Patent application title:

MODULATORS OF YAP1 EXPRESSION

Publication number:

US20220315927A1

Publication date:
Application number:

17/527,953

Filed date:

2021-11-16

Abstract:

The present embodiments provide methods, compounds, and compositions useful for inhibiting YAP1 expression, which may be useful for treating, preventing, or ameliorating a cancer associated with YAP1.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N15/1135 »  CPC main

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides against oncogenes or tumor suppressor genes

A61K9/0012 »  CPC further

Medicinal preparations characterised by special physical form Galenical forms characterised by the site of application

C12N2310/315 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the backbone Phosphorothioates

C12N2320/31 »  CPC further

Applications; Uses; Special therapeutic applications Combination therapy

C12N15/113 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

A61P35/00 »  CPC further

Antineoplastic agents

A61K9/00 IPC

Medicinal preparations characterised by special physical form

A61K45/00 »  CPC further

Medicinal preparations containing active ingredients not provided for in groups  - 

Description

SEQUENCE LISTING

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0352USC1SEQ_ST25.txt created Nov. 9, 2021, which is 814 kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

FIELD

The present embodiments provide methods, compounds, and compositions useful for inhibiting YAP1 expression, which can be useful for treating, preventing, or ameliorating a cancer associated with YAP1.

BACKGROUND

Yes-associated protein (YAP1) is a transcriptional coactivator that is frequently activated in multiple human cancer types due to alterations in the tumor suppressive ‘Hippo’ pathway or its amplification. YAP1 is the downstream regulator of the Hippo pathway and promotes tumor growth through both tumor autonomous and immune-regulatory mechanisms. An active Hippo pathway is tumor suppressive and phosphorylates YAP1, resulting in its inactivation. When the Hippo pathway is inactive, YAP1 is dephosphorylated and translocated into the nucleus where it promotes expression of multiple genes.

SUMMARY

Certain embodiments provided herein are directed to potent and tolerable compounds and compositions useful for inhibiting YAP1 expression, which can be useful for treating, preventing, ameliorating, or slowing progression of cancer associated with YAP1.

DETAILED DESCRIPTION

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank and NCBI reference sequence records are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

It is understood that the sequence set forth in each SEQ ID NO contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Compounds described by ION number indicate a combination of nucleobase sequence, chemical modification, and motif.

Unless otherwise indicated, the following terms have the following meanings:

“2′-deoxynucleoside” means a nucleoside comprising 2′-H(H) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2′-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

“2′-O-methoxyethyl” (also 2′-MOE and 2′-O(CH2)2—OCH3) refers to an O-methoxy-ethyl modification at the 2′ position of a furanosyl ring. A 2′-O-methoxyethyl modified sugar is a modified sugar.

“2′-MOE nucleoside” (also 2′-O-methoxyethyl nucleoside) means a nucleoside comprising a 2′-MOE modified sugar moiety.

“2′-substituted nucleoside” or “2-modified nucleoside” means a nucleoside comprising a 2′-substituted or 2′-modified sugar moiety. As used herein, “2′-substituted” or “2-modified” in reference to a sugar moiety means a sugar moiety comprising at least one 2′-substituent group other than H or OH.

“3′ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 3′-most nucleotide of a particular compound.

“5′ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 5′-most nucleotide of a particular compound.

“5-methylcytosine” means a cytosine with a methyl group attached to the 5 position.

“About” means within ±10% of a value. For example, if it is stated, “the compounds affected about 70% inhibition of YAP1”, it is implied that YAP1 levels are inhibited within a range of 60% and 80%.

“Administration” or “administering” refers to routes of introducing a compound or composition provided herein to an individual to perform its intended function. An example of a route of administration that can be used includes, but is not limited to parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.

“Administered concomitantly” or “co-administration” means administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Concomitant administration does not require that both compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. Concomitant administration or co-administration encompasses administration in parallel or sequentially.

“Amelioration” refers to an improvement or lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain embodiments, amelioration includes a delay or slowing in the progression or severity of one or more indicators of a condition or disease. The progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.

“Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

“Antibody,” as used in this disclosure, refers to an immunoglobulin or a fragment or a derivative thereof, and encompasses any polypeptide comprising an antigen-binding site, regardless of whether it is produced in vitro or in vivo. The term includes, but is not limited to, polyclonal, monoclonal, monospecific, polyspecific, non-specific, humanized, single-chain, chimeric, synthetic, recombinant, hybrid, mutated, and grafted antibodies. Unless otherwise modified by the term “intact,” as in “intact antibodies,” for the purposes of this disclosure, the term “antibody” also includes antibody fragments such as Fab, F(ab′)2, Fv, scFv, Fd, dAb, and other antibody fragments that retain antigen-binding function, i.e., the ability to bind, for example, CTLA-4 or PD-L1 specifically. Typically, such fragments would comprise an antigen-binding domain.

“Anti-CTLA-4 antibody” refers to an antibody or antigen binding fragment thereof that specifically binds a CTLA-4 polypeptide. Exemplary anti-CTLA-4 antibodies are described for example at U.S. Pat. Nos. 6,682,736; 7,109,003; 7,123,281; 7,411,057; 7,824,679; 8,143,379; 7,807,797; and 8,491,895 (Tremelimumab is 11.2.1, therein), which are herein incorporated by reference. Tremelimumab (U.S. Pat. No. 6,682,736) is an exemplary anti-CTLA-4 antibody. Tremelimumab VL, VH, and CDR amino acid sequences are provided at SEQ ID NOs: 1-8, herein.

“Anti-OX40 antibody” refers to an antibody or antigen binding fragment thereof that specifically binds OX40. OX40 antibodies include monoclonal and polyclonal antibodies that are specific for OX40 and antigen-binding fragments thereof. In certain aspects, anti-OX40 antibodies as described herein are monoclonal antibodies (or antigen-binding fragments thereof), e.g., murine, humanized, or fully human monoclonal antibodies. In one particular embodiment, the OX40 antibody is an OX40 receptor agonist, such as the mouse anti-human OX40 monoclonal antibody (9B12) described by Weinberg et al., J Immunother 29, 575-585 (2006). In another embodiment, an OX40 antibody is MEDI0562 as described in US 2016/0137740, incorporated herein by reference. MEDI0562 VH and VL amino acid sequences are provided at SEQ ID NOs: 25-26, herein. In other embodiments, the antibody which specifically binds to OX40, or an antigen-binding fragment thereof, binds to the same OX40 epitope as mAb 9B12.

“Anti-PD-L1 antibody” refers to an antibody or antigen binding fragment thereof that specifically binds a PD-L1 polypeptide. Exemplary anti-PD-L1 antibodies are described for example at US2013/0034559, U.S. Pat. Nos. 8,779,108 and 9,493,565 which are herein incorporated by reference. Durvalumab (MEDI4736) is an exemplary anti-PD-L1 antibody. Durvalumab VL, VH, and CDR amino acid sequences are provided at SEQ ID NOs: 9-16, herein. Other anti-PD-L1 antibodies include BMS-936559 (Bristol-Myers Squibb) and MPDL3280A (atezolizumab) (Roche).

“Anti-PD-1 antibody” refers to an antibody or antigen binding fragment thereof that specifically binds a PD-1 polypeptide. Exemplary anti-PD-1 antibodies are described for example at U.S. Pat. Nos. 7,521,051; 8,008,449; 8,354,509; 9,073,994; 9,393,301; 9,402,899; and 9,439,962, which are herein incorporated by reference. Exemplary anti-PD-1 antibodies include, without limitation, nivolumab, pembrolizumab, pidilizumab, and AMP-514.

“Antigen-binding domain,” “antigen-binding fragment,” and “binding fragment” refer to a part of an antibody molecule that comprises amino acids responsible for the specific binding between the antibody and the antigen. In instances, where an antigen is large, the antigen-binding domain may only bind to a part of the antigen. A portion of the antigen molecule that is responsible for specific interactions with the antigen-binding domain is referred to as “epitope” or “antigenic determinant.” An antigen-binding domain typically comprises an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH), however, it does not necessarily have to comprise both. For example, a so-called Fd antibody fragment consists only of a VH domain, but still retains some antigen-binding function of the intact antibody. Binding fragments of an antibody are produced by recombinant DNA techniques, or by enzymatic or chemical cleavage of intact antibodies. Binding fragments include Fab, Fab′, F(ab′)2, Fv, and single-chain antibodies. An antibody other than a “bispecific” or “bifunctional” antibody is understood to have each of its binding sites identical. Digestion of antibodies with the enzyme, papain, results in two identical antigen-binding fragments, known also as “Fab” fragments, and a “Fc” fragment, having no antigen-binding activity but having the ability to crystallize. Digestion of antibodies with the enzyme, pepsin, results in the a F(ab′)2 fragment in which the two arms of the antibody molecule remain linked and comprise two-antigen binding sites. The F(ab′)2 fragment has the ability to crosslink antigen. “Fv” when used herein refers to the minimum fragment of an antibody that retains both antigen-recognition and antigen-binding sites. “Fab” when used herein refers to a fragment of an antibody that comprises the constant domain of the light chain and the CH1 domain of the heavy chain.

“mAb” refers to monoclonal antibody. Antibodies of the present disclosure comprise without limitation whole native antibodies, bispecific antibodies; chimeric antibodies; Fab, Fab′, single chain V region fragments (scFv), fusion polypeptides, and unconventional antibodies.

“Antisense activity” means any detectable and/or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound to the target.

“Antisense compound” means a compound comprising an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, oligonucleotides, ribozymes, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.

“Antisense inhibition” means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.

“Antisense mechanisms” are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.

“Antisense oligonucleotide” means an oligonucleotide having a nucleobase sequence that is complementary to a target nucleic acid or region or segment thereof. In certain embodiments, an antisense oligonucleotide is specifically hybridizable to a target nucleic acid or region or segment thereof.

“Bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety. “Bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

“Branching group” means a group of atoms having at least 3 positions that are capable of forming covalent linkages to at least 3 groups. In certain embodiments, a branching group provides a plurality of reactive sites for connecting tethered ligands to an oligonucleotide via a conjugate linker and/or a cleavable moiety.

“Cell-targeting moiety” means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.

“cEt” or “constrained ethyl” means a bicyclic furanosyl sugar moiety comprising a bridge connecting the 4′-carbon and the 2′-carbon, wherein the bridge has the formula: 4′-CH(CH3)—O-2′.

“cEt nucleoside” means a nucleoside comprising a cEt modified sugar moiety.

“Chemical modification” in a compound describes the substitutions or changes through chemical reaction, of any of the units in the compound relative to the original state of such unit. “Modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase. “Modified oligonucleotide” means an oligonucleotide comprising at least one modified internucleoside linkage, a modified sugar, and/or a modified nucleobase.

“Chemically distinct region” refers to a region of a compound that is in some way chemically different than another region of the same compound. For example, a region having 2′-O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2′-O-methoxyethyl modifications.

“Chimeric antisense compounds” means antisense compounds that have at least 2 chemically distinct regions, each position having a plurality of subunits.

“Chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more sterorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.

“Cleavable bond” means any chemical bond capable of being split. In certain embodiments, a cleavable bond is selected from among: an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a di-sulfide, or a peptide.

“Cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.

“Complementary” in reference to an oligonucleotide means the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Nucleobase matches or complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methyl cytosine (mC) and guanine (G) unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. By contrast, “fully complementary” or “100% complementary” in reference to oligonucleotides means that such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.

“Conjugate group” means a group of atoms that is attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

“Conjugate linker” means a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

“Conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

“Contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.

“Designing” or “Designed to” refer to the process of designing a compound that specifically hybridizes with a selected nucleic acid molecule.

“Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid, e.g. saline solution.

“Differently modified” means chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are “differently modified,” even though the DNA nucleoside is unmodified. Likewise, DNA and RNA are “differently modified,” even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified. For example, a nucleoside comprising a 2′-OMe modified sugar and an unmodified adenine nucleobase and a nucleoside comprising a 2′-OMe modified sugar and an unmodified thymine nucleobase are not differently modified.

“Dose” means a specified quantity of a compound or pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments, where subcutaneous administration is desired, the desired dose may require a volume not easily accommodated by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments, a dose may be administered in two or more injections to minimize injection site reaction in an individual. In other embodiments, the compound or pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week or month.

“Dosing regimen” is a combination of doses designed to achieve one or more desired effects.

“Double-stranded antisense compound” means an antisense compound comprising two oligomeric compounds that are complementary to each other and form a duplex, and wherein one of the two said oligomeric compounds comprises an oligonucleotide.

“Effective amount” means the amount of compound sufficient to effectuate a desired physiological outcome in an individual in need of the compound. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.

“Efficacy” means the ability to produce a desired effect.

“Expression” includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to, the products of transcription and translation.

“Gapmer” means an oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.”

“Hybridization” means the annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target.

“Immediately adjacent” means there are no intervening elements between the immediately adjacent elements of the same kind (e.g. no intervening nucleobases between the immediately adjacent nucleobases).

“Individual” means a human or non-human animal selected for treatment or therapy.

“Inhibiting the expression or activity” refers to a reduction or blockade of the expression or activity relative to the expression of activity in an untreated or control sample and does not necessarily indicate a total elimination of expression or activity.

“Internucleoside linkage” means a group or bond that forms a covalent linkage between adjacent nucleosides in an oligonucleotide. “Modified internucleoside linkage” means any internucleoside linkage other than a naturally occurring, phosphate internucleoside linkage. Non-phosphate linkages are referred to herein as modified internucleoside linkages.

“Lengthened oligonucleotides” are those that have one or more additional nucleosides relative to an oligonucleotide disclosed herein, e.g. a parent oligonucleotide.

“Linked nucleosides” means adjacent nucleosides linked together by an internucleoside linkage.

“Linker-nucleoside” means a nucleoside that links an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of a compound. Linker-nucleosides are not considered part of the oligonucleotide portion of a compound even if they are contiguous with the oligonucleotide.

“Mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned. For example, nucleobases including but not limited to a universal nucleobase, inosine, and hypoxanthine, are capable of hybridizing with at least one nucleobase but are still mismatched or non-complementary with respect to nucleobase to which it hybridized. As another example, a nucleobase of a first oligonucleotide that is not capable of hybridizing to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned is a mismatch or non-complementary nucleobase.

“Modulating” refers to changing or adjusting a feature in a cell, tissue, organ or organism. For example, modulating YAP1 RNA can mean to increase or decrease the level of YAP1 RNA and/or YAP1 protein in a cell, tissue, organ or organism. A “modulator” effects the change in the cell, tissue, organ or organism. For example, a YAP1 compound can be a modulator that decreases the amount of YAP1 RNA and/or YAP1 protein in a cell, tissue, organ or organism.

“MOE” means methoxyethyl.

“Monomer” refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides.

“Motif” means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.

“Natural” or “naturally occurring” means found in nature.

“Non-bicyclic modified sugar” or “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

“Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.

“Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid. As used herein a “naturally occurring nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). A “modified nucleobase” is a naturally occurring nucleobase that is chemically modified. A “universal base” or “universal nucleobase” is a nucleobase other than a naturally occurring nucleobase and modified nucleobase, and is capable of pairing with any nucleobase.

“Nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage.

“Nucleoside” means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. “Modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase.

“Oligomeric compound” means a compound comprising a single oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.

“Oligonucleotide” means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another. Unless otherwise indicated, oligonucleotides consist of 8-80 linked nucleosides. “Modified oligonucleotide” means an oligonucleotide, wherein at least one sugar, nucleobase, or internucleoside linkage is modified. “Unmodified oligonucleotide” means an oligonucleotide that does not comprise any sugar, nucleobase, or internucleoside modification.

“Parent oligonucleotide” means an oligonucleotide whose sequence is used as the basis of design for more oligonucleotides of similar sequence but with different lengths, motifs, and/or chemistries. The newly designed oligonucleotides may have the same or overlapping sequence as the parent oligonucleotide.

“Parenteral administration” means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.

“Pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an individual. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution, such as PBS or water-for-injection.

“Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds or oligonucleotides, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

“Pharmaceutical agent” means a compound that provides a therapeutic benefit when administered to an individual.

“Pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more compounds or salt thereof and a sterile aqueous solution.

“Phosphorothioate linkage” means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom. A phosphorothioate internucleoside linkage is a modified internucleoside linkage.

“Phosphorus moiety” means a group of atoms comprising a phosphorus atom. In certain embodiments, a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.

“Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an oligomeric compound.

“Prevent” refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely.

“Prodrug” means a compound in a form outside the body which, when administered to an individual, is metabolized to another form within the body or cells thereof. In certain embodiments, the metabolized form is the active, or more active, form of the compound (e.g., drug). Typically conversion of a prodrug within the body is facilitated by the action of an enzyme(s) (e.g., endogenous or viral enzyme) or chemical(s) present in cells or tissues, and/or by physiologic conditions.

“Reduce” means to bring down to a smaller extent, size, amount, or number.

“RefSeq No.” is a unique combination of letters and numbers assigned to a sequence to indicate the sequence is for a particular target transcript (e.g., target gene). Such sequence and information about the target gene (collectively, the gene record) can be found in a genetic sequence database. Genetic sequence databases include the NCBI Reference Sequence database, GenBank, the European Nucleotide Archive, and the DNA Data Bank of Japan (the latter three forming the International Nucleotide Sequence Database Collaboration or INSDC).

“Region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.

“RNAi compound” means an antisense compound that acts, at least in part, through RISC or Ago2, but not through RNase H, to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.

“Segments” are defined as smaller or sub-portions of regions within a nucleic acid.

“Side effects” means physiological disease and/or conditions attributable to a treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality.

“Single-stranded” in reference to a compound means the compound has only one oligonucleotide. “Self-complementary” means an oligonucleotide that at least partially hybridizes to itself. A compound consisting of one oligonucleotide, wherein the oligonucleotide of the compound is self-complementary, is a single-stranded compound. A single-stranded compound may be capable of binding to a complementary compound to form a duplex.

“Sites” are defined as unique nucleobase positions within a target nucleic acid.

“Specifically hybridizable” refers to an oligonucleotide having a sufficient degree of complementarity between the oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids. In certain embodiments, specific hybridization occurs under physiological conditions.

“Specifically inhibit” with reference to a target nucleic acid means to reduce or block expression of the target nucleic acid while exhibiting fewer, minimal, or no effects on non-target nucleic acids. Reduction does not necessarily indicate a total elimination of the target nucleic acid's expression.

“Standard cell assay” means assay(s) described in the Examples and reasonable variations thereof.

“Standard in vivo experiment” means the procedure(s) described in the Example(s) and reasonable variations thereof.

“Stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

“Sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. “Unmodified sugar moiety” or “unmodified sugar” means a 2′-OH(H) furanosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2′-H(H) moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1′, 3′, and 4′ positions, an oxygen at the 3′ position, and two hydrogens at the 5′ position. “Modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate. “Modified furanosyl sugar moiety” means a furanosyl sugar comprising a non-hydrogen substituent in place of at least one hydrogen of an unmodified sugar moiety. In certain embodiments, a modified furanosyl sugar moiety is a 2′-substituted sugar moiety. Such modified furanosyl sugar moieties include bicyclic sugars and non-bicyclic sugars.

“Sugar surrogate” means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary compounds or nucleic acids.

“Synergy” or “synergize” refers to an effect of a combination that is greater than additive of the effects of each component alone at the same doses.

“YAP1” means any nucleic acid or protein of YAP1. “YAP1 nucleic acid” means any nucleic acid encoding YAP1. For example, in certain embodiments, a YAP1 nucleic acid includes a DNA sequence encoding YAP1, an RNA sequence transcribed from DNA encoding YAP1 (including genomic DNA comprising introns and exons), and an mRNA sequence encoding YAP1. “YAP1 mRNA” means an mRNA encoding a YAP1 protein. The target may be referred to in either upper or lower case.

“YAP1 specific inhibitor” refers to any agent capable of specifically inhibiting YAP1 RNA and/or YAP1 protein expression or activity at the molecular level. For example, YAP1 specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of YAP1 RNA and/or YAP1 protein.

“Target gene” refers to a gene encoding a target.

“Targeting” means the specific hybridization of a compound to a target nucleic acid in order to induce a desired effect.

“Target nucleic acid,” “target RNA,” “target RNA transcript” and “nucleic acid target” all mean a nucleic acid capable of being targeted by compounds described herein.

“Target region” means a portion of a target nucleic acid to which one or more compounds is targeted.

“Target segment” means the sequence of nucleotides of a target nucleic acid to which a compound is targeted. “5′ target site” refers to the 5′-most nucleotide of a target segment. “3′ target site” refers to the 3′-most nucleotide of a target segment.

“Terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

“Therapeutically effective amount” means an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual.

“Treat” refers to administering a compound or pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal.

Certain Embodiments

Certain embodiments provide methods, compounds and compositions for inhibiting YAP1 expression.

Certain embodiments provide compounds targeted to a YAP1 nucleic acid. In certain embodiments, the YAP1 nucleic acid has the sequence set forth in RefSeq or GENBANK Accession No. NM_001282101.1 (SEQ ID NO: 1) or NC_000011.10 truncated from nucleotides 102107001 to 102236000 (SEQ ID NO: 2), each of which is incorporated by reference in its entirety. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 9 to 80 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 80 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 11 to 80 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 11 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 12 to 80 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 12 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide comprises an at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 2565-2580, 2566-2581, or 4600-4615 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide comprises an at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 123590-123605, 117330-117345, 117761-117776, 117757-117772, 117758-117773, 117330-117345, 119672-119687, 123591-123606, 125625-125640, or 117755-117770 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is complementary within nucleotides 2565-2580, 2566-2581, or 4600-4615 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is complementary within nucleotides 123590-123605, 117330-117345, 117761-117776, 117757-117772, 117758-117773, 117330-117345, 119672-119687, 123591-123606, 125625-125640, or 117755-117770 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide comprises an at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion of any one of the nucleobase sequences of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

In certain embodiments, a compound targeted to YAP1 is ION 1198440. Out of over 3,000 compounds that were screened as described in the Examples section below, ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872 emerged as the top lead compounds. In particular, ION 1198440 exhibited the best combination of properties in terms of potency and tolerability out of over 3,000 compounds.

In certain embodiments, any of the foregoing modified oligonucleotides has at least one modified internucleoside linkage, at least one modified sugar, and/or at least one modified nucleobase.

In certain embodiments, at least one nucleoside of any of the foregoing modified oligonucleotides comprises a modified sugar. In certain embodiments, the modified sugar comprises a 2′-O-methoxyethyl group. In certain embodiments, the modified sugar is a bicyclic sugar, such as a 4′-CH(CH3)—O-2′ group, a 4′-CH2—O-2′ group, or a 4′-(CH2)2—O-2′ group.

In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage, such as a phosphorothioate internucleoside linkage.

In certain embodiments, at least one nucleobase of the foregoing modified oligonucleotides is a modified nucleobase, such as 5-methylcytosine.

In certain embodiments, any of the foregoing modified oligonucleotides has:

    • a gap segment consisting of linked 2′-deoxynucleosides;
    • a 5′ wing segment consisting of linked nucleosides; and
    • a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 80 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides and has a nucleobase sequence consisting of the nucleobase sequence recited in any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 23-2940, wherein the modified oligonucleotide has:

    • a gap segment consisting of linked 2′-deoxynucleosides;
    • a 5′ wing segment consisting of linked nucleosides; and
    • a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863, wherein the modified oligonucleotide has:

    • a gap segment consisting of linked 2′-deoxynucleosides;
    • a 5′ wing segment consisting of linked nucleosides; and
    • a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 810 and 1404, wherein the modified oligonucleotide has:

    • a gap segment consisting often linked 2′-deoxynucleosides;
    • a 5′ wing segment consisting of three linked nucleosides; and
    • a 3′ wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NO: 2868, wherein the modified oligonucleotide has a gapmer consisting of a 5′-region, a 3′-region, and a central region positioned between the 5′-region and the 3′-region wherein:

the 5′-region consists of 3 linked modified nucleosides, wherein each nucleoside of the 5′-region comprises a cEt nucleoside;

the 3′-region consists of 3 linked modified nucleosides, wherein each nucleoside of the 3′-region comprises a cEt nucleoside;

the central region consists of 10 linked nucleosides, wherein the second nucleoside from the 5′ end of the central region comprises a 2′-O-methyl modified sugar moiety and the first and third through tenth nucleosides from the 5′ end of the central region each comprises a 2′ deoxynucleoside;

wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NO: 2868; wherein the modified oligonucleotide comprises the sugar motif kkk-d-y-d(8)-kkk, wherein “k” indicates a cEt modified sugar moiety, “d” indicates an unmodified 2′-deoxyribosyl sugar moiety, and “y” indicates a 2′-O-methyl modified sugar moiety; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of ION 1197270 having the nucleobase sequence and chemical motif: TksTksAksAdsAysGdsTdsGdsTdsAdsTdsGdsTdsmCksAksGk, wherein “d” represents a 2′-deoxyribose sugar, “k” represents a cEt modified sugar, “y” represents a 2′-O-methyl sugar, “s” represents a phosphorothioate internucleoside linkage, and “mC” refers to a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NO: 2864, wherein the modified oligonucleotide has:

a gap segment consisting often linked 2′-deoxynucleosides;

a 5′ wing segment consisting of one linked nucleoside; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NOs: 1404 or 1101, wherein the modified oligonucleotide has:

a gap segment consisting of nine linked 2′-deoxynucleosides;

a 5′ wing segment consisting of three linked nucleosides; and

a 3′ wing segment consisting of four linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a cEt nucleoside, a cEt nucleoside, and a 2′-O-methoxyethyl nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NO: 2812, wherein the modified oligonucleotide has:

a gap segment consisting of nine linked 2′-deoxynucleosides;

a 5′ wing segment consisting of three linked nucleosides; and

a 3′ wing segment consisting of four linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein the 3′ wing segment comprises a 2′-O-methoxyethyl nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NOs: 1200 or 2863, wherein the modified oligonucleotide has:

a gap segment consisting of nine linked 2′-deoxynucleosides;

a 5′ wing segment consisting of two linked nucleosides; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NO: 2865, wherein the modified oligonucleotide has:

a gap segment consisting often linked 2′-deoxynucleosides;

a 5′ wing segment consisting of one linked nucleoside; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

Certain embodiments provide a modified oligonucleotide, wherein the anion form of the modified oligonucleotide has the following chemical structure:

or a salt thereof.

Certain embodiments provide a modified oligonucleotide according to the following chemical structure:

or a salt thereof.

Certain embodiments provide a modified oligonucleotide according to the following chemical structure:

Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. Unless otherwise indicated, an oligonucleotide described herein and the term “oligonucleotide” are intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or a salt thereof” expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with a cation. In certain instances, one or more specific cation is identified.

In any of the foregoing embodiments, the compound or oligonucleotide can be at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to a nucleic acid encoding YAP1.

In any of the foregoing embodiments, the compound can be single-stranded. In certain embodiments, the compound comprises deoxyribonucleotides. In certain embodiments, the compound is double-stranded. In certain embodiments, the compound is double-stranded and comprises ribonucleotides. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In any of the foregoing embodiments, the compound can consist of 8 to 80, 10 to 30, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked nucleosides. In certain embodiments, the compound comprises or consists of an oligonucleotide.

In certain embodiments, compounds or compositions provided herein comprise a salt of the modified oligonucleotide. In certain embodiments, the salt is a sodium salt. In certain embodiments, the salt is a potassium salt.

In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having at least one of an increase an alanine transaminase (ALT) or aspartate transaminase (AST) value of no more than 4 fold, 3 fold, or 2 fold over saline treated animals or an increase in liver, spleen, or kidney weight of no more than 30%, 20%, 15%, 12%, 10%, 5%, or 2% compared to control treated animals.

In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase of ALT or AST over control treated animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase in liver, spleen, or kidney weight over control animals.

Certain embodiments provide a composition comprising the compound of any of the aforementioned embodiments or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition has a viscosity less than about 40 centipoise (cP), less than about 30 centipose (cP), less than about 20 centipose (cP), less than about 15 centipose (cP), or less than about 10 centipose (cP). In certain embodiments, the composition having any of the aforementioned viscosities comprises a compound provided herein at a concentration of about 100 mg/mL, about 125 mg/mL, about 150 mg/mL, about 175 mg/mL, about 200 mg/mL, about 225 mg/mL, about 250 mg/mL, about 275 mg/mL, or about 300 mg/mL. In certain embodiments, the composition having any of the aforementioned viscosities and/or compound concentrations has a temperature of room temperature or about 20° C., about 21° C., about 22° C., about 23° C., about 24° C., about 25° C., about 26° C., about 27° C., about 28° C., about 29° C., or about 30° C.

Non-limiting numbered embodiments include:

E1. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940.

E2. A compound comprising a modified oligonucleotide 9 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940.

E3. A compound comprising a modified oligonucleotide 10 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940.

E4. A compound comprising a modified oligonucleotide 11 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940.

E5. A compound comprising a modified oligonucleotide 12 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940.

E6. A compound comprising a modified oligonucleotide consisting of 16 to 80 linked nucleosides having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940.

E7. A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940.

E8. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides complementary within nucleotides 2565-2580, 2566-2581, or 4600-4615 of SEQ ID NO: 1 or within nucleotides 123590-123605, 117330-117345, 117761-117776, 117757-117772, 117758-117773, 117330-117345, 119672-119687, 123591-123606, 125625-125640, or 117755-117770 of SEQ ID NO: 2.

E9. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

E10. A compound comprising a modified oligonucleotide 9 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

E11. A compound comprising a modified oligonucleotide 10 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

E12. A compound comprising a modified oligonucleotide 11 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

E13. A compound comprising a modified oligonucleotide 12 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

E14. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides having a nucleobase sequence comprising any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

E15. A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

E16. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides having a nucleobase sequence comprising any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

E17. A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

E18. The compound of any one of embodiments E1-E17, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar, or at least one modified nucleobase.

E19. The compound of embodiment E18, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

E20. The compound of embodiment E18 or E19, wherein the modified sugar is a bicyclic sugar.

E21. The compound of embodiment E20, wherein the bicyclic sugar is selected from the group consisting of: 4′-(CH2)—O-2′ (LNA); 4′-(CH2)2—O-2′ (ENA); and 4′-CH(CH3)—O-2′ (cEt).

E22. The compound of embodiment E18 or E19, wherein the modified sugar is 2′-O-methoxyethyl.

E23. The compound of any one of embodiments E18-E22, wherein the modified nucleobase is a 5-methylcytosine.

E24. The compound of any one of embodiments E1-E23, wherein the modified oligonucleotide comprises:

a gap segment consisting of linked 2′-deoxynucleosides;

a 5′ wing segment consisting of linked nucleosides; and

a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

E25. A compound comprising a modified oligonucleotide consisting of 16 to 80 linked nucleosides having a nucleobase sequence comprising any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863, wherein the modified oligonucleotide comprises:

    • a gap segment consisting of linked 2′-deoxynucleosides;
    • a 5′ wing segment consisting of linked nucleosides; and
    • a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

E26. A compound comprising a modified oligonucleotide consisting of 16-80 linked nucleobases having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 810 and 1404, wherein the modified oligonucleotide comprises:

a gap segment consisting of ten linked 2′-deoxynucleosides;

a 5′ wing segment consisting of three linked nucleosides; and

a 3′ wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.

E27. A compound comprising a modified oligonucleotide consisting of 16-80 linked nucleobases having a nucleobase sequence comprising the sequence recited in SEQ ID NOs: 2864, wherein the modified oligonucleotide comprises:

a gap segment consisting often linked 2′-deoxynucleosides;

a 5′ wing segment consisting of one linked nucleoside; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.

E28. A compound comprising a modified oligonucleotide consisting of 16-80 linked nucleobases having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 2868, wherein the modified oligonucleotide comprises a gapmer consisting of a 5′-region, a 3′-region, and a central region positioned between the 5′-region and the 3′-region wherein:

    • the 5′-region consists of 3 linked modified nucleosides, wherein each nucleoside of the 5′-region comprises a cEt nucleoside;

the 3′-region consists of 3 linked modified nucleosides, wherein each nucleoside of the 3′-region comprises a cEt nucleoside;

the central region consists of 10 linked nucleosides, wherein the second nucleoside from the 5′ end of the central region comprises a 2′-O-methyl modified sugar moiety and the first and third through tenth nucleosides from the 5′ end of the central region each comprises a 2′ deoxynucleoside;

wherein each internucleoside linkage is a phosphorothioate linkage; and

wherein each cytosine is a 5-methylcytosine.

E29. A compound comprising a modified oligonucleotide consisting of 16-80 linked nucleobases having a nucleobase sequence comprising the sequence recited in SEQ ID NOs: 1200 or 2863, wherein the modified oligonucleotide comprises:

a gap segment consisting of nine linked 2′-deoxynucleosides;

a 5′ wing segment consisting of two linked nucleosides; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.

E30. A compound comprising or consisting of a modified oligonucleotide consisting of 16-80 linked nucleobases having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 2865, wherein the modified oligonucleotide comprises:

a gap segment consisting of ten linked 2′-deoxynucleosides;

a 5′ wing segment consisting of one linked nucleoside; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.

E31. The compound of any one of embodiments E1-E30, wherein the oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of SEQ ID NOs: 1-10.

E32. The compound of any one of embodiments E1-E31, wherein the compound is single-stranded.

E33. The compound of any one of embodiments E1-E31, wherein the compound is double-stranded.

E34. The compound of any one of embodiments E1-E33, wherein the compound comprises ribonucleotides.

E35. The compound of any one of embodiments E1-E33, wherein the compound comprises deoxyribonucleotides.

E36. The compound of any one of embodiments E1-E35, wherein the modified oligonucleotide consists of 16 to 30 linked nucleosides.

E37. The compound of any preceding embodiment E1-E36, wherein the compound consists of the modified oligonucleotide.

E38. A compound consisting of a pharmaceutically acceptable salt of any of the compounds of embodiments E1-E36.

E39. The compound of embodiment E38, wherein the pharmaceutically acceptable salt is a sodium salt.

E40. The compound of embodiment E38, wherein the pharmaceutically acceptable salt is a potassium salt.

E41. A compound having the formula:

or a salt thereof.

E42. A compound having the formula:

E43. A composition comprising the compound of any one of embodiments E1-E42 and a pharmaceutically acceptable diluent or carrier.

E44. A composition comprising the compound of any one of embodiments E1-E42 and water.

E45. A composition comprising a compound or modified oligonucleotide of any preceding embodiment E1-E44, for use in therapy.

E46. A combination comprising the compound of any one of embodiments E1-E42 or the composition of any of embodiments E43-E45 and a secondary agent.

E47. The combination of embodiment E46, wherein the secondary agent is a CDK4/6 inhibitor.

E48. The combination of embodiment E47, wherein the CDK4/6 inhibitor is palbociclib, ribociclib, or abemaciclib.

E49. The combination of embodiment E46, wherein the secondary agent is an EGFR inhibitor.

E50. The combination of embodiment E49, wherein the EGFR inhibitor is cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib.

E51. The combination of embodiment E46, wherein the secondary agent is a kinase inhibitor.

E52. The combination of embodiment E51, wherein the kinase inhibitor is sorafenib, regorafenib, or carbozantinib.

E53. A method of treating or ameliorating cancer in an individual comprising administering to the individual a compound targeted to YAP1, thereby treating or ameliorating the cancer.

E54. The method of embodiment E53, wherein the compound is an antisense compound targeted to YAP1.

E55. The method of embodiment E53 or E54, further comprising administering a secondary agent.

E56. The method of embodiment E55, wherein the secondary agent is a CDK4/6 inhibitor.

E57. The method of embodiment E56, wherein the CDK4/6 inhibitor is palbociclib, ribociclib, or abemaciclib.

E58. The method of embodiment E55, wherein the secondary agent is an EGFR inhibitor.

E59. The method of embodiment E58, wherein the EGFR inhibitor is cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib.

E60. The method of embodiment E55, wherein the secondary agent is a kinase inhibitor.

E61. The method of embodiment E60, wherein the kinase inhibitor is sorafenib, regorafenib, or carbozantinib.

E62. The method of any of embodiments E53-E61, wherein the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, or a cancer having a heterozygous FAT1 gene mutation, a squamous cell carcinoma (SCC) having a mutant FAT1 gene, a head and neck squamous cell carcinoma (HNSCC) having a mutant FAT1 gene, an oral tongue squamous cell carcinoma (OTSCC) having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.

E63. The method of any of embodiments E53-E62, wherein administering the compound inhibits or reduces cancer cell proliferation, tumor growth, or metastasis.

E64. A method of inhibiting expression of YAP1 in a cell comprising contacting the cell with a compound targeted to YAP1, thereby inhibiting expression of YAP1 in the cell.

E65. The method of embodiment E64, wherein the cell a cancer cell.

E66. The method of embodiment E65, wherein the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, or a cancer having a heterozygous FAT1 gene mutation, a squamous cell carcinoma (SCC) having a mutant FAT1 gene, a head and neck squamous cell carcinoma (HNSCC) having a mutant FAT1 gene, an oral tongue squamous cell carcinoma (OTSCC) having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.

E67. A method of reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis in an individual having cancer comprising administering a compound targeted to YAP1 to the individual, thereby reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis in the individual.

E68. The method of embodiment E67, wherein the individual has hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, or a cancer having a heterozygous FAT1 gene mutation, a squamous cell carcinoma (SCC) having a mutant FAT1 gene, a head and neck squamous cell carcinoma (HNSCC) having a mutant FAT1 gene, an oral tongue squamous cell carcinoma (OTSCC) having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.

E69. The method of any one of embodiments E64-E68, wherein the compound is an antisense compound targeted to YAP1.

E70. The method of any one of embodiments E64-E69, wherein the compound is the compound of any one of embodiments 1-42 or composition of any one of embodiments 43-45.

E71. The method of any of embodiments E64-E70, wherein the compound is administered parenterally.

E72. Use of a compound targeted to YAP1 for treating, preventing, or ameliorating a cancer associated with YAP1.

E73. Use of a compound targeted to YAP1 and a secondary agent for treating, preventing, or ameliorating a cancer associated with YAP1.

E74. The use of embodiment E73, wherein the secondary agent is a CDK4/6 inhibitor.

E75. The use of embodiment E74, wherein the CDK4/6 inhibitor is palbociclib, ribociclib, or abemaciclib.

E76. The use of embodiment E73, wherein the secondary agent is an EGFR inhibitor.

E77. The use of embodiment E76, wherein the EGFR inhibitor is cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib.

E78. The use of embodiment E73, wherein the secondary agent is a kinase inhibitor.

E79. The use of embodiment E78, wherein the kinase inhibitor is sorafenib, regorafenib, or carbozantinib.

E80. The use of any of embodiments E72-E79, wherein the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, or a cancer having a heterozygous FAT1 gene mutation, a squamous cell carcinoma (SCC) having a mutant FAT1 gene, a head and neck squamous cell carcinoma (HNSCC) having a mutant FAT1 gene, an oral tongue squamous cell carcinoma (OTSCC) having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.

E81. The use of any of embodiments E72-E80, wherein the compound is an antisense compound targeted to YAP1.

E82. The use of any of embodiments E72-E81, wherein the compound is the compound of any one of embodiments E1-E42 or composition of any one of embodiments E43-E45.

E83. Use of a compound targeted to YAP1 in the manufacture of a medicament for treating or ameliorating a cancer associated with YAP1.

E84. The use of embodiment E83, wherein the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, or a cancer having a heterozygous FAT1 gene mutation, a squamous cell carcinoma (SCC) having a mutant FAT1 gene, a head and neck squamous cell carcinoma (HNSCC) having a mutant FAT1 gene, an oral tongue squamous cell carcinoma (OTSCC) having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.

E85. The use of embodiment E83 or E84, wherein the compound is an antisense compound targeted to YAP1.

E86. The use of any one of embodiments E83-E85, wherein the compound is the compound of any one of embodiments 1-42 or composition of any one of embodiments E43-E45.

E87. Use of a compound targeted to YAP1 in the preparation of a medicament for treating or ameliorating a cancer associated with YAP1.

E88. The use of embodiment E87, wherein the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, or a cancer having a heterozygous FAT1 gene mutation, a squamous cell carcinoma (SCC) having a mutant FAT1 gene, a head and neck squamous cell carcinoma (HNSCC) having a mutant FAT1 gene, an oral tongue squamous cell carcinoma (OTSCC) having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.

E89. The use of embodiment E87 or E88, wherein the compound is an antisense compound targeted to YAP1.

E90. The use of any one of embodiments E87-E89, wherein the compound is the compound of any one of embodiments 1-42 or composition of any one of embodiments E43-E45.

Certain Indications

Certain embodiments provided herein relate to methods of inhibiting YAP1 expression, which can be useful for treating, preventing, or ameliorating a cancer associated with YAP1 in an individual, by administration of a compound that targets YAP1. In certain embodiments, the compound can be a YAP1 specific inhibitor. In certain embodiments, the compound can be an antisense compound, oligomeric compound, or oligonucleotide targeted to YAP1.

Examples of cancers associated with YAP1 treatable, preventable, and/or ameliorable with the compounds and methods provided herein include hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma.

In certain embodiments, a method of treating, preventing, or ameliorating a cancer associated with YAP1 in an individual comprises administering to the individual a compound comprising a YAP1 specific inhibitor, thereby treating, preventing, or ameliorating the cancer. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound inhibits or reduces cancer cell proliferation, tumor growth, or metastasis.

In certain embodiments, a method of treating or ameliorating caner comprises administering to the individual a compound comprising a YAP1 specific inhibitor, thereby treating or ameliorating the cancer. In certain embodiments, the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound inhibits or reduces cancer cell proliferation, tumor growth, or metastasis. In certain embodiments, the individual is identified as having or at risk of having a cancer associated with YAP1.

In certain embodiments, a method of inhibiting expression of YAP1 in an individual having, or at risk of having, a cancer associated with YAP1 comprises administering to the individual a compound comprising a YAP1 specific inhibitor, thereby inhibiting expression of YAP1 in the individual. In certain embodiments, administering the compound inhibits expression of YAP1 in a cancer cell in the individual. In certain embodiments, the individual has, or is at risk of having hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound inhibits or reduces cancer cell proliferation, tumor growth, or metastasis. In certain embodiments, the individual is identified as having or at risk of having a cancer associated with YAP1.

In certain embodiments, a method of inhibiting expression of YAP1 in a cell comprises contacting the cell with a compound comprising a YAP1 specific inhibitor, thereby inhibiting expression of YAP1 in the cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a liver cancer cell or squamous cancer cell. In certain embodiments, the cancer cell is in the liver, head, or neck of an individual having cancer. In certain embodiments, the cell is in an individual who has, or is at risk of having cancer, such as hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In certain embodiments, a method of reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis of an individual having, or at risk of having, a cancer associated with YAP1 comprises administering to the individual a compound comprising a YAP1 specific inhibitor, thereby reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis in the individual. In certain embodiments, the individual has, or is at risk of having, hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, the individual is identified as having or at risk of having a cancer associated with YAP1.

Certain embodiments are drawn to a compound comprising a YAP1 specific inhibitor for use in treating cancer. In certain embodiments, the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

Certain embodiments are drawn to a compound comprising a YAP1 specific inhibitor for use in reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis in an individual having cancer. In certain embodiments, the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

Certain embodiments are drawn to use of a compound comprising a YAP1 specific inhibitor for the manufacture or preparation of a medicament for treating cancer. Certain embodiments are drawn to use of a compound comprising a YAP1 specific inhibitor for the preparation of a medicament for treating a cancer associated with YAP1. In certain embodiments, the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

Certain embodiments are drawn to use of a compound comprising a YAP1 specific inhibitor for the manufacture or preparation of a medicament for reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis in an individual having cancer. In certain embodiments, the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In any of the foregoing methods or uses, the compound can be targeted to YAP1. In certain embodiments, the compound comprises or consists of a modified oligonucleotide, for example a modified oligonucleotide consisting of 8 to 80 linked nucleosides, 10 to 30 linked nucleosides, 12 to 30 linked nucleosides, or 20 linked nucleosides. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1-10. In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage, at least one nucleoside of the modified oligonucleotide comprises a modified sugar and/or at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a bicyclic sugar or a 2′-O-methoxyethyl, and the modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide has a gap segment consisting of linked 2′-deoxynucleosides; a 5′ wing segment consisting of linked nucleosides; and a 3′ wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

In any of the foregoing embodiments, the modified oligonucleotide can consist of 12 to 30, 15 to 30, 15 to 25, 15 to 24, 16 to 24, 17 to 24, 18 to 24, 19 to 24, 20 to 24, 19 to 22, 20 to 22, 16 to 20, or 17 or 20 linked nucleosides. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1-10. In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage, at least one nucleoside of the modified oligonucleotide comprises a modified sugar and/or at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a bicyclic sugar or a 2′-O-methoxyethyl, and the modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide has a gap segment consisting of linked 2′-deoxynucleosides; a 5′ wing segment consisting of linked nucleosides; and a 3′ wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940, wherein the modified oligonucleotide has:

    • a gap segment consisting of linked 2′-deoxynucleosides;
    • a 5′ wing segment consisting of linked nucleosides; and
    • a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863, wherein the modified oligonucleotide has:

    • a gap segment consisting of linked 2′-deoxynucleosides;
    • a 5′ wing segment consisting of linked nucleosides; and
    • a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 810 and 1404, wherein the modified oligonucleotide has:

a gap segment consisting often linked 2′-deoxynucleosides;

a 5′ wing segment consisting of three linked nucleosides; and

a 3′ wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 2864, wherein the modified oligonucleotide has:

a gap segment consisting often linked 2′-deoxynucleosides;

a 5′ wing segment consisting of one linked nucleoside; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NOs: 1200 or 2863, wherein the modified oligonucleotide has:

a gap segment consisting of nine linked 2′-deoxynucleosides;

a 5′ wing segment consisting of two linked nucleosides; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NO: 2865, wherein the modified oligonucleotide has:

a gap segment consisting of ten linked 2′-deoxynucleosides;

a 5′ wing segment consisting of one linked nucleoside; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the foregoing methods or uses, the compound can be a modified oligonucleotide, wherein the anion form of the modified oligonucleotide has the following chemical structure:

or a salt thereof.

In any of the foregoing methods or uses, the compound can be a modified oligonucleotide according to the following chemical structure:

or a salt thereof.

In any of the foregoing methods or uses, the compound can be a modified oligonucleotide according to the following chemical structure:

In any of the foregoing methods or uses, the compound can be administered parenterally. For example, in certain embodiments the compound can be administered through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.

Certain Combinations and Combination Therapies

In certain embodiments, a first agent comprising a compound described herein is co-administered with one or more secondary agents. In certain embodiments, such second agents are designed to treat the same disease, disorder, or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein. In certain embodiments, a first agent is designed to treat an undesired side effect of a second agent. In certain embodiments, second agents are co-administered with the first agent to treat an undesired effect of the first agent. In certain embodiments, such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein. In certain embodiments, second agents are co-administered with the first agent to produce a combinational effect. In certain embodiments, second agents are co-administered with the first agent to produce a synergistic effect. In certain embodiments, the co-administration of the first and second agents permits use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy.

In certain embodiments, one or more compounds or compositions provided herein, such as ION 1198440, are co-administered with one or more secondary agents. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are administered at different times. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are prepared together in a single formulation. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are prepared separately. In certain embodiments, a secondary agent is selected from: CDK4/6 inhibitors including but not limited to palbociclib, ribociclib, or abemaciclib; EGFR inhibitors including but not limited to cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib; or kinase inhibitors including but not limited to sorafenib, regorafenib, or carbozantinib.

Certain embodiments are directed to the use of a compound targeted to YAP1 as described herein, such as ION 1198440, in combination with a secondary agent. In particular embodiments such use is in a method of treating a patient suffering from cancer including, but not limited to, hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, a secondary agent is selected from: CDK4/6 inhibitors including but not limited to palbociclib, ribociclib, or abemaciclib; EGFR inhibitors including but not limited to cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib; or kinase inhibitors including but not limited to sorafenib, regorafenib, or carbozantinib.

Certain embodiments are drawn to a combination of a compound targeted to YAP1 as described herein, such as ION 1198440, and a secondary agent, such as CDK4/6 inhibitors including but not limited to palbociclib, ribociclib, or abemaciclib; EGFR inhibitors including but not limited to cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib; or kinase inhibitors including but not limited to sorafenib, regorafenib, or carbozantinib.

In certain embodiments the compound targeted to YAP1 as described herein, such as ION 1198440, and the secondary agent are used in combination treatment by administering the two agents simultaneously, separately or sequentially. In certain embodiments the two agents are formulated as a fixed dose combination product. In other embodiments the two agents are provided to the patient as separate units which can then either be taken simultaneously or serially (sequentially).

In certain embodiments, a compound targeted to YAP1 as described herein, such as ION 1198440, is used in combination with an immunomodulatory agent such as an anti-PD-L1 antibody (or an antigen-binding fragment thereof), an anti-PD-1 antibody (or an antigen-binding fragment thereof), an anti-CTLA-4 antibody (or an antigen-binding fragment thereof) or an OX40 agonist ((e.g., an OX40 ligand fusion protein, or an OX40 agonist antibody or antigen-binding fragment thereof).

In certain embodiments, a compound targeted to YAP1 as described herein, such as ION 1198440, is used in combination with an immune checkpoint inhibitor such as an anti-PD-L1 antibody (or an antigen-binding fragment thereof), an anti-PD-1 antibody (or an antigen-binding fragment thereof), or an anti-CTLA-4 antibody (or an antigen-binding fragment thereof).

Anti-PD-L1 antibodies are known in the art. Exemplary anti-PD-L1 antibodies include: MEDI4736 (durvalumab), MPDL3280A, BMS936559, 2.7A4, AMP-714, MDX-1105 and MPDL3280A (atezolizumab).

Anti-PD-1 antibodies are known in the art. Exemplary anti-PD-1 antibodies include: nivolumab, pembrolizumab, pidilizumab, and AMP-514

Anti-CTLA-4 antibodies are known in the art. Exemplary anti-CTLA-4 antibodies include: tremelimumab and ipilimumab, also termed MDX-010 (or BMS-734016).

OX40 agonists and antibodies are known in the art. Exemplary OX40 agonists and/or antibodies include: MEDI6383, 9B12 and MEDI0562.

In one embodiment, the combination includes the antisense oligonucleotide Ionis 1198440 or a salt thereof, and at least one immunomodulator selected from the group consisting of: MEDI4736, MPDL3280A, BMS936559, 2.7A4, AMP-714, MDX-1105, nivolumab, pembrolizumab, pidilizumab, MPDL3280A, tremelimumab, ipilimumab, MEDI0562 and MEDI0562.

In one embodiment, the combination includes the anti-PD-L1 antibody MEDI4736 (duvalumab) and ION 1198440.

In one embodiment, the combination includes ION 1198440, the anti-PD-L1 antibody MEDI4736 (durvalumab) and the anti-CTLA-4 antibody tremelimumab.

Certain Anti-PD-L1 Antibodies

Antibodies that specifically bind and inhibit PD-L1 are included in the present disclosure.

Durvalumab (MEDI4736) is an exemplary anti-PD-L1 antibody that is selective for a PD-L1 polypeptide and blocks the binding of PD-L1 to the PD-1 and CD80 receptors. Durvalumab can relieve PD-L1-mediated suppression of human T-cell activation in vitro and inhibits tumor growth in a xenograft model via a T-cell dependent mechanism.

Information regarding durvalumab (or fragments thereof) for use in the methods provided herein can be found in U.S. Pat. No. 8,779,108, the disclosure of which is incorporated herein by reference in its entirety. The fragment crystallizable (Fc) domain of durvalumab contains a triple mutation in the constant domain of the IgG1 heavy chain that reduces binding to the complement component C1q and the FcÎł receptors responsible for mediating antibody-dependent cell-mediated cytotoxicity (ADCC).

Durvalumab and antigen-binding fragments thereof for use in the methods provided herein comprises a heavy chain and a light chain or a heavy chain variable region and a light chain variable region. In certain embodiments, MEDI4736 or an antigen-binding fragment thereof for use in the methods provided herein comprises the variable heavy chain and variable light chain CDR sequences of the 2.14H9OPT antibody as disclosed in U.S. Pat. Nos. 8,779,108 and 9,493,565, which is herein incorporated by reference in its entirety.

There are numerous anti-PD-L1 antibodies in the published literature that could feature in the present disclosure, including compounds in development and/or in clinical trials such as: durvalumab (MEDI4736), MPDL3280A, BMS936559, 2.7A4, AMP-714 and MDX-1105. Patent specifications disclosing anti-PD-L1 antibodies that may be useful in the present disclosure include: U.S. Pat. Nos. 7,943,743; 8,383,796; 9,102,725; 9,273,135 (BMS/Medarex), US2006/0153841 (Dana Farber), US2011/0271358 (Dana Farber), U.S. Pat. Nos. 8,552,154 and 9,102,727 (Dana Farber), U.S. Pat. No. 8,217,149 (Genentech), including issued U.S. Pat. No. 8,217,149, US2012/0039906 (INSERM), US2016/0031990 (Amplimmune), U.S. Pat. No. 8,779,108 (MedImmune—for durvalumab/MED14726 and 2.7A4), US2014/0044738 (Amplimmune—for AMP-714) and US2010/0285039 (John's Hopkins University). Each of these disclosures is herein incorporated by reference in its entirety.

Certain Anti-CTLA-4 Antibodies

Antibodies that specifically bind CTLA-4 and inhibit CTLA-4 activity are useful for enhancing an anti-tumor immune response. Information regarding tremelimumab (or antigen-binding fragments thereof) for use in the methods provided herein can be found in U.S. Pat. No. 6,682,736 (where it is referred to as 11.2.1), the disclosure of which is incorporated herein by reference in its entirety. Tremelimumab (also known as CP-675,206, CP-675, CP-675206, and ticilimumab) is a human IgG2 monoclonal antibody that is highly selective for CTLA-4 and blocks binding of CTLA-4 to CD80 (B7.1) and CD86 (B7.2). It has been shown to result in immune activation in vitro and some patients treated with tremelimumab have shown tumor regression.

Tremelimumab for use in the methods provided herein comprises a heavy chain and a light chain or a heavy chain variable region and a light chain variable region. In a specific aspect, tremelimumab or an antigen-binding fragment thereof for use in the methods provided herein comprises a light chain variable region comprising the amino acid sequences shown herein above and a heavy chain variable region comprising the amino acid sequence shown herein above. In a specific aspect, tremelimumab or an antigen-binding fragment thereof for use in the methods provided herein comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises the Kabat-defined CDR1, CDR2, and CDR3 sequences shown herein above, and wherein the light chain variable region comprises the Kabat-defined CDR1, CDR2, and CDR3 sequences shown herein above. Those of ordinary skill in the art would easily be able to identify Chothia-defined, Abm-defined or other CDR definitions known to those of ordinary skill in the art. In a specific aspect, tremelimumab or an antigen-binding fragment thereof for use in the methods provided herein comprises the variable heavy chain and variable light chain CDR sequences of the 11.2.1 antibody as disclosed in U.S. Pat. No. 6,682,736, which is herein incorporated by reference in its entirety.

Other anti-CTLA-4 antibodies are described, for example, in US 20070243184. In one embodiment, the anti-CTLA-4 antibody is Ipilimumab, also termed MDX-010; BMS-734016.

Certain OX40 Agonists

OX40 agonists interact with the OX40 receptor on CD4+ T-cells during, or shortly after, priming by an antigen resulting in an increased response of the CD4+ T-cells to the antigen. An OX40 agonist interacting with the OX40 receptor on antigen specific CD4+ T-cells can increase T cell proliferation as compared to the response to antigen alone. The elevated response to the antigen can be maintained for a period of time substantially longer than in the absence of an OX40 agonist. Thus, stimulation via an OX40 agonist enhances the antigen specific immune response by boosting T-cell recognition of antigens, e.g., tumor cells. OX40 agonists are described, for example, in U.S. Pat. Nos. 6,312,700, 7,504,101, 7,622,444, and 7,959,925, which are incorporated herein by reference in their entireties. Methods of using such agonists in cancer treatment are described, for example, in US2015/0098942 and in US2015/0157710, each of which are incorporated herein by reference in its entirety.

OX40 agonists include, but are not limited to OX40 binding molecules, e.g., binding polypeptides, e.g., OX40 ligand (“OX40L”) or an OX40-binding fragment, variant, or derivative thereof, such as soluble extracellular ligand domains and OX40L fusion proteins, and anti-OX40 antibodies (for example, monoclonal antibodies such as humanized monoclonal antibodies), or an antigen-binding fragment, variant or derivative thereof. Examples of anti-OX40 monoclonal antibodies are described, for example, in U.S. Pat. Nos. 5,821,332 and 6,156,878, the disclosures of which are incorporated herein by reference in their entireties. In certain embodiments, the anti-OX40 monoclonal antibody is 9B12, or an antigen-binding fragment, variant, or derivative thereof, as described in Weinberg, A. D., et al. J Immunother 29, 575-585 (2006), which is incorporated herein by reference in its entirety. In another embodiment, an OX40 antibody is MEDI0562 as described in US 2016/0137740.

In certain embodiments, the antibody which specifically binds to OX40, or an antigen-binding fragment thereof binds to the same OX40 epitope as mAb 9B12. An example of a humanized OX40 antibody is described by Morris et al., Mol Immunol. May 2007; 44(12): 3112-3121. 9B12 is a murine IgG1, anti-OX40 mAb directed against the extracellular domain of human OX40 (CD134) (Weinberg, A. D., et al. J Immunother 29, 575-585 (2006)). It was selected from a panel of anti-OX40 monoclonal antibodies because of its ability to elicit an agonist response for OX40 signaling, stability, and for its high level of production by the hybridoma. For use in clinical applications, 9B12 mAb is equilibrated with phosphate buffered saline, pH 7.0, and its concentration is adjusted to 5.0 mg/ml by diafiltration.

“OX40 ligand” (“OX40L”) (also variously termed tumor necrosis factor ligand superfamily member 4, gp34, TAX transcriptionally-activated glycoprotein-1, and CD252) is found largely on antigen presenting cells (APCs), and can be induced on activated B cells, dendritic cells (DCs), Langerhans cells, plamacytoid DCs, and macrophages (Croft, M., (2010) Ann Rev Immunol 28:57-78). Other cells, including activated T cells, NK cells, mast cells, endothelial cells, and smooth muscle cells can express OX40L in response to inflammatory cytokines (Id.). OX40L specifically binds to the OX40 receptor. The human protein is described in U.S. Pat. No. 6,156,878. The mouse OX40L is described in U.S. Pat. No. 5,457,035. OX40L is expressed on the surface of cells and includes an intracellular, a transmembrane and an extracellular receptor-binding domain. A functionally active soluble form of OX40L can be produced by deleting the intracellular and transmembrane domains as described, e.g., in U.S. Pat. Nos. 5,457,035; 6,312,700; 6,156,878; 6,242,566; 6,528,055; 6,528,623; 7,098,184; and 7,125,670, the disclosures of which are incorporated herein for all purposes. A functionally active form of OX40L is a form that retains the capacity to bind specifically to OX40, that is, that possesses an OX40 “receptor binding domain.” An example is amino acids 51 to 183 of human OX40L. Methods of determining the ability of an OX40L molecule or derivative to bind specifically to OX40 are discussed below. Methods of making and using OX40L and its derivatives (such as derivatives that include an OX40 binding domain) are described in U.S. Pat. Nos. 6,156,878; 6,242,566; 6,528,055; 6,528,623; 7,098,184; and 7,125,670, which also describe proteins comprising the soluble form of OX40L linked to other peptides, such as human immunoglobulin (“Ig”) Fc regions, that can be produced to facilitate purification of OX40 ligand from cultured cells, or to enhance the stability of the molecule after in vivo administration to a mammal (see also, U.S. Pat. Nos. 5,457,035 and 7,959,925, both of which are incorporated by reference herein in their entireties).

Also included within the definition of OX40L are OX40 ligand variants which vary in amino acid sequence from naturally occurring OX40 ligand molecules but which retain the ability to specifically bind to an OX40 receptor. Such variants are described in U.S. Pat. Nos. 5,457,035; 6,156,878; 6,242,566; 6,528,055; 6,528,623; 7,098,184; and 7,125,670. In a related embodiment, a mutant of OX40L which has lost the ability to specifically bind to OX40, for example amino acids 51 to 183, in which the phenylalanine at position 180 of the receptor-binding domain of human OX40L has been replaced with alanine (F180A) is used.

OX40 agonists include a fusion protein in which one or more domains of OX40L is covalently linked to one or more additional protein domains. Exemplary OX40L fusion proteins that can be used as OX40 agonists are described in U.S. Pat. No. 6,312,700, the disclosure of which is incorporated herein by reference in its entirety. In one embodiment, an OX40 agonist includes an OX40L fusion polypeptide that self-assembles into a multimeric (e.g., trimeric or hexameric) OX40L fusion protein. Such fusion proteins are described, e.g., in U.S. Pat. No. 7,959,925, which is incorporated by reference herein in its entirety. The multimeric OX40L fusion protein exhibits increased efficacy in enhancing antigen specific immune response in a subject, particularly a human subject, due to its ability to spontaneously assemble into highly stable trimers and hexamers.

In another embodiment, an OX40 agonist capable of assembling into a multimeric form includes a fusion polypeptide comprising in an N-terminal to C-terminal direction: an immunoglobulin domain, wherein the immunoglobulin domain includes an Fc domain, a trimerization domain, wherein the trimerization domain includes a coiled coil trimerization domain, and a receptor binding domain, wherein the receptor binding domain is an OX40 receptor binding domain, e.g., an OX40L or an OX40-binding fragment, variant, or derivative thereof, where the fusion polypeptide can self-assemble into a trimeric fusion protein. In one aspect, an OX40 agonist capable of assembling into a multimeric form is capable of binding to the OX40 receptor and stimulating at least one OX40 mediated activity. In certain aspects, the OX40 agonist includes an extracellular domain of OX40 ligand.

The trimerization domain of an OX40 agonist capable of assembling into a multimeric form serves to promote self-assembly of individual OX40L fusion polypeptide molecules into a trimeric protein. Thus, an OX40L fusion polypeptide with a trimerization domain self-assembles into a trimeric OX40L fusion protein. In one aspect, the trimerization domain is an isoleucine zipper domain or other coiled coli polypeptide structure. Exemplary coiled coil trimerization domains include: TRAF2 (GENBANKÂŽ Accession No. Q12933, amino acids 299-348; Thrombospondin 1 (Accession No. P07996, amino acids 291-314; Matrilin-4 (Accession No. 095460, amino acids 594-618; CMP (matrilin-1) (Accession No. NP-002370, amino acids 463-496; HSF1 (Accession No. AAX42211, amino acids 165-191; and Cubilin (Accession No. NP-001072, amino acids 104-138. In certain specific aspects, the trimerization domain includes a TRAF2 trimerization domain, a Matrilin-4 trimerization domain, or a combination thereof.

OX40L FP is a human OX40 ligand IgG4P fusion protein that specifically binds to, and triggers signaling by, the human OX40 receptor, a member of the TNFR superfamily. OX40L FP is also disclosed in US2016/0024176, incorporated herein by reference in its entirety. OX40L FP is composed of three distinct domains: (1) human OX40 ligand extracellular receptor binding domains (RBDs) that form homotrimers and bind the OX40 receptor; (2) isoleucine zipper trimerization domains derived from TNFR-associated factor 2 that stabilize the homotrimeric structure of the OX40 ligand RBDs; and (3) human IgG4 fragment crystallizable gamma (FcÎł) domains that facilitate FcÎł receptor clustering of the fusion protein when bound to OX40 receptors, and contain a serine to proline substitution at position 228 (according to EU numbering) in the hinge regions (IgG4P) to promote stability of two sets of OX40 ligand RBD homotrimers. The IgG4P Fc domain is fused directly to an isoleucine zipper trimerization domain derived from amino acid residues 310-349 of human tumor necrosis factor 2 (TRAF2). Fused to the c-terminus of the TRAF2 domain are amino acid residues 51-183 of the extracellular receptor binding domain (RBD) of human OX40L (gene name TNFSF4). The TRAF2 domain stabilizes the homotrimeric structure of OX40L RBDs to enable OX40 binding and activation, while the IgG4P Fc domain confers serum stability, dimerization of OX40L trimers, and facilitates FcÎł receptor clustering of the hexameric fusion protein. One OX40L FP variant possesses a phenylalanine (F) to alanine (A) mutation at the amino acid corresponding to position 180 in OX40L. Another OX40L FP variant has the IgG4P Fc domain replaced with a human IgG1 Fc domain. In particular embodiments, the OX40 agonist for use in the present disclosure is one of the OX40L FP variants.

In particular embodiments, the OX40 agonist for use in the present disclosure has been modified to increase its serum half-life. For example, the serum half-life of an OX40 agonist can be increased by conjugation to a heterologous molecule such as serum albumin, an antibody Fc region, or PEG. In certain embodiments, OX40 agonists can be conjugated to other therapeutic agents or toxins to form immunoconjugates and/or fusion proteins. In certain embodiments, the OX40 agonist can be formulated so as to facilitate administration and promote stability of the active agent.

Antibody Derivatives

Antibodies for use in the present disclosure (e.g., anti-CTLA-4, anti-PD-L1, anti-PD-1, anti-OX40) may include variants of these sequences that retain the ability to specifically bind their targets. Such variants may be derived from the sequence of these antibodies by a skilled artisan using techniques well known in the art. For example, amino acid substitutions, deletions, or additions, can be made in the FRs and/or in the CDRs. While changes in the FRs are usually designed to improve stability and immunogenicity of the antibody, changes in the CDRs are typically designed to increase affinity of the antibody for its target. Variants of FRs also include naturally occurring immunoglobulin allotypes. Such affinity-increasing changes may be determined empirically by routine techniques that involve altering the CDR and testing the affinity antibody for its target. For example, conservative amino acid substitutions can be made within any one of the disclosed CDRs. Various alterations can be made according to the methods described in Antibody Engineering, 2nd ed., Oxford University Press, ed. Borrebaeck, 1995. These include but are not limited to nucleotide sequences that are altered by the substitution of different codons that encode a functionally equivalent amino acid residue within the sequence, thus producing a “silent” change. For example, the nonpolar amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine. The polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged (basic) amino acids include arginine, lysine, and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

Derivatives and analogs of antibodies of the present disclosure can be produced by various techniques well known in the art, including recombinant and synthetic methods (Maniatis (1990) Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., and Bodansky et al. (1995) The Practice of Peptide Synthesis, 2nd ed., Spring Verlag, Berlin, Germany). Analogous shuffling or combinatorial techniques are also disclosed by Stemmer (Nature (1994) 370: 389-391), who describes the technique in relation to a β-lactamase gene but observes that the approach may be used for the generation of antibodies.

One may generate novel VH or VL regions carrying one or more sequences derived from the sequences disclosed herein using random mutagenesis of one or more selected VH and/or VL genes. One such technique, error-prone PCR, is described by Gram et al. (Proc. Nat. Acad. Sci. U.S.A. (1992) 89: 3576-3580).

Another method that may be used is to direct mutagenesis to CDRs of VH or VL genes. Such techniques are disclosed by Barbas et al. (Proc. Nat. Acad. Sci. U.S.A. (1994) 91: 3809-3813) and Schier et al. (J. Mol. Biol. (1996) 263: 551-567).

Similarly, one or more, or all three CDRs may be grafted into a repertoire of VH or VL domains, which are then screened for an antigen-binding fragment specific for CTLA-4 or PD-L1.

A portion of an immunoglobulin variable domain will comprise at least one of the CDRs substantially as set out herein and, optionally, intervening framework regions from the scFv fragments as set out herein. The portion may include at least about 50% of either or both of FR1 and FR4, the 50% being the C-terminal 50% of FR1 and the N-terminal 50% of FR4. Additional residues at the N-terminal or C-terminal end of the substantial part of the variable domain may be those not normally associated with naturally occurring variable domain regions. For example, construction of antibodies by recombinant DNA techniques may result in the introduction of N- or C-terminal residues encoded by linkers introduced to facilitate cloning or other manipulation steps. Other manipulation steps include the introduction of linkers to join variable domains to further protein sequences including immunoglobulin heavy chain constant regions, other variable domains (for example, in the production of diabodies), or proteinaceous labels as discussed in further detail below.

A skilled artisan will recognize that antibodies for use in the present disclosure may comprise antigen-binding fragments containing only a single CDR from either VL or VH domain. Either one of the single chain specific binding domains can be used to screen for complementary domains capable of forming a two-domain specific antigen-binding fragment capable of, for example, binding to CTLA-4 and PD-L1.

Antibodies for use in the present disclosure described herein can be linked to another functional molecule, e.g., another peptide or protein (albumin, another antibody, etc.). For example, the antibodies can be linked by chemical cross-linking or by recombinant methods. The antibodies may also be linked to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192; or 4,179,337. The antibodies can be chemically modified by covalent conjugation to a polymer, for example, to increase their circulating half-life. Exemplary polymers and methods to attach them are also shown in U.S. Pat. Nos. 4,766,106; 4,179,337; 4,495,285, and 4,609,546.

The antibodies may also be altered to have a glycosylation pattern that differs from the native pattern. For example, one or more carbohydrate moieties can be deleted and/or one or more glycosylation sites added to the original antibody. Addition of glycosylation sites to the presently disclosed antibodies may be accomplished by altering the amino acid sequence to contain glycosylation site consensus sequences known in the art. Another means of increasing the number of carbohydrate moieties on the antibodies is by chemical or enzymatic coupling of glycosides to the amino acid residues of the antibody. Such methods are described in WO 87/05330, and in Aplin et al. (1981) CRC Crit. Rev. Biochem., 22: 259-306. Removal of any carbohydrate moieties from the antibodies may be accomplished chemically or enzymatically, for example, as described by Hakimuddin et al. (1987) Arch. Biochem. Biophys., 259: 52; and Edge et al. (1981) Anal. Biochem., 118: 131 and by Thotakura et al. (1987) Meth. Enzymol., 138: 350. The antibodies may also be tagged with a detectable, or functional, label. Detectable labels include radiolabels such as 131I or 99Tc, which may also be attached to antibodies using conventional chemistry. Detectable labels also include enzyme labels such as horseradish peroxidase or alkaline phosphatase. Detectable labels further include chemical moieties such as biotin, which may be detected via binding to a specific cognate detectable moiety, e.g., labeled avidin.

Antibodies, in which CDR sequences differ only insubstantially from those set forth herein are encompassed within the scope of this present disclosure. Typically, an amino acid is substituted by a related amino acid having similar charge, hydrophobic, or stereochemical characteristics. Such substitutions would be within the ordinary skills of an artisan. Unlike in CDRs, more substantial changes can be made in FRs without adversely affecting the binding properties of an antibody. Changes to FRs include, but are not limited to, humanizing a non-human derived or engineering certain framework residues that are important for antigen contact or for stabilizing the binding site, e.g., changing the class or subclass of the constant region, changing specific amino acid residues which might alter the effector function such as Fc receptor binding, e.g., as described in U.S. Pat. Nos. 5,624,821 and 5,648,260 and Lund et al. (1991) J. Immun. 147: 2657-2662 and Morgan et al. (1995) Immunology 86: 319-324, or changing the species from which the constant region is derived.

One of skill in the art will appreciate that the modifications described above are not all-exhaustive, and that many other modifications would be obvious to a skilled artisan in light of the teachings of the present disclosure.

Certain Compounds

In certain embodiments, compounds described herein can be antisense compounds. In certain embodiments, the antisense compound comprises or consists of an oligomeric compound. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

In certain embodiments, a compound described herein comprises or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

In certain embodiments, a compound or antisense compound is single-stranded. Such a single-stranded compound or antisense compound comprises or consists of an oligomeric compound. In certain embodiments, such an oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugate group. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a single-stranded antisense compound or oligomeric compound comprises a self-complementary nucleobase sequence.

In certain embodiments, compounds are double-stranded. Such double-stranded compounds comprise a first modified oligonucleotide having a region complementary to a target nucleic acid and a second modified oligonucleotide having a region complementary to the first modified oligonucleotide. In certain embodiments, the modified oligonucleotide is an RNA oligonucleotide. In such embodiments, the thymine nucleobase in the modified oligonucleotide is replaced by a uracil nucleobase. In certain embodiments, compound comprises a conjugate group. In certain embodiments, one of the modified oligonucleotides is conjugated. In certain embodiments, both the modified oligonucleotides are conjugated. In certain embodiments, the first modified oligonucleotide is conjugated. In certain embodiments, the second modified oligonucleotide is conjugated. In certain embodiments, the first modified oligonucleotide consists of 12-30 linked nucleosides and the second modified oligonucleotide consists of 12-30 linked nucleosides. In certain embodiments, one of the modified oligonucleotides has a nucleobase sequence comprising at least 8 contiguous nucleobases of any of SEQ ID NOs: 23-2940.

In certain embodiments, antisense compounds are double-stranded. Such double-stranded antisense compounds comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. The first oligomeric compound of such double stranded antisense compounds typically comprises or consists of a modified oligonucleotide and optionally a conjugate group. The oligonucleotide of the second oligomeric compound of such double-stranded antisense compound may be modified or unmodified. Either or both oligomeric compounds of a double-stranded antisense compound may comprise a conjugate group. The oligomeric compounds of double-stranded antisense compounds may include non-complementary overhanging nucleosides.

Examples of single-stranded and double-stranded compounds include but are not limited to oligonucleotides, siRNAs, microRNA targeting oligonucleotides, and single-stranded RNAi compounds, such as small hairpin RNAs (shRNAs), single-stranded siRNAs (ssRNAs), and microRNA mimics.

In certain embodiments, a compound described herein has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 10 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 12 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 12 to 22 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 14 to 30 linked subunits. In certain embodiments, compound described herein comprises an oligonucleotide consisting of 14 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 15 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 15 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 16 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 16 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 17 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 17 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 18 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 18 to 21 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 18 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 20 to 30 linked subunits. In other words, such oligonucleotides consist of 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, 18 to 21 subunits, 20 to 30 subunits, or 12 to 22 linked subunits, respectively. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 14 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 16 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 17 linked subunits. In certain embodiments, compound described herein comprises an oligonucleotide consisting of 18 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 19 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 20 linked subunits. In other embodiments, a compound described herein comprises an oligonucleotide consisting of 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits. In certain such embodiments, the compound described herein comprises an oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits, or a range defined by any two of the above values. In some embodiments the linked subunits are nucleotides, nucleosides, or nucleobases.

In certain embodiments, the compound may further comprise additional features or elements, such as a conjugate group, that are attached to the oligonucleotide. In certain embodiments, such compounds are antisense compounds. In certain embodiments, such compounds are oligomeric compounds. In embodiments where a conjugate group comprises a nucleoside (i.e. a nucleoside that links the conjugate group to the oligonucleotide), the nucleoside of the conjugate group is not counted in the length of the oligonucleotide.

In certain embodiments, compounds may be shortened or truncated. For example, a single subunit may be deleted from the 5′ end (5′ truncation), or alternatively from the 3′ end (3′ truncation). A shortened or truncated compound targeted to an YAP1 nucleic acid may have two subunits deleted from the 5′ end, or alternatively may have two subunits deleted from the 3′ end, of the compound. Alternatively, the deleted nucleosides may be dispersed throughout the compound.

When a single additional subunit is present in a lengthened compound, the additional subunit may be located at the 5′ or 3′ end of the compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in a compound having two subunits added to the 5′ end (5′ addition), or alternatively to the 3′ end (3′ addition), of the compound. Alternatively, the added subunits may be dispersed throughout the compound.

It is possible to increase or decrease the length of a compound, such as an oligonucleotide, and/or introduce mismatch bases without eliminating activity (Woolf et al. Proc. Natl. Acad. Sci. USA 1992, 89:7305-7309; Gautschi et al. J. Natl. Cancer Inst. March 2001, 93:463-471; Maher and Dolnick Nuc. Acid. Res. 1998, 16:3341-3358). However, seemingly small changes in oligonucleotide sequence, chemistry and motif can make large differences in one or more of the many properties required for clinical development (Seth et al. J. Med. Chem. 2009, 52, 10; Egli et al. J. Am. Chem. Soc. 2011, 133, 16642).

In certain embodiments, compounds described herein are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as short-interfering RNA or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and/or sequester a target nucleic acid (thus, include microRNA/microRNA-mimic compounds). As used herein, the term siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term “RNAi” is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.

In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to YAP1 described herein. In certain embodiments, the compound can be double-stranded. In certain embodiments, the compound comprises a first strand comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 23-2940 and a second strand. In certain embodiments, the compound comprises a first strand comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940 and a second strand. In certain embodiments, the compound comprises ribonucleotides in which the first strand has uracil (U) in place of thymine (T) in any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises (i) a first strand comprising a nucleobase sequence complementary to the site on YAP1 to which any of SEQ ID NOs: 23-2940 is targeted, and (ii) a second strand. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2′ position in the sugar contains a halogen (such as fluorine group; 2′-F) or contains an alkoxy group (such as a methoxy group; 2′-OMe). In certain embodiments, the compound comprises at least one 2′-F sugar modification and at least one 2′-OMe sugar modification. In certain embodiments, the at least one 2′-F sugar modification and at least one 2′-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the dsRNA compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compound contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000.

In certain embodiments, the first strand of the compound is an siRNA guide strand and the second strand of the compound is an siRNA passenger strand. In certain embodiments, the second strand of the compound is complementary to the first strand. In certain embodiments, each strand of the compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides. In certain embodiments, the first or second strand of the compound can comprise a conjugate group.

In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to YAP1 described herein. In certain embodiments, the compound is single stranded. In certain embodiments, such a compound is a single-stranded RNAi (ssRNAi) compound. In certain embodiments, the compound comprises at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises ribonucleotides in which uracil (U) is in place of thymine (T) in any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a nucleobase sequence complementary to the site on YAP1 to which any of SEQ ID NOs: 23-2940 is targeted. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2′ position in the sugar contains a halogen (such as fluorine group; 2′-F) or contains an alkoxy group (such as a methoxy group; 2′-OMe). In certain embodiments, the compound comprises at least one 2′-F sugar modification and at least one 2′-OMe sugar modification. In certain embodiments, the at least one 2′-F sugar modification and at least one 2′-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compound contains a capped strand, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000. In certain embodiments, the compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides. In certain embodiments, the compound can comprise a conjugate group.

In certain embodiments, compounds described herein comprise modified oligonucleotides. Certain modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or f such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the modified oligonucleotides provided herein are all such possible isomers, including their racemic and optically pure forms, unless specified otherwise. Likewise, all cis- and trans-isomers and tautomeric forms are also included.

The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2H or 3H in place of 1H, 13C or 14C in place of 12C, 15N in place of 14N, 17O or 18O in place of 16O, and 33S, 34S, 35S, or 36S in place of 32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes, such as an imaging assay.

Certain Mechanisms

In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. In certain embodiments, compounds described herein are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, compounds described herein selectively affect one or more target nucleic acid. Such compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in a significant undesired antisense activity.

In certain antisense activities, hybridization of a compound described herein to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain compounds described herein result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, compounds described herein are sufficiently “DNA-like” to elicit RNase H activity. Further, in certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.

In certain antisense activities, compounds described herein or a portion of the compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain compounds described herein result in cleavage of the target nucleic acid by Argonaute. Compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).

In certain embodiments, hybridization of compounds described herein to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of the compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of the compound to a target nucleic acid results in alteration of translation of the target nucleic acid.

Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and/or a phenotypic change in a cell or animal.

Target Nucleic Acids, Target Regions and Nucleotide Sequences

In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron.

Nucleotide sequences that encode YAP1 include, without limitation, the following: GENBANK or RefSEQ No. NM_001282101.1 (SEQ ID NO: 1); NC_000011.10 truncated from nucleotides 102107001 to 102236000 (SEQ ID NO: 2); NM 006106.4 (SEQ ID NO: 3); NM_001130145.2 (SEQ ID NO: 4); NM_001195044.1 (SEQ ID NO: 5); NM_001195045.1 (SEQ ID NO: 6); NM_001282097.1 (SEQ ID NO: 7); NM_001282098.1 (SEQ ID NO: 8); NM_001282099.1 (SEQ ID NO: 9); and NM_001282100.1 (SEQ ID NO: 10), each of which is incorporated by reference in its entirety.

Hybridization

In some embodiments, hybridization occurs between a compound disclosed herein and a YAP1 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

Hybridization can occur under varying conditions. Hybridization conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein are specifically hybridizable with a YAP1 nucleic acid.

Complementarity

An oligonucleotide is said to be complementary to another nucleic acid when the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Nucleobase matches or complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methyl cytosine (mC) and guanine (G) unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. An oligonucleotide is fully complementary or 100% complementary when such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.

In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. Non-complementary nucleobases between a compound and a YAP1 nucleic acid may be tolerated provided that the compound remains able to specifically hybridize to a target nucleic acid. Moreover, a compound may hybridize over one or more segments of a YAP1 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

In certain embodiments, the compounds provided herein, or a specified portion thereof, are, are at least, or are up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a YAP1 nucleic acid, a target region, target segment, or specified portion thereof. In certain embodiments, the compounds provided herein, or a specified portion thereof, are 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or any number in between these ranges, complementary to a YAP1 nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of a compound with a target nucleic acid can be determined using routine methods.

For example, a compound in which 18 of 20 nucleobases of the compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, a compound which consists of 18 nucleobases having four non-complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid. Percent complementarity of a compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

In certain embodiments, compounds described herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, a compound may be fully complementary to a YAP1 nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, “fully complementary” means each nucleobase of a compound is complementary to the corresponding nucleobase of a target nucleic acid. For example, a 20 nucleobase compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the compound. Fully complementary can also be used in reference to a specified portion of the first and/or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase compound can be “fully complementary” to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase compound is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the compound. At the same time, the entire 30 nucleobase compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.

In certain embodiments, compounds described herein comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain such embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain such embodiments selectivity of the compound is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5′-end of the gap region. In certain such embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3′-end of the gap region. In certain such embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5′-end of the wing region. In certain such embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3′-end of the wing region. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide not having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5′-end of the oligonucleotide. In certain such embodiments, the mismatch is at position, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3′-end of the oligonucleotide.

The location of a non-complementary nucleobase may be at the 5′ end or 3′ end of the compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer oligonucleotide.

In certain embodiments, compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a YAP1 nucleic acid, or specified portion thereof.

In certain embodiments, compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a YAP1 nucleic acid, or specified portion thereof.

In certain embodiments, compounds described herein also include those which are complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of a compound. In certain embodiments, the compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 15 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 16 nucleobase portion of a target segment. Also contemplated are compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Identity

The compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or portion thereof. In certain embodiments, compounds described herein are antisense compounds or oligomeric compounds. In certain embodiments, compounds described herein are modified oligonucleotides. As used herein, a compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the compounds described herein as well as compounds having non-identical bases relative to the compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the compound. Percent identity of an compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

In certain embodiments, compounds described herein, or portions thereof, are, or are at least, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the compounds or SEQ ID NOs, or a portion thereof, disclosed herein. In certain embodiments, compounds described herein are about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, or any percentage between such values, to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or portion thereof, in which the compounds comprise an oligonucleotide having one or more mismatched nucleobases. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5′-end of the oligonucleotide. In certain such embodiments, the mismatch is at position, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3′-end of the oligonucleotide.

In certain embodiments, compounds described herein comprise or consist of antisense compounds. In certain embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

In certain embodiments, compounds described herein comprise or consist of oligonucleotides. In certain embodiments, a portion of the oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

Certain Modified Compounds

In certain embodiments, compounds described herein comprise or consist of oligonucleotides consisting of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA (i.e., comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage).

A. Modified Nucleosides

Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.

1. Modified Sugar Moieties

In certain embodiments, sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more acyclic substituent, including but not limited to substituents at the 2′, 4′, and/or 5′ positions. In certain embodiments one or more acyclic substituent of non-bicyclic modified sugar moieties is branched. Examples of 2′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2′-F, 2′-OCH3 (“OMe” or “O-methyl”), and 2′-O(CH2)2OCH3 (“MOE”). In certain embodiments, 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O—C1-C10 alkoxy, O—C1-C10 substituted alkoxy, 0-C1-C10 alkyl, O—C1-C10 substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(═O)—N(Rm)(Rn), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl, and the 2′-substituent groups described in Cook et al., U.S. Pat. No. 6,531,584; Cook et al., U.S. Pat. No. 5,859,221; and Cook et al., U.S. Pat. No. 6,005,087. Certain embodiments of these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4′-substituent groups suitable for linearly non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5′-methyl (R or S), 5′-vinyl, and 5′-methoxy. In certain embodiments, non-bicyclic modified sugars comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., US2010/190837 and Rajeev et al., US2013/0203836.

In certain embodiments, a 2′-substituted nucleoside or 2′-non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2′-substituent group selected from: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH═CH2, OCH2CH═CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(═O)—N(Rm)(Rn)), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl.

In certain embodiments, a 2′-substituted nucleoside or 2′-non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2′-substituent group selected from: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(═O)—N(H)CH3 (“NMA”).

In certain embodiments, a 2′-substituted nucleoside or 2′-non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2′-substituent group selected from: F, OCH3, and OCH2CH2OCH3.

Nucleosides comprising modified sugar moieties, such as non-bicyclic modified sugar moieties, are referred to by the position(s) of the substitution(s) on the sugar moiety of the nucleoside. For example, nucleosides comprising 2′-substituted or 2-modified sugar moieties are referred to as 2′-substituted nucleosides or 2-modified nucleosides.

Certain modified sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms. Examples of such 4′ to 2′ bridging sugar substituents include but are not limited to: 4′-CH2-2′, 4′-(CH2)2-2′, 4′-(CH2)3-2′, 4′-CH2—O-2′ (“LNA”), 4′-CH2—S-2′, 4′-(CH2)2—O-2′ (“ENA”), 4′-CH(CH3)—O-2′ (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4′-CH2—O—CH2-2′, 4′-CH2—N(R)-2′, 4′-CH(CH2OCH3)—O-2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 7,399,845, Bhat et al., U.S. Pat. No. 7,569,686, Swayze et al., U.S. Pat. No. 7,741,457, and Swayze et al., U.S. Pat. No. 8,022,193), 4′-C(CH3)(CH3)—O-2′ and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283), 4′-CH2—N(OCH3)-2′ and analogs thereof (see, e.g., Prakash et al., U.S. Pat. No. 8,278,425), 4′-CH2—O—N(CH3)-2′ (see, e.g., Allerson et al., U.S. Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745), 4′-CH2—C(H)(CH3)-2′ (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4′-CH2—C(═CH2)-2′ and analogs thereof (see e.g., Seth et al., U.S. Pat. No. 8,278,426), 4′-C(RaRb)—N(R)—O-2′, 4′-C(RaRb)—O—N(R)-2′, 4′-CH2—O—N(R)-2′, and 4′-CH2—N(R)—O-2′, wherein each R, Ra, and Rb is, independently, H, a protecting group, or C1-C12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672).

In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(Ra)(Rb)]n—, —[C(Ra)(Rb)]n—O—, —C(Ra)═C(Rb)—, —C(Ra)═N—, —C(═NRa)—, —C(═O)—, —C(═S)—, —O—, —Si(Ra)2—, —S(═O)x—, and —N(Ra)—;

wherein:

x is 0, 1, or 2;

n is 1, 2, 3, or 4;

each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O)2-J1), or sulfoxyl (S(═O)-J1); and each J1 and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.

Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wengel et al., U.S. Pat. No. 7,053,207, Imanishi et al., U.S. Pat. No. 6,268,490, Imanishi et al. U.S. Pat. No. 6,770,748, Imanishi et al., U.S. RE44,779; Wengel et al., U.S. Pat. No. 6,794,499, Wengel et al., U.S. Pat. No. 6,670,461; Wengel et al., U.S. Pat. No. 7,034,133, Wengel et al., U.S. Pat. No. 8,080,644; Wengel et al., U.S. Pat. No. 8,034,909; Wengel et al., U.S. Pat. No. 8,153,365; Wengel et al., U.S. Pat. No. 7,572,582; and Ramasamy et al., U.S. Pat. No. 6,525,191, Torsten et al., WO 2004/106356, Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. Pat. No. 7,547,684; Seth et al., U.S. Pat. No. 7,666,854; Seth et al., U.S. Pat. No. 8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth et al., U.S. Pat. No. 8,030,467; Seth et al., U.S. Pat. No. 8,268,980; Seth et al., U.S. Pat. No. 8,546,556; Seth et al., U.S. Pat. No. 8,530,640; Migawa et al., U.S. Pat. No. 9,012,421; Seth et al., U.S. Pat. No. 8,501,805; Allerson et al., US2008/0039618; and Migawa et al., US2015/0191727.

In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the ι-L configuration or in the β-D configuration.

α-L-methyleneoxy (4′-CH2—O—2′) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified.

In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).

In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2′-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5′ position.

In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see e.g., Leumann, C J. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:

(“F-HNA”, see e.g., Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; and Swayze et al., U.S. Pat. No. 9,005,906, F-HNA can also be referred to as a F-THP or 3′-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:

wherein, independently, for each of said modified THP nucleoside:

Bx is a nucleobase moiety;

T3 and T4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′-terminal group; q1, q2, q3, q4, q5, q6 and q7 are each, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and each of R1 and R2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(═X)J1, OC(═X)NJ1J2, NJ3C(═X)NJ1J2, and CN, wherein X is O, S or NJ1, and each J1, J2, and J3 is, independently, H or C1-C6 alkyl.

In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6 and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.”

In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013/130378.

Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.

2. Modified Nucleobases

Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds.

In certain embodiments, compounds described herein comprise modified oligonucleotides. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.

In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimi-dines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (C═C—CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443.

Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manoharan et al., US2003/0158403, Manoharan et al., US2003/0175906; Dinh et al., U.S. Pat. No. 4,845,205; Spielvogel et al., U.S. Pat. No. 5,130,302; Rogers et al., U.S. Pat. No. 5,134,066; Bischofberger et al., U.S. Pat. No. 5,175,273; Urdea et al., U.S. Pat. No. 5,367,066; Benner et al., U.S. Pat. No. 5,432,272; Matteucci et al., U.S. Pat. No. 5,434,257; Gmeiner et al., U.S. Pat. No. 5,457,187; Cook et al., U.S. Pat. No. 5,459,255; Froehler et al., U.S. Pat. No. 5,484,908; Matteucci et al., U.S. Pat. No. 5,502,177; Hawkins et al., U.S. Pat. No. 5,525,711; Haralambidis et al., U.S. Pat. No. 5,552,540; Cook et al., U.S. Pat. No. 5,587,469; Froehler et al., U.S. Pat. No. 5,594,121; Switzer et al., U.S. Pat. No. 5,596,091; Cook et al., U.S. Pat. No. 5,614,617; Froehler et al., U.S. Pat. No. 5,645,985; Cook et al., U.S. Pat. No. 5,681,941; Cook et al., U.S. Pat. No. 5,811,534; Cook et al., U.S. Pat. No. 5,750,692; Cook et al., U.S. Pat. No. 5,948,903; Cook et al., U.S. Pat. No. 5,587,470; Cook et al., U.S. Pat. No. 5,457,191; Matteucci et al., U.S. Pat. No. 5,763,588; Froehler et al., U.S. Pat. No. 5,830,653; Cook et al., U.S. Pat. No. 5,808,027; Cook et al., U.S. Pat. No. 6,166,199; and Matteucci et al., U.S. Pat. No. 6,005,096.

In certain embodiments, compounds targeted to a YAP1 nucleic acid comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

3. Modified Internucleoside Linkages

The naturally occurring internucleoside linkage of RNA and DNA is a 3′ to 5′ phosphodiester linkage In certain embodiments, compounds described herein having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

In certain embodiments, compounds targeted to an YAP1 nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.

In certain embodiments, compounds described herein comprise oligonucleotides. Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P═O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P═S”), and phosphorodithioates (“HS-P═S”). Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (—CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (—O—C(═O)(NH)—S—); siloxane (—O—SiH2-O—); and N,N′-dimethylhydrazine (—CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral internucleoside linkages include but are not limited to alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.

Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH2-N(CH3)-O—5′), amide-3 (3′-CH2-C(═O)—N(H)-5′), amide-4 (3′-CH2-N(H)—C(═O)-5′), formacetal (3′-O—CH2-O—5′), methoxypropyl, and thioformacetal (3′-S—CH2-O—5′). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.

In certain embodiments, oligonucleotides comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif. In certain embodiments, internucleoside linkages are arranged in a gapped motif. In such embodiments, the internucleoside linkages in each of two wing regions are different from the internucleoside linkages in the gap region. In certain embodiments the internucleoside linkages in the wings are phosphodiester and the internucleoside linkages in the gap are phosphorothioate. The nucleoside motif is independently selected, so such oligonucleotides having a gapped internucleoside linkage motif may or may not have a gapped nucleoside motif and if it does have a gapped nucleoside motif, the wing and gap lengths may or may not be the same.

In certain embodiments, oligonucleotides comprise a region having an alternating internucleoside linkage motif. In certain embodiments, oligonucleotides comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate.

In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3′ end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3′ end of the oligonucleotide.

In certain embodiments, oligonucleotides comprise one or more methylphosponate linkages. In certain embodiments, oligonucleotides having a gapmer nucleoside motif comprise a linkage motif comprising all phosphorothioate linkages except for one or two methylphosponate linkages. In certain embodiments, one methylphosponate linkage is in the central gap of an oligonucleotide having a gapmer nucleoside motif.

In certain embodiments, it is desirable to arrange the number of phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, it is desirable to arrange the number and position of phosphorothioate internucleoside linkages and the number and position of phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate internucleoside linkages may be decreased and the number of phosphodiester internucleoside linkages may be increased. In certain embodiments, the number of phosphorothioate internucleoside linkages may be decreased and the number of phosphodiester internucleoside linkages may be increased while still maintaining nuclease resistance. In certain embodiments it is desirable to decrease the number of phosphorothioate internucleoside linkages while retaining nuclease resistance. In certain embodiments it is desirable to increase the number of phosphodiester internucleoside linkages while retaining nuclease resistance.

Certain Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. Oligonucleotides can have a motif, e.g. a pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages. In certain embodiments, modified oligonucleotides comprise one or more modified nucleoside comprising a modified sugar. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).

a. Certain Sugar Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.

In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which comprises two external regions or “wings” and a central or internal region or “gap.” The three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3′-most nucleoside of the 5′-wing and the 5′-most nucleoside of the 3′-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5′-wing differs from the sugar motif of the 3′-wing (asymmetric gapmer).

In certain embodiments, the wings of a gapmer comprise 1-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 2-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 3-5 nucleosides. In certain embodiments, the nucleosides of a gapmer are all modified nucleosides.

In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, the gap of a gapmer comprises 7-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 8-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 10 nucleosides. In certain embodiment, each nucleoside of the gap of a gapmer is an unmodified 2′-deoxy nucleoside.

In certain embodiments, the gapmer is a deoxy gapmer. In such embodiments, the nucleosides on the gap side of each wing/gap junction are unmodified 2′-deoxy nucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides. In certain such embodiments, each nucleoside of the gap is an unmodified 2′-deoxy nucleoside. In certain such embodiments, each nucleoside of each wing is a modified nucleoside.

In certain embodiments, a modified oligonucleotide has a fully modified sugar motif wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif wherein each nucleoside of the region comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified comprises the same 2′-modification.

In certain embodiments, a modified oligonucleotide can comprise a sugar motif described in Swayze et al., US2010/0197762; Freier et al., US2014/0107330; Freier et al., US2015/0184153; and Seth et al., US2015/0267195, each of which is incorporated by reference in its entirety herein.

Certain embodiments provided herein are directed to modified oligomeric compounds useful for inhibiting target nucleic acid expression, which can be useful for treating, preventing, ameliorating, or slowing progression of a disease associated with such a target nucleic acid. In certain embodiments, the modified oligomeric compounds comprise antisense oligonucleotides that are gapmers having certain sugar motifs. In certain embodiments, the gapmer sugar motifs provided herein can be combined with any nucleobase sequence and any internucleoside linkage motif to form potent antisense oligonucleotides.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: ekk-d9-kkee, wherein ‘d’ represents a 2′-deoxyribose sugar, ‘k’ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: k-d9-kekeke, wherein ‘d’ represents a 2′-deoxyribose sugar, ‘k’ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kkk-d8-kekek, wherein ‘d’ represents a 2′-deoxyribose sugar, ‘k’ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kkk-d9-keke, wherein ‘d’ represents a 2′-deoxyribose sugar, ‘k’ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-kdkdk, wherein ‘d’ represents a 2′-deoxyribose sugar, ‘k’ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-eeekk, wherein ‘d’ represents a 2′-deoxyribose sugar, ‘k’ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-eeekk, wherein ‘d’ represents a 2′-deoxyribose sugar, ‘k’ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-ekeke, wherein ‘d’ represents a 2′-deoxyribose sugar, ‘k’ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.

b. Certain Nucleobase Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.

In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3′-end of the oligonucleotide. In certain embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5′-end of the oligonucleotide.

In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2′-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.

c. Certain Internucleoside Linkage Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, essentially each internucleoside linking group is a phosphate internucleoside linkage (P═O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate (P═S). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is independently selected from a phosphorothioate and phosphate internucleoside linkage. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphate linkages. In certain embodiments, the terminal internucleoside linkages are modified.

4. Certain Modified Oligonucleotides

In certain embodiments, compounds described herein comprise modified oligonucleotides. In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification, motifs, and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif. Likewise, such gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Furthermore, in certain instances, an oligonucleotide is described by an overall length or range and by lengths or length ranges of two or more regions (e.g., a regions of nucleosides having specified sugar modifications), in such circumstances it may be possible to select numbers for each range that result in an oligonucleotide having an overall length falling outside the specified range. In such circumstances, both elements must be satisfied. For example, in certain embodiments, a modified oligonucleotide consists of 15-20 linked nucleosides and has a sugar motif consisting of three regions, A, B, and C, wherein region A consists of 2-6 linked nucleosides having a specified sugar motif, region B consists of 6-10 linked nucleosides having a specified sugar motif, and region C consists of 2-6 linked nucleosides having a specified sugar motif. Such embodiments do not include modified oligonucleotides where A and C each consist of 6 linked nucleosides and B consists of 10 linked nucleosides (even though those numbers of nucleosides are permitted within the requirements for A, B, and C) because the overall length of such oligonucleotide is 22, which exceeds the upper limit of the overall length of the modified oligonucleotide (20). Herein, if a description of an oligonucleotide is silent with respect to one or more parameter, such parameter is not limited. Thus, a modified oligonucleotide described only as having a gapmer sugar motif without further description may have any length, internucleoside linkage motif, and nucleobase motif Unless otherwise indicated, all modifications are independent of nucleobase sequence.

Certain Conjugated Compounds

In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2′-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3′ and/or 5′-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3′-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5′-end of oligonucleotides.

In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a compound has a nucleobase sequence that is complementary to a target nucleic acid. In certain embodiments, oligonucleotides are complementary to a messenger RNA (mRNA). In certain embodiments, oligonucleotides are complementary to a sense transcript.

Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

A. Certain Conjugate Groups

In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.

Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic, a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), -an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, i, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; doi: 10.1038/mtna.2014.72 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).

1. Conjugate Moieties

Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

2. Conjugate Linkers

Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain compounds, a conjugate group is a single chemical bond (i.e. conjugate moiety is attached to an oligonucleotide via a conjugate linker through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.

In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which a compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, a compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such a compound is more than 30. Alternatively, an compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such a compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.

In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate may comprise one or more cleavable moieties, typically within the conjugate linker. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.

In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, one or more linker-nucleosides are linked to one another and/or to the remainder of the compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2′-deoxy nucleoside that is attached to either the 3′ or 5′-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2′-deoxyadenosine.

Compositions and Methods for Formulating Pharmaceutical Compositions

Compounds described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

Certain embodiments provide pharmaceutical compositions comprising one or more compounds or a salt thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds comprise or consist of a modified oligonucleotide. In certain such embodiments, the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more compound. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more compound and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

A compound described herein targeted to YAP1 nucleic acid can be utilized in pharmaceutical compositions by combining the compound with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising a compound targeted to YAP1 nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the compound comprises or consists of a modified oligonucleotide provided herein.

Pharmaceutical compositions comprising compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

A prodrug can include the incorporation of additional nucleosides at one or both ends of a compound which are cleaved by endogenous nucleases within the body, to form the active compound.

In certain embodiments, the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.

EXAMPLES

The Examples below describe the screening process to identify lead compounds targeted to YAP1. Out of over 3,000 oligonucleotides that were screened, ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872 emerged as the top lead compounds. In particular, ION 1198440 exhibited the best combination of properties in terms of potency and tolerability out of over 3,000 oligonucleotides.

Non-Limiting Disclosure and Incorporation by Reference

Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2′-OH for the natural 2′-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) for natural uracil of RNA).

Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligonucleotide having the nucleobase sequence “ATCGATCG” encompasses any oligonucleotides having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and compounds having other modified nucleobases, such as “ATmCGAUCG,” wherein mC indicates a cytosine base comprising a methyl group at the 5-position.

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

Example 1: Antisense Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers

Modified oligonucleotides were designed to target a Yap1 nucleic acid and were tested for their effect on Yap1 mRNA level in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured A-431 cells at a density of 5,000 cells per well were treated using free uptake with 2,000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and Yap1 mRNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS4814 (forward sequence GGGAAGTGAGCCTGTTTGGA, designated herein as SEQ ID NO.: 11; reverse sequence ACTGTTGAACAAACTAAATGCTGTGA, designated herein as SEQ ID NO.: 12; probe sequence ATGGATGCCATTCCTTTTGCCCAGTT, designated herein as SEQ ID NO.: 13) was used to measure mRNA levels. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREENÂŽ. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). The modified oligonucleotides with percent control values marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides targeting the amplicon region.

The newly designed modified oligonucleotides in the Tables below were designed as 3-10-3 cEt gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on the 5′ direction and the 3′ direction comprising three nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a cEt sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P═S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.

“Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either SEQ ID NO.: 1 (GENBANK Accession No. NM_001282101.1), or SEQ ID NO.: 2 (GENBANK Accession No. NC_000011.10 truncated from nucleotides 102107001 to 102236000). ‘N/A’ indicates that the modified oligonucleotide does not target that particular gene sequence with 10000 complementarity. ‘N.D.’ indicates that the % UTC is not defined for that particular modified oligonucleotide in that particular experiment. Activity of the modified oligonucleotide may be defined in a different experiment.

TABLE 1
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1 and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2 YAP1
Compound Start Stop Start Stop (% SEQ
Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO
715400 559 574 4019 4034 CTCCGAGTCCCCGCGG 107 23
715403 658 673 4118 4133 GAAGGAGTCGGGCAGC 72 24
715406 664 679 4124 4139 CTTGAAGAAGGAGTCG 58 25
715409 704 719 N/A N/A CAGTACTGGCCTGTCG 76 26
715412 710 725 7144 7159 CTGCATCAGTACTGGC 66 27
715415 744 759 7178 7193 CGAACATGCTGTGGAG 24 28
715418 798 813 7232 7247 AGTGTCCCAGGAGAAA 126 29
715421 949 964 N/A N/A GTGATTTAAGAAGTAT 71 30
715424 972 987 55467 55482 TGCCATGTTGTTGTCT 58 31
715427 1081 1096 79022 79037 CCATCCATCAGGAAGA 90 32
715430 1102 1117 79043 79058 ATCCTGAGTCATGGCT 118 33
715433 1133 1148 79074 79089 TGTTCTTATGGTTTAT 36 34
715436 1178 1193 N/A N/A TGGCAAAACGAGGGTC 126 35
715439 1184 1199 N/A N/A GGTTCATGGCAAAACG 99 36
715442 1210 1225 98912 98927 CACTGGAGCACTCTGA 64 37
715445 1460 1475 116649 116664 CATCCTGCTCCAGTGT 87 38
715448 1509 1524 116698 116713 CTCAATTCCTGAGACA 97 39
715451 1516 1531 116705 116720 CATTGTTCTCAATTCC 75 40
715454 1558 1573 N/A N/A ATAGGTGCCACTGTTA 78 41
715457 1564 1579 120469 120484 AGAGTGATAGGTGCCA 47 42
715460 1570 1585 120475 120490 ATCTCGAGAGTGATAG 114 43
715463 1608 1623 120513 120528 CTGTAGCTGCTCATGC 73 44
715466 1751 1766 122776 122791 CAAGGTCCACATTTGT 83 45
715469 1870 1885 122895 122910 TAGCTTGGTGGCAGCC 94 46
715472 1876 1891 122901 122916 TTTATCTAGCTTGGTG 52 47
715475 1883 1898 122908 122923 AGCTTTCTTTATCTAG 103 48
715478 3560 3575 124585 124600 ACCATTATTACTCCTG 7 49
715481 3566 3581 124591 124606 TTGGAAACCATTATTA 66 50
715484 3572 3587 101152 101167 TACTCTTTGGAAACCA 123 51
124597 124612
715487 3630 3645 124655 124670 ATTACTTCATAGCTTA 22 52
715490 3636 3651 124661 124676 CCAACTATTACTTCAT 38 53
715493 3665 3680 124690 124705 GTGCTAGCTGGTGCCA 62 54
715496 3720 3735 124745 124760 CCCTTGAAAATAAGGG 124 55
715499 3726 3741 124751 124766 TATGAACCCTTGAAAA 126 56
715502 4011 4026 125036 125051 CCAGACTTAATTCAAG 91 57
715505 4684 4699 125709 125724 ATTGGTTTATTGTAAA 84 58
715508 1397 1412 102529 102544 CTGTGCTGGGATTGAT 24 59
715511 1419 1434 N/A N/A TCCTGACATTTTGGAG 107 60
715514 N/A N/A 4573 4588 GAGCGAAGGTGCGGAG 121 61
715517 N/A N/A 5151 5166 GGCCTATGAGTCAACC 109 62
715520 N/A N/A 5544 5559 TTCTTTCCACTCAAGT 122 63
715523 N/A N/A 7140 7155 ATCAGTACTGGCCTAT 32 64
715526 N/A N/A 7385 7400 ACTTACTTTAAGAAGT 112 65
715529 N/A N/A 8646 8661 TGAAACCTGATCCTTT 148 66
715532 N/A N/A 8820 8835 TAACAACCTGGTTTGT 91 67
715535 N/A N/A 8906 8921 CTATTAAGCTGTTTAA 91 68
715538 N/A N/A 10383 10398 CTTTGTAACTTAAAAG 110 69
715541 N/A N/A 10918 10933 CTTGAAGAACTATTTC 105 70
715544 N/A N/A 10924 10939 CAACTACTTGAAGAAC 128 71
715547 N/A N/A 10930 10945 GTTGACCAACTACTTG 98 72
715550 N/A N/A 10938 10953 AGGAAGTTGTTGACCA 70 73
715553 N/A N/A 10944 10959 AGAAATAGGAAGTTGT 90 74
715556 N/A N/A 10965 10980 AAGTTATTCAGCAGCT 63 75
715559 N/A N/A 28556 28571 CTGCCATTTAAGAAAT 114 76
715562 N/A N/A 37601 37616 CACACAACTCAGACAG 77 77
715565 N/A N/A 37826 37841 GGATAAATGAATTATA 115 78
715568 N/A N/A 37832 37847 AAGGTAGGATAAATGA 116 79
715571 N/A N/A 105518 105533 AAAATCCTGCCAACAT 127 80
715574 N/A N/A 79119 79134 TACCAAAACGAGGGTC 118 81
715577 N/A N/A 80085 80100 GCATTCACAGAGTTAA 21 82
715580 N/A N/A 80919 80934 GCCTGTCTGGAATACA 101 83
715583 N/A N/A 80954 80969 GGGCCACAAAATAAAA 164 84
715586 N/A N/A 80980 80995 AAAAGGTCTGGAACAG 53 85
715589 N/A N/A 81086 81101 CCAGCAGCTAACAGCT 107 86
715592 N/A N/A 81151 81166 TTCTTTGGCAGAGATA 89 87
715595 N/A N/A 98883 98898 TCATGGCTGAAATGAA 104 88
715598 N/A N/A 102395 102410 CCCAAGCTACCCAAGA 103 89
715601 N/A N/A 102401 102416 AGAATTCCCAAGCTAC 106 90
715604 N/A N/A 102407 102422 TAGCACAGAATTCCCA 107 91
715607 N/A N/A 102413 102428 TCACCATAGCACAGAA 116 92
715610 N/A N/A 102451 102466 GGCTGTGTAGGCTGAC 87 93
715613 N/A N/A 102473 102488 ATTACTTTAAGCCACA 85 94
715616 N/A N/A 102484 102499 GACGGATAAAAATTAC 95 95
715619 N/A N/A 102490 102505 AAATAAGACGGATAAA 114 96
715622 N/A N/A 102496 102511 AGTAAAAAATAAGACG 137 97
715625 N/A N/A 102506 102521 ATTGCCTAAGAGTAAA 99 98
715628 N/A N/A 102555 102570 GCCTACCTGACATTTT 114 99
715631 N/A N/A 102561 102576 ATAAGAGCCTACCTGA 134 100

TABLE 2
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1 and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2 YAP1
Compound Start Stop Start Stop (% SEQ
Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO
715401 562 577 4022 4037 GGTCTCCGAGTCCCCG 84 101
715404 660 675 4120 4135 AAGAAGGAGTCGGGCA 64 102
715407 666 681 4126 4141 GGCTTGAAGAAGGAGT 53 103
715410 706 721 N/A N/A ATCAGTACTGGCCTGT 61 104
715413 740 755 7174 7189 CATGCTGTGGAGTCAG 96 105
715416 746 761 7180 7195 CTCGAACATGCTGTGG 53 106
715419 929 944 7363 7378 GACCAGAAGATGTCTT 107 107
715422 968 983 55463 55478 ATGTTGTTGTCTGATC 57 108
715425 976 991 55471 55486 GTCCTGCCATGTTGTT 98 109
715428 1083 1098 79024 79039 TCCCATCCATCAGGAA 106 110
715431 1104 1119 79045 79060 CCATCCTGAGTCATGG 99 111
715434 1136 1151 79077 79092 TCTTGTTCTTATGGTT 31 112
715437 1180 1195 N/A N/A CATGGCAAAACGAGGG 89 113
715440 1186 1201 N/A N/A CTGGTTCATGGCAAAA 85 114
715443 1212 1227 98914 98929 TTCACTGGAGCACTCT 40 115
715446 1505 1520 116694 116709 ATTCCTGAGACATCCC 81 116
715449 1511 1526 116700 116715 TTCTCAATTCCTGAGA 124 117
715452 1518 1533 116707 116722 GTCATTGTTCTCAATT 71 118
715455 1560 1575 N/A N/A TGATAGGTGCCACTGT 65 119
715458 1566 1581 120471 120486 CGAGAGTGATAGGTGC 58 120
715461 1572 1587 120477 120492 TCATCTCGAGAGTGAT 153 121
715464 1745 1760 122770 122785 CCACATTTGTCCCAGG 89 122
715467 1769 1784 122794 122809 CATCTCCTTCCAGTGT 77 123
715470 1872 1887 122897 122912 TCTAGCTTGGTGGCAG 83 124
715473 1878 1893 122903 122918 TCTTTATCTAGCTTGG 32 125
715476 1885 1900 122910 122925 AAAGCTTTCTTTATCT 84 126
715479 3562 3577 124587 124602 AAACCATTATTACTCC 38 127
715482 3568 3583 124593 124608 CTTTGGAAACCATTAT 58 128
715485 3574 3589 124599 124614 AATACTCTTTGGAAAC 72 129
715488 3632 3647 124657 124672 CTATTACTTCATAGCT 66 130
715491 3638 3653 124663 124678 AACCAACTATTACTTC 71 131
715494 3668 3683 124693 124708 GAGGTGCTAGCTGGTG 46 132
715497 3722 3737 124747 124762 AACCCTTGAAAATAAG 155 133
715500 3966 3981 11043 11058 AAGCCTTAGAGTCAAT 30 134
124991 125006
715503 4013 4028 125038 125053 CCCCAGACTTAATTCA 136 135
715506 4686 4701 125711 125726 AAATTGGTTTATTGTA 112 136
715509 1399 1414 102531 102546 TGCTGTGCTGGGATTG 42 137
715512 N/A N/A 4550 4565 AGGCGCGCGCATTGTG 97 138
715515 N/A N/A 5147 5162 TATGAGTCAACCTGCA 94 139
715518 N/A N/A 5477 5492 TTTGGGCAAAGTTCCT 60 140
715521 N/A N/A 5546 5561 TCTTCTTTCCACTCAA 72 141
715524 N/A N/A 7381 7396 ACTTTAAGAAGTATCT 93 142
715527 N/A N/A 7387 7402 TCACTTACTTTAAGAA 111 143
715530 N/A N/A 8816 8831 AACCTGGTTTGTTTCC 61 144
715533 N/A N/A 8822 8837 CCTAACAACCTGGTTT 97 145
715536 N/A N/A 8908 8923 GGCTATTAAGCTGTTT 137 146
715539 N/A N/A 10637 10652 AGATCTCACTGACCTA 102 147
715542 N/A N/A 10920 10935 TACTTGAAGAACTATT 120 148
715545 N/A N/A 10926 10941 ACCAACTACTTGAAGA 87 149
715548 N/A N/A 10934 10949 AGTTGTTGACCAACTA 117 150
715551 N/A N/A 10940 10955 ATAGGAAGTTGTTGAC 82 151
715554 N/A N/A 10961 10976 TATTCAGCAGCTTATA 93 152
715557 N/A N/A 10967 10982 GGAAGTTATTCAGCAG 46 153
715560 N/A N/A 37563 37578 CCCTTTACAAAAATAG 98 154
715563 N/A N/A 37603 37618 AGCACACAACTCAGAC 86 155
715566 N/A N/A 37828 37843 TAGGATAAATGAATTA 94 156
715569 N/A N/A 37834 37849 CAAAGGTAGGATAAAT 122 157
715572 N/A N/A 78867 78882 TCAGAGAAGAAAGGTA 97 158
715575 N/A N/A 79123 79138 CCTTTACCAAAACGAG 134 159
715578 N/A N/A 80087 80102 TGGCATTCACAGAGTT 50 160
715581 N/A N/A 80921 80936 AAGCCTGTCTGGAATA 106 161
715584 N/A N/A 80976 80991 GGTCTGGAACAGATTA 96 162
715587 N/A N/A 80982 80997 TGAAAAGGTCTGGAAC 79 163
715590 N/A N/A 81147 81162 TTGGCAGAGATAAAAC 84 164
715593 N/A N/A 81153 81168 ATTTCTTTGGCAGAGA 60 165
715596 N/A N/A 98885 98900 GTTCATGGCTGAAATG 104 166
715599 N/A N/A 102397 102412 TTCCCAAGCTACCCAA 82 167
715602 N/A N/A 102403 102418 ACAGAATTCCCAAGCT 110 168
715605 N/A N/A 102409 102424 CATAGCACAGAATTCC 112 169
715608 N/A N/A 102430 102445 AATTGTATCCAGACAT 100 170
715611 N/A N/A 102469 102484 CTTTAAGCCACATGGT 106 171
715614 N/A N/A 102475 102490 AAATTACTTTAAGCCA 110 172
715617 N/A N/A 102486 102501 AAGACGGATAAAAATT 98 173
715620 N/A N/A 102492 102507 AAAAATAAGACGGATA 111 174
715623 N/A N/A 102502 102517 CCTAAGAGTAAAAAAT 113 175
715626 N/A N/A 102551 102566 ACCTGACATTTTGGAG 64 176
715629 N/A N/A 102557 102572 GAGCCTACCTGACATT 112 177
715632 N/A N/A 109609 109624 ATCCAATTATGTCCCA 109 178

TABLE 3
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1 and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2 YAP1
Compound Start Stop Start Stop (% SEQ
Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO
715402 656 671 4116 4131 AGGAGTCGGGCAGCTT 59 179
715405 662 677 4122 4137 TGAAGAAGGAGTCGGG 60 180
715408 668 683 4128 4143 GCGGCTTGAAGAAGGA 60 181
715411 708 723 7142 7157 GCATCAGTACTGGCCT 94 182
715414 742 757 7176 7191 AACATGCTGTGGAGTC 31 183
715417 749 764 7183 7198 GAGCTCGAACATGCTG 104 184
715420 947 962 N/A N/A GATTTAAGAAGTATCT 107 185
715423 970 985 55465 55480 CCATGTTGTTGTCTGA 30 186
715426 1079 1094 79020 79035 ATCCATCAGGAAGAGG 80 187
715429 1100 1115 79041 79056 CCTGAGTCATGGCTTG 62 188
715432 1106 1121 79047 79062 CTCCATCCTGAGTCAT 65 189
715435 1138 1153 79079 79094 GGTCTTGTTCTTATGG 36 190
715438 1182 1197 N/A N/A TTCATGGCAAAACGAG 82 191
715441 1188 1203 N/A N/A CTCTGGTTCATGGCAA 57 192
715444 1249 1264 98951 98966 TCCCTGTGGGCTCTGG 84 193
715447 1507 1522 116696 116711 CAATTCCTGAGACATC 81 194
715450 1514 1529 116703 116718 TTGTTCTCAATTCCTG 53 195
715453 1556 1571 N/A N/A AGGTGCCACTGTTAAG 59 196
715456 1562 1577 120467 120482 AGTGATAGGTGCCACT 96 197
715459 1568 1583 120473 120488 CTCGAGAGTGATAGGT 93 198
715462 1574 1589 120479 120494 TCTCATCTCGAGAGTG 94 199
715465 1747 1762 122772 122787 GTCCACATTTGTCCCA 91 200
715468 1868 1883 122893 122908 GCTTGGTGGCAGCCAA 90 201
715471 1874 1889 122899 122914 TATCTAGCTTGGTGGC 36 202
715474 1881 1896 122906 122921 CTTTCTTTATCTAGCT 78 203
715477 3543 3558 124568 124583 AGACACATACTCTAGT 61 204
715480 3564 3579 124589 124604 GGAAACCATTATTACT 23 205
715483 3570 3585 124595 124610 CTCTTTGGAAACCATT 15 206
715486 3628 3643 124653 124668 TACTTCATAGCTTATA 27 207
715489 3634 3649 124659 124674 AACTATTACTTCATAG 90 208
715492 3663 3678 124688 124703 GCTAGCTGGTGCCACT 76 209
715495 3671 3686 124696 124711 ACAGAGGTGCTAGCTG 80 210
715498 3724 3739 124749 124764 TGAACCCTTGAAAATA 91 211
715501 3968 3983 64588 64603 AAAAGCCTTAGAGTCA 28 212
124993 125008
715504 4682 4697 125707 125722 TGGTTTATTGTAAAAG 70 213
715507 1391 1406 102523 102538 TGGGATTGATATTCCG 95 214
715510 1402 1417 102534 102549 ATTTGCTGTGCTGGGA 22 215
715513 N/A N/A 4554 4569 GCGGAGGCGCGCGCAT 125 216
715516 N/A N/A 5149 5164 CCTATGAGTCAACCTG 77 217
715519 N/A N/A 5540 5555 TTCCACTCAAGTTACA 96 218
715522 N/A N/A 5548 5563 ACTCTTCTTTCCACTC 87 219
715525 N/A N/A 7383 7398 TTACTTTAAGAAGTAT 100 220
715528 N/A N/A 8644 8659 AAACCTGATCCTTTGA 98 221
715531 N/A N/A 8818 8833 ACAACCTGGTTTGTTT 94 222
715534 N/A N/A 8885 8900 TCCCCAGGTCAGCATG 112 223
715537 N/A N/A 10155 10170 ACTTGGCACCAAAAGC 122 224
715540 N/A N/A 10916 10931 TGAAGAACTATTTCCT 82 225
715543 N/A N/A 10922 10937 ACTACTTGAAGAACTA 72 226
715546 N/A N/A 10928 10943 TGACCAACTACTTGAA 59 227
715549 N/A N/A 10936 10951 GAAGTTGTTGACCAAC 66 228
715552 N/A N/A 10942 10957 AAATAGGAAGTTGTTG 86 229
715555 N/A N/A 10963 10978 GTTATTCAGCAGCTTA 21 230
715558 N/A N/A 10969 10984 CAGGAAGTTATTCAGC 37 231
715561 N/A N/A 37599 37614 CACAACTCAGACAGGG 69 232
715564 N/A N/A 37605 37620 CAAGCACACAACTCAG 75 233
715567 N/A N/A 37830 37845 GGTAGGATAAATGAAT 99 234
715570 N/A N/A 37836 37851 GCCAAAGGTAGGATAA 79 235
715573 N/A N/A 64347 64362 TATATATGGTAGTCTA 76 236
715576 N/A N/A 79125 79140 AACCTTTACCAAAACG 80 237
715579 N/A N/A 80917 80932 CTGTCTGGAATACACA 100 238
715582 N/A N/A 80924 80939 GTCAAGCCTGTCTGGA 33 239
715585 N/A N/A 80978 80993 AAGGTCTGGAACAGAT 73 240
715588 N/A N/A 81084 81099 AGCAGCTAACAGCTTG 96 241
715591 N/A N/A 81149 81164 CTTTGGCAGAGATAAA 41 242
715594 N/A N/A 81155 81170 ATATTTCTTTGGCAGA 39 243
715597 N/A N/A 98888 98903 CTGGTTCATGGCTGAA 89 244
715600 N/A N/A 102399 102414 AATTCCCAAGCTACCC 82 245
715603 N/A N/A 102405 102420 GCACAGAATTCCCAAG 106 246
715606 N/A N/A 102411 102426 ACCATAGCACAGAATT 88 247
715609 N/A N/A 102448 102463 TGTGTAGGCTGACTTA 56 248
715612 N/A N/A 102471 102486 TACTTTAAGCCACATG 77 249
715615 N/A N/A 102482 102497 CGGATAAAAATTACTT 94 250
715618 N/A N/A 102488 102503 ATAAGACGGATAAAAA 101 251
715621 N/A N/A 102494 102509 TAAAAAATAAGACGGA 106 252
715624 N/A N/A 102504 102519 TGCCTAAGAGTAAAAA 123 253
715627 N/A N/A 102553 102568 CTACCTGACATTTTGG 88 254
715630 N/A N/A 102559 102574 AAGAGCCTACCTGACA 94 255
715633 N/A N/A 120466 120481 GTGATAGGTGCCACTA 78 256

Example 2: Antisense Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers

Modified oligonucleotides were designed to target a Yap1 nucleic acid and were tested for their effect on Yap1 mRNA level in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured A-431 cells at a density of 5,000 cells per well were treated using free uptake with 2,000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and Yap1 mRNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS4814 was used to measure mRNA levels. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREENÂŽ. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). The modified oligonucleotides with percent control values marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides targeting the amplicon region.

The newly designed modified oligonucleotides in the Tables below were designed as 3-10-3 cEt gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on the 5′ direction and the 3′ direction comprising three nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a cEt sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P═S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.

“Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Gapmers listed in the Tables below are targeted to either SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 (GENBANK Accession No. NM_006106.4), or SEQ ID NO: 4 (GENBANK Accession No. NM_001130145.2). ‘N/A’ indicates that the modified oligonucleotide does not target that particular gene sequence with 100% complementarity. ‘N.D.’ indicates that the % UTC is not defined for that particular modified oligonucleotide in that particular experiment. Activity of the modified oligonucleotide may be defined in a different experiment.

TABLE 4
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1 and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2 YAP1
Compound Start Stop Start Stop (% SEQ
Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO
716346 1 16 3461 3476 TTTCCCTGGCGGCGGC 77 257
716349 107 122 3567 3582 ACTTTTTCCCTCCAAC 78 258
716352 184 199 3644 3659 CTGCGCCCCGGCTCCA 105 259
716355 279 294 3739 3754 GACGGCTGCGGGCCGG 96 260
716358 331 346 3791 3806 CGAGGGCTACGCCCGG 104 261
716361 405 420 3865 3880 GGTTGAGGCGGCGGCT 75 262
716364 493 508 3953 3968 CGCCGCGGGTGCCGGT 110 263
716367 631 646 4091 4106 CATGGGCACGGTCTGG 70 264
716370 716 731 7150 7165 CAGTGCCTGCATCAGT 25 265
716373 775 790 7209 7224 CAACTGCAGAGAAGCT 69 266
716376 855 870 7289 7304 CGAAGATGCTGAGCTG 35 267
716379 927 942 7361 7376 CCAGAAGATGTCTTTG 123 268
716382 993 1008 55488 55503 AGCATGGCCTTCCTGG 73 269
716385 1084 1099 79025 79040 TTCCCATCCATCAGGA 87 270
716388 1144 1159 79085 79100 AGAGGTGGTCTTGTTC 55 271
716391 1206 1221 98908 98923 GGAGCACTCTGACTGA 44 272
716394 1304 1319 99006 99021 GTTGCTGCAGTCGCAT 120 273
716397 1365 1380 99067 99082 GGCCTCACCTGCCGAA 88 274
716400 1423 1438 N/A N/A TAACTCCTGACATTTT 106 275
716403 1491 1506 116680 116695 CCGGGAGAAGACACTG 110 276
716406 1576 1591 120481 120496 ACTCTCATCTCGAGAG 117 277
716409 1636 1651 120541 120556 CAGGAAGTCATCTGGG 99 278
716412 1717 1732 122742 122757 GTAGTCTGGGAAACGG 41 279
716415 1794 1809 122819 122834 AGCTCCTCTCCTTCTA 90 280
716418 1910 1925 122935 122950 CCTGAGGGCTCTATAA 75 281
716421 1996 2011 123021 123036 TATTAGCCTGAAAACT 86 282
716424 2064 2079 123089 123104 GCAATGGACAAGGAAG 25 283
716427 2170 2185 123195 123210 AGCCCCCAAAATGAAC 86 284
716430* 2221 2236 123246 123261 TAACTGGGCAAAAGGA 28 285
716433* 2272 2287 123297 123312 AGCATCTGACTTCTAA 20 286
716436 2329 2344 123354 123369 ACTGGACAAAGGAAGC 59 287
716439 2387 2402 123412 123427 GTATTTAATATCAGAT 77 288
716442 2466 2481 123491 123506 GCACTAGGAGGAAAAG 63 289
716445 2559 2574 123584 123599 GTATGTGGCAATAATT 28 290
716448 2683 2698 123708 123723 CCGACAAAACCAACCA 62 291
716451 2734 2749 123759 123774 CCCAAGCTACAACTAT 67 292
716454 2803 2818 123828 123843 CGAGATTTAAATAAGG 27 293
716457 2883 2898 123908 123923 AAAGGATACATTCCAC 61 294
716460 2946 2961 123971 123986 TATTCTAAATGCATAC 86 295
716463 2998 3013 124023 124038 GACTGCCCCAACCAGA 64 296
716466 3071 3086 124096 124111 GTGGAGCACTCCCCTA 58 297
716469 3122 3137 124147 124162 GTTTGCTCCTTTCCAA 25 298
716472 3204 3219 124229 124244 GTCATGCACATTATGA 78 299
716475 3272 3287 124297 124312 CTTCCAAAACTAAGGC 63 300
716478 3330 3345 124355 124370 TATTTTAATCTAGTCG 46 301
716481 3382 3397 121835 121850 TCAGCATAGAAGTAGG 23 302
124407 124422
716484 3433 3448 124458 124473 CACTTTTCCAGCTAAC 35 303
716487 3541 3556 42912 42927 ACACATACTCTAGTTA 64 304
124566 124581
716490 3640 3655 124665 124680 ACAACCAACTATTACT 63 305
716493 3692 3707 124717 124732 ACATTGAAAGACCCTT 30 306
716496 3745 3760 124770 124785 GAAGAGATTTTATGCC 19 307
716499 3852 3867 124877 124892 TTTTGCCCTCCTCCAA 102 308
716502 3913 3928 124938 124953 CACAGTGATTGCATTT 11 309
716505 3996 4011 125021 125036 GATTTAATCTTTCTGC 35 310
716508 4065 4080 125090 125105 CTAGGTAGAATTTCAT 67 311
716511 4131 4146 125156 125171 GATCTTCTGCACATTA 51 312
716514 4201 4216 125226 125241 GCTGATATATAAGATA 68 313
716517 4255 4270 125280 125295 TTCACAACCCCCCCCC 53 314
716520 4312 4327 125337 125352 AGTCTTTATTAAAGAG 96 315
716523 4426 4441 125451 125466 CAAATTAAAGTTGAGG 37 316
716526 4481 4496 125506 125521 TCAAAGCACTGTGCCA 88 317
716529 4544 4559 125569 125584 CAAACTCAAAAAGGGA 61 318
716532 4615 4630 125640 125655 CAAGAAGCAGTTAAGC 70 319
716535 4737 4752 125762 125777 CCTGACTGAAAATAAC 86 320
716538 4789 4804 125814 125829 TCTGAAACTCCAAATC 77 321
716541 4840 4855 125865 125880 TAAAGGCACTACATTT 92 322
716544 4898 4913 125923 125938 TACTTAACACAGCAAC 71 323
716547 4986 5001 44309 44324 GGTATGAATTCTGAAT 44 324
126011 126026
716550 5037 5052 126062 126077 GCACTGAATATTGCCA 77 325
716553 5088 5103 126113 126128 ATCCACCTGAGCACTC 54 326
716556 5211 5226 126236 126251 GCATTAAAGAATTCTC 39 327
716559 5294 5309 126319 126334 CCTAACATATGAGCAT 62 328
716565 N/A N/A 5516 5531 GGGCTAACTACATTGC 129 329
716568 N/A N/A 5640 5655 GATTTTTTCTGAGTTC 72 330
716574 N/A N/A 11831 11846 TACACTGTATATGTTC 91 331
11769 11784
716577 N/A N/A 58766 58781 TCTGTCAGTTATCCTA 21 332
58782 58797

TABLE 5
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1 and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2 YAP1
Compound Start Stop Start Stop (% SEQ
Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO
716347 64 79 3524 3539 TGCCTTTCCCCGCCTC 85 333
716350 129 144 3589 3604 CTCGGACCTGCGGCGC 99 334
716353 216 231 3676 3691 GCATCCCCCGCCCCGG 98 335
716356 296 311 3756 3771 CGAGGTGGAGAAGCGG 112 336
716359 348 363 3808 3823 CCCCTGACCCAGGCGA 101 337
716362 433 448 3893 3908 AGGCGGCTGCCCTTGG 94 338
716365 533 548 3993 4008 TCTGATGCCCGGCGGG 83 339
716368 652 667 4112 4127 GTCGGGCAGCTTCCGG 86 340
716371 733 748 7167 7182 TGGAGTCAGGGCTCCT 115 341
716374 802 817 7236 7251 GGTCAGTGTCCCAGGA 54 342
716377 876 891 7310 7325 GGTATCTCAAAAGAAG 76 343
716380 944 959 7378 7393 TTAAGAAGTATCTCTG 54 344
716383 1049 1064 55544 55559 TCATCATATTCTGCTG 98 345
716386 1110 1125 79051 79066 ATTTCTCCATCCTGAG 60 346
716389 1161 1176 79102 79117 AGCCTTGGGTCTAGCC 93 347
716392 1266 1281 98968 98983 CTGCCACCCATGACGC 95 348
716395 1331 1346 99033 99048 GCCGCAGCCTCTCCTT 92 349
716398 1382 1397 N/A N/A TATTCCGCATTGCCTG 70 350
716401 1440 1455 116629 116644 AACTGGCTACGCAGGG 92 351
716404 1519 1534 116708 116723 CGTCATTGTTCTCAAT 63 352
716407 1593 1608 120498 120513 CTTAGTCCACTGTCTG 35 353
716410 1668 1683 N/A N/A GTATCACCTGTATCCA 52 354
716413 1753 1768 122778 122793 TCCAAGGTCCACATTT 79 355
716416 1834 1849 122859 122874 AAGGATGTCAGAACTC 45 356
716419 1962 1977 122987 123002 TTTCCGGTGCATGTGT 36 357
716422 2030 2045 123055 123070 AGTATCTTGCTGGACG 39 358
716425 2081 2096 123106 123121 GCAATACATTAACAGC 71 359
716428* 2187 2202 123212 123227 ACAGGCTCACTTCCCC 10 360
716431* 2238 2253 123263 123278 AATGATTGGTGAACAT 55 361
716434* 2289 2304 123314 123329 TAAATGCTGTGACATG 44 362
716437 2349 2364 123374 123389 CCAGTAAATCATGTTT 41 363
716440 2406 2421 123431 123446 CTCTTCAAATCAGCAT 45 364
716443 2483 2498 123508 123523 TTATGTGACTAATGAT 73 365
716446 2597 2612 123622 123637 GCACACCCACAAAATT 83 366
716449 2700 2715 123725 123740 GGTCATTTGCCTAGGT 49 367
716452 2759 2774 123784 123799 TTACCAAAACAACTAC 98 368
716455 2849 2864 123874 123889 GTTATGTTTGGGTGTG 17 369
716458 2900 2915 123925 123940 AAGCAGGGAAACCTAA 94 370
716461 2963 2978 123988 124003 ATAAACTACTAGTCAT 123 371
716464 3015 3030 124040 124055 TACTTCAAACATCTGC 62 372
716467 3088 3103 124113 124128 CCGTATGCCCAGAGGG 99 373
716470 3170 3185 124195 124210 AATCGAGACTTAAAAA 104 374
716473 3221 3236 124246 124261 CTATAAAGCTTATTTC 104 375
716476 3292 3307 124317 124332 GAACTACAAACTAGAA 91 376
716479 3348 3363 124373 124388 GAACAATCTTGAAGGC 32 377
716482 3399 3414 124424 124439 CTATCCAGGGTCAATT 83 378
716485 3461 3476 124486 124501 ACTACCAATATACATT 84 379
716488 3558 3573 38751 38766 CATTATTACTCCTGTA 67 380
124583 124598
716491 3658 3673 124683 124698 CTGGTGCCACTTTAAT 54 381
716494 3709 3724 124734 124749 AAGGGCTTATTCTAGA 112 382
716497 3762 3777 124787 124802 AGCAGCTTTTGCCAGG 65 383
716500 3869 3884 124894 124909 AACTTCTTACTTCCAA 18 384
716503 3951 3966 124976 124991 TTATTATGAGTGATCA 33 385
716506 4031 4046 125056 125071 TCTGCAGTGGCCATTT 62 386
716509 4083 4098 125108 125123 TATACCCAATTTTGCA 70 387
716512 4150 4165 125175 125190 ACTCCTTCCAAGTAGC 99 388
716515 4218 4233 125243 125258 TAAGCTAAAGCTAATC 123 389
716518 4272 4287 125297 125312 CAAGGTCCCCCTAAAT 88 390
716521 4329 4344 125354 125369 CAGCACGGTGTAAGAC 79 391
716524 4443 4458 125468 125483 ACTGAGGTATAACTGG 35 392
716527 4502 4517 125527 125542 AGTACAGAGGGCATCG 64 393
716530 4561 4576 125586 125601 ACATCAAGGCTATGAT 83 394
716533 4666 4681 125691 125706 CAATTCAAGAATACCC 64 395
716536 4754 4769 125779 125794 AAGTAGATCTAAGAAG 94 396
716539 4806 4821 125831 125846 AATAGTGCTTTGGAAG 59 397
716542 4863 4878 125888 125903 CTTCCCTGTGTTCATT 45 398
716545 4916 4931 125941 125956 GCATGTATTTAATATG 91 399
716548 5003 5018 126028 126043 GAGTTTCAACACTGAT 31 400
716551 5054 5069 126079 126094 CGCTAGAAAAGTGTTA 76 401
716554 5105 5120 126130 126145 ATGCTTGCGAGGATAA 30 402
716557 5243 5258 126268 126283 ATTGGTACTATATATA 80 403
716560 5312 5327 126337 126352 TAACAATTTATGTAAG 107 404
716563 N/A N/A 5445 5460 TGAAGCAAGTTCTCAA 126 405
716566 N/A N/A 5552 5567 GGTAACTCTTCTTTCC 102 406
716569 N/A N/A 5674 5689 CTCCTTAACCCGGGTT 115 407
716572 N/A N/A 126465 126480 CAGTAAGAAGCCAAAA 122 408
716575 N/A N/A 30867 30882 AAAGAACTTAGTTCCC 84 409
31189 31204
716578 N/A N/A 70445 70460 AACTTTCACATAAACT 102 410
70695 70710

TABLE 6
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
716348 84 99 3544 3559 ACGGAGGCCGGACAGC 107 411
716351 166 181 3626 3641 GGTCTGGCGGCTGCGC 112 412
716354 251 266 3711 3726 TCGCTCTCAGGGCCGG 114 413
716357 314 329 3774 3789 CGCCCCGGCTCCACGG 127 414
716360 388 403 3848 3863 CTGCCCGGGATCCATG 118 415
716363 467 482 3927 3942 CGGACGGCGGGCCCTG 103 416
716366 568 583 4028 4043 CAGGTCGGTCTCCGAG 95 417
716369 670 685 4130 4145 CGGCGGCTTGAAGAAG 94 418
716372 751 766 7185 7200 ATGAGCTCGAACATGC 61 419
716375 819 834 7253 7268 GAGACTACTCCAGTGG 63 420
716378 893 908 7327 7342 GCAGAGGTACATCATC 44 421
716381 961 976 55456 55471 TGTCTGATCGATGTGA 35 422
716384 1066 1081 N/A N/A AGGACCTGAAGCCGAG 71 423
716387 1127 1142 79068 79083 TATGGTTTATATAGTA 33 424
716390 1189 1204 N/A N/A TCTCTGGTTCATGGCA 66 425
716393 1285 1300 98987 99002 TTGCTGCTGGTTGGAG 46 426
716396 1348 1363 99050 99065 CAGTTCTTGCTGTTTC 123 427
716399 1403 1418 102535 102550 AATTTGCTGTGCTGGG 40 428
716402 1474 1489 116663 116678 ATTTTGAGTCCCACCA 85 429
716405 1547 1562 116736 116751 TGTTAAGGAAAGGATC 149 430
716408 1610 1625 120515 120530 CACTGTAGCTGCTCAT 54 431
716411 1700 1715 122725 122740 TCTGCTGTGAGGGCAG 102 432
716414 1777 1792 122802 122817 GTTCATTCCATCTCCT 59 433
716417 1891 1906 122916 122931 TGTAAGAAAGCTTTCT 78 434
716420 1979 1994 24076 24091 CAACTGGCTTATGGAA 50 435
123004 123019
716423 2047 2062 71297 71312 GCAAAATAGAGGATTA 43 436
123072 123087
716426 2115 2130 123140 123155 TTTGATTCTTTAGAGC 45 437
716429* 2204 2219 123229 123244 TGGCATCCATCATCCA 28 438
716432* 2255 2270 123280 123295 TCTGAGTATTTAGTTA 30 439
716435* 2306 2321 123331 123346 ACAACTGTTGAACAAA 45 440
716438 2366 2381 123391 123406 ATTTTTGGCTTGTCAG 32 441
716441 2423 2438 123448 123463 GCCTTGGTTTCAGCTA 57 442
716444 2528 2543 123553 123568 AAATTGTCTCATGCCT 40 443
716447 2666 2681 123691 123706 CCAACCAACCCCCCCA 97 444
716450 2717 2732 123742 123757 AACAGATTCACTAATA 83 445
716453 2786 2801 123811 123826 GGTAAAAAAAACCAGG 87 446
716456 2866 2881 123891 123906 ACCACACTATTATAAA 96 447
716459 2926 2941 123951 123966 CGCTACCATTTTAAAA 121 448
716462 2981 2996 124006 124021 TTAAACTACCAGTGAA 86 449
716465 3036 3051 124061 124076 GCTCTTTCTAGAACAC 82 450
716468 3105 3120 124130 124145 TCATCAGATAATATCT 118 451
716471 3187 3202 124212 124227 CCTACTCACTGAATTC 48 452
716474 3238 3253 124263 124278 TAAATGAAGGTAAACC 120 453
716477 3309 3324 124334 124349 GTGTTCATTACAAATG 42 454
716480 3365 3380 124390 124405 GCAAGTCTTGTAAGTA 18 455
716483 3416 3431 15582 15597 CAAAACCTTATAGTAT 159 456
82739 82754
124441 124456
716486 3494 3509 124519 124534 ATCATGATTATCTCTA 68 457
716489 3606 3621 124631 124646 AGTTAATTCATGCTCG 23 458
716492 3675 3690 124700 124715 AAACACAGAGGTGCTA 72 459
716495 3728 3743 124753 124768 GTTATGAACCCTTGAA 58 460
716498 3833 3848 124858 124873 GAAGGGCCAAAATACT 92 461
716501 3891 3906 124916 124931 GCACTGAAAGTACTTA 32 462
716504 3970 3985 6107 6122 ATAAAAGCCTTAGAGT 112 463
62583 62598
124995 125010
716507 4048 4063 125073 125088 ACTACTCTAAAACTCC 53 464
716510 4102 4117 125127 125142 CAACATGCTATGTAAT 122 465
716513 4184 4199 125209 125224 AATCTTAATCTGTGGC 30 466
716516 4237 4252 125262 125277 AACTTTCCCACCCTCC 84 467
716519 4290 4305 125315 125330 GTTTATAAAGTTCTCT 57 468
716522 4363 4378 125388 125403 GTGACTGAAACTCTAG 47 469
716525 4460 4475 125485 125500 CACAGTACTGCTACAA 64 470
716528 4520 4535 125545 125560 TTAGGTCTCCTTCAGG 70 471
716531 4580 4595 125605 125620 GGACATAAAACAAGAG 65 472
716534 4693 4708 125718 125733 GATTATAAAATTGGTT 90 473
716537 4772 4787 125797 125812 ATGTGCTCCATCAACC 36 474
716540 4823 4838 125848 125863 GAAAAGTTATTACAAC 120 475
716543 4880 4895 125905 125920 TATTTGTAGCAAAGTC 35 476
716546 4968 4983 125993 126008 CACAATTAATTACTGT 103 477
716549 5020 5035 126045 126060 CCACTTTTGCAATGTT 44 478
716552 5071 5086 126096 126111 TTTCTCAGATGTACCA 53 479
716555 5167 5182 126192 126207 TACTTTTTCAAGATAC 99 480
716558 5277 5292 126302 126317 CTCTTACATCTAAAAC 81 481
716561 5338 5353 126363 126378 AAGGTATTACATAAGA 58 482
716564 N/A N/A 5479 5494 CTTTTGGGCAAAGTTC 103 483
716567 N/A N/A 5599 5614 GACTATACAACAGGCC 134 484
716570 N/A N/A 5717 5732 AAGTGTTTAGGCAAGC 56 485
716573 N/A N/A 126516 126531 AGTTACTACTGTAATC 116 486
716576 N/A N/A 58764 58779 TGTCAGTTATCCTATC 52 487
58780 58795
716579 N/A N/A 94212 94227 ATAGAGATTTTCCCTC 84 488
103505 103520

TABLE 7
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 3, and 4
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 3 NO: 3 NO: 4 NO: 4
Compound Start Stop Start Stop YAP1 SEQ ID
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) NO
716562 N/A N/A 1359 1374 GCCTGCCGAAGCAGTT 103 489
716571 1062 1077 N/A N/A GCTGAAGCCGAGTTCA 91 490

Example 3: Antisense Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers

Modified oligonucleotides were designed to target a Yap1 nucleic acid and were tested for their effect on Yap1 mRNA level in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured A-431 cells at a density of 5,000 cells per well were treated using free uptake with 2,000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and Yap1 mRNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS36584 (forward sequence ACGACCAATAGCTCAGATCCT, designated herein as SEQ ID NO.: 14; reverse sequence CACCTGTATCCATCTCATCCAC, designated herein as SEQ ID NO.: 15; probe sequence TGTAGCTGCTCATGCTTAGTCCACTG, designated herein as SEQ ID NO.: 16) was used to measure mRNA levels. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREENÂŽ. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). The modified oligonucleotides with percent control values marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides targeting the amplicon region.

The newly designed modified oligonucleotides in the Tables below were designed as 3-10-3 cEt gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on the 5′ direction and the 3′ direction comprising three nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a cEt sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P═S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.

“Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either SEQ ID NO.: 1 or SEQ ID NO.: 2. ‘N/A’ indicates that the modified oligonucleotide does not target that particular gene sequence with 100% complementarity. ‘N.D.’ indicates that the % UTC is not defined for that particular modified oligonucleotide in that particular experiment. Activity of the modified oligonucleotide may be defined in a different experiment.

TABLE 8
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
715483 3570 3585 124595 124610 CTCTTTGGAAACCATT  2 206
715491 3638 3653 124663 124678 AACCAACTATTACTTC  8 131
958348 556 571 4016 4031 CGAGTCCCCGCGGACG 122  491
958349 557 572 4017 4032 CCGAGTCCCCGCGGAC 81 492
958350 558 573 4018 4033 TCCGAGTCCCCGCGGA 106  493
958351 560 575 4020 4035 TCTCCGAGTCCCCGCG 67 494
958352 563 578 4023 4038 CGGTCTCCGAGTCCCC 110  495
958353 564 579 4024 4039 TCGGTCTCCGAGTCCC 43 496
958354 565 580 4025 4040 GTCGGTCTCCGAGTCC 31 497
958355 611 626 4071 4086 CGTTGGCCGTCTTGGG 51 498
958356 663 678 4123 4138 TTGAAGAAGGAGTCGG  9 499
958357 667 682 4127 4142 CGGCTTGAAGAAGGAG 12 500
958358 669 684 4129 4144 GGCGGCTTGAAGAAGG 34 501
958359 709 724 7143 7158 TGCATCAGTACTGGCC 117  502
958360 745 760 7179 7194 TCGAACATGCTGTGGA 12 503
958361 747 762 7181 7196 GCTCGAACATGCTGTG  8 504
958362 748 763 7182 7197 AGCTCGAACATGCTGT 58 505
958363 750 765 7184 7199 TGAGCTCGAACATGCT 70 506
958364 969 984 55464 55479 CATGTTGTTGTCTGAT 19 507
958365 971 986 55466 55481 GCCATGTTGTTGTCTG 34 508
958366 1607 1622 120512 120527 TGTAGCTGCTCATGCT  16* 509
958367 1871 1886 122896 122911 CTAGCTTGGTGGCAGC 105  510
958368 1873 1888 122898 122913 ATCTAGCTTGGTGGCA 11 511
958369 1875 1890 122900 122915 TTATCTAGCTTGGTGG  4 512
958370 1877 1892 122902 122917 CTTTATCTAGCTTGGT  7 513
958371 3637 3652 124662 124677 ACCAACTATTACTTCA  2 514
958372 3666 3681 124691 124706 GGTGCTAGCTGGTGCC 49 515
958373 3667 3682 124692 124707 AGGTGCTAGCTGGTGC  8 516
958374 3670 3685 124695 124710 CAGAGGTGCTAGCTGG 38 517
958375 3967 3982 11044 11059 AAAGCCTTAGAGTCAA  2 518
124992 125007
958376 1392 1407 102524 102539 CTGGGATTGATATTCC 31 519
958377 1393 1408 102525 102540 GCTGGGATTGATATTC  9 520
958378 N/A N/A 7141 7156 CATCAGTACTGGCCTA 25 521
958379 N/A N/A 3336 3351 GCGCCCGCCCGCACCG 124  522
958380 N/A N/A 3337 3352 CGCGCCCGCCCGCACC 106  523
958381 N/A N/A 3344 3359 TCCTCTGCGCGCCCGC 146  524
958382 N/A N/A 3345 3360 TTCCTCTGCGCGCCCG 111  525
958383 N/A N/A 3346 3361 CTTCCTCTGCGCGCCC 96 526
958384 N/A N/A 3347 3362 CCTTCCTCTGCGCGCC 131  527
958385 N/A N/A 4548 4563 GCGCGCGCATTGTGCA 115  528
958386 N/A N/A 4549 4564 GGCGCGCGCATTGTGC 111  529
958387 N/A N/A 4551 4566 GAGGCGCGCGCATTGT 131  530
958388 N/A N/A 4552 4567 GGAGGCGCGCGCATTG 112  531
958389 N/A N/A 4553 4568 CGGAGGCGCGCGCATT 126  532
958390 N/A N/A 4571 4586 GCGAAGGTGCGGAGCG 145  533
958391 N/A N/A 4572 4587 AGCGAAGGTGCGGAGC 102  534
958392 N/A N/A 5148 5163 CTATGAGTCAACCTGC 50 535
958393 N/A N/A 5150 5165 GCCTATGAGTCAACCT 89 536
958394 N/A N/A 8647 8662 TTGAAACCTGATCCTT 54 537
958395 N/A N/A 8821 8836 CTAACAACCTGGTTTG 114  538
958396 N/A N/A 8909 8924 AGGCTATTAAGCTGTT 131  539
958397 N/A N/A 8910 8925 CAGGCTATTAAGCTGT 127  540
958398 N/A N/A 8911 8926 GCAGGCTATTAAGCTG 76 541
958399 N/A N/A 10927 10942 GACCAACTACTTGAAG 45 542
958400 N/A N/A 10929 10944 TTGACCAACTACTTGA 26 543
958401 N/A N/A 10964 10979 AGTTATTCAGCAGCTT 19 544
958402 N/A N/A 29057 29072 CTCTTACACAGCCTAG 28 545
958403 N/A N/A 36596 36611 CAGTTTATGTAGTAGT  5 546
958404 N/A N/A 37602 37617 GCACACAACTCAGACA 52 547
958405 N/A N/A 44925 44940 TTATGGGATGAGTGCT 24 548
958406 N/A N/A 55773 55788 TTTCAGTTATCGGCCC 29 549
958407 N/A N/A 63319 63334 AATACTGATCTGCAGC 35 550
958408 N/A N/A 64348 64363 CTATATATGGTAGTCT 20 551
958409 N/A N/A 79120 79135 TTACCAAAACGAGGGT 99 552
958410 N/A N/A 79121 79136 TTTACCAAAACGAGGG 70 553
958411 N/A N/A 79122 79137 CTTTACCAAAACGAGG 90 554
958412 N/A N/A 79124 79139 ACCTTTACCAAAACGA 49 555
958413 N/A N/A 90343 90358 CTAGTAATCTTACTGG 80 556
958414 N/A N/A 102402 102417 CAGAATTCCCAAGCTA 73 557
958415 N/A N/A 102449 102464 CTGTGTAGGCTGACTT 16 558
958416 N/A N/A 102450 102465 GCTGTGTAGGCTGACT 36 559
958417 N/A N/A 102483 102498 ACGGATAAAAATTACT 85 560
958418 N/A N/A 102558 102573 AGAGCCTACCTGACAT 47 561
958419 N/A N/A 102560 102575 TAAGAGCCTACCTGAC 68 562
958420 N/A N/A 109095 109110 TTCATAATCTGACTAG 66 563
958421 N/A N/A 112417 112432 CTCCGTGGTGATCCCA 13 564
958422 N/A N/A 115003 115018 TTTCTTAACCAGCGGA 15 565
958423 N/A N/A 121122 121137 GATCAACATGCTAACA 51 566

TABLE 9
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
715483 3570 3585 124595 124610 CTCTTTGGAAACCATT 1 206
958436 91 106 3551 3566 TCCCTTGACGGAGGCC 124 567
958441 281 296 3741 3756 GCGACGGCTGCGGGCC 72 568
958446 346 361 3806 3821 CCTGACCCAGGCGAGC 70 569
958451 538 553 3998 4013 CACGATCTGATGCCCG 10 570
958456 824 839 7258 7273 GGCCAGAGACTACTCC 90 571
958461 1355 1370 99057 99072 GCCGAAGCAGTTCTTG 79 572
958466 1840 1855 122865 122880 GTCATTAAGGATGTCA 9 573
958471 1943 1958 122968 122983 CTTAGATCCTTCACAG 14 574
958476 1961 1976 122986 123001 TTCCGGTGCATGTGTC 2 575
958481 1980 1995 123005 123020 GCAACTGGCTTATGGA 6 576
958486 2106 2121 123131 123146 TTAGAGCCAACTGTGA 9 577
958491 2291 2306 123316 123331 ACTAAATGCTGTGACA 4 578
958496 2515 2530 123540 123555 CCTTATAAGCTCCTAA 3 579
958501 2693 2708 123718 123733 TGCCTAGGTTCCGACA 41 580
958506 2812 2827 123837 123852 GCAGATAATCGAGATT 6 581
958511 2870 2885 123895 123910 CACTACCACACTATTA 31 582
958516 3003 3018 124028 124043 CTGCAGACTGCCCCAA 38 583
958521 3112 3127 124137 124152 TTCCAATTCATCAGAT 14 584
958526 3353 3368 124378 124393 AGTAAGAACAATCTTG 6 585
958531 3371 3386 124396 124411 GTAGGAGCAAGTCTTG 5 586
958536 3393 3408 124418 124433 AGGGTCAATTTTCAGC 3 587
958541 3404 3419 124429 124444 GTATTCTATCCAGGGT 4 588
958546 3538 3553 124563 124578 CATACTCTAGTTACAT 6 589
958551 3550 3565 124575 124590 CTCCTGTAGACACATA 5 590
958556 3639 3654 124664 124679 CAACCAACTATTACTT 10 591
958561 3673 3688 124698 124713 ACACAGAGGTGCTAGC 48 592
958566 3935 3950 124960 124975 ACCTATGAACTATTAT 18 593
958571 4105 4120 125130 125145 CAACAACATGCTATGT 43 594
958576 4173 4188 125198 125213 GTGGCTACTGGCAAAT 53 595
958581 4203 4218 125228 125243 CTGCTGATATATAAGA 26 596
958586 4331 4346 125356 125371 GGCAGCACGGTGTAAG 78 597
958591 4461 4476 125486 125501 TCACAGTACTGCTACA 38 598
958596 4610 4625 125635 125650 AGCAGTTAAGCACTTT 3 599
958601 4844 4859 125869 125884 CCTTTAAAGGCACTAC 17 600
958606 5087 5102 126112 126127 TCCACCTGAGCACTCA 31 601
958611 5284 5299 126309 126324 GAGCATGCTCTTACAT 92 602
958616 1141 1156 79082 79097 GGTGGTCTTGTTCTTA 10 603
958621 1172 1187 79113 79128 AACGAGGGTCAAGCCT 29 604
958626 N/A N/A 5475 5490 TGGGCAAAGTTCCTAT 158 605
958631 N/A N/A 5583 5598 TGCAAATAGGAGAGGG 122 606
958636 N/A N/A 3328 3343 CCGCACCGCGGCCCGG 126 607
958641 N/A N/A 7512 7527 AGCTACAGAGCTTAAC 102 608
958646 N/A N/A 10769 10784 TATTATATGGCTAAGC 26 609
958651 N/A N/A 12678 12693 AACTAAAGAGGACTTA 62 610
958656 N/A N/A 17870 17885 ACGCAATCTGTGATCC 48 611
958661 N/A N/A 21191 21206 TGCCGTTGGCCCCTCC 120 612
958666 N/A N/A 24643 24658 GAAAAGGGCAATCATA 52 613
958671 N/A N/A 30409 30424 CATTATATGGCACCCA 19 614
958676 N/A N/A 31186 31201 GAACTTAGTTCCCTAT 34 615
958681 N/A N/A 34104 34119 AATTAACACCTGAGCT 84 616
958686 N/A N/A 36190 36205 CGCAATATAGTCTATA 4 617
958691 N/A N/A 38179 38194 TCAGTTGGCAACAGTC 20 618
958696 N/A N/A 40280 40295 GCATACTACACTATAA 56 619
958701 N/A N/A 41534 41549 TTAAACTAGGCACATT 98 620
958706 N/A N/A 45392 45407 TCGCATGGCCACTGCC 112 621
958711 N/A N/A 48862 48877 CCAAATAAGGATCTGT 34 622
958716 N/A N/A 54493 54508 ATGGACTGTATGCAGC 84 623
958721 N/A N/A 56973 56988 GTAGTATAATGAGTTA 1 624
105504 105519
958726 N/A N/A 58765 58780 CTGTCAGTTATCCTAT 3 625
58781 58796
958731 N/A N/A 58768 58783 GCTCTGTCAGTTATCC 7 626
58784 58799
59523 59538
958736 N/A N/A 62193 62208 GTGATATGGATTCTGT 3 627
958741 N/A N/A 66072 66087 GTTACTGCAACTGCCC 14 628
958746 N/A N/A 70253 70268 GTTATCCTCTATAGTC 22 629
958751 N/A N/A 75535 75550 TCAATGCAGGATTCCA 30 630
958756 N/A N/A 79463 79478 GTGTTGCATGACAGCC 15 631
958761 N/A N/A 82824 82839 AGTCTCAACAACCTTC 7 632
958766 N/A N/A 86559 86574 TAACATATGTCTACTC 23 633
958771 N/A N/A 92071 92086 CTACAGACGAATTCCA 18 634
958776 N/A N/A 94770 94785 GGTACTCTCCTTCAGA 94 635
958781 N/A N/A 97391 97406 GTCATCTATGTGTCCT 6 636
958786 N/A N/A 99922 99937 TATGTCCTACTTTCCC 10 637
958791 N/A N/A 102044 102059 CATAAGAAAAGACGAC 123 638
958796 N/A N/A 103309 103324 ATTATATGGTTGCTTC 3 639
958801 N/A N/A 108999 109014 CGCTAGCACGCGCGCT 131 640
958806 N/A N/A 112159 112174 TGCCTAGGGTTCTGTG 30 641
958811 N/A N/A 115185 115200 CACTGAGGCACGGCCC 92 642
958816 N/A N/A 120622 120637 GTGATAACATATCCCA 71 643

TABLE 10
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
715483 3570 3585 124595 124610 CTCTTTGGAAACCATT 2 206
958437 134 149 3594 3609 AGGCACTCGGACCTGC 84 644
958442 290 305 3750 3765 GGAGAAGCGGCGACGG 21 645
958447 404 419 3864 3879 GTTGAGGCGGCGGCTG 48 646
958452 571 586 4031 4046 CTCCAGGTCGGTCTCC 26 647
958457 857 872 7291 7306 GTCGAAGATGCTGAGC 5 648
958462 1439 1454 116628 116643 ACTGGCTACGCAGGGC 46 649
958467 1864 1879 122889 122904 GGTGGCAGCCAAAACA 32 650
958472 1945 1960 122970 122985 TCCTTAGATCCTTCAC 5 651
958477 1963 1978 122988 123003 ATTTCCGGTGCATGTG 2 652
958482 2000 2015 123025 123040 TCTGTATTAGCCTGAA 10 653
958487 2192 2207 123217 123232 TCCAAACAGGCTCACT 10 654
958492 2356 2371 123381 123396 TGTCAGACCAGTAAAT 12 655
958497 2534 2549 123559 123574 ATATGGAAATTGTCTC 1 656
958502 2722 2737 123747 123762 CTATTAACAGATTCAC 13 657
958507 2814 2829 123839 123854 GAGCAGATAATCGAGA 6 658
958512 2875 2890 123900 123915 CATTCCACTACCACAC 14 659
958517 3030 3045 124055 124070 TCTAGAACACTAAACT 88 660
958522 3156 3171 124181 124196 AATTAGTCCAAGGGAG 32 661
958527 3356 3371 124381 124396 GTAAGTAAGAACAATC 4 662
958532 3374 3389 124399 124414 GAAGTAGGAGCAAGTC 2 663
958537 3394 3409 124419 124434 CAGGGTCAATTTTCAG 3 664
79237 79252
958542 3408 3423 124433 124448 TATAGTATTCTATCCA 4 665
96503 96518
102951 102966
958547 3540 3555 124565 124580 CACATACTCTAGTTAC 4 666
56579 56594
958552 3555 3570 124580 124595 TATTACTCCTGTAGAC 16 667
958557 3641 3656 124666 124681 CACAACCAACTATTAC 10 668
958562 3691 3706 124716 124731 CATTGAAAGACCCTTA 6 669
958567 3938 3953 124963 124978 TCAACCTATGAACTAT 3 670
958572 4159 4174 125184 125199 ATTATAGGCACTCCTT 5 671
958577 4176 4191 125201 125216 TCTGTGGCTACTGGCA 4 672
958582 4206 4221 125231 125246 AATCTGCTGATATATA 21 673
958587 4364 4379 125389 125404 GGTGACTGAAACTCTA 2 674
958592 4488 4503 125513 125528 CGTAAGATCAAAGCAC 12 675
958597 4626 4641 125651 125666 CCCAATACAACCAAGA 6 676
958602 4936 4951 125961 125976 TGCCATGTTCCATATA 16 677
958607 5109 5124 126134 126149 CAACATGCTTGCGAGG 11 678
958612 5295 5310 126320 126335 ACCTAACATATGAGCA 18 679
958617 1143 1158 79084 79099 GAGGTGGTCTTGTTCT 40 680
958622 1384 1399 102516 102531 GATATTCCGCATTGCC 3 681
958627 N/A N/A 5476 5491 TTGGGCAAAGTTCCTA 61 682
958632 N/A N/A 5610 5625 CTCCGACAGGAGACTA 55 683
958637 N/A N/A 4394 4409 CCGCAGAGAGAAACTC 101 684
958642 N/A N/A 8249 8264 GACATCAATTTCAGTC 91 685
958647 N/A N/A 10939 10954 TAGGAAGTTGTTGACC 11 686
958652 N/A N/A 14156 14171 GCTACGACGGCTGGCC 136 687
958657 N/A N/A 18786 18801 CAGTATAATATCCTAA 37 688
958662 N/A N/A 21800 21815 GAACAGATAGGACTAC 51 689
958667 N/A N/A 25870 25885 TGCCGGGCCCCTATGC 80 690
958672 N/A N/A 30864 30879 GAACTTAGTTCCCTTC 67 691
958677 N/A N/A 31187 31202 AGAACTTAGTTCCCTA 51 692
958682 N/A N/A 34164 34179 CCATGAGGGACTCCCA 123 693
958687 N/A N/A 36660 36675 ACACTATGTGTTCTGC 57 694
958692 N/A N/A 39314 39329 GGCTAGAGGCCGGGTG 105 695
958697 N/A N/A 40306 40321 CTAAAGATGACTACTG 39 696
958702 N/A N/A 41672 41687 TGATGTCTTGTCCAGA 16 697
958707 N/A N/A 46503 46518 TCAATGCTGTATCAGA 23 698
958712 N/A N/A 49103 49118 TTATATAGGTTACAGA 52 699
958717 N/A N/A 55730 55745 AATAATATAGCTTACG 11 700
958722 N/A N/A 57612 57627 CATAATAGGACACAAC 59 701
958727 N/A N/A 58767 58782 ATCTGTCAGTTATCCT 2 702
958732 N/A N/A 59675 59690 AGCACGGTGTAGCTTT 60 703
958737 N/A N/A 62586 62601 GGAATACAAGCCCGAG 8 704
958742 N/A N/A 66232 66247 AGCAATATGGTATTAG 4 705
958747 N/A N/A 72144 72159 GTAAAGAGGGTGACAT 106 706
958752 N/A N/A 75582 75597 GAATTTTTAGTCCAGT 2 707
958757 N/A N/A 79978 79993 GTGATCTGCACATTGT 5 708
958762 N/A N/A 84225 84240 GATTAGAGGACTCATT 16 709
958767 N/A N/A 86751 86766 ACGAATAAGGCATTAG 6 710
958772 N/A N/A 92334 92349 CAACAAACATAGTTAC 61 711
958777 N/A N/A 94786 94801 GTAACTGTTTCTAGGT 10 712
958782 N/A N/A 97670 97685 ATGGTCTCCCAGTCAC 20 713
958787 N/A N/A 101109 101124 TGGGCAAAGTTCCTCT 67 714
958792 N/A N/A 102355 102370 GCCAATGGAGTCACCA 46 715
958797 N/A N/A 105351 105366 ACGAGCACAGCACCCT 13 716
958802 N/A N/A 110683 110698 AGATAATCATCCTCAA 25 717
958807 N/A N/A 112517 112532 TCATTGTAGTCTGTCT 3 718
958812 N/A N/A 115821 115836 TACTATAAGACACCAA 31 719
958817 N/A N/A 121734 121749 TGCCAGGTAAGCCACA 30 720

TABLE 11
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
715483 3570 3585 124595 124610 CTCTTTGGAAACCATT 1 206
958438 181 196 3641 3656 CGCCCCGGCTCCACTG 61 721
958443 306 321 3766 3781 CTCCACGGGCCGAGGT 90 722
958448 437 452 3897 3912 GCGAAGGCGGCTGCCC 86 723
958453 635 650 4095 4110 GCCTCATGGGCACGGT 70 724
958458 1006 1021 55501 55516 GTTCATCTGGGACAGC 12 725
958463 1502 1517 116691 116706 CCTGAGACATCCCGGG 63 726
958468 1866 1881 122891 122906 TTGGTGGCAGCCAAAA 86 727
958473 1948 1963 122973 122988 GTCTCCTTAGATCCTT 5 728
958478 1967 1982 122992 123007 GGAAATTTCCGGTGCA 14 729
958483 2039 2054 123064 123079 GAGGATTAAAGTATCT 17 730
958488 2209 2224 123234 123249 AGGAATGGCATCCATC 41 731
958493 2435 2450 123460 123475 AAACAGTCTTCAGCCT 16 732
958498 2561 2576 74512 74527 GAGTATGTGGCAATAA 1 733
123586 123601
958503 2740 2755 123765 123780 AACCATCCCAAGCTAC 15 734
958508 2816 2831 123841 123856 GAGAGCAGATAATCGA 7 735
958513 2927 2942 123952 123967 GCGCTACCATTTTAAA 104 736
958518 3047 3062 124072 124087 CCACAGTAATAGCTCT 1 737
958523 3174 3189 124199 124214 TTCCAATCGAGACTTA 3 738
958528 3362 3377 124387 124402 AGTCTTGTAAGTAAGA 18 739
958533 3379 3394 124404 124419 GCATAGAAGTAGGAGC 3 740
958538 3397 3412 31598 31613 ATCCAGGGTCAATTTT 10 741
124422 124437
958543 3412 3427 124437 124452 ACCTTATAGTATTCTA 4 742
958548 3542 3557 124567 124582 GACACATACTCTAGTT 21 743
958553 3559 3574 38752 38767 CCATTATTACTCCTGT 1 744
121706 121721
124584 124599
958558 3643 3658 124668 124683 TTCACAACCAACTATT 9 745
958563 3759 3774 124784 124799 AGCTTTTGCCAGGAGA 3 746
958568 3947 3962 124972 124987 TATGAGTGATCAACCT 5 747
958573 4164 4179 125189 125204 GGCAAATTATAGGCAC 2 748
958578 4181 4196 125206 125221 CTTAATCTGTGGCTAC 4 749
958583 4210 4225 125235 125250 AGCTAATCTGCTGATA 89 750
958588 4373 4388 125398 125413 GTGTACTTAGGTGACT 10 751
958593 4506 4521 125531 125546 GGTCAGTACAGAGGGC 7 752
958598 4636 4651 125661 125676 CCCAATGCTACCCAAT 4 753
958603 4987 5002 44310 44325 TGGTATGAATTCTGAA 3 754
75463 75478
126012 126027
958608 5136 5151 126161 126176 TGATAGGCACACCCAC 11 755
958613 1062 1077 55557 55572 CCTGAAGCCGAGTTCA 15 756
958618 1149 1164 79090 79105 AGCCAAGAGGTGGTCT 36 757
958623 1386 1401 102518 102533 TTGATATTCCGCATTG 3 758
958628 N/A N/A 5514 5529 GCTAACTACATTGCAG 81 759
958633 N/A N/A 5656 5671 TGTCATCAGGTTAAGT 76 760
958638 N/A N/A 4565 4580 GTGCGGAGCGCGCGGA 127 761
958643 N/A N/A 8457 8472 TAGCAACCCACCCTGG 59 762
958648 N/A N/A 10980 10995 GAATACTGAGTCAGGA 7 763
958653 N/A N/A 15503 15518 TTACACACAGGCTATG 17 764
958658 N/A N/A 18787 18802 ACAGTATAATATCCTA 6 765
958663 N/A N/A 22200 22215 CTATTAGGGACTGAAC 32 766
958668 N/A N/A 27649 27664 GTGATCTGTGAGAGGT 2 767
958673 N/A N/A 30865 30880 AGAACTTAGTTCCCTT 30 768
958678 N/A N/A 32244 32259 GGAGGAGTCACCATGG 74 769
958683 N/A N/A 34256 34271 TATTGTGCTGCATCTC 16 770
958688 N/A N/A 36686 36701 GGCTATGTAGCCTTCC 82 771
958693 N/A N/A 39371 39386 GTGGTGTCTCACAGGC 99 772
958698 N/A N/A 40400 40415 CTTATTAGCCCTCAAA 30 773
958703 N/A N/A 43429 43444 GATAACTAAGCACTAC 49 774
958708 N/A N/A 46790 46805 ATGTCAGATGTCAATT 19 775
958713 N/A N/A 50391 50406 TGCTAGAGGCTGTTCC 55 776
958718 N/A N/A 55941 55956 GAACACTATAGCTTGG 4 777
958723 N/A N/A 58021 58036 AACCCACTAAAACCGG 63 778
958728 N/A N/A 45026 45041 TATCTGTCAGTTATCC 10 779
58768 58783
58784 58799
958733 N/A N/A 60397 60412 TAATAGACTAGACTTA 67 780
958738 N/A N/A 63528 63543 TCTATATGTTTCCCCC 11 781
958743 N/A N/A 66740 66755 GACTATAAAGGGTTTA 30 782
958748 N/A N/A 72564 72579 ACATGTGACATTCCGG 83 783
958753 N/A N/A 76248 76263 TGTATATGCCGTTCCC 4 784
958758 N/A N/A 79985 80000 CTATTCAGTGATCTGC 2 785
958763 N/A N/A 84603 84618 CACAATACAAGATGCA 3 786
958768 N/A N/A 87653 87668 GTGCAAGCAGGTTCCC 17 787
958773 N/A N/A 93005 93020 AGCTGGTAGGGCAAGA 43 788
958778 N/A N/A 95129 95144 GCTACCTGGAGCGAAG 75 789
958783 N/A N/A 98257 98272 TGATCTGATGCTTGCT 35 790
958788 N/A N/A 101110 101125 CTGGGCAAAGTTCCTC 54 791
958793 N/A N/A 102510 102525 CCGCATTGCCTAAGAG 9 792
958798 N/A N/A 107371 107386 TGCAGTATAATATCCT 3 793
958803 N/A N/A 110998 111013 GATAATCATCCTCAGC 24 794
958808 N/A N/A 113126 113141 AGCGATTGGCCTCCCA 59 795
958813 N/A N/A 116872 116887 TTACAGAGAGATTCAT 8 796
958818 N/A N/A 121757 121772 GTTGTCAACTCTAGGG 23 797

TABLE 12
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
715483 3570 3585 124595 124610 CTCTTTGGAAACCATT  1 206
958439 182 197 3642 3657 GCGCCCCGGCTCCACT 77 798
958444 315 330 3775 3790 ACGCCCCGGCTCCACG 97 799
958449 468 483 3928 3943 CCGGACGGCGGGCCCT 84 800
958454 754 769 7188 7203 GGAATGAGCTCGAACA  3 801
958459 1061 1076 55556 55571 CTGAAGCCGAGTTCAT 28 802
958464 1600 1615 120505 120520 GCTCATGCTTAGTCCA   3* 803
958469 1904 1919 122929 122944 GGCTCTATAACCATGT 17 804
958474 1950 1965 122975 122990 GTGTCTCCTTAGATCC  3 805
958479 1969 1984 122994 123009 ATGGAAATTTCCGGTG 15 806
958484 2067 2082 123092 123107 GCAGCAATGGACAAGG  2 807
958489 2262 2277 123287 123302 TTCTAAGTCTGAGTAT 14 808
958494 2468 2483 123493 123508 TAGCACTAGGAGGAAA 28 809
958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA  1 810
958504 2805 2820 123830 123845 ATCGAGATTTAAATAA 63 811
958509 2851 2866 123876 123891 ATGTTATGTTTGGGTG  4 812
958514 2957 2972 123982 123997 TACTAGTCATGTATTC 20 813
958519 3061 3076 124086 124101 CCCCTAGGCACTATCC 20 814
958524 3199 3214 124224 124239 GCACATTATGAACCTA 13 815
958529 3364 3379 124389 124404 CAAGTCTTGTAAGTAA  3 816
958534 3383 3398 121836 121851 TTCAGCATAGAAGTAG  3 817
124408 124423
958539 3400 3415 124425 124440 TCTATCCAGGGTCAAT 11 818
958544 3471 3486 124496 124511 GCTAAATTCAACTACC  8 819
958549 3546 3561 100828 100843 TGTAGACACATACTCT  8 820
110388 110403
124571 124586
958554 3561 3576 38754 38769 AACCATTATTACTCCT  1 821
120229 120244
124586 124601
958559 3645 3660 124670 124685 AATTCACAACCAACTA 17 822
958564 3841 3856 124866 124881 TCCAAATTGAAGGGCC 62 823
958569 3965 3980 124990 125005 AGCCTTAGAGTCAATT  3 824
958574 4166 4181 125191 125206 CTGGCAAATTATAGGC 13 825
958579 4183 4198 125208 125223 ATCTTAATCTGTGGCT  4 826
958584 4221 4236 125246 125261 CCCTAAGCTAAAGCTA 74 827
958589 4409 4424 125434 125449 GTAAAGGAAGATCTCC  4 828
958594 4523 4538 125548 125563 CTCTTAGGTCTCCTTC  8 829
958599 4663 4678 125688 125703 TTCAAGAATACCCAGT  5 830
958604 5055 5070 126080 126095 ACGCTAGAAAAGTGTT 94 831
958609 5221 5236 126246 126261 TGACAAGTGTGCATTA 16 832
958614 1137 1152 79078 79093 GTCTTGTTCTTATGGT  6 833
958619 1156 1171 79097 79112 TGGGTCTAGCCAAGAG 71 834
958624 1390 1405 102522 102537 GGGATTGATATTCCGC 74 835
958629 N/A N/A 5523 5538 CCCGAGTGGGCTAACT 128  836
958634 N/A N/A 5673 5688 TCCTTAACCCGGGTTT 61 837
958639 N/A N/A 6783 6798 GTTATGGGTGCTTTTC 18 838
958644 N/A N/A 8524 8539 ATGATCAAACCTTTTC  5 839
958649 N/A N/A 12237 12252 TGCCACTGGTGAATAC 36 840
958654 N/A N/A 16919 16934 AATGGAGTGGCCGGGC 110  841
958659 N/A N/A 18852 18867 GTTGTATTACTCTCCA  2 842
958664 N/A N/A 23239 23254 ACGAACTAAGGTGTAC 40 843
958669 N/A N/A 28420 28435 GCTATCTTTGGATCCA 76 844
958674 N/A N/A 30866 30881 AAGAACTTAGTTCCCT 25 845
31188 31203
958679 N/A N/A 33917 33932 GTAACTGCCACAGTTA 77 846
958684 N/A N/A 35513 35528 GCTGAAGACGGCCCTT 70 847
958689 N/A N/A 36864 36879 CATTAAGGAGGTTATG 87 848
958694 N/A N/A 39375 39390 ATTGGTGGTGTCTCAC 41 849
958699 N/A N/A 40415 40430 GACTAGAAAGATCATC 20 850
958704 N/A N/A 43572 43587 CCCTACACTCGAGGAT 122  851
958709 N/A N/A 46944 46959 TCAATCTATGAGACCC 57 852
958714 N/A N/A 52275 52290 GAGCACTGCGCCCTGG 82 853
958719 N/A N/A 56409 56424 GTACATAATGGGCTAA 49 854
958724 N/A N/A 58762 58777 TCAGTTATCCTATCCC  2 855
958729 N/A N/A 58763 58778 GTCAGTTATCCTATCT  4 856
58779 58794
958734 N/A N/A 61207 61222 ACACATAGAGCTAAGG  7 857
958739 N/A N/A 64256 64271 AGCAATAGAGTAACCA  4 858
958744 N/A N/A 67858 67873 GCATACTGGTGCCCCA 45 859
958749 N/A N/A 74623 74638 CCACAAGGGCAGTACG 51 860
958754 N/A N/A 77489 77504 CCTTAGGAAGGCTCCC 31 861
958759 N/A N/A 81664 81679 GCCTATCGCCCCAAGC 61 862
958764 N/A N/A 85543 85558 TGGGTCTCTTGATTTC 34 863
958769 N/A N/A 89667 89682 CATTGCCACGATCTAA 36 864
958774 N/A N/A 94013 94028 TGCTAGATATCGCCAA 33 865
958779 N/A N/A 95898 95913 TCGAATATAGAGGCCT 80 866
958784 N/A N/A 99202 99217 GGCTGGATAGAATGCT 79 867
958789 N/A N/A 101277 101292 TACTATATAATACCCT 17 868
958794 N/A N/A 102512 102527 TTCCGCATTGCCTAAG 14 869
958799 N/A N/A 107814 107829 ATTACTCAATCATGGT  2 870
958804 N/A N/A 110999 111014 AGATAATCATCCTCAG 17 871
958809 N/A N/A 113144 113159 TCTTAACACCTGAGCT 66 872
958814 N/A N/A 117837 117852 GGCTATGCCTCTCTTA 214  873
958819 N/A N/A 122502 122517 TGCTTCAACATTGTTC  9 874

TABLE 13
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
715483 3570 3585 124595 124610 CTCTTTGGAAACCATT 1 206
958440 183 198 3643 3658 TGCGCCCCGGCTCCAC 54 875
958445 327 342 3787 3802 GGCTACGCCCGGACGC 63 876
958450 496 511 3956 3971 GGTCGCCGCGGGTGCC 59 877
958455 757 772 7191 7206 AGAGGAATGAGCTCGA 43 878
958460 1294 1309 98996 99011 TCGCATCTGTTGCTGC 52 879
958465 1726 1741 122751 122766 GGCTTCAAGGTAGTCT 84 880
958470 1941 1956 8781 8796 TAGATCCTTCACAGAT 18 881
45134 45149
122966 122981
958475 1959 1974 122984 122999 CCGGTGCATGTGTCTC 37 882
958480 1978 1993 24075 24090 AACTGGCTTATGGAAA 24 883
123003 123018
958485 2089 2104 56507 56522 AGAGGTCAGCAATACA 3 884
122015 122030
123114 123129
958490 2281 2296 123306 123321 GTGACATGAAGCATCT 5 885
958495 2488 2503 123513 123528 GGTCATTATGTGACTA 56 886
958500 2570 2585 123595 123610 TCTATATTAGAGTATG 5 887
958505 2809 2824 123834 123849 GATAATCGAGATTTAA 6 888
958510 2867 2882 123892 123907 TACCACACTATTATAA 43 889
958515 2993 3008 124018 124033 CCCCAACCAGATTTAA 28 890
958520 3091 3106 124116 124131 CTACCGTATGCCCAGA 27 891
958525 3235 3250 124260 124275 ATGAAGGTAAACCACT 3 892
958530 3367 3382 124392 124407 GAGCAAGTCTTGTAAG 20 893
958535 3392 3407 124417 124432 GGGTCAATTTTCAGCA 10 894
958540 3402 3417 124427 124442 ATTCTATCCAGGGTCA 8 895
958545 3535 3550 5536 5551 ACTCTAGTTACATCAT 3 896
124560 124575
958550 3548 3563 124573 124588 CCTGTAGACACATACT 4 897
958555 3619 3634 124644 124659 GCTTATATTGAAGAGT 4 898
958560 3656 3671 124681 124696 GGTGCCACTTTAATTC 22 899
958565 3895 3910 124920 124935 TTGAGCACTGAAAGTA 4 900
958570 4092 4107 125117 125132 TGTAATTCATATACCC 5 901
958575 4171 4186 125196 125211 GGCTACTGGCAAATTA 9 902
958580 4186 4201 125211 125226 ATAATCTTAATCTGTG 4 903
958585 4278 4293 125303 125318 CTCTATCAAGGTCCCC 5 904
958590 4439 4454 125464 125479 AGGTATAACTGGGCAA 2 905
958595 4563 4578 125588 125603 CCACATCAAGGCTATG 8 906
958600 4752 4767 125777 125792 GTAGATCTAAGAAGCC 8 907
958605 5068 5083 126093 126108 CTCAGATGTACCAACG 7 908
958610 5250 5265 126275 126290 AGGTAACATTGGTACT 34 909
958615 1139 1154 79080 79095 TGGTCTTGTTCTTATG 3 910
958620 1162 1177 79103 79118 AAGCCTTGGGTCTAGC 57 911
958625 1394 1409 102526 102541 TGCTGGGATTGATATT 6 912
958630 N/A N/A 5554 5569 GCGGTAACTCTTCTTT 52 913
958635 N/A N/A 5713 5728 GTTTAGGCAAGCAGCT 43 914
958640 N/A N/A 7413 7428 TAGATAACTGTCTCCC 13 915
958645 N/A N/A 9559 9574 GCCCATAGTTGACAGG 54 916
958650 N/A N/A 12498 12513 TCAATTGAGTCTGCTA 3 917
958655 N/A N/A 17868 17883 GCAATCTGTGATCCCA 12 918
958660 N/A N/A 19378 19393 CCCACTGGGTTTGTCC 106 919
958665 N/A N/A 23878 23893 CTGCATACCCTCCAGC 84 920
958670 N/A N/A 28665 28680 GGTCTTGGTGATTGGC 20 921
958675 N/A N/A 31177 31192 TCCCTATCAGCTGGGC 112 922
958680 N/A N/A 34103 34118 ATTAACACCTGAGCTG 50 923
958685 N/A N/A 35577 35592 AGCTATGGAAAGTGTC 24 924
958690 N/A N/A 37103 37118 TGGACTCTTGATCACA 26 925
958695 N/A N/A 39759 39774 TCAATTCTCCACCAGA 45 926
958700 N/A N/A 41085 41100 CTAATATAGACTACTC 55 927
958705 N/A N/A 45162 45177 GGCCATCAATAAAGAC 112 928
958710 N/A N/A 47735 47750 AGGGAACCCTTGGCTA 77 929
958715 N/A N/A 53767 53782 GTAATAGGAGGTAAGA 48 930
958720 N/A N/A 56594 56609 GTCTACTAGAGCTGCC 12 931
958725 N/A N/A 58763 58778 GTCAGTTATCCTATCC 1 932
958730 N/A N/A 58783 58798 CTCTGTCAGTTATCCT 4 933
958735 N/A N/A 61265 61280 AGCAATCTTGTGGATC 7 934
958740 N/A N/A 65047 65062 CGGCACCAAACACCCA 57 935
958745 N/A N/A 69906 69921 TCCCAGCCGCATGGCT 78 936
958750 N/A N/A 75333 75348 TGTAAGAGGAGACCAC 28 937
958755 N/A N/A 78709 78724 TAACATAAGACACGGA 12 938
958760 N/A N/A 82249 82264 AGTAATAGATCTACAA 76 939
958765 N/A N/A 86532 86547 GTACAGGAGAGATTGC 37 940
958770 N/A N/A 90915 90930 ACAGAGCGGTGCACCC 64 941
958775 N/A N/A 94061 94076 GTCTATACGGGAGATT 29 942
958780 N/A N/A 96542 96557 TCAACTACTTTTCAGC 24 943
958785 N/A N/A 99371 99386 GCAATCCACAATTCCA 2 944
958790 N/A N/A 102039 102054 GAAAAGACGACACAGT 68 945
958795 N/A N/A 102514 102529 TATTCCGCATTGCCTA 8 946
958800 N/A N/A 108359 108374 TCGATAATATATGGCA 22 947
958805 N/A N/A 111001 111016 CAAGATAATCATCCTC 6 948
958810 N/A N/A 114182 114197 TTATATACGGGAAAAT 47 949
958815 N/A N/A 120003 120018 GGGCGAGGAGACAGGT 16 950
958820 N/A N/A 126468 126483 GACCAGTAAGAAGCCA 49 951

Example 4: Antisense Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers

Modified oligonucleotides were designed to target a Yap1 nucleic acid and were tested for their effect on Yap1 mRNA level in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured A-431 cells at a density of 5,000 cells per well were treated using free uptake with 2,000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and Yap1 mRNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS4814 was used to measure mRNA levels. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREENÂŽ. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). The modified oligonucleotides with percent control values marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides targeting the amplicon region.

The newly designed modified oligonucleotides in the Tables below were designed as 3-10-3 cEt gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on the 5′ direction and the 3′ direction comprising three nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a cEt sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P═S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.

“Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either SEQ ID NO. 1, SEQ ID NO.: 2, SEQ ID NO.: 3 (GENBANK Accession No. NM_006106.4), or SEQ ID NO. 4 (GENBANK Accession No. NM_001130145.2). ‘N/A’ indicates that the modified oligonucleotide does not target that particular gene sequence with 10000 complementarity. ‘N.D.’ indicates that the % UTC is not defined for that particular modified oligonucleotide in that particular experiment. Activity of the modified oligonucleotide may be defined in a different experiment.

TABLE 14
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 2 810
1074112 97 112 3557 3572 TCCAACTCCCTTGACG 83 952
1074144 285 300 3745 3760 AGCGGCGACGGCTGCG 92 953
1074176 364 379 3824 3839 CTCCCCCGACGCGCAC 84 954
1074208 541 556 4001 4016 GTGCACGATCTGATGC 96 955
1074240 896 911 7330 7345 CTGGCAGAGGTACATC 29 956
1074272 1118 1133 79059 79074 TATAGTAAATTTCTCC 16 957
1074304 1357 1372 99059 99074 CTGCCGAAGCAGTTCT 109 958
1074336 1451 1466 116640 116655 CCAGTGTTGGTAACTG 97 959
1074368 1672 1687 N/A N/A GATAGTATCACCTGTA 8 960
1074400 1928 1943 122953 122968 GATTTAGAATTCAGTC 42 961
1074432 2243 2258 123268 123283 GTTAAAATGATTGGTG 3* 962
1074464 2564 2579 123589 123604 TTAGAGTATGTGGCAA 2 963
1074496 2743 2758 123768 123783 AATAACCATCCCAAGC 69 964
1074528 2996 3011 124021 124036 CTGCCCCAACCAGATT 25 965
1074560 3172 3187 124197 124212 CCAATCGAGACTTAAA 3 966
1074592 3368 3383 124393 124408 GGAGCAAGTCTTGTAA 23 967
1074624 3706 3721 124731 124746 GGCTTATTCTAGAAAC 65 968
1074656 4008 4023 125033 125048 GACTTAATTCAAGATT 31 969
1074688 4224 4239 125249 125264 TCCCCCTAAGCTAAAG 83 970
1074720 4403 4418 125428 125443 GAAGATCTCCATATTC 58 971
1074752 4592 4607 125617 125632 CATTAGGAACAAGGAC 10 972
1074784 4758 4773 125783 125798 CCATAAGTAGATCTAA 25 973
1074816 5032 5047 126057 126072 GAATATTGCCACCCAC 15 974
1074848 5140 5155 126165 126180 GTTATGATAGGCACAC 11 975
1074912 N/A N/A 5525 5540 ATCCCGAGTGGGCTAA 85 976
1074944 N/A N/A 5623 5638 AAAACCCTTTGGTCTC 89 977
1074976 N/A N/A 126479 126494 TTCTATTGGAAGACCA 35 978
1075008 N/A N/A 5286 5301 TAATCGAACATTGTGT 61 979
1075040 N/A N/A 7618 7633 TTATAAAGAGGCTCAG 10 980
1075072 N/A N/A 9650 9665 TCCGGGTAAATATCTC 37 981
1075104 N/A N/A 11109 11124 ATTATAAGGTCCTACA 67 982
1075136 N/A N/A 13294 13309 CTAGAATATTAAAGGG 87 983
1075168 N/A N/A 16596 16611 CATCAAAATTTCACGA 49 984
1075200 N/A N/A 21836 21851 CATATTAACTAGATGA 120 985
1075232 N/A N/A 24676 24691 ATTTATCAGCCATTGT 13 986
1075264 N/A N/A 27401 27416 GAATAATATGCAGAAC 53 987
1075296 N/A N/A 30827 30842 ATTATAAGCTGTGTTG 18 988
1075328 N/A N/A 32291 32306 CTCGCAAAGCCTCTTC 21 989
1075360 N/A N/A 34021 34036 AGGCAACAACATCTAA 50 990
1075392 N/A N/A 36045 36060 GACGGGTGAACCTGTT 95 991
1075424 N/A N/A 38749 38764 TTATTAATCCTGTCCA 18 992
1075456 N/A N/A 40812 40827 TTACGAAATGTTTAGT 61 993
1075488 N/A N/A 42808 42823 CAGAATAAGGGAGATC 56 994
1075520 N/A N/A 45363 45378 CCCCAACAACTGCTAA 77 995
1075552 N/A N/A 47526 47541 GATTATAACATGCTGT 74 996
1075584 N/A N/A 49326 49341 AATAATTGACCTAGCA 57 997
1075616 N/A N/A 51128 51143 GTAAAACCGATTTTTC 46 998
1075648 N/A N/A 52713 52728 TCAATAAAGTGGGACT 67 999
1075680 N/A N/A 55168 55183 ATTATTACCCCTTCTA 73 1000
1075712 N/A N/A 57557 57572 GACGCGAAATACTTAC 7 1001
1075744 N/A N/A 59642 59657 TTCGGGTTAGCAGACT 6 1002
1075776 N/A N/A 62195 62210 ATGTGATATGGATTCT 10 1003
1075808 N/A N/A 64255 64270 GCAATAGAGTAACCAG 3 1004
1075840 N/A N/A 67174 67189 CCTAAAATAGGAATGC 89 1005
1075872 N/A N/A 70920 70935 CAATTATGACAAACAG 21 1006
1075904 N/A N/A 73288 73303 GTATAGGATCTACTAA 51 1007
1075936 N/A N/A 76577 76592 CTTATATTCTCTCCGA 49 1008
1075968 N/A N/A 80319 80334 TATTTAAGCCAAACCG 5 1009
1076000 N/A N/A 82082 82097 CCTAATATGACTCCTT 4 1010
1076032 N/A N/A 84424 84439 TATAATTTCCCTGATC 105 1011
1076064 N/A N/A 86676 86691 TATGAACAATGTACTC 5 1012
1076096 N/A N/A 90315 90330 AATAATAAACGATTCT 71 1013
1076128 N/A N/A 92094 92109 TCTAAACCTAAAGACT 118 1014
1076160 N/A N/A 93143 93158 TTATACTAGTACGGCA 20 1015
1076192 N/A N/A 95979 95994 CTACAACCTGGACTTT 34 1016
1076224 N/A N/A 97726 97741 TATAAACCTTGCTACA 67 1017
1076256 N/A N/A 100250 100265 TTATTTAGGCCCCATA 4 1018
1076288 N/A N/A 103352 103367 CTTATTTAGCATAGTG 3 1019
1076320 N/A N/A 105383 105398 CATTAACCTCACCCAT 52 1020
1076352 N/A N/A 109308 109323 GATAACCCTGAAACAA 37 1021
1076384 N/A N/A 111269 111284 TATAAGGGACTTGCTG 25 1022
1076416 N/A N/A 113834 113849 ACCGAAATGATACTGA 8 1023
1076448 N/A N/A 117100 117115 CTTATAATGCAATCCT 2 1024
1076480 N/A N/A 119636 119651 GTAAATATCCATTACC 72 1025
1076512 N/A N/A 122045 122060 CATAAACCATTAAGTG 65 1026
1076544 N/A N/A 71389 71404 GACCAACCTCCCCTTG 89 1027

TABLE 15
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA  1  810
1074113 98 113 3558 3573 CTCCAACTCCCTTGAC 61 1028
1074145 286 301 3746 3761 AAGCGGCGACGGCTGC 73 1029
1074177 365 380 3825 3840 CCTCCCCCGACGCGCA 69 1030
1074209 640 655 4100 4115 CCGGAGCCTCATGGGC 72 1031
1074241 921 936 7355 7370 GATGTCTTTGCCATCT 72 1032
1074273 1129 1144 79070 79085 CTTATGGTTTATATAG 34 1033
1074305 1360 1375 99062 99077 CACCTGCCGAAGCAGT 64 1034
1074337 1469 1484 116658 116673 GAGTCCCACCATCCTG 10 1035
1074369 1673 1688 N/A N/A TGATAGTATCACCTGT 19 1036
1074401 1960 1975 122985 123000 TCCGGTGCATGTGTCT 18 1037
1074433 2258 2273 123283 123298 AAGTCTGAGTATTTAG   5* 1038
1074465 2572 2587 123597 123612 AATCTATATTAGAGTA 44 1039
1074497 2744 2759 123769 123784 CAATAACCATCCCAAG 26 1040
1074529 3001 3016 124026 124041 GCAGACTGCCCCAACC 50 1041
1074561 3176 3191 124201 124216 AATTCCAATCGAGACT 10 1042
1074593 3369 3384 124394 124409 AGGAGCAAGTCTTGTA  6 1043
1074625 3711 3726 124736 124751 ATAAGGGCTTATTCTA 42 1044
1074657 4016 4031 125041 125056 TCCCCCCAGACTTAAT 59 1045
1074689 4225 4240 125250 125265 CTCCCCCTAAGCTAAA 70 1046
1074721 4404 4419 125429 125444 GGAAGATCTCCATATT 43 1047
1074753 4594 4609 125619 125634 TACATTAGGAACAAGG  4 1048
1074785 4759 4774 125784 125799 ACCATAAGTAGATCTA 10 1049
1074817 5034 5049 126059 126074 CTGAATATTGCCACCC  8 1050
1074849 5141 5156 126166 126181 TGTTATGATAGGCACA 18 1051
1074913 N/A N/A 5526 5541 CATCCCGAGTGGGCTA 99 1052
1074945 N/A N/A 5624 5639 CAAAACCCTTTGGTCT 74 1053
1074977 N/A N/A 126483 126498 CTTGTTCTATTGGAAG 94 1054
1075009 N/A N/A 5287 5302 ATAATCGAACATTGTG 43 1055
1075041 N/A N/A 7620 7635 GATTATAAAGAGGCTC  5 1056
1075073 N/A N/A 9719 9734 CATAAAAGTTCCCCAG 51 1057
1075105 N/A N/A 11110 11125 AATTATAAGGTCCTAC 42 1058
1075137 N/A N/A 13320 13335 GATTAAATACTGACCA  3 1059
1075169 N/A N/A 16611 16626 AAAACGGAGTAATGCC 39 1060
1075201 N/A N/A 21864 21879 CTTTAAAGCCCTAATT 114  1061
1075233 N/A N/A 24679 24694 GTAATTTATCAGCCAT  2 1062
1075265 N/A N/A 27404 27419 TCTGAATAATATGCAG 44 1063
1075297 N/A N/A 30831 30846 GTTAATTATAAGCTGT 10 1064
1075329 N/A N/A 32457 32472 AGGGAAAACTTTGCAC 26 1065
1075361 N/A N/A 34085 34100 TCTTAAGGGAATGTAT 69 1066
1075393 N/A N/A 36169 36184 CTTAACCTATGCCAAA 37 1067
1075425 N/A N/A 38750 38765 ATTATTAATCCTGTCC 26 1068
1075457 N/A N/A 40828 40843 AGTAATATGTACATGG  5 1069
1075489 N/A N/A 42854 42869 GAGCAACAACTATGAG 51 1070
1075521 N/A N/A 45427 45442 AAATCGAGGCGAATCT 65 1071
1075553 N/A N/A 47527 47542 TGATTATAACATGCTG 77 1072
1075585 N/A N/A 49327 49342 AAATAATTGACCTAGC 52 1073
1075617 N/A N/A 51372 51387 TAAGAACGACATATGC 27 1074
1075649 N/A N/A 52715 52730 CTTCAATAAAGTGGGA 56 1075
1075681 N/A N/A 55170 55185 TAATTATTACCCCTTC 37 1076
1075713 N/A N/A 57571 57586 AATCAACCTTGTTAGA 58 1077
1075745 N/A N/A 59682 59697 CTTCAAAAGCACGGTG 58 1078
1075777 N/A N/A 62196 62211 TATGTGATATGGATTC 12 1079
1075809 N/A N/A 64257 64272 TAGCAATAGAGTAACC 13 1080
1075841 N/A N/A 67205 67220 ATTTAGGTACTCAGTA 27 1081
1075873 N/A N/A 70936 70951 CTTGAATACTACACCA 16 1082
1075905 N/A N/A 73332 73347 CCTGAACACAGGAGTA 43 1083
1075937 N/A N/A 76578 76593 ACTTATATTCTCTCCG 36 1084
1075969 N/A N/A 80320 80335 GTATTTAAGCCAAACC 11 1085
1076001 N/A N/A 82122 82137 ACTCAAGGAACCATTT 24 1086
1076033 N/A N/A 84540 84555 CATTAGTAGGTATTTC  8 1087
1076065 N/A N/A 86761 86776 CTTTAGTAACACGAAT 36 1088
1076097 N/A N/A 90316 90331 CAATAATAAACGATTC 70 1089
1076129 N/A N/A 92131 92146 CATAAACCTTAGTCCT 26 1090
1076161 N/A N/A 93145 93160 TCTTATACTAGTACGG 14 1091
1076193 N/A N/A 96059 96074 TTAATACACAGGTTCC 29 1092
1076225 N/A N/A 97727 97742 ATATAAACCTTGCTAC 66 1093
1076257 N/A N/A 100265 100280 CTAAGAAACTCATAGT 54 1094
1076289 N/A N/A 103430 103445 AACGGACAACTTAACA 21 1095
1076321 N/A N/A 105417 105432 CAATATCACTTGGGCC 63 1096
1076353 N/A N/A 109381 109396 ATTAAACATTCGGATT 30 1097
1076385 N/A N/A 111270 111285 ATATAAGGGACTTGCT 32 1098
1076417 N/A N/A 113840 113855 CTTTACACCGAAATGA 42 1099
1076449 N/A N/A 117101 117116 CCTTATAATGCAATCC  2 1100
1076481 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC  1 1101
1076513 N/A N/A 122094 122109 CATTAACACTCCTCAG 36 1102
1076545 N/A N/A 76624 76639 AACCAACCTTCCCTAC 68 1103

TABLE 16
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA  2  810
1074114 109 124 3569 3584 GAACTTTTTCCCTCCA 30 1104
1074146 287 302 3747 3762 GAAGCGGCGACGGCTG 91 1105
1074178 366 381 3826 3841 GCCTCCCCCGACGCGC 95 1106
1074210 641 656 4101 4116 TCCGGAGCCTCATGGG 113  1107
1074242 925 940 7359 7374 AGAAGATGTCTTTGCC 56 1108
1074274 1132 1147 79073 79088 GTTCTTATGGTTTATA  4 1109
1074306 1363 1378 99065 99080 CCTCACCTGCCGAAGC 107  1110
1074338 1476 1491 116665 116680 GGATTTTGAGTCCCAC 77 1111
1074370 1674 1689 N/A N/A TTGATAGTATCACCTG  8 1112
1074402 1971 1986 122996 123011 TTATGGAAATTTCCGG 25 1113
1074434 2264 2279 123289 123304 ACTTCTAAGTCTGAGT  51* 1114
1074466 2651 2666 123676 123691 ACCGACCCTGCCAAAA 32 1115
1074498 2745 2760 123770 123785 ACAATAACCATCCCAA 17 1116
1074530 3021 3036 124046 124061 CTAAACTACTTCAAAC 88 1117
1074562 3177 3192 124202 124217 GAATTCCAATCGAGAC 30 1118
1074594 3370 3385 124395 124410 TAGGAGCAAGTCTTGT  6 1119
1074626 3730 3745 124755 124770 CTGTTATGAACCCTTG  5 1120
1074658 4023 4038 125048 125063 GGCCATTTCCCCCCAG 89 1121
1074690 4226 4241 125251 125266 CCTCCCCCTAAGCTAA 81 1122
1074722 4405 4420 125430 125445 AGGAAGATCTCCATAT 57 1123
1074754 4598 4613 125623 125638 CTTTTACATTAGGAAC 11 1124
1074786 4760 4775 125785 125800 AACCATAAGTAGATCT 28 1125
1074818 5035 5050 126060 126075 ACTGAATATTGCCACC 12 1126
1074850 5142 5157 126167 126182 TTGTTATGATAGGCAC  5 1127
1074914 N/A N/A 5529 5544 TTACATCCCGAGTGGG 97 1128
1074946 N/A N/A 5625 5640 CCAAAACCCTTTGGTC 109  1129
1074978 N/A N/A 126492 126507 TTGCCAGTTCTTGTTC 38 1130
1075010 N/A N/A 5288 5303 AATAATCGAACATTGT 88 1131
1075042 N/A N/A 7676 7691 TTAAAAGGTTTGGCAC 17 1132
1075074 N/A N/A 9744 9759 TATAGTAAGACTAATC 105  1133
1075106 N/A N/A 11112 11127 CAAATTATAAGGTCCT 10 1134
1075138 N/A N/A 13444 13459 AATAATAGATACTGCC  4 1135
1075170 N/A N/A 17299 17314 ACTAAAATCCCCAAGG 94 1136
1075202 N/A N/A 21884 21899 AATTATATAAGGCTGT 26 1137
1075234 N/A N/A 24701 24716 GTAAATACTCTAGTTC 22 1138
1075266 N/A N/A 27425 27440 TATTAGGACAAAGTAC 57 1139
1075298 N/A N/A 30895 30910 ATCTCGGAAATTTAAA 128  1140
1075330 N/A N/A 32458 32473 GAGGGAAAACTTTGCA 63 1141
1075362 N/A N/A 34134 34149 CAGGAAAAATCTAGGT 50 1142
1075394 N/A N/A 36170 36185 TCTTAACCTATGCCAA 27 1143
1075426 N/A N/A 38752 38767 GTATTATTAATCCTGT 49 1144
1075458 N/A N/A 40971 40986 CCACAATATACTCCAA  7 1145
1075490 N/A N/A 42884 42899 CATATACGCAATTAGT 27 1146
1075522 N/A N/A 45428 45443 CAAATCGAGGCGAATC 82 1147
1075554 N/A N/A 47574 47589 TTGCAATAGTCACCCA 56 1148
1075586 N/A N/A 49373 49388 TATTAGCACCTGGGTA 64 1149
1075618 N/A N/A 51375 51390 TTTTAAGAACGACATA 69 1150
1075650 N/A N/A 52783 52798 ATATTACAATCCCAGC 48 1151
1075682 N/A N/A 55172 55187 GATAATTATTACCCCT 35 1152
1075714 N/A N/A 57577 57592 AATTACAATCAACCTT 42 1153
1075746 N/A N/A 59700 59715 GATTAACCCAGTAGAG 28 1154
1075778 N/A N/A 62239 62254 CATTTATACCAGGCAC  3 1155
1075810 N/A N/A 64258 64273 GTAGCAATAGAGTAAC  7 1156
1075842 N/A N/A 67207 67222 GTATTTAGGTACTCAG  2 1157
1075874 N/A N/A 71096 71111 CTTAACAACCCTACGA 113  1158
1075906 N/A N/A 73792 73807 CCTCAATACAGATGAA 39 1159
1075938 N/A N/A 76754 76769 GAATATATGGGTTTCA 55 1160
1075970 N/A N/A 80333 80348 GCTTAAAAGGACAGTA 34 1161
1076002 N/A N/A 82141 82156 ATTTAATGGCTTGCAT 21 1162
1076034 N/A N/A 84970 84985 AATTAGAAACTTGGCC 74 1163
1076066 N/A N/A 87168 87183 CATATAAGATGTTTGC  8 1164
1076098 N/A N/A 90319 90334 TTACAATAATAAACGA 94 1165
1076130 N/A N/A 92149 92164 CTGGAATAGTGGGTGC 34 1166
1076162 N/A N/A 93320 93335 ATTTACTTGGCAACTC  9 1167
1076194 N/A N/A 96060 96075 TTTAATACACAGGTTC 22 1168
1076226 N/A N/A 97728 97743 CATATAAACCTTGCTA 36 1169
1076258 N/A N/A 100563 100578 CTTTAGGTGCCTCCTT 10 1170
1076290 N/A N/A 103434 103449 CTCCAACGGACAACTT 28 1171
1076322 N/A N/A 106041 106056 ATTTACAAGTGAGCAC 21 1172
1076354 N/A N/A 109382 109397 GATTAAACATTCGGAT 13 1173
1076386 N/A N/A 111389 111404 AGTTATAACAGTGTAA  7 1174
1076418 N/A N/A 113873 113888 TATAATAACCCATTGT 63 1175
1076450 N/A N/A 117136 117151 CTTGAATAGCTATGTG 13 1176
1076482 N/A N/A 119679 119694 CTTTAGACTAAGTAAG 107  1177
1076514 N/A N/A 122224 122239 CCTTAGGAGATGCACC 18 1178
1076546 N/A N/A 79333 79348 CCCCAACCTGAGGAGC 94 1179

TABLE 17
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA  3  810
1074115 110 125 3570 3585 AGAACTTTTTCCCTCC 33 1180
1074147 288 303 3748 3763 AGAAGCGGCGACGGCT 23 1181
1074179 383 398 3843 3858 CGGGATCCATGGCTTC 49 1182
1074211 643 658 4103 4118 CTTCCGGAGCCTCATG 67 1183
1074243 932 947 7366 7381 TCTGACCAGAAGATGT 60 1184
1074275 1146 1161 79087 79102 CAAGAGGTGGTCTTGT 73 1185
1074307 1367 1382 99069 99084 GTGGCCTCACCTGCCG 105  1186
1074339 1479 1494 116668 116683 ACTGGATTTTGAGTCC 31 1187
1074371 1675 1690 122700 122715 GTTGATAGTATCACCT 31 1188
1074403 1973 1988 122998 123013 GCTTATGGAAATTTCC  9 1189
1074435 2265 2280 123290 123305 GACTTCTAAGTCTGAG  19* 1190
1074467 2652 2667 123677 123692 CACCGACCCTGCCAAA 31 1191
1074499 2746 2761 123771 123786 TACAATAACCATCCCA 10 1192
1074531 3023 3038 124048 124063 CACTAAACTACTTCAA 73 1193
1074563 3178 3193 124203 124218 TGAATTCCAATCGAGA  4 1194
1074595 3376 3391 124401 124416 TAGAAGTAGGAGCAAG  4 1195
1074627 3731 3746 124756 124771 CCTGTTATGAACCCTT  3 1196
1074659 4042 4057 125067 125082 CTAAAACTCCATCTGC 12 1197
1074691 4227 4242 125252 125267 CCCTCCCCCTAAGCTA 76 1198
1074723 4410 4425 125435 125450 GGTAAAGGAAGATCTC  6 1199
1074755 4600 4615 125625 125640 CACTTTTACATTAGGA  3 1200
1074787 4761 4776 125786 125801 CAACCATAAGTAGATC 13 1201
1074819 5039 5054 126064 126079 AAGCACTGAATATTGC 33 1202
1074851 5143 5158 126168 126183 ATTGTTATGATAGGCA  6 1203
1074915 N/A N/A 5531 5546 AGTTACATCCCGAGTG 65 1204
1074947 N/A N/A 5626 5641 TCCAAAACCCTTTGGT 99 1205
1074979 N/A N/A 126493 126508 ATTGCCAGTTCTTGTT 32 1206
1075011 N/A N/A 5292 5307 GCACAATAATCGAACA 44 1207
1075043 N/A N/A 7834 7849 CCCCAAAAGCCCTACT 73 1208
1075075 N/A N/A 9942 9957 AATTTTATAAGCCCAC  9 1209
1075107 N/A N/A 11251 11266 TAAAAACATTGTGGCC 114  1210
1075139 N/A N/A 13448 13463 CCCAAATAATAGATAC 65 1211
1075171 N/A N/A 17320 17335 CCCCAATATAAAGAAC 88 1212
1075203 N/A N/A 21885 21900 TAATTATATAAGGCTG 68 1213
1075235 N/A N/A 24702 24717 AGTAAATACTCTAGTT 38 1214
1075267 N/A N/A 27547 27562 CTATTTAGAATAAGTG 83 1215
1075299 N/A N/A 31204 31219 GATAACCAATGCACCA 21 1216
1075331 N/A N/A 32471 32486 GATAAACACTGCAGAG 33 1217
1075363 N/A N/A 34223 34238 ACACAATATCAAGTCC 25 1218
1075395 N/A N/A 36225 36240 ATGAATAAGTATGCCA  4 1219
1075427 N/A N/A 38797 38812 TATAAGGCATCTTGGA 60 1220
1075459 N/A N/A 41050 41065 AACCAAGGATAGTCAT 37 1221
1075491 N/A N/A 43058 43073 GACGGAAGTTGCAAGG 93 1222
1075523 N/A N/A 45517 45532 AATTAAGGGCCCACAA 78 1223
1075555 N/A N/A 47585 47600 GCCAAAAATTCTTGCA 92 1224
1075587 N/A N/A 49375 49390 CTTATTAGCACCTGGG 50 1225
1075619 N/A N/A 51414 51429 CTTAGATACTACTTTG 54 1226
1075651 N/A N/A 52784 52799 TATATTACAATCCCAG 57 1227
1075683 N/A N/A 55227 55242 CTGAAAAAGTTATGCC 56 1228
1075715 N/A N/A 57578 57593 GAATTACAATCAACCT 12 1229
1075747 N/A N/A 59709 59724 ATTTAGCATGATTAAC 43 1230
1075779 N/A N/A 62290 62305 GTATTACAAACTGATT 28 1231
1075811 N/A N/A 64261 64276 ATTGTAGCAATAGAGT 10 1232
1075843 N/A N/A 67232 67247 CATGAAATGATGGAAC 47 1233
1075875 N/A N/A 71097 71112 ACTTAACAACCCTACG 72 1234
1075907 N/A N/A 73846 73861 AATTACTACTGGCCAT 55 1235
1075939 N/A N/A 76757 76772 CTTGAATATATGGGTT  6 1236
1075971 N/A N/A 80380 80395 TATTAACATACCTCAT 28 1237
1076003 N/A N/A 82142 82157 AATTTAATGGCTTGCA  8 1238
1076035 N/A N/A 84972 84987 GTAATTAGAAACTTGG  9 1239
1076067 N/A N/A 87169 87184 GCATATAAGATGTTTG  4 1240
1076099 N/A N/A 90414 90429 CCTCAAAACTTGGATT 41 1241
1076131 N/A N/A 92180 92195 TATTATGAGGACTGAT 23 1242
1076163 N/A N/A 93798 93813 GATATAAGTTACCAAT 16 1243
1076195 N/A N/A 96248 96263 AATAACATGGTTCTGT 20 1244
1076227 N/A N/A 97800 97815 ACTTATAAGGCCAGCA 16 1245
1076259 N/A N/A 100700 100715 ATTTAACTCCTGAAGT 61 1246
1076291 N/A N/A 103541 103556 GATTAATGGTGGCATT  4 1247
1076323 N/A N/A 106043 106058 CAATTTACAAGTGAGC  5 1248
1076355 N/A N/A 109562 109577 CTACAAAAGAGCTATG 92 1249
1076387 N/A N/A 111398 111413 TGACAACACAGTTATA 13 1250
1076419 N/A N/A 113874 113889 ATATAATAACCCATTG 47 1251
1076451 N/A N/A 117183 117198 CCTTAAGAACATGAGG 77 1252
1076483 N/A N/A 119774 119789 ACGGGAAATCATATAG  5 1253
1076515 N/A N/A 122246 122261 CTGCAAGAATACTTTA 30 1254
1076547 N/A N/A 97024 97039 GACCAACCTCCCTCAG 89 1255

TABLE 18
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA  1  810
1074116 111 126 3571 3586 GAGAACTTTTTCCCTC 112  1256
1074148 292 307 3752 3767 GTGGAGAAGCGGCGAC 66 1257
1074180 384 399 3844 3859 CCGGGATCCATGGCTT 86 1258
1074212 644 659 4104 4119 GCTTCCGGAGCCTCAT 53 1259
1074244 933 948 7367 7382 CTCTGACCAGAAGATG 95 1260
1074276 1147 1162 79088 79103 CCAAGAGGTGGTCTTG 87 1261
1074308 1376 1391 N/A N/A GCATTGCCTGTGGCCT 132  1262
1074340 1493 1508 116682 116697 TCCCGGGAGAAGACAC 120  1263
1074372 1680 1695 122705 122720 CTTTGGTTGATAGTAT 10 1264
1074404 1974 1989 122999 123014 GGCTTATGGAAATTTC 16 1265
1074436 2277 2292 123302 123317 CATGAAGCATCTGACT  31* 1266
1074468 2653 2668 123678 123693 CCACCGACCCTGCCAA 34 1267
1074500 2747 2762 123772 123787 CTACAATAACCATCCC 10 1268
1074532 3026 3041 124051 124066 GAACACTAAACTACTT 59 1269
1074564 3179 3194 124204 124219 CTGAATTCCAATCGAG  4 1270
1074596 3401 3416 124426 124441 TTCTATCCAGGGTCAA 12 1271
1074628 3732 3747 124757 124772 GCCTGTTATGAACCCT  5 1272
1074660 4057 4072 125082 125097 AATTTCATTACTACTC 48 1273
1074692 4245 4260 125270 125285 CCCCCCCAAACTTTCC 101  1274
1074724 4411 4426 125436 125451 GGGTAAAGGAAGATCT 22 1275
1074756 4601 4616 125626 125641 GCACTTTTACATTAGG  3 1276
1074788 4762 4777 125787 125802 TCAACCATAAGTAGAT 25 1277
1074820 5046 5061 126071 126086 AAGTGTTAAGCACTGA 85 1278
1074852 5144 5159 126169 126184 AATTGTTATGATAGGC  4 1279
1074916 N/A N/A 5532 5547 AAGTTACATCCCGAGT 75 1280
1074948 N/A N/A 5630 5645 GAGTTCCAAAACCCTT 61 1281
1074980 N/A N/A 126494 126509 TATTGCCAGTTCTTGT 26 1282
1075012 N/A N/A 5349 5364 CTATTGGAATGTTAAC 119  1283
1075044 N/A N/A 7844 7859 AATTAGACTCCCCCAA 58 1284
1075076 N/A N/A 10048 10063 CATAACATCATGGAAG 25 1285
1075108 N/A N/A 11252 11267 CTAAAAACATTGTGGC 67 1286
1075140 N/A N/A 13661 13676 CTTTAGGTTAAGCAAT 86 1287
1075172 N/A N/A 17404 17419 CTTTACATGAACTGAT 14 1288
1075204 N/A N/A 22115 22130 GTTAAACACATCTCAG 43 1289
1075236 N/A N/A 24827 24842 TATAATACCACAAAGT 81 1290
1075268 N/A N/A 27596 27611 TATTAACCTGGAGAGT 47 1291
1075300 N/A N/A 31414 31429 CGTGAAAAGAAAGGCC 98 1292
1075332 N/A N/A 32520 32535 AGCGGGTTTAGAATGC 66 1293
1075364 N/A N/A 34293 34308 CGAAAATAGTTCTCAA 59 1294
1075396 N/A N/A 36570 36585 ATTATCGCACATACAT 89 1295
1075428 N/A N/A 38799 38814 TATATAAGGCATCTTG 53 1296
1075460 N/A N/A 41053 41068 AATAACCAAGGATAGT 30 1297
1075492 N/A N/A 43309 43324 GCTAAAATGATACTTC 29 1298
1075524 N/A N/A 45518 45533 TAATTAAGGGCCCACA 71 1299
1075556 N/A N/A 47618 47633 TGGCAAAAGAGTGGTG 68 1300
1075588 N/A N/A 49376 49391 ACTTATTAGCACCTGG 27 1301
1075620 N/A N/A 51476 51491 GATGAAGAATCTATAG 88 1302
1075652 N/A N/A 52785 52800 GTATATTACAATCCCA 40 1303
1075684 N/A N/A 55228 55243 TCTGAAAAAGTTATGC 78 1304
1075716 N/A N/A 57654 57669 GCCGAAATACTCTCAT 19 1305
1075748 N/A N/A 59723 59738 GTAAATCAAGTTGCAT  7 1306
1075780 N/A N/A 62440 62455 TATAATAATCCAGAAC 98 1307
1075812 N/A N/A 64470 64485 CATTAAGATTTTAACC 103  1308
1075844 N/A N/A 67247 67262 TATTAAATAAGAGCTC 84 1309
1075876 N/A N/A 71176 71191 GTATTTATGATGATTC  6 1310
1075908 N/A N/A 74518 74533 AATAAGGAGTAGGTGG 50 1311
1075940 N/A N/A 77113 77128 ACTCAACAACCCCAAG 54 1312
1075972 N/A N/A 80426 80441 TCACAAGGGCTAATTC 22 1313
1076004 N/A N/A 82143 82158 TAATTTAATGGCTTGC  2 1314
1076036 N/A N/A 84973 84988 CGTAATTAGAAACTTG 19 1315
1076068 N/A N/A 87383 87398 CTAAAATGACCTTAGC 73 1316
1076100 N/A N/A 90552 90567 AATAAGGGACTACTTT 65 1317
1076132 N/A N/A 92207 92222 CATCAATACTGACATC 28 1318
1076164 N/A N/A 93799 93814 TGATATAAGTTACCAA 50 1319
1076196 N/A N/A 96347 96362 TATCAAGGGAATTATT 113  1320
1076228 N/A N/A 98039 98054 ATTAACCTCAGTGAGC 69 1321
1076260 N/A N/A 100704 100719 CTTAATTTAACTCCTG  3 1322
1076292 N/A N/A 103572 103587 TATTATTGAGTTATCC 27 1323
1076324 N/A N/A 106059 106074 GCTCAAAAGGTCTCTC 13 1324
1076356 N/A N/A 109576 109591 CATAATTGGACTGTCT 99 1325
1076388 N/A N/A 111483 111498 GAAATATTCGAGAAGA  6 1326
1076420 N/A N/A 113876 113891 CCATATAATAACCCAT 26 1327
1076452 N/A N/A 117193 117208 GGACTATAGCCCTTAA 16 1328
1076484 N/A N/A 119777 119792 GAAACGGGAAATCATA 10 1329
1076516 N/A N/A 122314 122329 CATAAACATGAGTGGT  8 1330
1076548 N/A N/A 116744 116759 CACCAACCTGTTAAGG 106  1331

TABLE 19
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA  2  810
1074117 117 132 3577 3592 GCGCCTGAGAACTTTT 87 1332
1074149 298 313 3758 3773 GCCGAGGTGGAGAAGC 58 1333
1074181 385 400 3845 3860 CCCGGGATCCATGGCT 107  1334
1074213 654 669 4114 4129 GAGTCGGGCAGCTTCC 55 1335
1074245 941 956 7375 7390 AGAAGTATCTCTGACC  5 1336
1074277 1153 1168 79094 79109 GTCTAGCCAAGAGGTG 18 1337
1074309 1378 1393 N/A N/A CCGCATTGCCTGTGGC 80 1338
1074341 1494 1509 116683 116698 ATCCCGGGAGAAGACA 106  1339
1074373 1681 1696 122706 122721 GCTTTGGTTGATAGTA 26 1340
1074405 1991 2006 123016 123031 GCCTGAAAACTGCAAC 27 1341
1074437 2278 2293 123303 123318 ACATGAAGCATCTGAC   4* 1342
1074469 2654 2669 123679 123694 CCCACCGACCCTGCCA 77 1343
1074501 2748 2763 123773 123788 ACTACAATAACCATCC  9 1344
1074533 3028 3043 124053 124068 TAGAACACTAAACTAC 80 1345
1074565 3180 3195 124205 124220 ACTGAATTCCAATCGA  5 1346
1074597 3405 3420 124430 124445 AGTATTCTATCCAGGG  5 1347
1074629 3742 3757 124767 124782 GAGATTTTATGCCTGT  3 1348
1074661 4058 4073 125083 125098 GAATTTCATTACTACT 36 1349
1074693 4246 4261 125271 125286 CCCCCCCCAAACTTTC 92 1350
1074725 4437 4452 125462 125477 GTATAACTGGGCAAAT 17 1351
1074757 4607 4622 125632 125647 AGTTAAGCACTTTTAC 21 1352
1074789 4763 4778 125788 125803 ATCAACCATAAGTAGA 17 1353
1074821 5049 5064 126074 126089 GAAAAGTGTTAAGCAC 18 1354
1074853 5145 5160 126170 126185 CAATTGTTATGATAGG 15 1355
1074917 N/A N/A 5533 5548 CAAGTTACATCCCGAG 80 1356
1074949 N/A N/A 5642 5657 GTGATTTTTTCTGAGT 31 1357
1074981 N/A N/A 126495 126510 TTATTGCCAGTTCTTG  9 1358
1075013 N/A N/A 5768 5783 CATAAACCCACTTCGA 102  1359
1075045 N/A N/A 7845 7860 AAATTAGACTCCCCCA 18 1360
1075077 N/A N/A 10057 10072 TATACGGTCCATAACA 35 1361
1075109 N/A N/A 11253 11268 ACTAAAAACATTGTGG 71 1362
1075141 N/A N/A 13863 13878 TATACGAGAAGTTGAA 54 1363
1075173 N/A N/A 17464 17479 CTTTAGGGCAACTGTA 22 1364
1075205 N/A N/A 22160 22175 ATTAAATGAGCACCAC 29 1365
1075237 N/A N/A 25230 25245 GCTGAAAATGCTAACT 105  1366
1075269 N/A N/A 27597 27612 TTATTAACCTGGAGAG 13 1367
1075301 N/A N/A 31460 31475 CAGCAACACCTAAGGA 92 1368
1075333 N/A N/A 32529 32544 AGTTAACAAAGCGGGT 14 1369
1075365 N/A N/A 34295 34310 CACGAAAATAGTTCTC 11 1370
1075397 N/A N/A 36571 36586 CATTATCGCACATACA 79 1371
1075429 N/A N/A 38974 38989 CTTTACTATCTGGGTC 23 1372
1075461 N/A N/A 41056 41071 CTAAATAACCAAGGAT 64 1373
1075493 N/A N/A 43320 43335 AGACAAGGGATGCTAA 67 1374
1075525 N/A N/A 45519 45534 TTAATTAAGGGCCCAC 130  1375
1075557 N/A N/A 47655 47670 TATTAAGGTGGCTTAC 57 1376
1075589 N/A N/A 49390 49405 AATTAGCAGGGCAGAC 84 1377
1075621 N/A N/A 51645 51660 GATTAACATTGATACT 61 1378
1075653 N/A N/A 53476 53491 CATAAACTCTGCTGTC 58 1379
1075685 N/A N/A 55369 55384 CATAATCAAAGGGTGC 60 1380
1075717 N/A N/A 57665 57680 CATAAATTTCAGCCGA 10 1381
1075749 N/A N/A 59800 59815 AATTATGAATGATGGG  4 1382
1075781 N/A N/A 62475 62490 CATATATTGTGACTTC  2 1383
1075813 N/A N/A 64652 64667 ACTAATATGCAACTCT  4 1384
1075845 N/A N/A 67654 67669 GTGGAAAAGTATGATC 19 1385
1075877 N/A N/A 71248 71263 CTGGAAAAGTACATTC 28 1386
1075909 N/A N/A 74519 74534 AAATAAGGAGTAGGTG 93 1387
1075941 N/A N/A 77150 77165 AGTCAATAGCAATCAC 11 1388
1075973 N/A N/A 80581 80596 CCGCAACACCATTCTT  8 1389
1076005 N/A N/A 82193 82208 GTACAAAATCTCCAGG 69 1390
1076037 N/A N/A 84987 85002 CTTAAATTCTCTTACG 21 1391
1076069 N/A N/A 87384 87399 TCTAAAATGACCTTAG 118  1392
1076101 N/A N/A 90553 90568 AAATAAGGGACTACTT 71 1393
1076133 N/A N/A 92254 92269 CATACTAATTTGGTAA 60 1394
1076165 N/A N/A 93923 93938 CCCCAAGGACTTGCCA 79 1395
1076197 N/A N/A 96350 96365 TATTATCAAGGGAATT 94 1396
1076229 N/A N/A 98040 98055 AATTAACCTCAGTGAG 91 1397
1076261 N/A N/A 100852 100867 CCCCAACAAGTTCCTG 39 1398
1076293 N/A N/A 103575 103590 GCTTATTATTGAGTTA  3 1399
1076325 N/A N/A 106620 106635 CTAATAATGGAAGAGT 16 1400
1076357 N/A N/A 109680 109695 TCCAAAAACTTCTTAG 22 1401
1076389 N/A N/A 111486 111501 ATCGAAATATTCGAGA 76 1402
1076421 N/A N/A 113900 113915 AATTATGACCTCCATG 65 1403
1076453 N/A N/A 117330 117345 GTAATATTGCAATCTG  1 1404
1076485 N/A N/A 119781 119796 AAACGAAACGGGAAAT 55 1405
1076517 N/A N/A 122329 122344 CATAATAAGACTAAAC 102  1406
1076549 N/A N/A 117537 117552 GTGCAAAATACCTTTG  8 1407

TABLE 20
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA  1  810
1074118 131 146 3591 3606 CACTCGGACCTGCGGC 66 1408
1074150 299 314 3759 3774 GGCCGAGGTGGAGAAG 85 1409
1074182 386 401 3846 3861 GCCCGGGATCCATGGC 82 1410
1074214 672 687 4132 4147 TCCGGCGGCTTGAAGA 89 1411
1074246 942 957 7376 7391 AAGAAGTATCTCTGAC 11 1412
1074278 1158 1173 79099 79114 CTTGGGTCTAGCCAAG 31 1413
1074310 1379 1394 N/A N/A TCCGCATTGCCTGTGG 100  1414
1074342 1495 1510 116684 116699 CATCCCGGGAGAAGAC 56 1415
1074374 1682 1697 122707 122722 TGCTTTGGTTGATAGT 13 1416
1074406 2032 2047 123057 123072 AAAGTATCTTGCTGGA 16 1417
1074438 2279 2294 123304 123319 GACATGAAGCATCTGA   1* 1418
1074470 2657 2672 123682 123697 CCCCCCACCGACCCTG 69 1419
1074502 2749 2764 123774 123789 AACTACAATAACCATC 31 1420
1074534 3041 3056 124066 124081 TAATAGCTCTTTCTAG 88 1421
1074566 3181 3196 124206 124221 CACTGAATTCCAATCG  3 1422
1074598 3410 3425 124435 124450 CTTATAGTATTCTATC 46 1423
1074630 3743 3758 124768 124783 AGAGATTTTATGCCTG  5 1424
1074662 4062 4077 125087 125102 GGTAGAATTTCATTAC 30 1425
1074694 4247 4262 125272 125287 CCCCCCCCCAAACTTT 79 1426
1074726 4438 4453 125463 125478 GGTATAACTGGGCAAA  2 1427
1074758 4608 4623 125633 125648 CAGTTAAGCACTTTTA  4 1428
1074790 4764 4779 125789 125804 CATCAACCATAAGTAG 28 1429
1074822 5051 5066 126076 126091 TAGAAAAGTGTTAAGC 25 1430
1074854 5146 5161 126171 126186 ACAATTGTTATGATAG 23 1431
1074918 N/A N/A 5534 5549 TCAAGTTACATCCCGA 60 1432
1074950 N/A N/A 5652 5667 ATCAGGTTAAGTGATT 120  1433
1074982 N/A N/A 126500 126515 ACCTTTTATTGCCAGT 13 1434
1075014 N/A N/A 6038 6053 GGAGAAATAAAAGTCG 46 1435
1075046 N/A N/A 7846 7861 AAAATTAGACTCCCCC 12 1436
1075078 N/A N/A 10061 10076 CAACTATACGGTCCAT  3 1437
1075110 N/A N/A 11254 11269 GACTAAAAACATTGTG 120  1438
1075142 N/A N/A 13865 13880 GATATACGAGAAGTTG 16 1439
1075174 N/A N/A 17491 17506 CCTGAAAAGACAGTCC 74 1440
1075206 N/A N/A 22161 22176 TATTAAATGAGCACCA 36 1441
1075238 N/A N/A 25596 25611 CTTAAACAGGTGCCAA 24 1442
1075270 N/A N/A 27599 27614 CTTTATTAACCTGGAG 18 1443
1075302 N/A N/A 31497 31512 CCTTAAAGCTTCCACC 75 1444
1075334 N/A N/A 32542 32557 TTAATAATCTACCAGT 60 1445
1075366 N/A N/A 34296 34311 ACACGAAAATAGTTCT 27 1446
1075398 N/A N/A 36612 36627 TATATATGGCCCTTTA 49 1447
1075430 N/A N/A 39017 39032 CTTAACTAACTTGACC 96 1448
1075462 N/A N/A 41259 41274 GTTTATAGACAAGTCA 15 1449
1075494 N/A N/A 43450 43465 TCTCAACAATTTGCTA 47 1450
1075526 N/A N/A 45520 45535 TTTAATTAAGGGCCCA 110  1451
1075558 N/A N/A 47656 47671 ATATTAAGGTGGCTTA 51 1452
1075590 N/A N/A 49396 49411 CATCAAAATTAGCAGG 50 1453
1075622 N/A N/A 51771 51786 TCTTATACCTATCTTC 56 1454
1075654 N/A N/A 53501 53516 TATTAAGACGAATCCA 76 1455
1075686 N/A N/A 55578 55593 GTAATTACAGTGTCTC 10 1456
1075718 N/A N/A 57703 57718 CCACTAAAACCAAGTT 48 1457
1075750 N/A N/A 59801 59816 CAATTATGAATGATGG 10 1458
1075782 N/A N/A 62506 62521 TATTAGGTTTCCCGTT 10 1459
1075814 N/A N/A 64821 64836 TATAAAGCAGGGCATT 47 1460
1075846 N/A N/A 67670 67685 GATTAAGAGCCTATCT 96 1461
1075878 N/A N/A 71286 71301 GATTATCAAGTAGTTT 35 1462
1075910 N/A N/A 74520 74535 GAAATAAGGAGTAGGT 93 1463
1075942 N/A N/A 77172 77187 TGACTATACATGGTGA 46 1464
1075974 N/A N/A 80589 80604 AAAAAATTCCGCAACA 39 1465
1076006 N/A N/A 82219 82234 TTTAAACCTGAGACTC 41 1466
1076038 N/A N/A 85047 85062 AGGCAAGAATTGGGTA 11 1467
1076070 N/A N/A 87434 87449 ATTAGTAATGCACAGG  6 1468
1076102 N/A N/A 90613 90628 CTTAACAAATCAGCCC 32 1469
1076134 N/A N/A 92267 92282 GATTAGAGTTGGGCAT 10 1470
1076166 N/A N/A 93997 94012 ATTTACACCACCGCCC 77 1471
1076198 N/A N/A 96351 96366 CTATTATCAAGGGAAT 81 1472
1076230 N/A N/A 98041 98056 GAATTAACCTCAGTGA 50 1473
1076262 N/A N/A 101120 101135 AGACAATAGTCTGGGC 41 1474
1076294 N/A N/A 103629 103644 TATATTAGTGCCCCCT  6 1475
1076326 N/A N/A 106621 106636 GCTAATAATGGAAGAG  4 1476
1076358 N/A N/A 109745 109760 GTTTAACAAACTTGTA 43 1477
1076390 N/A N/A 111487 111502 GATCGAAATATTCGAG 54 1478
1076422 N/A N/A 113901 113916 GAATTATGACCTCCAT 13 1479
1076454 N/A N/A 117469 117484 TAAACTAATCCCATAT 35 1480
1076486 N/A N/A 119782 119797 GAAACGAAACGGGAAA  5 1481
1076518 N/A N/A 122341 122356 GATAAGCACCACCATA 25 1482
1076550 N/A N/A 120573 120588 TACCAACCTGTATCCA 61 1483

TABLE 21
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA  1  810
1074119 132 147 3592 3607 GCACTCGGACCTGCGG 71 1484
1074151 300 315 3760 3775 GGGCCGAGGTGGAGAA 81 1485
1074183 407 422 3867 3882 CCGGTTGAGGCGGCGG 90 1486
1074215 674 689 4134 4149 GCTCCGGCGGCTTGAA 77 1487
1074247 955 970 N/A N/A ATCGATGTGATTTAAG 43 1488
1074279 1165 1180 79106 79121 GTCAAGCCTTGGGTCT 13 1489
1074311 1380 1395 N/A N/A TTCCGCATTGCCTGTG 24 1490
1074343 1498 1513 116687 116702 AGACATCCCGGGAGAA 18 1491
1074375 1688 1703 122713 122728 GCAGGGTGCTTTGGTT 33 1492
1074407 2033 2048 123058 123073 TAAAGTATCTTGCTGG  6 1493
1074439 2283 2298 123308 123323 CTGTGACATGAAGCAT   2* 1494
1074471 2658 2673 123683 123698 CCCCCCCACCGACCCT 69 1495
1074503 2750 2765 123775 123790 CAACTACAATAACCAT 29 1496
1074535 3042 3057 124067 124082 GTAATAGCTCTTTCTA  5 1497
1074567 3189 3204 124214 124229 AACCTACTCACTGAAT 38 1498
1074599 3423 3438 124448 124463 GCTAACTCAAAACCTT 12 1499
1074631 3765 3780 124790 124805 CATAGCAGCTTTTGCC  9 1500
1074663 4069 4084 125094 125109 CATTCTAGGTAGAATT 79 1501
1074695 4266 4281 125291 125306 CCCCCTAAATCTTCAC 49 1502
1074727 4440 4455 125465 125480 GAGGTATAACTGGGCA  9 1503
1074759 4619 4634 125644 125659 CAACCAAGAAGCAGTT 43 1504
1074791 4767 4782 125792 125807 CTCCATCAACCATAAG 20 1505
1074823 5080 5095 126105 126120 GAGCACTCATTTCTCA 77 1506
1074855 5213 5228 126238 126253 GTGCATTAAAGAATTC 29 1507
1074887 N/A N/A 5450 5465 TAGCCTGAAGCAAGTT 57 1508
1074919 N/A N/A 5535 5550 CTCAAGTTACATCCCG 48 1509
1074951 N/A N/A 5653 5668 CATCAGGTTAAGTGAT 85 1510
1074983 N/A N/A 126501 126516 CACCTTTTATTGCCAG 11 1511
1075015 N/A N/A 6067 6082 CAGAATAAGTATGATT 55 1512
1075047 N/A N/A 7847 7862 TAAAATTAGACTCCCC  7 1513
1075079 N/A N/A 10149 10164 CACCAAAAGCTTAGTT 40 1514
1075111 N/A N/A 11385 11400 TAGGAATATGGGTAGT  5 1515
1075143 N/A N/A 13883 13898 CCTTATTAGTCAGTTC  2 1516
1075175 N/A N/A 17507 17522 ACTGAAAGATTCCATG 99 1517
1075207 N/A N/A 22162 22177 CTATTAAATGAGCACC  4 1518
1075239 N/A N/A 25597 25612 TCTTAAACAGGTGCCA 27 1519
1075271 N/A N/A 27652 27667 GATGTGATCTGTGAGA 11 1520
1075303 N/A N/A 31554 31569 TAAACTAATCTACAAC 100  1521
1075335 N/A N/A 32543 32558 CTTAATAATCTACCAG 30 1522
1075367 N/A N/A 34502 34517 CATTACTTAGGGCTTA 12 1523
1075399 N/A N/A 36614 36629 CATATATATGGCCCTT 15 1524
1075431 N/A N/A 39045 39060 TAACTAAACTGATTCC 74 1525
1075463 N/A N/A 41370 41385 CTTAATCCAAAGCTTC 34 1526
1075495 N/A N/A 43489 43504 CTTAATTGGTAACTGA 19 1527
1075527 N/A N/A 45521 45536 ATTTAATTAAGGGCCC 82 1528
1075559 N/A N/A 47657 47672 GATATTAAGGTGGCTT 24 1529
1075591 N/A N/A 49541 49556 GTAATAATCACCTTAC 76 1530
1075623 N/A N/A 51815 51830 CATAATCAAAATGGGC 48 1531
1075655 N/A N/A 53502 53517 CTATTAAGACGAATCC 38 1532
1075687 N/A N/A 55642 55657 TAAACGAGTAATGACT 23 1533
1075719 N/A N/A 58015 58030 CTAAAACCGGCTGGAC 76 1534
1075751 N/A N/A 59839 59854 GAGGAACAAGATCTCA 72 1535
1075783 N/A N/A 62684 62699 CTTAATTTACCTGAAC 36 1536
1075815 N/A N/A 64822 64837 GTATAAAGCAGGGCAT 36 1537
1075847 N/A N/A 67823 67838 CTTTATAGCAGATGCC 14 1538
1075879 N/A N/A 71353 71368 GAATAAAGAAGTCACC 77 1539
1075911 N/A N/A 74637 74652 TGACAAAACAGGCACC 41 1540
1075943 N/A N/A 77361 77376 GTATATCAAACCTTTT 15 1541
1075975 N/A N/A 80592 80607 GGAAAAAAATTCCGCA 84 1542
1076007 N/A N/A 82293 82308 CATTAGGCCTTTTACT 27 1543
1076039 N/A N/A 85200 85215 GATTAGAGCTGTATTC 29 1544
1076071 N/A N/A 87435 87450 TATTAGTAATGCACAG 14 1545
1076103 N/A N/A 90614 90629 GCTTAACAAATCAGCC 79 1546
1076135 N/A N/A 92319 92334 CATAATTGACAGGTAT 14 1547
1076167 N/A N/A 93999 94014 AAATTTACACCACCGC 33 1548
1076199 N/A N/A 96382 96397 TATCAAAAGTCCATCC 37 1549
1076231 N/A N/A 98106 98121 TTAGAAATGGACTGGG 16 1550
1076263 N/A N/A 101298 101313 AATAACCAAGTGAGTT 21 1551
1076295 N/A N/A 103630 103645 GTATATTAGTGCCCCC  2 1552
1076327 N/A N/A 106694 106709 GATAAGCAAGGTTCTC  7 1553
1076359 N/A N/A 109776 109791 ATTTATCCTAGTTACC 29 1554
1076391 N/A N/A 111530 111545 CAAATATAGTTAGCCT 22 1555
1076423 N/A N/A 114068 114083 CCTGAACCTTCTGGAT 93 1556
1076455 N/A N/A 117635 117650 ACTAAATACTTTTAGC 86 1557
1076487 N/A N/A 119786 119801 GTACGAAACGAAACGG 21 1558
1076519 N/A N/A 122375 122390 ACACAACACGACAGCA 31 1559
1076551 N/A N/A 5268 5283 GTGGAATAGCAGCCAT 67 1560

TABLE 22
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA  1  810
1074120 137 152 3597 3612 GCGAGGCACTCGGACC 50 1561
1074152 301 316 3761 3776 CGGGCCGAGGTGGAGA 77 1562
1074184 408 423 3868 3883 GCCGGTTGAGGCGGCG 100  1563
1074216 681 696 4141 4156 GATTTGGGCTCCGGCG 58 1564
1074248 956 971 N/A N/A GATCGATGTGATTTAA 29 1565
1074280 1166 1181 79107 79122 GGTCAAGCCTTGGGTC 43 1566
1074312 1383 1398 102515 102530 ATATTCCGCATTGCCT 18 1567
1074344 1500 1515 116689 116704 TGAGACATCCCGGGAG 99 1568
1074376 1706 1721 122731 122746 AACGGTTCTGCTGTGA 44 1569
1074408 2036 2051 123061 123076 GATTAAAGTATCTTGC 23 1570
1074440 2284 2299 123309 123324 GCTGTGACATGAAGCA  38* 1571
1074472 2660 2675 123685 123700 AACCCCCCCACCGACC 107  1572
1074504 2804 2819 123829 123844 TCGAGATTTAAATAAG 76 1573
1074536 3043 3058 124068 124083 AGTAATAGCTCTTTCT  6 1574
1074568 3190 3205 124215 124230 GAACCTACTCACTGAA 12 1575
1074600 3425 3440 124450 124465 CAGCTAACTCAAAACC 29 1576
1074632 3766 3781 124791 124806 TCATAGCAGCTTTTGC 12 1577
1074664 4070 4085 125095 125110 GCATTCTAGGTAGAAT 49 1578
1074696 4268 4283 125293 125308 GTCCCCCTAAATCTTC 38 1579
1074728 4441 4456 125466 125481 TGAGGTATAACTGGGC  3 1580
1074760 4620 4635 125645 125660 ACAACCAAGAAGCAGT 11 1581
1074792 4776 4791 125801 125816 ATCAATGTGCTCCATC  4 1582
1074824 5083 5098 126108 126123 CCTGAGCACTCATTTC 53 1583
1074856 5223 5238 126248 126263 TTTGACAAGTGTGCAT 15 1584
1074888 N/A N/A 5453 5468 GTTTAGCCTGAAGCAA 58 1585
1074920 N/A N/A 5536 5551 ACTCAAGTTACATCCC 68 1586
1074952 N/A N/A 5661 5676 GTTTTTGTCATCAGGT 42 1587
1074984 N/A N/A 126503 126518 ATCACCTTTTATTGCC 31 1588
1075016 N/A N/A 6068 6083 TCAGAATAAGTATGAT 100  1589
1075048 N/A N/A 7848 7863 GTAAAATTAGACTCCC  4 1590
1075080 N/A N/A 10219 10234 ATTACAAAGACAGCCC 18 1591
1075112 N/A N/A 11388 11403 ATATAGGAATATGGGT  6 1592
1075144 N/A N/A 14659 14674 ACCCTATATCCTATAT 82 1593
1075176 N/A N/A 17544 17559 AATTACCCGGGAACTA 70 1594
1075208 N/A N/A 22191 22206 ACTGAACACAGGCTAC 24 1595
1075240 N/A N/A 25749 25764 TAAACGGTTTATATTC 16 1596
1075272 N/A N/A 28023 28038 AATTAGCCAGCATGCA 110  1597
1075304 N/A N/A 31613 31628 CACGGGTACCAGAAAA 50 1598
1075336 N/A N/A 32544 32559 GCTTAATAATCTACCA 32 1599
1075368 N/A N/A 34751 34766 GAGAATAAGCAATCAG 24 1600
1075400 N/A N/A 36641 36656 TAGCAATAGTCAGGTA 11 1601
1075432 N/A N/A 39046 39061 CTAACTAAACTGATTC 121  1602
1075464 N/A N/A 41448 41463 CCACTAAACCACCTAA 77 1603
1075496 N/A N/A 43503 43518 TTATATAATGCAGGCT 22 1604
1075528 N/A N/A 45616 45631 ATCGAAGGGCAAACTC 42 1605
1075560 N/A N/A 47723 47738 GCTAAATAAAGGTTAC 86 1606
1075592 N/A N/A 49542 49557 CGTAATAATCACCTTA 55 1607
1075624 N/A N/A 51848 51863 ATCTATAACCCTTATT 91 1608
1075656 N/A N/A 53591 53606 AAAACGGTTTTTCTAA 103  1609
1075688 N/A N/A 55673 55688 GACAATAAACATCACC 12 1610
1075720 N/A N/A 58458 58473 CTTTACTACATATAGC 47 1611
1075752 N/A N/A 60020 60035 CATAATTATACTGATC 19 1612
1075784 N/A N/A 62703 62718 ATTTTATAGGGCCATT  3 1613
1075816 N/A N/A 64824 64839 TAGTATAAAGCAGGGC  7 1614
1075848 N/A N/A 67963 67978 GATTACAATGGGCAGT  9 1615
1075880 N/A N/A 71412 71427 ATTAACTACACCACGA 30 1616
1075912 N/A N/A 74743 74758 AGTTATACACAACCAC 13 1617
1075944 N/A N/A 77599 77614 TATTAGGAACAGATCA 25 1618
1075976 N/A N/A 80964 80979 ATTAAAAGTCGGGCCA 92 1619
1076008 N/A N/A 82386 82401 AGCGAAAATAACATTA 33 1620
1076040 N/A N/A 85319 85334 CTTAAAGAAGCACTAG 105  1621
1076072 N/A N/A 87726 87741 CACAAAAACTGGTCTG 18 1622
1076104 N/A N/A 90640 90655 ACGAAATAGTAACTGT 24 1623
1076136 N/A N/A 92372 92387 CAACAACCTCATGTAA 60 1624
1076168 N/A N/A 94000 94015 CAAATTTACACCACCG 23 1625
1076200 N/A N/A 96417 96432 GATTACACTATCAAAA 67 1626
1076232 N/A N/A 98125 98140 GTAATACACCATTTGG 15 1627
1076264 N/A N/A 101302 101317 ACCCAATAACCAAGTG 40 1628
1076296 N/A N/A 103670 103685 TATAAAGACCCAATGC 68 1629
1076328 N/A N/A 107005 107020 ACTGAACCGCTGCCTC 33 1630
1076360 N/A N/A 109778 109793 CTATTTATCCTAGTTA 59 1631
1076392 N/A N/A 111564 111579 TATTAATCAAATAGGG 64 1632
1076424 N/A N/A 114085 114100 ACTTAACCTGACAGCT 76 1633
1076456 N/A N/A 117763 117778 CTTTAAAGTGTATGTC  2 1634
1076488 N/A N/A 119867 119882 GCCAATAAGATAAGAA 19 1635
1076520 N/A N/A 122407 122422 AATTATATGCAGCAGC 21 1636
1076552 N/A N/A 11807 11822 ATGTATAAATACCAGG  7 1637

TABLE 23
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2 YAP1
Compound Start Stop Start Stop (% SEQ
Number Site Site Site Site Sequence (5' to 3') UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA   2  810
1074121  138  153   3598   3613 TGCGAGGCACTCGGAC  87 1638
1074153  303  318   3763   3778 CACGGGCCGAGGTGGA  78 1639
1074185  409  424   3869   3884 GGCCGGTTGAGGCGGC  91 1640
1074217  682  697   4142   4157 GGATTTGGGCTCCGGC  74 1641
1074249  957  972 N/A N/A TGATCGATGTGATTTA  23 1642
1074281 1169 1184  79110  79125 GAGGGTCAAGCCTTGG  91 1643
1074313 1385 1400 102517 102532 TGATATTCCGCATTGC   5 1644
1074345 1533 1548 116722 116737 TCTGAGCTATTGGTCG   8 1645
1074377 1707 1722 122732 122747 AAACGGTTCTGCTGTG  52 1646
1074409 2037 2052 123062 123077 GGATTAAAGTATCTTG   6 1647
1074441 2294 2309 123319 123334 CAAACTAAATGCTGTG   5* 1648
1074473 2661 2676 123686 123701 CAACCCCCCCACCGAC  82 1649
1074505 2806 2821 123831 123846 AATCGAGATTTAAATA  83 1650
1074537 3044 3059 124069 124084 CAGTAATAGCTCTTTC   3 1651
1074569 3191 3206 124216 124231 TGAACCTACTCACTGA   8 1652
1074601 3426 3441 124451 124466 CCAGCTAACTCAAAAC  24 1653
1074633 3774 3789 124799 124814 GAGGCTTTTCATAGCA  78 1654
1074665 4072 4087 125097 125112 TTGCATTCTAGGTAGA  17 1655
1074697 4274 4289 125299 125314 ATCAAGGTCCCCCTAA  44 1656
1074729 4445 4460 125470 125485 ACACTGAGGTATAACT   9 1657
1074761 4628 4643 125653 125668 TACCCAATACAACCAA  15 1658
1074793 4777 4792 125802 125817 AATCAATGTGCTCCAT   9 1659
1074825 5084 5099 126109 126124 ACCTGAGCACTCATTT  36 1660
1074857 5245 5260 126270 126285 ACATTGGTACTATATA  25 1661
1074889 N/A N/A   5454   5469 AGTTTAGCCTGAAGCA  42 1662
1074921 N/A N/A   5537   5552 CACTCAAGTTACATCC  65 1663
1074953 N/A N/A   5663   5678 GGGTTTTTGTCATCAG  32 1664
1074985 N/A N/A 126504 126519 AATCACCTTTTATTGC  49 1665
1075017 N/A N/A   6099   6114 CTTAAAGTGATACACC  19 1666
1075049 N/A N/A   7912   7927 GAAATATTGGTAAGTC  10 1667
1075081 N/A N/A  10220  10235 GATTACAAAGACAGCC   7 1668
1075113 N/A N/A  11804  11819 TATAAATACCAGGTAC  67 1669
1075145 N/A N/A  15306  15321 TCCCAAAAGGAGTAGC  58 1670
1075177 N/A N/A  17546  17561 GAAATTACCCGGGAAC  27 1671
1075209 N/A N/A  22213  22228 CATCAACAATGGTCTA  11 1672
1075241 N/A N/A  25786  25801 GATAATTACTAACTGA  31 1673
1075273 N/A N/A  28145  28160 AAATTATGGTCAGGCT  18 1674
1075305 N/A N/A  31621  31636 AAACGAAACACGGGTA  66 1675
1075337 N/A N/A  32561  32576 GCTTATATCCTGTAAC  48 1676
1075369 N/A N/A  34752  34767 GGAGAATAAGCAATCA  31 1677
1075401 N/A N/A  36720  36735 CGATTAAAACACTGGT   3 1678
1075433 N/A N/A  39050  39065 TTAACTAACTAAACTG 124 1679
1075465 N/A N/A  41471  41486 GATTTATTGAACTGAG   7 1680
1075497 N/A N/A  43504  43519 ATTATATAATGCAGGC  14 1681
1075529 N/A N/A  45618  45633 AAATCGAAGGGCAAAC  84 1682
1075561 N/A N/A  47742  47757 GTAAGTAAGGGAACCC  32 1683
1075593 N/A N/A  49605  49620 CATTAGAGTATGAACT  99 1684
1075625 N/A N/A  51849  51864 AATCTATAACCCTTAT  49 1685
1075657 N/A N/A  53594  53609 TAAAAAACGGTTTTTC  84 1686
1075689 N/A N/A  55744  55759 CAACTATACAAGGCAA   4 1687
1075721 N/A N/A  58637  58652 TTAAATACCTTCTAGC  67 1688
1075753 N/A N/A  60167  60182 CTAGAACCTTTTCCAG  65 1689
1075785 N/A N/A  62704  62719 CATTTTATAGGGCCAT   2 1690
1075817 N/A N/A  65591  65606 CCTAAAGAAGTCTTGG 100 1691
1075849 N/A N/A  67996  68011 CTAGAACACGCTGATG  55 1692
1075881 N/A N/A  71413  71428 GATTAACTACACCACG  23 1693
1075913 N/A N/A  75193  75208 CCCCTATACTTTTTGA  46 1694
1075945 N/A N/A  77600  77615 GTATTAGGAACAGATC  11 1695
1075977 N/A N/A  80965  80980 GATTAAAAGTCGGGCC  73 1696
1076009 N/A N/A  82387  82402 TAGCGAAAATAACATT  69 1697
1076041 N/A N/A  85661  85676 GTTAAAGAGTGGAAAT  47 1698
1076073 N/A N/A  88094  88109 CTTTAAGGTCTAGTTA  47 1699
1076105 N/A N/A  90641  90656 TACGAAATAGTAACTG  13 1700
1076137 N/A N/A  92375  92390 CACCAACAACCTCATG  45 1701
1076169 N/A N/A  94082  94097 CTACTATATCTTTGGG  10 1702
1076201 N/A N/A  96469  96484 CTAAAAAGACAGGGCC  99 1703
1076233 N/A N/A  98280  98295 CCAATAAAGCAAGTAG  13 1704
1076265 N/A N/A 101306 101321 TATTACCCAATAACCA   9 1705
1076297 N/A N/A 103671 103686 TTATAAAGACCCAATG  52 1706
1076329 N/A N/A 107153 107168 AATTATACTGGCTACT  14 1707
1076361 N/A N/A 109944 109959 TGGGAAAAGCTACCAC  87 1708
1076393 N/A N/A 111591 111606 CTTTACTTACTGGTGG   4 1709
1076425 N/A N/A 114175 114190 CGGGAAAATTCTGGAG  32 1710
1076457 N/A N/A 117800 117815 GAACTATAATCTTATA  74 1711
1076489 N/A N/A 119885 119900 CAAAATAGGTGAGTCA   2 1712
1076521 N/A N/A 122446 122461 ACTAAAGGAGTCATGA  67 1713
1076553 N/A N/A  37304  37319 TGGGAATAATTTGGCC  69 1714

TABLE 24
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 2  810
1074122 139 154 3599 3614 CTGCGAGGCACTCGGA 73 1715
1074154 304 319 3764 3779 CCACGGGCCGAGGTGG 100 1716
1074186 410 425 3870 3885 GGGCCGGTTGAGGCGG 74 1717
1074218 726 741 7160 7175 AGGGCTCCTGCAGTGC 70 1718
1074250 958 973 N/A N/A CTGATCGATGTGATTT 6 1719
1074282 1170 1185 79111 79126 CGAGGGTCAAGCCTTG 83 1720
1074314 1387 1402 102519 102534 ATTGATATTCCGCATT 12 1721
1074346 1534 1549 116723 116738 ATCTGAGCTATTGGTC 10 1722
1074378 1708 1723 122733 122748 GAAACGGTTCTGCTGT 31 1723
1074410 2041 2056 123066 123081 TAGAGGATTAAAGTAT 32 1724
1074442 2351 2366 123376 123391 GACCAGTAAATCATGT 21 1725
1074474 2662 2677 123687 123702 CCAACCCCCCCACCGA 71 1726
1074506 2807 2822 123832 123847 TAATCGAGATTTAAAT 107 1727
1074538 3049 3064 124074 124089 ATCCACAGTAATAGCT 31 1728
1074570 3192 3207 124217 124232 ATGAACCTACTCACTG 12 1729
1074602 3427 3442 124452 124467 TCCAGCTAACTCAAAA 24 1730
1074634 3777 3792 124802 124817 GCTGAGGCTTTTCATA 55 1731
1074666 4085 4100 125110 125125 CATATACCCAATTTTG 16 1732
1074698 4275 4290 125300 125315 TATCAAGGTCCCCCTA 78 1733
1074730 4463 4478 125488 125503 TATCACAGTACTGCTA 46 1734
1074762 4630 4645 125655 125670 GCTACCCAATACAACC 6 1735
1074794 4779 4794 125804 125819 CAAATCAATGTGCTCC 5 1736
1074826 5090 5105 126115 126130 AAATCCACCTGAGCAC 51 1737
1074858 5246 5261 126271 126286 AACATTGGTACTATAT 23 1738
1074890 N/A N/A 5456 5471 GAAGTTTAGCCTGAAG 58 1739
1074922 N/A N/A 5542 5557 CTTTCCACTCAAGTTA 87 1740
1074954 N/A N/A 5665 5680 CCGGGTTTTTGTCATC 91 1741
1074986 N/A N/A 126511 126526 CTACTGTAATCACCTT 78 1742
1075018 N/A N/A 6100 6115 CCTTAAAGTGATACAC 29 1743
1075050 N/A N/A 8047 8062 ACCCAACGGTCATGTT 94 1744
1075082 N/A N/A 10252 10267 CTTTAGATACAAGAGG 80 1745
1075114 N/A N/A 11805 11820 GTATAAATACCAGGTA 26 1746
1075146 N/A N/A 15570 15585 GTATTAAGGGATTTTC 8 1747
1075178 N/A N/A 17552 17567 CTGGAAGAAATTACCC 47 1748
1075210 N/A N/A 22314 22329 GTATTTTAACCTAAAC 100 1749
1075242 N/A N/A 25790 25805 CAGGGATAATTACTAA 7 1750
1075274 N/A N/A 28203 28218 AATAATCCAGCCTAGG 86 1751
1075306 N/A N/A 31622 31637 TAAACGAAACACGGGT 30 1752
1075338 N/A N/A 32572 32587 CCCAAAAACTAGCTTA 56 1753
1075370 N/A N/A 34931 34946 CTTACGAATCACATAT 32 1754
1075402 N/A N/A 36792 36807 GAGCAACACAAGCATA 45 1755
1075434 N/A N/A 39406 39421 GTAAAAGAGGTGCATC 96 1756
1075466 N/A N/A 41511 41526 TCCAAAAACCATCAGT 28 1757
1075498 N/A N/A 43505 43520 CATTATATAATGCAGG 9 1758
1075530 N/A N/A 45619 45634 GAAATCGAAGGGCAAA 30 1759
1075562 N/A N/A 47824 47839 GTATTTATGGCAACAT 15 1760
1075594 N/A N/A 49676 49691 TGAGAATATTCCTCCC 64 1761
1075626 N/A N/A 51926 51941 CATTAGCCAAAGCTCA 34 1762
1075658 N/A N/A 53595 53610 GTAAAAAACGGTTTTT 103 1763
1075690 N/A N/A 55750 55765 CGTTAACAACTATACA 33 1764
1075722 N/A N/A 58638 58653 GTTAAATACCTTCTAG 88 1765
1075754 N/A N/A 60230 60245 CTTAAATGGCACAGTT 20 1766
1075786 N/A N/A 62749 62764 CTATATTGATTCCAGA 19 1767
1075818 N/A N/A 65659 65674 CATAACTTAGAACCAT 35 1768
1075850 N/A N/A 68030 68045 CTATAGGTACTTAGAA N.D. 1769
1075882 N/A N/A 71422 71437 GAAAATCCTGATTAAC 73 1770
1075914 N/A N/A 75298 75313 ATTTAGGATGCCTTTA 14 1771
1075946 N/A N/A 77683 77698 GCTGAATAAGTAACTT 20 1772
1075978 N/A N/A 80966 80981 AGATTAAAAGTCGGGC 11 1773
1076010 N/A N/A 82396 82411 TATAAACAATAGCGAA 44 1774
1076042 N/A N/A 85704 85719 CTTAAGCAAGAGTCCA 35 1775
1076074 N/A N/A 88162 88177 CTAATTAGCTTTCAGC 92 1776
1076106 N/A N/A 90642 90657 CTACGAAATAGTAACT 77 1777
1076138 N/A N/A 92409 92424 AGCCAACAATTTTTGG 113 1778
1076170 N/A N/A 94131 94146 AGTAAAGAGTACTGTA 16 1779
1076202 N/A N/A 96470 96485 TCTAAAAAGACAGGGC 32 1780
1076234 N/A N/A 98304 98319 CCTTAATATATCCACA 24 1781
1076266 N/A N/A 101308 101323 ATTATTACCCAATAAC 72 1782
1076298 N/A N/A 103672 103687 GTTATAAAGACCCAAT 10 1783
1076330 N/A N/A 107154 107169 GAATTATACTGGCTAC 3 1784
1076362 N/A N/A 110095 110110 CCACTAAATAAAGCAG 16 1785
1076394 N/A N/A 111629 111644 CCTAAATTAGACTTGA 20 1786
1076426 N/A N/A 114176 114191 ACGGGAAAATTCTGGA 9 1787
1076458 N/A N/A 117825 117840 CTTAATTAGCCTCAGT 6 1788
1076490 N/A N/A 119886 119901 CCAAAATAGGTGAGTC 2 1789
1076522 N/A N/A 122448 122463 GCACTAAAGGAGTCAT 35 1790
1076554 N/A N/A 38773 38788 TGGGAATAGTGAATTT 30 1791

TABLE 25
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 1 810
1074123 140 155 3600 3615 GCTGCGAGGCACTCGG 72 1792
1074155 311 326 3771 3786 CCCGGCTCCACGGGCC 87 1793
1074187 439 454 3899 3914 CTGCGAAGGCGGCTGC 47 1794
1074219 730 745 7164 7179 AGTCAGGGCTCCTGCA 30 1795
1074251 959 974 N/A N/A TCTGATCGATGTGATT 7 1796
1074283 1174 1189 79115 79130 AAAACGAGGGTCAAGC 12 1797
1074315 1388 1403 102520 102535 GATTGATATTCCGCAT 3 1798
1074347 1546 1561 116735 116750 GTTAAGGAAAGGATCT 34 1799
1074379 1711 1726 122736 122751 TGGGAAACGGTTCTGC 20 1800
1074411 2095 2110 123120 123135 TGTGAAAGAGGTCAGC 3 1801
1074443 2354 2369 123379 123394 TCAGACCAGTAAATCA 7 1802
1074475 2663 2678 123688 123703 ACCAACCCCCCCACCG 72 1803
1074507 2808 2823 123833 123848 ATAATCGAGATTTAAA 74 1804
1074539 3051 3066 124076 124091 CTATCCACAGTAATAG 62 1805
1074571 3193 3208 124218 124233 TATGAACCTACTCACT 37 1806
1074603 3428 3443 124453 124468 TTCCAGCTAACTCAAA 17 1807
1074635 3783 3798 124808 124823 TCCCAAGCTGAGGCTT 31 1808
1074667 4107 4122 125132 125147 CCCAACAACATGCTAT 15 1809
1074699 4276 4291 125301 125316 CTATCAAGGTCCCCCT 27 1810
1074731 4467 4482 125492 125507 CAGGTATCACAGTACT 19 1811
1074763 4631 4646 125656 125671 TGCTACCCAATACAAC 25 1812
1074795 4780 4795 125805 125820 CCAAATCAATGTGCTC 4 1813
1074827 5092 5107 126117 126132 TAAAATCCACCTGAGC 39 1814
1074859 5248 5263 126273 126288 GTAACATTGGTACTAT 16 1815
1074891 N/A N/A 5457 5472 TGAAGTTTAGCCTGAA 31 1816
1074923 N/A N/A 5556 5571 GGGCGGTAACTCTTCT 73 1817
1074955 N/A N/A 5666 5681 CCCGGGTTTTTGTCAT 93 1818
1074987 N/A N/A 4228 4243 GCCGCGGCTCCCGAGC 94 1819
1075019 N/A N/A 6185 6200 CATTAGAGTTTGATTA 64 1820
1075051 N/A N/A 8055 8070 AATAAACAACCCAACG 56 1821
1075083 N/A N/A 10265 10280 CAACAACACTCCTCTT 54 1822
1075115 N/A N/A 11890 11905 GTATAGCCTTATTCTT 6 1823
1075147 N/A N/A 15583 15598 TATAAACCTTACAGTA 57 1824
1075179 N/A N/A 18169 18184 AATTAGCCGGTCCCAG 107 1825
1075211 N/A N/A 22668 22683 AATAAAGGGTCCTAAC 91 1826
1075243 N/A N/A 26237 26252 CTTAGTAAGAATTGTC 4 1827
1075275 N/A N/A 28517 28532 CTAGAAAGGCCATGTA 76 1828
1075307 N/A N/A 31624 31639 ATTAAACGAAACACGG 28 1829
1075339 N/A N/A 32573 32588 ACCCAAAAACTAGCTT 70 1830
1075371 N/A N/A 34942 34957 CTGCAAAAGTTCTTAC 90 1831
1075403 N/A N/A 36942 36957 CTTAATCAGGTACTAT 18 1832
1075435 N/A N/A 39516 39531 CTTAAACGATAAAGTA 93 1833
1075467 N/A N/A 41522 41537 CATTAATGCCATCCAA 60 1834
1075499 N/A N/A 43601 43616 GCTAAAAAATGAGTAG 99 1835
1075531 N/A N/A 45685 45700 CTTAATAGTTTAACCT 66 1836
1075563 N/A N/A 47947 47962 CCATATAACCAGTTTT 12 1837
1075595 N/A N/A 49869 49884 TATAATACATCTCCCC 50 1838
1075627 N/A N/A 51985 52000 ATAAGATAGTCGGTTC 19 1839
1075659 N/A N/A 53597 53612 AAGTAAAAAACGGTTT 125 1840
1075691 N/A N/A 55841 55856 CGTCAAAATTAACAGA 46 1841
1075723 N/A N/A 58758 58773 TTATCCTATCCCTGGT 32 1842
1075755 N/A N/A 60231 60246 ACTTAAATGGCACAGT 73 1843
1075787 N/A N/A 62761 62776 CTTAAGGATTGGCTAT 28 1844
1075819 N/A N/A 65672 65687 GTATATCCGTTCTCAT 2 1845
1075851 N/A N/A 68466 68481 GCCGAATATGGGAAAA 70 1846
1075883 N/A N/A 71454 71469 ACTAAAACCATTTGCC 20 1847
1075915 N/A N/A 75299 75314 AATTTAGGATGCCTTT 16 1848
1075947 N/A N/A 78266 78281 CTTTATAGGAATAGAG 95 1849
1075979 N/A N/A 81132 81147 CATAATCCACTATGCA 18 1850
1076011 N/A N/A 82397 82412 ATATAAACAATAGCGA 61 1851
1076043 N/A N/A 85727 85742 CAAAAAGGCTATTGAG 36 1852
1076075 N/A N/A 88209 88224 ACACAAGGGTTGCTAA 38 1853
1076107 N/A N/A 90801 90816 CATTACCAACTTCTTC 23 1854
1076139 N/A N/A 92416 92431 CGAAAAAAGCCAACAA 18 1855
1076171 N/A N/A 94134 94149 ATTAGTAAAGAGTACT 30 1856
1076203 N/A N/A 96576 96591 GTTAATACATGGCCAA 29 1857
1076235 N/A N/A 98318 98333 TCAAAATAATCAGCCC 34 1858
1076267 N/A N/A 101345 101360 ATTTAAGGTGCATAAG 13 1859
1076299 N/A N/A 103673 103688 CGTTATAAAGACCCAA 3 1860
1076331 N/A N/A 107265 107280 CATTATTCAGTAGTTG 71 1861
1076363 N/A N/A 110104 110119 CATAAAAGTCCACTAA 72 1862
1076395 N/A N/A 111649 111664 GTAACTAACCTAAGGA 34 1863
1076427 N/A N/A 114212 114227 CAAATTTACTGATCTC 3 1864
1076459 N/A N/A 117903 117918 CTTCAACAAGACAGGT 4 1865
1076491 N/A N/A 119888 119903 AGCCAAAATAGGTGAG 12 1866
1076523 N/A N/A 122559 122574 ATTTATATCAGGTCAA 5 1867
1076555 N/A N/A 74684 74699 TGGGAATAGTACACAG 19 1868

TABLE 26
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA   1  810
1074124  141  156   3601   3616 GGCTGCGAGGCACTCG  94 1869
1074156  329  344   3789   3804 AGGGCTACGCCCGGAC  96 1870
1074188  440  455   3900   3915 GCTGCGAAGGCGGCTG 113 1871
1074220  752  767   7186   7201 AATGAGCTCGAACATG  22 1872
1074252  997 1012  55492  55507 GGACAGCATGGCCTTC  50 1873
1074284 1175 1190  79116  79131 CAAAACGAGGGTCAAG  21 1874
1074316 1389 1404 102521 102536 GGATTGATATTCCGCA  33 1875
1074348 1578 1593 120483 120498 GTACTCTCATCTCGAG 100 1876
1074380 1714 1729 122739 122754 GTCTGGGAAACGGTTC  11 1877
1074412 2096 2111 123121 123136 CTGTGAAAGAGGTCAG  55 1878
1074444 2368 2383 123393 123408 ACATTTTTGGCTTGTC   3 1879
1074476 2685 2700 123710 123725 TTCCGACAAAACCAAC  18 1880
1074508 2818 2833 123843 123858 GAGAGAGCAGATAATC   7 1881
1074540 3052 3067 124077 124092 ACTATCCACAGTAATA  26 1882
1074572 3194 3209 124219 124234 TTATGAACCTACTCAC  17 1883
1074604 3446 3461 124471 124486 TTATTAATCTGATCAC  12 1884
1074636 3791 3806 124816 124831 ATCTATCTTCCCAAGC  56 1885
1074668 4108 4123 125133 125148 TCCCAACAACATGCTA  20 1886
1074700 4320 4335 125345 125360 GTAAGACAAGTCTTTA  26 1887
1074732 4468 4483 125493 125508 CCAGGTATCACAGTAC  30 1888
1074764 4632 4647 125657 125672 ATGCTACCCAATACAA  18 1889
1074796 4782 4797 125807 125822 CTCCAAATCAATGTGC  22 1890
1074828 5093 5108 126118 126133 ATAAAATCCACCTGAG  58 1891
1074860 5252 5267 126277 126292 AAAGGTAACATTGGTA   9 1892
1074892 N/A N/A   5458   5473 CTGAAGTTTAGCCTGA  42 1893
1074924 N/A N/A   5585   5600 CCTGCAAATAGGAGAG  87 1894
1074956 N/A N/A   5667   5682 ACCCGGGTTTTTGTCA 104 1895
1074988 N/A N/A   4324   4339 ACCGCGGCGGAGTGGA  94 1896
1075020 N/A N/A   6193   6208 TTAATTAGCATTAGAG  30 1897
1075052 N/A N/A   8204   8219 ATATATACTTGATCCA   3 1898
1075084 N/A N/A  10268  10283 TGACAACAACACTCCT   9 1899
1075116 N/A N/A  11969  11984 CTTAACATTTAATGGC  15 1900
1075148 N/A N/A  16000  16015 CGGAAAAAACACCTAG  66 1901
1075180 N/A N/A  18759  18774 TATTACTACAACCATA  56 1902
1075212 N/A N/A  22669  22684 CAATAAAGGGTCCTAA  76 1903
1075244 N/A N/A  26292  26307 ACCCAAAAATTCTGTG  76 1904
1075276 N/A N/A  28647  28662 GACCAATACAATGGGA  78 1905
1075308 N/A N/A  31625  31640 AATTAAACGAAACACG  97 1906
1075340 N/A N/A  32580  32595 CCCGAACACCCAAAAA 103 1907
1075372 N/A N/A  34997  35012 ATATATAGACTTGAGA  27 1908
1075404 N/A N/A  37268  37283 ATATAACCTGAACTAA 102 1909
1075436 N/A N/A  39517  39532 CCTTAAACGATAAAGT  89 1910
1075468 N/A N/A  41570  41585 CACCAATACTGAGTAT  91 1911
1075500 N/A N/A  43668  43683 TAAATTAAGCCAACAC  26 1912
1075532 N/A N/A  45686  45701 ACTTAATAGTTTAACC 121 1913
1075564 N/A N/A  48028  48043 ATATAACAGGCCACCA  81 1914
1075596 N/A N/A  49870  49885 ATATAATACATCTCCC  91 1915
1075628 N/A N/A  52040  52055 CCGCAAAATATTAATT 118 1916
1075660 N/A N/A  53599  53614 CAAAGTAAAAAACGGT  72 1917
1075692 N/A N/A  55999  56014 TAAGAACACCATAGCA  11 1918
1075724 N/A N/A  58769  58784 CTATCTGTCAGTTATC  44 1919
1075756 N/A N/A  60243  60258 ATTTACCCTGCCACTT  49 1920
1075788 N/A N/A  62762  62777 TCTTAAGGATTGGCTA  15 1921
1075820 N/A N/A  65896  65911 TCTGAACGGGCTGTTG  27 1922
1075852 N/A N/A  68471  68486 GATAAGCCGAATATGG  58 1923
1075884 N/A N/A  71468  71483 ATTAGTAATGACTAAC 116 1924
1075916 N/A N/A  75300  75315 CAATTTAGGATGCCTT   6 1925
1075948 N/A N/A  78306  78321 GGACTAAAGAATACAG  31 1926
1075980 N/A N/A  81219  81234 CAATATCCTACACCAT  43 1927
1076012 N/A N/A  82398  82413 AATATAAACAATAGCG  34 1928
1076044 N/A N/A  85729  85744 ATCAAAAAGGCTATTG  73 1929
1076076 N/A N/A  88372  88387 TATCAATACTTTAGTC  57 1930
1076108 N/A N/A  90863  90878 AAACAAAACCGGCTTT 116 1931
1076140 N/A N/A  92417  92432 ACGAAAAAAGCCAACA  28 1932
1076172 N/A N/A  94135  94150 TATTAGTAAAGAGTAC   98 1933
1076204 N/A N/A  96620  96635 GATAATGAATCCTTGT 11 1934
1076236 N/A N/A  98440  98455 GGAGAACCTTATTTAT  51 1935
1076268 N/A N/A 101514 101529 GTACAATAATGCTTCC  10 1936
1076300 N/A N/A 103687 103702 AAAAAATGGCTTCACG  22 1937
1076332 N/A N/A 107285 107300 TATAAGGAATGGCAAC 107 1938
1076364 N/A N/A 110105 110120 CCATAAAAGTCCACTA  30 1939
1076396 N/A N/A 111672 111687 CTATATTTGAGCCATG   2 1940
1076428 N/A N/A 114406 114421 ATTAAAAAGAAGCACG  53 1941
1076460 N/A N/A 117914 117929 TAATATAGCCCCTTCA   7 1942
1076492 N/A N/A 120180 120195 AAAAGATACCCCCAGT  47 1943
1076524 N/A N/A 122560 122575 AATTTATATCAGGTCA   6 1944
1076556 N/A N/A 116991 117006 GTATAGGCAGAAGCAA   9 1945

TABLE 27
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA   2  810
1074125  160  175   3620   3635 GCGGCTGCGCCTCGGG  94 1946
1074157  333  348   3793   3808 AGCGAGGGCTACGCCC 103 1947
1074189  441  456   3901   3916 GGCTGCGAAGGCGGCT  96 1948
1074221  753  768   7187   7202 GAATGAGCTCGAACAT   6 1949
1074253 1001 1016  55496  55511 TCTGGGACAGCATGGC  11 1950
1074285 1176 1191 N/A N/A GCAAAACGAGGGTCAA  17 1951
1074317 1406 1421 102538 102553 GAGAATTTGCTGTGCT  12 1952
1074349 1580 1595 120485 120500 CTGTACTCTCATCTCG  30 1953
1074381 1715 1730 122740 122755 AGTCTGGGAAACGGTT  16 1954
1074413 2097 2112 123122 123137 ACTGTGAAAGAGGTCA   4 1955
1074445 2471 2486 123496 123511 TGATAGCACTAGGAGG   6 1956
1074477 2686 2701 123711 123726 GTTCCGACAAAACCAA  10 1957
1074509 2850 2865 123875 123890 TGTTATGTTTGGGTGT   5 1958
1074541 3053 3068 124078 124093 CACTATCCACAGTAAT  23 1959
1074573 3195 3210 124220 124235 ATTATGAACCTACTCA  14 1960
1074605 3464 3479 124489 124504 TCAACTACCAATATAC  20 1961
1074637 3792 3807 124817 124832 AATCTATCTTCCCAAG  36 1962
1074669 4109 4124 125134 125149 ATCCCAACAACATGCT  13 1963
1074701 4322 4337 125347 125362 GTGTAAGACAAGTCTT  17 1964
1074733 4469 4484 125494 125509 GCCAGGTATCACAGTA  47 1965
1074765 4634 4649 125659 125674 CAATGCTACCCAATAC  34 1966
1074797 4783 4798 125808 125823 ACTCCAAATCAATGTG  31 1967
1074829 5095 5110 126120 126135 GGATAAAATCCACCTG  92 1968
1074861 5279 5294 126304 126319 TGCTCTTACATCTAAA  23 1969
1074893 N/A N/A   5459   5474 GCTGAAGTTTAGCCTG  78 1970
1074925 N/A N/A   5586   5601 GCCTGCAAATAGGAGA  94 1971
1074957 N/A N/A   5668   5683 AACCCGGGTTTTTGTC 102 1972
1074989 N/A N/A   4423   4438 GAGGGAAAGCACGCCC 105 1973
1075021 N/A N/A   6245   6260 TTACAACCTAGATTTG  68 1974
1075053 N/A N/A   8205   8220 AATATATACTTGATCC   4 1975
1075085 N/A N/A  10318  10333 TGCGGAAACAAGTGTA  11 1976
1075117 N/A N/A  12081  12096 CCTCAATAGCAAGACA  48 1977
1075149 N/A N/A  16001  16016 GCGGAAAAAACACCTA  50 1978
1075181 N/A N/A  18762  18777 TTATATTACTACAACC  15 1979
1075213 N/A N/A  22670  22685 ACAATAAAGGGTCCTA  33 1980
1075245 N/A N/A  26692  26707 CCTAATATGCTATTGT  34 1981
1075277 N/A N/A  28762  28777 TTATAAGAACTGTGGC  13 1982
1075309 N/A N/A  31626  31641 TAATTAAACGAAACAC 110 1983
1075341 N/A N/A  32592  32607 GCTGAACAATCTCCCG  31 1984
1075373 N/A N/A  34998  35013 TATATATAGACTTGAG  13 1985
1075405 N/A N/A  37270  37285 CTATATAACCTGAACT  84 1986
1075437 N/A N/A  39572  39587 TATTAGTACGAGCTAC  85 1987
1075469 N/A N/A  41723  41738 TGATATAATGACCAAG  25 1988
1075501 N/A N/A  43670  43685 CATAAATTAAGCCAAC  67 1989
1075533 N/A N/A  45730  45745 GATTACTCAGCTATGT  65 1990
1075565 N/A N/A  48029  48044 TATATAACAGGCCACC  52 1991
1075597 N/A N/A  49954  49969 ATTAACATTTGCCCGC  47 1992
1075629 N/A N/A  52041  52056 GCCGCAAAATATTAAT 100 1993
1075661 N/A N/A  53794  53809 GAATAGGATACAAGCA  74 1994
1075693 N/A N/A  56014  56029 CATTAAAAGTTGGGTT  36 1995
1075725 N/A N/A  58772  58787 ATCCTATCTGTCAGTT  18 1996
1075757 N/A N/A  60324  60339 CTTAATACATTATTCC   2 1997
1075789 N/A N/A  62993  63008 AATTACAAGCTAATGC  79 1998
1075821 N/A N/A  66155  66170 CTTAACTTCCCACTCG  22 1999
1075853 N/A N/A  68653  68668 GAGCGATAAGCTGTAT  72 2000
1075885 N/A N/A  71469  71484 CATTAGTAATGACTAA 112 2001
1075917 N/A N/A  75472  75487 AGCAAAAAGTGATATG  55 2002
1075949 N/A N/A  78635  78650 TAGGAACACCAAGGTT  48 2003
1075981 N/A N/A  81222  81237 AAGCAATATCCTACAC  40 2004
1076013 N/A N/A  82644  82659 GTTTAATACCTCTGAC  76 2005
1076045 N/A N/A  85776  85791 GTGCAATAAATAGTTC  11 2006
1076077 N/A N/A  88420  88435 GGATTAAAGTTTTCAC   5 2007
1076109 N/A N/A  91026  91041 CTTAAATGACCAATTC  23 2008
1076141 N/A N/A  92418  92433 TACGAAAAAAGCCAAC  29 2009
1076173 N/A N/A  94244  94259 CAATATATCCTGAGAT  91 2010
1076205 N/A N/A  96783  96798 TAGTATAATTCATGAC  51 2011
1076237 N/A N/A  98456  98471 ACTAAAGGACAAAGGT 109 2012
1076269 N/A N/A 101560 101575 GACGAAAAATATTCTT  28 2013
1076301 N/A N/A 104195 104210 GTATAAGACCTTGGGA  34 2014
1076333 N/A N/A 107286 107301 CTATAAGGAATGGCAA  97 2015
1076365 N/A N/A 110141 110156 TAAGAAGGGCCAATGG  15 2016
1076397 N/A N/A 111675 111690 AACCTATATTTGAGCC   4 2017
1076429 N/A N/A 114456 114471 CATTACAAGCATAGGC  26 2018
1076461 N/A N/A 117917 117932 GATTAATATAGCCCCT   3 2019
1076493 N/A N/A 120197 120212 TGACAATAAGGGACAA  34 2020
1076525 N/A N/A 122561 122576 GAATTTATATCAGGTC   3 2021
1076557 N/A N/A  55411  55426 AACAAATACCAGGTTC 111 2022

TABLE 28
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA   2  810
1074126  163  178   3623   3638 CTGGCGGCTGCGCCTC 111 2023
1074158  334  349   3794   3809 GAGCGAGGGCTACGCC  72 2024
1074190  463  478   3923   3938 CGGCGGGCCCTGCCCC 114 2025
1074222  755  770   7189   7204 AGGAATGAGCTCGAAC   5 2026
1074254 1002 1017  55497  55512 ATCTGGGACAGCATGG  13 2027
1074286 1193 1208  98895  98910 TGATTCTCTGGTTCAT  32 2028
1074318 1407 1422 102539 102554 GGAGAATTTGCTGTGC   4 2029
1074350 1591 1606 120496 120511 TAGTCCACTGTCTGTA  14 2030
1074382 1719 1734 122744 122759 AGGTAGTCTGGGAAAC   8 2031
1074414 2098 2113 123123 123138 AACTGTGAAAGAGGTC   6 2032
1074446 2472 2487 123497 123512 ATGATAGCACTAGGAG   3 2033
1074478 2691 2706 123716 123731 CCTAGGTTCCGACAAA  69 2034
1074510 2878 2893 123903 123918 ATACATTCCACTACCA  10 2035
1074542 3056 3071 124081 124096 AGGCACTATCCACAGT  21 2036
1074574 3196 3211 124221 124236 CATTATGAACCTACTC  17 2037
1074606 3500 3515 124525 124540 GGTATAATCATGATTA   4 2038
1074638 3816 3831 124841 124856 AGATTTTGTAATTGGG   2 2039
1074670 4141 4156 125166 125181 AAGTAGCTTTGATCTT  49 2040
1074702 4323 4338 125348 125363 GGTGTAAGACAAGTCT  16 2041
1074734 4470 4485 125495 125510 TGCCAGGTATCACAGT  51 2042
1074766 4638 4653 125663 125678 ATCCCAATGCTACCCA   8 2043
1074798 4800 4815 125825 125840 GCTTTGGAAGATCTGA   4 2044
1074830 5097 5112 126122 126137 GAGGATAAAATCCACC  89 2045
1074862 5287 5302 126312 126327 TATGAGCATGCTCTTA  56 2046
1074894 N/A N/A   5460   5475 TGCTGAAGTTTAGCCT  79 2047
1074926 N/A N/A   5592   5607 CAACAGGCCTGCAAAT 111 2048
1074958 N/A N/A   5669   5684 TAACCCGGGTTTTTGT 107 2049
1074990 N/A N/A   4687   4702 GCCGCAAAGGAAAGGG 108 2050
1075022 N/A N/A   6247   6262 ATTTACAACCTAGATT  91 2051
1075054 N/A N/A   8206   8221 CAATATATACTTGATC  48 2052
1075086 N/A N/A  10392  10407 AGTTATAGACTTTGTA  25 2053
1075118 N/A N/A  12281  12296 CTATTTACTCTGTCAC   4 2054
1075150 N/A N/A  16002  16017 AGCGGAAAAAACACCT  35 2055
1075182 N/A N/A  18766  18781 GATATTATATTACTAC  61 2056
1075214 N/A N/A  22671  22686 AACAATAAAGGGTCCT  45 2057
1075246 N/A N/A  26760  26775 GATAACTAGTAACCGT   6 2058
1075278 N/A N/A  28866  28881 TATACTAACATTCACG  48 2059
1075310 N/A N/A  31627  31642 GTAATTAAACGAAACA  84 2060
1075342 N/A N/A  32636  32651 ACTAAAAGGGAGTAGG  87 2061
1075374 N/A N/A  35122  35137 GAAAATACTCCTCCTA  27 2062
1075406 N/A N/A  37271  37286 ACTATATAACCTGAAC  99 2063
1075438 N/A N/A  39657  39672 CATATTAGAGTTGAGG  22 2064
1075470 N/A N/A  41860  41875 GCCAATAAGTTATCAA  50 2065
1075502 N/A N/A  44236  44251 CTTAACATGATTCTAG  61 2066
1075534 N/A N/A  45787  45802 ACCCAAGGACAGCACA  53 2067
1075566 N/A N/A  48030  48045 ATATATAACAGGCCAC  50 2068
1075598 N/A N/A  49955  49970 AATTAACATTTGCCCG  62 2069
1075630 N/A N/A  52052  52067 TATAACCAAATGCCGC  60 2070
1075662 N/A N/A  53888  53903 AAGGGATACAAGTGTT  78 2071
1075694 N/A N/A  56015  56030 ACATTAAAAGTTGGGT  11 2072
1075726 N/A N/A  58776  58791 AGTTATCCTATCTGTC  14 2073
1075758 N/A N/A  60403  60418 GTAATTTAATAGACTA  73 2074
1075790 N/A N/A  63026  63041 TCAGAAGAACTCCCAT  14 2075
1075822 N/A N/A  66205  66220 CTTAGTAATTGCCCAT  35 2076
1075854 N/A N/A  68837  68852 CTTATAATAGAGCTAA  52 2077
1075886 N/A N/A  71526  71541 CATAACACTGAAGGTG  60 2078
1075918 N/A N/A  75510  75525 CTTAAACTAACTGTTG  82 2079
1075950 N/A N/A  78649  78664 TGACAATACCTTCCTA  30 2080
1075982 N/A N/A  81227  81242 CATGAAAGCAATATCC  23 2081
1076014 N/A N/A  82658  82673 AATCAACCTATGAGGT  98 2082
1076046 N/A N/A  85784  85799 CTTAAATGGTGCAATA  28 2083
1076078 N/A N/A  89187  89202 CTTTAGCCTCTATACC  23 2084
1076110 N/A N/A  91091  91106 CTTTACCTAAATGTTG  53 2085
1076142 N/A N/A  92419  92434 ATACGAAAAAAGCCAA  38 2086
1076174 N/A N/A  94299  94314 GATATATGGTAGCATA   3 2087
1076206 N/A N/A  96835  96850 CAATAAACTTACCCTT  55 2088
1076238 N/A N/A  98513  98528 GATGAATAGCTAAGAA  30 2089
1076270 N/A N/A 101571 101586 TAACAATAGTAGACGA  28 2090
1076302 N/A N/A 104337 104352 AATAAGCCTCACCTTT  74 2091
1076334 N/A N/A 107288 107303 ACCTATAAGGAATGGC 108 2092
1076366 N/A N/A 110167 110182 ATTTACATGAGAGGAG   4 2093
1076398 N/A N/A 111707 111722 CTTGAAGGGCTATGGA  62 2094
1076430 N/A N/A 114752 114767 CGTTATAAGATGTGCT   4 2095
1076462 N/A N/A 117971 117986 TCAGAAGGATATGCAG   6 2096
1076494 N/A N/A 120254 120269 CTAATTGAAGCTGGCA   3 2097
1076526 N/A N/A 102684 102699 GTAGAAAGATGGCTCA   3 2098
1076558 N/A N/A  82852  82867 GCCAAATATTTAACTC  30 2099

TABLE 29
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA   2  810
1074127  171  186   3631   3646 CCACTGGTCTGGCGGC  57 2100
1074159  335  350   3795   3810 CGAGCGAGGGCTACGC  77 2101
1074191  464  479   3924   3939 ACGGCGGGCCCTGCCC  80 2102
1074223  786  801   7220   7235 GAAACAGCTCCCAACT  48 2103
1074255 1004 1019  55499  55514 TCATCTGGGACAGCAT  16 2104
1074287 1195 1210  98897  98912 ACTGATTCTCTGGTTC  11 2105
1074319 1425 1440 N/A N/A GCTAACTCCTGACATT  47 2106
1074351 1596 1611 120501 120516 ATGCTTAGTCCACTGT   7 2107
1074383 1722 1737 122747 122762 TCAAGGTAGTCTGGGA  40 2108
1074415 2101 2116 123126 123141 GCCAACTGTGAAAGAG  10 2109
1074447 2473 2488 123498 123513 AATGATAGCACTAGGA   4 2110
1074479 2697 2712 123722 123737 CATTTGCCTAGGTTCC   2 2111
1074511 2879 2894 123904 123919 GATACATTCCACTACC   9 2112
1074543 3059 3074 124084 124099 CCTAGGCACTATCCAC  57 2113
1074575 3197 3212 124222 124237 ACATTATGAACCTACT  14 2114
1074607 3502 3517 124527 124542 AAGGTATAATCATGAT   4 2115
1074639 3817 3832 124842 124857 TAGATTTTGTAATTGG   3 2116
1074671 4142 4157 125167 125182 CAAGTAGCTTTGATCT   8 2117
1074703 4324 4339 125349 125364 CGGTGTAAGACAAGTC  16 2118
1074735 4483 4498 125508 125523 GATCAAAGCACTGTGC 117 2119
1074767 4640 4655 125665 125680 TTATCCCAATGCTACC  12 2120
1074799 4801 4816 125826 125841 TGCTTTGGAAGATCTG   8 2121
1074831 5098 5113 126123 126138 CGAGGATAAAATCCAC  35 2122
1074863 5288 5303 126313 126328 ATATGAGCATGCTCTT  41 2123
1074895 N/A N/A   5465   5480 TCCTATGCTGAAGTTT  60 2124
1074927 N/A N/A   5594   5609 TACAACAGGCCTGCAA  74 2125
1074959 N/A N/A   5670   5685 TTAACCCGGGTTTTTG 128 2126
1074991 N/A N/A   4727   4742 AATTATTTGACTCCCC  60 2127
1075023 N/A N/A   6249   6264 GTATTTACAACCTAGA  18 2128
1075055 N/A N/A   8271   8286 CTATTAAGTGAGCTTT   4 2129
1075087 N/A N/A  10400  10415 TCTCAATAAGTTATAG  39 2130
1075119 N/A N/A  12305  12320 AGGGAATATGTTAATC   8 2131
1075151 N/A N/A  16014  16029 TTTAAAAGTACCAGCG  60 2132
1075183 N/A N/A  18905  18920 ATTACTAAGACAGTGG  15 2133
1075215 N/A N/A  22672  22687 AAACAATAAAGGGTCC  44 2134
1075247 N/A N/A  26764  26779 CTAAGATAACTAGTAA 101 2135
1075279 N/A N/A  28867  28882 CTATACTAACATTCAC  52 2136
1075311 N/A N/A  31628  31643 AGTAATTAAACGAAAC 100 2137
1075343 N/A N/A  32637  32652 AACTAAAAGGGAGTAG  89 2138
1075375 N/A N/A  35237  35252 CTAAATATCAACTCCC  35 2139
1075407 N/A N/A  37273  37288 GAACTATATAACCTGA  32 2140
1075439 N/A N/A  39815  39830 AATTAGAGATATGGAC  77 2141
1075471 N/A N/A  41861  41876 AGCCAATAAGTTATCA  55 2142
1075503 N/A N/A  44248  44263 GCTGAAAAAGGGCTTA  66 2143
1075535 N/A N/A  45791  45806 AATTACCCAAGGACAG  53 2144
1075567 N/A N/A  48031  48046 GATATATAACAGGCCA  65 2145
1075599 N/A N/A  49979  49994 ACCCTATAGCTTTAGG  90 2146
1075631 N/A N/A  52055  52070 CCCTATAACCAAATGC 104 2147
1075663 N/A N/A  53926  53941 CTAAATAGGTGGTTAT  80 2148
1075695 N/A N/A  56025  56040 GAATAACACCACATTA  30 2149
1075727 N/A N/A  58798  58813 TTATCGGAGGCTTCGC  31 2150
1075759 N/A N/A  60742  60757 CCTTATAAATTATGAC  44 2151
1075791 N/A N/A  63059  63074 CTTTATCAGCCATCAC  10 2152
1075823 N/A N/A  66222  66237 TATTAGAGGTTCCAGG  30 2153
1075855 N/A N/A  68937  68952 GATTTTTAGGCAGACG   7 2154
1075887 N/A N/A  71602  71617 TATTACTTGATTGACA  10 2155
1075919 N/A N/A  75511  75526 TCTTAAACTAACTGTT  78 2156
1075951 N/A N/A  78699  78714 CACGGAAGAGCTTGCA  34 2157
1075983 N/A N/A  81249  81264 ATCGAAAAGCAAACTC   5 2158
1076015 N/A N/A  82981  82996 ATTTAGTTGGTTGTTA   8 2159
1076047 N/A N/A  85785  85800 ACTTAAATGGTGCAAT  34 2160
1076079 N/A N/A  89467  89482 AAGCAATATATGGCCT  37 2161
1076111 N/A N/A  91203  91218 AATTAGTTAGGATATC  67 2162
1076143 N/A N/A  92420  92435 GATACGAAAAAAGCCA   8 2163
1076175 N/A N/A  94392  94407 CAATAGGTAACAGGTA  15 2164
1076207 N/A N/A  96838  96853 AGTCAATAAACTTACC  58 2165
1076239 N/A N/A  98583  98598 GTTTAAAAAAAACGGG  75 2166
1076271 N/A N/A 101685 101700 CGGCAACAACAAAATG  18 2167
1076303 N/A N/A 104339 104354 CTAATAAGCCTCACCT  34 2168
1076335 N/A N/A 107289 107304 CACCTATAAGGAATGG  80 2169
1076367 N/A N/A 110169 110184 CTATTTACATGAGAGG   3 2170
1076399 N/A N/A 111771 111786 GATAACTTAGAGATGT   4 2171
1076431 N/A N/A 114853 114868 CACCAATAGAACATAT  31 2172
1076463 N/A N/A 118082 118097 GATTAGTAACACTGAT  38 2173
1076495 N/A N/A 120353 120368 GATTAGTGAAAATTCC  30 2174
1076527 N/A N/A 117218 117233 GCACAACCTTACATTT   6 2175
1076559 N/A N/A 111532 111547 AACAAATATAGTTAGC  74 2176

TABLE 30
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA   1  810
1074128  173  188   3633   3648 CTCCACTGGTCTGGCG  76 2177
1074160  336  351   3796   3811 GCGAGCGAGGGCTACG  86 2178
1074192  465  480   3925   3940 GACGGCGGGCCCTGCC 108 2179
1074224  821  836   7255   7270 CAGAGACTACTCCAGT  16 2180
1074256 1033 1048  55528  55543 CACTGGTGGACTGGTG  64 2181
1074288 1196 1211  98898  98913 GACTGATTCTCTGGTT  48 2182
1074320 1426 1441 N/A N/A GGCTAACTCCTGACAT  80 2183
1074352 1597 1612 120502 120517 CATGCTTAGTCCACTG  69 2184
1074384 1723 1738 122748 122763 TTCAAGGTAGTCTGGG  35 2185
1074416 2108 2123 123133 123148 CTTTAGAGCCAACTGT   9 2186
1074448 2474 2489 123499 123514 TAATGATAGCACTAGG   3 2187
1074480 2698 2713 123723 123738 TCATTTGCCTAGGTTC   3 2188
1074512 2880 2895 123905 123920 GGATACATTCCACTAC  64 2189
1074544 3063 3078 124088 124103 CTCCCCTAGGCACTAT  34 2190
1074576 3201 3216 124226 124241 ATGCACATTATGAACC   7 2191
1074608 3529 3544 124554 124569 GTTACATCATCTCTTC   5 2192
1074640 3828 3843 124853 124868 GCCAAAATACTTAGAT  26 2193
1074672 4143 4158 125168 125183 CCAAGTAGCTTTGATC   6 2194
1074704 4326 4341 125351 125366 CACGGTGTAAGACAAG  16 2195
1074736 4504 4519 125529 125544 TCAGTACAGAGGGCAT   4 2196
1074768 4641 4656 125666 125681 CTTATCCCAATGCTAC  11 2197
1074800 4808 4823 125833 125848 CAAATAGTGCTTTGGA   6 2198
1074832 5099 5114 126124 126139 GCGAGGATAAAATCCA  17 2199
1074864 5289 5304 126314 126329 CATATGAGCATGCTCT  47 2200
1074896 N/A N/A   5472   5487 GCAAAGTTCCTATGCT  99 2201
1074928 N/A N/A   5595   5610 ATACAACAGGCCTGCA  83 2202
1074960 N/A N/A   5671   5686 CTTAACCCGGGTTTTT  81 2203
1074992 N/A N/A   4728   4743 CAATTATTTGACTCCC  63 2204
1075024 N/A N/A   6368   6383 ACTGAACAAGTATCTT  32 2205
1075056 N/A N/A   8297   8312 CTTTATTATCTCAACC  21 2206
1075088 N/A N/A  10433  10448 ATTTATAGTCAGGTTC   2 2207
1075120 N/A N/A  12519  12534 AATTAGCCTACCACCT  42 2208
1075152 N/A N/A  16101  16116 TATAATGGGAGGATTA  99 2209
1075184 N/A N/A  18998  19013 CAAGAACACTGGTATT  67 2210
1075216 N/A N/A  23247  23262 TATTTTACACGAACTA  55 2211
1075248 N/A N/A  26930  26945 GTACAAAAAGCGGTCG  64 2212
1075280 N/A N/A  28870  28885 GAACTATACTAACATT  57 2213
1075312 N/A N/A  31662  31677 TTAATTGAACTCAGGG  37 2214
1075344 N/A N/A  32638  32653 TAACTAAAAGGGAGTA  91 2215
1075376 N/A N/A  35238  35253 CCTAAATATCAACTCC  72 2216
1075408 N/A N/A  37387  37402 CTAAAATGGCATAAGG  23 2217
1075440 N/A N/A  39843  39858 AAATTATTAGTTGTCG  28 2218
1075472 N/A N/A  41890  41905 GATTATAGTTAAACAG  92 2219
1075504 N/A N/A  44291  44306 CTTAAATGAGAGAACC  71 2220
1075536 N/A N/A  45793  45808 TTAATTACCCAAGGAC  55 2221
1075568 N/A N/A  48108  48123 TTATTTAAGTTGGGAG  23 2222
1075600 N/A N/A  49991  50006 CACTATAATCTGACCC  68 2223
1075632 N/A N/A  52056  52071 TCCCTATAACCAAATG  95 2224
1075664 N/A N/A  53927  53942 GCTAAATAGGTGGTTA  87 2225
1075696 N/A N/A  56066  56081 TTACAAAAGTTACTGC  28 2226
1075728 N/A N/A  58800  58815 CTTTATCGGAGGCTTC  15 2227
1075760 N/A N/A  61106  61121 GAGAAAAACTACGGAT  39 2228
1075792 N/A N/A  63072  63087 GATTAGAAAGTGCCTT   6 2229
1075824 N/A N/A  66223  66238 GTATTAGAGGTTCCAG   3 2230
1075856 N/A N/A  68965  68980 CCTAATCAAGTTCTGC  40 2231
1075888 N/A N/A  71648  71663 ACTTAAACTTGAGGGA  22 2232
1075920 N/A N/A  75749  75764 AAAGAAAGCTGCGCAC 108 2233
1075952 N/A N/A  78848  78863 CTATATACCTGCTTCT  41 2234
1075984 N/A N/A  81250  81265 TATCGAAAAGCAAACT  44 2235
1076016 N/A N/A  83002  83017 TAATAGGATGGATTCT   8 2236
1076048 N/A N/A  85859  85874 GATTAAAGGCTGGAAG  32 2237
1076080 N/A N/A  89574  89589 CATTAGCAGTTCACTA  55 2238
1076112 N/A N/A  91226  91241 ATTCAAAACCACGGAA  98 2239
1076144 N/A N/A  92435  92450 TTTTATAGGGCAATGG   7 2240
1076176 N/A N/A  94395  94410 CTCCAATAGGTAACAG  43 2241
1076208 N/A N/A  97037  97052 GAGGAATATTACAGAC  15 2242
1076240 N/A N/A  98611  98626 ATTAAAAGCAAGGTGC  56 2243
1076272 N/A N/A 101702 101717 TTAGAACAACTACTAC  53 2244
1076304 N/A N/A 104340 104355 ACTAATAAGCCTCACC  30 2245
1076336 N/A N/A 107295 107310 CATTACCACCTATAAG  31 2246
1076368 N/A N/A 110251 110266 CATTTTATGTAAGGCC  15 2247
1076400 N/A N/A 111869 111884 GTTAAAAGCCGTGAAA  10 2248
1076432 N/A N/A 114880 114895 CATTAGTATTCACTGT  18 2249
1076464 N/A N/A 118102 118117 CATATACAATTCTGCC   2 2250
1076496 N/A N/A 120437 120452 GTTAAAGACCAACACA  81 2251
1076528 N/A N/A  16102  16117 TTATAATGGGAGGATT  86 2252
1076560 N/A N/A 113259 113274 TCCAAATATGGCATAC  10 2253

TABLE 31
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA   1  810
1074129  178  193   3638   3653 CCCGGCTCCACTGGTC  77 2254
1074161  337  352   3797   3812 GGCGAGCGAGGGCTAC  98 2255
1074193  471  486   3931   3946 GGTCCGGACGGCGGGC  74 2256
1074225  822  837   7256   7271 CCAGAGACTACTCCAG  11 2257
1074257 1034 1049  55529  55544 GCACTGGTGGACTGGT  29 2258
1074289 1197 1212  98899  98914 TGACTGATTCTCTGGT  13 2259
1074321 1427 1442 N/A N/A GGGCTAACTCCTGACA  73 2260
1074353 1612 1627 120517 120532 GACACTGTAGCTGCTC  17 2261
1074385 1724 1739 122749 122764 CTTCAAGGTAGTCTGG  17 2262
1074417 2109 2124 123134 123149 TCTTTAGAGCCAACTG   2 2263
1074449 2475 2490 123500 123515 CTAATGATAGCACTAG  36 2264
1074481 2705 2720 123730 123745 AATATGGTCATTTGCC  14 2265
1074513 2881 2896 123906 123921 AGGATACATTCCACTA  47 2266
1074545 3064 3079 124089 124104 ACTCCCCTAGGCACTA  18 2267
1074577 3211 3226 124236 124251 TATTTCTGTCATGCAC   3 2268
1074609 3532 3547 124557 124572 CTAGTTACATCATCTC   8 2269
1074641 3829 3844 124854 124869 GGCCAAAATACTTAGA 107 2270
1074673 4154 4169 125179 125194 AGGCACTCCTTCCAAG  43 2271
1074705 4327 4342 125352 125367 GCACGGTGTAAGACAA  20 2272
1074737 4510 4525 125535 125550 TTCAGGTCAGTACAGA   7 2273
1074769 4642 4657 125667 125682 TCTTATCCCAATGCTA  12 2274
1074801 4809 4824 125834 125849 ACAAATAGTGCTTTGG   8 2275
1074833 5100 5115 126125 126140 TGCGAGGATAAAATCC  17 2276
1074865 5290 5305 126315 126330 ACATATGAGCATGCTC  46 2277
1074897 N/A N/A   5473   5488 GGCAAAGTTCCTATGC  76 2278
1074929 N/A N/A   5596   5611 TATACAACAGGCCTGC  79 2279
1074961 N/A N/A   5676   5691 TCCTCCTTAACCCGGG  93 2280
1074993 N/A N/A   4755   4770 TCTAATCAACACTGGA  65 2281
1075025 N/A N/A   6468   6483 ACTTAAGAACTCACAC  58 2282
1075057 N/A N/A   8351   8366 CCTTAGGAGTAGACTG  14 2283
1075089 N/A N/A  10434  10449 CATTTATAGTCAGGTT   2 2284
1075121 N/A N/A  12521  12536 AAAATTAGCCTACCAC  40 2285
1075153 N/A N/A  16103  16118 ATTATAATGGGAGGAT  38 2286
1075185 N/A N/A  19001  19016 GCCCAAGAACACTGGT  78 2287
1075217 N/A N/A  23248  23263 TTATTTTACACGAACT  71 2288
1075249 N/A N/A  27029  27044 ATTACGATTAGATCAG   5 2289
1075281 N/A N/A  29105  29120 CAGCAAAAGTACCATG  36 2290
1075313 N/A N/A  31663  31678 CTTAATTGAACTCAGG  28 2291
1075345 N/A N/A  32639  32654 GTAACTAAAAGGGAGT  29 2292
1075377 N/A N/A  35267  35282 CTAGAAAGGTTGGCCC 108 2293
1075409 N/A N/A  37405  37420 CTTTAAATAGCAGAGG  22 2294
1075441 N/A N/A  40002  40017 GAATTAAAGCAGTGCC  24 2295
1075473 N/A N/A  41930  41945 AGTTATAACTGTACTA  89 2296
1075505 N/A N/A  44322  44337 GCTAAATTACAGAGGT  18 2297
1075537 N/A N/A  45795  45810 CTTTAATTACCCAAGG  82 2298
1075569 N/A N/A  48125  48140 GTAGAAAGGCATTAGA  45 2299
1075601 N/A N/A  49992  50007 ACACTATAATCTGACC  50 2300
1075633 N/A N/A  52118  52133 CTATATTGGCTCCTAG  82 2301
1075665 N/A N/A  53953  53968 ATTTAGTTGTGCACAG  87 2302
1075697 N/A N/A  56110  56125 AATAATCCATGCTTGC  16 2303
1075729 N/A N/A  58853  58868 TATTTAAAAATAGCGC  88 2304
1075761 N/A N/A  61107  61122 GGAGAAAAACTACGGA  13 2305
1075793 N/A N/A  63128  63143 CATTAGTTGCCCTGAC  31 2306
1075825 N/A N/A  66353  66368 CCCCTAAAGAAGATTT  44 2307
1075857 N/A N/A  68976  68991 CTTAAACAATCCCTAA  69 2308
1075889 N/A N/A  72204  72219 ATTAAAAGTAGGCCCT  71 2309
1075921 N/A N/A  75750  75765 GAAAGAAAGCTGCGCA  93 2310
1075953 N/A N/A  78851  78866 AACCTATATACCTGCT  36 2311
1075985 N/A N/A  81251  81266 ATATCGAAAAGCAAAC  82 2312
1076017 N/A N/A  83003  83018 CTAATAGGATGGATTC   5 2313
1076049 N/A N/A  85860  85875 AGATTAAAGGCTGGAA   4 2314
1076081 N/A N/A  89730  89745 GATAATTCACCCTTGT  15 2315
1076113 N/A N/A  91298  91313 TGACAATAGCCAATGC  16 2316
1076145 N/A N/A  92457  92472 CCTTATAGGTTATAGT  41 2317
1076177 N/A N/A  94422  94437 CTTTATTTCCCACCCG  37 2318
1076209 N/A N/A  97241  97256 CATTAGCACACCTTTT  12 2319
1076241 N/A N/A  98642  98657 CAATAAGGAACAGTTT  42 2320
1076273 N/A N/A 101849 101864 AAACAAAATGGCGAAT  84 2321
1076305 N/A N/A 104341 104356 TACTAATAAGCCTCAC  37 2322
1076337 N/A N/A 107326 107341 ATTAAACCAGGGACTG  25 2323
1076369 N/A N/A 110591 110606 TATTCGGTATTTTCTA   2 2324
1076401 N/A N/A 112117 112132 TCTAAAGACTCTCATT  31 2325
1076433 N/A N/A 114928 114943 ATTAACTTTCGCTAAA  69 2326
1076465 N/A N/A 118550 118565 GCTTAAGGAATATACA   5 2327
1076497 N/A N/A 120579 120594 AAAGAATACCAACCTG  72 2328
1076529 N/A N/A  40252  40267 CTATAATGAGGATTAC 108 2329
1076561 N/A N/A  11318  11333 GTATACCAAGCTACTC  22 2330

TABLE 32
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA   2  810
1074130  214  229   3674   3689 ATCCCCCGCCCCGGCG 119 2331
1074162  338  353   3798   3813 AGGCGAGCGAGGGCTA 101 2332
1074194  474  489   3934   3949 CCGGGTCCGGACGGCG  57 2333
1074226  859  874   7293   7308 CTGTCGAAGATGCTGA  10 2334
1074258 1044 1059  55539  55554 ATATTCTGCTGCACTG  36 2335
1074290 1198 1213  98900  98915 CTGACTGATTCTCTGG   5 2336
1074322 1428 1443 N/A N/A AGGGCTAACTCCTGAC  94 2337
1074354 1613 1628 120518 120533 GGACACTGTAGCTGCT  24 2338
1074386 1733 1748 122758 122773 CAGGAATGGCTTCAAG  39 2339
1074418 2110 2125 123135 123150 TTCTTTAGAGCCAACT   4 2340
1074450 2476 2491 123501 123516 ACTAATGATAGCACTA   5 2341
1074482 2706 2721 123731 123746 TAATATGGTCATTTGC  12 2342
1074514 2882 2897 123907 123922 AAGGATACATTCCACT  25 2343
1074546 3065 3080 124090 124105 CACTCCCCTAGGCACT  33 2344
1074578 3214 3229 124239 124254 GCTTATTTCTGTCATG   8 2345
1074610 3533 3548 124558 124573 TCTAGTTACATCATCT   5 2346
1074642 3830 3845 124855 124870 GGGCCAAAATACTTAG  78 2347
1074674 4157 4172 125182 125197 TATAGGCACTCCTTCC  22 2348
1074706 4336 4351 125361 125376 TTAATGGCAGCACGGT  48 2349
1074738 4511 4526 125536 125551 CTTCAGGTCAGTACAG  12 2350
1074770 4643 4658 125668 125683 ATCTTATCCCAATGCT  15 2351
1074802 4836 4851 125861 125876 GGCACTACATTTAGAA  37 2352
1074834 5101 5116 126126 126141 TTGCGAGGATAAAATC  14 2353
1074866 5291 5306 126316 126331 AACATATGAGCATGCT  30 2354
1074898 N/A N/A   5481   5496 AACTTTTGGGCAAAGT 101 2355
1074930 N/A N/A   5597   5612 CTATACAACAGGCCTG  84 2356
1074962 N/A N/A   5709   5724 AGGCAAGCAGCTAAAT  78 2357
1074994 N/A N/A   4784   4799 AAACTAAATGGACCGG  94 2358
1075026 N/A N/A   6556   6571 CTTAAAAGCCATCTAC  55 2359
1075058 N/A N/A   8466   8481 ATTACAAAGTAGCAAC  66 2360
1075090 N/A N/A  10590  10605 GCTTATAATCTTTCAG   9 2361
1075122 N/A N/A  12522  12537 GAAAATTAGCCTACCA  16 2362
1075154 N/A N/A  16104  16119 CATTATAATGGGAGGA  13 2363
1075186 N/A N/A  19097  19112 AAATCGATTATTCAGA  73 2364
1075218 N/A N/A  23347  23362 CTTAACACTGGTAAGA  97 2365
1075250 N/A N/A  27030  27045 AATTACGATTAGATCA  55 2366
1075282 N/A N/A  29645  29660 GAAAAATGAGCCCGGT 103 2367
1075314 N/A N/A  31708  31723 AATAAAGTCTAATCCA  54 2368
1075346 N/A N/A  32705  32720 GTAAGTAAAACTGCTG  16 2369
1075378 N/A N/A  35289  35304 AAAACTAATCATCGAT  83 2370
1075410 N/A N/A  37572  37587 GATTAACAGCCCTTTA  36 2371
1075442 N/A N/A  40105  40120 TATTAGTTCTACGATT  71 2372
1075474 N/A N/A  41975  41990 TTTAATAGGCTCTATC  68 2373
1075506 N/A N/A  44427  44442 CATAAAGGTGACAGCC  66 2374
1075538 N/A N/A  46165  46180 GAATTGGAACACCTCA  66 2375
1075570 N/A N/A  48306  48321 GATACTAAGCACAGAG  16 2376
1075602 N/A N/A  50018  50033 TATTATAAGTCTACAA 114 2377
1075634 N/A N/A  52121  52136 AGACTATATTGGCTCC  65 2378
1075666 N/A N/A  53955  53970 AAATTTAGTTGTGCAC 106 2379
1075698 N/A N/A  56114  56129 GTTTAATAATCCATGC  10 2380
1075730 N/A N/A  58854  58869 GTATTTAAAAATAGCG  92 2381
1075762 N/A N/A  61391  61406 GATAAATGGGTTGATT  20 2382
1075794 N/A N/A  63266  63281 CATAATGAATGTGGGT  38 2383
1075826 N/A N/A  66375  66390 TAGGGAAAACCATAGC  23 2384
1075858 N/A N/A  68977  68992 CCTTAAACAATCCCTA  23 2385
1075890 N/A N/A  72205  72220 GATTAAAAGTAGGCCC  92 2386
1075922 N/A N/A  75778  75793 GCCCAAAATAGGATAC  60 2387
1075954 N/A N/A  78881  78896 ATTTAAGGCTGTGTTC  50 2388
1075986 N/A N/A  81253  81268 GAATATCGAAAAGCAA  26 2389
1076018 N/A N/A  83004  83019 ACTAATAGGATGGATT  15 2390
1076050 N/A N/A  85864  85879 CTTTAGATTAAAGGCT  45 2391
1076082 N/A N/A  89791  89806 TCTCAATACACTATAT  38 2392
1076114 N/A N/A  91589  91604 ATTAGTAAGCTGAGGA   3 2393
1076146 N/A N/A  92471  92486 GCTAAAACTTTCATCC  23 2394
1076178 N/A N/A  94474  94489 CCTGAAATACAGGTGT 100 2395
1076210 N/A N/A  97442  97457 ATTTATATGCTCCCTC  20 2396
1076242 N/A N/A  98645  98660 ATGCAATAAGGAACAG  33 2397
1076274 N/A N/A 102073 102088 TGAGAATAGAGCAGGT   9 2398
1076306 N/A N/A 104347 104362 CTTTACTACTAATAAG  99 2399
1076338 N/A N/A 107327 107342 CATTAAACCAGGGACT  33 2400
1076370 N/A N/A 110594 110609 GATTATTCGGTATTTT   2 2401
1076402 N/A N/A 112324 112339 CGTAATTATTTTTGCT  38 2402
1076434 N/A N/A 115047 115062 CTTTAGGTTTATGCCT  25 2403
1076466 N/A N/A 118557 118572 ATTTAGAGCTTAAGGA   5 2404
1076498 N/A N/A 120644 120659 TTACAATACCTTATGA  70 2405
1076530 N/A N/A  64823  64838 AGTATAAAGCAGGGCA   5 2406
1076562 N/A N/A  12922  12937 TATTACAGAGGGTAGC  17 2407

TABLE 33
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA   4  810
1074131  222  237   3682   3697 GGCCCCGCATCCCCCG  72 2408
1074163  339  354   3799   3814 CAGGCGAGCGAGGGCT 118 2409
1074195  475  490   3935   3950 CCCGGGTCCGGACGGC  79 2410
1074227  860  875   7294   7309 ACTGTCGAAGATGCTG  10 2411
1074259 1046 1061  55541  55556 TCATATTCTGCTGCAC  38 2412
1074291 1202 1217  98904  98919 CACTCTGACTGATTCT  11 2413
1074323 1429 1444 N/A N/A CAGGGCTAACTCCTGA 116 2414
1074355 1615 1630 120520 120535 AGGGACACTGTAGCTG  55 2415
1074387 1734 1749 122759 122774 CCAGGAATGGCTTCAA  32 2416
1074419 2111 2126 123136 123151 ATTCTTTAGAGCCAAC   4 2417
1074451 2477 2492 123502 123517 GACTAATGATAGCACT   6 2418
1074483 2709 2724 123734 123749 CACTAATATGGTCATT  15 2419
1074515 2908 2923 123933 123948 TAACTGGAAAGCAGGG   9 2420
1074547 3068 3083 124093 124108 GAGCACTCCCCTAGGC  71 2421
1074579 3224 3239 124249 124264 CCACTATAAAGCTTAT   6 2422
1074611 3621 3636 124646 124661 TAGCTTATATTGAAGA  19 2423
1074643 3835 3850 124860 124875 TTGAAGGGCCAAAATA  68 2424
1074675 4161 4176 125186 125201 AAATTATAGGCACTCC   6 2425
1074707 4337 4352 125362 125377 TTTAATGGCAGCACGG  36 2426
1074739 4525 4540 125550 125565 GACTCTTAGGTCTCCT  24 2427
1074771 4644 4659 125669 125684 AATCTTATCCCAATGC  18 2428
1074803 4837 4852 125862 125877 AGGCACTACATTTAGA  32 2429
1074835 5102 5117 126127 126142 CTTGCGAGGATAAAAT  30 2430
1074867 5292 5307 126317 126332 TAACATATGAGCATGC  40 2431
1074899 N/A N/A   5482   5497 TAACTTTTGGGCAAAG  52 2432
1074931 N/A N/A   5601   5616 GAGACTATACAACAGG  35 2433
1074963 N/A N/A   5710   5725 TAGGCAAGCAGCTAAA  76 2434
1074995 N/A N/A   4785   4800 AAAACTAAATGGACCG  50 2435
1075027 N/A N/A   6578   6593 AAATTTGAACTGCCCA  28 2436
1075059 N/A N/A   8749   8764 ATTTACTTTGGATGTC  11 2437
1075091 N/A N/A  10609  10624 AAACAACGAATGATTG  65 2438
1075123 N/A N/A  12563  12578 CTTTAGGAAAGGGTAT  21 2439
1075155 N/A N/A  16105  16120 TCATTATAATGGGAGG   5 2440
1075187 N/A N/A  19108  19123 GCCCAAGGAGGAAATC  77 2441
1075219 N/A N/A  23348  23363 CCTTAACACTGGTAAG 117 2442
1075251 N/A N/A  27031  27046 TAATTACGATTAGATC  79 2443
1075283 N/A N/A  29653  29668 CGAATATAGAAAAATG  90 2444
1075315 N/A N/A  31772  31787 CATAACTTGATGACTC  27 2445
1075347 N/A N/A  32821  32836 CATAGGTAGGCAACAA  20 2446
1075379 N/A N/A  35306  35321 TACCAAAACTACAACC  75 2447
1075411 N/A N/A  37768  37783 CAAAAAGGGTAAGGCA  39 2448
1075443 N/A N/A  40138  40153 GATTAACAGAGCTAGA  29 2449
1075475 N/A N/A  42037  42052 TAGCAACACATGAAGA  64 2450
1075507 N/A N/A  44455  44470 GTACAACCTAGTGATA  82 2451
1075539 N/A N/A  46198  46213 CTTAAGGGATGGAACA  79 2452
1075571 N/A N/A  48312  48327 CAAATAGATACTAAGC  54 2453
1075603 N/A N/A  50064  50079 TATGAACAAGTATGAG  35 2454
1075635 N/A N/A  52207  52222 AATAAACACCTCGCCA  97 2455
1075667 N/A N/A  53956  53971 CAAATTTAGTTGTGCA 109 2456
1075699 N/A N/A  56158  56173 GATTTATACTCAGGTT   4 2457
1075731 N/A N/A  58878  58893 CCCCAATATTATCTAC  40 2458
1075763 N/A N/A  61435  61450 ATTTAGGCTTTGGGTT  16 2459
1075795 N/A N/A  63289  63304 GTAATTATATACCCAC  66 2460
1075827 N/A N/A  66457  66472 ATACTATACCTAAGGA  60 2461
1075859 N/A N/A  69260  69275 ACTTATCACTCTGCCC  20 2462
1075891 N/A N/A  72206  72221 AGATTAAAAGTAGGCC  89 2463
1075923 N/A N/A  75823  75838 TTTAATACTCTCTGGG  42 2464
1075955 N/A N/A  79005  79020 GACCTATAATACAGAA  85 2465
1075987 N/A N/A  81256  81271 GAAGAATATCGAAAAG  13 2466
1076019 N/A N/A  83005  83020 CACTAATAGGATGGAT  12 2467
1076051 N/A N/A  85945  85960 CTTAACTATTCAGCCC  21 2468
1076083 N/A N/A  89966  89981 CGCTATAAAGTGGCAT  46 2469
1076115 N/A N/A  91590  91605 CATTAGTAAGCTGAGG   7 2470
1076147 N/A N/A  92516  92531 ATTAACTCACGAAGAC  25 2471
1076179 N/A N/A  94487  94502 AATTAGCCAACCACCT  38 2472
1076211 N/A N/A  97443  97458 AATTTATATGCTCCCT  22 2473
1076243 N/A N/A  98790  98805 ATATTCGATGTAACTT  41 2474
1076275 N/A N/A 102220 102235 GTATTAGATAAAGCAG  10 2475
1076307 N/A N/A 104378 104393 GTAATTACCTCTAATC  38 2476
1076339 N/A N/A 107352 107367 CAGCAATACTGTGGGC  13 2477
1076371 N/A N/A 110712 110727 TAAGAACGAACCTCCA  49 2478
1076403 N/A N/A 112457 112472 ATTTAAGACCTGGTGA  26 2479
1076435 N/A N/A 115328 115343 CGTAAACATCATCTCT  12 2480
1076467 N/A N/A 118559 118574 GTATTTAGAGCTTAAG   5 2481
1076499 N/A N/A 121073 121088 GCTAATATATCCAATT  37 2482
1076531 N/A N/A  66739  66754 ACTATAAAGGGTTTAG  66 2483
1076563 N/A N/A  31631  31646 CAAAGTAATTAAACGA  91 2484

TABLE 34
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA   1  810
1074132  223  238   3683   3698 CGGCCCCGCATCCCCC  96 2485
1074164  340  355   3800   3815 CCAGGCGAGCGAGGGC 135 2486
1074196  476  491   3936   3951 GCCCGGGTCCGGACGG  99 2487
1074228  861  876   7295   7310 GACTGTCGAAGATGCT  17 2488
1074260 1051 1066  55546  55561 GTTCATCATATTCTGC  48 2489
1074292 1216 1231  98918  98933 CTGTTTCACTGGAGCA  10 2490
1074324 1430 1445 N/A N/A GCAGGGCTAACTCCTG 116 2491
1074356 1616 1631 120521 120536 GAGGGACACTGTAGCT  43 2492
1074388 1805 1820 122830 122845 GACTTGGCATCAGCTC  16 2493
1074420 2112 2127 123137 123152 GATTCTTTAGAGCCAA   2 2494
1074452 2478 2493 123503 123518 TGACTAATGATAGCAC   3 2495
1074484 2710 2725 123735 123750 TCACTAATATGGTCAT   3 2496
1074516 2909 2924 123934 123949 TTAACTGGAAAGCAGG  22 2497
1074548 3093 3108 124118 124133 ATCTACCGTATGCCCA   4 2498
1074580 3225 3240 124250 124265 ACCACTATAAAGCTTA   5 2499
1074612 3622 3637 124647 124662 ATAGCTTATATTGAAG  12 2500
1074644 3836 3851 124861 124876 ATTGAAGGGCCAAAAT  93 2501
1074676 4162 4177 125187 125202 CAAATTATAGGCACTC   4 2502
1074708 4338 4353 125363 125378 CTTTAATGGCAGCACG  55 2503
1074740 4526 4541 125551 125566 GGACTCTTAGGTCTCC  75 2504
1074772 4650 4665 125675 125690 AGTTAAAATCTTATCC  80 2505
1074804 4874 4889 125899 125914 TAGCAAAGTCACTTCC  15 2506
1074836 5111 5126 126136 126151 AACAACATGCTTGCGA  27 2507
1074868 5297 5312 126322 126337 GTACCTAACATATGAG  74 2508
1074900 N/A N/A   5484   5499 ATTAACTTTTGGGCAA  40 2509
1074932 N/A N/A   5602   5617 GGAGACTATACAACAG  88 2510
1074964 N/A N/A   5711   5726 TTAGGCAAGCAGCTAA 112 2511
1074996 N/A N/A   4843   4858 AATAAATGCTTACGGG  60 2512
1075028 N/A N/A   6670   6685 AAAAATCAAGCCCTCG 103 2513
1075060 N/A N/A   8896   8911 GTTTAACAATCTCCCC  70 2514
1075092 N/A N/A  10612  10627 TTAAAACAACGAATGA  63 2515
1075124 N/A N/A  12652  12667 GTAAAAACCTGGGTTT  58 2516
1075156 N/A N/A  16175  16190 ATTATATGACTCTGCT  22 2517
1075188 N/A N/A  19193  19208 AGTCAACCTGTAATTA  14 2518
1075220 N/A N/A  23362  23377 AATTTTAACTGTGACC  24 2519
1075252 N/A N/A  27032  27047 TTAATTACGATTAGAT  90 2520
1075284 N/A N/A  29658  29673 CTTTTCGAATATAGAA  76 2521
1075316 N/A N/A  31797  31812 GTATATAGATACCCAC  25 2522
1075348 N/A N/A  32855  32870 TCACAAAACCCTACAC  96 2523
1075380 N/A N/A  35609  35624 ACTAAAACTGACTGTC  94 2524
1075412 N/A N/A  37770  37785 TCCAAAAAGGGTAAGG  48 2525
1075444 N/A N/A  40268  40283 ATAAATCCTCATGTGG 112 2526
1075476 N/A N/A  42291  42306 TCTTATCCTACAGCTT  75 2527
1075508 N/A N/A  44490  44505 GAAAAAGGTTTAGGGT  84 2528
1075540 N/A N/A  46199  46214 GCTTAAGGGATGGAAC  78 2529
1075572 N/A N/A  48372  48387 CAATTTAACTGTTACA  84 2530
1075604 N/A N/A  50104  50119 ATAATTAAGCTATCAC  81 2531
1075636 N/A N/A  52208  52223 CAATAAACACCTCGCC  91 2532
1075668 N/A N/A  54032  54047 AATTATTGGTGACACT  80 2533
1075700 N/A N/A  56179  56194 GCCAAATAAGAGGTAG  22 2534
1075732 N/A N/A  58998  59013 AATAACCTCGAGTGCT  36 2535
1075764 N/A N/A  61668  61683 CTTCAAGGAAGGTGCT 103 2536
1075796 N/A N/A  63290  63305 AGTAATTATATACCCA  64 2537
1075828 N/A N/A  66513  66528 TTAGAATAGTTCTACC  59 2538
1075860 N/A N/A  69290  69305 AACTATAAGCTATGTG  73 2539
1075892 N/A N/A  72236  72251 CACCAATACCAAAGTC  54 2540
1075924 N/A N/A  75824  75839 ATTTAATACTCTCTGG  21 2541
1075956 N/A N/A  79218  79233 TATAAAGCAATGCGAT  27 2542
1075988 N/A N/A  81357  81372 AATTAAGCTTCTCTAG  90 2543
1076020 N/A N/A  83011  83026 CCCCAACACTAATAGG  60 2544
1076052 N/A N/A  86023  86038 GCAATAAAGCTGAACT  23 2545
1076084 N/A N/A  89980  89995 CATCAATAGAGAGTCG   7 2546
1076116 N/A N/A  91600  91615 GAAAATAGCCCATTAG  25 2547
1076148 N/A N/A  92517  92532 TATTAACTCACGAAGA  52 2548
1076180 N/A N/A  94489  94504 ATAATTAGCCAACCAC  42 2549
1076212 N/A N/A  97445  97460 CAAATTTATATGCTCC  15 2550
1076244 N/A N/A  98799  98814 CAATTTGGGATATTCG  14 2551
1076276 N/A N/A 102282 102297 CTTTAGGAGTCAGAAC  59 2552
1076308 N/A N/A 104379 104394 AGTAATTACCTCTAAT  32 2553
1076340 N/A N/A 107364 107379 TAATATCCTCATCAGC   8 2554
1076372 N/A N/A 110715 110730 CAATAAGAACGAACCT  76 2555
1076404 N/A N/A 112458 112473 TATTTAAGACCTGGTG  13 2556
1076436 N/A N/A 115413 115428 CATTACTACTCTGTCC  39 2557
1076468 N/A N/A 118602 118617 CATTACTACTAAGAGT  91 2558
1076500 N/A N/A 121129 121144 CAATTAAGATCAACAT  99 2559
1076532 N/A N/A  68936  68951 ATTTTTAGGCAGACGC  12 2560
1076564 N/A N/A  39617  39632 TAAAGTAATGCTACAG  77 2561

TABLE 35
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA   2  810
1074133  224  239   3684   3699 GCGGCCCCGCATCCCC 101 2562
1074165  341  356   3801   3816 CCCAGGCGAGCGAGGG  90 2563
1074197  477  492   3937   3952 TGCCCGGGTCCGGACG  91 2564
1074229  864  879   7298   7313 GAAGACTGTCGAAGAT   5 2565
1074261 1055 1070  55550  55565 CCGAGTTCATCATATT  19 2566
1074293 1217 1232  98919  98934 GCTGTTTCACTGGAGC  54 2567
1074325 1431 1446 116620 116635 CGCAGGGCTAACTCCT  42 2568
1074357 1617 1632 120522 120537 CGAGGGACACTGTAGC  12 2569
1074389 1808 1823 122833 122848 GCAGACTTGGCATCAG  14 2570
1074421 2113 2128 123138 123153 TGATTCTTTAGAGCCA   3 2571
1074453 2479 2494 123504 123519 GTGACTAATGATAGCA   4 2572
1074485 2711 2726 123736 123751 TTCACTAATATGGTCA   4 2573
1074517 2939 2954 123964 123979 AATGCATACAAAGCGC  55 2574
1074549 3094 3109 124119 124134 TATCTACCGTATGCCC   6 2575
1074581 3226 3241 124251 124266 AACCACTATAAAGCTT  18 2576
1074613 3623 3638 124648 124663 CATAGCTTATATTGAA   7 2577
1074645 3837 3852 124862 124877 AATTGAAGGGCCAAAA  81 2578
1074677 4169 4184 125194 125209 CTACTGGCAAATTATA  22 2579
1074709 4352 4367 125377 125392 TCTAGAACAGCTGCCT  71 2580
1074741 4528 4543 125553 125568 AAGGACTCTTAGGTCT  78 2581
1074773 4651 4666 125676 125691 CAGTTAAAATCTTATC  94 2582
1074805 4875 4890 125900 125915 GTAGCAAAGTCACTTC   9 2583
1074837 5112 5127 126137 126152 TAACAACATGCTTGCG  11 2584
1074869 5298 5313 126323 126338 AGTACCTAACATATGA  31 2585
1074901 N/A N/A   5485   5500 TATTAACTTTTGGGCA  61 2586
1074933 N/A N/A   5603   5618 AGGAGACTATACAACA  72 2587
1074965 N/A N/A   5715   5730 GTGTTTAGGCAAGCAG  20 2588
1074997 N/A N/A   4854   4869 GCCGCGAGGAAAATAA 119 2589
1075029 N/A N/A   7004   7019 ATATTCGACACTGGAG  33 2590
1075061 N/A N/A   8954   8969 CCTTATACTTTTAGCC   5 2591
1075093 N/A N/A  10664  10679 CAAAGTAAGGTATGAG   3 2592
1075125 N/A N/A  12777  12792 CTTAAGGTACAAGGCA  84 2593
1075157 N/A N/A  16192  16207 CCAGAAAATCATAGTA  19 2594
1075189 N/A N/A  19238  19253 GCTAATAGTCACTGTT  11 2595
1075221 N/A N/A  23384  23399 CATTATCCGGGAGAGC  10 2596
1075253 N/A N/A  27033  27048 GTTAATTACGATTAGA  20 2597
1075285 N/A N/A  29702  29717 TATACATAGTCAATTC  60 2598
1075317 N/A N/A  31832  31847 GTATTCGCCTCCTGCA  27 2599
1075349 N/A N/A  33000  33015 ATTAAAGCTCATTGAT  81 2600
1075381 N/A N/A  35767  35782 TATTACCCTACTCATA  89 2601
1075413 N/A N/A  37807  37822 CATAACTACATCGACA  34 2602
1075445 N/A N/A  40269  40284 TATAAATCCTCATGTG  84 2603
1075477 N/A N/A  42405  42420 CTTTATCTCACTAGCT  86 2604
1075509 N/A N/A  44622  44637 CATAATCCCTGACTTG  81 2605
1075541 N/A N/A  46250  46265 GCTCAAAACTGACATA  47 2606
1075573 N/A N/A  48504  48519 AAGGAACCTTCTGTGT  72 2607
1075605 N/A N/A  50176  50191 CGTAAACATTTTGCCT  38 2608
1075637 N/A N/A  52219  52234 CCACAACCTGTCAATA 100 2609
1075669 N/A N/A  54033  54048 AAATTATTGGTGACAC  70 2610
1075701 N/A N/A  56296  56311 AATTACTAGAGGCTTC   3 2611
1075733 N/A N/A  58999  59014 CAATAACCTCGAGTGC  28 2612
1075765 N/A N/A  61721  61736 CTTAAGGCAGCTCTAT  58 2613
1075797 N/A N/A  63378  63393 GATAATCATGATACTC   3 2614
1075829 N/A N/A  66603  66618 ACTCAATAGATCATTG  41 2615
1075861 N/A N/A  69291  69306 TAACTATAAGCTATGT  78 2616
1075893 N/A N/A  72284  72299 CGTGAAAAAGATGTGG   7 2617
1075925 N/A N/A  75907  75922 AACCTATATTATTTGC  28 2618
1075957 N/A N/A  79219  79234 CTATAAAGCAATGCGA  28 2619
1075989 N/A N/A  81362  81377 GCTAAAATTAAGCTTC  78 2620
1076021 N/A N/A  83058  83073 CATTAATAAAGTTACC  95 2621
1076053 N/A N/A  86047  86062 TACCAACAAGGCATCA  55 2622
1076085 N/A N/A  90079  90094 ACTAATAGGCCATCTG   7 2623
1076117 N/A N/A  91603  91618 CTAGAAAATAGCCCAT  15 2624
1076149 N/A N/A  92518  92533 TTATTAACTCACGAAG  24 2625
1076181 N/A N/A  94490  94505 TATAATTAGCCAACCA  26 2626
1076213 N/A N/A  97518  97533 TCTCAAGGAATTGCCT  27 2627
1076245 N/A N/A  98849  98864 CCTAAAAAACTAGTGA 101 2628
1076277 N/A N/A 102574 102589 GCTAAAACATCAGATA  24 2629
1076309 N/A N/A 104525 104540 GATAACTTTCCACAAT   9 2630
1076341 N/A N/A 107422 107437 ATTAACTACAACTGTG  18 2631
1076373 N/A N/A 111082 111097 AACGGATATACAATAA  10 2632
1076405 N/A N/A 112459 112474 TTATTTAAGACCTGGT  12 2633
1076437 N/A N/A 115843 115858 GAAGAATAGCATCTGA  19 2634
1076469 N/A N/A 118627 118642 GTAAAAGGGAACTAAG  69 2635
1076501 N/A N/A 121268 121283 CATAACACTTAAGGTG  97 2636
1076533 N/A N/A  75580  75595 ATTTTTAGTCCAGTGG   9 2637
1076565 N/A N/A  55334  55349 CATTAAGTCACAGCAT  74 2638

TABLE 36
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA   1  810
1074134  225  240   3685   3700 CGCGGCCCCGCATCCC  79 2639
1074166  342  357   3802   3817 ACCCAGGCGAGCGAGG  72 2640
1074198  478  493   3938   3953 TTGCCCGGGTCCGGAC 112 2641
1074230  866  881   7300   7315 AAGAAGACTGTCGAAG   4 2642
1074262 1056 1071  55551  55566 GCCGAGTTCATCATAT  48 2643
1074294 1275 1290  98977  98992 TTGGAGTTGCTGCCAC  80 2644
1074326 1432 1447 116621 116636 ACGCAGGGCTAACTCC  36 2645
1074358 1618 1633 120523 120538 TCGAGGGACACTGTAG  17 2646
1074390 1810 1825 122835 122850 CTGCAGACTTGGCATC  64 2647
1074422 2189 2204 123214 123229 AAACAGGCTCACTTCC    9* 2648
1074454 2480 2495 123505 123520 TGTGACTAATGATAGC   1 2649
1074486 2712 2727 123737 123752 ATTCACTAATATGGTC   4 2650
1074518 2940 2955 123965 123980 AAATGCATACAAAGCG  13 2651
1074550 3095 3110 124120 124135 ATATCTACCGTATGCC  23 2652
1074582 3228 3243 124253 124268 TAAACCACTATAAAGC  18 2653
1074614 3624 3639 124649 124664 TCATAGCTTATATTGA  49 2654
1074646 3838 3853 124863 124878 AAATTGAAGGGCCAAA  39 2655
1074678 4179 4194 125204 125219 TAATCTGTGGCTACTG   7 2656
1074710 4353 4368 125378 125393 CTCTAGAACAGCTGCC  42 2657
1074742 4529 4544 125554 125569 AAAGGACTCTTAGGTC  25 2658
1074774 4661 4676 125686 125701 CAAGAATACCCAGTTA  16 2659
1074806 4877 4892 125902 125917 TTGTAGCAAAGTCACT   8 2660
1074838 5113 5128 126138 126153 ATAACAACATGCTTGC   9 2661
1074870 5301 5316 126326 126341 GTAAGTACCTAACATA  20 2662
1074902 N/A N/A   5486   5501 CTATTAACTTTTGGGC  54 2663
1074934 N/A N/A   5604   5619 CAGGAGACTATACAAC  74 2664
1074966 N/A N/A   5721   5736 ATTGAAGTGTTTAGGC   9 2665
1074998 N/A N/A   4998   5013 CACGCGACCTACTAAG  61 2666
1075030 N/A N/A   7007   7022 TTAATATTCGACACTG  37 2667
1075062 N/A N/A   8960   8975 CTTTAACCTTATACTT  58 2668
1075094 N/A N/A  10705  10720 GATAAATGTAACTAGC  10 2669
1075126 N/A N/A  12890  12905 CTTAAATCTTAGCAAC  20 2670
1075158 N/A N/A  16240  16255 CGGCAAAAACAAAATC  76 2671
1075190 N/A N/A  19295  19310 TATCAAGGATTCAGTA  45 2672
1075222 N/A N/A  23766  23781 GTATTTGGACAACTCT   3 2673
1075254 N/A N/A  27099  27114 TCCCAAAAGTCATCGC  28 2674
1075286 N/A N/A  29807  29822 ATTACGGACAGAAGTG  48 2675
1075318 N/A N/A  31850  31865 ATCCTAAAGCCACTGC  72 2676
1075350 N/A N/A  33001  33016 GATTAAAGCTCATTGA  62 2677
1075382 N/A N/A  35769  35784 ATTATTACCCTACTCA  33 2678
1075414 N/A N/A  37990  38005 CATACTAATCCCTCTT  41 2679
1075446 N/A N/A  40270  40285 CTATAAATCCTCATGT  87 2680
1075478 N/A N/A  42416  42431 CATTTTGAACCCTTTA  20 2681
1075510 N/A N/A  44630  44645 GAATAACACATAATCC  83 2682
1075542 N/A N/A  46607  46622 TGAGAAAGGTTCCTGA  66 2683
1075574 N/A N/A  48508  48523 AGTCAAGGAACCTTCT  47 2684
1075606 N/A N/A  50368  50383 GCTAAACCTACACGCT  82 2685
1075638 N/A N/A  52324  52339 ATTAACCAGAAGCCTG  79 2686
1075670 N/A N/A  54501  54516 TATATATGATGGACTG  39 2687
1075702 N/A N/A  56442  56457 GAGGAAGGGCACCTTT  81 2688
1075734 N/A N/A  59002  59017 AGGCAATAACCTCGAG  26 2689
1075766 N/A N/A  61741  61756 GGAGAACACAAGAGGC   5 2690
1075798 N/A N/A  63396  63411 ATTTAGATAGTTACTG  21 2691
1075830 N/A N/A  66610  66625 GATGAACACTCAATAG  12 2692
1075862 N/A N/A  70001  70016 CTAATAACTTGTCTAC  67 2693
1075894 N/A N/A  72305  72320 CTCGAAAGCTGGGCCC 100 2694
1075926 N/A N/A  75911  75926 GTAGAACCTATATTAT  25 2695
1075958 N/A N/A  79351  79366 CATTATGACATTCCCC  12 2696
1075990 N/A N/A  81490  81505 CGTTATTATGCAGCAA   1 2697
1076022 N/A N/A  83093  83108 TAATTAGATGCTGACA   2 2698
1076054 N/A N/A  86104  86119 CATTAGACTTTCTGTC  21 2699
1076086 N/A N/A  90080  90095 AACTAATAGGCCATCT  31 2700
1076118 N/A N/A  91688  91703 CGTAAATTGAGGCCCA  45 2701
1076150 N/A N/A  92520  92535 ATTTATTAACTCACGA  11 2702
1076182 N/A N/A  94491  94506 CTATAATTAGCCAACC  15 2703
1076214 N/A N/A  97543  97558 ATCCTATACATTAAGA  67 2704
1076246 N/A N/A  98850  98865 TCCTAAAAAACTAGTG  75 2705
1076278 N/A N/A 102644 102659 AATAAGGACAGGACCC  29 2706
1076310 N/A N/A 104554 104569 ACCCTATACTTGAATT  36 2707
1076342 N/A N/A 107423 107438 CATTAACTACAACTGT  33 2708
1076374 N/A N/A 111084 111099 ATAACGGATATACAAT  15 2709
1076406 N/A N/A 112460 112475 ATTATTTAAGACCTGG   4 2710
1076438 N/A N/A 115846 115861 TAGGAAGAATAGCATC  13 2711
1076470 N/A N/A 118843 118858 GATAAAGAGGTTAACA  34 2712
1076502 N/A N/A 121320 121335 CAAAGTAAGTGAGCCC  17 2713
1076534 N/A N/A  79220  79235 ACTATAAAGCAATGCG   4 2714
1076566 N/A N/A  55576  55591 AATTACAGTGTCTCAC  63 2715

TABLE 37
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ
Number Site Site Site Site Sequence (5′ to 3′) (% UTC) ID NO
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA   2  810
1074135  226  241   3686   3701 CCGCGGCCCCGCATCC  91 2716
1074167  353  368   3813   3828 CGCACCCCCTGACCCA  58 2717
1074199  483  498   3943   3958 GCCGGTTGCCCGGGTC 101 2718
1074231  867  882   7301   7316 AAAGAAGACTGTCGAA   8 2719
1074263 1057 1072  55552  55567 AGCCGAGTTCATCATA  34 2720
1074295 1278 1293  98980  98995 TGGTTGGAGTTGCTGC  15 2721
1074327 1433 1448 116622 116637 TACGCAGGGCTAACTC  39 2722
1074359 1619 1634 120524 120539 TTCGAGGGACACTGTA  18 2723
1074391 1828 1843 122853 122868 GTCAGAACTCAAAGCT  14 2724
1074423 2190 2205 123215 123230 CAAACAGGCTCACTTC    4* 2725
1074455 2485 2500 123510 123525 CATTATGTGACTAATG  67 2726
1074487 2714 2729 123739 123754 AGATTCACTAATATGG   7 2727
1074519 2959 2974 123984 123999 ACTACTAGTCATGTAT  45 2728
1074551 3096 3111 124121 124136 AATATCTACCGTATGC  58 2729
1074583 3229 3244 124254 124269 GTAAACCACTATAAAG  30 2730
1074615 3625 3640 124650 124665 TTCATAGCTTATATTG   8 2731
1074647 3839 3854 124864 124879 CAAATTGAAGGGCCAA  27 2732
1074679 4182 4197 125207 125222 TCTTAATCTGTGGCTA   5 2733
1074711 4354 4369 125379 125394 ACTCTAGAACAGCTGC  28 2734
1074743 4530 4545 125555 125570 GAAAGGACTCTTAGGT  16 2735
1074775 4681 4696 125706 125721 GGTTTATTGTAAAAGC   3 2736
1074807 4927 4942 125952 125967 CCATATAGAAGGCATG  75 2737
1074839 5114 5129 126139 126154 TATAACAACATGCTTG  33 2738
1074871 5302 5317 126327 126342 TGTAAGTACCTAACAT  70 2739
1074903 N/A N/A   5487   5502 CCTATTAACTTTTGGG  87 2740
1074935 N/A N/A   5605   5620 ACAGGAGACTATACAA  80 2741
1074967 N/A N/A   5726   5741 GACAAATTGAAGTGTT 116 2742
1074999 N/A N/A   5004   5019 AACCAACACGCGACCT  77 2743
1075031 N/A N/A   7009   7024 ATTTAATATTCGACAC  52 2744
1075063 N/A N/A   9104   9119 TACGGAAGGCCAACTG  16 2745
1075095 N/A N/A  10722  10737 CTTGAAAACAAGCCAC  63 2746
1075127 N/A N/A  12934  12949 GCTAAATTATGCTATT  79 2747
1075159 N/A N/A  16250  16265 CAAAAAATCACGGCAA  63 2748
1075191 N/A N/A  19412  19427 ACGGGAAAGAAAGGCC  83 2749
1075223 N/A N/A  23854  23869 GTTAAAAGTGAACCCA  19 2750
1075255 N/A N/A  27113  27128 AAATATCCGTGTCCTC  16 2751
1075287 N/A N/A  29808  29823 TATTACGGACAGAAGT  58 2752
1075319 N/A N/A  31860  31875 TATAACAATCATCCTA  59 2753
1075351 N/A N/A  33002  33017 AGATTAAAGCTCATTG  38 2754
1075383 N/A N/A  35770  35785 AATTATTACCCTACTC  45 2755
1075415 N/A N/A  38069  38084 CATTAAATGACAGCCT  52 2756
1075447 N/A N/A  40272  40287 CACTATAAATCCTCAT  96 2757
1075479 N/A N/A  42463  42478 GACAATAAATCTGCCT  77 2758
1075511 N/A N/A  44708  44723 CAATATTATCTGAGCT 106 2759
1075543 N/A N/A  46674  46689 ATATATTAGGAGTTTC  22 2760
1075575 N/A N/A  48710  48725 TTACAACACAAGTCTA  55 2761
1075607 N/A N/A  50539  50554 AAAACGGTGTGAAGAA  45 2762
1075639 N/A N/A  52325  52340 AATTAACCAGAAGCCT 101 2763
1075671 N/A N/A  54503  54518 GATATATATGATGGAC  37 2764
1075703 N/A N/A  56609  56624 GGAGAAAGCCATCAAG  10 2765
1075735 N/A N/A  59100  59115 GAATCGATGTGTTGCG  17 2766
1075767 N/A N/A  61758  61773 TATTACACAGGCAGGC  12 2767
1075799 N/A N/A  63412  63427 CCTCAACACATTTGAG  85 2768
1075831 N/A N/A  66680  66695 TATTAGCCTTCTAACC  59 2769
1075863 N/A N/A  70002  70017 CCTAATAACTTGTCTA  71 2770
1075895 N/A N/A  72306  72321 ACTCGAAAGCTGGGCC  38 2771
1075927 N/A N/A  75923  75938 GCTTAAAATCATGTAG  32 2772
1075959 N/A N/A  79446  79461 GATTATTATTGCAGCT  15 2773
1075991 N/A N/A  81533  81548 ATATAGGACCACGACT  62 2774
1076023 N/A N/A  83094  83109 ATAATTAGATGCTGAC   4 2775
1076055 N/A N/A  86186  86201 AATTACTAACAATCTC  45 2776
1076087 N/A N/A  90082  90097 CAAACTAATAGGCCAT  10 2777
1076119 N/A N/A  91742  91757 GTTAAATATGAATTGG   7 2778
1076151 N/A N/A  92521  92536 TATTTATTAACTCACG  14 2779
1076183 N/A N/A  94494  94509 CTTCTATAATTAGCCA   7 2780
1076215 N/A N/A  97620  97635 TTATAACAGACTGGCT  47 2781
1076247 N/A N/A  99297  99312 GACCAAAACAGCTCTT  11 2782
1076279 N/A N/A 102645 102660 CAATAAGGACAGGACC  71 2783
1076311 N/A N/A 104558 104573 TATAACCCTATACTTG  56 2784
1076343 N/A N/A 107707 107722 AGACTAAATCTTCCCT   8 2785
1076375 N/A N/A 111085 111100 TATAACGGATATACAA  22 2786
1076407 N/A N/A 112462 112477 GTATTATTTAAGACCT  22 2787
1076439 N/A N/A 115906 115921 CTTATATGGTTTTGTG   4 2788
1076471 N/A N/A 118862 118877 CATTAGACTAGGCTTT   5 2789
1076503 N/A N/A 121702 121717 AATTACCCCTGTGAGG  77 2790
1076535 N/A N/A  83322  83337 ATTTTTAGCTCGCAAT  28 2791
1076567 N/A N/A  59365  59380 GATTACAGTGACATTC  10 2792

TABLE 38
Inhibition of Yap1 mRNA by
3-10-3 cEt gapmers targeting SEQ ID NO.: 3
SEQ ID SEQ ID
NO: 3 NO: 3
Compound Start Stop YAP1 SEQ
Number Site Site Sequence (5′ to 3′) (% UTC) ID NO
1074880 1246 1261 CTCCTGCCGAAGCAGT 101 2793
1074881 1250 1265 CTAACTCCTGCCGAAG  76 2794
1074882 1251 1266 GCTAACTCCTGCCGAA  73 2795
1074883 1252 1267 GGCTAACTCCTGCCGA 107 2796
1074884 1253 1268 GGGCTAACTCCTGCCG 110 2797
1074885 1254 1269 AGGGCTAACTCCTGCC 115 2798
1074886 1255 1270 CAGGGCTAACTCCTGC 104 2799

Example 5: Antisense Inhibition of Human Yap1 in SNU-449 Cells by Modified Oligonucleotides

Modified oligonucleotides with additional chemistry modifications were designed to target a Yap1 nucleic acid and were tested for their effect on Yap1 mRNA level in SNU-449 cells. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured SNU-449 cells at a density of 10,000 cells per well were treated using free uptake with 2,000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and Yap1 mRNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS36584 was used to measure mRNA levels. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREENÂŽ. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). The modified oligonucleotides with percent control values marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides targeting the amplicon region.

Several different chemistry modifications were tested, which are specified in the Chemistry Notation column of the tables below, wherein the notation “d” refers to a 2′-deoxyribose sugar, the notation “s” refers to a phosphorothioate (P═S) internucleoside linkage, the notation “k” refers to a cEt modified sugar, the notation “y” refers to a 2′-O-methyl ribose sugar, the notation “e” refers to a MOE modified sugar, and the notation “mC” refers to a 5-methylcytosine.

“Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either SEQ ID NO.: 1 or SEQ ID NO.: 2. ‘N/A’ indicates that the modified oligonucleotide does not target that particular gene sequence with 10000 complementarity. ‘N.D.’ indicates that the % UTC is not defined for that particular modified oligonucleotide in that particular experiment. Activity of the modified oligonucleotide may be defined in a different experiment.

TABLE 39
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ ID
Number Site Site Site Site Sequence (5′ to 3′) CHEMISTRY NOTATION (% UTC) NO
715487 3630 3645 124655 124670 ATTACTTCATAGCTTA AksTksTksAdsmCdsTdsTdsmCdsAds 12 52
TdsAdsGdsmCdsTksTksAk
958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTksAdsGdsAdsGdsTdsAdsTds 8 810
GdsTdsGdsGksmCksAk
1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAksAdsTdsTdsGdsTdsmCds 7 2800
TdsmCdsAdsTdsGksmCksmCk
1095379 4443 4458 125468 125483 ACTGAGGTATAACTGG AksmCdsTdsGdsAdsGdsGdsTdsAds 52 392
TdsAdsAksmCesTksGesGk
1095397 4441 4456 125466 125481 TGAGGTATAACTGGGC TksGdsAdsGdsGdsTdsAdsTdsAds 53 1580
AdsmCdsTksGesGksGesmCk
1095398 4442 4457 125467 125482 CTGAGGTATAACTGGG mCksTdsGdsAdsGdsGdsTdsAdsTds 38 2801
AdsAdsmCksTesGksGesGk
1095399 4444 4459 125469 125484 CACTGAGGTATAACTG mCksAdsmCdsTdsGdsAdsGdsGdsTds 46 2802
AdsTdsAksAesmCksTesGk
1198370 2524 2539 123549 123564 TGTCTCATGCCTTATA TksGdsTdsmCdsTdsmCdsAdsTdsGds 20 2803
mCdsmCdsTksTesAksTesAk
1198371 2526 2541 123551 123566 ATTGTCTCATGCCTTA AksTdsTdsGdsTdsmCdsTdsmCdsAds 15 2804
TdsGdsmCksmCesTksTesAk
1198372 2527 2542 123552 123567 AATTGTCTCATGCCTT AksAdsTdsTdsGdsTdsmcdsTdsmcds 21 2805
AdsTdsGksmCesmCksTesTk
1198373 2528 2543 123553 123568 AAATTGTCTCATGCCT AksAdsTdsTdsGdsTdsmcdsTdsmcds 40 443
AdsTksGesmCksmCesTk
1198374 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAdsAdsAdsTdsTdsGdsTdsmcds 24 2800
TdsmCdsAksTesGksmCesmCk
1198375 2530 2545 123555 123570 GGAAATTGTCTCATGC GksGdsAdsAdsAdsTdsTdsGdsTdsmcds 22 2806
TdsmCksAesTksGesmCk
1198376 2531 2546 123556 123571 TGGAAATTGTCTCATG TksGdsGdsAdsAdsAdsTdsTdsGdsTds 36 2807
mCdsTksmCesAksTesGk
1198377 2532 2547 123557 123572 ATGGAAATTGTCTCAT AksTdsGdsGdsAdsAdsAdsTdsTds 30 2808
GdsTdsmCksTesmCksAesTk
1198378 2534 2549 123559 123574 ATATGGAAATTGTCTC AksTdsAdsTdsGdsGdsAdsAdsAds 39 656
TdsTdsGksTesmCksTesmCk
1198379 2560 2575 123585 123600 AGTATGTGGCAATAAT AksGdsTdsAdsTdsGdsTdsGdsGds 45 2809
mCdsAdsAksTesAksAesTk
1198380 2562 2577 123587 123602 AGAGTATGTGGCAATA AksGdsAdsGdsTdsAdsTdsGdsTds 18 2810
GdsGdsmCksAesAksTesAk
1198381 2563 2578 123588 123603 TAGAGTATGTGGCAAT TksAdsGdsAdsGdsTdsAdsTdsGdsTds 19 2811
GdsGksmCesAksAesTk
1198382 2564 2579 123589 123604 TTAGAGTATGTGGCAA TksTdsAdsGdsAdsGdsTdsAdsTdsGds 19 963
TdsGksGesmCksAesAk
1198383 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTdsTdsAdsGdsAdsGdsTdsAdsTds 31 810
GdsTksGesGksmCesAk
1198384 2566 2581 123591 123606 TATTAGAGTATGTGGC TksAdsTdsTdsAdsGdsAdsGdsTdsAds 6 2812
TdsGksTesGksGesmCk
1198385 2567 2582 123592 123607 ATATTAGAGTATGTGG AksTdsAdsTdsTdsAdsGdsAdsGdsTds 30 2813
AdsTksGesTksGesGk
1198386 2568 2583 123593 123608 TATATTAGAGTATGTG TksAdsTdsAdsTdsTdsAdsGdsAdsGds 77 2814
TdsAksTesGksTesGk
1198387 2570 2585 123595 123610 TCTATATTAGAGTATG TksmCdsTdsAdsTdsTdsTdsAds 84 887
GdsAdsGksTesAksTesGk
1198388 4436 4451 125461 125476 TATAACTGGGCAAATT TksAdsTdsAdsAdsmCdsTdsGdsGds 90 2815
GdsmCdsAksAesAksTesTk
1198389 4438 4453 125463 125478 GGTATAACTGGGCAAA GksGdsTdsAdsTdsAdsAdsmCdsTds 28 1427
GdsGdsGksmCesAksAesAk
1198390 4439 4454 125464 125479 AGGTATAACTGGGCAA AksGdsGdsTdsAdsTdsAdsAdsmCds 37 905
TdsGdsGksGesmCksAesAk
1198391 4440 4455 125465 125480 GAGGTATAACTGGGCA GksAdsGdsGdsTdsAdsTdsAdsAds 29 1503
mCdsTdsGksGesGksmCesAk
1198392 4446 4461 125471 125486 AACACTGAGGTATAAC AksAdsmCdsAdsmCdsTdsGdsAdsGds 48 2816
GdsTdsAksTesAksAesmCk
1198393 4595 4610 125620 125635 TTACATTAGGAACAAG TksTdsAdsmCdsAdsTdsTdsAdsGds 58 2817
GdsAdsAksmCesAksAesGk
1198394 4597 4612 125622 125637 TTTTACATTAGGAACA TksTdsTdsTdsAdsmCdsAdsTdsTdsAds 63 2818
GdsGdsGksAesAksmCesAk
1198395 4598 4613 125623 125638 CTTTTACATTAGGAAC mCksTdsTdsTdsTdsAdsmCdsAdsTds 35 1124
TdsAdsGksGesAksAesmCk
1198396 4599 4614 125624 125639 ACTTTTACATTAGGAA AksmCdsTdsTdsTdsTdsAdsmCdsAdsAds 25 2819
TdsTdsAksGesGksAesAk
1198397 4600 4615 125625 125640 CACTTTTACATTAGGA mCksAdsmCdsTdsTdsTdsTdsAdsmCds 17 1200
AdsTdsTksAesGksGesAk
1198398 4601 4616 125626 125641 GCACTTTTACATTAGG GksmCdsAdsmCdsTdsTdsTdsTdsAds 18 1276
mCdsAdsTksTesAksGesGk
1198399 4602 4617 125627 125642 AGCACTTTTACATTAG AksGdsmCdsAdsmCdsTdsTdsTdsTds 35 2820
AdsmCdsAksTesTksAesGk
1198400 4603 4618 125628 125643 AAGCACTTTTACATTA AksAdsGdsmCdsAdsmCdsTdsTdsTds 62 2821
TdsAdsmCksAesTksTesAk
1198401 4605 4620 125630 125645 TTAAGCACTTTTACAT TksTdsAdsAdsGdsmCdsAdsmCdsTds 63 2822
TdsTdsTksAesmCksAesTk
1198402 4795 4810 125820 125835 GGAAGATCTGAAACTC GksGdsAdsAdsGdsAdsTdsmCdsTds 32 2823
GdsAdsAksAesmCksTesmCk
1198403 4797 4812 125822 125837 TTGGAAGATCTGAAAC TksTdsGdsGdsAdsAdsGdsAdsTds 54 2824
mCdsTdsGksAesAksAesmCk
1198404 4798 4813 125823 125838 TTTGGAAGATCTGAAA TksTdsTdsGdsGdsAdsAdsGdsAdsTds 55 2825
mCdsTksGesAksAesAk
1198405 4799 4814 125824 125839 CTTTGGAAGATCTGAA mCksTdsTdsTdsGdsGdsAdsAdsGdsAds 36 2826
AdsTdsmCksTesGksAesAk
1198406 4800 4815 125825 125840 GCTTTGGAAGATCTGA GksmCdsTdsTdsTdsGdsGdsAdsAds 17 2044
GdsAdsTksmCesTksGesAk
1198407 4801 4816 125826 125841 TGCTTTGGAAGATCTG TksGdsmCdsTdsTdsTdsGdsGdsAds 23 2121
AdsGdsAksTesmCksTesGk
1198408 4802 4817 125827 125842 GTGCTTTGGAAGATCT GksTdsGdsmCdsTdsTdsTdsGdsGds 41 2827
AdsAdsGksAesTksmCesTk
1198409 4803 4818 125828 125843 AGTGCTTTGGAAGATC AksGdsTdsGdsmCdsTdsTdsTdsGds 19 2828
GdsAdsAksGesAksTesmCk
1198410 4805 4820 125830 125845 ATAGTGCTTTGGAAGA AksTdsAdsGdsTdsGdsmCdsTdsTdsTds 48 2829
GdsGksAesAksGesAk
1198411 N/A N/A 94729 94744 AGGATGCATGGTTTTT AksGdsGdsAdsTdsGdsmCdsAdsTds 33 2830
GdsGdsTksTesTksTesTk
1198412 N/A N/A 94731 94746 TTAGGATGCATGGTTT TksTdsAdsGdsGdsAdsTdsGdsmCds 17 2831
AdsTdsGksGesTksTesTk
1198413 N/A N/A 94732 94747 TTTAGGATGCATGGTT TksTdsTdsAdsGdsGdsAdsTdsGdsmCds 29 2832
mCdsAdsTksGesGksTesTk
1198414 N/A N/A 94733 94748 ATTTAGGATGCATGGT AksTdsTdsTdsAdsGdsGdsAdsGds 20 2833
mCdsAksTesGksGesTk
1198415 N/A N/A 94734 94749 GATTTAGGATGCATGG GksAdsTdsTdsTdsAdsGdsGdsAdsTds 29 2834
GdsmCksAesTksGesGk
1198416 N/A N/A 94735 94750 AGATTTAGGATGCATG AksGdsAdsTdsTdsTdsAdsGdsGdsAds 29 2835
TdsGksmCesAksTesGk
1198417 N/A N/A 94736 94751 CAGATTTAGGATGCAT mCksAdsGdsAdsTdsTdsTdsAdsGds 40 2836
GdsAdsTksGesmCksAesTk
1198418 N/A N/A 94737 94752 TCAGATTTAGGATGCA TksmCdsAdsGdsAdsTdsTdsTdsAds 67 2837
GdsGdsAdsTesGksmCesAk
1198419 N/A N/A 94739 94754 ATTCAGATTTAGGATG AksTdsTdsmCdsAdsGdsAdsTdsTdsTds 78 2838
AdsAdsGksGesAksTesGk
1198420 N/A N/A 115903 115918 ATATGGTTTTGTGTGT AksTdsAdsTdsGdsGdsTdsTdsTdsTds 41 2839
GdsTksGesTksGesTk
1198421 N/A N/A 115905 115920 TTATATGGTTTTGTGT TksTdsAdsTdsAdsTdsGdsGdsTdsTds 36 2840
TdsTksGesTksGesTk
1198422 N/A N/A 115906 115921 CTTATATGGTTTTGTG mCksTdsTdsAdsTdsAdsTdsGdsGds 18 2788
TdsTdsTksTesGksTesGk
1198423 N/A N/A 115907 115922 TCTTATATGGTTTTGT TksmCdsTdsTdsAdsTdsAdsTdsGds 10 2841
GdsTdsTksTesTksGesTk
1198424 N/A N/A 115908 115923 CTCTTATATGGTTTTG mCksTdsmCdsTdsTdsAdsTdsAdsTds 15 2842
GdsGdsTksTesTksTesGk
1198429 N/A N/A 117325 117340 ATTGCAATCTGTCTGA AksTdsTdsGdsmCdsAdsAdsTdsmCds 48 2843
TdsGdsTksmCesTksGesAk
1198430 N/A N/A 117327 117342 ATATTGCAATCTGTCT AksTdsAdsTdsTdsGdsmCdsAdsAds 49 2844
TdsmCdsTksGesTksmCesTk
1198431 N/A N/A 117328 117343 AATATTGCAATCTGTC AksAdsTdsAdsTdsTdsGdsmCdsAds 35 2845
AdsTdsmCksTesGksTesmCk
1198432 N/A N/A 117329 117344 TAATATTGCAATCTGT TksAdsAdsTdsAdsTdsTdsGdsmCds 70 2846
AdsAdsTksmCesTksGesTk
1198433 N/A N/A 117330 117345 GTAATATTGCAATCTG GksTdsAdsAdsTdsAdsTdsTdsGds  36 1404
mCdsAdsAksTesmCksTesGk
1198434 N/A N/A 117331 117346 TGTAATATTGCAATCT TksGdsTdsAdsAdsTdsAdsTdsTdsGds 78 2847
mCdsAksAesTksmCesTk
1198435 N/A N/A 117332 117347 ATGTAATATTGCAATC AksTdsGdsTdsAdsAdsTdsAdsTdsTds 57 2848
GdsmCksAesAksTesmCk
1198436 N/A N/A 117333 117348 TATGTAATATTGCAAT TksAdsTdsGdsTdsAdsAdsTdsAdsTds 69 2849
TdsGksmCesAksAesTk
1198437 N/A N/A 117335 117350 TTTATGTAATATTGCA TksTdsTdsAdsTdsGdsTdsAdsAdsTds 63 2850
AdsTksTesGksmCesAk
1198447 N/A N/A 119667 119682 TAAGGTTTCCCAGATT TksAdsAdsGdsGdsTdsTdsTdsmCds 63 2851
mCdsAksGesAksTesTk
1198448 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA AksGdsTdsAdsAdsGdsGdsTdsTdsTds 36 2852
mCdsmCksmCesAksGesAk
1198449 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG AksAdsGdsTdsAdsAdsGdsGdsTds 37 2853
TdsTdsmCksmCesmCksAesGk
1198450 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA TksAdsAdsGdsTdsAdsAdsGdsGds 42 2854
TdsTdsTksmCesmCksmCesAk
1198451 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC mCksTdsAdsAdsGdsTdsAdsAdsGds 48 1101
GdsTdsTksTesmCksmCesmCk
1198452 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC AksmCdsTdsAdsAdsGdsTdsAdsAds 38 2855
GdsGdsTksTesTksmCesmCk
1198453 N/A N/A 119674 119689 GACTAAGTAAGGTTTC GksAdsmCdsTdsAdsAdsGdsTdsAds 48 2856
AdsGdsGksTesTksTesmCk
1198454 N/A N/A 119675 119690 AGACTAAGTAAGGTTT AksGdsAdsmCdsTdsAdsAdsGdsTds 39 2857
AdsAdsGksGesTksTesTk
1198455 N/A N/A 119677 119692 TTAGACTAAGTAAGGT TksTdsAdsGdsAdsmCdsTdsAdsAds 42 2858
GdsTdsAksAesGksGesTk

TABLE 40
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ ID
Number Site Site Site Site Sequence (5′ to 3′) CHEMISTRY NOTATION (% UTC) NO
715487 3630 3645 124655 124670 ATTACTTCATAGCTTA AksTksTksAdsmCdsTdsTdsmCdsAds 28 52
TdsAdsGdsmCdsTksTksAk
958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTksAdsGdsAdsGdsTdsAdsTds 15 810
GdsTdsGdsGksmCksAk
1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAksAdsTdsTdsGdsTdsmCds 9 2800
TdsmCdsAdsTdsGksmCksmCk
1198425 N/A N/A 115909 115924 ACTCTTATATGGTTTT AksmCdsTdsmCdsTdsTdsAdsTdsAds 35 2859
TdsGdsGksTesTksTesTk
1198426 N/A N/A 115910 115925 AACTCTTATATGGTTT AksAdsmCdsTdsmCdsTdsTdsAdsTds 111 2860
AdsTdsGksGesTksTesTk
1198427 N/A N/A 115911 115926 CAACTCTTATATGGTT mCksAdsAdsmCdsTdsmCdsTdsTdsAds 62 2861
TdsAdsTksGesGksTesTk
1198428 N/A N/A 115913 115928 GACAACTCTTATATGG GksAdsmCdsAdsAdsmCdsTdsmCdsTds 62 2862
TdsAdsTksAesTksGesGk
1198438 N/A N/A 117755 117770 TGTATGTCAGAAGAGT TksGdsTdsAdsTdsGdsTdsmCdsAds 7 2863
GdsAdsAksGesAksGesTk
1198439 N/A N/A 117757 117772 AGTGTATGTCAGAAGA AksGdsTdsGdsTdsAdsTdsGdsTdsmCds 6 2864
AdsGksAesAksGesAk
1198440 N/A N/A 117758 117773 AAGTGTATGTCAGAAG AksAdsGdsTdsGdsTdsAdsTdsGdsTds 5 2865
mCdsAksGesAksAesGk
1198441 N/A N/A 117759 117774 AAAGTGTATGTCAGAA AksAdsAdsGdsTdsGdsTdsAdsTdsGds 19 2866
TdsmCksAesGksAesAk
1198442 N/A N/A 117760 117775 TAAAGTGTATGTCAGA TksAdsAdsAdsGdsTdsGdsTdsAdsTds 44 2867
GdsTksmCesAksGesAk
1198443 N/A N/A 117761 117776 TTAAAGTGTATGTCAG TksTdsAdsAdsAdsGdsTdsGdsTdsAds 39 2868
TdsGksTesmCksAesGk
1198444 N/A N/A 117762 117777 TTTAAAGTGTATGTCA TksTdsTdsAdsAdsAdsGdsTdsGdsTds 70 2869
AdsTksGesTksmCesAk
1198445 N/A N/A 117763 117778 CTTTAAAGTGTATGTC mCksTdsTdsTdsAdsAdsAdsGdsTds 61 1634
GdsTdsAksTesGksTesmCk
1198446 N/A N/A 117765 117780 AACTTTAAAGTGTATG AksAdsmCdsTdsTdsTdsAdsAdsAds 83 2870
GdsTdsGksTesAksTesGk
1198714 2524 2539 123549 123564 TGTCTCATGCCTTATA TksGesTksmCdsTdsmCdsAdsTdsGds 20 2803
mCdsmCdsTdsTesAesTksAk
1198715 2526 2541 123551 123566 ATTGTCTCATGCCTTA AksTesTksGdsTdsmCdsTdsmCdsAds 33 2804
TdsGdsmCdsmCesTesTksAk
1198716 2527 2542 123552 123567 AATTGTCTCATGCCTT AksAesTksTdsGdsTdsmCdsTdsmCds 27 2805
AdsTdsGdsmCesmCesTksTk
1198717 2528 2543 123553 123568 AAATTGTCTCATGCCT AksAesAksTdsTdsGdsTdsmCdsTds 41 443
mCdsAdsTdsGesmCesmCksTk
1198718 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAesAksAdsTdsTdsGdsTdsmCdsTds 9 2800
mCdsAdsTesGesmCksmCk
1198719 2530 2545 123555 123570 GGAAATTGTCTCATGC GksGesAksAdsAdsTdsTdsGdsTdsmCds 14 2806
TdsmCdsAesTesGksmCk
1198720 2531 2546 123556 123571 TGGAAATTGTCTCATG TksGesGksAdsAdsAdsTdsTdsGdsTds 21 2807
mCdsTdsmCesAesTksGk
1198721 2532 2547 123557 123572 ATGGAAATTGTCTCAT AksTesGksGdsAdsAdsAdsTdsTdsGds 48 2808
TdsmCdsTesmCesAksTk
1198722 2534 2549 123559 123574 ATATGGAAATTGTCTC AksTesAksTdsGdsGdsAdsAdsAdsTds 48 656
TdsGdsTesmCesTksmCk
1198723 2560 2575 123585 123600 AGTATGTGGCAATAAT AksGesTksAdsTdsGdsTdsGdsGds 57 2809
mCdsAdsAdsTesAesAksTk
1198724 2562 2577 123587 123602 AGAGTATGTGGCAATA AksGesAksGdsTdsAdsTdsGdsTdsGds 16 2810
GdsmCdsAesAesTksAk
1198725 2563 2578 123588 123603 TAGAGTATGTGGCAAT TksAesGksAdsGdsTdsAdsTdsGdsTds 23 2811
GdsGdsmCesAesAksTk
1198726 2564 2579 123589 123604 TTAGAGTATGTGGCAA TksTesAksGdsAdsGdsTdsAdsTdsGds 28 963
TdsGdsGesmCesAksAk
1198727 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTesTksAdsGdsAdsGdsTdsAdsTds 19 810
GdsTdsGesGesmCksAk
1198728 2566 2581 123591 123606 TATTAGAGTATGTGGC TksAesTksTdsAdsGdsAdsGdsTdsAds 17 2812
TdsGdsTesGesGksmCk
1198729 2567 2582 123592 123607 ATATTAGAGTATGTGG AksTesAksTdsTdsAdsGdsAdsGdsTds 21 2813
AdsTdsGesTesGksGk
1198730 2568 2583 123593 123608 TATATTAGAGTATGTG TksAesTksAdsTdsTdsAdsGdsAdsGds 57 2814
TdsAdsTesGesTksGk
1198731 2570 2585 123595 123610 TCTATATTAGAGTATG TksmCesTksAdsTdsAdsTdsTdsAdsGds 59 887
AdsGdsTesAesTksGk
1198732 4436 4451 125461 125476 TATAACTGGGCAAATT TksAesTksAdsAdsmCmsTdsGdsGds 86 2815
GdsmCdsAdsAesAesTksTk
1198741 4595 4610 125620 125635 TTACATTAGGAACAAG TksTesAksmCdsAdsTdsTdsAdsGds 60 2817
GdsAdsAdsmCesAesAksGk
1198742 4597 4612 125622 125637 TTTTACATTAGGAACA TksTesTksTdsAdsmCdsAdsTdsTdsAds 143 2818
GdsGdsAesAesmCksAk
1198743 4598 4613 125623 125638 CTTTTACATTAGGAAC mCksTesTksTdsTdsAdsmCdsAdsTds 86 1124
TdsAdsGdsGesAesAksmCk
1198744 4599 4614 125624 125639 ACTTTTACATTAGGAA AksmCesTksTdsTdsTdsAdsmCdsAds 66 2819
TdsTdsAdsGesGesAksAk
1198745 4600 4615 125625 125640 CACTTTTACATTAGGA mCksAesmCksTdsTdsTdsTdsAdsmCds 57 1200
AdsTdsTdsAesGesGksAk
1198746 4601 4616 125626 125641 GCACTTTTACATTAGG GksmCesAksmCdsTdsTdsTdsTdsAds 7 1276
mCdsAdsTdsTesAesGksGk
1198747 4602 4617 125627 125642 AGCACTTTTACATTAG AksGesmCksAdsmCdsTdsTdsTdsTds 38 2820
AdsmCdsAdsTesTesAksGk
1198748 4603 4618 125628 125643 AAGCACTTTTACATTA AksAesGksmCdsAdsmCdsTdsTdsTds 81 2821
TdsAdsmCdsAesTesTksAk
1198749 4605 4620 125630 125645 TTAAGCACTTTTACAT TksTesAksAdsGdsmCdsAdsmCdsTds 73 2822
TdsTdsTdsAesmCesAksTk
1198750 4795 4810 125820 125835 GGAAGATCTGAAACTC GksGesAksAdsGdsAdsTdsmCdsTds 32 2823
GdsAdsAdsAesmCesTksmCk
1198751 4797 4812 125822 125837 TTGGAAGATCTGAAAC TksTesGksGdsAdsAdsGdsAdsTdsmCds 76 2824
TdsGdsAesAesAksmCk
1198752 4798 4813 125823 125838 TTTGGAAGATCTGAAA TksTesTksGdsGdsAdsAdsGdsAdsTds 111 2825
mCdsTdsGesAesAksAk
1198753 4799 4814 125824 125839 CTTTGGAAGATCTGAA mCksTesTksTdsGdsGdsAdsAdsGds 58 2826
GdsTdsmCdsTesGesAksAk
1198754 4800 4815 125825 125840 GCTTTGGAAGATCTGA GksmCesTksTdsTdsGdsGdsAdsAds 23 2044
GdsAdsTdsmCesTesGksAk
1198755 4801 4816 125826 125841 TGCTTTGGAAGATCTG TksGesmCksTdsTdsGdsGdsAds 32 2121
AdsGdsAdsTesmCesTksGk
1198756 4802 4817 125827 125842 GTGCTTTGGAAGATCT GksTesGksmCdsTdsTdsTdsGdsGds 50 2827
AdsAdsGdsAesTesmCksTk
1198757 4803 4818 125828 125843 AGTGCTTTGGAAGATC AksGesTksGdsmCdsTdsTdsTdsGds 40 2828
GdsAdsAdsGesAesTksmCk
1198758 4805 4820 125830 125845 ATAGTGCTTTGGAAGA AksTesAksGdsTdsGdsmCdsTdsTds 47 2829
TdsGdsGdsAesAesGksAk
1198759 N/A N/A 94729 94744 AGGATGCATGGTTTTT AksGesGksAdsTdsGdsmCdsAdsTds 27 2830
GdsGdsTdsTesTesTksTk
1198760 N/A N/A 94731 94746 TTAGGATGCATGGTTT TksTesAksGdsGdsAdsTdsGdsmCds 91 2831
AdsTdsGdsGesTesTksTk
1198761 N/A N/A 94732 94747 TTTAGGATGCATGGTT TksTesTksAdsGdsGdsAdsTdsGdsmCds 42 2832
AdsTdsGesGesTksTk
1198762 N/A N/A 94733 94748 ATTTAGGATGCATGGT AksTesTksTdsAdsGdsGdsAdsTdsGds 30 2833
mCdsAdsTesGesGksTk
1198763 N/A N/A 94734 94749 GATTTAGGATGCATGG GksAesTksTdsTdsAdsGdsGdsAdsTds 26 2834
GdsmCdsAesTesGksGk
1198764 N/A N/A 94735 94750 AGATTTAGGATGCATG AksGesAksTdsTdsTdsAdsGdsGdsAds 28 2835
TdsGdsmCesAesTksGk
1198765 N/A N/A 94736 94751 CAGATTTAGGATGCAT mCksAesGksAdsTdsTdsTdsAdsGds 23 2836
GdsAdsTdsGesmCesAksTk
1198766 N/A N/A 94737 94752 TCAGATTTAGGATGCA TksmCesAksGdsAdsTdsTdsTdsAds 19 2837
GdsGdsAdsTesGesmCksAk
1198767 N/A N/A 94739 94754 ATTCAGATTTAGGATG AksTksmC TesdsAdsGdsAdsTdsTds 65 2838
TdsAdsGdsGesAesTksGk
1198777 N/A N/A 117325 117340 ATTGCAATCTGTCTGA AksTesTksGdsmCdsAdsAdsTdsmCds 84 2843
TdsGdsTdsmCesTesGksAk
1198778 N/A N/A 117327 117342 ATATTGCAATCTGTCT AksTesAksTdsTdsGdsmCdsAdsAds 55 2844
TdsmCdsTdsGesTesmCksTk
1198779 N/A N/A 117328 117343 AATATTGCAATCTGTC AksAesTksAdsTdsTdsGdsmCdsAds 49 2845
AdsTdsmCdsTesGesTksmCk
1198780 N/A N/A 117329 117344 TAATATTGCAATCTGT TksAesAksTdsAdsTdsTdsGdsmCds 80 2846
AdsAdsTdsmCesTesGksTk
1198781 N/A N/A 117330 117345 GTAATATTGCAATCTG GksTesAksAdsTdsAdsTdsTdsGdsmCds 25 1404
AdsAdsTesmCesTksGk
1198782 N/A N/A 117331 117346 TGTAATATTGCAATCT TksGesTksAdsAdsTdsAdsTdsTdsGds 61 2847
mCdsAdsAesTesmCksTk
1198783 N/A N/A 117332 117347 ATGTAATATTGCAATC AksTesGksTdsAdsAdsTdsAdsTdsTds 78 2848
GdsmCdsAesAesTksmCk
1198784 N/A N/A 117333 117348 TATGTAATATTGCAAT TksAesTksGdsTdsAdsAdsTdsAdsTds 94 2849
TdsGdsmCesAesAksTk
1198785 N/A N/A 117335 117350 TTTATGTAATATTGCA TksTesTksAdsTdsGdsTdsAdsAdsTds 86 2850
AdsTdsTesGesmCksAk
1198795 N/A N/A 119667 119682 TAAGGTTTCCCAGATT TksAesAksGdsGdsTdsTdsTdsmCds 43 2851
mCdsmCdsAdsGesAesTksTk
1198796 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA AksGesTksAdsAdsGdsGdsTdsTdsTds 32 2852
mCdsmCdsmCesAesGksAk
1198797 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG AksAesGksTdsAdsAdsGdsGdsTdsTds 31 2853
TdsmCdsmCesmCesAksGk
1198798 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA TksAesAksGdsTdsAdsAdsGdsGdsTds 38 2854
TdsTdsmCesmCesmCksAk
1198799 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC mCksTesAksAdsGdsTdsAdsAdsGds 18 1101
GdsTdsTdsTesmCesmCksmCk
1198800 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC AksmCesTksAdsAdsGdsTdsAdsAds 47 2855
GdsGdsTdsTesTesmCksmCk
1198801 N/A N/A 119674 119689 GACTAAGTAAGGTTTC GksAesmCksTdsAdsAdsGdsTdsAds 47 2856
AdsGdsGdsTesTesTksmCk
1198802 N/A N/A 119675 119690 AGACTAAGTAAGGTTT AksGesAksmCdsTdsAdsAdsGdsTds 83 2857
AdsAdsGdsGesTesTksTk
1198803 N/A N/A 119677 119692 TTAGACTAAGTAAGGT TksTesAksGdsAdsmCdsTdsAdsAdsGds 62 2858
TdsAdsAesGesGksTk

TABLE 41
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ ID
Number Site Site Site Site Sequence (5′ to 3′) CHEMISTRY NOTATION (% UTC) NO
715487 3630 3645 124655 124670 ATTACTTCATAGCTTA AksTksTksAdsmCdsTdsTdsmCdsAds 28 52
TdsAdsGdsmCdsTksTksAk
958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTksAdsGdsAdsGdsTdsAdsTds 14 810
GdsTdsGdsGksmCksAk
1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAksAdsTdsTdsGdsTdsmCdsTds 12 2800
mCdsAdsTdsGksmCksmCk
1198628 2524 2539 123549 123564 TGTCTCATGCCTTATA TksGksTdsmCdsTdsmCdsAdsTdsGds 27 2803
mCdsmCdsTdsTksAesTksAe
1198629 2526 2541 123551 123566 ATTGTCTCATGCCTTA AksTksTdsGdsTdsmCdsTdsmCdsAds 22 2804
TdsGdsmCdsmCksTesTksAe
1198630 2527 2542 123552 123567 AATTGTCTCATGCCTT AksAksTdsTdsGdsTdsmCdsTdsmCds 37 2805
AdsTdsGdsmCksmCesTksTe
1198631 2528 2543 123553 123568 AAATTGTCTCATGCCT AksAksAdsTdsTdsGdsTdsmCdsTds 53 443
mCdsAdsTdsGksmCesmCksTe
1198632 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAdsAdsTdsTdsGdsTdsmCds 21 2800
TdsmCdsAdsTksGesmCksmCe
1198633 2530 2545 123555 123570 GGAAATTGTCTCATGC GksGksAdsAdsAdsTdsTdsGdsTds 46 2806
mCdsTdsmCdsAksTesGksmCe
1198634 2531 2546 123556 123571 TGGAAATTGTCTCATG TksGksGdsAdsAdsAdsTdsTdsGdsTds 34 2807
mCdsTdsmCksAesTksGe
1198635 2532 2547 123557 123572 ATGGAAATTGTCTCAT AksTksGdsGdsAdsAdsAdsTdsTdsGds 57 2808
TdsmCdsTksmCesAksTe
1198636 2534 2549 123559 123574 ATATGGAAATTGTCTC AksTksAdsTdsGdsGdsAdsAdsAdsTds 41 656
TdsGdsTksmCesTksmCe
1198637 2560 2575 123585 123600 AGTATGTGGCAATAAT AksGksTdsAdsTdsGdsTdsGdsGds 64 2809
mCdsAdsAdsTksAesAksTe
1198638 2562 2577 123587 123602 AGAGTATGTGGCAATA AksGksAdsGdsTdsAdsTdsGdsTdsGds 18 2810
GdsmCdsAksAesTksAe
1198639 2563 2578 123588 123603 TAGAGTATGTGGCAAT TksAksGdsAdsGdsTdsAdsTdsGdsTds 32 2811
GdsGdsmCksAesAksTe
1198640 2564 2579 123589 123604 TTAGAGTATGTGGCAA TksTksAdsGdsAdsGdsTdsAdsTdsGds 26 963
TdsGdsGksmCesAksAe
1198641 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTdsAdsGdsAdsGdsTdsAdsTds 15 810
GdsTdsGksGesmCksAe
1198642 2566 2581 123591 123606 TATTAGAGTATGTGGC TksAksTdsTdsAdsGdsAdsGdsTdsAds 19 2812
TdsGdsTksGesGksmCe
1198643 2567 2582 123592 123607 ATATTAGAGTATGTGG AksTksAdsTdsTdsAdsGdsAdsGdsTds 25 2813
AdsTdsGksTesGksGe
1198644 2568 2583 123593 123608 TATATTAGAGTATGTG TksAksTdsAdsTdsTdsAdsGdsAdsGds 73 2814
TdsAdsTksGesTksGe
1198645 2570 2585 123595 123610 TCTATATTAGAGTATG TksmCksTdsAdsTdsAdsTdsTdsAdsGds 73 887
AdsGdsTksAesTksGe
1198651 4595 4610 125620 125635 TTACATTAGGAACAAG TksTksAdsmCdsAdsTdsTdsAdsGdsGds 94 2817
AdsAdsmCksAesAksGe
1198652 4597 4612 125622 125637 TTTTACATTAGGAACA TksTksTdsTdsAdsmCdsAddsTdsTds 68 2818
AdsGdsGdsAksAesmCksAe
1198653 4598 4613 125623 125638 CTTTTACATTAGGAAC mCksTksTdsTdsTdsAdsmCdsAdsTds 64 1124
TdsAdsGdsGksAesAksmCe
1198654 4599 4614 125624 125639 ACTTTTACATTAGGAA AksmCksTdsTdsTdsTdsAdsmCdsAds 91 2819
TdsTdsAdsGksGesAksAe
1198655 4600 4615 125625 125640 CACTTTTACATTAGGA mCksAksmCdsTdsTdsTdsTdsAdsmCds 30 1200
AdsTdsTdsAksGesGksAe
1198656 4601 4616 125626 125641 GCACTTTTACATTAGG GksmCksAdsmCdsTdsTdsTdsTdsAds 11 1276
mCdsAdsTdsTksAesGksGe
1198657 4602 4617 125627 125642 AGCACTTTTACATTAG AksGksmCdsAdsmCdsTdsTdsTdsTds 95 2820
AdsmCdsAdsTksTesAksGe
1198658 4603 4618 125628 125643 AAGCACTTTTACATTA AksAksGdsmCdsAdsmCdsTdsTdsTds 62 2821
TdsAdsmCdsAksTesTksAe
1198659 4605 4620 125630 125645 TTAAGCACTTTTACAT TksTksAdsAdsGdsmCdsAdsmCdsTds 58 2822
TdsTdsTdsAksmCesAksTe
1198660 4795 4810 125820 125835 GGAAGATCTGAAACTC GksGksAdsAdsGdsAdsTdsmCdsTds 66 2823
GdsAdsAdsAksmCesTksmCe
1198661 4797 4812 125822 125837 TTGGAAGATCTGAAAC TksTksGdsGdsAdsAdsGdsAdsTds 111 2824
mCdsTdsGdsAksAesAksmCe
1198662 4798 4813 125823 125838 TTTGGAAGATCTGAAA TksTksTdsGdsGdsAdsAdsGdsAdsTds 83 2825
mCdsTdsGksAesAksAe
1198663 4799 4814 125824 125839 CTTTGGAAGATCTGAA mCksTksTdsTdsGdsGdsAdsAdsGds 76 2826
AdsTdsmCdsTksGesAksAe
1198664 4800 4815 125825 125840 GCTTTGGAAGATCTGA GksmCksTdsTdsTdsGdsGdsAdsAds 18 2044
GdsAdsTdsmCksTesGksAe
1198665 4801 4816 125826 125841 TGCTTTGGAAGATCTG TksGksmCdsTdsTdsTdsGdsGdsAdsAds 38 2121
GdsAdsTksmCesTksGe
1198666 4802 4817 125827 125842 GTGCTTTGGAAGATCT GksTksGdsmCdsTdsTdsTdsGdsGdsAds 44 2827
AdsGdsAksTesmCksTe
1198667 4803 4818 125828 125843 AGTGCTTTGGAAGATC AksGksTdsGdsmCdsTdsTdsTdsGdsGds 40 2828
AdsAdsGksAesTksmCe
1198668 4805 4820 125830 125845 ATAGTGCTTTGGAAGA AksTksAdsGdsTdsGdsmCdsTdsTdsTds 72 2829
GdsGdsAksAesGksAe
1198669 N/A N/A 94729 94744 AGGATGCATGGTTTTT AksGksGdsAdsTdsGdsmCdsAdsTds 61 2830
GdsGdsTdsTksTesTksTe
1198670 N/A N/A 94731 94746 TTAGGATGCATGGTTT TksTksAdsGdsGdsAdsTdsGdsmCds 55 2831
AdsTdsGdsGksTesTksTe
1198671 N/A N/A 94732 94747 TTTAGGATGCATGGTT TksTksTdsAdsGdsGdsAdsTdsGdsmCds 26 2832
AdsTdsGksGesTksTe
1198672 N/A N/A 94733 94748 ATTTAGGATGCATGGT AksTksTdsTdsAdsGdsGdsAdsTdsGds  41 2833
mCdsAdsTksGesGksTe
1198673 N/A N/A 94734 94749 GATTTAGGATGCATGG GksAksTdsTdsTdsAdsGdsGdsAdsTds 10 2834
GdsmCdsAksTesGksGe
1198674 N/A N/A 94735 94750 AGATTTAGGATGCATG AksGksAdsTdsTdsTdsAdsGdsGdsAds 21 2835
TdsGdsmCksAesTksGe
1198675 N/A N/A 94736 94751 CAGATTTAGGATGCAT mCksAksGdsAdsTdsTdsTdsAdsGds 35 2836
GdsAdsTdsGksmCesAksTe
1198676 N/A N/A 94737 94752 TCAGATTTAGGATGCA TksmCksAdsGdsAdsTdsTdsTdsAdsGds 52 2837
GdsAdsTksGesmCksAe
1198677 N/A N/A 94739 94754 ATTCAGATTTAGGATG AksTksTdsmCdsAdsGdsAdsTdsTdsTds 87 2838
AdsGdsGksAesTksGe
1198687 N/A N/A 117325 117340 ATTGCAATCTGTCTGA AksTksTdsGdsmCdsAdsAdsTdsmCds 55 2843
TdsGdsTdsmCksTesGksAe
1198688 N/A N/A 117327 117342 ATATTGCAATCTGTCT AksTksAdsTdsTdsGdsmCdsAdsAds 48 2844
TdsmCdsTdsGksTesmCksTe
1198689 N/A N/A 117328 117343 AATATTGCAATCTGTC AksAksTdsAdsTdsTdsGdsmCdsAds 91 2845
AdsTdsmCdsTksGesTksmCe
1198690 N/A N/A 117329 117344 TAATATTGCAATCTGT TksAksAdsTdsAdsTdsTdsGdsmCdsAds 64 2846
AdsTdsmCksTesGksTe
1198691 N/A N/A 117330 117345 GTAATATTGCAATCTG GksTksAdsAdsTdsAdsTdsTdsGdsmCds 38 1404
AdsAdsTksmCesTksGe
1198692 N/A N/A 117331 117346 TGTAATATTGCAATCT TksGksTdsAdsAdsTdsAdsTdsTdsGds 120 2847
mCdsAdsAksTesmCksTe
1198733 4438 4453 125463 125478 GGTATAACTGGGCAAA GksGesTksAdsTdsAdsAdsmCdsTds 47 1427
GdsGdsGdsmCesAesAksAk
1198734 4439 4454 125464 125479 AGGTATAACTGGGCAA AksGesGksTdsAdsTdsAdsAdsmCds 29 905
TdsGdsGdsGesmCesAksAk
1198735 4440 4455 125465 125480 GAGGTATAACTGGGCA GksAesGksGdsTdsAdsTdsAdsAds 34 1503
mCdsTdsGdsGesGesmCksAk
1198736 4441 4456 125466 125481 TGAGGTATAACTGGGC TksGesAksGdsGdsTdsAdsTdsAdsAds 20 1580
mCdsTdsGesGesGksmCk
1198737 4442 4457 125467 125482 CTGAGGTATAACTGGG mCksTesGksAdsGdsGdsTdsAdsTds 24 2801
AdsAdsmCdsTesGesGksGk
1198738 4443 4458 125468 125483 ACTGAGGTATAACTGG AksmCesTksGdsAdsGdsGdsTdsAds 38 392
TdsAdsAdsmCesTesGksGk
1198739 4444 4459 125469 125484 CACTGAGGTATAACTG mCksAesmCksTdsGdsAdsGdsGdsTds 94 2802
AdsTdsAdsAesmCesTksGk
1198740 4446 4461 125471 125486 AACACTGAGGTATAAC AksAesmCksAdsmCdsTdsGdsAdsGds 39 2816
GdsTdsAdsTesAesAksmCk
1198768 N/A N/A 115903 115918 ATATGGTTTTGTGTGT AksTesAksTdsGdsGdsTdsTdsTdsTds 61 2839
GdsTdsGesTesGksTk
1198769 N/A N/A 115905 115920 TTATATGGTTTTGTGT TksTesAksTdsAdsTdsGdsGdsTdsTds 77 2840
TdsTdsGesTesGksTk
1198770 N/A N/A 115906 115921 CTTATATGGTTTTGTG mCksTesTksAdsTdsAdsTdsGdsGds 40 2788
TdsTdsTdsTesGesTksGk
1198771 N/A N/A 115907 115922 TCTTATATGGTTTTGT TksmCesTksTdsAdsTdsAdsTdsGds 85 2841
GdsTdsTdsTesTesGksTk
1198772 N/A N/A 115908 115923 CTCTTATATGGTTTTG mCksTesmCksTdsTdsAdsTdsAdsTds 41 2842
GdsGdsTdsTesTesTksGk
1198773 N/A N/A 115909 115924 ACTCTTATATGGTTTT AksmCesTksmCdsTdsTdsAdsTdsAds 58 2859
TdsGdsGdsTesTesTksTk
1198774 N/A N/A 115910 115925 AACTCTTATATGGTTT AksAesmCdsTdsmCdsTdsTdsAdsTds 106 2860
AdsTdsGdsGesTesTksTk
1198775 N/A N/A 115911 115926 CAACTCTTATATGGTT mCksAesAksmCdsTdsmCdsTdsTds 113 2861
AdsTdsAdsTdsGesGesTksTk
1198776 N/A N/A 115913 115928 GACAACTCTTATATGG GksAesmCksAdsAdsmCdsTdsmCds 57 2862
TdsTdsAdsTdsAesTesGksGk
1198786 N/A N/A 117755 117770 TGTATGTCAGAAGAGT TksGesTksAdsTdsGdsTdsmCdsAds 16 2863
AdsAdsGesAesGksTk
1198787 N/A N/A 117757 117772 AGTGTATGTCAGAAGA AksGesTksGdsTdsAdsTdsGdsTdsmCds 9 2864
AdsGdsAesAesGksAk
1198788 N/A N/A 117758 117773 AAGTGTATGTCAGAAG AksAesGksTdsGdsTdsAdsTdsGdsTds 17 2865
mCdsAdsGesAesAksGk
1198789 N/A N/A 117759 117774 AAAGTGTATGTCAGAA AksAesAksGdsTdsGdsTdsAdsTdsGds 22 2866
TdsmCdsAesGesAksAk
1198790 N/A N/A 117760 117775 TAAAGTGTATGTCAGA TksAesAksGdsTdsGdsTdsAdsTdsGds 27 2867
GdsTdsmCesAesGksAk
1198791 N/A N/A 117761 117776 TTAAAGTGTATGTCAG TksTesAksAdsAdsGdsTdsGdsTdsAds 39 2868
TdsGdsTesmCesAksGk
1198792 N/A N/A 117762 117777 TTTAAAGTGTATGTCA TksTesTksAdsAdsAdsGdsTksGdsTds 48 2869
AdsTdsGesTesmCksAk
1198793 N/A N/A 117763 117778 CTTTAAAGTGTATGTC mCksTesTksTdsAdsAdsGdsTdsGdsAds 34 1634
GdsTdsAdsTesGesTksmCk
1198794 N/A N/A 117765 117780 AACTTTAAAGTGTATG AksAesmcksTdsTdsAdsAdsAdsGds 74 2870
TdsGdsTesAesTksGk

TABLE 42
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ ID
Number Site Site Site Site Sequence (5′ to 3′) CHEMISTRY NOTATION (% UTC) NO
715487 3630 3645 124655 124670 ATTACTTCATAGCTTA AksTksTksAdsmCdsTdsTdsmCdsAds 29 52
TdsAdsGdsmCdsTksTksAk
958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTksAdsGdsAdsGdsTdsAdsTds 15 810
GdsTdsGdsGksmCksAk
1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAksAdsTdsTdsGdsTdsmCdsTds 11 2800
mCdsAdsTdsGksmCksmCk
1095463 4443 4458 125468 125483 ACTGAGGTATAACTGG AksmCksTdsGdsAdsGdsGdsTdsAds 37 392
TdsAdsAdsmCksTesGksGe
1095481 4441 4456 125466 125481 TGAGGTATAACTGGGC TksGksAdsGdsGdsTdsAdsTdsAdsAds 21 1580
mCdsTdsGksGesGksmCe
1095482 4442 4457 125467 125482 CTGAGGTATAACTGGG mCksTksGdsAdsGdsGdsTdsAdsTds 72 2801
AdsAdsmCdsTksGesGksGe
1095483 4444 4459 125469 125484 CACTGAGGTATAACTG mCksAksmCdsTdsGdsAdsGdsGdsTds 101 2802
AdsTdsAdsAksmCesTksGe
1198198 2524 2539 123549 123564 TGTCTCATGCCTTATA TksGksTdsmCdsTdsmCdsAdsTdsGds 29 2803
mCdsmCdsTesTesAesTksAk
1198199 2526 2541 123551 123566 ATTGTCTCATGCCTTA AksTksTdsGdsTdsmCdsTdsmCdsAds 38 2804
TdsGdsmCesmCesTesTksAk
1198200 2527 2542 123552 123567 AATTGTCTCATGCCTT AksAksTdsTdsGdsTdsmCdsTdsmCds 49 2805
AdsTdsGesmCesmCesTksTk
1198201 2528 2543 123553 123568 AAATTGTCTCATGCCT AksAksAdsTdsGdsTdsmCdsTds 34 443
mCdsAdsTesGesmCesmCksTk
1198202 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAdsAdsTdsTdsGdsTdsmCds 14 2800
TdsmCdsAesTesGesmCksmCk
1198203 2530 2545 123555 123570 GGAAATTGTCTCATGC GksGksAdsAdsAdsTdsTdsGdsTds 19 2806
mCdsTdsmCesAesTesGksmCk
1198204 2531 2546 123556 123571 TGGAAATTGTCTCATG TksGksGdsAdsAdsAdsTdsTdsGdsTds 31 2807
mCdsTesmCesAesTksGk
1198205 2532 2547 123557 123572 ATGGAAATTGTCTCAT AksTksGdsGdsAdsAdsAdsTdsTdsGds 64 2808
TdsmCesTesmCesAksTk
1198206 2534 2549 123559 123574 ATATGGAAATTGTCTC AksTksAdsTdsGdsGdsAdsAdsAdsTds 43 656
TdsGesTesmCesTksmCk
1198207 2560 2575 123585 123600 AGTATGTGGCAATAAT AksGksTdsAdsTdsGdsTdsGdsGds 91 2809
mCdsAdsAesTesAesAksTk
1198208 2562 2577 123587 123602 AGAGTATGTGGCAATA AksGksAdsGdsTdsAdsTdsGdsTdsGds 25 2810
GdsmCesAesAesTksAk
1198209 2563 2578 123588 123603 TAGAGTATGTGGCAAT TksAksGdsAdsGdsTdsAdsTdsGdsTds 45 2811
GdsGesmCesAesAksTk
1198210 2564 2579 123589 123604 TTAGAGTATGTGGCAA TksTksAdsGdsAdsGdsTdsAdsTdsGds 28 963
TdsGesGesmCesAksAk
1198211 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTdsAdsGdsAdsGdsTdsAdsTds 19 810
GdsTesGesGesmCksAk
1198212 2566 2581 123591 123606 TATTAGAGTATGTGGC TksAksTdsTdsAdsGdsAdsGdsTdsAds 17 2812
TdsGesTesGesGksmCk
1198213 2567 2582 123592 123607 ATATTAGAGTATGTGG AksTksAdsTdsTdsAdsGdsAdsGdsTds 16 2813
AdsTesGesTesGksGk
1198214 2568 2583 123593 123608 TATATTAGAGTATGTG TksAksTdsAdsTdsTdsAdsGdsAdsGds 91 2814
TdsAesTesGesTksGk
1198215 2570 2585 123595 123610 TCTATATTAGAGTATG TksmCksTdsAdsTdsAdsTdsTdsAdsGds 120 887
AdsGesTesAesTksGk
1198221 4595 4610 125620 125635 TTACATTAGGAACAAG TksTksAdsmCdsAdsTdsTdsAdsGds 95 2817
GdsAdsAesmCesAesAksGk
1198222 4597 4612 125622 125637 TTTTACATTAGGAACA TksTksTdsTdsAdsmCdsAdsTdsTds 87 2818
AdsGdsGesAesAesmCksAk
1198223 4598 4613 125623 125638 CTTTTACATTAGGAAC mCksTksTdsTdsTdsAdsmCdsAdsTds 94 1124
TdsAdsGesGesAesAksmCk
1198224 4599 4614 125624 125639 ACTTTTACATTAGGAA AksmCksTdsTdsTdsTdsAdsmCdsAds 74 2819
TdsTdsAesGesGesAksAk
1198225 4600 4615 125625 125640 CACTTTTACATTAGGA mCksAksmCdsTdsTdsTdsTdsAdsmCds 67 1200
AdsTdsTesAesGesGksAk
1198226 4601 4616 125626 125641 GCACTTTTACATTAGG GksmCksAdsmCdsTdsTdsTdsTdsAds 23 1276
mCdsAdsTesTesAesGksGk
1198227 4602 4617 125627 125642 AGCACTTTTACATTAG AksGksmCdsAdsmCdsTdsTdsTdsTds 104 2820
AdsmCdsAesTesTesAksGk
1198228 4603 4618 125628 125643 AAGCACTTTTACATTA AksAksGdsmCdsAdsmCdsTdsTdsTdsTds 54 2821
TdsAdsmCesAesTesTksAk
1198229 4605 4620 125630 125645 TTAAGCACTTTTACAT TksTksAdsAdsGdsmCdsAdsmCdsTds 80 2822
TdsTdsTesAesmCesAksTk
1198230 4795 4810 125820 125835 GGAAGATCTGAAACTCG GksGksAdsAdsGdsAdsTdsmCdsTds 81 2823
GdsAdsAesAesmCesTksk
1198231 4797 4812 125822 125837 TTGGAAGATCTGAAAC TksTksGdsGdsAdsAdsGdsAdsTds 73 2824
mCdsTdsGesAesAesAksmCk
1198232 4798 4813 125823 125838 TTTGGAAGATCTGAAA TksTksTdsGdsGdsAdsAdsGdsAds 92 2825
TdsmCdsTesGesAesAksAk
1198233 4799 4814 125824 125839 CTTTGGAAGATCTGAA mCksTksTdsTdsGdsGdsAdsAdsGds 49 2826
AdsTdsmCesTesGesAksAk
1198234 4800 4815 125825 125840 GCTTTGGAAGATCTGA GksmCksTdsTdsTdsGdsGdsAdsAds 45 2044
GdsAdsTesmCesTesGksAk
1198235 4801 4816 125826 125841 TGCTTTGGAAGATCTG TksGksmCdsTdsTdsTdsGdsGdsAdsAds 49 2121
GdsAesTesmCesTksGk
1198236 4802 4817 125827 125842 GTGCTTTGGAAGATCT GksTksGdsmCdsTdsTdsTdsGdsGds 24 2827
AdsAdsGesAesTesmCksTk
1198237 4803 4818 125828 125843 AGTGCTTTGGAAGATC AksGksTksGdsmCdsTdsTdsTdsGds 51 2828
GdsAdsAesGesAesTksmCk
1198238 4805 4820 125830 125845 ATAGTGCTTTGGAAGA AksTksAdsGdsTdsAdsmCdsTdsTds 88 2829
TdsGdsGesAesAesGksAk
1198239 N/A N/A 94729 94744 AGGATGCATGGTTTTT AksGksGdsAdsTdsGdsmCdsAdsTds 39 2830
GdsGdsTesTesTesTksTk
1198240 N/A N/A 94731 94746 TTAGGATGCATGGTTT TksTksAdsGdsGdsAdsTdsGdsmCds 43 2831
AdsTdsGesGesTesTksTk
1198646 4436 4451 125461 125476 TATAACTGGGCAAATT TksAksTdsAdsAdsmCdsTdsGdsGds 80 2815
GdsmCdsAdsAksAesTksTe
1198647 4438 4453 125463 125478 GGTATAACTGGGCAAA GksGksTdsAdsTdsAdsAdsmCdsTds 47 1427
GdsGdsGdsmCksAesAksAe
1198648 4439 4454 125464 125479 AGGTATAACTGGGCAA AksGksGdsTdsAdsTdsAdsAdsmCds 43 905
TdsGdsGdsGksmCesAksAe
1198649 4440 4455 125465 125480 GAGGTATAACTGGGCA GksAksGdsGdsTdsAdsTdsAdsAds 27 1503
mCdsTdsGdsGksGesmCksAe
1198650 4446 4461 125471 125486 AACACTGAGGTATAAC AksAkmCdsAdsmCdsTdsGdsAdsGds 88 2816
GdsTdsAdsTksAesAksmCe
1198678 N/A N/A 115903 115918 ATATGGTTTTGTGTGT AksTksAdsTdsGdsGdsTdsTdsTdsTds 58 2839
GdsTdsGksTesGksTe
1198679 N/A N/A 115905 115920 TTATATGGTTTTGTGT TksTksAdsTdsAdsTdsGdsGdsTdsTds 54 2840
TdsTdsGksTesGksTe
1198680 N/A N/A 115906 115921 CTTATATGGTTTTGTG mCksTksTdsAdsTdsAdsTdsGdsGds 28 2788
TdsTdsTdsTksGesTksGe
1198681 N/A N/A 115907 115922 TCTTATATGGTTTTGT TksmCksTdsTdsAdsTdsAdsTdsGds 54 2841
GdsTdsTdsTksTesGksTe
1198682 N/A N/A 115908 115923 CT CTTATATGGTTTTG mCksTksmCdsTdsTdsAdsTdsAdsTds 25 2842
GdsGdsTdsTksTesTksGe
1198683 N/A N/A 115909 115924 ACTCTTATATGGTTTT AksmCksTdsmCdsTdsTdsAdsTdsAds 27 2859
TdsGdsGdsTksTesTksTe
1198684 N/A N/A 115910 115925 AACTCTTATATGGTTT AksAksmCdsTdsmCdsTdsTdsAdsTds 75 2860
AdsTdsGdsGksTesTksTe
1198685 N/A N/A 115911 115926 CAACTCTTATATGGTT mCksAksAdsmCdsTdsmCdsTdsTds 70 2861
AdsTdsAdsTdsGksGesTksTe
1198686 N/A N/A 115913 115928 GACAACTCTTATATGG GksAksmCdsAdsAdsmCdsTdsmCds 78 2862
TdsTdsAdsTdsAksTesGksGe
1198693 N/A N/A 117332 117347 AT GTAATATTGCAATC AksTksGdsTdsAdsAdsTdsAdsTdsTds 92 2848
GdsmCdsAksAesTksmCe
1198694 N/A N/A 117333 117348 TATGTAATATTGCAAT TksAksTdsGdsTdsAdsAdsTdsAdsTds 110 2849
TdsGdsmCksAesAksTe
1198695 N/A N/A 117335 117350 TTTATGTAATATTGCA TksTksTdsAdsTdsGdsTdsAdsAdsTds 75 2850
AdsTdsTksGesmCksAe
1198696 N/A N/A 117755 117770 TGTATGTCAGAAGAGT TksGksTdsAdsTdsGdsTdsmCdsAds 12 2863
GdsAdsAdsGksAesGksTe
1198697 N/A N/A 117757 117772 AGTGTATGTCAGAAGA AksGksTdsGdsTdsAdsTdsGdsTdsmCds 12 2864
AdsGdsAksAesGksAe
1198698 N/A N/A 117758 117773 AAGTGTATGTCAGAAG AksAksGdsTdsGdsTdsAdsTdsGdsTds 12 2865
mCdsAdsGksAesAksGe
1198699 N/A N/A 117759 117774 AAAGTGTATGTCAGAA AksAksAdsGdsTdsGdsTdsAdsTdsGds 30 2866
TdsmCdsAksGesAksAe
1198700 N/A N/A 117760 117775 TAAAGTGTATGTCAGA TksAksAdsAdsGdsTdsGdsTdsAdsTds 26 2867
GdsTdsmCksAesGksAe
1198701 N/A N/A 117761 117776 TTAAAGTGTATGTCAG TksTksAdsAdsAdsGdsTdsGdsTdsAds 46 2868
TdsGdsTksmCesAksGes
1198702 N/A N/A 117762 117777 TTTAAAGTGTATGTCA TksTksTdsAdsAdsAdsGdsTdsGdsTds 74 2869
AdsTdsGksTesmCksAe
1198703 N/A N/A 117763 117778 CTTTAAAGTGTATGTC mCksTksTdsTdsAdsAdsAdsGdsTds 42 1634
GdsTdsAdsTksGesTksmCe
1198704 N/A N/A 117765 117780 AACTTTAAAGTGTATG AksAksmCdsTdsTdsTdsAdsAdsAds 72 2870
GdsTdsGdsTksAesTksGe
1198705 N/A N/A 119667 119682 TAAGGTTTCCCAGATT TksAksAdsGdsGdsTdsTdsTdsmCds 70 2851
mCdsmCdsAdsGksAesTksTe
1198706 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA AksGksTdsAdsAdsGdsGdsTdsTdsTds 39 2852
mCdsmCdsmCksAesGksAe
1198707 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG AksAksGdsTdsAdsAdsGdsGdsTdsTds 31 2853
TdsmCdsmCksmCesAksGe
1198708 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA TksAksAdsGdsTdsAdsAdsGdsGdsTds 34 2854
TdsTdsmCksmCesmCksAe
1198709 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC mCksTksAdsAdsGdsTdsAdsAdsGds 29 1101
GdsTdsTdsTksmCesmCksmCe
1198710 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC AksmCksTdsAdsAdsGdsTdsAdsAds 51 2855
GdsGdsTdsTksTesmCksmCe
1198711 N/A N/A 119674 119689 GACTAAGTAAGGTTTC GksAksmCdsTdsAdsAdsGdsTdsAds 60 2856
AdsGdsGdsTksTesTksmCe
1198712 N/A N/A 119675 119690 AGACTAAGTAAGGTTT AksGksAdsmCdsTdsAdsAdsGdsTds 110 2857
AdsAdsGdsGksTesTksTe
1198713 N/A N/A 119677 119692 TTAGACTAAGTAAGGT TksTksAdsGdsAdsmCdsTdsAdsAds 62 2858
GdsTdsAdsAksGesGksTe

TABLE 43
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ ID
Number Site Site Site Site Sequence (5′ to 3′) CHEMISTRY NOTATION (% UTC) NO
715487 3630 3645 124655 124670 ATTACTTCATAGCTTA AksTksTksAdsmCdsTdsTdsmCdsAds 25 52
TdsAdsGdsmCdsTksTksAk
958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTksAdsGdsAdsGdsTdsAds 14 810
TdsGdsTdsGdsGksmCksAk
1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAksAdsTdsTdsGdsTdsmCds 11 2800
TdsmCdsAdsTdsGksmCksmCk
1095575 4443 4458 125468 125483 ACTGAGGTATAACTGG AksmCksTdsGdsAdsGdsGdsTdsAds 55 392
TdsAdsAesmCesTesGksGk
1095593 4441 4456 125466 125481 TGAGGTATAACTGGGC TksGksAdsGdsGdsTdsAdsTdsAdsAds 16 1580
mCdsTesGesGesGksmCk
1095594 4442 4457 125467 125482 CTGAGGTATAACTGGG mCksTksGdsAdsGdsGdsTdsAdsTds 27 2801
AdsAdsmCesTesGesGksGk
1095595 4444 4459 125469 125484 CACTGAGGTATAACTG mCksAksmCdsTdsGdsAdsGdsGdsTds 63 2802
AdsTdsAesAesmCesTksGk
1198216 4436 4451 125461 125476 TATAACTGGGCAAATT TksAksTdsAdsAdsmCdsTdsGdsGds 89 2815
GdsmCdsAesAesAesTksTk
1198217 4438 4453 125463 125478 GGTATAACTGGGCAAA GksGksTdsAdsTdsAdsAdsmCdsTds 57 1427
GdsGdsGesmCesAesAksAk
1198218 4439 4454 125464 125479 AGGTATAACTGGGCAA AksGksGdsTdsAdsTdsAdsAdsmCds 40 905
TdsGdsGesGesmCesAksAk
1198219 4440 4455 125465 125480 GAGGTATAACTGGGCA GksAksGdsGdsTdsAdsTdsAdsAds 22 1503
mCdsTdsGesGesGesmCksAk
1198220 4446 4461 125471 125486 AACACTGAGGTATAAC AksAksmCdsAdsmCdsTdsGdsAdsGds 89 2816
GdsTdsAesTesAesAksmCk
1198241 N/A N/A 94732 94747 TTTAGGATGCATGGTT TksTksTdsAdsGdsGdsAdsTdsGds 32 2832
mCdsAdsTesGesGesTksTk
1198242 N/A N/A 94733 94748 ATTTAGGATGCATGGT AksTksTdsTdsAdsGdsGdsAdsTds 47 2833
GdsmCdsAesTesGesGksTk
1198243 N/A N/A 94734 94749 GATTTAGGATGCATGG GksAksTdsTdsTdsAdsGdsGdsAdsTds 8 2834
GdsmCesAesTesGksGk
1198244 N/A N/A 94735 94750 AGATTTAGGATGCATG AksGksAdsTdsTdsTdsAdsGdsGdsAds 24 2835
TdsGesmCesAesTksGk
1198245 N/A N/A 94736 94751 CAGATTTAGGATGCAT mCksAksGdsAdsTdsTdsTdsAdsGds 46 2836
GdsAdsTesGesmCesAksTk
1198246 N/A N/A 94737 94752 TCAGATTTAGGATGCA TksmCksAdsGdsAdsTdsTdsTdsAds 30 2837
GdsGdsAesTesGesmCksAk
1198247 N/A N/A 94739 94754 ATTCAGATTTAGGATG AksTksTdsmCdsAdsGdsAdsTdsTds 99 2838
TdsAdsGesGesAesTksGk
1198248 N/A N/A 115903 115918 ATATGGTTTTGTGTGT AksTksAdsTdsGdsGdsTdsTdsTdsTds 64 2839
GdsTesGesTesGksTk
1198249 N/A N/A 115905 115920 TTATATGGTTTTGTGT TksTksAdsTdsAdsTdsGdsGdsTdsTds 42 2840
TdsTesGesTesGksTk
1198250 N/A N/A 115906 115921 CTTATATGGTTTTGTG mCksTksTdsAdsTdsAdsTdsGdsGds 50 2788
TdsTdsTesTesGesTksGk
1198251 N/A N/A 115907 115922 TCTTATATGGTTTTGT TksmCksTdsTdsAdsTdsAdsTdsGds 83 2841
GdsTdsTesTesTesGksTk
1198252 N/A N/A 115908 115923 CTCTTATATGGTTTTG mCksTksmCdsTdsTdsAdsTdsAdsTds 26 2842
GdsGdsTesTesTesTksGk
1198253 N/A N/A 115909 115924 ACTCTTATATGGTTTT AksmCksTdsmCdsTdsTdsAdsTdsAds 50 2859
TdsGdsGesTesTesTksTk
1198254 N/A N/A 115910 115925 AACTCTTATATGGTTT AksAksmCdsTdsmCdsTdsTdsAdsTds 95 2860
AdsTdsGesGesTesTksTk
1198255 N/A N/A 115911 115926 CAACTCTTATATGGTT mCksAksAdsmCdsTdsmCdsTdsTds 84 2861
AdsTdsAdsTesGesGesTksTk
1198256 N/A N/A 115913 115928 GACAACTCTTATATGG GksAksmCdsAdsAdsmCdsTdsmCdsT 78 2862
dsTdsAdsTesAesTesGksGk
1198257 N/A N/A 117325 117340 ATTGCAATCTGTCTGA AksTksTdsGdsmCdsAdsAdsTdsmCds 85 2843
TdsGdsTesmCesTesGksAk
1198258 N/A N/A 117327 117342 ATATTGCAATCTGTCT AksTksAdsTdsTdsGdsmCdsAdsAds 52 2844
TdsmCdsTesGesTesmCksTk
1198259 N/A N/A 117328 117343 AATATTGCAATCTGTC AksAksTdsAdsTdsTdsGdsmCdsAds 51 2845
AdsTdsmCesTesGesTksmCk
1198260 N/A N/A 117329 117344 TAATATTGCAATCTGT TksAksAdsTdsAdsTdsTdsGdsmCds 106 2846
AdsAdsTesmCesTesGksTk
1198261 N/A N/A 117330 117345 GTAATATTGCAATCTG GksTksAdsAdsTdsAdsTdsTdsGds 54 1404
mCdsAdsAesTesmCesTksGk
1198262 N/A N/A 117331 117346 TGTAATATTGCAATCT TksGksTdsAdsAdsTdsAdsTdsTds 114 2847
GdsmCdsAesAesTesmCksTk
1198263 N/A N/A 117332 117347 ATGTAATATTGCAATC AksTksGdsTdsAdsAdsTdsAdsTdsTds 114 2848
GdsmCesAesAesTksmCk
1198264 N/A N/A 117333 117348 TATGTAATATTGCAAT TksAksTdsGdsTdsAdsAdsTdsAdsTds 73 2849
TdsGesmCesAesAksTk
1198265 N/A N/A 117335 117350 TTTATGTAATATTGCA TksTksTdsAdsTdsGdsTdsAdsAdsTds 111 2850
AdsTesTesGesmCksAk
1198266 N/A N/A 117755 117770 TGTATGTCAGAAGAGT TksGksTdsAdsTdsGdsTdsmCdsAds 25 2863
GdsAdsAesGesAesGksTk
1198267 N/A N/A 117757 117772 AGTGTATGTCAGAAGA AksGksTdsGdsTdsAdsTdsGdsTds 7 2864
mCdsAdsGesAesAesGksAk
1198268 N/A N/A 117758 117773 AAGTGTATGTCAGAAG AksAksGdsTdsGdsTdsAdsTdsGdsTds 11 2865
mCdsAesGesAesAksGk
1198269 N/A N/A 117759 117774 AAAGTGTATGTCAGAA AksAksAdsGdsTdsGdsTdsAdsTdsGds 58 2866
TdsmCesAesGesAksAk
1198270 N/A N/A 117760 117775 TAAAGTGTATGTCAGA TksAksAdsAdsGdsTdsGdsTdsAdsTds 52 2867
GdsTesmCesAesGksAk
1198271 N/A N/A 117761 117776 TTAAAGTGTATGTCAG TksTksAdsAdsAdsGdsTdsGdsTdsAds 44 2868
TdsGesTesmCesAksGk
1198272 N/A N/A 117762 117777 TTTAAAGTGTATGTCA TksTksTdsAdsAdsAdsGdsTdsGdsTds 37 2869
AdsTesGesTesmCksAk
1198273 N/A N/A 117763 117778 CTTTAAAGTGTATGTC mCksTksTdsTdsAdsAdsAdsGdsTds 52 1634
GdsTdsAesTesGesTksmCk
1198274 N/A N/A 117765 117780 AACTTTAAAGTGTATG AksAksmCdsTdsTdsTdsAdsAdsAds 69 2870
GdsTdsGesTesAesTksGk
1198275 N/A N/A 119667 119682 TAAGGTTTCCCAGATT TksAksAdsGdsGdsTdsTdsTdsmCds 52 2851
mCdsmCdsAesGesAesTksTk
1198276 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA AksGksTdsAdsAdsGdsGdsTdsTdsTds 52 2852
mCdsmCesmCesAesGksAk
1198277 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG AksAksGdsTdsAdsAdsGdsGdsTdsTds 32 2853
TdsmCesmCesmCesAksGk
1198278 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA TksAksAdsGdsTdsAdsAdsGdsGdsTds 43 2854
TdsTesmCesmCesmCksAk
1198279 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC mCksTksAdsAdsGdsTdsAdsAdsGds 43 1101
GdsTdsTesTesmCesmCksmCk
1198280 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC AksmCksTdsAdsAdsGdsTdsAdsAds 40 2855
GdsGdsTesTesTesmCksmCk
1198281 N/A N/A 119674 119689 GACTAAGTAAGGTTTC GksAksmCdsTdsAdsAdsGdsTdsAds 71 2856
AdsGdsGesTesTesTksmCk
1198282 N/A N/A 119675 119690 AGACTAAGTAAGGTTT AksGksAdsmCdsTdsAdsAdsGdsTds 58 2857
AdsAdsGesGesTesTksTk
1198283 N/A N/A 119677 119692 TTAGACTAAGTAAGGT TksTksAdsGdsAdsmCdsTdsAdsAds 99 2858
GdsTdsAesAesGesGksTk
1198456 2524 2539 123549 123564 TGTCTCATGCCTTATA TksGksTdsmCdsTdsmCdsAdsTdsGds 21 2803
mCdsmCdsTesTksAesTksAe
1198457 2526 2541 123551 123566 ATTGTCTCATGCCTTA AksTksTdsGdsTdsmCdsTdsmCdsAds 18 2804
TdsGdsmCesmCksTesTksAe
1198458 2527 2542 123552 123567 AATTGTCTCATGCCTT AksAksTdsTdsGdsTdsmCdsTdsmCds 30 2805
AdsTdsGesmCksmCesTksTe
1198459 2528 2543 123553 123568 AAATTGTCTCATGCCT AksAksAdsTdsTdsGdsTdsmCdsTds 28 443
mCdsAdsTesGksmCesmCksTe
1198460 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAdsAdsTdsTdsGdsTdsmCds 17 2800
TdsmCdsAesTksGesmCksmCe
1198461 2530 2545 123555 123570 GGAAATTGTCTCATGC GksGksAdsAdsAdsTdsTdsGdsTds 24 2806
mCdsTdsmCesAksTesGksmCe
1198462 2531 2546 123556 123571 TGGAAATTGTCTCATG TksGksGdsAdsAdsAdsTdsTdsGdsTds 27 2807
mCdsTesmCksAesTksGe
1198463 2532 2547 123557 123572 ATGGAAATTGTCTCAT AksTksGdsGdsAdsAdsAdsTdsTdsGds 59 2808
TdsmCesTksmCesAksTe
1198464 2534 2549 123559 123574 ATATGGAAATTGTCTC AksTksAdsTdsGdsGdsAdsAdsAdsTds 41 656
TdsGesTksmCesTksmCe
1198465 2560 2575 123585 123600 AGTATGTGGCAATAAT AksGksTdsAdsTdsGdsTdsGdsGds 68 2809
mCdsAdsAesTksAesAksTe
1198466 2562 2577 123587 123602 AGAGTATGTGGCAATA AksGksAdsGdsTdsAdsTdsGdsTdsGds 12 2810
GdsmCesAksAesTksAe
1198467 2563 2578 123588 123603 TAGAGTATGTGGCAAT TksAksGdsAdsGdsTdsAdsTdsGdsTds 27 2811
GdsGesmCksAesAksTe
1198468 2564 2579 123589 123604 TTAGAGTATGTGGCAA TksTksAdsGdsAdsGdsTdsAdsTdsGds 22 963
TdsGesGksmCesAksAe
1198469 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTdsAdsGdsAdsGdsTdsAdsTds 23 810
GdsTesGksGesmCksAe
1198470 2566 2581 123591 123606 TATTAGAGTATGTGGC TksAksTdsTdsAdsGdsAdsGdsTdsAds 17 2812
TdsGesTksGesGksmCe
1198471 2567 2582 123592 123607 ATATTAGAGTATGTGG AksTksAdsTdsTdsAdsGdsAdsGdsTds 21 2813
AdsTesGksTesGksGe
1198472 2568 2583 123593 123608 TATATTAGAGTATGTG TksAksTdsAdsTdsTdsAdsGdsAdsGds 60 2814
TdsAesTksGesTksGe
1198473 2570 2585 123595 123610 TCTATATTAGAGTATG TksmCksTdsAdsTdsAdsTdsTdsAds 66 887
GdsAdsGesTksAesTksGe
1198479 4595 4610 125620 125635 TTACATTAGGAACAAG TksTksAdsmCdsAdsTdsTdsAdsGds 65 2817
GdsAdsAesmCksAesAksGe
1198480 4597 4612 125622 125637 TTTTACATTAGGAACA TksTksTdsTdsAdsmCdsAdsTdsTds 75 2818
AdsGdsGesAksAesmCksAe
1198481 4598 4613 125623 125638 CTTTTACATTAGGAAC mCksTksTdsTdsTdsAdsmCdsAdsTds 72 1124
TdsAdsGesGksAesAksmCe
1198482 4599 4614 125624 125639 ACTTTTACATTAGGAA AksmCksTdsTdsTdsTdsAdsmCdsAds 63 2819
TdsTdsAesGksGesAksAe
1198483 4600 4615 125625 125640 CACTTTTACATTAGGA mCksAksmCdsTdsTdsTdsTdsAdsmCds 31 1200
AdsTdsTesAksGesGksAe
1198484 4601 4616 125626 125641 GCACTTTTACATTAGG GksmCksAdsmCdsTdsTdsTdsTdsAds 18 1276
mCdsAdsTesTksAesGksGe
1198485 4602 4617 125627 125642 AGCACTTTTACATTAG AksGksmCdsAdsmCdsTdsTdsTdsTds 64 2820
AdsmCdsAesTksTesAksGe

TABLE 44
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ ID
Number Site Site Site Site Sequence (5′ to 3′) CHEMISTRY NOTATION (% UTC) NO
715487 3630 3645 124655 124670 ATTACTTCATAGCTTA AksTksTksAdsmCdsTdsTdsmCds 18 52
AdsTdsAdsGdsmCdsTksTksAk
958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTksAdsGdsAdsGdsTdsAds 9 810
TdsGdsTdsGdsGksmCksAk
1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAksAdsTdsTdsGdsTdsmCds 7 2800
TdsmCdsAdsTdsGksmCksmCk
1095603 4443 4458 125468 125483 ACTGAGGTATAACTGG AksmCksTdsGdsAdsGdsGdsTds 29 2872
AdsTdsAdsAesmCksTesGksGe
1095621 4441 4456 125466 125481 TGAGGTATAACTGGGC TksGksAdsGdsGdsTdsAdsTdsAds 22 1580
AdsmCdsTesGksGesGksmCe
1095622 4442 4457 125467 125482 CTGAGGTATAACTGGG mCksTksGdsAdsGdsGdsTdsAds 44 2801
TdsAdsAdsmCesTksGesGksGe
1095623 4444 4459 125469 125484 CACTGAGGTATAACTG mCksAksmCdsTdsGdsAdsGdsGds 57 2802
TdsAdsTdsAesAksmCesTksGe
1198474 4436 4451 125461 125476 TATAACTGGGCAAATT TksAksTdsAdsAdsmCdsTdsGds 68 2815
GdsGdsmCdsAesAksAesTksTe
1198475 4438 4453 125463 125478 GGTATAACTGGGCAAA GksGksTdsAdsTdsAdsAdsmCds 25 1427
TdsGdsGdsGesmCksAesAksAe
1198476 4439 4454 125464 125479 AGGTATAACTGGGCAA AksGksGdsTdsAdsTdsAdsAds 31 905
mCdsTdsGdsGesGksmCesAksAe
1198477 4440 4455 125465 125480 GAGGTATAACTGGGCA GksAksGdsGdsTdsAdsTdsAds 47 1503
AdsmCdsTdsGesGksGesmCksAe
1198478 4446 4461 125471 125486 AACACTGAGGTATAAC AksAksmCdsAdsmCdsTdsGdsAds 60 2816
GdsGdsTdsAesTksAesAksmCe
1198486 4603 4618 125628 125643 AAGCACTTTTACATTA AksAksGdsmCdsAdsmCdsTdsTds 39 2821
TdsTdsAdsmCesAksTesTksAe
1198487 4605 4620 125630 125645 TTAAGCACTTTTACAT TksTksAdsAdsGdsmCdsAdsmCds 62 2822
TdsTdsTdsTesAksmCesAksTe
1198488 4795 4810 125820 125835 GGAAGATCTGAAACTC GksGksAdsAdsGdsAdsTdsmCds 66 2823
TdsGdsAdsAesAksmCesTksmCe
1198489 4797 4812 125822 125837 TTGGAAGATCTGAAAC TksTksGdsGdsAdsAdsGdsAdsTds 50 2824
mCdsTdsGesAksAesAksmCe
1198490 4798 4813 125823 125838 TTTGGAAGATCTGAAA TksTksTdsGdsGdsAdsAdsGdsAds 53 2825
TdsmCdsTesGksAesAksAe
1198491 4799 4814 125824 125839 CTTTGGAAGATCTGAA mCksTksTdsTdsGdsGdsAdsAds 22 2826
GdsAdsTdsmCesTksGesAksAe
1198492 4800 4815 125825 125840 GCTTTGGAAGATCTGA GksmCksTdsTdsTdsGdsGdsAds 15 2044
AdsGdsAdsTesmCksTesGksAe
1198493 4801 4816 125826 125841 TGCTTTGGAAGATCTG TksGksmCdsTdsTdsTdsGdsGds 28 2121
AdsAdsGdsAesTksmCesTksGe
1198494 4802 4817 125827 125842 GTGCTTTGGAAGATCT GksTksGdsmCdsTdsTdsTdsGds 15 2827
GdsAdsAdsGesAksTesmCksTe
1198495 4803 4818 125828 125843 AGTGCTTTGGAAGATC AksGksTdsGdsmCdsTdsTdsTds 22 2828
GdsGdsAdsAesGksAesTksmCe
1198496 4805 4820 125830 125845 ATAGTGCTTTGGAAGA AksTksAdsGdsTdsGdsmCdsTds 46 2891
TdsTdsGdsGesAksAesGksAe
1198497 N/A N/A 94729 94744 AGGATGCATGGTTTTT AksGksGdsAdsTdsGdsmCdsAds 22 2830
TdsGdsGdsTesTksTesTksTe
1198498 N/A N/A 94731 94746 TTAGGATGCATGGTTT TksTksAdsGdsGdsAdsTdsGdsmCds 39 2831
AdsTdsGesGksTesTksTe
1198499 N/A N/A 94732 94747 TTTAGGATGCATGGTT TksTksTdsAdsGdsGdsAdsTdsGds 13 2832
mCdsAdsTesGksGesTksTe
1198500 N/A N/A 94733 94748 ATTTAGGATGCATGGT AksTksTdsTdsAdsGdsGdsAdsTds 17 2833
GdsmCdsAesTksGesGksTe
1198501 N/A N/A 94734 94749 GATTTAGGATGCATGG GksAksTdsTdsTdsAdsGdsGdsAds 5 2834
TdsGdsmCesAksTesGksGe
1198502 N/A N/A 94735 94750 AGATTTAGGATGCATG AksGksAdsTdsTdsTdsAdsGdsGds 16 2835
AdsTdsGesmCksAesTksGe
1198503 N/A N/A 94736 94751 CAGATTTAGGATGCAT mCksAksGdsAdsTdsTdsTdsAds 31 2836
GdsGdsAdsTesGksmCesAksTe
1198504 N/A N/A 94737 94752 TCAGATTTAGGATGCA TksmCksAdsGdsAdsTdsTdsTds 15 2837
AdsGdsGdsAesTksGesmCksAe
1198505 N/A N/A 94739 94754 ATTCAGATTTAGGATG AksTksTdsmCdsAdsGdsAdsTds 73 2838
TdsTdsAdsGesGksAesTksGe
1198506 N/A N/A 115903 115918 ATATGGTTTTGTGTGT AksTksAdsTdsGdsGdsTdsTdsTds 47 2839
TdsGdsTesGksTesGksTe
1198507 N/A N/A 115905 115920 TTATATGGTTTTGTGT TksTksAdsTdsAdsTdsGdsGdsTds 17 2840
TdsTdsTesGksTesGksTe
1198508 N/A N/A 115906 115921 CTTATATGGTTTTGTG mCksTksTdsAdsTdsAdsTdsGds 22 2788
GdsTdsTdsTesTksGesTksGe
1198509 N/A N/A 115907 115922 TCTTATATGGTTTTGT TksmCksTdsTdsAdsTdsAdsTds 20 2841
GdsGdsTdsTesTksTesGksTe
1198510 N/A N/A 115908 115923 CTCTTATATGGTTTTG mCksTksmCdsTdsTdsAdsTdsAds 8 2842
TdsGdsGdsTesTksTesTksGe
1198511 N/A N/A 115909 115924 ACTCTTATATGGTTTT AksmCksTdsmCdsTdsTdsAdsTds 53 2859
AdsTdsGdsGesTksTesTksTe
1198512 N/A N/A 115910 115925 AACTCTTATATGGTTT AksAksmCdsTdsmCdsTdsTdsAds 62 2860
TdsAdsTdsGesGksTesTksTe
1198513 N/A N/A 115911 115926 CAACTCTTATATGGTT mCksAksAdsmCdsTdsmCdsTdsTds 63 2861
AdsTdsAdsTesGksGesTksTe
1198514 N/A N/A 115913 115928 GACAACTCTTATATGG GksAksmCdsAdsAdsmCdsTdsmCds 53 2862
TdsTdsAdsTesAksTesGksGe
1198515 N/A N/A 117325 117340 ATTGCAATCTGTCTGA AksTksTdsGdsmCdsAdsAdsTds 44 2843
mCdsTdsGdsTesmCksTesGksAe
1198516 N/A N/A 117327 117342 ATATTGCAATCTGTCT AksTksAdsTdsTdsGdsmCdsAds 50 2844
AdsTdsmCdsTesGksTesmCksTe
1198517 N/A N/A 117328 117343 AATATTGCAATCTGTC AksAksTdsAdsTdsTdsGdsmCds 36 2845
AdsAdsTdsmCesTksGesTksmCe
1198518 N/A N/A 117329 117344 TAATATTGCAATCTGT TksAksAdsTdsAdsTdsTdsGdsmCds 71 2846
AdsAdsTesmCksTesGksTe
1198519 N/A N/A 117330 117345 GTAATATTGCAATCTG GksTksAdsAdsTdsAdsTdsTdsGds 20 1404
mCdsAdsAesTksmCesTksGe
1198520 N/A N/A 117331 117346 TGTAATATTGCAATCT TksGksTdsAdsAdsTdsAdsTdsTds 51 2847
GdsmCdsAesAksTesmCksTe
1198521 N/A N/A 117332 117347 ATGTAATATTGCAATC AksTksGdsTdsAdsAdsTdsAdsTds 44 2848
TdsGdsmCesAksAesTksmCe
1198522 N/A N/A 117333 117348 TATGTAATATTGCAAT TksAksTdsGdsTdsAdsAdsTdsAds 37 2849
TdsTdsGesmCksAesAksTe
1198523 N/A N/A 117335 117350 TTTATGTAATATTGCA TksTksTdsAdsTdsGdsTdsAdsAds 93 2850
TdsAdsTesTksGesmCksAe
1198524 N/A N/A 117755 117770 TGTATGTCAGAAGAGT TksGksTdsAdsTdsGdsTdsmCds 3 2863
AdsGdsAdsAesGksAesGksTe
1198525 N/A N/A 117757 117772 AGTGTATGTCAGAAGA AksGksTdsGdsTdsAdsTdsGdsTds 2 2864
mCdsAdsGesAksAesGksAe
1198526 N/A N/A 117758 117773 AAGTGTATGTCAGAAG AksAksGdsTdsGdsTdsAdsTdsGds 2 2865
TdsmCdsAesGksAesAksGe
1198527 N/A N/A 117759 117774 AAAGTGTATGTCAGAA AksAksAdsGdsTdsGdsTdsAdsTds 5 2866
GdsTdsmCesAksGesAksAe
1198528 N/A N/A 117760 117775 TAAAGTGTATGTCAGA TksAksAdsAdsGdsTdsGdsTdsAds 14 2867
TdsGdsTesmCksAesGksAe
1198529 N/A N/A 117761 117776 TTAAAGTGTATGTCAG TksTksAdsAdsAdsGdsTdsGdsTds 17 2868
AdsTdsGesTksmCesAksGe
1198530 N/A N/A 117762 117777 TTTAAAGTGTATGTCA TksTksTdsAdsAdsAdsGdsTdsGds 29 2869
TdsAdsTesGksTesmCksAe
1198531 N/A N/A 117763 117778 CTTTAAAGTGTATGTC mCksTksTdsTdsAdsAdsAdsGds 21 1634
TdsGdsTdsAesTksGesTksmCe
1198532 N/A N/A 117765 117780 AACTTTAAAGTGTATG AksAksmCdsTdsTdsTdsAdsAds 36 2870
AdsGdsTdsGesTksAesTksGe
1198533 N/A N/A 119667 119682 TAAGGTTTCCCAGATT TksAksAdsGdsGdsTdsTdsTds 35 2851
mCdsmCdsmCdsAesGksAesTksTe
1198534 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA AksGksTdsAdsAdsGdsGdsTdsTds 30 2852
TdsmCdsmCesmCksAesGksAe
1198535 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG AksAksGdsTdsAdsAdsGdsGds 35 2853
TdsTdsTdsmCesmCksmCesAksGe
1198536 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA TksAksAdsGdsTdsAdsAdsGds 20 2854
GdsTdsTdsTesmCksmCesmCksAe
1198537 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC mCksTksAdsAdsGdsTdsAdsAds 24 1101
GdsGdsTdsTesTksmCesmCksmCe
1198538 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC AksmCksTdsAdsAdsGdsTdsAds 29 2855
AdsGdsGdsTesTksTesmCksmCe
1198539 N/A N/A 119674 119689 GACTAAGTAAGGTTTC GksAksmCdsTdsAdsAdsGdsTds 54 2856
AdsAdsGdsGesTksTesTksmCe
1198540 N/A N/A 119675 119690 AGACTAAGTAAGGTTT AksGksAdsmCdsTdsAdsAdsGds 51 2857
TdsAdsAdsGesGksTesTksTe
1198541 N/A N/A 119677 119692 TTAGACTAAGTAAGGT TksTksAdsGdsAdsmCdsTdsAds 34 2858
AdsGdsTdsAesAksGesGksTe
1198890 2524 2539 123549 123564 TGTCTCATGCCTTATA TksGksTdsmCdsTdsmCdsAdsTds 19 2803
GdsmCdsmCdsTksTdsAksTdsAk
1198891 2526 2541 123551 123566 ATTGTCTCATGCCTTA AksTksTdsGdsTdsmCdsTdsmCds 18 2804
AdsTdsGdsmCksmCdsTksTdsAk
1198892 2527 2542 123552 123567 AATTGTCTCATGCCTT AksAksTdsTdsGdsTdsmCdsTds 24 2805
mCdsAdsTdsGksmCdsmCksTdsTk
1198899 2560 2575 123585 123600 AGTATGTGGCAATAAT AksGksTdsAdsTdsGdsTdsGdsGds 75 2809
mCdsAdsAksTdsAksAdsTk
1198900 2562 2577 123587 123602 AGAGTATGTGGCAATA AksGksAdsGdsTdsAdsTdsGdsTds 11 2810
GdsGdsmCksAdsAksTdsAk
1198901 2563 2578 123588 123603 TAGAGTATGTGGCAAT TksAksGdsAdsGdsTdsAdsTdsGds 28 2811
TdsGdsGksmCdsAksAdsTk
1198902 2564 2579 123589 123604 TTAGAGTATGTGGCAA TksTksAdsGdsAdsGdsTdsAdsTds 13 963
GdsTdsGksGdsmCksAdsAk
1198903 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTdsAdsGdsAdsGdsTdsAds 24 810
TdsGdsTksGdsGksmCdsAk
1198904 2566 2581 123591 123606 TATTAGAGTATGTGGC TksAksTdsTdsAdsGdsAdsGdsTds 12 2812
AdsTdsGksTdsGksGdsmCk
1198905 2567 2582 123592 123607 ATATTAGAGTATGTGG AksTksAdsTdsTdsAdsGdsAdsGds 5 2813
TdsAdsTksGdsTksGdsGk
1198906 2568 2583 123593 123608 TATATTAGAGTATGTG TksAksTdsAdsTdsTdsAdsGdsAds 56 2814
GdsTdsAksTdsGksTdsGk
1198907 2570 2585 123595 123610 TCTATATTAGAGTATG TksmCksTdsAdsTdsAdsTdsTds 74 887
AdsGdsAdsGksTdsAksTdsGk

TABLE 45
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 1 NO: 1 NO: 2 NO: 2
Compound Start Stop Start Stop YAP1 SEQ ID
Number Site Site Site Site Sequence (5′ to 3′) CHEMISTRY NOTATION (% UTC) NO
715487 3630 3645 124655 124670 ATTACTTCATAGCTTA AksTksTksAdsmCdsTdsTdsmCdsAds 28 52
TdsAdsGdsmCdsTksTksAk
958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTksAdsGdsAdsGdsTdsAdsTds 15 810
GdsTdsGdsGksmCksAk
91074461 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAksAdsTdsTdsGdsTdsmCds 9 2800
TdsmCdsAdsTdsGksmCksAk
1095491 4443 4458 125468 125483 ACTGAGGTATAACTGG AksmCksTdsGdsAdsGdsGdsTdsAds 65 392
TdsAdsAksmCdsTksGdsGk
1095509 4441 4456 125466 125481 TGAGGTATAACTGGGC TksGksAdsGdsGdsTdsAdsTdsAdsAds 29 1580
mCdsTksGdsGksGdsmCk
1095510 4442 4457 125467 125482 CTGAGGTATAACTGGG mCksTksGdsAdsGdsGdsTdsAdsTds 35 2801
AdsAdsmCksTdsGksGdsGk
1095511 4444 4459 125469 125484 CACTGAGGTATAACTG mCksAksmCdsTdsGdsAdsGdsGdsTds 46 2802
AdsTdsAksAdsmCksTdsGk
1198893 2528 2543 123553 123568 AAATTGTCTCATGCCT AksAksAdsTdsTdsGdsTdsmCdsTds 58 443
mCdsAdsTksGdsmCksmCdsTk
1198894 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAdsAdsTdsTdsGdsTdsmCds 57 2800
TdsmCdsAksTdsGksmCksmCk
1198895 2530 2545 123555 123570 GGAAATTGTCTCATGC GksGksAdsAdsAdsTdsTdsGdsTds 22 2806
mCdsTdsmCksAdsTksGdsmCk
1198896 2531 2546 123556 123571 TGGAAATTGTCTCATG TksGksGdsAdsAdsAdsTdsTdsGdsTds 59 2807
mCdsTksmCdsAksTdsGk
1198897 2532 2547 123557 123572 ATGGAAATTGTCTCAT AksTksGdsGdsAdsAdsAdsTdsTds 61 2808
GdsTdsmCksTdsmCksAdsTk
1198898 2534 2549 123559 123574 ATATGGAAATTGTCTC AksTksAdsTdsGdsGdsAdsAdsAds 53 656
TdsTdsGksTdsmCksTdsmCk
1198908 4436 4451 125461 125476 TATAACTGGGCAAATT TksAksTdsAdsAdsmCdsTdsGdsGds 124 2815
GdsmCdsAksAdsAksTdsTk
1198909 4438 4453 125463 125478 GGTATAACTGGGCAAA GksGksTdsAdsTdsAdsAdsmCdsTds 56 1427
GdsGdsGksmCdsAksAdsAk
1198910 4439 4454 125464 125479 AGGTATAACTGGGCAA AksGksGdsTdsAdsTdsAdsAdsmCds 40 905
TdsGdsGksGdsmCksAdsAk
1198911 4440 4455 125465 125480 GAGGTATAACTGGGCA GksAksGdsGdsTdsAdsTdsAdsAds 26 1503
mCdsTdsGksGdsGksmCdsAk
1198912 4446 4461 125471 125486 AACACTGAGGTATAAC AksAksmCdsAdsmCdsTdsGdsAdsGds 78 2816
GdsTdsAksTdsAksAdsmCk
1198913 4595 4610 125620 125635 TTACATTAGGAACAAG TksTksAdsmCdsAdsTdsTdsAdsGds 86 2817
GdsAdsAksmCdsAksAdsGk
1198914 4597 4612 125622 125637 TTTTACATTAGGAACA TksTksTdsTdsAdsmCdsAdsTdsTds 68 2818
AdsGdsGksAdsAksmCdsAk
1198915 4598 4613 125623 125638 CTTTTACATTAGGAAC mCksTksTdsTdsTdsAdsmCdsAdsTds 37 1124
TdsAdsGksGdsAksAdsmCk
1198916 4599 4614 125624 125639 ACTTTTACATTAGGAA AksmCksTdsTdsTdsTdsAdsmCdsAds 59 2819
TdsTdsAksGdsGksAdsAk
1198917 4600 4615 125625 125640 CACTTTTACATTAGGA mCksAksmCdsTdsTdsTdsTdsAdsmCds 21 1200
AdsTdsTksAdsGksGdsAk
1198918 4601 4616 125626 125641 GCACTTTTACATTAGG GksmCksAdsmCdsTdsTdsTdsTdsAds 27 1276
mCdsAdsTksTdsAksGdsGk
1198919 4602 4617 125627 125642 AGCACTTTTACATTAG AksGksmCdsAdsmCdsTdsTdsTdsTds 60 2820
AdsmCdsAksTdsTksAdsGk
1198920 4603 4618 125628 125643 AAGCACTTTTACATTA AksAksGdsmCdsAdsmCdsTdsTdsTds 54 2821
TdsAdsmCksAdsTksTdsAk
1198921 4605 4620 125630 125645 TTAAGCACTTTTACAT TksTksAdsAdsGdsmCdsAdsmCdsTds 89 2822
TdsTdsTksAdsmCksAdsTk
1198922 4795 4810 125820 125835 GGAAGATCTGAAACTC GksGksAdsAdsGdsAdsTdsmCdsTds 59 2823
GdsAdsAksAdsmCksTdsmCk
1198923 4797 4812 125822 125837 TTGGAAGATCTGAAAC TksTksGdsGdsAdsAdsGdsAdsTds 73 2824
mCdsTdsGksAdsAksAdsmCk
1198924 4798 4813 125823 125838 TTTGGAAGATCTGAAA TksTksTdsGdsGdsAdsAdsGdsAdsTds 75 2825
mCdsTksGdsAksAdsAk
1198925 4799 4814 125824 125839 CTTTGGAAGATCTGAA mCksTksTdsTdsGdsGdsAdsAdsGds 52 2826
AdsTdsmCksTdsGksAdsAk
1198926 4800 4815 125825 125840 GCTTTGGAAGATCTGA GksmCksTdsTdsTdsGdsGdsAdsAds 45 2044
GdsAdsTksmCdsTksGdsAk
1198927 4801 4816 125826 125841 TGCTTTGGAAGATCTG TksGksmCdsTdsTdsTdsGdsGdsAds 50 2121
AdsGdsAksTdsmCksTdsGk
1198928 4802 4817 125827 125842 GTGCTTTGGAAGATCT GksTksGdsmCdsTdsTdsTdsGdsGds 28 2827
AdsAdsGksAdsTksmCdsTk
1198929 4803 4818 125828 125843 AGTGCTTTGGAAGATC AksGksTdsGdsmCdsTdsTdsTdsGds 43 2828
GdsAdsAksGdsAksTdsmCk
1198930 4805 4820 125830 125845 ATAGTGCTTTGGAAGA AksTksAdsGdsTdsGdsmCdsTdsTdsTds 68 2829
GdsGksAdsAksGdsAk
1198931 N/A N/A 94729 94744 AGGATGCATGGTTTTT AksGksGdsAdsTdsGdsmCdsAdsTds 47 2830
GdsGdsTksTdsTksTdsTk
1198932 N/A N/A 94731 94746 TTAGGATGCATGGTTT TksTksAdsGdsGdsAdsTdsGdsmCds 35 2831
AdsTdsGksGdsTksTdsTk
1198933 N/A N/A 94732 94747 TTTAGGATGCATGGTT TksTksTdsAdsGdsGdsAdsTdsGds 69 2832
mCdsAdsTksGdsGksTdsTk
1198934 N/A N/A 94733 94748 ATTTAGGATGCATGGT AksTksTdsTdsAdsGdsGdsAdsTdsGds 56 2833
mCdsAksTdsGksGdsTk
1198935 N/A N/A 94734 94749 GATTTAGGATGCATGG GksAksTdsTdsTdsAdsGdsGdsAdsTds 18 2834
GdsmCksAdsTksGdsGk
1198936 N/A N/A 94735 94750 AGATTTAGGATGCATG AksGksAdsTdsTdsTdsAdsGdsGdsAds 38 2835
TdsGksmCdsAksTdsGk
1198937 N/A N/A 94736 94751 CAGATTTAGGATGCAT mCksAksGdsAdsTdsTdsTdsAdsGds 48 2836
GdsAdsTksGdsmCksAdsTk
1198938 N/A N/A 94737 94752 TCAGATTTAGGATGCA TksmCksAdsGdsAdsTdsTdsTdsAds 59 2837
GdsGdsAksTdsGksmCdsAk
1198939 N/A N/A 94739 94754 ATTCAGATTTAGGATG AksTksTdsmCdsAdsGdsAdsTdsTds 102 2838
TdsAdsGksGdsAksTdsGk
1198940 N/A N/A 115903 115918 ATATGGTTTTGTGTGT AksTksAdsTdsGdsGdsTdsTdsTdsTds 51 2881
GdsTksGdsTksGdsTk
1198941 N/A N/A 115905 115920 TTATATGGTTTTGTGT TksTksAdsTdsAdsTdsGdsGdsTdsTds 35 2840
TdsTksGdsTksGdsTk
1198942 N/A N/A 115906 115921 CTTATATGGTTTTGTG mCksTksTdsAdsTdsAdsTdsGdsGds 42 2788
TdsTdsTksTdsGksTdsGk
1198943 N/A N/A 115907 115922 TCTTATATGGTTTTGT TksmCksTdsTdsAdsTdsAdsTdsGds 31 2841
GdsTdsTksTdsTksGdsTk
1198944 N/A N/A 115908 115923 CTCTTATATGGTTTTG mCksTksmCdsTdsTdsAdsTdsAdsTds 34 2842
GdsGdsTksTdsTksTdsGk
1198945 N/A N/A 115909 115924 ACTCTTATATGGTTTT AksmCksTdsmCdsTdsTdsAdsTdsAds 48 2859
TdsGdsGksTdsTksTdsTk
1198946 N/A N/A 115910 115925 AACTCTTATATGGTTT AksAksmCdsTdsmCdsTdsTdsAdsTds 72 2860
AdsTdsGksGdsTksTdsTk
1198947 N/A N/A 115911 115926 CAACTCTTATATGGTT mCksAksAdsmCdsTdsmCdsTdsTds 88 2861
AdsTdsAdsTksGdsGksTdsTk
1198948 N/A N/A 115913 115928 GACAACTCTTATATGG GksAksmCdsAdsAdsmCdsTdsmCds 96 2862
TdsTdsAdsTksAdsTksGdsGk
1198949 N/A N/A 117325 117340 ATTGCAATCTGTCTGA AksTksTdsGdsmCdsAdsAdsTdsmCds 61 2843
TdsGdsTksmCdsTksGdsAk
1198950 N/A N/A 117327 117342 ATATTGCAATCTGTCT AksTksAdsTdsTdsGdsmCdsAdsAds 85 2844
TdsmCdsTksGdsTksmCdsTk
1198951 N/A N/A 117328 117343 AATATTGCAATCTGTC AksAksTdsAdsTdsTdsGdsmCdsAds 81 2845
AdsTdsmCksTdsGksTdsmCk
1198952 N/A N/A 117329 117344 TAATATTGCAATCTGT TksAksAdsTdsAdsTdsTdsGdsmCds 77 2846
AdsAdsTksmCdsTksGdsTk
1198953 N/A N/A 117330 117345 GTAATATTGCAATCTG GksTksAdsAdsTdsAdsTdsTdsGds 58 1404
mCdsAdsAksTdsmCksTdsGk
1198954 N/A N/A 117331 117346 TGTAATATTGCAATCT TksGksTdsAdsAdsTdsAdsTdsTdsGds 94 2847
mCdsAksAdsTksmCdsTk
1198955 N/A N/A 117332 117347 ATGTAATATTGCAATC AksTksGdsTdsAdsAdsTdsAdsTdsTds 92 2848
GdsmCksAdsAksTdsmCk
1198956 N/A N/A 117333 117348 TATGTAATATTGCAAT TksAksTdsGdsTdsAdsAdsTdsAdsTds 76 2849
TdsGksmCdsAksAdsTk
1198957 N/A N/A 117335 117350 TTTATGTAATATTGCA TksTksTdsAdsTdsGdsTdsAdsAdsTds 81 2850
AdsTksTdsGksmCdsAk
1198958 N/A N/A 117755 117770 TGTATGTCAGAAGAGT TksGksTdsAdsTdsGdsTdsmCdsAds 12 2863
GdsAdsAksGdsAksGdsTk
1198959 N/A N/A 117757 117772 AGTGTATGTCAGAAGA AksGksTdsGdsTdsAdsTdsGdsTds 8 2864
mCdsAdsGksAdsAksGdsAk
1198960 N/A N/A 117758 117773 AAGTGTATGTCAGAAG AksAksGdsTdsGdsTdsAdsTdsGdsTds 6 2865
mCdsAksGdsAksAdsGk
1198961 N/A N/A 117759 117774 AAAGTGTATGTCAGAA AksAksAdsGdsTdsGdsTdsAdsTds 12 2866
GdsTdsmCksAdsGksAdsAk
1198962 N/A N/A 117760 117775 TAAAGTGTATGTCAGA TksAksAdsAdsGdsTdsGdsTdsAdsTds 52 2867
GdsTksmCdsAksGdsAk
1198963 N/A N/A 117761 117776 TTAAAGTGTATGTCAG TksTksAdsAdsAdsGdsTdsGdsTdsAds 27 2868
TdsGksTdsmCksAdsGk
1198964 N/A N/A 117762 117777 TTTAAAGTGTATGTCA TksTksTdsAdsAdsAdsGdsTdsGdsTds 59 2869
AdsTksGdsTksmCdsAk
1198965 N/A N/A 117763 117778 CTTTAAAGTGTATGTC mCksTksTdsTdsAdsAdsAdsGdsTds 95 1634
GdsTdsAksTdsGksTdsmCk
1198967 N/A N/A 119667 119682 TAAGGTTTCCCAGATT TksAksAdsGdsGdsTdsTdsTdsmCds 65 2851
mCdsmCdsAksGdsAksTdsTk
1198968 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA AksGksTdsAdsAdsGdsGdsTdsTdsTds 57 2852
mCdsmCksmCdsAksGdsAk
1198969 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG AksAksGdsTdsAdsAdsGdsGdsTdsTds 31 2853
TdsmCksmCdsmCksAdsGk
1198970 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA TksAksAdsGdsTdsAdsAdsGdsGdsTds 29 2854
TdsTksmCdsmCksmCdsAk
1198971 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC mCksTksAdsAdsGdsTdsAdsAdsGds 31 1101
GdsTdsTksTdsmCksmCdsmCk
1198972 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC AksmCksTdsAdsAdsGdsTdsAdsAds 46 2855
GdsGdsTksTdsTksmCdsmCk
1198973 N/A N/A 119674 119689 GACTAAGTAAGGTTTC GksAksmCdsTdsAdsAdsGdsTdsAds 53 2856
AdsGdsGksTdsTksTdsmCk
1198974 N/A N/A 119675 119690 AGACTAAGTAAGGTTT AksGksAdsmCdsTdsAdsAdsGdsTds 73 2857
AdsAdsGksGdsTksTdsTk
1198975 N/A N/A 119677 119692 TTAGACTAAGTAAGGT TksTksAdsGdsAdsmCdsTdsAdsAds 52 2858
GdsTdsAksAdsGksGdsTk

TABLE 46
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
SEQ SEQ SEQ SEQ
ID ID ID ID
NO: 1 NO: 1 NO: 2 NO: 2 YAP1 SEQ
Compound Start Stop Start Stop Sequence (% ID
Number Site Site Site Site (5′ to 3′) CHEMSITRY NOTATION UTC) NO
 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA AksTksTksAdsmCdsTdsTdsmCdsAds  25   52
TdsAdsGdsmCdsTksTksAk
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksksAdsGdsAdsGdsTdsAdsTds  16  810
GdsTdsGdsGksmCksAk
1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAksAdsTdsTdsGdsTdsmCds  14 2800
TdsmCdsAdsTdsGksmCksmCk
1095407 4443 4458 125468 125483 ACTGAGGTATAACTGG AksmCksTdsGdsAdsGdsGdsTdsAds  54  392
TdsAdsAksmCesTksGesGk
1095425 4441 4456 125466 125481 TGAGGTATAACTGGGC TksGksAdsGdsGdsTdsAdsTdsAdsAds  57 1580
mCdsTksGesGksGesmCk
1095426 4442 4457 125467 125482 CTGAGGTATAACTGGG mCksTksGdsAdsGdsGdsTdsAdsTds  54 2801
AdsAdsmCksTesGksGesGk
1095427 4444 4459 125469 125484 CACTGAGGTATAACTG mCksAksmCdsTdsGdsAdsGdsGdsTds  45 2802
AdsTdsAksAesmCksTesGk
1198804 2524 2539 123549 123564 TGTCTCATGCCTTATA TksGksTdsmCdsTdsmCdsAdsTdsGdsm  22 2803
CdsmCdsTksTesAksTesAk
1198805 2526 2541 123551 123566 ATTGTCTCATGCCTTA AksTksTdsGdsTdsmCdsTdsmCdsAds  23 2804
TdsGdsmCksmCesTksTesAk
1198806 2527 2542 123552 123567 AATTGTCTCATGCCTT AksAksTdsTdsGdsTdsmCdsTdsmCds  33 2805
AdsTdsGksmCesmCksTesTk
1198807 2528 2543 123553 123568 AAATTGTCTCATGCCT AksAksAdsTdsTdsGdsTdsmCdsTdsm  44  433
CdsAdsTksGesmCksmCesTk
1198808 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAdsAdsTdsTdsGdsTdsmCds  40 2800
TdsmCdsAksTesGksmCesmCk
1198809 2530 2545 123555 123570 GGAAATTGTCTCATGC GksGksAdsAdsAdsTdsTdsGdsTdsm  27 2806
CdsTdsmCksAesTksGesmCk
1198810 2531 2546 123556 123571 TGGAAATTGTCTCATG TksGksGdsAdsAdsAdsTdsTdsGdsTds  50 2807
mCdsTksmCesAksTesGk
1198811 2532 2547 123557 123572 ATGGAAATTGTCTCAT AksTksGdsGdsAdsAdsAdsTdsTdsGds  38 2808
TdsmCksTesmCksAesTk
1198812 2534 2549 123559 123574 ATATGGAAATTGTCTC AksTksAdsTdsGdsGdsAdsAdsAdsTds  26  656
TdsGksTesmCksTesmCk
1198813 2560 2575 123585 123600 AGTATGTGGCAATAAT AksGksTdsAdsTdsGdsTdsGdsGdsm  55 2809
CdsAdsAksTesAksAesTk
1198814 2562 2577 123587 123602 AGAGTATGTGGCAATA AksGksAdsGdsTdsAdsTdsGdsTdsGds  13 2810
GdsmCksAesAksTesAk
1198815 2563 2578 123588 123603 TAGAGTATGTGGCAAT TksAksGdsAdsGdsTdsAdsTdsGdsTds  24 2811
GdsGksmCesAksAesTk
1198816 2564 2579 123589 123604 TTAGAGTATGTGGCAA TksTksAdsGdsAdsGdsTdsAdsTdsGds  27  963
TdsGksGesmCksAesAk
1198817 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTdsAdsGdsAdsGdsTdsAdsTds  43  810
GdsTksGesGksmCesAk
1198818 2566 2581 123591 123606 TATTAGAGTATGTGGC TksAksTdsTdsAdsGdsAdsGdsTdsAds  15 2812
TdsGksTesGksGesmCk
1198819 2567 2582 123592 123607 ATATTAGAGTATGTGG AksTksAdsTdsTdsAdsGdsAdsGdsTds  44 2813
AdsTksGesTksGesGk
1198820 2568 2583 123593 123608 TATATTAGAGTATGTG TksAksTdsAdsTdsTdsAdsGdsAdsGds  62 2814
TdsAksTesGksTesGk
1198821 2570 2585 123595 123610 TCTATATTAGAGTATG TksmCksTdsAdsTdsAdsTdsTdsAds  62  887
GdsAdsGksTesAksTesGk
1198822 4436 4451 125461 125476 TATAACTGGGCAAATT TksAksTdsAdsAdsmCdsTdsGdsGds  97 2815
GdsmCdsAksAesAksTesTk
1198823 4438 4453 125463 125478 GGTATAACTGGGCAAA GksGksTdsAdsTdsAdsAdsmCdsTds  65 1427
GdsGdsGksmCesAksAesAk
1198824 4439 4454 125464 125479 AGGTATAACTGGGCAA AksGksGdsTdsAdsTdsAdsAdsmCds  72  905
TdsGdsGksGesmCksAesAk
1198825 4440 4455 125465 125480 GAGGTATAACTGGGCA GksAksGdsGdsTdsAdsTdsAdsAdsm  64 1503
CdsTdsGksGesGksmCesAk
1198826 4446 4461 125471 125486 AACACTGAGGTATAAC AksAksmCdsAdsmCdsTdsGdsAdsGds  64 2816
GdsTdsAksTesAksAesmCk
1198827 4595 4610 125620 125635 TTACATTAGGAACAAG TksTksAdsmCdsAdsTdsTdsAdsGds  60 2817
GdsAdsAksmCesAksAesGk
1198828 4597 4612 125622 125637 TTTTACATTAGGAACA TksTksTdsTdsAdsmCdsAdsTdsTdsAds  59 2818
GdsGksAesAksmCesAk
1198829 4598 4613 125623 125638 CTTTTACATTAGGAAC mCksTksTdsTdsTdsAdsmCdsAdsTds  36 1124
TdsAdsGksGesAksAesmCk
1198830 4599 4614 125624 125639 ACTTTTACATTAGGAA AksmCksTdsTdsTdsTdsAdsmCdsAds  37 2819
TdsTdsAksGesGksAesAk
1198831 4600 4615 125625 125640 CACTTTTACATTAGGA mCksAksmCdsTdsTdsTdsTdsAdsmCds  12 1200
AdsTdsTksAesGksGesAk
1198832 4601 4616 125626 125641 GCACTTTTACATTAGG GksmCksAdsmCdsTdsTdsTdsTdsAdsm  20 1276
CdsAdsTksTesAksGesGk
1198833 4602 4617 125627 125642 AGCACTTTTACATTAG AksmCdsAdsmCdsTdsTdsTdsTds  54 2820
AdsmCdsAksTesTksAesGk
1198834 4603 4618 125628 125643 AAGCACTTTTACATTA AksAksGdsmCdsAdsmCdsTdsTdsTds  54 2821
TdsAdsmCksAesTksTesAk
1198835 4605 4620 125630 125645 TTAAGCACTTTTACAT TksTksAdsAdsGdsmCdsAdsmCdsTds   85 2822
TdsTdsTksAesmCksAesTk
1198836 4795 4810 125820 125835 GGAAGATCTGAAACTC GksGksAdsAdsGdsAdsTdsmCdsTds  43 2823
GdsAdsAksAesmCksTesmCk
1198837 4797 4812 125822 125837 TTGGAAGATCTGAAAC TksTksGdsGdsAdsAdsGdsAdsTdsm  66 2824
CdsTdsGksAesAksAesmCk
1198838 4798 4813 125823 125838 TTTGGAAGATCTGAAA TksTksTdsGdsGdsAdsAdsGdsAdsTds  66 2825
mCdsTksGesAksAesAk
1198839 4799 4814 125824 125839 CTTTGGAAGATCTGAA mCksTksTdsTdsGdsGdsAdsAdsGds  36 2826
AdsTdsmCksTesGksAesAk
1198840 4800 4815 125825 125840 GCTTTGGAAGATCTGA GksmCksTdsTdsTdsGdsGdsAdsAds  26 2044
GdsAdsTksmCesTksGesAk
1198841 4801 4816 125826 125841 TGCTTTGGAAGATCTG TksGksmCdsTdsTdsTdsGdsGdsAds 116 2121
AdsGdsAksTesmCksTesGk
1198842 4802 4817 125827 125842 GTGCTTTGGAAGATCT GksTksGdsmCdsTdsTdsTdsGdsGds  37 2827
AdsAdsGksAesTksmCesTk
1198843 4803 4818 125828 125843 AGTGCTTTGGAAGATC AksGksTdsGdsmCdsTdsTdsTdsGds  45 2828
GdsAdsAksGesAksTesmCk
1198844 4805 4820 125830 125845 ATAGTGCTTTGGAAGA AksTksAdsGdsTdsGdsmCdsTdsTds  56 2829
TdsGdsGksAesAksGesAk
1198845 N/A N/A  94729  94744 AGGATGCATGGTTTTT AksGksGdsAdsTdsGdsmCdsAdsTds  43 2830
GdsGdsTksTesTksTesTk
1198846 N/A N/A  94731  94746 TTAGGATGCATGGTTT TksTksAdsGdsGdsAdsTdsGdsmCds  34 2831
AdsTdsGksGesTksTesTk
1198847 N/A N/A  94732  94747 TTTAGGATGCATGGTT TksTksTdsAdsGdsGdsAdsTdsGdsm  51 2832
CdsAdsTksGesGksTesTk
1198848 N/A N/A  94733  94748 ATTTAGGATGCATGGT AksTksTdsTdsAdsGdsGdsAdsTdsGds  47 2833
mCdsAksTesGksGesTk
1198849 N/A N/A  94734  94749 GATTTAGGATGCATGG GksAksTdsTdsTdsAdsGdsGdsAdsTds  42 2834
GdsmCksAesTksGesGk
1198850 N/A N/A  94735  94750 AGATTTAGGATGCATG AksGksAdsTdsTdsTdsAdsGdsGdsAds  33 2835
TdsGksmCesAksTesGk
1198851 N/A N/A  94736  94751 CAGATTTAGGATGCAT mCksAksGdsAdsTdsTdsTdsAdsGds  82 2836
GdsAdsTksGesmCksAesTk
1198852 N/A N/A  94737  94752 TCAGATTTAGGATGCA TksmCksAdsGdsAdsTdsTdsTdsAds  41 2837
GdsGdsAksTesGksmCesAk
1198853 N/A N/A  94739  94754 ATTCAGATTTAGGATG AksTksTdsmCdsAdsGdsAdsTdsTds 105 2838
TdsAdsGksGesAksTesGk
1198854 N/A N/A 115903 115918 ATATGGTTTTGTGTGT AksTksAdsTdsGdsGdsTdsTdsTdsTds  56 2839
GdsTksGesTksGesTk
1198855 N/A N/A 115905 115920 TTATATGGTTTTGTGT TksTksAdsTdsAdsTdsGdsGdsTdsTds  30 2840
TdsTksGesTksGesTk
1198856 N/A N/A 115906 115921 CTTATATGGTTTTGTG mCksTksTdsAdsTdsAdsTdsGdsGds  20 2788
TdsTdsTksTesGksTesGk
1198857 N/A N/A 115907 115922 TCTTATATGGTTTTGT TksmCksTdsTdsAdsTdsAdsTdsGds  19 2841
GdsTdsTksTesTksGesTk
1198863 N/A N/A 117325 117340 ATTGCAATCTGTCTGA AksTksTdsGdsmCdsAdsAdsTdsmCds  65 2843
TdsGdsTksmCesTksGesAk
1198864 N/A N/A 117327 117342 ATATTGCAATCTGTCT AksTksAdsTdsTdsGdsmCdsAdsAds  56 2844
TdsmCdsTksGesTksmCesTk
1198865 N/A N/A 117328 117343 AATATTGCAATCTGTC AksAdsTdsTdsGdsmCdsAds  38 2845
dAsTdsmCksTesGksTesmCk
1198866 N/A N/A 117329 117344 TAATATTGCAATCTGT TksAksAdsTdsAdsTdsTdsGdsmCds  60 2846
AdsAdsTksmCesTksGesTk
1198867 N/A N/A 117330 117345 GTAATATTGCAATCTG GksTksAdsAdsTdsAdsTdsTdsGdsm  25 1404
CdsAdsAksTesmCksTesGk
1198868 N/A N/A 117331 117346 TGTAATATTGCAATCT TksGksTdsAdsAdsTdsAdsTdsTdsGds  49 2847
mCdsAksAesTksmCesTk
1198869 N/A N/A 117332 117347 ATGTAATATTGCAATC AksTksGdsTdsAdsAdsTdsAdsTdsTds  49 2848
GdsmCksAesAksTesmCk
1198870 N/A N/A 117333 117348 TATGTAATATTGCAAT TksAksTdsGdsTdsAdsAdsTdsAdsTds  86 2849
TdsGksmCesAksAesTk
1198871 N/A N/A 117335 117350 TTTATGTAATATTGCA TksTksTdsAdsTdsGdsTdsAdsAdsTds  77 2850
AdsTksTesGksmCesAk
1198881 N/A N/A 119667 119682 TAAGGTTTCCCAGATT TksAksAdsGdsGdsTdsTdsTdsmCdsm  36 2851
CdsmCdsAksGesAksTesTk
1198882 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA AksGksTdsAdsAdsGdsGdsTdsTdsTds  56 2852
mCdsmCksmCesAksGesAk
1198883 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG AksAksGdsTdsAdsAdsGdsGdsTdsTds  47 2853
TdsmCksmCesmCksAesGk
1198884 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA TksAksAdsGdsTdsAdsAdsGdsGdsTds  28 2854
TdsTksmCesmCksmCesAk
1198885 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC mCksTksAdsAdsGdsTdsAdsAdsGds  41 1101
GdsTdsTksTesmCksmCesmCk
1198886 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC AksmCksTdsAdsAdsGdsTdsAdsAds  45 2855
GdsGdsTksTesTksmCesmCk
1198887 N/A N/A 119674 119689 GACTAAGTAAGGTTTC GksAksmCdsTdsAdsAdsGdsTdsAds  71 2856
AdsGdsGksTesTksTesmCk
1198888 N/A N/A 119675 119690 AGACTAAGTAAGGTTT AksGksAdsmCdsTdsAdsAdsGdsTds  51 2857
AdsAdsGksGesTksTesTk
1198889 N/A N/A 119677 119692 TTAGACTAAGTAAGGT TksTksAdsGdsAdsmCdsTdsAdsAds  27 2858
GdsTdsAksAesGksGesTk
1198966 N/A N/A 117765 117780 AACTTTAAAGTGTATG AksAksmCdsTdsTdsTdsAdsAdsAds  78 2870
GdsTdsGksTdsAksTdsGk

TABLE 47
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
SEQ SEQ SEQ SEQ
ID ID ID ID
NO: 1 NO: 1 NO: 2 NO: 2 YAP1 SEQ
Compound Start Stop Start Stop Sequence (% ID
Number Site Site Site Site (5′ to 3′) CHEMSITRY NOTATION UTC) NO
 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA AksTksTksAdsmCdsTdsTdsmCdsAds  39   52
TdsAdsGdsmCdsTksTksAk
 716444 2528 2543 123553 123568 AAATTGTCTCATGCCT AksAksAksTdsTdsGdsTdsmCdsTdsm  46  443
CdsAdsTdsGdsmCksmCksTk
 958497 2534 2549 123559 123574 ATATGGAAATTGTCTC AksTksAksTdsGdsGdsAdsAdsAdsTds  20  656
TdsGdsTdsmCksTksmCk
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTksAdsGdsAdsGdsTdsAdsTds  17  810
GdsTdsGdsGksmCksAk
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTksAdsGdsAdsGdsTdsAdsTds  10  810
GdsTdsGdsGksmCksAk
 958500 2570 2585 123595 123610 TCTATATTAGAGTATG TksmCksTksAdsTdsAdsTdsTdsAds  53  887
GdsAdsGdsTdsAksTksGk
1009324 2560 2575  36419  36434 AGTATGTGGCAATAAT AksGksTksAdsTdsGdsTdsGdsGdsm  27 2809
 63341  63356 CdsAdsAdsTdsAksAksTk
123585 123600
1009325 2562 2577  63343  63358 AGAGTATGTGGCAATA AksGksAksGdsTdsAdsTdsGdsTdsGds  16 2810
 71690  71705 GdsmCdsAdsAksTksAk
123587 123602
1009326 2566 2581 123591 123606 TATTAGAGTATGTGGC TksAksTksTdsAdsGdsAdsGdsTdsAds  10 2812
TdsGdsTdsGksGksmCk
1009327 2567 2582 123592 123607 ATATTAGAGTATGTGG AksTksAksTdsTdsAdsGdsAdsGdsTds  27 2813
AdsTdsGdsTksGksGk
1009328 2568 2583 123593 123608 TATATTAGAGTATGTG TksAksTksAdsTdsTdsAdsGdsAdsGds  67 2814
TdsAdsTdsGksTksGk
1009394 2223 2238 123248 123263 TATAACTGGGCAAATT TksAksTksAdsAdsmCdsTdsGdsGds  73 2815
4436 4451 125461 125476 GdsmCdsAdsAdsAksTksTk
1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAksAdsTdsTdsGdsTdsCds   5 2800
TdsmCdsAdsTdsGksmCksmCk
1074462 2530 2545 123555 123570 GGAAATTGTCTCATGC GksGksAksAdsAdsTdsTdsGdsTdsm   7 2806
CdsTdsmCdsAdsTksGksmCk
1074463 2563 2578 123588 123603 TAGAGTATGTGGCAAT TksAksGksAdsGdsTdsAdsTdsGdsTds  20 2811
GdsGdsmCdsAksAksTk
1074464 2564 2579 123589 123604 TTAGAGTATGTGGCAA TksTksAksGdsAdsGdsTdsAdsTdsGds   5  963
TdsGdsGdsmCksAksAk
1074754 4598 4613 125623 125638 CTTTTACATTAGGAAC mCksTksTksTdsTdsAdsmCdsAdsTds  69 1124
TdsAdsGdsGdsAksAksmCk
1074755 4600 4615 125625 125640 CACTTTTACATTAGGA mCksAksmCksTdsTdsTdsTdsAdsmCds  23 1200
AdsTdsTdsAdsGksGksAk
1074756 4601 4616 125626 125641 GCACTTTTACATTAGG GksmCksAdsmCdsTdsTdsTdsTdsAdsm   8 1276
CdsAdsTdsTdsAksGksGk
1074798 4800 4815 125825 125840 GCTTTGGAAGATCTGA GksmCksTksTdsTdsGdsGdsAdsAds  19 2044
GdsAdsTdsmCdsTksGksAk
1074799 4801 4816 125826 125841 TGCTTTGGAAGATCTG TksGksmCksTdsTdsTdsGdsGdsAds  21 2121
AdsGdsAdsTdsmCksTksGk
1076186 N/A N/A  94733  94748 ATTTAGGATGCATGGT AksTksTksTdsAdsGdsGdsAdsTdsGds  31 2833
mCdsAdsTdsGksGksTk
1076187 N/A N/A  94734  94749 GATTTAGGATGCATGG GksAksTksTdsTdsAdsGdsGdsAdsTds  17 2834
GdsmCdsAdsTksGksGk
1076453 N/A N/A 117330 117345 GTAATATTGCAATCTG GksTksAksAdsTdsAdsTdsTdsGdsm   7 1404
CdsAdsAdsTdsmCksTksGk
1076481 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC mCksTksAksAdsGdsTdsAdsAdsGds  13 1101
GdsTdsTdsTdsmCksmCksmCk
1096369 4802 4817 125827 125842 GTGCTTTGGAAGATCT GksTksGksmCdsTdsTdsTdsGdsGds  45 2827
AdsAdsGdsAdsTksmCksTk
1097037 N/A N/A  94735  94750 AGATTTAGGATGCATG AksGksAksTdsTdsTdsAdsGdsGdsAds  38 2835
TdsGdsmCdsAksTksGk
1097238 N/A N/A 117325 117340 ATTGCAATCTGTCTGA AksTksTksGdsmCdsAdsAdsTdsmCds  77 2843
TdsGdsTdsmCdsTksGksAk
1197176 2524 2539 123549 123564 TGTCTCATGCCTTATA TksGksTksmCdsTdsmCdsAdsTdsGdsm  17 2803
CdsmCdsTdsTdsAksTksAk
1197177 2526 2541 123551 123566 ATTGTCTCATGCCTTA AksTksTksGdsTdsmCdsTdsmCdsAds  15 2804
TdsGdsmCdsmCdsTksTksAk
1197178 2527 2542 123552 123567 AATTGTCTCATGCCTT AksAksTksTdsGdsTdsmCdsTdsmCds  12 2805
AdsTdsGdsmCdsmCksTksTk
1197179 2531 2546 123556 123571 TGGAAATTGTCTCATG TksGksGksAdsAdsAdsTdsTdsGdsTds  16 2807
mCdsTdsmCdsAksTksGk
1197180 2532 2547 123557 123572 ATGGAAATTGTCTCAT AksTksGksGdsAdsAdsAdsTdsTdsGds  47 2808
TdsmCdsTdsmCksAksTk
1197181 4595 4610 125620 125635 TTACATTAGGAACAAG TksTksAksmCdsAdsTdsTdsAdsGds  87 2817
GdsAdsAdsmCdsAksAksGk
1197182 4597 4612 125622 125637 TTTTACATTAGGAACA TksTksTksTdsAdsmCdsAdsTdsTds 115 2818
AdsGdsGdsAdsAksmCksAk
1197183 4599 4614 125624 125639 ACTTTTACATTAGGAA AksmCksTksTdsTdsTdsAdsmCdsAds  41 2819
TdsTdsAdsGdsGksAksAk
1197184 4602 4617 125627 125642 AGCACTTTTACATTAG AksGksmCksAdsmCdsTdsTdsTdsTds  20 2820
AdsmCdsAdsTdsTksAksGk
1197185 4603 4618 125628 125643 AAGCACTTTTACATTA AksAksGksmCdsAdsmCdsTdsTdsTds  55 2821
TdsAdsmCdsAdsTksTksAk
1197186 4605 4620 125630 125645 TTAAGCACTTTTACAT TksTksAksAdsGdsmCdsAdsmCdsTds  65 2822
TdsTdsTdsAdsmCksAksTk
1197187 4795 4810 125820 125835 GGAAGATCTGAAACTC GksGksAksAdsGdsAdsTdsmCdsTds  24 2823
GdsAdsAdsAdsmCksTksmCk
1197188 4797 4812 125822 125837 TTGGAAGATCTGAAAC TksTksGksGdsAdsAdsGdsAdsTdsm  96 2824
CdsTdsGdsAdsAksAksmCk
1197189 4798 4813 125823 125838 TTTGGAAGATCTGAAA TksTksTksGdsGdsAdsAdsGdsAdsTds  71 2825
mCdsTdsGdsAksAksAk
1197190 4799 4814 125824 125839 CTTTGGAAGATCTGAA mCksTksTksTdsGdsGdsAdsAdsGds  57 2826
AdsTdsmCdsTdsGksAksAk
1197191 4803 4818 125828 125843 AGTGCTTTGGAAGATC AksGksTksGdsmCdsTdsTdsTdsGds  40 2828
GdsAdsAdsGdsAksTksmCk
1197192 4805 4820 125830 125845 ATAGTGCTTTGGAAGA AksTksAksGdsTdsGdsmCdsTdsTds  39 2829
TdsGdsGdsAdsAksGksAk
1197193 N/A N/A  94729  94744 AGGATGCATGGTTTTT AksGksGksAdsTdsGdsmCdsAdsTds  15 2830
GdsGdsTdsTdsTksTksTk
1197194 N/A N/A  94731  94746 TTAGGATGCATGGTTT TksTksAksGdsGdsAdsTdsGdsmCds  37 2831
AdsTdsGdsGdsTksTksTk
1197195 N/A N/A  94732  94747 TTTAGGATGCATGGTT TksTksTksAdsGdsGdsAdsTdsGdsm  38 2832
CdsAdsTdsGdsGksTksTk
1197196 N/A N/A  94736  94751 CAGATTTAGGATGCAT mCksAksGksAdsTdsTdsTdsAdsGds  27 2836
GdsAdsTdsGdsmCksAksTk
1197197 N/A N/A  94737  94752 TCAGATTTAGGATGCA TksmCksAksGdsAdsTdsTdsTdsAds  20 2837
GdsGdsAdsTdsGksmCksAk
1197198 N/A N/A  94739  94754 ATTCAGATTTAGGATG AksTksTksmCdsAdsGdsAdsTdsTds 139 2838
TdsAdsGdsGdsAksTksGk
1197206 N/A N/A 117327 117342 ATATTGCAATCTGTCT AksTksAksTdsTdsGdsmCdsAdsAds  63 2844
TdsmCdsTdsGdsTksmCksTk
1197207 N/A N/A 117328 117343 AATATTGCAATCTGTC AksAksTksAdsTdsTdsGdsmCdsAds  51 2845
AdsTdsmCdsTdsGksTksmCk
1197208 N/A N/A 117329 117344 TAATATTGCAATCTGT TksAksAksTdsAdsTdsTdsGdsmCds  66 2846
AdsAdsTdsmCdsTksGksTk
1197209 N/A N/A 117331 117346 TGTAATATTGCAATCT TksGksTksAdsAdsTdsAdsTdsTdsGds  33 2847
mCdsAdsAdsTksmCksTk
1197210 N/A N/A 117332 117347 ATGTAATATTGCAATC AksTksGksTdsAdsAdsTdsAdsTdsTds 105 2848
GdsmCdsAdsAksTksmCk
1197211 N/A N/A 117333 117348 TATGTAATATTGCAAT TksAksTksGdsTdsAdsAdsTdsAdsTds  80 2849
TdsGdsmCdsAksAksTk
1197212 N/A N/A 117335 117350 TTTATGTAATATTGCA TksTksTksAdsTdsGdsTdsAdsAdsTds  55 2850
AdsTdsTdsGksmCksAk
1197220 N/A N/A 119667 119682 TAAGGTTTCCCAGATT TksAksAksGdsGdsTdsTdsTdsmCdsm  32 2851
CdsmCdsAdsGdsAksTksTk
1197221 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA AksGksTksAdsAdsGdsGdsTdsTdsTds  42 2852
mCdsmCdsmCdsAksGksAk
1197222 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG AksAksGksTdsAdsAdsGdsGdsTdsTds  40 2853
TdsmCdsmCdsmCksAksGk
1197223 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA TksAksAksGdsTdsAdsAdsGdsGdsTds  11 2854
TdsTdsmCdsmCksmCksAk
1197224 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC AksmCksTksAdsAdsGdsTdsAdsAds  24 2855
GdsGdsTdsTdsTksmCksmCk
1197225 N/A N/A 119674 119689 GACTAAGTAAGGTTTC GksAksmCksTdsAdsAdsGdsTdsAds  46 2856
AdsGdsGdsTdsTksTksmCk
1197226 N/A N/A 119675 119690 AGACTAAGTAAGGTTT AksGksAksmCdsTdsAdsAdsGdsTds  67 2857
AdsAdsGdsGdsTksTksTk
1197227 N/A N/A 119677 119692 TTAGACTAAGTAAGGT TksTksAksGdsAdsmCdsTdsAdsAds  64 2858
GdsTdsAdsAdsGksGksTk
1198858 N/A N/A 115908 115923 CTCTTATATGGTTTTG mCksTksmCdsTdsTdsAdsTdsAdsTds  29 2842
GdsGdsTksTesTksTesGk
1198859 N/A N/A 115909 115924 ACTCTTATATGGTTTT AksmCksTdsmCdsTdsTdsAdsTdsAds  33 2859
TdsGdsGksTesTksTesTk
1198860 N/A N/A 115910 115925 AACTCTTATATGGTTT AksAksmCdsTdsmCdsTdsTdsAdsTds  82 2860
AdsTdsGksGesTksTesTk
1198861 N/A N/A 115911 115926 CAACTCTTATATGGTT mCksAksAdsmCdsTdsmCdsTdsTds 100 2861
AdsTdsAdsTksGesGksTesTk
1198862 N/A N/A 115913 115928 GACAACTCTTATATGG GksAksmCdsAdsAdsmCdsTdsmCds  72 2862
TdsTdsAdsTksAesTksGesGk
1198872 N/A N/A 117755 117770 TGTATGTCAGAAGAGT TksGksTdsAdsTdsGdsTdsmCdsAds   8 2863
GdsAdsAksGesAksGesTk
1198873 N/A N/A 117757 117772 AGTGTATGTCAGAAGA AksGdsTdsGdsTdsAdsTdsGdsTdsm   4 2864
CdsAdsGksAesAksGesAk
1198874 N/A N/A 117758 117773 AAGTGTATGTCAGAAG AksAksGdsTdsGdsTdsAdsTdsGdsTds   2 2865
mCdsAksGesAksAesGk
1198875 N/A N/A 117759 117774 AAAGTGTATGTCAGAA AksAksAdsGdsTdsGdsTdsAdsTdsGds   5 2866
TdsmCksAesGksAesAk
1198876 N/A N/A 117760 117775 TAAAGTGTATGTCAGA TksAksAdsAdsGdsTdsGdsTdsAdsTds  31 2867
GdsTksmCesAksGesAk
1198877 N/A N/A 117761 117776 TTAAAGTGTATGTCAG TksTksAdsAdsAdsGdsTdsGdsTdsAds  11 2868
TdsGksTesmCksAesGk
1198878 N/A N/A 117762 117777 TTTAAAGTGTATGTCA TksTksTdsAdsAdsAdsGdsTdsGdsTds  42 2869
AdsTksGesTksmCesAk
1198879 N/A N/A 117763 117778 CTTTAAAGTGTATGTC mCksTksTdsTdsAdsAdsAdsGdsTds  29 1634
GdsTdsAksTesGksTesmCk
1198880 N/A N/A 117765 117780 AACTTTAAAGTGTATG AksAksmCdsTdsTdsTdsAdsAdsAds  98 2870
GdsTdsGksTesAksTesGk

TABLE 48
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
SEQ SEQ SEQ SEQ
ID ID ID ID
NO: 1 NO: 1 NO: 2 NO: 2 YAP1 SEQ
Compound Start Stop Start Stop Sequence (% ID
Number Site Site Site Site (5′ to 3′) CHEMSITRY NOTATION UTC) NO
 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA AksTksTksAdsmCdsTdsTdsmCdsAds  34   52
TdsAdsGdsmCdsTksTksAk
 716524 4443 4458 125468 125483 ACTGAGGTATAACTGG AksmCksTksGdsAdsGdsGdsTdsAds  59  392
TdsAdsAdsmCdsTksGksGk
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTksAdsGdsAdsGdsTdsAdsTds  15  810
GdsTdsGdsGksmCksAk
 958590 4439 4454 125464 125479 AGGTATAACTGGGCAA AksGksGksTdsAdsTdsAdsAdsmCds  18  905
TdsGdsGdsGdsmCksAksAk
1009395 4442 4457 125467 125482 CTGAGGTATAACTGGG mCksTksGksAdsGdsGdsTdsAdsTds  43 2801
AdsAdsmCdsTdsGksGksGk
1009396 4444 4459 106028 106043 CACTGAGGTATAACTG mCksAksmCksTdsGdsAdsGdsGdsTds  41 2802
125469 125484 AdsTdsAdsAdsmCksTksGk
1009397 4446 4461 106030 106045 AACACTGAGGTATAAC AksAksmCksAdsmCdsTdsGdsAdsGds  44 2816
125471 125486 GdsTdsAdsTdsAksAksmCk
1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAksAdsTdsTdsGdsTdsmCds  20 2800
TdsmCdsAdsTdsGksmCksmCk
1074726 4438 4453 125463 125478 GGTATAACTGGGCAAA GksGksTksAdsTdsAdsAdsmCdsTds  23 1427
GdsGdsGdsmCdsAksAksAk
1074727 4440 4455 125465 125480 GAGGTATAACTGGGCA GksAksGksGdsTdsAdsTdsAdsAdsm  51 1503
CdsTdsGdsGdsGksmCksAk
1074728 4441 4456 125466 125481 TGAGGTATAACTGGGC TksGksAksGdsGdsTdsAdsTdsAdsAds  14 1580
mCdsTdsGdsGksGksmCk
1076439 N/A N/A 115906 115921 CTTATATGGTTTTGTG mCksTksTksAdsTdsAdsTdsGdsGds  31 2788
TdsTdsTdsTdsGksTksGk
1076456 N/A N/A 117763 117778 CTTTAAAGTGTATGTC mCksTksTksTdsAdsAdsAdsGdsTds  44 1634
GdsTdsAdsTdsGksTksmCk
1097224 N/A N/A 115908 115923 CTCTTATATGGTTTTG mCksTksmCksTdsTdsAdsTdsAdsTds  22 2842
GdsGdsTdsTdsTksTksGk
1097247 N/A N/A 117760 117775 TAAAGTGTATGTCAGA TksAksAksAdsGdsTdsGdsTdsAdsTds   9 2867
GdsTdsmCdsAksGksAk
1197199 N/A N/A 115903 115918 ATATGGTTTTGTGTGT AksTksAksTdsGdsGdsTdsTdsTdsTds  75 2839
GdsTdsGdsTksGksTk
1197200 N/A N/A 115905 115920 TTATATGGTTTTGTGT TksTksAksTdsAdsTdsGdsGdsTdsTds  49 2840
TdsTdsGdsTksGksTk
1197201 N/A N/A 115907 115922 TCTTATATGGTTTTGT TksmCTksTdsAdsTdsAdsTdsGdsGds  46 2841
TdsTdsTdsTksGksTk
1197202 N/A N/A 115909 115924 ACTCTTATATGGTTTT AksmCksTksmCdsTdsTdsAdsTdsAds  27 2859
TdsGdsGdsTdsTksTksTk
1197203 N/A N/A 115910 115925 AACTCTTATATGGTTT AksAksmCksTdsmCdsTdsTdsAdsTds  68 2860
AdsTdsGdsGdsTksTksTk
1197204 N/A N/A 115911 115926 CAACTCTTATATGGTT mCksAksAksmCdsTdsmCdsTdsTds  89 2861
AdsTdsAdsTdsGdsGksTksTk
1197205 N/A N/A 115913 115928 GACAACTCTTATATGG GksAksmCksAdsAdsmCdsTdsmCds  67 2862
TdsTdsAdsTdsAdsTksGksGk
1197213 N/A N/A 117755 117770 TGTATGTCAGAAGAGT TksGksTksAdsTdsGdsTdsmCdsAds   5 2863
GdsAdsAdsGdsAksGksTk
1197214 N/A N/A 117757 117772 AGTGTATGTCAGAAGA AksGksTksGdsTdsAdsTdsGdsTdsm   5 2864
CdsAdsGdsAdsAksGksAk
1197215 N/A N/A 117758 117773 AAGTGTATGTCAGAAG AksAksGksTdsGdsTdsAdsTdsGdsTds  13 2865
mCdsAdsGdsAksAksGk
1197216 N/A N/A 117759 117774 AAAGTGTATGTCAGAA AksAksAksGdsTdsGdsTdsAdsTdsGds  12 2866
TdsmCdsAdsGksAksAk
1197217 N/A N/A 117761 117776 TTAAAGTGTATGTCAG TksTksAksAdsAdsTdsTdsGdsTdsAds   8 2868
TdsGdsTdsmCksAksGk
1197218 N/A N/A 117762 117777 TTTAAAGTGTATGTCA TksTksTksAdsAdsAdsGdsTdsGdsTds  29 2869
AdsTdsGdsTksmCksAk
1197219 N/A N/A 117765 117780 AACTTTAAAGTGTATG AksAksmCksTdsTdsTdsAdsAdsAds  71 2870
GdsTdsGdsTdsAksTksGk
1198284 2524 2539 123549 123564 TGTCTCATGCCTTATA TksGksTksmCdsTdsmCdsAdsTdsGdsm  27 2803
CdsmCdsTdsTksAesTksAe
1198285 2526 2541 123551 123566 ATTGTCTCATGCCTTA AksTksTksGdsTdsmCdsTdsmCdsAds  13 2804
TdsGdsmCdsmCksTesTksAe
1198286 2527 2542 123552 123567 AATTGTCTCATGCCTT AksAksTksTdsGdsTdsmCdsTdsmCds  17 2805
AdsTdsGdsmCksmCesTksTe
1198287 2528 2543 123553 123568 AAATTGTCTCATGCCT AksAksAksTdsTdsGdsTdsmCdsTdsm  13  443
CdsAdsTdsGksmCesmCksTe
1198288 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAksAdsTdsTdsGdsTdsmCds  10 2800
TdsmCdsAdsTksGesmCksmCe
1198289 2530 2545 123555 123570 GGAAATTGTCTCATGC GksGksAksAdsAdsTdsTdsGdsTdsm  12 2806
CdsTdsmCdsAksTesGksmCe
1198290 2531 2546 123556 123571 TGGAAATTGTCTCATG TksGksGksAdsAdsAdsTdsTdsGdsTds  15 2807
mCdsTdsmCksAesTksGe
1198291 2532 2547 123557 123572 ATGGAAATTGTCTCAT AksTksGksGdsAdsAdsAdsTdsTdsGds  58 2808
TdsmCdsTksmCesAksTe
1198292 2534 2549 123559 123574 ATATGGAAATTGTCTC AksTksAksTdsGdsGdsAdsAdsAdsTds  58  656
TdsGdsTksmCesTksmCe
1198293 2560 2575 123585 123600 AGTATGTGGCAATAAT AksGksTksAdsTdsGdsTdsGdsGdsm  25 2809
CdsAdsAdsTksAesAksTe
1198294 2562 2577 123587 123602 AGAGTATGTGGCAATA AksGksAksGdsTdsAdsTdsGdsTdsGds  13 2810
GdsmCdsAksAesTksAe
1198295 2563 2578 123588 123603 TAGAGTATGTGGCAAT TksAksGksAdsGdsTdsAdsTdsGdsTds  15 2811
GdsGdsmCksAesAksTe
1198296 2564 2579 123589 123604 TTAGAGTATGTGGCAA TksTksAksGdsAdsGdsAdsTdsGds  29  963
TdsGdsGksmCesAksAe
1198297 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTksAdsGdsAdsGdsTdsAdsTds   8  810
GdsTdsGksGesmCksAe
1198298 2566 2581 123591 123606 TATTAGAGTATGTGGC TksAksTksTdsAdsGdsAdsGdsTdsAds  23 2812
TdsGdsTksGesGksmCe
1198299 2567 2582 123592 123607 ATATTAGAGTATGTGG AksTksAksTdsTdsAdsGdsAdsGdsTds  27 2813
AdsTdsGksTesGksGe
1198300 2568 2583 123593 123608 TATATTAGAGTATGTG TksAksTksAdsTdsTdsAdsGdsAdsGds  60 2814
TdsAdsTksGesTksGe
1198301 2570 2585 123595 123610 TCTATATTAGAGTATG TksmCksTksAdsTdsAdsTdsTdsAds  43  887
GdsAdsGdsTksAesTksGe
1198307 4595 4610 125620 125635 TTACATTAGGAACAAG TksTksAksmCdsAdsTdsTdsAdsGds  49 2817
GdsAdsAdsmCksAesAksGe
1198308 4597 4612 125622 125637 TTTTACATTAGGAACA TksTksTksTdsAdsmCdsAdsTdsTds  68 2818
AdsGdsGdsAksAesmCksAe
1198309 4598 4613 125623 125638 CTTTTACATTAGGAAC mCksTksTksTdsTdsAdsmCdsAdsTds  85 1124
TdsAdsGdsGksAesAksmCe
1198310 4599 4614 125624 125639 ACTTTTACATTAGGAA AksmCksTksTdsTdsTdsAdsmCdsAds  28 2819
TdsTdsAdsGksGesAksAe
1198311 4600 4615 125625 125640 CACTTTTACATTAGGA mCksAksmCksTdsTdsTdsTdsAdsmCds  39 1200
AdsTdsTdsAksGesGksAe
1198312 4601 4616 125626 125641 GCACTTTTACATTAGG GksmCksAksmCdsTdsTdsTdsTdsAdsm   7 1276
CdsAdsTdsTksAesGksGe
1198313 4602 4617 125627 125642 AGCACTTTTACATTAG AksGksmCksAdsmCdsTdsTdsTdsTds  31 2820
AdsmCdsAdsTksTesAksGe
1198314 4603 4618 125628 125643 AAGCACTTTTACATTA AksAksGksmCdsAdsmCdsTdsTdsTds  82 2821
TdsAdsmCdsAksTesTksAe
1198315 4605 4620 125630 125645 TTAAGCACTTTTACAT TksTksAksAdsGdsmCdsAdsmCdsTds  85 2822
TdsTdsTdsAksmCesAksTe
1198316 4795 4810 125820 125835 GGAAGATCTGAAACTC GksGksAksAdsGdsAdsTdsmCdsTds  49 2823
GdsAdsAdsAksmCesTksmCe
1198317 4797 4812 125822 125837 TTGGAAGATCTGAAAC TksTksGksGdsAdsAdsGdsAdsTdsm  74 2824
CdsTdsGdsAksAesAksmCe
1198318 4798 4813 125823 125838 TTTGGAAGATCTGAAA TksTksTksGdsGdsAdsAdsGdsAdsTds 120 2825
mCdsTdsGksAesAksAe
1198319 4799 4814 125824 125839 CTTTGGAAGATCTGAA mCksTksTksTdsGdsGdsAdsAdsGds  47 2826
AdsTdsmCdsTksGesAksAe
1198320 4800 4815 125825 125840 GCTTTGGAAGATCTGA GksmCksTksTdsTdsGdsGdsAdsAds  26 2044
GdsAdsTdsmCksTesGksAe
1198321 4801 4816 125826 125841 TGCTTTGGAAGATCTG TksGksmCksTdsTdsTdsGdsGdsAds  45 2121
AdsGdsAdsTksmCesTksGe
1198322 4802 4817 125827 125842 GTGCTTTGGAAGATCT GksTksGksmCdsTdsTdsTdsGdsGds  48 2827
AdsAdsGdsAksTesmCksTe
1198323 4803 4818 125828 125843 AGTGCTTTGGAAGATC AksGksTksGdsmCdsTdsTdsTdsGds  32 2828
GdsAdsAdsGksAesTksmCe
1198324 4805 4820 125830 125845 ATAGTGCTTTGGAAGA AksTksAksGdsTdsGdsmCdsTdsTds  53 2829
TdsGdsGdsAksAesGksAe
1198325 N/A N/A  94729  94744 AGGATGCATGGTTTTT AksGksGksAdsTdsGdsmCdsAdsTds  34 2830
GdsGdsTdsTksTesTksTe
1198326 N/A N/A  94731  94746 TTAGGATGCATGGTTT TksTksAksGdsGdsAdsTdsGdsmCds  84 2831
AdsTdsGdsGksTesTksTe
1198327 N/A N/A  94732  94747 TTTAGGATGCATGGTT TksTksTksAdsGdsGdsAdsTdsGdsm  29 2832
CdsAdsTdsGksGesTksTe
1198328 N/A N/A  94733  94748 ATTTAGGATGCATGGT AksTksTksTdsAdsGdsGdsAdsTdsGds  42 2833
mCdsAdsTksGesGksTe
1198329 N/A N/A  94734  94749 GATTTAGGATGCATGG GksAksTksTdsTdsAdsGdsGdsAdsTds  36 2834
GdsmCdsAksTesGksGe
1198330 N/A N/A  94735  94750 AGATTTAGGATGCATG AksGksAksTdsTdsTdsAdsGdsGdsAds  27 2934
TdsGdsmCksAesTksGe
1198331 N/A N/A  94736  94751 CAGATTTAGGATGCAT mCksAksGksAdsTdsTdsTdsAdsGds  26 2836
GdsAdsTdsGksmCesAksTe
1198332 N/A N/A  94737  94752 TCAGATTTAGGATGCA TksmCksAksGdsAdsTdsTdsTdsAds  58 2837
GdsGdsAdsTksGesmCksAe
1198333 N/A N/A  94739  94754 ATTCAGATTTAGGATG AksTksTksmCdsAdsGdsAdsTdsTds  77 2838
TdsAdsGdsGksAesTksGe
1198343 N/A N/A 117325 117340 ATTGCAATCTGTCTGA AksTksTksGdsmCdsAdsAdsTdsmCds  39 2843
TdsGdsTdsmCksTesGksAe
1198344 N/A N/A 117327 117342 ATATTGCAATCTGTCT AksTksAksTdsTdsGdsmCdsAdsAds  55 2844
TdsmCdsTdsGksTesmCksTe
1198345 N/A N/A 117328 117343 AATATTGCAATCTGTC AksAksTksAdsTdsTdsGdsmCdsAds  75 2845
AdsTdsmCdsTksGesTksmCe
1198346 N/A N/A 117329 117344 TAATATTGCAATCTGT TksAksAksTdsAdsTdsTdsGdsmCds  40 2846
AdsAdsTdsmCksTesGksTe
1198347 N/A N/A 117330 117345 GTAATATTGCAATCTG GksTksAksAdsTdsAdsTdsTdsGdsm  14 1404
CdsAdsAdsTksmCesTksGe
1198348 N/A N/A 117331 117346 TGTAATATTGCAATCT TksGksTksAdsAdsTdsAdsTdsTdsGds  40 2847
mCdsAdsAksTesmCksTe

TABLE 49
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
SEQ SEQ SEQ SEQ
ID ID ID ID
NO: 1 NO: 1 NO: 2 NO: 2 YAP1 SEQ
Compound Start Stop Start Stop Sequence (% ID
Number Site Site Site Site (5′ to 3′) CHEMSITRY NOTATION UTC) NO
 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA AksTksksAdsmCdsTdsTdsmCdsAds  30   52
TdsAdsGdsmCdsTksTksAk
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTksAdsGdsAdsGdsTdsAdsTds  13  810
GdsTdsGdsGksmCksAk
1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAksAdsTdsTdsGdsTdsmCds  10 2800
TdsmCdsAdsTdsGksmCksmCk
1095547 4443 4458 125468 125483 ACTGAGGTATAACTGG AksmCksTksGdsAdsGdsGdsTdsAds  42  392
TdsAdsAdsmCksTesGksGe
1095565 4441 4456 125466 125481 TGAGGTATAACTGGGC TksGksAksGdsGdsTdsAdsTdsAdsAds  25 1580
mCdsTdsGksGesGksmCe
1095566 4442 4457 125467 125482 CTGAGGTATAACTGGG mCksTksGksAdsGdsGdsTdsAdsTds  47 2801
AdsAdsmCdsTksGesGksGe
1095567 4444 4459 125469 125484 CACTGAGGTATAACTG mCksAksmCksTdsGdsAdsGdsGdsTds  92 2802
AdsTdsAdsAksmCesTksGe
1198302 4436 4451 125461 125476 TATAACTGGGCAAATT TksAksTksAdsAdsmCdsTdsGdsGds  67 2815
GdsmCdsAdsAksAesTksTe
1198303 4438 4453 125463 125478 GGTATAACTGGGCAAA GksGksTksAdsTdsAdsAdsmCdsTds  27 1427
GdsGdsGdsmCksAesAksAe
1198304 4439 4454 125464 125479 AGGTATAACTGGGCAA AksGksGksTdsAdsTdsAdsAdsmCds  33  905
TdsGdsGdsGksmCesAksAe
1198305 4440 4455 125465 125480 GAGGTATAACTGGGCA GksAksGksGdsTdsAdsTdsAdsAdsm  78 1503
CdsTdsGdsGksGesmCksAe
1198306 4446 4461 125471 125486 AACACTGAGGTATAAC AksAksmCksAdsmCdsTdsGdsAdsGds  64 2816
GdsTdsAdsTksAesAksmCe
1198334 N/A N/A 115903 115918 ATATGGTTTTGTGTGT AksTksAksTdsGdsGdsTdsTdsTdsTds  57 2839
GdsTdsGksTesGksTe
1198335 N/A N/A 115905 115920 TTATATGGTTTTGTGT TksTksAksTdsAdsTdsGdsGdsTdsTds  26 2840
TdsTdsGksTesGksTe
1198336 N/A N/A 115906 115921 CTTATATGGTTTTGTG mCksTksTksAdsTdsAdsTdsGdsGds  31 2788
TdsTdsTdsTksGesTksGe
1198337 N/A N/A 115907 115922 TCTTATATGGTTTTG TksmCksTksTdsAdsTdsAdsTdsGds  26 2841
GdsTdsTdsTksTesGksTe
1198338 N/A N/A 115908 115923 CTCTTATATGGTTTTG mCksTksmCksTdsTdsAdsTdsAdsTds  24 2842
GdsGdsTdsTksTesTksGe
1198339 N/A N/A 115909 115924 ACTCTTATATGGTTTT AksmCksTksmCdsTdsTdsAdsTdsAds  25 2859
TdsGdsGdsTksTesTksTe
1198340 N/A N/A 115910 115925 AACTCTTATATGGTTT AksAksmCksTdsmCdsTdsTdsAdsTds 123 2860
AdsTdsGdsGksTesTksTe
1198341 N/A N/A 115911 115926 CAACTCTTATATGGTT mCksAksAksmCdsTdsmCdsTdsTds  90 2861
AdsTdsAdsTdsGksGesTksTe
1198342 N/A N/A 115913 115928 GACAACTCTTATATGG GksAksmCksAdsAdsmCdsTdsmCds 101 2862
TdsTdsAdsTdsAksTesGksGe
1198349 N/A N/A 117332 117347 ATGTAATATTGCAATC AksTksGksTdsAdsAdsdsAdsTdsTds  85 2848
GdsmCdsAksAesTksmCe
1198350 N/A N/A 117333 117348 TATGTAATATTGCAAT TksAksTksGdsTdsAdsAdsTdsAdsTds  83 2849
TdsGdsmCksAesAksTe
1198351 N/A N/A 117335 117350 TTTATGTAATATTGCA TksTksTksAdsTdsGdsTdsAdsAdsTds  40 2850
AdsTdsTksGesmCksAe
1198352 N/A N/A 117755 117770 TGTATGTCAGAAGAGT TksGksTksAdsTdsGdsTdsmCdsAds   7 2863
GdsAdsAdsGksAesGksTe
1198353 N/A N/A 117757 117772 AGTGTATGTCAGAAGA AksGksTksGdsTdsAdsTdsGdsTdsm   8 2864
CdsAdsGdsAksAesGksAe
1198354 N/A N/A 117758 117773 AAGTGTATGTCAGAAG AksAksGksTdsGdsTdsAdsTdsGdsTds   6 2865
mCdsAdsGksAesAksGe
1198355 N/A N/A 117759 117774 AAAGTGTATGTCAGAA AksAksAksGdsTdsGdsTdsAdsTdsGds   6 2866
TdsmCdsAksGesAksAe
1198356 N/A N/A 117760 117775 TAAAGTGTATGTCAGA TksAksAksAdsGdsTdsGdsTdsAdsTds   5 2867
GdsTdsmCksAesGksAe
1198357 N/A N/A 117761 117776 TTAAAGTGTATGTCAG TksTksAksAdsAdsGdsTdsGdsTdsAds  21 2868
TdsGdsTksmCesAksGe
1198358 N/A N/A 117762 117777 TTTAAAGTGTATGTCA TksTksTksAdsAdsAdsGdsTdsGdsTds  15 2869
AdsTdsGksTesmCksAe
1198359 N/A N/A 117763 117778 CTTTAAAGTGTATGTC mCksTksTksTdsAdsAdsAdsGdsTds  28 1634
GdsTdsAdsTksGesTksmCe
1198360 N/A N/A 117765 117780 AACTTTAAAGTGTATG AksAksmCksTdsTdsTdsAdsAdsAds  74 2870
GdsTdsGdsTksAesTksGe
1198361 N/A N/A 119667 119682 TAAGGTTTCCCAGATT TksAksAksGdsGdsTdsTdsTdsmCdsm  39 2851
CdsmCdsAdsGksAesTksTe
1198362 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA AksGksTksAdsAdsGdsGdsTdsTdsTds  24 2852
mCdsmCdsmCksAesGksAe
1198363 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG AksAksGksTdsAdsAdsGdsGdsTdsTds  55 2853
TdsmCdsmCksmCesAksGe
1198364 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA TksAksAksGdsTdsAdsAdsGdsGdsTds  29 2854
TdsTdsmCksmCesmCksAe
1198365 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC mCksTksAksAdsGdsTdsAdsAdsGds  13 1101
GdsTdsTdsTksmCesmCksmCe
1198366 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC AksmCksTksAdsAdsGdsTdsAdsAds  45 2855
GdsGdsTdsTksTesmCksmCe
1198367 N/A N/A 119674 119689 GACTAAGTAAGGTTTC GksAksmCksTdsAdsAdsGdsTdsAds  58 2856
AdsGdsGdsTksTesTksmCe
1198368 N/A N/A 119675 119690 AGACTAAGTAAGGTTT AksGksAksmCdsTdsAdsAdsGdsTds  79 2857
AdsAdsGdsGksTesTksTe
1198369 N/A N/A 119677 119692 TTAGACTAAGTAAGGT TksTksAksGdsAdsmCdsTdsAdsAds  51 2858
GdsTdsAdsAksGesGksTe
1198542 2524 2539 123549 123564 TGTCTCATGCCTTATA TksGksTksmCdsTdsmCdsAdsTdsGdsm  23 2803
CdsmCdsTdsTksAksTksAe
1198543 2526 2541 123551 123566 ATTGTCTCATGCCTTA AksTksTksGdsTdsmCdsTdsmCdsAds  15 2804
TdsGdsmCdsmCksTksTksAe
1198544 2527 2542 123552 123567 AATTGTCTCATGCCTT AksAksTksTdsGdsTdsmCdsTdsmCds  21 2805
AdsTdsGdsmCksmCksTksTe
1198545 2528 2543 123553 123568 AAATTGTCTCATGCCT AksAksAksTdsTdsGdsTdsmCdsTdsm  32  443
CdsAdsTdsGksmCksmCksTe
1198546 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAksAdsTdsTdsGdsTdsmCds  11 2800
TdsmCdsAdsTksGksmCksmCe
1198547 2530 2545 123555 123570 GGAAATTGTCTCATGC GksGksAksAdsAdsTdsTdsGdsTdsm  27 2806
CdsTdsmCdsAksTksGksmCe
1198548 2531 2546 123556 123571 TGGAAATTGTCTCATG TksGksGksAdsAdsAdsTdsTdsGdsTds  26 2807
mCdsTdsmCksAksTksGe
1198549 2532 2547 123557 123572 ATGGAAATTGTCTCAT AksTksGksGdsAdsAdsAdsTdsTdsGds  84 2808
TdsmCdsTksmCksAksTe
1198550 2534 2549 123559 123574 ATATGGAAATTGTCTC AksTksAksTdsGdsGdsAdsAdsAdsTds  17  656
TdsGdsTksmCksTksmCe
1198551 2560 2575 123585 123600 AGTATGTGGCAATAAT AksGksTksAdsTdsGdsTdsGdsGdsm  34 2809
CdsAdsAdsTksAksAksTe
1198552 2562 2577 123587 123602 AGAGTATGTGGCAATA AksGksAksGdsTdsAdsTdsGdsTdsGds  17 2810
GdsmCdsAksAksTksAe
1198553 2563 2578 123588 123603 TAGAGTATGTGGCAAT TksAksGksAdsGdsTdsAdsTdsGdsTds  13 2811
GdsGdsmCksAksAksTe
1198554 2564 2579 123589 123604 TTAGAGTATGTGGCAA TksTksAksGdsAdsGdsTdsAdsTdsGds  16  963
TdsGdsGksmCksAksAe
1198555 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTksAdsGdsAdsGdsTdsAdsTds  11  810
GdsTdsGksGksmCksAe
1198556 2566 2581 123591 123606 TATTAGAGTATGTGGC TksAksTksTdsAdsGdsAdsGdsTdsAds  25 2812
TdsGdsTksGksGksmCe
1198557 2567 2582 123592 123607 ATATTAGAGTATGTGG AksiTksAksTdsTdsAdsGdsAdsGdsTds  16 2813
AdsTdsGksTksGksGe
1198558 2568 2583 123593 123608 TATATTAGAGTATGTG TksAksTksAdsTdsTdsAdsGdsAdsGds  46 2814
TdsAdsTksGksTksGe
1198559 2570 2585 123595 123610 TCTATATTAGAGTATG TksmCksTksAdsTdsAdsTdsTdsAds  55 887
GdsAdsGdsTksAksTksGe
1198565 4595 4610 125620 125635 TTACATTAGGAACAAG TksTksAksmCdsAdsTdsTdsAdsGds  53 2817
GdsAdsAdsmCksAksAksGe
1198566 4597 4612 125622 125637 TTTTACATTAGGAACA TksTksTksTdsAdsmCdsAdsTdsTds  83 2818
AdsGdsGdsAksAksmCksAe
1198567 4598 4613 125623 125638 CTTTTACATTAGGAAC mCksTksTksTdsTdsAdsmCdsAdsTds  54 1124
TdsAdsGdsGksAksAksmCe
1198568 4599 4614 125624 125639 ACTTTTACATTAGGAA AksmCksTksTdsTdsTdsAdsmCdsAds  31 2819
TdsTdsAdsGksGksAksAe
1198569 4600 4615 125625 125640 CACTTTTACATTAGGA mCksAksmCksTdsTdsTdsTdsAdsmCds  14 1200
AdsTdsTdsAksGksGksAe
1198570 4601 4616 125626 125641 GCACTTTTACATTAGG GksmCksAksmCdsTdsTdsTdsTdsAdsm  15 1276
CdsAdsTdsTksAksGksGe
1198571 4602 4617 125627 125642 AGCACTTTTACATTAG AksGksmCksAdsmCdsTdsTdsTdsTds  32 2820
AdsmCdsAdsTksTksAksGe
1198572 4603 4618 125628 125643 AAGCACTTTTACATTA AksAksGksmCdsAdsmCdsTdsTdsTds  53 2821
TdsAdsmCdsAksTksTksAe
1198573 4605 4620 125630 125645 TTAAGCACTTTTACAT TksTksAksAdsGdsmCdsAdsmCdsTds  76 2822
TdsTdsTdsAksmCksAksTe
1198574 4795 4810 125820 125835 GGAAGATCTGAAACTC GksGksAksAdsGdsAdsTdsmCdsTds  37 2823
GdsAdsAdsAksmCksTksmCe
1198575 4797 4812 125822 125837 TTGGAAGATCTGAAAC TksTksGksGdsAdsAdsGdsAdsTdsm  94 2824
CdsTdsGdsAksAksAksmCe
1198576 4798 4813 125823 125838 TTTGGAAGATCTGAAA TksTksTksGdsGdsAdsAdsGdsAdsTds  92 2825
mCdsTdsGksAksAksAe
1198577 4799 4814 125824 125839 CTTTGGAAGATCTGAA mCksTksTksTdsGdsGdsAdsAdsGds  40 2826
AdsTdsmCdsTksGksAksAe
1198578 4800 4815 125825 125840 GCTTTGGAAGATCTGA GksmCksTksTdsTdsGdsGdsAdsAds  18 2044
GdsAdsTdsmCksTksGksAe
1198579 4801 4816 125826 125841 TGCTTTGGAAGATCTG TksGksmCksTdsTdsTdsGdsGdsAds  34 2121
AdsGdsAdsTksmCksTksGe
1198580 4802 4817 125827 125842 GTGCTTTGGAAGATCT GksTksGksmCdsTdsTdsTdsGdsGds  43 2827
AdsAdsGdsAksTksmCksTe
1198581 4803 4818 125828 125843 AGTGCTTTGGAAGATC AksGksTksGdsmCdsTdsTdsTdsGds  42 2828
GdsAdsAdsGksAksTksmCe
1198582 4805 4820 125830 125845 ATAGTGCTTTGGAAGA AksTksAksGdsTdsGdsmCdsTdsTds  63 2829
TdsGdsGdsAksAksGksAe
1198583 N/A N/A  94729  94744 AGGATGCATGGTTTTT AksGksGksAdsTdsGdsmCdsAdsTds  27 2830
GdsGdsTdsTksTksTksTe
1198584 N/A N/A  94731  94746 TTAGGATGCATGGTTT TksTksAksGdsGdsAdsTdsGdsmCds  37 2831
AdsTdsGdsGksTksTksTe

TABLE 50
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
SEQ SEQ SEQ SEQ
ID ID ID ID
NO: 1 NO: 1 NO: 2 NO: 2 YAP1 SEQ
Compound Start Stop Start Stop Sequence (% ID
Number Site Site Site Site (5′ to 3′) CHEMSITRY NOTATION UTC) NO
 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA AksTksTksAdsmCdsTdsTdsmCdsAds  31   52
TdsAdsGdsmCdsTksTksAk
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTksAdsGdsAdsGdsTdsAdsTds  12  810
GdsTdsGdsGksmCksAk
1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAksAdsTdsTdsGdsTdsmCds  16 2800
TdsmCdsAdsTdsGksmCksmCk
1095435 4443 4458 125468 125483 ACTGAGGTATAACTGG AksmCksTksGdsAdsGdsGdsTdsAds  39  392
TdsAdsAdsmCksTksGksGe
1095453 4441 4456 125466 125481 TGAGGTATAACTGGGC TksGksAksGdsGdsTdsAdsTdsAdsAds  32 1580
mCdsTdsGksGksGksmCe
1095454 4442 4457 125467 125482 CTGAGGTATAACTGGG mCksTksGksAdsGdsGdsTdsAdsTds  47 2801
AdsAdsmCdsTksGksGksGe
1197228 2527 2542 123552 123567 AATTGTCTCATGCCTT AksAksTksTdsGysTdsmCdsTdsmCds  25 2805
AdsTdsGdsmCdsmCksTksTk
1197229 2530 2545 123555 123570 GGAAATTGTCTCATGC GksGksAksAdsAysTdsTdsGdsTdsm  21 2806
CdsTdsmCdsAdsTksGksmCk
1197230 2531 2546 123556 123571 TGGAAATTGTCTCATG TksGksGksAdsAysAdsTdsTdsGdsTds  29 2807
mCdsTdsmCdsAksTksGk
1197231 2532 2547 123557 123572 ATGGAAATTGTCTCAT AksTksGksGdsAysAdsAdsTdsTdsGds  50 2808
TdsmCdsTdsmCksAksTk
1197232 2534 2549 123559 123574 ATATGGAAATTGTCTC AksTksAksTdsGysGdsAdsAdsAdsTds  55  656
TdsGdsTdsmCksTksmCk
1197233 2563 2578 123588 123603 TAGAGTATGTGGCAAT TksAksGksAdsGysTdsAdsTdsGdsTds  36 2811
GdsGdsmCdsAksAksTk
1197234 2564 2579 123589 123604 TTAGAGTATGTGGCAA TksTksAksGdsAysGdsTdsAdsTdsGds  24  963
TdsGdsGdsmCksAksAk
1197235 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTksAdsGysAdsGdsTdsAdsTds  16  810
GdsTdsGdsGksmCksAk
1197236 2566 2581 123591 123606 TATTAGAGTATGTGGC TksAksTksTdsAysGdsAdsGdsTdsAds  17 2812
TdsGdsTdsGksGksmCk
1197244 4595 4610 125620 125635 TTACATTAGGAACAAG TksTksAksmCdsAysTdsTdsAdsGds  60 2817
GdsAdsAdsmCdsAksAksGk
1197245 4597 4612 125622 125637 TTTTACATTAGGAACA TksTksTksTdsAysmCdsAdsTdsTds  88 2818
AdsGdsGdsAdsAksmCksAk
1197246 4602 4617 125627 125642 AGCACTTTTACATTAG AksGksmCksAdsCysTdsTdsTdsTds  33 2820
AdsmCdsAdsTdsTksAksGk
1197247 4603 4618 125628 125643 AAGCACTTTTACATTA AksAksGksmCdsAysmCdsTdsTdsTds  47 2821
TdsAdsmCdsAdsTksTksAk
1197280 2524 2539 123549 123564 TGTCUCATGCCTTATA TksGksTksmCdsUysmCdsAdsTdsGds  53 2871
mCdsmCdsTdsTdsAksTksAk
1197281 2526 2541 123551 123566 ATTGUCTCATGCCTTA AksTksTksGdsUysmCdsTdsmCdsAds  42 2872
TdsGdsmCdsmCdsTksTksAk
1197282 2528 2543 123553 123568 AAATUGTCTCATGCCT AksAksAksTdsUysGdsTdsmCdsTdsm  40 2873
CdsAdsTdsGdsmCksmCksTk
1197283 2529 2544 123554 123569 GAAAUTGTCTCATGCC GksAksAksAdsUysTdsGdsTdsmCds  29 2874
TdsmCdsAdsTdsGksmCksmCk
1197284 2560 2575 123585 123600 AGTAUGTGGCAATAAT AksGksTksAdsUysGdsTdsGdsGdsm  35 2875
CdsAdsAdsTdsAksAksTk
1197285 2562 2577 123587 123602 AGAGUATGTGGCAATA AksGksAksGdsUysAdsTdsGdsTds  28 2876
GdsGdsmCdsAdsAksTksAk
1197286 2567 2582 123592 123607 ATATUAGAGTATGTGG AksTksAksTdsUysAdsGdsAdsGdsTds  43 2877
AdsTdsGdsTksGksGk
1197287 2568 2583 123593 123608 TATAUTAGAGTATGTG TksAksTksAdsUysTdsAdsGdsAdsGds 108 2878
TdsAdsTdsGksTksGk
1197288 2570 2585 123595 123610 TCTAUATTAGAGTATG TksmCksTksAdsUysAdsTdsTdsAds  94 2879
GdsAdsGdsTdsAksTksGk
1197291 4598 4613 125623 125638 CTTTUACATTAGGAAC mCksTksTksTdsUysAdsmCdsAdsTds  83 2880
TdsAdsGdsGdsAksAksmCk
1197292 4599 4614 125624 125639 ACTTUTACATTAGGAA AksmCksTksTdsUysTdsAdsmCdsAds  84 2881
TdsTdsAdsGdsGksAksAk
1197293 4600 4615 125625 125640 CACTUTTACATTAGGA mCksAksmCksTdsUysTdsTdsAdsm  94 2882
CdsAdsTdsTdsAdsGksGksAk
1197294 4601 4616 125626 125641 GCACUTTTACATTAGG GksmCksAksmCdsUysTdsTdsTdsAds  25 2883
mCdsAdsTdsTdsAksGksGk
1198560 4436 4451 125461 125476 TATAACTGGGCAAATT TksAksTksAdsAdsmCdsTdsGdsGds  53 2815
GdsmCdsAdsAksAksTksTe
1198561 4438 4453 125463 125478 GGTATAACTGGGCAAA GksGksTksAdsTdsAdsAdsmCdsTds  29 1427
GdsGdsGdsmCksAksAksAe
1198562 4439 4454 125464 125479 AGGTATAACTGGGCAA AksGksGksTdsAdsTdsAdsAdsmCds  30  905
TdsGdsGdsGksmCksAksAe
1198563 4440 4455 125465 125480 GAGGTATAACTGGGCA GksAksGksGdsTdsAdsTdsAdsAdsm  53 1503
CdsTdsGdsGksGksmCksAe
1198564 4446 4461 125471 125486 AACACTGAGGTATAAC AksAksmCksAdsmCdsTdsGdsAdsGds  44 2816
GdsTdsAdsTksAksAksmCe
1198585 N/A N/A  94732  94747 TTTAGGATGCATGGTT TksTksTksAdsGdsGdsAdsTdsGdsm  22 2832
CdsAdsTdsGksGksTksTe
1198586 N/A N/A  94733  94748 ATTTAGGATGCATGGT AksTksTksTdsAdsGdsGdsAdsTdsGds  96 2833
mCdsAdsTksGksGksTe
1198587 N/A N/A  94734  94749 GATTTAGGATGCATGG GksAksTksTdsTdsAdsGdsGdsAdsTds  41 2834
GdsmCdsAksTksGksGe
1198588 N/A N/A  94735  94750 AGATTTAGGATGCATG AksGksAksTdsTdsTdsAdsGdsGdsAds  32 2835
TdsGdsmCksAksTksGe
1198589 N/A N/A  94736  94751 CAGATTTAGGATGCAT mCksAksGksAdsTdsTdsTdsAdsGds  24 2836
GdsAdsTdsGksmCksAksTe
1198590 N/A N/A  94737  94752 TCAGATTTAGGATGCA TksmCksAksGdsAdsTdsTdsTdsAds  46 2837
GdsGdsAdsTksGksmCksAe
1198591 N/A N/A  94739  94754 ATTCAGATTTAGGATG AksTksTksmCdsAdsGdsAdsTdsTds 106 2838
TdsAdsGdsGksAksTksGe
1198592 N/A N/A 115903 115918 ATATGGTTTTGTGTGT AksTksAksTdsGdsGdsTdsTdsTdsTds  50 2839
GdsTdsGksTksGksTe
1198593 N/A N/A 115905 115920 TTATATGGTTTTGTGT TksTksAksTdsAdsTdsGdsGdsTdsTds  45 2840
TdsTdsGksTksGksTe
1198594 N/A N/A 115906 115921 CTTATATGGTTTTGTG mCksTksTksAdsTdsAdsTdsGdsGds  23 2788
TdsTdsTdsTksGksTksGe
1198595 N/A N/A 115907 115922 TCTTATATGGTTTTGT TksmCksTksTdsAdsTdsAdsTdsGds  27 2841
GdsTdsTdsTksTksGksTe
1198596 N/A N/A 115908 115923 CTCTTATATGGTTTTG mCksTksmCksTdsTdsAdsTdsAdsTds  16 2842
GdsGdsTdsTksTksTksGe
1198597 N/A N/A 115909 115924 ACTCTTATATGGTTTT AksmCksTksmCdsTdsTdsAdsTdsAds  27 2859
TdsGdsGdsTksTksTksTe
1198598 N/A N/A 115910 115925 AACTCTTATATGGTTT AksAksmCksTdsmCdsTdsTdsAdsTds  76 2860
AdsTdsGdsGksTksTksTe
1198599 N/A N/A 115911 115926 CAACTCTTATATGGTT mCksAksAksmCdsTdsmCdsTdsTds  90 2861
AdsTdsAdsTdsGksGksTksTe
1198600 N/A N/A 115913 115928 GACAACTCTTATATGG GksAksmCksAdsAdsmCdsTdsmCds  72 2862
TdsTdsAdsTdsAksTksGksGe
1198601 N/A N/A 117325 117340 ATTGCAATCTGTCTGA AksTksTksGdsmCdsAdsAdsTdsmCds  50 2843
TdsGdsTdsmCksTksGksAe
1198602 N/A N/A 117327 117342 ATATTGCAATCTGTCT AksTksAksTdsTdsGdsmCdsAdsAds  29 2844
TdsmCdsTdsGksTksmCksTe
1198603 N/A N/A 117328 117343 AATATTGCAATCTGTC AksAksTksAdsTdsTdsGdsmCdsAds  51 2845
AdsTdsmCdsTksGksTksmCe
1198604 N/A N/A 117329 117344 TAATATTGCAATCTGT TksAksAksTdsAdsTdsTdsGdsmCds  48 2846
AdsAdsTdsmCksTksGksTe
1198605 N/A N/A 117330 117345 GTAATATTGCAATCTG GksTksAksAdsTdsAdsTdsTdsGdsm   7 1404
CdsAdsAdsTksmCksTksGe
1198606 N/A N/A 117331 117346 TGTAATATTGCAATCT TksGksTksAdsAdsTdsAdsTdsTdsGds  25 2847
mCdsAdsAksTksmCksTe
1198607 N/A N/A 117332 117347 ATGTAATATTGCAATC AksTksGksTdsAdsAdsTdsAdsTdsTds  77 2848
GdsmCdsAksAksTksmCe
1198608 N/A N/A 117333 117348 TATGTAATATTGCAAT TksAksTksGdsTdsAdsAdsTdsAdsTds  83 2849
TdsGdsmCksAksAksTe
1198609 N/A N/A 117335 117350 TTTATGTAATATTGCA TksTksTksAdsTdsGdsTdsAdsAdsTds  52 2850
AdsTdsTksGksmCksAe
1198610 N/A N/A 117755 117770 TGTATGTCAGAAGAGT TksGksTksAdsTdsGdsTdsmCdsAds   4 2863
GdsAdsAdsGksAksGksTe
1198611 N/A N/A 117757 117772 AGTGTATGTCAGAAGA AksGksTksGdsTdsAdsTdsGdsTdsm   7 2864
CdsAdsGdsAksAksGksAe
1198612 N/A N/A 117758 117773 AAGTGTATGTCAGAAG AksAksGksTdsGdsTdsAdsTdsGdsTds  5 2865
mCdsAdsGksAksAksGe
1198613 N/A N/A 117759 117774 AAAGTGTATGTCAGAA AksAksAksGdsTdsGdsTdsAdsTdsGds   3 2866
TdsmCdsAksGksAksAe
1198614 N/A N/A 117760 117775 TAAAGTGTATGTCAGA TksAksAksAdsGdsTdsGdsTdsAdsTds   4 2867
GdsTdsmCksAksGksAe
1198615 N/A N/A 117761 117776 TTAAAGTGTATGTCAG TksTksAksAdsAdsGdsTdsGdsTdsAds  10 2868
TdsGdsTksmCksAksGe
1198616 N/A N/A 117762 117777 TTTAAAGTGTATGTCA TksTksTksAdsAdsAdsGdsTdsGdsTds  16 2869
AdsTdsGksTksmCksAe
1198617 N/A N/A 117763 117778 CTTTAAAGTGTATGTC mCksTksTksTdsAdsAdsAdsGdsTds  34 1634
GdsTdsAdsTksGksTksmCe
1198618 N/A N/A 117765 117780 AACTTTAAAGTGTATG AksAksmCksTdsTdsTdsAdsAdsAds  74 2870
GdsTdsGdsTksAksTksGe
1198619 N/A N/A 119667 119682 TAAGGTTTCCCAGATT TksAksAksGdsGdsTdsTdsTdsmCdsm  53 2851
CdsmCdsAdsGksAksTksTe
1198620 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA AksGksTksAdsAdsGasGdsTdsTdsTds  26 2852
mCdsmCdsmCksAksGksAe
1198621 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG AksAksGksTdsAdsAdsGdsGdsTdsTds  80 2853
TdsmCdsmCksmCksAksGe
1198622 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA TksAksAksGdsTdsAdsAdsGdsGdsTds  26 2854
TdsTdsmCksmCksmCksAe
1198623 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC mCksTksAksAdsGdsTdsAdsAdsGds   9 1101
GdsTdsTdsTksmCksmCksmCe
1198624 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC AksmCksTksAdsAdsGdsTdsAdsAds  20 2855
GdsGdsTdsTksTksmCksmCe
1198625 N/A N/A 119674 119689 GACTAAGTAAGGTTTC GksAksmCksTdsAdsAdsGdsTdsAds  64 2856
AdsGdsGdsTksTksTksmCe
1198626 N/A N/A 119675 119690 AGACTAAGTAAGGTTT AksGksAksmCdsTfsAdsAdsGdsTds  99 2857
AdsAdsGdsGksTksTksTe
1198627 N/A N/A 119677 119692 TTAGACTAAGTAAGGT TksTksAksGdsAdsmCdsTdsAdsAds  39 2858
GdsTdsAdsAksGksGksTe

TABLE 51
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
SEQ SEQ SEQ SEQ
ID ID ID ID
NO: 1 NO: 1 NO: 2 NO: 2 YAP1 SEQ
Compound Start Stop Start Stop Sequence (% ID
Number Site Site Site Site (5′ to 3′) CHEMSITRY NOTATION UTC) NO
 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA AksTksTksAdsmCdsTdsTdsmCdsAds  24   52
TdsAdsGdsmCdsTksTksAk
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTksAdsGdsAdsGdsTdsAdsTds   9  810
GdsTdsGdsGksmCksAk
1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAksAdsTdsTdsGdsTdsmCds   5 2800
TdsmCdsAdsTdsGksmCksmCk
1197237 4436 4451 125461 125476 TATAACTGGGCAAATT TksAksTksAdsAysmCdsTdsGdsGds  74 2815
GdsmCdsAdsAdsAksTksTk
1197238 4439 4454 125464 125479 AGGTATAACTGGGCAA AksGksGksTdsAysTdsAdsAdsmCds  43  905
TdsGdsgdsGdsmCksAksAk
1197239 4441 4456 125466 125481 TGAGGTATAACTGGGC TksGksAksGdsGysTdsAdsTdsAdsAds  47 1580
mCdsTdsGdsGksGksmCk
1197240 4442 4457 125467 125482 CTGAGGTATAACTGGG mCksTksGksAdsGysGdsTdsAdsTds  58 2801
AdsAdsmCdsTdsGksGksGk
1197241 4443 4458 125468 125483 ACTGAGGTATAACTGG AksmCksTksGdsAysGdsGdsTdsAds  19  392
TdsAdsAdsmCdsTksGksGk
1197242 4444 4459 125469 125484 CACTGAGGTATAACTG mCksAksmCksTdsGysAdsGdsGdsTds  46 2802
AdsTdsAdsAdsmCksTksGk
1197243 4446 4461 125471 125486 AACACTGAGGTATAAC AksAksmCksAdsCysTdsGdsAdsGds  81 2816
GdsTdsAdsTdsAksAksmCk
1197248 4605 4620 125630 125645 TTAAGCACTTTTACAT TksTksAksAdsGysmCdsAdsmCdsTds  75 2822
TdsTdsTdsAdsmCksAksTk
1197249 4795 4810 125820 125835 GGAAGATCTGAAACTC GksGksAksAdsGysAdsTdsmCdsTds  28 2823
GdsAdsAdsAdsmCksTksmCk
1197250 4797 4812 125822 125837 TTGGAAGATCTGAAAC TksTksGksGdsAysAdsGdsAdsTdsm  60 2824
CdsTdsGdsAdsAksAksmCk
1197251 4798 4813 125823 125838 TTTGGAAGATCTGAAA TksTksTksGdsGysAdsAdsGdsAdsTds  74 2825
mCdsTdsGdsAksAksAk
1197252 4799 4814 125824 125839 CTTTGGAAGATCTGAA mCksTksTksTdsGysGdsAdsAdsGds  53 2826
AdsTdsmCdsTdsGksAksAk
1197253 4803 4818 125828 125843 AGTGCTTTGGAAGATC AksGksTksGdsCysTdsTdsTdsGdsGds  58 2828
AdsAdsGdsAksTksmCk
1197254 N/A N/A  94731  94746 TTAGGATGCATGGTTT TksTksAksGdsGysAdsTdsGdsmCds  51 2831
AdsTdsGdsGdsTksTksTk
1197255 N/A N/A  94732  94747 TTTAGGATGCATGGTT TksTksTksAdsGysGdsAdsTdsGdsm  38 2832
CdsAdsTdsGdsGksTksTk
1197256 N/A N/A  94733  94748 ATTTAGGATGCATGGT AksTksTksTdsAysGdsGdsAdsTdsGds  31 2833
mCdsAdsTdsGksGksTk
1197257 N/A N/A  94737  94752 TCAGATTTAGGATGCA TksmCksAksGdsAysTdsTdsTdsAds  20 2837
GdsGdsAdsTdsGksmCksAk
1197258 N/A N/A  94739  94754 ATTCAGATTTAGGATG AksTksTksmCdsAysGdsAdsTdsTds  57 2838
TdsAdsGdsGdsAksTksGk
1197259 N/A N/A 115903 115918 ATATGGTTTTGTGTGT AksTksAksTdsGysGdsTdsTdsTdsTds  59 2839
GdsTdsGdsTksGksTk
1197260 N/A N/A 115905 115920 TTATATGGTTTTGTGT TksTksAksTdsAysTdsGdsGdsTdsTds  65 2840
TdsTdsGdsTksGksTk
1197261 N/A N/A 115907 115922 TCTTATATGGTTTTGT TksmCksTksTdsAysTdsAdsTdsGds  91 2841
GdsTdsTdsTdsTksGksTk
1197262 N/A N/A 115910 115925 AACTCTTATATGGTTT AksAksmCksTdsCysTdsTdsAdsTds  89 2860
AdsTdsGdsGdsTksTksTk
1197263 N/A N/A 115913 115928 GACAACTCTTATATGG GksAksmCksAdsAysmCdsTdsmCds  91 2862
TdsTdsAdsTdsAdsTksGksGk
1197264 N/A N/A 117325 117340 ATTGCAATCTGTCTGA AksTksTksGdsCysAdsAdsTdsmCds  33 2843
TdsGdsTdsmCdsTksGksAk
1197265 N/A N/A 117329 117344 TAATATTGCAATCTGT TksAksAksTdsAysTdsTdsGdsmCds 103 2846
AdsAdsTdsmCdsTksGksTk
1197266 N/A N/A 117331 117346 TGTAATATTGCAATCT TksGksTksAdsAysTdsAdsTdsTdsGds  31 2847
mCdsAdsAdsTksmCksTk
1197267 N/A N/A 117332 117347 ATGTAATATTGCAATC AksTksGksTdsAysAdsTdsAdsTdsTds  62 2848
GdsmCdsAdsAksTksmCk
1197268 N/A N/A 117758 117773 AAGTGTATGTCAGAAG AksAksGksTdsGysTdsAdsTdsGdsTds  25 2865
mCdsAdsGdsAksAksGk
1197269 N/A N/A 117760 117775 TAAAGTGTATGTCAGA TksAksAksAdsGysTdsGdsTdsAdsTds   3 2867
GdsTdsmCdsAksGksAk
1197270 N/A N/A 117761 117776 TTAAAGTGTATGTCAG TksTksAksAdsAysGdsTdsGdsTdsAds   2 2868
TdsGdsTdsmCksAksGk
1197271 N/A N/A 117762 117777 TTTAAAGTGTATGTCA TksAksTksAdsAysAdsGdsTdsGdsTds  12 2869
AdsTdsGdsTksmCksAk
1197272 N/A N/A 117763 117778 CTTTAAAGTGTATGTC mCksTksTksTdsAysAdsAdsGdsTds  32 1634
GdsTdsAdsTdsGksTksmCk
1197273 N/A N/A 119667 119682 TAAGGTTTCCCAGATT TksAksAksGdsGysTdsTdsTdsmCdsm  68 2851
CdsmCdsAdsGdsAksTksTk
1197274 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA AksGksTksAdsAysGdsGdsTdsTdsTds  31 2852
mCdsmCdsmCdsAksGksAk
1197275 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG AksAksGksTdsAysAdsGdsGdsTdsTds  30 2853
TdsmCdsmCdsmCksAksGk
1197276 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC mCksTksAksAdsGysTdsAdsAdsGds  44 1101
GdsTdsTdsTdsmCksmCksmCk
1197277 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC AksmCksTksAdsAysGdsTdsAdsAds  23 2855
GdsGdsTdsTdsTksmCksmCk
1197278 N/A N/A 119674 119689 GACTAAGTAAGGTTTC GksAksmCksTdsAysAdsGdsTdsAds  36 2856
AdsGdsGdsTdsTksTksmCk
1197279 N/A N/A 119677 119692 TTAGACTAAGTAAGGT TksTksAksGdsAysmCdsTdsAdsAds  54 2858
GdsTdsAdsAdsGksGksTk
1197289 4438 4453 125463 125478 GGTAUAACTGGGCAAA GksGksTksAdsUysAdsAdsmCdsTds  48 2884
GdsGdsGdsmCdsAksAksAk
1197290 4440 4455 125465 125480 GAGGUATAACTGGGCA GksAksGksGdsUysAdsTdsAdsAdsm  37 2885
CdsTdsGdsGdsGksmCksAk
1197295 4800 4815 125825 125840 GCTTUGGAAGATCTGA GksmCksTksTdsUysGdsGdsAdsAds  24 2886
GdsAdsTdsmCdsTksGksAk
1197296 4801 4816 125826 125841 TGCTUTGGAAGATCTG TksGksmCksTdsUysTdsGdsGdsAds  36 2887
AdsGdsAdsTdsmCksTksGk
1197297 4802 4817 125827 125842 GTGCUTTGGAAGATCT GksTksGksmCdsUysTdsTdsGdsGds  25 2888
AdsAdsGdsAdsTksmCksTk
1197298 4805 4820 125830 125845 ATAGUGCTTTGGAAGA AksTksAksGdsUysGdsmCdsTdsTds  46 2889
TdsGdsGdsAdsAksGksAk
1197299 N/A N/A  94729  94744 AGGAUGCATGGTTTTT AksGksGksAdsUysGdsmCdsAdsTds  41 2890
GdsGdsTdsTdsTksTksTk
1197300 N/A N/A  94734  94749 GATTUAGGATGCATGG GksAksTksTdsUysAdsGdsGdsAdsTds  42 2891
GdsmCdsAdsTksGksGk
1197301 N/A N/A  94735  94750 AGATUTAGGATGCATG AksGksAksTdsUysTdsAdsGdsGds  71 2892
AdsTdsGdsmCdsAksTksGk
1197302 N/A N/A  94736  94751 CAGAUTTAGGATGCAT mCksAksGksAdsUysTdsTdsAdsGds  54 2893
GdsAdsTdsGdsmCksAksTk
1197303 N/A N/A 115906 115921 CTTAUATGGTTTTGTG mCksTksTksAdsUysAdsTdsGdsGds  72 2894
TdsTdsTdsTdsGksTksGk
1197304 N/A N/A 115908 115923 CTCTUATATGGTTTTG mCksTksmCksTdsUysAdsTdsAdsTds  45 2895
GdsGdsTdsTdsTksTksGk
1197305 N/A N/A 115909 115924 ACTCUTATATGGTTTT AksmCksTksmCdsUysTdsAdsTdsAds  30 2896
TdsGdsGdsTdsTksTksTk
1197306 N/A N/A 115911 115926 CAACUCTTATATGGTT mCksAksAksmCdsUysmCdsTdsTds  77 2897
AdsTdsAdsTdsGdsGksTksTk
1197307 N/A N/A 117327 117342 ATATUGCAATCTGTCT AksTksAksTdsUysGdsmCdsAdsAds  88 2898
TdsmCdsTdsGdsTksmCksTk
1197308 N/A N/A 117328 117343 AATAUTGCAATCTGTC AksAksTksAdsUysTdsGdsmCdsAds  49 2899
AdsTdsmCdsTdsGksTksmCk
1197309 N/A N/A 117330 117345 GTAAUATTGCAATCTG GksTksAksAdsUysAdsTdsTdsGdsm  11 2900
CdsAdsAdsTdsmCksTksGk
1197310 N/A N/A 117333 117348 TATGUAATATTGCAAT TksAksTksGdsUysAdsAdsTdsAdsTds 109 2901
TdsGdsmCdsAksAksTk
1197311 N/A N/A 117335 117350 TTTAUGTAATATTGCA TksTksTksAdsUysGdsTdsAdsAdsTds  27 2902
AdsTdsTdsGksmCksAk
1197312 N/A N/A 117755 117770 TGTAUGTCAGAAGAGT TksGksTksAdsUysGdsTdsmCdsAds  10 2903
GdsAdsAdsGdsAksGksTk
1197313 N/A N/A 117757 117772 AGTGUATGTCAGAAGA AksGksTksGdsUysAdsTdsGdsTdsm   8 2904
CdsAdsGdsAdsAksGksAk
1197314 N/A N/A 117759 117774 AAAGUGTATGTCAGAA AksAksAksGdsUysGdsTdsAdsTds  22 2905
GdsTdsmCdsAdsGksAksAk
1197315 N/A N/A 117765 117780 AACTUTAAAGTGTATG AksAksmCksTdsUysTdsAdsAdsAds 116 2906
GdsTdsGdsTdsAksTksGk
1197316 N/A N/A 119671 119686 TAAGUAAGGTTTCCCA TksAksAksGdsUysAdsAdsGdsGds  46 2907
TdsTdsTdsmCdsmCksmCksAk
1197317 N/A N/A 119675 119690 AGACUAAGTAAGGTTT AksGksAksmCdsUysAdsAdsGssTds  78 2908
AdsAdsGdsGdsTksTksTk
1200784 2524 2539 123549 123564 TGTCTCATGCCTTATA TksGksTksmCdsTdsCysAdsTdsGdsm  19 2803
CdsmCdsTdsTdsAksTksAk
1200785 2526 2541 123551 123566 ATTGTCTCATGCCTTA AksTksTksGdsTdsCysTdsmCdsAds  15 2804
TdsGdsmCdsmCdsTksTksAk
1200786 2527 2542 123552 123567 AATTGUCTCATGCCTT AksAksTksTdsGdsUysmCdsTdsmCds  21 2909
AdsTdsGdsmCdsmCksTksTk
1200787 2528 2543 123553 123568 AAATTGTCTCATGCCT AksAksAksTdsTdsGysTdsmCdsTdsm  38  443
CdsAdsTdsGdsmCksmCksTk
1200793 2560 2575 123585 123600 AGTATGTGGCAATAAT AksGksTksAdsTdsGysTdsGdsGdsm  31 2809
CdsAdsAdsTdsAksAksTk
1200794 2562 2577 123587 123602 AGAGTATGTGGCAATA AksGksAksGdsTdsAysTdsGdsTdsGds  18 2810
GdsmCdsAdsAksTksAk
1200795 2563 2578 123588 123603 TAGAGUATGTGGCAAT TksAksGksAdsGdsUysAdsTdsGdsTds  30 2910
GdsGdsmCdsAksAksTk
1200796 2564 2579 123589 123604 TTAGAGTATGTGGCAA TksTksAksGdsAdsGysTdsAdsTdsGds  15  963
TdsGdsGdsmCksAksAk
1200797 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTksAdsGdsAysGdsTdsAdsTds 11 810
GdsTdsGdsGksmCksAk
1200798 2566 2581 123591 123606 TATTAGAGTATGTGGC TksAksTksTdsAdsGysAdsGdsTdsAds    7 2812
TdsGdsTdsGksGksmCk
1200799 2567 2582 123592 123607 ATATTAGAGTATGTGG AksTksAksTdsTdsAysGdsAdsGdsTds  27 2813
AdsTdsGdsTksGksGk
1200800 2568 2583 123593 123608 TATATUAGAGTATGTG TksAksTksAdsTdsUysAdsGdsAdsGds  61 2911
TdsAdsTdsGksTksGk
1200801 2570 2585 123595 123610 TCTATATTAGAGTATG TksmCksTksAdsTdsAysTdsTdsAds  77 887
GdsAdsGdsTdsAksTksGk

TABLE 52
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
SEQ SEQ SEQ SEQ
ID ID ID ID
NO: 1 NO: 1 NO: 2 NO: 2 YAP1 SEQ
Compound Start Stop Start Stop Sequence (% ID
Number Site Site Site Site (5′ to 3′) CHEMSITRY NOTATION UTC) NO
 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA AksTksTksAdsmCdsTdsTdsmCdsAds  29   52
TdsAdsGdsmCdsTksTksAk
 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA AksTksTksAdsGdsAdsGdsTdsAdsTds  14  810
GdsTdsGdsGksmCksAk
1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC GksAksAksAdsTdsTdsGdsTdsmCds  15 2800
TdsmCdsAdsTdsGksmCksmCk
1200788 2529 2544 123554 123569 GAAATUGTCTCATGCC GksAksAksAdsTdsUysGdsTdsmCds  19 2912
TdsmCdsAdsTdsGksmCksmCk
1200789 2530 2545 123555 123570 GGAAAUTGTCTCATGC GksGksAksAdsAdsUysTdsGdsTdsm  12 2913
CdsTdsmCdsAdsTksGksmCk
1200790 2531 2546 123556 123571 TGGAAATTGTCTCATG TksGksGksAdsAdsAysTdsTdsGdsTds  33 2807
mCdsTdsmCdsAksTksGk
1200791 2532 2547 123557 123572 ATGGAAATTGTCTCAT AksTksGksGdsAdsAysAdsTdsTdsGds  46 2808
TdsmCdsTdsmCksAksTk
1200792 2534 2549 123559 123574 ATATGGAAATTGTCTC AksTksAksTdsGdsGysAdsAdsAdsTds  52  656
TdsGdsTdsmCksTksmCk
1200802 4436 4451 125461 125476 TATAACTGGGCAAATT TksAksTksAdsAdsCysTdsGdsGdsGds  89 2815
mCdsAdsAdsAksTksTk
1200803 4438 4453 125463 125478 GGTATAACTGGGCAAA GksGksTksAdsTdsAysAdsmCdsTds  22 1427
GdsGdsGdsmCdsAksAksAk
1200804 4439 4454 125464 125479 AGGTAUAACTGGGCAA AksGksGksTdsAdsUysAdsAdsmCds  44 2914
TdsGdsGdsGdsmCksAksAk
1200805 4440 4455 125465 125480 GAGGTATAACTGGGCA GksAksGksGdsTdsAysTdsAdsAdsm  50 1503
CdsTdsGdsGdsGksmCksAk
1200806 4441 4456 125466 125481 TGAGGUATAACTGGGC TksGksAksGdsGdsUysAdsTdsAds  24 2915
AdsmCdsTdsGdsGksGksmCk
1200807 4442 4457 125467 125482 CTGAGGTATAACTGGG mCksTksGksAdsGdsGysTdsAdsTds  69 2801
AdsAdsmCdsTdsGksGksGk
1200808 4443 4458 125468 125483 ACTGAGGTATAACTGG AksmCksTksGdsAdsGysGdsTdsAds  45  392
TdsAdsAdsmCdsTksGksGk
1200809 4444 4459 125469 125484 CACTGAGGTATAACTG mCksAksmCksTdsGdsAysGdsGdsTds  69 2802
AdsTasAdsAdsmCksTksGk
1200810 4446 4461 125471 125486 AACACUGAGGTATAAC AksAksmCksAdsmCdsUysGdsAdsGds  94 2916
GdsTdsAdsTdsAksAksmCk
1200811 4595 4610 125620 125635 TTACAUTAGGAACAAG TksTksAksmCdsAdsUysTdsAdsGds  62 2917
GdsAdsAdsmCdsAksAksGk
1200812 4597 4612 125622 125637 TTTTACATTAGGAACA TksTksTksTdsAdsCysAdsTdsTdsAds  59 2928
GdsGdsAdsAksmCksAk
1200813 4598 4613 125623 125638 CTTTTACATTAGGAAC mCksTksTksTdsTdsAysmCdsAdsTds  58 1124
TdsAdsGdsGdsAksAksmCk
1200814 4599 4614 125624 125639 ACTTTUACATTAGGAA AksmCksTksTdsTdsUysAdsmCdsAds  73 2918
TdsTdsAdsGdsGksAksAk
1200815 4600 4615 125625 125640 CACTTUTACATTAGGA mCksAksmCksTdsTdsUysTdsAdsm  55 2919
CdsAdsTdsTdsAdsGksGksAk
1200816 4601 4616 125626 125641 GCACTUTTACATTAGG GksCksAksmCdsTdsUysTdsTdsAds  37 2920
mCdsAdsTdsTdsAksGksGk
1200817 4602 4617 125627 125642 AGCACUTTTACATTAG AksGksmCksAdsmCdsUysTdsTdsTds  38 2921
AdsmCdsAdsTdsTksAksGk
1200818 4603 4618 125628 125643 AAGCACTTTTACATTA AksAksGksmCdsAdsCysTdsTdsTds  31 2821
TdsAdsmCdsAdsTksTksAk
1200819 4605 4620 125630 125645 TTAAGCACTTTTACAT TksTksAksAdsGdsCysAdsmCdsTds 101 2822
TdsTdsTdsAdsmCksAksTk
1200820 4795 4810 125820 125835 GGAAGATCTGAAACTC GksGksAksAdsGdsAysTdsmCdsTds  24 2823
GdsAdsAdsAdsmCksTksmCk
1200821 4797 4812 125822 125837 TTGGAAGATCTGAAAC TksTksGksGdsAdsAysGdsAdsTdsm  59 2824
CdsTdsGdsAdsAksAksmCk
1200822 4798 4813 125823 125838 TTTGGAAGATCTGAAA TksTksTksGdsGdsAysAdsGdsAdsTds  55 2938
mCdsTdsGdsAksAksAk
1200823 4799 4814 125824 125839 CTTTGGAAGATCTGAA mCksTksTksTdsGdsGysAdsAdsGds  46 2826
AdsTdsmCdsTdsGksAksAk
1200824 4800 4815 125825 125840 GCTTTGGAAGATCTGA GksmCksTksTdsTdsGysGdsAdsAds  43 2044
GdsAdsTdsmCdsTksGksAk
1200825 4801 4816 125826 125841 TGCTTUGGAAGATCTG TksGksmCksTdsTdsUysGdsGdsAds  39 2922
AdsGdsAdsTdsmCksTksGk
1200826 4802 4817 125827 125842 GTGCTUTGGAAGATCT GksTksGksmCdsTdsUysTdsGdsGds  26 2923
AdsAdsGdsAdsTksmCksTk
1200827 4803 4818 125828 125843 AGTGCUTTGGAAGATC AksGksTksGdsmCdsUysTdsTdsGds  67 2924
GdsAdsAdsGdsAksTksmCk
1200828 4805 4820 125830 125845 ATAGTGCTTTGGAAGA AksTksAksGdsTdsGysmCdsTdsTds  54 2829
TdsGdsGdsAdsAksGksAk
1200829 N/A N/A  94729  94744 AGGATGCATGGTTTTT AksGksGksAdsTdsGysmCdsAdsTds  49 2830
GdsGdsTdsTdsTksTksTk
1200830 N/A N/A  94731  94746 TTAGGATGCATGGTTT TksTksAksGdsGdsAysTdsGdsmCds  50 2831
AdsTdsGdsGdsTksTksTk
1200831 N/A N/A  94732  94747 TTTAGGATGCATGGTT TksTksTksAdsGdsGysAdsTdsGdsm  42 2832
CdsAdsTdsGdsGksTksTk
1200832 N/A N/A  94733  94748 ATTTAGGATGCATGGT AksTksTksTdsAdsGysGdsAdsTdsGds  61 2833
mCdsAdsTdsGksGksTk
1200833 N/A N/A  94734  94749 GATTTAGGATGCATGG GksAksTksTdsTdsAysGdsGdsAdsTds  31 2834
GdsmCdsAdsTksGksGk
1200834 N/A N/A  94735  94750 AGATTUAGGATGCATG AksGksAksTdsTdsUysAdsGdsGds  37 2925
AdsTdsGdsmCdsAksTksGk
1200835 N/A N/A  94736  94751 CAGATUTAGGATGCAT mCksAksGksAdsTdsUysTdsAdsGds  82 2926
GdsAdsTdsGdsmCksAksTk
1200836 N/A N/A  94737  94752 TCAGAUTTAGGATGCA TksmCksAksGdsAdsUysTdsTdsAds  72 2927
GdsGdsAdsTdsGksmCksAk
1200837 N/A N/A  94739  94754 ATTCAGATTTAGGATG AksTksTksmCdsAdsGysAdsTdsTds  82 2838
TdsAdsGdsGdsAksTksGk
1200838 N/A N/A 115903 115918 ATATGGTTTTGTGTGT AksTksAksTdsGdsGysTdsTdsTdsTds  65 2839
GdsTdsGdsTksGksTk
1200839 N/A N/A 115905 115920 TTATAUGGTTTTGTGT TksTksAksTdsAdsUysGdsGdsTdsTds  44 2928
TdsTdsGdsTksGksTk
1200840 N/A N/A 115906 115921 CTTATATGGTTTTGTG mCksTksTksAdsTdsAysTdsGdsGds  48 2788
TdsTdsTdsTdsGksTksGk
1200841 N/A N/A 115907 115922 TCTTAUATGGTTTTGT TksmCksTksTdsAdsUysAdsTdsGds  76 2929
GdsTdsTdsTdsTksGksTk
1200842 N/A N/A 115908 115923 CTCTTATATGGTTTTG mCksTksmCksTdsTdsAysTdsAdsTds 168 2842
GdsGdsTdsTdsTksTksGk
1200843 N/A N/A 115909 115924 ACTCTUATATGGTTTT AksmCksTksmCdsTdsUysAdsTdsAds  46 2930
TdsGdsGdsTdsTksTksTk
1200844 N/A N/A 115910 115925 AACTCUTATATGGTTT AksAksmCksTdsmCdsUysTdsAdsTds 132 2931
AdsTdsGdsGdsTksTksTk
1200845 N/A N/A 115911 115926 CAACTCTTATATGGTT mCksAksAksmCdsTdsCysTdsTdsAds 100 2861
TdsAdsTdsGdsGksTksTk
1200846 N/A N/A 115913 115928 GACAACTCTTATATGG GksAksmCksAdsAdsCysTdsmCdsTds  38 2862
TdsAdsTdsAdsTksGksGk
1200847 N/A N/A 117325 117340 ATTGCAATCTGTCTGA AksTksTksGdsmCdsAysAdsTdsmCds  54 2843
TdsGdsTdsmCdsTksGksAk
1200848 N/A N/A 117327 117342 ATATTGCAATCTGTCT AksTksAksTdsTdsGysmCdsAdsAds  58 2844
TdsmCdsTdsGdsTksmCksTk
1200849 N/A N/A 117328 117343 AATATUGCAATCTGTC AksAksTksAdsTdsUysGdsmCdsAds  53 2932
AdsTdsmCdsTdsGksTksmCk
1200850 N/A N/A 117329 117344 TAATAUTGCAATCTGT TksAksAksTdsAdsUysTdsGdsmCds  83 2933
AdsAdsTdsmCdsTksGksTk
1200851 N/A N/A 117330 117345 GTAATATTGCAATCTG GksTksAksAdsTdsAysTdsTdsGdsm  25 1404
CdsAdsAdsTdsmCksTksGk
1200852 N/A N/A 117331 117346 TGTAAUATTGCAATCT TksGksTksAdsAdsUysAdsTdsTdsGds  32 2934
mCdsAdsAdsTksmCksTk
1200853 N/A N/A 117332 117347 ATGTAATATTGCAATC AksTksGksTdsAdsAysTdsAdsTdsTds  69 2848
GdsmCdsAdsAksTksmCk
1200854 N/A N/A 117333 117348 TATGTAATATTGCAAT TksAksTksGdsTdsAysAdsTdsAdsTds  91 2849
TdsGdsmCdsAksAksTk
1200855 N/A N/A 117335 117350 TTTATGTAATATTGCA TksTksTksAdsTdsGysTdsAdsAdsTds  56 2850
AdsTdsTdsGksmCksAk
1200856 N/A N/A 117755 117770 TGTATGTCAGAAGAGT TksGksTksAdsTdsGysTdsmCdsAds  29 2863
GdsAdsAdsGdsAksGksTk
1200857 N/A N/A 117757 117772 AGTGTATGTCAGAAGA AksGksTksGdsTdsAysTdsGdsTdsm   4 2864
CdsAdsGdsAdsAksGksAk
1200858 N/A N/A 117758 117773 AAGTGUATGTCAGAAG AksAksGksTdsGdsUysAdsTdsGdsTds  10 2935
mCdsAdsGdsAksAksGk
1200859 N/A N/A 117759 117774 AAAGTGTATGTCAGAA AksAksAksGdsTdsGysTdsAdsTdsGds  28 2866
TdsmCdsAdsGksAksAk
1200860 N/A N/A 117760 117775 TAAAGUGTATGTCAGA TksAksAksAdsGdsUysGdsTdsAdsTds  16 2936
GdsTdsmCdsAksGksAk
1200861 N/A N/A 117761 117776 TTAAAGTGTATGTCAG TksTksAksAdsAdsGysTdsGdsTdsAds  10 2868
TdsGdsTdsmCksAksGk
1200862 N/A N/A 117762 117777 TTTAAAGTGTATGTCA TksTksTksAdsAdsAysGdsTdsGdsTds  17 2869
AdsTdsGdsTksmCksAk
1200863 N/A N/A 117763 117778 CTTTAAAGTGTATGTC mCksTksTksTdsAdsAysAdsGdsTds  41 1634
GdsTdsAdsTdsGksTksmCk
1200864 N/A N/A 117765 117780 AACTTUAAAGTGTATG AksAksmCksTdsTdsUysAdsAdsAds  84 2937
GdsTdsGdsTdsAksTksGk
1200865 N/A N/A 119667 119682 TAAGGUTTCCCAGATT TksAksAksGdsGdsUysTdsTdsmCdsm  54 2938
CdsmCdsAdsGdsAksTksTk
1200866 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA AksGksTksAdsAdsGysGdsTdsTdsTds  41 2852
mCdsmCdsmCdsAksGksAk
1200867 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG AksAksGksTdsAdsAysGdsGdsTdsTds  38 2853
TdsmCdsmCdsmCksAksGk
1200868 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA TksAksAksGdsTdsAysAdsGdsGdsTds  36 2854
TdsTdsmCdsmCksmCksAk
1200869 N/A N/A 119672 119687 CTAAGUAAGGTTTCCC mCksTksAksAdsGdsUysAdsAdsGds  25 2939
GdsTdsTdsTdsmCksmCksmCk
1200870 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC AksmCksTksAdsAdsGysTdsAdsAds  73 2855
GdsGdsTdsTdsTksmCksmCk
1200871 N/A N/A 119674 119689 GACTAAGTAAGGTTTC GksAksmCksTdsAdsAysGdsTdsAds  65 2856
AdsGdsGdsTdsTksTksmCk
1200872 N/A N/A 119675 119690 AGACTAAGTAAGGTTT AksGksAksmCdsTdsAysAdsGdsTds  98 2857
AdsAdsGdsGdsTksTksTk
1200873 N/A N/A 119677 119692 TTAGACTAAGTAAGGT TksTksAksGdsAdsCysTdsAdsAdsGds  55 2858
TdsAdsAdsGksGksTk

Example 6: Dose-Dependent Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers

Modified oligonucleotides described in the studies above were tested at various doses in A-431 cells. Cultured A-431 cells at a density of 5,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREENÂŽ. Results are presented in the tables below as percent control of the amount of Yap11 mRNA relative to untreated control cells (% UTC). IC50s were calculated using a linear regression on a log/linear plot of the data in excel.

TABLE 53
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in A-431 cells
% UTC
ION 148 444 1333 4000 IC50
No. nM nM nM nM (ÎźM)
715415 84 59 55 42 1.8
715423 83 91 80 57 >4.0
715433 87 72 65 40 2.5
715434 84 69 64 43 2.8
715473 89 67 50 30 1.3
715478 70 47 29 16 0.4
715479 98 80 77 64 >4.0
715480 91 79 67 59 >4.0
715483 82 58 43 35 1.1
715486 93 89 81 56 >4.0
715487 87 56 48 29 1.0
715490 98 89 76 43 4.1
715500 97 72 67 48 3.6
715501 82 82 68 56 >4.0
715508 78 70 67 43 3.5
715510 88 67 59 45 2.4
715523 100  62 75 44 3.2
715555 93 71 63 42 2.5
715577 87 76 73 45 >4.0

TABLE 54
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in A-431 cells
% UTC
ION 148 444 1333 4000 IC50
No. nM nM nM nM (ÎźM)
715414 91 91 102 67 >4.0
715435 80 67 61 48 3.4
715471 82 103 105 79 >4.0
715478 72 59 31 18 0.6
715558 94 112 80 66 >4.0
715582 98 63 93 70 >4.0
716370 81 79 69 49 >4.0
716376 103 94 79 50 >4.0
716424 76 69 51 44 2.0
716445 89 82 56 44 2.6
716454 91 71 54 48 2.6
716469 71 78 89 39 >4.0
716481 89 90 58 32 2.0
716484 88 78 80 55 >4.0
716493 95 97 86 72 >4.0
716496 74 87 64 49 >4.0
716502 73 57 45 30 0.8
716505 83 103 82 66 >4.0
716577 109 93 79 60 >4.0

TABLE 55
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in A-431 cells
% UTC
ION 148 444 1333 4000 IC50
No. nM nM nM nM (ÎźM)
715478 76 56 32 18 0.6
716381 106 90 80 44 4.2
716387 94 94 80 67 >4.0
716407 84 75 72 39 3.0
716419 89 84 49 47 2.5
716438 93 75 62 49 3.4
716455 95 70 49 25 1.2
716479 88 78 55 57 >4.0
716480 80 56 38 39 1.0
716489 84 83 69 61 >4.0
716500 88 96 79 46 >4.0
716501 91 69 66 55 >4.0
716503 91 80 67 64 >4.0
716513 82 73 39 39 1.4
716524 103 92 96 62 >4.0
716537 120 96 88 63 >4.0
716543 62 99 79 64 >4.0
716548 99 89 79 67 >4.0
716554 87 90 76 50 >4.0

Example 7: Dose-Dependent Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers

Modified oligonucleotides described in the studies above were tested at various doses in A-431 cells. Cultured A-431 cells at a density of 10,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS36584. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREENÂŽ. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). IC50s were calculated using a linear regression on a log/linear plot of the data in excel.

TABLE 56
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in A-431 cells
% UTC
ION 15.6 62.5 250.0 4000.00 IC50
No. nM nM nM nM (ÎźM)
715483 78 38 15 6 0.05
715491 92 83 48 28 0.27
958356 84 79 39 21 0.18
958361 100 80 42 22 0.22
958369 107 68 34 17 0.17
958370 98 74 41 22 0.20
958371 89 57 27 11 0.10
958373 72 45 21 17 0.05
958375 74 35 11 5 0.04
958377 90 60 38 17 0.13
958403 94 63 30 12 0.12
958476 71 30 13 6 0.03
958496 86 53 27 9 0.09
958536 94 67 30 16 0.14
958596 69 38 14 7 0.04
958721 72 32 9 3 0.03
958726 99 70 40 16 0.17
958736 83 38 14 7 0.06
958796 91 62 32 15 0.13

TABLE 57
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in A-431 cells
% UTC
ION 15.6 62.5 250.0 4000.00 IC50
No. nM nM nM nM (ÎźM)
715483 79 45 15 4 0.1
958451 98 74 51 23 0.2
958466 84 81 49 30 0.3
958481 86 62 28 14 0.1
958486 87 73 45 22 0.2
958491 94 65 27 10 0.1
958506 80 55 24 10 0.1
958526 118 83 40 17 0.2
958531 92 63 26 13 0.1
958541 81 51 18 9 0.1
958546 91 72 45 22 0.2
958551 95 73 34 14 0.2
958556 103 95 63 34 0.5
958616 78 49 29 17 0.1
958686 75 69 38 18 0.1
958731 85 64 39 19 0.1
958761 84 73 41 24 0.2
958781 77 45 20 10 0.1
958786 106 84 51 25 0.3

TABLE 58
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in A-431 cells
% UTC
ION 15.6 62.5 250.0 4000.00 IC50
No. nM nM nM nM (ÎźM)
715483 84 44 15 5 0.1
958457 91 50 24 13 0.1
958472 92 63 39 23 0.2
958477 83 37 14 6 0.1
958497 82 35 11 3 0.1
958527 89 74 35 13 0.1
958532 88 44 16 7 0.1
958537 100 56 21 11 0.1
958542 90 70 35 17 0.1
958547 98 74 43 22 0.2
958567 99 80 44 16 0.2
958577 81 51 22 11 0.1
958587 94 49 18 7 0.1
958622 79 50 18 7 0.1
958727 90 42 25 8 0.1
958742 105 70 39 20 0.2
958752 102 66 26 9 0.1
958757 110 89 43 27 0.3
958807 92 65 30 10 0.1

TABLE 59
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in A-431 cells
% UTC
ION 15.6 62.5 250.0 4000.00 IC50
No. nM nM nM nM (ÎźM)
715483 83 44 16 4 0.1
958498 70 21 5 2 0.02
958507 93 69 38 19 0.2
958518 95 55 18 4 0.1
958533 99 61 27 12 0.1
958553 68 23 12 5 0.03
958562 105 95 59 28 0.4
958563 94 54 22 10 0.1
958572 83 77 31 22 0.2
958573 81 56 23 8 0.1
958597 104 46 45 20 0.2
958603 70 27 11 4 0.03
958623 100 62 29 10 0.1
958668 81 38 12 5 0.1
958737 104 92 57 29 0.4
958758 83 66 33 12 0.1
958763 98 60 22 8 0.1
958767 101 57 20 10 0.1
958798 101 61 26 12 0.1

TABLE 60
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in A-431 cells
% UTC
ION 15.6 62.5 250.0 4000.00 IC50
No. nM nM nM nM (ÎźM)
715483 79 40 13 3 0.1
958473 85 60 29 17 0.1
958508 65 64 32 13 0.1
958523 86 64 31 12 0.1
958538 101 77 52 30 0.3
958543 84 63 36 18 0.1
958554 70 34 11 4 0.03
958558 84 83 67 35 0.5
958568 88 65 37 21 0.1
958578 78 52 23 10 0.1
958588 93 73 46 27 0.2
958593 99 60 27 15 0.1
958598 93 58 36 19 0.1
958648 80 65 48 24 0.2
958658 90 88 59 29 0.4
958718 104 80 44 24 0.2
958753 72 48 20 11 0.1
958793 88 61 42 25 0.2
958813 81 79 47 29 0.2

TABLE 61
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in A-431 cells
% UTC
ION 15.6 62.5 250.0 4000.00 IC50
No. nM nM nM nM (ÎźM)
715483 80 38 13 4 0.1
958454 72 40 12 4 0.04
958474 63 37 18 11 0.03
958484 77 38 10 4 0.05
958499 54 12 3 1 <0.01
958509 66 37 15 7 0.03
958529 103 64 27 11 0.1
958534 85 48 21 9 0.1
958569 82 49 24 7 0.1
958579 85 52 24 12 0.1
958589 75 50 19 8 0.1
958599 100 74 44 16 0.2
958614 84 49 22 13 0.1
958644 97 85 50 24 0.3
958659 91 68 28 9 0.1
958724 89 55 20 6 0.1
958729 73 44 13 4 0.05
958739 77 46 19 7 0.1
958799 88 53 25 10 0.1

TABLE 62
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION % UTC IC50
No. 15.6 nM 62.5 nM 250.0 nM 4000.00 nM (ÎźM)
715483 88 40 12 4 0.1
958485 68 38 13 8 0.04
958525 94 57 26 8 0.1
958544 65 77 40 17 0.1
958545 75 50 19 8 0.1
958549 98 78 47 28 0.3
958550 91 60 26 10 0.1
958555 99 73 34 13 0.2
958565 83 62 30 13 0.1
958580 95 59 24 9 0.1
958590 71 33 9 4 0.03
958594 91 70 42 20 0.2
958615 91 60 34 18 0.1
958650 82 51 17 7 0.1
958725 65 36 7 1 0.03
958730 88 48 19 7 0.1
958734 87 65 35 15 0.1
958785 78 52 18 6 0.1
958819 79 63 34 19 0.1

TABLE 63
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION % UTC IC50
No. 15.6 nM 62.5 nM 250.0 nM 4000.00 nM (ÎźM)
715483 87 45 15 4 0.1
715483 77 36 10 3 0.04
715487 77 44 13 4 0.1
716454 84 39 12 6 0.1
958490 81 54 26 13 0.1
958500 91 63 32 16 0.1
958505 81 72 53 21 0.2
958535 98 64 38 19 0.2
958540 62 28 14 8 0.02
958570 93 60 33 17 0.1
958575 89 58 34 20 0.1
958585 95 71 40 17 0.2
958595 83 57 37 16 0.1
958600 69 44 23 14 0.05
958605 76 63 34 9 0.1
958625 86 59 35 17 0.1
958735 116 69 37 23 0.2
958795 90 69 38 20 0.2
958805 90 89 56 28 0.3

Example 8: Dose-Dependent Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers

Modified oligonucleotides described in the studies above were tested at various doses in A-431 cells. Cultured A-431 cells at a density of 10,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREENÂŽ. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). IC50s were calculated using a linear regression on a log/linear plot of the data in excel.

TABLE 64
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
 958499 27 4 3 2 <0.02
1074368 67 34 15 10 0.1
1074464 25 6 3 3 <0.02
1074560 50 16 6 4 <0.02
1074753 42 10 6 4 <0.02
1075137 70 22 8 4 0.1
1075233 45 12 5 3 <0.02
1075712 69 38 13 7 0.1
1075744 55 22 9 7 <0.02
1075808 38 9 4 4 <0.02
1075968 74 37 11 5 0.1
1076000 71 31 10 5 0.1
1076064 68 26 10 5 0.1
1076256 68 33 11 6 0.1
1076288 31 7 3 4 <0.02
1076416 67 33 13 7 0.1
1076448 61 19 4 3 <0.02
1076449 44 8 3 2 <0.02
1076481 21 4 2 3 <0.02

TABLE 65
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
 958499 24 4 2 2 <0.02
1074274 42 14 7 5 <0.02
1074593 50 20 9 8 <0.02
1074594 53 23 10 5 <0.02
1074595 67 21 8 4 0.04
1074626 54 18 8 5 <0.02
1074627 17 5 3 3 <0.02
1074755 28 9 5 3 <0.02
1074817 50 22 13 11 <0.02
1074850 63 20 7 5 0.04
1075041 62 31 11 7 0.05
1075138 66 27 8 5 0.05
1075457 52 21 8 6 <0.02
1075458 74 43 17 6 0.1
1075778 56 29 10 5 0.03
1075810 67 28 12 7 0.1
1075842 27 7 3 3 <0.02
1076067 45 13 5 4 <0.02
1076386 61 30 11 5 0.04

TABLE 66
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
 958499 28 4 2 2 <0.02
1074563 80 31 7 5 0.1
1074564 40 14 7 4 <0.02
1074628 29 13 7 6 <0.02
1074723 56 24 11 8 <0.02
1074756 22 7 4 4 <0.02
1074851 51 19 9 7 <0.02
1074852 36 11 4 4 <0.02
1075395 60 18 7 5 <0.02
1075748 81 36 12 7 0.1
1075876 47 20 7 5 <0.02
1075939 46 19 10 8 <0.02
1076003 60 28 17 11 0.04
1076004 27 7 3 2 <0.02
1076260 61 30 12 5 0.05
1076291 75 26 8 5 0.1
1076323 41 35 13 5 <0.02
1076388 87 40 13 6 0.1
1076483 63 27 11 6 0.04

TABLE 67
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
 958499 23 4 2 2 <0.02
1074245 47 21 8 5 <0.02
1074565 47 20 9 6 <0.02
1074566 41 12 5 3 <0.02
1074597 35 15 8 7 <0.02
1074629 21 5 3 3 <0.02
1074630 57 23 10 6 <0.02
1074726 26 8 4 3 <0.02
1074758 74 23 8 5 0.1
1075078 65 32 12 4 0.1
1075749 46 22 7 4 <0.02
1075781 52 15 4 3 <0.02
1075813 57 31 11 5 0.04
1076293 49 18 6 5 <0.02
1076326 53 20 6 3 <0.02
1076453 11 2 1 2 <0.02
1076486 84 45 16 6 0.1
1076516 64 39 18 13 0.1
1076549 53 24 10 6 <0.02

TABLE 68
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
 958499 31 5 2 2 <0.02
1074407 55 27 13 8 <0.02
1074535 57 21 7 5 <0.02
1074536 64 24 9 6 0.04
1074728 28 7 4 4 <0.02
1074792 48 17 7 5 <0.02
1075047 80 63 27 10 0.2
1075048 76 42 13 5 0.1
1075111 42 11 6 5 <0.02
1075112 87 36 13 7 0.1
1075143 59 21 5 3 <0.02
1075207 82 51 17 7 0.1
1075686 72 44 18 14 0.1
1075784 54 18 5 3 <0.02
1076070 55 17 8 6 <0.02
1076294 76 50 21 11 0.1
1076295 55 17 5 3 <0.02
1076327 73 38 17 9 0.1
1076456 43 14 5 3 <0.02

TABLE 69
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
 958499 36 5 2 2 <0.02
1074250 67 35 15 9 0.1
1074313 56 21 9 5 <0.02
1074409 60 30 13 7 0.04
1074537 47 21 6 4 <0.02
1074762 74 32 14 8 0.1
1074794 56 23 10 6 <0.02
1075081 76 50 22 9 0.1
1075401 62 26 11 7 0.04
1075465 75 35 14 9 0.1
1075689 97 59 19 8 0.2
1075785 29 7 3 3 <0.02
1075816 66 29 12 8 0.1
1076330 57 31 9 4 0.04
1076393 54 20 8 5 <0.02
1076458 88 52 23 10 0.2
1076489 43 13 4 3 <0.02
1076490 36 9 4 3 <0.02
1076552 73 40 17 12 0.1

TABLE 70
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
 958499 27 4 2 2 <0.02
1074251 73 33 16 10 0.1
1074315 57 26 9 5 0.03
1074411 47 20 8 6 <0.02
1074443 69 35 14 8 0.1
1074795 38 14 7 5 <0.02
1075115 57 41 17 9 0.1
1075146 67 38 16 8 0.1
1075242 71 39 18 12 0.1
1075243 50 18 7 5 <0.02
1075498 82 40 21 16 0.1
1075819 48 18 7 5 <0.02
1076298 92 58 29 18 0.2
1076299 68 38 13 5 0.1
1076426 68 46 24 18 0.1
1076427 75 30 9 4 0.1
1076459 67 32 13 7 0.1
1076491 81 45 21 10 0.1
1076523 67 38 18 7 0.1

TABLE 71
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
 958499 29 5 2 2 <0.02
1074221 75 38 14 7 0.1
1074413 50 19 6 3 <0.02
1074444 49 21 7 4 <0.02
1074508 62 30 14 8 0.05
1074509 44 12 6 5 <0.02
1075052 40 10 4 4 <0.02
1075053 61 24 8 5 0.04
1075084 103 72 37 14 0.3
1075757 43 14 5 2 <0.02
1075916 73 34 14 8 0.1
1076077 53 19 9 5 <0.02
1076396 64 22 5 3 0.04
1076397 43 14 5 4 <0.02
1076460 79 53 25 12 0.2
1076461 65 24 7 3 0.04
1076524 71 30 12 7 0.1
1076525 43 14 5 2 <0.02
1076556 72 46 19 11 0.1

TABLE 72
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
 958499 95 89 82 81 >2.0
1074222 59 21 8 5 <0.02
1074318 48 12 6 4 <0.02
1074414 64 34 14 7 0.1
1074445 57 19 8 6 <0.02
1074446 39 11 5 3 <0.02
1074477 77 48 20 12 0.1
1074606 31 10 6 4 <0.02
1074638 14 4 3 3 <0.02
1074766 72 32 14 7 0.1
1074798 34 12 5 6 <0.02
1075118 85 36 8 4 0.1
1075246 70 34 12 6 0.1
1076174 58 21 7 4 <0.02
1076366 63 25 8 4 0.04
1076430 42 14 6 4 <0.02
1076462 61 22 8 5 0.03
1076494 34 7 3 2 <0.02
1076526 44 9 3 2 <0.02

TABLE 73
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
 958499 103 89 85 87 >2.0
1074351 69 33 13 7 0.1
1074447 47 20 8 5 <0.02
1074448 54 13 4 3 <0.02
1074479 23 8 4 4 <0.02
1074480 33 9 5 3 <0.02
1074607 45 22 10 5 <0.02
1074639 46 18 7 5 <0.02
1075055 60 20 6 4 0.03
1075088 37 9 4 2 <0.02
1075824 33 10 5 3 <0.02
1075855 65 30 12 8 0.1
1075983 81 46 17 6 0.1
1076015 70 37 15 9 0.1
1076143 81 48 20 9 0.1
1076367 31 10 4 3 <0.02
1076399 60 29 11 6 0.04
1076464 36 10 3 2 <0.02
1076527 81 41 16 8 0.1

TABLE 74
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
 958499 33 5 3 2 <0.02
1074417 68 26 7 3 0.1
1074576 69 41 14 9 0.1
1074577 33 10 4 3 <0.02
1074608 49 20 9 7 <0.02
1074609 65 29 15 11 0.1
1074672 34 18 10 7 <0.02
1074736 34 12 7 7 <0.02
1074737 50 21 8 6 <0.02
1074800 48 21 10 7 <0.02
1074801 76 41 19 12 0.1
1075089 45 9 3 3 <0.02
1075249 77 37 16 8 0.1
1075792 79 41 15 10 0.1
1076017 59 25 9 5 0.03
1076049 61 16 13 6 <0.02
1076369 60 20 6 3 <0.02
1076370 46 12 4 2 <0.02
1076465 72 32 14 7 0.1

TABLE 75
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
 958499 27 5 2 2 <0.02
1074290 49 17 9 7 <0.02
1074418 55 26 9 4 <0.02
1074419 48 15 5 3 <0.02
1074420 38 8 3 2 <0.02
1074450 54 22 7 5 <0.02
1074451 63 26 8 4 0.04
1074484 43 12 5 3 <0.02
1074578 66 30 18 11 0.1
1074579 54 22 8 5 <0.02
1074610 57 20 10 7 <0.02
1074675 47 18 6 3 <0.02
1075155 51 15 6 4 <0.02
1075699 26 6 3 2 <0.02
1076114 34 11 6 5 <0.02
1076115 47 17 9 6 <0.02
1076466 43 18 8 6 <0.02
1076467 24 6 3 2 <0.02
1076530 53 26 11 7 <0.02

TABLE 76
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
 958499 36 5 2 2 <0.02
1074229 58 24 9 5 <0.02
1074421 61 29 8 5 0.04
1074452 88 28 9 5 0.1
1074453 51 18 9 5 <0.02
1074485 47 14 5 3 <0.02
1074548 50 15 7 8 <0.02
1074549 67 31 12 7 0.1
1074580 55 18 8 5 <0.02
1074613 63 23 9 6 0.04
1074676 54 16 6 5 <0.02
1075061 58 23 9 6 <0.02
1075093 74 26 7 4 0.1
1075701 84 34 11 6 0.1
1075797 43 11 4 3 <0.02
1075893 80 29 11 8 0.1
1076084 69 34 12 8 0.1
1076085 70 34 14 9 0.1
1076340 79 42 17 11 0.1

TABLE 77
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in A-431 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
958499 37 4 2 2 <0.02
1074230 62 30 12 8 0.05
1074454 39 9 3 3 <0.02
1074486 55 26 10 6 <0.02
1074487 73 28 11 6 0.1
1074678 73 37 16 10 0.1
1074679 52 16 6 5 <0.02
1074775 26 5 2 2 <0.02
1075222 75 30 8 5 0.1
1075766 56 21 11 8 <0.02
1075990 28 6 3 3 <0.02
1076022 63 28 8 5 0.04
1076023 60 18 5 3 <0.02
1076119 82 35 12 6 0.1
1076183 65 22 9 6 0.04
1076406 51 20 9 7 <0.02
1076439 48 13 6 5 <0.02
1076471 64 29 9 5 0.05
1076534 88 48 20 10 0.2

Example 9: Dose-Dependent Inhibition of Human Yap1 in SNU-449 Cells by Modified Oligonucleotides

Modified oligonucleotides described in the studies above were tested at various doses in SNU-449 cells. Cultured SNU-449 cells at a density of 10,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS36584. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREENÂŽ. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). IC50s were calculated using a linear regression on a log/linear plot of the data in excel.

TABLE 78
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-449 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
715487 94 47 23 8 0.2
1198371 85 66 46 21 0.3
1198380 72 55 27 11 0.1
1198382 77 56 36 18 0.2
1198384 76 50 24 17 0.1
1198397 70 53 28 14 0.1
1198398 73 55 33 18 0.2
1198406 70 57 31 16 0.2
1198409 100 68 45 27 0.4
1198412 73 54 33 15 0.2
1198422 88 60 30 19 0.2
1198423 58 35 15 6 0.05
1198424 64 44 24 9 0.1
1198438 62 28 7 2 0.04
1198439 44 21 5 2 <0.03
1198440 55 23 6 2 <0.03
1198718 87 37 14 4 0.1
1198719 67 30 9 3 0.1
1198746 49 24 9 3 <0.03

TABLE 79
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-449 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
715487 90 44 15 5 0.1
1198202 83 46 16 5 0.1
1198212 74 35 10 2 0.1
1198213 91 33 11 3 0.1
1198638 70 42 13 4 0.1
1198641 55 29 11 3 0.03
1198642 79 48 15 4 0.1
1198656 55 22 8 3 <0.03
1198664 52 33 14 5 <0.03
1198673 51 26 8 3 <0.03
1198696 58 31 11 2 0.04
1198697 60 29 7 1 0.04
1198698 55 29 8 2 0.03
1198724 56 25 8 3 <0.03
1198728 51 28 9 3 <0.03
1198786 63 32 11 2 0.1
1198787 68 21 6 1 0.05
1198788 64 30 7 2 0.1
1198799 62 35 13 4 0.1

TABLE 80
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides SNU-449 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
715487 98 56 25 10 0.2
958590 69 52 29 12 0.1
1074728 69 45 19 8 0.1
1097247 58 28 8 2 0.04
1197215 56 31 7 2 0.04
1197216 66 39 15 4 0.1
1197217 66 39 14 4 0.1
1198285 67 41 16 5 0.1
1198286 64 45 22 8 0.1
1198287 95 68 36 16 0.3
1198288 77 43 17 7 0.1
1198289 72 41 18 9 0.1
1198290 60 39 20 10 0.1
1198294 59 33 14 5 0.05
1198295 82 47 19 8 0.1
1198297 67 42 16 7 0.1
1198347 67 54 24 8 0.1
1198354 66 24 5 1 0.05
1198356 85 30 7 1 0.1

TABLE 81
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-449 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
715487 109 53 28 12 0.3
1198352 58 29 10 3 0.04
1198353 60 30 10 4 0.04
1198355 63 34 10 4 0.1
1198358 68 39 20 8 0.1
1198365 59 38 15 5 0.1
1198543 75 42 19 6 0.1
1198546 70 42 18 6 0.1
1198550 73 56 30 13 0.2
1198552 72 46 23 9 0.1
1198553 65 38 19 6 0.1
1198554 72 46 22 8 0.1
1198555 73 40 19 9 0.1
1198557 81 52 26 11 0.2
1198569 71 45 22 14 0.1
1198570 58 33 16 9 0.04
1198578 73 45 25 12 0.1
1198610 69 29 7 2 0.1
1198613 80 25 7 2 0.1

TABLE 82
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-449 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
715487 125 73 35 15 0.4
1197229 54 32 16 7 0.03
1197235 64 36 16 5 0.1
1197236 64 46 25 14 0.1
1197269 48 21 7 1 <0.03
1197270 43 23 8 2 <0.03
1197312 101 58 34 11 0.3
1197313 71 38 16 6 0.1
1198596 73 40 14 4 0.1
1198605 57 27 7 1 0.03
1198611 37 19 4 1 <0.03
1198612 44 12 2 0 <0.03
1198614 69 26 3 1 0.1
1198615 52 23 5 2 <0.03
1198616 78 46 18 5 0.1
1198623 48 24 5 1 <0.03
1198624 62 37 21 9 0.1
1200797 84 52 23 11 0.2
1200798 77 44 17 7 0.1

TABLE 83
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-449 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
715487 136 70 35 10 0.4
958499 93 47 19 7 0.2
1074461 76 37 15 5 0.1
1197271 70 47 19 8 0.1
1197309 91 63 30 9 0.2
1200784 70 51 26 12 0.1
1200785 98 73 42 24 0.4
1200788 61 38 19 9 0.1
1200789 60 32 15 5 0.05
1200794 85 59 31 13 0.2
1200796 69 47 25 12 0.1
1200803 72 52 34 18 0.2
1200806 91 54 34 18 0.2
1200820 104 69 36 17 0.3
1200857 66 30 8 2 0.1
1200858 71 39 14 4 0.1
1200860 59 35 15 5 0.05
1200861 74 43 17 4 0.1
1200862 88 64 35 13 0.2

TABLE 84
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-449 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
715487 100 62 29 12 0.3
1074462 90 38 13 3 0.1
1074464 109 50 19 6 0.2
1198804 71 48 19 5 0.1
1198805 61 42 20 7 0.1
1198814 63 25 6 3 0.04
1198815 84 64 34 15 0.2
1198818 68 33 15 5 0.1
1198831 74 33 10 4 0.1
1198832 77 53 23 13 0.1
1198856 72 55 24 7 0.1
1198857 78 44 13 4 0.1
1198873 38 12 2 0 <0.03
1198874 36 8 1 0 <0.03
1198875 61 23 4 1 0.04
1198895 62 37 16 9 0.1
1198911 62 31 12 7 0.05
1198917 81 37 12 6 0.1
1198918 60 33 13 9 0.05

TABLE 85
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-449 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
715487 103 56 25 10 0.2
1009325 59 36 16 4 0.1
1009326 59 35 14 4 0.05
1074756 42 20 6 3 <0.03
1074798 62 38 17 8 0.1
1076187 68 46 24 12 0.1
1076453 67 29 8 1 0.1
1076481 86 40 15 3 0.1
1197176 66 37 19 6 0.1
1197177 56 29 8 2 0.03
1197178 64 36 14 4 0.1
1197179 58 38 17 7 0.1
1197193 85 52 24 11 0.2
1197213 87 46 14 2 0.1
1197214 88 31 7 1 0.1
1197223 88 55 25 8 0.2
1198312 76 34 10 5 0.1
1198872 49 21 6 1 <0.03
1198877 62 32 13 5 0.05

TABLE 86
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-449 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
715487 92 53 22 12 0.2
1095481 73 47 16 8 0.1
1095593 73 44 27 10 0.1
1198203 71 51 25 11 0.1
1198211 72 37 23 12 0.1
1198243 55 28 10 5 <0.03
1198267 78 44 15 3 0.1
1198268 83 52 17 5 0.1
1198457 82 56 31 12 0.2
1198460 60 49 28 11 0.1
1198466 68 44 18 6 0.1
1198470 73 41 18 9 0.1
1198484 80 45 24 12 0.1
1198501 65 36 17 11 0.1
1198524 50 32 9 3 <0.03
1198525 62 26 8 1 0.04
1198526 61 30 8 2 0.04
1198527 63 35 12 3 0.1
1198905 75 43 21 6 0.1

TABLE 87
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-449 cells
ION % UTC IC50
No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (ÎźM)
715487 89 48 23 10 0.2
1198492 67 39 19 10 0.1
1198494 59 37 24 13 0.1
1198499 89 42 30 12 0.2
1198500 72 51 34 15 0.2
1198502 76 50 29 15 0.2
1198504 77 46 27 24 0.1
1198507 83 57 29 13 0.2
1198510 71 44 18 6 0.1
1198528 87 54 30 11 0.2
1198529 86 69 37 16 0.3
1198900 69 36 18 7 0.1
1198902 74 46 22 10 0.1
1198904 78 36 23 10 0.1
1198935 50 46 23 11 0.04
1198958 68 39 16 5 0.1
1198959 62 28 8 2 0.04
1198960 77 35 8 2 0.1
1198961 77 35 11 3 0.1

Example 10: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Balb/c Mice

Balb/c mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of male Balb/c mice at 4-6 weeks of age (obtained from Taconic) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male Balb/c mice was injected with PBS. Mice were euthanized on day 26 post start of treatment (24 hours following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 88
Plasma chemistry markers in Balb/c mice
ION ALT AST TBIL
No. (U/L) (U/L) (mg/dL)
PBS 35 56 0.18
715480 791 439 0.15
715484 116 110 0.15
715487 79 96 0.13
715491 33 48 0.11
715557 1755 2377 0.28
715558 65 91 0.16
715582 2460 2320 2.09
715593 628 610 0.11
715609 1120 2941 0.67
715659 332 431 0.23
715744 164 138 0.15
715763 522 316 0.18
715766 182 191 0.12
715784 47 47 0.13
715797 188 222 0.15
715859 306 133 0.17
715863 2090 903 0.54

Body and Organ Weights

Body weights of Balb/c mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 89
Body and organ weights
body
ION weight Liver Kidney Spleen
No. (g) (g) (g) (g)
PBS 22 1.05 0.37 0.09
715480 22 1.64 0.34 0.12
715484 22 1.47 0.37 0.13
715487 23 1.24 0.36 0.14
715491 22 1.03 0.32 0.12
715557 21 1.96 0.31 0.12
715558 22 1.33 0.38 0.12
715582 22 1.46 0.38 0.16
715593 19 1.12 0.30 0.13
715609 21 2.64 0.33 0.10
715659 20 1.21 0.31 0.11
715744 22 1.18 0.32 0.17
715763 23 1.71 0.36 0.13
715766 21 1.40 0.30 0.12
715784 23 1.15 0.39 0.12
715797 22 1.39 0.36 0.16
715859 22 1.32 0.36 0.14
715863 21 1.79 0.33 0.12

Example 11: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Balb/c Mice

Balb/c mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of male Balb/c mice at 4-6 weeks of age (obtained from Taconic) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male Balb/c mice was injected with PBS. Mice were euthanized on day 26 post start of treatment (24 hours following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 90
Plasma chemistry markers in Balb/c mice
ION ALT AST BUN TBIL
No. (U/L) (U/L) (mg/dL) (mg/dL)
PBS 18 54 14 0.18
715415 1075 701 17 0.14
715473 3046 2861 20 2.77
715483 62 70 16 0.17
715487 59 81 16 0.18
716424 2077 1422 20 0.22
716454 39 60 14 0.18
716455 1089 1193 22 0.25
716480 2156 844 19 0.14
716481 1935 2248 21 0.46
716502 2920 1329 17 0.27
716513 325 229 17 0.14

Body and Organ Weights

Body weights of Balb/c mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 91
Body and organ weights
body
ION weight Liver Kidney Spleen
No. (g) (g) (g) (g)
PBS 24 1.09 0.40 0.11
715415 25 1.79 0.40 0.17
715473 20 1.46 0.31 0.09
715483 25 1.56 0.43 0.12
715487 27 1.46 0.42 0.15
716424 23 2.08 0.36 0.15
716454 25 1.48 0.42 0.14
716455 21 2.66 0.32 0.14
716480 21 2.58 0.34 0.10
716481 22 1.99 0.36 0.13
716502 23 2.18 0.42 0.10
716513 25 1.59 0.41 0.18

Example 12: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Balb/c Mice

Balb/c mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of male Balb/c mice at 6-7 weeks of age (obtained from Taconic) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male Balb/c mice was injected with PBS. Mice were euthanized on day 26 post start of treatment (24 hours following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 92
Plasma chemistry markers in Balb/c mice
ION ALT AST TBIL BUN
No. (U/L) (U/L) (mg/dL) (mg/dL)
PBS 22 63 0.16 22
958375 2736 3013 0.43 22
958454 1183 2162 6.53 45
958498 1441 3197 0.74 12
958499 142 146 0.17 26
958509 1483 1627 0.31 26
958540 4127 3940 0.44 25
958553 174 227 0.20 29
958554 583 1051 0.28 17
958590 374 360 0.16 25
958603 1103 927 0.35 27
958721 57 114 0.17 28
958725 3758 3758 0.91 31
958729 4368 4503 2.15 30
958736 2439 1450 0.31 20

Body and Organ Weights

Body weights of Balb/c mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 93
Body and organ weights
body
ION weight Liver Kidney Spleen
No. (g) (g) (g) (g)
PBS 24 1.28 0.37 0.09
958375 23 2.00 0.39 0.12
958454 14 0.68 0.25 0.03
958498 20 1.51 0.45 0.19
958499 23 1.44 0.32 0.14
958509 20 1.50 0.27 0.13
958540 19 1.53 0.33 0.09
958553 21 1.01 0.29 0.11
958554 22 1.05 0.28 0.15
958590 25 1.76 0.40 0.13
958603 21 1.80 0.36 0.20
958721 24 1.45 0.33 0.12
958725 15 1.23 0.21 0.04
958729 15 1.32 0.24 0.05
958736 24 1.95 0.39 0.18

Example 13: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Balb/c Mice

Balb/c mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of male Balb/c mice at 4-6 weeks of age (obtained from Taconic) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male Balb/c mice was injected with PBS. Mice were euthanized on day 25 post start of treatment (24 hours following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 94
Plasma chemistry markers in Balb/c mice
ION ALT AST TBIL BUN
No. (U/L) (U/L) (mg/dL) (mg/dL)
PBS     26*   65* 0.18 22
958371   249 199 0.24 30
958914  1855 1837  0.68 29
958933    63 122 0.22 33
958939  2236 1863  0.38 23
958941   772 500 0.23 30
958961    66 106 0.19 28
958973    93 126 0.20 22
959022 13242 8058  1.12 25
959030  1160 1328  0.21 29
959155  2146 1686  0.22 26
959167  1556 2096  0.56 24
959196  1169 785 0.31 27
959197   753 493 0.29 23
*Average of 3 values

Body and Organ Weights

Body weights of Balb/c mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 95
Body and organ weights body
body
ION weight Liver Kidney Spleen
No. (g) (g) (g) (g)
PBS 25 1.29 0.39 0.09
958371 23 1.31 0.32 0.15
958914 19 1.22 0.32 0.12
958933 27 1.86 0.37 0.15
958939 24 1.67 0.40 0.23
958941 26 1.81 0.37 0.15
958961 26 1.47 0.39 0.15
958973 26 1.71 0.40 0.19
959022 19 1.76 0.34 0.11
959030 25 1.73 0.38 0.14
959155 21 1.53 0.34 0.25
959167 22 0.96 0.37 0.10
959196 23 1.22 0.34 0.11
959197 23 1.37 0.34 0.14

Example 14: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Balb/c Mice

Balb/c mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of male Balb/c mice at 5-6 weeks of age (obtained from Taconic) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male Balb/c mice was injected with PBS. Mice were euthanized on day 27 post start of treatment (24 hours following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 96
Plasma chemistry markers in Balb/c mice
ION ALT AST TBIL BUN
No. (U/L) (U/L) (mg/dL) (mg/dL)
PBS 33 123 0.25 22
958497 46 151 0.24 26
958534 1962 1617 0.33 26
958589 35 66 0.21 24
958596 207 162 0.23 24
958622 224 254 0.24 23
958739 145 186 0.21 21

Body and Organ Weights

Body weights of Balb/c mice were measured on day 25, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 97
Body and organ weights
body
ION weight Liver Kidney Spleen
No. (g) (g) (g) (g)
PBS 23 1.14 0.35 0.08
958497 23 1.31 0.35 0.11
958534 22 1.81 0.32 0.09
958589 25 1.40 0.37 0.10
958596 25 2.11 0.36 0.13
958622 23 0.92 0.33 0.12
958739 24 1.58 0.36 0.13

Example 15: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in CD-1 Mice

CD-1 mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of four male CD-1 mice at 4-5 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-1 mice was injected with PBS. Mice were euthanized on day 26 post start of treatment (24 hrs following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB) and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 98
Plasma chemistry markers in CD-1 mice
ION ALT AST TBIL BUN ALB
No. (U/L) (U/L) (mg/dL) (mg/dL) (g/dL)
PBS 32 47 19 0.2 2.5
1074234 81 187 23 0.2 2.3
1074461 1563 865 22 0.6 2.2
1074554 32 49 22 0.2 2.5
1074557 32 65 23 0.2 2.3
1074587 163 131 25 0.2 2.4
1074588 38 67 22 0.2 2.3
1074622 34 59 20 0.2 2.5
1074655 1360 978 19 0.3 2.0
1074680 78 125 19 0.1 2.0
1075067 28 59 23 6.4 2.5
1075068 43 81 19 0.2 2.2
1075741 114 113 20 0.2 2.3
1075768 48 65 19 0.2 2.3
1075769 74 103 18 0.2 2.5
1075774 45 71 20 0.2 2.5
1075838 97 131 22 0.2 2.2
715483 79 125 21 0.2 2.2
715487 66 113 21 0.1 1.9
716454 44 56 20 0.2 2.3

Body and Organ Weights

Body weights of CD-1 mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 99
Body and organ weights
body
ION weight Liver Kidney Spleen
No. (g) (g) (g) (g)
PBS 44 2.51 0.61 0.12
1074234 37 2.26 0.55 0.12
1074554 38 2.09 0.52 0.11
1074557 38 1.87 0.61 0.15
1074587 39 2.33 0.58 0.16
1074588 40 2.40 0.69 0.20
1074622 38 2.16 0.64 0.21
1074655 39 3.40 0.69 0.30
1074680 42 2.52 0.65 0.24
1075067 40 2.12 0.65 0.17
1075068 38 2.15 0.64 0.20
1075741 39 2.21 0.62 0.23
1075768 37 1.86 0.54 0.13
1075769 35 1.76 0.47 0.10
1075774 37 2.23 0.59 0.14
1075838 41 2.28 0.57 0.25
715483 40 2.26 0.64 0.21
715487 41 2.24 0.59 0.21
716454 38 2.31 0.55 0.20

Example 16: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in CD-1 Mice

CD-1 mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of four male CD-1 mice at 4-5 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-1 mice was injected with PBS. Mice were euthanized on day 27 post start of treatment (24 hrs following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB) and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 100
Plasma chemistry markers in CD-1 mice
ION ALT AST TBIL BUN Albumin
No. (U/L) (U/L) (mg/dL) (mg/dL) (g/dL)
PBS 21 45 0.19 22 2.5
1076024 41 88 0.19 19 2.3
1076157 55 105 0.19 19 2.1
1076186 74 97 0.16 23 2.5
1076187 57 90 0.18 20 2.3
1076190 48 63 0.17 20 2.2
1076287 53 98 0.20 21 2.1
1076379 37 89 0.15 20 2.1
1076382 52 87 0.14 19 1.9
1076475 38 62 0.15 18 2.0
1095493 1623 1449 0.69 18 1.8

Body and Organ Weights

Body weights of CD-1 mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 101
Body and organ weights
body
ION weight Liver Kidney Spleen
No. (g) (g) (g) (g)
PBS 35 1.78 0.56 0.12
1076024 40 2.28 0.66 0.15
1076157 38 2.48 0.58 0.23
1076186 37 2.42 0.58 0.16
1076187 34 1.95 0.56 0.14
1076190 38 2.28 0.56 0.15
1076287 36 2.36 0.63 0.36
1076379 38 2.21 0.57 0.18
1076382 36 2.22 0.62 0.21
1076475 37 2.16 0.64 0.17
1095493 28 1.94 0.50 0.17

Example 17: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in CD-1 Mice

CD-1 mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of four male CD-1 mice at 4-5 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-1 mice was injected with PBS. Mice were euthanized on day 27 post start of treatment (24 hrs following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB) and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 102
Plasma chemistry markers in CD-1 mice
ION ALT AST BUN TBIL
No. (U/L) (U/L) (mg/dL) (mg/dL)
PBS 22 100 24 0.16
1095404 1282 503 22 0.14
1095515 1041 951 19 1.12
1095632 92 126 26 0.15
1096947 46 116 23 0.17
1096450 1104 635 25 2.19
1096973 35 59 20 0.22
1097037 73 97 23 0.12
1096522 652 397 21 0.16
1075395 38 51 21 0.18
1097183 834 738 16 0.39
1097224 39 78 21 0.09
1097231 85 112 21 0.13

Body and Organ Weights

Body weights of CD-1 mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 103
Body and organ weights
body
ION weight Liver Kidney Spleen
No. (g) (g) (g) (g)
PBS 34 1.92 0.55 0.11
1095404 33 2.09 0.58 0.15
1095515 26 1.52 0.47 0.20
1095632 33 2.04 0.48 0.17
1096947 33 1.91 0.51 0.21
1096450 35 2.59 0.42 0.19
1096973 35 2.21 0.48 0.18
1097037 33 2.33 0.52 0.21
1096522 31 2.04 0.45 0.18
1075395 34 2.30 0.49 0.20
1097183 28 1.23 0.46 0.20
1097224 37 1.93 0.54 0.16
1097231 34 2.37 0.47 0.24

Example 18: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in CD-1 Mice

CD-1 mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of four male CD-1 mice at 5-6 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 9 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-1 mice was injected with PBS. Mice were euthanized on day 34 post start of treatment (24 hours following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB) and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 104
Plasma chemistry markers in CD-1 mice
ION ALT AST BUN TBIL
No. (U/L) (U/L) (mg/dL) (mg/dL)
PBS 24 53 20 0.27
958499 79 88 24 0.18
1074755 88 104 22 0.21
1076453 56 113 20 0.24
1076481 71 121 23 0.23

Body and Organ Weights

Body weights of CD-1 mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 105
Body and organ weights
body
ION weight Liver Kidney Spleen
No. (g) (g) (g) (g)
PBS 39 1.84 0.59 0.17
958499 39 2.20 0.57 0.22
1074755 39 2.27 0.61 0.19
1076453 38 1.91 0.56 0.20
1076481 39 2.06 0.57 0.23

Example 19: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in CD-1 Mice

CD-1 mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of four male CD-1 mice at 4-6 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-1 mice was injected with PBS. Mice were euthanized on day 26 post start of treatment (24 hrs following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB) and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 106
Plasma chemistry markers in CD-1 mice
ION ALT AST TBIL BUN
No. (U/L) (U/L) (mg/dL) (mg/dL)
PBS 32 48 0.25 20
1198439 210 219 0.25 18
1198440 121 140 0.22 19
1198872 192 207 0.25 22
1157929 39 50 0.22 19
1157034 210 165 0.19 17
1157111 48 74 0.22 17

Body and Organ Weights

Body weights of CD-1 mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 107
Body and organ weights
body
ION weight Liver Kidney Spleen
No. (g) (g) (g) (g)
PBS 36 2.04 0.59 0.12
1198439 36 2.03 0.51 0.25
1198440 35 1.97 0.46 0.18
1198872 34 1.84 0.40 0.16
1157929 34 1.98 0.43 0.13
1157034 35 2.43 0.53 0.17
1157111 36 2.53 0.50 0.21

Example 20: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Sprague-Dawley Rats

Sprague-Dawley rats are a multipurpose model used for safety and efficacy evaluations. The rats were treated with Ionis modified oligonucleotides from the studies described in the Examples above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Male Sprague-Dawley rats were maintained on a 12-hour light/dark cycle and fed ad libitum with Purina normal rat chow. Groups of 4 Sprague-Dawley rats each were weekly injected subcutaneously with 50 mg/kg of Ionis oligonucleotide for 6 weeks (total 7 doses). Forty-eight hours after the last dose, the rats were euthanized; and organs, urine and plasma were harvested for further analysis.

Plasma Chemistry Markers

To evaluate the effect of Ionis oligonucleotides on hepatic function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in the table below expressed in IU/L. Plasma levels of total bilirubin (TBIL), albumin (ALB), and blood urea nitrogen (BUN) were also measured using the same clinical chemistry analyzer and the results are also presented in the table below. Ionis modified oligonucleotides that caused changes in the levels of any markers of liver function outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 108
Plasma chemistry markers in Sprague-Dawley rats
Plasma clinical chemistry
ALT AST TBIL BUN ALB
ASO (U/L) (U/L) (mg/dL) (mg/dL) (g/dL)
PBS 31* 67* 0.17* 16 1.61
958499 61 109 0.18 24 2.78
1074755 57 97 0.12 29 2.99
1076187 54 113 0.10 21 2.91
1076453 47 77 0.13 23 3.14
1076481 50 91 0.13 49 2.74
1097224 31 51 0.07 86 1.61
*Refers to groups with only 3 data points

Kidney Function

To evaluate the effect of Ionis oligonucleotides on kidney function, urinary levels of total protein and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The ratios of total protein to creatinine (P/C ratio) are presented in the Table below. Ionis oligonucleotides that caused changes in the levels of the ratio outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 109
Total protein to creatinine ratio in Sprague-Dawley rats
ION URINE
NO. P/C ratio
PBS 1
958499 5
1074755 5
1076187 5
1076453 5
1076481 5
1097224 87

Body and Organ Weights

Liver, spleen and kidney weights were measured at the end of the study and are presented in the table below. Terminal body weight was measured prior to necropsy. Ionis oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 110
Body and Organ weights
body
ION weight Liver Kidney Spleen
No. (g) (g) (g) (g)
PBS 423 16 3.1 0.9
958499 333 14 3.1 2.8
1074755 357 16 3.3 2.1
1076187 344 17 3.0 1.7
1076453 371 16 3.2 2.1
1076481 367 14 2.6 2.1
1097224 316 13 4.5 1.4

Example 21: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Sprague-Dawley Rats

Sprague-Dawley rats are a multipurpose model used for safety and efficacy evaluations. The rats were treated with Ionis modified oligonucleotides from the studies described in the Examples above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Male Sprague-Dawley rats were maintained on a 12-hour light/dark cycle and fed ad libitum with Purina normal rat chow. Groups of 4 Sprague-Dawley rats each were weekly injected subcutaneously with 50 mg/kg of Ionis oligonucleotide for 6 weeks (total 7 doses). Forty-eight hours after the last dose, the rats were euthanized; and organs, urine and plasma were harvested for further analysis.

Plasma Chemistry Markers

To evaluate the effect of Ionis oligonucleotides on hepatic function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in the Table below expressed in IU/L. Plasma levels of total bilirubin (TBIL) and blood urea nitrogen (BUN) were also measured using the same clinical chemistry analyzer and the results are also presented in the Table below. Ionis modified oligonucleotides that caused changes in the levels of any markers of liver function outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 111
Plasma chemistry markers in Sprague-Dawley rats
Plasma clinical chemistry
ALT AST TBIL BUN
ASO (U/L) (U/L) (mg/dL) (mg/dL)
PBS 64 98 0.19 19
1198874 73 102 0.16 22
1200857 183 318 4.93 56
1074756 114* 79* 0.10* 0.57*
1198873 78* 79* 0.17* 24*
1198439 54* 94* 0.15* 22*
1198615 38 71 0.13 21
1198440 58** 108** 0.17** 20**
1198612 74 91 0.12 31
1198312 132 108 0.14 25
*Refers to groups with 3 samples
**Refers to groups with 2 samples

Body and Organ Weights

Liver, spleen and kidney weights were measured at the end of the study and are presented in the table below. Terminal body weight was measured prior to necropsy. Ionis oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 112
Body and Organ weights
body
ION weight Liver Kidney Spleen
No. (g) (g) (g) (g)
PBS 453 17 3.64 0.91
1198874 372 20 3.67 2.61
1200857 307 19 6.97 2.55
1074756 349 21* 4.71* 1.99*
1198873 408 19 3.65 2.42
1198439 319* 17* 3.68* 2.28*
1198615 369 16 3.01 2.35
1198440 373 18 3.29 2.78
1198612 345 17 3.60 2.33
1198312 365 19 4.26 2.19
*Refers to groups with 3 samples

Kidney Function

To evaluate the effect of Ionis oligonucleotides on kidney function, urinary levels of total protein and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The ratios of total protein to creatinine (P/C ratio) are presented in the Table below. Ionis oligonucleotides that caused changes in the levels of the ratio outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 113
Total protein to creatinine ratio in Sprague-Dawley rats
URINE
ION P/C
NO. ratio
PBS 1
1198874 9
1200857 52
1074756 167
1198873 9
1198439 8*
1198615 8
1198440 9
1198612 11
1198312 60
*Refers to groups with 3 samples

Example 22: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Sprague-Dawley Rats

Sprague-Dawley rats are a multipurpose model used for safety and efficacy evaluations. The rats were treated with Ionis modified oligonucleotides from the studies described in the Examples above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Male Sprague-Dawley rats were maintained on a 12-hour light/dark cycle and fed ad libitum with Purina normal rat chow. Groups of 4 Sprague-Dawley rats each were weekly injected subcutaneously with 50 mg/kg of Ionis oligonucleotide for 6 weeks (total 7 doses). Forty-eight hours after the last dose, the rats were euthanized; and organs, urine and plasma were harvested for further analysis.

Plasma Chemistry Markers

To evaluate the effect of Ionis oligonucleotides on hepatic function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in the Table below expressed in IU/L. Plasma levels of total bilirubin (TBIL) and blood urea nitrogen (BUN) were also measured using the same clinical chemistry analyzer and the results are also presented in the Table below. Ionis modified oligonucleotides that caused changes in the levels of any markers of liver function outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 114
Plasma chemistry markers in Sprague-Dawley rats
Plasma clinical chemistry
ALT AST TBIL BUN
ASO (U/L) (U/L) (mg/dL) (mg/dL)
PBS 80 105 0.22 19
1197270 84 120 0.19 24
1198872 109 134 0.20 18
1198728 54 71 0.18 22
1198831 54 69 0.20 23
1198623 96 87 0.24 21
1198605 46 76 0.33 18

Kidney Function

To evaluate the effect of Ionis oligonucleotides on kidney function, urinary levels of total protein and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The ratios of total protein to creatinine (P/C ratio) are presented in the Table below. Ionis oligonucleotides that caused changes in the levels of the ratio outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 115
Total protein to creatinine ratio in Sprague-Dawley rats
URINE
ION P/C
NO. ratio
PBS 1
1197270 14
1198872 8
1198728 7
1198831 17
1198623 5
1198605 28

Body and Organ Weights

Liver, spleen and kidney weights were measured at the end of the study and are presented in the table below. Terminal body weight was measured prior to necropsy. Ionis oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 116
Body and Organ weights
body
ION weight Liver Kidney Spleen
No. (g) (g) (g) (g)
PBS 476 18 3.4 0.9
1197270 374 15 3.6 2.0
1198872 417 17 3.4 1.3
1198728 381 15 2.9 1.4
1198831 426 19 3.3 2.0
1198623 472 20 3.6 1.9
1198605 372 18 3.6 2.1

Example 23: Measurement of Viscosity of Modified Oligonucleotides Targeting Human Yap1

The viscosity of select modified oligonucleotides from the studies described above was measured with the aim of screening out modified oligonucleotides which have a viscosity of more than 40 centipoise (cP). Modified oligonucleotides having a viscosity greater than 40 cP would have less than optimal viscosity.

Oligonucleotides (32-38 mg) were weighed into a glass vial; approximately 100 ΟL of water was added, and the modified oligonucleotide was dissolved into solution by heating the vial to 55° C. Part (75 ΟL) of the pre-heated sample was pipetted to a micro-viscometer (PAC Cambridge Viscosity Viscometer). The temperature of the micro-viscometer was set to 25° C. and the viscosity of the sample was measured. The entire 75 uL of sample was them combined with the remaining portion of the sample was diluted appropriately for UV reading at 260 nM (Cary UV instrument). Modified oligonucleotides solutions that were not optimal in their viscosity under the criterion stated above were excluded in further studies.

TABLE 117
Viscosity of modified oligonucleotides
Com- Concentration Concentration
pound by weight by UV Viscocity
ID (mg/mL) (mg/mL) (cP)
958499 300 220.7 84.5
1074755 300 217.2 7.2
1074756 300 232.8 17.4
1076187 300 237.4 40.6
1076453 300 229.1 46.4
1076481 300 213.0 6.4
1097224 300 230.7 8.1
1197269 300 211.4 10.7
1197270 300 241.6 15.1
1198243 300 234.0 13.4
1198312 300 233.1 17.5
1198439 300 233.8 14
1198440 300 219.7 8.6
1198501 300 220.0 14.5
1198605 300 220.7 59.6
1198611 300 228.3 8.6
1198612 300 230.1 10.2
1198615 300 223.1 23
1198623 300 215.4 20.8
1198641 300 223.2 16.4
1198656 300 227.6 26.1
1198673 300 237.2 15.3
1198728 300 241.8 30.9
1198746 300 232.7 13.4
1198831 300 204.0 5.8
1198872 300 220.7 5.5
1198873 300 229.1 7.6
1198874 300 222.0 12.5
1200857 300 226.4 13.1

Example 24: Dose-Dependent Inhibition of Human Yap1 in A-431 Cells by Modified Oligonucleotides

Modified oligonucleotides described in the studies above were tested at various doses in A-431 cells. Cultured A-431 cells at a density of 11,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS36584. Yap1 mRNA levels were normalized to GAPDH content, as measured by primer probe set RTS104 (forward sequence GAAGGTGAAGGTCGGAGTC, designated herein as SEQ ID NO.: 17; reverse sequence GAAGATGGTGATGGGATTTC, designated herein as SEQ ID NO.: 18; probe sequence CAAGCTTCCCGTTCTCAGCC, designated herein as SEQ ID NO.: 19). Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). IC50s were calculated using a linear regression on a log/linear plot of the data in excel.

TABLE 118
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in A-431 cells
ION % UTC IC50
No. 0.002 ÎźM 0.008 ÎźM 0.04 ÎźM 0.2 ÎźM 1 ÎźM (ÎźM)
 958499 1 3 28 91 117 0.03
1076453 0 1 23 74 89 0.01
1197270 0 2 26 80 99 0.02
1198439 0 1 11 65 93 0.02
1198440 0 1 14 69 96 0.02
1198605 0 2 26 57 96 0.02
1198623 2 5 28 72 96 0.01
1198728 1 4 27 85 87 0.02
1198831 2 6 28 72 83 0.01
1198872 1 3 19 70 94 0.01

Example 25: Activity of Modified Oligonucleotides Targeting Human Yap1 in SCC25 Cells

Modified oligonucleotides described in the studies above were tested at various doses in squamous cell carcinoma cell line SCC25. A control oligonucleotide 792169 (a 3-10-3 cET gapmer with a full phosphorothioate backbone, CGCCGATAAGGTACAC, designated herein as SEQ ID No.: 2940; is not complementary to any known human gene) was also tested.

RNA Analysis

Cultured SCC25 cells at a density of 5,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated herein as SEQ ID NO.: 20; reverse sequence GCCATGCCAATCTCATCTTGT, designated herein as SEQ ID NO.: 21; probe sequence CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO.: 22). Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 119
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in SCC25 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 96 89 93 98
958499 47 22 10 4
1076453 59 21 7 3
1197270 48 24 12 7
1198439 35 12 5 3
1198440 39 14 5 3
1198605 48 23 10 5
1198623 61 31 15 10
1198728 71 31 15 7
1198831 63 36 16 14
1198872 54 22 9 7

Cell Proliferation Assay

Cultured SCC25 cells at a density of 1,000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-GloÂŽ 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 120
Antiproliferative effect of modified
oligonucleotides in SCC25 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 103 104 100 88
958499 76 42 25 14
1076453 81 40 23 15
1197270 75 40 22 14
1198439 62 30 22 16
1198440 73 33 22 16
1198605 77 39 23 13
1198623 84 55 36 29
1198728 88 61 30 20
1198831 88 54 25 21
1198872 82 37 22 18

Example 26: Dose Dependent Inhibition of Human Yap1 by Modified Oligonucleotides in a Human Hepatocellular Carcinoma SNU449 Xenograft Tumor Model

A SNU449 hepatocellular carcinoma xenograft tumor model was used to evaluate activity of modified oligonucleotides targeted to human Yap1. Ten million SNU449 cells in 30% matrigel were implanted subcutaneously into the flanks of female NOD Cg-Prkdcscid ll2rgtm1Wjl/SzJ (NSG) mice (from Jackson Laboratory) at 4-6 weeks of age. When tumors reached an average volume of 100 mm3, approximately two weeks post-implantation, groups of four mice each were administered at 50 mg/kg twice weekly with modified oligonucleotides for five days. Tumors were collected and tested for Yap1 mRNA knockdown by RT-qPCR. Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated animals (% control).

TABLE 121
Inhibition of human Yap1 mRNA expression by
modified oligonucleotides in SNU449 xenografts
ION
No. % control
PBS 100
958499 54
1074755 70
1076453 56
1197269 57
1197270 54
1198439 51
1198440 51
1198501 54
1198605 55
1198615 62
1198623 60
1198641 68
1198673 52
1198728 64
1198831 67
1198872 52
715487 61

Example 27: Dose Dependent Inhibition of Human Yap1 by Modified Oligonucleotides in a Human Epidermoid Carcinoma A-431 Xenograft Tumor Model

An epidermoid carcinoma A-431 xenograft tumor model was used to evaluate activity of modified oligonucleotides targeted to human Yap1. Five million A-431 cells in 30% matrigel were implanted subcutaneously into the flanks of female NCr-Foxn1nu mice (from Taconic) at 4-6 weeks of age. When tumors reached an average volume of 40 mm3, approximately two weeks post-implantation, groups of four mice each were administered at either 25 mg/kg or 50 mg/kg daily with modified oligonucleotides for four days (5 doses). Tumors were collected 6-8 hours post final dose and tested for Yap1 mRNA knockdown by RT-qPCR. Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated animals (% control).

TABLE 122
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in A-431 xenografts
% control
ION No. 25 mpk 50 mpk
PBS 100 100
958499 49 29
1076453 55 25
1197270 57 38
1198439 37 19
1198440 32 21
1198605 32 30
1198623 43 36
1198728 47 39
1198831 47 37
1198872 34 26
715487 61 57

Example 28: Dose Dependent Inhibition of Human Yap1 by Modified Oligonucleotides in a Human Squamous Cell Carcinoma CAL27 Xenograft Tumor Model

A squamous cell carcinoma CAL27 xenograft tumor model was used to evaluate activity of modified oligonucleotides targeted to human Yap1. Five million CAL27 cells in 30% matrigel were implanted subcutaneously into the flanks of female CrTac:NCr-Foxn1nu mice (from Taconic) at 4-6 weeks of age. Groups of four mice each were administered with either 15 mg/kg or 30 mg/kg of modified oligonucleotides daily for five days after tumor size had reached ˜100 mm3 (about 3 weeks post implantation). Tumors were collected and tested for Yap1 mRNA knockdown by RT-qPCR. Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated untreated control cells (% UTC).

TABLE 123
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in CAL27 xenografts
% UTC
ION No. 15 mg/kg 30 mg/kg
PBS 100 100
958499 68 53
1076453 69 46
1197270 55 38
1198439 66 38
1198440 67 41
1198605 65 48
1198623 52 44
1198728 77 56
1198831 70 48
1198872 55 38

Example 29: Activity of Modified Oligonucleotides Targeting Human Yap1 in a Human Squamous Cell Carcinoma CAL33 Xenograft Tumor Model

A xenograft tumor model was used to evaluate activity of modified oligonucleotides targeted to human Yap1. One million CAL33 cells in 30% matrigel were implanted subcutaneously into the flanks of female CrTac:NCr-Foxn1nu (Taconic) mice. When tumors reached an average volume of 100 mm3, approximately two weeks post-implantation, groups of eight mice were administered at 50 mg/kg twice weekly with modified oligonucleotides for two weeks. ION 792169 was administered as a control.

Tumor samples were collected for measurement of Yap1 mRNA levels by RT-qPCR. Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated animals (% control).

Tumor volume was measured at the indicated days in the table below. Tumor weight was determined at end of study. Mice were sacrificed when tumors from PBS-treated mice reached 2,000 mm3.

TABLE 124
Yap1 mRNA levels in tumors
ION No. % control
PBS 102
792169 74
1198728 40
1198440 12

TABLE 125
Tumor volume (mm3)
Days post-implantation 10 13 17 21 24 27 31 34 38 40 44
ION Number Average Tumor Volume (mm3)
PBS 144 254 382 666 855 974 1180 1342 1458 1472 1377
 792169 123 262 367 531 774 805 962 1057 1171 1160 1069
1198728 113 253 423 621 835 988 1123 1233 1239 1277 1277
1198440 115 279 376 574 651 818 888 857 770 746 834

TABLE 126
Tumor weight (g)
Average Tumor weight
ION No. (g)
PBS 1.02
792169 0.85
1198728 0.88
1198440 0.36

Example 30: Activity of Modified Oligonucleotides Targeting Human Yap1 in a Human Hepatocellular Carcinoma SNU449 Xenograft Tumor Model

Modified oligonucleotides described in the studies above were tested in a hepatocellular carcinoma SNU449 xenograft tumor model. A control oligonucleotide 792169 was also tested.

Five million SNU449 cells in 30% matrigel were implanted subcutaneously into the fatpads of female NOD.Cg-Prkdcscid II2rgtm1Wjl/SzJ mice (from Jackson Laboratory) at 4-6 weeks of age. 43 days post implantation (when tumors had reached approximately 100 mm3 in size), groups of eight mice each were administered with 50 mg/kg modified oligonucleotide daily for 10 days (loading dose), following which they were administered with 50 mg/kg modified oligonucleotide four times a week for one week, following which they were dosed with 50 mg/kg modified oligonucleotide thrice weekly until the end of the study. Animals were sacrificed and tumors were collected on day 119 post implantation. Yap1 mRNA knockdown in tumors was measured by RT-qPCR as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated animals (% control).

Tumor volumes were also measured at the indicated days in the table below

TABLE 127
Yap1 mRNA levels in tumors
Ion No. % control
PBS 100
792169 90
1198440 34

TABLE 128
Tumor volume (mm3)
Days Post Average Tumor Volume
Tumor (mm3)
Implantation PBS 792169 1198440
43 111  111 111
46 175  162 152
50 208  180 168
53 252  247 201
57 292  280 242
60 362  317 263
64 396  397 338
67 438  466 376
71 463  519 373
75 570  559 401
78 597  634 429
81 657  681 514
85 760  785 606
88 786  889 613
92 955 1170 690
94 1048 1215 773
98 1114 1355 804
101 1175 1417 818
105 1252 1509 894
108 1284 1571 921
119 1431  1697* 978
*Average of 7 samples

Example 31: Activity of Modified Oligonucleotides Targeting Human Yap1 in NCI H747 Cells

Modified oligonucleotides described in the studies above were tested at various doses in colorectal adeocarcinoma cell line NCI H747. A control oligonucleotide 792169 was also tested.

RNA Analysis

Cultured NCI H747 cells at a density of 10,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 129
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in NCI H747 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 94 83 87 100
715487 83 70 49 30
1198440 73 53 21 9

Cell Proliferation Assay

Cultured NCI H747 cells at a density of 3000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After 7 days, cell proliferation was measured using the luminescent cell viability CellTiter-GloÂŽ 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 130
Antiproliferative effect of modified oligonucleotides in NCI
H747 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 89 97 91 80
715487 91 86 65 42
1198440 87 66 36 18

Example 32: Activity of Modified Oligonucleotides Targeting Human Yap1 in NCI H292 Cells

Modified oligonucleotides described in the studies above were tested at various doses in mucoepidermoid pulmonary carinoma cell line NCI 1-1292. A control oligonucleotide 792169 was also tested.

RNA Analysis

Cultured NCI H292 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 131
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in NCI H292 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 98 112 111 106
715487 104 83 40 12
1198440 89 53 18 5

Cell Proliferation Assay

Cultured NCI H292 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-GloÂŽ 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 132
Antiproliferative effect of modified oligonucleotides in NCI
H292 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 98 97 99 92
715487 87 90 69 20
1198440 100 83 30 15

Example 33: Activity of Modified Oligonucleotides Targeting Human Yap1 in BICR56 Cells

Modified oligonucleotides described in the studies above were tested at various doses in squamous cell carcinoma adherent keratinocyte cell line BICR56. A control oligonucleotide 792169 was also tested.

RNA Analysis

Cultured BICR56 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 133
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in BICR56 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 99 92 85 97
715487 68 28 16 11
1198440 40 10 7 7

Cell Proliferation Assay

Cultured BICR56 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-GloÂŽ 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 134
Antiproliferative effect of modified oligonucleotides in
BICR56 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 106 100 92 87
715487 70 26 9 4
1198440 28 10 6 4

Example 34: Effect of Modified Oligonucleotides Targeting Human Yap1 in Cynomolgus Monkeys

Cynomolgus monkeys were treated with Ionis modified oligonucleotides selected from studies described in the Examples above. Modified oligonucleotide tolerability was evaluated.

Treatment

Prior to the study, the monkeys were kept in quarantine during which the animals were observed daily for general health. The monkeys were 2-4 years old and weighed 2-4 kg. Eleven groups of 4 randomly assigned male cynomolgus monkeys each were injected subcutaneously with Ionis oligonucleotide or saline in a clock-wise rotation between four different sites on the back. Following loading doses on days 1, 3, 5 and 7, the monkeys were dosed once per week (on days 14, 21, 28, 35, and 42) with 35 mg/kg of Ionis oligonucleotide. A control group of 4 cynomolgus monkeys was injected with 0.9% saline in a similar manner and served as the control group.

During the study period, the monkeys were observed twice daily for signs of illness or distress. Any animal experiencing more than momentary or slight pain or distress due to the treatment, injury or illness was treated by the veterinary staff with approved analgesics or agents to relieve the pain after consultation with the Study Director. Any animal in poor health or in a possible moribund condition was identified for further monitoring and possible euthanasia. Scheduled euthanasia of the animals was conducted on day 86 approximately 48 hours after the last dose by exsanguination while under deep anesthesia. The protocols described in the Example were approved by the Institutional Animal Care and Use Committee (IACUC).

Body and Organ Weight Measurements

To evaluate the effect of Ionis oligonucleotides on the overall health of the animals, body and organ weights were measured. Terminal body weight was measured prior to necropsy. Organ weights were measured as well, and all weight measurements are presented in the Table below. The results indicate that effect of treatment with modified oligonucleotides on body and organ weights was within the expected range for modified oligonucleotides. Specifically, treatment with ION 1198440 was well tolerated in terms of the body and organ weights of the monkeys.

TABLE 135
Body and Organ weights (g)
Terminal
ION Body Liver with
No. Weight Heart kidney spleen gallbladder
Saline 2855 11 14 3 60
958499 2894 10 15 4 68
1076453 2955 11 16 5 72
1197270 2852 10 17 4 73
1198439 2959 10 15 3 67
1198440 2919 11 15 3 65
1198605 2968 11 15 4 67
1198623 2790 9 13 3 62
1198728 2722 10 15 5 65
1198831 2788 11 14 4 65
1198872 3126 12 15 4 63

Kidney and Liver Function

To evaluate the effect of Ionis oligonucleotides on hepatic and kidney function, blood samples were collected from all the study groups on day 44. The monkeys were fasted overnight prior to blood collection. Blood was collected in tubes without anticoagulant for serum separation. The tubes were kept at room temperature for a minimum of 90 minutes and then centrifuged at 3000 rpm for 10 minutes to obtain serum. Levels of various liver function markers were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan). Plasma levels of glucose (GLU), blood urea nitrogen (BUN), creatinine (CREA), total protein (TP), albumin (ALB), globulin (GLO), albumin/globulin (A/G) ratio calculated, alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), gamma-glutamyltransferase (GGT), alkaline phosphatase (ALP), triglyceride (TG), high density lipoprotein (HDL), and low density lipoprotein (LDL) were measured and the results are presented in the table below. The results indicate that modified oligonucleotides had no effect on liver function outside the expected range for modified oligonucleotides. Specifically, treatment with ION 1198440 was well tolerated in terms of the liver function in monkeys.

TABLE 136
Liver/Kidney function markers in cynomolgus monkey plasma
ION ALT AST TBIL GGT ALP TG HDL LDL
NO. (IU/L) (IU/L) (mg/dL) (IU/L) (IU/L) (mg/dL) (mg/dL) (mg/dL)
Saline 60 50 0.3 91 1539 34 96 68
 958499 67 73 0.2 67 1449 41 89 46
1076453 53 76 0.2 78 1173 29 98 66
1197270 84 78 0.2 75 1215 31 102 48
1198439 40 65 0.2 63 1298 28 82 59
1198440 45 75 0.2 80 1412 30 104 54
1198605 40 58 0.2 85 1445 25 115 57
1198623 50 47 0.2 59 916 34 87 50
1198728 58 92 0.3 59 1165 24 95 57
1198831 48 63 0.3 65 1096 22 108 63
1198872 48 94 0.3 79 1098 19 114 60

TABLE 137
Liver/Kidney function markers in cynomolgus monkey plasma
ION GLU BUN CREA TP ALB GLO A/G
NO. (mg/dL) (mg/dL) (mg/dL) (g/dL) (g/dL) (g/dL) ratio
Saline 84 25 1.0 7.2 4.2 3.0 1.4
 958499 83 24 0.9 7.2 4.0 3.2 1.3
1076453 89 27 0.9 7.0 3.9 3.1 1.3
1197270 115 27 0.9 6.8 3.7 3.1 1.2
1198439 115 24 0.9 6.8 4.0 2.8 1.4
1198440 91 26 0.9 7.0 4.1 2.9 1.4
1198605 69 22 0.8 6.7 4.0 2.7 1.5
1198623 70 26 0.8 7.2 4.2 3.0 1.4
1198728 95 26 0.9 7.3 4.1 3.2 1.3
1198831 73 26 0.7 6.7 3.9 2.8 1.4
1198872 80 27 0.9 7.1 4.0 3.1 1.3

Pro-Inflammatory Proteins Analysis

To evaluate any inflammatory effect of Ionis oligonucleotides in cynomolgus monkeys, blood samples were taken for analysis. The monkeys were fasted overnight prior to blood collection. On day 42 (pre-dose and 24 hours post-dose), approximately 0.8 mL of blood was collected from each animal and put into tubes without anticoagulant for serum separation. The tubes were kept at room temperature for a minimum of 90 min and then centrifuged at 3,000 rpm for 10 min at room temperature to obtain serum. Complement C3 were measured using a Toshiba 120 FR NEO chemistry analyzer (Toshiba Co., Japan). The results indicate that treatment with ION 1198440 did not cause any inflammation in monkeys. Another marker of inflammation, C-Reactive Protein (CRP) was tested together with the clinical chemistry parameters tested for liver function above.

TABLE 138
Pro-inflammatory protein analysis in cynomolgus monkeys
Complement C3 (mg/dL)
Day 42 day 42 CRP (mg/L)
ION No. (pre-dose) (24 hr post-dose) day 44
Saline 117 106 4.1
958499 112 89 9.9
1076453 101 88 1.5
1197270 103 86 9.8
1198439 99 94 2.9
1198440 95 88 4.8
1198605 105 95 4.2
1198623 105 101 2.0
1198728 93 90 4.0
1198831 81 81 1.1
1198872 103 96 1.1

Hematology

To evaluate any effect of Ionis oligonucleotides in cynomolgus monkeys on hematologic parameters, blood samples of approximately 0.5 mL of blood was collected from each of the available study animals on day 44. The samples were collected in tubes containing K2-EDTA. Samples were analyzed for red blood cell (RBC) count, Hemoglobin (HGB), Hematocrit (HCT), Mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), RBC Distribution Width (RCDW), reticulocyte count (Retic), platelet count (PLT), mean platelet volume (MPV), white blood cells (WBC) count, individual white blood cell counts, such as that of monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), and large unstained cells (LUC) using an ADVIA2120i hematology analyzer (Siemens, USA).

The data indicate the oligonucleotides did not cause any changes in hematologic parameters outside the expected range for modified oligonucleotides at this dose. Specifically, treatment with ION 1198440 was well tolerated in terms of the hematologic parameters of the monkeys.

TABLE 139
Blood cell counts in cynomolgus monkeys
RBC HGB HCT MCV MCH MCHC RCDW Retic PLT
ION NO. (×10{circumflex over ( )}6/μL) (g/dL) (%) (fL) (pg) (g/dL) (%) (%) (103/μL)
Saline 5.8 13 46 79 23 29 13 1.2 334
 958499 5.6 12 43 77 22 29 12 1.5 399
1076453 5.5 13 43 79 23 29 15 1.2 358
1197270 5.6 12 44 79 22 28 12 1.1 452
1198439 6.0 14 48 79 22 28 12 1.2 367
1198440 5.9 14 47 80 23 29 12 1.2 420
1198605 6.1 13 46 75 22 29 13 1.1 385
1198623 5.9 14 46 78 23 30 13 1.0 376
1198728 5.9 14 47 80 23 29 12 1.3 428
1198831 5.6 13 43 76 23 30 12 1.0 377
1198872 5.7 13 44 78 23 30 12 1.2 400

TABLE 140
Blood cell counts in cynomolgus monkeys
ION WBC NEU LYM MON EOS BAS LUC MPV
NO. (×103/μL) (%) (%) (%) (%) (%) (%) (fL)
Saline 9.2 41 55 3.2 1.0 0.3 0.5 8.2
 958499 12.0 49 44 3.5 1.1 0.4 1.2 7.6
1076453 10.0 39 54 3.9 1.1 0.4 1.2 8.4
1197270 10.6 38 54 3.5 2.7 0.4 1.2 7.1
1198439 10.3 27 68 2.9 1.5 0.3 0.6 7.6
1198440 10.9 28 65 3.2 2.8 0.4 0.7 7.5
1198605 10.5 44 51 2.8 0.8 0.4 0.5 8.1
1198623 11.7 43 53 2.0 0.8 0.4 0.7 7.8
1198728 10.7 29 64 2.9 2.2 0.5 0.9 8.0
1198831 7.6 44 50 3.3 2.0 0.3 0.8 7.3
1198872 10.4 64 32 2.2 0.6 0.3 0.5 7.1

Coagulation

To evaluate effect of Ionis modified oligonucleotides on coagulation in cynomolgus monkeys, blood samples of approximately 0.9 mL were collected from each of the available study animals on day 44. The samples were collected in tubes containing 3.2% sodium citrate. Coagulation parameters tested include Activated partial thromboplastin time (APTT), prothrombin time (PT) and Figrinogen (FIB).

The data indicate the modified oligonucleotides did not cause any changes in coagulation parameters outside the expected range for modified oligonucleotides at this dose. Specifically, treatment with ION 1198440 was well tolerated in terms of the coagulation parameters of the monkeys.

TABLE 141
Coagulation Parameters in cynomolgus monkeys
ION PT FIB APTT
No. (sec) (mg/dL) (sec)
Saline 9 229 18
958499 9 275 18
1076453 9 234 20
1197270 10 257 17
1198439 10 246 19
1198440 10 260 20
1198605 9 236 23
1198623 10 229 17
1198728 9 242 18
1198831 10 209 18
1198872 10 206 21

Urine Analysis

Food was removed overnight the day before fresh urine collection, but water was supplied. Fresh urine samples for urinalysis and urine chemistry were collected from all animals using a clean cage pan on wet ice (first in the morning) on day 44. Urinalysis/Urine Chemistry parameters creatinine (UCRE), microprotein (UTP), urine microalbumin (UALB), and protein/creatinine (P/C) ratio were measured using a Toshiba 120FR automated chemistry analyzer (Toshiba Co., Japan). Specifically, treatment with ION 1198440 was well tolerated in terms urine chemistry markers.

TABLE 142
Urinalysis and Urine Chemistry Markers
ION UTP UALB UCRE P/C
NO. (mg/dL) (mg/dL) (mg/dL) ratio
Saline 13 0.5 69 0.3
958499 16 0.1 60 0.3
1076453 14 0.1 50 0.3
1197270 18 1.3 56 0.3
1198439 15 0.1 68 0.2
1198440 13 0.2 53 0.3
1198605 12 0.4 69 0.2
1198623 10 0.2 44 0.2
1198728 16 0.3 70 0.2
1198831 13 0.1 46 0.3
1198872 14 0.3 111 0.2

Example 35: Activity of Modified Oligonucleotides Targeting Human Yap1 in BICR-22 Cells

Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous carcinoma (lymph node m cell line BICR-2. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured BICR-22 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 144
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in BICR-22 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 99 98 98 98
715487 82 45 23 13
1198440 44 14 4 4

Cell Proliferation Assay

Cultured BICR-22 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-GloÂŽ 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 145
Antiproliferative effect of modified
oligonucleotides in BICR-22 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 97 95 82 65
715487 70 56 28 22
1198440 55 37 29 19

Example 36: Activity of Modified Oligonucleotides Targeting Human Yap1 in CAL33 Cells

Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma line CAL33. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured CAL33 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 146
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in CAL33 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 106 106 91 85
715487 81 41 12 6
1198440 43 14 5 5

Cell Proliferation Assay

Cultured CAL33 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-GloÂŽ 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 147
Antiproliferativeeffect of modified oligonucleotides in
CAL33 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 92 93 81 67
715487 89 79 61 37
1198440 84 67 58 44

Example 37: Activity of Modified Oligonucleotides Targeting Human Yap1 in CAL27 Cells

Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma line CAL27. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured CAL27 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 148
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in CAL27 cells
% UTC
ION No. 0.08 ÎźM 0.4 ÎźM 2 ÎźM 10 ÎźM
792169 95 90 97 88
715487 35 23 5 3
1198440 23 6 4 4

Cell Proliferation Assay

Cultured CAL27 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-GloÂŽ 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 149
Antiproliferative effect of modified
oligonucleotides in CAL27 cells
% UTC
ION No. 0.08 ÎźM 0.4 ÎźM 2 ÎźM 10 ÎźM
792169 96 102 103 90
715487 95 85 67 33
1198440 86 85 83 51

Example 38: Activity of Modified Oligonucleotides Targeting Human Yap1 in Detroit-562 Cells

Modified oligonucleotides described in the studies above were tested at various doses in pharynx carcinoma cell line Detroit-562. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured Detroit-562 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 150
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in Detroit-562 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 102 102 94 99
715487 77 29 10 5
1198440 32 8 3 2

Cell Proliferation Assay

Cultured Detroit-562 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-GloÂŽ 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 151
Antiproliferative effect of modified
oligonucleotides in Dctroit-562 cells
%UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 99 106 100 79
715487 92 84 71 52
1198440 84 67 59 45

Example 39: Activity of Modified Oligonucleotides Targeting Human Yap1 in SCC-4 Cells

Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma cell line SCC-4. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured SCC-4 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 152
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in SCC-4 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 92 106 105 104
715487 81 46 23 13
1198440 63 27 11 5

Cell Proliferation Assay

Cultured SCC-4 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-GloÂŽ 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 153
Antiproliferative effect of modified oligonucleotides in
SCC-4 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 125 169 142 136
715487 158 121 106 69
1198440 82 60 21 11

Example 40: Activity of Modified Oligonucleotides Targeting Human Yap1 in SCC-9 Cells

Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma cell line SCC-9. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured SCC-9 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 154
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in SCC-9 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 86 94 96 101
715487 74 44 21 11
1198440 53 18 6 2

Cell Proliferation Assay

Cultured SCC-9 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-GloÂŽ 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 155
Antiproliferative effect of modified
oligonucleotides in SCC-9 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 104 111 102 94
715487 97 73 51 34
1198440 88 46 35 31

Example 41: Activity of Modified Oligonucleotides Targeting Human Yap1 in SCC-15 Cells

Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma cell line SCC-15. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured SCC-15 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 156
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in SCC-15 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 91 100 102 105
715487 69 33 12 5
1198440 39 10 4 2

Cell Proliferation Assay

Cultured SCC-15 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-GloÂŽ 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 157
Antiproliferative effect of modified
oligonucleotides in SCC-15 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 93 92 89 71
715487 87 66 47 28
1198440 72 54 42 32

Example 42: Activity of Modified Oligonucleotides Targeting Human Yap1 in SCC-25 Cells

Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma cell line SCC-25. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured SCC-25 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 158
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in SCC-25 cells
% UTC
ION No. 0.08 ÎźM 0.4 ÎźM 2 ÎźM 10 ÎźM
792169 87 87 89 86
715487 70 32 16 11
1198440 32 12 8 7

Cell Proliferation Assay

Cultured SCC-25 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-GloÂŽ 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 159
Antiproliferative effect of
modified oligonucleotides in SCC-25 cells
% UTC
ION No. 0.08 ÎźM 0.4 ÎźM 2 ÎźM 10 ÎźM
792169 97 101 96 92
715487 82 48 25 15
1198440 56 27 20 16

Example 43: Activity of Modified Oligonucleotides Targeting Human Yap1 in SNU-899 Cells

Modified oligonucleotides described in the studies above were tested at various doses in laryngeal squamous cell carcinoma cell line SN-899. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured SNU-899 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 160
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-899 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 106 106 111 102
715487 62 26 9 4
1198440 35 12 3 2

Cell Proliferation Assay

Cultured SNU-899 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-GloÂŽ 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 161
Antiproliferative effect of modified
oligonucleotides in SNU-899 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 90 94 96 86
715487 82 78 71 62
1198440 82 75 69 66

Example 44: Activity of Modified Oligonucleotides Targeting Human Yap1 in SNU-1066 Cells

Modified oligonucleotides described in the studies above were tested at various doses in laryngeal squamous cell carcinoma line SNU-1066. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured SNU-1066 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 162
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in SNU-1066 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 91 94 93 98
715487 77 49 22 7
1198440 70 28 7 2

Cell Proliferation Assay

Cultured SNU-1066 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-GloÂŽ 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 163
Antiproliferative effect of modified
oligonucleotides in SNU-1066 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 100 104 102 96
715487 97 86 72 47
1198440 89 66 58 43

Example 45: Activity of Modified Oligonucleotides Targeting Human Yap1 in SNU-1076 Cells

Modified oligonucleotides described in the studies above were tested at various doses in upper aerodigestive tract/laryngeal squamous cell carcinoma line SNU-1076. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured SNU-1076 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 164
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in SNU-1076 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 89 98 102 107
715487 89 67 31 11
1198440 83 43 11 3

Cell Proliferation Assay

Cultured SNU-1076 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-GloÂŽ 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 165
Antiproliferative effect of modified
oligonucleotides in SNU-1076 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 97 104 106 108
715487 91 90 86 79
1198440 99 87 81 81

Example 46: Activity of Modified Oligonucleotides Targeting Human Yap1 in SNU-1214 Cells

Modified oligonucleotides described in the studies above were tested at various doses in laryngeal squamous cell carcinoma cell line SNU-1214. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured SNU-1214 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 166
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in SNU-1214 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 97 104 106 109
715487 71 36 16 9
1198440 40 11 4 3

Cell Proliferation Assay

Cultured SNU-1214 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-GloÂŽ 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 167
Antiproliferative effect of modified
oligonucleotides in SNU-1214 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 105 90 96 72
715487 93 69 52 38
1198440 84 72 53 49

Example 47: Activity of Modified Oligonucleotides Targeting Human Yap1 in UPCI:SCC090 Cells

Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma cell line UPCI:SCC090. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured UPCI:SCC090 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 168
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in UPCI:SCC090 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 100 108 112 84
715487 70 37 26 14
1198440 60 26 10 5

Cell Proliferation Assay

Cultured UPCI:SCC090 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-GloÂŽ 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 169
Antiproliferative
effect of modified oligonucleotides in UPCI:SCC090 cells
% UTC
ION No. 0.04 ÎźM 0.2 ÎźM 1 ÎźM 5 ÎźM
792169 100 104 99 93
715487 92 94 72 68
1198440 101 92 75 70

Example 30: Activity of Modified Oligonucleotides Targeting Human Yap1 in a Human Hepatocellular

carcinoma SNU449 xenograft tumor model (alone and in combination with sorafenib) Modified oligonucleotides described in the studies above were tested in a hepatocellular carcinoma SNU449 xenograft tumor model. In addition to testing the modified oligonucleotide by itself, combination therapy with sorafenib was also tested. A control oligonucleotide 792169, described herein above, was also tested.

Five million SNU449 cells in 30% matrigel were implanted subcutaneously into the fatpads of female NOD.Cg-Prkdcscid II2rgtm1Wjl/SzJ mice (from Jackson Laboratory) at 4-6 weeks of age. 43 days post implantation (when tumors had reached approximately 100 mm3 in size), groups of eight mice each were administered with 50 mg/kg modified oligonucleotide daily for 10 days (loading dose), following which they were administered with 50 mg/kg modified oligonucleotide four times a week for one week, following which they were dosed with 50 mg/kg modified oligonucleotide thrice weekly until the end of the study. Another group of 8 animals was treated with 30 mg/kg of sorafenib orally 7 times a week until end of study. A final group of 8 animals were treated with a combination of 30 mg/kg of sorafenib orally 7 times a week for 11 weeks and 50 mg/kg of modified oligonucleotide 1198440 at 50 mg/kg 5 times a week for 3 weeks, 4 times a week for the following week, then 3 times a week for the duration of the study (7 weeks). Animals were sacrificed, and tumors were collected on day 119 post implantation.

Measurement of RNA

Yap1 mRNA knockdown in tumors was measured by RT-qPCR as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated animals (% control).

TABLE 127
Yap1 mRNA levels in tumors
%
Ion No. control
PBS 100
 792169 90
1198440 34
Sorafenib 103
1198440 + Sorafenib 42

Measurement of Tumor Volume

Tumor volumes were also measured at the indicated days in the table below. Treatment with ION No. 1198440 led to significant reduction in tumor volume. In addition, combination treatment of ION No. 1198440 with sorafenib led to further reduction in tumor volume.

TABLE 128
Tumor volume (mm3)
Days Post Average Tumor Volume (mm3)
Tumor 1198440 +
Implantation PBS 792169 1198440 sorafenib sorafenib
43 111 111 111 112 111
46 175 162 152 145 162
50 208 180 168 159 162
53 252 247 201 173 210
57 292 280 242 200 224
60 362 317 263 234 258
64 396 397 338 217 210
67 438 466 376 277 250
71 463 519 373 249 241
75 570 559 401 283 279
78 597 634 429 322 296
81 657 681 514 391 400
85 760 785 606 416 380
88 786 889 613 451 413
92 955 1170  690 508 421
94 1048 1215  773 581 495
98 1114 1355  804 625 525
101 1175 1417  818 685 541
105 1252 1509  894 671 495
108 1284 1571  921 663 470
119 1431 1697* 978 747 584
*Average of 7 samples

Measurement of ERK Activation

Sorafenib is a RAF inhibitor used for treatment of several cancers including hepatocellular carcinoma. However, it leads to ERK activation in HCCs, which impacts therapeutic efficacy (Chen Y., et al., Overcoming sorafenib evasion in hepatocellular carcinoma using CXCR4-targeted nanoparticles to co-deliver MEK-inhibitors, Sci Rep. 2017; 7: 44123).

The effect of modified oligonucleotide in mitigating the ERK1/2 activation mediated by sorafenib was tested. Protein analysis was carried out using standard procedures. The primary antibody against Erkl/2 was rabbit mAb 4695, Cell Signaling Technology, and against pERK1/2 was rabbit anti-phospho p44/42 antibody 9101, Cell Signaling Technology. ERK protein levels were compared to internal control GAPDH. GAPDH levels were measured using rabbit mAb 5174, Cell Signaling Technology as the primary antibody. The secondary antibody used was donkey anti-rabbit NA934, GE Healthcare. pERK/ERK levels were calculated relative to PBS control to determine % activation of ERK1/2. Combination therapy of ION No. 1198440 with sorafenib led to a significant decrease in ERK1/2 activation mediated by sorafenib treatment alone.

TABLE 129
Tumor volume (mm3)
%
activation
Ion No. of ERK1/2
PBS 100
 792169 100
1198440 88
Sorafenib 142
1198440 + Sorafenib 68

Example 48: Activity of Modified Oligonucleotides Targeting Human Yap1 in Combination with Sorafenib in SNU449 Cells

Modified oligonucleotides described in the studies above were tested at various doses in hepatocellular carcinoma cell line SNU449. ION No. 792169, described herein above, was used as a control modified oligonucleotide. ION No. 715487 was used to target Yap1 RNA. Cultured SNU449 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below in combination with sorafenib diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured.

Measurement of RNA

Yap1 mRNA knockdown in tumors was measured by RT-qPCR as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated cells (% control).

TABLE 170
Yap1 mRNA levels
SORAFENIB YAP1 mRNA (% control)
CONCENTRATION 715487 at 715487 715487 715487 792169 at 792169 792169 792169
(uM) 0.04 uM at 0.2 uM at 1 uM at 5 uM 0.04 uM at 0.2 uM at 1 uM at 5 uM
0 98 54 30 9 115 113 103 103
0.37 97 51 23 8 97 96 99 104
1.11 77 44 22 7 100 97 93 95
3.33 83 45 21 7 99 91 92 97
10 78 46 20 8 102 94 93 97

Cell Proliferation Assay

SNU449 plated at 1000 cells/well were treated with a combination of modified oligonucleotide and sorafenib at concentrations outlined in the table below. 144 hours post treatment, proliferation of SNU449 cells was measured using the luminescent cell viability CellTiter-GloÂŽ 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 171
Antiproliferative effect of modified oligonucleotides in SNU449 cells
SORAFENIB % UTC
CONCENTRATION 715487 at 715487 715487 715487 792169 at 792169 792169 792169
(uM) 0.04 uM at 0.2 uM at 1 uM at 5 uM 0.04 uM at 0.2 uM at 1 uM at 5 uM
0 98 93 84 64 99 97 97 86
0.37 102 94 83 64 103 100 95 84
1.11 93 77 45 23 97 91 89 68
3.33 27 12 5 3 51 30 27 6
10 2 2 1 1 3 4 3 1

Example 49: Activity of Modified Oligonucleotides Targeting Human Yap1 in Combination with Îą-PD1 Antibody in DEN-HCC Model

The DEN model is a chemically induced model of hepatocellular carcinoma (HCC). N-nitrosodiethylamine (DEN) is administered at 25 mg/kg into 15 day old C57/BL6 mice. Carcinomas form 6 months post injection. After formation, carcinomas were then dissected from the liver and passaged subcutaneously into C57BL/6 male mice at 4-6 weeks of age to establish a subcutaneous model. For this experiment, mice were passaged with P8 subcutaneously established DEN carcinomas, rendering P9 for the duration of the experiment. Subcutaneous carcinomas are found to form at 4-6 weeks post implantation. Modified oligonucleotides 792169 (control compound) and 715491 (YAP-1 targeting modified oligonucleotide) were treated subcutaneously into groups of 7-8 mice at 10 mg/kg/week 5 times a week for 11 weeks (total of 55 doses). The PBS-only treated group and the control group were treated 5 times a week for 4 weeks (total of 20 doses). Îą-PD1 antibody (BioXCell) was treated intraperitoneally at 10 mg/kg/week twice a week for 4 weeks (total of 8 doses). Tumor volume was measured over the time points indicated in the table below. F.D. refers to mice that were sacrificed because their tumor volume became too large. As shown in the table below, mice administered PBS, 792169 (control compound), or Îą-PD1 antibody were sacrificed before the end of the experiment because their tumor volume became too large.

TABLE 172
Tumor volume (mm3)
Average Tumor Volume (mm3)
Days on 715491 +
treatment PBS 792169 715491 Îą-PD1 Îą-PD1
1 373 354 356 546 455
5 553 376 417 673 475
8 688 414 463 782 558
11 729 523 461 910 525
15 856 604 523 911 529
18 968 633 526 1127 524
23 1220 773 658 1134 508
25 1337 864 659 1252 513
28 1355 802 661 1412 489
31 F.D. F.D. 740 F.D. 516
35 F.D. F.D. 798 F.D. 519
38 F.D. F.D. 741 F.D. 491
43 F.D. F.D. 723 F.D. 440
45 F.D. F.D. 741 F.D. 457
49 F.D. F.D. 765 F.D. 474
54 F.D. F.D. 780 F.D. 552
58 F.D. F.D. 852 F.D. 544
61 F.D. F.D. 925 F.D. 592
65 F.D. F.D. 896 F.D. 590
68 F.D. F.D. 940 F.D. 604
72 F.D. F.D. 953 F.D. 577
75 F.D. F.D. 985 F.D. 675
79 F.D. F.D. 960 F.D. 590

Claims

1.-8. (canceled)

9. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence selected from the group consisting of SEQ ID NOs: 810, 1404, 2868, 2864, 286-5-1-494-1101, 2812, 1200, and 2863.

10.-16. (canceled)

17. A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of a nucleobase sequence selected from the group consisting of SEQ ID NOs: 810, 1404, 2868, 2864, 286-1-404, 1101, 2812, 1200, or 2863.

18. The compound of claim 17, wherein at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage, at least one sugar of the modified oligonucleotide is a modified sugar, or at least one nucleobase of the modified oligonucleotide is a modified nucleobase.

19. The compound of claim 18, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

20. The compound of claim 18, wherein the modified sugar is a bicyclic sugar.

21. The compound of claim 20, wherein the bicyclic sugar is selected from the group consisting of: 4′-(CH2)—O—2′ (LNA); 4′-(CH2)2—O—2′ (ENA); and 4′-CH(CH3)—O—2′ (cEt).

22. The compound of claim 18, wherein the modified sugar is 2′-O-methoxyethyl.

23. The compound of claim 18, wherein the modified nucleobase is 5-methylcytosine.

24. The compound of claim 17, wherein the modified oligonucleotide has:

a gap segment consisting of linked 2′-deoxynucleosides;

a 5′ wing segment consisting of linked nucleosides; and

a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

25.-37. (canceled)

38. A compound consisting of a pharmaceutically acceptable salt of the compound of claim 17.

39. The compound of claim 38, wherein the pharmaceutically acceptable salt is a sodium salt.

40. The compound of claim 38, wherein the pharmaceutically acceptable salt is a potassium salt.

41. (canceled)

42. (canceled)

43. (canceled)

44. A composition comprising the compound of claim 17 and a pharmaceutically acceptable diluent or carrier.

45. A composition comprising the compound of claim 17 and water.

46. (canceled)

47. A combination comprising the compound of claim 17 and a secondary agent.

48. The combination of claim 47, wherein the secondary agent is a CDK4/6 inhibitor.

49. (canceled)

50. The combination of claim 47, wherein the secondary agent is an EGFR inhibitor.

51. (canceled)

52. The combination of claim 47, wherein the secondary agent is a kinase inhibitor.

53.-64. (canceled)

65. A method of inhibiting expression of YAP1 in a cell comprising contacting the cell with a compound of claim 17, thereby inhibiting expression of YAP1 in the cell.

66. The method of claim 65, wherein the cell a cancer cell.

67.-99. (canceled)

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: