Patent application title:

PEPTIDE TARGETING MYCOBACTERIUM TUBERCULOSIS TOXIN-ANTITOXIN SYSTEM AND USE THEREOF

Publication number:

US20220033439A1

Publication date:
Application number:

16/632,867

Filed date:

2018-07-31

Abstract:

The present invention relates to a peptide targeting a toxin-antitoxin system of Mycobacterium tuberculosis and a use thereof. Specifically, the antibiotic peptide of the present invention inhibits the formation of a toxin-antitoxin complex of Mycobacterium tuberculosis without affecting an active site of the toxin, thereby inducing the death of Mycobacterium tuberculosis by means of a separated toxin. Therefore, the antibiotic peptide can be usefully used as an antibiotic composition against Mycobacterium tuberculosis.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

A61K38/00 »  CPC further

Medicinal preparations containing peptides

C07K7/08 »  CPC main

Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof; Linear peptides containing only normal peptide links having 12 to 20 amino acids

Description

BACKGROUND OF THE INVENTION

1. Field of the Invention

The present invention relates to a peptide targeting a toxin-antitoxin system of Mycobacterium tuberculosis and a use thereof.

2. Description of the Related Art

Tuberculosis is an acute and chronic disease which is infectious and contagious that can occur anywhere in the body. It is a terrible disease that can even lead to death. Approximately 85% of tuberculosis is developed in the lung and can be spread to any organ in the body through blood stream or lymph nodes. Tuberculosis is transmitted through the air from cough, runny nose and sputum of a patient. Approximately 9 million people were infected with tuberculosis in 2013, among which about 1.5 million people were dead. In addition, because of the emergence of multidrug-resistant tuberculosis and even fully resistant tuberculosis, it is requested to develop a novel antimicrobial agent to treat Mycobacterium tuberculosis.

A toxin-antitoxin gene was first known to play a certain role in maintaining E. coli plasmid. When the plasmid containing the toxin-antitoxin gene is lost, the toxin with a stable structure is retained, but the antitoxin protein with an unstable structure is degraded, leading to the destruction of E. coli eventually. Since the toxin-antitoxin gene was first identified, it has been found that the toxin-antitoxin gene is present not only in the plasmid but also in the chromosome of E. coli. It is known that the gene above is involved in multidrug resistance, biofilm formation and growth inhibition under stress situations.

Toxin-antitoxin systems can be largely divided into three types (Type I, II and III). In type I system, an antitoxin in the form of RNA binds to a toxin in the form of RNA to eliminate the toxicity. In type II system, an antitoxin in the form of protein binds to a toxin in the form of protein to eliminate the toxicity. In type III systems, an antitoxin in the form of RNA binds to a toxin in the form of protein to eliminate the toxicity.

Among these three types, type II system has been most studied. In type II system, toxin and antitoxin genes are coded through operon. Under the difficult external conditions for bacteria, such as elevated temperature or depletion of nutrients, unstable antitoxins are decomposed by stress-inducing proteolytic enzymes and accordingly cannot neutralize the toxin's toxicity, resulting in cell death. The largest part of type II system is VapBC family, and the toxin portion (VapC) of the VapBC family is known to inhibit cell growth based on the RNase activity thereof.

If the formation of the toxin-antitoxin complex can be artificially inhibited, the toxic toxin would not be neutralized and therefore cell would be eventually dead. Thus, the toxin-antitoxin system is an attractive target for the development of novel antibiotics.

In Mycobacterium tuberculosis, more than half of the toxin-antitoxin systems are found to belong to VapBC family. Such VapBC family is involved in the extreme incubation period and drug resistance of Mycobacterium tuberculosis.

Thus, the present inventors tried to develop a therapeutic agent for tuberculosis targeting the toxin-antitoxin protein complex. In the course of our study, the inventors identified the structure of the VapBC26 complex of Mycobacterium tuberculosis, based on which the inventors designed a peptide that can obstruct the formation of a toxin-antitoxin protein complex and confirmed that the peptide was able to inhibit the formation of the toxin-antitoxin protein complex in vitro successfully, leading to the completion of the present invention.

SUMMARY OF THE INVENTION

It is an object of the present invention to provide a peptide targeting a toxin-antitoxin system of Mycobacterium tuberculosis and a composition comprising the same as an active ingredient.

To achieve the above object, the present invention provides an antibiotic peptide that inhibits the binding of an antitoxin protein to any one or more residues selected from the group consisting of α3 and α4 of a Mycobacterium tuberculosis toxin protein.

The present invention also provides an antibiotic composition against Mycobacterium tuberculosis comprising the antibiotic peptide as an active ingredient.

The present invention also provides an antibiotic quasi-drug against Mycobacterium tuberculosis comprising the antibiotic peptide as an active ingredient.

The present invention also provides an antibiotic external preparation against Mycobacterium tuberculosis comprising the antibiotic peptide as an active ingredient.

The present invention also provides a method for preventing, ameliorating or treating Mycobacterium tuberculosis comprising a step of administering the antibiotic peptide to a subject.

In addition, the present invention provides a use of the antibiotic peptide for the preparation of antibiotics against Mycobacterium tuberculosis.

Advantageous Effect

The antibiotic peptide of the present invention inhibits the formation of a toxin-antitoxin complex of Mycobacterium tuberculosis without affecting an active site of the toxin, thereby inducing the death of Mycobacterium tuberculosis by means of a separated toxin. Therefore, the antibiotic peptide can be usefully used as an antibiotic composition against Mycobacterium tuberculosis.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGS. 1a and 1b are diagrams showing the results of multi-angle light scattering (MALS) combined with size exclusion chromatography performed to determine the structures of VapB26 and VapBC26.

FIGS. 2a˜2d are schematic diagrams showing the structure of the VapBC26 complex.

FIGS. 3a˜3d are diagrams showing the shapes of VapBC26 hetero-octamer, VapC26 dimer, VapB26 dimer and VapBC26 hetero-dimer from various aspects.

FIG. 4 is a diagram showing the interface of the hetero-dimer formed between VapB26 and VapC26.

FIGS. 5a˜5d are diagrams showing the hydrophobic interface and active site of the homozygous dimer formed between two VapC26s.

FIGS. 6a˜6d are diagrams showing the interface of the homo-dimer formed between two VapB26s.

FIGS. 7a and 7b are diagrams showing the structures of the VapBC26 complex and VapB proteins compared to their homologs.

FIG. 8 is a diagram showing the comparison of the nucleotide sequences of VapC proteins of Mycobacterium tuberculosis, Shigella flexneri and Rickettsia felis strains.

FIGS. 9a˜9d are diagrams showing the ribonuclease activity of VapC26 measured using a mimetic peptide to VapC26 α4 (9a, 9b (mimetic peptide concentration fixation)), the ribonuclease activity measured using the VapBC26 complex and the mutant complex thereof (9c) and the results of size exclusion chromatography performed using the same (9d).

FIG. 10 is a diagram showing the ribonuclease activity of VapBC26 measured when the mimetic peptides α3 and α4 were added respectively or together.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

Hereinafter, the present invention is described in detail.

The present invention provides an antibiotic peptide that inhibits the binding of an antitoxin protein to any one or more residues selected from the group consisting of α3 and α4 of a Mycobacterium tuberculosis toxin protein.

The said peptide can be synthesized by the conventional chemical synthesis method in the art (W. H. Freeman and Co., Proteins; structures and molecular principles, 1983). Particularly, the peptide can be synthesized by solution phase peptide synthesis, solid-phase peptide syntheses, fragment condensation, and F-moc or T-BOC chemical method, and more particularly, it can be synthesized by solid-phase peptide synthesis.

The peptide of the present invention can also be prepared by the following genetic engineering method. First, a DNA sequence encoding the peptide is constructed according to the conventional method. The DNA sequence can be prepared by PCR amplification using appropriate primers. Alternatively, the DNA sequence can be synthesized by the standard method known in the art, such as using automated DNA synthesizers (eg, products of Biosearch or Applied Biosystems).

The DNA sequence is inserted into a vector comprising one or more expression control sequences (eg, promoters, enhancers, etc.) that are operably linked thereto to regulate the DNA sequence expression. The host cell is transformed with the recombinant expression vector formed therefrom, and the resulting transformant is cultured under the appropriate media and conditions to allow the DNA sequence to be expressed. Then, the substantially pure peptide encoded by the DNA sequences is recovered from the culture product using the method known in the art (eg, chromatography). The genetic engineering method for the peptide synthesis of the present invention can be referred to the following literature: Maniatis et al., Molecular Cloning; A laboratory Manual, Cold Spring Harbor laboratory, 1982; Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, N.Y., Second (1998) and Third (2000) Edition; Gene Expression Technology, Method in Enzymology, Genetics and Molecular Biology, Method in Enzymology, Guthrie & Fink (eds.), Academic Press, San Diego, Calif., 1991; and Hitzeman et al., J. Biol. Chem., 255:12073-12080, 1990.

The toxin protein can be composed of the amino acid sequence represented by SEQ. ID. NO: 15.

The said α3 and α4 can be the residues involved in binding of VapC26 and VapB26. Particularly, in an embodiment of the present invention, α3 can be composed of the 37th to 52nd amino acid sequence of VapC26. In addition, α4 can be composed of the 54th to 65th amino acid sequence of VapC26.

The peptide can include a polypeptide consisting of any sequence known in the art. In an embodiment of the present invention, the peptide can be composed of any one or more amino acid sequences selected from the group consisting of SEQ ID NOs: 11˜13. More particularly, the peptide can be a peptide consisting of the amino acid sequence represented by SEQ ID NO: 12.

The peptide can be a variant of an amino acid sequence having a different sequence formed by deletion, insertion, substitution, or a combination thereof of amino acid residues within a range that does not affect the function of the protein. Amino acid exchange in proteins or peptides that does not alter the activity of the molecule as a whole is known in the art. In some cases, it can be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, or farnesylation. Therefore, the present invention can include a polypeptide having an amino acid sequence substantially identical to a polypeptide having an amino acid sequence represented by any one or more sequences selected from the group consisting of SEQ ID NOs: 11˜13, and a variant or a fragment thereof. The said substantially identical polypeptide can have homology with at least 80%, specifically at least 90% and more specifically at least 95% with the polypeptide of the present invention. In addition, the peptide does not affect the activity of the toxin.

In a preferred embodiment of the present invention, the present inventors identified the structure of VapBC26 to synthesize an antibiotic peptide that can inhibit toxin-antitoxin binding. To do so, the VapBC26 protein complex, toxin (VapC26) and antitoxin (VapB26) proteins of Mycobacterium tuberculosis were isolated and purified. Then, the molecular weight of the VapBC26 protein complex was confirmed almost similar to the theoretical molecular weight of the VapBC26 hetero-octamer model by performing the experiments such as multi-angle light scattering and sitting-drop vapor diffusion, and the specific structure was determined (see FIGS. 1˜7).

According to the structure confirmed above, seven peptides were designed that mimic the binding region of the toxin without affecting the toxin. When they were treated with the VapBC26 protein complex, the formation of the protein complex was inhibited (see FIGS. 9 and 10). By further experiments, it was confirmed that the Tyr51 region of VapB26 played the most important role in the interaction between VapB26 and VapC26 (see FIG. 9).

Thus, the synthetic peptide of the present invention inhibited the formation of a toxin-antitoxin protein complex of Mycobacterium tuberculosis without affecting the activity of the toxin, thereby inducing the death of Mycobacterium tuberculosis by means of a separated toxin. Therefore, the synthetic peptide can be effectively used as an antibiotic peptide against Mycobacterium tuberculosis.

The present invention also provides an antibiotic composition against Mycobacterium tuberculosis comprising the antibiotic peptide as an active ingredient.

The antibiotic composition against Mycobacterium tuberculosis can inhibit any one or more residues selected from the group consisting of α3 and α4 of a Mycobacterium tuberculosis toxin protein from binding to an antitoxin protein. Therefore, it is possible to suppress the formation of the VapBC26 complex, which is a conjugate of toxin-antitoxin of Mycobacterium tuberculosis.

The toxin protein can be composed of the amino acid sequence represented by SEQ ID NO: 15. The α3 and α4 can be the residues involved in binding of VapC26 and VapB26. Particularly, in an embodiment of the present invention, α3 can be composed of the 37th to 52nd amino acid sequence of VapC26. In addition, α4 can be composed of the 54th to 65th amino acid sequence of VapC26.

The peptide can include a polypeptide consisting of any sequence known in the art. In an embodiment of the present invention, the peptide can be composed of any one or more amino acid sequences selected from the group consisting of SEQ ID NOs: 11˜13. More particularly, the peptide can be a peptide consisting of the amino acid sequence represented by SEQ ID NO: 12.

The peptide can be a variant of an amino acid sequence having a different sequence formed by deletion, insertion, substitution, or a combination thereof of amino acid residues within a range that does not affect the function of the protein. Amino acid exchange in proteins or peptides that does not alter the activity of the molecule as a whole is known in the art. In some cases, it can be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, or farnesylation. Therefore, the present invention can include a polypeptide having an amino acid sequence substantially identical to a polypeptide having an amino acid sequence represented by any one or more sequences selected from the group consisting of SEQ ID NOs: 11˜13, and a variant or a fragment thereof. The said substantially identical polypeptide can have homology with at least 80%, specifically at least 90% and more specifically at least 95% with the polypeptide of the present invention. In addition, the peptide does not affect the activity of the toxin.

The synthetic peptide of the present invention inhibits the formation of a toxin-antitoxin complex of Mycobacterium tuberculosis without affecting the activity of the toxin (see FIGS. 9 and 10), thereby inducing the death of Mycobacterium tuberculosis by means of the separated toxin. Therefore, the peptide can be effectively used as an antibiotic composition against Mycobacterium tuberculosis.

The antibiotic composition comprising the antibiotic peptide of the present invention preferably contains the antibiotic peptide at the amount of 0.1 to 50 weight % by the total weight of the composition, but not always limited thereto.

The composition of the present invention can further include suitable carriers, excipients and diluents commonly used in the preparation of a medicine.

The composition of the present invention can be formulated for oral administration, for example powders, granules, tablets, capsules, suspensions, emulsions, syrups and aerosols, and for parenteral administration, for example external use, suppositories and sterile injections, etc. The carriers, excipients and diluents are exemplified by lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. Formulations can be prepared by using generally used excipients or diluents such as fillers, extenders, binders, wetting agents, disintegrating agents and surfactant. Solid formulations for oral administration are tablets, pills, powders, granules and capsules. These solid formulations are prepared by mixing one or more suitable excipients such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. Except for the simple excipients, lubricants, for example magnesium stearate, talc, etc, can be used. Liquid formulations for oral administrations are suspensions, solutions, emulsions and syrups, and the above-mentioned formulations can contain various excipients such as wetting agents, sweeteners, aromatics and preservatives in addition to generally used simple diluents such as water and liquid paraffin. Formulations for parenteral administration are sterilized aqueous solutions, water-insoluble excipients, suspensions, emulsions, lyophilized preparations, suppositories and injections. Water insoluble excipients and suspensions can contain, in addition to the active compound or compounds, propylene glycol, polyethylene glycol, vegetable oil like olive oil, injectable ester like ethylolate, etc. Suppositories can contain, in addition to the active compound or compounds, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin, etc.

The present invention also provides an antibiotic quasi-drug against Mycobacterium tuberculosis comprising the antibiotic peptide as an active ingredient.

The antibiotic quasi-drug against Mycobacterium tuberculosis can inhibit any one or more residues selected from the group consisting of α3 and α4 of a Mycobacterium tuberculosis toxin protein from binding to an antitoxin protein. Therefore, it is possible to suppress the formation of the VapBC26 complex, which is a conjugate of toxin-antitoxin of Mycobacterium tuberculosis.

The toxin protein can be composed of the amino acid sequence represented by SEQ ID NO: 15. The α3 and α4 can be the residues involved in binding of VapC26 and VapB26. Particularly, in an embodiment of the present invention, α3 can be composed of the 37th to 52nd amino acid sequence of VapC26. In addition, α4 can be composed of the 54th to 65th amino acid sequence of VapC26. The peptide does not affect the activity of the toxin.

The synthetic peptide of the present invention inhibits the formation of a toxin-antitoxin protein complex of Mycobacterium tuberculosis without affecting the activity of the toxin (see FIGS. 9 and 10), thereby inducing the death of Mycobacterium tuberculosis by means of the separated toxin. Therefore, the synthetic peptide can be effectively used as an antibiotic quasi-drug against Mycobacterium tuberculosis.

When the composition of the present invention is used as a quasi-drug additive, the peptide can be added as it is, or used together with other quasi-drugs or quasi-drug components, and can be appropriately used according to the conventional method. The mixing amount of the active ingredient can be appropriately determined according to the purpose of use.

The quasi-drug composition of the present invention is preferably disinfectant cleaner, shower foam, gagreen, wet tissue, detergent soap, hand wash, humidifier filler, mask, ointment, patch or filter filler, but not always limited thereto.

The present invention also provides an antibiotic external preparation against Mycobacterium tuberculosis comprising the antibiotic peptide as an active ingredient.

The antibiotic external preparation against Mycobacterium tuberculosis can inhibit any one or more residues selected from the group consisting of α3 and α4 of a Mycobacterium tuberculosis toxin protein from binding to an antitoxin protein. Therefore, it is possible to suppress the formation of the VapBC26 complex, which is a conjugate of toxin-antitoxin of Mycobacterium tuberculosis.

The toxin protein can be composed of the amino acid sequence represented by SEQ ID NO: 15. The α3 and α4 can be the residues involved in binding of VapC26 and VapB26. Particularly, in an embodiment of the present invention, α3 can be composed of the 37th to 52nd amino acid sequence of VapC26. In addition, α4 can be composed of the 54th to 65th amino acid sequence of VapC26. The peptide does not affect the activity of the toxin.

The synthetic peptide of the present invention inhibits the formation of a toxin-antitoxin protein complex of Mycobacterium tuberculosis without affecting the activity of the toxin (see FIGS. 9 and 10), thereby inducing the death of Mycobacterium tuberculosis by means of the separated toxin. Therefore, the synthetic peptide can be effectively used as an antibiotic external preparation against Mycobacterium tuberculosis.

The present invention also provides a method for preventing, ameliorating or treating Mycobacterium tuberculosis comprising a step of administering the antibiotic peptide to a subject.

The antibiotic peptide of the present invention can have the characteristics as described above. The subject may be a mammal, specifically a human.

The composition of the present invention can be administered orally or parenterally, and any parenteral administration can be used. At this time, systemic or topical administration is possible, but systemic administration is more preferred, and intravenous administration is most preferred.

The effective dosage of the composition of the present invention can be determined according to condition and weight of a patient, severity of a disease, form of a drug, administration pathway and duration by those skilled in the art. However, for the desired effect, the effective dosage of the antibiotic peptide of the present invention is 1-2 mg/kg, preferably 0.5-1 mg/kg, and can be administered 1 to 3 times a day.

The antibiotic composition of the present invention can be administered to a patient in the form of bolus, by single dose having relatively short period of infusion or by multiple dose of fractionated treatment protocol for a long term.

In addition, the present invention provides a use of the antibiotic peptide for the preparation of antibiotics against Mycobacterium tuberculosis.

The antibiotic peptide of the present invention can have the characteristics as described above.

Practical and presently preferred embodiments of the present invention are illustrative as shown in the following Examples.

However, it will be appreciated that those skilled in the art, on consideration of this disclosure, may make modifications and improvements within the spirit and scope of the present invention.

<Example 1> Expression and Purification of Toxin (VapC26) and Antitoxin (VapB26) Protein

The present inventors performed the following process to obtain Mycobacterium tuberculosis toxin (VapC26), antitoxin (VapB26) and a toxin-antitoxin (VapBC26) protein complex.

<1-1> Cloning and Transformation of Toxin and Antitoxin Genes

First, the gene Rv0582 (Bioneer Innovation, Korea) encoding the toxin protein VapC26 of Mycobacterium tuberculosis and the gene Rv0581 (Bioneer Innovation, Korea) encoding the antitoxin protein VapB26 were amplified by PCR (polymerase chain reaction). The sequence of each primer used for PCR is as follows.

TABLE 1
SEQ. ID.
Gene Primer NO:
VapC26 5′-GGAA TTC CAT ATG ATC GAC ACG SEQ. ID.
AGT GCG-3′(forward) NO: 1
5′-CCG CTC GAG TTA CGG AAT GAC SEQ. ID.
GGT GAA CGC CCC-3′(reverse) NO: 2
VapB26 5′-G GAA TTC CAT ATG GAC AAG ACG SEQ. ID.
ACG GTC-3′(forward) NO: 3
5′-TTA CCG CTC GAG CCG CTC SEQ. ID.
ACCGAAGCCAGC CAG-3′(reverse) NO: 4
VapB26 5′- SEQ. ID.
(for GGCGGGGCCTGGGAGATGGCCAACTGCGGT NO: 5
muta- GCC-3′(forward)
tion) 5′- SEQ. ID.
GGCACCGCAGTTGGCCATCTCCCAGGCCCC NO: 6
GCC-3′(reverse)

VapC26 was obtained by performing size exclusion chromatography using HiLoad 16/60 Superdex 75 prep-grade column (GE Healthcare) under the same buffer condition as used in the purification of apBC26.

<Example 2> Multi-Angle Light Scattering Combined with Size Exclusion Chromatography

Multi-angle light scattering (MALS) was performed to determine the oligomer structures of VapB26 and VapBC26.

Size exclusion chromatography was performed by using 1260 Infinity HPLC system (Agilent Technologies) with BioSep SEC-s3000 column (Phenomenex). Scattering data were obtained from the miniDAWN-TREOS line (Wyatt Technology) at 657.4 nm for emission and analyzed with ASTRA 6.0.1.10 software (Wyatt Technology). For the experiment, 100 μM of VapB26 and VapBC26 were used. VapB26 was analyzed in a buffer containing 20 mM MES (pH 6) and 50 mM NaCl, which was the condition of NMR experiment, and VapBC26 was analyzed in a buffer containing 50 mM Tris-HCl (pH 7.9), 500 mM NaCl and 250 mM imidazole, which was the condition of protein crystallization experiment. All experiments were performed at room temperature.

As a result, as shown in FIGS. 1a and 1b, it was confirmed that the molecular weight of the VapBC26 protein complex was 97.5±1.6 kDa, which was almost similar to the theoretical molecular weight (97.0 kDa) of the hetero-octamer model of VapBC26 (FIGS. 1a and 1b).

<Example 3> Structural Analysis of Toxin and Antitoxin Proteins

<3-1> Formation of Toxin-Antitoxin (VapBC26) Protein Complex Crystal and Data Analysis

Sitting-drop vapor diffusion was performed to confirm the crystal structure of the VapBC26 protein complex purified in Example 1.

Samples were prepared by mixing 1 of the VapBC26 protein complex solution dissolved in 50 mM Tris-HCl at the concentration of 5 mg/ with 250 mM imidazole containing 1 of reservoir solution. Initial crystal screening with the VapBC26 protein complex was performed using crystal screening 1, 2 and Index 1, 2 kit (Hamton Research). Crystals of the VapBC26 complex were grown at 4° C., and 25% Taximate (pH 7.0) was used as a crystallization solution. The crystals were frozen immediately with liquid nitrogen because severe cracking damage occurred when they were contacted with glycerol containing a cryoprotectant.

Data were collected using beamline 7A and ADSC Quantum Q270 CCD detector in Pohang Accelerator Center (Korea). As a result, as shown in Table 2, the unit cell parameters of the crystals of the native VapBC26 complex were as follows: a=64.35 Å, b=64.35 Å, c=216.96 Å and α=β=γ=90°. The unit cell parameters of the crystals of the VapBC26 substituted with selenomethionine (SeMet) were as follows: a=64.22 Å, b=64.22 Å, c=216.13 Å and α=β=γ=90°. Both proteins belonged to the square space group P41. On the other hand, the calculated total mass of the protein complex containing His-6 tag at N terminus was 24,116.3 Da. At this time, all data were processed using HKL2000 software. The structure of the VapBC26 complex of Mycobacterium tuberculosis was analyzed at 2.65 Å resolution by single wavelength anomalous dispersion using SeMet (2.55 Å to the native complex crystals) (Table 2a).

In addition, the mutation of Met50 did not affect the folding of the protein, the structures of the two complexes were almost the same, and the pattern of protein-protein interaction was also the same (Table 2b). The native complex crystals showed slightly better resolution. However, the selenomethionine-substituted crystals were analyzed as with the native complex, and the crystallization conditions and spatial groups were the same, so further analysis was performed using the data of SeMet.

TABLE 2
Data Collection Se-Met Native
(a) Data Collection
X-ray source 7A beamline of 7A beamline of
PLS PLS
X-ray wavelength(â„«) 0.9794 0.9795
Space group P41 P41
Unit cell parameters/a, 64.22, 64.22, 64.35, 64.35,
b, c(â„«) 216.13 216.96
Unit cell parameters α, c = 233.03 c = 232.79
β, γ(°)
Resolution range(â„«) 30-2.65 50-2.65
molecules per ASU 4 VapBC26 4 VapBC26
heterodimers heterodimers
observed reflections(>1σ) 619653 105433
unique reflections 25229 27340
Completeness(%) 99.8(100)e 94.9(99.1)e
<I/σ(I)> 70.20(10.87)e 34.98(3.93)e
multiplicitya 24.6(25.4)e 3.9(4.2)e
Rmergeb 11.3(54.3)e 7.8(67)e
(b) Additional Analysis
Rworkc 20.8 22.8
Rfreed 23.9 28.4
No. of atoms/average B-factor(â„«2)
Protein 6170/61.0 5978/79.8
Water oxygen  65/47.9  54/83.1
RMSDf from ideal geometry
Bond distance(â„«) 0.006 0.007
Bond angle(°) 1.25 1.27
Ramachandran statistics
Most favored 96.2 95.5
regions(%)
Additional allowed 3.7 4.4
regions(%)
Residues in disallowed 0.1 0.1
regions(%)
aNobs/Nunique
bRmerge = Σ(I − <I>)I Σ<I>
cRwork = Σhkl||Fobs| − k|Fcalc||/Σhkl|Fobs|
dRwork value was calculated at the remaining reflection.
eThe value in the insert is the highest resolution shell value.
fRMSD(Root mean square deviation) was obtained using REFMAC ™.

<3-2> Confirmation of Toxin-Antitoxin (VapBC26) Protein Complex Structure

The crystal structure of the VapBC26 protein complex of Mycobacterium tuberculosis was confirmed based on the data obtained in Example <3-1>.

The asymmetric unit of the VapBC26 protein complex crystal included four VapB26 and four VapC26 proteins in a hetero-octameric assembly. Four of the heterodimeric VapBC26 protein complexes were included in the asymmetric unit. A VapB26 dimer was bound to two VapC26 monomers, and the two VapB2C2 complexes were linked to each other by a double axis. A flexible hinge loop of the antitoxin was confirmed to envelope the toxin protein by a hook known as the looped arm shape (FIGS. 2a˜2d and FIGS. 3a˜3d).

In the structure of the VapBC26 protein complex heterodimer, VapB26 was linked to VapC26 through the deep valley formed by four α-helices (α1-4) of VapC26 (FIG. 4). At this time, two C-terminal segments of VapB26, Arg59-Val61 and Phe68-Glu70 rotated at the binding interface, and the residues of Asp62, Glu63 and Leu64 formed 310-helix. The long loop between α2- and α3-helices of VapB26 contributed to the binding to VapC26 through hydrophobic interactions involving the following VapB26 residues: Pro44, Pro46, Tyr51, Ala52, Pro56, Ile57 and Ala58 of the loop between α2- and α3-helices; Val61, Leu64 and Leu65 of α3-helix; and Phe68 (FIG. 4).

On the other hand, the following residues were involved in binding in VapC26: Leu9, Ala10, Tyr11 and Phe12 of α1-helix; Tyr45, Leu46, Val47, Val51, Ala58 and Val59 of α3- and α4-helices; and Ala15, Pro17, Ile26, Leu33, Ala41, Ala67, Trp68 and Leu115 the loop between α4- and α5-helices.

Aromatic residues were involved in the formation of the VapB26 and VapC26 dimers as well as in the arrangement of the catalytic sites of VapC26 (FIG. 4). In addition, the interface of the VapBC26 protein complex was composed of the regions of 1174.1 â„«2 (chains A and B), 1246 â„«2 (chains C and D), 998.9 â„«2 (chains E and F) and 1080.1 â„«2 (chains G and H) (FIG. 4).

<3-3> Confirmation of Toxin (VapC26) Protein Structure

The structure of VapC26, a toxin protein of Mycobacterium tuberculosis, was confirmed based on the data obtained in Example <3-1>.

As a result, it was confirmed that VapC26 contained 7 α-helices and 5 β-helices. In addition, as shown in FIG. 3, it was composed of the α/β/α sandwich folded shape consisting of 5 β-helices and 7 α-helices: β1 (residues 1-4), α1 (residues 5-13), α2 (residues 18-27), β2 (residues 33-36), α3 (residues 37-52), α4 (residues 54-65), β3 (residues 68-71), α5 (residues 74-92), α6 (residues 94-108), β4 (residues 110-114), α7 (residues 116-124) and β5 (residues 129-134) (FIG. 3). On the other hand, four-stranded parallel sheets (β2-β1-β4-β5) were surrounded by 5 α-helices with two remaining α-helices (α3 and α4) located outward of the structure.

In VapC26, α5-helix of one monomer was in contact with α3- and β4-helices of another adjacent monomer and α3-helices formed homodimers through partial hydrophobic interactions in the middle of the interface. In particular, Pro37, Tyr38, Val40 and Ala41 residues were involved in the contact of α3-α3 and Leu57, Leu60 and Ala64 residues of α4-helix were interacted with Ala75, Ile78, Ala82 and Val85 of α5-helix (FIG. 5a). Among them, Ile78 played an important role in dimerization of VapC26 by participating in hydrophobic interactions with Val40, Leu60, Ala64 and Leu70. In addition, Ile95 of α6-helix was involved in the hydrophobic interaction associated dimerization with Val40, Ala41 and Leu60 (FIG. 5b). That is, more than 30 residues in total were involved in the formation of dimmers (FIG. 5A). The interface of the VapC26 homodimer had an average area of about 1085 Å2 (1065.1 Å2 between chains B and H; and 1104.8 Å2 between chains D and F). The active site of VapC26 was formed by β1-α1 loops, α3, α6, β3 and β7 loops. The metal coordination site of VapC26 was surrounded by the carboxylic acid oxygen atoms located at four well-conserved residues of Asp4 (N terminus of α1-helix), Glu42 (α3-helix), Asp97 (α6-helix) and Asp116 (α7-helix) (FIG. 5c). In addition, these four acidic residues were composed of negatively charged pockets at the active site (FIG. 5d).

<3-4> Confirmation of Antitoxin (VapB26) Protein Structure

The structure of VapB26, an antitoxin protein of Mycobacterium tuberculosis, was confirmed based on the data obtained in Example <3-1>.

As a result, it was confirmed that VapB26 contained 3 α-helices and one β-strand having β1-α1-β2-β3 status. The four secondary structural elements corresponded to residues 3-6 (R1), residues 10-23 (α1), residues 27-39 (α2) and residues 60-65 (α3) of chain A, and to residues 4-7 (R1), residues 10-23 (α1), residues 27-39 (α2) and residues 60-65 (α3) of chain C. The structure of VapB26 was characterized by an N-terminal sheet, two adjacent helices and a small C-terminal α-helix with a long hinge loop between α2- and β-helices (FIGS. 3a˜3d). Three consecutive prolines (Pro44, Pro45 and Pro46) were located between α2-helix and the long loop. On the other hand, Gly24 located in the short loop region between α1- and α2-helices generated a turn shape by forming hydrogen bonds with the adjacent residues.

In addition, two VapB26 dimers interacted with each other through the N-terminal β-strand to form a homodimer. The calculated molecular weight of VapB26 was 19.0±0.4 kDa, which was almost same to the theoretical molecular weight of the VapB26 dimer (19.2 kDa) (FIGS. 1a and 1b). The N-terminal domain of the dimer had the RHH motif and the dimer interface showed an average area of about 1372.3 Å2 (1332.2 Å2 between chains E and G; and 1412.4 Å2 between chains A and C). More than 30 residues of each VapB26 were involved in dimerization, and the most notable difference between the two VapB26 structures was observed in the N-terminal domain. In addition, the N-terminal domains of the chains A and C were structurally well aligned, but the N-terminal domains of the chains E and G were not well folded.

In the VapB26 dimer comprising Asp2-Leu8 and Thr4-Val6, the residue pairs on two β1 strands formed antiparallel β-sheets through hydrogen bonds between their skeletal atoms (FIG. 6a). The main chain 0 atom of Tyr7 acted as an acceptor at the hydrogen bond with the Nε and NH2 atoms of Arg32 located at α2-helix. In addition, Glu11 located at α1-helix and Arg36 located at α2-helix played an important role in cross-stabilization between α1- and α2-helices by participating in hydrogen bonds through the side chains NH and Os to help dimerization (FIG. 6b). In addition to the hydrogen bonds, nonpolar residues contributed to the formation of the dimerization interface, and residues of α2-helix including Val30, VaIle31, Ile35 and Val39 interacted with the corresponding residues in the α2-helix of the adjacent VapB26 (FIG. 6c). Ile35 and Val39 played an important role in the interaction with Leu12, Ala15, Val16 and Ala19 located at α1-helix of the adjacent VapB26 monomer. In addition, Ala28, Ile31 and Ile35 hydrophobically interacted with Val6 located at β1 hydrophobicity, and Leu8 located at β1-α1 loop interacted with Ile31 and Ile35 of VapB26 (FIG. 6d).

<Example 4> Analysis of Characteristics of Toxin-Antitoxin (VapBC26) Protein Complex

To analyze the structural similarity of the VapBC26 protein complex, structural homologs of VapBC26 were screened using DALI server, a three-dimensional mapping program, to identify the structural differences between the VapBC26 protein complex and VapB5, VapB15 and VapB30.

As a result, in the structural homologs, it was confirmed that the binding region of the toxin to the antitoxin was mainly composed of one or two α-helices, but the binding region of the antitoxin to the toxin was composed of α-helix and four antiparallel β sheets. In addition, the structures of VapB5, VapB15 and VapB30 included only one α-helix (VapB30) or two α-helices (VapB5 and VapB15). The VapBs protein of Shigella flexneri and Rickettsia felis strains contained only one α-helix (α2) in the binding region of the toxin. VapB3 of Mycobacterium tuberculosis showed a complete electron density map at the N-terminus due to the presence of the elongated α-helix (α3), but VapB26 did not contain specific helices in the binding region, except for the short α-helix at the C-terminus (α3) of chains A and C. VapB26 formed a flexible hinge loop without secondary structure in the binding groove formed by α-helix of VapC26 (FIG. 7a). Interestingly, VapB26 did not share the important structural similarities with other VapB proteins except VapB3. The VapB protein did not have the same DNA binding domain, so only a few VapB proteins with the structures similar to VapB26 were determined to be complete. In addition, DNA binding domains of other VapB proteins were generally located in the N-terminal region, but VapB5, VapB15 and VapB30 of Mycobacterium tuberculosis did not have the N-terminal structure, so that the structure of the DNA binding site of these proteins could not be confirmed. Among the VapB proteins whose structures were determined, only VapB3 of Mycobacterium tuberculosis shared the same RHH DNA binding site as VapB26. However, in general, VapBC3 of Mycobacterium tuberculosis did not have high structural similarity to VapBC26, and the structural similarity was observed only between the antitoxin VapB proteins (FIG. 7b).

In addition, the VapC toxin generally contained the N-terminal (PIN) domain of PilT, which exhibited the ribonuclease activity against cellular mRNA, wherein VapC26 of Mycobacterium tuberculosis had a structural feature similar to the PIN domain motif. Despite the low level of sequence similarity of about 16-25%, the secondary structures of the VapC protein were largely similar to each other (FIG. 8). VapC included conserved acidic residues as well as other conserved residues that support the active site (FIG. 8).

<Experimental Example 1> Changes in Ribonuclease Activity of Toxin Protein by Addition of Peptide Imitating Binding Region

The following experiment was performed in order to investigate the changes in ribonuclease (RNAse) activity by the peptides imitating the binding regions of VapB26 and toxin VapC26.

First, 7 short peptides were designed to imitate the binding regions of VapB26 and VapC26 and their sequences are shown in Table 3 below. Among these peptides, the peptides consisting of the amino acid sequences represented by SEQ. ID. NOs: 8 and 9 were designed to imitate the binding region of VapB26, and the peptides consisting of the amino acid sequences represented by SEQ ID NOs: 10, 11, 12 and 13 were designed to imitate the binding region of VapC26. Then, by adding these peptides to the complex, it was confirmed whether the formation of the toxin-antitoxin protein complex was inhibited. When the peptide binds to the complex with high affinity, the activity of VapC26 isolated from the complex becomes more prevalent, and thereby the ribonuclease activity increases, which can be monitored by fluorescence quenching.

TABLE 3
SEQ.
ID.
Protein Amino acid sequence NO:
Mimetic peptide PPPRGGLYAGSEPIA(44-58) SEQ.
for VapB26 Coil ID.
between α2 and α3 NO: 8
Mimetic peptide VDELLAGF(61-68) SEQ. 
for VapB26 α3 ID.
NO: 9
Mimetic peptide ALLAYFDAAEP(7-17) SEQ.
for VapC26 α1 ID.
NO: 10
Mimetic peptide PYVVAELDYLVATRVG(37-52) SEQ.
for VapC26 α3 ID.
NO: 11
Mimetic peptide DAELAVLRELAG(54-65) SEQ.
for VapC26 α4 ID.
NO: 12
Mimetic peptide YLVATRVGVDAELAV(45-59) SEQ.
for VapC2 partial ID.
motif between α3 NO: 13
and α4
Mimetic peptide PYVVAELDYLVATRVGVDAELAV SEQ.
for VapC26 whole LRELAG(37-65) ID.
α3 and α4 NO: 14
VapC26 MIIDTSALLA YFDAAEPDHA SEQ.
AVSECIDSSA DALVVSPYVV ID.
AELDYLVATR VGVDAELAVL NO: 15
RELAGGAWEL ANCGAAEIEQ
AARIVTKYQD QRIGIADAAN
VVLADRYRTR TILTLDRRHF
SALRPIGGGR FTVIP

As a result, as shown in FIG. 9a, the ribonuclease activity of the VapBC26 protein complex itself of Mycobacterium tuberculosis was weaker than the ribonuclease activity of VapC26 itself. In the presence of 2.5 μM of VapBC26, the ribonuclease activity was increased by competing with the peptide. In addition, the mimetic peptide for VapC26 α3 (SEQ. ID. NO: 11), the mimetic peptide for VapC26 α4 (SEQ. ID. NO: 12) and the mimetic peptide for VapC26 partial motif between α3 and α4 (SEQ. ID. NO: 13) acted as a VapBC26 binding inhibitor (FIGS. 9a and 10). Compared with when the mimetic peptide represented by SEQ. ID. NO: 11 and the mimetic peptide represented by SEQ. ID. NO: 13 were added, the ribonuclease activity of VapBC26 was more increased when the mimetic represented by SEQ. ID. NO: 12 was added (FIG. 10).

Next, the concentration of the mimetic peptide for VapC26 α4 was fixed at 2.5 μM and the additional experiment was performed with increasing the concentration of VapBC26 from 0.625 to 20 μM. As a result, as shown in FIG. 9b, from the concentration of VapBC26 of 10 μM, the results of RFU were similar (FIG. 9b).

<Experimental Example 2> Changes in Ribonuclease Activity by Mutation

First, mutations were induced in VapB26 using EZchange™ site-directed mutation kit (Enzynomics, Korea) according to the manufacturer's protocol. Through this process, Pro46 and Tyr51 of VapB26 and Leu46 of VapC26 involved in hydrophobic binding were replaced with alanine or glutamate to reduce or eliminate hydrophobicity. Key binding residues were identified by adding 10 μM of the mimetic peptide for VapC26 α4 to the prepared mutations. The sequences of the primers used for inducing the mutations are shown in Table 1 (SEQ. ID. NOs: 5 and 6).

As a result, as shown in FIG. 9c, it was confirmed that Tyr51 of VapB26 played the most important role in the interaction between VapB26 and VapC26 (FIG. 9c).

In addition, to support the results above, not only VapB26, VapC26, and the native VapB26 protein complex, but also the VapBC26 protein complex containing Y51E prepared by mutating the 51st Tyr residue of VapB26 with Glu and the VapC26 α4 mimetic peptide supposed to be added to each complex were filled in Superdex 75 10/300 prepacked column (GE Healthcare) with the combinations shown in FIG. 9d, followed by size exclusion chromatography. The results are shown as UV absorbance at 280 nm according to the elution volume.

As a result, as shown in FIG. 9d, the mimic peptides added with the VapBC26 protein complex showed peaks at different positions from the original peaks corresponding to VapB26 and VapC26, and the mimetic peptide added with the protein complex containing Y51E included more degraded proteins compared to the mimetic peptide added with the native protein complex (FIG. 9d). The calculated area corresponding to VapC26 in the mimetic peptide added with the protein complex comprising Y51E was larger by 15.42% than that of the mimetic peptide added with the native protein complex. As shown in FIG. 9C, this is almost consistent with the fluorescence increase of 15.07% in Y51E. Therefore, it was confirmed that Tyr51 of VapB26 played the most important role in the interaction between VapB26 and VapC26 (FIGS. 9c and 9d).

Claims

1. An antibiotic peptide that inhibits the binding of an antitoxin to one or more α3 residues or α4 residues of a Mycobacterium tuberculosis toxin protein.

2. The antibiotic peptide according to claim 1, wherein the toxin protein comprises the amino acid sequence represented by SEQ ID NO: 15.

3. The antibiotic peptide according to claim 1, wherein the α3 residues consist of the 37th to 52nd amino acid sequence of VapC26.

4. The antibiotic peptide according to claim 1, wherein the α4 residues consist of the 54th to 65th amino acid sequence of VapC26.

5. The antibiotic peptide according to claim 1, wherein the peptide comprises one or more of the amino acid sequences represented by SEQ ID NOs: 11-13.

6. The antibiotic peptide according to claim 1, wherein the peptide does not affect activity of a toxin.

7. An antibiotic composition against Mycobacterium tuberculosis comprising the antibiotic peptide of claim 1 and a carrier.

8. The antibiotic composition against Mycobacterium tuberculosis according to claim 7, wherein the antibiotic peptide comprises one or more of the amino acid sequence represented by SEQ ID NOs: 11-13.

9. An antibiotic quasi-drug against Mycobacterium tuberculosis comprising the antibiotic peptide of claim 1.

10. The antibiotic composition against Mycobacterium tuberculosis of claim 1, formulated for external application to a subject.

11. A method for ameliorating or treating a Mycobacterium tuberculosis infection in a subject, comprising a step of:

administering the antibiotic peptide of claim 1 to the subject, thereby ameliorating or treating the Mycobacterium tuberculosis infection of the subject.

12. (canceled)

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: