US20210261995A1
2021-08-26
17/241,441
2021-04-27
The invention provides compositions and methods for engineering bacteria to produce fucosylated oligosaccharides, and the use thereof in the prevention or treatment of infection.
Get notified when new applications in this technology area are published.
Y02P20/52 » CPC further
Technologies relating to chemical industry; Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Y02P20/52 » CPC further
Technologies relating to chemical industry; Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
C12N9/1051 » CPC further
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Transferases (2.); Glycosyltransferases (2.4) Hexosyltransferases (2.4.1)
C12N9/2471 » CPC further
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on beta-galactose-glycoside bonds, e.g. carrageenases (3.2.1.83; 3.2.1.157); beta-agarase (3.2.1.81) Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
C12Y204/01 » CPC further
Glycosyltransferases (2.4) Hexosyltransferases (2.4.1)
C12Y204/01065 » CPC further
Glycosyltransferases (2.4); Hexosyltransferases (2.4.1) 3-Galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase (2.4.1.65), i.e. alpha-1-3 fucosyltransferase
C12Y302/01023 » CPC further
Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2); Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1) Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
C12Y306/03018 » CPC further
Hydrolases acting on acid anhydrides (3.6) acting on acid anhydrides; catalysing transmembrane movement of substances (3.6.3) Oligosaccharide-transporting ATPase (3.6.3.18)
C12P19/00 » CPC main
Preparation of compounds containing saccharide radicals
C12N9/00 » CPC further
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes
C12N9/10 IPC
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes Transferases (2.)
C12P19/18 » CPC further
Preparation of compounds containing saccharide radicals produced by the action of a glycosyl transferase, e.g. alpha-, beta- or gamma-cyclodextrins
C12P19/26 » CPC further
Preparation of compounds containing saccharide radicals Preparation of nitrogen-containing carbohydrates
C07H3/06 » CPC further
Compounds containing only hydrogen atoms and saccharide radicals having only carbon, hydrogen, and oxygen atoms Oligosaccharides, i.e. having three to five saccharide radicals attached to each other by glycosidic linkages
C07H13/04 » CPC further
Compounds containing saccharide radicals esterified by carbonic acid or derivatives thereof, or by organic acids, e.g. phosphonic acids by carboxylic acids having the esterifying carboxyl radicals attached to acyclic carbon atoms
C12N15/70 » CPC further
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression Vectors or expression systems specially adapted for E. coli
C12N9/14 » CPC further
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes Hydrolases (3)
This application is a continuation of U.S. Ser. No. 15/442,127 filed Feb. 24, 2017, which is a continuation of U.S. Ser. No. 14/033,664 filed Sep. 23, 2013, now U.S. Pat. No. 9,587,241 issued Mar. 7, 2017, which is a divisional of U.S. Ser. No. 13/398,526 filed Feb. 16, 2012, now U.S. Pat. No. 9,453,230 issued Sep. 27, 2016, and claims the benefit of priority under 35 U.S.C. § 119(e) to U.S. Provisional Application No. 61/443,470, filed Feb. 16, 2011, the entire contents of each of which are incorporated herein by reference.
The contents of the text file named “37847-505C01US_Sequence_Listing.txt”, which was created on Jan. 26, 2017 and is 94 KB in size, are hereby incorporated by reference in their entirety.
The invention provides compositions and methods for producing purified oligosaccharides, in particular certain fucosylated and/or sialylated oligosaccharides that are typically found in human milk.
Human milk contains a diverse and abundant set of neutral and acidic oligosaccharides (human milk oligosaccharides, HMOS). Many of these molecules are not utilized directly by infants for nutrition, but they nevertheless serve critical roles in the establishment of a healthy gut microbiome, in the prevention of disease, and in immune function. Prior to the invention described herein, the ability to produce HMOS inexpensively at large scale was problematic. For example, HMOS production through chemical synthesis was limited by stereo-specificity issues, precursor availability, product impurities, and high overall cost. As such, there is a pressing need for new strategies to inexpensively manufacture large quantities of HMOS for a variety of commercial applications.
The invention described herein features efficient and economical methods for producing fucosylated and sialylated oligosaccharides. The method for producing a fucosylated oligosaccharide in a bacterium comprises the following steps: providing a bacterium that comprises a functional β-galactosidase gene, an exogenous fucosyltransferase gene, a GDP-fucose synthesis pathway, and a functional lactose permease gene; culturing the bacterium in the presence of lactose; and retrieving a fucosylated oligosaccharide from the bacterium or from a culture supernatant of the bacterium.
To produce a fucosylated oligosaccharide by biosynthesis, the bacterium utilizes an endogenous or exogenous guanosine diphosphate (GDP)-fucose synthesis pathway. By “GDP-fucose synthesis pathway” is meant a sequence of reactions, usually controlled and catalyzed by enzymes, which results in the synthesis of GDP-fucose. An exemplary GDP-fucose synthesis pathway in Escherichia coli is set forth below. In the GDP-fucose synthesis pathway set forth below, the enzymes for GDP-fucose synthesis include: 1) manA=phosphomannose isomerase (PMI), 2) manB=phosphomannomutase (PMM), 3) manC=mannose-1-phosphate guanylyltransferase (GMP), 4) gmd=GDP-mannose-4,6-dehydratase (GMD), 5) fcl=GDP-fucose synthase (GFS), and 6) ΔwcaJ=mutated UDP-glucose lipid carrier transferase.
Glucose→Glc-6-P→Fru-6-P→1 Man-6-P→2 Man-1-P→3 GDP-Man→4,5 GDP-Fuc6 Colanic acid.
The synthetic pathway from fructose-6-phosphate, a common metabolic intermediate of all organisms, to GDP-fucose consists of 5 enzymatic steps: 1) PMI (phosphomannose isomerase), 2) PMM (phosphomannomutase), 3) GMP (mannose-1-phosphate guanylyltransferase), 4) GMD (GDP-mannose-4,6-dehydratase), and 5) GFS (GDP-fucose synthase). Individual bacterial species possess different inherent capabilities with respect to GDP-fucose synthesis. Escherichia coli, for example, contains enzymes competent to perform all five steps, whereas Bacillus licheniformis is missing enzymes capable of performing steps 4 and 5 (i.e., GMD and GFS). Any enzymes in the GDP-synthesis pathway that are inherently missing in any particular bacterial species are provided as genes on recombinant DNA constructs, supplied either on a plasmid expression vector or as exogenous genes integrated into the host chromosome.
The invention described herein details the manipulation of genes and pathways within bacteria such as the enterobacterium Escherichia coli K12 (E. coli) or probiotic bacteria leading to high level synthesis of HMOS. A variety of bacterial species may be used in the oligosaccharide biosynthesis methods, for example Erwinia herbicola (Pantoea agglomerans), Citrobacter freundii, Pantoea citrea, Pectobacterium carotovorum, or Xanthomonas campestris. Bacteria of the genus Bacillus may also be used, including Bacillus subtilis, Bacillus licheniformis, Bacillus coagulans, Bacillus thermophilus, Bacillus laterosporus, Bacillus megaterium, Bacillus mycoides, Bacillus pumilus, Bacillus lentus, Bacillus cereus, and Bacillus circulans. Similarly, bacteria of the genera Lactobacillus and Lactococcus may be modified using the methods of this invention, including but not limited to Lactobacillus acidophilus, Lactobacillus salivarius, Lactobacillus plantarum, Lactobacillus helveticus, Lactobacillus delbrueckii, Lactobacillus rhamnosus, Lactobacillus bulgaricus, Lactobacillus crispatus, Lactobacillus gasseri, Lactobacillus casei, Lactobacillus reuteri, Lactobacillus jensenii, and Lactococcus lactis. Streptococcus thermophiles and Proprionibacterium freudenreichii are also suitable bacterial species for the invention described herein. Also included as part of this invention are strains, modified as described here, from the genera Enterococcus (e.g., Enterococcus faecium and Enterococcus thermophiles), Bifidobacterium (e.g., Bifidobacterium longum, Bifidobacterium infantis, and Bifidobacterium bifidum), Sporolactobacillus spp., Micromomospora spp., Micrococcus spp., Rhodococcus spp., and Pseudomonas (e.g., Pseudomonas fluorescens and Pseudomonas aeruginosa). Bacteria comprising the characteristics described herein are cultured in the presence of lactose, and a fucosylated oligosaccharide is retrieved, either from the bacterium itself or from a culture supernatant of the bacterium. The fucosylated oligosaccharide is purified for use in therapeutic or nutritional products, or the bacteria are used directly in such products.
The bacterium also comprises a functional β-galactosidase gene. The β-galactosidase gene is an endogenous β-galactosidase gene or an exogenous β-galactosidase gene. For example, the β-galactosidase gene comprises an E. coli lacZ gene (e.g., GenBank Accession Number V00296 (GI:41901), incorporated herein by reference). The bacterium accumulates an increased intracellular lactose pool, and produces a low level of β-galactosidase.
A functional lactose permease gene is also present in the bacterium. The lactose permease gene is an endogenous lactose permease gene or an exogenous lactose permease gene. For example, the lactose permease gene comprises an E. coli lacY gene (e.g., GenBank Accession Number V00295 (GI:41897), incorporated herein by reference). Many bacteria possess the inherent ability to transport lactose from the growth medium into the cell, by utilizing a transport protein that is either a homolog of the E. coli lactose permease (e.g., as found in Bacillus licheniformis), or a transporter that is a member of the ubiquitous PTS sugar transport family (e.g., as found in Lactobacillus casei and Lactobacillus rhamnosus). For bacteria lacking an inherent ability to transport extracellular lactose into the cell cytoplasm, this ability is conferred by an exogenous lactose transporter gene (e.g., E. coli lacY) provided on recombinant DNA constructs, and supplied either on a plasmid expression vector or as exogenous genes integrated into the host chromosome.
The bacterium comprises an exogenous fucosyltransferase gene. For example, the exogenous fucosyltransferase gene encodes α(1,2) fucosyltransferase and/or α(1,3) fucosyltransferase. An exemplary α(1,2) fucosyltransferase gene is the wcfW gene from Bacteroides fragilis NCTC 9343 (SEQ ID NO: 4). An exemplary α(1,3) fucosyltransferase gene is the Helicobacter pylori 26695 futA gene. One example of the Helicobacter pylori futA gene is presented in GenBank Accession Number HV532291 (GI:365791177), incorporated herein by reference.
Alternatively, a method for producing a fucosylated oligosaccharide by biosynthesis comprises the following steps: providing an enteric bacterium that comprises a functional β-galactosidase gene, an exogenous fucosyltransferase gene, a mutation in a colanic acid synthesis gene, and a functional lactose permease gene; culturing the bacterium in the presence of lactose; and retrieving a fucosylated oligosaccharide from the bacterium or from a culture supernatant of the bacterium.
To produce a fucosylated oligosaccharide by biosynthesis, the bacterium comprises a mutation in an endogenous colanic acid (a fucose-containing exopolysaccharide) synthesis gene. By “colanic acid synthesis gene” is meant a gene involved in a sequence of reactions, usually controlled and catalyzed by enzymes that result in the synthesis of colanic acid. Exemplary colanic acid synthesis genes include an rcsA gene (e.g., GenBank Accession Number M58003 (GI:1103316), incorporated herein by reference), an rcsB gene, (e.g., GenBank Accession Number E04821 (GI:2173017), incorporated herein by reference), a wcaJ gene, (e.g., GenBank Accession Number (amino acid) BAA15900 (GI:1736749), incorporated herein by reference), a wzxC gene, (e.g., GenBank Accession Number (amino acid) BAA15899 (GI:1736748), incorporated herein by reference), a wcaD gene, (e.g., GenBank Accession Number (amino acid) BAE76573 (GI:85675202), incorporated herein by reference), a wza gene, (e.g., GenBank Accession Number (amino acid) BAE76576 (GI:85675205), incorporated herein by reference), a wzb gene, and (e.g., GenBank Accession Number (amino acid) BAE76575 (GI:85675204), incorporated herein by reference), and a wzc gene (e.g., GenBank Accession Number (amino acid) BAA15913 (GI:1736763), incorporated herein by reference).
This is achieved through a number of genetic modifications of endogenous E. coli genes involved either directly in colanic acid precursor biosynthesis, or in overall control of the colanic acid synthetic regulon. Specifically, the ability of the host E. coli strain to synthesize colanic acid, an extracellular capsular polysaccharide, is eliminated by the deletion of the wcaJ gene, encoding the UDP-glucose lipid carrier transferase. In a wcaJ null background, GDP-fucose accumulates in the E. coli cytoplasm. Over-expression of a positive regulator protein, RcsA, in the colanic acid synthesis pathway results in an increase in intracellular GDP-fucose levels. Over-expression of an additional positive regulator of colanic acid biosynthesis, namely RcsB, is also utilized, either instead of or in addition to over-expression of RcsA, to increase intracellular GDP-fucose levels. Alternatively, colanic acid biosynthesis is increased following the introduction of a null mutation into the E. coli lon gene (e.g., GenBank Accession Number L20572 (GI:304907), incorporated herein by reference). Lon is an adenosine-5′-triphosphate (ATP)-dependant intracellular protease that is responsible for degrading RcsA, mentioned above as a positive transcriptional regulator of colanic acid biosynthesis in E. coli. In a lon null background, RcsA is stabilized, RcsA levels increase, the genes responsible for GDP-fucose synthesis in E. coli are up-regulated, and intracellular GDP-fucose concentrations are enhanced.
For example, the bacterium further comprises a functional, wild-type E. coli lacZ+ gene inserted into an endogenous gene, for example the lon gene in E. coli. In this manner, the bacterium may comprise a mutation in a lon gene.
The bacterium also comprises a functional β-galactosidase gene. The β-galactosidase gene is an endogenous β-galactosidase gene or an exogenous β-galactosidase gene. For example, the β-galactosidase gene comprises an E. coli lacZ gene. The endogenous lacZ gene of the E. coli is deleted or functionally inactivated, but in such a way that expression of the downstream lactose permease (lacY) gene remains intact.
The bacterium comprises an exogenous fucosyltransferase gene. For example, the exogenous fucosyltransferase gene encodes α(1,2) fucosyltransferase and/or α(1,3) fucosyltransferase. An exemplary α(1,2) fucosyltransferase gene is the wcfW gene from Bacteroides fragilis NCTC 9343 (SEQ ID NO: 4). An exemplary α(1,3) fucosyltransferase gene is the Helicobacter pylori 26695 futA gene. One example of the Helicobacter pylori futA gene is presented in GenBank Accession Number HV532291 (GI:365791177), incorporated herein by reference.
A functional lactose permease gene is also present in the bacterium. The lactose permease gene is an endogenous lactose permease gene or an exogenous lactose permease gene. For example, the lactose permease gene comprises an E. coli lacY gene.
The bacterium may further comprise an exogenous rcsA and/or rcsB gene (e.g., in an ectopic nucleic acid construct such as a plasmid), and the bacterium optionally further comprises a mutation in a lacA gene (e.g., GenBank Accession Number X51872 (GI:41891), incorporated herein by reference).
Bacteria comprising the characteristics described herein are cultured in the presence of lactose, and a fucosylated oligosaccharide is retrieved, either from the bacterium itself or from a culture supernatant of the bacterium. The fucosylated oligosaccharide is purified for use in therapeutic or nutritional products, or the bacteria are used directly in such products.
The bacteria used herein to produce HMOS are genetically engineered to comprise an increased intracellular guanosine diphosphate (GDP)-fucose pool, an increased intracellular lactose pool (as compared to wild type) and to comprise fucosyl transferase activity. Accordingly, the bacterium contains a mutation in a colanic acid (a fucose-containing exopolysaccharide) synthesis pathway gene, such as a wcaJ gene, resulting in an enhanced intracellular GDP-fucose pool. The bacterium further comprises a functional, wild-type E. coli lacZ+ gene inserted into an endogenous gene, for example the lon gene in E. coli. In this manner, the bacterium may further comprise a mutation in a lon gene. The endogenous lacZ gene of the E. coli is deleted or functionally inactivated, but in such a way that expression of the downstream lactose permease (lacY) gene remains intact. The organism so manipulated maintains the ability to transport lactose from the growth medium, and to develop an intracellular lactose pool for use as an acceptor sugar in oligosaccharide synthesis, while also maintaining a low level of intracellular beta-galactosidase activity useful for a variety of additional purposes. The bacterium may further comprise an exogenous rcsA and/or rcsB gene (e.g., in an ectopic nucleic acid construct such as a plasmid), and the bacterium optionally further comprises a mutation in a lacA gene. Preferably, the bacterium accumulates an increased intracellular lactose pool, and produces a low level of beta-galactosidase.
The bacterium possesses fucosyl transferase activity. For example, the bacterium comprises one or both of an exogenous fucosyltransferase gene encoding an α(1,2) fucosyltransferase and an exogenous fucosyltransferase gene encoding an α(1,3) fucosyltransferase. An exemplary α(1,2) fucosyltransferase gene is the wcfW gene from Bacteroides fragilis NCTC 9343 (SEQ ID NO: 4). Prior to the present invention, this wcfW gene was not known to encode a protein with an α(1,2) fucosyltransferase activity, and further was not suspected to possess the ability to utilize lactose as an acceptor sugar. Other α(1,2) fucosyltransferase genes that use lactose as an acceptor sugar (e.g., the Helicobacter pylori 26695 futC gene or the E. coli O128:B12 wbsJ gene) may readily be substituted for Bacteroides fragilis wcfW. One example of the Helicobacter pylori futC gene is presented in GenBank Accession Number EF452503 (GI:134142866), incorporated herein by reference.
An exemplary α(1,3) fucosyltransferase gene is the Helicobacter pylori 26695 futA gene, although other α(1,3) fucosyltransferase genes known in the art may be substituted (e.g., α(1,3) fucosyltransferase genes from Helicobacter hepaticus Hh0072, Helicobacter bilis, Campylobacter jejuni, or from Bacteroides species). The invention includes a nucleic acid construct comprising one, two, three or more of the genes described above. For example, the invention includes a nucleic acid construct expressing an exogenous fucosyltransferase gene (encoding α(1,2) fucosyltransferase or α(1,3) fucosyltransferase) transformed into a bacterial host strain comprising a deleted endogenous β-galactosidase (e.g., lacZ) gene, a replacement functional β-galactosidase gene of low activity, a GDP-fucose synthesis pathway, a functional lactose permease gene, and a deleted lactose acetyltransferase gene.
Also within the invention is an isolated E. coli bacterium as described above and characterized as comprising a defective colanic acid synthesis pathway, a reduced level of β-galactosidase (LacZ) activity, and an exogenous fucosyl transferase gene. The invention also includes: a) methods for phenotypic marking of a gene locus in a β-galactosidase negative host cell by utilizing a β-galactosidase (e.g., lacZ) gene insert engineered to produce a low but readily detectable level of β-galactosidase activity, b) methods for readily detecting lytic bacteriophage contamination in fermentation runs through release and detection of cytoplasmic β-galactosidase in the cell culture medium, and c) methods for depleting a bacterial culture of residual lactose at the end of production runs. a), b) and c) are each achieved by utilizing a functional β-galactosidase (e.g., lacZ) gene insert carefully engineered to direct the expression of a low, but detectable level of β-galactosidase activity in an otherwise β-galactosidase negative host cell.
A purified fucosylated oligosaccharide produced by the methods described above is also within the invention. A purified oligosaccharide, e.g., 2′-FL, 3FL, LDFT, is one that is at least 90%, 95%, 98%, 99%, or 100% (w/w) of the desired oligosaccharide by weight.
Purity is assessed by any known method, e.g., thin layer chromatography or other electrophoretic or chromatographic techniques known in the art. The invention includes a method of purifying a fucosylated oligosaccharide produced by the genetically engineered bacterium described above, which method comprises separating the desired fucosylated oligosaccharide (e.g., 2′-FL) from contaminants in a bacterial cell extract or lysate, or bacterial cell culture supernatant. Contaminants include bacterial DNA, protein and cell wall components, and yellow/brown sugar caramels sometimes formed in spontaneous chemical reactions in the culture medium.
The oligosaccharides are purified and used in a number of products for consumption by humans as well as animals, such as companion animals (dogs, cats) as well as livestock (bovine, equine, ovine, caprine, or porcine animals, as well as poultry). For example, a pharmaceutical composition comprising purified 2′-fucosyllactose (2′-FL), 3-fucosyllactose (3FL), lactodifucotetraose (LDFT), or 3′-sialyl-3-fucosyllactose (3′-S3FL) and an excipient is suitable for oral administration. Large quantities of 2′-FL, 3FL, LDFT, or 3′-S3FL are produced in bacterial hosts, e.g., an E. coli bacterium comprising a heterologous α(1,2)fucosyltransferase, a heterologous α(1,3) fucosyltransferase, or a heterologous sialyltransferase, or a combination thereof. An E. coli bacterium comprising an enhanced cytoplasmic pool of each of the following: lactose, GDP-fucose, and CMP-Neu5Ac, is useful in such production systems. In the case of lactose and GDP-fucose, endogenous E. coli metabolic pathways and genes are manipulated in ways that result in the generation of increased cytoplasmic concentrations of lactose and/or GDP-fucose, as compared to levels found in wild type E. coli. For example, the bacteria contain at least 10%, 20%, 50%, 2×, 5×, 10× or more of the levels in a corresponding wild type bacteria that lacks the genetic modifications described above. In the case of CMP-Neu5Ac, endogenous Neu5Ac catabolism genes are inactivated and exogenous CMP-Neu5Ac biosynthesis genes introduced into E. coli resulting in the generation of a cytoplasmic pool of CMP-Neu5Ac not found in the wild type bacterium. A method of producing a pharmaceutical composition comprising a purified HMOS is carried out by culturing the bacterium described above, purifying the HMOS produced by the bacterium, and combining the HMOS with an excipient or carrier to yield a dietary supplement for oral administration. These compositions are useful in methods of preventing or treating enteric and/or respiratory diseases in infants and adults. Accordingly, the compositions are administered to a subject suffering from or at risk of developing such a disease.
The invention therefore provides methods for increasing intracellular levels of GDP-fucose in Escherichia coli by manipulating the organism's endogenous colanic acid biosynthesis pathway. This is achieved through a number of genetic modifications of endogenous E. coli genes involved either directly in colanic acid precursor biosynthesis, or in overall control of the colanic acid synthetic regulon. The invention also provides for increasing the intracellular concentration of lactose in E. coli, for cells grown in the presence of lactose, by using manipulations of endogenous E. coli genes involved in lactose import, export, and catabolism. In particular, described herein are methods of increasing intracellular lactose levels in E. coli genetically engineered to produce a human milk oligosaccharide by incorporating a lacA mutation into the genetically modified E. coli. The lacA mutation prevents the formation of intracellular acetyl-lactose, which not only removes this molecule as a contaminant from subsequent purifications, but also eliminates E. coli's ability to export excess lactose from its cytoplasm, thus greatly facilitating purposeful manipulations of the E. coli intracellular lactose pool.
Also described herein are bacterial host cells with the ability to accumulate a intracellular lactose pool while simultaneously possessing low, functional levels of cytoplasmic β-galactosidase activity, for example as provided by the introduction of a functional recombinant E. coli lacZ gene, or by a β-galactosidase gene from any of a number of other organisms (e.g., the lac4 gene of Kluyveromyces lactis (e.g., GenBank Accession Number M84410 (GI:173304), incorporated herein by reference). Low, functional levels of cytoplasmic β-galactosidase include β-galactosidase activity levels of between 0.05 and 200 units, e.g., between 0.05 and 5 units, between 0.05 and 4 units, between 0.05 and 3 units, or between 0.05 and 2 units (for unit definition see: Miller J H, Laboratory CSH. Experiments in molecular genetics. Cold Spring Harbor Laboratory Cold Spring Harbor, N.Y.; 1972; incorporated herein by reference). This low level of cytoplasmic β-galactosidase activity, while not high enough to significantly diminish the intracellular lactose pool, is nevertheless very useful for tasks such as phenotypic marking of desirable genetic loci during construction of host cell backgrounds, for detection of cell lysis due to undesired bacteriophage contaminations in fermentation processes, or for the facile removal of undesired residual lactose at the end of fermentations.
In one aspect, the human milk oligosaccharide produced by engineered bacteria comprising an exogenous nucleic acid molecule encoding an α(1,2) fucosyltransferase, is 2′-FL (2′-fucosyllactose). Preferably, the α(1,2)fucosyltransferase utilized is the previously completely uncharacterized wcfW gene from Bacteroides fragilis NCTC 9343 of the present invention, alternatively the futC gene of Helicobacter pylori 26695 or the wbsJ gene of E. coli strain O128:B12, or any other α(1,2) fucosyltransferase capable of using lactose as the sugar acceptor substrate may be utilized for 2′-FL synthesis. In another aspect the human milk oligosaccharide produced by engineered bacteria comprising an exogenous nucleic acid molecule encoding an α(1,3) fucosyltransferase, is 3FL (3-fucosyllactose), wherein the bacterial cell comprises an exogenous nucleic acid molecule encoding an exogenous α(1,3) fucosyltransferase. Preferably, the bacterial cell is E. coli. The exogenous α(1,3) fucosyltransferase is isolated from, e.g., Helicobacter pylori, H. hepaticus, H. bilis, C. jejuni, or a species of Bacteroides. In one aspect, the exogenous α(1,3) fucosyltransferase comprises H. hepaticus Hh0072, H. pylori 11639 FucTa, or H. pylori UA948 FucTa (e.g., GenBank Accession Number AF194963 (GI:28436396), incorporated herein by reference). The invention also provides compositions comprising E. coli genetically engineered to produce the human milk tetrasaccharide lactodifucotetraose (LDFT). The E. coli in this instance comprise an exogenous nucleic acid molecule encoding an α(1,2) fucosyltransferase and an exogenous nucleic acid molecule encoding an α(1,3) fucosyltransferase. In one aspect, the E. coli is transformed with a plasmid expressing an α(1,2) fucosyltransferase and/or a plasmid expressing an α(1,3) fucosyltransferase. In another aspect, the E. coli is transformed with a plasmid that expresses both an α(1,2) fucosyltransferase and an α(1,3) fucosyltransferase. Alternatively, the E. coli is transformed with a chromosomal integrant expressing an α(1,2) fucosyltransferase and a chromosomal integrant expressing an α(1,3) fucosyltransferase. Optionally, the E. coli is transformed with plasmid pG177.
Also described herein are compositions comprising a bacterial cell that produces the human milk oligosaccharide 3′-S3FL (3′-sialyl-3-fucosyllactose), wherein the bacterial cell comprises an exogenous sialyl-transferase gene encoding α(2,3)sialyl-transferase and an exogenous fucosyltransferase gene encoding α(1,3) fucosyltransferase. Preferably, the bacterial cell is E. coli. The exogenous fucosyltransferase gene is isolated from, e.g., Helicobacter pylori, H. hepaticus, H. bilis, C. jejuni, or a species of Bacteroides. For example, the exogenous fucosyltransferase gene comprises H. hepaticus Hh0072, H. pylori 11639 FucTa, or H. pylori UA948 FucTa. The exogenous sialyltransferase gene utilized for 3′-S3FL production may be obtained from any one of a number of sources, e.g., those described from N. meningitidis and N. gonorrhoeae. Preferably, the bacterium comprises a GDP-fucose synthesis pathway.
Additionally, the bacterium contains a deficient sialic acid catabolic pathway. By “sialic acid catabolic pathway” is meant a sequence of reactions, usually controlled and catalyzed by enzymes, which results in the degradation of sialic acid. An exemplary sialic acid catabolic pathway in Escherichia coli is described herein. In the sialic acid catabolic pathway described herein, sialic acid (Neu5Ac; N-acetylneuraminic acid) is degraded by the enzymes NanA (N-acetylneuraminic acid lyase) and NanK (N-acetylmannosamine kinase). For example, a deficient sialic acid catabolic pathway is engineered in Escherichia coli by way of a null mutation in endogenous nanA (N-acetylneuraminate lyase) (e.g., GenBank Accession Number D00067 (GI:216588), incorporated herein by reference) and/or nanK (N-acetylmannosamine kinase) genes (e.g., GenBank Accession Number (amino acid) BAE77265 (GI:85676015), incorporated herein by reference). Other components of sialic acid metabolism include: (nanT) sialic acid transporter; (ManNAc-6-P) N-acetylmannosamine-6-phosphate; (GlcNAc-6-P) N-acetylglucosamine-6-phosphate; (GlcN-6-P) Glucosamine-6-phosphate; and (Fruc-6-P) Fructose-6-phosphate.
Moreover, the bacterium (e.g., E. coli) also comprises a sialic acid synthetic capability. For example, the bacterium comprises a sialic acid synthetic capability through provision of an exogenous UDP-GlcNAc 2-epimerase (e.g., neuC of Campylobacter jejuni or equivalent (e.g., GenBank Accession Number (amino acid) AAG29921 (GI:11095585), incorporated herein by reference)), a Neu5Ac synthase (e.g., neuB of C. jejuni or equivalent, e.g., GenBank Accession Number (amino acid) AAG29920 (GI:11095584), incorporated herein by reference)), and/or a CMP-Neu5Ac synthetase (e.g., neuA of C. jejuni or equivalent, e.g., GenBank Accession Number (amino acid) ADN91474 (GI:307748204), incorporated herein by reference).
Additionally, the bacterium also comprises a functional β-galactosidase gene and a functional lactose permease gene. Bacteria comprising the characteristics described herein are cultured in the presence of lactose, and a 3′-sialyl-3-fucosyllactose is retrieved, either from the bacterium itself or from a culture supernatant of the bacterium.
Also provided are methods for producing a 3′-sialyl-3-fucosyllactose (3′-S3FL) in an enteric bacterium, wherein the enteric bacterium comprises a mutation in an endogenous colanic acid synthesis gene, a functional lacZ gene, a functional lactose permease gene, an exogenous fucosyltransferase gene encoding α(1,3) fucosyltransferase, and an exogenous sialyltransferase gene encoding an α(2,3)sialyl transferase. Additionally, the bacterium contains a deficient sialic acid catabolic pathway. For example, the bacterium comprises a deficient sialic acid catabolic pathway by way of a null mutation in endogenous nanA (N-acetylneuraminate lyase) and/or nanK (N-acetylmannosamine kinase) genes. The bacterium also comprises a sialic acid synthetic capability. For example, the bacterium comprises a sialic acid synthetic capability through provision of an exogenous UDP-GlcNAc 2-epimerase (e.g., neuC of C. jejuni or equivalent), a Neu5Ac synthase (e.g., neuB of C. jejuni or equivalent), and/or a CMP-Neu5Ac synthetase (e.g., neuA of C. jejuni or equivalent). Bacteria comprising the characteristics described herein are cultured in the presence of lactose, and a 3′-sialyl-3-fucosyllactose is retrieved, either from the bacterium itself or from a culture supernatant of the bacterium.
Also provided is a method for phenotypic marking of a gene locus in a host cell, whose native β-galactosidase gene is deleted or inactivated, by utilizing an inserted recombinant β-galactosidase (e.g., lacZ) gene engineered to produce a low, but detectable level of β-galactosidase activity. Similarly, the invention also provides methods for depleting a bacterial culture of residual lactose in a β-galactosidase negative host cell, whose native β-galactosidase gene is deleted or inactivated, by utilizing an inserted recombinant β-galactosidase (e.g., lacZ) gene engineered to produce a low but detectable level of β-galactosidase activity. Finally, also provided is a method for detecting bacterial cell lysis in a culture of a β-galactosidase negative host cell, whose native β-galactosidase gene is deleted or inactivated, by utilizing an inserted recombinant β-galactosidase (e.g., lacZ) gene engineered to produce a low but detectable level of β-galactosidase activity.
Methods of purifying a fucosylated oligosaccharide produced by the methods described herein are carried out by binding the fucosylated oligosaccharide from a bacterial cell lysate or bacterial cell culture supernatant of the bacterium to a carbon column, and eluting the fucosylated oligosaccharide from the column. Purified fucosylated oligosaccharide are produced by the methods described herein.
Optionally, the invention features a vector, e.g., a vector containing a nucleic acid. The vector can further include one or more regulatory elements, e.g., a heterologous promoter. The regulatory elements can be operably linked to a protein gene, fusion protein gene, or a series of genes linked in an operon in order to express the fusion protein. In yet another aspect, the invention comprises an isolated recombinant cell, e.g., a bacterial cell containing an aforementioned nucleic acid molecule or vector. The nucleic acid sequence can be optionally integrated into the genome.
The term “substantially pure” in reference to a given polypeptide, polynucleotide or oligosaccharide means that the polypeptide, polynucleotide or oligosaccharide is substantially free from other biological macromolecules. The substantially pure polypeptide, polynucleotide or oligosaccharide is at least 75% (e.g., at least 80, 85, 95, or 99%) pure by dry weight. Purity can be measured by any appropriate calibrated standard method, for example, by column chromatography, polyacrylamide gel electrophoresis, thin layer chromatography (TLC) or HPLC analysis.
Polynucleotides, polypeptides, and oligosaccharides of the invention are purified and/or isolated. Purified defines a degree of sterility that is safe for administration to a human subject, e.g., lacking infectious or toxic agents. Specifically, as used herein, an “isolated” or “purified” nucleic acid molecule, polynucleotide, polypeptide, protein or oligosaccharide, is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or chemical precursors or other chemicals when chemically synthesized. For example, Purified HMOS compositions are at least 60% by weight (dry weight) the compound of interest. Preferably, the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight the compound of interest. Purity is measured by any appropriate calibrated standard method, for example, by column chromatography, polyacrylamide gel electrophoresis, thin layer chromatography (TLC) or HPLC analysis. For example, a “purified protein” refers to a protein that has been separated from other proteins, lipids, and nucleic acids with which it is naturally associated. Preferably, the protein constitutes at least 10, 20, 50 70, 80, 90, 95, 99-100% by dry weight of the purified preparation.
By “isolated nucleic acid” is meant a nucleic acid that is free of the genes which flank it in the naturally-occurring genome of the organism from which the nucleic acid is derived. The term covers, for example: (a) a DNA which is part of a naturally occurring genomic DNA molecule, but is not flanked by both of the nucleic acid sequences that flank that part of the molecule in the genome of the organism in which it naturally occurs; (b) a nucleic acid incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner, such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein. Isolated nucleic acid molecules according to the present invention further include molecules produced synthetically, as well as any nucleic acids that have been altered chemically and/or that have modified backbones. For example, the isolated nucleic acid is a purified cDNA or RNA polynucleotide.
A “heterologous promoter”, when operably linked to a nucleic acid sequence, refers to a promoter which is not naturally associated with the nucleic acid sequence.
The terms “express” and “over-express” are used to denote the fact that, in some cases, a cell useful in the method herein may inherently express some of the factor that it is to be genetically altered to produce, in which case the addition of the polynucleotide sequence results in over-expression of the factor. That is, more factor is expressed by the altered cell than would be, under the same conditions, by a wild type cell. Similarly, if the cell does not inherently express the factor that it is genetically altered to produce, the term used would be to merely “express” the factor since the wild type cell did not express the factor at all.
The terms “treating” and “treatment” as used herein refer to the administration of an agent or formulation to a clinically symptomatic individual afflicted with an adverse condition, disorder, or disease, so as to effect a reduction in severity and/or frequency of symptoms, eliminate the symptoms and/or their underlying cause, and/or facilitate improvement or remediation of damage. The terms “preventing” and “prevention” refer to the administration of an agent or composition to a clinically asymptomatic individual who is susceptible to a particular adverse condition, disorder, or disease, and thus relates to the prevention of the occurrence of symptoms and/or their underlying cause.
The invention provides a method of treating, preventing, or reducing the risk of infection in a subject comprising administering to said subject a composition comprising a human milk oligosaccharide, purified from a culture of a recombinant strain of the current invention, wherein the HMOS binds to a pathogen and wherein the subject is infected with or at risk of infection with the pathogen. In one aspect, the infection is caused by a Norwalk-like virus or Campylobacter jejuni. The subject is preferably a mammal in need of such treatment. The mammal is, e.g., any mammal, e.g., a human, a primate, a mouse, a rat, a dog, a cat, a cow, a horse, or a pig. In a preferred embodiment, the mammal is a human. For example, the compositions are formulated into animal feed (e.g., pellets, kibble, mash) or animal food supplements for companion animals, e.g., dogs or cats, as well as livestock or animals grown for food consumption, e.g., cattle, sheep, pigs, chickens, and goats. Preferably, the purified HMOS is formulated into a powder (e.g., infant formula powder or adult nutritional supplement powder, each of which is mixed with a liquid such as water or juice prior to consumption) or in the form of tablets, capsules or pastes or is incorporated as a component in dairy products such as milk, cream, cheese, yogurt or kefir, or as a component in any beverage, or combined in a preparation containing live microbial cultures intended to serve as probiotics, or in prebiotic preparations intended to enhance the growth of beneficial microorganisms either in vitro or in vivo. For example, the purified sugar (e.g., 2′-FL) can be mixed with a Bifidobacterium or Lactobacillus in a probiotic nutritional composition. (i.e. Bifidobacteria are beneficial components of a normal human gut flora and are also known to utilize HMOS for growth.
By the terms “effective amount” and “therapeutically effective amount” of a formulation or formulation component is meant a nontoxic but sufficient amount of the formulation or component to provide the desired effect.
The transitional term “comprising,” which is synonymous with “including,” “containing,” or “characterized by,” is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. By contrast, the transitional phrase “consisting of” excludes any element, step, or ingredient not specified in the claim. The transitional phrase “consisting essentially of” limits the scope of a claim to the specified materials or steps “and those that do not materially affect the basic and novel characteristic(s)” of the claimed invention.
Other features and advantages of the invention will be apparent from the following description of the preferred embodiments thereof, and from the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All published foreign patents and patent applications cited herein are incorporated herein by reference. Genbank and NCBI submissions indicated by accession number cited herein are incorporated herein by reference. All other published references, documents, manuscripts and scientific literature cited herein are incorporated herein by reference. In the case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
FIG. 1 is a schematic illustration showing the synthetic pathway of the major neutral fucosyl-oligosaccharides found in human milk.
FIG. 2 is a schematic illustration showing the synthetic pathway of the major sialyloligosaccharides found in human milk.
FIG. 3 is a schematic demonstrating metabolic pathways and the changes introduced into them to engineer 2′-fucosyllactose (2′-FL) synthesis in Escherichia coli (E. coli). Specifically, the lactose synthesis pathway and the GDP-fucose synthesis pathway are illustrated. In the GDP-fucose synthesis pathway: manA=phosphomannose isomerase (PMI), manB=phosphomannomutase (PMM), manC=mannose-1-phosphate guanylyltransferase (GMP), gmd=GDP-mannose-4,6-dehydratase, fcl=GDP-fucose synthase (GFS), and ΔwcaJ=mutated UDP-glucose lipid carrier transferase.
FIG. 4 is a photograph of a thin layer chromatogram of purified 2′-FL produced in E. coli.
FIG. 5 is a schematic demonstrating metabolic pathways and the changes introduced into them to engineer 3′-sialyllactose (3′-SL) synthesis in E. coli. Abbreviations include: (Neu5Ac) N-acetylneuraminic acid, sialic acid; (nanT) sialic acid transporter; (ΔnanA) mutated N-acetylneuraminic acid lyase; (ManNAc) N-acetylmannosamine; (ΔnanK) mutated N-acetylmannosamine kinase; (ManNAc-6-P) N-acetylmannosamine-6-phosphate; (GlcNAc-6-P) N-acetylglucosamine-6-phosphate; (GlcN-6-P) Glucosamine-6-phosphate; (Fruc-6-P) Fructose-6-phosphate; (neuA), CMP-N-acetylneuraminic acid synthetase; (CMP-Neu5Ac) CMP-N-acetylneuraminic acid; and (neuB), N-acetylneuraminic acid synthase.
FIG. 6 is a schematic demonstrating metabolic pathways and the changes introduced into them to engineer 3-fucosyllactose (3-FL) synthesis in E. coli.
FIG. 7 is a plasmid map of pG175, which expresses the E. coli α(1,2)fucosyltransferase gene wbsJ.
FIG. 8 is a photograph of a western blot of lysates of E. coli containing pG175 and expressing wbsJ, and of cells containing pG171, a pG175 derivative plasmid carrying the H. pylori 26695 futC gene in place of wbsJ and which expresses futC.
FIG. 9 is a photograph of a thin layer chromatogram of 3FL produced in E. coli containing the plasmid pG176 and induced for expression of the H. pylori 26695 α(1,3)fucosyltransferase gene futA by tryptophan addition.
FIG. 10 is a plasmid map of pG177, which contains both the H. pylori 26695 α(1,2)fucosyltransferase gene futC and the H. pylori 26695 α(1,3)fucosyltransferase gene futA, configured as an operon.
FIG. 11 is a photograph of a thin layer chromatogram of 2′-FL, 3FL, and LDFT (lactodifucotetraose) produced in E. coli, directed by plasmids pG171, pG175 (2′-FL), pG176 (3FL), and pG177 (LDFT, 2′-FL and 3FL).
FIG. 12 is a diagram showing the replacement of the lon gene in E. coli strain E390 by a DNA fragment carrying both a kanamycin resistance gene (derived from transposon Tn5) and a wild-type E. coli lacZ+ coding sequence.
FIG. 13A-E is a DNA sequence with annotations (in GenBank format) of the DNA insertion into the lon region diagrammed in FIG. 12 (SEQ ID NOs 9-15).
FIG. 14 is a table containing the genotypes of several E. coli strains of the current invention.
FIG. 15 is a plasmid map of pG186, which expresses the α(1,2)fucosyltransferase gene futC in an operon with the colanic acid pathway transcription activator gene rcsB.
FIG. 16 is a photograph of a western blot of lysates of E. coli containing pG180, a pG175 derivative plasmid carrying the B. fragilis wcfW gene in place of wbsJ and which expresses wcfW, and of cells containing pG171, a pG175 derivative plasmid carrying the H. pylori 26695 futC gene in place of wbsJ and which expresses futC.
FIG. 17 is a photograph of a thin layer chromatogram of 2′-FL produced in E. coli by cells carrying plasmids pG180 or pG171 and induced for expression of wcfW or futC respectively.
FIG. 18 is a photograph of a thin layer chromatogram showing the kinetics and extent of 2′-FL production in a 10 L bioreactor of E. coli host strain E403 transformed with plasmid pG171.
FIG. 19 is a column chromatogram and a TLC analysis of the resolution on a carbon column of a sample of 2′-FL made in E. coli from a lactose impurity.
FIG. 20 is a photograph of a thin layer chromatogram showing 3′-SL in culture medium produced by E. coli strain E547, containing plasmids expressing a bacterial α(2,3)sialyltransferase and neuA, neuB and neuC.
Human milk glycans, which comprise both oligosaccharides (HMOS) and their glycoconjugates, play significant roles in the protection and development of human infants, and in particular the infant gastrointestinal (GI) tract. Milk oligosaccharides found in various mammals differ greatly, and their composition in humans is unique (Hamosh M., 2001 Pediatr Clin North Am, 48:69-86; Newburg D. S., 2001 Adv Exp Med Biol, 501:3-10). Moreover, glycan levels in human milk change throughout lactation and also vary widely among individuals (Morrow A. L. et al., 2004 J Pediatr, 145:297-303; Chaturvedi P et al., 2001 Glycobiology, 11:365-372). Previously, a full exploration of the roles of HMOS was limited by the inability to adequately characterize and measure these compounds. In recent years sensitive and reproducible quantitative methods for the analysis of both neutral and acidic HMOS have been developed (Erney, R., Hilty, M., Pickering, L., Ruiz-Palacios, G., and Prieto, P. (2001) Adv Exp Med Biol 501, 285-297. Bao, Y., and Newburg, D. S. (2008) Electrophoresis 29, 2508-2515). Approximately 200 distinct oligosaccharides have been identified in human milk, and combinations of a small number of simple epitopes are responsible for this diversity (Newburg D. S., 1999 Curr_Med Chem, 6:117-127; Ninonuevo M. et al., 2006 J Agric Food Chem, 54:7471-74801). HMOS are composed of 5 monosaccharides: D-glucose (Glc), D-galactose (Gal), N-acetylglucosamine (GlcNAc), L-fucose (Fuc), and sialic acid (N-acetyl neuraminic acid, Neu5Ac, NANA). HMOS are usually divided into two groups according to their chemical structures: neutral compounds containing Glc, Gal, GlcNAc, and Fuc, linked to a lactose (Galβ1-4Glc) core, and acidic compounds including the same sugars, and often the same core structures, plus NANA (Charlwood J. et al., 1999 Anal_Biochem, 273:261-277; Martín-Sosa et al., 2003 J Dairy Sci, 86:52-59; Parkkinen J. and Finne J., 1987 Methods Enzymol, 138:289-300; Shen Z. et al., 2001 J Chromatogr A, 921:315-321). Approximately 70-80% of oligosaccharides in human milk are fucosylated, and their synthetic pathways are believed to proceed in a manner similar to those pathways shown in FIG. 1 (with the Type I and Type II subgroups beginning with different precursor molecules). A smaller proportion of the oligosaccharides in human milk are sialylated, or are both fucosylated and sialylated. FIG. 2 outlines possible biosynthetic routes for sialylated (acidic) HMOS, although their actual synthetic pathways in humans are not yet completely defined.
Interestingly, HMOS as a class, survive transit through the intestine of infants very efficiently, a function of their being poorly transported across the gut wall and of their resistance to digestion by human gut enzymes (Chaturvedi, P., Warren, C. D., Buescher, C. R., Pickering, L. K. & Newburg, D. S. Adv Exp Med Biol 501, 315-323 (2001)). One consequence of this survival in the gut is that HMOS are able to function as prebiotics, i.e. they are available to serve as an abundant carbon source for the growth of resident gut commensal microorganisms (Ward, R. E., Niñonuevo, M., Mills, D. A., Lebrilla, C. B., and German, J. B. (2007) Mol Nutr Food Res 51, 1398-1405). Recently, there is burgeoning interest in the role of diet and dietary prebiotic agents in determining the composition of the gut microflora, and in understanding the linkage between the gut microflora and human health (Roberfroid, M., Gibson, G. R., Hoyles, L., McCartney, A. L., Rastall, R., Rowland, I., Wolvers, D., Watzl, B., Szajewska, H., Stahl, B., Guarner, F., Respondek, F., Whelan, K., Coxam, V., Davicco, M. J., Léotoing, L., Wittrant, Y., Delzenne, N. M., Cani, P. D., Neyrinck, A. M., and Meheust, A. (2010) Br J Nutr 104 Suppl 2, S1-63).
A number of human milk glycans possess structural homology to cell receptors for enteropathogens, and serve roles in pathogen defense by acting as molecular receptor “decoys”. For example, pathogenic strains of Campylobacter bind specifically to glycans in human milk containing the H-2 epitope, i.e., 2′-fucosyl-N-acetyllactosamine or 2′-fucosyllactose (2′-FL); Campylobacter binding and infectivity are inhibited by 2′-FL and other glycans containing this H-2 epitope (Ruiz-Palacios, G. M., Cervantes, L. E., Ramos, P., Chavez-Munguia, B., and Newburg, D. S. (2003) J Biol Chem 278, 14112-14120). Similarly, some diarrheagenic E. coli pathogens are strongly inhibited in vivo by HMOS containing 2′-linked fucose moieties. Several major strains of human caliciviruses, especially the noroviruses, also bind to 2′-linked fucosylated glycans, and this binding is inhibited by human milk 2′-linked fucosylated glycans. Consumption of human milk that has high levels of these 2′-linked fucosyloligosaccharides has been associated with lower risk of norovirus, Campylobacter, ST of E. coli-associated diarrhea, and moderate-to-severe diarrhea of all causes in a Mexican cohort of breastfeeding children (Newburg D. S. et al., 2004 Glycobiology, 14:253-263; Newburg D. S. et al., 1998 Lancet, 351:1160-1164). Several pathogens are also known to utilize sialylated glycans as their host receptors, such as influenza (Couceiro, J. N., Paulson, J. C. & Baum, L. G. Virus Res 29, 155-165 (1993)), parainfluenza (Amonsen, M., Smith, D. F., Cummings, R. D. & Air, G. M. J Virol 81, 8341-8345 (2007), and rotoviruses (Kuhlenschmidt, T. B., Hanafin, W. P., Gelberg, H. B. & Kuhlenschmidt, M. S. Adv Exp Med Biol 473, 309-317 (1999)). The sialyl-Lewis X epitope is used by Helicobacter pylori (Mandavi, J., Sondén, B., Hurtig, M., Olfat, F. O., et al. Science 297, 573-578 (2002)), Pseudomonas aeruginosa (Scharfman, A., Delmotte, P., Beau, J., Lamblin, G., et al. Glycoconj J 17, 735-740 (2000)), and some strains of noroviruses (Rydell, G. E., Nilsson, J., Rodriguez-Diaz, J., Ruvoën-Clouet, N., et al. Glycobiology 19, 309-320 (2009)).
While studies suggest that human milk glycans could be used as prebiotics and as antimicrobial anti-adhesion agents, the difficulty and expense of producing adequate quantities of these agents of a quality suitable for human consumption has limited their full-scale testing and perceived utility. What has been needed is a suitable method for producing the appropriate glycans in sufficient quantities at reasonable cost. Prior to the invention described herein, there were attempts to use several distinct synthetic approaches for glycan synthesis. Novel chemical approaches can synthesize oligosaccharides (Flowers, H. M. Methods Enzymol 50, 93-121 (1978); Seeberger, P. H. Chem Commun (Camb) 1115-1121 (2003)), but reactants for these methods are expensive and potentially toxic (Koeller, K. M. & Wong, C. H. Chem Rev 100, 4465-4494 (2000)). Enzymes expressed from engineered organisms (Albermann, C., Piepersberg, W. & Wehmeier, U. F. Carbohydr Res 334, 97-103 (2001); Bettler, E., Samain, E., Chazalet, V., Bosso, C., et al. Glycoconj J 16, 205-212 (1999); Johnson, K. F. Glycoconj J 16, 141-146 (1999); Palcic, M. M. Curr Opin Biotechnol 10, 616-624 (1999); Wymer, N. & Toone, E. J. Curr Opin Chem Biol 4, 110-119 (2000)) provide a precise and efficient synthesis (Palcic, M. M. Curr Opin Biotechnol 10, 616-624 (1999)); Crout, D. H. & Vic, G. Curr Opin Chem Biol 2, 98-111 (1998)), but the high cost of the reactants, especially the sugar nucleotides, limits their utility for low-cost, large-scale production. Microbes have been genetically engineered to express the glycosyltransferases needed to synthesize oligosaccharides from the bacteria's innate pool of nucleotide sugars (Endo, T., Koizumi, S., Tabata, K., Kakita, S. & Ozaki, A. Carbohydr Res 330, 439-443 (2001); Endo, T., Koizumi, S., Tabata, K. & Ozaki, A. Appl Microbiol Biotechnol 53, 257-261 (2000); Endo, T. & Koizumi, S. Curr Opin Struct Biol 10, 536-541 (2000); Endo, T., Koizumi, S., Tabata, K., Kakita, S. & Ozaki, A. Carbohydr Res 316, 179-183 (1999); Koizumi, S., Endo, T., Tabata, K. & Ozaki, A. Nat Biotechnol 16, 847-850 (1998)). However, low overall product yields and high process complexity have limited the commercial utility of these approaches.
Prior to the invention described herein, which enables the inexpensive production of large quantities of neutral and acidic HMOS, it had not been possible to fully investigate the ability of this class of molecule to inhibit pathogen binding, or indeed to explore their full range of potential additional functions.
Prior to the invention described herein, chemical syntheses of HMOS were possible, but were limited by stereo-specificity issues, precursor availability, product impurities, and high overall cost (Flowers, H. M. Methods Enzymol 50, 93-121 (1978); Seeberger, P. H. Chem Commun (Camb) 1115-1121 (2003); Koeller, K. M. & Wong, C. H. Chem Rev 100, 4465-4494 (2000)). Also, prior to the invention described herein, in vitro enzymatic syntheses were also possible, but were limited by a requirement for expensive nucleotide-sugar precursors. The invention overcomes the shortcomings of these previous attempts by providing new strategies to inexpensively manufacture large quantities of human milk oligosaccharides for use as dietary supplements. The invention described herein makes use of an engineered bacterium E. coli (or other bacteria) engineered to produce 2′-FL, 3FL, LDFT, or sialylated fucosyl-oligosaccharides in commercially viable levels, for example the methods described herein enable the production of 2′-fucosylactose at >50 g/L in bioreactors.
The E. coli K12 prototroph W3110 was chosen as the parent background for fucosylated HMOS biosynthesis. This strain had previously been modified at the ampC locus by the introduction of a tryptophan-inducible PtrpB-cI+ repressor construct (McCoy, J. & Lavallie, E. Current protocols in molecular biology/edited by Frederick M. Ausubel . . . [et al.] (2001)), enabling economical production of recombinant proteins from the phage λ PL promoter (Sanger, F., Coulson, A. R., Hong, G. F., Hill, D. F. & Petersen, G. B. J Mol Biol 162, 729-773 (1982)) through induction with millimolar concentrations of tryptophan (Mieschendahl, M., Petri, T. & Hänggi, U. Nature Biotechnology 4, 802-808 (1986)). The strain GI724, an E. coli W3110 derivative containing the tryptophan-inducible PtrpB-cI+ repressor construct in ampC, was used at the basis for further E. coli strain manipulations (FIG. 14).
Biosynthesis of fucosylated HMOS requires the generation of an enhanced cellular pool of both lactose and GDP-fucose (FIG. 3). This enhancement was achieved in strain GI724 through several manipulations of the chromosome using λ Red recombineering (Court, D. L., Sawitzke, J. A. & Thomason, L. C. Annu Rev Genet 36, 361-388 (2002)) and generalized P1 phage transduction (Thomason, L. C., Costantino, N. & Court, D. L. Mol Biol Chapter 1, Unit 1.17 (2007)). FIG. 14 is a table presenting the genotypes of several E. coli strains constructed for this invention. The ability of the E. coli host strain to accumulate intracellular lactose was first engineered in strain E183 (FIG. 14) by simultaneous deletion of the endogenous β-galactosidase gene (lacZ) and the lactose operon repressor gene (lacI). During construction of this deletion in GI724 to produce E183, the lacIq promoter was placed immediately upstream of the lactose permease gene, lacY. The modified strain thus maintains its ability to transport lactose from the culture medium (via LacY), but is deleted for the wild-type copy of the lacZ (β-galactosidase) gene responsible for lactose catabolism. An intracellular lactose pool is therefore created when the modified strain is cultured in the presence of exogenous lactose.
Subsequently, the ability of the host E. coli strain to synthesize colanic acid, an extracellular capsular polysaccharide, was eliminated in strain E205 (FIG. 14) by the deletion of the wcaJ gene, encoding the UDP-glucose lipid carrier transferase (Stevenson, G., Andrianopoulos, K., Hobbs, M. & Reeves, P. R. J Bacteriol 178, 4885-4893 (1996)) in strain E183. In a wcaJ null background, GDP-fucose accumulates in the E. coli cytoplasm (Dumon, C., Priem, B., Martin, S. L., Heyraud, A., et al. Glycoconj J 18, 465-474 (2001)).
A thyA (thymidylate synthase) mutation was introduced into strain E205 to produce strain E214 (FIG. 14) by P1 transduction. In the absence of exogenous thymidine, thyA strains are unable to make DNA, and die. The defect can be complemented in trans by supplying a wild-type thyA gene on a multicopy plasmid. (Belfort, M., Maley, G. F. & Maley, F. Proceedings of the National Academy of Sciences 80, 1858 (1983)). This complementation is used herein as a means of plasmid maintenance (eliminating the need for a more conventional antibiotic selection scheme to maintain plasmid copy number).
One strategy for GDP-fucose production is to enhance the bacterial cell's natural synthesis capacity. For example, this is enhancement is accomplished by inactivating enzymes involved in GDP-fucose consumption, and/or by overexpressing a positive regulator protein, RcsA, in the colanic acid (a fucose-containing exopolysaccharide) synthesis pathway. Collectively, this metabolic engineering strategy re-directs the flux of GDP-fucose destined for colanic acid synthesis to oligosaccharide synthesis (FIG. 3). By “GDP-fucose synthesis pathway” is meant a sequence of reactions, usually controlled and catalyzed by enzymes, which results in the synthesis of GDP-fucose. An exemplary GDP-fucose synthesis pathway in Escherichia coli as described in FIG. 3 is set forth below. In the GDP-fucose synthesis pathway set forth below, the enzymes for GDP-fucose synthesis include: 1) manA=phosphomannose isomerase (PMI), 2) manB=phosphomannomutase (PMM), 3) manC=mannose-1-phosphate guanylyltransferase (GMP), 4) gmd=GDP-mannose-4,6-dehydratase (GMD), 5) fcl=GDP-fucose synthase (GFS), and 6) Δwcaf=mutated UDP-glucose lipid carrier transferase.
Glucose→Glc-6-P→Fru-6-P→1 Man-6-P→2 Man-1-P→3 GDP-Man→4,5 GDP-Fuc6 Colanic acid.
Specifically, the magnitude of the cytoplasmic GDP-fucose pool in strain E214 is enhanced by over-expressing the E. coli positive transcriptional regulator of colanic acid biosynthesis, RscA (Gottesman, S. & Stout, V. Mol Microbiol 5, 1599-1606 (1991)). This over-expression of RcsA is achieved by incorporating a wild-type rcsA gene, including its promoter region, onto a multicopy plasmid vector and transforming the vector into the E. coli host, e.g. into E214. This vector typically also carries additional genes, in particular one or two fucosyltransferase genes under the control of the pL promoter, and thyA and beta-lactamase genes for plasmid selection and maintenance. pG175 (SEQ ID NO: 1 and FIG. 7), pG176 (SEQ ID NO: 2), pG177 (SEQ ID NO: 3 and FIG. 10), pG171 (SEQ ID NO: 5) and pG180 (SEQ ID NO: 6) are all examples of fucosyltransferase-expressing vectors that each also carry a copy of the rcsA gene, for the purpose of increasing the intracellular GDP-fucose pool of the E. coli hosts transformed with these plasmids. Over-expression of an additional positive regulator of colanic acid biosynthesis, namely RcsB (Gupte G, Woodward C, Stout V. Isolation and characterization of rcsb mutations that affect colanic acid capsule synthesis in Escherichia coli K-12. J Bacteriol 1997, July; 179(13):4328-35), can also be utilized, either instead of or in addition to over-expression of RcsA, to increase intracellular GDP-fucose levels. Over-expression of rcsB is also achieved by including the gene on a multi-copy expression vector. pG186 is such a vector (SEQ ID NO: 8 and FIG. 15). pG186 expresses rcsB in an operon with futC under pL promoter control. The plasmid also expresses rcsA, driven off its own promoter. pG186 is a derivative of pG175 in which the α(1,2) FT (wbsJ) sequence is replaced by the H. pylori futC gene (FutC is MYC-tagged at its C-terminus). In addition, at the XhoI restriction site immediately 3′ of the futC CDS, the E. coli rcsB gene is inserted, complete with a ribosome binding site at the 5′end of the rcsB CDS, and such that futC and rcsB form an operon.
A third means to increase the intracellular GDP-fucose pool may also be employed. Colanic acid biosynthesis is increased following the introduction of a null mutation into the E. coli lon gene. Lon is an ATP-dependent intracellular protease that is responsible for degrading RcsA, mentioned above as a positive transcriptional regulator of colanic acid biosynthesis in E. coli (Gottesman, S. & Stout, V. Mol Microbiol 5, 1599-1606 (1991)). In a lon null background, RcsA is stabilized, RcsA levels increase, the genes responsible for GDP-fucose synthesis in E. coli are up-regulated, and intracellular GDP-fucose concentrations are enhanced. The lon gene was almost entirely deleted and replaced by an inserted functional, wild-type, but promoter-less E. coli lacZ+ gene (Δlon::(kan, lacZ+) in strain E214 to produce strain E390. λ Red recombineering was used to perform the construction. FIG. 12 illustrates the new configuration of genes engineered at the lon locus in E390. FIG. 13A-E presents the complete DNA sequence of the region, with annotations in GenBank format. Genomic DNA sequence surrounding the lacZ+ insertion into the lon region in E. coli strain E390 is set forth below (SEQ ID NO: 7)
The lon mutation in E390 increases intracellular levels of RcsA, and enhances the intracellular GDP-fucose pool. The inserted lacZ+ cassette not only knocks out lon, but also converts the lacZ− host back to both a lacZ+ genotype and phenotype. The modified strain produces a minimal (albeit still readily detectable) level of β-galactosidase activity (1-2 units), which has very little impact on lactose consumption during production runs, but which is useful in removing residual lactose at the end of runs, is an easily scorable phenotypic marker for moving the lon mutation into other lacZ− E. coli strains by P1 transduction, and can be used as a convenient test for cell lysis (e.g. caused by unwanted bacteriophage contamination) during production runs in the bioreactor.
The production host strain, E390 incorporates all the above genetic modifications and has the following genotype:
ampC::(PtrpBλcI+), PlacIq(ΔlacI-lacZ)158lacY+, ΔwcaJ, thyA748::Tn10, Δlon::(kan, lacZ+)
An additional modification of E390 that is useful for increasing the cytoplasmic pool of free lactose (and hence the final yield of 2′-FL) is the incorporation of a lacA mutation. LacA is a lactose acetyltransferase that is only active when high levels of lactose accumulate in the E. coli cytoplasm. High intracellular osmolarity (e.g., caused by a high intracellular lactose pool) can inhibit bacterial growth, and E. coli has evolved a mechanism for protecting itself from high intra cellular osmolarity caused by lactose by “tagging” excess intracellular lactose with an acetyl group using LacA, and then actively expelling the acetyl-lactose from the cell (Danchin, A. Bioessays 31, 769-773 (2009)). Production of acetyl-lactose in E. coli engineered to produce 2′-FL or other human milk oligosaccharides is therefore undesirable: it reduces overall yield. Moreover, acetyl-lactose is a side product that complicates oligosaccharide purification schemes. The incorporation of a lacA mutation resolves these problems. Strain E403 (FIG. 14) is a derivative of E390 that carries a deletion of the lacA gene and thus is incapable of synthesizing acetyl-lactose.
The production host strain, E403 incorporates all the above genetic modifications and has the following genotype:
ampC::(PtrpBλcI+), PlacIq(ΔlacI-lacZ)158lacY+, ΔwcaJ, thyA748::Tn10, Δlon::(kan, lacZ+) ΔlacA
Various alternative α(1,2) fucosyltransferases are able to utilize lactose as a sugar acceptor and are available for the purpose of 2′-FL synthesis when expressed under appropriate culture conditions in E. coli E214, E390 or E403. For example the plasmid pG175 (ColE1, thyA+, bla+, PL2-wbsJ, rcsA+) (SEQ ID NO: 1, FIG. 7) carries the wbsJ α(1,2)fucosyltransferase gene of E. coli strain O128:B12 and can direct the production of 2′-FL in E. coli strain E403. In another example plasmid pG171 (ColE1, thyA+, bla+, PL2-futC, rcsA+) (SEQ ID NO: 5), carries the H. pylori 26695 futC α(1,2)fucosyltransferase gene (Wang, G., Rasko, D. A., Sherburne, R. & Taylor, D. E. Mol Microbiol 31, 1265-1274 (1999)) and will also direct the production of 2′-FL in strain E403. In a preferred example, the plasmid pG180 (ColE1, thyA+, bla+, PL2-wcfW, rcsA+) (SEQ ID NO: 6) carries the previously uncharacterized Bacteroides fragilis NCTC 9343 wcfW α(1,2)fucosyltransferase gene of the current invention and directs the production of 2′-FL in E. coli strain E403.
The addition of tryptophan to the lactose-containing growth medium of cultures of any one of the strains E214, E390 or E403, when transformed with any one of the plasmids pG171, pG175 or pG180 leads, for each particular strain/plasmid combination, to activation of the host E. coli tryptophan utilization repressor TrpR, subsequent repression of PtrpB, and a consequent decrease in cytoplasmic cI levels, which results in a de-repression of PL, expression of futC, wbsJ or wcfW, respectively, and production of 2′-FL. FIG. 8 is a coomassie blue-stained SDS PAGE gel of lysates of E. coli containing pG175 and expressing wbsJ, and of cells containing pG171 and expressing futC. Prominent stained protein bands running at a molecular weight of approximately 35 kDa are seen for both WbsJ and FutC at 4 and 6 h following PL induction (i.e., after addition of tryptophan). FIG. 16 is a coomassie blue-stained SDS PAGE gel of lysates of E. coli containing pG180 and expressing wcfW, and of cells containing pG171 and expressing H. pylori futC. Prominent stained bands for both WcfW and FutC are seen at a molecular weight of approximately 40 kDa at 4 and 6 h following PL induction (i.e., after addition of tryptophan to the growth medium). For 2′-FL production in small scale laboratory cultures (<100 ml) strains were grown at 30 C in a selective medium lacking both thymidine and tryptophan to early exponential phase (e.g. M9 salts, 0.5% glucose, 0.4% casaminoacids). Lactose was then added to a final concentration of 0.5 or 1%, along with tryptophan (200 μM final) to induce expression of the α(1,2) fucosyltransferase, driven from the PL promoter. At the end of the induction period (˜24 h) TLC analysis was performed on aliquots of cell-free culture medium, or of heat extracts of cells (treatments at 98 C for 10 min, to release sugars contained within the cell). FIG. 11 shows a TLC analysis of cytoplasmic extracts of engineered E. coli cells transformed with pG175 or pG171. Cells were induced to express wbsJ or futC, respectively, and grown in the presence of lactose. The production of 2′-FL can clearly be seen in heat extracts of cells carrying either plasmid. FIG. 17 shows a TLC analysis of cytoplasmic extracts of engineered E. coli cells transformed with pG180 or pG171. Cells were induced to express wcfW or futC, respectively, and grown in the presence of lactose. The production of 2′-FL can clearly be seen with both plasmids. Prior to the present invention the wcfW gene had never been shown to encode a protein with demonstrated α(1,2) fucosyltransferase activity, or to utilize lactose as a sugar acceptor substrate.
The DNA sequence of the Bacteroides fragilis strain NCTC 9343 wcfW gene (protein coding sequence) is set forth below (SEQ ID NO: 4).
2′-FL can be produced in the bioreactor by any one of the host E. coli strains E214, E390 or E403, when transformed with any one of the plasmids pG171, pG175 or pG180. Growth of the transformed strain is performed in a minimal medium in a bioreactor, 10 L working volume, with control of dissolved oxygen, pH, lactose substrate, antifoam and nutrient levels. Minimal “FERM” medium is used in the bioreactor, which is detailed below.
Ferm (10 liters): Minimal medium comprising:
Production cell densities of A600>100 are routinely achieved in these bioreactor runs. Briefly, a small bacterial culture is grown overnight in “FERM”—in the absence of either antibiotic or exogenous thymidine. The overnight culture (@ ˜2 A600) is used to inoculate a bioreactor (10 L working volume, containing “FERM”) to an initial cell density of ˜0.2 A600. Biomass is built up in batch mode at 30° C. until the glycerol is exhausted (A600 ˜20), and then a fed batch phase is initiated utilizing glycerol as the limiting carbon source. At A600 ˜30, 0.2 g/L tryptophan is added to induce α(1,2) fucosyltransferase synthesis. An initial bolus of lactose is also added at this time. 5 hr later, a continuous slow feed of lactose is started in parallel to the glycerol feed. These conditions are continued for 48 hr (2′-FL production phase). At the end of this period, both the lactose and glycerol feeds are terminated, and the residual glycerol and lactose are consumed over a final fermentation period, prior to harvest. 2′-FL accumulates in the spent fermentation medium at concentrations as much as 30 times higher than in the cytoplasm. The specific yield in the spent medium varies between 10 and 50 g/L, depending on precise growth and induction conditions. FIG. 18 is a TLC of culture medium samples removed from a bioreactor at various times during a 2′-FL production run utilizing plasmid pG171 transformed into strain E403. All of the input lactose was converted to product by the end of the run, and product yield was approximately 25 g/L 2′-FL.
2′-FL purification from E. coli fermentation broth is accomplished though five steps:
Fermentation broth is harvested and cells removed by sedimentation in a preparative centrifuge at 6000×g for 30 min. Each bioreactor run yields about 5-7 L of partially clarified supernatant. Clarified supernatants have a brown/orange coloration attributed to a fraction of caramelized sugars produced during the course of the fermentation, particularly by side-reactions promoted by the ammonium ions present in the fermentation medium.
A column packed with coarse carbon (Calgon 12×40 TR) of ˜1000 ml volume (dimension 5 cm diameter×60 cm length) is equilibrated with 1 column volume (CV) of water and loaded with clarified culture supernatant at a flow rate of 40 ml/min. This column has a total capacity of about 120 g of sugar (lactose). Following loading and sugar capture, the column is washed with 1.5 CV of water, then eluted with 2.5 CV of 50% ethanol or 25% isopropanol (lower concentrations of ethanol at this step (25-30%) may be sufficient for product elution). This solvent elution step releases about 95% of the total bound sugars on the column and a small portion of the color bodies (caramels). In this first step capture of the maximal amount of sugar is the primary objective. Resolution of contaminants is not an objective. The column can be regenerated with a 5 CV wash with water.
A volume of 2.5 L of ethanol or isopropanol eluate from the capture column is rotary-evaporated at 56 C and a sugar syrup in water is generated (this typically is a yellow-brown color). Alternative methods that could be used for this step include lyophilization or spray-drying.
A column (GE Healthcare HiScale50/40, 5×40 cm, max pressure 20 bar) connected to a Biotage Isolera One FLASH Chromatography System is packed with 750 ml of a Darco Activated Carbon G60 (100-mesh): Celite 535 (coarse) 1:1 mixture (both column packings obtained from Sigma). The column is equilibrated with 5 CV of water and loaded with sugar from step 3 (10-50 g, depending on the ratio of 2′-FL to contaminating lactose), using either a celite loading cartridge or direct injection. The column is connected to an evaporative light scattering (ELSD) detector to detect peaks of eluting sugars during the chromatography. A four-step gradient of isopropanol, ethanol or methanol is run in order to separate 2′-FL from monosaccharides (if present), lactose and color bodies. e.g., for B=ethanol: Step 1, 2.5 CV 0% B; Step 2, 4 CV 10% B (elutes monosaccharides and lactose contaminants); step 3, 4 CV 25% B (Elutes 2′-FL); step 4, 5 CV 50% B (elutes some of the color bodies and partially regenerates the column) Additional column regeneration is achieved using methanol @ 50% and isopropanol @ 50%. Fractions corresponding to sugar peaks are collected automatically in 120-ml bottles, pooled and directed to step 5. In certain purification runs from longer-than-normal fermentations, passage of the 2′-FL-containing fraction through anion-exchange and cation exchange columns can remove excess protein/DNA/caramel body contaminants. Resins tested successfully for this purpose are Dowex 22 and Toyopearl Mono-Q, for the anion exchanger, and Dowex 88 for the cation exchanger. Mixed bed Dowex resins have proved unsuitable as they tend to adsorb sugars at high affinity via hydrophobic interactions. FIG. 19 illustrates the performance of Darco G60:celite 1:1 in separating lactose from 2′-fucoyllactose when used in Flash chromatography mode.
3.0 L of 25% B solvent fractions is rotary-evaporated at 56 C until dry. Clumps of solid sugar are re-dissolved in a minimum amount of water, the solution frozen, and then lyophilized A white, crystalline, sweet powder (2′-FL) is obtained at the end of the process. 2′-FL purity obtained lies between 95 and 99%.
Sugars are routinely analyzed for purity by spotting 1 μl aliquots on aluminum-backed silica G60 Thin Layer Chromatography plates (10×20 cm; Macherey-Nagel). A mixture of LDFT (Rf=0.18), 2′-FL (Rf=0.24), lactose (Rf=0.30), trehalose (Rf=0.32), acetyl-lactose (Rf=0.39) and fucose (Rf=0.48) (5 g/L concentration for each sugar) is run alongside as standards. The plates are developed in a 50% butanol:25% acetic acid:25% water solvent until the front is within 1 cm from the top. Improved sugar resolution can be obtained by performing two sequential runs, drying the plate between runs. Sugar spots are visualized by spraying with α-naphtol in a sulfuric acid-ethanol solution (2.4 g α-naphtol in 83% (v/v) ethanol, 10.5% (v/v) sulfuric acid) and heating at 120 C for a few minutes. High molecular weight contaminants (DNA, protein, caramels) remain at the origin, or form smears with Rfs lower than LDFT.
Any one of E. coli host strains E214, E390 or E403, when transformed with a plasmid expressing an α(1,3)fucosyltransferase capable of using lactose as the sugar acceptor substrate, will produce the human milk oligosaccharide product, 3-fucosyllactose (3FL). FIG. 9 illustrates the pathways utilized in engineered strains of E. coli of this invention to achieve production of 3FL. For example, the plasmid pG176 (ColE1, thyA+, bla+, PL2-futA, rcsA+) (SEQ ID NO: 2), is a derivative of pG175 in which the α(1,2) FT (wbsJ) sequence is replaced by the Helicobacter pylori futA gene (Dumon, C., Bosso, C., Utille, J. P., Heyraud, A. & Samain, E. Chembiochem 7, 359-365 (2006)). pG176 will direct the production of 3FL when transformed into any one of the host E. coli strains E214, E390 or E403. FIG. 11 shows a TLC analysis of 3FL production from E403 transformed with pG176. Additionally there are several other related bacterial-type α(1,3)-fucosyltransferases identified in Helicobacter pylori which could be used to direct synthesis of 3FL, e.g., “11639 FucTa” (Ge, Z., Chan, N. W., Palcic, M. M. & Taylor, D. E. J Biol Chem 272, 21357-21363 (1997); Martin, S. L., Edbrooke, M. R., Hodgman, T. C., van den Eijnden, D. H. & Bird, M. I. J Biol Chem 272, 21349-21356 (1997)) and “UA948 FucTa” (Rasko, D. A., Wang, G., Palcic, M. M. & Taylor, D. E. J Biol Chem 275, 4988-4994 (2000)). In addition to α(1,3)-fucosyltransferases from H. pylori, an α(1,3)fucosyltransferase (Hh0072, sequence accession AAP76669) isolated from Helicobacter hepaticus exhibits activity towards both non-sialylated and sialylated Type 2 oligosaccharide acceptor substrates (Zhang, L., Lau, K., Cheng, J., Yu, H., et al. Glycobiology (2010)). Furthermore, there are several additional bacterial α(1,3)-fucosyltransferases that may be used to make 3FL according to the methods of this invention. For example, close homologs of Hh0072 are found in H. H. bilis (HRAG_01092 gene, sequence accession EE024035), and in C. jejuni (C1336_000250319 gene, sequence accession EFC31050).
3FL biosynthesis is performed as described above for 2′-FL, either at small scale in culture tubes and culture flasks, or in a bioreactor (10 L working volume) utilizing control of dissolved oxygen, pH, lactose substrate, antifoam and carbon:nitrogen balance. Cell densities of A600 ˜100 are reached in the bioreactor, and specific 3FL yields of up to 3 g/L have been achieved. Approximately half of the 3FL produced is found in the culture supernatant, and half inside the cells. Purification of 3FL from E. coli culture supernatants is achieved using an almost identical procedure to that described above for 2′-FL. The only substantive difference being that 3FL elutes from carbon columns at lower alcohol concentrations than does 2′-FL.
E. coli strains E214, E390 and E403 accumulate cytoplasmic pools of both lactose and GDP-fucose, as discussed above, and when transformed with plasmids expressing either an α(1,2) fucosyltransferase or an α(1,3) fucosyltransferase can synthesize the human milk oligosaccharides 2′-FL or 3FL respectively. The tetrasaccharide lactodifucotetrose (LDFT) is another major fucosylated oligosaccharide found in human milk, and contains both α(1,2)- and α(1,3)-linked fucose residues. pG177 (FIG. 10, SEQ ID NO: 3) is a derivative of pG175 in which the wbsJ gene is replaced by a two gene operon comprising the Helicobacter pylori futA gene and the Helicobacter pylori futC gene (i.e., an operon containing both an α(1,3)- and α(1,2)-fucosyltransferase). E. coli strains E214, E390 and E403 produce LDFT when transformed with plasmid pG177 and grown, either in small scale or in the bioreactor, as described above. In FIG. 11 (lanes pG177), LDFT made in E. coli, directed by pG177, was observed on analysis of cell extracts by thin layer chromatography.
The first step in the production of 3′-sialyllactose (3′-SL) in E. coli is generation of a host background strain that accumulates cytoplasmic pools of both lactose and CMP-Neu5Ac (CMP-sialic acid). Accumulation of cytoplasmic lactose is achieved through growth on lactose and inactivation of the endogenous E. coli β-galactosidase gene (lacZ), being careful to minimize polarity effects on lacY, the lac permease. This accumulation of a lactose pool has already been accomplished and is described above in E. coli hosts engineered for 2′-FL, 3FL and LDFT production.
Specifically, a scheme to generate a cytoplasmic CMP-Neu5Ac pool, modified from methods known in the art, (e.g., Ringenberg, M., Lichtensteiger, C. & Vimr, E. Glycobiology 11, 533-539 (2001); Fierfort, N. & Samain, E. J Biotechnol 134, 261-265 (2008)), is shown in FIG. 5. Under this scheme, the E. coli K12 sialic acid catabolic pathway is first ablated through introduction of null mutations in endogenous nanA (N-acetylneuraminate lyase) and nanK (N-acetylmannosamine kinase) genes. By “sialic acid catabolic pathway” is meant a sequence of reactions, usually controlled and catalyzed by enzymes, which results in the degradation of sialic acid. An exemplary sialic acid catabolic pathway in Escherichia coli is set forth in FIG. 5. In the sialic acid catabolic pathway in FIG. 5, sialic acid (Neu5Ac; N-acetylneuraminic acid) is degraded by the enzymes NanA (N-acetylneuraminic acid lyase) and NanK (N-acetylmannosamine kinase). Other abbreviations for the sialic acid catabolic pathway in FIG. 5 include: (nanT) sialic acid transporter; (ΔnanA) mutated N-acetylneuraminic acid lyase; (ΔnanK) mutated N-acetylmannosamine kinase; (ManNAc-6-P) N-acetylmannosamine-6-phosphate; (GlcNAc-6-P) N-acetylglucosamine-6-phosphate; (GlcN-6-P) Glucosamine-6-phosphate; (Fruc-6-P) Fructose-6-phosphate; (neuA), CMP-N-acetylneuraminic acid synthetase; (CMP-Neu5Ac) CMP-N-acetylneuraminic acid; and (neuB), N-acetylneuraminic acid synthase.
Next, since E. coli K12 lacks a de novo sialic acid synthesis pathway, sialic acid synthetic capability is introduced through the provision of three recombinant enzymes; a UDP-GlcNAc 2-epimerase (e.g., neuC), a Neu5Ac synthase (e.g., neuB) and a CMP-Neu5Ac synthetase (e.g., neuA). Equivalent genes from C. jejuni, E. coli K1, H. influenzae or from N. meningitides can be utilized (interchangeably) for this purpose.
The addition of sialic acid to the 3′ position of lactose to generate 3′-sialyllactose is then achieved utilizing a bacterial-type α(2,3)sialyltransferase, and numerous candidate genes have been described, including those from N. meningitidis and N. gonorrhoeae (Gilbert, M., Watson, D. C., Cunningham, A. M., Jennings, M. P., et al. J Biol Chem 271, 28271-28276 (1996); Gilbert, M., Cunningham, A. M., Watson, D. C., Martin, A., et al. Eur J Biochem 249, 187-194 (1997)). The Neisseria enzymes are already known to use lactose as an acceptor sugar. The recombinant N. meningitidis enzyme generates 3′-sialyllactose in engineered E. coli (Fierfort, N. & Samain, E. J Biotechnol 134, 261-265 (2008)). FIG. 20 shows a TLC analysis of culture media taken from a culture of E. coli strain E547 (ampC::(PtrpBλcI+), PlacIq(ΔlacI-lacZ)158lacY+, ΔlacA, Δnan) and carrying plasmids expressing neuA,B,C and a bacterial-type α(2,3)sialyltransferase. The presence of 3′-sialyllactose (3′-SL) in the culture media is clearly seen.
Prior to the invention described herein, it was unpredictable that a combination of any particular fucosyltransferase gene and any particular sialyl-transferase gene in the same bacterial strain could produce 3′-S3FL. Described below are results demonstrating that the combination of a fucosyltransferase gene and a sialyl-transferase gene in the same LacZ+ E. coli strain resulted in the production of 3′-S3FL. These unexpected results are likely due to the surprisingly relaxed substrate specificity of the particular fucosyltransferase and sialyl-transferase enzymes utilized.
Humans synthesize the sialyl-Lewis X epitope utilizing different combinations of six α(1,3)fucosyl- and six α(2,3)sialyl-transferases encoded in the human genome (de Vries, T., Knegtel, R. M., Holmes, E. H. & Macher, B. A. Glycobiology 11, 119R-128R (2001); Taniguchi, A. Curr Drug Targets 9, 310-316 (2008)). These sugar transferases differ not only in their tissue expression patterns, but also in their acceptor specificities. For example, human myeloid-type α(1,3) fucosyltransferase (FUT IV) will fucosylate Type 2 (Galβ1->4Glc/GlcNAc) chain-based acceptors, but only if they are non-sialylated. In contrast “plasma-type” α(1,3) fucosyltransferase (FUT VI) will utilize Type 2 acceptors whether or not they are sialylated, and the promiscuous “Lewis” α(1,3/4) fucosyltransferase (FUT III), found in breast and kidney, will act on sialylated and non-sialylated Type 1 (Galβ1->3GlcNAc) and Type 2 acceptors (Easton, E. W., Schiphorst, W. E., van Drunen, E., van der Schoot, C. E. & van den Eijnden, D. H. Blood 81, 2978-2986 (1993)). A similar situation exists for the family of human□ α(2,3)sialyl-transferases, with different enzymes exhibiting major differences in acceptor specificity (Legaigneur, P., Breton, C., El Battari, A., Guillemot, J. C., et al. J Biol Chem 276, 21608-21617 (2001); Jeanneau, C., Chazalet, V., Augé, C., Soumpasis, D. M., et al. J Biol Chem 279, 13461-13468 (2004)). This diversity in acceptor specificity highlights a key issue in the synthesis of 3′-sialyl-3-fucosyllactose (3′-S3FL) in E. coli, i.e., to identify a suitable combination of fucosyl- and sialyl-transferases capable of acting cooperatively to synthesize 3′-S3FL (utilizing lactose as the initial acceptor sugar). However, since human and all other eukaryotic fucosyl- and sialyl-transferases are secreted proteins located in the lumen of the golgi, they are poorly suited for the task of 3′-S3FL biosynthesis in the bacterial cytoplasm.
Several bacterial pathogens are known to incorporate fucosylated and/or sialylated sugars into their cell envelopes, typically for reasons of host mimicry and immune evasion. For example; both Neisseria meningitides and Campylobacter jejuni are able to incorporate sialic acid through 2,3-linkages to galactose moieties in their capsular lipooligosaccharide (LOS) (Tsai, C. M., Kao, G. & Zhu, P. I Infection and Immunity 70, 407 (2002); Gilbert, M., Brisson, J. R., Karwaski, M. F., Michniewicz, J., et al. J Biol Chem 275, 3896-3906 (2000)), and some strains of E. coli incorporate α(1,2) fucose groups into lipopolysaccharide (LPS) (Li, M., Liu, X. W., Shao, J., Shen, J., et al. Biochemistry 47, 378-387 (2008); Li, M., Shen, J., Liu, X., Shao, J., et al. Biochemistry 47, 11590-11597 (2008)). Certain strains of Helicobacter pylori are able not only to incorporate α(2,3)-sialyl- groups, but also α(1,2)-, α(1,3)-, and α(1,4)-fucosyl- groups into LPS, and thus can display a broad range of human Lewis-type epitopes on their cell surface (Moran, A. P. Carbohydr Res 343, 1952-1965 (2008)). Most bacterial sialyl- and fucosyl-transferases operate in the cytoplasm, i.e., they are better suited to the methods described herein than are eukaryotic golgi-localized sugar transferases.
Strains of E. coli engineered to express the transferases described above accumulate a cytoplasmic pool of lactose, as well as an additional pool of either the nucleotide sugar GDP-fucose, or the nucleotide sugar CMP-Neu5Ac (CMP-sialic acid). Addition of these sugars to the lactose acceptor is performed in these engineered hosts using candidate recombinant α(1,3)-fucosyl- or α(2,3)-sialyl-transferases, generating 3-fucosyllactose and 3′-sialyllactose respectively. Finally, the two synthetic capabilities are combined into a single E. coli strain to produce 3′-S3FL.
An E. coli strain that accumulates cytoplasmic pools of both lactose and GDP-fucose has been developed. This strain, when transformed with a plasmid over-expressing an α(1,2)fucosyltransferase, produces 2′-fucosyllactose (2′-FL) at levels of ˜10-50 g/L of bacterial culture medium. A substitution of the α(1,2) fucosyltransferase in this host with an appropriate α(1,3) fucosyltransferase leads to the production of 3-fucosyllactose (3FL). The bacterial α(1,3) fucosyltransferase then works in conjunction with a bacterial α(2,3)sialyltransferase to make the desired product, 3′-S3FL.
An α(1,3)fucosyltransferase (Hh0072) isolated from Helicobacter hepaticus exhibits activity towards both non-sialylated and sialylated Type 2 oligosaccharide acceptor substrates (Zhang, L., Lau, K., Cheng, J., Yu, H., et al. Glycobiology (2010)). This enzyme is cloned, expressed, and evaluated to measure utilization of a lactose acceptor and to evaluate production of 3FL in the context of the current GDP-fucose-producing E. coli host. Hh0072 is also tested in concert with various bacterial α(2,3)sialyltransferases for its competence in 3′-S3FL synthesis. As alternatives to Hh0072, there are two characterized homologous bacterial-type 3-fucosyltransferases identified in Helicobacter pylori, “11639 FucTa” (Ge, Z., Chan, N. W., Palcic, M. M. & Taylor, D. E. J Biol Chem 272, 21357-21363 (1997); Martin, S. L., Edbrooke, M. R., Hodgman, T. C., van den Eijnden, D. H. & Bird, M. I. J Biol Chem 272, 21349-21356 (1997)) and “UA948 FucTa” (Rasko, D. A., Wang, G., Palcic, M. M. & Taylor, D. E. J Biol Chem 275, 4988-4994 (2000)). These two paralogs exhibit differing acceptor specificities, “11639 FucTa” utilizes only Type 2 acceptors and is a strict α(1,3)-fucosyltransferase, whereas “UA948 FucTa” has relaxed acceptor specificity (utilizing both Type 1 and Type 2 acceptors) and is able to generate both α(1,3)- and α(1,4)-fucosyl linkages. The precise molecular basis of this difference in specificity was determined (Ma, B., Lau, L. H., Palcic, M. M., Hazes, B. & Taylor, D. E. J Biol Chem 280, 36848-36856 (2005)), and characterization of several additional α(1,3)-fucosyltransferase paralogs from a variety of additional H. pylori strains revealed significant strain-to-strain acceptor specificity diversity.
In addition to the enzymes from H. pylori and H. hepaticus, other bacterial α(1,3)-fucosyltransferases are optionally used. For example, close homologs of Hh0072 are found in H. bilis (HRAG_01092 gene, sequence accession EEO24035), and in C. jejuni (C1336_000250319 gene, sequence accession EFC31050).
Described below is 3′-S3FL synthesis in E. coli. The first step towards this is to combine into a single E. coli strain the 3-fucosyllactose synthetic ability, outlined above, with the ability to make 3′-sialyllactose, also outlined above. All of the chromosomal genetic modifications discussed above are introduced into a new host strain, which will then simultaneously accumulate cytoplasmic pools of the 3 specific precursors; lactose, GDP-fucose and CMP-Neu5Ac. This “combined” strain background is then used to host simultaneous production of an α(1,3)fucosyltransferase with an α(2,3)sialyltransferase, with gene expression driven either off two compatible multicopy plasmids or with both enzyme genes positioned on the same plasmid as an artificial operon. Acceptor specificities for some of the bacterial α(1,3)fucosyltransferases and α(2,3)sialyltransferases, particularly with respect to fucosylation of 3′-sialyllactose and sialylation of 3-fucosyllactose and different combinations of α(1,3)fucosyltransferase and α(23)sialyltransferase enzymes are evaluated. Production levels and ratios of 3′-SL, 3FL and 3′-S3FL are monitored, e.g., by TLC, with confirmation of identity by NMR and accurate quantitation either by calibrated mass spectrometry utilizing specific ion monitoring, or by capillary electrophoresis (Bao, Y., Zhu, L. & Newburg, D. S. Simultaneous quantification of sialyloligosaccharides from human milk by capillary electrophoresis. Anal Biochem 370, 206-214 (2007)).
The sequences corresponding to the SEQ ID NOs described herein are provided below. The sequence of PG175 is set forth below (SEQ ID NO: 1):
| TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCA | |
| CAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTG | |
| TTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGC | |
| ACCATATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCG | |
| CCTCCTCAACCTGTATATTCGTAAACCACGCCCAATGGGAGCTGTCTCAGGTTTGTTCCT | |
| GATTGGTTACGGCGCGTTTCGCATCATTGTTGAGTTTTTCCGCCAGCCCGACGCGCAGTT | |
| TACCGGTGCCTGGGTGCAGTACATCAGCATGGGGCAAATTCTTTCCATCCCGATGATTGT | |
| CGCGGGTGTGATCATGATGGTCTGGGCATATCGTCGCAGCCCACAGCAACACGTTTCCTG | |
| AGGAACCATGAAACAGTATTTAGAACTGATGCAAAAAGTGCTCGACGAAGGCACACAGAA | |
| AAACGACCGTACCGGAACCGGAACGCTTTCCATTTTTGGTCATCAGATGCGTTTTAACCT | |
| GCAAGATGGATTCCCGCTGGTGACAACTAAACGTTGCCACCTGCGTTCCATCATCCATGA | |
| ACTGCTGTGGTTTCTGCAGGGCGACACTAACATTGCTTATCTACACGAAAACAATGTCAC | |
| CATCTGGGACGAATGGGCCGATGAAAACGGCGACCTCGGGCCAGTGTATGGTAAACAGTG | |
| GCGCGCCTGGCCAACGCCAGATGGTCGTCATATTGACCAGATCACTACGGTACTGAACCA | |
| GCTGAAAAACGACCCGGATTCGCGCCGCATTATTGTTTCAGCGTGGAACGTAGGCGAACT | |
| GGATAAAATGGCGCTGGCACCGTGCCATGCATTCTTCCAGTTCTATGTGGCAGACGGCAA | |
| ACTCTCTTGCCAGCTTTATCAGCGCTCCTGTGACGTCTTCCTCGGCCTGCCGTTCAACAT | |
| TGCCAGCTACGCGTTATTGGTGCATATGATGGCGCAGCAGTGCGATCTGGAAGTGGGTGA | |
| TTTTGTCTGGACCGGTGGCGACACGCATCTGTACAGCAACCATATGGATCAAACTCATCT | |
| GCAATTAAGCCGCGAACCGCGTCCGCTGCCGAAGTTGATTATCAAACGTAAACCCGAATC | |
| CATCTTCGACTACCGTTTCGAAGACTTTGAGATTGAAGGCTACGATCCGCATCCGGGCAT | |
| TAAAGCGCCGGTGGCTATCTAATTACGAAACATCCTGCCAGAGCCGACGCCAGTGTGCGT | |
| CGGTTTTTTTACCCTCCGTTAAATTCTTCGAGACGCCTTCCCGAAGGCGCCATTCGCCAT | |
| TCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGC | |
| TGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGT | |
| CACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTTCTTTAATGAAGCAGGGCATCAGGA | |
| CGGTATCTTTGTGGAGAAAGCAGAGTAATCTTATTCAGCCTGACTGGTGGGAAACCACCA | |
| GTCAGAATGTGTTAGCGCATGTTGACAAAAATACCATTAGTCACATTATCCGTCAGTCGG | |
| ACGACATGGTAGATAACCTGTTTATTATGCGTTTTGATCTTACGTTTAATATTACCTTTA | |
| TGCGATGAAACGGTCTTGGCTTTGATATTCATTTGGTCAGAGATTTGAATGGTTCCCTGA | |
| CCTGCCATCCACATTCGCAACATACTCGATTCGGTTCGGCTCAATGATAACGTCGGCATA | |
| TTTAAAAACGAGGTTATCGTTGTCTCTTTTTTCAGAATATCGCCAAGGATATCGTCGAGA | |
| GATTCCGGTTTAATCGATTTAGAACTGATCAATAAATTTTTTCTGACCAATAGATATTCA | |
| TCAAAATGAACATTGGCAATTGCCATAAAAACGATAAATAACGTATTGGGATGTTGATTA | |
| ATGATGAGCTTGATACGCTGACTGTTAGAAGCATCGTGGATGAAACAGTCCTCATTAATA | |
| AACACCACTGAAGGGCGCTGTGAATCACAAGCTATGGCAAGGTCATCAACGGTTTCAATG | |
| TCGTTGATTTCTCTTTTTTTAACCCCTCTACTCAACAGATACCCGGTTAAACCTAGTCGG | |
| GTGTAACTACATAAATCCATAATAATCGTTGACATGGCATACCCTCACTCAATGCGTAAC | |
| GATAATTCCCCTTACCTGAATATTTCATCATGACTAAACGGAACAACATGGGTCACCTAA | |
| TGCGCCACTCTCGCGATTTTTCAGGCGGACTTACTATCCCGTAAAGTGTTGTATAATTTG | |
| CCTGGAATTGTCTTAAAGTAAAGTAAATGTTGCGATATGTGAGTGAGCTTAAAACAAATA | |
| TTTCGCTGCAGGAGTATCCTGGAAGATGTTCGTAGAAGCTTACTGCTCACAAGAAAAAAG | |
| GCACGTCATCTGACGTGCCTTTTTTATTTGTACTACCCTGTACGATTACTGCAGCTCGAG | |
| TTATTATAATTTTACCCACGATTCGGGAATAATATCATGTTTAATATCTTTCTTAAACCA | |
| TTTACTCGGAGCAATTACTGTTTTATTTTTATTTTCATTTAACCAAGCAGCCCACCAACT | |
| GAAAGAACTATTTGAAATTATATTATTTTTACATTTACTCATAAGCAGCATATCTAATTC | |
| AACATGATAAGCATCACCTTGAACAAAACATATTTGATTATTAAAAAATATATTTTCCCT | |
| GCACCACTTTATATCATCAGAAAAAATGAAGAGAAGGGTTTTTTTATTAATAACACCTTT | |
| ATTCATCAAATAATCAATGGCACGTTCAAAATATTTTTCACTACATGTGCCATGAGTTTC | |
| ATTTGCTATTTTACTGGAAACATAATCACCTCTTCTAATATGTAATGAACAAGTATCATT | |
| TTCTTTAATTAAATTAAGCAATTCATTTTGATAACTATTAAACTTGGTTTTAGGTTGAAA | |
| TTCCTTTATCAACTCATGCCTAAATTCCTTAAAATATTTTTCAGTTTGAAAATAACCGAC | |
| GATTTTTTTATTTATACTTTTGGTATCAATATCTGGATCATACTCTAAACTTTTCTCAAC | |
| GTAATGCTTTCTGAACATTCCTTTTTTCATGAAATGTGGGATTTTTTCGGAAAATAAGTA | |
| TTTTTCAAATGGCCATGCTTTTTTTACAAATTCTGAACTACAAGATAATTCAACTAATCT | |
| TAATGGATGAGTTTTATATTTTACTGCATCAGATATATCAACAGTCAAATTTTGATGAGT | |
| TCTTTTTGCAATAGCAAATGCAGTTGCATACTGAAACATTTGATTACCAAGACCACCAAT | |
| AATTTTAACTTCCATATGTATATCTCCTTCTTCTAGAATTCTAAAAATTGATTGAATGTA | |
| TGCAAATAAATGCATACACCATAGGTGTGGTTTAATTTGATGCCCTTTTTCAGGGCTGGA | |
| ATGTGTAAGAGCGGGGTTATTTATGCTGTTGTTTTTTTGTTACTCGGGAAGGGCTTTACC | |
| TCTTCCGCATAAACGCTTCCATCAGCGTTTATAGTTAAAAAAATCTTTCGGAACTGGTTT | |
| TGCGCTTACCCCAACCAACAGGGGATTTGCTGCTTTCCATTGAGCCTGTTTCTCTGCGCG | |
| ACGTTCGCGGCGGCGTGTTTGTGCATCCATCTGGATTCTCCTGTCAGTTAGCTTTGGTGG | |
| TGTGTGGCAGTTGTAGTCCTGAACGAAAACCCCCCGCGATTGGCACATTGGCAGCTAATC | |
| CGGAATCGCACTTACGGCCAATGCTTCGTTTCGTATCACACACCCCAAAGCCTTCTGCTT | |
| TGAATGCTGCCCTTCTTCAGGGCTTAATTTTTAAGAGCGTCACCTTCATGGTGGTCAGTG | |
| CGTCCTGCTGATGTGCTCAGTATCACCGCCAGTGGTATTTATGTCAACACCGCCAGAGAT | |
| AATTTATCACCGCAGATGGTTATCTGTATGTTTTTTATATGAATTTATTTTTTGCAGGGG | |
| GGCATTGTTTGGTAGGTGAGAGATCAATTCTGCATTAATGAATCGGCCAACGCGCGGGGA | |
| GAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGG | |
| TCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAG | |
| AATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACC | |
| GTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACA | |
| AAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGT | |
| TTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACC | |
| TGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATC | |
| TCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGC | |
| CCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACT | |
| TATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTG | |
| CTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTA | |
| TCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCA | |
| AACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAA | |
| AAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACG | |
| AAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCC | |
| TTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTG | |
| ACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCAT | |
| CCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTG | |
| GCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAA | |
| TAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCA | |
| TCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGC | |
| GCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTT | |
| CATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAA | |
| AAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTAT | |
| CACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCT | |
| TTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGA | |
| GTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAG | |
| TGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGA | |
| GATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCA | |
| CCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGG | |
| CGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATC | |
| AGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAG | |
| GGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCA | |
| TGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC |
The sequence of pG176 is set forth below (SEQ ID NO: 2):
| TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAG | |
| CGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATG | |
| CGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAA | |
| ATACCGCATCAGGCGCCATGAAACAGTATTTAGAACTGATGCAAAAAGTGCTCGACGAAGGCACACAGAAAAACG | |
| ACCGTACCGGAACCGGAACGCTTTCCATTTTTGGTCATCAGATGCGTTTTAACCTGCAAGATGGATTCCCGCTGG | |
| TGACAACTAAACGTTGCCACCTGCGTTCCATCATCCATGAACTGCTGTGGTTTCTGCAGGGCGACACTAACATTG | |
| CTTATCTACACGAAAACAATGTCACCATCTGGGACGAATGGGCCGATGAAAACGGCGACCTCGGGCCAGTGTATG | |
| GTAAACAGTGGCGCGCCTGGCCAACGCCAGATGGTCGTCATATTGACCAGATCACTACGGTACTGAACCAGCTGA | |
| AAAACGACCCGGATTCGCGCCGCATTATTGTTTCAGCGTGGAACGTAGGCGAACTGGATAAAATGGCGCTGGCAC | |
| CGTGCCATGCATTCTTCCAGTTCTATGTGGCAGACGGCAAACTCTCTTGCCAGCTTTATCAGCGCTCCTGTGACG | |
| TCTTCCTCGGCCTGCCGTTCAACATTGCCAGCTACGCGTTATTGGTGCATATGATGGCGCAGCAGTGCGATCTGG | |
| AAGTGGGTGATTTTGTCTGGACCGGTGGCGACACGCATCTGTACAGCAACCATATGGATCAAACTCATCTGCAAT | |
| TAAGCCGCGAACCGCGTCCGCTGCCGAAGTTGATTATCAAACGTAAACCCGAATCCATCTTCGACTACCGTTTCG | |
| AAGACTTTGAGATTGAAGGCTACGATCCGCATCCGGGCATTAAAGCGCCGGTGGCTATCTAAGGCGCCATTCGCC | |
| ATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGG | |
| ATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGC | |
| CAAGCTTTCTTTAATGAAGCAGGGCATCAGGACGGTATCTTTGTGGAGAAAGCAGAGTAATCTTATTCAGCCTGA | |
| CTGGTGGGAAACCACCAGTCAGAATGTGTTAGCGCATGTTGACAAAAATACCATTAGTCACATTATCCGTCAGTC | |
| GGACGACATGGTAGATAACCTGTTTATTATGCGTTTTGATCTTACGTTTAATATTACCTTTATGCGATGAAACGG | |
| TCTTGGCTTTGATATTCATTTGGTCAGAGATTTGAATGGTTCCCTGACCTGCCATCCACATTCGCAACATACTCG | |
| ATTCGGTTCGGCTCAATGATAACGTCGGCATATTTAAAAACGAGGTTATCGTTGTCTCTTTTTTCAGAATATCGC | |
| CAAGGATATCGTCGAGAGATTCCGGTTTAATCGATTTAGAACTGATCAATAAATTTTTTCTGACCAATAGATATT | |
| CATCAAAATGAACATTGGCAATTGCCATAAAAACGATAAATAACGTATTGGGATGTTGATTAATGATGAGCTTGA | |
| TACGCTGACTGTTAGAAGCATCGTGGATGAAACAGTCCTCATTAATAAACACCACTGAAGGGCGCTGTGAATCAC | |
| AAGCTATGGCAAGGTCATCAACGGTTTCAATGTCGTTGATTTCTCTTTTTTTAACCCCTCTACTCAACAGATACC | |
| CGGTTAAACCTAGTCGGGTGTAACTACATAAATCCATAATAATCGTTGACATGGCATACCCTCACTCAATGCGTA | |
| ACGATAATTCCCCTTACCTGAATATTTCATCATGACTAAACGGAACAACATGGGTCACCTAATGCGCCACTCTCG | |
| CGATTTTTCAGGCGGACTTACTATCCCGTAAAGTGTTGTATAATTTGCCTGGAATTGTCTTAAAGTAAAGTAAAT | |
| GTTGCGATATGTGAGTGAGCTTAAAACAAATATTTCGCTGCAGGAGTATCCTGGAAGATGTTCGTAGAAGCTTAC | |
| TGCTCACAAGAAAAAAGGCACGTCATCTGACGTGCCTTTTTTATTTGTACTACCCTGTACGATTACTGCAGCTCG | |
| AGTTAATTCAAATCTTCTTCAGAAATCAATTTTTGTTCCAAACCCAATTTTTTAACCAACTTTCTCACCGCGCGC | |
| AACAAAGGCAAGGATTTTTGATAAGCTTTGCGATAGATTTTAAAAGTGGTGTTTTGAGAGAGTTCTAATAAAGGC | |
| GAAGCGTTTTGTAAAAGCCGGTCATAATTAACCCTCAAATCATCATAATTAACCCTCAAATCATCAATGGATACT | |
| AACGGCTTATGCAGATCGTACTCCCACATGAAAGATGTTGAGAATTTGTGATAAATCGTATCGTTTTCTAAAATC | |
| GTTTTAAAAAAATCTAGGATTTTTTTAAAACTCAAATCTTGGTAAAAGTAAGCTTTCCCATCAAGGGTGTTTAAA | |
| GGGTTTTCATAGAGCATGTCTAAATAAGCGTTTGGGTGCGTGTGCAGGTATTTGATATAATCAATCGCTTCATCA | |
| AAGTTGTTGAAATCATGCACATTCACAAAACTTTTAGGGTTAAAATCTTTCGCCACGCTGGGACTCCCCCAATAA | |
| ATAGGAATGGTATGGCTAAAATACGCATCAAGGATTTTTTCGGTTACATAGCCATAACCTTGCGAGTTTTCAAAA | |
| CAGAGATTGAACTTGTATTGGCTTAAAAACTCGCTTTTGTTTCCAACCTTATAGCCTAAAGTGTTTCTCACACTT | |
| CCTCCCCCAGTAACTGGCTCTATGGAATTTAGAGCGTCATAAAAAGCGTTCCTCATAGGAGCGTTAGCGTTGCTC | |
| GCTACAAAACTGGCAAACCCTCTTTTTAAAAGATCGCTCTCATCATTCACTACTGCGCACAAATTAGGGTGGTTT | |
| TCTTTAAAATGATGAGAGGGTTTTTTTAAAGCATAAAGGCTGTTGTCTTTGAGTTTGTAGGGCGCAGTGGTGTCA | |
| TTAACAAGCTCGGCTTTATAGTGCAAATGGGCATAATACAAAGGCATTCTCAAATAACGATCATTAAAATCCAAT | |
| TCATCAAAGCCTATGGCGTAATCAAAGAGGTTGAAATTAGGTGATTCGTTTTCACCGGTGTAAAACACTCGTTTA | |
| GTGTTTTGATAAGATAAAATCTTTCTAGCCGCTCCAAGAGGATTGCTAAAAACTAGATCTGAAAATTCATTGGGG | |
| TTTTGGTGGAGGGTGATTGCGTAGCGTTGGCTTAGGATAAAATAAAGAACGCTCTTTTTAAATTCTTTAATTTCT | |
| TCATCTCCCCACCAATTCGCCACAGCGATTTTTAGGGGGGGGGGGGGAGATTTAGAGGCCATTTTTTCAATGGAA | |
| GCGCTTTCTATAAAGGCGTCTAATAGGGGTTGGAACATATGTATATCTCCTTCTTGAATTCTAAAAATTGATTGA | |
| ATGTATGCAAATAAATGCATACACCATAGGTGTGGTTTAATTTGATGCCCTTTTTCAGGGCTGGAATGTGTAAGA | |
| GCGGGGTTATTTATGCTGTTGTTTTTTTGTTACTCGGGAAGGGCTTTACCTCTTCCGCATAAACGCTTCCATCAG | |
| CGTTTATAGTTAAAAAAATCTTTCGGAACTGGTTTTGCGCTTACCCCAACCAACAGGGGATTTGCTGCTTTCCAT | |
| TGAGCCTGTTTCTCTGCGCGACGTTCGCGGCGGCGTGTTTGTGCATCCATCTGGATTCTCCTGTCAGTTAGCTTT | |
| GGTGGTGTGTGGCAGTTGTAGTCCTGAACGAAAACCCCCCGCGATTGGCACATTGGCAGCTAATCCGGAATCGCA | |
| CTTACGGCCAATGCTTCGTTTCGTATCACACACCCCAAAGCCTTCTGCTTTGAATGCTGCCCTTCTTCAGGGCTT | |
| AATTTTTAAGAGCGTCACCTTCATGGTGGTCAGTGCGTCCTGCTGATGTGCTCAGTATCACCGCCAGTGGTATTT | |
| ATGTCAACACCGCCAGAGATAATTTATCACCGCAGATGGTTATCTGTATGTTTTTTATATGAATTTATTTTTTGC | |
| AGGGGGGCATTGTTTGGTAGGTGAGAGATCAATTCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTT | |
| GCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATC | |
| AGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGG | |
| CCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCA | |
| TCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGG | |
| AAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAG | |
| CGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGT | |
| GCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACA | |
| CGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTT | |
| CTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTAC | |
| CTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAA | |
| GCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTG | |
| GAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTA | |
| AAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGA | |
| GGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGAT | |
| ACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATC | |
| AGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTAT | |
| TAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGG | |
| CATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATG | |
| ATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGT | |
| GTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGAC | |
| TGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACG | |
| GGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTC | |
| AAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTAC | |
| TTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAA | |
| ATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATA | |
| CATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGT | |
| CTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC |
The sequence of pG177 is set forth below (SEQ ID NO: 3):
| TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAG | |
| CGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATG | |
| CGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAA | |
| ATACCGCATCAGGCGCCATGAAACAGTATTTAGAACTGATGCAAAAAGTGCTCGACGAAGGCACACAGAAAAACG | |
| ACCGTACCGGAACCGGAACGCTTTCCATTTTTGGTCATCAGATGCGTTTTAACCTGCAAGATGGATTCCCGCTGG | |
| TGACAACTAAACGTTGCCACCTGCGTTCCATCATCCATGAACTGCTGTGGTTTCTGCAGGGCGACACTAACATTG | |
| CTTATCTACACGAAAACAATGTCACCATCTGGGACGAATGGGCCGATGAAAACGGCGACCTCGGGCCAGTGTATG | |
| GTAAACAGTGGCGCGCCTGGCCAACGCCAGATGGTCGTCATATTGACCAGATCACTACGGTACTGAACCAGCTGA | |
| AAAACGACCCGGATTCGCGCCGCATTATTGTTTCAGCGTGGAACGTAGGCGAACTGGATAAAATGGCGCTGGCAC | |
| CGTGCCATGCATTCTTCCAGTTCTATGTGGCAGACGGCAAACTCTCTTGCCAGCTTTATCAGCGCTCCTGTGACG | |
| TCTTCCTCGGCCTGCCGTTCAACATTGCCAGCTACGCGTTATTGGTGCATATGATGGCGCAGCAGTGCGATCTGG | |
| AAGTGGGTGATTTTGTCTGGACCGGTGGCGACACGCATCTGTACAGCAACCATATGGATCAAACTCATCTGCAAT | |
| TAAGCCGCGAACCGCGTCCGCTGCCGAAGTTGATTATCAAACGTAAACCCGAATCCATCTTCGACTACCGTTTCG | |
| AAGACTTTGAGATTGAAGGCTACGATCCGCATCCGGGCATTAAAGCGCCGGTGGCTATCTAAGGCGCCATTCGCC | |
| ATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGG | |
| ATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGC | |
| CAAGCTTTCTTTAATGAAGCAGGGCATCAGGACGGTATCTTTGTGGAGAAAGCAGAGTAATCTTATTCAGCCTGA | |
| CTGGTGGGAAACCACCAGTCAGAATGTGTTAGCGCATGTTGACAAAAATACCATTAGTCACATTATCCGTCAGTC | |
| GGACGACATGGTAGATAACCTGTTTATTATGCGTTTTGATCTTACGTTTAATATTACCTTTATGCGATGAAACGG | |
| TCTTGGCTTTGATATTCATTTGGTCAGAGATTTGAATGGTTCCCTGACCTGCCATCCACATTCGCAACATACTCG | |
| ATTCGGTTCGGCTCAATGATAACGTCGGCATATTTAAAAACGAGGTTATCGTTGTCTCTTTTTTCAGAATATCGC | |
| CAAGGATATCGTCGAGAGATTCCGGTTTAATCGATTTAGAACTGATCAATAAATTTTTTCTGACCAATAGATATT | |
| CATCAAAATGAACATTGGCAATTGCCATAAAAACGATAAATAACGTATTGGGATGTTGATTAATGATGAGCTTGA | |
| TACGCTGACTGTTAGAAGCATCGTGGATGAAACAGTCCTCATTAATAAACACCACTGAAGGGCGCTGTGAATCAC | |
| AAGCTATGGCAAGGTCATCAACGGTTTCAATGTCGTTGATTTCTCTTTTTTTAACCCCTCTACTCAACAGATACC | |
| CGGTTAAACCTAGTCGGGTGTAACTACATAAATCCATAATAATCGTTGACATGGCATACCCTCACTCAATGCGTA | |
| ACGATAATTCCCCTTACCTGAATATTTCATCATGACTAAACGGAACAACATGGGTCACCTAATGCGCCACTCTCG | |
| CGATTTTTCAGGCGGACTTACTATCCCGTAAAGTGTTGTATAATTTGCCTGGAATTGTCTTAAAGTAAAGTAAAT | |
| GTTGCGATATGTGAGTGAGCTTAAAACAAATATTTCGCTGCAGGAGTATCCTGGAAGATGTTCGTAGAAGCTTAC | |
| TGCTCACAAGAAAAAAGGCACGTCATCTGACGTGCCTTTTTTATTTGTACTACCCTGTACGATTACTGCAGCTCG | |
| AGTTAATTCAAATCTTCTTCAGAAATCAATTTTTGTTCAGCGTTATACTTTTGGGATTTTACCTCAAAATGGGAT | |
| TCTATTTTCACCCACTCCTTACAAAGGATATTCTCATGCCCAAAAAGCCAGTGTTTGGGGCCAATAATGATTTTT | |
| TCTGGATTTTCTATCAAATAGGCCGCCCACCAGCTATAAGTGCTATTAGCGATAATGCCATGCTGACAAGATTGC | |
| ATGAGCAGCATGTCCCAATACGCCTCTTCTTCTTTATCCCTAGTGGTCATGTCCATAAAAGGGTAGCCAAGATCA | |
| AGATTTTGCGTGAATTCTAAGTCTTCGCAAAACACAAAAAGCTCCATGTTTGGCACGCGCTTTGCCATATACTCA | |
| AGCGCCTTTTTTTGATAGTCAATACCAAGCTGACAGCCAATCCCCACATAATCCCCTCTTCTTATATGCACAAAC | |
| ACGCTGTTTTTAGCGGCTAAAATCAAAGAAAGCTTGCACTGATATTCTTCCTCTTTTTTATTATTATTCTTATTA | |
| TTTTCGGGTGGTGGTGGTAGAGTGAAGGTTTGCTTGATTAAAGGGGATATAGCATCAAAGTATCGTGGATCTTGG | |
| AAATAGCCAAAAAAATAAGTCAAGCGGCTTGGCTTTAGCAATTTAGGCTCGTATTCAAAAACGATTTCTTGACTC | |
| ACCCTATCAAATCCCATGCATTTGAGCGCGTCTCTTACTAGCTTGGGGAGGTGTTGCATTTTAGCTATAGCGATT | |
| TCTTTCGCGCTCGCATAGGGCAAATCAATAGGGAAAAGTTCTAATTGCATTTTCCTATCGCTCCAATCAAAAGAA | |
| GTGATATCTAACAGCACAGGCGTATTAGAGTGTTTTTGCAAACTTTTAGCGAAAGCGTATTGAAACATTTGATTC | |
| CCAAGCCCTCCGCAAATTTGCACCACCTTAAAAGCCATATGTATATCTCCTTCTTGCTCGAGTTAATTCAAATCT | |
| TCTTCAGAAATCAATTTTTGTTCCAAACCCAATTTTTTAACCAACTTTCTCACCGCGCGCAACAAAGGCAAGGAT | |
| TTTTGATAAGCTTTGCGATAGATTTTAAAAGTGGTGTTTTGAGAGAGTTCTAATAAAGGCGAAGCGTTTTGTAAA | |
| AGCCGGTCATAATTAACCCTCAAATCATCATAATTAACCCTCAAATCATCAATGGATACTAACGGCTTATGCAGA | |
| TCGTACTCCCACATGAAAGATGTTGAGAATTTGTGATAAATCGTATCGTTTTCTAAAATCGTTTTAAAAAAATCT | |
| AGGATTTTTTTAAAACTCAAATCTTGGTAAAAGTAAGCTTTCCCATCAAGGGTGTTTAAAGGGTTTTCATAGAGC | |
| ATGTCTAAATAAGCGTTTGGGTGCGTGTGCAGGTATTTGATATAATCAATCGCTTCATCAAAGTTGTTGAAATCA | |
| TGCACATTCACAAAACTTTTAGGGTTAAAATCTTTCGCCACGCTGGGACTCCCCCAATAAATAGGAATGGTATGG | |
| CTAAAATACGCATCAAGGATTTTTTCGGTTACATAGCCATAACCTTGCGAGTTTTCAAAACAGAGATTGAACTTG | |
| TATTGGCTTAAAAACTCGCTTTTGTTTCCAACCTTATAGCCTAAAGTGTTTCTCACACTTCCTCCCCCAGTAACT | |
| GGCTCTATGGAATTTAGAGCGTCATAAAAAGCGTTCCTCATAGGAGCGTTAGCGTTGCTCGCTACAAAACTGGCA | |
| AACCCTCTTTTTAAAAGATCGCTCTCATCATTCACTACTGCGCACAAATTAGGGTGGTTTTCTTTAAAATGATGA | |
| GAGGGTTTTTTTAAAGCATAAAGGCTGTTGTCTTTGAGTTTGTAGGGCGCAGTGGTGTCATTAACAAGCTCGGCT | |
| TTATAGTGCAAATGGGCATAATACAAAGGCATTCTCAAATAACGATCATTAAAATCCAATTCATCAAAGCCTATG | |
| GCGTAATCAAAGAGGTTGAAATTAGGTGATTCGTTTTCACCGGTGTAAAACACTCGTTTAGTGTTTTGATAAGAT | |
| AAAATCTTTCTAGCCGCTCCAAGAGGATTGCTAAAAACTAGATCTGAAAATTCATTGGGGTTTTGGTGGAGGGTG | |
| ATTGCGTAGCGTTGGCTTAGGATAAAATAAAGAACGCTCTTTTTAAATTCTTTAATTTCTTCATCTCCCCACCAA | |
| TTCGCCACAGCGATTTTTAGGGGGGGGGGGGGAGATTTAGAGGCCATTTTTTCAATGGAAGCGCTTTCTATAAAG | |
| GCGTCTAATAGGGGTTGGAACATATGTATATCTCCTTCTTGAATTCTAAAAATTGATTGAATGTATGCAAATAAA | |
| TGCATACACCATAGGTGTGGTTTAATTTGATGCCCTTTTTCAGGGCTGGAATGTGTAAGAGCGGGGTTATTTATG | |
| CTGTTGTTTTTTTGTTACTCGGGAAGGGCTTTACCTCTTCCGCATAAACGCTTCCATCAGCGTTTATAGTTAAAA | |
| AAATCTTTCGGAACTGGTTTTGCGCTTACCCCAACCAACAGGGGATTTGCTGCTTTCCATTGAGCCTGTTTCTCT | |
| GCGCGACGTTCGCGGCGGCGTGTTTGTGCATCCATCTGGATTCTCCTGTCAGTTAGCTTTGGTGGTGTGTGGCAG | |
| TTGTAGTCCTGAACGAAAACCCCCCGCGATTGGCACATTGGCAGCTAATCCGGAATCGCACTTACGGCCAATGCT | |
| TCGTTTCGTATCACACACCCCAAAGCCTTCTGCTTTGAATGCTGCCCTTCTTCAGGGCTTAATTTTTAAGAGCGT | |
| CACCTTCATGGTGGTCAGTGCGTCCTGCTGATGTGCTCAGTATCACCGCCAGTGGTATTTATGTCAACACCGCCA | |
| GAGATAATTTATCACCGCAGATGGTTATCTGTATGTTTTTTATATGAATTTATTTTTTGCAGGGGGGCATTGTTT | |
| GGTAGGTGAGAGATCAATTCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTC | |
| TTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGC | |
| GGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAG | |
| GAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACG | |
| CTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCG | |
| CTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCA | |
| TAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGT | |
| TCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACT | |
| GGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCC | |
| TAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGT | |
| TGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCG | |
| CAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACG | |
| TTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAA | |
| ATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGC | |
| GATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACC | |
| ATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCC | |
| AGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGA | |
| AGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACG | |
| CTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTG | |
| CAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGT | |
| TATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAAC | |
| CAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCC | |
| ACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCT | |
| GTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTC | |
| TGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCAT | |
| ACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTAT | |
| TTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTAT | |
| TATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC |
The sequence of Bacteroides fragilis NCTC 9343 wcfW CDS DNA is set for the below (SEQ ID NO: 4):
| ATGATTGTATCATCTTTGCGAGGAGGATTGGGGAATCAAATGTTTATTTAC |
| GCTATGGTGAAGGCCATGGCATTAAGAAACAATGTACCATTCGCTTTTAAT |
| TTGACTACTGATTTTGCAAATGATGAAGTTTATAAAAGGAAACTTTTATTA |
| TCATATTTTGCATTAGACTTGCCTGAAAATAAAAAATTAACATTTGATTTT |
| TCATATGGGAATTATTATAGAAGGCTAAGTCGTAATTTAGGTTGTCATATA |
| CTTCATCCATCATATCGTTATATTTGCGAAGAGCGCCCTCCCCACTTTGAA |
| TCAAGGTTAATTAGTTCTAAGATTACAAATGCTTTTCTGGAAGGATATTGG |
| CAGTCAGAAAAATATTTTCTTGATTATAAACAAGAGATAAAAGAGGACTTT |
| GTAATACAAAAAAAATTAGAATACACATCGTATTTGGAATTGGAAGAAATA |
| AAATTGCTAGATAAGAATGCCATAATGATTGGGGTTAGACGGTATCAGGAA |
| AGTGATGTAGCTCCTGGTGGAGTGTTAGAAGATGATTACTATAAATGTGCT |
| ATGGATATTATGGCATCAAAAGTTACTTCTCCTGTTTTCTTTTGTTTTTCA |
| CAAGATTTAGAATGGGTTGAAAAACATCTAGCGGGAAAATATCCTGTTCGT |
| TTGATAAGTAAAAAGGAGGATGATAGTGGTACTATAGATGATATGTTTCTA |
| ATGATGCATTTTCGTAATTATATAATATCGAATAGCTCTTTTTACTGGTGG |
| GGAGCATGGCTTTCGAAATATGATGATAAGCTGGTGATTGCTCCAGGTAAT |
| TTTATAAATAAGGATTCTGTACCAGAATCTTGGTTTAAATTGAATGTAAGA |
| TAA |
The sequence of pG171 is set forth below (SEQ ID NO: 5):
| TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCA | |
| CAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTG | |
| TTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGC | |
| ACCATATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCG | |
| CCTCCTCAACCTGTATATTCGTAAACCACGCCCAATGGGAGCTGTCTCAGGTTTGTTCCT | |
| GATTGGTTACGGCGCGTTTCGCATCATTGTTGAGTTTTTCCGCCAGCCCGACGCGCAGTT | |
| TACCGGTGCCTGGGTGCAGTACATCAGCATGGGGCAAATTCTTTCCATCCCGATGATTGT | |
| CGCGGGTGTGATCATGATGGTCTGGGCATATCGTCGCAGCCCACAGCAACACGTTTCCTG | |
| AGGAACCATGAAACAGTATTTAGAACTGATGCAAAAAGTGCTCGACGAAGGCACACAGAA | |
| AAACGACCGTACCGGAACCGGAACGCTTTCCATTTTTGGTCATCAGATGCGTTTTAACCT | |
| GCAAGATGGATTCCCGCTGGTGACAACTAAACGTTGCCACCTGCGTTCCATCATCCATGA | |
| ACTGCTGTGGTTTCTGCAGGGCGACACTAACATTGCTTATCTACACGAAAACAATGTCAC | |
| CATCTGGGACGAATGGGCCGATGAAAACGGCGACCTCGGGCCAGTGTATGGTAAACAGTG | |
| GCGCGCCTGGCCAACGCCAGATGGTCGTCATATTGACCAGATCACTACGGTACTGAACCA | |
| GCTGAAAAACGACCCGGATTCGCGCCGCATTATTGTTTCAGCGTGGAACGTAGGCGAACT | |
| GGATAAAATGGCGCTGGCACCGTGCCATGCATTCTTCCAGTTCTATGTGGCAGACGGCAA | |
| ACTCTCTTGCCAGCTTTATCAGCGCTCCTGTGACGTCTTCCTCGGCCTGCCGTTCAACAT | |
| TGCCAGCTACGCGTTATTGGTGCATATGATGGCGCAGCAGTGCGATCTGGAAGTGGGTGA | |
| TTTTGTCTGGACCGGTGGCGACACGCATCTGTACAGCAACCATATGGATCAAACTCATCT | |
| GCAATTAAGCCGCGAACCGCGTCCGCTGCCGAAGTTGATTATCAAACGTAAACCCGAATC | |
| CATCTTCGACTACCGTTTCGAAGACTTTGAGATTGAAGGCTACGATCCGCATCCGGGCAT | |
| TAAAGCGCCGGTGGCTATCTAATTACGAAACATCCTGCCAGAGCCGACGCCAGTGTGCGT | |
| CGGTTTTTTTACCCTCCGTTAAATTCTTCGAGACGCCTTCCCGAAGGCGCCATTCGCCAT | |
| TCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGC | |
| TGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGT | |
| CACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTTCTTTAATGAAGCAGGGCATCAGGA | |
| CGGTATCTTTGTGGAGAAAGCAGAGTAATCTTATTCAGCCTGACTGGTGGGAAACCACCA | |
| GTCAGAATGTGTTAGCGCATGTTGACAAAAATACCATTAGTCACATTATCCGTCAGTCGG | |
| ACGACATGGTAGATAACCTGTTTATTATGCGTTTTGATCTTACGTTTAATATTACCTTTA | |
| TGCGATGAAACGGTCTTGGCTTTGATATTCATTTGGTCAGAGATTTGAATGGTTCCCTGA | |
| CCTGCCATCCACATTCGCAACATACTCGATTCGGTTCGGCTCAATGATAACGTCGGCATA | |
| TTTAAAAACGAGGTTATCGTTGTCTCTTTTTTCAGAATATCGCCAAGGATATCGTCGAGA | |
| GATTCCGGTTTAATCGATTTAGAACTGATCAATAAATTTTTTCTGACCAATAGATATTCA | |
| TCAAAATGAACATTGGCAATTGCCATAAAAACGATAAATAACGTATTGGGATGTTGATTA | |
| ATGATGAGCTTGATACGCTGACTGTTAGAAGCATCGTGGATGAAACAGTCCTCATTAATA | |
| AACACCACTGAAGGGCGCTGTGAATCACAAGCTATGGCAAGGTCATCAACGGTTTCAATG | |
| TCGTTGATTTCTCTTTTTTTAACCCCTCTACTCAACAGATACCCGGTTAAACCTAGTCGG | |
| GTGTAACTACATAAATCCATAATAATCGTTGACATGGCATACCCTCACTCAATGCGTAAC | |
| GATAATTCCCCTTACCTGAATATTTCATCATGACTAAACGGAACAACATGGGTCACCTAA | |
| TGCGCCACTCTCGCGATTTTTCAGGCGGACTTACTATCCCGTAAAGTGTTGTATAATTTG | |
| CCTGGAATTGTCTTAAAGTAAAGTAAATGTTGCGATATGTGAGTGAGCTTAAAACAAATA | |
| TTTCGCTGCAGGAGTATCCTGGAAGATGTTCGTAGAAGCTTACTGCTCACAAGAAAAAAG | |
| GCACGTCATCTGACGTGCCTTTTTTATTTGTACTACCCTGTACGATTACTGCAGCTCGAG | |
| TTTAATTCAAATCTTCTTCAGAAATCAATTTTTGTTCAGCGTTATACTTTTGGGATTTTA | |
| CCTCAAAATGGGATTCTATTTTCACCCACTCCTTACAAAGGATATTCTCATGCCCAAAAA | |
| GCCAGTGTTTGGGGCCAATAATGATTTTTTCTGGATTTTCTATCAAATAGGCCGCCCACC | |
| AGCTATAAGTGCTATTAGCGATAATGCCATGCTGACAAGATTGCATGAGCAGCATGTCCC | |
| AATACGCCTCTTCTTCTTTATCCCTAGTGGTCATGTCCATAAAAGGGTAGCCAAGATCAA | |
| GATTTTGCGTGAATTCTAAGTCTTCGCAAAACACAAAAAGCTCCATGTTTGGCACGCGCT | |
| TTGCCATATACTCAAGCGCCTTTTTTTGATAGTCAATACCAAGCTGACAGCCAATCCCCA | |
| CATAATCCCCTCTTCTTATATGCACAAACACGCTGTTTTTAGCGGCTAAAATCAAAGAAA | |
| GCTTGCACTGATATTCTTCCTCTTTTTTATTATTATTCTTATTATTTTCGGGTGGTGGTG | |
| GTAGAGTGAAGGTTTGCTTGATTAAAGGGGATATAGCATCAAAGTATCGTGGATCTTGGA | |
| AATAGCCAAAAAAATAAGTCAAGCGGCTTGGCTTTAGCAATTTAGGCTCGTATTCAAAAA | |
| CGATTTCTTGACTCACCCTATCAAATCCCATGCATTTGAGCGCGTCTCTTACTAGCTTGG | |
| GGAGGTGTTGCATTTTAGCTATAGCGATTTCTTTCGCGCTCGCATAGGGCAAATCAATAG | |
| GGAAAAGTTCTAATTGCATTTTCCTATCGCTCCAATCAAAAGAAGTGATATCTAACAGCA | |
| CAGGCGTATTAGAGTGTTTTTGCAAACTTTTAGCGAAAGCGTATTGAAACATTTGATTCC | |
| CAAGCCCTCCGCAAATTTGCACCACCTTAAAAGCCATATGTATATCTCCTTCTTGAATTC | |
| TAAAAATTGATTGAATGTATGCAAATAAATGCATACACCATAGGTGTGGTTTAATTTGAT | |
| GCCCTTTTTCAGGGCTGGAATGTGTAAGAGCGGGGTTATTTATGCTGTTGTTTTTTTGTT | |
| ACTCGGGAAGGGCTTTACCTCTTCCGCATAAACGCTTCCATCAGCGTTTATAGTTAAAAA | |
| AATCTTTCGGAACTGGTTTTGCGCTTACCCCAACCAACAGGGGATTTGCTGCTTTCCATT | |
| GAGCCTGTTTCTCTGCGCGACGTTCGCGGCGGCGTGTTTGTGCATCCATCTGGATTCTCC | |
| TGTCAGTTAGCTTTGGTGGTGTGTGGCAGTTGTAGTCCTGAACGAAAACCCCCCGCGATT | |
| GGCACATTGGCAGCTAATCCGGAATCGCACTTACGGCCAATGCTTCGTTTCGTATCACAC | |
| ACCCCAAAGCCTTCTGCTTTGAATGCTGCCCTTCTTCAGGGCTTAATTTTTAAGAGCGTC | |
| ACCTTCATGGTGGTCAGTGCGTCCTGCTGATGTGCTCAGTATCACCGCCAGTGGTATTTA | |
| TGTCAACACCGCCAGAGATAATTTATCACCGCAGATGGTTATCTGTATGTTTTTTATATG | |
| AATTTATTTTTTGCAGGGGGGCATTGTTTGGTAGGTGAGAGATCAATTCTGCATTAATGA | |
| ATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTC | |
| ACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCG | |
| GTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGC | |
| CAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGC | |
| CCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGA | |
| CTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACC | |
| CTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAT | |
| AGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG | |
| CACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCC | |
| AACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGA | |
| GCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACT | |
| AGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTT | |
| GGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAG | |
| CAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGG | |
| TCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAA | |
| AGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATA | |
| TATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCG | |
| ATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATA | |
| CGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCG | |
| GCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCT | |
| GCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGT | |
| TCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGC | |
| TCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGA | |
| TCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGT | |
| AAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTC | |
| ATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAA | |
| TAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCA | |
| CATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCA | |
| AGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCT | |
| TCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCC | |
| GCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAA | |
| TATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATT | |
| TAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTC | |
| TAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTT | |
| CGTC |
The sequence of pG180 is set forth below (SEQ ID NO: 6):
| TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCA | |
| CAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTG | |
| TTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGC | |
| ACCATATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCG | |
| CCTCCTCAACCTGTATATTCGTAAACCACGCCCAATGGGAGCTGTCTCAGGTTTGTTCCT | |
| GATTGGTTACGGCGCGTTTCGCATCATTGTTGAGTTTTTCCGCCAGCCCGACGCGCAGTT | |
| TACCGGTGCCTGGGTGCAGTACATCAGCATGGGGCAAATTCTTTCCATCCCGATGATTGT | |
| CGCGGGTGTGATCATGATGGTCTGGGCATATCGTCGCAGCCCACAGCAACACGTTTCCTG | |
| AGGAACCATGAAACAGTATTTAGAACTGATGCAAAAAGTGCTCGACGAAGGCACACAGAA | |
| AAACGACCGTACCGGAACCGGAACGCTTTCCATTTTTGGTCATCAGATGCGTTTTAACCT | |
| GCAAGATGGATTCCCGCTGGTGACAACTAAACGTTGCCACCTGCGTTCCATCATCCATGA | |
| ACTGCTGTGGTTTCTGCAGGGCGACACTAACATTGCTTATCTACACGAAAACAATGTCAC | |
| CATCTGGGACGAATGGGCCGATGAAAACGGCGACCTCGGGCCAGTGTATGGTAAACAGTG | |
| GCGCGCCTGGCCAACGCCAGATGGTCGTCATATTGACCAGATCACTACGGTACTGAACCA | |
| GCTGAAAAACGACCCGGATTCGCGCCGCATTATTGTTTCAGCGTGGAACGTAGGCGAACT | |
| GGATAAAATGGCGCTGGCACCGTGCCATGCATTCTTCCAGTTCTATGTGGCAGACGGCAA | |
| ACTCTCTTGCCAGCTTTATCAGCGCTCCTGTGACGTCTTCCTCGGCCTGCCGTTCAACAT | |
| TGCCAGCTACGCGTTATTGGTGCATATGATGGCGCAGCAGTGCGATCTGGAAGTGGGTGA | |
| TTTTGTCTGGACCGGTGGCGACACGCATCTGTACAGCAACCATATGGATCAAACTCATCT | |
| GCAATTAAGCCGCGAACCGCGTCCGCTGCCGAAGTTGATTATCAAACGTAAACCCGAATC | |
| CATCTTCGACTACCGTTTCGAAGACTTTGAGATTGAAGGCTACGATCCGCATCCGGGCAT | |
| TAAAGCGCCGGTGGCTATCTAATTACGAAACATCCTGCCAGAGCCGACGCCAGTGTGCGT | |
| CGGTTTTTTTACCCTCCGTTAAATTCTTCGAGACGCCTTCCCGAAGGCGCCATTCGCCAT | |
| TCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGC | |
| TGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGT | |
| CACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTTCTTTAATGAAGCAGGGCATCAGGA | |
| CGGTATCTTTGTGGAGAAAGCAGAGTAATCTTATTCAGCCTGACTGGTGGGAAACCACCA | |
| GTCAGAATGTGTTAGCGCATGTTGACAAAAATACCATTAGTCACATTATCCGTCAGTCGG | |
| ACGACATGGTAGATAACCTGTTTATTATGCGTTTTGATCTTACGTTTAATATTACCTTTA | |
| TGCGATGAAACGGTCTTGGCTTTGATATTCATTTGGTCAGAGATTTGAATGGTTCCCTGA | |
| CCTGCCATCCACATTCGCAACATACTCGATTCGGTTCGGCTCAATGATAACGTCGGCATA | |
| TTTAAAAACGAGGTTATCGTTGTCTCTTTTTTCAGAATATCGCCAAGGATATCGTCGAGA | |
| GATTCCGGTTTAATCGATTTAGAACTGATCAATAAATTTTTTCTGACCAATAGATATTCA | |
| TCAAAATGAACATTGGCAATTGCCATAAAAACGATAAATAACGTATTGGGATGTTGATTA | |
| ATGATGAGCTTGATACGCTGACTGTTAGAAGCATCGTGGATGAAACAGTCCTCATTAATA | |
| AACACCACTGAAGGGCGCTGTGAATCACAAGCTATGGCAAGGTCATCAACGGTTTCAATG | |
| TCGTTGATTTCTCTTTTTTTAACCCCTCTACTCAACAGATACCCGGTTAAACCTAGTCGG | |
| GTGTAACTACATAAATCCATAATAATCGTTGACATGGCATACCCTCACTCAATGCGTAAC | |
| GATAATTCCCCTTACCTGAATATTTCATCATGACTAAACGGAACAACATGGGTCACCTAA | |
| TGCGCCACTCTCGCGATTTTTCAGGCGGACTTACTATCCCGTAAAGTGTTGTATAATTTG | |
| CCTGGAATTGTCTTAAAGTAAAGTAAATGTTGCGATATGTGAGTGAGCTTAAAACAAATA | |
| TTTCGCTGCAGGAGTATCCTGGAAGATGTTCGTAGAAGCTTACTGCTCACAAGAAAAAAG | |
| GCACGTCATCTGACGTGCCTTTTTTATTTGTACTACCCTGTACGATTACTGCAGCTCGAG | |
| TTTAATTCAAATCTTCTTCAGAAATCAATTTTTGTTCTCTTACATTCAATTTAAACCAAG | |
| ATTCTGGTACAGAATCCTTATTTATAAAATTACCTGGAGCAATCACCAGCTTATCATCAT | |
| ATTTCGAAAGCCATGCTCCCCACCAGTAAAAAGAGCTATTCGATATTATATAATTACGAA | |
| AATGCATCATTAGAAACATATCATCTATAGTACCACTATCATCCTCCTTTTTACTTATCA | |
| AACGAACAGGATATTTTCCCGCTAGATGTTTTTCAACCCATTCTAAATCTTGTGAAAAAC | |
| AAAAGAAAACAGGAGAAGTAACTTTTGATGCCATAATATCCATAGCACATTTATAGTAAT | |
| CATCTTCTAACACTCCACCAGGAGCTACATCACTTTCCTGATACCGTCTAACCCCAATCA | |
| TTATGGCATTCTTATCTAGCAATTTTATTTCTTCCAATTCCAAATACGATGTGTATTCTA | |
| ATTTTTTTTGTATTACAAAGTCCTCTTTTATCTCTTGTTTATAATCAAGAAAATATTTTT | |
| CTGACTGCCAATATCCTTCCAGAAAAGCATTTGTAATCTTAGAACTAATTAACCTTGATT | |
| CAAAGTGGGGAGGGCGCTCTTCGCAAATATAACGATATGATGGATGAAGTATATGACAAC | |
| CTAAATTACGACTTAGCCTTCTATAATAATTCCCATATGAAAAATCAAATGTTAATTTTT | |
| TATTTTCAGGCAAGTCTAATGCAAAATATGATAATAAAAGTTTCCTTTTATAAACTTCAT | |
| CATTTGCAAAATCAGTAGTCAAATTAAAAGCGAATGGTACATTGTTTCTTAATGCCATGG | |
| CCTTCACCATAGCGTAAATAAACATTTGATTCCCCAATCCTCCTCGCAAAGATGATACAA | |
| TCATATGTATATCTCCTTCTTGTCTAGAATTCTAAAAATTGATTGAATGTATGCAAATAA | |
| ATGCATACACCATAGGTGTGGTTTAATTTGATGCCCTTTTTCAGGGCTGGAATGTGTAAG | |
| AGCGGGGTTATTTATGCTGTTGTTTTTTTGTTACTCGGGAAGGGCTTTACCTCTTCCGCA | |
| TAAACGCTTCCATCAGCGTTTATAGTTAAAAAAATCTTTCGGAACTGGTTTTGCGCTTAC | |
| CCCAACCAACAGGGGATTTGCTGCTTTCCATTGAGCCTGTTTCTCTGCGCGACGTTCGCG | |
| GCGGCGTGTTTGTGCATCCATCTGGATTCTCCTGTCAGTTAGCTTTGGTGGTGTGTGGCA | |
| GTTGTAGTCCTGAACGAAAACCCCCCGCGATTGGCACATTGGCAGCTAATCCGGAATCGC | |
| ACTTACGGCCAATGCTTCGTTTCGTATCACACACCCCAAAGCCTTCTGCTTTGAATGCTG | |
| CCCTTCTTCAGGGCTTAATTTTTAAGAGCGTCACCTTCATGGTGGTCAGTGCGTCCTGCT | |
| GATGTGCTCAGTATCACCGCCAGTGGTATTTATGTCAACACCGCCAGAGATAATTTATCA | |
| CCGCAGATGGTTATCTGTATGTTTTTTATATGAATTTATTTTTTGCAGGGGGGCATTGTT | |
| TGGTAGGTGAGAGATCAATTCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTT | |
| TGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGC | |
| TGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGG | |
| ATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGG | |
| CCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGAC | |
| GCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTG | |
| GAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCT | |
| TTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGG | |
| TGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCT | |
| GCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCAC | |
| TGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGT | |
| TCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTC | |
| TGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCA | |
| CCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGAT | |
| CTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCAC | |
| GTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATT | |
| AAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACC | |
| AATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTG | |
| CCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTG | |
| CTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGC | |
| CAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTA | |
| TTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTG | |
| TTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCT | |
| CCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTA | |
| GCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGG | |
| TTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGA | |
| CTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTT | |
| GCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCA | |
| TTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTT | |
| CGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTT | |
| CTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGA | |
| AATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATT | |
| GTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGC | |
| GCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAA | |
| CCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC |
The sequence of W3110 deltalon::Kan::lacZ with RBS Escherichia coli str. K-12 substr. W3110 is set forth below (SEQ ID NO: 7):
| GTCCATGGAAGACGTCGAAAAAGTGGTTATCGACGAGTCGGTAATTGATGGTCAAAGCAA | |
| ACCGTTGCTGATTTATGGCAAGCCGGAAGCGCAACAGGCATCTGGTGAATAATTAACCAT | |
| TCCCATACAATTAGTTAACCAAAAAGGGGGGATTTTATCTCCCCTTTAATTTTTCCTCTA | |
| TTCTCGGCGTTGAATGTGGGGGAAACATCCCCATATACTGACGTACATGTTAATAGATGG | |
| CGTGAAGCACAGTCGTGTCATCTGATTACCTGGCGGAAATTAAACTAAGAGAGAGCTCTA | |
| TGATTCCGGGGATCCGTCGACCTGCAGTTCGAAGTTCCTATTCTCTAGAAAGTATAGGAA | |
| CTTCAGAGCGCTTTTGAAGCTCACGCTGCCGCAAGCACTCAGGGCGCAAGGGCTGCTAAA | |
| GGAAGCGGAACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCA | |
| GCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCA | |
| GTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAAT | |
| TGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTT | |
| TCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCTGATCAAGAGACAGGATGAG | |
| GATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGG | |
| AGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGT | |
| TCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCC | |
| TGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTT | |
| GCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAG | |
| TGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGG | |
| CTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAG | |
| CGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATG | |
| ATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGC | |
| GCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCA | |
| TGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACC | |
| GCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGG | |
| CTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCT | |
| ATCGCCTTCTTGACGAGTTCTTCTAATAAGGGGATCTTGAAGTTCCTATTCCGAAGTTCC | |
| TATTCTCTAGAAAGTATAGGAACTTCGAAGCAGCTCCAGCCTACATAAAGCGGCCGCTTA | |
| TTTTTGACACCAGACCAACTGGTAATGGTAGCGACCGGCGCTCAGCTGGAATTCCGCCGA | |
| TACTGACGGGCTCCAGGAGTCGTCGCCACCAATCCCCATATGGAAACCGTCGATATTCAG | |
| CCATGTGCCTTCTTCCGCGTGCAGCAGATGGCGATGGCTGGTTTCCATCAGTTGCTGTTG | |
| ACTGTAGCGGCTGATGTTGAACTGGAAGTCGCCGCGCCACTGGTGTGGGCCATAATTCAA | |
| TTCGCGCGTCCCGCAGCGCAGACCGTTTTCGCTCGGGAAGACGTACGGGGTATACATGTC | |
| TGACAATGGCAGATCCCAGCGGTCAAAACAGGCGGCAGTAAGGCGGTCGGGATAGTTTTC | |
| TTGCGGCCCTAATCCGAGCCAGTTTACCCGCTCTGCTACCTGCGCCAGCTGGCAGTTCAG | |
| GCCAATCCGCGCCGGATGCGGTGTATCGCTCGCCACTTCAACATCAACGGTAATCGCCAT | |
| TTGACCACTACCATCAATCCGGTAGGTTTTCCGGCTGATAAATAAGGTTTTCCCCTGATG | |
| CTGCCACGCGTGAGCGGTCGTAATCAGCACCGCATCAGCAAGTGTATCTGCCGTGCACTG | |
| CAACAACGCTGCTTCGGCCTGGTAATGGCCCGCCGCCTTCCAGCGTTCGACCCAGGCGTT | |
| AGGGTCAATGCGGGTCGCTTCACTTACGCCAATGTCGTTATCCAGCGGTGCACGGGTGAA | |
| CTGATCGCGCAGCGGCGTCAGCAGTTGTTTTTTATCGCCAATCCACATCTGTGAAAGAAA | |
| GCCTGACTGGCGGTTAAATTGCCAACGCTTATTACCCAGCTCGATGCAAAAATCCATTTC | |
| GCTGGTGGTCAGATGCGGGATGGCGTGGGACGCGGCGGGGAGCGTCACACTGAGGTTTTC | |
| CGCCAGACGCCACTGCTGCCAGGCGCTGATGTGCCCGGCTTCTGACCATGCGGTCGCGTT | |
| CGGTTGCACTACGCGTACTGTGAGCCAGAGTTGCCCGGCGCTCTCCGGCTGCGGTAGTTC | |
| AGGCAGTTCAATCAACTGTTTACCTTGTGGAGCGACATCCAGAGGCACTTCACCGCTTGC | |
| CAGCGGCTTACCATCCAGCGCCACCATCCAGTGCAGGAGCTCGTTATCGCTATGACGGAA | |
| CAGGTATTCGCTGGTCACTTCGATGGTTTGCCCGGATAAACGGAACTGGAAAAACTGCTG | |
| CTGGTGTTTTGCTTCCGTCAGCGCTGGATGCGGCGTGCGGTCGGCAAAGACCAGACCGTT | |
| CATACAGAACTGGCGATCGTTCGGCGTATCGCCAAAATCACCGCCGTAAGCCGACCACGG | |
| GTTGCCGTTTTCATCATATTTAATCAGCGACTGATCCACCCAGTCCCAGACGAAGCCGCC | |
| CTGTAAACGGGGATACTGACGAAACGCCTGCCAGTATTTAGCGAAACCGCCAAGACTGTT | |
| ACCCATCGCGTGGGCGTATTCGCAAAGGATCAGCGGGCGCGTCTCTCCAGGTAGCGAAAG | |
| CCATTTTTTGATGGACCATTTCGGCACAGCCGGGAAGGGCTGGTCTTCATCCACGCGCGC | |
| GTACATCGGGCAAATAATATCGGTGGCCGTGGTGTCGGCTCCGCCGCCTTCATACTGCAC | |
| CGGGCGGGAAGGATCGACAGATTTGATCCAGCGATACAGCGCGTCGTGATTAGCGCCGTG | |
| GCCTGATTCATTCCCCAGCGACCAGATGATCACACTCGGGTGATTACGATCGCGCTGCAC | |
| CATTCGCGTTACGCGTTCGCTCATCGCCGGTAGCCAGCGCGGATCATCGGTCAGACGATT | |
| CATTGGCACCATGCCGTGGGTTTCAATATTGGCTTCATCCACCACATACAGGCCGTAGCG | |
| GTCGCACAGCGTGTACCACAGCGGATGGTTCGGATAATGCGAACAGCGCACGGCGTTAAA | |
| GTTGTTCTGCTTCATCAGCAGGATATCCTGCACCATCGTCTGCTCATCCATGACCTGACC | |
| ATGCAGAGGATGATGCTCGTGACGGTTAACGCCTCGAATCAGCAACGGCTTGCCGTTCAG | |
| CAGCAGCAGACCATTTTCAATCCGCACCTCGCGGAAACCGACATCGCAGGCTTCTGCTTC | |
| AATCAGCGTGCCGTCGGCGGTGTGCAGTTCAACCACCGCACGATAGAGATTCGGGATTTC | |
| GGCGCTCCACAGTTTCGGGTTTTCGACGTTCAGACGTAGTGTGACGCGATCGGCATAACC | |
| ACCACGCTCATCGATAATTTCACCGCCGAAAGGCGCGGTGCCGCTGGCGACCTGCGTTTC | |
| ACCCTGCCATAAAGAAACTGTTACCCGTAGGTAGTCACGCAACTCGCCGCACATCTGAAC | |
| TTCAGCCTCCAGTACAGCGCGGCTGAAATCATCATTAAAGCGAGTGGCAACATGGAAATC | |
| GCTGATTTGTGTAGTCGGTTTATGCAGCAACGAGACGTCACGGAAAATGCCGCTCATCCG | |
| CCACATATCCTGATCTTCCAGATAACTGCCGTCACTCCAGCGCAGCACCATCACCGCGAG | |
| GCGGTTTTCTCCGGCGCGTAAAAATGCGCTCAGGTCAAATTCAGACGGCAAACGACTGTC | |
| CTGGCCGTAACCGACCCAGCGCCCGTTGCACCACAGATGAAACGCCGAGTTAACGCCATC | |
| AAAAATAATTCGCGTCTGGCCTTCCTGTAGCCAGCTTTCATCAACATTAAATGTGAGCGA | |
| GTAACAACCCGTCGGATTCTCCGTGGGAACAAACGGCGGATTGACCGTAATGGGATAGGT | |
| CACGTTGGTGTAGATGGGCGCATCGTAACCGTGCATCTGCCAGTTTGAGGGGACGACGAC | |
| AGTATCGGCCTCAGGAAGATCGCACTCCAGCCAGCTTTCCGGCACCGCTTCTGGTGCCGG | |
| AAACCAGGCAAAGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGT | |
| GCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG | |
| TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATCCGT | |
| AATCATGGTCATAGTAGGTTTCCTCAGGTTGTGACTGCAAAATAGTGACCTCGCGCAAAA | |
| TGCACTAATAAAAACAGGGCTGGCAGGCTAATTCGGGCTTGCCAGCCTTTTTTTGTCTCG | |
| CTAAGTTAGATGGCGGATCGGGCTTGCCCTTATTAAGGGGTGTTGTAAGGGGATGGCTGG | |
| CCTGATATAACTGCTGCGCGTTCGTACCTTGAAGGATTCAAGTGCGATATAAATTATAAA | |
| GAGGAAGAGAAGAGTGAATAAATCTCAATTGATCGACAAGATTGCTGCAGGGGCTGATAT | |
| CTCTAAAGCTGCGGCTGGCCGTGCGTTAGATGCTATTATTGCTTCCGTAACTGAATCTCT | |
| GAAAGAAGG |
The sequence of pG186 is set forth below (SEQ ID NO: 8):
| TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCA | |
| CAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTG | |
| TTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGC | |
| ACCATATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCG | |
| CCTCCTCAACCTGTATATTCGTAAACCACGCCCAATGGGAGCTGTCTCAGGTTTGTTCCT | |
| GATTGGTTACGGCGCGTTTCGCATCATTGTTGAGTTTTTCCGCCAGCCCGACGCGCAGTT | |
| TACCGGTGCCTGGGTGCAGTACATCAGCATGGGGCAAATTCTTTCCATCCCGATGATTGT | |
| CGCGGGTGTGATCATGATGGTCTGGGCATATCGTCGCAGCCCACAGCAACACGTTTCCTG | |
| AGGAACCATGAAACAGTATTTAGAACTGATGCAAAAAGTGCTCGACGAAGGCACACAGAA | |
| AAACGACCGTACCGGAACCGGAACGCTTTCCATTTTTGGTCATCAGATGCGTTTTAACCT | |
| GCAAGATGGATTCCCGCTGGTGACAACTAAACGTTGCCACCTGCGTTCCATCATCCATGA | |
| ACTGCTGTGGTTTCTGCAGGGCGACACTAACATTGCTTATCTACACGAAAACAATGTCAC | |
| CATCTGGGACGAATGGGCCGATGAAAACGGCGACCTCGGGCCAGTGTATGGTAAACAGTG | |
| GCGCGCCTGGCCAACGCCAGATGGTCGTCATATTGACCAGATCACTACGGTACTGAACCA | |
| GCTGAAAAACGACCCGGATTCGCGCCGCATTATTGTTTCAGCGTGGAACGTAGGCGAACT | |
| GGATAAAATGGCGCTGGCACCGTGCCATGCATTCTTCCAGTTCTATGTGGCAGACGGCAA | |
| ACTCTCTTGCCAGCTTTATCAGCGCTCCTGTGACGTCTTCCTCGGCCTGCCGTTCAACAT | |
| TGCCAGCTACGCGTTATTGGTGCATATGATGGCGCAGCAGTGCGATCTGGAAGTGGGTGA | |
| TTTTGTCTGGACCGGTGGCGACACGCATCTGTACAGCAACCATATGGATCAAACTCATCT | |
| GCAATTAAGCCGCGAACCGCGTCCGCTGCCGAAGTTGATTATCAAACGTAAACCCGAATC | |
| CATCTTCGACTACCGTTTCGAAGACTTTGAGATTGAAGGCTACGATCCGCATCCGGGCAT | |
| TAAAGCGCCGGTGGCTATCTAATTACGAAACATCCTGCCAGAGCCGACGCCAGTGTGCGT | |
| CGGTTTTTTTACCCTCCGTTAAATTCTTCGAGACGCCTTCCCGAAGGCGCCATTCGCCAT | |
| TCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGC | |
| TGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGT | |
| CACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTTCTTTAATGAAGCAGGGCATCAGGA | |
| CGGTATCTTTGTGGAGAAAGCAGAGTAATCTTATTCAGCCTGACTGGTGGGAAACCACCA | |
| GTCAGAATGTGTTAGCGCATGTTGACAAAAATACCATTAGTCACATTATCCGTCAGTCGG | |
| ACGACATGGTAGATAACCTGTTTATTATGCGTTTTGATCTTACGTTTAATATTACCTTTA | |
| TGCGATGAAACGGTCTTGGCTTTGATATTCATTTGGTCAGAGATTTGAATGGTTCCCTGA | |
| CCTGCCATCCACATTCGCAACATACTCGATTCGGTTCGGCTCAATGATAACGTCGGCATA | |
| TTTAAAAACGAGGTTATCGTTGTCTCTTTTTTCAGAATATCGCCAAGGATATCGTCGAGA | |
| GATTCCGGTTTAATCGATTTAGAACTGATCAATAAATTTTTTCTGACCAATAGATATTCA | |
| TCAAAATGAACATTGGCAATTGCCATAAAAACGATAAATAACGTATTGGGATGTTGATTA | |
| ATGATGAGCTTGATACGCTGACTGTTAGAAGCATCGTGGATGAAACAGTCCTCATTAATA | |
| AACACCACTGAAGGGCGCTGTGAATCACAAGCTATGGCAAGGTCATCAACGGTTTCAATG | |
| TCGTTGATTTCTCTTTTTTTAACCCCTCTACTCAACAGATACCCGGTTAAACCTAGTCGG | |
| GTGTAACTACATAAATCCATAATAATCGTTGACATGGCATACCCTCACTCAATGCGTAAC | |
| GATAATTCCCCTTACCTGAATATTTCATCATGACTAAACGGAACAACATGGGTCACCTAA | |
| TGCGCCACTCTCGCGATTTTTCAGGCGGACTTACTATCCCGTAAAGTGTTGTATAATTTG | |
| CCTGGAATTGTCTTAAAGTAAAGTAAATGTTGCGATATGTGAGTGAGCTTAAAACAAATA | |
| TTTCGCTGCAGGAGTATCCTGGAAGATGTTCGTAGAAGCTTACTGCTCACAAGAAAAAAG | |
| GCACGTCATCTGACGTGCCTTTTTTATTTGTACTACCCTGTACGATTACTGCAGCTCGAG | |
| TTAGTCTTTATCTGCCGGACTTAAGGTCACTGAAGAGAGATAATTCAGCAGGGCGATATC | |
| GTTCTCGACACCCAGCTTCATCATCGCAGATTTCTTCTGGCTACTGATGGTTTTAATACT | |
| GCGGTTCAGCTTTTTAGCGATCTCGGTCACCAGGAAGCCTTCCGCAAACAGGCGCAGAAC | |
| TTCACTCTCTTTTGGCGAGAGACGCTTGTCACCGTAACCACCAGCACTGATTTTTTCCAA | |
| CAGGCGAGAAACGCTTTCCGGGGTAAATTTCTTCCCTTTCTGCAGCGCGGCGAGAGCTTT | |
| CGGCAGATCGGTCGGTGCACCTTGTTTCAGCACGATCCCTTCGATATCCAGATCCAATAC | |
| CGCACTAAGAATCGCCGGGTTGTTGTTCATAGTCAGAACAATGATCGACAGGCTTGGGAA | |
| ATGGCGCTTGATGTACTTGATTAAGGTAATGCCATCGCCGTACTTATCGCCAGGCATGGA | |
| GAGATCGGTAATCAACACATGCGCATCCAGTTTCGGCAGGTTGTTGATCAGTGCTGTAGA | |
| GTCTTCAAATTCGCCGACAACATTCACCCACTCAATTTGCTCAAGTGATTTGCGAATACC | |
| GAACAAGACTATCGGATGGTCATCGGCAATAATTACGTTCATATTGTTCATTGTATATCT | |
| CCTTCTTCTCGAGTTTAATTCAAATCTTCTTCAGAAATCAATTTTTGTTCAGCGTTATAC | |
| TTTTGGGATTTTACCTCAAAATGGGATTCTATTTTCACCCACTCCTTACAAAGGATATTC | |
| TCATGCCCAAAAAGCCAGTGTTTGGGGCCAATAATGATTTTTTCTGGATTTTCTATCAAA | |
| TAGGCCGCCCACCAGCTATAAGTGCTATTAGCGATAATGCCATGCTGACAAGATTGCATG | |
| AGCAGCATGTCCCAATACGCCTCTTCTTCTTTATCCCTAGTGGTCATGTCCATAAAAGGG | |
| TAGCCAAGATCAAGATTTTGCGTGAATTCTAAGTCTTCGCAAAACACAAAAAGCTCCATG | |
| TTTGGCACGCGCTTTGCCATATACTCAAGCGCCTTTTTTTGATAGTCAATACCAAGCTGA | |
| CAGCCAATCCCCACATAATCCCCTCTTCTTATATGCACAAACACGCTGTTTTTAGCGGCT | |
| AAAATCAAAGAAAGCTTGCACTGATATTCTTCCTCTTTTTTATTATTATTCTTATTATTT | |
| TCGGGTGGTGGTGGTAGAGTGAAGGTTTGCTTGATTAAAGGGGATATAGCATCAAAGTAT | |
| CGTGGATCTTGGAAATAGCCAAAAAAATAAGTCAAGCGGCTTGGCTTTAGCAATTTAGGC | |
| TCGTATTCAAAAACGATTTCTTGACTCACCCTATCAAATCCCATGCATTTGAGCGCGTCT | |
| CTTACTAGCTTGGGGAGGTGTTGCATTTTAGCTATAGCGATTTCTTTCGCGCTCGCATAG | |
| GGCAAATCAATAGGGAAAAGTTCTAATTGCATTTTCCTATCGCTCCAATCAAAAGAAGTG | |
| ATATCTAACAGCACAGGCGTATTAGAGTGTTTTTGCAAACTTTTAGCGAAAGCGTATTGA | |
| AACATTTGATTCCCAAGCCCTCCGCAAATTTGCACCACCTTAAAAGCCATATGTATATCT | |
| CCTTCTTGAATTCTAAAAATTGATTGAATGTATGCAAATAAATGCATACACCATAGGTGT | |
| GGTTTAATTTGATGCCCTTTTTCAGGGCTGGAATGTGTAAGAGCGGGGTTATTTATGCTG | |
| TTGTTTTTTTGTTACTCGGGAAGGGCTTTACCTCTTCCGCATAAACGCTTCCATCAGCGT | |
| TTATAGTTAAAAAAATCTTTCGGAACTGGTTTTGCGCTTACCCCAACCAACAGGGGATTT | |
| GCTGCTTTCCATTGAGCCTGTTTCTCTGCGCGACGTTCGCGGCGGCGTGTTTGTGCATCC | |
| ATCTGGATTCTCCTGTCAGTTAGCTTTGGTGGTGTGTGGCAGTTGTAGTCCTGAACGAAA | |
| ACCCCCCGCGATTGGCACATTGGCAGCTAATCCGGAATCGCACTTACGGCCAATGCTTCG | |
| TTTCGTATCACACACCCCAAAGCCTTCTGCTTTGAATGCTGCCCTTCTTCAGGGCTTAAT | |
| TTTTAAGAGCGTCACCTTCATGGTGGTCAGTGCGTCCTGCTGATGTGCTCAGTATCACCG | |
| CCAGTGGTATTTATGTCAACACCGCCAGAGATAATTTATCACCGCAGATGGTTATCTGTA | |
| TGTTTTTTATATGAATTTATTTTTTGCAGGGGGGCATTGTTTGGTAGGTGAGAGATCAAT | |
| TCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTC | |
| CGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGC | |
| TCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACAT | |
| GTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTT | |
| CCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCG | |
| AAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTC | |
| TCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGT | |
| GGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAA | |
| GCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTA | |
| TCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAA | |
| CAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAA | |
| CTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTT | |
| CGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTT | |
| TTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGAT | |
| CTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCAT | |
| GAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATC | |
| AATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGC | |
| ACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTA | |
| GATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGA | |
| CCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCG | |
| CAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGC | |
| TAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCAT | |
| CGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAG | |
| GCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGAT | |
| CGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAA | |
| TTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAA | |
| GTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGA | |
| TAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGG | |
| GCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGC | |
| ACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGG | |
| AAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACT | |
| CTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACAT | |
| ATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGT | |
| GCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTAT | |
| CACGAGGCCCTTTCGTC |
While the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
The patent and scientific literature referred to herein establishes the knowledge that is available to those with skill in the art. All United States patents and published or unpublished United States patent applications cited herein are incorporated by reference. All published foreign patents and patent applications cited herein are hereby incorporated by reference. Genbank and NCBI submissions indicated by accession number cited herein are hereby incorporated by reference. All other published references, documents, manuscripts and scientific literature cited herein are hereby incorporated by reference.
While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.
1. A method for producing a fucosylated oligosaccharide in a bacterium, comprising
providing a bacterium, said bacterium comprising a functional β-galactosidase gene, an exogenous fucosyltransferase gene, a GDP-fucose synthesis pathway, a functional lactose permease gene;
culturing said bacterium in the presence of lactose; and
retrieving a fucosylated oligosaccharide from said bacterium or from a culture supernatant of said bacterium.
2. The method of claim 1, wherein said β-galactosidase gene comprises an E. coli lacZ gene.
3. The method of claim 1, wherein said β-galactosidase gene is an endogenous β-galactosidase gene or an exogenous β-galactosidase gene.
4. The method of claim 1, wherein said bacterium accumulates an increased intracellular lactose pool, and produces a low level of β-galactosidase.
5. The method of claim 1, wherein said exogenous fucosyltransferase gene encodes α(1,2) fucosyltransferase or α(1,3) fucosyltransferase.
6. The method of claim 5, wherein said α(1,2) fucosyltransferase gene comprises a Bacteroides fragilis wcfW gene.
7. The method of claim 5, wherein said α(1,3) fucosyltransferase gene comprises a Helicobacter pylori 26695 futA gene.
8. The method of claim 5, wherein said bacterium comprises both an exogenous fucosyltransferase gene encoding α(1,2) fucosyltransferase and an exogenous fucosyltransferase gene encoding α(1,3) fucosyltransferase.
9. The method of claim 1, wherein said GDP-fucose synthesis pathway comprises endogenous enzymes or exogenous enzymes.
10. The method of claim 1, wherein said lactose permease gene is an endogenous lactose permease gene or an exogenous lactose permease gene.
11. A method for producing a fucosylated oligosaccharide in a bacterium, comprising
providing an enteric bacterium, said bacterium comprising a functional β-galactosidase gene, an exogenous fucosyltransferase gene, a mutation in a colanic acid synthesis gene, and a functional lactose permease gene;
culturing said bacterium in the presence of lactose; and
retrieving a fucosylated oligosaccharide from said bacterium or from a culture supernatant of said bacterium.
12. The method of claim 11, wherein said β-galactosidase gene comprises an E. coli lacZ gene.
13. The method of claim 11, wherein said exogenous fucosyltransferase gene encodes α(1,2) fucosyltransferase or α(1,3) fucosyltransferase.
14. The method of claim 11, wherein said enteric bacterium comprises E. coli.
15. The method of claim 14, wherein said colanic acid synthesis gene comprises a wcaJ gene
16. The method of claim 14, wherein said bacterium further comprises a mutation in a lon gene.
17. The method of claim 14, wherein said bacterium comprises a functional, wild-type E. coli lacZ+ gene inserted into an endogenous lon gene.
18. The method of claim 14, wherein an endogenous lacZ gene of said E. coli is deleted.
19. The method of claim 14, wherein said bacterium further comprises an exogenous rcsA or rcsB gene.
20. The method of claim 14, wherein said bacterium further comprises a mutation in a lacA gene.
21. A method for producing a 3′-sialyl-3-fucosyllactose (3′-S3FL) in a bacterium,
said bacterium comprising a functional β-galactosidase gene, an exogenous sialyl-transferase gene, an exogenous fucosyltransferase gene, a GDP-fucose synthesis pathway, a deficient sialic acid catabolic pathway, a sialic acid synthetic capability, and a functional lactose permease gene;
culturing said bacterium in the presence of lactose; and
retrieving said 3′-S3FL from said bacterium or from a culture supernatant of said bacterium.
22. The method of claim 21, wherein said exogenous sialyl-transferase gene encodes α(2,3)sialyl-transferase.
23. The method of claim 21, wherein said exogenous fucosyltransferase gene encodes α(1,3) fucosyltransferase.
24. The method of claim 21, wherein said deficient sialic acid catabolic pathway comprises a null mutation in endogenous N-acetylneuraminate lyase or N-acetylmannosamine kinase genes.
25. The method of claim 21, wherein said sialic acid synthetic capability comprises an exogenous UDP-GlcNAc 2-epimerase gene, an exogenous Neu5Ac synthase gene, or an exogenous CMP-Neu5Ac synthetase gene.
26. A method for producing a 3′-sialyl-3-fucosyllactose (3′-S3FL) in an enteric bacterium,
said enteric bacterium comprising a functional lacZ gene, an exogenous fucosyltransferase gene, an exogenous sialyltransferase gene, a mutation in an endogenous colanic acid synthesis gene, a functional lactose permease gene, a deficient sialic acid catabolic pathway, and sialic acid synthetic capability;
culturing said bacterium in the presence of lactose; and
retrieving said 3′-S3FL from said bacterium or from a culture supernatant of said bacterium.
27. The method of claim 26, wherein said exogenous fucosyltransferase gene encodes α(1,3) fucosyltransferase.
28. The method of claim 26, wherein said exogenous sialyltransferase gene encodes an α(2,3)sialyl transferase.
29. The method of claim 26, wherein said deficient sialic acid catabolic pathway comprises a null mutation in endogenous N-acetylneuraminate lyase or N-acetylmannosamine kinase genes.
30. The method of claim 26, wherein said sialic acid synthetic capability comprises an exogenous UDP-GlcNAc 2-epimerase gene, an exogenous Neu5Ac synthase gene, or an exogenous CMP-Neu5Ac synthetase gene.
31. A method for phenotypic marking of a gene locus in a host cell, whose native β-galactosidase gene is deleted or inactivated, by utilizing an inserted recombinant β-galactosidase gene engineered to produce a low but detectable level of β-galactosidase activity.
32. A method for depleting a bacterial culture of residual lactose in a β-galactosidase negative host cell, whose native β-galactosidase gene is deleted or inactivated, by utilizing an inserted recombinant β-galactosidase gene engineered to produce a low but detectable level of β-galactosidase activity.
33. A method for detecting bacterial cell lysis in a culture of a β-galactosidase negative host cell, whose native β-galactosidase gene is deleted or inactivated, by utilizing an inserted recombinant β-galactosidase gene engineered to produce a low but detectable level of β-galactosidase activity.
34. A method of purifying a fucosylated oligosaccharide produced by the method of claim 1, comprising binding said fucosylated oligosaccharide from a bacterial cell lysate or bacterial cell culture supernatant of said bacterium to a carbon column, and eluting said fucosylated oligosaccharide from said column.
35. An isolated E. coli bacterium comprising a defective colanic acid synthesis pathway, reduced level of β-galactosidase activity, and an exogenous fucosyl transferase gene.
36. A purified fucosylated oligosaccharide produced by the method of claim 1.
37. A nucleic acid construct comprising an exogenous fucosyltransferase gene transformed into a bacterial host strain comprising a deleted endogenous β-galactosidase gene, a replacement functional β-galactosidase gene of low activity, a GDP-fucose synthesis pathway, a functional lactose permease gene, and a deleted lactose acetyltransferase gene.
38. The nucleic acid construct of claim 37, wherein said exogenous fucosyltransferase gene encodes α(1,2) fucosyltransferase or α(1,3) fucosyltransferase.