US20210198744A1
2021-07-01
17/201,469
2021-03-15
The present invention relates to methods for simultaneously determining the presence or absence of mutations, deletions, duplications and single nucleotide polymorphisms in a cystic fibrosis transmembrane regulator (CFTR) nucleic acid. Oligonucleotide primers and kits used to amplify regions of a CFTR nucleic acid for high throughput, massively parallel sequencing and methods of determining an individual's cystic fibrosis status are also disclosed.
Get notified when new applications in this technology area are published.
C12Q1/6827 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Hybridisation assays for detection of mutation or polymorphism
C12Q2600/156 » CPC further
Oligonucleotides characterized by their use Polymorphic or mutational markers
C12Q1/6883 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
G10L15/00 » CPC further
Speech recognition
G10L15/22 » CPC further
Speech recognition Procedures used during a speech recognition process, e.g. man-machine dialogue
This application is a Divisional of U.S. application Ser. No. 16/158,823, filed Oct. 12, 2018, which is a Divisional of U.S. application Ser. No. 14/774,331, which is the U.S. National Stage application of PCT/US2014/027870, filed Mar. 14, 2014, which claims priority from U.S. Provisional Application No. 61/785,862, filed Mar. 14, 2013.
The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-WEB and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Mar. 12, 2021, is named seqlisting.txt and is 40,033 bytes.
The present invention relates to methods for simultaneously determining the presence or absence of mutations, deletions, duplications and single nucleotide polymorphisms in a cystic fibrosis transmembrane regulator (CFTR) nucleic acid. Nucleotide sequences (such as for primers) used to amplify regions of a CFTR nucleic acid for high throughput, massively parallel sequencing and methods of determining an individual's cystic fibrosis status are also disclosed.
The following description of the background of the invention is provided simply as an aid in understanding the invention and is not admitted to describe or constitute prior art to the invention.
Cystic fibrosis (CF) is the most common severe autosomal recessive genetic disorder in the Caucasian population. It affects approximately 1 in 2,500 live births in North America (Boat et al, The Metabolic Basis of Inherited Disease, 6th ed, pp 2649-2680, McGraw Hill, NY (1989)). Approximately 1 in 25 persons are carriers of the disease. The major symptoms of cystic fibrosis include chronic pulmonary disease, pancreatic exocrine insufficiency, and elevated sweat electrolyte levels. The symptoms are consistent with cystic fibrosis being an exocrine disorder. Although recent advances have been made in the analysis of ion transport across the apical membrane of the epithelium of CF patient cells, it is not clear that the abnormal regulation of chloride channels represents the primary defect in the disease.
The gene for CF has been localized to a 250,000 base pair genomic sequence present on the long arm of chromosome 7. This sequence encodes a membrane-associated protein called the âcystic fibrosis transmembrane regulatorâ (or âCFTRâ). There are greater than 1000 different mutations in the CFTR gene, having varying frequencies of occurrence in the population, presently reported to the Cystic Fibrosis Genetic Analysis Consortium. These mutations exist in both the coding regions (e.g., ÎF508, a mutation found on about 70% of CF alleles, represents a deletion of a phenylalanine at residue 508) and the non-coding regions (e.g., the 5T, 7T, and 9T mutations correspond to a sequence of 5, 7, or 9 thymidine bases located at the splice branch/acceptor site of intron 8) of the CFTR gene. Comparison of the CFTR genomic and cDNA sequences confirms the presence of 27 exons. The exons are numbered 1-27 as shown in NCBI Reference Sequence accession no. NM_000492.3. Each intron is flanked by the consensus GT-AG splice-site sequence as previously reported (Zielenski, et al., (1991) Genomics 10, 214-228).
Methods for detecting CFTR gene mutations have been described. See e.g., Audrezet et al., âGenomic rearrangements in the CFTR gene: extensive allelic heterogeneity and diverse mutational mechanismsâ Hum Mutat. 2004 April; 23(4):343-57; PCT WO 1004/040013 A1 and corresponding US application #20040110138; titled âMethod for the detection of multiple genetic targetsâ by Spiegelman and Lem; US patent application No. 20030235834; titled âApproaches to identify cystic fibrosisâ by Dunlop et al.; and US patent application No. 20040126760 titled âNovel compositions and methods for carrying out multiple PCR reactions on a single sampleâ by N. Broude.
Currently, however, multiple different analysis and/or detection methods must be employed in order to accurately obtain comprehensive sequence data. For example, traditional Sanger sequencing methodology may be employed to determine the presence or absence of mutations involving a small number of nucleotides in the CFTR gene. Sanger sequencing, though, is unable to detect large deletions and duplications such as those involving one or more exons. As a result, additional methods such as quantitative fluorescent polymerase chain reaction (QF-PCR) are needed to detect these larger types of mutations.
Accordingly, improved methods are needed to efficiently detect the variety of CFTR gene defects which underlie CF and to simultaneously capture both dosage data (e.g., gene copy number) and sequence data. Moreover, improved methods are needed for detecting rare mutations in the CFTR gene. Ideally, methods that can detect multiple classes of CFTR mutations such as those involving small base changes (e.g., missense mutations, nonsense mutations, small insertions or deletions and/or splice-site mutations) and those involving larger deletions and/or duplications in a single assay are desirable.
Provided is a method for determining the nucleotide sequence of a sample CFTR nucleic acid, the method comprising (a) producing an adapter-tagged amplicon library by amplifying multiple target segments of the sample CFTR nucleic acid and (b) determining the nucleotide sequences of the target segments by sequencing the amplicons in the amplicon library using high throughput massively parallel sequencing.
Also provided is a method for determining the presence or absence of a CFTR nucleotide sequence variant in a sample CFTR nucleic acid comprising (a) producing an adapter-tagged amplicon library by amplifying multiple target segments of the sample CFTR nucleic acid; (b) determining the nucleotide sequences of the target segments by sequencing the amplicons in the amplicon library using high throughput massively parallel sequencing; (c) comparing each target segment nucleotide sequence determined in step (b) with the corresponding region of a reference CFTR nucleotide sequence; and (d) determining that the sample CFTR nucleic acid has a variant sequence if or when one or more of the target segment sequences is different from the corresponding region of the reference CFTR nucleotide sequence.
A sequence variant is a CFTR sequence that is different from a corresponding region of a reference CFTR nucleic acid sequence. Such differences in the CFTR sequence can include point mutations, insertions deletions and/or duplications or copy number variations (CNV). CNVs are gains and losses of genomic sequence >50 bp between two individuals of a species (Mills et al. 2011, Mapping copy number variation by population-scale genome sequencing, Nature 470: 59-65). Such variations can be determined when using next-generation sequencing by using a read depth (i.e., mapping density) approach if amplification is halted during library generation during the exponential phase of PCR. A normal dosage in relation to all other amplicons for a normal specimen will be one, ½ for a homozygous deletions and 1½ for homozygous duplication.
In some embodiments the reference CFTR nucleic acid sequence comprises a wild type CFTR nucleic acid sequence. In some embodiments the sequence variant comprises a CFTR nucleotide sequence mutation associated with cystic fibrosis.
Another aspect of the present invention provides a method for determining the presence or absence of base changes, gene deletions and gene duplications in a sample CFTR nucleic acid as compared to a reference CFTR nucleotide sequence, said method comprising (a) producing an adapter-tagged amplicon library by amplifying multiple target segments of the sample CFTR nucleic acid, (b) determining the nucleotide sequences of the target segments by sequencing the amplicons using high throughput massively parallel sequencing, (c) comparing each target segment sequence determined in step (b) with the corresponding region of the reference CFTR nucleotide sequence; and (d) determining that one or more base changes, gene deletions and/or gene duplications is present in the sample CFTR nucleic acid if or when one or more of the target segment sequences is different from the corresponding region of the reference CFTR nucleotide sequence. In some embodiments, the reference CFTR sequence consists of or, alternatively, comprises a wild type CFTR nucleic acid sequence.
Another aspect of the present invention provides a method for diagnosing a genetic basis for cystic fibrosis in an individual comprising (a) producing an adapter-tagged amplicon library by amplifying multiple target segments of a CFTR nucleic acid from said individual, (b) determining the nucleotide sequences of the target segments by sequencing the amplicons using high throughput massively parallel sequencing, and (c) determining that the individual has a genetic basis for cystic fibrosis if or when the nucleotide sequence of one or more of the target segments contains a mutation associated with cystic fibrosis. Genetic mutations associated with cystic fibrosis are well known in the art and include both rare and common mutations.
In any of the aspects of the present invention, high throughput massively parallel sequencing may be performed using a read depth approach.
A sample CFTR nucleic acid may be any form of nucleic acid including, for example, genomic DNA, RNA (such as mRNA) or cDNA.
In some embodiments of the above methods, CFTR nucleic acids from more than one sample are sequenced. In some cases all samples are sequenced simultaneously in parallel. In a preferred embodiment, CFTR nucleic acids from at least 5, 10, 20, 30 or 35 up to 40, 45, 48 or 50 different samples are amplified and sequenced using methods of the present invention. All amplicons derived from a single sample may comprise an index sequence that indicates the source from which the amplicon is generated, the index for each sample being different from the indexes from all other samples. As such, the use of indexes permits multiple samples to be pooled per sequencing run and the sample source subsequently ascertained based on the index sequence.
In some embodiments, the Access Array⢠System (Fluidigm Corp., San Francisco, Calif.) is used to generate a bar coded (indexed) amplicon library by simultaneously amplifying the CFTR nucleic acids from the samples in one set up. The library that is generated then can be used on a sequencing platform such as, for example, Roche/454⢠GS FLX⢠sequencing system (Roche, Germany), Ion Torrent⢠Ion PGM⢠Sequencer (Life Technologies, Carlsbad, Calif.) or MiSeqŽ Personal Sequencer (Illumina, Inc., San Diego, Calif.).
In some embodiments of the present invention, sample CFTR target segments are amplified using primers that contain an oligonucleotide sequencing adapter to produce adapter-tagged amplicons. In other embodiments, the employed primers do not contain adapter sequences and the amplicons produced are subsequently (i.e. after amplification) ligated to an oligonucleotide sequencing adapter on one or both ends of the amplicons. In some embodiments, all sense amplicons contain the same sequencing adapter and all antisense amplicons contain a sequencing adapter having a different sequence from the sense amplicon sequencing adapter. In some embodiments, only a single stranded sample CFTR nucleic acid is amplified and/or sequenced.
Methods of the present invention may be used to sequence all or part of a CFTR gene or cDNA. In some embodiments, from at least one, two, five, 10 or 20 up to 25 or 28 exons are evaluated. In other embodiments all or a portion of the CFTR promoter region is also evaluated. Some or all CFTR introns may also be evaluated. In one embodiment, the CFTR target segments, when combined, represent the CFTR coding region and all intron/exon junctions, plus from about 100, 500, 750, 900 or 1000 up to about 1000 nucleotides of the CFTR promoter immediately upstream (in the 5 prime direction) of the first exon plus from about 50, 100, 150 or 200 up to about 200, 250, 300 or 400 nucleotides immediately downstream (in the 3 prime direction) of the CFTR gene. In a preferred embodiment, one or more sample CFTR nucleic acids are sequenced using at least one primer that comprise a sequence shown in Table 1 or Table 2. In a preferred embodiment, all of the primers shown in Tables 1 or 2 are used.
In a similar embodiment, all exons and a portion of one or more introns are represented.
Oligonucleotides and combinations of oligonucleotides that are useful as primers in the methods of the present invention are also provided. These oligonucleotides are provided as substantially purified material. Kits comprising oligonucleotides for performing amplifications and sequencing as described herein also are provided.
Provided by the present invention are methods for simultaneously determining the presence or absence of CFTR gene mutations involving a small number of nucleotides in addition to larger deletions and duplications in a CFTR nucleotide sequence of a sample CFTR nucleic acid in a single assay. By determining the presence or absence of CFTR nucleotide sequence variants in a sample CFTR nucleic acid, an investigator can determine an individual's cystic fibrosis status based on the presence or absence of CFTR mutations associated with cystic fibrosis in the sample obtained from the individual.
The methods of the present invention comprise generating an adapter-tagged amplicon library by amplifying multiple target segments of a sample CFTR nucleic acid of one or more samples and determining the target segment sequences by sequencing the amplicons using high throughput massively parallel sequencing (i.e., next generation sequencing). Using the provided methods, both gene sequence and gene dosage may be determined in a nucleic acid sample. Gene dosage (also referred to as copy number variation) can be determined by performing next generation sequencing and using a read depth approach.
In some embodiments, the one or more sample CFTR sequences are compared with a reference CFTR sequence to determine if differences (e.g., difference in sequence or copy number) are present. A reference CFTR sequence may be a CFTR genomic or cDNA sequence, or a portion thereof, from a normal (non-cystic fibrosis afflicted and non-cystic fibrosis carrier) individual. In some cases, a reference CFTR sequence may comprise a wild type CFTR nucleic acid sequence. Various methods known in the art (e.g., read depth approach) can be employed to analyze sequencing data to determine if differences are present as compared to a reference sequence.
The term âamplifyâ as used herein with respect to nucleic acid sequences, refers to methods that increase the representation of a population of nucleic acid sequences in a sample. Nucleic acid amplification methods, such as PCR, isothermal methods, rolling circle methods, etc., are well known to the skilled artisan. See, e.g., Saiki, âAmplification of Genomic DNAâ in PCR Protocols, Innis et al., Eds., Academic Press, San Diego, Calif. 1990, pp 13-20; Wharam et al., Nucleic Acids Res. 2001 Jun. 1; 29(11):E54-E54; Hafner et al., Biotechniques 2001 April; 30(4):852-6, 858, 860 passim; Zhong et al., Biotechniques 2001 April; 30(4):852-6, 858, 860.
The term âCFTR promoter regionâ as used herein refers to a segment of the CFTR gene representing at least the first 250 nucleotides upstream from the translation start site. In other embodiments, the promoter region may include the first 250 nt, first 300 nt, first 350 nt, first 400 nt, first 450 nt, first 500 nt, first 1 kb, first 5 kb, first 10, kb, first 15, kb, first 20, kb, first 21 kb or first 22 kb of sequence directly upstream of the start codon. A deletion of the promoter region as defined herein may be accompanied by deletion of downstream exons/introns but not all of the CFTR gene. In some embodiments, the coordinate deletion involving the CFTR promoter region and downstream CFTR gene sequence involves about less than 10 exons, and more typically involves less than 5 exons. Deletions or duplications of the CFTR promoter region may be detected using primers that flank the deleted or duplicated sequence. In a preferred embodiment, a promoter deletion or duplication involves a segment of at least four or more nucleotides, more preferably 5 or more, more preferably 8 or more, and even more preferably 12 or more nucleotides.
A âCFTR nucleic acidâ as used herein refers to a nucleic acid that contains a sequence of a CFTR gene, mRNA, cDNA or a portion of such a CFTR sequence. A CFTR nucleic acid may contain the CFTR coding region. A CFTR nucleic acid may be genomic DNA, cDNA, single stranded DNA or mRNA. In some embodiments, only a single strand of a sample CFTR nucleic acid is amplified and/or sequenced. In some embodiments both strands of double stranded CFTR DNA are amplified and sequenced. A CFTR nucleic acid may be present in a biological sample or it may be isolated from a biological sample.
The terms âcomplementaryâ or âcomplementarityâ as used herein with reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) refers to the base-pairing rules. The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5Ⲡend of one sequence is paired with the 3Ⲡend of the other, is in âantiparallel association.â For example, for the sequence â5â˛-A-G-T-3â' is complementary to the sequence â3â˛-T-C-A-5.â Certain bases not commonly found in natural nucleic acids may be included in the nucleic acids described herein; these include, for example, inosine, 7-deazaguanine, Locked Nucleic Acids (LNA), and Peptide Nucleic Acids (PNA). Complementary need not be perfect; stable duplexes may contain mismatched base pairs, degenerative, or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs. A complement sequence can also be a sequence of RNA complementary to the DNA sequence or its complement sequence, and can also be a cDNA.
The term âdeletionâ as used herein encompasses a mutation that removes one or more nucleotides from nucleic acid. Conversely, the term âduplicationâ refers to a mutation that inserts one or more nucleotides of identical sequence directly next to this sequence in the nucleic acid. In a preferred embodiment, a deletion or duplication involves a segment of four or more nucleotides.
The term âdosageâ or âgene dosageâ refers to the number of copies of a gene, or portions of a gene, present in a sample.
The term âprimerâ as used herein means a sequence of nucleotides, preferably DNA, that hybridizes to a substantially complementary target sequence and is recognized by DNA polymerase to begin DNA replication. The term primer as used herein includes all forms of primers that may be synthesized including peptide nucleic acid primers, locked nucleic acid primers, phosphorothioate modified primers, labeled primers, and the like.
The term âsubstantially complementaryâ as used herein means that two sequences hybridize under stringent hybridization conditions. The skilled artisan will understand that substantially complementary sequences need not hybridize along their entire length. In particular, substantially complementary sequences may comprise a contiguous sequence of bases that do not hybridize to a target sequence, positioned 3Ⲡor 5Ⲡto a contiguous sequence of bases that hybridize under stringent hybridization conditions to a target sequence.
The term âflankingâ as used herein with regard to primers means that a primer hybridizes to a target nucleic acid adjoining a region of interest sought to be amplified on the target. The skilled artisan will understand that preferred primers are pairs of primers that hybridize 5Ⲡfrom a region of interest, one on each strand of a target double stranded DNA molecule, such that nucleotides may be added to the 3Ⲡend of the primer by a suitable DNA polymerase. Primers that flank a CFTR exon are generally designed not to anneal to the exon sequence but rather to anneal to sequence that adjoins the exon (e.g. intron sequence). However, in some cases, amplification primer may be designed to anneal to the exon sequence. The location of primer annealing for many primer pairs that may be used with the methods is shown in Table 1.
âSequencing depthâ or âread depthâ as used herein refers to the number of times a sequence has been sequenced (the depth of sequencing). As an example, read depth can be determined by aligning multiple sequencing run results and counting the start position of reads in nonoverlapping windows of a certain size (for example, 100 bp). Copy number variation can be determined based on read depth using methods known in the art. For example, using a method described in Yoon et al., Genome Research 2009 September; 19(9): 1586-1592; Xie et al., BMC Bioinformatics 2009 Mar. 6; 10:80; or Medvedev et al., Nature Methods 2009 November; 6(11 Suppl):513-20. Use of this type of method and analysis is referred to as a âread depth approach.â
âCoverage depthâ refers to the number of nucleotides from sequencing reads that are mapped to a given position.
The term âspecificâ as used herein in reference to an oligonucleotide primer means that the nucleotide sequence of the primer has at least 12 bases of sequence identity with a portion of the nucleic acid to be amplified when the oligonucleotide and the nucleic acid are aligned. An oligonucleotide primer that is specific for a nucleic acid is one that, under the stringent hybridization or washing conditions, is capable of hybridizing to the target of interest and not substantially hybridizing to nucleic acids which are not of interest. Higher levels of sequence identity are preferred and include at least 75%, at least 80%, at least 85%, at least 90%, at least 95% and more preferably at least 98% sequence identity.
The term âmultiplex PCRâ as used herein refers to amplification of two or more products which are each primed using a distinct primer pair.
The term âhybridizeâ as used herein refers to a process where two complementary nucleic acid strands anneal to each other under appropriately stringent conditions. Hybridizations are typically and preferably conducted with probe-length nucleic acid molecules, preferably 20-100 nucleotides in length, more preferably 18-50 nucleotides in length. Nucleic acid hybridization techniques are well known in the art. See, e.g., Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y. Those skilled in the art understand how to estimate and adjust the stringency of hybridization conditions such that sequences having at least a desired level of complementary will stably hybridize, while those having lower complementary will not. For examples of hybridization conditions and parameters, see, e.g., Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y.; Ausubel, F. M. et al. 1994, Current Protocols in Molecular Biology. John Wiley & Sons, Secaucus, N.J. In some embodiments, specific hybridization occurs under stringent hybridization conditions.
The term âstringent hybridization conditionsâ as used herein refers to hybridization conditions at least as stringent as the following: hybridization in 50% formamide, 5ĂSSC, 50 mM NaH2PO4, pH 6.8, 0.5% SDS, 0.1 mg/mL sonicated salmon sperm DNA, and 5Ă Denhart's solution at 42° C. overnight; washing with 2ĂSSC, 0.1% SDS at 45° C.; and washing with 0.2ĂSSC, 0.1% SDS at 45° C. In another example, stringent hybridization conditions should not allow for hybridization of two nucleic acids which differ over a stretch of 20 contiguous nucleotides by more than two bases.
The term âsense strandâ as used herein means the strand of double-stranded DNA (dsDNA) that includes at least a portion of a coding sequence of a functional protein. âAnti-sense strandâ means the strand of dsDNA that is the reverse complement of the sense strand.
The term âforward primerâ as used herein means a primer that anneals to the anti-sense strand of dsDNA. A âreverse primerâ anneals to the sense-strand of dsDNA.
The term âisolatedâ as used herein with respect to a nucleic acid (e.g., an RNA, DNA or a mixed polymer) is one which is substantially separated from other cellular components which naturally accompany such nucleic acid. The term embraces a nucleic acid sequence which has been removed from its naturally occurring environment, and includes recombinant or cloned DNA isolates, oligonucleotides, and chemically synthesized analogs or analogs biologically synthesized by heterologous systems.
The term âsubstantially pureâ as used herein means a nucleic acid, represents more than 50% of the nucleic acid in a sample. The nucleic acid sample may exist in solution or as a dry preparation.
The term âcoding sequenceâ as used herein means a sequence of a nucleic acid or its complement, or a part thereof, that can be transcribed and/or translated to produce the mRNA for and/or the polypeptide or a fragment thereof. Coding sequences include exons in a genomic DNA or immature primary RNA transcripts, which are joined together by the cell's biochemical machinery to provide a mature mRNA. The anti-sense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced there from.
The term ânon-coding sequenceâ as used herein means a sequence of a nucleic acid or its complement, or a part thereof, that is not transcribed into amino acid in vivo, or where tRNA does not interact to place or attempt to place an amino acid. Non-coding sequences include both intron sequences in genomic DNA or immature primary RNA transcripts, and gene-associated sequences such as promoters, enhancers, silencers, etc.
The term âhigh throughput, massively parallel sequencingâ as used herein refers to sequencing methods that can generate multiple sequencing reactions of clonally amplified molecules and of single nucleic acid molecules in parallel. This allows increased throughput and yield of data. These methods are also known in the art as next generation sequencing (NGS) methods. NGS methods include, for example, sequencing-by-synthesis using reversible dye terminators, and sequencing-by-ligation. Non-limiting examples of commonly used NGS platforms include miRNA BeadArray (Illumina, Inc.), Roche 454⢠GS FLXâ˘-Titanium (Roche Diagnostics), and ABI SOLiD⢠System (Applied Biosystems, Foster City, Calif.).
The term âcarrier stateâ or âcystic fibrosis carrierâ as used herein means a person who contains one CFTR allele that has a mutant CFTR nucleic acid sequence associated with cystic fibrosis, but a second allele that is not a mutant CFTR nucleic acid sequence. Cystic fibrosis is an âautosomal recessiveâ disease, meaning that a mutation produces little or no phenotypic effect when present in a heterozygous condition with a non-disease related allele, but produces a âdisease stateâ when a person is homozygous or compound heterozygote , i.e., both CFTR alleles are mutant CFTR nucleic acid sequences.
The term âwild typeâ as used herein with respect to the CFTR gene or a locus thereof refers to the CFTR gene sequence which is found in NCBI GenBank locus IDs M58478 (HUMCFTC), AC000111 and AC000061. A cDNA for a CFTR gene is found in Audrezet et al., Hum. Mutat. (2004) 23 (4), 343-357 and/or Genbank accession number NM _000492.3.
A ârare CFTR mutationâ is a mutation in the CFTR gene sequence that is present in <0.1% of cystic fibrosis patients.
A âprivate CFTR mutationâ is a mutation in the CFTR gene sequence that is found in only a single family or a small group.
A âcommon CFTR mutationâ is a mutation in the CFTR gene sequence that is associated with cystic fibrosis and is present in at least 0.1% of patients with cystic fibrosis.
A âgenetic basis for cystic fibrosisâ in an individual refers to the individual's genotype, in particular, of their CFTR nucleic acids and whether the individual possesses at least one CFTR mutation that contributes to cystic fibrosis.
The term âaboutâ as used herein means in quantitative terms plus or minus 10%.
A âsample CFTR nucleic acidâ is a CFTR nucleic acid in, or isolated from, a biological sample. Processing methods to release or otherwise make available a nucleic acid for detection are well known in the art and may include steps of nucleic acid manipulation, e.g., preparing a cDNA by reverse transcription of RNA from the biological sample. A biological sample may be a body fluid or a tissue sample. In some cases a biological sample may consist of or comprise blood, plasma, sera, urine, feces, epidermal sample, vaginal sample, skin sample, cheek swab, sperm, amniotic fluid, cultured cells, bone marrow sample and/or chorionic villi, cultured cells, and the like. Fixed or frozen tissues also may be used. Whole blood samples of about 0.5 to 5 ml collected with EDTA, ACD or heparin as anti-coagulant are suitable. Amniotic fluid of 10-15 ml, cultured cells which are 80-100% confluent in two T-25 flasks and 25 mg of chorionic villi are useful sample amounts for processing.
An âindividualâ is any mammal. In a preferred embodiment, and individual is a human.
A CFTR target segment that is amplified and sequenced according to the present invention may represent one or more individual exon(s) or portion(s) of exon(s) of the CFTR gene or one or more portions of a CFTR mRNA. A target segment also may include the CFTR promoter region and/or one or more CFTR introns. In some embodiments the target segments represent the entire CFTR gene or the entire CFTR coding region. In a preferred embodiment the target segments represent the entire CFTR coding region and at least one intron or a portion there and an adjacent region located immediately upstream (in the 5Ⲡdirection) of the coding sequence. The adjacent, upstream region may consist of from about 100 nucleotides up to about 500, 750, 1000, 1100, or 1200 nucleotides of the sequence located immediately upstream of the CFTR coding sequence. In some embodiments, the adjacent, upstream region comprises all or a portion of the CFTR promoter sequence.
In accordance with the present invention, each CFTR nucleic acid target segment may be amplified with an oligonucleotide primer or primer pair specific to the target segment. In some embodiments a single primer or one or both primers of a primer pair comprise a specific adapter sequence (also referred to as a sequencing adapter) ligated to the 5Ⲡend of the target specific sequence portion of the primer. This sequencing adapter is a short oligonucleotide of known sequence that can provide a priming site for both amplification and sequencing of the adjoining, unknown nucleic acid. As such, adapters allow binding of a fragment to a flow cell for next generation sequencing. Any adapter sequence may be included in a primer used in the present invention.
In some embodiments, all forward amplicons (i.e., amplicons extended from forward primers that hybridized with antisense strands of a target segment) contain the same adapter sequence. In some embodiments when double stranded sequencing is performed, all forward amplicons contain the same adapter sequence and all reverse amplicons (i.e., amplicons extended from reverse primers that hybridized with sense strands of a target segment) contain an adapter sequence that is different from the adapter sequence of the forward amplicons.
In a particular embodiment, the âforwardâ adapter sequence consists of or comprises: ACACTGACGACATGGTTCTACA (SEQ ID NO:1) or a sequence 90%, 95% or 99% identical to SEQ ID NO:2. and the reverse adapter sequence consists of or comprises TACGGTAGCAGAGACTTGGTCT (SEQ ID NO:2) or a sequence 90%, 95% or 99% identical to SEQ ID NO:2.
Other adapter sequences are known in the art. Some manufacturers recommend specific adapter sequences for use with the particular sequencing technology and machinery that they offer.
In some cases, amplicons from a single sample source further comprise an identical index sequence (also referred to as an index tag, a âbarcodeâ or a multiplex identifier (MID). In some cases, indexed amplicons are generated using primers (for example, forward primers and/or reverse primers) containing the index sequence. Such indexed primers may be included during library preparation as a âbarcodingâ tool to identify specific amplicons as originating from a particular sample source. Indexed amplicons from more than one sample source are quantified individually and then pooled prior to sequencing. As such, the use of index sequences permits multiple samples (i.e., samples from more than one sample source) to be pooled per sequencing run and the sample source subsequently ascertained based on the index sequence.
When adapter-ligated and/or indexed primers are employed to amplify a CFTR target segment, the adapter sequence and/or index sequence gets incorporated into the amplicon (along with the target-specific primer sequence) during amplification. Therefore, the resulting amplicons are sequencing-competent and do not require the traditional library preparation protocol. Moreover, the presence of the index tag permits the differentiation of sequences from multiple sample sources.
In some embodiments, sequencing templates (amplicons) are prepared by emulsion-based clonal amplification of target segments using specialized fusion primers (containing an adapter sequence) and capture beads. A single adapter-bound fragment is attached to the surface of a bead, and an oil emulsion containing necessary amplification reagents is formed around the bead/fragment component. Parallel amplification of millions of beads with millions of single strand fragments produces a sequencer-ready library.
In some embodiments the amplicons constituting the adapter-tagged (and, optionally, indexed) amplicon library are produced by polymerase chain reaction (PCR). In some embodiments, the amplicon library is generated using a multiplexed PCR approach, such as that disclosed in U.S. Pat. No. 8,092,996, incorporated by reference herein in its entirety.
Bridge PCR is yet another method for in vitro clonal amplification after a library is generated, in preparation for sequencing. This process is a means to clonally amplify a single target molecule, a member of a library, in a defined physical region such as a solid surface, for example, a bead in suspension or a cluster on a glass slide. In this method, fragments are amplified using primers attached to the solid surface forming âDNA coloniesâ or âDNA clustersâ. This method is used in some of the genome analyzer sequencers manufactured by Illumina, Inc. (San Diego, Calif.).
Alternatively, each CFTR nucleic acid target segment may be amplified with non-adapter-ligated and/or non-indexed primers and a sequencing adapter and/or an index sequence may be subsequently ligated to each of the resulting amplicons.
Following the production of an adapter tagged and, optionally indexed, amplicon library, the amplicons are sequenced using high throughput, massively parallel sequencing (i.e. next generation sequencing). Methods for performing high throughput, massively parallel sequencing are known in the art. The capacity offered by next generation sequencing has revolutionized amplicon sequencing. Companies such as RainDance Technologies, Inc. (Lexington, Mass.) and Fluidigm Corporation offer platforms which generate libraries that are sequencing-competent and composed purely of targeted sequences. By enabling high-throughput, mini PCR setup, these technologies are ideal for preparing amplicon libraries. One drawback of PCR-based approaches is the limitation of amplicon length, which is determined by PCR itself. However, by targeting overlapping regions, this problem can be circumvented.
In some embodiments, high throughput, massively parallel sequencing employs sequencing-by-synthesis with reversible dye terminators. In other embodiments, sequencing is performed via sequencing-by-ligation. In yet other embodiments, sequencing is single molecule sequencing.
Sequencing by synthesis, like the âold styleâ dye-termination electrophoretic sequencing, relies on incorporation of nucleotides by a DNA polymerase to determine the base sequence. Reversible terminator methods use reversible versions of dye-terminators, adding one nucleotide at a time, detecting fluorescence at each position by repeated removal of the blocking group to allow polymerization of another nucleotide. The signal of nucleotide incorporation can vary with fluorescently labeled nucleotides, phosphate-driven light reactions and hydrogen ion sensing having all been used. The MiSeqÂŽ personal sequencing system (Illumina, Inc.) employs sequencing by synthesis with reversible terminator chemistry.
In contrast to the sequencing by synthesis method, the sequencing by ligation method uses a DNA ligase to determine the target sequence. This sequencing method relies on enzymatic ligation of oligonucleotides that are adjacent through local complementarity on a template DNA strand. This technology employs a partition of all possible oligonucleotides of a fixed length, labeled according to the sequenced position. Oligonucleotides are annealed and ligated and the preferential ligation by DNA ligase for matching sequences results in a dinucleotide encoded color space signal at that position (through the release of a flourescently labeled probe that corresponds to a known nucleotide at a known position along the oligo). This method is primarily used by Life Technologies' SOLiD⢠sequencers.
The Ion Torrent⢠(Life Technologies, Carlsbad, Calif.) amplicon sequencing system employs a flow-based approach that detects pH changes caused by the release of hydrogen ions during incorporation of unmodified nucleotides in DNA replication. For use with this system, a sequencing library is initially produced by generating DNA fragments flanked by sequencing adapters. These fragments are clonally amplified on particles by emulsion PCR. The particles with the amplified template are then placed in a silicon semiconductor sequencing chip. During replication, the chip is flooded with one nucleotide after another, and if a nucleotide complements the DNA molecule in a particular microwell of the chip, then it will be incorporated. A proton is naturally released when a nucleotide is incorporated by the polymerase in the DNA molecule, resulting in a detectable local change of pH. The pH of the solution then changes in that well and is detected by the ion sensor.
The 454⢠GS FLX⢠sequencing system (Roche, Germany), employs a light-based detection methodology in a large-scale parallel pyrosequencing system. Pyrosequencing uses DNA polymerization, adding one nucleotide species at a time and detecting and quantifying the number of nucleotides added to a given location through the light emitted by the release of attached pyrophosphates. For use with the 454⢠system, adapter-ligated DNA fragments are fixed to small DNA-capture beads in a water-in-oil emulsion and amplified by PCR (emulsion PCR). Each DNA-bound bead is placed into a well on a picotiter plate and sequencing reagents are delivered across the wells of the plate. The four DNA nucleotides are added sequentially in a fixed order across the picotiter plate device during a sequencing run. During the nucleotide flow, millions of copies of DNA bound to each of the beads are sequenced in parallel. When a nucleotide complementary to the template strand is added to a well, the nucleotide is incorporated onto the existing DNA strand, generating a light signal that is recorded by a CCD camera in the instrument.
In some embodiments, amplicons from more than one sample source are pooled prior to high throughput sequencing. âMultiplexingâ is the pooling of multiple adapter-tagged and indexed libraries into a single sequencing run. When indexed primer sets are used, this capability can be exploited for comparative studies. In some embodiments, amplicon libraries from up to 48 separate sources are pooled prior to sequencing.
The described methods for determining the presence or absence of base changes, gene deletions and gene duplications in a CFTR nucleic acid may be used for determining a genetic basis for cystic fibrosis. Accordingly, one aspect of the present invention provides a method for diagnosing a genetic basis for cystic fibrosis in an individual comprising (a) producing an adapter-tagged amplicon library by amplifying multiple target segments of a sample CFTR nucleic acid from said individual, (b) determining the nucleotide sequences of the target segments by sequencing the amplicons using high throughput massively parallel sequencing, and (c) determining that the individual has a genetic basis for being affected with cystic fibrosis or for being a cystic fibrosis carrier if or when the nucleotide sequence of one or more of the target segments contains a mutation associated with cystic fibrosis.
The present invention can additionally be used to detect one or more rare CFTR mutations or private mutations in a CFTR nucleic acid from an individual, thereby identifying an individual who possesses one or more rare or private CFTR mutation(s). In some embodiments, the present invention is used to identify rare familial mutations in an obligate cystic fibrosis carrier after the carrier has tested negative in a routine screening test for common mutations. Such routine screening tests may include Cystic Fibrosis Screen: Detectable Mutations, CF Mutation Screen, Cystic Fibrosis Mutation Screen, CFTR Screen, Cystic Fibrosis Screen, Cystic Fibrosis Carrier Screen, and CF-60. The present invention can also be used to identify rare mutations in a cystic fibrosis-affected (i.e. symptomatic) individual who has not had two CFTR sequence mutations identified by at least one routine cystic fibrosis mutation screening test.
In some embodiments, the methods disclosed herein are employed to confirm cystic fibrosis carrier status in an individual such as, for example, a parent, a sibling or other relatives of a cystic fibrosis-affected individual with one or more rare or private mutations. In some embodiments, the present invention is used for prenatal diagnosis of an individual, in particular, an individual who is related to a cystic fibrosis-affected individual or who is suspected of being a cystic fibrosis carrier
In some aspects of the present invention, at least 2, 5, 10, 20, 25, or 28 and up to 25, 29, or 30, target segments of the CFTR gene may be sequenced with gains and losses of genomic sequence (>50 bp) determined using a read depth approach. In one approach, 29 target segments are sequenced, representing the CFTR coding region (including all exons/intron junctions). In another embodiment, the CFTR coding region (including all exons/intron junctions) in addition to about 1 kb upstream and about 300 kb downstream of the CFTR gene are assayed.
The sequence of substantially pure nucleic acid primers which are DNA (or an RNA equivalent) and which are useful for amplifying the promoter region, all of the CFTR exons and intron/exon junctions, and a region immediately downstream of the CFTR gene are shown in Table 1. The letter F or R at the end of the primer name indicates whether the primer is a forward (F) or reverse (R) PCR primer. In some embodiments, the primers of Table 1 are used with Ion Torrent Personal Genome Machine⢠and/or Illumina MiSeqŽ Personal Sequencing System. In some embodiments, the primers of Table 2 are used with a Roche/454⢠GS FLX⢠sequencer and/or Sanger sequencing. In a preferred embodiment, one or more primers consisting of or comprising any of SEQ ID NOs: 3-54 and 107-140 further comprise sequencing adapter sequence SEQ ID NO:1. In another preferred embodiment, one or more primers consisting of or comprising any of SEQ ID NOs: 55-106 and 141-174 further comprises sequencing adapter sequence SEQ ID NO:2.
| TABLEâ1 |
| CFTRâPrimerâSequencesâforâAmpliconâSequencing |
| SEQ | |||
| ID | Primer | ||
| NO: | Name | PrimerâSequence | Hybridizesâto |
| 3 | p1F | AAAGGATAGACAAGGAACACATCCTGG | promoter |
| 4 | P2F | CTAATAAAGCTTGGTTCTTTTCTCCGAC | promoter |
| 5 | P3F | ACCTTGCAAACGTAACAGGAACCC | promoter |
| 6 | P4F | CGGTGGCTTCTTCTGTCCTCCA | promoter |
| 7 | P5F | GTCAGAATCGGGAAAGGGAGGTG | promoter |
| 8 | P6F | GGGGAAAGAGCAAAAGGAAGGG | promoter |
| 9 | E1F | GTCTTTGGCATTAGGAGCTTGAGC | Exonâ1 |
| 10 | E2F | TCAAGTGAATATCTGTTCCTCCTCTCTTT | Exonâ2 |
| 11 | E3F | GCACATGCAACTTATTGGTCCCAC | Exonâ3 |
| 12 | E4aF | ATGAAATTTAATTTCTCTGTTTTTCCCC | Exonâ4 |
| 13 | E4bF | AGGCTTATGCCTTCTCTTTATTGTGAG | Exonâ4 |
| 14 | E5F | TTTGTTGAAATTATCTAACTTTCCATTTTTC | Exonâ5 |
| 15 | E6F | CACCTGTTTTTGCTGTGCTTTTATTTTC | Exonâ6 |
| 16 | E7F | TACTATTAGATTGATTGATTGATTGATTGATT | Exonâ7 |
| 17 | E8aF | CTCAGATCTTCCATTCCAAGATCCC | Exonâ8 |
| 18 | E8bF | CTTCCCTATGCACTAATCAAAGGAATC | Exonâ8 |
| 19 | E9F | GCTATTCTGATTCTATAATATGTTTTTGCTCTC | Exonâ9 |
| 20 | E9outerF | GAGTITATTTCAAATATGATGAATCCTAGTGCTTGGC | Exonâ9 |
| 21 | E10aF | CTTTTCAAACTAATTGTACATAAAACAAGCATC | Exonâ10 |
| 22 | E10bF | AAACAATAACAATAGAAAAACTTCTAATGGTG | Exonâ10 |
| 23 | E11aF | TGACCTAATAATGATGGGTTTTATTTCC | Exonâ11 |
| 24 | E11bF | TTTCCTGGATTATGCCTGGCAC | Exonâ11 |
| 25 | E12F | ACTAAAAGTGACTCTCTAATTTTCTATTTTTGG | Exonâ12 |
| 26 | I12F | AATTTCTTAATTGTGTGCTGAATACAATTTTC | Intronâ12 |
| 27 | E13F | GAGAGGAAATGTAATTTAATTTCCATTTTC | Exonâ13 |
| 28 | 14CFz | GCATGAAGGTAGCAGCTATTTTTATGGG | Exonâ14 |
| 29 | E14aF | GCTAAAATACGAGACATATTGCAATAAAGTATT | Exonâ14 |
| 30 | E14bF | AAAACTAGGATTTTGGTCACTTCTAAAATG | Exonâ14 |
| 31 | E14cF | GAACTCCAAAATCTACAGCCAGACTTTAG | Exonâ14 |
| 32 | E14dF | TTCTCATTAGAAGGAGATGCTCCTGTC | Exonâ14 |
| 33 | E14eF | CAATCAACTCTATACGAAAATTTTCCATTG | Exonâ14 |
| 34 | E14fF | TGTCCTTAGTACCAGATTCTGAGCAGG | Exonâ14 |
| 35 | E14gF | CTCAGTTAACCAAGGTCAGAACATTCAC | Exonâ14 |
| 36 | E15F | CTGTCTTATTGTAATAGCCATAATTCTTTTATTC | Exonâ15 |
| 37 | E16F | AAATCAACTGTGTCTTGTTCCATTCC | Exonâ16 |
| 38 | E17aF | TGCCAAATAACGATTTCCTATTTGC | Exonâ17 |
| 39 | E17bF | GTGTTTTACATTTACGTGGGAGTAGCC | Exonâ17 |
| 40 | E18F | TTTTGAGGAATTTGTCATCTTGTATATTAT | Exonâ18 |
| 41 | E19F | CTCACCAACATGTTTTCTTTGATCTTAC | Exonâ19 |
| 42 | E20aF | TTGCAATGTTTTCTATGGAAATATTTCAC | Exonâ20 |
| 43 | E20bF | CTTACTTTGAAACTCTGTTCCACAAAGC | Exonâ20 |
| 44 | E21F | GAGGTTCATTTACGTCTTTTGTGCATC | Exonâ21 |
| 45 | E22aF | GTGAAATTGTCTGCCATTCTTAAAAACA | Exonâ22 |
| 46 | E22bF | GTGAAGAAAGATGACATCTGGCCC | Exonâ22 |
| 47 | I22F | CCTTGTGGATCTAAATTTCAGTTGACTTG | Intronâ22 |
| 48 | E23F | CAGAAGTGATCCCATCACTTTTACCTTAT | Exonâ23 |
| 49 | E24F | TTCATACTTTCTTCTTCTTTTCTTTTTTGC | Exonâ24 |
| 50 | E25F | CTCTGTGGTATCTGAACTATCTTCTCTAACTG | Exonâ25 |
| 51 | E26F | GATCATTACTGTTCTGTGATATTATGTGTGG | Exonâ26 |
| 52 | E27aF | CTCTGGTCTGACCTGCCTTCTGTC | Exonâ27 |
| 53 | E27bF | CCAGAAACTGCTGAACGAGAGGAG | Exonâ27 |
| 54 | 3UF | CAGAAGAAGAGGTGCAAGATACAAGG | 3â˛âUTR |
| 55 | P1R | CATTTACCTTAGCGCTTCCTTTGCG | promoter |
| 56 | P2R | CTCCTCCTTTTCCCGATGATCCTAG | promoter |
| 57 | P3R | CTCTCTTTAGGTCCAGTTGGCAACG | promoter |
| 58 | P4R | CCTTCCTCCTCTCCTCCTTCGCT | promoter |
| 59 | P5R | AATTCCCCCCACCCACCCCTACTC | promoter |
| 60 | P6R | CCTTTTCCAGAGGCGACCTCTG | promoter |
| 61 | E1R | CTTTCGTGGGCACGTGTCTTTC | Exonâ1 |
| 62 | E2R | TTCTCTTCTCTAAATAATTAATAATATGAATTTCTC | Exonâ2 |
| 63 | E3R | GTGATACATAATGAATGTACAAATGAGATCC | Exonâ3 |
| 64 | E4aR | GCTGGGTGTAGGAGCAGTGTCCT | Exonâ4 |
| 65 | E4bR | CATGGGGCCTGTGCAAGGAAG | Exonâ4 |
| 66 | E5R | TAACCACTAATTACTATTATCTGACCCAGG | Exonâ5 |
| 67 | E6R | TTTAAAACTTTCAAGTTATGAAAATAGGTTGC | Exonâ6 |
| 68 | E7R | AAGGACAGAATTACTAACAATATTGAAATTATTG | Exonâ7 |
| 69 | E8ar | GATGGTGGTGAATATTTTCCIGAG | Exonâ8 |
| 70 | E8br | TATTTAAATCATAGTATATAATGCAGCATTATGGTAC | Exonâ8 |
| 71 | E9R | GAAGAAAACAGTTAGGTGTTTAGAGCAAAC | Exonâ9 |
| 72 | E9outerR | CGCCATTAGGATGAAATCCITATTCACAAAG | Exonâ9 |
| 73 | E10aR | AAGAAGTGAGAAATTACTGAAGAAGAGGCT | Exonâ10 |
| 74 | E10bR | CAAATTAAGTTCTTAATAGTGAAGAACAAAAGAAC | Exonâ10 |
| 75 | E11aR | ATCATAGGAAACACCAAAGATGATATTTTC | Exonâ11 |
| 76 | E11bR | GGTTCATATGCATAATCAAAAAGTTTTCAC | Exonâ11 |
| 77 | E12R | GCAAATGCTTGCTAGACCAATAATTAG | Exonâ12 |
| 78 | I12R | GAACAGTAATAAAGATGAAGACACAGTTCCC | Intronâ12 |
| 79 | E13R | GCATGAGCATTATAAGTAAGGTATTCAAAG | Exonâ13 |
| 80 | 14DRz | GGTACTAAGGACAGCCTTCTCTCTAAAG | Exonâ14 |
| 81 | E14aR | CAAAATTAATATTTTGTCAGCTTTCTTTAAATG | Exonâ14 |
| 82 | E14bR | GAAAGAATCACATCCCATGAGTTTTG | Exonâ14 |
| 83 | E14cR | AAGATTGTTTTTTTGTTTCTGTCCAGG | Exonâ14 |
| 84 | E14dR | CTAAGGACAGCCTTCTCTCTAAAGGC | Exonâ14 |
| 85 | E1eR | TCCTTCGTGCCTGAAGCGTGG | Exonâ14 |
| 86 | E14fR | CACTTTTCGTGTGGATGCTGTTG | Exonâ14 |
| 87 | E14gR | GTGAAATACCCCCAAGCGATGTATAC | Exonâ14 |
| 88 | E15R | CTTTAAATCCAGTAATACTTTACAATAGAACATTC | Exonâ15 |
| 89 | E16R | ACAAAGTGGATTACAATACATACAAACATAGTG | Exonâ16 |
| 90 | E17aR | GAAGAATCCCATAGCAAGCAAAGTG | Exonâ17 |
| 91 | E17bR | GGATCAGCAGTTTCATTTCTTAGACCTAG | Exonâ17 |
| 92 | E18R | TAATAATACAGACATACTTAACGGTACTTATTTTTAC | Exonâ18 |
| 93 | E19R | CAAGATGAGTATCGCACATTCACTGTC | Exonâ19 |
| 94 | E20aR | CAAGAACCAGTTGGCAGTATGTAAATTC | Exonâ20 |
| 95 | E20bR | CTTAAATGCTTAGCTAAAGTTAATGAGTTCATAG | Exonâ20 |
| 96 | E21R | TTTTTCATAAAAGTTAAAAAGATGATAAGACTT | Exonâ21 |
| 97 | E22aR | ATCTTTGACAGTCATTTGGCCCC | Exonâ22 |
| 98 | E22bR | GTCTAACAAAGCAAGCAGTGTTCAAATC | Exonâ22 |
| 99 | I22R | GGTGCTAGCTGTAATTGCATTGTACC | Intronâ22 |
| 100 | E23R | CTTTTTTCTGGCTAAGTCCTTTTGC | Exonâ23 |
| 101 | E24R | CCTTTCAAAATCATTTCAGTTAGCAGC | Exonâ24 |
| 102 | E25R | GTGCTATTAAGTAACAGAACATCTGAAACTC | Exonâ25 |
| 103 | E26R | AATTACAAGGGCAATGAGATCTTAAGTAAAG | Exonâ26 |
| 104 | E27aR | TGGGGAAAGAGCTTCACCCTGT | Exonâ27 |
| 105 | E27bR | GTCCCATGTCAACATTTATGCTGC | Exonâ27 |
| 106 | 3UR | CATATCAGTGTCCTCAATTCCCCTTAC | 3â˛âUTR |
| TABLEâ2 |
| CFTRâPrimerâSequencesâforâAmpliconâSequencing |
| SEQ | |||
| ID | Hybridizes | ||
| NO: | PrimerâName | PrimerâSequence | to |
| 107 | q-PROMOTER- | CGTGTCCTAAGATTTCTGTG | promoter |
| 1-1F | |||
| 108 | q-PROMOTER- | TGCCAACTGGACCTAAAG | promoter |
| 2-1F | |||
| 109 | q1e1F | CACCCAGAGTAGTAGGTCTTTG | Exonâ1 |
| 110 | q2e2F | CATAATTTTCCATATGCCAG | Exonâ2 |
| 111 | s3e1F | CTTGGGTTAATCTCCTTGGA | Exonâ3 |
| 112 | q4e1F | AAAGTCTTGTGTTGAAATTCTCA | Exonâ4 |
| GG | |||
| 113 | g5e3F | ACATTTATGAACCTGAGAAG | Exonâ5 |
| 114 | q6ae1F | GGGGTGGAAGATACAATGAC | Exonâ6 |
| 115 | q6be2F | AAAATAATGCCCATCTGTTG | Exonâ7 |
| 116 | q7e3F | CTTCCATTCCAAGATCCC | Exonâ8 |
| 117 | q8e1F | GATGTAGCACAATGAGAGTATAA | Exonâ9 |
| AG | |||
| 118 | g9e9F | TGGATCATGGGCCATGTGC | Exonâ10 |
| 119 | s10e3F | AGCAGAGTACCTGAAACAGGA | Exonâ11 |
| 120 | g11e1F | CAGATTGAGCATACTAAAAGTG | Exonâ12 |
| 121 | q11i4F | GTGTGCTGAATACAATTTTC | Intronâ12 |
| 122 | s12e1F | GTGAATCGATGTGGTGACCA | Exonâ13 |
| 123 | q13-1e1F | CGAGGATAAATGATTTGCTCAAA | Exonâ14 |
| G | |||
| 124 | q13-2e1F | TCCTAACTGAGACCTTACAC | Exonâ14 |
| 125 | q14ae5F | GTGGCATGAAACTGTACTGT | Exonâ15 |
| 126 | q14be2F | ATGGGAGGAATAGGTGAAGA | Exonâ16 |
| 127 | q15e3F | GGTTAAGGGTGCATGCTCTTC | Exonâ17 |
| 128 | q16e4F | CTACTGTGATCCAAACTTAGTAT | Exonâ18 |
| TG | |||
| 129 | q17ae1F | ACACTTTGTCCACTTTGC | Exonâ19 |
| 130 | q17be1F | ATCTATTCAAAGAATGGCAC | Exonâ20 |
| 131 | q18e1F | TAGATGCTGTGATGAACTG | Exonâ21 |
| 132 | q19e3F | CCCGACAAATAACCAAGTGAC | Exonâ22 |
| 133 | q19i2F | GAATCATTCAGTGGGTATAAGC | Intronâ22 |
| AG | |||
| 134 | g20e3F | TCTCTATTCTGTTCCAAGG | Exonâ23 |
| 135 | g21e1F | TGATGGTAAGTACATGGGTG | Exonâ24 |
| 136 | q22e1F | CTGTCAAGGTTGTAAATAGAC | Exonâ25 |
| 137 | q23e1F | CTGTTCTGTGATATTATGTGTG | Exonâ26 |
| 138 | q24e1F | TATTTTCCTTTGAGCCTG | Exonâ27 |
| 139 | CFTR-22.2F | CTTAATTGTGTGCTGAATACAAT | Intronâ12 |
| TTTC | |||
| 140 | CFTR-31.2F | GAATCATTCAGTGGGTATAAGCA | Intronâ22 |
| G | |||
| 141 | q-PROMOTER- | CCTTTCCCGATTCTGACTC | promoter |
| 1-1R | |||
| 142 | q-PROMOTER- | CCAAACCCAACCCATACAC | promoter |
| 2-1R | |||
| 143 | q1e1R | CAAACCCAACCCATACACAC | Exonâ1 |
| 144 | q2e2R | CTATGTTTGCTTTCTCTTCTC | Exonâ2 |
| 145 | s3e2R | ATTCACCAGATTTCGTAGTC | Exonâ3 |
| 146 | q4e1R | CCAGCTCACTACCTAATTTATGA | Exonâ4 |
| CAT | |||
| 147 | g5e4R | CAGAATAGGGAAGCTAGAG | Exonâ5 |
| 148 | q6ae1R | CATAGAGCAGTCCTGGTTTTAC | Exonâ6 |
| 149 | q6be2R | GTGGAAGTCTACCATGATAAACA | Exonâ7 |
| TA | |||
| 150 | q7E4R | GCAAAGTTCATTAGAACTGATC | Exonâ8 |
| 151 | q8e1R | CACAAAGAAGAAAACAGTTAGG | Exonâ9 |
| 152 | g9e11R | AAAGAGACATGGACACCAAATTA | Exonâ10 |
| AG | |||
| 153 | s10e3R | CCATTCACAGTAGCTTACCCA | Exonâ11 |
| 154 | g11e2R | TACATGAATGACATTTACAGCA | Exonâ12 |
| 155 | q11i4R | AAGATGAAGACACAGTTCCC | Intronâ12 |
| 156 | s12e1R | CTGGTTTAGCATGAGGCGGT | Exonâ13 |
| 157 | q13-1e2R | TCGTATAGAGTTGATTGGATTGA | Exonâ14 |
| GA | |||
| 158 | q13-2e1R | TTCTGTGGGGTGAAATAC | Exonâ14 |
| 159 | q14ae6R | CACATCCCCAAACTATCTTAA | Exonâ15 |
| 160 | q14be2R | TGGATTACAATACATACAAACA | Exonâ16 |
| 161 | q15e4R | GGCCCTATTGATGGTGGATC | Exonâ17 |
| 162 | q16e5R | AGGTAAGCAGTTCTGACTTATTA | Exonâ18 |
| 163 | q17ae1R | CAGATGAGTATCGCACATTC | Exonâ19 |
| 164 | q17be1R | GATAACCTATAGAATGCAGC | Exonâ20 |
| 165 | q18e1R | GAAGGAAAGAAGAGATAAGG | Exonâ21 |
| 166 | q19e4R | CGCTAACACATTGCTTCAGGCTA | Exonâ22 |
| C | |||
| 167 | q19i3R | CTTCAATGCACCTCCTCCC | Intronâ22 |
| 168 | g20e4R | ACAAGTATCAAATAGCAG | Exonâ23 |
| 169 | g21e2R | CAAAAGTACCTGTTGCTCCA | Exonâ24 |
| 170 | q22e1R | AAGCAGGCATAATGATTC | Exonâ25 |
| 171 | q23e1R | AATTACAAGGGCAATGAG | Exonâ26 |
| 172 | q24e1R | GCAGAGGTAACTGTTCCAC | Exonâ27 |
| 173 | CFTR-22.2F | AGTAATAAAGATGAAGACACAGT | Intronâ12 |
| TCCC | |||
| 174 | CFTR-31.2R | CTTCAATGCACCTCCTCCC | Intronâ22 |
The following examples serve to illustrate the present invention. These examples are in no way intended to limit the scope of the invention.
Genomic DNA was isolated from either whole blood or paraffin embedded tissue. CFTR amplicon libraries were created for samples from 48 different sources. The CFTR gene is one of a select few genes that to date has been extensively and exhaustively sequenced and, as such, has been annotated with many polymorphisms. Avoiding these polymorphism made the selection of primer and or probe binding sites particularly difficult. Libraries were generated using primers from Table 1 or Table 2 and size selected using either AMPureÂŽ beads or eGel.
The forward primers of Tables 1 and 2 each had an adapter oligonucleotide ligated to the 5Ⲡend of the primer. The adapter sequence of the forward primer adapter was 5â˛-ACACTGACGACATGGTTCTACA-3Ⲡ(SEQ ID NO: 1). The reverse primers of Tables 1 and 2 each had an adapter oligonucleotide ligated to the 5Ⲡend of the primer. The sequence of the reverse primer adapter was 5â˛-TACGGTAGCAGAGACTTGGTCT-3Ⲡ(SEQ ID NO: 2).
In addition, the high GC content of the CFTR promoter region made it additionally difficult to determine suitable thermal cycling conditions during library generation. The ultimate PCR protocol employed is shown in Table 3.
| TABLE 3 |
| PCR Protocol |
| PCR Stages | Number of Cycles | ||
| 50° C. 2 minutes | 1 | 1 | |
| 70° C. 20 minutes | 1 | ||
| 95° C. 10 minutes | 1 | ||
| 95° C. 30 seconds | X4 | 2 | |
| 65° C. 30 seconds | |||
| 72° C. 1 minute | |||
| 95° C. 15 seconds | X8 | 3 | |
| 80° C. 30 seconds | |||
| 60° C. 30 seconds | |||
| 72° C. 1 minute | |||
| 95° C. 15 seconds | x8 | 4 | |
| 60° C. 30 seconds | |||
| 72° C. 1 minute | |||
| 95° C. 15 seconds | x2 | 5 | |
| 80° C. 30 seconds | |||
| 60° C. 30 seconds | |||
| 72° C. 1 minute | |||
| 95° C. 15 seconds | X12 | 6 | |
| 60° C. 30 seconds | |||
| 72° C. 1 minute | |||
| 95° C. 15 seconds | X6 | 7 | |
| 80° C. 30 seconds | |||
| 60° C. 30 seconds | |||
| 72° C. 1 minute | |||
1. A method for determining the nucleotide sequence of a sample CFTR nucleic acid comprising:
(a) producing an adapter-tagged amplicon library by amplifying multiple target segments of the sample CFTR nucleic acid, wherein each target segment is amplified with a pair of oligonucleotide primers, wherein at least one primer of the primer pair is selected from the group consisting of SEQ ID NOS: 3-174; and
(b) determining the nucleotide sequences of the target segments by sequencing the amplicons in the amplicon library using high throughput massively parallel sequencing.
2. The method of claim 1, wherein the multiple target segments are amplified by PCR.
3. The method of claim 1, wherein the sample CFTR nucleic acid is at least one nucleic acid selected from the group consisting of genomic DNA, mRNA and cDNA.
4. The method of claim 1, wherein an adapter sequence is ligated to one of both ends of each amplicon.
5. The method of claim 1, wherein at least one primer of the primer pair is ligated to a sequencing adapter sequence prior to amplification.
6. The method of claim 1, wherein the amplicons are labeled with an index label that indicates the sample source from which the amplicon is generated.
7. The method of claim 6, wherein the index label is an oligonucleotide.
8. The method of claim 1, wherein the multiple target segments of the sample CFTR nucleic acid, together, span the CFTR coding region and all intron/junctions.
9. The method of claim 8, wherein the multiple target segments further span about 1000 nucleotides of the promoter region immediately upstream of the first exon.
10. The method of claim 9, wherein the multiple target segments further span about 200 to 350 nucleotides immediately downstream of the CFTR sequence.
11. The method of claim 1, wherein the at least one primer of the primer pair is selected from the group consisting of SEQ ID NOs: 9-54, 61-106, 109-140, and 143-174.
12. The method of claim 1, wherein the high throughput massively parallel sequencing involves a read depth approach.
13. A kit comprising an oligonucleotide primer selected from the group consisting of SEQ ID NO: 3-174, wherein the primer further comprises a fluorescent label.
14. The kit of claim 13, wherein the oligonucleotide primer is selected from the group consisting of SEQ ID NO: 9-54, 61-106, 109-140, and 143-174.
15. The kit of claim 13, wherein the oligonucleotide primer is ligated to a sequencing adapter sequence.
16. The kit of claim 15, wherein the sequencing adapter sequence comprises SEQ ID NO: 1.
17. The kit of claim 15, wherein the sequencing adapter sequence comprises SEQ ID NO: 2.