Patent application title:

METHOD TO ALTER CHINESE HAMSTER OVARY CELL LINE STABILITY

Publication number:

US20210380948A1

Publication date:
Application number:

17/407,578

Filed date:

2021-08-20

Abstract:

The present invention provides a recombinant eukaryotic cell expressing one or more heterologous double strand break (DSB) repair proteins in an amount effective for enhancing DSB repair in the cell. The recombinant eukaryotic cell may express a recombinant product of interest. Also provided are methods for enhancing double strand break (DSB) repair in eukaryotic cells, establishing host cells for production of a recombinant product of interest, producing a recombinant product of interest, improving production of a recombinant product of interest by eukaryotic cells, and/or investigating suitability of eukaryotic cells as host cells for producing a recombinant product of interest.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N5/0682 »  CPC main

Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor; Animal cells or tissues; Human cells or tissues; Vertebrate cells; Cells of the genital tract; Non-germinal cells from gonads Cells of the female genital tract, e.g. endometrium; Non-germinal cells from ovaries, e.g. ovarian follicle cells

C12N9/93 »  CPC further

Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes Ligases (6)

C12Y605/01001 »  CPC further

forming phosphoric ester bonds (6.5.1) DNA ligase (ATP) (6.5.1.1)

C12N2510/02 »  CPC further

Genetically modified cells Cells for production

C12N2511/00 »  CPC further

Cells for large scale production

C12Y402/99 »  CPC further

Carbon-oxygen lyases (4.2) Other carbon-oxygen lyases (4.2.99)

C12N9/00 IPC

Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes

C12N9/88 »  CPC further

Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes Lyases (4.)

Description

CROSS-REFERENCE TO RELATED APPLICATION

This application is a continuation of U.S. application Ser. No. 16/372,932, filed Apr. 2, 2019, which claims priority to U.S. Provisional Application No. 62/651,317, filed Apr. 2, 2018, the contents of which are incorporated herein by reference in their entireties for all purposes.

REFERENCE TO U.S. GOVERNMENT SUPPORT

This invention was made with government support under Grant Nos. 1412365 and 1539359 by the National Science Foundation. The United States has certain rights in the invention.

REFERENCE TO SEQUENCE LISTING

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled UOD-502US1_SequenceListing.txt, created Aug. 18, 2021, which is 41.kKB in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

FIELD OF THE INVENTION

The invention relates generally to improvement of stability of host cells for producing recombinant proteins.

BACKGROUND OF THE INVENTION

The biopharmaceutical sector is the fastest growing part of pharmaceutical industry. With an annual growth rate of 9.2%, global annual sales of recombinant therapeutic proteins reached $154 billion in 2015 and will continue to grow. The strong demand from the market, combined with an increasing number of innovative therapeutic proteins approved by US Food and Drug Administration (FDA), provides significant drivers to ensure stable, high productivity and product quality in existing and newly created cell lines used to manufacture these molecules.

Chinese hamster ovary (CHO) cells are the most important cell lines for commercial manufacturing of therapeutic proteins, and produce more than $100 billion per year of products. A key factor that resulted in the broad use of CHO as a platform is the immense adaptive ability of the cells that allows growth at high cell density in serum-free suspension culture, and also allows selection of clones with diverse phenotypes including high productivity as well as clones expressing products with desired product characteristics. The exceptional adaptability of CHO cells arises from an inherent genome instability—DNA sequence changes and chromosomal rearrangements occur frequently during cell culture. However, this ā€œunstable genomeā€ also has an undesirable consequence when it comes to selected clones with desired properties: there is the chance for cells to reduce the copy number or alter the expression of integrated transgenes, which in turn manifests as an inability to maintain high productivity or product quality over relevant time periods for commercial application: ˜60 days in culture. This production instability remains a key concern in commercial manufacturing processes.

Beyond genome instability, another often-reported cause of production instability is a decrease in transgene transcripts, mainly due to the epigenetic silencing via promoter methylation and histone modifications. So far, two reports have targeted this mechanism and increased production stability by using CMV promoter mutants to prevent promoter methylation, or by deleting the gene Fam60A which acts presumably to decrease histone deacetylation. However, although epigenetic transcriptional silencing was associated with production instability in some cell lines, a reduction in the transgene copy number due to genome instability was the predominant cause of production instability in a majority of cell lines. The inability to maintain genome integrity will negatively affect production stability in most, if not all, production cell lines during long-term culture. Yet, no study has been able to control production stability by addressing the genome instability problem in CHO cells.

Genome instability is a common feature of most cancers, and can arise from defects in DNA damage repair. Of all types of DNA damages, the most toxic is double strand break (DSB). Two distinct and complementary DSB repair pathways (NHEJ and HDR) have evolved to protect the genome from deleterious effect of DSBs. Non-homologous end joining (NHEJ) pathway ligates the two ends of broken DNA together with limited trimming of DNA ends, but is intrinsically error-prone. In contrast, the homology directed repair (HDR) pathway requires a homologous sequence to faithfully restore the original sequence of the broken DNA. Many genes are involved in the two pathways, and mutations in these genes could result in DNA sequence alternations and chromosomal rearrangements, which often contribute to carcinogenesis. The inherent genome instability of CHO cells, particularly the frequent chromosomal rearrangements, is also possibly attributed to a deficient DSB repair caused by mutations in DSB repair genes. Given that Chinese hamster (CH) cells, from which CHO cells were originally derived, have a stable genome and thus a functional DSB repair, expressing functional (CH) DSB repair genes in CHO cells could be a potential way to rescue the DSB repair system and improve the genome stability.

There remains a need for a method to improve stability of host cells for producing recombinant proteins.

SUMMARY OF THE INVENTION

The present invention relates to enhancement of double strand break (DSB) repair in and stability of eukaryotic cells and the use such eukaryotic cells to produce products of interest.

A recombinant eukaryotic cell is provided. The recombinant eukaryotic cell expresses a heterologous double strand break (DSB) repair protein in an amount effective for enhancing DSB repair in the cell. The heterologous DSB repair protein may be expressed in an amount effective for enhancing stability of the cell for at least 1 month. The heterologous DSB repair protein may be selected from the group consisting of DNA ligase IV (LIG4), x-ray repair cross complementing 6 (XRCC6), partner and localizer of BRCA2 (PALB2), and PARP1 binding protein which is encoded by the PARPBP gene (PARI). The heterologous DSB repair protein may be LIG4 or XRCC6. The heterologous DSB repair protein may be expressed transiently or stably.

The recombinant eukaryotic cell may be a mammalian cell. The mammalian cell may be selected from the group consisting of a rodent cell, a mouse cell and a Chinese hamster cell. The mammalian cell may be a Chinese hamster ovary (CHO) cell.

The heterologous DSB repair protein may be from the Chinese hamster. The heterologous DSB repair protein may comprise an amino acid sequence at least 70% identical to the amino acid sequence of SEQ ID No: 1 or 2.

The heterologous DSB repair protein may be from a Chinese hamster ovary cell. The heterologous DSB repair protein may comprise an amino acid sequence at least 70% identical to the amino acid sequence of SEQ ID No: 3 or 4.

The recombinant eukaryotic cell may comprise a heterologous DSB repair gene encoding the heterologous DSB repair protein. The heterologous DSB repair gene may comprise a nucleic acid sequence at least 70% identical to the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8. The heterologous DSB repair gene may be integrated into the genome of the recombinant eukaryotic cell.

The recombinant eukaryotic cell may comprise a heterologous nucleic acid sequence encoding a recombinant product of interest and expressing the recombinant product of interest. The recombinant product of interest may be a protein or a polypeptide. The protein may be a monoclonal antibody. The heterologous nucleic acid sequence encoding the recombinant product of interest may be integrated into the genome of the recombinant eukaryotic cell. The recombinant product of interest may be a secreted embryonic alkaline phosphate (SEAP).

The recombinant eukaryotic cell may further comprise a heterologous nucleic acid sequence encoding a selection marker integrated into the genome of the recombinant eukaryotic cell.

A method for enhancing double strand break (DSB) repair in eukaryotic cells (enhancement method) is provided. The method comprises expressing an effective amount of a heterologous DSB repair protein in the eukaryotic cells. The method may further comprise enhancing stability of the eukaryotic cells over time. The method may further comprise introducing into the eukaryotic cells a heterologous nucleic acid gene encoding the heterologous DSB repair protein. The heterologous nucleic acid sequence encoding the heterologous DSB repair protein may be introduced into the eukaryotic cells by overexpression, transgene expression, gene knock-in, gene activation, transcription activation, translation activation, gene mutation or a combination thereof.

A method for establishing host cells for production of a recombinant product of interest (establishment method) is provided. The method comprises (a) expressing a heterologous double strand break (DSB) repair protein in the eukaryotic cells; (b) determining DSB repair in the eukaryotic cells of step (a); and (c) isolating eukaryotic cells in which the DSB repair is enhanced as host cells. The method may further comprise editing the genome of the host cells to improve DSB repair in the host cells. Host cells established according to this method are provided.

A method for producing a recombinant product of interest (production method) is provided. The method comprises (a) growing eukaryotic cells in a culture medium, wherein the recombinant eukaryotic cells comprise a heterologous nucleic acid sequence encoding a recombinant product of interest; (b) expressing a heterologous double strand break (DSB) repair protein in the eukaryotic cells; and (c) expressing the recombinant product of interest by the eukaryotic cells. The average productivity of the recombinant product of interest by the eukaryotic cells may drop less than 30% over a period of at least 8 weeks. The eukaryotic cells may retain at least 70% of the copy number of the heterologous nucleic acid sequence encoding the recombinant product of interest over a period of at least 8 weeks. The method may further comprise editing the genome of the eukaryotic cells to improve DSB repair in the eukaryotic cells. The method may further comprise expressing a selection maker by the eukaryotic cells, which may further comprise a heterologous nucleic acid sequence encoding the selection marker, and the heterologous nucleic acid sequence encoding the recombinant product of interest and the heterologous nucleic acid sequence encoding the selection marker may be integrated into the genome of the eukaryotic cells. The method may further comprise growing the eukaryotic cells under a condition that induces DNA damage. The recombinant product of interest may be a protein or a polypeptide. The protein may be a monoclonal antibody.

A method of improving production of a recombinant product of interest by eukaryotic cells (improvement method) is provided. The eukaryotic cells comprise a heterologous nucleic acid sequence encoding the recombinant product of interest and produce the recombinant product of interest. The method comprises expressing a heterologous double strand break (DSB) repair protein by the recombinant eukaryotic cells. The method may further comprise enhancing DSB repair in the eukaryotic cells. The method may further comprise enhancing stability of the eukaryotic cells over time. The method may further comprise expressing a selection maker by the eukaryotic cells, which comprise a heterologous nucleic acid sequence encoding the selection marker. The heterologous nucleic acid sequence encoding the recombinant product of interest and the heterologous nucleic acid sequence encoding the selection marker may be integrated into the genome of the eukaryotic cells. The method may further comprise growing the eukaryotic cells under a condition that induces DNA damage. The recombinant product of interest may be a protein or a polypeptide. The protein may be a monoclonal antibody.

A method of investigating suitability of eukaryotic cells as host cells for producing a recombinant product of interest (investigation method) is provided. The eukaryotic cells comprise a heterologous nucleic acid sequence encoding the recombinant product of interest. The method comprises (a) expressing a heterologous double strand break (DSB) repair protein by the eukaryotic cells; and (b) determining DSB repair in the eukaryotic cells, wherein an improvement of the DSB repair indicates that the eukaryotic cells are suitable as host cells for producing a recombinant product of interest. The DSB repair protein may be selected from the group consisting of DNA ligase IV (LIG4), x-ray repair cross complementing 6 (XRCC6), partner and localizer of BRCA2 (PALB2), and PARP1 binding protein which is encoded by the PARPBP gene (PARI). The heterologous DSB repair protein may be LIG4 or XRCC6. Where the heterologous DSB repair protein is LIG4 or XRCC6, the method may further comprise quantifying the expression of the LIG4 or XRCC6 in the eukaryotic cells. The method may further comprise quantifying the expression of the recombinant product of interest by the eukaryotic cells. The method may further comprise identifying eukaryotic cells into whose genome the heterologous nucleic acid sequence encoding the recombinant product of interest is integrated. The method may further comprise identifying eukaryotic cells producing the recombinant product of interest in an amount greater than 100 mg per liter for recombinant eukaryotic cells, for example, grown in fed-batch culture. The method may further comprise expressing a selection maker by the eukaryotic cells, which may further comprise a heterologous nucleic acid sequence encoding the selection marker, and the heterologous nucleic acid sequence encoding the recombinant product of interest and the heterologous nucleic acid sequence encoding the selection marker may be integrated into the genome of the eukaryotic cells. The method may further comprise growing the eukaryotic cells under a condition that induces DNA damage. The recombinant product of interest may be a protein or a polypeptide. The protein may be a monoclonal antibody.

For the enhancement method, the establishment method, the production method, the improvement method, or the investigation method, the heterologous DSB repair protein may be expressed transiently or stably. The eukaryotic cells may be mammalian cells. The mammalian cells may be selected from the group consisting of rodent cells, mouse cells and Chinese hamster cells. The mammalian cells may be CHO cells. The heterologous DSB repair protein may be from a Chinese hamster (CH) cell or a Chinese hamster ovary (CHO) cell. The heterologous DSB repair protein may comprise an amino acid sequence at least 70% identical to the amino acid sequence of SEQ ID No: 1, 2, 3 or 4. The eukaryotic cell may comprise a heterologous DSB repair gene encoding the heterologous DSB repair protein. The heterologous DSB repair gene may comprise a nucleic acid sequence at least 70% identical to the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8. The heterologous DSB repair gene may be integrated into the genome of the eukaryotic cell.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows (A) endogenous DSB numbers in CHO-K1, BHK-21 and bEnd.3 cells, and remaining DSB numbers after one-hour treatment with 10 (B) or 50 μg/mL (C) bleomycin. Each error bar is constructed using a 95% confidence interval of the mean. The letter n represents the number of cells used for counting γH2AX foci. The p-value was obtained by the Student's t-test. On the scatter plot, the 95% confidence interval is drawn for the mean DSB number at the given time point.

FIG. 2 shows (A) a graphical illustration of the experimental process. (B) Remaining average DSB numbers in CHO-K1, BHK-21 and bEnd.3 cells after 12-hour treatment with 10 μg/mL bleomycin. On the scatter plot, the 95% confidence interval is drawn for the mean DSB number at the given time point.

FIG. 3 shows DSB numbers in CHO-K1 cells with or without expression of CH-version DSB repair genes at various hours after bleomycin treatment. The CHO-K1 cells were transfected with null vector plasmid or plasmids expressing the indicated CH-version genes. Cells were incubated with 10 μg/mL bleomycin for 12 hours. Each error bar is constructed using a 95% confidence interval of the mean.

FIG. 4 shows number of remaining DSBs in CHO-K1 cells expressing the CH-version of XRCC6 or XRCC5 after bleomycin treatment. The control CHO-K1 cells were transfected with null vector plasmid. All cells were treated with 10 μg/mL bleomycin for 12 hours. Each error bar is constructed using a 95% confidence interval of the mean.

FIG. 5 shows the effect of four DSB genes expression levels on DSB repair. CHO-K1 cells were transfected with the null vector plasmid, or with the indicated amount of the plasmid expressing the CH or CHO-version PARI (A), XRCC6 (B), LIG4 (C) and PALB2 (D). All transfections were made with four million cells. The cells were treated with 10 μg/mL bleomycin for 12 hours. Each error bar is constructed using a 95% confidence interval of the mean.

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to alteration of stability of host cells for producing recombinant proteins. The invention is made based on the surprising discovery when double strand break (DSB) repair and genome stability in Chinese hamster ovary (CHO) cells were investigated. The inventors have discovered that DSB repair in CHO cells is deficient, but heterologous expression of DSB repair genes from Chinese hamster (CH) cells in CHO cells can improve DSB repair dramatically in the CHO cells. Enhancement of DSB repair in cells increases genome and production stabilities of the cells.

The term ā€œpolypeptideā€ used herein refers to a polymer of amino acid residues with no limitation with respect to the minimum length of the polymer. For example, the polypeptide may have at least 20 amino acids. A polypeptide may be modified by, for example, glycosylation and/or phosphorylation.

The term ā€œproteinā€ used herein refers to a biological molecule comprising one or more polypeptides. The protein may be an antibody, or a variant, derivative, analog, or fragment thereof, which specifically binds to an antigen of interest. The antibody may be a polyclonal antibody, a monoclonal antibody, a chimeric antibody, CDR-grafted antibody or humanized antibody.

The term ā€œpolynucleotideā€ used herein refers to a polymer of nucleotide residues with no limitation with respect to the minimum length of the polymer. For example, the polynucleotide may have at least 60 nucleotides. The polynucleotide may be a DNA, cDNA or RNA molecule, or a combination thereof.

The term ā€œvariantā€ of a protein, polypeptide or polynucleotide used herein refers to a respective protein, polypeptide or polynucleotide having an amino acid or nucleic acid sequence that is the same as the amino acid or nucleic acid sequence of the original protein, polypeptide or polynucleotide except having at least one amino acid or nucleic acid modified, for example, deleted, inserted, or replaced, respectively. A variant of a protein, polypeptide or polynucleotide may have an amino acid or nucleic acid sequence at least about 80%, 90%, 95%, or 99%, preferably at least about 90%, more preferably at least about 95%, identical to the amino acid sequence or nucleic acid of the original protein, polypeptide or polynucleotide.

A recombinant eukaryotic cell is provided. The recombinant eukaryotic cell expresses one or more heterologous double strand break (DSB) repair proteins in an amount effective for enhancing DSB repair in the cell. The DSB repair protein may be expressed in an amount effective for enhancing stability of the cell over time.

The term ā€œdouble strand break (DSB) repairā€ used herein refers to the molecular mechanism inside cells wherein the cell is able to repair a break in both strands of the DNA using either of two mechanisms known as homologous recombination or non-homologous end-joining recombination. DSB repair in a cell or cells may be evaluated by using an assay called the γ-H2AX assay. For example, the phosphorylated histone H2AX may be a tool to monitor DNA double strand breaks because it is known that the Ser 139 residue in H2AX, a variant of the core histone H2A family, becomes phosphorylated immediately after the introduction of DNA damage. This phosphorylated version of H2AX is known as γ-H2AX and may be assayed with an antibody that binds to γ-H2AX and measured. The greater the amount of γ-H2AX is observed, the greater the number of DSBs may be present.

The term ā€œstabilityā€ as used herein refers to no significant change (e.g., no more than 1%, 2%, 5%, 10%, 15%, 18%, 20%, 25%, 30%, 35% or 40%) in one or more characteristics of a cell over a period. The period may be at least 1, 2, 3, 4, 5, 6 or 7 weeks, 1 month, or 1, 2, 5, 10, 20, 30, 40, 50, or 60 population doublings of the cell culture. The period may be no more than 8, 9, 10, 11, 12, 15, 18 or 24 weeks, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 18 or 24 months, or 70, 80, 90, 100, 110, 120, 130, 140, or 150 population doublings of the cell culture. The period may be 1-10, 1-30, or 1-60 days from the start of cultivation of the cells. Examples of the characteristics of a cell include growth rate or genome of the cell, expression of endogenous proteins or growth factors by the cell, a heterologous nucleic acid sequence, whether integrated into the genome of the cell, and production of a recombinant protein, for example, with a specific modification, by the cell.

In one embodiment, the eukaryotic cells may retain at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of the copy number of the heterologous nucleic acid sequence encoding a heterologous DSB repair protein over a period of, for example, at least 1, 2, 3, 4, 5, 6 or 7 weeks, 1 month, or 1, 2, 5, 10, 20, 30, 40, 50, or 60 population doublings of the cell culture, and/or no more than 8, 9, 10, 11, 12, 15, 18 or 24 weeks, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 18 or 24 months, or 70, 80, 90, 100, 110, 120, 130, 140, or 150 population doublings of the cell culture. The nucleic acid sequence encoding the heterologous DSB repair protein may be integrated into the genome of the cell.

In another embodiment, the eukaryotic cells may retain at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of the copy number of the heterologous nucleic acid sequence encoding a recombinant product of interest over a period of, for example, at least 1, 2, 3, 4, 5, 6 or 7 weeks, 1 month, or 1, 2, 5, 10, 20, 30, 40, 50, or 60 population doublings of the cell culture, and/or no more than 8, 9, 10, 11, 12, 15, 18 or 24 weeks, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 18 or 24 months, or 70, 80, 90, 100, 110, 120, 130, 140, or 150 population doublings of the cell culture. The nucleic acid sequence encoding the recombinant product of interest may be integrated into the genome of the cell.

The term ā€œproductivityā€ as used herein refers to the amount of a recombinant product of interest produced by eukaryotic cells grown in a culture medium over time. The productivity may be expressed in units of grams per liter for a fed-batch culture where cells are cultivated in medium in a vessel and nutrients are periodically added to the vessel with the purpose of extending the duration of the culture. The purpose of the periodic addition of nutrients to the vessel may also be to increase the amount of recombinant protein produced. In a continuous culture, nutrients are continuously added to cells grown in a vessel and waste products are continuously removed from the vessel. In a continuous culture, the productivity of the cells may be expressed as a volumetric productivity in units of grams per liter per day. The recombinant product of interest may be expressed by the cells and remain inside the cells or secreted by the cells into the culture medium. The productivity of a recombinant product of interest by eukaryotic cells may drop over time. The production of the recombinant product of interest is deemed stable production if no more than 1%, 2%, 5%, 10%, 15%, 18%, 20%, 25%, 30%, 35% or 40% of the productivity of a recombinant product of interest, for example, a heterologous recombinant protein (e.g., antibody), drops in eukaryotic cells over a period. The period may be at least 1, 2, 3, 4, 5, 6 or 7 weeks, 1 month, or 1, 2, 5, 10, 20, 30, 40, 50, or 60 population doublings of the cell culture. The period may be no more than 8, 9, 10, 11, 12, 15, 18 or 24 weeks, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 18 or 24 months, or 70, 80, 90, 100, 110, 120, 130, 140, or 150 population doublings of the cell culture. The period may be 1-10, 1-30, or 1-60 days from the start of cultivation of the cells.

The term ā€œan effective amountā€ used herein refers to an amount of the heterologous double strand break (DSB) repair protein(s) expressed in the cell required to achieve a stated goal (e.g., enhancement of DSB repair in the cell or enhancement of stability of the cell). The effective amount of the heterologous DSB repair protein(s) may vary depending upon the stated goals, the biological state of the cell and the environment surrounding the cell.

The recombinant eukaryotic cell may be a mammalian cell. The mammalian cell may be a rodent cell, a mouse cell and a Chinese hamster cell. The mammalian cell may be a CHO cell.

The heterologous DSB repair protein may be expressed transiently or stably. In one embodiment, the heterologous DSB repair protein may be expressed stably.

The heterologous DSB repair protein may be from any cell, in which DSB repair occurs naturally, other than the eukaryotic cell from which the recombinant eukaryotic cell is prepared. The heterologous DSB repair protein may be identical to an endogenous protein involved in DSB repair in a cell other than the eukaryotic cell from which the recombinant eukaryotic cell is prepared. The heterologous DSB repair protein may be identical to an endogenous DSB repair protein from a cell other than the eukaryotic cell from which the recombinant eukaryotic cell is prepare, or a variant thereof. The heterologous DSB repair protein may be identical to an endogenous DSB repair protein in a Chinese hamster (CH) cell, or a variant thereof. The heterologous DSB repair protein may be identical to an endogenous DSB repair protein in a Chinese hamster ovary (CHO) cell line, or a variant thereof. The heterologous DSB repair protein may be selected from the group consisting of DNA ligase IV (LIG4), x-ray repair cross complementing 6 (XRCC6), partner and localizer of BRCA2 (PALB2), and PARP1 binding protein which is encoded by the PARPBP gene (PARI). In some embodiments, the DSB repair protein may be LIG4 or XRCC6.

The heterologous DSB repair protein may comprise an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID No: 1, 2, 3 or 4. The heterologous DSB repair protein may comprise the amino acid sequence of SEQ ID No: 1, 2, 3 or 4. The heterologous DSB repair protein may consist of the amino acid sequence of SEQ ID No: 1, 2, 3 or 4.

The recombinant eukaryotic cell may comprise a heterologous DSB repair gene encoding the heterologous DSB repair protein. The heterologous DSB repair gene may encode LIG4, XRCC6, PALB2 or PARI. In some embodiments, the heterologous DSB repair gene may encode LIG4 or XRCC6. The heterologous DSB repair gene may comprise a nucleic acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8. The heterologous DSB repair gene may comprise the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8. The heterologous DSB repair gene may consist of the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8. The heterologous DSB repair gene may be integrated into the genome of the recombinant eukaryotic cell.

The recombinant eukaryotic cell may comprise a heterologous nucleic acid sequence encoding a recombinant product of interest and express the recombinant product of interest. The heterologous nucleic acid sequence encoding the recombinant product of interest may be integrated into the genome of the recombinant eukaryotic cell.

The recombinant product of interest may be a protein, polypeptide, or antibody. For example, the recombinant product of interest may be secreted embryonic alkaline phosphate (SEAP). The recombinant product of interest may be an antibody, for example, a polyclonal antibody, a monoclonal antibody, a chimeric antibody, CDR-grafted antibody or humanized antibody. In one embodiment, the recombinant product of interest may be a monoclonal antibody.

The recombinant eukaryotic cell may further comprise a heterologous nucleic acid sequence encoding a selection marker. The heterologous nucleic acid sequence encoding the selection marker may be integrated into the genome of the recombinant eukaryotic cell.

A method for enhancing double strand break (DSB) repair in eukaryotic cells (enhancement method) is provided. The method comprises expressing an effective amount of a heterologous DSB repair protein in the eukaryotic cells. The eukaryotic cells may be mammalian cells. The mammalian cells may be selected from the group consisting of rodent cells, mouse cells and Chinese hamster cells. The mammalian cells may be CHO cells. The heterologous DSB repair protein may be from a Chinese hamster (CH) cell. The heterologous DSB repair protein may be from a Chinese hamster ovary (CHO) cell.

The enhancement method may further comprise enhancing stability of the eukaryotic cells over time. The heterologous DSB repair protein may be LIG4, XRCC6, PALB2 or PARI, preferably, LIG4 or XRCC6. The heterologous DSB repair protein may comprise an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID No: 1, 2, 3 or 4. The heterologous DSB repair protein may comprise the amino acid sequence of SEQ ID No: 1, 2, 3 or 4. The heterologous DSB repair protein may consist of the amino acid sequence of SEQ ID No: 1, 2, 3 or 4.

The enhancement method may further comprise introducing into the eukaryotic cells a heterologous nucleic acid gene encoding the heterologous DSB repair protein. The heterologous nucleic acid sequence encoding the heterologous DSB repair protein may be introduced into the eukaryotic cells by overexpression, transgene expression, gene knock-in, gene activation, transcription activation, translation activation, gene mutation or a combination thereof. The heterologous DSB repair gene may encode LIG4, XRCC6, PALB2 or PARI, preferably, LIG4 or XRCC6. The heterologous DSB repair gene may comprise a nucleic acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8. The heterologous DSB repair gene may comprise the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8. The heterologous DSB repair gene may consist of the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8. The heterologous DSB repair gene may be integrated into the genome of the recombinant eukaryotic cell.

A method for establishing host cells for production of a recombinant product of interest (establishment method) is provided. The method comprises expressing a heterologous double strand break (DSB) repair protein in the eukaryotic cells; determining DSB repair in the eukaryotic cells of step (a); and isolating eukaryotic cells in which the DSB repair is enhanced as host cells. The method may further comprise editing the genome of the host cells to improve DSB repair in the host cells.

According to the establishment method, the heterologous DSB repair protein may be expressed transiently or stably, preferably stably, in the eukaryotic cells. The eukaryotic cells may be mammalian cells. The mammalian cells may be selected from the group consisting of rodent cells, mouse cells and Chinese hamster cells. The mammalian cells may be CHO cells. The heterologous DSB repair protein may be from a Chinese hamster (CH) cell. The heterologous DSB repair protein may be from a Chinese hamster ovary (CHO) cell. The heterologous DSB repair protein may be LIG4, XRCC6, PALB2 or PARI, preferably, LIG4 or XRCC6. The heterologous DSB repair protein may comprise an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID No: 1, 2, 3 or 4. The heterologous DSB repair protein may comprise the amino acid sequence of SEQ ID No: 1, 2, 3 or 4. The heterologous DSB repair protein may consist of the amino acid sequence of SEQ ID No: 1, 2, 3 or 4. The eukaryotic cells may comprise a heterologous nucleic acid sequence encoding the heterologous DSB repair protein. The heterologous DSB repair gene may be integrated into the genome of the eukaryotic cell. The heterologous DSB repair gene may encode LIG4, XRCC6, PALB2 or PARI, preferably, LIG4 or XRCC6. The heterologous DSB repair gene may comprise a nucleic acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8. The heterologous DSB repair gene may comprise the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8. The heterologous DSB repair gene may consist of the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8.

According to the establishment method, the eukaryotic cells may comprise a heterologous nucleic acid sequence encoding a recombinant product of interest and express the recombinant product of interest. The heterologous nucleic acid sequence encoding the recombinant product of interest may be integrated into the genome of the recombinant eukaryotic cell. The recombinant product of interest may be a protein or polypeptide. For example, the recombinant product of interest may be secreted embryonic alkaline phosphate (SEAP). The recombinant product of interest may be an antibody, for example, a polyclonal antibody, a monoclonal antibody, a chimeric antibody, CDR-grafted antibody or humanized antibody. In one embodiment, the recombinant product of interest may be a monoclonal antibody. The eukaryotic cells may further comprise a heterologous nucleic acid sequence encoding a selection marker. The heterologous nucleic acid sequence encoding the selection marker may be integrated into the genome of the recombinant eukaryotic cell.

For each method for establishing host cells for production of a recombinant product of interest, the established host cells are provided.

A method for producing a recombinant product of interest (production method) is provided. The method comprises growing eukaryotic cells in a culture medium. The eukaryotic cells comprise a heterologous nucleic acid sequence encoding a recombinant product of interest. The method further comprises expressing a heterologous double strand break (DSB) repair protein in the eukaryotic cells; and expressing the recombinant product of interest by the eukaryotic cells. The method may further comprise editing the genome of the eukaryotic cells to improve DSB repair in the eukaryotic cells. The method may further comprise growing the eukaryotic cells under a condition that induces DNA damage. A condition that induces DNA damage may involve the additional of chemicals to the culture expected to induce DNA damage and double-strand breaks. Another condition that induces DNA damage may involve the use of radiation exposure to the culture in a manner expected to induce DNA damage and double-strand breaks. Yet another condition that induces DNA damage may involve the application of a chemical selection pressure to cells to enable only those cells able to survive in the presence of relevant amounts of the chemical agent and which may induce DNA damage and double-strand breaks.

According to the production method, the heterologous DSB repair protein may be expressed transiently or stably, preferably stably, in the eukaryotic cells. The eukaryotic cells may be mammalian cells. The mammalian cells may be selected from the group consisting of rodent cells, mouse cells and Chinese hamster cells. The mammalian cells may be CHO cells. The heterologous DSB repair protein may be from a Chinese hamster (CH) cell. The heterologous DSB repair protein may be from a Chinese hamster ovary (CHO) cell. The heterologous DSB repair protein may be LIG4, XRCC6, PALB2 or PARI, preferably, LIG4 or XRCC6. The heterologous DSB repair protein may comprise an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID No: 1, 2, 3 or 4. The heterologous DSB repair protein may comprise the amino acid sequence of SEQ ID No: 1, 2, 3 or 4. The heterologous DSB repair protein may consist of the amino acid sequence of SEQ ID No: 1, 2, 3 or 4. The eukaryotic cells may comprise a heterologous nucleic acid sequence encoding the heterologous DSB repair protein. The heterologous DSB repair gene may be integrated into the genome of the eukaryotic cell. The heterologous DSB repair gene may encode LIG4, XRCC6, PALB2 or PARI, preferably, LIG4 or XRCC6. The heterologous DSB repair gene may comprise a nucleic acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8. The heterologous DSB repair gene may comprise the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8. The heterologous DSB repair gene may consist of the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8.

According to the production method, the heterologous nucleic acid sequence encoding the recombinant product of interest may be integrated into the genome of the recombinant eukaryotic cell. The recombinant product of interest may be a protein or polypeptide. The recombinant product of interest may be an antibody, for example, a polyclonal antibody, a monoclonal antibody, a chimeric antibody, CDR-grafted antibody or humanized antibody. In one embodiment, the recombinant product of interest may be a monoclonal antibody. The eukaryotic cells may further comprise a heterologous nucleic acid sequence encoding a selection marker. The heterologous nucleic acid sequence encoding the selection marker may be integrated into the genome of the recombinant eukaryotic cell.

According to the production method of the present invention, the productivity of the recombinant product of interest by the eukaryotic cells may drop less than 5%, 10%, 15%, 18%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or 70% over a period. The period may be at least 1, 2, 3, 4, 5, 6 or 7 weeks, 1 month, or 1, 2, 5, 10, 20, 30, 40, 50, or 60 population doublings of the cell culture. The period may be no more than 8, 9, 10, 11, 12, 15, 18 or 24 weeks, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 18 or 24 months, or 70, 80, 90, 100, 110, 120, 130, 140, or 150 population doublings of the cell culture. The period may be 1-10, 1-30, or 1-60 days from the start of cultivation of the cells. For example, the productivity of the recombinant product of interest by the eukaryotic cells may drop less than 30% over 8 weeks or less than 18% over a period of at least 11 weeks.

According to the production method of the present invention, the eukaryotic cells may retain at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of the copy number of the heterologous nucleic acid sequence encoding the recombinant product of interest over a period. The period may be at least 1, 2, 3, 4, 5, 6 or 7 weeks, 1 month, or 1, 2, 5, 10, 20, 30, 40, 50, or 60 population doublings of the cell culture. The period may be no more than 8, 9, 10, 11, 12, 15, 18 or 24 weeks, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 18 or 24 months, or 70, 80, 90, 100, 110, 120, 130, 140, or 150 population doublings of the cell culture. The period may be 1-10, 1-30, or 1-60 days from the start of cultivation of the cells. In one embodiment, the eukaryotic cells may retain at least 70% of the copy number of the heterologous nucleic acid sequence encoding the recombinant product of interest over a period of at least 8 weeks. In another embodiment, the eukaryotic cells may retain at least 75% of the copy number of the heterologous nucleic acid sequence encoding the recombinant product of interest over a period of at least 11 weeks.

A method of improving production of a recombinant product of interest by eukaryotic cells (improvement method) is provided. The eukaryotic cells comprise a heterologous nucleic acid sequence encoding the recombinant product of interest and produce the recombinant product of interest. The method comprises expressing a heterologous double strand break (DSB) repair protein by the recombinant eukaryotic cells. The method may further comprise enhancing DSB repair in the eukaryotic cells. The method may further comprise enhancing stability of the eukaryotic cells over a period. The period may be at least 1, 2, 3, 4, 5, 6 or 7 weeks, 1 month, or 1, 2, 5, 10, 20, 30, 40, 50, or 60 population doublings of the cell culture. The period may be no more than 8, 9, 10, 11, 12, 15, 18 or 24 weeks, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 18 or 24 months, or 70, 80, 90, 100, 110, 120, 130, 140, or 150 population doublings of the cell culture. The period may be 1-10, 1-30, or 1-60 days from the start of cultivation of the cells. The method may further comprise growing the eukaryotic cells under a condition that induces DNA damage.

According to the improvement method, the heterologous DSB repair protein may be expressed transiently or stably, preferably stably, in the eukaryotic cells. The eukaryotic cells may be mammalian cells. The mammalian cells may be selected from the group consisting of rodent cells, mouse cells and Chinese hamster cells. The mammalian cells may be CHO cells. The heterologous DSB repair protein may be from a Chinese hamster (CH) cell. The heterologous DSB repair protein may be from a Chinese hamster ovary (CHO) cell. The heterologous DSB repair protein may be LIG4, XRCC6, PALB2 or PARI, preferably, LIG4 or XRCC6. The heterologous DSB repair protein may comprise an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID No: 1, 2, 3 or 4. The heterologous DSB repair protein may comprise the amino acid sequence of SEQ ID No: 1, 2, 3 or 4. The heterologous DSB repair protein may consist of the amino acid sequence of SEQ ID No: 1, 2, 3 or 4. The eukaryotic cells may comprise a heterologous nucleic acid sequence encoding the heterologous DSB repair protein. The heterologous DSB repair gene may be integrated into the genome of the eukaryotic cell. The heterologous DSB repair gene may encode LIG4, XRCC6, PALB2 or PARI, preferably, LIG4 or XRCC6. The heterologous DSB repair gene may comprise a nucleic acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8. The heterologous DSB repair gene may comprise the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8. The heterologous DSB repair gene may consist of the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8.

According to the improvement method, the heterologous nucleic acid sequence encoding the recombinant product of interest may be integrated into the genome of the recombinant eukaryotic cell. The recombinant product of interest may be a protein or polypeptide. The recombinant product of interest may be an antibody, for example, a polyclonal antibody, a monoclonal antibody, a chimeric antibody, CDR-grafted antibody or humanized antibody. In one embodiment, the recombinant product of interest may be a monoclonal antibody. The eukaryotic cells may further comprise a heterologous nucleic acid sequence encoding a selection marker. The heterologous nucleic acid sequence encoding the selection marker may be integrated into the genome of the recombinant eukaryotic cell.

A method of investigating suitability of eukaryotic cells as host cells for producing a recombinant product of interest (investigation method) is provided. The eukaryotic cells comprise a heterologous nucleic acid sequence encoding the recombinant product of interest. The method comprises expressing a heterologous double strand break (DSB) repair protein by the eukaryotic cells; and determining DSB repair in the eukaryotic cells. An improvement of the DSB repair indicates that the eukaryotic cells are suitable as host cells for producing a recombinant product of interest. The method may further comprise quantifying the expression of the heterologous double strand break (DSB) repair protein, for example, LIG4 or XRCC6, in the eukaryotic cells. The method may further comprise quantifying the expression of the recombinant product of interest by the eukaryotic cells. The method may further comprise identifying eukaryotic cells into whose genome the heterologous nucleic acid sequence encoding the recombinant product of interest is integrated, and optionally identifying eukaryotic cells producing the recombinant product of interest in an amount greater than 1, 10, 50, 100, 150, 200, 250 or 500 mg per liter for recombinant eukaryotic cells. The method may further comprise growing the eukaryotic cells under a condition that induces DNA damage.

According to the investigation method, the heterologous DSB repair protein may be expressed transiently or stably, preferably stably, in the eukaryotic cells. The eukaryotic cells may be mammalian cells. The mammalian cells may be selected from the group consisting of rodent cells, mouse cells and Chinese hamster cells. The mammalian cells may be CHO cells. The heterologous DSB repair protein may be from a Chinese hamster (CH) cell. The heterologous DSB repair protein may be LIG4, XRCC6, PALB2 or PARI, preferably, LIG4 or XRCC6. The heterologous DSB repair protein may comprise an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID No: 1, 2, 3 or 4. The heterologous DSB repair protein may comprise the amino acid sequence of SEQ ID No: 1, 2, 3 or 4. The heterologous DSB repair protein may consist of the amino acid sequence of SEQ ID No: 1, 2, 3 or 4. The eukaryotic cells may comprise a heterologous nucleic acid sequence encoding the heterologous DSB repair protein. The heterologous DSB repair gene may be integrated into the genome of the eukaryotic cell. The heterologous DSB repair gene may encode LIG4, XRCC6, PALB2 or PARI, preferably, LIG4 or XRCC6. The heterologous DSB repair gene may comprise a nucleic acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8. The heterologous DSB repair gene may comprise the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8. The heterologous DSB repair gene may consist of the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8.

According to the investigation method, the heterologous nucleic acid sequence encoding the recombinant product of interest may be integrated into the genome of the recombinant eukaryotic cell. The recombinant product of interest may be a protein or polypeptide. The recombinant product of interest may be an antibody, for example, a polyclonal antibody, a monoclonal antibody, a chimeric antibody, CDR-grafted antibody or humanized antibody. In one embodiment, the recombinant product of interest may be a monoclonal antibody. The eukaryotic cells may further comprise a heterologous nucleic acid sequence encoding a selection marker. The heterologous nucleic acid sequence encoding the selection marker may be integrated into the genome of the recombinant eukaryotic cell.

Example 1. Rescue of Deficient DNA Double-Strand Break Repair in CHO Cells

Materials and Methods

Plasmid Construction

To clone eight DSB repair genes, total mRNA from CHO-K1 cells or Chinese hamster liver tissue was extracted using Qiagen RNeasy Mini kit and reverse-transcribed into cDNA to be used as templates to generate gene fragments by PCR. All primers used for cloning are listed in Table 1. FBXO18 gene and partial sequences of RNF8 and LIG4 genes were synthesized as gBlocks Gene Fragments (Integrated DNA Technologies, Coralville, Iowa). A vector fragment was obtained by PCR amplification from plasmid pcDNA3.1/zeo(+) (Thermo Fisher, Waltham, Mass.). Plasmids expressing DSB repair genes were constructed via Gibson assembly of gene fragment(s) and the vector fragment following the manufacturer's instruction (New England Biolabs, Ipswich, Mass.).

TABLEā€ƒ1
Oligonucleotidesā€ƒusedā€ƒforā€ƒgeneā€ƒcloning
Cloning SEQ
primers Oligonucleotideā€ƒsequenceā€ƒ(5ā€²ā€ƒtoā€ƒ3′) IDā€ƒNO
XRCC5ā€ƒF1 GGAGACCCAAGCTGGCTAGCCCAGCAACATGGCGTGGT 9
XRCC5ā€ƒR1 CGCCGTAGACTCTCACTGAAGGAG 10
XRCC5ā€ƒF2 GAGATCTACTCCTTCAGTGAGAGT 11
XRCC5ā€ƒR2 GGTTTAACGGGCCCTCTAGACTATATCATATCCAGTAAATCATCC 12
ACATCG
XRCC6ā€ƒF GGAGACCCAAGCTGGCTAGCAAACCAACATGTCAGGGTGG 13
XRCC6ā€ƒR GGTTTAACGGGCCCTCTAGATCAGTTCTTATGGAAGTGTCTG 14
RNF8ā€ƒF TGTCTCCCTGCCTTGCCTTA 15
RNF8ā€ƒR GTTTAAACGGGCCCTCTAGATCATGACAGTCTCTTTGCTT 16
LIG4ā€ƒF GGAGACCCAAGCTGGCTAGCTTGCTTCTATGGCTACCTCA 17
LIG4ā€ƒR GCCTGGATTCTGCACTATAT 18
PALB2ā€ƒF1 GGAGACCCAAGCTGGCTAGCCCATCCGGATGGAAGAGCCT 19
PALB2ā€ƒR1 GACATATGACGGGTAGTTCTAACGTAGTATTCTGCAGGAAACG 20
PALB2ā€ƒF2 ATACTACGTTAGAACTACCCGTCATATGTCAGACTATC 21
PALB2ā€ƒR2 GGTTTAACGGGCCCTCTAGATTAAAAGTAGCGGTATATGAATAT 22
ATTTC
PARIā€ƒF GGAGACCCAAGCTGGCTAGCCTAGGAGAATGGCTGTGCTC 23
PARIā€ƒR GTTTAAACGGGCCCTCTAGATCACAGCCTAAAAAACTGAG 24
MUS81ā€ƒF GGAGACCCAAGCTGGCTAGCTAGATCTTATGGCGGCACGG 25
MUS81ā€ƒR GTTTAAACGGGCCCTCTAGATCAGGTCAGTGGACTGTGGC 26
pcDNA3.1ā€ƒF TCTAGAGGGCCCGTTTAAAC 27
pcDNA3.1ā€ƒR GCTAGCCAGCTTGGGTCTCC 28

Cell Culture and Transfection

CHO-K1, BHK-21 hamster fibroblast (ATCC, Manassas, Va.) and bEnd.3 mouse endothelial cells (ATCC, Manassas, Va.) were cultured in 5 mL Iscove's Modified Dulbecco's Medium (IMDM, Hyclone Laboratories Inc., Logan, Utah) supplemented with 10% fetal bovine serum (FBS, Hyclone Laboratories Inc., Logan, Utah) in T-25 culture flasks (Corning Inc., Corning, N.Y.) at 37° C. and 5% CO2. For the transient expression of DSB repair genes in CHO-K1, 6Ɨ106 cells were transfected with 6 μg plasmid (unless indicated otherwise) using the Nucleofector Kit T (Lonza, Cologne, Germany).

Immunofluorescence

CHO-K1, bEnd.3 or transfected CHO-K1 cells were seeded in chambers of an 8-well chambered cover glass (Cellvis, Mountain View, Calif.) at 2Ɨ105 cells/mL with 0.5 mL culture media. After 24-hour incubation, cells were treated with 10 μg/mL bleomycin (Sigma-Aldrich, St. Louis, Mo.) for 1 or 12 hours or with 50 μg/mL for 1 hour, followed by immediate media change with fresh warm culture media. After indicated hours of incubation in fresh media, the treated cells were washed three times with Tris buffered saline (TBS), fixed with 4% paraformaldehyde in TBS for 15 min, washed three times with TBS, permeabilized with 0.1% Triton-X100 (Sigma-Aldrich, St. Louis, Mo.) in TBS for 5 min, and washed three times with TBS. Cells were then blocked in TBS containing 3% goat serum (Sigma-Aldrich, St. Louis, Mo.) for 1 hour, incubated with 1:500 primary antibody (anti-phosphorylated γH2AX antibody, EMD Millipore, Billerica, Mass.) at 4° C. overnight, washed three times with TBS, and incubated with 1:1000 Alexa Fluor 488-conjugated secondary antibody (anti-mouse IgG antibody, Life Technologies, Carlsbad, Calif.) for 1 hour at room temperature. After three TBS washes, nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, Carlsbad, Calif.) for 15 min and again washed three times with TBS. Images were taken using a LSM 710 confocal microscope (Carl Zeiss, Thornwood, N.Y.) with a 63Ɨ objective. At least 50 cells and foci were counted per cell sample in duplicate cultures using software ImageJ.

Viability of Cells Post DSB Induction

Cells were treated with or without 10 μg/mL bleomycin (Sigma-Aldrich, St. Louis, Mo.) for 12 hours, followed by immediate media change with fresh warm culture media. Viable cells were counted daily up to four days post DSB induction. The survival rate was calculated as the viable cells in the treatment sample divided by those in the non-treatment control sample.

Results

CHO Cells are Deficient in DSB Repair

To test our hypothesis that the DSB repair system is not functioning effectively in CHO cells, DSB repair was compared between three cell lines, CHO-K1, BHK-21 and bEnd.3. To eliminate possible differential impacts of external culture environment on DSB formation and repair, the three cells were maintained in the same culture media and incubation conditions, and always treated in the same manner during experiments. An endogenous DSB level was first estimated by counting the number of γH2AX foci per cell in more than 100 cells. While CHO cells had an average of 0.7 DSBs more than bEnd.3 cells, the difference was not significant (p-value=0.20, Student's t-test), as both cells exhibited a similar level of endogenous DSBs, with ˜4.4 DSB formation per cell (FIG. 1A). BHK-21 cells had a lower endogenous DSB level than CHO-K1 and bEND.3 cells, with only 1.7 DSB formation per cell.

The DSB repair of the three cells was then compared by calculating the rate of decrease in γH2AX foci number following DSB induction with one-hour treatment of 10 or 50 μg/mL bleomycin (BL). As expected, the higher concentration of bleomycin added to the media induced more DSBs in cells (FIGS. 1B and 1C, and Table 2). However, CHO cells had substantially fewer DSBs after bleomycin treatment under both conditions, and also showed a slower repair rate than both BHK-21 and bEnd.3 cells, repairing fewer induced DSBs per hour (Table 2). Two possibilities are consistent with these observations. Either CHO cells have a lower DSB repair rate than BHK-21 and bEnd.3 cells in general, or the increase in DSBs in BHK-21 and bEnd.3 cells trigger a higher DSB repair rate.

TABLE 2
DSB repair
BL (μg/mL) Induced DSB number Repair rate (DSB/hour)
CHO-K1 10  6 0.9
BHK-21 10 13 1.8
bEnd.3 10 14 2.2
CHO-K1 50 13 1.7
BHK-21 50 20 2.3
bEnd.3 50 21 3.2

A more appropriate comparison of repair efficiency requires an equivalent level of induced DSB formation in all cell lines. With an equivalent level of induced DSBs, the observed difference in the rate of DSB disappearance is governed by the repair capability of each cell line, and thus can more accurately reflect the difference of DSB repair between different cell types. However, the number of induced DSBs is proportional to the intracellular concentration of bleomycin, and the transport mechanism of bleomycin possibly varies between different cell lines. Without a detailed understanding of the transport rates of bleomycin in CHO, BHK-21 and bEnd.3 cells, a one-hour treatment may not be sufficient to allow bleomycin to reach the same intracellular level in cells. Alternatively, given sufficient treatment time, passive diffusion of bleomycin through any cellular membrane will reach equilibrium, thus producing the same amount of intracellular bleomycin and subsequently, the same number of DSBs. Therefore, a 12-hour treatment was tested with 10 μg/mL bleomycin. Induction and repair of DSBs happen simultaneously during the 12 hours, and the cell with a slow repair would exhibit more DSBs after bleomycin removal (FIG. 2A). Indeed, because of slower repair, the CHO cells had more DSBs than bEnd.3 cells (FIG. 2B). After removing bleomycin, the CHO cells continued to repair DSBs at a rate of 0.89 DSB per hour, significantly lower than the rate of 1.03 DSB per hour by the bEnd.3 cells (p-value=2.06Ɨ10āˆ’10, ANCOVA analysis). CHO and BHK-21 cells had similar DSBs remaining after the 12-hour treatment. However, after bleomycin removal, BHK-21 cells exhibited a much higher repair rate, 2.64 DSB per hour (add statistical analysis). The results of comparing DSB repair under three conditions were all consistent with the hypothesis that DSB repair is deficient in CHO cells.

Expression of CH-Version Genes Improved DSB Repair

By comparing CHO-K1 and CH genome sequences, seven DSB repair genes were found to have notable sequence deviations between CHO and CH cells (Table 3), suggesting that these genes might be defective genes that result in a lower efficiency of the DSB repair system of CHO cells. To test the effect of gene sequence deviations on the repair capability, the seven DSB repair genes of functional (CH) versions were cloned, and transiently expressed individually in CHO cells. A 12-hour treatment with 10 μg/mL bleomycin was used to induce DSBs. After bleomycin removal, the number of γH2AX foci was quantified at four time points to evaluate DSB repair in the CHO cells expressing the CH-version genes. At one hour after bleomycin removal, a large number of DSBs were still unrepaired in control CHO-K1 cells (FIG. 3), whereas four CH-version genes helped the cells to achieve a lower DSB level (LIG4, PALB2, XRCC6 and PARI). In addition, the CHO cells managed to repair a certain amount of DSBs within 24 hours after bleomycin removal, but the four CH-version genes led to further reduced DSB numbers and significantly improved DSB repair. This result suggests that the sequence variations in the four DSB repair genes might be associated with the deficient DSB repair system of CHO cells, and expressing functional CH-version genes can improve DSB repair.

TABLE 3
CHO-version DSB genes: sequence variations compared to CH-version
Repair Nucleotide Amino Acid
Pathway Function Gene Change Change
HDR Core Repair PALB2  941 T > G I314S
Machinery 1190 C > T T397I
Regulator of PARI  161 G > A G54E
HDR Execution FBXO18 ā€ƒ25 C > T L9F
MUS81  346 C > A L116M
 971 C > G T324R
NHEJ Upstream RNF8 138 base pair 46 amino
Regulator deletion acid deletion
Core Repair XRCC6 1818 G > T Q606H
Machinery LIG4  433 C > A L145I
2221T > C C741R

The significant positive impact of CH-version XRCC6 on CHO's DSB repair leads to a question about its partner, the CH-version XRCC5. To participate in the NHEJ pathway, XRCC6 needs to form a heterodimer (called Ku) with XRCC5 to rapidly recognize DSBs and bind DNA ends with high affinity. Ku also activates DNA-dependent protein kinase and serves as a scaffold to recruit other key components in the NHEJ pathway. Unexpectedly, the expression of CH-version XRCC5 did not improve the repair in CHO cells (FIG. 4). These observations may suggest that the XRCC6 unit, rather than XRCC5 in Ku, is the defective component, impairing NHEJ pathway and undermining the DSB repair capability in CHO cells.

Overexpression of Specific DSB Repair Genes can Improve DSB Repair

Two possible underlying mechanisms may be resulting in the observed improvement in repair by expressing the four CH-version DSB repair genes: a) the sequence differences in the four CHO-version genes impair protein function and expression of the correct CH-version rescues the DSB repair pathway; or b) CHO-version genes are functioning adequately and the heterologous expression of the CH genes simply provides copies of functioning proteins that increase the repair rate. To address this question, the four repair genes, PALB2, PARI, LIG4, and XRCC6 were cloned with their corresponding CHO-version sequences. The effect of CH or CHO-version genes on repair capability was compared in CHO cells transfected with the two versions of expression plasmids. The relationship between gene abundance and DSB repair was also explored by transfecting various concentrations of plasmid. For all four of the genes tested, cells expressing the CH-version did not seem to provide a significant improvement in DSB repair compared with the cells expressing the CHO-version of genes, at any given time point (FIG. 5). This observations is consistent with CHO-version genes functioning adequately relative to CH-version genes where the overexpression of the CHO-version would produce similar impacts on DSB repair improvement as the CH-counterparts. Another interesting observation is that the DSB repair efficiency changed in a concentration dependent manner in cells expressing XRCC6 or PARI (FIGS. 5A and B), but not PALB2 or LIG4 (FIGS. 5C and D). As the expression of XRCC6 or PARI increased, CHO cells showed fewer DSBs remaining and thus had a better DSB repair. These results are consistent with a mechanism where the improvement in DSB repair by expressing CH- or CHO-version DSB genes is primarily due to an increased abundance of the respective proteins.

All documents, books, manuals, papers, patents, published patent applications, guides, abstracts, and/or other references cited herein are incorporated by reference in their entirety. Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with the true scope and spirit of the invention being indicated by the following claims.

Claims

What is claimed:

1. A recombinant eukaryotic cell expressing a heterologous double strand break (DSB) repair protein in an amount effective for enhancing DSB repair in the cell.

2. The recombinant eukaryotic cell of claim 1, wherein the heterologous DSB repair protein is expressed in an amount effective for enhancing stability of the cell for at least 1 month.

3. The recombinant eukaryotic cell of claim 1 or 2, wherein the heterologous DSB repair protein may be selected from the group consisting of DNA ligase IV (LIG4), x-ray repair cross complementing 6 (XRCC6), partner and localizer of BRCA2 (PALB2), and PARP1 binding protein which is encoded by the PARPBP gene (PARI).

4. The recombinant eukaryotic cell of claim 3, wherein the heterologous DSB repair protein is LIG4 or XRCC6.

5. The recombinant eukaryotic cell of any one of claims 1-4, wherein the heterologous DSB repair protein is expressed transiently.

6. The recombinant eukaryotic cell of any one of claims 1-4, wherein the heterologous DSB repair protein is expressed stably.

7. The recombinant eukaryotic cell of any one of claims 1-6, wherein the recombinant eukaryotic cell is a mammalian cell.

8. The recombinant eukaryotic cell of claim 7, wherein the mammalian cell is selected from the group consisting of a rodent cell, a mouse cell and a Chinese hamster cell.

9. The recombinant eukaryotic cell of any one of claims 1-8, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.

10. The recombinant eukaryotic cell of any one of claim 1-9, wherein the heterologous DSB repair protein is from a Chinese hamster cell.

11. The recombinant eukaryotic cell of any one of claims 1-9, wherein the heterologous DSB repair protein is from a Chinese hamster ovary (CHO) cell.

12. The recombinant eukaryotic cell of claim 1, wherein the heterologous DSB repair protein comprises an amino acid sequence at least 70% identical to the amino acid sequence of SEQ ID No: 1, 2, 3 or 4.

13. The recombinant eukaryotic cell of any one of claims 1-12, wherein the recombinant eukaryotic cell comprises a heterologous DSB repair gene encoding the heterologous DSB repair protein.

14. The recombinant eukaryotic cell of claim 13, wherein the heterologous DSB repair gene comprises a nucleic acid sequence at least 70% identical to the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8.

15. The recombinant eukaryotic cell of claim 13 or 14, wherein the heterologous DSB repair gene is integrated into the genome of the recombinant eukaryotic cell.

16. The recombinant eukaryotic cell of any one of claims 1-15, comprising a heterologous nucleic acid sequence encoding a recombinant product of interest and expressing the recombinant product of interest.

17. The recombinant eukaryotic cell of claim 16, wherein the recombinant product of interest is a protein or a polypeptide.

18. The recombinant eukaryotic cell of claim 17, wherein the protein is a monoclonal antibody.

19. The recombinant eukaryotic cell of claim 16, wherein the heterologous nucleic acid sequence encoding the recombinant product of interest is integrated into the genome of the recombinant eukaryotic cell.

20. The recombinant eukaryotic cell of claim 19, further comprising a heterologous nucleic acid sequence encoding a selection marker integrated into the genome of the recombinant eukaryotic cell.

21. The recombinant eukaryotic cell of any one of claims 16-20, wherein the recombinant product of interest is a secreted embryonic alkaline phosphate (SEAP).

22. A method for enhancing double strand break (DSB) repair in eukaryotic cells, comprising expressing an effective amount of a heterologous DSB repair protein in the eukaryotic cells.

23. The method of claim 22, further comprising enhancing stability of the eukaryotic cells over time.

24. The method of claim 22 or 23, further comprising introducing into the eukaryotic cells a heterologous nucleic acid gene encoding the heterologous DSB repair protein.

25. The method of claim 24, wherein the heterologous nucleic acid sequence encoding the heterologous DSB repair protein is introduced into the eukaryotic cells by overexpression, transgene expression, gene knock-in, gene activation, transcription activation, translation activation, gene mutation or a combination thereof.

26. A method for establishing host cells for production of a recombinant product of interest, comprising:

(a) expressing a heterologous double strand break (DSB) repair protein in the eukaryotic cells;

(b) determining DSB repair in the eukaryotic cells of step (a); and

(c) isolating eukaryotic cells in which the DSB repair is enhanced as host cells.

27. The method of claim 26, further comprising editing the genome of the host cells to improve DSB repair in the host cells.

28. A method for producing a recombinant product of interest, comprising:

(a) growing eukaryotic cells in a culture medium, wherein the recombinant eukaryotic cells comprise a heterologous nucleic acid sequence encoding a recombinant product of interest;

(b) expressing a heterologous double strand break (DSB) repair protein in the eukaryotic cells; and

(c) expressing the recombinant product of interest by the eukaryotic cells.

29. The method of claim 28, wherein the average productivity of the recombinant product of interest by the eukaryotic cells drops less than 30% over a period of at least 8 weeks.

30. The method of claim 28, wherein the eukaryotic cells retain at least 70% of the copy number of the heterologous nucleic acid sequence encoding the recombinant product of interest over a period of at least 8 weeks.

31. The method of any one of claims 28-30, further comprising editing the genome of the eukaryotic cells to improve DSB repair in the eukaryotic cells.

32. A method of improving production of a recombinant product of interest by eukaryotic cells, wherein the eukaryotic cells comprise a heterologous nucleic acid sequence encoding the recombinant product of interest and produce the recombinant product of interest, comprising expressing a heterologous double strand break (DSB) repair protein by the recombinant eukaryotic cells.

33. The method of claim 32, further comprising enhancing DSB repair in the eukaryotic cells.

34. The method of claim 32, further comprising enhancing stability of the eukaryotic cells over time.

35. A method of investigating suitability of eukaryotic cells as host cells for producing a recombinant product of interest, wherein the eukaryotic cells comprise a heterologous nucleic acid sequence encoding the recombinant product of interest, comprising:

(a) expressing a heterologous double strand break (DSB) repair protein by the eukaryotic cells; and

(b) determining DSB repair in the eukaryotic cells, wherein an improvement of the DSB repair indicates that the eukaryotic cells are suitable as host cells for producing a recombinant product of interest.

36. The method of any one of claims 22-35, wherein the DSB repair protein is from the group consisting of DNA ligase IV (LIG4), x-ray repair cross complementing 6 (XRCC6), partner and localizer of BRCA2 (PALB2), and PARP1 binding protein which is encoded by the PARPBP gene (PARI).

37. The method of claim 36, wherein the heterologous DSB repair protein is LIG4 or XRCC6.

38. The method of any one of claims 22-37, wherein the heterologous DSB repair protein is expressed transiently.

39. The method of any one of claims 22-37, wherein the heterologous DSB repair protein is expressed stably.

40. The method of any one of claims 22-39, wherein the eukaryotic cells are mammalian cells.

41. The method of claim 40, wherein the mammalian cells are selected from the group consisting of rodent cells, mouse cells and Chinese hamster cells.

42. The method of claim 40, wherein the mammalian cells are CHO cells.

43. The method of any one of 22-42, wherein the heterologous DSB repair protein is from a Chinese hamster (CH) cell.

44. The method of any one of claims 22-42, wherein the heterologous DSB repair protein is from a Chinese hamster ovary (CHO) cell.

45. The method of any one of claims 22-42, wherein the heterologous DSB repair protein comprises an amino acid sequence at least 70% identical to the amino acid sequence of SEQ ID No: 1, 2, 3 or 4.

46. The method of any one of claims 22-45, wherein the eukaryotic cell comprises a heterologous DSB repair gene encoding the heterologous DSB repair protein.

47. The method of claim 46, wherein the heterologous DSB repair gene comprises a nucleic acid sequence at least 70% identical to the nucleic acid sequence of SEQ ID No: 5, 6, 7 or 8.

48. The method of claim 46 or 47, wherein the heterologous DSB repair gene is integrated into the genome of the eukaryotic cell.

49. The method of any one of claims 28-48, further comprising expressing a selection maker by the eukaryotic cells, wherein the eukaryotic cells further comprises a heterologous nucleic acid sequence encoding the selection marker, and wherein the heterologous nucleic acid sequence encoding the recombinant product of interest and the heterologous nucleic acid sequence encoding the selection marker are integrated into the genome of the eukaryotic cells.

50. The method of any one of claims 28-49, further comprising growing the eukaryotic cells under a condition that induces DNA damage.

51. The method of any one of claims 28-50, wherein the recombinant product of interest is a protein or a polypeptide.

52. The method of claim 51, wherein the protein is a monoclonal antibody.

53. The method of claim 35, wherein the heterologous DSB repair protein is LIG4 or XRCC6, further comprising quantifying the expression of the LIG4 or XRCC6 in the eukaryotic cells.

54. The method of claim 35 or 53, further comprising quantifying the expression of the recombinant product of interest by the eukaryotic cells.

55. The method of claim 54, further comprising identifying eukaryotic cells into whose genome the heterologous nucleic acid sequence encoding the recombinant product of interest is integrated.

56. The method of claim 54, further comprising identifying eukaryotic cells producing the recombinant product of interest in an amount greater than 100 mg per liter for recombinant eukaryotic cells.

57. Host cells established according to the method of claim 26 or 27.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: