US20230323354A1
2023-10-12
18/012,867
2021-06-28
The present invention relates to an artificial RNA having at least one hybridization region against one or more target disruption structures of one or more RNA fragments, wherein such an artificial RNA suitable for disrupting by hybridization one or more target disruption structures of one or more RNA fragments, thereby modulating the functionality of the one or more RNA fragments.
Get notified when new applications in this technology area are published.
C12N15/1131 » CPC main
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides against viruses
C12N2310/532 » CPC further
Structure or type of the nucleic acid; Physical structure partially self-complementary or closed Closed or circular
C12N15/113 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
The present invention relates to the field of biotechnology. In particular, the present invention relates to artificial RNAs as defined in the present invention. More particularly, the present invention relates to artificial RNAs suitable for disrupting by hybridization one or more target disruption structures of one or more RNA fragments, thereby modulating the one or more RNA fragments.
BACKGROUND OF THE INVENTIONA vast amount of research and development is underway to extend the range of medicines in general, such as antivirals to treat pathogens currently without commercial treatments or to treat cancer. Also, with the tendency of viruses and tumoral cells to mutate and become drug resistant, the need of the hour is to develop and refresh the pipeline of antitumorals and/or antivirals with new therapies. The opportunities available for this market, according to a recent market report (https://www.mordorintelligence.com/industry-reports/global-antiviral-drugs-market-industry), are (i) an increasing need for broad-spectrum antiviral drugs and (ii) access to antiviral drugs in the pharmerging markets.
Current approved and effective antiviral treatments include molecules that specifically interact with viral proteins essential for the viral life cycle. Developing these therapeutic molecules is costly and highly time consuming. Moreover, every molecule functions solely for a specific virus. Multiple efforts have been made to develop RNA-based antiviral treatments to target the viral RNA genome [Brice A Sullenger and Smita Nair. From the RNA world to the clinic. Science 352 (6292), 1417-1420]. These include the design of 19 nucleotide-long micro RNAs (miRNAs) that specifically interact with viral RNA genomes, leading to their subsequent degradation by the cellular RISC system. Although successful in cell culture, a major drawback for their clinical use is the rapid emergence and selection of mutations in the RNA genome that inhibit the interaction with the miRNAs. Another drawback of miRNAs as antiviral molecules is their stability, as they are naturally degraded by the cellular decay machinery.
Because of the cost and time required to develop new therapeutic agents against viral proteins, RNA-based therapeutics has generated a lot of attention in the last years. RNA-based therapies have been able to address targets untreatable with antibody and small-molecule approaches [Ling-Ling Chen. The biogenesis and emerging roles of circular RNAs. Nature Reviews Molecular Cell Biology 17, 205-211 (2016), doi:10.1038/nrm.2015.32]. Consequently, multiple companies have been created to develop RNA-based therapies to treat multiple diseases. For instance, the company Moderna is developing an mRNA-based vaccine against infection caused by SARS-CoV-2 (Covid-19). These companies focus on the use of antisense, siRNAs, aptamers and microRNA mimics/anti-microRNAs. However, these molecules (i) are rapidly degraded and (ii) share with protein- and antibodies-based therapies the emergence of drug resistance by the high tendency of viruses to mutate.
The present inventors have particularly focused their approach on stable artificial RNAs, such as circular RNAs. Circular RNAs (circRNAs) are back-splicing products of precursor mRNAs that appear naturally in the cell (see review [Ling-Ling Chen. The biogenesis and emerging roles of circular RNAs. Nature Reviews Molecular Cell Biology 17, 205-211 (2016), doi:10.1038/nrm.2015.32]). Previously thought to be irrelevant byproducts, are now proven to perform several functions, such as miRNA sponges and RBP (RNA binding proteins) sponges. Circular RNA has no ends. This is very important, since most mRNA degradation pathways in the cell require 5′or 3′ ends for the cellular exonucleases to carry out their degradation function. Consequently, circRNAs are extremely stable molecules. The potential of circRNAs as novel therapeutic platforms have not been fully exploited.
WO2017/222911 discloses the use of circular RNAs generated with exogenous introns to stimulate immune response or circular RNAs generated with endogenous introns to prevent immune recognition of foreign RNA.
WO0061595 discloses a covalently-closed multiple antisense (CMAS)-oligo, which is constructed to form a closed type by ligation using complementary primer, and a ribbon-type antisense (RiAS)-oligo, which is composed of two loops containing multiple antisense sequences and a stem connecting the two loops that is constructed to by ligation using complementary sequences at both 5 prime ends.
WO 2013/162350 A2 relates to the use of circular RNAs composed of 2 purine rich domains that can target viral pyrimidine rich regions in order to form triple helices that can block viral replication.
CN 108165549 A relates to the use of circular RNAs as micro-RNA sponges. It presents an artificial formulation of the well-known function of endogenous circRNAs, where multiple partial complementarity regions target mature micro-RNAs that activate AGO2 pathway upon hybridization.
In addition, there is an increasing need for better understanding molecular mechanisms underlying many pathologies, such as cancer, viral infections, autoimmune diseases, neurological diseases, genetic disorders, etc. In most of these pathologies, RNAs play a role in the underlying mechanisms. Hence, there is a need for tools which would allow the study of the specific functions of the RNAs involved in the molecular mechanisms involving pathologies.
The present invention addresses the above problems, and is directed to tools which allow the modulation of the functionality of RNA fragments, such as, e.g., viral genome, which allow multiple applications. For instance, with the tools of the present invention (artificial RNAs) it is possible to study the structure-function relationship of a certain RNA fragment, or certain regions within a certain RNA fragment. In addition, with the RNAs of the present invention, it is possible to prevent and/or treat diseases where RNA fragments are involved, such as viral infections, cancer, immune diseases, genetic disorders, etc. For instance, with the artificial RNA of the present invention it is possible to study RBPs (ribosome binding proteins) that bind to double stranded RNA motifs.
SUMMARY OF THE INVENTIONIn a first aspect, the present invention provides an artificial circular RNA suitable for disrupting by hybridization one or more target disruption structures of one or more RNA fragments,
Preferably, the artificial circular RNA according to the first aspect or any of its embodiments comprises between 6 and 20 hybridization regions. Preferably, the least two, and preferably all, of the hybridization regions are capable of completely hybridizing with the same target hybridization region. Preferably, the least two, and preferably all, of the hybridization regions have different nucleotide sequences.
Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the 2 or more hybridization regions are:
Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the one or more RNA fragments is selected from mRNA, tRNA, rRNA, non-coding RNA and viral genomic RNA.
Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the one or more RNA fragments is viral genomic RNA.
Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the one or more RNA fragments is positive-sense single-stranded viral genomic RNA.
Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the viral genomic RNA is selected from Influenza virus, HAV, Poliovirus, Coxsackie B virus, Coronavirus and Rhinovirus (common cold).
Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the viral genomic RNA is selected from Hepatitis C virus, Dengue, Zika, Chikungunya, West Nile and Yellow Fever virus.
Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the viral genomic RNA is from Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)
Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the at least one or more target disruption structures are selected from the group consisting of:
Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the at least one or more target disruption structures comprises or consists of the target disruption structures selected from the list consisting of SEQ ID NOs.:76, 77, 78 and/or 79 from Hepatitis C virus, and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs: 25, 26, 27 and 28.
Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the at least one or more target disruption structures comprises or consists of the target disruption structures selected from the list consisting of SEQ ID NO.:29 and/or 30 from Dengue virus, and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs.: 29 and 30.
Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the at least one or more target disruption structures comprises or consists of the target disruption structures selected from the list consisting of SEQ ID NOs.: 80, 81 and/or 82 from Chikungunya, and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs.: 33, 35, and 31.
Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the at least one or more target disruption structures comprise or consist of the target disruption structure of SEQ ID NO.: 83 from West Nile and the target hybridization regions is SEQ ID NO.: 37.
Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the at least one or more target disruption structures comprise or consists of the target disruption structures selected from the list consisting of SEQ ID NOs.: 84, 58, 85, 86, and/or 87 from Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs.: 62, 58, 59, 60, and 61.
Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the at least one or more target disruption structures comprise or consists of the target disruption structures selected from the list consisting of SEQ ID NOs.: 30 and/or 79 from Dengue Virus and Hepatitis C Virus, and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs.: 30 and 28.
Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the at least one or more target disruption structures comprise or consists of the target disruption structures selected from the list consisting of SEQ ID NOs SEQ ID NOs.: 30 and/or 83 from Dengue Virus and West Nile Virus, and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs.: 30 and 37.
Preferably, the sequence of the artificial circular RNA according to the first aspect or any of its embodiments comprises, or preferably, consists of, the following nucleotides defined in: SEQ ID NO: 2, 3, 4, 5, 6 (for Hepatitis C virus); 8, 9, 10 (for Dengue virus); 12, 13, 14, 15, 39 (for Chikungunya virus); 16 and 17 (broad spectrum activity for both Hepatitis C virus and Dengue Virus); 24 and 19 (for West Nile Virus); 21, 22 and 23 (broad spectrum activity for both Dengue and West Nile Viruses); 32 (broad spectrum activity for both Hepatitis C virus and Dengue Virus); 36, 38, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 65, 66, 67, 68, 69, 70, 71, 72 (for Severe acute respiratory syndrome coronavirus 2).
Preferably, the one or more target hybridization region of the artificial circular RNA which completely hybridize with the two or more hybridization regions is comprised in the artificial RNA defined in SEQ ID NO.: 1, SEQ ID NO.: 7, SEQ ID NO.: 11, SEQ ID NO.: 34 and/or SEQ ID NO.: 20.
In a second aspect, the present invention relates to a composition comprising the artificial RNA of the invention.
In a third aspect, the present invention relates to a kit comprising the artificial RNA and/or the composition of the present invention.
In a fourth aspect, the present invention relates to the artificial RNA and/or the composition of the present invention for use as a medicament, preferably for use in a method of preventing and/or treating a viral infection. Preferably, the viral infection is caused by Hepatitis C virus, Hepatitis A virus, Poliovirus, Influenza virus, Coxsackie B virus, rhinovirus (common cold), Dengue, Zika, Chikungunya, West Nile, Yellow Fever virus or coronavirus, such as SARS and/or MERS, preferably SARS-CoV-2.
In a sixth aspect, the present invention provides a method of screening for artificial circular RNA comprising two or more hybridization regions capable of disrupting by hybridization one or more target disruption structures of one or more RNA fragments, wherein the target disruption structures are defined as:
FIG. 1 represents schematically the intracellular production of antiviral circRNA. This figure describes how a circular RNA can be produced within the target cell. First, the figure shows a plasmid containing a CMV promoter, two complementary and repetitive regions surrounding the candidate circular RNA and flanking splicing acceptor and donor sites. This plasmid is transfected into the target cell. The cell then transcribes the linear RNA as shown, and the area between the splice donor and acceptor sites gets circularized through backsplicing.
FIG. 2. Synthesis and circularization of RNA. Workflow composed of four major steps: (A) production of T7 promoter-flanked templates by PCR. (B) RNA preparation by in vitro transcription. (C) Generation of specific termini for ligation. In vitro transcribed RNAs have to be dephosphorylated prior in vitro circularization. (D) Ligation with T4 RNA Ligase 1 or circRNA Ligase. Circular or linear oligomers can be formed as side products.
FIG. 3 represents schematically the mode of action.This figure shows the mode of action of a circular RNA as it hinders viral cycle. Viruses contain RNA structures in their genome that are vital for their life cycles. The circular RNA targets those structures by binding to them in a way that a conformational change occurs that hinders vital steps of the virus life cycle.
FIG. 4 represents schematically an example of a relevant mode of action. This figure shows an example of how hybridization of the circular RNA can alter viral cycle. First, RNA binding proteins (RBPs) are necessary for many steps in the viral life cycle. These RBPs generally bind specific regions of the viral genome, where both sequence and structure (or structural context) are necessary. Similar to the figure, an example is the binding of PTB in the last domain of the IRES element of many picornaviruses, which binds to a box of single stranded pyrimidines immediately 3′ of a stable haripin. As in the right drawing, when a circular RNA binds a certain structured region of the IRES and the single stranded region preceding this structured region, it changes the RNA structure in such a way that the box of pyrimidines is not in the same estructural context anymore, and therefore the RBP cannot bind to it.
FIG. 5 represents an example of a circRNA that targets 3 different regions of the viral genome (or 3 different viral genomes) with 2 hybridization sequences per target region. Regions with the same color represent that they target the same viral region.
FIG. 6 represents schematically the RNA secondary structure of the beginning and end of the HCV genome. Highlighted are the regions to which our circular RNAs are designed to target to.
FIG. 7 represents schematically the results of 4 of the designed RNAs against HCV genome. The ids of the circRNAs correspond to the target regions shown in the previous figure. As it can be seen, infection is lowered up to 20% with respect to the control.
FIG. 8 represents schematically the RNA secondary structure of the DENV genome. Highlighted are the regions to which our circular RNAs are designed to target to.
FIG. 9 represents schematically the results of 3 of the designed RNAs against DENV genome. The ids of the circRNAs correspond to the target regions shown in the previous figure. As it can be seen, infection is lowered up to 40% with respect to the control.
FIG. 10 represents the results of the 4 designed RNAs against CHIKV genome. As it can be seen, infection is lowered up to 50% with respect to the control.
FIG. 11 represents the results of a broadspectrum circRNA designed against both DENV and HCV genomes when used to treat DENV infection. HCV_CDS2 is one of the circRNAs in example 1 and used here as negative control. DENV1_chp is one of the circRNAs in example 2 and used here as positive control.
FIG. 12 represents the results of a broadspectrum circRNA designed against both DENV and HCV genomes when used to treat HCV infection. HCV_CDS2 is one of the circRNAs in example 1 and used here as positive control. DENV1_chp is one of the circRNAs in example 2 and used here as negative control.
FIG. 13 represents the results of a second broadspectrum circRNA designed against both DENV and HCV genomes when used to treat DENV infection. HCV_CDS2 is one of the circRNAs in example 1 and used here as negative control. DENV1_chp is one of the circRNAs in example 2 and used here as positive control.
FIG. 14 represents the results of a second broadspectrum circRNA designed against both DENV and HCV genomes when used to treat HCV infection. HCV_CDS2 is one of the circRNAs in example 1 and used here as positive control. DENV1_chp is one of the circRNAs in example 2 and used here as negative control.
FIG. 15 represents the results of the two designed RNAs against West Nile virus (WNV) genome, circ wnv_slll 1 and circ wnv_slll 2. As it can be seen, infection is lowered with respect to the control.
FIG. 16 represents the results of three broadspectrum circRNAs designed against both WNV and DENV (dchp_wsll_A, dchp_wsll_B and dchp_wsll_C) when used to treat WNV infection. Positive and negative controls from examples 2 and 5 were used. As it can be seen, all circRNA showed inhibition.
FIG. 17 represents the results of three broadspectrum circRNAs designed against both WNV and DENV (dchp_wsll_A, dchp_wsll_B and dchp_wsll_C) when used to treat DENV infection. Positive and negative controls from examples 2 and 5 were used. As it can be seen, all circRNA showed inhibition.
FIG. 18 represents the capacity of the designed RNA against HCV in inhibiting chronically infected cells with HCV. CircRNAs inhibit infectivity in HCV chronically infected cells. Huh7/Scr cells were infected with HCV and 48hpi transfected with circ_hcv_cds2. Two days later luciferase values were measured. Effects on infectivity are determined by changes in luciferase expression levels.
FIG. 19 represents the result of the designed RNA against a region required for HCV RNA replication and its ability to inhibit HCV replication. Circ_hcv_cds2, which targets a region required for HCV RNA replication, inhibits HCV RNA replication. Circ_hcv_cds2 inhibited luciferase levels 48 hours post infection when HCV RNA is translated and replicated but not at 4 hours post infection when HCV RNA is solely translated. Effects on infectivity are determined by changes in luciferase expression levels. Statistical significance was calculated using a T-test (*represents p-value < 0.05).
FIG. 20 represents the result of the designed RNA against a region required for DENV RNA replication and its ability to inhibit DENV replication. Circ_dv_3utr and circ_dv_cHP_v1, designed to target structures within the DENV RNA genome directing RNA replication, inhibit DENV RNA replication. The circ_dv_3utr and circ_dv_cHP_v1 inhibit luciferase expression levels at 48 hours when the RNA genome is translated and replicated but not at 8 hours when is solely translated. All Results were obtained from at least three biological replicates. Statistical significance was calculated using a T-test (*represents p-value < 0.05).
FIG. 21. Artificial circRNA structure and mode of action. 1) CircRNAs contain several different hybridization (brown regions H) and separation sequences (light grey regions S). Hybridization sequences target the viral RNA genome (dark grey regions) and separation sequences allow for structural flexibility and physical separation among the hybridization ones. Note that all H and S sequences are different among themselves. 2) Hybridization regions are designed to target and disrupt a particular viral RNA genome structure, leading to a decrease in infectivity. The hybridization starts in a single stranded region, an external or hairpin loop or a pseudoknot and finish within a helix, so that the helix is disrupted.
FIG. 22. WNV structures used for the design of circWNV. Representation of the 5′-UTR (above) and 3′-UTR (below) from WNV genome. In red the hybridization regions used for the design of the circWNV. UTR: untranslated region [Adapted from Fernandez-Sanlés et al., 2017, Front. Microbiol. 8, 1-16].
FIG. 23. Schematic CHIKV structures used for the design of circCHIKV. Representation of the predicted 5′-UTR (A), RSE (B) and Recording Element (C). In A and B all the structure is targeted by the circRNA in C, the hybridization region is depicted in red. UTR: untranslated region; RSE: repetitive sequence elements. [Adapted from Kendra et al., 2018, Virology 339, 200-212; and from Khan et al., 2002, J. Gen. Virol. 83, 3075-3084].
FIG. 24. Designed broad-spectrum circRNAs impair both DENV and HCV infectivity. Cells were transfected with the circRNA dv_chp_v1, the circRNA hcv_cds2 or the broad-spectrum circRNA (circ dchp_hcv_cds2_2) containing hybridization sequences from circRNA dv_chp_v1 and circRNA hcv_cds2. Next, cells were infected either with DENV or HCV harbouring the luciferase reporter gene and 48h later the infectivity was measured. All results were obtained from at least three biological replicates. Effects on infectivity are determined by changes in luciferase expression levels. Statistical significance was calculated using a T-test (*represents p-value < 0.05).
FIG. 25. Depicts the protocol to obtain circular RNAs in vitro.
FIG. 26. Shows the results of both a circular RNA against DNV and WNV and a circular RNA against HCV generated in vitro.
FIG. 27. Shows types of target disruption structures (inner line) and target hybridization regions (outer line).
FIG. 28. Exemplifies the relationship between target disruption structure, target hybridization region and hybridization region, and it shows the mechanism of disruption by hybridization.
FIG. 29. Comparison of cleavage efficiency of different Hammerhead ribozymes.
FIG. 30. Gel with different magnesium conditions.
FIG. 31. Gel showing different IVT times.
FIG. 32. Gel showing the RNAse R effect without gel purification.
FIG. 33. Shows the efficacy results of the circRNAs designed against SARS-Cov2.
FIG. 34. Shows the efficacy of an in vitro generated circRNA against SARS-Cov2.
DETAILED DESCRIPTION OF THE INVENTION DefinitionsIn describing the present disclosure, the following terms will be used and are defined as indicated below.
The forms “a”, “an” and “the” include plural referents unless the context states otherwise.
The term “about” when referred to a given amount or quantity is meant to include deviations of plus or minus five percent.
The term “artificial circular RNAs” or “circular RNAs” or “circRNAs” is used herein to refer to non-coding RNAs forming covalently closed continuous loops which have the 3′ and 5′ ends joint together, thus they are missing the 5′-cap and in consequence the polyadenylated tail. Therefore, they are resistant to exonuclease-mediated degradation and to debranching enzymes, which confers them higher stability with respect to other RNAs.
The term “complementary” and “complementarity” are interchangeable and refer to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands or regions. Complementary polynucleotide strands or regions can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G). 100% (or total) complementary refers to the situation in which each nucleotide unit of one polynucleotide strand or region can hydrogen bond with each nucleotide unit of a second polynucleotide strand or region. Less than perfect (or partial) complementarity refers to the situation in which some, but not all, nucleotide units of two strands or two regions can hydrogen bond with each other and can be expressed as a percentage.
The term “hybridization” is used to refer to the structure formed by 2 independent strands of RNA that form a double stranded structure via base pairings from one strand to the other. These base pairs are considered to be G-C, A-U and G-U. (A - Adenine, C -Cytosin, G-Guanine, U - Uracil). As in the case of the complementarity, the hybridization can be total or partial.
The term “transfection or “transfect” is used to refer to the uptake of circular RNA by a cell. A cell has been “transfected” when the circular RNA has been introduced inside the cell membrane.
“Stem-loop intramolecular base pairing” (“stem-loops”) is a pattern that can occur in single-stranded DNA or, more commonly, in RNA. The structure is also known as a “hairpin” or “hairpin loop”. It occurs when two regions of the same strand, usually complementary in nucleotide sequence when read in opposite directions, base-pair to form a double helix that ends in an unpaired loop. The resulting structure is a key building block of many RNA secondary structures. The base-pairing of the helix need not be complete, there could be stretches of single stranded nucleotides, which are called “bulges” or “internal loops”. As an important secondary structure of RNA, it can direct RNA folding, protect structural stability for messenger RNA (mRNA), provide recognition sites for RNA binding proteins, and serve as a substrate for enzymatic reactions.
“Internal-loops” (also termed “interior loops”), in RNA, are found where the double stranded RNA separates due to no Watson-Crick base pairing between the nucleotides. Internal-loops can be classified as either symmetrical or asymmetrical, with some asymmetrical internal-loops, also known as bulges. Internal-loops differ from stem-loops as they occur in the middle of a stretch of double stranded RNA.
“External-loops” are stretches of single-stranded nucleotides that separate hairpin loops or multi-loops.
“Multi-loops” are branching off of a double-stranded region into several hairpin loops.
In the context of the present invention a “target disruption structure” is a stem loop (or hairpin loop), preferably preceded or followed by a stretch of unpaired nucleotides, (external loop, bulge or internal loop or multiloop, see FIG. 27).
In the context of the present invention, a “target hybridization region” is a region within a target disruption structure composed of a single stranded region preceded or followed by a double-stranded region. The target hybridization region is thus a region that, upon hybridization of another RNA strand, yields the disruption of the structure to which it belongs to.
“Disruption by hybridization”: given a target disruption structure, a target hybridization region and an artificial RNA that completely hybridizes with the target hybridization region, disruption by hybridization occurs when the energy of the hybridization is more favourable than the energy of the target disruption structure (more negative). Upon such hybridization, the structure of the target disruption structure changes, at least, completely for the overlap between the target disruption structure and the target hybridization region. Such energy calculations can be obtained in silico using well established software like RNAcofold (Lorenz, Ronny and Bernhart, Stephan H. and Höner zu Siederdissen, Christian and Tafer, Hakim and Flamm, Christoph and Stadler, Peter F. and Hofacker, Ivo L., ViennaRNA Package 2.0, Algorithms for Molecular Biology, 6:1 26, 2011, doi:10.1186/1748-7188-6-26; Reuter, J. S., & Mathews, D. H. (2010). RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics. 11,129; Mathews, D. H., et al., “Predicting oligonucleotide affinity to nucleic acid targets”, RNA, 1999 5: 1458-1469), RNAstructure (https://rna.urmc.rochester.edu/RNAstructure.html), Mfold (http://unafold.rna.albany.edu/?q=mfold, M. Zuker, “Mfold web server for nucleic acid folding and hybridization prediction”, Nucleic Acids Res. 31 (13), 3406-3415, 2003) or Vienna package (http://rna.tbi.univie.ac.at/; Lorenz, Ronny and Bernhart, Stephan H. and Höner zu Siederdissen, Christian and Tafer, Hakim and Flamm, Christoph and Stadler, Peter F. and Hofacker, Ivo L., ViennaRNA Package 2.0, Algorithms for Molecular Biology, 6:1 26, 2011, doi: 10.1186/1748-7188-6-26).
“Viral conserved structure” refers to viral genomic RNA structures which are conserved among members of the same species, genus, family, etc. Those structures are sometimes characterized in the literature and have been experimentally validated. In the absence of such experimental proof, there exists software that can predict such structures in silico. For instance, all viral genomes of the same family can be aligned, using for example ClustalW, and then using RNAz (RNAz 2.0: Improved noncoding RNA detection, Gruber AR, Findeiβ S, Washietl S, Hofacker IL, Stadler PF. Pac Symp Biocomput. 15:69-79, 2010; Nucleic Acids Res. 1994 Nov 11; 22(22): 4673-4680, doi: 10.1093/nar/22.22.4673, PMCID: PMC308517, PMID: 7984417; CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice, J D Thompson, D G Higgins, and T J Gibson). RNAz predicts structured regions that are more thermodynamically stable than expected by comparison to random sequences of the same length and sequence composition (z-score), and additionally assesses regions by the support of compensatory and consistent mutations in the sequence alignment. Such conserved structures are believed to be so due to its functional relevance in the life-cycle of the virus. Within example 14, we show how some these viral conserved structures have been found.
The term 5′UTR refers to the region upstream of the coding region, immediately before the start codon.
The term “IRES” is defined as an internal ribosome entry site and is an RNA element that allows for translation initiation in a cap-independent manner, as part of the greater process of protein synthesis. In eukaryotic translation, initiation typically occurs at the 5′ end of mRNA molecules, since 5′ cap recognition is required for the assembly of the initiation complex. The location for IRES elements is often in the 5′UTR, but can also occur elsewhere in mRNAs.
The term CDS refers to the coding region of a messenger RNA or a viral genome. This is the region that codes for the corresponding protein.
The term 3′UTR refers to the region of the viral genome downstream of the CDS, immediately after the stop codon.
The term “cHP” means “capsid-coding region hairpin element” which is a known region of several flavivirus genomes found within the CDS.
The term “RSE” means “conserved repeated sequence element” and it is a known structure found in the 3′UTR of several alphavirus genomes.
“SRVVLC”, structured region vital for the viral life cycle, are structured regions of the RNA viral genome which are vital in the viral replication, encapsidation and/or translation, i.e., if disrupted, the virus is less capable of performing essential functions of its life cycle and thus, the virus is less infective.
“Administering” an artificial RNA to a cell comprises transducing, transfecting, electroporating, translocating, fusing, phagocytosing, shooting or ballistic methods, etc., i.e., any means by which a nucleic acid can be transported across a cell membrane.
“Homology region” refers to regions in different virus strains/serotypes which share common structural and/or functional characteristics. Homologous structures do not imply sequence identity as a necessary condition. The skilled person is able to identify homologous regions in other viral strains/serotypes as the ones defined in the present application by conventional means.
The degree of identity between two sequences can be determined by conventional methods, for example, by means of standard sequence alignment algorithms known in the state of the art, such as, for example BLASTn (Altschul S.F. et al. Basic local alignment search tool. J Mol Biol. 1990 Oct 5; 215(3):403-10).
During the description of the claims, the word “comprising”, and its variants does not intend to exclude other technical characteristics, additives, components or steps. In addition, the term “comprising” may also encompass the term “consisting of”.
Description of the InventionIn general, RNA fragments such as mRNA, tRNA, rRNA, non-coding RNA, viral RNA genomes, viral mRNAs, etc., contain highly structured regions (regions with secondary structure) which are either essential for their function or which, while not being essential, may play a more or less important role in the functionality of said RNA fragment. These highly structured regions comprise hairpin loops or at least portions of hairpin loops preceded or followed by a region of unpaired nucleotides. If the structure (such as the secondary structure) of these hairpin loops or portions of hairpin loops is altered, conformational changes within the RNA fragment take place. This would lead to changes in the functionality of the RNA fragment.
Biological RNA is single stranded and often forms complex and intricate base-pairing interactions due to its increased ability to form hydrogen bonds stemming from the extra hydroxyl group in the ribose sugar. The secondary structure of RNA consists of a single polynucleotide which is folded within the same molecule. Base pairing in RNA occurs when RNA folds between complementarity regions. Both single- and double-stranded regions are often found in RNA molecules. The antiparallel strands form a helical shape. The four basic elements in the secondary structure of RNA are helices, loops, bulges, and junctions. Stem-loop or hairpin loop is the most common element of RNA secondary structure. Stem-loop is formed when the RNA chains fold back on themselves to form a double helical tract called the stem, the unpaired nucleotides form a single stranded region called the loop.
The secondary structure of RNA can be predicted either computationally or with experimental methods. Computationally, RNA secondary structure can be predicted from one or several nucleic acid sequences using tools publically available to the skilled person, e.g., Vienna package, as described above.
As outlined above, RNA structure such as RNA secondary structure is important in many biological processes, including translation regulation in messenger RNA, replication of single-stranded RNA viruses, and the function of structural RNAs and RNA/protein complexes. In fact, for many RNA molecules, the secondary structure is highly important to the correct function of the RNA — often more so than the actual sequence.
Hence, changes in the secondary structure of the RNA fragments will inevitably lead to changes in the functionality of the RNA fragments.
The artificial RNAs of the present invention, preferably circRNAs, are able to change the secondary structure of the RNA fragments they target. Accordingly, with the artificial RNAs of the present invention it is possible to modulate the functionality of the target RNA fragments. For instance, within viral genomes, there are highly structured regions which are vital for the viral life cycle (SRVVLC). If these regions are altered in their conformation or secondary structure (e.g., disrupted), the virus would be less capable (and, preferably incapable) of performing essential functions of its life cycle. Accordingly, altering the conformation or secondary structure of these regions vital for the viral life cycle would lead the virus less infective, ideally totally ineffective. The same principle can be applied to other RNA fragments. For instance, a change in the conformation of a tRNA molecule can lead to a decrease (or increase) in the efficiency of translation of that specific tRNA. For instance, a change in the secondary structure of an mRNA molecule can lead to a decrease (or to an increase) in the binding affinity of that mRNA molecule and a certain protein or even the ribosome and thus affect its translation rate. Changes in the structure of an IRES element, both viral and cellular, can affect translation initiation. Changes in the structure of the UTRs of an mRNA can obscure miRNA binding sites, thus affecting translation regulation of such mRNA. Changes in the structure of intronic regions can affect splicing, etc.
In particular, the artificial RNAs of the present invention, preferably circRNAs, are able to hybridize with specific regions within the target RNA fragment. In doing so, the artificial RNAs of the present invention, preferably circRNAs, are able to disrupt these specific target regions within the target RNA fragment. These “specific regions within the target RNA fragment” are the so-called “target disruption structures”.
The target disruption structures comprise at least a hairpin loop preceded or followed by a region of unpaired nucleotides, and also comprise the so-called “target hybridization region(s)”. The target hybridization regions are regions within the target disruption structures which comprise a single-stranded region of at least 2 nucleotides, preceded or followed by a double-stranded region.
The artificial RNAs of the present invention, preferably circRNAs, hybridize with the target hybridization regions through the so-called “hybridization regions”. In other words, the artificial RNAs of the present invention, preferably circRNAs, comprise at least one hybridization region, which is a region of the artificial RNA which is able to completely hybridize with one or more target hybridization regions comprised in the target disruption regions of the target RNA fragment.
Hybridization (or hybridisation) is a phenomenon in which two RNA molecules anneal to each other via base pairing interactions. In the context of this invention only canonical base pairings are considered (C-G,A-U and G-U). By “complete hybridization” it is understood that all of the nucleotides of the hybridization region of the artificial RNA anneal with all of the nucleotides of the target hybridization region.
When the hybridization region completely hybridizes with the target hybridization region, the energy of the hybridization between the hybridization region and the target hybridization region is more negative than the energy of the target disruption region. When this happens, the target disruption structure is disrupted, i.e., the secondary structure of the target RNA fragment is altered. Hence, the functionality of the target RNA fragment is also altered: the functionality of the RNA fragment has been modulated by the artificial RNA of the present invention. This can be reproduced, and thus candidates for hybridization region that completely hybridize with the target hybridization region can be easily found, by using RNA design tools such as NUPACK or RNAiFold once the target hybridization region is known as explained below.
In a first aspect, the present invention relates to artificial RNAs, preferably circRNAs, suitable for disrupting by hybridization one or more target disruption structures of one or more RNA fragments.
By “disrupting by hybridization one or more target disruption structures of one or more RNA fragments” it is understood, in the context of the present invention, that the secondary structure of the one or more target disruption structures of one or more RNA fragments is altered when a hybridization region of the artificial RNA of the present invention completely hybridizes with the corresponding target hybridization region of the target disruption structure.
The artificial RNA of the invention, preferably circRNA, can be of any length as long as it comprises at least one hybridization region as described in the present invention and is suitable for disrupting by hybridization one or more target disruption structures of one or more RNA fragments. Preferably, the RNA of the present invention, preferably circRNA, comprises between 100 and 1000 nucleotides, more preferably between 150 and 800 nucleotides, and even more preferably between 200 and 600 nucleotides.
As described above, the artificial RNA of the present invention, which is preferably a circular RNA, comprises at least one hybridization region. The at least one hybridization region is a region of the artificial RNA (i.e., a sequence of nucleotides) which completely hybridizes with at least one target hybridization region comprised in the one or more target disruption structures of the one or more RNA fragments. The number of nucleotides of the hybridization region is not limited as long as it is able to completely hybridize with at least one target hybridization region, although preferably it has the same length as the target hybridization region, comprised in the one or more target disruption structures and, in doing so, disrupts (i.e., alters the secondary structure) of the one or more target disruption structures.
In a preferred embodiment, the at least one hybridization region has a total of between 7 and 100 nucleotides, more preferably between 10 and 50 nucleotides, even more preferably between 15 and 35 nucleotides, such as between 15 and 25 nucleotides.
As described above, the hybridization region completely hybridizes with at least one target hybridization region comprised in the one or more target disruption structures of the one or more RNA fragments. The target disruption structures are regions of the RNA fragments which comprise at least a portion of a hairpin loop preceded or followed by a region of unpaired nucleotides. The target disruption structures comprise at least one target hybridization region. The target hybridization regions are regions (i.e., a sequence of nucleotides) which comprises a single-stranded region of at least 2 nucleotides preceded or followed by a double-stranded region. The length of the target hybridization region is not limited as long as it comprises a single-stranded region of at least 2 nucleotides preceded or followed by a double-stranded region and is able to completely hybridize with the at least one hybridization region of the artificial RNA. Preferably, the single-stranded region of the target hybridization region comprises 3 nucleotides or more, such as 3, 4, 5, 10, 15 nucleotides or more. Preferably the double-stranded region of the target hybridization region comprises 5 nucleotides or more, such as 5, 7, 10, 15, 20, 25 nucleotides or more.
Importantly, the hybridization region of the artificial RNA of the present invention, which is preferably a circular RNA, completely hybridizes with at least one target hybridization region comprised in the one or more target disruption structures of the one or more RNA fragments. Hence, the at least one hybridization region of the artificial RNA of the present invention has exaclty the same number of nucleotides than the at least one target hybridization region with which it hybridizes. Consequently, the at least one hybridization region of the artificial RNA of the present invention has a first region of a certain number of nucleotides which completely hybridizes with the single-stranded region of the target hybridization region, and a second region of a certain number of nucleotides which completely hybridizes with the double-stranded region of the target hybridization region.
In other words, in a first step, the single-stranded region of the target hybridization region anneals with certain nucleotides of the hybridization region of the artificial RNA, which is preferably a circular RNA. In a second step, the double-stranded region of the target hybridization region, which precedes or follows the single-stranded region, is disrupted, and new interactions are formed between one strand of the double-stranded region of the target hybridization region and certain nucleotides of the hybridization region of the artificial RNA, which anneal to each other. The disruption of the double-stranded region of the target hybridization region occurs when the energy of the hybridization between the at least one hybridization region and the at least one target hybridization region is more negative (more favourable) than the energy of the target disruption region. The energy of hybridization and the capacity of disrupting the one or more target disruption structures can be measured, for example, with RNAcofold; the identification of potential candidates of the hybridization regions of the artificial RNA of the present invention characterized by having an energy of the hybridization between the at least one hybridization region and the at least one target hybridization region more negative (more favourable) than the energy of the target disruption region, can be easily identified by RNA inverse folding tools, such as NUPACK, RNAifold, or MoiRNAiFold as illustrated in example 4.
As a result, at least the double-stranded region of the target hybridization region is disrupted and, hence, the target disruption structure is also disrupted. Hence, the structure of the target disruption structure changes, at least, completely for the overlap between the target disruption structure and the target hybridization region. Therefore, the secondary structure of the target RNA fragment is changed and, thus, its functionality is also altered.
The hybridization between the hybridization region of the artificial RNA and the target hybridization region of the target disruption structures of the RNA fragment can be followed in vitro or in vivo. The change in secondary structure of the RNA fragment can also be checked employing techniques well-known in the art such as SHAPE (Poulsen, Line Dahl et al. “SHAPE Selection (SHAPES) enrich for RNA structure signal in SHAPE sequencing-based probing data.” RNA (New York, N.Y.) vol. 21,5 (2015): 1042-52. doi:10.1261/rna.047068.114) or PARIS (Lu Z, Gong J, Zhang QC. PARIS: Psoralen Analysis of RNA Interactions and Structures with High Throughput and Resolution. Methods Mol Biol. 2018;1649:59-84. doi: 10.1007/978-1-4939-7213-5_4).
Consequently, the at least one hybridization region comprised in the artificial RNA of the present invention is further characterized because, when hybridizing with the target hybridization region, the energy of the hybridization between the at least one hybridization region and the at least one target hybridization region is more negative than the energy of the target disruption region, thereby disrupting the target disruption structure. As discussed above, the skilled person is able to predict the energy of the hybridization between the at least one hybridization region and the at least one target hybridization region and the energy of the target disruption region. Available tools for this prediction are, e.g., well established software like RNAcofold (Lorenz, Ronny and Bernhart, Stephan H. and Höner zu Siederdissen, Christian and Tafer, Hakim and Flamm, Christoph and Stadler, Peter F. and Hofacker, Ivo L., ViennaRNA Package 2.0, Algorithms for Molecular Biology, 6:1 26, 2011, doi: 10.1186/1748-7188-6-26; Reuter, J. S., & Mathews, D. H. (2010). RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics. 11,129, Mathews, D. H. et al., “Predicting oligonucleotide affinity to nucleic acid targets”, RNA, 1999 5: 1458-1469), RNAstructure (https://rna.urmc.rochester.edu/RNAstructure.html), Mfold (http://unafold.rna.albany.edu/?q=mfold, M. Zuker, “Mfold web server for nucleic acid folding and hybridization prediction”, Nucleic Acids Res. 31 (13), 3406-3415, 2003) or Vienna package (http://rna.tbi.univie.ac.at/), as described in detail above.
Preferably, the energy of the hybridization between the at least one hybridization region and the at least one target hybridization region and the energy of the target disruption region is preferably calculated with RNAcofold software, with the settings as described in Mathews, D. H., et al., “Predicting oligonucleotide affinity to nucleic acid targets”, RNA, 1999 5: 1458-1469. It is however noted that such calculation shall be unnecessary when RNA inverse folding tools, such as NUPACK, RNAifold, or MoiRNAiFold, are used for the identification of potential candidates of the hybridization regions of the artificial RNA of the present invention characterized by having an energy of the hybridization between the at least one hybridization region and the at least one target hybridization region more negative (more favourable) than the energy of the target disruption region.
For a given RNA fragment, the skilled person is able to identify potential target disruption structures, since these are regions of RNA which comprise at least a portion of a hairpin loop preceded or followed by a region of unpaired nucleotides. There are many RNA structure prediction software available to the skilled person and that predict the secondary structure of a given RNA sequence. For instance, we refer to Mathews, D. H., et al. “RNA secondary structure prediction.” Current protocols in nucleic acid chemistry vol. Chapter 11 (2007): Unit 11.2. doi:10.1002/0471142700.nc1102s28.
In addition, the skilled person is able to identify one or more target hybridization regions within the target disruption structure, because the target hybridization region is comprised in the target disruption structure and comprises a single-stranded region of at least 2 nucleotides preceded or followed by a double-stranded region, as defined above.
Once a target hybridization region is identified, the skilled person, as indicated above, is able to design one or more hybridization regions which would completely hybridize with the target hybridization region. Similarly as above, the skilled person is aware of several software for the design of RNA sequences which would completely hybridize with a given RNA sequence, e.g., NUPACK (http://www.nupack.org/design/new, see also B. R. Wolfe, N. J. Porubsky, J. N. Zadeh, R. M. Dirks, and N. A. Pierce, “Constrained multistate sequence design for nucleic acid reaction pathway engineering”, JAm Chem Soc, 139:3134-3144, 2017; B. R. Wolfe and N. A. Pierce, “Sequence design for a test tube of interacting nucleic acid strands”, ACS Synth Biol, 4:1086-1100, 2015; J. N. Zadeh, B. R. Wolfe, and N. A. Pierce, “Nucleic acid sequence design via efficient ensemble defect optimization” J Comput Chem, 32:439-452, 2011; and R. M. Dirks, M. Lin, E. Winfree, and N. A. Pierce, “Paradigms for computational nucleic acid design” Nucl Acids Res, 32:1392-1403, 2004.) or RNAiFold (https://bioinformatics.bc.edu/clotelab/RNAiFold/, see also Juan Antonio Garcia-Martin, Peter Clote, Ivan Dotu, “RNAiFold: A constraint programming algorithm for RNA inverse folding and molecular design, J Bioinform Comput Biol 11(2): 1350001, 2013; and Garcia-Martin JA, Dotu I, Clote P., “RNAiFold 2.0 A web server and software to design custom and Rfam-based RNA molecules”, Nucleic Acids Research Web Server issue, 2015, doi: 10.1093/nar/gkv460, “RNAiFold 2.0 A web server and software to design custom and Rfam-based RNA molecules”). Moreover, it is possible to ascertain whether a certain target disruption structure can be disrupted by hybridization given a particular target hybridization region. This can be achieved using several RNA inverse folding or RNA design tools publicly available, such as NUPACK (http://www.nupack.org/design/new), RNAiFold (http://bioinformatics.bc.edu/clotelab/RNAiFold/) or its recent extension MoiRNAiFold (https://moiraibiodesign.com/design/).
For instance, in RNAiFold (and MoiRNAiFold), given any specific target disruption structure, such as the one shown in FIG. 28 (AAUAGAGUCCUGCCCAUUGGCGGG) and its target hybridization region (GAGUCCUGCC), one can use the following input file:
| #RNAscdstr((((((((((&....))))))))))..........#RNAs | eqconNNNNNNNNNN&AAUAGAGUCCUGCCCAUUGGCGGG |
Wherein the input of ((((((((((&....)))))))))).......... corresponds to the well established dot bracket notation (see, e.g. RNAlib-2.4.18: RNA Structure Notations (univie.ac.at), and wherein the input NNNNNNN&AAUAGAGUCCUGCCCAUUGGCGGG indicates that every “N” is a nucleotide (any nucleotide A,C,G or U) corresponding with “(” above and that has to hybridize with the corresponding “)” indicated above. That is, the RNAiFold (and MoiRNAiFold) should return a solution (or multiple ones) of potential hybridization regions that can indeed disrupt the target disruption structure AAUAGAGUCCUGCCCAUUGGCGGG upon complete hybridization to the target hybridization region GAGUCCUGCC .
In this case, a sample set of 10 solutions return by the RNA inverse folding tool was the following:
| GGCGGGGCUC&AAUAGAGUCCUGCCCAUUGGCGGGGGUGGGGCUC&AAUA | GAGUCCUGCCCAUUGGCGGGGGCAGGGCUC&AAUAGAGUCCUGCCCAUUG | GCGGGGGUAGGGCUC&AAUAGAGUCCUGCCCAUUGGCGGGGGUGGGACUC | &AAUAGAGUCCUGCCCAUUGGCGGGGGCGGGACUC&AAUAGAGUCCUGCC | CAUUGGCGGGGGCAGGACUC&AAUAGAGUCCUGCCCAUUGGCGGGGGUAG GACUC&AAUAGAGUCCUGCCCAUUGGCGGGGGCGGGAUUC&AAUAGAGUC | CUGCCCAUUGGCGGGGGUGGGAUUC&AAUAGAGUCCUGCCCAUUGGCGGG |
from which it follows first, that the target disruption structure can be disrupted via hybridization and second, that the hybridization regions (in bold) can be used to construct a circRNA (by separating these regions with random polynucleotide regions) that can disrupt by hybridization the target disruption structure.
Thus provided these input instructions, if the software tool returns a solution (or multiple ones) it means that the target disruption structure can indeed be disrupted by hybridization. From the set of solutions it follows the generation of the circRNA of this invention: by taking any number of these solutions (hybridization regions) and separating them by random nucleotides regions. Example 14 shows additional input files for several of the target disruption structures used as examples through this application.
In the context of this invention, hybridization region is a region within the artificial circular RNA capable of hybridizing with the target hybridization region in the RNA fragment of interest and disrupting by hybridization the target disruption structure (see FIG. 28 for a depiction of how all these concepts relate to each other). In a preferred embodiment, the energy of hybridization and the capacity of disrupting the one or more target disruption structures can be calculated with RNA inverse folding tools, such as NUPACK, RNAifold, MoiRNAiFold.
As indicated above, in a much preferred embodiment, the artificial RNA of the invention is a circular RNA. In this sense, the present inventors have found that the use of artificial RNA-based therapies as disclosed herein, preferably circular RNAs, has fundamental advantages over other RNA molecules:
In a further embodiment, the artificial RNA of the present invention, which is preferably a circular RNA, comprises at least one hybridization region, wherein the at least one hybridization region is capable of hybridizing target hybridization regions from different target disruption structures within the same RNA fragment, or even from different RNA fragments.
In a preferred embodiment, the artificial RNA of the present invention, which is preferably a circular RNA, comprises 2 or more hybridization regions, preferably between 6 and 20 hybridization regions. In a further preferred embodiment, at least two, and preferably all, of the hybridization regions are capable of completely hybridizing with the same target hybridization region. Hence, the artificial RNA according to this preferred embodiment would have more probabilities of disrupting the target disruption structure of the RNA fragment, and would then be more effective in modulating the functionality of the RNA fragment, especially RNA fragments which are prone to mutations (e.g., viruses and/or tumors). Hence, having multiple hybridization regions impacts mainly the mutant escaping capabilities of the virus/tumor.
In another more preferred embodiment, the RNA of the present invention, which is preferably a circular RNA, comprises at least two hybridization regions, wherein at least two, and preferably all, of the hybridization regions have different nucleotide sequences, i.e., are different from each other in terms of nucleotide sequence. Hence, in this preferred embodiment, the at least two hybridization regions, preferably all of the hybridization regions of the artificial RNA, are different from each other, and they all target (are capable of hybridizing) the same target hybridization region (“many-to-one” approach). This way, the artificial RNA according to this preferred embodiment would have more probabilities of disrupting the target disruption structure of the RNA fragment, and would then be more effective in modulating the functionality of the RNA fragment. Alternatively, the at least two hybridization regions, preferably all of the hybridization regions of the artificial RNA, which are different from each other, target (are capable of hybridizing) different target hybridization regions from different target disruption structures, either within the same RNA fragment or even from different RNA fragments.
In a further preferred embodiment, the two or more hybridization regions of the artificial RNA of the present invention are:
Preferably, the one or more RNA fragments is selected from mRNA, tRNA, rRNA, non-coding RNA and viral genomic RNA. More preferably, the RNA fragment is viral genomic RNA. Even more preferably, the one or more RNA fragments is positive-sense single-stranded (ss) viral genomic RNA.
Viral RNA genomes and viral mRNAs contain highly structured regions (“target disruption structures”) comprising at least a portion of a hairpin loop preceded or followed by a region of unpaired nucleotides which are essential for their function. These highly structured regions are preferably structured regions vital for the viral life cycle (SRVVLC). If these regions are disrupted, the virus would be less capable (and, preferably incapable) of performing essential functions of its life cycle. Accordingly, disrupting these regions would render the virus less infective, ideally totally ineffective.
The present inventors have designed artificial RNAs, preferably circular RNAs, comprising at least one (and preferably more than one) hybridization region that hybridizes to at least one target hybridization region (such as one, or two, or more) within at least one target disruption structure (such as one, or two, or more) present in the viral genomic RNA and disrupts it, consequently reducing or even inhibiting viral infection. As described above, in a preferred embodiment, the artificial RNAs of the present invention comprise at least two (and preferably more) hybridization regions, which are different from each other, and which are able to completely hybridize with one target hybridization region within one target disruption structure present in the viral genomic RNA and disrupt it, consequently reducing or even inhibiting viral infection. In this way (“many-to-one” approach) the efficiency of the disruption is increased.
In one embodiment, the one or more target disruption structures is comprised in the IRES element of the viral genome. Preferably, the one or more target disruption structures comprised in the IRES element of the viral genome is a structured region vital for the viral life cycle (SRVVLC).
In another embodiment, the one or more target disruption structures is comprised in the 5′UTR and/or in the 3′UTR of the viral genome. Preferably, the one or more target disruption structures comprised in the 5′UTR and/or in the 3′UTR of the viral genome is a structured region vital for the viral life cycle (SRVVLC).
In a further embodiment, the one or more target disruption structures is comprised in the CDS of the viral genome. Preferably, the one or more target disruption structures comprised in the CDS of the viral genome is a structured region vital for the viral life cycle (SRVVLC).
In a further embodiment, the at least two hybridization region of the artificial RNA are capable of completely hybridizing with at least one target hybridization region comprised in at least one disruption structure present in any combination of two of the following locations: the IRES element, the region of the 5′UTR, the region of the CDS and/or the region of the 3′UTR of the viral genome.
In a further embodiment, the artificial RNA of the present invention, which is preferably a circular RNA, is able to disrupt by hybridization one or more target disruption structures comprised in at least two viral genomic RNAs. Preferably, the artificial RNA of the present invention is able to disrupt by hybridization one or more structured regions vital for the viral life cycle comprised in at least two viral genomic RNAs.
In a preferred embodiment, the disruption of the one or more structured regions vital for the viral life cycle renders the virus less active, more preferably the disruption of the one or more structured regions vital for the viral life cycle renders the virus completely inactive.
The viral genome as target RNA fragment (viral genomic RNA) is not limited. Any viral genome with target disruption structures (i.e., regions comprising at least a hairpin loop preceded or followed by a region of unpaired nucleotides) may be a suitable target RNA fragment for the artificial RNA of the present invention. Examples of viral genomes which may be target RNA fragments according to the present invention are the following: Hepatitis-C-Virus (HCV), Influenza virus, Hepatitis-A-Virus (HAV), Poliovirus, Coxsackie B virus, Coronavirus, Rhinovirus (common cold), Dengue virus, Zika virus, Chikungunya virus, West Nile virus and Yellow Fever virus.
In another preferred embodiment, the target disruption structures that the artificial RNA of the present invention, preferably in the artificial circular RNA of the present invention, is able to disrupt is a target disruption structure comprised in the 5′UTR of the viral genome. In a preferred embodiment, the target disruption structure of the 5′UTR region of the DENV (Dengue virus) genome is cHP (capsid coding hairpin region).
In another preferred embodiment, the target disruption structures that the artificial RNA of the present invention, preferably in the artificial circular RNA of the present invention, is able to disrupt is a target disruption structure comprised in the IRES element of the viral genome. In a preferred embodiment, the target disruption structure of the IRES element of the HCV (Hepatitis-C virus) viral genome is IRES1 and/or IRES2.
In another preferred embodiment, the target disruption structures that the artificial RNA of the present invention, preferably in the artificial circular RNA of the present invention, is able to disrupt is a target disruption structure comprised in the CDS of the viral genome. In a preferred embodiment, the target disruption structure of the CDS of the viral genome is CDS1 and/or CDS2. Preferably, the target disruption structure is selected from regions SL388, SL427, SL588 and/or SL750 of the genome of the HCV. In a preferred embodiment, the target disruption structure is region SL427 and/or region SL588 of the genome of the HCV (SL stands for Stem Loop).
In another preferred embodiment, the target disruption structures that the artificial RNA of the present invention, preferably in the artificial circular RNA of the present invention, is able to disrupt is a target disruption structure comprised in the 3′UTR of the viral genome. In a preferred embodiment, the target disruption structure of the 3′UTR region of the DENV genome is sHP (short Stem Loop or short Hairpin region). In a further preferred embodiment, the target disruption structure of the 3′UTR region of the WNV (West Nile virus) genome is SL_II.
In another preferred embodiment, in the circular RNA according to any of the preceding embodiments, the target disruption structures are found in a combination of two or more of the IRES element, the structured region of the 5′UTR, the structured region of the CDS or the structured region of the 3′UTR of the viral genome.
In another preferred embodiment, the target disruption structure of the CHIKV (Chikungunya virus) genome is the RSE region and/or the Recoding Element (RE).
In a further preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes is comprised in SEQ ID NO.: 1. In particular, the target hybridization region comprises the nucleotide sequence as defined in one or more of SEQ ID NO.: 25 to 28, or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 25 to 28, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 25 to 28, or the homologe regions in another HCV strain/serotype.
In a preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes comprises the nucleotide sequence as defined in SEQ ID NO.: 25 to 27 (combination circ_hcv_ires1, circ HCV2 and circ_hcv_cds1, see Table 1 below) or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 25 to 27, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 25 to 27, or the homologe regions in another HCV strain/serotype.
The degree of identity between two sequences can be determined by conventional methods, for example, by means of standard sequence alignment algorithms known in the state of the art, such as, for example BLASTn (Altschul S.F. et al. Basic local alignment search tool. J Mol Biol. 1990 Oct 5; 215(3):403-10).
“Homology region” refers to regions in different virus strains/serotypes which share common structural and/or functional characteristics. Homologous structures do not imply sequence identity as a necessary condition. The skilled person is able to identify homologe regions in other viral strains/serotypes as the ones defined in the present application by conventional means.
TABLE 1
| CircRNAs designed against HCi98V | Name of the artificial circular RNA | Target disruption structure comprised in | Target hybridization region | SEQ ID NO.: | Hybridization regions of the artificial RNA | circ_hcv_ires1 | IRES 1 SEQ ID NO.: 76 | CUCCGCCAUGA AUCACUCCCCU GUGAGGAACUA SEQ ID NO.: 25 | SEQ ID NO.:2 | 7 | Circ HCV2 | IRES 2 SEQ ID NO.: 77 | UCUCGUAGACC GUGCACCAUGA GC SEQ ID NO.: 26 | SEQ ID NO.:3 | 11 | circ_hcv_cds1 | CDS1 (target disruption structure: cHP) SEQ ID NO.: 78 | CCAAAAGAAAC ACCAACCGUCG CCCAGA SEQ ID NO.: 27 | SEQ ID NO.:4 | 8 | circ_hcv_combo1 | IRES- CDS | Combination circ_hcv_ires1, circ HCV2 and circ_hcv_cds1 | SEQ ID NO.:5 | 3xtarget | circ_hcv_cds2 | CDS2 SEQ ID NO.: 79 | GGGGCCCCAGG SEQ ID NO.: 28 | SEQ ID NO.:6 SEQ ID NO : 64 | 12 | IRES: internal ribosomal entry site; CDS: coding sequence; cHP: capsid hairpin. |
The different circRNAs designed against HCV are classified in the table with information of the target disruption structures which they disrupt by hybridization, the sequence of the target hybridization region which completely hybridizes with the hybridization region of the artificial RNA, the sequence of the whole circRNA and the number of hybridization regions present in each candidate (each artificial circular RNA).
In a further preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes is comprised in SEQ ID NO.: 7. In particular, the target hybridization region comprises the nucleotide sequence as defined in one or more of SEQ ID NO.: 29 to 30 or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 29 to 30, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 29 to 30, or the homologe regions in another DENV strain/serotype.
TABLE 2
| CircRNAs designed against DENV | Name of the artificial circular RNA | Target disruption structure comprised in | Target hybridization region | SEQ ID NO.: | Hybridization regions of the artificial RNA | circ_dv_3utr | 3′ UTR (target disruption structure: sHP) SEQ ID NO.: 29 | AACAGCAUAU UGACGCUGGG AAAGACCAGA GA SEQ ID NO.: 29 | SEQ ID NO.:8 | 7 | circ_dv_cHP_v1 | CDS (target disruption structure: cHP ) SEQ ID NO.: 30 | ACGGAAAAAG GCGAAAAACA CGCCUUUCAA UAU SEQ ID NO.: 30 | SEQ ID NO.:9 | 7 | circ_dv_cHP_v2 | CDS (target disruption structure: cHP ) SEQ ID NO.: 30 | SEQ ID NO.: 30 | SEQ ID NO.:10 | 7 | UTR: untranslated region cHP: capsid region hairpin |
The different circRNAs designed against DENV are classified in the table with information of the target disruption structures which they disrupt by hybridization, the sequence of the target hybridization region which completely hybridizes with the hybridization region of the artificial RNA, the sequence of the whole circRNA and the number of hybridization regions present in each candidate (each artificial circular RNA).
In a further preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes is comprised in one or more of SEQ ID NO.: 1 and SEQ ID NO.: 7. In particular, the target hybridization region comprises the nucleotide sequence as defined in one or more of SEQ ID NO.: 30 and SEQ ID NO.: 28 or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 30 and SEQ ID NO.: 28, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 30 and SEQ ID NO.: 28, or the homologe regions in another DENV/HCV strain/serotype.
TABLE 3
| Broad-spectrum DENV-HCV circRNA | Name of the artificial circular RNA | Target disruption structure comprised in | Target hybridization region | SEQ ID NO.: | Hybridization regions of the artificial RNA | circ_dv_cHP_v 1_ circ_hcv_cds2_ 2 | DENV: CDS (target disruption structure: cHP) HCV: CDS SEQ ID NOs.: 30 and 79. | ACGGAAAAAGGCGAAA AACACGCCUUUCAAUA U SEQ ID NO.: 30 GGGGCCCCAGG SEQ ID NO.: 28 | SEQ ID NO: 32 | 4 x target | DENV cHP_HCV CDS2_T | DENV: CDS (target disruption structure: cHP) HCV: CDS2 SEQ ID NOs.: 30 and 79. | SEQ ID NO.: 30 SEQ ID NO.: 28 | SEQ ID NO: 16 | 19 | DENVlcHP_H CV CDS2_1 | DENV: CDS (target disruption structure: cHP) HCV: CDS2 SEQ ID NOs.: 30 and 79. | SEQ ID NO.: 30 SEQ ID NO.: 28 | SEQ ID NO: 17 | 4xtarget | cHP: capsid region hairpin CDS: coding sequence. |
Information for circ_dv_cHP_v1-circ_hcv_cds2 of the two target disruption structures (DENV cHP and HCV CDS), the target hybridization regions, the sequence of the complete circRNA and the number of hybridization regions in each circRNA.
In a further preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes is comprised in SEQ ID NO. 11. In particular, the target hybridization region comprises the nucleotide sequence as defined in one or more of SEQ ID NO.: 31, 33 and 35 or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 31, 33 and 35, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 31, 33 and 35, or the homologe regions in another CHIKV strain/serotype.
TABLE 4
| CircRNAs designed against CHIKV | Name of the artificial circular RNA | Target disruption structure comprised in | Target hybridization region | SEQ ID NO.: | Hybridization regions of the artificial RNA | chikv5utr | 5′UTR SEQ ID NO: 80 | ACACACGUAGC CUACCAGUUUC UUACUGCUCUA CU SEQ ID NO.: 33 | SEQ ID NO.:12 | 6 | chikv5utr | 5′UTR SEQ ID NO: 80 | SEQ ID NO.: 33 | SEQ ID NO.: 13 | 7 | chikvRSE | 3′ UTR (target disruption structure: Repetitive Sequence Element (RSE)) SEQ ID NO: 81 | AGCAAAUAAUC UAUAGAUCAAA GGGCUACGCAA SEQ ID NO.: 35 | SEQ ID NO.: 14 | 6 | Chikv_re | Recoding Element (CDS) SEQ ID NO: 82 | GCUGCUGUAAA ACGUUGGCUUU UUUAGCCGUAA U SEQ ID NO.: 31 | SEQ ID NO.:39 | 6 | chikvRSE | 3′ UTR (target disruption structure: RSE) SEQ ID NO: 81 | SEQ ID NO.: 35 | SEQ ID NO.: 15 | 6 | UTR: untranslated region CDS: coding sequence. |
The different circRNAs designed against CHIKV are classified in the table with information of the target disruption structure, the sequence of the target hybridization region, the sequence of the whole circRNA and the number of hybridization regions present in each candidate (in each artificial circRNA).
In a further preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes is comprised in SEQ ID NO. 20. In particular, the target hybridization region comprises the nucleotide sequence as defined in SEQ ID NO.: 37 or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 37, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 37, or the homologe regions in another WNV strain/serotype.
TABLE 5
| CircRNAs designed against WNV | Name of the artificial circular RNA | Target disruption structure comprised in | Target hybridization region | SEQ ID NO.: | Hybridization regions of the artificial RNA | circ_wnv_s1II_1 | 3′ UTR (target disruption structure SL III) SEQ ID NO.: 83 | UUUUGAGGAGA AAGUCAGGCCG GGAAGUU SEQ ID NO.: 37 | SEQ ID NO.:24 | 7 | circ_wnv_s1II_2 | 3′ UTR (target disruption structure SL III) SEQ ID NO.: 83 | UUUUGAGGAGA AAGUCAGGCCG GGAAGUU SEQ ID NO.: 37 | SEQ ID NO.: 19 | 7 | UTR: untranslated region. |
The different circRNAs designed against WNV are classified in the table with information of the target disruption structures, the sequence of the target hybridization region, the sequence of the complete circRNA and the number of hybridization regions present in each candidate (in each artificial circRNA). SLIII: Stem Loop III.
In a further preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes is comprised in SEQ ID NO.: 20 and SEQ ID NO.: 7. In particular, the target hybridization region comprises the nucleotide sequence as defined in one or more of SEQ ID NO.: 30 and 37 or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 30 and 37, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 30 and 37, or the homologe regions in another DENV/WNV strain/serotype.
TABLE 6
| CircRNAs designed against WNV and DENV | Name of the artificial circular RNA | Target disruption structure comprised in | Target hybridization region | SEQ ID NO.: | Hybridization regions of the artificial RNA | dchp_ws1I_A | CDS and 3′ UTR (target disruption structures: cHP and SLII ) | SEQ ID NO.: 30 and 37 | SEQ ID NO.:21 SEQ ID NO: 63 | 6 | dchp_ws1I_B | CDS and 3′ UTR (target disruption structures: cHP and SLI I) | SEQ ID NO.: 30 and 37 | SEQ ID NO.:22 | 6 | dchp_ws1I_C | CDS and 3′ UTR (target disruption structures: cHP and SLI I) | SEQ ID NO.: 30 and 37 | SEQ ID NO.:23 | 6 | SLI: Stem Loop I. cHP: capsid region hairpin |
The different circRNAs designed against WNV and DENV are classified in the table with information of the target disruption structures, the sequence of the target hybridization region, the sequence of the complete circRNA and the number of hybridization regions present in each candidate (in each artificial circRNA).
In a further preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes is comprised in one or more of SEQ ID NO.: 1, SEQ ID NO.: 7, SEQ ID NO.: 11 and/or SEQ ID NO. 20. In particular, the target hybridization region comprises the nucleotide sequence as defined in one or more of SEQ ID NO.: 25 to 31, 33 and 35, 37 or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 25 to 31, 33 and 35, 37, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 25 to 31, 33 and 35, 37.
In another preferred embodiment, the target disruption structures in the HCV viral genome are found in the IRES and/or CDS region and/or a combination of them. More preferably, the target disruption structure of the HCV genome is selected from the list of target disruption structures comprising or consisting of SEQ ID NOs.: 76, 77, 78 or 79 or a nucleotide sequence with at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the nucleotide sequence as defined in SEQ ID NOs.: 76, 77, 78, or 79, or any combination thereof.
In another preferred embodiment, the target disruption structures in the Dengue viral genome are found in the 3′UTR and/or is the cHP and/or a combination of them. More preferably, the target disruption structure of the DENV genome is selected from the list of target disruption structures comprising or consisting of SEQ ID NOs.: 29 or 30, or a nucleotide sequence with at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the nucleotide sequence as defined in SEQ ID NOs.: 29 or 30, or any combination thereof.
In another preferred embodiment, the target disruption structures in the Zika viral genome are found in the 5′UTR and/or are the RSE and/or a combination of them.
In another preferred embodiment, the target disruption structures in the Chikungunya viral genome is found in the 5′UTR and/or is the RSE and/or a combination of them. More preferably, the target disruption structure of the CHIKV genome is selected from the list of target disruption structures comprising or consisting of SEQ ID NOs.: 80, 81, or 82, or a nucleotide sequence with at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the nucleotide sequence as defined in SEQ ID NOs.: 80, 81, or 82, or any combination thereof.
In another preferred embodiment, the target disruption structure in the West Nile viral genome is the stem-loop III (SLIII). More preferably, the target disruption structure of the WNV genome comprises or consists of SEQ ID NO.: 83, or a nucleotide sequence with at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the nucleotide sequence as defined in SEQ ID NO.: 83.
In another preferred embodiment, the hybridization regions of the artificial RNA of the present invention, which is preferably a circular RNA, target (i.e., are able to completely hybridize with target hybridization regions present in) more than one the target disruption structures present in one viral genome.
In a particular embodiment, the artificial RNA of the present invention, preferably the artificial circular RNA of the present invention, has a broad spectrum activity against a RNA viral genome, preferably against HCV, Dengue, Zika, Chikungunya, West Nile and Yellow Fever viral genome. In the present invention “a broad spectrum activity” related to the artificial RNA, preferably the circular RNA of the present invention means that said artificial RNA is effective against a wide range of RNA viruses, preferably against HCV, Dengue, Zika, Chikungunya, West Nile and Yellow Fever.
In a further preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes is comprised in SEQ ID NO. 34. In particular, the target hybridization region comprises the nucleotide sequence as defined in one or more of SEQ ID NO.: 58-62 or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 58-62, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 58-62, or the homologe regions in another SARS-CoV-2 strain/serotype.
In another preferred embodiment, the target disruption structures in the SARS-CoV-2 viral genome is found in the Target A, B, C, D, 3′UTR, 5′UTR, and/or a combination of them. More preferably, the target disruption structure of the SARS-CoV-2 genome is selected from the list of target disruption structures comprising or consisting of SEQ ID NOs.: 84, 58, 85, 86, 87, or a nucleotide sequence with at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the nucleotide sequence as defined in SEQ ID NOs.: 84, 58, 85, 86 or 87, or any combination thereof.
TABLE 7
| CircRNAs designed against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) isolate Wuhan-Hu-1 (complete genome: SEQ ID NO.: 34) | Name of the artificial circular RNA | Target disruption structure comprised in | Target hybridization region | SEQ ID NO.: | Hybridization regions of the artificial RNA | Artificial circular ARN 1; target disruption structure comprised in SARS-CoV-2 3′UTR replication site | 3′UTR replication site SEQ ID NO.: 84 | CAGAAUGAAUU CUCGUAACUAC AUAGCACAAGU AG SEQ ID NO.: 62 | SEQ ID NO.:36 | 6 | Artificial circular ARN 2; target disruption structure comprised in SARS-CoV-2 3′UTR | 3′UTR replication site SEQ ID NO.: 84 | CAGAAUGAAUU CUCGUAACUAC AUAGCACAAGU AG SEQ ID NO.: 62 | SEQ ID NO.:38 | 6 | Artificial circular RNA 3; target disruption structure comprised in SARS-CoV-2 3′UTR replication site | 3′UTR replication site SEQ ID NO.: 84 | CAGAAUGAAUU CUCGUAACUAC AUAGCACAAGU AG SEQ ID NO.: 62 | SEQ ID NO.:40 | 6 | Artificial circular RNA 4; target disruption structure comprised in SARS-CoV-2 3′UTR replication site | 3′UTR replication site SEQ ID NO.: 84 | CAGAAUGAAUU CUCGUAACUAC AUAGCACAAGU AG SEQ ID NO.: 62 | SEQ ID NO.:41 | 6 | Artificial circular RNA 5; target disruption structure comprised in SARS-CoV-2 3′UTR replication site | 3′UTR replication site SEQ ID NO.: 84 | CAGAAUGAAUU CUCGUAACUAC AUAGCACAAGU AG SEQ ID NO.: 62 | SEQ ID NO.:42 | 6 | Artificial circular RNA 6; target disruption structure comprised in SARS-CoV-2 3′UTR replication site | 3′UTR replication site SEQ ID NO.: 84 | CAGAAUGAAUU CUCGUAACUAC AUAGCACAAGU AG SEQ ID NO.: 62 | SEQ ID NO.: 88 | 6 | Artificial circular RNA 7; target disruption structure comprised in SARS-CoV-2 3′UTR replication site | 3′UTR replication site SEQ ID NO.: 84 | CAGAAUGAAUU CUCGUAACUAC AUAGCACAAGU AG SEQ ID NO.: 62 | SEQ ID NO.: 89 | 6 | Artificial circular RNA 8; target disruption structure comprised in SARS-CoV-2 3′UTR replication site | 3′UTR replication site SEQ ID NO.: 84 | CAGAAUGAAUU CUCGUAACUAC AUAGCACAAGU AG SEQ ID NO.: 62 | SEQ ID NO.: 65 | 6 | Artificial circular RNA 1; target disruption structure comprised in SARS-CoV-2 5′UTR (S1II) | 5′UTR (target disruption structure: S1II) SEQ ID NO.: 58 | AACCAACUUUC GAUCUCUUGUA GAUCU SEQ ID NO.: 58 | SEQ ID NO.:43 | 7 | Artificial circular RNA 2; target disruption structure comprised in SARS-CoV-2 5′UTR (S1II) | 5′UTR (target disruption structure: S1II) SEQ ID NO.: 58 | AACCAACUUUC GAUCUCUUGUA GAUCU SEQ ID NO.: 58 | SEQ ID NO.:44 | 7 | Artificial circular RNA 3; target disruption structure comprised in SARS-CoV-2 5′UTR (S1II) | 5′UTR (target disruption structure: S1II) SEQ ID NO.: 58 | AACCAACUUUC GAUCUCUUGUA GAUCU SEQ ID NO.: 58 | SEQ ID NO.:45 | 7 | Artificial circular RNA 4; target disruption structure comprised in SARS-CoV-2 5′UTR (S1II) | 5′UTR (target disruption structure: S1II) SEQ ID NO.: 58 | AACCAACUUUC GAUCUCUUGUA GAUCU SEQ ID NO.: 58 | SEQ ID NO.: 66 | 7 | Artificial circular RNA 5; target disruption structure comprised in SARS-CoV-2 5′UTR (S1II) | 5′UTR (target disruption structure: S1II) SEQ ID NO.: 58 | AACCAACUUUC GAUCUCUUGUA GAUCU SEQ ID NO.: 58 | SEQ ID NO.: 67 | 7 | Artificial circular RNA 1; target hybridization region: SARS-CoV-2 Target A | Target hybridization region: SARS-CoV-2 Target A SEQ ID NO.: 85 | UUUAAGUUUAG AAUAGACGGUG ACAUGGUACCA SEQ ID NO.: 59 | SEQ ID NO.:46 | 6 | Artificial circular RNA 2; target hybridization region: SARS-CoV-2 Target A | Target hybridization region: SARS-CoV-2 Target A SEQ ID NO.: 85 | UUUAAGUUUAG AAUAGACGGUG ACAUGGUACCA SEQ ID NO.: 59 | SEQ ID NO.:47 | 6 | Artificial circular RNA 3; target hybridization region: SARS-CoV-2 Target A | Target hybridization region: SARS-CoV-2 Target A SEQ ID NO.: 85 | UUUAAGUUUAG AAUAGACGGUG ACAUGGUACCA SEQ ID NO.: 59 | SEQ ID NO.:48 | 6 | Artificial circular RNA 4; target hybridization region: SARS-CoV-2 Target A | Target hybridization region: SARS-CoV-2 Target A SEQ ID NO.: 85 | UUUAAGUUUAG AAUAGACGGUG ACAUGGUACCA SEQ ID NO.: 59 | SEQ ID NO.:49 | 6 | Artificial circular RNA 5; target hybridization region: SARS-CoV-2 Target A | Target hybridization region: SARS-CoV-2 Target A SEQ ID NO.: 85 | UUUAAGUUUAG AAUAGACGGUG ACAUGGUACCA SEQ ID NO.: 59 | SEQ ID NO.:68 | 6 | Artificial circular RNA 6; target hybridization region: SARS-CoV-2 Target A | Target hybridization region: SARS-CoV-2 Target A | UUUAAGUUUAG AAUAGACGGUG ACAUGGUACCA SEQ ID NO.: 59 | SEQ ID NO.:69 | 6 | SEQ ID NO.: 85 | Artificial circular RNA 7; target hybridization region: SARS-CoV-2 Target A | Target hybridization region: SARS-CoV-2 Target A SEQ ID NO.: 85 | UUUAAGUUUAG AAUAGACGGUG ACAUGGUACCA SEQ ID NO.: 59 | SEQ ID NO.:70 | 6 | Artificial circular RNA 1; target hybridization region: SARS-CoV-2 Target C | Target hybridization region: SARS-CoV-2 Target C SEQ ID NO.: 86 | UCACUAAGAAA UCUGCUGCUGA GGCUUCUA SEQ ID NO.: 60 | SEQ ID NO.:50 | 7 | Artificial circular RNA 2; target hybridization region: SARS-CoV-2 Target C | Target hybridization region: SARS-CoV-2 Target C SEQ ID NO.: 86 | UCACUAAGAAA UCUGCUGCUGA GGCUUCUA SEQ ID NO.: 60 | SEQ ID NO.:51 | 7 | Artificial circular RNA 3; target hybridization region: SARS-CoV-2 Target C | Target hybridization region: SARS-CoV-2 Target C SEQ ID NO.: 86 | UCACUAAGAAA UCUGCUGCUGA GGCUUCUA SEQ ID NO.: 60 | SEQ ID NO.:52 | 7 | Artificial circular RNA 4; target hybridization region: SARS-CoV-2 Target C | Target hybridization region: SARS-CoV-2 Target C SEQ ID NO.: 86 | UCACUAAGAAA UCUGCUGCUGA GGCUUCUA SEQ ID NO.: 60 | SEQ ID NO.:53 | 7 | Artificial circular RNA 5; target hybridization region: SARS-CoV-2 Target C | Target hybridization region: SARS-CoV-2 Target C SEQ ID NO.: 86 | UCACUAAGAAA UCUGCUGCUGA GGCUUCUA SEQ ID NO.: 60 | SEQ ID NO.:71 | 7 | Artificial circular RNA 6; target hybridization region: SARS-CoV-2 Target C | Target hybridization region: SARS-CoV-2 Target C SEQ ID NO.: 86 | UCACUAAGAAA UCUGCUGCUGA GGCUUCUA SEQ ID NO.: 60 | SEQ ID NO.:72 | 7 | Artificial circular RNA 1; target hybridization region: SARS-CoV-2 Target D | Target hybridization region: SARS-CoV-2 Target D SEQ ID NO.: 87 | UCGUCUAUCUU CUGCAGGCUGC UUACGGUUU SEQ ID NO.: 61 | SEQ ID NO.:54 | 6 | Artificial circular RNA 2; target hybridization region: SARS-CoV-2 Target D | Target hybridization region: SARS-CoV-2 Target D SEQ ID NO.: 87 | UCGUCUAUCUU CUGCAGGCUGC UUACGGUUU SEQ ID NO.: 61 | SEQ ID NO.:55 | 6 | Artificial circular RNA 3; target hybridization region: SARS-CoV-2 Target D | Target hybridization region: SARS-CoV-2 Target D SEQ ID NO.: 87 | UCGUCUAUCUU CUGCAGGCUGC UUACGGUUU SEQ ID NO.: 61 | SEQ ID NO.:56 | 6 | Artificial circular RNA 4; target hybridization region: SARS-CoV-2 Target D | Target hybridization region: SARS-CoV-2 Target D SEQ ID NO.: 87 | UCGUCUAUCUU CUGCAGGCUGC UUACGGUUU SEQ ID NO.: 61 | SEQ ID NO.:57 | 6 |
The different circRNAs designed against SARS-CoV-2 are classified in the table with information of the target disruption structures, the sequence of the target hybridization region, the sequence of the complete circRNA and the number of hybridization regions present in each candidate (in each artificial circRNA).
In a further preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes is comprised in one or more of SEQ ID NO.: 1, SEQ ID NO.: 7, SEQ ID NO.: 11 and/or SEQ ID NO. 20. In particular, the target hybridization region comprises the nucleotide sequence as defined in one or more of SEQ ID NO.: 25 to 31, 33, 35, 37 and 58-62 or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 25 to 31, 33 and 35, 37, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 25 to 31, 33, 35, 37, and 58-62.
All the possible combinations of the target disruption structures and/or the target hybridization regions from the same virus or from different viruses disclosed above are included herein as particular embodiments for the design of the circRNAs sequences of the present invention. It is noted that for each target disruption structures disclosed throughtout the present invention (IRES, CDS, etc), different corresponding hybridization regions can be used and/or combined as described herein in order to design the circRNAs.
In a second aspect, the present invention provides a composition comprising the artificial RNA of the present invention, in any of the embodiments, alone or in combination, disclosed herein.
Preferably, the composition is a pharmaceutical composition, and preferably comprises the artificial RNA of the present invention, in any of the embodiments, and one or more pharmaceutically acceptable carriers.
Where clinical applications are contemplated, pharmaceutical compositions will be prepared in a form appropriate for the intended application. Generally, this will entail preparing compositions that are essentially free of pyrogens, as well as other impurities that could be harmful to humans or animals.
Colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes, may be used as delivery vehicles for artificial RNAs, such as circular RNAs. Commercially available fat emulsions that are suitable for delivering the nucleic acids of the disclosure to tissues include Intralipid, Liposyn, Liposyn II, Liposyn III, Nutrilipid, and other similar lipid emulsions. A colloidal system for use as a delivery vehicle in vivo is a liposome (i.e., an artificial membrane vesicle). The preparation and use of such systems is well known in the art. Exemplary formulations are also disclosed in U.S. Pat. No. 5,981,505; U.S. Pat. No. 6,217,900; U.S. Pat. No. 6,383,512; U.S. Pat. No. 5,783,565; U.S. Pat. No. 7,202,227; U.S. Pat. No. 6,379,965; U.S. Pat. No. 6,127,170; U.S. Pat. No. 5,837,533; U.S. Pat. No. 6,747,014; and WO 03/093449. In particular, cationic liposome formulations comprising lipofectamine can be used for delivery. Lipofectamine may be formulated with a neutral co-lipid or helper lipid. See e.g., U.S. Pat. No. 7,479,573, Dalby et al. (2004) Science Direct, Methods 33:95-103, Hawley-Nelson et al. (1993) Focus 15 :73-79.
One will generally desire to employ appropriate salts and buffers to render delivery vehicles stable and allow for uptake by target cells. Buffers also will be employed when recombinant cells (e.g., transfected ex vivo with an artificial RNA, such as a circular RNA) are introduced into a patient. Aqueous compositions of the present disclosure comprise an effective amount of the delivery vehicle, dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.
The phrases “pharmaceutically acceptable” or “pharmacologically acceptable” refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human. As used herein, “pharmaceutically acceptable carrier” includes solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like acceptable for use in formulating pharmaceuticals, such as pharmaceuticals suitable for administration to humans. The use of such media and agents for pharmaceutically active substances is well known in the art.
Except insofar as any conventional media or agent is incompatible with the active ingredients of the present disclosure, its use in therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions, provided they do not inactivate the nucleic acids of the compositions.
The pharmaceutical forms suitable for injectable use or catheter delivery include, for example, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Generally, these preparations are sterile and fluid to the extent that easy injectability exists. Preparations should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Appropriate solvents or dispersion media may contain, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions may be prepared by incorporating the active compounds in an appropriate amount into a solvent along with any other ingredients (for example as enumerated above) as desired, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the desired other ingredients, e.g., as enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation include vacuum drying and freeze-drying techniques which yield a powder of the active ingredient(s) plus any additional desired ingredient from a previously sterile-filtered solution thereof.
The compositions of the present invention generally may be formulated in a neutral or salt form. Pharmaceutically-acceptable salts include, for example, acid addition salts (formed with the free amino groups of the protein) derived from inorganic acids (e.g., hydrochloric or phosphoric acids, or from organic acids (e.g., acetic, oxalic, tartaric, mandelic, and the like). Salts formed with the free carboxyl groups of the protein can also be derived from inorganic bases (e.g., sodium, potassium, ammonium, calcium, or ferric hydroxides) or from organic bases (e.g., isopropylamine, trimethylamine, histidine, procaine and the like).
Upon formulation, solutions are preferably administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations may easily be administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like. For parenteral administration in an aqueous solution, for example, the solution generally is suitably buffered and the liquid diluent first rendered isotonic for example with sufficient saline or glucose. Such aqueous solutions may be used, for example, for intravenous, intramuscular, subcutaneous and intraperitoneal administration. Preferably, sterile aqueous media are employed as is known to those of skill in the art, particularly in light of the present disclosure. By way of illustration, a single dose may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, “Remington’s Pharmaceutical Sciences” 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, and general safety and purity standards as required by FDA Office of Biologies standards.
The pharmaceutical compositions of the present invention can also be housed in a syringe, an implantation device, or the like, depending upon the intended mode of delivery and use. Preferably, the compositions comprising artificial RNAs, such as artificial circular RNAs, prepared as described herein, are in unit dosage form, meaning an amount of a composition appropriate for a single dose, in a premeasured or pre-packaged form.
As for the administration, at least one therapeutically effective cycle of treatment with an artificial RNA, such as artificial circular RNAs, may be administered to a subject for treatment of a viral infection caused by, e.g., HCV, Dengue virus, Zika virus, Chikungunya virus, West Nile virus, Yellow Fever virus or coronavirus, such as SARS and/or MERS, preferably SARS-CoV-2.
By “therapeutically effective dose or amount” of a composition comprising an artificial RNA, such as artificial circular RNAs, is intended an amount that, when administered as described herein, brings about a positive therapeutic response, such as improved recovery from the treated condition, such as for example the viral infection, the cancer or the genetic disorder.
Multiple therapeutically effective doses of compositions comprising artificial RNAs of the present invention, such as artificial circular RNAs of the present invention, and/or one or more other therapeutic agents, will be administered. The compositions of the present invention are typically, although not necessarily, administered via injection (subcutaneously, intravenously, intra-arterially, or intramuscularly), by infusion, or locally. Additional modes of administration are also contemplated, such as intraperitoneal, intrathecal, intratumor, intralymphatic, intravascular, intralesion, transdermal, and so forth. In some embodiments, the pharmaceutical composition comprising the artificial RNA of the present invention,, such as artificial circular RNAs, is administered locally. The pharmaceutical compositions comprising the artificial RNAs of the present invention, such as artificial circular RNAs, and other agents may be administered using the same or different routes of administration in accordance with any medically acceptable method known in the art.
The pharmaceutical compositions comprising the artificial RNAs of the present invention, such as artificial circular RNAs, may also be administered prophylactically, e.g., to prevent the viral infection and/or cancer and/or genetic disorder.
The pharmaceutical compositions comprising the artificial RNAs of the present invention, such as artificial circular RNAs, and/or other agents are in a sustained-release formulation, or a formulation that is administered using a sustained-release device. Such devices are well known in the art, and include, for example, miniature implantable pumps that can provide for delivery over time in a continuous, steady-state fashion at a variety of doses to achieve a sustained-release effect with a non-sustained-release pharmaceutical composition.
Those of ordinary skill in the art will appreciate which conditions compositions comprising artificial RNAs of the present invention can effectively treat and/or prevent. The actual dose to be administered will vary depending upon the age, weight, and general condition of the subject as well as the severity of the condition being treated, the judgment of the health care professional, and conjugate being administered.
Therapeutically effective amounts can be determined by those skilled in the art, and are adjusted to the particular requirements of each particular case. Compositions comprising the artificial RNAs of the present invention, such as artificial circular RNAs, can be administered alone or in combination with one or more other therapeutic agents. The specific dosing schedule will be known by those of ordinary skill in the art or can be determined experimentally using routine methods. Exemplary dosing schedules include, without limitation, administration five times a day, four times a day, three times a day, twice daily, once daily, three times weekly, twice weekly, once weekly, twice monthly, once monthly, and any combination thereof. Preferred compositions are those requiring dosing no more than once a day.
Compositions comprising the artificial RNAs of the present invention, such as artificial circular RNAs, can be administered prior to, concurrent with, or subsequent to other agents. If provided at the same time as other agents, the artificial RNAs of the present invention can be provided in the same or in a different composition. Thus, artificial RNAs and one or more other agents can be presented to the individual by way of concurrent therapy.
By “concurrent therapy” is intended administration to a subject such that the therapeutic effect of the combination of the substances is caused in the subject undergoing therapy. For example, concurrent therapy may be achieved by administering a dose of a pharmaceutical composition comprising an artificial RNA according to the present invention, such as artificial circular RNAs, and a dose of a pharmaceutical composition comprising at least one other agent, which in combination comprise a therapeutically effective dose, according to a particular dosing regimen. Similarly, an artificial RNA of the present invention and one or more other therapeutic agents can be administered in at least one therapeutic dose. Administration of the separate pharmaceutical compositions can be performed simultaneously or at different times (i.e., sequentially, in either order, on the same day, or on different days), as long as the therapeutic effect of the combination of these substances is caused in the subject undergoing therapy.
In a third aspect, the present invention provides a kit comprising the artificial RNA of the present invention, in any of its embodiments, or comprising the composition of the present invention, and instructions for using the artificial RNA or composition.
Hence, any of the artificial RNAs and/or compositions described herein may be included in a kit. For example circular RNAs as disclosed herein may be included in a kit. The kit may also include one or more transfection reagents to facilitate delivery of the artificial RNAs to cells. Such kits may also include components that preserve the polynucleotides or that protect against their degradation. Such components may be RNAse-free or protect against RNAses.
Such kits generally will comprise, in suitable means, distinct containers for each individual reagent or solution. The kit may comprise one or more containers holding the artificial RNAs and other agents. Suitable containers for the compositions include, for example, bottles, vials, syringes, and test tubes. Containers can be formed from a variety of materials, including glass or plastic. A container may have a sterile access port (for example, the container may be a vial having a stopper pierceable by a hypodermic injection needle).
The kit can further comprise a container comprising a pharmaceutically acceptable buffer, such as phosphate-buffered saline, Ringer’s solution, or dextrose solution. It can also contain other materials useful to the end-user, including other pharmaceutically acceptable formulating solutions such as buffers, diluents, filters, needles, and syringes or other delivery devices. The delivery device may be pre-filled with the compositions.
The kit can also comprise a package insert containing written instructions for methods of treating the viral infections with the artificiañ RNAs of the present invention. The package insert can be an unapproved draft package insert or can be a package insert approved by the Food and Drug Administration (FDA) or other regulatory body.
As described above, preferably, the artificial RNA of the present invention, in any of its embodiments, which may be comprised in the composition or kit of the present invention, comprises the nucleotide sequence as defined in SEQ ID NO: 2, 3, 4, 5, 6 (for HCV); 8, 9, 10 (for Dengue virus); 12, 13, 14, 15, 39 (for Chikungunya virus); 16 and 17 (Broadspectrum activity for both HCV and Dengue Virus); 24 and 19 (for West Nile Virus); 21, 22 and 23 (Broad spectrum activity for both Dengue and West Nile Viruses); 32 (Broad spectrum activity for both HCV and Dengue Virus), 36, 38, 40, 41, 42, 88, 89, 65, 43, 44, 45, 66, 67, 46, 47, 48, 49, 68, 69, 70, 50, 51, 52, 53, 71, 72, 54, 55, 56, 57 (for SARS-CoV-2 virus). These are the target hybridization regions which completely hybridize with the hybridization regions comprised in the artificial RNAs described in the examples below.
Preferably, the the one or more target hybridization regions which completely hybridize with the at least one hybridization region comprised in the artificial RNA of the present invention, in any of its embodiments, which may also be comprised in the composition and/or kit of the present invention is comprised in SEQ ID NO.: 1, SEQ ID NO.: 7, SEQ ID NO.: 11, SEQ ID NO.: 20 and/or SEQ ID NO.: 34.
In a fourth aspect, the present invention provides the artificial RNA of the present invention, in any of its embodiments, or the composition or the kit of the present invention for use as a medicament. Preferably, the present invention provides the artificial RNA of the present invention, in any of its embodiments, or the composition or the kit of the present invention for use in a method of preventing and/or treating a viral infection. Preferably, the artificial RNA of the present invention has a broad spectrum activity against two or more RNA viruses.
In a further embodiment, the present invention provides the artificial RNA of the present invention, in any of its embodiments, or the composition or the kit of the present invention for use in a method of preventing and/or treating cancer.
In a further embodiment, the present invention provides the artificial RNA of the present invention, in any of its embodiments, or the composition or the kit of the present invention for use in a method of preventing and/or treating genetic disorders.
In the context of the present invention, a genetic disorder refers to a health problem caused by one or more abnormalities in the genome. It can be caused by a mutation in a single gene (monogenic) or multiple genes (polygenic) or by a chromosomal abnormality. Examples of genetic disorders are the following: Familial hypercholesterolemia, Polycystic kidney disease, Neurofibromatosis type I, Hereditary spherocytosis, Marfan syndrome, Huntington’s disease, Sickle cell anaemia, Cystic fibrosis, Tay-Sachs disease, Phenylketonuria, Mucopolysaccharidoses, Lysosomal acid lipase deficiency, Glycogen storage diseases, Galactosemia, Duchenne muscular dystrophy or Hemophilia.
Hence, in the fourth aspect, the present invention provides the use of the artificial RNA of the present invention, in any of its embodiments, or the composition or the kit of the present invention for the manufacture of a medicament for preventing and/or treating a viral infection and/or cancer and/or a genetic disorder.
In a preferred embodiment, the viral infection is caused by HCV, Dengue, Zika, Chikungunya, West Nile, Yellow Fever virus or coronavirus, such as SARS and/or MERS, preferably SARS-CoV-2.
As it is well known in the art (see for example WO 2017/222911), any known method of nucleic acid delivery may be used for administration of the artificial RNAs as disclosed herein (e.g., immunogenic or non-immunogenic) to a subject. For example, an artificial RNA may be administered by transfection in vivo. Alternatively, the artificial RNA may be administered by transfection ex vivo, and subsequent transfer of a cell transfected with the artificial RNA to the subject.
An artificial RNA, such as a circular RNA, can be delivered with a nucleic acid carrier (e.g. cationic carrier) or a nanoparticle (e.g., lipid nanoparticle, polymeric nanoparticle, nanoparticle comprising a combination of polymers and peptides, or an electrostatic complex). The artificial RNA may be delivered to a subject using a recombinant virus, an exosome, liposome, or other lipid vesicle, or a cell engineered to secrete an artificial RNA, such as a circular RNA.
The artificial RNA, such as a circular RNA, can also be conjugated to a targeting ligand (e.g., small molecule, peptide or protein) for localized delivery to a particular site (e.g., cells, tissue, or organ) in the subject. The artificial RNA can be even linked to an internalization sequence, a protein transduction domain, or a cell penetrating peptide to facilitate entry into a cell.
In a fifth aspect, the present invention provides a method for producing the artificial RNA of the invention, preferably the artificial circular RNA of the present invention, wherein in the method comprises the step of:
Artificial RNAs, such as circRNAs, are designed using an in-house software tool. This tool allows for several design constraints to be taken into account, for instance GC content range of the sequence. Once the artificial RNAs, such as circRNAs RNAs, are designed, they can be produced intracellularly or by in vitro transcription.
Intracellular Production of Artificial RNAs, Such as CircRNAsThe corresponding artificial RNAs sequence, such as circRNAs sequence, in DNA form is commercially obtained and cloned to be later transformed into cells using the following steps.
First, the designed artificial RNA sequence is cloned into a plasmid (por example a pcDNA3-CIRS7 plasmid) between two sequences that mediate splicing and circularization, SA (splicing acceptor) and SD (splicing donor) (clone gently provided by Dr. Thomas B. Hansen from the University of Aarhus (Denmark) (Patent application: WO 2014/082644 A1). This plasmid contains a gene conferring resistance to the antibiotic ampicillin. The derived plasmid is then transformed into XL1-Blue competent cells (Sigma). The transformed cells are grown in LB media with ampicillin (LB—Amp) for selection. One of the selected colonies is then grown in LB—Amp liquid medium for 36h for amplification. After this time, the culture is centrifuged to obtain the bacteria cells and the plasmid purified using NucleoSpin® Plasmid kit (Macherey-Nagel).
When these derived plasmids are introduced into human cells, the transcription promoter CMV is recognized by the cellular transcription machinery and a mRNA is expressed using the host transcription machinery. For the production of circRNAs, the resultant RNA is circularized by the host splicing machinery generating the designed circRNAs (see FIG. 1).
In Vitro Production of Artificial CircRNAsThe production of circRNAs can be also achieved in vitro by obtaining the corresponding linear RNA, through chemical synthesis or in vitro transcription, and then circularize it with RNA ligases (see FIG. 2).
A more efficient approach is to produce the circRNAs in vitro from T7 promoter-flanked templates. This plasmid contains self-cleavage ribozymes that after the in vitro transcription will be cleaved generating the ends that will allow the circularization and generation of circRNAs. For each candidate, the T7 promoter plasmid was linearized using Hindlll (FastDigest) during 30 min at 37° C. The purified linearized molecule was in vitro transcribed and purified from a polyacrylamide gel. Afterwards, the RNAs will be circularized using RtcB (NEB) and the circularized molecules were selected after RNAse R (Lucigen) treatment during 30′ at 37° C. (See FIG. 25).
More specifically, circRNAs were produced from a T7-derived plasmid containing the circRNA of interest surrounded in both ends by ribozymes which are RNA molecules with self-cleavage capacity. We used at the 5′ the eggplant latent viroid (ELVd) and at the 3′, the coral one, as the pair of hammerheads. As we saw lower cleavage efficiency in the 5′ hammerhead, we tested several ribozymes both natural and artificial in order to decide which pair of hammerheads were more efficient. As seen in the FIG. 29, all hammerheads tested except number 3 and 7 produced the desired cleaved RNA molecule with different cleavage efficiencies being hammerheads 5-6-9 the best ones. After extracting the bands of the corresponding cleaved RNA molecule from the gel, we saw similar amounts in the three hammerheads, however, we decided to use the artificial ribozyme 3 (ART-RBZ3) as the hammerhead was behaving the same way as in the predictions in silico.
We, then, tested whether we could increase the ratio of partially cleaved/completely cleaved using different concentrations of magnesium in buffers but we did not observe any difference (FIG. 30).
Once the hammerheads were established and to continue with the production of our desired circRNA, we cloned the circRNA sequence into the plasmid and we linearized 10 micrograms using Hind III (Fast Digest) following manufacturer’s instructions. The linearized DNA was phenol-chloroform purified and further in vitro transcribed. Moreover, we tested the optimal amount of linearized plasmid to use as a template and the reaction time. We saw that using either 10 micrograms or 1 microgram of linearized DNA, we obtained the same quantity of cleaved RNA molecule using T7 RNA polymerase (Takara) either incubating 6h (as recommended by the manufacturer’s) or 3h (FIG. 31). Thus, we decided to do the IVT using 1 microgram of template and 3h of reaction.
The IVT was stopped and ran in a urea gel for 4 hours and the desired band (complete cleavage) was cut and RNA was further isolated from there. This last step generates a low yield of the recovered RNA and requires plenty of time to generate sufficient linear molecule to further continue with the protocol. To improve this, we purified the IVT by Chloroform/Isoamyl alcohol extraction instead of running a gel with better results in terms of recovery.
Next, we proceed with the circularization of 10 micrograms of purified linear RNA using RtcB (New England Biolabs) during 1 hour at 37° C. To eliminate non-circular RNA forms, the resulting RNA was RNAse R (Lucigen) treated and purified following manufacturer’s instructions. In order to validate the RNAse R treatment, we ran a urea gel and selected the circRNA band. As said before, the urea gel purification caused a significant loss of RNA material. Therefore, we decided to avoid the gel purification, increasing the RNAse R conditions (FIG. 32) and purifying as done before in the protocol obtaining higher amounts of circRNA. This change in the protocol (see FIG. 25) is key to achieve significant amounts of circRNA at reasonable cost and time. Finally, the presence of circRNA was verified with a TBE-Urea gel only using 1% of the material.
Mode of ActionThe artificial RNAs, such as circRNAs, are designed so that they hybridize with selected regions (target hybridization regions) present in target disruption structures of one or more RNA fragments, such as an RNA viral genome. These target disruption structures are relevant to the functionality of the RNA fragments, as described above. For instance, if the RNA fragment is RNA viral genome, the target disruption structures may be relevant for multiple functions of the viral RNA and infectivity such as translation, replication, localization or/and encapsidation. These signals can be found in the 5′ and 3′untranslated regions and in the coding sequence region (CDS) of the viral RNA genomes. In one embodiment, these target disruption structures can be located within the IRES element (Internal Ribosomal Entry Site), which is responsible for sequestering the host ribosomes to initiate translation of the viral proteins for some viral RNA genomes.
The mechanism of action is NOT just the hybridization between the hybridization regions of the artificial RNA and the target hybridization regions of the target disruption structures, in contrast to the state of the art, but the structural changes triggered upon this hybridization will alter the secondary structure of the RNA fragment, ultimately affecting its function. For instance, viral RNA genomes and viral mRNAs contain highly structured regions essential for their function. Binding of the designed artificial RNAs to target disruption structures in the viral RNA genome will lead to the unfolding of the structure (changes in the secondary structure) and consequently to the reduction or even inhibition of the infectivity (see, e.g., FIG. 3).
For instance, the disruption of the target disruption structures in the RNA viral genome can disturb the accessibility of RNA binding proteins (RBP) to their target viral RNA sequences. Note that this strategy differs from that whose aim is hybridizing the exact binding site of an RBP (see, e.g., FIG. 4).
Sometimes, RBPs bind single stranded RNA regions that require to be found in a specific structural context, for instance, immediately 3′ of a stem loop (see, e.g., FIG. 4, left side). In our case, hybridizing with a different target hybridization region might disrupt this stem loop (which is part of a target disruption structure) and, although the binding site remains accessible, the structural change renders RBP binding ineffective (see, e.g., FIG. 4, right side).
StructureThe structure of the designed artificial RNAs, such as circRNAs, is very flexible. Generally, it contains at least one, preferably several hybridization regions that hybridize with at least one, preferably several target hybridization regions present in at least one, preferably several target disruption structures of one or more RNA fragments, preferably in the viral genome. These preferably several hybridization regions in the artificial RNA are preferably separated by sequences that are quasi-random, in the sense that they do not perform any functions other than separate the preferably several hybridization regions, and to allow for the observance of the design constraints (low secondary structure, specific GC content, etc.). For instance, an example of an artificial RNA, which is a circRNA, that targets 3 different target disruption structures of the viral genome with 2 hybridization regions per target disruption structure is depicted in FIG. 5. Regions with the same color represent the fact that they target the same viral target disruption structure.
However, as explained above, these preferably several hybridization regions of the artificial RNA, such as circRNA, that target the same target hybridization region within a certain target disruption structure are preferably designed to be different from each other. This is possible since RNA allows for three different base-pairing types: G-C, A-U and G-U. This fact also entails that, e.g., viral escape (through mutations) from the artificial RNAs is more difficult since it will need to escape all the different hybridization regions at the same time. Note that the hybridization requirement is different from the anti-sense or complementarity requirement.
It is also possible to design the hybridization regions of a single artificial RNA in order to target different regions of different RNA fragments, such as different regions of different RNA viruses to obtain broad-spectrum artificial RNAs.
In a sixth aspect, the present invention provides a method of screening for artificial circular RNA comprising two or more hybridization regions capable of disrupting by hybridization one or more target disruption structures of one or more RNA fragments, wherein the target disruption structures are defined as comprising:
As indicated above, in step a) of the method according to the sixth aspect or any of its embodiments, the identification of the two or more hybridization regions according to step a) is performed by RNA inverse folding tools such as NUPACK, RNAifold, MoiRNAiFold, wherein the method preferably comprises the steps of:
In a preferred embodiment of the method according to the sixth aspect or any of its embodiments, the method comprises a pre-step that comprises identifying as a target disruption structure those structures of one or more RNA fragments that comprise:
In a preferred embodiment of the method according to the sixth aspect or any of its embodiments, the method comprises a further step d) of confirming in a biological setting the capacity of the designed artificial circular RNA as designed in step b) of disrupting by hybridization one or more target disruption structures of one or more RNA fragments.
In a preferred embodiment, the method according to the sixth aspect or any of its embodiments comprises the use of the target disruption structures and the target hybridization regions defined above in Tables 1 to 7.
The present invention is now further illustrated by reference to the following examples which do not intend to limit the scope of the present invention.
SEQUENCE LISTINGSEQ ID NO: 1
| <211> 9678 | <212> RNA | <213> Hepatitis C virus | <220> | <221> misc_ feature | <222> 24..56 | <223> /note=“target region of the 5′UTR” | <220> | <221> misc_ feature | <222> 323..346 | <223> /note=“target region of the 5′UTR” | <220> | <221> misc_ feature | <222> 372..399 | <223> /note=“target region of the CDS” | <220> | <221> misc_ feature | <222> 459..474 | <223> /note=“target region of the CDS” | <220> | <221> misc_ feature | <222> 651..668 | <223> /note=“target region of the CDS” | <220> | <221> misc_ feature | <222> 9567..9600 | <223> /note=“target region of the 3′UTR” | <400> 1 |
| accugccccu aauaggggcg acacuccgcc augaaucacu ccccugugag gaacuacugu 60 | cuucacgcag aaagcgccua gccauggcgu uaguaugagu gucguacagc cuccaggccc 120 | cccccucccg ggagagccau aguggucugc ggaaccggug aguacaccgg aauugccggg 180 | aagacugggu ccuuucuugg auaaacccac ucuaugcccg gccauuuggg cgugcccccg 240 | caagacugcu agccgaguag cguuggguug cgaaaggccu ugugguacug ccugauaggg 300 | cgcuugcgag ugccccggga ggucucguag accgugcacc augagcacaa auccuaaacc 360 | ucaaagaaaa accaaaagaa acaccaaccg ucgcccagaa gacguuaagu ucccgggcgg 420 | cggccagauc guuggcggag uauacuuguu gccgcgcagg ggccccaggu ugggugugcg 480 | cacgacaagg aaaacuucgg agcgguccca gccacguggg agacgccagc ccauccccaa 540 | agaucggcgc uccacuggca aggccugggg aaaaccaggu cgccccuggc cccuauaugg 600 | gaaugaggga cucggcuggg caggauggcu ccuguccccc cgaggcucuc gccccuccug 660 | gggccccacu gacccccggc auaggucgcg caacgugggu aaagucaucg acacccuaac 720 | guguggcuuu gccgaccuca ugggguacau ccccgucgua ggcgccccgc uuaguggcgc 780 | cgccagagcu gucgcgcacg gcgugagagu ccuggaggac gggguuaauu augcaacagg 840 | gaaccuaccc gguuuccccu uuucuaucuu cuugcuggcc cuguuguccu gcaucaccgu 900 | uccggucucu gcugcccagg ugaagaauac caguagcagc uacaugguga ccaaugacug 960 | cuccaaugac agcaucacuu ggcagcucga ggcugcgguu cuccacgucc ccgggugcgu 1020 | cccgugcgag agagugggga auacgucacg guguugggug ccagucucgc caaacauggc 1080 | ugugcggcag cccggugccc ucacgcaggg ucugcggacg cacaucgaua ugguugugau 1140 | guccgccacc uucugcucug cucucuacgu gggggaccuc uguggcgggg ugaugcucgc 1200 | ggcccaggug uucaucgucu cgccgcagua ccacugguuu gugcaagaau gcaauugcuc 1260 | caucuacccu ggcaccauca cuggacaccg cauggcaugg gacaugauga ugaacugguc 1320 | gcccacggcc accaugaucc uggcguacgu gaugcgcguc cccgagguca ucauagacau 1380 | cguuagcggg gcucacuggg gcgucauguu cggcuuggcc uacuucucua ugcagggagc 1440 | gugggcgaag gucauuguca uccuucugcu ggccgcuggg guggacgcgg gcaccaccac 1500 | cguuggaggc gcuguugcac guuccaccaa cgugauugcc ggcguguuca gccauggccc 1560 | ucagcagaac auucagcuca uuaacaccaa cggcaguugg cacaucaacc guacugccuu 1620 | gaauugcaau gacuccuuga acaccggcuu ucucgcggcc uuguucuaca ccaaccgcuu 1680 | uaacucguca ggguguccag ggcgccuguc cgccugccgc aacaucgagg cuuuccggau 1740 | aggguggggc acccuacagu acgaggauaa ugucaccaau ccagaggaua ugaggccgua 1800 | cugcuggcac uaccccccaa agccgugugg cguagucccc gcgaggucug uguguggccc 1860 | aguguacugu uucaccccca gcccgguagu agugggcacg accgacagac guggagugcc 1920 | caccuacaca uggggagaga augagacaga ugucuuccua cugaacagca cccgaccgcc 1980 | gcagggcuca ugguucggcu gcacguggau gaacuccacu gguuucacca agacuugugg 2040 | cgcgccaccu ugccgcacca gagcugacuu caacgccagc acggacuugu ugugcccuac 2100 | ggauuguuuu aggaagcauc cugaugccac uuauauuaag ugugguucug ggcccuggcu 2160 | cacaccaaag ugccuggucc acuacccuua cagacucugg cauuaccccu gcacagucaa 2220 | uuuuaccauc uucaagauaa gaauguaugu aggggggguu gagcacaggc ucacggccgc 2280 | augcaacuuc acucgugggg aucgcugcga cuuggaggac agggacagga gucagcuguc 2340 | uccucuguug cacucuacca cggaaugggc cauccugccc ugcaccuacu cagacuuacc 2400 | cgcuuuguca acuggucuuc uccaccuuca ccagaacauc guggacguac aauacaugua 2460 | uggccucuca ccugcuauca caaaauacgu cguucgaugg gagugggugg uacucuuauu 2520 | ccugcucuua gcggacgcca gagucugcgc cugcuugugg augcucaucu uguugggcca 2580 | ggccgaagca gcauuggaga aguuggucgu cuugcacgcu gcgagugcgg cuaacugcca 2640 | uggccuccua uauuuugcca ucuucuucgu ggcagcuugg cacaucaggg gucggguggu 2700 | ccccuugacc accuauugcc ucacuggccu auggcccuuc ugccuacugc ucauggcacu 2760 | gccccggcag gcuuaugccu augacgcacc ugugcacgga cagauaggcg uggguuuguu 2820 | gauauugauc acccucuuca cacucacccc gggguauaag acccuccucg gccagugucu 2880 | guggugguug ugcuaucucc ugacccuggg ggaagccaug auucaggagu ggguaccacc 2940 | caugcaggug cgcggcggcc gcgauggcau cgcgugggcc gucacuauau ucugcccggg 3000 | ugugguguuu gacauuacca aauggcuuuu ggcguugcuu gggccugcuu accucuuaag 3060 | ggccgcuuug acacaugugc cguacuucgu cagagcucac gcucugauaa ggguaugcgc 3120 | uuuggugaag cagcucgcgg gggguaggua uguucaggug gcgcuauugg cccuuggcag 3180 | guggacuggc accuacaucu augaccaccu cacaccuaug ucggacuggg ccgcuagcgg 3240 | ccugcgcgac uuagcggucg ccguggaacc caucaucuuc aguccgaugg agaagaaggu 3300 | caucgucugg ggagcggaga cggcugcaug uggggacauu cuacauggac uucccguguc 3360 | cgcccgacuc ggccaggaga uccuccucgg cccagcugau ggcuacaccu ccaaggggug 3420 | gaagcuccuu gcucccauca cugcuuaugc ccagcaaaca cgaggccucc ugggcgccau 3480 | aguggugagu augacggggc gugacaggac agaacaggcc ggggaagucc aaauccuguc 3540 | cacagucucu caguccuucc ucggaacaac caucucgggg guuuugugga cuguuuacca 3600 | cggagcuggc aacaagacuc uagccggcuu acgggguccg gucacgcaga uguacucgag 3660 | ugcugagggg gacuugguag gcuggcccag ccccccuggg accaagucuu uggagccgug 3720 | caagugugga gccgucgacc uauaucuggu cacgcggaac gcugauguca ucccggcucg 3780 | gagacgcggg gacaagcggg gagcauugcu cuccccgaga cccauuucga ccuugaaggg 3840 | guccucgggg gggccggugc ucugcccuag gggccacguc guugggcucu uccgagcagc 3900 | ugugugcucu cggggcgugg ccaaauccau cgauuucauc cccguugaga cacucgacgu 3960 | uguuacaagg ucucccacuu ucagugacaa cagcacgcca ccggcugugc cccagaccua 4020 | ucaggucggg uacuugcaug cuccaacugg caguggaaag agcaccaagg ucccugucgc 4080 | guaugccgcc cagggguaca aaguacuagu gcuuaacccc ucgguagcug ccacccuggg 4140 | guuuggggcg uaccuaucca aggcacaugg caucaauccc aacauuagga cuggagucag 4200 | gaccgugaug accggggagg ccaucacgua cuccacauau ggcaaauuuc ucgccgaugg 4260 | gggcugcgcu agcggcgccu augacaucau cauaugcgau gaaugccacg cuguggaugc 4320 | uaccuccauu cucggcaucg gaacgguccu ugaucaagca gagacagccg gggucagacu 4380 | aacugugcug gcuacggcca caccccccgg gucagugaca accccccauc ccgauauaga 4440 | agagguaggc cucgggcggg agggugagau ccccuucuau gggagggcga uuccccuauc 4500 | cugcaucaag ggagggagac accugauuuu cugccacuca aagaaaaagu gugacgagcu 4560 | cgcggcggcc cuucggggca ugggcuugaa ugccguggca uacuauagag gguuggacgu 4620 | cuccauaaua ccagcucagg gagauguggu ggucgucgcc accgacgccc ucaugacggg 4680 | guacacugga gacuuugacu ccgugaucga cugcaaugua gcggucaccc aagcugucga 4740 | cuucagccug gaccccaccu ucacuauaac cacacagacu gucccacaag acgcugucuc 4800 | acgcagucag cgccgcgggc gcacagguag aggaagacag ggcacuuaua gguauguuuc 4860 | cacuggugaa cgagccucag gaauguuuga caguguagug cuuugugagu gcuacgacgc 4920 | aggggcugcg ugguacgauc ucacaccagc ggagaccacc gucaggcuua gagcguauuu 4980 | caacacgccc ggccuacccg ugugucaaga ccaucuugaa uuuugggagg caguuuucac 5040 | cggccucaca cacauagacg cccacuuccu cucccaaaca aagcaagcgg gggagaacuu 5100 | cgcguaccua guagccuacc aagcuacggu gugcgccaga gccaaggccc cucccccguc 5160 | cugggacgcc auguggaagu gccuggcccg acucaagccu acgcuugcgg gccccacacc 5220 | ucuccuguac cguuugggcc cuauuaccaa ugaggucacc cucacacacc cugggacgaa 5280 | guacaucgcc acaugcaugc aagcugaccu ugaggucaug accagcacgu ggguccuagc 5340 | uggaggaguc cuggcagccg ucgccgcaua uugccuggcg acuggaugcg uuuccaucau 5400 | cggccgcuug cacgucaacc agcgagucgu cguugcgccg gauaaggagg uccuguauga 5460 | ggcuuuugau gagauggagg aaugcgccuc uagggcggcu cucaucgaag aggggcagcg 5520 | gauagccgag auguugaagu ccaagaucca aggcuugcug cagcaggccu cuaagcaggc 5580 | ccaggacaua caacccgcua ugcaggcuuc auggcccaaa guggaacaau uuugggccag 5640 | acacaugugg aacuucauua gcggcaucca auaccucgca ggauugucaa cacugccagg 5700 | gaaccccgcg guggcuucca ugauggcauu cagugccgcc cucaccaguc cguugucgac 5760 | caguaccacc auccuucuca acaucauggg aggcugguua gcgucccaga ucgcaccacc 5820 | cgcgggggcc accggcuuug ucgucagugg ccuggugggg gcugccgugg gcagcauagg 5880 | ccuggguaag gugcuggugg acauccuggc aggauauggu gcgggcauuu cgggggcccu 5940 | cgucgcauuc aagaucaugu cuggcgagaa gcccucuaug gaagauguca ucaaucuacu 6000 | gccugggauc cugucuccgg gagcccuggu gguggggguc aucugcgcgg ccauucugcg 6060 | ccgccacgug ggaccggggg agggcgcggu ccaauggaug aacaggcuua uugccuuugc 6120 | uuccagagga aaccacgucg ccccuacuca cuacgugacg gagucggaug cgucgcagcg 6180 | ugugacccaa cuacuuggcu cucuuacuau aaccagccua cucagaagac uccacaauug 6240 | gauaacugag gacugcccca ucccaugcuc cggauccugg cuccgcgacg ugugggacug 6300 | gguuugcacc aucuugacag acuucaaaaa uuggcugacc ucuaaauugu uccccaagcu 6360 | gcccggccuc cccuucaucu cuugucaaaa gggguacaag gguguguggg ccggcacugg 6420 | caucaugacc acgcgcugcc cuugcggcgc caacaucucu ggcaaugucc gccugggcuc 6480 | uaugaggauc acagggccua aaaccugcau gaacaccugg caggggaccu uuccuaucaa 6540 | uugcuacacg gagggccagu gcgcgccgaa accccccacg aacuacaaga ccgccaucug 6600 | gaggguggcg gccucggagu acgcggaggu gacgcagcau gggucguacu ccuauguaac 6660 | aggacugacc acugacaauc ugaaaauucc uugccaacua ccuucuccag aguuuuucuc 6720 | cuggguggac ggugugcaga uccauagguu ugcacccaca ccaaagccgu uuuuccggga 6780 | ugaggucucg uucugcguug ggcuuaauuc cuaugcuguc gggucccagc uucccuguga 6840 | accugagccc gacgcagacg uauugagguc caugcuaaca gauccgcccc acaucacggc 6900 | ggagacugcg gcgcggcgcu uggcacgggg aucaccucca ucugaggcga gcuccucagu 6960 | gagccagcua ucagcaccgu cgcugcgggc caccugcacc acccacagca acaccuauga 7020 | cguggacaug gucgaugcca accugcucau ggagggcggu guggcucaga cagagccuga 7080 | guccagggug cccguucugg acuuucucga gccaauggcc gaggaagaga gcgaccuuga 7140 | gcccucaaua ccaucggagu gcaugcuccc caggagcggg uuuccacggg ccuuaccggc 7200 | uugggcacgg ccugacuaca acccgccgcu cguggaaucg uggaggaggc cagauuacca 7260 | accgcccacc guugcugguu gugcucuccc cccccccaag aaggccccga cgccuccccc 7320 | aaggagacgc cggacagugg gucugagcga gagcaccaua ucagaagccc uccagcaacu 7380 | ggccaucaag accuuuggcc agccccccuc gagcggugau gcaggcucgu ccacgggggc 7440 | gggcgccgcc gaauccggcg guccgacguc cccuggugag ccggcccccu cagagacagg 7500 | uuccgccucc ucuaugcccc cccucgaggg ggagccugga gauccggacc uggagucuga 7560 | ucagguagag cuucaaccuc ccccccaggg ggggggggua gcucccgguu cgggcucggg 7620 | gucuuggucu acuugcuccg aggaggacga uaccaccgug ugcugcucca ugucauacuc 7680 | cuggaccggg gcucuaauaa cucccuguag ccccgaagag gaaaaguugc caaucaaccc 7740 | uuugaguaac ucgcuguugc gauaccauaa caagguguac uguacaacau caaagagcgc 7800 | cucacagagg gcuaaaaagg uaacuuuuga caggacgcaa gugcucgacg cccauuauga 7860 | cucagucuua aaggacauca agcuagcggc uuccaagguc agcgcaaggc uccucaccuu 7920 | ggaggaggcg ugccaguuga cuccacccca uucugcaaga uccaaguaug gauucggggc 7980 | caaggagguc cgcagcuugu ccgggagggc cguuaaccac aucaaguccg uguggaagga 8040 | ccuccuggaa gacccacaaa caccaauucc cacaaccauc auggccaaaa augagguguu 8100 | cugcguggac cccgccaagg gggguaagaa accagcucgc cucaucguuu acccugaccu 8160 | cggcguccgg gucugcgaga aaauggcccu cuaugacauu acacaaaagc uuccucaggc 8220 | gguaauggga gcuuccuaug gcuuccagua cuccccugcc caacgggugg aguaucucuu 8280 | gaaagcaugg gcggaaaaga aggaccccau ggguuuuucg uaugauaccc gaugcuucga 8340 | cucaaccguc acugagagag acaucaggac cgaggagucc auauaccagg ccugcucccu 8400 | gcccgaggag gcccgcacug ccauacacuc gcugacugag agacuuuacg uaggagggcc 8460 | cauguucaac agcaaggguc aaaccugcgg uuacagacgu ugccgcgcca gcggggugcu 8520 | aaccacuagc auggguaaca ccaucacaug cuaugugaaa gcccuagcgg ccugcaaggc 8580 | ugcggggaua guugcgccca caaugcuggu augcggcgau gaccuaguag ucaucucaga 8640 | aagccagggg acugaggagg acgagcggaa ccugagagcc uucacggagg ccaugaccag 8700 | guacucugcc ccuccuggug auccccccag accggaauau gaccuggagc uaauaacauc 8760 | cuguuccuca aaugugucug uggcguuggg cccgcggggc cgccgcagau acuaccugac 8820 | cagagaccca accacuccac ucgcccgggc ugccugggaa acaguuagac acuccccuau 8880 | caauucaugg cugggaaaca ucauccagua ugcuccaacc auauggguuc gcaugguccu 8940 | aaugacacac uucuucucca uucucauggu ccaagacacc cuggaccaga accucaacuu 9000 | ugagauguau ggaucaguau acuccgugaa uccuuuggac cuuccagcca uaauugagag 9060 | guuacacggg cuugacgccu uuucuaugca cacauacucu caccacgaac ugacgcgggu 9120 | ggcuucagcc cucagaaaac uuggggcgcc accccucagg guguggaaga gucgggcucg 9180 | cgcagucagg gcgucccuca ucucccgugg agggaaagcg gccguuugcg gccgauaucu 9240 | cuucaauugg gcggugaaga ccaagcucaa acucacucca uugccggagg cgcgccuacu 9300 | ggacuuaucc aguugguuca ccgucggcgc cggcgggggc gacauuuuuc acagcguguc 9360 | gcgcgcccga ccccgcucau uacucuucgg ccuacuccua cuuuucguag ggguaggccu 9420 | cuuccuacuc cccgcucggu agagcggcac acacuaggua cacuccauag cuaacuguuc 9480 | cuuuuuuuuu uuuuuuuuuu uuuuuuuuuu uuuuuuuuuu uuuucuuuuu uuuuuuuuuc 9540 | ccucuuucuu cccuucucau cuuauucuac uuucuuucuu gguggcucca ucuuagcccu 9600 | agucacggcu agcugugaaa gguccgugag ccgcaugacu gcagagagug ccguaacugg 9660 | ucucucugca gaucaugu 9678 |
SEQ ID NO: 2
| <211> 294 | <212> RNA | <213> Artificial sequence | <220> | <223> Circular Artificial sequence to IRES1 (hepatitis C virus) | (circ_hcv_ires1) | <220> | <221> misc_ feature | <222> 1..33 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <220> | <221> misc_ feature | <222> 1..33 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <220> | <221> misc_ feature | <222> 43..75 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <220> | <221> misc_ feature | <222> 85..117 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <220> | <221> misc_ feature | <222> 127..159 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <220> | <221> misc_ feature | <222> 169..201 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <220> | <221> misc_ feature | <222> 169..201 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <220> | <221> misc_ feature | <222> 211..243 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <220> | <221> misc_ feature | <222> 253..285 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <400> 2 |
| uaguuccuca cgggggagug guucguggug gagcggcgcc aaugguuuuu ugcgggggag 60 | ugguucgugg cggggguaac cccuuaguuc uucauggggg ggugguucau gguggggaaa 120 | cuaccguagu uuuucacagg ggggugguuc auggcggaga gaagcgcuua guuucuuaug 180 | ggggagugau ucauggcgga guguggggca ugguuuuucg caggggagug auucguggug 240 | gggagaguuu ugugguucuu uguagggggg ugauucgugg uggggacauc auug 294 |
SEQ ID NO: 3
| <211> 373 | <212> RNA | <213> Artificial sequence | <220> | <223> Circular Artificial sequence to IRES2 (hepatitis C virus) | <220> | <221> misc_ feature | <222> 11..34 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <220> | <221> misc_ feature | <222> 44..67 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <220> | <221> misc_ feature | <222> 77..100 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <220> | <221> misc_ feature | <222> 110..123 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <220> | <221> misc_ feature | <222> 133..166 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <220> | <221> misc_ feature | <222> 176..199 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <220> | <221> misc_ feature | <222> 209..232 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <220> | <221> misc_ feature | <222> 242..265 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <220> | <221> misc_ feature | <222> 275..298 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <220> | <221> misc_ feature | <222> 308..331 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <220> | <221> misc_ feature | <222> 341..373 | <223> /note=“hybridization site to IRES (hepatitis c virus)” | <400> 3 |
| ugccgaaaau gcuuauggug cacgguuugc gagagcaaga agagcuugug gugcaugguu 60 | ugcggggaca guaaaggcuc auggugcaug gucuacgagg ugagauagcg uuuauggugu 120 | acggucugug ggaaauuccg guguucgugg ugugcggucu gugggauauu agaucguuca 180 | ugguguacgg uuugugggga uaauagcggc uuauggugca cggucuaugg gacgcgagaa 240 | ggcucauggu gugugguuug ugaggcagug ugcgguucau ggugcacggu cugcgagaca 300 | ccaggcggcu cguggugcac ggucuauggg gugucgucgu gcuuguggug ugcggucuau 360 | gagggcggcu gaa 373 |
SEQ ID NO: 4
| <211> 346 | <212> RNA | <213> Artificial sequence | <220> | <223> Circular Artificial sequence to CDS1 (hepatitis C virus) | (circ_hcv_cds1 ) | <220> | <221> misc_ feature | <222> 11..38 | <223> /note=“hybridization site to CDS1 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 53..80 | <223> /note=“hybridization site to CDS1 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 95..122 | <223> /note=“hybridization site to CDS1 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 137..164 | <223> /note=“hybridization site to CDS1 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 179..206 | <223> /note=“hybridization site to CDS1 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 221..248 | <223> /note=“hybridization site to CDS1 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 263..290 | <223> /note=“hybridization site to CDS1 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 305..332 | <223> /note=“hybridization site to CDS1 (hepatitis C virus)” | <400> 4 |
| cugcacuggg uuugggcgac gguugguguu uuuuuuggac gagauuucuu gcucugggcg 60 | acgguuggug uuucuuuugg guguuagugc guacucuggg cgaugguugg uguuucuuuu 120 | gguaauuauu acuuucuuug ggcgaugguu gguguuuuuu uugguggggu gaaaagaguu 180 | ugggcggugg uugguguuuc uuuuggcgug gugaguaaca uuuggguggc gguugguguu 240 | uuuuuuggcu gcaacgcacc gguuugggcg acgguuggug uuucuuuugg gggucaaccg 300 | ggaaucuggg uggcgguugg uguuuuuuuu ggugauggcc gaggua 346 |
SEQ ID NO: 5
| <211> 355 | <212> RNA | <213> Artificial sequence | <220> | <223> Circular Artificial sequence to IRES1, IRES2 and CDS1 (hepatitis | C virus) (circ_hcv_combo1) | <220> | <221> misc_ feature | <222> 11..43 | <223> /note=“hybridization site to IRES1 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 54..77 | <223> /note=“hybridization site to IRES2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 88..115 | <223> /note=“hybridization site to CDS1 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 126..158 | <223> /note=“hybridization site to IRES1 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 169..192 | <223> /note=“hybridization site to IRES2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 203..230 | <223> /note=“hybridization site to CDS1 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 241..273 | <223> /note=“hybridization site to IRES1 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 284..307 | <223> /note=“hybridization site to IRES2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 318..345 | <223> /note=“hybridization site to IRES2 (hepatitis C virus)” | <400> 5 |
| gcgccaagua uaguuccuca caggggagug auuuauggug gagaccccua aacgcuugug 60 | gugcacgguc uacgggguac cgagaaguuu gggcgguggu ugguguuuuu uuuggcgcuu 120 | gugggugguu uuuugcaggg gagugauuua ugguggaggc aagaguuugc uuauggugua 180 | cggucuguga gaugacauca gguuugggcg gcgguuggug uuuuuuuugg augaggaacc 240 | uaguucuuca uaggggagug auuuguggug gagacagcga guuguuugug gugcacgguu 300 | uacgagaaga augaagaucu ggguggcggu ugguguuucu uuugguagca caugu 355 |
SEQ ID NO: 6
| <211> 288 | <212> RNA | <213> Artificial sequence | <220> | <223> Circular Artificial sequence to CDS2 (hepatitis C virus) | (circ_hcv_cds2) | <220> | <221> misc_ feature | <222> 4..14 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 28..38 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 52..62 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 76..86 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 100..110 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 124..134 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 148..158 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 172..182 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 196..206 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 220..230 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 244..254 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 266..278 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <400> 6 |
| cccccugggg cucugaugag gaaccucucu ggggucccca cagcgagucu ccuuggggcc 60 | ccuagaauga aguucuuugg gguuucauag cacgguucuc cugggguuuu cauacgauug 120 | ucucuugggg ucuugcgugu uuacccuuuu gggguccugc uaagggggcu uucuggggcc 180 | uuucgaauaa gucuuuuugg ggccucguuu uaucacucuu cugggguucc cagccuuucc 240 | cuucuugggg cuccuccgac caugccccuu gggguucuac ccuguaug 288 |
SEQ ID NO: 7
| <211> 10722 | <212> RNA | <213> Dengue virus | <220> | <221> misc_ feature | <222> 108..140 | <223> /note=“target region of cHP” | <220> | <221> misc_ feature | <222> 10615..10646 | <223> /note=“target region of 3UTR” | <400> 7 |
| aguuguuagu cuacguggac cgacaaagac agauucuuug agggagcuaa gcucaacgua 60 | guucuaacag uuuuuuaauu agagagcaga ucucugauga auaaccaacg gaaaaaggcg 120 | aaaaacacgc cuuucaauau gcugaaacgc gagagaaacc gcgugucgac ugugcaacag 180 | cugacaaaga gauucucacu uggaaugcug cagggacgag gaccauuaaa acuguucaug 240 | gcccuggugg cguuccuucg uuuccuaaca aucccaccaa cagcagggau auugaagaga 300 | uggggaacaa uuaaaaaauc aaaagcuauu aauguuuuga gaggguucag gaaagagauu 360 | ggaaggaugc ugaacaucuu gaauaggaga cgcagaucug caggcaugau cauuaugcug 420 | auuccaacag ugauggcguu ccauuuaacc acacguaacg gagaaccaca caugaucguc 480 | agcagacaag agaaagggaa aagucuucug uuuaaaacag aggauggcgu gaacaugugu 540 | acccucaugg ccauggaccu uggugaauug ugugaagaca caaucacgua caaguguccc 600 | cuucucaggc agaaugagcc agaagacaua gacuguuggu gcaacucuac guccacgugg 660 | guaacuuaug ggacguguac caccauggga gaacauagaa gagaaaaaag aucaguggca 720 | cucguuccac augugggaau gggacuggag acacgaacug aaacauggau gucaucagaa 780 | ggggccugga aacaugucca gagaauugaa acuuggaucu ugagacaucc aggcuucacc 840 | augauggcag caauccuggc auacaccaua ggaacgacac auuuccaaag agcccugauu 900 | uucaucuuac ugacagcugu cacuccuuca augacaaugc guugcauagg aaugucaaau 960 | agagacuuug uggaaggggu uucaggagga agcuggguug acauagucuu agaacaugga 1020 | agcuguguga cgacgauggc aaaaaacaaa ccaacauugg auuuugaacu gauaaaaaca 1080 | gaagccaaac agccugccac ccuaaggaag uacuguauag aggcaaagcu aaccaacaca 1140 | acaacagaau cucgcugccc aacacaaggg gaacccagcc uaaaugaaga gcaggacaaa 1200 | agguucgucu gcaaacacuc caugguagac agaggauggg gaaauggaug uggacuauuu 1260 | ggaaagggag gcauugugac cugugcuaug uucagaugca aaaagaacau ggaaggaaaa 1320 | guugugcaac cagaaaacuu ggaauacacc auugugauaa caccucacuc aggggaagag 1380 | caugcagucg gaaaugacac aggaaaacau ggcaaggaaa ucaaaauaac accacagagu 1440 | uccaucacag aagcagaauu gacagguuau ggcacuguca caauggagug cucuccaaga 1500 | acgggccucg acuucaauga gaugguguug cugcagaugg aaaauaaagc uuggcuggug 1560 | cacaggcaau gguuccuaga ccugccguua ccaugguugc ccggagcgga cacacaaggg 1620 | ucaaauugga uacagaaaga gacauugguc acuuucaaaa auccccaugc gaagaaacag 1680 | gauguuguug uuuuaggauc ccaagaaggg gccaugcaca cagcacuuac aggggccaca 1740 | gaaauccaaa ugucaucagg aaacuuacuc uucacaggac aucucaagug caggcugaga 1800 | auggacaagc uacagcucaa aggaauguca uacucuaugu gcacaggaaa guuuaaaguu 1860 | gugaaggaaa uagcagaaac acaacaugga acaauaguua ucagagugca auaugaaggg 1920 | gacggcucuc caugcaagau cccuuuugag auaauggauu uggaaaaaag acaugucuua 1980 | ggucgccuga uuacagucaa cccaauugug acagaaaaag auagcccagu caacauagaa 2040 | gcagaaccuc cauucggaga cagcuacauc aucauaggag uagagccggg acaacugaag 2100 | cucaacuggu uuaagaaagg aaguucuauc ggccaaaugu uugagacaac aaugaggggg 2160 | gcgaagagaa uggccauuuu aggugacaca gccugggauu uuggauccuu gggaggagug 2220 | uuuacaucua uaggaaaggc ucuccaccaa gucuuuggag caaucuaugg agcugccuuc 2280 | agugggguuu cauggacuau gaaaauccuc auaggaguca uuaucacaug gauaggaaug 2340 | aauucacgca gcaccucacu gucugugaca cuaguauugg ugggaauugu gacacuguau 2400 | uugggaguca uggugcaggc cgauaguggu ugcguuguga gcuggaaaaa caaagaacug 2460 | aaauguggca gugggauuuu caucacagac aacgugcaca cauggacaga acaauacaag 2520 | uuccaaccag aauccccuuc aaaacuagcu ucagcuaucc agaaagccca ugaagagggc 2580 | auuuguggaa uccgcucagu aacaagacug gagaaucuga uguggaaaca aauaacacca 2640 | gaauugaauc acauucuauc agaaaaugag gugaaguuaa cuauuaugac aggagacauc 2700 | aaaggaauca ugcaggcagg aaaacgaucu cugcggccuc agcccacuga gcugaaguau 2760 | ucauggaaaa cauggggcaa agcaaaaaug cucucuacag agucucauaa ccagaccuuu 2820 | cucauugaug gccccgaaac agcagaaugc cccaacacaa auagagcuug gaauucguug 2880 | gaaguugaag acuauggcuu uggaguauuc accaccaaua uauggcuaaa auugaaagaa 2940 | aaacaggaug uauucugcga cucaaaacuc augucagcgg ccauaaaaga caacagagcc 3000 | guccaugccg auauggguua uuggauagaa agugcacuca augacacaug gaagauagag 3060 | aaagccucuu ucauugaagu uaaaaacugc cacuggccaa aaucacacac ccucuggagc 3120 | aauggagugc uagaaaguga gaugauaauu ccaaagaauc ucgcuggacc agugucucaa 3180 | cacaacuaua gaccaggcua ccauacacaa auaacaggac cauggcaucu agguaagcuu 3240 | gagauggacu uugauuucug ugauggaaca acagugguag ugacugagga cugcggaaau 3300 | agaggacccu cuuugagaac aaccacugcc ucuggaaaac ucauaacaga auggugcugc 3360 | cgaucuugca cauuaccacc gcuaagauac agaggugagg augggugcug guacgggaug 3420 | gaaaucagac cauugaagga gaaagaagag aauuugguca acuccuuggu cacagcugga 3480 | caugggcagg ucgacaacuu uucacuagga gucuugggaa uggcauuguu ccuggaggaa 3540 | augcuuagga cccgaguagg aacgaaacau gcaauacuac uaguugcagu uucuuuugug 3600 | acauugauca cagggaacau guccuuuaga gaccugggaa gagugauggu uaugguaggc 3660 | gccacuauga cggaugacau agguaugggc gugacuuauc uugcccuacu agcagccuuc 3720 | aaagucagac caacuuuugc agcuggacua cucuugagaa agcugaccuc caaggaauug 3780 | augaugacua cuauaggaau uguacuccuc ucccagagca ccauaccaga gaccauucuu 3840 | gaguugacug augcguuagc cuuaggcaug augguccuca aaauggugag aaauauggaa 3900 | aaguaucaau uggcagugac uaucauggcu aucuugugcg ucccaaacgc agugauauua 3960 | caaaacgcau ggaaagugag uugcacaaua uuggcagugg uguccguuuc cccacugcuc 4020 | uuaacauccu cacagcaaaa aacagauugg auaccauuag cauugacgau caaaggucuc 4080 | aauccaacag cuauuuuucu aacaacccuc ucaagaacca gcaagaaaag gagcuggcca 4140 | uuaaaugagg cuaucauggc agucgggaug gugagcauuu uagccaguuc ucuccuaaaa 4200 | aaugauauuc ccaugacagg accauuagug gcuggagggc uccucacugu gugcuacgug 4260 | cucacuggac gaucggccga uuuggaacug gagagagcag ccgaugucaa augggaagac 4320 | caggcagaga uaucaggaag caguccaauc cugucaauaa caauaucaga agaugguagc 4380 | augucgauaa aaaaugaaga ggaagaacaa acacugacca uacucauuag aacaggauug 4440 | cuggugaucu caggacuuuu uccuguauca auaccaauca cggcagcagc augguaccug 4500 | ugggaaguga agaaacaacg ggccggagua uugugggaug uuccuucacc cccacccaug 4560 | ggaaaggcug aacuggaaga uggagccuau agaauuaagc aaaaagggau ucuuggauau 4620 | ucccagaucg gagccggagu uuacaaagaa ggaacauucc auacaaugug gcaugucaca 4680 | cguggcgcug uucuaaugca uaaaggaaag aggauugaac caucaugggc ggacgucaag 4740 | aaagaccuaa uaucauaugg aggaggcugg aaguuagaag gagaauggaa ggaaggagaa 4800 | gaaguccagg uauuggcacu ggagccugga aaaaauccaa gagccgucca aacgaaaccu 4860 | ggucuuuuca aaaccaacgc cggaacaaua ggugcuguau cucuggacuu uucuccugga 4920 | acgucaggau cuccaauuau cgacaaaaaa ggaaaaguug ugggucuuua ugguaauggu 4980 | guuguuacaa ggaguggagc auaugugagu gcuauagccc agacugaaaa aagcauugaa 5040 | gacaacccag agaucgaaga ugacauuuuc cgaaagagaa gacugaccau cauggaccuc 5100 | cacccaggag cgggaaagac gaagagauac cuuccggcca uagucagaga agcuauaaaa 5160 | cgggguuuga gaacauuaau cuuggccccc acuagaguug uggcagcuga aauggaggaa 5220 | gcccuuagag gacuuccaau aagauaccag accccagcca ucagagcuga gcacaccggg 5280 | cgggagauug uggaccuaau gugucaugcc acauuuacca ugaggcugcu aucaccaguu 5340 | agagugccaa acuacaaccu gauuaucaug gacgaagccc auuucacaga cccagcaagu 5400 | auagcagcua gaggauacau cucaacucga guggagaugg gugaggcagc ugggauuuuu 5460 | augacagcca cucccccggg aagcagagac ccauuuccuc agagcaaugc accaaucaua 5520 | gaugaagaaa gagaaauccc ugaacguucg uggaauuccg gacaugaaug ggucacggau 5580 | uuuaaaggga agacuguuug guucguucca aguauaaaag caggaaauga uauagcagcu 5640 | ugccugagga aaaauggaaa gaaagugaua caacucagua ggaagaccuu ugauucugag 5700 | uaugucaaga cuagaaccaa ugauugggac uucgugguua caacugacau uucagaaaug 5760 | ggugccaauu ucaaggcuga gaggguuaua gaccccagac gcugcaugaa accagucaua 5820 | cuaacagaug gugaagagcg ggugauucug gcaggaccua ugccagugac ccacucuagu 5880 | gcagcacaaa gaagagggag aauaggaaga aauccaaaaa augagaauga ccaguacaua 5940 | uacauggggg aaccucugga aaaugaugaa gacugugcac acuggaaaga agcuaaaaug 6000 | cuccuagaua acaucaacac gccagaagga aucauuccua gcauguucga accagagcgu 6060 | gaaaaggugg augccauuga uggcgaauac cgcuugagag gagaagcaag gaaaaccuuu 6120 | guagacuuaa ugagaagagg agaccuacca gucugguugg ccuacagagu ggcagcugaa 6180 | ggcaucaacu acgcagacag aagguggugu uuugauggag ucaagaacaa ccaaauccua 6240 | gaagaaaacg uggaaguuga aaucuggaca aaagaagggg aaaggaagaa auugaaaccc 6300 | agaugguugg augcuaggau cuauucugac ccacuggcgc uaaaagaauu uaaggaauuu 6360 | gcagccggaa gaaagucucu gacccugaac cuaaucacag aaauggguag gcucccaacc 6420 | uucaugacuc agaaggcaag agacgcacug gacaacuuag cagugcugca cacggcugag 6480 | gcagguggaa gggcguacaa ccaugcucuc agugaacugc cggagacccu ggagacauug 6540 | cuuuuacuga cacuucuggc uacagucacg ggagggaucu uuuuauucuu gaugagcgga 6600 | aggggcauag ggaagaugac ccugggaaug ugcugcauaa ucacggcuag cauccuccua 6660 | ugguacgcac aaauacagcc acacuggaua gcagcuucaa uaauacugga guuuuuucuc 6720 | uaguuuugcu uauuccagaa ccugaaaaac agagaacacc ccaagacaac caacugaccu 6780 | acguugucau agccauccuc acaguggugg ccgcaaccau ggcaaacgag auggguuucc 6840 | uagaaaaaac gaagaaagau cucggauugg gaagcauugc aacccagcaa cccgagagca 6900 | acauccugga cauagaucua cguccugcau cagcauggac gcuguaugcc guggccacaa 6960 | cauuuguuac accaauguug agacauagca uugaaaauuc cucagugaau gugucccuaa 7020 | cagcuauagc caaccaagcc acaguguuaa ugggucucgg gaaaggaugg ccauugucaa 7080 | agauggacau cggaguuccc cuucucgcca uuggaugcua cucacaaguc aaccccauaa 7140 | cucucacagc agcucuuuuc uuauugguag cacauuaugc caucauaggg ccaggacucc 7200 | aagcaaaagc aaccagagaa gcucagaaaa gagcagcggc gggcaucaug aaaaacccaa 7260 | cugucgaugg aauaacagug auugaccuag auccaauacc uuaugaucca aaguuugaaa 7320 | agcaguuggg acaaguaaug cuccuagucc ucugcgugac ucaaguauug augaugagga 7380 | cuacaugggc ucugugugag gcuuuaaccu uagcuaccgg gcccaucucc acauuguggg 7440 | aaggaaaucc agggagguuu uggaacacua ccauugcggu gucaauggcu aacauuuuua 7500 | gagggaguua cuuggccgga gcuggacuuc ucuuuucuau uaugaagaac acaaccaaca 7560 | caagaagggg aacuggcaac auaggagaga cgcuuggaga gaaauggaaa agccgauuga 7620 | acgcauuggg aaaaagugaa uuccagaucu acaagaaaag uggaauccag gaaguggaua 7680 | gaaccuuagc aaaagaaggc auuaaaagag gagaaacgga ccaucacgcu gugucgcgag 7740 | gcucagcaaa acugagaugg uucguugaga gaaacauggu cacaccagaa gggaaaguag 7800 | uggaccucgg uuguggcaga ggaggcuggu cauacuauug uggaggacua aagaauguaa 7860 | gagaagucaa aggccuaaca aaaggaggac caggacacga agaacccauc cccaugucaa 7920 | cauaugggug gaaucuagug cgucuucaaa guggaguuga cguuuucuuc aucccgccag 7980 | aaaaguguga cacauuauug ugugacauag gggagucauc accaaauccc acaguggaag 8040 | caggacgaac acucagaguc cuuaacuuag uagaaaauug guugaacaac aacacucaau 8100 | uuugcauaaa gguucucaac ccauauaugc ccucagucau agaaaaaaug gaagcacuac 8160 | aaaggaaaua uggaggagcc uuagugagga auccacucuc acgaaacucc acacaugaga 8220 | uguacugggu auccaaugcu uccgggaaca uagugucauc agugaacaug auuucaagga 8280 | uguugaucaa cagauuuaca augagauaca agaaagccac uuacgagccg gauguugacc 8340 | ucggaagcgg aacccguaac aucgggauug aaagugagau accaaaccua gauauaauug 8400 | ggaaaagaau agaaaaaaua aagcaagagc augaaacauc auggcacuau gaccaagacc 8460 | acccauacaa aacgugggca uaccauggua gcuaugaaac aaaacagacu ggaucagcau 8520 | cauccauggu caacggagug gucaggcugc ugacaaaacc uugggacguc guccccaugg 8580 | ugacacagau ggcaaugaca gacacgacuc cauuuggaca acagcgcguu uuuaaagaga 8640 | aaguggacac gagaacccaa gaaccgaaag aaggcacgaa gaaacuaaug aaaauaacag 8700 | cagaguggcu uuggaaagaa uuagggaaga aaaagacacc caggaugugc accagagaag 8760 | aauucacaag aaaggugaga agcaaugcag ccuugggggc cauauucacu gaugagaaca 8820 | aguggaaguc ggcacgugag gcuguugaag auaguagguu uugggagcug guugacaagg 8880 | aaaggaaucu ccaucuugaa ggaaagugug aaacaugugu guacaacaug augggaaaaa 8940 | gagagaagaa gcuaggggaa uucggcaagg caaaaggcag cagagccaua ugguacaugu 9000 | ggcuuggagc acgcuucuua gaguuugaag cccuaggauu cuuaaaugaa gaucacuggu 9060 | ucuccagaga gaacucccug aguggagugg aaggagaagg gcugcacaag cuagguuaca 9120 | uucuaagaga cgugagcaag aaagagggag gagcaaugua ugccgaugac accgcaggau 9180 | gggauacaag aaucacacua gaagaccuaa aaaaugaaga aaugguaaca aaccacaugg 9240 | aaggagaaca caagaaacua gccgaggcca uuuucaaacu aacguaccaa aacaaggugg 9300 | ugcgugugca aagaccaaca ccaagaggca caguaaugga caucauaucg agaagagacc 9360 | aaagagguag uggacaaguu ggcaccuaug gacucaauac uuucaccaau auggaagccc 9420 | aacuaaucag acagauggag ggagaaggag ucuuuaaaag cauucagcac cuaacaauca 9480 | cagaagaaau cgcugugcaa aacugguuag caagaguggg gcgcgaaagg uuaucaagaa 9540 | uggccaucag uggagaugau uguguuguga aaccuuuaga ugacagguuc gcaagcgcuu 9600 | uaacagcucu aaaugacaug ggaaagauua ggaaagacau acaacaaugg gaaccuucaa 9660 | gaggauggaa ugauuggaca caagugcccu ucuguucaca ccauuuccau gaguuaauca 9720 | ugaaagacgg ucgcguacuc guuguuccau guagaaacca agaugaacug auuggcagag 9780 | cccgaaucuc ccaaggagca ggguggucuu ugcgggagac ggccuguuug gggaagucuu 9840 | acgcccaaau guggagcuug auguacuucc acagacgcga ccucaggcug gcggcaaaug 9900 | cuauuugcuc ggcaguacca ucacauuggg uuccaacaag ucgaacaacc ugguccauac 9960 | augcuaaaca ugaauggaug acaacggaag acaugcugac agucuggaac agggugugga 10020 | uucaagaaaa cccauggaug gaagacaaaa cuccagugga aucaugggag gaaaucccau 10080 | acuuggggaa aagagaagac caauggugcg gcucauugau uggguuaaca agcagggcca 10140 | ccugggcaaa gaacauccaa gcagcaauaa aucaaguuag aucccuuaua ggcaaugaag 10200 | aauacacaga uuacaugcca uccaugaaaa gauucagaag agaagaggaa gaagcaggag 10260 | uucuguggua gaaagcaaaa cuaacaugaa acaaggcuag aagucagguc ggauuaagcc 10320 | auaguacgga aaaaacuaug cuaccuguga gccccgucca aggacguuaa aagaagucag 10380 | gccaucauaa augccauagc uugaguaaac uaugcagccu guagcuccac cugagaaggu 10440 | guaaaaaauc cgggaggcca caaaccaugg aagcuguacg cauggcguag uggacuagcg 10500 | guuagaggag accccucccu uacaaaucgc agcaacaaug ggggcccaag gcgagaugaa 10560 | gcuguagucu cgcuggaagg acuagagguu agaggagacc cccccgaaac aaaaaacagc 10620 | auauugacgc ugggaaagac cagagauccu gcugucuccu cagcaucauu ccaggcacag 10680 | aacgccagaa aauggaaugg ugcuguugaa ucaacagguu cu 10722 |
SEQ ID NO: 8
| <211> 293 | <212> RNA | <213> Artificial sequence | <220> | <223> Circular Artificial sequence to 3UTR (Dengue virus) | (circ_dv_3utr) | <220> | <221> misc_ feature | <222> 7..38 | <223> /note=“hybridization site to 3UTR (Dengue virus)” | <220> | <221> misc_ feature | <222> 48..79 | <223> /note=“hybridization site to 3UTR (Dengue virus)” | <220> | <221> misc_ feature | <222> 89..120 | <223> /note=“hybridization site to 3UTR (Dengue virus)” | <220> | <221> misc_ feature | <222> 130..161 | <223> /note=“hybridization site to 3UTR (Dengue virus)” | <220> | <221> misc_ feature | <222> 171..202 | <223> /note=“hybridization site to 3UTR (Dengue virus)” | <220> | <221> misc_ feature | <222> 212..243 | <223> /note=“hybridization site to 3UTR (Dengue virus)” | <220> | <221> misc_ feature | <222> 253..284 | <223> /note=“hybridization site to 3UTR (Dengue virus)” | <400> 8 |
| gcgccgucuu uggucuuuuu uggcgucagu auguuguuuu uuaaccaucu uugguuuuuc 60 | cuggcgucag ugugcuguua uaguaugguc ucugguuuuu uuuagcguua gugugcuguu 120 | aaagcuuucu cucuggucuu uuccaguguc aauaugcugu uuagugugcu ucuuugguuu 180 | uucuuggugu uggugugcug uuucagcaag uucucugguc uuuucuggcg uugauguguu 240 | guucgcuggc gaucuuuggu cuuucucggu gucgauaugu uguuaguggc cca 293 |
SEQ ID NO: 9
| <211> 300 | <212> RNA | <213> Artificial sequence | <220> | <223> Circular Artificial sequence to ChP (Dengue virus) | (circ_dv_cHP_v1) | <220> | <221> misc_ feature | <222> 7..39 | <223> /note=“hybridization site to ChP (Dengue virus)” | <220> | <221> misc_ feature | <222> 49..81 | <223> /note=“hybridization site to ChP (Dengue virus)” | <220> | <221> misc_ feature | <222> 91..123 | <223> /note=“hybridization site to ChP (Dengue virus)” | <220> | <221> misc_ feature | <222> 133..165 | <223> /note=“hybridization site to ChP (Dengue virus)” | <220> | <221> misc_ feature | <222> 175..207 | <223> /note=“hybridization site to ChP (Dengue virus)” | <220> | <221> misc_ feature | <222> 217..249 | <223> /note=“hybridization site to ChP (Dengue virus)” | <220> | <221> misc_ feature | <222> 259..291 | <223> /note=“hybridization site to ChP (Dengue virus)” | <400> 9 |
| gcgccgaugu uggggggugu guuuuuuguc uuuuuucguu gggguguaau guugagaggc 60 | guguuuuuug cuuuuuuuug ugcaccuuau auauugggag guguguuuuu cgcuuuuuuc 120 | cgucuggcug gcauauuggg gggcguguuu uucguuuuuu uucguuacaa gcuaauauug 180 | aagggugugu uuuucgccuu uuuccguguu aaagauaugu ugaaaggcgu guuuuucguu 240 | uuuuuccgua aguuuuaaau auuggagggc guguuuuucg cuuuuuucug uagaccggaa 300 |
SEQ ID NO: 10
| <211> 294 | <212> RNA | <213> Artificial sequence | <220> | <223> Circular Artificial sequence to ChP2 (Dengue virus) | (circ_dv_cHP_v2) | <220> | <221> misc_ feature | <222> 7..39 | <223> /note=“hybridization site to ChP2 (Dengue virus)” | <220> | <221> misc_ feature | <222> 55..87 | <223> /note=“hybridization site to ChP2 (Dengue virus)” | <220> | <221> misc_ feature | <222> 103..135 | <223> /note=“hybridization site to ChP2 (Dengue virus)” | <220> | <221> misc_ feature | <222> 151..183 | <223> /note=“hybridization site to ChP2 (Dengue virus)” | <220> | <221> misc_ feature | <222> 199..231 | <223> /note=“hybridization site to ChP2 (Dengue virus)” | <220> | <221> misc_ feature | <222> 247..279 | <223> /note=“hybridization site to ChP2 (Dengue virus)” | <400> 10 |
| gcgccgaugu ugagaggugu guuuuuugcu uuuuuucguu uauuacucca acagauauug 60 | agaggcgugu uuuucgcuuu uuuucguaga agguaauaga aaauauuggg gggcguguuu 120 | uucgucuuuu uucgugacuc uuacgaguuu auguugaaag guguguuuuu cgcuuuuuuu 180 | uguagggaac agucgcaaau auuggggggu guguuuuucg ccuuuuuucg uggcaccgua 240 | auccgcaugu ugaaaggugu guuuuucguu uuuuuccguc aacucguucu uaua 294 |
SEQ ID NO: 11
| <211> 11840 | <212> RNA | <213> Chikungunya virus | <220> | <221> misc_ feature | <222> 14..48 | <223> /note=“target region of 5UTR” | <220> | <221> misc_ feature | <222> 11367..11399 | <223> /note=“target region of RSE” | <400> 11 |
| auggcugcgu gagacacacg uagccuacca guuucuuacu gcucuacucu gcaaagcaag 60 | agauuaauaa cccaucaugg auccugugua cguggacaua gacgcugaca gcgccuuuuu 120 | gaaggcccug caacgugcgu accccauguu ugagguggaa ccaaggcagg ucacaccgaa 180 | ugaccaugcu aaugcuagag cguucucgca ucuagcuaua aaacuaauag agcaggaaau 240 | ugaccccgac ucaaccaucc uggauaucgg cagugcgcca gcaaggagga ugaugucgga 300 | caggaaguac cacugcgucu gcccgaugcg cagugcggaa gaucccgaga gacucgccaa 360 | uuaugcgaga aagcuagcau cugccgcagg aaaaguccug gacagaaaca ucucuggaaa 420 | gaucggggac uuacaagcag uaauggccgu gccagacacg gagacgccaa cauucugcuu 480 | acacacagac gucucaugua gacagagagc agacgucgcu auauaccaag acgucuaugc 540 | uguacacgca cccacgucgc uauaccacca ggcgauuaaa gggguccgag uggcguacug 600 | gguuggguuc gacacaaccc cguucaugua caaugccaug gcgggugccu accccucaua 660 | cucgacaaac ugggcagaug agcagguacu gaaggcuaag aacauaggau uauguucaac 720 | agaccugacg gaagguagac gaggcaaguu gucuauuaug agagggaaaa agcuaaaacc 780 | gugcgaccgu gugcuguucu caguaggguc aacgcucuac ccggaaagcc gcaagcuacu 840 | uaagagcugg caccugccau cgguguucca uuuaaagggc aaacucagcu ucacaugccg 900 | cugugauaca gugguuucgu gugagggcua cgucguuaag agaauaacga ugagcccagg 960 | ccuuuaugga aaaaccacag gguaugcggu aacccaccac gcagacggau uccugaugug 1020 | caagacuacc gacacgguug acggcgaaag arugucauuc ucggugugca cauacgugcc 1080 | ggcgaccauu ugugaucaaa ugaccggcau ccuugcuaca gaagucacgc cggaggaugc 1140 | acagaagcug uugguggggc ugaaccagag aauagugguu aacggcagaa cgcaacggaa 1200 | uacgaacacc augaaaaauu aucugcuucc cguggucgcc caagccuuca guaagugggc 1260 | aaaggagugc cggaaagaca uggaagauga aaaacuccug ggggucagag aaagaacacu 1320 | gaccugcugc ugucuauggg cauucaagaa gcagaaaaca cacacggucu acaagaggcc 1380 | ugauacccag ucaauucaga agguucaggc cgaguuugac agcuuugugg uaccgagucu 1440 | guggucgucc ggguugucaa ucccuuugag gacuagaauc aaaugguugu uaagcaaggu 1500 | gccaaaaacc gaccugaucc cauacagcgg agacgcccga gaagcccggg acgcagaaaa 1560 | agaagcagag gaagaacgag aagcagaacu gacucgcgaa gcccuaccac cucuacaggc 1620 | agcacaggaa gauguucagg ucgaaaucga cguggaacag cuugaggaca gagcgggcgc 1680 | aggaauaaua gagacuccga gaggagcuau caaaguuacu gcccaaccaa cagaccacgu 1740 | cgugggagag uaccugguac ucuccccgca gaccguacua cguagccaga agcucagucu 1800 | gauucacgcu uuggcggagc aagugaagac gugcacgcac aacggacgag cagggaggua 1860 | ugcggucgaa gcguacgacg gccgaguccu agugcccuca ggcuaugcaa ucucgccuga 1920 | agacuuccag agucuaagcg aaagcgcaac gaugguguau aacgaaagag aguucguaaa 1980 | cagaaagcua caccauauug cgaugcacgg accagcccug aacaccgacg aagagucgua 2040 | ugagcuggug agggcagaga ggacagaaca cgaguacguc uacgacgugg aucagagaag 2100 | augcuguaag aaggaagaag ccgcaggacu gguacuggug ggcgacuuga cuaauccgcc 2160 | cuaccacgaa uucgcauaug aagggcuaaa aauccgcccu gccugcccau acaaaauugc 2220 | agucauagga gucuucggag uaccgggauc uggcaaguca gcuauuauca agaaccuagu 2280 | uaccaggcag gaccugguga cuagcggaaa gaaagaaaac ugccaagaaa ucaccaccga 2340 | cgugaugaga cagagagguc uagagauauc ugcacguacg guugacucgc ugcucuugaa 2400 | uggaugcaac agaccagucg acguguugua cguagacgag gcguuugcgu gccacucugg 2460 | aacgcuacuu gcuuugaucg ccuuggugag accaaggcag aaaguuguac uuugugguga 2520 | cccgaagcag ugcggcuucu ucaauaugau gcagaugaaa gucaacuaua aucacaacau 2580 | cugcacccaa guguaccaca aaaguaucuc caggcggugu acacugccug ugaccgccau 2640 | ugugucaucg uugcauuacg aaggcaaaau gcgcacuacg aaugaguaca acaagccgau 2700 | uguaguggac acuacaggcu caacaaaacc ugacccugga gaccucgugu uaacgugcuu 2760 | cagagggugg guuaaacaac ugcaaauuga cuaucgugga uacgagguca ugacagcagc 2820 | cgcaucccaa ggguuaacca gaaaaggagu uuacgcaguu agacaaaaag uuaaugaaaa 2880 | cccgcucuau gcaucaacgu cagagcacgu caacguacuc cuaacgcgua cggaagguaa 2940 | acugguaugg aagacacuuu ccggcgaccc guggauaaag acgcugcaga acccaccgaa 3000 | aggaaacuuc aaagcaacua uuaaggagug ggagguggag caugcaucaa uaauggcggg 3060 | caucugcagu caccaaauga ccuucgauac auuccaaaau aaagccaacg uuuguugggc 3120 | uaagagcuug gucccuaucc ucgaaacagc ggggauaaaa cuaaaugaua ggcagugguc 3180 | ucagauaauu caagccuuca aagaagacaa agcauacuca ccugaaguag cccugaauga 3240 | aauauguacg cgcauguaug ggguggaucu agacagcggg cuauuuucua aaccguuggu 3300 | gucuguguau uacgcggaua accacuggga uaauaggccu ggagggaaaa uguucggauu 3360 | uaaccccgag gcagcaucca uucuagaaag aaaguaucca uucacaaaag ggaaguggaa 3420 | caucaacaag cagaucugcg ugacuaccag gaggauagaa gacuuuaacc cuaccaccaa 3480 | caucauaccg gccaacagga gacuaccaca cucauuagug gccgaacacc gcccaguaaa 3540 | aggggaaaga auggaauggc ugguuaacaa gauaaacggc caccacgugc uccuggucag 3600 | uggcuauaac cuugcacugc cuacuaagag agucacuugg guagcgccgu uagguguccg 3660 | cggagcggac uacacauaca accuagaguu gggucugcca gcaacgcuug guagguauga 3720 | ccuagugguc auaaacaucc acacaccuuu ucgcauacac cauuaccaac agugcgucga 3780 | ccacgcaaug aaacugcaaa ugcucggggg ugacucauug agacugcuca aaccgggcgg 3840 | cucucuauug aucagagcau augguuacgc agauagaacc agugaacgag ucaucugcgu 3900 | auugggacgc aaguuuagau cgucuagagc guugaaacca ccauguguca ccagcaacac 3960 | ugagauguuu uuccuauuca gcaacuuuga caauggcaga aggaauuuca caacucaugu 4020 | caugaacaau caacugaaug cagccuucgu aggacagguc acccgagcag gaugugcacc 4080 | gucguaccgg guaaaacgca uggacaucgc gaagaacgau gaagagugcg uagucaacgc 4140 | cgcuaacccu cgcggguuac cgggugrcgg uguuugcaag gcaguauaca aaaaauggcc 4200 | ggaguccuuu aagaacagug caacaccagu gggaaccgca aaaacaguua ugugcgguac 4260 | guauccagua auccacgcug uuggaccaaa cuucucuaau uauucggagu cugaagggga 4320 | ccgggaauug gcagcugccu aucgagaagu cgcaaaggaa guaacuaggc ugggaguaaa 4380 | uaguguagcu auaccucucc ucuccacagg uguauacuca ggagggaaag acaggcugac 4440 | ccagucacug aaccaccucu uuacagccau ggacucgacg gaugcagacg uggucaucua 4500 | cugccgcgac aaagaauggg agaagaaaau aucugaggcc auacagaugc ggacccaagu 4560 | agagcugcug gaugagcaca ucuccauaga cugcgauauu guucgcgugc acccugacag 4620 | cagcuuggca ggcagaaaag gauacagcac cacggaaggc gcacuguacu cauaucuaga 4680 | agggacccgu uuucaucaga cggcugugga uauggcggag auacauacua uguggccaaa 4740 | gcaaacagag gccaaugagc aagucugccu auaugcccug ggggaaagua uugaaucgau 4800 | caggcagaaa ugcccggugg augaugcaga cgcaucaucu ccccccaaaa cugucccgug 4860 | ccuuugccgu uacgcuauga cuccagaacg cgucacccgg cuucgcauga accacgucac 4920 | aagcauaauu guguguucuu cguuuccccu cccaaaguac aaaauagaag gagugcaaaa 4980 | agucaaaugc ucuaagguaa ugcuauuuga ccacaacgug ccaucgcgcg uaaguccaag 5040 | ggaauauaka ucuucccagg agucugcaca ggaggcgagu acaaucacgu cacugacgca 5100 | uagucaauuc gaccuaagcg uugauggcga gauacugccc gucccgucag accuggaugc 5160 | ugacgcccca gcccuagaac cagcacuaga cgacggggcg acacacacgc ugccauccac 5220 | aaccggaaac cuugcggccg ugucugauug gguaaugagc accguaccug ucgcgccgcc 5280 | cagaagaagg cgagggagaa accugacugu gacaugugac gagagagaag ggaauauaac 5340 | acccauggcu agcguccgau ucuuuagggc agagcugugu ccggucguac aagaaacagc 5400 | ggagacgcgu gacacagcaa ugucucuuca ggcaccaccg aguaccgcca cggaaccgaa 5460 | ucauccgccg aucuccuucg gagcaucaag cgagacguuc cccauuacau uuggggacuu 5520 | caacgaagga gaaaucgaaa gcuugucuuc ugagcuacua acuuucggag acuucuuacc 5580 | aggagaagug gaugacuuga cagacagcga cugguccacg ugcucagaca cggacgacga 5640 | guuaugacua gacagggcag guggguauau auucucgucg gacaccgguc caggucauuu 5700 | acaacagaag ucaguacgcc agucagugcu gccggugaac acccuggagg aaguccacga 5760 | ggagaagugu uacccaccua agcuggauga agcaaaggag caacuauuac uuaagaaacu 5820 | ccaggagagu gcauccaugg ccaacagaag cagguaucag ucgcgcaaag uagaaaacau 5880 | gaaagcagca aucauccaga gacuaaagag aggcuguaga cuauacuuaa ugucagagac 5940 | cccaaaaguc ccuacuuacc ggacuacaua uccggcgccu guguacucgc cuccgaucaa 6000 | cguccgauug uccaaucccg aguccgcagu ggcagcaugc aaugaguucu uagcuagaaa 6060 | cuauccaacu gucucaucau accaaauuac cgacgaguau gaugcauauc uagacauggu 6120 | ggacgggucg gagaguugcc uggaccgagc gacauucaau ccgucaaaac ucaggagcua 6180 | cccgaaacag cacgcuuacc acgcgcccuc caucagaagc gcuguaccgu ccccauucca 6240 | gaacacacua cagaauguac uggcagcagc cacgaaaaga aacugcaacg ucacacagau 6300 | gagggaauua cccacuuugg acucagcagu auucaacgug gaguguuuca aaaaauucgc 6360 | augcaaccaa gaauacuggg aagaauuugc ugccagcccu auuaggauaa caacugagaa 6420 | uuuagcaacc uauguuacua aacuaaaagg gccaaaagca gcagcgcuau ucgcaaaaac 6480 | ccauaaucua cugccacuac aggaaguacc aauggauagg uucacaguag auaugaaaag 6540 | ggacguaaag gugacuccug guacaaagca uacagaggaa agaccuaagg ugcagguuau 6600 | acaggcggcu gaacccuugg cgacagcaua ccuauguggg auucacagag agcugguuag 6660 | gaggcugaac gccguccucc uacccaaugu acauacacua uuugacaugu cugccgagga 6720 | uuucgaugcc aucauagccg cacacuuuaa gccaggagac acuguuuugg aaacggacau 6780 | agccuccuuu gauaagagcc aagaugauuc acuugcgcuu acugcuuuga ugcuguuaga 6840 | ggauuuaggg guggaucacu cccugcugga cuugauagag gcugcuuucg gagagauuuc 6900 | cagcugucac cuaccgacag guacgcgcuu caaguucggc gccaugauga aaucagguau 6960 | guuccuaacu cuguucguca acacauuguu aaacaucacc aucgccagcc gagugcugga 7020 | agaucgucug acaaaauccg cgugcgcggc cuucaucggc gacgacaaca uaauacaugg 7080 | agucgucucc gaugaauuga uggcagccag augugccacu uggaugaaca uggaagugaa 7140 | gaucauagau gcaguuguau ccuugaaagc cccuuacuuu uguggagggu uuauacugca 7200 | cgauacugug acaggaacag cuugcagagu ggcagacccg cuaaaaaggc uuuuuaaacu 7260 | gggcaaaccg cuagcggcag gugacgaaca agaugaagau agaagacgag cgcuggcuga 7320 | cgaagugauc agauggcaac gaacagggcu aauugaugag cuggagaaag cgguauacuc 7380 | uagguacgaa gugcagggua uaucaguugu gguaaugucc auggccaccu uugcaagcuc 7440 | cagauccaac uucgagaagc ucagaggacc cgucauaacu uuguacggcg guccuaaaua 7500 | gguacgcacu acagcuaccu auuuugcaga agccgacagc aaguaucuaa acacuaauca 7560 | gcuacaaugg aguucauccc aacccaaacu uuuuacaaua ggagguacca gccucgaccc 7620 | uggacuccgc gcccuacuau ccaagucauc aggcccagac cgcgcccuca gaggcaagcu 7680 | gggcaacuug cccagcugau cucagcaguu aauaaacuga caaugcgcgc gguaccccaa 7740 | cagaagccac gcaggaaucg gaagaauaag aagcaaaagc aaaaacaaca ggcgccacaa 7800 | aacaacacaa aucaaaagaa gcagccaccu aaaaagaaac cggcucaaaa gaaaaagaag 7860 | ccgggccgca gagagaggau gugcaugaaa aucgaaaaug auuguauuuu cgaagucaag 7920 | cacgaaggua agguaacagg uuacgcgugc cugguggggg acaaaguaau gaaaccagca 7980 | cacguaaagg ggaccaucga uaacgcggac cuggccaaac uggccuuuaa gcggucaucu 8040 | aaguaugacc uugaaugcgc gcagauaccc gugcacauga aguccgacgc uucgaaguuc 8100 | acccaugaga aaccggaggg guacuacaac uggcaccacg gagcaguaca guacucagga 8160 | ggccgguuca ccaucccuac aggugcuggc aaaccagggg acagcggcag accgaucuuc 8220 | gacaacaagg gacgcguggu ggccauaguc uuaggaggag cuaaugaagg agcccguaca 8280 | gcccucucgg uggugaccug gaauaaagac auugucacua aaaucacccc cgagggggcc 8340 | gaagagugga gucuugccau cccaguuaug ugccuguugg caaacaccac guuccccugc 8400 | ucccagcccc cuugcacgcc cugcugcuac gaaaaggaac cggaggaaac ccuacgcaug 8460 | cuugaggaca acgucaugag accuggguac uaucagcugc uacaagcauc cuuaacaugu 8520 | ucuccccacc gccagcgacg cagcaccaag gacaacuuca augucuauaa agccacaaga 8580 | ccauacuuag cucacugucc cgacugugga gaagggcacu cgugccauag ucccguagca 8640 | cuagaacgca ucagaaauga agcgacagac gggacgcuga aaauccaggu cuccuugcaa 8700 | aucggaauaa agacggauga cagccacgau uggaccaagc ugcguuauau ggacaaccac 8760 | augccagcag acgcagagag ggcggggcua uuuguaagaa caucagcacc guguacgauu 8820 | acuggaacaa ugggacacuu cauccuggcc cgauguccaa aaggggaaac ucugacggug 8880 | ggauucacug acaguaggaa gauuagucac ucauguacgc acccauuuca ccacgacccu 8940 | ccugugauag gucgggaaaa auuccauucc cgaccgcagc acgguaaaga gcuaccuugc 9000 | agcacguacg ugcagagcac cgccgcaacu accgaggaga uagagguaca caugccccca 9060 | gacaccccug aucgcacauu aaugucacaa caguccggca acguaaagau cacagucaau 9120 | ggccagacgg ugcgguacaa guguaauugc gguggcucaa augaaggacu aacaacuaca 9180 | gacaaaguga uuaauaacug caagguugau caaugucaug ccgcggucac caaucacaaa 9240 | aaguggcagu auaacucccc ucuggucccg cguaaugcug aacuugggga ccgaaaagga 9300 | aaaauucaca ucccguuucc gcuggcaaau guaacaugca gggugccuaa agcaaggaac 9360 | cccaccguga cguacgggaa aaaccaaguc aucaugcuac uguauccuga ccacccaaca 9420 | cuccuguccu accggaauau gggagaagaa ccaaacuauc aagaagagug ggugaugcau 9480 | aagaaggaag ucgugcuaac cgugccgacu gaagggcucg aggucacgug gggcaacaac 9540 | gagccguaua aguauuggcc gcaguuaucu acaaacggua cagcccaugg ccacccgcau 9600 | gagauaauuc uguauuauua ugagcuguac cccacuauga cuguaguagu ugugucagug 9660 | gccacguuca uacuccuguc gauggugggu auggcagcgg ggaugugcau gugugcacga 9720 | cgcagaugca ucacaccgua ugaacugaca ccaggagcua ccgucccuuu ccugcuuagc 9780 | cuaauaugcu gcaucagaac agcuaaagcg gccacauacc aagaggcugc gauauaccug 9840 | uggaacgagc agcaaccuuu guuuuggcua caagcccuua uuccgcuggc agcccugauu 9900 | guucuaugca acugucugag acucuuacca ugcugcugua aaacguuggc uuuuuuagcc 9960 | guaaugagcg ucggugccca cacugugagc gcguacgaac acguaacagu gaucccgaac 10020 | acggugggag uaccguauaa gacucuaguc aauagaccug gcuacagccc caugguauug 10080 | gagauggaac uacugucagu cacuuuggag ccaacacuau cgcuugauua caucacgugc 10140 | gaguacaaaa ccgucauccc gucuccguac gugaagugcu gcgguacagc agagugcaag 10200 | gacaaaaacc uaccugacua cagcuguaag gucuucaccg gcgucuaccc auuuaugugg 10260 | ggcggcgccu acugcuucug cgacgcugaa aacacgcagu ugagcgaagc acacguggag 10320 | aaguccgaau caugcaaaac agaauuugca ucagcauaca gggcucauac cgcaucugca 10380 | ucagcuaagc uccgcguccu uuaccaagga aauaacauca cuguaacugc cuaugcaaac 10440 | ggcgaccaug ccgucacagu uaaggacgcc aaauucauug uggggccaau gucuucagcc 10500 | uggacaccuu ucgacaacaa aauuguggug uacaaaggug acgucuauaa cauggacuac 10560 | ccgcccuuug gcgcaggaag accaggacaa uuuggcgaua uccaaagucg cacaccugag 10620 | aguaaagacg ucuaugcuaa uacacaacug guacugcaga gaccggcugu ggguacggua 10680 | cacgugccau acucucaggc accaucuggc uuuaaguauu ggcuaaaaga acgcggggcg 10740 | ucgcugcagc acacagcacc auuuggcugc caaauagcaa caaacccggu aagagcggug 10800 | aacugcgccg uagggaacau gcccaucucc aucgacauac cggaagcggc cuucacuagg 10860 | gucgucgacg cgcccucuuu aacggacaug ucgugcgagg uaccagccug cacccauucc 10920 | ucagacuuug ggggcgucgc cauuauuaaa uaugcagcca gcaagaaagg caagugugcg 10980 | gugcauucga ugacuaacgc cgucacuauu cgggaagcug agauagaagu ugaagggaau 11040 | ucucagcugc aaaucucuuu cucgacggcc uuagccagcg ccgaauuccg cguacaaguc 11100 | uguucuacac aaguacacug ugcagccgag ugccaccccc cgaaggacca cauagucaac 11160 | uacccggcgu cacauaccac ccucgggguc caggacaucu ccgcuacggc gaugucaugg 11220 | gugcagaaga ucacgggagg ugugggacug guuguugcug uugccgcacu gauucuaauc 11280 | guggugcuau gcgugucguu cagcaggcac uaacuugaca auuaaguaug aagguauaug 11340 | uguccccuaa gagacacacu guacauagca aauaaucuau agaucaaagg gcuacgcaac 11400 | cccugaauag uaacaaaaua caaaaucacu aaaaauuaua aaaacagaaa aauacauaaa 11460 | uagguauacg uguccccuaa gagacacauu guauguaggu gauaaguaua gaucaaaggg 11520 | ccgaauaacc ccugaauagu aacaaaauau gaaaaucaau aaaaaucaua aaauagaaaa 11580 | accauaaaca gaaguaguuc aaagggcuau aaaaccccug aauaguaaca aaacauaaaa 11640 | uuaauaaaaa ucaaaugaau accauaauug gcaaacggaa gagauguagg uacuuaagcu 11700 | uccuaaaagc agccgaacuc acuuugagaa guaggcauag cauaccgaac ucuuccacga 11760 | uucuccgaac ccacagggac guaggagaug uuauuuuguu uuuaauauuu caaaaaaaaa 11820 | aaaaaaaaaa aaaaaaaaaa 11840 |
SEQ ID NO: 12
| <211> 294 | <212> RNA | <213> Artificial sequence | <220> | <223> Circular Artificial sequence to 5UTR (Chikungunya virus) | (chikv_5utr1 ) | <220> | <221> misc_ feature | <222> 7..41 | <223> /note=“hybridization site to 5UTR (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 55..89 | <223> /note=“hybridization site to 5UTR (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 103..137 | <223> /note=“hybridization site to 5UTR (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 151..185 | <223> /note=“hybridization site to 5UTR (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 199..233 | <223> /note=“hybridization site to 5UTR (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 247..281 | <223> /note=“hybridization site to 5UTR (Chikungunya virus)” | <400> 12 |
| gcgccgagua gagcagugag gaacuggugg guugcgugug uuuugucacu acguaguaga 60 | gugguaggaa auuggugggc ugcgugugug gcuuccagug ccaguagagc ggugagagau 120 | ugguagguua uguguguguu cucgcccgaa aguagagugg ugagggguug guagguuacg 180 | uguguucaaa uaugacggag uagaguagug gggggcuggu ggguugugug uguucggaga 240 | ccagacagua gaguaguaag agguuggugg gcuacgugug ugccacacca cccg 294 |
SEQ ID NO: 13
| <211> 314 | <212> RNA | <213> Artificial sequence | <220> | <223> Circular Artificial sequence to 5UTR (Chikungunya virus) | (chikv_5utr2) | <220> | <221> misc_ feature | <222> 7..41 | <223> /note=“hybridization site to 5UTR (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 51..85 | <223> /note=“hybridization site to 5UTR (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 95..129 | <223> /note=“hybridization site to 5UTR (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 139..173 | <223> /note=“hybridization site to 5UTR (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 183..217 | <223> /note=“hybridization site to 5UTR (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 227..261 | <223> /note=“hybridization site to 5UTR (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 271..305 | <223> /note=“hybridization site to 5UTR (Chikungunya virus)” | <400> 13 |
| gcgccgagua gagugguggg ggguugguag guugcgugug ucuuagcgcc aguagagcag 60 | uaagggacug guaggcugcg ugugugguac uuacaguaga gcggugagag acuggugggc 120 | uaugugugug ccauccuuag uagaguggua gggaguuggu gggcugugug uguggggccu 180 | auaguagagu agugggagau ugguagguua cguguguagc ugcacgagua gagcaguggg 240 | aaguuggugg guugugugug ucuccgacga aguagaguag uaagaaauug guggguuaug 300 | uguguaccug aguc 314 |
SEQ ID NO: 14
| <211> 288 | <212> RNA | <213> Artificial sequence | <220> | <223> Circular Artificial sequence to RSE (Chikungunya virus) | (chikv_RSE1) | <220> | <221> misc_ feature | <222> 7..39 | <223> /note=“hybridization site to RSE (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 54..86 | <223> /note=“hybridization site to RSE (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 101..133 | <223> /note=“hybridization site to RSE (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 148..180 | <223> /note=“hybridization site to RSE (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 195..227 | <223> /note=“hybridization site to RSE (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 242..274 | <223> /note=“hybridization site to RSE (Chikungunya virus)” | <400> 14 |
| gcgccguugc guggcucuuu ggucuauaga uuauuuguuu gcggguugcc cucuugcgug 60 | guucuuuggu cuguggauug uuugcuugcc cgcgagcagg uuguguaguc cuuugaucug 120 | uagguuguuu guuguucgua acacuucuug cguagcucuu ugaucuauag guuauuugcu 180 | cuagguucga accguugcgu ggucuuuuga ucuauggguu guuuguucau caaaaccuuu 240 | cuuguguggc cuuuuggucu guagauuguu uguuuccaac gacguacu 288 |
SEQ ID NO: 15
| <211> 288 | <212> RNA | <213> Artificial Sequence | <220> | <223> Circular Artificial sequence to RSE2 (Chikungunya virus) | (chikvRSE) | <220> | <221> misc_ feature | <222> 7..39 | <223> /note=“hybridization site to RSE2 (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 54..86 | <223> /note=“hybridization site to RSE2 (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 101..133 | <223> /note=“hybridization site to RSE2 (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 148..180 | <223> /note=“hybridization site to RSE2 (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 195..227 | <223> /note=“hybridization site to RSE2 (Chikungunya virus)” | <220> | <221> misc_ feature | <222> 242..274 | <223> /note=“hybridization site to RSE2 (Chikungunya virus)” | <400> 15 |
| gcgccguugc guggcucuuu ggucuauggg uuguuugcuu gcggguugcc cucuugugua 60 | gcuuuuugau cuguggguua uuugcuugcc cgcgagcagg uugcguaguu cuuugauuug 120 | uagguuguuu gcuguucgua acacuucuug cguaguuuuu ugaucuaugg auuguuugcu 180 | cuagguucga accguugcgu agcucuuugg uuuauagauu auuugcucau caaaaccuuu 240 | cuuguguggu ccuuugaucu auagguuauu ugcuuccaac gacguacu 288 |
SEQ ID NO: 16
| <211> 620 | <212> RNA | <213> Artificial sequence | <220> | <223> Broadspectrum circular RNA to hepatitis C virus and Dengue virus | (DENV1 cHP_ HCV CDS2_T) | <220> | <221> misc_ feature | <222> 16..48 | <223> /note=“hybridization site to chp (Dengue virus)” | <220> | <221> misc_ feature | <222> 58..90 | <223> /note=“hybridization site to chp (Dengue virus)” | <220> | <221> misc_ feature | <222> 100..132 | <223> /note=“hybridization site to chp (Dengue virus)” | <220> | <221> misc_ feature | <222> 142..174 | <223> /note=“hybridization site to chp (Dengue virus)” | <220> | <221> misc_ feature | <222> 184..216 | <223> /note=“hybridization site to chp (Dengue virus)” | <220> | <221> misc_ feature | <222> 226..258 | <223> /note=“hybridization site to chp (Dengue virus)” | <220> | <221> misc_ feature | <222> 268..300 | <223> /note=“hybridization site to chp (Dengue virus)” | <220> | <221> misc_ feature | <222> 330..340 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 354..364 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 378..388 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 402..412 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 426..436 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 450..460 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 474..484 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 498..508 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 522..532 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 546..556 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 570..580 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 594..604 | <223> /note=“hybridization site to CDS2 (hepatitis C virus)” | <400> 16 |
| ggauccgcgg cgccgauguu ggggggugug uuuuuugucu uuuuucguug ggguguaaug 60 | uugagaggcg uguuuuuugc uuuuuuuugu gcaccuuaua uauugggagg uguguuuuuc 120 | gcuuuuuucc gucuggcugg cauauugggg ggcguguuuu ucguuuuuuu ucguuacaag 180 | cuaauauuga aggguguguu uuucgccuuu uuccguguua aagauauguu gaaaggcgug 240 | uuuuucguuu uuuuccguaa guuuuaaaua uuggagggcg uguuuuucgc uuuuuucugu 300 | agaccggaac cgggaauuca cucgagcccc cuggggcucu gaugaggaac cucucugggg 360 | uccccacagc gagucuccuu ggggccccua gaaugaaguu cuuugggguu ucauagcacg 420 | guucuccugg gguuuucaua cgauugucuc uuggggucuu gcguguuuac ccuuuugggg 480 | uccugcuaag ggggcuuucu ggggccuuuc gaauaagucu uuuuggggcc ucguuuuauc 540 | acucuucugg gguucccagc cuuucccuuc uuggggcucc uccgaccaug ccccuugggg 600 | uucuacccug uaugggaucc 620 |
SEQ ID NO: 17
| <211> 298 | <212> RNA | <213> Artificial sequence | <220> | <223> Broadspectrum circular RNA to hepatitis C virus and Dengue virus | (DENV1 cHP_ HCV CDS2_1) | <220> | <221> misc_ feature | <222> 7..22 | <223> /note=“hybridization site to CDS2(2) (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 35..67 | <223> /note=“hybridization site to chp (Dengue virus)” | <220> | <221> misc_ feature | <222> 80..95 | <223> /note=“hybridization site to CDS2(2) (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 108..140 | <223> /note=“hybridization site to chp (Dengue virus)” | <220> | <221> misc_ feature | <222> 153..168 | <223> /note=“hybridization site to CDS2(2) (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 181..213 | <223> /note=“hybridization site to chp (Dengue virus)” | <220> | <221> misc_ feature | <222> 226..241 | <223> /note=“hybridization site to CDS2(2) (hepatitis C virus)” | <220> | <221> misc_ feature | <222> 254..286 | <223> /note=“hybridization site to chp (Dengue virus)” | <400> 17 |
| gcgccgccug gcuugggguu uucccaggac ucuaauauug gaaggcgugu uuuuugucuu 60 | uuuucguguc cugccuccuc uuagccuggg guuuuacgac cgcaccuaug uugagaggug 120 | uguuuuuugc cuuuuuucgu uugauacccu cauuuaaucu ggggcucuag gugcagcaaa 180 | auguuggagg gcguguuuuu cguuuuuuuc uguccugcac gaucucccga uuugggguuc 240 | ucguugguga cguauauuga gggguguguu uuucgcuuuu uuucguauug gacgucgu 298 |
SEQ ID NO: 18
| <211> 41 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial sequence for showing an squematic example of the mode | of action according to figure 4 wherein the sequence has no | particular value | <400> 18 |
| aacgccaugc aagcgcgcag aucgagcugu gcgcuuuuuu u 41 |
SEQ ID NO: 19
| <211> 299 | <212> RNA | <213> Artificial sequence | <220> | <223> circ_wnv_slll_2 | <400> 19 |
| ugcaguuaga uaaacuuucc gguuugauuu ucucuucaaa agacaguucu ucgaacuucc 60 | cggcuugguu uucuuuucaa aaauggggcc ccucaacuuc cuggucuggu uuucuccuua 120 | aaaggcuaua cgaucaacuu ucuggccuga cuuucuucuu aaaaagcuau caucgcaacu 180 | ucucggcuug acuuucucuu uaaaacccuc gguaaccaac uuuucggccu gauuuucuuc 240 | ucaaaaguuu uggcgacuaa cuucuugguu uggcuuucuc cucaaaaaau auaaacagc 299 |
SEQ ID NO: 20
| <211> 11029 | <212> RNA | <213> West Nile virus | <220> | <223> Genome West Nile virus | <400> 20 |
| aguaguucgc cugugugagc ugacaaacuu aguaguguuu gugaggauua acaacaauua 60 | acacagugcg agcuguuucu uagcacgaag aucucgaugu cuaagaaacc aggagggccc 120 | ggcaagagcc gggcugucaa uaugcuaaaa cgcggaaugc cccgcguguu guccuugauu 180 | ggacugaaga gggcuauguu gagccugauc gacggcaagg ggccaauacg auuuguguug 240 | gcucucuugg cguucuucag guucacagca auugcuccga cccgagcagu gcuggaucga 300 | uggagaggug ugaacaaaca aacagcgaug aaacaccuuc ugaguuuuaa gaaggaacua 360 | gggaccuuga ccagugcuau caaucggcgg agcucaaaac aaaagaaaag aggaggaaag 420 | accggaauug cagucaugau uggccugauu gccagcguag gagcaguuac ccucucuaac 480 | uuccaaggga aggugaugau gacgguaaau gcuacugacg ucacagaugu caucacgauu 540 | ccaacagcug cuggaaagaa ccuaugcauu gucagagcaa uggauguggg auacaugugc 600 | gaugauacua ucacuuauga augcccagug cugucggcug guaaugaucc agaagacauc 660 | gacuguuggu gcacaaaguc agcagucuac gucagguaug gaagaugcac caagacacgc 720 | cacucaagac gcagucggag gucacugaca gugcagacac acggagaaag cacucuagcg 780 | aacaagaagg gggcuuggau ggacagcacc aaggccacaa gguauuuggu aaaaacagaa 840 | ucauggaucu ugaggaaccc uggauaugcc cugguggcag ccgucauugg uuggaugcuu 900 | gggagcaaca ccaugcagag aguuguguuu gucgugcuau ugcuuuuggu ggccccagcu 960 | uacagcuuca acugccuugg aaugagcaac agagacuucu uggaaggagu gucuggagca 1020 | acaugggugg auuugguucu cgaaggcgac agcugcguga cuaucauguc uaaggacaag 1080 | ccuaccaucg augugaagau gaugaauaug gaggcggcca accuggcaga gguccgcagu 1140 | uauugcuauu uggcuaccgu cagcgaucuc uccaccaaag cugcgugccc gaccauggga 1200 | gaagcucaca augacaaacg ugcugaccca gcuuuugugu gcagacaagg agugguggac 1260 | aggggcuggg gcaacggcug cggacuauuu ggcaaaggaa gcauugacac augcgccaaa 1320 | uuugccugcu cuaccaaggc aauaggaaga accaucuuga aagagaauau caaguacgaa 1380 | guggccauuu uuguccaugg accaacuacu guggagucgc acggaaacua cuccacacag 1440 | guuggagcca cucaggcagg gagauucagc aucacuccug cggcgccuuc auacacacua 1500 | aagcuuggag aauauggaga ggugacagug gacugugaac cacggucagg gauugacacc 1560 | aaugcauacu acgugaugac uguuggaaca aagacguucu ugguccaucg ugagugguuc 1620 | auggaccuca accucccuug gagcagugcu ggaaguacug uguggaggaa cagagagacg 1680 | uuaauggagu uugaggaacc acacgccacg aagcagucug ugauagcauu gggcucacaa 1740 | gagggagcuc ugcaucaagc uuuggcugga gccauuccug uggaauuuuc aagcaacacu 1800 | gucaaguuga cgucggguca uuugaagugu agagugaaga uggaaaaauu gcaguugaag 1860 | ggaacaaccu auggcgucug uucaaaggcu uucaaguuuc uugggacucc cgcagacaca 1920 | ggucacggca cugugguguu ggaauugcag uacacuggca cggauggacc uugcaaaguu 1980 | ccuaucucgu caguggcuuc auugaacgac cuaacgccag ugggcagauu ggucacuguc 2040 | aacccuuuug uuucaguggc cacggccaac gcuaaggucc ugauugaauu ggaaccaccc 2100 | uuuggagacu cauacauagu ggugggcaga ggagaacaac agaucaauca ccauuggcac 2160 | aagucuggaa gcagcauugg caaagccuuu acaaccaccc ucaaaggagc gcagagacua 2220 | gccgcucuag gagacacagc uugggacuuu ggaucaguug gagggguguu caccucaguu 2280 | gggaaggcug uccaucaagu guucggagga gcauuccgcu cacuguucgg aggcaugucc 2340 | uggauaacgc aaggauugcu gggggcucuc cuguugugga ugggcaucaa ugcucgugau 2400 | agguccauag cucucacguu ucucgcaguu ggaggaguuc ugcucuuccu cuccgugaac 2460 | gugcacgcug acacugggug ugccauagac aucagccggc aagagcugag auguggaagu 2520 | ggaguguuca uacacaauga uguggaggcu uggauggacc gguacaagua uuacccugaa 2580 | acgccacaag gccuagccaa gaucauucag aaagcucaua aggaaggagu gugcggucua 2640 | cgaucaguuu ccagacugga gcaucaaaug ugggaagcag ugaaggacga gcugaacacu 2700 | cuuuugaagg agaauggugu ggaccuuagu gucgugguug agaaacagga gggaauguac 2760 | aagucagcac cuaaacgccu caccgccacc acggaaaaau uggaaauugg cuggaaggcc 2820 | uggggaaaga guauuuuauu ugcaccagaa cucgccaaca acaccuuugu gguugauggu 2880 | ccggagacca aggaaugucc gacucagaau cgcgcuugga auagcuuaga aguggaggau 2940 | uuuggauuug gucucaccag cacucggaug uuccugaagg ucagagagag caacacaacu 3000 | gaaugugacu cgaagaucau uggaacggcu gucaagaaca acuuggcgau ccacagugac 3060 | cuguccuauu ggauugaaag caggcucaau gauacgugga agcuugaaag ggcaguucug 3120 | ggugaaguca aaucauguac guggccugag acgcauaccu uguggggcga uggaauccuu 3180 | gagagugacu ugauaauacc agucacacug gcgggaccac gaagcaauca caaucggaga 3240 | ccuggguaca agacacaaaa ccagggccca ugggacgaag gccggguaga gauugacuuc 3300 | gauuacugcc caggaacuac ggucacccug agugagagcu gcggacaccg uggaccugcc 3360 | acucgcacca ccacagagag cggaaaguug auaacagauu ggugcugcag gagcugcacc 3420 | uuaccaccac ugcgcuacca aacugacagc ggcuguuggu augguaugga gaucagacca 3480 | cagagacaug augaaaagac ccucgugcag ucacaaguga augcuuauaa ugcugauaug 3540 | auugacccuu uucaguuggg ccuucugguc guguucuugg ccacccagga gguccuucgc 3600 | aagaggugga cagccaagau cagcaugcca gcuauacuga uugcucugcu aguccuggug 3660 | uuugggggca uuacuuacac ugauguguua cgcuauguca ucuugguggg ggcagcuuuc 3720 | gcagaaucua auucgggagg agacguggua cacuuggcgc ucauggcgac cuucaagaua 3780 | caaccagugu uuaugguggc aucguuucuc aaagcgagau ggaccaacca ggagaacauu 3840 | uuguugaugu uggcggcugu uuucuuucaa auggcuuauc acgaugcccg ccaaauucug 3900 | cucugggaga ucccugaugu guugaauuca cuggcgguag cuuggaugau acugagagcc 3960 | auaacauuca caacgacauc aaacgugguu guuccgcugc uagcccugcu aacacccggg 4020 | cugagacgcu ugaaucugga uguguacagg auacugcugu ugauggucgg aauaggcagc 4080 | uugaucaggg agaagaggag ugcagcugca aaaaagaaag gagcaagucu gcuaugcuug 4140 | gcucuagccu caacaggacu uuucaacccc augauccuug cugcuggacu gauugcaugu 4200 | gaucccaacc guaaacgcgg auggcccgca acugaaguga ugacagcugu cggccuaaug 4260 | uuugccaucg ucggagggcu ggcagagcuu gacauugacu ccauggccau uccaaugacu 4320 | aucgcggggc ucauguuugc ugcuuucgug auuucuggga aaucaacaga uauguggauu 4380 | gagagaacgg cggacauuuc cugggaaagu gaugcagaaa uuacaggcuc gagcgaaaga 4440 | guugaugugc ggcuugauga ugauggaaac uuccagcuca ugaaugaucc aggagcaccu 4500 | uggaagauau ggaugcucag aauggucugu cucgcgauua gugcguacac ccccugggca 4560 | aucuugcccu caguaguugg auuuuggaua acucuccaau acacaaagag aggaggcgug 4620 | uugugggaca cucccucacc aaaggaguac aaaaaggggg acacgaccac cggcgucuac 4680 | aggaucauga cucgugggcu gcucggcagu uaucaagcag gagcgggcgu gaugguugaa 4740 | gguguuuucc acacccuuug gcauacaaca aaaggagccg cuuugaugag cggagagggc 4800 | cgccuggacc cauacugggg cagugucaag gaggaucgac uuuguuacgg aggacccugg 4860 | aaauugcagc acaaguggaa cgggcaggau gaggugcaga ugauuguggu ggaaccuggc 4920 | aagaacguua agaacguccg gacgaaacca gggguguuca aaacaccuga aggagaaauc 4980 | ggggccguga cuuuggacuu ccccacugga acaucaggcu caccaauagu ggacaaaaac 5040 | ggugauguga uugggcuuua uggcaaugga gucauaaugc ccaacggcuc auacauaagc 5100 | gcgauagugc agggugaaag gauggaugag ccaaucccag ccggauucga accugagaug 5160 | cugaggaaaa aacagaucac uguacuggau cuccaucccg gcgccgguaa aacaaggagg 5220 | auucugccac agaucaucaa agaggccaua aacagaagac ugagaacagc cgugcuagca 5280 | ccaaccaggg uuguggcugc ugagauggcu gaagcacuga gaggacugcc cauccgguac 5340 | cagacauccg cagugcccag agaacauaau ggaaaugaga uuguugaugu caugugucau 5400 | gcuacccuca cccacaggcu gaugucuccu cacagggugc cgaacuacaa ccuguucgug 5460 | auggaugagg cucauuucac cgacccagcu agcauugcag caagagguua cauuuccaca 5520 | aaggucgagc uaggggaggc ggcggcaaua uucaugacag ccaccccacc aggcacuuca 5580 | gauccauucc cagaguccaa uucaccaauu uccgacuuac agacugagau cccggaucga 5640 | gcuuggaacu cuggauacga auggaucaca gaauacaccg ggaagacggu uugguuugug 5700 | ccuaguguca agauggggaa ugagauugcc cuuugccuac aacgugcugg aaagaaagua 5760 | guccaauuga acagaaaguc guacgagacg gaguacccaa aauguaagaa cgaugauugg 5820 | gacuuuguua ucacaacaga cauaucugaa augggggcua acuucaaggc gagcagggug 5880 | auugacagcc ggaagagugu gaaaccaacc aucauaacag aaggagaagg gagagugauc 5940 | cugggagaac caucugcagu gacagcagcu agugccgccc agagacgugg acguaucggu 6000 | agaaauccgu cgcaaguugg ugaugaguac uguuaugggg ggcacacgaa ugaagacgac 6060 | ucgaacuucg cccauuggac ugaggcacga aucaugcugg acaacaucaa caugccaaac 6120 | ggacugaucg cucaauucua ccaaccagag cgugagaagg uauauaccau ggauggggaa 6180 | uaccggcuca gaggagaaga gagaaaaaac uuucuggaac uguugaggac ugcagaucug 6240 | ccaguuuggc uggcuuacaa gguugcagcg gcuggagugu cauaccacga ccggaggugg 6300 | ugcuuugaug guccuaggac aaacacaauu uuagaagaca acaacgaagu ggaagucauc 6360 | acgaagcuug gugaaaggaa gauucugagg ccgcgcugga uugacgccag gguguacucg 6420 | gaucaccagg cacuaaaggc guucaaggac uucgccucgg gaaaacguuc ucagauaggg 6480 | cucauugagg uucugggaaa gaugccugag cacuucaugg ggaagacaug ggaagcacuu 6540 | gacaccaugu acguuguggc cacugcagag aaaggaggaa gagcucacag aauggcccug 6600 | gaggaacugc cagaugcucu ucagacaauu gccuugauug ccuuauugag ugugaugacc 6660 | augggaguau ucuuccuccu caugcagcgg aagggcauug gaaagauagg uuugggaggc 6720 | gcugucuugg gagucgcgac cuuuuucugu uggauggcug aaguuccagg aacgaagauc 6780 | gccggaaugu ugcugcucuc ccuucucuug augauugugc uaauuccuga gccagagaag 6840 | caacguucgc agacagacaa ccagcuagcc guguuccuga uuugugucau gacccuugug 6900 | agcgcagugg cagccaacga gauggguugg cuagauaaga ccaagaguga cauaagcagu 6960 | uuguuugggc aaagaauuga ggucaaggag aauuucagca ugggagaguu ccuucuggac 7020 | uugaggccgg caacagccug gucacuguac gcugugacaa cagcgguccu cacuccacug 7080 | cuaaagcauu ugaucacguc agauuacauc aacaccucau ugaccucaau aaacguucag 7140 | gcaagugcac uauucacacu cgcgcgaggc uuccccuucg ucgauguugg agugucggcu 7200 | cuccugcuag cagccggaug cuggggacaa gucacccuca ccguuacggu aacagcggca 7260 | acacuccuuu uuugccacua ugccuacaug guucccgguu ggcaagcuga ggcaaugcgc 7320 | ucagcccagc ggcggacagc ggccggaauc augaagaacg cuguagugga uggcaucgug 7380 | gccacggacg ucccagaauu agagcgcacc acacccauca ugcagaagaa aguuggacag 7440 | aucaugcuga ucuugguguc ucuagcugca guaguaguga acccgucugu gaagacagua 7500 | cgagaagccg gaauuuugau cacggccgca gcggugacgc uuugggagaa uggagcaagc 7560 | ucuguuugga acgcaacaac ugccaucgga cucugccaca ucaugcgugg ggguugguug 7620 | ucaugucuau ccauaacaug gacacucaua aagaacaugg aaaaaccagg acuaaaaaga 7680 | gguggggcaa aaggacgcac cuugggagag guuuggaaag aaagacucaa ccagaugaca 7740 | aaagaagagu ucacuaggua ccgcaaagag gccaucaucg aagucgaucg cucagcggca 7800 | aaacacgcca ggaaagaagg caaugucacu ggagggcauc cagucucuag gggcacagca 7860 | aaacugagau ggcuggucga acggagguuu cucgaaccgg ucggaaaagu gauugaccuu 7920 | ggauguggaa gaggcgguug guguuacuau auggcaaccc aaaaaagagu ccaagaaguc 7980 | agaggguaca caaagggcgg ucccggacau gaagagcccc aacuagugca aaguuaugga 8040 | uggaacauug ucaccaugaa gaguggagug gauguguucu acagaccuuc ugaguguugu 8100 | gacacccucc uuugugacau cggagagucc ucgucaagug cugagguuga agagcauagg 8160 | acgauucggg uccuugaaau gguugaggac uggcugcacc gagggccaag ggaauuuugc 8220 | gugaaggugc ucugccccua caugccgaaa gucauagaga agauggagcu gcuccaacgc 8280 | cgguaugggg ggggacuggu cagaaaccca cucucacgga auuccacgca cgagauguau 8340 | ugggugaguc gagcuucagg caauguggua cauucaguga auaugaccag ccaggugcuc 8400 | cuaggaagaa uggaaaaaag gaccuggaag ggaccccaau acgaggaaga uguaaacuug 8460 | ggaaguggaa ccagggcggu gggaaaaccc cugcucaacu cagacaccag uaaaaucaag 8520 | aacaggauug aacgacucag gcgugaguac aguucgacgu ggcaccacga ugagaaccac 8580 | ccauauagaa ccuggaacua ucacggcagu uaugauguga agcccacagg cuccgccagu 8640 | ucgcugguca auggaguggu caggcuccuc ucaaaaccau gggacaccau cacgaauguu 8700 | accaccaugg ccaugacuga cacuacuccc uucgggcagc agcgaguguu caaagagaag 8760 | guggacacga aagcuccuga accgccagaa ggagugaagu acgugcucaa cgagaccacc 8820 | aacugguugu gggcguuuuu ggccagagaa aaacguccca gaaugugcuc ucgagaggaa 8880 | uucauaagaa aggucaacag caaugcagcu uugggugcca uguuugaaga gcagaaucaa 8940 | uggaggagcg ccagagaagc aguugaagau ccaaaauuuu gggagauggu ggaugaggag 9000 | cgcgaggcac aucugcgggg ggaaugucac acuugcauuu acaacaugau gggaaagaga 9060 | gagaaaaaac ccggagaguu cggaaaggcc aagggaagca gagccauuug guucaugugg 9120 | cucggagcuc gcuuucugga guucgaggcu cuggguuuuc ucaaugaaga ccacuggcuu 9180 | ggaagaaaga acucaggagg aggugucgag ggcuugggcc uccaaaaacu ggguuacauc 9240 | cugcgugaag uuggcacccg gccugggggc aagaucuaug cugaugacac agcuggcugg 9300 | gacacccgca ucacgagagc ugacuuggaa aaugaagcua aggugcuuga gcugcuugau 9360 | ggggaacauc ggcgucuugc cagggccauc auugagcuca ccuaucguca caaaguugug 9420 | aaagugaugc gcccggcugc ugauggaaga accgucaugg auguuaucuc cagagaagau 9480 | cagaggggga guggacaagu ugucaccuac gcccuaaaca cuuucaccaa ccuggccguc 9540 | cagcugguga ggaugaugga aggggaagga gugauuggcc cagaugaugu ggagaaacuc 9600 | acaaaaggga aaggacccaa agucaggacc uggcuguuug agaaugggga agaaagacuc 9660 | agccgcaugg cugucagugg agaugacugu gugguaaagc cccuggacga ucgcuuugcc 9720 | accucgcucc acuuccucaa ugcuauguca aagguucgca aagacaucca agaguggaaa 9780 | ccgucaacug gaugguauga uuggcagcag guuccauuuu gcucaaacca uuucacugaa 9840 | uugaucauga aagauggaag aacacuggug guuccaugcc gaggacagga ugaauuggua 9900 | ggcagagcuc gcauaucucc aggggccgga uggaacgucc gcgacacugc uugucuggcu 9960 | aagucuuaug cccagaugug gcugcuucug uacuuccaca gaagagaccu gcggcucaug 10020 | gccaacgcca uuugcuccgc ugucccugug aauugggucc cuaccggaag aaccacgugg 10080 | uccauccaug caggaggaga guggaugaca acagaggaca uguuggaggu cuggaaccgu 10140 | guuuggauag aggagaauga auggauggaa gacaaaaccc caguggagaa auggagugac 10200 | gucccauauu caggaaaacg agaggacauc ugguguggca gccugauugg cacaagagcc 10260 | cgagccacgu gggcagaaaa cauccaggug gcuaucaacc aagucagagc aaucaucgga 10320 | gaugagaagu auguggauua caugaguuca cuaaagagau augaagacac aacuuugguu 10380 | gaggacacag uacuguagau auuuaaucaa uuguaaauag acaauauaag uaugcauaaa 10440 | aguguaguuu uauaguagua uuuaguggug uuaguguaaa uaguuaagaa aauuuugagg 10500 | agaaagucag gccgggaagu ucccgccacc ggaaguugag uagacggugc ugccugcgac 10560 | ucaaccccag gaggacuggg ugaacaaagc cgcgaaguga uccauguaag cccucagaac 10620 | cguuucggaa ggaggacccc acauguugua acuucaaagc ccaaugucag accacgcuac 10680 | ggcgugcuac ucugcggaga gugcagucug cgauagugcc ccaggaggac uggguuaaca 10740 | aaggcaaacc aacgccccac gcggcccuag ccccgguaau gguguuaacc agggcgaaag 10800 | gacuagaggu uagaggagac cccgcgguuu aaagugcacg gcccagccug gcugaagcug 10860 | uaggucaggg gaaggacuag agguuagugg agaccccgug ccacaaaaca ccacaacaaa 10920 | acagcauauu gacaccuggg auagacuagg agaucuucug cucugcacaa ccagccacac 10980 | ggcacagugc gccgacaaug guggcuggug gugcgagaac acaggaucu 11029 |
SEQ ID NO: 21
| <211> 270 | <212> RNA | <213> Artificial Sequence | <220> | <223> dchp_wsll_A | <400> 21 |
| ugcaguuaga uaauauuggg agguguguuu uuugccuuuu uccguagauc cucgcgaaac 60 | uucuuggccu gguuuucuuu ucaaaagagu ccuuacguau auuggagggu guguuuuucg 120 | cuuuuuuccg ucucggaaac gauaacuucc uggcuugauu uuuucuucaa aagcugcguu 180 | aucuauauug agaggcgugu uuuucgucuu uuuccguucc aaccuggaga acuuuuuggc 240 | cugauuuucu cuucaaaacc aggccguacc 270 |
SEQ ID NO: 22
| <211> 270 | <212> RNA | <213> Artificial Sequence | <220> | <223> dchp_wsll_B | <400> 22 |
| ugcaguuaga uaauauugga aggcguguuu uuugcuuuuu uccguagauc cuaacggaac 60 | uuccuggccu gauuuucuuc uuaaaagagu ccuuacguau auugaaaggu guguuuuucg 120 | ccuuuuuccg ucucggaaac gauaacuuuc cggccugguu uuuuccuuaa aagcugcguu 180 | aucuauauug aggggugugu uuuuugucuu uuuccguucc aaccuggaga acuuccuggu 240 | uuggcuuuuu ucuugaaacc aggccguacc 270 |
SEQ ID NO: 23
| <211> 270 | <212> RNA | <213> Artificial Sequence | <220> | <223> dchp_wsll_C | <400> 23 |
| ugcaguuaga uaauauuggg agguguguuu uuugccuuuu uccguagauc cucgcgaaac 60 | uucuuggccu gguuuucuuu ucaaaagagu ccuuacguau auuggagggu guguuuuucg 120 | cuuuuuuccg ucucggaaac gauaacuucc uggcuugauu uuuucuucaa aagcugcguu 180 | aucuauauug agaggcgugu uuuucgucuu uuuccguucc aaccuggaga acuucccggc 240 | cugacuuuuu ccuuaaaacc aggccguacc 270 |
SEQ ID NO: 24
| <211> 299 | <212> RNA | <213> Artificial Sequence | <220> | <223> circ_wnv_slll_1 | <400> 24 |
| ugcaguuaga uaaacuuucu gguuugguuu ucuccucaaa agacaguucu ucgaacuucc 60 | cgguuugauu uucucuuuaa aaauggggcc ccucaacuuc uuggucugac uuucucuuca 120 | aaaggcuaua cgaucaacuu cucggccuga uuuucuuuuc aaaaagcuau caucgcaacu 180 | uccuggucug guuuucuucu caaaacccuc gguaaccaac uuuccggcuu gacuuucuuc 240 | uuaaaacguu uugcgacaaa cuuuucggcu uggcuuucuc cuuaaaauau guaaacagc 299 |
SEQ ID NO: 25
| <211> 33 | <212> RNA | <213> Artificial Sequence | <220> | <223> Target sequence IRES Circ HCV1 | <400> 25 |
| cuccgccaug aaucacuccc cugugaggaa cua 33 |
SEQ ID NO: 26
| <211> 24 | <212> RNA | <213> Artificial Sequence | <220> | <223> Target sequence IRES Circ HCV2 | <400> 26 |
| ucucguagac cgugcaccau gagc 24 |
SEQ ID NO: 27
| <211> 28 | <212> RNA | <213> Artificial Sequence | <220> | <223> Target sequence cHP (CDS1) circ_hcv_cds1 | <400> 27 |
| ccaaaagaaa caccaaccgu cgcccaga 28 |
SEQ ID NO: 28
| <211> 16 | <212> RNA | <213> Artificial Sequence | <220> | <223> Target sequence CDS2 circ_hcv_cds2 | <400> 28 |
| ggggccccag g 16 |
SEQ ID NO: 29
| <211> 32 | <212> RNA | <213> Artificial Sequence | <220> | <223> Target sequence sHP (3′ UTR) circ_dv_3utr | <400> 29 |
| aacagcauau ugacgcuggg aaagaccaga ga 32 |
SEQ ID NO: 30
| <211> 33 | <212> RNA | <213> Artificial Sequence | <220> | <223> Target sequence cHP½ circ_dv_cHP_v½ | <400> 30 |
| acggaaaaag gcgaaaaaca cgccuuucaa uau 33 |
SEQ ID NO: 31
| <211> 34 | <212> RNA | <213> Artificial Sequence | <220> | <223> Target sequence Chikv_re | <400> 31 |
| gcugcuguaa aacguuggcu uuuuuagccg uaau 34 |
SEQ ID NO: 32
| <211> 294 | <212> RNA | <213> Artificial Sequence | <220> | <223> Broad Spectrum Circular Artificial sequence to DENV cHP and HCV | CDS (circ_dv_cHP_v1_circ_hcv_cds2_2) | <400> 32 |
| gcgccgaugu ugaaaggugu guuuuucguu uuuuucuguc aaguguagga ucuucugggg 60 | ucucgggccc cacgaccaau guuggggggc guguuuuucg cuuuuuucug ucaaaauaau 120 | guugaccugg gguucuuuac ugaacucauu auguugggag gcguguuuuu ugucuuuuuu 180 | uguuuuaucu acacccgucu gggguuuugu cggcgccacg acauguuggg ggguguguuu 240 | uuugccuuuu uccgucucag ugcggcgccc uugggguucc cuuucgcauc acgu 294 |
SEQ ID NO: 33
| <211> 35 | <212> RNA | <213> Artificial Sequence | <220> | <223> Target sequence 5 UTR chikv5utr | <400> 33 |
| acacacguag ccuaccaguu ucuuacugcu cuacu 35 |
SEQ ID NO: 34
| <211> 29903 | <212> RNA | <213> Coronaviridae | <220> | <223> NC_045512.2 Severe acute respiratory syndrome coronavirus 2 | (SARS-CoV-2) isolate Wuhan-Hu-1, complete genome | <400> 34 |
| auuaaagguu uauaccuucc cagguaacaa accaaccaac uuucgaucuc uuguagaucu 60 | guucucuaaa cgaacuuuaa aaucugugug gcugucacuc ggcugcaugc uuagugcacu 120 | cacgcaguau aauuaauaac uaauuacugu cguugacagg acacgaguaa cucgucuauc 180 | uucugcaggc ugcuuacggu uucguccgug uugcagccga ucaucagcac aucuagguuu 240 | cguccgggug ugaccgaaag guaagaugga gagccuuguc ccugguuuca acgagaaaac 300 | acacguccaa cucaguuugc cuguuuuaca gguucgcgac gugcucguac guggcuuugg 360 | agacuccgug gaggaggucu uaucagaggc acgucaacau cuuaaagaug gcacuugugg 420 | cuuaguagaa guugaaaaag gcguuuugcc ucaacuugaa cagcccuaug uguucaucaa 480 | acguucggau gcucgaacug caccucaugg ucauguuaug guugagcugg uagcagaacu 540 | cgaaggcauu caguacgguc guagugguga gacacuuggu guccuugucc cucauguggg 600 | cgaaauacca guggcuuacc gcaagguucu ucuucguaag aacgguaaua aaggagcugg 660 | uggccauagu uacggcgccg aucuaaaguc auuugacuua ggcgacgagc uuggcacuga 720 | uccuuaugaa gauuuucaag aaaacuggaa cacuaaacau agcaguggug uuacccguga 780 | acucaugcgu gagcuuaacg gaggggcaua cacucgcuau gucgauaaca acuucugugg 840 | cccugauggc uacccucuug agugcauuaa agaccuucua gcacgugcug guaaagcuuc 900 | augcacuuug uccgaacaac uggacuuuau ugacacuaag agggguguau acugcugccg 960 | ugaacaugag caugaaauug cuugguacac ggaacguucu gaaaagagcu augaauugca 1020 | gacaccuuuu gaaauuaaau uggcaaagaa auuugacacc uucaaugggg aauguccaaa 1080 | uuuuguauuu cccuuaaauu ccauaaucaa gacuauucaa ccaaggguug aaaagaaaaa 1140 | gcuugauggc uuuaugggua gaauucgauc ugucuaucca guugcgucac caaaugaaug 1200 | caaccaaaug ugccuuucaa cucucaugaa gugugaucau uguggugaaa cuucauggca 1260 | gacgggcgau uuuguuaaag ccacuugcga auuuuguggc acugagaauu ugacuaaaga 1320 | aggugccacu acuugugguu acuuacccca aaaugcuguu guuaaaauuu auuguccagc 1380 | augucacaau ucagaaguag gaccugagca uagucuugcc gaauaccaua augaaucugg 1440 | cuugaaaacc auucuucgua aggguggucg cacuauugcc uuuggaggcu guguguucuc 1500 | uuauguuggu ugccauaaca agugugccua uuggguucca cgugcuagcg cuaacauagg 1560 | uuguaaccau acagguguug uuggagaagg uuccgaaggu cuuaaugaca accuucuuga 1620 | aauacuccaa aaagagaaag ucaacaucaa uauuguuggu gacuuuaaac uuaaugaaga 1680 | gaucgccauu auuuuggcau cuuuuucugc uuccacaagu gcuuuugugg aaacugugaa 1740 | agguuuggau uauaaagcau ucaaacaaau uguugaaucc ugugguaauu uuaaaguuac 1800 | aaaaggaaaa gcuaaaaaag gugccuggaa uauuggugaa cagaaaucaa uacugagucc 1860 | ucuuuaugca uuugcaucag aggcugcucg uguuguacga ucaauuuucu cccgcacucu 1920 | ugaaacugcu caaaauucug ugcguguuuu acagaaggcc gcuauaacaa uacuagaugg 1980 | aauuucacag uauucacuga gacucauuga ugcuaugaug uucacaucug auuuggcuac 2040 | uaacaaucua guuguaaugg ccuacauuac aggugguguu guucaguuga cuucgcagug 2100 | gcuaacuaac aucuuuggca cuguuuauga aaaacucaaa cccguccuug auuggcuuga 2160 | agagaaguuu aaggaaggug uagaguuucu uagagacggu ugggaaauug uuaaauuuau 2220 | cucaaccugu gcuugugaaa uugucggugg acaaauuguc accugugcaa aggaaauuaa 2280 | ggagaguguu cagacauucu uuaagcuugu aaauaaauuu uuggcuuugu gugcugacuc 2340 | uaucauuauu gguggagcua aacuuaaagc cuugaauuua ggugaaacau uugucacgca 2400 | cucaaaggga uuguacagaa aguguguuaa auccagagaa gaaacuggcc uacucaugcc 2460 | ucuaaaagcc ccaaaagaaa uuaucuucuu agagggagaa acacuuccca cagaaguguu 2520 | aacagaggaa guugucuuga aaacugguga uuuacaacca uuagaacaac cuacuaguga 2580 | agcuguugaa gcuccauugg uugguacacc aguuuguauu aacgggcuua uguugcucga 2640 | aaucaaagac acagaaaagu acugugcccu ugcaccuaau augaugguaa caaacaauac 2700 | cuucacacuc aaaggcggug caccaacaaa gguuacuuuu ggugaugaca cugugauaga 2760 | agugcaaggu uacaagagug ugaauaucac uuuugaacuu gaugaaagga uugauaaagu 2820 | acuuaaugag aagugcucug ccuauacagu ugaacucggu acagaaguaa augaguucgc 2880 | cuguguugug gcagaugcug ucauaaaaac uuugcaacca guaucugaau uacuuacacc 2940 | acugggcauu gauuuagaug aguggaguau ggcuacauac uacuuauuug augagucugg 3000 | ugaguuuaaa uuggcuucac auauguauug uucuuucuac ccuccagaug aggaugaaga 3060 | agaaggugau ugugaagaag aagaguuuga gccaucaacu caauaugagu augguacuga 3120 | agaugauuac caagguaaac cuuuggaauu uggugccacu ucugcugcuc uucaaccuga 3180 | agaagagcaa gaagaagauu gguuagauga ugauagucaa caaacuguug gucaacaaga 3240 | cggcagugag gacaaucaga caacuacuau ucaaacaauu guugagguuc aaccucaauu 3300 | agagauggaa cuuacaccag uuguucagac uauugaagug aauaguuuua gugguuauuu 3360 | aaaacuuacu gacaauguau acauuaaaaa ugcagacauu guggaagaag cuaaaaaggu 3420 | aaaaccaaca gugguuguua augcagccaa uguuuaccuu aaacauggag gagguguugc 3480 | aggagccuua aauaaggcua cuaacaaugc caugcaaguu gaaucugaug auuacauagc 3540 | uacuaaugga ccacuuaaag ugggugguag uuguguuuua agcggacaca aucuugcuaa 3600 | acacugucuu cauguugucg gcccaaaugu uaacaaaggu gaagacauuc aacuucuuaa 3660 | gagugcuuau gaaaauuuua aucagcacga aguucuacuu gcaccauuau uaucagcugg 3720 | uauuuuuggu gcugacccua uacauucuuu aagaguuugu guagauacug uucgcacaaa 3780 | ugucuacuua gcugucuuug auaaaaaucu cuaugacaaa cuuguuucaa gcuuuuugga 3840 | aaugaagagu gaaaagcaag uugaacaaaa gaucgcugag auuccuaaag aggaaguuaa 3900 | gccauuuaua acugaaagua aaccuucagu ugaacagaga aaacaagaug auaagaaaau 3960 | caaagcuugu guugaagaag uuacaacaac ucuggaagaa acuaaguucc ucacagaaaa 4020 | cuuguuacuu uauauugaca uuaauggcaa ucuucaucca gauucugcca cucuuguuag 4080 | ugacauugac aucacuuucu uaaagaaaga ugcuccauau auagugggug auguuguuca 4140 | agaggguguu uuaacugcug ugguuauacc uacuaaaaag gcugguggca cuacugaaau 4200 | gcuagcgaaa gcuuugagaa aagugccaac agacaauuau auaaccacuu acccggguca 4260 | ggguuuaaau gguuacacug uagaggaggc aaagacagug cuuaaaaagu guaaaagugc 4320 | cuuuuacauu cuaccaucua uuaucucuaa ugagaagcaa gaaauucuug gaacuguuuc 4380 | uuggaauuug cgagaaaugc uugcacaugc agaagaaaca cgcaaauuaa ugccugucug 4440 | uguggaaacu aaagccauag uuucaacuau acagcguaaa uauaagggua uuaaaauaca 4500 | agagggugug guugauuaug gugcuagauu uuacuuuuac accaguaaaa caacuguagc 4560 | gucacuuauc aacacacuua acgaucuaaa ugaaacucuu guuacaaugc cacuuggcua 4620 | uguaacacau ggcuuaaauu uggaagaagc ugcucgguau augagaucuc ucaaagugcc 4680 | agcuacaguu ucuguuucuu caccugaugc uguuacagcg uauaaugguu aucuuacuuc 4740 | uucuucuaaa acaccugaag aacauuuuau ugaaaccauc ucacuugcug guuccuauaa 4800 | agauuggucc uauucuggac aaucuacaca acuagguaua gaauuucuua agagagguga 4860 | uaaaagugua uauuacacua guaauccuac cacauuccac cuagauggug aaguuaucac 4920 | cuuugacaau cuuaagacac uucuuucuuu gagagaagug aggacuauua agguguuuac 4980 | aacaguagac aacauuaacc uccacacgca aguuguggac augucaauga cauauggaca 5040 | acaguuuggu ccaacuuauu uggauggagc ugauguuacu aaaauaaaac cucauaauuc 5100 | acaugaaggu aaaacauuuu auguuuuacc uaaugaugac acucuacgug uugaggcuuu 5160 | ugaguacuac cacacaacug auccuaguuu ucuggguagg uacaugucag cauuaaauca 5220 | cacuaaaaag uggaaauacc cacaaguuaa ugguuuaacu ucuauuaaau gggcagauaa 5280 | caacuguuau cuugccacug cauuguuaac acuccaacaa auagaguuga aguuuaaucc 5340 | accugcucua caagaugcuu auuacagagc aagggcuggu gaagcugcua acuuuugugc 5400 | acuuaucuua gccuacugua auaagacagu aggugaguua ggugauguua gagaaacaau 5460 | gaguuacuug uuucaacaug ccaauuuaga uucuugcaaa agagucuuga acguggugug 5520 | uaaaacuugu ggacaacagc agacaacccu uaagggugua gaagcuguua uguacauggg 5580 | cacacuuucu uaugaacaau uuaagaaagg uguucagaua ccuuguacgu gugguaaaca 5640 | agcuacaaaa uaucuaguac aacaggaguc accuuuuguu augaugucag caccaccugc 5700 | ucaguaugaa cuuaagcaug guacauuuac uugugcuagu gaguacacug guaauuacca 5760 | guguggucac uauaaacaua uaacuucuaa agaaacuuug uauugcauag acggugcuuu 5820 | acuuacaaag uccucagaau acaaaggucc uauuacggau guuuucuaca aagaaaacag 5880 | uuacacaaca accauaaaac caguuacuua uaaauuggau gguguuguuu guacagaaau 5940 | ugacccuaag uuggacaauu auuauaagaa agacaauucu uauuucacag agcaaccaau 6000 | ugaucuugua ccaaaccaac cauauccaaa cgcaagcuuc gauaauuuua aguuuguaug 6060 | ugauaauauc aaauuugcug augauuuaaa ccaguuaacu gguuauaaga aaccugcuuc 6120 | aagagagcuu aaaguuacau uuuucccuga cuuaaauggu gauguggugg cuauugauua 6180 | uaaacacuac acacccucuu uuaagaaagg agcuaaauug uuacauaaac cuauuguuug 6240 | gcauguuaac aaugcaacua auaaagccac guauaaacca aauaccuggu guauacguug 6300 | ucuuuggagc acaaaaccag uugaaacauc aaauucguuu gauguacuga agucagagga 6360 | cgcgcaggga auggauaauc uugccugcga agaucuaaaa ccagucucug aagaaguagu 6420 | ggaaaauccu accauacaga aagacguucu ugaguguaau gugaaaacua ccgaaguugu 6480 | aggagacauu auacuuaaac cagcaaauaa uaguuuaaaa auuacagaag agguuggcca 6540 | cacagaucua auggcugcuu auguagacaa uucuagucuu acuauuaaga aaccuaauga 6600 | auuaucuaga guauuagguu ugaaaacccu ugcuacucau gguuuagcug cuguuaauag 6660 | ugucccuugg gauacuauag cuaauuaugc uaagccuuuu cuuaacaaag uuguuaguac 6720 | aacuacuaac auaguuacac gguguuuaaa ccguguuugu acuaauuaua ugccuuauuu 6780 | cuuuacuuua uugcuacaau uguguacuuu uacuagaagu acaaauucua gaauuaaagc 6840 | aucuaugccg acuacuauag caaagaauac uguuaagagu gucgguaaau uuugucuaga 6900 | ggcuucauuu aauuauuuga agucaccuaa uuuuucuaaa cugauaaaua uuauaauuug 6960 | guuuuuacua uuaaguguuu gccuagguuc uuuaaucuac ucaaccgcug cuuuaggugu 7020 | uuuaaugucu aauuuaggca ugccuucuua cuguacuggu uacagagaag gcuauuugaa 7080 | cucuacuaau gucacuauug caaccuacug uacugguucu auaccuugua guguuugucu 7140 | uagugguuua gauucuuuag acaccuaucc uucuuuagaa acuauacaaa uuaccauuuc 7200 | aucuuuuaaa ugggauuuaa cugcuuuugg cuuaguugca gagugguuuu uggcauauau 7260 | ucuuuucacu agguuuuucu auguacuugg auuggcugca aucaugcaau uguuuuucag 7320 | cuauuuugca guacauuuua uuaguaauuc uuggcuuaug ugguuaauaa uuaaucuugu 7380 | acaaauggcc ccgauuucag cuaugguuag aauguacauc uucuuugcau cauuuuauua 7440 | uguauggaaa aguuaugugc auguuguaga cgguuguaau ucaucaacuu guaugaugug 7500 | uuacaaacgu aauagagcaa caagagucga auguacaacu auuguuaaug guguuagaag 7560 | guccuuuuau gucuaugcua auggagguaa aggcuuuugc aaacuacaca auuggaauug 7620 | uguuaauugu gauacauucu gugcugguag uacauuuauu agugaugaag uugcgagaga 7680 | cuugucacua caguuuaaaa gaccaauaaa uccuacugac cagucuucuu acaucguuga 7740 | uaguguuaca gugaagaaug guuccaucca ucuuuacuuu gauaaagcug gucaaaagac 7800 | uuaugaaaga cauucucucu cucauuuugu uaacuuagac aaccugagag cuaauaacac 7860 | uaaagguuca uugccuauua auguuauagu uuuugauggu aaaucaaaau gugaagaauc 7920 | aucugcaaaa ucagcgucug uuuacuacag ucagcuuaug ugucaaccua uacuguuacu 7980 | agaucaggca uuagugucug auguugguga uagugcggaa guugcaguua aaauguuuga 8040 | ugcuuacguu aauacguuuu caucaacuuu uaacguacca auggaaaaac ucaaaacacu 8100 | aguugcaacu gcagaagcug aacuugcaaa gaaugugucc uuagacaaug ucuuaucuac 8160 | uuuuauuuca gcagcucggc aaggguuugu ugauucagau guagaaacua aagauguugu 8220 | ugaaugucuu aaauugucac aucaaucuga cauagaaguu acuggcgaua guuguaauaa 8280 | cuauaugcuc accuauaaca aaguugaaaa caugacaccc cgugaccuug gugcuuguau 8340 | ugacuguagu gcgcgucaua uuaaugcgca gguagcaaaa agucacaaca uugcuuugau 8400 | auggaacguu aaagauuuca ugucauuguc ugaacaacua cgaaaacaaa uacguagugc 8460 | ugcuaaaaag aauaacuuac cuuuuaaguu gacaugugca acuacuagac aaguuguuaa 8520 | uguuguaaca acaaagauag cacuuaaggg ugguaaaauu guuaauaauu gguugaagca 8580 | guuaauuaaa guuacacuug uguuccuuuu uguugcugcu auuuucuauu uaauaacacc 8640 | uguucauguc augucuaaac auacugacuu uucaagugaa aucauaggau acaaggcuau 8700 | ugaugguggu gucacucgug acauagcauc uacagauacu uguuuugcua acaaacaugc 8760 | ugauuuugac acaugguuua gccagcgugg ugguaguuau acuaaugaca aagcuugccc 8820 | auugauugcu gcagucauaa caagagaagu ggguuuuguc gugccugguu ugccuggcac 8880 | gauauuacgc acaacuaaug gugacuuuuu gcauuucuua ccuagaguuu uuagugcagu 8940 | ugguaacauc uguuacacac caucaaaacu uauagaguac acugacuuug caacaucagc 9000 | uuguguuuug gcugcugaau guacaauuuu uaaagaugcu ucugguaagc caguaccaua 9060 | uuguuaugau accaauguac uagaagguuc uguugcuuau gaaaguuuac gcccugacac 9120 | acguuaugug cucauggaug gcucuauuau ucaauuuccu aacaccuacc uugaagguuc 9180 | uguuagagug guaacaacuu uugauucuga guacuguagg cacggcacuu gugaaagauc 9240 | agaagcuggu guuuguguau cuacuagugg uagaugggua cuuaacaaug auuauuacag 9300 | aucuuuacca ggaguuuucu gugguguaga ugcuguaaau uuacuuacua auauguuuac 9360 | accacuaauu caaccuauug gugcuuugga cauaucagca ucuauaguag cuggugguau 9420 | uguagcuauc guaguaacau gccuugccua cuauuuuaug agguuuagaa gagcuuuugg 9480 | ugaauacagu cauguaguug ccuuuaauac uuuacuauuc cuuaugucau ucacuguacu 9540 | cuguuuaaca ccaguuuacu cauucuuacc ugguguuuau ucuguuauuu acuuguacuu 9600 | gacauuuuau cuuacuaaug auguuucuuu uuuagcacau auucagugga ugguuauguu 9660 | cacaccuuua guaccuuucu ggauaacaau ugcuuauauc auuuguauuu ccacaaagca 9720 | uuucuauugg uucuuuagua auuaccuaaa gagacgugua gucuuuaaug guguuuccuu 9780 | uaguacuuuu gaagaagcug cgcugugcac cuuuuuguua aauaaagaaa uguaucuaaa 9840 | guugcguagu gaugugcuau uaccucuuac gcaauauaau agauacuuag cucuuuauaa 9900 | uaaguacaag uauuuuagug gagcaaugga uacaacuagc uacagagaag cugcuuguug 9960 | ucaucucgca aaggcucuca augacuucag uaacucaggu ucugauguuc uuuaccaacc 10020 | accacaaacc ucuaucaccu cagcuguuuu gcagaguggu uuuagaaaaa uggcauuccc 10080 | aucugguaaa guugaggguu guaugguaca aguaacuugu gguacaacua cacuuaacgg 10140 | ucuuuggcuu gaugacguag uuuacugucc aagacaugug aucugcaccu cugaagacau 10200 | gcuuaacccu aauuaugaag auuuacucau ucguaagucu aaucauaauu ucuugguaca 10260 | ggcugguaau guucaacuca ggguuauugg acauucuaug caaaauugug uacuuaagcu 10320 | uaagguugau acagccaauc cuaagacacc uaaguauaag uuuguucgca uucaaccagg 10380 | acagacuuuu ucaguguuag cuuguuacaa ugguucacca ucugguguuu accaaugugc 10440 | uaugaggccc aauuucacua uuaaggguuc auuccuuaau gguucaugug guaguguugg 10500 | uuuuaacaua gauuaugacu gugucucuuu uuguuacaug caccauaugg aauuaccaac 10560 | uggaguucau gcuggcacag acuuagaagg uaacuuuuau ggaccuuuug uugacaggca 10620 | aacagcacaa gcagcuggua cggacacaac uauuacaguu aauguuuuag cuugguugua 10680 | cgcugcuguu auaaauggag acaggugguu ucucaaucga uuuaccacaa cucuuaauga 10740 | cuuuaaccuu guggcuauga aguacaauua ugaaccucua acacaagacc auguugacau 10800 | acuaggaccu cuuucugcuc aaacuggaau ugccguuuua gauaugugug cuucauuaaa 10860 | agaauuacug caaaauggua ugaauggacg uaccauauug gguagugcuu uauuagaaga 10920 | ugaauuuaca ccuuuugaug uuguuagaca augcucaggu guuacuuucc aaagugcagu 10980 | gaaaagaaca aucaagggua cacaccacug guuguuacuc acaauuuuga cuucacuuuu 11040 | aguuuuaguc cagaguacuc aauggucuuu guucuuuuuu uuguaugaaa augccuuuuu 11100 | accuuuugcu auggguauua uugcuauguc ugcuuuugca augauguuug ucaaacauaa 11160 | gcaugcauuu cucuguuugu uuuuguuacc uucucuugcc acuguagcuu auuuuaauau 11220 | ggucuauaug ccugcuaguu gggugaugcg uauuaugaca ugguuggaua ugguugauac 11280 | uaguuugucu gguuuuaagc uaaaagacug uguuauguau gcaucagcug uaguguuacu 11340 | aauccuuaug acagcaagaa cuguguauga ugauggugcu aggagagugu ggacacuuau 11400 | gaaugucuug acacucguuu auaaaguuua uuaugguaau gcuuuagauc aagccauuuc 11460 | caugugggcu cuuauaaucu cuguuacuuc uaacuacuca gguguaguua caacugucau 11520 | guuuuuggcc agagguauug uuuuuaugug uguugaguau ugcccuauuu ucuucauaac 11580 | ugguaauaca cuucagugua uaaugcuagu uuauuguuuc uuaggcuauu uuuguacuug 11640 | uuacuuuggc cucuuuuguu uacucaaccg cuacuuuaga cugacucuug guguuuauga 11700 | uuacuuaguu ucuacacagg aguuuagaua uaugaauuca cagggacuac ucccacccaa 11760 | gaauagcaua gaugccuuca aacucaacau uaaauuguug gguguuggug gcaaaccuug 11820 | uaucaaagua gccacuguac agucuaaaau gucagaugua aagugcacau caguagucuu 11880 | acucucaguu uugcaacaac ucagaguaga aucaucaucu aaauuguggg cucaaugugu 11940 | ccaguuacac aaugacauuc ucuuagcuaa agauacuacu gaagccuuug aaaaaauggu 12000 | uucacuacuu ucuguuuugc uuuccaugca gggugcugua gacauaaaca agcuuuguga 12060 | agaaaugcug gacaacaggg caaccuuaca agcuauagcc ucagaguuua guucccuucc 12120 | aucauaugca gcuuuugcua cugcucaaga agcuuaugag caggcuguug cuaaugguga 12180 | uucugaaguu guucuuaaaa aguugaagaa gucuuugaau guggcuaaau cugaauuuga 12240 | ccgugaugca gccaugcaac guaaguugga aaagauggcu gaucaagcua ugacccaaau 12300 | guauaaacag gcuagaucug aggacaagag ggcaaaaguu acuagugcua ugcagacaau 12360 | gcuuuucacu augcuuagaa aguuggauaa ugaugcacuc aacaacauua ucaacaaugc 12420 | aagagauggu uguguucccu ugaacauaau accucuuaca acagcagcca aacuaauggu 12480 | ugucauacca gacuauaaca cauauaaaaa uacgugugau gguacaacau uuacuuaugc 12540 | aucagcauug ugggaaaucc aacagguugu agaugcagau aguaaaauug uucaacuuag 12600 | ugaaauuagu auggacaauu caccuaauuu agcauggccu cuuauuguaa cagcuuuaag 12660 | ggccaauucu gcugucaaau uacagaauaa ugagcuuagu ccuguugcac uacgacagau 12720 | gucuugugcu gccgguacua cacaaacugc uugcacugau gacaaugcgu uagcuuacua 12780 | caacacaaca aagggaggua gguuuguacu ugcacuguua uccgauuuac aggauuugaa 12840 | augggcuaga uucccuaaga gugauggaac ugguacuauc uauacagaac uggaaccacc 12900 | uuguagguuu guuacagaca caccuaaagg uccuaaagug aaguauuuau acuuuauuaa 12960 | aggauuaaac aaccuaaaua gagguauggu acuugguagu uuagcugcca caguacgucu 13020 | acaagcuggu aaugcaacag aagugccugc caauucaacu guauuaucuu ucugugcuuu 13080 | ugcuguagau gcugcuaaag cuuacaaaga uuaucuagcu agugggggac aaccaaucac 13140 | uaauuguguu aagauguugu guacacacac ugguacuggu caggcaauaa caguuacacc 13200 | ggaagccaau auggaucaag aauccuuugg uggugcaucg uguugucugu acugccguug 13260 | ccacauagau cauccaaauc cuaaaggauu uugugacuua aaagguaagu auguacaaau 13320 | accuacaacu ugugcuaaug acccuguggg uuuuacacuu aaaaacacag ucuguaccgu 13380 | cugcgguaug uggaaagguu auggcuguag uugugaucaa cuccgcgaac ccaugcuuca 13440 | gucagcugau gcacaaucgu uuuuaaacgg guuugcggug uaagugcagc ccgucuuaca 13500 | ccgugcggca caggcacuag uacugauguc guauacaggg cuuuugacau cuacaaugau 13560 | aaaguagcug guuuugcuaa auuccuaaaa acuaauuguu gucgcuucca agaaaaggac 13620 | gaagaugaca auuuaauuga uucuuacuuu guaguuaaga gacacacuuu cucuaacuac 13680 | caacaugaag aaacaauuua uaauuuacuu aaggauuguc cagcuguugc uaaacaugac 13740 | uucuuuaagu uuagaauaga cggugacaug guaccacaua uaucacguca acgucuuacu 13800 | aaauacacaa uggcagaccu cgucuaugcu uuaaggcauu uugaugaagg uaauugugac 13860 | acauuaaaag aaauacuugu cacauacaau uguugugaug augauuauuu caauaaaaag 13920 | gacugguaug auuuuguaga aaacccagau auauuacgcg uauacgccaa cuuaggugaa 13980 | cguguacgcc aagcuuuguu aaaaacagua caauucugug augccaugcg aaaugcuggu 14040 | auuguuggug uacugacauu agauaaucaa gaucucaaug guaacuggua ugauuucggu 14100 | gauuucauac aaaccacgcc agguagugga guuccuguug uagauucuua uuauucauug 14160 | uuaaugccua uauuaaccuu gaccagggcu uuaacugcag agucacaugu ugacacugac 14220 | uuaacaaagc cuuacauuaa gugggauuug uuaaaauaug acuucacgga agagagguua 14280 | aaacucuuug accguuauuu uaaauauugg gaucagacau accacccaaa uuguguuaac 14340 | uguuuggaug acagaugcau ucugcauugu gcaaacuuua auguuuuauu cucuacagug 14400 | uucccaccua caaguuuugg accacuagug agaaaaauau uuguugaugg uguuccauuu 14460 | guaguuucaa cuggauacca cuucagagag cuagguguug uacauaauca ggauguaaac 14520 | uuacauagcu cuagacuuag uuuuaaggaa uuacuugugu augcugcuga cccugcuaug 14580 | cacgcugcuu cugguaaucu auuacuagau aaacgcacua cgugcuuuuc aguagcugca 14640 | cuuacuaaca auguugcuuu ucaaacuguc aaacccggua auuuuaacaa agacuucuau 14700 | gacuuugcug ugucuaaggg uuucuuuaag gaaggaaguu cuguugaauu aaaacacuuc 14760 | uucuuugcuc aggaugguaa ugcugcuauc agcgauuaug acuacuaucg uuauaaucua 14820 | ccaacaaugu gugauaucag acaacuacua uuuguaguug aaguuguuga uaaguacuuu 14880 | gauuguuacg augguggcug uauuaaugcu aaccaaguca ucgucaacaa ccuagacaaa 14940 | ucagcugguu uuccauuuaa uaaauggggu aaggcuagac uuuauuauga uucaaugagu 15000 | uaugaggauc aagaugcacu uuucgcauau acaaaacgua augucauccc uacuauaacu 15060 | caaaugaauc uuaaguaugc cauuagugca aagaauagag cucgcaccgu agcugguguc 15120 | ucuaucugua guacuaugac caauagacag uuucaucaaa aauuauugaa aucaauagcc 15180 | gccacuagag gagcuacugu aguaauugga acaagcaaau ucuauggugg uuggcacaac 15240 | auguuaaaaa cuguuuauag ugauguagaa aacccucacc uuauggguug ggauuauccu 15300 | aaaugugaua gagccaugcc uaacaugcuu agaauuaugg ccucacuugu ucuugcucgc 15360 | aaacauacaa cguguuguag cuugucacac cguuucuaua gauuagcuaa ugagugugcu 15420 | caaguauuga gugaaauggu cauguguggc gguucacuau auguuaaacc agguggaacc 15480 | ucaucaggag augccacaac ugcuuaugcu aauaguguuu uuaacauuug ucaagcuguc 15540 | acggccaaug uuaaugcacu uuuaucuacu gaugguaaca aaauugccga uaaguauguc 15600 | cgcaauuuac aacacagacu uuaugagugu cucuauagaa auagagaugu ugacacagac 15660 | uuugugaaug aguuuuacgc auauuugcgu aaacauuucu caaugaugau acucucugac 15720 | gaugcuguug uguguuucaa uagcacuuau gcaucucaag gucuaguggc uagcauaaag 15780 | aacuuuaagu caguucuuua uuaucaaaac aauguuuuua ugucugaagc aaaauguugg 15840 | acugagacug accuuacuaa aggaccucau gaauuuugcu cucaacauac aaugcuaguu 15900 | aaacagggug augauuaugu guaccuuccu uacccagauc caucaagaau ccuaggggcc 15960 | ggcuguuuug uagaugauau cguaaaaaca gaugguacac uuaugauuga acgguucgug 16020 | ucuuuagcua uagaugcuua cccacuuacu aaacauccua aucaggagua ugcugauguc 16080 | uuucauuugu acuuacaaua cauaagaaag cuacaugaug aguuaacagg acacauguua 16140 | gacauguauu cuguuaugcu uacuaaugau aacacuucaa gguauuggga accugaguuu 16200 | uaugaggcua uguacacacc gcauacaguc uuacaggcug uuggggcuug uguucuuugc 16260 | aauucacaga cuucauuaag auguggugcu ugcauacgua gaccauucuu auguuguaaa 16320 | ugcuguuacg accaugucau aucaacauca cauaaauuag ucuugucugu uaauccguau 16380 | guuugcaaug cuccagguug ugaugucaca gaugugacuc aacuuuacuu aggagguaug 16440 | agcuauuauu guaaaucaca uaaaccaccc auuaguuuuc cauugugugc uaauggacaa 16500 | guuuuugguu uauauaaaaa uacauguguu gguagcgaua auguuacuga cuuuaaugca 16560 | auugcaacau gugacuggac aaaugcuggu gauuacauuu uagcuaacac cuguacugaa 16620 | agacucaagc uuuuugcagc agaaacgcuc aaagcuacug aggagacauu uaaacugucu 16680 | uaugguauug cuacuguacg ugaagugcug ucugacagag aauuacaucu uucaugggaa 16740 | guugguaaac cuagaccacc acuuaaccga aauuaugucu uuacugguua ucguguaacu 16800 | aaaaacagua aaguacaaau aggagaguac accuuugaaa aaggugacua uggugaugcu 16860 | guuguuuacc gagguacaac aacuuacaaa uuaaauguug gugauuauuu ugugcugaca 16920 | ucacauacag uaaugccauu aagugcaccu acacuagugc cacaagagca cuauguuaga 16980 | auuacuggcu uauacccaac acucaauauc ucagaugagu uuucuagcaa uguugcaaau 17040 | uaucaaaagg uugguaugca aaaguauucu acacuccagg gaccaccugg uacugguaag 17100 | agucauuuug cuauuggccu agcucucuac uacccuucug cucgcauagu guauacagcu 17160 | ugcucucaug ccgcuguuga ugcacuaugu gagaaggcau uaaaauauuu gccuauagau 17220 | aaauguagua gaauuauacc ugcacgugcu cguguagagu guuuugauaa auucaaagug 17280 | aauucaacau uagaacagua ugucuuuugu acuguaaaug cauugccuga gacgacagca 17340 | gauauaguug ucuuugauga aauuucaaug gccacaaauu augauuugag uguugucaau 17400 | gccagauuac gugcuaagca cuauguguac auuggcgacc cugcucaauu accugcacca 17460 | cgcacauugc uaacuaaggg cacacuagaa ccagaauauu ucaauucagu guguagacuu 17520 | augaaaacua uagguccaga cauguuccuc ggaacuuguc ggcguugucc ugcugaaauu 17580 | guugacacug ugagugcuuu gguuuaugau aauaagcuua aagcacauaa agacaaauca 17640 | gcucaaugcu uuaaaauguu uuauaagggu guuaucacgc augauguuuc aucugcaauu 17700 | aacaggccac aaauaggcgu gguaagagaa uuccuuacac guaacccugc uuggagaaaa 17760 | gcugucuuua uuucaccuua uaauucacag aaugcuguag ccucaaagau uuugggacua 17820 | ccaacucaaa cuguugauuc aucacagggc ucagaauaug acuaugucau auucacucaa 17880 | accacugaaa cagcucacuc uuguaaugua aacagauuua auguugcuau uaccagagca 17940 | aaaguaggca uacuuugcau aaugucugau agagaccuuu augacaaguu gcaauuuaca 18000 | agucuugaaa uuccacguag gaauguggca acuuuacaag cugaaaaugu aacaggacuc 18060 | uuuaaagauu guaguaaggu aaucacuggg uuacauccua cacaggcacc uacacaccuc 18120 | aguguugaca cuaaauucaa aacugaaggu uuauguguug acauaccugg cauaccuaag 18180 | gacaugaccu auagaagacu caucucuaug auggguuuua aaaugaauua ucaaguuaau 18240 | gguuacccua acauguuuau cacccgcgaa gaagcuauaa gacauguacg ugcauggauu 18300 | ggcuucgaug ucgaggggug ucaugcuacu agagaagcug uugguaccaa uuuaccuuua 18360 | cagcuagguu uuucuacagg uguuaaccua guugcuguac cuacagguua uguugauaca 18420 | ccuaauaaua cagauuuuuc cagaguuagu gcuaaaccac cgccuggaga ucaauuuaaa 18480 | caccucauac cacuuaugua caaaggacuu ccuuggaaug uagugcguau aaagauugua 18540 | caaauguuaa gugacacacu uaaaaaucuc ucugacagag ucguauuugu cuuaugggca 18600 | cauggcuuug aguugacauc uaugaaguau uuugugaaaa uaggaccuga gcgcaccugu 18660 | ugucuaugug auagacgugc cacaugcuuu uccacugcuu cagacacuua ugccuguugg 18720 | caucauucua uuggauuuga uuacgucuau aauccguuua ugauugaugu ucaacaaugg 18780 | gguuuuacag guaaccuaca aagcaaccau gaucuguauu gucaagucca ugguaaugca 18840 | cauguagcua guugugaugc aaucaugacu aggugucuag cuguccacga gugcuuuguu 18900 | aagcguguug acuggacuau ugaauauccu auaauuggug augaacugaa gauuaaugcg 18960 | gcuuguagaa agguucaaca caugguuguu aaagcugcau uauuagcaga caaauuccca 19020 | guucuucacg acauugguaa cccuaaagcu auuaagugug uaccucaagc ugauguagaa 19080 | uggaaguucu augaugcaca gccuuguagu gacaaagcuu auaaaauaga agaauuauuc 19140 | uauucuuaug ccacacauuc ugacaaauuc acagauggug uaugccuauu uuggaauugc 19200 | aaugucgaua gauauccugc uaauuccauu guuuguagau uugacacuag agugcuaucu 19260 | aaccuuaacu ugccugguug ugaugguggc aguuuguaug uaaauaaaca ugcauuccac 19320 | acaccagcuu uugauaaaag ugcuuuuguu aauuuaaaac aauuaccauu uuucuauuac 19380 | ucugacaguc caugugaguc ucauggaaaa caaguagugu cagauauaga uuauguacca 19440 | cuaaagucug cuacguguau aacacguugc aauuuaggug gugcugucug uagacaucau 19500 | gcuaaugagu acagauugua ucucgaugcu uauaacauga ugaucucagc uggcuuuagc 19560 | uuguggguuu acaaacaauu ugauacuuau aaccucugga acacuuuuac aagacuucag 19620 | aguuuagaaa auguggcuuu uaauguugua aauaagggac acuuugaugg acaacagggu 19680 | gaaguaccag uuucuaucau uaauaacacu guuuacacaa aaguugaugg uguugaugua 19740 | gaauuguuug aaaauaaaac aacauuaccu guuaauguag cauuugagcu uugggcuaag 19800 | cgcaacauua aaccaguacc agaggugaaa auacucaaua auuugggugu ggacauugcu 19860 | gcuaauacug ugaucuggga cuacaaaaga gaugcuccag cacauauauc uacuauuggu 19920 | guuuguucua ugacugacau agccaagaaa ccaacugaaa cgauuugugc accacucacu 19980 | gucuuuuuug augguagagu ugauggucaa guagacuuau uuagaaaugc ccguaauggu 20040 | guucuuauua cagaagguag uguuaaaggu uuacaaccau cuguaggucc caaacaagcu 20100 | agucuuaaug gagucacauu aauuggagaa gccguaaaaa cacaguucaa uuauuauaag 20160 | aaaguugaug guguugucca acaauuaccu gaaacuuacu uuacucagag uagaaauuua 20220 | caagaauuua aacccaggag ucaaauggaa auugauuucu uagaauuagc uauggaugaa 20280 | uucauugaac gguauaaauu agaaggcuau gccuucgaac auaucguuua uggagauuuu 20340 | agucauaguc aguuaggugg uuuacaucua cugauuggac uagcuaaacg uuuuaaggaa 20400 | ucaccuuuug aauuagaaga uuuuauuccu auggacagua caguuaaaaa cuauuucaua 20460 | acagaugcgc aaacagguuc aucuaagugu guguguucug uuauugauuu auuacuugau 20520 | gauuuuguug aaauaauaaa aucccaagau uuaucuguag uuucuaaggu ugucaaagug 20580 | acuauugacu auacagaaau uucauuuaug cuuuggugua aagauggcca uguagaaaca 20640 | uuuuacccaa aauuacaauc uagucaagcg uggcaaccgg guguugcuau gccuaaucuu 20700 | uacaaaaugc aaagaaugcu auuagaaaag ugugaccuuc aaaauuaugg ugauagugca 20760 | acauuaccua aaggcauaau gaugaauguc gcaaaauaua cucaacugug ucaauauuua 20820 | aacacauuaa cauuagcugu acccuauaau augagaguua uacauuuugg ugcugguucu 20880 | gauaaaggag uugcaccagg uacagcuguu uuaagacagu gguugccuac ggguacgcug 20940 | cuugucgauu cagaucuuaa ugacuuuguc ucugaugcag auucaacuuu gauuggugau 21000 | ugugcaacug uacauacagc uaauaaaugg gaucucauua uuagugauau guacgacccu 21060 | aagacuaaaa auguuacaaa agaaaaugac ucuaaagagg guuuuuucac uuacauuugu 21120 | ggguuuauac aacaaaagcu agcucuugga gguuccgugg cuauaaagau aacagaacau 21180 | ucuuggaaug cugaucuuua uaagcucaug ggacacuucg caugguggac agccuuuguu 21240 | acuaauguga augcgucauc aucugaagca uuuuuaauug gauguaauua ucuuggcaaa 21300 | ccacgcgaac aaauagaugg uuaugucaug caugcaaauu acauauuuug gaggaauaca 21360 | aauccaauuc aguugucuuc cuauucuuua uuugacauga guaaauuucc ccuuaaauua 21420 | agggguacug cuguuauguc uuuaaaagaa ggucaaauca augauaugau uuuaucucuu 21480 | cuuaguaaag guagacuuau aauuagagaa aacaacagag uuguuauuuc uagugauguu 21540 | cuuguuaaca acuaaacgaa caauguuugu uuuucuuguu uuauugccac uagucucuag 21600 | ucaguguguu aaucuuacaa ccagaacuca auuacccccu gcauacacua auucuuucac 21660 | acgugguguu uauuacccug acaaaguuuu cagauccuca guuuuacauu caacucagga 21720 | cuuguucuua ccuuucuuuu ccaauguuac uugguuccau gcuauacaug ucucugggac 21780 | caaugguacu aagagguuug auaacccugu ccuaccauuu aaugauggug uuuauuuugc 21840 | uuccacugag aagucuaaca uaauaagagg cuggauuuuu gguacuacuu uagauucgaa 21900 | gacccagucc cuacuuauug uuaauaacgc uacuaauguu guuauuaaag ucugugaauu 21960 | ucaauuuugu aaugauccau uuuugggugu uuauuaccac aaaaacaaca aaaguuggau 22020 | ggaaagugag uucagaguuu auucuagugc gaauaauugc acuuuugaau augucucuca 22080 | gccuuuucuu auggaccuug aaggaaaaca ggguaauuuc aaaaaucuua gggaauuugu 22140 | guuuaagaau auugaugguu auuuuaaaau auauucuaag cacacgccua uuaauuuagu 22200 | gcgugaucuc ccucaggguu uuucggcuuu agaaccauug guagauuugc caauagguau 22260 | uaacaucacu agguuucaaa cuuuacuugc uuuacauaga aguuauuuga cuccugguga 22320 | uucuucuuca gguuggacag cuggugcugc agcuuauuau guggguuauc uucaaccuag 22380 | gacuuuucua uuaaaauaua augaaaaugg aaccauuaca gaugcuguag acugugcacu 22440 | ugacccucuc ucagaaacaa aguguacguu gaaauccuuc acuguagaaa aaggaaucua 22500 | ucaaacuucu aacuuuagag uccaaccaac agaaucuauu guuagauuuc cuaauauuac 22560 | aaacuugugc ccuuuuggug aaguuuuuaa cgccaccaga uuugcaucug uuuaugcuug 22620 | gaacaggaag agaaucagca acuguguugc ugauuauucu guccuauaua auuccgcauc 22680 | auuuuccacu uuuaaguguu auggaguguc uccuacuaaa uuaaaugauc ucugcuuuac 22740 | uaaugucuau gcagauucau uuguaauuag aggugaugaa gucagacaaa ucgcuccagg 22800 | gcaaacugga aagauugcug auuauaauua uaaauuacca gaugauuuua caggcugcgu 22860 | uauagcuugg aauucuaaca aucuugauuc uaagguuggu gguaauuaua auuaccugua 22920 | uagauuguuu aggaagucua aucucaaacc uuuugagaga gauauuucaa cugaaaucua 22980 | ucaggccggu agcacaccuu guaauggugu ugaagguuuu aauuguuacu uuccuuuaca 23040 | aucauauggu uuccaaccca cuaauggugu ugguuaccaa ccauacagag uaguaguacu 23100 | uucuuuugaa cuucuacaug caccagcaac uguuugugga ccuaaaaagu cuacuaauuu 23160 | gguuaaaaac aaauguguca auuucaacuu caaugguuua acaggcacag guguucuuac 23220 | ugagucuaac aaaaaguuuc ugccuuucca acaauuuggc agagacauug cugacacuac 23280 | ugaugcuguc cgugauccac agacacuuga gauucuugac auuacaccau guucuuuugg 23340 | uggugucagu guuauaacac caggaacaaa uacuucuaac cagguugcug uucuuuauca 23400 | ggauguuaac ugcacagaag ucccuguugc uauucaugca gaucaacuua cuccuacuug 23460 | gcguguuuau ucuacagguu cuaauguuuu ucaaacacgu gcaggcuguu uaauaggggc 23520 | ugaacauguc aacaacucau augaguguga cauacccauu ggugcaggua uaugcgcuag 23580 | uuaucagacu cagacuaauu cuccucggcg ggcacguagu guagcuaguc aauccaucau 23640 | ugccuacacu augucacuug gugcagaaaa uucaguugcu uacucuaaua acucuauugc 23700 | cauacccaca aauuuuacua uuaguguuac cacagaaauu cuaccagugu cuaugaccaa 23760 | gacaucagua gauuguacaa uguacauuug uggugauuca acugaaugca gcaaucuuuu 23820 | guugcaauau ggcaguuuuu guacacaauu aaaccgugcu uuaacuggaa uagcuguuga 23880 | acaagacaaa aacacccaag aaguuuuugc acaagucaaa caaauuuaca aaacaccacc 23940 | aauuaaagau uuuggugguu uuaauuuuuc acaaauauua ccagauccau caaaaccaag 24000 | caagagguca uuuauugaag aucuacuuuu caacaaagug acacuugcag augcuggcuu 24060 | caucaaacaa uauggugauu gccuugguga uauugcugcu agagaccuca uuugugcaca 24120 | aaaguuuaac ggccuuacug uuuugccacc uuugcucaca gaugaaauga uugcucaaua 24180 | cacuucugca cuguuagcgg guacaaucac uucugguugg accuuuggug caggugcugc 24240 | auuacaaaua ccauuugcua ugcaaauggc uuauagguuu aaugguauug gaguuacaca 24300 | gaauguucuc uaugagaacc aaaaauugau ugccaaccaa uuuaauagug cuauuggcaa 24360 | aauucaagac ucacuuucuu ccacagcaag ugcacuugga aaacuucaag auguggucaa 24420 | ccaaaaugca caagcuuuaa acacgcuugu uaaacaacuu agcuccaauu uuggugcaau 24480 | uucaaguguu uuaaaugaua uccuuucacg ucuugacaaa guugaggcug aagugcaaau 24540 | ugauagguug aucacaggca gacuucaaag uuugcagaca uaugugacuc aacaauuaau 24600 | uagagcugca gaaaucagag cuucugcuaa ucuugcugcu acuaaaaugu cagagugugu 24660 | acuuggacaa ucaaaaagag uugauuuuug uggaaagggc uaucaucuua uguccuuccc 24720 | ucagucagca ccucauggug uagucuucuu gcaugugacu uaugucccug cacaagaaaa 24780 | gaacuucaca acugcuccug ccauuuguca ugauggaaaa gcacacuuuc cucgugaagg 24840 | ugucuuuguu ucaaauggca cacacugguu uguaacacaa aggaauuuuu augaaccaca 24900 | aaucauuacu acagacaaca cauuuguguc ugguaacugu gauguuguaa uaggaauugu 24960 | caacaacaca guuuaugauc cuuugcaacc ugaauuagac ucauucaagg aggaguuaga 25020 | uaaauauuuu aagaaucaua caucaccaga uguugauuua ggugacaucu cuggcauuaa 25080 | ugcuucaguu guaaacauuc aaaaagaaau ugaccgccuc aaugagguug ccaagaauuu 25140 | aaaugaaucu cucaucgauc uccaagaacu uggaaaguau gagcaguaua uaaaauggcc 25200 | augguacauu uggcuagguu uuauagcugg cuugauugcc auaguaaugg ugacaauuau 25260 | gcuuugcugu augaccaguu gcuguaguug ucucaagggc uguuguucuu guggauccug 25320 | cugcaaauuu gaugaagacg acucugagcc agugcucaaa ggagucaaau uacauuacac 25380 | auaaacgaac uuauggauuu guuuaugaga aucuucacaa uuggaacugu aacuuugaag 25440 | caaggugaaa ucaaggaugc uacuccuuca gauuuuguuc gcgcuacugc aacgauaccg 25500 | auacaagccu cacucccuuu cggauggcuu auuguuggcg uugcacuucu ugcuguuuuu 25560 | cagagcgcuu ccaaaaucau aacccucaaa aagagauggc aacuagcacu cuccaagggu 25620 | guucacuuug uuugcaacuu gcuguuguug uuuguaacag uuuacucaca ccuuuugcuc 25680 | guugcugcug gccuugaagc cccuuuucuc uaucuuuaug cuuuagucua cuucuugcag 25740 | aguauaaacu uuguaagaau aauaaugagg cuuuggcuuu gcuggaaaug ccguuccaaa 25800 | aacccauuac uuuaugaugc caacuauuuu cuuugcuggc auacuaauug uuacgacuau 25860 | uguauaccuu acaauagugu aacuucuuca auugucauua cuucagguga uggcacaaca 25920 | aguccuauuu cugaacauga cuaccagauu ggugguuaua cugaaaaaug ggaaucugga 25980 | guaaaagacu guguuguauu acacaguuac uucacuucag acuauuacca gcuguacuca 26040 | acucaauuga guacagacac ugguguugaa cauguuaccu ucuucaucua caauaaaauu 26100 | guugaugagc cugaagaaca uguccaaauu cacacaaucg acgguucauc cggaguuguu 26160 | aauccaguaa uggaaccaau uuaugaugaa ccgacgacga cuacuagcgu gccuuuguaa 26220 | gcacaagcug augaguacga acuuauguac ucauucguuu cggaagagac agguacguua 26280 | auaguuaaua gcguacuucu uuuucuugcu uucgugguau ucuugcuagu uacacuagcc 26340 | auccuuacug cgcuucgauu gugugcguac ugcugcaaua uuguuaacgu gagucuugua 26400 | aaaccuucuu uuuacguuua cucucguguu aaaaaucuga auucuucuag aguuccugau 26460 | cuucuggucu aaacgaacua aauauuauau uaguuuuucu guuuggaacu uuaauuuuag 26520 | ccauggcaga uuccaacggu acuauuaccg uugaagagcu uaaaaagcuc cuugaacaau 26580 | ggaaccuagu aauagguuuc cuauuccuua cauggauuug ucuucuacaa uuugccuaug 26640 | ccaacaggaa uagguuuuug uauauaauua aguuaauuuu ccucuggcug uuauggccag 26700 | uaacuuuagc uuguuuugug cuugcugcug uuuacagaau aaauuggauc accgguggaa 26760 | uugcuaucgc aauggcuugu cuuguaggcu ugauguggcu cagcuacuuc auugcuucuu 26820 | ucagacuguu ugcgcguacg cguuccaugu ggucauucaa uccagaaacu aacauucuuc 26880 | ucaacgugcc acuccauggc acuauucuga ccagaccgcu ucuagaaagu gaacucguaa 26940 | ucggagcugu gauccuucgu ggacaucuuc guauugcugg acaccaucua ggacgcugug 27000 | acaucaagga ccugccuaaa gaaaucacug uugcuacauc acgaacgcuu ucuuauuaca 27060 | aauugggagc uucgcagcgu guagcaggug acucagguuu ugcugcauac agucgcuaca 27120 | ggauuggcaa cuauaaauua aacacagacc auuccaguag cagugacaau auugcuuugc 27180 | uuguacagua agugacaaca gauguuucau cucguugacu uucagguuac uauagcagag 27240 | auauuacuaa uuauuaugag gacuuuuaaa guuuccauuu ggaaucuuga uuacaucaua 27300 | aaccucauaa uuaaaaauuu aucuaaguca cuaacugaga auaaauauuc ucaauuagau 27360 | gaagagcaac caauggagau ugauuaaacg aacaugaaaa uuauucuuuu cuuggcacug 27420 | auaacacucg cuacuuguga gcuuuaucac uaccaagagu guguuagagg uacaacagua 27480 | cuuuuaaaag aaccuugcuc uucuggaaca uacgagggca auucaccauu ucauccucua 27540 | gcugauaaca aauuugcacu gacuugcuuu agcacucaau uugcuuuugc uuguccugac 27600 | ggcguaaaac acgucuauca guuacgugcc agaucaguuu caccuaaacu guucaucaga 27660 | caagaggaag uucaagaacu uuacucucca auuuuucuua uuguugcggc aauaguguuu 27720 | auaacacuuu gcuucacacu caaaagaaag acagaaugau ugaacuuuca uuaauugacu 27780 | ucuauuugug cuuuuuagcc uuucugcuau uccuuguuuu aauuaugcuu auuaucuuuu 27840 | gguucucacu ugaacugcaa gaucauaaug aaacuuguca cgccuaaacg aacaugaaau 27900 | uucuuguuuu cuuaggaauc aucacaacug uagcugcauu ucaccaagaa uguaguuuac 27960 | agucauguac ucaacaucaa ccauauguag uugaugaccc guguccuauu cacuucuauu 28020 | cuaaauggua uauuagagua ggagcuagaa aaucagcacc uuuaauugaa uugugcgugg 28080 | augaggcugg uucuaaauca cccauucagu acaucgauau cgguaauuau acaguuuccu 28140 | guuuaccuuu uacaauuaau ugccaggaac cuaaauuggg uagucuugua gugcguuguu 28200 | cguucuauga agacuuuuua gaguaucaug acguucgugu uguuuuagau uucaucuaaa 28260 | cgaacaaacu aaaaugucug auaauggacc ccaaaaucag cgaaaugcac cccgcauuac 28320 | guuuggugga cccucagauu caacuggcag uaaccagaau ggagaacgca guggggcgcg 28380 | aucaaaacaa cgucggcccc aagguuuacc caauaauacu gcgucuuggu ucaccgcucu 28440 | cacucaacau ggcaaggaag accuuaaauu cccucgagga caaggcguuc caauuaacac 28500 | caauagcagu ccagaugacc aaauuggcua cuaccgaaga gcuaccagac gaauucgugg 28560 | uggugacggu aaaaugaaag aucucagucc aagaugguau uucuacuacc uaggaacugg 28620 | gccagaagcu ggacuucccu auggugcuaa caaagacggc aucauauggg uugcaacuga 28680 | gggagccuug aauacaccaa aagaucacau uggcacccgc aauccugcua acaaugcugc 28740 | aaucgugcua caacuuccuc aaggaacaac auugccaaaa ggcuucuacg cagaagggag 28800 | cagaggcggc agucaagccu cuucucguuc cucaucacgu agucgcaaca guucaagaaa 28860 | uucaacucca ggcagcagua ggggaacuuc uccugcuaga auggcuggca auggcgguga 28920 | ugcugcucuu gcuuugcugc ugcuugacag auugaaccag cuugagagca aaaugucugg 28980 | uaaaggccaa caacaacaag gccaaacugu cacuaagaaa ucugcugcug aggcuucuaa 29040 | gaagccucgg caaaaacgua cugccacuaa agcauacaau guaacacaag cuuucggcag 2910 | acguggucca gaacaaaccc aaggaaauuu uggggaccag gaacuaauca gacaaggaac 29160 | ugauuacaaa cauuggccgc aaauugcaca auuugccccc agcgcuucag cguucuucgg 29220 | aaugucgcgc auuggcaugg aagucacacc uucgggaacg ugguugaccu acacaggugc 29280 | caucaaauug gaugacaaag auccaaauuu caaagaucaa gucauuuugc ugaauaagca 29340 | uauugacgca uacaaaacau ucccaccaac agagccuaaa aaggacaaaa agaagaaggc 29400 | ugaugaaacu caagccuuac cgcagagaca gaagaaacag caaacuguga cucuucuucc 29460 | ugcugcagau uuggaugauu ucuccaaaca auugcaacaa uccaugagca gugcugacuc 29520 | aacucaggcc uaaacucaug cagaccacac aaggcagaug ggcuauauaa acguuuucgc 29580 | uuuuccguuu acgauauaua gucuacucuu gugcagaaug aauucucgua acuacauagc 29640 | acaaguagau guaguuaacu uuaaucucac auagcaaucu uuaaucagug uguaacauua 29700 | gggaggacuu gaaagagcca ccacauuuuc accgaggcca cgcggaguac gaucgagugu 29760 | acagugaaca augcuaggga gagcugccua uauggaagag cccuaaugug uaaaauuaau 29820 | uuuaguagug cuauccccau gugauuuuaa uagcuucuua ggagaaugac aaaaaaaaaa 29880 | aaaaaaaaaa aaaaaaaaaa aaa 29903 |
SEQ ID NO: 35
| <211> 33 | <212> RNA | <213> Artificial Sequence | <220> | <223> Target sequence RSE Circ chikvRSE | <400> 35 |
| agcaaauaau cuauagauca aagggcuacg caa 33 |
SEQ ID NO: 36
| <211> 294 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular ARN 1; target disruption structure comprised | in SARS-CoV-2 3′UTR replication site | <400> 36 |
| ugcaguuaga uacugcuugu guuauguggu ugugaggguu uauuuugaga uccugcuggu 60 | uacuugugcu guguaguuau gagaguuugu uuuggauacc uuuagccugc uuguguugug 120 | ugguugcgag gauuuauucu gcucggaaac gauuuguuug uguuauguag uuguggggau 180 | ucauucuggc ugcuuccucu uuauuugugu uguguaguua cgggaguucg uuuuguccca 240 | cauagaguug cuugugcuau gugguuacgg ggauuuauuu ugccagggcc aaac 294 |
SEQ ID NO: 37
| <211> 29 | <212> RNA | <213> Artificial Sequence | <220> | <223> Target sequence SL III 3′ UTR circ_wnv_slll_½ | <400> 37 |
| uuuugaggag aaagucaggc cgggaaguu 29 |
SEQ ID NO: 38
| <211> 294 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular ARN 2; target disruption structure comprised | in SARS-CoV-2 3′UTR replication site | <400> 38 |
| ugcaguuaga uacugcuugu guuauguggu ugugaggguu uauuuugaga uccugcuggu 60 | uacuugugcu guguaguuau gagaguuugu uuuggauacc uuuagccugc uuguguugug 120 | ugguugcgag gauuuauucu gcucggaaac gauuuguuug uguuauguag uuguggggau 180 | ucauucuggc ugcuuccucu uuguuugugu uguguaguua cggggguucg uuuuguccca 240 | cauagaguua cuugugcuau guaguuauga ggauucauuu ugccagggcc aaac 294 |
SEQ ID NO: 39
| <211> 294 | <212> RNA | <213> Artificial Sequence | <220> | <223> Circ Chikv_re | <400> 39 |
| gcgccgauua uggcuaaaag agucaacguu uuguaguagc ugcggguugc ccucauuacg 60 | guuaagaggg uuaauguuuu auagcagcug cccgcgagca ggauuauggu uggaaagguu 120 | aacguuuugc agcagcguuc guaacacuuc auuauggcua aggaagccaa cguuuugugg 180 | uagccuaggu ucgaaccgau uauggcuaga ggggucagcg uuuuauggua gccaucaaaa 240 | ccuuucauua cggcugagag agccaauguu uuacaguagc uccaacgacg uacu 294 |
SEQ ID NO: 40
| <211> 294 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA 3; target disruption structure comprised | in SARS-CoV-2 3′UTR replication site | <400> 40 |
| ugcaguuaga uacugcuugu guuauguggu ugugaggguu uauuuugaga uccugcuggu 60 | uguuugugcu auguaguuac gaggguucau uuuggauacc uuuagccugc uuguguugug 120 | ugguugcgag gauuuauucu gcucggaaac gauuuguuug uguuauguag uuguggggau 180 | ucauucuggc ugcuuccucu cugcuugugc uguguaguua ugagaguuug uuuuguccca 240 | cauagaguua uuuguguugu guaguugugg gaguuuguuu ugccagggcc aaac 294 |
SEQ ID NO: 41
| <211> 294 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA 4; target disruption structure comprised | in SARS-CoV-2 3′UTR replication site | <400> 41 |
| ugcaguuaga uauuguuugu gcuauguggu uguggggauu cauucugaug ucguauuguu 60 | ugcuuguguu gugugguuac gggaauuugu uuugaacucu uaguuguugu uugugcugug 120 | uaguuguggg gguuuguucu gauguucuga ucuuuguuug uguuauguag uuacgaggau 180 | uuauucuggu gcaacaaguu cuauuugugu uaugugguug cggggguucg uuuugcccgg 240 | ccuucgcuua cuuguguugu guaguuguga ggauucguuu uggaugcauc gaac 294 |
SEQ ID NO: 42
| <211> 294 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA 5; target disruption structure comprised | in SARS-CoV-2 3′UTR replication site | <400> 42 |
| ugcaguuaga uacuauuugu gcuauguagu ugcggggguu uguuuugugg cuuucuuacc 60 | uguuuguguu augugguugu gaggauuugu uuuggccgac ucguuccugc uugugcugug 120 | uaguuguggg aguucauuuu guucagaguu agccuacuug uguuauguag uuaugagagu 180 | ucguuuugga gagacgcaca cuguuugugu ugugugguua uggggauucg uuuugugggu 240 | ccggcuccug uuugugcugu gugguuauga gaauuuguuc ugaagauuua uucc 294 |
SEQ ID NO: 43
| <211> 292 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA 1; target disruption structure comprised | in SARS-CoV-2 5′UTR (SIII) | <400> 43 |
| ugcaguuaga uaagaucugc aggggguuga ggguugguug auccaggcug cuagaucuau 60 | aagggguugg gaguugguuc uuuagcuauc ccagauuugu gagggguugg ggguugguua 120 | ggcuuacagu uaagaucuau gggagguugg agguugguua ccgccgaguu auagauuuau 180 | aggggaucgg aaguugguua aagcuagggc gaagaucugc gggggguugg aaguugguua 240 | uacaacgaau uaagauuuau ggggggucgg ggguugguuu aguaguugga ug 292 |
SEQ ID NO: 44
| <211> 292 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA 2; target disruption structure comprised | in SARS-CoV-2 5′UTR (SIII) | <400> 44 |
| ugcaguuaga uaggaucuau aagggguugg aaguugguua uguggucgcg cgaggucugu 60 | aagagauuga aaguugguug ucacugacgu aaagauuuac gagagaucga ggguugguug 120 | aaugucgguc ugggguuugu gggggguugg agguugguua uugguauaac ggaggucuau 180 | gagagguuga ggguugguuc gcgauagaca ccgggucugc aggaggucgg aaguugguua 240 | guugaacaga cuggguuuau ggggggucga gaguugguua uuuguuccga gg 292 |
SEQ ID NO: 45
| <211> 292 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA 3; target disruption structure comprised | in SARS-CoV-2 5′UTR (SIII) | <400> 45 |
| ugcaguuaga uaagguuugc gagggauugg aaguugguug aaauguggaa ggggauuugc 60 | gagagguuga aaguugguuu uuauuaaagg uaggaucuac aagggauuga agguugguua 120 | cccaguagcu caggguuuac aggaggucgg agguugguuu uucuggauag aaaggucuau 180 | aagagguuga ggguugguuu ggagauugua acggauuuau gagagaucga gaguugguua 240 | aaaacaagga acggauuuac aagggguugg ggguugguua uacuuagcgg ug 292 |
SEQ ID NO: 46
| <211> 282 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA 1; target hybridization region: | SARS-CoV-2 Target A | <400> 46 |
| ugcaguuaga uauggugcug ugucgucguc uauucuaagu uugggagauc cugcuggugg 60 | uauuauguua cugucuguuc uaaauuugag gauaccuuua gcuggugucg uguuauuguc 120 | uguuuuggac uuaggcucgg aaacgauugg uacuguguca cugucuguuu uaggcuugaa 180 | gcugcuuccu cuugguguua ugucaucguc uauuuugaac uuggguccca cauagagugg 240 | uaccaugucg uugucuguuc uggauuuaaa ccagggccaa ac 282 |
SEQ ID NO: 47
| <211> 282 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA 2; target hybridization region: | SARS-CoV-2 Target A | <400> 47 |
| ugcaguuaga uaugguacug ugucacuguc uguucugaac uugagcguuc acgucucugg 60 | ugcuauguug ucgucuauuc uaaacuuaag aacuagguau aguggugucg uguuaucguc 120 | uauuuugggc uugggggcuc cccuuggugg uaccauguca ccgucuauuc ugaauuuaaa 180 | ucucccauag ugugguaucg uguugccguc uauuuuagac uuggaccacc gucuguuugg 240 | uacuauguug cugucuguuu ugaacuugag aucagauuaa gg 282 |
SEQ ID NO: 48
| <211> 282 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA 3; target hybridization region: | SARS-CoV-2 Target A | <400> 48 |
| ugcaguuaga uaugguaccg ugucgucguc uauuuuggau uuaaaagauc cugcuggugg 60 | uauuaugucg uuguuuguuc ugaguuuaaa gauaccuuua gcugguacca uguuaccguc 120 | uguucuaagu uuaaacucgg aaacgauugg uauuguguug ucguuuguuc uagauuuaaa 180 | gcugcuuccu cuugguaucg ugucgccguc uauucugagc uuaaauccca cauagagugg 240 | uacuauguug uugucuauuu ugaguuuaaa ccagggccaa ac 282 |
SEQ ID NO: 49
| <211> 282 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA 4; target hybridization region: | SARS-CoV-2 Target A | <400> 49 |
| ugcaguuaga uaugguaccg ugucgccguu uguucugagc uuaaaguucu ugcgcucugg 60 | uaucauguug cuguuuauuc uaggcuuaaa ucggccgucu ggugguauug ugucguuguc 120 | uguucugagu uuaaaucucu uucccggugg uacuguguug ucgucuauuc uggguuuaaa 180 | acucgacccc ggugguacca ugucaccguc uguuuuagac uuaaaguuac aagucgcugg 240 | uauuauguug cugucuauuc uagauuuaaa auucccccag cc 282 |
SEQ ID NO: 50
| <211> 299 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA 1; target hybridization region: | SARS-CoV-2 Target C | <400> 50 |
| ugcaguuaga uauagaggcc uugguggcag guuucuuggu gaagugagua uaguagaggu 60 | cuuaguagca gguuuuuuag ugauguaacc uauguagaag ccucagcagc agauuucuug 120 | gugggggguc aaggguaggg gucuuggugg uagauuuuuu gguggcacuu gaggaguagg 180 | aguuucggcg guggauuucu uagugggcua ggaaauuugg gagcuuuggu gguagguuuu 240 | uuggugaggu gggaggguug ggggcuucgg uagcggauuu uuuaguggaa cugaaagcg 299 |
SEQ ID NO: 51
| <211> 292 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA 2; target hybridization region: | SARS-CoV-2 Target C | <400> 51 |
| ugcaguuaga uauaggaguu ucggcggcgg guuuuuuggu gaaaguugaa uuuagaaguu 60 | ucgguggcgg guuucuuagu gagaaauuca gauagaaguu uuggcagugg auuucuuggu 120 | gaggaauggg uuuggaagcc uugguagugg auuuuuuagu ggccacccuu gguagaagcu 180 | uuggugguag auuuuuuggu ggguaacuua auugggaguu uugguggcag guuuuuuagu 240 | gauaggagac cguagggguu ucagcaguag auuucuuagu gggagacaga cu 292 |
SEQ ID NO: 52
| <211> 292 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA 3; target hybridization region: | SARS-CoV-2 Target C | <400> 52 |
| ugcaguuaga uauaggaguc ucggcagcgg auuuuuuagu ggacaugacu uuuagaggcc 60 | uugguagcgg auuucuuagu ggucuacagc gaugggaguu uuggcggugg guuuuuuggu 120 | gaccucuaau guuggaggcu ucagcagcag guuuuuuagu gauaagagua gguaggggcc 180 | uuaguagcag auuucuuggu gggauucgaa uuuagagguu uuaguaguag guuucuuagu 240 | gaagggcuuu auuggggguu uuagcggcag auuuuuuggu ggauucgauc ug 292 |
SEQ ID NO: 53
| <211> 292 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA 4; target hybridization region: | SARS-CoV-2 Target C | <400> 53 |
| ugcaguuaga uauggaaguu uuggcagugg guuucuuagu ggugggacuu gauagaaguc 60 | uuagugguag guuucuuggu ggggcggagu guuggaggcu uugguagcgg guuuuuuagu 120 | ggggcuaucu cgugggaguc uugguaguag auuucuuggu gaaggaugcg gguggaaguc 180 | uuagcggcgg auuuuuuggu ggccaguuag uauggggguu uugguagcag guuuuuuggu 240 | gauaguagac ucuggaggcu ucgguagcag auuuuuuagu gaguuauaaa gg 292 |
SEQ ID NO: 54
| <211> 270 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA 1; target hybridization region: | SARS-CoV-2 Target D | <400> 54 |
| ugcaguuaga uaaaaccgua agcagccugu agaagguaga cgaguccaga cguacaaacc 60 | guaggcagcu ugcagaagau agacgaagaa cgaguacuaa accgugggca guuugcgggg 120 | gauagacgaa gcuuggagac uaaaccguaa guagucugug ggggauggac gaauuucugg 180 | caauaaaccg uagguaguuu gcagagggua gacgagcucg uagcuagaaa ccgugaguag 240 | ccuguagagg auggacgacu gagaccucaa 270 |
SEQ ID NO: 55
| <211> 270 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA 2; target hybridization region: | SARS-CoV-2 Target D | <400> 55 |
| ugcaguuaga uaaaaccgua ggcagccugu aggagguaga cgaguuuucu cacggaaacc 60 | guggguagcu uguaggagau agacgaguug aggaccagaa accguaagug guuugcagga 120 | gauggacgag uuugggcagu uaaaccguga gcagucugca ggggguagac gaauguucgg 180 | agcaaaaccg ugaguaguuu guagaaggug gacgagagga gaguaggaaa ccguaagcag 240 | ucuguagggg auggacgauu uauaaucagu 270 |
SEQ ID NO: 56
| <211> 270 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA 3; target hybridization region: | SARS-CoV-2 Target D | <400> 56 |
| ugcaguuaga uaaagccgug agcggcuugu ggaagauaga ugaaaggauu ggaaaagacc 60 | guaagcagcu uguagaagau gggugacaag uaauggaaaa auuguaagug gucugcggaa 120 | ggugggugga uaaggaacuu gagaucguag guaguuugua gaggguaggu gggacuaugg 180 | ggaugaacug ugggcggucu gcaggaggug gacgagagag guacauaaga ccguaaguag 240 | uuuguggggg augggcgaug uauugcacac 270 |
SEQ ID NO: 57
| <211> 270 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA 4; target hybridization region: | SARS-CoV-2 Target D | <400> 57 |
| ugcaguuaga uaaagccgug agcggcuugu ggaagauaga ugaaaggauu ggaaaagacc 60 | guaagcagcu uguagaagau gggugacaag uaauggaaaa auuguaagug gucugcggaa 120 | ggugggugga uaaggaacuu gagaucguag guaguuugua gaggguaggu gggacuaugg 180 | ggaugaacug ugggcggucu gcaggaggug gacgagagag guacauaaag ccguaaguag 240 | cuuguagggg auagauggug uauugcacac 270 |
SEQ ID NO: 58
| <211> 27 | <212> RNA | <213> Artificial Sequence | <220> | <223> SARS-CoV-2 target hybridization region - comprised in | 5′UTR SLII | <400> 58 |
| aaccaacuuu cgaucucuug uagaucu 27 |
SEQ ID NO: 59
| <211> 33 | <212> RNA | <213> Artificial Sequence | <220> | <223> SARS-CoV-2 target hybridization region - Target A | <400> 59 |
| uuuaaguuua gaauagacgg ugacauggua cca 33 |
SEQ ID NO: 60
| <211> 30 | <212> RNA | <213> Artificial Sequence | <220> | <223> SARS-CoV-2 target hybridization region - Target C | <400> 60 |
| ucacuaagaa aucugcugcu gaggcuucua 30 |
SEQ ID NO: 61
| <211> 31 | <212> RNA | <213> Artificial Sequence | <220> | <223> SARS-CoV-2 target hybridization region - Target D | <400> 61 |
| ucgucuaucu ucugcaggcu gcuuacgguu u 31 |
SEQ ID NO: 62
| <211> 35 | <212> RNA | <213> Artificial Sequence | <220> | <223> SARS-CoV-2 target hybridization region - comprised in | 3UTR Replication Site | <400> 62 |
| cagaaugaau ucucguaacu acauagcaca aguag 35 |
SEQ ID NO: 63
| <211> 289 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA against WNV and DENV (circWD1-in vitro) | <400> 63 |
| ugcaguuaga uaugcaguua gauaauauug ggaggugugu uuuuugccuu uuuccguaga 60 | uccucgcgaa acuucuuggc cugguuuucu uuucaaaaga guccuuacgu auauuggagg 120 | guguguuuuu cgcuuuuuuc cgucucggaa acgauaacuu ccuggcuuga uuuuuucuuc 180 | aaaagcugcg uuaucuauau ugagaggcgu guuuuucguc uuuuuccguu ccaaccugga 240 | gaacuuuuug gccugauuuu cucuucaaaa ccaggccgua ccgacaguc 289 |
SEQ ID NO: 64
| <211> 307 | <212> RNA | <213> Artificial Sequence | <220> | <223> Artificial circular RNA against HCV (circHCV-in vitro) | <400> 64 |
| ugcaguuaga uacccccugg ggcucugaug aggaaccucu cugggguccc cacagcgagu 60 | cuccuugggg ccccuagaau gaaguucuuu gggguuucau agcacgguuc uccugggguu 120 | uucauacgau ugucucuugg ggucuugcgu guuuacccuu uugggguccu gcuaaggggg 180 | cuuucugggg ccuuucgaau aagucuuuuu ggggccucgu uuuaucacuc uucugggguu 240 | cccagccuuu cccuucuugg ggcuccuccg accaugcccc uugggguucu acccuguaug 300 | gacaguc 307 |
>SEQ ID 65
| CCCGGTTCCGCACTACTTGTGCTGTGTAGTTACGAGGATTCGTTCTGACC | GTGTCTTCGCTATTTGTGCTATGTAGTTATGGGAGTTTATTCTGCTGCTC | GTGGACCTACTTGTGTTATGTAGTTGTGGGAGTTCGTTCTGGGGCAGTTC | GCTCTATTTGTGCTGTGTGGTTGCGGGGGTTCATTTTGATCCCGATAAGC | CTACTTGTGTTGTGTAGTTATGAGGGTTTGTTTTGACCATACGACAGCTA | CTTGTGCTATGTGGTTGTGAGGATTCATTCTGGACAGTC |
>SEQ ID 66
| CCCGGTTCCGCAAGATTTGTAGGAGGTCGAAAGTTGGTTTACAACGCTAC | TGGGGTCTACAGGAGGTTGAAGGTTGGTTGTCATAATGCAGTGGATCTAC | AGGGGGTCGAGAGTTGGTTGCCGCCATTCACAGGGTCTGCAGGGGGTCGG | AAGTTGGTTAGCAGATGTTTGAAGGTCTACGAGAGATTGGGGGTTGGTTA | GGCTCGGAAGAAAGATTTATAGGGGGTTGGAGGTTGGTTCCAGTCAGTTT | ACGGATCTACAAGGGGTTGGGAGTTGGTTGACAGTC |
>SEQ ID 67
| CCCGGTTCCGCAAGATTTGTAGGAGGTCGAAAGTTGGTTTACAACGCTAC | TGGGGTCTACAGGAGGTTGAAGGTTGGTTGTCATAATGCAGTGGATCTAC | AGGGGGTCGAGAGTTGGTTGCCGCCATTCACAGGGTCTGCGAGAGGTCGG | AAGTTGGTTAGCAGATGTTTGAAGGTCTACGAGAGATTGGGGGTTGGTTA | GGCTCGGAAGAAAGATTTATAGGGGGTTGGAGGTTGGTTCCAGTCAGTTT | ACGGATCTACAAGGGGTTGGGAGTTGGTTGACAGTC |
>SEQ ID 68
| CCCGGTTCCGCATGGTATTGTGTTACCGTCTATTTTAAGCTTAAGGCCCC | CAAACTAGTTGGTGCCGTGTTGCCGTCTGTTCTAAGCTTAAGCTCGATCC | CGTGTTTGGTGCTATGTCACCGTCTATTCTAGACTTAGGCCGTCACTATC | ATTTGGTGTTGTGTTATTGTCTATTTTGGACTTGAACATGATTACACAAC | TGGTATCGTGTTGTCGTCTGTTTTAGACTTAGGTCGCTTTTCTTTCCTGG | TACCATGTCGCCGTCTGTTTTGGGCTTGAGGACAGTC |
>SEQ ID 69
| CCCGGTTCCGCATGGTATTATGTTGCCGTCTATTCTGGACTTAAACATTC | CGTCATAGCTGGTGTCGTGTTATCGTCTATTCTAAACTTGAGGTCACAGT | CGAACCTGGTGCTATGTCGTTGTCTGTTCTGGGTTTAAGCTACTTTTTCA | TGATGGTACTGTGTTACTGTCTGTTCTAGACTTGGGCGAGCAGAGATCTT | TGGTACTATGTCACCGTCTATTTTAAGCTTGGGATTAAAGCACCTGGTGG | TACCGTGTCGCTGTCTATTTTGGGCTTAGAGACAGTC |
>SEQ ID 70
| CCCGGTTCCGCATGGTATTATGTTATTGTTTGTTCTGGGCTTAAAGAAGT | ACCATTAGGTGGTATCGTGTTGTTGTTTATTCTAGATTTAAAGACCTGGG | GGCATCTGGTACTGTGTTGTCGTCTATTTTAGACTTAAAGTGGGCGATCG | AGTTGGTACCATGTCATCGTTTATTTTAGGCTTAAACACAGATTCGCCTC | TGGTACTATGTCGCCGTTTATTTTGGGTTTAAATATGCGTGGAGCAATGG | TATCATGTTACCGTCTATTTTGAACTTAAAGACAGTC |
>SEQ ID 71
| CCCGGTTCCGCATAGGGGCCTTGGCAGTAGGTTTTTTAGTGGAGTAGCCA | TTTAGGGGTTTCAGTGGTAGATTTCTTAGTGGAACCATATTGTAGGAGTC | TCGGTAGTGGATTTCTTGGTGAATCGCTTGGCTGGAAGCCTTAGTAGCAG | GTTTTTTGGTGGCAGCTAAGCATAGAGGCCTCGGTAGTAGATTTTTTAGT | GATCGTAGAGGATAGGGGCTTTGGCAGCAGATTTTTTGGTGGGAGATTGC | CTTAGGAGCCTCGGCAGCAGGTTTCTTGGTGAGACAGTC |
>SEQ ID 72
| CCCGGTTCCGCATAGGAGCCTTAGCGGTAGGTTTCTTAGTGAACTATTAT | TTTAGAAGCTTTAGTAGCGGATTTTTTGGTGGTTTTTATAACTGGAGGTT | TCAGTGGCAGGTTTTTTAGTGGAGGAGTGAGCTGGAAGTCTCGGTAGCAG | GTTTTTTGGTGATGGCATTGACTGGAAGTCTTGGCGGTAGATTTCTTGGT | GAGTCTCACCGATGGAAGTTTCAGCGGCGGGTTTCTTGGTGGTGAATGAA | CTTAGGGGCTTCAGCGGCGGATTTCTTAGTGGGACAGTC |
SEQ ID NO.:73
| 5′-FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1-3′ |
SEQ ID NO.:74
| 5′-GACCCCAAAATCAGCGAAAT-3′ |
SEQ ID NO.:75
| 5′-TCTGGTTACTGCCAGTTGAATCTG-3 |
SEQ ID NO.: 76,
| CUCCGCCAUGAAUCACUCCCCUGUGAGGAACUACUGUCUUCACGCAGAAA | GCGCCUAGCCAUGGCGUUAGUAUGAGUGUCGUACAGCCUCCAGGCCC |
SEQ ID NO. : 77
| UCUCGUAGACCGUGCACCAUGAGCACAAAUCCU |
SEQ ID NO. : 78;
| CCAAAAGAAACACCAACCGUCGCCCAGAAGACGUUAAGUUCCCGGGCGGC | GG |
SEQ ID NO.: 79;
| GAUCGUUGGCGGAGUAUACUUGUUGCCGCGCAGGGGCCCCAGGUUGGGUG | UGCGCACGACAAGGAAAACUUCGGAGCGGUC |
SEQ ID NO.: 80,
| AUGGCUGCGUGAGACACACGUAGCCUACCAGUUUCUUACUGCUCUACUCU | GCAAAGCAAGAGAUUAAUAA |
SEQ ID NO.: 81,
| AGCAAAUAAUCUAUAGAUCAAAGGGCUACGCAACCCCUGAA |
SEQ ID NO.: 82,
| UGUCUGAGACUCUUACCAUGCUGCUGUAAAACGUUGGCUUUUUUAGCCGU AAUGAGCGUCGGUGCCCAC |
SEQ ID NO.: 83,
| UUUUGAGGAGAAAGUCAGGCCGGGAAGUUCCCGCCACCGGAAGUUGAGUA | GACGGUGCUGCCUGCGA |
SEQ ID NO.: 84,
| CAGAAUGAAUUCUCGUAACUACAUAGCACAAGUAGAUGUAGUUAACUU |
SEQ ID NO.: 85,
| CUUUAAGUUUAGAAUAGACGGUGACAUGGUACCACAUAUAUCACGUCAAC | GUCUUA |
SEQ ID NO.: 86
| UCACUAAGAAAUCUGCUGCUGAGGCUUCUAAGAAGCCCUCGGCAAA |
SEQ ID NO.: 87,
| UCGUCUAUCUUCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGCAGCGAU |
>SEQ ID 88
| CCCGGTTCCGCACTACTTGTGTTATGTAGTTACGAGGATTCGTTTTGCTC | TTTTCTCCCTTATTTGTGTTGTGTAGTTATGGGAGTTTGTTCTGGCGTGG | TACGTCTTACTTGTGTTGTGTGGTTATGAGAGTTCATTCTGTATCACCAC | TAGCTGCTTGTGCTGTGTAGTTATGAGGATTTATTCTGGAATACCGTTCC | CTGTTTGTGCTGTGTGGTTATGGGAGTTCGTTCTGTGAGGTGTTCCACTG | CTTGTGCTATGTGGTTACGAGAATTTGTTTTGGACAGTC |
>SEQ ID 89
| CCCGGTTCCGCACTACTTGTGCTGTGTAGTTACGAGGATTCGTTCTGACC | GTGTCTTCGCTATTTGTGCTATGTAGTTATGGGAGTTTATTCTGCAACCA | GTGGACCTACTTGTGTTATGTAGTTGTGGGAGTTCGTTCTGGGGCAGTTC | GCTCTATTTGTGCTGTGTGGTTGCGGGGGTTCATTTTGATCCCGATAAGC | CTACTTGTGTTGTGTAGTTATGAGGGTTTGTTTTGACCATACGACAGCTA | CTTGTGCTATGTGGTTGTGAGGATTCATTCTGGACAGTC |
We have designed and tested four circRNAs (circ_hcv_ires1 (SEQ ID NO.: 2), circ_hcv_cds1 (SEQ ID NO.: 4), circ_hcv_cds2 (SEQ ID NO.: 6) y circ_hcv_combo1 (SEQ ID NO.: 5) against two different regions of HCV genome (see SEQ ID NO.: 1) as previously disclosed in the section Production of circRNAs. Circ_hcv_ires1 contains 7 hybridization sites of length 33 nucleotides that target a sequence in the IRES element. Circ_hcv_cds1 contains 8 hybridization sites of length 28 nucleotides that target a sequence in the coding region. Circ_hcv_cds2 contains 12 hybridization sites that target a sequence in the coding region. Circ_hcv_combo1 contains 3 hybridization sites per target region (IRES1 (SEQ ID NO.: 25), IRES2 (SEQ ID NO.: 26) and cHP (CDS1) (SEQ ID NO.: 27)). The target regions in the HCV genome are depicted in FIG. 6 and SEQ ID NO.: 1. Both IRES1 (domain IV) and IRES2 (domain V) target disruption structures were considered SRVVLC in C Romero-López et al. 2007 (Cell Mol Life Sci . 2007 Nov;64(22):2994-3006. doi: 10.1007/s00018-007-7345-y) https://pubmed.ncbi.nlm.nih.gov/17938858/. Both CDS1 (cHP) and CDS2 (SL427) target disruption structures were considered SRVVLC in Pirakitikulr et al. 2016 (Molecular Cell 62, 111-120 Apr. 7, 2016 a2016 Elsevier Inc. http://dx.doi.org/10.1016/j.molcel.2016.01.024).
Cell Cultures and TransfectionWe transfected each circRNA in Huh7 cells and 24h post-transfection we infected the cells with an HCV derivative that expresses luciferase. After 48 hours post-infection, we measured the luciferase levels and compared the values to a control (mock transfected). We carried out five biological replicates for each condition. All circRNAs tested inhibit HCV infection by a significant amount. As shown in FIG. 7 all circRNAs designed are capable of lowering the infection with different efficiencies that range between 30% and 70% with respect to the control.
Example 2We have designed and tested three circRNAs (circ_dv_3utr (SEQ ID NO.: 8), circ_dv_cHP_v1 (SEQ ID NO.: 9) and circ_dv_cHP_v2 (SEQ ID NO.: 10)) against two different regions of DENV (Dengue) genome (SEQ ID NO.: 7) as previously disclosed in the section Production of circRNAs. Plasmid to generate DENV (pFK-DVs-R2A) carrying the Renilla luciferase reporter gene has been previously described (Scaturro, P. et al. Characterization of the mode of action of a potent dengue virus capsid inhibitor. J. Virol. 88, 11540-55 (2014)). All three circRNAs contain 7 hybridization regions that target the corresponding regions in the DENV genome (See FIG. 8 and SEQ ID NO.: 7). The target disruption structure corresponding to circ_dv_3utr (sHP) was considered SRVVLC in Huber et al. 2019 (Nature Communications volume 10, Article number: 1408 (2019)), and the target disruption structure cHP was considered SRVVLC in Fernández-Sanlés et al. 2017 (Front Microbiol. 2017; 8: 546,doi:10.3389/fmicb.2017.00546).
Cell Cultures and TransfectionThe human embryonic kidney cell line HEK293 was maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine serum (FBS) and 10% non-essential amino acids. Cells were grown in an incubator with 5% CO2 at 37° C. 1 105 HEK293 cells/well were seeded in 24-well plates the day before transfection. 2 micrograms of each plasmid containing the cirRNAs or the empty plasmid were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions. After overnight incubation, DMEM medium was removed and cells were washed with 1X PBS. Cells were inoculated with Dengue Virus for 4 h at 37° C. Finally, the virus containing media was replaced with fresh media. Forty-eight hours post infection, Luciferase activity was assayed. Cells were washed with 1X PBS, lysed in 150 µl of Renilla lysis buffer and frozen. Upon thawing, lysates were resuspended by pipetting. 4 µl of the lysates were mixed with 20 µl of Renila Luciferase Assay Buffer and 1/200 of substrate from the Renilla Luciferase assay system (Promega) and measured immediately in a luminometer for 2 s. Mean relative light units (RLU) were plotted as percentage relative to control infections (cells transfected with the circoVIR plasmid).
Results are shown in FIG. 9 and depict the significant inhibition of DENV infection with respect to the control (empty plasmid).
Example 3We have designed and tested five circRNAs (chikv_5utr1 (SEQ ID NO.: 12), chikv_5utr2 (SEQ ID NO.: 13), chikv_RSE1 (SEQ ID NO.: 14), chikv_RSE2 (SEQ ID NO.: 15) and chikv_RE (SEQ ID NO.: 39) against three different regions of CHIKV (Chikungunya) genome (SEQ ID NO.: 11) as previously disclosed in the section Production of circRNAs. The plasmid to generate CHIKV carrying the reporter gene of Gaussian luciferase (kindly provided by Dr. Merits, University of Tartu, Estonia) is based directly on the viral sequence isolated from a human patient from La Reunion (isolate LR2006_OPY1 (DQ443544). All five circRNAs contain 6 hybridization regions that target the corresponding regions in the CHIKV genome (SEQ ID NO.: 11). Both the target disruption structure en the 5′ UTR of CHIKV and the target disruption structure “Repetitive Sequence Structure” were considered SRVVLC in Hossain Khan et al., 2002 (Journal of General Virology (2002), 83, 3075-3084). The Recoding Element, third target disruption structure for CHIKV, was considered SRVVLC in A. Kendra et al., 2018 (J. Biol. Chem. (2018) 293(45) 17536 -17545).
Cell Cultures and TransfectionThe human embryonic kidney cell line HEK293 was maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine serum (FBS) and 10% non-essential amino acids. Cells were grown in an incubator with 5% CO2 at 37° C. 1 105 HEK293 cells/well were seeded in 24-well plates the day before transfection. 2 micrograms of each plasmid containing the cirRNAs or the empty plasmid were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions. After overnight incubation, DMEM medium was removed and cells were washed with 1X PBS. Cells were inoculated with Chikungunya Virus for 1 h at 37° C. Finally, the virus containing media was replaced with fresh media. Sixteen hours post infection, Luciferase activity was assayed. The supernatant of the cells was collected and inactivated with UV for 10 minutes. 4 µl of the supernatant were mixed with 20 µl of Renila Luciferase Assay Buffer and 1/200 of substrate from the Renilla Luciferase assay system (Promega) and measured immediately in a luminometer for 2 s. Mean relative light units (RLU) were plotted as percentage relative to control infections (cells transfected with the circoVIR plasmid).
Results are shown in FIG. 10 and depict the significant inhibition of CHIKV infection with respect to the control (empty plasmid).
Example 4We have designed and tested three circRNA (DENV1 cHP_ HCV CDS2_1 (SEQ ID NO.: 17), DENV cHP_ HCV CDS2_2 (circ_dv_cHP_v1_circ_hcv_cds2_2, SEQ ID NO.: 32), and (DENV1 cHP_ HCV CDS2_T (SEQ ID NO.: 16) against one region of DENV (Dengue) genome (SEQ ID NO.: 7) and one region of HCV genome (SEQ ID NO.: 1) as previously disclosed in the section Production of circRNAs. Plasmid to generate HCV (pFK-Luc-Jc1) carrying the Firefly luciferase reporter gene has been previously described (Wakita T et al., Production of infectious hepatitis C virus in tissue culture from a cloned viral genome, Nat Med, 2005;11:791-796). Plasmid to generate DENV (pFK-DVs-R2A) carrying the Renilla luciferase reporter gene has been previously described (Scaturro, P. et al., Characterization of the mode of action of a potent dengue virus capsid inhibitor, J. Virol. 88, 11540-55 (2014)).
The first 2 circRNAs contain 6 hybridization regions that target the corresponding regions in the DENV genome and the HCV genome, and the last one contains 7 against DENV and 12 against HCV.
Cell Cultures and TransfectionThe human embryonic kidney cell line HEK293 was maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine serum (FBS) and 10% non-essential amino acids. Cells were grown in an incubator with 5% CO2 at 37° C. 1 105 HEK293 cells/well were seeded in 24-well plates the day before transfection. 2 micrograms of each plasmid containing the cirRNAs or the empty plasmid were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions. After overnight incubation, DMEM medium was removed and cells were washed with 1X PBS. Cells were inoculated with Dengue Virus for 4 h at 37° C. Finally, the virus containing media was replaced with fresh media. Forty-eight hours post infection, Luciferase activity was assayed. Cells were washed with 1X PBS, lysed in 150 µl of Renilla lysis buffer and frozen. Upon thawing, lysates were resuspended by pipetting. 4 µl of the lysates were mixed with 20 µl of Renila Luciferase Assay Buffer and 1/200 of substrate from the Renilla Luciferase assay system (Promega) and measured immediately in a luminometer for 2 s. Mean relative light units (RLU) were plotted as percentage relative to control infections (cells transfected with the circoVIR plasmid).
The human hepatocarcinoma cell line Huh7/Scr was maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine serum (FBS) and 10% non-essential amino acids. Cells were grown in an incubator with 5% CO2 at 37° C. 2.5 104 Huh7/Scr cells/well were seeded in 24-well plates the day before transfection. 2 micrograms of each plasmid containing the cirRNAs or the empty plasmid were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions.
After overnight incubation, DMEM medium was removed and cells were washed with 1X PBS. Cells were inoculated with the different viruses for 4 h at 37° C. Finally, the virus containing media was replaced with fresh media. Forty-eight hours post infection, Luciferase activity was assayed. Cells were washed with 1X PBS, lysed in 150 µl of Passive lysis buffer and frozen. Upon thawing, lysates were resuspended by pipetting. 50 µl of the lysates were mixed with 25 µl of Luciferase Assay Reagent (Promega) and incubated 5 minutes at room temperature. Afterwards the luciferase activity was measured in a luminometer for 2 s. Mean relative light units (RLU) were plotted as percentage relative to control infections (cells transfected with the circoVIR plasmid).
Results for each circRNA against both DENV and HCV along with the corresponding positive and negative controls from examples 1 and 2 are shown in FIGS. 11, 12, 1314 and 24. Inhibition is shown for all circRNAs in both viral infections, demonstrating the broadspectrum capabilities of the design circRNAs.
Example 5We have designed and tested two circRNAs (circ_wnv_slll_1 (SEQ ID NO.: 24), circ_wnv_slll_2 (SEQ ID NO.: 19)) against one region of WNV (West Nile Virus) genome (SEQ ID NO.: 20) as previously disclosed in the section Production of circRNAs. Plasmid to generate WNV carrying the Nanoluc luciferase reporter gene was kindly provided by Dr. Merits, University of Tartu, Estonia. Both circRNAs contain 7 hybridization regions that target the corresponding region in the WNV genome. The target disruption structure SLII was considered SRVVLC in Fernández-Sanlés et al., 2017 (Front Microbiol. 2017; 8: 546 doi: 10.3389/fmicb.2017.00546).
Cell Cultures and TransfectionThe human embryonic kidney cell line HEK293 was maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine serum (FBS) and 10% non-essential amino acids. Cells were grown in an incubator with 5% CO2 at 37° C. 1 105 HEK293 cells/well were seeded in 24-well plates the day before transfection. 2 micrograms of each plasmid containing the circRNAs or the empty plasmid were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions. After overnight incubation, DMEM medium was removed and cells were washed with 1X PBS. Cells were inoculated with WNV for 4 h at 37° C. Finally, the virus containing media was replaced with fresh media. Forty-eight hours post infection, Luciferase activity was assayed. Cells were washed with 1X PBS, lysed in 150 µl of Renilla lysis buffer and frozen. Upon thawing, lysates were resuspended by pipetting. 4 µl of the lysates were mixed with 20 µl of Renila Luciferase Assay Buffer and 1/200 of substrate from the Renilla Luciferase assay system (Promega) and measured immediately in a luminometer for 2 s. Mean relative light units (RLU) were plotted as percentage relative to control infections (cells transfected with the circoVIR plasmid).
Results are shown in FIG. 15 and depict the significant inhibition of WNV infection with respect to the control (empty plasmid).
Example 6We have designed and tested three circRNA (dchp_wslll_A (SEQ ID NO.: 21), dchp_wslll_B (SEQ ID NO.: 22) and dchp_wslll_C (SEQ ID NO.: 23) against one region of DENV (Dengue) genome (SEQ ID NO: 7) and one region of WNV genome (SEQ ID NO.: 20) as previously disclosed in the section Production of circRNAs. Plasmid to generate DENV (pFK-DVs-R2A) carrying the Renilla luciferase reporter gene has been previously described (Scaturro, P. et al., Characterization of the mode of action of a potent dengue virus capsid inhibitor, J. Virol. 88, 11540-55 (2014)). Plasmid to generate WNV carrying the Nanoluc luciferase reporter gene was kindly provided by Dr. Merits, University of Tartu, Estonia. The circRNAs contain 6 hybridization regions that target the corresponding regions in the DENV genome and the WNV genome.
Cell Cultures and TransfectionThe human embryonic kidney cell line HEK293 was maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine serum (FBS) and 10% non-essential amino acids. Cells were grown in an incubator with 5% CO2 at 37° C. 1x105 HEK293 cells/well and were seeded in 24-well plates the day before transfection. 2 micrograms of each plasmid containing the circRNAs or the empty plasmid were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions. After overnight incubation, DMEM medium was removed and cells were washed with 1X PBS. Cells were inoculated with Dengue Virus or West Nile Virus for 4h at 37° C. Finally, the virus containing media was replaced with fresh media. Forty-eight hours post infection, Luciferase activity was assayed. Cells were washed with 1X PBS, lysed in 150 µl of Renilla lysis buffer and frozen. Upon thawing, lysates were resuspended by pipetting. 4 µl of the lysates were mixed with 20 µl of Renila Luciferase Assay Buffer and 1/200 of substrate from the Renilla Luciferase assay system (Promega) and measured immediately in a luminometer for 2 s. Mean relative light units (RLU) were plotted as percentage relative to control infections (cells transfected with the circoVIR plasmid).
Results for each circRNA against both DENV and WNV along with the corresponding positive and negative controls from examples 2 and 5 are shown in FIGS. 16 and 17. Inhibition is shown for the circRNAs in both viral infections, demonstrating the broadspectrum capabilities of the designed circRNAs.
Example 7We tested whether circ_hcv_cds2 (SEQ ID NO.: 6) may inhibit infections already established. For this, Huh7/Scr cells were infected with HCVJc1-luc and 48 hours later transfected with circ_hcv_cds2 (SEQ ID NO.: 6). Luciferase values were measured 24 hours post-transfection. Importantly, circ_hcv_cds2 inhibited infectivity with similar efficiency as when cells were expressing the circ_hcv_cds2 before infection (FIG. 18).
Example 8Next, we examine whether the circ_hcv_cds2 (SEQ ID NO.: 6) is indeed inhibiting the function described for the target sequence, viral RNA replication. For this, we used HCV RNA replicons that harbour a luciferase reporter gene but not the viral structural genes required for encapsidation. Thus, these replicons allow efficient translation and replication of the viral RNA genome but not virion production. Huh7/Scr cells were transfected with circ_hcv_cds2 (SEQ ID NO.: 6) or the corresponding empty plasmid and the next day, transfected with the HCV replicon. Luciferase values were measured at 4 hours and 48 hours post-HCV replicon transfection. These times were selected because already established kinetics prove that luciferase production derived at 4 hours is solely from HCV RNA translation and at 48 hours from both translation and replication. Indeed, a decrease in viral infectivity was observed at 48 but not at 4 hours post-transfection (FIG. 19) indicating that circ_hcv_cds2 impairs viral RNA replication.
Example 9Circ_dv_3utr (SEQ ID NO.: 8) and circ_dv_cHP_v1 (SEQ ID NO.: 9), designed to target structures within the DENV RNA genome directing RNA replication, were tested to see if they inhibit DENV RNA replication following the same procedure as in Example 8. The results show that circ_dv_3utr and circ_dv_cHP_v1 inhibit luciferase expression levels at 48 hours when the RNA genome is translated and replicated but not at 8 hours when is solely translated (FIG. 20).
Example 10The human embryonic kidney cell line HEK293 and the Hepatocarcinoma cell line Huh7 were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine serum (FBS) and 10% non-essential amino acids. Cells were grown in an incubator with 5% CO2 at 37° C. 1x105 HEK293 cells/well or 4x104 Huh7/cells and were seeded in 24-well plates the day before transfection. 100 nanograms of circular RNAs against WNV-DENV (circWD1-in vitro SEQ ID NO.: 63) or circular RNA against HCV (circHCV-in vitro SEQ ID NO.: 64) were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions. After overnight incubation, DMEM medium was removed and cells were washed with 1X PBS. HEK293 cells were inoculated with Dengue Virus or West Nile Virus for 4 h at 37° C. In parallel, Huh7 cells were inoculated with Hepatitis C virus for 4h at 37° C. Finally, the virus containing media was replaced with fresh media. Forty-eight hours post infection, Luciferase activity was assayed. Cells were washed with 1X PBS, lysed in 150 µl of Renilla lysis buffer (HEK293) or 150 µl of Passive lysis buffer and frozen. Upon thawing, lysates were resuspended by pipetting. In the case of DENV and WNV, 4 µl of the lysates were mixed with 20 µl of Renila Luciferase Assay Buffer and 1/200 of substrate from the Renilla Luciferase assay system (Promega) and measured immediately in a luminometer for 2 s. In the case of HCV, 50 µl of the lysates were mixed with 25 µl of Luciferase Assay Reagent (LARII) for 5 minutes and measured immediately in a luminometer for 2 s. Mean relative light units (RLU) were plotted as percentage relative to control infections (cells transfected with the circoVIR plasmid) in FIG. 26.
Example 11We have designed and tested twelve circRNA (circ_SARS_tA_4 (SEQ ID NO.: 49), circ_SARS_tA_5 (SEQ ID NO.: 68), circ_SARS_tA_6 (SEQ ID NO.: 69), circ_SARS_tA_7 (SEQ ID NO.: 70), circ_SARS_tC_3 (SEQ ID NO.: 52), circ_SARS_tC_5 (SEQ ID NO.: 71), circ_SARS_tC_6 (SEQ ID NO.: 72), circ_SARS_3utr_6 (SEQ ID NO.:63), circ_SARS_3utr_7 (SEQ ID NO.: 89), circ_SARS_3utr_8 (SEQ ID NO.:65), circ_SARS_5utr_4 (SEQ ID NO.: 66), circ_SARS_5utr_5 (SEQ ID NO.: 67) against four regions of SARS-CoV-2 genome (SEQ ID NO: 58; SEQ ID NO: 59; SEQ ID NO: 60; SEQ ID NO: 62) as previously disclosed in the section Production of circRNAs. SARS-CoV-2 strain hCoV-19/Spain/VH000001133/2020 (EPI_ISL_418860) was kindly provided by Miguel Chillon, Universitat Autonoma de Barcelona. The designed circRNAs contain between 6 and 7 hybridization regions that target the corresponding regions in the SARS-CoV-2 genome. The target disruption structure Replication Site was considered SRVVLC in J. Goebel et al., 2004 (American Society for Microbiology. Journal of VirologyVolume 78, Issue 14, Pages 7846-7851https://doi.org/10.1128/JVI.78.14.7846-7851.2004). The target disruption structure SL-2 was considered SRVVLC in Chen et al., 2010 (Virology 401 (2010) 29-41 doi: 10.1016/j.virol.2010.02.007). The rest of the target disruption structures (A,C and D) were considered to be viral conserved structures, following the RNAz approach mentioned above, in Rangan et al., 2020 (doi: https://doi.org/10.1101/2020.03.27.012906).
Example 12. Cell Cultures and TransfectionThe green monkey kidney epithelial cell line VERO E6 was maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine serum (FBS) and 10% non-essential amino acids. Cells were grown in an incubator with 5% CO2 at 37° C. 6x104 VERO E6 cells per well were seeded in 24-well plates the day before transfection. 2 micrograms of each plasmid containing the circRNAs or the empty plasmid were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions. After overnight incubation, DMEM medium was removed and cells were washed with 1X PBS. Cells were inoculated with SARS-CoV-2 for 1 h at 37° C. Finally, the virus containing media was replaced with fresh media. Forty-eight hours post infection, supernatant was collected and inactivated and viral RNA was extracted using Quick-RNA Viral Kit (Zymo Research, Irvine, USA). SARS-CoV-2 RNA levels were measured by qPCR using qScript XLT One-Step RT-qPCR ToughMix, ROX (Quanta Biosciences, Berverly, USA), using the specific probe 2019-nCoV_N1-P, 5′-FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1-3′ (SEQ ID NO.:73); as well as primers 2019-nCoV_N1-F, 5′-GACCCCAAAATCAGCGAAAT-3′ (SEQ ID NO.: 74); and 2019-nCoV_N1-R, 5′-TCTGGTTACTGCCAGTTGAATCTG-3′ (SEQ ID NO.: 75) (Biomers, Ulm, Germany). Mean relative RNA levels were plotted as percentage relative to control infections (cells transfected with the circoVIR plasmid).
Results for each circRNA against SARS-CoV-2 are shown in FIG. 33. Inhibition is shown for the circRNAs in SARS-CoV-2 viral infection, demonstrating the antiviral effect of the designed circRNAs.
Example 13The green monkey kidney epithelial cell line VERO E6 was maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine serum (FBS) and 10% non-essential amino acids. Cells were grown in an incubator with 5% CO2 at 37° C. 6x104 VERO E6 cells per well were seeded in 24-well plates the day before transfection. 100 nanograms of circular RNAs against SARS-CoV-2 (circSARS-in vitro SEQ ID NO.: 70) or circular RNA against WNV-DENV (circWD1-in vitro SEQ ID NO.: 21) were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions. After overnight incubation, DMEM medium was removed and cells were washed with 1X PBS. Cells were inoculated with SARS-CoV-2 for 1 h at 37° C. Finally, the virus containing media was replaced with fresh media. Forty-eight hours post infection, supernatant was collected and inactivated and viral RNA was extracted using Quick-RNA Viral Kit (Zymo Research, Irvine, USA). SARS-CoV-2 RNA levels were measured by qPCR using qScript XLT One-Step RT-qPCR ToughMix, ROX (Quanta Biosciences, Berverly, USA), using the specific probe 2019-nCoV_N1-P, 5′-FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1-3′ (SEQ ID NO.:73); as well as primers 2019-nCoV_N1-F, 5′-GACCCCAAAATCAGCGAAAT-3′ (SEQ ID NO.: 74); and 2019-nCoV_N1-R, 5′-TCTGGTTACTGCCAGTTGAATCTG-3′ (SEQ ID NO.: 75) (Biomers, Ulm, Germany). Mean relative RNA levels were plotted as percentage relative to control infections (cells transfected with an irrelevant circRNA) in FIG. 34.
Example 14In this example we present some of the input files for RNAiFold to both check whether a target disruption structure is indeed possible to disrupt by hybridization (from which immediately follows the design of the circRNA with the hybridization region/s to disrupt it).
For HCV target disruption structure cHP and corresponding target hybridization region (SEQ ID NO 27, highlighted in bold):
| #RNAscdstr((((((((((((((((((((((((((((&))))))))))) | ))))))))))))))))),,,,,,,,,,,,,,,,,,,,,,,,#RNAseqco | nNNNNNNNNNNNNNNNNNNNNNNNNNNNN&CCAAAAGAAACACCAACCGU | CGCCCAGAAGACGUUAAGUUCCCGGGCGGCGG |
The input “((((((((((((((((((((((((((((&)))))))))))))))))))))))))))),,,,,,,,,,,,,,,,,,,,,,,,” means that the software should look for a nucleotide sequence that is k nucleotides in length, wherein the nucleotides located at positions corresponding to a open bracket “(” should be base paired to the nucleotides located at positions corresponding to a closed bracket “)” in the Minimum Free Energy structure. The comas “,” mean that the nucleotides in the corresponding positions can be base paired or not in the Minimum Free Energy Structure. The & symbol separates both strands. Note that the base paired nucleotides on the second strand (target disruption structure) correspond to the target hybridization region.
Further, the input:
| “NNNNNNNNNNNNNNNNNNNNNNNNNNNN&CCAAAAGAAACACCAACCGU” | CGCCCAGAAGACGUUAAGUUCCCGGGCGGCGG " |
means fixes the nucleotides that are available for selection, where N means any nucleotide (A,C,G or U). In this case, the nucleotides corresponding to the target disruption structure are fixed and all the nucleotides corresponding to the hybridization region are unfixed (N- any nucleotide). The results are shown herein below:
| UCUGGGCGACGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC | GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG |
| UUUGGGCGACGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC | GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG |
| UCUGGGUGACGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC | GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG |
| UUUGGGUGACGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC | GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG |
| UCUGGGCGGCGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC | GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG |
| UUUGGGCGGCGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC | GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG |
| UCUGGGUGGCGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC | GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG |
| UUUGGGUGGCGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC | GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG |
| UCUGGGCGAUGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC | GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG |
| UUUGGGCGAUGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC | GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG |
For CHIKV target disruption structure RSE and corresponding target hybridization region (SEQ ID NO 35):
| #RNAscdstr(((((((((((((((((((((((((((((((((&)))))) | ))))))))))))))))))))))))))).#RNAseqconNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNN&AGCAAAUAAUCUAUAGAUCAAAGGGCUA CGCAACCCCUGAA |
The results are shown herein below:
| UUGCGUGGCCCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG | AUCAAAGGGCUACGCAACCCCUGAA |
| UUGUGUGGCCCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG | AUCAAAGGGCUACGCAACCCCUGAA |
| UUGCGUAGCCCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG | AUCAAAGGGCUACGCAACCCCUGAA |
| UUGUGUAGCCCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG | AUCAAAGGGCUACGCAACCCCUGAA |
| UUGCGUGGUCCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG | AUCAAAGGGCUACGCAACCCCUGAA |
| UUGUGUGGUCCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG | AUCAAAGGGCUACGCAACCCCUGAA |
| UUGCGUAGUCCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG | AUCAAAGGGCUACGCAACCCCUGAA |
| UUGUGUAGUCCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG | AUCAAAGGGCUACGCAACCCCUGAA |
| UUGCGUAGCUCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG | AUCAAAGGGCUACGCAACCCCUGAA |
| UUGUGUAGCUCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG | AUCAAAGGGCUACGCAACCCCUGAA |
For WNV target disruption structure SLII and corresponding target hybridization region (SEQ ID NO 37):
| #RNAscdstr((((((((((((((((((((((((((((&))))))))))) ))))))))))))))))),,,,,,,,,,,,,,,,,,,,,,,,#RNAseqco n NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN&UUUUGAGGAGAAAGU CAGGCCGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGC GA |
The results are shown herein below:
| GAUUUUCUGGCCUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA |
| AAUUUUCUGGCCUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA |
| GAUUUUUUGGCCUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA |
| AAUUUUUUGGCCUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA |
| GAUUUUCUGGCUUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA |
| AAUUUUCUGGCUUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA |
| GAUUUUUUGGCUUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA |
| AAUUUUUUGGCUUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA |
| GACUUUCUGGCCUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA |
| AACUUUCUGGCCUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA |
For SARS-Cov2 target disruption structure Replication Site and corresponding target hybridization region (SEQ ID NO 62):
| #RNAscdstr(((((((((((((((((((((((((((((((((((&)))) ))))))))))))))))))))))))))))))).............#RNAse qconNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN&CAGAAUGAAUUC UCGUAACUACAUAGCACAAGUAGAUGUAGUUAACUU |
The results are shown herein below:
| CUACUUGUGCUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU |
| UUACUUGUGCUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU |
| CUGCUUGUGCUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU |
| UUGCUUGUGCUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU |
| CUAUUUGUGCUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU |
| UUAUUUGUGCUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU |
| CUGUUUGUGCUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU |
| UUGUUUGUGCUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU |
| CUGCUUGUGUUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU |
| UUGCUUGUGUUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU |
In all cases, including those not depicted above, RNAiFold return multiple solutions, i.e., sequences corresponding to potential hybridization regions that shall disrupt by hybridization the corresponding target disruption structures.
Lasltly, we present herein the well-established dot bracket notation used in the present invention to obtain the target hybridization region (highlighted herein in bold) for each virus:
HCV Target 1: IRES 1 (Domain II)SEQ ID NO.: 76, FIG. 1a in Romero et al. 2007 (Cell Mol Life Sci. 2007 Nov;64(22):2994-3006. doi: 10.1007/s00018-007-7345-y.):
| CUCCGCCAUGAAUCACUCCCCUGUGAGGAACUACUGUCUUCACGCAGAAA | GCGCCUAGCCAUGGCGUUAGUAUGAGUGUCGUACAGCCUCCAGGCCC... | ................((((.((((.....(((((..(((.((...(((( | ((.......))))))....)).)))..).))))))))))))... |
SEQ ID NO. : 77, FIG. 1a in Romero et al. (Cell Mol Life Sci. 2007 Nov;64(22):2994-3006. doi: 10.1007/s00018-007-7345-y.):
| UCUCGUAGACCGUGCACCAUGAGCACAAAUCCU...........((((.. | .....))))....... |
SEQ ID NO. : 78; FIG. S1 B in Pirakitikulr et al.2016 (Pirakitikulr et al., 2016, Molecular Cell 62, 111-120 Apr. 7, 2016 Elsevier Inc):
| CCAAAAGAAACACCAACCGUCGCCCAGAAGACGUUAAGUUCCCGGGC | GGCGG ................(((((((((.(..(((.....))).. | )))))))))) |
SEQ ID NO.: 79; FIG. 2a in Pirakitikulr et al.2016 (Pirakitikulr et al., 2016, Molecular Cell 62, 111-120 Apr. 7, 2016 Elsevier Inc).
| GAUCGUUGGCGGAGUAUACUUGUUGCCGCGCAGGGGCCCCAGGUUGGGUG | UGCGCACGACAAGGAAAACUUCGGAGCGGUC(((((((..((((((...( | ((((((..(((((...((((......)))).))))).)))))))....)) | )))).))))))) |
SEQ ID NO.: 29; FIG. 1c in Huber et al., 2019 (Huber et al. Nature Communications volume 10, Article number: 1408, 2019)
| AACAGCAUAUUGACGCUGGGAAAGACCAGAGA...............((( | (......))))... |
SEQ ID NO.: 30; FIG. 2B in Sanlés et al. 2017 (Sanlés et al. 2017. Front Microbiol.; 8: 546.):
| ACGGAAAAAGGCGAAAAACACGCCUUUCAAUAU......(((((.(.... | ....))))))...... |
SEQ ID NO.: 80, FIG. 3A in Khan et al. 2002 (Khan et al. Journal Of General Virology Volume 83, Issue 12):
| AUGGCUGCGUGAGACACACGUAGCCUACCAGUUUCUUACUGCUCUACUCU | GCAAAGCAAGAGAUUAAUAA..(((((((((.....)))))))))....( | (((((((.((((........))..)).))))))))..... |
SEQ ID NO.: 81, FIG. 4B in Khan et al. 2002 (Khan et al. Journal Of General Virology Volume 83, Issue 12):
| AGCAAAUAAUCUAUAGAUCAAAGGGCUACGCAACCCCUGAA......... | ........(((..(((........))).))). |
SEQ ID NO.: 82, FIG. 4D in Kendra et al. 2018 (Kendra et al. 2018 Protein Synthesis And Degradation| Volume 293, Issue 45, P17536-17545, Nov. 09, 2018):
| UGUCUGAGACUCUUACCAUGCUGCUGUAAAACGUUGGCUUUUUUAGCCGU AAUGAGCGUCGGUGCCCAC.((((((..(((((((..(((....)))... | ....((((.....)))))))).)))..)))).)).... |
SEQ ID NO.: 83, FIG. 3 in Sanlés et al. 2017 (Sanlés et al. 2017. Front Microbiol.; 8: 546.):
| UUUUGAGGAGAAAGUCAGGCCGGGAAGUUCCCGCCACCGGAAGUUGAGUA | GACGGUGCUGCCUGCGA.............(.((((((((((...))))) | .(((((.............)))))..)))))).. |
SEQ ID NO.: 84, FIG. 1 in Goebel et al. 2004 (Goebel et al.. Journal Of Virology, July 2004, p. 7846-7851):
| CAGAAUGAAUUCUCGUAACUACAUAGCACAAGUAGAUGUAGUUAACUU.. | .............(((((((((.((....))..))))))))).... |
SEQ ID NO.: 58, FIG. 3b in Cheng Chen et al. 2010 (Cheng chen et al. Virology, Volume 401, Issue 1, 25 May 2010, Pages 29-41)
| AACCAACUUUCGAUCUCUUGUAGAUCU ...........(((((.....) | )))). |
SEQ ID NO.: 85, FIG. 2 in Rangan et al. 2020 (Rangan et al. bioRxiv preprint doi: https://doi.org/10.1101/2020.03.27.012906):
| CUUUAAGUUUAGAAUAGACGGUGACAUGGUACCACAUAUAUCACGUCAAC | GUCUUA...............(((((.((((.(((((.......))))). | )))).))))).. |
SEQ ID NO.: 86, FIG. 2 in Rangan et al. 2020 (Rangan et al. bioRxiv preprint doi: https://doi.org/10.1101/2020.03.27.012906):
| UCACUAAGAAAUCUGCUGCUGAGGCUUCUAAGAAGCCCUCGGCAAA.... | ...........((((((((((...)))).)))))))).. |
SEQ ID NO.: 87, FIG. 2 in Rangan et al. 2020 (Rangan et al. bioRxiv preprint doi: https://doi.org/10.1101/2020.03.27.012906):
| UCGUCUAUCUUCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGCAGCGAU. | ................(((((.((((......)))))..)))))... |
The present invention also comprises the following items:
1. An artificial circular RNA between 200 and 600 nucleotides having 6 to 20 hybridization regions of sizes between 10 and 50 nucleotides against one or more structured regions of one or more RNA viral genomes, wherein such hybridization regions have sequences that are different among each other, wherein the one or more structured regions are structured regions vital for the viral life cycle (SRVVLC) preceded by a single stranded region, and wherein the artificial circular RNA is capable of disrupting the structure of the one or more SRVVLC, rendering the virus less infective.
2. The artificial circular RNA of item 1, wherein the hybridization regions are:
3. The artificial circular RNA according to any of the preceding items, wherein the target of the hybridization regions is a SRVVLC of the IRES element of the viral genome.
4. The artificial circular RNA according to any of the items 1 o 2, wherein the target of the hybridization regions is a SRVVLC of the 5′UTR of the viral genome.
5. The artificial circular RNA according to any of the items 1 or 2, wherein the target of the hybridization regions is a SRVVLC of the CDS of the viral genome.
6. The artificial circular RNA according to items 1 or 2, wherein the target of the hybridization regions is a SRVVLC of the 3′UTR of the viral genome.
7. The artificial circular RNA, according to any of items 1 to 6, wherein the target of the hybridization regions is a combination of two or more of the IRES element, the region of the 5′UTR, the region of the CDS or the region of the 3′UTR of the viral genome.
8. The artificial circular RNA according to item 3 or 7, wherein said viral genome is selected from HCV, HAV, Poliovirus, Coxsackie B virus and rhinovirus (common cold).
9. The artificial circular RNA according to any of items 4 to 7, wherein said viral genome is selected from HCV, Dengue, Zika, Chikungunya, West Nile and Yellow Fever virus.
10. The artificial circular RNA according to any of items 1 to 9, wherein said circular RNA has a broad spectrum activity against two or more RNA viral genome.
11. A composition comprising the artificial circular RNA according to any of the previous items.
12. A kit comprising the artificial circular RNA according to any of items 1 to 10 or the composition according to item 11, and instructions for using said circular RNA or composition.
13. The artificial circular RNA according to any of items 1 to 10, or the composition according to item 11 or the kit according to items 12, wherein said circular RNA comprises the sequence selected from SEQ ID NO: 2, 4, 5, 6 (for HCV); 8, 9, 10 (for Dengue virus); 12, 13, 14, 15, 39 (for Chikungunya virus); 16 and 17 (Broadspectrum activity for both HCV and Dengue Virus); 24 and 19 (for West Nile Virus); 21, 22 and 23 (Broad spectrum activity for both Dengue and West Nile Viruses); 32 (Broad spectrum activity for both HCV and Dengue Virus), whrerin the one or more targets of the 6 to 20 hybridization regions is comprised in SEQ ID NO.: 1, SEQ ID NO.: 7, SEQ ID NO.: 11 and/or SEQ ID NO.: 20.
14. The artificial circular RNA according to any of items 1 to 10 or 13, or the composition according to item 11 or 13 or the kit according to item 12 or 13 for use in preventing and/or treating a viral infection.
15. The artificial circular RNA or the composition or the kit for use according to item 14, wherein said viral infection is caused by HCV, HAV, Poliovirus, Coxsackie B virus, rhinovirus (common cold), Dengue, Zika, Chikungunya, West Nile or Yellow Fever virus.
1. An artificial circular RNA suitable for disrupting by hybridization one or more target disruption structures of one or more RNA fragments,
(a) wherein the artificial circular RNA comprises between 150 and 800 nucleotides, preferably between 200 and 600 nucleotides;
(b) wherein the artificial circular RNA comprises two or more hybridization regions which:
(i) completely hybridize with at least one target hybridization region comprised in the one or more target disruption structures of the one or more RNA fragments; and
(ii) have a total of between 7 and 100 nucleotides, preferably between 10 and 50 nucleotides;
(c) wherein the one or more target disruption structures:
(i) comprises at least a hairpin loop preceded or followed by a region of unpaired nucleotides; and
(ii) comprises at least one target hybridization region which comprises a single-stranded region of at least 2 nucleotides, preferably 3 nucleotides or more preceded or followed by a double-stranded region of at least 5 nucleotides, preferably 10 nucleotides or more, wherein the at least one target hybridization region completely hybridizes with each of the two or more hybridization regions of the artificial circular RNA; and
(d) wherein the two or more hybridization regions comprised in the artificial circular RNA are further characterized because, when hybridizing with the target hybridization region, the energy of hybridization, as measured by RNAcofold, between the hybridization region and the at least one target hybridization region is more negative than the energy of the target disruption region, thereby disrupting the target disruption structure.
2. The artificial circular RNA of claim 1 wherein the artificial circular RNA comprises between 6 and 20 hybridization regions.
3. The artificial circular RNA of claim 2 wherein at least two, and preferably all, of the hybridization regions are capable of completely hybridizing with the same target hybridization region.
4. The artificial circular RNA of any one of claims 2-3 wherein at least two, and preferably all, of the hybridization regions have different nucleotide sequences.
5. The artificial circular RNA of any one of claims 2-4, wherein the 2 or more hybridization regions are:
a) separated by non-hybridization regions of sizes up to 20 nucleotides; or
b) are not separated by non-hybridization regions; or
c) are overlapping.
6. The artificial circular RNA of any one of the preceding claims, wherein the one or more RNA fragments is selected from mRNA, tRNA, rRNA, non-coding RNA and viral genomic RNA.
7. The artificial circular RNA of claim 6, wherein the one or more RNA fragments is viral genomic RNA.
8. The artificial circular RNA of claim 7, wherein the one or more RNA fragments is positive-sense single-stranded viral genomic RNA.
9. The artificial circular RNA of any of claims 6 to 7 wherein the viral genomic RNA is selected from Influenza virus, HAV, Poliovirus, Coxsackie B virus, Coronavirus and Rhinovirus (common cold).
10. The artificial circular RNA of any of claims 6 to 8, wherein the viral genomic RNA is selected from Hepatitis C virus, Dengue, Zika, Chikungunya, West Nile and Yellow Fever virus.
11. The artificial circular RNA of any of claims 6 to 8, wherein the viral genomic RNA is from Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).
12. The artificial circular RNA of any of claims 7 to 11, wherein the at least one or more target disruption structures are selected from the group consisting of:
(a) Internal Ribosome Entry (IRES) Domain IV and Domain V, capsid-coding region hairpin element (cHP) or SL427 from Hepatitis C Virus,
(b) short Stem Loop (sHP) or capsid-coding region hairpin element (cHP) from Dengue virus,
(c) 5′ untranslated region (5′UTR), Repetitive Sequence Element (RSE) or Recoding Element from Chikungunya,
(d) Stem loop III (SLIII) from West Nile, and/or
(e) SL-2, Replication site, Target A, Target C, Target D from Coronavirus, preferably from Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).
13. The artificial circular RNA according to any of claims 7 to 12, wherein the at least one or more target disruption structures comprise the target disruption structures selected from the list consisting of SEQ ID NOs.:76, 77, 78 and/or 79 from Hepatitis C virus, and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs: 25, 26, 27 and 28.
14. The artificial circular RNA according to any of claims 7 to 12, wherein the at least one or more target disruption structures comprise the target disruption structures selected from the list consisting of SEQ ID NOs.:29 and/or 30 from Dengue virus, and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs.: 29 and 30.
15. The artificial circular RNA according to any of claims 7 to 12, wherein the at least one or more target disruption structures comprise the target disruption structures selected from the list consisting of SEQ ID NOs.:80, 81 and/or 82 from Chikungunya, and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs.: 33, 35, and 31 .
16. The artificial circular RNA according to any of claims 7 to 12, wherein the at least one or more target disruption structures comprise the target disruption structure of SEQ ID NO.: 83 from West Nile and wherein the target hybridization regions is SEQ ID NO.: 37.
17. The artificial circular RNA according any of claims 7 to 12, wherein the at least one or more target disruption structures comprise the target disruption structures selected from the list consisting of SEQ ID NOs.: 84, 58, 85, 86, and/or 87 from Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs.: 62, 58, 59, 60, and 61.
18. The artificial circular RNA according any of claims 7 to 12, wherein the at least one or more target disruption structures comprise the target disruption structures selected from the list consisting of SEQ ID NOs.: 30 and/or 79 from Dengue Virus and Hepatitis C Virus, and wherein the target hybridization regions, for each of these target disruption structures, are elected from SEQ ID NOs.: 30 and 28.
19. The artificial circular RNA according any of claims 7 to 12, wherein the at least one or more target disruption structures comprise the target disruption structures selected from the list consisting of SEQ ID NOs.: 30 and/or 83 from Dengue Virus and West Nile Virus, and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs.: 30 and 37.
20. A composition comprising the artificial circular RNA as defined in any of the previous claims.
21. A kit comprising the artificial circular RNA as defined in any of claims 1 to 19 or comprising the composition as defined in claim 20, and instructions for using the artificial circular RNA or composition.
22. The artificial circular RNA of any of claims 1 to 19, or the composition of claim 20, or the kit of claim 21, wherein the sequence of the artificial RNA comprises, or preferably, consists of, the following nucleotides defined in: SEQ ID NO: 2, 3, 4, 5, 6 (for Hepatitis C virus); 8, 9, 10 (for Dengue virus); 12, 13, 14, 15, 39 (for Chikungunya virus); 16 and 17 (broad spectrum activity for both Hepatitis C virus and Dengue Virus); 24 and 19 (for West Nile Virus); 21, 22 and 23 (broad spectrum activity for both Dengue and West Nile Viruses); 32 (broad spectrum activity for both Hepatitis C virus and Dengue Virus); 36, 38, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 65, 66, 67, 68, 69, 70, 71, 72 (for Severe acute respiratory syndrome coronavirus 2).
23. The artificial circular RNA of any of claims 1 to 19 or the composition of claim 20, or the kit of claim 21, wherein the one or more target hybridization region of the artificial circular RNA which completely hybridize with the two or more hybridization regions is comprised in the artificial RNA defined in SEQ ID NO.: 1, SEQ ID NO.: 7, SEQ ID NO.: 11, SEQ ID NO.: 34 and/or SEQ ID NO.: 20.
24. The artificial circular RNA of any one of claims 1 to 19 and 22 and 23, or the composition of any of claims 20 to 23, or the kit of any one of claims 21 to 23 for use as a medicament.
25. The artificial circular RNA of any one of claims 1 to 19 and 22 to 24, or the composition of any of claims 20 to 24, or the kit of any one of claims 21 to 24 for use in a method of preventing and/or treating a viral infection.
26. The artificial circular RNA of any one of claims 1 to 19 and 22 to 25, or the composition of any of claims 20 to 25, or the kit of any one of claims 21 to 26 for use according to claim 25, wherein the viral infection is caused by Hepatitis C virus, Hepatitis A virus, Poliovirus, Influenza virus, Coxsackie B virus, rhinovirus (common cold), Dengue, Zika, Chikungunya, West Nile, Yellow Fever virus or coronavirus, such as SARS and/or MERS, preferably SARS-CoV-2.
27. A method of screening for artificial circular RNA comprising two or more hybridization regions capable of disrupting by hybridization one or more target disruption structures of one or more RNA fragments, wherein the target disruption structures are defined as:
iii. a first region with at least a hairpin loop preceded or followed by a second region of unpaired nucleotides; and
iv. as comprising at least one target hybridization region which comprises a single-stranded region of at least 2 nucleotides, preferably 3 nucleotides or more preceded or followed by a double-stranded region of at least 5 nucleotides, preferably 10 nucleotides or more, and
wherein the method comprises the steps of:d) identifying the two or more hybridization regions of the artificial circular RNA as those regions that have a total of between 7 and 100 nucleotides in length, preferably between 10 and 50 nucleotides that, when hybridizing with the at least one target hybridization region, the energy of the hybridization between the two or more hybridization regions and the at least one target hybridization region is more negative than the energy of the target disruption structure, thereby disrupting the one or more target disruption structure; wherein the the two or more hybridization regions comprised in the artificial circular RNA, are identified by RNA inverse folding tools, such as NUPACK, RNAifold, or MoiRNAiFold;
e) designing an artificial circular RNA comprising the two or more hybridization regions capable of disrupting the one or more target disruption structures as identified in step a), wherein said artificial circular RNA is between 150 and 800 nucleotides in length, preferably between 200 and 600 nucleotides; and
f) optionally selecting the artificial circular RNA capable of disrupting by hybridization the one or more target disruption structures as designed in step b), and optionally packaging it into a product.