Patent application title:

POLYNUCLEOTIDES FOR THE AMPLIFICATION AND DETECTION OF CHLAMYDIA TRACHOMATIS

Publication number:

US20210301325A1

Publication date:
Application number:

17/054,071

Filed date:

2019-05-09

Abstract:

The invention provides methods and compositions for the detection of Chlamydia trachomatis in a test sample. Its presence or absence in the sample is determined by nucleic acid based testing methods using primers and/or probes and or molecular beacons that bind to the 23S ribosomal genes or gene transcripts.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q2600/112 »  CPC further

Oligonucleotides characterized by their use Disease subtyping, staging or classification

C12Q2600/16 »  CPC further

Oligonucleotides characterized by their use Primer sets for multiplex assays

C12Q2600/166 »  CPC further

Oligonucleotides characterized by their use Oligonucleotides used as internal standards, controls or normalisation probes

C12Q2531/101 »  CPC further

Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid Linear amplification, i.e. non exponential

C12Q2563/107 »  CPC further

Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence

C12Q1/689 »  CPC main

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria

C12Q1/682 »  CPC further

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Hybridisation assays characterised by the detection means Signal amplification

C12Q1/6844 »  CPC further

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids Nucleic acid amplification reactions

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of U.S. Provisional Application No. 62/669,236, filed May 9, 2018, and U.S. Non-Provisional application Ser. No. 15/976,733, filed May 10, 2018, the disclosures of which are incorporated by reference herein in their entirety.

SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on May 8, 2019, is named TSM-045W0 CRF sequencelisting.txt and is 29,937 bytes in size.

FIELD OF THE INVENTION

The present invention relates to the fields of molecular biology and nucleic acid chemistry. The invention provides methods and reagents for detecting pathogens, such as Chlamydia trachomatis and accordingly, also relates to the fields of medical diagnostics and prognostics. In particular, the invention relates to polynucleotides and methods for amplifying and detecting Chlamydia trachomatis.

BACKGROUND OF THE INVENTION

There is an urgent need for the development of a rapid, affordable, sample-in answer-out point of care (POC) diagnostic platform for sexually transmitted infections (STIs). The World Health Organization (WHO) estimates that more than 499 million new cases of curable STIs, namely those due to Neisseria gonorrhoeae (NG), Chlamydia trachomatis (CT), Trichomonas vaginalis (TV) and Syphilis occur every year worldwide in men and women aged 15-49 years, causing significant morbidity and mortality. Untreated gonococcal and chlamydial infections in women in sub-Saharan Africa have been implicated as the cause of up to 85% of infertility among women seeking infertility intervention.

C. trachomatis is responsible for the most common sexually transmitted infection in the US. Chlamydia can cause urethritis in men and pelvic inflammatory disease, ectopic pregnancy and infertility in women. Asymptomatic infections are common both in men and women which warrants screenings to prevent the spread of the disease (as recommended by the CDC).

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 identifies labeled polynucleotide sequences, or molecular beacons, that are capable of binding to amplicon produced from each primer set.

SUMMARY

The present invention encompasses, in some embodiments, a composition comprising a set of polynucleotides selected from the group consisting of Set-1 through Set-81. In some embodiments, the composition further comprises a probe. In some embodiments, the probe comprises a label. In some embodiments, the probe is a labeled polynucleotide. In a preferred implementation, the label is a fluorophore, which preferably is covalently attached to a terminus of the polynucleotide. In a particularly preferred embodiment, the probe or polynucleotide is a molecular beacon comprising a fluorophore, a quencher, and a polynucleotide. In one embodiment, the fluorophore is FAM and the quencher is BHQ1. In an alternate implementation, the fluorophore is ATTO 565 or Alexa 594 and the quencher is BHQ1 or BHQ2.

In some implementations, composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, and nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, nucleotides 6-27 of SEQ ID NO: 130, and nucleotides 8-29 of SEQ ID NO: 131. In further implementations, the labeled polynucleotide can comprise a sequence selected from the group consisting of SEQ ID NOs: 97 through 131. In certain implementations, the sequence of the labeled polynucleotide is selected from the group consisting of SEQ ID NOs: 97 through 131. In other embodiments, the sequence of the labeled polynucleotide is selected from the group consisting of SEQ ID NOs: 97 through 131.

In some embodiments, the set of polynucleotides is selected from the group consisting of Set-12, Sets 14-27, Set-39, Sets 41-54, Set-66, and Sets 68-81, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 7-32 of SEQ ID NO: 128, and nucleotides 4-27 of SEQ ID NO: 129. In some implementations, the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 128, and SEQ ID NO: 129. In some implementations, the sequence of the labeled polynucleotide is SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 128, and SEQ ID NO: 129. In a preferred implementation, the sequence of the labeled polynucleotide is SEQ ID NO: 115, and the set of polynucleotides is selected from the group consisting of Set-20, Set-24, Set-47, Set-51, Set-74 and Set-78. Even more preferably, the set of polynucleotides is Set-20 or Set-24.

In yet another embodiment, the set of polynucleotides is selected from the group consisting of Sets 12-27, Sets 39-54, and Sets 66-81, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, and nucleotides 7-34 of SEQ ID NO: 122. More particularly, the labeled polynucleotide can comprise a sequence selected from the group consisting of SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 106, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 120, SEQ ID NO: 121, and SEQ ID NO: 122. In certain implementations, the sequence of the labeled polynucleotide is selected from the group consisting of SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 106, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 120, SEQ ID NO: 121, and SEQ ID NO: 122.

In one implementation, the set of polynucleotides is selected from the group consisting of Set-12, Sets 14-18, Set-20, Set-24, Set-27, Set-39, Sets 41-45, Set-47, Set-51, Set-54, Set-66, Sets 68-72, Set 74, Set-78, and Set-81, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 6-28 of SEQ ID NO: 125 and nucleotides 7-28 of SEQ ID NO: 126. In certain implementations, the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 125 and SEQ ID NO: 126. In some embodiments, the sequence of the labeled polynucleotide is SEQ ID NO: 125 or SEQ ID NO: 126.

In another implementation, the set of polynucleotides is selected from the group consisting of Sets 14-27, Sets 41-54, and Sets 68-81, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 8-31 of SEQ ID NO: 113 and nucleotides 3-27 of SEQ ID NO: 127. In some embodiments, the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 113 and SEQ ID NO: 127. In other embodiments, the sequence of the labeled polynucleotide is SEQ ID NO: 113 or SEQ ID NO: 127.

In yet another embodiment, the set of polynucleotides is selected from the group consisting of Sets 12-20, Sets 22-27, Sets 39-47, Sets 49-54, Sets 66-74, and Sets 76-81, and the composition comprises a labeled polynucleotide comprising nucleotides 6-27 of SEQ ID NO: 130. In some implementations, the labeled polynucleotide comprises SEQ ID NO: 130. In other embodiments, the sequence of the labeled polynucleotide is SEQ ID NO: 130.

In one implementation, the set of polynucleotides is selected from the group consisting of Set-13, Set-40 and Set-67, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 6-30 of SEQ ID NO: 102 and nucleotides 8-29 of SEQ ID NO: 131. In such an embodiment, the labeled polynucleotide can comprise a sequence selected from the group consisting of SEQ ID NO: 102 and SEQ ID NO: 131. In another embodiment, the sequence of the labeled polynucleotide is SEQ ID NO: 102 or SEQ ID NO: 131.

Another aspect of the invention provides molecular beacons comprising a fluorophore, a quencher, and a polynucleotide, wherein the polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, and nucleotides 8-29 of SEQ ID NO: 120.

Yet another aspect of the invention provides methods of detecting Chlamydia trachomatis in a test sample, the method comprising (a) extracting nucleic acid from the test sample, (b) amplifying a target sequence by reacting the nucleic acid extracted in step (a) with a reaction mixture comprising a strand displacement DNA polymerase and a sequence-specific primer set, wherein said sequence-specific primer set is selected from the group consisting of Set-1 through Set-81, and (c) detecting the presence or absence of an amplified product of step (b); wherein the presence of said amplification product is indicative of the presence of Chlamydia trachomatis in the test sample. In one embodiment, the amplification in step (b) of the target sequence is performed at between about 60° C. and about 67° C. for less than 30 minutes. Preferably, the amplification step is performed for less than fifteen minutes, less than ten minutes or less than six minutes. In some implementations, the reaction mixture further comprises a reverse transcriptase. In some implementations, Chlamydia trachomatis is present in the test sample at a concentration of ≤100 IFU/mL, ≤50 IFU/mL, ≤5 IFU/mL, or even ≤2 IFU/mL. In one implementation, Chlamydia trachomatis is present in the test sample at a concentration of ≤5 IFU/ml and the amplification step is performed for less than 15 minutes. In another implementation, Chlamydia trachomatis is present in the test sample at a concentration of ≤10 IFU/ml and the amplification step is performed for less than six minutes.

In certain embodiments, detecting the presence or absence of the amplification product comprises hybridizing the amplified product with a probe comprising a polynucleotide attached to a label. In a preferred implementation, the label is a fluorophore, which preferably is covalently attached to a terminus of the polynucleotide. In a particularly preferred embodiment, the probe or polynucleotide is a molecular beacon comprising a fluorophore, a quencher, and a polynucleotide. In one embodiment, the fluorophore is FAM and the quencher is BHQ1. In an alternate implementation, the fluorophore is ATTO 565 or Alexa 594 and the quencher is BHQ1 or BHQ2. This method can be practiced using any combination of primer set and labeled polynucleotide, e.g. molecular beacon, described herein. FIG. 1 identifies labeled polynucleotide sequences, or molecular beacons, that are capable of binding to the amplicon resulting from each primer set, and therefore are useful in detecting the presence of Chlamydia trachomatis in a test sample.

Yet another aspect of the invention provides kits comprising the compositions comprising a set of polynucleotides selected from the group consisting of Set-1 through Set-81. In some embodiments, the kit further comprises a strand displacement polymerase and, optionally, a reverse transcriptase. In certain embodiments, the kit comprises a molecular beacon comprising a fluorophore, a quencher, and a polynucleotide, wherein the polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, nucleotides 6-27 of SEQ ID NO: 130, and nucleotides 8-29 of SEQ ID NO: 131. The polynucleotide sequence of the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 97 through SEQ ID NO: 131. In some embodiments, the polynucleotide sequence of the molecular beacon consists of a sequence selected from the group consisting of SEQ ID NO: 97 through SEQ ID NO: 131. In one embodiment, the polynucleotide sequence of the molecular beacon consists of SEQ ID NO: 115 and the set of polynucleotides is Set-20 or Set-24.

Yet another aspect of the invention provides methods of detecting Chlamydia trachomatis in a test sample, the method comprising (a) extracting nucleic acid from the test sample, (b) amplifying a target sequence by reacting the nucleic acid extracted in step (a) for less than ten minutes with a reaction mixture comprising a strand displacement DNA polymerase and a sequence-specific LAMP primer set, and (c) detecting the presence or absence of an amplified product of step (b); wherein the presence of said amplification product is indicative of the presence of Chlamydia trachomatis in the test sample. In some implementations, Chlamydia trachomatis is present in the test sample at a concentration of ≤100 IFU/mL, ≤50 IFU/mL, ≤5 IFU/mL, or even ≤2 IFU/mL. In certain implementations, the amplifying step comprises reacting the nucleic acid extracted in step (a) with a reaction mixture comprising a strand displacement DNA polymerase and a sequence-specific primer set, wherein said sequence-specific primer set is selected from the group consisting of Set-1 through Set-81. In such implementations, detecting the presence or absence of the amplification product can comprise hybridizing the amplified product with a molecular beacon comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 97 through SEQ ID NO: 131. In some implementations, detecting the presence or absence of the amplification product comprises hybridizing the amplified product with a molecular beacon comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 99 through SEQ ID NO: 120.

In some embodiments of the methods described herein, the test sample comprises one or more other microorganisms in addition to Chlamydia trachomatis, and wherein the target sequence from Chlamydia trachomatis is preferentially amplified over a polynucleotide sequence from the one or more other microorganisms.

In some embodiments, the invention provides a nucleic acid sequence at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% identical to any one of SEQ ID NOs 1-96 and methods of using those nucleic acid sequences to detect Chlamydia trachomatis in a test sample. In some embodiments, the invention provides a nucleic acid sequence at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% identical to any one of the group consisting of nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, and nucleotides 5-30 of SEQ ID NO: 117 and methods of using those nucleic acid sequences to detect Chlamydia trachomatis in a test sample.

DETAILED DESCRIPTION

Detecting low concentrations of species (down to a few molecules or microorganisms in a sample) is a challenge in medicine. The present invention relates to the selective detection of Chlamydia trachomatis. In particular, based on new detection strategies utilizing nucleic acid amplification, particularly RT-LAMP, and molecular beacon detection, Chlamydia infections can be diagnosed using the methods and reagents described herein. Using RNA (either ribosomal RNA (rRNA) or messenger RNA) as the target regions provides multiple copies of the target per C. trachomatis genome. Accordingly, this facilitates the detection of C. trachomatis in samples utilizing the approaches described herein relative to techniques that target genomic DNA, even when present in multiple copies per genome. In addition, the molecular beacon detection reagents described herein provide additional specificity, failing to bind, in most cases, to off target amplified DNA, thereby minimizing the occurrence of, e.g., false positives. This specificity is illustrated in, inter alia, Example 4 provided below. Many other features of the invention are also described herein.

As used herein, “nucleic acid” includes both DNA and RNA, including DNA and RNA containing non-standard nucleotides. A “nucleic acid” contains at least one polynucleotide (a “nucleic acid strand”). A “nucleic acid” may be single-stranded or double-stranded. The term “nucleic acid” refers to nucleotides and nucleosides which make up, for example, deoxyribonucleic acid (DNA) macromolecules and ribonucleic acid (RNA) macromolecules. The most common nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). It should be further understood that the present invention can be used for biological sequences containing artificial nucleotides such as peptide nucleic acid (PNA), morpholino, locked nucleic acid (LNA), glycol nucleic acid (GNA) and threose nucleic acid (TNA), among others. Preferably, the artificial nucleotides are locked nucleic acid molecules, including [alpha]-L-LNAs. LNAs comprise ribonucleic acid analogues wherein the ribose ring is “locked” by a methylene bridge between the 2′-oxygen and the 4′-carbon—i.e., oligonucleotides, containing at least one LNA monomer, that is, one 2′-O,4′-C-methylene-β3-D-ribofuranosyl nucleotide. LNA bases form standard Watson-Crick base pairs but the locked configuration increases the rate and stability of the basepairing reaction (Jepsen et al., Oligonucleotides, 14, 130-146 (2004)).

As used herein, a “polynucleotide” refers to a polymeric chain containing two or more nucleotides, which contain deoxyribonucleotides, ribonucleotides, and/or their analog, such as those containing modified backbones (e.g. peptide nucleic acids (PNAs) or phosphorothioates) or modified bases. “Polynucleotides” includes primers, oligonucleotides, nucleic acid strands, etc. A polynucleotide may contain standard or non-standard nucleotides. Thus, the term includes mRNA, tRNA, rRNA, ribozymes, DNA, cDNA, recombinant nucleic acids, branched nucleic acids, plasmids, vectors, probes, primers, etc. Typically, a polynucleotide contains a 5′ phosphate at one terminus (“5′ terminus”) and a 3′ hydroxyl group at the other terminus (“3′ terminus”) of the chain. The most 5′ nucleotide of a polynucleotide may be referred to herein as the “5′ terminal nucleotide” of the polynucleotide. The most 3′ nucleotide of a polynucleotide may be referred to herein as the “3′ terminal nucleotide” of the polynucleotide. Where nucleic acid of the invention takes the form of RNA, it may or may not have a 5′ cap.

LAMP is a nucleic acid amplification method that relies on auto-cycle strand-displacement DNA synthesis performed by a Bst DNA polymerase, or other strand displacement polymerases. The amplified products are stem-loop structures with several repeated sequences of the target, and have multiple loops. The principal merit of this method is that denaturation of the DNA template is not required, and thus the LAMP reaction can be conducted under isothermal conditions (ranging from 60 to 67° C.). LAMP requires only one enzyme and four types of primers that recognize six distinct hybridization sites in the target sequence. The reaction can be accelerated by the addition of two additional primers. The method produces a large amount of amplified product, resulting in easier detection, such as detection by visual judgment of the turbidity or fluorescence of the reaction mixture.

In brief, the reaction is initiated by annealing and extension of a pair of ‘loop-forming’ primers (forward and backward inner primers, FIP and BIP, respectively), followed by annealing and extension of a pair of flanking primers (F3 and B3). Extension of these primers results in strand-displacement of the loop-forming elements, which fold up to form terminal hairpin-loop structures. Once these key structures have appeared, the amplification process becomes self-sustaining, and proceeds at constant temperature in a continuous and exponential manner (rather than a cyclic manner, like PCR) until all of the nucleotides (dATP, dTTP, dCTP & dGTP) in the reaction mixture have been incorporated into the amplified DNA. Optionally, an additional pair of primers can be included to accelerate the reaction. These primers, termed Loop primers, hybridize to non-inner primer bound terminal loops of the inner primer dumbbell shaped products.

The term “primer” as used herein refers to an oligonucleotide, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of primer extension product which is complementary to a nucleic acid strand (template) is induced, i.e., in the presence of nucleotides and an agent for polymerization, such as DNA polymerase, and at a suitable temperature and pH.

LAMP allows amplification of target DNA sequences with higher sensitivity and specificity than PCR, often with reaction times of below 30 minutes, which is equivalent to the fastest real-time PCR tests. The target sequence which is amplified is typically 200-300 base-pairs (bp) in length, and the reaction relies upon recognition of between 120 bp and 160 bp of this sequence by several primers simultaneously during the amplification process. This high level of stringency makes the amplification highly specific, such that the appearance of amplified DNA in a reaction occurs only if the entire target sequence was initially present.

Applications for LAMP have been further extended to include detection of RNA molecules by addition of Reverse Transcriptase enzyme (RT). By including RNA detection, the types of targets for which LAMP can be applied are also expanded and add the ability to additionally target RNA based viruses, important regulatory non-coding RNA (sRNA, miRNA), and RNA molecules that have been associated with particular disease or physiological states. The ability to detect RNA also has the potential to increase assay sensitivity, for instance in choosing highly expressed, stable, and/or abundant messenger RNA (mRNA) or ribosomal RNA (rRNA) targets. This preliminary phase of amplification involves the reverse transcription of RNA molecules to complementary DNA (cDNA). The cDNA then serves as template for the strand displacing DNA polymerase. Use of a thermostable RT enzyme (i.e., NEB RTx) enables the reaction to be completed at a single temperature and in a one step, single mix reaction.

A “target sequence,” as used herein, means a nucleic acid sequence of Chlamydia trachomatis, or complement thereof, that is amplified, detected, or both amplified and detected using one or more of the polynucleotides herein provided. Additionally, while the term target sequence sometimes refers to a double stranded nucleic acid sequence, those skilled in the art will recognize that the target sequence can also be single stranded, e.g., RNA. A target sequence may be selected that is more or less specific for a particular organism. For example, the target sequence may be specific to an entire genus, to more than one genus, to a species or subspecies, serogroup, auxotype, serotype, strain, isolate or other subset of organisms.

The speed, specificity and sensitivity of the primers/probe compositions and method described herein result from several aspects. Exemplary primers for use in the compositions and methods according to the present invention include:

TABLE 1
Primer Sequences
Sequence ID Sequence (5′ to 3′)
SEQ ID NO: 1 CGAAGGAATGACGGAGTA
SEQ ID NO: 2 CGCCTTAGAATATTCATCTCG
SEQ ID NO: 3 GCGACCTGATCTTATGTTAGCGCGATTGGAAGAGTCCGTA
SEQ ID NO: 4 GAACCGATGGTGTGGAGCCCACCTGTGTCGGTT
SEQ ID NO: 5 CTACTAACCGTTCTCATCGC
SEQ ID NO: 6 CTGTTGATGGTGACCGTAC
SEQ ID NO: 7 AAAACTATAGCGAAGGAATGACGGA
SEQ ID NO: 8 TAATTTGCCGAGTTCCTTAACGAAAG
SEQ ID NO: 9 CCCCGAAGATTCCCCTTGATCGCCGTAGAGCGATGAGAACGGTT
SEQ ID NO: 10 GGTGTGGAGCGAGGCTTTCAAGAAATAATATTCATCTCGCCCACCTGTG
SEQ ID NO: 11 TGATCTTATGTTAGCGGATTTGCCTACT
SEQ ID NO: 12 TTTCTAGCTGTTGATGGTGACCGT
SEQ ID NO: 13 AACTATAGCGAAGGAATGACGGAG
SEQ ID NO: 14 TAATTTGCCGAGTTCCTTAACGAAAG
SEQ ID NO: 15 CCCCGAAGATTCCCCTTGATCGCCGTAGAGCGATGAGAACGGTT
SEQ ID NO: 16 GGTGTGGAGCGAGGCTTTCAAGAAATAATATTCATCTCGCCCACCTGTG
SEQ ID NO: 17 TGATCTTATGTTAGCGGATTTGCCTACT
SEQ ID NO: 18 GTTGATGGTGACCGTACCAAAACC
SEQ ID NO: 19 ATAGCGAAGGAATGACGGAGTAAG
SEQ ID NO: 20 TAATTTGCCGAGTTCCTTAACGAAAG
SEQ ID NO: 21 CCCCGAAGATTCCCCTTGATCGCCGTAGAGCGATGAGAACGGTT
SEQ ID NO: 22 GGTGTGGAGCGAGGCTTTCAAGAAATAATATTCATCTCGCCCACCTGTG
SEQ ID NO: 23 GACCTGATCTTATGTTAGCGGATTTGC
SEQ ID NO: 24 TTTCTAGCTGTTGATGGTGACCGT
SEQ ID NO: 25 AGAAGCGAGTCCGGGAGAT
SEQ ID NO: 26 CTGCTGAATACTACGCTCTCCTAC
SEQ ID NO: 27 CCAACATTCCAACTGTCTTCGAATCATCACTCAGCCCAGACCGCCG
SEQ ID NO: 28 GCGTAACAGCTCACCAATCGAGAATCATTGTCTTATCGACACACCCGC
SEQ ID NO: 29 TTACCCACTTAGCATAAAATTAGGGACCTTAA
SEQ ID NO: 30 ACGGGACTAAGCATAAAACCGACA
SEQ ID NO: 31 AGAAGCGAGTCCGGGAGAT
SEQ ID NO: 32 CCGGTACACCTTCTCTGCTG
SEQ ID NO: 33 AAGCCAACATTCCAACTGTCTTCGAATCATCAGCCCAGACCGCCG
SEQ ID NO: 34 GCGTAACAGCTCACCAATCGAGAATCATTGTCTTATCGACACACCCGC
SEQ ID NO: 35 TTACCCACTTAGCATAAAATTAGGGACCTTAA
SEQ ID NO: 36 ACGGGACTAAGCATAAAACCGACA
SEQ ID NO: 37 CACAGGTGGGCGAGATGAATAT
SEQ ID NO: 38 CTGACATATCCCTTTAACCTTTTGGC
SEQ ID NO: 39 ATAGTCACCCTAAAAGGCTCCCCTTATTCCAGGCGCGCGAGATAACTTT
SEQ ID NO: 40 AGAAATGGCCCAGGCGACTGTTTAGGCAGGCGTCACACCATATACT
SEQ ID NO: 41 GGGATAATTTGCCGAGTTCCTTAACG
SEQ ID NO: 42 AAAACACAGCACTATGCAAACCTCTAAG
SEQ ID NO: 43 CACAGGTGGGCGAGATGAAT
SEQ ID NO: 44 CTGACATATCCCTTTAACCTTTTGGC
SEQ ID NO: 45 ATAGTCACCCTAAAAGGCTCCCCTTATTCCAGGCGCGCGAGATAACTTT
SEQ ID NO: 46 AGAAATGGCCCAGGCGACTGTTTAGGCAGGCGTCACACCATATACT
SEQ ID NO: 47 GGGATAATTTGCCGAGTTCCTTAACG
SEQ ID NO: 48 AAAACACAGCACTATGCAAACCTCTAAG
SEQ ID NO: 49 ATTCGAAGACAGTTGGAATGT
SEQ ID NO: 50 TATTATCGGCGCAATGATTCTCGAGGCTTAGAGGCAGCAATC
SEQ ID NO: 51 GTGAGCTGTTACGCACTCT
SEQ ID NO: 52 TCGTTACTTATGCCATGGATC
SEQ ID NO: 53 TAAACGGGACTAAGCATAAAACCGACCTTCTCTGCTGAATACTACG
SEQ ID NO: 54 GATAAGACACGCGGTAGGAG
SEQ ID NO: 55 CTTACCAACGGAAATCAAACTC
SEQ ID NO: 56 CACTTAGCATAAAATTAGGGACCTTAATCGGGGGGCTAAGCTTCGT
SEQ ID NO: 57 GCGGTCTGGGCTGTTC
SEQ ID NO: 58 TATCGGCGCAATGATTCTC
SEQ ID NO: 59 TGGGTAAGGAAGTGATGATTCGAAGGGTGAGCTGTTACGCAC
SEQ ID NO: 60 TGGCTTAGAGGCAGCAATC
SEQ ID NO: 61 ATCGGCGCAATGATTCTCGATGGCTTAGAGGCAGCAATC
SEQ ID NO: 62 CGTTACTTATGCCATGGATCT
SEQ ID NO: 63 TAAGACACGCGGTAGGAGA
SEQ ID NO: 64 GAAATCGAAGAGATTCCCTGTG
SEQ ID NO: 65 GGTGTTGAGGTCGGTCTT
SEQ ID NO: 66 TTATCCTCAATCCTACAACCCCGAGTAGCGGCGAGCGAAAG
SEQ ID NO: 67 GGATCAGGACTCCTAGTTGAACACACTCCTTTCGTCTACGGGAC
SEQ ID NO: 68 CCTTATCAGCTCGGTTTAGGC
SEQ ID NO: 69 GGAAAGATGGATGATACAGGGTG
SEQ ID NO: 70 GTTGTAGGATTGAGGATAAAGGATC
SEQ ID NO: 71 TACTGGTTCACTATCGGTCATT
SEQ ID NO: 72 TCGGTCTTTCTCTCCTTTCGTCTACTCCTAGTTGAACACATCTGGAA
SEQ ID NO: 73 CCTCAACACCTGAGTAGGACTAGACGCCTTGGAGAGTGGTCTC
SEQ ID NO: 74 GGACTATCACCCTGTATCATCCA
SEQ ID NO: 75 CGTGAAACCTAGTCTGAATCTGG
SEQ ID NO: 76 TATTCCCCTTTCGCTCGC
SEQ ID NO: 77 GGCTATTCCCCTTTCGCTC
SEQ ID NO: 78 TTAGGCTATTCCCCTTTCGC
SEQ ID NO: 79 GCTATTCCCCTTTCGCTCGC
SEQ ID NO: 80 GTTTAGGCTATTCCCCTTTC
SEQ ID NO: 81 CTGAAACATCTTAGTAAGCAGAGG
SEQ ID NO: 82 GTGTCTAGTCCTACTCAGGTG
SEQ ID NO: 83 CCTACAACCCCGAGCCTTATCAAGAGATTCCCTGTGTAGCG
SEQ ID NO: 84 GGACTCCTAGTTGAACACATCTGGATTCTCTCCTTTCGTCTACGG
SEQ ID NO: 85 GCTCGGTTTAGGCTATTCCC
SEQ ID NO: 86 AAGATGGATGATACAGGGTGATAGT
SEQ ID NO: 87 CGAACTGAAACATCTTAGTAAGCAG
SEQ ID NO: 88 CTCCTTTCGTCTACGGGACTA
SEQ ID NO: 89 ATCAGCTCGGTTTAGGCTATTCCCGAAAAGAAATCGAAGAGATTCCCTG
SEQ ID NO: 90 GCTCGGGGTTGTAGGATTGAGGATACCTGTATCATCCATCTTTCCAGAT
SEQ ID NO: 91 CTTTCGCTCGCCGCTAC
SEQ ID NO: 92 GGATCAGGACTCCTAGTTGAACAC
SEQ ID NO: 93 CCTACAACCCCGAGCCTTATCAGAAAAGAAATCGAAGAGATTCCCTG
SEQ ID NO: 94 ATCAGCTCGGTTTAGGCTATTCCCAGAGATTCCCTGTGTAGCG
SEQ ID NO: 95 GCTCGGGGTTGTAGGATTGAGGATATTCTCTCCTTTCGTCTACGG
SEQ ID NO: 96 GCTCGGGGTTGTAGGATTGAGGATACTGTATCATCCATCTTTCCAGATGT

Detection of the LAMP amplified products can be achieved via a variety of methods. In a preferred embodiment, detection of product is conducted by adding a fluorescently-labeled probe to the primer mix. The term used herein “probe” refers to a single-stranded nucleic acid molecule comprising a portion or portions that are complementary, or substantially complementary, to a target sequence. In certain implementations, the fluorescently-labeled probe is a molecular beacon.

As used herein, “molecular beacon” refers to a single stranded hairpin-shaped oligonucleotide probe designed to report the presence of specific nucleic acids in a solution. A molecular beacon consists of four components; a stem, hairpin loop, end labelled fluorophore and opposite end-labelled quencher (Tyagi et al., (1998) Nature Biotechnology 16:49-53). When the hairpin-like beacon is not bound to a target, the fluorophore and quencher lie close together and fluorescence is suppressed. In the presence of a complementary target nucleotide sequence, the stem of the beacon opens to hybridize to the target. This separates the fluorophore and quencher, allowing the fluorophore to fluoresce. Alternatively, molecular beacons also include fluorophores that emit in the proximity of an end-labelled donor. “Wavelength-shifting Molecular Beacons” incorporate an additional harvester fluorophore enabling the fluorophore to emit more strongly. Current reviews of molecular beacons include Wang et al., 2009, Angew Chem Int Ed Engl, 48(5):856-870; Cissell et al., 2009, Anal Bioanal Chem 393(1):125-35; Li et al., 2008, Biochem Biophys Res Comm 373(4):457-61; and Cady, 2009, Methods Mol Biol 554:367-79.

In one implementation, the molecular beacon comprises a fluorophore, a quencher, and a polynucleotide, wherein the polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, and nucleotides 8-29 of SEQ ID NO: 120. In one embodiment, the polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 99 through SEQ ID NO: 120. In another embodiment, the polynucleotide consists of a sequence selected from the group consisting of SEQ ID NO: 99 through SEQ ID NO: 120. The polynucleotides having the sequences described above can include one or more non-natural nucleosides or linkages, such as peptide nucleic acid (PNA), morpholino, locked nucleic acid (LNA), glycol nucleic acid (GNA) and threose nucleic acid (TNA), among others. In some embodiments, the polynucleotide of the molecular beacon comprises one to six locked nucleic acids. In a preferred embodiment, the polynucleotide of the molecular beacon comprises three locked nucleic acids. In another preferred embodiment, the polynucleotide of the molecular beacon comprises four locked nucleic acids.

The molecular beacon is preferably used in a composition also comprising a set of sequence-specific LAMP primers. In one implementation, the molecular beacon comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, and nucleotides 6-27 of SEQ ID NO: 130. In such an implementation, the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 97 through SEQ ID NO: 130. More preferably, polynucleotide sequence of the molecular beacon consists of a sequence selected from the group consisting of SEQ ID NO: 97 through SEQ ID NO: 130. In a particularly preferred implementation, the polynucleotide sequence of the molecular beacon is SEQ ID NO: 115.

When included in a composition comprising a set of polynucleotides selected from the group consisting of Sets 12-27, Sets 39-54, and Sets 66-81, the molecular beacon preferably comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, and nucleotides 7-34 of SEQ ID NO: 122. More particularly, the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 106, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 120, SEQ ID NO: 121, and SEQ ID NO: 122. In certain implementations, the polynucleotide sequence of the molecular beacon is selected from the group consisting of SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 106, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 120, SEQ ID NO: 121, and SEQ ID NO: 122.

When included in a composition comprising a set of polynucleotides selected from the group consisting of Set-12, Sets 14-18, Set-20, Set-24, Set-27, Set-39, Sets 41-45, Set-47, Set-51, Set-54, Set-66, Sets 68-72, Set 74, Set-78, and Set-81, the molecular beacon preferably comprises a sequence selected from the group consisting of nucleotides 6-28 of SEQ ID NO: 125 and nucleotides 7-28 of SEQ ID NO: 126. In certain implementations, the molecular beacon can comprise a polynucleotide sequence selected from the group consisting of SEQ ID NO: 125 and SEQ ID NO: 126. In some embodiments, the polynucleotide sequence of the molecular beacon is SEQ ID NO: 125 or SEQ ID NO: 126.

When used in combination with a set of polynucleotides selected from the group consisting of Sets 14-27, Sets 41-54, and Sets 68-81, the molecular beacon preferably comprises a polynucleotide sequence selected from the group consisting of nucleotides 8-31 of SEQ ID NO: 113 and nucleotides 3-27 of SEQ ID NO: 127. In some embodiments, the labeled polynucleotide of the molecular beacon comprises a sequence selected from the group consisting of SEQ ID NO: 113 and SEQ ID NO: 127. In other embodiments, the polynucleotide sequence of the molecular beacon is SEQ ID NO: 113 or SEQ ID NO: 127.

When included in a composition comprising a set of polynucleotides selected from the group consisting of Sets 12-20, Sets 22-27, Sets 39-47, Sets 49-54, Sets 66-74, and Sets 76-81, the molecular beacon preferably comprises nucleotides 6-27 of SEQ ID NO: 130. In some implementations, the molecular beacon comprises SEQ ID NO: 130. In other embodiments, the polynucleotide sequence of the molecular beacon is SEQ ID NO: 130.

When used in combination with a set of polynucleotides selected from the group consisting of Set-13, Set-40 and Set-67, the molecular beacon preferably comprises a sequence selected from the group consisting of nucleotides 6-30 of SEQ ID NO: 102 and nucleotides 8-29 of SEQ ID NO: 131. In such an embodiment, the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 102 and SEQ ID NO: 131. In another embodiment, the polynucleotide sequence of the molecular beacon is SEQ ID NO: 102 or SEQ ID NO: 131.

The term “label” as used herein means a molecule or moiety having a property or characteristic which is capable of detection and, optionally, of quantitation. A label can be directly detectable, as with, for example (and without limitation), radioisotopes, fluorophores, chemiluminophores, enzymes, colloidal particles, fluorescent microparticles and the like; or a label may be indirectly detectable, as with, for example, specific binding members. It will be understood that directly detectable labels may require additional components such as, for example, substrates, triggering reagents, quenching moieties, light, and the like to enable detection and/or quantitation of the label. When indirectly detectable labels are used, they are typically used in combination with a “conjugate”. A conjugate is typically a specific binding member that has been attached or coupled to a directly detectable label. Coupling chemistries for synthesizing a conjugate are well known in the art and can include, for example, any chemical means and/or physical means that does not destroy the specific binding property of the specific binding member or the detectable property of the label. As used herein, “specific binding member” means a member of a binding pair, i.e., two different molecules where one of the molecules through, for example, chemical or physical means specifically binds to the other molecule. In addition to antigen and antibody specific binding pairs, other specific binding pairs include, but are not intended to be limited to, avidin and biotin; haptens and antibodies specific for haptens; complementary nucleotide sequences; enzyme cofactors or substrates and enzymes; and the like.

The molecular beacon can be composed of nucleic acid only such as DNA or RNA, or it can be composed of a peptide nucleic acid (PNA) conjugate. The fluorophore can be any fluorescent organic dye or a single quantum dot. The quenching moiety desirably quenches the luminescence of the fluorophore. Any suitable quenching moiety that quenches the luminescence of the fluorophore can be used. A fluorophore can be any fluorescent marker/dye known in the art. Examples of suitable fluorescent markers include, but are not limited to, Fam, Hex, Tet, Joe, Rox, Tamra, Max, Edans, Cy dyes such as Cy5, Fluorescein, Coumarin, Eosine, Rhodamine, Bodipy, Alexa, Cascade Blue, Yakima Yellow, Lucifer Yellow, Texas Red, and the family of ATTO dyes. A quencher can be any quencher known in the art. Examples of quenchers include, but are not limited to, Dabcyl, Dark Quencher, Eclipse Dark Quencher, ElleQuencher, Tamra, BHQ and QSY (all of them are Trade-Marks). The skilled person would know which combinations of dye/quencher are suitable when designing a probe. In an exemplary embodiment, fluorescein (FAM) is used in conjunction with Blackhole Quencher™ (BHQ™) (Novato, Calif.). Binding of the molecular beacon to amplified product can then be directly, visually assessed. Alternatively, the fluorescence level can be measured by spectroscopy in order to improve sensitivity.

A variety of commercial suppliers produce standard and custom molecular beacons, including Abingdon Health (UK; www.abingdonhealth.com), Attostar (US, MN; www.attostar.com), Biolegio (NLD; www.biolegio.com), Biomers.net (DEU; www.biomers.net), Biosearch Technologies (US, CA; www.biosearchtech.com), Eurogentec (BEL; www.eurogentec.com), Gene Link (US, NY; www.genelink.com) Integrated DNA Technologies (US, IA; www.idtdna.com), Isogen Life Science (NLD; www.isogen-lifescience.com), Midland Certified Reagent (US, TX; www.oligos.com), Eurofins (DEU; www.eurofinsgenomics.eu), Sigma-Aldrich (US, TX; www.sigmaaldrich.com), Thermo Scientific (US, MA; www.thermoscientific.com), TIB MOLBIOL (DEU; www.tib-molbiol.de), TriLink Bio Technologies (US, CA; www.trilinkbiotech.com). A variety of kits, which utilize molecular beacons are also commercially available, such as the Sentineli'm Molecular Beacon Allelic Discrimination Kits from Stratagene (La Jolla, Calif.) and various kits from Eurogentec SA (Belgium, eurogentec.com) and Isogen Bioscience BV (The Netherlands, isogen.com).

The oligonucleotide probes and primers of the invention are optionally prepared using essentially any technique known in the art. In certain embodiments, for example, the oligonucleotide probes and primers described herein are synthesized chemically using essentially any nucleic acid synthesis method, including, e.g., according to the solid phase phosphoramidite triester method described by Beaucage and Caruthers (1981), Tetrahedron Letts. 22(20):1859-1862, which is incorporated by reference, or another synthesis technique known in the art, e.g., using an automated synthesizer, as described in Needham-VanDevanter et al. (1984) Nucleic Acids Res. 12:6159-6168, which is incorporated by reference. A wide variety of equipment is commercially available for automated oligonucleotide synthesis. Multi-nucleotide synthesis approaches (e.g., tri-nucleotide synthesis, etc.) are also optionally utilized. Moreover, the primer nucleic acids described herein optionally include various modifications. To further illustrate, primers are also optionally modified to improve the specificity of amplification reactions as described in, e.g., U.S. Pat. No. 6,001,611, issued Dec. 14, 1999, which is incorporated by reference. Primers and probes can also be synthesized with various other modifications as described herein or as otherwise known in the art.

In addition, essentially any nucleic acid (and virtually any labeled nucleic acid, whether standard or non-standard) can be custom or standard ordered from any of a variety of commercial sources, such as Integrated DNA Technologies, the Midland Certified Reagent Company, Eurofins, Biosearch Technologies, Sigma Aldrich and many others.

Test samples are generally derived or isolated from subjects, typically mammalian subjects, more typically human subjects, suspected of having a Chlamydia infection. Exemplary samples or specimens include blood, plasma, serum, urine, synovial fluid, seminal fluid, seminal plasma, prostatic fluid, vaginal fluid, cervical fluid, uterine fluid, cervical scrapings, amniotic fluid, anal scrapings, mucus, sputum, tissue, and the like. Essentially any technique for acquiring these samples is optionally utilized including, e.g., scraping, venipuncture, swabbing, biopsy, or other techniques known in the art.

The term “test sample” as used herein, means a sample taken from an organism or biological fluid that is suspected of containing or potentially contains a target sequence. The test sample can be taken from any biological source, such as for example, tissue, blood, saliva, sputa, mucus, sweat, urine, urethral swabs, cervical swabs, vaginal swabs, urogenital or anal swabs, conjunctival swabs, ocular lens fluid, cerebral spinal fluid, milk, ascites fluid, synovial fluid, peritoneal fluid, amniotic fluid, fermentation broths, cell cultures, chemical reaction mixtures and the like. The test sample can be used (i) directly as obtained from the source or (ii) following a pre-treatment to modify the character of the sample. Thus, the test sample can be pre-treated prior to use by, for example, preparing plasma or serum from blood, disrupting cells or viral particles, preparing liquids from solid materials, diluting viscous fluids, filtering liquids, distilling liquids, concentrating liquids, inactivating interfering components, adding reagents, purifying nucleic acids, and the like.

Advantageously, the invention enables reliable rapid detection of Chlamydia trachomatis in a clinical sample, such as a urine sample.

To further illustrate, prior to analyzing the target nucleic acids described herein, those nucleic acids may be purified or isolated from samples that typically include complex mixtures of different components. Cells in collected samples are typically lysed to release the cell contents. For example, C. trachomatis and other cells in the particular sample can be lysed by contacting them with various enzymes, chemicals, and/or lysed by other approaches known in the art, which degrade, e.g., bacterial cell walls. In some embodiments, nucleic acids are analyzed directly in the cell lysate. In other embodiments, nucleic acids are further purified or extracted from cell lysates prior to detection. Essentially any nucleic acid extraction methods can be used to purify nucleic acids in the samples utilized in the methods of the present invention. Exemplary techniques that can be used to purifying nucleic acids include, e.g., affinity chromatography, hybridization to probes immobilized on solid supports, liquid-liquid extraction (e.g., phenol-chloroform extraction, etc.), precipitation (e.g., using ethanol, etc.), extraction with filter paper, extraction with micelle-forming reagents (e.g., cetyl-trimethyl-ammonium-bromide, etc.), binding to immobilized intercalating dyes (e.g., ethidium bromide, acridine, etc.), adsorption to silica gel or diatomic earths, adsorption to magnetic glass particles or organo silane particles under chaotropic conditions, and/or the like. Sample processing is also described in, e.g., U.S. Pat. Nos. 5,155,018, 6,383,393, and 5,234,809, which are each incorporated by reference.

A test sample may optionally have been treated and/or purified according to any technique known by the skilled person, to improve the amplification efficiency and/or qualitative accuracy and/or quantitative accuracy. The sample may thus exclusively, or essentially, consist of nucleic acid(s), whether obtained by purification, isolation, or by chemical synthesis. Means are available to the skilled person, who would like to isolate or purify nucleic acids, such as DNA, from a test sample, for example to isolate or purify DNA from cervical scrapes (e.g., QIAamp-DNA Mini-Kit; Qiagen, Hilden, Germany).

EXAMPLES

Example 1: Target Selection and Primer Probe Design

Considering the constitutive and high level of expression of the ribosomal genes in bacterial cells, these genes were chosen as targets for the amplification assay, specifically the 16S and 23S genes.

16S and 23S gene sequences for multiple serovars of C. trachomatis, closely related species such as Chlamydophila pneumoniae and Chlamydia psittaci, and for other species commonly found in the urine or vaginal fluid were retrieved from the NCBI database. Sequences were aligned using Clustal omega (Sievers, et al. 2011. Molecular Systems Biology 7:539) and regions with unique specific bases to C. trachomatis species were identified. Loop mediated amplification primers were designed using LAMP designer (Premier Biosoft). For added specificity, molecular beacons or probes targeting the amplified products were designed manually or using Beacon designer (Premier Biosoft). Designed primer sets and beacons were further analyzed for specificity using BLAST against the human genome and the NCBI nucleotide database. Various primer sets and probes were designed and screened for reaction speed.

The inventive primer sets are summarized in Table 2, which include, at a minimum, a forward inner primer (FIP) and backward inner primer (BIP). Additionally, the primer sets typically also include at least two additional primers selected from the forward outer primer (F3), backward outer primer (B3), forward loop primer (LF) and backward loop primer (LB).

TABLE 2
LAMP Primer Sets
Set F3 B3 FIP BIP LF LB
Set-1 SEQ ID NO: 1 SEQ ID NO: 2 SEQ ID NO: 3 SEQ ID NO: 4 SEQ ID NO: 5 SEQ ID NO: 6
Set-2 SEQ ID NO: 7 SEQ ID NO: 8 SEQ ID NO: 9 SEQ ID NO: 10 SEQ ID NO: 11 SEQ ID NO: 12
Set-3 SEQ ID NO: 13 SEQ ID NO: 14 SEQ ID NO: 15 SEQ ID NO: 16 SEQ ID NO: 17 SEQ ID NO: 18
Set-4 SEQ ID NO: 19 SEQ ID NO: 20 SEQ ID NO: 21 SEQ ID NO: 22 SEQ ID NO: 23 SEQ ID NO: 24
Set-5 SEQ ID NO: 25 SEQ ID NO: 26 SEQ ID NO: 27 SEQ ID NO: 28 SEQ ID NO: 29 SEQ ID NO: 30
Set-6 SEQ ID NO: 31 SEQ ID NO: 32 SEQ ID NO: 33 SEQ ID NO: 34 SEQ ID NO: 35 SEQ ID NO: 36
Set-7 SEQ ID NO: 37 SEQ ID NO: 38 SEQ ID NO: 39 SEQ ID NO: 40 SEQ ID NO: 41 SEQ ID NO: 42
Set-8 SEQ ID NO: 43 SEQ ID NO: 44 SEQ ID NO: 45 SEQ ID NO: 46 SEQ ID NO: 47 SEQ ID NO: 48
Set-9 SEQ ID NO: 49 SEQ ID NO: 52 SEQ ID NO: 50 SEQ ID NO: 53 SEQ ID NO: 51 SEQ ID NO: 54
Set-10 SEQ ID NO: 55 SEQ ID NO: 58 SEQ ID NO: 56 SEQ ID NO: 59 SEQ ID NO: 57 SEQ ID NO: 60
Set-11 SEQ ID NO: 49 SEQ ID NO: 62 SEQ ID NO: 61 SEQ ID NO: 53 SEQ ID NO: 51 SEQ ID NO: 63
Set-12 SEQ ID NO: 64 SEQ ID NO: 65 SEQ ID NO: 66 SEQ ID NO: 67 SEQ ID NO: 68 SEQ ID NO: 69
Set-13 SEQ ID NO: 70 SEQ ID NO: 71 SEQ ID NO: 72 SEQ ID NO: 73 SEQ ID NO: 74 SEQ ID NO: 75
Set-14 SEQ ID NO: 81 SEQ ID NO: 82 SEQ ID NO: 83 SEQ ID NO: 84 SEQ ID NO: 76 SEQ ID NO: 86
Set-15 SEQ ID NO: 81 SEQ ID NO: 82 SEQ ID NO: 83 SEQ ID NO: 84 SEQ ID NO: 77 SEQ ID NO: 86
Set-16 SEQ ID NO: 81 SEQ ID NO: 82 SEQ ID NO: 83 SEQ ID NO: 84 SEQ ID NO: 78 SEQ ID NO: 86
Set-17 SEQ ID NO: 81 SEQ ID NO: 82 SEQ ID NO: 83 SEQ ID NO: 84 SEQ ID NO: 79 SEQ ID NO: 86
Set-18 SEQ ID NO: 81 SEQ ID NO: 82 SEQ ID NO: 83 SEQ ID NO: 84 SEQ ID NO: 80 SEQ ID NO: 86
Set-19 SEQ ID NO: 87 SEQ ID NO: 82 SEQ ID NO: 89 SEQ ID NO: 84 SEQ ID NO: 91 SEQ ID NO: 86
Set-20 SEQ ID NO: 81 SEQ ID NO: 82 SEQ ID NO: 83 SEQ ID NO: 84 SEQ ID NO: 85 SEQ ID NO: 86
Set-21 SEQ ID NO: 87 SEQ ID NO: 88 SEQ ID NO: 89 SEQ ID NO: 90 SEQ ID NO: 91 SEQ ID NO: 92
Set-22 SEQ ID NO: 87 SEQ ID NO: 82 SEQ ID NO: 89 SEQ ID NO: 84 SEQ ID NO: 76 SEQ ID NO: 86
Set-23 SEQ ID NO: 87 SEQ ID NO: 82 SEQ ID NO: 93 SEQ ID NO: 84 SEQ ID NO: 76 SEQ ID NO: 86
Set-24 SEQ ID NO: 87 SEQ ID NO: 82 SEQ ID NO: 94 SEQ ID NO: 84 SEQ ID NO: 76 SEQ ID NO: 86
Set-25 SEQ ID NO: 87 SEQ ID NO: 82 SEQ ID NO: 89 SEQ ID NO: 95 SEQ ID NO: 91 SEQ ID NO: 92
Set-26 SEQ ID NO: 87 SEQ ID NO: 82 SEQ ID NO: 93 SEQ ID NO: 95 SEQ ID NO: 76 SEQ ID NO: 92
Set-27 SEQ ID NO: 87 SEQ ID NO: 82 SEQ ID NO: 94 SEQ ID NO: 95 SEQ ID NO: 76 SEQ ID NO: 92
Set- 28 SEQ ID NO: 1 SEQ ID NO: 2 SEQ ID NO: 3 SEQ ID NO: 4
Set-29 SEQ ID NO: 7 SEQ ID NO: 8 SEQ ID NO: 9 SEQ ID NO: 10
Set-30 SEQ ID NO: 13 SEQ ID NO: 14 SEQ ID NO: 15 SEQ ID NO: 16
Set-31 SEQ ID NO: 19 SEQ ID NO: 20 SEQ ID NO: 21 SEQ ID NO: 22
Set-32 SEQ ID NO: 25 SEQ ID NO: 26 SEQ ID NO: 27 SEQ ID NO: 28
Set-33 SEQ ID NO: 31 SEQ ID NO: 32 SEQ ID NO: 33 SEQ ID NO: 34
Set-34 SEQ ID NO: 37 SEQ ID NO: 38 SEQ ID NO: 39 SEQ ID NO: 40
Set-35 SEQ ID NO: 43 SEQ ID NO: 44 SEQ ID NO: 45 SEQ ID NO: 46
Set-36 SEQ ID NO: 49 SEQ ID NO: 52 SEQ ID NO: 50 SEQ ID NO: 53
Set-37 SEQ ID NO: 55 SEQ ID NO: 58 SEQ ID NO: 56 SEQ ID NO: 59
Set-38 SEQ ID NO: 49 SEQ ID NO: 62 SEQ ID NO: 61 SEQ ID NO: 53
Set-39 SEQ ID NO: 64 SEQ ID NO: 65 SEQ ID NO: 66 SEQ ID NO: 67
Set-40 SEQ ID NO: 70 SEQ ID NO: 71 SEQ ID NO: 72 SEQ ID NO: 73
Set-41 SEQ ID NO: 81 SEQ ID NO: 82 SEQ ID NO: 83 SEQ ID NO: 84
Set-42 SEQ ID NO: 81 SEQ ID NO: 82 SEQ ID NO: 83 SEQ ID NO: 84
Set-43 SEQ ID NO: 81 SEQ ID NO: 82 SEQ ID NO: 83 SEQ ID NO: 84
Set-44 SEQ ID NO: 81 SEQ ID NO: 82 SEQ ID NO: 83 SEQ ID NO: 84
Set-45 SEQ ID NO: 81 SEQ ID NO: 82 SEQ ID NO: 83 SEQ ID NO: 84
Set-46 SEQ ID NO: 87 SEQ ID NO: 82 SEQ ID NO: 89 SEQ ID NO: 84
Set-47 SEQ ID NO: 81 SEQ ID NO: 82 SEQ ID NO: 83 SEQ ID NO: 84
Set-48 SEQ ID NO: 87 SEQ ID NO: 88 SEQ ID NO: 89 SEQ ID NO: 90
Set-49 SEQ ID NO: 87 SEQ ID NO: 82 SEQ ID NO: 89 SEQ ID NO: 84
Set-50 SEQ ID NO: 87 SEQ ID NO: 82 SEQ ID NO: 93 SEQ ID NO: 84
Set-51 SEQ ID NO: 87 SEQ ID NO: 82 SEQ ID NO: 94 SEQ ID NO: 84
Set-52 SEQ ID NO: 87 SEQ ID NO: 82 SEQ ID NO: 89 SEQ ID NO: 95
Set-53 SEQ ID NO: 87 SEQ ID NO: 82 SEQ ID NO: 93 SEQ ID NO: 95
Set-54 SEQ ID NO: 87 SEQ ID NO: 82 SEQ ID NO: 94 SEQ ID NO: 95
Set-55 SEQ ID NO: 3 SEQ ID NO: 4
Set-56 SEQ ID NO: 9 SEQ ID NO: 10
Set-57 SEQ ID NO: 15 SEQ ID NO: 16
Set-58 SEQ ID NO: 21 SEQ ID NO: 22
Set-59 SEQ ID NO: 27 SEQ ID NO: 28
Set-60 SEQ ID NO: 33 SEQ ID NO: 34
Set-61 SEQ ID NO: 39 SEQ ID NO: 40
Set-62 SEQ ID NO: 45 SEQ ID NO: 46
Set-63 SEQ ID NO: 50 SEQ ID NO: 53
Set-64 SEQ ID NO: 56 SEQ ID NO: 59
Set-65 SEQ ID NO: 61 SEQ ID NO: 53
Set-66 SEQ ID NO: 66 SEQ ID NO: 67
Set-67 SEQ ID NO: 72 SEQ ID NO: 73
Set-68 SEQ ID NO: 83 SEQ ID NO: 84
Set-69 SEQ ID NO: 83 SEQ ID NO: 84
Set-70 SEQ ID NO: 83 SEQ ID NO: 84
Set-71 SEQ ID NO: 83 SEQ ID NO: 84
Set-72 SEQ ID NO: 83 SEQ ID NO: 84
Set-73 SEQ ID NO: 89 SEQ ID NO: 84
Set-74 SEQ ID NO: 83 SEQ ID NO: 84
Set-75 SEQ ID NO: 89 SEQ ID NO: 90
Set-76 SEQ ID NO: 89 SEQ ID NO: 84
Set-77 SEQ ID NO: 93 SEQ ID NO: 84
Set-78 SEQ ID NO: 94 SEQ ID NO: 84
Set-79 SEQ ID NO: 89 SEQ ID NO: 95
Set-80 SEQ ID NO: 93 SEQ ID NO: 95
Set-81 SEQ ID NO: 94 SEQ ID NO: 95

Example 2: Amplification Reaction Kinetics

A negative urine matrix was spiked with titred C. trachomatis (strain Z054, D-UW3 (Zeptometrix) or ATCC serovar D strain VR-885) at two different concentrations (103 IFU/mL and 10 IFU/mL). Nucleic acids were extracted using standard extraction methods and the sample was amplified using LAMP primers sets as described in Table 2. YoPro™ dye (Life Technologies; green fluorescent carbocyanine nucleic acid stain) was used for the detection of the amplified product. In this example a 25 μl reaction contained 1× Isothermal Amplification Buffer (New England Biolabs) supplemented with 4.8 mM or 6 mM MgCl2, 1.4 mM or 1.6 mM dNTP, 200 nM YO-PRO-1 dye (Life Technologies), primers (0.2 μM of F3 and B3, when present; 1.6 μM of FIP and BIP; 0.4-0.8 μM of LF and LB, when present), 8 or 12 Units of Bst2 polymerase (New England Biolabs), 7.5 Units RTx Warmstart (reverse transcriptase; New England Biolabs), and the extracted nucleic acid (as template) or water (as no template control). The reactions were incubated at 63° or 65° C. and kinetics were monitored using a Roche real-time Lightcycler96 (Roche).

This example shows that using this set of primers and the loop mediated amplification method, fast amplification kinetics are achieved. Results are summarized in Table 3, in which the Time to Positive (Tp) was calculated by the instrument. NT indicates concentrations not tested. Results are classified by the time to positive (NT means “not tested” and “no call” indicates that no amplification was detected).

TABLE 3
Time to Positive Dye Detection
primers Tp 103 IFU/mL Tp 10 IFU/mL NTC
Set-1 6.1 7.8 25.12
Set-2 8.6 10.8 36.81
Set-3 6.6 9.1 28.59
Set-4 8.2 19.8 36.77
Set-5 7.9 11.1 31.42
Set-6 8.8 12.2 38.28
Set-7 11.0 14.4 21.05
Set-8 10.9 14.2 19.86
Set-9 NT 7.0 42.89
Set-10 NT 6.8 32.68
Set-11 NT 11.0 27.34
Set-12 4.1 6.54 48.03
Set-13 7.3 10.13 46.55
Set-14 4.4 5.18 29.24
Set-15 4.6 5.21 20.34
Set-16 4.6 5.40 43.24
Set-17 4.5 5.36 23.37
Set-18 3.9 6.00 23.78

Example 3: Beacon Design Location Effect on Assay Kinetics

Amplification reactions containing some of the above primers sets and the intercalating dye resulted in the detection of an amplification product when using water or negative urine extraction or the DNA of closely related specie such as C. pneumoniae or C. psittaci as templates at frequencies ranging between 0% to 75% of the time (Table 4), within variable intervals of our cut off window for the assay time. Results are classified by the time to positive (“no call” indicates that no amplification was detected).

TABLE 4
Cross Reactivity - Dye Detection
C. pneumoniae C. psittaci
Primer Set NTC (water) DNA DNA
Set-9 42.9 1 of 2 15.2 1 of 1 NT
Set-10 32.7 1 of 2 9.4 1 of 1 NT
Set-11 27.3 1 of 2 18.0 1 of 1 NT

For added specificity molecular beacons were designed along these primers sets to make sure only signal from the C. trachomatis target is detected (sequences listed in table 5). Each molecular beacon probe was designed with 5′ fluorophore/3′ quencher modifications (6-Carboxyfluorescein (FAM) and Black Hole Quencher 1 (BHQ1)) included to provide target-specific fluorescent detection.

TABLE 5
Probe Sequences
ID Fluor Quench Sequence (5′ to 3′) Sequence ID
MB1 FAM BHQ1 CGCGCACATCTGGAAAGATGGATGATACAGGGTGCGCG SEQ ID NO: 97
MB2 FAM BHQ1 CGTCCAGGACTCCTAGTTGAACACATCTGGACG SEQ ID NO: 98
MB3 FAM BHQ1 CCGGATCAGGACTCCTAGTTGAACACATCTGATCCGG SEQ ID NO: 99
MB4 FAM BHQ1 CGGCCAGGACTCCTAGTTGAACACATCTGGCCG SEQ ID NO: 100
MB5 FAM BHQ1 CGTCCGGATCAGGACTCCTAGTTGAACACCGGACG SEQ ID NO: 101
MB6 FAM BHQ1 CTCGCCACGTGAAACCTAGTCTGAATCTGGCGAG SEQ ID NO: 102
MB7 FAM BHQ1 CCGTGGATGATACAGGGTGATAGTCCACGG SEQ ID NO: 103
MB8 FAM BHQ1 CGTGGGATGATACAGGGTGATAGTCCCACG SEQ ID NO: 104
MB9 FAM BHQ1 CGGCTCGAGATTCCCTGTGTAGCGGCGAGCCG SEQ ID NO: 105
MB10 FAM BHQ1 CGCCAGGATCAGGACTCCTAGTTGAACCTGGCG SEQ ID NO: 106
MB11 FAM BHQ1 CACCGGGATGATACAGGGTGATAGTCCCGGTC SEQ ID NO: 107
MB12 FAM BHQ1 CACCGGGATGATACAGGGTGATAGTCCCGGTG SEQ ID NO: 108
MB13 FAM BHQ1 TCGCGGGATGATACAGGGTGATAGTCCCGCGG SEQ ID NO: 109
MB14 FAM BHQ1 CAGCGGGATCAGGACTCCTAGTTGAACCCGCTG SEQ ID NO: 110
MB15 FAM BHQ1 CACGCTCGAGATTCCCTGTGTAGCGGCGAGCGTG SEQ ID NO: 111
MB16 FAM BHQ1 CAGGCGGATCAGGACTCCTAGTTGAACACCGCCTG SEQ ID NO: 112
MB17 FAM BHQ1 CAGCGACAGAAATCGAAGAGATTCCCTGTGTCGCTG SEQ ID NO: 113
MB18 FAM BHQ1 CACGGGATGATACAGGGTGATAGTCCCGTC SEQ ID NO: 114
MB19 FAM BHQ1 CACGGGATGATACAGGGTGATAGTCCCGTG SEQ ID NO: 115
MB20 FAM BHQ1 CACGATGGATGATACAGGGTGATAGTCCATCGTG SEQ ID NO: 116
MB21 FAM BHQ1 CACCGATGGATGATACAGGGTGATAGTCCCATCGGTG SEQ ID NO: 117
MB22 FAM BHQ1 CGCGATCGAGGATAAAGGATCAGGACTCGATCGCG SEQ ID NO: 118
MB23 FAM BHQ1 CGCGATCATTGAGGATAAAGGATCAGGACTGATCGCG SEQ ID NO: 119
MB24 FAM BHQ1 CGCGATCCTCCTAGTTGAACACATCTGGAGATCGCG SEQ ID NO: 120
MB25 FAM BHQ1 CGCGATCAGGACTCCTAGTTGAACACATCTGGATCGCG SEQ ID NO: 121
MB26 FAM BHQ1 CGCGACTCAGGACTCCTAGTTGAACACATCTGGAGTCG SEQ ID NO: 122
CG
MB27 FAM BHQ1 CGCGATCCGGATAAAGGATCAGGACTCCTAGTTGGGAT SEQ ID NO: 123
CGCG
MB28 FAM BHQ1 CGCGAGTAGGATTGAGGATAAAGGATCAGGACTCGCG SEQ ID NO: 124
MB29 FAM BHQ1 CGCGATCCCTGTGTAGCGGCGAGCGAGATCGCG SEQ ID NO: 125
MB30 FAM BHQ1 CGCGATCCTGTGTAGCGGCGAGCGAAAGATCGCG SEQ ID NO: 126
MB31 FAM BHQ1 CGGCTCGGGGTTGTAGGATTGAGGATACGAGCCG SEQ ID NO: 127
MB32 FAM BHQ1 CCGGAGCCTACAACCCCGAGCCTTATCAGCTCCGG SEQ ID NO: 128
MB33 FAM BHQ1 GCGCAGCTCGGTTTAGGCTATTCCCCTGCGCG SEQ ID NO: 129
MB34 FAM BHQ1 CGCGGTCTCTCCTTTCGTCTACGGGACCGCG SEQ ID NO: 130
MB35 FAM BHQ1 CGCAGTGAGAGAAAGACCGACCTCAACACTGCG SEQ ID NO: 131

A negative urine matrix was spiked with titred C. trachomatis (strain Z054, D-UW3 (Zeptometrix) or ATCC serovar D strain VR-885) at two different concentrations (103 IFU/mL and 10 IFU/mL). Nucleic acids were extracted using standard extraction methods and the sample was amplified using a LAMP primer set (per Table 2) and one of the molecular beacons (per Table 4) was used for the detection of the amplified product. In this example a 25 μl reaction contained 1× Isothermal Amplification Buffer (New England Biolabs) supplemented with 4.8 mM or 6 mM MgCl2, 1.4 mM or 1.6 mM dNTP, 200 nM molecular beacon (Sigma-Aldrich), primers (0.2 μM of F3 and B3, if present; 1.6 μM or 2 μM of FIP and BIP; 0.4-0.8 μM of LF and LB, if present), 8 or 12 Units of Bst2 polymerase (New England Biolabs), 7.5 Units RTx Warmstart (reverse transcriptase; New England Biolabs), and the extracted nucleic acid (as template) or water (as no template control). The reactions were incubated at 63° C. and kinetics were monitored using a Roche real-time Lightcycler96 (Roche). The time to positive for each primer-probe combination is reported in Table 6. Results are classified by the time to positive (Tp) from reaction initiation as follows: “NT” indicates that this combination was not tested and “no call” indicates that no amplification was detected.

TABLE 6
Time to Positive Probe Detection
Primers Beacon 103 IFU/mL 10 IFU/mL NTC
Set-12 MB1 5.6 7.6 no call
Set-12 MB2 4.8 6.7 no call
Set-12 MB3 5.2 7.2 no call
Set-12 MB4 6.3 8.4 no call
Set-12 MB5 5.6 7.4 no call
Set-13 MB2 14.6 20.9 no call
Set-13 MB6 8.9 11.2 no call
Set-14 MB11 4.8 6.7 no call
Set-14 MB12 5.2 6.7 no call
Set-14 MB13 5.1 6.9 no call
Set-14 MB15 5.5 7.0 no call
Set-14 MB18 4.8 6.5 no call
Set-14 MB19 5.8 7.3 no call
Set-14 MB2 4.9 6.5 no call
Set-14 MB7 4.8 6.3 no call
Set-14 MB8 4.9 6.7 no call
Set-14 MB9 5.2 7.0 no call
Set-15 MB2 4.4 6.4 no call
Set-16 MB2 4.2 7.4 no call
Set-17 MB2 4.3 6.0 no call
Set-18 MB2 4.8 6.6 no call
Set-19 MB11 6.0 8.0 no call
Set-19 MB12 5.9 7.9 no call
Set-19 MB13 5.9 8.0 no call
Set-19 MB18 5.6 7.4 no call
Set-19 MB19 6.6 8.7 no call
Set-19 MB2 4.7 6.6 no call
Set-19 MB20 5.7 7.7 no call
Set-19 MB21 5.7 7.6 no call
Set-20 MB11 5.2 7.3 no call
Set-20 MB12 5.2 6.7 no call
Set-20 MB13 4.9 6.7 no call
Set-20 MB15 5.1 7.2 no call
Set-20 MB18 4.7 6.7 no call
Set-20 MB19 5.5 7.3 no call
Set-20 MB20 5.6 7.2 no call
Set-20 MB21 5.1 7.2 no call
Set-20 MB3 5.8 7.7 no call
Set-20 MB4 5.0 6.7 32.7
Set-20 MB7 5.0 6.8 no call
Set-20 MB8 5.0 6.9 no call
Set-20 MB9 4.9 7.1 no call
Set-21 MB10 6.8 8.5 no call
Set-21 MB14 6.7 8.9 no call
Set-21 MB16 6.4 8.4 no call
Set-21 MB17 2.7 3.5 no call
Set-21 MB3 8.2 10.3 no call
Set-21 MB4 6.9 8.9 no call
Set-22 MB19 7.3 9.3 no call
Set-23 MB19 11.8 14.8 no call
Set-24 MB19 6.5 8.4 no call
Set-24 MB20 6.3 8.3 no call
Set-24 MB21 5.9 8.1 no call
Set-25 MB19 7.3 9.7 no call
Set-25 MB20 7.6 10.0 no call
Set-25 MB21 7.2 8.4 no call
Set-26 MB19 19.0 25.5 41.4
Set-27 MB19 7.9 10.0 no call
Set-76 MB19 17.3 NT no call
Set-78 MB19 12.2 NT no call
Set-79 MB19 28.6 NT no call
Set-81 MB19 22.1 NT no call

Use of Molecular Beacons for detection resulted in a slight increase in reaction Tp, however the significant enhancement in assay specificity provided a reasonable tradeoff, no amplification was observed in the water sample or DNA from a close related species within the testing period of 45 min (see Example 4, Table 7).

Example 4: Specificity Testing

A negative urine matrix was spiked with titred C. trachomatis or with organisms commonly associated with sexually transmitted infections (e.g., Neisseria gonorrhoeae) or species closely related to C. trachomatis (C. pneumonia or C. psittaci). Bacterial stocks were serially diluted in PBS before addition to the urine matrix at the desired concentration. Corresponding extracted nucleic acids or DNAs of the test species were used as templates in RT-LAMP reactions containing the LAMP primers and molecular beacon probe, according to the methods described Example 3, above. NT indicates reactions not tested.

TABLE 7
Cross Reactivity - Probe Detection
103 10
Primers Beacon IFU/mL IFU/mL C. pneumoniae C. psittaci N. gonorrhoeae NTC
Set-14 MB2 4.4 6.2 13.5 13.2 20.2 19.6
Set-14 MB11 NT 6.7 18.6 14.4 32.1 23.3
Set-20 MB2 4.7 7.0 22.5 23.5 21.8 21.1
Set-20 MB11 NT 6.7 26.4 27.1 27.8 20.4
Set-21 MB2 6.6 8.6 No call No call No call No call
Set-19 MB19 NT 8.1 No call No call No call No call
Set-20 MB19 NT 7.8 33.4 28.6 No call No call
Set-14 MB19 NT 7.3 20.1 14.9 No call No call

This example shows that the CT23S assay and its reaction formulation can be designed to be highly specific, limiting cross reactivity with sequences of closely related organisms and those commonly associated with sexually transmitted infections.

Example 5: Sensitivity Testing

A RNA molecular standard was diluted to various concentrations to assess the sensitivity of the indicated primer set/molecular beacon combinations (Table 8). Standards were serially diluted with 0.1 mg/mL Poly A carrier RNA in PBS (Sigma) and used as template for amplification in RTLAMP reactions. Final concentrations in reactions were 40, 8, or 4 copies/uL. Reaction conditions were equivalent to those described above in Example 3. Amplification signal was obtained with concentrations as low as 4 copies/uL (see Table 8).

TABLE 8
Sensitivity with LAMP and Molecular Beacon
Primer Set Beacon 40 copies/uL 8 copies/uL 4 copies/uL
Set-14 MB2 6.5 7.6 12.3
Set-20 MB2 6.5 7.8 9.9

Claims

We claim:

1. A composition comprising a set of polynucleotides selected from the group consisting of Set-20, Set-24, Set-47, Set-51, Set-74 and Set-78.

2. The composition of claim 1, further comprising a probe.

3. The composition of claim 2, wherein the probe is a labeled polynucleotide.

4. The composition of claim 3, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, and nucleotides 6-27 of SEQ ID NO: 130.

5. The composition of claim 2, wherein the probe is a molecular beacon comprising a fluorophore, a quencher, and a polynucleotide.

6. The composition of claim 5, wherein the molecular beacon comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, and nucleotides 6-27 of SEQ ID NO: 130.

7. The composition of claim 6, wherein the molecular beacon comprises a sequence selected from the group consisting of SEQ ID NOs: 97-101 and 103-130.

8. The composition of claim 7, wherein the polynucleotide sequence consists of SEQ ID NO: 115.

9. A molecular beacon comprising a fluorophore, a quencher, and a polynucleotide, wherein the polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, and nucleotides 6-27 of SEQ ID NO: 130.

10. The molecular beacon of claim 9, wherein the polynucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 97-101 and 103-130.

11. The composition of claim 10, wherein the polynucleotide sequence consists of SEQ ID NO: 115.

12. The molecular beacon of claim 9, wherein the fluorophore is FAM and the quencher is BHQ1.

13. A method of detecting Chlamydia trachomatis in a test sample, the method comprising:

(a) extracting nucleic acid from the test sample;

(b) amplifying a target sequence by reacting the nucleic acid extracted in step (a) with a reaction mixture comprising a strand displacement DNA polymerase and a sequence-specific primer set, wherein said sequence-specific primer set is selected from the group consisting of Set-20, Set-24, Set-47, Set-51, Set-74, and Set-78; and

(c) detecting the presence or absence of an amplified product of step (b); wherein the presence of said amplification product is indicative of the presence of Chlamydia trachomatis in the test sample.

14. The method of claim 13, wherein the amplification in step (b) of the target sequence is performed at between about 60° C. and about 67° C. for less than fifteen minutes.

15. The method of claim 14, wherein the amplification step is performed for less than ten minutes.

16. The method of claim 13, wherein the reaction mixture further comprises a reverse transcriptase.

17. The method of claim 13, wherein detecting the presence or absence of the amplification product comprises hybridizing the amplified product with a probe comprising a polynucleotide attached to a label.

18. The method of claim 17, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, and nucleotides 6-27 of SEQ ID NO: 130.

19. The method of claim 18, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 97-101 and 103-130.

20. The method of claim 19, wherein the sequence of the labeled polynucleotide is SEQ ID NO: 115.

21. The method of claim 13, wherein Chlamydia trachomatis is present in the test sample at a concentration of ≤100 IFU/mL.

22. The method of claim 21, wherein Chlamydia trachomatis is present in the test sample at a concentration of ≤5 IFU/ml and the amplification step is performed for less than 15 minutes.

23. The method of claim 21, wherein Chlamydia trachomatis is present in the test sample at a concentration of ≤10 IFU/ml and the amplification step is performed for less than six minutes.

24. A kit comprising a composition according to claim 1.

25. The kit of claim 24, further comprising a strand displacement polymerase.

26. The kit of claim 24, further comprising a molecular beacon comprising a fluorophore, a quencher, and a polynucleotide, wherein the polynucleotide consists of a sequence selected from the group consisting of SEQ ID NOs: 97-101 and 103-130.

27. The kit of claim 26, wherein the polynucleotide consists of SEQ ID NO: 115.

28. A method of detecting Chlamydia trachomatis in a test sample, the method comprising:

(a) extracting nucleic acid from the test sample;

(b) amplifying a target sequence by reacting the nucleic acid extracted in step (a) for less than ten minutes with a reaction mixture comprising a strand displacement DNA polymerase and a sequence-specific LAMP primer set selected from the group consisting of Set-20 and Set-24; and

(c) detecting the presence or absence of an amplified product of step (b); wherein the presence of said amplification product is indicative of the presence of Chlamydia trachomatis in the test sample.

29. The method of claim 28, wherein detecting the presence or absence of the amplification product comprises hybridizing the amplified product with a molecular beacon comprising a polynucleotide sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, and nucleotides 6-27 of SEQ ID NO: 130.

30. The method of claim 28, wherein detecting the presence or absence of the amplification product comprises hybridizing the amplified product with a molecular beacon comprising a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 97-101 and 103-130.

31. A composition comprising a set of polynucleotides selected from the group consisting of Set-1 through Set-81.

32. The composition of claim 31, further comprising a probe.

33. The composition of claim 32, wherein the probe comprises a label.

34. The composition of claim 33, wherein the probe is a labeled polynucleotide.

35. The composition of claim 34, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, and nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, nucleotides 6-27 of SEQ ID NO: 130, and nucleotides 8-29 of SEQ ID NO: 131.

36. The composition of claim 34, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 97 through 131.

37. The composition of claim 34, wherein the label is a fluorophore.

38. The composition of claim 37, wherein the fluorophore is covalently attached to a terminus of the polynucleotide.

39. The composition of claim 31, further comprising a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 5-26 of SEQ ID NO:

103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 7-32 of SEQ ID NO: 128, and nucleotides 4-27 of SEQ ID NO: 129, and wherein the set of polynucleotides is selected from the group consisting of Set-12, Sets 14-27, Set-39, Sets 41-54, Set-66, and Sets 68-81.

40. The composition of claim 39, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 128, and SEQ ID NO: 129.

41. The composition of claim 40, wherein the sequence of the labeled polynucleotide is SEQ ID NO: 115, and the set of polynucleotides is selected from the group consisting of Set-20, Set-24, Set-47, Set-51, Set-74 and Set-78.

42. The composition of claim 41, wherein the set of polynucleotides is Set-20 or Set-24.

43. The composition of claim 31, further comprising a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, and nucleotides 7-34 of SEQ ID NO: 122, and wherein the set of polynucleotides is selected from the group consisting of Sets 12-27, Sets 39-54, and Sets 66-81.

44. The composition of claim 43, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 106, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 120, SEQ ID NO: 121, and SEQ ID NO: 122.

45. The composition of claim 31, further comprising a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 6-28 of SEQ ID NO: 125 and nucleotides 7-28 of SEQ ID NO: 126, and wherein the set of polynucleotides is selected from the group consisting of Set-12, Sets 14-18, Set-20, Set-24, Set-27, Set-39, Sets 41-45, Set-47, Set-51, Set-54, Set-66, Sets 68-72, Set 74, Set-78, and Set-81.

46. The composition of claim 45, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 125 and SEQ ID NO: 126.

47. The composition of claim 31, further comprising a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 8-31 of SEQ ID NO: 113 and nucleotides 3-27 of SEQ ID NO: 127, and wherein the set of polynucleotides is selected from the group consisting of Sets 14-27, Sets 41-54, and Sets 68-81.

48. The composition of claim 47, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 113 and SEQ ID NO: 127.

49. The composition of claim 31, further comprising a labeled polynucleotide comprising nucleotides 6-27 of SEQ ID NO: 130, and wherein the set of polynucleotides is selected from the group consisting of Sets 12-20, Sets 22-27, Sets 39-47, Sets 49-54, Sets 66-74, and Sets 76-81.

50. The composition of claim 49, wherein the labeled polynucleotide comprises SEQ ID NO: 130.

51. The composition of claim 31, further comprising a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 6-30 of SEQ ID NO: 102 and nucleotides 8-29 of SEQ ID NO: 131, and wherein the set of polynucleotides is selected from the group consisting of Set-13, Set-40 and Set-67.

52. The composition of claim 51, wherein the polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 102 and SEQ ID NO: 131.

53. The composition of claim 52, wherein the probe is a molecular beacon comprising a fluorophore, a quencher, and a polynucleotide.

54. The composition of claim 53, wherein the molecular beacon comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, and nucleotides 6-27 of SEQ ID NO: 130.

55. The composition of claim 54, wherein the molecular beacon comprises a sequence selected from the group consisting of SEQ ID NO: 97 through SEQ ID NO: 130.

56. The composition of claim 55, wherein the polynucleotide sequence consists of SEQ ID NO: 115.

57. A molecular beacon comprising a fluorophore, a quencher, and a polynucleotide, wherein the polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, and nucleotides 8-29 of SEQ ID NO: 120.

58. The molecular beacon of claim 57, wherein the polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 99 through SEQ ID NO: 120.

59. The molecular beacon of claim 58, wherein the polynucleotide consists of a sequence selected from the group consisting of SEQ ID NO: 99 through SEQ ID NO: 120.

60. The molecular beacon of claim 57, wherein the fluorophore is FAM and the quencher is BHQ1.

61. The molecular beacon of claim 57, wherein the fluorophore is ATTO 565 or Alexa 594 and the quencher is BHQ1 or BHQ2.

62. A method of detecting Chlamydia trachomatis in a test sample, the method comprising:

(a) extracting nucleic acid from the test sample;

(b) amplifying a target sequence by reacting the nucleic acid extracted in step (a) with a reaction mixture comprising a strand displacement DNA polymerase and a sequence-specific primer set, wherein said sequence-specific primer set is selected from the group consisting of Set-1 through Set-81; and

(c) detecting the presence or absence of an amplified product of step (b); wherein the presence of said amplification product is indicative of the presence of Chlamydia trachomatis in the test sample.

63. The method of claim 62, wherein the amplification in step (b) of the target sequence is performed at between about 60° C. and about 67° C. for less than 30 minutes.

64. The method of claim 63, wherein the amplification step is performed for less than fifteen minutes.

65. The method of claim 64, wherein the amplification step is performed for less than ten minutes.

66. The method of claim 65, wherein the amplification step is performed for less than six minutes.

67. The method of claim 62, wherein the reaction mixture further comprises a reverse transcriptase.

68. The method of claim 62, wherein detecting the presence or absence of the amplification product comprises hybridizing the amplified product with a probe comprising a polynucleotide attached to a label.

69. The method of claim 68, wherein the label is a fluorophore.

70. The method of claim 69, wherein the fluorophore is covalently attached to a terminus of the polynucleotide.

71. The method of claim 68, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, nucleotides 6-27 of SEQ ID NO: 130, and nucleotides 8-29 of SEQ ID NO: 131.

72. The method of claim 71, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 97 through 130.

73. The method of claim 68, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 7-32 of SEQ ID NO: 128, and nucleotides 4-27 of SEQ ID NO: 129, and wherein the sequence-specific primer set is selected from the group consisting of Set-12, Sets 14-27, Set-39, Sets 41-54, Set-66, and Sets 68-81.

74. The method of claim 73, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 128, and SEQ ID NO: 129

75. The method of claim 74, wherein the sequence of the labeled polynucleotide is SEQ ID NO: 115, and the sequence-specific primer set is selected from the group consisting of Set-20, Set-24, Set-47, Set-51, Set-74 and Set-78.

76. The method of claim 75, wherein the sequence-specific primer set is Set-20 or Set-24.

77. The method of claim 68, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, and nucleotides 7-34 of SEQ ID NO: 122, and wherein the sequence-specific primer set is selected from the group consisting of Sets 12-27, Sets 39-54, and Sets 66-81.

78. The method of claim 77, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 106, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 120, SEQ ID NO: 121, and SEQ ID NO: 122

79. The method of claim 68, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 6-28 of SEQ ID NO: 125 and nucleotides 7-28 of SEQ ID NO: 126, and wherein the sequence-specific primer set is selected from the group consisting of Set-12, Sets 14-18, Set-20, Set-24, Set-27, Set-39, Sets 41-45, Set-47, Set-51, Set-54, Set-66, Sets 68-72, Set 74, Set-78, and Set-81.

80. The method of claim 79, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 125 and SEQ ID NO: 126.

81. The method of claim 68, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 8-31 of SEQ ID NO: 113 and nucleotides 3-27 of SEQ ID NO: 127, and wherein the sequence-specific primer set is selected from the group consisting of Sets 14-27, Sets 41-54, and Sets 68-81.

82. The method of claim 81, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 113 and SEQ ID NO: 127.

83. The method of claim 68, wherein the labeled polynucleotide comprises nucleotides 6-27 of SEQ ID NO: 130, and wherein the sequence-specific primer set is selected from the group consisting of Sets 12-20, Sets 22-27, Sets 39-47, Sets 49-54, Sets 66-74, and Sets 76-81.

84. The method of claim 83, wherein the labeled polynucleotide comprises SEQ ID NO: 130.

85. The method of claim 68, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 6-30 of SEQ ID NO: 102 and nucleotides 8-29 of SEQ ID NO: 131, and wherein sequence-specific primer set is selected from the group consisting of Set-13, Set-40 and Set-67.

86. The method of claim 85, wherein the polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 102 and SEQ ID NO: 131.

87. The method of claim 62, wherein Chlamydia trachomatis is present in the test sample at a concentration of ≤100 IFU/mL.

88. The method of claim 87, wherein Chlamydia trachomatis is present in the test sample at a concentration of ≤50 IFU/mL.

89. The method of claim 88, wherein Chlamydia trachomatis is present in the test sample at a concentration of ≤5 IFU/mL.

90. The method of claim 89, wherein Chlamydia trachomatis is present in the test sample at a concentration of ≤2 IFU/mL.

91. The method of claim 87, wherein Chlamydia trachomatis is present in the test sample at a concentration of ≤5 IFU/ml and the amplification step is performed for less than 15 minutes.

92. The method of claim 87, wherein Chlamydia trachomatis is present in the test sample at a concentration of ≤10 IFU/ml and the amplification step is performed for less than six minutes.

93. A kit comprising a composition according to claim 31.

94. The kit of claim 93, further comprising a strand displacement polymerase.

95. The kit of claim 94, further comprising a molecular beacon comprising a fluorophore, a quencher, and a polynucleotide, wherein the polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, nucleotides 6-27 of SEQ ID NO: 130, and nucleotides 8-29 of SEQ ID NO: 131.

96. The kit of claim 95, wherein the polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 97 through SEQ ID NO: 131.

97. The kit of claim 96, wherein the polynucleotide consists of a sequence selected from the group consisting of SEQ ID NO: 97 through SEQ ID NO: 131.

98. The kit of claim 97, wherein the polynucleotide consists of SEQ ID NO: 115 and the set of polynucleotides is Set-20 or Set-24.

99. A method of detecting Chlamydia trachomatis in a test sample, the method comprising:

(a) extracting nucleic acid from the test sample;

(b) amplifying a target sequence by reacting the nucleic acid extracted in step (a) for less than ten minutes with a reaction mixture comprising a strand displacement DNA polymerase and a sequence-specific LAMP primer set; and

(c) detecting the presence or absence of an amplified product of step (b); wherein the presence of said amplification product is indicative of the presence of Chlamydia trachomatis in the test sample.

100. The method of claim 99, wherein Chlamydia trachomatis is present in the test sample at a concentration of ≤100 IFU/mL.

101. The method of claim 100, wherein Chlamydia trachomatis is present in the test sample at a concentration of ≤10 IFU/mL.

102. The method of claim 99, wherein the amplifying step comprises reacting the nucleic acid extracted in step (a) with a reaction mixture comprising a strand displacement DNA polymerase and a sequence-specific primer set, wherein said sequence-specific primer set is selected from the group consisting of Set-1 through Set-81.

103. The method of claim 102, wherein detecting the presence or absence of the amplification product comprises hybridizing the amplified product with a molecular beacon comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 97 through SEQ ID NO: 131.

104. The method of claim 102, wherein detecting the presence or absence of the amplification product comprises hybridizing the amplified product with a molecular beacon comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 99 through SEQ ID NO: 120.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class: