Patent application title:

METHODS OF ACTIVATING DYSFUNCTIONAL IMMUNE CELLS AND TREATMENT OF CANCER

Publication number:

US20210293820A1

Publication date:
Application number:

17/334,862

Filed date:

2021-05-31

Abstract:

Method of activating dysfunctional T cells, determining responsiveness of a subject having a tumor to an immune checkpoint inhibition are provided. Also provided is an agent capable of inhibiting a target gene or expression product thereof for use in treating a subject having a tumor. Additionally or alternatively provided is an immune checkpoint inhibitor and an agent capable of inhibiting a target gene or expression product thereof for use in treating a subject having a tumor.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q2600/156 »  CPC further

Oligonucleotides characterized by their use Polymorphic or mutational markers

G01N33/574 »  CPC main

Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor for cancer

C12N15/113 »  CPC further

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

G01N33/50 IPC

Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing

Description

RELATED APPLICATIONS

This application is a Continuation patent application of PCT Application No. PCT/IL2019/051312 filed on Nov. 28, 2019, which claims the benefit of priority of Israel Patent Application No. 263394 filed on Nov. 29, 2018. The contents of the above applications are all incorporated by reference as if fully set forth herein in their entirety.

SEQUENCE LISTING STATEMENT

The ASCII file, entitled 88026Sequence Listing.txt, created on May 31, 2021, comprising 283,926 bytes, submitted concurrently with the filing of this application is incorporated herein by reference.

FIELD AND BACKGROUND OF THE INVENTION

The present invention, in some embodiments thereof, relates to methods of activating dysfunctional immune cells and treatment of cancer.

T cell checkpoint blockade therapies that aim to reactivate tumor-specific T cell responses have revolutionized cancer treatment, resulting in durable responses in patients with advanced disease (Ribas and Wolchok, 2018; Sharma and Allison, 2015). Nevertheless, many patients do not achieve long-term clinical benefit, and our understanding of the mechanisms underlying response or resistance to these therapies are still incomplete (Reading et al., 2018; Sharma et al., 2017; Śledzińska et al., 2015). Recent single cell RNA sequencing-based studies of tumor infiltrating immune cell populations in melanoma and other tumor types provide evidence for a highly heterogeneous make-up of immune cell infiltrates, and this heterogeneity is likely to form a determining factor in therapy outcome (Azizi et al., 2018; Guo et al., 2018; Lavin et al., 2017; Sade-Feldman et al., 2018; Savas et al., 2018; Tirosh et al., 2016; Zhang et al., 2018; Zheng et al., 2017). Continuous increases in sample size and quality, diversity of patients sampled, and analysis methodology are required to uncover the mechanisms that underlie successful immunotherapy response.

Within the heterogeneous tumor microenvironment, T cells make up a considerable part of the immune infiltrate. The intratumoral T cell compartment comprises effector, memory, and regulatory T cells. In addition, a subset of CD8 T cells that has acquired a state of ‘dysfunction’ or ‘exhaustion’ is frequently observed. Such dysfunctional T cells are characterized by a loss of classical CD8 T cell effector functions, such as cytotoxicity (Hashimoto et al., 2018; Pauken and Wherry, 2015; Wherry and Kurachi, 2015). In addition, the dysfunctional T cells in human tumors display a unique T cell cytokine secretion signature (Guo et al., 2018; Sade-Feldman et al., 2018; Savas et al., 2018; Thommen and Schumacher, 2018; Thommen et al., 2018). Whereas T cell exhaustion was previously associated with a loss of proliferative capacity, recent studies are providing evidence for a proliferative potential of T cells with high levels of PD-1 expression in human tumors (Guo et al., 2018; Savas et al., 2018; Thommen et al., 2018; Zhang et al., 2018). In addition to high levels of PD-1 expression, the dysfunctional T cell compartment is characterized by increased expression of inhibitory checkpoint molecules such as TIM-3 and LAGS (Thommen and Schumacher, 2018; Wherry and Kurachi, 2015). Furthermore, characterization of dysfunctional T cell populations in murine tumor and chronic viral infection models has demonstrated that dysfunctionality of T cells in these models is associated with the expression of transcriptional regulators such as Prdm1, Maf1, and Eomes (Chihara et al., 2018; Paley et al., 2012; Shin et al., 2009). To what extent these and other factors drive T cell dysfunction in human melanoma, and how their expression is induced, remain open and important questions.

The role and predictive potential of T cells with different levels of expression of exhaustion markers is presently a matter of debate. In murine models, T cells with high expression of markers of T cell exhaustion appear refractory to reinvigoration by PD-1 blockade (Blackburn et al., 2008; Im et al., 2016; Pauken et al., 2016; Philip et al., 2017; Schietinger et al., 2016). Nevertheless, the frequency of dysfunctional T cells expressing high levels of PD-1 has been shown to correlate with clinical response to anti-PD-1 therapy in NSCLC patients (Thommen et al., 2018). As a second issue, a significant complication in the analysis of T cell states in human tumors is that T cell infiltrates at tumor sites express a variable degree of tumor-reactivity (Scheper et al., in press; Simoni et al., 2018). For this reason, detailed characterization of dysfunctional T cells in a setting in which TCR clonality and the level of tumor-reactivity is known would be of value.

Hence, detailed characterization of dysfunctional T cells can lead to better understanding of their role in immune regulation and function and to identification of novel immune modulatory pathways and further optimization of strategies for T-cell activation, vital for establishing improved response across diverse human tumors.

Additional related background art:

US Publication Number 20110105341

WO2017191274

SUMMARY OF THE INVENTION

According to an aspect of some embodiments of the present invention there is provided a method of activating dysfunctional CD8+/Lag3+/PD1+/Tim3+/CD103+/CD39+/CD137+/Klrg1 T cells, the method comprising, contacting dysfunctional CD8+/Lag3+/PD1+/Tim3+/CD103+/CD39+/CD137+/Klrg1 T cells with an agent capable of down-regulating a target gene selected from the group consisting of AKAP5, DGKH, PAG1, GALM, FUT8, WARS, CBLB, PIK3AP1, APOBEC3G, SLAMF7, SIRPG, GALNT1 or an expression product thereof, thereby activating the dysfunctional immune cells.

According to an aspect of some embodiments of the present invention there is provided a method of determining responsiveness of a subject having a tumor to an immune checkpoint inhibition, the method comprising determining in a tumor of a subject a level of dysfunctional CD8+/Lag3+/PD1+/Tim3+/CD103+/CD39+/CD137+/Klrg1 T cells, wherein a level of the dysfunctional cells above a predetermined threshold is indicative of a response to an immune checkpoint inhibition.

According to an aspect of some embodiments of the present invention there is provided a method of treating a subject having a tumor, the method comprising:

(a) determining responsiveness of a subject to immune checkpoint inhibition as described herein; and
(i) wherein when the level of the dysfunctional cells is above the predetermined threshold, treating or selecting treatment for the subject with immune checkpoint inhibition; or
(ii) wherein when the level of the dysfunctional cells is below the predetermined threshold, subjecting the dysfunctional cells to ex vivo expansion and subsequently treating or selecting treatment for the subject with the immune checkpoint inhibition.

According to an aspect of some embodiments of the present invention there is provided a method of treating a subject having a tumor, the method comprising administering to the subject an immune checkpoint inhibitor and an agent capable of down-regulating a target gene selected from the group consisting of AKAP5, DGKH, PAG1, GALM, FUT8, WARS, CBLB, PIK3AP1, APOBEC3G, SLAMF7, SIRPG, GALNT1 or an expression product thereof, thereby treating the subject having the tumor.

According to an aspect of some embodiments of the present invention there is provided a method of treating a subject having a tumor, the method comprising administering to the subject an agent capable of down-regulating a target gene selected from the group consisting of AKAP5, DGKH, PAG1, GALM, FUT8, WARS, CBLB, PIK3AP1, APOBEC3G, SLAMF7, SIRPG, GALNT1 or an expression product thereof, thereby treating the subject having the tumor.

According to an aspect of some embodiments of the present invention there is provided an agent capable of inhibiting a target gene or expression product thereof selected from the group consisting of AKAP5, DGKH, PAG1, GALM, FUT8, WARS, CBLB, PIK3AP1, APOBEC3G, SLAMF7, SIRPG, GALNT1 for use in treating a subject having a tumor.

According to an aspect of some embodiments of the present invention there is provided an immune checkpoint inhibitor and an agent capable of inhibiting a target gene or expression product thereof selected from the group consisting of AKAP5, DGKH, PAG1, GALM, FUT8, WARS, CBLB, PIK3AP1, APOBEC3G, SLAMF7, SIRPG, GALNT1 for use in treating a subject having a tumor.

According to some embodiments of the invention, the administering the immune checkpoint inhibitor is following the administering the agent.

According to some embodiments of the invention, the activating is performed ex-vivo.

According to some embodiments of the invention, the activating is performed in-vivo.

According to some embodiments of the invention, the dysfunctional cells are in a proliferative cell state and/or are not in growth arrest.

According to some embodiments of the invention, the tumor is a solid tumor.

According to some embodiments of the invention, the solid tumor is a melanoma.

According to some embodiments of the invention, the dysfunctional T cells are tumor infiltrating cells.

According to some embodiments of the invention, the immune checkpoint is selected from the group consisting of cytotoxic T-lymphocyte antigen 4 (CTLA4), programmed death 1 (PD-1) or its ligands, lymphocyte activation gene-3 (LAG3), B7 homolog 3 (B7-H3), B7 homolog 4 (B7-H4), indoleamine (2,3)-dioxygenase (IDO), adenosine A2a receptor, neuritin, B- and T-lymphocyte attenuator (BTLA), killer immunoglobulin-like receptors (KIR), T cell immunoglobulin and mucin domain-containing protein 3 (TIM-3), inducible T cell costimulator (ICOS), CD27, CD28, CD40, CD244 (2B4), CD160, GARP, OX40, CD137 (4-1BB), CD25, VISTA, BTLA, TNFR25, CD57, CCR2, CCRS, CCR6, CD39, CD73, CD4, CD18, CD49b, CD1d, CDS, CD21, TIMI, CD19, CD20, CD23, CD24, CD38, CD93, IgM, B220 (CD45R), CD317, CD11b, Ly6G, ICAM-1, FAP, PDGFR, Podoplanin, and TIGIT.

According to some embodiments of the invention, the determining the level of dysfunctional cells is performed by fluorescence activated cell sorting (FACS).

According to some embodiments of the invention, the determining the level of dysfunctional cells is performed by single cell transcriptome analysis.

Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)

The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.

In the drawings:

FIGS. 1A, 1B, 1C, 1D, 1E and 1F Profiling immune infiltrates in human melanoma with scRNA-seq and scTCR-seq. A. Graphical overview of the experimental setting. Single immune cells were collected from human melanoma, and processed by MARS-seq for transcriptional profiling, and scTCR-seq for clonotype analysis of T cells. B. Two-dimensional (2D) projection of expression profiles of 47,772 immune cells partitioned into 324 metacells. Single cells are shown in dots. Metacells consisting of related cells are connected with edges and are positioned in proximity, broad immune cell subsets are annotated and marked by color code. C. 2D projection of sub-clustered T and NK cells. A total of 29,825 cells are represented in 218 metacells from the model shown in B, annotated in 9 groups and marked by color code. D. Expression (molecules/1,000 UMIs) of select genes across the T/NK metacell model. E. 2D projection of a selected set of marker genes over the metacell model. F. Distribution of the number of patients contributing to each metacell. Only patient with at least 2 cells in the metacell are considered as contributors.

FIGS. 1G, 1H, 1I, 1J, 1K, 1L, 1M, 1N 1O, 1P and 1Q G. FACS sorting strategy for T cells (CD45+/CD3+) and non-T cells (CD45+/CD3−) from tumor single cell suspension, as shown for three patients (bottom). H. Confusion matrix of all tumor immune infiltrates as shown in FIG. 1B. I-J. Metacell size distribution (C) and metacell ribosomal load compared to mean total UMI (D). K. Confusion matrix of T and NK cells. L. Distribution of FACS indices (measured by index-sorting) for CD4 and CD8 across different T cell types and NK cells for a representative patient. Values are logicle transformed (using the flowCore R package from Bioconductor). Colors represent cell types as in panel E. M. Scatter plot comparing mean absolute gene UMIs (log 2) of naive-like CD4 and naive-like CD8 T cells, based on FACS indices for CD4 and CD8. N. Naive gene enrichment as compared to non-naive T cells versus naive mean gene expression. O. Genes characterizing memory T cells, showing top 70 enriched genes, averaged across the 3 memory T metacells. P. Genes characterizing dysfunctional CD4 T cells, showing the top 70 enriched genes of the dysfunctional CD4 metacell. Q. Comparing cytotoxic T cells and NK cells gene enrichment, selecting the top 20 enriched genes within each group.

FIGS. 2A, 2B, 2C, 2D, 2E, 2F, 2G, 2H, 2I, 2J and 2K: Transcriptional gradients of tumor infiltrating T cells. A. Gene-gene correlation heatmap of top variable genes within CD8+ T metacells. B. Bar graph showing top 30 genes that are most correlated to LAG3 across CD8+ T metacells. The 30 “dysfunctional” genes are used to calculate the dysfunctional score. Scatter plots are depicting the dysfunctional score per metacell versus log enrichment of a selected set of dysfunctional genes. C. Similar to panel B, but showing top 30 genes correlated to FGFBP2, which define the cytotoxic score. The correlation of a selected set of cytotoxic genes with the cytotoxic score per metacell is shown. D. Cytotoxic score versus dysfunctional score on CD8+ metacells. E. Top transcription factors correlated with the dysfunctional score (right) and cytotoxic score (left). F. Shown are differences of dysfunctional and cytotoxic scores per metacell (X axis) versus the prediction (Y axis) of a linear model using TF expression alone (10-fold cross validation, lasso regularized). Inferred non-zero coefficients for TF variables are shown to the right. G. Bar graph showing the top 30 genes with the highest correlation to IL2RA (Treg score). H. Transcription factors with highest correlation to the Treg score. I. Linear model using transcription factors to predict the Treg score, similar to panel F. J. Gene enrichment in dysfunctional and Treg cells over naïve-like cells. A selected set of highly expressed genes (mean molecules per cell >=0.05) are shown, highlighting key genes either distinct or shared among the two groups. K. Treg-score versus dysfunctional-score on all metacells. Different groups of metacell are color-coded as in panel D.

FIGS. 2L, 2M, 2N, 2O, 2P, 2Q, 2R and 2S. L. Gene-gene correlation matrix for the top variable genes in CD8+ T cells, identical to FIG. 2A. Shown here with all gene names. M. Gene correlation to LAG3 on single cells (using spearman correlation on UMI counts, y-axis) and on metacells (using Pearson correlation on gene enrichment, x-axis). N-O. Sixty genes that most correlated with the dysfunctional score (C) and cytotoxic score (D) over CD8+ cells. Genes comprising these scores are colored, and were removed from the score when calculating their correlation to it. Number in parenthesis is the rank of the gene in the metacell correlation to the anchor gene defining the dysfunctional and cytotoxic scores (LAG3 or FGFBP2). P. Comparing cytotoxic to dysfunctional features on single cells. Showing the fraction of cytotoxic UMIs and dysfunctional UMIs, separating sub-panel per group of metacells (transitional, dysfunctional, cytotoxic). In each panel all CD8 cells are in grey and the group cells overlay them in color. Q. Stratifying dysfunctional T cells by the dysfunctional score, showing fraction of UMIs of genes from the dysfunctional score, TIGIT and ID3, in each decile. Difference between adjacent decile is tested for significance by chisq-test (*P<0.05; **P<0.01; ***P<1×10-3). R. Gene enrichment in Treg metacells of several representative genes comprising the Treg score versus Treg-score. S. Gene enrichment of Tfh and Treg cells over naïve-like cells. Showing data for strongly expressed genes (mean molecules per cell >=0.05) and labelling genes of interest and strongly enriched genes.

FIGS. 3A, 3B, 3C, 3D, 3E and 3F: Heterogeneity and transcriptional gradients of different myeloid populations. A. 2D projection of 16,142 non-T/NK cells partitioned into 100 metacells and 7 metacell groups annotated and marked by color code. B. Expression (molecules/1,000 UMIs) of marker genes in B cells, plasma cells, and different myeloid cells. C.

Top differentially expressed genes in macrophages (left), monocytes (center), and dendritic cells (right), as compared to the other two groups. D. Scatter plot comparing the monocyte, macrophage and DC scores per metacell as shown for myeloid metacells. E. Top transcription factors correlated with the monocyte score (upper) and macrophage score (lower). DC is excluded from this analysis due to the small number of DC metacells. F. Data illustrating the performance of a linear model using TFs to model the difference between monocyte and macrophage scores per metacell. Computed as in FIG. 2F.

FIGS. 3G, 3H, 3I and 3J. G. Confusion matrix for non-T/NK cells. H. Marker gene expression heat map for non-T/NK cells. Each column is a cell and each row is a gene. Cells are separated into different groups, colors as in FIG. 3A-F. I. Gene-gene correlation on gene enrichments in metacells for monocytes, macrophage, and dendritic cells metacells. J. Stratifying classical monocyte cells by the percentage of UMIs from the monocyte program, showing fraction of UMIs of the monocyte program genes, LYZ, and CEBPB in each quantile, difference between adjacent quantiles is tested for significance by Chisq-test (*P<0.05; **P<0.01; ***P<1×10-3).

FIGS. 4A, 4B, 4C and 4D: Inter-patient variation in the composition of dysfunctional CD8+ T cells and other immune cells. A. 2D projections of the composition of T and NK cells (top), and non-T/NK immune cells (bottom) in different patients. Showing six representative patients ordered by their fraction of dysfunctional CD8+ T cells within all T cells. B. Metacells (columns) are ordered by groups and clustered within each group. Showing from top to bottom the number of cells in the metacell, the top contributing patients to each metacell. Bar height is the fraction of cells, top patient in dark green, second patient in light green, the rest in white, patients' contribution to metacells, patients are ordered based on the frequency of dysfunctional CD8+ T cells, and metacell groups. Compositions of T cells and other immune cells are shown on the right (colors as in FIG. 1 for T/NK cells and FIG. 3 for non-T/NK cells). C. Patients are ordered by the fraction of dysfunctional CD8+ T cells within all T cells and binned into 3 groups (low, medium, and high dysfunctional). Disease stage, tumor location (LN: Lymph node; MSC: muscle; (S)C: (sub)cutaneous; p(S)C: primary (sub)cutaneous), treatment background (N: naïve; T: treated; IT: immunotherapy treated), percentage of CD3+ cells within total immune cells measured by FACS, and percentage of tumor immune infiltrates measured by histology are shown (Method), grey bars represent missing data. D. Frequency of different immune populations within the three groups of patients defined in panel (C) with each circle representing a patient and horizontal line the group median. Spearman correlation between the fraction of the group and the fraction of the dysfunctional group are shown on top, with stars marking significant p-value of a Mann-Whitney test between patients in the low and high groups (*P <0.05; **P <0.01; ***P <1×10-3).

FIGS. 4E, 4F, 4G and 4H. E. Type I IFN-induced gene expression intensity per patient. Showing the total UMIs fraction of type I IFN-induced genes across all patient cells, ordering patient by median percentage. F. Genes in monocytes and B cells that are most highly correlated with dysfunctional load across patients. Using patients with more than 50 cells in each group, ending up with 14 patients for the monocyte and 12 for B cells, showing genes total UMI count in parenthesis. G. T cell subtype compositions in treatment naive patients. Percentage of CD3+ cells in total CD45+ cells (analyzed by FACS) and percentage of immune infiltrates (analyzed by histology) are shown. H. Comparison of T cell subtype composition between metastases from the same patient. Two patients, p12 and p17, are shown.

FIGS. 5A, 5B, 5C, 5D, 5E, 5F, 5G, 5H, 5I, 5J, 5K and 5L: Clonal expansion and proliferation within the dysfunctional CD8+ T cell compartment. A. Graphical overview of the use of scTCR-seq to identify shared clones between two independent lesions from the same patient. B. Overview of TCR clonality for all patients, showing the size of each T cell clone (largest at the bottom, smallest at the top) in each tumor. Corresponding TCRs from two lesions of the same patient are marked. C. Patients' clonal composition, showing from top to bottom the number of distinct clones per patient, the number of T cells of which the TCR was retrieved, the distribution of clones by size for size one, size two and size >2 cells clones, and the T cells subtype composition of each group of clones, shown in pie charts (if the group has >=10 cells). Patients are ordered by the fraction of their size-one clones. D. Clonality of the TCR repertoire of the three groups of patients as defined in FIG. 4C: low, medium, and high dysfunctional. Showing the fraction of clones with >2 cells (left) and patient clonality score (right; defined by Pielou's evenness). Showing median as horizontal line, correlation and significance as in FIG. 4D. E. T cell subtype composition of cells with unique TCR (clone size=1) or shared TCR (clone size >2). F. Fraction of proliferating cells per metacell, calculated by defining a cell as proliferative using analysis of the bimodal distribution of cell cycle gene expression. Circle size reflects the fraction of proliferating cells in the metacell, using 2D projection as in FIG. 1C. G. percentage of proliferating cells in different immune cell types and subtypes, number of cells per metacell group are shown on the right. H-I. Fraction of proliferating cells in dysfunctional (H) and Treg (I) groups classified into bins according to their dysfunctional score (H) and Treg score (I). Scores defined as in FIGS. 2B and 2G. J. Gene enrichment over dysfunctional CD8 T cells stratified by the dysfunctional score load, showing highly varying genes, sorting genes by the decile they pick in and by their enrichment in that decile. K. Cell subtype composition of T cell clones of intermediate size (shared by 8-20 cells, left) or large size (shared by more than 20 cells, right). Clones are hierarchically clustered, matching patients are shown on bottom and clone ID on top. L. Pairwise clone sharing propensity by cell group. Showing the enrichment of the observed number of cell pairs sharing clones by their associated group over a control generated by random sampling cells by patients, preserving the patient cell composition, TCR detection probability, number of clones and clone sizes.

FIGS. 5M, 5N, 5O, 5P, 5Q, 5R, 5S and 5T. M. T cell subtype composition for T cells with different levels of TCR mRNA transcript (percentage of TRAC and TRBC2 genes UMIs); probability of detecting the TCR sequence in T cells with different levels of TCR mRNA transcript are shown as dot. N. Fraction of detected TCR per metacell versus the gene enrichment difference of CD8A plus CD8B and minus CD4. O. Correlation of genes from the cell cycle gene module on T and NK metacells. P. Frequency distribution of cell cycle score on all T cells. Cell cycle score is calculated as percentage of cell cycle gene UMIs out of total UMIs. Dashed line mark the threshold for marking a cell as proliferative. Q. Empiric cumulative distribution plots of cell cycle score per group. Note that the score is negated, and cells below the dashed line are the proliferative ones (fraction of proliferation in the legend) R. FACS analysis of PD-1 and Ki-67 expression in tumor infiltrating CD8+ T cells from three patients (p8, p28, p10). S. Cell cycle profile for PD-1 positive CD8 T cells from one representative tumor (p28), as measured by DNA staining with DAPI and distinguishing G0/G1 phase, S phase, and G2/M phase. T. Gene enrichment over Treg cells stratified by the Treg-score load, showing highly varying genes, sorting genes by the decile they pick in and by their enrichment in that decile.

FIGS. 6A, 6B and 6C: The relationship between cellular states and tumor reactivity of T cells. A. Graphical overview of the method to assess T cell reactivity. Ex vivo expanded TILs were co-cultured with autologous tumor cells to examine the presence of a tumor-specific TCR repertoire by measuring IFNg and TNFa secretion. B. tumor reactivity was measured as the percentage of T cells that secrete IFNg or TNFa after co-culture with autologous tumor material. Tumor reactivity of the tumor samples from 10 patients were assayed. C. The fraction of UMIs from genes of the dysfunctional program and cytotoxic program were calculated for each CD8+ T cell, and the distribution of these fractions across all CD8+ T cells are shown per patient. Patients are ordered by the median of the UMI percentage of dysfunctional gene program. T cell subtype composition within the CD8+ T cells are shown on top for each patient. Green and red circles mark reactive and non-reactive patients, respectively.

FIGS. 6D, 6E, 6F, 6G and 6H. D. Two-dimensional projection of expression profiles of 17,452 cells partitioned into 102 metacells. Single cells are shown in dots. Showing cells from: PBMCs of melanoma patients (p13, p17, p27), PBMCs from healthy donors, a healthy tissue that was misdiagnosed as tumor lesion (p22), and a residual tumor lesion that underwent regression after treatment (p24-1). E. Confusion matrix for all the cells as shown in panel A. C. Expression (molecules/1,000 transcripts) of marker genes, same genes as in FIG. 1D. F-H. Marker gene expression heat map for cells shown in panel A. Each column is a cell and each row is a gene. G. 2D projection of the composition of immune cells for PBMCs from p13, p17, and p27. Immune infiltrates from a healthy tissue what was misdiagnosed as tumor lesion from p22 and a residual tumor lesion that underwent regression after treatment from p24 are also shown.

FIG. 7 schematically depicts an embodiment for carrying out single cell transcriptome analysis.

FIG. 8 is a bar graph showing the percentage of CXCL13 positive cells within the GFP positive CD8 population, either without stimulation or upon stimulation with plate bound CD3 and soluble CD28 (CD3/CD28).

DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

The present invention, in some embodiments thereof, relates to methods of activating dysfunctional immune cells and treatment of cancer.

Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

Tumor immune cell compositions play a major role in response to immunotherapy but their heterogeneity and dynamics remain poorly characterized.

Whilst reducing embodiments of the invention to practice, the present inventors combined single cell RNA-sequencing, TCR-sequencing and T cell reactivity assays to trace immune cell dynamics in melanoma patients. Using this approach, they were able to demonstrate the presence of two effector T cell subsets, of which only one transitions into a dysfunctional T cell pool, as based both on a conserved gradient of expression of dysfunction-associated genes, and TCR sharing. Contrary to the prevailing paradigm that “exhausted” T cells are differentiating from the cytotoxic T cell compartment. Further, dysfunctional T cells are the major proliferating immune cell compartment, and that the strength of the T cell dysfunction signature is associated with tumor reactivity. Data from 25 melanoma patients confirm the universality of this observation and distinguish shared and divergent regulatory modules between dysfunctional CD8 and regulatory T cells. The present data demonstrate that CD8 T cells previously associated with a dysfunctional or exhausted state are in fact a highly proliferating and dynamically regulated population within the human tumor microenvironment. Such a T cell population can be used both as a diagnostic marker for the cytotoxic T cell potential of the cancer affected patient as well as a target for activation, in both in vivo and ex vivo settings. Thus, according to an aspect of the invention there is provided a method of determining responsiveness of a subject having a tumor to an immune checkpoint inhibition, the method comprising determining in a tumor of a subject a level of dysfunctional CD8+/Lag3+/PD1+/Tim3+/CD103+/CD39+/CD137+/Klrg1 T cells, wherein a level of said dysfunctional cells above a predetermined threshold is indicative of a response to an immune checkpoint inhibition.

As used herein “subject” refers to a mammal, e.g., human, diagnosed with cancer. The terms “cancer” and “cancerous” refer to or describe the physiological condition in mammals that is typically characterized by unregulated malignant cell growth.

Examples of cancers that can be analyzed and treated according to some embodiments of the invention, include, but are not limited to, tumors of the gastrointestinal tract (colon carcinoma, rectal carcinoma, colorectal carcinoma, colorectal cancer, colorectal adenoma, hereditary nonpolyposis type 1, hereditary nonpolyposis type 2, hereditary nonpolyposis type 3, hereditary nonpolyposis type 6; colorectal cancer, hereditary nonpolyposis type 7, small and/or large bowel carcinoma, esophageal carcinoma, tylosis with esophageal cancer, stomach carcinoma, pancreatic carcinoma, pancreatic endocrine tumors), endometrial carcinoma, dermatofibrosarcoma protuberans, gallbladder carcinoma, Biliary tract tumors, prostate cancer, prostate adenocarcinoma, renal cancer (e.g., Wilms' tumor type 2 or type 1), liver cancer (e.g., hepatoblastoma, hepatocellular carcinoma, hepatocellular cancer), bladder cancer, embryonal rhabdomyosarcoma, germ cell tumor, trophoblastic tumor, testicular germ cells tumor, immature teratoma of ovary, uterine, epithelial ovarian, sacrococcygeal tumor, choriocarcinoma, placental site trophoblastic tumor, epithelial adult tumor, ovarian carcinoma, serous ovarian cancer, ovarian sex cord tumors, cervical carcinoma, uterine cervix carcinoma, small-cell and non-small cell lung carcinoma, nasopharyngeal, breast carcinoma (e.g., ductal breast cancer, invasive intraductal breast cancer, sporadic; breast cancer, susceptibility to breast cancer, type 4 breast cancer, breast cancer-1, breast cancer-3; breast-ovarian cancer), squamous cell carcinoma (e.g., in head and neck), neurogenic tumor, astrocytoma, ganglioblastoma, neuroblastoma, lymphomas (e.g., Hodgkin's disease, non-Hodgkin's lymphoma, B cell, Burkitt, cutaneous T cell, histiocytic, lymphoblastic, T cell, thymic), gliomas, adenocarcinoma, adrenal tumor, hereditary adrenocortical carcinoma, brain malignancy (tumor), various other carcinomas (e.g., bronchogenic large cell, ductal, Ehrlich-Lettre ascites, epidermoid, large cell, Lewis lung, medullary, mucoepidermoid, oat cell, small cell, spindle cell, spinocellular, transitional cell, undifferentiated, carcino sarcoma, choriocarcinoma, cystadenocarcinoma), ependimoblastoma, epithelioma, erythroleukemia (e.g., Friend, lymphoblast), fibrosarcoma, giant cell tumor, glial tumor, glioblastoma (e.g., multiforme, astrocytoma), glioma hepatoma, heterohybridoma, heteromyeloma, histiocytoma, hybridoma (e.g., B cell), hypernephroma, insulinoma, islet tumor, keratoma, leiomyoblastoma, leiomyosarcoma, lymphosarcoma, melanoma, mammary tumor, mastocytoma, medulloblastoma, mesothelioma, metastatic tumor, monocyte tumor, multiple myeloma, myelodysplastic syndrome, myeloma, nephroblastoma, nervous tissue glial tumor, nervous tissue neuronal tumor, neurinoma, neuroblastoma, oligodendroglioma, osteochondroma, osteomyeloma, osteosarcoma (e.g., Ewing's), papilloma, transitional cell, pheochromocytoma, pituitary tumor (invasive), plasmacytoma, retinoblastoma, rhabdomyosarcoma, sarcoma (e.g., Ewing's, histiocytic cell, Jensen, osteogenic, reticulum cell), schwannoma, subcutaneous tumor, teratocarcinoma (e.g., pluripotent), teratoma, testicular tumor, thymoma and trichoepithelioma, gastric cancer, fibrosarcoma, glioblastoma multiforme; multiple glomus tumors, Li-Fraumeni syndrome, liposarcoma, lynch cancer family syndrome II, male germ cell tumor, mast cell leukemia, medullary thyroid, multiple meningioma, endocrine neoplasia myxosarcoma, paraganglioma, familial nonchromaffin, pilomatricoma, papillary, familial and sporadic, rhabdoid predisposition syndrome, familial, rhabdoid tumors, soft tissue sarcoma, and Turcot syndrome with glioblastoma.

According to a specific embodiment, the cancer is melanoma.

According to a specific embodiment, the cancer is a solid tumor.

According to a specific embodiment, the cancer is a primary tumor.

According to a specific embodiment, the cancer is metastatic.

According to a specific embodiment, the cancer is a secondary tumor.

As the significance of personalized treatment becomes more apparent, also known as “precision medicine”, it is important to determine the genetic makeup of subjects prior to initiation.

As used herein “determining responsiveness” refers to an ex vivo method for determining the likelihood of a subject to benefit from a treatment as described herein. The likelihood may be based on gene expression, immune assays, cell proliferation or combinations of same.

Responsiveness is determined when any of the above criteria shows at least a statistically significant change (dependent on the assay) as compared to a non-responsive control.

According to a specific embodiment, an increase in responsiveness as compared to a non-responsive control is of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more.

As used herein “immune checkpoint inhibition” refers to cancer immunotherapy. The therapy targets immune checkpoints, key regulators of the immune system that stimulate or inhibit its actions, which tumors can use to protect themselves from attacks by the immune system. Checkpoint therapy can block inhibitory checkpoints, activate stimulatory functions, thereby restoring immune system function. Currently approved checkpoint inhibitors target the molecules CTLA4, PD-1, and PD-L1. PD-1 is the transmembrane programmed cell death 1 protein (also called PDCD1 and CD279), which interacts with PD-L1 (PD-1 ligand 1, or CD274).

Examples of immune checkpoint inhibitors include, but are not limited to, of cytotoxic T-lymphocyte antigen 4 (CTLA4), programmed death 1 (PD-1) or its ligands, lymphocyte activation gene-3 (LAG3), B7 homolog 3 (B7-H3), B7 homolog 4 (B7-H4), indoleamine (2,3)-dioxygenase (IDO), adenosine A2a receptor, neuritin, B- and T-lymphocyte attenuator (BTLA), killer immunoglobulin-like receptors (KIR), T cell immunoglobulin and mucin domain-containing protein 3 (TIM-3), inducible T cell costimulator (ICOS), CD27, CD28, CD40, CD244 (2B4), CD160, GARP, OX40, CD137 (4-1BB), CD25, VISTA, BTLA, TNFR25, CD57, CCR2, CCRS, CCR6, CD39, CD73, CD4, CD18, CD49b, CD1d, CDS, CD21, TIMI, CD19, CD20, CD23, CD24, CD38, CD93, IgM, B220 (CD45R), CD317, CD11b, Ly6G, ICAM-1, FAP, PDGFR, Podoplanin, and TIGIT.

Examples of clinically approved immune checkpoint inhibitors include, but are not limited to, Ipilimumab, (anti CTLA-4), Nivolimumab (anti PD-1) and Pembrolizumab (anti PD 1).

As mentioned, the method is effected by determining in a tumor of a subject the level of dysfunctional CD8+/Lag3+/PD1+/Tim3+/CD103+/CD39+/CD137+/Klrg1 T cells.

As used herein “dysfunctional CD8+/Lag3+/PD1+/Tim3+/CD103+/CD39+/CD137+/Klrg1 T cells” refers to T cells, also known as “exhausted T cells”, that are in a proliferative state, however, exhibit poor (ineffective) effector function, expression of inhibitory receptor molecules and a transcriptional state that is distinct from that of functional effector cells or naive T cells.

According to a specific embodiment, the dysfunctional T cells, as described herein, are characterized by a gene expression profile, as listed in Table 1 hereinbelow.

TABLE 1
Gene expression enrichment table (Dysfunctional over naive T cells)
gene Log2 enrichment gene Log2 enrichment gene Log2 enrichment
KIR2DL4 4.490732143 HLA-DRB1 2.056594732 SIRPG 1.468527293
CCL3 4.004577849 TRGC2 2.044328432 HOPX 1.468016815
CCL4L2 3.999896786 GNLY 2.0358099 GABARAPL1 1.438919269
VCAM1 3.969975947 CD8B 2.029955887 TTN 1.4327192
SPRY2 3.931655941 CCL5 1.999008669 F2R 1.424682579
TNFRSF9 3.814912466 KLRC3 1.946597734 TRPS1 1.394265236
CCL4L1 3.765283822 HLA-DPB1 1.946126846 PCNA 1.385862832
CCL4 3.584087737 KLRK1 1.943475387 CD2BP2 1.359807185
GZMB 3.414998534 HLA-DRA 1.940498471 MCM5 1.356498879
CXCL13 3.225302969 LYST 1.922323385 DUSP4 1.352008488
NKG7 3.224628478 PDCD1 1.88892228 ATXN1 1.340471952
GPR56 3.214909407 TOP2A 1.876717438 PLA2G16 1.335699176
AKAP5 3.190543821 HIST1H1B 1.871529434 TAPBPL 1.32968705
KLRC2 3.07986313 TOX 1.860832979 FAM105B 1.299457067
IFNG 3.023685758 DGKH 1.832450982 HLA-DQB1 1.276384107
ZBED2 3.006054003 PIK3AP1 1.831395119 SNX9 1.252655186
MIR155HG 3.005452717 ITGAE 1.787252658 TUBA1B 1.248830683
RDH10 2.985007184 XCL1 1.784476906 AD000671.6 1.246266457
LAG3 2.941694402 CTSW 1.781971159 CD27 1.228474064
KLRD1 2.887714855 SNAP47 1.778086444 ID2 1.219909107
CD8A 2.814011346 UBE2F 1.771708602 PPP1R16B 1.218086614
FCRL3 2.801517444 NUSAP1 1.763442642 IFI27L2 1.217989994
FAM3C 2.73095743 TOX2 1.762632921 IL2RB 1.209285565
GFOD1 2.715219172 XXbac- 1.762277298 GALNT1 1.205077078
BPG254F23.6
TNIP3 2.629363508 HLA-DPA1 1.756087635 APOBEC3C 1.201949055
CRTAM 2.495450012 ZEB2 1.748952373 MCM6 1.182082011
XCL2 2.488569474 CD74 1.729597749 RNU2-2P 1.167309262
PTMS 2.481079283 NAB1 1.725000601 TNFRSF1B 1.16673391
ID3 2.467155489 WARS 1.704170551 IKZF3 1.156061281
MK167 2.466407488 CENPF 1.674894093 PTPN6 1.148259466
HAVCR2 2.463106931 HLA-DRB5 1.662792933 GGA2 1.1440375
ENTPD1 2.454383944 CD38 1.654686237 RFTN1 1.141330623
HLA-DQA1 2.389376746 METRNL 1.638056742 SYT11 1.121439198
EOMES 2.366789379 APOBEC3G 1.635277528 HIST1H4C 1.119372493
GZMH 2.351709126 RIN3 1.599236078 GBP2 1.112680616
PRF1 2.334922721 STMN1 1.592882744 DUSP2 1.111771358
FASLG 2.3211962 RAB27A 1.557588099 ABI3 1.111291789
PHLDA1 2.250461525 CTLA4 1.547774899 KIF20B 1.101567556
HLA-DRB6 2.249952345 CD63 1.522760313 CD84 1.089153328
CSF1 2.235526487 NR4A2 1.501423197 ARPC5L 1.080873084
TIGIT 2.228280115 AC092580.4 1.499468647 ITM2A 1.080354662
HLA-DMA 2.155555695 CBLB 1.498923491 TRGC1 1.077011593
CST7 2.14725879 SLAMF7 1.482145187 SH2D2A 1.0757751
NBL1 2.111557553 TRAF5 1.480749707 MPHOSPH9 1.07069683
PSTPIP1 1.069986924 CHST12 0.878623806 NCOA1 0.765855226
ZFP36L1 1.068194989 SNORD3A 0.87559877 PSMB9 0.764075393
CD7 1.06428792 SH2D1A 0.873117753 TAP1 0.764063866
SYTL3 1.060595686 RAB1B 0.867612725 AKR1B1 0.763693165
PLEK 1.057743433 PTPN22 0.865283024 RANBP1 0.76355573
MIAT 1.049975924 PTPN11 0.862481115 TBCD 0.759087868
GZMA 1.032440074 RBPJ 0.858278624 C11orf48 0.759045305
HMGN3 1.024445927 SRI 0.857465561 OASL 0.756166035
LINC00152 1.023060248 CDK2AP2 0.849223113 ATP1B3 0.75608455
GZMK 1.019996804 AGFG1 0.845833047 HMGB1P5 0.749209003
GBP5 1.019496738 ##### 0.845389729 HMGN2 0.748154151
MFSD6 1.01473735 LSM2 0.842808972 SPATS2L 0.747833924
HSPB11 1.009086603 BATF 0.839311624 RNA5-8SP6 0.743125245
RNF19A 0.999305652 FKBP1A 0.83817168 VIMP 0.740307829
ITGB7 0.995408172 PSMD8 0.837041871 SURF4 0.735657861
SERPINB1 0.988131839 USP24 0.833602695 PSMB8 0.733526327
APOBEC3D 0.985730472 COTL1 0.828665295 TMPO 0.732176424
ANXA5 0.983363554 CD81 0.826240194 CCND2 0.730944468
LITAF 0.977883155 SDF2L1 0.824265289 RCC2 0.728775622
IGF2R 0.974011679 SMC4 0.822965909 CALR 0.728577573
TRIM8 0.964281324 PMF1 0.81947984 RAB7L1 0.724281302
GSTP1 0.963111439 TRIM69 0.818961728 EZR 0.723353885
SHFM1 0.958160361 PTPRA 0.818853728 KCTD20 0.723204854
TXNDC17 0.956062973 SLA 0.818302708 RHOC 0.721258064
PKM 0.953726223 C12orf75 0.816897669 EXOSC9 0.717378397
LSP1 0.941442562 APMAP 0.815963632 CCDC69 0.717287609
SRGN 0.939304612 PYHIN1 0.813585594 SLC20A1 0.715469689
IRF2 0.937052626 GBP4 0.811721375 C5orf56 0.715162048
PTPN7 0.934842321 TUBB 0.811166985 TMEM189 0.714866167
GAPDHP40 0.9281729 ZCRB1 0.800785097 VOPP1 0.714408628
GALM 0.927456627 MDM2 0.799550754 PYCARD 0.713406744
SERPINB9 0.91962915 PPM1M 0.797606265 CTSD 0.710740997
PTTG1 0.918339081 C17orf49 0.796792332 PSMA2 0.707531441
MAPRE2 0.910691685 DGKZ 0.795608007 UBE2A 0.706959784
TXNDC11 0.910594325 CCR5 0.790428507 RC3H1 0.705979072
MAP2K2 0.90694099 RNF115 0.78975068 ENSA 0.705264749
ARL6IP1 0.904515172 MBD2 0.789138893 MIS18BP1 0.704956252
PRKCH 0.902286887 TBC1D4 0.783033145 ANKRD32 0.704818058
HMGB2 0.89647923 RGS2 0.782221627 MEA1 0.697988454
ACTN4 0.896103528 NASP 0.781024945 HNRNPLL 0.693861252
CLEC2D 0.894950814 LASP1 0.777574929 SLA2 0.690396657
FAM53B 0.893456661 PCED1B 0.773658204 PGAM1 0.68951194
ITGA1 0.884707243 SPATA13 0.772467917 CXCR6 0.68821601
FUT8 0.882003415 H2AFZ 0.766115765 DEK 0.687235987
CLIC1 0.687111406 VPS26A 0.630215471 NUCKS1 0.575340857
ZFP91 0.679084757 SNRPG 0.628362888 YARS 0.575246268
HSBP1 0.678358777 RNASEH2C 0.625435284 ST8SIA4 0.573175086
LSMD1 0.677859686 SUB1 0.624503735 TYMP 0.572377274
IFI16 0.676971277 AMICA1 0.622193744 RARRES3 0.57074508
SP140 0.67424705 MCTS1 0.621753893 SNRNP27 0.569661634
CKAP2 0.673259099 MCM3 0.621400261 PSMB2 0.569646251
POMP 0.673255113 ITGB1BP1 0.621337269 ANAPC11 0.569282856
PBDC1 0.670398514 LBR 0.620757543 HMGB1 0.568539592
ETF1 0.670164784 SMC1A 0.616654824 ARPP19 0.567112735
ATRAID 0.670154265 PSMB10 0.616478021 CD3D 0.566430265
DNAJB14 0.670128866 NPIPB5 0.615384681 SREK1 0.563140105
MAP4K1 0.668244511 POLR2K 0.614639793 IWS1 0.560329292
CSNK2B 0.668083952 SYNGR2 0.614434528 CEBPZ 0.560210911
ADRM1 0.667439928 ADNP 0.613804593 GTF2A2 0.557777631
IL32 0.666871719 VCP 0.611263909 HCST 0.556700829
PSME2 0.6649294 SCARNA9 0.610456508 PSMA5 0.55577973
PFDN2 0.664674095 ASXL2 0.608563436 DNAJB11 0.554744341
PFKP 0.664566976 RTF1 0.607273049 SPCS2 0.552459222
PDIA6 0.657820135 PSMA4 0.606674353 VTI1B 0.552439747
ORMDL3 0.656341159 NAPA 0.604978651 TLN1 0.548061428
HDGF 0.653531895 BST2 0.603729729 FKBP2 0.547968703
CD97 0.652232866 MIR4435-1HG 0.603130505 PAG1 0.5453731
U2AF1 0.651130901 NLRC5 0.602865285 UBE2J1 0.544816824
RABAC1 0.64851274 ZFP91-CNTF 0.602069129 RBBP7 0.544405216
SNRPB 0.647877047 FSCN3 0.601349734 NUDT21 0.54343484
VAMPS 0.647641837 LGALS1 0.600819117 GTF3C6 0.542229894
RBM12 0.647419094 ODC1 0.600312371 PSMD4 0.542167091
PLEKHF1 0.644817513 ZC3H7A 0.598006709 RNF187 0.541650857
HNRNPAB 0.642530956 LRBA 0.592201609 AKAP13 0.541364603
ARPC2 0.642244765 STAT3 0.590541518 RUNX3 0.53748367
FBXL18 0.641251253 ZNF106 0.58785756 PLSCR1 0.537136982
UBB 0.638477541 ZBTB7A 0.587063132 CSK 0.536484213
CALM3 0.635962806 CYTH4 0.586946581 SMC5 0.536182949
VMP1 0.634803097 GBP1 0.58687048 HERPUD2 0.533861732
MARK3 0.634359636 ABHD17A 0.583400338 EID1 0.52931039
ZCCHC6 0.634356785 AL353354.1 0.581014846 SPEN 0.528913357
DCAF7 0.6335917 MYO9B 0.579371611 SLAMF6 0.525054691
ARHGAP9 0.632565876 SNRPD1 0.579366551 SCLT1 0.524314986
CDK6 0.631432859 SNRPF 0.578176389 THRAP3 0.524313535
UBE2L6 0.631242868 TRAC 0.577482435 CLTA 0.524191224
TRAF1 0.631188664 HLA-A 0.576666225 FAM111A 0.523669776
SNF8 0.631157433 CMIP 0.576612356 WDR1 0.523114952
IPCEF1 0.631100818 SPN 0.576094192 MOB3A 0.52308913
WSB1 0.52300756 CLEC2B 0.477936471 Sep. 2 0.45124665
SRSF1 0.522624848 HSPB1 0.476589491 M6PR 0.447944245
ADRBK1 0.521508413 ITGB2 0.476249767 HSP90B1 0.447660785
USP16 0.521189482 PARP4 0.475025059 PPM1G 0.447491837
KRAS 0.52043565 HLA-B 0.474420176 HIST1H1C 0.446833301
DRAP1 0.520036912 EIF3B 0.473965281 TCEB2 0.446819937
MIEN1 0.519664844 Sep. 7 0.47145212 AC012379.1 0.446728033
SRSF9 0.518037521 CMTM6 0.47050531 TXN 0.446391075
PSMD1 0.51526274 WIPF2 0.470327016 BZW1 0.444621266
SZRD1 0.51102297 FAM192A 0.470262138 CWC15 0.444598676
RAB8B 0.508415712 ARGLU1 0.469914568 LCP2 0.443536893
FYN 0.508311977 SFPQ 0.469496696 YWHAH 0.44254042
HSPA4 0.508059077 PRDM1 0.468670533 PAFAH1B2 0.442334057
MSI2 0.507299642 PSMC3 0.468520404 CTC-260F20.3 0.442050649
OTUB1 0.506365953 PDCD10 0.467881212 EMC7 0.442034035
CRIP1 0.505317652 PPDPF 0.467661485 TMEM256 0.441689954
ZBTB38 0.505214395 FUS 0.467117845 AP2B1 0.440891599
MSN 0.504987534 MCL1 0.465921176 RN7SL2 0.440799897
SEC61B 0.504504344 SMS 0.46452993 DNMT1 0.440549587
MAT2A 0.502032324 DDX27 0.463779764 PPP1CA 0.440207464
MYO1F 0.501124601 NAA38 0.46341298 EIF4H 0.440192051
RNF213 0.498254058 AIP 0.46236438 FBXO7 0.439614509
ITGAL 0.497577817 PARP1 0.462079322 RHOA 0.43951829
PITPNB 0.497564735 FAM49B 0.461954973 RAB10 0.438013842
RAC1 0.49695249 PJA2 0.461824295 UBE2N 0.437924428
CD3G 0.496558156 LSM6 0.461728236 CARD16 0.436697784
TRBC2 0.495369298 PSMB4 0.461393033 PPP2R1A 0.436240923
ANAPC5 0.49464261 SKA2 0.461231874 TUBB4B 0.435782507
DCP2 0.491910991 BAZ1B 0.460867863 C1orf43 0.435522735
MYO1G 0.491739093 RNU4ATAC 0.460744289 AMZ2 0.433537674
SLFN12L 0.490332356 BSG 0.458957846 TMEM109 0.433370415
RAPGEF1 0.490235164 YWHAE 0.458886137 C7orf73 0.433310991
HCP5 0.490115253 TOX4 0.457410102 KPNA6 0.433043585
MAPKAPK2 0.489798794 HMGN1P38 0.456952704 DYNLL1 0.432056016
PSMB6 0.488702093 BUB3 0.456352248 PTMAP2 0.431326304
PSMA3 0.487467225 IRF9 0.456318123 NHP2 0.431156727
SUMO1 0.486799076 SCAMP2 0.456281295 SMC3 0.430895996
CTSC 0.486308027 XIAP 0.455729993 SCAND1 0.430450539
ARHGAP30 0.484803336 CHTOP 0.454948952 CNPY3 0.429641645
COMMD7 0.484774877 EWSR1 0.454260707 RASAL3 0.429593816
EDF1 0.482387687 AKT1 0.454159396 SQSTM1 0.428940663
ARAP2 0.480452518 DTX3L 0.452261577 IFI30 0.428022
MANF 0.479342441 PPP2CA 0.451971075 PPP1R11 0.427863648
EIF4E2 0.479193576 LPIN1 0.451910062 SAP30BP 0.42779976
EFHD2 0.427201098 LAMTOR5 0.400662398 GNB2 0.380658167
CFL1 0.426883263 IVNS1ABP 0.400622696 HNRNPM 0.38062134
POLR2E 0.426752831 SUMO2 0.399914179 ABCF1 0.379878832
RNASEK- 0.426545806 SRP9 0.399214464 PARVG 0.37928924
C17orf49
DNAJC2 0.426171753 SH3KBP1 0.39890884 SRP14 0.378813984
RN7SL4P 0.425644053 CSNK2B- 0.398870209 HSPA5 0.377777129
LY6G5B-1181
ARPC1B 0.424960986 PCMT1 0.398120494 PSD4 0.377712772
FAM120A 0.424902009 RBCK1 0.39744028 RBBP4 0.377662235
SEL1L3 0.423783016 NEDD8 0.397388281 NAP1L4 0.37702568
DNAJC1 0.422738017 POLR2B 0.396052078 PARP9 0.37670255
PSMD7 0.421663153 ZNF655 0.395970938 IQGAP1 0.374341351
EAPP 0.42121925 IRF1 0.395805162 TAF9 0.373872967
DENND2D 0.420098458 TMCO1 0.39574203 NUCB1 0.373626613
UFD1L 0.419856801 EIF2S1 0.395516038 CTCF 0.373036854
HN1 0.419032439 KRT222 0.395237153 ZNF207 0.371685618
CAPZA1 0.418881908 NKTR 0.394532855 HNRNPD 0.371603547
CASP4 0.418567423 CHST11 0.393997097 TOP1 0.371527887
PRKAR1A 0.41823527 SIT1 0.39332859 SMG1 0.370580974
CREB1 0.417255846 DDB1 0.392285537 TPP1 0.370156543
HNRNPA2B1 0.416815297 OGT 0.391263918 HLA-C 0.369770436
HIST2H2AC 0.416492104 CTD-3214H19.4 0.390529331 NRBP1 0.368446511
COPZ1 0.416103134 FERMT3 0.390488576 ITPKB 0.367831308
ATPSEP2 0.41596389 RFC1 0.38973581 TACC1 0.36763938
GNAS 0.414013788 PTMAP5 0.38929649 CNDP2 0.367258284
KRCC1 0.412505358 GPR171 0.389172996 CEP57 0.367221849
ANXA6 0.412421308 SUZ12 0.388537252 HNRNPR 0.367037912
NEDD9 0.411406663 PSMA7 0.388426829 LBH 0.366320201
CCT8 0.409780094 KMT2A 0.387590569 AP2M1 0.366227081
WAS 0.409444959 CELF2 0.387499581 LMAN1 0.36613928
PSMB1 0.40911407 AC104698.1 0.387175508 SASH3 0.363606007
ZNRF1 0.40878235 SH3GLB1 0.387068254 PDIA3 0.362949724
RAN 0.408396333 HERPUD1 0.386250247 RER1 0.362883465
HNRNPA3 0.408348607 COPA 0.386225463 ARF6 0.361881914
SH3BP1 0.40825723 SEMA4D 0.385957779 MOB1A 0.359900502
ZYX 0.406007345 MAPK1IP1L 0.385660385 RAD23B 0.359708748
SF3B5 0.405995826 RBM8A 0.385042803 CTDSP1 0.359580903
DDX39B 0.405975635 SPTAN1 0.384407985 CSNK1D 0.357642414
NSRP1 0.405914573 SRSF4 0.384182413 FAM32A 0.357217257
TOP2B 0.405212862 PUF60 0.383631406 FRG1 0.357206223
PSMA1 0.405143618 TXNL4A 0.382836719 SRSF11 0.35679426
WNK1 0.405019131 SAMSN1 0.382763904 AP2S1 0.356535413
OAZ1 0.40404809 SEC11A 0.382379146 ZNHIT1 0.356370827
SNX17 0.403238879 PFN1 0.381752567 PVRIG 0.355429545
NOP58 0.402936725 CBX5 0.380763987 MAN1A2 0.355164867
PTPRCAP 0.355148611 MGEA5 0.333922976 TRIM38 0.315024393
PNISR 0.354506328 PAIP2 0.333870435 CDC37 0.31489579
TROVE2 0.353935489 TRA2B 0.333580647 Y_RNA 0.313676892
SAMD9L 0.353479999 PSME1 0.331975352 LMAN2 0.313540404
PPP1R12A 0.353379543 SUPT16H 0.331935088 DDOST 0.313531649
FUBP1 0.352943329 RECQL 0.331930959 C17orf62 0.313125044
ENY2 0.352909428 LSM3 0.331671958 GYG1 0.312429274
HSP90AA1 0.352176901 LY6E 0.33100507 PSMC5 0.309305294
SEC11C 0.352025897 ARPC4 0.330703384 UBE2L3 0.308614651
DDX58 0.350661116 NOL7 0.330591619 PAFAH1B1 0.308524092
CLIP1 0.350635164 ERICH1 0.330085117 NFATC3 0.307463021
TPM4 0.350085933 PRPF38B 0.329795914 PNN 0.307409754
BHLHE40 0.349443112 CXCR3 0.329743227 MAP1LC3B 0.307354257
LIMS1 0.349004992 SMARCE1 0.329317082 PPP1CC 0.307100617
RNF181 0.34860977 SRSF7 0.329077923 IL2RG 0.306904292
MIF 0.348375436 CCDC142 0.329067758 SLU7 0.30678132
AKNA 0.348370278 ADD1 0.328170078 MESDC2 0.306778585
CALM2 0.347603954 SH3BGRL3 0.328111255 H2AFY 0.306680552
PAPOLA 0.345501816 GBP3 0.327960408 SSR1 0.306235552
RBM25 0.345501816 SRSF2 0.327671982 FMNL1 0.306150476
DERL1 0.345161879 ANP32E 0.327480116 SET 0.305859679
HDDC2 0.34374274 EIF1B 0.326710808 CAPRIN1 0.305338077
ORAI1 0.343304253 HP1BP3 0.326531451 LRP10 0.304143062
PARP14 0.342005772 PREX1 0.32650236 USP7 0.30396405
SEPHS2 0.341607894 ZFC3H1 0.326011132 MAP4 0.303493242
RPN2 0.341401807 DPP8 0.325872182 FLNA 0.303342124
CAP1 0.3413674 HNRNPL 0.325777187 UBL5 0.303066469
CNOT1 0.341344887 CHD6 0.325607926 ZBTB1 0.302783199
TRAPPC1 0.341299511 ATP6V0C 0.324497907 ARPC3 0.30172489
TRMT112 0.340218056 CNOT2 0.32423314 USP1 0.301723181
ZNF292 0.340070457 UBE4A 0.323747989 SMEK1 0.301566892
CLTC 0.340014435 SLC3A2 0.322451839 CDK13 0.30147008
GSDMD 0.338752139 PABPN1 0.322307337 SNX20 0.301271992
RPL22L1 0.337846256 COPE 0.322214156 CHMP2A 0.300546586
USP8 0.337665839 METAP2 0.319873793 POLR2L 0.300535232
SRSF3 0.337275283 C8orf59 0.319851017 MXD4 0.30037844
PSMD2 0.336938788 BTN3A1 0.319330286 RALA 0.300077082
DNTTIP2 0.335987061 RNASEH2B 0.319115312 UBXN4 0.299633831
ATG12 0.335700992 SNRPC 0.318807981 HIST1H1E 0.298074848
SNW1 0.335395311 ARF1 0.317498663 LARP7 0.29800218
ITGA4 0.335040272 HMGN1 0.316946986 RASGRP1 0.297676704
VPS28 0.334938917 TMEM167A 0.316902327 RPL7L1 0.297414316
C4orf3 0.334735326 AP000721.4 0.316775281 PRR13 0.296511051
COX6CP1 0.334336334 RAB6A 0.316761559 GNAI2 0.296451464
RNF10 0.295974057 BUD31 0.279329791 NOP56 0.259067319
PSMC2 0.294932436 HSPH1 0.278381267 YWHAQ 0.258993874
SPCS1 0.294370243 SF3A3 0.278015815 CD2 0.258786707
JAK3 0.294266263 BIN1 0.277805095 SNORA67 0.257871132
CCNK 0.294043399 C1orf63 0.276125941 OAS2 0.256911981
PDCD5 0.293864364 NELL2 0.275578883 RUNX1 0.256720812
NAA50 0.293817053 TMX4 0.275066579 SNRPE 0.256720812
SSRP1 0.293593209 TAF7 0.274937844 BRD7 0.255465458
BFAR 0.293074395 PSMG2 0.274724538 SELK 0.254445951
SNRPD3 0.292598834 AP3D1 0.274542463 CCNDBP1 0.253914486
NONO 0.292522266 RALY 0.274533875 RNPS1 0.253098084
XRN1 0.292478389 PRKACB 0.274514957 HNRNPF 0.252724266
NFATC2IP 0.292072562 RPL17-C18orf32 0.273477907 ZNFX1 0.252183535
SNX5 0.291058161 RAB7A 0.272341752 AC004057.1 0.251936232
NCOR1 0.290949706 ZFR 0.271752577 SRPR 0.251152016
SRP19 0.290887702 VAPA 0.271525811 KRT10 0.251098482
CYBA 0.28991218 RGS1 0.271485129 CCT6A 0.250971389
CTD- 0.289649887 ARHGEF3 0.271352533 ZFAND5 0.250478211
2545G14.7
MORF4L1 0.28911482 FAM96B 0.271204264 TMSB4XP4 0.249450865
MITD1 0.287983326 LAMTOR1 0.270811576 ADAR 0.24913663
FAM208A 0.287957455 PPHLN1 0.270433323 CAPZB 0.249125122
DNAJC8 0.287953454 PDAP1 0.269987173 PTBP1 0.249094935
RBX1 0.287645363 EIF5 0.269630475 PTMA 0.248504371
POLR2G 0.286721018 HDAC1 0.268944097 USO1 0.248199818
ARPC5 0.286228153 BIRC6 0.268863507 GNPTAB 0.248144941
SSR3 0.284877483 UHMK1 0.268691446 LRRFIP1 0.24657496
DYNLT1 0.284514033 TBL1XR1 0.266866944 SON 0.246066903
CNOT6L 0.28408865 TERF2IP 0.26601867 PGK1 0.24589605
ZNF644 0.283210449 PTGER4 0.265880286 U2SURP 0.245462365
PPP6R1 0.283125599 H2AFV 0.265808922 TMEM14B 0.244664934
HLA-F 0.282800185 COPS6 0.265492185 APOL6 0.244544444
HERC1 0.282713116 GABARAPL2 0.265489902 INPP4B 0.242637112
GIGYF2 0.282589655 WDR83O5 0.265138339 CNPY2 0.242248848
ARHGDIA 0.282393661 PRRC2C 0.264780713 DHX36 0.239562743
CBX3 0.282319213 UBLCP1 0.263869785 ANP32B 0.238914275
TOR1AIP1 0.281985928 GNG2 0.263681025 TRAT1 0.238209091
VASP 0.281611172 POLR2J 0.263453997 ATRX 0.237307866
KIF5B 0.281340652 PDCD6 0.26316521 SUPT5H 0.236939507
NCL 0.281217567 MGAT1 0.263118886 CAPNS1 0.236858284
C9orf16 0.280993291 SHKBP1 0.262055667 UBC 0.236650885
MYL6 0.280984045 USP48 0.262055667 AP003419.11 0.236423788
EVL 0.280153233 USF2 0.261995623 ACTB 0.235310537
FDFT1 0.279736807 PRPF40A 0.261963889 SYNE1 0.235166289
TMSB4XP8 0.279448086 UBE3A 0.260057701 LDHA 0.234424436
BTN3A3 0.233804839 AIMP1 0.213964675 RPF1 0.194116357
TOB2 0.233471523 THOC7 0.212902014 ARF4 0.193968454
ZNF24 0.233370869 UBA2 0.21176386 ACTG1 0.19379579
BRD4 0.232745836 ACTR2 0.211654569 ATP2B4 0.193631382
RBM23 0.232457296 CERS2 0.210308533 C14orf166 0.193220165
NHP2L1 0.23165042 HNRNPK 0.209197551 FOXN3 0.193219175
IST1 0.231409723 ZRANB2 0.209010695 DAD1 0.192668226
DDX46 0.231224953 BTN3A2 0.208923563 TRA2A 0.192112123
CD3E 0.230619198 RAB11A 0.208557108 SYNCRIP 0.191714949
DDX39A 0.230151692 C19orf53 0.207810394 LNPEP 0.191472767
HDLBP 0.230016398 RANBP2 0.207785498 ZNF706 0.191386583
RN7SL3 0.228040813 ATP11B 0.207293014 SEC61G 0.190925601
EMC10 0.227389742 DDX60 0.206641679 ALOX5AP 0.190673778
HNRNPC 0.227360597 TBCB 0.206048918 STAT2 0.19012373
ENO1 0.227175129 DOCK8 0.205820844 EIF3J 0.188656784
ILF2 0.226397881 TMED5 0.205775266 PA2G4 0.188421922
PNRC2 0.226119395 TAPBP 0.205754492 PFN1P1 0.188395485
NFATC2 0.225741436 ANXA11 0.205731543 OS9 0.188063177
THEMIS 0.225629989 EIF31 0.205554041 SIVA1 0.18761931
MTPN 0.224489135 CELF1 0.205292436 ARL6IP5 0.186848091
SERF2 0.224018531 EPS15 0.205179684 ANKRD17 0.186810614
BAZ2A 0.222997155 TMEM59 0.204796959 SRM 0.18608177
N4BP1 0.222705807 TMEM258 0.204583066 SREK1IP1 0.185518442
PTBP3 0.222700584 MATR3 0.204052917 ACIN1 0.185231681
RNF4 0.222301958 PRPF8 0.203874747 Sep. 1 0.184502814
UBA1 0.222161962 PIK3CD 0.203549859 WAC 0.18409035
ABI1 0.221744062 SRSF10 0.203056165 ACTR3 0.184021861
PSMB7 0.221368277 DDX23 0.202669046 DDX17 0.183822584
CD164 0.220971634 GGNBP2 0.20185104 USP15 0.18369593
DHX15 0.22075958 KHDRBS1 0.200516121 NLRP1 0.183278068
FKBP3 0.220110666 GTF2F1 0.200282478 TM9SF2 0.182859671
CCDC85B 0.2199542 LIMD2 0.199935027 PCBP1 0.182135867
CTSS 0.218874591 SDF4 0.199435264 ITSN2 0.182074213
DOCK2 0.218106684 GOLGA7 0.199126123 XPO1 0.181786421
ZMAT2 0.217985152 SMARCC1 0.197970972 RSRC2 0.179799278
YTHDF2 0.217912967 GPRIN3 0.197393197 C10orf118 0.179715115
TRIP12 0.217437996 TCERG1 0.196701631 GDI2 0.178812199
BRD2 0.216567496 UBE2K 0.196372563 SERINC3 0.177933216
RN7SL1 0.215898959 CANX 0.19617537 ILF3 0.177851421
ELK4 0.215318395 FBXW5 0.196083325 ATP6V1E1 0.177342173
THOC2 0.215069339 Z82188.1 0.195917756 CPNE1 0.177065782
CFLAR 0.214841285 FAM104A 0.195162508 ANP32A 0.176346837
B2M 0.214661773 SRRM1 0.194388972 SLC9A3R1 0.17551176
ROCK1 0.214016757 UPF2 0.19416293 TCEB1 0.175010869
PCM1 0.174874062 SHISA5 0.15525488 EIF2AK1 0.136371144
BCLAF1 0.17447155 ZNF148 0.155175513 BECN1 0.136219082
SAMD3 0.17443151 GNB1 0.154264741 CHD1 0.13478989
DPY30 0.173926779 LCK 0.154208513 RNF145 0.13429457
XBP1 0.173735013 SAP18 0.153940385 STAU1 0.133701333
ZC3H11A 0.172778159 GPATCH8 0.15385323 PSMF1 0.133652302
CDC5L 0.172317677 XRCC5 0.153761571 ERGIC2 0.133525033
ARHGEF1 0.171496334 SELT 0.153112012 ALKBH5 0.131229233
HSP90AB3P 0.171414548 PPP2R5C 0.152992205 PTGES3 0.130681337
TXNL1 0.170766389 GSPT1 0.152713888 NIN 0.130475215
NLRC3 0.170506145 DPP7 0.151698739 PPT1 0.128889289
CUTA 0.170441481 XAF1 0.151099143 EFCAB14 0.128827943
RAB8A 0.169056726 CKLF 0.151077862 LSM7 0.128710202
KRR1 0.168986823 CGGBP1 0.150466817 LUC7L3 0.128481534
VAMP2 0.168541506 COPB1 0.15008826 KMT2E 0.127380033
BIRC2 0.168195348 DNAJA1 0.14956126 INPP5D 0.126118571
RSBN1L 0.167782831 GLG1 0.148860815 BNIP2 0.125560722
QARS 0.16736974 PUM2 0.148860815 CAPN2 0.124935296
PTPN18 0.166780326 XRCC6 0.14875673 RBMX 0.124882747
ANKRD11 0.166636475 STAT1 0.147990083 TMEM230 0.124873632
SPCS3 0.166462847 H1FX 0.147344333 EIF4G2 0.123710306
CCT4 0.166443165 SF3B2 0.147121332 PPIA 0.123672611
RBM3 0.166118603 SYNRG 0.146848967 FRYL 0.123058119
PPP2R5A 0.165549791 CCT2 0.14619569 PHIP 0.12287934
PCSK7 0.16491811 CTB-89H12.4 0.144560233 VPS29 0.122248697
H3F3B 0.164878262 MX1 0.14430441 SKAP1 0.12219721
UBE2I 0.164549395 DYNC1H1 0.14422707 CAPZA2 0.121196651
PCGF5 0.164332364 EPSTI1 0.143836217 BCAP31 0.121068535
IFITM2 0.164321747 TCP1 0.143818016 UBE2D3 0.120028225
UBE2G2 0.162561312 ATP6V1F 0.14361021 ANKHD1- 0.119476771
EIF4EBP3
RAP1A 0.162407141 DDX6 0.14309102 REEP5 0.118908143
ARID4B 0.162385343 NEMF 0.141753533 FAM89B 0.11871513
KIAA0040 0.161827689 HNRNPU 0.141075409 PPP1R18 0.1179741
AUP1 0.161534545 SRP72 0.140928238 SMARCC2 0.117972262
AC011737.2 0.161430153 CCAR1 0.140723227 IL10RA 0.117305062
C11orf58 0.16072967 PSMD6 0.140355021 SAMD9 0.117144669
RNF7 0.159214337 WAPAL 0.140033439 PHF11 0.116609696
TPR 0.158665391 DENND1C 0.139160723 DDX24 0.116453895
CAB39 0.158338768 RASSF5 0.138758852 TPM3 0.115821814
TRIM28 0.15832187 MAPK1 0.137547606 PPP2R5E 0.115389643
MTDH 0.157362483 HCLS1 0.137458999 DAXX 0.114941562
PPP1R7 0.156640269 RTFDC1 0.137225966 MDFIC 0.114600493
BLOC1S2 0.156366542 MEAF6 0.136934254 EFR3A 0.114424092
PRKCB 0.155741682 PTPN1 0.136380606 CD46 0.11437728
EMC4 0.113678151 TRIP11 0.093867919 EIF5B 0.076214436
EP300 0.112915733 NMI 0.09336339 NOP10 0.075891175
CALCOCO2 0.112093107 BRK1 0.093310333 TBCA 0.074465066
STIM2 0.111772267 C19orf43 0.093003703 GPBP1 0.074079371
SNRNP70 0.11165773 ORMDL1 0.092968295 ADH5 0.073780496
MED4 0.111439927 RABEP1 0.092783849 GIMAP6 0.073430914
HNRNPA1P48 0.111330917 PRKX 0.090834248 EEF1DP1 0.073329792
NCKAP1L 0.11111549 IFI6 0.090196789 MED13 0.071943166
SF3B14 0.110994801 TMEM50A 0.089636598 TMEM248 0.071180486
DNAJC21 0.110097683 EIF2AK2 0.088605622 AFTPH 0.071173791
MDM4 0.109959679 RNF114 0.088296598 FNBP1 0.071166584
MAPRE1 0.109270486 FNTA 0.087974514 GNA13 0.071070746
WIPF1 0.109143849 VPS4B 0.087723389 EIF1AX 0.07096605
RBM17 0.108722567 MT2A 0.08734337 SBNO1 0.069546306
SF3B1 0.108199704 EIF4EBP2 0.086615656 ATP6V0E1 0.068309896
SERBP1 0.107671208 MYEOV2 0.086367168 CCNL1 0.067967172
IRF3 0.105660089 DDT 0.085375522 IRF7 0.067892217
GLIPR2 0.10454944 ARF3 0.085361278 C19orf66 0.067254319
GOLGA4 0.104005677 URI1 0.085266145 ARHGAP25 0.066230345
CCSER2 0.103900699 TCF25 0.085025488 OIP5-AS1 0.065719911
SLTM 0.103174595 WHSC1L1 0.084751123 SF3A1 0.064523225
OPTN 0.103113725 RPL15P3 0.084747675 CIRBP 0.06420065
ARID5B 0.103033616 RAD21 0.083483132 HUWE1 0.063032567
UBE2D2 0.101893175 VPS35 0.082739981 NUP210 0.062303008
Sep. 15 0.101816114 EIF3A 0.082628283 HNRNPDL 0.061584612
PTPRC 0.101641671 SDAD1 0.082564995 CD96 0.061449634
CDV3 0.1015913 IFITM1 0.082457967 TSPAN14 0.061250235
ST3GAL1 0.101399461 KDM5A 0.082366496 HNRNPH1 0.060777882
POLR3GL 0.100966671 WASF2 0.081728166 HSP90AB1 0.060697144
MVP 0.099995099 RABGAP1L 0.0811494 DARS 0.059772198
PTP4A2 0.099486812 HNRNPUL2 0.080390778 TNIP1 0.058901653
CACYBP 0.098806281 C6orf62 0.0801926 SNRPD2 0.058833167
IDS 0.098802048 UFC1 0.079703354 TBC1D10C 0.058247243
PDCD2 0.096987995 SNRNP200 0.079431356 TRIM22 0.056920742
RAD50 0.096987995 TMBIM6 0.079302256 ANAPC16 0.056796813
ERH 0.096921244 RBM5 0.078442109 RPS15AP38 0.056668456
ALDOA 0.096884203 MACF1 0.078399207 KIAA2026 0.055914864
ICAM3 0.096290018 CORO1A 0.078364371 PRDM2 0.055897144
ATF7IP 0.095087098 FTL 0.07800592 STAT6 0.054299972
PPIB 0.094587842 SRSF5 0.077751998 PRPF4B 0.053501209
TMED2 0.09442747 CCDC91 0.077179822 TMED4 0.053141317
SH3BGRL 0.094425019 SYAP1 0.076863988 PPIG 0.052967482
DYNLRB1 0.094372436 EPC1 0.076472624 TTC1 0.052437342
TUG1 0.094223659 CCT5 0.07630883 EIF3M 0.05234172
SNRPB2 0.051746365 CSDE1 0.034518408 CNOT7 0.007232642
SETX 0.051684093 STK10 0.032534293 PHF20L1 0.007133327
DOK2 0.051516687 PAK2 0.032446534 CTB-36O1.7 0.006810488
VPS13C 0.051432629 FBXW7 0.031338392 STAT5B 0.006048252
LPXN 0.050412229 ZCCHC11 0.031181928 ARID1A 0.005722394
CTR9 0.049923019 DR1 0.031008994 CTDNEP1 0.005369374
RAP1B 0.049635469 SUMO3 0.030834926 RASA2 0.003477636
ACP1 0.049624672 SLC38A1 0.030034926 STAG2 0.00239101
UTRN 0.049331826 UBQLN1 0.029670912 NOLC1 0.002270043
NFKB1 0.04869259 SMARCA2 0.029174605 CIR1 0.001659941
CASP1 0.048249673 YWHAB 0.02823678 ITGB1 0.001435134
ELF1 0.047209266 CNTRL 0.027520812 GPBP1L1 0.000720532
ZBTB4 0.047102076 YWHAZ 0.027066103 ZKSCAN1 2.88E−05
HIST1H1D 0.046458256 PTMAP4 0.026925292 PEBP1 2.51E−05
G3BP2 0.046012174 WDR26 0.026017021 FYB −0.000992234
RBM39 0.045932293 TANK 0.025146574 ARCN1 −0.001635646
PSMB3 0.04590686 LINC00493 0.024446523 KCNAB2 −0.00262286
PPA1 0.045804939 USP14 0.024216482 RHOF −0.002980605
YTHDC1 0.045614349 TM9SF3 0.024149605 ATF4 −0.00351396
USP47 0.045255138 SP110 0.023359562 SMARCA5 −0.003546764
SRRM2 0.044840424 YWHAG 0.022782721 ZNF638 −0.004154354
DBNL 0.044819155 NME2 0.022768371 NUFIP2 −0.005339637
MZT2B 0.044380871 TMSB4X 0.022440831 TALDO1 −0.006359566
TAX1BP1 0.043943706 MYL12B 0.021222141 DYRK1A −0.006699275
WBP11 0.043130194 KIAA1109 0.018470701 HNRNPH3 −0.007866518
USP9X 0.042509604 IK 0.01821637 ESYT1 −0.008376456
RAD23A 0.042195181 AKAP9 0.017769389 UBE2R2 −0.008492178
TMEM30A 0.041495316 C12orf57 0.016943589 ZC3H13 −0.008868228
VAMP8 0.04123862 CHD4 0.016203864 SEPW1 −0.009716326
YBX1 0.040244484 DENR 0.015290422 LAMTOR4 −0.010671456
ARID5A 0.039713629 N4BP2L2 0.014694262 USP34 −0.010952694
STX16 0.039704509 RBBP6 0.014474945 SYNE2 −0.011093572
CSNK1G3 0.039407523 UBE2Q1 0.01428704 H3F3AP6 −0.011256756
KPNB1 0.039140251 AL136419.6 0.013957554 MED15 −0.011359543
HSPA8 0.038619362 SCAF11 0.013487926 ELOVL5 −0.011434195
TRAPPC5 0.038492262 NMT1 0.013132997 DDX5 −0.012372733
TIAL1 0.038020443 HIF1A 0.011916565 TAPSAR1 −0.013052188
TARDBP 0.037580733 LAMP1 0.011407931 SIPA1 −0.013679828
ZC3H15 0.037109931 MAP3K2 0.011302887 HELZ −0.015104435
PRDX1 0.036618152 CDC42 0.011175877 APBB1IP −0.015965174
TAF10 0.035943768 TMED10 0.010971933 HLA-E −0.016019852
TRAF3IP3 0.035894027 IMP3 0.00851047 TAOK1 −0.016397656
JTB 0.034797702 SAT1 0.00788386 MAF −0.017871328
ASH1L 0.034712466 MAT2B 0.007369696 UFM1 −0.018472271
GMFG −0.018611922 FNBP4 −0.047815699 NIPBL −0.07472685
CLNS1A −0.018982662 SSB −0.04839845 MAP7D1 −0.077572831
SAR1A −0.019645369 CCNI −0.048932299 ERAP2 −0.078795192
RPS24P8 −0.020454204 EIF1 −0.049284926 PDS5A −0.080299973
UBR4 −0.021089524 LSM4 −0.050322676 SEC63 −0.080906166
RB1CC1 −0.022352539 SETD2 −0.050693456 CLDND1 −0.082243716
AZIN1 −0.022753906 CKLF-CMTM1 −0.051508746 RAB14 −0.082581069
SENP6 −0.023703306 MRFAP1L1 −0.051720218 HEBP2 −0.082880568
CBFB −0.025707654 GOLGB1 −0.052028667 HMOX2 −0.083242015
DDX18 −0.025739079 GYPC −0.053195338 BPTF −0.083407765
OAS3 −0.026824239 RIF1 −0.053403877 EHD1 −0.083477219
CSTB −0.026942588 G3BP1 −0.054250625 PCNP −0.083724193
CIB1 −0.028053869 ARL6IP4 −0.054376759 PLEKHA2 −0.08510135
HNRNPA1 −0.031583297 DDX3X −0.058756581 ATP6AP2 −0.085196117
FAM177A1 −0.031831575 SSU72 −0.058764656 RPS4Y1 −0.086515586
BOD1L1 −0.031962267 OSTC −0.058809315 ITK −0.088061747
PRRC2B −0.032152358 CEP350 −0.058868809 FXR1 −0.088800254
SKP1 −0.033180062 ZAP70 −0.058913473 HNRNPUL1 −0.089452204
GIT2 −0.033502566 TAOK3 −0.059262314 AC011933.1 −0.089691379
PBRM1 −0.035937938 TCEA1 −0.060618094 NUP62 −0.092338021
AL590762.1 −0.036488169 CMTM3 −0.060903091 COMMD6 −0.092432268
KAT2B −0.037114519 TAB2 −0.06160049 ANXA2 −0.092660534
CLSTN1 −0.037480827 ISG20 −0.062190049 FLOT2 −0.093039292
NR3C1 −0.037796276 TRAM1 −0.062491603 DOCK11 −0.096053757
ARID4A −0.038197984 FIP1L1 −0.062655518 PPP1R2 −0.096715936
MPHOSPH8 −0.038379258 CREM −0.063961985 BIRC3 −0.097715444
SP100 −0.038386751 RPL35AP21 −0.064280532 PDE3B −0.098700294
RPS27L −0.039037286 TMA7 −0.064536047 DNAJC3 −0.099119174
DIAPH1 −0.039381517 PPCS −0.065291041 MIER1 −0.099766443
RHOG −0.039423649 RNPEPL1 −0.067284571 DDX21 −0.100409245
ARFGEF1 −0.039781033 KDM2A −0.067776136 RPL24P2 −0.100539591
TSC22D4 −0.04011824 LARP1 −0.068202656 UBE2H −0.104899558
RALBP1 −0.040649678 MZT2A −0.068483733 CCT3 −0.105718255
DHX9 −0.041538242 MYL12A −0.068886876 FYTTD1 −0.107162473
TAF1D −0.042427875 MYH9 −0.070052578 EIF2S2 −0.10889976
RHOH −0.042864968 WDR82 −0.070365753 BTF3 −0.110634243
PRKDC −0.04348065 BRWD1 −0.071004737 LSM14A −0.111120199
SUGT1 −0.043627832 SNX6 −0.07123632 MRFAP1 −0.111602959
CNBP −0.043667454 NPM1 −0.071366304 APOL3 −0.112867845
RPL36AP21 −0.044041986 AKAP11 −0.072138033 SMCHD1 −0.114690261
CYFIP2 −0.044536272 REST −0.07336251 ARRB2 −0.115280648
PURA −0.044600275 RPA2 −0.073433536 PSIP1 −0.115496776
ABRACL −0.044657647 U2AF2 −0.073520607 LPIN2 −0.117326436
TGOLN2 −0.047708734 GATA3 −0.074180401 NUDT3 −0.11737082
P1P4K2A −0.117485038 IER2 −0.161241913 DHRS7 −0.201766808
EVI2B −0.119966052 AC005884.1 −0.161551305 RPS24 −0.202048301
RSF1 −0.120717473 STK17B −0.163135954 ACAP2 −0.202059374
PCBP2 −0.121723289 CHD2 −0.164951502 PCED1B-AS1 −0.203464933
CTBP1 −0.123032756 PNRC1 −0.165664054 RPL36AL −0.203500955
MKNK2 −0.123315384 JUN −0.165706656 KIAA1551 −0.204904822
YY1 −0.124058353 RPL21P28 −0.16766389 POLE3 −0.205148804
RBMS1 −0.124059655 CLK1 −0.168186138 CHD3 −0.205226279
STK17A −0.124701155 DAZAP2 −0.168747449 ARHGDIB −0.207633796
BDP1 −0.126215933 SYF2 −0.169060104 SNURF −0.207838585
GPR65 −0.126254245 SLFN5 −0.169849998 NDFIP1 −0.209123998
EPRS −0.129668351 KIF2A −0.169858868 SUN2 −0.21062428
ACAP1 −0.130106898 AP000936.1 −0.169965813 TMSB10 −0.211177014
ATXN7L3B −0.130121758 ERGIC3 −0.170632513 CUL3 −0.212321451
NT5C3A −0.130234629 O5T4 −0.172067524 GLRX −0.21279021
JAK1 −0.130860951 FAM204A −0.174443988 ETS1 −0.214478946
APRT −0.131134682 RTN4 −0.174814215 UBXN1 −0.214648923
GVINP1 −0.13124866 S100A11 −0.175328651 FGFR1OP2 −0.214928598
BAZ1A −0.132555609 UBTF −0.175348794 TLK1 −0.214970248
CDC42SE2 −0.133260981 KLF13 −0.175647933 XRN2 −0.215541069
RAB2A −0.13632851 CDC42SE1 −0.17622252 CTB-79E8.3 −0.215736783
EIF3K −0.137332296 PHACTR2 −0.178594703 RSAD2 −0.215892212
RWDD1 −0.137802685 FAM107B −0.17909001 CALM1 −0.216514782
MYCBP2 −0.139537204 DYNLL2 −0.180588358 DEF6 −0.220283475
POLR1D −0.140099655 PPP1R10 −0.181689245 PSAP −0.224363567
RNF149 −0.141238412 ZC3H6 −0.181918678 ARL4C −0.2258361
PTPN2 −0.1421677 SF1 −0.182483832 DNAJA2 −0.227098909
ARHGEF6 −0.145417047 RPS19 −0.182583631 TRABD −0.227098909
ZNF101 −0.147203347 GLIPR1 −0.182601606 CCND3 −0.227682528
NUP50 −0.147414201 ERBB2IP −0.183273078 TMF1 −0.228156223
RBM27 −0.149439516 SLK −0.186022813 STT3B −0.228780885
NFE2L2 −0.149878184 EIF3H −0.1868365 ZNF217 −0.230778267
ABHD14B −0.150789741 STK4 −0.187068491 BBX −0.231499054
CD53 −0.151273603 CMPK1 −0.187627488 RPL21P75 −0.231591617
PDE4DIP −0.151745449 CTD-2013N17.1 −0.187766493 CEP85L −0.231901677
RPL12 −0.15183916 THUMPD1 −0.191619961 UBALD2 −0.233445601
LIME1 −0.153470846 MLLT6 −0.192655381 TGFBR2 −0.235113527
RPL24P8 −0.153945057 PFDN5 −0.193391155 NUB1 −0.235195426
SSR2 −0.154341857 XPC −0.19608081 SIGIRR −0.236247702
JUND −0.155077314 MBNL1 −0.197783986 LAPTM5 −0.23755316
NSA2 −0.155601632 GIMAP4 −0.198255484 EIF3D −0.239271246
C19orf60 −0.159516543 KMT2C −0.199005214 ANKRD12 −0.241653199
RPS7P10 −0.160485837 CD47 −0.199072365 STK24 −0.242474797
AKIRIN1 −0.161120635 KTN1 −0.200661105 PHF15 −0.242562114

TABLE 2
Gene expression enrichment table (Dysfunctional over cytotoxic T cells)
gene Log2 enrichment gene Log2 enrichment gene Log2 enrichment
TOX2 4.246364078 TBC1D4 1.647325425 AGFG1 1.076866057
CXCL13 4.036278733 TNIP3 1.645146769 RANBP1 1.066980292
ZBED2 3.176146138 TOX 1.599865108 PTTG1 1.065344039
DUSP4 3.165131762 GALM 1.583036233 CRTAM 1.05518417
AKAP5 3.034198419 LYST 1.582198919 ANXA5 1.053531721
CSF1 3.01220214 FUT8 1.577463535 CBLB 1.047953007
TNFRSF9 2.782034838 COTL1 1.573092823 NASP 1.046075219
NR4A2 2.780719901 STMN1 1.532278061 TNFRSF1B 1.045451402
RDH10 2.76319932 CD38 1.530849128 TMPO 1.028116806
ID3 2.747769245 RBPJ 1.514824455 HIST1H4C 1.016315726
TTN 2.719796984 XXbac- 1.50438335 GBP2 1.01151009
BPG254F23.6
MIR155HG 2.710836178 CENPF 1.502396387 CCL4 1.010269474
CCL3 2.685067084 KIF20B 1.499161911 MBD2 1.001780582
VCAM1 2.596824313 AD000671.6 1.476665438 PTPN11 1.000436748
PDCD1 2.557412907 GFOD1 1.448634439 HMGB2 0.997510965
CTLA4 2.556476899 HLA-DPA1 1.383121077 TNFAIP3 0.992321248
KIR2DL4 2.543002006 HLA-DRB1 1.331322029 MFSD6 0.989933143
SIRPG 2.488019188 MAF 1.324824159 SLA 0.98736254
SNX9 2.482502044 TRAF5 1.293235526 SMC1A 0.987267398
LAG3 2.478477582 TUBA1B 1.282131565 FKBP1A 0.986748255
ENTPD1 2.472322061 ZFP36L1 1.275419265 CD2BP2 0.982720037
SNAP47 2.427842609 CCR5 1.272368513 TRIM8 0.979740278
CXCR6 2.373113741 RGS2 1.269947688 HMGN2 0.977658867
MKI67 2.368854732 LIMS1 1.264511425 SEL1L3 0.973893962
DGKH 2.367918725 EOMES 1.261949587 CD7 0.968202549
HAVCR2 2.336536442 PCNA 1.256492775 RAB27A 0.965540958
HLA-DQA1 2.307890337 INPP4B 1.255985082 BIRC3 0.962794223
IFNG 2.285146668 TAPBPL 1.253710336 CBX5 0.961792412
CD27 2.263888577 PKM 1.240482322 BATF 0.956074735
TOP2A 2.242875364 ANKRD32 1.221168454 GGA2 0.955323838
CCL4L2 2.223429546 ATXN1 1.199378459 STAT3 0.952182056
TIGIT 2.21696405 HLA-DRB5 1.198549528 RALA 0.949090895
PTMS 2.149830649 HIST1H1B 1.18284669 RNU2-2P 0.935307315
RGS1 2.044538264 TRAF1 1.182491823 GPR171 0.933986674
AMICA1 1.992383484 VOPP1 1.181603795 GBP5 0.927116589
HLA-DMA 1.919395493 HNRNPLL 1.180543596 IFI27L2 0.922544425
FCRL3 1.834842207 WARS 1.170128203 RGCC 0.919755511
ITGAE 1.831629894 TRAC 1.14591268 CALM3 0.915665164
PHLDA1 1.818600144 SIT1 1.116619677 SPTAN1 0.914641526
ITM2A 1.784882554 CD8A 1.103531809 SMC4 0.908938074
FAM3C 1.762646221 TYMP 1.099328056 IRF2 0.902095396
HLA-DRA 1.708018888 GZMK 1.096456346 ALOX5AP 0.900858005
CD74 1.661364154 IKZF3 1.090838634 GBP4 0.900259565
PAG1 1.647865112 PPP1R16B 1.081329324 CDK6 0.898863904
DYNLL1 0.892535525 COPA 0.725293847 HMGB1P5 0.625179453
ASXL2 0.89061564 GALNT1 0.723248126 APOBEC3C 0.625034645
LINC00152 0.88998062 MAP4K1 0.72132236 ZNF106 0.624697318
STAT1 0.889229438 YWHAE 0.720866763 LSP1 0.621687448
DUSP2 0.887379787 IFI6 0.720528564 CLTA 0.620404225
METRNL 0.872057512 TUBB 0.708919567 WAS 0.619746318
PSTPIP1 0.869113687 PTMAP5 0.707794072 JAK3 0.616593092
CD84 0.851598986 ANAPC11 0.706838636 XRN1 0.614832454
AC011737.2 0.84612485 ZNF638 0.697508255 PARP14 0.613951488
LSM2 0.841079926 DHX15 0.696811446 SYNGR2 0.613487727
SYT11 0.83484488 DRAP1 0.695703247 GNAS 0.608154087
TRIM69 0.823772426 ARID5B 0.694871249 TLK1 0.60633379
HLA-DPB1 0.822260522 HN1 0.6919225 SUMO1 0.606050335
CTSB 0.821634166 BRD7 0.691260018 ANP32B 0.605368677
SHFM1 0.812708345 PTPRA 0.689574108 SURF4 0.605294588
RFTN1 0.812699209 DDX27 0.687807787 M6PR 0.602011588
ORMDL3 0.809926529 SERPINB1 0.687568148 SH2D1A 0.601321877
RCC2 0.808021023 FAM105B 0.67910903 STAU1 0.598405892
EZR 0.806057497 PIK3AP1 0.675162927 HMGB1 0.5975204
SUZ12 0.800703687 DENND2D 0.674579507 RNF187 0.597106882
TRAT1 0.789682368 FAM89B 0.672659025 SRI 0.594954783
PCED1B 0.789199538 MAPRE2 0.668657269 BST2 0.594740624
AC104698.1 0.785866589 H1FX 0.666948101 SMG1 0.594442358
VAMP5 0.782113691 CD8B 0.666526652 IPCEF1 0.593965588
PLEC 0.782062326 FKBP3 0.663361426 CCL5 0.592797613
WNK1 0.780557611 TXNDC17 0.663007232 SUPT16H 0.591548379
MCL1 0.780174304 CNTRL 0.660879058 FYB 0.586576058
ZNF101 0.774681742 PIM2 0.66016627 C17orf49 0.583627795
ANKRD11 0.767035756 UBE2L6 0.660145229 MESDC2 0.583350664
HIST1H1C 0.7615626 GTF2F1 0.653671504 PTBP1 0.582904981
PARP1 0.758089061 FAM53B 0.652781348 NAP1L4 0.576169578
TRBC2 0.755886085 KMT2A 0.65266019 PSME2 0.576017571
EPSTI1 0.754279546 PSMD8 0.652154347 ARL6IP1 0.573107458
MAP4 0.751917934 YARS 0.647966746 PTPN6 0.571298578
RIN3 0.744640669 DEK 0.6444439 PTMAP2 0.570633916
NUDT21 0.741564846 CCND2 0.644431523 SRGN 0.567983421
HSPB1 0.740244189 LASP1 0.643401628 MZT2A 0.567448017
AC092580.4 0.737905348 OASL 0.63913066 CXCR3 0.566107583
SH3KBP1 0.735969205 RPL7L1 0.636564657 CLEC2D 0.563914801
AKR1B1 0.733202642 RNF213 0.635970285 HDLBP 0.563442063
C11orf48 0.729379307 UBE2A 0.630286398 PTPN7 0.56292947
CD2 0.728623474 ADNP 0.629420545 TERF2IP 0.559488602
UBE2F 0.726326883 ANP32E 0.626293512 PDCD6 0.555049355
RNF19A 0.726197745 H2AFZ 0.625509269 PSMB8 0.552867191
UBA1 0.552316856 ZNFX1 0.505994847 SEMA4D 0.459732034
WIPF2 0.552289321 ARID5A 0.504826272 RAN 0.458953036
SSU72 0.550979254 SFPQ 0.504506933 GSPT1 0.456527563
DDX60 0.547347871 ZC3H7A 0.503555517 RAB10 0.454998678
PPP1CC 0.546217626 ID2 0.500933348 MTDH 0.454480028
RNF145 0.545880799 MIF 0.500797543 TAP1 0.450497073
NFKBIA 0.544910885 EIF5 0.498063108 GTF3C6 0.450428009
YWHAH 0.541900475 ITSN2 0.49662149 SSRP1 0.450325607
LRP10 0.540474592 GPRIN3 0.495574217 MAPKAPK2 0.448743651
TXNL4A 0.53843111 NKTR 0.492593393 MEA1 0.448270003
APOBEC3D 0.538325054 ZCRB1 0.491155307 DDX24 0.447681633
ITPKB 0.538088143 IFI44 0.490139019 LCP2 0.447077411
ALKBH5 0.537460838 TOP1 0.489234918 ANP32A 0.446485582
MIR4435- 0.536182252 SMC5 0.488741083 ERAP2 0.445328144
1HG
MAT2A 0.533279922 XCL2 0.487939169 PRRC2C 0.444916869
TBL1XR1 0.530811281 HLA-A 0.48747415 NUCKS1 0.443929423
PLA2G16 0.53078605 MAP2K2 0.487269557 SEPHS2 0.442695289
SBNO1 0.529318114 SH2D2A 0.484328388 CBX3 0.442092845
WDR83OS 0.528477459 ALDOA 0.483724564 CNOT6L 0.441119331
ZBTB1 0.527631001 PSMD4 0.482137763 TAB2 0.440718127
MIAT 0.52731174 PEBP1 0.481567473 LEPROTL1 0.440526303
SMARCA2 0.52731174 MXD4 0.481331911 PCGF5 0.438257207
ZNF292 0.52727842 C14orf166 0.479916125 ST8SIA4 0.438107925
ST3GAL1 0.527009433 CD3E 0.479272556 AKT1 0.437045335
BAZ1B 0.526100401 GATA3 0.478611636 REST 0.437008757
LDHA 0.525935727 SET 0.478334803 RPS6KA3 0.436060204
HNRNPR 0.525837897 IL2RG 0.477566652 BRD4 0.436013137
CTCF 0.525506973 IGF2R 0.475221768 LIMD2 0.435831308
PAFAH1B2 0.524899475 SREK1 0.474282517 RFC1 0.435349958
CSK 0.524822404 IL2RB 0.474189483 CALR 0.434341512
NFKB1 0.521941702 KCTD20 0.469830632 SUPT5H 0.43377704
VPS28 0.521030752 IFI16 0.469794872 AC004057.1 0.433717104
RAC1 0.520984458 LSMD1 0.468353031 TMEM189 0.43318335
AC012379.1 0.519015002 AP2B1 0.467857313 PDIA6 0.43190232
SP140 0.517637088 CTD-3214H19.4 0.466203275 ZCCHC6 0.431305922
EEF1DP1 0.516673862 SUB1 0.465826755 CKLF 0.43033687
UPF2 0.514465181 HNRNPAB 0.465741153 AC013394.2 0.430000007
SAMSN1 0.513363791 NR3C1 0.465347735 WBP11 0.430000007
FASLG 0.511021853 HNRNPL 0.464851546 LPIN2 0.429466396
CTSD 0.510736628 PSMB2 0.463028468 IFI44L 0.429414423
PSMB6 0.509220101 VPS35 0.46253711 DGKZ 0.428966431
NPIPB5 0.508696741 YTHDF2 0.462162738 TRMT112 0.428888094
HMGN1 0.506734239 ACTN4 0.461375457 FIP1L1 0.428004484
NONO 0.506421759 PARP4 0.460246044 HNRNPD 0.427346898
SLA2 0.427153705 SNORD3A 0.38880082 DDIT4 0.347258738
PSMC3 0.427104125 SMEK1 0.386458941 CREM 0.347182223
HERC1 0.426850811 N4BP1 0.385430883 C5orf56 0.345862739
NOP58 0.426430512 HNRNPA2B1 0.384476991 LMAN2 0.345631694
PRPF40A 0.426148731 NCL 0.38227436 PTGER4 0.345380449
OAS3 0.422944618 KHDRBS1 0.37925823 ILF3 0.344968283
FAM102A 0.422683019 ARID4B 0.377392964 COPE 0.344898207
PSMB9 0.421897655 NAPA 0.376994218 SMC3 0.344330832
UBXN4 0.421384293 HERPUD1 0.376848051 TOP2B 0.343981781
SNRPD1 0.421333877 CD96 0.376452428 CCT6A 0.343933428
NCOA1 0.419805905 RGS10 0.376320151 GIGYF2 0.343369834
PSMA4 0.41949318 EDF1 0.376146695 PPP6R1 0.343277162
SEC11A 0.418671841 H2AFY 0.375848572 HSPH1 0.342468891
RN7SL2 0.417518678 RBM23 0.375273114 LY6E 0.3415914
VCP 0.416319554 UBE2N 0.37491543 PSMB7 0.34085043
AP2M1 0.416123896 DNTTIP2 0.373643038 EIF3A 0.338959864
NPM1 0.415517077 ELK4 0.372690398 ARHGEF1 0.338532396
SNRPB 0.415024907 HP1BP3 0.372581398 HMGN3 0.338135925
PIK3IP1 0.413426752 PSMB4 0.372264551 UBE2D2 0.337475696
ARHGEF6 0.412879256 SRP14 0.371827485 RPL21P28 0.337096099
EXOSC9 0.409965134 USP1 0.370320339 GZMB 0.336257247
CDK2AP2 0.408688249 ELF1 0.369428174 PGK1 0.335674801
APOL3 0.408582987 RPL35AP21 0.367463081 PPP1R12A 0.33566646
MYCBP2 0.408471656 FYN 0.36596036 ZBTB38 0.335459702
RTF1 0.408326763 STAT5B 0.363876856 PSMA2 0.335097975
NCOR1 0.407901837 ARPP19 0.363259795 AIMP1 0.334696429
DYNC1H1 0.407208195 MATR3 0.362859276 CSNK2B 0.334448261
RAD21 0.406986052 C1orf43 0.362415782 PSMC2 0.334243167
PTMA 0.404079084 XAF1 0.362255888 C17orf62 0.334171842
GBP1 0.402180733 EP300 0.36184353 FERMT3 0.333789907
HDGF 0.401213799 RPL15P3 0.361781602 PTPN22 0.333351638
ABI3 0.400601137 HERPUD2 0.361572713 KMT2E 0.331556622
U2AF1 0.399775529 RNA5-8SP6 0.36135302 LAMTOR5 0.331413077
MX1 0.399425923 MGAT1 0.361348955 DARS 0.331120524
ENO1 0.399206926 EVL 0.358935162 RTFDC1 0.330398207
PCM1 0.397477784 COPZ1 0.358440955 LARP1 0.330351499
MAPK1IP1L 0.393693949 GOLGB1 0.358402342 CEP57 0.330306238
SAMD9L 0.392185573 DNAJA1 0.356645656 PDS5A 0.32834655
PJA2 0.391372023 CRIP1 0.355011285 XCL1 0.328124586
SPEN 0.390920275 ADRBK1 0.354381022 RABAC1 0.327977864
OS9 0.389486974 KIF5B 0.354360866 CCDC142 0.326119983
CHST12 0.389291896 SPATA13 0.353321756 WSB1 0.323681837
UBB 0.389255659 DNMT1 0.351316443 OAS2 0.322836397
RARRES3 0.388984896 ISG15 0.347423175 ENSA 0.322421755
CCDC85B 0.321817265 PSMA7 0.293405399 SMCHD1 0.270660024
CEP350 0.321038972 PPP1R2 0.292240975 PNN 0.268689234
ACIN1 0.319889267 THRAP3 0.291088641 ARPC2 0.268632115
EIF4H 0.319766339 CSDE1 0.290597862 AC016739.2 0.268009878
ANAPC5 0.319444633 CALM2 0.290529487 CD63 0.267848768
DHX9 0.318002082 USP7 0.289729785 SERPINB9 0.266398255
SNX20 0.317665744 SYNCRIP 0.288816582 HNRNPC 0.265560988
CTC- 0.317297433 TCEB2 0.288589435 RPL22L1 0.26541366
260F20.3
PA2G4 0.316779278 TPR 0.288155483 CD81 0.264797055
CAPZB 0.316670336 TMX4 0.287825226 CMIP 0.264361513
GGNBP2 0.316097522 PDCD10 0.286659347 EIF2AK2 0.263414493
ICAM3 0.313922978 Sep-07 0.286620849 CYLD 0.26303073
RPL12 0.31363482 PPM1G 0.285812947 THOC2 0.262329327
RBCK1 0.312418857 SQSTM1 0.285732425 RNASET2 0.261691037
SNORA67 0.311505608 WDR82 0.285732425 CANX 0.261386548
AZIN1 0.311321402 TMSB4XP8 0.284821132 PHIP 0.260957574
DTX3L 0.310760678 NAP1L1 0.28424766 NSA2 0.260944411
CHST11 0.310653724 CCAR1 0.28393594 ARPC1B 0.260876995
METAP2 0.310138412 CREB1 0.28364883 PSMA1 0.259772317
DCP2 0.309649927 POLR2K 0.283588479 TMEM258 0.259693201
CCDC69 0.309369794 FAM208A 0.283550471 UBE3A 0.259041429
MT2A 0.308521335 APOBEC3G 0.283130243 PSIP1 0.258490499
DNAJB11 0.308235661 POLR2J 0.281999753 SPCS2 0.257179124
ITGA4 0.307796461 FKBP5 0.281857341 YY1 0.256864316
SCAMP2 0.307553847 ATP1B3 0.281377957 CCSER2 0.256687314
Sep-02 0.307541262 ETF1 0.280461324 CDC37 0.256341834
HNRNPM 0.305402589 CLTC 0.280197081 CCNI 0.255907945
HNRNPU 0.304999955 PTPRCAP 0.280145096 PDAP1 0.255814348
SNRNP200 0.304798164 PSMA5 0.279113555 CTD- 0.255697259
2013N17.1
NUP210 0.304773661 WHSC1L1 0.27881603 ARHGAP30 0.254195231
DCAF7 0.304147848 NEMF 0.278323664 SNRPD3 0.254068624
GDI2 0.303519072 TAF9 0.277210934 SRSF2 0.252989823
AL136419.6 0.30234308 UBE2K 0.275500744 SRSF4 0.252707069
BDP1 0.302095673 F2R 0.275236545 C12orf57 0.25250224
FBXL18 0.301974586 MZT2B 0.275090518 NMT1 0.252477908
ATP5EP2 0.301970891 TMSB4XP4 0.275053377 SCAF11 0.251831991
SNW1 0.300364727 IL32 0.273725665 PRPF4B 0.250652518
NFATC2IP 0.300340643 XPO1 0.272893766 SERBP1 0.25006245
SRSF7 0.29733719 OIP5-AS1 0.272265884 HNRNPK 0.249542019
HSP90B1 0.297214204 RHOH 0.271636127 ARF6 0.247882735
XIAP 0.296824219 MAP1LC3B 0.2712585 AP000721.4 0.247593978
C4orf3 0.295831448 ADD1 0.271001628 DDX23 0.247252697
CLIP1 0.295263999 ATP6V0C 0.270724079 PPDPF 0.24689439
PSMB1 0.293920472 HSP90AB1 0.270676774 C7orf73 0.246315677
CAPRIN1 0.245082291 KPNB1 0.221336781 ETS1 0.198858062
CKLF-CMTM1 0.244643357 SF3B5 0.220717379 KDM2A 0.198796033
RIF1 0.244447439 TRA2B 0.220274406 TLN1 0.198517426
CTD- 0.244446222 SLFN5 0.219228599 PSMB3 0.197880758
2545G14.7
VMP1 0.24441297 PSMF1 0.218976541 SNRPG 0.197785053
UFD1L 0.243238883 ARID4A 0.21831269 ANAPC16 0.197450637
ZFR 0.242855148 SON 0.217010756 URI1 0.197288136
FNBP1 0.241822336 SRP9 0.216907033 FUBP1 0.19724479
PRKAR1A 0.240371938 STK24 0.216847337 GTF2A2 0.197039178
RECQL 0.240293844 STX16 0.216154523 CHD4 0.195350536
LPIN1 0.240033468 PHF11 0.214805415 Sep-01 0.195344317
LBR 0.239829153 TGOLN2 0.214450371 UBC 0.195006468
PARP9 0.239612636 RANBP2 0.214325817 CSNK1G3 0.19452606
HUWE1 0.239495452 RSRC2 0.214126642 BSG 0.194377891
IRF9 0.239050425 NLRC5 0.214022143 PSMG2 0.192109049
RPN2 0.238720297 HLA-B 0.213657414 RAB14 0.191786374
XRCC6 0.238720297 ATF7IP 0.213607456 PPIG 0.18983423
SH3BP1 0.238565059 DDX46 0.213381969 SF3B2 0.189822497
PSME1 0.238009448 NOP10 0.21317667 ARHGAP9 0.189822053
DNAJB1 0.23691789 HSP90AA1 0.212163064 HCP5 0.189790771
SRSF9 0.236802449 BRK1 0.211449744 BIRC6 0.189777521
CCDC91 0.236749183 SKAP1 0.209534658 RAD23B 0.18977087
PRKCH 0.235954924 NLRC3 0.20948355 OAZ1 0.188666311
TXN 0.235781977 WAPAL 0.20899374 SUMO2 0.188119097
COX6CP1 0.235511827 COL6A3 0.208835877 RNASEH2B 0.187853408
PRDM1 0.235429816 RHOA 0.20862293 PRRC2B 0.187796977
NIN 0.234812893 POMP 0.207822339 CAB39 0.187646531
PAK2 0.233639959 ZNF706 0.207325778 UBE2I 0.186741083
DOCK2 0.232606256 ATRX 0.207043163 SYNRG 0.185455511
ARPC5L 0.23244805 CEBPZ 0.20674695 HCLS1 0.18531104
DNAJC21 0.232275074 SMARCA5 0.206198364 ARHGDIA 0.185147333
PSMA3 0.231877403 EIF5A 0.20573454 LAPTM5 0.184260847
DNAJB14 0.231688698 EID1 0.205623418 ZNF644 0.18377627
TRAPPC1 0.231493538 RNPS1 0.205158683 ATP6V1F 0.183510234
ADAR 0.230997889 ILF2 0.204954056 BRD2 0.18291514
PPIB 0.230206531 RSAD2 0.204567358 HSPA4 0.18284669
C9orf16 0.22812413 TMEM109 0.204320429 BHLHE40 0.18258839
CALCOCO2 0.227987155 EIF4G2 0.204185762 CST7 0.182179545
NHP2L1 0.226409747 CCNDBP1 0.203965267 SNRPF 0.180961279
NOP56 0.224375458 XRN2 0.203347 LNPEP 0.179912476
KRAS 0.224223879 CPNE1 0.203168869 TRIP12 0.179296361
RPS15AP38 0.224135958 CIB1 0.202520288 POLR2G 0.179178851
ZNF207 0.2240937 GNAI2 0.201481506 CARD16 0.178933405
STK17B 0.223947314 LPXN 0.19935179 SPCS1 0.178870849
SNRPC 0.17804751 PTEN 0.154100495 YWHAB 0.131702373
H2AFV 0.175565051 RPL31P2 0.153698842 YBX1 0.131604481
CNOT2 0.175371862 LGALS3 0.153500804 TPP1 0.131256054
BAZ2A 0.175251856 ATP11B 0.153494544 PTMAP4 0.130874761
USF2 0.175222801 JUNB 0.152534927 CWC15 0.130568513
RBBP7 0.174895988 MKNK2 0.15148958 MYL6 0.129693682
UBE2R2 0.174843825 ARGLU1 0.15071639 ZNHIT1 0.129346624
CCT8 0.174798512 NHP2 0.150580515 LCK 0.129141764
DDX39B 0.174691693 SNRPD2 0.15050376 CHMP2A 0.128778014
GYG1 0.17316829 SREK1IP1 0.150390781 JUN 0.128437664
ESYT1 0.17313407 STK17A 0.149798567 KRT222 0.128037947
NAA38 0.172809705 USP16 0.149022108 ATRAID 0.127543843
SETX 0.172741608 PLP2 0.148762582 PAIP2 0.125890524
RAB1B 0.17239724 LARP7 0.14843159 RASGRP1 0.125587779
KIAA1551 0.171165525 TROVE2 0.147944068 SLC20A1 0.12528062
RBBP4 0.17115318 CFL1 0.14671075 ARPC3 0.125276898
SUMO3 0.17099179 AKAP13 0.146699473 RABGAP1L 0.125227581
CD3D 0.170772941 RNASEK-C17orf49 0.146362474 STAG2 0.124871845
YTHDC1 0.170333693 LMAN1 0.145482125 PTP4A2 0.124852893
EMC4 0.169995865 H3F3B 0.145242453 MRFAP1L1 0.124839784
SNURF 0.169143954 COPB1 0.143796989 SENP6 0.123914076
PREX1 0.169042132 TAX1BP1 0.143758437 RBMX 0.12341348
ATF4 0.168142279 MGEA5 0.143303946 RBM25 0.122238515
TAF7 0.167423109 ASH1L 0.142027419 GIMAP4 0.122151831
HDAC1 0.167369176 UBALD2 0.141979017 HIST2H2AC 0.121885978
PNRC2 0.167091029 SAT1 0.140903562 PPA1 0.121140331
GABARAPL2 0.163281449 IRF1 0.140469736 PDIA3 0.11982068
SRRM1 0.16323734 CNOT1 0.140207551 TNIP1 0.119469707
NOL7 0.163140553 YWHAG 0.139876894 SNRNP27 0.119446741
SF3B14 0.16270508 AIP 0.139697985 UBXN1 0.118846431
C1orf63 0.161985279 TIAL1 0.138752115 VAPA 0.118790032
HNRNPUL2 0.161759559 ZC3H11A 0.138637909 BUB3 0.118161966
AKAP9 0.161078317 RPL23AP2 0.138563448 FAM120A 0.117470416
HNRNPF 0.16019408 SAMD9 0.137944683 DYNLT1 0.116841046
XRCC5 0.158236841 PPP2R5A 0.137346946 SH3BGRL 0.116832336
SEC61B 0.158220213 DENR 0.137171709 RAB8B 0.116186801
KIF2A 0.157802549 ANXA11 0.137050674 PSMB10 0.116143887
TTC39C 0.15756368 SLU7 0.136928537 ANKHD1- 0.115811629
EIF4EBP3
RBM5 0.157321232 SRPR 0.135664451 TAF1D 0.115318077
VAMP8 0.156665237 RAP1A 0.135208899 SKA2 0.115100847
EIF3H 0.156490396 RN7SL4P 0.134993068 TMBIM6 0.114113485
CERS2 0.155944326 IRF7 0.134732449 GMFG 0.113425345
SMARCC1 0.155742355 APOL6 0.132135102 GSDMD 0.112829575
PNISR 0.155010038 SF3A1 0.132080128 GYPC 0.111854097
U2SURP 0.111752312 EIF3D 0.088230409 UHMK1 0.061920074
TAOK1 0.111731481 CMTM6 0.08813014 SMARCE1 0.061648343
CLIC1 0.109008392 HSPA5 0.086726058 VPS13C 0.061530023
RBM17 0.10820711 HNRNPH1 0.086550546 SELT 0.061067628
FAM192A 0.107643278 RPL21P75 0.085610439 KTN1 0.060395273
PAPOLA 0.107078708 PIK3CD 0.085350023 EPC1 0.060162726
CGGBP1 0.10699988 RSBN1L 0.085084039 IL16 0.0600978
USP15 0.10694309 BUD31 0.082804038 ZYX 0.059050962
HNRNPA1 0.106350615 RPL24P2 0.082270005 RSF1 0.058906012
SRSF3 0.106207717 IL10RA 0.082006746 KAT6A 0.058774038
UBL5 0.104509291 VTI1B 0.081948888 EFCAB14 0.058553379
BECN1 0.104132088 MSN 0.081776819 ZMAT2 0.058127851
UBE2G2 0.10297544 ANXA6 0.080909697 NFATC2 0.056180019
MRFAP1 0.102643987 YPEL5 0.080570055 CD3G 0.055677304
SLAMF6 0.102035395 DDOST 0.080280182 PPP1R11 0.054687617
PPP1R7 0.102018688 RAB8A 0.079442326 RPLP1 0.054314584
RNF181 0.102018688 LSM6 0.07942426 RBBP6 0.054258246
CACYBP 0.101847654 TMCO1 0.079149181 EIF2AK1 0.053698257
PCBP2 0.101712377 CMTM3 0.079022289 ARL6IP5 0.052616423
ITGB7 0.101563234 PCBP1 0.078942189 SRSF10 0.051800456
G3BP2 0.101272715 RPS2P7 0.076023892 GNB1 0.051687138
DDX17 0.101182235 LRRFIP1 0.075210787 KLRK1 0.051637603
PRPF8 0.099398324 DOCK8 0.074887483 C6orf48 0.051503409
FUS 0.098913773 SP100 0.074547155 ARAP2 0.050604495
ARF1 0.097887288 IQGAP1 0.074539539 RPL41 0.049845478
EPS15 0.097512464 WDR26 0.074109181 TNFSF10 0.04966911
RALY 0.096908382 RASAL3 0.07400762 SRSF5 0.048702513
CAPZA1 0.09643566 RSL1D1 0.073359865 RPL10AP6 0.04744867
C19orf43 0.09549839 PPP2CA 0.073269337 NAA50 0.047380383
GSTP1 0.095271207 WASF2 0.072560237 GNB2 0.047262147
FDFT1 0.095198416 CELF2 0.072292836 SLC38A1 0.046596369
SRSF11 0.094651272 NUFIP2 0.07191049 BTN3A2 0.045930013
EVI2A 0.094391459 DYNLRB1 0.071684526 SRSF1 0.045829939
PSMC5 0.094377118 PPP1CA 0.070796133 USP47 0.045063464
RASSF5 0.092957125 SP110 0.070088833 SPCS3 0.043946366
PTGES3 0.092711391 CXCR4 0.069976709 AMZ2 0.043566006
COPS6 0.092691196 CTSS 0.067209039 HSPA8 0.042906926
TBCB 0.09179731 STT3B 0.067014606 BCLAF1 0.042813492
DBNL 0.091765099 C8orf59 0.065169336 HNRNPUL1 0.042746834
WDR1 0.090856872 EIF3I 0.064765418 FAM96B 0.041332565
TRIM22 0.090279448 PNRC1 0.063621961 PDCD5 0.040926508
PVRIG 0.090265018 TARDBP 0.062815268 ZC3H13 0.039334246
RPL24P8 0.090263179 RPL39 0.062274182 AC005884.1 0.038868837
SASH3 0.088683297 ENY2 0.06209453 FRG1 0.038842744
NDFIP1 0.038761753 MAT2B 0.010954865 CFLAR −0.012715678
NEDD8 0.038397505 CTB-89H12.4 0.010821529 RPS24P8 −0.013369414
AC007969.5 0.038374511 SLTM 0.010196189 KIAA2026 −0.013943406
SRRM2 0.038338342 PRDX1 0.0099881 ARPC4 −0.014334415
TCEB1 0.037743683 PTPN2 0.009827899 TANK −0.014408258
ORMDL1 0.037712921 SNRPB2 0.009776683 PUM2 −0.014451429
TMEM14B 0.036594785 ITK 0.009737801 PDCD4 −0.014874019
ZCCHC11 0.036555997 CHD2 0.009713873 TRAPPC5 −0.0150988
SRP72 0.034402353 MOB3A 0.008932209 EWSR1 −0.0155502
Z82188.1 0.033307447 HLA-F 0.0087219 SERP1 −0.016642758
IRF3 0.032198616 COMMD6 0.008021766 CCT4 −0.016670327
POLR2L 0.031960801 NIPBL 0.0068219 VAMP2 −0.016700464
TGFBR2 0.031403734 Sep-06 0.006185718 ABCF1 −0.017223053
PPIA 0.030597894 RPS7P10 0.005722805 EIF1 −0.018428428
NSRP1 0.03052581 USP8 0.00441441 ATG12 −0.019200245
ZNF655 0.030413444 KRR1 0.004334469 SH3GLB1 −0.019653456
CLSTN1 0.030190966 BCL11B 0.002194462 TMEM50A −0.019935272
MAP3K2 0.029283421 JTB 0.001819719 NMI −0.020082922
CTDSP1 0.029167881 SRP19 0.001293363 ARL6IP4 −0.020218201
PAFAH1B1 0.028939588 PFDN5 0.001144198 RPL13AP25 −0.020649975
DEF6 0.028419796 PHF20L1 0.000236008 REEP5 −0.02133552
S100A11 0.02826972 RPS27L −0.000823517 C19orf66 −0.021790298
BTF3 0.02761011 SF3B1 −0.002144295 ACAP1 −0.022344379
UBE2D3 0.026701524 UGP2 −0.002216546 CIRBP −0.023031622
CCNL1 0.02566998 RBX1 −0.002424582 TUBA4A −0.023967648
RN7SL3 0.024793287 BPTF −0.002601679 ATP6V1E1 −0.023983981
SNHG5 0.024140916 PSMD7 −0.003503329 ARID1A −0.025101483
RPL15P2 0.023340972 GZMA −0.004158427 GOLGA4 −0.025180935
OGT 0.023287502 B2M −0.005672531 PRPF38B −0.026004767
MYH9 0.022992128 LSM3 −0.006267521 RPL37P2 −0.026203044
BTG2 0.022874684 ZBTB4 −0.006454513 GOLGA7 −0.027209403
ST13 0.021546424 APBB1IP −0.006743845 BTN3A1 −0.02807256
CELF1 0.02077087 TMEM59 −0.006986916 CDV3 −0.030008369
CCT5 0.020540796 GIMAP6 −0.007148931 SERINC3 −0.031067606
SKP1 0.019809653 POLR3GL −0.00785893 EIF2S2 −0.031307582
FMNL1 0.019678021 CSNK1D −0.008289983 SZRD1 −0.031977594
MYEOV2 0.018856706 EIF5B −0.00886603 HNRNPA3 −0.032544112
FAIM3 0.015992601 RAB11A −0.008979241 PPHLN1 −0.033783729
DAD1 0.015359033 CCNK −0.009655606 RBM8A −0.034320058
CNOT7 0.014633937 SCARNA9 −0.009820924 SF1 −0.034563195
ATP6V0E1 0.013665649 MPHOSPH8 −0.010046952 BCAP31 −0.035443903
MEAF6 0.013032566 CDC5L −0.010726421 ANKRD12 −0.036038968
C19orf53 0.012942939 CD6 −0.012116002 DHX36 −0.036141879
RAD23A 0.010954954 SNX6 −0.012275943 ATP2B4 −0.036281233
SETD2 −0.037398696 SEC62 −0.063851504 OSBPL8 −0.093209559
C6orf62 −0.037737369 RPS2 −0.06411251 RPS3AP47 −0.093319792
JAK1 −0.03900138 ROCK1 −0.064393921 SSR1 −0.093883225
HLA-E −0.039391871 ISG20 −0.065598687 MANF −0.096102028
MDM4 −0.040533527 IMP3 −0.065663171 CSTB −0.09635792
SVIP −0.040643888 TMED2 −0.067690089 WAC −0.096455975
SMAP2 −0.041022065 RPL30P4 −0.067858328 PCNP −0.096898523
ERGIC3 −0.041499903 KRCC1 −0.069024246 THEMIS −0.098481079
VIM −0.041539044 AC079250.1 −0.070048536 RN7SL1 −0.098981497
CAP1 −0.045378062 LAMP1 −0.070340814 HIST1H1E −0.10076121
PRF1 −0.045987136 RNF7 −0.070781572 RPL24 −0.100968457
RPSAP58 −0.047146354 EIF3L −0.071313518 SH3BGRL3 −0.100970387
PTPRC −0.047580328 RNPEPL1 −0.071319784 ACTB −0.101772165
PSD4 −0.047705386 DERL1 −0.071603176 PRKX −0.102479135
SYTL3 −0.047945019 CREBBP −0.071781376 OST4 −0.103730141
SAP18 −0.049073141 EEF1D −0.072467016 CTD- −0.103874802
2666L21.3
OPTN −0.049167769 CDC42SE2 −0.073300911 EML4 −0.104978591
FAM111A −0.04960079 TMEM66 −0.073502701 KDM5A −0.105916999
EIF3J −0.049707972 ACTR3 −0.074027482 BNIP2 −0.106129617
HLA-C −0.050251124 RAB7A −0.074289553 FGFR1OP2 −0.106315442
FTL −0.052870009 CD164 −0.074994296 PYHIN1 −0.106573223
TRGC2 −0.053667903 CCT3 −0.075978703 ZFP36 −0.106966454
ERP29 −0.055401631 AKNA −0.077014819 STK10 −0.107110288
AKIRIN1 −0.055745135 CORO1A −0.077634737 EEF2 −0.109152482
RER1 −0.056573664 RPL23 −0.078822704 RPL17- −0.109212835
C18orf32
RPL4P2 −0.057271821 ACP1 −0.07955762 BAZ1A −0.109883026
WIPF1 −0.057594992 ZNF24 −0.080383433 TACC1 −0.110006478
TMOD3 −0.057672672 MOB1A −0.08131844 CDK13 −0.111159584
SEC11C −0.057967924 GNB2L1 −0.082179675 TMED4 −0.111663182
TTC3 −0.057967924 PPP1CB −0.082201217 EIF4A2 −0.112194726
C10orf118 −0.058340379 CAPNS1 −0.082581904 RABEP1 −0.112444545
NACA3P −0.059857311 SERF2 −0.082724931 TSPAN14 −0.113960615
C11orf58 −0.060021127 CHD3 −0.085463003 RPL18 −0.114110165
DDX18 −0.06004019 C19orf60 −0.085920636 CTC- −0.115901455
260E6.2
TAF10 −0.060638964 CDKN1B −0.086624861 MYL12B −0.117179701
FBXO7 −0.060966509 ZBTB7A −0.087163451 LSM14A −0.117766662
EIF3M −0.061260343 SSR3 −0.087529358 CNN2 −0.117829629
TMSB4X −0.062351588 UBE2Q1 −0.08947315 TRAM1 −0.11825899
RHOF −0.0627426 PBXIP1 −0.090850945 RPS24 −0.118581805
FNTA −0.062872363 RPL15 −0.091486361 SMEK2 −0.119655545
SLFN12L −0.063585539 ACTR2 −0.091831451 RBM3 −0.119754358
TAPBP −0.063723974 RPS12P23 −0.09190132 TPM3 −0.119777113
CUTA −0.063755192 HNRNPDL −0.092136116 DDX21 −0.11980006
IDS −0.063851504 CASP1 −0.092402279 RPS9 −0.121540668
IVNS1ABP −0.12158007 NACA −0.151596608 TCF25 −0.180945814
SNX3 −0.121609463 CTDNEP1 −0.154618858 ABI1 −0.181662943
CLEC2B −0.122920895 CD37 −0.156561252 ACTG1 −0.184532237
RPL36AP21 −0.123360187 BIRC2 −0.157231303 Sep-15 −0.185678711
FOXN3 −0.123467066 PRDM2 −0.158660987 MAN1A2 −0.185930556
CASP4 −0.123819949 ABRACL −0.158882369 PTBP3 −0.186273888
SYNE2 −0.124035393 GPATCH8 −0.159646408 UBLCP1 −0.186682452
SEC61G −0.124207171 FNBP4 −0.159676682 RPL26 −0.186769584
GPSM3 −0.124379551 EIF1AX −0.1602536 DDX5 −0.186988399
BIN1 −0.125227436 ZC3H15 −0.160256906 TAOK3 −0.187478157
UFC1 −0.125291809 SYAP1 −0.162041364 STK4 −0.188592106
MORF4L1 −0.126135937 TNFAIP8 −0.162208153 NUDT3 −0.188805524
JUND −0.128028965 CLK1 −0.162698219 RPL13AP5 −0.189380987
C17orf76- −0.12893012 MACF1 −0.162754529 RPS15 −0.189440725
AS1
AC107983.4 −0.129538226 PSAP −0.163122426 LUC7L3 −0.191458984
MAPRE1 −0.129858004 EIF3K −0.163251894 TMC8 −0.191966763
YWHAQ −0.130110034 EHD1 −0.163703865 CAPN2 −0.192708785
NKG7 −0.130438624 EIF2S3 −0.163902962 CMPK1 −0.194677042
PRR13 −0.130796742 CIR1 −0.164026009 RPS11 −0.194980043
LAMTOR4 −0.134628045 PABPN1 −0.164547602 GCC2 −0.195022324
FAM107B −0.134697894 AC009245.3 −0.164684305 VPS26A −0.196000279
RPL13P12 −0.134722144 N4BP2L2 −0.165695528 RPL28 −0.197016778
DR1 −0.136890795 EIF3E −0.166240992 SELK −0.198198615
BZW1 −0.13702138 DNAJC1 −0.166742608 RPS28 −0.198586267
CTSC −0.13825913 RHOG −0.166747616 VPS4B −0.198877451
POLR1D −0.138563442 PHF3 −0.166988373 AC002994.1 −0.200994224
FXR1 −0.138800171 NUB1 −0.170624903 CTD- −0.201224969
2031P19.4
Y_RNA −0.138927143 TMA7 −0.170806026 RPS4XP11 −0.201545131
IK −0.139414778 GPBP1 −0.171083144 IFITM1 −0.202443669
TM9SF3 −0.141108094 RPS19 −0.17168262 CNBP −0.202575159
BOD1L1 −0.141212614 GLG1 −0.172331088 DAZAP2 −0.202681623
EVI2B −0.143209796 MIER1 −0.173609885 OSTC −0.203288822
FBL −0.14362595 ERBB2IP −0.173722743 RB1CC1 −0.204047876
PTPN1 −0.145750995 RPS5 −0.173780158 APMAP −0.20537768
IFIT3 −0.146804479 PFN1 −0.174140254 TMEM30A −0.205666002
DNAJC8 −0.14740075 GIMAP7 −0.17428042 ARCN1 −0.20811445
SHISA5 −0.147668798 RBM39 −0.175638122 RPL36 −0.210730161
TMEM248 −0.148161155 ARHGAP15 −0.177722986 RPS7P1 −0.211644539
RPS20P10 −0.148595464 CARD8 −0.17834958 UBE2L3 −0.213178433
UTRN −0.149091904 Sep-09 −0.178488895 BBX −0.214405098
HSPA1A −0.14913323 ABHD14B −0.178733578 RPS4XP7 −0.215281803
IL27RA −0.150107847 RPL8 −0.178814725 NME2 −0.215675151
AP000936.1 −0.150443504 ZFC3H1 −0.180140888 SNX5 −0.218087705
RPL36AL −0.15119346 MED15 −0.180195744 CTB-79E8.3 −0.218518674
FXYD5 −0.219351533 CTB-36O1.7 −0.263001729 CYTIP −0.310302171
RPS2P5 −0.220331891 MIR3654 −0.263542682 RPL34P31 −0.310721325
SSR2 −0.221608698 SSB −0.264922036 C9orf78 −0.31189415
GTF3A −0.221685178 RASA2 −0.265325831 RPL7A −0.31275119
PRKACB −0.222712831 DOCK11 −0.265485377 RTN4 −0.314300532
CCDC88C −0.223180899 SPOCK2 −0.265601897 AUP1 −0.314466466
RPLP0 −0.223279724 EIF3F −0.266478943 UXT −0.314975237
USP34 −0.224805723 IRF2BP2 −0.266962959 RPL24P4 −0.315978041
RPS17L −0.225225183 TRIM38 −0.27114843 FBXW7 −0.317509859
KIAA1109 −0.225335468 ARPC5 −0.272953339 RPS8 −0.318182689
SEPW1 −0.226941559 TMED5 −0.273058482 PPP2R5C −0.319603403
TMEM230 −0.227105375 CD97 −0.273305799 RPS29 −0.321786177
KAT2B −0.227525436 LGALS8 −0.274578987 GAS5 −0.324742248
TRAF3IP3 −0.228006404 TBC1D10C −0.27472127 TCP1 −0.324829087
UBA52 −0.228416064 KMT2C −0.275546829 POLE3 −0.324890498
MBNL1 −0.229118933 RPS20P14 −0.276016714 TMED10 −0.325736583
PPP1R18 −0.234681037 RPL4 −0.276710928 LITAF −0.325938927
EIF3G −0.235069861 EPRS −0.28030505 RPS7 −0.327699603
EEFIA1 −0.235303198 SAR1A −0.280414393 SERINC1 −0.328704591
LIME1 −0.238075392 RPL7AP6 −0.281465502 RPS6 −0.332389009
RPL13 −0.240291423 RPS16 −0.281628935 PRR5L −0.332558036
IER2 −0.240612338 TMSB10 −0.281749382 RPL11 −0.333188387
ARHGEF3 −0.241111029 SYF2 −0.282363097 GIMAP1 −0.334896758
KCNAB2 −0.243722341 YIPF4 −0.283038248 RPL32 −0.337468933
MTPN −0.245460018 HSPA1B −0.283655145 ZC3HAV1 −0.337631997
TRAPPC10 −0.246811714 HIST1H1D −0.283785417 SLC9A3R1 −0.338404542
SLC2A3 −0.24821468 CYFIP2 −0.286467763 RPS4Y1 −0.338906161
RPS13 −0.248799118 EMB −0.287425109 RPL37P23 −0.33994822
DIAPH1 −0.250676191 DUSP1 −0.288644193 RWDD1 −0.340369336
FAM204A −0.250740522 IKZF1 −0.290300258 CYBA −0.342016405
SSBP4 −0.250893389 RPL29 −0.293134432 FTH1P8 −0.342133345
TAPSAR1 −0.251065027 RPS4X −0.294921021 GIMAP2 −0.343693458
RCSD1 −0.251309619 CCT2 −0.295357204 CTSW −0.344433828
ATXN7L3B −0.251958976 HMHA1 −0.295389994 TPM4 −0.345947599
ITM2B −0.254045123 LTB −0.29664062 GIMAP5 −0.347025418
ARHGDIB −0.255130822 H3F3AP6 −0.296956226 RPL6 −0.347056726
ZAP70 −0.255963101 CTBP1 −0.297066795 CTD- −0.348848562
2248H3.1
GLTSCR2 −0.256536249 RPL27 −0.29842396 HNRNPH3 −0.34960096
ARFGEF1 −0.256882983 YWHAZ −0.299657535 TMC6 −0.350286646
APRT −0.257193446 ATP6V1G1 −0.300452772 TNRC6B −0.350799523
FAU −0.257302852 SEC31A −0.301193633 ABHD17A −0.352364961
INPP5D −0.258894485 DNAJC3 −0.30470924 PIK3R1 −0.352367914
RPL19 −0.261886679 PPCS −0.307776947 RPL35 −0.35346904
FAM49B −0.262974567 ORAI1 −0.3095392 ACAP2 −0.355022173
TBCA −0.356257272 PABPC1 −0.399541338 GLIPR1 −0.496231063
TAGLN2 −0.357358971 ITGB2 −0.403724103 RUNX3 −0.496579207
CDC42 −0.358108273 AC007387.2 −0.403786531 C16orf54 −0.498090567
CD44 −0.358946364 PPP2R5E −0.40413355 EEF1A1P5 −0.50000952
RPS27A −0.359326551 AC073610.5 −0.404957188 RPS3AP6 −0.500033907
BTG1 −0.359572701 ARIH2 −0.405972077 EIF4EBP2 −0.500722325
CTB-63M22.1 −0.360443861 RPL22 −0.406320842 UCHL5 −0.502398902
HECA −0.361548025 ERH −0.4130443 RPL5P34 −0.510281152
RPS7P11 −0.361744555 THUMPD1 −0.414779474 STIM2 −0.512925218
RPL35P5 −0.363854577 RPL5P17 −0.416500556 RPL34P18 −0.514295577
RPL37 −0.364068248 AB019441.29 −0.419315073 SC22CB- −0.519881101
1E7.1
CHMP4B −0.364343787 CHURC1 −0.422231738 CTD- −0.520635164
3035D6.1
DCAF5 −0.366730799 UBE2B −0.424956806 RPL10P3 −0.525284451
PTPN18 −0.368280268 RPS4XP6 −0.425443121 RPS20 −0.533255911
PFNIPI −0.368744698 C12orf75 −0.433479927 EIF4B −0.533440201
TC2N −0.37003223 RPL31 −0.43429294 ZRANB2 −0.533743912
DNAJA2 −0.370569027 GLRX −0.439300585 RPL6P27 −0.538367849
RPS23P8 −0.371150898 RPL37A −0.442077183 PCSK7 −0.540501279
SEC63 −0.371616662 LAT −0.443458511 VASP −0.540620986
ZFAS1 −0.372587831 OFD1 −0.444224074 CALM1 −0.542949477
RPSA −0.373012718 OTUB1 −0.445001729 RPS3 −0.544583766
PIN1 −0.374535165 DICER1 −0.448035883 RPL36A- −0.545292364
HNRNPH2
RPL18AP3 −0.375433413 CTD-2192J16.15 −0.449594972 DIP2A −0.547308309
HOPX −0.376528944 RSL24D1 −0.450922135 MYO1G −0.550959474
RPL27A −0.377772021 SNORA52 −0.45589142 SELPLG −0.55168156
THOC7 −0.378018027 TTC14 −0.456906815 MIR142 −0.558066774
ITGAL −0.380932577 RPL23A −0.459197855 RPL31P7 −0.55816466
MLLT6 −0.382420422 STK39 −0.466777449 AL161626.1 −0.558179008
RPLP2 −0.382553276 SLAMF7 −0.468207641 KLRD1 −0.560502179
NFATC3 −0.384049221 ZNF33A −0.469326351 RPL30 −0.561155983
ANXA2 −0.386048512 RPS12 −0.470744295 GPR56 −0.56133914
FGD3 −0.387623409 RPL34P34 −0.472622763 SPN −0.563471577
AES −0.387639784 CD53 −0.475938556 MYO1F −0.564436468
RPS17 −0.389423746 RNU4ATAC −0.476978087 TAGAP −0.565442062
UFM1 −0.390415053 RPS23 −0.477394261 ARRB2 −0.566035484
RBL2 −0.391717547 SP140L −0.477783169 AD000092.3 −0.566809964
HCST −0.392143307 RPS21 −0.479033914 FLNA −0.569143069
RPL38 −0.393335811 ARHGAP25 −0.480066448 RPL9P3 −0.574133513
RAB7L1 −0.394660391 RPS3AP26 −0.484455302 RPL7AP30 −0.574350599
TPT1 −0.395874419 RPA2 −0.484906287 XBP1 −0.574782928
SCFD1 −0.396394599 RNF125 −0.485039157 RBMS1 −0.57619459
PCED1B-AS1 −0.397901124 RPL5 −0.487037702 AL590762.1 −0.5764221
PIP4K2A −0.398286821 EIF4E3 −0.488849707 PRKCB −0.578155694
GNPTAB −0.399422527 FAUP1 −0.493343397 RPS25 −0.580554197
SNORD100 −0.58220023 IFITM2 −0.670686661 ADAM8 −0.825269248
MYL12A −0.582771606 FOS −0.673433452 SIGIRR −0.833731267
SIPA1 −0.584897652 PLEKHB2 −0.681668338 PLEKHA2 −0.839042314
SUN2 −0.585136068 SNHG8 −0.695961478 S100A4 −0.841020512
GRK6 −0.589466476 FAM129A −0.698234346 TMEM123 −0.842897864
RPL14 −0.59008004 AC022431.1 −0.69857368 RPL10 −0.845234718
LGALS1 −0.595719441 SNHG6 −0.698822917 ITGB1 −0.845683317
FLI1 −0.596180878 SNRK −0.704268205 AHNAK −0.859507184
GVINP1 −0.596331935 RPL5P1 −0.70937821 FUT11 −0.864078312
GNG2 −0.597687614 CD247 −0.709958047 SYVN1 −0.86793939
RPS10 −0.600311759 EEF1B2 −0.71040053 ATM −0.877577565
FOXP1 −0.600402865 MAPK1 −0.712218527 STAT4 −0.888586443
RGS19 −0.605813217 RPL15P18 −0.714258581 PIM1 −0.90799456
RPL14P1 −0.60602406 EPB41 −0.714472359 GPR65 −0.909871415
GRAP2 −0.610420938 CD69 −0.717470849 LPCAT1 −0.909977135
RASSF1 −0.612688241 PRMT2 −0.723038476 AIM1 −0.919403438
TSC22D3 −0.615274117 S100A6 −0.727843176 PICALM −0.923473932
DHRS7 −0.623628873 SAMHD1 −0.730009225 CTB-13H5.1 −0.932207045
SNORA21 −0.62691957 CD52 −0.732758071 CRBN −0.935918926
RPL18A −0.628322526 CYTH1 −0.734132177 SAMD3 −0.940268415
RAB2A −0.630585899 KLF6 −0.734514718 RPS26P3 −0.955180916
RPL5P4 −0.631338004 RPL4P4 −0.735719058 RPS18P12 −0.976116547
AC004453.8 −0.637981458 CSNK1G2 −0.736540976 MIR4426 −0.986216635
CD48 −0.638514194 ZEB2 −0.744273126 RORA −1.011381106
RPS12P26 −0.639841255 MYADM −0.74630447 SNORD54 −1.023561261
RPL23P8 −0.640779211 CD5 −0.747964528 TGFB1 −1.032744394
KLF13 −0.641312841 GZMH −0.748507537 S1PR4 −1.04680028
PTPRE −0.645341521 SNORD33 −0.757431514 ARL4C −1.047573013
RAP1B −0.65206146 RPL3P4 −0.758710036 ADD3 −1.074733464
PARP8 −0.652583813 RPS3AP25 −0.766671093 RPS3A −1.091806291
CAST −0.654455736 TRGC1 −0.768882262 RASA3 −1.117467173
IQGAP2 −0.655475282 SYNE1 −0.776726743 CISH −1.121199368
GLIPR2 −0.65740651 SYTL1 −0.788414043 GLUL −1.123797764
IFITM3 −0.660585759 TPST2 −0.789248047 KLRG1 −1.126206038
DOK2 −0.661249412 ST6GAL1 −0.79169706 TRDC −1.175148522
RPL13A −0.663177113 ZFP36L2 −0.794711311 FLT3LG −1.195045669
CTC- −0.665145234 SYTL2 −0.799462016 FAM101B −1.195185566
575D19.1
RPL17 −0.665440982 MBP −0.799765267 RPL3P2 −1.211121384
CD47 −0.666468952 CDC25B −0.800933715 TES −1.219027083
KLRC3 −0.666528125 RPL39P3 −0.802602245 BIN2 −1.22399095
RPS15AP24 −0.666945763 CCND3 −0.815121492 EMP3 −1.238574249
MIR4461 −0.667423432 CDC42SE1 −0.819824071 DSTN −1.256907828
RPS11P5 −0.667506025 RPS3AP5 −0.822432246 TBX21 −1.257847021
RPS27 −0.670207707 ZNF91 −0.824138188 RPL9 −1.257929751
SCARNA17 −1.258055987 FGFBP2 −3.625303303
EFHD2 −1.284676374 CX3CR1 −3.89599549
ANXA1 −1.319255793
RPL3 −1.321233896
S100A10 −1.333249522
TXNIP −1.336561642
LYAR −1.34307284
ZNF683 −1.344891044
STK38 −1.373902943
RAP2B −1.390194315
CDC42EP3 −1.412009563
RPS4XP22 −1.415835472
LINC00861 −1.477545987
TCF7 −1.547463756
RPS26P13 −1.594276603
KLRB1 −1.61268254
PLEK −1.653288825
PTGER2 −1.680635716
SELL −1.681257967
FCRL6 −1.700521674
MGAT4A −1.712793728
MATK −1.723951247
LCP1 −1.736741652
FAM65B −1.952662791
PXN −1.960906257
SPON2 −1.973436319
C1orf21 −2.000006077
FGR −2.160079299
SSR4 −2.230095632
KIR2DL1 −2.255399813
SORL1 −2.273390624
FCGR3A −2.359501383
MYBL1 −2.465472748
KLF2 −2.480976663
GNLY −2.511289185
C1orf162 −2.636492352
IL7R −2.702324738
TGFBR3 −2.726648453
CD300A −2.828201035
S1PR1 −2.895840659
PLAC8 −2.953691051
S1PR5 −3.362079875
TYROBP −3.428687971
KLRF1 −3.573438845

According to a specific embodiment, the cells are tumor infiltrating lymphocytes (TILs).

Methods of isolating TILs are well known in the art. Typically, this is done by dissociating the tumor tissue in the presence of a protease following by a centrifugation on a discontinuous Percoll gradient (e.g., GE Healthcare). Isolated cells are then used in various assays of T cell function, expression, cell cycle or a combination of same. Other exemplary methods of isolating TILs are further described hereinbelow.

According to a specific embodiment, following isolation, the preparation is essentially free of tumor cells e.g., less than 20%, 10% or 5% tumor cells are in the preparation.

Methods of determining gene expression profiles can be performed at the RNA or protein level.

Below is a more detailed description of methods that can be used to analyze expression of a plurality of genes on the single cell level.

Methods of Analyzing and/or Quantifying RNA

Northern Blot analysis: This method involves the detection of a particular RNA in a mixture of RNAs. An RNA sample is denatured by treatment with an agent (e.g., formaldehyde) that prevents hydrogen bonding between base pairs, ensuring that all the RNA molecules have an unfolded, linear conformation. The individual RNA molecules are then separated according to size by gel electrophoresis and transferred to a nitrocellulose or a nylon-based membrane to which the denatured RNAs adhere. The membrane is then exposed to labeled DNA probes. Probes may be labeled using radio-isotopes or enzyme linked nucleotides. Detection may be using autoradiography, colorimetric reaction or chemiluminescence. This method allows both quantitation of an amount of particular RNA molecules and determination of its identity by a relative position on the membrane which is indicative of a migration distance in the gel during electrophoresis.

RT-PCR analysis: This method uses PCR amplification of relatively rare RNAs molecules. First, RNA molecules are purified from the cells and converted into complementary DNA (cDNA) using a reverse transcriptase enzyme (such as an MMLV-RT) and primers such as, oligo dT, random hexamers or gene specific primers. Then by applying gene specific primers and Taq DNA polymerase, a PCR amplification reaction is carried out in a PCR machine. Those of skills in the art are capable of selecting the length and sequence of the gene specific primers and the PCR conditions (i.e., annealing temperatures, number of cycles and the like) which are suitable for detecting specific RNA molecules. It will be appreciated that a semi-quantitative RT-PCR reaction can be employed by adjusting the number of PCR cycles and comparing the amplification product to known controls.

RNA in situ hybridization stain: In this method DNA or RNA probes are attached to the RNA molecules present in the cells. Generally, the cells are first fixed to microscopic slides to preserve the cellular structure and to prevent the RNA molecules from being degraded and then are subjected to hybridization buffer containing the labeled probe. The hybridization buffer includes reagents such as formamide and salts (e.g., sodium chloride and sodium citrate) which enable specific hybridization of the DNA or RNA probes with their target mRNA molecules in situ while avoiding non-specific binding of probe. Those of skills in the art are capable of adjusting the hybridization conditions (i.e., temperature, concentration of salts and formamide and the like) to specific probes and types of cells. Following hybridization, any unbound probe is washed off and the bound probe is detected using known methods. For example, if a radio-labeled probe is used, then the slide is subjected to a photographic emulsion which reveals signals generated using radio-labeled probes; if the probe was labeled with an enzyme then the enzyme-specific substrate is added for the formation of a colorimetric reaction; if the probe is labeled using a fluorescent label, then the bound probe is revealed using a fluorescent microscope; if the probe is labeled using a tag (e.g., digoxigenin, biotin, and the like) then the bound probe can be detected following interaction with a tag-specific antibody which can be detected using known methods.

In situ RT-PCR stain: This method is described in Nuovo G J, et al. [Intracellular localization of polymerase chain reaction (PCR)-amplified hepatitis C cDNA. Am J Surg Pathol. 1993, 17: 683-90] and Komminoth P, et al. [Evaluation of methods for hepatitis C virus detection in archival liver biopsies. Comparison of histology, immunohistochemistry, in situ hybridization, reverse transcriptase polymerase chain reaction (RT-PCR) and in situ RT-PCR. Pathol Res Pract. 1994, 190: 1017-25]. Briefly, the RT-PCR reaction is performed on fixed cells by incorporating labeled nucleotides to the PCR reaction. The reaction is carried on using a specific in situ RT-PCR apparatus such as the laser-capture microdissection PixCell I LCM system available from Arcturus Engineering (Mountainview, Calif.).

Single Cell Transcriptome Analysis

This method relies on sequencing the transcriptome of a single cell. In one embodiment a high-throughput method is used, where the RNAs from different cells are tagged individually, allowing a single library to be created while retaining the cell identity of each read. The method can be carried out a number of ways—see for example US Patent Application No. 20100203597 and US Patent Application No. 20180100201, the contents of which are incorporated herein by reference.

One particular method for carrying out single cell transcriptome analysis is summarized in FIG. 7 and detailed herein below.

Cells are typically aliquoted into wells such that only one cell is present per well. Cells are treated with an agent that disrupts the cell and nuclear membrane making the RNA of the cell accessible to sequencing reactions.

According to one embodiment, the RNA is amplified using the following in vitro transcription amplification protocol:

(Step 1) contacting the RNA of a single cell with an oligonucleotide comprising a polydT sequence at its terminal 3′ end, a T7 RNA polymerase promoter sequence at its terminal 5′ end and a barcode sequence positioned between the polydT sequence and the RNA polymerase promoter sequence under conditions that allow synthesis of a single stranded DNA molecule from the RNA, wherein the barcode sequence comprises a cell barcode and a molecular identifier;

The polydT oligonucleotide of this embodiment may optionally comprise an adapter sequence required for sequencing—see for example FIG. 5.

RNA polymerase promoter sequences are known in the art and include for example T7 RNA polymerase promoter sequence—e.g.

(SEQ ID NO: 63)
SCGATTGAGGCCGGTAATACGACTCACTATAGGGGC.

Preferably the polydT sequence comprises at least 5 nucleotides. According to another embodiment the polydT sequence is between about 5 to 50 nucleotides, more preferably between about 5-25 nucleotides, and even more preferably between about 12 to 14 nucleotides.

The barcode sequence is useful during multiplex reactions when a number of samples are pooled in a single reaction. The barcode sequence may be used to identify a particular molecule, sample or library. The barcode sequence is attached 5′ end of polydT sequence and 3′ of the T7 RNA polymerase sequence. The barcode sequence may be between 3-400 nucleotides, more preferably between 3-200 and even more preferably between 3-100 nucleotides. Thus, the barcode sequence may be 6 nucleotides, 7 nucleotides, 8, nucleotides, nine nucleotides or ten nucleotides.

In one embodiment, the barcode sequence is used to identify a cell type, or a cell source (e.g. a patient).

Molecular identifiers are useful to correct for amplification bias, which reduces quantitative accuracy of the method. The molecular identifier comprises between 4-20 bases. The molecular identifier is of a length such that each RNA molecule of the sample is catalogued (labeled) with a molecular identifier having a unique sequence.

Following annealing of a primer (e.g. polydT primer) to the RNA sample, an RNA-DNA hybrid may be synthesized by reverse transcription using an RNA-dependent DNA polymerase. Suitable RNA-dependent DNA polymerases for use in the methods and compositions of the invention include reverse transcriptases (RTs). RTs are well known in the art. Examples of RTs include, but are not limited to, Moloney murine leukemia virus (M-MLV) reverse transcriptase, human immunodeficiency virus (HIV) reverse transcriptase, rous sarcoma virus (RSV) reverse transcriptase, avian myeloblastosis virus (AMV) reverse transcriptase, rous associated virus (RAV) reverse transcriptase, and myeloblastosis associated virus (MAV) reverse transcriptase or other avian sarcoma-leukosis virus (ASLV) reverse transcriptases, and modified RTs derived therefrom. See e.g. U.S. Pat. No. 7,056,716. Many reverse transcriptases, such as those from avian myeloblastosis virus (AMV-RT), and Moloney murine leukemia virus (MMLV-RT) comprise more than one activity (for example, polymerase activity and ribonuclease activity) and can function in the formation of the double stranded cDNA molecules. However, in some instances, it is preferable to employ a RT which lacks or has substantially reduced RNase H activity.

RTs devoid of RNase H activity are known in the art, including those comprising a mutation of the wild type reverse transcriptase where the mutation eliminates the RNase H activity. Examples of RTs having reduced RNase H activity are described in US20100203597. In these cases, the addition of an RNase H from other sources, such as that isolated from E. coli, can be employed for the formation of the single stranded cDNA. Combinations of RTs are also contemplated, including combinations of different non-mutant RTs, combinations of different mutant RTs, and combinations of one or more non-mutant RT with one or more mutant RT.

Examples of suitable enzymes include, but are not limited to AffinityScript from Agilent or Superscript III from Invitrogen. Preferably the reverse transcriptase is devoid of terminal Deoxynucleotidyl Transferase (TdT) activity.

Additional components required in a reverse transcription reaction include dNTPS (dATP, dCTP, dGTP and dTTP) and optionally a reducing agent such as Dithiothreitol (DTT) and MnCl2.

The polydT oligonucleotide may be attached to a solid support (e.g. beads) so that the cDNA which is synthesized may be purified.

Annealing temperature and timing are determined both by the efficiency with which the primer is expected to anneal to a template and the degree of mismatch that is to be tolerated.

The annealing temperature is usually chosen to provide optimal efficiency and specificity, and generally ranges from about 50° C. to about 80° C., usually from about 55° C. to about 70° C., and more usually from about 60° C. to about 68° C. Annealing conditions are generally maintained for a period of time ranging from about 15 seconds to about 30 minutes, usually from about 30 seconds to about 5 minutes.

(Step 2): Once cDNA is generated, the cDNA may be pooled from cDNA generated from other single cells (using the same method as described herein above).

The sample may optionally be treated with an enzyme to remove excess primers, such as exonuclease I. Other options of purifying the single stranded DNA are also contemplated including for example the use of paramagnetic microparticles. This may be carried out following or prior to sample pooling.

(Step 3): Second strand synthesis.

Second strand synthesis of cDNA may be effected by incubating the sample in the presence of nucleotide triphosphates and a DNA polymerase. Commercial kits are available for this step which include additional enzymes such as RNAse H (to remove the RNA strand) and buffers. This reaction may optionally be performed in the presence of a DNA ligase. Following second strand synthesis, the product may be purified using methods known in the art including for example the use of paramagnetic microparticles.

(Step 4): Following synthesis of the second strand of the cDNA, RNA may be synthesized by incubating with a corresponding RNA polymerase. Commercially available kits may be used such as the T7 High Yield RNA polymerase IVT kit (New England Biolabs).

(Step 5): Prior to fragmentation of the amplified RNA, the DNA may be removed using a DNAse enzyme. The RNA may be purified as well prior to fragmentation. Fragmentation of the RNA may be carried out as known in the art. Fragmentation kits are commercially available such as the Ambion fragmentation kit.

(Step 6): The amplified and fragmented RNA is now labeled on its 3′ end. For this a ligase reaction is performed which essentially ligates single stranded DNA (ssDNA) to the RNA. Other methods of labeling the amplified and fragmented RNA are described in US Application No. 20170137806, the contents of which are incorporated herein by reference. The single stranded DNA has a free phosphate at its 5′end and optionally a blocking moiety at its 3′end in order to prevent head to tail ligation. Examples of blocking moieties include C3 spacer or a biotin moiety. Typically, the ssDNA is between 10-50 nucleotides in length and more preferably between 15 and 25 nucleotides.

(Step 7): Reverse transcription is then performed using a primer that is complementary to the primer used in the preceding step. The library may then be completed and amplified through a nested PCR reaction as illustrated in FIG. 5.

(Step 8): Amplification

Once the adapter polynucleotide of the present invention is ligated to the single stranded DNA (i.e. further to extension of the single stranded DNA), amplification reactions may be performed.

As used herein, the term “amplification” refers to a process that increases the representation of a population of specific nucleic acid sequences in a sample by producing multiple (i.e., at least 2) copies of the desired sequences. Methods for nucleic acid amplification are known in the art and include, but are not limited to, polymerase chain reaction (PCR) and ligase chain reaction (LCR). In a typical PCR amplification reaction, a nucleic acid sequence of interest is often amplified at least fifty thousand fold in amount over its amount in the starting sample. A “copy” or “amplicon” does not necessarily mean perfect sequence complementarity or identity to the template sequence. For example, copies can include nucleotide analogs such as deoxyinosine, intentional sequence alterations (such as sequence alterations introduced through a primer comprising a sequence that is hybridizable but not complementary to the template), and/or sequence errors that occur during amplification.

A typical amplification reaction is carried out by contacting a forward and reverse primer (a primer pair) to the adapter-extended DNA described herein together with any additional amplification reaction reagents under conditions which allow amplification of the target sequence.

The terms “forward primer” and “forward amplification primer” are used herein interchangeably, and refer to a primer that hybridizes (or anneals) to the target (template strand).

The terms “reverse primer” and “reverse amplification primer” are used herein interchangeably, and refer to a primer that hybridizes (or anneals) to the complementary target strand. The forward primer hybridizes with the target sequence 5′ with respect to the reverse primer.

The term “amplification conditions”, as used herein, refers to conditions that promote annealing and/or extension of primer sequences. Such conditions are well-known in the art and depend on the amplification method selected. Thus, for example, in a PCR reaction, amplification conditions generally comprise thermal cycling, i.e., cycling of the reaction mixture between two or more temperatures. In isothermal amplification reactions, amplification occurs without thermal cycling although an initial temperature increase may be required to initiate the reaction. Amplification conditions encompass all reaction conditions including, but not limited to, temperature and temperature cycling, buffer, salt, ionic strength, and pH, and the like.

As used herein, the term “amplification reaction reagents”, refers to reagents used in nucleic acid amplification reactions and may include, but are not limited to, buffers, reagents, enzymes having reverse transcriptase and/or polymerase activity or exonuclease activity, enzyme cofactors such as magnesium or manganese, salts, nicotinamide adenine dinuclease (NAD) and deoxynucleoside triphosphates (dNTPs), such as deoxyadenosine triphosphate, deoxyguanosine triphosphate, deoxycytidine triphosphate and thymidine triphosphate. Amplification reaction reagents may readily be selected by one skilled in the art depending on the amplification method used.

According to this aspect of the present invention, the amplifying may be effected using techniques such as polymerase chain reaction (PCR), which includes, but is not limited to Allele-specific PCR, Assembly PCR or Polymerase Cycling Assembly (PCA), Asymmetric PCR, Helicase-dependent amplification, Hot-start PCR, Intersequence-specific PCR (ISSR), Inverse PCR, Ligation-mediated PCR, Methylation-specific PCR (MSP), Miniprimer PCR, Multiplex Ligation-dependent Probe Amplification, Multiplex-PCR, Nested PCR, Overlap-extension PCR, Quantitative PCR (Q-PCR), Reverse Transcription PCR (RT-PCR), Solid Phase PCR: encompasses multiple meanings, including Polony Amplification (where PCR colonies are derived in a gel matrix, for example), Bridge PCR (primers are covalently linked to a solid-support surface), conventional Solid Phase PCR (where Asymmetric PCR is applied in the presence of solid support bearing primer with sequence matching one of the aqueous primers) and Enhanced Solid Phase PCR (where conventional Solid Phase PCR can be improved by employing high Tm and nested solid support primer with optional application of a thermal ‘step’ to favor solid support priming), Thermal asymmetric interlaced PCR (TAIL-PCR), Touchdown PCR (Step-down PCR), PAN-AC and Universal Fast Walking.

The PCR (or polymerase chain reaction) technique is well-known in the art and has been disclosed, for example, in K. B. Mullis and F. A. Faloona, Methods Enzymol., 1987, 155: 350-355 and U.S. Pat. Nos. 4,683,202; 4,683,195; and 4,800,159 (each of which is incorporated herein by reference in its entirety). In its simplest form, PCR is an in vitro method for the enzymatic synthesis of specific DNA sequences, using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. A plurality of reaction cycles, each cycle comprising: a denaturation step, an annealing step, and a polymerization step, results in the exponential accumulation of a specific DNA fragment (“PCR Protocols: A Guide to Methods and Applications”, M. A. Innis (Ed.), 1990, Academic Press: New York; “PCR Strategies”, M. A. Innis (Ed.), 1995, Academic Press: New York; “Polymerase chain reaction: basic principles and automation in PCR: A Practical Approach”, McPherson et al. (Eds.), 1991, IRL Press: Oxford; R. K. Saiki et al., Nature, 1986, 324: 163-166). The termini of the amplified fragments are defined as the 5′ ends of the primers. Examples of DNA polymerases capable of producing amplification products in PCR reactions include, but are not limited to: E. coli DNA polymerase I, Klenow fragment of DNA polymerase I, T4 DNA polymerase, thermostable DNA polymerases isolated from Thermus aquaticus (Taq), available from a variety of sources (for example, Perkin Elmer), Thermus thermophilus (United States Biochemicals), Bacillus stereothermophilus (Bio-Rad), or Thermococcus litoralis (“Vent” polymerase, New England

Biolabs).

The duration and temperature of each step of a PCR cycle, as well as the number of cycles, are generally adjusted according to the stringency requirements in effect. Annealing temperature and timing are determined both by the efficiency with which a primer is expected to anneal to a template and the degree of mismatch that is to be tolerated. The ability to optimize the reaction cycle conditions is well within the knowledge of one of ordinary skill in the art. Although the number of reaction cycles may vary depending on the detection analysis being performed, it usually is at least 15, more usually at least 20, and may be as high as 60 or higher. However, in many situations, the number of reaction cycles typically ranges from about 20 to about 40.

The above cycles of denaturation, annealing, and polymerization may be performed using an automated device typically known as a thermal cycler or thermocycler. Thermal cyclers that may be employed are described in U.S. Pat. Nos. 5,612,473; 5,602,756; 5,538,871; and 5,475,610 (each of which is incorporated herein by reference in its entirety). Thermal cyclers are commercially available, for example, from Perkin Elmer-Applied Biosystems (Norwalk, Conn.), BioRad (Hercules, Calif.), Roche Applied Science (Indianapolis, Ind.), and Stratagene (La Jolla, Calif.).

Amplification products obtained using primers of the present invention may be detected using agarose gel electrophoresis and visualization by ethidium bromide staining and exposure to ultraviolet (UV) light or by sequence analysis of the amplification product.

According to one embodiment, the amplification and quantification of the amplification product may be effected in real-time (qRT-PCR).

(Step 9): Sequencing

Methods for sequence determination are generally known to the person skilled in the art. Preferred sequencing methods are next generation sequencing methods or parallel high throughput sequencing methods e.g. Massively Parallel Signature Sequencing (MPSS). An example of an envisaged sequence method is pyrosequencing, in particular 454 pyrosequencing, e.g. based on the Roche 454 Genome Sequencer. This method amplifies DNA inside water droplets in an oil solution with each droplet containing a single DNA template attached to a single primer-coated bead that then forms a clonal colony. Pyrosequencing uses luciferase to generate light for detection of the individual nucleotides added to the nascent DNA, and the combined data are used to generate sequence read-outs. Yet another envisaged example is Illumina or Solexa sequencing, e.g. by using the Illumina Genome Analyzer technology, which is based on reversible dye-terminators. DNA molecules are typically attached to primers on a slide and amplified so that local clonal colonies are formed. Subsequently one type of nucleotide at a time may be added, and non-incorporated nucleotides are washed away. Subsequently, images of the fluorescently labeled nucleotides may be taken and the dye is chemically removed from the DNA, allowing a next cycle. Yet another example is the use of Applied Biosystems' SOLiD technology, which employs sequencing by ligation. This method is based on the use of a pool of all possible oligonucleotides of a fixed length, which are labeled according to the sequenced position. Such oligonucleotides are annealed and ligated. Subsequently, the preferential ligation by DNA ligase for matching sequences typically results in a signal informative of the nucleotide at that position. Since the DNA is typically amplified by emulsion PCR, the resulting bead, each containing only copies of the same DNA molecule, can be deposited on a glass slide resulting in sequences of quantities and lengths comparable to Illumina sequencing. A further method is based on Helicos' Heliscope technology, wherein fragments are captured by polyT oligomers tethered to an array. At each sequencing cycle, polymerase and single fluorescently labeled nucleotides are added and the array is imaged. The fluorescent tag is subsequently removed and the cycle is repeated. Further examples of sequencing techniques encompassed within the methods of the present invention are sequencing by hybridization, sequencing by use of nanopores, microscopy-based sequencing techniques, microfluidic Sanger sequencing, or microchip-based sequencing methods. The present invention also envisages further developments of these techniques, e.g. further improvements of the accuracy of the sequence determination, or the time needed for the determination of the genomic sequence of an organism etc.

According to one embodiment, the sequencing method comprises deep sequencing.

As used herein, the term “deep sequencing” refers to a sequencing method wherein the target sequence is read multiple times in the single test. A single deep sequencing run is composed of a multitude of sequencing reactions run on the same target sequence and each, generating independent sequence readout.

It will be appreciated that methods which rely on microfluidics can also be used to carry out single cell transcriptome analysis.

Thus, a combination of molecular barcoding and emulsion-based microfluidics to isolate, lyse, barcode, and prepare nucleic acids from individual cells in high-throughput may be used. Microfluidic devices (for example, fabricated in polydimethylsiloxane), sub-nanoliter reverse emulsion droplets. These droplets are used to co-encapsulate nucleic acids with a barcoded capture bead. Each bead, for example, is uniquely barcoded so that each drop and its contents are distinguishable. The nucleic acids may come from any source known in the art, such as for example, those which come from a single cell, a pair of cells, a cellular lysate, or a solution. The cell is lysed as it is encapsulated in the droplet. To load single cells and barcoded beads into these droplets with Poisson statistics, 100,000 to 10 million such beads are needed to barcode about 10,000-100,000 cells. In this regard there can be a single-cell sequencing library which may comprise: merging one uniquely barcoded mRNA capture microbead with a single-cell in an emulsion droplet having a diameter of 75-125 μm; lysing the cell to make its RNA accessible for capturing by hybridization onto RNA capture microbead; performing a reverse transcription either inside or outside the emulsion droplet to convert the cell's mRNA to a first strand cDNA that is covalently linked to the mRNA capture microbead; pooling the cDNA-attached microbeads from all cells: and preparing and sequencing a single composite RNA-Seq library, as described herein above. In this regard reference is made to Macosko et al., 2015, “Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets” Cell 161, 1202-1214; International patent application number PCT/US2015/049178, published as WO2016/040476 on Mar. 17, 2016; Klein et al., 2015, “Droplet Barcoding for Single-Cell Transcriptomics Applied to Embryonic Stem Cells” Cell 161, 1187-1201; Zheng, et al., 2016, “Haplotyping germline and cancer genomes with high-throughput linked-read sequencing” Nature Biotechnology 34, 303-311; and International patent publication number WO 2014210353 A2, all the contents and disclosure of each of which are herein incorporated by reference in their entirety.

Methods of Detecting Expression and/or Activity of Proteins

Expression and/or activity level of proteins expressed in the cells of the cultures of some embodiments of the invention can be determined using methods known in the arts.

Enzyme linked immunosorbent assay (ELISA): This method involves fixation of a sample (e.g., fixed cells or a proteinaceous solution) containing a protein substrate to a surface such as a well of a microtiter plate. A substrate specific antibody coupled to an enzyme is applied and allowed to bind to the substrate. Presence of the antibody is then detected and quantitated by a colorimetric reaction employing the enzyme coupled to the antibody. Enzymes commonly employed in this method include horseradish peroxidase and alkaline phosphatase. If well calibrated and within the linear range of response, the amount of substrate present in the sample is proportional to the amount of color produced. A substrate standard is generally employed to improve quantitative accuracy.

Western blot: This method involves separation of a substrate from other protein by means of an acrylamide gel followed by transfer of the substrate to a membrane (e.g., nylon or PVDF). Presence of the substrate is then detected by antibodies specific to the substrate, which are in turn detected by antibody binding reagents. Antibody binding reagents may be, for example, protein A, or other antibodies. Antibody binding reagents may be radiolabeled or enzyme linked as described hereinabove. Detection may be by autoradiography, colorimetric reaction or chemiluminescence. This method allows both quantitation of an amount of substrate and determination of its identity by a relative position on the membrane which is indicative of a migration distance in the acrylamide gel during electrophoresis.

Radio-immunoassay (RIA): In one version, this method involves precipitation of the desired protein (i.e., the substrate) with a specific antibody and radiolabeled antibody binding protein (e.g., protein A labeled with I125) immobilized on a precipitable carrier such as agarose beads. The number of counts in the precipitated pellet is proportional to the amount of substrate.

In an alternate version of the RIA, a labeled substrate and an unlabelled antibody binding protein are employed. A sample containing an unknown amount of substrate is added in varying amounts. The decrease in precipitated counts from the labeled substrate is proportional to the amount of substrate in the added sample.

Fluorescence activated cell sorting (FACS): This method involves detection of a substrate in situ in cells by substrate specific antibodies. The substrate specific antibodies are linked to fluorophores. Detection is by means of a cell sorting machine which reads the wavelength of light emitted from each cell as it passes through a light beam. This method may employ two or more antibodies simultaneously.

Immunohistochemical analysis: This method involves detection of a substrate in situ in fixed cells by substrate specific antibodies. The substrate specific antibodies may be enzyme linked or linked to fluorophores. Detection is by microscopy and subjective or automatic evaluation. If enzyme linked antibodies are employed, a colorimetric reaction may be required. It will be appreciated that immunohistochemistry is often followed by counterstaining of the cell nuclei using for example Hematoxyline or Giemsa stain.

In situ activity assay: According to this method, a chromogenic substrate is applied on the cells containing an active enzyme and the enzyme catalyzes a reaction in which the substrate is decomposed to produce a chromogenic product visible by a light or a fluorescent microscope.

In vitro activity assays: In these methods the activity of a particular enzyme is measured in a protein mixture extracted from the cells. The activity can be measured in a spectrophotometer well using colorimetric methods or can be measured in a non-denaturing acrylamide gel (i.e., activity gel). Following electrophoresis the gel is soaked in a solution containing a substrate and colorimetric reagents. The resulting stained band corresponds to the enzymatic activity of the protein of interest. If well calibrated and within the linear range of response, the amount of enzyme present in the sample is proportional to the amount of color produced. An enzyme standard is generally employed to improve quantitative accuracy.

According to a specific embodiment, the gene expression is determined by transcriptome analysis.

According to a specific embodiment, the gene expression is determined by a single cell transcriptome analysis as described above.

According to a specific embodiment, the cells are determined by the level of at least one (e.g., 2, 3, 4, 5, 6, 7 or 8) but not more than 10 markers (e.g., 1-10, 2-10, 3-10, 4-10, 5-10, 6-10, 7-10, 8-10, 1-5, 2-5, 3-5, 4-5, 1-8, 2-8, 3-8, 4-8, 5-8), e.g., CD8+/Lag3+/PD1+/Tim3+/CD103+/CD39+/CD137+/Klrg1. Positive (+) and negative (−) expression are determined as known in the art.

According to a specific embodiment, the marker is PD-1.

According to a specific embodiment, the markers are PD-1 and CD103.

According to a specific embodiment, the cells are in a proliferative state (G2/M).

According to a specific embodiment, the cells occupy all stages of the cell cycle (G0/G1, S, and M), in stark contrast to cell cycle arrest (FIG. 5M-T).

Methods of determining cellular proliferation and cell cycle are well known in the art. Some are detailed hereinbelow and in the Examples section which follows.

Cell cycle analysis by DNA content measurement is a method that most frequently employs flow cytometry to distinguish cells in different phases of the cell cycle. Before analysis, the cells are usually permeabilised and treated with a fluorescent dye that stains DNA quantitatively, such as propidium iodide (PI) or 4,6-diamidino-2-phenylindole (DAPI). The fluorescence intensity of the stained cells correlates with the amount of DNA they contain. As the DNA content doubles during the S phase, the DNA content (and thereby intensity of fluorescence) of cells in the G0 phase and G1 phase (before S), in the S phase, and in the G2 phase and M phase (after S) identifies the cell cycle phase position in the major phases (G0/G1 versus S versus G2/M phase) of the cell cycle. The cellular DNA content of individual cells is often plotted as their frequency histogram to provide information about relative frequency (percentage) of cells in the major phases of the cell cycle.

Multiparameter analysis of the cell cycle includes, in addition to measurement of cellular DNA content, other cell cycle related constituents/features. The concurrent measurement of cellular DNA and RNA content, or DNA susceptibility to denaturation at low pH using the metachromatic dye acridine orange, reveals the G1Q, G1A, and G1B cell cycle compartments and also makes it possible to discriminate between S, G2 and mitotic cells. The cells in G1Q are quiescent, temporarily withdrawn from the cell cycle (also identifiable as G0), the G1A are in the growth phase while G1B are the cells just prior entering S, with their growth (RNA and protein content, size) similar to that of the cells initiating DNA replication. Similar cell cycle compartments are also recognized by multiparameter analysis that includes measurement of expression of cyclin D1, cyclin E, cyclin A and cyclin B1, each in relation to DNA content. Concurrent measurement of DNA content and of incorporation of DNA precursor 5-bromo-T-deoxyuridine (BrdU) by flow cytometry is an especially useful assay.

According to a specific embodiment, the cell proliferative state can also be determined by proliferation markers such as KI67 or MCM-2.

As used herein, expression of inhibitory receptor molecules include, but are not limited to, PD-1, LAG-3, TIM3, TIGIT, CD103, CD39, CD137.

Methods of determining a dysfunctional phenotype are well known in the art. These include, secretion of cytokines that are in direct correlation with cytotoxic T cell function. Examples include, but are not limited to, interleukin 2 (IL-2), tumor necrosis factor (TNF), and interferon gamma (IFNgamma, IFNg). Oftentimes, a dysfunctional phenotype is determined in the presence of the tumor cells or antigens thereof, as further described hereinbelow.

Products for determining T cell exhaustion are commercially available. Examples include, but are not limited to, the kits available from R&D systems, Cell Signaling Technology, Ultivue and the like.

As mentioned, a level of the dysfunctional cells above a predetermined threshold is indicative of a response to an immune checkpoint inhibition.

Without wishing to be bound by theory it is suggested that the higher the level of the dysfunctional cells the better is the prognosis. It is suggested that the subject has many T cells expressing TCRs that recognize the tumor.

According to another aspect of the invention, there is provided a method of treating a subject having a tumor, the method comprising:

(a) determining responsiveness of a subject to immune checkpoint inhibition according as described above; and
(i) wherein when the level of the dysfunctional cells is above the predetermined threshold, treating or selecting treatment for the subject with immune checkpoint inhibition; or
(ii) wherein when the level of the dysfunctional cells is below the predetermined threshold, subjecting the dysfunctional cells to ex vivo expansion and subsequently treating or selecting treatment for the subject with the immune checkpoint inhibition.

Hence, the level of dysfunctional cells dictates immediate treatment with immune checkpoint inhibitors or whether the cells need to be subjected to ex vivo expansion followed by the treatment with the immune checkpoint inhibition.

Thus, once an inadequate level of dysfunctional cells is observed e.g., below 20% (e.g., below 15%, 10%), the cells are subjected to ex vivo expansion and optionally stimulation (e.g., with neo-antigens, tissue fragments, antigen presenting cells loaded with the antigens, etc.).

Methods of ex vivo expanding TILs are well known in the art and are basically based on any protocol for adoptive cell therapy (ACT), e.g., Dudley et al. J Immunother. 2003; 26(4): 332-342, which is hereby incorporated by reference in its entirety.

Briefly and not meant to be limiting, a tumor sample is dissected free if surrounding normal tissue and necrotic areas. The sample is cut into fragments and each being placed in a well (e.g., 24 well plate) in the presence of a culture medium and IL-2. Each fragment is inspected every once in a while using low-power inverted microscope to monitor extrusion and proliferation of lymphocytes. The culture medium is typically changed 1 week following initiation of culturing.

Another approach is to use cultures derived from single-cell digests (see e.g., Riddell et al. Science 1992 257:238-241 which is hereby incorporated by reference in its entirety). Briefly and not meant to be limiting, each solid tumor specimen is dissected of surrounding tissue and necrotic areas. The specimen is fragmented and subjected to enzymatic (e.g., collagenase, hyaluronidase and DNAse) treatment in a culture medium under agitation. The single cell slurry is passed through sterile wire mesh to remove undigested tissue chunks. The digested single cells are washed in buffer and the viable cells are purified on a Ficoll gradient and the cells are resuspended for plating, typically in a 24 well plate. The plates are placed in a humidified incubator in the presence of IL-2. The cells are passaged as needed.

Another approach uses tumor infiltrating lymphocyte (TIL) cultures derived from physically disaggregation of tumor samples. Such an approach may use a dedicated machinery e.g., Medimachine (Becton Dickenson) including mini homogenizers. Fragments of tumor are prepared by dissection of biopsy specimens free from normal and necrotic tissue. Several fragments at a time are physically disaggregated by a 30-second Medimachine treatment, which disaggregated the tumor chunks using mechanical shear provided by a rotating disk that forces the tumor chunks across a small grater inside the medicon. The resulting slurry of single cells and small cell aggregates is washed, and resuspended in a culture medium. The cell suspension is layered onto a two-step gradient with a lower step of 100% Ficoll, and a middle step of 75% Ficoll and 25% CM. After 20 minutes' centrifugation at 2000 rpm (about 1100 g), the interfaces are collected. The lower interface containing the lymphocyte-enriched fraction is processed separately from the upper interface containing the tumor-enriched cells. Each fraction is washed. The lower, TIL-enriched fraction is plated in 24-well plates, and individual TIL cultures are generated exactly as for the single-cell suspensions derived by enzymatic degradation.

Regardless of the specific protocol used, the cultures can be further treated with an anti-CD3 antibody (and IL-2) optionally in the presence of irradiated, allogeneic feeder cells at a 200:1 ratio of feeder cells to responding TILs. —

TIL activity and specificity are determined by analysis of cytokine secretion as described above. Basically, the cells are washed to remove IL-2 prior to the assay. The cells are plated with stimulator cells (e.g., with the autologous tumor or antigen loaded-APCs).

Following culturing supernatants are collected and analyzed for TFNgamma secretion (e.g., by ELISA).

It will be appreciated that stimulation with anti CD3 and/or anti CD28 can be part of the expansion protocol. The protocol may include the use of specific antigens e.g., neo-antigens, where available, to promote the proliferation of tumor specific clones. The antigens can be loaded on antigen presenting cells or provided in a soluble form. The T cell activation needs two signals, One, activation of TCR complex. Another, co-stimulation of CD28 by CD80 or CD86. This stimulation is normally of two kinds, antigen dependent (in the presence of an antigen and co-stimulation from antigen presenting cells or anti-CD28 antibodies etc) and antigen independent (in the absence of an antigen but a mitogen [PHA or Con A] or anti-CD3 and anti-CD28 antibodies). Antigen dependent stimulation expands only antigen specific T cells whereas antigen independent stimulation expands all T cells in the sample culture.

The main principle behind stimulation by anti-CD3 and anti-CD28 antibodies is: the anti-CD3 will bind to CD3 and activate TCR complex without antigenic peptide from the antigen presenting cells; the anti-CD28 will bind to CD28 and stimulates the T cells without CD80 or CD86 from antigen presenting cells.

Once enough cells are at hand they are administered to the subject. According to a specific embodiment, the cells (in vitro expanded TILs) are autologous to the subject.

According to a specific embodiment, the cells (in vitro expanded TILs) are allogeneic to the subject.

According to a specific embodiment, the effective amount of cells is as typically used in adoptive cell therapy, e.g., 1-100*106 cell.

As used herein, the term “treating” includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition. As used herein the condition refers to cancer.

According to a specific embodiment, the cells are non-genetically modified cells.

According to a specific embodiment, the cells are genetically modified to confer a function, e.g., T cell receptor specificity (e.g., CAR-T cells), immortalization and the like.

According to an aspect of the invention, there is provided a method of activating dysfunctional CD8+/Lag3+/PD1+/Tim3+/CD103+/CD39+/CD137+/Klrg1 T cells, the method comprising, contacting dysfunctional CD8+/Lag3+/PD1+/Tim3+/CD103+/CD39+/CD137+/Klrg1 T cells with an agent capable of down-regulating a target gene selected from the group consisting of AKAP5, DGKH, PAG1, GALM, FUT8, WARS, CBLB, PIK3AP1, APOBEC3G, SLAMF7, SIRPG, GALNT1 or an expression product thereof, thereby activating the dysfunctional immune cells.

According to an embodiment of the invention, the method is performed ex vivo.

According to an embodiment of the invention, the method is performed in vivo.

According to an aspect of the invention, there is provided a method of treating a subject having a tumor, the method comprising administering to the subject an immune checkpoint inhibitor and an agent capable of down-regulating a target gene selected from the group consisting of AKAP5, DGKH, PAG1, GALM, FUT8, WARS, CBLB, PIK3AP1, APOBEC3G, SLAMF7, SIRPG, GALNT1 or an expression product thereof, thereby treating the subject having the tumor.

According to an aspect of the invention, there is provided a method of treating a subject having a tumor, the method comprising administering to the subject an agent capable of down-regulating a target gene selected from the group consisting of AKAP5, DGKH, PAG1, GALM, FUT8, WARS, CBLB, PIK3AP1, APOBEC3G, SLAMF7, SIRPG, GALNT1 or an expression product thereof, thereby treating the subject having the tumor.

According to an aspect of the invention, there is provided an agent capable of inhibiting a target gene or expression product thereof selected from the group consisting of AKAP5, DGKH, PAG1, GALM, FUT8, WARS, CBLB, PIK3AP1, APOBEC3G, SLAMF7, SIRPG, GALNT1 for use in treating a subject having a tumor.

According to an aspect of the invention, there is provided an immune checkpoint inhibitor and an agent capable of inhibiting a target gene or expression product thereof selected from the group consisting of AKAP5, DGKH, PAG1, GALM, FUT8, WARS, CBLB, PIK3AP1, APOBEC3G, SLAMF7, SIRPG, GALNT1 for use in treating a subject having a tumor.

Any agent known in the art or generated by methods which are well known in the art to target these genes can be used according to the present teachings e.g., a CAR-T (e.g., Gogishvili Blood. 2017 Dec. 28; 130(26):2838-2847. doi: 10.1182/blood-2017-04-778423. Epub 2017 Oct. 31., which is hereby incorporated by reference in its entirety). Others are listed throughout the application.

As used herein “target gene” refers to the nucleic acid sequence encoding the gene, an mRNA product thereof or a polypeptide product thereof.

An “agent” refers to a chemical entity e.g., small molecule, peptide, a nucleic acid molecule.

As used herein “AKAP5” refers to the gene encoding A-kinase anchor protein 5. Aliases: AKAP5, AKAP75, AKAP79, H21, A-kinase anchoring protein 5. An exemplary mRNA sequence for human is provided in GenBank Accession Number NM_004857 (SEQ ID NO: 1). Exemplary protein sequences for human are provided in GenBank Accession Number NP_004848 (SEQ ID NO: 2) and NM_004848.3 (SEQ ID NO: 3). The protein is expressed in T lymphocytes and is known to interfere with IL-2 transcription.

As used herein “DGKH” refers to the gene encoding Diacylglycerol Kinase Eta, DGKeta or EC 2.7.1.107. This gene encodes a member of the diacylglycerol kinase (DGK) enzyme family. Members of this family are involved in regulating intracellular concentrations of diacylglycerol and phosphatidic acid. Protein products include, NP_178009 (SEQ ID NO: 4).

As used herein “PAG1” refers to the gene encoding phosphoprotein associated with glycosphingolipid-enriched microdomains 1. Aiases: CBP, PAG, phosphoprotein membrane anchor with glycosphingolipid microdomains 1. The protein encoded by this gene is a type III transmembrane adaptor protein that binds to the tyrosine kinase csk protein. It is involved in the regulation of T cell activation. An exemplary mRNA sequence for human is provided in GenBank Accession Number NM_018440 (SEQ ID NO: 5). An exemplary protein sequence for human is provided in GenBank Accession Number NP_060910 (SEQ ID NO: 6).

As used herein “GALM” refers to the gene encoding the enzyme that converts alpha-aldose to the beta-anomer. Aliases: BLOCK25, GLAT, HEL-S-63p, IBD1, galactose mutarotase (aldose 1-epimerase), galactose mutarotase. An exemplary mRNA sequence for human is provided in GenBank Accession Number NM_138801 (SEQ ID NO: 7). An exemplary protein sequence for human is provided in GenBank Accession Number NP_620156 (SEQ ID NO: 8).

As used herein “FUT8” refers to the gene encoding Alpha-(1,6)-fucosyltransferase. Aliases: FUT8, fucosyltransferase 8, CDGF. An exemplary mRNA sequence for human is provided in GenBank Accession Number NM_004480 (SEQ ID NO: 9), NM_178154 (SEQ ID NO: 10), NM_178155 (SEQ ID NO: 11), NM_178156 (SEQ ID NO: 12), NM_178157 (SEQ ID NO: 13). An exemplary protein sequence for human is provided in GenBank Accession Number NP_004471 (SEQ ID NO: 14), NP_835368 (SEQ ID NO: 15), NP_835369 (SEQ ID NO: 16).

As used herein “WARS” refers to the gene encoding the enzyme Tryptophanyl-tRNA synthetase. Aliases: Tryptophanyl-tRNA synthetase, cytoplasmic, GAMMA-2, IFI53, IFP53, tryptophanyl-tRNA synthetase, HMN9. An exemplary mRNA sequence for human is provided in GenBank Accession Number NM_004184 (SEQ ID NO: 17), NM_173701 (SEQ ID NO: 18), NM_213645 (SEQ ID NO: 19), NM_213646 (SEQ ID NO: 20). An exemplary protein sequence for human is provided in GenBank Accession Number NP_004175 (SEQ ID NO: 21), NP_776049 (SEQ ID NO: 22), NP_998810 (SEQ ID NO: 23), NP_998811 (SEQ ID NO: 24).

As used herein “CBLB” refers to the gene encoding the E3 ubiquitin-protein ligase, CBL-B. Aliases: Cbl-b, RNF56, Nbla00127, Cbl proto-oncogene B. An exemplary mRNA sequence for human is provided in GenBank Accession Number NM_170662 (SEQ ID NO: 25), NM_001321786 (SEQ ID NO: 26), NM_NM_001321788 (SEQ ID NO: 27), NM_NM_001321789 (SEQ ID NO: 28), NM_NM_00132190 (SEQ ID NO: 29). An exemplary protein sequence for human is provided in GenBank Accession Number NP_001308715 (SEQ ID NO: 30), NP_001308717 (SEQ ID NO: 31), NP_001308718 (SEQ ID NO: 32), NP_001308719 (SEQ ID NO: 33), NP_001308720 (SEQ ID NO: 34).

As used herein “PIK3AP1” refers to the gene encoding the enzyme Phosphoinositide 3-kinase adapter protein 1. Aliases: BCAP, phosphoinositide-3-kinase adaptor protein 1. An exemplary mRNA sequence for human is provided in GenBank Accession Number NM_152309 (SEQ ID NO: 35). An exemplary protein sequence for human is provided in GenBank Accession Number NP_689522 (SEQ ID NO: 36).

As used herein “APOBEC3G” refers to the gene encoding the enzyme, apolipoprotein B mRNA editing enzyme. Aliases: A3G, ARCD, ARP-9, ARP9, CEM-15, CEM15, MDS019, bK150C2.7, dJ494G10.1, apolipoprotein B mRNA editing enzyme catalytic subunit 3G. An exemplary mRNA sequence for human is provided in GenBank Accession Number NM_021822 (SEQ ID NO: 37). An exemplary protein sequence for human is provided in GenBank Accession Number NP_068594 (SEQ ID NO: 38), NP_001336365 (SEQ ID NO: 39), NP_001336366 (SEQ ID NO: 40), NP_001336367 (SEQ ID NO: 41).

As used herein “SLAM7” refers to the gene encoding the SLAM family member 7. Aliases: 19A, CD319, CRACC, CS1, SLAM family member 7. An exemplary mRNA sequence for human is provided in GenBank Accession Number NM_001282588 (SEQ ID NO: 42), NM_001282589 (SEQ ID NO: 43), NM_001282590 (SEQ ID NO: 44), NM_001282591 (SEQ ID NO: 45), NM_001282592 (SEQ ID NO: 46). An exemplary protein sequence for human is provided in GenBank Accession Number NP_001269517 (SEQ ID NO: 47), NP_001269518 (SEQ ID NO: 48), NP_001269519 (SEQ ID NO: 49), NP_001269520 (SEQ ID NO: 50), NP_001269521 (SEQ ID NO: 51).

As used herein “SIRPG” refers to the gene encoding Signal-regulatory protein gamma. Aliases: CD172g, SIRP-B2, SIRPB2, SIRPgamma, bA77C3.1, signal regulatory protein gamma. An exemplary mRNA sequence for human is provided in GenBank Accession Number NM_001039508 (SEQ ID NO: 52), NM_018556 (SEQ ID NO: 53), NM_080816 (SEQ ID NO: 54). An exemplary protein sequence for human is provided in GenBank Accession Number NP_001039508 (SEQ ID NO: 52), NP_018556 (SEQ ID NO: 55), NP_080816 (SEQ ID NO: 56).

As used herein “GALNT1” refers to the gene encoding the enzyme Polypeptide N-acetylgalactosaminyltransferase 1. Aliases: GALNAC-T1, polypeptide N-acetylgalactosaminyltransferase 1. An exemplary mRNA sequence for human is provided in GenBank Accession Number NM_001160401 (SEQ ID NO: 57), NM_013814 (SEQ ID NO: 58), NM_001361200 (SEQ ID NO: 59). An exemplary protein sequence for human is provided in GenBank Accession Number NP_001153876 (SEQ ID NO: 60), NP_038842 (SEQ ID NO: 61), NP_001348129 (SEQ ID NO: 62).

As used herein “an agent capable of down-regulating a target gene” refers to down-regulation of expression (mRNA or protein) or down-regulation of activity, e.g., enzymatic function.

As used herein the phrase “downregulates expression” refers to downregulating the expression of a protein (e.g. the protein product of the target gene, e.g., AKAP5) at the genomic (e.g. homologous recombination and site specific endonucleases) and/or the transcript level using a variety of molecules which interfere with transcription and/or translation (e.g., RNA silencing agents) or on the protein level (e.g., aptamers, small molecules and inhibitory peptides, antagonists, enzymes that cleave the polypeptide, antibodies and the like).

For the same culture conditions the expression is generally expressed in comparison to the expression in a cell of the same species but not contacted with the agent or contacted with a vehicle control, also referred to as control.

Down regulation of expression may be either transient or permanent.

According to specific embodiments, down regulating expression refers to the absence of mRNA and/or protein, as detected by RT-PCR or Western blot, respectively.

According to other specific embodiments down regulating expression refers to a decrease in the level of mRNA and/or protein, as detected by RT-PCR or Western blot, respectively. The reduction may be by at least a 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% reduction.

Non-limiting examples of agents capable of down regulating the target gene, e.g., AKAP5 expression are described in details hereinbelow.

Down-Regulation at the Nucleic Acid Level

Down-regulation at the nucleic acid level is typically effected using a nucleic acid agent, having a nucleic acid backbone, DNA, RNA, mimetics thereof or a combination of same. The nucleic acid agent may be encoded from a DNA molecule or provided to the cell per se.

According to specific embodiments, the downregulating agent is a polynucleotide.

According to specific embodiments, the downregulating agent is a polynucleotide capable of hybridizing to a gene or mRNA encoding the target protein.

According to specific embodiments, the downregulating agent directly interacts with the target gene or expression product thereof.

According to specific embodiments, the agent directly binds the target gene of expression product thereof.

According to specific embodiments, the agent indirectly binds the target gene of expression product thereof (e.g. binds an effector of the target gene or expression product thereof).

According to specific embodiments the downregulating agent is an RNA silencing agent or a genome editing agent.

Thus, downregulation of the target gene or expression product thereof can be achieved by RNA silencing. As used herein, the phrase “RNA silencing” refers to a group of regulatory mechanisms [e.g. RNA interference (RNAi), transcriptional gene silencing (TGS), post-transcriptional gene silencing (PTGS), quelling, co-suppression, and translational repression] mediated by RNA molecules which result in the inhibition or “silencing” of the expression of a corresponding protein-coding gene. RNA silencing has been observed in many types of organisms, including plants, animals, and fungi.

As used herein, the term “RNA silencing agent” refers to an RNA which is capable of specifically inhibiting or “silencing” the expression of a target gene. In certain embodiments, the RNA silencing agent is capable of preventing complete processing (e.g, the full translation and/or expression) of an mRNA molecule through a post-transcriptional silencing mechanism. RNA silencing agents include non-coding RNA molecules, for example RNA duplexes comprising paired strands, as well as precursor RNAs from which such small non-coding RNAs can be generated. Exemplary RNA silencing agents include dsRNAs such as siRNAs, miRNAs and shRNAs.

In one embodiment, the RNA silencing agent is capable of inducing RNA interference.

In another embodiment, the RNA silencing agent is capable of mediating translational repression.

According to an embodiment of the invention, the RNA silencing agent is specific to the target RNA and does not cross inhibit or silence other targets or a splice variant which exhibits 99% or less global homology to the target gene, e.g., less than 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81% global homology to the target gene; as determined by PCR, Western blot, Immunohistochemistry and/or flow cytometry.

RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs).

Following is a detailed description on RNA silencing agents that can be used according to specific embodiments of the present invention.

DsRNA, siRNA and shRNA—The presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme referred to as dicer. Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs). Short interfering RNAs derived from dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes. The RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex.

Accordingly, some embodiments of the invention contemplate use of dsRNA to downregulate protein expression from mRNA.

According to one embodiment dsRNA longer than 30 bp are used. Various studies demonstrate that long dsRNAs can be used to silence gene expression without inducing the stress response or causing significant off-target effects—see for example [Strat et al., Nucleic Acids Research, 2006, Vol. 34, No. 13 3803-3810; Bhargava A et al. Brain Res. Protoc. 2004; 13:115-125; Diallo M., et al., Oligonucleotides. 2003; 13:381-392; Paddison P. J., et al., Proc. Natl Acad. Sci. USA. 2002; 99:1443-1448; Tran N., et al., FEBS Lett. 2004; 573:127-134].

According to some embodiments of the invention, dsRNA is provided in cells where the interferon pathway is not activated, see for example Billy et al., PNAS 2001, Vol 98, pages 14428-14433. and Diallo et al, Oligonucleotides, Oct. 1, 2003, 13(5): 381-392. doi: 10.1089/154545703322617069.

According to an embodiment of the invention, the long dsRNA are specifically designed not to induce the interferon and PKR pathways for down-regulating gene expression. For example, Shinagwa and Ishii [Genes & Dev. 17 (11): 1340-1345, 2003] have developed a vector, named pDECAP, to express long double-strand RNA from an RNA polymerase II (Pol II) promoter. Because the transcripts from pDECAP lack both the 5′-cap structure and the 3′-poly(A) tail that facilitate ds-RNA export to the cytoplasm, long ds-RNA from pDECAP does not induce the interferon response.

Another method of evading the interferon and PKR pathways in mammalian systems is by introduction of small inhibitory RNAs (siRNAs) either via transfection or endogenous expression.

The term “siRNA” refers to small inhibitory RNA duplexes (generally between 18-30 base pairs) that induce the RNA interference (RNAi) pathway. Typically, siRNAs are chemically synthesized as 21mers with a central 19 bp duplex region and symmetric 2-base 3′-overhangs on the termini, although it has been recently described that chemically synthesized RNA duplexes of 25-30 base length can have as much as a 100-fold increase in potency compared with 21mers at the same location. The observed increased potency obtained using longer RNAs in triggering RNAi is suggested to result from providing Dicer with a substrate (27mer) instead of a product (21mer) and that this improves the rate or efficiency of entry of the siRNA duplex into RISC.

It has been found that position of the 3′-overhang influences potency of an siRNA and asymmetric duplexes having a 3′-overhang on the antisense strand are generally more potent than those with the 3′-overhang on the sense strand (Rose et al., 2005). This can be attributed to asymmetrical strand loading into RISC, as the opposite efficacy patterns are observed when targeting the antisense transcript.

The strands of a double-stranded interfering RNA (e.g., an siRNA) may be connected to form a hairpin or stem-loop structure (e.g., an shRNA). Thus, as mentioned, the RNA silencing agent of some embodiments of the invention may also be a short hairpin RNA (shRNA).

The term “shRNA”, as used herein, refers to an RNA agent having a stem-loop structure, comprising a first and second region of complementary sequence, the degree of complementarity and orientation of the regions being sufficient such that base pairing occurs between the regions, the first and second regions being joined by a loop region, the loop resulting from a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region. The number of nucleotides in the loop is a number between and including 3 to 23, or 5 to 15, or 7 to 13, or 4 to 9, or 9 to 11. Some of the nucleotides in the loop can be involved in base-pair interactions with other nucleotides in the loop. Examples of oligonucleotide sequences that can be used to form the loop include 5′-CAAGAGA-3′ and 5′-UUACAA-3′ (International Patent Application Nos. WO2013126963 and WO2014107763). It will be recognized by one of skill in the art that the resulting single chain oligonucleotide forms a stem-loop or hairpin structure comprising a double-stranded region capable of interacting with the RNAi machinery.

Synthesis of RNA silencing agents suitable for use with some embodiments of the invention can be effected as follows. First, the target gene mRNA sequence is scanned downstream of the AUG start codon for AA dinucleotide sequences. Occurrence of each AA and the 3′ adjacent 19 nucleotides is recorded as potential siRNA target sites. Preferably, siRNA target sites are selected from the open reading frame, as untranslated regions (UTRs) are richer in regulatory protein binding sites. UTR-binding proteins and/or translation initiation complexes may interfere with binding of the siRNA endonuclease complex [Tuschl ChemBiochem. 2:239-245]. It will be appreciated though, that siRNAs directed at untranslated regions may also be effective, as demonstrated for GAPDH wherein siRNA directed at the 5′ UTR mediated about 90% decrease in cellular GAPDH mRNA and completely abolished protein level (www(dot)ambion(dot)com/techlib/tn/91/912(dot)html).

Second, potential target sites are compared to an appropriate genomic database (e.g., human, mouse, rat etc.) using any sequence alignment software, such as the BLAST software available from the NCBI server (www(dot)ncbi(dot)nlm(dot)nih(dot)gov/BLAST/). Putative target sites which exhibit significant homology to other coding sequences are filtered out.

Qualifying target sequences are selected as template for siRNA synthesis. Preferred sequences are those including low G/C content as these have proven to be more effective in mediating gene silencing as compared to those with G/C content higher than 55%. Several target sites are preferably selected along the length of the target gene for evaluation. For better evaluation of the selected siRNAs, a negative control is preferably used in conjunction. Negative control siRNA preferably include the same nucleotide composition as the siRNAs but lack significant homology to the genome. Thus, a scrambled nucleotide sequence of the siRNA is preferably used, provided it does not display any significant homology to any other gene.

It will be appreciated that, and as mentioned hereinabove, the RNA silencing agent of some embodiments of the invention need not be limited to those molecules containing only RNA, but further encompasses chemically-modified nucleotides and non-nucleotides.

miRNA and miRNA mimics—According to another embodiment the RNA silencing agent may be a miRNA.

The term “microRNA”, “miRNA”, and “miR” are synonymous and refer to a collection of non-coding single-stranded RNA molecules of about 19-28 nucleotides in length, which regulate gene expression. miRNAs are found in a wide range of organisms (viruses.fwdarw.humans) and have been shown to play a role in development, homeostasis, and disease etiology.

Below is a brief description of the mechanism of miRNA activity.

Genes coding for miRNAs are transcribed leading to production of a miRNA precursor known as the pri-miRNA. The pri-miRNA is typically part of a polycistronic RNA comprising multiple pri-miRNAs. The pri-miRNA may form a hairpin with a stem and loop. The stem may comprise mismatched bases.

The hairpin structure of the pri-miRNA is recognized by Drosha, which is an RNase III endonuclease. Drosha typically recognizes terminal loops in the pri-miRNA and cleaves approximately two helical turns into the stem to produce a 60-70 nucleotide precursor known as the pre-miRNA. Drosha cleaves the pri-miRNA with a staggered cut typical of RNase III endonucleases yielding a pre-miRNA stem loop with a 5′ phosphate and ˜2 nucleotide 3′ overhang. It is estimated that approximately one helical turn of stem (˜10 nucleotides) extending beyond the Drosha cleavage site is essential for efficient processing. The pre-miRNA is then actively transported from the nucleus to the cytoplasm by Ran-GTP and the export receptor Ex-portin-5.

The double-stranded stem of the pre-miRNA is then recognized by Dicer, which is also an RNase III endonuclease. Dicer may also recognize the 5′ phosphate and 3′ overhang at the base of the stem loop. Dicer then cleaves off the terminal loop two helical turns away from the base of the stem loop leaving an additional 5′ phosphate and ˜2 nucleotide 3′ overhang. The resulting siRNA-like duplex, which may comprise mismatches, comprises the mature miRNA and a similar-sized fragment known as the miRNA*. The miRNA and miRNA* may be derived from opposing arms of the pri-miRNA and pre-miRNA. miRNA* sequences may be found in libraries of cloned miRNAs but typically at lower frequency than the miRNAs.

Although initially present as a double-stranded species with miRNA*, the miRNA eventually becomes incorporated as a single-stranded RNA into a ribonucleoprotein complex known as the RNA-induced silencing complex (RISC). Various proteins can form the RISC, which can lead to variability in specificity for miRNA/miRNA* duplexes, binding site of the target gene, activity of miRNA (repress or activate), and which strand of the miRNA/miRNA* duplex is loaded in to the RISC.

When the miRNA strand of the miRNA:miRNA* duplex is loaded into the RISC, the miRNA* is removed and degraded. The strand of the miRNA:miRNA* duplex that is loaded into the RISC is the strand whose 5′ end is less tightly paired. In cases where both ends of the miRNA:miRNA* have roughly equivalent 5′ pairing, both miRNA and miRNA* may have gene silencing activity.

The RISC identifies target nucleic acids based on high levels of complementarity between the miRNA and the mRNA, especially by nucleotides 2-7 of the miRNA.

A number of studies have looked at the base-pairing requirement between miRNA and its mRNA target for achieving efficient inhibition of translation (reviewed by Bartel 2004, Cell 116-281). In mammalian cells, the first 8 nucleotides of the miRNA may be important (Doench & Sharp 2004 GenesDev 2004-504). However, other parts of the microRNA may also participate in mRNA binding. Moreover, sufficient base pairing at the 3′ can compensate for insufficient pairing at the 5′ (Brennecke et al, 2005 PLoS 3-e85). Computation studies, analyzing miRNA binding on whole genomes have suggested a specific role for bases 2-7 at the 5′ of the miRNA in target binding but the role of the first nucleotide, found usually to be “A” was also recognized (Lewis et at 2005 Cell 120-15). Similarly, nucleotides 1-7 or 2-8 were used to identify and validate targets by Krek et al. (2005, Nat Genet 37-495).

The target sites in the mRNA may be in the 5′ UTR, the 3′ UTR or in the coding region. Interestingly, multiple miRNAs may regulate the same mRNA target by recognizing the same or multiple sites. The presence of multiple miRNA binding sites in most genetically identified targets may indicate that the cooperative action of multiple RISCs provides the most efficient translational inhibition.

miRNAs may direct the RISC to downregulate gene expression by either of two mechanisms: mRNA cleavage or translational repression. The miRNA may specify cleavage of the mRNA if the mRNA has a certain degree of complementarity to the miRNA. When a miRNA guides cleavage, the cut is typically between the nucleotides pairing to residues 10 and 11 of the miRNA. Alternatively, the miRNA may repress translation if the miRNA does not have the requisite degree of complementarity to the miRNA. Translational repression may be more prevalent in animals since animals may have a lower degree of complementarity between the miRNA and binding site.

It should be noted that there may be variability in the 5′ and 3′ ends of any pair of miRNA and miRNA*. This variability may be due to variability in the enzymatic processing of Drosha and Dicer with respect to the site of cleavage. Variability at the 5′ and 3′ ends of miRNA and miRNA* may also be due to mismatches in the stem structures of the pri-miRNA and pre-miRNA. The mismatches of the stem strands may lead to a population of different hairpin structures. Variability in the stem structures may also lead to variability in the products of cleavage by Drosha and Dicer.

The term “microRNA mimic” or “miRNA mimic” refers to synthetic non-coding RNAs that are capable of entering the RNAi pathway and regulating gene expression. miRNA mimics imitate the function of endogenous miRNAs and can be designed as mature, double stranded molecules or mimic precursors (e.g., or pre-miRNAs). miRNA mimics can be comprised of modified or unmodified RNA, DNA, RNA-DNA hybrids, or alternative nucleic acid chemistries (e.g., LNAs or 2′-0,4′-C-ethylene-bridged nucleic acids (ENA)). For mature, double stranded miRNA mimics, the length of the duplex region can vary between 13-33, 18-24 or 21-23 nucleotides. The miRNA may also comprise a total of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides. The sequence of the miRNA may be the first 13-33 nucleotides of the pre-miRNA. The sequence of the miRNA may also be the last 13-33 nucleotides of the pre-miRNA.

Preparation of miRNAs mimics can be effected by any method known in the art such as chemical synthesis or recombinant methods.

It will be appreciated from the description provided herein above that contacting cells with a miRNA may be effected by transfecting the cells with e.g. the mature double stranded miRNA, the pre-miRNA or the pri-miRNA.

The pre-miRNA sequence may comprise from 45-90, 60-80 or 60-70 nucleotides.

The pri-miRNA sequence may comprise from 45-30,000, 50-25,000, 100-20,000, 1,000-1,500 or 80-100 nucleotides.

Antisense—Antisense is a single stranded RNA designed to prevent or inhibit expression of a gene by specifically hybridizing to its mRNA. Downregulation can be effected using an antisense polynucleotide capable of specifically hybridizing with an mRNA transcript encoding the expression product of the target gene.

Design of antisense molecules which can be used to efficiently downregulate an mRNA of the target gene must be effected while considering two aspects important to the antisense approach. The first aspect is delivery of the oligonucleotide into the cytoplasm of the appropriate cells, while the second aspect is design of an oligonucleotide which specifically binds the designated mRNA within cells in a way which inhibits translation thereof.

The prior art teaches of a number of delivery strategies which can be used to efficiently deliver oligonucleotides into a wide variety of cell types [see, for example, Jääskeläinen et al. Cell Mol Biol Lett. (2002) 7(2):236-7; Gait, Cell Mol Life Sci. (2003) 60(5):844-53; Martino et al. J Biomed Biotechnol. (2009) 2009:410260; Grijalvo et al. Expert Opin Ther Pat. (2014) 24(7):801-19; Falzarano et al, Nucleic Acid Ther. (2014) 24(1):87-100; Shilakari et al. Biomed Res Int. (2014) 2014: 526391; Prakash et al. Nucleic Acids Res. (2014) 42(13):8796-807 and Asseline et al. J Gene Med. (2014) 16(7-8):157-65].

In addition, algorithms for identifying those sequences with the highest predicted binding affinity for their target mRNA based on a thermodynamic cycle that accounts for the energetics of structural alterations in both the target mRNA and the oligonucleotide are also available [see, for example, Walton et al. Biotechnol Bioeng 65: 1-9 (1999)]. Such algorithms have been successfully used to implement an antisense approach in cells.

In addition, several approaches for designing and predicting efficiency of specific oligonucleotides using an in vitro system were also published (Matveeva et al., Nature Biotechnology 16: 1374-1375 (1998)].

Thus, the generation of highly accurate antisense design algorithms and a wide variety of oligonucleotide delivery systems, enable an ordinarily skilled artisan to design and implement antisense approaches suitable for downregulating expression of known sequences without having to resort to undue trial and error experimentation.

Nucleic acid agents can also operate at the DNA level as summarized infra.

Downregulation of the target gene can also be achieved by inactivating the gene via introducing targeted mutations involving loss-of function alterations (e.g. point mutations, deletions and insertions) in the gene structure.

As used herein, the phrase “loss-of-function alterations” refers to any mutation in the DNA sequence of a gene, which results in downregulation of the expression level and/or activity of the expressed product, i.e., the mRNA transcript and/or the translated protein. Non-limiting examples of such loss-of-function alterations include a missense mutation, i.e., a mutation which changes an amino acid residue in the protein with another amino acid residue and thereby abolishes the enzymatic activity of the protein; a nonsense mutation, i.e., a mutation which introduces a stop codon in a protein, e.g., an early stop codon which results in a shorter protein devoid of the enzymatic activity; a frame-shift mutation, i.e., a mutation, usually, deletion or insertion of nucleic acid(s) which changes the reading frame of the protein, and may result in an early termination by introducing a stop codon into a reading frame (e.g., a truncated protein, devoid of the enzymatic activity), or in a longer amino acid sequence (e.g., a readthrough protein) which affects the secondary or tertiary structure of the protein and results in a non-functional protein, devoid of the enzymatic activity of the non-mutated polypeptide; a readthrough mutation due to a frame-shift mutation or a modified stop codon mutation (i.e., when the stop codon is mutated into an amino acid codon), with an abolished enzymatic activity; a promoter mutation, i.e., a mutation in a promoter sequence, usually 5′ to the transcription start site of a gene, which results in down-regulation of a specific gene product; a regulatory mutation, i.e., a mutation in a region upstream or downstream, or within a gene, which affects the expression of the gene product; a deletion mutation, i.e., a mutation which deletes coding nucleic acids in a gene sequence and which may result in a frame-shift mutation or an in-frame mutation (within the coding sequence, deletion of one or more amino acid codons); an insertion mutation, i.e., a mutation which inserts coding or non-coding nucleic acids into a gene sequence, and which may result in a frame-shift mutation or an in-frame insertion of one or more amino acid codons; an inversion, i.e., a mutation which results in an inverted coding or non-coding sequence; a splice mutation i.e., a mutation which results in abnormal splicing or poor splicing; and a duplication mutation, i.e., a mutation which results in a duplicated coding or non-coding sequence, which can be in-frame or can cause a frame-shift.

According to specific embodiments loss-of-function alteration of a gene may comprise at least one allele of the gene.

The term “allele” as used herein, refers to any of one or more alternative forms of a gene locus, all of which alleles relate to a trait or characteristic. In a diploid cell or organism, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes.

According to other specific embodiments loss-of-function alteration of a gene comprises both alleles of the gene. In such instances the mutation may be in a homozygous form or in a heterozygous form.

Methods of introducing nucleic acid alterations to a gene of interest are well known in the art [see for example Menke D. Genesis (2013) 51:-618; Capecchi, Science (1989) 244:1288-1292; Santiago et al. Proc Natl Acad Sci USA (2008) 105:5809-5814; International Patent Application Nos. WO 2014085593, WO 2009071334 and WO 2011146121; U.S. Pat. Nos. 8,771,945, 8,586,526, 6,774,279 and UP Patent Application Publication Nos. 20030232410, 20050026157, US20060014264; the contents of which are incorporated by reference in their entireties] and include targeted homologous recombination, site specific recombinases, PB transposases and genome editing by engineered nucleases. Agents for introducing nucleic acid alterations to a gene of interest can be designed publically available sources or obtained commercially from Transposagen, Addgene and Sangamo Biosciences.

Following is a description of various exemplary methods used to introduce nucleic acid alterations to a gene of interest and agents for implementing same that can be used according to specific embodiments of the present invention.

Genome Editing using engineered endonucleases—this approach refers to a reverse genetics method using artificially engineered nucleases to cut and create specific double-stranded breaks at a desired location(s) in the genome, which are then repaired by cellular endogenous processes such as, homology directed repair (HDR) and non-homologous end-joining (NFfEJ). NFfEJ directly joins the DNA ends in a double-stranded break, while HDR utilizes a homologous sequence as a template for regenerating the missing DNA sequence at the break point. In order to introduce specific nucleotide modifications to the genomic DNA, a DNA repair template containing the desired sequence must be present during HDR. Genome editing cannot be performed using traditional restriction endonucleases since most restriction enzymes recognize a few base pairs on the DNA as their target and the probability is very high that the recognized base pair combination will be found in many locations across the genome resulting in multiple cuts not limited to a desired location. To overcome this challenge and create site-specific single- or double-stranded breaks, several distinct classes of nucleases have been discovered and bioengineered to date. These include the meganucleases, Zinc finger nucleases (ZFNs), transcription-activator like effector nucleases (TALENs) and CRISPR/Cas system.

Meganucleases—Meganucleases are commonly grouped into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cys box family and the HNH family. These families are characterized by structural motifs, which affect catalytic activity and recognition sequence. For instance, members of the LAGLIDADG family are characterized by having either one or two copies of the conserved LAGLIDADG motif. The four families of meganucleases are widely separated from one another with respect to conserved structural elements and, consequently, DNA recognition sequence specificity and catalytic activity. Meganucleases are found commonly in microbial species and have the unique property of having very long recognition sequences (>14 bp) thus making them naturally very specific for cutting at a desired location. This can be exploited to make site-specific double-stranded breaks in genome editing. One of skill in the art can use these naturally occurring meganucleases, however the number of such naturally occurring meganucleases is limited. To overcome this challenge, mutagenesis and high throughput screening methods have been used to create meganuclease variants that recognize unique sequences. For example, various meganucleases have been fused to create hybrid enzymes that recognize a new sequence. Alternatively, DNA interacting amino acids of the meganuclease can be altered to design sequence specific meganucleases (see e.g., U.S. Pat. No. 8,021,867). Meganucleases can be designed using the methods described in e.g., Certo, M T et al. Nature Methods (2012) 9:073-975; U.S. Pat. Nos. 8,304,222; 8,021,867; 8,119,381; 8, 124,369; 8, 129,134; 8,133,697; 8,143,015; 8,143,016; 8,148,098; or 8,163,514, the contents of each are incorporated herein by reference in their entirety. Alternatively, meganucleases with site specific cutting characteristics can be obtained using commercially available technologies e.g., Precision Biosciences' Directed Nuclease Editor™ genome editing technology.

ZFNs and TALENs—Two distinct classes of engineered nucleases, zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), have both proven to be effective at producing targeted double-stranded breaks (Christian et al., 2010; Kim et al., 1996; Li et al., 2011; Mahfouz et al., 2011; Miller et al., 2010).

Basically, ZFNs and TALENs restriction endonuclease technology utilizes a non-specific DNA cutting enzyme which is linked to a specific DNA binding domain (either a series of zinc finger domains or TALE repeats, respectively). Typically a restriction enzyme whose DNA recognition site and cleaving site are separate from each other is selected. The cleaving portion is separated and then linked to a DNA binding domain, thereby yielding an endonuclease with very high specificity for a desired sequence. An exemplary restriction enzyme with such properties is Fok1. Additionally Fok1 has the advantage of requiring dimerization to have nuclease activity and this means the specificity increases dramatically as each nuclease partner recognizes a unique DNA sequence. To enhance this effect, Fok1 nucleases have been engineered that can only function as heterodimers and have increased catalytic activity. The heterodimer functioning nucleases avoid the possibility of unwanted homodimer activity and thus increase specificity of the double-stranded break.

Thus, for example to target a specific site, ZFNs and TALENs are constructed as nuclease pairs, with each member of the pair designed to bind adjacent sequences at the targeted site. Upon transient expression in cells, the nucleases bind to their target sites and the Fok1 domains heterodimerize to create a double-stranded break. Repair of these double-stranded breaks through the nonhomologous end-joining (NHEJ) pathway most often results in small deletions or small sequence insertions. Since each repair made by NHEJ is unique, the use of a single nuclease pair can produce an allelic series with a range of different deletions at the target site. The deletions typically range anywhere from a few base pairs to a few hundred base pairs in length, but larger deletions have successfully been generated in cell culture by using two pairs of nucleases simultaneously (Carlson et al., 2012; Lee et al., 2010). In addition, when a fragment of DNA with homology to the targeted region is introduced in conjunction with the nuclease pair, the double-stranded break can be repaired via homology directed repair to generate specific modifications (Li et al., 2011; Miller et al., 2010; Urnov et al., 2005).

Although the nuclease portions of both ZFNs and TALENs have similar properties, the difference between these engineered nucleases is in their DNA recognition peptide. ZFNs rely on Cys2-His2 zinc fingers and TALENs on TALEs. Both of these DNA recognizing peptide domains have the characteristic that they are naturally found in combinations in their proteins. Cys2-His2 Zinc fingers typically found in repeats that are 3 bp apart and are found in diverse combinations in a variety of nucleic acid interacting proteins. TALEs on the other hand are found in repeats with a one-to-one recognition ratio between the amino acids and the recognized nucleotide pairs. Because both zinc fingers and TALEs happen in repeated patterns, different combinations can be tried to create a wide variety of sequence specificities. Approaches for making site-specific zinc finger endonucleases include, e.g., modular assembly (where Zinc fingers correlated with a triplet sequence are attached in a row to cover the required sequence), OPEN (low-stringency selection of peptide domains vs. triplet nucleotides followed by high-stringency selections of peptide combination vs. the final target in bacterial systems), and bacterial one-hybrid screening of zinc finger libraries, among others. ZFNs can also be designed and obtained commercially from e.g., Sangamo Biosciences™ (Richmond, Calif.).

Method for designing and obtaining TALENs are described in e.g. Reyon et al. Nature Biotechnology 2012 May; 30(5):460-5; Miller et al. Nat Biotechnol. (2011) 29: 143-148; Cermak et al. Nucleic Acids Research (2011) 39 (12): e82 and Zhang et al. Nature Biotechnology (2011) 29 (2): 149-53. A recently developed web-based program named Mojo Hand was introduced by Mayo Clinic for designing TAL and TALEN constructs for genome editing applications (can be accessed through www(dot)talendesign(dot)org). TALEN can also be designed and obtained commercially from e.g., Sangamo Biosciences™ (Richmond, Calif.).

CRISPR-Cas system—Many bacteria and archea contain endogenous RNA-based adaptive immune systems that can degrade nucleic acids of invading phages and plasmids. These systems consist of clustered regularly interspaced short palindromic repeat (CRISPR) genes that produce RNA components and CRISPR associated (Cas) genes that encode protein components. The CRISPR RNAs (crRNAs) contain short stretches of homology to specific viruses and plasmids and act as guides to direct Cas nucleases to degrade the complementary nucleic acids of the corresponding pathogen. Studies of the type II CRISPR/Cas system of Streptococcus pyogenes have shown that three components form an RNA/protein complex and together are sufficient for sequence-specific nuclease activity: the Cas9 nuclease, a crRNA containing 20 base pairs of homology to the target sequence, and a trans-activating crRNA (tracrRNA) (Jinek et al. Science (2012) 337: 816-821.). It was further demonstrated that a synthetic chimeric guide RNA (gRNA) composed of a fusion between crRNA and tracrRNA could direct Cas9 to cleave DNA targets that are complementary to the crRNA in vitro. It was also demonstrated that transient expression of Cas9 in conjunction with synthetic gRNAs can be used to produce targeted double-stranded brakes in a variety of different species (Cho et al., 2013; Cong et al., 2013; DiCarlo et al., 2013; Hwang et al., 2013a,b; Jinek et al., 2013; Mali et al., 2013).

The CRIPSR/Cas system for genome editing contains two distinct components: a gRNA and an endonuclease e.g. Cas9.

The gRNA is typically a 20 nucleotide sequence encoding a combination of the target homologous sequence (crRNA) and the endogenous bacterial RNA that links the crRNA to the Cas9 nuclease (tracrRNA) in a single chimeric transcript. The gRNA/Cas9 complex is recruited to the target sequence by the base-pairing between the gRNA sequence and the complement genomic DNA. For successful binding of Cas9, the genomic target sequence must also contain the correct Protospacer Adjacent Motif (PAM) sequence immediately following the target sequence. The binding of the gRNA/Cas9 complex localizes the Cas9 to the genomic target sequence so that the Cas9 can cut both strands of the DNA causing a double-strand break. Just as with ZFNs and TALENs, the double-stranded brakes produced by CRISPR/Cas can undergo homologous recombination or NHEJ.

The Cas9 nuclease has two functional domains: RuvC and HNH, each cutting a different DNA strand. When both of these domains are active, the Cas9 causes double strand breaks in the genomic DNA.

A significant advantage of CRISPR/Cas is that the high efficiency of this system coupled with the ability to easily create synthetic gRNAs enables multiple genes to be targeted simultaneously. In addition, the majority of cells carrying the mutation present biallelic mutations in the targeted genes.

However, apparent flexibility in the base-pairing interactions between the gRNA sequence and the genomic DNA target sequence allows imperfect matches to the target sequence to be cut by Cas9.

Modified versions of the Cas9 enzyme containing a single inactive catalytic domain, either RuvC- or HNH-, are called ‘nickases’. With only one active nuclease domain, the Cas9 nickase cuts only one strand of the target DNA, creating a single-strand break or ‘nick’. A single-strand break, or nick, is normally quickly repaired through the HDR pathway, using the intact complementary DNA strand as the template. However, two proximal, opposite strand nicks introduced by a Cas9 nickase are treated as a double-strand break, in what is often referred to as a ‘double nick’ CRISPR system. A double-nick can be repaired by either NHEJ or HDR depending on the desired effect on the gene target. Thus, if specificity and reduced off-target effects are crucial, using the Cas9 nickase to create a double-nick by designing two gRNAs with target sequences in close proximity and on opposite strands of the genomic DNA would decrease off-target effect as either gRNA alone will result in nicks that will not change the genomic DNA.

Modified versions of the Cas9 enzyme containing two inactive catalytic domains (dead Cas9, or dCas9) have no nuclease activity while still able to bind to DNA based on gRNA specificity. The dCas9 can be utilized as a platform for DNA transcriptional regulators to activate or repress gene expression by fusing the inactive enzyme to known regulatory domains. For example, the binding of dCas9 alone to a target sequence in genomic DNA can interfere with gene transcription.

There are a number of publically available tools available to help choose and/or design target sequences as well as lists of bioinformatically determined unique gRNAs for different genes in different species such as the Feng Zhang lab's Target Finder, the Michael Boutros lab's Target Finder (E-CRISP), the RGEN Tools: Cas-OFFinder, the CasFinder: Flexible algorithm for identifying specific Cas9 targets in genomes and the CRISPR Optimal Target Finder.

In order to use the CRISPR system, both gRNA and Cas9 should be expressed in a target cell. The insertion vector can contain both cassettes on a single plasmid or the cassettes are expressed from two separate plasmids. CRISPR plasmids are commercially available such as the px330 plasmid from Addgene.

“Hit and run” or “in-out”—involves a two-step recombination procedure. In the first step, an insertion-type vector containing a dual positive/negative selectable marker cassette is used to introduce the desired sequence alteration. The insertion vector contains a single continuous region of homology to the targeted locus and is modified to carry the mutation of interest. This targeting construct is linearized with a restriction enzyme at a one site within the region of homology, electroporated into the cells, and positive selection is performed to isolate homologous recombinants. These homologous recombinants contain a local duplication that is separated by intervening vector sequence, including the selection cassette. In the second step, targeted clones are subjected to negative selection to identify cells that have lost the selection cassette via intrachromosomal recombination between the duplicated sequences. The local recombination event removes the duplication and, depending on the site of recombination, the allele either retains the introduced mutation or reverts to wild type. The end result is the introduction of the desired modification without the retention of any exogenous sequences.

The “double-replacement” or “tag and exchange” strategy—involves a two-step selection procedure similar to the hit and run approach, but requires the use of two different targeting constructs. In the first step, a standard targeting vector with 3′ and 5′ homology arms is used to insert a dual positive/negative selectable cassette near the location where the mutation is to be introduced. After electroporation and positive selection, homologously targeted clones are identified. Next, a second targeting vector that contains a region of homology with the desired mutation is electroporated into targeted clones, and negative selection is applied to remove the selection cassette and introduce the mutation. The final allele contains the desired mutation while eliminating unwanted exogenous sequences.

Site-Specific Recombinases—The Cre recombinase derived from the P1 bacteriophage and Flp recombinase derived from the yeast Saccharomyces cerevisiae are site-specific DNA recombinases each recognizing a unique 34 base pair DNA sequence (termed “Lox” and “FRY”, respectively) and sequences that are flanked with either Lox sites or FRT sites can be readily removed via site-specific recombination upon expression of Cre or Flp recombinase, respectively. For example, the Lox sequence is composed of an asymmetric eight base pair spacer region flanked by 13 base pair inverted repeats. Cre recombines the 34 base pair lox DNA sequence by binding to the 13 base pair inverted repeats and catalyzing strand cleavage and religation within the spacer region. The staggered DNA cuts made by Cre in the spacer region are separated by 6 base pairs to give an overlap region that acts as a homology sensor to ensure that only recombination sites having the same overlap region recombine.

Basically, the site specific recombinase system offers means for the removal of selection cassettes after homologous recombination. This system also allows for the generation of conditional altered alleles that can be inactivated or activated in a temporal or tissue-specific manner. Of note, the Cre and Flp recombinases leave behind a Lox or FRT “scar” of 34 base pairs. The Lox or FRT sites that remain are typically left behind in an intron or 3′ UTR of the modified locus, and current evidence suggests that these sites usually do not interfere significantly with gene function.

Thus, Cre/Lox and Flp/FRT recombination involves introduction of a targeting vector with 3′ and 5′ homology arms containing the mutation of interest, two Lox or FRT sequences and typically a selectable cassette placed between the two Lox or FRT sequences. Positive selection is applied and homologous recombinants that contain targeted mutation are identified. Transient expression of Cre or Flp in conjunction with negative selection results in the excision of the selection cassette and selects for cells where the cassette has been lost. The final targeted allele contains the Lox or FRT scar of exogenous sequences.

Transposases—As used herein, the term “transposase” refers to an enzyme that binds to the ends of a transposon and catalyzes the movement of the transposon to another part of the genome.

As used herein the term “transposon” refers to a mobile genetic element comprising a nucleotide sequence which can move around to different positions within the genome of a single cell. In the process the transposon can cause mutations and/or change the amount of a DNA in the genome of the cell.

A number of transposon systems that are able to also transpose in cells e.g. vertebrates have been isolated or designed, such as Sleeping Beauty [Izsvák and Ivics Molecular Therapy (2004) 9, 147-156], piggyBac [Wilson et al. Molecular Therapy (2007) 15, 139-145], To12 [Kawakami et al. PNAS (2000) 97 (21): 11403-11408] or Frog Prince [Miskey et al. Nucleic Acids Res. December 1, (2003) 31(23): 6873-6881]. Generally, DNA transposons translocate from one DNA site to another in a simple, cut-and-paste manner. Each of these elements has their own advantages, for example, Sleeping Beauty is particularly useful in region-specific mutagenesis, whereas To12 has the highest tendency to integrate into expressed genes. Hyperactive systems are available for Sleeping Beauty and piggyBac. Most importantly, these transposons have distinct target site preferences, and can therefore introduce sequence alterations in overlapping, but distinct sets of genes. Therefore, to achieve the best possible coverage of genes, the use of more than one element is particularly preferred. The basic mechanism is shared between the different transposases, therefore we will describe piggyBac (PB) as an example.

PB is a 2.5 kb insect transposon originally isolated from the cabbage looper moth, Trichoplusia ni. The PB transposon consists of asymmetric terminal repeat sequences that flank a transposase, PBase. PBase recognizes the terminal repeats and induces transposition via a “cut-and-paste” based mechanism, and preferentially transposes into the host genome at the tetranucleotide sequence TTAA. Upon insertion, the TTAA target site is duplicated such that the PB transposon is flanked by this tetranucleotide sequence. When mobilized, PB typically excises itself precisely to reestablish a single TTAA site, thereby restoring the host sequence to its pretransposon state. After excision, PB can transpose into a new location or be permanently lost from the genome.

Typically, the transposase system offers an alternative means for the removal of selection cassettes after homologous recombination quit similar to the use Cre/Lox or Flp/FRT. Thus, for example, the PB transposase system involves introduction of a targeting vector with 3′ and 5′ homology arms containing the mutation of interest, two PB terminal repeat sequences at the site of an endogenous TTAA sequence and a selection cassette placed between PB terminal repeat sequences. Positive selection is applied and homologous recombinants that contain targeted mutation are identified. Transient expression of PBase removes in conjunction with negative selection results in the excision of the selection cassette and selects for cells where the cassette has been lost. The final targeted allele contains the introduced mutation with no exogenous sequences.

For PB to be useful for the introduction of sequence alterations, there must be a native TTAA site in relatively close proximity to the location where a particular mutation is to be inserted.

Genome editing using recombinant adeno-associated virus (rAAV) platform—this genome-editing platform is based on rAAV vectors which enable insertion, deletion or substitution of DNA sequences in the genomes of live mammalian cells. The rAAV genome is a single-stranded deoxyribonucleic acid (ssDNA) molecule, either positive- or negative-sensed, which is about 4.7 kb long. These single-stranded DNA viral vectors have high transduction rates and have a unique property of stimulating endogenous homologous recombination in the absence of double-strand DNA breaks in the genome. One of skill in the art can design a rAAV vector to target a desired genomic locus and perform both gross and/or subtle endogenous gene alterations in a cell. rAAV genome editing has the advantage in that it targets a single allele and does not result in any off-target genomic alterations. rAAV genome editing technology is commercially available, for example, the rAAV GENESIS™ system from Horizon™ (Cambridge, UK).

It will be appreciated that the agent can be a mutagen that causes random mutations and the cells exhibiting downregulation of the expression level and/or activity of the target gene or expression product thereof may be selected.

The mutagens may be, but are not limited to, genetic, chemical or radiation agents. For example, the mutagen may be ionizing radiation, such as, but not limited to, ultraviolet light, gamma rays or alpha particles. Other mutagens may include, but not be limited to, base analogs, which can cause copying errors; deaminating agents, such as nitrous acid; intercalating agents, such as ethidium bromide; alkylating agents, such as bromouracil; transposons; natural and synthetic alkaloids; bromine and derivatives thereof; sodium azide; psoralen (for example, combined with ultraviolet radiation). The mutagen may be a chemical mutagen such as, but not limited to, ICR191, 1,2,7,8-diepoxy-octane (DEO), 5-azaC, N-methyl-N-nitrosoguanidine (MNNG) or ethyl methane sulfonate (EMS).

Methods for qualifying efficacy and detecting sequence alteration are well known in the art and include, but not limited to, DNA sequencing, electrophoresis, an enzyme-based mismatch detection assay and a hybridization assay such as PCR, RT-PCR, RNase protection, in-situ hybridization, primer extension, Southern blot, Northern Blot and dot blot analysis.

Sequence alterations in a specific gene can also be determined at the protein level using e.g. chromatography, electrophoretic methods, immunodetection assays such as ELISA and western blot analysis and immunohistochemistry.

In addition, one ordinarily skilled in the art can readily design a knock-in/knock-out construct including positive and/or negative selection markers for efficiently selecting transformed cells that underwent a homologous recombination event with the construct. Positive selection provides a means to enrich the population of clones that have taken up foreign DNA. Non-limiting examples of such positive markers include glutamine synthetase, dihydrofolate reductase (DHFR), markers that confer antibiotic resistance, such as neomycin, hygromycin, puromycin, and blasticidin S resistance cassettes. Negative selection markers are necessary to select against random integrations and/or elimination of a marker sequence (e.g. positive marker). Non-limiting examples of such negative markers include the herpes simplex-thymidine kinase (HSV-TK) which converts ganciclovir (GCV) into a cytotoxic nucleoside analog, hypoxanthine phosphoribosyltransferase (HPRT) and adenine phosphoribosytransferase (ARPT).

Down-regulation at the polypeptide level is also contemplated herein.

According to specific embodiments the agent capable of downregulating a target gene product is an antibody or antibody fragment capable of specifically binding the protein. Preferably, the antibody specifically binds at least one epitope of the target protein. As used herein, the term “epitope” refers to any antigenic determinant on an antigen to which the paratope of an antibody binds. Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or carbohydrate side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics.

As the target protein is localized intracellularly, an antibody or antibody fragment capable of specifically binding the target protein is typically an intracellular antibody.

Methods of producing polyclonal and monoclonal antibodies as well as fragments thereof are well known in the art (See for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988, incorporated herein by reference).

Another agent which can be used along with some embodiments of the invention to downregulate the target protein is an aptamer. As used herein, the term “aptamer” refers to double stranded or single stranded RNA molecule that binds to specific molecular target, such as a protein. Various methods are known in the art which can be used to design protein specific aptamers. The skilled artisan can employ SELEX (Systematic Evolution of Ligands by Exponential Enrichment) for efficient selection as described in Stoltenburg R, Reinemann C, and Strehlitz B (Biomolecular engineering (2007) 24(4):381-403).

Another agent capable of downregulating the target protein would be any molecule which binds to and/or cleaves the target protein. Such molecules can be a small molecule, antagonists, or inhibitory peptide.

Treatment can be combined with any anti cancer treatment known in the art, including, but not limited to, chemotherapeutic agents, radiotherapeutic agents, hormonal therapy, immune modulators, engineered immune cell therapy (e.g., CAR-T) and other treatment regimens (e.g., surgery, cell transplantation e.g. hematopoietic stem cell transplantation) which are well known in the art.

The chemotherapeutic agent of the present invention can be, but not limited to, cytarabine (cytosine arabinoside, Ara-C, Cytosar-U), asprin, sulindac, curcumin, alkylating agents including: nitrogen mustards, such as mechlor-ethamine, cyclophosphamide, ifosfamide, melphalan and chlorambucil; nitrosoureas, such as carmustine (BCNU), lomustine (CCNU), and semustine (methyl-CCNU); thylenimines/methylmelamine such as thriethylenemelamine (TEM), triethylene, thiophosphoramide (thiotepa), hexamethylmelamine (HMM, altretamine); alkyl sulfonates such as busulfan; triazines such as dacarbazine (DTIC); antimetabolites including folic acid analogs such as methotrexate and trimetrexate, pyrimidine analogs such as 5-fluorouracil, fluorodeoxyuridine, gemcitabine, cytosine arabinoside (AraC, cytarabine), 5-azacytidine, 2,2 •difluorodeoxycytidine, purine analogs such as 6-mercaptopurine, 6-thioguanine, azathioprine, 2′-deoxycoformycin (pentostatin), erythrohydroxynonyladenine (EHNA), fludarabine phosphate, and 2-chlorodeoxyadenosine (cladribine, 2-CdA); natural products including antimitotic drugs such as paclitaxel, vinca alkaloids including vinblastine (VLB), vincristine, and vinorelbine, taxotere, estramustine, and estramustine phosphate; epipodophylotoxins such as etoposide and teniposide; antibiotics, such as actimomycin D, daunomycin (rubidomycin), doxorubicin, mitoxantrone, idarubicin, bleomycins, plicamycin (mithramycin), mitomycinC, and actinomycin; enzymes such as L-asparaginase, cytokines such as interferon (IFN)-gamma, tumor necrosis factor (TNF)-alpha, TNF-beta and GM-CSF, anti-angiogenic factors, such as angiostatin and endostatin, inhibitors of FGF or VEGF such as soluble forms of receptors for angiogenic factors, including soluble VGF/VEGF receptors, platinum coordination complexes such as cisplatin and carboplatin, anthracenediones such as mitoxantrone, substituted urea such as hydroxyurea, methylhydrazine derivatives including Nmethylhydrazine (MIH) and procarbazine, adrenocortical suppressants such as mitotane (o,p′-DDD) and aminoglutethimide; hormones and antagonists including adrenocorticosteroid antagonists such as prednisone and equivalents, dexamethasone and aminoglutethimide;

progestin such as hydroxyprogesterone caproate, medroxyprogesterone acetate and megestrol acetate; estrogen such as diethylstilbestrol and ethinyl estradiol equivalents; antiestrogen such as tamoxifen; androgens including testosterone propionate and fluoxymesterone/equivalents; antiandrogens such as flutamide, gonadotropin-releasing hormone analogs and leuprolide; non-steroidal antiandrogens such as flutamide; kinase inhibitors, histone deacetylase inhibitors, methylation inhibitors, proteasome inhibitors, monoclonal antibodies, oxidants, anti-oxidants, telomerase inhibitors, BH3 mimetics, ubiquitin ligase inhibitors, stat inhibitors and receptor tyrosin kinase inhibitors such as imatinib mesylate (marketed as Gleevac or Glivac) and erlotinib (an EGF receptor inhibitor) now marketed as Tarveca; and anti-virals such as oseltamivir phosphate, Amphotericin B, and palivizumab.

In some embodiments the chemotherapeutic agent of the present invention is cytarabine (cytosine arabinoside, Ara-C, Cytosar-U), quizartinib (AC220), sorafenib (BAY 43-9006), lestaurtinib (CEP-701), midostaurin (PKC412), carboplatin, carmustine, chlorambucil, dacarbazine, ifosfamide, lomustine, mechlorethamine, procarbazine, pentostatin, (2′deoxycoformycin), etoposide, teniposide, topotecan, vinblastine, vincristine, paclitaxel, dexamethasone, methylprednisolone, prednisone, all-trans retinoic acid, arsenic trioxide, interferon-alpha, rituximab (Rituxan®), gemtuzumab ozogamicin, imatinib mesylate, Cytosar-U), melphalan, busulfan (Myleran®), thiotepa, bleomycin, platinum (cisplatin), cyclophosphamide, Cytoxan®)., daunorubicin, doxorubicin, idarubicin, mitoxantrone, 5-azacytidine, cladribine, fludarabine, hydroxyurea, 6-mercaptopurine, methotrexate, 6-thioguanine, or any combination thereof.

According to a specific embodiment, the treatment is combined with an immune checkpoint inhibitor, such as described above.

According to a specific embodiment, administering the immune checkpoint inhibitor is following administering the agent, as described herein, or the cells (e.g., TILs). It is suggested that treatment with the agent or the cells will prime treatment with the checkpoint inhibitors.

The agent/cells of some embodiments of the invention can be administered to an organism per se, or in a pharmaceutical composition where it is mixed with suitable carriers or excipients.

As used herein a “pharmaceutical composition” refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.

Herein the term “active ingredient” refers to the agent/cells accountable for the biological effect.

Hereinafter, the phrases “physiologically acceptable carrier” and “pharmaceutically acceptable carrier” which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases.

Herein the term “excipient” refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.

Techniques for formulation and administration of drugs may be found in “Remington's Pharmaceutical Sciences,” Mack Publishing Co., Easton, Pa., latest edition, which is incorporated herein by reference.

Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery, intravenous, intraperitoneal, intranasal, or intraocular injections.

Conventional approaches for drug delivery to the central nervous system (CNS) include: neurosurgical strategies (e.g., intracerebral injection or intracerebroventricular infusion); molecular manipulation of the agent (e.g., production of a chimeric fusion protein that comprises a transport peptide that has an affinity for an endothelial cell surface molecule in combination with an agent that is itself incapable of crossing the BBB) in an attempt to exploit one of the endogenous transport pathways of the BBB; pharmacological strategies designed to increase the lipid solubility of an agent (e.g., conjugation of water-soluble agents to lipid or cholesterol carriers); and the transitory disruption of the integrity of the BBB by hyperosmotic disruption (resulting from the infusion of a mannitol solution into the carotid artery or the use of a biologically active agent such as an angiotensin peptide). However, each of these strategies has limitations, such as the inherent risks associated with an invasive surgical procedure, a size limitation imposed by a limitation inherent in the endogenous transport systems, potentially undesirable biological side effects associated with the systemic administration of a chimeric molecule comprised of a carrier motif that could be active outside of the CNS, and the possible risk of brain damage within regions of the brain where the BBB is disrupted, which renders it a suboptimal delivery method.

Alternately, one may administer the pharmaceutical composition in a local rather than systemic manner, for example, via injection of the pharmaceutical composition directly into a tissue region of a patient.

Pharmaceutical compositions of some embodiments of the invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

Pharmaceutical compositions for use in accordance with some embodiments of the invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.

For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

For oral administration, the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

Pharmaceutical compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.

For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

For administration by nasal inhalation, the active ingredients for use according to some embodiments of the invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.

Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.

Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.

The pharmaceutical composition of some embodiments of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.

Pharmaceutical compositions suitable for use in context of some embodiments of the invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (agent/cells) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., cancer. melanoma) or prolong the survival of the subject being treated.

Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.

Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in “The Pharmacological Basis of Therapeutics”, Ch. 1 p. 1).

Dosage amount and interval may be adjusted individually to provide agent/cells levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.

Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.

The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.

Compositions of some embodiments of the invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as is further detailed above.

As used herein the term “about” refers to ±10%.

The terms “comprises”, “comprising”, “includes”, “including”, “having” and their conjugates mean “including but not limited to”.

The term “consisting of” means “including and limited to”.

The term “consisting essentially of” means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.

As used herein, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a compound” or “at least one compound” may include a plurality of compounds, including mixtures thereof.

Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.

As used herein the term “method” refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.

When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.

It is understood that any Sequence Identification Number (SEQ ID NO) disclosed in the instant application can refer to either a DNA sequence or a RNA sequence, depending on the context where that SEQ ID NO is mentioned, even if that SEQ ID NO is expressed only in a DNA sequence format or a RNA sequence format.

It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

EXAMPLES

Reference is now made to the following examples, which together with the above descriptions, illustrate the invention in a non-limiting fashion.

Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, “Molecular Cloning: A laboratory Manual” Sambrook et al., (1989); “Current Protocols in Molecular Biology” Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., “Current Protocols in Molecular Biology”, John Wiley and Sons, Baltimore, Md. (1989); Perbal, “A Practical Guide to Molecular Cloning”, John Wiley & Sons, New York (1988); Watson et al., “Recombinant DNA”, Scientific American Books, New York; Birren et al. (eds) “Genome Analysis: A Laboratory Manual Series”, Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; “Cell Biology: A Laboratory Handbook”, Volumes I-III Cellis, J. E., ed. (1994); “Current Protocols in Immunology” Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), “Basic and Clinical Immunology” (8th Edition), Appleton & Lange, Norwalk, Conn. (1994); Mishell and Shiigi (eds), “Selected Methods in Cellular Immunology”, W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; “Oligonucleotide Synthesis” Gait, M. J., ed. (1984); “Nucleic Acid Hybridization” Hames, B. D., and Higgins S. J., eds. (1985); “Transcription and Translation” Hames, B. D., and Higgins S. J., Eds. (1984); “Animal Cell Culture” Freshney, R. I., ed. (1986); “Immobilized Cells and Enzymes” IRL Press, (1986); “A Practical Guide to Molecular Cloning” Perbal, B., (1984) and “Methods in Enzymology” Vol. 1-317, Academic Press; “PCR Protocols: A Guide To Methods And Applications”, Academic Press, San Diego, Calif. (1990); Marshak et al., “Strategies for Protein Purification and Characterization—A Laboratory Course Manual” CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.

Materials and Methods

Tumor Dissociation

Fresh tumor tissue was dissociated by manual mincing followed by an incubation of 20 minutes at 37° C. in RPMI with collagenase IV (Sigma-Aldrich C5138) and pulmozyme (Roche), alternated with 3 rounds of dissociation with a gentlemacs dissociator (Miltenyi, 130-093-235, 130-096-334). After dissociation, cell suspensions were filtered with a 100 um filter, washed in RPMI 1640 medium with penicillin, streptomycin and human serum. Cell suspensions were frozen down in 90% FBS and 10% DMSO.

PBMC Isolation

PBMCs were isolated from blood using a Ficoll gradient. PBMCs were frozen in 90% FBS and 10% DMSO directly after collection.

Single Cell Sorting of Tumor and Blood Materials

Tumor cell suspensions and PBMCs were thawed in RPMI with human serum, penicillin and streptomycin, and 250 U/ml benzonase. Cells were stained in PBS with 0.5% BSA and 2 mM EDTA containing fluorochrome-conjugated antibodies. Cells were stained with propidium iodide (PI) immediately prior to sorting with a FACSaria Fusion. Forward and side scatter settings were used to select for immune cells and exclude doublets, viable cells were identified based on low PI staining, and immune cells were sorted based on CD45 expression. For each tumor, multiple plates were sorted with CD3+ and CD3− immune cells. Immune cells were single cell sorted using index sorting into 384 wells plates containing 2 μL of lysis solution with barcoded poly(T) reverse-transcription (RT) primers. Four empty wells were kept in each 384-well plate as a no-cell control. Plates were briefly centrifuged, snap frozen on dry ice, and stored at −80 degree. Antibodies used for sorting are CD3-FITC and CD45-APC or CD45-BV510, and for index sorting combinations of CD4-BV421, CD4-BV510, CD8-AF700, CD8-Pacific Orange, PD1-PE, CD103-BV711, PDL1-APC, CD11b-BV650, CD56-PE, TIM3-BV421, LAG3-AF700, OX40-BV711, CD137-APC. For PBMC sorting, CD45-FITC, CD3-FITC, CD8-AF700, PD1-PE, CD103-BV711, CCR7-PECF594, and CD45RA-PECY5.5 were used.

Single Cell Libraries Preparation

Single cell libraries were prepared with Massively Parallel Single-Cell RNA-seq Library (MARS-seq) (Jaitin et al., 2014). In brief, mRNA from tumor or immune cells sorted into cell capture plates are barcoded and converted into cDNA and pooled using an automated pipeline. The pooled sample is then linearly amplified by T7 in vitro transcription, and the resulting RNA is fragmented and converted into a sequencing-ready library by tagging the samples with pool barcodes and illumina sequences during ligation, reverse transcription, and PCR. Each pool of cells is tested for library quality and concentration is assessed.

Single Cell TCR-Seq (scTCR-Seq) Libraries Preparation

After linear amplification by T7 RNA polymerase-mediated in vitro transcription in MARS-seq library process, half of the resulting RNA material was reversed transcribed with a primer set that are specific to different Vβ segments of human T cell receptor β chain (Han et al., 2014). The resulting complementary DNA was then amplified with a set of nested primers (Han et al., 2014) and partial rd-2 primer. The PCR product was then cleaned up and used for a final amplification step with P7-rd1 and P5-rd2 primers. The TCR libraries were then sequenced in Illumina Miseq, with 165 bp of read1 sequence and 15 bp of read2 sequence. Primer sequences are listed Table 3 below.

TABLE 3
TCRb 
primer 
set 1 sequence
TRBV2 CTGAAATATTCGATGATCAATTCTCAG 64
TRBV3 TCATTATAAATGAAACAGTTCCAAATCG 65
TRBV4 AGTGTGCCAAGTCGCTTCTCAC 66
TRBV5-1 GAGACACAGAGAAACAAAGGAAACTTC 67
TRBV5-4,8 AGAGGAAACTYCCCTCCTAGATT 68 C/T
69
TRBV6- AAGGAGAAGTCCCSAATGGCTACAA 70 C/G
1,5,6
TRBV6-2,3 AGGGTACAACTGCCAAAGGAGAGGT 71
TRBV6-4 GGCAAAGGAGAAGTCCCTGATGGTT 72
TRBV6-8 CTGACAAAGAAGTCCCCAATGGCTAC 73
TRBV6-9 CACTGACAAAGGAGAAGTCCCCGAT 74
TRBV7-2,7 AGACAAATCAGGGCTGCCCAGTGA 75
TRBV7-3 GACTCAGGGCTGCCCAACGAT 76
77
78
TRBV7-8 CCAGAATGAAGCTCAACTAGACAA 79
TRBV7-9 GACTTACTTCCAGAATGAAGCTCAACT 80
TRBV9 GAGCAAAAGGAAACATTCTTGAACGATT 81
TRBV10-1,3 GGCTRATCCATTACTCATATGGTGTT 82 A/G
TRBV10-2 GATAAAGGAGAAGTCCCCGATGGCT 83
TRBV11 GATTCACAGTTGCCTAAGGATCGAT 84
TRBV12-3,4 GATTCAGGGATGCCCGAGGATCG 85
TRBV12-5 GATTCGGGGATGCCGAAGGATCG 86
TRBV13 GCAGAGCGATAAAGGAAGCATCCCT 87
TRBV14 TCCGGTATGCCCAACAATCGATTCT 88
TRBV15 GATTTTAACAATGAAGCAGACACCCCT 89
TRBV16 GATGAAACAGGTATGCCCAAGGAAAG 90
TRBV18 TATCATAGATGAGTCAGGAATGCCAAAG 91
TRBV19 GACTTTCAGAAAGGAGATATAGCTGAA 92
TRBV20 CAAGGCCACATACGAGCAAGGCGTC 93
TRBV24 CAAAGATATAAACAAAGGAGAGATCTCT 94
TRBV25 AGAGAAGGGAGATCTTTCCTCTGAGT 95
TRBV27 GACTGATAAGGGAGATGTTCCTGAAG 96
TRBV28 GGCTGATCTATTTCTCATATGATGTTAA 97
TRBV29 GCCACATATGAGAGTGGATTTGTCATT 98
TRBV30 GGTGCCCCAGAATCTCTCAGCCT 99

scTCR-Seq Protocol Validation

Five different human T cell clones with known TCR sequences were stained with CD3-APC, CD3-FITC, CD3-PE, CD3-PerCP, and CD3-AF700 and subsequently mixed in a 1:1 ratio, and four single cell 384 well plates were sorted while recording index values, and processed with scTCR-seq method. The obtained TCRβ sequences were then compared with the known reference sequence per cell to determine the sensitivity and specificity. The present method was able to identify the TCRβ in 32% (490/1520) of cells sorted, with the correct TCRβ assigned in 97% (442/455) of cells with clear FACS index data to serve as a reference.

Ex Vivo T Cell Expansion

T cells were expanded from tumor fragments or tumor suspension by culturing in RPMI with human serum, penicillin and streptomycin and 6000 IU/ml IL2 for 14 days. For further expansion, T cells were cultured in RPMI with human serum, penicillin and streptomycin with 3000 IU/ml IL2, 30 ng/ml aCD3 antibody, and 1:200 irradiated PBMCs (40Gy) for an additional 14 days.

Cell Cycle Staining

Tumor single cell suspensions were stained with Live/dead fixable near-IR dead cell stain kit, CD45-APC, CX3CR1-PE, PD1-PeCy7, CD8-AF700 and CD3-FITC. After fixation with the FOXP3/transcription factor staining buffer set and additional fixation with 70% ethanol, cells were permeabilized and stained with KI67-PerCPCy5.5. Prior to read-out, 1 ug/ml DAPI was added.

Tumor Reactivity Assays

Ex vivo expanded T cells and tumor suspensions were incubated in RPMI with human serum, penicillin and streptomycin, and benzonase for 45-60 min. T cells were labeled with cell trace violet according to manufacturer's protocol. T cells and tumor cells were overnight co-cultured in a 1:1 ratio in RPMI with human serum, penicillin and streptomycin. 60 minutes after starting the co-culture, golgiplug (BD Biosciences) was added to the medium. Cell suspension were extracellularly stained with CD3-APC, CD8-AF700, and IRDye in PBS with 0.5% BSA and 2 mM EDTA. Cells were fixated and permeabilized in 1% PFA and 0.1% Triton. Intracellular staining for IFNg-PE, TNFa-AF499, and CD137-BV650 was done in 1% PFA, 0.1% Triton, and 1% BSA.

Histology Analysis

Paraffin sections were cut at 3 um from FFPE tumor material. Slides were stained with Hematoxylin and Bluing Reagent and manually scored for the percentage of immune infiltrate.

Quantification and Statistical Analysis

Low-Level MARS-Seq Processing

All scRNA-seq libraries (pooled at equimolar concentration) were sequenced using Illumina NextSeq 500 at a median sequencing depth of ˜40,000 reads per cell. Sequences were mapped to human genome (hg19), demultiplexed, and filtered as previously described (Jaitin et al., 2014) with the following adaptations. Mapping of reads was done using HISAT (version 0.1.6); reads with multiple mapping positions were excluded. Reads were associated with genes if they were mapped to an exon, using the UCSC genome browser for reference. Exons of different genes that shared genomic position on the same strand were considered a single gene with a concatenated gene symbol. The level of spurious UMIs in the data was estimated using statistics on empty MARS-seq wells, and excluded rare cases with estimated noise >5% (median estimated noise over all experiment was 2%).

scTCR-Seq Raw Data Processing and Analysis

TCR sequences were generated from 384 well plates, including a barcode and UMI, similar to MARS-seq. Initial filtering was performed on each plate independently. Barcode sequencing errors were corrected by grouping reads with similar barcodes (hamming distance <=2) and filtering reads with similar UMIs but different barcodes. Typical sequencing coverage for TCR molecules was high after extracting positions 80-130 base pairs in the sequence for the hyper variable region, and used filtering of low coverage UMIs since these were observed to be strongly enriched for errors and contamination (i.e. as demonstrated previously in MARS-seq). These filtering stages provided us with a filtered table of candidate TCR sequences per barcode.

The remaining pre-processing was similar to Tracer (Stubbington et al., 2016). The fasta files from the first step were used as the input of IgBlast (ftp://ftp(dot)ncbi(dot)nlm(dot)nih(dot)gov/blast/executables/igblast/release/1.7.0/). Reads were then grouped according to the TCR sequence that represented them best, provided mapping was to the correct gene segments and the E-values for the reported V and J alignments were below 5e-3. A csv file with statistics from IgBlast was generated for all the productive reads (not shown).

Metacell Modelling

The MetaCell package (Baran et al. Submitted, see software resources) was used with the following specific parameters (complete script reproducing all analysis from raw data will be available). Specific mitochondrial, Immunoglobulins, high abundance lincRNA, and genes linked with poorly supported transcriptional models were removed (annotated with the prefix “RP-”). Cells with less than 500 UMIs or total fraction of mitochondrial gene expression exceeding 60% were filtered. Gene features were selected using the parameter Tvm=0.2 and minimal total umi >200. Gene features associated with the cell cycle, type I Interferon (IFN) response, and general stress using a clustering approach were used. To this end first all genes with correlation coefficient at least 0.1 for one of the anchor genes MKI67, HIST1H1D, PCNA, SMC4, MCM3 (cell cycle), ISG15, OAS1, WARS, IFIT1 (type I IFN) and TXN, HSP90AB1, HSPA1A, FOS, HIF1A (stress) were identified. The present inventors then hierarchically clustered the correlation matrix between these genes (filtering genes with low coverage and compute correlation using a down-sampled UMI matrix).

For the MC model in FIG. 1-5, cells from 25 patients with validated pathological profile (two patients had 2 metastases) were used. It is of note that no patients were filtered before the MC creation. On some panels, a minimum of 100 T/NK cells per patient was enforced. The gene selection strategy discussed above retained a total of 1,675 gene features for the computation of the Metacell balanced similarity graph. The present inventors used K=200, 500 bootstrap iterations and otherwise standard parameters. No outlier filtering was applied, but the MC splitting phase was performed.

Annotation of the MC model was done using the MC confusion matrix and analysis of marker genes. A single erythrocyte MC of 14 cells was removed, and classified the remaining MCs as T/NK or other, using straightforward analysis of known cell type markers (e.g. CD3D, CD3G, CD4, CD8A-B, and more). Detailed annotation within the T/NK MC model was performed using hierarchical clustering of the T/NK confusion matrix (FIG. 1K) and supervised analysis of enriched genes as shown in the text.

Analysis of PBMC data (FIGS. 6D-H) was performed using similar parameters, with K=200, and analysis of marker genes shown to be enriched in the infiltrates model.

Defining Differentiation Gene Modules and Gradients

To account for the complex gene expression in dysfunctional CD8, cytotoxic CD8, T regulatory, macrophage, and monocytes, a metacell analysis was combined with an approach aiming at identifying quantitative gene signatures. Given any list of signature genes for a certain differentiation fate, the signature's scores for each metacell were identified by averaging the metacell log enrichment scores (lfp values) of the genes in the set. Note that using this approach the contribution of highly expressed genes to the score was limited, and relied on the regularization of the metacell computation of gene enrichment scores to restrict the noise levels inflicted over the differentiation scores.

To define signatures gene sets for CD8 dysfunctional, CD8 cytotoxic, and regulatory T-cells, groups of 30 non-TF genes that were maximally correlated to selected anchor genes (LAG3, FGFBP2 and IL2RA) were identified, using linear correlation over metacells' log enrichment scores. Genes associated with cell cycle, type I IFN and stress were filtered from these lists. Anchors were validated by testing correlation of the signature scores computed from their derived gene sets to all genes while excluding the gene itself from the score (FIGS. 2N-O), establishing consistency and robustness (genes remained top ranking even when omitting them from the score) to anchor selection. The anchor approach for T-cells was preferred over the alternative approach of finding genes with maximal enrichment for a selected metacell, given the high complexity and multiple regulatory processes affecting the T-cells transcriptional space. Selecting and validating a consistent gene set starting from a well-defined anchor ensured that our score is based on the pathway of interest, and imitated some classical concepts from biclustering analysis.

For defining myeloid signature gene sets the simpler approach of selecting the genes with highest enrichment in metacells annotated as monocytes, DC, or macrophage (excluding one metacell annotated as non-classical monocytes) was used. To this end the log enrichment scores of each gene was averaged over the metacells in the respective groups, but excluded genes for which only one metacell was enriched over the other metacells in the group by 8-fold or more.

To validate the significance of the transcriptional gradients that the present inventors observed when computing the various signature scores, the present inventors relied on the fact that metacells group cells into disjoint sets, and tested differential expression of genes that were not part of the signature gene set between bins of cells that were grouped into metacells with increasing ranges of signature scores (e.g. FIG. 2Q). To study potential transcriptional regulatory networks in T-cells and myeloid cells w a list of annotated transcription factors genes was used (Lambert et al., 2018) with some specific additions (ID2, ID3 and TOX). As mentioned above, TFs were not considered when defining the signature scores, so modelling was not over-fitted a-priori. For modelling the difference between the dysfunctional and cytotoxic signature scores in CD8+ metacells, candidate regulatory TFs were identified as those enriched at least two fold over the background in at least one CD8+ metacell and inferred a simple linear model aiming to predict the difference in signature scores using the enrichment scores of a subset of the TF candidates. This was done in the framework of a lasso-regularized cross validation scheme with the R package glmnet. A similar approach was applied to predict the T-reg score in T-reg metacells and the difference between monocyte and macrophages scores in myeloid metacells.

Analysis of Clonal-Sharing

scTCR-seq data can provide a clonal identifier for the T-cells in which it is observed. Cells sharing an identifier were therefore considered sharing a clonal origin. Cells missing an identifier were considered as not observed (rather than not clonal). A correlation was observed between the intensity of TCR expression (as estimated by MARS-seq) and the rate of scTCR-seq detection, which may suggest systematic bias in the analysis of clonality rates, enriching for signals in T-cell populations showing high levels of TCR (e.g. dysfunctional, Tfh, and Treg cells, FIG. 5M-N). To control for some of these effects, as well as for the variable efficiency of TCR detection in different patients, the present inventors used a resampling strategy to generate randomized TCR-seq information and control for clonality statistics. Resampling was performed by selecting at random a new cell for each observed TCR sequence, but forcing the cell to maintain the original patient source, and the original bin (one of 9 bins) of overall TCR-seq expression. This was repeated for 200 iterations and gave rise to a robust control dataset that preserve patient/clone size compositions and the overall relationship between TCR intensity and probability of TCR detection. Statistics on the metacell types of pairs of cells belonging to the same clone was thereby controlled for using comparison to the randomized data (FIG. 5L). NK cells (51 cells) with retrieved TCR were removed from this analysis as they represent misclassified T cells. Cells within the memory and dysfunctional CD4 metacells were also removed because their low frequency prevented the robust statistical analysis of the clonality signatures.

Data and Software Availability

The MetaCell R package and its open-source code are available from www(dot)bitbucket(dot)org/tanaylab/metacell/src/default/

Example 1

Transcriptional States of Immune Cells in Human Melanoma

In order to better understand the heterogeneity of immune cells within and across melanoma patients, a protocol for single cell transcriptomic and protein index characterization of immune (CD45+) cells, and in particular T (CD3+) cells in melanoma tumors was designed (FIGS. 1A and 1G). Design of the study was focused on maintaining the in situ RNA composition of tumor infiltrating immune cells, by immediate dissociation of tumor material for MARS-seq analysis (Jaitin et al., 2014). Data was collected on a total of 47,772 QC positive tumor infiltrating cells from 25 melanoma patients, including patients with stage 3 and stage 4 melanoma with a diverse treatment history, and 9 treatment-naïve, stage 3, in-transit melanomas (Table 4).

TABLE 4
Clinical metadata for sequenced patients. Related to FIG. 1A. Multiple
metastases from the same patient are marked with a -1 or -2 in the
patient ID. PBMCs are noted as -PB. Tumor location (primary (P),
(sub)cutaneous, lymphnode (LN), and musculus (MSC)), disease
stage, and immune checkpoint therapy prior to and at the time of
resection are shown.
Tumor Disease On-
Patient_ID location stage Prior treatment treatment Notes
p1 LN 4
p10 MSC 4 aCTLA4, aPD1
p11 (S)C 3
p12-1 (S)C 3
p12-2 (S)C 3
p13 (S)C 3
p13-PB PBMC 3
p15 (S)C 3
p16 (S)C 3
p17-1 (S)C 3
p17-2 (S)C 3
p17-PB PBMC 3
p18 (S)C 3
p19 (S)C 3
p2 LN 4 aPD1, aCTLA4
p20 (S)C 3 aPD1
p21 (S)C 3
p22 LN 3 No tumor
cells left
p23 LN 3
p24-1 LN 3 Healthy tissue
p24-2 LN 3
p25 P 3
p26 P 2
p27 (S)C 4 aPD1 aPD1
p27-PB PBMC 4
p28 (S)C 4 aPD1, aCTLA4
p3 (S)C 4
p4 (S)C 4 aPD1
p5 LN 4 aCTLA4, aPD1
p6 (S)C 4 aPD1 aPD1
p8 (S)C 4 aPDL1,
aCTLA4, aPD1
p9 (S)C 4 aCTLA4, aPD1 aPD1

Recent work demonstrates that the infiltrating T cell compartment in human tumors is composed of a mixture of tumor reactive and bystander T cells, including T cells reactive against human herpesviruses (Scheper et al.; Simoni et al., 2018). For this reason, it was important to characterize both the transcriptional state of T cells and their TCR, allowing one to determine which T cell states are clonally linked and which are potentially tumor-specific. To this end, a variant of MARS-seq was developed that provides information on both the TCR and the transcriptome of individual T cells (Methods). The MetaCell algorithm was used to identify homogeneous and robust groups of cells (“meta-cells”; Methods) from scRNA-seq data, resulting in a detailed map of 324 metacells organized into seven broad lineages, including T cells (characterized by expression of CD3), NK cells (KLRD1), dendritic cells (CD1C), macrophages (C1Q), monocytes (VCAN), B cells (CD19), and plasma cells (Ig) (FIGS. 1B and 1H-J; and data not shown).

Example 2

T Cells Form a Gradient of Transcriptional States within Tumors

Both T and NK cells were characterized by a diverse group of transcriptional states that annotated broadly using analysis of the metacell similarity matrix (similarity between 218 metacells, FIG. 1K) and its 2D projection (FIG. 1C). This mapping revealed naïve-like T cells, but also CD4 and CD8 T cell pools with different degrees of differentiation. T cells in the naïve-like subset were metabolically inactive cells that showed weak transcriptional activity (FIG. 1D-E). FACS-based index analysis allowed subdivision of some of the naïve subset into CD4+ and CD8+ (FIG. 1L), but apart from high level expression of the IL7R, CCR7, and the transcription factor TCF7, limited additional transcriptional activity was observed relative to other T cell pools (FIGS. 1E and M-L). In contrast, the non-naïve T cell metacells showed remarkable transcriptional heterogeneity. Another small group of cells that was made up of CD4 and CD8 T cells was putatively annotated as memory T cell population (FIG. 1O). The CD8 subset was initially subdivided into a transitional CD8 T (GZMK) pool, a cytotoxic T effector (GZMH) pool and a large cluster of dysfunctional CD8 T cells, marked by high expression of immune checkpoint molecules such as PD-1 and LAGS. The borders between these different CD8 classes were diffuse, even though metacell resampling analysis supported the robustness of the model. This observation implied that transcriptional gradients contribute to T cell heterogeneity as further discussed below. The CD4 T cell subset was dominated by FOXP3 expressing regulatory T cells (Treg) but also included a distinct subset with characteristics of follicular helper T cells (marked by CXCL13), and another smaller group of cells expressing various immune checkpoint molecules, similar to the ones observed in CD8 T cells (FIG. 1P). Finally, although CD3 negative, NK cells expressed many gene modules that were also observed in cytotoxic T cells (FIG. 1Q).

Importantly, despite the high diversity in T cell types and states, data from multiple patients contributed to the definition of all Metacells (FIG. 1F). This observation demonstrates that a robust universal regulatory process controls the T cell states that occur within human tumors. As such, the transcriptional T cell states that are observed pan-patient can be used for in-depth analysis of the possible gene regulatory mechanisms that give rise to the diversity of T cell states in melanoma immune infiltrates.

Example 3

Dysfunctional CD8 Cells Span a Regulated Differentiation Spectrum

Analysis of CD8+ metacells resulted in the de novo identification of a rich set of co-regulated gene modules (FIGS. 2A and 2L), including programs associated with basic cellular functions (ACTB and MHC-I genes), naïve T cell regulation (TCF7), and specific groups of genes linked with effector functions (GZMH, GNLY, FGFBP2, and CX3CR1) or the dysfunctional state (TIGIT, PD-1, and LAG3). Based on these data, two transcriptional scores were computed, one quantifying the activity of a dysfunctional gene module (correlated with LAG3) and the other assessing overall intensity of the expression of a cytotoxic gene module (correlated with FGFBP2) (FIGS. 2B-C and 2M-O). Then a quantitative comparison of the distribution of the two programs was performed over all CD8+ metacells and observed a spectrum of transcriptional intensities, demonstrating the presence of a transitional CD8+θstate that forms a continuum with the dysfunctional T cell state. Weaker support for a continuum between the transitional and cytotoxic effector states was observed (FIGS. 2D and 2P). The observation of this continuum from the transitional towards the dysfunctional state argues against models assuming three distinct and static molecular states (i.e. clusters of transitional, cytotoxic, and dysfunctional cells), or a differentiation regime that leads from the cytotoxic program towards a dysfunctional (“exhausted”) state. In addition, the molecular data suggested that the two trajectories that lead towards the cytotoxic or to the dysfunctional state are highly regulated. It was found that many transcription factors (TFs), partly not yet associated with a dysfunctional phenotype in human T cells, correlated with the dysfunctional program. These included the Notch signaling TF RBPJ as well as ZBED2, ETV1, MAF, PRDM1, and EOMES (FIG. 2E). In addition, distinct transcription factors that correlated specifically with the cytotoxic program (KLF2 and TBX21/T-bet) were also observed (FIG. 2E). Using the expression of these TFs, a simple linear regulatory model was inferred, predicting the contrasting dysfunctional and cytotoxic programs with high accuracy (R2=0.93) using lasso-regularized cross validation on 139 metacells (FIG. 2F). We note that metacells define disjoint and robust groups of single cells and provide statistical support for putative transcriptional gradients, which robustly control for smoothing artifacts or low-depth data (FIG. 2Q).

A similar analysis of CD4 Treg metacells identified a co-regulated gene module that includes IL2RA, ICOS and GITR (FIGS. 2G-H and 2R). Furthermore, analysis of this gene module and TFs that were correlated with it (BTAF, FOXP3, and IKZF2) across Treg metacells suggested that Tregs within tumors can be organized along a gradient of intensifying expression of characteristic Treg genes and specific TFs (FIG. 2I). Interestingly, some of the gene modules activated in Tregs overlapped with those characteristic of the dysfunctional program in CD8 cells, and a number of TFs, including PRDM1, VDR, MAF and ZBED2, were correlated with both programs. To further examine transcriptional overlap between dysfunctional CD8 T cells and regulatory T cells, the gene expression correlation was compared to the dysfunctional and Treg program (FIG. 2J). Genes that were correlated with both the dysfunctional and Treg gradient included regulatory molecules and many co-inhibitory and co-stimulatory receptors (e.g. TNFRSF9/CD137, CSF-1 and TIGIT). In contrast, FOXP3, IL2RA (CD25), and IKZF4 were only associated with regulatory T cells, while PD-1, CXCL13, IFNG, and EOMES were preferentially correlated with the dysfunctional and not the Treg program. Visualization of the dysfunctional and Treg scores for metacells confirmed the overlap between these two differentiation programs (FIG. 2K). Interestingly, CD4 Tfh metacells shared genes with the dysfunctional CD8 program that were distinctively missing in Tregs—including CXCL13 (FIG. 2S). In conclusion a dominant group of dysfunctional CD8 T cells was observed that is characterized by gradual rather than discrete activation of immune checkpoint gene expression, and that also partially shares regulatory mechanisms with regulatory CD4 T and Tfh cell populations. In contrast, the observed CD8 cytotoxic cell pool stands out as a more distinct population.

Example 4

Monocyte Differentiation and Bifurcation is Observed within Tumors

An in-depth analysis of the metacell map was performed consisting of 16,412 QC positive CD45+ cells, across all patients, following in silico removal of T/NK cells (FIG. 3A). Within this model diverse myeloid cell types were observed, including macrophages (C1Q), monocytes (VCAN), dendritic cells (DC; enriched for CLEC10A and CD1C), plasmacytoid dendritic cells (LILRA4), and also a small group of osteoclast-like (MMP9) cells (FIGS. 3B and 3E-F; and data not shown).

In addition, metacells defining B and plasma cells were observed. To characterize potential myeloid differentiation trajectories, the transcriptional signatures for monocyte, macrophage, and DC metacells were identified (FIGS. 3C and 3F-G). These signatures were then used to compute scores for each metacell in the myeloid model, resulting in a bifurcation like structure that connects specific transcriptional states that define the three programs through metacells expressing these pathways with transitional intensity (FIGS. 3D and 3H). A model was derived that accurately predicts monocyte and macrophage metacell expression signatures from TF expression alone (R2=0.99, cross validated lasso regularized linear model) (FIG. 3E-F). These data, and in particular the existence of monocytes in different stages of differentiation within tumors, suggest an ongoing development of monocytes within tumors, rather than the sole infiltration of mature myeloid types.

The presence of various myeloid cell populations has previously been suggested as a potential modifier of T cell activity in tumors (Binnewies et al., 2018; Lavin et al., 2017; Merad et al., 2013; Salmon et al., 2016; Tcyganov et al., 2018).

Example 5

Inter-Patient Variation of Dysfunctional CD8+ T Cells

To map conserved and patient specific patterns in infiltrating immune cells, the immune composition of each patient was systematically analyzed (FIG. 4A-B). Globally, the majority of the observed T cell transcriptional states were shared across many patients, with relatively few cases of individual patients contributing more than half of the cells in a metacell. A more heterogeneous distribution was observed for myeloid cells, with many metacells composed by cells from a small number of patients. These patient-specific myeloid cell states included several macrophage and monocyte metacells highly enriched for type-I interferon signaling (FIGS. 4B and 4E). While the metacell model showed that the transcriptional states of T cells were conserved between patients, the frequency of these states in different patients was remarkably diverse. In particular, it was observed that the CD8 dysfunctional state constituted a highly variable fraction (ranging from 3.6% to 72.1%, median of 28.9%) of the tumor-infiltrating T cells (FIG. 4C). Analysis of possible correlations between dysfunctional CD8 T cell load and gene expression signatures in monocytes or in B cells showed no significant results, indicating that such correlations, if existing, are insufficiently strong to allow detection in our patient cohort (FIG. 4F). In contrast, we did observe the fraction of dysfunctional T cells to be negatively correlated to the fraction of naïve T cells (p<0.001; FIG. 4D), and positively correlated to the fraction of Tfh cells (p<0.05; FIG. 4D). The latter observation might indicate the presence of tertiary lymphoid structures with high levels of dysfunctional cells in a subset of tumors, as previously described in lung (Thommen et al., 2018) and breast cancer (Buisseret et al., 2017; Gu-Trantien et al., 2017). To start examining the possible connections between this differential representation of T cell states and treatment history or site of metastasis, heterogeneity was compared in T cell states either within a set of stage 3 and 4 tumors with different treatment history or within a set of 9 treatment-naïve, stage 3, in-transit melanomas. Notably, substantial heterogeneity was observed even when restricting analysis to treatment-naïve patients at the same anatomical site (FIG. 4G). Furthermore, analysis of 2 independent lesions for 2 patients revealed a similar composition (FIG. 4H), suggesting composition variability is not driven by technical biases. In summary, our data define a universal spectrum of dysfunctional T cell states within melanoma patients but show that the abundance of cells within this spectrum is remarkably different between patients. The current cohort does not support the existence of a strong link between myeloid cell compositions and dysfunctional or other T cell states, but does suggest that the load of CD8 dysfunctional T cells is an intrinsic, and possibly key feature of melanoma tumors.

Example 6

Dysfunctional CD8 Cells have Proliferative Capacity and Form Large Clones within Tumors

To understand the clonal structure of different T cell states, a modified version of the MARS-seq protocol was generated that allows coupled analysis of single cell transcriptomes and TCR sequences (FIG. 1A; Methods). With this strategy, it was possible to recover TCRβ sequence from 6,306 T cells, consisting of 3,492 unique TCRβ sequences. As expected, TCR clonotype composition was highly variable across patients, and the only case where same clones were identified from different biopsies was for the two independent metastases from patient p12, revealing remarkably similar clone compositions in the two metastatic lesions (FIG. 5A-B; not shown). Some T cell infiltrates showed a diverse TCR repertoire with minimal clonal expansion, while others were strongly dominated by a small number of T cell clones (FIG. 5B-C). Interestingly, larger clones showed a non-uniform distribution of functional states (FIG. 5C), with an enrichment for dysfunctional states and depletion of naïve states. Conversely, stratification of patients by their inferred dysfunctional T cell score showed clonality to be positively correlated with the fraction of dysfunctional cells (FIG. 5D). Projection of clonal composition data on the T cell metacells (FIG. 5E), and quantification of the fraction of cells linked with a singleton or with a clone >2 cells, highlighted dysfunctional metacells as being strongly enriched for larger clones (see additional control for TCR expression intensity in Figure M-N).

To link clonal composition with potential proliferation dynamics in tumors, we computed a proliferation score for each cell, by pooling the expression of cell cycle genes (FIG. 5O; not shown), and then used the resulting bimodal distribution to classify the proliferative state of individual cells (FIG. 5P; Methods). Notably, to avoid interference of parallel gene modules with analysis of cell state, proliferation genes were excluded during metacell derivation in the model described in FIG. 1. In contrast to expectations, a large fraction of T cells was observed to be cycling (in total 6.8%), with the fraction of proliferating cells showing a highly non-uniform distribution of T cell states (FIGS. 5F and 5Q). The highest fraction of proliferative cells was observed in dysfunctional T cells, which were nearly 10 fold more likely to proliferate than naïve-like T cells (FIGS. 5G and 5Q). FACS analysis of Ki-67, a nuclear protein marking cellular proliferation, validated the proliferative capacity of dysfunctional T cells (FIG. 5R). Furthermore, dysfunctional T cells were observed to occupy all stages of the cell cycle (G0/G1, S, and M), arguing against the possibility of cell cycle arrest (FIG. 5S). Tregs and Tfh CD4+ T cells also showed higher fractions of cells expressing proliferation-associated genes as compared to naïve or cytotoxic T cells, or as compared to NK cells. Analysis of the fraction of cells that show a proliferation signature along the dysfunctional and Treg transcriptional gradients indicated that proliferation was most profound in the earlier stages of both postulated differentiation trajectories (FIGS. 5H-J and 5T). In summary, both the proliferation dynamics and distribution of clone sizes support the model that dysfunctional T cells in human melanoma form a highly proliferative and dynamic compartment. In addition, regulatory T cells also appear to proliferate prior to full activation of their regulatory program (FIGS. 5I and 5T), but this presumed proliferation is not associated with the accumulation of large Treg clones in the tumors.

Example 7

Clonal Linkage of Naïve, Transitional and Dysfunctional T Cells

The clonal identifiers obtained by TCR analysis provide a unique data set to infer the lineage structure of T cells in tumors. As shown in FIG. 5K, the composition of clones generally shows high functional coherence, with the individual cells within a clone being allocated to the same functional class or related classes. In very rare cases, TCR clones were observed in sister cells that mapped to both CD4 and CD8 T metacells. Examination of index sorting data suggested that these cases originated from rare metacell mis-assignment of individual cells. To systematically analyze all available information on intra-clonal structure, including data from small clones, all pairs of cells sampled from the same TCR clone were identified and then estimated lineage relationship between cell types using pooled statistics of paired types, compared to shuffled controls (Methods). As expected, that data show a very clear separation between CD4+ cells and CD8+ cells. More interestingly, a strong clustering of transitional CD8+ and dysfunctional cells was observed, whereas cytotoxic cells formed a distinct group (FIG. 5L).

In contrast, CD8+ effector cytotoxic cells appear to originate from external inputs. To further examine this, additional 15,744 (11,872 QC positive) cells including PBMCs were pooled from 3 melanoma patients and 2 healthy donors (FIG. 6D-E). This analysis demonstrated a complete lack of dysfunctional cells within these samples but ample evidence for naïve-like, transitional CD8+ and cytotoxic T cells (FIG. 6F-H). This is consistent with a model of ongoing differentiation and proliferation of dysfunctional T cells at tumor sites, and suggests that their development may be distinct (in time and space) from the dynamics of cytotoxic T cell differentiation.

Example 8

High Levels of Dysfunctionality in CD8 T Cells is Associated with Tumor Reactivity

To understand the relationship between the presence of T cells with defined differentiation states and tumor reactivity of the intratumoral T cell pool, T cells from 10 patients were expanded ex vivo, and reactivity of expanded T cells towards autologous single cell tumor digest was tested. (FIG. 6A). Tumor reactivity, as measured by IFNg production, was highly variable between TILs derived from different patients. In six out of ten patients, 2%-38% of the T cells showed tumor reactivity, and for the remaining patients no reactivity above background could be detected (below 1%) (FIG. 6B). Of those 4 samples, tumor cells from one patient (p8) were HLA class I negative, thereby preventing proper analysis of CD8+ T cell reactivity. Interestingly, when ordering patients by the distribution of dysfunctional scores within CD8+ T cells, we observed that T cell pools with detectable reactivity against autologous tumor cells generally displayed a more prominent CD8+ dysfunctional state (FIG. 6C). When combined with the data on transcriptional gradients that characterize dysfunctional states, the clonal composition of the dysfunctional T cell pool and the evidence for ongoing proliferation of this subset, these data support a model in which an ongoing intratumoral T cell differentiation is induced by antigen-driven interactions with surrounding tumor cells.

Example 9

AKAP5 and ID3 Overexpression Primes Tumor Infiltrating T Cells Towards a Dysfunctional State

In order to evaluate the involvement of AKAP5 and ID3 in the priming of a dysfunctional phenotype in CD8 T cells an over expression model of AKAP5 and ID3 was used in T cells expanded from the tumor or heathy donor peripheral blood mononuclear cells (PBMC). AKAP5, ID3, and GFP control were overexpressed in T cells isolated from both the tumor and PBMC and the dysfunctional status was measured using FACS for intra cellular staining of CXCL13 production in CD8 T cells, in unstimulated conditions, or after TCR triggering by CD28 and CD3 for 12 hours (FIG. 8). Whereas CD8 and CD4 T cells from healthy blood and CD4 T cells expanded from the tumor did not produce CXCL13 upon overexpression of both AKAP5 and ID3 (data not shown), overexpression of either of these factors in tumor expanded CD8 T cells induced production of CXCL13, irrespective of TCR triggering.

Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

It is the intent of the applicant(s) that all publications, patents and patent applications referred to in this specification are to be incorporated in their entirety by reference into the specification, as if each individual publication, patent or patent application was specifically and individually noted when referenced that it is to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. In addition, any priority document(s) of this application is/are hereby incorporated herein by reference in its/their entirety.

REFERENCES

    • (other references are recited throughout the application)
  • Apetoh, L., Smyth, M. J., Drake, C. G., Abastado, J.-P., Apte, R. N., Ayyoub, M., Blay, J.-Y., Bonneville, M., Butterfield, L. H., Caignard, A., et al. (2015). Consensus nomenclature for CD8+ T cell phenotypes in cancer. Oncoimmunology 4, e998538.
  • Azizi, E., Carr, A. J., Plitas, G., Cornish, A. E., Konopacki, C., Prabhakaran, S., Nainys, J., Wu, K., Kiseliovas, V., Setty, M., et al. (2018). Single-Cell Map of Diverse Immune Phenotypes in the Breast Tumor Microenvironment. Cell 174, 1-16.
  • Binnewies, M., Roberts, E. W., Kersten, K., Chan, V., Fearon, D. F., Merad, M., Coussens, L. M., Gabrilovich, D. I., Ostrand-Rosenberg, S., Hedrick, C. C., et al. (2018). Understanding the tumor immune microenvironment (TIME) for effective therapy. Nat. Med. 24, 541-550.
  • Blackburn, S. D., Shin, H., Freeman, G. J., and Wherry, E. J. (2008). Selective expansion of a subset of exhausted CD8 T cells by alphaPD-L1 blockade. Proc. Natl. Acad. Sci. U.S.A 105, 15016-15021.
  • Borst, J., Ahrends, T., Bqbala, N., Melief, C. J. M., and Kastenmüller, W. (2018). CD4+ T cell help in cancer immunology and immunotherapy. Nat. Rev. Immunol. 1.
  • Buisseret, L., Garaud, S., de Wind, A., Van den Eynden, G., Boisson, A., Solinas, C., Gu-Trantien, C., Naveaux, C., Lodewyckx, J.-N., Duvillier, H., et al. (2017). Tumor-infiltrating lymphocyte composition, organization and PD-1/PD-L1 expression are linked in breast cancer. Oncoimmunology 6, e1257452.
  • Chihara, N., Madi, A., Kondo, T., Zhang, H., Acharya, N., Singer, M., Nyman, J., Marjanovic, N. D., Kowalczyk, M. S., Wang, C., et al. (2018). Induction and transcriptional regulation of the co-inhibitory gene module in T cells. Nature 558, 454-459.
  • Gu-Trantien, C., Migliori, E., Buisseret, L., Wind, A. de, Brohée, S., Garaud, S., Noel, G., Chi, V. L. D., Lodewyckx, J.-N., Naveaux, C., et al. (2017). CXCL13-producing TFH cells link immune suppression and adaptive memory in human breast cancer. JCI Insight 2.
  • Guo, X., Zhang, Y., Zheng, L., Zheng, C., and Song, J. (2018). Global characterization of T cells in non-small cell lung cancer by single-cell sequencing. Nat. Med. 1-18.
  • Han, A., Glanville, J., Hansmann, L., and Davis, M. M. (2014). Linking T-cell receptor sequence to functional phenotype at the single-cell level. Nat. Biotechnol. 32, 684-692.
  • Hashimoto, M., Kamphorst, A. O., Im, S. J., Kissick, H. T., Pillai, R. N., Ramalingam, S. S., Araki, K., and Ahmed, R. (2018). CD8 T Cell Exhaustion in Chronic Infection and Cancer: Opportunities for Interventions. Annu. Rev. Med 69, 301-318.
  • Im, S. J., Hashimoto, M., Gerner, M. Y., Lee, J., Kissick, H. T., Burger, M. C., Shan, Q., Hale, J. S., Lee, J., Nasti, T. H., et al. (2016). Defining CD8+ T cells that provide the proliferative burst after PD-1 therapy. Nature 537, 417-421.
  • Jaitin, D. A., Kenigsberg, E., Keren-Shaul, H., Elefant, N., Paul, F., Zaretsky, I., Mildner, A., Cohen, N., Jung, S., Tanay, A., et al. (2014). Massively parallel single-cell RNA-seq for marker-free decomposition of tissues into cell types. Science 343, 776-779.
  • Lambert, S. A., Jolma, A., Campitelli, L. F., Das, P. K., Yin, Y., Albu, M., Chen, X., Taipale, J., Hughes, T. R., and Weirauch, M. T. (2018). The Human Transcription Factors. Cell 172, 650-665.
  • Lavin, Y., Kobayashi, S., Leader, A., Amir, E. D., Elefant, N., Bigenwald, C., Remark, R., Sweeney, R., Becker, C. D., Levine, J. H., et al. (2017). Innate Immune Landscape in Early Lung Adenocarcinoma by Paired Single-Cell Analyses. Cell/69, 750-765.e17.
  • Merad, M., Sathe, P., Helft, J., Miller, J., and Mortha, A. (2013). The Dendritic Cell Lineage: Ontogeny and Function of Dendritic Cells and Their Subsets in the Steady State and the Inflamed Setting. Annu. Rev. Immunol 31, 563-604.
  • Paley, M. A., Kroy, D. C., Odorizzi, P. M., Johnnidis, J. B., Dolfi, D. V., Barnett, B. E., Bikoff, E. K., Robertson, E. J., Lauer, G. M., Reiner, S. L., et al. (2012). Progenitor and terminal subsets of CD8+ T cells cooperate to contain chronic viral infection. Science (80-). 338, 1220-1225.
  • Pauken, K. E., and Wherry, E. J. (2015). Overcoming T cell exhaustion in infection and cancer. Trends Immunol. 36, 265-276.
  • Pauken, K. E., Sammons, M. A., Odorizzi, P. M., Manne, S., Godec, J., Khan, O., Drake, A. M., Chen, Z., Sen, D. R., Kurachi, M., et al. (2016). Epigenetic stability of exhausted T cells limits durability of reinvigoration by PD-1 blockade. Science 354, 1160-1165.
  • Petrovas, C., Price, D. A., Mattapallil, J., Ambrozak, D. R., Geldmacher, C., Cecchinato, V., Vaccari, M., Tryniszewska, E., Gostick, E., Roederer, M., et al. (2007). SIV-specific CD8+ T cells express high levels of PD1 and cytokines but have impaired proliferative capacity in acute and chronic SIVmac251 infection. Blood 110, 928-936.
  • Reading, J. L., Galvez-Cancino, F., Swanton, C., Lladser, A., Peggs, K. S., and Quezada, S. A. (2018). The function and dysfunction of memory CD8+ T cells in tumor immunity. Immunol. Rev. 283, 194-212.
  • Ribas, A., and Wolchok, J. D. (2018). Cancer immunotherapy using checkpoint blockade. Science 359, 1350-1355.
  • Salmon, H., Idoyaga, J., Rahman, A., Leboeuf, M., Remark, R., Jordan, S., Casanova-Acebes, M., Khudoynazarova, M., Agudo, J., Tung, N., et al. (2016). Expansion and Activation of CD103(+) Dendritic Cell Progenitors at the Tumor Site Enhances Tumor Responses to Therapeutic PD-L1 and BRAF Inhibition. Immunity 44, 924-938.
  • Savas, P., Virassamy, B., Ye, C., Salim, A., Mintoff, C. P., Caramia, F., Salgado, R., Byrne, D. J., Teo, Z. L., Dushyanthen, S., et al. (2018). Single-cell profiling of breast cancer T cells reveals a tissue-resident memory subset associated with improved prognosis. Nat. Med. 24, 986-993.
  • Scheper, W., Kelderman, S., Fanchi, L. F., Linnemann, C., Bendle, G., Rooij, M. A. J. de, Hirt, C., Mezzadra, R., Slagter, M., Dijkstra, K., et al. Low and variable tumor-reactivity of the intratumoral TCR repertoire in human cancers. Nat. Med. In Press.
  • Sharma, P., and Allison, J. P. (2015). The future of immune checkpoint therapy. Science 348, 56-61.
  • Sharma, P., Hu-Lieskovan, S., Wargo, J. A., and Ribas, A. (2017). Primary, Adaptive, and Acquired Resistance to Cancer Immunotherapy. Cell 168, 707-723.
  • Shin, H., Blackburn, S. D., Blattman, J. N., and Wherry, E. J. (2007). Viral antigen and extensive division maintain virus-specific CD8 T cells during chronic infection. J. Exp. Med. 204, 941-949.
  • Shin, H., Blackburn, S. D., Intlekofer, A. M., Kao, C., Angelosanto, J. M., Reiner, S. L., and Wherry, E. J. (2009). A role for the transcriptional repressor Blimp-1 in CD8(+) T cell exhaustion during chronic viral infection. Immunity. 31, 309-320.
  • Simoni, Y., Becht, E., Fehlings, M., Loh, C. Y., Koo, S. L., Teng, K. W. W., Yeong, J. P. S., Nahar, R., Zhang, T., Kared, H., et al. (2018). Bystander CD8+ T cells are abundant and phenotypically distinct in human tumour infiltrates. Nature 557, 575-579.
  • Śledzińska, A., Menger, L., Bergerhoff, K., Peggs, K. S., and Quezada, S. A. (2015). Negative immune checkpoints on T lymphocytes and their relevance to cancer immunotherapy. Mol. Oncol. 9, 1936-1965.
  • Stubbington, M. J. T., Lönnberg, T., Proserpio, V., Clare, S., Speak, A. O., Dougan, G., and Teichmann, S. A. (2016). T cell fate and clonality inference from single-cell transcriptomes. Nat. Methods 13, 329-332.
  • Tcyganov, E., Mastio, J., Chen, E., and Gabrilovich, D. I. (2018). Plasticity of myeloid-derived suppressor cells in cancer. Curr. Opin. Immunol. 51, 76-82.
  • Thommen, D. S., and Schumacher, T. N. (2018). T Cell Dysfunction in Cancer. Cancer Cell 33, 547-562.
  • Thommen, D. S., Koelzer, V. H., Herzig, P., Roller, A., Trefny, M., Dimeloe, S., Kiialainen, A., Hanhart, J., Schill, C., Hess, C., et al. (2018). A transcriptionally and functionally distinct PD-1+ CD8+ T cell pool with predictive potential in non-small-cell lung cancer treated with PD-1 blockade. Nat. Med. 24, 994-1004.
  • Tirosh, I., Izar, B., Prakadan, S. M., Wadsworth, M. H., Treacy, D., Trombetta, J. J., Rotem, A., Rodman, C., Lian, C., Murphy, G., et al. (2016). Dissecting the multicellular ecosystem of metastatic melanoma by single-cell RNA-seq. Science 352, 189-196.
  • Wherry, E. J., and Kurachi, M. (2015). Molecular and cellular insights into T cell exhaustion. Nat. Rev. Immunol. 15, 486-499.
  • Zheng, C., Zheng, L., Yoo, J. K., Guo, H., Zhang, Y., Guo, X., Kang, B., Hu, R., Huang, J. Y., Zhang, Q., et al. (2017). Landscape of Infiltrating T Cells in Liver Cancer Revealed by Single-Cell Sequencing. Cell 169, 1342-1356.e16.

Claims

What is claimed is:

1. A method of activating dysfunctional CD8+/Lag3+/PD1+/Tim3+/CD103+/CD39+/CD137+/Klrg1 T cells, the method comprising, contacting dysfunctional CD8+/Lag3+/PD1+/Tim3+/CD103+/CD39+/CD137+/Klrg1 T cells with an agent capable of down-regulating a target gene selected from the group consisting of AKAP5, DGKH, PAG1, GALM, FUT8, WARS, CBLB, PIK3AP1, APOBEC3G, SLAMF7, SIRPG, GALNT1 or an expression product thereof, thereby activating the dysfunctional immune cells.

2. A method of treating a subject having a tumor, the method comprising:

(a) determining responsiveness of the subject to immune checkpoint inhibition by: determining in the tumor of the subject a level of dysfunctional CD8+/Lag3+/PD1+/Tim3+/CD103+/CD39+/CD137+/Klrg1 T cells, wherein a level of said dysfunctional cells above a predetermined threshold is indicative of a response to the immune checkpoint inhibition; and

(i) wherein when said level of said dysfunctional cells is above said predetermined threshold, treating or selecting treatment for the subject with immune checkpoint inhibition; or

(ii) wherein when said level of said dysfunctional cells is below said predetermined threshold, subjecting said dysfunctional cells to ex vivo expansion and subsequently treating or selecting treatment for the subject with said immune checkpoint inhibition.

3. A method of treating a subject having a tumor, the method comprising administering to the subject an immune checkpoint inhibitor and an agent capable of down-regulating a target gene selected from the group consisting of AKAP5, DGKH, PAG1, GALM, FUT8, WARS, CBLB, PIK3AP1, APOBEC3G, SLAMF7, SIRPG, GALNT1 or an expression product thereof, thereby treating the subject having the tumor.

4. A method of treating a subject having a tumor, the method comprising administering to the subject an agent capable of down-regulating a target gene selected from the group consisting of AKAP5, DGKH, PAG1, GALM, FUT8, WARS, CBLB, PIK3AP1, APOBEC3G, SLAMF7, SIRPG, GALNT1 or an expression product thereof, thereby treating the subject having the tumor.

5. The method of claim 3, wherein said administering said immune checkpoint inhibitor is following said administering said agent.

6. The method of claim 1, wherein said activating is performed ex-vivo.

7. The method of claim 1, wherein said activating is performed in-vivo.

8. The method of claim 1, wherein said dysfunctional cells are in a proliferative cell state and/or are not in growth arrest.

9. The method of claim 2, wherein said tumor is a solid tumor.

10. The method of claim 9, wherein said solid tumor is a melanoma.

11. The method of claim 1, wherein said dysfunctional T cells are tumor infiltrating cells.

12. The method of claim 2, wherein said immune checkpoint is selected from the group consisting of cytotoxic T-lymphocyte antigen 4 (CTLA4), programmed death 1 (PD-1) or its ligands, lymphocyte activation gene-3 (LAG3), B7 homolog 3 (B7-H3), B7 homolog 4 (B7-H4), indoleamine (2,3)-dioxygenase (IDO), adenosine A2a receptor, neuritin, B- and T-lymphocyte attenuator (BTLA), killer immunoglobulin-like receptors (KIR), T cell immunoglobulin and mucin domain-containing protein 3 (TIM-3), inducible T cell costimulator (ICOS), CD27, CD28, CD40, CD244 (2B4), CD160, GARP, OX40, CD137 (4-1BB), CD25, VISTA, BTLA, TNFR25, CD57, CCR2, CCRS, CCR6, CD39, CD73, CD4, CD18, CD49b, CD1d, CDS, CD21, TIMI, CD19, CD20, CD23, CD24, CD38, CD93, IgM, B220 (CD45R), CD317, CD11b, Ly6G, ICAM-1, FAP, PDGFR, Podoplanin, and TIGIT.

13. The method of claim 2, wherein said determining said level of dysfunctional cells is performed by fluorescence activated cell sorting (FACS).

14. The method of claim 2, wherein said determining said level of dysfunctional cells is performed by single cell transcriptome analysis.

15. The method of claim 2, wherein said dysfunctional cells are in a proliferative cell state and/or are not in growth arrest.

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: