Patent application title:

NUCLEIC ACID TEST KIT, TEST METHOD, AND USE

Publication number:

US20230193408A1

Publication date:
Application number:

17/925,675

Filed date:

2021-07-16

Abstract:

Disclosed is a nucleic acid test kit, comprising a Cpf1 test system, said Cpf1 test system comprising: a guide RNA, a Cpf1 protein, a nucleic acid probe, and a manganese ion-containing solution. Also provided is a mutated Cpf1 protein and a nucleic acid test kit containing the mutated Cpf1 protein. Also provided is a crRNA for testing coronavirus nucleic acid, and a nucleic acid test kit containing said crRNA. Further provided is a use of the nucleic acid test kit, and a test method for the nucleic acid. When the nucleic acid test kit, mutated Cpf1 protein, or crRNA of the present invention are used for nucleic acid testing (for example, testing the nucleic acid of a SARS-related coronavirus or MERS coronavirus), the signal strength during the test is substantially enhanced, and the test time is thus reduced and the test efficiency improved. In addition, the sensitivity, specificity, and accuracy are high, the test is visual, the cost is low, the operation is simple and convenient, and no large-scale complex t equipment is required.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q1/701 »  CPC main

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage Specific hybridization probes

C12Q1/70 IPC

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage

Description

The present application claims the priority of Chinese patent application 2020104262831 filed on May 19, 2020. The entire content of the aforementioned Chinese patent application is incorporated herein by reference.

TECHNICAL FIELD

The present invention belongs to the technical field of biology, and particularly relates to a nucleic acid detection kit including a Cpf1 detection system and a detection method. The present invention further relates to use of the nucleic acid detection kit, in particular to use in rapid detection of nucleic acids of a severe acute respiratory syndrome-associated coronavirus and a Middle East respiratory syndrome coronavirus.

BACKGROUND

Coronaviruses belong to the genus Coronavirus of the family Coronaviridae in the order Nidovirales [6]. A mature coronavirus has an envelope on the surface thereof, the envelope is covered with spikes having spherical ends, so the entire spikes are petal-shaped or pear-shaped, and there is a wide gap between the spikes. Coronavirus particles are named for the regularly arranged crown-like envelope spikes under an electron microscope. Members of the Coronavirus genus have caused several outbreaks, such as Severe Acute Respiratory Syndrome (abbreviated as SARS) in 2002 and Middle East respiratory syndrome coronavirus (MERS-CoV) in 2012. The first SARS case was discovered in Shunde city, Guangdong province in 2002, and then the virus rapidly spread to more than 30 countries and regions including Hong Kong, Vietnam, Singapore, and Canada, with over 8,000 infections and a mortality rate of about 10% [7]. MERS-CoV was first identified in 2012 [8]. From September, 2012 to January, 2020, WHO had reported a total of 2,506 laboratory-confirmed cases, of which 862 cases were dead (at a mortality rate of approximately 34.3%). Unlike the SARS epidemic that broke out in 2002, which was effectively controlled, there is ongoing spreading and infection of MERS-CoV to date, and two confirmed MERS infectors were still reported by WHO in January, 2020. The two disease outbreaks have had a tremendous impact on social life and the economy, and there are currently no effective vaccines and therapeutic drugs for these two highly contagious coronaviruses. Timely diagnosis and isolation are effective ways to control the outbreak of the disease.

Rapid and efficient nucleic acid detection is an effective method for clinical prevention and control of viral diseases. Most of the existing detection methods for viral diseases are based on a nucleic acid detection. In the guidance document of laboratory diagnostic procedures for Severe Acute Respiratory Syndrome (abbreviated as SARS) and Middle East respiratory syndrome coronavirus (MERS-CoV) issued by WHO, real-time reverse transcription PCR (rRT-PCR) is recommended for detection and diagnosis of the viruses. The detection of viral nucleic acids by rRT-PCR is mainly limited by expensive PCR experimental equipment, the number of personnel able to perform a skilled and stable operation, long detection time, etc. Immunological detection methods are also important means for virus detection, such as double-antibody sandwich ELISA, colloidal gold immunochromatography test paper, and the similar methods. The immunological examination is susceptible to the course of the disease and is easy to miss the diagnosis because there are few antibodies in the patient in the early stage and the corresponding antibody will be produced after a certain period; and a rehabilitated patient after illness may carry such an antibody, which may easily lead to false positive in immunodiagnostics. To effectively control the spread of viral infectious diseases, it is necessary to establish a simple, rapid, and specific novel detection method.

CRISPR-Cas (Clustered regularly interspaced short palindromic repeats, CRISPRs) is an adaptive immune system in bacteria, in which a Cas protein targets and degrades a foreign nucleic acid by an RNA-guided nuclease [1,2]. CRISPR-Cpf1 (Cpf1) belongs to the second family of Cas enzymes and is used for guiding an RNA to direct a double-stranded DNA for cleavage by a single RuvC catalytic domain. Cpf1 enzymes recognize Thymine (T) nucleotide-rich protospacer adjacent motifs (PAMs) [3], catalyze their own guide-CRISPR RNA (crRNA) to mature [4], and specifically recognize and cleave a complementary paired double-stranded DNA (dsDNA) [3]. When the CRISPR/Cpf1 protein recognizes and cleaves the target double-stranded DNA in a sequence-specific manner, it will induce a strong non-specific single-stranded DNA (ssDNA) trans-cleavage activity [5]. Cpf1 has endonuclease activity, and the ligand ion of an endonuclease is usually a magnesium ion. The existing Cpf1-based nucleic acid detection still has low signal intensity, which results in the defects of long detection time and low detection efficiency of low concentration samples in the actual detection. There is therefore a need to further enhance the intensity of the detection signal to meet the needs of the actual detection. In addition, there is an urgent need to improve the sensitivity, specificity, and stability in detecting nucleic acids.

CONTENT OF THE PRESENT INVENTION

A technical problem to be solved by the present invention is to overcome the defects such as too high cost, a long detection time, low detection efficiency, insufficient specificity and sensitivity in nucleic acid detection in the prior art, and provided herein is a nucleic acid detection kit, a mutated Cpf1 protein, a crRNA, a detection method, and usage. When the nucleic acid detection kit, mutated Cpf1 protein, or crRNA of the present invention are used for nucleic acid detection (for example, detecting the nucleic acid of a SARS-associated coronavirus or MERS coronavirus), the signal intensity during the detection is substantially enhanced, and thus the detection time is reduced and the detection efficiency is improved. In addition, the sensitivity, specificity, and accuracy are high, the detection is visual, the cost is low, the operation is simple, and no large-scale complex detection equipment is required.

Cpf1 has endonuclease activity, and the ligand ion of an endonuclease is usually a magnesium ion in the art. However, the present inventors have found for the first time that a manganese ion can promote the ability of Cpf1 to cleave a nucleic acid probe (e.g., a single-stranded DNA probe), and thus improve the signal intensity of the Cpf1 detection, so that the Cpf1-mediated in vitro detection signal can be enhanced to reduce the detection time and improve the detection efficiency. In addition, through a large number of experiments in the present invention, it is unexpectedly found that when certain Cpf1 proteins are specifically mutated, the signal intensity during nucleic acid detection can also be significantly improved. The present inventors have also adopted the Cpf1 fluorescence method for the first time to detect SARS-related coronavirus and MERS coronavirus and developed a crRNA through a large number of experiments, which can be used for detecting these viruses with very high sensitivity, specificity, and accuracy.

To solve the aforementioned technical problem, in a first aspect, the present invention provides a nucleic acid detection kit including a Cpf1 detection system, said Cpf1 detection system including a guide RNA, a Cpf1 protein, a nucleic acid probe, and a manganese ion-containing solution.

Preferably, the manganese ion-containing solution is a solution of manganese sulfate, manganese chloride, or manganese acetate.

Preferably, the nucleic acid probe is a single-stranded DNA probe, which preferably includes a fluorescent label, more preferably has a fluorescent group and a fluorescence quenching group at its 5′ and 3′ terminals, respectively, and further more preferably has a fluorescent group at its 5′ terminal and a fluorescence quenching group at its 3′ terminal.

The fluorescent group may be conventional in the art, for example, 6-FAM, TET, CY3, CY5, or ROX. The fluorescence quenching group may be conventional in the art, for example, BHQ1, BHQ2, or BHQ3. The sequence of the single-stranded DNA probe is prepared according to conventional methods in the art and may be, for example, TTTATTT.

Preferably, the Cpf1 protein is selected from one or more of AsCpf1 (Acidaminococcus sp. BV3L6), BbCpf1 (Beauveria bassiana KA00251), BoCpf1 (Bacteroidetes oral), FnCpf1 (Francisella novicida U112), HkCpf1 (Helcococcus kunzii), Lb4Cpf1 (Lachnospiraceae bacterium MC2017), Lb5Cpf1 (Lachnospiraceae bacterium NC2008), LbCpf1 (Lachnospiraceae bacterium ND2006), Oscpf1 (Oribacterium sp.), and TsCpf1 (Thiomicrospira sp. XS5).

Preferably, the Cpf1 protein is a codon-optimized Cpf1 protein, the nucleotide sequence of which is preferably as shown in one or more of SEQ ID NOs: 14-23.

Preferably, the Cpf1 protein is a mutated Cpf1 protein, which preferably has an amino acid sequence with 98%, preferably more than 99% sequence homology to a native Cpf1 protein. More preferably, the sequence of the mutated Cpf1 protein includes a sequence in which one or more sites of K180, E184, N607 and K613 as shown in SEQ ID NO: 55 are mutated to R, or one or more sites of T148, T152, G532 and K538 as shown in SEQ ID NO: 54 are mutated to R. For example, the sequence may be a sequence in which E184 and N607 as shown in SEQ ID NO: 55 are mutated to R, a sequence in which E184, N607 and K613 as shown in SEQ ID NO: 55 are mutated to R, a sequence in which K180, E184, N607 and K613 as shown in SEQ ID NO: 55 are mutated to R, a sequence in which T152 and G532 as shown in SEQ ID NO: 54 are mutated to R, a sequence in which T152, G532 and K538 as shown in SEQ ID NO: 54 are mutated to R, and a sequence in which T148, T152, G532 and K538 as shown in SEQ ID NO: 54 are mutated to R. Further more preferably, the nucleotide sequence of the mutated Cpf1 protein is as shown in SEQ ID NOs: 30-41.

Preferably, the guide RNA is an RNA that guides the Cpf1 protein to specifically bind to the nucleic acid, preferably a crRNA; the crRNA is preferably a crRNA for detecting a viral nucleic acid; more preferably a crRNA for detecting a SARS-associated coronavirus or a MERS-CoV virus; and the SARS-associated coronavirus is preferably SARS-CoV (severe acute respiratory syndrome coronavirus) or SARS-CoV-2 (severe acute respiratory syndrome coronavirus 2). More preferably, the crRNA is a crRNA for detecting an orf1ab gene of the SARS-CoV virus, a crRNA for detecting an orf1a gene of the MERS-CoV virus, a crRNA for detecting an upE gene of the MERS-CoV virus, a crRNA for detecting a E gene of the SARS-CoV-2 virus, a crRNA for detecting an S gene of the SARS-CoV-2 virus, a crRNA for detecting an M gene of the SARS-CoV-2 virus and/or a crRNA for detecting an N gene of the SARS-CoV-2 virus; the nucleotide sequence of the orf1ab gene is as shown in SEQ ID NO: 11, the nucleotide sequence of the orf1a gene is as shown in SEQ ID NO: 12, the nucleotide sequence of the upE gene is as shown in SEQ ID NO: 13, and the nucleotide sequence of the E gene is as shown in SEQ ID NO: 46; the nucleotide sequence of the SARS-CoV-2-S gene is as shown in SEQ ID NO: 79; the nucleotide sequence of the SARS-CoV-2-M gene is as shown in SEQ ID NO: 80; and the nucleotide sequence of the SARS-CoV-2-N gene is as shown in SEQ ID NO: 81. Further more preferably, the nucleotide sequence of the crRNA is preferably as shown in one or more of SEQ ID NOs: 1-10, SEQ ID NO: 47, SEQ ID NO: 48 and SEQ ID NO: 53, and SEQ ID NOs: 56-72.

Preferably, the manganese ion in the manganese ion-containing solution has a concentration of 5-600 mM, e.g., 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 mM, etc. The point values listed are examples only and are not intended to be limiting, and it should be understood that any point value within this concentration range can be freely combined, and thus any combination of concentration ranges is intended to be within the scope of the present invention. For example, the concentration range such as 5-50, 5-100, 5-200, 5-300, 5-400, 5-500, 100-200, 100-300, and 200-300 should be within the scope of the present invention. In experiments, the inventors have found that working concentrations of the manganese ion within 0.5-60 mM are all effective, and the kit generally contains a 10-fold mixed stock solution, so that the concentration of the stock solution is 5-600 mM. In a preferred embodiment of the present invention, the manganese ion in the manganese ion-containing solution as used has a concentration of 100 mM.

Preferably, the nucleic acid probe has a concentration of 1-100 pmol/μL, and preferably 25 pmol/μL.

Preferably, the Cpf1 protein has a concentration of 20-1,000 ng/μL, and preferably 200 ng/μL.

Preferably, the guide RNA has a concentration of 0.1-50 μM, and preferably 1 μm.

Preferably, the nucleic acid detection kit further includes an RNA enzyme inhibitor and a buffer; and preferably the RNA enzyme inhibitor has a concentration of 10-200 U/μL, and preferably 40 U/μL.

Preferably, the buffer preferably includes NaCl, Tris, and BSA, and preferably has a pH of 7.9. In a preferred embodiment of the present invention, the buffer as used is a 10× buffer with a composition of 1,000 mM NaCl, 500 mM Tris, and 1,000 μg/mL BSA, pH 7.9.

To solve the aforementioned technical problem, in a second aspect, the present invention provides a mutated Cpf1 protein with the sequence including a sequence in which one or more sites of K180, E184, N607 and K613 as shown in SEQ ID NO: 55 are mutated to R; alternatively, the sequence includes a sequence in which one or more sites of T148, T152, G532 and K538 as shown in SEQ ID NO: 54 are mutated to R.

Preferably, the sequence of the mutated Cpf1 protein includes a sequence in which E184 and N607 as shown in SEQ ID NO: 55 are mutated to R.

Preferably, the sequence of the mutated Cpf1 protein includes a sequence in which E184, N607 and K613 as shown in SEQ ID NO: 55 are mutated to R.

Preferably, the sequence of the mutated Cpf1 protein includes a sequence in which K180, E184, N607 and K613 as shown in SEQ ID NO: 55 are mutated to R.

Preferably, the sequence of the mutated Cpf1 protein includes a sequence in which T152 and G532 as shown in SEQ ID NO: 54 are mutated to R.

Preferably, the sequence of the mutated Cpf1 protein includes a sequence in which T152, G532 and K538 as shown in SEQ ID NO: 54 are mutated to R.

Preferably, the sequence of the mutated Cpf1 protein includes a sequence in which T148, T152, G532 and K538 as shown in SEQ ID NO: 54 are mutated to R.

More preferably, the nucleotide sequence of the mutated Cpf1 protein is as shown in SEQ ID NOs: 30-41.

To solve the aforementioned technical problem, in a third aspect, the present invention provides a nucleic acid detection kit including a Cpf1 detection system, said Cpf1 detection system including a guide RNA, a nucleic acid probe, and a mutated Cpf1 protein according to the second aspect of the present invention.

Preferably, the guide RNA is an RNA that guides the Cpf1 protein to specifically bind to the nucleic acid, preferably a crRNA; the crRNA is preferably a crRNA for detecting a viral nucleic acid; more preferably a crRNA for detecting a SARS-associated coronavirus or a MERS-CoV virus; the SARS-associated coronavirus is preferably SARS-CoV or SARS-CoV-2; the crRNA is a crRNA for detecting an orf1ab gene of the SARS-CoV virus, a crRNA for detecting an orf1a gene of the MERS-CoV virus, a crRNA for detecting an upE gene of the MERS-CoV virus, a crRNA for detecting a E gene of the SARS-CoV-2 virus, a crRNA for detecting an S gene of the SARS-CoV-2 virus, a crRNA for detecting an M gene of the SARS-CoV-2 virus and/or a crRNA for detecting an N gene of the SARS-CoV-2 virus; the nucleotide sequence of the orf1ab gene is as shown in SEQ ID NO: 11, the nucleotide sequence of the orf1a gene is as shown in SEQ ID NO: 12, the nucleotide sequence of the upE gene is as shown in SEQ ID NO: 13, the nucleotide sequence of the E gene is as shown in SEQ ID NO: 46, and the nucleotide sequence of the SARS-CoV-2-S gene is as shown in SEQ ID NO: 79; the nucleotide sequence of the SARS-CoV-2-M gene is as shown in SEQ ID NO: 80; the nucleotide sequence of the SARS-CoV-2-N gene is as shown in SEQ ID NO: 81; more preferably, the nucleotide sequence of crRNA is as shown in one or more of SEQ ID NOs: 1-10, SEQ ID NO: 47, SEQ ID NO: 48 and SEQ ID NO: 53, and SEQ ID NOs: 56-72;

preferably, the nucleic acid probe is a single-stranded DNA probe, which preferably includes a fluorescent label, more preferably has a fluorescent group and a fluorescence quenching group at its two terminals, respectively, and further more preferably has a fluorescent group at a 5′ terminal and a fluorescence quenching group at a 3′ terminal. The fluorescent group may be conventional in the art, for example, 6-FAM, TET, CY3, CY5, or ROX. The fluorescence quenching group may be conventional in the art, for example, BHQ1, BHQ2, or BHQ3. The single-stranded DNA probe can be prepared according to conventional methods in the art, and its sequence may be, for example, TTTATTT.

Preferably, the guide RNA has a concentration of 0.1-50 μM, and preferably 1 μm.

Preferably, the mutated Cpf1 protein has a concentration of 20-1,000 ng/μL, and preferably 200 ng/μL.

Preferably, the nucleic acid probe has a concentration of 1-100 pmol/μL, and preferably 25 pmol/μL.

Preferably, the nucleic acid detection kit further includes a metal ion-containing solution such as a magnesium ion-containing solution and a manganese ion-containing solution; and preferably, the metal ion in the solution has a concentration of 5-600 mM, e.g., 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450 or 500 mM, etc. The point values listed are examples only and are not intended to be limiting, and it should be understood that any point value within this concentration range can be freely combined, and thus any combination of concentration ranges is intended to be within the scope of the present invention. For example, the concentration range such as 5-50, 5-100, 5-200, 5-300, 5-400, 5-500, 100-200, 100-300, and 200-300 should be within the scope of the present invention. In experiments, the inventors have found that working concentrations of the metal ion within 0.5-60 mM are all effective, and the kit generally contains a 10-fold mixed stock solution, so that the concentration of the stock solution is 5-600 mM. In a preferred embodiment of the present invention, the metal ion in the metal ion-containing solution used has a concentration of 100 mM.

Preferably, the nucleic acid detection kit further includes an RNA enzyme inhibitor and a buffer; preferably the RNA enzyme inhibitor has a concentration of 10-200 U/μL, and preferably 40 U/μL.

Preferably, the buffer includes NaCl, Tris, and BSA, and preferably has a pH of 7.9. In a preferred embodiment of the present invention, the buffer as used is a 10× buffer with the composition of 1,000 mM NaCl, 500 mM Tris, and 1,000 μg/mL BSA, pH 7.9.

To solve the aforementioned technical problem, in the fourth aspect, the present invention provides a crRNA for detecting nucleic acid of a coronavirus, wherein the crRNA is a crRNA for detecting an orf1ab gene of the SARS-CoV virus, a crRNA for detecting an orf1a gene of the MERS-CoV virus, a crRNA for detecting an upE gene of the MERS-CoV virus, a crRNA for detecting a E gene of the SARS-CoV-2 virus, a crRNA for detecting an S gene of the SARS-CoV-2 virus, a crRNA for detecting an M gene of the SARS-CoV-2 virus and/or a crRNA for detecting an N gene of the SARS-CoV-2 virus; the nucleotide sequence of the orf1ab gene is as shown in SEQ ID NO: 11, the nucleotide sequence of the orf1a gene is as shown in SEQ ID NO: 12, the nucleotide sequence of the upE gene is as shown in SEQ ID NO: 13, the nucleotide sequence of the E gene is as shown in SEQ ID NO: 46, and the nucleotide sequence of the SARS-CoV-2-S gene is as shown in SEQ ID NO: 79; the nucleotide sequence of the SARS-CoV-2-M gene is as shown in SEQ ID NO: 80; and the nucleotide sequence of the SARS-CoV-2-N gene is as shown in SEQ ID NO: 81.

Preferably, the nucleotide sequence of the crRNA for detecting the orf1ab gene of the SARS-CoV virus is as shown in one or more of SEQ ID NOs: 1-3.

Preferably, the nucleotide sequence of the crRNA for detecting the orf1a gene of the SARS-CoV virus is as shown in one or more of SEQ ID NOs: 4-7.

Preferably, the nucleotide sequence of the crRNA for detecting the upE gene of the SARS-CoV virus is as shown in one or more of SEQ ID NOs: 8-10.

Preferably, the nucleotide sequence of the crRNA for detecting the E gene of the SARS-CoV-2 virus is as shown in one or more of SEQ ID NO: 47, SEQ ID NO: 48, and SEQ ID NO: 53.

Preferably, the nucleotide sequence of the crRNA for detecting the S gene of the SARS-CoV-2 virus is as shown in one or more of SEQ ID NOs: 56-63.

Preferably, the nucleotide sequence of the crRNA for detecting the M gene of the SARS-CoV-2 virus is as shown in one or more of SEQ ID NOs: 64-68.

Preferably, the nucleotide sequence of the crRNA for detecting the N gene of the SARS-CoV-2 virus is as shown in one or more of SEQ ID NOs: 69-72.

In a preferred embodiment of the present invention, a process for preparing the crRNA includes the steps of designing a 44 bp crRNA by searching for a targeting sequence containing a cpf1 recognition sequence (PAM) TTTN for the orf1ab gene of the nucleic acid of a SARS virus with the sequence of SEQ ID NO: 11; designing a 44 bp crRNA by searching for a targeting sequence containing the cpf1 recognition sequence (PAM) TTTN for the upE gene of the nucleic acid of a MERS virus with the sequence of SEQ ID NO: 12; designing a 44 bp crRNA by searching for a targeting sequence containing the cpf1 recognition sequence (PAM) TTTN for the Orf1 gene of the nucleic acid of the MERS virus with the sequence of SEQ ID NO: 13; designing a 44 bp crRNA by searching for a targeting sequence containing the cpf1 recognition sequence (PAM) TTTN for the E gene of the nucleic acid of a SARS-CoV-2 virus with the sequence of SEQ ID NO: 46; designing a 44 bp crRNA by searching for a targeting sequence containing the cpf1 recognition sequence (PAM) TTTN for the S gene of the nucleic acid of the SARS-CoV-2 virus with the sequence of SEQ ID NO: 79; designing a 44 bp crRNA by searching for a targeting sequence containing the cpf1 recognition sequence (PAM) TTTN for the M gene of the nucleic acid of the SARS-CoV-2 virus with the sequence of SEQ ID NO: 80; and designing a 44 bp crRNA by searching for a targeting sequence containing the cpf1 recognition sequence (PAM) TTTN for the N gene of the nucleic acid of the SARS-CoV-2 virus with the sequence of SEQ ID NO: 81. After the design is complete, the crRNA is prepared. The crRNA can be constructed into a vector pUC57-T7-crRNA to obtain a target crRNA by in vitro transcription, or can be synthesized into an RNA sequence by a company.

To solve the aforementioned technical problem, in a fifth aspect, the present invention provides a nucleic acid detection kit including a Cpf1 detection system, said Cpf1 detection system including a crRNA, a Cpf1 protein, and a nucleic acid probe according to the fourth aspect of the present invention.

Preferably, the Cpf1 protein is selected from one or more of AsCpf1 (Acidaminococcus sp. BV3L6), BbCpf1 (Beauveria bassiana KA00251), BoCpf1 (Bacteroidetes oral), FnCpf1 (Francisella novicida U112), HkCpf1 (Helcococcus kunzii), Lb4Cpf1 (Lachnospiraceae bacterium MC2017), Lb5Cpf1 (Lachnospiraceae bacterium NC2008), LbCpf1 (Lachnospiraceae bacterium ND2006), Oscpf1 (Oribacterium sp.), and TsCpf1 (Thiomicrospira sp. XS5), or those having 98%, preferably more than 99% sequence homology to the amino acid sequence thereof.

Preferably, the Cpf1 protein is a codon-optimized Cpf1 protein, the nucleotide sequence of which is preferably as shown in one or more of SEQ ID NOs: 14-23.

Preferably, the Cpf1 protein is a mutated Cpf1 protein, which preferably has an amino acid sequence with 98%, preferably more than 99% sequence homology to a native Cpf1 protein. More preferably, the sequence of the mutated Cpf1 protein includes a sequence in which one or more sites of K180, E184, N607 and K613 as shown in SEQ ID NO: 55 are mutated to R, or one or more sites of T148, T152, G532 and K538 as shown in SEQ ID NO: 54 are mutated to R. For example, the sequence may be a sequence in which E184 and N607 as shown in SEQ ID NO: 55 are mutated to R, a sequence in which E184, N607 and K613 as shown in SEQ ID NO: 55 are mutated to R, a sequence in which K180, E184, N607 and K613 as shown in SEQ ID NO: 55 are mutated to R, a sequence in which T152 and G532 as shown in SEQ ID NO: 54 are mutated to R, a sequence in which T152, G532 and K538 as shown in SEQ ID NO: 54 are mutated to R, and a sequence in which T148, T152, G532 and K538 as shown in SEQ ID NO: 54 are mutated to R. Further more preferably, the nucleotide sequence of the mutated Cpf1 protein is as shown in SEQ ID NOs: 30-41.

Preferably, the nucleic acid probe is a single-stranded DNA probe, which preferably includes a fluorescent label, more preferably has a fluorescent group and a fluorescence quenching group at its two terminals, respectively, and further more preferably has a fluorescent group at a 5′ terminal and a fluorescence quenching group at a 3′ terminal. The fluorescent group may be conventional in the art, for example, 6-FAM, TET, CY3, CY5, or ROX. The fluorescence quenching group may be conventional in the art, for example, BHQ1, BHQ2, or BHQ3. The single-stranded DNA probe can be prepared according to conventional methods in the art, and its sequence may be, for example, TTTATTT.

Preferably, the crRNA has a concentration of 0.1-50 μM, and preferably 1 μM.

Preferably, the Cpf1 protein has a concentration of 20-1,000 ng/μL, and preferably 200 ng/μL.

Preferably, the nucleic acid probe has a concentration of 1-100 pmol/μL, and preferably 25 pmol/μL.

Preferably, the nucleic acid detection kit further includes a metal ion-containing solution such as a magnesium ion-containing solution and a manganese ion-containing solution; and preferably, the metal ion in the solution has a concentration of 5-600 mM, e.g., 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450 or 500 mM, etc. The point values listed are examples only and are not intended to be limiting, and it should be understood that any point value within this concentration range can be freely combined, and thus any combination of concentration ranges is intended to be within the scope of the present invention. For example, the concentration range such as 5-50, 5-100, 5-200, 5-300, 5-400, 5-500, 100-200, 100-300, and 200-300 should be within the scope of the present invention. In experiments, the inventors have found that working concentrations of the metal ion within 0.5-60 mM are all effective, and the kit generally contains a 10-fold mixed stock solution, so that a concentration of the stock solution is 5-600 mM. In a preferred embodiment of the present invention, the metal ion in the metal ion-containing solution used has a concentration of 100 mM.

Preferably, the nucleic acid detection kit further includes an RNA enzyme inhibitor and a buffer; and preferably the RNA enzyme inhibitor has a concentration of 10-200 U/μL, and preferably 40 U/μL.

Preferably, the buffer includes NaCl, Tris, and BSA, and preferably has a pH of 7.9. In a preferred embodiment of the present invention, the buffer as used is a 10× buffer consisting of 1,000 mM NaCl, 500 mM Tris, and 1,000 μg/mL BSA, pH 7.9.

To solve the aforementioned technical problem, in a sixth aspect, the present invention provides a method for detecting a nucleic acid by using the Cpf1 detection system described in the nucleic acid detection kit according to the first, third, and fifth aspects of the present invention.

Preferably, the nucleic acid in a sample to be tested is released by using a nucleic acid rapid release reagent.

Preferably, the nucleic acid is obtained by amplifying the nucleic acid in a sample to be tested, preferably by RT-RPA. The time of amplification is preferably 25±5 min, and/or the temperature of amplification is preferably 39±5° C., and/or the primers for amplification are preferably as shown in SEQ ID NOs: 24-29, SEQ ID NOs: 44-45, and SEQ ID NOs: 73-78.

Preferably, the Cpf1 detection system has a reaction temperature of 37±5° C.

Preferably, the Cpf1 detection system has a reaction time of 25±5 min.

Preferably, the method further includes the step of reading a result, preferably by a microplate reader or with naked eyes under a fluorescent lamp.

In a preferred embodiment of the present invention, the detecting method includes the following steps:

step a: using a nucleic acid rapid release reagent to inactivate a sample virus and release the nucleic acid in the sample to be tested; and

step b: amplifying nucleic acids in the sample to be tested by using isothermal amplification primers: adding the products obtained in step a into an RT-RPA isothermal amplification system with specific primers SEQ ID NO: 24 and SEQ ID NO: 25 for orf1ab gene fragments from the nucleic acid of a SARS virus, or specific primers SEQ ID NO: 26 and SEQ ID NO: 27 for upE gene fragments from the nucleic acid of a MERS virus, or specific primers SEQ ID NO: 28 and SEQ ID NO: 29 for upE gene fragments from the nucleic acid of the MERS virus, or specific primers SEQ ID NO: 44 and SEQ ID NO: 45 for E gene fragments from a SARS-CoV-2 virus, or specific primers SEQ ID NO: 73 and SEQ ID NO: 74 for S gene fragments from the SARS-CoV-2 virus, or specific primers of SEQ ID NO: 75 and SEQ ID NO: 76 for M gene fragments from the SARS-CoV-2 virus, or specific primers SEQ ID NO: 77 and SEQ ID NO: 78 for N gene fragments from the SARS-CoV-2 virus, and reacting at 37° C. for 30 min to amplify a specific product;

step c: when the Cpf1 detection system is used for identifying and cutting the orf1ab of the nucleic acid of the SARS virus or the upE gene fragment of the nucleic acid of the MERS virus or the Orf1 gene fragment of the nucleic acid of the MERS virus or the E gene fragment of the SARS-CoV-2 virus or the S gene fragment of the SARS-CoV-2 virus or the M gene fragment of the SARS-CoV-2 virus or the N gene fragment of the SARS-CoV-2 virus: adding the product obtained in step b into the Cpf1 detection system and reacting at 37° C. for 25 min; and

step d: directly detecting and interpreting whether the viral nucleic acid exists in the sample to be tested by a fluorescence microplate reader or with naked eyes under a fluorescent lamp.

To solve the aforementioned technical problem, in a seventh aspect, the present invention provides use of the nucleic acid detection kit according to the first, third, and fifth aspects of the present invention, the mutated Cpf1 protein according to the second aspect of the present invention, or the crRNA according to the fourth aspect of the present invention in detecting a nucleic acid, preferably a viral nucleic acid, or in preparation of a reagent for detecting a nucleic acid, preferably a viral nucleic acid.

Preferably, the virus is a SARS-associated coronavirus or a MERS-CoV virus; and the SARS-associated coronavirus is preferably SARS-CoV or SARS-CoV-2.

The nucleic acid detection kit for rapid detection of the nucleic acids of SARS and MERS viruses as provided by the present invention can be subjected to fluorescence detection by a microplate reader and can also be subjected to fluorescence detection with naked eyes. In the nucleic acid probe (e.g. ssDNA FQ reporter) of the present invention, when the fluorescence detection is performed by a microplate reader, the detection excitation light is set to 485 nm-520 nm; and when direct detection is performed with naked eyes, a light emitter producing a light source with a wavelength of 485 nm is selected for the detection.

In the present invention, generally, the clinical sample may be subjected to a virus inactivation treatment to release the nucleic acid from the sample to be tested. Viral RNAs can be reverse-transcribed (RT) to obtain DNAs under isothermal conditions, which can be subjected to recombinase polymerase amplification (RPA) [9]. When the fluorescent detection is used, the presence of the viral nucleic acid in the Cpf1 detection system results in the specific activation of the endonuclease activity of the Cpf1 protein mediated by the specific crRNA. The activated Cpf1 protein cleaves the ssDNA FQ reporter labeled with a fluorescent group and a fluorescence quenching group, thereby releasing the activated fluorescent group, and fluorescence reads can be detected by a microplate reader or a green reaction is visible to the naked eyes. Accordingly, when no viral nucleic acid is present in the sample to be tested, there will be no fluorescence reads or no visible green reaction.

In the present invention, the nucleic acid probe may also be generally referred to as a fluorescence-quenched single-stranded DNA (ssDNA) reporter system, which generally contains a fluorescent group and a quenching group. The fluorescence is quenched by the quenching group when the nucleic acid probe is of an intact state, and after being cleaved during the reaction, the nucleic acid probe emits fluorescence. In a preferred embodiment of the present invention, the nucleic acid probe is 5′-6-FAM/TTTATTT/BHQ1-3′.

In a preferred embodiment of the present invention, a method for preparing the Cpf1 protein may include: performing prokaryotic codon optimization on the nucleic acid sequences of cpf1 proteins from different sources to obtain the sequences SEQ ID NOs: 14-23; constructing the sequences into a pET 28a expression vector; performing low-temperature-induced soluble protein expression; and obtaining the target protein by affinity purification and molecular sieve purification.

To solve the aforementioned technical problem, the present invention further provides a method for detecting whether a subject contains a certain virus (e.g., infected with the virus), including performing detection with the nucleic acid detection kit according to the first, third, and fifth aspects of the present invention, the mutated Cpf1 protein according to the second aspect of the present invention, or the crRNA according to the fourth aspect of the present invention. The purpose of the detection is to determine whether the subject contains the nucleic acid of the virus.

Explanation of Terms

The term crRNA refers to CRISPR RNA, which is a short RNA that guides Cas12a (Cpf1) to bind to a target DNA sequence.

The term CRISPR refers to clustered regularly interspaced short palindromic repeats, which are the immune system of many prokaryotes.

The term Cas protein refers to a CRISPR-associated protein, which is an associated protein in a CRISPR system.

The term Cpf1 (also known as Cas12a) refers to a crRNA-dependent endonuclease, which is a type V enzyme in the classification of the CRISPR system.

The term PAM refers to a protospacer-adjacent motif necessary for cleavage by Cas12a, wherein the PAM for FnCas12a is a TTN sequence, and the PAM for LbCas12a is a TTTN sequence.

The term RT-RPA (reverse transcription-recombinase polymerase amplification) is used in the conventional sense of the art and generally refers to reverse transcription isothermal amplification, also known as reverse transcription-recombinase polymerase amplification.

In the present invention, the provided nucleotide sequence is generally considered as including a terminator by default, as would understood by those skilled in the art.

The preferred embodiments of the present invention can be obtained by any combination of the aforementioned preferred conditions based on common knowledge in the art.

The reagents and starting materials used in the present invention are commercially available.

The present invention has the following positive effects:

When the nucleic acid detection kit, mutated Cpf1 protein, or crRNA of the present invention are used for detecting a nucleic acid (for example, detecting the nucleic acid of a SARS-associated coronavirus or MERS coronavirus), the signal intensity during the detection is substantially enhanced, and thus the detection time is reduced and the detection efficiency is improved. In addition, the sensitivity, specificity, and accuracy are high, the detection is visual (detected directly with the naked eyes under a fluorescent lamp), the cost is low, the operation is simple, and no large-scale complex detection equipment is required. These advantages make the kits and detection methods of the present invention more suitable for the basic-level rapid detection, identification, and diagnosis of viruses such as the SARS-associated coronavirus and the MERS-coronavirus in primary experiments and clinical front-line practice. In a preferred embodiment of the present invention, the signal intensity during virus detection is increased by up to 3-5 times over the prior art. In a preferred embodiment of the present invention, the detection sensitivity is 1E8 copies of viruses when the DNA sample of the virus is detected, and 5 copies of viruses when the RNA sample of the virus is detected.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a schematic diagram of a method for enhanced Cpf1 rapid detection of a viral nucleic acid;

FIG. 2 shows the effect of different metal ions on different Cpf1 signals;

FIG. 3 shows the effect of the manganese ion on the fluorescence detection of different Cpf1 proteins;

FIG. 4 shows the effect of different manganese salts on the fluorescence detection of different Cpf1 proteins;

FIG. 5 shows the fluorescence detection effects of different crRNAs in detecting different genes of SARS and MERS viruses;

FIG. 6 shows the sensitivity of the enhanced Cpf1 fluorescence detection for DNAs of the SARS and MERS viruses;

FIG. 7 shows the sensitivity of the enhanced Cpf1 fluorescence detection for the DNAs of the SARS and MERS viruses;

FIG. 8 shows the specificity of the Cpf1 rapid fluorescence detection of the DNAs of the SARS and MERS viruses;

FIG. 9 shows the specificity of the Cpf1 rapid fluorescence detection of RNAs of the SARS and MERS viruses;

FIG. 10 shows the fluorescence results of a simulated detection of clinical nucleic acid samples;

FIG. 11 shows the effect of manganese ions on the fluorescence detection of different Cpf1 mutated proteins;

FIG. 12 shows the fluorescence detection effect of different crRNAs in detecting SARS-CoV-2 viral genes;

FIG. 13 shows the fluorescence results of a simulated detection of clinical nucleic acid samples;

FIG. 14 shows detection results of a S gene, M gene, and N gene against SARS-CoV-2;

FIG. 15 is a graph showing the results of detecting a E gene of SARS-CoV2 in different cpf1 mutants by a microplate reader;

FIG. 16 is a graph showing the results of detecting a S gene of SARS-CoV2 in different cpf1 mutants by a microplate reader;

FIG. 17 is a graph showing the results of detecting a M gene of SARS-CoV2 in different cpf1 mutants by a microplate reader; and

FIG. 18 is a graph showing the results of detecting a N gene of SARS-CoV2 in different cpf1 mutants by a microplate reader.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

The present invention will be described in detail below in connection with specific examples. It should be understood that these examples are only used for describing the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that various changes and modifications may be made to the present invention by those skilled in the art after reading the content taught by the present invention, and these equivalent forms also fall within the scope defined by the claims appended the present application.

The experimental methods in the following examples which are not specified with specific conditions are generally selected according to conventional methods and conditions or according to the product manual.

In the present invention, a TwistAmp® Basic kit as the RPA amplification kit is purchased from TwistAmp; an MEGAshortscript T7 Transcription Kit as the in vitro crRNA transcription kit and an MEGAclear Kit as the purification kit are purchased from Ambion; conventional reagents such as Tris-Base, BSA, NaCl, Tris-HCl, EDTA, EGTA, CaCl2, CoCl2, CuSO4, MgCl2, NiSO4, FeSO4, MgSO4, MnCl2, MnSO4, ZnSO4, BSA, and glycerol are available from Thermo Fisher; nucleic acid fragments for detection, ssDNA probes and RNA synthesis are completed by GenScript (Nanjing) Biotech Corp.; and the rapid nucleic acid releasing reagent from Vazyme Biotech Co., Ltd. is used for obtaining pretreated nucleic acids in the present invention.

The overall technical schematic diagram of the present invention is as shown in FIG. 1, including the following three parts: preparation of a nucleic acid sample to be tested, design and preparation of Cpf1 detection components, system construction, and fluorescence detection.

Example 1: Sensitivity-Enhanced Cpf1 Detection Assay

1. Effect of Different Metal Ions on Fluorescence Intensity for Cpf1 Detection

Cpf1 genes from different species were subjected to codon optimization in this example, with the sequences as shown in SEQ ID NOs: 14-23 (the codon-optimized nucleotide sequences respectively corresponding to AsCpf1, BbCpf1, BoCpf1, and FnCpf1 (the amino acid sequence as shown in SEQ ID NO: 55), HkCpf1, Lb4Cpf1, Lb5Cpf1, and LbCpf1 (the amino acid sequence as shown in SEQ ID NO: 54), OsCpf1 and TsCpf1), then cloned into a pet28a plasmid (this step was done by GenScript (Nanjing) Biotech Corp.), expressed in Escherichia coli, and purified for detection experiments.

The enhanced Cpf1 detection employed a 20 μL system as shown in Table 1, but not limited thereto, including the adjustment of a ratio of corresponding components, and the metal ions included CaCl2, CoCl2, CuSO4, NiSO4, FeSO4, MgSO4, MnSO4, and ZnSO4.

TABLE 1
Viral cpf1 detection system
Components Amount/Sample
10× Buffer 2 μL
Metal ion solution 1 μL
Rnase Inhibitors (40 U/μL, purchased from Vazyme 1 μL
Biotech Co., Ltd.)
CRISPR-cpf1 (200 ng/μL) 1 μL
ssDNA FQ reporter (25 pmol/μL) 1 μL
crRNA (1 μM) 1 μL
Sample (DNA reverse transcribed from DNA or RNA X μL
of the upE gene of the MERS virus or the ORF1a
gene of the MERS virus as prepared in Example 2.1)
H2O (RNA free) Up to 20 μL

The composition of the 10× buffer was: 1,000 mM NaCl, 500 mM Tris, 1,000 μg/mL BSA, and pH 7.9. The ssDNA FQ reporter is 6FAM/TTTATTT/3BHQ1.

The detection efficiency of different metal ions for crRNA3 from the nucleic acid of the MERS virus (with specific information as shown in SEQ ID NO: 6 in Table 2-1 below) was detected sequentially. A Cpf1 detection system was added with each 1 μL of 100 mM metal ion stock solution, with the other components remaining the same, the mixture was mixed homogeneously, and reacted at 37° C. for 30 min, and the above reaction products were subjected to subsequent result detection and judgment.

The activity of the Cpf1 detection system was determined with fluorescence detection. The fluorescence of the detection reaction was measured by a full-wavelength microplate reader, with an excitation wavelength of 485 nm and an emission wavelength of 520 nm, and the fluorescence value at 30 min of detection was read as the reaction value. The reaction detection results were as shown in FIG. 2. The results showed that in the detection system of the present invention, the manganese ion can increase the signal intensity for each of AsCpf1, FnCpf1, and LbCpf1, and the fluorescence intensity thereof was significantly increased compared with that of other metal ions and was 3-5 times higher than that of magnesium and iron ions (the result diagrams of AsCpf1, BbCpf1, and BoCpf1 were as shown in FIG. 2, and the resultant results of Cpf1 of other species were similar).

2. Effects of Manganese Ion on Detected Fluorescence Intensities of Different Species of Cpf1

The effects of manganese and magnesium ions on the detected fluorescence intensities of different species of Cpf1 were detected sequentially. A Cpf1 detection system was added with each 1 μL of the aforementioned different species of Cpf1 respectively, including AsCpf1, BbCpf1, BoCpf1, FnCpf1, HkCpf1, Lb4Cpf1, Lb5Cpf1, LbCpf1, OsCpf1, and TsCpf1, with the other components remaining the same (same as part 1), the mixture was mixed homogeneously and reacted at 37° C. for 30 min, and the aforementioned reaction products were subjected to subsequent detection and judgment of fluorescence intensity; the fluorescence signal of the manganese ion was divided by the fluorescence signal of the magnesium ion, and the result was as shown in FIG. 3. The result showed that in all of the different species of Cpf1 detection systems of the present invention, the manganese ion can improve the fluorescence signal intensity, with a ratio of the increase in the intensity of the manganese ion relative to the magnesium ion ranging from 3.2 to 8 times.

3. Effects of Manganese Ion on Detected Fluorescence Intensities of Different Species of Cpf1 Mutated Proteins

The effects of manganese and magnesium ions on the detected fluorescence intensities of different species of Cpf1 (LbCpf1 and FnCpf1) mutated proteins were detected sequentially. A Cpf1 detection system was added with each 1 μL of different species of Cpf1 mutated proteins, including LbCpf1 (with the amino acid sequence as shown in SEQ ID NO: 54), LbCpf1-T148R (SEQ ID NO: 36), LbCpf1-T152R (SEQ ID NO: 37), LbCpf1-G532R (SEQ ID NO: 38), LbCpf1-K536R (SEQ ID NO: 42), LbCpf1-K538R (SEQ ID NO: 39), LbCpf1-T152R/G532R (SEQ ID NO: 40), LbCpf1-T152R/G532R/K538R (SEQ ID NO: 41), FnCpf1 (with the amino acid sequence as shown in SEQ ID NO: 55), FnCpf1-K180R (SEQ ID NO: 30), FnCpf1-E184R (SEQ ID NO: 31), FnCpf1-N607R (SEQ ID NO: 32), FnCpf1-K611R (SEQ ID NO: 43), FnCpf1-K613R (SEQ ID NO: 33), FnCpf1-E184R/N607R (SEQ ID NO: 34), FnCpf1-E184R/N607R/K613R (SEQ ID NO: 35), with the other components remaining the same (same as part 1), the mixture was mixed homogeneously, and reacted at 37° C. for 30 min, and the aforementioned reaction products were subjected to subsequent detection and judgment of results, and the detection results were as shown in FIG. 11. The results showed that in the different species of Cpf1 mutation detection system of the present invention, some mutations could increase the signal intensity, but LbCpf1-K536R and FnCpf1-K611R could not increase the signal intensity. The manganese ion can increase the fluorescence signal intensity of the active mutated protein, with a ratio of the increase in the intensity of the manganese ion relative to the magnesium ion ranging from 3 to 5 times. In addition, the Cpf1 mutated protein also has a corresponding increase in fluorescent signal intensity relative to the unmutated Cpf1 protein, wherein the mutants FnCpf1-E184R, FnCpf1-N607R, FnCpf1-K613R, FnCpf1-E184R/N607R, FnCpf1-E184R/N607R/K613R, and LbCpf1-T152R, LbCpf1-G532R, LbCpf1-K538R, LbCpf1-T152R/G532R, LbCpf1-T152R/G532R/K538R had a ½-1 times increase in fluorescent signal intensity relative to their unmutated proteins.

4. Enhancing Effects of Different Forms of Manganese Salts on Signal

The effects of MnSO4, MnCl2, and Mn(CH3COO)2 on the detected fluorescence intensities of different species of Cpf1 were detected sequentially. A Cpf1 detection system was added with each 1 μL of the different species of Cpf1, including AsCpf1, BbCpf1, BoCpf1, FnCpf1, HkCpf1, Lb4Cpf1, Lb5Cpf1, LbCpf1, OsCpf1, and TsCpf1, with the other components remaining the same (same as part 1), the mixture was blended homogeneously and reacted at 37° C. for 30 min, the aforementioned reaction products were subjected to subsequent detection and judgment of fluorescence intensity, and the results were as shown in FIG. 4. The results showed that different forms of manganese salts could increase the fluorescence signal intensity in the detection system of the present invention.

Example 2: Rapid and Sensitive Detection of Gene Fragments of SARS and MERS Viruses

2.1 Nucleic Acid Preparation

In this example, the orf1ab gene of the SARS-CoV virus was referred to the AY278487 gene on NCBI, the upE gene fragment of the MERS virus was referred to the JX869059 gene on NCBI, the ORF1a gene fragment of the MERS virus was referred to the JX869059 gene on NCBI, and the E gene fragment, S gene fragment, M gene fragment, and N gene fragment of the SARS-CoV-2 virus were referred to the NC045512 genome on NCBI, which were all synthesized by GenScript (Nanjing) Biotech Corp., and named as SARS-ORF1ab, MERS-upE, MERS-ORF1a, SARS-CoV-2-E, SARS-CoV-2-S, SARS-CoV-2-M, SARS-CoV-2-N, with corresponding sequences as shown in SEQ ID NOs: 11-13, SEQ ID NO: 46, SEQ ID NOs: 79-81, respectively.

RNA nucleic acid samples corresponding to the orf1ab gene of the SARS-CoV virus, the upE gene fragment and ORF1a of the MERS virus, the E gene of the SARS-CoV-2 virus, the S gene of the SARS-CoV-2 virus, the M gene of the SARS-CoV-2 virus, and the N gene of the SARS-CoV-2 virus were prepared by in vitro transcription. The specific operation was as follows: the corresponding gene RNA samples pcRNA-SARS-orf1ab, pcRNA-MERS-upE and pcRNA-MERS-ORF1a, pcRNA-SARS-CoV-2-E, pcRNA-SARS-CoV-2-S, pcRNA-SARS-CoV-2-M, pcRNA-SARS-CoV-2-N were transcribed by using the MEGAshortscript T7 transcription kit (Thermo Fisher Scientific) with the aforementioned SARS-ORF1ab, MERS-upE, and ORF1a, SARS-CoV-2-E, SARS-CoV-2-S, SARS-CoV-2-M, SARS-CoV-2-N as templates, respectively. The transcribed RNA was purified by using the MEGAclear kit (Thermo Fisher Scientific) and recovered by an ethanol precipitation method. The resulting single-stranded RNA (ssRNA) after transcription was detected for mass and concentration, and stored at −80° C. until use.

2.2 Design and Preparation for Specific crRNA

Preparation for a specific crRNA was performed according to the following protocol: designing a 44 bp crRNA by searching for a targeting sequence containing the cpf1 recognition sequence Protospacer Adjacent Motif (PAM) TTTN against SARS-ORF1ab, MERS-upE gene, MERS-ORF1a gene, SARS-CoV-2-E gene, SARS-CoV-2-S gene, SARS-CoV-2-M gene, SARS-CoV-2-N. They were named as SARS-orf1ab-crRNA1 to SARS-orf1a-crRNA3 against the SARS-ORF1ab gene, MERS-upE-crRNA1 to MERS-upE-crRNA4 against the MERS-upE gene, MERS-ORF1a-crRNA1 to MERS-ORF1a-crRNA3 against the MERS-ORF1a gene, Cov2-E-crRNA1 to CoV2-E-crRNA7 against SARS-CoV2-E gene, Cov2-S-cr3 to CoV2-S-cr10 against SARS-CoV2-S gene, Cov2-M-cr1 to CoV2-M-cr5 against SARS-CoV2-M gene, and Cov2-N-cr1 to CoV2-N-cr4 against SARS-CoV2-N gene, respectively. After the design was complete, crRNA was prepared. The preparation of crRNA could be carried out by GenScript (Nanjing) Biotech Corp., in which an oligo could be synthesized and constructed into a vector pUC57-T7-crRNA, and the target crRNA could be obtained through in vitro transcription; or a RNA corresponding to the crRNA sequence could be synthesized directly by GenScript (Nanjing) Biotech Corp.

The crRNAs of the SARS-ORF1ab, MERS-upE gene, MERS-ORF1a gene and SARS-CoV-2-E gene, SARS-CoV-2-S gene, SARS-CoV-2-M gene, and SARS-CoV-2-N gene provided by the present invention included SEQ ID NO: 1 to SEQ ID NO: 10, SEQ ID NO: 47 to SEQ ID NO: 53, SEQ ID NO: 56 to SEQ ID NO: 72, and the specific information was as shown in Table 2-1 and Table 2-2:

TABLE 2-1
crRNA specific for nucleic acids of SARS and MERS viruses
crRNA Sequence
Number Sequence Name crRNA Sequence (5′ to 3′)
SEQ ID NO: 1 SARS-O-Cr1 UAAUUUCUACUAAGUGUAGAU
UACAGGUUAGCUAACGAGUGU
GC
SEQ ID NO: 2 SARS-O-Cr2 UAAUUUCUACUAAGUGUAGAU
UCAAGCUGUUACAGCCAAUGU
AA
SEQ ID NO: 3 SARS-O-Cr3 UAAUUUCUACUAAGUGUAGAU
AACUGAUGGUAAUAAGAUAGC
UG
SEQ ID NO: 4 MC-E-crRNA1 UAAUUUCUACUAAGUGUAGAU
GACAUAUGGAAAACGAACUAU
GU
SEQ ID NO: 5 MC-E-crRNA2 UAAUUUCUACUAAGUGUAGAU
UCCAAGAACGAAUAGGGUUGU
UC
SEQ ID NO: 6 MC-E-crRNA3 UAAUUUCUACUAAGUGUAGAU
CUAUGAACAACCCUAUUCGUUC
U
SEQ ID NO: 7 MC-E-crRNA4 UAAUUUCUACUAAGUGUAGAU
CAUAUGUCCAAAGAGAGACUA
AU
SEQ ID NO: 8 MC-O-Cr1 UAAUUUCUACUAAGUGUAGAU
ACUUAUGCAAACAUAGUCUAC
GA
SEQ ID NO: 9 MC-O-Cr2 UAAUUUCUACUAAGUGUAGAU
GUCAGCGCUGAUUGCAGUUGC
AA
SEQ ID NO: 10 MC-O-Cr3 UAAUUUCUACUAAGUGUAGAU
CAACUGCAAUCAGCGCUGACGA
A
SEQ ID NO: 47 CoV2-E-Cr1 UAAUUUCUACUAAGUGUAGAU
ACAAGACUCACGUUAACAAUA
UU
SEQ ID NO: 48 CoV2-E-Cr2 UAAUUUCUACUAAGUGUAGAU
ACACGAGAGUAAACGUAAAAA
GA
SEQ ID NO: 49 CoV2-E-Cr3 UAAUUUCUACUAAGUGUAGAU
AACACGAGAGUAAACGUAAAA
AG
SEQ ID NO: 50 CoV2-E-Cr4 UAAUUUCUACUAAGUGUAGAU
UACGUUUACUCUCGUGUUAAA
AA
SEQ ID NO: 51 CoV2-E-Cr5 UAAUUUCUACUAAGUGUAGAU
UAACACGAGAGUAAACGUAAA
AA
SEQ ID NO: 52 CoV2-E-Cr6 UAAUUUCUACUAAGUGUAGAU
ACGUUUACUCUCGUGUUAAAA
AU
SEQ ID NO: 53 CoV2-E-Cr7 UAAUUUCUACUAAGUGUAGAU
CGUUUACUCUCGUGUUAAAAA
UC

TABLE 2-2
crRNA specific for SARS and MERS virus nucleic acids
crRNA Sequence Sequence
Number Name crRNA Sequence (5′ to 3′)
SEQ ID NO: 56 CoV2-S-cr3 UaaUUUcUacUaagUgUagaUACAAG
ACUCACGUUAACAAUAUU
SEQ ID NO: 57 CoV2-S-cr4 UaaUUUcUacUaagUgUagaUACACG
AGAGUAAACGUAAAAAGA
SEQ ID NO: 58 CoV2-S-cr5 UaaUUUcUacUaagUgUagaUAACAC
GAGAGUAAACGUAAAAAG
SEQ ID NO: 59 CoV2-S-cr6 UaaUUUcUacUaagUgUagaUUACGU
UUACUCUCGUGUUAAAAA
SEQ ID NO: 60 CoV2-S-cr7 UaaUUUcUacUaagUgUagaUUAACA
CGAGAGUAAACGUAAAAA
SEQ ID NO: 61 CoV2-S-cr8 UaaUUUcUacUaagUgUagaUACGUU
UACUCUCGUGUUAAAAAU
SEQ ID NO: 62 CoV2-S-cr9 UaaUUUcUacUaagUgUagaUCGUUU
ACUCUCGUGUUAAAAAUC
SEQ ID NO: 63 CoV2-S-cr10 UaaUUUcUacUaagUgUagaUACuCCu
GGuGAuuCuuCuuCAGG
SEQ ID NO: 64 CoV2-M-cr1 UaaUUUcUacUaagUgUagaUuAGAA
GCGGuCuGGuCAGAAuAG
SEQ ID NO: 65 CoV2-M-cr2 UaaUUUcUacUaagUgUagaUGGCAG
GuCCuuGAuGuCACAGCG
SEQ ID NO: 66 CoV2-M-cr3 UaaUUUcUacUaagUgUagaUuuuAGG
CAGGuCCuuGAuGuCAC
SEQ ID NO: 67 CoV2-M-cr4 UaaUUUcUacUaagUgUagaUuAAuA
AGAAAGCGuuCGuGAuGu
SEQ ID NO: 68 CoV2-M-cr5 UaaUUUcUacUaagUgUagaUuuAuuA
CAAAuuGGGAGCuuCGC
SEQ ID NO: 69 CoV2-N-cr1 UaaUUUcUacUaagUgUagaUuuGAAC
uGuuGCGACuACGuGAu
SEQ ID NO: 70 CoV2-N-cr2 UaaUUUcUacUaagUgUagaUCuGCuG
CuuGACAGAuuGAACCA
SEQ ID NO: 71 CoV2-N-cr3 UaaUUUcUacUaagUgUagaUCuCuCA
AGCuGGuuCAAuCuGuC
SEQ ID NO: 72 CoV2-N-cr4 UaaUUUcUacUaagUgUagaUGCCuuG
uuGuuGuuGGCCuuuAC

2.3 Reverse Transcription Isothermal Amplification Reaction

In this example, single-stranded RNA (ssRNA) viral nucleic acids prepared in 2.1 above were pre-amplified by using reverse transcription isothermal amplification (RT-RPA) for the cpf1 detection reaction. Amplification primers RT-RPA-F (forward primer) and RT-RPA-R (reverse primer) for Rt-RPA were designed and synthesized according to the requirements of isothermal amplification reaction (Table 3). According to the RT-RPA isothermal amplification procedure, a sample to be tested was amplified. The specific operation was as follows: isothermal amplification was performed in a 50 μL reaction system. x μL of RNA sample, (18.5-x) μL of ddH2O, 2 μL of the respective RPA-F in Table 3, 2 μL of RPA-R, and 25 μL of reaction buffer were blended, and the mixture was added into the reaction tube to dissolve and blend homogeneously. Finally, 2.5 μL of magnesium acetate was added, the mixture was blended homogeneously and incubated at 39° C. for 30 min. RT-RPA product samples were detected in the next step.

TABLE 3
RT-RPA primer sequences specific for nucleic acid of coronavirus CoV
SEQ Name Primer Name Primer Sequence
SEQ ID NO: 24 SARS-orf1ab-RPA-F CTAACATGCTTAGGATAATGGC
CTCTCTTGTTC
SEQ ID NO: 25 SARS-orf1ab-RPA-R GTAAGCGTAAAACTCATCCACG
AATTCATGATC
SEQ ID NO: 26 MERS-upE-RPA-F CTCGCTTATCGTTTAAGCAGCT
CTGCGCTACTATG
SEQ ID NO: 27 MERS-upE-RPA-R CTCGCTTATCGTTTAAGCAGCT
CTGCGCTACTATG
SEQ ID NO: 28 MERS-Orf1-RPA-F CTATTCCCACACAGTTGTTCCC
ACTCTTAT
SEQ ID NO: 29 MERS-Orf1-RPA-R CTTGAGGCTTCTCCAATGCTAT
AAGTGTAC
SEQ ID NO: 44 CoV2-E-RPA-F TGTACTCATTCGTTTCGGAAGA
GACAGGTACG
SEQ ID NO: 45 Cov2-E-RPA-R TAGACCAGAAGATCAGGAACT
CTAGAAGAATTCAG
SEQ ID NO: 73 CoV2-S-RPA-F GGAAAGTGAGTTCAGAGTTTA
TTCTAGTGCGA
SEQ ID NO: 74 CoV2-S-RPA-R CACAGTCTACAGCATCTGTAAT
GGTTCCAT
SEQ ID NO: 75 CoV2-M-RPA-F CTACTTCATTGCTTCTTTCAGA
CTGTTTGC
SEQ ID NO: 76 CoV2-M-RPA-R TTATAGTTGCCAATCCTGTAGC
GACTGTAT
SEQ ID NO: 77 CoV2-N-RPA-F ATCGTGCTACAACTTCCTCAAG
GAACAACA
SEQ ID NO: 78 CoV2-N-RPA-R GCAATTTGCGGCCAATGTTTGT
AATCAGTT

2.4 In this example, as shown in Table 4, the enhanced cpf1 detection was conducted in a 20 μL system, but not limited thereto, including the adjustment of a ratio of corresponding components:

TABLE 4
Virus cpf1 detection system
Components Amount/Sample
10× Buffer 2 μL
Metal ion solution 1 μL
Rnase Inhibitors (40 U/μL) 1 μL
CRISPR-cpf1 (200 ng/μL) 1 μL
ssDNA FQ reporter (25 pmol/μL) 1 μL
crRNA (1 μM) 1 μL
Sample X μL
H2O (RNA-free) Up to 20 μL

2.5 Fluorescence Detection with a Full-Wavelength Microplate Reader

In a fluorescence detection by a microplate reader, 2 μL of 10× buffer, 1 μL of L Rnase Inhibitors, 1 μL of Cpf1, 1 μL of L ssDNA FQ reporter, 5 μL of the RT-RPA product sample obtained in 2.3 above, 1 μL of L crRNA, and 9 μL of H2O were added to a system for detecting a target gene by Cpf1 sequentially. The components were blended homogeneously and reacted at 37° C. for 30 min. In the above reaction system, the concentration of Rnase Inhibitors was 40 U/μL, the concentration of Cpf1 was 200 ng/μL, the concentration of ssDNA FQ reporter was 25 pM/μL, and the concentration of crRNA was 1 nM/μL.

Firstly, the detection efficiency of crRNA against the orf1ab gene of SARS-CoV, upE gene of MERS virus, ORF1a gene of MERS virus, E gene of SARS-CoV-2, S gene of SARS-CoV-2, M gene of SARS-CoV-2, and N gene of SARS-CoV-2 were detected sequentially. To a Cpf1 detection system was added 1 μL of crRNA respectively, with the other components remaining the same, the mixture was mixed homogeneously, and reacted at 37° C. for 30 min, and the above reaction products were subjected to subsequent results detection and judgment.

The activity of the Cpf1 detection system was determined with a fluorescence detection. The fluorescence of the detection reaction was measured by a full-wavelength microplate reader, with an excitation wavelength of 485 nm and an emission wavelength of 520 nm, and the detected fluorescence value at 30 min was read as the reaction value. The results for different crRNA against SARS-CoV and MERS virus were as shown in FIG. 5. The results showed that in the detection system of the present invention, crRNA against different gene fragments could effectively and specifically detect the corresponding gene fragments. The detection results of E gene against SARS-CoV-2 were as shown in FIG. 12, wherein CoV2-E-Cr4 and CoV2-E-Cr5 could not be detected, CoV2-E-Cr3 and CoV2-E-Cr6 had a low detection efficiency, and CoV2-E-Cr1, CoV2-E-Cr2, and CoV2-E-Cr7 had a high detection efficiency. In subsequent experiments, CoV2-E-Cr1, CoV2-E-Cr2, and CoV2-E-Cr7 were mixed to prepare SARS-CoV2-Crmix for a subsequent detection of SARS-CoV-2-E gene. The detection results of the S gene, M gene, and N gene against SARS-CoV-2 were as shown in FIG. 14, and crRNA against different gene fragments can efficiently and specifically detect the corresponding gene fragments. CoV2-S-Cr3, CoV2-S-Cr5, and CoV2-S-Cr6 had a higher detection efficiency for SARS-CoV-2-S gene, and these three crRNA were mixed to prepare CoV2-S-Crmix for subsequent monitoring of SARS-CoV-2-S gene; wherein CoV2-M-Cr1, CoV2-M-Cr2, and CoV2-M-Cr4 had a higher detection efficiency for SARS-CoV-2-M gene, and these three crRNA were mixed in subsequent experiments to prepare CoV2-M-Crmix for subsequent monitoring of SARS-CoV-2-M gene; wherein, CoV2-N-Cr1, CoV2-N-Cr2, and CoV2-N-Cr6 had a higher detection efficiency for SARS-CoV-2-N, and these three crRNA were mixed to prepare CoV2-N-Crmix for subsequent monitoring of SARS-CoV-2-N gene.

In view of the consistent detection effect of crRNA against SARS-orf1ab and MERS-upE genes in this example, SARS-O-crRNA1 to SARS-O-crRNA3 against the SARS-orf1ab gene were mixed in an equal proportion to obtain SARS-O-Crmix; MERS-E-crRNA1 to MERS-E-crRNA4 against the MERS-upE gene were mixed in an equal proportion to obtain MERS-E-Crmix; MERS-O-crRNA1 to MERS-O-crRNA3 against the MERS-Orf gene were mixed in an equal proportion to obtain MERS-O-Crmix. In the subsequent detection, the SARS-orf1ab gene was detected by SARS-O-Crmix, the MERS-upE gene was detected by MERS-E-Crmix, and the MERS-Orf gene was detected by MERS-O-Crmix.

Example 3: High-Sensitivity Detection of Viral Nucleic Acid Based on cpf1 Fluorescence Method

In this example, to measure the effect of the cpf1 fluorescence method on the detection sensitivity, the following detection was performed.

(1) Firstly, according to the DNA sample corresponding to SARS-orf1ab, MERS-upE, and MERS-Orf1 gene fragments as described in 2.1 of Example 2, the molecular weight of the detection fragment was calculated, and gradient dilution was performed to obtain the detection sample containing 5E9, 1E9, 5E8, 1E8, 5E7, and 1E7 copies per microlitre (copy/μL).

The above diluted sample was subjected to a cpf1-specific reaction by the fluorescence method, and detection and interpretation of fluorescence results were performed according to the detection procedure in Example 2. The operation was briefly described as follows: 1 μL of gradient diluted samples were added into a 20 μL of cpf1 fluorescent nucleic acid detection system (wherein the added crRNA was SARS-O-Crmix for detecting SARS-orf1ab gene, MERS-E-Crmix for detecting MERS-upE gene, or MERS-O-Crmix for detecting MERS-Orf gene as described above), the mixture was blended homogeneously and reacted at 37° C. for 30 min to interpret the fluorescence results.

In this example, SARS and MERS viruses were detected with an enhanced cpf1 fluorescence method by a microplate reader, respectively (see FIG. 6 for the results), resulting in the high-sensitivity detection of 1E8 copies of viruses with high sensitivity.

(2) Secondly, according to the RNA samples corresponding to SARS-orf1ab, MERS-upE, and MERS-Orf1 gene fragments as described in 2.1 of Example 2, the molecular weight of the detection fragments was calculated, and gradient dilution was performed to obtain the detection samples containing 1000, 100, 10, and 5 copies per microliter (copy/μL).

The above diluted sample was subjected to a cpf1-specific reaction by the fluorescence method, and detection and interpretation of fluorescence results were performed according to the detection procedure in Example 2. The operation was briefly described as follows: 1 μL of gradient diluted samples were added to a 50 μL of RT-RPA isothermal amplification reaction system for amplification. 10 μL of isothermal amplification products were added into a 20 μL of cpf1 fluorescent nucleic acid detection system (wherein the added crRNA was SARS-O-Crmix for detecting SARS-orf1ab gene, MERS-E-Crmix for detecting MERS-upE gene, or MERS-O-Crmix for detecting MERS-Orf gene as described above), the mixture was blended homogeneously, and reacted at 37° C. for 25 min to interpret the fluorescence results.

In this example, SARS and MERS virus RNA were detected with a cpf1 fluorescence method by a microplate reader, respectively (see FIG. 7 for the results), resulting in the high-sensitivity detection of 5 copies of viruses with high sensitivity.

Example 4: High-Specificity Detection of Nucleic Acid of Virus Based on cpf1 Fluorescence Method

In this example, the following detection was carried out to examine whether the cpf1 fluorescence method can perform a highly specific reaction and effectively distinguish SARS-CoV from MERS virus.

(1) Firstly, the specificity of the viral DNA was detected.

According to the nucleic acid detection segments SARS-orf1ab and MERS-upE of SARS-CoV and MERS virus in the present invention, with reference to the method in Example 2, DNA samples corresponding to the gene sequence of MERS virus (SARS-ORF1ab, MERS-upE, and MERS-Orf1) were prepared.

Referring to Example 2, the above DNA samples were mixed, and to the enhanced Cpf1 detection system were sequentially added 2 μL Buffer, 1 μL Rnase Inhibitors, 1 μL Cpf1, 1 μL ssDNA FQ reporter, 1 μL crRNA (wherein the added crRNA was the above SARS-O-Crmix for detecting SARS-orf1ab gene, MERS-E-Crmix for detecting MERS-upE gene, or MERS-O-Crmix for detecting MERS-Orf gene) and 1 μL detection sample. The components were blended homogeneously and reacted at 37° C. for 30 min. In this assay system, Rnase Inhibitors had a concentration of 40 U/μL, Cpf1 had a concentration of 200 ng/μL, ssDNA DB reporter had a concentration of 25 pM/μL, and crRNA had a concentration of 1 nM/μL.

In this example, the activity of the Cpf1 detection system was determined with a fluorescence detection. The fluorescence of the detection reaction was measured by a full-wavelength microplate reader, with an excitation wavelength of 485 nm and an emission wavelength of 520 nm, and the detected fluorescence value at 30 min was read as the reaction value. The detection results were as shown in FIG. 8a (T1, T2, T3, and T4 in FIG. 8 are formulated samples, respectively, wherein T1 is DNA known to be free of SARS or MERS-upE genes, T2 is DNA known to contain the SARS gene; T3 is DNA known to contain the MERS-upE gene; T4 is DNA known to contain SARS and MERS-upE genes. Mers-Crmix in FIG. 8 refers to MERS-E-Crmix described above, and SARS-Crmix refers to SARS-O-Crmix described above). Meanwhile, the product after the cpf1 detection reaction for 30 min was placed under a 485 nm laser lamp, and the result could be directly interpreted with the naked eyes. When crRNA specifically recognized the target nucleic acid fragment, the color of the reaction product changed from colorless to fluorescent green; accordingly, if there was no corresponding target nucleic acid to be detected, the reaction product remained colorless. After thecpf1 detection reaction for 30 min, the results were interpreted with the naked eyes under fluorescence and recorded by photography. As shown in FIG. 8b, crRNA targeting different gene fragments could effectively and specifically detect the corresponding gene fragments with high specificity and accurate detection results.

(2) Secondly, the specificity of the virus RNA was detected.

According to the nucleic acid detection segments SARS-ORF1ab, MERS-upE, and MERS-Orf1 of SARS-CoV and MERS virus in the present invention, with reference to the method in Example 2, RNA samples corresponding to the gene sequence of MERS virus (SARS-ORF1ab, MERS-upE, and MERS-Orf1) were prepared.

Referring to Example 2, SARS-CoV and MERS virus detection samples were separately amplified by RT-RPA reaction. The RNA samples were mixed, and into the enhanced Cpf1 detection system were sequentially added 2 μL Buffer, 1 μL Rnase Inhibitors, 1 μL Cpf1, 1 μL ssDNA FQ reporter, 1 μL crRNA, and 10 μL detection samples. The components were blended homogeneously and reacted at 37° C. for 30 min. In this assay system, Rnase Inhibitors have a concentration of 40 U/μL, Cpf1 has a concentration of 200 ng/μL, ssDNA DB reporter has a concentration of 25 pM/μL, and crRNA has a concentration of 1 nM/μL.

In this example, the activity of the Cpf1 detection system was determined with a fluorescence detection. The fluorescence of the detection reaction was measured by using a full-wavelength microplate reader, with an excitation wavelength of 485 nm and an emission wavelength of 520 nm, and the detected fluorescence value at 30 min was read as the reaction value. The detection results were as shown in FIG. 9a (T5, T6, T7, and T8 in FIG. 9 are formulated samples, respectively, wherein T5 is RNA known to be free of SARS or MERS-upE genes, T6 is RNA known to contain the SARS gene; T7 is RNA known to contain the MERS-upE gene; T8 is RNA known to contain SARS and MERS-upE genes. Mers-Crmix in FIG. 9 refers to MERS-E-Crmix, and SARS-Crmix refers to SARS-O-Crmix described above). Meanwhile, the product after the cpf1 detection reaction for 30 min was placed under a 485 nm laser lamp, and the result could be directly interpreted with the naked eyes. When crRNA specifically recognized the target nucleic acid fragment, the color of the reaction product changed from colorless to fluorescent green; accordingly, if there was no corresponding target nucleic acid to be detected, the reaction product remained colorless. After the cpf1 detection reaction for 30 min, the results were interpreted with the naked eyes under fluorescence and recorded by photography. As shown in FIG. 9b, crRNA targeting different gene fragments can effectively and specifically detect the corresponding gene fragments with high specificity and accurate detect results.

Example 5: Rapid Detection of Nucleic Acid of Clinical Virus by a Simulated cpf1 Fluorescence Method

This example simulated the nucleic acid of clinical tissue samples for rapid detection. This detection did not involve any clinical SARS and MERS virus samples, and all operations were qualified according to relevant laws and regulations and relevant provisions.

In this example, an RNA sample corresponding to SARS-CoV nucleic acid (SARS-orf1ab) and an RNA sample corresponding to the MERS virus nucleic acid (MERS-orf1ab and MERS-upE) in Example 2 were first spotted onto a throat swab to simulate a clinical sample for detection.

(1) Firstly, the virus was inactivated and the viral nucleic acid was released. A rapid nucleic acid release agent purchased from Vazyme Biotech Co., Ltd. was used in this example to obtain pretreated nucleic acids. The steps were as follows: the throat swabs were added to 50 μL of PBS to simulate the dissolution of the virus into a liquid. 3 μL of the sample to be tested was taken, added with 20 μL of a nucleic acid lysis solution and a RNA enzyme inhibitor, allowed to stand at room temperature for 3 min, then added with 20 μL of a neutralization solution, and blended homogeneously for the next detection. In the Cpf1 detection, 5 μL of each sample to be tested was taken and subjected to RT-RPA pre-amplification with the steps same as those in Example 1 to obtain a Cpf1 detection sample.

To the Cpf1 detection system were sequentially added 2 μL Buffer, 1 μL Rnase Inhibitors, 1 μL Cpf1, 1 μL ssDNA FQ reporter, 10 μL RPA sample, and 1 μL crRNA. The components were blended homogeneously and reacted at 37° C. for 25 min.

In this example, the cpf1 detection results were observed with the naked eyes under a fluorescent lamp or directly determined by a microplate reader. As shown in FIG. 10, the simulated clinical negative and positive samples could be effectively determined and detected by a microplate reader with the cpf1 fluorescence method of the present invention. Similarly, under light, the simulated clinical negative and positive samples could be effectively determined with the naked eyes under a fluorescent lamp (FIG. 10, CS1-CS6 in the figure were formulated samples respectively, wherein CS1, CS2, and CS6 were samples known to be positive for SARS-CoV, and the rest were samples known to be negative for SARS and negative for MERS. Mers-Crmix in the figure referred to MERS-E-Crmix, and SARS-Crmix referred to the above-mentioned SARS-O-Crmix). It could be seen that the detection method in the present invention was fast, visual, low in cost, and simple in operation, while the accuracy of the results obtained was high.

(2) Similarly, samples of CS7 to CS12 were prepared in simulated clinical mode, in which CS8, CS10, and CS11 are samples known to be SARS-CoV-2 positive, CS9 is a sample known to be MERS-CoV positive, and the rest were samples known to be SARS-CoV-2 negative and MERS-CoV negative. The detection was performed by a method similar to that in (1) above, and then the cpf1 detection results were observed with the naked eyes under a fluorescent lamp or directly determined by a microplate reader. As shown in FIG. 13 (MERS-Crmix is MERS-E-Crmix in the figure), the simulated clinical negative and positive samples could be effectively determined and detected by a microplate reader with the cpf1 fluorescence method of the present invention. It could be seen that the detection method of the present invention is high in accuracy.

In addition, combining the results of the above examples, it could be further seen that when the ligand ion of Cpf1 in the reaction system was replaced with a manganese ion, the signal intensity of the detection could be significantly increased when detecting nucleic acids of different viruses (SARS-CoV, MERS-CoV, SARS-CoV-2, etc.), thus indicating that the manganese ion system had universality.

Example 6: Rapid Detection of Different Genes of Nucleic Acid of Clinical SARS-CoV-2 Virus by Simulated cpf1 Fluorescence Method

This example simulated rapid detection of nucleic acids of clinical tissue samples. This detection did not involve any clinical SARS-CoV-2 sample, and all operations were qualified according to relevant laws and regulations and relevant provisions.

In this example, firstly, an RNA sample corresponding to the nucleic acid of the SARS-CoV-2 virus (CoV2-E-gene, CoV2-S-gene, CoV2-M-gene, and CoV2-N-gene) was spotted onto a throat swab to simulate a clinical sample for detection.

(1) Firstly, the virus was inactivated and the viral nucleic acid was released. A rapid nucleic acid release agent purchased from Vazyme Biotech Co., Ltd. was used in this example to obtain pretreated nucleic acids. The steps were as follows: the throat swab was added into 50 μL of PBS to simulate the dissolution of the virus into a liquid. 3 μL of the sample to be tested was taken, added with 20 μL of a nucleic acid lysis solution and an RNA enzyme inhibitor, allowed to stand at room temperature for 3 min, then added with 20 μL of a neutralization solution, and blended homogeneously for the next detection. In the Cpf1 detection, 5 μL of each sample to be tested was taken and subjected to RT-RPA pre-amplification with the steps same as those in Example 1 to obtain a Cpf1 detection sample.

To the Cpf1 detection system were sequentially added 2 μL Buffer, 1 μL Rnase Inhibitors, 1 μL Cpf1 or Cpf1 mutated protein, 1 μL ssDNA FQ reporter, 10 μL RPA sample, and 1 μL crRNA, 1 μL Mn2+ or Mg2+, the components were blended homogeneously and reacted at 37° C. for 25 min.

In this example, the detection results of cpf1 and mutation thereof could be directly determined by a microplate reader. As shown in FIGS. 15, 16, 17, and 18, different cpf1 mutants in the present invention could detect the S gene, M gene, N gene, and E gene of SARS-CoV2 by a microplate reader. Effective detection could be performed by adding Mg2+ and Mn2+ ions, but the addition of Mn2+ enabled signals to be stronger, and the manganese ion system had universality.

REFERENCES

  • 1. R, B., et al., CRISPR provides acquired resistance against viruses in prokaryotes. Science (New York, N.Y.), 2007. 315(5819): p. 1709-12.
  • 2. L A, M. and S. E J, CRISPR interference limits horizontal gene transfer in staphylococci by targeting DNA. Science (New York, N.Y.), 2008. 322(5909): p. 1843-5.
  • 3. B, Z., et al., Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell, 2015. 163(3): p. 759-71.
  • 4. I, F., et al., The CRISPR-associated DNA-cleaving enzyme Cpf1 also processes precursor CRISPR RNA. Nature, 2016. 532(7600): p. 517-21.
  • 5. J S, C., et al., CRISPR-Cpf1 target binding unleashes indiscriminate single-stranded DNase activity. Science (New York, N.Y.), 2018. 360(6387): p. 436-439.
  • 6. González, J M. et al., A comparative sequence analysis to revise the current taxonomy of the family Coronaviridae, Gomez-Puertas P, Cavanagh D, Gorbalenya A E, Enjuanes L. Arch Virol. 2003; 148(11): p. 2207-35.
  • 7. Ksiazek, T G. et al., A novel coronavirus associated with severe acute respiratory syndrome. N Engl J Med, 2003, 348(20): p. 1953-1966
  • 8. Zaki, A M. et al., Isolation Of A Novel Coronavirus From A Man With Pneumonia In Saudi Arabia. N Engl J Med, 2012, 367(19): p. 1814-20.
  • 9 O, P., et al., DNA detection using recombination proteins. PLoS biology, 2006. 4(7): p. e204.

Claims

1. A nucleic acid detection kit, comprising a Cpf1 detection system which comprises:

a guide RNA, a Cpf1 protein, a nucleic acid probe, and a manganese ion-containing solution.

2. The nucleic acid detection kit according to claim 1, wherein the manganese ion-containing solution is a manganese sulfate, manganese chloride, or manganese acetate solution;

or the nucleic acid probe is a single-stranded DNA probe which preferably comprises a fluorescent label, more preferably has a fluorescent group and a fluorescence quenching group at its 5′ and 3′ terminals, respectively, and further more preferably has a fluorescent group at its 5′ terminal and a fluorescence quenching group at its 3′ terminal; the fluorescent group is preferably 6-FAM, TET, CY3, CY5, or ROX, the fluorescence quenching group is preferably BHQ1, BHQ2, or BHQ3, and a sequence of the single-stranded DNA probe is TTTATTT;

or the Cpf1 protein is selected from one or more of AsCpf1, BbCpf1, BoCpf1, FnCpf1, HkCpf1, Lb4Cpf1, Lb5Cpf1, LbCpf1, Oscpf1, and TsCpf1;

or the Cpf1 protein is a codon-optimized Cpf1 protein, the nucleotide sequence of which is preferably as shown in one or more of SEQ ID NOs: 14-23;

or the Cpf1 protein is a mutated Cpf1 protein, which preferably has an amino acid sequence with 98%, and preferably more than 99% sequence homology to a native Cpf1 protein;

a sequence of the mutated Cpf1 protein more preferably comprises a sequence in which one or more sites of K180, E184, N607 and K613 as shown in SEQ ID NO: 55 are mutated to R, or one or more sites of T148, T152, G532 and K538 as shown in SEQ ID NO: 54 are mutated to R;

further more preferably comprises a sequence in which E184 and N607, E184, N607 and K613, or K180, E184, N607 and K613 as shown in SEQ ID NO: 55 are mutated to R, or a sequence in which T152 and G532, T152, G532 and K538, or T148, T152, G532 and K538 as shown in SEQ ID NO: 54 are mutated to R; and most preferably the nucleotide sequence is as shown in SEQ ID NOs: 30-41.

3. The nucleic acid detection kit according to claim 1, wherein the guide RNA is an RNA that guides the Cpf1 protein to specifically bind to the nucleic acid, and preferably a crRNA; the crRNA is preferably a crRNA for detecting a viral nucleic acid; more preferably a crRNA for detecting a SARS-associated coronavirus or MERS-CoV virus; and the SARS-associated coronavirus is preferably a SARS-CoV or SARS-CoV-2 coronavirus;

preferably, the crRNA is a crRNA for detecting an orf1ab gene of the SARS-CoV virus, a crRNA for detecting an orf1a gene of the MERS-CoV virus, a crRNA for detecting an upE gene of the MERS-CoV virus, a crRNA for detecting a E gene of the SARS-CoV-2 virus, a crRNA for detecting an S gene of the SARS-CoV-2 virus, a crRNA for detecting an M gene of the SARS-CoV-2 virus, or a crRNA for detecting an N gene of the SARS-CoV-2 virus; a nucleotide sequence of the orf1ab gene is as shown in SEQ ID NO: 11, a nucleotide sequence of the orf1a gene is as shown in SEQ ID NO: 12, a nucleotide sequence of the upE gene is as shown in SEQ ID NO: 13, and a nucleotide sequence of the E gene is as shown in SEQ ID NO: 46; a nucleotide sequence of the SARS-CoV-2-S gene is as shown in SEQ ID NO: 79; a nucleotide sequence of the SARS-CoV-2-M gene is as shown in SEQ ID NO: 80; and a nucleotide sequence of the SARS-CoV-2-N gene is as shown in SEQ ID NO: 81;

more preferably, a nucleotide sequence of crRNA is preferably as shown in one or more of SEQ ID NOs: 1-10, SEQ ID NO: 47, SEQ ID NO: 48 and SEQ ID NO: 53, and SEQ ID NOs: 56-72.

4. The nucleic acid detection kit according to claim 1, wherein the manganese ion-containing solution has a concentration of manganese ions of 5-600 mM, and preferably 100 mM;

or the nucleic acid probe has a concentration of 1-100 pmol/μL, and preferably 25 pmol/μL;

or the Cpf1 protein has a concentration of 20-1,000 ng/μL, and preferably 200 ng/μL;

or the guide RNA has a concentration of 0.1-50 μM, and preferably 1 μM;

or the nucleic acid detection kit further comprises an RNA enzyme inhibitor and a buffer;

preferably the RNA enzyme inhibitor has a concentration of 10-200 U/μL, and preferably 40 U/μL; preferably the buffer comprises NaCl, Tris, and BSA, and the pH of the buffer is preferably 7.9.

5. A mutated Cpf1 protein, wherein a sequence of it comprises a sequence in which one or more sites of K180, E184, N607 and K613 as shown in SEQ ID NO: 55 are mutated to R; or alternatively, the sequence of it comprises a sequence in which one or more sites of T148, T152, G532 and K538 as shown in SEQ ID NO: 54 are mutated to R;

preferably, a sequence of the mutated Cpf1 protein comprises a sequence in which E184 and N607, E184, N607 and K613, or K180, E184, N607 and K613 as shown in SEQ ID NO: 55 are mutated to R; or a sequence in which T152 and G532, T152, G532 and K538, or T148, T152, G532 and K538 as shown in SEQ ID NO: 54 are mutated to R;

more preferably, a nucleotide sequence of the mutated Cpf1 protein is as shown in SEQ ID NOs: 30-41.

6. A nucleic acid detection kit comprising a Cpf1 detection system, wherein the Cpf1 detection system comprises: a guide RNA, a nucleic acid probe, and a mutated Cpf1 protein according to claim 5;

preferably, the guide RNA is an RNA that guides the Cpf1 protein to specifically bind to the nucleic acid, and preferably a crRNA; the crRNA is preferably a crRNA for detecting a viral nucleic acid; more preferably a crRNA for detecting a SARS-associated coronavirus or a MERS-CoV virus; the SARS-associated coronavirus is preferably a SARS-CoV or SARS-CoV-2 coronavirus; the crRNA is a crRNA for detecting an orf1ab gene of the SARS-CoV virus, a crRNA for detecting an orf1a gene of the MERS-CoV virus, a crRNA for detecting an upE gene of the MERS-CoV virus, a crRNA for detecting a E gene of the SARS-CoV-2 virus, a crRNA for detecting an S gene of the SARS-CoV-2 virus, a crRNA for detecting an M gene of the SARS-CoV-2 virus or a crRNA for detecting an N gene of the SARS-CoV-2 virus; a nucleotide sequence of the orf1ab gene is as shown in SEQ ID NO: 11, a nucleotide sequence of the orf1a gene is as shown in SEQ ID NO: 12, a nucleotide sequence of the upE gene is as shown in SEQ ID NO: 13, and a nucleotide sequence of the E gene is as shown in SEQ ID NO: 46; a nucleotide sequence of the SARS-CoV-2-S gene is as shown in SEQ ID NO: 79; a nucleotide sequence of the SARS-CoV-2-M gene is as shown in SEQ ID NO: 80; a nucleotide sequence of the SARS-CoV-2-N gene is as shown in SEQ ID NO: 81; and more preferably, a nucleotide sequence of the crRNA is as shown in one or more of SEQ ID NOs: 1-10, SEQ ID NO: 47, SEQ ID NO: 48 and SEQ ID NO: 53, and SEQ ID NOs: 56-72;

or the nucleic acid probe is a single-stranded DNA probe which preferably comprises a fluorescent label, more preferably has a fluorescent group and a fluorescence quenching group at its two terminals, respectively, and further more preferably has a fluorescent group at a 5′ terminal and a fluorescence quenching group at a 3′ terminal; the fluorescent group is preferably 6-FAM, TET, CY3, CY5, or ROX, the fluorescence quenching group is preferably BHQ1, BHQ2, or BHQ3, and a sequence of the single-stranded DNA probe is for example TTTATTT;

or the guide RNA has a concentration of 0.1-50 μM, and preferably 1 μM;

or the mutated Cpf1 protein has a concentration of 20-1,000 ng/μL, and preferably 200 ng/μL;

or the nucleic acid probe has a concentration of 1-100 pmol/μL, and preferably 25 pmol/μL;

or the nucleic acid detection kit further comprises a metal ion-containing solution;

preferably a metal ion in the solution has a concentration of 5-600 mM, and preferably 100 mM;

or the nucleic acid detection kit further comprises an RNA enzyme inhibitor and a buffer;

preferably the RNA enzyme inhibitor has a concentration of 10-200 U/μL, and preferably 40 U/μL; preferably the buffer comprises NaCl, Tris, and BSA, and the pH of the buffer is preferably 7.9.

7. A crRNA for detecting a nucleic acid of a coronavirus, wherein the crRNA is a crRNA for detecting an orf1ab gene of a SARS-CoV virus, a crRNA for detecting an orf1a gene of a MERS-CoV virus, a crRNA for detecting an upE gene of the MERS-CoV virus, a crRNA for detecting a E gene of a SARS-CoV-2 virus, a crRNA for detecting an S gene of the SARS-CoV-2 virus, a crRNA for detecting an M gene of the SARS-CoV-2 virus, or a crRNA for detecting an N gene of the SARS-CoV-2 virus; a nucleotide sequence of the orf1ab gene is as shown in SEQ ID NO: 11, a nucleotide sequence of the orf1a gene is as shown in SEQ ID NO: 12, a nucleotide sequence of the upE gene is as shown in SEQ ID NO: 13, and a nucleotide sequence of the E gene is as shown in SEQ ID NO: 46; a nucleotide sequence of the SARS-CoV-2-S gene is as shown in SEQ ID NO: 79; a nucleotide sequence of the SARS-CoV-2-M gene is as shown in SEQ ID NO: 80; and a nucleotide sequence of the SARS-CoV-2-N gene is as shown in SEQ ID NO: 81;

wherein, the nucleotide sequence of the crRNA for detecting the orf1ab gene of the SARS-CoV virus is preferably as shown in one or more of SEQ ID NOs: 1-3; the nucleotide sequence of the crRNA for detecting the orf1a gene of the MERS-CoV virus is preferably as shown in one or more of SEQ ID NOs: 4-7; the nucleotide sequence of the crRNA for detecting the upE gene of the MERS-CoV virus is preferably as shown in one or more of SEQ ID NOs: 8-10; the nucleotide sequence of the crRNA for detecting the E gene of the SARS-CoV-2 virus is preferably as shown in SEQ ID NOs: 47, 48 and 53; the nucleotide sequence of the crRNA for detecting the S gene of the SARS-CoV-2 virus is preferably as shown in one or more of SEQ ID NOs: 56-63; the nucleotide sequence of the crRNA for detecting the M gene of the SARS-CoV-2 virus is preferably as shown in one or more of SEQ ID NOs: 64-68; and the nucleotide sequence of the crRNA for detecting the N gene of the SARS-CoV-2 virus is preferably as shown in one or more of SEQ ID NOs: 69-72.

8. A nucleic acid detection kit comprising a Cpf1 detection system, wherein the Cpf1 detection system comprises the crRNA, Cpf1 protein, and nucleic acid probe according to claim 7;

preferably, the Cpf1 protein is selected from one or more of AsCpf1, BbCpf1, BoCpf1, FnCpf1, HkCpf1, Lb4Cpf1, Lb5Cpf1, LbCpf1, Oscpf1, and TsCpf1, or those having 98%, preferably 99%, or more sequence homology to the amino acid sequence thereof;

or the Cpf1 protein is a codon-optimized Cpf1 protein of which a nucleotide sequence is preferably as shown in one or more of SEQ ID NOs: 14-23;

or the nucleic acid probe is a single-stranded DNA probe which preferably comprises a fluorescent label, more preferably has a fluorescent group and a fluorescence quenching group at its two terminals, respectively, and further more preferably has a fluorescent group at a 5′ terminal and a fluorescence quenching group at a 3′ terminal; the fluorescent group is preferably 6-FAM, TET, CY3, CY5, or ROX, the fluorescence quenching group is preferably BHQ1, BHQ2, or BHQ3, and the sequence of the single-stranded DNA probe is for example TTTATTT;

or the crRNA has a concentration of 0.1-50 μM, and preferably 1 μM;

or the Cpf1 protein has a concentration of 20-1,000 ng/μL, and preferably 200 ng/μL;

or the nucleic acid probe has a concentration of 1-100 pmol/μL, and preferably 25 pmol/μL;

or the nucleic acid detection kit further comprises a metal ion-containing solution;

preferably a metal ion in the solution has a concentration of 5-600 mM, and preferably 100 mM;

or the nucleic acid detection kit further comprises an RNA enzyme inhibitor and a buffer;

preferably the RNA enzyme inhibitor has a concentration of 10-200 U/μL, and preferably 40 U/μL; and preferably the buffer comprises NaCl, Tris, and BSA, and the pH of the buffer is preferably 7.9.

9. A method for detecting a nucleic acid, wherein the nucleic acid is detected by using the Cpf1 detection system in the nucleic acid detection kit according to claim 1;

preferably, the nucleic acid in a sample to be tested is released by using a nucleic acid rapid release reagent;

or the nucleic acid is obtained by amplifying the nucleic acid in the sample to be tested, preferably by RT-RPA; a time of the amplification is preferably 25±5 min, a temperature of the amplification is preferably 39±5° C., and primers for the amplification are preferably as shown in SEQ ID NOs: 24-29, SEQ ID NOs: 44-45, and SEQ ID NOs: 73-78;

or the Cpf1 detection system has a reaction temperature of 37±5° C.;

or the Cpf1 detection system has a reaction time of 25±5 min;

or the method further comprises the step of reading a result, preferably by a microplate reader or with naked eyes under a fluorescent lamp.

10. A method for detecting a nucleic acid, preferably a viral nucleic acid, or for preparing of a reagent for detecting a nucleic acid, preferably a viral nucleic acid by using the nucleic acid detection kit according to claim 1;

preferably, the virus is a SARS-associated coronavirus or a MERS-CoV virus; and the SARS-associated coronavirus is preferably a SARS-CoV or SARS-CoV-2.

11. A method for detecting a nucleic acid, wherein the nucleic acid is detected by using the Cpf1 detection system in the nucleic acid detection kit according to claim 6;

preferably, the nucleic acid in a sample to be tested is released by using a nucleic acid rapid release reagent;

or the nucleic acid is obtained by amplifying the nucleic acid in the sample to be tested, preferably by RT-RPA; a time of the amplification is preferably 25±5 min, a temperature of the amplification is preferably 39±5° C., and primers for the amplification are preferably as shown in SEQ ID NOs: 24-29, SEQ ID NOs: 44-45, and SEQ ID NOs: 73-78;

or the Cpf1 detection system has a reaction temperature of 37±5° C.;

or the Cpf1 detection system has a reaction time of 25±5 min;

or the method further comprises the step of reading a result, preferably by a microplate reader or with naked eyes under a fluorescent lamp.

12. A method for detecting a nucleic acid, wherein the nucleic acid is detected by using the Cpf1 detection system in the nucleic acid detection kit according to claim 8;

preferably, the nucleic acid in a sample to be tested is released by using a nucleic acid rapid release reagent;

or the nucleic acid is obtained by amplifying the nucleic acid in the sample to be tested, preferably by RT-RPA; a time of the amplification is preferably 25±5 min, a temperature of the amplification is preferably 39±5° C., and primers for the amplification are preferably as shown in SEQ ID NOs: 24-29, SEQ ID NOs: 44-45, and SEQ ID NOs: 73-78;

or the Cpf1 detection system has a reaction temperature of 37±5° C.;

or the Cpf1 detection system has a reaction time of 25±5 min;

or the method further comprises the step of reading a result, preferably by a microplate reader or with naked eyes under a fluorescent lamp.

13. A method for detecting a nucleic acid, preferably a viral nucleic acid, or for preparing of a reagent for detecting a nucleic acid, preferably a viral nucleic acid by using the nucleic acid detection kit according to claim 6;

preferably, the virus is a SARS-associated coronavirus or a MERS-CoV virus; and the SARS-associated coronavirus is preferably a SARS-CoV or SARS-CoV-2.

14. A method for detecting a nucleic acid, preferably a viral nucleic acid, or for preparing of a reagent for detecting a nucleic acid, preferably a viral nucleic acid by using the nucleic acid detection kit according to claim 8;

preferably, the virus is a SARS-associated coronavirus or a MERS-CoV virus; and the SARS-associated coronavirus is preferably a SARS-CoV or SARS-CoV-2.

15. A method for detecting a nucleic acid, preferably a viral nucleic acid, or for preparing of a reagent for detecting a nucleic acid, preferably a viral nucleic acid by using the mutated Cpf1 protein according to claim 5;

preferably, the virus is a SARS-associated coronavirus or a MERS-CoV virus; and the SARS-associated coronavirus is preferably a SARS-CoV or SARS-CoV-2.

16. A method for detecting a nucleic acid, preferably a viral nucleic acid, or for preparing of a reagent for detecting a nucleic acid, preferably a viral nucleic acid by using the crRNA according to claim 7;

preferably, the virus is a SARS-associated coronavirus or a MERS-CoV virus; and the SARS-associated coronavirus is preferably a SARS-CoV or SARS-CoV-2.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class: