synonymous_Mutation
504 KRAS NM_004985 536 c.39C>T p.G13G Gain of function Synonymous_Mutation
505 KRAS NM_004985 537 c.39C>A p.G13G Gain of function Synonymous_Mutation
506 KRAS NM_004985 529 c.37G>C p.G13R Gain of function Missense_Mutation
507 KRAS NM_004985 529 c.37G>C p.G13R Gain of function Missense_Mutation
508 KRAS NM_004985 529 c.37G>C p.G13R Gain of function Missense_Mutation
509 KRAS NM_004985 528 c.37G>A p.G13S Gain of function Missense_Mutation
510 KRAS NM_004985 528 c.37G>A p.G13S Gain of function Missense_Mutation
511 KRAS NM_004985 528 c.37G>A p.G13S Gain of function Missense_Mutation
512 KRAS NM_004985 12721 c.38_39GC>TT p.G13V Gain of function Missense_Mutation
513 KRAS NM_004985 12721 c.38_39GC>TT p.G13V Gain of function Missense_Mutation
514 KRAS NM_004985 12721 c.38_39GC>TT p.G13V Gain of function Missense_Mutation
515 KRAS NM_004985 534 c.38G>T p.G13V Gain of function Missense_Mutation
516 KRAS NM_004985 534 c.38G>T p.G13V Gain of function Missense_Mutation
517 KRAS NM_004985 534 c.38G>T p.G13V Gain of function Missense_Mutation
518 KRAS NM_004985 538 c.43G>A p.G15S Gain of function Missense_Mutation
519 KRAS NM_004985 19940 c.351A>C p.K117N Gain of function Missense_Mutation
520 KRAS NM_004985 28519 c.351A>T p.K117N Gain of function Missense_Mutation
521 KRAS NM_004985 12703 c.57G>C p.L19F Gain of function Missense_Mutation
522 KRAS NM_004985 20818 c.57G>T p.L19F Gain of function Missense_Mutation
523 KRAS NM_004985 543 c.64C>A p.Q22K Gain of function Missense_Mutation
524 KRAS NM_004985 550 c.181C>G p.Q61E Gain of function Missense_Mutation
525 KRAS NM_004985 550 c.181C>G p.Q61E Gain of function Missense_Mutation
526 KRAS NM_004985 550 c.181C>G p.Q61E Gain of function Missense_Mutation
527 KRAS NM_004985 554 c.183A>C p.Q61H Gain of function Missense_Mutation
528 KRAS NM_004985 554 c.183A>C p.Q61H Gain of function Missense_Mutation
529 KRAS NM_004985 554 c.183A>C p.Q61H Gain of function Missense_Mutation
530 KRAS NM_004985 555 c.183A>T p.Q61H Gain of function Missense_Mutation
531 KRAS NM_004985 555 c.183A>T p.Q61H Gain of function Missense_Mutation
532 KRAS NM_004985 555 c.183A>T p.Q61H Gain of function Missense_Mutation
533 KRAS NM_004985 549 c.181C>A p.Q61K Gain of function Missense_Mutation
534 KRAS NM_004985 549 c.181C>A p.Q61K Gain of function Missense_Mutation
535 KRAS NM_004985 549 c.181C>A p.Q61K Gain of function Missense_Mutation
536 KRAS NM_004985 87298 c.180_181TC>AA p.Q61K Gain of function Missense_Mutation
537 KRAS NM_004985 87298 c.180_181TC>AA p.Q61K Gain of function Missense_Mutation
538 KRAS NM_004985 87298 c.180_181TC>AA p.Q61K Gain of function Missense_Mutation
539 KRAS NM_004985 553 c.182A>T p.Q61L Gain of function Missense_Mutation
540 KRAS NM_004985 553 c.182A>T p.Q61L Gain of function Missense_Mutation
541 KRAS NM_004985 553 c.182A>T p.Q61L Gain of function Missense_Mutation
542 KRAS NM_004985 551 c.182A>C p.Q61P Gain of function Missense_Mutation
543 KRAS NM_004985 551 c.182A>C p.Q61P Gain of function Missense_Mutation
544 KRAS NM_004985 551 c.182A>C p.Q61P Gain of function Missense_Mutation
545 KRAS NM_004985 552 c.182A>G p.Q61R Gain of function Missense_Mutation
546 KRAS NM_004985 552 c.182A>G p.Q61R Gain of function Missense_Mutation
547 KRAS NM_004985 552 c.182A>G p.Q61R Gain of function Missense_Mutation
548 KRAS NM_004985 87288 c.173C>T p.T58I Gain of function Missense_Mutation
549 KRAS NM_004985 12722 c.40G>A p.V14I Gain of function Missense_Mutation
550 KRAS NM_004985 507 c.24A>G p.V8V Gain of function Synonymous_Mutation
551 MAP2K1E ENST00000307102 236154 c.171G>T p.K57N Gain of function Missense_Mutation
552 MET NM_000245 201908 c.3350A>G p.D1117G Gain of function Missense_Mutation
553 MET NM_000245 706 c.504G>T p.E168D Gain of function Missense_Mutation
554 MET NM_000245 698 c.3335A>T p.H1112L Gain of function Missense_Mutation
555 MET NM_000245 703 c.3335A>G p.H1112R Gain of function Missense_Mutation
556 MET NM_000245 696 c.3334C>T p.H1112Y Gain of function Missense_Mutation
557 MET NM_000245 697 c.3370C>G p.H1124D Gain of function Missense_Mutation
558 MET NM_000245 701 c.3390G>A p.L1130L Gain of function Synonymous_Mutation
559 MET NM_000245 691 c.3803T>C p.M1268T Gain of function Missense_Mutation
560 MET NM_000245 702 c.3352A>T p.N1118Y Gain of function Missense_Mutation
561 MET NM_000245 710 c.1124A>G p.N375S Gain of function Missense_Mutation
562 MET NM_000245 707 c.3029C>T p.T1010I Gain of function Missense_Mutation
563 MET NM_000245 699 c.3743A>G p.Y1248C Gain of function Missense_Mutation
564 MET NM_000245 700 c.3757T>G p.Y1253D Gain of function Missense_Mutation
565 NOTCH1 NM_017617.2 13050 c.4778T>C p.F1593S Loss of Function Missense_Mutation
566 NOTCH1 NM_017617.2 12772 c.4724T>C p.L1575P Loss of Function Missense_Mutation
567 NOTCH1 NM_017617.2 24673 c.4724T>C p.L1575P Loss of Function Missense_Mutation
568 NOTCH1 NM_017617.2 13046 c.4757T>C p.L1586P Loss of Function Missense_Mutation
569 NOTCH1 NM_017617.2 25839 c.4757T>G p.L1586R Loss of Function Missense_Mutation
570 NOTCH1 NM_017617.2 13042 c.4781T>C p.L1594P Loss of Function Missense_Mutation
571 NOTCH1 NM_017617.2 24888 c.4790T>A p.L1597H Loss of Function Missense_Mutation
572 NOTCH1 NM_017617.2 12771 c.4802T>C p.L1601P Loss of Function Missense_Mutation
573 NOTCH1 NM_017617.2 28524 c.4802T>A p.L1601Q Loss of Function Missense_Mutation
574 NOTCH1 NM_017617.2 13053 c.4796G>C p.R1599P Loss of Function Missense_Mutation
575 NOTCH1 NM_017617.2 25836 c.4730T>A p.V1577E Loss of Function Missense_Mutation
576 NOTCH1 NM_017617.2 13047 c.4735_4737delGTG p.V1579del Loss of Function In_Frame_Del
577 NOTCH1 NM_017617.2 13040 c.5030T>A p.V1677D Loss of Function Missense_Mutation
578 NRAS NM_002524 558 c.31G>A p.A11T Gain of function Missense_Mutation
579 NRAS NM_002524 577 c.52G>A p.A18T Gain of function Missense_Mutation
580 NRAS NM_002524 565 c.35G>C p.G12A Gain of function Missense_Mutation
581 NRAS NM_002524 562 c.34G>T p.G12C Gain of function Missense_Mutation
582 NRAS NM_002524 564 c.35G>A p.G12D Gain of function Missense_Mutation
583 NRAS NM_002524 567 c.36T>C p.G12G Gain of function Synonymous_Mutation
584 NRAS NM_002524 12723 c.34_35GG>AA p.G12N Gain of function Missense_Mutation
585 NRAS NM_002524 561 c.34G>C p.G12R Gain of function Missense_Mutation
586 NRAS NM_002524 563 c.34G>A p.G12S Gain of function Missense_Mutation
587 NRAS NM_002524 566 c.35G>T p.G12V Gain of function Missense_Mutation
588 NRAS NM_002524 575 c.38G>C p.G13A Gain of function Missense_Mutation
589 NRAS NM_002524 570 c.37G>T p.G13C Gain of function Missense_Mutation
590 NRAS NM_002524 573 c.38G>A p.G13D Gain of function Missense_Mutation
591 NRAS NM_002524 576 c.39T>C p.G13G Gain of function Synonymous_Mutation
592 NRAS NM_002524 569 c.37G>C p.G13R Gain of function Missense_Mutation
593 NRAS NM_002524 571 c.37G>A p.G13S Gain of function Missense_Mutation
594 NRAS NM_002524 574 c.38G>T p.G13V Gain of function Missense_Mutation
595 NRAS NM_002524 28673 c.179G>A p.G60E Gain of function Missense_Mutation
596 NRAS NM_002524 581 c.181C>G p.Q61E Gain of function Missense_Mutation
597 NRAS NM_002524 585 c.183A>T p.Q61H Gain of function Missense_Mutation
598 NRAS NM_002524 586 c.183A>C p.Q61H Gain of function Missense_Mutation
599 NRAS NM_002524 12730 c.180_181AC>TA p.Q61K Gain of function Missense_Mutation
600 NRAS NM_002524 580 c.181C>A p.Q61K Gain of function Missense_Mutation
601 NRAS NM_002524 12725 c.181_182CA>TT p.Q61L Gain of function Missense_Mutation
602 NRAS NM_002524 30646 c.182_183AA>TG p.Q61L Gain of function Missense_Mutation
603 NRAS NM_002524 583 c.182A>T p.Q61L Gain of function Missense_Mutation
604 NRAS NM_002524 582 c.182A>C p.Q61P Gain of function Missense_Mutation
605 NRAS NM_002524 587 c.183A>G p.Q61Q Gain of function Synonymous_Mutation
606 NRAS NM_002524 33693 c.182_183AA>GG p.Q61R Gain of function Missense_Mutation
607 NRAS NM_002524 579 c.181_182CA>AG p.Q61R Gain of function Missense_Mutation
608 NRAS NM_002524 584 c.182A>G p.Q61R Gain of function Missense_Mutation
609 NRAS NM_002524 589 c.193A>T p.S65C Gain of function Missense_Mutation
610 PIK3CA NM_006218.1 17449 c.3207A>G p.*1069_*1069insW Gain of function N/A
611 PIK3CA NM_006218.1 249908 c.3207+29T>C p.? Gain of function N/A
612 PIK3CA NM_006218.1 28938 c.3059C>T p.A1020V Gain of function Missense_Mutation
613 PIK3CA NM_006218.1 17445 c.3104C>T p.A1035V Gain of function Missense_Mutation
614 PIK3CA NM_006218.1 27156 c.3137C>A p.A1046E Gain of function Missense_Mutation
615 PIK3CA NM_006218.1 27273 c.3136G>A p.A1046T Gain of function Missense_Mutation
616 PIK3CA NM_006218.1 36286 c.3085G>C p.D1029H Gain of function Missense_Mutation
617 PIK3CA NM_006218.1 25086 c.3133G>A p.D1045N Gain of function Missense_Mutation
618 PIK3CA NM_006218.1 760 c.1624G>A p.E542K Gain of function Missense_Mutation
619 PIK3CA NM_006218.1 17442 c.1624G>C p.E542Q Gain of function Missense_Mutation
620 PIK3CA NM_006218.1 762 c.1625A>T p.E542V Gain of function Missense_Mutation
621 PIK3CA NM_006218.1 12458 c.1634A>C p.E545A Gain of function Missense_Mutation
622 PIK3CA NM_006218.1 27374 c.1635G>C p.E545D Gain of function Missense_Mutation
623 PIK3CA NM_006218.1 765 c.1635G>T p.E545D Gain of function Missense_Mutation
624 PIK3CA NM_006218.1 764 c.1634A>G p.E545G Gain of function Missense_Mutation
625 PIK3CA NM_006218.1 763 c.1633G>A p.E545K Gain of function Missense_Mutation
626 PIK3CA NM_006218.1 27133 c.1633G>C p.E545Q Gain of function Missense_Mutation
627 PIK3CA NM_006218.1 27155 c.1634A>T p.E545V Gain of function Missense_Mutation
628 PIK3CA NM_006218.1 29110 c.3115T>C p.F1039L Gain of function Missense_Mutation
629 PIK3CA NM_006218.1 27158 c.3146G>C p.G1049A Gain of function Missense_Mutation
630 PIK3CA NM_006218.1 12597 c.3145G>C p.G1049R Gain of function Missense_Mutation
631 PIK3CA NM_006218.1 777 c.3145G>A p.G1049S Gain of function Missense_Mutation
632 PIK3CA NM_006218.1 776 c.3140A>T p.H1047L Gain of function Missense_Mutation
633 PIK3CA NM_006218.1 24714 c.3141T>G p.H1047Q Gain of function Missense_Mutation
634 PIK3CA NM_006218.1 775 c.3140A>G p.H1047R Gain of function Missense_Mutation
635 PIK3CA NM_006218.1 774 c.3139C>T p.H1047Y Gain of function Missense_Mutation
636 PIK3CA NM_006218.1 36289 c.3143A>G p.H1048R Gain of function Missense_Mutation
637 PIK3CA NM_006218.1 778 c.2102A>C p.H701P Gain of function Missense_Mutation
638 PIK3CA NM_006218.1 25085 c.3120G>A p.M1040I Gain of function Missense_Mutation
639 PIK3CA NM_006218.1 29313 c.3129G>A p.M1043I Gain of function Missense_Mutation
640 PIK3CA NM_006218.1 773 c.3129G>T p.M1043I Gain of function Missense_Mutation
641 PIK3CA NM_006218.1 94984 c.3129G>C p.M1043I Gain of function Missense_Mutation
642 PIK3CA NM_006218.1 12463 c.3128T>C p.M1043T Gain of function Missense_Mutation
643 PIK3CA NM_006218.1 12591 c.3127A>G p.M1043V Gain of function Missense_Mutation
644 PIK3CA NM_006218.1 27134 c.3130A>G p.N1044D Gain of function Missense_Mutation
645 PIK3CA NM_006218.1 12592 c.3132T>A p.N1044K Gain of function Missense_Mutation
646 PIK3CA NM_006218.1 759 c.1616C>G p.P539R Gain of function Missense_Mutation
647 PIK3CA NM_006218.1 6147 c.1636C>G p.Q546E Gain of function Missense_Mutation
648 PIK3CA NM_006218.1 24712 c.1638G>T p.Q546H Gain of function Missense_Mutation
649 PIK3CA NM_006218.1 766 c.1636C>A p.Q546K Gain of function Missense_Mutation
650 PIK3CA NM_006218.1 25041 c.1637A>T p.Q546L Gain of function Missense_Mutation
651 PIK3CA NM_006218.1 767 c.1637A>C p.Q546P Gain of function Missense_Mutation
652 PIK3CA NM_006218.1 12459 c.1637A>G p.Q546R Gain of function Missense_Mutation
653 PIK3CA NM_006218.1 13594 c.3068G>A p.R1023Q Gain of function Missense_Mutation
654 PIK3CA NM_006218.1 771 c.3073A>G p.T1025A Gain of function Missense_Mutation
655 PIK3CA NM_006218.1 36285 c.3074C>T p.T1025I Gain of function Missense_Mutation
656 PIK3CA NM_006218.1 772 c.3074C>A p.T1025N Gain of function Missense_Mutation
657 PIK3CA NM_006218.1 12590 c.3073A>T p.T1025S Gain of function Missense_Mutation
658 PIK3CA NM_006218.1 21451 c.3075C>T p.T1025T Gain of function Synonymous_Mutation
659 PIK3CA NM_006218.1 249872 c.1631C>A p.T544N Gain of function Missense_Mutation
660 PIK3CA NM_006218.1 12461 c.3062A>G p.Y1021C Gain of function Missense_Mutation
661 PIK3CA NM_006218.1 17444 c.3061T>C p.Y1021H Gain of function Missense_Mutation
662 PIK3CA_EN ENST00000263967 125370 c.1633G>A p.E545K Gain of function Missense_Mutation
663 PIK3CA_EN ENST00000263967 94987 c.3140A>T p.H1047L Gain of function Missense_Mutation
664 PIK3CA_EN ENST00000263967 94986 c.3140A>G p.H1047R Gain of function Missense_Mutation
665 PIK3CA_EN ENST00000263967 94985 c.3129G>C p.M1043I Gain of function Missense_Mutation
666 PTEN NM_000314.4 14087 c.165_209del45 p.? Loss of Function N/A
667 PTEN NM_000314.4 19564 c.1026+1G>T p.? Loss of Function N/A
668 PTEN NM_000314.4 249834 c.635-2A>G p.? Loss of Function N/A
669 PTEN NM_000314.4 27365 c.635-91G>C p.? Loss of Function N/A
670 PTEN NM_000314.4 28920 c.635-1G>A p.? Loss of Function N/A
671 PTEN NM_000314.4 5907 c.493-12delT p.? Loss of Function N/A
672 PTEN NM_000314.4 5915 c.1-9C>G p.? Loss of Function N/A
673 PTEN NM_000314.4 5916 c.209+5G>A p.? Loss of Function N/A
674 PTEN NM_000314.4 5932 c.635-9A>G p.? Loss of Function N/A
675 PTEN NM_000314.4 5950 c.635-12T>G p.? Loss of Function N/A
676 PTEN NM_000314.4 5951 c.635-17T>G p.? Loss of Function N/A
677 PTEN NM_000314.4 5957 c.1026+1G>T Loss of Function N/A
678 PTEN NM_000314.4 5958 c.165-1G>T p.? Loss of Function N/A
679 PTEN NM_000314.4 5959 c.165-2A>C p.? Loss of Function N/A
680 PTEN NM_000314.4 5960 c.165-1G>A p.? Loss of Function N/A
681 PTEN NM_000314.4 5961 c.493-1G>A p.? Loss of Function N/A
682 PTEN NM_000314.4 5971 c.635-1G>T p.? Loss of Function N/A
683 PTEN NM_000314.4 5974 c.209+1G>C p.? Loss of Function N/A
684 PTEN NM_000314.4 5975 c.209+1delGT p.? Loss of Function N/A
685 PTEN NM_000314.4 5976 c.209+1G>T p.? Loss of Function N/A
686 PTEN NM_000314.4 5979 c.209+1delGTAA p.? Loss of Function N/A
687 PTEN NM_000314.4 4912 c.750_751delTG p.C250fs*2 Loss of Function Frame_Shift_Del
688 PTEN NM_000314.4 5125 c.755A>G p.D252G Loss of Function Missense_Mutation
689 PTEN NM_000314.4 5246 c.754G>T p.D252Y Loss of Function Missense_Mutation
690 PTEN NM_000314.4 5814 c.993delC p.D331fs*13 Loss of Function Frame_Shift_Del
691 PTEN NM_000314.4 5093 c.992A>G p.D331G Loss of Function Missense_Mutation
692 PTEN NM_000314.4 5292 c.703G>T p.E235* Loss of Function Nonsense_Mutation
693 PTEN NM_000314.4 88109 c.724G>T p.E242* Loss of Function Nonsense_Mutation
694 PTEN NM_000314.4 26404 c.723_724insT p.E242fs*1 Loss of Function Frame_Shift_Ins
695 PTEN NM_000314.4 5888 c.723_724insTT p.E242fs*15 Loss of Function Frame_Shift_Ins
696 PTEN NM_000314.4 17564 c.766G>A p.E256K Loss of Function Missense_Mutation
697 PTEN NM_000314.4 5314 c.862G>T p.E288* Loss of Function Nonsense_Mutation
698 PTEN NM_000314.4 13452 c.863delA p.E288fs*3 Loss of Function Frame_Shift_Del
699 PTEN NM_000314.4 28906 c.871G>T p.E291* Loss of Function Nonsense_Mutation
700 PTEN NM_000314.4 5298 c.19G>T p.E7* Loss of Function Nonsense_Mutation
701 PTEN NM_000314.4 4885 c.1011_1014delTTCT p.F337fs*6 Loss of Function Frame_Shift_Del
702 PTEN NM_000314.4 5869 c.1009delT p.F337fs*7 Loss of Function Frame_Shift_Del
703 PTEN NM_000314.4 5255 c.1021T>G p.F341V Loss of Function Missense_Mutation
704 PTEN NM_000314.4 5257 c.166T>G p.F56V Loss of Function Missense_Mutation
705 PTEN NM_000314.4 5114 c.494G>A p.G165E Loss of Function Splice_Site
706 PTEN NM_000314.4 5091 c.493G>A p.G165R Loss of Function Splice_Site
707 PTEN NM_000314.4 5220 c.751G>T p.G251C Loss of Function Missense_Mutation
708 PTEN NM_000314.4 13981 c.752G>A p.G251D Loss of Function Missense_Mutation
709 PTEN NM_000314.4 28914 c.878delG p.G293fs*14 Loss of Function Frame_Shift_Del
710 PTEN NM_000314.4 5042 c.182A>G p.H61R Loss of Function Missense_Mutation
711 PTEN NM_000314.4 5230 c.758T>A p.I253N Loss of Function Missense_Mutation
712 PTEN NM_000314.4 5037 c.37A>G p.K13E Loss of Function Missense_Mutation
713 PTEN NM_000314.4 5887 c.711_712insAA p.K237fs*19 Loss of Function Frame_Shift_Ins
714 PTEN NM_000314.4 4908 c.760_764delAAAGT p.K254fs*42 Loss of Function Frame_Shift_Del
715 PTEN NM_000314.4 133713 c.780_780delA p.K260fs*6 Loss of Function Frame_Shift_Del
716 PTEN NM_000314.4 43075 c.787A>T p.K263* Loss of Function Nonsense_Mutation
717 PTEN NM_000314.4 41768 c.179_179delA p.K60fs*39 Loss of Function Frame_Shift_Del
718 PTEN NM_000314.4 5048 c.196A>G p.K66E Loss of Function Missense_Mutation
719 PTEN NM_000314.4 5191 c.198G>T p.K66N Loss of Function Missense_Mutation
720 PTEN NM_000314.4 4929 c.17_18delAA p.K6fs*4 Loss of Function Frame_Shift_Del
721 PTEN NM_000314.4 4937 c.16_17delAA p.K6fs*4 Loss of Function Frame_Shift_Del
722 PTEN NM_000314.4 39615 c.950_953delTACT p.L318fs*2 Loss of Function Frame_Shift_Del
723 PTEN NM_000314.4 4894 c.952_955delCTTA p.L318fs*2 Loss of Function Frame_Shift_Del
724 PTEN NM_000314.4 4903 c.954_957delTACT p.L318fs*2 Loss of Function Frame_Shift_Del
725 PTEN NM_000314.4 4916 c.953_956delTTAC p.L318fs*2 Loss of Function Frame_Shift_Del
726 PTEN NM_000314.4 5000 c.170_171insT p.L57fs*6 Loss of Function Frame_Shift_Ins
727 PTEN NM_000314.4 5127 c.170T>C p.L57S Loss of Function Missense_Mutation
728 PTEN NM_000314.4 5253 c.170T>G p.L57W Loss of Function Missense_Mutation
729 PTEN NM_000314.4 23626 c.962_963insA p.N323fs*2 Loss of Function Frame_Shift_Ins
730 PTEN NM_000314.4 4990 c.968_969insA p.N323fs*2 Loss of Function Frame_Shift_Ins
731 PTEN NM_000314.4 5801 c.968delA p.N323fs*21 Loss of Function Frame_Shift_Del
732 PTEN NM_000314.4 4932 c.987_990delTAAA p.N329fs*14 Loss of Function Frame_Shift_Del
733 PTEN NM_000314.4 4942 c.187_188delAA p.N63fs*10 Loss of Function Frame_Shift_Del
734 PTEN NM_000314.4 5811 c.188delA p.N63fs*36 Loss of Function Frame_Shift_Del
735 PTEN NM_000314.4 17561 c.638C>A p.P213H Loss of Function Missense_Mutation
736 PTEN NM_000314.4 241294 c.638C>G p.P213R Loss of Function Missense_Mutation
737 PTEN NM_000314.4 30729 c.637C>T p.P213S Loss of Function Missense_Mutation
738 PTEN NM_000314.4 5822 c.738delG p.P246fs*10 Loss of Function Frame_Shift_Del
739 PTEN NM_000314.4 5111 c.737C>T p.P246L Loss of Function Missense_Mutation
740 PTEN NM_000314.4 23644 c.743C>G p.P248? Loss of Function N/A
741 PTEN NM_000314.4 4986 c.741_742insA p.P248fs*5 Loss of Function Frame_Shift_Ins
742 PTEN NM_000314.4 23657 c.1015C>T p.P339S Loss of Function Missense_Mutation
743 PTEN NM_000314.4 5153 c.49C>T p.Q17* Loss of Function Nonsense_Mutation
744 PTEN NM_000314.4 5149 c.511C>T p.Q171* Loss of Function Nonsense_Mutation
745 PTEN NM_000314.4 5200 c.511C>G p.Q171E Loss of Function Missense_Mutation
746 PTEN NM_000314.4 5244 c.512A>C p.Q171P Loss of Function Missense_Mutation
747 PTEN NM_000314.4 4976 c.49_51delCAA p.Q17del Loss of Function In_Frame_Del
748 PTEN NM_000314.4 5159 c.733C>T p.Q245* Loss of Function Nonsense_Mutation
749 PTEN NM_000314.4 5160 c.781C>T p.Q261* Loss of Function Nonsense_Mutation
750 PTEN NM_000314.4 5156 c.892C>T p.Q298* Loss of Function Nonsense_Mutation
751 PTEN NM_000314.4 5101 c.40A>G p.R14G Loss of Function Missense_Mutation
752 PTEN NM_000314.4 5232 c.44G>T p.R15I Loss of Function Missense_Mutation
753 PTEN NM_000314.4 5270 c.45A>T p.R155 Loss of Function Missense_Mutation
754 PTEN NM_000314.4 5089 c.517C>T p.R173C Loss of Function Missense_Mutation
755 PTEN NM_000314.4 5825 c.517delC p.R173fs*10 Loss of Function Frame_Shift_Del
756 PTEN NM_000314.4 5039 c.518G>A p.R173H Loss of Function Missense_Mutation
757 PTEN NM_000314.4 5151 c.1003C>T p.R335* Loss of Function Nonsense_Mutation
758 PTEN NM_000314.4 5775 c.1002_1003CC>TT p.R335* Loss of Function Nonsense_Mutation
759 PTEN NM_000314.4 5049 c.29G>A p.S10N Loss of Function Missense_Mutation
760 PTEN NM_000314.4 5218 c.509G>T p.S170I Loss of Function Missense_Mutation
761 PTEN NM_000314.4 5045 c.509G>A p.S170N Loss of Function Missense_Mutation
762 PTEN NM_000314.4 4931 c.881_885delGTCTA p.S294f5*2 Loss of Function Frame_Shift_Del
763 PTEN NM_000314.4 5313 c.176C>A p.S59* Loss of Function Nonsense_Mutation
764 PTEN NM_000314.4 5052 c.499A>G p.T167A Loss of Function Missense_Mutation
765 PTEN NM_000314.4 4982 c.955_957delACT p.T319del Loss of Function Frame_Shift_Del
766 PTEN NM_000314.4 4958 c.955_958delACTT p.T319fs*1 Loss of Function Frame_Shift_Del
767 PTEN NM_000314.4 4896 c.956_959delCTTT p.T319fs*24 Loss of Function Frame_Shift_Del
768 PTEN NM_000314.4 5008 c.955_956insA p.T319fs*6 Loss of Function Frame_Shift_Ins
769 PTEN NM_000314.4 5823 c.963delA p.T321fs*23 Loss of Function Frame_Shift_Del
770 PTEN NM_000314.4 4994 c.963_964insA p.T321fs*3 Loss of Function Frame_Shift_Ins
771 PTEN NM_000314.4 5816 c.867delA p.V290fs*1 Loss of Function Frame_Shift_Del
772 PTEN NM_000314.4 4898 c.950_953delTACT p.V317fs*3 Loss of Function Frame_Shift_Del
773 PTEN NM_000314.4 4899 c.951_954delACTT p.V317fs*3 Loss of Function Frame_Shift_Del
774 PTEN NM_000314.4 4943 c.950_954delTACTT p.V317fs*6 Loss of Function Frame_Shift_Del
775 PTEN NM_000314.4 5133 c.47A>G p.Y16C Loss of Function Missense_Mutation
776 PTEN NM_000314.4 5878 c.46_47insT p.Y16fs*28 Loss of Function Frame_Shift_Ins
777 PTEN NM_000314.4 28897 c.520T>G p.Y174D Loss of Function Missense_Mutation
778 PTEN NM_000314.4 4969 c.526_528delTAT p.Y176del Loss of Function In_Frame_Del
779 PTEN NM_000314.4 33702 c.530A>G p.Y177C Loss of Function Missense_Mutation
780 PTEN NM_000314.4 5290 c.1008C>G p.Y336* Loss of Function Nonsense_Mutation
781 PTEN NM_000314.4 5296 c.195C>A p.Y65* Loss of Function Nonsense_Mutation
782 PTEN NM_000314.4 5317 c.195C>G p.Y65* Loss of Function Nonsense_Mutation
783 PTEN NM_000314.4 43077 c.203A>G p.Y68C Loss of Function Missense_Mutation
784 PTEN NM_000314.4 4889 c.202_203delTA p.Y68fs*5 Loss of Function Frame_Shift_Del
785 PTEN NM_000314.4 5036 c.202T>C p.Y68H Loss of Function Missense_Mutation
786 Q7Z252_H ENST00000341462 98900 c.397G>A p.D133N Unclassified Missense_Mutation
787 Q7Z252_H ENST00000341462 187238 c.448C>T p.P150S Unclassified Missense_Mutation
788 SMAD4 NM_005359.3 14167 c.955+5G>C p.? Loss of Function N/A
789 SMAD4 NM_005359.3 14215 c.353C>T p.A118V Loss of Function Missense_Mutation
790 SMAD4 NM_005359.3 14105 c.1394_1395insT p.A466fs*28 Loss of Function Frame_Shift_Ins
791 SMAD4 NM_005359.3 14216 c.363_364insA p.C123fs*2 Loss of Function Frame_Shift_Ins
792 SMAD4 NM_005359.3 25274 c.366_367insA p.C123fs*2 Loss of Function Frame_Shift_Ins
793 SMAD4 NM_005359.3 14221 c.1496G>A p.C499Y Loss of Function Missense_Mutation
794 SMAD4 NM_005359.3 14115 c.1569C>G p.C523W Loss of Function Missense_Mutation
795 SMAD4 NM_005359.3 14135 c.1051G>C p.D351H Loss of Function Missense_Mutation
796 SMAD4 NM_005359.3 14232 c.1064A>G p.D355G Loss of Function Missense_Mutation
797 SMAD4 NM_005359.3 14110 c.989A>C p.E330A Loss of Function Missense_Mutation
798 SMAD4 NM_005359.3 14134 c.1576G>T p.E526* Loss of Function Nonsense_Mutation
799 SMAD4 NM_005359.3 14121 c.1015_1029del15 p.F339_5343del Loss of Function In_Frame_Del
800 SMAD4 NM_005359.3 14118 c.502G>T p.G168* Loss of Function Nonsense_Mutation
801 SMAD4 NM_005359.3 14174 c.1072G>T p.G358* Loss of Function Nonsense_Mutation
802 SMAD4 NM_005359.3 14126 c.1519A>C p.K507Q Loss of Function Missense_Mutation
803 SMAD4 NM_005359.3 14057 c.733C>T p.Q245* Loss of Function Nonsense_Mutation
804 SMAD4 NM_005359.3 14163 c.931C>T p.Q311* Loss of Function Nonsense_Mutation
805 SMAD4 NM_005359.3 14223 c.1229_1230insCA p.Q410fs*6 Loss of Function Frame_Shift_Ins
806 SMAD4 NM_005359.3 14124 c.1341_1365del25 p.Q448f5*20 Loss of Function Frame_Shift_Del
807 SMAD4 NM_005359.3 14140 c.1081C>T p.R361C Loss of Function Missense_Mutation
808 SMAD4 NM_005359.3 14122 c.1082G>A p.R361H Loss of Function Missense_Mutation
809 SMAD4 NM_005359.3 14113 c.1490G>A p.R497H Loss of Function Missense_Mutation
810 SMAD4 NM_005359.3 14129 c.1543A>T p.R515* Loss of Function Nonsense_Mutation
811 SMAD4 NM_005359.3 14111 c.1028C>G p.S343* Loss of Function Nonsense_Mutation
812 SMAD4 NM_005359.3 14177 c.1546_1553delCAGAGCAT p.S517fs*7 Loss of Function Frame_Shift_Del
813 SMAD4 NM_005359.3 14217 c.776_777delCT p.T259fs*4 Loss of Function Frame_Shift_Del
814 SMAD4 NM_005359.3 14220 c.1058A>G p.Y353C Loss of Function Missense_Mutation
815 SMAD4 NM_005359.3 14175 c.1236C>G p.Y412* Loss of Function Nonsense_Mutation
816 STK11 NM_000455 25847 c.580G>A p.D194N Loss of Function Missense_Mutation
817 STK11 NM_000455 20944 c.580G>T p.D194Y Loss of Function Missense_Mutation
818 STK11 NM_000455 25229 c.595G>T p.E199* Loss of Function Nonsense_Mutation
819 STK11 NM_000455 21212 c.169delG p.E57fs*7 Loss of Function In_Frame_Del
820 STK11 NM_000455 20857 c.787_790delTTGT p.F264fs*22 Loss of Function In_Frame_Del
821 STK11 NM_000455 21360 c.1062C>G p.F354L Loss of Function Missense_Mutation
822 STK11 NM_000455 25851 c.842_843insC p.L282fs*3 Loss of Function In_Frame_Ins
823 STK11 NM_000455 12924 c.842delC p.P281fs*6 Loss of Function In_Frame_Del
824 STK11 NM_000455 20871 c.837delC p.P281fs*6 Loss of Function In_Frame_Del
825 STK11 NM_000455 21355 c.842C>T p.P281L Loss of Function Missense_Mutation
826 STK11 NM_000455 12925 c.109C>T p.Q37* Loss of Function Nonsense_Mutation
827 STK11 NM_000455 21378 c.96C>G p.T32T Loss of Function Synonymous_Mutation
828 STK11 NM_000455 18652 c.996G>A p.W332* Loss of Function Nonsense_Mutation
829 STK11 NM_000455 29005 c.816C>T p.Y272Y Loss of Function Synonymous_Mutation
830 STK11 NM_000455 27322 c.180delC p.Y60fs*1 Loss of Function In_Frame_Del
831 TP53 NM_000546 18657 c.560-2A>G p.? Loss of Function N/A
832 TP53 NM_000546 21572 c.376-1G>A p.? Loss of Function N/A
833 TP53 NM_000546 22908 c.376-1G>T p.? Loss of Function N/A
834 TP53 NM_000546 43541 c.559+3G>C p.? Loss of Function N/A
835 TP53 NM_000546 43753 c.560-1G>A p.? Loss of Function N/A
836 TP53 NM_000546 43841 c.560-1G>T p.? Loss of Function N/A
837 TP53 NM_000546 43872 c.560-1G>C p.? Loss of Function N/A
838 TP53 NM_000546 43927 c.559+9C>T p.? Loss of Function N/A
839 TP53 NM_000546 44268 c.559+1G>T p.? Loss of Function N/A
840 TP53 NM_000546 44297 c.376-3C>T p.? Loss of Function N/A
841 TP53 NM_000546 44495 c.559+2T>A p.? Loss of Function N/A
842 TP53 NM_000546 44933 c.376-4A>G p.? Loss of Function N/A
843 TP53 NM_000546 45026 c.560-2A>T p.? Loss of Function N/A
844 TP53 NM_000546 45364 c.376-1delG p.? Loss of Function N/A
845 TP53 NM_000546 45672 c.376-2A>G p.? Loss of Function N/A
846 TP53 NM_000546 45711 c.559+2T>G p.? Loss of Function N/A
847 TP53 NM_000546 45809 c.376-1G>C p.? Loss of Function N/A
848 TP53 NM_000546 46049 c.376-2A>C p.? Loss of Function N/A
849 TP53 NM_000546 46059 c.560-3T>G p.? Loss of Function N/A
850 TP53 NM_000546 6900 c.376-1G>A p.? Loss of Function N/A
851 TP53 NM_000546 6901 c.559+1G>A p.? Loss of Function N/A
852 TP53 NM_000546 44966 c.385G>A p.A129T Loss of Function Missense_Mutation
853 TP53 NM_000546 44550 c.386C>T p.A129V Loss of Function Missense_Mutation
854 TP53 NM_000546 44130 c.477C>T p.A159A Loss of Function Synonymous_Mutation
855 TP53 NM_000546 11496 c.476C>A p.A159D Loss of Function Missense_Mutation
856 TP53 NM_000546 45057 c.475delG p.A159fs*11 Loss of Function Frame_Shift_Del
857 TP53 NM_000546 43836 c.475G>C p.A159P Loss of Function Missense_Mutation
858 TP53 NM_000546 45286 c.475G>T p.A159S Loss of Function Missense_Mutation
859 TP53 NM_000546 43626 c.475G>A p.A159T Loss of Function Missense_Mutation
860 TP53 NM_000546 11148 c.476C>T p.A159V Loss of Function Missense_Mutation
861 TP53 NM_000546 44119 c.483C>T p.A161A Loss of Function Synonymous_Mutation
862 TP53 NM_000546 11323 c.482C>A p.A161D Loss of Function Missense_Mutation
863 TP53 NM_000546 44230 c.481delG p.A161fs*9 Loss of Function Frame_Shift_Del
864 TP53 NM_000546 10739 c.481G>A p.A161T Loss of Function Missense_Mutation
865 TP53 NM_000546 43689 c.482C>T p.A161V Loss of Function Missense_Mutation
866 TP53 NM_000546 45029 c.565_591del27 p.A189_V197delAPP Loss of Function In_Frame_Del
867 TP53 NM_000546 45440 c.567C>T p.A189A Loss of Function Synonymous_Mutation
868 TP53 NM_000546 43698 c.566C>G p.A189G Loss of Function Missense_Mutation
869 TP53 NM_000546 44923 c.565G>C p.A189P Loss of Function Missense_Mutation
870 TP53 NM_000546 43537 c.565G>A p.A189T Loss of Function Missense_Mutation
871 TP53 NM_000546 44349 c.566C>T p.A189V Loss of Function Missense_Mutation
872 TP53 NM_000546 45268 c.827C>A p.A276D Loss of Function Missense_Mutation
873 TP53 NM_000546 45695 c.827C>G p.A276G Loss of Function Missense_Mutation
874 TP53 NM_000546 43663 c.826G>C p.A276P Loss of Function Missense_Mutation
875 TP53 NM_000546 45467 c.826G>T p.A276S Loss of Function Missense_Mutation
876 TP53 NM_000546 44114 c.826G>A p.A276T Loss of Function Missense_Mutation
877 TP53 NM_000546 10756 c.827C>T p.A276V Loss of Function Missense_Mutation
878 TP53 NM_000546 44019 c.226_270del45 p.A76_590del15 Loss of Function In_Frame_Del
879 TP53 NM_000546 45200 c.233C>T p.A78V Loss of Function Missense_Mutation
880 TP53 NM_000546 44075 c.251C>G p.A84G Loss of Function Missense_Mutation
881 TP53 NM_000546 44194 c.251C>T p.A84V Loss of Function Missense_Mutation
882 TP53 NM_000546 44231 c.262delG p.A88fs*35 Loss of Function Frame_Shift_Del
883 TP53 NM_000546 44319 c.405C>A p.C135* Loss of Function Nonsense_Mutation
884 TP53 NM_000546 43704 c.405C>T p.C135C Loss of Function Synonymous_Mutation
885 TP53 NM_000546 10647 c.404G>T p.C135F Loss of Function Missense_Mutation
886 TP53 NM_000546 44670 c.400delT p.C135fs*35 Loss of Function Frame_Shift_Del
887 TP53 NM_000546 44829 c.403T>G p.C135G Loss of Function Missense_Mutation
888 TP53 NM_000546 10684 c.403T>C p.C135R Loss of Function Missense_Mutation
889 TP53 NM_000546 44643 c.404G>C p.C1355 Loss of Function Missense_Mutation
890 TP53 NM_000546 44910 c.403T>A p.C1355 Loss of Function Missense_Mutation
891 TP53 NM_000546 44219 c.405C>G p.C135W Loss of Function Missense_Mutation
892 TP53 NM_000546 10801 c.404G>A p.C135Y Loss of Function Missense_Mutation
893 TP53 NM_000546 43734 c.528C>A p.C176* Loss of Function Nonsense_Mutation
894 TP53 NM_000546 45399 c.526_543del18 p.C176_R181delCPH Loss of Function In_Frame_Del
895 TP53 NM_000546 10645 c.527G>T p.C176F Loss of Function Missense_Mutation
896 TP53 NM_000546 44759 c.526delT p.C176fs*71 Loss of Function Frame_Shift_Del
897 TP53_ENST ENST00000269305 99601 c.404G>A p.C135Y Loss of Function Missense_Mutation
898 TP53 NM_000546 44948 c.526T>C p.C176R Loss of Function Missense_Mutation
899 TP53 NM_000546 44146 c.526T>A p.C176S Loss of Function Missense_Mutation
900 TP53_ENST ENST00000413465 99598 c.404G>A p.C135Y Loss of Function Missense_Mutation
901 TP53_ENST ENST00000545858 99625 c.434G>T p.C145F Loss of Function Missense_Mutation
902 TP53 NM_000546 10687 c.527G>A p.C176Y Loss of Function Missense_Mutation
903 TP53 NM_000546 45562 c.546C>A p.C182* Loss of Function Nonsense_Mutation
904 TP53_ENST ENST00000269305 117398 c.527G>T p.C176F Loss of Function Missense_Mutation
905 TP53_ENST ENST00000413465 117395 c.527G>T p.C176F Loss of Function Missense_Mutation
906 TP53 NM_000546 44692 c.526T>G p.C176G Loss of Function Missense_Mutation
907 TP53 NM_000546 44645 c.527G>C p.C176S Loss of Function Missense_Mutation
908 TP53 NM_000546 45394 c.687T>A p.C229* Loss of Function Nonsense_Mutation
909 TP53 NM_000546 45654 c.685_699del15 p.C229_H233delCTT Loss of Function In_Frame_Del
910 TP53 NM_000546 43648 c.685_686delTG p.C229fs*10 Loss of Function Frame_Shift_Del
911 TP53 NM_000546 44360 c.686_687delGT p.C229fs*10 Loss of Function Frame_Shift_Del
912 TP53 NM_000546 11114 c.528C>G p.C176W Loss of Function Missense_Mutation
913 TP53 NM_000546 46288 c.546C>T p.C182C Loss of Function Synonymous_Mutation
914 TP53 NM_000546 45677 c.714T>A p.C238* Loss of Function Nonsense_Mutation
915 TP53 NM_000546 43778 c.713G>T p.C238F Loss of Function Missense_Mutation
916 TP53 NM_000546 44563 c.544T>C p.C182R Loss of Function Missense_Mutation
917 TP53 NM_000546 43828 c.544T>A p.C182S Loss of Function Missense_Mutation
918 TP53 NM_000546 43700 c.712T>A p.C238S Loss of Function Missense_Mutation
919 TP53 NM_000546 44653 c.713G>C p.C238S Loss of Function Missense_Mutation
920 TP53 NM_000546 44676 c.714T>G p.C238W Loss of Function Missense_Mutation
921 TP53 NM_000546 11059 c.713G>A p.C238Y Loss of Function Missense_Mutation
922 TP53 NM_000546 44378 c.726C>A p.C242* Loss of Function Nonsense_Mutation
923 TP53 NM_000546 45691 c.726C>T p.C242C Loss of Function Synonymous_Mutation
924 TP53 NM_000546 10810 c.725G>T p.C242F Loss of Function Missense_Mutation
925 TP53 NM_000546 44657 c.722delC p.C242fs*5 Loss of Function Frame_Shift_Del
926 TP53 NM_000546 6530 c.723delC p.C242fs*5 Loss of Function Frame_Shift_Del
927 TP53 NM_000546 44546 c.545G>A p.C182Y Loss of Function Missense_Mutation
928 TP53 NM_000546 45612 c.685T>C p.C229R Loss of Function Missense_Mutation
929 TP53 NM_000546 11133 c.725G>C p.C242S Loss of Function Missense_Mutation
930 TP53 NM_000546 44935 c.724T>A p.C242S Loss of Function Missense_Mutation
931 TP53 NM_000546 44313 c.686G>A p.C229Y Loss of Function Missense_Mutation
932 TP53 NM_000546 10646 c.725G>A p.C242Y Loss of Function Missense_Mutation
933 TP53 NM_000546 44735 c.825T>C p.C275C Loss of Function Synonymous_Mutation
934 TP53 NM_000546 10701 c.824G>T p.C275F Loss of Function Missense_Mutation
935 TP53_ENST ENST00000269305 99626 c.713G>T p.C238F Loss of Function Missense_Mutation
936 TP53_ENST ENST00000413465 99624 c.713G>T p.C238F Loss of Function Missense_Mutation
937 TP53 NM_000546 45413 c.824G>C p.C275S Loss of Function Missense_Mutation
938 TP53 NM_000546 46336 c.712T>G p.C238G Loss of Function Missense_Mutation
939 TP53 NM_000546 10893 c.824G>A p.C275Y Loss of Function Missense_Mutation
940 TP53 NM_000546 44972 c.831T>A p.C277* Loss of Function Nonsense_Mutation
941 TP53 NM_000546 45109 c.831T>C p.C277C Loss of Function Synonymous_Mutation
942 TP53 NM_000546 10749 c.830G>T p.C277F Loss of Function Missense_Mutation
943 TP53 NM_000546 44321 c.712T>C p.C238R Loss of Function Missense_Mutation
944 TP53 NM_000546 44135 c.724T>G p.C242G Loss of Function Missense_Mutation
945 TP53 NM_000546 11738 c.724T>C p.C242R Loss of Function Missense_Mutation
946 TP53 NM_000546 45338 c.552T>C p.D184D Loss of Function Synonymous_Mutation
947 TP53 NM_000546 11356 c.726C>G p.C242W Loss of Function Missense_Mutation
948 TP53_ENST ENST00000269305 99932 c.824G>T p.C275F Loss of Function Missense_Mutation
949 TP53 NM_000546 11501 c.823T>G p.C275G Loss of Function Missense_Mutation
950 TP53 NM_000546 45823 c.558T>C p.D186D Loss of Function Synonymous_Mutation
951 TP53 NM_000546 45838 c.556delG p.D186fs*61 Loss of Function Frame_Shift_Del
952 TP53 NM_000546 43902 c.823T>C p.C275R Loss of Function Missense_Mutation
953 TP53 NM_000546 43823 c.825T>G p.C275W Loss of Function Missense_Mutation
954 TP53_ENST ENST00000269305 165084 c.824G>A p.C275Y Loss of Function Missense_Mutation
955 TP53 NM_000546 45074 c.829T>G p.C277G Loss of Function Missense_Mutation
956 TP53 NM_000546 45299 c.831T>G p.C277W Loss of Function Missense_Mutation
957 TP53 NM_000546 45796 c.623A>G p.D208G Loss of Function Missense_Mutation
958 TP53 NM_000546 43737 c.830G>A p.C277Y Loss of Function Missense_Mutation
959 TP53 NM_000546 44249 c.623A>T p.D208V Loss of Function Missense_Mutation
960 TP53_ENST ENST00000414315 99599 c.86>A p.C3Y Loss of Function Missense_Mutation
961 TP53 NM_000546 45028 c.684C>T p.D228D Loss of Function Synonymous_Mutation
962 TP53_ENST ENST00000545858 99600 c.125G>A p.C42Y Loss of Function Missense_Mutation
963 TP53_ENST ENST00000545858 117397 c.248G>T p.C83F Loss of Function Missense_Mutation
964 TP53_ENST ENST00000414315 117396 c.131G>T p.C44F Loss of Function Missense_Mutation
965 TP53 NM_000546 43797 c.550G>C p.D184H Loss of Function Missense_Mutation
966 TP53 NM_000546 44029 c.550G>A p.D184N Loss of Function Missense_Mutation
967 TP53 NM_000546 11665 c.842A>C p.D281A Loss of Function Missense_Mutation
968 TP53 NM_000546 43958 c.843C>T p.D281D Loss of Function Synonymous_Mutation
969 TP53 NM_000546 43837 c.843C>G p.D281E Loss of Function Missense_Mutation
970 TP53 NM_000546 43906 c.843C>A p.D281E Loss of Function Missense_Mutation
971 TP53 NM_000546 44202 c.550G>T p.D184Y Loss of Function Missense_Mutation
972 TP53 NM_000546 10943 c.841G>C p.D281H Loss of Function Missense_Mutation
973 TP53 NM_000546 43596 c.841G>A p.D281N Loss of Function Missense_Mutation
974 TP53 NM_000546 45729 c.842A>T p.D281V Loss of Function Missense_Mutation
975 TP53 NM_0005 11516 c.841G>T p.D281Y Loss of Function Missense_Mutation
976 TP53 NM_000546 44837 c.556G>C p.D186H Loss of Function Missense_Mutation
977 TP53 NM_000546 10996 c.511G>T p.E171* Loss of Function Nonsense_Mutation
978 TP53 NM_000546 46095 c.511delG p.E171fs*3 Loss of Function Frame_Shift_Del
979 TP53 NM_000546 44700 c.556G>A p.D186N Loss of Function Missense_Mutation
980 TP53 NM_000546 44312 c.511G>A p.E171K Loss of Function Missense_Mutation
981 TP53 NM_000546 45519 c.620A>G p.D207G Loss of Function Missense_Mutation
982 TP53 NM_000546 43597 c.538G>T p.E180* Loss of Function Nonsense_Mutation
983 TP53 NM_000546 45372 c.540G>T p.E180D Loss of Function Missense_Mutation
984 TP53 NM_000546 45707 c.624C>A p.D208E Loss of Function Missense_Mutation
985 TP53 NM_000546 44241 c.592G>T p.E198* Loss of Function Nonsense_Mutation
986 TP53 NM_000546 45851 c.624C>G p.D208E Loss of Function Missense_Mutation
987 TP53 NM_000546 43987 c.622G>A p.D208N Loss of Function Missense_Mutation
988 TP53 NM_000546 10804 c.610G>T p.E204* Loss of Function Nonsense_Mutation
989 TP53 NM_000546 43761 c.612G>A p.E204E Loss of Function Synonymous_Mutation
990 TP53 NM_000546 44011 c.610delG p.E204fs*43 Loss of Function Frame_Shift_Del
991 TP53 NM_000546 43862 c.683A>C p.D228A Loss of Function Missense_Mutation
992 TP53 NM_000546 43853 c.684C>G p.D228E Loss of Function Missense_Mutation
993 TP53 NM_000546 44817 c.661G>T p.E221* Loss of Function Nonsense_Mutation
994 TP53 NM_000546 43960 c.683A>G p.D228G Loss of Function Missense_Mutation
995 TP53 NM_000546 44398 c.682G>A p.D228N Loss of Function Missense_Mutation
996 TP53 NM_000546 43750 c.811G>T p.E271* Loss of Function Nonsense_Mutation
997 TP53 NM_000546 45529 c.683A>T p.D228V Loss of Function Missense_Mutation
998 TP53 NM_000546 45786 c.682G>T p.D228Y Loss of Function Missense_Mutation
999 TP53 NM_000546 11232 c.842A>G p.D281G Loss of Function Missense_Mutation
1000 TP53 NM_000546 10719 c.811G>A p.E271K Loss of Function Missense_Mutation
1001 TP53 NM_000546 11606 c.31G>C p.E11Q Loss of Function Missense_Mutation
1002 TP53 NM_000546 44469 c.812A>T p.E271V Loss of Function Missense_Mutation
1003 TP53 NM_000546 44388 c.853G>T p.E285* Loss of Function Nonsense_Mutation
1004 TP53 NM_000546 44732 c.512A>G p.E171G Loss of Function Missense_Mutation
1005 TP53 NM_000546 44709 c.855G>A p.E285E Loss of Function Synonymous_Mutation
1006 TP53 NM_000546 45751 c.511G>C p.E171Q Loss of Function Missense_Mutation
1007 TP53 NM_000546 10722 c.853G>A p.E285K Loss of Function Missense_Mutation
1008 TP53 NM_000546 43772 c.538G>A p.E180K Loss of Function Missense_Mutation
1009 TP53 NM_000546 43690 c.592G>A p.E198K Loss of Function Missense_Mutation
1010 TP53 NM_000546 43919 c.856G>T p.E286* Loss of Function Nonsense_Mutation
1011 TP53 NM_000546 44292 c.858A>G p.E286E Loss of Function Synonymous_Mutation
1012 TP53 NM_000546 44651 c.856_863delGAAGAGAA p.E286fs*17 Loss of Function Frame_Shift_Del
1013 TP53 NM_000546 45277 c.856delG p.E286fs*59 Loss of Function Frame_Shift_Del
1014 TP53 NM_000546 43565 c.857A>G p.E286G Loss of Function Missense_Mutation
1015 TP53 NM_000546 10726 c.856G>A p.E286K Loss of Function Missense_Mutation
1016 TP53 NM_000546 44250 c.856G>C p.E286Q Loss of Function Missense_Mutation
1017 TP53 NM_000546 43936 c.857A>T p.E286V Loss of Function Missense_Mutation
1018 TP53 NM_000546 44133 c.859G>T p.E287* Loss of Function Nonsense_Mutation
1019 TP53 NM_000546 43776 c.861G>A p.E287E Loss of Function Synonymous_Mutation
1020 TP53 NM_000546 45449 c.592G>C p.E198Q Loss of Function Missense_Mutation
1021 TP53 NM_000546 45253 c.611A>G p.E204G Loss of Function Missense_Mutation
1022 TP53 NM_000546 10856 c.880G>T p.E294* Loss of Function Nonsense_Mutation
1023 TP53 NM_000546 43990 c.610G>A p.E204K Loss of Function Missense_Mutation
1024 TP53 NM_000546 45516 c.662A>G p.E221G Loss of Function Missense_Mutation
1025 TP53 NM_000546 44207 c.874delA p.E294fs*51 Loss of Function Frame_Shift_Del
1026 TP53 NM_000546 45670 c.877delG p.E294fs*51 Loss of Function Frame_Shift_Del
1027 TP53 NM_000546 6621 c.880delG p.E294fs*51 Loss of Function Frame_Shift_Del
1028 TP53 NM_000546 44853 c.661G>A p.E221K Loss of Function Missense_Mutation
1029 TP53 NM_000546 44441 c.813G>C p.E271D Loss of Function Missense_Mutation
1030 TP53 NM_000546 45284 c.813G>A p.E271E Loss of Function Synonymous_Mutation
1031 TP53 NM_000546 10710 c.892G>T p.E298* Loss of Function Nonsense_Mutation
1032 TP53 NM_000546 43879 c.812A>G p.E271G Loss of Function Missense_Mutation
1033 TP53 NM_000546 11291 c.1006G>T p.E336* Loss of Function Nonsense_Mutation
1034 TP53 NM_000546 11286 c.1015G>T p.E339* Loss of Function Nonsense_Mutation
1035 TP53 NM_000546 11078 c.1027G>T p.E343* Loss of Function Nonsense_Mutation
1036 TP53 NM_000546 10770 c.1045G>T p.E349* Loss of Function Nonsense_Mutation
1037 TP53 NM_000546 43706 c.811G>C p.E271Q Loss of Function Missense_Mutation
1038 TP53 NM_000546 43614 c.854A>C p.E285A Loss of Function Missense_Mutation
1039 TP53 NM_000546 45649 c.854A>G p.E285G Loss of Function Missense_Mutation
1040 TP53 NM_000546 44654 c.400T>C p.F134L Loss of Function Missense_Mutation
1041 TP53_ENST ENST00000269305 137087 c.853G>A p.E285K Loss of Function Missense_Mutation
1042 TP53 NM_000546 43941 c.400T>G p.F134V Loss of Function Missense_Mutation
1043 TP53 NM_000546 44162 c.635_636delTT p.F212fs*3 Loss of Function Frame_Shift_Del
1044 TP53 NM_000546 44695 c.634_635delTT p.F212fs*3 Loss of Function Frame_Shift_Del
1045 TP53 NM_000546 45138 c.853G>C p.E285Q Loss of Function Missense_Mutation
1046 TP53 NM_000546 44227 c.854A>T p.E285V Loss of Function Missense_Mutation
1047 TP53_ENST ENST00000269305 99924 c.856G>A p.E286K Loss of Function Missense_Mutation
1048 TP53 NM_000546 43621 c.809T>G p.F270C Loss of Function Missense_Mutation
1049 TP53 NM_000546 43809 c.808T>A p.F270I Loss of Function Missense_Mutation
1050 TP53 NM_000546 44156 c.810T>A p.F270L Loss of Function Missense_Mutation
1051 TP53 NM_000546 44262 c.808T>C p.F270L Loss of Function Missense_Mutation
1052 TP53 NM_000546 45297 c.810T>G p.F270L Loss of Function Missense_Mutation
1053 TP53 NM_000546 11305 c.809T>C p.F270S Loss of Function Missense_Mutation
1054 TP53 NM_000546 44737 c.860A>G p.E287G Loss of Function Missense_Mutation
1055 TP53 NM_000546 44225 c.859G>A p.E287K Loss of Function Missense_Mutation
1056 TP53 NM_000546 42813 c.313G>T p.G105C Loss of Function Missense_Mutation
1057 TP53 NM_000546 44481 c.313G>T p.G105C Loss of Function Missense_Mutation
1058 TP53 NM_000546 45801 c.312delG p.G105fs*18 Loss of Function Frame_Shift_Del
1059 TP53 NM_000546 45179 c.313G>C p.G105R Loss of Function Missense_Mutation
1060 TP53 NM_000546 45534 c.882G>T p.E294D Loss of Function Missense_Mutation
1061 TP53 NM_000546 44715 c.460G>T p.G154C Loss of Function Missense_Mutation
1062 TP53 NM_000546 44412 c.882G>A p.E294E Loss of Function Synonymous_Mutation
1063 TP53 NM_000546 44726 c.460_466delGGCACCC p.G154fs*14 Loss of Function Frame_Shift_Del
1064 TP53 NM_000546 43666 c.462C>T p.G154G Loss of Function Synonymous_Mutation
1065 TP53 NM_000546 44298 c.462C>A p.G154G Loss of Function Synonymous_Mutation
1066 TP53 NM_000546 43746 c.881A>G p.E294G Loss of Function Missense_Mutation
1067 TP53 NM_000546 44127 c.880G>A p.E294K Loss of Function Missense_Mutation
1068 TP53 NM_000546 6815 c.461G>T p.G154V Loss of Function Missense_Mutation
1069 TP53 NM_000546 45824 c.880G>C p.E294Q Loss of Function Missense_Mutation
1070 TP53 NM_000546 45820 c.893A>T p.E298V Loss of Function Missense_Mutation
1071 TP53 NM_000546 44026 c.559G>A p.G187S Loss of Function Splice_Site
1072 TP53 NM_000546 45169 c.326T>C p.F109S Loss of Function Missense_Mutation
1073 TP53 NM_000546 44537 c.595G>T p.G199* Loss of Function NonsenseMutation
1074 TP53 NM_000546 43949 c.401T>G p.F134C Loss of Function Missense_Mutation
1075 TP53 NM_000546 45051 c.597A>G p.G199G Loss of Function Synonymous_Mutation
1076 TP53 NM_000546 11319 c.402T>G p.F134L Loss of Function Missense_Mutation
1077 TP53 NM_000546 44140 c.596G>T p.G199V Loss of Function Missense_Mutation
1078 TP53 NM_000546 44506 c.401T>C p.F134S Loss of Function Missense_Mutation
1079 TP53 NM_000546 45703 c.634T>A p.F212I Loss of Function Missense_Mutation
1080 TP53 NM_000546 45868 c.678C>T p.G226G Loss of Function Synonymous_Mutation
1081 TP53 NM_000546 44846 c.636T>A p.F212L Loss of Function Missense_Mutation
1082 TP53 NM_000546 46214 c.635T>C p.F212S Loss of Function Missense_Mutation
1083 TP53 NM_000546 44956 c.808T>G p.F270V Loss of Function Missense_Mutation
1084 TP53 NM_000546 11524 c.730G>T p.G244C Loss of Function Missense_Mutation
1085 TP53 NM_000546 10883 c.731G>A p.G244D Loss of Function Missense_Mutation
1086 TP53 NM_000546 44940 c.730delG p.G244fs*3 Loss of Function Frame_Shift_Del
1087 TP53 NM_000546 43656 c.732C>G p.G244G Loss of Function Synonymous_Mutation
1088 TP53 NM_000546 44513 c.732C>A p.G244G Loss of Function Synonymous_Mutation
1089 TP53 NM_000546 44787 c.732C>T p.G244G Loss of Function Synonymous_Mutation
1090 TP53 NM_000546 44221 c.730G>C p.G244R Loss of Function Missense_Mutation
1091 TP53 NM_000546 10941 c.730G>A p.G244S Loss of Function Missense_Mutation
1092 TP53 NM_000546 43918 c.809T>A p.F270Y Loss of Function Missense_Mutation
1093 TP53 NM_000546 13119 c.322_324delGGT p.G108del Loss of Function In_Frame_Del
1094 TP53 NM_000546 11081 c.733G>T p.G245C Loss of Function Missense_Mutation
1095 TP53 NM_000546 39293 c.734G>A p.G245D Loss of Function Missense_Mutation
1096 TP53 NM_000546 43606 c.734G>A p.G245D Loss of Function Missense_Mutation
1097 TP53 NM_000546 44642 c.733delG p.G245fs*2 Loss of Function Frame_Shift_Del
1098 TP53 NM_000546 44900 c.735C>T p.G245G Loss of Function Synonymous_Mutation
1099 TP53_ENST ENST00000545858 179807 c.455G>A p.G152D Loss of Function Missense_Mutation
1100 TP53 NM_000546 10957 c.733G>C p.G245R Loss of Function Missense_Mutation
1101 TP53 NM_000546 6932 c.733G>A p.G245S Loss of Function Missense_Mutation
1102 TP53 NM_000546 11196 c.734G>T p.G245V Loss of Function Missense_Mutation
1103 TP53 NM_000546 44891 c.796G>T p.G266* Loss of Function NonsenseMutation
1104 TP53_ENST ENST00000545858 121037 c.454G>A p.G152S Loss of Function Missense_Mutation
1105 TP53 NM_000546 10867 c.797G>A p.G266E Loss of Function Missense_Mutation
1106 TP53 NM_000546 10794 c.796G>A p.G266R Loss of Function Missense_Mutation
1107 TP53 NM_000546 11205 c.796G>C p.G266R Loss of Function Missense_Mutation
1108 TP53 NM_000546 10958 c.797G>T p.G266V Loss of Function Missense_Mutation
1109 TP53 NM_000546 43714 c.836G>A p.G279E Loss of Function Missense_Mutation
1110 TP53 NM_000546 44896 c.835_838delGGGA p.G279fs*65 Loss of Function Frame_Shift_Del
1111 TP53 NM_000546 46284 c.837G>A p.G279G Loss of Function Synonymous_Mutation
1112 TP53 NM_000546 44603 c.835G>A p.G279R Loss of Function Missense_Mutation
1113 TP53 NM_000546 45622 c.461G>A p.G154D Loss of Function Missense_Mutation
1114 TP53 NM_000546 45506 c.460_461GG>AT p.G154I Loss of Function Missense_Mutation
1115 TP53 NM_000546 44128 c.879G>A p.G293G Loss of Function Synonymous_Mutation
1116 TP53 NM_000546 44131 c.879G>C p.G293G Loss of Function Synonymous_Mutation
1117 TP53 NM_000546 43692 c.460G>A p.G154S Loss of Function Missense_Mutation
1118 TP53 NM_000546 45275 c.559G>T p.G187C Loss of Function Missense_Mutation
1119 TP53 NM_000546 87513 c.902_903insC p.G302fs*4 Loss of Function Frame_Shift_Ins
1120 TP53 NM_000546 45998 c.906G>C p.G302G Loss of Function Synonymous_Mutation
1121 TP53 NM_000546 11514 c.1001G>T p.G334V Loss of Function Missense_Mutation
1122 TP53 NM_000546 44023 c.560G>A p.G187D Loss of Function Missense_Mutation
1123 TP53 NM_000546 45479 c.504C>T p.H168H Loss of Function Synonymous_Mutation
1124 TP53 NM_000546 44801 c.503A>T p.H168L Loss of Function Missense_Mutation
1125 TP53 NM_000546 44808 c.503A>C p.H168P Loss of Function Missense_Mutation
1126 TP53 NM_000546 45240 c.560G>T p.G187V Loss of Function Missense_Mutation
1127 TP53 NM_000546 43989 c.596G>A p.G199E Loss of Function Missense_Mutation
1128 TP53 NM_000546 44901 c.532C>G p.H178D Loss of Function Missense_Mutation
1129 TP53 NM_000546 43978 c.529delC p.H178fs*69 Loss of Function Frame_Shift_Del
1130 TP53 NM_000546 44134 c.528delC p.H178fs*69 Loss of Function Frame_Shift_Del
1131 TP53 NM_000546 44659 c.532delC p.H178fs*69 Loss of Function Frame_Shift_Del
1132 TP53 NM_000546 44971 c.534C>T p.H178H Loss of Function Synonymous_Mutation
1133 TP53 NM_000546 43749 c.595G>A p.G199R Loss of Function Missense_Mutation
1134 TP53 NM_000546 45739 c.677G>C p.G226A Loss of Function Missense_Mutation
1135 TP53 NM_000546 11998 c.534C>A p.H178Q Loss of Function Missense_Mutation
1136 TP53 NM_000546 46163 c.534C>G p.H178Q Loss of Function Missense_Mutation
1137 TP53 NM_000546 44547 c.677G>A p.G226D Loss of Function Missense_Mutation
1138 TP53 NM_000546 44776 c.535C>G p.H179D Loss of Function Missense_Mutation
1139 TP53 NM_000546 44793 c.537T>C p.H179H Loss of Function Synonymous_Mutation
1140 TP53 NM_000546 43635 c.536A>T p.H179L Loss of Function Missense_Mutation
1141 TP53 NM_000546 44151 c.535C>A p.H179N Loss of Function Missense_Mutation
1142 TP53 NM_000546 44218 c.536A>C p.H179P Loss of Function Missense_Mutation
1143 TP53 NM_000546 11249 c.537T>G p.H179Q Loss of Function Missense_Mutation
1144 TP53 NM_000546 44214 c.537T>A p.H179Q Loss of Function Missense_Mutation
1145 TP53 NM_000546 10889 c.536A>G p.H179R Loss of Function Missense_Mutation
1146 TP53 NM_000546 10768 c.535C>T p.H179Y Loss of Function Missense_Mutation
1147 TP53 NM_000546 43584 c.534_535CC>TT p.H179Y Loss of Function Missense_Mutation
1148 TP53 NM_000546 44002 c.577C>G p.H193D Loss of Function Missense_Mutation
1149 TP53 NM_000546 44848 c.579T>C p.H193H Loss of Function Synonymous_Mutation
1150 TP53 NM_000546 11066 c.578A>T p.H193L Loss of Function Missense_Mutation
1151 TP53 NM_000546 45607 c.676G>A p.G226S Loss of Function Missense_Mutation
1152 TP53 NM_000546 43833 c.578A>C p.H193P Loss of Function Missense_Mutation
1153 TP53 NM_000546 10742 c.578A>G p.H193R Loss of Function Missense_Mutation
1154 TP53 NM_000546 10672 c.577C>T p.H193Y Loss of Function Missense_Mutation
1155 TP53 NM_000546 44399 c.677G>T p.G226V Loss of Function Missense_Mutation
1156 TP53 NM_000546 44372 c.640delC p.H214fs*33 Loss of Function Frame_Shift_Del
1157 TP53 NM_000546 44638 c.640_647delCATAGTGT p.H214fs*5 Loss of Function Frame_Shift_Del
1158 TP53 NM_000546 12013 c.731G>C p.G244A Loss of Function Missense_Mutation
1159 TP53 NM_000546 42811 c.641A>G p.H214R Loss of Function Missense_Mutation
1160 TP53 NM_000546 43687 c.641A>G p.H214R Loss of Function Missense_Mutation
1161 TP53 NM_000546 43652 c.731G>T p.G244V Loss of Function Missense_Mutation
1162 TP53 NM_000546 43965 c.734G>C p.G245A Loss of Function Missense_Mutation
1163 TP53_ENST ENST00000269305 179806 c.734G>A p.G245D Loss of Function Missense_Mutation
1164 TP53_ENST ENST00000413465 179805 c.734G>A p.G245D Loss of Function Missense_Mutation
1165 TP53 NM_000546 45410 c.733_734GG>AA p.G245N Loss of Function Missense_Mutation
1166 TP53 NM_000546 45069 c.886delC p.H296fs*49 Loss of Function Frame_Shift_Del
1167 TP53_ENST ENST00000269305 121035 c.733G>A p.G245S Loss of Function Missense_Mutation
1168 TP53_ENST ENST00000413465 121036 c.733G>A p.G245S Loss of Function Missense_Mutation
1169 TP53 NM_000546 45488 c.797G>C p.G266A Loss of Function Missense_Mutation
1170 TP53_ENST ENST00000269305 99952 c.797G>T p.G266V Loss of Function Missense_Mutation
1171 TP53 NM_000546 46032 c.836G>T p.G279V Loss of Function Missense_Mutation
1172 TP53 NM_000546 43674 c.835G>T p.G279W Loss of Function Missense_Mutation
1173 TP53 NM_000546 45417 c.877G>A p.G293R Loss of Function Missense_Mutation
1174 TP53 NM_000546 43988 c.905G>A p.G302E Loss of Function Missense_Mutation
1175 TP53 NM_000546 44830 c.1066G>T p.G356W Loss of Function Missense_Mutation
1176 TP53_ENST ENST00000545858 99918 c.299A>T p.H100L Loss of Function Missense_Mutation
1177 TP53 NM_000546 43545 c.503A>G p.H168R Loss of Function Missense_Mutation
1178 TP53 NM_000546 43861 c.502C>T p.H168Y Loss of Function Missense_Mutation
1179 TP53 NM_000546 44633 c.583A>T p.I195F Loss of Function Missense_Mutation
1180 TP53 NM_000546 44877 c.584T>A p.I195N Loss of Function Missense_Mutation
1181 TP53 NM_000546 44539 c.584T>G p.1195S Loss of Function Missense_Mutation
1182 TP53 NM_000546 11089 c.584T>C p.I195T Loss of Function Missense_Mutation
1183 TP53 NM_000546 43550 c.694A>T p.I232F Loss of Function Missense_Mutation
1184 TP53 NM_000546 10715 c.695T>A p.I232N Loss of Function Missense_Mutation
1185 TP53 NM_000546 45045 c.695T>G p.1232S Loss of Function Missense_Mutation
1186 TP53 NM_000546 44601 c.695T>C p.I232T Loss of Function Missense_Mutation
1187 TP53 NM_000546 44068 c.532C>A p.H178N Loss of Function Missense_Mutation
1188 TP53 NM_000546 44457 c.751_759delATCCTCACC p.1251_T253delILT Loss of Function In_Frame_Del
1189 TP53 NM_000546 44215 c.533A>C p.H178P Loss of Function Missense_Mutation
1190 TP53 NM_000546 43967 c.751A>T p.I251F Loss of Function Missense_Mutation
1191 TP53 NM_000546 44064 c.748delC p.I251fs*94 Loss of Function Frame_Shift_Del
1192 TP53 NM_000546 44124 c.751delA p.I251fs*94 Loss of Function Frame_Shift_Del
1193 TP53 NM_000546 44511 c.753C>A p.I251I Loss of Function Synonymous_Mutation
1194 TP53 NM_000546 44120 c.532C>T p.H178Y Loss of Function Missense_Mutation
1195 TP53 NM_000546 11374 c.752T>A p.I251N Loss of Function Missense_Mutation
1196 TP53 NM_000546 43829 c.752T>G p.1251S Loss of Function Missense_Mutation
1197 TP53_ENST ENST00000269305 129848 c.535C>T p.H179Y Loss of Function Missense_Mutation
1198 TP53_ENST ENST00000413465 129849 c.535C>T p.H179Y Loss of Function Missense_Mutation
1199 TP53_ENST ENST00000269305 99919 c.578A>T p.H193L Loss of Function Missense_Mutation
1200 TP53_ENST ENST00000413465 99916 c.578A>T p.H193L Loss of Function Missense_Mutation
1201 TP53 NM_000546 43935 c.577C>A p.H193N Loss of Function Missense_Mutation
1202 TP53 NM_000546 45035 c.761T>G p.1254S Loss of Function Missense_Mutation
1203 TP53 NM_000546 45115 c.640C>G p.H214D Loss of Function Missense_Mutation
1204 TP53 NM_000546 44407 c.642T>G p.H214Q Loss of Function Missense_Mutation
1205 TP53 NM_000546 43651 c.763A>T p.I255F Loss of Function Missense_Mutation
1206 TP53 NM_000546 11244 c.764T>A p.I255N Loss of Function Missense_Mutation
1207 TP53 NM_000546 10788 c.764T>G p.1255S Loss of Function Missense_Mutation
1208 TP53 NM_000546 44112 c.640C>T p.H214Y Loss of Function Missense_Mutation
1209 TP53 NM_000546 46031 c.697C>G p.H233D Loss of Function Missense_Mutation
1210 TP53 NM_000546 45959 c.698A>T p.H233L Loss of Function Missense_Mutation
1211 TP53 NM_000546 44641 c.394A>T p.K132* Loss of Function NonsenseMutation
1212 TP53 NM_000546 10813 c.394A>G p.K132E Loss of Function Missense_Mutation
1213 TP53 NM_000546 43661 c.394delA p.K132fs*38 Loss of Function Frame_Shift_Del
1214 TP53 NM_000546 43592 c.395A>T p.K132M Loss of Function Missense_Mutation
1215 TP53 NM_000546 10991 c.396G>T p.K132N Loss of Function Missense_Mutation
1216 TP53 NM_000546 43963 c.396G>C p.K132N Loss of Function Missense_Mutation
1217 TP53 NM_000546 44350 c.699C>G p.H233Q Loss of Function Missense_Mutation
1218 TP53 NM_000546 11582 c.395A>G p.K132R Loss of Function Missense_Mutation
1219 TP53 NM_000546 43912 c.395A>C p.K132T Loss of Function Missense_Mutation
1220 TP53 NM_000546 10750 c.490A>T p.K164* Loss of Function Nonsense_Mutation
1221 TP53 NM_000546 10762 c.490A>G p.K164E Loss of Function Missense_Mutation
1222 TP53 NM_000546 45187 c.490_499del10 p.K164fs*3 Loss of Function Frame_Shift_Del
1223 TP53 NM_000546 44861 c.490delA p.K164fs*6 Loss of Function Frame_Shift_Del
1224 TP53 NM_000546 45103 c.492G>A p.K164K Loss of Function Synonymous_Mutation
1225 TP53 NM_000546 44705 c.697C>T p.H233Y Loss of Function Missense_Mutation
1226 TP53 NM_000546 44522 c.887A>T p.H296L Loss of Function Missense_Mutation
1227 TP53 NM_000546 45306 c.886C>A p.H296N Loss of Function Missense_Mutation
1228 TP53 NM_000546 43915 c.886C>T p.H296Y Loss of Function Missense_Mutation
1229 TP53 NM_000546 44475 c.871A>T p.K291* Loss of Function Nonsense_Mutation
1230 TP53 NM_000546 45494 c.888_889CC>TT p.H297Y Loss of Function Missense_Mutation
1231 TP53 NM_000546 44897 c.871_889del19 p.K291fs*48 Loss of Function Frame_Shift_Del
1232 TP53 NM_000546 46224 c.873G>A p.K291K Loss of Function Synonymous_Mutation
1233 TP53 NM_000546 45803 c.889C>T p.H297Y Loss of Function Missense_Mutation
1234 TP53_ENST ENST00000414315 129851 c.139C>T p.H47Y Loss of Function Missense_Mutation
1235 TP53_ENST ENST00000414315 99917 c.182A>T p.H61L Loss of Function Missense_Mutation
1236 TP53_ENST ENST00000545858 129850 c.256C>T p.H86Y Loss of Function Missense_Mutation
1237 TP53 NM_000546 44320 c.484A>T p.I162F Loss of Function Missense_Mutation
1238 TP53 NM_000546 44694 c.486C>A p.1162I Loss of Function Missense_Mutation
1239 TP53 NM_000546 45627 c.486C>T p.1162I Loss of Function Missense_Mutation
1240 TP53 NM_000546 43773 c.913A>T p.K305* Loss of Function Nonsense_Mutation
1241 TP53 NM_000546 44125 c.486C>G p.I162M Loss of Function Missense_Mutation
1242 TP53 NM_000546 11966 c.485T>A p.I162N Loss of Function Missense_Mutation
1243 TP53 NM_000546 11449 c.388C>T p.L130F Loss of Function Missense_Mutation
1244 TP53 NM_000546 43898 c.485T>G p.1162S Loss of Function Missense_Mutation
1245 TP53 NM_000546 45077 c.390C>T p.L130L Loss of Function Synonymous_Mutation
1246 TP53 NM_000546 44413 c.484A>G p.I162V Loss of Function Missense_Mutation
1247 TP53 NM_000546 11462 c.388C>G p.L130V Loss of Function Missense_Mutation
1248 TP53 NM_000546 10995 c.580C>T p.L194F Loss of Function Missense_Mutation
1249 TP53 NM_000546 43623 c.581T>A p.L194H Loss of Function Missense_Mutation
1250 TP53 NM_000546 43929 c.582T>C p.L194L Loss of Function Synonymous_Mutation
1251 TP53 NM_000546 43827 c.581T>C p.L194P Loss of Function Missense_Mutation
1252 TP53 NM_000546 44571 c.581T>G p.L194R Loss of Function Missense_Mutation
1253 TP53 NM_000546 44622 c.694A>G p.I232V Loss of Function Missense_Mutation
1254 TP53 NM_000546 44650 c.751_753delATC p.1251del Loss of Function In_Frame_Del
1255 TP53 NM_000546 44157 c.601delT p.L201fs*46 Loss of Function Frame_Shift_Del
1256 TP53 NM_000546 43793 c.617T>A p.L206* Loss of Function Nonsense_Mutation
1257 TP53 NM_000546 44852 c.617delT p.L206fs*41 Loss of Function Frame_Shift_Del
1258 TP53 NM_000546 10931 c.751A>C p.I251L Loss of Function Missense_Mutation
1259 TP53 NM_000546 11213 c.752T>C p.I251T Loss of Function Missense_Mutation
1260 TP53 NM_000546 44541 c.754delC p.L252fs*93 Loss of Function Frame_Shift_Del
1261 TP53 NM_000546 45407 c.751A>G p.I251V Loss of Function Missense_Mutation
1262 TP53 NM_000546 44769 c.755T>C p.L252P Loss of Function Missense_Mutation
1263 TP53 NM_000546 11929 c.760_761AT>GA p.I254D Loss of Function Missense_Mutation
1264 TP53 NM_000546 11011 c.794T>C p.L265P Loss of Function Missense_Mutation
1265 TP53 NM_000546 44092 c.794T>G p.L265R Loss of Function Missense_Mutation
1266 TP53 NM_000546 45446 c.865C>T p.L289F Loss of Function Missense_Mutation
1267 TP53 NM_000546 45688 c.867C>T p.L289L Loss of Function Synonymous_Mutation
1268 TP53 NM_000546 45647 c.760A>T p.I254F Loss of Function Missense_Mutation
1269 TP53 NM_000546 44535 c.761T>A p.I254N Loss of Function Missense_Mutation
1270 TP53 NM_000546 46015 c.1043T>A p.L348* Loss of Function Nonsense_Mutation
1271 TP53 NM_000546 46348 c.1044G>T p.L348F Loss of Function Missense_Mutation
1272 TP53 NM_000546 45586 c.397delA p.M133fs*37 Loss of Function Frame_Shift_Del
1273 TP53 NM_000546 44058 c.761T>C p.I254T Loss of Function Missense_Mutation
1274 TP53 NM_000546 11781 c.398T>A p.M133K Loss of Function Missense_Mutation
1275 TP53 NM_000546 44030 c.760A>G p.I254V Loss of Function Missense_Mutation
1276 TP53 NM_000546 11181 c.764T>C p.I255T Loss of Function Missense_Mutation
1277 TP53 NM_000546 44290 c.763A>G p.I255V Loss of Function Missense_Mutation
1278 TP53 NM_000546 44986 c.302A>G p.K101R Loss of Function Missense_Mutation
1279 TP53 NM_000546 11224 c.394A>C p.K132Q Loss of Function Missense_Mutation
1280 TP53 NM_000546 44841 c.491A>T p.K164M Loss of Function Missense_Mutation
1281 TP53 NM_000546 11369 c.492G>T p.K164N Loss of Function Missense_Mutation
1282 TP53 NM_000546 44126 c.507G>A p.M169I Loss of Function Missense_Mutation
1283 TP53 NM_000546 45490 c.507G>T p.M169I Loss of Function Missense_Mutation
1284 TP53 NM_000546 44521 c.490A>C p.K164Q Loss of Function Missense_Mutation
1285 TP53 NM_000546 44387 c.491A>C p.K164T Loss of Function Missense_Mutation
1286 TP53 NM_000546 45162 c.709delA p.M237fs*10 Loss of Function Frame_Shift_Del
1287 TP53 NM_000546 45862 c.710delT p.M237fs*10 Loss of Function Frame_Shift_Del
1288 TP53 NM_000546 10834 c.711G>A p.M237I Loss of Function Missense_Mutation
1289 TP53 NM_000546 11063 c.711G>T p.M237I Loss of Function Missense_Mutation
1290 TP53 NM_000546 44415 c.711G>C p.M237I Loss of Function Missense_Mutation
1291 TP53 NM_000546 43952 c.710T>A p.M237K Loss of Function Missense_Mutation
1292 TP53 NM_000546 45050 c.871A>G p.K291E Loss of Function Missense_Mutation
1293 TP53 NM_000546 44446 c.873G>C p.K291N Loss of Function Missense_Mutation
1294 TP53 NM_000546 43747 c.872A>G p.K291R Loss of Function Missense_Mutation
1295 TP53 NM_000546 44525 c.709A>G p.M237V Loss of Function Missense_Mutation
1296 TP53 NM_000546 44433 c.872A>C p.K291T Loss of Function Missense_Mutation
1297 TP53 NM_000546 44451 c.874A>G p.K292E Loss of Function Missense_Mutation
1298 TP53 NM_000546 45611 c.876A>C p.K292N Loss of Function Missense_Mutation
1299 TP53 NM_000546 43624 c.875A>G p.K292R Loss of Function Missense_Mutation
1300 TP53 NM_000546 44346 c.875A>C p.K292T Loss of Function Missense_Mutation
1301 TP53 NM_000546 44345 c.915G>T p.K305N Loss of Function Missense_Mutation
1302 TP53 NM_000546 43743 c.914A>G p.K305R Loss of Function Missense_Mutation
1303 TP53 NM_000546 46114 c.389T>A p.L130H Loss of Function Missense_Mutation
1304 TP53 NM_000546 44664 c.736_750del15 p.M246_P250delMN Loss of Function In_Frame_Del
1305 TP53 NM_000546 44903 c.736delA p.M246fs*1 Loss of Function Frame_Shift_Del
1306 TP53 NM_000546 10757 c.738G>C p.M246I Loss of Function Missense_Mutation
1307 TP53 NM_000546 44310 c.738G>A p.M246I Loss of Function Missense_Mutation
1308 TP53 NM_000546 46136 c.738G>T p.M246I Loss of Function Missense_Mutation
1309 TP53 NM_000546 44063 c.389T>G p.L130R Loss of Function Missense_Mutation
1310 TP53 NM_000546 43777 c.603G>C p.L201F Loss of Function Missense_Mutation
1311 TP53 NM_000546 11376 c.737T>G p.M246R Loss of Function Missense_Mutation
1312 TP53 NM_000546 45489 c.603G>T p.L201F Loss of Function Missense_Mutation
1313 TP53 NM_000546 43555 c.736A>G p.M246V Loss of Function Missense_Mutation
1314 TP53 NM_000546 44247 c.754_756delCTC p.L252del Loss of Function In_Frame_Del
1315 TP53 NM_000546 44054 c.754C>T p.L252F Loss of Function Missense_Mutation
1316 TP53 NM_000546 45882 c.391delA p.N131fs*39 Loss of Function Frame_Shift_Del
1317 TP53 NM_000546 45091 c.755T>A p.L252H Loss of Function Missense_Mutation
1318 TP53 NM_000546 45393 c.793C>A p.L265M Loss of Function Missense_Mutation
1319 TP53 NM_000546 43968 c.866T>C p.L289P Loss of Function Missense_Mutation
1320 TP53 NM_000546 44070 c.1031T>C p.L344P Loss of Function Missense_Mutation
1321 TP53 NM_000546 43859 c.598delA p.N200fs*47 Loss of Function Frame_Shift_Del
1322 TP53 NM_000546 44206 c.399G>T p.M133I Loss of Function Missense_Mutation
1323 TP53 NM_000546 43730 c.398T>G p.M133R Loss of Function Missense_Mutation
1324 TP53 NM_000546 43641 c.628delA p.N210fs*37 Loss of Function Frame_Shift_Del
1325 TP53 NM_000546 43723 c.398T>C p.M133T Loss of Function Missense_Mutation
1326 TP53_ENST ENST00000545858 99647 c.432G>A p.M144I Loss of Function Missense_Mutation
1327 TP53 NM_000546 43891 c.480G>A p.M160I Loss of Function Missense_Mutation
1328 TP53 NM_000546 45674 c.480G>T p.M160I Loss of Function Missense_Mutation
1329 TP53 NM_000546 44305 c.479T>A p.M160K Loss of Function Missense_Mutation
1330 TP53 NM_000546 44842 c.478A>C p.M160L Loss of Function Missense_Mutation
1331 TP53 NM_000546 44328 c.478A>G p.M160V Loss of Function Missense_Mutation
1332 TP53 NM_000546 45134 c.715_726del12 p.N239_C242delNSS Loss of Function In_Frame_Del
1333 TP53 NM_000546 43851 c.506T>C p.M169T Loss of Function Missense_Mutation
1334 TP53 NM_000546 10777 c.715A>G p.N239D Loss of Function Missense_Mutation
1335 TP53 NM_000546 69195 c.714_715insT p.N239fs*1 Loss of Function Frame_Shift_Ins
1336 TP53 NM_000546 44183 c.715delA p.N239fs*8 Loss of Function Frame_Shift_Del
1337 TP53 NM_000546 44431 c.505A>G p.M169V Loss of Function Missense_Mutation
1338 TP53_ENST ENST00000269305 99648 c.711G>A p.M237I Loss of Function Missense_Mutation
1339 TP53 NM_000546 44094 c.716A>G p.N239S Loss of Function Missense_Mutation
1340 TP53_ENST ENST00000413465 99646 c.711G>A p.M237I Loss of Function Missense_Mutation
1341 TP53 NM_000546 44965 c.709A>T p.M237L Loss of Function Missense_Mutation
1342 TP53 NM_000546 6546 c.741_742CC>AT p.N247_R248>KW Loss of Function In_Frame_Del
1343 TP53 NM_000546 45032 c.710T>G p.M237R Loss of Function Missense_Mutation
1344 TP53 NM_000546 43995 c.740A>T p.N247I Loss of Function Missense_Mutation
1345 TP53 NM_000546 45329 c.710T>C p.M237T Loss of Function Missense_Mutation
1346 TP53 NM_000546 44428 c.741C>T p.N247N Loss of Function Synonymous_Mutation
1347 TP53 NM_000546 44129 c.729G>A p.M243I Loss of Function Missense_Mutation
1348 TP53 NM_000546 46228 c.729G>C p.M243I Loss of Function Missense_Mutation
1349 TP53 NM_000546 44322 c.728T>A p.M243K Loss of Function Missense_Mutation
1350 TP53 NM_000546 43726 c.727A>T p.M243L Loss of Function Missense_Mutation
1351 TP53 NM_000546 43765 c.727A>C p.M243L Loss of Function Missense_Mutation
1352 TP53 NM_000546 46208 c.859_872del14 p.N288fs*13 Loss of Function Frame_Shift_Del
1353 TP53 NM_000546 45459 c.862delA p.N288fs*57 Loss of Function Frame_Shift_Del
1354 TP53 NM_000546 44514 c.728T>G p.M243R Loss of Function Missense_Mutation
1355 TP53 NM_000546 44536 c.728T>C p.M243T Loss of Function Missense_Mutation
1356 TP53 NM_000546 44879 c.1033delA p.N345fs*25 Loss of Function Frame_Shift_Del
1357 TP53 NM_000546 44396 c.382delC p.P128fs*42 Loss of Function Frame_Shift_Del
1358 TP53 NM_000546 46131 c.380delC p.P128fs*42 Loss of Function Frame_Shift_Del
1359 TP53 NM_000546 44844 c.727A>G p.M243V Loss of Function Missense_Mutation
1360 TP53 NM_000546 44103 c.737T>A p.M246K Loss of Function Missense_Mutation
1361 TP53 NM_000546 44749 c.453C>T p.P151P Loss of Function Synonymous_Mutation
1362 TP53 NM_000546 45594 c.453C>G p.P151P Loss of Function Synonymous_Mutation
1363 TP53 NM_000546 45992 c.736A>T p.M246L Loss of Function Missense_Mutation
1364 TP53 NM_000546 10790 c.455C>T p.P152L Loss of Function Missense_Mutation
1365 TP53 NM_000546 44061 c.456G>A p.P152P Loss of Function Synonymous_Mutation
1366 TP53 NM_000546 44613 c.455C>A p.P152Q Loss of Function Missense_Mutation
1367 TP53 NM_000546 45505 c.455C>G p.P152R Loss of Function Missense_Mutation
1368 TP53 NM_000546 43582 c.454C>T p.P152S Loss of Function Missense_Mutation
1369 TP53 NM_000546 11355 c.737T>C p.M246T Loss of Function Missense_Mutation
1370 TP53 NM_000546 44212 c.391_393delAAC p.N131del Loss of Function In_Frame_Del
1371 TP53 NM_000546 43964 c.459C>T p.P153P Loss of Function Synonymous_Mutation
1372 TP53 NM_000546 44416 c.459C>A p.P153P Loss of Function Synonymous_Mutation
1373 TP53 NM_000546 44589 c.393_395delCAA p.N131del Loss of Function In_Frame_Del
1374 TP53 NM_000546 43535 c.391A>C p.N131H Loss of Function Missense_Mutation
1375 TP53 NM_000546 43570 c.529_546del18 p.P177_C182delPHH Loss of Function In_Frame_Del
1376 TP53 NM_000546 44730 c.529_545del17 p.P177fs*3 Loss of Function Frame_Shift_Del
1377 TP53 NM_000546 44794 c.392A>T p.N131I Loss of Function Missense_Mutation
1378 TP53 NM_000546 44097 c.530C>T p.P177L Loss of Function Missense_Mutation
1379 TP53 NM_000546 43679 c.531C>T p.P177P Loss of Function Synonymous_Mutation
1380 TP53 NM_000546 44818 c.531C>G p.P177P Loss of Function Synonymous_Mutation
1381 TP53 NM_000546 10651 c.530C>G p.P177R Loss of Function Missense_Mutation
1382 TP53 NM_000546 44474 c.392A>G p.N131S Loss of Function Missense_Mutation
1383 TP53 NM_000546 43533 c.391A>T p.N131Y Loss of Function Missense_Mutation
1384 TP53 NM_000546 46107 c.599A>T p.N200I Loss of Function Missense_Mutation
1385 TP53 NM_000546 39455 c.569delC p.P190fs*57 Loss of Function Frame_Shift_Del
1386 TP53 NM_000546 45320 c.569delC p.P190fs*57 Loss of Function Frame_Shift_Del
1387 TP53 NM_000546 43657 c.569C>T p.P190L Loss of Function Missense_Mutation
1388 TP53 NM_000546 44502 c.599A>G p.N200S Loss of Function Missense_Mutation
1389 TP53 NM_000546 45441 c.629A>G p.N210S Loss of Function Missense_Mutation
1390 TP53 NM_000546 11542 c.703A>G p.N235D Loss of Function Missense_Mutation
1391 TP53 NM_000546 44784 c.703_705delAAC p.N235del Loss of Function In_Frame_Del
1392 TP53 NM_000546 43860 c.704A>T p.N235I Loss of Function Missense_Mutation
1393 TP53 NM_000546 45341 c.571delC p.P191fs*56 Loss of Function Frame_Shift_Del
1394 TP53 NM_000546 43616 c.704A>G p.N235S Loss of Function Missense_Mutation
1395 TP53 NM_000546 45620 c.704A>C p.N235T Loss of Function Missense_Mutation
1396 TP53 NM_000546 45172 c.703A>T p.N235Y Loss of Function Missense_Mutation
1397 TP53 NM_000546 45055 c.715_720delAACAGT p.N239_5240delNS Loss of Function In_Frame_Del
1398 TP53 NM_000546 44689 c.657C>T p.P219P Loss of Function Synonymous_Mutation
1399 TP53 NM_000546 44510 c.717C>G p.N239K Loss of Function Missense_Mutation
1400 TP53 NM_000546 44647 c.717C>A p.N239K Loss of Function Missense_Mutation
1401 TP53 NM_000546 43801 c.716A>C p.N239T Loss of Function Missense_Mutation
1402 TP53 NM_000546 45870 c.715A>T p.N239Y Loss of Function Missense_Mutation
1403 TP53 NM_000546 45005 c.739A>G p.N247D Loss of Function Missense_Mutation
1404 TP53 NM_000546 45632 c.741C>A p.N247K Loss of Function Missense_Mutation
1405 TP53 NM_000546 10771 c.749C>T p.P250L Loss of Function Missense_Mutation
1406 TP53 NM_000546 44512 c.740A>G p.N247S Loss of Function Missense_Mutation
1407 TP53 NM_000546 43588 c.740A>C p.N247T Loss of Function Missense_Mutation
1408 TP53 NM_000546 43864 c.739A>T p.N247Y Loss of Function Missense_Mutation
1409 TP53 NM_000546 43979 c.802A>C p.N268H Loss of Function Missense_Mutation
1410 TP53 NM_000546 10814 c.832C>G p.P278A Loss of Function Missense_Mutation
1411 TP53 NM_000546 44868 c.804C>T p.N268N Loss of Function Synonymous_Mutation
1412 TP53 NM_000546 44871 c.833delC p.P278fs*67 Loss of Function Frame_Shift_Del
1413 TP53 NM_000546 45178 c.832delC p.P278fs*67 Loss of Function Frame_Shift_Del
1414 TP53 NM_000546 43755 c.833C>A p.P278H Loss of Function Missense_Mutation
1415 TP53 NM_000546 10863 c.833C>T p.P278L Loss of Function Missense_Mutation
1416 TP53 NM_000546 10887 c.833C>G p.P278R Loss of Function Missense_Mutation
1417 TP53 NM_000546 10939 c.832C>T p.P278S Loss of Function Missense_Mutation
1418 TP53 NM_000546 43697 c.832C>A p.P278T Loss of Function Missense_Mutation
1419 TP53 NM_000546 44523 c.863A>G p.N288S Loss of Function Missense_Mutation
1420 TP53 NM_000546 45332 c.885T>C p.P295P Loss of Function Synonymous_Mutation
1421 TP53 NM_000546 43725 c.862A>T p.N288Y Loss of Function Missense_Mutation
1422 TP53 NM_000546 45131 c.383C>T p.P128L Loss of Function Missense_Mutation
1423 TP53 NM_000546 44397 c.382C>T p.P128S Loss of Function Missense_Mutation
1424 TP53 NM_000546 44788 c.454C>G p.P152A Loss of Function Missense_Mutation
1425 TP53 NM_000546 45184 c.902delC p.P301fs*44 Loss of Function Frame_Shift_Del
1426 TP53 NM_000546 45487 c.898delC p.P301fs*44 Loss of Function Frame_Shift_Del
1427 TP53 NM_000546 45546 c.901delC p.P301fs*44 Loss of Function Frame_Shift_Del
1428 TP53 NM_000546 44165 c.903A>G p.P301P Loss of Function Synonymous_Mutation
1429 TP53_ENST ENST00000269305 129856 c.455C>T p.P152L Loss of Function Missense_Mutation
1430 TP53_ENST ENST00000413465 129857 c.455C>T p.P152L Loss of Function Missense_Mutation
1431 TP53 NM_000546 44561 c.454C>A p.P152T Loss of Function Missense_Mutation
1432 TP53 NM_000546 44367 c.458C>T p.P153L Loss of Function Missense_Mutation
1433 TP53 NM_000546 43675 c.457C>T p.P153S Loss of Function Missense_Mutation
1434 TP53 NM_000546 45660 c.457C>A p.P153T Loss of Function Missense_Mutation
1435 TP53 NM_000546 45326 c.530C>A p.P177H Loss of Function Missense_Mutation
1436 TP53 NM_000546 10650 c.529C>T p.P1775 Loss of Function Missense_Mutation
1437 TP53 NM_000546 44426 c.568C>G p.P190A Loss of Function Missense_Mutation
1438 TP53 NM_000546 44032 c.298C>T p.Q100* Loss of Function Nonsense_Mutation
1439 TP53 NM_000546 10886 c.310C>T p.Q104* Loss of Function Nonsense_Mutation
1440 TP53 NM_000546 11166 c.406C>T p.Q136* Loss of Function Nonsense_Mutation
1441 TP53 NM_000546 43767 c.406C>G p.Q136E Loss of Function Missense_Mutation
1442 TP53 NM_000546 45089 c.407A>C p.Q136P Loss of Function Missense_Mutation
1443 TP53 NM_000546 44665 c.568_570delCCT p.P190del Loss of Function In_Frame_Del
1444 TP53 NM_000546 43632 c.493C>T p.Q165* Loss of Function Nonsense_Mutation
1445 TP53 NM_000546 44004 c.569C>G p.P190R Loss of Function Missense_Mutation
1446 TP53 NM_000546 44682 c.568C>T p.P1905 Loss of Function Missense_Mutation
1447 TP53 NM_000546 44438 c.568C>A p.P190T Loss of Function Missense_Mutation
1448 TP53 NM_000546 11333 c.499C>T p.Q167* Loss of Function Nonsense_Mutation
1449 TP53 NM_000546 44275 c.499_500delCA p.Q167f5*13 Loss of Function Frame_Shift_Del
1450 TP53 NM_000546 51646 c.498_499insC p.Q167f5*14 Loss of Function Frame_Shift_Ins
1451 TP53 NM_000546 44336 c.499delC p.Q167f5*3 Loss of Function Frame_Shift_Del
1452 TP53 NM_000546 44234 c.571_573delCCT p.P191del Loss of Function In_Frame_Del
1453 TP53 NM_000546 45140 c.572_574delCTC p.P191del Loss of Function In_Frame_Del
1454 TP53 NM_000546 44299 c.501G>A p.Q1670 Loss of Function Synonymous_Mutation
1455 TP53_ENST ENST00000269305 111724 c.572_574delCTC p.P191delP Loss of Function In_Frame_Del
1456 TP53 NM_000546 10733 c.574C>T p.Q192* Loss of Function Nonsense_Mutation
1457 TP53_ENST ENST00000413465 111721 c.572_574delCTC p.P191delP Loss of Function In_Frame_Del
1458 TP53 NM_000546 43782 c.576G>A p.Q192Q Loss of Function Synonymous_Mutation
1459 TP53 NM_000546 44351 c.572C>T p.P191L Loss of Function Missense_Mutation
1460 TP53 NM_000546 44172 c.572C>G p.P191R Loss of Function Missense_Mutation
1461 TP53 NM_000546 43682 c.328C>T p.R110C Loss of Function Missense_Mutation
1462 TP53 NM_000546 43702 c.571C>T p.P191S Loss of Function Missense_Mutation
1463 TP53 NM_000546 10716 c.329G>T p.R110L Loss of Function Missense_Mutation
1464 TP53 NM_000546 11250 c.329G>C p.R110P Loss of Function Missense_Mutation
1465 TP53_ENST ENST00000414315 129859 c.59C>T p.P20L Loss of Function Missense_Mutation
1466 TP53 NM_000546 46124 c.466C>T p.R156C Loss of Function Missense_Mutation
1467 TP53 NM_000546 45896 c.466delC p.R156fs*14 Loss of Function Frame_Shift_Del
1468 TP53 NM_000546 44439 c.656C>T p.P219L Loss of Function Missense_Mutation
1469 TP53 NM_000546 43739 c.467G>A p.R156H Loss of Function Missense_Mutation
1470 TP53 NM_000546 44076 c.655C>T p.P219S Loss of Function Missense_Mutation
1471 TP53 NM_000546 10760 c.467G>C p.R156P Loss of Function Missense_Mutation
1472 TP53 NM_000546 44301 c.468C>G p.R156R Loss of Function Synonymous_Mutation
1473 TP53 NM_000546 44854 c.655C>A p.P219T Loss of Function Missense_Mutation
1474 TP53 NM_000546 44921 c.748_756delCCCATCCTC p.P250_1_252delPIL Loss of Function In_Frame_Del
1475 TP53 NM_000546 43848 c.472C>T p.R158C Loss of Function Missense_Mutation
1476 TP53 NM_000546 45019 c.471_472CC>TT p.R158C Loss of Function Missense_Mutation
1477 TP53 NM_000546 43831 c.472_475delCGCG p.R158fs*11 Loss of Function Frame_Shift_Del
1478 TP53 NM_000546 43781 c.472delC p.R158fs*12 Loss of Function Frame_Shift_Del
1479 TP53 NM_000546 11087 c.472C>G p.R158G Loss of Function Missense_Mutation
1480 TP53 NM_000546 10690 c.473G>A p.R158H Loss of Function Missense_Mutation
1481 TP53 NM_000546 10714 c.473G>T p.R158L Loss of Function Missense_Mutation
1482 TP53 NM_000546 44096 c.748C>G p.P250A Loss of Function Missense_Mutation
1483 TP53 NM_000546 43940 c.474C>T p.R158R Loss of Function Synonymous_Mutation
1484 TP53 NM_000546 46393 c.520_536del17 p.R174fs*1 Loss of Function Frame_Shift_Del
1485 TP53 NM_000546 44725 c.522delG p.R174fs*73 Loss of Function Frame_Shift_Del
1486 TP53 NM_000546 44609 c.748_749CC>TT p.P250F Loss of Function Missense_Mutation
1487 TP53 NM_000546 44476 c.749C>A p.P250H Loss of Function Missense_Mutation
1488 TP53 NM_000546 45034 c.748_749CC>AA p.P250N Loss of Function Missense_Mutation
1489 TP53 NM_000546 43957 c.750C>T p.P250P Loss of Function Synonymous_Mutation
1490 TP53 NM_000546 44742 c.523_540del18 p.R175_E180delRCP Loss of Function Frame_Shift_Del
1491 TP53 NM_000546 43680 c.523C>T p.R175C Loss of Function Missense_Mutation
1492 TP53 NM_000546 10870 c.523C>G p.R175G Loss of Function Missense_Mutation
1493 TP53 NM_000546 10648 c.524G>A p.R175H Loss of Function Missense_Mutation
1494 TP53 NM_000546 44464 c.749_750CC>AG p.P250Q Loss of Function Missense_Mutation
1495 TP53 NM_000546 43695 c.748C>T p.P250S Loss of Function Missense_Mutation
1496 TP53 NM_000546 44566 c.525C>G p.R175R Loss of Function Synonymous_Mutation
1497 TP53 NM_000546 45515 c.525C>T p.R175R Loss of Function Synonymous_Mutation
1498 TP53_ENST ENST00000269305 99725 c.832C>G p.P278A Loss of Function Missense_Mutation
1499 TP53 NM_000546 11090 c.541C>T p.R181C Loss of Function Missense_Mutation
1500 TP53 NM_000546 43587 c.832_833CC>TT p.P278F Loss of Function Missense_Mutation
1501 TP53_ENST ENST00000269305 129831 c.833C>T p.P278L Loss of Function Missense_Mutation
1502 TP53 NM_000546 45046 c.542G>C p.R181P Loss of Function Missense_Mutation
1503 TP53 NM_000546 43728 c.543C>T p.R181R Loss of Function Synonymous_Mutation
1504 TP53 NM_000546 10705 c.586C>T p.R196* Loss of Function Nonsense_Mutation
1505 TP53 NM_000546 45021 c.585_586CC>TT p.R196* Loss of Function Nonsense_Mutation
1506 TP53 NM_000546 44757 c.586delC p.R196fs*51 Loss of Function Frame_Shift_Del
1507 TP53 NM_000546 43814 c.587G>C p.R196P Loss of Function Missense_Mutation
1508 TP53_ENST ENST00000269305 139044 c.832C>T p.P278S Loss of Function Missense_Mutation
1509 TP53 NM_000546 44569 c.588A>G p.R196R Loss of Function Synonymous_Mutation
1510 TP53 NM_000546 44615 c.586C>A p.R196R Loss of Function Synonymous_Mutation
1511 TP53 NM_000546 45233 c.884C>T p.P295L Loss of Function Missense_Mutation
1512 TP53 NM_000546 44750 c.883C>T p.P295S Loss of Function Missense_Mutation
1513 TP53 NM_000546 45311 c.898C>G p.P300A Loss of Function Missense_Mutation
1514 TP53 NM_000546 43766 c.899C>T p.P300L Loss of Function Missense_Mutation
1515 TP53 NM_000546 44729 c.898C>T p.P300S Loss of Function Missense_Mutation
1516 TP53 NM_000546 44753 c.901C>T p.P301S Loss of Function Missense_Mutation
1517 TP53 NM_000546 11290 c.625A>T p.R209* Loss of Function Nonsense_Mutation
1518 TP53 NM_000546 96575 c.625_634del10 p.R209fs*35 Loss of Function Frame_Shift_Del
1519 TP53 NM_000546 45438 c.626delG p.R209fs*38 Loss of Function Frame_Shift_Del
1520 TP53 NM_000546 13120 c.626_627delGA p.R209fs*6 Loss of Function Frame_Shift_Del
1521 TP53 NM_000546 6482 c.625_626delAG p.R209fs*6 Loss of Function Frame_Shift_Del
1522 TP53_ENST ENST00000414315 111722 c.176_178delCTC p.P59delP Loss of Function In_Frame_Del
1523 TP53_ENST ENST00000545858 129858 c.176C>T p.P59L Loss of Function Missense_Mutation
1524 TP53 NM_000546 10654 c.637C>T p.R213* Loss of Function Nonsense_Mutation
1525 TP53 NM_000546 43807 c.637delC p.R213fs*34 Loss of Function Frame_Shift_Del
1526 TP53 NM_000546 44358 c.634delT p.R213fs*34 Loss of Function Frame_Shift_Del
1527 TP53 NM_000546 45777 c.633delT p.R213fs*34 Loss of Function Frame_Shift_Del
1528 TP53 NM_000546 44102 c.637C>G p.R213G Loss of Function Missense_Mutation
1529 TP53 NM_000546 43650 c.638G>T p.R213L Loss of Function Missense_Mutation
1530 TP53 NM_000546 11860 c.638G>C p.R213P Loss of Function Missense_Mutation
1531 TP53 NM_000546 10735 c.638G>A p.R213Q Loss of Function Missense_Mutation
1532 TP53 NM_000546 45116 c.742delC p.R248fs*97 Loss of Function Frame_Shift_Del
1533 TP53 NM_000546 11564 c.742C>G p.R248G Loss of Function Missense_Mutation
1534 TP53 NM_000546 45543 c.743_744GG>TT p.R248L Loss of Function Missense_Mutation
1535 TP53 NM_000546 6549 c.743G>T p.R248L Loss of Function Missense_Mutation
1536 TP53 NM_000546 11491 c.743G>C p.R248P Loss of Function Missense_Mutation
1537 TP53 NM_000546 10662 c.743G>A p.R248Q Loss of Function Missense_Mutation
1538 TP53 NM_000546 44908 c.743_744GG>AA p.R248Q Loss of Function Missense_Mutation
1539 TP53 NM_000546 46265 c.224C>G p.P75R Loss of Function Missense_Mutation
1540 TP53 NM_000546 44287 c.229C>G p.P77A Loss of Function Missense_Mutation
1541 TP53 NM_000546 43910 c.245C>T p.P82L Loss of Function Missense_Mutation
1542 TP53 NM_000546 10656 c.742C>T p.R248W Loss of Function Missense_Mutation
1543 TP53 NM_000546 6545 c.741_742CC>TT p.R248W Loss of Function Missense_Mutation
1544 TP53 NM_000546 44916 c.746delG p.R249fs*96 Loss of Function Frame_Shift_Del
1545 TP53 NM_000546 10668 c.745A>G p.R249G Loss of Function Missense_Mutation
1546 TP53 NM_000546 44091 c.746G>A p.R249K Loss of Function Missense_Mutation
1547 TP53 NM_000546 43871 c.746G>T p.R249M Loss of Function Missense_Mutation
1548 TP53 NM_000546 45918 c.253C>T p.P85S Loss of Function Missense_Mutation
1549 TP53 NM_000546 10785 c.747G>C p.R249S Loss of Function Missense_Mutation
1550 TP53 NM_000546 10817 c.747G>T p.R249S Loss of Function Missense_Mutation
1551 TP53 NM_000546 43665 c.746G>C p.R249T Loss of Function Missense_Mutation
1552 TP53 NM_000546 43629 c.745A>T p.R249W Loss of Function Missense_Mutation
1553 TP53 NM_000546 11392 c.800G>C p.R267P Loss of Function Missense_Mutation
1554 TP53 NM_000546 43923 c.800G>A p.R267Q Loss of Function Missense_Mutation
1555 TP53 NM_000546 43544 c.260C>A p.P87Q Loss of Function Missense_Mutation
1556 TP53 NM_000546 11183 c.799C>T p.R267W Loss of Function Missense_Mutation
1557 TP53 NM_000546 10659 c.817C>T p.R273C Loss of Function Missense_Mutation
1558 TP53 NM_000546 44701 c.817delC p.R273fs*72 Loss of Function Frame_Shift_Del
1559 TP53 NM_000546 43688 c.265C>T p.P89S Loss of Function Missense_Mutation
1560 TP53 NM_000546 10660 c.818G>A p.R273H Loss of Function Missense_Mutation
1561 TP53 NM_000546 10779 c.818G>T p.R273L Loss of Function Missense_Mutation
1562 TP53 NM_000546 43896 c.818G>C p.R273P Loss of Function Missense_Mutation
1563 TP53 NM_000546 43909 c.817C>A p.R273S Loss of Function Missense_Mutation
1564 TP53 NM_000546 44390 c.838A>T p.R280* Loss of Function NonsenseMutation
1565 TP53_ENST ENST00000545858 111723 c.293_295delCTC p.P98delP Loss of Function In_Frame_Del
1566 TP53 NM_000546 44005 c.835delG p.R280fs*65 Loss of Function Frame_Shift_Del
1567 TP53 NM_000546 11123 c.838A>G p.R280G Loss of Function Missense_Mutation
1568 TP53 NM_000546 11287 c.839G>T p.R280I Loss of Function Missense_Mutation
1569 TP53 NM_000546 10728 c.839G>A p.R280K Loss of Function Missense_Mutation
1570 TP53 NM_000546 44568 c.840A>G p.R280R Loss of Function Synonymous_Mutation
1571 TP53 NM_000546 44171 c.840A>T p.R280S Loss of Function Missense_Mutation
1572 TP53 NM_000546 44233 c.840A>C p.R280S Loss of Function Missense_Mutation
1573 TP53 NM_000546 10724 c.839G>C p.R280T Loss of Function Missense_Mutation
1574 TP53 NM_000546 10992 c.844C>G p.R282G Loss of Function Missense_Mutation
1575 TP53 NM_000546 44681 c.293C>T p.P98L Loss of Function Missense_Mutation
1576 TP53 NM_000546 12296 c.292C>T p.P98S Loss of Function Missense_Mutation
1577 TP53 NM_000546 44338 c.845G>A p.R282Q Loss of Function Missense_Mutation
1578 TP53 NM_000546 44724 c.846G>A p.R282R Loss of Function Synonymous_Mutation
1579 TP53 NM_000546 44918 c.844C>A p.R282R Loss of Function Synonymous_Mutation
1580 TP53 NM_000546 10704 c.844C>T p.R282W Loss of Function Missense_Mutation
1581 TP53 NM_000546 43585 c.843_844CC>TT p.R282W Loss of Function Missense_Mutation
1582 TP53 NM_000546 45293 c.407A>G p.Q136R Loss of Function Missense_Mutation
1583 TP53 NM_000546 45891 c.847_866del20 p.R283fs*16 Loss of Function Frame_Shift_Del
1584 TP53 NM_000546 45188 c.847delC p.R283fs*62 Loss of Function Frame_Shift_Del
1585 TP53 NM_000546 44850 c.494A>T p.Q165L Loss of Function Missense_Mutation
1586 TP53 NM_000546 44851 c.494A>C p.Q165P Loss of Function Missense_Mutation
1587 TP53 NM_000546 44308 c.494A>G p.Q165R Loss of Function Missense_Mutation
1588 TP53 NM_000546 10743 c.848G>C p.R283P Loss of Function Missense_Mutation
1589 TP53 NM_000546 43977 c.849C>T p.R283R Loss of Function Synonymous_Mutation
1590 TP53 NM_000546 45679 c.868C>T p.R290C Loss of Function Missense_Mutation
1591 TP53 NM_000546 45626 c.501G>T p.Q167H Loss of Function Missense_Mutation
1592 TP53 NM_000546 45342 c.500A>T p.Q167L Loss of Function Missense_Mutation
1593 TP53 NM_000546 10663 c.916C>T p.R306* Loss of Function Nonsense_Mutation
1594 TP53 NM_000546 11071 c.1009C>T p.R337C Loss of Function Missense_Mutation
1595 TP53 NM_000546 43882 c.1010G>A p.R337H Loss of Function Missense_Mutation
1596 TP53 NM_000546 11411 c.1010G>T p.R337L Loss of Function Missense_Mutation
1597 TP53 NM_000546 11073 c.1024C>T p.R342* Loss of Function Nonsense_Mutation
1598 TP53 NM_000546 18597 c.1024delC p.R342fs*3 Loss of Function Frame_Shift_Del
1599 TP53 NM_000546 43795 c.1023delC p.R342fs*3 Loss of Function Frame_Shift_Del
1600 TP53 NM_000546 45639 c.1024delC p.R342fs*3 Loss of Function Frame_Shift_Del
1601 TP53 NM_000546 45276 c.1025G>C p.R342P Loss of Function Missense_Mutation
1602 TP53 NM_000546 43709 c.500A>G p.Q167R Loss of Function Missense_Mutation
1603 TP53 NM_000546 45044 c.576G>T p.Q192H Loss of Function Missense_Mutation
1604 TP53 NM_000546 44849 c.575A>G p.Q192R Loss of Function Missense_Mutation
1605 TP53 NM_000546 45944 c.318C>G p.S106R Loss of Function Missense_Mutation
1606 TP53 NM_000546 40942 c.380C>T p.S127F Loss of Function Missense_Mutation
1607 TP53 NM_000546 45536 c.1061A>G p.Q354R Loss of Function Missense_Mutation
1608 TP53 NM_000546 46115 c.329G>A p.R110H Loss of Function Missense_Mutation
1609 TP53 NM_000546 44687 c.379T>C p.S127P Loss of Function Missense_Mutation
1610 TP53_ENST ENST00000269305 99929 c.329G>T p.R110L Loss of Function Missense_Mutation
1611 TP53 NM_000546 43970 c.380C>A p.S127Y Loss of Function Missense_Mutation
1612 TP53 NM_000546 11508 c.497C>A p.S166* Loss of Function Nonsense_Mutation
1613 TP53 NM_000546 44467 c.497C>G p.S166* Loss of Function Nonsense_Mutation
1614 TP53_ENST ENST00000413465 99928 c.329G>T p.R110L Loss of Function Missense_Mutation
1615 TP53_ENST ENST00000545858 242000 c.359G>T p.R120L Loss of Function Missense_Mutation
1616 TP53_ENST ENST00000545858 99021 c.464G>A p.R155Q Loss of Function Missense_Mutation
1617 TP53 NM_000546 10706 c.548C>G p.S183* Loss of Function Nonsense_Mutation
1618 TP53 NM_000546 11717 c.548C>A p.S183* Loss of Function Nonsense_Mutation
1619 TP53_ENST ENST00000545858 120006 c.463C>T p.R155W Loss of Function Missense_Mutation
1620 TP53 NM_000546 46001 c.466_486del21 p.R156_1162delRVR Loss of Function In_Frame_Del
1621 TP53 NM_000546 45314 c.553delA p.S185f5*62 Loss of Function Frame_Shift_Del
1622 TP53 NM_000546 45154 c.466C>G p.R156G Loss of Function Missense_Mutation
1623 TP53 NM_000546 43548 c.467G>T p.R156L Loss of Function Missense_Mutation
1624 TP53 NM_000546 43744 c.466C>A p.R156S Loss of Function Missense_Mutation
1625 TP53 NM_000546 44267 c.472_477delCGCGCC p.R158_A159delRA Loss of Function In_Frame_Del
1626 TP53 NM_000546 44887 c.644delG p.S215f5*32 Loss of Function Frame_Shift_Del
1627 TP53 NM_000546 43951 c.643A>G p.S215G Loss of Function Missense_Mutation
1628 TP53 NM_000546 11450 c.644G>T p.S215I Loss of Function Missense_Mutation
1629 TP53_ENST ENST00000269305 220779 c.473G>A p.R158H Loss of Function Missense_Mutation
1630 TP53 NM_000546 44979 c.645T>G p.S215R Loss of Function Missense_Mutation
1631 TP53 NM_000546 45122 c.645T>A p.S215R Loss of Function Missense_Mutation
1632 TP53 NM_000546 46000 c.643A>C p.S215R Loss of Function Missense_Mutation
1633 TP53_ENST ENST00000413465 220778 c.473G>A p.R158H Loss of Function Missense_Mutation
1634 TP53 NM_000546 43615 c.473G>C p.R158P Loss of Function Missense_Mutation
1635 TP53 NM_000546 44524 c.521G>A p.R174K Loss of Function Missense_Mutation
1636 TP53 NM_000546 45671 c.521G>T p.R174M Loss of Function Missense_Mutation
1637 TP53 NM_000546 44217 c.718delA p.S240f5*7 Loss of Function Frame_Shift_Del
1638 TP53 NM_000546 43973 c.718A>G p.S240G Loss of Function Missense_Mutation
1639 TP53 NM_000546 44518 c.522G>A p.R174R Loss of Function Synonymous_Mutation
1640 TP53 NM_000546 44782 c.520A>T p.R174W Loss of Function Missense_Mutation
1641 TP53_ENST ENST00000269305 99914 c.524G>A p.R175H Loss of Function Missense_Mutation
1642 TP53 NM_000546 44838 c.720T>C p.S240S Loss of Function Synonymous_Mutation
1643 TP53_ENST ENST00000413465 99022 c.524G>A p.R175H Loss of Function Missense_Mutation
1644 TP53 NM_000546 10718 c.524G>T p.R175L Loss of Function Missense_Mutation
1645 TP53 NM_000546 10709 c.722C>G p.S241C Loss of Function Missense_Mutation
1646 TP53 NM_000546 45416 c.524G>C p.R175P Loss of Function Missense_Mutation
1647 TP53 NM_000546 43931 c.523C>A p.R175S Loss of Function Missense_Mutation
1648 TP53 NM_000546 10812 c.722C>T p.S241F Loss of Function Missense_Mutation
1649 TP53 NM_000546 45017 c.722_723CC>TT p.S241F Loss of Function Missense_Mutation
1650 TP53 NM_000546 43645 c.721delT p.S241f5*6 Loss of Function Frame_Shift_Del
1651 TP53 NM_000546 44578 c.721T>C p.S241P Loss of Function Missense_Mutation
1652 TP53 NM_000546 10738 c.542G>A p.R181H Loss of Function Missense_Mutation
1653 TP53 NM_000546 10935 c.722C>A p.S241Y Loss of Function Missense_Mutation
1654 TP53 NM_000546 44152 c.542G>T p.R181L Loss of Function Missense_Mutation
1655 TP53 NM_000546 44599 c.587G>A p.R196Q Loss of Function Missense_Mutation
1656 TP53 NM_000546 46074 c.604C>T p.R202C Loss of Function Missense_Mutation
1657 TP53 NM_000546 43594 c.605G>A p.R202H Loss of Function Missense_Mutation
1658 TP53 NM_000546 44925 c.605G>T p.R202L Loss of Function Missense_Mutation
1659 TP53 NM_000546 43608 c.605G>C p.R202P Loss of Function Missense_Mutation
1660 TP53 NM_000546 44074 c.605_606GT>CG p.R202P Loss of Function Missense_Mutation
1661 TP53 NM_000546 44237 c.904delG p.S303f5*42 Loss of Function Frame_Shift_Del
1662 TP53 NM_000546 44174 c.604C>A p.R202S Loss of Function Missense_Mutation
1663 TP53 NM_000546 45995 c.626G>A p.R209K Loss of Function Missense_Mutation
1664 TP53 NM_000546 45257 c.626G>C p.R209T Loss of Function Missense_Mutation
1665 TP53 NM_000546 18610 c.267delC p.S90f5*33 Loss of Function Frame_Shift_Del
1666 TP53 NM_000546 45500 c.281C>A p.S94* Loss of Function NonsenseMutation
1667 TP53_ENST ENST00000269305 241998 c.638G>T p.R213L Loss of Function Missense_Mutation
1668 TP53_ENST ENST00000413465 241997 c.638G>T p.R213L Loss of Function Missense_Mutation
1669 TP53_ENST ENST00000269305 99602 c.743G>A p.R248Q Loss of Function Missense_Mutation
1670 TP53_ENST ENST00000413465 99020 c.743G>A p.R248Q Loss of Function Missense_Mutation
1671 TP53 NM_000546 85574 c.291_295delCCCTT p.S99fs*48 Loss of Function Frame_Shift_Del
1672 TP53 NM_000546 44257 c.301delA p.T102fs*21 Loss of Function Frame_Shift_Del
1673 TP53 NM_000546 44920 c.742C>A p.R248R Loss of Function Synonymous_Mutation
1674 TP53 NM_000546 44303 c.463A>G p.T155A Loss of Function Missense_Mutation
1675 TP53 NM_000546 44009 c.463_470delACCCGCGT p.T155fs*23 Loss of Function Frame_Shift_Del
1676 TP53 NM_000546 44033 c.464C>T p.T155I Loss of Function Missense_Mutation
1677 TP53 NM_000546 11218 c.464C>A p.T155N Loss of Function Missense_Mutation
1678 TP53 NM_000546 10912 c.463A>C p.T155P Loss of Function Missense_Mutation
1679 TP53 NM_000546 43670 c.465C>T p.T155T Loss of Function Synonymous_Mutation
1680 TP53 NM_000546 45084 c.744G>A p.R248R Loss of Function Synonymous_Mutation
1681 TP53 NM_000546 44384 c.510G>A p.T170T Loss of Function Synonymous_Mutation
1682 TP53 NM_000546 45541 c.510G>T p.T170T Loss of Function Synonymous_Mutation
1683 TP53 NM_000546 45735 c.744G>C p.R248R Loss of Function Synonymous_Mutation
1684 TP53 NM_000546 44371 c.631delA p.T211fs*36 Loss of Function Frame_Shift_Del
1685 TP53 NM_000546 43939 c.632C>T p.T211I Loss of Function Missense_Mutation
1686 TP53_ENST ENST00000269305 120007 c.742C>T p.R248W Loss of Function Missense_Mutation
1687 TP53 NM_000546 46211 c.633T>C p.T211T Loss of Function Synonymous_Mutation
1688 TP53 NM_000546 45157 c.688delA p.T230fs*17 Loss of Function Frame_Shift_Del
1689 TP53 NM_000546 44458 c.688_698del11 p.T230fs*6 Loss of Function Frame_Shift_Del
1690 TP53_ENST ENST00000413465 120005 c.742C>T p.R248W Loss of Function Missense_Mutation
1691 TP53 NM_000546 44625 c.747G>A p.R249R Loss of Function Synonymous_Mutation
1692 TP53 NM_000546 44271 c.688A>C p.T230P Loss of Function Missense_Mutation
1693 TP53_ENST ENST00000269305 131478 c.747G>T p.R249S Loss of Function Missense_Mutation
1694 TP53_ENST ENST00000413465 131479 c.747G>T p.R249S Loss of Function Missense_Mutation
1695 TP53 NM_000546 45784 c.691delA p.T231fs*16 Loss of Function Frame_Shift_Del
1696 TP53 NM_000546 45706 c.801G>T p.R267R Loss of Function Synonymous_Mutation
1697 TP53_ENST ENST00000269305 179804 c.799C>T p.R267W Loss of Function Missense_Mutation
1698 TP53 NM_000546 44113 c.693C>T p.T231T Loss of Function Synonymous_Mutation
1699 TP53_ENST ENST00000414315 220780 c.77G>A p.R26H Loss of Function Missense_Mutation
1700 TP53 NM_000546 44460 c.757_760delACCA p.T253fs*91 Loss of Function Frame_Shift_Del
1701 TP53_ENST ENST00000269305 99933 c.817C>T p.R273C Loss of Function Missense_Mutation
1702 TP53 NM_000546 43843 c.817C>G p.R273G Loss of Function Missense_Mutation
1703 TP53_ENST ENST00000269305 99729 c.818G>A p.R273H Loss of Function Missense_Mutation
1704 TP53 NM_000546 44843 c.759C>T p.T253T Loss of Function Synonymous_Mutation
1705 TP53 NM_000546 45843 c.838_843delAGAGAC p.R280_D281delRD Loss of Function In_Frame_Del
1706 TP53_ENST ENST00000269305 129830 c.839G>A p.R280K Loss of Function Missense_Mutation
1707 TP53 NM_000546 44470 c.845G>T p.R282L Loss of Function Missense_Mutation
1708 TP53 NM_000546 44352 c.850A>C p.T284P Loss of Function Missense_Mutation
1709 TP53 NM_000546 44835 c.852A>T p.T284T Loss of Function Synonymous_Mutation
1710 TP53 NM_000546 44306 c.845G>C p.R282P Loss of Function Missense_Mutation
1711 TP53 NM_000546 44417 c.910delA p.T304fs*41 Loss of Function Frame_Shift_Del
1712 TP53_ENST ENST00000269305 99925 c.844C>T p.R282W Loss of Function Missense_Mutation
1713 TP53 NM_000546 10911 c.847C>T p.R283C Loss of Function Missense_Mutation
1714 TP53 NM_000546 46035 c.847C>G p.R283G Loss of Function Missense_Mutation
1715 TP53 NM_000546 11483 c.848G>A p.R283H Loss of Function Missense_Mutation
1716 TP53 NM_000546 10670 c.469G>T p.V157F Loss of Function Missense_Mutation
1717 TP53 NM_000546 43710 c.468delC p.V157fs*13 Loss of Function Frame_Shift_Del
1718 TP53 NM_000546 45111 c.469_473delGTCCG p.V157fs*22 Loss of Function Frame_Shift_Del
1719 TP53 NM_000546 43903 c.470T>G p.V157G Loss of Function Missense_Mutation
1720 TP53 NM_000546 44463 c.848G>T p.R283L Loss of Function Missense_Mutation
1721 TP53 NM_000546 44017 c.869G>A p.R290H Loss of Function Missense_Mutation
1722 TP53 NM_000546 43934 c.471C>A p.V157V Loss of Function Synonymous_Mutation
1723 TP53 NM_000546 44526 c.471C>T p.V157V Loss of Function Synonymous_Mutation
1724 TP53 NM_000546 44639 c.869G>T p.R290L Loss of Function Missense_Mutation
1725 TP53 NM_000546 45278 c.1025G>A p.R342Q Loss of Function Missense_Mutation
1726 TP53 NM_000546 44240 c.514G>T p.V172F Loss of Function Missense_Mutation
1727 TP53 NM_000546 45906 c.514delG p.V172fs*2 Loss of Function Frame_Shift_Del
1728 TP53 NM_000546 45047 c.515T>G p.V172G Loss of Function Missense_Mutation
1729 TP53_ENST ENST00000414315 99023 c.128G>A p.R43H Loss of Function Missense_Mutation
1730 TP53 NM_000546 44973 c.516T>C p.V172V Loss of Function Synonymous_Mutation
1731 TP53_ENST ENST00000545858 220781 c.194G>A p.R65H Loss of Function Missense_Mutation
1732 TP53 NM_000546 43732 c.517delG p.V173fs*1 Loss of Function Frame_Shift_Del
1733 TP53 NM_000546 45583 c.514_559del46 p.V173fs*59 Loss of Function Frame_Shift_Del
1734 TP53 NM_000546 43054 c.518T>G p.V173G Loss of Function Missense_Mutation
1735 TP53 NM_000546 44383 c.518T>G p.V173G Loss of Function Missense_Mutation
1736 TP53 NM_000546 43559 c.517G>T p.V173L Loss of Function Missense_Mutation
1737 TP53 NM_000546 44057 c.517G>C p.V173L Loss of Function Missense_Mutation
1738 TP53 NM_000546 11084 c.517G>A p.V173M Loss of Function Missense_Mutation
1739 TP53 NM_000546 44517 c.519G>A p.V173V Loss of Function Synonymous_Mutation
1740 TP53 NM_000546 44018 c.214C>T p.R72C Loss of Function Missense_Mutation
1741 TP53 NM_000546 43905 c.590T>G p.V197G Loss of Function Missense_Mutation
1742 TP53 NM_000546 45985 c.215G>A p.R72H Loss of Function Missense_Mutation
1743 TP53_ENST ENST00000414315 241999 c.242G>T p.R81L Loss of Function Missense_Mutation
1744 TP53 NM_000546 44845 c.591G>A p.V197V Loss of Function Synonymous_Mutation
1745 TP53_ENST ENST00000545858 99024 c.245G>A p.R82H Loss of Function Missense_Mutation
1746 TP53 NM_000546 45308 c.607delG p.V203fs*44 Loss of Function Frame_Shift_Del
1747 TP53 NM_000546 44226 c.380C>T p.S127F Loss of Function Missense_Mutation
1748 TP53 NM_000546 45015 c.380_381CC>TT p.S127F Loss of Function Missense_Mutation
1749 TP53 NM_000546 44707 c.609G>A p.V203V Loss of Function Synonymous_Mutation
1750 TP53 NM_000546 53285 c.379T>A p.S127T Loss of Function Missense_Mutation
1751 TP53 NM_000546 44282 c.496T>G p.S166A Loss of Function Missense_Mutation
1752 TP53 NM_000546 44274 c.647T>A p.V216E Loss of Function Missense_Mutation
1753 TP53 NM_000546 44239 c.647delT p.V216fs*31 Loss of Function Frame_Shift_Del
1754 TP53 NM_000546 43681 c.647T>G p.V216G Loss of Function Missense_Mutation
1755 TP53 NM_000546 11210 c.646G>T p.V216L Loss of Function Missense_Mutation
1756 TP53 NM_000546 10667 c.646G>A p.V216M Loss of Function Missense_Mutation
1757 TP53 NM_000546 44289 c.497C>T p.S166L Loss of Function Missense_Mutation
1758 TP53 NM_000546 44035 c.496T>C p.S166P Loss of Function Missense_Mutation
1759 TP53 NM_000546 44300 c.548C>T p.S183L Loss of Function Missense_Mutation
1760 TP53 NM_000546 44343 c.547T>C p.S183P Loss of Function Missense_Mutation
1761 TP53 NM_000546 44714 c.553A>G p.S185G Loss of Function Missense_Mutation
1762 TP53 NM_000546 44185 c.555C>A p.S185R Loss of Function Missense_Mutation
1763 TP53 NM_000546 45198 c.555C>T p.S185S Loss of Function Missense_Mutation
1764 TP53 NM_000546 44198 c.653T>G p.V218G Loss of Function Missense_Mutation
1765 TP53 NM_000546 11307 c.643A>T p.S215C Loss of Function Missense_Mutation
1766 TP53 NM_000546 44093 c.644G>A p.S215N Loss of Function Missense_Mutation
1767 TP53 NM_000546 45511 c.645T>C p.S215S Loss of Function Missense_Mutation
1768 TP53 NM_000546 13421 c.814delG p.V272fs*73 Loss of Function Frame_Shift_Del
1769 TP53 NM_000546 44870 c.815T>G p.V272G Loss of Function Missense_Mutation
1770 TP53 NM_000546 44175 c.644G>C p.S215T Loss of Function Missense_Mutation
1771 TP53 NM_000546 43920 c.680C>T p.S227F Loss of Function Missense_Mutation
1772 TP53 NM_000546 10891 c.814G>A p.V272M Loss of Function Missense_Mutation
1773 TP53 NM_000546 44393 c.821T>C p.V274A Loss of Function Missense_Mutation
1774 TP53 NM_000546 44448 c.821T>A p.V274D Loss of Function Missense_Mutation
1775 TP53 NM_000546 10769 c.820G>T p.V274F Loss of Function Missense_Mutation
1776 TP53 NM_000546 43945 c.821T>G p.V274G Loss of Function Missense_Mutation
1777 TP53 NM_000546 44621 c.718A>T p.S240C Loss of Function Missense_Mutation
1778 TP53 NM_000546 44443 c.820G>C p.V274L Loss of Function Missense_Mutation
1779 TP53 NM_000546 45491 c.822T>G p.V274V Loss of Function Synonymous_Mutation
1780 TP53 NM_000546 43660 c.719G>T p.S2401 Loss of Function Missense_Mutation
1781 TP53 NM_000546 43684 c.720T>G p.S240R Loss of Function Missense_Mutation
1782 TP53 NM_000546 44192 c.272G>A p.W91* Loss of Function Nonsense_Mutation
1783 TP53 NM_000546 44492 c.273G>A p.W91* Loss of Function Nonsense_Mutation
1784 TP53 NM_000546 44453 c.309C>G p.Y103* Loss of Function Nonsense_Mutation
1785 TP53 NM_000546 11448 c.321C>G p.Y107* Loss of Function Nonsense_Mutation
1786 TP53 NM_000546 45040 c.321C>A p.Y107* Loss of Function Nonsense_Mutation
1787 TP53 NM_000546 46103 c.319T>G p.Y107D Loss of Function Missense_Mutation
1788 TP53 NM_000546 45509 c.321C>T p.Y107Y Loss of Function Synonymous_Mutation
1789 TP53 NM_000546 10862 c.378C>G p.Y126* Loss of Function Nonsense_Mutation
1790 TP53 NM_000546 10888 c.378C>A p.Y126* Loss of Function Nonsense_Mutation
1791 TP53 NM_000546 45261 c.720T>A p.S240R Loss of Function Missense_Mutation
1792 TP53 NM_000546 44964 c.719G>C p.S240T Loss of Function Missense_Mutation
1793 TP53 NM_000546 11517 c.377A>G p.Y126C Loss of Function Splice_Site
1794 TP53 NM_000546 43900 c.376T>G p.Y126D Loss of Function Splice_Site
1795 TP53 NM_000546 249845 c.377_377delA p.Y126fs*44 Loss of Function Frame_Shift_Del
1796 TP53 NM_000546 44380 c.376T>A p.Y126N Loss of Function Splice_Site
1797 TP53 NM_000546 44142 c.377A>C p.Y126S Loss of Function Splice_Site
1798 TP53 NM_000546 43820 c.489C>G p.Y163* Loss of Function Nonsense_Mutation
1799 TP53 NM_000546 45411 c.489C>A p.Y163* Loss of Function Nonsense_Mutation
1800 TP53 NM_000546 10808 c.488A>G p.Y163C Loss of Function Missense_Mutation
1801 TP53 NM_000546 44216 c.487T>G p.Y163D Loss of Function Missense_Mutation
1802 TP53 NM_000546 45194 c.487delT p.Y163fs*7 Loss of Function Frame_Shift_Del
1803 TP53 NM_000546 43846 c.487T>C p.Y163H Loss of Function Missense_Mutation
1804 TP53 NM_000546 44623 c.487T>A p.Y163N Loss of Function Missense_Mutation
1805 TP53 NM_000546 44224 c.721T>G p.S241A Loss of Function Missense_Mutation
1806 TP53 NM_000546 44391 c.489C>T p.Y163Y Loss of Function Synonymous_Mutation
1807 TP53 NM_000546 43928 c.615T>A p.Y205* Loss of Function Nonsense_Mutation
1808 TP53 NM_000546 44924 c.615T>G p.Y205* Loss of Function Nonsense_Mutation
1809 TP53 NM_000546 43947 c.614A>G p.Y205C Loss of Function Missense_Mutation
1810 TP53 NM_000546 45168 c.722_724delCCT p.S241del Loss of Function In_Frame_Del
1811 TP53 NM_000546 45548 c.721_723delTCC p.S241del Loss of Function In_Frame_Del
1812 TP53 NM_000546 44067 c.721T>A p.S241T Loss of Function Missense_Mutation
1813 TP53 NM_000546 45685 c.613T>A p.Y205N Loss of Function Missense_Mutation
1814 TP53 NM_000546 146240 c.806_808delGCT p.S269_F270>I Loss of Function In_Frame_Del
1815 TP53 NM_000546 44505 c.660T>G p.Y220* Loss of Function Nonsense_Mutation
1816 TP53 NM_000546 10758 c.659A>G p.Y220C Loss of Function Missense_Mutation
1817 TP53 NM_000546 45248 c.805A>T p.S269C Loss of Function Missense_Mutation
1818 TP53 NM_000546 44585 c.655delC p.Y220fs*27 Loss of Function Frame_Shift_Del
1819 TP53 NM_000546 44637 c.658T>C p.Y220H Loss of Function Missense_Mutation
1820 TP53 NM_000546 43962 c.805A>G p.S269G Loss of Function Missense_Mutation
1821 TP53 NM_000546 43850 c.659A>C p.Y220S Loss of Function Missense_Mutation
1822 TP53 NM_000546 45114 c.702C>A p.Y234* Loss of Function Nonsense_Mutation
1823 TP53 NM_000546 10725 c.701A>G p.Y234C Loss of Function Missense_Mutation
1824 TP53 NM_000546 44236 c.806G>A p.S269N Loss of Function Missense_Mutation
1825 TP53 NM_000546 44886 c.807C>T p.S269S Loss of Function Missense_Mutation
1826 TP53 NM_000546 45507 c.806G>C p.S269T Loss of Function Missense_Mutation
1827 TP53 NM_000546 43956 c.700T>A p.Y234N Loss of Function Missense_Mutation
1828 TP53 NM_000546 43865 c.701A>C p.Y234S Loss of Function Missense_Mutation
1829 TP53 NM_000546 43564 c.708C>A p.Y236* Loss of Function Nonsense_Mutation
1830 TP53 NM_000546 44960 c.708C>G p.Y236* Loss of Function Nonsense_Mutation
1831 TP53 NM_000546 10731 c.707A>G p.Y236C Loss of Function Missense_Mutation
1832 TP53 NM_000546 43602 c.706T>G p.Y236D Loss of Function Missense_Mutation
1833 TP53 NM_000546 44565 c.907A>T p.S303C Loss of Function Missense_Mutation
1834 TP53 NM_000546 43986 c.908G>A p.S303N Loss of Function Missense_Mutation
1835 TP53 NM_000546 43826 c.706T>A p.Y236N Loss of Function Missense_Mutation
1836 TP53 NM_000546 44167 c.908G>C p.S303T Loss of Function Missense_Mutation
1837 TP53 NM_000546 44132 c.708C>T p.Y236Y Loss of Function Synonymous_Mutation
1838 TP53_ENST ENST00000269305 131534 c.559+1G>A p.? Loss of Function N/A
1839 TP53 NM_000546 44832 c.1096T>G p.S366A Loss of Function Missense_Mutation
1840 TP53_ENST ENST00000269305 179823 c.528C>A p.C176* Loss of Function Nonsense_Mutation
1841 TP53 NM_000546 44048 c.280T>A p.S94T Loss of Function Missense_Mutation
1842 TP53 NM_000546 44673 c.284C>T p.S95F Loss of Function Missense_Mutation
1843 TP53 NM_000546 44447 c.287C>T p.S96F Loss of Function Missense_Mutation
1844 TP53 NM_000546 44036 c.296C>T p.S99F Loss of Function Missense_Mutation
1845 TP53_ENST ENST00000269305 118013 c.592G>T p.E198* Loss of Function Nonsense_Mutation
1846 TP53 NM_000546 43678 c.305C>T p.T102I Loss of Function Missense_Mutation
1847 TP53 NM_000546 44552 c.509C>T p.T170M Loss of Function Missense_Mutation
1848 TP53_ENST ENST00000269305 126981 c.880G>T p.E294* Loss of Function Nonsense_Mutation
1849 TP53 NM_000546 44238 c.631A>G p.T211A Loss of Function Missense_Mutation
1850 TP53 NM_000546 44661 c.632C>A p.T211N Loss of Function Missense_Mutation
1851 TP53 NM_000546 43868 c.689C>T p.T230I Loss of Function Missense_Mutation
1852 TP53_ENST ENST00000269305 111498 c.532delC p.H178fs*69 Loss of Function Frame_Shift_Del
1853 TP53 NM_000546 43806 c.689C>A p.T230N Loss of Function Missense_Mutation
1854 TP53 NM_000546 45631 c.688A>T p.T230S Loss of Function Missense_Mutation
1855 TP53 NM_000546 43980 c.691A>G p.T231A Loss of Function Missense_Mutation
1856 TP53 NM_000546 44820 c.692C>T p.T231I Loss of Function Missense_Mutation
1857 TP53 NM_000546 43889 c.691A>T p.T231S Loss of Function Missense_Mutation
1858 TP53 NM_000546 45322 c.757A>G p.T253A Loss of Function Missense_Mutation
1859 TP53 NM_000546 43683 c.758C>T p.T253I Loss of Function Missense_Mutation
1860 TP53 NM_000546 45980 c.757A>C p.T253P Loss of Function Missense_Mutation
1861 TP53_ENST ENST00000269305 117949 c.574C>T p.Q192* Loss of Function Nonsense_Mutation
1862 TP53 NM_000546 43881 c.757A>T p.T253S Loss of Function Missense_Mutation
1863 TP53 NM_000546 44544 c.766A>G p.T256A Loss of Function Missense_Mutation
1864 TP53 NM_000546 44662 c.766A>T p.T256S Loss of Function Missense_Mutation
1865 TP53_ENST ENST00000269305 99668 c.586C>T p.R196* Loss of Function Nonsense_Mutation
1866 TP53_ENST ENST00000269305 99618 c.637C>T p.R213* Loss of Function Nonsense_Mutation
1867 TP53 NM_000546 45728 c.850A>G p.T284A Loss of Function Missense_Mutation
1868 TP53 NM_000546 46207 c.910A>G p.T304A Loss of Function Missense_Mutation
1869 TP53 NM_000546 45128 c.911C>T p.T304I Loss of Function Missense_Mutation
1870 TP53 NM_000546 44200 c.242C>T p.T81I Loss of Function Missense_Mutation
1871 TP53 NM_000546 44329 c.470T>A p.V157D Loss of Function Missense_Mutation
1872 TP53 NM_000546 45551 c.469_471delGTC p.V157del Loss of Function In_Frame_Del
1873 TP53_ENST ENST00000269305 131480 c.469G>T p.V157F Loss of Function Missense_Mutation
1874 TP53_ENST ENST00000413465 131481 c.469G>T p.V157F Loss of Function Missense_Mutation
1875 TP53 NM_000546 43625 c.469G>A p.V157I Loss of Function Missense_Mutation
1876 TP53_ENST ENST00000269305 99947 c.916C>T p.R306* Loss of Function Nonsense_Mutation
1877 TP53_ENST ENST00000269305 99721 c.1024C>T p.R342* Loss of Function Nonsense_Mutation
1878 TP53 NM_000546 45120 c.469G>C p.V157L Loss of Function Missense_Mutation
1879 TP53 NM_000546 44996 c.515T>C p.V172A Loss of Function Missense_Mutation
1880 TP53 NM_000546 44229 c.515T>A p.V172D Loss of Function Missense_Mutation
1881 TP53 NM_000546 43955 c.514G>A p.V172I Loss of Function Missense_Mutation
1882 TP53 NM_000546 44327 c.518T>C p.V173A Loss of Function Missense_Mutation
1883 TP53_ENST ENST00000269305 121042 c.517G>C p.V173L Loss of Function Missense_Mutation
1884 TP53_ENST ENST00000269305 99946 c.378C>G p.Y126* Loss of Function Nonsense_Mutation
1885 TP53_ENST ENST00000269305 99641 c.517G>T p.V173L Loss of Function Missense_Mutation
1886 TP53_ENST ENST00000413465 121043 c.517G>C p.V173L Loss of Function Missense_Mutation
1887 TP53_ENST ENST00000413465 99638 c.517G>T p.V173L Loss of Function Missense_Mutation
1888 TP53_ENST ENST00000413465 98964 c.517G>A p.V173M Loss of Function Missense_Mutation
1889 TP53 NM_000546 44424 c.590T>A p.V197E Loss of Function Missense_Mutation
1890 TP53_ENST ENST00000413465 131535 c.559+1G>A p.? Loss of Function N/A
1891 TP53 NM_000546 46212 c.589G>T p.V197L Loss of Function Missense_Mutation
1892 TP53_ENST ENST00000413465 179822 c.528C>A p.C176* Loss of Function Nonsense_Mutation
1893 TP53 NM_000546 43779 c.589G>A p.V197M Loss of Function Missense_Mutation
1894 TP53 NM_000546 44411 c.608T>A p.V203E Loss of Function Missense_Mutation
1895 TP53_ENST ENST00000413465 118010 c.592G>T p.E198* Loss of Function Nonsense_Mutation
1896 TP53 NM_000546 44365 c.607G>T p.V203L Loss of Function Missense_Mutation
1897 TP53 NM_000546 43599 c.607G>A p.V203M Loss of Function Missense_Mutation
1898 TP53_ENST ENST00000413465 111495 c.532delC p.H178fs*69 Loss of Function Frame_Shift_Del
1899 TP53 NM_000546 44567 c.647T>C p.V216A Loss of Function Missense_Mutation
1900 TP53 NM_000546 44607 c.646_648delGTG p.V216del Loss of Function In_Frame_Del
1901 TP53 NM_000546 45110 c.650T>C p.V217A Loss of Function Missense_Mutation
1902 TP53 NM_000546 44929 c.650T>A p.V217E Loss of Function Missense_Mutation
1903 TP53 NM_000546 44375 c.650T>G p.V217G Loss of Function Missense_Mutation
1904 TP53_ENST ENST00000413465 117946 c.574C>T p.Q192* Loss of Function Nonsense_Mutation
1905 TP53 NM_000546 44334 c.649G>T p.V217L Loss of Function Missense_Mutation
1906 TP53 NM_000546 44930 c.653T>C p.V218A Loss of Function Missense_Mutation
1907 TP53 NM_000546 6496 c.652_654delGTG p.V218del Loss of Function In_Frame_Del
1908 TP53_ENST ENST00000413465 99665 c.586C>T p.R196* Loss of Function Nonsense_Mutation
1909 TP53_ENST ENST00000413465 99615 c.637C>T p.R213* Loss of Function Nonsense_Mutation
1910 TP53 NM_000546 44317 c.653T>A p.V218E Loss of Function Missense_Mutation
1911 TP53 NM_000546 44683 c.652G>A p.V218M Loss of Function Missense_Mutation
1912 TP53_ENST ENST00000414315 131483 c.73G>T p.V25F Loss of Function Missense_Mutation
1913 TP53 NM_000546 44294 c.815T>C p.V272A Loss of Function Missense_Mutation
1914 TP53 NM_000546 44580 c.815T>A p.V272E Loss of Function Missense_Mutation
1915 TP53 NM_000546 10859 c.814G>T p.V272L Loss of Function Missense_Mutation
1916 TP53 NM_000546 45898 c.814G>C p.V272L Loss of Function Missense_Mutation
1917 TP53_ENST ENST00000269305 99950 c.814G>A p.V272M Loss of Function Missense_Mutation
1918 TP53_ENST ENST00000269305 165075 c.820G>T p.V274F Loss of Function Missense_Mutation
1919 TP53_ENST ENST00000413465 99944 c.378C>G p.Y126* Loss of Function Nonsense_Mutation
1920 TP53 NM_000546 43667 c.820G>A p.V274I Loss of Function Missense_Mutation
1921 TP53_ENST ENST00000414315 121045 c.121G>C p.V41L Loss of Function Missense_Mutation
1922 TP53_ENST ENST00000414315 99639 c.121G>T p.V41L Loss of Function Missense_Mutation
1923 TP53_ENST ENST00000414315 98965 c.121G>A p.V41M Loss of Function Missense_Mutation
1924 TP53_ENST ENST00000545858 131482 c.190G>T p.V64F Loss of Function Missense_Mutation
1925 TP53_ENST ENST00000414315 131537 c.163+1G>A p.? Loss of Function N/A
1926 TP53 NM_000546 45288 c.217G>C p.V73L Loss of Function Missense_Mutation
1927 TP53_ENST ENST00000414315 179824 c.132C>A p.C44* Loss of Function Nonsense_Mutation
1928 TP53 NM_000546 43787 c.217G>A p.V73M Loss of Function Missense_Mutation
1929 TP53_ENST ENST00000414315 118011 c.196G>T p.E66* Loss of Function Nonsense_Mutation
1930 TP53_ENST ENST00000414315 111496 c.136delC p.H46fs*>45 Loss of Function Frame_Shift_Del
1931 TP53_ENST ENST00000545858 121044 c.238G>C p.V80L Loss of Function Missense_Mutation
1932 TP53_ENST ENST00000545858 99640 c.238G>T p.V80L Loss of Function Missense_Mutation
1933 TP53_ENST ENST00000545858 98966 c.238G>A p.V80M Loss of Function Missense_Mutation
1934 TP53_ENST ENST00000269305 220766 c.319T>G p.Y107D Loss of Function Missense_Mutation
1935 TP53_ENST ENST00000414315 117947 c.178C>T p.Q60* Loss of Function Nonsense_Mutation
1936 TP53_ENST ENST00000413465 220765 c.319T>G p.Y107D Loss of Function Missense_Mutation
1937 TP53 NM_000546 44405 c.376_396del21 p.Y126_K132delYSP Loss of Function In_Frame_Del
1938 TP53_ENST ENST00000414315 99666 c.190C>T p.R64* Loss of Function Nonsense_Mutation
1939 TP53_ENST ENST00000414315 99616 c.241C>T p.R81* Loss of Function Nonsense_Mutation
1940 TP53 NM_000546 44774 c.376_393del18 p.Y126_N131delYSP Loss of Function In_Frame_Del
1941 TP53_ENST ENST00000269305 220783 c.376T>G p.Y126D Loss of Function Missense_Mutation
1942 TP53_ENST ENST00000413465 220782 c.376T>G p.Y126D Loss of Function Missense_Mutation
1943 TP53_ENST ENST00000545858 99719 c.380A>G p.Y127C Loss of Function Missense_Mutation
1944 TP53_ENST ENST00000545858 165074 c.422A>G p.Y141C Loss of Function Missense_Mutation
1945 TP53_ENST ENST00000545858 116673 c.428A>G p.Y143C Loss of Function Missense_Mutation
1946 TP53_ENST ENST00000545858 131536 c.280+1G>A p.? Loss of Function N/A
1947 TP53_ENST ENST00000269305 129852 c.488A>G p.Y163C Loss of Function Missense_Mutation
1948 TP53_ENST ENST00000413465 129853 c.488A>G p.Y163C Loss of Function Missense_Mutation
1949 TP53_ENST ENST00000545858 179825 c.249C>A p.C83* Loss of Function Nonsense_Mutation
1950 TP53 NM_000546 45025 c.488A>C p.Y163S Loss of Function Missense_Mutation
1951 TP53_ENST ENST00000545858 118012 c.313G>T p.E105* Loss of Function Nonsense_Mutation
1952 TP53 NM_000546 43844 c.613T>G p.Y205D Loss of Function Missense_Mutation
1953 TP53 NM_000546 11351 c.614A>T p.Y205F Loss of Function Missense_Mutation
1954 TP53 NM_000546 43642 c.613T>C p.Y205H Loss of Function Missense_Mutation
1955 TP53_ENST ENST00000545858 111497 c.253delC p.H85fs*69 Loss of Function Frame_Shift_Del
1956 TP53 NM_000546 44169 c.614A>C p.Y205S Loss of Function Missense_Mutation
1957 TP53_ENST ENST00000269305 99720 c.659A>G p.Y220C Loss of Function Missense_Mutation
1958 TP53_ENST ENST00000413465 99718 c.659A>G p.Y220C Loss of Function Missense_Mutation
1959 TP53 NM_000546 11847 c.658T>G p.Y220D Loss of Function Missense_Mutation
1960 TP53_ENST ENST00000545858 117948 c.295C>T p.Q99* Loss of Function Nonsense_Mutation
1961 TP53_ENST ENST00000545858 99667 c.307C>T p.R103* Loss of Function Nonsense_Mutation
1962 TP53_ENST ENST00000545858 99617 c.358C>T p.R120* Loss of Function Nonsense_Mutation
1963 TP53 NM_000546 44672 c.658T>A p.Y220N Loss of Function Missense_Mutation
1964 TP53_ENST ENST00000269305 165073 c.701A>G p.Y234C Loss of Function Missense_Mutation
1965 TP53_ENST ENST00000413465 165072 c.701A>G p.Y234C Loss of Function Missense_Mutation
1966 TP53 NM_000546 43768 c.700T>G p.Y234D Loss of Function Missense_Mutation
1967 TP53 NM_000546 44953 c.700_702delTAC p.Y234del Loss of Function In_Frame_Del
1968 TP53 NM_000546 11152 c.700T>C p.Y234H Loss of Function Missense_Mutation
1969 TP53_ENST ENST00000269305 116674 c.707A>G p.Y236C Loss of Function Missense_Mutation
1970 TP53_ENST ENST00000413465 116672 c.707A>G p.Y236C Loss of Function Missense_Mutation
1971 TP53 NM_000546 44072 c.706_708delTAC p.Y236del Loss of Function In_Frame_Del
1972 TP53 NM_000546 44326 c.706T>C p.Y236H Loss of Function Missense_Mutation
1973 TP53 NM_000546 44693 c.707A>C p.Y236S Loss of Function Missense_Mutation
1974 TP53_ENST ENST00000414315 129855 c.92A>G p.Y31C Loss of Function Missense_Mutation
1975 TP53_ENST ENST00000545858 99945 c.99C>G p.Y33* Loss of Function Nonsense_Mutation
1976 TP53_ENST ENST00000545858 220784 c.97T>G p.Y33D Loss of Function Missense_Mutation
1977 TP53_ENST ENST00000545858 129854 c.209A>G p.Y70C Loss of Function Missense__Mutation

TABLE 19
Driver
Gene 5′ Gene Symbol 3′ Gene Symbol 5′ Entrez Id 3′ Entrez Id Source
1 ABL1 BCR ABL1 613 25 11289094, 21435002, ngs
2 ABL1 BCR ABL1 613 25 11289094, 21435002, ngs
3 AKT3 MAGI3 AKT3 260425 10000 Banerji et al 2012, Nature
4 ALK EML4 ALK 27436 238 ngs
5 ALK EML4 ALK 27436 238 ngs
6 ALK EML4 ALK 27436 238 literature
7 ALK EML4 ALK 27436 238 literature
8 ALK EML4 ALK 27436 238 literature
9 ALK EML4 ALK 27436 238
10 ALK EML4 ALK 27436 238 OncoNetwork
11 ALK EML4 ALK 27436 238 OncoNetwork
12 ALK EML4 ALK 27436 238 OncoNetwork
13 ALK EML4 ALK 27436 238 OncoNetwork; ngs
14 ALK EML4 ALK 27436 238 OncoNetwork; ngs
15 ALK EML4 ALK 27436 238 OncoNetwork
16 ALK EML4 ALK 27436 238 OncoNetwork
17 ALK EML4 ALK 27436 238 OncoNetwork
18 ALK EML4 ALK 27436 238 OncoNetwork
19 ALK EML4 ALK 27436 238 OncoNetwork
20 ALK EML4 ALK 27436 238 OncoNetwork
21 ALK EML4 ALK 27436 238 OncoNetwork
22 ALK EML4 ALK 27436 238 OncoNetwork
23 ALK KIF5B ALK 3799 238 OncoNetwork
24 ALK KIF5B ALK 3799 238 OncoNetwork
25 ALK KIF5B ALK 3799 238 OncoNetwork
26 ALK KLC1 ALK 3831 238 cosmic
27 ALK TFG ALK 10342 238 cosmic
28 ALK TFG ALK 10342 238 cosmic
29 ALK TFG ALK 10342 238 cosmic
30 ALK ALK PTPN3 238 5774 Jung et al 2012, Genes Chromosomes Cance
31 BRAF AGTRAP BRAF 57085 673 cosmic
32 BRAF AKAP9 BRAF 10142 673 AY803272.1
33 BRAF SLC45A3 BRAF 85414 673 cosmic
34 CDK4 CDK4 UBA1 1019 7317 Asmann et al. 2012 Cancer Research
35 ERBB2 WIPF2 ERBB2 147179 2064 Asmann et al. 2011 Nucleic Acids Research
36 ERG TMPRSS2 ERG 7113 2078 cosmic; ngs
37 ERG TMPRSS2 ERG 7113 2078 ngs
38 ERG TMPRSS2 ERG 7113 2078 cosmic
39 ERG TMPRSS2 ERG 7113 2078 ngs
40 ERG TMPRSS2 ERG 7113 2078 cosmic; ngs
41 ERG TMPRSS2 ERG 7113 2078 cosmic; ngs
42 ERG TMPRSS2 ERG 7113 2078 cosmic; ngs
43 ERG TMPRSS2 ERG 7113 2078 ngs
44 ERG TMPRSS2 ERG 7113 2078 cosmic; ngs
45 ERG TMPRSS2 ERG 7113 2078 cosmic
46 ERG TMPRSS2 ERG 7113 2078 cosmic
47 ERG TMPRSS2 ERG 7113 2078 cosmic
48 ERG TMPRSS2 ERG 7113 2078 cosmic
49 ERG TMPRSS2 ERG 7113 2078 cosmic; ngs
50 ERG TMPRSS2 ERG 7113 2078 cosmic
51 ERG TMPRSS2 ERG 7113 2078 cosmic
52 ERG TMPRSS2 ERG 7113 2078 cosmic; ngs
53 ERG TMPRSS2 ERG 7113 2078 cosmic
54 ERG TMPRSS2 ERG 7113 2078 cosmic
55 ERG TMPRSS2 ERG 7113 2078 cosmic
56 ERG TMPRSS2 ERG 7113 2078 cosmic
57 ERG TMPRSS2 ERG 7113 2078 cosmic
58 ERG TMPRSS2 ERG 7113 2078 cosmic
59 ETV1 TMPRSS2 ETV1 7113 2115 ngs
60 ETV1 TMPRSS2 ETV1 7113 2115 cosmic; ngs
61 ETV1 TMPRSS2 ETV1 7113 2115 cosmic
62 ETV1 TMPRSS2 ETV1 7113 2115 cosmic
63 ETV1 TMPRSS2 ETV1 7113 2115 cosmic
64 ETV1 TMPRSS2 ETV1 7113 2115 cosmic
65 ETV4 TMPRSS2 ETV4 7113 2118 ngs
66 ETV4 TMPRSS2 ETV4 7113 2118 ngs
67 ETV4 TMPRSS2 ETV4 7113 2118 cosmic
68 ETV4 TMPRSS2 ETV4 7113 2118 cosmic
69 ETV4 TMPRSS2 ETV4 7113 2118 cosmic
70 ETV5 TMPRSS2 ETV5 7113 2119 EU314929.1
71 ETV5 TMPRSS2 ETV5 7113 2119 EU314930.1
72 ETV5 TMPRSS2 ETV5 7113 2119 EU314931.1
73 FGFR3 FGFR3 TACC3 2261 10 cosmic; ngs
74 FGFR3 FGFR3 TACC3 2261 10 cosmic
75 FGFR3 FGFR3 TACC3 2261 10 cosmic
76 FGFR3 FGFR3 TACC3 2261 10460
77 FGFR3 FGFR3 TACC3 2261 10460
78 FGFR3 FGFR3 TACC3 2261 10 ngs
79 FGFR3 FGFR3 TACC3 2261 10 ngs
80 FGFR3 FGFR3 TACC3 2261 10 ngs
81 FGFR3 FGFR3 TACC3 2261 10 ngs
82 FGFR3 FGFR3 TACC3 2261 10 cosmic
83 FGFR3 FGFR3 TACC3 2261 10 cosmic; ngs
84 NTRK3 ETV6 NTRK3 2120 4916 ARUP
85 NTRK3 ETV6 NTRK3 2120 4916 ARUP
86 RAF1 ESRP1 RAF1 54845 5894 cosmic
87 RARA PML RARA 5371 5914 12032336, ngs
88 RARA PML RARA 5371 5914 12032336, ngs
89 RARA PML RARA 5371 5914 ngs
90 RET CCDC6 RET 8030 5979 OncoNetwork; ngs
91 RET ERC1 RET 23085 5979 ngs
92 RET ERC1 RET 23085 5979 ngs
93 RET ERC1 RET 23085 5979 ngs
94 RET GOLGA5 (PTC5) RET 9950 5979 Klaugbauer et al. 1998, Cancer Research
95 RET HOOK3 RET 84376 5979 DQ104207.1
96 RET KIAA1468 (RFG9) RET 57614 5979 Klugbauer et al 2000, Cancer Res
97 RET KIF5B RET 3799 5979 OncoNetwork
98 RET KIF5B RET 3799 5979 OncoNetwork
99 RET KIF5B RET 3799 5979 OncoNetwork
100 RET KIF5B RET 3799 5979 OncoNetwork
101 RET KIF5B RET 3799 5979 OncoNetwork
102 RET KIF5B RET 3799 5979 OncoNetwork
103 RET KIF5B RET 3799 5979 OncoNetwork
104 RET KTN1 (PTC8) RET 3895 5979 Salassidis et al 2000, Cancer Res
105 RET NCOA4 RET 8031 5979 ngs
106 RET PCM1 (PTC4) RET 5108 5979 Corvi et al 2000, Oncogene
107 RET PRKAR1A RET 5573 5979 Bongarzone et al. 1993, Molecular and cellu
108 RET TRIM24 (PTC6) RET 8805 5979 Klugbauer and Rabes 1999 Oncogene
109 RET TRIM27 RET 5987 5979 Saenko et al 2003, Mutat Res
110 RET TRIM33 (PTC7) RET 51592 5979 Klugbauer and Rabes 1999 Oncogene
111 ROS1 CD74 ROS1 972 6098 OncoNetwork; lungrx; ngs
112 ROS1 CD74 ROS1 972 6098 OncoNetwork; lungrx
113 ROS1 CD74 ROS1 972 6098 lungrx
114 ROS1 EZR ROS1 7430 6098 lungrx
115 ROS1 EZR ROS1 7430 6098 OncoNetwork; ngs
116 ROS1 GOPC ROS1 57120 6098 OncoNetwork
117 ROS1 GOPC ROS1 57120 6098 OncoNetwork
118 ROS1 LRIG3 ROS1 121227 6098 OncoNetwork
119 ROS1 SDC4 ROS1 6385 6098 OncoNetwork
120 ROS1 SDC4 ROS1 6385 6098 OncoNetwork
121 ROS1 SDC4 ROS1 6385 6098 OncoNetwork
122 ROS1 SDC4 ROS1 6385 6098 OncoNetwork
123 ROS1 SLC34A2 ROS1 10568 6098
124 ROS1 SLC34A2 ROS1 10568 6098
125 ROS1 SLC34A2 ROS1 10568 6098
126 ROS1 SLC34A2 ROS1 10568 6098 OncoNetwork
127 ROS1 SLC34A2 ROS1 10568 6098 OncoNetwork
128 ROS1 TPM3 ROS1 7170 6098 OncoNetwork
129 ALK CLIP4 ALK 79745 238 Cazes et al. 2013, Cancer Research
130 ALK GTF2IRD1 ALK 9569 238 ngs
131 ALK MEMO1 ALK 51072 238 ngs
132 ALK NCOA1 ALK 8648 238 N/A
133 ALK PRKAR1A ALK 5573 238 N/A
134 ALK STRN ALK 6801 238 cosmic; ngs
135 ALK TPM1 ALK 7168 238 ngs
136 RET AKAP13 RET 11214 5979 ngs
137 RET FKBP15 RET 23307 5979 ngs
138 RET SPECC1L RET 23384 5979 N/A
139 RET TBL1XR1 RET 79718 5979 N/A
140 ROS1 CEP85L ROS1 387119 6098 ngs
141 ABL1 BCR ABL1 613 25 11289094, 21435002
142 ABL1 BCR ABL1 613 25 11289094, 21435002
143 ABL1 BCR ABL1 613 25 11289094, 21435002
144 ABL1 BCR ABL1 613 25 11289094, 21435002
145 ABL1 BCR ABL1 613 25 11289094, 21435002
146 ABL1 BCR ABL1 613 25 11289094, 21435002
147 ABL1 BCR ABL1 613 25 11289094, 21435002
148 ABL1 BCR ABL1 613 25 11289094, 21435002
149 PAX8 PPARG 7849 5468 COSMIC COSF1223
150 PAX8 PPARG 7849 5468 COSMIC, ngs COSF1215
151 PAX8 PPARG 7849 5468 COSMIC, ngs COSF1217
152 PAX8 PPARG 7849 5468 COSMIC CSOF1221
153 PAX8 PPARG 7849 5468 COSMIC COSF1219, COSF1222
154 RARA PML RARA 5371 5914 Ampang
155 RARA ZBTB16 RARA Ampang
156 RARA PML RARA Ampang
157 ABL1 BCR ABL1 613 25 Ampang
158 ABL1 BCR ABL1 613 25 Ampang
159 ABL1 BCR ABL1 613 25 Ampang
160 ABL1 BCR ABL1 613 25 Ampang
161 ABL1 BCR 25 613 Ampang
162 ABL1 BCR 25 613 Ampang
163 ABL1 EML1 ABL1 Ampang
164 RARA ZBTB16 RARA Ampang
165 RARA ZBTB16 Ampang
Cosmic IDs Cosmic IDs NGS
5′ Exon 5′ Exon 3′ Exon 3′ Exon (Observed (Inferred Breakpoint
Number Type Number Type Sequence) Breakpoint) Cosmic Fusion Syntax Label
1 1 cds 2 cds BCR_ABL1_23
2 14 cds 2 cds BCR_ABL1_24
3 9 cds 2 cds
4 6 cds 18 cds EML4_ALK_87
5 6 cds 17 cds EML4_ALK_88
6 14 (with an cds 20 cds
additional
11
nucleotides
of  unknown
origin)
7 14 cds 20 cds
8 15 cds 20 cds
9 N/A see N/A
‘NGSfusionsequences’
tab
10 17 cds 20 cds COSF1366, COSF1368
COSF1367
11 6 cds 19 cds COSF1296 COSF1297
12 13 cds 20 cds COSF408, COSF463,
COSF1062 COSF489,
COSF1063,
COSF462,
COSF410,
COSF414
13 20 cds 20 cds COSF409 COSF465, EML4_ALK_12
COSF490,
COSF731,
COSF464
14 6 cds 20 cds COSF411, COSF474, EML4_ALK_32
COSF412, COSF734,
COSF1296 COSF476,
COSF493,
COSF1297
15 6 (plus 33 cds 20 cds COSF411, COSF474,
nucleotides COSF412, COSF734,
from COSF1296 COSF476,
exon 6b) COSF493,
COSF1297
16 14 (with an cds 20 cds COSF477 COSF491
additional (starting
11 at
nucleotides nucleotide
of unknown 50 in
origin) exon 20)
17 2 cds 20 cds COSF478 COSF480
18 2 cds 20 cds COSF479
(contains
an
additional
117
nucleotides
from intron
19)
19 13 cds 20 cds COSF1062 COSF1063
(starting
at
nucleotide
69 in
exon 20)
20 14 cds 20 cds COSF1064 COSF1065
(starting
at
nucleotide
13 in
exon 20)
21 15 cds 20 cds COSF413 COSF475
(minus 19 (starting
nucleotides) at
nucleotide
21 of
exon 20)
22 18 cds 20 cds COSF487 COSF1376
23 15 cds 20 cds COSF1060,
COSF1381
24 24 cds 20 cds COSF1058
25 17 cds 20 cds COSF1257
26 9 cds 20 cds 1276 1277 KLC1{ENST00000389744}:
r.1_1530_ALK{NM_004304}:
r.4080_6222
27 5 cds 20 cds 426 TFG{ENST00000240851}:
r.1_1029_ALK{NM_004304}:
r.4080_6222
28 4 cds 20 cds 424 425 TFG{ENST00000240851+56:
r.1_864_ALK{NM_004304}:
r.4080_6222
29 6 cds 20 cds 428 429 TFG{ENST00000240851}:
r.1_1170_ALK{NM_0 04304}:
r.4080_6222
30 **** Fusion contains exons 1
and 2 of PTPN3 with part of
intron 9 followed by exons 10
and 11 of ALK and the exons 3,
4, 5, of PTPN3****
31 well cds? 8 cds 828 829 AGTRAP{ENST00000314340}:
within r.1_598_BRAF{NM_004333}:
exon 5? r.1043_2513
32 8 cds 9 cds
33 1 utr5 8 cds 871 872 SLC45A3{ENST00000367145}:
r.1_66_BRAF{NM_004333}:
r.1042_2513
34 Exons not specified.
35 1 utr5 4 cds
36 1 utr5 2 utr5 23 123 TMPRSS2{NM_005656.2}: TMPRSS2_ERG_67
r.1_71_ERG{NM_004449.3}:
r.38_3097
37 1 utr5 3 cds TMPRSS2_ERG_73
38 1 utr5 3 utr5 24 124 TMPRSS2{NM_005656.2}:
r.1_71_ERG{NM_004449.3}:
r.140_3097
39 1 cds 4 cds TMPRSS2_ERG_62
40 1 utr5 4 cds 38 138 TMPRSS2{NM_005656.2}: TMPRSS2_ERG_63
r.1_71_ERG{NM_004449.3}:
r.226-?3097
41 1 utr5 4 cds 25 125 TMPRSS2{NM_005656.2}: TMPRSS2_ERG_63
r.1_71_ERG{NM_004449.3}:
r.226_3097
42 1 utr5 4 cds 39 139 TMPRSS2{NM_005656.2}: TMPRSS2_ERG_63
r.1_71 + ?_ERG
{NM_004449.3}:
r.226-?_3097
43 1 cds 5 cds TMPRSS2_ERG_77
44 1 utr5 5 cds 26 126 TMPRSS2{NM_005656.2}: TMPRSS2_ERG_61
r.1_71_ERG{NM_004449.3}:
r.444_3097
45 1 utr5 6 cds 36 TMPRSS2{NM_005656.2}:
r.1_71_ERG{NM_004449.3}:
r.596_3097
46 1 utr5 2 (no utr5 41 TMPRSS2{NM_005656.2}:
exon 5) r.1_71_ERG{NM_004449.31:
r.38_443_ERG{NM_004449.3}:
r.596_3097
47 1 utr5 3 (no utr5 40 TMPRSS2{NM_005656.2}:
exon 4) r.1_71_ERG{NM_004449.31:
r.140_225_ERG
{NM_004449.3}:
r.444_3097
48 2 cds 2 utr5 27 127 TMPRSS2{NM_005656.2}:
r.1_142_ERG{NM_004449.3}:
r.38_3097
49 2 cds 4 cds 28 128 TMPRSS2{NM_005656.2}: TMPRSS2_ERG_64
r.1_142_ERG{NM_004449.3}:
r.226_3097
50 2 cds 5 cds 29 129 TMPRSS2{NM_005656.2}:
r.1_142_ERG{NM_004449.3}:
r.444_3097
51 2 cds 4 (with cds 216 TMPRSS2{NM_005656.2}:
repeat of r.1_142_ERG{AY204740.1}:
portion r.226_320_ERG{NM_004449.3}:
of 4) r.226_3097
52 3 cds 4 cds 30 130 TMPRSS2{NM_005656.2}: TMPRSS2_ERG_68
r.1_365_ERG{NM_004449.3}:
r.226_3097
53 4 cds 4 cds 18 118 TMPRSS2{NM_005656.2}:
r.1_452_ERG{NM_004449.3}:
r.226_3097
54 4 cds 5 cds 17 TMPRSS2{NM_005656.2}:
r.1_452_ERG{NM_004449.3}:
r.444_3097
55 5 cds 4 cds 16 116 TMPRSS2{NM_005656.2}:
r.1_572_ERG{NM_004449.3}:
r.226_3097
56 4 (no cds 4 cds 202 TMPRSS2{NM_005656.2}:
exon 2 r.1_71_TMPRSS2{NM_005656.2}:
or 3) r.366_452_ERG{NM_004449.3}:
r.226_3097
57 4 (no cds 5 cds 203 TMPRSS2{NM_005656.2}:
exon 2 r.1_71_TMPRSS2{NM_005656.2}:
or 3) r.366_452_ERG{NM_004449.3}:
r.444_3097
58 unknown unknown unknown unknown 21 121 TMPRSS2{NM_005656.2}:
r.?_ERG{NM_004449.3}:r.?
59 2 cds 9 cds TMPRSS2_ETV1_59
60 1 utr5 7 cds 33 TMPRSS2{NM_005656.2}: TMPRSS2_ETV1_53
r.1_71_ETV1{NM_004956.3}:
r.323_6158
61 2 cds 7 cds 34 134 TMPRSS2{NM_005656.2}:
r.1_142_ETV1{NM_004956.3}:
r.323_6158
62 1 utr5 6 cds 14 TMPRSS2{NM_005656.2}:
r.1_71_ETV1{NM_004956.3}:
r.269_6158
63 2 cds 6 cds 15 115 TMPRSS2{NM_005656.2}:
r.1_142_ETV1{NM_004956.3}:
r.269_6158
64 unknown unknown unknown unknown 22 122 TMPRSS2{NM_005656.2}:
r.?_ETV1{NM_004956.3}:r.?
65 1 utr5 2 utr5 TMPRSS2_ETV4_83
66 1 utr5 3 cds TMPRSS2_ETV4_82
67 8 kb intergenic? 3 cds 214 TMPRSS2{NM_005656.1}:
upstream of r.(1-8013_1-8000)_ETV4
start {NM_001986.1}
r.131-19_2212
68 8 kb intergenic? 2 cds 213 212 TMPRSS2{NM_005656.2}:
upstream r.(1-8047_1-8000)_ETV4
of start {NM_001986.1}:
r.131-19_2212
69 unknown unknown unknown unknown 44 144 TMPRSS2{NM_005656.2}:
r.?_ETV4{NM_001986.1}:r.?
70 1 utr5 2 utr5
71 3 cds 2 utr5
72 3 cds 2 utr5
73 17 cds 11 cds 1348 FGFR3{NM_000142}: FGFR3_TACC3_3
r.1_2530_TACC3
{ENST00000313288}:
r.2048_2781
74 17 + cds middle cds 1350 1351 FGFR3{NM_000142}:
extra? of 5? r.1_2530 +
104_TACC3{ENST00000313288}:
r.541_2781
75 17 cds 8 cds 1353 1355 FGFR3{NM_000142}:
r.1_2530_TACC3
{ENST00000313288}:
r.1751_2781
76 N/A see N/A
‘NGSfusionsequences’
tab
77 N/A see N/A
‘NGSfusionsequences’
tab
78 16 cds 11 cds FGFR3_TACC3_51
79 15 cds 11 cds FGFR3_TACC3_29
80 16 cds 10 cds FGFR3_TACC3_18
81 17 cds 6 cds FGFR3_TACC3_11
82 17 + cds middle cds 1357 1358 FGFR3{NM_000142}:
extra? of 9? r.1_2530 +
63_TACC3{ENST00000313288}:
r.1877_2781
83 17 cds 10 cds 1359 1360 FGFR3{NM_000142}: FGFR3_TACC3_19
r.1_2530_TACC3
{ENST00000313288}:
r.1943_2781
84 5 cds 13 cds COSF571 COSF572,
COSF889
85 4 cds 13 cds COSF823 COSF824
86 13 cds 6 cds 826 830 ESRP1{ENST00000358397}:
r.1_1955_RAF1{NM_002880}:
r.975_3245
87 6 cds 3 cds PML_RARA_25
88 3 cds 3 cds PML_RARA_26
89 4 cds 3 cds PML_RARA_27
90 1 cds 12 cds COSF1271 COSF1272 CCDC6_RET_44
91 7 cds 12 cds ERC1_RET_10
92 12 cds 12 cds ERC1_RET_85
93 17 cds 12 cds ERC1_RET_86
94 7 cds Includes
RET
Kinase
domain
95 11 cds 12 cds
96 10 cds Not
specified
97 24 cds 8 cds COSF1236 COSF1242
98 24 cds 11 cds COSF1262 COSF1263
99 16 cds 12 cds COSF1231 COSF1240
100 15 cds 11 cds COSF1255 COSF1256
101 23 cds 12 cds COSF1234 COSF1235
102 22 cds 12 cds COSF1253 COSF1254
103 15 cds 12 cds COSF1232 COSF1233
104 30 cds Includes
RET
Kinase
domain
105 7 cds 12 cds NCOA4_RET_89
106 29 cds Described
as RET
breakpoint
is the
same as
RET/PTC
1/2/3
with
intact
Kinase
domain
107 Exons not specified.
108 Exons not specified. The fusion includes the
RET tyrosine kinase domain
109 3 cds The
fusion
includes
the RET
tyrosine
kinase
domain
110 Exons not specified. The fusion includes the
RET tyrosine kinase domain
111 6 cds 34 cds COSF1200 COSF1203 CD74_ROS1_30
112 6 cds 32 cds COSF1202 COSF1201
113 N/A see N/A
‘NGSfusionsequences’
tab
114 N/A see N/A
‘NGSfusionsequences’
tab
115 10 cds 34 cds COSF1267 COSF1268 EZR_ROS1_43
116 8 cds 35 cds COSF1139 COSF1251
117 4 cds 36 cds COSF1188 COSF1210
118 16 cds 35 cds COSF1269 COSF1270
119 2 cds 32 cds COSF1265 COSF1266
120 4 cds 34 cds COSF1280 COSF1279
121 4 cds 32 cds COSF1278 COSF1279
122 2 cds 34 cds not in not in
cosmic cosmic
123 N/A see N/A
‘NGSfusionsequences’
tab
124 N/A see N/A
‘NGSfusionsequences’
tab
125 N/A see N/A
‘NGSfusionsequences’
tab
126 4 cds 32 cds COSF1198 COSF1197
127 13 cds 32 cds COSF1261, COSF1260
COSF1259
128 8 cds 35 cds COSF1273 COSF1274
129 11 cds 23 cds
130 7 cds 20 cds
131 2 cds 7 cds
132 N/A see N/A
‘NGSfusionsequences’
tab
133 N/A see N/A
‘NGSfusionsequences’
tab
134 3 cds 20 cds COSF1430 COSF1431 STRN{ENST00000263918}:
r.1_421_ALK{NM_004304}:
r.4080_6222
135 8 cds 20 cds
136 36 cds 12 cds
137 25 cds 12 cds
138 N/A see N/A
‘NGSfusionsequences’
tab
139 N/A See N/A
‘NGSfusionsequences’
tab
140 8 cds 36 cds
141 6 cds 2 cds
142 8 cds 2 cds
143 13 cds 2 cds
144 19 cds 2 cds
145 1 cds 3 cds
146 13 cds 3 cds
147 14 cds 3 cds
148 2 cds la utr5
149 7 cds 2 cds
150 8 cds 2 cds
151 9 cds 2 cds
152 9 (short - cds 2 cds
only the
first 102
bases of
exon 9)
153 10 cds 2 cds
154 6 cds 3 cds
155 3 cds 3 cds
156 5 3
157 18 cds 2 cds
158 6 cds 3 cds
159 19 cds 3 cds
160 18 cds 3 cds
161 1 14
162 1 15
163 17 2
164 4 cds 3 cds
165 2 4
NGS
5′ NGS 3′ NGS Reference Sample
5′ Accession Breakpoint 3′ Accession Breakpoint Build 5′ NGS Sequence 3′ NGS Sequence Count
1 NM_004327 23524426 NM_005157 133729451 hg19 CACTGCCCGGTTGTCGTGTCCG AAGCCCTTCAGCGGCCAGT 1
AGGCCACCATCGTGGGCGTCCG AGCATCTGACTTTGAGCCT
CAAGACCGGGCAGATCTGGCCC CAGGGTCTGAGTGAAGCC
AACGATGGCGAGGGCGCCTTCC GCTCGTTGGAACTCCAAG
ATGGAGACGCAG GAAAACCTTCTCGCTGGAC
CCAGTGA
2 NM_004327 23632600 NM_005157 133729451 hg19 ATTCCGCTGACCATCAATAAGG AAGCCCTTCAGCGGCCAGT 2
AAGATGATGAGTCTCCGGGGCT AGCATCTGACTTTGAGCCT
CTATGGGTTTCTGAATGTCATCG CAGGGTCTGAGTGAAGCC
TCCACTCAGCCACTGGATTTAAG GCTCGTTGGAACTCCAAG
CAGAGTTCAA GAAAACCTTCTCGCTGGAC
CCAGTGA
3
4 NM_019063 42491868 NM_004304 29450442 hg19 GATGATAGCCGTAATAAATTGT AAGTGATGGAAGGCCACG 1
CGAAAATACCTTCAACACCCAA GGGAAGTGAATATTAAGC
ATTAATACCAAAAGTTACCAAA ATTATCTAAACTGCAGTCA
ACTGCAGACAAGCATAAAGATG CTGTGAGGTAGACGAATG
TCATCATCAACC TCACATGGACCCTGAAAGC
CACAAGGT
5 NM_019063 42491869 NM_004304 29451751 hg19 ATGATAGCCGTAATAAATTGTC AGGCGGCAATGCAGCCTC 1
GAAAATACCTTCAACACCCAAAT AAACAATGACCCCGAAAT
TAATACCAAAAGTTACCAAAACT GGATGGGGAAGATGGGG
GCAGACAAGCATAAAGATGTCA TTTCCTTCATCAGTCCACTG
TCATCAACCA GGCATCCTGTACACCCCAG
CTTTAAAA
6
7
8
9
10
11
12
13 NM_019063 42552694 NM_004304 29446394 hg19 GGAAGGTGCACTGGACATTCCA TGTACCGCCGGAAGCACC 1
GCTACATCACACACCTTGACTGG AGGAGCTGCAAGCCATGC
TCCCCAGACAACAAGTATATAAT AGATGGAGCTGCAGAGCC
GTCTAACTCGGGAGACTATGAA CTGAGTACAAGCTGAGCA
ATATTGTACT AGCTCCGCACCTCGACCAT
CATGACCGA
14 NM_019063 42491870 NM_004304 29448327 hg19 TGATAGCCGTAATAAATTGTCG GTGTACCGCCGGAAGCAC 1
AAAATACCTTCAACACCCAAATT CAGGAGCTGCAAGCCATG
AATACCAAAAGTTACCAAAACT CAGATGGAGCTGCAGAGC
GCAGACAAGCATAAAGATGTCA CCTGAGTACAAGCTGAGC
TCATCAACCAA AAGCTCCGCACCTCGACCA
TCATGACCG
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36 NM_005656 42880008 NM_004449 39956869 hg19 GAGTAGGCGCGAGCTAAGCAG GTTATTCCAGGATCTTTGG 3
GAGGCGGAGGCGGAGGCGGA AGACCCGAGGAAAGCCGT
GGGCGAGGGGCGGGGAGCGCC GTTGACCAAAAGCAAGAC
GCCTGGAGCGCGGCAG AAATGACTCACAGAGAAA
AAAGATGGCAGAACCAAG
GGCAACTAA
37 NM_005656 42880008 NM_004449 39947671 hg19 GAGTAGGCGCGAGCTAAGCAG CCGTCAGGTTCTGAACAGC 1
GAGGCGGAGGCGGAGGCGGA TGGTAGATGGGCTGGCTT
GGGCGAGGGGCGGGGAGCGCC ACTGAAGGACATGATTCA
GCCTGGAGCGCGGCAG GACTGTCCCGGACCCAGC
AGCTCATATCAAGGAAGC
CTTATCAGT
38
39 NM_001135099 42879877 NM_004449 39817544 hg19 GGGGTCCGGGCTGGGGAGGGG GAAGCCTTATCAGTTGTGA 26
AACCTGGGCGCCTGGGACCCGC GTGAGGACCAGTCGTTGTT
CGATGCCCCCTGCCCCGCCCGG TGAGTGTGCCTACGGAAC
AGGTGAAAGCGGGTGTGAGGA GCCACACCTGGCTAAGAC
GCGCGGCGCGGCAG AGAGATGACCGCGTCCTCC
TCCAGCG
40 NM_005656 42880008 NM_004449 39817544 hg19 GAGTAGGCGCGAGCTAAGCAG GAAGCCTTATCAGTTGTGA 34
GAGGCGGAGGCGGAGGCGGA GTGAGGACCAGTCGTTGTT
GGGCGAGGGGCGGGGAGCGCC TGAGTGTGCCTACGGAAC
GCCTGGAGCGCGGCAG GCCACACCTGGCTAAGAC
AGAGATGACCGCGTCCTCC
TCCAGCG
41 NM_005656 42880008 NM_004449 39817544 hg19 GAAGCCTTATCAGTTGTGA 34
GAGTAGGCGCGAGCTAAGCAG GTGAGGACCAGTCGTTGTT
GAGGCGGAGGCGGAGGCGGA TGAGTGTGCCTACGGAAC
GGGCGAGGGGCGGGGAGCGCC GCCACACCTGGCTAAGAC
GCCTGGAGCGCGGCAG AGAGATGACCGCGTCCTCC
TCCAGCG
42 NM_005656 42880008 NM_004449 39817544 hg19 GAGTAGGCGCGAGCTAAGCAG GAAGCCTTATCAGTTGTGA 34
GAGGCGGAGGCGGAGGCGGA GTGAGGACCAGTCGTTGTT
GGGCGAGGGGCGGGGAGCGCC TGAGTGTGCCTACGGAAC
GCCTGGAGCGCGGCAG GCCACACCTGGCTAAGAC
AGAGATGACCGCGTCCTCC
TCCAGCG
43 NM_001135099 42879877 NM_004449 39795483 hg19 GGGGTCCGGGCTGGGGAGGGG GAACTCTCCTGATGAATGC 1
AACCTGGGCGCCTGGGACCCGC AGTGTGGCCAAAGGCGGG
CGATGCCCCCTGCCCCGCCCGG AAGATGGTGGGCAGCCCA
AGGTGAAAGCGGGTGTGAGGA GACACCGTTGGGATGAAC
GCGCGGCGCGGCAG TACGGCAGCTACATGGAG
GAGAAGCAC
44 NM_005656 42880008 NM_004449 39795483 hg19 GAGTAGGCGCGAGCTAAGCAG GAACTCTCCTGATGAATGC 5
GAGGCGGAGGCGGAGGCGGA AGTGTGGCCAAAGGCGGG
GGGCGAGGGGCGGGGAGCGCC AAGATGGTGGGCAGCCCA
GCCTGGAGCGCGGCAG GACACCGTTGGGATGAAC
TACGGCAGCTACATGGAG
GAGAAGCAC
45
46
47
48
49 NM_005656 42870046 NM_004449 39817544 hg19 GGCGGGGAGCGCCGCCTGGAG GAAGCCTTATCAGTTGTGA 24
CGCGGCAGGTCATATTGAACAT GTGAGGACCAGTCGTTGTT
TCCAGATACCTATCATTACTCGA TGAGTGTGCCTACGGAAC
TGCTGTTGATAACAGCAAGATG GCCACACCTGGCTAAGAC
GCTTTGAACTCA AGAGATGACCGCGTCCTCC
TCCAGCG
50
51
52 NM_005656 42866283 NM_004449 39817544 hg19 TCCCCCGTGCCCCAGTACGCCCC GAAGCCTTATCAGTTGTGA 1
GAGGGTCCTGACGCAGGCTTCC GTGAGGACCAGTCGTTGTT
AACCCCGTCGTCTGCACGCAGC TGAGTGTGCCTACGGAAC
CCAAATCCCCATCCGGGACAGT GCCACACCTGGCTAAGAC
GTGCACCTCAA AGAGATGACCGCGTCCTCC
TCCAGCG
53
54
55
56
57
58
59 NM_005656 42870046 NM_004956 13971374 hg19 GGCGGGGAGCGCCGCCTGGAG ATTTCGCCGCCAGCTTTCT 1
CGCGGCAGGTCATATTGAACAT GAACCCTGTAACTCCTTTC
TCCAGATACCTATCATTACTCGA CTCCTTTGCCGACGATGCC
TGCTGTTGATAACAGCAAGATG AAGGGAAGGACGTCCTAT
GCTTTGAACTCA GTACCAACGCCAGATGTCT
GAGCCA
60 NM_005656 42880008 NM_004956 13978871 hg19 GAGTAGGCGCGAGCTAAGCAG TGGCTTTTCATGGCCTGCC 1
GAGGCGGAGGCGGAGGCGGA ACTGAAAATCAAGAAAGA
GGGCGAGGGGCGGGGAGCGCC ACCCCACAGTCCATGTTCA
GCCTGGAGCGCGGCAG GAAATCAGCTCTGCCTGCA
GTCAAGAACAGCCCTTTAA
ATTCAG
61
62
63
64
65 NM_005656 42880008 NM_001986 41623036 hg19 GAGTAGGCGCGAGCTAAGCAG GTCTCGGCCCCCGCTTGGG 1
GAGGCGGAGGCGGAGGCGGA GCCCCGGCCGTGCGGCCG
GGGCGAGGGGCGGGGAGCGCC GAGGGAGCGGCCGGATG
GCCTGGAGCGCGGCAG GAGCGGAGGATGAAAGCC
GGATACTTGGACCAGCAA
GTGCCCTACA
66 NM_005656 42880008 NM_001986 41622735 hg19 GAGTAGGCGCGAGCTAAGCAG AAATCGCCCGGAAATGGG 2
GAGGCGGAGGCGGAGGCGGA AGCTTGCGCGAAGCGCTG
GGGCGAGGGGCGGGGAGCGCC ATCGGCCCGCTGGGGAAG
GCCTGGAGCGCGGCAG CTCATGGACCCGGGCTCCC
TGCCGCCCCTCGACTCTGA
AGATCTCT
67
68
69
70
71
72
73 NM_000142 1808661 NM_006342 1741429 hg19 GATCATGCGGGAGTGCTGGCAT GTAAAGGCGACACAGGAG 8
GCCGCGCCCTCCCAGAGGCCCA GAGAACCGGGAGCTGAGG
CCTTCAAGCAGCTGGTGGAGGA AGCAGGTGTGAGGAGCTC
CCTGGACCGTGTCCTTACCGTG CACGGGAAGAACCTGGAA
ACGTCCACCGAC CTGGGGAAGATCATGGAC
AGGTTCGAAG
74
75
76
77
78 NM_000142 1808408 NM_006342 1741429 hg19 GCTGGGGGGCTCCCCGTACCCC GTAAAGGCGACACAGGAG 1
GGCATCCCTGTGGAGGAGCTCT GAGAACCGGGAGCTGAGG
TCAAGCTGCTGAAGGAGGGCCA AGCAGGTGTGAGGAGCTC
CCGCATGGACAAGCCCGCCAAC CACGGGAAGAACCTGGAA
TGCACACACGAC CTGGGGAAGATCATGGAC
AGGTTCGAAG
79 NM_000142 1808276 NM_006342 1741429 hg19 CGACTACTACAAGAAGACGACC GTAAAGGCGACACAGGAG 1
AACGGCCGGCTGCCCGTGAAGT GAGAACCGGGAGCTGAGG
GGATGGCGCCTGAGGCCTTGTT AGCAGGTGTGAGGAGCTC
TGACCGAGTCTACACTCACCAG CACGGGAAGAACCTGGAA
AGTGACGTCTGG CTGGGGAAGATCATGGAC
AGGTTCGAAG
80 NM_000142 1808408 NM_006342 1739325 hg19 GCTGGGGGGCTCCCCGTACCCC GTGCCAGGCCCACCCCCA 1
GGCATCCCTGTGGAGGAGCTCT GGTGTTCCCGCGCCTGGG
TCAAGCTGCTGAAGGAGGGCCA GGCCCACCCCTGTCCACCG
CCGCATGGACAAGCCCGCCAAC GACCTATAGTGGACCTGCT
TGCACACACGAC CCAGTACAGCCAGAAGGA
CCTGGATG
81 NM_000142 1808661 NM_006342 1732899 hg19 GATCATGCGGGAGTGCTGGCAT GAGAGAGCCTTGAACTCT 1
GCCGCGCCCTCCCAGAGGCCCA GCCAGCACCTCGCTTCCCA
CCTTCAAGCAGCTGGTGGAGGA CAAGCTGTCCAGGCAGTG
CCTGGACCGTGTCCTTACCGTG AGCCAGTGCCCACCCATCA
ACGTCCACCGAC GCAGGGGCAGCCTGCCTT
GGAGCTGA
82
83 NM_000142 1808661 NM_006342 1739325 hg19 GATCATGCGGGAGTGCTGGCAT GTGCCAGGCCCACCCCCA 2
GCCGCGCCCTCCCAGAGGCCCA GGTGTTCCCGCGCCTGGG
CCTTCAAGCAGCTGGTGGAGGA GGCCCACCCCTGTCCACCG
CCTGGACCGTGTCCTTACCGTG GACCTATAGTGGACCTGCT
ACGTCCACCGAC CCAGTACAGCCAGAAGGA
CCTGGATG
84
85
86
87 NM_002675 74325755 NM_000964 38504568 hg19 CCCCACCTGGATGGACCGCCTA CCATTGAGACCCAGAGCA 8
GCCCCAGGAGCCCCGTCATAGG GCAGTTCTGAAGAGATAG
AAGTGAGGTCTTCCTGCCCAAC TGCCCAGCCCTCCCTCGCC
AGCAACCACGTGGCCAGTGGCG ACCCCCTCTACCCCGCATC
CCGGGGAGGCAG TACAAGCCTTGCTTTGTCT
GTCAGGA
88 NM_002675 74315749 NM_000964 38504568 hg19 GAGGAGCCCCAGAGCCTGCAA CCATTGAGACCCAGAGCA 7
GCTGCCGTGCGCACCGATGGCT GCAGTTCTGAAGAGATAG
TCGACGAGTTCAAGGTGCGCCT TGCCCAGCCCTCCCTCGCC
GCAGGACCTCAGCTCTTGCATC ACCCCCTCTACCCCGCATC
ACCCAGGGGAAAG TACAAGCCTTGCTTTGTCT
GTCAGGA
89 NM_002675 74317268 NM_000964 38504568 hg19 CCTCAGCTCTTGCATCACCCAGG CCATTGAGACCCAGAGCA 3
GGAAAGATGCAGCTGTATCCAA GCAGTTCTGAAGAGATAG
GAAAGCCAGCCCAGAGGCTGCC TGCCCAGCCCTCCCTCGCC
AGCACTCCCAGGGACCCTATTG ACCCCCTCTACCCCGCATC
ACGTTGACCTG TACAAGCCTTGCTTTGTCT
GTCAGGA
90 NM_005436 61665880 NM_020630 43612032 hg19 AGAGAACAAGGTGCTGAAGAT GAGGATCCAAAGTGGGAA 2
AGAGCTGGAGACCTACAAACTG TTCCCTCGGAAGAACTTGG
AAGTGCAAGGCACTGCAGGAG TTCTTGGAAAAACTCTAGG
GAGAACCGCGACCTGCGCAAAG AGAAGGCGAATTTGGAAA
CCAGCGTGACCATC AGTGGTCAAGGCAACGGC
CTTCCATC
91 NM_178039 1250953 NM_020630 43612032 hg19 GGATATGGCTGAAGAGAAGGG GAGGATCCAAAGTGGGAA 1
GACACAAGCTGGAGAGATACAT TTCCCTCGGAAGAACTTGG
GACCTCAAGGACATGTTGGATG TTCTTGGAAAAACTCTAGG
TGAAGGAGCGGAAGGTTAATGT AGAAGGCGAATTTGGAAA
TCTTCAGAAGAAG AGTGGTCAAGGCAACGGC
CTTCCATC
92 NM_178039 1346070 NM_020630 43612032 hg19 GAAGCACAAGGAACAGGTGGA GAGGATCCAAAGTGGGAA 1
AAAAAAGAAGAGTGCACAAAT TTCCCTCGGAAGAACTTGG
GTTAGAGGAGGCGCGACGACG TTCTTGGAAAAACTCTAGG
GGAGGACAATCTCAACGACAGC AGAAGGCGAATTTGGAAA
TCTCAGCAGCTACAG AGTGGTCAAGGCAACGGC
CTTCCATC
93 NM_178039 1553916 NM_020630 43612032 hg19 CCCCCTGATCCTCCGTGGACTCA GAGGATCCAAAGTGGGAA 1
CTCCACCAGCTTCCTATAACTTG TTCCCTCGGAAGAACTTGG
GACGATGACCAGGCGGCTTGG TTCTTGGAAAAACTCTAGG
GAGAATGAGCTGCAGAAGATG AGAAGGCGAATTTGGAAA
ACCCGGGGGCAG AGTGGTCAAGGCAACGGC
CTTCCATC
94
95
96
97
98
99
100
101
102
103
104
105 NM_005437 51582939 NM_020630 43612032 hg19 CCTTGGAAGCAAACCTGCCAGT GAGGATCCAAAGTGGGAA 2
GGTTATCAAGCTCCTTACATACC TTCCCTCGGAAGAACTTGG
CAGCACCGACCCCCAGGACTGG TTCTTGGAAAAACTCTAGG
CTTACCCAAAAGCAGACCTTGG AGAAGGCGAATTTGGAAA
AGAACAGTCAG AGTGGTCAAGGCAACGGC
CTTCCATC
106
107
108
109
110
111 NM_004355 149784243 NM_002944 117645578 hg19 ATAGACTGGAAGGTCTTTGAGA ATGATTTTTGGATACCAGA 1
GCTGGATGCACCATTGGCTCCT AACAAGTTTCATACTTACT
GTTTGAAATGAGCAGGCACTCC ATTATAGTTGGAATATTTC
TTGGAGCAAAAGCCCACTGACG TGGTTGTTACAATCCCACT
CTCCACCGAAAG GACCTTTGTCTGGCATAGA
AGATT
112
113
114
115 NM_003379 159191796 NM_002944 117645578 hg19 GAAACCGTGGAGAGAGAGAAA ATGATTTTTGGATACCAGA 1
GAGCAGATGATGCGCGAGAAG AACAAGTTTCATACTTACT
GAGGAGTTGATGCTGCGGCTGC ATTATAGTTGGAATATTTC
AGGACTATGAGGAGAAGACAA TGGTTGTTACAATCCCACT
AGAAGGCAGAGAGAG GACCTTTGTCTGGCATAGA
AGATT
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130 NM_005685 73935627 NM_004304 29446394 hg19 1
131 NM_015955 32168371 NM_004304 29543748 hg19 1
132
133
134 NM_003162 37143221 NM_004304 29446394 hg19 2
135 NM_000366 63354844 NM_004304 29446394 hg19 1
136 NM_006738 86284726 NM_020630 43612032 hg19 1
137 NM_015258 115932802 NM_020630 43612032 hg19 1
138
139
140 NM_001042475 117641193 NM_002944 117641193 hg19 1
141 NM_004327 23613779 NM_005157 133729451 hg19
142 NM_004327 23615961 NM_005157 133729451 hg19
143 NM_004327 23631808 NM_005157 133729451 hg19
144 NM_004327 23654023 NM_005157 133729451 hg19
145 NM_004327 23524426 NM_005157 133730188 hg19
146 NM_004327 23631808 NM_005157 133730188 hg19
147 NM_004327 23632600 NM_005157 133730188 hg19
148 NM_004327 23596167 NM_005157 133710831 hg19
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165

Claims

What is claimed is:

1. A method to determine an actionable treatment recommendation for a subject diagnosed with cancer, comprising:

obtaining a biological sample from the subject

detecting at least one variant using a set of probes that hybridize to and amplify i) the variants of at least one gene in Tables 13-17 and 19; or ii) EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, ERRBB4, MET, RET, FGFR1, FGFR2, FGFR3, DDR2, NRAS, PTEN, MAP2K1, TP53, STK11, CTNNB1, SMAD4, FBXW7, NOTCH 1, KIT/PGDFRA, PIK3CA, AKT1, and HRAS genes to detect at least one variant,

determining, based on the at least one variant detected, an actionable treatment recommendation for the subject.

2. The method of claim 1, wherein the cancer is an adenocarcinoma lung cancer or a squamous cell carcinoma lung cancer.

3. The method of claim 1, wherein the sample is tissue comprising tumor tissue.

4. The method of claim 3, wherein the sample is an FFPE tumor tissue sample.

5. The method of claim 1, wherein the at least one variant is selected from ALK fusion, ROS1 fusion (EZR, SLC34A2, CD74, and/or SDC4), or MET gene amplification, EGFR (L858R, Exon 19 del, G719X and/or T790M), KRAS (G12C/V/D/A/S/R/F, G13C, G3D and/or G12F), BRAF (L597R, D594H/N, V600E), ERBB2 exon 20 ins, PIK3CA (E545K, E545G, E545a, H1047R, E542K, and/or H1047L), and a combination thereof.

6. The method of claim 1, wherein the actionable treatment recommendation is a course of treatment, refraining from a treatment, enrollment in a clinical trial, or a combination thereof.

7. The method of claim 6, further comprising performing the actionable treatment recommendation.

8. The method of claim 1, wherein the set of probes are in the same reaction mixture.

9. A method to determine an actionable treatment recommendation for a subject diagnosed with lung cancer, comprising:

detecting in a sample from a subject, at least one variant using a set of probes that hybridize to and amplify i) the variants of at least one gene in Tables 13-17 and 19; or ii) EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, ERRBB4, MET, RET, FGFR1, FGFR2, FGFR3, DDR2, NRAS, PTEN, MAP2K1, TP53, STK11, CTNNB1, SMAD4, FBXW7, NOTCH 1, KIT/PGDFRA, PIK3CA, AKT1, and HRAS genes to detect at least one variant,

determining, based on the at least one variant detected, an actionable treatment recommendation for the subject.

10. The method of claim 1 or 9, wherein the actionable treatment recommendation is selected from

a. Crizotinib when the variant detected is an ALK fusion, ROS1 fusion (EZR, SLC34A2, CD74, and/or SDC4), or MET gene amplification;

b. EGFR tyrosine kinase inhibitor (TKI) when the variant detected is EGFR (L858R, Exon 19 del, and/or G719X);

c. A non EGFR TKI when the variant detected is EGFR T790M;

d. A MEK inhibitor when the variant detected is KRAS G12C/V/D/A/S/R/F, G13C, G3D and/or G12F;

e. Vermurafenib when the variant detected is BRAF V600E;

f. An irreversible pan-erb inhibitor when the variant detected is ERBB2 exon 20 ins; and

g. A PIC3CA inhibitor when the variant detected is PIK3CA (E545K, E545G, E545a, H1047R, and/or H1047L).

11. The method of claim 1 or 9, further comprising treating the subject with the recommended actionable treatment.

12. The method of claim 1, wherein detection of a variant in at least one of the genes provides an actionable treatment recommendation for i) a cancer in Table 18; or ii) at least 50% of all primary lung adenocarcinoma.

13. A method to determine the likelihood of a response to a treatment in an individual afflicted with cancer, comprising:

determining the presence or absence of at least one gene variant in a sample obtained from the individual, wherein the at least one variant is i) a gene variant in Tables 13-17 and 19 or ii) in EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, ERRBB4, MET, RET, FGFR1, FGFR2, FGFR3, DDR2, NRAS, PTEN, MAP2K1, TP53, STK11, CTNNB1, SMAD4, FBXW7, NOTCH 1, KIT/PGDFRA, PIK3CA, AKT1, and HRAS genes,

wherein the presence of at least one variant indicates the individual is likely or unlikely to respond to the treatment.

14. The method of claim 13 wherein the treatment is selected from:

a. crizotinib when the variant detected is an ALK fusion, ROS1 fusion (EZR, SLC34A2, CD74, and/or SDC4), or MET gene amplification;

b. EGFR tyrosine kinase inhibitor (TKI) when the variant detected is EGFR (L858R, Exon 19 del, and/or G719X);

c. a non-EGFR TKI treatment when the variant detected is EGFR T790M;

d. a MEK inhibitor when the variant detected is KRAS G12C/V/D/A/S/R/F, G13C, G3D and/or G12F;

e. vermurafenib when the variant detected is BRAF V600E;

f. an irreversible pan-erb inhibitor when the variant detected is ERBB2 exon 20 ins; and

g. a PIC3CA inhibitor when the variant detected is PIK3CA (E545K, E545G, E545a, H1047R, E542K and/or H1047L).

15. A method of detecting a nucleic acid variant in a sample, comprising

obtaining a biological sample,

a) amplifying at least one gene selected from i) the genes in Tables 13-17 and 19 or ii) EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, ERRBB4, MET, RET, FGFR1, FGFR2, FGFR3, DDR2, NRAS, PTEN, MAP2K1, TP53, STK11, CTNNB1, SMAD4, FBXW7, NOTCH 1, KIT/PGDFRA, PIK3CA, AKT1, and HRAS, using primers that specifically hybridize to the genes;

b) amplifying at least one variant selected from i) the variants in Tables 13-17 and 19, or ii) EGFR (L858R, Exon 19 del, G719X, T790M and/or Exon 20 ins), KRAS (G12C/V/D/A/S/R/F, G13C, G13D and/or G12F), BRAF (L597R, D594H/N, V600E), ERBB2 exon 20 ins, PIK3CA (E545K, E545G, E545a, H1047R, and/or H1047L), c) detecting at least one nucleic acid variant present in the sample.

16. A method of treating lung adenocarcinoma in a patient, comprising testing for the presence of variants in at least one of ALK, ROS1, KRAS, BRAF, ERBB2, MET, RET, FGFR1, and KIT/PDGFRA genes in a lung tumor sample from the patient and administering a therapeutically effective amount a treatment to the patient, wherein the treatment is

a. Crizotinib when the variant detected is an ALK fusion, ROS1 fusion (EZR, SLC34A2, CD74, and/or SDC4), or MET gene amplification;

b. EGFR tyrosine kinase inhibitor (TKI) when the variant detected is EGFR (L858R, Exon 19 del, and/or G719X);

c. A MEK inhibitor when the variant detected is KRAS G12C/V/D/A/S/R/F, G13C, G3D and/or G12F;

d. Vermurafenib when the variant detected is BRAF V600E; and

e. An irreversible pan-erb inhibitor when the variant detected is ERBB2 exon 20 ins.

17. A method of identifying patients with lung cancer eligible for treatment with crizotnib, an EGFR TKI, or a treatment other than an EGFR™, a MEK inhibitor, vermurafenib, or an irreversible pan-erb inhibitor, comprising testing a lung tumor sample from the patient for the presence of a variant comprising an ALK fusion, ROS1 fusion (EZR, SLC34A2, CD74, and/or SDC4), EGFR (L858R, Exon 19 del, and/or T790M), KRAS (G12C/V/D/A), wherein the presence of at least one of said variants indicates the patient is eligible for treatment with at least one of said treatments.

18. The method of claim 17, wherein the ALK gene fusion isoform is an EML4-ALK gene fusion isoform.

19. A kit comprising a set of probes, wherein the set of probes specifically recognize the genes i) in Tables 13-17 and 19; or ii) AKT1, ALK, BRAF, ERBB2, EGFR, FGFR1, HRAS, KIT, KRAS, MET, PIK3CA, RET and ROS, and wherein the set of probes can recognize and distinguish one or more allelic variants of the genes in i) Tables 13-17 and 19; or ii) AKT1, ALK, BRAF, ERBB2, EGFR, HRAS, KRAS, MET, PIK3CA, RET and ROS.

20. The kit of claim 19, wherein the allelic variants include one or more of the polynucleotides encoding AKT1 (E17K), BRAF (L597R, D594H/N, V600E), EGFR (L858R, G719X, T790M), HRAS (Q61L/K/R, G12C/D), KRAS G12A/C/D/F/R/V) and PIK3CA (E545A/G/K, H1047L/R).

21. The kit of claim 19, wherein the allelic variants include one or more of the polynucleotides encoding EGFR (L858R, G719X, T790M) and KRAS G12A/C/D/F/R/V).

22. The kit of claim 19, wherein two or more of the probes are primer pairs.

23. The kit of claim 19, wherein one or more of the probes are detectably labeled.

24. The kit of claim 19, wherein the set of probes comprises at least 4 amplification detection assays, wherein the at least 4 amplification detection assays are specific for the genes ALK, EGFR, KRAS and ROS.

26. A composition comprising a set of probes, wherein the set of probes specifically hybridize with a plurality of genes i) in Tables 13-17 and 19; or ii) the genes AKT1, ALK, BRAF, ERBB2, EGFR, FGFR1, HRAS, KIT, KRAS, MET, PIK3CA, RET and ROS, and wherein the set of probes can recognize and distinguish one or more allelic variants of the genes i) in Tables 13-17 and 19; or ii) AKT1, ALK, BRAF, ERBB2, EGFR, HRAS, KRAS, MET, PIK3CA, RET and ROS.

27. The composition of claim 26, further comprising a sample.

28. The composition of claim 27, wherein the sample comprises nucleic acids from tumor cells.

29. The method of claims 1, 11, 15 or 16, wherein the gene variants are selected from an A1 and prevalence selected from AI1+Prevalence>1%, AI2+Prevalence>1%, AI3+Prevalence>1%, AI1+Prevalence 0.1%-1%, AI2+Prevalence 0.1%-1%, AI3+Prevalence 0.1%-1%, and combinations thereof.

30. The kit of claim 19, wherein the gene variants are selected from an A and prevalence selected from AI1+Prevalence>1%, AI2+Prevalence>1%, AI3+Prevalence>1%, AI1+Prevalence 0.1%-1%, AI2+Prevalence 0.1%-1%, AI3+Prevalence 0.1%-1%, and combinations thereof.

31. The composition of claim 26, wherein the gene variants are selected from an A1 and prevalence selected from AI1+Prevalence>1%, AI2+Prevalence>1%, AI3+Prevalence>1%, AI1+Prevalence 0.1%-1%, AI2+Prevalence 0.1%-1%, AI3+Prevalence 0.1%-1%, and combinations thereof.

32. A method to determine an actionable treatment recommendation for a subject diagnosed with lung cancer, comprising:

obtaining a biological sample from the subject;

detecting at least one variant using a set of probes that hybridize to and amplify EGFR, ALK, ROS1, KRAS, BRAF, ERBB2, MET, RET, FGFR1, KIT/PGDFRA, PIK3CA, AKT1, BRAF, and HRAS genes to detect at least one variant;

determining, based on the at least one variant detected, an actionable treatment recommendation for the subject.

33. A method of reporting an actionable index

obtaining a biological sample

amplifying a plurality of genes selected from the genes in Tables 13-17 and 19,

amplifying at least one variant selected from the variants Tables 13-17 and 19,

detecting at least one nucleic acid variant present in the sample,

determining the actionable index of the nucleic acid variant present,

reporting the actionable index.

34. The method of claim 33, wherein the biological sample comprises cancer cells.

35. The method of claim 33, wherein the actionable index is a treatment index.

35. The method of claim 33, wherein actionable index is selected from category A1, A2, A3, A4 or A5.

36. The method of any one of claims 1, 9, 13, wherein the nucleic acid variant is detected with one or more sequencing methods.

37. The method of any one of claims 1, 9, 13, wherein the nucleic acid variant is detected with one or more method selected from Maxam-Gilbert sequencing, Sanger sequencing, capillary array DNA sequencing, thermal cycle sequencing, solid-phase sequencing, sequencing with mass spectrometry such as matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, sequencing by hybridization, next generation sequencing (NGS), and a combination thereof.

38. The method of claim any one of claims 1, 9, 13, wherein the nucleic acid variant is detected with NGS.

39. The method of claim 38, further comprising confirming the detection of the nucleic acid variant with one or more methods selected from Maxam-Gilbert sequencing, Sanger sequencing, capillary array DNA sequencing, thermal cycle sequencing, solid-phase sequencing, sequencing with mass spectrometry such as matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, and sequencing by hybridization.

40. The method of any one of claims 1, 9, 13, wherein the at least one variant is associated with a cancer in Table 18.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class: