US20220403391A1
2022-12-22
17/629,627
2020-07-27
Engineered multispecific antigen binding molecules are provided which contain two or more different aptamer moieties joined by a linker. The antigen binding molecules are capable of specifically binding to one or more antigens and bridging different cell types, such as immune cells and cancer cells. The linked aptamers can be used to modulate and enhance immune function.
Get notified when new applications in this technology area are published.
C12N15/115 » CPC main
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
A61P35/00 » CPC further
Antineoplastic agents
This application claims priority to U.S. Provisional Application No. 62/879,413, filed 26 Jul. 2019; and to U.S. Provisional Application No. 62/879,401, filed 26 Jul. 2019; and to PCT Application No. PCT/IB2019/000890, filed 26 Jul. 2019; and to PCT Application No. PCT/US2020/43778, filed 27 Jul. 2020. Each of the aforementioned applications is hereby incorporated by reference in its entirety.
Aptamers are synthetic single strand (ss) DNA or RNA molecules that form specific secondary and tertiary structures. They can specifically bind to native folded proteins, toxins or other cellular targets with high affinity and specificity. They are non-immunogenic but like antibodies, aptamers can activate or inhibit receptor functions. Their small size, stability, cost-effective and highly controlled chemical synthesis make aptamers attractive therapeutic agents. As such, aptamers are regarded as promising synthetic alternatives to monoclonal antibodies for both diagnostic and therapeutic purposes
Multispecific aptamers are two or more aptamers linked together and designed to specifically bind different epitopes with high affinity and specificity. The multimeric specificity opens up a wide range of research, diagnostic, and clinical applications, including redirecting cells to another cells type (e.g., T-cell or NK cell to a tumor cell), blocking two different signaling pathways simultaneously, dual targeting of different disease mediators, and delivering payloads to specific cells. In such uses, precise targeting and in some cases the ability to affect specific cellular function is an important determinant of successful research, diagnostic and therapeutic uses.
Provided herein is an engineered antigen binding molecule, comprising two or more different aptamer moieties linked together and capable of specifically binding to one or more cancer cell antigens and one or more immune effector cell antigens.
An aspect of the invention is a method for linking aptamers of interest together. In some embodiments, this can be achieved via click chemistry. In some embodiments the length of the linker, the flexibility or mobility the linker confers to the targeting moieties, as well as the type of linker can affect immune effector cell function or interfere with the targeting aptamer moieties affecting affinity, specificity, and or conformation. In some embodiments the selection of linker can affect the pharmacokinetic and pharmacodynamic properties of the multispecific aptamer. In some embodiments the selection of linker can affect activity and safety (e.g., immunogenicity). In some embodiments, the antigen binding moiety of the multispecific aptamer can recognize with high affinity and specificity specific antigens.
Another aspect of the invention is a multispecific antigen molecule containing two or more linked aptamers having different target binding specificities. In some embodiments, the multispecific aptamer can bind and bring within proximity cells expressing the targeted antigens.
In some embodiments, the multispecific aptamer allows for an immune effector cell to be redirected to a cancer cell. In turn the binding of the engineered multispecific aptamer to the respective targeted epitopes allows for an immune effector cell to become activated and exert unaltered its anti-cancer killing function.
In some embodiments, the antigen binding moiety of the multispecific aptamer can redirect immune effector T-cells expressing CD3, CD8, CD4, or other T-cell specific antigens to other cellular targets of interest such as CD19, epithelial cell adhesion molecule, CD20, CD22, CD123, BCMA, B7H3, CEA, PSMA, Her2, CD33, CD38, DLL3, EGF-R, MHC class I-related protein MR1 or Mesothelin.
In some embodiments, the antigen binding moiety of the multispecific aptamer can redirect an immune effector NK cell such as via a CD16A, NKG2D, or other NK-cell specific antigen to other cellular targets of interest such as CD30, CD19, Epithelial cell adhesion molecule, CD20, CD22, CD123, BCMA, B7H3, CEA, PSMA, Her2, CD33, CD38, DLL3, EGF-R, MHC class I-related protein MR1 or Mesothelin.
In some embodiments, the multispecific aptamer can engage conditional costimulatory or immune checkpoints by simultaneous targeting of two immunomodulating targets, resulting in blockade of an inhibitory target, depletion of suppressive cells, or activation of effector cells (e.g., involving targets such as PD-1, PD-L1, CTLA04, Lag-3, TIM-3, or OX40) and tumor microenvironment (TME) regulators such as CD47 or VEGF.
In some embodiments, the multispecific aptamer can target one or more tumor associated antigens such as PRAME, NY-ESO-1, MAGE A4, MAGE A3/A6, MAGE A10, AFP.
In some embodiments, the multispecific aptamer can target antigens involved in an inflammatory or autoimmune disease, cardiometabolic disease, respiratory disease, ophthalmic disease, neurologic disease, or infectious disease.
In some embodiments, the multispecific aptamer is capable of activating and stimulating immune effector cells to kill cells expressing specific targeted antigens.
In some embodiments, the multispecific aptamer binds to but does not activate target cells to which it binds, such as immune effector cells, but merely serves as a bridge between two targets, such as between an immune effector cell and a cancer cell.
In some embodiments, the multispecific aptamer can be a drug product used in the prevention, treatment or amelioration a proliferative disease, a tumorous disease, an inflammatory disease, an immunological disorder, an autoimmune disease, an infectious disease, viral disease, allergic reactions, parasitic reactions, graft-versus-host diseases or host-versus-graft diseases in a subject in the need thereof, metabolic disease, neurologic disease, ophthalmic diseases.
In some embodiments, the multispecific aptamer can be a delivery system (e.g., gene therapy applications).
In some embodiments the multispecific aptamer can be used in diagnostic applications.
In some embodiments, the multispecific aptamer can be used in purification systems.
In some embodiments, the multispecific aptamer can be used in cell selection or enrichments applications.
The present technology also can be summarized in the following list of features.
1. An aptamer-based multispecific antigen binding molecule comprising 1) two or more target binding aptamer regions having binding specificities for different targets, and 2) one or more linkers connecting the aptamer regions.
2. The aptamer-based multispecific antigen binding molecule of feature 1, wherein the linker comprises comprises or consists of a linker moiety selected from the group consisting of a covalent bond, a single-stranded nucleic acid, a double-stranded nucleic acid, self-assembling complementary oligonucleotides, a peptide, a polypeptide, an oligosaccharide, a polysaccharide, a synthetic polymer, a hydrazone, a thioether, an ester, a triazole, a nanoparticle, a micelle, a liposome, a cell, a click chemistry product and combinations thereof.
3. The aptamer-based multispecific antigen binding molecule of feature 1 or feature 2 that can bind to specific targets on one or more of human cells, immune cells, cancer cells, genetically modified cells, bacteria, or viruses.
4. The aptamer-based multispecific antigen binding molecule of any of the preceding features that can redirect the binding of one cell type from one target cell to another target cell.
5. The aptamer-based multispecific antigen binding molecule of any of the preceding features that can form a bridge between an immune cell and a cancer cell.
6. The aptamer-based multispecific antigen binding molecule of any of the preceding features that can stimulate and activate an immune cell.
7. The aptamer-based multispecific antigen binding molecule of feature 6, wherein the immune cell is a T-cell, NK-cell, or macrophage, and said binding leads to destruction of a target cell bound to a target binding aptamer of the aptamer based multispecific antigen binding molecule.
8. The aptamer-based multispecific antigen binding molecule of any of the previous features, wherein the molecule possesses a binding specificity for an antigen selected from the group consisting of CD3, CD8, CD4, CD19, Epithelial cell adhesion molecule, CD20, CD22, CD123, BCMA, B7H3, CEA, PSMA, Her2, CD33, CD38, DLL3, EGF-R, NKG2D ligands, MHC class I-related protein MR1, mesothelin, PD-1, PD-L1, CTLA04, Lag-3, TIM-3, OX40, CD47, VEGF, PRAME, NY-ESO-1, MAGE A4, MAGE A3/A6, MAGE A10, and AFP.
9. The aptamer-based multispecific antigen binding molecule of feature 3, wherein the molecule binds to an immune cell expressing CD3 antigen.
10. The aptamer-based multispecific antigen binding molecule of feature 1, wherein the molecule binds PSMA antigen on a cancer cell.
11. The aptamer-based multispecific antigen binding molecule of feature 1 comprising one or more CD3 antigen binding region that can bind to a T-cell and one or more PSMA antigen binding region that can bind to a PSMA expressing cell, wherein the CD3 antigen binding region and the PMSA antigen binding region are connected by one or more linkers.
12. Use of the aptamer-based multispecific antigen binding molecule of feature 11 in the treatment of a PSMA expressing cancer including prostate cancer.
FIG. 1 shows schematic representations of several embodiments of multispecific aptamers of the present technology.
FIG. 2 shows a scheme for a click chemistry reaction to link aptamers.
FIGS. 3A and 3B show binding of anti-PSMA (3A) and anti-CD3 (3B) aptamers to cells that do and do not express the respective antigens.
FIGS. 4A and 4B show agarose gels of monomeric and dimeric (bispecific) aptamers.
FIG. 5 shows the time course (half-life) of an RNA aptamer in serum.
FIGS. 6A and 6B show the binding affinities of bispecific aptamers to PSMA-positive and negative cells.
FIGS. 7A and 7B show the binding affinities of bispecific aptamers to CD3-positive and negative cells.
FIG. 8 shows the cytotoxicity of bispecific aptamers towards PSMA-positive cells.
The linking moiety of an aptamer based multimeric binding molecule can be simply one or more covalent bonds between individual aptamers or can be a synthetic or naturally occurring polymer such as a hydrocarbon, polyether, polyamine, polyamide, hydrazone, thioether, ester, triazaole, nucleic acid, peptide, carbohydrate, or lipid. In certain embodiments, the linking moiety is not a peptide. In certain embodiments, the aptamer based multispecific molecule is devoid of peptides, and is devoid of polypeptides and proteins. The linking moiety also can take the form of a nanoscale structure (such as a polymer, protein, nanoparticle, nanotube, nanocrystal, nanowire, nanoribbon, nanocrystal, micelle, or liposome), or a microscale structure (such as a microbead or a cell), or a larger structure (such as a solid support). Preferably, the linking moiety is a biodegradable polymer. The linking moiety can be a polymer that is linear, branched, cyclic, or a combination of these structures. The linking moiety can also serve as the backbone for a dendrimeric structure, or a hub or star-shaped structure (such as a core structure to which two or more aptamers are bound). For non-covalent association, two or more individual aptamers can be bound via non-covalent interactions either directly between the aptamers or through interaction with a linking moiety. The non-covalent interactions can be, for example, one or more hydrogen bonds, ionic bonds, hydrophobic bonds, van der Waals interactions, or a combination thereof. High affinity binding pairs, such as streptavidin-biotin, can be used to non-covalently link aptamers in an aptamer based multimeric binding molecule.
A linker or linking moiety can be any chemical moiety that covalently or non-covalently joins monomeric aptamer units together. The linker can include or consist of, for example, oligonucleotides, polynucleotides, peptides, polypeptides, or carbohydrates. The linker can include or consist of a cell receptor, a ligand, or a lipid. The linker can include or consist of a hydrocarbon chain or polymer such as a substituted or unsubstituted alkyl chain or ring structure, a polyethylene glycol polymer, or a modified or unmodified oligonucleotide or polynucleotide. The linker can be a single covalent bond, or can include one or more ionic bonds, hydrogen bonds, hydrophobic bonds, or van der Waals interactions. The linker can include a disulfide-bridge, a heparin or heparan sulfate-derived oligosaccharide (a glycosoaminoglycan), a chemical cross-linker, hydrazone, thioether, ester, or triazole. The linker can be cleavable by an enzyme, allowing for release of individual apttamers and/or termination of a target-target interaction by the interaction by the aptamer based multispecific molecule. The linker can have a net positive, negative, or neutral charge. The linker can be as flexible or as rigid as desired to ensure preservation of the functional properties of the individual monomeric aptamer units in a multimeric construct and to promote binding to the first target and the second target, or to promote their interaction. The linker can include a flexible portion, such as a polymer of 5-20 glycine and/or serine residues. The linker can also contain a rigid, defined structure, such as a polymer of glutamate, alanine, lysine, and/or leucine. The linker can include a hinge portion or a spacer portion. The linker can include a substituted or unsubstituted C2-C50 chain or ring structure, a polyethylene glycol polymer (e.g., hexaethyleneglycol), or a modified or unmodified oligonucleotide or polynucleotide. The linker can include a heparin or heparan sulfate-derived oligosaccharide (a glycosoaminoglycan), a chemical cross-linker, peptide, polypeptide, hydrazone, thioether, or ester.
A C2-C50 linker can include a backbone of 2 to 50 carbon atoms (saturated or unsaturated, straight chain, branched, or cyclic), 0 to 10 aryl groups, 0 to 10 heteroaryl groups, and 0 to 10 heterocyclic groups, optionally containing an ether linkage, (e.g., one or more alkylene glycol units, including but not limited to one or more ethylene glycol units âOâ(CH2CH2O)â; one or more 1,3-propane diol units; an amine, an amide; or a thioether. Each backbone carbon atom can be independently unsubstituted (i.e., comprising only âH substituents) or can be substituted with one or more groups selected from C1 to C3 alkyl, âOH, âNH2, âSH, âOâ(C1 to C6 alkyl), âSâ(C1 to C6 alkyl), halogen, âOC(O)(C1 to C6 alkyl), and âNHâ(C1 to C6 alkyl). In some embodiments, the linker is a C2-C20 linker, a C2-C10 linker, a C2-C8 linker, a C2-C6 linker, a C2-C5 linker, a C2-C4 linker, or a C3 linker, wherein each carbon may be independently substituted as described above.
In certain embodiments, there is non-covalent bonding between aptamers, mediated for example through ionic bonding, hydrogen bonding, hydrophobic bonding, van der Waals interactions, or a mixture thereof, without any intervening linking moiety joining the individual aptamers. A single multimeric aptamer construct also can use a mixture of covalent bonding, through an intervening linker moiety connecting certain aptamers, and non-covalent bonding, without an intervening linker moiety, at other bonding sites between aptamers.
The linkers optionally can have one or more functionalities. For example, in some embodiments, the linker is sensitive to temperature and/or pH, meaning that the linker either changes conformation or is cleaved at a pre-designed range of temperature and/or pH.
Any suitable method for making or selecting an aptamer to a target can be employed to obtain the component aptamers of an aptamer based multispecific molecule. For example, aptamers can be identified by Systematic Evolution of Ligands by Exponential Enrichment (SELEX). SELEX is described, for example, in U.S. Pat. No. 5,270,163 which is hereby incorporated by reference. Briefly, SELEX starts with a plurality of nucleic acids (i.e., candidate aptamer sequences) containing varied nucleotide sequences which are contacted with a target. Unbound nucleic acids are separated from those that form aptamer-target complexes. The aptamer-target complexes are then dissociated, the nucleic acids are amplified, and the steps of binding, separating, dissociating, and amplifying are repeated through as many cycles as desired to yield a population of aptamers of progressively higher affinity to the target. Cycles of selection and amplification can be repeated until no significant improvement in binding affinity is achieved on further repetitions of the cycle.
The cycles of selection and amplification can be interrupted before a single aptamer is identified. In such cases, a population of aptamers is identified, which can offer significant information regarding the sequence, structure, or motifs that allow binding of the aptamer with a target. Such a population of candidate aptamers also can inform which portions of the aptamer are not critical for target binding. This information can then guide the generation of other aptamers to the same target. The aptamers thus generated can be used as input for a new round of SELEX, potentially yielding aptamers with better binding affinities or other characteristics of interest.
In some embodiments, candidate aptamer sequences are created that contain multimeric aptamer constructs, such as candidate aptamer based multispecific molecules, which are then subjected to further rounds of selection as a multimeric construct. Multimeric candidate aptamer constructs can be made by linking individual candidate aptamer moieties with a linking moiety, and optionally using such constructs as input for one or more rounds of SELEX. In some embodiments, individual aptamers are independently selected via one or more rounds of SELEX, and finally linked together with a linking moiety. Therefore, multimerization of monomeric aptamers as well as of multimeric aptamer constructs can be performed prior to, during, or post SELEX procedures.
The present technology further provides cell redirecting aptamers (e.g., multivalent aptamers), which can be used as aptameric bridges in aptamer-based CAR immunotherapy systems as well as for in vivo or ex vivo genetic modification of cells. The aptameric bridges, cells, kits, and methods of the present technology can be employed in a wide variety of uses, including as immunotherapies for the treatment of cancers (e.g., hematologic or non-hematologic, individual cells or solid tumors), autoimmune diseases (e.g. arthritis, myasthenia gravis, pemphigus), neuroinflammatory diseases, ophthalmic diseases, neurodegenerative diseases (e.g., ALS, Huntington's disease, Alzheimer's disease), neuromuscular diseases (including Duchenne muscular dystrophy, SMA), infectious diseases (e.g., HIV, HSV, HPV, HBV, Ebola, tuberculosis, Cryptococcus), and metabolic diseases (e.g., Type 1 diabetes mellitus). They also can be used to provide diagnostic agents, kits, and methods for use in such immunotherapies, including imaging, analysis of cell trafficking, and research and development of new immunotherapies, as well as to provide prophylaxis when combined with stem cell therapies (e.g., HSCT).
As used herein, âchimeric antigen receptor cellsâ or âCAR cellsâ are genetically modified cells (e.g., T-cells, NK-cells, monocytes, or others), that have been manipulated ex vivo or in vivo to express a single-chain variable domain (scFv) antibody fused, through a stalk or transmembrane domain, to the intracellular domain of a receptor (e.g., CD3-TCR) so as to endow the cell with the ability to recognize and bind one or more specific antigens and activate a cellular immune response (e.g., kill cancer cells or destroy a virus-infected cell).
As used herein, âantigenic lossâ or âantigenic escapeâ can refer to any of several mechanisms of resistance or adaptation to immunotherapy, such as downregulation of a tumor antigen or upregulation of inhibitory ligands (e.g., PD-L1, TIM3, LAG3) which contributes to CAR-T cell failure, failure of a CAR cell to get to its target (e.g., a tumor site), immunity against the antibody portion of a CAR (e.g., T-cell response against the scFv, particularly if it is not fully humanized), CAR-T cell fitness (i.e., diminished potential for memory self-renewal and increased propensity for exhaustion), or antigen splicing or mutation.
A multimeric aptamer or linked aptamer of the present technology contains two or more aptamers covalently or non-covalently bound by a linking moiety. According to an embodiment of the technology, the two or more aptamers can form a CAR-binding portion and a target-binding portion, each of which contains one or more aptamers. The CAR-binding aptamer binds to a CAR expressed in an immune cell, such as a T cell, and in some embodiments activates the immune cell but in other embodiments (e.g., when acting as a âkillâ switch) does not activate the immune cell. The target is an intended target of immunotherapy, i.e., a cell intended for elimination. Thus, the CAR-expressing cell and aptameric bridge are intended for use together as a system in an immunotherapy, such as CAR-T cell therapy. Binding of the aptameric bridge to the CAR as well as to the target is preferably high affinity binding. The target can be a protein (such as a cell-surface receptor protein), a cell, a small molecule, or a nucleic acid. The target is preferably located on the surface of a target cell, such as a cancer cell, and may or may not be found on other cells (normal cells) of the subject.
In some embodiments, the target is a tumor antigen, such as CD19, CD20, CD22, CD30, CD123, BCMA, NY-ESO-1, mesothelin, MHC class I-related protein MR1, PSA, PSMA, MART-1, MART-2, Gp100, tyrosinase, p53, ras, Ftt3, NKG2D ligangs, Lewis-Y, MUC1, SAP-1, survivin, CEA, Ep-CAM, Her2, Her3, EGFRvIII, BRCA1/2, CD70, CD73, CD16A, CD40, VEGF-ι, VEGF, TGF-β, CD32B, CD79B, cMet, PCSK9, IL-4RA, IL-17, IL-23, 4-1BB, LAG-3, CTLA-4, PD-L1, PD-1, OX-40, or mutated SOD. Component aptamers of an aptameric bridge also can specifically bind to combinations of such targets. In some embodiments, the target is an antigen of an infectious agent, such as gag, reverse transcriptase, tat, HIV-1 envelope protein, circumsporozoite protein, HCV nonstructural proteins, hemaglutinins; an aptamer bridge also can specifically bind to combinations of such targets.
In a preferred embodiment, the CAR-binding aptamer or aptamers are selected for specific binding to the extracellular domain of a CAR having affinity for a peptide neo-epitope (PNE), i.e., an anti-PNE CAR. Since the PNE is an epitope that does not exist within the subject's body, immune cells expressing the anti-PNE CAR are not activated by endogenous biomolecules, but await the administration to the subject of the aptameric bridge, which serves as an âonâ switch for the immune cells and targets the CAR-expressing cells toward a desired antigen(s) or cell type(s) bearing the antigen(s). The immune activation and in vivo expansion of the CAR-expressing immune cells can be turned off by administration to the subject of a peptide containing the PNE or of either the CAR-binding aptamer or target-binding aptamer of the bridge in monomeric form, any one of which will terminate the activation of the CAR-expressing immune cells by the target.
The PNE can be any peptide epitope not found in the host's proteome (e.g., not found in the human proteome), for which an anti-PNE CAR can be obtained. An example of a preferred PNE is a peptide fragment of the GCN4 transcription factor from Saccharomyces cerevisiae (NYHLENEVARLKKL, SEQ ID NO:1). A CAR binding GCN4 with high affinity (Kd=5.2 ΟM) and including the 52SR4 single chain antibody is described by Rodgers et al. Further PNEs suitable for use with a CAR and corresponding aptameric bridge include: (i) the N-terminal 15-mer peptide ESQPDPKPDELHKSS (SEQ ID NO:2) of Staphylococcal enterotoxin B, paired with an antibody binding thereto and described in Clin. Vaccine Immunol. 17(11): 1708-1717; (ii) deoxynivalenol, an E. coli mycotoxin, paired with an scFv binding thereto and described at Protein Expr. Purif. 35(1): 84-92; (iii) HPV-16 protein E5, paired with an antibody thereto described at Biomed. Res. Int. 2018; 2018: 5809028; (iv) a rabies virus protein and an scFv binding thereto and described at Protein Expression and Purification 86 (2012) 75-81; (v) an influenza A matrix protein paired with an scFv binding thereto and described at Bioconjugate Chem. 2010, 21, 1134-1141; (vi) amino acids 134-145 (PRVRGLYFPAGG, SEQ ID NO:3) of pre-Ί protein of HBV, paired with an scFv binding thereto and described at Viral Immunol. 2018 May 30; (vii) a VP 3 peptide of duck hepatitis virus type 1, paired with an scFv described at J. of Virological Methods 257 (2018) 73-78; (viii) a peptide (MEESKGYEPP, SEQ ID NO:4) from Glycoprotein D of bovine herpes virus 1 paired with an scFv described at Appl Microbiol Biotechnol. 2017 December; 101(23-24):8331-8344; (ix) a peptide comprising amino acid 159 of VP1 protein of South African Territories 2 (SAT2) foot and mouth virus, paired with an scFv binding thereto and described at Virus Research 167 (2012) 370-379; (x) a peptide (DRTNNQVKA, SEQ ID NO:5) of OmpD from Salmonella typhimurium, paired with an scFv binding thereto and described at Veterinary Microbiology 147 (2011) 162-169; (xi) a peptide of isoferritin from E. coli, paired with an scFv binding thereto and described at Journal of Biotechnology 102 (2003) 177/189; (xii) a peptide (AQEPPRQ, SEQ ID NO:6) located at the N terminus of the grapevine leafroll-associated virus 3 coat protein, paired with an scFv binding thereto an described at Arch. Virol. (2008) 153:1075-1084; (xiii) a peptide (PTDSTDNNQNGGRNGARPKQRRPQ, SEQ ID NO:7) of N protein of SARS-CoV, paired with an scFv binding thereto and described at Acta Biochimica et Biophysica Sinica 2004, 36(8): 541-547; (xiv) a peptide containing amino acids 1-15 of HIV Tat protein, paired with an scFv that binds thereto and is described at J. Virol. 2004 April; 78(7): 3792-3796; and (xv) a peptide from amino acids 1363-1454 of the helicase domain of HCV NS3, paired with an scFv binding thereto and described at J. Hepatology 37 (2002) 660-668, J Virol 1994; 68:4829-4836, and Arch Virol 1997; 142:601-610.
Other examples of universal CARs that can be paired with an aptameric bridge of the present technology are described at J. Autoimmun. 2013 May. 42:105-16; Blood Cancer J. 2016 August, 6(8): e458; Oncotarget. 2017 Dec. 12, 8(65): 108584-108603; Oncotarget 2017 May 9, 8(19): 31368-31385; Oncotarget 2018 Jan. 26, 9(7): 7487-7500; and WO2016030414.
A10 RNA aptamer (SEQ ID NO:8) is a 39 nucleotide-long sequence that has been selected against the human prostate-specific membrane antigen (PSMA) and used as a prostate specific delivery agent for siRNA (McNamara et al. 2006-Dassie et al. 2009).
