US20230348908A1
2023-11-02
18/156,360
2023-01-18
This invention relates to polycomb-associated RNAs, libraries and fragments of those RNAs, inhibitory nucleic acids and methods and compositions for targeting RNAs, and methods of use thereof.
Get notified when new applications in this technology area are published.
C12Q2600/158 » CPC further
Oligonucleotides characterized by their use Expression markers
C12N2310/113 » CPC further
Structure or type of the nucleic acid; Type of nucleic acid; Antisense targeting other non-coding nucleic acids, e.g. antagomirs
C12N2310/3231 » CPC further
Structure or type of the nucleic acid; Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
C12Q2600/178 » CPC further
Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
C12N15/113 » CPC main
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
C12Q1/6883 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
C12Q1/6806 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
C12Q1/6886 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
This application is a continuation of U.S. patent application Ser. No. 17/038,425, filed Sep. 30, 2020, which is a continuation of U.S. patent application Ser. No. 15/558,974, filed Sep. 15, 2017, now U.S. Pat. No. 10,900,036, which is a U.S. National Phase Application under 35 U.S.C. § 371 of International Patent Application No. PCT/US2016/022778, filed on Mar. 17, 2016, which claims the benefit of U.S. Provisional Patent Application Ser. No. 62/134,361, filed on Mar. 17, 2015. The entire contents of the foregoing are hereby incorporated by reference.
This application contains a Sequence Listing that has been submitted electronically as an XML file named “29539-0159003_SL_ST26.xml.” The .xml file, created on Jan. 18, 2023, is 82,469,717 bytes in size. The material in the .txt file is hereby incorporated by reference in its entirety.
This invention was made with Government support under Grant No. RO1-DA36895 awarded by the National Institutes of Health. The Government has certain rights in the invention.
This invention relates to the RNA interactome of Polycomb Repressive Complex 1 (PRC1) and methods of using inhibitory nucleic acids that bind RNAs and inhibit the PRC1-RNA interaction to modulate gene expression.
Transcriptome analyses have suggested that, although only 1-2% of the mammalian genome is protein-coding, 70-90% is transcriptionally active (Carninci et al., 2005; Kapranov et al., 2007; Mercer et al., 2009). Ranging from 100 nt to >100 kb, these transcripts are largely unknown in function, may originate within or between genes, and may be conserved and developmentally regulated (Kapranov et al., 2007; Guttman et al., 2009). Recent discoveries argue that a subset of these transcripts play crucial roles in epigenetic regulation.
RNA-mediated recruitment is especially attractive for Polycomb proteins. First identified in Drosophila as homeotic regulators, Polycomb proteins are conserved from flies to mammals and control many aspects of development (Ringrose and Paro, 2004; Boyer et al., 2006; Lee et al., 2006; Schuettengruber et al., 2007; Pietersen and van Lohuizen, 2008; Schwartz and Pirrotta, 2008).
Polycomb Repressive Complex 1 (PRC1) is the enzymatic complex that ubiquitylates histone H2A at lysine 119 (H2AK119Ub). In mammals, it is composed of multiple variable subunits, including (1) the catalytic subunit, Ring1b or Ring1a; (2) Bmi1 (which can be PCGF1, PCGF2, PCGF3, PCGF5, or PCGF6); (3) PH1 (or PH2, PH3); and (4) CBX2, 4, 6, 7, or 8. Action of PRC1 on chromatin results in chromatin compaction and transcriptional repression. The classical PRC1 complex exists in two forms in which either CBX and MPH or RYBP subunits associate with the catalytic core subunits RING1A/B and PCGF2/4. The PRC1 interacting protein, SCMLH1/2/3, is only weakly associated/substoichiometric and is considered an accessory factor, rather than a core component. The RanBP-ZF domain present in RYBP/YAF2 has an RNA binding function in some related proteins but apparently not in RYBP/YAF2. See, e.g., Brockdorff, RNA 19:429-442 (2013); Yap et al., Mol Cell. 38(5):662-74 (2010).
Although PRC1 binds thousands of sites in the mammalian genome, how PRC1 is targeted to chromatin has remained a mystery. YY1 and the H3K27me3 chromatin mark may recruit PRC1 in some contexts, but they are unlikely to be the general or only mechanisms. RNA-mediated targeting is another potential mechanism. PRC1 is known to interact with at least one RNA, ANRIL, likely via the chromodomain (CD) of the CBX7 protein (Yap et al., Mol Cell. 38(5):662-74 (2010)). ANRIL is an antisense non-coding RNA (ncRNA) at the INK4b/ARF/INK4a locus (Pasmant et al., Cancer Res 67: 3963-3969 (2007)). How many RNAs interact with PRC1 and whether they are a general recruiting tool for PRC1 has not previously been determined.
A new ‘denaturing’ CLIP-seq method was developed using the biotin-avidin method, which enables washes in high salt and urea (i.e., protein denaturing conditions). Because the exemplified system includes two protein tags, FLAG and biotin, purification can be performed with either tag or conducted as a tandem affinity purification (e.g., FLAG purification first, followed by biotin pulldown). For the denaturing method, the biotin tag is preferably used. During CLIP, because the interacting RNAs are UV-crosslinked to RNA-binding proteins in a covalent fashion, the RNA-protein interactions survive the wash conditions, whereas nonspecific, low-affinity interactions are not preserved. These methods were used to identify genome-wide pools of polycomb repressive complex 1 (PRC1)-interacting RNAs (referred to herein as the “PRC1 transcriptome” or “PRC1 RNA interactome”) in several cell types, including embryonic stem cells and human fibroblast cells.
The results of the studies described herein demonstrated that PRC1 binds both noncoding RNA and coding RNA. The transcriptome includes antisense, intergenic, and promoter-associated transcripts, as well as many unannotated RNAs. A large number of transcripts occur within imprinted regions, oncogene and tumor suppressor loci, and stem-cell-related bivalent domains. Further evidence is provided that inhibitory oligonucleotides that specifically bind to these PRC1-interacting RNAs can successfully modulate gene expression in a variety of separate and independent examples, presumably by inhibiting PRC1-associated effects. PRC1 binding sites can be classified into several groups, including (i) 3′ untranslated region [3′ UTR], (ii) promoter-associated, (iii) gene body, (iv) antisense, and (v) intergenic. Inhibiting the PRC1-RNA interactions can lead to either activation or repression, depending on context.
Also provided herein are methods for isolating RNA sequences that interact with a selected protein, e.g., with chromatin complexes, in a cell; the methods include providing a cell expressing (i) a biotin ligase, e.g., BirA, and (ii) the protein of interest comprising a biotinylation sequence; exposing the cells to UV-crosslinking; lysing the cells, isolating protein-RNA complexes from the lysed cells, e.g., using avidin purification, e.g., streptavidin beads; washing the complexes in protein-denaturing conditions, e.g., high salt and detergent, e.g., using 8 M urea+0.1% SDS; and isolating the protein-RNA complexes.
In one aspect, described herein are methods for isolating RNA sequences that interact with a selected protein, e.g., with chromatin complexes. The methods include providing a cell expressing (i) a biotin ligase, e.g., BirA, and (ii) the protein of interest comprising a biotinylation sequence; exposing the cells to UV-crosslinking to crosslink the proteins to RNA, to create protein-RNA complexes; lysing the cells to obtain a sample comprising the protein-RNA complexes; isolating protein-RNA complexes from the lysed cells, e.g., using avidin purification, e.g., streptavidin beads; washing the complexes in protein-denaturing conditions, e.g., high salt and detergent, e.g., using 8 M urea+0.1% SDS; and isolating the protein-RNA complexes.
In some embodiments, the methods include optionally preparing a plurality of validated cDNAs complementary to the pool of ribonucleic acids (RNAs) that bind to the protein of interest; these methods include synthesizing DNA complementary to the RNAs to provide an initial population of cDNAs; PCR-amplifying, if necessary, using strand-specific primers; purifying the initial population of cDNAs to obtain a purified population of cDNAs that are at least about 20 nucleotides (nt) in length, e.g., at least 25, 50, 75, 100, 150, 200, or 250 nt in length; sequencing at least part or substantially all of the purified population of cDNAs; aligning reads to a reference genome and retaining only those that are aligned; selecting high-confidence cDNA sequences, optionally, based on criteria that (1) the candidate transcript has a minimum read density in reads per kilobase per million reads (RPKM) terms (e.g., above a desired threshold); and/or (2) the candidate transcript is enriched in the wildtype library versus a suitable control library (such as an IgG pulldown library or a protein-null pulldown library); thereby preparing the plurality of cDNAs. In some embodiments, the cDNAs are synthesized using strand-specific adaptors.
In some embodiments, the method is used to prepare a library representing a transcriptome associated with the protein of interest.
In some embodiments, the methods further include sequencing substantially all of the cDNAs.
In another aspect the invention features an inhibitory nucleic acid that specifically binds to, or is complementary to a region of an RNA that is known to bind to Polycomb repressive complex 1 (PRC1), wherein the sequence of the region is selected from the group consisting of SEQ ID NOs:1 to 5893 (human), 5894 to 17415 (human), and 17416 to 36368 (mouse) as set forth in Tables 1-3. Without being bound by a theory of invention, these inhibitory nucleic acids are able to interfere with the binding of and function of PRC1, by preventing recruitment of PRC1 to a specific chromosomal locus. For example, data herein shows that a single administration of inhibitory nucleic acids designed to specifically bind a RNA can alter expression of a gene associated with the RNA. Data provided herein also indicate that putative ncRNA binding sites for PRC1 show no conserved primary sequence motif, making it possible to design specific inhibitory nucleic acids that will interfere with PRC1 interaction with a single ncRNA, without generally disrupting PRC1 interactions with other ncRNAs. Further, data provided herein support that RNA can recruit PRC1 in a cis fashion, repressing gene expression at or near the specific chromosomal locus from which the RNA was transcribed, thus making it possible to design inhibitory nucleic acids that inhibit the function of PRC1 and increase the expression of a specific target gene.
In some embodiments, the inhibitory nucleic acid is provided for use in a method of modulating expression of a “gene targeted by the PRC1-binding RNA” (e.g., an intersecting or nearby gene, as set forth in Tables 1-3 below), meaning a gene whose expression is regulated by the PRC1-binding RNA. The term “PRC1-binding RNA” or “RNA that binds PRC1” is used interchangeably with “PRC1-associated RNA” and “PRC1-interacting RNA”, and refers to an RNA transcript or a region thereof (e.g., a Peak as described below) that binds the PRC1 complex, directly or indirectly. Such binding may be determined by dCLIP-SEQ techniques described herein using a component of the PRC1 complex, e.g., PRC1 itself. SEQ ID NOs: 1 to 5893 represent human RNA sequences containing portions that have been experimentally determined to bind PRC1 using the dCLIP-seq method described herein; SEQ ID NOs: 17416 to 36368 represent murine RNA sequences containing portions that have been experimentally determined to bind PRC1 using the dCLIP-seq method described herein; and SEQ ID NOs: 5894 to 17415 represent or human RNA sequences corresponding to the murine RNA sequences.
Such methods of modulating gene expression may be carried out in vitro, ex vivo, or in vivo. Tables 1-3 display genes targeted by the PRC1-binding RNA; the SEQ ID NOS: of the PRC1-associated RNA are set forth in the same row as the gene name. In some embodiments, the inhibitory nucleic acid is provided for use in a method of treating disease, e.g. a disease category as described herein. The treatment may involve modulating expression (either up or down) of a gene targeted by the PRC1-binding RNA, preferably upregulating gene expression. The inhibitory nucleic acid may be formulated as a sterile composition for parenteral administration. It is understood that any reference to uses of compounds throughout the description contemplates use of the compound in preparation of a pharmaceutical composition or medicament for use in the treatment of a disease. Thus, as one nonlimiting example, this aspect of the invention includes use of such inhibitory nucleic acids in the preparation of a medicament for use in the treatment of disease, wherein the treatment involves upregulating expression of a gene targeted by the PRC1-binding RNA.
Diseases, disorders or conditions that may be treated according to the invention include cardiovascular, metabolic, inflammatory, bone, neurological or neurodegenerative, pulmonary, hepatic, kidney, urogenital, bone, cancer, and/or protein deficiency disorders.
In a related aspect, the invention features a process of preparing an inhibitory nucleic acid that modulates gene expression, the process comprising the step of synthesizing an inhibitory nucleic acid of between 5 and 40 bases in length, or about 8 to 40, or about 5 to 50 bases in length, optionally single stranded, that specifically binds, or is complementary to, an RNA sequence that has been identified as binding to PRC1, optionally an RNA of any of Tables 1-3 or any one of SEQ ID NOs: 1 to 5893, or 5894 to 17415, or 17416 to 36368. This aspect of the invention may further comprise the step of identifying the RNA sequence as binding to PRC1, optionally through the dCLIP-seq method described herein.
In a further aspect of the present invention a process of preparing an inhibitory nucleic acid that specifically binds to an RNA that binds to Polycomb repressive complex 1 (PRC1) is provided, the process comprising the step of designing and/or synthesizing an inhibitory nucleic acid of between 5 and 40 bases in length, or about 8 to 40, or about 5 to 50 bases in length, optionally single stranded, that specifically binds to an RNA sequence that binds to PRC1, optionally an RNA of any of Tables 1-3 or any one of SEQ ID NOs: 1 to 5893, or 5894 to 17415, or 17416 to 36368.
In some embodiments prior to synthesizing the inhibitory nucleic acid the process further comprises identifying an RNA that binds to PRC1.
In some embodiments the RNA has been identified by a method involving identifying an RNA that binds to PRC1.
In some embodiments the inhibitory nucleic acid is at least 80% complementary to a contiguous sequence of between 5 and 40 bases, or about 8 to 40, or about 5 to 50 bases in said RNA sequence that binds to PRC1. In some embodiments the sequence of the designed and/or synthesized inhibitory nucleic acid is based on a said RNA sequence that binds to PRC1, or a portion thereof, said portion having a length of from 5 to 40 contiguous base pairs, or about 8 to 40 bases, or about 5 to 50 bases.
In some embodiments the sequence of the designed and/or synthesized inhibitory nucleic acid is based on a nucleic acid sequence that is complementary to said RNA sequence that binds to PRC1, or is complementary to a portion thereof, said portion having a length of from 5 to 40 contiguous base pairs, or about 8 to 40 base pairs, or about 5 to 50 base pairs.
The designed and/or synthesized inhibitory nucleic acid may be at least 80% complementary to (optionally one of at least 90%, 95%, 96%, 97%, 98%, 99% or 100% complementary to) the portion of the RNA sequence to which it binds or targets, or is intended to bind or target. In some embodiments it may contain 1, 2 or 3 base mismatches compared to the portion of the target RNA sequence or its complement respectively. In some embodiments it may have up to 3 mismatches over 15 bases, or up to 2 mismatches over 10 bases.
The inhibitory nucleic acid or portion of RNA sequence that binds to PRC1 may have a length of one of at least 8 to 40, or 10 to 50, or 5 to 50, or 5 to 40 bases, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases. Where the inhibitory nucleic acid is based on an RNA sequence that binds to PRC1, a nucleic acid sequence that is complementary to said RNA sequence that binds to PRC1 or a portion of such a sequence, it may be based on information about that sequence, e.g. sequence information available in written or electronic form, which may include sequence information contained in publicly available scientific publications or sequence databases.
In some embodiments, the isolated single stranded oligonucleotide is of 5 to 40 nucleotides in length and has a region of complementarity that is complementary with at least 5 contiguous nucleotides of the PRC1-binding RNA that inhibits expression of the target gene, wherein the oligonucleotide is complementary to and binds specifically within a PRC1-binding region of the PRC1-binding RNA and interferes with binding of PRC1 to the PRC1-binding region without inducing degradation of the PRC1-binding RNA (e.g., wherein the PRC1-binding region has a nucleotide sequence identified using a denaturing cross-linking immunoprecipitation procedure using an a biotin-tagged PRC1 as described herein), and without interfering with binding of PRC2 to a PRC2-binding region of the RNA (as described in WO 2012/087983 or WO 2012/065143, wherein the PRC2-binding region has a nucleotide sequence protected from nucleases during an RNA immunoprecipitation procedure using an antibody directed against PRC2), optionally wherein the PRC1-binding RNA is transcribed from a sequence of the chromosomal locus of the target gene, and optionally wherein a decrease in recruitment of PRC1 to the target gene in the cell following delivery of the single stranded oligonucleotide to the cell, compared with an appropriate control cell to which the single stranded oligonucleotide has not been delivered, indicates effectiveness of the single stranded oligonucleotide.
Where the design and/or synthesis involves design and/or synthesis of a sequence that is complementary to a nucleic acid described by such sequence information the skilled person is readily able to determine the complementary sequence, e.g. through understanding of Watson-Crick base pairing rules which form part of the common general knowledge in the field.
In the methods described above the RNA that binds to PRC1 may be, or have been, identified, or obtained, by a method that involves identifying RNA that binds to PRC1.
Such methods may involve the following steps: providing a sample containing nuclear ribonucleic acids, contacting the sample with an agent that binds specifically to PRC1 or a subunit thereof, allowing complexes to form between the agent and protein in the sample, partitioning the complexes, synthesizing nucleic acid that is complementary to nucleic acid present in the complexes.
If necessary, the method may further comprise the steps of amplifying the synthesized nucleic acid, and/or purifying the nucleic acid (or amplified nucleic acid), and/or sequencing the nucleic acids so obtained, and/or filtering/analysing the nucleic acids so obtained to identify high-probability PRC1 (or subunit thereof)-interacting transcripts.
In one embodiment the method involves the dCLIP-Seq method described herein.
In accordance with the above, in some embodiments the RNA that binds to PRC1 may be one that is known to bind PRC1, e.g. information about the sequence of the RNA and/or its ability to bind PRC1 is available to the public in written or electronic form allowing the design and/or synthesis of the inhibitory nucleic acid to be based on that information. As such, an RNA that binds to PRC1 may be selected from known sequence information and used to inform the design and/or synthesis of the inhibitory nucleic acid.
In other embodiments the RNA that binds to PRC1 may be identified as one that binds PRC1 as part of the method of design and/or synthesis.
In preferred embodiments design and/or synthesis of an inhibitory nucleic acid involves manufacture of a nucleic acid from starting materials by techniques known to those of skill in the art, where the synthesis may be based on a sequence of an RNA (or portion thereof) that has been selected as known to bind to Polycomb repressive complex 2.
Methods of design and/or synthesis of an inhibitory nucleic acid may involve one or more of the steps of:
Inhibitory nucleic acids so designed and/or synthesized may be useful in method of modulating gene expression as described herein.
As such, the process of preparing an inhibitory nucleic acid may be a process that is for use in the manufacture of a pharmaceutical composition or medicament for use in the treatment of disease, optionally wherein the treatment involves modulating expression of a gene targeted by the RNA binds to PRC1.
Thus, provided herein are methods for isolating RNA sequences that interact with a selected protein, e.g., with chromatin complexes, in a cell. The methods include providing a cell expressing (i) a biotin ligase, e.g., BirA, and (ii) the protein of interest comprising a biotinylation sequence; exposing the cells to UV-crosslinking; lysing the cells, isolating protein-RNA complexes from the lysed cells, e.g., using avidin purification, e.g., streptavidin beads; washing the complexes in protein-denaturing conditions, e.g., high salt and detergent, e.g., using 8 M urea+0.1% SDS; and isolating the protein-RNA complexes. In some embodiments, the methods include labelling the RNA in the RNA-protein complexes, e.g., by phosphorylation using 32P-ATP. In some embodiments, the methods include purifying the RNA-protein complexes, preparing cDNA from the RNA, and deep sequencing the cDNA to identify the RNA sequences bound to the protein.
Also provided are kits for use in the methods described herein; these kits include an expression vector comprising a sequence encoding a biotin ligase, and an expression vector comprising a sequence encoding a biotinylation sequence, and optionally one or more buffers. In some embodiments, the buffers include one or more of a high stringency denaturing buffer, e.g., comprising 8 M urea (range: 5-10 M, 6-10 M, 7-10 M, 7-9 M, or 7.5-8.5 M) plus 0.1% SDS (range: 0.0-2.0%); a wash buffer (e.g., PBS+2% SDS; and a high salt wash buffer (e.g., PBS+750 mM NaCl+1% NP40+0.5% NaDeoxycholate+0.1% SDS).
In yet another aspect, the invention provides isolated nucleic acids comprising a sequence referred to in any of Tables 1-3, or a fragment comprising at least 20 nt thereof. In some or any embodiments, the invention provides an isolated nucleic acid comprising (a) an RNA sequence as set forth in Tables 1-3 that targets a proto-oncogene or oncogene as set forth in Tables 1-3, or (b) a fragment of (a) that is at least 20 bases in length that retains PRC1-binding activity, or (c) a derivative of (a) or (b) that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous thereto, or (d) a nucleic acid of (a), (b), or (c) in which one or more bases has been replaced with a base of similar base-pairing capacity, such as replacing U with T. In preferred embodiments, the isolated nucleic acid of (a), (b) or (c) is for use in a method of decreasing expression of an oncogene. In some embodiments, the isolated nucleic acid is synthetic. In some embodiments, the isolated RNA comprises a SEQ ID NO. associated with Pvt1 in Tables 1-3. Pvt1 is known in the art to be disrupted in some cases of Burkitt's lymphoma as well as in plasmacytomas (e.g., by translocations from another chromosome). Therefore, Pvt1 is likely to act by targeting PRC1 to c-Myc in order to repress its expression. Accordingly, exogenous administration of any of the RNA sequences associated with Pvt1 in Tables 1-3, or inhibitory nucleic acids complementary thereto, could rescue Pvt1 loss-of-function phenotypes contributing to various cancers.
In a further aspect, the invention provides methods for decreasing expression of an oncogene in a cell. In some embodiments, the methods include contacting the cell with a PRC1-binding fragment described in any of Tables 1-3, or a nucleic acid sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous to a PRC1-binding fragment as referred to in any of Tables 1-3. In exemplary methods, the RNA a nucleic acid in which one or more bases has been replaced with a base of similar base-pairing capacity, such as replacing U with T. PRC1-binding fragments of murine or orthologous ncRNAs, including human ncRNA, which retain the ncRNA's ability to bind PRC1, are contemplated.
In yet another aspect, the invention features methods for increasing expression of a tumor suppressor in a mammal, e.g. human, in need thereof. The methods include administering to said mammal an inhibitory nucleic acid that specifically binds, or is complementary, to a human PRC1-interacting RNA corresponding to a tumor suppressor locus of any of Tables 1-3 or a human RNA corresponding to an imprinted gene of any of Tables 1-3, or a related naturally occurring RNA that is othologous or at least 90%, (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%%, or 100%) identical over at least 15 (e.g., at least 20, 21, 25, 30, 100) nucoleobases thereof, in an amount effective to increase expression of the tumor suppressor or growth suppressing gene. It is understood that one method of determining human orthologous RNA that corresponds to murine RNA is to identify a corresponding human sequence at least 90% identical (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to at least 15 nucleobases of the murine sequence (or at least 20, 21, 25, 30, 40, 50, 60, 70, 80, 90 or 100 nucleobases).
In an additional aspect, the invention provides methods for inhibiting or suppressing tumor growth in a mammal, e.g. human, with cancer, comprising administering to said mammal an inhibitory nucleic acid that specifically binds, or is complementary, to a human PRC1-interacting RNA corresponding to a tumor suppressor locus of any of Tables 1-3, or a human RNA corresponding to an imprinted gene of any of Tables 1-3, or a related naturally-occurring RNA that is orthologous or at least 90%, (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical over at least 15 (e.g., at least 20, 21, 25, 30, 50, 70, 100) nucleobases thereof, in an amount effective to suppress or inhibit tumor growth.
In another aspect, the invention features methods for treating a mammal, e.g., a human, with cancer comprising administering to said mammal an inhibitory nucleic acid that specifically binds, or is complementary, to a human RNA corresponding to a tumor suppressor locus of any of Tables 1-3, or a human RNA corresponding to an imprinted gene of Tables 1-3, or a related naturally occurring RNA that is orthologous or at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical over at least 15 (e.g., at least 20, 21, 25, 30, 50, 70, 100) nucleobases thereof, in a therapeutically effective amount.
Also provided herein are inhibitory nucleic acids that specifically bind, or are complementary to, a region of an RNA that is known to bind to Polycomb repressive complex 1 (PRC1), wherein the sequence of the region is selected from the group consisting of SEQ ID NOs:1 to 5893 (human), 5894 to 17415 (human), and 17416 to 36368 (mouse) as set forth in Tables 1-3, for use in the treatment of disease, wherein the treatment involves modulating expression of a gene targeted by the RNA, wherein the inhibitory nucleic acid is between 5 and 40 bases in length, and wherein the inhibitory nucleic acid is formulated as a sterile composition.
Further described herein are process for preparing an inhibitory nucleic acid that specifically binds, or is complementary to, an RNA that is known to bind to Polycomb repressive complex 1 (PRC1), selected from the group consisting of SEQ ID NOs:1 to 5893 (human), 5894 to 17415 (human), and 17416 to 36368 (mouse) as set forth in Tables 1-3; the processes include the step of designing and/or synthesizing an inhibitory nucleic acid of between 5 and 40 bases in length, optionally single stranded, that specifically binds to a region of the RNA that binds PRC1.
In some embodiments, the sequence of the designed and/or synthesized inhibitory nucleic acid is a nucleic acid sequence that is complementary to said RNA sequence that binds to PRC1, or is complementary to a portion thereof, said portion having a length of from 5 to 40 contiguous base pairs.
In some embodiments, the inhibitory nucleic acid is for use in the manufacture of a pharmaceutical composition or medicament for use in the treatment of disease, optionally wherein the treatment involves modulating expression of a gene targeted by the RNA binds to PRC1.
In some embodiments, the modulation is increasing expression of a gene and the region of the RNA that binds PRC1 can be in intergenic space mapping to a noncoding RNA, antisense to the coding gene, or in the promoter, 3′UTR, 5′UTR, exons, and introns of a coding gene.
In some embodiments, the modulation is decreasing expression of a gene and the region of the RNA that binds PRC1 can be in intergenic space mapping to a noncoding RNA, antisense to the coding gene, or in the promoter, 3′UTR, 5′UTR, exons, and introns of a coding gene.
In some embodiments, the modulation is to influence gene expression by altering splicing of a gene and the region of the RNA that binds PRC1 can be in intergenic space mapping to a noncoding RNA, antisense to the coding gene, or in the promoter, 3′UTR, 5′UTR, exons, and introns of a coding gene.
Also provided herein are sterile compositions comprising an inhibitory nucleic acid that specifically binds, or is complementary to, an RNA sequence of any one of SEQ ID NOs:1 to 5893 (human), 5894 to 17415 (human), and 17416 to 36368 (mouse) and is capable of modulating expression of a gene targeted by the RNA as set forth in Tables 1-3. In some embodiments, the composition is for parenteral administration. In some embodiments, the RNA sequence is in the 3′UTR of a gene, and the inhibitory nucleic acid is capable of upregulating or downregulating expression of a gene targeted by the RNA.
Also provided herein is an inhibitory nucleic acid for use in the treatment of disease, wherein said inhibitory nucleic acid specifically binds, or is complementary to, an RNA sequence of any one of SEQ ID NOs:1 to 5893 (human) or 5894 to 17415 (human), and wherein the treatment involves modulating expression of a gene targeted by the RNA according to Tables 1-3.
The present disclosure also provides methods for modulating gene expression in a cell or a mammal comprising administering to the cell or the mammal an inhibitory nucleic acid that specifically binds, or is complementary to, an RNA sequence of any one of SEQ ID NOs:1 to 5893 (human) or 5894 to 17415 (human) or 17416 to 36368 (mouse), in an amount effective for modulating expression of a gene targeted by the RNA according to Table 1-3.
In addition, provided herein are inhibitory nucleic acids of about 5 to 50 bases in length that specifically bind, or are complementary to, a fragment of at least five consecutive bases within any of SEQ ID NOs:1 to 5893 (human) or 5894 to 17415 (human) or 17416 to 36368 (mouse), optionally for use in the treatment of disease, wherein the treatment involves modulating expression of a gene targeted by the RNA.
In addition, provided are methods for modulating expression of a gene comprising administering to a mammal an inhibitory nucleic acid as described herein in an amount effective for modulating expression of a gene targeted by the RNA as set forth in Tables 1-3.
In some embodiments, the modulation is upregulating or downregulating gene expression, optionally wherein the gene targeted by the RNA is selected from the group set forth in Tables 1-3, and wherein the RNA sequence is listed in the same row as the gene.
In some embodiments, the inhibitory nucleic acid is 5 to 40 bases in length (optionally 12-30, 12-28, or 12-25 bases in length).
In some embodiments, the inhibitory nucleic acid is 10 to 50 bases in length.
In some embodiments, the inhibitory nucleic acid comprises a base sequence at least 90% complementary to at least 10 bases of the RNA sequence.
In some embodiments, the inhibitory nucleic acid comprises a sequence of bases at least 80% or 90% complementary to, e.g., at least 5-30, 10-30, 15-30, 20-30, 25-30 or 5-40, 10-40, 15-40, 20-40, 25-40, or 30-40 bases of the RNA sequence.
In some embodiments, the inhibitory nucleic acid comprises a sequence of bases with up to 3 mismatches (e.g., up to 1, or up to 2 mismatches) in complementary base pairing over 10, 15, 20, 25 or 30 bases of the RNA sequence.
In some embodiments, the inhibitory nucleic acid comprises a sequence of bases at least 80% complementary to at least 10 bases of the RNA sequence.
In some embodiments, the inhibitory nucleic acid comprises a sequence of bases with up to 3 mismatches over 15 bases of the RNA sequence.
In some embodiments, the inhibitory nucleic acid is single stranded.
In some embodiments, the inhibitory nucleic acid is double stranded.
In some embodiments, the inhibitory nucleic acid comprises one or more modifications comprising: a modified sugar moiety, a modified internucleoside linkage, a modified nucleotide and/or combinations thereof.
In some embodiments, the inhibitory nucleic acid is an antisense oligonucleotide, LNA molecule, PNA molecule, ribozyme or siRNA.
In some embodiments, the inhibitory nucleic acid is double stranded and comprises an overhang (optionally 2-6 bases in length) at one or both termini.
In some embodiments, the inhibitory nucleic acid is selected from the group consisting of antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, micro RNAs (miRNAs); small, temporal RNAs (stRNA), and single- or double-stranded RNA interference (RNAi) compounds.
In some embodiments, the RNAi compound is selected from the group consisting of short interfering RNA (siRNA); or a short, hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); and small activating RNAs (saRNAs).
In some embodiments, the antisense oligonucleotide is selected from the group consisting of antisense RNAs, antisense DNAs, and chimeric antisense oligonucleotides.
In some embodiments, the modified internucleoside linkage comprises at least one of: alkylphosphonate, phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, carboxymethyl ester, or combinations thereof.
In some embodiments, the modified sugar moiety comprises a 2′-O-methoxyethyl modified sugar moiety, a 2′-methoxy modified sugar moiety, a 2′-O-alkyl modified sugar moiety, or a bicyclic sugar moiety. In some embodiments, the inhibitory nucleic acids include 2′-OMe, 2′-F, LNA, PNA, FANA, ENA or morpholino modifications.
Further provided are sterile compositions comprising an isolated nucleic acid that is a mouse RNA sequence of any one of any one of SEQ ID NOs:1 to 5893 (human) or 5894 to 17415 (human) or 17416 to 36368 (mouse), or a fragment thereof at least 20 bases in length that retains PRC1-binding activity.
Also provided are isolated nucleic acids for use in a method of decreasing expression of an oncogene, comprising an RNA sequence as set forth in Tables 1-3 that targets a proto-oncogene or oncogene as set forth in Tables 1-3, or a fragment thereof at least 20 bases in length that retains PRC1-binding activity.
In addition, provided are methods for decreasing expression of an oncogene in a cell, the method comprising contacting the cell with an RNA sequence as set forth in Tables 1-3 that targets an oncogene as set forth in Tables 1-3, or a fragment thereof at least 20 bases in length that retains PRC1-binding activity.
Further, provided herein are methods of inducing expression of a target gene in a cell, the method comprising delivering to the cell a single stranded oligonucleotide of 5 to 40 nucleotides in length having a region of complementarity that is complementary with at least 5 contiguous nucleotides of a PRC1-binding RNA that inhibits expression of the target gene, wherein the oligonucleotide is complementary to and binds specifically to the PRC1-binding RNA, and wherein the PRC1-binding RNA is transcribed from a sequence of the chromosomal locus of the target gene.
In some embodiments, the RNA is a non-codingRNA.
In some embodiments, the methods include detecting expression of the PRC1-binding RNA in the cell, wherein expression of the PRC1-binding RNA in the cell indicates that the single stranded oligonucleotide is suitable for increasing expression of the target gene in the cell.
In some embodiments, the methods include detecting a change in expression of the target gene following delivery of the single stranded oligonucleotide to the cell, wherein an increase in expression of the target gene compared with an appropriate control cell indicates effectiveness of the single stranded oligonucleotide.
In some embodiments, the methods include detecting a change in recruitment of PRC1 to the target gene in the cell following delivery of the single stranded oligonucleotide to the cell, wherein a decrease in recruitment compared with an appropriate control cell indicates effectiveness of the single stranded oligonucleotide.
In some embodiments, the cell is in vitro.
In some embodiments, the cell is in vivo.
In some embodiments, at least one nucleotide of the oligonucleotide is a modified nucleotide.
In some embodiments, the PRC1-binding RNA is transcribed from the same strand as the target gene in a genomic region containing the target gene.
In some embodiments, the oligonucleotide has complementarity to a region of the PRC1-binding RNA transcribed from a portion of the target gene corresponding to an exon.
In some embodiments, the oligonucleotide has complementarity to a region of the PRC1-binding RNA transcribed from the same strand as the target gene within a chromosomal region within −2.0 kb to +0.001 kb of the transcription start site of the target gene.
In some embodiments, the oligonucleotide has complementarity to a region of the PRC1-binding RNA transcribed from the opposite strand of the target gene within a chromosomal region within −0.5 to +0.1 kb of the transcription start site of the target gene.
In some embodiments, the oligonucleotide has complementarity to the PRC1-binding RNA in a region of the PRC1-binding RNA that forms a stem-loop structure.
In some embodiments, at least one nucleotide of the oligonucleotide is an RNA or DNA nucleotide.
In some embodiments, at least one nucleotide of the oligonucleotide is a ribonucleic acid analogue comprising a ribose ring having a bridge between its 2′-oxygen and 4′-carbon.
In some embodiments, the ribonucleic acid analogue comprises a methylene bridge between the 2′-oxygen and the 4′-carbon.
In some embodiments, at least one nucleotide of the oligonucleotide comprises a modified sugar moiety.
In some embodiments, the modified sugar moiety comprises a 2′-O-methoxyethyl modified sugar moiety, a 2′-methoxy modified sugar moiety, a 2′-O-alkyl modified sugar moiety, or a bicyclic sugar moiety.
In some embodiments, the oligonucleotide comprises at least one modified internucleoside linkage.
In some embodiments, the at least one modified internucleoside linkage is selected from phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, carboxymethyl ester, and combinations thereof.
In some embodiments, the oligonucleotide is configured such that hybridization of the single stranded oligonucleotide to the PRC1-binding RNA does not activate an RNAse H pathway in the cell.
In some embodiments, the oligonucleotide is configured such that hybridization of the single stranded oligonucleotide to the PRC1-binding RNA does not induce substantial cleavage or degradation of the PRC1-binding RNA in the cell.
In some embodiments, the oligonucleotide is configured such that hybridization of the single stranded oligonucleotide to the PRC1-binding RNA interferes with interaction of the RNA with PRC1 in the cell.
In some embodiments, the target gene is a protein-coding gene.
In some embodiments, the chromosomal locus of the target gene is an endogenous gene of an autosomal chromosome.
In some embodiments, the cell is a cell of a male subject.
In some embodiments, the oligonucleotide has complementarity to a region of the PRC1-binding RNA transcribed from a portion of the target gene corresponding to an intron-exon junction or an intron.
In some embodiments, the oligonucleotide has complementarity to a region of the PRC1-binding RNA transcribed from a portion of the target gene corresponding to a translation initiation region or a translation termination region.
In some embodiments, the oligonucleotide has complementarity to a region of the PRC1-binding RNA transcribed from a portion of the target gene corresponding to a promoter.
In some embodiments, the oligonucleotide has complementarity to a region of the PRC1-binding RNA transcribed from a portion of the target gene corresponding to a 5′-UTR
In some embodiments, the oligonucleotide has complementarity to a region of the PRC1-binding RNA transcribed from a portion of the target gene corresponding to a 3′-UTR
In some or any embodiments, the inhibitory nucleic acid is an oligomeric base compound or oligonucleotide mimetic that hybridizes to at least a portion of the target nucleic acid and modulates its function. In some or any embodiments, the inhibitory nucleic acid is single stranded or double stranded. A variety of exemplary inhibitory nucleic acids are known and described in the art. In some examples, the inhibitory nucleic acid is an antisense oligonucleotide, locked nucleic acid (LNA) molecule, peptide nucleic acid (PNA) molecule, ribozyme, siRNA, antagomirs, external guide sequence (EGS) oligonucleotide, microRNA (miRNA), small, temporal RNA (stRNA), or single- or double-stranded RNA interference (RNAi) compounds. It is understood that the term “LNA molecule” refers to a molecule that comprises at least one LNA modification; thus LNA molecules may have one or more locked nucleotides (conformationally constrained) and one or more non-locked nucleotides. It is also understood that the term “LNA” includes a nucleotide that comprises any constrained sugar that retains the desired properties of high affinity binding to complementary RNA, nuclease resistance, lack of immune stimulation, and rapid kinetics. Exemplary constrained sugars include those listed below. Similarly, it is understood that the term “PNA molecule” refers to a molecule that comprises at least one PNA modification and that such molecules may include unmodified nucleotides or internucleoside linkages.
In some or any embodiments, the inhibitory nucleic acid comprises at least one nucleotide and/or nucleoside modification (e.g., modified bases or with modified sugar moieties), modified internucleoside linkages, and/or combinations thereof. Thus, inhibitory nucleic acids can comprise natural as well as modified nucleosides and linkages. Examples of such chimeric inhibitory nucleic acids, including hybrids or gapmers, are described below.
In some embodiments, the inhibitory nucleic acid comprises one or more modifications comprising: a modified sugar moiety, and/or a modified internucleoside linkage, and/or a modified nucleotide and/or combinations thereof. In some embodiments, the modified internucleoside linkage comprises at least one of: alkylphosphonate, phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, carboxymethyl ester, or combinations thereof. In some embodiments, the modified sugar moiety comprises a 2′-O-methoxyethyl modified sugar moiety, a 2′-methoxy modified sugar moiety, a 2′-O-alkyl modified sugar moiety, or a bicyclic sugar moiety. Other examples of modifications include locked nucleic acid (LNA), peptide nucleic acid (PNA), arabinonucleic acid (ANA), optionally with 2′-F modification, 2′-fluoro-D-Arabinonucleic acid (FANA), phosphorodiamidate morpholino oligomer (PMO), ethylene-bridged nucleic acid (ENA), optionally with 2′-0,4′-C-ethylene bridge, and bicyclic nucleic acid (BNA). Yet other examples are described below and/or are known in the art.
In some embodiments, the inhibitory nucleic acid is 5-40 bases in length (e.g., 12-30, 12-28, 12-25). The inhibitory nucleic acid may also be 10-50, or 5-50 bases length. For example, the inhibitory nucleic acid may be one of any of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases in length. In some embodiments, the inhibitory nucleic acid is double stranded and comprises an overhang (optionally 2-6 bases in length) at one or both termini. In other embodiments, the inhibitory nucleic acid is double stranded and blunt-ended. In some embodiments, the inhibitory nucleic acid comprises or consists of a sequence of bases at least 80% or 90% complementary to, e.g., at least 5, 10, 15, 20, 25 or 30 bases of, or up to 30 or 40 bases of, the target RNA, or comprises a sequence of bases with up to 3 mismatches (e.g., up to 1, or up to 2 mismatches) over 10, 15, 20, 25 or 30 bases of the target RNA.
Thus, the inhibitory nucleic acid can comprise or consist of a sequence of bases at least 80% complementary to at least 10 contiguous bases of the target RNA, or at least 80% complementary to at least 15, or 15-30, or 15-40 contiguous bases of the target RNA, or at least 80% complementary to at least 20, or 20-30, or 20-40 contiguous bases of the target RNA, or at least 80% complementary to at least 25, or 25-30, or 25-40 contiguous bases of the target RNA, or at least 80% complementary to at least 30, or 30-40 contiguous bases of the target RNA, or at least 80% complementary to at least 40 contiguous bases of the target RNA. Moreover, the inhibitory nucleic acid can comprise or consist of a sequence of bases at least 90% complementary to at least 10 contiguous bases of the target RNA, or at least 90% complementary to at least 15, or 15-30, or 15-40 contiguous bases of the target RNA, or at least 90% complementary to at least 20, or 20-30, or 20-40 contiguous bases of the target RNA, or at least 90% complementary to at least 25, or 25-30, or 25-40 contiguous bases of the target RNA, or at least 90% complementary to at least 30, or 30-40 contiguous bases of the target RNA, or at least 90% complementary to at least 40 contiguous bases of the target RNA. Similarly, the inhibitory nucleic acid can comprise or consist of a sequence of bases fully complementary to at least 5, 10, or 15 contiguous bases of the target RNA.
Complementarity can also be referenced in terms of the number of mismatches in complementary base pairing, as noted above. Thus, the inhibitory nucleic acid can comprise or consist of a sequence of bases with up to 3 mismatches over 10 contiguous bases of the target RNA, or up to 3 mismatches over 15 contiguous bases of the target RNA, or up to 3 mismatches over 20 contiguous bases of the target RNA, or up to 3 mismatches over 25 contiguous bases of the target RNA, or up to 3 mismatches over 30 contiguous bases of the target RNA. Similarly, the inhibitory nucleic acid can comprise or consist of a sequence of bases with up to 2 mismatches over 10 contiguous bases of the target RNA, or up to 2 mismatches over 15 contiguous bases of the target RNA, or up to 2 mismatches over 20 contiguous bases of the target RNA, or up to 2 mismatches over 25 contiguous bases of the target RNA, or up to 2 mismatches over 30 contiguous bases of the target RNA. Similarly, the inhibitory nucleic acid can comprise or consist of a sequence of bases with one mismatch over 10, 15, 20, 25 or 30 contiguous bases of the target RNA.
As such, in some embodiments the inhibitory nucleic acid comprises or consists of a sequence of bases about 5 to 40, or 8 to 40, or 10 to 50, or 5 to 50 bases in length, comprising a base sequence at least 80% complementary to (optionally one of at least 90%, 95%, 96%, 97%, 98%, 99% or 100% complementary to) a contiguous sequence of at least 5 to 40 bases, or 8 to 40, or 10 to 50, or 5 to 50 bases (optionally one of at least 10, 15, 20, 25 or 30 bases, or one of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases) of the target RNA. Thus, in some embodiments the inhibitory nucleic acid may comprise or consist of a sequence of at least 5 to 40, or 8 to 40, or 5 to 50, or 10 to 50, bases (optionally one of at least 10, 15, 20, 25 or 30 bases, or one of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases) having at least 80% identity to (optionally one of at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to) a contiguous sequence of bases of the same length of an antisense nucleic acid that is completely complementary in sequence to the target RNA. In some embodiments the sequence of the inhibitory nucleic acid may contain 1, 2 or 3 mismatches in complementary base pairing compared to the target ncRNA sequence, over 10, 15, 20, 25 or 30 bases (optionally one of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 bases) of the target RNA.
In some or any embodiments, the inhibitory nucleic acid is 5 to 40, or 8 to 40, or 10 to 50 bases in length (e.g., 12-30, 12-28, 12-25, 5-25, or 10-25, bases in length), and comprises a sequence of bases with up to 3 mismatches in complementary base pairing over 15 bases of, or up to 2 mismatches over 10 bases.
In some embodiments, gene expression is modulated in a cell. In some embodiments, the cell is a cancer cell, e.g., a tumor cell, in vitro or in vivo, e.g., in a subject. In other embodiments, the cell is a stem cell that is contacted with the inhibitory nucleic acid, PRC1-binding ncRNA, or fragment thereof, ex vivo, for example to enhance pluripotency, enhance differentiation, or induce the stem cell to differentiate to a particular cell type, e.g. nerve, neuron, dopaminergic neuron, muscle, skin, heart, kidney, liver, lung, neuroendocrine, retinal, retinal pigment epithelium, pancreatic alpha or beta cells, hematopoietic, chondrocyte, bone cells and/or blood cells (e.g., T-cells, B-cells, macrophages, erythrocytes, platelets, and the like).
In an additional aspect, the invention provides methods for enhancing pluripotency of a stem cell. The methods include contacting the cell with an inhibitory nucleic acid that specifically binds, or is complementary, to a nucleic acid sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to a PRC1-binding fragment thereof, as referred to in Tables 1-3. PRC1-binding fragments of murine or orthologous RNAs, including human RNAs, are contemplated in the aforementioned method.
In a further aspect, the invention features methods for enhancing differentiation of a stem cell, the method comprising contacting the cell with an inhibitory nucleic acid that specifically binds, or is complementary, to a PRC1-binding RNA sequence as set forth in SEQ ID NOS. 17416 to 36368 [mouse Peaks] or 1 to 5893 [human Peaks] or 5894 to 17416 [human Peaks identified by LiftOver].
In some embodiments, the stem cell is an embryonic stem cell. In some embodiments, the stem cell is an iPS cell or an adult stem cell.
In an additional aspect, the invention provides sterile compositions including an inhibitory nucleic acid that specifically binds to or is at least 90% complementary to (e.g., at least 5, 10, 15, 20, 25 or 30 bases of, or up to 30 or 40 bases of) a sequence listed in any of Tables 1-3, or any one of SEQ ID NOs: 17416 to 36368 [mouse Peaks] or 1 to 5893 [human Peaks] or 5894 to 17416 [human Peaks identified by LiftOver], or a related naturally occurring RNA at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to at least 15 (e.g., at least 20, 21, 25, 30, 100) nucleobases of an ncRNA of any of Tables 1-3 or any one of SEQ ID NOs: 17416 to 36368 [mouse Peaks] or 1 to 5893 [human Peaks] or 5894 to 17416 [human Peaks identified by LiftOver], for parenteral administration. In some embodiments, the inhibitory nucleic acid is selected from the group consisting of antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, micro RNAs (miRNAs); small, temporal RNAs (stRNA), and single- or double-stranded RNA interference (RNAi) compounds. In some embodiments, the RNAi compound is selected from the group consisting of short interfering RNA (siRNA); or a short, hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); and small activating RNAs (saRNAs).
In some embodiments, the antisense oligonucleotide is selected from the group consisting of antisense RNAs, antisense DNAs, chimeric antisense oligonucleotides, and antisense oligonucleotides.
In some embodiments, the inhibitory nucleic acid comprises one or more modifications comprising: a modified sugar moiety, a modified internucleoside linkage, a modified nucleotide and/or combinations thereof. In some embodiments, the modified internucleoside linkage comprises at least one of: alkylphosphonate, phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, carboxymethyl ester, or combinations thereof. In some embodiments, the modified sugar moiety comprises a 2′-O-methoxyethyl modified sugar moiety, a 2′-methoxy modified sugar moiety, a 2′-O-alkyl modified sugar moiety, or a bicyclic sugar moiety. Other examples of modifications include locked nucleic acid (LNA), peptide nucleic acid (PNA), arabinonucleic acid (ANA), optionally with 2′-F modification, 2′-fluoro-D-Arabinonucleic acid (FANA), phosphorodiamidate morpholino oligomer (PMO), ethylene-bridged nucleic acid (ENA), optionally with 2′-0,4′-C-ethylene bridge, and bicyclic nucleic acid (BNA). Yet other examples are described below and/or are known in the art.
PRC1-binding fragments of any of the RNA sequences set forth in the sequence listing as summarized below are contemplated. In some aspects, the fragments may recruit PRC1 and enhance PRC1 activity, thereby repressing gene expression, while in other instances the fragments may interfere with PRC1 activity by masking the ncRNA-binding sites on PRC1. In particular, the invention features uses of fragments of the RNA below to modulate expression of any of the genes set forth in Tables 1-3, for use in treating a disease, disorder, condition or association (whether in the “opposite strand” column or the “same strand” column).
Moreover, inhibitory nucleic acids that specifically bind to any of the RNA peaks set forth in the sequence listing as summarized below, any one of SEQ ID NOs: 1 to 5893, 5894 to 17415, or 17416 to 36368, are also contemplated. In particular, the invention features uses of these inhibitory nucleic acids to upregulate expression of any of the genes set forth in Tables 1-3, for use in treating a disease, disorder, condition or association known in the art (whether in the “opposite strand” column or the “same strand”); upregulations of a set of genes grouped together in any one of the categories is contemplated. In some embodiments it is contemplated that expression may be increased by at least about 15-fold, 20-fold, 30-fold, 40-fold, 50-fold or 100-fold, or any range between any of the foregoing numbers. In other experiments, increased mRNA expression has been shown to correlate to increased protein expression.
Thus, in various aspects, the invention features inhibitory nucleic acids that specifically bind to any of the RNA sequences of any of Tables 1-3, for use in modulating expression of a group of reference genes that fall within any one or more of the categories set forth in the tables, and for treating corresponding diseases, disorders or conditions.
In another aspect, the invention also features inhibitory nucleic acids that specifically bind, or are complementary, to any of the RNA sequences of SEQ ID NOS: 17416 to 36368 [mouse Peaks] or 1 to 5893 [human Peaks] or 5894 to 17416 [human Peaks identified by LiftOver], whether in the “opposite strand” column or the “same strand” column of Tables 1-3. In some embodiments, the inhibitory nucleic acid is provided for use in a method of modulating expression of a gene targeted by the PRC1-binding RNA (e.g., an intersecting or nearby gene, as set forth in any of Tables 1-4 below). Such methods may be carried out in vitro, ex vivo, or in vivo. In some embodiments, the inhibitory nucleic acid is provided for use in methods of treating disease, e.g. as described below. The treatments may involve modulating expression (either up or down) of a gene targeted by the PRC1-binding RNA, preferably upregulating gene expression. In some embodiments, the inhibitory nucleic acid is formulated as a sterile composition for parenteral administration. Thus, in one aspect the invention describes a group of inhibitory nucleic acids that specifically bind, or are complementary to, a group of RNA sequences, i.e., Peaks, in any one of Tables 1, 2, or 3. In particular, the invention features uses of such inhibitory nucleic acids to upregulate expression of any of the reference genes set forth in Tables 1-3, for use in treating a disease, disorder, or condition.
It is understood that inhibitory nucleic acids of the invention may be complementary to, or specifically bind to, Peaks, or regions adjacent to (within 100, 200, 300, 400, or 500 nts of) Peaks, as shown in Tables 1-3.
Also provided herein are methods for treating a subject with MECP2 Duplication Syndrome. The methods include administering a therapeutically effective amount of an inhibitory nucleic acid targeting a PRC1-binding region on Mecp2 RNA, e.g., an inhibitory nucleic acid targeting a sequence within the 3′UTR of Mecp2. In some embodiments, inhibitory nucleic acid comprises any of SEQ ID NOs:36399 to 36404.
Further provided herein are methods for treating a subject with systemic lupus erythematosus. The methods include administering a therapeutically effective amount of an inhibitory nucleic acid targeting a PRC1-binding region on IRAK1 RNA, e.g., an inhibitory nucleci acid targeting a sequence within the 3′UTR of IRAK1.
In some embodiments, the inhibitory nucleic acid comprises any of SEQ ID NOs:36396 to 36398.
In some embodiments, the inhibitory nucleic acid comprises at least one locked nucleotide.
Also provided herein are inhibitory nucleic acids targeting a PRC1-binding region on Mecp2 RNA, preferably wherein the PRC1 binding region comprises SEQ ID NO:5876 or 5877, and/or preferably an inhibitory nucleic acid targeting a sequence within the 3′UTR of Mecp2, for use in treating a subject with MECP2 Duplication Syndrome, e.g., comprising any of SEQ ID NOs:36399 to 36404.
In addition, provided herein are inhibitory nucleic acids targeting a PRC1-binding region on IRAK1 RNA, preferably wherein the PRC1 binding region comprises SEQ ID NO:5874 or 5875, and/or preferably an inhibitory nucleic acid targeting a sequence within the 3′UTR of IRAK1, for use in treating a subject with systemic lupus erythematosus, e.g., an inhibitory nucleic acid comprising any of SEQ ID NOs:36396 to 36398.
In some or any embodiments, the inhibitory nucleic acids are, e.g., about 5 to 40, about 8 to 40, or 10 to 50 bases, or 5 to 50 bases in length. In some embodiments, the inhibitory nucleic acid comprises or consists of a sequence of bases at least 80% or 90% complementary to, e.g., at least 5, 10, 15, 20, 25 or 30 bases of, or up to 30 or 40 bases of, the target RNA (e.g., any one of SEQ ID NOs: 1 to 36,368), or comprises a sequence of bases with up to 3 mismatches (e.g., up to 1, or up to 2 mismatches) over 10, 15, 20, 25 or 30 bases of the target RNA.
Thus, as noted above, the inhibitory nucleic acid can comprise or consist of a sequence of bases at least 80% complementary to at least 10, or 10-30 or 10-40 contiguous bases of the target RNA, or at least 80% complementary to at least 15, or 15-30, or 15-40 contiguous bases of the target RNA, or at least 80% complementary to at least 20, or 20-30, or 20-40 contiguous bases of the target RNA, or at least 80% complementary to at least 25, or 25-30, or 25-40 contiguous bases of the target RNA, or at least 80% complementary to at least 30, or 30-40 contiguous bases of the target RNA, or at least 80% complementary to at least 40 contiguous bases of the target RNA. Moreover, the inhibitory nucleic acid can comprise or consist of a sequence of bases at least 90% complementary to at least 5, or 5-30 or 5-40 or 8-40 contiguous bases of the target RNA, or at least 90% complementary to at least 10, or 10-30, or 10-40 contiguous bases of the target RNA, or at least 90% complementary to at least 15, or 15-30, or 15-40 contiguous bases of the target RNA, or at least 90% complementary to at least 20, or 20-30, or 20-40 contiguous bases of the target RNA, or at least 90% complementary to at least 25, or 25-30, or 25-40 contiguous bases of the target RNA, or at least 90% complementary to at least 30, or 30-40 contiguous bases of the target RNA, or at least 90% complementary to at least 40 contiguous bases of the target RNA. Similarly, the inhibitory nucleic acid can comprise or consist of a sequence of bases fully complementary to at least 5, 10, or 15 contiguous bases of the target RNA. It is understood that some additional non-complementary bases may be included. It is understood that inhibitory nucleic acids that comprise such sequences of bases as described may also comprise other non-complementary bases. For example, an inhibitory nucleic acid can be 20 bases in total length but comprise a 15 base portion that is fully complementary to 15 bases of the target RNA. Similarly, an inhibitory nucleic acid can be 20 bases in total length but comprise a 15 base portion that is at least 80% complementary to 15 bases of the target RNA.
Complementarity can also be referenced in terms of the number of mismatches in complementary base pairing, as noted above. Thus, the inhibitory nucleic acid can comprise or consist of a sequence of bases with up to 3 mismatches over 10 contiguous bases of the target RNA, or up to 3 mismatches over 15 contiguous bases of the target RNA, or up to 3 mismatches over 20 contiguous bases of the target RNA, or up to 3 mismatches over 25 contiguous bases of the target RNA, or up to 3 mismatches over 30 contiguous bases of the target RNA. Similarly, the inhibitory nucleic acid can comprise or consist of a sequence of bases with up to 2 mismatches over 10 contiguous bases of the target RNA, or up to 2 mismatches over 15 contiguous bases of the target RNA, or up to 2 mismatches over 20 contiguous bases of the target RNA, or up to 2 mismatches over 25 contiguous bases of the target RNA, or up to 2 mismatches over 30 contiguous bases of the target RNA. Similarly, the inhibitory nucleic acid can comprise or consist of a sequence of bases with one mismatch over 10, 15, 20, 25 or 30 contiguous bases of the target RNA.
In some or any of the embodiments of inhibitory nucleic acids described herein (e.g. in the summary, detailed description, or examples of embodiments) or the processes for designing or synthesizing them, the inhibitory nucleic acids may optionally exclude (a) any LNA that disrupts binding of PRC2 to an RNA, e.g., as describe in WO 2012/087983 or WO 2012/065143; (b) any one or more of the specific inhibitory nucleic acids made or actually disclosed (i.e. specific chemistry, single or double-stranded, specific modifications, and specific base sequence), set forth in WO 2012/065143 or WO 2012/087983; and/or the general base sequence of any one or more of the inhibitory nucleic acids of (b); and/or (c) the group of inhibitory nucleic acids that specifically bind or are complementary to the same specific portion of RNA (a stretch of contiguous bases) as any one or more of the inhibitory nucleic acids of (a); as disclosed in any one or more of the following publications: as targeting ANRIL RNA (as described in Yap et al., Mol Cell. 2010 Jun. 11; 38(5):662-74) HOTAIR RNA (Rinn et al., 2007), Tsix, RepA, or Xist RNAs ((Zhao et al., 2008) [SEQ ID NOs: 936166-936170 of WO 2012/087983], or (Sarma et al., 2010) [SEQ ID NOs: 936177-936186 of WO 2012/087983] or (Zhao et al., 2010) [SEQ ID NOs: 936187-936188 of WO 2012/087983] or (Prasnath et al., 2005) [SEQ ID NOs: 936173-936176 of WO 2012/087983] or (Shamovsky et al., 2006) [SEQ ID NO: 936172 of WO 2012/087983] or (Mariner et al., 2008) [SEQ ID NO: 936171 of WO 2012/087983] or (Sunwoo et al., 2008) or (Bernard et al., 2010) [SEQ ID NO: 936189 of WO 2012/087983]; or as targeting short RNAs of 50-200 nt that are identified as candidate PRC2 regulators (Kanhere et al., 2010); or (Kuwabara et al., US 2005/0226848) [SEQ ID NOs: 936190-936191 of WO 2012/087983] or (Li et al., US 2010/0210707) [SEQ ID NOs: 936192-936227 of WO 2012/087983] or (Corey et al., 7,709,456) [SEQ ID NOs: 936228-936245] or (Mattick et al., WO 2009/124341), or (Corey et al., US 2010/0273863) [SEQ ID NOs: 936246-936265 of WO 2012/087983], or (Wahlstedt et al., US 2009/0258925) [SEQ ID NOs: 935060-935126 of WO 2012/087983], or BACE: US 2009/0258925 [SEQ ID NOs: 935060-935126 of WO 2012/087983]; ApoA1: US 2010/0105760/EP235283 [SEQ ID NOs: 935127-935299 of WO 2012/087983], P73, p53, PTEN, WO 2010/065787 A2/EP2370582 [SEQ ID NOs: 935300-935345 of WO 2012/087983]; SIRT1: WO 2010/065662 A2/EP09831068 [SEQ ID NOs: 935346-935392 of WO 2012/087983]; VEGF: WO 2010/065671 A2/EP2370581 [SEQ ID NOs: 935393-935403 of WO 2012/087983]; EPO: WO 2010/065792 A2/EP09831152 [SEQ ID NOs: 935404-935412 of WO 2012/087983]; BDNF: WO2010/093904 [SEQ ID NOs: 935413-935423 of WO 2012/087983], DLK1: WO 2010/107740 [SEQ ID NOs: 935424-935430 of WO 2012/087983]; NRF2/NFE2L2: WO 2010/107733 [SEQ ID NOs: 935431-935438 of WO 2012/087983]; GDNF: WO 2010/093906 [SEQ ID NOs: 935439-935476 of WO 2012/087983]; SOX2, KLF4, Oct3A/B, “reprogramming factors: WO 2010/135329 [SEQ ID NOs: 935477-935493 of WO 2012/087983]; Dystrophin: WO 2010/129861 [SEQ ID NOs: 935494-935525 of WO 2012/087983]; ABCA1, LCAT, LRP1, ApoE, LDLR, ApoA1: WO 2010/129799 [SEQ ID NOs: 935526-935804 of WO 2012/087983]; HgF: WO 2010/127195 [SEQ ID NOs: 935805-935809 of WO 2012/087983]; TTP/Zfp36: WO 2010/129746[SEQ ID NOs: 935810-935824 of WO 2012/087983]; TFE3, IRS2: WO 2010/135695 [SEQ ID NOs: 935825-935839 of WO 2012/087983]; RIG1, MDA5, IFNA1: WO 2010/138806 [SEQ ID NOs: 935840-935878 of WO 2012/087983]; PON1: WO 2010/148065 [SEQ ID NOs: 935879-935885 of WO 2012/087983]; Collagen: WO/2010/148050 [SEQ ID NOs: 935886-935918 of WO 2012/087983]; Dyrk1A, Dscr1, “Down Syndrome Gene”: WO/2010/151674 [SEQ ID NOs: 935919-935942 of WO 2012/087983]; TNFR2: WO/2010/151671 [SEQ ID NOs: 935943-935951 of WO 2012/087983]; Insulin: WO/2011/017516 [SEQ ID NOs: 935952-935963 of WO 2012/087983]; ADIPOQ: WO/2011/019815 [SEQ ID NOs: 935964-935992 of WO 2012/087983]; CHIP: WO/2011/022606 [SEQ ID NOs: 935993-936004 of WO 2012/087983]; ABCB1: WO/2011/025862 [SEQ ID NOs: 936005-936014 of WO 2012/087983]; NEUROD1, EUROD1, HNF4A, MAFA, PDX, KX6, “Pancreatic development gene”: WO/2011/085066 [SEQ ID NOs: 936015-936054 of WO 2012/087983]; MBTPS1: WO/2011/084455 [SEQ ID NOs: 936055-936059 of WO 2012/087983]; SHBG: WO/2011/085347 [SEQ ID NOs: 936060-936075 of WO 2012/087983]; IRF8: WO/2011/082409 [SEQ ID NOs: 936076-936080 of WO 2012/087983]; UCP2: WO/2011/079263 [SEQ ID NOs: 936081-936093 of WO 2012/087983]; HGF: WO/2011/079261 [SEQ ID NOs: 936094-936104 of WO 2012/087983]; GH: WO/2011/038205 [SEQ ID NOs: 936105-936110 of WO 2012/087983]; IQGAP: WO/2011/031482 [SEQ ID NOs: 936111-936116 of WO 2012/087983]; NRF1: WO/2011/090740 [SEQ ID NOs: 936117-936123 of WO 2012/087983]; P63: WO/2011/090741 [SEQ ID NOs: 936124-936128 of WO 2012/087983]; RNAseH1: WO/2011/091390 [SEQ ID NOs: 936129-936140 of WO 2012/087983]; ALOX12B: WO/2011/097582 [SEQ ID NOs: 936141-936146 of WO 2012/087983]; PYCR1: WO/2011/103528 [SEQ ID NOs: 936147-936151 of WO 2012/087983]; CSF3: WO/2011/123745 [SEQ ID NOs: 936152-936157 of WO 2012/087983]; FGF21: WO/2011/127337 [SEQ ID NOs: 936158-936165 of WO 2012/087983]; SIRTUIN (SIRT): WO2011/139387 [SEQ ID NOs: 936266-936369 and 936408-936425 of WO 2012/087983]; PAR4: WO2011/143640 [SEQ ID NOs: 936370-936376 and 936426 of WO 2012/087983]; LHX2: WO2011/146675 [SEQ ID NOs: 936377-936388 and 936427-936429 of WO 2012/087983]; BCL2L11: WO2011/146674 [SEQ ID NO: 936389-936398 and 936430-936431 of WO 2012/087983]; MSRA: WO2011/150007 [SEQ ID NOs: 936399-936405 and 936432 of WO 2012/087983]; ATOH1: WO2011/150005 [SEQ ID NOs: 936406-936407 and 936433 of WO 2012/087983] of which each of the foregoing is incorporated by reference in its entirety herein. In some or any of the embodiments, optionally excluded from the invention are of inhibitory nucleic acids that specifically bind to, or are complementary to, any one or more of the following regions: Nucleotides 1-932 of SEQ ID NO: 935128 of WO 2012/087983; Nucleotides 1-1675 of SEQ ID NO: 935306 of WO 2012/087983; Nucleotides 1-518 of SEQ ID NO: 935307 of WO 2012/087983; Nucleotides 1-759 of SEQ ID NO: 935308 of WO 2012/087983; Nucleotides 1-25892 of SEQ ID NO: 935309 of WO 2012/087983; Nucleotides 1-279 of SEQ ID NO: 935310 of WO 2012/087983; Nucleotides 1-1982 of SEQ ID NO: 935311 of WO 2012/087983; Nucleotides 1-789 of SEQ ID NO: 935312 of WO 2012/087983; Nucleotides 1-467 of SEQ ID NO: 935313 of WO 2012/087983; Nucleotides 1-1028 of SEQ ID NO: 935347 of WO 2012/087983; Nucleotides 1-429 of SEQ ID NO: 935348 of WO 2012/087983; Nucleotides 1-156 of SEQ ID NO: 935349 of WO 2012/087983; Nucleotides 1-593 of SEQ ID NO:935350 of WO 2012/087983; Nucleotides 1-643 of SEQ ID NO: 935395 of WO 2012/087983; Nucleotides 1-513 of SEQ ID NO: 935396 of WO 2012/087983; Nucleotides 1-156 of SEQ ID NO: 935406 of WO 2012/087983; Nucleotides 1-3175 of SEQ ID NO: 935414 of WO 2012/087983; Nucleotides 1-1347 of SEQ ID NO: 935426 of WO 2012/087983; Nucleotides 1-5808 of SEQ ID NO: 935433 of WO 2012/087983; Nucleotides 1-237 of SEQ ID NO: 935440 of WO 2012/087983; Nucleotides 1-1246 of SEQ ID NO: 935441 of WO 2012/087983; Nucleotides 1-684 of SEQ ID NO: 935442 of WO 2012/087983; Nucleotides 1-400 of SEQ ID NO: 935473 of WO 2012/087983; Nucleotides 1-619 of SEQ ID NO: 935474 of WO 2012/087983; Nucleotides 1-813 of SEQ ID NO: 935475 of WO 2012/087983; Nucleotides 1-993 of SEQ ID NO: 935480 of WO 2012/087983; Nucleotides 1-401 of SEQ ID NO: 935480 of WO 2012/087983; Nucleotides 1-493 of SEQ ID NO: 935481 of WO 2012/087983; Nucleotides 1-418 of SEQ ID NO: 935482 of WO 2012/087983; Nucleotides 1-378 of SEQ ID NO: 935496 of WO 2012/087983; Nucleotides 1-294 of SEQ ID NO: 935497 of WO 2012/087983; Nucleotides 1-686 of SEQ ID NO: 935498 of WO 2012/087983; Nucleotides 1-480 of SEQ ID NO: 935499 of WO 2012/087983; Nucleotides 1-501 of SEQ ID NO: 935500 of WO 2012/087983; Nucleotides 1-1299 of SEQ ID NO: 935533 of WO 2012/087983; Nucleotides 1-918 of SEQ ID NO: 935534 of WO 2012/087983; Nucleotides 1-1550 of SEQ ID NO: 935535 of WO 2012/087983; Nucleotides 1-329 of SEQ ID NO: 935536 of WO 2012/087983; Nucleotides 1-1826 of SEQ ID NO: 935537 of WO 2012/087983; Nucleotides 1-536 of SEQ ID NO: 935538 of WO 2012/087983; Nucleotides 1-551 of SEQ ID NO: 935539 of WO 2012/087983; Nucleotides 1-672 of SEQ ID NO: 935540 of WO 2012/087983; Nucleotides 1-616 of SEQ ID NO: 935541 of WO 2012/087983; Nucleotides 1-471 of SEQ ID NO: 935542 of WO 2012/087983; Nucleotides 1-707 of SEQ ID NO: 935543 of WO 2012/087983; Nucleotides 1-741 of SEQ ID NO: 935544 of WO 2012/087983; Nucleotides 1-346 of SEQ ID NO: 935545 of WO 2012/087983; Nucleotides 1-867 of SEQ ID NO: 935546 of WO 2012/087983; Nucleotides 1-563 of SEQ ID NO: 935547 of WO 2012/087983; Nucleotides 1-970 of SEQ ID NO: 935812 of WO 2012/087983; Nucleotides 1-1117 of SEQ ID NO: 935913 of WO 2012/087983; Nucleotides 1-297 of SEQ ID NO: 935814 of WO 2012/087983; Nucleotides 1-497 of SEQ ID NO: 935827 of WO 2012/087983; Nucleotides 1-1267 of SEQ ID NO: 935843 of WO 2012/087983; Nucleotides 1-586 of SEQ ID NO: 935844 of WO 2012/087983; Nucleotides 1-741 of SEQ ID NO: 935845 of WO 2012/087983; Nucleotides 1-251 of SEQ ID NO: 935846 of WO 2012/087983; Nucleotides 1-681 of SEQ ID NO: 935847 of WO 2012/087983; Nucleotides 1-580 of SEQ ID NO: 935848 of WO 2012/087983; Nucleotides 1-534 of SEQ ID NO: 935880 of WO 2012/087983; Nucleotides 1-387 of SEQ ID NO: 935889 of WO 2012/087983; Nucleotides 1-561 of SEQ ID NO: 935890 of WO 2012/087983; Nucleotides 1-335 of SEQ ID NO: 935891 of WO 2012/087983; Nucleotides 1-613 of SEQ ID NO: 935892 of WO 2012/087983; Nucleotides 1-177 of SEQ ID NO: 935893 of WO 2012/087983; Nucleotides 1-285 of SEQ ID NO: 935894 of WO 2012/087983; Nucleotides 1-3814 of SEQ ID NO: 935921 of WO 2012/087983; Nucleotides 1-633 of SEQ ID NO: 935922 of WO 2012/087983; Nucleotides 1-497 of SEQ ID NO: 935923 Nucleotides 1-545 of SEQ ID NO: 935924 of WO 2012/087983; Nucleotides 1-413 of SEQ ID NO: 935950 of WO 2012/087983; Nucleotides 1-413 of SEQ ID NO: 935951 of WO 2012/087983; Nucleotides 1-334 of SEQ ID NO: 935962 of WO 2012/087983; Nucleotides 1-582 of SEQ ID NO: 935963 of WO 2012/087983; Nucleotides 1-416 of SEQ ID NO: 935964 of WO 2012/087983; Nucleotides 1-3591 of SEQ ID NO: 935990 of WO 2012/087983; Nucleotides 1-875 of SEQ ID NO: 935991 of WO 2012/087983; Nucleotides 1-194 of SEQ ID NO: 935992 of WO 2012/087983; Nucleotides 1-2074 of SEQ ID NO: 936003 of WO 2012/087983; Nucleotides 1-1237 of SEQ ID NO: 936004 of WO 2012/087983; Nucleotides 1-4050 of SEQ ID NO: 936013 of WO 2012/087983; Nucleotides 1-1334 of SEQ ID NO: 936014 of WO 2012/087983; Nucleotides 1-1235 of SEQ ID NO: 936048 of WO 2012/087983; Nucleotides 1-17,964 of SEQ ID NO: 936049 of WO 2012/087983; Nucleotides 1-50,003 of SEQ ID NO: 936050 of WO 2012/087983; Nucleotides 1-486 of SEQ ID NO: 936051 of WO 2012/087983; Nucleotides 1-494 of SEQ ID NO: 936052 of WO 2012/087983; Nucleotides 1-1992 of SEQ ID NO: 936053 of WO 2012/087983; Nucleotides 1-1767 of SEQ ID NO: 936054 of WO 2012/087983; Nucleotides 1-1240 of SEQ ID NO: 936059 of WO 2012/087983; Nucleotides 1-3016 of SEQ ID NO: 936074 of WO 2012/087983; Nucleotides 1-1609 of SEQ ID NO: 936075 of WO 2012/087983; Nucleotides 1-312 of SEQ ID NO: 936080 of WO 2012/087983; Nucleotides 1-243 of SEQ ID NO: 936092 of WO 2012/087983; Nucleotides 1-802 of SEQ ID NO: 936093 of WO 2012/087983; Nucleotides 1-514 of SEQ ID NO: 936102 of WO 2012/087983; Nucleotides 1-936 of SEQ ID NO: 936103 of WO 2012/087983; Nucleotides 1-1075 of SEQ ID NO: 936104 of WO 2012/087983; Nucleotides 1-823 of SEQ ID NO: 936110 of WO 2012/087983; Nucleotides 1-979 of SEQ ID NO: 936116 of WO 2012/087983; Nucleotides 1-979 of SEQ ID NO: 936123 of WO 2012/087983; Nucleotides 1-288 of SEQ ID NO: 936128 of WO 2012/087983; Nucleotides 1-437 of SEQ ID NO: 936137 of WO 2012/087983; Nucleotides 1-278 of SEQ ID NO: 936138 of WO 2012/087983; Nucleotides 1-436 of SEQ ID NO: 936139 of WO 2012/087983; Nucleotides 1-1140 of SEQ ID NO: 936140 of WO 2012/087983; Nucleotides 1-2082 of SEQ ID NO: 936146 of WO 2012/087983; Nucleotides 1-380 of SEQ ID NO: 936151 of WO 2012/087983; Nucleotides 1-742 of SEQ ID NO: 936157 of WO 2012/087983; Nucleotides 1-4246 of SEQ ID NO: 936165 of WO 2012/087983; Nucleotides 1-1028 of SEQ ID NO: 936408 of WO 2012/087983; Nucleotides 1-429 of SEQ ID NO: 936409 of WO 2012/087983; Nucleotides 1-508 of SEQ ID NO: 936410 of WO 2012/087983; Nucleotides 1-593 of SEQ ID NO: 936411 of WO 2012/087983; Nucleotides 1-373 of SEQ ID NO: 936412 of WO 2012/087983; Nucleotides 1-1713 of SEQ ID NO: 936413 of WO 2012/087983; Nucleotides 1-660 of SEQ ID NO:936414 of WO 2012/087983; Nucleotides 1-589 of SEQ ID NO: 936415 of WO 2012/087983; Nucleotides 1-726 of SEQ ID NO: 936416 of WO 2012/087983; Nucletides 1-320 of SEQ ID NO: 936417 of WO 2012/087983; Nucletides 1-616 of SEQ ID NO: 936418 of WO 2012/087983; Nucletides 1-492 of SEQ ID NO: 936419 of WO 2012/087983; Nucletides 1-428 of SEQ ID NO: 936420 of WO 2012/087983; Nucletides 1-4041 of SEQ ID NO: 936421 of WO 2012/087983; Nucletides 1-705 of SEQ ID NO: 936422 of WO 2012/087983; Nucletides 1-2714 of SEQ ID NO: 936423 of WO 2012/087983; Nucletides 1-1757 of SEQ ID NO: 936424 of WO 2012/087983; Nucletides 1-3647 of SEQ ID NO: 936425 of WO 2012/087983; Nucleotides 1-354 of SEQ ID NO: 936426 of WO 2012/087983; Nucleotides 1-2145 of SEQ ID NO: 936427, Nucleotides 1-606 of SEQ ID NO: 936428 of WO 2012/087983; Nucleotides 1-480 of SEQ ID NO: 936429 of WO 2012/087983; Nucleotides 1-3026 of SEQ ID NO: 936430 of WO 2012/087983; Nucleotides 1-1512 of SEQ ID NO: 936431 of WO 2012/087983; Nucleotides 1-3774 of SEQ ID NO: 936432 of WO 2012/087983; Nucleotides 1-589 of SEQ ID NO: 936433.
In some of the embodiments of inhibitory nucleic acids described herein, or processes for designing or synthesizing them, the inhibitory nucleic acids will upregulate gene expression and may specifically bind or specifically hybridize or be complementary to the PRC1-binding RNA that is transcribed from the same strand as a protein coding reference gene. The inhibitory nucleic acid may bind to a region of the PRC1-binding RNA, that originates within or overlaps an intron, exon, intron-exon junction, 5′ UTR, 3′ UTR, a translation initiation region, or a translation termination region of a protein-coding sense-strand of a reference gene (refGene).
In some or any of the embodiments of inhibitory nucleic acids described herein, or processes for designing or synthesizing them, the inhibitory nucleic acids will upregulate gene expression and may specifically bind or specifically hybridize or be complementary to a PRC1 binding RNA that transcribed from the opposite strand (the antisense-strand) of a protein-coding reference gene.
The inhibitory nucleic acids described herein may be modified, e.g. comprise a modified sugar moiety, a modified internucleoside linkage, a modified nucleotide and/or combinations thereof. In addition, the inhibitory nucleic acids can exhibit one or more of the following properties: do not induce substantial cleavage or degradation of the target RNA; do not cause substantially complete cleavage or degradation of the target RNA; do not activate the RNAse H pathway; do not activate RISC; do not recruit any Argonaute family protein; are not cleaved by Dicer; do not mediate alternative splicing; are not immune stimulatory; are nuclease resistant; have improved cell uptake compared to unmodified oligonucleotides; are not toxic to cells or mammals; may have improved endosomal exit; do interfere with interaction of ncRNA with PRC1, preferably the Ezh2 subunit but optionally the Suz12, Eed, RbAp46/48 subunits or accessory factors such as Jarid2; do decrease histone H3-lysine27 methylation and/or do upregulate gene expression.
In some or any of the embodiments of inhibitory nucleic acids described herein, or processes for designing or synthesizing them, the inhibitory nucleic acids may optionally exclude those that bind DNA of a promoter region, as described in Kuwabara et al., US 2005/0226848 or Li et al., US 2010/0210707 or Corey et al., 7,709,456 or Mattick et al., WO 2009/124341, or those that bind DNA of a 3′ UTR region, as described in Corey et al., US 2010/0273863.
Inhibitory nucleic acids that are designed to interact with RNA to modulate gene expression are a distinct subset of base sequences from those that are designed to bind a DNA target (e.g., are complementary to the underlying genomic DNA sequence from which the RNA is transcribed).
This application incorporates by reference the entire disclosures of U.S. provisional Nos. 61/425,174 filed on Dec. 20, 2010, and 61/512,754 filed on Jul. 28, 2011, and International Patent Appliation Nos. PCT/US2011/060493, filed Nov. 12, 2011, and PCT/US2011/065939, filed on Dec. 19, 2011.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.
FIGS. 1A-B are schematics of exemplary denaturing CLIP (dCLIP) pull-down methods (1A) and library preparation methods (1B).
FIGS. 2A-C show four test genes for effects of disrupting PRC1-3′UTR interactions. IGV screenshots shown for three Chromobox Homolog 7 (CBX7)-binding RNAs: (2A) Mouse DDB1 and CUL4 Associated Factor 12-Like 1 (Dcaf12L1); (2B) Mouse Calmodulin 2 (Calm2); (2C) Mouse methyl CpG binding protein 2 (Mecp2). For each gene, the RNA-seq profile shows the FPKM expression values of each gene. CLIP-seq profiles are then shown for various biological replicates (e.g., Cbx7 #1, #2, #3). For Dcaf12L1 and Calm2, statistically significant peaks (“Peak”, as called by PeakRanger software) shown as bars under each replicate's track. Two control (tag-only libraries) are shown for each gene. Only the relevant strand is shown (Watson or Crick). Note highly reproducible CLIP profiles and very clean control libraries. ASO LNA mixmers used for knockoff analysis are shown as black bars. The mixmers were pooled for the transfections.
FIGS. 3A-C are graphs showing gene upregulation as a result of disrupting PRC1-3′UTR interactions. 16.7 ES cells were nucleofected with pooled mixmer LNAs against Calmodulin 2 (Calm2) (leftmost bars) or DDB1 and CUL4 Associated Factor 12-Like 1 (Dcafl2L1) (middle bars); Dual-specific phosphatase 9 (Dusp9) was used as a negative control (right bars). Cells were harvested after 24 hours and whole cell RNA was used for quantitative gene expression analysis using real-time RT-PCR. Expression of specific transcripts was normalized to beta-actin as a reference gene.
FIGS. 4A-B shows the test gene, nix, and results of knocking off PRC1 from Tsix RNA. (4A) The RNA-seq profile shows the Fragments Per Kilobase of transcript per Million mapped reads (FPKM) expression values of each gene. CLIP-seq profiles are then shown for two biological replicates (Cbx7 #1, #2), with corresponding statistically significant peaks (“Peak”, as called by PeakRanger software) shown as bars under each replicate's track. Two control (tag-only libraries) are shown for each gene. Antisense oligonucleotide (ASO) LNA mixmers used for knockoff analysis are shown as black bars. The mixmers were pooled for the transfections. Only the Watson strand is shown in the figure. (4B) Tsix RNA is a repressor of Xist expression. Here we hypothesized that Tsix recruits PRC1 to repress Xist expression. The RT-qPCR analysis performed 6 hours after administering Tsix LNAs support this interaction. Xist upregulation was achieved specifically.
Table 1: Human CBX7-RNA binding sites as determined by denaturing CLIP-seq analysis in Human 293 cells. All coordinates in hg19. The columns (c) correspond to: c1, SEQ ID Number. c2, Chromosome number. c3, Read start position. c4, Read end position. c5, chromosome strand that the transcript is made from (+, top or Watson strand; −, bottom or Crick strand of each chromosome). C6, nearest gene name. c7, gene categories as defined in Example 2.
Table 2: Human LiftOver sequences corresponding to CBX7-RNA binding sites as determined by denaturing CLIP-seq analysis in mouse ES cells shown. All coordinates in hg19. CBX7-binding sites derived from CLIP-seq performed in the mouse ES cell line, 16.7, as shown in Table 3, are translated from mouse mm9 to human hg19 coordinates.
Table 3: Mouse CBX7-RNA binding sites as determined by denaturing CLIP-seq analysis in ES cells derived from Mus musculus. All coordinates in mm9. CLIP-seq performed in the mouse ES cell line, EL 16.7. CBX7 binding sites in the RNA are shown.
The new ‘denaturing’ CLIP-seq (dCLIP-seq) method, which utilizes a biotin tag to enable purification of RNA-protein complexes under denaturing conditions to increase the specificity of the purification scheme, was used to capture a genome-wide pool of transcripts (>30 nt) that bind with the PRC1 complex via the CBX7 subunit. Transcriptome characterization has identified classes of medically significant targets. Many if not all of the mouse PRC1-transcripts identified herein were shown by LiftOver analysis to have direct counterparts in the human epigenome.
As demonstrated herein, at least a subset of RNAs directly interacts with PRC1 in vivo and, in many cases, the interacting subunit is a CBX protein, e.g., CBX7. In some cases, the interacting subunit is CBX2, 4, 6, or 8. CBX7 is generally expressed earlier in development in less-differentiated cells, while CBX2, 4, 6, 8 are expressed in more differentiated cells and may be more tissue-specific. The CBX family is likely to have highly overlapping RNA interactomes, because the proteins are highly similar to each other and have RNA-binding domains.
The present analysis suggests that both cis and trans mechanisms may be utilized by RNAs in the PRC1 RNA interactome. As shown herein, PRC1 has a number of different cis-regulatory effects. PRC1 binding sites can be classified into several groups, including (i) 3′ untranslated region (3′ UTR), (ii) promoter-associated, (iii) gene body, (iv) antisense, and (v) intergenic. Disrupting the interaction between PRC1 and a binding RNA could lead to either activation or repression. For example, targeting the PRC1 binding sites within the 3′ UTR of Calm2 and Dcafl211 results in upregulation of these coding genes (FIG. 3). Calm2 is a member of the calmodulin gene family, with three distinct calmodulin genes throughout the genome that encode an identical protein. CALM2 is a calcium binding protein that plays a role in signaling pathways, cell cycle progression and proliferation. Mutations are associated with long-QT syndrome (LQTS, life-threatening ventricular arrhythmias) with delayed neurodevelopment and epilepsy. By contrast, targeting various regions within Mecp2 and IRAK1 resulted in gene downregulation (FIGS. 5A-B). The present methods may be especially useful when one aims to titrate down but not eliminate gene expression, such as in the case of MECP2 Duplication Syndrome (a disease in which the MECP2 gene is duplicated and causes an Rett Syndrome-like disorder) or for treating autoimmune or inflammatory diseases, such as systemic lupus erythematosis (SLE), for which IRAK1 (interleukin 1 associated kinase 1) has been implicated.
As used herein, the 3′UTR is the last exon of a protein coding gene that usually includes the last few translated codons and the rest of the untranslated 3′ end of the mRNA encoded by the gene.
The evidence presented herein further demonstrates that RNA cofactors are a general feature of Polycomb regulation and that inhibitory nucleic acids as described herein that target RNAs in the PRC1 RNA interactome can successfully modulate (e.g., upregulate) gene expression, with effects dependent on the target site in the interacting transcript. The effects are presumed to be caused by inhibiting PRC1-RNA interactions. Genes in cis, in either antisense-strand orientation or same strand orientation, and extending 1 kb or more, e.g. 5 or 20 kb, from the location of the PRC1-binding RNA, can be regulated. Because chromatin modifiers such as PRC1 play a central role in maintaining stem cell pluripotency and in cancer, a genome-wide profile of regulatory RNAs will be a valuable resource in the quest to diagnose and treat disease. To downregulate gene expression, targeting RNA-PRC1 interactions by antisense oligonucleotides provides an alternative approach to RNAi methods, when one aims to titrate down but not eliminate gene expression, such as in the case of MECP2 Duplication Syndrome (a disease in which the MECP2 gene is duplicated and causes an Rett Syndrome-like disorder) or for treating autoimmune or inflammatory diseases, such as systemic lupus erythematosis (SLE), for which IRAK1 (interleukin 1 associated kinase 1) has been implicated.
Denaturing CLIP-seq Methods (dCLIP-seq)
Described herein are methods for pulling down RNAs that bind to a protein of interest, to produce libraries of those RNAs, and to identify regions of the RNAs to which the proteins bind. These methods were used to identify RNAs that bind the CBX7 portion of the PRC1 complex, but can be used with any proteins known or suspected to bind RNA. In some embodiments, the methods include the steps shown in FIGS. 1A and/or 1B; one of skill in the art will appreciate that other techniques can be substituted for those shown. These include conventional CLIP (see, e.g., Davidovich et al., Mol Cell. 2015 Feb. 5; 57(3):552-8), HITS-CLIP (Darnell, Wiley Interdiscip Rev RNA. 2010 September-October; 1(2): 266-286), PAR-CLIP, iCLIP (huppertz et al., Methods. 2014 February; 65(3): 274-287), and native RIP (Zhao et al., Mol Cell. 2010 Dec. 22; 40(6):939-53).
In preferred embodiments, the methods are practiced using cells, e.g., mammalian cells, that express the bacterial biotin ligase BirA, and an RNA-binding protein of interest, e.g., CBX2, CBX4, CBX6, CBX7, or CBX8, fused to a biotinylation tag sequence. In some embodiments, the BirA and RNA binding protein are on separate vectors, preferably separate vectors with different selectable markers, e.g., different antibiotic resistance genes, or different fluorescent proteins. In some embodiments, the BirA is expressed from a first vector under neomycin resistance, and the protein of interest fused to a biotinylation tag sequence is expressed from a second vector under puromycin resistance. Biotinylation tag sequences are known in the art, see, e.g., Schatz, Biotechnology (N Y). 1993 October; 11(10):1138-43; Tucker and Grisshammer, Biochem J. 1996 Aug. 1; 317 (Pt 3):891-9; and Beckett et al., Protein Sci. 1999 April; 8(4):921-9. An exemplary biotinylation sequence is GLNDIFEAQKIEWHE (SEQ ID NO: 36369); other sequences are known in the art, e.g., GLNDIFEAQKIEWH (SEQ ID NO: 36370); and others as disclosed in Beckett et al., Protein Science 1999, 8:921-929, e.g., in FIG. 5 and Table 2 therein. Sequences for BirA are also known in the art; see, e.g., Howard et al., Gene. 1985; 35(3):321-31. An exemplary protein sequence for BirA is as follows:
| (SEQ ID NO: 36371) | |
| 10 20 30 40 | |
| MKDNTVPLKL IALLANGEFH SGEQLGETLG MSRAAINKHI | |
| 50 60 70 80 | |
| QTLRDWGVDV FTVPGKGYSL PEPIQLLNAK QILGQLDGGS | |
| 90 100 110 120 | |
| VAVLPVIDST NQYLLDRIGE LKSGDACIAE YQQAGRGRRG | |
| 130 140 150 160 | |
| RKWFSPFGAN LYLSMFWRLE QGPAAAIGLS LVIGIVMAEV | |
| 170 180 190 200 | |
| LRKLGADKVR VKWPNDLYLQ DRKLAGILVE LTGKTGDAAQ | |
| 210 220 230 240 | |
| IVIGAGINMA MRRVEESVVN QGWITLQEAG INLDRNTLAA | |
| 250 260 270 280 | |
| MLIRELRAAL ELFEQEGLAP YLSRWEKLDN FINRPVKLII | |
| 290 300 310 320 | |
| GDKEIFGISR GIDKQGALLL EQDGIIKPWM GGEISLRSAE | |
| K |
Cells are crosslinked by exposure to ultraviolet (UV) light (e.g., preferably 254 nm, but a range of 200 nm to 400 nm may be possible), cellular lysates are prepared, then DNAsed to solubilize the chromatin, and protein-RNA complexes are pulled down using streptavidin beads. Importantly, the samples are then washed, preferably with a high stringency wash, e.g., using 8 M urea (range: 5-10 M, 6-10 M, 7-10 M, 7-9 M, or 7.5-8.5 M)+0.1% SDS (range: 0.0-2.0%). Other detergents may be used as substitutes for SDS, including Triton X-100 and NP40. Samples can then be further washed, e.g., in PBS+2% SDS and further in high salt buffer (e.g., PBS+750 mM NaCl+1% NP40+0.5% NaDeoxycholate+0.1% SDS; variations on salt/detergent conditions are possible). Under such suitable stringent conditions, most proteins are denatured, resulting in the loss of the nonspecific RNA-protein interactions. Only the extremely high-affinity biotin-avidin interaction survives. Thus, these steps can be used to effectively remove the vast majority of background RNA, resulting in extremely clean “peaks” of binding. The samples are then treated with DNAse to remove contaminating DNA. The RNA is phosphorylated using P32-ATP and run on SDS-PAGE and transferred onto membrane. Bands corresponding to the protein-RNA complex are then excised and eluted for cDNA preparation.
In some embodiments, the methods include contacting the sample with an agent, e.g., an antibody, that binds specifically to an RNA-binding protein or protein complex such as PRC1, e.g., to CBX7.
In some embodiments, the methods include some or all of the following: isolating the complexes; synthesizing DNA complementary to the RNAs to provide an initial population of cDNAs; PCR-amplifying, if necessary, using strand-specific primers; purifying the initial population of cDNAs to obtain a purified population of cDNAs that are at least 20 nucleotides (nt) in length; and high-throughput sequencing the purified population of cDNAs. Homopolymer reads are filtered, and reads matching the mitochondrial genome and ribosomal RNAs are excluded from all subsequent analyses. Reads that align to a reference genome with ≤1 mismatch are retained, excluding homopolymers, reads that align to the mitochondrial genome, and ribosomal RNAs. High probability PRC1-interacting transcripts are then called based on criteria that reads were significantly enriched in the wildtype library versus control library (such as a protein-null or tag-only control library, a minus-crosslinking library, or library made from an IgG pulldown done in parallel) for any given transcript. For example, under one set of criteria published in Zhao et al., 2010, the transcripts were enriched 3:1 in the wildtype library over the EZH2-null library, and each transcript had an RPKM minimum of 0.4. The criteria can be adjusted up or down based on empirical control data suggesting what cutoffs could be reasonably used. Statistical methods may also be used to call enrichment or “peaks” (binding sites) in the PRC1 library relative to control libraries, as has been used for the peaks called herein.
In general, to construct dCLIP-seq libraries, RNAs are extracted from the gel using standard techniques. To capture all RNAs (not just polyA RNAs) and to preserve strand information, 3′ end-specific adapter is ligated to the extracted RNA fragments followed by hybridization with reverse transcription primer specific to 3′ end adaptor and ligation of second adaptor specific to 5′ end. The subsequent reverse transcription step creates first strand cDNA sequence that contains sequences complementary to the 3′ and 5′ adapters. The resulting PCR using 3′- and 5′-adaptor specific primer pairs is then performed to amplify the cDNAs and the products sequenced via standard methods of high throughput sequencing. Prior to sequencing, a size-selection step is incorporated in which amplified PCR products of desired sizes are excised after separation by gel electrophoresis (e.g., on a Nu-Sieve agarose gel or in an acrylamide gel) in order to remove an undesirable side products such as adapter dimers.
Kits
Provided herein are kits for use in the dCLIP-seq methods described herein. The kits can include, but are not limited to, an expression vector for expressing the bacterial biotin ligase BirA in a cell type of interest, and an expression vector for expressing RNA-binding proteins of interest, e.g., mammalian (e.g., human or mouse) RNA-binding proteins of interest PRC1 components such as CBX2, CBX4, CBX6, CBX7, CBX8, or RYPB fused in-frame to a Flag-biotinylation tag sequence. In addition to PRC1 components, PRC2 components (EZH2, EZH1, SUZ12, etc) or any other RNA-binding protein (ATRX, YY1, CTCF, as three examples) may be used as bait and fused in frame to the biotin tag. In some embodiments, the kits include buffers, e.g., a high stringency denaturing buffer, e.g., comprising 8 M urea (range: 5-10 M, 6-10 M, 7-10 M, 7-9 M, or 7.5-8.5 M) plus 0.1% SDS (range: 0.0-2.0%); wash buffer (e.g., PBS+2% SDS; high salt wash buffer (e.g., PBS+750 mM NaCl+1% NP40+0.5% NaDeoxycholate+0.1% SDS. Other detergents may be used as substitutes for SDS, including Triton X-100 and NP40; variations on salt conditions are also possible. In some embodiments, the kits include cells expressing BirA.
PRC1-Interacting RNAs and RNA Libraries
The present invention includes the individual PRC1-binding regions of RNAs described herein, as well as libraries of RNAs produced by methods described herein. In some embodiments, the libraries are in solution, or are lyophilized. In some embodiments, the libraries are bound to a substrate, e.g., wherein each member of the library is bound to an individually addressable member, e.g., an individual area on an array (e.g., a microarray), or a bead. The PRC1 RNA interactome consists of both coding and noncoding transcripts. Non-coding PRC1-interacting RNA transcripts may also include a protein-coding sequence of bases, e.g., a distinct transcript that overlaps in position with a protein-coding reference gene (e.g., the gene whose expression is modulated in cis).
In one embodiment, an RNA includes a nucleotide sequence that is at least about 85% or more homologous or identical to the entire length of an RNA sequence shown herein, e.g., in any of Tables 1-4, or a fragment comprising at least 20 nt thereof (e.g., at least 25, 30, 35, 40, 50, 60, 70, 80, 90, or 100 nt thereof, e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50% or more of the full length RNA). In some embodiments, the nucleotide sequence is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous or identical to an RNA sequence shown herein.
Mouse-to-human LiftOver analysis and analysis in the UCSC genome browser of syntenic positions indicate the existence of similar transcripts in the human genome. This process and LiftOver chains are generally described in Kent et al., Proc. Nat'l Acad. Sci., 100(20) 11484-11489 (2003). Given the geographic and sequence similarities between the mouse and human transcripts, we believe that a similar number of PRC1-interacting transcripts occur in the human system. The data suggest that many if not all of the mouse PRC1-transcripts have direct counterparts in the human epigenome. Such direct counterparts in other species are termed “orthologous” herein.
RNAs may be functionally conserved without being highly conserved at the level of overall nucleotide identity. For example, mouse Xist shows only 76% overall nucleotide identity with human XIST using sliding 21-bp windows, or an overall sequence identity of only 60%. However, within specific functional domains, the degree of conservation can be >70% between different mammalian species. The crucial motif in some RNAs (e.g., Repeat A of XIST) is the secondary structures formed by the repeat. An RNA interacting with PRC1 may therefore be similarly low in overall conservation but still have conservation in secondary structure within specific domains of the RNA, and thereby demonstrate functional conservation with respect to recruitment of PRC1.
Calculations of homology or sequence identity between sequences (the terms are used interchangeably herein) are performed as follows.
To determine the percent identity of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). The length of a reference sequence aligned for comparison purposes is at least 80% of the length of the reference sequence, and in some embodiments is at least 90% or 100%. The nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein nucleic acid “identity” is equivalent to nucleic acid “homology”). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
For purposes of the present invention, the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
There are several potential uses for the RNAs described herein in the expanded PRC1 transcriptome: The RNAs themselves, or antagomirs and small molecules designed against them, can be utilized to modulate expression (either up or down) of Polycomb target genes.
In various related aspects, including with respect to the targeting of RNAs by LNA molecule, PRC1-binding RNAs can include endogenous coding and non-coding cellular RNAs, including but not limited to those RNAs that are greater than 60 nt in length, e.g., greater than 100 nt, e.g., greater than 200 nt, have no positive-strand open reading frames greater than 100 amino acids in length, are identified as ncRNAs by experimental evidence, and are distinct from known (smaller) functional-RNA classes (including but not limited to ribosomal, transfer, and small nuclear/nucleolar RNAs, siRNA, piRNA, and miRNA). See, e.g., Lipovich et al., “MacroRNA underdogs in a microRNA world: Evolutionary, regulatory, and biomedical significance of mammalian long non-protein-coding RNA” Biochimica et Biophysica Acta (2010) doi:10.1016/j.bbagrm.2010.10.001; Ponting et al., Cell 136(4):629-641 (2009), Jia et al., RNA 16 (8) (2010) 1478-1487, Dinger et al., Nucleic Acids Res. 37 1685 (2009) D122-D126 (database issue); and references cited therein. ncRNAs have also been referred to as, and can include, long non-coding RNA, long RNA, large RNA, macro RNA, intergenic RNA, and NonCoding Transcripts.
The methods described herein can be used to target both coding and non-coding RNAs. Known classes of RNAs include large intergenic non-coding RNAs (lincRNAs, see, e.g., Guttman et al., Nature. 2009 Mar. 12; 458(7235):223-7. Epub 2009 Feb. 1, which describes over a thousand exemplary highly conserved large non-coding RNAs in mammals; and Khalil et al., PNAS 106(28)11675-11680 (2009)); promoter associated short RNAs (PASRs; see, e.g., Seila et al., Science. 2008 Dec. 19; 322(5909):1849-51. Epub 2008 Dec. 4; Kanhere et al., Molecular Cell 38, 675-688, (2010)); endogenous antisense RNAs (see, e.g., Numata et al., BMC Genomics. 10:392 (2009); Okada et al., Hum Mol Genet. 17(11):1631-40 (2008); Numata et al., Gene 392(1-2):134-141 (2007); and Rosok and Sioud, Nat Biotechnol. 22(1):104-8 (2004)); and RNAs that bind chromatin modifiers such as PRC2 and LSD1 (see, e.g., Tsai et al., Science. 2010 Aug. 6; 329(5992):689-93. Epub 2010 Jul. 8; and Zhao et al., Science. 2008 Oct. 31; 322(5902):750-6).
Exemplary ncRNAs include XIST, TSIX, SRA1, and KCNQ1OT1. The sequences for more than 17,000 long human ncRNAs can be found in the NCode™ Long ncRNA Database on the Invitrogen website. Additional long ncRNAs can be identified using, e.g., manual published literature, Functional Annotation of Mouse (FANTOM3) project, Human Full-length cDNA Annotation Invitational (H-Invitational) project, antisense ncRNAs from cDNA and EST database for mouse and human using a computation pipeline (Zhang et al., Nucl. Acids Res. 35 (suppl 1): D156-D161 (2006); Engstrom et al., PLoS Genet. 2:e47 (2006)), human snoRNAs and scaRNAs derived from snoRNA-LBME-db, RNAz (Washietl et al. 2005), Noncoding RNA Search (Torarinsson, et al. 2006), and EvoFold (Pedersen et al. 2006).
Methods of Modulating Gene Expression
The RNAs described herein, including fragments thereof that are at least 20 nt in length, and inhibitory nucleic acids and small molecules targeting (e.g., complementary to) them, can be used to modulate gene expression in a cell, e.g., a cancer cell, a stem cell, or other normal cell types for gene or epigenetic therapy. The cells can be in vitro, including ex vivo, or in vivo (e.g., in a subject who has cancer, e.g., a tumor).
The methods described herein can be used for modulating expression of oncogenes and tumor suppressors in cells, e.g., cancer cells. For example, to decrease expression of an gene (e.g., an oncogene or imprinted gene) in a cell, the methods include introducing into the cell an inhibitory nucleic acid or small molecule that specifically binds, or is complementary, to a PRC1-binding region of an RNA that increases expression of the gene, e.g., an oncogene and/or an imprinted gene, set forth in Tables 1-3. As another example, to increase expression of a gene, e.g., a tumor suppressor, in a cell, the methods include introducing into the cell an inhibitory nucleic acid or small molecule that specifically binds, or is complementary, to a PRC1-binding region of an RNA that decreases expression of the gene, e.g., of a tumor suppressor gene, set forth in Tables 1-3, e.g., in subjects with cancer, e.g., lung adenocarcinoma patients.
In general, the methods include introducing into the cell an inhibitory nucleic acid that specifically binds, or is complementary, to a region of an RNA that modulated expression of a gene as set forth in Tables 1-3.
In preferred embodiments, the inhibitory nucleic acid binds to a region within or near (e.g., within 100, 200, 300, 400, 500, 600, 700, 1K, 2K, or 5K bases of) a PRC1-binding region of the RNA as set forth in Tables 1-3. The empirically-identified “peaks,” which are believed to represent PRC1-binding regions are shown in Table 1, with 500 nts of sequence on each side, so that in some the methods can include targeting a sequence as shown in one of the sequences in Tables 1-3, or a sequence that is between 500 nts from the start and 500 nts of the end of a sequence shown in Tables 1-3, or between 400 nts from the start and 400 nts of the end, 300 nts from the start and 300 nts of the end, between 200 nts from the start and 200 nts of the end, or between 100 nts from the start and 100 nts of the end, of a sequence shown in Tables 1-3. A nucleic acid that binds “specifically” binds primarily to the target RNA or related RNAs to inhibit regulatory function of the RNA but not of other non-target RNAs. The specificity of the nucleic acid interaction thus refers to its function (e.g., inhibiting the PRC1-associated repression of gene expression) rather than its hybridization capacity. Inhibitory nucleic acids may exhibit nonspecific binding to other sites in the genome or other RNAs, without interfering with binding of other regulatory proteins and without causing degradation of the non-specifically-bound RNA. Thus this nonspecific binding does not significantly affect function of other non-target RNAs and results in no significant adverse effects.
These methods can be used to treat a cancer in a subject by administering to the subject a composition (e.g., as described herein) comprising a PRC1-binding fragment of an RNA as described herein and/or an inhibitory nucleic acid that binds to an RNA (e.g., an inhibitory nucleic acid that binds to an RNA that inhibits a tumor suppressor, or cancer-suppressing gene, or imprinted gene and/or other growth-suppressing genes in any of Tables 1-3). Examples of cellular proliferative and/or differentiative disorders include cancer, e.g., carcinoma, sarcoma, metastatic disorders or hematopoietic neoplastic disorders, e.g., leukemias. A metastatic tumor can arise from a multitude of primary tumor types, including but not limited to those of prostate, colon, lung, breast and liver origin.
As used herein, treating includes “prophylactic treatment” which means reducing the incidence of or preventing (or reducing risk of) a sign or symptom of a disease in a patient at risk for the disease, and “therapeutic treatment”, which means reducing signs or symptoms of a disease, reducing progression of a disease, reducing severity of a disease, in a patient diagnosed with the disease. With respect to cancer, treating includes inhibiting tumor cell proliferation, increasing tumor cell death or killing, inhibiting rate of tumor cell growth or metastasis, reducing size of tumors, reducing number of tumors, reducing number of metastases, increasing 1-year or 5-year survival rate.
As used herein, the terms “cancer”, “hyperproliferative” and “neoplastic” refer to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. Hyperproliferative and neoplastic disease states may be categorized as pathologic, i.e., characterizing or constituting a disease state, or may be categorized as non-pathologic, i.e., a deviation from normal but not associated with a disease state. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. “Pathologic hyperproliferative” cells occur in disease states characterized by malignant tumor growth. Examples of non-pathologic hyperproliferative cells include proliferation of cells associated with wound repair.
The terms “cancer” or “neoplasms” include malignancies of the various organ systems, such as affecting lung (e.g. small cell, non-small cell, squamous, adenocarcinoma), breast, thyroid, lymphoid, gastrointestinal, genito-urinary tract, kidney, bladder, liver (e.g. hepatocellular cancer), pancreas, ovary, cervix, endometrium, uterine, prostate, brain, as well as adenocarcinomas which include malignancies such as most colon cancers, colorectal cancer, renal-cell carcinoma, prostate cancer and/or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus.
The term “carcinoma” is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. In some embodiments, the disease is renal carcinoma or melanoma. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary. The term also includes carcinosarcomas, e.g., which include malignant tumors composed of carcinomatous and sarcomatous tissues. An “adenocarcinoma” refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures.
The term “sarcoma” is art recognized and refers to malignant tumors of mesenchymal derivation.
Additional examples of proliferative disorders include hematopoietic neoplastic disorders. As used herein, the term “hematopoietic neoplastic disorders” includes diseases involving hyperplastic/neoplastic cells of hematopoietic origin, e.g., arising from myeloid, lymphoid or erythroid lineages, or precursor cells thereof. Preferably, the diseases arise from poorly differentiated acute leukemias, e.g., erythroblastic leukemia and acute megakaryoblastic leukemia. Additional exemplary myeloid disorders include, but are not limited to, acute promyeloid leukemia (APML), acute myelogenous leukemia (AML) and chronic myelogenous leukemia (CML) (reviewed in Vaickus, L. (1991) Crit Rev. in Oncol./Hemotol. 11:267-97); lymphoid malignancies include, but are not limited to acute lymphoblastic leukemia (ALL) which includes B-lineage ALL and T-lineage ALL, chronic lymphocytic leukemia (CLL), prolymphocytic leukemia (PLL), hairy cell leukemia (HLL) and Waldenstrom's macroglobulinemia (WM). Additional forms of malignant lymphomas include, but are not limited to non-Hodgkin lymphoma and variants thereof, peripheral T cell lymphomas, adult T cell leukemia/lymphoma (ATL), cutaneous T-cell lymphoma (CTCL), large granular lymphocytic leukemia (LGF), Hodgkin's disease and Reed-Stenberg disease.
In some embodiments, specific cancers that can be treated using the methods described herein include, but are not limited to: breast, lung, prostate, CNS (e.g., glioma), salivary gland, prostate, ovarian, and leukemias (e.g., ALL, CML, or AML). Associations of these genes with a particular cancer are known in the art, e.g., as described in Futreal et al., Nat Rev Cancer. 2004; 4;177-83; and The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website, Bamford et al., Br J Cancer. 2004; 91; 355-8; see also Forbes et al., Curr Protoc Hum Genet. 2008; Chapter 10; Unit 10.11, and the COSMIC database, e.g., v.50 (Nov. 30, 2010).
In addition, the methods described herein can be used for modulating (e.g., enhancing or decreasing) pluripotency of a stem cell and to direct stem cells down specific differentiation pathways to make endoderm, mesoderm, ectoderm, and their developmental derivatives. To increase, maintain, or enhance pluripotency, the methods include introducing into the cell an inhibitory nucleic acid that specifically binds to, or is complementary to, a PRC1-binding site on a non-coding RNA as set forth in any of Tables 1-3. Stem cells useful in the methods described herein include adult stem cells (e.g., adult stem cells obtained from the inner ear, bone marrow, mesenchyme, skin, fat, liver, muscle, or blood of a subject, e.g., the subject to be treated); embryonic stem cells, or stem cells obtained from a placenta or umbilical cord; progenitor cells (e.g., progenitor cells derived from the inner ear, bone marrow, mesenchyme, skin, fat, liver, muscle, or blood); and induced pluripotent stem cells (e.g., iPS cells).
Furthermore, the present methods can be used to treat Systemic Lupus erythematosus (SLE), an autoimmune disease that affects 1.5 million Americans (16,000 new cases per year). Ages 10-50 are the most affected, with more sufferers being female than male. SLE is a multi-organ disease; the effects include arthritis, joint pain & swelling, chest pain, fatigue, general malaise, hair loss, mouth sores, sensitivity to light, skin rash, and swollen lymph nodes. Current treatments include corticosteroids, immunosuppressants, and more recently belimumab (an inhibitor of B cell activating factor).
The causes of SLE are probably multiple, including HLA haplotypes. The interleukin 1 receptor associated kinase 1 (IRAK1) has been implicated in some patients. IRAK1 is X-linked (possibly explaining the female predominance of the disease) and is involved in immune response to foreign antigens and pathogens. IRAK1 has been associated with SLE in both adult and pediatric forms. Overexpression of IRAK1 in animal models causes SLE, and knocking out IRAK1 in mice alleviates symptoms of SLE. See, e.g., Jacob et al., Proc Natl Acad Sci USA. 2009 Apr. 14; 106(15):6256-61. The present methods can include treating a subject with SLE by administering an inhibitory nucleic acid that is complementary to a PRC1-binding region on IRAK1 RNA, e.g., an LNA targeting the 3′ UTR, e.g., as shown in Table 4.
The present methods can also be used to treat MECP2 Duplication Syndrome in a subject. This condition is characterized by mental retardation, weak muscle tone, and feeding difficulties, as well as poor/absent speech, seizures, and muscle spasticity. There are more reported cases in males than in females; female carriers may have skewed XCI. There is a 50% mortality rate by age 25 associated with this condition, which accounts for 1-2% of X-linked mental retardation. The real rate of incidence is unknown, as many go undiagnosed. Genetically, the cause is duplication (even triplication) of MECP2 gene. There is no current treatment. The present methods can include treating a subject with MECP2 Duplication Syndrome by administering an inhibitory nucleic acid that is complementary to a PRC1-binding region on Mecp2 RNA, e.g., an LNA targeting the 3′UTR of Mecp2 as shown in FIG. 2C, e.g., as shown in Table 4.
In some embodiments, the methods described herein include administering a composition, e.g., a sterile composition, comprising an inhibitory nucleic acid that is complementary to a PRC1-binding region on an RNA described herein, e.g., as set forth in any of Tables 1-3, or SEQ ID NOS:1-5893 (human) or 5894-17415 (human LiftOver). Inhibitory nucleic acids for use in practicing the methods described herein can be an antisense or small interfering RNA, including but not limited to an shRNA or siRNA. In some embodiments, the inhibitory nucleic acid is a modified nucleic acid polymer (e.g., a locked nucleic acid (LNA) molecule). The present methods can include administration of a
Inhibitory nucleic acids have been employed as therapeutic moieties in the treatment of disease states in animals, including humans. Inhibitory nucleic acids can be useful therapeutic modalities that can be configured to be useful in treatment regimes for the treatment of cells, tissues and animals, especially humans.
For therapeutics, an animal, preferably a human, suspected of having cancer is treated by administering an RNA or inhibitory nucleic acid in accordance with this invention. For example, in one non-limiting embodiment, the methods comprise the step of administering to the animal in need of treatment, a therapeutically effective amount of an RNA or inhibitory nucleic acid as described herein.
Inhibitory Nucleic Acids
Inhibitory nucleic acids useful in the present methods and compositions include antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, single- or double-stranded RNA interference (RNAi) compounds such as siRNA compounds, molecules comprising modified bases, locked nucleic acid molecules (LNA molecules), antagomirs, peptide nucleic acid molecules (PNA molecules), and other oligomeric compounds or oligonucleotide mimetics which hybridize to at least a portion of the target nucleic acid and modulate its function. In some embodiments, the inhibitory nucleic acids include antisense RNA, antisense DNA, chimeric antisense oligonucleotides, antisense oligonucleotides comprising modified linkages, interference RNA (RNAi), short interfering RNA (siRNA); a micro, interfering RNA (miRNA); a small, temporal RNA (stRNA); or a short, hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); small activating RNAs (saRNAs), or combinations thereof. See, e.g., WO 2010040112.
In the present methods, the inhibitory nucleic acids are preferably designed to target a specific region of the RNA that binds to PRC1, as described herein (see Tables 1-3). These “inhibitory” nucleic acids are believed to work by inhibiting the interaction between the RNA and PRC1, and as described herein can be used to modulate expression of a gene.
In some embodiments, the inhibitory nucleic acids are 10 to 50, 13 to 50, or 13 to 30 nucleotides in length. One having ordinary skill in the art will appreciate that this embodies oligonucleotides having antisense (complementary) portions of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or any range therewithin. It is understood that non-complementary bases may be included in such inhibitory nucleic acids; for example, an inhibitory nucleic acid 30 nucleotides in length may have a portion of 15 bases that is complementary to the targeted RNA. In some embodiments, the oligonucleotides are 15 nucleotides in length. In some embodiments, the antisense or oligonucleotide compounds of the invention are 12 or 13 to 30 nucleotides in length. One having ordinary skill in the art will appreciate that this embodies inhibitory nucleic acids having antisense (complementary) portions of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length, or any range therewithin.
Preferably the inhibitory nucleic acid comprises one or more modifications comprising: a modified sugar moiety, and/or a modified internucleoside linkage, and/or a modified nucleotide and/or combinations thereof. It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and in fact more than one of the modifications described herein may be incorporated in a single oligonucleotide or even at within a single nucleoside within an oligonucleotide.
In some embodiments, the inhibitory nucleic acids are chimeric oligonucleotides that contain two or more chemically distinct regions, each made up of at least one nucleotide. These oligonucleotides typically contain at least one region of modified nucleotides that confers one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target) and a region that is a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. Chimeric inhibitory nucleic acids of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures comprise, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of which is herein incorporated by reference.
In some embodiments, the inhibitory nucleic acid comprises at least one nucleotide modified at the 2′ position of the sugar, most preferably a 2′-O-alkyl, 2′-O-alkyl-O-alkyl or 2′-fluoro-modified nucleotide. In other preferred embodiments, RNA modifications include 2′-fluoro, 2′-amino and 2′ O-methyl modifications on the ribose of pyrimidines, abasic residues or an inverted base at the 3′ end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) than; 2′-deoxyoligonucleotides against a given target.
A number of nucleotide and nucleoside modifications have been shown to make the oligonucleotide into which they are incorporated more resistant to nuclease digestion than the native oligodeoxynucleotide; these modified oligos survive intact for a longer time than unmodified oligonucleotides. Specific examples of modified oligonucleotides include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. Most preferred are oligonucleotides with phosphorothioate backbones and those with heteroatom backbones, particularly CH2—NH—O—CH2, CH, ˜N(CH3)˜O˜CH2 (known as a methylene(methylimino) or MMI backbone], CH2—O—N(CH3)—CH2, CH2—N(CH3)—N(CH3)—CH2 and O—N(CH3)—CH2—CH2 backbones, wherein the native phosphodiester backbone is represented as O—P—O—CH,); amide backbones (see De Mesmaeker et al. Ace. Chem. Res. 1995, 28:366-374); morpholino backbone structures (see Summerton and Weller, U.S. Pat. No. 5,034,506); peptide nucleic acid (PNA) backbone (wherein the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone, see Nielsen et al., Science 1991, 254, 1497). Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3′alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′; see U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050.
Morpholino-based oligomeric compounds are described in Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510); Genesis, volume 30, issue 3, 2001; Heasman, J., Dev. Biol., 2002, 243, 209-214; Nasevicius et al., Nat. Genet., 2000, 26, 216-220; Lacerra et al., Proc. Natl. Acad. Sci., 2000, 97, 9591-9596; and U.S. Pat. No. 5,034,506, issued Jul. 23, 1991. In some embodiments, the morpholino-based oligomeric compound is a phosphorodiamidate morpholino oligomer (PMO) (e.g., as described in Iverson, Curr. Opin. Mol. Ther., 3:235-238, 2001; and Wang et al., J. Gene Med., 12:354-364, 2010; the disclosures of which are incorporated herein by reference in their entireties).
Cyclohexenyl nucleic acid oligonucleotide mimetics are described in Wang et al., J. Am. Chem. Soc., 2000, 122, 8595-8602.
Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These comprise those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts; see U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264, 562; 5, 264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.
Modified oligonucleotides are also known that include oligonucleotides that are based on or constructed from arabinonucleotide or modified arabinonucleotide residues. Arabinonucleosides are stereoisomers of ribonucleosides, differing only in the configuration at the 2′-position of the sugar ring. In some embodiments, a 2′-arabino modification is 2′-F arabino. In some embodiments, the modified oligonucleotide is 2′-fluoro-D-arabinonucleic acid (FANA) (as described in, for example, Lon et al., Biochem., 41:3457-3467, 2002 and Min et al., Bioorg. Med. Chem. Lett., 12:2651-2654, 2002; the disclosures of which are incorporated herein by reference in their entireties). Similar modifications can also be made at other positions on the sugar, particularly the 3′ position of the sugar on a 3′ terminal nucleoside or in 2′-5′ linked oligonucleotides and the 5′ position of 5′ terminal nucleotide.
PCT Publication No. WO 99/67378 discloses arabinonucleic acids (ANA) oligomers and their analogues for improved sequence specific inhibition of gene expression via association to complementary messenger RNA.
Other preferred modifications include ethylene-bridged nucleic acids (ENAs) (e.g., International Patent Publication No. WO 2005/042777, Morita et al., Nucleic Acid Res., Suppl 1:241-242, 2001; Surono et al., Hum. Gene Ther., 15:749-757, 2004; Koizumi, Curr. Opin. Mol. Ther., 8:144-149, 2006 and Horie et al., Nucleic Acids Symp. Ser (Oxf), 49:171-172, 2005; the disclosures of which are incorporated herein by reference in their entireties). Preferred ENAs include, but are not limited to, 2′-0,4′-C-ethylene-bridged nucleic acids.
Examples of LNAs are described in WO 2008/043753 and include compounds of the following formula.
Preferably, the LNA used in the oligomer of the invention comprises at least one LNA unit according any of the formulas
Preferably, the Locked Nucleic Acid (LNA) used in the oligomeric compound, such as an antisense oligonucleotide, of the invention comprises at least one nucleotide comprises a Locked Nucleic Acid (LNA) unit according any of the formulas shown in Scheme 2 of PCT/DK2006/000512.
Preferably, the LNA used in the oligomer of the invention comprises internucleoside linkages selected from —O—P(O)2—O—, —O—P(O,S)—O—, —O—P(S)2—O—, —S—P(O)2—O—, —S—P(O,S)—O—, —S—P(S)2—O—, —O—P(O)2—S—, —O—P(O,S)—S—, —S—P(O)2—S—, —O—PO(RH)—O—, O—PO(OCH3)—O—, —O—PO(NRH)—O—, —O—PO(OCH2CH2S—R)—O—, —O—PO(BH3)—O—, —O—PO(NHRH)—O—, —P(O)2—NRH—, —NRH—P(O)2—O—, —NRH—CO—O—, where RH is selected from hydrogen and C1-4-alkyl.
Specifically preferred LNA units are shown in scheme 2:
The term “thio-LNA” comprises a locked nucleotide in which at least one of X or Y in the general formula above is selected from S or —CH2—S—. Thio-LNA can be in both beta-D and alpha-L-configuration.
The term “amino-LNA” comprises a locked nucleotide in which at least one of X or Y in the general formula above is selected from —N(H)—, N(R)—, CH2—N(H)—, and —CH2—N(R)— where R is selected from hydrogen and C1-4-alkyl. Amino-LNA can be in both beta-D and alpha-L-configuration.
The term “oxy-LNA” comprises a locked nucleotide in which at least one of X or Y in the general formula above represents —O— or —CH2—O—. Oxy-LNA can be in both beta-D and alpha-L-configuration.
The term “ena-LNA” comprises a locked nucleotide in which Y in the general formula above is —CH2—O— (where the oxygen atom of —CH2—O— is attached to the 2′-position relative to the base B).
LNAs are described in additional detail below.
One or more substituted sugar moieties can also be included, e.g., one of the following at the 2′ position: OH, SH, SCH3, F, OCN, OCH3 OCH3, OCH3 O(CH2)n CH3, O(CH2)n NH2 or O(CH2)n CH3 where n is from 1 to about 10; Ci to C10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF3; OCF3; O—, S—, or N-alkyl; O—, S—, or N-alkenyl; SOCH3; SO2 CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an oligonucleotide; or a group for improving the pharmacodynamic properties of an oligonucleotide and other substituents having similar properties. A preferred modification includes 2′-methoxyethoxy [2′-0-CH2CH2OCH3, also known as 2′—O—(2-methoxyethyl)] (Martin et al, HeIv. Chim. Acta, 1995, 78, 486). Other preferred modifications include 2′-methoxy (2′-0-CH3), 2′-propoxy (2′—OCH2 CH2CH3) and 2′-fluoro (2′-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3′ position of the sugar on the 3′ terminal nucleotide and the 5′ position of 5′ terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group.
Inhibitory nucleic acids can also include, additionally or alternatively, nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2′ deoxycytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, isocytosine, pseudoisocytosine, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2-(methylamino)adenine, 2-(imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 5-propynyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl)adenine, 6-aminopurine, 2-aminopurine, 2-chloro-6-aminopurine and 2,6-diaminopurine or other diaminopurines. See, e.g., Komberg, “DNA Replication,” W. H. Freeman & Co., San Francisco, 1980, pp 75-77; and Gebeyehu, G., et al. Nucl. Acids Res., 15:4513 (1987)). A “universal” base known in the art, e.g., inosine, can also be included. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2<0>C. (Sanghvi, in Crooke, and Lebleu, eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions.
It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and in fact more than one of the modifications described herein may be incorporated in a single oligonucleotide or even at within a single nucleoside within an oligonucleotide.
In some embodiments, both a sugar and an internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, for example, an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al, Science, 1991, 254, 1497-1500.
Inhibitory nucleic acids can also include one or more nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases comprise the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases comprise other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudo-uracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylquanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.
Further, nucleobases comprise those disclosed in U.S. Pat. No. 3,687,808, those disclosed in “The Concise Encyclopedia of Polymer Science And Engineering”, pages 858-859, Kroschwitz, ed. John Wiley & Sons, 1990; those disclosed by Englisch et al., Angewandle Chemie, International Edition, 1991, 30, page 613, and those disclosed by Sanghvi, Chapter 15, Antisense Research and Applications,” pages 289-302, Crooke, and Lebleu, eds., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, comprising 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2<0>C (Sanghvi, et al., eds, “Antisense Research and Applications,” CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2′—O-methoxyethyl sugar modifications. Modified nucleobases are described in U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175, 273; 5, 367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,596,091; 5,614,617; 5,750,692, and 5,681,941, each of which is herein incorporated by reference.
In some embodiments, the inhibitory nucleic acids are chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. For example, one or more inhibitory nucleic acids, of the same or different types, can be conjugated to each other; or inhibitory nucleic acids can be conjugated to targeting moieties with enhanced specificity for a cell type or tissue type. Such moieties include, but are not limited to, lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al, Ann. N. Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Mancharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-t oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937). See also U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552, 538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486, 603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762, 779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082, 830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5, 245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391, 723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5, 565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599, 928 and 5,688,941, each of which is herein incorporated by reference.
These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharnacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present invention. Representative conjugate groups are disclosed in International Patent Application No. PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No. 6,287,860, which are incorporated herein by reference. Conjugate moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-5-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxy cholesterol moiety. See, e.g., U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941.
The inhibitory nucleic acids useful in the present methods are sufficiently complementary to the target RNA, e.g., hybridize sufficiently well and with sufficient biological functional specificity, to give the desired effect. “Complementary” refers to the capacity for pairing, through base stacking and specific hydrogen bonding, between two sequences comprising naturally or non-naturally occurring (e.g., modified as described above) bases (nucleosides) or analogs thereof. For example, if a base at one position of an inhibitory nucleic acid is capable of hydrogen bonding with a base at the corresponding position of an RNA, then the bases are considered to be complementary to each other at that position. 100% complementarity is not required. As noted above, inhibitory nucleic acids can comprise universal bases, or inert abasic spacers that provide no positive or negative contribution to hydrogen bonding. Base pairings may include both canonical Watson-Crick base pairing and non-Watson-Crick base pairing (e.g., Wobble base pairing and Hoogsteen base pairing). It is understood that for complementary base pairings, adenosine-type bases (A) are complementary to thymidine-type bases (T) or uracil-type bases (U), that cytosine-type bases (C) are complementary to guanosine-type bases (G), and that universal bases such as such as 3-nitropyrrole or 5-nitroindole can hybridize to and are considered complementary to any A, C, U, or T. Nichols et al., Nature, 1994; 369:492-493 and Loakes et al., Nucleic Acids Res., 1994; 22:4039-4043. Inosine (I) has also been considered in the art to be a universal base and is considered complementary to any A, C, U, or T. See Watkins and SantaLucia, Nucl. Acids Research, 2005; 33 (19): 6258-6267.
In some embodiments, the location on a target RNA to which an inhibitory nucleic acids hybridizes is defined as a region to which a protein binding partner binds, as shown in Tables 1-3. Routine methods can be used to design an inhibitory nucleic acid that binds to this sequence with sufficient specificity. In some embodiments, the methods include using bioinformatics methods known in the art to identify regions of secondary structure, e.g., one, two, or more stem-loop structures, or pseudoknots, and selecting those regions to target with an inhibitory nucleic acid. For example, methods of designing oligonucleotides similar to the inhibitory nucleic acids described herein, and various options for modified chemistries or formats, are exemplified in Lennox and Behlke, Gene Therapy (2011) 18: 1111-1120, which is incorporated herein by reference in its entirety, with the understanding that the present disclosure does not target miRNA ‘seed regions’.
While the specific sequences of certain exemplary target segments are set forth herein, one of skill in the art will recognize that these serve to illustrate and describe particular embodiments within the scope of the present invention. Additional target segments are readily identifiable by one having ordinary skill in the art in view of this disclosure. Target segments 5-500 nucleotides in length comprising a stretch of at least five (5) consecutive nucleotides within the protein binding region, or immediately adjacent thereto, are considered to be suitable for targeting as well. Target segments can include sequences that comprise at least the 5 consecutive nucleotides from the 5′-terminus of one of the protein binding regions (the remaining nucleotides being a consecutive stretch of the same RNA beginning immediately upstream of the 5′-terminus of the binding segment and continuing until the inhibitory nucleic acid contains about 5 to about 100 nucleotides). Similarly preferred target segments are represented by RNA sequences that comprise at least the 5 consecutive nucleotides from the 3′-terminus of one of the illustrative preferred target segments (the remaining nucleotides being a consecutive stretch of the same RNA beginning immediately downstream of the 3′-terminus of the target segment and continuing until the inhibitory nucleic acid contains about 5 to about 100 nucleotides). One having skill in the art armed with the sequences provided herein will be able, without undue experimentation, to identify further preferred protein binding regions to target with complementary inhibitory nucleic acids.
In the context of the present disclosure, hybridization means base stacking and hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. Complementary, as the term is used in the art, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a RNA molecule, then the inhibitory nucleic acid and the RNA are considered to be complementary to each other at that position. The inhibitory nucleic acids and the RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond with each other through their bases. Thus, “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the inhibitory nucleic acid and the RNA target. For example, if a base at one position of an inhibitory nucleic acid is capable of hydrogen bonding with a base at the corresponding position of a RNA, then the bases are considered to be complementary to each other at that position. 100% complementarity is not required.
It is understood in the art that a complementary nucleic acid sequence need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. A complementary nucleic acid sequence for purposes of the present methods is specifically hybridizable when binding of the sequence to the target RNA molecule interferes with the normal function of the target RNA to cause a loss of activity (e.g., inhibiting PRC1-associated repression with consequent up-regulation of gene expression) and there is a sufficient degree of complementarity to avoid non-specific binding of the sequence to non-target RNA sequences under conditions in which avoidance of the non-specific binding is desired, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed under suitable conditions of stringency. For example, stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate. Low stringency hybridization can be obtained in the absence of organic solvent, e.g., formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and more preferably at least about 50% formamide. Stringent temperature conditions will ordinarily include temperatures of at least about 30° C., more preferably of at least about 37° C., and most preferably of at least about 42° C. Varying additional parameters, such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Various levels of stringency are accomplished by combining these various conditions as needed. In a preferred embodiment, hybridization will occur at 30° C. in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. In a more preferred embodiment, hybridization will occur at 37° C. in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 μg/ml denatured salmon sperm DNA (ssDNA). In a most preferred embodiment, hybridization will occur at 42° C. in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 μg/ml ssDNA. Useful variations on these conditions will be readily apparent to those skilled in the art.
For most applications, washing steps that follow hybridization will also vary in stringency. Wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature. For example, stringent salt concentration for the wash steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for the wash steps will ordinarily include a temperature of at least about 25° C., more preferably of at least about 42° C., and even more preferably of at least about 68° C. In a preferred embodiment, wash steps will occur at 25° C. in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 42° C. in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 68° C. in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. Additional variations on these conditions will be readily apparent to those skilled in the art. Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis (Science 196:180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.
In general, the inhibitory nucleic acids useful in the methods described herein have at least 80% sequence complementarity to a target region within the target nucleic acid, e.g., 90%, 95%, or 100% sequence complementarity to the target region within an RNA. For example, an antisense compound in which 18 of 20 nucleobases of the antisense oligonucleotide are complementary, and would therefore specifically hybridize, to a target region would represent 90 percent complementarity. Percent complementarity of an inhibitory nucleic acid with a region of a target nucleic acid can be determined routinely using basic local alignment search tools (BLAST programs) (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). Antisense and other compounds of the invention that hybridize to an RNA are identified through routine experimentation. In general the inhibitory nucleic acids must retain specificity for their target, i.e., either do not directly bind to, or do not directly significantly affect expression levels of, transcripts other than the intended target.
Target-specific effects, with corresponding target-specific functional biological effects, are possible even when the inhibitory nucleic acid exhibits non-specific binding to a large number of non-target RNAs. For example, short 8 base long inhibitory nucleic acids that are fully complementary to a RNA may have multiple 100% matches to hundreds of sequences in the genome, yet may produce target-specific effects, e.g. upregulation of a specific target gene through inhibition of PRC1 activity. 8-base inhibitory nucleic acids have been reported to prevent exon skipping with a high degree of specificity and reduced off-target effect. See Singh et al., RNA Biol., 2009; 6(3): 341-350. 8-base inhibitory nucleic acids have been reported to interfere with miRNA activity without significant off-target effects. See Obad et al., Nature Genetics, 2011; 43: 371-378.
For further disclosure regarding inhibitory nucleic acids, please see US2010/0317718 (antisense oligos); US2010/0249052 (double-stranded ribonucleic acid (dsRNA)); US2009/0181914 and US2010/0234451 (LNA molecules); US2007/0191294 (siRNA analogues); US2008/0249039 (modified siRNA); and WO2010/129746 and WO2010/040112 (inhibitory nucleic acids).
Antisense
In some embodiments, the inhibitory nucleic acids are antisense oligonucleotides. Antisense oligonucleotides are typically designed to block expression of a DNA or RNA target by binding to the target and halting expression at the level of transcription, translation, or splicing. Antisense oligonucleotides of the present invention are complementary nucleic acid sequences designed to hybridize under stringent conditions to an RNA in vitro, and are expected to inhibit the activity of PRC1 in vivo. Thus, oligonucleotides are chosen that are sufficiently complementary to the target, i.e., that hybridize sufficiently well and with sufficient biological functional specificity, to give the desired effect.
Modified Base, Including Locked Nucleic Acids (LNAs)
In some embodiments, the inhibitory nucleic acids used in the methods described herein comprise one or more modified bonds or bases. Modified bases include phosphorothioate, methylphosphonate, peptide nucleic acids, or locked nucleic acids (LNAs). Preferably, the modified nucleotides are part of locked nucleic acid molecules, including [alpha]-L-LNAs. LNAs include ribonucleic acid analogues wherein the ribose ring is “locked” by a methylene bridge between the 2′-oxygen and the 4′-carbon—i.e., oligonucleotides containing at least one LNA monomer, that is, one 2′-0,4′-C-methylene-β-D-ribofuranosyl nucleotide. LNA bases form standard Watson-Crick base pairs but the locked configuration increases the rate and stability of the basepairing reaction (Jepsen et al., Oligonucleotides, 14, 130-146 (2004)). LNAs also have increased affinity to base pair with RNA as compared to DNA. These properties render LNAs especially useful as probes for fluorescence in situ hybridization (FISH) and comparative genomic hybridization, as knockdown tools for miRNAs, and as antisense oligonucleotides to target mRNAs or other RNAs, e.g., RNAs as described herein.
The modified base/LNA molecules can include molecules comprising 10-30, e.g., 12-24, e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in each strand, wherein one of the strands is substantially identical, e.g., at least 80% (or more, e.g., 85%, 90%, 95%, or 100%) identical, e.g., having 3, 2, 1, or 0 mismatched nucleotide(s), to a target region in the RNA. The modified base/LNA molecules can be chemically synthesized using methods known in the art.
The modified base/LNA molecules can be designed using any method known in the art; a number of algorithms are known, and are commercially available (e.g., on the internet, for example at exiqon.com). See, e.g., You et al., Nuc. Acids. Res. 34:e60 (2006); McTigue et al., Biochemistry 43:5388-405 (2004); and Levin et al., Nuc. Acids. Res. 34:e142 (2006). For example, “gene walk” methods, similar to those used to design antisense oligos, can be used to optimize the inhibitory activity of a modified base/LNA molecule; for example, a series of oligonucleotides of 10-30 nucleotides spanning the length of a target RNA can be prepared, followed by testing for activity. Optionally, gaps, e.g., of 5-10 nucleotides or more, can be left between the LNAs to reduce the number of oligonucleotides synthesized and tested. GC content is preferably between about 30-60%. General guidelines for designing modified base/LNA molecules are known in the art; for example, LNA sequences will bind very tightly to other LNA sequences, so it is preferable to avoid significant complementarity within an LNA molecule. Contiguous runs of three or more Gs or Cs, or more than four LNA residues, should be avoided where possible (for example, it may not be possible with very short (e.g., about 9-10 nt) oligonucleotides). In some embodiments, the LNAs are xylo-LNAs.
For additional information regarding LNA molecules see U.S. Pat. Nos. 6,268,490; 6,734,291; 6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,060,809; 7,084,125; and 7,572,582; and U.S. Pre-Grant Pub. Nos. 20100267018; 20100261175; and 20100035968; Koshkin et al. Tetrahedron 54, 3607-3630 (1998); Obika et al. Tetrahedron Lett. 39, 5401-5404 (1998); Jepsen et al., Oligonucleotides 14:130-146 (2004); Kauppinen et al., Drug Disc. Today 2(3):287-290 (2005); and Ponting et al., Cell 136(4):629-641 (2009), and references cited therein.
As demonstrated herein and previously (see, e.g., WO 2012/065143 and WO 2012/087983, incorporated herein by reference), LNA molecules can be used as a valuable tool to manipulate and aid analysis of RNAs. Advantages offered by an LNA molecule-based system are the relatively low costs, easy delivery, and rapid action. While other inhibitory nucleic acids may exhibit effects after longer periods of time, LNA molecules exhibit effects that are more rapid, e.g., a comparatively early onset of activity, are fully reversible after a recovery period following the synthesis of new RNA, and occur without causing substantial or substantially complete RNA cleavage or degradation. One or more of these design properties may be desired properties of the inhibitory nucleic acids of the invention. Additionally, LNA molecules make possible the systematic targeting of domains within much longer nuclear transcripts. Although a PNA-based system has been described earlier, the effects on Xi were apparent only after 24 hours (Beletskii et al., Proc Natl Acad Sci USA. 2001; 98:9215-9220). The LNA technology enables high-throughput screens for functional analysis of non-coding RNAs and also provides a novel tool to manipulate chromatin states in vivo for therapeutic applications.
In various related aspects, the methods described herein include using LNA molecules to target RNAs for a number of uses, including as a research tool to probe the function of a specific RNA, e.g., in vitro or in vivo. The methods include selecting one or more desired RNAs, designing one or more LNA molecules that target the RNA, providing the designed LNA molecule, and administering the LNA molecule to a cell or animal. The methods can optionally include selecting a region of the RNA and designing one or more LNA molecules that target that region of the RNA.
Aberrant imprinted gene expression is implicated in several diseases including Long QT syndrome, Beckwith-Wiedemann, Prader-Willi, and Angelman syndromes, as well as behavioral disorders and carcinogenesis (see, e.g., Falls et al., Am. J. Pathol. 154:635-647 (1999); Lalande, Annu Rev Genet 30:173-195 (1996); Hall Annu Rev Med. 48:35-44 (1997)). LNA molecules can be created to treat such imprinted diseases. As one example, the long QT Syndrome can be caused by a K+ gated Calcium-channel encoded by Kcnq1. This gene is regulated by its antisense counterpart, the long noncoding RNA, Kcnq1ot1 (Pandey et al., Mol Cell. 2008 Oct. 24; 32(2):232-46). Disease arises when Kcnq1ot1 is aberrantly expressed. LNA molecules can be created to downregulate Kcnq1ot1, thereby restoring expression of Kcnq1. As another example, LNA molecules could inhibit RNA cofactors for polycomb complex chromatin modifiers to reverse the imprinted defect.
From a commercial and clinical perspective, the timepoints between about 1 to 24 hours potentially define a window for epigenetic reprogramming. The advantage of the LNA system is that it works quickly, with a defined half-life, and is therefore reversible upon degradation of LNAs, at the same time that it provides a discrete timeframe during which epigenetic manipulations can be made. By targeting nuclear long RNAs, LNA molecules or similar polymers, e.g., xylo-LNAs, might be utilized to manipulate the chromatin state of cells in culture or in vivo, by transiently eliminating the regulatory RNA and associated proteins long enough to alter the underlying locus for therapeutic purposes. In particular, LNA molecules or similar polymers that specifically bind to, or are complementary to, PRC1-binding RNA can prevent recruitment of PRC1 to a specific chromosomal locus, in a gene-specific fashion.
LNA molecules might also be administered in vivo to treat other human diseases, such as but not limited to cancer, neurological disorders, infections, inflammation, and myotonic dystrophy. For example, LNA molecules might be delivered to tumor cells to downregulate the biologic activity of a growth-promoting or oncogenic long nuclear RNA (e.g., Gtl2 or MALAT1 (Luo et al., Hepatology. 44(4):1012-24 (2006)), a RNA associated with metastasis and is frequently upregulated in cancers). Repressive RNAs downregulating tumor suppressors can also be targeted by LNA molecules to promote reexpression. For example, expression of the INK4b/ARF/INK4a tumor suppressor locus is controlled by Polycomb group proteins including PRC1 and PRC1 and repressed by the antisense noncoding RNA ANRIL (Yap et al., Mol Cell. 2010 Jun. 11; 38(5):662-74). PRC1-binding regions described herein in ANRIL can be targeted by LNA molecules to promote reexpression of the INK4b/ARF/INK4a tumor suppressor. Some ncRNAs may be positive regulators of oncogenes. Such “activating ncRNAs” have been described recently (e.g., Jpx (Tian et al., Cell. 143(3):390-403 (2010) and others (Ørom et al., Cell. 143(1):46-58 (2010)). Therefore, LNA molecules could be directed at these activating ncRNAs to downregulate oncogenes. LNA molecules could also be delivered to inflammatory cells to downregulate regulatory ncRNA that modulate the inflammatory or immune response. (e.g., LincRNA-Cox2, see Guttman et al., Nature. 458(7235):223-7. Epub 2009 Feb. 1 (2009)).
In still other related aspects, the LNA molecules targeting PRC1-binding regions in RNAs described herein can be used to create animal or cell models of conditions associated with altered gene expression (e.g., as a result of altered epigenetics).
The methods described herein may also be useful for creating animal or cell models of other conditions associated with aberrant imprinted gene expression, e.g., as noted above.
In various related aspects, the results described herein demonstrate the utility of LNA molecules for targeting RNA, for example, to transiently disrupt chromatin for purposes of reprogramming chromatin states ex vivo. Because LNA molecules stably displace RNA for hours and chromatin does not rebuild for hours thereafter, LNA molecules create a window of opportunity to manipulate the epigenetic state of specific loci ex vivo, e.g., for reprogramming of hiPS and hESC prior to stem cell therapy. For example, Gtl2 controls expression of DLK1, which modulates the pluripotency of iPS cells. Low Gtl2 and high DLK1 is correlated with increased pluripotency and stability in human iPS cells. Thus, LNA molecules targeting Gtl2 can be used to inhibit differentiation and increase pluripotency and stability of iPS cells.
See also PCT/US 11/60493, which is incorporated by reference herein in its entirety.
Interfering RNA, Including siRNA/shRNA
In some embodiments, the inhibitory nucleic acid sequence that is complementary to an RNA can be an interfering RNA, including but not limited to a small interfering RNA (“siRNA”) or a small hairpin RNA (“shRNA”). Methods for constructing interfering RNAs are well known in the art. For example, the interfering RNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e., each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure); the antisense strand comprises nucleotide sequence that is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof (i.e., an undesired gene) and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. Alternatively, interfering RNA is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions are linked by means of nucleic acid based or non-nucleic acid-based linker(s). The interfering RNA can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The interfering can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNA interference.
In some embodiments, the interfering RNA coding region encodes a self-complementary RNA molecule having a sense region, an antisense region and a loop region. Such an RNA molecule when expressed desirably forms a “hairpin” structure, and is referred to herein as an “shRNA.” The loop region is generally between about 2 and about 10 nucleotides in length. In some embodiments, the loop region is from about 6 to about 9 nucleotides in length. In some embodiments, the sense region and the antisense region are between about 15 and about 20 nucleotides in length. Following post-transcriptional processing, the small hairpin RNA is converted into a siRNA by a cleavage event mediated by the enzyme Dicer, which is a member of the RNase III family. The siRNA is then capable of inhibiting the expression of a gene with which it shares homology. For details, see Brummelkamp et al., Science 296:550-553, (2002); Lee et al, Nature Biotechnol., 20, 500-505, (2002); Miyagishi and Taira, Nature Biotechnol 20:497-500, (2002); Paddison et al. Genes & Dev. 16:948-958, (2002); Paul, Nature Biotechnol, 20, 505-508, (2002); Sui, Proc. Natl. Acad. Sd. USA, 99(6), 5515-5520, (2002); Yu et al. Proc NatlAcadSci USA 99:6047-6052, (2002).
The target RNA cleavage reaction guided by siRNAs is highly sequence specific. In general, siRNA containing a nucleotide sequences identical to a portion of the target nucleic acid are preferred for inhibition. However, 100% sequence identity between the siRNA and the target gene is not required to practice the present invention. Thus the invention has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence. For example, siRNA sequences with insertions, deletions, and single point mutations relative to the target sequence have also been found to be effective for inhibition. Alternatively, siRNA sequences with nucleotide analog substitutions or insertions can be effective for inhibition. In general the siRNAs must retain specificity for their target, i.e., must not directly bind to, or directly significantly affect expression levels of, transcripts other than the intended target.
Ribozymes
In some embodiments, the inhibitory nucleic acids are ribozymes. Trans-cleaving enzymatic nucleic acid molecules can also be used; they have shown promise as therapeutic agents for human disease (Usman & McSwiggen, 1995 Ann. Rep. Med. Chem. 30, 285-294; Christoffersen and Marr, 1995 J. Med. Chem. 38, 2023-2037). Enzymatic nucleic acid molecules can be designed to cleave specific RNA targets within the background of cellular RNA. Such a cleavage event renders the RNA non-functional.
In general, enzymatic nucleic acids with RNA cleaving activity act by first binding to a target RNA. Such binding occurs through the target binding portion of a enzymatic nucleic acid which is held in close proximity to an enzymatic portion of the molecule that acts to cleave the target RNA. Thus, the enzymatic nucleic acid first recognizes and then binds a target RNA through complementary base pairing, and once bound to the correct site, acts enzymatically to cut the target RNA. Strategic cleavage of such a target RNA will destroy its ability to direct synthesis of an encoded protein. After an enzymatic nucleic acid has bound and cleaved its RNA target, it is released from that RNA to search for another target and can repeatedly bind and cleave new targets.
Several approaches such as in vitro selection (evolution) strategies (Orgel, 1979, Proc. R. Soc. London, B 205, 435) have been used to evolve new nucleic acid catalysts capable of catalyzing a variety of reactions, such as cleavage and ligation of phosphodiester linkages and amide linkages, (Joyce, 1989, Gene, 82, 83-87; Beaudry et al., 1992, Science 257, 635-641; Joyce, 1992, Scientific American 267, 90-97; Breaker et al, 1994, TIBTECH 12, 268; Bartel et al, 1993, Science 261:1411-1418; Szostak, 1993, TIBS 17, 89-93; Kumar et al, 1995, FASEB J., 9, 1183; Breaker, 1996, Curr. Op. Biotech., 1, 442). The development of ribozymes that are optimal for catalytic activity would contribute significantly to any strategy that employs RNA-cleaving ribozymes for the purpose of regulating gene expression. The hammerhead ribozyme, for example, functions with a catalytic rate (kcat) of about 1 min−1 in the presence of saturating (10 MM) concentrations of Mg2+ cofactor. An artificial “RNA ligase” ribozyme has been shown to catalyze the corresponding self-modification reaction with a rate of about 100 min-1. In addition, it is known that certain modified hammerhead ribozymes that have substrate binding arms made of DNA catalyze RNA cleavage with multiple turn-over rates that approach 100 min-1.
Making and Using Inhibitory Nucleic Acids
The nucleic acid sequences used to practice the methods described herein, whether RNA, cDNA, genomic DNA, vectors, viruses or hybrids thereof, can be isolated from a variety of sources, genetically engineered, amplified, and/or expressed/generated recombinantly. If desired, nucleic acid sequences of the invention can be inserted into delivery vectors and expressed from transcription units within the vectors. The recombinant vectors can be DNA plasmids or viral vectors. Generation of the vector construct can be accomplished using any suitable genetic engineering techniques well known in the art, including, without limitation, the standard techniques of PCR, oligonucleotide synthesis, restriction endonuclease digestion, ligation, transformation, plasmid purification, and DNA sequencing, for example as described in Sambrook et al. Molecular Cloning: A Laboratory Manual. (1989)), Coffin et al. (Retroviruses. (1997)) and “RNA Viruses: A Practical Approach” (Alan J. Cann, Ed., Oxford University Press, (2000)).
Preferably, inhibitory nucleic acids of the invention are synthesized chemically. Nucleic acid sequences used to practice this invention can be synthesized in vitro by well-known chemical synthesis techniques, as described in, e.g., Adams (1983) J. Am. Chem. Soc. 105:661; Belousov (1997) Nucleic Acids Res. 25:3440-3444; Frenkel (1995) Free Radic. Biol. Med. 19:373-380; Blommers (1994) Biochemistry 33:7886-7896; Narang (1979) Meth. Enzymol. 68:90; Brown (1979) Meth. Enzymol. 68:109; Beaucage (1981) Tetra. Lett. 22:1859; U.S. Pat. No. 4,458,066; WO/2008/043753 and WO/2008/049085, and the references cited therein.
Nucleic acid sequences of the invention can be stabilized against nucleolytic degradation such as by the incorporation of a modification, e.g., a nucleotide modification. For example, nucleic acid sequences of the invention includes a phosphorothioate at least the first, second, or third internucleotide linkage at the 5′ or 3′ end of the nucleotide sequence. As another example, the nucleic acid sequence can include a 2′-modified nucleotide, e.g., a 2′-deoxy, 2′-deoxy-2′-fluoro, 2′—O-methyl, 2′—O-methoxyethyl (2′—O-MOE), 2′—O-aminopropyl (2′—O-AP), 2′—O-dimethylaminoethyl (2′—O-DMAOE), 2′—O-dimethylaminopropyl (2′—O-DMAP), 2′—O-dimethylaminoethyloxyethyl (2′—O-DMAEOE), or 2′—O—N-methylacetamido (2′—O—NMA). As another example, the nucleic acid sequence can include at least one 2′—O-methyl-modified nucleotide, and in some embodiments, all of the nucleotides include a 2′—O-methyl modification. In some embodiments, the nucleic acids are “locked,” i.e., comprise nucleic acid analogues in which the ribose ring is “locked” by a methylene bridge connecting the 2′—O atom and the 4′-C atom (see, e.g., Kaupinnen et al., Drug Disc. Today 2(3):287-290 (2005); Koshkin et al., J. Am. Chem. Soc., 120(50):13252-13253 (1998)). For additional modifications see US 20100004320, US 20090298916, and US 20090143326.
It is understood that any of the modified chemistries or formats of inhibitory nucleic acids described herein can be combined with each other, and that one, two, three, four, five, or more different types of modifications can be included within the same molecule.
Techniques for the manipulation of nucleic acids used to practice this invention, such as, e.g., subcloning, labeling probes (e.g., random-primer labeling using Klenow polymerase, nick translation, amplification), sequencing, hybridization and the like are well described in the scientific and patent literature, see, e.g., Sambrook et al., Molecular Cloning; A Laboratory Manual 3d ed. (2001); Current Protocols in Molecular Biology, Ausubel et al., eds. (John Wiley & Sons, Inc., New York 2010); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); Laboratory Techniques In Biochemistry And Molecular Biology: Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic Acid Preparation, Tijssen, ed. Elsevier, N.Y. (1993).
Pharmaceutical Compositions
The methods described herein can include the administration of pharmaceutical compositions and formulations comprising inhibitory nucleic acid sequences designed to target an RNA.
In some embodiments, the compositions are formulated with a pharmaceutically acceptable carrier. The pharmaceutical compositions and formulations can be administered parenterally, topically, orally or by local administration, such as by aerosol or transdermally. The pharmaceutical compositions can be formulated in any way and can be administered in a variety of unit dosage forms depending upon the condition or disease and the degree of illness, the general medical condition of each patient, the resulting preferred method of administration and the like. Details on techniques for formulation and administration of pharmaceuticals are well described in the scientific and patent literature, see, e.g., Remington: The Science and Practice of Pharmacy, 21st ed., 2005.
The inhibitory nucleic acids can be administered alone or as a component of a pharmaceutical formulation (composition). The compounds may be formulated for administration, in any convenient way for use in human or veterinary medicine. Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.
Formulations of the compositions of the invention include those suitable for intradermal, inhalation, oral/nasal, topical, parenteral, rectal, and/or intravaginal administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient (e.g., nucleic acid sequences of this invention) which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration, e.g., intradermal or inhalation. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect, e.g., an antigen specific T cell or humoral response.
Pharmaceutical formulations of this invention can be prepared according to any method known to the art for the manufacture of pharmaceuticals. Such drugs can contain sweetening agents, flavoring agents, coloring agents and preserving agents. A formulation can be admixtured with nontoxic pharmaceutically acceptable excipients which are suitable for manufacture. Formulations may comprise one or more diluents, emulsifiers, preservatives, buffers, excipients, etc. and may be provided in such forms as liquids, powders, emulsions, lyophilized powders, sprays, creams, lotions, controlled release formulations, tablets, pills, gels, on patches, in implants, etc.
Pharmaceutical formulations for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in appropriate and suitable dosages. Such carriers enable the pharmaceuticals to be formulated in unit dosage forms as tablets, pills, powder, dragees, capsules, liquids, lozenges, gels, syrups, slurries, suspensions, etc., suitable for ingestion by the patient. Pharmaceutical preparations for oral use can be formulated as a solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable additional compounds, if desired, to obtain tablets or dragee cores. Suitable solid excipients are carbohydrate or protein fillers include, e.g., sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxy-methylcellulose; and gums including arabic and tragacanth; and proteins, e.g., gelatin and collagen. Disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate. Push-fit capsules can contain active agents mixed with a filler or binders such as lactose or starches, lubricants such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active agents can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers.
Aqueous suspensions can contain an active agent (e.g., nucleic acid sequences of the invention) in admixture with excipients suitable for the manufacture of aqueous suspensions, e.g., for aqueous intradermal injections. Such excipients include a suspending agent, such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia, and dispersing or wetting agents such as a naturally occurring phosphatide (e.g., lecithin), a condensation product of an alkylene oxide with a fatty acid (e.g., polyoxyethylene stearate), a condensation product of ethylene oxide with a long chain aliphatic alcohol (e.g., heptadecaethylene oxycetanol), a condensation product of ethylene oxide with a partial ester derived from a fatty acid and a hexitol (e.g., polyoxyethylene sorbitol mono-oleate), or a condensation product of ethylene oxide with a partial ester derived from fatty acid and a hexitol anhydride (e.g., polyoxyethylene sorbitan mono-oleate). The aqueous suspension can also contain one or more preservatives such as ethyl or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents and one or more sweetening agents, such as sucrose, aspartame or saccharin. Formulations can be adjusted for osmolarity.
In some embodiments, oil-based pharmaceuticals are used for administration of nucleic acid sequences of the invention. Oil-based suspensions can be formulated by suspending an active agent in a vegetable oil, such as arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin; or a mixture of these. See e.g., U.S. Pat. No. 5,716,928 describing using essential oils or essential oil components for increasing bioavailability and reducing inter- and intra-individual variability of orally administered hydrophobic pharmaceutical compounds (see also U.S. Pat. No. 5,858,401). The oil suspensions can contain a thickening agent, such as beeswax, hard paraffin or cetyl alcohol. Sweetening agents can be added to provide a palatable oral preparation, such as glycerol, sorbitol or sucrose. These formulations can be preserved by the addition of an antioxidant such as ascorbic acid. As an example of an injectable oil vehicle, see Minto (1997) J. Pharmacol. Exp. Ther. 281:93-102.
Pharmaceutical formulations can also be in the form of oil-in-water emulsions. The oily phase can be a vegetable oil or a mineral oil, described above, or a mixture of these. Suitable emulsifying agents include naturally-occurring gums, such as gum acacia and gum tragacanth, naturally occurring phosphatides, such as soybean lecithin, esters or partial esters derived from fatty acids and hexitol anhydrides, such as sorbitan mono-oleate, and condensation products of these partial esters with ethylene oxide, such as polyoxyethylene sorbitan mono-oleate. The emulsion can also contain sweetening agents and flavoring agents, as in the formulation of syrups and elixirs. Such formulations can also contain a demulcent, a preservative, or a coloring agent. In alternative embodiments, these injectable oil-in-water emulsions of the invention comprise a paraffin oil, a sorbitan monooleate, an ethoxylated sorbitan monooleate and/or an ethoxylated sorbitan trioleate.
The pharmaceutical compounds can also be administered by in intranasal, intraocular and intravaginal routes including suppositories, insufflation, powders and aerosol formulations (for examples of steroid inhalants, see e.g., Rohatagi (1995) J. Clin. Pharmacol. 35:1187-1193; Tjwa (1995) Ann. Allergy Asthma Immunol. 75:107-111). Suppositories formulations can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at body temperatures and will therefore melt in the body to release the drug. Such materials are cocoa butter and polyethylene glycols.
In some embodiments, the pharmaceutical compounds can be delivered transdermally, by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.
In some embodiments, the pharmaceutical compounds can also be delivered as microspheres for slow release in the body. For example, microspheres can be administered via intradermal injection of drug which slowly release subcutaneously; see Rao (1995) J. Biomater Sci. Polym. Ed. 7:623-645; as biodegradable and injectable gel formulations, see, e.g., Gao (1995) Pharm. Res. 12:857-863 (1995); or, as microspheres for oral administration, see, e.g., Eyles (1997) J. Pharm. Pharmacol. 49:669-674.
In some embodiments, the pharmaceutical compounds can be parenterally administered, such as by intravenous (IV) administration or administration into a body cavity or lumen of an organ. These formulations can comprise a solution of active agent dissolved in a pharmaceutically acceptable carrier. Acceptable vehicles and solvents that can be employed are water and Ringer's solution, an isotonic sodium chloride. In addition, sterile fixed oils can be employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can likewise be used in the preparation of injectables. These solutions are sterile and generally free of undesirable matter. These formulations may be sterilized by conventional, well known sterilization techniques. The formulations may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents, e.g., sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like. The concentration of active agent in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight, and the like, in accordance with the particular mode of administration selected and the patient's needs. For IV administration, the formulation can be a sterile injectable preparation, such as a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated using those suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation can also be a suspension in a nontoxic parenterally-acceptable diluent or solvent, such as a solution of 1,3-butanediol. The administration can be by bolus or continuous infusion (e.g., substantially uninterrupted introduction into a blood vessel for a specified period of time).
In some embodiments, the pharmaceutical compounds and formulations can be lyophilized. Stable lyophilized formulations comprising an inhibitory nucleic acid can be made by lyophilizing a solution comprising a pharmaceutical of the invention and a bulking agent, e.g., mannitol, trehalose, raffinose, and sucrose or mixtures thereof. A process for preparing a stable lyophilized formulation can include lyophilizing a solution about 2.5 mg/mL protein, about 15 mg/mL sucrose, about 19 mg/mL NaCl, and a sodium citrate buffer having a pH greater than 5.5 but less than 6.5. See, e.g., U.S. 20040028670.
The compositions and formulations can be delivered by the use of liposomes. By using liposomes, particularly where the liposome surface carries ligands specific for target cells, or are otherwise preferentially directed to a specific organ, one can focus the delivery of the active agent into target cells in vivo. See, e.g., U.S. Pat. Nos. 6,063,400; 6,007,839; Al-Muhammed (1996) J. Microencapsul. 13:293-306; Chonn (1995) Curr. Opin. Biotechnol. 6:698-708; Ostro (1989) Am. J. Hosp. Pharm. 46:1576-1587. As used in the present invention, the term “liposome” means a vesicle composed of amphiphilic lipids arranged in a bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes that are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.
Liposomes can also include “sterically stabilized” liposomes, i.e., liposomes comprising one or more specialized lipids. When incorporated into liposomes, these specialized lipids result in liposomes with enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. Pat. No. 6,287,860.
The formulations of the invention can be administered for prophylactic and/or therapeutic treatments. In some embodiments, for therapeutic applications, compositions are administered to a subject who is need of reduced triglyceride levels, or who is at risk of or has a disorder described herein, in an amount sufficient to cure, alleviate or partially arrest the clinical manifestations of the disorder or its complications; this can be called a therapeutically effective amount. For example, in some embodiments, pharmaceutical compositions of the invention are administered in an amount sufficient to decrease serum levels of triglycerides in the subject.
The amount of pharmaceutical composition adequate to accomplish this is a therapeutically effective dose. The dosage schedule and amounts effective for this use, i.e., the dosing regimen, will depend upon a variety of factors, including the stage of the disease or condition, the severity of the disease or condition, the general state of the patient's health, the patient's physical status, age and the like. In calculating the dosage regimen for a patient, the mode of administration also is taken into consideration.
The dosage regimen also takes into consideration pharmacokinetics parameters well known in the art, i.e., the active agents' rate of absorption, bioavailability, metabolism, clearance, and the like (see, e.g., Hidalgo-Aragones (1996) J. Steroid Biochem. Mol. Biol. 58:611-617; Groning (1996) Pharmazie 51:337-341; Fotherby (1996) Contraception 54:59-69; Johnson (1995) J. Pharm. Sci. 84:1144-1146; Rohatagi (1995) Pharmazie 50:610-613; Brophy (1983) Eur. J. Clin. Pharmacol. 24:103-108; Remington: The Science and Practice of Pharmacy, 21st ed., 2005). The state of the art allows the clinician to determine the dosage regimen for each individual patient, active agent and disease or condition treated. Guidelines provided for similar compositions used as pharmaceuticals can be used as guidance to determine the dosage regiment, i.e., dose schedule and dosage levels, administered practicing the methods of the invention are correct and appropriate.
Single or multiple administrations of formulations can be given depending on for example: the dosage and frequency as required and tolerated by the patient, the degree and amount of therapeutic effect generated after each administration (e.g., effect on tumor size or growth), and the like. The formulations should provide a sufficient quantity of active agent to effectively treat, prevent or ameliorate conditions, diseases or symptoms.
In alternative embodiments, pharmaceutical formulations for oral administration are in a daily amount of between about 1 to 100 or more mg per kilogram of body weight per day. Lower dosages can be used, in contrast to administration orally, into the blood stream, into a body cavity or into a lumen of an organ. Substantially higher dosages can be used in topical or oral administration or administering by powders, spray or inhalation. Actual methods for preparing parenterally or non-parenterally administrable formulations will be known or apparent to those skilled in the art and are described in more detail in such publications as Remington: The Science and Practice of Pharmacy, 21st ed., 2005.
Various studies have reported successful mammalian dosing using complementary nucleic acid sequences. For example, Esau C., et al., (2006) Cell Metabolism, 3(2):87-98 reported dosing of normal mice with intraperitoneal doses of miR-122 antisense oligonucleotide ranging from 12.5 to 75 mg/kg twice weekly for 4 weeks. The mice appeared healthy and normal at the end of treatment, with no loss of body weight or reduced food intake. Plasma transaminase levels were in the normal range (AST 3/4 45, ALT 3/4 35) for all doses with the exception of the 75 mg/kg dose of miR-122 ASO, which showed a very mild increase in ALT and AST levels. They concluded that 50 mg/kg was an effective, non-toxic dose. Another study by Krützfeldt J., et al., (2005) Nature 438, 685-689, injected anatgomirs to silence miR-122 in mice using a total dose of 80, 160 or 240 mg per kg body weight. The highest dose resulted in a complete loss of miR-122 signal. In yet another study, locked nucleic acid molecules (“LNA molecules”) were successfully applied in primates to silence miR-122. Elmen J., et al., (2008) Nature 452, 896-899, report that efficient silencing of miR-122 was achieved in primates by three doses of 10 mg kg-1 LNA-antimiR, leading to a long-lasting and reversible decrease in total plasma cholesterol without any evidence for LNA-associated toxicities or histopathological changes in the study animals.
In some embodiments, the methods described herein can include co-administration with other drugs or pharmaceuticals, e.g., compositions for providing cholesterol homeostasis. For example, the inhibitory nucleic acids can be co-administered with drugs for treating or reducing risk of a disorder described herein.
The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
PRC1 is Polycomb Repressive Complex 1, a Polycomb complex that is biochemically distinct from PRC2. PRC1 is the ezymatic complex that ubiquitylates histone H2A at lysine 119 (H2AK119Ub). Action of PRC1 on chromatin results in chromatin compaction and transcriptional repression. Although PRC1 binds thousands of sites in the mammalian genome, how PRC1 is targeted to chromatin has remained a mystery. YY1 may recruit PRC1 in some contexts, but is unlikely to be the general mechanism. RNA-mediated targeting is another potential mechanism. PRC1 is known to interact with at least one RNA—ANRIL (Yap et al., Mol Cell. 2010 Jun. 11; 38(5):662-74). This example describes methods that were developed to determining how many RNAs interact with PRC1 and whether they are a general recruiting tool for PRC1.
These “denaturing” CLIP-seq methods (also referred to herein as dCLIP-seq) utilize a biotin tag to enable purification of RNA-protein complexes under denaturing conditions to increase the specificity of the purification scheme. As shown in FIGS. 1A-B, for the denaturing CLIP method, cell lines stably expressing two vectors were prepared: vector #1—expressing bacterial biotin ligase BirA under neomycin resistance; and vector #2—expressing a protein of interest (here, PRC1) fused to a biotinylation tag or control vector under puromycin resistance. Both human HEK 293 kidney cells and mouse 16.7 ES cells were used. Cells were crosslinked by exposure to ultraviolet (UV) light (254 nm) at 150-400 mJ/cm2 on ice depending on cell layer thickness, cellular lysates are prepared, then treated with DNAse to solubilize the chromatin, and protein-RNA complexes were pulled down using streptavidin beads. Importantly, the samples were then washed with a high stringency wash using 8 M urea+0.1% SDS (range: 0.0-2.0%) at room temperature. Samples were then further washed in PBS+2% SDS and further in high salt buffer (PBS+750 mM NaCl+1% NP40+0.5% NaDeoxycholate+0.1% SDS), each at room temperature. Under such stringent conditions, most proteins are denatured, resulting in the loss of the nonspecific RNA-protein interactions. Only the extremely high-affinity biotin-avidin interaction survives. Thus, these steps can be used to effectively remove the vast majority of background RNA, resulting in extremely clean “peaks” of binding. The samples are then treated with DNAse to remove contaminating DNA. The RNA was phosphorylated using 32P-ATP and run on SDS-PAGE and transferred onto a membrane. Broad bands corresponding to the RNA-PRC1 complex were identified by the presence of radioactive labeling (hot smear on the membrane) and then excised and eluted for cDNA preparation preparation prior to deep sequencing.
Peaks (high-frequency sequences, believed to correlate with protein binding sites on the RNA), were called by the following methods. About 40 million paired-end 50 nucleotide (nt) reads were generated for every dCLIP-seq sample. Adaptor sequences were trimmed with either Trim Galore! v0.3.3 (for dCLIP-seq; stringency 15 and allowed error rate 0.2), or cutadapt (v1.0). Identical sequences (PCR duplicates) were removed by custom programs prior to alignment. To account for the M. mus (mus)/M. castaneus (cas) hybrid character of mouse 16.7 ES cell line used for a dCLIP-seq, reads were first aligned to custom mus/129 and cas genomes, and then mapped back to the reference mm9 genome (Pinter et al., Genome Res 22, 1864-1876, 2012). For dCLIP-seq data obtained from human HEK293 cell line, alignments were performed to hg19 human reference genome. All alignments were performed with Tophat (v2.0.11) (Kim et al., Genome Biol 14, R36, 2013). Post-processing of alignments was performed with custom scripts using SAMtools (Li et al., Bioinformatics 25, 2078-2079, 2009), and BEDtools v2.17.0 (Quinlan and Hall, Bioinformatics 26, 841-842, 2010). These included accounting, alignment file-type conversion, extracting and sorting reads (SAMtools), and obtaining wig coverage files (SAMtools depth).
Fragment per million (fpm) wig files were then created by scaling uniquely aligned wig files to total number of fragments per million in each library (determined by SAMtools flagstat combining reads “with itself and mate mapped” and “singletons”). Then consecutive wig entries of equal coverage were merged forming bed files that were used for peak calling. The peak caller software peakranger (v.16) (Uren et al., Bioinformatics 28, 3013-3020, 2012) was used. The software peakranger requires an even distribution of watson/crick entries, so prior to calling, strand specific bed file entries were randomized for strand. The software peakranger was called with arguments ranger—p 0.01—format bed—gene_annot_file (either mm9 or hg19 appropriate), —d experiment and —c mock-transfected control, to find narrow peaks with p-value 0.01 or less. To extract more uniquely aligned reads, a second round of peak calling was performed from the mus track, this time including “pegged” reads attained using tophat2 with the option —g 100. Pegged reads are singletons extracted from the reps track where the locus of one end is fixed locus and other varies. We then merged the results with the previous method.
CLIP-seq performed in human female embryonic kidney fibroblast line, HEK293, as described above in Example 1. CBX7 binding sites in the RNA are shown in Table 1. Peaks were called from uniquely mapped reads using the software peakranger (p=0.01). The resulting strand specific bed files were then converted to their respective strands. To produce non-overlapping peaks, entries, from two biological replicate bed files were expanded by 500 nucleotides on each side and merged. The envelope of 500 bases was added because RNA-protein interactions could be affected by changes in nucleic acid folding nearby, which in turn could cause allosteric effects on the RNA-protein interaction. Then the closest gene was determined for each entry (bedtools closest) and categorized as “Imprinted” gene, “Oncogene”, and/or “Tumor Suppressor”.
Our analysis turned up 5893 binding sites in RNA for human CBX7. The columns (c) in Table 1 correspond to: c1, SEQ ID Number. c2, Chromosome number. c3, Read start position. c4, Read end position. c5, chromosome strand that the transcript is made from (+, top or Watson strand; −, bottom or Crick strand of each chromosome). C6, nearest gene name. c7, gene categories as defined in the following way.
The hexadecimal code is used in Table 1 to indicate the number of categories satisfied by each gene: The 4 bit represents an Imprinted gene (IM). The 2 bit represents an Oncogene (OC). The 1 bit represents a Tumor Suppressor (TS). The hexadecimal code can be translated to binary. Each bit represents the condition (1) or absence (0) of the condition. Thus:
| Value | binary | meaning | |
| 0x1 | 0 0 1 | TS | |
| 0x2 | 0 1 0 | OC | |
| 0x3 | 0 1 1 | TS and OC | |
| 0x4 | 1 0 0 | IM | |
| 0x5 | 1 0 1 | IM and TS | |
| 0x6 | 1 1 0 | IM and OC | |
| 0x7 | 1 1 1 | IM and OC and TS | |
CLIP-seq was performed as described in Example 1 in the mouse ES cell line, EL 16.7. CBX7 binding sites in the RNA are shown in Table 3. Peaks were called from uniquely mapped reads using the software peakranger (p=0.01). The resulting strand specific bed files were then converted to their respective strand. To produce non-overlapping peaks entries, 3 biological replicates of undifferentiated and 1 biological replicate of day 7-differentiated ES cells were expanded by 500 nucleotides on each side and merged. The envelope of 500 bases was added because RNA-protein interactions could be affected by changes in nucleic acid folding nearby, which in turn could cause allosteric effects on the RNA-protein interaction. Then the closest gene was determined for each entry (bedtools closest) and categorized as “Imprinted” gene, “Oncogene”, and/or “Tumor Suppressor”.
Our analysis revealed 18,953 binding sites (peaks) in RNA for mouse ES cells. The columns (c) in Table 3 correspond to: c1, SEQ ID Number. c2, Chromosome number. c3, Read start position. c4, Read end position. c5, chromosome strand that the transcript is made from (+, top or Watson strand; −, bottom or Crick strand of each chromosome). C6, nearest gene name. c7, gene categories as defined above in Example 2.
CBX7-binding sites shown in Table 2 were derived from dCLIP-seq performed in the mouse ES cell line, 16.7, as shown in Table 3, translated from mouse mm9 to human hg19 coordinates. The software UCSC Liftover was used to convert mouse mm9 coordinates from the mouse sub-sheet to human hg19 in the human liftover sub-sheet, prior to the envelope extension and merge step. The analysis led to 11,522 binding sites in human RNA. The columns (c) in Table 2 correspond to: c1, SEQ ID Number. c2, Chromosome number. c3, Read start position. c4, Read end position. c5, chromosome strand that the transcript is made from (+, top or Watson strand; −, bottom or Crick strand of each chromosome). C6, nearest gene name. c7, gene categories as defined in Example 2.
Analysis of the results described above indicated that PRC1 binding sites can be classified into several groups, including (i) 3′ untranslated region [3′ UTR], (ii) promoter-associated, (iii) gene body, (iv) antisense, and (v) intergenic. In order to block the identified interactions between Cbx7 and specific RNA transcripts, antisense oligonucleotides (ASO) LNAs were administered to cells in culture, to determine whether targeting the interaction between PRC1 and each of these RNA classes would change gene expression in cis.
First, the effects of disrupting PRC1-3′UTR interactions were examined. Potential Cbx7 binding sites (identified as described above) that were within 3′UTRs of three selected transcripts were identified based on CLIP-seq data, including (FIG. 2A) Mouse DDB1 and CUL4 Associated Factor 12-Like 1 (Dcafl2L1); (FIG. 2B) Mouse Calmodulin 2 (Calm2); (FIG. 2C) Mouse Mecp2; and Human IRAK1. 22-mer mixmer LNAs targeting selected binding sites (FIG. 3) were designed with the following sequences:
| TABLE 4 |
| Sequences of LNAs targeting Dusp9, Dcaf12L1, IRAK1, Mecp2, and Calm2 |
| SEQ ID | |||
| Target Gene | LNA I.D | LNA sequence | NO: |
| Dusp9 | Dusp9-1-a | CCTACAGTTCCAAGAAGTCTAA | 36372 |
| Dusp9-1-b | GAAGCAGGAAGGAGTCTACACG | 36373 | |
| Dusp9-2-a | CAGTTTGACCACCCTCAGTCAC | 36374 | |
| Dusp9-2-b | AAAGAAACAGTCAGGGCACCAG | 36375 | |
| Dusp9-3-a | CACAGGTATTGCCAGCTCCAGG | 36376 | |
| Dusp9-3-b | CACACACACAGAGTCTACAACG | 36377 | |
| Dcaf12L1 | Dcaf12L1-1 | CCTGTCTGCCATACATTCTACA | 36378 |
| Dcaf12L1-2 | GCTCAGACTTCTTCCTTTGCAC | 36379 | |
| Dcaf12L1-3 | GTAACAGATCTATTCTACTTGA | 36380 | |
| Dcaf12L1-4-a | CATTATCTCTATTTATCTGAAC | 36381 | |
| Dcaf12L1-4-b | GGAGAAAACCAATCTATCCGCA | 36382 | |
| Calm2 | Calm2-1-a | GCCAGAGTAAGCCACATGCAAC | 36383 |
| Calm2-1-b | TTAGATGTGCAGACGGGCTTAG | 36384 | |
| Calm2-2-a | TTACAGCTCCACACTTCAACAAC | 36385 | |
| Calm2-2-b | ACATGCTGACAGTTCCTAAAAG | 36386 | |
| Scrambled control | LNA-Scr | GTGTAACACGTCTATACGCCCA | 36387 |
| Tsix | Tsix-region-1 | AGAGTACAGTTAACAAGCTGGGT | 36388 |
| Tsix-region-2 | TGTTTTGTGACAGGGATTCT | 36389 | |
| Tsix-region-3a | TTCTTCCTTGCATTGTGTCTA | 36390 | |
| Tsix-region-3b | GGTGTGTCCTATGGTCCTATGT | 36391 | |
| Tsix-region-3c | CCATGTAACAGAATGTTGAGAT | 36392 | |
| Tsix-region-4a | CATAATCTGTGACCAGTACCTC | 36393 | |
| Tsix-region-4b | CATCAGAAGAGGTTAGATAT | 36394 | |
| Tsix-region-4c | TGGAGGCAGGTGGATTTCTAAC | 36395 | |
| IRAK1 | IRAK1-a | CCAACATGCGCCAGCCTCCTCA | 36396 |
| IRAK1-b | AAGTGCTGGGATTACAGGCGTG | 36397 | |
| IRAK1-c | ATCATGACTCACTGCAGCCTCG | 36398 | |
| Mecp2 | Mecp2-reg 1-a | TCGCTATACCACAGTCCACAGG | 36399 |
| Mecp2-reg1-b | TGAAGCAGAGAGCAGGAAGAAG | 36400 | |
| Mecp2-reg1-c | ACACCTCAAATCTCAAGAGGCT | 36401 | |
| Mecp2-reg2-a | GATTACTCCCTAGAGCAAGGCC | 36402 | |
| Mecp2-reg2-b | CACAAGGAAAGGGCTCGGCACA | 36403 | |
| Mecp2-reg2-c | CCACTTCCCTCCCTTCAAATGC | 36404 | |
Phosphate residues were replaced with phosphorothioate residues for increased stability. Multiple LNA oligonucleotides (LNAs) targeting the same transcript were pooled together to the final concentration of 50 μM. Following trypsinization and feeder removal, a total of 2×106 EL 16.7 mouse ES cells were resuspended in 100 μL of ES cell nucleofector solution (Lonza) supplemented with 2 μM LNAs. The cells were transfected using the A-030 program. A 0.5 mL of culture medium was added to the cells and 250 μL of this suspension was plated on gelatinized 6-well tissue culture dish with 2 ml of fibroblast-conditioned media. Per time point, whole cell RNA was extracted using a Trizol reagent and expression of the target genes was estimated using quantitative real-time RT-PCR (normalized to beta-actin as a reference gene).
The effect of LNAs on gene expression was represented as a ratio between specific LNAs and scrambled control. The results are shown in FIGS. 3 and 5A-B. To test the specificity of LNA pools, two unrelated amplicons were tested for every LNA pool along with a specific one. There was a specific increase in Dcafl2L1 gene expression 24 hrs after nucleofection with the Dcafl2L1-specific LNA pool as compared to unrelated Calm2 or Dusp9 genes (FIG. 3, right). The same was true for the LNA pool against Calm2, which resulted in a specific increase in Calm2 mRNA levels as compared to unrelated Dsup9 and Dcaf12L1 genes 24 hrs after nucleofection (FIG. 3, left). These results indicate that targeting the RNA interaction with PRC1 lead to an increase in gene expression.
In contrast, LNAs targeting Mecp2 and IRAK1 interaction with PRC1-binding RNA resulted in gene downregulation, presumably as a result of disrupting PRC1 RNA interactions. Mouse embryonic fibroblasts (MEFs) were nucleofected with pooled LNAs and harvested after 24 hours for qRT-PCR analysis of Mecp2 expression. Downregulation was seen after Mecp2-specific LNA treatment, but not seen with LNAs against Tsix or scrambled control. In addition, human PC3 cells were transfected with pooled IRAK1-specific LNA or control scrambled LNA, then harvested after 24 hours or 36 hours for qRT-PCR analysis of IRAK1 expression. Specific downregulation was seen for IRAK1-specific LNA. Thus, these LNAs caused downregulation but not elimination of gene expression in cis. Thus, targeting 3′ UTR-PRC1 interactions by antisense oligonucleotides provides an alternative approach to RNAi methods and may be especially useful when one aims to titrate down but not eliminate gene expression, such as in the case of MECP2 Duplication Syndrome.
Second, we examined the effects of disrupting PRC1-antisense RNA interactions. As an example, Tsix RNA is antisense to Xist and binds PRC1 via CBX7 at both Tsix's 5′ and 3′ ends. Tsix RNA is a known repressor of Xist expression but the mechanisms of repression have not be fully elucidated. Here we hypothesized that Tsix in part recruits PRC1 to repress Xist expression. Targeting Tsix RNA with ASO mixmers led to increased Xist expression even after just 6 hours of treatment (FIG. 4A, B), consistent with a derepression of Xist when PRC1 cannot be recruited. Furthermore, ANRIL is antisense to INK4a and interacts with CBX7. Targeting ANRIL is expected to lead to derepression of the linked coding gene INK4a, consistent with loss of ANRIL-PRC1 interactions. Thus, antisense RNAs interact with PRC1 and serve as recruiting tools for PRC1 in cis.
Third, we examined the effects of disrupting PRC1-intergenic RNA interactions. Genes can either be turned up or down. For example, Xist is a CBX7 target. Xist recruits PRC1 via CBX7 to the rest of the X-chromosome. Targeting Xist binding sites is expected to prevent PRC1 recruitment and leads to failure of X-inactivation or higher likelihood of X-reactivation. As an opposite example, Pvt1 is a long noncoding RNA located next to c-Myc and is a frequent site of translocations in B-cell lymphomas (e.g., Burkitt's). Pvt1 and cMyc are both associated with oncogenesis. Pvt1 appears to be a positive regulator of cMyc expression. Our analysis shows that Pvt1 is a PRC1 target. Pvt1 may recruit PRC1 and result in upregulation of cMyc.
These data indicate that PRC1-RNA interactions may serve different functions within cells and genes may be up- or down-regulated by disrupting these CBX7-RNA interactions.
| Lengthy table referenced here |
| US20230348908A1-20231102-T00001 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20230348908A1-20231102-T00002 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20230348908A1-20231102-T00003 |
| Please refer to the end of the specification for access instructions. |
It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
| LENGTHY TABLES |
| The patent application contains a lengthy table section. A copy of the table is available in electronic form from the USPTO web site (<![CDATA[https://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20230348908A1]]>). An electronic copy of the table will also be available from the USPTO upon request and payment of the fee set forth in 37 CFR 1.19(b)(3). |
1.-36. (canceled)
37. A method of reducing expression of a target interleukin 1 receptor-associated kinase 1 (IRAK1) gene in a cell, the method comprising delivering to the cell a single stranded oligonucleotide of 15 to 40 nucleotides in length having a region of complementarity that is complementary with at least 15 contiguous nucleotides of an IRAK1 RNA, wherein the oligonucleotide is complementary to and binds to or within 500 nt of SEO ID NOs: 5874, 5875, 17389, 17390, or 17391, wherein PRC1 binding to the IRAK1 RNA is disrupted.
38.-41. (canceled)
42. The method of claim 37, wherein the cell is in vitro.
43. The method of claim 37, wherein the cell is in vivo.
44. The method of claim 37, wherein at least one nucleotide of the oligonucleotide is a modified nucleotide.
45.-48. (canceled)
49. The method of claim 37, wherein the oligonucleotide has complementarity to the IRAK1 RNA in a region of the IRAK1 RNA that forms a stem-loop structure.
50. (canceled)
51. The method of claim 37, wherein at least one nucleotide of the oligonucleotide is a ribonucleic acid analogue comprising a ribose ring having a bridge between its 2′-oxygen and 4′-carbon.
52. The method of claim 51, wherein the ribonucleic acid analogue comprises a methylene bridge between the 2′-oxygen and the 4′-carbon.
53. The method of claim 37, wherein at least one nucleotide of the oligonucleotide comprises a modified sugar moiety.
54. The method of claim 53, wherein the modified sugar moiety comprises a 2′-O-methoxyethyl modified sugar moiety, a 2′-methoxy modified sugar moiety, a 2′—O-alkyl modified sugar moiety, or a bicyclic sugar moiety.
55. The method of claim 37, wherein the oligonucleotide comprises at least one modified internucleoside linkage.
56. The method of claim 55, wherein the at least one modified internucleoside linkage is selected from phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, carboxymethyl ester, and combinations thereof.
57. The method of claim 37, wherein the oligonucleotide is configured such that hybridization of the single stranded oligonucleotide to the PRC1-binding RNA does not activate an RNAse H pathway in the cell.
58.-61. (canceled)
62. The method of claim 37, wherein the cell is a cell of a male subject.
63.-67. (canceled)
68. A method of isolating RNA sequences that interact with a selected protein, e.g., with chromatin complexes, in a cell, the method comprising:
providing a cell expressing (i) a biotin ligase, e.g., BirA, and (ii) the protein of interest comprising a biotinylation sequence;
exposing the cells to UV-crosslinking;
lysing the cells,
isolating protein-RNA complexes from the lysed cells, e.g., using avidin purification, e.g., streptavidin beads;
washing the complexes in protein-denaturing conditions, e.g., high salt and detergent, e.g., using 8 M urea+0.1% SDS; and
isolating the protein-RNA complexes.
69.-75. (canceled)
76. A method for treating a subject with systemic lupus erythematosis, the method comprising administering a therapeutically effective amount of an inhibitory nucleic acid targeting a PRC1-binding region on IRAK1 RNA, preferably wherein the PRC1 binding region comprises SEQ ID NO: 5874, 5875, 17389, 17390, or 17391.
77. The method of claim 76, comprising administering an inhibitory nucleic acid targeting a sequence within the 3′UTR of IRAK1.
78. (canceled)
79. The method of claim 76, wherein the inhibitory nucleic acid comprises at least one locked nucleotide (LNA).
80.-83. (canceled)
84. The method of claim 37, wherein the oligonucleotide binds to or within 100 nt of SEQ ID NOs: 5874, 5875, 17389, 17390, or 17391.
85. The method of claim 37, wherein the oligonucleotide binds to or within SEQ ID NOs: 5874, 5875, 17389, 17390, or 17391.