US20210337753A1
2021-11-04
16/972,647
2019-06-06
Methods of in vitro clonal propagation, regeneration and transformation in Cannabis are provided. Also provided is the use of such methods in improvements of cannabis cultivars such as via breeding.
Get notified when new applications in this technology area are published.
A01H4/005 » CPC main
Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor Methods for micropropagation; Vegetative plant propagation using cell or tissue culture techniques
A01H4/008 » CPC further
Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor Methods for regeneration to complete plants
A01G31/00 » CPC further
Soilless cultivation, e.g. hydroponics
A01H4/00 IPC
Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
A01H6/28 » CPC further
Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy Cannabaceae, e.g. cannabis
A01G22/00 » CPC further
Cultivation of specific crops or plants not otherwise provided for
This application claims the benefit of priority of U.S. Provisional Patent Application No. 62/681,697 filed on 7 Jun. 2018, the contents of which are incorporated herein by reference in their entirety.
The ASCII file, entitled 77944 Sequence Listing.txt, created on 5 Jun. 2019, comprising 49,173 bytes, submitted concurrently with the filing of this application is incorporated herein by reference.
The present invention, in some embodiments thereof, relates to methods of regenerating and transforming cannabis.
Cannabis sativa L. is an annual herb. It is among the earliest cultivated plants which originated in Central Asia. It is valued as a food, oil, fiber, medicinal and recreational drug source and, consequently, has been dispersed throughout the world. Cannabis sativa L. (marijuana) contains cannabinoids, a unique class of terpenophenolic compounds which accumulates mainly in glandular trichomes of the plant. Over 100 cannabinoids have been isolated from marijuana, the major biologically active compound being A9-tetrahydrocannabinol, commonly referred as THC.
The development of genetic transformation technology for plants has resulted in a great progress toward the genetic design of plants with enhanced production traits, such as herbicide, insect and disease resistance. Commercial cultivars of several transgenic plants have been released. The development of new Cannabis cultivars with improved traits could be further facilitated using biotechnological strategies. The dioecious life cycle of many Cannabis varieties complicates breeding efforts towards improvement of specific traits, such as resistance to pests and diseases. Development of a tissue culture system to regenerate cannabis plantlets and an Agrobacterium mediated transformation protocol would permit exploitation of a greater amount of genetic diversity for plant improvement and would facilitate clonal multiplication of plants with desirable traits.
There are only a small number of reports concerning tissue culture of Cannabis. Most of these studies were aimed at developing a cell culture system to obtain secondary metabolites, particularly the class of cannabinoids that are distinctive to the genus Cannabis (Turner et al., 1980). Callus cultures (Hemphill et al., 1978; Heitrich and Binder, 1982) and suspension cultures (Veliky and Genest, 1972; Itokawa et al., 1977; Hartsel et al., 1983; Loh et al., 1983; Braemer and Paris, 1987) have been established for extraction of secondary metabolites and biotransformation studies.
Methods to multiply C. sativa plants in-vitro via stimulation of axillary buds on nodal segments, or induction of adventitious buds in the shoot tips have been described (Lata et al., 2009 vitro Cell. Dev. Biol. Plant 45, 12-19. doi: 10.1007/s11627-008-9167-5; Wang et al., 2009 Pak. J. Bot. 41, 603-608). It was shown that micro-propagated plants are genetically stable; therefore the method is appropriate and useful for the clonal multiplication of this important crop (Lata et al., 2010 Planta Med. 76, 1629-1633. doi: 10.1055/s-0030-1249773; Lata et al. Journal of Applied Research on Medicinal and Aromatic Plants 3 (2016) 18-26).
A protocol has also been developed for the propagation of hemp via the synthetic seed technology. According to this procedure, axillary buds or nodal segments are encapsulated in calcium alginate beads (Lata et al., 2009 Physiol. Mol. Biol. Plants 15, 79-86. doi: 10.1007/s12298-009-0008-8, Lata 2011 Biotechnol. Lett. 33, 2503-2508. doi: 10.1007/s10529-011-0712-7), which can then be stored and subsequently used for clonal propagation of the plant. This system was shown to allow the growth of homogeneous and genetically stable Cannabis plants even after 6 months of storage (Lata et al., 2011, Biotechnol. Lett. 33, 2503-2508. doi: 10.1007/s10529-011-0712-7).
Organ regeneration, in particular shoots, can be quite cumbersome and therefore the screening of different plant growth regulator concentrations and combinations has to be carried out to find the right culture medium composition.
Cannabis sativa is a notorious recalcitrant plant to transformation, because the regeneration efficiencies are quite low (Slusarkiewicz-Jarzina et al., 2005 Acta Biol. Cracov. Ser. Bot. 47, 145-151).
Genome editing is a promising new technique for plant breeding. With designer nucleases called CRISPR-Cas9 mutations can be precisely directed to any gene of interest. Successful genome editing requires simple genetics (diploid) and the availability of a high-quality genomic DNA sequence. Following editing, the CRISPR-Cas genes should be removed, for example by crossing and selecting null-segregates that inherit the induced mutation. Crossing is not suitable for heterozygous crops like Cannabis, in which varieties are vegetatively propagated. Methods for transient expression in leaf protoplasts need to be developed.
Additional background art includes:
Zhao et al., 2017âNature plants. 3(12). 956;
MacKinnon, L., McDougall, G., Azis, N., and Millam, S. (2001). âProgress towards transformation of fibre hemp,â in Annual Report of the Scottish Crop Research Institute 2000/2001, eds W. H. Macfarlane Smith and T. D. Heilbronn (Dundee: SCRI Invergowrie), 84-86;
U.S. Patent Application Publication number: 20120311744;
According to an aspect of some embodiments of the present invention there is provided a method of in-vitro propagating cannabis, the method comprising:
(a) culturing a cannabis plant part comprising a meristem on a solid culture medium so as to obtain an explant; and subsequently
(b) subjecting the explant to a cell wall disrupting agent;
(c) culturing the explant in a liquid medium; and optionally subsequently
wherein steps (a)-(c) are effected for 1 to n times until emergence of leaves suitable for regeneration.
According to some embodiments of the invention, the method further comprises sterilizing the explant prior to (a).
According to some embodiments of the invention, the liquid medium comprises the cell wall disrupting agent.
According to some embodiments of the invention, the step (c) is performed while shaking.
According to some embodiments of the invention, step (a) is performed for 7-30 days.
According to some embodiments of the invention, step (c) is performed for 5-30 days.
According to some embodiments of the invention, the meristem is an apical meristem or an axillary meristem.
According to some embodiments of the invention, the explant comprising the meristem is of a stem.
According to some embodiments of the invention, the explant is from a seedling.
According to some embodiments of the invention, the explant is from a mature plant.
According to some embodiments of the invention, the method further comprises removing leaves and necrotic regions from the explant between steps (a) to (c).
According to some embodiments of the invention, the cell wall disrupting agent is selected from the group consisting of a chemical, an enzyme and a physical treatment.
According to some embodiments of the invention, the enzyme comprises a plurality of enzymes.
According to some embodiments of the invention, the enzyme is provided at a sub-lethal concentration.
According to some embodiments of the invention, the enzyme is selected from the group consisting of pectinase, cutinase and a combination thereof.
According to some embodiments of the invention, in the step (a), the solid medium is devoid of the cell wall disrupting agent.
According to some embodiments of the invention, the emergence of leaves suitable for regeneration is manifested by rooting and acclimatization
According to an aspect of some embodiments of the present invention there is provided a regenerable cannabis explant obtainable according to the method as described herein.
According to an aspect of some embodiments of the present invention there is provided a method of cannabis regeneration in a tissue culture, the method comprising culturing regenerable cannabis explant in-vitro in a solid medium comprising at least one regeneration agent and a cell wall disrupting agent so as to regenerate cannabis.
According to an aspect of some embodiments of the present invention there is provided a method of in-vitro cannabis transformation, the method comprising, contacting a regenerable cannabis explants in-vitro with a polynucleotide encoding an expression product of interest and a cell wall disrupting agent.
According to some embodiments of the invention, the method further comprises wounding the leaves prior to contacting.
According to some embodiments of the invention, the transformation comprises a transient transformation.
According to some embodiments of the invention, the transformation comprises a stable transformation.
According to some embodiments of the invention, the contacting is effected by bombardment or Agrobacterium.
According to an aspect of some embodiments of the present invention there is provided a method of in planta cannabis regeneration, the method comprising:
(a) removing, exposing and/or wounding a meristem of a cannabis tissue so as to obtain a meristem-depleted cannabis tissue; and
(b) treating the meristem-depleted cannabis tissue with a composition comprising at least one plant hormone which allow for meristem regeneration;
According to an aspect of some embodiments of the present invention there is provided a method of in planta cannabis transformation, the method comprising:
(a) removing, exposing and/or wounding a meristem of a cannabis tissue so as to obtain a meristem-depleted cannabis tissue; and
(b) treating the meristem-depleted cannabis tissue with a composition comprising at least one plant hormone that allows plant regeneration and with a composition comprising a nucleic acid sequence encoding an expression product of interest.
According to some embodiments of the invention, the composition comprising the at least one plant hormone that allow plant regeneration and the composition comprising the nucleic acid sequence of interest are the same compositions.
According to some embodiments of the invention, the composition comprising at least one plant hormone that allow plant regeneration and the composition comprising the nucleic acid sequence of interest are different compositions.
According to some embodiments of the invention, treating with the composition comprising at least one plant hormone that allow plant regeneration and the composition comprising the nucleic acid sequence of interest is performed concomitantly.
According to some embodiments of the invention, treating with the composition comprising at least one plant hormone that allow plant regeneration and the composition comprising the nucleic acid sequence of interest is performed sequentially.
According to some embodiments of the invention, the sequentially is within an interval of 24-96 h.
According to some embodiments of the invention, the cannabis plant is a seedling.
According to some embodiments of the invention, the cannabis plant is a mature plant.
According to some embodiments of the invention, the mature plant comprises at least two nodes.
According to some embodiments of the invention, the exposing is effected while leaving a single leaf or cotyledon to allow photosynthesis.
According to some embodiments of the invention, the composition is formulated such that allows attachment of the composition to a surface of the meristem-depleted cannabis tissue.
According to some embodiments of the invention, at least one of the composition comprising at least one plant hormone and a composition comprising a nucleic acid sequence of interest comprises an emulsifier.
According to an aspect of some embodiments of the present invention there is provided a method of cannabis regeneration via somatic embryogenesis, the method comprising:
(a) culturing a callus or a regenerable cannabis explant in a liquid culture while shaking till appearance of globular structures;
(b) culturing the globular structures in a liquid culture while shaking till appearance of leaves.
According to some embodiments of the invention, step (a) is effected in the presence of CPPU; and wherein step (b) is effected in the presence of CPPU+TBD.
According to some embodiments of the invention, the step (a) is effected in the absence of TBD.
According to an aspect of some embodiments of the present invention there is provided a method of in-vitro cannabis transformation, the method comprising, contacting a leaf producible according to the method as described herein with a polynucleotide encoding an expression product of interest.
According to some embodiments of the invention, the polynucleotide is comprised in a formulation comprising Agrobacterium or PEG.
According to an aspect of some embodiments of the present invention there is provided a method of producing cannabis protoplasts, the method comprising, treating a cannabis tissue with macerozyme R-10 and mannitol, so as to obtain protoplasts.
According to some embodiments of the invention, the method further comprises treating with cellulose onzuka R-10 and/or hemicelluloses.
According to some embodiments of the invention, the macerozyme R-10 is provided at a concentration of 0.4-1.5%.
According to some embodiments of the invention, the hemicelluloses is provided at a concentration of 0.5-2%.
According to some embodiments of the invention, the onzuka R-10 provided at a concentration of 0.5-3%.
According to an aspect of some embodiments of the present invention there is provided protoplasts obtainable according to the method as described herein.
According to an aspect of some embodiments of the present invention there is provided a method of cannabis transformation, the method comprising contacting the protoplasts as described herein with a composition comprising a nucleic acid sequence encoding an expression product of interest.
According to an aspect of some embodiments of the present invention there is provided a method of cannabis transformation, the method comprising contacting pollen of a cannabis plant with particles comprising a nucleic acid sequence encoding an expression product of interest under a magnetic field that concentrates the particles and allows penetration of the nucleic acid sequence of interest into the pollen.
According to some embodiments of the invention, the pollen is used up to 12 hours post harvesting.
According to some embodiments of the invention, the cannabis is Cannabis sativa.
According to an aspect of some embodiments of the present invention there is provided a method of cannabis regeneration, the method comprising transforming an explants of the cannabis with a regenerating gene and allowing the tissue to regenerate.
According to some embodiments of the invention, the transforming is according to the method as described herein.
According to some embodiments of the invention, the regenerating gene comprises a nucleic acid sequence of CsBBM and CsSERK1 or a homolog of same.
According to an aspect of some embodiments of the present invention there is provided a transformed cannabis plant obtainable as described herein.
According to some embodiments of the invention, the nucleic acid sequence encoding an expression product of interest is selected from the group consisting of a genome editing agent, an RNA silencing agent, a regeneration agent, a gene conferring an agriculturally valuable agent and a modulator of cannabis metabolome.
According to an aspect of some embodiments of the present invention there is provided a method of breeding, the method comprising crossing the plant as described herein with another cannabis plant.
According to some embodiments of the invention, the method further comprises selecting for a phenotype of interest.
According to some embodiments of the invention, the phenotype comprises presence or absence of a transgene.
According to some embodiments of the invention, the phenotype of interest comprises an agriculturally valuable trait and/or a cannabis valuable trait.
Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.
Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.
In the drawings:
FIG. 1 shows the establishment of Cannabis tissue culture. Ten different cannabis cultivars seedlings and shoot cuttings were sterilized and grown on œ MS medium supplemented with 10 g/L sucrose, 5.5 g/L agar at a pH of 6.8 with different plant hormone combinations under light for 16 h per day. Most cultivars exhibited limited growth on solid media supplemented with different hormonal combinations.
FIG. 2 is a bar graph showing tissue culture response to various growth media. Growth rate was scored from 1 (growth arrest) to 5 (rapid growth).
FIGS. 3A-C are images showing Cannabis plant propagation in tissue culture using âliquid treatmentâ according to the embodiment described in the Examples section. FIG. 3Aâ28 days old tissue culture in solid medium presents low growth and development. FIG. 3Bâ49 days old which is 21 days in the âliquid treatmentâ according to the embodiment described in the Examples section. FIG. 3CâThe same plant after the âliquid treatmentâ (FIG. 3B), cultured in a solid medium;
FIG. 4 shows the results of a combined treatment with liquid media with sub-lethal doses of cuticle nicking enzymes and plant and surfactants;
FIGS. 5A-C show rooting and acclimatization of Cannabis plants generated according to FIG. 4. FIG. 5AâIn-vitro plant after solid-liquid-solid culturing with the nicking enzymes in liquid phase. FIG. 5BâPlants in rooting cylinders. FIG. 5CâPotted plants in the greenhouse one month after acclimatization (planting).
FIG. 6 is an image showing Cannabis regeneration from different plant tissues (leaves and calli from tissue culture, cotyledons from seeds).
FIG. 7 shows cannabis transformation of different plant tissues. Successful transformation of several cannabis cultivars using the uidA-intron and nptII genes. Efficient transient transformation of leaves, hypocotyls, callus and cotyledons of several Cannabis cultivars (upper panel). Positive PCR was shown in all tested clones (lower panel).
FIGS. 8A-F are images showing Cannabis seedlings in planta regeneration using the âregeneration pasteâ according to the embodiment described in the Examples section with appropriate plant hormone combinations. FIG. 8A. Seedling meristemâthe striped line indicates the cutting, wounding place. FIG. 8B. Peeling and exposing the tissue between the cotyledon and stem. Note that there is no meristem hidden. Cutting start is indicated by arrowheads, FIG. 8C. Scanning electron micrograph of the cut seedling, FIG. 8D. Stereoscope micrograph of the cut seedling, FIGS. 8E-F. Regenerating shoots, arrowhead indicates the remains of the removed stem.
FIG. 9 is an image showing in planta regeneration of cannabis cuttings, using the âregeneration pasteâ according to the embodiment described in the Examples section with appropriate plant hormone combinations. Plant regeneration was observed 14 days after application of the âregeneration pastâ.
FIGS. 10A-C show in planta transformation using the Agrobacterium strain EHA 105 harboring the binary vector pME504 that carries the genes for ÎČ-glucuronidase (GUS) and neomycin phosphotransferase (npt II). The proof of transformability in the TO generation was indicated by the GUS histochemical staining analysis of the seedlings and molecular characterization and GUS and nptII, using PCR.
FIGS. 11A-C show in planta transformation using the Agrobacterium strain EHA 105 harboring the binary vector pX11 that carries the genes for nptII and betalains. The proof of transformability in the T0 generation was indicated by betalains staining (FIGS. 11A-B) and PCR.
FIGS. 12A-B show a liquid culture (FIG. 12A) and globular stage embryos (FIG. 12B) that was initiated on B5 media, supplemented with 10 mg/l CPPU.
FIGS. 13A-B show plant regeneration on liquid media. Suspension culture with globular stage embryos (FIG. 13A) callus formation (FIG. 13B) and plant regeneration (FIG. 13C) was initiated on B5 media, supplemented with 10 mg/l CBD-CPPU.
FIG. 14 is a graph showing mesophyll protoplasts yield (Ă106) in three different cultivars of Cannabis sativa under a variety of enzymatic treatments.
FIGS. 15A-B show cannabis protoplasts isolated after enzymatic treatment (complex of enzymes C).
FIG. 16 shows protoplast transformation using the RFP gene.
FIGS. 17A-D are images of optical microscopy of Cannabis pollen. FIG. 17AâPollen grain stained with Safranine O. FIG. 17BâGermination of pollen grain after 18 h. (FIG. 17CâTransformed pollen grain expressing the exogenous reporter GUS gene. FIG. 17DâNo transformation staining control.
FIG. 18 shows the Sequences of the CsBBM and CsSERK1 genes (SEQ ID NOs: 2 and 1, respectively). Transcript sequences were obtained from the database available at www(dot)medicinalplantgenomics(dot)msu(dot)edu/index(dot)shtml. Start and stop codons are highlighted in yellow.
FIG. 19 is a map of the plasmid used to induce somatic embryogenesis and genome editing in Cannabis plants. The CAS9 is under the control of the CsUBIQUITIN10 promoter (SEQ ID NO: 11); the CsBBM, and CsSERK1 genes are under the same CsUBIQUITIN10 promoter (SEQ ID NO: 11).
The present invention, in some embodiments thereof, relates to methods of regenerating and transforming cannabis.
Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.
Cannabis is currently witnessing a revival because of its rich repertoire of phytochemicals, its fibers and its agricultural features, namely resistance to drought and pests, well-developed root system preventing soil erosion and lower water requirement with respect to other crops, e.g., cotton. Cannabis varieties producing oil, biomass and phytochemicals are currently cultivated. The availability of genome sequences greatly helps molecular studies on this important crop (van Bakel et al., 2011, The draft genome and transcriptome of Cannabis sativa. Genome Biol. 12:R-102. doi: 10.1186/gb-2011-12-10-R-102). In addition, the scientific community is very much interested in harnessing Cannabis pharmacological power.
However, to date, there are only a small number of reports concerning tissue culture of Cannabis. Most of these studies were aimed at developing a cell culture system to obtain secondary metabolites, particularly the class of cannabinoids that are distinctive to the genus Cannabis (Turner et al., 1980). Callus cultures (Hemphill et al., 1978; Heitrich and Binder, 1982) and suspension cultures (Veliky and Genest, 1972; Itokawa et al., 1977; Hartsel et al., 1983; Loh et al., 1983; Braemer and Paris, 1987) have been established for extraction of secondary metabolites and biotransformation studies. However transgenic cultivars of Cannabis plants have not yet been released and research has not demonstrated that this technology can be applied.
Whilst reducing embodiments of the invention to practice, the present inventors were able to regenerate cannabis in culture and to develop protocols for plant transformation either on tissue explants, pollen or even in planta.
These protocols can be exploited towards genetic manipulation of this crop plant by way of over-expression, genome editing or silencing which can benefit the entire cannabis industry.
The term âplantâ as used herein encompasses whole plants, a grafted plant, ancestors and progeny of the plants and plant parts, including seeds, shoots, stems, roots (including tubers), rootstock, scion, and plant cells, tissues and organs. The plant may be in any form including suspension cultures, embryos, meristematic regions, callus tissue, leaves, gametophytes, sporophytes, pollen, and microspores.
The terms âcannabisâ refers to the genus which includes all different species including Cannabis sativa, Cannabis indica and Cannabis ruderalis as well as wild Cannabis.
Cannabis is diploid, having a chromosome complement of 2n=20, although polyploid individuals have been artificially produced and are also contemplated herein. The first genome sequence of Cannabis, which is estimated to be 820 Mb in size, was published in 2011 by a team of Canadian scientists (van Bakel et al, supra).
All known strains of Cannabis are wind-pollinated and the fruit is an achene. Most strains of Cannabis are short day plants, with the possible exception of C. sativa subsp. sativa var. spontanea (=C. ruderalis), which is commonly described as âauto-floweringâ and may be day-neutral.
According to a specific embodiment, the plant is of C. sativa.
Cannabis has long been used for drug and industrial purposes: fiber (hemp), for seed and seed oils, extracts for medicinal purposes, and as a recreational drug. The selected genetic background (e.g., cultivar) depends on the future use. Industrial hemp products are made from Cannabis plants selected to produce an abundance of fiber. Some Cannabis strains have been bred to produce minimal levels of THC, the principal psychoactive constituent responsible for the psychoactivity associated with marijuana. Marijuana has historically consisted of the dried flowers of Cannabis plants selectively bred to produce high levels of THC and other psychoactive cannabinoids. Various extracts including hashish and hash oil are also produced from the plant.
Thus, for example, a CBD rich strain can be selected from a group consisting of Golan, Avidekel, Fedora 17, ACDC, and any combination thereof; or wherein said cannabis plant is a THC rich strain; said THC rich strain is selected from a group consisting of Everest, Black Destroyer, Critical Neville Haze, Mataro Blue, LSD OG Kush, Pineapple Chunk, Blue Monster Holk, Y Griega, Satori, Tutankhamon, and any combination thereof.
Some additional varieties are provided infra in Example 1 of the Examples section which follows (e.g., WON21, Pinola, Goodrich, Glory, Lemon Haze, Jack herer, Lemon Haze Bnn., Cheese and SLH.).
The term âvarietyâ as used herein has identical meaning to the corresponding definition in the International Convention for the Protection of New Varieties of Plants (UPOV treaty), of Dec. 2, 1961, as Revised at Geneva on Nov. 10, 1972, on Oct. 23, 1978, and on Mar. 19, 1991. Thus, âvarietyâ means a plant grouping within a single botanical taxon of the lowest known rank, which grouping, irrespective of whether the conditions for the grant of a breeder's right are fully met, can be i) defined by the expression of the characteristics resulting from a given genotype or combination of genotypes, ii) distinguished from any other plant grouping by the expression of at least one of the said characteristics and iii) considered as a unit with regard to its suitability for being propagated unchanged.
The term âvarietyâ is interchangeable with âcultivarâ.
As mentioned, embodiments of the invention relate to cannabis transformation and plant regeneration. It will be appreciated that the process of tissue transformation is dependent on the ability of the plant to regenerate. The protocol of regeneration can be selected from in-vitro regeneration and in planta regeneration.
As used herein âregenerationâ or âregeneratingâ refers to the development of a whole plant from somatic cells e.g., in tissue culture (in-vitro) or in planta.
As used herein âregenerableâ refers to the ability to develop into a whole plant in-vitro.
According to a specific embodiment, the regeneration efficiency using embodiments of the invention is at least 50% (regenerants from the source tissue or organ).
According to a specific embodiment, the regeneration efficiency using embodiments of the invention is at least 60%.
According to a specific embodiment, the regeneration efficiency using embodiments of the invention is at least 70%.
According to a specific embodiment, the regeneration efficiency using embodiments of the invention is at least 80%.
According to a specific embodiment, the regeneration efficiency using embodiments of the invention is at least 90%.
According to a specific embodiment, the transformation efficiency using embodiments of the invention is at least 60% (e.g., in transient transformation).
According to a specific embodiment, the transformation efficiency using embodiments of the invention is at least 70% (e.g., in transient transformation).
According to a specific embodiment, the transformation efficiency using embodiments of the invention is at least 80% (e.g., in transient transformation).
According to a specific embodiment, the transformation efficiency using embodiments of the invention is at least 90% (e.g., in transient transformation).
According to a specific embodiment, the transformation efficiency using embodiments of the invention is at least 1% (e.g., in stable transformation).
According to a specific embodiment, the transformation efficiency using embodiments of the invention is at least 2% (e.g., in stable transformation).
According to a specific embodiment, the transformation efficiency using embodiments of the invention is at least 3% (e.g., in stable transformation).
According to a specific embodiment, the transformation efficiency using embodiments of the invention is at least 5% (e.g., in stable transformation).
A common mode of plant regeneration both in planta and in-vitro is de novo organogenesis, in which plant cuttings or explants first form ectopic apical meristems and subsequently develop shoots and roots. Meristems are specialized plant tissues where new cells, tissues and organs are generated through cell division and differentiation. Plants can also regenerate through somatic embryogenesis in-vitro, whereby isolated protoplasts or cells first develop cellular structures similar to zygotic embryos and subsequently generate whole plant bodies, as contemplated herein and further described hereinbelow. Both of these regeneration processes occur either directly from parental tissues (e.g., leaves, stems, roots) or indirectly via the formation of a callus.
An in-vitro regeneration protocol may first be preceded by a step of clonal propagation for large scale, reproducible, uniform (±10%) production of plant material/explant.
As used herein a âregenerable explantâ refers to regenerable cells (cannabis cells) for use in tissue culture for transforming and regenerating Cannabis. A tissue culture which includes regenerable cells is capable of regenerating plants having the physiological and morphological characteristics of Cannabis (transformed or no-transformed).
According to a specific embodiment âtransformedâ refers to transgenic.
According to another embodiment, âtransformedâ refers to non-transgenic, such as by means of genome-editing.
The regenerable cells in such tissue cultures can be from embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, pistils, roots, root tips, flowers, seeds, pods, bolls, buds, stems, or the like.
According to a specific embodiment, the regenerable cells are suitable for applying a regeneration protocol.
The present inventors have realized through a series of laborious experiments, that the key factor for successful in-vitro propagation (as determined by time dependent biomass accumulation) is an initial growth on a solid medium, transfer to a liquid medium and transfer back to a solid medium, so as to allow the explants to exploit the substances in the media. This, combined with a treatment with a cell wall disrupting agent is pertinent to the success of clonal propagation.
Thus, according to an aspect of the invention there is provided a method of in-vitro propagating cannabis, the method comprising:
(a) culturing a cannabis plant part comprising a meristem on a solid culture medium so as to obtain an explant; and subsequently
(b) subjecting the explant to a cell wall disrupting agent;
(c) culturing the explant in a liquid medium; and optionally
wherein steps (a)-(c) are effected for 1 to n times until emergence of leaves suitable for regeneration.
As used herein âin-vitro propagationâ or âplant micropropagationâ refers to an integrated process in which cells, tissues or organs of a selected plant are isolated, surface sterilized, and incubated in a growth-promoting aseptic environment to produce many clone plantlets (Altman, 2000, Spier, R. E. Encyclopedia of Cell Technology. New York: John Wiley &. Sons, 916-929).
Thus, somatic cells, under appropriate conditions, can differentiate to a whole plant.
According to a specific embodiment, the process of clonal propagation is done under aseptic conditions.
According to a specific embodiment, the plant part taken to the tissue culture is sterilized prior to initiation of culturing.
For instance, the plant part is washed under abundant water flow (e.g., for 2 hours) followed by alcohol treatment (e.g., 70% ethanol) and optionally NaClO (e.g., 1.5%) that may be repeated as needed.
Thus, a cannabis plant part comprising a meristem is cultured on a solid culture medium so as to obtain an explant.
As used herein âmeristemâ refers to a plant tissue containing undifferentiated cells (meristematic cells), found in zones of the plant where growth can take place. Meristematic cells give rise to various organs of the plant and keep the plant growing. There are three types of meristematic tissues: apical (at the tips), intercalary (in the middle) and lateral (axial, at the sides).
According to a specific embodiment, the meristem is an apical or an axillary meristem.
According to a specific embodiment, the plant part is of a stem, e.g., shoot tips or axillary buds.
According to a specific embodiment, the plant part comprises both apical and axillary meristems.
According to a specific embodiment, the plant part comprises a root meristem.
According to a specific embodiment, the plant part comprises a root tip.
A plant part and a tissue may be interchangeable herein.
Such a tissue can be taken from a mature plant or a seedling e.g., having two true leaves that are then cut from the roots (a seedling may be more responsive than a mature plant) due to different levels of plant hormones present in the plants. The present inventors were able to show clonal propagation for both options (see Example 1).
According to a specific embodiment, the plant part comprises a nodal segment.
Typically, the medium used for clonal propagation (or regeneration or transformation) is a basal medium like white medium, Nitsch and Nitsch medium, B5 medium and Gamborf medium.
According to a specific embodiment, the medium is Murashige and Skoog (1962) (MS medium).
The strength of the medium or combination of media can be optimized for the protocol (e.g., propagation, regeneration or transformation).
According to a specific embodiment, the medium is œ MS medium supplemented with sucrose at a pH of 6.8.
According to a specific embodiment, the carbon source is at a concentration of 1-4%.
According to a specific embodiment, the pH is 5.4-7.2.
Measures should be taken to supplement the medium with an appropriate mineral nutrition and carbon source (e.g., sucrose, glucose, maltose and galactose as well as the sugar-alcohols glycerol and sorbitol). The carbohydrates added to the culture medium supply energy for the metabolism. The addition of a carbon source in any nutrition medium is essential for in-vitro growth and development because photosynthesis in culture is typically insufficient.
Culture media can be classified as liquid or solid. The liquid media have the advantage of faster and cheaper propagation than the solid ones. However, a serious disadvantage of using liquid in for clonal propagation is that shoot (stems), which are perpetually submerged in liquid cultures may become hyperhydric and hence cannot undergo clonal propagation.
According to a specific embodiment, the medium is œ MS medium supplemented with sucrose and hormone combinations.
The present inventors have found that for successful clonal propagation the explants require a first culturing period on a solid phase followed by liquid culturing and return to the solid phase.
Thus, a first stage of solid medium culturing is effected for 7-30 days (e.g., 21 days) or as long as the explant benefits from the solid culture and can absorb the nutrients/carbon source from the medium. The gelling agent that may be used to solidify the culture may change. Typically used are Agar and Gelrite. As the concentration of the gelling agent e.g., Agar may affect the development (e.g., root) the concentration is up to 1% e.g., Agar is 0.7%-1.0% w/w (e.g., 0.8%).
In order to improve the absorption of carbon source, minerals or other factors (e.g., regeneration agents, transformation agents etc. as further described hereinbelow), the explants may be treated with a cell wall disrupting agent. This can be performed at any step of the culturing e.g., during culturing on the solid phase and/or at the liquid phase.
According to a specific embodiment, the cell wall disrupting agent is present only at the liquid culture phase (i.e., absent from the solid medium).
As used herein âa cell wall disrupting agentâ refers to a chemical, biological or physical treatment of the explant that results in damage to the cell wall but not affecting cell viability either due to degradation, hydrolysis of the polymers e.g., polyesters of the cuticle and/or suberin layers or mechanical breakdown of the cell wall.
Examples of such enzymes can be found in The Journal of Experimental Botany, Vol. 64, No. 12, pp. 3519-3550, 2013 doi:10.1093/jxb/ert201; Darwin Review Biochemistry and physiological roles of enzymes that âcut and pasteâ plant cell-wall polysaccharides; and Catalysts of plant cell wall loosening, [Daniel J. Cosgrove 2016, which describe enzymes and other proteins e.g., expansions, that can be used in cell wall disruption.
These include, but are not limited expansions, endoglucanases, endotransglucosylases as well as, cutinase, pectin methyesterases and pectin modifying enzymes. From the whole range of CAZy groups, approximately 22 families are associated with enzymes that postsynthetically modify the plant cell wall. Plant glycosidases are mostly grouped in GH families 1, 2, 3, 27, 29, 31, 35, 36, 38, 51, and 95, while plant glycanases fall into GH families 2, 5, 9, 10, 16, 17, 28, and 81.
The cell wall disrupting agent may therefore be present in the liquid culture medium, the solid culture medium [towards the end of culturing on a solid medium i.e., not from the initiation of step (a)] or the explants may be taken out of the culture and treated with the cell wall disrupting agent before transfer to the liquid medium.
According to a specific embodiment, the treatment with the cell wall disrupting agent is (e.g., only) at the liquid phase.
According to a specific embodiment, the biological treatment comprises enzymes (e.g., âcuticle nicking enzymesâ).
Measures are taken to use the cell wall disrupting agent at sub-lethal dose/concentration i.e., less than lethal, but sufficiently high to disrupt the cell wall. Damage to the cell wall can be determined using various means including visual detection using a light microscope. Cell viability should be determined as well (e.g., staining, FACS etc.).
According to a specific embodiment, the enzymes are a fungal mix of pectin and cutinase enzymes.
As used herein, a cutinase (EC 3.1.1.74) is an enzyme that catalyzes the chemical reaction cutin+H2O cutin monomers.
According to a specific embodiment, the enzyme is a pectic enzyme e.g., pectin lyase (EC 4.2.2.10) which catalyzes the eliminative cleavage of (1â4)-α-D-galacturonan methyl ester to give oligosaccharides with 4-deoxy-6-O-methyl-α-D-galact-4-enuronosyl groups at their non-reducing ends.
Enzymes are available from commercial vendors e.g., BSG HandCraft Liquid Pectic Enzyme; Cutinase (Sigma, Ferdinand Maria Quincy). It will be appreciated that a single cell wall disrupting agent can be used, however combinations of 2, 3, 4, or more agents can be used (of the same or different types i.e., biological, chemical and physical).
According to a specific embodiment, the enzymes used include a pectic enzyme and a cutinase. As shown in Examples 2, the combination of the two enzymes increases explants growth rate in culture.
Accordingly, cutinase is available as a fungal mix of pectin and cutinase enzymes that is commercially available such as from BSG HandCraft Liquid Pectic Enzyme; CutinaseâSigma, Ferdinand Maria Quincy.
At the liquid stage (which is a discrete stage from the solid medium culturing stage) the same base medium, carbohydrates and/or minerals can be used except that the polymerizing agent (e.g., agar) is absent. However, different media and/or supplements can be used as well.
Culturing in the liquid medium may be effected for Îș-30 days (e.g., 21 days).
According to a specific embodiment, culturing is effected while shaking the container in which the explant is placed (in the liquid medium). There are numerous agitation methods including orbital, horizontal orbital shaking with limited amount of liquid.
Shaking prevents covering the whole explant with the medium during culturing at the liquid phase.
At any stage from the initiation of culturing (a-c), leaves (i.e., differentiated structures) and necrotic regions that can't regenerate are removed.
Additional agents that can be included in the culture (be it the solid phase, liquid phase, or all phases) include, but are not limited to, plant hormones, enzymes, vitamins, carbohydrates and minerals.
As mentioned, optionally, after culturing in the liquid medium the explant is transferred to culturing under solid conditions, for 20-45 days, and the whole process i.e., liquid, solid may be repeated for n number of times (e.g., 2, 3, 4, 5 or more times).
According to a specific embodiment, transfer from a solid to a liquid medium is taking place every 3-4 weeks, which significantly improves the growth and development.
Different strains may require different time periods for the propagation, generally requiring between 50 to 100 days. Culturing may be terminated once leaves suitable for regeneration emerge. According to a specific embodiment, such leaves are up to 48 days old (e.g., 21-48 days counting from transfer of the culture from liquid to solid), having up to about 0.5 cm width of surface area and optionally can be easily wounded such as with a scalpel or as further described hereinbelow.
The ability to regenerate can be determined using methods which are well known in the art e.g., rooting and acclimatization.
Elongation and root induction or development (rooting phase): This phase is designed to induce the establishment of fully developed plantlets. It is the last period in-vitro before transferring the plantlets to ex vitro conditions. Root induction is typically effected on a root induction solid medium in the presence of IBA and optionally other ingredients such as thiamine and possibly myo-inositol and/or charcoal. Rooting is much affected by the salt concentration in the medium. Also, the presence of auxins (e.g., IBA, IAA, NAA) at this stage is important as opposed to cytokinins. At rooting, it is important to balance the humidity required for rooting and the plant sensitivity to humidity. Under such considerations it is possible to lower the amount of the gelling agent (e.g., agar), add desiccating agents (e.g., silicone balls) and aerating the culture dishes. The use of gibberellins in the rooting medium may reduce or prevent the formation of adventitious roots and shoots, although it can stimulate root formation when present in low concentrations.
Transfer to ex vitro condition is also termed as âacclimatizationâ. Acclimatization is defined as the climatic or environmental adaptation of an organism, especially a plant that has been moved to a new environment (Kozai and Zobayed, 2003 www(dot)doi(dot)org/10(dot)1002/0471250570(dot)spi001). Measures are taken to protect the regenerated explants from dehydration, which is typically done by graded lowering of the humidity by stepwise transferring from a greenhouse or tunnel (e.g., covered with a polyethylene sheet) to partial covering to no covering at all.
An example of a rooting and acclimatization protocol is provided in Example 1 which follows.
The results may be evaluated several weeks after assay initiation (e.g., 3-5 weeks).
The skilled artisan would take into consideration other parameters during culturing. These include, but are not limited to, gas exchange and relative air humidity inside the culture vessel.
The culture vessel is typically a closed system but some gas exchange may occur dependent on the vessel. The use of closures with filters or vented vessels which allow gas exchange may increase the photosynthetic capacity, the multiplication rate and the survival of plants at the acclimatization stage.
According to a specific embodiment, the relative humidity in the culture (i.e., culture vessel) is 90%. The temperature and light regimen employed for regeneration are known to the skilled artisan and typically including long day (e.g., 16 h) at 24° C.
Also contemplated herein is a regenerable cannabis explant obtainable according to the method described herein. It will be appreciated that the process of clonal propagation does not form a callus.
Once any regenerable cannabis explant is available (e.g., such as by the clonal propagation method described herein), it can be subjected to regeneration.
Thus, according to an aspect of the invention there is provided a method of cannabis regeneration in a tissue culture, the method comprising culturing a regenerable cannabis explant in a solid medium comprising at least one regeneration agent and a cell wall disrupting agent so as to regenerate cannabis.
The regenerable cannabis explants can be a product of the clonal propagation as described above. Also contemplated are germinated seeds, including cotyledons, leaves hypocotyls; alternatively, calli.
Regeneration protocols are known in the art.
Basically, in addition to a basal salt mixture the medium comprises at least one auxin, at least one cytokinin and optionally at least one gibberellin. Typically, the basal salt mixture used is half strength MS (Murashige and Skoog) medium, the auxin is indol-3-butyric acid (IBA), the cytokinin is 6-benzylaminopurine (BA) the gibberellic acid is GA3. The medium typically further comprises as a carbon source. The medium further comprises, vitamins, myoinositol and thiamine-HCl and the pH of the medium is kept in the range of from about 4.5 to about 6.5 (e.g., 5.5-5.9).
The cultures are exposed to a cool fluorescent light in a photoperiod of 16 h of light and 8 h dark, at 25° C. Typically, the light intensity is in the range of between 40-70 Όmol/m2s. Under these conditions (the propagation medium and the light regime) elongation of the micropropagating shoots and the formation of leaves from the shoot buds occur within about 2-4 weeks.
The medium for each strain can be further adjusted according to the strain's needs such as with cytokinins (e.g., TDZ, ZEATIN, NAA), activated charcoal, phloroglucinol, concentrations of GA/auxion cytokinin etc.
According to a specific embodiment, the regeneration is effected in line with the protocols listed in Example 2 of the Examples section which follows.
Regeneration from leaves can be done from 3 to 4 weeks old plants by placing the leaves on regeneration medium with the cell wall disrupting agent, as described. The cultures are kept for a number of days (e.g., 7 days) in low light intensity (e.g., 2.5 mmol/m2 s) followed by exposure to high light intensity (e.g., 40 mmol/m2 s) at room temperature (e.g., 25° C.), in a 16/8 h photoperiod. Leaf explants can be examined after 14 and 21 days and the percentage of explant producing shoots is determined.
Regeneration from cotyledon can be done as follows: Seeds are disinfected and put in a culture medium. Seeds are germinated (e.g., in the dark for 2 d and thereafter transferred to light). Cotyledons from large seedlings that contain two true leaves are cut and placed on a regeneration medium with the cell wall disrupting agent. The cultures are kept in high light intensity (e.g., 40 mmol/m2 s) at room temperature (e.g., 25° C.), in a 16/8 h photoperiod.
Callus is induced such as by the following protocol. 21 days old tissue culture is placed on a PR12 solid medium (MS, 2% sucrose, 2 mg/l BA, 1 mg/l GA3, 0.8 sigma agar, pH 5.8) to encourage the creation of callus. Two weeks later, calli are placed on a regeneration medium with the cell wall disrupting agent [e.g., Murashige and Skoog (MS) medium salt mixture, containing 0.05-5.0 ÎŒM thidiazuron, supplemented with 100 mg/l myo-inositol, 1 mg/l thiamine-HCl, 2% sucrose (w/v) at pH 5.7, with 5 ml pectic enzymes reaction mixture (0.25 ml 10% enzyme, 0.25 ml 200 mM Tris-HCl)]. The cultures are kept in high light intensity (40 mmol/m2 s) at 25 8 C, in a 16/8 h photoperiod.
The regeneration can be prior to, concomitantly with, or following DNA transformation.
Thus, according to an aspect there is provided a method of in-vitro cannabis transformation, the method comprising, contacting a regenerable cannabis explant with a polynucleotide encoding an expression product of interest and a cell wall disrupting agent.
Thus, for regeneration and transformation the use of a cell wall disrupting agent as described above is contemplated.
It will be appreciated that additional wounding the explant (e.g., leaves) may improve the efficiency when done prior to the contacting with the polynucleotide.
Wounding induces numerous cellular responses including the production of plant hormones, loss of cell to cell communication and disruption of long distance signaling. It is suggested that the AP2/ERF-type transcriptional regulator WIND1 and its homolog WIND2, WIND3 or AIND4 are induced upon wounding and promote callus formation at cut sites.
Wounding can be effected physically e.g., by the use of a scalpel or a sandpaper, which scratches the plant surface.
As mentioned, the transformation introduces a polynucleotide encoding an expression product of interest.
As used herein âexpression productâ refers to an RNA or protein (also referred to herein as âpolypeptideâ).
According to a specific embodiment, the expression product is a protein.
According to a specific embodiment, the expression product brings about overexpression of an endogenous gene or homolog thereof or of a foreign gene expression product altogether. In embodiments of such cases, the expression product is heterologous to the plant/tissue being transformed.
It will be appreciated that the heterologous expression product can bring about down regulation of an endogenous gene such as by way of genome editing or RNA silencing.
The term âheterologousâ as used herein refers to exogenous, not-naturally occurring within a native cell of a cannabis plant of a specific developmental stage, or not expressed in a plant, not expressed in a particular plant species, or is expressed at a different expression level or localization in the plant, than the native protein.
However, using genome editing for instance can also effect overexpression of an endogenous gene (e.g., by way of a âgain of functionâ).
Genome editing as contemplates herein also mediates loss of function.
As used herein, the term âpolypeptideâ is used interchangeably with the terms âpeptidesâ, âoligopeptidesâ and âproteinsâ and refers to a biomolecule composed of amino acids of any length, linked together by peptide bonds.
The polypeptide of interest can be, for example, a plant polypeptide, a bacterial polypeptide, a viral polypeptide a mammalian polypeptide or a synthetic polypeptide (e.g., chimeric nuclease, nuclease e.g. cas9). Thus, the heterologous polypeptide of interest may be a plant polypeptide or protein that is a variant or mutated form of a plant polypeptide or protein or a polypeptide or protein not naturally found in the plant species, line or variety.
As used herein the term âpolynucleotideâ refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and/or a composite polynucleotide sequences (e.g., a combination of the above).
The term âisolatedâ refers to at least partially separated from the natural environment.
According to one embodiment, the heterologous polypeptide of interest may include, but is not limited to, a reporter polypeptide, an antiviral polypeptide, a viral moiety, an antiviral polypeptide, an antifungal polypeptide, an antibacterial polypeptide, an insect resistance polypeptide, a herbicide resistance polypeptide, a biotic or abiotic stress tolerance polypeptide, a pharmaceutical polypeptide, a growth inducing polypeptide, a growth inhibiting polypeptide, an enzyme, a transcription factor and a transposase.
Exemplary proteins which may be produced, include, but are not limited to: nucleases, kinases, proteases, enzymes, hormones, proteins that provide resistance to diseases, antimicrobial proteins, antiviral proteins, and proteinaceous DNA editing agents.
According to one embodiment, the heterologous polypeptide of interest comprises two or more (e.g., 2, 3, 4) heterologous polypeptides.
According to one embodiment, the heterologous polypeptide of interest enables modifying the plant genome, e.g., nuclease.
As used herein the term ânucleaseâ refers to any polypeptide, or complex comprising a polypeptide, that can generate a strand break in the genome, e.g. in genomic DNA. According to an embodiment, the cleavage is site specific usually conferred by an auxiliary subunit, alternatively the nuclease is inherently specific to a target sequence of interest.
As used herein, the term âcleavageâ or âDNA cleavageâ refers to the breakage of the covalent backbone of a DNA molecule. Both single-stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events. DNA cleavage can result in the production of either blunt ends or staggered ends.
Exemplary nucleases which may be used in accordance with the present teachings include restriction enzymes (e.g. type II restriction endonuclease), topoisomerases [e.g. DNA gyrase, eukaryotic topoisomerase II (topo II), and bacterial topoisomerase IV (topo IV)], recombinases (e.g. Cre recombinase, Hin recombinase), integrases, DNAses, endo-exonucleases (e.g. micrococcal nuclease) and homing endonucleases.
According to one embodiment, the nuclease utilized may comprise a non-specific DNA cleavage domain, for example, a type II restriction endonuclease such as the cleavage domain of the FokI restriction enzyme (GenBank accession number J04623).
According to one embodiment, the nuclease is a meganuclease.
As used herein, the term âmeganucleaseâ refers to a double-stranded endonuclease having a large polynucleotide recognition site, e.g. DNA sequences of at least 12 base pairs (bp) or from 12 bp to 40 bp. The meganuclease may also be referred to as rare-cutting or very rare-cutting endonuclease. The meganuclease of the invention may be monomeric or dimeric. The meganuclease may include any natural meganuclease such as a homing endonuclease, but may also include any artificial or man-made meganuclease endowed with high specificity, either derived from homing endonucleases of group I introns and inteins, or other proteins such as zinc finger proteins or group II intron proteins, or compounds such as nucleic acid fused with chemical compounds.
Artificial meganucleases of the invention include, but are not limited to, custom-made meganucleases which are meganucleases derived from any initial meganuclease, either natural or not, presenting a recognition and cleavage site different from the site of the initial meganuclease, i.e. the custom-made meganuclease cleaves a novel site with an efficacy at least 10 fold, at least 50 fold or at least 100 fold more than the natural meganuclease.
Custom-made meganucleases may be produced by any method known in the art, for example, by preparing a library of meganuclease variants and isolating, by selection and/or screening, the variants able to cleave the targeted DNA sequence. The diversity could be introduced in the meganuclease by any method known to one skilled in the art, for example, the diversity may be introduced by targeted mutagenesis (i.e. cassette mutagenesis, oligonucleotide directed codon mutagenesis, targeted random mutagenesis), by random mutagenesis (i.e. mutator strains, Neurospora crassa system (U.S. Pat. No. 6,232,112; WO 01/70946, error-prone PCR), by DNA shuffling, by directed mutation or a combination of these technologies (See Current Protocols in Molecular Biology, Chapter 8 âMutagenesis in cloned DNAâ, Eds Ausubel et al., John Wiley and Sons). The diversity may be introduced at positions of the residues contacting the DNA target or interacting (directly or indirectly) with the DNA target, or may be introduced specifically at the positions of the interacting amino acids. In libraries generated by targeted mutagenesis, the 20 amino acids can be introduced at the chosen variable positions. According to an embodiment, the amino acids present at the variable positions are the amino acids well-known to be generally involved in protein-DNA interaction. More particularly, these amino acids are generally the hydrophilic amino acids, e.g. comprise D, E, H, K, N, Q, R, S, T, Y. Synthetic or modified amino acids may also be used.
The custom-made meganuclease may be derived from any initial meganuclease.
According to one embodiment, the initial meganuclease is selected so as its natural recognition and cleavage site is the closest to the targeted DNA site. According to an embodiment, the initial meganuclease is a homing endonuclease. Homing endonucleases fall into 4 separated families on the basis of well conserved amino acids motifs, namely the LAGLIDADG family, the GIY-YIG family, the His-Cys box family, and the HNH family (Chevalier et al., 2001, N.A.R, 29, 3757-3774). According to one embodiment, the homing endonuclease is a I-Dmo I, PI-Sce I, I-SceI, PI-Pfu I, I-Cre I, I-Ppo I, or a hybrid homing endonuclease I-Dmo I/I-Cre I called E-Dre I (as taught in Chevalier et al., 2001, Nat Struct Biol, 8, 312-316).
Further details relating to meganucleases are found in U.S. Pat. No. 8,697,395 which is incorporated herein by reference.
According to another embodiment, of the present invention, the nuclease comprises an oligonucleotide-dependent nuclease such as Cas or a RISC.
RISC enzymes are taught in Martinez J, Tuschl T. RISC is a 5âČ phosphomonoester-producing RNA endonuclease. Genes Dev. 2004; 18:975-980. Also contemplated are sequence modifications to improve plant expression i.e., homologs that are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%. Homology and identity are also contemplated herein (e.g., using Blast(N)/(P) with default parameters).
According to one embodiment, the Cas9 or RISC is attached to a single guide RNA (sgRNA) to cleave genomic DNA in a sequence specific manner, hence the polynucleotide may encode the RNA targeting moiety such as a gRNA.
As used herein âa single guide RNAâ or âsgRNAâ refers to a chimeric RNA molecule which is composed of a clustered regularly interspersed short palindromic repeats (CRISPR) RNA (crRNA) and trans-encoded CRISPR RNA (tracrRNA). The crRNA defines a site-specific targeting of the Cas9 protein. The sequence is 19-22 nucleotides long e.g., 20 consecutive nucleotides complementary to the target and is typically located at the 5âČ end of the sgRNA molecule. The crRNA may have 100% complementation with the target sequence although at least 80%, 85%, 90%, and 95% global homology to the target sequence are also contemplated according to the present teachings.
The tracrRNA is 100-300 nucleotides long and provides a binding site for the nuclease e.g., Cas9 protein forming the CRISPR/Cas9 complex.
According to a specific embodiment a plurality of sgRNAs are provided to the plant cell that are complementary to different target nucleic acid sequences and the nuclease e.g., Cas9 enzyme cleaves the different target nucleic acid sequences in a site specific manner.
It will be appreciated that the sgRNA may be encoded from the same expression vector as the nuclease, e.g. Cas9. Additionally or alternatively, the sgRNA may be encoded from another nucleic acid construct and thus the CRISPR-Cas9 complex is encoded from a nucleic acid construct system.
According to another embodiment, sgRNA is encoded from the plant expression vector of the invention. In such a case the nuclease, e.g. Cas9, may be encoded from another nucleic acid construct and thus the CRISPR-Cas9 complex is encoded from a nucleic acid construct system.
Likewise, the plurality of sgRNAs may be encoded from a single vector or from a plurality of vectors as described herein. The use of a plurality of sgRNAs allows multiplexing.
Thus, the RNA-guided endonuclease of the invention comprises at least one nuclease (e.g. Cas9 or RISC) and at least one RNA binding domain (e.g. CRISPR). CRISPR/Cas proteins of the invention may comprise a nuclease domain, DNA binding domain, helicase domain, RNAse domain, protein-protein interaction domain and/or a dimerization domain.
According to one embodiment, the CRISPR/Cas protein can be a wild type CRISPR/Cas protein, a modified CRISPR/Cas protein, or a fragment of a wild type or modified CRISPR/Cas protein. Furthermore, the CRISPR/Cas protein can be modified to increase nucleic acid binding affinity and/or specificity, or to alter an enzymatic activity of the protein. For example, nuclease (i.e., Cas9) domains of the CRISPR/Cas protein can be modified.
Non-limiting examples of suitable Cas proteins which may be used in accordance with the present teachings include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9, Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Cszl, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966.
According to a specific embodiment, the cas nuclease is Cas9. Cas9 is a monomeric DNA nuclease guided to a DNA target sequence adjacent to the protospacer adjacent motif (PAM). The Cas9 protein comprises two nuclease domains homologous to RuvC and HNH nucleases. The HNH nuclease domain cleaves the complementary DNA strand whereas the RuvC-like domain cleaves the non-complementary strand and, as a result, a blunt cut is introduced in the target DNA.
In some embodiments, the CRISPR/Cas system comprises a wild type Cas9 protein or fragment thereof.
In other embodiments, the CRISPR/Cas system comprises a modified Cas9 protein. For example, the amino acid sequence of the Cas9 protein may be modified to alter one or more properties (e.g., nuclease activity, affinity, stability, etc.) of the protein. Alternatively, domains of the Cas9 protein not involved in RNA-guided cleavage can be eliminated from the protein such that the modified Cas9 protein is smaller than the wild type Cas9 protein.
According to one embodiment, the Cas9 protein can be modified to lack at least one functional nuclease domain. According to one embodiment, the Cas9 protein can be modified to lack all nuclease activity. According to another embodiment, the CRISPR/Cas system is fused with various effector domains, such as DNA cleavage domains. The DNA cleavage domain can be obtained from any endonuclease or exonuclease. Non-limiting examples of endonucleases from which a DNA cleavage domain can be derived include, but are not limited to, restriction endonucleases and homing endonucleases (see, for example, New England Biolabs Catalog or Belfort et al. (1997) Nucleic Acids Res.). In exemplary embodiments, the cleavage domain of the CRISPR/Cas system is a FokI endonuclease domain or a modified FokI endonuclease domain.
Various methods for designing CRISPR/Cas are known in the art and may be implemented in accordance with the present teachings. Further details relating to CRISPR/Cas can be found in PCT publication no. WO 2014089290 which is incorporated herein by reference in its entirety. According to another embodiment of the present invention, the nuclease comprises a chimeric nuclease.
As used herein the phrase âchimeric nucleaseâ refers to a synthetic chimeric polypeptide which forms a single open reading frame (ORF) and mediates DNA cleavage in a sequence specific manner.
According to a specific embodiment, the chimeric nucleases of this aspect of the present invention comprise separate domains for nucleic acid binding (e.g. DNA binding) and for nucleic acid cleavage (e.g. DNA cleavage), such that cleavage is sequence specific.
As used herein the phrase âsequence specificâ refers to a distinct chromosomal location at which nucleic acid cleavage (e.g. DNA cleavage) is introduced.
As used herein the phrase ânucleic acid binding domainâ refers to a native or synthetic amino acid sequence such as of a protein motif that binds to double- or single-stranded DNA or RNA in a sequence-specific manner (i.e. target site).
In order to induce efficient gene targeting, the nucleic acid (e.g. DNA) binding domain of the present invention needs to be coupled to a DNA cleavage domain (e.g. nuclease) as to permit DNA cleavage within a workable proximity of the target sequence. A workable proximity is any distance that still facilitates the sequence targeting. Optionally, the DNA binding domain overlaps the target sequence or may bind within the target sequence.
According to one embodiment, the chimeric nuclease induces a single stranded or a double stranded cleavage in the target site.
In generating chimeric nucleases any DNA or RNA binding domain that recognizes the desired target sequence (e.g. DNA binding sequence) with sufficient specificity may be employed. A variety of such DNA and RNA binding domains are known in the art.
Examples of DNA binding domains include, but are not limited to, a meganuclease binding domain, a helix-turn-helix (pfam 01381) binding domain, a leucine zipper (ZIP) binding domain, a winged helix (WH) binding domain, a winged helix turn helix domain (wHTH) binding domain, a helix-loop-helix binding domain, a transcription activator-like (TAL) binding domain, a recombinase, and a zinc finger binding domain.
In an exemplary embodiment of the present invention, the DNA binding domain is a zinc finger binding domain.
Thus, according to an embodiment of this aspect, the chimeric nuclease is a chimeric protein comprising a specific zinc finger binding domain (e.g., pfam00096) and the DNA cleavage domain, such as that of the FokI restriction enzyme (also referred to herein as the FokI cleavage domain), termed herein zinc finger nuclease (ZFN).
The zinc finger domain is 30 amino acids long and consists of a recognition helix and a 2-strand beta-sheet. The domain also contains four regularly spaced ligands for Zinc (either histidines or cysteines). The Zn ion stabilizes the 3D structure of the domain. Each finger contains one Zn ion and recognizes a specific triplet of DNA basepairs.
Zinc finger domains can be engineered to bind to a predetermined nucleotide sequence. Each individual zinc finger (e.g. Cys2/His2) contacts primarily three consecutive base pairs of DNA in a modular fashion [Pavletich et al., Science (1991) 252:809-817; Berg et al., Science (1996) 271:1081-1085]. By manipulating the number of zinc fingers and the nature of critical amino acid residues that contact DNA directly, DNA binding domains with novel specificities can be evolved and selected [see, e.g., Desjarlais et al., Proc. Natl. Acad. Sci. USA (1992) 89:7345-7349; Rebar et al., Science (1994) 263:671-673; Greisman et al., Science (1997) 275:657-661; Segal et al., Proc. Natl. Acad. Sci. USA (1999) 96:2758-2763]. Hence, a very wide range of DNA sequences can serve as specific recognition targets for zinc finger proteins. Chimeric nucleases with several different specificities based on zinc finger recognition have been previously disclosed [see for example, Huang et al., J. Protein Chem. (1996) 15:481-489; Kim et al., Biol. Chem. (1998) 379:489-495].
Various methods for designing chimeric nucleases with zinc finger binding domains are known in the art.
In one embodiment the DNA binding domain comprises at least one, at least two, at least 3, at least 4, at least 5 at least 6 zinc finger domains, binding a 3, 6, 9, 12, 15, or 18 nucleotide sequence, respectively. It will be appreciated by the skilled artisan that the longer the recognition sequence is, the higher the specificity that will be obtained.
Specific DNA binding zinc fingers can be selected by using polypeptide display libraries. The target site is used with the polypeptide display library in an affinity selection step to select variant zinc fingers that bind to the target site. Typically, constant zinc fingers and zinc fingers to be randomized are made from any suitable C2H2 zinc fingers protein, such as SP-1, SP-1C, TFIIIA, GLI, Tramtrack, YY1, or ZIF268 [see, e.g., Jacobs, EMBO J. 11:4507 (1992); Desjarlais & Berg, Proc. Natl. Acad. Sci. U.S.A. 90:2256-2260 (1993)]. The polypeptide display library encoding variants of a zinc finger protein comprising the randomized zinc finger, one or more variants of which will be selected, and, depending on the selection step, one or two constant zinc fingers, is constructed according to the methods known to those in the art. Optionally, the library contains restriction sites designed for ease of removing constant zinc fingers, and for adding in randomized zinc fingers. Zinc fingers are randomized, e.g., by using degenerate oligonucleotides, mutagenic cassettes, or error prone PCR. See, for example, U.S. Pat. Nos. 6,326,166, 6,410,248, and 6,479,626.
Zinc fingers can also be selected by design. A designed zinc finger protein is a protein not occurring in nature whose design/composition results principally from rational criteria. Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP designs and binding data. See, for example, U.S. Pat. Nos. 6,140,081; 6,453,242; and 6,534,261; see also WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO 03/016496.
According to another embodiment, the chimeric nuclease is a TALENs or a compact-TALENs (cTALENs).
As used herein, the term âTALENsâ or âTranscription Activator-Like Effector Nucleasesâ refers to the artificial restriction enzymes generated by fusing the TAL effector DNA binding domain to a DNA cleavage domain. TALENs of the invention enable efficient, programmable, and specific DNA cleavage.
It will be appreciated that Transcription activator-like effectors (TALEs) can be quickly engineered to bind practically any DNA sequence. The term TALEN, as used herein, is broad and includes a monomeric TALEN that can cleave double stranded DNA without assistance from another TALEN. The term TALEN is also used to refer to one or both members of a pair of TALENs that are engineered to work together to cleave DNA at the same site. TALENs that work together may be referred to as a left-TALEN and a right-TALEN. Further details relating to TALENS can be found in U.S. Pat. Nos. 8,450,471; 8,440,431; 8,440,432; and U.S. Pat. Applic. No. 20140256798 all of which are incorporated herein by reference in their entirety.
TALEs are proteins secreted by Xanthomonas bacteria. The DNA binding domain of TALEs contains a highly conserved 33-34 amino acid sequence with the exception of the 12th and 13th amino acids. These two locations are highly variable [Repeat Variable Diresidue (RVD)] and show a strong correlation with specific nucleotide recognition. This simple relationship between amino acid sequence and DNA recognition has allowed for the engineering of specific DNA binding domains by selecting a combination of repeat segments containing the appropriate RVDs.
TALENs of the invention are typically constructed using a non-specific DNA cleavage domain, such as the non-specific DNA cleavage domain of FokI endonuclease. Thus, wild-type FokI cleavage domain may be used as well as FokI cleavage domain variants with mutations designed to improve cleavage specificity and cleavage activity. The FokI domain functions as a dimer, requiring two constructs with unique DNA binding domains for sites in the target genome with proper orientation and spacing. Both the number of amino acid residues between the TALEN DNA binding domain and the DNA cleavage domain (e.g. FokI cleavage domain) and the number of bases between the two individual TALEN binding sites are parameters for achieving high levels of activity. The number of amino acid residues between the TALEN DNA binding domain and the DNA cleavage domain (e.g. FokI cleavage domain) may be modified by introduction of a spacer between the plurality of TAL effector repeat sequences and the nuclease (e.g. FokI endonuclease domain). The spacer sequence may be 12 to 30 nucleotides.
Furthermore, compact TALENs (cTALENs) may be used according to the present teachings. These cTALENs are typically designed with the partially specific I-TevI catalytic domain and are monomeric DNA-cleaving enzymes, i.e. TALENs which are half-size, single-polypeptide compact transcription activator-like effector nucleases (see Beurdeley M. et al., Nature Communications (2013) 4: 1762, which is incorporated herein by reference in its entirety).
The relationship between amino acid sequence and DNA recognition of the TALEN binding domain allows for designable proteins. In this case software programs (e.g. DNAWorks) may be used which calculate oligonucleotides suitable for assembly in a two step PCR; oligonucleotide assembly followed by whole gene amplification. Modular assembly schemes for generating engineered TALE constructs may also be used. Both methods offer a systematic approach to engineering DNA binding domains that are conceptually similar to the modular assembly method for generating zinc finger DNA recognition domains (described hereinabove).
Qualifying the nucleases (e.g. ZFN, TALENs and CRISPR/Cas) and meganucleases thus generated for specific target recognition can be effected using methods which are well known in the art.
A method for designing the nucleases (e.g. chimeric nucleases, ZFN, TALENs, Cas9, RISC, meganucleases) for use in gene targeting may include a process for testing the toxicity of the nuclease on a cell. Such a process may comprise expressing in the cell, or otherwise introducing into a cell, the nuclease and assessing cell growth or death rates by comparison against a control. The tendency of a nuclease to cleave at more than one position in the genome may be evaluated by in-vitro cleavage assays, followed by electrophoresis (e.g. pulsed field electrophoresis may be used to resolve very large fragments) and, optionally, probing or Southern blotting. In view of the present disclosure, one of ordinary skill in the art may devise other tests for cleavage specificity.
The heterologous polypeptide of interest (e.g. nuclease) disclosed herein may further comprise at least one nuclear localization signal (NLS) which facilitates the transport of the nuclease to the DNA-containing organelle. In general, an NLS comprises a stretch of basic amino acids which is recognized by specific receptors at the nuclear pores. The NLS can be located at the N-terminus, the C-terminal, or in an internal location of the nuclease.
Essentially any NLS may be employed, whether synthetic or a naturally occurring NLS, as long as the NLS is one that is compatible with the target cell (i.e. plant cell).
Although nuclear localization signals are discussed herewith, the present teachings are not meant to be restricted to these localization signals, as any signal directed to a DNA-containing organelle is envisaged by the present teachings. Such signals are well known in the art and can be easily retrieved by the skilled artisan.
Nuclear localization signals which may be used according to the present teachings include, but are not limited to, SV40 large T antigen NLS, acidic M9 domain of hnRNP A1, the sequence KIPIK in yeast transcription repressor Mata2 and the complex signals of U snRNPs, tobacco NLS and rice NLS.
In other exemplary embodiments, the localization signal for a DNA containing organelle can be a mitochondrial localization signal (MLS) or a chloroplast localization signal (CLS).
Mitochondrion localization signals (MLS) which may be used according to the present teachings include, but are not limited to the transition signals of, Beta ATPase subunit [cDNAs encoding the mitochondrial pre-sequences from Nicotiana plumbaginifolia ÎČ-ATPase (nucleotides 387-666)], Mitochondrial chaperonin CPN-60 [cDNAs encoding the mitochondrial pre-sequences from Arabidopsis thaliana CPN-60 (nucleotides 74-186] and COX4 [the first 25 codons of Saccharomyces cerevisiae COX4 which encodes the mitochondrial targeting sequence].
Chloroplast localization signals which may be used according to the present teachings include, but are not limited to the transition signals of the ribulose-1,5-bisphosphate carboxylase (Rubisco) small subunit (ats1A) associated transit peptide, the transition signal of LHC II, as well as the N-terminal regions of A. thaliana SIG2 and SIG3 ORFs.
See also www(dot)springerlink(dot)com/content/p65013h263617795/.
Alternatively, the chloroplast localization sequence (CLS) may be derived from a viroid [Evans and Pradhan (2004) US 2004/0142476 A1]. The viroid may be an Avsunviroidae viroid, for example, an Avocado Sunblotch Viroid (ASBVd), a Peach Latent Mosaic Virus (PLMVd), a Chrysanthemum Chlorotic Mottle Viroid (CChMVd) or an Eggplant Latent Viroid (ELVd).
According to a specific embodiment of the present invention, the localization signal may comprise a chloroplast localization signal.
In some embodiments, the heterologous polypeptide of interest (e.g. nuclease) further comprises at least one cell-penetrating domain. In one embodiment, the cell-penetrating domain can be a cell-penetrating peptide (CPP) sequence derived from Tat, Tat2, arginine-rich intracellular delivery peptides (AID), pVEC, transportan and penetratin.
According to a specific embodiment of the present invention, the CPP sequence comprises a dimmer of the Tat molecule (Tat2) which has an increased ability to translocate across plant cell membranes because of the presence of high number of arginine residues.
Various cloning kits can be used according to the teachings of some embodiments of the invention [e.g., GoldenGate assembly kit by New England Biolabs (NEB)].
According to a specific embodiment, the nucleic acid construct is a binary vector. Examples for binary vectors are pBIN19, pBI101, pBinAR, pGPTV, pCAMBIA, pBIB-HYG, pBecks, pGreen or pPZP (Hajukiewicz, P. et al., Plant Mol. Biol. 25, 989 (1994), and Hellens et al, Trends in Plant Science 5, 446 (2000)).
Examples of other vectors to be used in other methods of DNA delivery (e.g. transfection, electroporation, bombardment, viral inoculation) are: pGE-sgRNA (Zhang et al. Nat. Comms. 2016 7:12697), pJIT163-Ubi-Cas9 (Wang et al. Nat. Biotechnol 2004 32, 947-951), pICH47742::2Ă355-5âČUTR-hCas9(STOP)-NOST (Belhan et al. Plant Methods 2013 11; 9(1):39), pAHC25 (Christensen, A. H. & P. H. Quail, 1996. Ubiquitin promoter-based vectors for high-level expression of selectable and/or screenable marker genes in monocotyledonous plants. Transgenic Research 5: 213-218), pHBT-sGFP(S65T)-NOS (Sheen et al. Protein phosphatase activity is required for light-inducible gene expression in maize, EMBO J. 12 (9), 3497-3505 (1993).
According to a specific embodiment, the vector is the binary vector, pME 504.
According to a specific embodiment, the transformation comprises a transient transformation.
According to a specific embodiment, the transformation comprises a stable transformation.
Various methods are known for plant transformation. For example, transient transformation can be done in the absence of a selection marker for 3-14 days. Stable transformation will typically require 4-10 weeks in the presence of a selection marker (e.g., antibiotics). Further transformation protocols are described hereinbelow.
The delivery of nucleic acids into a plant cell (contacted) in embodiments of the invention can be done by any method known to those of skill in the art, including, for example and without limitation: by desiccation/inhibition-mediated DNA uptake (See, e.g., Potrykus et al. (1985) Mol. Gen. Genet. 199:183-8); by electroporation (See, e.g., U.S. Pat. No. 5,384,253); by agitation with silicon carbide fibers (See, e.g., U.S. Pat. Nos. 5,302,523 and 5,464,765); by Agrobacterium-mediated transformation (See, e.g., U.S. Pat. Nos. 5,563,055, 5,591,616, 5,693,512, 5,824,877, 5,981,840, and 6,384,301); by acceleration of DNA-coated particles (See, e.g., U.S. Pat. Nos. 5,015,580, 5,550,318, 5,538,880, 6,160,208, 6,399,861, and 6,403,865) and by Nanoparticles, nanocarriers and cell penetrating peptides (WO201126644A2; WO2009046384A1; WO2008148223A1) in the methods to deliver DNA, RNA, Peptides and/or proteins or combinations of nucleic acids and peptides into plant cells.
Other methods of transfection include the use of transfection reagents (e.g. Lipofectin, ThermoFisher), dendrimers (Kukowska-Latallo, J. F. et al., 1996, Proc. Natl. Acad. Sci. USA 93, 4897-902), cell penetrating peptides (Mae et al., 2005, Internalisation of cell-penetrating peptides into tobacco protoplasts, Biochimica et Biophysica Acta 1669(2):101-7) or polyamines (Zhang and Vinogradov, 2010, Short biodegradable polyamines for gene delivery and transfection of brain capillary endothelial cells, J Control Release, 143(3):359-366).
According to a specific embodiment, the introduction of DNA into plant cells is effected by electroporation.
According to a specific embodiment, the introduction of DNA into plant cells is effected by bombardment/biolistics.
According to a specific embodiment, the introduction of DNA into plant cells is effected by Agrobacterium mediated transformation.
Viruses that have been shown to be useful for the transformation of plant hosts include CaMV, TMV, TRV and BV. Transformation of plants using plant viruses is described in U.S. Pat. No. 4,855,237 (BGV), EP-A 67,553 (TMV), Japanese Published Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV); and Gluzman, Y. et al., Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189 (1988). Pseudovirus particles for use in expressing foreign DNA in many hosts, including plants, is described in WO 87/06261.
Construction of plant RNA viruses for the introduction and expression of non-viral exogenous nucleic acid sequences in plants is demonstrated by the above references as well as by Dawson, W. O. et al., Virology (1989) 172:285-292; Takamatsu et al. EMBO J. (1987) 6:307-311; French et al. Science (1986) 231:1294-1297; and Takamatsu et al. FEBS Letters (1990) 269:73-76.
When the virus is a DNA virus, suitable modifications can be made to the virus itself. Alternatively, the virus can first be cloned into a bacterial plasmid for ease of constructing the desired viral vector with the foreign DNA. The virus can then be excised from the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA, which is then replicated by the bacteria. Transcription and translation of this DNA will produce the coat protein which will encapsidate the viral DNA. If the virus is an RNA virus, the virus is generally cloned as a cDNA and inserted into a plasmid. The plasmid is then used to make all of the constructions. The RNA virus is then produced by transcribing the viral sequence of the plasmid and translation of the viral genes to produce the coat protein(s) which encapsidate the viral RNA.
Construction of plant RNA viruses for the introduction and expression in plants of non-viral exogenous nucleic acid sequences such as those included in the construct of some embodiments of the invention is demonstrated by the above references as well as in U.S. Pat. No. 5,316,931.
In one embodiment, a plant viral nucleic acid is provided in which the native coat protein coding sequence has been deleted from a viral nucleic acid, a non-native plant viral coat protein coding sequence and a non-native promoter, preferably the subgenomic promoter of the non-native coat protein coding sequence, capable of expression in the plant host, packaging of the recombinant plant viral nucleic acid, and ensuring a systemic infection of the host by the recombinant plant viral nucleic acid, has been inserted. Alternatively, the coat protein gene may be inactivated by insertion of the non-native nucleic acid sequence within it, such that a protein is produced. The recombinant plant viral nucleic acid may contain one or more additional non-native subgenomic promoters. Each non-native subgenomic promoter is capable of transcribing or expressing adjacent genes or nucleic acid sequences in the plant host and incapable of recombination with each other and with native subgenomic promoters. Non-native (foreign) nucleic acid sequences may be inserted adjacent the native plant viral subgenomic promoter or the native and a non-native plant viral subgenomic promoters if more than one nucleic acid sequence is included. The non-native nucleic acid sequences are transcribed or expressed in the host plant under control of the subgenomic promoter to produce the desired products.
In a second embodiment, a recombinant plant viral nucleic acid is provided as in the first embodiment except that the native coat protein coding sequence is placed adjacent one of the non-native coat protein subgenomic promoters instead of a non-native coat protein coding sequence.
In a third embodiment, a recombinant plant viral nucleic acid is provided in which the native coat protein gene is adjacent its subgenomic promoter and one or more non-native subgenomic promoters have been inserted into the viral nucleic acid. The inserted non-native subgenomic promoters are capable of transcribing or expressing adjacent genes in a plant host and are incapable of recombination with each other and with native subgenomic promoters. Non-native nucleic acid sequences may be inserted adjacent the non-native subgenomic plant viral promoters such that said sequences are transcribed or expressed in the host plant under control of the subgenomic promoters to produce the desired product.
In a fourth embodiment, a recombinant plant viral nucleic acid is provided as in the third embodiment except that the native coat protein coding sequence is replaced by a non-native coat protein coding sequence.
The viral vectors are encapsidated by the coat proteins encoded by the recombinant plant viral nucleic acid to produce a recombinant plant virus. The recombinant plant viral nucleic acid or recombinant plant virus is used to infect appropriate host plants. The recombinant plant viral nucleic acid is capable of replication in the host, systemic spread in the host, and transcription or expression of foreign gene(s) (isolated nucleic acid) in the host to produce the desired protein.
Genome transformation can be evaluated phenotypically, i.e., by the presence/absence of a certain trait e.g., antibiotic resistance, resistance to disease or herbicide, morphologically (e.g., plant height), reporter gene expression (e.g., GUS) etc.
Genome transformation can also be evaluated molecularly. This is of specific significance in the case of genome editing.
Thus, regenerated tissues/plants are validated for the presence of a transformation event. The following provides such validation methods for genome editing events, also referred to herein as âmutationâ or âeditâ, dependent on the type of editing sought e.g., insertion, deletion, insertion-deletion (Indel), inversion, substitution and combinations thereof.
Methods for detecting sequence alteration are well known in the art and include, but not limited to, DNA sequencing (e.g., next generation sequencing), electrophoresis, an enzyme-based mismatch detection assay and a hybridization assay such as PCR, RT-PCR, RNase protection, in-situ hybridization, primer extension, Southern blot, Northern Blot and dot blot analysis. Various methods used for detection of single nucleotide polymorphisms (SNPs) can also be used, such as PCR based T7 endonuclease, Hetroduplex and Sanger sequencing.
Another method of validating the presence of a DNA editing event e.g., Indels comprises a mismatch cleavage assay that makes use of a structure selective enzyme (e,g. m endonuclease) that recognizes and cleaves mismatched DNA.
The mismatch cleavage assay is a simple and cost-effective method for the detection of indels and is therefore the typical procedure to detect mutations induced by genome editing. The assay uses enzymes that cleave heteroduplex DNA at mismatches and extrahelical loops formed by multiple nucleotides, yielding two or more smaller fragments. A PCR product of Ë300-1000 bp is generated with the predicted nuclease cleavage site off-center so that the resulting fragments are dissimilar in size and can easily be resolved by conventional gel electrophoresis or high-performance liquid chromatography (HPLC). End-labeled digestion products can also be analyzed by automated gel or capillary electrophoresis. The frequency of indels at the locus can be estimated by measuring the integrated intensities of the PCR amplicon and cleaved DNA bands. The digestion step takes 15-60 min, and when the DNA preparation and PCR steps are added the entire assays can be completed in <3 h.
Two alternative enzymes are typically used in this assay. T7 endonuclease 1 (T7E1) is a resolvase that recognizes and cleaves imperfectly matched DNA at the first, second or third phosphodiester bond upstream of the mismatch. The sensitivity of a T7E1-based assay is 0.5-5%. In contrast, Surveyorâą nuclease (Transgenomic Inc., Omaha, Nebr., USA) is a member of the CEL family of mismatch-specific nucleases derived from celery. It recognizes and cleaves mismatches due to the presence of single nucleotide polymorphisms (SNPs) or small indels, cleaving both DNA strands downstream of the mismatch. It can detect indels of up to 12 nt and is sensitive to mutations present at frequencies as low as Ë3%, i.e. 1 in 32 copies.
Yet another method of validating the presence of an editing even comprises the high-resolution melting analysis.
High-resolution melting analysis (HRMA) involves the amplification of a DNA sequence spanning the genomic target (90-200 bp) by real-time PCR with the incorporation of a fluorescent dye, followed by melt curve analysis of the amplicons. HRMA is based on the loss of fluorescence when intercalating dyes are released from double-stranded DNA during thermal denaturation. It records the temperature-dependent denaturation profile of amplicons and detects whether the melting process involves one or more molecular species.
Yet another method is the heteroduplex mobility assay. Mutations can also be detected by analyzing re-hybridized PCR fragments directly by native polyacrylamide gel electrophoresis (PAGE). This method takes advantage of the differential migration of heteroduplex and homoduplex DNA in polyacrylamide gels. The angle between matched and mismatched DNA strands caused by an indel means that heteroduplex DNA migrates at a significantly slower rate than homoduplex DNA under native conditions, and they can easily be distinguished based on their mobility. Fragments of 140-170 bp can be separated in a 15% polyacrylamide gel. The sensitivity of such assays can approach 0.5% under optimal conditions, which is similar to T7E1 (After reannealing the PCR products, the electrophoresis component of the assay takes Ë2 h.
Other methods of validating the presence of editing events are described in length in Zischewski 2017 Biotechnol. Advances 1(1):95-104.
It will be appreciated that positive clones can be homozygous or heterozygous for the transformation event. The skilled artisan will select the clone for further culturing/regeneration according to the intended use.
It will be appreciated that crossing of the plant can be effected to improve agricultural traits, losing a transgene, also known as âcrossing outâ (e.g., nuclease after genome editing was successfully implemented), or generation of inbreds or hybrids.
Following the present teachings, the present inventors were able to exhibit at least 50% regeneration efficiency, as calculated by the number of regenerates on the leaves/the total number of treated leaves.
Whilst reducing embodiments of the invention to practice, the present inventors have devised a protocol for in planta regeneration and transformation. Meristems are responsible for repair after injury: when the clonal zone of the shoot apical meristem is locally ablated, surrounding cells in the peripheral zone reconstruct the functional meristem. In shoots, meristems in axillary buds are kept dormant by the presence of apical meristems. Upon loss of these apical meristems, apical dormancy is broken and axillary buds begin to grow.
As used herein âin plantaâ means not under the sterile conditions of a tissue culture.
Accordingly, there is provided a method of in planta cannabis regeneration, the method comprising:
(a) removing, exposing and/or wounding a meristem of a cannabis tissue so as to obtain a meristem-depleted cannabis tissue; and
(b) treating said meristem-depleted cannabis tissue with a composition comprising at least one plant hormone (e.g., cytokinin, auxin gibberellins, ethylene, ABA, Jasmonic acid);
According to a specific embodiment, the at least one plant hormone comprises a cytokinin and an auxin.
Also provided is a method of in planta cannabis transformation, the method comprising:
(a) removing, exposing and/or wounding a meristem of a cannabis tissue so as to obtain a meristem-depleted cannabis tissue; and
(b) treating said meristem-depleted cannabis tissue with a composition comprising at least one plant hormone (e.g., cytokinin, auxin gibberellins, ethylene, ABA Jasmonic acid) that allows plant regeneration and with a composition comprising a nucleic acid sequence encoding an expression product of interest;
According to a specific embodiment, the at least one plant hormone comprises a cytokinin and an auxin.
According to this aspect, the cannabis tissue is a tissue that comprises meristems (axial or apical) prior to their depletion as described.
According to an embodiment of the invention, cannabis seeds are allowed to germinate and grow until a size when at least two nodes are observed.
In order to expose the meristem, one cotyledon and the meristem with its leaves (i.e., of a seedling) are cut off from the seedling (e.g., at 145°), leaving the seedling with only one cotyledon so as to allow photosynthesis. Other embodiments of the invention relate to the same protocol when done on a mature plant (e.g., cutting having 2 nodes of an adult plant). In the latter case too, at least one leaf (e.g., not more than 1 leaf) is left to allow photosynthesis.
At this stage the tissue is treated with hormone(s). For example, cytokinin and auxin, at the relevant ratios. In addition gibberellin. ethylene, ABA and/or Jasmonic acid can be added.
The use of a paste formulation may enhance penetration, though other modes of applications (e.g., spraying, dropping) can be used too.
According to a specific embodiment, the composition is formulated such that allows attachment of the composition to a surface of the meristem-depleted cannabis tissue.
According to a specific embodiment, the formulation comprises (e.g., ALGANATE) a nanoemulsion paste prepared according to Pereira et al., 2017 (Colloids and surfaces B: Biointerfaces 150:141-152) e.g., cytokinins and auxin gibberellins, ethylene, aba, Jasmonic acid hormones combinations are mixed with nanoemulsion (e.g., 3:4 v/v) to create a âregeneration pasteâ. The paste is spread on the wounded cuttings.
According to a specific embodiment the nanoemulsion comprises lanolin.
As used herein ânanoemulsionâ refers to clear, thermodynamically stable, isotropic liquid mixtures of oil, water and surfactant, frequently in combination with a co-surfactant. The aqueous phase may contain salt(s) and/or other ingredients, and the âoilâ may actually be a complex mixture of different hydrocarbons and olefins, in contrast to ordinary emulsions,
The regeneration can be effected together with the transformation (in this case, when Agrobacterium is used, it is better to employ a microemulsion that can comprise the bacterial cells). Accordingly, the composition which comprises the regenerating hormones can include also the nucleic acid of interest. Conversely, the same composition (e.g., alginate based) can be used for both transformation and regeneration even if taken in 2 different steps.
In a sequential embodiment, whereby the transformation step follows regeneration, the transformation composition is applied 0-96 hours following application of the regeneration composition comprising the hormones.
It will be appreciated that the plant can be first transformed and then subjected to a regeneration protocol.
According to a specific embodiment, the transformation is Agrobacterium-based. Agrobacterium can be applied to the cannabis tissue in different modes e.g., dipping, microencapsulation, injecting and dripping.
Transformation and methods of validation are described herein.
Also provided herein is a method of cannabis regeneration via somatic embryogenesis, the method comprising:
(a) culturing a callus or a regenerable cannabis explant in a liquid culture while shaking till appearance of globular structures (e.g., as in FIG. 13A);
(b) culturing said globular structures in a liquid culture while shaking till appearance of leaves.
According to a specific embodiment, the regenerable cannabis explant is obtained according to the protocol of clonal propagation as described above.
According to a specific embodiment, the culturing is effected under shaking (such as described hereinabove) to elicit the development of embryonic tissue i.e., dedifferentiation that is followed by differentiation in the presence of CPPU and CPPU+cBD.
According to a specific embodiment, step (a) is effected in the presence of CPPU; and wherein step (b) is effected in the presence of CPPU+cBD.
According to a specific embodiment, step (a) is effected in the absence of cBD.
According to a specific protocol regeneration via somatic embryogenesis is effected as follows: a tissue explants having leaf segments of 1.5 cm diameter and 4-5 cm length are selected. Innermost leaf whorls are cut obliquely (0.5-1.0 cm), injured with a sharp scalpel blade in order to achieve callus initiation (de-differentiation). Leaf segments are used as explants for inoculation on MS medium (Murashige and Skoog 1962) supplemented with 2,4-D (4.0 mg/L) and kinetin [Kin] (0.5 mg/L). After 2-3 weeks the cultures are incubated at 25±2° C. at 70-80% humidity in dark in liquid Gamborg B5 medium supplemented with 6% sucrose and different plant hormones including the CPPU and cBD. The media was refreshed every three weeks.
Also provided is a method of in-vitro cannabis transformation, the method comprising, contacting a leaf producible according to the method as described herein with a polynucleotide encoding an expression product of interest. According to a specific embodiment, the polynucleotide is comprised in a formulation comprising Agrobacterium or PEG (as described herein).
Plants can also regenerate from protoplast or pollen. Whilst reducing embodiments of the invention to practice, the present inventors have identified a protocol for the efficient production of protoplasts using enzymatic digestion.
Accordingly there is provided a method of producing cannabis protoplasts, the method comprising, treating a cannabis tissue with macerozyme R-10 and mannitol, so as to obtain protoplasts.
As used herein âprotoplastâ refers to a plant cell devoid of a cell wall.
Protoplasts can be isolated from a wide variety of cannabis tissues and organs that include leaves, roots, shoot apices, embryos, microspores and mesophyll tissue of seedlings (e.g., cotyledons) or mature plants (e.g., leaves). In addition, callus and suspension cultures also serve as sources for protoplast isolation.
A sterile tissue is used. Disinfection can be done any time before the production of protoplasts.
The present inventors have found that a combination of macerozyme R-10 and mannitol allows the survival of at least 4% of isolated protoplasts following 48 hours cultivation in a liquid (drop) culture. In addition less than 1% of the protoplasts developed a cell wall.
Macerozyme R-10 is a macerating enzyme from the Rhizopus sp. which is suited for the isolation of plant cells. The enzyme has pectinase and hemicellulase activity. Macerozyme R-10 is commercially available from a number of vendors including but not limited to Sigma-Aldrich, GoldBio(dot)Com and Yakult Pharmaceutical Industries Co.
As used herein âMannitolâ is used herein as a carbon source. It will be appreciated that other carbon sources such as sorbitol, fructose, glucose, galactose and sucrose can be alternatively used. Mannitol, being metabolically inert, may be preferred.
In an exemplary protocol, sterile cotyledons are cut to fine pieces (e.g., 1-5 mm) and incubated in a cell wall degrading solution e.g., W5â1.5% cellulose, 0.5% macerozyme, 0.4% mannitol, 20 mM KCl, 20 mM MES, 10 mM CaCl2 and 0.1% BSA, placed in vacuum for 10 min and then shaken for 5 h at 50 rpm pH 4.5-7. The protoplasts are then filtered, diluted and pelleted by centrifugation. Up to now the procedure is done at room temperature. The protoplasts are re-suspended in a cell wall degrading solution (e.g., W5) and incubated on ice, before being centrifuged again and re-suspended in a solution containing mannitol and MgCl2.
According to a specific embodiment, treating the tissue is also done with onzuka R-10 and/or hemicelluloses.
Cellulose or hemicelluloses are used to release the protoplasts from the cell debris.
As used herein âOnzuka R-10â refers to a cellulase derived from Trichoderma viride, which decomposes plant cell walls.
Other Onzuka cellulases can also be used e.g., Onzuka FA and Onzuka.
According to a specific embodiment, macerozyme R-10 is provided at a concentration of 0.4-1.5%.
According to a specific embodiment, said hemicellulose is provided at a concentration of 0.5-2%.
According to a specific embodiment, said Onzuka is provided at a concentration of 0.5-3%.
According to a specific embodiment, said mannitol is provided at a concentration of 0.1-0.3%.
The various enzymes for protoplast isolation are commercially available. For instance, Macerozyme R-10 is commercially available from a number of vendors including, but not limited to, Sigma-Aldrich, GoldBio(dot)Com and Yakult Pharmaceutical Industries Co.
The enzymes are typically used at a pH 4.5 to 6.0 (e.g., 5.8), temperature 25-30° C. (e.g., room temperature) with a wide variation in incubation period that may range from half an hour to 20 hours (e.g., 5 hours).
The enzyme digested plant cells, besides protoplasts contain undigested cells, broken protoplasts and undigested tissues. The cell clumps and undigested tissues can be removed by filtration. This is followed by centrifugation and washings of the protoplasts. After centrifugation, the protoplasts are recovered in a solution which may contain percoll or a combination of mannitol and salt (e.g., MgCl2).
According to a specific embodiment at least 50-70% of the preparation comprises protoplasts that are viable and intact.
Thus, according to an embodiment, the isolated protoplasts are tested for viability and ability to undergo sustained cell divisions and regeneration.
Examples of methods for assessing protoplast viability include but are not limited to, fluorescein diacetate (FDA) staining methodâThe dye accumulates inside viable protoplasts which can be detected by fluorescence microscopy; phenosafranine stain is selectively taken up by dead protoplasts (turn red) while the viable cells remain unstained; exclusion of Evans blue dye by intact membranes; measurement of cell wall formationâCalcofluor white (CFW) stain binds to the newly formed cell walls which emit fluorescence; Oxygen uptake by protoplasts which can be measured by oxygen electrode; Photosynthetic activity of protoplasts; and ability of protoplasts to undergo continuous mitotic divisions (this is a direct measure).
Such protoplasts can be subjected to a method of transformation.
Typically in the absence of cell wall the DNA can be transferred using simple reagents such as PEG.
Thus, according to an embodiment of the invention, introducing DNA into protoplasts comprises polyethylene glycol (PEG)-mediated DNA uptake. For further details see Karesch et al. (1991) Plant Cell Rep. 9:575-578; Mathur et al. (1995) Plant Cell Rep. 14:221-226; Negrutiu et al. (1987) Plant Cell Mol. Biol. 8:363-373.
Based on the present teachings the present inventors were able to successfully introduce the RFP gene to cannabis protoplasts.
Also provided are protoplasts (transformed or not) obtainable according to the present teachings.
Protoplasts are then cultured under conditions that allow them to grow cell walls, start dividing to form a callus, develop shoots and roots, and regenerate whole plants.
The very first step in protoplast culture is the development of a cell wall around the membrane of the protoplast. This is followed by the cell divisions that give rise to a small colony. The cell colonies may be grown continuously as cultures or regenerated to whole plants. Protoplasts are cultured either in semisolid agar or liquid medium. In an embodiment, protoplasts are first allowed to develop cell wall in liquid medium, and then transferred to agar medium.
Solid culture (e.g., Agarose): The concentration of the agar should be such that it forms a soft agar gel when mixed with the protoplast suspension e.g., 0.5-0.7%. According to a specific embodiment, the plating of protoplasts is carried out by Bergmann's cell plating technique. In agar cultures, the protoplasts remain in a fixed position, divide and form cell clones. The advantage with agar culture is that clumping of protoplasts is avoided.
According to another embodiment, a liquid culture is used. Liquid culture may be used for protoplast cultivation for the following reasons:
1. It is easy to dilute and transfer.
2. Density of the cells can be manipulated as desired.
3. Osmotic pressure of liquid medium can be altered as desired.
In general, the nutritional requirements of protoplasts are similar to those of cultured plant cells, as mentioned above (e.g., MS).
According to some embodiments, the following considerations are taken place:
1. The medium should be devoid of ammonium, and the quantities of iron and zinc should be less.
2. The concentration of calcium should be 2-4-times higher than used for cell cultures. This is needed for membrane stability.
3. High auxin/kinetin ratio is suitable to induce cell divisions while high kinetin/auxin ratio is required for regeneration.
4. Glucose is the preferred carbon source by protoplasts although a combination of sugars (glucose and sucrose) can be used.
5. The vitamins used for protoplast cultures are the same as used in standard tissue culture media.
Osmoticum and osmotic pressure:
As used herein âOsmoticumâ refers to the reagents/chemicals that are added to increase the osmotic pressure of a liquid.
The isolation and culture of protoplasts require osmotic protection until they develop a strong cell wall. In fact, if the freshly isolated protoplasts are directly added to the normal culture medium, they will burst. Thus, addition of an osmoticum is essential for both isolation and culture media of protoplast to prevent their rupture.
According to a specific embodiment, the osmoticum is non-ionic. The non-ionic substances most commonly used are soluble carbohydrates such as mannitol, sorbitol, glucose, fructose, galactose and sucrose. According to a specific embodiment, mannitol is used.
According to a specific embodiment, the osmoticum is ionic. Potassium chloride, calcium chloride and magnesium phosphate are the ionic substances in use to maintain osmotic pressure. When the protoplasts are transferred to a culture medium, the use of metabolically active osmotic stabilizers (e.g., glucose, sucrose) along with metabolically inert osmotic stabilizers (mannitol) is advantageous. As the growth of protoplasts and cell wall regeneration occurs, the metabolically active compounds are utilized, and this results in the reduced osmotic pressure so that proper osmolarity is maintained.
The culture techniques of protoplasts may vary.
According to a specific embodiment, the feeder layer technique or micro drop culture is used.
The process of cell wall formation in cultured protoplasts starts within a few hours after isolation that may take two to several days under suitable conditions. As the cell wall development occurs, the protoplasts lose their characteristic spherical shape. The newly developed cell wall by protoplasts can be identified by using calcofluor white fluorescent stain. The freshly formed cell wall is composed of loosely bound micro fibrils which get organized to form a typical cell wall. This process of cell wall development requires continuous supply of nutrients, particularly a readily metabolised carbon source (e.g. sucrose).
Cell wall development is found to be improper in the presence of ionic osmotic stabilizers in the medium. The protoplasts with proper cell wall development undergo normal cell division. On the other hand, protoplasts with poorly regenerated cell wall show budding and fail to undergo normal mitosis.
As the cell wall formation around protoplasts is complete, the cells increase in size, and the first division generally occurs within 2-7 days. Subsequent divisions result in small colonies, and by the end of third week, visible colonies (macroscopic colonies) are formed. These colonies are then transferred to an osmotic-free (mannitol or sorbitol-free) medium for further development to form callus.
With induction and appropriate manipulations, the callus can undergo organogenic or embryogenic differentiation to finally form the whole plant.
Plant regeneration can be done from the callus obtained either from protoplasts or from the culture of plant organs. There are however, certain differences in these two calli. The callus derived from plant organs carries preformed buds or organized structures, while the callus from protoplast culture does not have such structures.
To augment any of the above regeneration protocols, the present inventors have identified regenerating genes termed CsBBM (SEQ ID NO: 2 and 6) and CsSERK1 (SEQ ID NO: 1 and 10) that can facilitate plant regeneration.
Also contemplated are naturally occurring or synthetic homologs (e.g., of at least 30%, 40%, 50% or 80% nucleic acid identity of same).
Thus, according to an aspect of the invention there is provided a method of cannabis regeneration, the method comprising transforming an explant or plant (i.e., in planta) of the cannabis with a regenerating gene [e.g., CsBBM (SEQ ID NO: 2 and 6) and CsSERK1 (SEQ ID NO: 1 and 10)] and allowing the tissue to regenerate.
Such homologues can be, for example, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:10 (amino acid sequence of CsSerk1), as determined using the BestFit software of the Wisconsin sequence analysis package, utilizing the Smith and Waterman algorithm, where gap weight equals 50, length weight equals 3, average match equals 10 and average mismatch equals â9.
According to an additional or an alternative embodiment, the homologues can be, for example, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:6 (amino acid sequence of CsBBM), as determined using the BestFit software of the Wisconsin sequence analysis package, utilizing the Smith and Waterman algorithm, where gap weight equals 50, length weight equals 3, average match equals 10 and average mismatch equals â9.
Naturally occurring homologs are provided in BnBBM, AthBBM, ZmBBM, AtSERK1, BnSERK1, SISERK1. (SEQ ID NOs: 3-9).
Protocols for transformation (viral or non-viral dependent) are described throughout the specification.
Promoters useful for expression can be constitutively active or inducible (see e.g., WO2017/115353, WO2016/030885).
Nucleic acid sequences of the polypeptides of some embodiments of the invention may be optimized for plant expression. Examples of such sequence modifications include, but are not limited to, an altered G/C content to more closely approach that typically found in the plant species of interest, and the removal of codons atypically found in the plant species commonly referred to as codon optimization.
Also provided is a method of cannabis transformation. The method comprises contacting pollen of a cannabis plant with particles comprising a nucleic acid sequence encoding an expression product of interest under a magnetic field that concentrates said particles and allows penetration of said nucleic acid sequence of interest into said pollen.
Transformation under a magnetic field is typically referred to as âmagnetofectionâ.
The ability to transform cannabis using magnetofection is surprising, since to date the pollen apertures of cannabis have never been described.
This method is advantageous since it does not require plant regeneration.
In this system, exogenous DNA loaded with magnetic nanoparticles is delivered into pollen in the presence of a magnetic field.
The present inventors have surprisingly uncovered that fresh pollen i.e., up to 12 hours post harvesting exhibits better transformability.
Accordingly, magnetic nanoparticles (MNPs) are used as DNA carriers that can pass through the apertures in the pollen with the directional potential of a magnetic field (externally applied). Hence, positively charged polyethyleneimine-coated Fe3O4 MNPs are used as the DNA carriers for binding and condensing with electric negative DNA to form MNP-DNA complexes. After mixing MNP-DNA complexes with pollen, a magnetic field is then applied to direct the MNP-DNA complexes into the pollen through the apertures before pollination. Plants expressing a transgene of interest are then obtained typically after selection e.g., with an antibiotic.
According to an exemplary protocol, plasmid DNA (e.g., 1 ug) is left to bind with MNP's (MAGBIO, USA) at room temperature, prior to adding the transformation media: 10 gâ40 Sucrose, H3BO3â10.3 mg, KNO3â 2.3 mg, Ca(NO3)2â10.3 mg, MnSO4â10.3 mg, MgSO4 7H2Oâ10.3 mg, GA3â3 mg, H2O up to 100 ml.
Pollen (1-10 million grains) added to the medium containing the bound MNP-plasmid and left on a magnet (Chemicell) for 30 min at room temp and dried in 30° C. for 30 min.
Based on the present teachings the present inventors were able to successfully introduce the GUS gene to cannabis pollen.
Any of the plant material described herein can be used for the generation of cannabis plants with advanced agricultural, nutritional, pharmaceutical, recreational properties, as compared to no-transformed plants of the same genetic background, developmental stage and growth conditions but not being transformed, also referred to herein as âcontrolâ.
As used herein the term âaboutâ refers to ±10%.
The terms âcomprisesâ, âcomprisingâ, âincludesâ, âincludingâ, âhavingâ and their conjugates mean âincluding but not limited toâ.
The term âconsisting ofâ means âincluding and limited toâ.
The term âconsisting essentially ofâ means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
As used herein, the singular form âaâ, âanâ and âtheâ include plural references unless the context clearly dictates otherwise. For example, the term âa compoundâ or âat least one compoundâ may include a plurality of compounds, including mixtures thereof.
Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases âranging/ranges betweenâ a first indicate number and a second indicate number and âranging/ranges fromâ a first indicate number âtoâ a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
As used herein the term âmethodâ refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
As used herein, the term âtreatingâ includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.
When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.
It is understood that any Sequence Identification Number (SEQ ID NO) disclosed in the instant application can refer to either a DNA sequence or a RNA sequence, depending on the context where that SEQ ID NO is mentioned, even if that SEQ ID NO is expressed only in a DNA sequence format or a RNA sequence format.
It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
Reference is now made to the following examples, which together with the above descriptions, illustrate the invention in a non limiting fashion.
Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, âMolecular Cloning: A laboratory Manualâ Sambrook et al., (1989); âCurrent Protocols in Molecular Biologyâ Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., âCurrent Protocols in Molecular Biologyâ, John Wiley and Sons, Baltimore, Md. (1989); Perbal, âA Practical Guide to Molecular Cloningâ, John Wiley & Sons, New York (1988); Watson et al., âRecombinant DNAâ, Scientific American Books, New York; Birren et al. (eds) âGenome Analysis: A Laboratory Manual Seriesâ, Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; âCell Biology: A Laboratory Handbookâ, Volumes I-III Cellis, J. E., ed. (1994); âCurrent Protocols in Immunologyâ Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), âBasic and Clinical Immunologyâ (8th Edition), Appleton & Lange, Norwalk, Conn. (1994); Mishell and Shiigi (eds), âSelected Methods in Cellular Immunologyâ, W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; âOligonucleotide Synthesisâ Gait, M. J., ed. (1984); âNucleic Acid Hybridizationâ Hames, B. D., and Higgins S. J., eds. (1985); âTranscription and Translationâ Hames, B. D., and Higgins S. J., Eds. (1984); âAnimal Cell Cultureâ Freshney, R. I., ed. (1986); âImmobilized Cells and Enzymesâ IRL Press, (1986); âA Practical Guide to Molecular Cloningâ Perbal, B., (1984) and âMethods in Enzymologyâ Vol. 1-317, Academic Press; âPCR Protocols: A Guide To Methods And Applicationsâ, Academic Press, San Diego, Calif. (1990); Marshak et al., âStrategies for Protein Purification and CharacterizationâA Laboratory Course Manualâ CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.
Cannabis has acquired considerable importance as a food, oil, fiber, medicinal and recreational drug source crop all over the world. This extraordinary versatile important plant material naturally calls for development of suitable protocols for production of sufficient number of uniform planting materials from Cannabis varieties through biotechnological intervention. Among the biotechnological approaches, micropropagation is one of the most feasible techniques, allows efficient and rapid clonal propagation of many economically important crops.
This study describes an efficient in-vitro propagation, hardening and rooting procedures for obtaining plantlets from shoot tips and seedlings of Cannabis sativa L. Ten different cannabis cultivars seedlings and shoot cuttings were sterilized and grown on half-strength œ MS medium supplemented with 10 g/L sucrose, 5.5 g/L Agar at a pH of 6.8 with different plant hormone combinations under light for 16 h per day. Limited growth was observed on the solid media supplemented with different hormonal combinations in most of the cultivars tested. In order to increase cannabis plant permeability, a protocol was developed that utilizes âliquid treatmentâ in which the tissue culture explants are transferred from solid to liquid media supplemented with several sublethal concentrations of cuticle nicking enzymes every 3-4 weeks, resulting in significantly improved growth and development. The proliferated buds were successfully rooted on solid MS medium supplemented with resulting in 85% rooting of the plantlets. In-vitro clonal propagation, rooting and acclimatized plantlet production was established for 10 different Cannabis cultivars. The procedure requires a 50-70 days cycle for the In-vitro clonal propagation (20 days for shoot multiplication and 30 days for root induction) which includes 15-30 days for acclimatized plantlet production. Different strains may have different procedure time generally requiring between 50 to 100 days.
Materials and Methods
Plant Material
Ten different Cannabis cultivars representing a wide range of genetic diversity (Table 1) were used in this study. A few of them are hemp with low/non THC mainly used for fiber while the others are Cannabis cultivars with high THC and other cannabinoids for medical and recreational usage (e.g., 0-22% THC and 0.2-13% CBD). The plants of C. sativa were grown from seeds and cuttings.
| TABLE 1 | ||||
| No. | Name | Type | Usage | Origin |
| 106 | WON21 | Sativa | Fiber type | China |
| 108 | Pinola | Sativa | Fiber type, Oil | Canada |
| Dioecious | ||||
| 201 | Goodrich | Sativa | Medical | China |
| 202 | Glory | Sativa | Medical | China |
| 206 | Lemon Haze | Sativa | Drug type | Europe |
| 207 | White widow | Hybrid | Drug type | Europe |
| 208 | Jack herer | Hybrid | Drug type | Europe |
| 209 | Lemon Haze Bnn. | Hybrid | Drug type, Medical | Europe |
| 212 | Cheese | Hybrid | Drug type, Medical | Europe |
| 213 | SLH | Hybrid | Drug type, Medical | Europe |
Establishment and Propagation of Cannabis Tissue Culture from Mature Plants
Tissue Sterilization:
Cutting tissues from mature plants that contained apical and axillary meristems were washed under abundant water flow for 3 h. Tissues were then washed in ethanol 70% for 10 secs prior to 20 min wash in 1.5% NaClO.
Tissues were further abundantly washed 4 times in distilled water and set on different sterile proliferation growth medium. In order to determine an ideal composition for each line (Table 2).
Tissue Propagation
Every 21 days plants were transferred to a fresh propagation medium after carefully removing the leaves and exposure of side meristem.
Establishment and Propagation from Seeds
Seeds Sterilization and Germination
Seeds washed under abundant water flow for 2 h, then washed in ethanol 70% for 10 secs prior to 20 min wash in 1.5% NaClO supplemented with 0.1% Tween 20. Seeds were further abundantly washed 4 times in distilled water and set onto a sterile growth medium (œMS, 2% Sucrose, 0.8% agar). Seeds were germinated in the dark for 2 d and were then transferred to light. Two weeks later, large seedlings that contained at least two true leaves were cut from their roots and transferred to different sterile proliferation growth media. In order to determine an ideal composition for each line (Table 2).
Liquid Treatment
Young shoots were depleted from their leaves and necrotic tissue. They were then transferred to liquid medium that contained all growth components excluding Agar as mention in Table 2, below. Plantlets were grown in 250 ml jars containing 5 ml medium for shaking for 21 days and then transferred back to solid media.
Premium Liquid Treatment
Adding several sublethal concentrations of cuticle nicking enzymes to the liquid stage of the âliquid treatmentâ. 5 ml enzyme reaction mixture (0.25 ml 10% fungal mix of pectin and cutinase enzyme (BSG HandCraft Liquid Pectic Enzyme; CutinaseâSigma, Ferdinand Maria Quincy 0.25 ml 200 mM Tris-HCl) was added to 5 ml liquid media. Plants were incubated for 30 min in 30° C., then transferred to fresh liquid media.
The same medium was used for liquid and solid culturing.
| TABLE 2 |
| The different Proliferation media (PR), used for Cannabis tissue culture in this study |
| Ingredients | PR13 | PR12 | PR 11 | PR 11 + PG | PR14 | PR 18A | PR 18B | PR 18C |
| MS | 1 MS 0222 | 1 MS 0222 | 1 MS 0221 | 1 MS 0222 | 1 MS B5 | 1 MS 0222 | 1 MS 0222 | 1 MS 0222 |
| MS vitamins | 1 | ml/l |
| Sugar | 2% | 2% | 3% | 3% | 3% | 3% | 3% | 3% |
| BA | 2 mg/l | 2 mg/l | 1 | mg/l | 1 | mg/l | 0.25 | mg/l |
| TDZ | 0.11 mg/l | 0.11 | mg/l |
| Zeatin | 2 mg/l |
| NAA | 1 | mg/l |
| IBA | 0.2 | mg/l | 0.2 | mg/l | 0.05 | mg/l | 0.5 | mg/1 |
| GA3 | 1 mg/l | 1 mg/l | 0.05 | mg/l | 0.05 | mg/l | 0.1 | mg/l | 2.4 | mg/l | 0.2 | mg/1 |
| thiamine-HCl | 0.5 | mg/l | 0.5 | mg/l |
| Myo-inositol | 100 | mg/1 | 100 | mg/l | 100 | mg/l | 0.5 | mg/1 |
| Phlorpglucinol | 89 | mg/l | 100 | mg/1 |
| Activated | 500 | mg/l | |||||||
| Charcoal |
| Agar | 0.8% | 0.8% | 0.8% | 0.8% | 0.8% | 0.8% | 0.8% | 0.8% |
| SigmaAgar | S igmaAgar | SigmaAgar | SigmaAgar | SigmaAgar | gelrite | gelrite | gelrite | |
| PH | 5.8 | 5.8 | 5.7 | 5.7 | 5.8 | 5.8 | 5.8 | 5.8 |
Rooting and Acclimatization
Rooting and acclimatization experiments were carried out initially with Cannabis cultivars 213 and 108.
Shoot was cultivated individually in a tube with root induction (RI) medium composed of half strength MS medium (œMS) supplemented with 100 mg/l myo-inositol, 1 mg/l thiamine-HCl, 90 mg/l phloroglucinol, 2% sucrose (w/v), 0.25% activated charcoal (AC), with or without IBA (at different concentrations (0, 1, 2 mg/1) and 0.8% agar. Soil mixture was moistened by soaking the rooting cylinders in liquid RI medium supplemented with either 0, 1, or 2 mg/l IBA. Each treatment consisted of 10 shoots and results were scored after 4 weeks. Each experiment was repeated three times.
Results
Effect of Cuticle Necking Enzymes and Transfer of Plants from Solid to the Liquid Medium on Proliferation of Cannabis Tissue Culture
A tissue culture protocol was established for 10 different Cannabis cultivars representing a wide range of genetic diversity (FIG. 1). Several proliferation (PR) media were tested to determine the optimal medium for each cultivar based on their growth rate after 1-3 months (Table 2). Results are shown in FIG. 2.
Further analysis of the tissue culture showed a decline in the growth rate after 6 growth cycles probably because of limited ingredients uptake (FIG. 3A). In order to increase cannabis plant permeability a protocol for âliquid treatmentâ was developed in which the tissue culture was transferred from solid to liquid media every 3-4 weeks, and as a result significantly improved their growth and development (FIGS. 3B-C).
To further increase plant permeability, the âliquid treatmentâ was supplemented by adding several sublethal cuticle nicking enzymes to the liquid stage with the aim of creating cracks in the plant cuticle. Pectin and cutinases are extracellular enzymes catalyzing the hydrolysis of the polyesters of the cuticle and the suberin layers, which protect plant surfaces. A protocol referred to as âpremium liquid treatmentâ refers to the presence of cell wall degrading enzymes (Table 3, FIG. 4).
| TABLE 3 |
| Tissue culture response to âpremium liquid treatmentâ. Growth |
| rate was measured from 1 (growth arrest) to 5 (rapid growth). |
| Cultivar | Cultivar | Cultivar | Cultivar | Cultivar | Cultivar | Cultivar | Cultivar | Cultivar | Cultivar | |
| 201 | 202 | 206 | 207 | 208 | 209 | 212 | 213 | 106 | 108 | |
| Liquid | 3 | 4 | 3 | 2 | 3 | 3 | 2 | 1 | 3 | 2 |
| media | ||||||||||
| Liquid | 4 | 5 | 5 | 5 | 4 | 4 | 5 | 5 | 4 | 5 |
| media | ||||||||||
| with | ||||||||||
| pectic | ||||||||||
| Enzymes | ||||||||||
| Liquid | 4 | 5 | 5 | 5 | 5 | 4 | 4 | 5 | 3 | 5 |
| media | ||||||||||
| with | ||||||||||
| cutinases | ||||||||||
| enzymes | ||||||||||
| Solid | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 |
| medium | ||||||||||
| after | ||||||||||
| âpremium | ||||||||||
| liquid | ||||||||||
| treatmentâ | ||||||||||
The combined liquid media with sublethal cuticle nicking enzymes and plant surfactants (âpremium liquid treatmentâ) increased plant growth and development in a significant manner. Moreover, the change in the cannabis cultivars surface permeability lasted even when the plants were sub-cultured again on solid medium (FIG. 4).
Rooting and Acclimatization
To obtain root induction, different concentrations of IBA were examined. The shoots were placed in a tube containing rooting medium containing 0, 1, or 2 mg/l IBA. Using this method with 2 mg/l IBA, about 85% of the shoots formed roots. However, only low percentage of these plants successfully acclimatized under greenhouse conditions. According to the second approach, shoots were cultured directly in rooting cylinders. After 4 weeks, 100% root formation was achieved, independently of the concentration of auxin used (FIGS. 5A-C). These plants had better hardening and underwent easier acclimatization in greenhouse conditions. In-vitro clonal propagation, rooting and acclimatized plantlet production was established for 10 different Cannabis cultivars. According to an embodiment of the invention, the procedure requires a 50-70 days cycle for the In-vitro clonal propagation (20 days for shoot multiplication and 30 days for root induction) which includes 15-30 days for acclimatized plantlet production.
The development of new Cannabis cultivars with improved traits could be facilitated through the application of biotechnological strategies. The purpose of this study was to establish efficient regeneration of Cannabis in tissue culture and to establish a protocol for Agrobacterium-mediated transformation for foreign gene introduction.
Induction of high-frequency shoot regeneration using nodal segments containing axillary buds from tissue culture plants of Cannabis sativa was achieved on premium treatment media with cuticle nicking enzymes, added to Murashige and Skoog (MS) medium salt mixture, containing 0.05-5.0 ÎŒM thidiazuron, supplemented with 100 mg/l myo-inositol, 1 mg/l thiamine-HCl, 2% sucrose (w/v) at pH 5.7) with 5 ml cuticle nicking enzymes reaction mixture (0.25 ml 10% enzyme, fungal mix of pectin and cutinase (BSG HandCraft Liquid Pectic Enzyme; CutinaseâSigma, Ferdinand Maria Quincy 0.25 ml 200 mM Tris-HCl). The quality and quantity of regenerates were better with media treatment with cuticle nicking enzymes and thidiazuron (0.5 ÎŒM thidiazuron). Adding 7.0 ÎŒM of gibberellic acid into a medium containing 0.5 ÎŒM thidiazuron slightly increased shoot growth. Stem and leaf segments from seedlings and tissue culture of four Cannabis varieties were placed on Murashige and Skoog medium with Gamborg B5 vitamins (MB) supplemented with different combination of plant growth regulators and 3% sucrose, and 8 g 121 agar. Large masses of callus were produced within 4 weeks for all cultivars. Transformation with Agrobacterium tumefaciens strain EHA105 harboring the vector pME 504 carrying the nptII and the uidA-intron genes for Cannabis callus, hypocotyls, leaves and cotyledons were established.
Regeneration Using Premium Treatment
Regeneration from Cannabis plant material using tissue culture, germinated leaves, cotyledons and hypocotyls were used for regeneration. The plants were placed on a petri dish containing 20 ml regeneration media using premium treatment with cuticle nicking enzymes: MS salt mixture, supplemented with 100 mg/l myo-inositol, 1 mg/l thiamine-HCl, 2% sucrose (w/v) at pH 5.7) with and without 5 ml pectic enzymes reaction mixture (0.25 ml 10% enzyme fungal mix of pectin and cutinase 0.25 ml 200 mM Tris-HCl).
Regeneration from Leaves
Three youngest expanding leaves isolated from 3 to 4 weeks old plants were with and placed on regeneration medium with cuticle nicking enzymes (Murashige and Skoog (MS) medium salt mixture, containing 0.05-5.0 ΌM thidiazuron, supplemented with 100 mg/l myo-inositol, 1 mg/l thiamine-HCl, 2% sucrose (w/v) at pH 5.7, with 5 ml pectic enzymes reaction mixture (0.25 ml 10% cuticle nicking enzyme in 0.25 ml 200 mM Tris-HCl). The cultures were kept for 7 days in low light intensity (2.5 mmol/m2 s) followed by exposure to high light intensity (40 mmol/m2 s) at 25° C., in a 16/8 h photoperiod. Leaf explants were examined after 14 and 21 days and the percentage of explant producing shoots were calculated.
Regeneration from Cotyledon
Seeds were washed under abundant water flow for 2 h, and then washed in ethanol 70% for 10 secs prior to 20 min wash in 1.5% NaClO with 0.1% Tween 20. Seeds washed 4 times in distilled water and set onto a sterile growth medium (œMS, 2% Sucrose, 0.8% agar). Seeds were germinated in the dark for 2 days and were then transferred to light. Two weeks later, cotyledon from large seedlings that contained two true leaves were cut and placed on regeneration medium with cuticle nicking enzymes (Murashige and Skoog (MS) medium salt mixture, containing 0.05-5.0 ΌM thidiazuron, supplemented with 100 mg/l myo-inositol, 1 mg/l thiamine-HCl, 2% sucrose (w/v) at pH 5.7, with 5 ml pectic enzymes reaction mixture (0.25 ml 10% enzyme, 0.25 ml 200 mM Tris-HCl). The cultures were kept in high light intensity (40 mmol/m2 s) at 25° C., in a 16/8 h photoperiod.
Regeneration from Callus
21 days old tissue culture were placed on PR12 solid media (MS, 2% sucrose, 2 mg/l BA, 1 mg/l GA3, 0.8 sigma agar, pH 5.8) to encourage the creation of callus. Two weeks later, calli were replaced on regeneration medium with cuticle nicking enzymes (Murashige and Skoog (MS) medium salt mixture, containing 0.05-5.0 ÎŒM thidiazuron, supplemented with 100 mg/l myo-inositol, 1 mg/l thiamine-HCl, 2% sucrose (w/v) at pH 5.7, with 5 ml pectic enzymes reaction mixture (0.25 ml 10% enzyme, 0.25 ml 200 mM Tris-HCl). The cultures were kept in high light intensity (40 mmol/m2 s) at 25 8 C, in a 16/8 h photoperiod.
Agrobacterium tumefaciens Strain and Plasmid
The super-virulent Agrobacterium tumefaciens strain EHA 105 harboring the vector pME 504 carrying the nptII and the uidA-intron genes was used. An Agrobacterium culture was grown overnight in LB medium with appropriate antibiotics. Bacteria were spun down by centrifugation (4000 rpm for 15 min), resuspended in liquid SIM medium supplemented with 100 ΌM Acetosyringone (AS) to obtain a final OD600 of 0.7, and incubated in an orbital shaker at 28° C. and 250 rpm for 4 h.
Cannabis Transformation
Leaves of 3-4 weeks old micropropagated shoots were wounded and immersed in the bacterial suspension for 20 min, dry-blotted on a filter paper and cultured on regeneration medium using the premium treatment with sublethal cuticle nicking enzymes based on MS salt mixture, supplemented with 2.0 mg/l TDZ and 2 mg/l IBA, 100 mg/l myo-inositol, 1 mg/l thiamine-HCl, 2% sucrose (w/v) at pH 5.7) whit 5 ml pectic enzymes reaction mixture (0.25 ml 10% enzyme, 0.25 ml 200 mM Tris-HCl). Transformation was evaluated by GUS staining.
GUS Staining
Fresh plant material was transferred to a histochemical reagent (1.1 mM X-Gluc in 100 mM potassium phosphate buffer pH 7.0: 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide and 0.1% Triton X-100) and incubated for one hour to overnight at 37° C. After staining, the disks were transferred to 70% ethanol for 1 h to overnight until bleached.
Molecular Confirmation of Transformation
To verify the presence and integration of the nptII and GUS genes, all selected clones were subjected to molecular analyses by PCR. Plant genomic DNA was isolated from leaves according to Murray. M. G, and W. Fm Thompson. âRapid isolation of high molecular weight plant DNA.â Nucleic acids research 8.19 (1980): 4321-4326.
The oligonucleotide primers used for the PCR amplification of a 645 bp fragment of the nptII gene were:
| Directâprimer |
| (SEQâIDâNO:â12) |
| 5âČ-GCCâGCTâTGGâGTGâGAGâAGGâCTAâT-3âČâ(63.6°âC.); |
| Reverseâprimer |
| (SEQâIDâNO:â13) |
| 5âČ-GAGâGAAâGCGâGTCâAGCâCCAâTTC-3âČâ(60°âC.). |
| GUSup |
| (SEQâIDâNO:â14) |
| 5âČ-CGAâGCGâATTâTGGâTCAâTGTâGAAâG-3âČâ(57.5°âC.); |
| GUSlowâprimer |
| (SEQâIDâNO:â15) |
| 5âČ-CATâTGTâTTGâCCTâCCCâTGCâTGCâGGTâT-3âČâ(55.9°âC.) |
| (Sigma). |
Amplification was performed in aliquots of 25 Όl using a thermal cycler (Biometra). The PCR conditions for amplification of the nptII gene fragment were 95° C. for 5 min, followed by 35 cycles at 94° C. for 1 min, 62° C. for 1 min, 72° C. for 1 min, and a final extension at 72° C. for 10 min. Amplification of the uidA-intron fragment was performed according to the following program: 95° C. for 5 min followed by 35 cycles at 94° C. for 45 s, 55° C. for 45 s, 72° C. for 45 s, and a final extension at 72° C. for 10 min.
Results
The âRegeneration Premium treatmentâ with cuticle nicking enzymes increased Cannabis regeneration rate. In preliminary experiments, about 5 to 10% of the explants exhibited shoot regeneration when cultured on a regeneration medium supplemented with hormones.
In order to increase plant regeneration rate a âregeneration premium treatmentâ was added including the addition of cuticle nicking enzymes to the solid medium. âRegeneration Premium treatmentâ increased plant regeneration ten times more compared with non-treated plants in all the tested cultivars (Table 4).
| TABLE 4 |
| The effect of hormones concentration and âregeneration premium treatmentâ |
| on shoot regeneration of several cannabis lines (% regeneration) |
| Cultivar | Cultivar | Cultivar | Cultivar | Cultivar | Cultivar | Cultivar | Cultivar | |
| 201 | 202 | 208 | 209 | 212 | 213 | 106 | 108 | |
| MS | 5 | 3 | 4 | 5 | 8 | 9 | 11 | 22 |
| regeneration | ||||||||
| medium | ||||||||
| MS | 46 | 61 | 55 | 49 | 50 | 57 | 61 | 52 |
| regeneration | ||||||||
| medium + | ||||||||
| Pectic | ||||||||
| Enzymes | ||||||||
| MS | 53 | 66 | 60 | 49 | 55 | 60 | 75 | 70 |
| regeneration | ||||||||
| medium + | ||||||||
| Pectic | ||||||||
| Enzymes + | ||||||||
| Triton | ||||||||
| X-100 + s | ||||||||
The âpremium treatmentâ enhanced cannabis regeneration from different plant organs: plant cotyledons, callus and leaves (FIG. 4).
Transformation
The present study describes the successful transformation of several cannabis cultivars using the uidA-intron and nptII genes. An efficient transient transformation of leaves, hypocotyls, callus and cotyledons of several Cannabis cultivars was observed (FIG. 7 upper panel). Transformation of the selected clones has been confirmed by GUS histochemical assay and molecular analysis. Positive PCR was shown in all tested clones (FIG. 7, lower panel). The transformation was confirmed by GUS staining and PCR. Stable transformation is tested by subcultures of the plants in selective conditions of 100 mg 1-1 kanamycin.
Alternate methods that avoid/minimize tissue culture would be beneficial for the development of new transgenic Cannabis cultivars. Transgenic Cannabis plants have been produced by a tissue-culture independent Agrobacterium tumefaciens-mediated transformation procedure. One of the two cotyledons of germinated Cannabis seedlings was excised. Unique regeneration method using plant hormones in a nano-encapsulation paste were introduced to the excised apical meristem of the germinating seedling. Regeneration of more than 80% of the germinating seedlings was obtained. A similar regeneration ratio was achieved with adult Cannabis plants of three different cultivars, suggesting that the nano encapsulation paste induces efficient regeneration. Agrobacterium strain EHA 105 harboring the binary vector pME504 that carries the genes for ÎČ-glucuronidase (GUS) and neomycin phosphotransferase (npt II), or the plasmid carrying the nptII and betalain genes (Polturak. Guy, et al. âEngineered gray mold resistance, antioxidant capacity, and pigmentation in betalain-producing crops and ornamentals.â Proceedings of the National Academy of Sciences (2017): 201707176).
For in planta transformation, Agrobacterium strain EHA 105 harboring the different binary plasmids was mixed with the emulsifier paste to enhance attachment to the cut plant surface. The proof of transformability in the TO generation was indicated by the GUS histochemical analysis of the seedlings (wounded seedlings with the single cotyledon) ten days after co-cultivation and was further confirmed by PCR analysis and typical betalains red leaves expression. Molecular characterization and GUS and betalains expression analysis were done using PCR.
Materials and Methods
Plant Material
SeedsâCannabis Sativa L. seeds (from various cultivars) were surface sterilized with 1.5% sodium hypo chloric acid followed by several washes with sterile water. Seeds were germinated on sterile, wet, filter paper disks until visible root emergence.
Seedlingsâseeds were germinated in solid media (soil, vermiculite, MS, etc.) until first two true leaves were observed (between 2-4 true leaves).
Plantsâseeds were allowed to germinate and grow to a size when at list two nodes were observed.
âPre-Regeneration Tissue Preparationâ
One cotyledon and the meristem with its leaves were cut off from the seedlings at 145°, leaving the seedling with only one cotyledon. Plants were allowed to grow until at least 2 nodes were apparent, then the shoot was cut off from lowest leaf at 145°, leaving the plant with only one leaf.
âRegeneration Pasteâ
Several hormonal combinations sets were made and applied to cut seedlings and cut plants by spraying or by ALGANATEâą nanoemulsion paste prepared according to Pereira et al., 2017 (Colloids and surfaces B: Biointerfaces 150:141-152); different cytokinins and auxin hormones combinations in various concentrations were mixed with nanoemulsion (usually 3:4 v/v) to create a âregeneration pasteâ. The paste was spread on the wounded cuttings
Imaging for the Detection of in Planta Regeneration
Scanning Electron Microscopy
Scanning Electron Microscopy was done with a Hitachi TM-3030Plus microscope. Imaging was done under low vacuum conditions without any sample preparation.
Histology
The tissue was fixed in 10% Formalin, 5% acetic acid and 50% alcohol (FAA) for 24 h, followed by gradual dehydration in a set of increasing concentrations of ethanol, which was replaced by Histo-Clear and embedded in paraffin. The embedded tissue was cut to 10 ÎŒm sections using a Lecica RM2245 microtome and stained with Safranin/Fast Green. Samples were viewed using light microscope (DMLB, Leica) or stereoscope (MZFLIII, Leica).
Agrobacterium tumefaciens Strain and Plasmid
Super-virulent A. tumefaciens strain EHA105 harboring the vector pME 504 carrying the uidA-intron reporter gene and the nptII resistant genes or the vector pX11 carrying the nptII and betalain genes were used. See also Poluraka et al. PNAS Aug. 22, 2017. 114 (34) 9062-9067;
Bacteria were spun down by centrifugation (8000 g for 10 min). Bacteria were re-suspended in a transformation buffer (1 MS, 5.86 g/l MES, 1% sucrose, pH 7.0) with 100 mg/l acetosyringone, to obtain a final OD600 of 0.6, and incubated in an orbital shaker at 28° C. while shaking at 250 rpm for 3 h until plant infection.
Plant material (micropropagated shoots from tissue culture, seedling or seeds) were vacuum infiltrated for 5 min in a vacuum desiccator. The infiltration followed by co-cultivation with the agrobacterium for 30 min at R.T, then transferred for further growth on infection medium.
Pre-Transformation Tissue Preparation
Prior to agrobacterium transformation, all tissues were mechanically treated; seeds were cut, pressed or punched with the root remaining intact. One cotyledon and the meristem with its leaves were cut off from the seedlings at 145°, leaving the seedling with only one cotyledon. Plants were allowed to grow until at least 2 nodes were apparent, then the shoot was cut off from the lowest leaf at 145°, leaving the plant with only one leaf.
Agro Mediated Transformation
Binary plasmids for various genetic modification purposes were introduced into Agrobacterium tumefaciens. Agrobacterium was applied to the tissue in different ways; a. dipping, b. microencapsulation, c. injecting and d. dripping. In any case, agrobacterium comprising the desired plasmid was grown in the presence of selective antibiotics which were later replaced by an activation medium. In case of dipping, treated seeds or seedlings were co-cultivated with the bacteria for 2 min to several hours. When microencapsulation was applied, several activating media were tested: MSO, half MSO, SIM and CT.
Microencapsulation Transformation
Agrobacterium was grown and activated as described in materials and methods, and then it was mixed with lanolin nano-emulsifier (according to Zhang et al 2014 (Nanotechnology, 25(12), 125101) usually at 3:4 (v/v) ratio. The resultant paste was spread on the cutting up to 24 h after performance of the cut.
GUS Staining
A fresh plant material was transferred to a histochemical reagent (1.1 mM X-Gluc in 100 mM potassium phosphate buffer pH 7.0: 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide and 0.1% Triton X-100) and incubated for one hour to overnight at 37° C. After staining, the disks were transferred to 70% ethanol for 1 h to overnight until bleached.
Betalains Separation
For betalains observation, fresh tissue (0.5 g) was ground in the presence of CTAB buffer (3% CTAB, 28% NaCl, 4% EDTA, 10% Tris HCl, 3% PVP and 25% water), mixed with chloroform and centrifuged.
Results
In Planta Regeneration Using a Regeneration Paste
Genetic modifications (i.e. genome editing, gene transfer, etc.â) require a platform for introducing those modifications into the plant cells and an efficient method for regenerating the modified cells only to get a new, modified plant. In many cases, this could be the bottleneck for establishing an efficient transformation protocol. Development of an in planta transformation protocol may eliminate the use of tissue culture.
Seedlings were germinated in solid media, when first two leaves were observed (FIGS. 8A-B) the meristem with its leaves and one of the cotyledons was removed (FIGS. 8A-D). The wounded tissue was spread with the regeneration paste. The seedlings were left to grow at 16 h light and after 7 days regeneration from around the cut area was observed (FIGS. 8E-F). After 7 days regeneration events were observed and after 12 days seedlings were evaluated for different events as shown in Table 5 below.
Young 3-5 weeks old Cannabis plants immerging from cuttings were left to grow until at list two nodes were observed, then the stem was cut at the same way the seedlings were, leaving only one leaf. The wound was spread with the regeneration paste and the plants were left at 16 h light, allowing the plant to regenerate (FIG. 9).
| TABLE 5 |
| The effects of different hormones by spreading the âregeneration pasteâ on various cannabis strains: |
| recovery from injury is indicated as recovery percentage. R(regenerate), M(meristem), C(callus), N(no change). |
| t005 | t006 | t009 | ||||||||
| Spreading | Spreading | Spreading | t010 | |||||||
| t001 | t002 | t003 | t004 | 400 mg/l | 100 mg/l | t007 | t008 | 500 mg/l | Spreading | |
| Spreading | Spreading | Spreading | Spreading | BAP | ZEATIN | Spreading | Spreading | ZEATIN + | MS 0222 | |
| Treatment | 4000 mg/l | 2000 mg/l | 50 mg/l | 50 mg/l | 50 mg/l | 50 mg/l | 1000 mg/l | 2000 mg/l | 1000 mg/l | 2 mg/l TDZ |
| cultivar | BAP | BAP | BAP | BAP | IBA | IBA | ZEATIN | ZEATIN | IAA | 2 mg/l IBA |
| #102 | â„70% | â„70% | 10% | â„70% | â„70% | â„70% | Not tasted | Not tasted | Not tasted | â„70% |
| Mortality | Mortality | recovery | Mortality | Mortality | Mortality | Mortality | ||||
| 3% M | ||||||||||
| 97%N | ||||||||||
| #106 | Not tasted | Not tasted | Not tasted | Not tasted | 50% | 75% | Not tasted | Not tasted | Not tasted | 50% |
| recovery | recovery | recovery | ||||||||
| 10% M | 45% R | 40% R | ||||||||
| 35% R | 15% M | 30% M | ||||||||
| 55% N | 30% C | 25% C | ||||||||
| 10% N | 5% N | |||||||||
| #107 | Not tasted | Not tasted | Not tasted | Not tasted | 50% | 50% | Not tasted | Not tasted | Not tasted | 25% |
| recovery | recovery | recovery | ||||||||
| 55% R | 50% R | 100% N | ||||||||
| 37% C | 20% C | |||||||||
| 8% N | 30% N | |||||||||
| #108 | Not tasted | Not tasted | Not tasted | 72% | Not | Not tasted | 80% | 80% | 80% | Not tasted |
| recovery | tasted | recovery | recovery | recovery | ||||||
| 9% R | 71% R | 30% R | 8% R | |||||||
| 6% M | 7% M | 30% M | 28% M | |||||||
| 85% N | 22% N | 40% N | 60% C | |||||||
| 4% N | ||||||||||
In planta Agrobacterium application is complicated due to poor attachment of the bacteria to the wounding area. For in planta transformation, Agrobacterium strain EHA 105 harboring the different binary plasmids were mixed with emulsifier paste to enhance attachment to the cut plant surface. Agrobacterium was grown and activated as described in materials and methods, and then it was mixed with lanolin nano-emulsifier usually at 3:4 (v/v) ratio. The resultant paste was spread on the cutting up to 24 h after the wounding. Agrobacterium strain EHA 105 harboring the binary vector pME504 that carries the genes for ÎČ-glucuronidase (GUS) and neomycin phosphotransferase (npt II), or the plasmid pX11 carrying the nptII and betalain genes were used for transformation. The proof of transformability in the TO generation was indicated by the GUS histochemical analysis of the seedlings, ten days after co-cultivation and was further confirmed by PCR analysis and typical betalains red leaf expression (FIGS. 10A-C to 11A-C). Molecular characterization and GUS and betalains expression analysis were done using PCR (FIGS. 10A-C to 11A-C).
Materials and Methods
Leaf segments from tissue culture grown on the solid medium (1.5 cm diameter and 4-5 cm long) of two Cannabis cultivars (108 and 201) were used. Innermost leaf whorls were cut obliquely (0.5-1.0 cm), injured with sharp scalpel blade in order to achieve callus initiation. Leaf segment, were used as explant for inoculation on MS medium (Murashige and Skoog 1962) supplemented with 2,4-D (4.0 mg/L) and kinetin [Kin] (0.5 mg/L). After 2-3 weeks the cultures were incubated at 25±2 C at 70-80% humidity in dark in liquid Gamborg B5 medium supplemented with 6% sucrose and different plant hormones (Table 1). The media was refreshed every three weeks.
Leaf segments from tissue culture from two different genotypes (108 and 201) have been used as primary explants. The explants were chopped to small pieces (as less as 0.5 mm) and cultivated in liquid Gamborg B5 medium supplemented with 6% sucrose and different plant hormones (Table 1). The media were refreshed every three weeks.
Results
Cannabis sativa Micropropagation Via Somatic EmbryogenesisâEffect of Cannabidiol (CBD) with CPPU Microemulsion
The first globular shaped embryos were observed 4 weeks after initiation.
CPPU (at a concentration of 10 mg/1) alone or as a CBD-CPPU microemulsion was essential for the embryo initiation. Low amounts of embryos were generated in media with 2iPâ3 mg/l CPPU but the addition of the CBD-CPPU microemulsion dramatically increased somatic embryogenesis. The embryos were cultivated on gyratory shaker at dark.
| TABLE 6 |
| Type of the hormones used in Somatic embryo |
| initiation in cannabis explants: |
| Hormone | Concentration [mg/l] | |
| CBD-CPPU | 10 | |
| CPPU | 10 | |
| 2.4D | ||
| 2iP | 3 | |
| Kinetin | 2 | |
| Zeatin | 1 | |
| TDZ | 2 | |
| Picloram | 12.5 | |
| Dihydric zeatin | 2 | |
| Kinetin ribosid | 2 | |
| BAP | 1 | |
The initiated suspension cultures along with embryos in globular stage (FIGS. 12A-B) were sub-cultured in the same medium for three weeks. Part of the cultures was transferred to B5 Gamborg media, supplemented with different hormones/chemicals (Table 2) to provoke embryo elongation and further development. The cultures were transferred to fresh media every three weeks.
| TABLE 7 |
| Different supplements were used in |
| hemp somatic embryo development: |
| Supplements to B5 media | Concentration | |
| for E development | [mg/l] | |
| CPPU | 10 | |
| CPPU | 20 | |
| CPPU and 6% sucrose | 10 | |
| (instead of 3%) | ||
| CPPU and 6% sucrose | 20 | |
| (instead of 3%) | ||
| CBD-CPPU and 6% sucrose | 20 | |
| (instead of 3%) | ||
| 2iP | 3 | |
| TDZ/Piclorame | 2/12.5 | |
| PEG 4000 | 1% | |
Some of the somatic embryos after the second sub-culture on B5 media, supplemented with CBD-CPPU and 6% sucrose (instead of 3%) underwent to torpedo shaped embryos.
With some of the torpedo shaped embryos, after the third subculture on B5 media supplemented with CBD-CPPU and 6% sucrose, plants regeneration occurred in the liquid media (FIGS. 13A-C).
Protoplasts were successfully isolated in all tested Cannabis cultivars. The combination and concentration of the enzymes, as well as the time for treatment were optimized. Presence and optionally concentration (0.5 M) of mannitol were important for protoplast culture. About 4% of the protoplasts survived after 48 hours cultivation in liquid culture. Some of the protoplasts developed cell wallâless than 1%. Protoplast transformation was also established.
Material and Methods
Protoplast Isolation
Seeds were sterilized with 1.5% sodium hypochlorite for 20 min, followed by a series of washes with sterile water. Seeds were left to germinate on sterile MS media and cotyledons were harvested when emerged. Cotyledons were cut to fine pieces and incubated in a cell wall degrading solution containing 1.5% cellulose, 0.5% macerozyme, 0.4% mannitol, 20 mM KCl, 20 mM MES, 10 mM CaCl2 and 0.1% BSA, placed in vacuum for 10 min and then shaken for 5 h at 50 rpm. The protoplasts were then filtered through a 100 ÎŒm mesh, diluted with 1 volume of W5 (150 mM NaCl, 125 mM CaCl2, 5 mM KCl, and 2 mM MES) and pelleted by centrifugation (Room temperature, 2 min at 300 g). The protoplasts were re-suspended in W5 solution and incubated for 30 min on ice, before being centrifuged again and re-suspended in 100 ÎŒl of MMg solution containing, 0.4 M mannitol and 15 mM MgCl2.
Protoplast Transformation
Red fluorescent protein (RFP), a visual marker, in plasmid DNA (5-20 ÎŒg) was added to protoplasts and an equal volume of 40% PEG solution (in 0.2 M mannitol and 0.1 M CaCl2). The mixture was incubated for 15-30 min. Two volumes of W5 were added to each sample, centrifuged for 2 min, re-suspended in 1 ml of W5, and then incubated at room temperature for 16-24 hr.
Results
Three different combinations of enzymes (Table 8) were tested for the ability to isolate protoplasts from three cultivars of Cannabis sativa (cultivar 1, 2, 3 are 201, 202, 203). Leaf explants were enzymatically treated either for 4 hours or for 17 hours. Only one of the enzyme's combinationâenzyme mix C, was efficient (FIG. 14). Protoplasts were isolated from all three tested cultivars. The cultivars were differing in the yield of the protoplasts (FIG. 14). Maximum protoplasts were harvested from cannabis cultivar 1 (Protoplast concentration was 2.2Ă106/ml). The protocol for protoplasts isolation was optimized regarding the medium compositionâconcentrations of Mannitol, CaCl2 and PVP pretreatment. The isolated protoplasts (FIGS. 15A-B) were filtered through a 100 ÎŒm mesh, diluted with 1 volume of W5 (150 mM NaCl, 125 mM CaCl2, 5 mM KCl, and 2 mM MES) and pelleted by centrifugation. Purified protoplasts were cultivated under dark condition in droplets double layer (liquid/solid) culture.
| TABLE 8 |
| Combination of enzymes used in hemp protoplasts |
| A | Cellulisine - 4% | |
| Driselase - 0.3% | ||
| B | Cellulose Onozuka R-10 - 2% | |
| Hemicellulose - 1% | ||
| Driselase - 0.3% | ||
| C | Cellulose Onozuka R-10 - 1.5% | |
| Hemicellulose - 1% | ||
| Macerozyme R-10 - 0.4% | ||
Protoplast Transformation
As mentioned above, an efficient cannabis protoplast isolation protocol was developed using different plant tissues. FIG. 16 shows protoplast transformation using the RFP gene (Chung, Sang-Min, Ellen L. Frankman, and Tzvi Tzfira. âA versatile vector system for multiple gene expression in plants.â Trends in plant science 10.8 (2005): 357-361).).
This protoplast isolation protocol allowed protoplast isolation from 10 different cannabis strains that were clonally propagated in culture.
Cannabis pollen transformation Most of the current transformation methods require plant regeneration from tissue culture, involving long and laborious processes. In order to overcome the constraints of in-vitro tissue culture regeneration, pollen-mediated transformation methods are considered to be promising alternatives. Pollen release active DNA to the ovary during pollination and fertilization. Transgenic seeds can be directly generated through pollination with exogenous DNA-transformed pollen. In pollen magnetofection technology, positively charged, polyethyleneimine-coated Fe3O4 MNPs (Magnetic Nano Particles) are used as DNA carriers for binding and condensing with electric negative DNA to form MNP-DNA complexes. Here is shown for the first time positive Cannabis pollen transformation using the GUS reporter gene, by employing the magnetofection technology.
Material and Methods
Plasmid
For Cannabis pollen transformation, the binary vector CsUBQ::GUS was used. The plasmid carries the GUS reporter gene under the Cannabis Sativa UBQ 10 promoter.
Pollen
Pollen collected from four different samples in two replicates was used:
1. Fresh, âmalenizedâ from genotype 213;
2. One-month-old, âmalenizedâ from genotype 212;
3. Two-month-old, male from genotype 108;
4. Two-month-old, âmalenizedâ from genotype 216;
Samples were tested for viability prior to transformation.
Transformation
1 ug of plasmid was left to bind with MNP's (MAGBIO, USA) for 30 min at room temperature, prior to adding the transformation media: 10 gâ40 g Sucrose, H3BO3â10.3 mg, KNO3â2.3 mg, Ca(NO3)2â10.3 mg, MnSO4â10.3 mg, MgSO4 7H2Oâ10.3 mg, GA3â3 mg, H2O up to 100 ml.
Pollen (1-10 million grains) added to the Media containing bound MNP'sâplasmid and left on a magnet (Chemicell) for 30 min at room temp and dried in 30° C. for 30 min.
Results
Cannabis pollen characteristics and imaging. Cannabis is wind pollinated and therefore, its pollen grain diameter is about 25 um and there are about half million grains per 1 mg of pollen (data not shown). Cannabis pollen was examined under light microscope in the presence of Safranine 0 (FIG. 17A) and it clearly shows apertures where the pollen wall is absent or reduced Pollen viability was confirmed by incubating pollen grains on germination media and after 18 h pollen tubes were observed (FIG. 17B).
Exogenous Gene Expression in Cannabis Pollen
In order to test whether exogenous genes can be expressed in pollen, a reporter gene in CsUBQ::GUS plasmid was transformed into cannabis pollen using the MNPs. If the GUS gene is successfully transformed, the GUS protein (ÎČ-Glucuronidase) will be expressed, which can then be stained blue by X-gluc solution. Optical microscopy showed that pollen grains were stained blue by X-gluc, suggesting that MNP-DNA complexes did not inhibit transformation function and that the GUS gene was indeed successfully transformed and expressed (FIG. 17C).
In order to identify the homologous genes of the BBM and SERK1 genes in Cannabis, blast analysis was performed using the Arabidopsis BBM and SERK1 genes (SEQ ID NOs: 3 and 7) as a bait. The sequences of the genes that show the highest homology to these genes are shown in FIG. 18. To isolate the CsBBM and CsSERK1 genes, total RNA was extracted from Cannabis calli, followed by cDNA synthesis. Then, candidate genes were isolated from cDNA generated out of RNA from regenerating Cannabis callus using the primers 5âČ ATGAGTATTATTACTAATGATAGTAATCTCAG3âČ (SEQ ID NO: 16) and TTATTCCATGCCGAATATTGGTGTT3âČ (SEQ ID NO: 17) for CsBBM, and 5âČ ATGGAAGGTGATGCCTTGCATAGTC3 (SEQ ID NO: 18) and 5âČTTACCITCGGACCAGATAACTCGACC3âČ (SEQ ID NO: 19) for CsSERK1.
These cDNA were amplified using specific primers for the CsBBM and CsSERK1 genes and cloned into pCAMBIA binary vectors under the control of a constitutive 35S promoter and fused to an expression cassette of the CAS9 gene, under the control of the CsUBIQUITIN10 promoter (SEQ ID NO: 11, FIG. 19).
Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.
In addition, any priority document(s) of this application is/are hereby incorporated herein by reference in its/their entirety.
1. A method of in-vitro propagating cannabis, the method comprising:
(a) culturing a cannabis plant part comprising a meristem on a solid culture medium so as to obtain an explant; and subsequently
(b) subjecting said explant to a cell wall disrupting agent;
(c) culturing said explant in a liquid medium; and optionally subsequently wherein steps (a)-(c) are effected for 1 to n times until emergence of leaves suitable for regeneration.
2. The method of claim 1, further comprising sterilizing said explant prior to (a).
3. The method of claim 1, wherein said liquid medium comprises said cell wall disrupting agent.
4. The method of claim 1, wherein said step (c) is performed while shaking.
5. The method of claim 1, wherein step (a) is performed for 7-30 days.
6. The method of claim 1, wherein step (c) is performed for 5-30 days.
7. The method of claim 1, wherein said meristem is an apical meristem or an axillary meristem.
8. The method of claim 1, wherein said explant comprising said meristem is of a stem.
9. The method of claim 1, wherein said explant is from a seedling.
10. The method of claim 1, wherein said explant is from a mature plant.
11. The method of claim 1, further comprising removing leaves and necrotic regions from said explant between steps (a) to (c).
12. The method of claim 1, wherein said cell wall disrupting agent is selected from the group consisting of a chemical, an enzyme and a physical treatment.
13. The method of claim 1, wherein said enzyme comprises a plurality of enzymes.
14. The method of claim 12, wherein said enzyme is provided at a sub-lethal concentration.
15. The method of claim 1, wherein said enzyme is selected from the group consisting of pectinase, cutinase and a combination thereof.
16. The method of claim 1, wherein in said steps (a) said solid medium is devoid of said cell wall disrupting agent.
17. The method of claim 1, wherein said emergence of leaves suitable for regeneration is manifested by rooting and acclimatization.
18. (canceled)
19. A method of cannabis regeneration in a tissue culture, the method comprising culturing regenerable cannabis explant in-vitro in a solid medium comprising at least one regeneration agent and a cell wall disrupting agent so as to regenerate cannabis.
20. The method of claim 19, wherein said regenerable cannabis explant is obtained by a method of in-vitro propagating cannabis, the method comprising:
(a) culturing a cannabis plant part comprising a meristem on a solid culture medium so as to obtain an explant; and subsequently
(b) subjecting said explant to a cell wall disrupting agent;
(c) culturing said explant in a liquid medium; and optionally subsequently wherein steps (a)-(c) are effected for 1 to n times until emergence of leaves suitable for regeneration.
21-63. (canceled)