A number of DNA aptamers (SEQ ID NOS:9-110) and RNA aptamers (SEQ ID NOS:111-116) were developed having high affinity binding for human CD3. CELTIC_1s, CELTIC_19s and CELTIC_core are DNA aptamers (SEQ ID NOS: 54, 63 and 65), and ARACD3-3700006 and ARACD3-0010209 are RNA aptamers (SEQ ID NOS:115 and 111), that have all been selected against human CD3. These DNA or 2â˛-Deoxy-2â˛-fluoro-thymidine-modified RNA (2â˛F-RNA) aptamers were purchased from baseclick (Neuried, Germany) as HPLC-RP purified single stranded oligos synthetized via standard solid phase phosphoramidite chemistry. The anti-CD3 aptamers did not activate cytokine secretion or surface marker expression even when combined with costimulatory anti-CD28 antibody, and unlike anti-CD3 monoclonal antibodies.
Several consensus sequences for anti-CD3 aptamers were developed. According to these consensus sequences, DNA and RNA aptamers having high affinity for human CD3 can include the following consensus sequences or variants thereof:
| 1. | |
| (SEQâIDâNO:â117) | |
| GX1X2TX3GX4X5X6X7X8X9GGX10CTGG, | |
| whereinâX1âisâGâorâA;âX2âandâX6âare | |
| A,âT,âorâG;âX3âisâT,âorâG;âX4âand | |
| X9âareâGâorâC;âX5âisâCâorâT; | |
| X7âisâT,âG,âorâC;âandâX8âandâX10 | |
| areâC,âT,âorâA. | |
| 2. | |
| (SEQâIDâNO:â118) | |
| GGGX1TTGGCX2X3X4GGGX5CTGGC, | |
| whereinâX1âandâX2âareâA,âT,âorâG;âX3 | |
| isâT,âC,âorâG;âX4âandâX5 | |
| areâA,âT,âorâC. | |
| 3. | |
| (SEQâIDâNO:â119) | |
| GX1TTX2GX3X4X5X6CX7GGX8CTGGX9G, | |
| whereinâX1âisâAâorâG;âX2âisâTâorâG; | |
| X3âandâX7,âX9âareâGâorâC;âX4âisâTâorâC; | |
| X5âisâAâorâT;âX6âisâT,âC,âorâG;âX8âis | |
| AâorâC. | |
| 4. | |
| (SEQâIDâNO:â120) | |
| GGGTTTGGCAX1CGGGCCTGGC, | |
| whereinâX1âisâG,âC,âorâT. | |
| 5. | |
| (SEQâIDâNO:â121) | |
| GCAGCGAUUCUX1GUUU, | |
| whereinâX1âisâUâorânoâbase. |
A10 RNA aptamer (SEQ ID NO:8) is a 39 nucleotide-long sequence that has been selected against the human prostate-specific membrane antigen (PSMA) and used as a prostate specific delivery agent for siRNA (McNamara et al. 2006-Dassie et al. 2009).
CELTIC_1s, CELTIC_19s and CELTIC_core are DNA aptamers (SEQ ID NOS: 54, 63 and 65), and ARACD3-3700006 and ARACD3-0010209 are RNA aptamers (SEQ ID NOS:115 and 111), that have all been previously selected against human CD3.
These DNA or 2â˛-deoxy-2â˛-fluoro-thymidine-modified RNA (2â˛F-RNA) aptamers were purchased from baseclick (Neuried, Germany) as HPLC-RP purified single stranded oligos synthetized via standard solid phase phosphoramidite chemistry. The anti-CD3 aptamers did not activate cytokine secretion or surface marker expression even when combined with costimulatory anti-CD28 antibody, and unlike anti-CD3 monoclonal antibodies (data not shown).
A10 aptamer was modified with an azide group at its 3â˛-end for subsequent triazole inter-nucleotide dimerization. Biotin was added to the 5â˛-end of A10 aptamer as a Biotin-TEG that introduces a 16-atom mixed polarity spacer between the aptamer sequence and the biotin flag. A Cy5-labelled version of A10 was also synthetized. CELTIC_1s, CELTIC_19s, CELTIC_core, ARACD3-3700006 and ARACD3-0010209 were modified with an alkyne group at their 5â˛-end for subsequent triazole inter-nucleotide dimerization. Molecular weight, purity and integrity were verified by HPLC-MS. Affinity and specificity of the A10 anti-PSMA RNA aptamer was evaluated on PSMA positive and PSMA negative cells (FIG. 3A). Affinity and specificity of anti-CD3 aptamers were evaluated on CD3 positive and CD3 negative cells (FIG. 3B).
Anti-PSMA A10 and anti-CD3 aptamers were heterodimerized by copper-catalyzed click reaction performed for 60 min at 45° C. with the Oligo2-Click kit L (baseclick, Neuried, Germany) according to manufacturers instructions. Reaction products were separated by gel electrophoresis on 3% agarose gel migrated in 1ĂTBE buffer (Invitrogen) at 100 V during 30 min. The gels were visualized using Bio-Rad imaging system and the results are shown in FIGS. 4A and 4B. Gel slices corresponding to dimeric aptamers were cut out from the gel and nucleic acids were extracted for 72 h at 8° C. by passive elution in 25 mM NaCl-TE buffer. Bispecific aptamer dimers were recovered by standard sodium acetate precipitation, resuspended in sterile water and stored at â20° C. until use.
Stability of A10 RNA aptamer was measured in Dulbecco's phosphate-buffered saline (DPBS) containing 5% FBS or the FBS alone. Biotinylated aptamer was denatured at 85° C. for 5 min and then immediately cooled on ice block to 4° C. for 5 min. The aptamer was then diluted to a final concentration of 2 ÎźM in DPBS supplemented with 5% of FBS or in pure FBS. Samples were incubated at 37° C. for 10 min, 30 min, 1 h, 2 h, 4 h or 24 h; the control sample contained the freshly prepared aptamers without incubation at 37° C. 100 nM streptavidin-PE was then added to each solution and aptamer was incubated with PSMA-positive LNCaP cells (Human Prostate CarcinomaâATCC CRL-1740). The half-life of aptamer A10 in DPBS buffer containing 5% FBS or in pure FBS was then determined using flow cytometry on the YL-1 channel, based on the variation of the fluorescence-positives cells number as a function of the incubation time at 37° C. The results of the measurements are shown in FIG. 5. Aptamer A10 incubated in DPBS buffer containing 5% serum was stable over 24 h. When tested in pure serum, half of the binding activity was lost within the first 2 h of incubation.
The affinity and specificity of anti-PSMAĂanti-CD3 bispecific aptamers to target proteins expressed on cells were evaluated by flow cytometry. These studies were performed on CD3-positive Jurkat (Acute T Cell Leukemia Human Cell LineâATCC TIB-152), CD3-negative Ramos (Burkitt's Lymphoma Human Cell LineâATCC CRL-1596), PSMA-positive LNCaP (Human Prostate CarcinomaâATCC CRL-1740) and PSMA-negative PC-3 (Human Prostate CarcinomaâATCC CRL-1435) cells by incubation with biotinylated RNA/DNA aptamers in SELEX buffer or RNA/RNA aptamers in DPBS buffer, supplemented with 5% of FBS. Cells were cultured in RPMI-1640 medium (Gibco Invitrogen), supplemented with 10% FBS (Gibco Invitrogen) and 1% Penicillin/Steptomycin (Gibco Invitrogen) prior to use. Prior to experiment, Jurkat, Ramos, LNCaP and PC-3 cells (2.5Ă105 cells/well) were seeded in 96-well plates and centrifuged at 2500 rpm for 2 min. The supernatant was discarded, and the pelleted cells were washed twice with 200 ÎźL of SELEX or DPBS-5% FBS buffer preheated at 37° C. Each washing step was followed by centrifugation at 2500 rpm for 2 min. Aptamers were denatured at 85° C. for 5 min and immediately placed on ice block of 4° C. for 5 min. Test samples were subsequently diluted at two different concentration ranges: 3, 10, 30, 100 and 300 nM (CD3 binding assays) and 30, 100 and 300 nM (PSMA binding assays) followed by addition of 100 nM phycoerythrin-labelled streptavidin (streptavidin-PE, eBioscience) to each solution. Jurkat, Ramos, LNCaP and PC-3 cells were resuspended in the aptamer dilutions (100 ÎźL/well) and incubated at 37° C. for 30 min in a 5% CO2 humidified atmosphere. As controls, cells were incubated with CD3 monoclonal antibodies (PE-labelled, OKT3 human anti-CD3, Invitrogen), PSMA monoclonal antibodies (Alexa Fluor 488-labelled, GCP-05 human anti-PSMA, Invitrogen), PE-streptavidin, monomeric aptamers or the respective buffers without additional reagents. After incubation, cells were centrifuged at 2500 rpm for 2 min and the supernatant with unbound sequences was discarded. The pelleted cells were washed with SELEX or DPBS-5% FBS buffer (200 ÎźL/well) and centrifuged twice in order to remove all weakly and non-specifically attached sequences. The cells were then washed with 1 mg/mL salmon sperm DNA solution (100 ÎźL/well) at 37° C. in a 5% CO2 humidified atmosphere. After 30 min, the salmon sperm solution was removed by centrifugation at 2500 rpm for 2 min and the cells were additionally washed twice with SELEX or DPBS-5% buffer (200 ÎźL/well) followed by centrifugation. Jurkat, Ramos, LNCaP and PC-3 cells with attached DNA or RNA sequences were then fixed (BD CellFIX solution #340181) and the fluorescence-positive cells were counted by flow cytometry (AttuneNXT; Invitrogen, Inc.) on the YL-1 channel.
The results of the binding studies to PSMA-positive cells are shown in FIGS. 6A and 6B. Three RNA/DNA aptamers (A10ĂCELTIC_1s, A10ĂCELTIC_19s, A10ĂCELTIC_core) and two RNA/RNA aptamers (A10ĂARACD3-3700006 and A10ĂARACD3-0010209) were analyzed along with A10 monomeric aptamer. For comparison, binding of the tested reagents to PSMA-negative PC-3 cells was also measured. A dose-dependent binding to PSMA-positive LNCaP cells was observed with A10 without reaching saturation of the signal at the highest tested concentrations. Intensity of the signal was as strong as for the antibody control. Residual binding of A10 monomer to PC-3 cells was only observed at the highest tested concentration. All bispecific PSMAĂCD3 aptamers exhibited similar binding properties to A10 monomer but with an improved specificity for target-positive cells as residual binding to PSMA-negative cells was reduced. For each tested concentration, signal intensity of bispecific aptamers was superior to the one measured for A10 monomer, suggesting that heterodimerization resulted in an improvement of the affinity.
In another experiment, binding of the same aptamers to CD3-positive Jurkat and CD-3 negative Ramos cells was investigated. See FIGS. 7A and 7B. As expected A10 aptamer did not bind to these two cell lines. Residual binding of anti-CD3 monomers to Ramos cells was only observed at the highest tested concentration. All bispecific PSMAĂCD3 aptamers exhibited similar dose-dependent binding but with superior specificity for target-positive cells as residual binding to CD3-negative cells was strongly reduced. For each tested concentration, signal intensity of bispecific aptamers was inferior to the one measured for anti-CD3 monomers, suggesting that heterodimerization resulted in the lowering of the affinity.
Altogether, these results suggest that after heterodimerization the binding properties of aptamers selected against different targets are not destroyed due to steric hindrance when evaluated separately. Depending on the selected partners, specificity and affinity for respective targets may even be improved upon dimerization.
Binding affinity measurements are performed using a BIAcore T200 instrument (GE Healthcare). To analyze interactions between aptamers and CD3 and PSMA proteins, 300 Resonance Units of biotinylated aptamers are immobilized on Series S Sensor chips SA (GE Healthcare) according to manufacturer's instructions (GE Healthcare). DPBS buffer is used as the running buffer. The interactions are measured in the âSingle Kinetics Cycleâ mode at a flow rate of 30 Îźl/min and by injecting different concentrations of human CD3 Îľ/Îł, CD3 Îľ/δ, IgG1 Fc and PSMA (Acro Biosystems). The highest aptamer concentration used is 300 nM. Other concentrations are obtained by 3-fold dilution. All kinetic data of the interaction are evaluated using the BIAcore T200 evaluation software.
Comparison of KD values for monomeric and bispecific aptamers are expected to show that dimerization does not disturb binding properties of each subunit for its particular target. Simultaneous binding of PSMA and CD3 Îľ/Îł also can be recorded with the manual injection mode at a flow rate of 10 Îźl/min and by injecting a solution of the first target at a saturating concentration followed by a solution of the second target at a saturating concentration. A second injection with an inverted sequence is performed. In both sequences, each injection resulting in responses of equal intensities indicates that both arms of bispecific aptamers are able to bind the second target while the binding site for the first antigen is occupied. Monomers failing to respond to both injections of target solutions indicate that the bispecific aptamer can simultaneously bind both targets.
Cytotoxicity assays were carried out on unstimulated peripheral blood mononuclear cells (PBMCs). Freshly prepared PBMCs were isolated from buffy coats obtained from healthy donors (Etablissement Français du Sang, Division RhĂ´nes-Alpes). After diluting the blood with DPBS, the PBMCs were separated over a FICOLL density gradient (FICOLL-PAQUE PREMIUM 1.077 GE Healthcare), washed twice with DPBS, resuspended in RPMI-1640 medium (Gibco Invitrogen) to obtain a cell density of 5Ă106 cells/ml. These PBMCs were used as effector cells.
LNCaP target cells were labeled with 2 ÎźM calcein AM (Trevigen Inc, Gaithersburg, Md., USA) for 30 min at 37° C. in cell culture medium. The calcein AM fluorochrome is a dye that is trapped inside live LNCaP cells and only released upon redirected lysis. After 2 washes in cell culture medium, a cell density of 5Ă105 cells/ml was adjusted in RPMI-1640 medium and 100 Îźl aliquots of 50,000 cells were used per assay reaction. A standard reaction at 37° C./5% CO2 lasted for 4 hr and used 5Ă104 cells calcein AM-labeled target cells, 5Ă105 PBMCs (E/T ratio of 1:10) and 20 Îźl of bispecific aptamer solutions at 1 ÎźM in a total volume of 200 Îźl. After the cytotoxic reaction, the released dye in the incubation medium was quantitated in a fluorescence reader (VarioSkan Lux, ThermoFisher, Waltham, Mass., USA) and compared with the fluorescence signal from a control reaction in which the cytotoxic compound was absent and a reaction in which the fluorescence signal was determined for totally lysed cells (where aptamers were replaced by A100 reagent purchased from Chemometec, Allerod, Denmark). On the basis of these readings, the specific cytotoxicity was calculated according to the following formula: [fluorescence (sample)âfluorescence (control)]/[fluorescence (total lysis)âfluorescence (control)]Ă100.
The results of the cytotoxicity assay obtained after 4 h incubation in presence of aptamers 100 nM with a single E:T ratio of 10:1 are shown in FIG. 8. Null to weak specific cell killing activity (<10%) was observed with PSMAĂCD3 bispecific RNA/DNA aptamers. Superior specific cytotoxicity was measured with RNA/RNA aptamers A10ĂARACD3-3700006 and A10ĂARACD3-0010209 that induced the killing of 40-50% of LNCaP cells. Control monomer A10 lacking the CD3 binding moiety did not induce any cytotoxicity.
These results suggest that engineered aptamer switches are able to recruit effector T lymphocytes to target cells to redirect their cytolytic machinery and eliminate a particular cell population.
In vivo efficacy and toxicity of different multimeric aptamer constructs in comparison to monomeric aptamers in mice are evaluated. Adult mice bearing PSMA positive tumors are administered with aptamers that specifically bind to CD3 and PSMA, in different groups of mice, the aptamers are either in monomeric form or multimeric form. Efficacy is evaluated by measuring tumor size, tumor growth and rate, and survival in the treated groups versus controls. Toxicity is assessed by the incidence of adverse reactions in treated groups versus controls.
In vivo efficacy and toxicity of different multimeric aptamer constructs in comparison to monomeric aptamers in mice are evaluated. Adult mice bearing PSMA positive tumors are administered aptamers that specifically bind to CD3 and PSMA, in different groups of mice, the aptamers are either in monomeric form or multimeric form. Efficacy is evaluated by measuring tumor size, tumor growth and rate, and survival in the treated groups versus controls. Toxicity is assessed by the incidence of adverse reactions in treated groups versus controls.
ARAA-00100001 and ARAA-01700001 aptamers were purchased from baseclick (Neuried, Germany) as HPLC-RP purified 2â˛-F RNA oligos synthetized via standard solid phase phosphoramidite chemistry.
A10 2â˛F-RNA aptamer was modified with an azide group at its 3â˛-end for subsequent triazole inter-nucleotide dimerization. Biotin was added to the 5â˛-end of A10 aptamer as a Biotin-TEG that introduces a 16-atom mixed polarity spacer between the aptamer sequence and the biotin flag. ARAA-00100001 and ARAA-01700001 were modified with an alkyne group at their 5â˛-end for subsequent triazole inter-nucleotide dimerization. Molecular weight, purity and integrity were verified by H PLC-MS.
The procedure described in Example 1 was used to prepare bispecific anti-PSMA A10 and anti-CAR PNE aptamers. The gels were visualized using Bio-Rad imaging system and the results are shown in FIG. 4A. Gel slices corresponding to dimeric aptamers were cut out from the gel and nucleic acids were extracted for 72 h at 8° C. by passive elution in 25 mM NaCl-TE buffer. Bispecific aptamer dimers were recovered by standard sodium acetate precipitation, resuspended in sterile water and stored at â20° C. until use.
The affinity and specificity of anti-PSMAĂanti-CAR PNE aptamers to target proteins expressed on cells were evaluated by flow cytometry. These studies were performed on PSMA-positive LNCaP (Human Prostate CarcinomaâATCC CRL-1740) and PSMA-negative PC-3 (Human Prostate CarcinomaâATCC CRL-1435) in DPBS buffer containing 5% FBS, as described in Example 3. Aptamers were tested within a single concentration range: 30, 100 and 300 nM.
The results of the binding studies to PSMA-positive cells are shown in FIG. 6A. Two RNA/RNA aptamers, A10ĂARAA-00100001 and A10ĂARAA-01700001 were analyzed along with A10 monomeric aptamer. For comparison, binding of the tested reagents to PSMA-negative PC-3 cells was also measured.
A dose-dependent binding to PSMA-positive LNCaP cells was observed with A10 without reaching saturation of the signal at the highest tested concentrations. Intensity of the signal was as strong as for the antibody control. Residual binding of A10 monomer to PC-3 cells was only observed at the highest tested concentration. Both bispecific PSMAĂCAR PNE aptamers exhibited similar binding properties to A10 monomer but with an improved specificity for target-positive cells as residual binding to PSMA-negative cells was reduced. For each tested concentration, signal intensity of bispecific aptamers was superior to the one measured for A10 monomer, suggesting that heterodimerization resulted in an improvement of the affinity.
Altogether the results from Example 9 and this example suggest that the heterodimerization of aptamers selected against different targets does not significantly impact the binding properties of each moiety when evaluated separately.
Cytotoxicity assays are carried out on unstimulated peripheral blood mononuclear cells (PBMCs). Freshly prepared PBMCs are isolated from buffy coats obtained from healthy donors (Etablissement Francais du Sang, Division Rhones-Alpes). After diluting the blood with DPBS, the PBMCs are separated over a FICOLL density gradient (FICOLL-PAQUE PREMIUM 1.077 GE Healthcare), washed twice with DPBS, resuspended in RPMI-1640 medium (Gibco Invitrogen) to obtain a cell density of 5Ă106 cells/mi. These PBMCs are transduced with lentiviral vectors expressing the CAR-PNE receptor. These PBMC-CAR-PNE are used as effector cells.
LNCaP target cells are labeled with 2 ÎźM calcein AM (Trevigen Inc, Gaithersburg, Md., USA) for 30 min at 37° C. in cell culture medium. The calcein AM fluorochrome is a dye that is trapped inside live LNCaP cells and only released upon redirected lysis. After 2 washes in cell culture medium, a cell density of 5Ă105 cells/mi is adjusted in RPMI-1640 medium and 100 Îźl aliquots of 50,000 cells are used per assay reaction. A standard reaction at 37° C./5% CO2 lasts for 4 hr and uses 5Ă104 cells calcein AM-labeled target cells, 5Ă105 PBMCs-CAR-PNE (ETT ratio of 1:10) and 20 Îźl of bispecific aptamer solutions at 1 ÎźM in a total volume of 200 Îźl. After the cytotoxic reaction, the released dye in the incubation medium is quantitated in a fluorescence reader (VarioSkan Lux, ThermoFisher, Waltham, Mass., USA) and compared with the fluorescence signal from a control reaction in which the cytotoxic compound is absent and a reaction in which the fluorescence signal is determined for totally lysed cells (where aptamers were replaced by A100 reagent purchased from Chemometec, Allerod, Denmark). On the basis of these readings, the specific cytotoxicity is calculated according to the following formula: [fluorescence (sample)âfluorescence (control)]/[fluorescence (total lysis)âfluorescence (control)]Ă100. The results of the cytotoxicity assay are obtained after 4 h incubation in presence of aptamers 100 nM with a single E:T ratio of 10:1. Specific cytotoxicity is measured with RNA/RNA aptamers A10ĂCAR PNE that induced the killing of more than 30% of LNCaP cells. Control monomer A10 lacking the CAR PNE binding moiety is also checked for cytotoxicity.
The engineered aptamer switches should be able to recruit effector T lymphocytes to target cells to redirect their cytolytic machinery and eliminate a particular cell population.
In vivo efficacy and toxicity of switch aptamer constructs in comparison to monomeric aptamers in mice are evaluated. Multimeric aptamers are prepared as switches that will turn on the activity of CAR T-cell based therapeutics. Adult mice bearing tumors are first injected with T cells transduced with CAR PNE and the multimeric aptamer made of an anti-CAR PNE aptamer fused to PSMA, or CD19, or CD2 or CD22 tumor associated targets is infused. Efficacy is evaluated by measuring tumor size, tumor growth and rate, and survival in the treated groups versus controls. Toxicity is assessed by the incidence of adverse reactions in treated groups versus controls.
| TABLEâ1 |
| SummaryâofâSequences |
| Sequence | SEQâID | |
| Description | Sequence | NO: |
| GCN4 | NYHLENEVARLKKL | 1 |
| Transcription | ||
| Factorâ(PNE) | ||
| N-terminal | ESQPDPKPDELHKSS | 2 |
| peptideâof | ||
| Staph, | ||
| entertoxinâB | ||
| (PNE) | ||
| HBVâpre-S2 | PRVRGLYFPAGG | 3 |
| proteinâ(aaâ134- | ||
| 145)â(PNE) | ||
| BovineâHerpes | MEESKGYEPP | 4 |
| Virus | ||
| GlycoproteinâD | ||
| (PNE) | ||
| Salmonella | DRTNNQVKA | 5 |
| typhimurium | ||
| OmpâDâpeptide | ||
| (PNE) | ||
| Grapevine | AQEPPRQ | 6 |
| leafroll- | ||
| associatedâvirus | ||
| 3âcoatâproteinâN- | ||
| terminalâpeptide | ||
| (PNE) | ||
| SARS-CoV-1âN | PTDSTDNNQNGGRNGARPKQRRPQ | 7 |
| proteinâpeptide | ||
| A10âRNA | GGGAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCCU | 8 |
| aptamerâanti- | ||
| PSMA | ||
| Clusterâ1 | CCGGGTGGGGGTTTGGCACCGGGCCTGGCGCAGGGATTCG | 9 |
| Clusterâ2 | GAGGGGTTTGGCATCGGGCCTGGCGCCATTCAAGCTATGC | 10 |
| Clusterâ3 | GCGTAAGGGTTTGGCAGCGGGCCTGGCGGAACGCGTGTAT | 11 |
| Clusterâ4 | GGAGTGGAGTATTCCGGGTTTGGCATCGGGCCTGGCGAAG | 12 |
| Clusterâ5 | CGGCAGGGGTTTGGCTCCGGGTCTGGCGAACTGGCTGAGA | 13 |
| Clusterâ6 | AAGGGATTGGCGTCGGGCCTGGCGTAAGGAGGCTATGCTC | 14 |
| Clusterâ7 | GGGATTGGCGCTGGGCCTGGCAAGGAATCTTCTCGTTGTA | 15 |
| Clusterâ8 | GGGATTGGCTTCGGGCCTGGCGAGTATTGTTTTCCTGGAG | 16 |
| Clusterâ9 | GCATCGAAATGGGGTTGGCACCGGGCCTGGCGAATTGGAT | 17 |
| Clusterâ10 | GAGACTAGAGGGATTGGCTTCGGGCCTGGCGTAC | 18 |
| Clusterâ11 | GATGGAGGGTTTGGCGGTGGGCCTGGCAAGTTATCTCATA | 19 |
| Clusterâ12 | TACGGCTAGGGTTTGGCGTTGGGCCTGGCAGGACCGTAAG | 20 |
| Clusterâ13 | ATATGGGAGGGTGAGGGTTTGGCTGCGGGCCTGGCGGGAG | 21 |
| Clusterâ14 | TGCGGCACATGTACGCGGAGGGATTGGCATAGGGTCTGGC | 22 |
| Clusterâ15 | GGGGTTGGCTTTGGGCCTGGCAGTCATTTGTGAATCCTTA | 23 |
| Clusterâ16 | TCCGACAAAAGGGATTGGCTTCGGGCCTGGCGGGGTTGCC | 24 |
| Clusterâ17 | GGTCGGGGTTTGGCATCGGGACTGGCGTTATACAATCGT | 25 |
| Clusterâ18 | GATGGGGTTTGGCGTCGGGCCTGGCGAATACATCTAAAAG | 26 |
| Clusterâ19 | TACCGCGGGGATTGGCTCCGGGCCTGGCGTCGTAATCTGA | 27 |
| Clusterâ20 | GGGGTTTGGCTGCGGGCCTGGCGCATGATTCAACGAGACA | 28 |
| Clusterâ21 | GGTCGGGTGCTACTGAGCGATTGGCTTTCCGGACTGGGGA | 29 |
| Clusterâ22 | CGACCACAGGGGTTTGGCTTCGGGACTGGCGGTGGGCACT | 30 |
| Clusterâ23 | CGACCACAGGGGTTTGGCTTCGGGACTGGCGGTGGGCACT | 31 |
| Clusterâ24 | TATGGGTTTGGCATCGGGCCTGGCGGAATGGAAAATGTTA | 32 |
| Clusterâ25 | AGACGGGTTTGGCTGCGGGCCTGGCGGTCGTCATTCCTCT | 33 |
| Clusterâ26 | GAGGGGATTGGCATTTGGGCCTGGCAAATTCATCTATTCT | 34 |
| Clusterâ27 | AGGGGTTTGGCGTCGGGCCTGGCGCAGCTCTTCTTGTGTTT | 35 |
| Clusterâ28 | GGGATTGGCTTCGGGCCTGGCGTATCTTTTACATTACC | 36 |
| Clusterâ29 | GGTGGACGGTATACAGGGGCTGCTCAGGATTGCGGATGAT | 37 |
| Clusterâ30 | CCGTTTGAAGCGTTAGGGTTTGGCATCGGGCCTGGCGCAC | 38 |
| Clusterâ31 | AGGGTTTGGCTACGGGCCTGGCGAGCTGTTTCCGCTACTC | 39 |
| Clusterâ32 | GTGTTATGATACTATGCGTATGGATTGCAAAGGGCTGCTG | 40 |
| Clusterâ33 | GAAGGGTTTGGCATTGGGCCTGGCAAGATAATTTGCAAGT | 41 |
| Clusterâ34 | CGGCGAAGTGGCAGGGTTTGGCTTCGGGTCTGGCGGAACA | 42 |
| Clusterâ35 | GAGGGTTTGGCAGTGGGCCTGGCATCAATTCTTTGTTTTC | 43 |
| Clusterâ36 | TACTGAGGGTTTGGCATTGGGCCTGGCATATTGGTATTT | 44 |
| Clusterâ37 | ATGGGTTTGGCACCGGGTCTGGCGGATTCGATAGGTGGTT | 45 |
| Clusterâ38 | GGGGGTTTGGCTCTGGGCCTGGCATAACGAACCTTCGGAG | 46 |
| Clusterâ39 | TGCCCGAGAGGACTGCTTAGGCTTGCGAGTAGGGAACGCT | 47 |
| Clusterâ40 | AGTGGGATTGGCTTCGGGCCTGGCGTTCGCAACATGTTTA | 48 |
| Clusterâ41 | GGGGATTGGCACTGGGACTGGCACCTTTTTAACATGTATG | 49 |
| Clusterâ42 | GCAATTAAGGGATTGGCTCCGGGCCTGGCGCCACGCATGG | 50 |
| Clusterâ43 | TGGGGTTTGGCAGCGGGTCTGGCGATCATAATGGTGTGCG | 51 |
| Clusterâ44 | ACGGGGGATTGGCTTTGGGCCTGGCAATTAATTTACTGTT | 52 |
| Clusterâ45 | GAGCGCTTGGCAGCCGGTCTGGGGACATCAGAGGTGATGG | 53 |
| CELTIC_1s | TTTCCGGGTGGGGGTTTGGCACCGGGCCTGGCGCAGGGAT | 54 |
| TCG | ||
| CELTIC_2s | GAGGGGTTTGGCATCGGGCCTGGCGCCATTCAAGCTATGC | 55 |
| CELTICâ3s | GCGTAAGGGTTTGGCAGCGGGCCTGGCGGAACGCGTGTAT | 56 |
| CELTICâ21s | GGTCGGGTGCTACTGAGCGATTGGCTTTCCGGACTGGGGA | 57 |
| CELTICâ4s | GGAGTGGAGTATTCCGGGTTTGGCATCGGGCCTGGCGAAG | 58 |
| CELTICâ5s | CGGCAGGGGTTTGGCTCCGGGTCTGGCGAACTGGCTGAGA | 59 |
| CELTICâ6s | AAGGGATTGGCGTCGGGCCTGGCGTAAGGAGGCTATGCTC | 60 |
| CELTIC_9s | GCATCGAAATGGGGTTGGCACCGGGCCTGGCGAATTGGAT | 61 |
| CELTICâ11s | GATGGAGGGTTTGGCGGTGGGCCTGGCAAGTTATCTCATA | 62 |
| CELTICâ19s | TACCGCGGGGATTGGCTCCGGGCCTGGCGTCGTAATCTGA | 63 |
| CELTICâ22s | CGACCACAGGGGTTTGGCTTCGGGACTGGCGGTGGGCACT | 64 |
| CELTICâcore | GGGXTTGGCXXXGGGXCTGGC | 65 |
| CELTICâcore_1 | GGGTTTGGCACCGGGCCTGGCGC | 66 |
| CELTICâcore_2 | GGGTTTGGCACCGGGCCTGGC | 67 |
| CELTICâcore_3 | CCGGGCCTGGCC | 68 |
| CELTICâcore_4 | GGGTTTGGCATCGGGCCTGGCG | 69 |
| CELTICâcore_5 | GGGTTTGGCGGTGGGCCTGGC | 70 |
| CELTICâcore_6 | TTTGGGTTTGGCACCGGGCCTGGC | 71 |
| CELTICâcore_T | TTTGGGTTTGGCATCGGGCCTGGC | 72 |
| CELTICâcore_7 | GGGTTTGCACCGGGCCTGGC | 73 |
| CELTICâcore_8 | GGGTTTGCACCGGGCCTGGC | 74 |
| CELTICâcore_9 | GGGTTTGGACCGGGCCTGGC | 75 |
| CELTIC | GGGTTTGGCACC_GGCCTGGC | 76 |
| core_10 | ||
| CELTIC | GGGTTTGGCACCGG_CCTGGC | 77 |
| core_11 | ||
| CELTIC | GGGTTTGGCACCGGG_CTGGC | 78 |
| core_12 | ||
| CELTIC | GGGTTTGGCACCGGGC_TGGC | 79 |
| core_13 | ||
| CELTIC | _GGTTTGGCATCGGGCCTGGC | 80 |
| core_14 | ||
| CELTIC | G_GTTTGGCATCGGGCCTGGC | 81 |
| core_15 | ||
| CELTIC | GG_TTTGGCATCGGGCCTGGC | 82 |
| core_16 | ||
| CELTIC | GGG_TTGGCATCGGGCCTGGC | 83 |
| core_17 | ||
| CELTIC | GGGT_TGGCATCGGGCCTGGC | 84 |
| core_18 | ||
| CELTIC | GGGTT_GGCATCGGGCCTGGC | 85 |
| core_19 | ||
| CELTIC | GGGTTT_GCATCGGGCCTGGC | 86 |
| core_20 | ||
| CELTIC | GGGTTTG_CATCGGGCCTGGC | 87 |
| core_21 | ||
| CELTIC | GGGTTTGG_ATCGGGCCTGGC | 88 |
| core_22 | ||
| CELTIC | GGGTTTGGC_TCGGGCCTGGC | 89 |
| core_23 | ||
| CELTIC | GGGTTTGGCA_CGGGCCTGGC | 90 |
| core_24 | ||
| CELTIC | GGGTTTGGCAT_GGGCCTGGC | 91 |
| core_25 | ||
| CELTIC | GGGTTTGGCATC_GGCCTGGC | 92 |
| core_26 | ||
| CELTIC | GGGTTTGGCATCG_GCCTGGC | 93 |
| core_27 | ||
| CELTIC | GGGTTTGGCATCGG_CCTGGC | 94 |
| core_28 | ||
| CELTIC | GGGTTTGGCATCGGG_CTGGC | 95 |
| core_29 | ||
| CELTIC | GGGTTTGGCATCGGGC_TGGC | 96 |
| core_30 | ||
| CELTIC | GGGTTTGGCATCGGGCC_GGC | 97 |
| core_31 | ||
| CELTIC | GGGTTTGGCATCGGGCCT_GC | 98 |
| core_32 | ||
| CELTIC | GGGTTTGGCATCGGGCCTG_C | 99 |
| core_33 | ||
| CELTIC | GGGTTTGGCATCGGGCCTGG_ | 100 |
| core_34 | ||
| CELTIC | GGGTTTGGGATCGGGCCTGGC | 101 |
| core_35 | ||
| CELTIC | GGGTTTGGCATCGGGCCTGGG | 102 |
| core_36 | ||
| CELTIC | GGGTTTGGGATCGGGCCTGGC | 103 |
| core_37 | ||
| CELTIC | GGGTTTGGCATCGGGACTGGC | 104 |
| core_38 | ||
| CELTIC | GGGTTTGGCATCGGGGCTGGC | 105 |
| core_39 | ||
| CELTIC | GGGTTTGGCATCGGGTCTGGC | 106 |
| core_40 | ||
| CELTIC | GGGTTTGGCATCGGGCTGGC | 107 |
| core_41 | ||
| CELTIC | GGGTTTGGCA_CGGG_CTGGC | 108 |
| core_42 | ||
| CELTIC | GGGTTTGGCAGCGGG_CTGGC | 109 |
| core_43 | ||
| CELTIC | GGGTTTGGCAACGGG_CTGGC | 110 |
| core_44 | ||
| ARACD3- | UCUAAGCAAUAUUGUUUGCUUUUGCAGCGAUUCUGUUUCGAU | 111 |
| 0010209 | AUAUUA | |
| ARACD3- | UUCAAGAUAAUGUAAUUAUUUUUGCAGCGAUUCUUGUUUUGU | 112 |
| 2980001 | UCGAUUU | |
| ARACD3- | CAAAGUUCAAGAUUGAGCUUUUUGCAGCGAUUCUUGUUUUAU | 113 |
| 0270039 | CAAACGA | |
| ARACD3- | GAUGAUAUCUUUAAUAUCAAUUGCAGCGAUUCUUGUUUGAGA | 114 |
| 3130001 | AUAAAC | |
| ARACD3- | UAUAGACUUUAAUGUCUCAUUUUCGCAGCGAUUCUUGUUUAU | 115 |
| 3700006 | UUAACAUA | |
| Core_sequence | UXGCAGCGAUUCUXXUU | 116 |
| RNA | ||
| Consensus-1 | GX1X2TX3GX4X5X6X7X8X9GGX10CTGG, | 117 |
| whereinâX1âisâGâorâA;âX2âand | ||
| X6âareâA,âT,âorâG;âX3âisâT,âorâG;âX4âand | ||
| X9âareâGâorâC;âX5âisâCâorâT;âX7 | ||
| isâT,âG,âorâC;âandâX8âandâX10âareâC,âT,âorâA. | ||
| Consensus-2 | GGGX1TTGGCX2X3X4GGGX5CTGGC,âwhereinâX1âandâX2âareâA,âT, | 118 |
| orâG;âX3âisâT,âC,âorâG;âX4âandâXsâareâA,âT,âorâC. | ||
| Consensus-3 | GX1TTX2GX3X4X5X6CX7GGX8CTGGX9G, | 119 |
| whereinâXâisâAâorâG;âX2âis | ||
| TâorâG;âXsâandâX7,âX9âareâGâor | ||
| C;âX4âisâTâorâC;âX5âisâAâorâT;âX6âisâT,âC, | ||
| orâG;âX8âisâAâorâC. | ||
| Consensus-4 | GGGTTTGGCAX1CGGGCCTGGC,âwhereinâX1âisâG,âC,âorâT. | 120 |
| Consensus-5 | GCAGCGAUUCUX1GUUU,âwhereinâX1âisâUâorânothing | 121 |
| DNAâaptamer | TAGGGAAGAGAAGGACATATGAT-(N40)- | 122 |
| library | TTGACTAGTACATGACCACTTGA | |
| forwardâprimer | TAGGGAAGAGAAGGACATATGAT | 123 |
| forâDNAâSELEX | ||
| reverseâprimer | TCAAGTGGTCATGTACTAGTCAA | 124 |
| forâDNAâSELEX | ||
| RNAâaptamer | CCTCTCTATGGGCAGTCGGTGAT-(N20)- | 125 |
| library | TTTCTGCAGCGATTCTTGTTT-(N10)- | |
| GGAGAATGAGGAACCCAGTGCAG | ||
| forwardâprimer | TAATACGACTCACTATAGGGCCTCTCTAT | 126 |
| forâRNAâSELEX | GGGCAGTCGGTGAT | |
| reverseâprimer | CTGCACTGGGTTCCTCATTCTCC | 127 |
| forâRNAâSELEX | ||
| forwardâblocking | ATCACCGACTGCCCATAGAGAGG | 128 |
| sequenceâfor | ||
| RNAâSELEX | ||
| reverseâblocking | CTGCACTGGGTTCCTCATTCTCC | 129 |
| sequenceâfor | ||
| RNAâSELEX | ||
| capture | CAAGAATCGCTGCAG | 130 |
| sequenceâfor | ||
| RNAâSELEX | ||
As used herein, âconsisting essentially ofâ allows the inclusion of materials or steps that do not materially affect the basic and novel characteristics of the claim. Any recitation herein of the term âcomprisingâ, particularly in a description of components of a composition or in a description of elements of a device, can be exchanged with âconsisting essentially ofâ or âconsisting ofâ.
While the present invention has been described in conjunction with certain preferred embodiments, one of ordinary skill, after reading the foregoing specification, will be able to effect various changes, substitutions of equivalents, and other alterations to the compositions and methods set forth herein.
1. An aptamer-based multispecific antigen binding molecule comprising 1) two or more target binding aptamer regions having binding specificities for different targets, and 2) one or more linkers connecting the aptamer regions, wherein the linker comprises a click chemistry product.
2. The aptamer-based multispecific antigen binding molecule of claim 1, wherein the linker further comprises a linker moiety selected from the group consisting of a covalent bond, a single-stranded nucleic acid, a double-stranded nucleic acid, self-assembling complementary oligonucleotides, a peptide, a polypeptide, an oligosaccharide, a polysaccharide, a synthetic polymer, a hydrazone, a thioether, an ester, a triazole, a nanoparticle, a micelle, a liposome, a cell, and combinations thereof.
3. The aptamer-based multispecific antigen binding molecule of any of the preceding claims that can bind to specific targets on one or more of human cells, immune cells, cancer cells, genetically modified cells, bacteria, or viruses.
4. The aptamer-based multispecific antigen binding molecule of any of the preceding claims that can redirect the binding of one cell type from one target cell to another target cell.
5. The aptamer-based multispecific antigen binding molecule of any of the preceding claims that can form a bridge between an immune cell and a cancer cell.
6. The aptamer-based multispecific antigen binding molecule of any of the preceding claims that can stimulate and activate an immune cell.
7. The aptamer-based multispecific antigen binding molecule of claim 6, wherein the immune cell is a T-cell, NK-cell, or macrophage, and said binding leads to destruction of a target cell bound to a target binding aptamer of the aptamer based multispecific antigen binding molecule.
8. The aptamer-based multispecific antigen binding molecule of any of the preceding claims, wherein the molecule possesses a binding specificity for an antigen selected from the group consisting of CD3, CD8, CD4, CD19, Epithelial cell adhesion molecule, CD20, CD22, CD123, BCMA, B7H3, CEA, PSMA, Her2, CD33, CD38, DLL3, EGF-R, NKG2D ligands, MHC class I-related protein MR1, mesothelin, PD-1, PD-L1, CTLA04, Lag-3, TIM-3, OX40, CD47, VEGF, PRAME, NY-ESO-1, MAGE A4, MAGE A3/A6, MAGE A10, and AFP.
9. The aptamer-based multispecific antigen binding molecule of claim 3, wherein the molecule binds to an immune cell expressing CD3 antigen.
10. The aptamer-based multispecific antigen binding molecule of claim 1, wherein the molecule binds PSMA antigen on a cancer cell.
11. The aptamer-based multispecific antigen binding molecule of claim 1 comprising one or more CD3 antigen binding region that can bind to a T-cell and one or more PSMA antigen binding region that can bind to a PSMA expressing cell, wherein the CD3 antigen binding region and the PMSA antigen binding region are connected by one or more linkers.
12. Use of the aptamer-based multispecific antigen binding molecule of claim 11 in the treatment of a PSMA expressing cancer including prostate cancer.