Patent application title:

Assays for the detection of SARS-CoV-2

Publication number:

US20210324484A1

Publication date:
Application number:

17/078,249

Filed date:

2020-10-23

āœ… Patent granted

Patent number:

US 11,149,320 B1

Grant date:

2021-10-19

PCT filing:

-

PCT publication:

-

Examiner:

Aaron A Priest

Agent:

Jeffrey I. Auerbach | AuerbachSchrot LLC

Adjusted expiration:

2040-10-23

Abstract:

The present invention is directed to methods for assaying for the presence of SARS-CoV-2 in a sample, including a clinical sample, and to oligonucleotides, reagents, and kits useful in such assays. In particular, the present invention is directed to such assays that are rapid, accurate and specific for the detection of SARS-CoV-2.

Inventors:

Assignee:

Applicant:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q1/701 »  CPC main

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage Specific hybridization probes

C12Q1/68 IPC

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids

C12Q1/70 IPC

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a continuation-in-part of, and claims priority to, U.S. patent application Ser. No. 16/837,364 (filed on Apr. 1, 2020; pending), which application claims priority to Italian Patent Application No. 102020000006754, filed on Mar. 31, 2020 (pending), each of which applications is herein incorporated by reference in its entirety.

REFERENCE TO SEQUENCE LISTING

This application includes one or more Sequence Listings pursuant to 37 C.F.R. 1.821 et seq., which are disclosed in computer-readable media (file name: SARS-CoV-2_0400_0020US2_ST25.txt, created on Oct. 18, 2020, and having a size of 156,199 bytes), which file is herein incorporated by reference in its entirety.

FIELD OF THE INVENTION

The present invention is directed to methods for assaying for the presence of SARS-CoV-2 in a sample, including a clinical sample, and to oligonucleotides, reagents, and kits useful in such assays. In particular, the present invention is directed to such assays that are rapid, accurate and specific for the detection of SARS-CoV-2.

BACKGROUND OF THE INVENTION

I. SARS-CoV-2

Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) is a newly identified coronavirus species (the virus was previously provisionally named ā€œ2019 novel coronavirusā€ or ā€œ2019-nCoVā€). SARS-CoV-2 infection is spread by human-to-human transmission via droplets or direct contact, and infection has been estimated to have a mean incubation period of 6.4 days and a Basic Reproduction Number of 2.24-3.58 (i.e., an epidemic doubling time of 6-8 days) (Fang, Y. et al. (2020) ā€œTransmission Dynamics Of The COVID-19 Outbreak And Effectiveness Of Government Interventions: A Data-Driven Analysis,ā€ J. Med. Virol. doi: 10.1002/jmv.25750; Zhao, W. M. et al. (2020) ā€œThe 2019 Novel Coronavirus Resource,ā€ Yi Chuan. 42(2):212-221; Zhu, N. et al. (2020) ā€œA Novel Coronavirus from Patients with Pneumonia in China, 2019,ā€ New Engl. J. Med. 382(8):727-733).

Patients infected with SARS-CoV-2 exhibit COVID-19, a condition initially characterized by fever and cough (Kong, I. et al. (2020) ā€œEarly Epidemiological and Clinical Characteristics of 28 Cases of Coronavirus Disease in South Korea,ā€ Osong Public Health Res Perspect. 11(1):8-14). In approximately 20% of patients, COVID-19 progresses to a severe respiratory disease and pneumonia that has a mortality of 5-10% (1-2% overall mortality). Bilateral lung involvement with ground-glass opacity are the most common finding from computed tomography images of the chest (Lai, C. C. et al. (2020) ā€œSevere Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) And Coronavirus Disease-2019 (COVID-19): The Epidemic And The Challenges,ā€ Int. J. Antimicrob. Agents. 55(3):105924). Since a cure for COVID-19 has not yet been identified, treatment presently consists of a ā€œFour-Anti and Two-Balanceā€ strategy included antivirus, anti-shock, anti-hyoxemia, anti-secondary infection, and maintaining water, electrolyte and acid-base balance and microecological balance (Xu, K. et al. (2020) ā€œManagement Of Corona Virus Disease-19 (COVID-19): The Zhejiang Experience,ā€ Zhejiang Da Xue Bao Yi Xue Ban. 49(1):0).

Coronaviruses (CoVs) belong to the subfamily Orthocoronavirinae in the family Coronaviridae and the order Nidovirales. The Coronaviridae family of viruses are enveloped, single-stranded, RNA viruses that possess a positive-sense RNA genome of 26 to 32 kilobases in length. Four genera of coronaviruses have been identified, namely, Alphacoronavirus (αCoV), Betacoronavirus (βCoV), Deltacoronavirus (Ī“CoV), and Gammacoronavirus (γCoV) (Chan, J. F. et al. (2013) ā€œInterspecies Transmission And Emergence Of Novel Viruses: Lessons From Bats And Birds,ā€ Trends Microbiol. 21(10):544-555). Evolutionary analyses have shown that bats and rodents are the gene sources of most αCoVs and βCoVs, while avian species are the gene sources of most Ī“CoVs and γCoVs.

Prior to 2019, only six coronavirus species were known to be pathogenic to humans. Four of these species were associated with mild clinical symptoms, but two coronaviruses, Severe Acute Respiratory Syndrome (SARS) coronavirus (SARS-CoV) (Marra, M. A. et al. (2003) ā€œThe Genome Sequence of the SARS-Associated Coronavirus,ā€ Science 300(5624):1399-1404) and Middle East Respiratory Syndrome (MERS) coronavirus (MERS-CoV) (Mackay, I. M. (2015) ā€œMERS Coronavirus: Diagnostics, Epidemiology And Transmission,ā€ Virol. J. 12:222. doi: 10.1186/s12985-015-0439-5) were associated with human mortalities approaching 10% (Su, S. et al. (2016) ā€œEpidemiology, Genetic Recombination, And Pathogenesis Of Coronaviruses,ā€ Trends Microbiol. 24:490-502; Al Johani, S. et al. (2016) ā€œMERS-CoV Diagnosis: An Update,ā€ J. Infect. Public Health 9(3):216-219).

SARS-CoV-2 is closely related (88%) to two bat-derived Severe Acute Respiratory Syndrome-like coronaviruses, bat-SL-CoVZC45 and bat-SL-CoVZXC21, and is more distantly related to SARS-CoV (79%) and MERS-CoV (50%) (Xie, C. et al. (2020) ā€œComparison Of Different Samples For 2019 Novel Coronavirus Detection By Nucleic Acid Amplification Testsā€ Int. J. Infect. Dis. /doi.org/10.1016/j.ijid.2020.02.050; Mackay, I. M. (2015) ā€œMERS Coronavirus: Diagnostics, Epidemiology And Transmission,ā€ Virol. J. 12:222. doi: 10.1186/s12985-015-0439-5; Gong, S. R. et al. (2018) ā€œThe Battle Against SARS And MERS Coronaviruses: Reservoirs And Animal Models,ā€ Animal Model Exp. Med. 1(2):125-133; Yin, Y. et al. (2018) ā€œMERS, SARS And Other Coronaviruses As Causes Of Pneumonia,ā€ Respirology 23(2):130-137). Phylogenetic analysis revealed that SARS-CoV-2 fell within the subgenus Sarbecovirus of the genus Betacoronavirus, with a relatively long branch length to its closest relatives bat-SL-CoVZC45 and bat-SL-CoVZXC21, and was genetically distinct from SARS-CoV (Drosten et al. (2003) ā€œIdentification Of A Novel Coronavirus In Patients With Severe Acute Respiratory Syndrome,ā€ New Engl. J. Med. 348:1967-1976; Lai, C. C. et al. (2020) ā€œSevere Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) And Coronavirus Disease-2019 (COVID-19): The Epidemic And The Challenges,ā€ Int. J. Antimicrob. Agents. 55(3):105924; Lu, R. et al. (2020) ā€œGenomic Characterisation And Epidemiology Of 2019 Novel Coronavirus: Implications For Virus Origins And Receptor Binding,ā€ The Lancet 395(10224): 565-574; Zhou, Y. et al. (2020) ā€œNetwork-Based Drug Repurposing For Novel Coronavirus 2019-nCoV/SARS-CoV-2,ā€ Cell Discov. 6(14): doi.org/10.1038/s41421-020-0153-3).

The SARS-CoV-2 genome has been sequenced from at least 170 isolates. The reference sequence is GenBank NC_045512 (Wang, C. et al. (2020) ā€œThe Establishment Of Reference Sequence For SARS-CoV-2 And Variation Analysis,ā€ J. Med. Virol. doi: 10.1002/jmv.25762; Chan, J. F. et al. (2020) ā€œGenomic Characterization Of The 2019 Novel Human-Pathogenic Coronavirus Isolated From A Patient With Atypical Pneumonia After Visiting Wuhan,ā€ Emerg. Microbes. Infect. 9(1):221-236).

Comparisons of the sequences of multiple isolates of the virus (MN988668 and NC_045512, isolated from Wuhan, China, and MN938384.1, MN975262.1, MN985325.1, MN988713.1, MN994467.1, MN994468.1, and MN997409.1) reveal greater than 99.99% identity (Sah, R. et al. (2020) ā€œComplete Genome Sequence of a 2019 Novel Coronavirus (SARS-CoV-2) Strain Isolated in Nepal,ā€ Microbiol. Resource Announcements 9(11): e00169-20, pages 1-3; Brüssow, H. (2020) ā€œThe Novel Coronavirus—A Snapshot of Current Knowledge,ā€ Microbial Biotechnology 0:(0):1-6). The SARS-CoV-2 genome is highly similar to that of human SARS-CoV, with an overall nucleotide identity of approximately 82% (Chan, J. F. et al. (2020) ā€œGenomic Characterization Of The 2019 Novel Human-Pathogenic Corona Virus Isolated From A Patient With Atypical Pneumonia After Visiting Wuhan,ā€ Emerg Microbes Infect 9:221-236; Chan, J. F. et al. (2020) ā€œImproved Molecular Diagnosis Of COVID-19 By The Novel, Highly Sensitive And Specific COVID-19-RdRp/Hel Real-Time Reverse Transcription-Polymerase Chain Reaction Assay Validated In Vitro And With Clinical Specimens,ā€ J Clin. Microbiol. JCM.00310-20. doi: 10.1128/JCM.00310-20). Based on its homology to related coronaviruses, SARS-CoV-2 is predicted to encode 12 open reading frame (ORFs) coding regions (ORF1ab, S (spike protein), 3, E (envelope protein), M (matrix), 7, 8, 9, 10b, N, 13 and 14. The arrangement of these coding regions is shown in FIG. 1. Two ORFs coding regions are of particular significance to the present invention: ORF1ab and the S gene (Lu, R. et al. (2020) ā€œGenomic Characterisation And Epidemiology Of 2019 Novel Coronavirus: Implications For Virus Origins And Receptor Binding,ā€ Lancet 395(10224):565-574).

A. ORF1ab

ORF1ab is composed of 21290 nucleotides and encodes an open reading frame of 7096 amino acids in length. Via a āˆ’1 ribosomal frameshift, the encoded protein is a polyprotein (pp) composed of a first segment (pp1a) of 4401 amino acid residues, and a second segment (pp1ab) of 2695 amino acid residues (Chen, Y, et al. (2020) ā€œEmerging Coronaviruses: Genome Structure, Replication, And Pathogenesis,ā€ J. Med. Virol. 92:418-423; Lu, R. et al. (2020) ā€œGenomic Characterisation And Epidemiology Of 2019 Novel Coronavirus: Implications For Virus Origins And Receptor Binding,ā€ Lancet 395(10224):565-574). Both segments include the same 180 amino acid long leader sequence. The polyprotein includes multiple non-structural proteins (nsp): a 638 amino acid long nsp2 protein, a 1945 amino acid long nsp3 protein, a 500 amino acid long nsp4 protein, a 306 amino acid long nsp5 protein, a 290 amino acid long nsp6 protein, an 83 amino acid long nsp7 protein, a 198 amino acid long nsp8 protein, a 113 amino acid long nsp9 single-strand binding protein, a 139 amino acid long nsp10 protein, a 923 amino acid long nsp12 RNA-dependent RNA polymerase (RdRp), a 601 amino acid long nsp13 helicase, a 527 amino acid long nsp14a2 3′→5′ exonuclease, a 346 amino acid long nsp15 endoRNAse, and a 298 amino acid long nsp16 2′-O-ribose-methyltransferase (Chen, Y, et al. (2020) ā€œEmerging Coronaviruses: Genome Structure, Replication, And Pathogenesis,ā€ J. Med. Virol. 92:418-423; Lu, R. et al. (2020) ā€œGenomic Characterisation And Epidemiology Of 2019 Novel Coronavirus: Implications For Virus Origins And Receptor Binding,ā€ Lancet 395(10224):565-574).

The sequence of the positive sense (ā€œsenseā€) strand of the ORF1ab of SARS-CoV-2 of GenBank NC_045512 (SEQ ID NO:415) is shown in Table 1.

TABLEā€ƒ1
SARS-
Theā€ƒORF1abā€ƒofā€ƒSARS-CoV-2ā€ƒ(SEQā€ƒIDā€ƒNO:ā€ƒ415) ORF1ab CoV-2
atggagagccā€ƒttgtccctggā€ƒtttcaacgagā€ƒaaaacacacgā€ƒtccaactcag 50 316
tttgcctgttā€ƒttacaggttcā€ƒgcgacgtgctā€ƒcgtacgtggcā€ƒtttggagact 100 366
ccgtggaggaā€ƒggtcttatcaā€ƒgaggcacgtcā€ƒaacatcttaaā€ƒagatggcact 150 416
tgtggcttagā€ƒtagaagttgaā€ƒaaaaggcgttā€ƒttgcctcaacā€ƒttgaacagcc 200 466
ctatgtgttcā€ƒatcaaacgttā€ƒcggatgctcgā€ƒaactgcacctā€ƒcatggtcatg 250 516
ttatggttgaā€ƒgctggtagcaā€ƒgaactcgaagā€ƒgcattcagtaā€ƒcggtcgtagt 300 566
ggtgagacacā€ƒttggtgtcctā€ƒtgtccctcatā€ƒgtgggcgaaaā€ƒtaccagtggc 350 616
ttaccgcaagā€ƒgttcttcttcā€ƒgtaagaacggā€ƒtaataaaggaā€ƒgctggtggcc 400 666
atagttacggā€ƒcgccgatctaā€ƒaagtcatttgā€ƒacttaggcgaā€ƒcgagcttggc 450 716
actgatccttā€ƒatgaagatttā€ƒtcaagaaaacā€ƒtggaacactaā€ƒaacatagcag 500 766
tggtgttaccā€ƒcgtgaactcaā€ƒtgcgtgagctā€ƒtaacggagggā€ƒgcatacactc 550 816
gctatgtcgaā€ƒtaacaacttcā€ƒtgtggccctgā€ƒatggctacccā€ƒtcttgagtgc 600 866
attaaagaccā€ƒttctagcacgā€ƒtgctggtaaaā€ƒgcttcatgcaā€ƒctttgtccga 650 916
acaactggacā€ƒtttattgacaā€ƒctaagaggggā€ƒtgtatactgcā€ƒtgccgtgaac 700 966
atgagcatgaā€ƒaattgcttggā€ƒtacacggaacā€ƒgttctgaaaaā€ƒgagctatgaa 750 1,016
ttgcagacacā€ƒcttttgaaatā€ƒtaaattggcaā€ƒaagaaatttgā€ƒacaccttcaa 800 1,066
tggggaatgtā€ƒccaaattttgā€ƒtatttcccttā€ƒaaattccataā€ƒatcaagacta 850 1,116
ttcaaccaagā€ƒggttgaaaagā€ƒaaaaagcttgā€ƒatggctttatā€ƒgggtagaatt 900 1,166
cgatctgtctā€ƒatccagttgcā€ƒgtcaccaaatā€ƒgaatgcaaccā€ƒaaatgtgcct 950 1,216
ttcaactctcā€ƒatgaagtgtgā€ƒatcattgtggā€ƒtgaaacttcaā€ƒtggcagacgg 1,000 1,266
gcgattttgtā€ƒtaaagccactā€ƒtgcgaattttā€ƒgtggcactgaā€ƒgaatttgact 1,050 1,316
aaagaaggtgā€ƒccactacttgā€ƒtggttacttaā€ƒccccaaaatgā€ƒctgttgttaa 1,100 1,366
aatttattgtā€ƒccagcatgtcā€ƒacaattcagaā€ƒagtaggacctā€ƒgagcatagtc 1,150 1,416
ttgccgaataā€ƒccataatgaaā€ƒtctggcttgaā€ƒaaaccattctā€ƒtcgtaagggt 1,200 1,466
ggtcgcactaā€ƒttgcctttggā€ƒaggctgtgtgā€ƒttctcttatgā€ƒttggttgcca 1,250 1,516
taacaagtgtā€ƒgcctattgggā€ƒttccacgtgcā€ƒtagcgctaacā€ƒataggttgta 1,300 1,566
accatacaggā€ƒtgttgttggaā€ƒgaaggttccgā€ƒaaggtcttaaā€ƒtgacaacctt 1,350 1,616
cttgaaatacā€ƒtccaaaaagaā€ƒgaaagtcaacā€ƒatcaatattgā€ƒttggtgactt 1,400 1,666
taaacttaatā€ƒgaagagatcgā€ƒccattattttā€ƒggcatcttttā€ƒtctgcttcca 1,450 1,716
caagtgctttā€ƒtgtggaaactā€ƒgtgaaaggttā€ƒtggattataaā€ƒagcattcaaa 1,500 1,766
caaattgttgā€ƒaatcctgtggā€ƒtaattttaaaā€ƒgttacaaaagā€ƒgaaaagctaa 1,550 1,816
aaaaggtgccā€ƒtggaatattgā€ƒgtgaacagaaā€ƒatcaatactgā€ƒagtcctcttt 1,600 1,866
atgcatttgcā€ƒatcagaggctā€ƒgctcgtgttgā€ƒtacgatcaatā€ƒtttctcccgc 1,650 1,916
actcttgaaaā€ƒctgctcaaaaā€ƒttctgtgcgtā€ƒgttttacagaā€ƒaggccgctat 1,700 1,966
aacaatactaā€ƒgatggaatttā€ƒcacagtattcā€ƒactgagactcā€ƒattgatgcta 1,750 2,016
tgatgttcacā€ƒatctgatttgā€ƒgctactaacaā€ƒatctagttgtā€ƒaatggcctac 1,800 2,066
attacaggtgā€ƒgtgttgttcaā€ƒgttgacttcgā€ƒcagtggctaaā€ƒctaacatctt 1,850 2,116
tggcactgttā€ƒtatgaaaaacā€ƒtcaaacccgtā€ƒccttgattggā€ƒcttgaagaga 1,900 2,166
agtttaaggaā€ƒaggtgtagagā€ƒtttcttagagā€ƒacggttgggaā€ƒaattgttaaa 1,950 2,216
tttatctcaaā€ƒcctgtgcttgā€ƒtgaaattgtcā€ƒggtggacaaaā€ƒttgtcacctg 2,000 2,266
tgcaaaggaaā€ƒattaaggagaā€ƒgtgttcagacā€ƒattctttaagā€ƒcttgtaaata 2,050 2,316
aatttttggcā€ƒtttgtgtgctā€ƒgactctatcaā€ƒttattggtggā€ƒagctaaactt 2,100 2,366
aaagccttgaā€ƒatttaggtgaā€ƒaacatttgtcā€ƒacgcactcaaā€ƒagggattgta 2,150 2,416
cagaaagtgtā€ƒgttaaatccaā€ƒgagaagaaacā€ƒtggcctactcā€ƒatgcctctaa 2,200 2,466
aagccccaaaā€ƒagaaattatcā€ƒttcttagaggā€ƒgagaaacactā€ƒtcccacagaa 2,250 2,516
gtgttaacagā€ƒaggaagttgtā€ƒcttgaaaactā€ƒggtgatttacā€ƒaaccattaga 2,300 2,566
acaacctactā€ƒagtgaagctgā€ƒttgaagctccā€ƒattggttggtā€ƒacaccagttt 2,350 2,616
gtattaacggā€ƒgcttatgttgā€ƒctcgaaatcaā€ƒaagacacagaā€ƒaaagtactgt 2,400 2,666
gcccttgcacā€ƒctaatatgatā€ƒggtaacaaacā€ƒaataccttcaā€ƒcactcaaagg 2,450 2,716
cggtgcaccaā€ƒacaaaggttaā€ƒcttttggtgaā€ƒtgacactgtgā€ƒatagaagtgc 2,500 2,766
aaggttacaaā€ƒgagtgtgaatā€ƒatcacttttgā€ƒaacttgatgaā€ƒaaggattgat 2,550 2,816
aaagtacttaā€ƒatgagaagtgā€ƒctctgcctatā€ƒacagttgaacā€ƒtcggtacaga 2,600 2,866
agtaaatgagā€ƒttcgcctgtgā€ƒttgtggcagaā€ƒtgctgtcataā€ƒaaaactttgc 2,650 2,916
aaccagtatcā€ƒtgaattacttā€ƒacaccactggā€ƒgcattgatttā€ƒagatgagtgg 2,700 2,966
agtatggctaā€ƒcatactacttā€ƒatttgatgagā€ƒtctggtgagtā€ƒttaaattggc 2,750 3,016
ttcacatatgā€ƒtattgttcttā€ƒtctaccctccā€ƒagatgaggatā€ƒgaagaagaag 2,800 3,066
gtgattgtgaā€ƒagaagaagagā€ƒtttgagccatā€ƒcaactcaataā€ƒtgagtatggt 2,850 3,116
actgaagatgā€ƒattaccaaggā€ƒtaaacctttgā€ƒgaatttggtgā€ƒccacttctgc 2,900 3,166
tgctcttcaaā€ƒcctgaagaagā€ƒagcaagaagaā€ƒagattggttaā€ƒgatgatgata 2,950 3,216
gtcaacaaacā€ƒtgttggtcaaā€ƒcaagacggcaā€ƒgtgaggacaaā€ƒtcagacaact 3,000 3,266
actattcaaaā€ƒcaattgttgaā€ƒggttcaacctā€ƒcaattagagaā€ƒtggaacttac 3,050 3,316
accagttgttā€ƒcagactattgā€ƒaagtgaatagā€ƒttttagtggtā€ƒtatttaaaac 3,100 3,366
ttactgacaaā€ƒtgtatacattā€ƒaaaaatgcagā€ƒacattgtggaā€ƒagaagctaaa 3,150 3,416
aaggtaaaacā€ƒcaacagtggtā€ƒtgttaatgcaā€ƒgccaatgtttā€ƒaccttaaaca 3,200 3,466
tggaggaggtā€ƒgttgcaggagā€ƒccttaaataaā€ƒggctactaacā€ƒaatgccatgc 3,250 3,516
aagttgaatcā€ƒtgatgattacā€ƒatagctactaā€ƒatggaccactā€ƒtaaagtgggt 3,300 3,566
ggtagttgtgā€ƒttttaagcggā€ƒacacaatcttā€ƒgctaaacactā€ƒgtcttcatgt 3,350 3,616
tgtcggcccaā€ƒaatgttaacaā€ƒaaggtgaagaā€ƒcattcaacttā€ƒcttaagagtg 3,400 3,666
cttatgaaaaā€ƒttttaatcagā€ƒcacgaagttcā€ƒtacttgcaccā€ƒattattatca 3,450 3,716
gctggtatttā€ƒttggtgctgaā€ƒccctatacatā€ƒtctttaagagā€ƒtttgtgtaga 3,500 3,766
tactgttcgcā€ƒacaaatgtctā€ƒacttagctgtā€ƒctttgataaaā€ƒaatctctatg 3,550 3,816
acaaacttgtā€ƒttcaagctttā€ƒttggaaatgaā€ƒagagtgaaaaā€ƒgcaagttgaa 3,600 3,866
caaaagatcgā€ƒctgagattccā€ƒtaaagaggaaā€ƒgttaagccatā€ƒttataactga 3,650 3,916
aagtaaacctā€ƒtcagttgaacā€ƒagagaaaacaā€ƒagatgataagā€ƒaaaatcaaag 3,700 3,966
cttgtgttgaā€ƒagaagttacaā€ƒacaactctggā€ƒaagaaactaaā€ƒgttcctcaca 3,750 4,016
gaaaacttgtā€ƒtactttatatā€ƒtgacattaatā€ƒggcaatcttcā€ƒatccagattc 3,800 4,066
tgccactcttā€ƒgttagtgacaā€ƒttgacatcacā€ƒtttcttaaagā€ƒaaagatgctc 3,850 4,116
catatatagtā€ƒgggtgatgttā€ƒgttcaagaggā€ƒgtgttttaacā€ƒtgctgtggtt 3,900 4,166
atacctactaā€ƒaaaaggctggā€ƒtggcactactā€ƒgaaatgctagā€ƒcgaaagcttt 3,950 4,216
gagaaaagtgā€ƒccaacagacaā€ƒattatataacā€ƒcacttacccgā€ƒggtcagggtt 4,000 4,266
taaatggttaā€ƒcactgtagagā€ƒgaggcaaagaā€ƒcagtgcttaaā€ƒaaagtgtaaa 4,050 4,316
agtgccttttā€ƒacattctaccā€ƒatctattatcā€ƒtctaatgagaā€ƒagcaagaaat 4,100 4,366
tcttggaactā€ƒgtttcttggaā€ƒatttgcgagaā€ƒaatgcttgcaā€ƒcatgcagaag 4,150 4,416
aaacacgcaaā€ƒattaatgcctā€ƒgtctgtgtggā€ƒaaactaaagcā€ƒcatagtttca 4,200 4,466
actatacagcā€ƒgtaaatataaā€ƒgggtattaaaā€ƒatacaagaggā€ƒgtgtggttga 4,250 4,516
ttatggtgctā€ƒagattttactā€ƒtttacaccagā€ƒtaaaacaactā€ƒgtagcgtcac 4,300 4,566
ttatcaacacā€ƒacttaacgatā€ƒctaaatgaaaā€ƒctcttgttacā€ƒaatgccactt 4,350 4,616
ggctatgtaaā€ƒcacatggcttā€ƒaaatttggaaā€ƒgaagctgctcā€ƒggtatatgag 4,400 4,666
atctctcaaaā€ƒgtgccagctaā€ƒcagtttctgtā€ƒttcttcacctā€ƒgatgctgtta 4,450 4,716
cagcgtataaā€ƒtggttatcttā€ƒacttcttcttā€ƒctaaaacaccā€ƒtgaagaacat 4,500 4,766
tttattgaaaā€ƒccatctcactā€ƒtgctggttccā€ƒtataaagattā€ƒggtcctattc 4,550 4,816
tggacaatctā€ƒacacaactagā€ƒgtatagaattā€ƒtcttaagagaā€ƒggtgataaaa 4,600 4,866
gtgtatattaā€ƒcactagtaatā€ƒcctaccacatā€ƒtccacctagaā€ƒtggtgaagtt 4,650 4,916
atcacctttgā€ƒacaatcttaaā€ƒgacacttcttā€ƒtctttgagagā€ƒaagtgaggac 4,700 4,966
tattaaggtgā€ƒtttacaacagā€ƒtagacaacatā€ƒtaacctccacā€ƒacgcaagttg 4,750 5,016
tggacatgtcā€ƒaatgacatatā€ƒggacaacagtā€ƒttggtccaacā€ƒttatttggat 4,800 5,066
ggagctgatgā€ƒttactaaaatā€ƒaaaacctcatā€ƒaattcacatgā€ƒaaggtaaaac 4,850 5,116
attttatgttā€ƒttacctaatgā€ƒatgacactctā€ƒacgtgttgagā€ƒgcttttgagt 4,900 5,166
actaccacacā€ƒaactgatcctā€ƒagttttctggā€ƒgtaggtacatā€ƒgtcagcatta 4,950 5,216
aatcacactaā€ƒaaaagtggaaā€ƒatacccacaaā€ƒgttaatggttā€ƒtaacttctat 5,000 5,266
taaatgggcaā€ƒgataacaactā€ƒgttatcttgcā€ƒcactgcattgā€ƒttaacactcc 5,050 5,316
aacaaatagaā€ƒgttgaagtttā€ƒaatccacctgā€ƒctctacaagaā€ƒtgcttattac 5,100 5,366
agagcaagggā€ƒctggtgaagcā€ƒtgctaactttā€ƒtgtgcacttaā€ƒtcttagccta 5,150 5,416
ctgtaataagā€ƒacagtaggtgā€ƒagttaggtgaā€ƒtgttagagaaā€ƒacaatgagtt 5,200 5,466
acttgtttcaā€ƒacatgccaatā€ƒttagattcttā€ƒgcaaaagagtā€ƒcttgaacgtg 5,250 5,516
gtgtgtaaaaā€ƒcttgtggacaā€ƒacagcagacaā€ƒacccttaaggā€ƒgtgtagaagc 5,300 5,566
tgttatgtacā€ƒatgggcacacā€ƒtttcttatgaā€ƒacaatttaagā€ƒaaaggtgttc 5,350 5,616
agataccttgā€ƒtacgtgtggtā€ƒaaacaagctaā€ƒcaaaatatctā€ƒagtacaacag 5,400 5,666
gagtcaccttā€ƒttgttatgatā€ƒgtcagcaccaā€ƒcctgctcagtā€ƒatgaacttaa 5,450 5,716
gcatggtacaā€ƒtttacttgtgā€ƒctagtgagtaā€ƒcactggtaatā€ƒtaccagtgtg 5,500 5,766
gtcactataaā€ƒacatataactā€ƒtctaaagaaaā€ƒctttgtattgā€ƒcatagacggt 5,550 5,816
gctttacttaā€ƒcaaagtcctcā€ƒagaatacaaaā€ƒggtcctattaā€ƒcggatgtttt 5,600 5,866
ctacaaagaaā€ƒaacagttacaā€ƒcaacaaccatā€ƒaaaaccagttā€ƒacttataaat 5,650 5,916
tggatggtgtā€ƒtgtttgtacaā€ƒgaaattgaccā€ƒctaagttggaā€ƒcaattattat 5,700 5,966
aagaaagacaā€ƒattcttatttā€ƒcacagagcaaā€ƒccaattgatcā€ƒttgtaccaaa 5,750 6,016
ccaaccatatā€ƒccaaacgcaaā€ƒgcttcgataaā€ƒttttaagtttā€ƒgtatgtgata 5,800 6,066
atatcaaattā€ƒtgctgatgatā€ƒttaaaccagtā€ƒtaactggttaā€ƒtaagaaacct 5,850 6,116
gcttcaagagā€ƒagcttaaagtā€ƒtacatttttcā€ƒcctgacttaaā€ƒatggtgatgt 5,900 6,166
ggtggctattā€ƒgattataaacā€ƒactacacaccā€ƒctcttttaagā€ƒaaaggagcta 5,950 6,216
aattgttacaā€ƒtaaacctattā€ƒgtttggcatgā€ƒttaacaatgcā€ƒaactaataaa 6,000 6,266
gccacgtataā€ƒaaccaaatacā€ƒctggtgtataā€ƒcgttgtctttā€ƒggagcacaaa 6,050 6,316
accagttgaaā€ƒacatcaaattā€ƒcgtttgatgtā€ƒactgaagtcaā€ƒgaggacgcgc 6,100 6,366
agggaatggaā€ƒtaatcttgccā€ƒtgcgaagatcā€ƒtaaaaccagtā€ƒctctgaagaa 6,150 6,416
gtagtggaaaā€ƒatcctaccatā€ƒacagaaagacā€ƒgttcttgagtā€ƒgtaatgtgaa 6,200 6,466
aactaccgaaā€ƒgttgtaggagā€ƒacattatactā€ƒtaaaccagcaā€ƒaataatagtt 6,250 6,516
taaaaattacā€ƒagaagaggttā€ƒggccacacagā€ƒatctaatggcā€ƒtgcttatgta 6,300 6,566
gacaattctaā€ƒgtcttactatā€ƒtaagaaacctā€ƒaatgaattatā€ƒctagagtatt 6,350 6,616
aggtttgaaaā€ƒacccttgctaā€ƒctcatggtttā€ƒagctgctgttā€ƒaatagtgtcc 6,400 6,666
cttgggatacā€ƒtatagctaatā€ƒtatgctaagcā€ƒcttttcttaaā€ƒcaaagttgtt 6,450 6,716
agtacaactaā€ƒctaacatagtā€ƒtacacggtgtā€ƒttaaaccgtgā€ƒtttgtactaa 6,500 6,766
ttatatgcctā€ƒtatttctttaā€ƒctttattgctā€ƒacaattgtgtā€ƒacttttacta 6,550 6,816
gaagtacaaaā€ƒttctagaattā€ƒaaagcatctaā€ƒtgccgactacā€ƒtatagcaaag 6,600 6,866
aatactgttaā€ƒagagtgtcggā€ƒtaaattttgtā€ƒctagaggcttā€ƒcatttaatta 6,650 6,916
tttgaagtcaā€ƒcctaatttttā€ƒctaaactgatā€ƒaaatattataā€ƒatttggtttt 6,700 6,966
tactattaagā€ƒtgtttgcctaā€ƒggttctttaaā€ƒtctactcaacā€ƒcgctgcttta 6,750 7,016
ggtgttttaaā€ƒtgtctaatttā€ƒaggcatgcctā€ƒtcttactgtaā€ƒctggttacag 6,800 7,066
agaaggctatā€ƒttgaactctaā€ƒctaatgtcacā€ƒtattgcaaccā€ƒtactgtactg 6,850 7,116
gttctataccā€ƒttgtagtgttā€ƒtgtcttagtgā€ƒgtttagattcā€ƒtttagacacc 6,900 7,166
tatccttcttā€ƒtagaaactatā€ƒacaaattaccā€ƒatttcatcttā€ƒttaaatggga 6,950 7,216
tttaactgctā€ƒtttggcttagā€ƒttgcagagtgā€ƒgtttttggcaā€ƒtatattcttt 7,000 7,266
tcactaggttā€ƒtttctatgtaā€ƒcttggattggā€ƒctgcaatcatā€ƒgcaattgttt 7,050 7,316
ttcagctattā€ƒttgcagtacaā€ƒttttattagtā€ƒaattcttggcā€ƒttatgtggtt 7,100 7,366
aataattaatā€ƒcttgtacaaaā€ƒtggccccgatā€ƒttcagctatgā€ƒgttagaatgt 7,150 7,416
acatcttcttā€ƒtgcatcatttā€ƒtattatgtatā€ƒggaaaagttaā€ƒtgtgcatgtt 7,200 7,466
gtagacggttā€ƒgtaattcatcā€ƒaacttgtatgā€ƒatgtgttacaā€ƒaacgtaatag 7,250 7,516
agcaacaagaā€ƒgtcgaatgtaā€ƒcaactattgtā€ƒtaatggtgttā€ƒagaaggtcct 7,300 7,566
tttatgtctaā€ƒtgctaatggaā€ƒggtaaaggctā€ƒtttgcaaactā€ƒacacaattgg 7,350 7,616
aattgtgttaā€ƒattgtgatacā€ƒattctgtgctā€ƒggtagtacatā€ƒttattagtga 7,400 7,666
tgaagttgcgā€ƒagagacttgtā€ƒcactacagttā€ƒtaaaagaccaā€ƒataaatccta 7,450 7,716
ctgaccagtcā€ƒttcttacatcā€ƒgttgatagtgā€ƒttacagtgaaā€ƒgaatggttcc 7,500 7,766
atccatctttā€ƒactttgataaā€ƒagctggtcaaā€ƒaagacttatgā€ƒaaagacattc 7,550 7,816
tctctctcatā€ƒtttgttaactā€ƒtagacaacctā€ƒgagagctaatā€ƒaacactaaag 7,600 7,866
gttcattgccā€ƒtattaatgttā€ƒatagtttttgā€ƒatggtaaatcā€ƒaaaatgtgaa 7,650 7,916
gaatcatctgā€ƒcaaaatcagcā€ƒgtctgtttacā€ƒtacagtcagcā€ƒttatgtgtca 7,700 7,966
acctatactgā€ƒttactagatcā€ƒaggcattagtā€ƒgtctgatgttā€ƒggtgatagtg 7,750 8,016
cggaagttgcā€ƒagttaaaatgā€ƒtttgatgcttā€ƒacgttaatacā€ƒgttttcatca 7,800 8,066
acttttaacgā€ƒtaccaatggaā€ƒaaaactcaaaā€ƒacactagttgā€ƒcaactgcaga 7,850 8,116
agctgaacttā€ƒgcaaagaatgā€ƒtgtccttagaā€ƒcaatgtcttaā€ƒtctactttta 7,900 8,166
tttcagcagcā€ƒtcggcaagggā€ƒtttgttgattā€ƒcagatgtagaā€ƒaactaaagat 7,950 8,216
gttgttgaatā€ƒgtcttaaattā€ƒgtcacatcaaā€ƒtctgacatagā€ƒaagttactgg 8,000 8,266
cgatagttgtā€ƒaataactataā€ƒtgctcacctaā€ƒtaacaaagttā€ƒgaaaacatga 8,050 8,316
caccccgtgaā€ƒccttggtgctā€ƒtgtattgactā€ƒgtagtgcgcgā€ƒtcatattaat 8,100 8,366
gcgcaggtagā€ƒcaaaaagtcaā€ƒcaacattgctā€ƒttgatatggaā€ƒacgttaaaga 8,150 8,416
tttcatgtcaā€ƒttgtctgaacā€ƒaactacgaaaā€ƒacaaatacgtā€ƒagtgctgcta 8,200 8,466
aaaagaataaā€ƒcttaccttttā€ƒaagttgacatā€ƒgtgcaactacā€ƒtagacaagtt 8,250 8,516
gttaatgttgā€ƒtaacaacaaaā€ƒgatagcacttā€ƒaagggtggtaā€ƒaaattgttaa 8,300 8,566
taattggttgā€ƒaagcagttaaā€ƒttaaagttacā€ƒacttgtgttcā€ƒctttttgttg 8,350 8,616
ctgctattttā€ƒctatttaataā€ƒacacctgttcā€ƒatgtcatgtcā€ƒtaaacatact 8,400 8,666
gacttttcaaā€ƒgtgaaatcatā€ƒaggatacaagā€ƒgctattgatgā€ƒgtggtgtcac 8,450 8,716
tcgtgacataā€ƒgcatctacagā€ƒatacttgtttā€ƒtgctaacaaaā€ƒcatgctgatt 8,500 8,766
ttgacacatgā€ƒgtttagccagā€ƒcgtggtggtaā€ƒgttatactaaā€ƒtgacaaagct 8,550 8,816
tgcccattgaā€ƒttgctgcagtā€ƒcataacaagaā€ƒgaagtgggttā€ƒttgtcgtgcc 8,600 8,866
tggtttgcctā€ƒggcacgatatā€ƒtacgcacaacā€ƒtaatggtgacā€ƒtttttgcatt 8,650 8,916
tcttacctagā€ƒagtttttagtā€ƒgcagttggtaā€ƒacatctgttaā€ƒcacaccatca 8,700 8,966
aaacttatagā€ƒagtacactgaā€ƒctttgcaacaā€ƒtcagcttgtgā€ƒttttggctgc 8,750 9,016
tgaatgtacaā€ƒatttttaaagā€ƒatgcttctggā€ƒtaagccagtaā€ƒccatattgtt 8,800 9,066
atgataccaaā€ƒtgtactagaaā€ƒggttctgttgā€ƒcttatgaaagā€ƒtttacgccct 8,850 9,116
gacacacgttā€ƒatgtgctcatā€ƒggatggctctā€ƒattattcaatā€ƒttcctaacac 8,900 9,166
ctaccttgaaā€ƒggttctgttaā€ƒgagtggtaacā€ƒaacttttgatā€ƒtctgagtact 8,950 9,216
gtaggcacggā€ƒcacttgtgaaā€ƒagatcagaagā€ƒctggtgtttgā€ƒtgtatctact 9,000 9,266
agtggtagatā€ƒgggtacttaaā€ƒcaatgattatā€ƒtacagatcttā€ƒtaccaggagt 9,050 9,316
tttctgtggtā€ƒgtagatgctgā€ƒtaaatttactā€ƒtactaatatgā€ƒtttacaccac 9,100 9,366
taattcaaccā€ƒtattggtgctā€ƒttggacatatā€ƒcagcatctatā€ƒagtagctggt 9,150 9,416
ggtattgtagā€ƒctatcgtagtā€ƒaacatgccttā€ƒgcctactattā€ƒttatgaggtt 9,200 9,466
tagaagagctā€ƒtttggtgaatā€ƒacagtcatgtā€ƒagttgcctttā€ƒaatactttac 9,250 9,516
tattccttatā€ƒgtcattcactā€ƒgtactctgttā€ƒtaacaccagtā€ƒttactcattc 9,300 9,566
ttacctggtgā€ƒtttattctgtā€ƒtatttacttgā€ƒtacttgacatā€ƒtttatcttac 9,350 9,616
taatgatgttā€ƒtcttttttagā€ƒcacatattcaā€ƒgtggatggttā€ƒatgttcacac 9,400 9,666
ctttagtaccā€ƒtttctggataā€ƒacaattgcttā€ƒatatcatttgā€ƒtatttccaca 9,450 9,716
aagcatttctā€ƒattggttcttā€ƒtagtaattacā€ƒctaaagagacā€ƒgtgtagtctt 9,500 9,766
taatggtgttā€ƒtcctttagtaā€ƒcttttgaagaā€ƒagctgcgctgā€ƒtgcacctttt 9,550 9,816
tgttaaataaā€ƒagaaatgtatā€ƒctaaagttgcā€ƒgtagtgatgtā€ƒgctattacct 9,600 9,866
cttacgcaatā€ƒataatagataā€ƒcttagctcttā€ƒtataataagtā€ƒacaagtattt 9,650 9,916
tagtggagcaā€ƒatggatacaaā€ƒctagctacagā€ƒagaagctgctā€ƒtgttgtcatc 9,700 9,966
tcgcaaaggcā€ƒtctcaatgacā€ƒttcagtaactā€ƒcaggttctgaā€ƒtgttctttac 9,750 10,016
caaccaccacā€ƒaaacctctatā€ƒcacctcagctā€ƒgttttgcagaā€ƒgtggttttag 9,800 10,066
aaaaatggcaā€ƒttcccatctgā€ƒgtaaagttgaā€ƒgggttgtatgā€ƒgtacaagtaa 9,850 10,116
cttgtggtacā€ƒaactacacttā€ƒaacggtctttā€ƒggcttgatgaā€ƒcgtagtttac 9,900 10,166
tgtccaagacā€ƒatgtgatctgā€ƒcacctctgaaā€ƒgacatgcttaā€ƒaccctaatta 9,950 10,216
tgaagatttaā€ƒctcattcgtaā€ƒagtctaatcaā€ƒtaatttcttgā€ƒgtacaggctg 10,000 10,266
gtaatgttcaā€ƒactcagggttā€ƒattggacattā€ƒctatgcaaaaā€ƒttgtgtactt 10,050 10,316
aagcttaaggā€ƒttgatacagcā€ƒcaatcctaagā€ƒacacctaagtā€ƒataagtttgt 10,100 10,366
tcgcattcaaā€ƒccaggacagaā€ƒctttttcagtā€ƒgttagcttgtā€ƒtacaatggtt 10,150 10,416
caccatctggā€ƒtgtttaccaaā€ƒtgtgctatgaā€ƒggcccaatttā€ƒcactattaag 10,200 10,466
ggttcattccā€ƒttaatggttcā€ƒatgtggtagtā€ƒgttggttttaā€ƒacatagatta 10,250 10,516
tgactgtgtcā€ƒtctttttgttā€ƒacatgcaccaā€ƒtatggaattaā€ƒccaactggag 10,300 10,566
ttcatgctggā€ƒcacagacttaā€ƒgaaggtaactā€ƒtttatggaccā€ƒttttgttgac 10,350 10,616
aggcaaacagā€ƒcacaagcagcā€ƒtggtacggacā€ƒacaactattaā€ƒcagttaatgt 10,400 10,666
tttagcttggā€ƒttgtacgctgā€ƒctgttataaaā€ƒtggagacaggā€ƒtggtttctca 10,450 10,716
atcgatttacā€ƒcacaactcttā€ƒaatgactttaā€ƒaccttgtggcā€ƒtatgaagtac 10,500 10,766
aattatgaacā€ƒctctaacacaā€ƒagaccatgttā€ƒgacatactagā€ƒgacctctttc 10,550 10,816
tgctcaaactā€ƒggaattgccgā€ƒttttagatatā€ƒgtgtgcttcaā€ƒttaaaagaat 10,600 10,866
tactgcaaaaā€ƒtggtatgaatā€ƒggacgtaccaā€ƒtattgggtagā€ƒtgctttatta 10,650 10,916
gaagatgaatā€ƒttacacctttā€ƒtgatgttgttā€ƒagacaatgctā€ƒcaggtgttac 10,700 10,966
tttccaaagtā€ƒgcagtgaaaaā€ƒgaacaatcaaā€ƒgggtacacacā€ƒcactggttgt 10,750 11,016
tactcacaatā€ƒtttgacttcaā€ƒcttttagtttā€ƒtagtccagagā€ƒtactcaatgg 10,800 11,066
tctttgttctā€ƒtttttttgtaā€ƒtgaaaatgccā€ƒtttttaccttā€ƒttgctatggg 10,850 11,116
tattattgctā€ƒatgtctgcttā€ƒttgcaatgatā€ƒgtttgtcaaaā€ƒcataagcatg 10,900 11,166
catttctctgā€ƒtttgtttttgā€ƒttaccttctcā€ƒttgccactgtā€ƒagcttatttt 10,950 11,216
aatatggtctā€ƒatatgcctgcā€ƒtagttgggtgā€ƒatgcgtattaā€ƒtgacatggtt 11,000 11,266
ggatatggttā€ƒgatactagttā€ƒtgtctggtttā€ƒtaagctaaaaā€ƒgactgtgtta 11,050 11,316
tgtatgcatcā€ƒagctgtagtgā€ƒttactaatccā€ƒttatgacagcā€ƒaagaactgtg 11,100 11,366
tatgatgatgā€ƒgtgctaggagā€ƒagtgtggacaā€ƒcttatgaatgā€ƒtcttgacact 11,150 11,416
cgtttataaaā€ƒgtttattatgā€ƒgtaatgctttā€ƒagatcaagccā€ƒatttccatgt 11,200 11,466
gggctcttatā€ƒaatctctgttā€ƒacttctaactā€ƒactcaggtgtā€ƒagttacaact 11,250 11,516
gtcatgttttā€ƒtggccagaggā€ƒtattgtttttā€ƒatgtgtgttgā€ƒagtattgccc 11,300 11,566
tattttcttcā€ƒataactggtaā€ƒatacacttcaā€ƒgtgtataatgā€ƒctagtttatt 11,350 11,616
gtttcttaggā€ƒctatttttgtā€ƒacttgttactā€ƒttggcctcttā€ƒttgtttactc 11,400 11,666
aaccgctactā€ƒttagactgacā€ƒtcttggtgttā€ƒtatgattactā€ƒtagtttctac 11,450 11,716
acaggagtttā€ƒagatatatgaā€ƒattcacagggā€ƒactactcccaā€ƒcccaagaata 11,500 11,766
gcatagatgcā€ƒcttcaaactcā€ƒaacattaaatā€ƒtgttgggtgtā€ƒtggtggcaaa 11,550 11,816
ccttgtatcaā€ƒaagtagccacā€ƒtgtacagtctā€ƒaaaatgtcagā€ƒatgtaaagtg 11,600 11,866
cacatcagtaā€ƒgtcttactctā€ƒcagttttgcaā€ƒacaactcagaā€ƒgtagaatcat 11,650 11,916
catctaaattā€ƒgtgggctcaaā€ƒtgtgtccagtā€ƒtacacaatgaā€ƒcattctctta 11,700 11,966
gctaaagataā€ƒctactgaagcā€ƒctttgaaaaaā€ƒatggtttcacā€ƒtactttctgt 11,750 12,016
tttgctttccā€ƒatgcagggtgā€ƒctgtagacatā€ƒaaacaagcttā€ƒtgtgaagaaa 11,800 12,066
tgctggacaaā€ƒcagggcaaccā€ƒttacaagctaā€ƒtagcctcagaā€ƒgtttagttcc 11,850 12,116
cttccatcatā€ƒatgcagctttā€ƒtgctactgctā€ƒcaagaagcttā€ƒatgagcaggc 11,900 12,166
tgttgctaatā€ƒggtgattctgā€ƒaagttgttctā€ƒtaaaaagttgā€ƒaagaagtctt 11,950 12,216
tgaatgtggcā€ƒtaaatctgaaā€ƒtttgaccgtgā€ƒatgcagccatā€ƒgcaacgtaag 12,000 12,266
ttggaaaagaā€ƒtggctgatcaā€ƒagctatgaccā€ƒcaaatgtataā€ƒaacaggctag 12,050 12,316
atctgaggacā€ƒaagagggcaaā€ƒaagttactagā€ƒtgctatgcagā€ƒacaatgcttt 12,100 12,366
tcactatgctā€ƒtagaaagttgā€ƒgataatgatgā€ƒcactcaacaaā€ƒcattatcaac 12,150 12,416
aatgcaagagā€ƒatggttgtgtā€ƒtcccttgaacā€ƒataatacctcā€ƒttacaacagc 12,200 12,466
agccaaactaā€ƒatggttgtcaā€ƒtaccagactaā€ƒtaacacatatā€ƒaaaaatacgt 12,250 12,516
gtgatggtacā€ƒaacatttactā€ƒtatgcatcagā€ƒcattgtgggaā€ƒaatccaacag 12,300 12,566
gttgtagatgā€ƒcagatagtaaā€ƒaattgttcaaā€ƒcttagtgaaaā€ƒttagtatgga 12,350 12,616
caattcacctā€ƒaatttagcatā€ƒggcctcttatā€ƒtgtaacagctā€ƒttaagggcca 12,400 12,666
attctgctgtā€ƒcaaattacagā€ƒaataatgagcā€ƒttagtcctgtā€ƒtgcactacga 12,450 12,716
cagatgtcttā€ƒgtgctgccggā€ƒtactacacaaā€ƒactgcttgcaā€ƒctgatgacaa 12,500 12,766
tgcgttagctā€ƒtactacaacaā€ƒcaacaaagggā€ƒaggtaggtttā€ƒgtacttgcac 12,550 12,816
tgttatccgaā€ƒtttacaggatā€ƒttgaaatgggā€ƒctagattcccā€ƒtaagagtgat 12,600 12,866
ggaactggtaā€ƒctatctatacā€ƒagaactggaaā€ƒccaccttgtaā€ƒggtttgttac 12,650 12,916
agacacacctā€ƒaaaggtcctaā€ƒaagtgaagtaā€ƒtttatactttā€ƒattaaaggat 12,700 12,966
taaacaacctā€ƒaaatagaggtā€ƒatggtacttgā€ƒgtagtttagcā€ƒtgccacagta 12,750 13,016
cgtctacaagā€ƒctggtaatgcā€ƒaacagaagtgā€ƒcctgccaattā€ƒcaactgtatt 12,800 13,066
atctttctgtā€ƒgcttttgctgā€ƒtagatgctgcā€ƒtaaagcttacā€ƒaaagattatc 12,850 13,116
tagctagtggā€ƒgggacaaccaā€ƒatcactaattā€ƒgtgttaagatā€ƒgttgtgtaca 12,900 13,166
cacactggtaā€ƒctggtcaggcā€ƒaataacagttā€ƒacaccggaagā€ƒccaatatgga 12,950 13,216
tcaagaatccā€ƒtttggtggtgā€ƒcatcgtgttgā€ƒtctgtactgcā€ƒcgttgccaca 13,000 13,266
tagatcatccā€ƒaaatcctaaaā€ƒggattttgtgā€ƒacttaaaaggā€ƒtaagtatgta 13,050 13,316
caaatacctaā€ƒcaacttgtgcā€ƒtaatgaccctā€ƒgtgggttttaā€ƒcacttaaaaa 13,100 13,366
cacagtctgtā€ƒaccgtctgcgā€ƒgtatgtggaaā€ƒaggttatggcā€ƒtgtagttgtg 13,150 13,416
atcaactccgā€ƒcgaacccatgā€ƒcttcagtcagā€ƒctgatgcacaā€ƒatcgttttta 13,200 13,466
aacgggtttgā€ƒcggtgtaagtā€ƒgcagcccgtcā€ƒttacaccgtgā€ƒcggcacaggc 13,250 13,516
actagtactgā€ƒatgtcgtataā€ƒcagggcttttā€ƒgacatctacaā€ƒatgataaagt 13,300 13,566
agctggttttā€ƒgctaaattccā€ƒtaaaaactaaā€ƒttgttgtcgcā€ƒttccaagaaa 13,350 13,616
aggacgaagaā€ƒtgacaatttaā€ƒattgattcttā€ƒactttgtagtā€ƒtaagagacac 13,400 13,666
actttctctaā€ƒactaccaacaā€ƒtgaagaaacaā€ƒatttataattā€ƒtacttaagga 13,450 13,716
ttgtccagctā€ƒgttgctaaacā€ƒatgacttcttā€ƒtaagtttagaā€ƒatagacggtg 13,500 13,766
acatggtaccā€ƒacatatatcaā€ƒcgtcaacgtcā€ƒttactaaataā€ƒcacaatggca 13,550 13,816
gacctcgtctā€ƒatgctttaagā€ƒgcattttgatā€ƒgaaggtaattā€ƒgtgacacatt 13,600 13,866
aaaagaaataā€ƒcttgtcacatā€ƒacaattgttgā€ƒtgatgatgatā€ƒtatttcaata 13,650 13,916
aaaaggactgā€ƒgtatgattttā€ƒgtagaaaaccā€ƒcagatatattā€ƒacgcgtatac 13,700 13,966
gccaacttagā€ƒgtgaacgtgtā€ƒacgccaagctā€ƒttgttaaaaaā€ƒcagtacaatt 13,750 14,016
ctgtgatgccā€ƒatgcgaaatgā€ƒctggtattgtā€ƒtggtgtactgā€ƒacattagata 13,800 14,066
atcaagatctā€ƒcaatggtaacā€ƒtggtatgattā€ƒtcggtgatttā€ƒcatacaaacc 13,850 14,116
acgccaggtaā€ƒgtggagttccā€ƒtgttgtagatā€ƒtcttattattā€ƒcattgttaat 13,900 14,166
gcctatattaā€ƒaccttgaccaā€ƒgggctttaacā€ƒtgcagagtcaā€ƒcatgttgaca 13,950 14,216
ctgacttaacā€ƒaaagccttacā€ƒattaagtgggā€ƒatttgttaaaā€ƒatatgacttc 14,000 14,266
acggaagagaā€ƒggttaaaactā€ƒctttgaccgtā€ƒtattttaaatā€ƒattgggatca 14,050 14,316
gacataccacā€ƒccaaattgtgā€ƒttaactgtttā€ƒggatgacagaā€ƒtgcattctgc 14,100 14,366
attgtgcaaaā€ƒctttaatgttā€ƒttattctctaā€ƒcagtgttcccā€ƒacctacaagt 14,150 14,416
tttggaccacā€ƒtagtgagaaaā€ƒaatatttgttā€ƒgatggtgttcā€ƒcatttgtagt 14,200 14,466
ttcaactggaā€ƒtaccacttcaā€ƒgagagctaggā€ƒtgttgtacatā€ƒaatcaggatg 14,250 14,516
taaacttacaā€ƒtagctctagaā€ƒcttagttttaā€ƒaggaattactā€ƒtgtgtatgct 14,300 14,566
gctgaccctgā€ƒctatgcacgcā€ƒtgcttctggtā€ƒaatctattacā€ƒtagataaacg 14,350 14,616
cactacgtgcā€ƒttttcagtagā€ƒctgcacttacā€ƒtaacaatgttā€ƒgcttttcaaa 14,400 14,666
ctgtcaaaccā€ƒcggtaattttā€ƒaacaaagactā€ƒtctatgacttā€ƒtgctgtgtct 14,450 14,716
aagggtttctā€ƒttaaggaaggā€ƒaagttctgttā€ƒgaattaaaacā€ƒacttcttctt 14,500 14,766
tgctcaggatā€ƒggtaatgctgā€ƒctatcagcgaā€ƒttatgactacā€ƒtatcgttata 14,550 14,816
atctaccaacā€ƒaatgtgtgatā€ƒatcagacaacā€ƒtactatttgtā€ƒagttgaagtt 14,600 14,866
gttgataagtā€ƒactttgattgā€ƒttacgatggtā€ƒggctgtattaā€ƒatgctaacca 14,650 14,916
agtcatcgtcā€ƒaacaacctagā€ƒacaaatcagcā€ƒtggttttccaā€ƒtttaataaat 14,700 14,966
ggggtaaggcā€ƒtagactttatā€ƒtatgattcaaā€ƒtgagttatgaā€ƒggatcaagat 14,750 15,016
gcacttttcgā€ƒcatatacaaaā€ƒacgtaatgtcā€ƒatccctactaā€ƒtaactcaaat 14,800 15,066
gaatcttaagā€ƒtatgccattaā€ƒgtgcaaagaaā€ƒtagagctcgcā€ƒaccgtagctg 14,850 15,116
gtgtctctatā€ƒctgtagtactā€ƒatgaccaataā€ƒgacagtttcaā€ƒtcaaaaatta 14,900 15,166
ttgaaatcaaā€ƒtagccgccacā€ƒtagaggagctā€ƒactgtagtaaā€ƒttggaacaag 14,950 15,216
caaattctatā€ƒggtggttggcā€ƒacaacatgttā€ƒaaaaactgttā€ƒtatagtgatg 15,000 15,266
tagaaaacccā€ƒtcaccttatgā€ƒggttgggattā€ƒatcctaaatgā€ƒtgatagagcc 15,050 15,316
atgcctaacaā€ƒtgcttagaatā€ƒtatggcctcaā€ƒcttgttcttgā€ƒctcgcaaaca 15,100 15,366
tacaacgtgtā€ƒtgtagcttgtā€ƒcacaccgtttā€ƒctatagattaā€ƒgctaatgagt 15,150 15,416
gtgctcaagtā€ƒattgagtgaaā€ƒatggtcatgtā€ƒgtggcggttcā€ƒactatatgtt 15,200 15,466
aaaccaggtgā€ƒgaacctcatcā€ƒaggagatgccā€ƒacaactgcttā€ƒatgctaatag 15,250 15,516
tgtttttaacā€ƒatttgtcaagā€ƒctgtcacggcā€ƒcaatgttaatā€ƒgcacttttat 15,300 15,566
ctactgatggā€ƒtaacaaaattā€ƒgccgataagtā€ƒatgtccgcaaā€ƒtttacaacac 15,350 15,616
agactttatgā€ƒagtgtctctaā€ƒtagaaatagaā€ƒgatgttgacaā€ƒcagactttgt 15,400 15,666
gaatgagtttā€ƒtacgcatattā€ƒtgcgtaaacaā€ƒtttctcaatgā€ƒatgatactct 15,450 15,716
ctgacgatgcā€ƒtgttgtgtgtā€ƒttcaatagcaā€ƒcttatgcatcā€ƒtcaaggtcta 15,500 15,766
gtggctagcaā€ƒtaaagaacttā€ƒtaagtcagttā€ƒctttattatcā€ƒaaaacaatgt 15,550 15,816
ttttatgtctā€ƒgaagcaaaatā€ƒgttggactgaā€ƒgactgaccttā€ƒactaaaggac 15,600 15,866
ctcatgaattā€ƒttgctctcaaā€ƒcatacaatgcā€ƒtagttaaacaā€ƒgggtgatgat 15,650 15,916
tatgtgtaccā€ƒttccttacccā€ƒagatccatcaā€ƒagaatcctagā€ƒgggccggctg 15,700 15,966
ttttgtagatā€ƒgatatcgtaaā€ƒaaacagatggā€ƒtacacttatgā€ƒattgaacggt 15,750 16,016
tcgtgtctttā€ƒagctatagatā€ƒgcttacccacā€ƒttactaaacaā€ƒtcctaatcag 15,800 16,066
gagtatgctgā€ƒatgtctttcaā€ƒtttgtacttaā€ƒcaatacataaā€ƒgaaagctaca 15,850 16,116
tgatgagttaā€ƒacaggacacaā€ƒtgttagacatā€ƒgtattctgttā€ƒatgcttacta 15,900 16,166
atgataacacā€ƒttcaaggtatā€ƒtgggaacctgā€ƒagttttatgaā€ƒggctatgtac 15,950 16,216
acaccgcataā€ƒcagtcttacaā€ƒggctgttgggā€ƒgcttgtgttcā€ƒtttgcaattc 16,000 16,266
acagacttcaā€ƒttaagatgtgā€ƒgtgcttgcatā€ƒacgtagaccaā€ƒttcttatgtt 16,050 16,316
gtaaatgctgā€ƒttacgaccatā€ƒgtcatatcaaā€ƒcatcacataaā€ƒattagtcttg 16,100 16,366
tctgttaatcā€ƒcgtatgtttgā€ƒcaatgctccaā€ƒggttgtgatgā€ƒtcacagatgt 16,150 16,416
gactcaacttā€ƒtacttaggagā€ƒgtatgagctaā€ƒttattgtaaaā€ƒtcacataaac 16,200 16,466
cacccattagā€ƒttttccattgā€ƒtgtgctaatgā€ƒgacaagttttā€ƒtggtttatat 16,250 16,516
aaaaatacatā€ƒgtgttggtagā€ƒcgataatgttā€ƒactgactttaā€ƒatgcaattgc 16,300 16,566
aacatgtgacā€ƒtggacaaatgā€ƒctggtgattaā€ƒcattttagctā€ƒaacacctgta 16,350 16,616
ctgaaagactā€ƒcaagctttttā€ƒgcagcagaaaā€ƒcgctcaaagcā€ƒtactgaggag 16,400 16,666
acatttaaacā€ƒtgtcttatggā€ƒtattgctactā€ƒgtacgtgaagā€ƒtgctgtctga 16,450 16,716
cagagaattaā€ƒcatctttcatā€ƒgggaagttggā€ƒtaaacctagaā€ƒccaccactta 16,500 16,766
accgaaattaā€ƒtgtctttactā€ƒggttatcgtgā€ƒtaactaaaaaā€ƒcagtaaagta 16,550 16,816
caaataggagā€ƒagtacaccttā€ƒtgaaaaaggtā€ƒgactatggtgā€ƒatgctgttgt 16,600 16,866
ttaccgaggtā€ƒacaacaacttā€ƒacaaattaaaā€ƒtgttggtgatā€ƒtattttgtgc 16,650 16,916
tgacatcacaā€ƒtacagtaatgā€ƒccattaagtgā€ƒcacctacactā€ƒagtgccacaa 16,700 16,966
gagcactatgā€ƒttagaattacā€ƒtggcttatacā€ƒccaacactcaā€ƒatatctcaga 16,750 17,016
tgagttttctā€ƒagcaatgttgā€ƒcaaattatcaā€ƒaaaggttggtā€ƒatgcaaaagt 16,800 17,066
attctacactā€ƒccagggaccaā€ƒcctggtactgā€ƒgtaagagtcaā€ƒttttgctatt 16,850 17,116
ggcctagctcā€ƒtctactacccā€ƒttctgctcgcā€ƒatagtgtataā€ƒcagcttgctc 16,900 17,166
tcatgccgctā€ƒgttgatgcacā€ƒtatgtgagaaā€ƒggcattaaaaā€ƒtatttgccta 16,950 17,216
tagataaatgā€ƒtagtagaattā€ƒatacctgcacā€ƒgtgctcgtgtā€ƒagagtgtttt 17,000 17,266
gataaattcaā€ƒaagtgaattcā€ƒaacattagaaā€ƒcagtatgtctā€ƒtttgtactgt 17,050 17,316
aaatgcattgā€ƒcctgagacgaā€ƒcagcagatatā€ƒagttgtctttā€ƒgatgaaattt 17,100 17,366
caatggccacā€ƒaaattatgatā€ƒttgagtgttgā€ƒtcaatgccagā€ƒattacgtgct 17,150 17,416
aagcactatgā€ƒtgtacattggā€ƒcgaccctgctā€ƒcaattacctgā€ƒcaccacgcac 17,200 17,466
attgctaactā€ƒaagggcacacā€ƒtagaaccagaā€ƒatatttcaatā€ƒtcagtgtgta 17,250 17,516
gacttatgaaā€ƒaactataggtā€ƒccagacatgtā€ƒtcctcggaacā€ƒttgtcggcgt 17,300 17,566
tgtcctgctgā€ƒaaattgttgaā€ƒcactgtgagtā€ƒgctttggtttā€ƒatgataataa 17,350 17,616
gcttaaagcaā€ƒcataaagacaā€ƒaatcagctcaā€ƒatgctttaaaā€ƒatgttttata 17,400 17,666
agggtgttatā€ƒcacgcatgatā€ƒgtttcatctgā€ƒcaattaacagā€ƒgccacaaata 17,450 17,716
ggcgtggtaaā€ƒgagaattcctā€ƒtacacgtaacā€ƒcctgcttggaā€ƒgaaaagctgt 17,500 17,766
ctttatttcaā€ƒccttataattā€ƒcacagaatgcā€ƒtgtagcctcaā€ƒaagattttgg 17,550 17,816
gactaccaacā€ƒtcaaactgttā€ƒgattcatcacā€ƒagggctcagaā€ƒatatgactat 17,600 17,866
gtcatattcaā€ƒctcaaaccacā€ƒtgaaacagctā€ƒcactcttgtaā€ƒatgtaaacag 17,650 17,916
atttaatgttā€ƒgctattaccaā€ƒgagcaaaagtā€ƒaggcatacttā€ƒtgcataatgt 17,700 17,966
ctgatagagaā€ƒcctttatgacā€ƒaagttgcaatā€ƒttacaagtctā€ƒtgaaattcca 17,750 18,016
cgtaggaatgā€ƒtggcaactttā€ƒacaagctgaaā€ƒaatgtaacagā€ƒgactctttaa 17,800 18,066
agattgtagtā€ƒaaggtaatcaā€ƒctgggttacaā€ƒtcctacacagā€ƒgcacctacac 17,850 18,116
acctcagtgtā€ƒtgacactaaaā€ƒttcaaaactgā€ƒaaggtttatgā€ƒtgttgacata 17,900 18,166
cctggcatacā€ƒctaaggacatā€ƒgacctatagaā€ƒagactcatctā€ƒctatgatggg 17,950 18,216
ttttaaaatgā€ƒaattatcaagā€ƒttaatggttaā€ƒccctaacatgā€ƒtttatcaccc 18,000 18,266
gcgaagaagcā€ƒtataagacatā€ƒgtacgtgcatā€ƒggattggcttā€ƒcgatgtcgag 18,050 18,316
gggtgtcatgā€ƒctactagagaā€ƒagctgttggtā€ƒaccaatttacā€ƒctttacagct 18,100 18,366
aggtttttctā€ƒacaggtgttaā€ƒacctagttgcā€ƒtgtacctacaā€ƒggttatgttg 18,150 18,416
atacacctaaā€ƒtaatacagatā€ƒttttccagagā€ƒttagtgctaaā€ƒaccaccgcct 18,200 18,466
ggagatcaatā€ƒttaaacacctā€ƒcataccacttā€ƒatgtacaaagā€ƒgacttccttg 18,250 18,516
gaatgtagtgā€ƒcgtataaagaā€ƒttgtacaaatā€ƒgttaagtgacā€ƒacacttaaaa 18,300 18,566
atctctctgaā€ƒcagagtcgtaā€ƒtttgtcttatā€ƒgggcacatggā€ƒctttgagttg 18,350 18,616
acatctatgaā€ƒagtattttgtā€ƒgaaaataggaā€ƒcctgagcgcaā€ƒcctgttgtct 18,400 18,666
atgtgatagaā€ƒcgtgccacatā€ƒgcttttccacā€ƒtgcttcagacā€ƒacttatgcct 18,450 18,716
gttggcatcaā€ƒttctattggaā€ƒtttgattacgā€ƒtctataatccā€ƒgtttatgatt 18,500 18,766
gatgttcaacā€ƒaatggggtttā€ƒtacaggtaacā€ƒctacaaagcaā€ƒaccatgatct 18,550 18,816
gtattgtcaaā€ƒgtccatggtaā€ƒatgcacatgtā€ƒagctagttgtā€ƒgatgcaatca 18,600 18,866
tgactaggtgā€ƒtctagctgtcā€ƒcacgagtgctā€ƒttgttaagcgā€ƒtgttgactgg 18,650 18,916
actattgaatā€ƒatcctataatā€ƒtggtgatgaaā€ƒctgaagattaā€ƒatgcggcttg 18,700 18,966
tagaaaggttā€ƒcaacacatggā€ƒttgttaaagcā€ƒtgcattattaā€ƒgcagacaaat 18,750 19,016
tcccagttctā€ƒtcacgacattā€ƒggtaaccctaā€ƒaagctattaaā€ƒgtgtgtacct 18,800 19,066
caagctgatgā€ƒtagaatggaaā€ƒgttctatgatā€ƒgcacagccttā€ƒgtagtgacaa 18,850 19,116
agcttataaaā€ƒatagaagaatā€ƒtattctattcā€ƒttatgccacaā€ƒcattctgaca 18,900 19,166
aattcacagaā€ƒtggtgtatgcā€ƒctattttggaā€ƒattgcaatgtā€ƒcgatagatat 18,950 19,216
cctgctaattā€ƒccattgtttgā€ƒtagatttgacā€ƒactagagtgcā€ƒtatctaacct 19,000 19,266
taacttgcctā€ƒggttgtgatgā€ƒgtggcagtttā€ƒgtatgtaaatā€ƒaaacatgcat 19,050 19,316
tccacacaccā€ƒagcttttgatā€ƒaaaagtgcttā€ƒttgttaatttā€ƒaaaacaatta 19,100 19,366
ccatttttctā€ƒattactctgaā€ƒcagtccatgtā€ƒgagtctcatgā€ƒgaaaacaagt 19,150 19,416
agtgtcagatā€ƒatagattatgā€ƒtaccactaaaā€ƒgtctgctacgā€ƒtgtataacac 19,200 19,466
gttgcaatttā€ƒaggtggtgctā€ƒgtctgtagacā€ƒatcatgctaaā€ƒtgagtacaga 19,250 19,516
ttgtatctcgā€ƒatgcttataaā€ƒcatgatgatcā€ƒtcagctggctā€ƒttagcttgtg 19,300 19,566
ggtttacaaaā€ƒcaatttgataā€ƒcttataacctā€ƒctggaacactā€ƒtttacaagac 19,350 19,616
ttcagagtttā€ƒagaaaatgtgā€ƒgcttttaatgā€ƒttgtaaataaā€ƒgggacacttt 19,400 19,666
gatggacaacā€ƒagggtgaagtā€ƒaccagtttctā€ƒatcattaataā€ƒacactgttta 19,450 19,716
cacaaaagttā€ƒgatggtgttgā€ƒatgtagaattā€ƒgtttgaaaatā€ƒaaaacaacat 19,500 19,766
tacctgttaaā€ƒtgtagcatttā€ƒgagctttgggā€ƒctaagcgcaaā€ƒcattaaacca 19,550 19,816
gtaccagaggā€ƒtgaaaatactā€ƒcaataatttgā€ƒggtgtggacaā€ƒttgctgctaa 19,600 19,866
tactgtgatcā€ƒtgggactacaā€ƒaaagagatgcā€ƒtccagcacatā€ƒatatctacta 19,650 19,916
ttggtgtttgā€ƒttctatgactā€ƒgacatagccaā€ƒagaaaccaacā€ƒtgaaacgatt 19,700 19,966
tgtgcaccacā€ƒtcactgtcttā€ƒttttgatggtā€ƒagagttgatgā€ƒgtcaagtaga 19,750 20,016
cttatttagaā€ƒaatgcccgtaā€ƒatggtgttctā€ƒtattacagaaā€ƒggtagtgtta 19,800 20,066
aaggtttacaā€ƒaccatctgtaā€ƒggtcccaaacā€ƒaagctagtctā€ƒtaatggagtc 19,850 20,116
acattaattgā€ƒgagaagccgtā€ƒaaaaacacagā€ƒttcaattattā€ƒataagaaagt 19,900 20,166
tgatggtgttā€ƒgtccaacaatā€ƒtacctgaaacā€ƒttactttactā€ƒcagagtagaa 19,950 20,216
atttacaagaā€ƒatttaaacccā€ƒaggagtcaaaā€ƒtggaaattgaā€ƒtttcttagaa 20,000 20,266
ttagctatggā€ƒatgaattcatā€ƒtgaacggtatā€ƒaaattagaagā€ƒgctatgcctt 20,050 20,316
cgaacatatcā€ƒgtttatggagā€ƒattttagtcaā€ƒtagtcagttaā€ƒggtggtttac 20,100 20,366
atctactgatā€ƒtggactagctā€ƒaaacgttttaā€ƒaggaatcaccā€ƒttttgaatta 20,150 20,416
gaagattttaā€ƒttcctatggaā€ƒcagtacagttā€ƒaaaaactattā€ƒtcataacaga 20,200 20,466
tgcgcaaacaā€ƒggttcatctaā€ƒagtgtgtgtgā€ƒttctgttattā€ƒgatttattac 20,250 20,516
ttgatgatttā€ƒtgttgaaataā€ƒataaaatcccā€ƒaagatttatcā€ƒtgtagtttct 20,300 20,566
aaggttgtcaā€ƒaagtgactatā€ƒtgactatacaā€ƒgaaatttcatā€ƒttatgctttg 20,350 20,616
gtgtaaagatā€ƒggccatgtagā€ƒaaacattttaā€ƒcccaaaattaā€ƒcaatctagtc 20,400 20,666
aagcgtggcaā€ƒaccgggtgttā€ƒgctatgcctaā€ƒatctttacaaā€ƒaatgcaaaga 20,450 20,716
atgctattagā€ƒaaaagtgtgaā€ƒccttcaaaatā€ƒtatggtgataā€ƒgtgcaacatt 20,500 20,766
acctaaaggcā€ƒataatgatgaā€ƒatgtcgcaaaā€ƒatatactcaaā€ƒctgtgtcaat 20,550 20,816
atttaaacacā€ƒattaacattaā€ƒgctgtaccctā€ƒataatatgagā€ƒagttatacat 20,600 20,866
tttggtgctgā€ƒgttctgataaā€ƒaggagttgcaā€ƒccaggtacagā€ƒctgttttaag 20,650 20,916
acagtggttgā€ƒcctacgggtaā€ƒcgctgcttgtā€ƒcgattcagatā€ƒcttaatgact 20,700 20,966
ttgtctctgaā€ƒtgcagattcaā€ƒactttgattgā€ƒgtgattgtgcā€ƒaactgtacat 20,750 21,016
acagctaataā€ƒaatgggatctā€ƒcattattagtā€ƒgatatgtacgā€ƒaccctaagac 20,800 21,066
taaaaatgttā€ƒacaaaagaaaā€ƒatgactctaaā€ƒagagggttttā€ƒttcacttaca 20,850 21,116
tttgtgggttā€ƒtatacaacaaā€ƒaagctagctcā€ƒttggaggttcā€ƒcgtggctata 20,900 21,166
aagataacagā€ƒaacattcttgā€ƒgaatgctgatā€ƒctttataagcā€ƒtcatgggaca 20,950 21,216
cttcgcatggā€ƒtggacagcctā€ƒttgttactaaā€ƒtgtgaatgcgā€ƒtcatcatctg 21,000 21,266
aagcatttttā€ƒaattggatgtā€ƒaattatcttgā€ƒgcaaaccacgā€ƒcgaacaaata 21,050 21,316
gatggttatgā€ƒtcatgcatgcā€ƒaaattacataā€ƒttttggaggaā€ƒatacaaatcc 21,100 21,366
aattcagttgā€ƒtcttcctattā€ƒctttatttgaā€ƒcatgagtaaaā€ƒtttcccctta 21,150 21,416
aattaaggggā€ƒtactgctgttā€ƒatgtctttaaā€ƒaagaaggtcaā€ƒaatcaatgat 21,200 21,466
atgattttatā€ƒctcttcttagā€ƒtaaaggtagaā€ƒcttataattaā€ƒgagaaaacaa 21,250 21,516
cagagttgttā€ƒatttctagtgā€ƒatgttcttgtā€ƒtaacaactaa 21,290 21,556

B. The S Gene

The S gene encodes the SARS-CoV-2 spike protein. The S protein of SARS-CoV is functionally cleaved into two subunits: the S1 domain and the S2 domain (He, Y. et al. (2004) ā€œReceptor-Binding Domain Of SARS-CoV Spike Protein Induces Highly Potent Neutralizing Antibodies: Implication For Developing Subunit Vaccine,ā€ Biochem. Biophys. Res. Commun. 324:773-781). The SARS-CoV S1 domain mediates receptor binding, while the SARS-CoV S2 domain mediates membrane fusion (Li, F. (2016) ā€œStructure, Function, And Evolution Of Coronavirus Spike Proteins,ā€ Annu. Rev. Virol. 3:237-261; He, Y. et al. (2004) ā€œReceptor-Binding Domain Of SARS-CoV Spike Protein Induces Highly Potent Neutralizing Antibodies: Implication For Developing Subunit Vaccine, Biochem. Biophys. Res. Commun. 324:773-781). The S gene of SARS-CoV-2 may have a similar function. Thus, the spike protein of coronaviruses is considered crucial for determining host tropism and transmission capacity (Lu, G. et al. (2015) ā€œBat-To-Human: Spike Features Determining ā€˜Host Jump’ Of Coronaviruses SARS-CoV, MERS-CoV, And Beyond,ā€ Trends Microbiol. 23:468-478; Wang, Q. et al. (2016) ā€œMERS-CoV Spike Protein: Targets For Vaccines And Therapeutics,ā€ Antiviral. Res. 133:165-177). In this regard, the S2 domain of the SARS-CoV-2 spike protein shows high sequence identity (93%) with bat-SL-CoVZC45 and bat-SL-CoVZXC21, but the SARS-CoV-2 S1 domain shows a much lower degree of identity (68%) with these bat-derived viruses (Lu, R. et al. (2020) ā€œGenomic Characterisation And Epidemiology Of 2019 Novel Coronavirus: Implications For Virus Origins And Receptor Binding,ā€ Lancet 395(10224):565-574). Thus, SARS-CoV-2 may bind to a different receptor than that bound by its related bat-derived viruses. It has been proposed that SARS-CoV-2 may bind to the angiotensin-converting enzyme 2 (ACE2) as a cell receptor (Lu, R. et al. (2020) ā€œGenomic Characterisation And Epidemiology Of 2019 Novel Coronavirus: Implications For Virus Origins And Receptor Binding,ā€ Lancet 395(10224):565-574).

The sequence of the positive sense (ā€œsenseā€) strand of the S Gene of SARS-CoV-2 of GenBank NC_045512 (SEQ ID NO:16) is shown in Table 2.

TABLEā€ƒ2
S SAS-
Theā€ƒSā€ƒGeneā€ƒofā€ƒSARS-CoV-2ā€ƒ(SEQā€ƒIDā€ƒNO:ā€ƒ16) Gene CoV-2
atgtttgtttā€ƒttcttgttttā€ƒattgccactaā€ƒgtctctagtcā€ƒagtgtgttaa 50 21,612
tcttacaaccā€ƒagaactcaatā€ƒtaccccctgcā€ƒatacactaatā€ƒtctttcacac 100 21,662
gtggtgtttaā€ƒttaccctgacā€ƒaaagttttcaā€ƒgatcctcagtā€ƒtttacattca 150 21,712
actcaggactā€ƒtgttcttaccā€ƒtttcttttccā€ƒaatgttacttā€ƒggttccatgc 200 21,762
tatacatgtcā€ƒtctgggaccaā€ƒatggtactaaā€ƒgaggtttgatā€ƒaaccctgtcc 250 21,812
taccatttaaā€ƒtgatggtgttā€ƒtattttgcttā€ƒccactgagaaā€ƒgtctaacata 300 21,862
ataagaggctā€ƒggatttttggā€ƒtactactttaā€ƒgattcgaagaā€ƒcccagtccct 350 21,912
acttattgttā€ƒaataacgctaā€ƒctaatgttgtā€ƒtattaaagtcā€ƒtgtgaatttc 400 21,962
aattttgtaaā€ƒtgatccatttā€ƒttgggtgtttā€ƒattaccacaaā€ƒaaacaacaaa 450 22,012
agttggatggā€ƒaaagtgagttā€ƒcagagtttatā€ƒtctagtgcgaā€ƒataattgcac 500 22,062
ttttgaatatā€ƒgtctctcagcā€ƒcttttcttatā€ƒggaccttgaaā€ƒggaaaacagg 550 22,112
gtaatttcaaā€ƒaaatcttaggā€ƒgaatttgtgtā€ƒttaagaatatā€ƒtgatggttat 600 22,162
tttaaaatatā€ƒattctaagcaā€ƒcacgcctattā€ƒaatttagtgcā€ƒgtgatctccc 650 22,212
tcagggttttā€ƒtcggctttagā€ƒaaccattggtā€ƒagatttgccaā€ƒataggtatta 700 22,262
acatcactagā€ƒgtttcaaactā€ƒttacttgcttā€ƒtacatagaagā€ƒttatttgact 750 22,312
cctggtgattā€ƒcttcttcaggā€ƒttggacagctā€ƒggtgctgcagā€ƒcttattatgt 800 22,362
gggttatcttā€ƒcaacctaggaā€ƒcttttctattā€ƒaaaatataatā€ƒgaaaatggaa 850 22,412
ccattacagaā€ƒtgctgtagacā€ƒtgtgcacttgā€ƒaccctctctcā€ƒagaaacaaag 900 22,462
tgtacgttgaā€ƒaatccttcacā€ƒtgtagaaaaaā€ƒggaatctatcā€ƒaaacttctaa 950 22,512
ctttagagtcā€ƒcaaccaacagā€ƒaatctattgtā€ƒtagatttcctā€ƒaatattacaa 1,000 22,562
acttgtgcccā€ƒttttggtgaaā€ƒgtttttaacgā€ƒccaccagattā€ƒtgcatctgtt 1,050 22,612
tatgcttggaā€ƒacaggaagagā€ƒaatcagcaacā€ƒtgtgttgctgā€ƒattattctgt 1,100 22,662
cctatataatā€ƒtccgcatcatā€ƒtttccactttā€ƒtaagtgttatā€ƒggagtgtctc 1,150 22,712
ctactaaattā€ƒaaatgatctcā€ƒtgctttactaā€ƒatgtctatgcā€ƒagattcattt 1,200 22,762
gtaattagagā€ƒgtgatgaagtā€ƒcagacaaatcā€ƒgctccagggcā€ƒaaactggaaa 1,250 22,812
gattgctgatā€ƒtataattataā€ƒaattaccagaā€ƒtgattttacaā€ƒggctgcgtta 1,300 22,862
tagcttggaaā€ƒttctaacaatā€ƒcttgattctaā€ƒaggttggtggā€ƒtaattataat 1,350 22,912
tacctgtataā€ƒgattgtttagā€ƒgaagtctaatā€ƒctcaaaccttā€ƒttgagagaga 1,400 22,962
tatttcaactā€ƒgaaatctatcā€ƒaggccggtagā€ƒcacaccttgtā€ƒaatggtgttg 1,450 23,012
aaggttttaaā€ƒttgttactttā€ƒcctttacaatā€ƒcatatggtttā€ƒccaacccact 1,500 23,062
aatggtgttgā€ƒgttaccaaccā€ƒatacagagtaā€ƒgtagtactttā€ƒcttttgaact 1,550 23,112
tctacatgcaā€ƒccagcaactgā€ƒtttgtggaccā€ƒtaaaaagtctā€ƒactaatttgg 1,600 23,162
ttaaaaacaaā€ƒatgtgtcaatā€ƒttcaacttcaā€ƒatggtttaacā€ƒaggcacaggt 1,650 23,212
gttcttactgā€ƒagtctaacaaā€ƒaaagtttctgā€ƒcctttccaacā€ƒaatttggcag 1,700 23,262
agacattgctā€ƒgacactactgā€ƒatgctgtccgā€ƒtgatccacagā€ƒacacttgaga 1,750 23,312
ttcttgacatā€ƒtacaccatgtā€ƒtcttttggtgā€ƒgtgtcagtgtā€ƒtataacacca 1,800 23,362
ggaacaaataā€ƒcttctaaccaā€ƒggttgctgttā€ƒctttatcaggā€ƒatgttaactg 1,850 23,412
cacagaagtcā€ƒcctgttgctaā€ƒttcatgcagaā€ƒtcaacttactā€ƒcctacttggc 1,900 23,462
gtgtttattcā€ƒtacaggttctā€ƒaatgtttttcā€ƒaaacacgtgcā€ƒaggctgttta 1,950 23,512
ataggggctgā€ƒaacatgtcaaā€ƒcaactcatatā€ƒgagtgtgacaā€ƒtacccattgg 2,000 23,562
tgcaggtataā€ƒtgcgctagttā€ƒatcagactcaā€ƒgactaattctā€ƒcctcggcggg 2,050 23,612
cacgtagtgtā€ƒagctagtcaaā€ƒtccatcattgā€ƒcctacactatā€ƒgtcacttggt 2,100 23,662
gcagaaaattā€ƒcagttgcttaā€ƒctctaataacā€ƒtctattgccaā€ƒtacccacaaa 2,150 23,712
ttttactattā€ƒagtgttaccaā€ƒcagaaattctā€ƒaccagtgtctā€ƒatgaccaaga 2,200 23,762
catcagtagaā€ƒttgtacaatgā€ƒtacatttgtgā€ƒgtgattcaacā€ƒtgaatgcagc 2,250 23,812
aatcttttgtā€ƒtgcaatatggā€ƒcagtttttgtā€ƒacacaattaaā€ƒaccgtgcttt 2,300 23,862
aactggaataā€ƒgctgttgaacā€ƒaagacaaaaaā€ƒcacccaagaaā€ƒgtttttgcac 2,350 23,912
aagtcaaacaā€ƒaatttacaaaā€ƒacaccaccaaā€ƒttaaagatttā€ƒtggtggtttt 2,400 23,962
aatttttcacā€ƒaaatattaccā€ƒagatccatcaā€ƒaaaccaagcaā€ƒagaggtcatt 2,450 24,012
tattgaagatā€ƒctacttttcaā€ƒacaaagtgacā€ƒacttgcagatā€ƒgctggcttca 2,500 24,062
tcaaacaataā€ƒtggtgattgcā€ƒcttggtgataā€ƒttgctgctagā€ƒagacctcatt 2,550 24,112
tgtgcacaaaā€ƒagtttaacggā€ƒccttactgttā€ƒttgccaccttā€ƒtgctcacaga 2,600 24,162
tgaaatgattā€ƒgctcaatacaā€ƒcttctgcactā€ƒgttagcgggtā€ƒacaatcactt 2,650 24,212
ctggttggacā€ƒctttggtgcaā€ƒggtgctgcatā€ƒtacaaataccā€ƒatttgctatg 2,700 24,262
caaatggcttā€ƒataggtttaaā€ƒtggtattggaā€ƒgttacacagaā€ƒatgttctcta 2,750 24,312
tgagaaccaaā€ƒaaattgattgā€ƒccaaccaattā€ƒtaatagtgctā€ƒattggcaaaa 2,800 24,362
ttcaagactcā€ƒactttcttccā€ƒacagcaagtgā€ƒcacttggaaaā€ƒacttcaagat 2,850 24,412
gtggtcaaccā€ƒaaaatgcacaā€ƒagctttaaacā€ƒacgcttgttaā€ƒaacaacttag 2,900 24,462
ctccaattttā€ƒggtgcaatttā€ƒcaagtgttttā€ƒaaatgatatcā€ƒctttcacgtc 2,950 24,512
ttgacaaagtā€ƒtgaggctgaaā€ƒgtgcaaattgā€ƒataggttgatā€ƒcacaggcaga 3,000 24,562
cttcaaagttā€ƒtgcagacataā€ƒtgtgactcaaā€ƒcaattaattaā€ƒgagctgcaga 3,050 24,612
aatcagagctā€ƒtctgctaatcā€ƒttgctgctacā€ƒtaaaatgtcaā€ƒgagtgtgtac 3,100 24,662
ttggacaatcā€ƒaaaaagagttā€ƒgatttttgtgā€ƒgaaagggctaā€ƒtcatcttatg 3,150 24,712
tccttccctcā€ƒagtcagcaccā€ƒtcatggtgtaā€ƒgtcttcttgcā€ƒatgtgactta 3,200 24,762
tgtccctgcaā€ƒcaagaaaagaā€ƒacttcacaacā€ƒtgctcctgccā€ƒatttgtcatg 3,250 24,812
atggaaaagcā€ƒacactttcctā€ƒcgtgaaggtgā€ƒtctttgtttcā€ƒaaatggcaca 3,300 24,862
cactggtttgā€ƒtaacacaaagā€ƒgaatttttatā€ƒgaaccacaaaā€ƒtcattactac 3,350 24,912
agacaacacaā€ƒtttgtgtctgā€ƒgtaactgtgaā€ƒtgttgtaataā€ƒggaattgtca 3,400 24,962
acaacacagtā€ƒttatgatcctā€ƒttgcaacctgā€ƒaattagactcā€ƒattcaaggag 3,450 25,012
gagttagataā€ƒaatattttaaā€ƒgaatcatacaā€ƒtcaccagatgā€ƒttgatttagg 3,500 25,062
tgacatctctā€ƒggcattaatgā€ƒcttcagttgtā€ƒaaacattcaaā€ƒaaagaaattg 3,550 25,112
accgcctcaaā€ƒtgaggttgccā€ƒaagaatttaaā€ƒatgaatctctā€ƒcatcgatctc 3,600 25,162
caagaacttgā€ƒgaaagtatgaā€ƒgcagtatataā€ƒaaatggccatā€ƒggtacatttg 3,650 25,212
gctaggttttā€ƒatagctggctā€ƒtgattgccatā€ƒagtaatggtgā€ƒacaattatgc 3,700 25,262
tttgctgtatā€ƒgaccagttgcā€ƒtgtagttgtcā€ƒtcaagggctgā€ƒttgttcttgt 3,750 25,312
ggatcctgctā€ƒgcaaatttgaā€ƒtgaagacgacā€ƒtctgagccagā€ƒtgctcaaagg 3,800 25,362
agtcaaattaā€ƒcattacaca 3,819 25,381

II. Assays for the Detection of SARS-CoV-2

SARS-CoV-2 was first identified in late 2019, and is believed to be a unique virus that had not previously existed. The first diagnostic test for SARS-CoV-2 used a real-time reverse transcription-PCR (rRT-PCR) assay that employed probes and primers of the SARS-CoV-2 E, N and nsp12 (RNA-dependent RNA polymerase; RdRp) genes (the ā€œSARS-CoV-2-RdRp-P2ā€ assay) (Corman, V. M. et al. (2020) ā€œDetection Of 2019 Novel Coronavirus (2019-nCoV) By Real-Time RT-PCR,ā€ Eurosurveill. 25(3):2000045; Spiteri, G. et al. (2020) ā€œFirst Cases Of Coronavirus Disease 2019 (COVID-19) In The WHO European Region, 24 January To 21 February 2020,ā€ Eurosurveill. 25(9) doi: 10.2807/1560-7917.ES.2020.25.9.2000178).

The probes employed in such assays were ā€œTaqManā€ oligonucleotide probes that were labeled with a fluorophore on the oligonucleotide's 5′ terminus and complexed to a quencher on the oligonucleotide's 3′ terminus. The ā€œTaqManā€ probe principle relies on the 5′-3′-exonuclease activity of Taq polymerase (Peake, I. (1989) ā€œThe Polymerase Chain Reaction,ā€ J. Clin. Pathol.; 42(7):673-676) to cleave the dual-labeled probe when it has hybridized to a complementary target sequence. The cleavage of the molecule separates the fluorophore from the quencher and thus leads to the production of a detectable fluorescent signal.

In the SARS-CoV-2-RdRp-P2 assay of Corman, V. M. et al. (2020), the RdRp Probe 2 and the probes of the E and N genes are described as being specific for SARS-CoV-2, whereas the RdRp Probe 2 is described as being a ā€œPanSarbeco-Probeā€ that detects SARS-CoV and bat-SARS-related coronaviruses in addition to SARS-CoV-2. The assay is stated to have provided its best results using the E gene and nsp12 (RdRp) gene primers and probes (5.2 and 3.8 copies per 25 μL reaction at 95% detection probability, respectively). The resulting limit of detection (LoD) from replicate tests was 3.9 copies per 25 μL reaction (156 copies/mL) for the E gene assay and 3.6 copies per 25 μL reaction (144 copies/mL) for the nsp12 (RdRp) assay. The assay was reported to be specific for SARS-CoV-2 and to require less than 60 minutes to complete.

The US Center for Disease Control and Prevention (CDC) developed an rRT-PCR based assay protocol that targeted the SARS-CoV-2 N gene (Won, J. et al. (2020) ā€œDevelopment Of A Laboratory-Safe And Low-Cost Detection Protocol For SARS-CoV-2 Of The Coronavirus Disease 2019 (COVID-19),ā€ Exp. Neurobiol. 29(2) doi: 10.5607/en20009).

Pfefferle, S. et al. (2020) (ā€œEvaluation Of A Quantitative RT-PCR Assay For The Detection Of The Emerging Coronavirus SARS-CoV-2 Using A High Throughput System,ā€ Eurosurveill. 25(9) doi: 10.2807/1560-7917.ES.2020.25.9.2000152) discloses the use of a custom-made primer/probe set targeting the E gene. The employed primers were modified with 2′-O-methyl bases in their penultimate base to prevent formation of primer dimers. ZEN double-quenched probe (IDT) were used to lower background fluorescence. The LoD was 689.3 copies/mL with 275.72 copies per reaction at 95% detection probability. The assay was reported to be specific for SARS-CoV-2 and to require less than 60 minutes.

Chan, J. F. et al. (2020) (ā€œImproved Molecular Diagnosis Of COVID-19 By The Novel, Highly Sensitive And Specific COVID-19-RdRp/Hel Real-Time Reverse Transcription-Polymerase Chain Reaction Assay Validated In Vitro And With Clinical Specimens,ā€ J. Clin. Microbiol. JCM.00310-20. doi: 10.1128/JCM.00310-20) explored the use of conserved and/or abundantly expressed SARS-CoV-2 genes as preferred targets of coronavirus RT-PCR assays. Such genes include the structural S and N genes, and the non-structural RdRp gene and ORF1ab. Chan, J. F. et al. (2020) describes the development of three real-time reverse transcriptase PCR (rRT-PCR) assays targeting the RNA-dependent RNA polymerase (RdRp)/helicase (Hel), spike (S), and nucleocapsid (N) genes of SARS-CoV-2 and compares such assays to the RdRp-P2 assay of Corman, V. M. et al. The LoD of the SARS-CoV-2-RdRp/Hel assay, the SARS-CoV-2-S assay, and the SARS-CoV-2-N assay was 1.8 TCID50/ml, while the LoD of the SARS-CoV-2-RdRp-P2 assay was 18 TCID50/ml. The TCID50 is the median tissue culture infectious dose.

An rt-PCR-based assay protocol targeting the E, N, S and RdRp genes was designed for specimen self-collection from a subject via pharyngeal swab. The assay required Trizol-based RNA purification, and detection was accomplished via an RT-PCR assay using SYBR Green as a detection fluor. The assay was reported to require approximately 4 hours to complete (Won, J. et al. (2020) (ā€œDevelopment Of A Laboratory-Safe And Low-Cost Detection Protocol For SARS-CoV-2 Of The Coronavirus Disease 2019 (COVID-19),ā€ Exp. Neurobiol. 29(2) doi: 10.5607/en20009).

Although prior rRT-PCR assays, such as the SARS-CoV-2-RdRp-P2 assay of Corman V. M. et al., are capable of detecting SARS-CoV-2, researchers have found them to suffer from major deficiencies. In use, such prior assays have been found to require laborious batch-wise manual processing and to not permit random access to individual samples (Cordes, A. K. et al. (2020) ā€œRapid Random Access Detection Of The Novel SARS-Coronavirus-2 (SARS-CoV-2, Previously 2019-nCoV) Using An Open Access Protocol For The Panther Fusion,ā€ J. Clin. Virol. 125:104305 doi: 10.1016/j.jcv.2020.104305). Additionally, long turnaround times and complicated operations are required. These factors cause such assays to generally take more than 2-3 hours to generate results. Due to such factors, certified laboratories are required to process such assays. The need for expensive equipment and trained technicians to perform such prior rRT-PCR assays encumbers the use of such assays in the field or at mobile locations. Thus, researchers have found such prior assays to have limited suitability for use in the rapid and simple diagnosis and screening of patients required to contain an outbreak (Li, Z. et al. (2020) ā€œDevelopment and Clinical Application of A Rapid IgM-IgG Combined Antibody Test for SARS-CoV-2 Infection Diagnosis,ā€ J. Med. Virol. doi: 10.1002/jmv.25727).

More significantly, prior rRT-PCR assays, such as the SARS-CoV-2-RdRp-P2 assay of Corman V. M. et al., have been found to lack specificity for SARS-CoV-2 (cross-reacting with SARS-CoV or other pathogens) (Chan, J. F. et al. (2020) ā€œImproved Molecular Diagnosis Of COVID-19 By The Novel, Highly Sensitive And Specific COVID-19-RdRp/Hel Real-Time Reverse Transcription-Polymerase Chain Reaction Assay Validated In Vitro And With Clinical Specimens,ā€ J. Clin. Microbiol. JCM.00310-20) and to provide a significant number of false negative results (Li, Z. et al. (2020) ā€œDevelopment and Clinical Application of A Rapid IgM-IgG Combined Antibody Test for SARS-CoV-2 Infection Diagnosis,ā€ J. Med. Virol. doi: 10.1002/jmv.25727).

For example, in a retrospective analysis of 4880 clinically-identified COVID-19 patients, samples obtained from the respiratory tracts of the patients were subjected to rRT-PCR amplification of the SARS-CoV-2 open reading frame 1ab (ORF1ab) and nucleocapsid protein (N) genes. Nasal and pharyngeal swabs of patients were evaluated for COVID-19 using a quantitative rRT-PCR (qRT-PCR) test. Only 38.42% (1875 of 4880) of actual COVID-19 patients were identified as positive using the rRT-PCR test. Of those testing positive, 39.80% were positive as determined by probes of the SARS-CoV-2 N gene and 40.98% were positive as determined by probes of the SARS-CoV-2 ORF1ab (Liu, R. et al. (2020) ā€œPositive Rate Of RT-PCR Detection Of SARS-CoV-2 Infection In 4880 Cases From One Hospital In Wuhan, China, From Jan To Feb 2020,ā€ Clinica Chimica Acta 505:172-175).

The study of Chan, J. F. et al. (2020) (ā€œImproved Molecular Diagnosis Of COVID-19 By The Novel, Highly Sensitive And Specific COVID-19-RdRp/Hel Real-Time Reverse Transcription-Polymerase Chain Reaction Assay Validated In Vitro And With Clinical Specimens,ā€ J. Clin. Microbiol. JCM.00310-20. doi: 10.1128/JCM.00310-20) found that of 273 specimens from 15 patients with laboratory-confirmed COVID-19, only 28% were SARS-CoV-2 positive by both the SARS-CoV-2-RdRp/Hel and RdRp-P2 assays. The SARS-CoV-2-RdRp/Hel assay was more sensitive, but still confirmed only 43.6% of the patients as having SARS-CoV-2 infection.

In a different study, RNA was extracted from 1070 clinical samples of 205 patients suffering from COVID-19. Real-time reverse transcription-PCR (rRT-PCR) was then used to amplify SARS-CoV-2 ORF1ab in order to confirm the COVID-19 diagnosis (Wang, W. et al. (2020) (ā€œDetection of SARS-CoV-2 in Different Types of Clinical Specimens,ā€ JAMA doi: 10.1001/jama.2020.3786). Bronchoalveolar lavage fluid specimens were reported to exhibit the highest positive rates (14 of 15; 93%), followed by sputum (72 of 104; 72%), nasal swabs (5 of 8; 63%), fibrobronchoscope brush biopsy (6 of 13; 46%), pharyngeal swabs (126 of 398; 32%), feces (44 of 153; 29%), and blood (3 of 307; 1%). None of the 72 urine specimens tested indicated a positive result. Thus, for example, pharyngeal swabs from such actual COVID-19 patients failed to accurately diagnose SARS-CoV-2 infection in 68% of those tested. Zhang, W. et al. (2020) (ā€œMolecular And Serological Investigation Of 2019-nCoV Infected Patients: Implication Of Multiple Shedding Routes,ā€ Emerg. Microbes Infect. 9(1):386-389) also discloses the presence of SARS-CoV-2 in feces of COVID-19 patients, however, its rRT-PCR assay results showed more anal swab positives than oral swab positives in a later stage of infection, suggesting viral shedding and the capacity of the infection to be transmitted through an oral-fecal route. A similar teaching is provided by Tang, A. et al. (2020) (ā€œDetection of Novel Coronavirus by RT-PCR in Stool Specimen from Asymptomatic Child, China,ā€ Emerg Infect Dis. 26(6). doi: 10.3201/eid2606.200301), which discloses that RT-PCR assays targeting ORF1ab and nucleoprotein N gene failed to detect SARS-CoV-2 in nasopharyngeal swab and sputum samples, but were able to detect virus in stool samples.

In a further study of individuals suffering from COVID-19, repeated assays for SARS-CoV-2 were also found to report negative results (Wu, X. et al. (2020) (ā€œCo-infection with SARS-CoV-2 and Influenza A Virus in Patient with Pneumonia, China,ā€ 26(6):pages 1-7. The publication teaches that existing assays for SARS-CoV-2 lack sufficient sensitivity, and thus lead to false negative diagnoses.

In light of the deficiencies encountered in using prior rRT-PCR assays, such as the SARS-CoV-2-RdRp-P2 assay of Corman V. M. et al., other approaches to assaying for SARS-CoV-2 have been explored. Li, Z. et al. (2020) (ā€œDevelopment and Clinical Application of A Rapid IgM-IgG Combined Antibody Test for SARS-CoV-2 Infection Diagnosis,ā€ J. Med. Virol. doi: 10.1002/jmv.25727) teaches that a point-of-care lateral flow immunoassay could be used to simultaneously detect anti-SARS-CoV-2 IgM and IgG antibodies in human blood and thus avoid the problems of the RdRp-P2 assay of Corman, V. M. et al. Immunoassays, however, may fail to discriminate between individuals suffering from COVID-19 and individuals who were previously infected with SARS-CoV-2, but have since recovered.

In sum, despite all prior efforts a need remains for a method of rapidly and accurately assaying for the presence of SARS-CoV-2. The present invention is directed to this and other goals.

SUMMARY OF THE INVENTION

The present invention is directed to methods for assaying for the presence of SARS-CoV-2 in a sample, including a clinical sample, and to oligonucleotides, reagents, and kits useful in such assays. In particular, the present invention is directed to such assays that are rapid, accurate and specific for the detection of SARS-CoV-2.

In detail, the invention provides a detectably labeled oligonucleotide that is capable of specifically hybridizing to a SARS-CoV-2 polynucleotide, wherein the detectably labeled oligonucleotide has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having a nucleotide sequence that consists of the nucleotide sequence of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7 or SEQ ID NO:8.

The invention additionally provides a kit for detecting the presence of SARS-CoV-2 in a clinical sample, wherein the kit comprises a detectably labeled oligonucleotide that is capable of specifically hybridizing to a SARS-CoV-2 polynucleotide, wherein the detectably labeled oligonucleotide has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having the nucleotide sequence of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7 or SEQ ID NO:8.

The invention additionally provides the embodiment of such kit, wherein the detectably labeled oligonucleotide has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4, and wherein the kit permits a determination of the presence or absence of the SARS-CoV-2 ORF1ab in a clinical sample.

The invention additionally provides the embodiment of such kit, wherein the detectably labeled oligonucleotide has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having the nucleotide sequence of SEQ ID NO:7 or SEQ ID NO:8, and wherein the kit permits a determination of the presence or absence of the SARS-CoV-2 S gene in a clinical sample.

The invention additionally provides the embodiment of such kits, wherein the kit comprises two detectably labeled oligonucleotides, wherein the detectable labels of the oligonucleotides are distinguishable, and wherein one of the two detectably labeled oligonucleotides has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4, and the second of the two detectably labeled oligonucleotides has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having the nucleotide sequence of SEQ ID NO:7 or SEQ ID NO:8.

The invention additionally provides the embodiment of such kits, wherein the detectably labeled oligonucleotide is a TaqMan probe, a molecular beacon probe, a scorpion primer-probe, or a HyBeacon probe.

The invention additionally provides the embodiment of such kits, wherein the detectably labeled oligonucleotide is fluorescently labeled.

The invention additionally provides the embodiment of such kits, wherein the kit permits the detection of the D614G polymorphism of the S gene of SARS-CoV-2.

The invention additionally provides the embodiment of such kits, wherein the kit is a multi-chambered, fluidic device.

The invention additionally provides a method for detecting the presence of SARS-CoV-2 in a clinical sample, wherein the method comprises incubating the clinical sample in vitro in the presence of a detectably labeled oligonucleotide that is capable of specifically hybridizing to a SARS-CoV-2 polynucleotide, wherein the detectably labeled oligonucleotide has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having the nucleotide sequence of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7 or SEQ ID NO:8; wherein the method detects the presence of SARS-CoV-2 in the clinical sample by detecting the presence of SARS-CoV-2 ORF1ab and/or SARS-CoV-2 S gene.

The invention additionally provides the embodiment of such method, wherein the detectably labeled oligonucleotide has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4, and wherein the method detects the presence of SARS-CoV-2 in the clinical sample by detecting the presence of SARS-CoV-2 ORF1ab.

The invention additionally provides the embodiment of such method, wherein the detectably labeled oligonucleotide has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having the nucleotide sequence of SEQ ID NO:7 or SEQ ID NO:8, and wherein the method detects the presence of SARS-CoV-2 in the clinical sample by detecting the presence of SARS-CoV-2 S gene.

The invention additionally provides the embodiment of such methods, wherein the detectably labeled oligonucleotide is fluorescently labeled.

The invention additionally provides the embodiment of such methods, wherein the method comprises incubating the clinical sample in the presence of two detectably labeled oligonucleotides, wherein the detectable labels of the oligonucleotides are distinguishable, and wherein one of the two detectably labeled oligonucleotides has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4, and the second of the two detectably labeled oligonucleotides has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having the nucleotide sequence of SEQ ID NO:7 or SEQ ID NO:8; wherein the method detects the presence of SARS-CoV-2 in the clinical sample by detecting the presence of both SARS-CoV-2 ORF1ab and SARS-CoV-2 S gene.

The invention additionally provides the embodiment of such method, wherein the detectably labeled oligonucleotide is fluorescently labeled.

The invention additionally provides the embodiment of such methods, wherein the method detects the presence or absence of the D614G polymorphism of the S gene of SARS-CoV-2.

The invention additionally provides the embodiment of such methods, wherein the method comprises a PCR amplification of the SARS-CoV-2 polynucleotide.

The invention additionally provides the embodiment of such methods, wherein the detectably labeled oligonucleotide is a TaqMan probe, a molecular beacon probe, a scorpion primer-probe, or a HyBeacon probe.

The invention additionally provides the embodiment of such methods, wherein the method comprises a LAMP amplification of the SARS-CoV-2 polynucleotide.

The invention additionally provides an oligonucleotide that comprises a 5′ terminus and a 3′ terminus, wherein the oligonucleotide has a SARS-CoV-2 oligonucleotide domain that has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:17-42, any of SEQ ID NOs:43-70, any of SEQ ID NOs:71-84, any of SEQ ID NOs:85-112, any of SEQ ID NOs:113-126, any of SEQ ID NOs:127-146, any of SEQ ID NOs:147-166, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, any of SEQ ID NOs:364-381, any of SEQ ID NOs:398-402, any of SEQ ID NOs:403-406, SEQ ID NO:411, or SEQ ID NO:412.

The invention additionally provides such an oligonucleotide wherein the oligonucleotide is detectably labeled and comprises a 5′ terminus and a 3′ terminus, wherein the oligonucleotide has a SARS-CoV-2 oligonucleotide domain that has a nucleotide sequence that consists of, consists essentially of, or comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:43-70, any of SEQ ID NOs:85-112, any of SEQ ID NOs:127-146, any of SEQ ID NOs:147-166, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, any of SEQ ID NOs:364-381, any of SEQ ID NOs:403-406, SEQ ID NO:411, or SEQ ID NO:412.

The invention additionally provides such an oligonucleotide wherein the oligonucleotide is detectably labeled and comprises a 5′ terminus and a 3′ terminus, wherein the oligonucleotide has a SARS-CoV-2 oligonucleotide domain that consists essentially of the nucleotide sequence of: SEQ ID NO:9, or SEQ ID NO:10.

The invention additionally provides such an oligonucleotide wherein the oligonucleotide is detectably labeled and comprises a 5′ terminus and a 3′ terminus, wherein the oligonucleotide has a SARS-CoV-2 oligonucleotide domain that consists essentially of the nucleotide sequence of: SEQ ID NO:11, or SEQ ID NO:12.

The invention additionally provides a TaqMan probe capable of detecting the presence of SARS-CoV-2, wherein the probe comprises an oligonucleotide, having a 5′ terminus and a 3′ terminus, that comprises a SARS-CoV-2 oligonucleotide domain whose nucleotide sequence consists of, consists essentially of, comprises, or is a variant of the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:127-146, any of SEQ ID NOs:147-166, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, any of SEQ ID NOs:364-381, wherein the 5′ terminus of the oligonucleotide is labeled with a fluorophore and the 3′ terminus of the oligonucleotide is complexed to a quencher of such fluorophore.

The invention additionally provides such a TaqMan probe, wherein the probe is capable of detecting the SARS-CoV-2 ORF1ab, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, any of SEQ ID NOs:127-146, or any of SEQ ID NOs:147-166.

The invention additionally provides such a TaqMan probe, wherein the probe is capable of detecting the SARS-CoV-2 S gene, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, or any of SEQ ID NOs:364-381.

The invention additionally provides such a TaqMan probe, wherein the probe is capable of detecting a polymorphism in the SARS-CoV-2 S gene, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: any of SEQ ID NOs:167-252, or any of SEQ ID NOs:273-363.

The invention additionally provides a molecular beacon probe capable of detecting the presence of SARS-CoV-2, wherein the probe comprises an oligonucleotide, having a 5′ terminus and a 3′ terminus, that comprises a SARS-CoV-2 oligonucleotide domain whose nucleotide sequence consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:127-146, any of SEQ ID NOs:147-166, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, any of SEQ ID NOs:364-381, wherein such a SARS-CoV-2 oligonucleotide domain is flanked by a 5′ oligonucleotide and a 3′ oligonucleotide, wherein such 5′ oligonucleotide and such 3′ oligonucleotide are at least substantially complementary to one another, and wherein at least one of such 5′ oligonucleotide and such 3′ oligonucleotide is detectably labeled and another of such 5′ oligonucleotide and such 3′ oligonucleotide is complexed to a quencher or an acceptor of such detectable label.

The invention additionally provides such a molecular beacon probe, wherein the probe is capable of detecting the SARS-CoV-2 ORF1ab, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, any of SEQ ID NOs:127-146, or any of SEQ ID NOs:147-166.

The invention additionally provides such a molecular beacon probe, wherein the probe is capable of detecting the SARS-CoV-2 S gene, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, or any of SEQ ID NOs:364-381.

The invention additionally provides such a molecular beacon probe, wherein the probe is capable of detecting a polymorphism in the SARS-CoV-2 S gene, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: any of SEQ ID NOs:167-252, or any of SEQ ID NOs:273-363.

The invention additionally provides a scorpion primer-probe capable of detecting the presence of SARS-CoV-2, wherein the probe comprises an oligonucleotide, having a 5′ terminus and a 3′ terminus, that comprises a SARS-CoV-2 oligonucleotide domain whose nucleotide sequence consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:127-146, any of SEQ ID NOs:147-166, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, any of SEQ ID NOs:364-381, wherein such a SARS-CoV-2 oligonucleotide domain is flanked by a 5′ oligonucleotide and a 3′ oligonucleotide, wherein such 5′ oligonucleotide and such 3′ oligonucleotide are at least substantially complementary to one another, and wherein at least one of such 5′ oligonucleotide and such 3′ oligonucleotide is detectably labeled and the other of such 5′ oligonucleotide and such 3′ oligonucleotide is complexed to a quencher or an acceptor of such detectably label, and wherein such 3′ oligonucleotide further comprises a polymerization blocking moiety, and a PCR primer oligonucleotide positioned 3′ from said blocking moiety.

The invention additionally provides such a scorpion primer-probe, wherein the probe is capable of detecting the SARS-CoV-2 ORF1ab, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, any of SEQ ID NOs:127-146, or any of SEQ ID NOs:147-166.

The invention additionally provides such a scorpion primer-probe, wherein the probe is capable of detecting the SARS-CoV-2 S gene, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, or any of SEQ ID NOs:364-381.

The invention additionally provides such a scorpion primer-probe, wherein the probe is capable of detecting a polymorphism in the SARS-CoV-2 S gene, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: any of SEQ ID NOs:167-252, or any of SEQ ID NOs:273-363.

The invention additionally provides such a scorpion primer-probe, wherein the probe is capable of detecting a polymorphism in the SARS-CoV-2 S gene, and wherein the PCR primer oligonucleotide has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: any of SEQ ID NOs:43-70, or any of SEQ ID NOs:85-112.

The invention additionally provides a HyBeaconā„¢ probe capable of detecting the presence of SARS-CoV-2, wherein the probe comprises an oligonucleotide, having a 5′ terminus and a 3′ terminus, that comprises a SARS-CoV-2 oligonucleotide domain whose nucleotide sequence consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:127-146, any of SEQ ID NOs:147-166, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, any of SEQ ID NOs:364-381, wherein at least one nucleotide residue of such SARS-CoV-2 oligonucleotide domain is detectably labeled.

The invention additionally provides such a HyBeaconā„¢ probe, wherein the probe is capable of detecting a polymorphism in the SARS-CoV-2 S gene, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: any of SEQ ID NOs:43-70, any of SEQ ID NOs:85-112, any of SEQ ID NOs:167-252, or any of SEQ ID NOs:273-363.

The invention additionally provides the embodiment of the above-described oligonucleotides, TaqMan probes, molecular beacon probes, scorpion primer-probes, or HyBeaconā„¢ probes, wherein the detectable label is a fluorophore that has an excitation wavelength within the range of about 352-690 nm and an emission wavelength that is within the range of about 447-705 nm. The invention additionally provides the embodiment of such oligonucleotides, wherein the fluorophore is JOE or FAM.

The invention additionally provides an oligonucleotide primer capable of amplifying an oligonucleotide portion of a SARS-CoV-2 polynucleotide present in a sample, wherein such oligonucleotide primer has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: any of: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:6, any of SEQ ID NOs:17-28, any of SEQ ID NOs:29-42, any of SEQ ID NOs:43-70, any of SEQ ID NOs:71-84, any of SEQ ID NOs:85-112, any of SEQ ID NOs:113-126, or any of SEQ ID NOs:398-410.

The invention additionally provides an oligonucleotide that has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:3 or SEQ ID NO:4.

The invention additionally provides an oligonucleotide that has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:7 or SEQ ID NO:8.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 provides an illustration of the structure of SARS-CoV-2 and its open reading frames (ORFs). The sequence presented is that of the reference SARS-CoV-2 sequence (GenBank NC_045512).

FIG. 2 shows the alignment and orientation of a Forward ORF1ab Primer and Reverse ORF1ab Primer of the present invention and the region of ORF1ab that these primers amplify in an rRT-PCR assay of SARS-CoV-2. Primer sequences are shown in underlined upper case letters; probe sequences are shown in boxed uppercase letters.

FIG. 3 shows the alignment and orientation of a Forward S Gene Primer and Reverse S Gene Primer of the present invention and the region of the S gene that these primers amplify in an rRT-PCR assay of SARS-CoV-2. Primer sequences are shown in underlined upper case letters; probe sequences are shown in boxed uppercase letters.

DETAILED DESCRIPTION OF THE INVENTION

The present invention is directed to methods for assaying for the presence of SARS-CoV-2 in a sample, including a clinical sample, and to oligonucleotides, reagents, and kits useful in such assays. In particular, the present invention is directed to such assays that are rapid, accurate and specific for the detection of SARS-CoV-2.

As used herein, an assay for the detection of SARS-CoV-2 is said to be ā€œspecificā€ for SARS-CoV-2 if it can be conducted under conditions that permit it to detect SARS-CoV-2 without exhibiting cross-reactivity to human DNA, or to DNA (or cDNA) of other pathogens, especially other coronavirus pathogens. The assays of the present invention detect SARS-CoV-2 by detecting the presence of a ā€œSARS-CoV-2 polynucleotideā€ nucleic acid molecule in a clinical sample. As used herein, a SARS-CoV-2 polynucleotide nucleic acid molecule is an RNA or DNA molecule that comprises the genome of SARS-CoV-2 or a portion of a gene or open reading frame (ORF) thereof (i.e., at least 1,000 nucleotides, at least 2,000 nucleotides, at least 5,000 nucleotides, at least 10,000 nucleotides, or at least 20,000 nucleotides of the SARS-CoV-2 genome, or more preferably, the entire SARS-CoV-2 genome of 29,903 nucleotides).

In particular, an assay for the detection of SARS-CoV-2 is said to be specific for SARS-CoV-2 if it can be conducted under conditions that permit it to detect SARS-CoV-2 without exhibiting cross-reactivity to DNA (or cDNA) of Influenza A, Influenza B, Respiratory Syncytial Virus, Group A Streptococcus (Streptococcus pyogenes), Parainfluenza I, Parainfluenza III, Haemophilus parainfluenzae, Enterovirus or Adenovirus, or to SARS-CoV, MERS-CoV, or bat-derived Severe Acute Respiratory Syndrome-like coronaviruses, such as bat-SL-CoVZC45 or bat-SL-CoVZXC21. More preferably, an assay for the detection of SARS-CoV-2 is said to be specific for SARS-CoV-2 if it can be conducted under conditions that permit it to detect SARS-CoV-2 without exhibiting cross-reactivity to DNA (or cDNA) of Adenovirus 1, Bordetella pertussis, Chlamydophila pneumoniae, Coronavirus 229E, Coronavirus NL63, Coronavirus OC43, Enterovirus 68, Haemophilus influenzae, Human metapneumovirus (hMPV-9), Influenza A H3N2 (Hong Kong 8/68), Influenza B (Phuket 3073/2013), Legionella pneumophilia, MERS Coronavirus, Mycobacterium tuberculosis, Parainfluenza Type 1, Parainfluenza Type 2, Parainfluenza Type 3, Parainfluenza Type 4A, Rhinovirus B14, RSV A Long, RSV B Washington, SARS-Coronavirus, SARS-Coronavirus HKU39849, Streptococcus pneumoniae, Streptococcus pyogenes, human leukocytes, or pooled human nasal fluid.

As used herein, an assay for the detection of SARS-CoV-2 is said to be ā€œaccurateā€ for SARS-CoV-2 if it is capable of detecting a viral dose of 400 copies/ml of SARS-CoV-2 with an LoD of at least 80%, and of detecting a viral dose of 500 copies/ml of SARS-CoV-2 with an LoD of at least 90%.

As used herein, an assay for the detection of SARS-CoV-2 is said to be ā€œrapidā€ for SARS-CoV-2 if it is capable of providing a determination of the presence or absence of SARS-CoV-2 within 2 hours, and more preferably within 90 minutes and most preferably, within 1 hour after the commencement of the assay.

III. Preferred Assays for the Detection of SARS-CoV-2

The present invention provides an assay for detecting the presence of SARS-CoV-2 in a ā€œclinical sampleā€. Such detection may be accomplished in situ or in vitro, but is preferably conducted in vitro. The clinical samples that may be evaluated in accordance with the present invention include any that may contain SARS-CoV-2, and include blood samples, bronchoalveolar lavage fluid specimens, fecal samples, fibrobronchoscope brush biopsy samples, nasal swab samples, nasopharyngeal swab samples, pharyngeal swab sample, oral samples (including saliva samples, sputum samples, etc.) and urine samples. Preferably, however, the employed clinical sample will be a nasal swab sample, a nasopharyngeal swab sample, a pharyngeal swab sample, or a sputum sample, and most preferably, the employed clinical sample will be a nasopharyngeal swab sample. In one embodiment, the sample will be pre-treated to extract RNA that may be present in the sample. Alternatively, and more preferably, the sample will be evaluated without prior RNA extraction.

A. Real-Time Reverse Transcriptase Polymerase Chain Reaction (rRT-PCR) Assay Formats

In one embodiment, the present invention preferably uses a real-time reverse transcriptase polymerase chain reaction (rRT-PCR) assay to detect the presence of SARS-CoV-2 in clinical samples. rRT-PCR assays are well known and widely deployed in diagnostic virology (see, e.g., Pang, J. et al. (2020) ā€œPotential Rapid Diagnostics, Vaccine and Therapeutics for 2019 Novel Coronavirus (2019-nCoV): A Systematic Review,ā€ J. Clin. Med. 26; 9(3)E623 doi: 10.3390/jcm9030623; Kralik, P. et al. (2017) ā€œA Basic Guide to Real-Time PCR in Microbial Diagnostics: Definitions, Parameters, and Everything,ā€ Front. Microbiol. 8:108. doi: 10.3389/fmicb.2017.00108).

To more easily describe the rRT-PCR assays of the present invention, such assays may be envisioned as involving multiple reaction steps:

  • (1) the reverse transcription of SARS-CoV-2 RNA that may be present in the clinical sample that is to be evaluated for SARS-CoV-2 presence;
  • (2) the PCR-mediated amplification of the SARS-CoV-2 cDNA produced from such reverse transcription;
  • (3) the hybridization of SARS-CoV-2-specific probes to such amplification products;
  • (4) the double-strand-dependent 5″→3″ exonuclease cleavage of the hybridized SARS-CoV-2-specific probes; and
  • (5) the detection of the unquenched probe fluorophores signifying that the evaluated clinical sample contained SARS-CoV-2.

It will be understood that such steps may be conducted separately (for example, in two or more reaction chambers, or with reagents for the different steps being added at differing times, etc.). However, it is preferred that such steps are to be conducted within the same reaction chamber, and that all reagents needed for the rRT-PCR assays of the present invention are to be provided to the reaction chamber at the start of the assay. It will also be understood that although the polymerase chain reaction (PCR) (see, e.g. Ghannam, M, G, et al. (2020) ā€œBiochemistry, Polymerase Chain Reaction (PCR),ā€ StatPearls Publishing, Treasure Is.; pp. 0.1-4; Lorenz, T. C. (2012) ā€œPolymerase Chain Reaction: Basic Protocol Plus Troubleshooting And Optimization Strategies,ā€ J. Vis. Exp. 2012 May 22; (63):e3998; pp. 1-15) is the preferred method of amplifying SARS-CoV-2 cDNA produced via reverse transcription, other DNA amplification technologies could alternatively be employed.

Accordingly, in a preferred embodiment, the rRT-PCR assays of the present invention comprise incubating a clinical sample in the presence of a DNA polymerase, a reverse transcriptase, one or more pairs of SARS-CoV-2-specific primers, one or more SARS-CoV-2-specific probes (typically, at least one probe for each region being amplified by an employed pair of primers), deoxynucleotide triphosphates (dNTPs) and buffers. The conditions of the incubation are cycled to permit the reverse transcription of SARS-CoV-2 RNA, the amplification of SARS-CoV-2 cDNA, the hybridization of SARS-CoV-2-specific probes to such cDNA, the cleavage of the hybridized SARS-CoV-2-specific probes and the detection of unquenched probe fluorophores. The reverse transcriptase is needed only to produce a cDNA version of SARS-CoV-2 RNA.

The rRT-PCR assays of the present invention employ at least one set of at least one ā€œForwardā€ primer that hybridizes to a polynucleotide domain of a first strand of a DNA molecule, and at least one ā€œReverseā€ primer that hybridizes to a polynucleotide domain of a second (and complementary) strand of such DNA molecule.

Preferably, such Forward and Reverse primers will permit the amplification of a region of ORF1ab, which encodes a non-structural polyprotein of SARS-CoV-2 and/or a region of the S gene, which encodes the virus spike surface glycoprotein and is required for host cell targeting. The SARS-CoV-2 spike surface glycoprotein is a key protein for specifically characterizing a coronavirus as being SARS-CoV-2 (Chen, Y. et al. (2020) ā€œStructure Analysis Of The Receptor Binding Of 2019-Ncov,ā€ Biochem. Biophys. Res. Commun. 525:135-140; Masters, P. S. (2006) ā€œThe Molecular Biology Of Coronaviruses,ā€ Adv. Virus Res. 66:193-292). The amplification of either of such targets alone is sufficient for the specific determination of SARS-CoV-2 presence in clinical samples. It is, however, preferred to assay for SARS-CoV-2 by incubating nucleic acid molecules of a clinical sample under conditions sufficient to amplify both such targets, if present therein, and then determining whether both such amplified products are detectable.

The present invention encompasses methods, kits and oligonucleotides sufficient to amplify any portion of the SARS-CoV-2 ORF1ab. The nucleotide sequence of an exemplary ORF1ab region is provided as SEQ ID NO:415. The primers of the present invention thus include any two or more oligonucleotide SARS-CoV-2 ORF1ab primers, each being of 15, 16, 17, 18, 19, 20 or more than 20 nucleotide residues in length, that is capable of specifically hybridizing to SEQ ID NO:415, or its complement, and of mediating the amplification of an oligonucleotide region (for example, via PCR, Loop-Mediated Isothermal Amplification (LAMP), rolling circle amplification, ligase chain reaction amplification, strand-displacement amplification, bind-wash PCR, singing wire PCR, NASBA, etc.) thereof that is capable of specifically hybridizing to SEQ ID NO:415. Preferably, such amplified region of SEQ ID NO:415 will be greater than about 20 nucleotide residues in length, and preferably less than about 50 nucleotide residues in length, more preferably less than about 100 nucleotide residues in length, more preferably less than about 150 nucleotide residues in length, more preferably less than about 200 nucleotide residues in length, more preferably less than about 300 nucleotide residues in length, more preferably less than about 400 nucleotide residues in length, and most preferably less than about 500 nucleotide residues in length. The present invention further encompasses one or more detectably-labeled SARS-CoV-2 ORF1ab probe oligonucleotide(s) (and especially fluorophore labeled oligonucleotides, as discussed in detail below), that is capable of specifically hybridizing to such amplified region of SEQ ID NO:415, and of detecting the presence of such amplified region, for example, by comprising a molecular beacon probe, HyBeaconĀ® probe, scorpion primer-probe, TaqMan probe, biotinylated oligoprobe, etc.

The present invention additionally encompasses methods, kits and oligonucleotides sufficient to amplify any portion of the SARS-CoV-2 S gene. The nucleotide sequence of an exemplary S gene is provided as SEQ ID NO:16. The primers of the present invention thus include any two or more oligonucleotide SARS-CoV-2 S gene primers, each being of 15, 16, 17, 18, 19, 20 or more than 20 nucleotide residues in length, that is capable of specifically hybridizing to SEQ ID NO:16, or its complement, and of mediating the amplification of an oligonucleotide region (for example, via PCR, Loop-Mediated Isothermal Amplification (LAMP), rolling circle amplification, ligase chain reaction amplification, strand-displacement amplification, bind-wash PCR, singing wire PCR, NASBA, etc.) thereof that is capable of specifically hybridizing to SEQ ID NO:16. Preferably, such amplified region of SEQ ID NO:16 will be greater than about 20 nucleotide residues in length, and preferably less than about 50 nucleotide residues in length, more preferably less than about 100 nucleotide residues in length, more preferably less than about 150 nucleotide residues in length, more preferably less than about 200 nucleotide residues in length, more preferably less than about 300 nucleotide residues in length, more preferably less than about 400 nucleotide residues in length, and most preferably less than about 500 nucleotide residues in length. The present invention further encompasses one or more detectably-labeled SARS-CoV-2 S gene probe oligonucleotide(s) (and especially fluorophore labeled oligonucleotides, as discussed in detail below), that is capable of specifically hybridizing to such amplified region of SEQ ID NO:16, and of detecting the presence of such amplified region, for example, by comprising a molecular beacon probe, HyBeaconĀ® probe, scorpion primer-probe, TaqMan probe, biotinylated oligoprobe, etc.

1. Preferred ORF1ab Primers

The amplification of SARS-CoV-2 ORF1ab is preferably mediated using a ā€œForward ORF1ab Primerā€ and a ā€œReverse ORF1ab Primer,ā€ whose sequences are suitable for amplifying a region of the SARS-CoV-2 ORF1ab. Although any Forward and Reverse ORF1ab Primers capable of mediating such amplification may be employed in accordance with the present invention, it is preferred to employ Forward and Reverse ORF1ab Primers that possess distinctive advantages. The preferred Forward ORF1ab Primer of the present invention comprises, consists essentially of, or consists of, the sequence (SEQ ID NO:1) atggtagagttgatggtcaa, which corresponds to the nucleotide sequence of nucleotides 19991-20010 of the sense-strand of the SARS-CoV-2 ORF1ab, or is a variant thereof. The preferred Reverse ORF1ab Primer of the present invention comprises, consists essentially of, or consists of, the sequence (SEQ ID NO:2) taagactagcttgtttggga, which corresponds to the nucleotide sequence of nucleotides 20088-20107 of the anti-sense-strand of SARS-CoV-2 ORF1ab, or is a variant thereof. Primers that consist essentially of the sequences of SEQ ID NO:1 and SEQ ID NO:2 amplify a double-stranded oligonucleotide having the sequence of nucleotides 19991-20107 of SARS-CoV-2 ORF1ab. Such preferred ā€œForward ORF1ab Primerā€ and preferred ā€œReverse ORF1ab Primerā€ have distinctive attributes for use in the detection of SARS-CoV-2.

The sequence of the ā€œsenseā€ strand of nucleotides 19991-20107 of the SARS-CoV-2 ORF1ab is SEQ ID NO:3; the sequence of the complement (ā€œanti-senseā€) strand is SEQ ID NO:4:

SEQā€ƒIDā€ƒNO:ā€ƒ3:
atggtagagtā€ƒtgatggtcaaā€ƒgtagacttatā€ƒttagaaatgc
ccgtaatggtā€ƒgttcttattaā€ƒcagaaggtagā€ƒtgttaaaggt
ttacaaccatā€ƒctgtaggtccā€ƒcaaacaagctā€ƒagtctta
SEQā€ƒIDā€ƒNO:ā€ƒ4:
taagactagcā€ƒttgtttgggaā€ƒcctacagatgā€ƒgttgtaaacc
tttaacactaā€ƒccttctgtaaā€ƒtaagaacaccā€ƒattacgggca
tttctaaataā€ƒagtctacttgā€ƒaccatcaactā€ƒctaccat

Such oligonucleotides illustrate the SARS-CoV-2 oligonucleotides that may be amplified using the ORF1ab primers of the present invention.

While it is preferred to detect the presence of the ORF1ab using primers that consist of the sequences of SEQ ID NO:1 and SEQ ID NO:2, the invention contemplates that other primers that consist essentially of the sequence of SEQ ID NO:1 or that consist essentially of the sequence of SEQ ID NO:2 (in that they possess 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional nucleotide residues, but retain the ability to specifically hybridize to DNA molecules having the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4, and more preferably retain the ability to specifically hybridize to DNA molecules having the nucleotide sequence of complement of the nucleotide sequence of SEQ ID NO:1 or the nucleotide sequence of complement of the nucleotide sequence of SEQ ID NO:2), or ā€œvariantsā€ of such primers that retain the ability to specifically hybridize to DNA molecules having the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4, and more preferably retain the ability to specifically hybridize to DNA molecules having the nucleotide sequence of complement of the nucleotide sequence of SEQ ID NO:1 or the nucleotide sequence of complement of the nucleotide sequence of SEQ ID NO:2, could be employed in accordance with the principles and goals of the present invention. Such ā€œVariant ORF1ab Primersā€ may, for example:

  • (1) lack 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides of SEQ ID NO:1 or of SEQ ID NO:2, or
  • (2) lack 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the 10 3′ terminal nucleotides of the sequence of SEQ ID NO:1 or of SEQ ID NO:2, or
  • (3) lack 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the 10 5′ terminal nucleotides of the sequence of SEQ ID NO:1 or of SEQ ID NO:2, or
  • (4) have a sequence that differs from that of SEQ ID NO:1 or of SEQ ID NO:2 in having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 additional nucleotides, or
  • (5) have a sequence that differs from that of SEQ ID NO:1 or of SEQ ID NO:2 in having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 substitution nucleotides in lieu of the nucleotides present in SEQ ID NO:1 or of SEQ ID NO:2, or
  • (6) combinations of such (1)-(5).
    Non-limiting examples of such primers are shown in Table 3 and Table 4.

TABLEā€ƒ3ā€ƒ
Illustrativeā€ƒVariantsā€ƒofā€ƒtheā€ƒPreferred
Forwardā€ƒORF1abā€ƒPrimer
SEQ
IDā€ƒNO Sequence
17 atggtagagttgatggtca
18 atggtagagttgatggtc
19 atggtagagttgatggt
20 atggtagagttgatgg
21 atggtagagttgatg
22 tggtagagttgatggtcaa
23 ggtagagttgatggtcaa
24 gtagagttgatggtcaa
25 tagagttgatggtcaa
26 agagttgatggtcaa
27 tggtagagttgatggtca
28 ggtagagttgatggtc

TABLEā€ƒ4ā€ƒ
Illustrativeā€ƒVariantsā€ƒofā€ƒtheā€ƒPreferred
Reverseā€ƒORF1abā€ƒPrimer
SEQ
IDā€ƒNO Sequence
29 taagactagcttgtttggg
30 taagactagcttgtttgg
31 taagactagcttgtttg
32 taagactagcttgttt
33 taagactagcttgtt
34 aagactagcttgtttggga
35 agactagcttgtttggga
36 gactagcttgtttggga
37 actagcttgtttggga
38 ctagcttgtttggga
39 aagactagcttgtttggg
40 agactagcttgtttggg
41 agactagcttgtttgg
42 gactagcttgtttgg

The alignment and relative orientation of the preferred Forward ORF1ab Primer (SEQ ID NO:1) and Reverse ORF1ab Primer (SEQ ID NO:2) of the present invention and the region of SARS-CoV-2 ORF1ab that these primers amplify in a rRT-PCR assay of SARS-CoV-2 are shown in FIG. 2.

2. Preferred S Gene Primers

The amplification of SARS-CoV-2 S gene is preferably mediated using a ā€œForward S Gene Primerā€ and a ā€œReverse S Gene Primer,ā€ whose sequences are suitable for amplifying a region of the SARS-CoV-2 S gene. Although any Forward and Reverse S Gene Primers capable of mediating such amplification may be employed in accordance with the present invention, it is preferred to employ Forward and Reverse S Gene Primers that possess distinctive advantages. The preferred Forward S Gene Primer of the present invention comprises, consists essentially of, or consists of, the sequence (SEQ ID NO:5) ctaaccaggttgctgttctt, which corresponds to the nucleotide sequence of nucleotides 23376-23395 of the sense-strand of the SARS-CoV-2 S gene, or is a variant thereof. The preferred Reverse S Gene Primer comprises, consists essentially of, or consists of, the sequence (SEQ ID NO:6) cctgtagaataaacacgcca, which corresponds to the nucleotide sequence of nucleotides 23459-23478 of the anti-sense-strand of the SARS-CoV-2 S gene, or is a variant thereof. Primers that consist essentially of the sequences of SEQ ID NO:5 and SEQ ID NO:6 amplify a double-stranded oligonucleotide having the sequence of nucleotides 23376-23478 of the SARS-CoV-2 S gene. Such preferred ā€œForward S Gene Primerā€ and preferred ā€œReverse S Gene Primerā€ have distinctive attributes for use in the detection of SARS-CoV-2.

The sequence of the ā€œsenseā€ strand of nucleotides 23376-23478 of the SARS-CoV-2 S gene is SEQ ID NO:7; the sequence of the complement (ā€œanti-senseā€) strand is SEQ ID NO:8:

SEQā€ƒIDā€ƒNO:ā€ƒ7:
ctaaccaggtā€ƒtgctgttcttā€ƒtatcaggatgā€ƒttaactgcac
agaagtccctā€ƒgttgctattcā€ƒatgcagatcaā€ƒacttactcct
acttggcgtgā€ƒtttattctacā€ƒagg
SEQā€ƒIDā€ƒNO:ā€ƒ8:
cctgtagaatā€ƒaaacacgccaā€ƒagtaggagtaā€ƒagttgatctg
catgaatagcā€ƒaacagggactā€ƒtctgtgcagtā€ƒtaacatcctg
ataaagaacaā€ƒgcaacctggtā€ƒtag

Such oligonucleotides illustrate the SARS-CoV-2 oligonucleotides that may be amplified using the S Gene Primers of the present invention.

The nucleotide residue that is responsible for the D614G single nucleotide polymorphism of the SARS-CoV-2 S gene is underlined. SARS-CoV-2 possessing the D614G mutation (in which the adenine residue present at position 28 of SEQ ID NO:7 (position 1841 of SEQ ID NO:16) is replaced with a guanine residue, and the thymine residue present at position 76 of SEQ ID NO:8 is replaced with a cytosine residue) has emerged as a predominant clade in Europe and is spreading worldwide and is associated with enhanced fitness and higher transmissibility (Haddad, H. et al. (2020) ā€œMirna Target Prediction Might Explain The Reduced Transmission Of SARS-CoV-2 In Jordan, Middle East,ā€ Noncoding RNA Res. 5(3):135-143; Isabel, S. et al. (2020) ā€œEvolutionary And Structural Analyses Of SARS-Cov-2 D614G Spike Protein Mutation Now Documented Worldwide,ā€ Sci. Rep. 10(1):14031:1-9; Laamarti, M. et al. (2020) ā€œGenome Sequences of Six SARS-CoV-2 Strains Isolated in Morocco, Obtained Using Oxford Nanopore MinION Technology,ā€ Microbiol. Resour. Announc. 9(32):e00767-20:1-4; Omotuyi, I. O. et al. (2020) ā€œAtomistic Simulation Reveals Structural Mechanisms Underlying D614G Spike Glycoprotein-Enhanced Fitness In SARS-CoV-2,ā€ J. Comput. Chem. 41(24):2158-2161; Ogawa, J. et al. (2020) ā€œThe D614G Mutation In The SARS-Cov2 Spike Protein Increases Infectivity In An ACE2 Receptor Dependent Manner,ā€ Preprint. bioRxiv. 2020; 2020.07.21.214932:1-10).

While it is preferred to detect the presence of the S gene using primers that consist of the sequences of SEQ ID NO:5 and SEQ ID NO:6, the invention contemplates that other primers that consist essentially of the sequence of SEQ ID NO:5 or that consist essentially of the sequence of SEQ ID NO:6 (in that they possess 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional nucleotide residues, but retain the ability to specifically hybridize to DNA molecules having the nucleotide sequence of SEQ ID NO:7 or SEQ ID NO:8, and more preferably retain the ability to specifically hybridize to DNA molecules having the nucleotide sequence of complement of the nucleotide sequence of SEQ ID NO:5 or the nucleotide sequence of complement of the nucleotide sequence of SEQ ID NO:6), or ā€œvariantsā€ of such primers that retain the ability to specifically hybridize to DNA molecules having the nucleotide sequence of SEQ ID NO:7 or SEQ ID NO:8, and more preferably retain the ability to specifically hybridize to DNA molecules having the nucleotide sequence of complement of the nucleotide sequence of SEQ ID NO:5 or the nucleotide sequence of complement of the nucleotide sequence of SEQ ID NO:6, could be employed in accordance with the principles and goals of the present invention. Such ā€œVariant S Gene Primersā€ may, for example:

  • (1) lack 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides of SEQ ID NO:5 or of SEQ ID NO:6, or
  • (2) lack 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the 10 3′ terminal nucleotides of the sequence of SEQ ID NO:5 or of SEQ ID NO:6, or
  • (3) lack 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the 10 5′ terminal nucleotides of the sequence of SEQ ID NO:5 or of SEQ ID NO:6, or
  • (4) have a sequence that differs from that of SEQ ID NO:5 or of SEQ ID NO:6 in having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 additional nucleotides, or
  • (5) have a sequence that differs from that of SEQ ID NO:5 or of SEQ ID NO:6 in having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 substitution nucleotides in lieu of the nucleotides present in SEQ ID NO:5 or of SEQ ID NO:6, or
  • (6) combinations of such (1)-(5).
    Non-limiting examples of such primers are shown in Table 5 and Table 6 (the nucleotide residue that is responsible for the D614G single nucleotide polymorphism of the SARS-CoV-2 S gene is underlined).

TABLEā€ƒ5ā€ƒ
Illustrativeā€ƒVariantsā€ƒofā€ƒtheā€ƒPreferred
Forwardā€ƒSā€ƒGeneā€ƒPrimer
SEQ
IDā€ƒNO Sequence
43 ctaaccaggttgctgttctttatcagga
44 ctaaccaggttgctgttctttatcaggg
45 taaccaggttgctgttctttatcagga
46 taaccaggttgctgttctttatcaggg
47 aaccaggttgctgttctttatcagga
48 aaccaggttgctgttctttatcaggg
49 accaggttgctgttctttatcagga
50 accaggttgctgttctttatcaggg
51 ccaggttgctgttctttatcagga
52 ccaggttgctgttctttatcaggg
53 caggttgctgttctttatcagga
54 caggttgctgttctttatcaggg
55 aggttgctgttctttatcagga
56 aggttgctgttctttatcaggg
57 ggttgctgttctttatcagga
58 ggttgctgttctttatcaggg
59 gttgctgttctttatcagga
60 gttgctgttctttatcaggg
61 ttgctgttctttatcagga
62 ttgctgttctttatcaggg
63 tgctgttctttatcagga
64 tgctgttctttatcaggg
65 gctgttctttatcagga
66 gctgttctttatcaggg
67 ctgttctttatcagga
68 ctgttctttatcaggg
69 tgttctttatcagga
70 tgttctttatcaggg
71 ctaaccaggttgctgttct
72 ctaaccaggttgctgttc
73 ctaaccaggttgctgtt
74 ctaaccaggttgctgt
75 ctaaccaggttgctg
76 taaccaggttgctgttctt
77 aaccaggttgctgttctt
78 accaggttgctgttctt
79 ccaggttgctgttctt
80 caggttgctgttctt
81 taaccaggttgctgttct
82 aaccaggttgctgttct
83 aaccaggttgctgttc
84 accaggttgctgttc

TABLEā€ƒ6ā€ƒ
Illustrativeā€ƒVariantsā€ƒofā€ƒtheā€ƒPreferred
Reverseā€ƒSā€ƒGeneā€ƒPrimer
SEQ
IDā€ƒNO Sequence
85 gcaacagggacttctgtgcagttaacat
86 gcaacagggacttctgtgcagttaacac
87 caacagggacttctgtgcagttaacat
88 caacagggacttctgtgcagttaacac
89 aacagggacttctgtgcagttaacat
90 aacagggacttctgtgcagttaacac
91 acagggacttctgtgcagttaacat
92 acagggacttctgtgcagttaacac
93 cagggacttctgtgcagttaacat
94 cagggacttctgtgcagttaacac
95 agggacttctgtgcagttaacat
96 agggacttctgtgcagttaacac
97 gggacttctgtgcagttaacat
98 gggacttctgtgcagttaacac
99 ggacttctgtgcagttaacat
100 ggacttctgtgcagttaacac
101 gacttctgtgcagttaacat
102 gacttctgtgcagttaacac
103 acttctgtgcagttaacat
104 acttctgtgcagttaacac
105 cttctgtgcagttaacat
106 cttctgtgcagttaacac
107 ttctgtgcagttaacat
108 ttctgtgcagttaacac
109 tctgtgcagttaacat
110 tctgtgcagttaacac
111 ctgtgcagttaacat
112 ctgtgcagttaacac
113 cctgtagaataaacacgcc
114 cctgtagaataaacacgc
115 cctgtagaataaacacg
116 cctgtagaataaacac
117 cctgtagaataaaca
118 ctgtagaataaacacgcca
119 tgtagaataaacacgcca
120 gtagaataaacacgcca
121 tagaataaacacgcca
122 agaataaacacgcca
123 ctgtagaataaacacgcc
124 tgtagaataaacacgcc
125 tgtagaataaacacgc
126 gtagaataaacacgc

The alignment and relative orientation of the Forward S Gene Primer (SEQ ID NO:5) and Reverse S Gene Primer (SEQ ID NO:6) of the present invention and the region of the SARS-CoV-2 S gene that these primers amplify in a rRT-PCR assay of SARS-CoV-2 are shown in FIG. 3.

B. Detection of SARS-CoV-2

In accordance with the present invention, the presence or absence of SARS-CoV-2 in a sample, such as a clinical sample, is preferably accomplished using one or more detectably labeled oligonucleotides as probe(s). As used herein, the term ā€œdetectably labeled oligonucleotideā€ denotes a nucleic acid molecule that comprises at least 10 nucleotide residues and not more than 500 nucleotide residues, more preferably, not more than 200 nucleotide residues, still more preferably, not more than 100 nucleotide residues, and still more preferably, not more than 50 nucleotide residues, and that is capable of specifically hybridizing to the RNA or CDNA of SARS-CoV-2. As used herein, the term ā€œspecifically hybridizingā€ denotes the capability of a nucleic acid molecule to detectably anneal to another nucleic acid molecule under conditions in which such nucleic acid molecule does not detectably anneal to a non-complementary nucleic acid molecule. The probes of the present invention permit the detection of SARS-CoV-2-specific polynucleotides, and thus permit a diagnosis of COVID-19. Additionally, the variant probes of the present invention permit the detection of polymorphisms (such as single nucleotide polymorphisms (SNPs), e.g., the SNPs that cause the D614G, V515F, V622I, P631S polymorphisms in the SARS-CoV-2 S gene), that may be present in the SARS-CoV-2 polynucleotides of a clinical sample. SNPs may be advantageously detected using two probes having distinguishable labels.

Detection can be accomplished using any suitable method, e.g., molecular beacon probes, HyBeaconĀ® probes, scorpion primer-probes, TaqMan probes, biotinylated oligoprobes in an enzyme-linked immunosorbent assay-based format, turbidity, radioisotopic-labeled oligoprobes, chemiluminescent detectors, amplification of the probe sequences using Q beta replicase, PNA-based detectors, LAMP, etc. (Bustin, S. A. et al. (2020) ā€œRT-qPCR Testing of SARS-CoV-2: A Primer,ā€ Intl. J. Molec. Sci. 21:3004:1-9; Chang, G.-J. J. et al. (1994) ā€œAn Integrated Target Sequence and Signal Amplification Assay, Reverse Transcriptase-PCR-Enzyme-Linked Immunosorbent Assay, To Detect and Characterize Flaviviruses,ā€ J. Clin. Microbiol. 32(2):477-483; Navarro, E. et al. (2015) ā€œReal-Time PCR Detection Chemistry,ā€ Clin. Chim. Acta 439:231-250; Persing, D. H. et al. (1989) ā€œIn Vitro Amplification Techniques For The Detection Of Nucleic Acids: New Tools For The Diagnostic Laboratory,ā€ Yale J. Biol. Med. 62(2):159-171; Schwab, K. J. et al. (2001) ā€œDevelopment Of A Reverse Transcription-PCR-DNA Enzyme Immunoassay For Detection Of ā€œNorwalk-Likeā€ Viruses And Hepatitis A Virus In Stool And Shellfish. Applied And Environmental Microbiology,ā€ 67(2):742-749; Yuan, X. et al. (2019) ā€œLAMP Real-Time Turbidity Detection For Fowl Adenovirus,ā€ BMC Vet. Res. 15: 256:1-4; French, D. J. et al. (2001) ā€œHyBeacon Probes: A New Tool For DNA Sequence Detection And Allele Discrimination,ā€ Mol. Cell. Probes 15(6):363-374; French, D. J. et al. (2006) ā€œHyBeaconsĀ®: A Novel DNA Probe Chemistry For Rapid Genetic Analysis,ā€ Intl. Cong. Series 1288:707-709; French, D. J. et al. (2008) ā€œHyBeacon Probes For Rapid DNA Sequence Detection And Allele Discrimination,ā€ Methods Mol. Biol. 429:171-85; Notomi, T. et al. (2000) ā€œLoop-Mediated Isothermal Amplification Of DNA,ā€ Nucl. Acids Res. 28(12):E63:1-7; Zhang, H. et al. (2019) ā€œLAMP-On-A-Chip: Revising Microfluidic Platforms For Loop-Mediated DNA Amplification,ā€ Trends Analyt. Chem. 113:44-53; Eiken Chemical Co., Ltd. (2020) ā€œEiken Chemical Launches the Loopamp 2019 nCoV Detection Kit,ā€ Press Release; pages 1-2; Zhang, H. et al. (2019) ā€œLAMP-On-A-Chip: Revising Microfluidic Platforms For Loop-Mediated DNA Amplification,ā€ Trends Analyt. Chem. 113:44-53; Yuan, X. et al. (2019) ā€œLAMP Real-Time Turbidity Detection For Fowl Adenovirus,ā€ BMC Vet. Res. 15: 256:1-4; U.S. Pat. Nos. 6,974,670; 7,175,985; 7,348,141; 7,399,588; 7,494,790; 7,998,673; and 9,909,168).

Preferably, the detection of the amplified SARS-CoV-2 polynucleotides of the present invention employs an oligonucleotide that is labeled with a fluorophore and complexed to a quencher of the fluorescence of that fluorophore (Navarro, E. et al. (2015) ā€œReal-Time PCR Detection Chemistry,ā€ Clin. Chim. Acta 439:231-250).

A wide variety of fluorophores and quenchers are known and are commercially available (e.g., Biosearch Technologies, Gene Link), and may be used in accordance with the methods of the present invention. Preferred fluorophores include the fluorophores Biosearch Blue, Alexa488, FAM, Oregon Green, Rhodamine Green-X, NBD-X, TET, Alexa430, BODIPY R6G-X, CAL Fluor Gold 540, JOE, Yakima Yellow, Alexa 532, VIC, HEX, and CAL Fluor Orange 560 (which have an excitation wavelength in the range of about 352-538 nm and an emission wavelength in the range of about 447-559 nm, and whose fluorescence can be quenched with the quencher BHQ1), or the fluorophores RBG, Alexa555, BODIPY 564/570, BODIPY TMR-X, Quasar 570, Cy3, Alexa 546, NED, TAMRA, Rhodamine Red-X, BODIPY 581/591, Redmond Red, CAL Fluor Red 590, Cy3.5, ROX, Alexa 568, CAL Fluor Red 610, BODIPY TR-X, Texas Red, CAL Fluor Red 635, Pulsar 650, Cy5, Quasar 670, CY5.5, Alexa 594, BODIPY 630/650-X, or Quasar 705 (which have an excitation wavelength in the range of about 524-690 nm and an emission wavelength in the range of about 557-705 nm, and whose fluorescence can be quenched with the quencher BHQ2). The preferred SARS-CoV-2-specific probes of the present invention are labeled with either the fluorophore 2′,7′-dimethoxy-4′,5′-dichloro-6-carboxyfluorescein (ā€œJOEā€) or the fluorophore 5(6)-carboxyfluorescein (ā€œFAMā€) on their 5′ termini. JOE is a xanthene fluorophore with an emission in yellow range (absorption wavelength of 520 nm; emission wavelength of 548 nm). FAM is a carboxyfluorescein molecule with an absorption wavelength of 495 nm and an emission wavelength of 517 nm; it is typically provided as a mixture of two isomers (5-FAM and 6-FAM). Quasar 670 is similar to cyanine dyes, and has an absorption wavelength of 647 nm and an emission wavelength of 670 nm.

The black hole quencher 1 (ā€œBHQ1ā€) is a preferred quencher for FAM and JOE fluorophores. BHQ1 quenches fluorescent signals of 480-580 nm and has an absorption maximum at 534 nm.

The black hole quencher 2 (ā€œBHQ2ā€) is a preferred quencher for Quasar 670. BHQ2 quenches fluorescent signals of 560-670 nm and has an absorption maximum at 579 nm.

JOE, FAM, Quasar 670, BHQ1 and BHQ2 are widely available commercially (e.g., Sigma Aldrich; Biosearch Technologies, etc.) and are coupled to oligonucleotides using methods that are well known (see, e.g., Zearfoss, N. R. et al. (2012) ā€œEnd-Labeling Oligonucleotides with Chemical Tags After Synthesis,ā€ Meth. Mol. Biol. 941:181-193). Oligonucleotide probes of any desired sequence labeled may be obtained commercially (e.g., ThermoFisher Scientific) already labeled with a desired fluorophore and complexed to a desired quencher.

As discussed above, the proximity of the quencher of a probe to the fluorophore of that probe results in a quenching of the fluorescent signal. Incubation of the probe in the presence of a double-strand-dependent 5″→3 exonuclease (such as the 5″→3″ exonuclease activity of Taq polymerase) cleaves the probe when it has hybridized to a complementary target sequence, thus separating the fluorophore from the quencher and permitting the production of a detectable fluorescent signal.

In a preferred embodiment, such oligonucleotides are modified to be TaqMan probes by being detectably complexed to a fluorophore and a quencher, with the fluorophore being preferably complexed to a nucleotide residue within 5 nucleotides, within 4 nucleotides, within 3 nucleotides, or within 2 nucleotides of the 5′ terminus of the probe, and the quencher being preferably complexed to a nucleotide residue within 5 nucleotides, within 4 nucleotides, within 3 nucleotides, or within 2 nucleotides of the 3′ terminus of the probe. In one embodiment, the fluorophore is complexed to the 5′ terminal nucleotide residue of the probe and the quencher is complexed to the 3′ terminal nucleotide of the probe. Labeling for molecular beacon and scorpion primer-probes is similar, but the positions of the fluorophore and quencher are modified in order to account for the presence of stem oligonucleotides and/or a PCR primer oligonucleotide.

1. Preferred Probes for Detecting SARS-CoV-2

(a) Preferred Probes for Detecting SARS-CoV-2 ORF1ab

The preferred probe for detecting the region of ORF1ab that is amplified by the above-described preferred ORF1ab Primers (SEQ ID NO:1 and SEQ ID NO:2) comprises, consists essentially of, or consists of, the nucleotide sequence (SEQ ID NO:9) tgcccgtaatggtgttcttattacaga (the preferred ā€œORF1ab Probeā€). Alternatively, an oligonucleotide that comprises, consists essentially of, or consists of, the complementary nucleotide sequence (SEQ ID NO:10) tctgtaataagaacaccattacgggca could be employed. The alignment and relative position of the preferred ORF1ab Probe of the present invention is shown in FIG. 2.

While the preferred rRT-PCR assays of the present invention detect the presence of the ORF1ab using a probe that consists of the nucleotide sequence of SEQ ID NO:9 or a probe that consists of the nucleotide sequence of SEQ ID NO:10, the invention contemplates that other probes that comprise an oligonucleotide domain that consists essentially of the nucleotide sequence of SEQ ID NO:9 or SEQ ID NO:10 (in that they possess 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional nucleotide residues, but retain the ability to specifically hybridize to DNA molecules having the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4, and more that preferably retain the ability to specifically hybridize to DNA molecules having the nucleotide sequence of SEQ ID NO:9 or SEQ ID NO:10), or ā€œvariantsā€ of such probes that comprise an oligonucleotide domain that exhibits the ability to specifically hybridize to DNA molecules having the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4, and more that preferably exhibits the ability to specifically hybridize to DNA molecules having the nucleotide sequence of SEQ ID NO:9 or SEQ ID NO:10 could be employed in accordance with the principles and goals of the present invention. Such ā€œVariant ORF1ab Probesā€ may, for example:

  • (1) lack 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides of SEQ ID NO:9 or of SEQ ID NO:10, or
  • (2) lack 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the 10 3′ terminal nucleotides of the sequence of SEQ ID NO:9 or of SEQ ID NO:10, or
  • (3) lack 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the 10 5′ terminal nucleotides of the sequence of SEQ ID NO:9 or of SEQ ID NO:10, or
  • (4) have a sequence that differs from that of SEQ ID NO:9 or of SEQ ID NO:10 in having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 additional nucleotides, or
  • (5) have a sequence that differs from that of SEQ ID NO:9 or of SEQ ID NO:10 in having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 substitution nucleotides in lieu of the nucleotides present in SEQ ID NO:9 or of SEQ ID NO:10, or
  • (6) combinations of such (1)-(5).
    Non-limiting examples of such probes are shown in Table 7 and Table 8.

TABLEā€ƒ7ā€ƒ
Illustrativeā€ƒSARS-CoV-2ā€ƒOligonucleotide
Domainsā€ƒofā€ƒSense-Strandā€ƒProbesā€ƒforā€ƒDetectingā€ƒ
theā€ƒPresenceā€ƒofā€ƒtheā€ƒSARS-CoV-2ā€ƒORF1ab
SEQ
IDā€ƒNO Sequence
127 tgcccgtaatggtgttcttattacag
128 tgcccgtaatggtgttcttattaca
129 tgcccgtaatggtgttcttattac
130 tgcccgtaatggtgttcttatta
131 tgcccgtaatggtgttcttatt
132 tgcccgtaatggtgttcttat
133 tgcccgtaatggtgttctta
134 gcccgtaatggtgttcttattacaga
135 cccgtaatggtgttcttattacaga
136 ccgtaatggtgttcttattacaga
137 cgtaatggtgttcttattacaga
138 gtaatggtgttcttattacaga
139 taatggtgttcttattacaga
140 aatggtgttcttattacaga
141 ttcttattacagaaggtagt
142 gcccgtaatggtgttcttattaca
143 gcccgtaatggtgttcttattac
144 cccgtaatggtgttcttattac
145 cccgtaatggtgttcttatta
146 ccgtaatggtgttcttatta

TABLEā€ƒ8ā€ƒ
Illustrativeā€ƒSARS-CoV-2ā€ƒOligonucleotide
Domainsā€ƒofā€ƒAntisense-Strandā€ƒProbesā€ƒforā€ƒDetecting
theā€ƒPresenceā€ƒofā€ƒtheā€ƒSARS-CoV-2ā€ƒORF1ab
SEQ
IDā€ƒNO Sequence
147 tctgtaataagaacaccattacgggc
148 tctgtaataagaacaccattacggg
149 tctgtaataagaacaccattacgg
150 tctgtaataagaacaccattacg
151 tctgtaataagaacaccattac
152 tctgtaataagaacaccatta
153 tctgtaataagaacaccatt
154 ctgtaataagaacaccattacgggca
155 tgtaataagaacaccattacgggca
156 gtaataagaacaccattacgggca
157 taataagaacaccattacgggca
158 aataagaacaccattacgggca
159 ataagaacaccattacgggca
160 taagaacaccattacgggca
161 ctgtaataagaacaccattacgggc
162 tgtaataagaacaccattacgggc
163 gtaataagaacaccattacgggc
164 gtaataagaacaccattacggg
165 taataagaacaccattacggg
166 taataagaacaccattacgg

(b) Preferred Probes for Detecting SARS-CoV-2 S Gene

The preferred probe for detecting the region of the S gene that is amplified by the above-described preferred S Gene Primers (SEQ ID NO:5 and SEQ ID NO:6) comprises, consists essentially of, or consists of, the sequence (SEQ ID NO:11) tgcacagaagtccctgttgct (the preferred ā€œS Gene Probeā€). Alternatively, an oligonucleotide that comprises, consists essentially of, or consists of, the complementary nucleotide sequence (SEQ ID NO:12) agcaacagggacttctgtgca could be employed. The alignment and relative position of the S Gene Probe of the present invention is shown in FIG. 3.

While the preferred rRT-PCR assays of the present invention detect the presence of the S gene using a probe that consists of the nucleotide sequence of SEQ ID NO:11 or a probe that consists of the nucleotide sequence of SEQ ID NO:12, the invention contemplates that other probes that comprise an oligonucleotide domain that consists essentially of the nucleotide sequence of SEQ ID NO:11 or SEQ ID NO:12 (in that they possess 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional nucleotide residues, but retain the ability to specifically hybridize to DNA molecules having the nucleotide sequence of SEQ ID NO:7 or SEQ ID NO:8, and that more preferably retain the ability to specifically hybridize to DNA molecules having the nucleotide sequence of SEQ ID NO:11 or SEQ ID NO:12), or ā€œvariantsā€ of such probes that comprise an oligonucleotide domain that exhibits the ability to specifically hybridize to DNA molecules having the nucleotide sequence of SEQ ID NO:7 or SEQ ID NO:8, and more that preferably exhibits the ability to specifically hybridize to DNA molecules having the nucleotide sequence of SEQ ID NO:11 or SEQ ID NO:12 could be employed in accordance with the principles and goals of the present invention. Such ā€œVariant S Gene Probesā€ may, for example:

  • (1) lack 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides of SEQ ID NO:11 or of SEQ ID NO:12, or
  • (2) lack 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the 10 3′ terminal nucleotides of the sequence of SEQ ID NO:11 or of SEQ ID NO:12, or
  • (3) lack 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the 10 5′ terminal nucleotides of the sequence of SEQ ID NO:11 or of SEQ ID NO:12, or
  • (4) have a sequence that differs from that of SEQ ID NO:11 or of SEQ ID NO:12 in having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 additional nucleotides, or
  • (5) have a sequence that differs from that of SEQ ID NO:11 or of SEQ ID NO:12 in having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 substitution nucleotides in lieu of the nucleotides present in SEQ ID NO:11 or of SEQ ID NO:12, or
  • (6) combinations of such (1)-(5).
    Non-limiting examples of such probes are shown in Table 9 and Table 10 (the nucleotide residue that is responsible for the D614G single nucleotide polymorphism of the SARS-CoV-2 S gene is underlined).

TABLEā€ƒ9ā€ƒ
Illustrativeā€ƒSARS-CoV-2ā€ƒOligonucleotide
Domainsā€ƒofā€ƒSenseā€ƒStrandā€ƒProbesā€ƒforā€ƒDetecting
theā€ƒPresenceā€ƒofā€ƒtheā€ƒSARS-CoV-2ā€ƒSā€ƒGene
SEQ
ID
NO Sequence
11 tgcacagaagtccctgttgct
167 ctgttctttatcaggatgttaactgcacaga
168 ctgttctttatcagggtgttaactgcacaga
169 tgttctttatcaggatgttaactgcacaga
170 tgttctttatcagggtgttaactgcacaga
171 gttctttatcaggatgttaactgcacaga
172 gttctttatcagggtgttaactgcacaga
173 ttctttatcaggatgttaactgcacaga
174 ttctttatcagggtgttaactgcacaga
175 tctttatcaggatgttaactgcacaga
176 tctttatcagggtgttaactgcacaga
177 ctttatcaggatgttaactgcacaga
178 ctttatcagggtgttaactgcacaga
179 tttatcaggatgttaactgcacaga
180 tttatcagggtgttaactgcacaga
181 ttatcaggatgttaactgcacaga
182 ttatcagggtgttaactgcacaga
183 tatcaggatgttaactgcacaga
184 tatcagggtgttaactgcacaga
185 atcaggatgttaactgcacaga
186 atcagggtgttaactgcacaga
187 tcaggatgttaactgcacaga
188 tcagggtgttaactgcacaga
11 tgcacagaagtccctgttgct
189 caggatgttaactgcacaga
190 cagggtgttaactgcacaga
191 ctgttctttatcaggatgttaactgcacag
192 ctgttctttatcagggtgttaactgcacag
193 ctgttctttatcaggatgttaactgcaca
194 ctgttctttatcagggtgttaactgcaca
195 ctgttctttatcaggatgttaactgcac
196 ctgttctttatcagggtgttaactgcac
197 ctgttctttatcaggatgttaactgca
198 ctgttctttatcagggtgttaactgca
199 ctgttctttatcaggatgttaactgc
200 ctgttctttatcagggtgttaactgc
201 ctgttctttatcaggatgttaactg
202 ctgttctttatcagggtgttaactg
203 ctgttctttatcaggatgttaact
204 ctgttctttatcagggtgttaact
205 ctgttctttatcaggatgttaac
206 ctgttctttatcagggtgttaac
207 ctgttctttatcaggatgttaa
208 ctgttctttatcagggtgttaa
209 ctgttctttatcaggatgtta
210 ctgttctttatcagggtgtta
211 ctgttctttatcaggatgtt
212 ctgttctttatcagggtgtt
213 tgttctttatcaggatgttaactgcacaga
214 tgttctttatcagggtgttaactgcacaga
11 tgcacagaagtccctgttgct
215 tgttctttatcaggatgttaactgcacag
216 tgttctttatcagggtgttaactgcacag
217 gttctttatcaggatgttaactgcacag
218 gttctttatcagggtgttaactgcacag
219 gttctttatcaggatgttaactgcaca
220 gttctttatcagggtgttaactgcaca
221 ttctttatcaggatgttaactgcaca
222 ttctttatcagggtgttaactgcaca
223 ttctttatcaggatgttaactgcac
224 ttctttatcagggtgttaactgcac
225 tctttatcaggatgttaactgcac
226 tctttatcagggtgttaactgcac
227 tctttatcaggatgttaactgca
228 totttatcagggtgttaactgca
229 ctttatcaggatgttaactgca
230 ctttatcagggtgttaactgca
231 ctttatcaggatgttaactgc
232 ctttatcagggtgttaactgc
233 tttatcaggatgttaactgc
234 tttatcagggtgttaactgc
235 tttatcaggatgttaactg
236 tttatcagggtgttaactg
237 ttatcaggatgttaactg
238 ttatcagggtgttaactg
239 tatcaggatgttaactg
240 tatcagggtgttaactg
11 tgcacagaagtccctgttgct
241 tatcaggatgttaact
242 tatcagggtgttaact
243 atcaggatgttaact
244 atcagggtgttaact
245 tcaggatgttaact
246 tcagggtgttaact
247 tcaggatgttaac
248 tcagggtgttaac
249 tcaggatgttaa
250 tcagggtgttaa
251 tcaggatgtta
252 tcagggtgtta
253 gcacagaagtccctgttgct
254 cacagaagtccctgttgct
255 acagaagtccctgttgct
256 cagaagtccctgttgct
257 cagaagtccctgttgctatt
258 agaagtccctgttgct
259 gaagtccctgttgct
260 tgcacagaagtccctgttgc
261 tgcacagaagtccctgttg
262 tgcacagaagtccctgtt
263 tgcacagaagtccctgt
264 tgcacagaagtccctg
265 tgcacagaagtccct
266 gcacagaagtccctgttgc
11 tgcacagaagtccctgttgct
267 cacagaagtccctgttgc
268 cacagaagtccctgttg
269 acagaagtccctgttgc
270 acagaagtccctgttg
271 cagaagtccctgttgc
272 cagaagtccctgttg

TABLEā€ƒ10ā€ƒ
Illustrativeā€ƒSARS-CoV-2ā€ƒOligonucleotide
Domainsā€ƒofā€ƒAntisense-Strandā€ƒProbesā€ƒfor
Detectingā€ƒtheā€ƒPresenceā€ƒofā€ƒtheā€ƒSARS-CoV-2ā€ƒSā€ƒGene
SEQ
IDā€ƒNO Sequence
12 agcaacagggacttctgtgca
273 tctgtgcagttaacatcctgataaagaacag
274 tctgtgcagttaacatcctgataaagaacag
275 tctgtgcagttaacaccctgataaagaacag
276 ctgtgcagttaacatcctgataaagaacag
277 ctgtgcagttaacaccctgataaagaacag
278 tgtgcagttaacatcctgataaagaacag
279 tgtgcagttaacaccctgataaagaacag
280 gtgcagttaacatcctgataaagaacag
281 gtgcagttaacaccctgataaagaacag
282 tgcagttaacatcctgataaagaacag
283 tgcagttaacaccctgataaagaacag
284 gcagttaacatcctgataaagaacag
285 gcagttaacaccctgataaagaacag
12 agcaacagggacttctgtgca
286 cagttaacatcctgataaagaacag
287 cagttaacaccctgataaagaacag
288 agttaacatcctgataaagaacag
289 agttaacaccctgataaagaacag
290 gttaacatcctgataaagaacag
291 gttaacaccctgataaagaacag
292 ttaacatcctgataaagaacag
293 ttaacaccctgataaagaacag
294 taacatcctgataaagaacag
295 taacaccctgataaagaacag
296 aacatcctgataaagaacag
297 aacaccctgataaagaacag
298 tctgtgcagttaacatcctgataaagaaca
299 tctgtgcagttaacaccctgataaagaaca
300 tctgtgcagttaacatcctgataaagaac
301 tctgtgcagttaacaccctgataaagaac
302 tctgtgcagttaacatcctgataaagaa
303 tctgtgcagttaacaccctgataaagaa
304 tctgtgcagttaacatcctgataaaga
305 tctgtgcagttaacaccctgataaaga
306 tctgtgcagttaacatcctgataaag
307 tctgtgcagttaacaccctgataaag
308 tctgtgcagttaacatcctgataaa
309 tctgtgcagttaacaccctgataaa
310 tctgtgcagttaacatcctgataa
311 tctgtgcagttaacaccctgataa
312 tctgtgcagttaacatcctgata
12 agcaacagggacttctgtgca
313 tctgtgcagttaacaccctgata
314 tctgtgcagttaacatcctgat
315 tctgtgcagttaacaccctgat
316 tctgtgcagttaacatcctga
317 tctgtgcagttaacaccctga
318 tctgtgcagttaacatcctg
319 tctgtgcagttaacaccctg
320 ctgtgcagttaacatcctgataaagaacag
321 ctgtgcagttaacaccctgataaagaacag
322 ctgtgcagttaacatcctgataaagaaca
323 ctgtgcagttaacaccctgataaagaaca
324 tgtgcagttaacatcctgataaagaaca
325 tgtgcagttaacaccctgataaagaaca
326 tgtgcagttaacatcctgataaagaac
327 tgtgcagttaacaccctgataaagaac
328 gtgcagttaacatcctgataaagaac
329 gtgcagttaacaccctgataaagaac
330 gtgcagttaacatcctgataaagaa
331 gtgcagttaacaccctgataaagaa
332 tgcagttaacatcctgataaagaa
333 tgcagttaacaccctgataaagaa
334 tgcagttaacatcctgataaaga
335 tgcagttaacaccctgataaaga
336 gcagttaacatcctgataaaga
337 gcagttaacaccctgataaaga
338 cagttaacatcctgataaaga
339 cagttaacaccctgataaaga
12 agcaacagggacttctgtgca
340 agttaacatcctgataaaga
341 agttaacaccctgataaaga
342 agttaacatcctgataaag
343 agttaacaccctgataaag
344 gttaacatcctgataaag
345 gttaacaccctgataaag
346 gttaacatcctgataaa
347 gttaacaccctgataaa
348 ttaacatcctgataaa
349 ttaacaccctgataaa
350 ttaacatcctgataa
351 ttaacaccctgataa
352 taacatcctgataa
353 taacaccctgataa
354 taacatcctgata
355 taacaccctgata
356 taacatcctgat
357 taacaccctgat
358 taacatcctg
359 taacaccctg
360 aacatcctgat
361 aacaccctgat
362 aacatcctga
363 aacaccctga
364 gcaacagggacttctgtgca
365 caacagggacttctgtgca
366 aacagggacttctgtgca
12 agcaacagggacttctgtgca
367 acagggacttctgtgca
368 cagggacttctgtgca
369 agggacttctgtgca
370 agcaacagggacttctgtgc
371 agcaacagggacttctgtg
372 agcaacagggacttctgt
373 agcaacagggacttctg
374 agcaacagggacttct
375 agcaacagggacttc
376 gcaacagggacttctgtgca
377 gcaacagggacttctgtgc
378 caacagggacttctgtgc
379 caacagggacttctgtg
380 aacagggacttctgtg
381 aacagggacttctgt

2. Preferred Types of Probes

(a) TaqMan Probes

In a preferred embodiment, TaqMan probes are employed to detect amplified SARS-CoV-2 oligonucleotides in accordance with the present invention. As described above, such probes are labeled on their 5′ termini with a fluorophore, and are complexed on their 3′ termini with a quencher of the fluorescence of that fluorophore. In order to simultaneously detect the amplification of two polynucleotide domains of SARS-CoV-2, two TaqMan probes are employed that have different fluorophores (with differing and distinguishable emission wavelengths); the employed quenchers may be the same or different. The chemistry and design of ā€œTaqManā€ probes is reviewed by Holland, P. M. et al. (1991) (ā€œDetection Of Specific Polymerase Chain Reaction Product By Utilizing The 5′→3′ Exonuclease Activity Of Thermus aquaticus DNA Polymerase,ā€ Proc. Natl. Acad. Sci. (U.S.A.) 88(16):7276-7280), by Navarro, E. et al. (2015) (ā€œReal-Time PCR Detection Chemistry,ā€ Clin. Chim. Acta 439:231-250), and by Gasparic, B. M. et al. (2010) (ā€œComparison Of Nine Different Real-Time PCR Chemistries For Qualitative And Quantitative Applications In GMO Detection,ā€ Anal. Bioanal. Chem. 396(6):2023-2029).

Suitable fluorophores and quenchers are as described above. In one embodiment of the invention, the 5′ terminus of the ORF1ab Probe is labeled with the fluorophore JOE, and the 3′ terminus of such probe is complexed to the quencher BHQ1 and the 5′ terminus of the S Gene Probe is labeled with the fluorophore FAM, and the 3′ terminus of such probe is complexed to the quencher BHQ1. In an alternative embodiment, the 5′ terminus of the ORF1ab Probe is labeled with the fluorophore FAM, and the 5′ terminus of the S Gene Probe is labeled with the fluorophore JOE. The use of such two fluorophores permits both probes to be used in the same assay.

Any of the SARS-CoV-2 oligonucleotide domains of the above-described ORF1ab probes may be employed to form TaqMan probes suitable for detecting the region of ORF1ab that is amplified by the above-described preferred ORF1ab Primers (e.g., SEQ ID NO:1, SEQ ID NO:2, any of SEQ ID NOs:17-28, any of SEQ ID NOs:29-42, any of SEQ ID NOs:398-399, any of SEQ ID NOs:403-406, and their respective variants).

Illustrative TaqMan ORF1ab probes may thus comprise any of the SARS-CoV-2 oligonucleotide domains of the above-described ORF1ab probes (e.g., SEQ ID NO:9, SEQ ID NO:10, any of SEQ ID NOs:127-146, or any of SEQ ID NOs:147-166, etc.)). As discussed above, the 5′ terminus of the TaqMan ORF1ab probe is labeled with a fluorophore, and the 3′ terminus of the probe is complexed to a quencher.

Similarly, any of the SARS-CoV-2 oligonucleotide domains of the above-described S gene probes may be employed to form TaqMan probes suitable for detecting the region of the S gene that is amplified by the above-described preferred S Gene Primers (e.g., SEQ ID NO:5, SEQ ID NO:6, any of SEQ ID NOs:43-70, any of SEQ ID NOs:71-84, any of SEQ ID NOs:85-112, any of SEQ ID NOs:113-126, or any of SEQ ID NOs:400-402, or any of SEQ ID NOs:407-410, and their respective variants).

Illustrative TaqMan S Gene probes may comprise any of the SARS-CoV-2 oligonucleotide domains of the above-described S gene probes (e.g., SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, or any of SEQ ID NOs:364-381, etc.)). As discussed above, the 5′ terminus of the TaqMan S Gene probe is labeled with a fluorophore, and the 3′ terminus of the probe is complexed to a quencher.

(b) Molecular Beacon Probes

Molecular beacon probes can alternatively be employed to detect amplified SARS-CoV-2 oligonucleotides in accordance with the present invention. Molecular beacon probes are also labeled with a fluorophore and complexed to a quencher. However, in such probes, the quenching of the fluorescence of the fluorophore only occurs when the quencher is directly adjacent to the fluorophore. Molecular beacon probes are thus designed to adopt a hairpin structure while free in solution (thus bringing the fluorescent dye and quencher into close proximity with one another). When a molecular beacon probe hybridizes to a target, the fluorophore is separated from the quencher, and the fluorescence of the fluorophore becomes detectable. Unlike TaqMan probes, molecular beacon probes are designed to remain intact during the amplification reaction, and must re-anneal to the target nucleic acid molecule in every cycle for signal measurement. The chemistry and design of molecular beacon probes is reviewed by Han, S. X. et al. (2013) (ā€œMolecular Beacons: A Novel Optical Diagnostic Tool,ā€ Arch. Immunol. Ther. Exp. (Warsz). 61(2):139-148), by Navarro, E. et al. (2015) (ā€œReal-Time PCR Detection Chemistry,ā€ Clin. Chim. Acta 439:231-250), by Goel, G. et al. (2005) (ā€œMolecular Beacon: A Multitask Probe,ā€ J. Appl. Microbiol. 99(3):435-442), by Kitamura, Y. et al. (2020) (ā€œElectrochemical Molecular Beacon for Nucleic Acid Sensing in a Homogeneous Solution,ā€ Analyt. Sci. 36:959-964), and by Zheng, J. et al. (2015) (ā€œRationally Designed Molecular Beacons For Bioanalytical And Biomedical Applications,ā€ Chem. Soc. Rev. 44(10):3036-3055). The use of molecular beacon probes to detect polymorphisms is reviewed by Peng, Q. et al. (2020) (ā€œA Molecular-Beacon-Based Asymmetric PCR Assay For Detecting Polymorphisms Related To Folate Metabolism,ā€ J. Clin. Lab. Anal. 34:e23337:1-7).

Additional nucleotides and/or linkers (e.g., oligo ethylene glycol linkers) may be interposed between the stem oligonucleotides and the loop oligonucleotide of the hairpin structure in order to provide improve the detection of single nucleotide polymorphisms (Farzan, V. M. et al. (2017) ā€œSpecificity Of SNP Detection With Molecular Beacons Is Improved By Stem And Loop Separation With Spacers,ā€ Analyst 142:945-950). ā€œDumbbellā€ molecular beacon probes may be used to detect single nucleotide polymorphisms using a single label (Bengston, H. N. et al. (2014) ā€œA Differential Fluorescent Receptor for Nucleic Acid Analysis,ā€ Chembiochem. 15(2):228-231).

The design of molecular beacon probes can be assisted using software, such as Beacon Designer (Premier Biosoft) (Thorton, B. et al. (2011) ā€œReal-Time PCR (qPCR) Primer Design Using Free Online Software,ā€ Biochem. Molec. Biol. Educat. 39(2):145-154). However, common considerations are typically sufficient for acceptable results (Kolpashchikov, D. M. (2012) ā€œAn Elegant Biosensor Molecular Beacon Probe: Challenges And Recent Solutions,ā€ Scientifica (Cairo). 2012:928783:1-17). Overall, to favor the formation of the probe-target complex, the melting temperature of the loop domain should be higher than that of the stem. The loop is typically 15-20 nucleotides long and fully complementary to the analyte. The stem should be C/G rich and contain 4-7 base pairs to ensure high stability and acceptable hybridization rates. Longer and more stable stems will reduce hybridization rates but may improve assay selectivity (Tsourkas, A. et al. (2003) ā€œHybridization Kinetics And Thermodynamics Of Molecular Beacons,ā€ Nucleic Acids Research 31(4): 1319-1330). The melting temperature of the stem should be at least 7° C. higher than the assay temperature to ensure efficient fluorescent quenching in the free MB probe. If the assay is SNP specific, the interrogated position should be complementary to a nucleotide close to the middle position of the loop sequence for better allele differentiation (Kolpashchikov, D. M. (2012) ā€œAn Elegant Biosensor Molecular Beacon Probe: Challenges And Recent Solutions,ā€ Scientifica (Cairo). 2012:928783:1-17; Finetti-Sialer, M. M. et al. (2005) ā€œIsolate-Specific Detection of Grapevine fanleaf virus from Xiphinema index Through DNA-Based Molecular Probes,ā€ Phytopathology 95(3):262-268).

Such probes thus comprise two small (e.g., 5-7 nucleotide long) complementary oligonucleotides positioned so as to flank the SARS-CoV-2 oligonucleotide and cause the probe to adopt a stem and loop-containing hairpin structure that positions a quencher adjacent to a fluorophore unless the probe's secondary structure is disrupted by hybridization to an oligonucleotide sequence that is complementary to the probe's loop sequence. The 5′ terminal portion of the complementary oligonucleotide that is positioned 5′ to the SARS-CoV-2 oligonucleotide is preferably labeled with a fluorophore, and the 3′ terminal domain of the complementary oligonucleotide that is positioned 3′ to the SARS-CoV-2 oligonucleotide is preferably complexed to a quencher of such fluorophore. Although it is preferred that such fluorophore be complexed to the 5′ terminal residue of the complementary oligonucleotide that is positioned 5′ to the SARS-CoV-2 oligonucleotide, it may be complexed within 5 nucleotides, within 4 nucleotides, within 3 nucleotides, or within 2 nucleotides of such 5′ terminal residue. Similarly, although it is preferred that such quencher be complexed to the 3′ terminal residue of the complementary oligonucleotide that is positioned 3′ to the SARS-CoV-2 oligonucleotide, it may be complexed within 5 nucleotides, within 4 nucleotides, within 3 nucleotides, or within 2 nucleotides of such 3′ terminal residue.

Examples of complementary oligonucleotides that may be added to the 3′ or 5′ termini of a SARS-CoV-2 oligonucleotide to form a molecular beacon probe include cggcgcc (SEQ ID NO:382) and its complement gcgccgg (SEQ ID NO:383); cggcgc (SEQ ID NO:384) and its complement gcgccg (SEQ ID NO:385); ccccccc (SEQ ID NO:386) and its complement ggggggg (SEQ ID NO:387); cccccc (SEQ ID NO:388) and its complement gggggg (SEQ ID NO:389); ccccc (SEQ ID NO:390) and its complement ggggg (SEQ ID NO:391); cgacc (SEQ ID NO:392) and its complement ggtcg (SEQ ID NO:393); ggcgc (SEQ ID NO:394) and its complement gcgcc (SEQ ID NO:395); gcgag (SEQ ID NO:396) and its complement ctcgc (SEQ ID NO:397).

Any of the SARS-CoV-2 oligonucleotide domains of the above-described ORF1ab probes may be employed as the loop domain of a molecular beacon probe suitable for detecting the region of ORF1ab that is amplified by the above-described preferred ORF1ab Primers (e.g., SEQ ID NO:1, SEQ ID NO:2, any of SEQ ID NOs:17-28, any of SEQ ID NOs:29-42, any of SEQ ID NOs:398-399, any of SEQ ID NOs:403-406, and their respective variants). Additional molecular beacon probes for the SARS-CoV-2 ORF1ab having shorter or longer loop regions can be readily constructed, for example by reducing or increasing the size of employed SARS-CoV-2 ORF1ab loop oligonucleotide, as desired.

Illustrative ORF1ab molecular beacon probes may comprise, from 5′ to 3′, a 5′ stem oligonucleotide (e.g., any of SEQ ID NOs:382-397, etc.), an ORF1ab oligonucleotide (e.g., any of the SARS-CoV-2 oligonucleotide domains of the above-described ORF1ab probes (e.g., SEQ ID NO:9, SEQ ID NO:10, any of SEQ ID NOs:127-146, or any of SEQ ID NOs:147-166, etc.)), which forms the loop domain of the molecular beacon probe, and a 3′ stem oligonucleotide whose sequence is complementary to that of the probe's 5′ stem oligonucleotide. As discussed above, the 5′ terminus of the ORF1ab molecular beacon probe is labeled with a fluorophore, and the 3′ terminus of the ORF1ab molecular beacon probe is complexed to a quencher. Additional molecular beacon probes for the SARS-CoV-2 ORF1ab having shorter or longer loop regions can be readily constructed, for example by reducing or increasing the size of employed SARS-CoV-2 ORF1ab loop oligonucleotide, as desired.

Similarly, any of the SARS-CoV-2 oligonucleotide domains of the above-described S gene probes may be employed as the loop domain of a molecular beacon probe suitable for detecting the region of the S gene that is amplified by the above-described preferred S Gene Primers (e.g., SEQ ID NO:5, SEQ ID NO:6, any of SEQ ID NOs:43-70, any of SEQ ID NOs:71-84, any of SEQ ID NOs:85-112, any of SEQ ID NOs:113-126, or any of SEQ ID NOs:400-402, or any of SEQ ID NOs:407-410, and their respective variants). Additional molecular beacon probes for the SARS-CoV-2 ORF1ab having shorter or longer loop regions can be readily constructed, for example by reducing or increasing the size of employed SARS-CoV-2 ORF1ab loop oligonucleotide, as desired.

Illustrative S Gene molecular beacon probes may comprise, from 5′ to 3′, a 5′ stem oligonucleotide (e.g., any of SEQ ID NOs:382-397, etc.), an S Gene oligonucleotide (e.g., any of the SARS-CoV-2 oligonucleotide domains of the above-described S gene probes (e.g., SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, or any of SEQ ID NOs:364-381, etc.)) which forms the loop domain of the molecular beacon probe, and a 3′ stem oligonucleotide whose sequence is complementary to that of the probe's 5′ stem oligonucleotide. As discussed above, the 5′ terminus of the S Gene molecular beacon probe is labeled with a fluorophore, and the 3′ terminus of the ORF1ab molecular beacon probe is complexed to a quencher. Additional molecular beacon probes for the SARS-CoV-2 S gene having shorter or longer loop regions can be readily constructed, for example by reducing or increasing the size of employed SARS-CoV-2 S gene loop oligonucleotide, as desired. Suitable fluorophores and quenchers are as described above.

(c) Scorpion Primer-Probes

Scorpion primer-probes (Whitcombe, D. et al. (1999) ā€œDetection Of PCR Products Using Self-Probing Amplicons And Fluorescence,ā€ Nat. Biotechnol. 17(8):804-807; Thelwell, N. et al. (2000) ā€œMode Of Action And Application Of Scorpion Primers To Mutation Detection,ā€ Nucleic Acids Res. 28(19):3752-3761; Finetti-Sialer, M. M. et al. (2005) ā€œIsolate-Specific Detection of Grapevine fanleaf virus from Xiphinema index Through DNA-Based Molecular Probes,ā€ Phytopathology 95(3):262-268; Solinas, A. et al. (2001) ā€œDuplex Scorpion Primers In SNP Analysis And FRET Applications,ā€ Nucl. Acids Res. 29(20):E96:1-9) can alternatively be employed to detect amplified SARS-CoV-2 oligonucleotides in accordance with the present invention. Scorpion primer-probes comprise 3′ and 5′ complementary oligonucleotides that are separated by an intervening loop oligonucleotide so as to adopt a stem and loop hairpin structure while free in solution. The 5′ terminus of the 5′ stem oligonucleotide is labeled with a fluorophore. The 3′ terminus of the 3′ stem oligonucleotide is complexed to a quencher, so that upon formation of a hairpin structure with the 5′ stem oligonucleotide, fluorescence is quenched. Scorpion primer-probes differ from molecular beacon probes in that the 3′ terminus of the 3′ stem oligonucleotide is additionally complexed to a blocker of polymerase-mediated primer extension (e.g., a hexaethylene glycol (HEG) blocker (Ma, M. Y. X. et al. (1993) ā€œDesign And Synthesis Of RNA Miniduplexes Via A Synthetic Linker Approach,ā€ Biochemistry 32(7):1751-1758; Ma, M. Y. X. et al. (1993) ā€œDesign And Synthesis Of RNA Miniduplexes Via A Synthetic Linker Approach. 2. Generation Of Covalently Closed, Double-Stranded Cyclic HIV-1 TAR RNA Analogs With High Tat-Binding Affinity,ā€ Nucleic Acids Res. 21(11):2585-2589)), and additionally comprises a 3′ PCR primer oligonucleotide that is complementary to a sequence of a target oligonucleotide. Thus, scorpion primer-probes have the overall structure (5′ to 3′): [fluorophore]-[5′ stem oligonucleotide]-[loop oligonucleotide]-[complementary 3′ stem oligonucleotide]-[quencher]-[blocker]-PCR primer oligonucleotide.

Upon hybridizing to a target oligonucleotide, the 3′ terminus of the PCR primer oligonucleotide is extended; however, the presence of the blocker prevents the polymerase-mediated extension of the 3′ terminus of the target hybridized target oligonucleotide. The sequences of the PCR primer oligonucleotide and the loop oligonucleotide are selected such that the sequence of the loop oligonucleotide is the same as a sequence of the target molecule approximately 11 bases or less downstream from the base of the target molecule that is hybridized to the 3′ terminus of the PCR primer oligonucleotide. Thus, extension of the PCR primer forms a oligonucleotide domain of the scorpion primer-probe that is complementary to the sequence of the loop oligonucleotide. In the next denaturation step of the PCR process, the loop sequence of the scorpion primer-probe hybridizes to the extended PCR product, thus opening the probe's hairpin structure. This separates the scorpion primer-probe's fluorophore from its quencher and permits fluorescence to be detected.

Any of the SARS-CoV-2 oligonucleotide domains of the above-described ORF1ab probes may be employed as the loop domain of a scorpion primer-probe suitable for detecting the region of ORF1ab that is amplified by the above-described preferred ORF1ab Primers (e.g., SEQ ID NO:1, SEQ ID NO:2, any of SEQ ID NOs:17-28, any of SEQ ID NOs:29-42, any of SEQ ID NOs:398-399, any of SEQ ID NOs:403-406, and their respective variants). As discussed above, such probes are similar to molecular beacon probes, but comprise a blocker moiety, typically positioned 3′ to the probe's quencher moiety, and a 3′ PCR primer oligonucleotide.

Illustrative ORF1ab scorpion primer-probes would comprise, from 5′ to 3′, a 5′ stem oligonucleotide (e.g., any of SEQ ID NOs:382-398, etc.), an ORF1ab oligonucleotide (e.g., any of the SARS-CoV-2 oligonucleotide domains of the above-described ORF1ab probes (e.g., SEQ ID NO:9, SEQ ID NO:10, any of SEQ ID NOs:127-146, or any of SEQ ID NOs:147-166, etc.), a 3′ stem oligonucleotide whose sequence is complementary to that of the probe's 5′ stem oligonucleotide, and a PCR primer oligonucleotide domain whose sequence is selected so that it is capable of hybridizing to a region of ORF1ab that is approximately 7 bases, 8 bases, 9 bases, 10 bases, or more preferably 11 bases upstream of an ORF1ab sequence that is the same as the sequence of the probe's ORF1ab oligonucleotide domain (or differs from such sequence by 5, 4, 3, 2 or 1 nucleotide residues), such that extension of the PCR primer oligonucleotide domain forms an extension product whose sequence is complementary to the probe's ORF1ab oligonucleotide domain.

To illustrate the structure of such ORF1ab scorpion primer-probes, the nucleotide sequences of an ORF1ab scorpion primer-probe whose loop polypeptide domain has the sequence of the preferred ORF1ab Probe tgcccgtaatggtgttcttattacaga (SEQ ID NO:9) could have the sequence, from 5′ to 3′, of a 5′ stem oligonucleotide (e.g., any of SEQ ID NOs:382-397, etc.), the preferred ORF1ab Probe (SEQ ID NO:9), a 3′ stem oligonucleotide whose sequence is complementary to that of the probe's 5′ stem oligonucleotide, and a PCR primer oligonucleotide having the sequence gagttgatggtcaagtagac (SEQ ID NO:398, corresponding to residues 12-26 of SEQ ID NO:3). After extension of the primer by 38 bases, the primer extension product contains a domain complementary to the sequence of the preferred ORF1ab Probe. Denaturation occurring in a subsequent step of the PCR process denatures the hybridized, complementary stem oligonucleotides, thereby permitting such oligonucleotides to separate from one another. Such separation attenuates the quenching of the fluorophore and thereby causes the fluorescent signal to become detectable. During the subsequent annealing stage of the PCR process, hybridization occurs between the loop domain of the probe and the complementary primer extension product of the probe. Such hybridization prevents the complementary stem oligonucleotides of the scorpion probe from re-hybridizing to one another, and thus causes the detectable fluorescent signal to be maintained.

Similarly, an ORF1ab scorpion primer-probe whose loop polypeptide domain has the sequence ttcttattacagaaggtagt (SEQ ID NO:141, corresponding to residues 52-73 of SEQ ID NO:3) could have the sequence, from 5′ to 3′, of a 5′ stem oligonucleotide (e.g., any of SEQ ID NOs:382-397, etc.), the ORF1ab oligonucleotide (SEQ ID NO:141), a 3′ stem oligonucleotide whose sequence is complementary to that of the probe's 5′ stem oligonucleotide, and a PCR primer oligonucleotide having the sequence gtagacttatttagaaatgc (SEQ ID NO:399, corresponding to residues 21-40 of SEQ ID NO:3).

Similarly, illustrative S Gene Scorpion Primer-Probes would comprise, from 5′ to 3′, a 5′ stem oligonucleotide (e.g., any of SEQ ID NOs:382-397, etc.), an S Gene oligonucleotide (e.g., any of the SARS-CoV-2 oligonucleotide domains of the above-described ORF1ab probes (e.g., SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, or any of SEQ ID NOs:364-381, etc.)), a 3′ stem oligonucleotide whose sequence is complementary to that of the probe's 5′ stem oligonucleotide, and a PCR primer oligonucleotide domain whose sequence is selected so that it is capable of hybridizing to a region of the S gene that is approximately 7 bases, 8 bases, 9 bases, 10 bases, or more preferably 11 bases upstream of an S gene sequence that is the same as the sequence of the probe's S gene oligonucleotide domain (or differs from such sequence by 5, 4, 3, 2 or 1 nucleotide residues), such that extension of the PCR primer oligonucleotide domain forms an extension product whose sequence is complementary to the probe's S gene oligonucleotide domain.

To illustrate the structure of such S gene scorpion primer-probes, the nucleotide sequences of an S gene scorpion primer-probe whose loop polypeptide domain has the sequence of the preferred S gene probe tgcacagaagtccctgttgct (SEQ ID NO:11) could have the sequence, from 5′ to 3′, of a 5′ stem oligonucleotide (e.g., any of SEQ ID NOs:382-397, etc.), the preferred S gene probe (SEQ ID NO:11), a 3′ stem oligonucleotide whose sequence is complementary to that of the probe's 5′ stem oligonucleotide, and a PCR primer oligonucleotide having the sequence ccaggttgctgttctttatc (SEQ ID NO:400, corresponding to residues 5-24 of SEQ ID NO:7). After extension of the primer by 32 bases, the primer extension product contains a domain complementary to the sequence of the preferred S gene probe. Denaturation occurring in a subsequent step of the PCR process denatures the hybridized, complementary stem oligonucleotides, thereby permitting such oligonucleotides to separate from one another. Such separation attenuates the quenching of the fluorophore and thereby causes the fluorescent signal to become detectable. During the subsequent annealing stage of the PCR process, hybridization occurs between the loop domain of the probe and the complementary primer extension product of the probe. Such hybridization prevents the complementary stem oligonucleotides of the scorpion probe from re-hybridizing to one another, and thus causes the detectable fluorescent signal to be maintained.

Similarly, an S gene scorpion primer-probe whose loop polypeptide domain has the sequence cagaagtccctgttgctatt (SEQ ID NO:257, corresponding to residues 40-59 of SEQ ID NO:7) could have the sequence, from 5′ to 3′, of a 5′ stem oligonucleotide (e.g., any of SEQ ID NOs:382-297, etc.), the S gene oligonucleotide (SEQ ID NO:257), a 3′ stem oligonucleotide whose sequence is complementary to that of the probe's 5′ stem oligonucleotide, and a PCR primer oligonucleotide having either the sequence gttgctgttctttatcagga (SEQ ID NO:401, corresponding to residues 9-28 of SEQ ID NO:7) or the sequence gttgctgttctttatcaggg (SEQ ID NO:402). The nucleotide residue that is responsible for the D614G single nucleotide polymorphism of the SARS-CoV-2 S gene is underlined. The use of S gene scorpion primer-probes having such PCR primer oligonucleotides would distinguish SARS-CoV-2 genomes having the single nucleotide polymorphism responsible for the D614G variation from SARS-CoV-2 S genomes lacking such polymorphism.

As discussed above, the 5′ terminus of the 5′ stem oligonucleotide of such scorpion primer-probes is labeled with a fluorophore, and the 3′ terminus of the 3′ stem oligonucleotide of such scorpion primer-probes is complexed to a quencher, which is separated from the 5′ terminus of the probe's PCR primer oligonucleotide by a blocker moiety. Suitable fluorophores and quenchers are as described above.

(d) HyBeaconā„¢ Probes

As discussed above, the invention additionally contemplates rRT-PCR assays in which detection is mediated through the use of HyBeaconā„¢ probes (LGC Limited). HyBeaconā„¢ probes comprise oligonucleotides that lack significant secondary structure and possess a fluorophore moiety attached to an internal nucleotide, and are typically modified at their 3′ terminus to prevent polymerase-mediated extension (U.S. Pat. Nos. 7,348,141 and 7,998,673; French, D. J. et al. (2001) ā€œHyBeacon Probes: A New Tool For DNA Sequence Detection And Allele Discrimination,ā€ Mol. Cell. Probes 15(6):363-374; French, D. J. et al. (2006) ā€œHyBeaconsĀ®: A Novel DNA Probe Chemistry For Rapid Genetic Analysis,ā€ Intl. Cong. Series 1288:707-709; French, D. J. et al. (2008) ā€œHyBeacon Probes For Rapid DNA Sequence Detection And Allele Discrimination,ā€ Methods Mol Biol. 429:171-85). Such probes do not rely on probe secondary structures, enzymatic digestion or interaction with additional oligonucleotides for target detection and sequence discrimination, but instead emit greater amounts of fluorescence when hybridized to complementary target oligonucleotides than when present in a non-hybridized single-stranded conformation. This shift in the quantity of fluorescence emission occurs as a direct result of target hybridization and, therefore, permits the detection and discrimination of DNA sequences by real-time PCR and melting curve analysis methodologies. Sequences differing by as little as a single nucleotide may be distinguished by measuring and exploiting the variation in Tm that occurs between different probe/target duplexes. HyBeaconā„¢ Probes do not rely on probe secondary structures, enzymatic digestion or interaction with additional oligonucleotides for target detection and sequence discrimination. Typically, the HyBeaconā„¢ probes of the present invention comprise 20 nucleotides or more in length. Suitable fluorophores and quenchers are as described above. Exemplary fluorophores that may be employed as the fluorophore of such probes include FAM, HEX, and TET.

Any of the SARS-CoV-2 oligonucleotide domains of the above-described ORF1ab probes (e.g., SEQ ID NO:9, SEQ ID NO:10, any of SEQ ID NOs:127-146, or any of SEQ ID NOs:147-166, etc.) may be employed to form a HyBeaconā„¢ probe suitable for detecting the region of ORF1ab that is amplified by the above-described preferred ORF1ab Primers (e.g., SEQ ID NO:1, SEQ ID NO:2, any of SEQ ID NOs:17-28, any of SEQ ID NOs:29-42, any of SEQ ID NOs:398-399, any of SEQ ID NOs:403-406, and their respective variants). Additional HyBeaconā„¢ probes for the SARS-CoV-2 ORF1ab having shorter or longer ORF1ab regions can be readily constructed, for example by reducing or increasing the size of employed SARS-CoV-2 ORF1ab oligonucleotide, as desired.

Illustrative ORF1ab HyBeaconā„¢ probes thus comprise, from 5′ to 3′, an oligonucleotide capable of hybridizing to a domain of the SARS-CoV-2 ORF1ab (e.g., any of the SARS-CoV-2 oligonucleotide domains of the above-described ORF1ab probes (e.g., SEQ ID NO:9, SEQ ID NO:10, any of SEQ ID NOs:127-146, or any of SEQ ID NOs:147-166, etc.). As discussed above, an internal residue of the ORF1ab HyBeaconā„¢ probe is labeled, preferably with a fluorophore, and the 3′ terminus of the probe is preferably modified terminus to prevent its polymerase-mediated extension when annealed to a complementary target molecule.

Similarly, any of the SARS-CoV-2 oligonucleotide domains of the above-described S Gene probes (e.g., SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, or any of SEQ ID NOs:364-381, etc.) may be employed to form a HyBeaconā„¢ probe suitable for detecting the region of the S gene that is amplified by the above-described preferred S Gene Primers (e.g., SEQ ID NO:5, SEQ ID NO:6, any of SEQ ID NOs:43-70, any of SEQ ID NOs:71-84, any of SEQ ID NOs:85-112, any of SEQ ID NOs:113-126, or any of SEQ ID NOs:400-402, or any of SEQ ID NOs:407-410, and their respective variants). Additional HyBeaconā„¢ probes for the SARS-CoV-2 S Gene having shorter or longer S Gene regions can be readily constructed, for example by reducing or increasing the size of employed SARS-CoV-2 S Gene oligonucleotide, as desired.

Illustrative S Gene HyBeaconā„¢ probes thus comprise, from 5′ to 3′, an oligonucleotide capable of hybridizing to a domain of the SARS-CoV-2 S Gene (e.g., any of the SARS-CoV-2 oligonucleotide domains of the above-described S gene probes (e.g., SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, or any of SEQ ID NOs:364-381, etc.). As discussed above, an internal residue of the S Gene HyBeaconā„¢ probe is labeled with a fluorophore, and the 3′ terminus of the probe is preferably modified terminus to prevent its polymerase-mediated extension when annealed to a complementary target molecule. HyBeaconā„¢ probes are particularly suitable for detecting single nucleotide polymorphisms (SNPs) in the S gene of SARS-CoV-2 viruses of a clinical sample (such as SNPs that cause the D614G, V515F, V622I, or P631S S gene polymorphisms). Particularly preferred are HyBeaconā„¢ probes that are capable of detecting the A1841G single nucleotide polymorphism that causes the S gene D614G polymorphism. Examples of such probes include oligonucleotides that have the sequence of: any of SEQ ID NOs:43-70, any of SEQ ID NOs:85-112, any of SEQ ID NOs:167-252, or any of SEQ ID NOs:273-363, etc.

3. Distinctive Attributes of the Preferred rRT-PCR Primers and Probes of the Present Invention

The assays of the present invention possess particular distinctive attributes that distinguish such assays from the assays of the prior art. One characteristic of the present invention relates to the use of at least two SARS-CoV-2 target regions as a basis for detection in an rRT-PCR assay. Thus, the rRT-PCR assays of the present invention preferably employ at least two sets of Forward and Reverse primers so as to be capable of specifically and simultaneously amplifying two oligonucleotide regions of SARS-CoV-2 RNA. In preferred embodiments, the primers of one of such two sets of primers have sequences that are capable of specifically amplifying a region of ORF1ab, and the primers of the second of such two sets of primers have sequences that are capable of specifically amplifying a region of the S gene.

The use of two amplification targets increases the accuracy of the assays of the present invention since they help ensure that such assays will continue to detect SARS-CoV-2 even if one target becomes eliminated from clinical isolates (for example by spontaneous mutation). The use of two amplification targets also increases the sensitivity of the assay because it is possible that the amplification of a particular target might not provide a detectable concentration of amplified product, for example due to processing or handling issues. By having two targets, the assays of the present invention are more likely to avoid such ā€œfalse negativeā€ results.

The selection of ORF1ab and the S genes as targets is a further characteristic of the assays of the present invention. These genes are particularly characteristic of SARS-CoV-2, and indeed the targeted region of the SARS-CoV-2 S gene (i.e., its S1 domain) exhibits relatively low homology (only 68%) to the S genes of other coronaviruses (by comparison the ORF1a of SARS-CoV-2 exhibits about 90% homology to the ORF1a of SARS-CoV; the ORF1b of SARS-CoV-2 exhibits about 86% homology to the ORF1b of SARS-CoV (Lu, R. et al. (2020) ā€œGenomic Characterisation And Epidemiology Of 2019 Novel Coronavirus: Implications For Virus Origins And Receptor Binding,ā€ The Lancet 395(10224):565-574). Thus, it is more likely that the assays of the present invention will not inaccurately amplify sequences of non-SARS-CoV-2 pathogens. Thus, the assays of the present invention are more likely to avoid ā€œfalse positiveā€ results.

The assays of the present invention employ probes that are unique to SARS-CoV-2 and detect SARS-CoV-2 under conditions in which non-SARS-CoV-2 pathogens are not detected. In a further attribute, the assays of the present invention employ very fast system primers that are designed to mediate the same degree of amplification under the same reaction parameters and temperatures.

The melting temperatures (Tm) of PCR primers determine their kinetics of denaturation from complementary oligonucleotides and their kinetics of annealing to complementary oligonucleotides (see, SantaLucia, J. (1998) A Unified View Of Polymer, Dumbbell, And Oligonucleotide DNA Nearest-Neighbor Thermodynamics,ā€ Proc. Natl. Acad. Sci. (U.S.A.) 95:1460-1465; von Ahsen, N. et al. (1999) ā€œApplication Of A Thermodynamic Nearest-Neighbor Model To Estimate Nucleic Acid Stability And Optimize Probe Design: Prediction Of Melting Points Of Multiple Mutations Of Apolipoprotein B-3500 And Factor V With A Hybridization Probe Genotyping Assay On The Lightcycler,ā€ Clin. Chem. 45(12):2094-2101). Primer pairs that exhibit ā€œsubstantially identical melting temperaturesā€ (i.e., ±2° C., more preferably, ±1° C., still more preferably ±0.5° C., and most preferably ±0.1° C., as calculated using the method of SantaLucia, J. (1998)) maximize the overall yield of the products that they amplify, and the rate at which such products are produced.

Significantly, the preferred Forward and Reverse ORF1ab Primers of the present invention exhibit such substantially identical melting temperatures, which is a further distinction of the present invention. The preferred Forward ORF1ab Primer has a base-stacking Tm of 58.2° C., whereas the preferred Reverse ORF1ab Primer has a base-stacking Tm of 58.1° C. Thus, the use of the preferred Forward and Reverse ORF1ab Primers of the present invention serves to maximize the overall yield of the amplified ORF1ab product, and the rate at which such product is produced.

The preferred Forward and Reverse S Gene Primers of the present invention also exhibit substantially identical melting temperatures, which is a further distinction of the present invention. The preferred Forward S Gene Primer has a base-stacking Tm of 60° C., whereas the preferred Reverse S Gene Primer has a base-stacking Tm of 59.9° C. Thus, the use of the preferred Forward and Reverse S Gene Primers of the present invention serves to maximize the overall yield of the amplified S Gene product, and the rate at which such product is produced.

Significantly, the melting temperatures of the Forward and Reverse ORF1ab Primers of the present invention are substantially similar to the melting temperature of the preferred Forward and Reverse S Gene Primers of the present invention. Thus, these two sets of preferred primers are extremely well-matched, which is a further distinction of the present invention. Their combined use serves to equalize the overall yield of the amplified ORF1ab and S gene products, which are of similar length (117 nucleotides vs. 103 nucleotides). The substantially similar melting temperatures of the employed sets of primers and the similar lengths of the two amplified products are further distinctions of the present invention.

In designing an rRT-PCR assay, it is desirable for the employed probe to have a Tm that is 5-10° C. higher than the employed amplification primers. The employed ORF1ab Probe has a base-stacking Tm of 66.2° C., an 8° C. difference from the Tm of the preferred ORF1ab Primers of the present invention. The employed S Gene Probe has a matching base-stacking Tm of 66.6° C., a 6.6° C. difference from the Tm of the preferred S Gene Primers of the present invention. Thus, each of the preferred probes of the present invention exhibit a desired Tm and the two preferred probes of the present invention exhibit substantially identical Tms. These are further distinctions of the present invention.

C. Other Amplification Assay Formats

Although the invention's assays for the detection of SARS-CoV-2 have been described in terms of rRT-PCR assays, the invention additionally contemplates the use of other assay formats, such as Loop-Mediated Isothermal Amplification (LAMP), rolling circle amplification, ligase chain reaction amplification, strand-displacement amplification, bind-wash PCR, singing wire PCR, NASBA (Fakruddin, M. et al. (2013) ā€œNucleic Acid Amplification: Alternative Methods Of Polymerase Chain Reaction,ā€ J. Pharm. Bioallied Sci. 5(4):245-252; Zhang, H. et al. (2019) ā€œLAMP-On-A-Chip: Revising Microfluidic Platforms For Loop-Mediated DNA Amplification,ā€ Trends Analyt. Chem. 113:44-53; Bodulev, O. L. et al. (2020) ā€œIsothermal Nucleic Acid Amplification Techniques and Their Use in Bioanalysis,ā€ Biochemistry (Mosc) 85(2):147-166; Dunbar, S. et al. (2019) ā€œAmplification Chemistries In Clinical Virology,ā€ J. Clin. Virol. 115:18-31; Daher, R. K. et al. (2016) ā€œRecombinase Polymerase Amplification for Diagnostic Applications,ā€ Clin. Chem. 62(7):947-958; Goo, N. I. et al. (2016) ā€œRolling Circle Amplification As Isothermal Gene Amplification In Molecular Diagnostics,ā€ Biochip J. 10(4):262-271; PCT Publication No. WO 2018/073435; U.S. Pat. No. 10,619,151; US Patent Publication No. US 2020/0063173; US 2019/0249168; US 2018/0237842), etc.).

For example, loop-mediated isothermal amplification (LAMP) may be used to detect SARS-CoV-2 in accordance with the present invention. The LAMP process amplifies DNA using four primers to amplify a target DNA oligonucleotide that is present in a double-stranded DNA molecule whose strands comprise the following domains: 3′ F3c-F2c-F1c-target oligonucleotide-B1-B2-B3 5′ and 5′ F3-F2-F1-complement of target oligonucleotide-B1c-B2c-B3c 3′, wherein F3 and F3c, F2 and F2c, F1 and F1c, B3 and B3c, B2 and B2c, and B1 and B1c have complementary sequences. The four LAMP primers are:

  • (1) a forward internal primer (FIP) composed of a 5′ F1c domain, whose sequence is complementary to the sequence of the F1 domain, and a 3′ F2 domain whose sequence is complementary to the sequence of the F2c domain;
  • (2) a forward external primer (F3) whose sequence is complementary to the sequence of the F3c domain;
  • (3) a backward internal primer (BIP) composed of a 5′ B1c domain, whose sequence is complementary to the sequence of the B1 domain, and a 3′ B2 domain whose sequence is complementary to the sequence of the B2c domain;
  • (4) a backward external primer (B3) whose sequence is complementary to the sequence of the B3c domain;
    (see, Notomi, T. et al. (2000) ā€œLoop-Mediated Isothermal Amplification Of DNA,ā€ Nucl. Acids Res. 28(12):E63:1-7; U.S. Pat. Nos. 6,974,670; 7,175,985; 7,494,790; 7,638,280; 9,909,168; US Patent Publication Nos. 2018/0371534; 2007/0099178; PCT Publication No. WO 2017/108663A1; EP Publication Nos. EP 1642978 and EP 1020534).

The selection of appropriate primers may be facilitated through the use of primer selection software (e.g., PrimerExplorerV5, NEB LAMP Primer Design Tool, etc.). Illustrative sets of LAMP primers for amplifying domains of the SARS-CoV-2 ORF1ab and S gene are shown in Table 11.

TABLEā€ƒ11ā€ƒ
Illustrative SEQ
LAMPā€ƒPrimer Sequence IDā€ƒNO:
ORF1abā€ƒFTP gaacaccattacgggcatttcta- 403
tcttttttgatggtagagttga
ORF1abā€ƒF3 tttgtgcaccactcactg 404
ORF1abā€ƒBIP aggtagtgttaaaggtttacaacca- 405
caattaatgtgactccattaagact
ORF1abā€ƒB3 ctgtgtttttacggcttctc 406
Sā€ƒGeneā€ƒFIP ctgtgcagttaacatcctgataaaga- 407
gtgttataacaccaggaacaa
Sā€ƒGeneā€ƒF3 tgttcttttggtggtgtca 408
Sā€ƒGeneā€ƒBIP gaagtccctgttgctattcatgc- 409
gtgtttgaaaaacattagaacct
Sā€ƒGeneā€ƒB3 gcccctattaaacagcct 410

The illustrative ORF1ab LAMP primers mediate the amplification of a domain of ORF1ab between the F2/F2c domains and the B2/B2c domains (SEQ ID NO:411) (residues 10-126 of which correspond to SEQ ID NO:3):

tcttttttgaā€ƒtggtagagttā€ƒgatggtcaagā€ƒtagacttattā€ƒ
tagaaatgccā€ƒcgtaatggtgā€ƒttcttattacā€ƒagaaggtagtā€ƒ
gttaaaggttā€ƒtacaaccatcā€ƒtgtaggtcccā€ƒaaacaagctaā€ƒ
gtcttaatggā€ƒagtcacattaā€ƒattg

and its complement (SEQ ID NO:412) (residues 19-135 of which correspond to SEQ ID NO:4):

caattaatgtā€ƒgactccattaā€ƒagactagcttā€ƒgtttgggaccā€ƒ
tacagatggtā€ƒtgtaaaccttā€ƒtaacactaccā€ƒttctgtaataā€ƒ
agaacaccatā€ƒtacgggcattā€ƒtctaaataagā€ƒtctacttgacā€ƒ
catcaactctā€ƒaccatcaaaaā€ƒaaga

The illustrative S Gene LAMP primers mediate the amplification of a domain of the S gene between the F2/F2c domains and the B2/B2c domains (SEQ ID NO:413) (residues 28-130 of which correspond to SEQ ID NO:7) (the nucleotide residue that is responsible for the D614G single nucleotide polymorphism of the SARS-CoV-2 S gene is underlined):

gtgttataacā€ƒaccaggaacaā€ƒaatacttctaā€ƒaccaggttgcā€ƒ
tgttctttatā€ƒcaggatgttaā€ƒactgcacagaā€ƒagtccctgttā€ƒ
gctattcatgā€ƒcagatcaactā€ƒtactcctactā€ƒtggcgtgtttā€ƒ
attctacaggā€ƒttctaatgttā€ƒtttcaaacacā€ƒgtgc

and its complement (SEQ ID NO:414) (residues 25-127 of which correspond to SEQ ID NO:8):

gcacgtgtttā€ƒgaaaaacattā€ƒagaacctgtaā€ƒgaataaacacā€ƒ
gccaagtaggā€ƒagtaagttgaā€ƒtctgcatgaaā€ƒtagcaacaggā€ƒ
gacttctgtgā€ƒcagttaacatā€ƒcctgataaagā€ƒaacagcaaccā€ƒ
tggttagaagā€ƒtatttgttccā€ƒtggtgttataā€ƒacac

In a preferred embodiment, detection of LAMP amplification is accomplished using one or two loop-primers, i.e., a Loop Primer B and/or a Loop Primer F (which contain sequences complementary to the single-stranded domain located between the above-described B1 and B2 domains or between the above-described F1 and F2 domains (PCT Publication No. WO 2017/108663). Either the Loop Primer F or the Loop Primer B, if present, is labeled at its 5′-end with at least one acceptor fluorophore. A further oligonucleotide probe, which is labeled at its 3′-end with at least one donor fluorophore is also employed. Especially preferred is the donor/acceptor pair BODIPY FL/ATTO647N. The further oligonucleotide probe has a sequence that is capable of hybridizing to the target nucleic acid sequence at a position which is 5′ to the labeled Loop Primer F or Loop Primer B so that, when hybridized to the target nucleic acid sequence, the 3′-end of the oligonucleotide probe is brought into close proximity to the 5′-end of the labeled Loop Primer F or Loop Primer B.

D. Nested and Multiplexed Amplification Reactions

In one embodiment, the specificity and efficiency of the SARS-CoV-2 detection assays of the present invention are increased through the use of pairs of nested primers (see, e.g., U.S. Pat. Nos. 4,683,202 and 8,906,622; Bashi, A. et al. (2020) ā€œMicrofluidic Devices For Detection Of RNA Viruses,ā€ Rev Med Virol. e2154:1-11; Ratcliff, R. M. et al. (2007) ā€œMolecular diagnosis of medical viruses,ā€ Curr. Issues Mol. Biol. 9(2):87-102; Hu, Y. et al. (2009) ā€œNested Real-Time PCR For Hepatitis A Detection,ā€ Lett. Appl. Microbiol. 49(5):615-619).

In one embodiment, the SARS-CoV-2 detection assays of the present invention are multiplexed reactions (Elnifro, E. M. et al. (2000) ā€œMultiplex PCR: Optimization And Application In Diagnostic Virology,ā€ Clin. Microbiol. Rev. 13(4):559-570; Lam, W. Y. et al. (2007) ā€œRapid Multiplex Nested PCR For Detection Of Respiratory Viruses,ā€ J. Clin. Microbiol. 45(11):3631-3640; Ratcliff, R. M. et al. (2007) ā€œMolecular diagnosis of medical viruses,ā€ Curr. Issues Mol. Biol. 9(2):87-102).

In one such embodiment the amplification of SARS-CoV-2 ORF1ab and S gene sequences is concurrently achieved in the same reaction chamber. The invention also pertains to multiplexed amplification reactions, in which the amplification and/or detection of two or more different SARS-CoV-2 target sequences of the same gene (e.g., one or more different SARS-CoV-2 ORF1ab target sequences in addition to the SARS-CoV-2 ORF1ab target sequences described above, one or more different SARS-CoV-2 S gene target sequences in addition to the SARS-CoV-2 S gene target sequences described above, etc.) is concurrently achieved through the use of additional sets of primer and probe molecules specific for such other target sequences. In one embodiment, such additional SARS-CoV-2 target sequences encompass polymorphisms that distinguish different SARS-CoV-2 clades. Exemplary polymorphisms of the SARS-CoV-2 S gene that may be detected in such embodiments of the invention are shown in Table 12.

TABLE 12
GenBank GenBank Polymorphism
Ref. No. Ref. No. S S
Protein Genomic Protein Gene
QHR84449.1 MT007544.1 S247R T741G
QHU79173.2 MT020781.2 H49Y C145T
QHZ00379.1 MT039890.1 S221W C662G
QIA20044.1 MT049951.1 Y28N T82A
QIA98583.1 MT050493.1 A930V C2789T
QIC53204.1 MT093571.1 F797C T2390G
QII57278.1 MT159716.2 F157L C471A
QII87830.1 MT163720.1 H655Y C1963T
QIJ96493.1 MT184910.1 G181V G542T
QIK50427.1 MT192765.1 D614G A1841G
QIO04367.1 MT226610.1 N74K T222A
QIQ08810.1 MT233521.1 K528X A1582N
QIQ49882.1 MT246461.1 L5F C13T
G476S G1426A
QIQ50092.1 MT246482.1 K814X A2440N
A2441N
G2442N
QIS30105.1 MT258381.1 D614X A1841R
QIS30115.1 MT258382.1 P427X T1281W
D614G A1841G
QIS30165.1 MT259236.1 V483A T1448C
QIS30295.1 MT259249.1 L54F G162C
D614G A1841G
QIS30335.1 MT259253.1 A348T G1042A
QIS30425.1 MT259262.1 G476S C84T
G1426A
QIS60489.1 MT262915.1 A520S G1558T
QIS60546.1 MT263384.1 T29I C86T
C2472T
QIS60582.1 MT263387.1 D1259H G3775C
QIS60906.1 MT263414.1 L5F C13T
QIS60930.1 MT263416.1 E96D G288T
QIS60978.1 MT263420.1 D1168H G3502C
QIS61254.1 MT263443.1 A1078V C3233T
QIS61338.1 MT263450.1 D111N G331A
QIS61422.1 MT263457.1 H519Q T1557A
QIS61468.1 MT263461.1 A942X A2823N
G2824N
QIT07011.1 MT276600.1 L8V T22G
QIU78825.1 MT292579.1 G910X G2728N
QIU80913.1 MT281577.1 S50L C249T
QIU80973.1 MT293160.1 A27V C80T
QIU81585.1 M1293211.1 T240I C719T
QIU81873.2 MT291835.2 A653V C1958T
QIU81885.1 MT291836.1 A570V C1709T
C2461T
QIV15164.1 MT304489.1 Q644X T771Y
C1930Y
QIV65033.1 MT308695.1 Y265X A794W
QIZ13143.1 MT326038.1 L1152X T3454N
T3455N
QIZ13179.1 MT326041.1 S71F C212T
QIZ13299.1 MT326051.1 D80Y G238T
QIZ13765.1 MT326090.1 D614G A1841G
V615F G1843T
QIZ13789.1 MT326092.1 D614G A1841G
V622I G1864A
C2013T
QIZ13861.1 MT326098.1 V70F G208T
QIZ14569.1 MT326157.1 C1250Y G3749A
QIZ15585.1 MT325564.1 D614G A1841G
V1228X T3683Y
QIZ15717.1 MT325575.1 P9L C26T
C2472T
QIZ15969.1 MT325596.1 F238X T708Y
D614G T712W
T713K
A1841G
QIZ16197.1 MT325615.1 W258L G773T
D614G A1841G
QIZ16509.1 MT327745.1 V772I G2314A
QIZ16559.1 MT328034.1 I197V A589G
QIZ64470.1 MT334539.1 D614G A1841G
A1078S G3232T
QIZ64530.1 MT334544.1 D614G A1841R
S939F G3371K
QIZ64578.1 MT334548.1 H146Y C436T
D614G A1841G
QIZ64624.1 MT334552.1 S98F C293T
QIZ97039.1 MT339039.1 N148S A443G
QIZ97051.1 MT339040.1 Y279X A836N
D614G T837N
A1841G
QJA17276.1 MT345871.1 D614G A1841G
I818V A2452G
QJA17468.1 MT345887.1 L5F C13T
D614G A1841G
QJA17524.1 MT344944.1 D614X A1841G
G1124X C2816T
QJA17596.1 MT344950.1 D614G A1841G
L1203F C3607T
QJA42177.1 MT350252.1 D614G A1841G
V1065L G3193T
QJC19491.1 MT358637.1 Q271R A812G
D614G A1841G
QJC20043.1 MT358689.1 K529E A1585G
D614G A1841G
QJC20367.1 MT358716.1 D614G A1841G
S929I G2786T
QJC20391.1 MT358718.1 D614G A1841G
T768I C2303T
QJC20993.1 MT230904.1 V367F G1099T
QJD20632.1 MT370516.1 T791I C2372T
QJD23273.1 MT370831.1 V90F G268T
D614G G906T
A1841G
QJD23524.1 MT370852.1 P217X C650N
QJD24377.1 MT370923.1 A522S G1564T
D614G A1841G
QJD25085.1 MT370982.1 F220X T659N
D614G A1841G
QJD25529.1 MT371019.1 D614G A1841G
P631S C1891T
QJD47202.1 MT375441.1 M731I G2193T
QJD47358.1 MT375454.1 Y423X A1268N
D614G A1841G
QJD47442.1 MT375461.1 Y200X A599N
D614G A1841G
QJD47718.1 MT374101.1 H49Y C145T
S884F C2651T
QJD48279.1 MT252707.1 M1237I A3711C
QJE38426.1 MT385432.1 A845S G8533T
QJE38606.1 MT385447.1 Y145H T433C
D614G A1841G
QJE38822.1 MT385465.1 S704X T2110 Y
QJF11959.1 MT394529.1 L752X C2254Y
QJF11971.1 MT394530.1 H655X C1963Y
QJF75467.1 MT412183.1 N354B A441R
A1060R
C2472T
QJF75779.1 MT412209.1 V503X G1507K
D614G A1841G
QJF76007.1 MT412228.1 S704L C2111T
C2820T
QJF76438.1 MT412264.1 L118F C352T
D614G A1841G
QJF77194.1 MT412327.1 A27S G79T
D614G A1841G
QJF77846.1 MT415320.1 Y28H T82C
C2568T
QJG65949.1 MT415368.1 G485R G1453A
T1455G
QJG65951.1 MT415370.1 A67S G199T
F1103L T3307C
A3312G
QJG65954.1 MT415373.1 S750R C2250A
L752R C2254A
T2255G
T2256G
C2461T
QJG65956.1 MT415375.1 G838S G2512A
QJG65957.1 MT415376.1 W152R T454C
QJI53955.1 MT419818.1 Q239R A716G
D614G A1841G
QJQ04352.1 MT429191.1 D614G A1841G
T676S A2026T
QJQ27878.1 MT434760.1 K557X A1669N
C2367T
QJQ28105.1 MT434799.1 T95I C284T
D614G A1841G

In one embodiment, the SARS-CoV-2 detection assays of the present invention are multiplexed reactions in which the amplification and/or detection of one or more SARS-CoV-2 target sequences other than ORF1a or the S gene is concurrently achieved through the use of additional sets of primer and probe molecules specific for such other target sequences. Such sequences could be sequences of the 3, E (envelope protein), M (matrix), 7, 8, 9, 10b, N, 13 and 14 genes, or sequences that encode the nsp2, nsp3, nsp4, nsp5, nsp6, nsp7, nsp8, nsp9, nsp10, nsp12, nsp13, nsp14a2, nsp15, and/or nsp16 proteins, etc.

In one embodiment, the SARS-CoV-2 detection assays of the present invention are multiplexed reactions in which the amplification and/or detection of one or more SARS-CoV-2 target sequences and the amplification and/or detection of one or more target sequences of a pathogen other than SARS-CoV-2 (and especially a respiratory pathogen other than SARS-CoV-2) is concurrently achieved through the use of additional sets of primer and probe molecules specific for such other target sequences. Examples of such other pathogens include Streptococcus pneumoniae, Mycoplasma pneumoniae, Legionella pneumophila, Haemophilus influenzae, Neisseria meningitidis, influenza virus (e.g., influenza A, influenza B, etc.), rhinovirus, non-SARS-CoV-2 pathogenic coronavirus, parainfluenza virus, human metapneumovirus (hMPV), respiratory syncytial virus (RSV), adenovirus, etc. (see, e.g., Basile, K. et al. (2018) ā€œPoint-Of-Care Diagnostics For Respiratory Viral Infections,ā€ Exp. Rev. Molec. Diagnos. 18(1):75-83; Mahony, J. B. et al. (2011) ā€œMolecular Diagnosis Of Respiratory Virus Infections,ā€ Crit. Rev. Clin. Lab. Sci. 48(5-6):217-249; Ieven, M. (2007) ā€œCurrently Used Nucleic Acid Amplification Tests For The Detection Of Viruses And Atypicals In Acute Respiratory Infections,ā€ J. Clin. Virol. 40(4):259-276).

IV. Preferred Methods for Conducting the Assays of the Present Invention

A. Detection of the SARS-CoV-2 ORF1ab

In accordance with the methods of the present invention, the detection of the presence of SARS-CoV-2 ORF1ab oligonucleotides in a clinical sample may be achieved using a TaqMan ORF1ab Probe by:

  • (I) incubating the clinical sample in vitro in the presence of:
    • (1) a reverse transcriptase and a DNA polymerase that has a 5′→3′ exonuclease activity;
    • (2) a Forward (or sense strand) ORF1ab Primer;
    • (3) a Reverse (or antisense strand) ORF1ab Primer; and
    • (4) a TaqMan ORF1ab Probe capable of detecting the presence of a SARS-CoV-2 ORF1ab oligonucleotide that is amplified by conducting PCR in the presence of such Forward and Reverse ORF1ab Primers, wherein the TaqMan ORF1ab Probe comprises a 5′ terminus and a 3′ terminus, and has a SARS-CoV-2 oligonucleotide domain whose nucleotide sequence consists of, consists essentially of, comprises, or is a variant of the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, any of SEQ ID NOs:127-146, or any of SEQ ID NOs:147-166, wherein the 5′ terminus of the oligonucleotide is labeled with a fluorophore and the 3′ terminus of the oligonucleotide is complexed to a quencher of such fluorophore.

wherein the incubation is in a reaction under conditions sufficient to permit:

    • (a) the Forward and Reverse ORF1ab Primers to mediate a polymerase chain reaction amplification of a region of the ORF1ab of SARS-CoV-2 to thereby produce amplified ORF1ab oligonucleotide molecules, if the SARS-CoV-2 is present in the clinical sample;
    • (b) the TaqMan ORF1ab Probe to hybridize to amplified ORF1ab oligonucleotide molecules; and
    • (c) the 5′→3′ exonuclease activity to hydrolyze hybridized TaqMan ORF1ab Probe, to thereby separate the fluorophore thereof from the quencher thereof and cause a fluorescent signal to become detectable; and
  • (II) determining whether the SARS-CoV-2 is present in the clinical sample by determining whether a fluorescent signal of the fluorophore has become detectable.

In accordance with the methods of the present invention, the detection of the presence of SARS-CoV-2 ORF1ab oligonucleotides in a clinical sample may alternatively be achieved using a Molecular Beacon ORF1ab Probe by:

  • (I) incubating the clinical sample in vitro in the presence of:
    • (1) a reverse transcriptase and a DNA polymerase;
    • (2) a Forward (or sense strand) ORF1ab Primer;
    • (3) a Reverse (or antisense strand) ORF1ab Primer; and
    • (4) a Molecular Beacon ORF1ab Probe capable of detecting the presence of a SARS-CoV-2 ORF1ab oligonucleotide that is amplified by conducting PCR in the presence of such Forward and Reverse ORF1ab Primers, wherein the Molecular Beacon ORF1ab Probe comprises a SARS-CoV-2 ORF1ab oligonucleotide domain that is flanked by a 5′ oligonucleotide and a 3′ oligonucleotide, wherein such 5′ oligonucleotide and such 3′ oligonucleotide are at least substantially complementary to one another, and wherein at least one of such 5′ oligonucleotide and such 3′ oligonucleotide is detectably labeled and another of such 5′ oligonucleotide and such 3′ oligonucleotide is complexed to a quencher or an acceptor of such detectable label, wherein the SARS-CoV-2 ORF1ab oligonucleotide domain of the Molecular Beacon ORF1ab Probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, any of SEQ ID NOs:127-146, or any of SEQ ID NOs:147-166;

wherein the incubation is in a reaction under conditions sufficient to permit:

    • (a) the Forward and Reverse ORF1ab Primers to mediate a polymerase chain reaction amplification of a region of the ORF1ab of SARS-CoV-2 to thereby produce amplified ORF1ab oligonucleotide molecules, if the SARS-CoV-2 is present in the clinical sample;
    • (b) the Molecular Beacon ORF1ab Probe to hybridize to amplified ORF1ab oligonucleotide molecules, thereby separating the fluorophore thereof from the quencher thereof and causing a fluorescent signal to become detectable; and
  • (II) determining whether the SARS-CoV-2 is present in the clinical sample by determining whether a fluorescent signal of the fluorophore has become detectable.

In accordance with the methods of the present invention, the detection of the presence of SARS-CoV-2 ORF1ab oligonucleotides in a clinical sample may alternatively be achieved using an ORF1ab Scorpion Primer-Probe by:

  • (I) incubating the clinical sample in vitro in the presence of:
    • (1) a reverse transcriptase and a DNA polymerase;
    • (2) a Forward (or sense strand) ORF1ab Primer;
    • (3) a Reverse (or antisense strand) ORF1ab Primer; and
    • (4) an ORF1ab Scorpion Primer-Probe capable of detecting the presence of a SARS-CoV-2 ORF1ab oligonucleotide that is amplified by conducting PCR in the presence of such Forward and Reverse ORF1ab Primers, wherein the ORF1ab Scorpion Primer-Probe comprises a SARS-CoV-2 oligonucleotide domain that is flanked by a 5′ oligonucleotide and a 3′ oligonucleotide, wherein such 5′ oligonucleotide and such 3′ oligonucleotide are at least substantially complementary to one another, and wherein at least one of such 5′ oligonucleotide and such 3′ oligonucleotide is detectably labeled and the other of such 5′ oligonucleotide and such 3′ oligonucleotide is complexed to a quencher or an acceptor of such detectably label, and wherein such 3′ oligonucleotide further comprises a polymerization blocking moiety, and a PCR primer oligonucleotide positioned 3′ from the blocking moiety, wherein the SARS-CoV-2 oligonucleotide domain of the ORF1ab Scorpion Primer-Probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, any of SEQ ID NOs:127-146, or any of SEQ ID NOs:147-166; and wherein the PCR primer oligonucleotide is selected so that it is capable of hybridizing to a region of ORF1ab that is approximately 7 bases, 8 bases, 9 bases, 10 bases, or more preferably 11 bases upstream of an ORF1ab sequence that is the same as the sequence of the probe's ORF1ab oligonucleotide domain (or differs from such sequence by 5, 4, 3, 2 or 1 nucleotide residues), such that extension of the PCR primer oligonucleotide domain of the ORF1ab Scorpion Primer-Probe forms an extension product whose sequence is complementary to the probe's ORF1ab oligonucleotide domain;

wherein the incubation is in a reaction under conditions sufficient to permit:

    • (a) the Forward and Reverse ORF1ab Primers to mediate a polymerase chain reaction amplification of a region of the ORF1ab of SARS-CoV-2 to thereby produce amplified ORF1ab oligonucleotide molecules, if the SARS-CoV-2 is present in the clinical sample;
    • (b) the ORF1ab Scorpion Primer-Probe to hybridize to amplified ORF1ab oligonucleotide molecules and be extended to form a domain that is complementary to the sequence of the SARS-CoV-2 oligonucleotide domain of the ORF1ab Scorpion Primer-Probe, such that, upon denaturation, the SARS-CoV-2 oligonucleotide domain of the ORF1ab Scorpion Primer-Probe hybridizes to the extended domain of the ORF1ab Scorpion Primer-Probe, and thereby prevents the complementary 5′ oligonucleotide and 3′ oligonucleotide domains of the probe from re-hybridizing to one another and attenuating the quenching of the detectable label;
  • (II) determining whether the SARS-CoV-2 is present in the clinical sample by determining whether a fluorescent signal of the fluorophore has become detectable.

Suitable Forward (or sense strand) ORF1ab Primers for such assays include oligonucleotides having a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:1 or any of SEQ ID NOs:17-28. Suitable Reverse (or antisense strand) ORF1ab Primers for such assays include oligonucleotides having a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:2 or any of SEQ ID NOs:29-42.

B. Detection of the SARS-CoV-2 S Gene

In accordance with the methods of the present invention, the detection of the presence of SARS-CoV-2 S Gene oligonucleotides in a clinical sample may be achieved using a TaqMan S Gene Probe by:

  • (I) incubating the clinical sample in vitro in the presence of:
    • (1) a reverse transcriptase and a DNA polymerase that has a 5′→3′ exonuclease activity;
    • (2) a Forward (or sense strand) S Gene Primer;
    • (3) a Reverse (or antisense strand) S Gene Primer; and
    • (4) the TaqMan S Gene Probe, wherein such probe is capable of detecting the presence of a SARS-CoV-2 S Gene oligonucleotide that is amplified by conducting PCR in the presence of such Forward and Reverse S Gene Primers, wherein the TaqMan S Gene Probe comprises a 5′ terminus and a 3′ terminus, and has a SARS-CoV-2 oligonucleotide portion whose nucleotide sequence consists of, consists essentially of, comprises, or is a variant of the nucleotide sequence of: SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, or any of SEQ ID NOs:364-381, wherein the 5′ terminus of the oligonucleotide is labeled with a fluorophore and the 3′ terminus of the oligonucleotide is complexed to a quencher of such fluorophore.

wherein the incubation is in a reaction under conditions sufficient to permit:

    • (a) the Forward and Reverse S Gene Primers to mediate a polymerase chain reaction amplification of a region of the S gene of SARS-CoV-2 to thereby produce amplified S gene oligonucleotide molecules, if the SARS-CoV-2 is present in the clinical sample;
    • (b) the TaqMan S Gene Probe to hybridize to amplified S gene oligonucleotide molecules; and
    • (c) the 5′→3′ exonuclease activity to hydrolyze hybridized TaqMan S Gene Probe, to thereby separate the fluorophore thereof from the quencher thereof and cause a fluorescent signal to become detectable; and
  • (II) determining whether the SARS-CoV-2 is present in the clinical sample by determining whether a fluorescent signal of the fluorophore has become detectable.

In accordance with the methods of the present invention, the detection of the presence of SARS-CoV-2 S gene oligonucleotides in a clinical sample may be achieved using a Molecular Beacon S Gene Probe by:

  • (I) incubating the clinical sample in vitro in the presence of:
    • (1) a reverse transcriptase and a DNA polymerase;
    • (2) a Forward (or sense strand) S Gene Primer;
    • (3) a Reverse (or antisense strand) S Gene Primer; and
    • (4) the Molecular Beacon S Gene Probe, wherein such probe is capable of detecting the presence of a SARS-CoV-2 S gene oligonucleotide that is amplified by conducting PCR in the presence of such Forward and Reverse S Gene Primers, wherein the Molecular Beacon S Gene Probe comprises a SARS-CoV-2 S gene oligonucleotide portion that is flanked by a 5′ oligonucleotide and a 3′ oligonucleotide, wherein such 5′ oligonucleotide and such 3′ oligonucleotide are at least substantially complementary to one another, and wherein at least one of such 5′ oligonucleotide and such 3′ oligonucleotide is detectably labeled and another of such 5′ oligonucleotide and such 3′ oligonucleotide is complexed to a quencher or an acceptor of such detectable label, wherein the SARS-CoV-2 S gene oligonucleotide portion of the Molecular Beacon S Gene Probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of the nucleotide sequence of: SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, or any of SEQ ID NOs:364-381;

wherein the incubation is in a reaction under conditions sufficient to permit:

    • (a) the Forward and Reverse S Gene Primers to mediate a polymerase chain reaction amplification of a region of the S Gene of SARS-CoV-2 to thereby produce amplified S gene oligonucleotide molecules, if the SARS-CoV-2 is present in the clinical sample;
    • (b) the Molecular Beacon S Gene Probe to hybridize to amplified S gene oligonucleotide molecules, thereby separating the fluorophore thereof from the quencher thereof and causing a fluorescent signal to become detectable; and
  • (II) determining whether the SARS-CoV-2 is present in the clinical sample by determining whether a fluorescent signal of the fluorophore has become detectable.

In accordance with the methods of the present invention, the detection of the presence of SARS-CoV-2 S gene oligonucleotides in a clinical sample may alternatively be achieved using an S Gene Scorpion Primer-Probe by:

  • (I) incubating the clinical sample in vitro in the presence of:
    • (1) a reverse transcriptase and a DNA polymerase;
    • (2) a Forward (or sense strand) S Gene Primer;
    • (3) a Reverse (or antisense strand) S Gene Primer; and
    • (4) the S Gene Scorpion Primer-Probe, wherein such probe is capable of detecting the presence of a SARS-CoV-2 S gene oligonucleotide that is amplified by conducting PCR in the presence of such Forward and Reverse S Gene Primers, wherein the S Gene Scorpion Primer-Probe comprises a SARS-CoV-2 oligonucleotide domain that is flanked by a 5′ oligonucleotide and a 3′ oligonucleotide, wherein such 5′ oligonucleotide and such 3′ oligonucleotide are at least substantially complementary to one another, and wherein at least one of such 5′ oligonucleotide and such 3′ oligonucleotide is detectably labeled and the other of such 5′ oligonucleotide and such 3′ oligonucleotide is complexed to a quencher or an acceptor of such detectably label, and wherein such 3′ oligonucleotide further comprises a polymerization blocking moiety, and a PCR primer oligonucleotide positioned 3′ from the blocking moiety, wherein the SARS-CoV-2 oligonucleotide domain of the S Gene Scorpion Primer-Probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of the nucleotide sequence of: SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, or any of SEQ ID NOs:364-381; and wherein the PCR primer oligonucleotide is selected so that it is capable of hybridizing to a region of S gene that is approximately 7 bases, 8 bases, 9 bases, 10 bases, or more preferably 11 bases upstream of an S gene sequence that is the same as the sequence of the probe's S gene oligonucleotide domain (or differs from such sequence by 5, 4, 3, 2 or 1 nucleotide residues), such that extension of the PCR primer oligonucleotide domain of the S Gene Scorpion Primer-Probe forms an extension product whose sequence is complementary to the probe's S Gene oligonucleotide domain;

wherein the incubation is in a reaction under conditions sufficient to permit:

    • (a) the Forward and Reverse S Gene Primers to mediate a polymerase chain reaction amplification of a region of the S gene of SARS-CoV-2 to thereby produce amplified S gene oligonucleotide molecules, if the SARS-CoV-2 is present in the clinical sample;
    • (b) the S Gene Scorpion Primer-Probe to hybridize to amplified S gene oligonucleotide molecules and be extended to form a domain that is complementary to the sequence of the SARS-CoV-2 oligonucleotide domain of the S Gene Scorpion Primer-Probe, such that, upon denaturation, the SARS-CoV-2 oligonucleotide domain of the S Gene Scorpion Primer-Probe hybridizes to the extended domain of the S Gene Scorpion Primer-Probe, and thereby prevents the complementary 5′ oligonucleotide and 3′ oligonucleotide domains of the probe from re-hybridizing to one another and attenuating the quenching of the detectable label;
  • (II) determining whether the SARS-CoV-2 is present in the clinical sample by determining whether a fluorescent signal of the fluorophore has become detectable.

Suitable Forward (or sense strand) S Gene Primers include oligonucleotides having a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:5 or any of SEQ ID NOs:43-70, or any of SEQ ID NOs:71-84. Suitable Reverse (or antisense strand) S Gene Primers include oligonucleotides having a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:6, or any of SEQ ID NOs:85-112, or any of SEQ ID NOs:113-126.

As discussed above, the region of the SARS-CoV-2 S gene amplified by the primers of the present invention comprises the nucleotide residue (position 1841 of SEQ ID NO:16) that is responsible for the D614G polymorphism of the SARS-CoV-2 S gene. In accordance with the methods of the present invention, the detection of the presence of the D614G polymorphism may be achieved using primers whose 3′ termini distinguish the nucleotide residue present at such position. Exemplary primers having this characteristic include primers having the nucleotide sequence of any of SEQ ID NOs:43-70 or any of SEQ ID NOs:85-112.

In accordance with the methods of the present invention, the detection of the presence of the D614G polymorphism may alternatively be achieved using molecular beacon probes, HyBeaconā„¢ probes or scorpion primer-probes whose sequences comprise the position 1841 nucleotide. Exemplary oligonucleotides having this characteristic include: any of SEQ ID NOs:43-70, any of SEQ ID NOs:85-112, any of SEQ ID NOs:167-252, or any of SEQ ID NOs:273-363

V. Preferred Platform for Conducting the Assays of the Present Invention

In a preferred embodiment, the above-described preferred primers and probes assay the presence of SARS-CoV-2 using a Direct Amplification Disc (DiaSorin Molecular LLC) and SIMPLEXAĀ® Direct Chemistry (DiaSorin Molecular LLC), as processed by a LIAISONĀ® MDX (DiaSorin Molecular LLC) rRt-PCR platform. The operating principles of DiaSorin Molecular LLC's LIAISONĀ® MDX rRt-PCR platform, SIMPLEXAĀ® Direct Chemistry and Direct Amplification Disc are disclosed in U.S. Pat. No. 9,067,205, US Patent Publn. No. 2012/0291565 A1, EP 2499498 B1, EP 2709760 B1, all herein incorporated by reference in their entireties.

In brief, the LIAISON® MDX (DiaSorin) rRt-PCR platform is a compact and portable thermocycler that additionally provides centrifugation and reaction processing capabilities. The device is capable of mediating sample heating (>5° C./sec) and cooling (>4° C./sec), and of regulating temperature to ±0.5° C. (in the range from room temperature to 99° C.). The LIAISON® MDX rRt-PCR platform has the ability to excite fluorescent labels at 475 nm, 475 nm, 520 nm, 580 nm, and 640 nm, and to measure fluorescence at 520 nm, 560 nm, 610 nm, and 682 nm, respectively.

The Direct Amplification Disc is radially oriented, multi-chambered, fluidic device that is capable of processing the amplification of target sequences (if present) in up to 8 (50 μL) clinical samples at a time. The samples may be provided directly to the Direct Amplification Disc, as cellular material or lysates, without any prior DNA or RNA extraction.

In brief, an aliquot of the clinical sample and reaction reagents (i.e., a DNA polymerase, a reverse transcriptase, one or more pairs of SARS-CoV-2-specific primers (preferably, the above-discussed preferred Forward and Reverse ORF1ab Primers and the above-discussed preferred Forward and Reverse S Gene Primers, two or more SARS-CoV-2-specific probes (preferably, the above-discussed preferred ORF1ab Probe and the above-discussed preferred S Gene Probe), and deoxynucleotide triphosphates (dNTPs) and buffers) are separately provided to a provision area of the Direct Amplification Disc (see, U.S. Pat. No. 9,067,205, US Patent Publn No. 2012/0291565 A1, EP 2709760 B1). Preferably, the reaction reagents required for rRT-PCR are provided using ā€œmaster mixes,ā€ which are widely available commercially (Applied Biosystems; ThermoFisher Scientific, etc.). Primers may be provided at a concentration of between 0.1 and 0.5 μM (5-25 pmol/per 50 μl reaction). Probe molecules may be provided at a concentration of between 0.05 and 0.25 μM (2.5-12.5 pmol/per 50 μl reaction).

The LIAISON® MDX device centrifuges the Direct Amplification Disc to thereby force a domain of the sample and reagents to be separately moved into reservoirs for a reaction chamber. The centrifugation moves any excess sample or reagents to a holding chamber. A laser within the LIAISON® MDX device then opens a first valve permitting the sample to flow into the reaction chamber. The chamber is then heated (for example to 95° C.); the high temperature and centrifugation serves to lyse cells that may be present in the sample. The laser within the LIAISON® MDX device then opens a second valve permitting reagents sample to flow into the reaction chamber and mix with the sample. The LIAISON® MDX device then commences to subject the reaction to PCR thermocycling. An internal control may be used to monitor successful instrument and sample processing and to detect RT-PCR failure and/or inhibition.

An internal control may be employed in order to confirm that the reaction conditions are suitable for target amplification and detection. A suitable internal control, for example, is one that amplifies MS2 phage sequences. A suitable Forward MS2 Phage Internal Control Primer has the sequence (SEQ ID NO:13 tgctcgcggatacccg); a suitable Reverse MS2 Phage Internal Control Primer has the sequence (SEQ ID NO:14 aacttgcgttctcgagcgat). Amplification mediated by such internal control primers may be detected using a TaqMan probe (MS2 Phage Internal Control Probe) having the sequence (SEQ ID NO:15 acctcgggtttccgtcttgctcgt. Alternatively, other MS2 internal control primers may be employed (Dreier, J. et al. (2005) ā€œUse of Bacteriophage MS2 as an Internal Control in Viral Reverse Transcription-PCR Assays,ā€ J. Clin. Microbiol. 43(9):4551-4557). The probe may be labeled with the Quasar 670 fluorophore and complexed to the BHQ2 quencher, or with any other fluorophore and any quencher capable of quenching the fluorescence of such fluorophore.

The LIAISON MDX Software runs a pre-heating cycle to denature the SARS-CoV-2 viral coat protein and thereby release the SARS-CoV-2 RNA. This step is followed by reverse transcription and subsequent amplification. During the extension phase of the PCR cycle, the 5′ nuclease activity of DNA polymerase degrades any probe that has hybridized to amplified product in the reaction, thereby causing the fluorescent label of the probe to separate from the quencher of the probe. Such separation permits a fluorescent signal to be detected. With each cycle, additional fluorescent label molecules are cleaved from their respective probes, increasing the fluorescence intensity.

Reaction results are monitored and presented to users via LIAISONĀ® MDX's software. Such software provides easy to understand results with the ability to check amplification curves after a run. The software also plots QC Charts and can be bi-directionally interfaced with LIS for easy integration into lab workflow. The LIAISONĀ® MDX permit random access to individual samples, and thus allows users to start the analysis of new samples without waiting for previously-started analyses to complete. Assay results can be obtained in one hour or less. Table 13 shows the Diagnostic Algorithm of the assay.

TABLE 13
SARS-CoV-2
CT value SARS-CoV-2 RNA
(ORF1ab CT value IC CT
Target) (S Gene Target) value Interpretation
≤40, ≠0 ≤40, ≠0 N/A SARS-CoV-2 RNA:
Detected
≤40, ≠0 N/A N/A SARS-CoV-2 RNA:
Detected
N/A ≤40, ≠0 N/A SARS-CoV-2 RNA:
Detected
0 0 ≤40, ≠0 SARS-CoV-2 RNA:
Not Detected
0 0 0 Results Invalid
Repeat Assay:
If RNA IC is still 0 on
repeat, test with a new
sample if clinically
warranted

Accordingly, if the ORF1ab and the S gene CT values are both ≤40 for a patient specimen, the result is reported as ā€œDetectedā€ for the SARS-CoV-2 RNA. The internal control is not applicable. If the ORF1ab CT value is ≤40 and the S gene CT value is 0 for a patient specimen, the result is reported as ā€œDetectedā€ for the SARS-CoV-2 RNA. The internal control is not applicable. If the ORF1ab CT value is 0 and the S gene CT value is ≤40 for a patient specimen, the result is reported as ā€œDetectedā€ for the SARS-CoV-2 RNA. The internal control is not applicable. If the ORF1ab and the S gene CT values are both 0 for a patient specimen and the internal control CT is non-zero and ≤45, the result is reported as ā€œNot Detectedā€ for the SARS-CoV-2 RNA. If the ORF1ab and the S gene CT values are both 0 for a patient specimen and the internal control CT is also 0, the result is reported as ā€œInvalid.ā€ This specimen should be re-assayed. If the internal control is still 0 for the repeated assay, the test should be repeated with a new sample, if clinically warranted.

VI. Kits

The invention additionally includes kits for conducting the above-described assays. In one embodiment, such kits will include one or more containers containing reagents for specifically detecting the SARS-CoV-2 ORF1ab (e.g., a Forward ORF1ab Primer, a Reverse ORF1ab Primer, and an ORF1ab Probe, that is preferably detectably labelled) and instructions for the use of such reagents to detect SARS-CoV-2. Such kits may comprise a Variant Forward ORF1ab Primer, a Variant Reverse ORF1ab Primer, and/or a Variant ORF1ab Probe. Most preferably, such kits will comprise the above-described preferred ORF1ab Forward Primer, the above-described preferred ORF1ab Reverse Primer and the above-described preferred ORF1ab Probe.

In a second embodiment, such kits will include one or more containers containing reagents for specifically detecting the SARS-CoV-2 S gene (e.g., a Forward S Gene Primer, a Reverse S Gene Primer, and an S Gene Probe, that is preferably detectably labelled) and instructions for the use of such reagents to detect SARS-CoV-2. Such kits may comprise a Variant Forward S Gene Primer, a Variant Reverse S Gene Primer, and/or a Variant S Gene Probe. Most preferably, such kits will comprise the above-described preferred S Gene Forward Primer, the above-described preferred S Gene Reverse Primer, and the above-described preferred S Gene Probe.

In a third embodiment, such kits will include one or more containers containing reagents for specifically detecting both the SARS-CoV-2 ORF1ab and the SARS-CoV-2 S gene (e.g., a Forward ORF1ab Primer, a Reverse ORF1ab Primer, an ORF1ab Probe, a Forward S Gene Primer, a Reverse S Gene Primer, and an S Gene Probe) and instructions for the use of such reagents to detect SARS-CoV-2, and will most preferably comprise the above-described preferred ORF1ab Forward Primer, the above-described preferred ORF1ab Reverse Primer, the above-described preferred ORF1ab Probe, the above-described preferred S Gene Forward Primer, the above-described preferred S Gene Reverse Primer and the above-described preferred S Gene Probe.

The containers of such kits will be vials, tubes, etc. and the reagents may be in liquid form or may be lyophilized. Alternatively, such containers will be a multi-chambered, fluidic device that is capable of processing the amplification of such primers. For example, the kits of the present invention may be a Direct Amplification Disc (U.S. Pat. No. 9,067,205) that has been preloaded with reagents for amplifying the above-described SARS-CoV-2 gene sequences.

VII. Embodiments of the Invention

Having now generally described the invention, the same will be more readily understood through reference to the following numbered Embodiments (ā€œEā€), which are provided by way of illustration and are not intended to be limiting of the present invention unless specified:

  • E1. A detectably labeled oligonucleotide that is capable of specifically hybridizing to a SARS-CoV-2 polynucleotide, wherein the detectably labeled oligonucleotide has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having a nucleotide sequence that consists of the nucleotide sequence of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7 or SEQ ID NO:8.
  • E2. The detectably labeled oligonucleotide of E1, wherein the oligonucleotide has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having a nucleotide sequence that consists of the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4.
  • E3. The detectably labeled oligonucleotide of E1, wherein the oligonucleotide has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having a nucleotide sequence that consists of the nucleotide sequence of SEQ ID NO:7 or SEQ ID NO:8.
  • E4. A kit for detecting the presence of SARS-CoV-2 in a clinical sample, wherein the kit comprises a detectably labeled oligonucleotide that is capable of specifically hybridizing to a SARS-CoV-2 polynucleotide, wherein the detectably labeled oligonucleotide has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having the nucleotide sequence of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7 or SEQ ID NO:8.
  • E5. The kit of E4, wherein the detectably labeled oligonucleotide has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4, and wherein the kit permits a determination of the presence or absence of the SARS-CoV-2 ORF1ab in a clinical sample.
  • E6. The kit of E4, wherein the detectably labeled oligonucleotide has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having the nucleotide sequence of SEQ ID NO:7 or SEQ ID NO:8, and wherein the kit permits a determination of the presence or absence of the SARS-CoV-2 S gene in a clinical sample.
  • E7. The kit of E4, wherein the kit comprises two detectably labeled oligonucleotides, wherein the detectable labels of the oligonucleotides are distinguishable, and wherein one of the two detectably labeled oligonucleotides has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4, and the second of the two detectably labeled oligonucleotides has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having the nucleotide sequence of SEQ ID NO:7 or SEQ ID NO:8.
  • E8. The kit of any one of E7, wherein the distinguishable detectable labels of the oligonucleotides are fluorescent labels.
  • E9. The kit of any one E4-E8, wherein at least one of the detectably labeled oligonucleotides is a TaqMan probe, a molecular beacon probe, a scorpion primer-probe probe or a HyBeaconā„¢ probe.
  • E10. The kit of any one of E4 or E6-E9, wherein the kit permits the detection of the D614G polymorphism of the S gene of SARS-CoV-2.
  • E11. The kit of any one of E4-E10, wherein the kit is a multi-chambered, fluidic device.
  • E12. The kit of any one of E4-E11, wherein the detectably labeled oligonucleotide is fluorescently labeled.
  • E13. A method for detecting the presence of SARS-CoV-2 in a clinical sample, wherein the method comprises incubating the clinical sample in vitro in the presence of a detectably labeled oligonucleotide that is capable of specifically hybridizing to a SARS-CoV-2 polynucleotide, wherein the detectably labeled oligonucleotide has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having the nucleotide sequence of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7 or SEQ ID NO:8; wherein the method detects the presence of SARS-CoV-2 in the clinical sample by detecting the presence of SARS-CoV-2 ORF1ab and/or SARS-CoV-2 S gene.
  • E14. The method of E13, wherein the detectably labeled oligonucleotide has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4, and wherein the method detects the presence of SARS-CoV-2 in the clinical sample by detecting the presence of SARS-CoV-2 ORF1ab.
  • E15. The method of E14, wherein the method comprises a PCR amplification of the SARS-CoV-2 polynucleotide.
  • E16. The method of any one of E14, wherein the detectably labeled oligonucleotide is a TaqMan probe.
  • E17. The method of E16, wherein the detectably labeled oligonucleotide is a TaqMan ORF1ab Probe, and wherein the method comprises:
    • (I) incubating the clinical sample in vitro in the presence of:
      • (1) a reverse transcriptase and a DNA polymerase that has a 5′→3′ exonuclease activity;
      • (2) a Forward (or sense strand) ORF1ab Primer;
      • (3) a Reverse (or antisense strand) ORF1ab Primer; and
      • (4) the TaqMan ORF1ab Probe, wherein such probe is capable of detecting the presence of a SARS-CoV-2 ORF1ab oligonucleotide that is amplified by conducting PCR in the presence of such Forward and Reverse ORf1ab Primers, wherein the TaqMan ORF1ab Probe comprises a 5′ terminus and a 3′ terminus, and has a SARS-CoV-2 oligonucleotide domain whose nucleotide sequence consists of, consists essentially of, comprises, or is a variant of the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, any of SEQ ID NOs:127-146, or any of SEQ ID NOs:147-166, wherein the 5′ terminus of the oligonucleotide is labeled with a fluorophore and the 3′ terminus of the oligonucleotide is complexed to a quencher of such fluorophore.
      • wherein the incubation is in a reaction under conditions sufficient to permit:
      • (a) the Forward and Reverse ORF1ab Primers to mediate a polymerase chain reaction amplification of a region of the ORF1ab of SARS-CoV-2 to thereby produce amplified ORF1ab oligonucleotide molecules, if the SARS-CoV-2 is present in the clinical sample;
      • (b) the TaqMan ORF1ab Probe to hybridize to amplified ORF1ab oligonucleotide molecules; and
      • (c) the 5′→3′ exonuclease activity to hydrolyze hybridized TaqMan ORF1ab Probe, to thereby separate the fluorophore thereof from the quencher thereof and cause a fluorescent signal to become detectable; and
    • (II) determining whether the SARS-CoV-2 is present in the clinical sample by determining whether a fluorescent signal of the fluorophore has become detectable.
  • E18. The method of any one of claims E14-E15, wherein the detectably labeled oligonucleotide is a molecular beacon probe.
  • E19. The method of E18, wherein the detectably labeled oligonucleotide is a Molecular Beacon ORF1ab Probe, and wherein the method comprises:
    • (I) incubating the clinical sample in vitro in the presence of:
      • (1) a reverse transcriptase and a DNA polymerase;
      • (2) a Forward (or sense strand) ORF1ab Primer;
      • (3) a Reverse (or antisense strand) ORF1ab Primer; and
      • (4) the Molecular Beacon ORF1ab Probe, wherein such probe is capable of detecting the presence of a SARS-CoV-2 ORF1ab oligonucleotide that is amplified by conducting PCR in the presence of such Forward and Reverse ORF1ab Primers, wherein the Molecular Beacon ORF1ab Probe comprises a SARS-CoV-2 ORF1ab oligonucleotide domain that is flanked by a 5′ oligonucleotide and a 3′ oligonucleotide, wherein such 5′ oligonucleotide and such 3′ oligonucleotide are at least substantially complementary to one another, and wherein at least one of such 5′ oligonucleotide and such 3′ oligonucleotide is detectably labeled and another of such 5′ oligonucleotide and such 3′ oligonucleotide is complexed to a quencher or an acceptor of such detectable label, wherein the SARS-CoV-2 ORF1ab oligonucleotide domain of the Molecular Beacon ORF1ab Probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, any of SEQ ID NOs:127-146, or any of SEQ ID NOs:147-166;
      • wherein the incubation is in a reaction under conditions sufficient to permit:
      • (a) the Forward and Reverse ORF1ab Primers to mediate a polymerase chain reaction amplification of a region of the ORF1ab of SARS-CoV-2 to thereby produce amplified ORF1ab oligonucleotide molecules, if the SARS-CoV-2 is present in the clinical sample;
      • (b) the Molecular Beacon ORF1ab Probe to hybridize to amplified ORF1ab oligonucleotide molecules, thereby separating the fluorophore thereof from the quencher thereof and causing a fluorescent signal to become detectable; and
    • (II) determining whether the SARS-CoV-2 is present in the clinical sample by determining whether a fluorescent signal of the fluorophore has become detectable.
  • E20. The method of any of E14-E15, wherein the detectably labeled oligonucleotide is a scorpion primer-probe.
  • E21. The method of E20, wherein the detectably labeled oligonucleotide is an ORF1ab Scorpion Primer-Probe, and wherein the method comprises:
    • (I) incubating the clinical sample in vitro in the presence of:
      • (1) a reverse transcriptase and a DNA polymerase;
      • (2) a Forward (or sense strand) ORF1ab Primer;
      • (3) a Reverse (or antisense strand) ORF1ab Primer; and
      • (4) the ORF1ab Scorpion Primer-Probe, wherein such probe is capable of detecting the presence of a SARS-CoV-2 ORF1ab oligonucleotide that is amplified by conducting PCR in the presence of such Forward and Reverse ORF1ab Primers, wherein the ORF1ab Scorpion Primer-Probe comprises a SARS-CoV-2 oligonucleotide domain that is flanked by a 5′ oligonucleotide and a 3′ oligonucleotide, wherein such 5′ oligonucleotide and such 3′ oligonucleotide are at least substantially complementary to one another, and wherein at least one of such 5′ oligonucleotide and such 3′ oligonucleotide is detectably labeled and the other of such 5′ oligonucleotide and such 3′ oligonucleotide is complexed to a quencher or an acceptor of such detectably label, and wherein such 3′ oligonucleotide further comprises a polymerization blocking moiety, and a PCR primer oligonucleotide positioned 3′ from the blocking moiety, wherein the SARS-CoV-2 oligonucleotide domain of the ORF1ab Scorpion Primer-Probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, any of SEQ ID NOs:127-146, or any of SEQ ID NOs:147-166; and wherein the PCR primer polynucleotide is selected so that it is capable of hybridizing to a region of ORF1ab that is approximately 7 bases, 8 bases, 9 bases, 10 bases, or more preferably 11 bases upstream of an ORF1ab sequence that is the same as the sequence of the probe's ORF1ab polynucleotide domain (or differs from such sequence by 5, 4, 3, 2 or 1 nucleotide residues), such that extension of the PCR primer polynucleotide domain of the ORF1ab Scorpion Primer-Probe forms an extension product whose sequence is complementary to the probe's ORF1ab polynucleotide domain;
      • wherein the incubation is in a reaction under conditions sufficient to permit:
      • (a) the Forward and Reverse ORF1ab Primers to mediate a polymerase chain reaction amplification of a region of the ORF1ab of SARS-CoV-2 to thereby produce amplified ORF1ab oligonucleotide molecules, if the SARS-CoV-2 is present in the clinical sample;
      • (b) the ORF1ab Scorpion Primer-Probe to hybridize to amplified ORF1ab oligonucleotide molecules and be extended to form a domain that is complementary to the sequence of the SARS-CoV-2 oligonucleotide domain of the ORF1ab Scorpion Primer-Probe, such that, upon denaturation, the SARS-CoV-2 oligonucleotide domain of the ORF1ab Scorpion Primer-Probe hybridizes to the extended domain of the ORF1ab Scorpion Primer-Probe, and thereby prevents the complementary 5′ oligonucleotide and 3′ oligonucleotide domains of the probe from re-hybridizing to one another and attenuating the quenching of the detectable label;
    • (II) determining whether the SARS-CoV-2 is present in the clinical sample by determining whether a fluorescent signal of the fluorophore has become detectable.
  • E22. The method of any of E17, E19, or E21, wherein the Forward (or sense strand) ORF1ab Primer is an oligonucleotide having a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:1 or any of SEQ ID NOs: 17-28.
  • E23. The method of any of E17, E19, or E22, wherein the Reverse (or antisense strand) ORF1ab Primer is an oligonucleotide having a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:2 or any of SEQ ID NOs:29-42.
  • E24. The method of E13, wherein the detectably labeled oligonucleotide has a nucleotide sequence that is able to specifically hybridize to an oligonucleotide having the nucleotide sequence of SEQ ID NO:7 or SEQ ID NO:8, and wherein the method detects the presence of SARS-CoV-2 in the clinical sample by detecting the presence of SARS-CoV-2 S gene.
  • E25. The method of E24, wherein the method comprises a PCR amplification of the SARS-CoV-2 polynucleotide.
  • E26. The method of E25, wherein the detectably labeled oligonucleotide is a TaqMan probe.
  • E27. The method of E26, wherein the detectably labeled oligonucleotide is a TaqMan S Gene Probe, and wherein the method comprises:
    • (I) incubating the clinical sample in vitro in the presence of:
      • (1) a reverse transcriptase and a DNA polymerase that has a 5′→3′ exonuclease activity;
      • (2) a Forward (or sense strand) S Gene Primer;
      • (3) a Reverse (or antisense strand) S Gene Primer; and
      • (4) a TaqMan S Gene Probe capable of detecting the presence of a SARS-CoV-2 S Gene oligonucleotide that is amplified by conducting PCR in the presence of such Forward and Reverse S Gene Primers, wherein the TaqMan S Gene Probe comprises a 5′ terminus and a 3′ terminus, and has a SARS-CoV-2 oligonucleotide portion whose nucleotide sequence consists of, consists essentially of, comprises, or is a variant of the nucleotide sequence of: SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, or any of SEQ ID NOs:364-381, wherein the 5′ terminus of the oligonucleotide is labeled with a fluorophore and the 3′ terminus of the oligonucleotide is complexed to a quencher of such fluorophore.
      • wherein the incubation is in a reaction under conditions sufficient to permit:
      • (a) the Forward and Reverse S Gene Primers to mediate a polymerase chain reaction amplification of a region of the S gene of SARS-CoV-2 to thereby produce amplified S gene oligonucleotide molecules, if the SARS-CoV-2 is present in the clinical sample;
      • (b) the TaqMan S Gene Probe to hybridize to amplified S gene oligonucleotide molecules; and
      • (c) the 5′→3′ exonuclease activity to hydrolyze hybridized TaqMan S Gene Probe, to thereby separate the fluorophore thereof from the quencher thereof and cause a fluorescent signal to become detectable; and
    • (II) determining whether the SARS-CoV-2 is present in the clinical sample by determining whether a fluorescent signal of the fluorophore has become detectable.
  • E28. The method of any one of E24-E25, wherein the detectably labeled oligonucleotide is a molecular beacon probe.
  • E29. The method of E28, wherein the detectably labeled oligonucleotide is a Molecular Beacon S Gene Probe, and wherein the method comprises:
    • (I) incubating the clinical sample in vitro in the presence of:
      • (1) a reverse transcriptase and a DNA polymerase;
      • (2) a Forward (or sense strand) S Gene Primer;
      • (3) a Reverse (or antisense strand) S Gene Primer; and
      • (4) the Molecular Beacon S Gene Probe, wherein such probe is capable of detecting the presence of a SARS-CoV-2 S gene oligonucleotide that is amplified by conducting PCR in the presence of such Forward and Reverse S Gene Primers, wherein the Molecular Beacon S Gene Probe comprises a SARS-CoV-2 S gene oligonucleotide portion that is flanked by a 5′ oligonucleotide and a 3′ oligonucleotide, wherein such 5′ oligonucleotide and such 3′ oligonucleotide are at least substantially complementary to one another, and wherein at least one of such 5′ oligonucleotide and such 3′ oligonucleotide is detectably labeled and another of such 5′ oligonucleotide and such 3′ oligonucleotide is complexed to a quencher or an acceptor of such detectable label, wherein the SARS-CoV-2 S gene oligonucleotide portion of the Molecular Beacon S Gene Probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of the nucleotide sequence of: SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, or any of SEQ ID NOs:364-381;
      • wherein the incubation is in a reaction under conditions sufficient to permit:
      • (a) the Forward and Reverse S Gene Primers to mediate a polymerase chain reaction amplification of a region of the S Gene of SARS-CoV-2 to thereby produce amplified S gene oligonucleotide molecules, if the SARS-CoV-2 is present in the clinical sample;
      • (b) the Molecular Beacon S Gene Probe to hybridize to amplified S gene oligonucleotide molecules, thereby separating the fluorophore thereof from the quencher thereof and causing a fluorescent signal to become detectable; and
    • (II) determining whether the SARS-CoV-2 is present in the clinical sample by determining whether a fluorescent signal of the fluorophore has become detectable.
  • E30. The method of any one of E24-E25, wherein the detectably labeled oligonucleotide is a scorpion primer-probe.
  • E31. The method of E30, wherein the detectably labeled oligonucleotide is an S Gene Scorpion Primer-Probe, and wherein the method comprises:
    • (I) incubating the clinical sample in vitro in the presence of:
      • (1) a reverse transcriptase and a DNA polymerase;
      • (2) a Forward (or sense strand) S Gene Primer;
      • (3) a Reverse (or antisense strand) S Gene Primer; and
      • (4) the S Gene Scorpion Primer-Probe, wherein such probe is capable of detecting the presence of a SARS-CoV-2 S gene oligonucleotide that is amplified by conducting PCR in the presence of such Forward and Reverse S Gene Primers, wherein the S Gene Scorpion Primer-Probe comprises a SARS-CoV-2 oligonucleotide domain that is flanked by a 5′ oligonucleotide and a 3′ oligonucleotide, wherein such 5′ oligonucleotide and such 3′ oligonucleotide are at least substantially complementary to one another, and wherein at least one of such 5′ oligonucleotide and such 3′ oligonucleotide is detectably labeled and the other of such 5′ oligonucleotide and such 3′ oligonucleotide is complexed to a quencher or an acceptor of such detectably label, and wherein such 3′ oligonucleotide further comprises a polymerization blocking moiety, and a PCR primer oligonucleotide positioned 3′ from the blocking moiety, wherein the SARS-CoV-2 oligonucleotide domain of the S Gene Scorpion Primer-Probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of the nucleotide sequence of: SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, or any of SEQ ID NOs:364-381; and wherein the PCR primer polynucleotide is selected so that it is capable of hybridizing to a region of S gene that is approximately 7 bases, 8 bases, 9 bases, 10 bases, or more preferably 11 bases upstream of an S gene sequence that is the same as the sequence of the probe's S gene oligonucleotide domain (or differs from such sequence by 5, 4, 3, 2 or 1 nucleotide residues), such that extension of the PCR primer polynucleotide domain of the S Gene Scorpion Primer-Probe forms an extension product whose sequence is complementary to the probe's S Gene polynucleotide domain;
      • wherein the incubation is in a reaction under conditions sufficient to permit:
      • (a) the Forward and Reverse S Gene Primers to mediate a polymerase chain reaction amplification of a region of the S gene of SARS-CoV-2 to thereby produce amplified S gene oligonucleotide molecules, if the SARS-CoV-2 is present in the clinical sample;
      • (b) the S Gene Scorpion Primer-Probe to hybridize to amplified S gene oligonucleotide molecules and be extended to form a domain that is complementary to the sequence of the SARS-CoV-2 oligonucleotide domain of the S Gene Scorpion Primer-Probe, such that, upon denaturation, the SARS-CoV-2 oligonucleotide domain of the S Gene Scorpion Primer-Probe hybridizes to the extended domain of the S Gene Scorpion Primer-Probe, and thereby prevents the complementary 5′ oligonucleotide and 3′ oligonucleotide domains of the probe from re-hybridizing to one another and attenuating the quenching of the detectable label;
    • (II) determining whether the SARS-CoV-2 is present in the clinical sample by determining whether a fluorescent signal of the fluorophore has become detectable.
  • E32. The method of any of E27, E29, or E31, wherein the Forward (or sense strand) S Gene Primer is an oligonucleotide having a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:5 or any of SEQ ID NOs:43-70, or any of SEQ ID NOs:71-84.
  • E33. The method of any of E27, E29, E31, or E32, wherein the Reverse (or antisense strand) S Gene Primer is an oligonucleotide having a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:6, or any of SEQ ID NOs:85-112, or any of SEQ ID NOs:113-126.
  • E34. The method of any one of E24-E33, wherein the method detects the presence or absence of the D614G polymorphism of the S gene of SARS-CoV-2.
  • E35. The method of any one of E34, wherein the method employs a TaqMan probe, a molecular beacon probe, a scorpion primer-probe or a HyBeaconā„¢ probe that comprises a SARS-CoV-2 oligonucleotide portion whose nucleotide sequence consists of, consists essentially of, comprises, or is a variant of the nucleotide sequence of: any of SEQ ID NOs:167-252, or any of SEQ ID NOs:273-363.
  • E36. The method of E13, wherein the method comprises a LAMP amplification of the SARS-CoV-2 polynucleotide.
  • E37. The method of E13-E36, wherein the method employs a fluorescently labeled oligonucleotide.
  • E38. An oligonucleotide that comprises a 5′ terminus and a 3′ terminus, wherein the oligonucleotide has a SARS-CoV-2 oligonucleotide domain that has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:17-42, any of SEQ ID NOs:43-70, any of SEQ ID NOs:71-84, any of SEQ ID NOs:85-112, any of SEQ ID NOs:113-126, any of SEQ ID NOs:127-146, any of SEQ ID NOs:147-166, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, any of SEQ ID NOs:364-381, any of SEQ ID NOs:398-402, any of SEQ ID NOs:403-406, SEQ ID NO:411, or SEQ ID NO:412.
  • E39. An oligonucleotide, wherein the oligonucleotide is detectably labeled and comprises a 5′ terminus and a 3′ terminus, wherein the oligonucleotide has a SARS-CoV-2 oligonucleotide domain that consists essentially of the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:43-70, any of SEQ ID NOs:85-112, any of SEQ ID NOs:127-146, any of SEQ ID NOs:147-166, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, any of SEQ ID NOs:364-381, any of SEQ ID NOs:403-406, SEQ ID NO:411, or SEQ ID NO:412.
  • E40. An oligonucleotide, wherein the oligonucleotide is detectably labeled and comprises a 5′ terminus and a 3′ terminus, wherein the oligonucleotide has a SARS-CoV-2 oligonucleotide domain that consists essentially of the nucleotide sequence of: SEQ ID NO:9, or SEQ ID NO:10.
  • E41 An oligonucleotide, wherein the oligonucleotide is detectably labeled and comprises a 5′ terminus and a 3′ terminus, wherein the oligonucleotide has a SARS-CoV-2 oligonucleotide domain that consists essentially of the nucleotide sequence of: SEQ ID NO:11, or SEQ ID NO:12.
  • E42. A TaqMan probe capable of detecting the presence of SARS-CoV-2, wherein the probe comprises an oligonucleotide, having a 5′ terminus and a 3′ terminus, that comprises a SARS-CoV-2 oligonucleotide domain whose nucleotide sequence consists of, consists essentially of, comprises, or is a variant of the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:127-146, any of SEQ ID NOs:147-166, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, any of SEQ ID NOs:364-381, wherein the 5′ terminus of the oligonucleotide is labeled with a fluorophore and the 3′ terminus of the oligonucleotide is complexed to a quencher of such fluorophore.
  • E43. A TaqMan probe, wherein the probe is capable of detecting the SARS-CoV-2 ORF1ab, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, any of SEQ ID NOs:127-146, or any of SEQ ID NOs:147-166.
  • E44. A TaqMan probe, wherein the probe is capable of detecting the SARS-CoV-2 S gene, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, or any of SEQ ID NOs:364-381.
  • E45. A TaqMan probe, wherein the probe is capable of detecting a polymorphism in the SARS-CoV-2 S gene, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: any of SEQ ID NOs:167-252, or any of SEQ ID NOs:273-363.
  • E46. A molecular beacon probe capable of detecting the presence of SARS-CoV-2, wherein the probe comprises an oligonucleotide, having a 5′ terminus and a 3′ terminus, that comprises a SARS-CoV-2 oligonucleotide domain whose nucleotide sequence consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:127-146, any of SEQ ID NOs:147-166, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, any of SEQ ID NOs:364-381, wherein such a SARS-CoV-2 oligonucleotide domain is flanked by a 5′ oligonucleotide and a 3′ oligonucleotide, wherein such 5′ oligonucleotide and such 3′ oligonucleotide are at least substantially complementary to one another, and wherein at least one of such 5′ oligonucleotide and such 3′ oligonucleotide is detectably labeled and another of such 5′ oligonucleotide and such 3′ oligonucleotide is complexed to a quencher or an acceptor of such detectable label.
  • E47. A molecular beacon probe, wherein the probe is capable of detecting the SARS-CoV-2 ORF1ab, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, any of SEQ ID NOs:127-146, or any of SEQ ID NOs:147-166.
  • E48. A molecular beacon probe, wherein the probe is capable of detecting the SARS-CoV-2 S gene, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, or any of SEQ ID NOs:364-381.
  • E49. A molecular beacon probe, wherein the probe is capable of detecting a polymorphism in the SARS-CoV-2 S gene, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: any of SEQ ID NOs:167-252, or any of SEQ ID NOs:273-363.
  • E50. A scorpion primer-probe capable of detecting the presence of SARS-CoV-2, wherein the probe comprises an oligonucleotide, having a 5′ terminus and a 3′ terminus, that comprises a SARS-CoV-2 oligonucleotide domain whose nucleotide sequence consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:127-146, any of SEQ ID NOs:147-166, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, any of SEQ ID NOs:364-381, wherein such a SARS-CoV-2 oligonucleotide domain is flanked by a 5′ oligonucleotide and a 3′ oligonucleotide, wherein such 5′ oligonucleotide and such 3′ oligonucleotide are at least substantially complementary to one another, and wherein at least one of such 5′ oligonucleotide and such 3′ oligonucleotide is detectably labeled and the other of such 5′ oligonucleotide and such 3′ oligonucleotide is complexed to a quencher or an acceptor of such detectably label, and wherein such 3′ oligonucleotide further comprises a polymerization blocking moiety, and a PCR primer oligonucleotide positioned 3′ from the blocking moiety.
  • E51. A scorpion primer-probe, wherein the probe is capable of detecting the SARS-CoV-2 ORF1ab, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, any of SEQ ID NOs:127-146, or any of SEQ ID NOs:147-166.
  • E52. A scorpion primer-probe, wherein the probe is capable of detecting the SARS-CoV-2 S gene, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, or any of SEQ ID NOs:364-381.
  • E53. A scorpion primer-probe, wherein the probe is capable of detecting a polymorphism in the SARS-CoV-2 S gene, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: any of SEQ ID NOs:167-252, or any of SEQ ID NOs:273-363.
  • E54. A scorpion primer-probe, wherein the probe is capable of detecting a polymorphism in the SARS-CoV-2 S gene, and wherein the PCR primer oligonucleotide has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: any of SEQ ID NOs:43-70, or any of SEQ ID NOs:85-112.
  • E55. A HyBeaconā„¢ probe capable of detecting the presence of SARS-CoV-2, wherein such probe comprises an oligonucleotide, having a 5′ terminus and a 3′ terminus, that comprises a SARS-CoV-2 oligonucleotide domain whose nucleotide sequence consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, any of SEQ ID NOs:127-146, any of SEQ ID NOs:147-166, any of SEQ ID NOs:167-252, any of SEQ ID NOs:253-272, any of SEQ ID NOs:273-363, any of SEQ ID NOs:364-381, wherein at least one nucleotide residue of such SARS-CoV-2 oligonucleotide domain is detectably labeled.
  • E56. A HyBeaconā„¢ probe, wherein the probe is capable of detecting a polymorphism in the SARS-CoV-2 S gene, and wherein the SARS-CoV-2 oligonucleotide domain of the probe has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: any of SEQ ID NOs:43-70, any of SEQ ID NOs:85-112, any of SEQ ID NOs:167-252, or any of SEQ ID NOs:273-363.
  • E57. The oligonucleotide of any of E39-E41, the TaqMan probe of any of E42-E45, the molecular beacon probe of any of E46-E49, the scorpion primer-probe of any of E50-E54, or the HyBeaconā„¢ probe of any of E55-E56, wherein the detectable label is a fluorophore that has an excitation wavelength within the range of about 352-690 nm and an emission wavelength that is within the range of about 447-705 nm.
  • E58. The oligonucleotide, TaqMan probe, molecular beacon probe, scorpion primer-probe, or HyBeaconā„¢ probe of E57, wherein the fluorophore is JOE or FAM.
  • E59. An oligonucleotide primer capable of amplifying an oligonucleotide portion of a SARS-CoV-2 polynucleotide present in a sample, wherein such oligonucleotide primer has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: any of: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:6, any of SEQ ID NOs:17-28, any of SEQ ID NOs:29-42, any of SEQ ID NOs:43-70, any of SEQ ID NOs:71-84, any of SEQ ID NOs:85-112, any of SEQ ID NOs:113-126, or any of SEQ ID NOs:398-410.
  • E60. An oligonucleotide that has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:3 or SEQ ID NO:4.
  • E61. An oligonucleotide that has a nucleotide sequence that consists of, consists essentially of, comprises, or is a variant of, the nucleotide sequence of: SEQ ID NO:7 or SEQ ID NO:8.

EXAMPLES

Having now generally described the invention, the same will be more readily understood through reference to the following examples, which are provided by way of illustration and are not intended to be limiting of the present invention unless specified.

Example 1

Design of the Preferred Primers and Probes

Two sets of primers and probes were designed for the specific detection of SARS-CoV-2. Each primer/probe set on its own has been shown to provide sensitive and specific detection of SARS-CoV-2 with no detection or cross-reactivity to other coronaviruses. The SARS-CoV-2 Reference Sequence (NC_045512.2; Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1, complete genome) was used to design such primers and probes.

The genome alignment of CoVs shows 58% identity of non-structural protein-coding region and 43% identity of structural proteins-coding region among different coronaviruses, with 54% identity at the whole genome level. This suggests that the non-structural proteins are more conserved and that the structural proteins exhibit greater diversity to fit their different environments (Chen, Y, et al. (2020) ā€œEmerging Coronaviruses: Genome Structure, Replication, And Pathogenesis,ā€ J. Med. Virol. 92:418-423).

An analysis was conducted comparing the sequence of SARS-CoV-2 to the sequences of six other CoVs that can infect humans and cause respiratory diseases, in order to select a region that would be able to detect and specifically discriminate SARS-CoV-2 from such other CoVs. The analysis focused on genomic regions coding for structural proteins that are unique to this virus (Ji, W. et al. (2020) ā€œCross-Species Transmission Of The Newly Identified Coronavirus 2019-nCoV,ā€ J Med. Virol. 92:433-440). However, since it is possible that such regions might frequently recombine, in parallel, primers were designed against genomic regions coding for non-structural proteins.

Regarding the selection of the S gene, the SARS-CoV-2 may be generated by a homologous recombination within a region spanning between position 21500 and 24000 (2500 bp), which covers most of the S gene sequence (Chen, Y, et al. (2020) ā€œEmerging Coronaviruses: Genome Structure, Replication, And Pathogenesis,ā€ J. Med. Virol. 92:418-423). In particular, inside the 2500 bp region, Chen, Y, et al. (2020) identified a unique sequence corresponding to the first 783 nucleotides at the 5′ end of the S gene. BLAST analysis of a 783 nucleotide fragment provided no match with any sequence present in NCBI database, apart from the Wuhan seafood market pneumonia virus isolate Wuhan-Hu-14.

Regarding the selection of the ORF1ab sequence, the SARS-CoV-2 has a characteristic non-structural protein-coding region, covering about two-thirds of its genome length, and encoding 16 non-structural proteins (nsp1-16); the sequence shows 58% identity to the sequences of other CoVs (Chen, Y, et al. (2020) ā€œEmerging Coronaviruses: Genome Structure, Replication, And Pathogenesis,ā€ J. Med. Virol. 92:418-423). This approximately 20 kb region was chosen for the design of different primer sets specific for SARS-CoV-2.

All primer sets designed to target ORF1ab and the S gene have been tested on the SARS-CoV2 complete genome sequences available in the Global Initiative on Sharing All Influenza Data (GISAID) database, using Geneious Prime software. Sequences were mapped to the Reference Sequence of SARS-CoV-2 (NC_045512.2), and the identified primers and probes were tested against the consensus. The analysis showed that all regions recognized by the identified primers and probes have a homology of 100% with all available SARS-CoV-2 sequences.

In addition to verifying the specificity of the design, the sequences of the six CoVs that can infect humans causing respiratory diseases (i.e., HCoV-229E, HCoV-OC43, HCoV-NL63, HKU1, SARS-CoV and MERS-CoV) were examined. The accession numbers for such sequences are: NC_002645.1 (Human coronavirus 229E); NC_006213.1 (Human coronavirus OC43 strain ATCC VR-759); NC_005831.2 (Human Coronavirus NL63), NC_006577.2 (Human coronavirus HKU1), NC_004718.3 (SARS-coronavirus), and NC_019843.3 (Middle East Respiratory Syndrome coronavirus).

The sequences of the above-described preferred Forward and Reverse ORF1ab Primers (SEQ ID NO:1 and SEQ ID NO:2, respectively), the above-described preferred Forward and Reverse S Gene Primers (SEQ ID NO:5 and SEQ ID NO:6, respectively), the above-described preferred ORF1ab Probe (SEQ ID NO:9) and the above-described preferred S Gene Probe (SEQ ID NO:11) were identified through such an analysis.

Example 2

Specificity of the SARS-CoV-2 Assay

Upon in silico analysis, a SIMPLEXAĀ® SARS-CoV-2 Direct assay using the above-described preferred Forward and Reverse ORF1ab and S Gene Primers and the above-described preferred ORF1ab and S Gene Probes were found to detect all SARS-CoV-2 virus strains and to exhibit no cross-reactivity with non-SARS-CoV-2 species.

In addition to the in silico analysis, an in vitro analysis of specificity was performed. The results of the in vitro specimen testing are presented in Table 14.

TABLE 14
Qualitative % Detection
(# Detected/# Tested)
Internal
Tested S Gene ORF1ab Control
Organism Concentration (FAM) (JOE) (Q670)
Adenovirus 1 1 Ɨ 105 U/mL 0% 0% 100%
(0/3) (0/3) (3/3)
Bordetella pertussis 1 Ɨ 106 CFU/mL 0% 0% 100%
(0/3) (0/3) (3/3)
Chlamydophila 1 Ɨ 106 IFU/mL 0% 0% 100%
pneumoniae (0/3) (0/3) (3/3)
Coronavirus 229E 1 Ɨ 105 TCID50/mL 0% 0% 100%
(0/3) (0/3) (3/3)
Coronavirus NL63 1 Ɨ 105 U/mL 0% 0% 100%
(0/3) (0/3) (3/3)
Coronavirus OC43 1 Ɨ 105 TCID50/mL 0% 0% 100%
(0/3) (0/3) (3/3)
Enterovirus 68 1 Ɨ 105 TCID50/mL 0% 0% 100%
(0/3) (0/3) (3/3)
Haemophilus influenzae 1 Ɨ 106 CFU/mL 0% 0% 100%
(0/3) (0/3) (3/3)
Human 1 Ɨ 105 TCID50/mL 0% 0% 100%
metapneumovirus (0/3) (0/3) (3/3)
(hMPV-9)
Influenza A H3N2 1 Ɨ 105 TCID50/mL 0% 0% 100%
Hong Kong 8/68 (0/3) (0/3) (3/3)
Influenza B 1 Ɨ 105 TCID50/mL 0% 0% 100%
Phuket 3073/2013 (0/3) (0/3) (3/3)
Legionella 1 Ɨ 106 CFU/mL 0% 0% 100%
pneumophilia (0/3) (0/3) (3/3)
MERS Coronavirus 1:3 dilution 0% 0% 100%
(Extracted RNA) (0/3) (0/3) (3/3)
Mycobacterium 1 Ɨ 106 copies/mL 0% 0% 100%
tuberculosis (0/3) (0/3) (3/3)
(Genomic DNA)
Parainfluenza Type 1 1 Ɨ 105 U/mL 0% 0% 100%
(0/3) (0/3) (3/3)
Parainfluenza Type 2 1 Ɨ 105 U/mL 0% 0% 100%
(0/3) (0/3) (3/3)
Parainfluenza Type 3 1 Ɨ 105 TCID50/mL 0% 0% 100%
(0/3) (0/3) (3/3)
Parainfluenza Type 4A 1 Ɨ 105 U/mL 0% 0% 100%
(0/3) (0/3) (3/3)
Rhinovirus B14 1 Ɨ 105 U/mL 0% 0% 100%
(0/3) (0/3) (3/3)
RSV A Long 1 Ɨ 105 TCID50/mL 0% 0% 100%
(0/3) (0/3) (3/3)
RSV B Washington 1 Ɨ 105 TCID50/mL 0% 0% 100%
(0/3) (0/3) (3/3)
SARS-Coronavirus 1 Ɨ 105 copies/mL 0% 0% 100%
(Purified RNA) (0/3) (0/3) (3/3)
SARS-Coronavirus 1:10 dilution 0% 0% 100%
HKU39849 (0/3) (0/3) (3/3)
(Extracted RNA)
Streptococcus 1 Ɨ 106 CFU/mL 0% 0% 100%
pneumoniae (0/3) (0/3) (3/3)
Streptococcus pyogenes 1 Ɨ 106 CFU/mL 0% 0% 100%
(0/3) (0/3) (3/3)
Human leukocytes 1 Ɨ 106 cells/mL 0% 0% 100%
(human genomic DNA) (0/3) (0/3) (3/3)
Pooled Human Nasal 1:5 dilution 0% 0% 100%
Fluid (0/3) (0/3) (3/3)

The assay was also found to demonstrate 100% specificity on a negative matrix (Universal Transport Medium (UTM); Copan Diagnostics). No not-specific signals were observed.

In conclusion, the above-described preferred Forward and Reverse ORF1ab Primers and the above-described preferred ORF1ab Probe were found to be capable of detecting SARS-CoV-2 without exhibiting cross-reactivity to human DNA, or to DNA (or cDNA) of other pathogens. Additionally, the above-described preferred Forward and Reverse S Gene Primers and the above-described preferred S Gene Probe were found to be capable of detecting SARS-CoV-2 without exhibiting cross-reactivity to human DNA, or to DNA (or cDNA) of other pathogens. The assay is thus specific for SARS-CoV-2.

The observation that the assay of the present invention reports the detection of SARS-CoV-2 when only one of such sets of primers and probes is employed (i.e., either a probe and primer set that targets ORF1ab or a probe and primer set that targets the S gene) indicates that by using both such sets of probes and primers, one can increase assay sensitivity in cases of low viral loads and that the accuracy of the assay will not be jeopardized by any point mutation which may occur during COVID-19 spread across the population.

To demonstrate the improvement in assay sensitivity obtained using both sets of preferred primers and probes, a preparation of SARS-CoV2 viral particles (from isolate 2019nCoV/italy-INMI1) in an oral swab-UTM matrix was tested at doses ranging from 10āˆ’5 to 10āˆ’8 TCID50/mL. As reported in Table 15 and Table 16, relative to the detection of either ORF1ab sequences or S gene sequences, the use of both sets of preferred primers and probes was found to increase the sensitivity of the assay, achieving the detection of the 10āˆ’8 TCID50/mL dose instead of 10āˆ’7 TCID50/mL.

TABLE 15
Samples ORF1ab S Gene
Reps TCID50/mL Copies/mL Target Target Result
 1-40 10āˆ’7 4000 Detected Detected Positive
1-3 10āˆ’8 400 Detected Detected Positive
4 Detected Not Detected Positive
5 Not Detected Detected Positive
6 Not Detected Not Detected Negative
7 Detected Detected Positive
8 Not Detected Detected Positive
9 Detected Detected Positive
10 Not Detected Not Detected Negative
11 Detected Not Detected Positive
12-13 Detected Detected Positive
14 Not Detected Detected Positive
15-18 Detected Detected Positive
19 Not Detected Not Detected Negative

The results obtained at 10āˆ’8 TCID50/mL (400 copies/mL) are summarized in Table 16.

TABLE 16
(Assay Detection Capability at 400 Viral RNA Copies/mL)
ORF1ab S Gene ORF1ab and S Gene
Number of Replicates 13/19 14/19 16/19
Detected
Percentage of Detection 68% 73.7% 84.2%

The data used in Table 16 was based on a viral dose of 10āˆ’8 TCID50/mL (400 copies/mL). When the samples contained 500 viral RNA copies/mL, the assays of the present invention exhibited a 100% ability to detect SARS-CoV-2 (Table 17).

TABLE 17
(Assay Detection Capability at 500 Viral RNA Copies/mL)
ORF1ab S Gene ORF1ab and S Gene
Number of Replicates 34/47 46/48 48/48
Detected
Percentage of Detection 72.3% 95.8% 100%

This level of sensitivity (determined with genomic viral RNA) reflects the type of results one would obtain using clinical samples containing SARS-CoV-2. The assays of the present invention thus will provide healthcare workers with analytical indications that will enable them to better interpret the results of the assay in clinical practice.

Example 3

Diagnostic Accuracy of the SARS-CoV-2 Assay

In a comparison between the methods of the present invention and the reference method of Corman, V. M. et al. (2020) (ā€œDetection Of 2019 Novel Coronavirus (2019-nCoV) By Real-Time RT-PCR,ā€ Eurosurveill. 25(3):2000045), the lower limit of detection (LoD) for both target genes was found to be the same: 3.2 (CI: 2.9-3.8) log 10 cp/mL and 0.40 (CI: 0.2-1.5) TCID50/mL for S gene while 3.2 log 10 (CI: 2.9-3.7) log 10 cp/mL and 0.4 (CI: 0.2-1.3) TCID50/mL for ORF1ab. The LoD obtained with extracted viral RNA for both S gene or ORF1ab was 2.7 log 10 cp/mL. Crossreactive analysis performed in 20 nasopharyngeal swabs confirmed a 100% of clinical specificity of the assay. Clinical performances of the SIMPLEXAĀ® COVID-19 Direct assay were assessed in 278 nasopharyngeal swabs tested in parallel with Corman's method. Concordance analysis showed an ā€œalmost perfectā€ agreement in SARS-CoV-2 RNA detection between the two assays, being Īŗ=0.938; SE=0.021; 95% CI=0.896-0.980, with the SIMPLEXAĀ® COVID-19 Direct assay showing a slightly higher sensitivity relative to the reference Corman's method, identifying nearly 3% additional positive samples, and detecting SARS-CoV-2 in BAL samples that had been found to give invalid results with the reference method (Bordi, L. et al. (2020) ā€œRapid And Sensitive Detection Of SARS-Cov-2 RNA Using The SIMPLEXAĀ® COVID-19 Direct Assay,ā€ J. Clin. Virol. 128:104416:1-5).

The methods of the present invention were found to have the lowest LoD (39±23 copies/ml) in a comparative study of different SARS-CoV-2 assays (Zhen, W. et al. (2020) ā€œComparison of Four Molecular In Vitro Diagnostic Assays for the Detection of SARS-CoV-2 in Nasopharyngeal Specimens,ā€ J. Clin. Microbiol. 58(8): e00743-20:1-8).

Similar findings that the methods of the present invention were more sensitive than other laboratory tests for SARS-CoV-2 have been reported by other research groups (Lieberman, J. A. et al. (2020) ā€œComparison of Commercially Available and Laboratory-Developed Assays for In Vitro Detection of SARS-CoV-2 in Clinical Laboratories,ā€ J. Clin. Microbiol. 58(8):e00821-20:1-6; Rhoads, D. D. et al. (2020) ā€œComparison Of Abbott ID NOWā„¢, DiaSorin SIMPLEXAĀ®, And CDC FDA Emergency Use Authorization Methods For The Detection Of SARS-CoV-2 From Nasopharyngeal And Nasal Swabs From Individuals Diagnosed With COVID-19,ā€ J. Clin. Microbiol. 58(8): e00760-20:1-2).

Cradic, K. et al. (2020) (ā€œClinical Evaluation and Utilization of Multiple Molecular In Vitro Diagnostic Assays for the Detection of SARS-CoV-2,ā€ Am. J. Clin. Pathol. 154(2):201-207) found that the methods of the present invention were more sensitive than the Abbott ID NOWā„¢ test, and as sensitive as the Roche COBASĀ® SARS-CoV-2 assay, despite not requiring sample processing steps of the Roche COBASĀ® assay or the Roche COBASĀ® assay's larger sample volume.

Fung, B. et. al. (2020) (ā€œDirect Comparison of SARS-CoV-2 Analytical Limits of Detection across Seven Molecular Assays,ā€ J. Clin. Microbiol. 58(9):e01535-20:) found that the Roche COBASĀ® assay was more sensitive than the assays of the present invention, but required more time to produce diagnostic results; the study did not evaluate the impact of specimen matrix on the ability to detect virus or compatibility with different media types.

Liotti, F. M. et al. (2020) (ā€œEvaluation Of Three Commercial Assays For SARS-CoV-2 Molecular Detection In Upper Respiratory Tract Samples,ā€ Eur. J. Clin. Microbiol. Infect. Dis. 10.1007/s10096-020-04025-0:1-9), likewise found that the methods of the present invention provided an accurate diagnostic test for SARS-CoV-2.

All publications and patents mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference in its entirety. While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth.

Claims

1. A detectably labeled oligonucleotide that is capable of specifically hybridizing to a SARS-CoV-2 polynucleotide, wherein the nucleotide sequence of said detectably labeled oligonucleotide that is capable of specifically hybridizing to said SARS-CoV-2 polynucleotide is able to specifically hybridize to an oligonucleotide having a nucleotide sequence that consists essentially of the nucleotide sequence of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7 or SEQ ID NO:8.

2. The detectably labeled oligonucleotide of claim 1, wherein the nucleotide sequence of said oligonucleotide that is capable of specifically hybridizing to said SARS-CoV-2 polynucleotide is able to specifically hybridize to an oligonucleotide having a nucleotide sequence that consists essentially of the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4.

3. The detectably labeled oligonucleotide of claim 1, wherein the nucleotide sequence of said oligonucleotide that is capable of specifically hybridizing to said SARS-CoV-2 polynucleotide is able to specifically hybridize to an oligonucleotide having that consists essentially of the nucleotide sequence of SEQ ID NO:7 or SEQ ID NO:8.

4. A kit for detecting the presence of SARS-CoV-2 in a clinical sample, wherein said kit comprises:

(A) an oligonucleotide primer capable of amplifying a portion of a SARS-CoV-2 polynucleotide; and

(B) a detectably labeled oligonucleotide that is capable of specifically hybridizing to a said amplified portion of said SARS-CoV-2 polynucleotide, wherein the nucleotide sequence of said detectably labeled oligonucleotide that is capable of specifically hybridizing to said SARS-CoV-2 polynucleotide is able to specifically hybridize to an oligonucleotide having a nucleotide sequence that consists essentially of the nucleotide sequence of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7 or SEQ ID NO:8.

5. The kit of claim 4, wherein the nucleotide sequence of said detectably labeled oligonucleotide that is capable of specifically hybridizing to said SARS-CoV-2 polynucleotide is able to specifically hybridize to an oligonucleotide having a nucleotide sequence that consists essentially of the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4, and wherein said kit permits a determination of the presence or absence of the SARS-CoV-2 ORF1ab in a clinical sample.

6. The kit of claim 4, wherein the nucleotide sequence of said detectably labeled oligonucleotide that is capable of specifically hybridizing to said SARS-CoV-2 polynucleotide is able to specifically hybridize to an oligonucleotide having a nucleotide sequence that consists essentially of the nucleotide sequence of SEQ ID NO:7 or SEQ ID NO:8, and wherein said kit permits a determination of the presence or absence of the SARS-CoV-2 S gene in a clinical sample.

7. The kit of claim 4, wherein said kit permits the detection of the D614G polymorphism of the S gene of SARS-CoV-2.

8. The kit of claim 4, wherein said kit is a multi-chambered, fluidic device.

9. The kit of claim 4, wherein said detectably labeled oligonucleotide is a TaqMan probe, a molecular beacon probe, a scorpion primer-probe, or a HyBeacon probe.

10. The kit of claim 4, wherein said detectably labeled oligonucleotide is fluorescently labeled.

11. The kit of claim 4, wherein said kit comprises two detectably labeled oligonucleotides, wherein the detectable labels of said oligonucleotides are distinguishable, and wherein the nucleotide sequence of one of said two detectably labeled oligonucleotides that is capable of specifically hybridizing to said SARS-CoV-2 polynucleotide is able to specifically hybridize to an oligonucleotide having a nucleotide sequence that consists essentially of the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4, and the nucleotide sequence of the second of said two detectably labeled oligonucleotides that is capable of specifically hybridizing to said SARS-CoV-2 polynucleotide is able to specifically hybridize to an oligonucleotide having a nucleotide sequence that consists essentially of the nucleotide sequence of SEQ ID NO:7 or SEQ ID NO:8.

12. The kit of claim 11, wherein at least one of said detectably labeled oligonucleotides is a TaqMan probe, a molecular beacon probe, a scorpion primer-probe probe or a HyBeaconā„¢ probe.

13. The kit of claim 11, wherein the distinguishable detectable labels of said oligonucleotides are fluorescent labels.

14. The kit of claim 11, wherein said kit permits the detection of the D614G polymorphism of the S gene of SARS-CoV-2.

15. The kit of claim 11, wherein said kit is a multi-chambered, fluidic device.

16. The kit of claim 11, wherein said detectably labeled oligonucleotide is fluorescently labeled.

17. A method for detecting the presence of SARS-CoV-2 in a clinical sample, wherein said method comprises incubating said clinical sample in vitro in the presence of a detectably labeled oligonucleotide that is capable of specifically hybridizing to a SARS-CoV-2 ORF1ab or SARS-CoV-2 S gene polynucleotide, wherein the nucleotide sequence of said detectably labeled oligonucleotide that is capable of specifically hybridizing to said SARS-CoV-2 polynucleotide is able to specifically hybridize to an oligonucleotide having a nucleotide sequence that consists essentially of the nucleotide sequence of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7 or SEQ ID NO:8; wherein said method detects the presence of SARS-CoV-2 in said clinical sample by detecting the presence of SARS-CoV-2 ORF1ab and/or SARS-CoV-2 S gene.

18. The method of claim 17, wherein the nucleotide sequence of said detectably labeled oligonucleotide that is capable of specifically hybridizing to said SARS-CoV-2 polynucleotide is able to specifically hybridize to an oligonucleotide having a nucleotide sequence that consists essentially of the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4, and wherein said method detects the presence of SARS-CoV-2 in said clinical sample by detecting the presence of SARS-CoV-2 ORF1ab.

19. The method of claim 17, wherein the nucleotide sequence of said detectably labeled oligonucleotide that is capable of specifically hybridizing to said SARS-CoV-2 polynucleotide is able to specifically hybridize to an oligonucleotide having a nucleotide sequence that consists essentially of the nucleotide sequence of SEQ ID NO:7 or SEQ ID NO:8, and wherein said method detects the presence of SARS-CoV-2 in said clinical sample by detecting the presence of SARS-CoV-2 S gene.

20. The method of claim 19, wherein said method detects the presence or absence of the D614G polymorphism of the S gene of SARS-CoV-2.

21. The method of claim 17, wherein said method comprises a PCR amplification of said SARS-CoV-2 polynucleotide.

22. The method of claim 17, wherein said detectably labeled oligonucleotide is a TaqMan probe, a molecular beacon probe, a scorpion primer-probe, or a HyBeacon probe.

23. The method of claim 17, wherein said method comprises a LAMP amplification of said SARS-CoV-2 polynucleotide.

24. The method of claim 17, wherein said detectably labeled oligonucleotide is fluorescently labeled.

25. The method of claim 17, wherein said method comprises incubating said clinical sample in the presence of two detectably labeled oligonucleotides, wherein the detectable labels of said oligonucleotides are distinguishable, and wherein the nucleotide sequence of one of said two detectably labeled oligonucleotides that is capable of specifically hybridizing to said SARS-CoV-2 polynucleotide is able to specifically hybridize to an oligonucleotide having a nucleotide sequence that consists essentially of the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4, and the nucleotide sequence of the second of said two detectably labeled oligonucleotides that is capable of specifically hybridizing to said SARS-CoV-2 polynucleotide is able to specifically hybridize to an oligonucleotide having a nucleotide sequence that consists essentially of the nucleotide sequence of SEQ ID NO:7 or SEQ ID NO:8; wherein said method detects the presence of SARS-CoV-2 in said clinical sample by detecting the presence of both SARS-CoV-2 ORF1ab and SARS-CoV-2 S gene.

26. The method of claim 25, wherein said method detects the presence or absence of the D614G polymorphism of the S gene of SARS-CoV-2.

27. The method of claim 25, wherein said method comprises a PCR amplification of said SARS-CoV-2 polynucleotide.

28. The method of claim 25, wherein said detectably labeled oligonucleotide is a TaqMan probe, a molecular beacon probe, a scorpion primer-probe, or a HyBeacon probe.

29. The method of claim 25, wherein said method comprises a LAMP amplification of said SARS-CoV-2 polynucleotide.

30. The method of claim 25, wherein said detectably labeled oligonucleotide is fluorescently labeled.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: