Patent application title:

COMPOSITION FOR INCREASING EXPRESSION OF BLOOD COAGULATION FACTOR GENE, COMPRISING CORE-SHELL STRUCTURED MICROPARTICLES AS ACTIVE INGREDIENT

Publication number:

US20230390211A1

Publication date:
Application number:

18/062,252

Filed date:

2022-12-06

Abstract:

The present disclosure relates to a composition for increasing the expression of a blood coagulation factor gene, which contains core-shell structured microparticles as an active ingredient. When administered in vivo along with blood coagulation factor VIII gene or a variant gene thereof, the composition for increasing the expression of a blood coagulation factor gene of the present disclosure can increase the expression of the gene by at least 30%. When administered along with a gene therapeutic agent, the composition can achieve a therapeutic effect even with a very small amount of a gene, and thus is useful.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

A61K9/5015 »  CPC main

Medicinal preparations characterised by special physical form; Preparations in capsules, e.g. of gelatin, of chocolate; Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals; Wall or coating material Organic compounds, e.g. fats, sugars

A61K38/1833 »  CPC further

Medicinal preparations containing peptides; Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans; Growth factors; Growth regulators Hepatocyte growth factor; Scatter factor; Tumor cytotoxic factor II

A61K47/186 »  CPC further

Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient; Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing nitrogen, e.g. nitro-, nitroso-, azo-compounds, nitriles, cyanates; Amines; Amides; Ureas; Quaternary ammonium compounds; Amino acids; Oligopeptides having up to five amino acids Quaternary ammonium compounds, e.g. benzalkonium chloride or cetrimide

A61K48/00 »  CPC further

Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

A61K9/50 IPC

Medicinal preparations characterised by special physical form; Preparations in capsules, e.g. of gelatin, of chocolate Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals

A61P7/04 »  CPC further

Drugs for disorders of the blood or the extracellular fluid Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents

A61K38/37 »  CPC further

Medicinal preparations containing peptides; Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans; Blood coagulation or fibrinolysis factors Factors VIII

A61P25/02 »  CPC further

Drugs for disorders of the nervous system for peripheral neuropathies

A61K31/02 »  CPC further

Medicinal preparations containing organic active ingredients Halogenated hydrocarbons

A61K31/025 »  CPC further

Medicinal preparations containing organic active ingredients; Halogenated hydrocarbons carbocyclic

A61K31/035 »  CPC further

Medicinal preparations containing organic active ingredients; Halogenated hydrocarbons having aliphatic unsaturation

A61K33/16 »  CPC further

Medicinal preparations containing inorganic active ingredients Fluorine compounds

A61K38/18 IPC

Medicinal preparations containing peptides; Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans Growth factors; Growth regulators

A61K38/30 »  CPC further

Medicinal preparations containing peptides; Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans; Hormones Insulin-like growth factors (Somatomedins), e.g. IGF-1, IGF-2

A61K47/06 »  CPC further

Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite

A61K47/18 IPC

Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient; Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing nitrogen, e.g. nitro-, nitroso-, azo-compounds, nitriles, cyanates Amines; Amides; Ureas; Quaternary ammonium compounds; Amino acids; Oligopeptides having up to five amino acids

A61K47/24 »  CPC further

Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient; Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing atoms other than carbon, hydrogen, oxygen, halogen, nitrogen or sulfur, e.g. cyclomethicone or phospholipids

A61K47/26 »  CPC further

Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient; Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite Carbohydrates, e.g. sugar alcohols, amino sugars, nucleic acids, mono-, di- or oligo-saccharides; Derivatives thereof, e.g. polysorbates, sorbitan fatty acid esters or glycyrrhizin

A61K47/28 »  CPC further

Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient; Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite Steroids, e.g. cholesterol, bile acids or glycyrrhetinic acid

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a continuation application of co-pending U.S. patent application Ser. No. 16/969,040, filed Dec. 28, 2020, which is a § 371 national stage entry of International Application No. PCT/KR2019/001709, filed on Feb. 12, 2019, which claims priority to Korean Patent Application No. 10-2018-0017075, filed on Feb. 12, 2018, and Korean Patent Application No. 10-2019-0016076, filed on Feb. 12, 2019, the entire contents of which are incorporated herein by reference.

SEQUENCE LISTING

The instant application contains a Sequence Listing, which has been submitted electronically in ASCII format, and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Oct. 15, 2020, is named G1035-17101_RevisedSequenceList.txt and is 52,733 bytes in size.

TECHNICAL FIELD

The present disclosure relates to a composition for increasing the expression of a blood coagulation factor gene, which contains core-shell structured microparticles as an active ingredient.

BACKGROUND ART

Hemophilia is one of severe genetic disorders. Hemophilia A is an X gene-linked disease occurring in 1 in 5000 males. It arises from the mutation of human blood coagulation factor VIII (also known as factor VIII, factor 8, FVIII or F8), which is an important plasma glycoprotein in blood clotting.

Before the 1980s, patients with hemophilia received administration of blood coagulation factor VIII extracted from the plasma of other people for treatment. But, this method had severe problems such as viral infection, etc. In order to overcome this advantage, full-length factor VIII produced in CHO cells, etc. based on recombinant protein researches are used for treatment since the 1980s.

The inventors of the present disclosure have researched to develop a gene therapeutic agent capable of achieving therapeutic effect even with a small amount of a gene. In doing so, they have identified that, when core-shell structured microparticles consisting of a halogenated hydrocarbon and/or halogenated sulfur as a core and a lipid component as an outer shell are administered in vivo along with a blood coagulation factor VIII gene, the expression of the blood coagulation factor gene is increased remarkably, and have completed the present disclosure.

REFERENCES OF RELATED ART

Patent Documents

(Patent document 001) KR 10-1542752 B.

(Patent document 002) KR 10-2018-0118659 A.

DISCLOSURE

Technical Problem

The present disclosure is directed to providing a composition for increasing the expression of a blood coagulation factor gene, which contains core-shell structured microparticles as an active ingredient.

The present disclosure is also directed to providing a pharmaceutical composition for preventing or treating a bleeding disorder or bleeding, which contains the composition described above.

Technical Solution

The present disclosure provides a composition for increasing the expression of a blood coagulation factor gene, which contains core-shell structured microparticles as an active ingredient, wherein the core is a halogenated hydrocarbon, halogenated sulfur or a mixture thereof as a biocompatible gas, and the shell is a lipid or a derivative thereof, and the blood coagulation factor gene is one or more gene selected from a human blood coagulation factor VIII gene or a variant gene thereof.

In an exemplary embodiment of the present disclosure, the biocompatible gas may be selected from sulfur hexafluoride, octafluoropropane, bromochlorodifluoromethane, chlorodifluoromethane, dichlorodifluoromethane, bromotrifluoromethane, chlorotrifluoromethane, chloropentafluoroethane, dichlorotetrafluoroethane and a mixture thereof.

In an exemplary embodiment of the present disclosure, the halogenated hydrocarbon may be a perfluorinated hydrocarbon.

In an exemplary embodiment of the present disclosure, the perfluorinated hydrocarbon may be perfluoromethane, perfluoroethane, perfluoropropane, perfluorobutane, perfluoropentane, perfluorohexane, perfluoroheptane, perfluoropropene, perfluorobutene, perfluorobutadiene, perfluorobut-2-ene, perfluorocyclobutane, perfluoromethylcyclobutane, perfluorodimethylcyclobutane, perfluorotrimethylcyclobutane, perfluorocyclopentane, perfluoromethylcyclopentane, perfluorodimethylcyclopentane, perfluoromethylcyclohexane, perfluoromethylcyclohexane, perfluoromethylcyclohexane or a mixture thereof.

In an exemplary embodiment of the present disclosure, the lipid may be one or more selected from a group consisting of a simple lipid, a phospholipid, a glyceroglycolipid, a sphingoglycolipid, a cholesterol and a cationic lipid.

In an exemplary embodiment of the present disclosure, the phospholipid may be selected from a group consisting of a phosphatidylcholine derivative, a phosphatidylethanolamine derivative, a phosphatidylserine derivative, a diacetylated phospholipid, L-Îą-dioleyl phosphatidylethanolamine, diolein, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, lysophosphatidylcholine, sphingomyelin, a polyethylene glycolated phospholipid, egg yolk lecithin, soy lecithin and a hydrogenated phospholipid.

In an exemplary embodiment of the present disclosure, the glyceroglycolipid may be selected from a group consisting of sulfoxyribosyl glyceride, diglycosyl diglyceride, digalactosyl diglyceride, galactosyl diglyceride and glycosyl diglyceride.

In an exemplary embodiment of the present disclosure, the sphingoglycolipid may be galactosyl cerebroside, lactosyl cerebroside or ganglioside.

In an exemplary embodiment of the present disclosure, the cationic lipid may be selected from a group consisting of 1,2-dioleoyl-3-trimethylammonium propane (DOTAP), N-(2,3-dioleyloxypropan-1-yl)-N,N,N-trimethylammonium chloride (DOTMA), 2,3-dioleyloxy-N-[2-(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE), 1,2-dioleoyloxypropyl-3-diethylhydroxyethylammonium bromide (DORIE) and 3β-[N—(N′N′-dimethylaminoethylhy)carbamoyl]cholesterol (DC-Chol).

In an exemplary embodiment of the present disclosure, the blood coagulation factor VIII may be composed of an amino acid sequence represented by SEQ ID NO 1, and the variant of blood coagulation factor VIII may be composed of an amino acid sequence represented by SEQ ID NO 3.

In an exemplary embodiment of the present disclosure, the composition may increase the expression of the blood coagulation factor gene by 30% or more.

The present disclosure also provides a pharmaceutical composition for preventing or treating a bleeding disorder or bleeding, which contains the composition described above and a human blood coagulation factor VIII gene or a variant gene thereof.

In an exemplary embodiment of the present disclosure, the bleeding disorder may be hemophilia A, hemophilia induced or complicated by an inhibitory antibody against blood coagulation factor VIII or blood coagulation factor VIIIa, or hemophilia B.

In an exemplary embodiment of the present disclosure, the bleeding disorder or bleeding may be one selected from a group consisting of neonatal coagulopathy, severe liver disease, thrombocytopenia, congenital deficiency of factor V, VII, X or XI, and von Willebrand disease having an inhibitor against von Willebrand factor.

In an exemplary embodiment of the present disclosure, the bleeding may be caused by blood loss associated with high-risk surgical procedures, traumatic blood loss, blood loss caused by bone marrow transplantation or blood loss caused by cerebral hemorrhage.

Advantageous Effects

A composition for increasing the expression of a blood coagulation factor gene of the present disclosure may increase the expression of the blood coagulation factor gene by at least 30% when administered in vivo along with blood coagulation factor VIII gene or a variant gene thereof (e.g., a polynucleotide encoding the gene or a vector including the same). Accordingly, it is useful since a therapeutic effect can be achieved with a very small amount of the gene when the composition is administered along with a gene therapeutic agent.

BRIEF DESCRIPTION OF DRAWINGS

FIG. 1 schematically illustrates a process of designing a blood coagulation factor VIII variant (F8M) according to an exemplary embodiment of the present disclosure.

FIG. 2 shows the cleavage map of a pGP vector according to an exemplary embodiment of the present disclosure.

FIG. 3 compares the expression level of the F8 protein in mouse depending on the administration of pGP-F8M (gene only), a pharmaceutical composition of a control group (F8M-JetPEI) and pharmaceutical compositions according to Example (F8M-MP1 and F8M-MP2).

FIG. 4 compares the expression level of the F9 protein in mouse depending on the administration of pGP-F9 (gene only) and pharmaceutical compositions according to Comparative Example (F9-MP1 and F9-MP2).

FIG. 5 schematically shows the domain structure constituting human blood coagulation factor VIII according to an exemplary embodiment of the present disclosure.

BEST MODE

Hereinafter, the present disclosure is described in detail.

In an aspect, the present disclosure provides a composition for increasing the expression of a blood coagulation factor gene, which contains core-shell structured microparticles as an active ingredient, wherein the core is a halogenated hydrocarbon, halogenated sulfur or a mixture thereof as a biocompatible gas, and the shell is a lipid or a derivative thereof, and the blood coagulation factor gene is one or more gene selected from a human blood coagulation factor VIII gene or a variant gene thereof.

Core

In the present disclosure, the “core” may be composed of a halogenated hydrocarbon, halogenated sulfur or a mixture thereof as a biocompatible gas.

The biocompatible gas may be sulfur hexafluoride, octafluoropropane, bromochlorodifluoromethane, chlorodifluoromethane, dichlorodifluoromethane, bromotrifluoromethane, chlorotrifluoromethane, chloropentafluoroethane, dichlorotetrafluoroethane or a mixture thereof.

Specifically, the halogenated hydrocarbon may be a perfluorinated hydrocarbon.

The perfluorinated hydrocarbon may be perfluoromethane, perfluoroethane, perfluoropropane, perfluorobutane, perfluoropentane, perfluorohexane, perfluoroheptane, perfluoropropene, perfluorobutene, perfluorobutadiene, perfluorobut-2-ene, perfluorocyclobutane, perfluoromethylcyclobutane, perfluorodimethylcyclobutane, perfluorotrimethylcyclobutane, perfluorocyclopentane, perfluoromethylcyclopentane, perfluorodimethylcyclopentane, perfluoromethylcyclohexane, perfluoromethylcyclohexane, perfluoromethylcyclohexane or a mixture thereof.

Specifically, the biocompatible gas of the present disclosure may be sulfur hexafluoride or perfluorobutane.

Shell

In the present disclosure, the “shell” may be composed of a lipid or a derivative thereof.

The lipid may be one or more selected from a group consisting of a simple lipid, a phospholipid, a glyceroglycolipid, a sphingoglycolipid, a cholesterol and a cationic lipid. Specifically, it may be a phospholipid.

The phospholipid may be a phosphatidylcholine derivative, a phosphatidylethanolamine derivative, a phosphatidylserine derivative, diacetylated phospholipid, L-Îą-dioleyl phosphatidylethanolamine, diolein, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, lysophosphatidylcholine, sphingomyelin, polyethylene glycolated phospholipid, egg yolk lecithin, soy lecithin, a hydrogenated phospholipid, etc.

The glyceroglycolipid may be sulfoxyribosyl glyceride, diglycosyl diglyceride, digalactosyl diglyceride, galactosyl diglyceride, glycosyl diglyceride, etc.

The sphingoglycolipid may be galactosyl cerebroside, lactosyl cerebroside, ganglioside, etc.

And, the cationic lipid may be 1,2-dioleoyl-3-trimethylammonium propane (DOTAP), N-(2,3-dioleyloxypropan-1-yl)-N,N,N-trimethylammonium chloride (DOTMA), 2,3-dioleyloxy-N-[2-(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE), 1,2-dioleoyloxypropyl-3-diethylhydroxyethylammonium bromide (DORIE), 3β-[N—(N′N′-dimethylaminoethylhy)carbamoyl]cholesterol (DC-Chol), etc.

Microparticles

The microparticles of the present disclosure are stabilized by the shell which surrounds the core gas. The shell retards the diffusion of a gas to nearby liquid and prevents fusion between the microparticles.

When administered in vivo, the microparticle retains its shape until it reaches a target cell or tissue, and releases the gas as it is destroyed near the target cell or tissue. The released gas may cause change in the cell membrane of the target cell and may facilitate the entry of the growth factor gene into the cytoplasmic environment of the target cell via the jet force of the gas.

The microparticles may have an average diameter of 1-10 Îźm, specifically 2-8 Îźm, more specifically 2-4 Îźm.

Composition for Increasing Gene Expression

Recently, there have been many researches on core-shell microparticles having a gas as a core. In the previous researches, the effect of increasing gene expression was not achieved unless ultrasound was irradiated together with the microparticles.

Specifically, Sang-Chol Lee et al., Korean Circulation J 2006; 36: 32-38; “Enhancement of Gene Delivery into Mouse Skeletal Muscle with Microbubble Destruction by Low-Frequency Ultrasound” discloses that the effect of increasing gene expression is not achieved when only a luciferase gene-microparticles mixture is injected without irradiation of ultrasound.

Z P Shen et al., Gene Therapy (2008) 15, 1147-1155; “Ultrasound with microbubbles enhances gene expression of plasmid DNA in the liver via intraportal delivery” also discloses that the effect of increasing gene expression is not achieved when only a luciferase gene-microparticles mixture is injected without irradiation of ultrasound.

In addition, Xingsheng Li et al., J Ultrasound Med 2008; 27: 453-460; “Experimental Research on Therapeutic Angiogenesis Induced by Hepatocyte Growth Factor Directed by Ultrasound-Targeted Microbubble Destruction in Rats” discloses that the effect of increasing gene expression is not achieved when only a HGF gene-liposome microparticles mixture is injected without irradiation of ultrasound.

However, the inventors of the present disclosure have identified that, while studying on the use of microparticles, the expression level of a blood coagulation factor gene, particularly a blood coagulation factor VIII gene, is increased remarkably even without ultrasound irradiation when the gene is injected along with the microparticles according to the present disclosure, and have completed the present disclosure. Meanwhile, as described specifically in the test example described later, the effect of increasing gene expression was not achieved with the microparticles for blood coagulation factor genes other than the blood coagulation factor VIII gene or a variant gene thereof (e.g., blood coagulation factor IX (also known as factor IX, factor 9, FIX or F9)).

When administered in vivo along with a blood coagulation factor VIII gene or a variant gene thereof, the composition for increasing gene expression of the present disclosure can increase the expression level of the blood coagulation factor gene by at least 30%.

In the examples described below, it was verified that, when administered along with a human blood coagulation factor VIII variant gene into mouse, the composition for increasing gene expression of the present disclosure increases the expression level of the blood coagulation factor VIII gene remarkably. More specifically, it was verified that, when the composition for increasing gene expression of the present disclosure and the blood coagulation factor VIII variant gene are administered together into an animal model, the expression level of the blood coagulation factor VIII gene is increased by 40% or more. In contrast, for a blood coagulation factor IX gene, the expression of the gene was hardly increased even when the composition for increasing gene expression of the present disclosure was administered together into mouse.

That is to say, it seems that the composition for increasing gene expression of the present disclosure is effective in increasing the expression level of the human blood coagulation factor gene specifically only when administered along with one or more gene selected from human blood coagulation factor VIII gene and a variant gene thereof, from among blood coagulation factors.

The composition may further contain a pharmaceutical adjuvant such as a stabilizer, a buffer, a salt for control of osmotic pressure, an excipient, an antiseptic, etc. or other therapeutically useful substances, and may be prepared into various formulations for oral or parenteral administration, specifically for parenteral administration, according to common methods. Specifically, a formulation for parenteral administration may be typically an injection formulation in the form of an isotonic aqueous solution or suspension. Alternatively, the composition may be prepared into a powder and then suspended in a solvent immediately before administration.

In the composition for increasing gene expression of the present disclosure, the content of the microparticles may be 0.5-2,000 ÎźL/mL, specifically 1-1,000 ÎźL/mL or 5-2,000 Îźg/mL, specifically 10-1,000 Îźg/mL, although not being particularly limited.

If the content of the microparticles is outside the above range, the desired effect cannot be achieved.

Specifically, the composition may be administered as a mixture with a gene to achieve a better effect.

Gene

The composition for increasing gene expression according to the present disclosure may further increase the expression and efficiency of genes when administered along with the following genes.

Blood Coagulation Factor VIII

In the present disclosure, the terms “blood coagulation factor VIII”, “factor VIII”, “FVIII” and “F8” are used interchangeably. Mature human blood coagulation factor VIII is composed of 2351 amino acids (including signal peptides), which are arranged in a domain structure shown in FIG. 5.

In FIG. 5, a1, a2 and a3 are acidic domains. The acidic domain a3 is known to be involved in the binding of the blood coagulation factor VIII molecule to a von Willebrand factor (vWF), which plays an important role in blood coagulation. In the process of secretion, the blood coagulation factor VIII is cleaved between the B-domain and the a3 acidic domain, resulting in a heterodimeric polypeptide. The blood coagulation factor VIII heterodimer consists of a light chain (including A3, C1 and C2) and a heavy chain of variable size (including A1, A2 and B). The heavy chain is heterogeneous due to limited proteolysis in the B-domain. In case of heterodimeric B-domain-deleted blood coagulation factor VIII, the “heavy chain” includes A1 and A2 but the B-domain is deleted partially or wholly.

The amino acid sequence of mature wild-type human blood coagulation factor VIII is shown in SEQ ID NO 1. The reference of an amino acid position of a specific sequence means the position of the amino acid in the VIII wild-type protein and does not exclude the presence of mutations (e.g., deletion, insertion and/or substitution) at other positions in the sequence. A DNA sequence encoding SEQ ID NO 1 is represented by SEQ ID NO 2.

“Blood coagulation factor VIII” includes not only wild-type blood coagulation factor VIII but also derivatives of the wild-type blood coagulation factor VIII having the procoagulant activity of the wild-type blood coagulation factor VIII. The derivative may have a sequence with deletion, insertion and/or addition as compared to the amino acid sequence of the wild-type blood coagulation factor VIII. Specifically, the derivative may be a molecule of blood coagulation factor VIII with all or part of the B-domain deleted. Throughout the present disclosure, the positions amino acids always refer to the positions of individual amino acids in the full-length mature wild-type blood coagulation factor VIII (including signal peptides).

Blood Coagulation Factor VIII Variant

In the present disclosure, the term “variant” includes conservative or non-conservative substitution, insertion or deletion of an amino acid sequence, a nucleic acid sequence, etc., and such change does not substantially alter the active site or active domain that confers the biological activity of FVIII.

The blood coagulation factor VIII variant according to the present disclosure is a single-chain blood coagulation factor VIII variant in which amino acids Asp784 to Arg1671 are deleted from blood coagulation factor VIII represented by SEQ ID NO 1. The blood coagulation factor VIII variant is one in which a part of the B-domain (residues 784-1667) and a part of the a3 domain (residues 1668-1671) are deleted, and the variant exhibits enhanced protein expression and improved blood coagulation activity and stability as compared to blood coagulation factor VIII and B-domain-deleted blood coagulation factor VIII. The blood coagulation factor VIII variant has an amino acid sequence represented by SEQ ID NO 3.

The “single-chain blood coagulation factor VIII” means a blood coagulation factor VIII molecule which exists as a single polypeptide chain without being cleaved into tow chains (e.g., a heavy chain and a light chain) by proteolysis during secretion from a cell expressing the blood coagulation factor VIII molecule.

In addition, the blood coagulation factor VIII variant may be expressed as a polynucleotide encoding the amino acid sequence.

Polynucleotide

In the present disclosure, the term “polynucleotide(s)” refers to any polyribonucleotide or polydeoxyribonucleotide which may be an unmodified RNA or DNA or a modified RNA or DNA. The polynucleotide of the present invention may be a single-chain DNA or RNA. As used herein, the term “polynucleotide(s)” includes a DNA or RNA containing modified bases and/or unique bases such as inosine. It is obvious that various modifications can be made to the DNA or RNA to serve a known useful purpose. As used herein, the term “polynucleotide(s)” includes such chemically, enzymatically or metabolically modified polynucleotide(s).

Those skilled in the art will appreciate that the blood coagulation factor VIII variant may be encoded by several polynucleotides due to the degeneracy of the genetic code. In other words, a polynucleotide sequence encoding the blood coagulation factor VIII variant that can be used in the present invention is interpreted to include a nucleotide sequence showing substantial identity to the amino acid sequence.

Plasmid

When the composition for increasing gene expression according to the present disclosure is administered along with a plasmid containing a single-chain polynucleotide encoding the gene, the expression efficiency and efficacy of the gene may be increased further.

In the present disclosure, the term “plasmid” generally refers to a circular DNA molecule formed by being operably linked to a vector so that an exogenous gene can be expressed in a host cell. However, the plasmid can be used as a vector that is degraded by specific restriction enzymes by gene recombination to incorporate a desired gene. Thus, the terms plasmid and vector are used interchangeably herein, and those skilled in the art of genetic engineering will fully understand their meanings even if they are not distinguished by names.

In the present disclosure, the term “vector” refers to a DNA molecule as a carrier that can stably transport an exogenous gene into a host cell. To be a useful vector, it must be replicable, have a way to enter the host cell, and be equipped with a means to detect its presence.

Expression

Expression Vector

The composition for increasing gene expression according to the present disclosure can further increase the expression and efficiency of a gene when administered along with expression vectors including single-chain polynucleotides encoding the gene.

In the present disclosure, the term “expression” refers to generation of the gene in a cell.

In the present disclosure, the term “expression vector” refers to a vector capable of expressing a target gene in a suitable host, and means a gene construct including an essential regulatory element operably linked to express a gene insert.

In the present disclosure, the term “operably linked” means that a nucleic acid expression-regulating sequence and a polynucleotide encoding a target gene are functionally linked to perform a general function. For example, a promoter and a polynucleotide encoding the gene may be operably linked to affect the expression of the polynucleotide. The operable linkage to a recombinant vector may be prepared using a genetic recombinant technique well known in the art, and site-specific DNA cleavage and ligation may be achieved using enzymes generally known in the art.

The expression vector of the present disclosure may be prepared using a plasmid, a vector or a viral vector, although not being limited thereto. An appropriate expression vector may include an expression-regulating element such as a promoter, an operator, a start codon, a stop codon, a polyadenylation signal, an enhancer, etc. and may be prepared variously according to purposes. The promoter of the vector may be constitutive or inducible. Since a plasmid is the most commonly used form of a vector at present, the terms “plasmid” and “vector” are used sometimes interchangeably in the present disclosure. For the purpose of the present disclosure, it is preferred to use a plasmid vector. A typical plasmid vector that can be used for this purpose has a structure including (a) a replication origin for effective replication into several to hundreds of plasmid vectors per host cell and (b) a restriction enzyme site into which a fragment of foreign DNA can be inserted. Even if a proper restriction enzyme site does not exist, the vector and foreign DNA can be easily ligated using synthetic oligonucleotide adaptors or linkers according to common methods.

A vector used for overexpression of a gene according to the present disclosure may be an expression vector known in the art. A framework vector that may be used in the present disclosure may be selected from a group consisting of pCDNA3.1, pGP, pEF, pVAX, pUDK, pCK, pQE40, pT7, pET/Rb, pET28a, pET-22b(+) and pGEX, although not being particularly limited thereto. Specifically, use of a vector selected from a group consisting of pGP, pEF, pCK, pUDK and pVAX may be preferred in terms of effect.

In a specific exemplary embodiment, the expression vector of the present disclosure may be an expression vector including a pGP vector having a cleavage map of FIG. 2.

Pharmaceutical Composition

In another aspect, the present disclosure provides a pharmaceutical composition for preventing or treating a bleeding disorder or bleeding, which contains the composition for increasing gene expression of the present disclosure and the blood coagulation factor VIII gene or a variant gene thereof.

The bleeding disorder may be hemophilia A, hemophilia induced or complicated by an inhibitory antibody against blood coagulation factor VIII or blood coagulation factor VIIIa, or hemophilia B. In addition, the bleeding disorder or bleeding may be one selected from a group consisting of neonatal coagulopathy, severe liver disease, thrombocytopenia, congenital deficiency of factor V, VII, X or XI, and von Willebrand disease having an inhibitor against von Willebrand factor.

And, the bleeding may be one caused by blood loss associated with high-risk surgical procedures, traumatic blood loss, blood loss caused by bone marrow transplantation or blood loss caused by cerebral hemorrhage.

The pharmaceutical composition for preventing or treating a bleeding disorder or bleeding may be usefully used to prevent or treat a bleeding disorder or bleeding since it exhibits superior therapeutic effect because gene expression is increased in vivo even with a small amount of the blood coagulation factor VIII gene or a variant gene thereof.

In the pharmaceutical composition of the present disclosure, the composition for increasing gene expression and the blood coagulation factor VIII gene or a variant gene thereof may be contained with a volume ratio of 1:0.5-30 (w/v).

The pharmaceutical composition of the present disclosure may be for gene therapy.

Formulation

The pharmaceutical composition of the present disclosure may be prepared into pharmaceutical formulations for therapeutic purposes.

Pharmaceutical carriers and excipients and suitable pharmaceutical formulations are known in the art (e.g., “Pharmaceutical Formulation Development of Peptides and Proteins”, Frokjaer et al., Taylor & Francis (2000) or “Handbook of Pharmaceutical Excipients”, 3rd edition, Kibbe et al., Pharmaceutical Press (2000)). In particular, the pharmaceutical composition of the present disclosure may be formulated as a lyophilized form or a stable liquid form. The composition of the present disclosure may be freeze-dried through various procedures known in the art. The freeze-dried formulation is reconstituted by adding one or more pharmaceutically acceptable diluent such as sterile water for injection or sterile physiological saline.

The formulation of the composition is delivered to a subject via any pharmaceutical suitable means of administration. Various known delivery systems may be used to deliver the composition through any convenient routes. Mainly, the composition of the present disclosure is administered systemically. For systemic administration, the composition of the present disclosure is formulated for parenteral (e.g., intravenous, subcutaneous, intramuscular, intraperitoneal, intracerebral, intrapulmonary, intranasal or transdermal) delivery or enteral (e.g., oral, vaginal or rectal) delivery according to common methods. The most preferred routes of administration are intravenous and intramuscular routes. These formulations can be administered continuously by infusion or by bolus injection. Some formulations encompass slow release systems.

The composition of the present disclosure is administered to a patient in a therapeutically effective dose, meaning a dose that is sufficient to produce the desired effect, preventing or lessening the severity or spread of the condition or indication being treated without reaching a dose which produces intolerable adverse effects. The exact dose depends on many factors such as the indication, formulation, mode of administration, etc. and has to be determined through preclinical and clinical trials for each respective indication.

The pharmaceutical composition of the present disclosure may be administered either alone or in combination with other therapeutic agents. These agents may be incorporated as a part of the same pharmaceutical.

Treatment Method

The present disclosure also relates to a method for treating a subject suffering from a bleeding disorder such as hemophilia A, hemophilia B or acquired hemophilia or a subject suffering from a chronic disease or liver disease. The treatment method may include a step of administering an effective amount of the pharmaceutical composition of the present disclosure to the subject.

According to an exemplary embodiment of the present disclosure, the gene of the present disclosure such as blood coagulation factor VIII gene or a variant gene thereof may be administered at a dose of 10 ng to 100 mg. When the administration of the blood coagulation factor VIII, a variant thereof or a polynucleotide encoding the same is repeated more than once, the administration dose may be the same or different for each administration.

Hereinafter, the present disclosure is described in more detail through specific examples. However, the examples are only for illustrating the present disclosure in more detail and it will be obvious to those of ordinary skill in the art that the scope of the present disclosure is not limited by them.

Examples

Preparation of Materials

Genes

Blood Coagulation Factor VIII (F8)

A gene full-length blood coagulation factor VIII (F8) represented by SEQ ID 1 was synthesized by Genscript (USA).

Variant of Blood Coagulation Factor VIII (F8M)

A full-length blood coagulation factor VIII gene represented by SEQ ID NO 1 was used as a template, and fragment 1 represented by SEQ ID NO 4 was prepared through polymerase chain reaction (PCR) using primers 1 and 2. The PCR was performed by mixing 2 μL of the template DNA, 1 μL of 10 pmol/μL primer each, 2.5 μL of 2.5 mM dNTP, 1 μL of a pfu enzyme mix (Enzynomics, Korea), 2.5 μL of a 10×buffer, and 50 μL of sterilized triply distilled water. The solution was reacted for 30 seconds at 95° C., 30 seconds at 60° C. and 30 seconds at 72° C. for 40 cycles. Using primers 3 and 4, fragment 2 represented by SEQ ID NO 5 was prepared by PCR as in the same manner as described above. Subsequently, the fragments 1 and 2 were subjected to overlapping PCR using primers 5 and 6, thereby preparing a single-chain blood coagulation factor VIII variant. In the overlapping PCR, 2 μL of each DNA fragment was added, and reaction time and method were the same as described above in the PCR. FIG. 1 schematically illustrates the process of designing the blood coagulation factor VIII variant (F8M) according to an exemplary embodiment of the present disclosure.

The primers are summarized in Table 1 below.

TABLE 1
Primer No. Primer name Base sequence
1 F8(F) ATGCAAATAGAGCTCTCCACCTGCTTCTTT
2 F8M-1(R) TCTGACTGAAGAGTAGTATTTTCTGGAATTGTGGT
GGCATTAAAT
3 F8M-2(F) CCACAATTCCAGAAAATACTACTCTTCAGTCAGAT
CAAGAGGAAATTGAC
4 F8(R) TCAGTAGAGGTCCTGTGCCTCGCAGCCCAG
5 F8 final(F) GCTAGCATGCAAATAGAGCTCTCCACCTGC
6 F8 final(R) GCGGCCGCTCAGTAGAGGTCCTGTGCCTCGCA

Blood Coagulation Factor IX (F9)

A gene of full-length blood coagulation factor IX (see GenBank base sequence FR846239.1) represented by SEQ ID NO 6 was synthesized by Bionics (Korea).

After synthesizing pCK plasm ids referring to the literature Lee et al. (Lee Y, et al. Improved expression of vascular endothelial growth factor by naked DNA in mouse skeletal muscles: implication for gene therapy of ischemic diseases. Biochem. Biophys. Res. Commun. 2000; 272(1): 230-235), PCR was conducted in the same manner described in the literature using primers 7 and 8 of Table 2 below. After reacting the obtained fragments with EcoRI enzyme at 37° C. for 1 hour, DNA was purified using an Expin Gel SV (GeneAll, Korea) kit. Then, after conducting ligation for 30 minutes using T4 ligase, the DNA was incubated overnight with E. coli. Next day, after isolating DNA from the colony through mini-prep, pGP plasmids represented by SEQ ID NO 7 were obtained. FIG. 2 shows the cleavage map of the pGP vector according to an exemplary embodiment of the present disclosure.

TABLE 2
Primer No. Primer name Base sequence
7 pGP(F) GACGAATTCACGCGTCTCGAGGCGGCCGCTCTA
GAGGGCCCGTTTAAA
8 pGP(R) GACGAATTCGTCGACGGATCCGCTAGCAAGCTT
CGTGTCAAGGACGGT

Preparation Example

Preparation of Plasmid DNAs Including Genes

Each of the genes and each of the pGP plasmids prepared above were cleaved with NheI and NotI enzymes for 1 hour and fragments were separated by conducting electrophoresis on agarose gel. The separated fragments were ligated for 30 minutes using T4 ligase and then incubated overnight with E. coli. Next day, DNA was isolated from the colony through mini-prep, and then digested with NheI and NotI. The cloned DNA was incubated overnight with an E. coli supernatant digested with restriction enzymes in a 4-L flask in the presence of kanamycin. Plasmid DNAs produced using an Endofree Giga prep. kit (Qiagen, USA) were used in animal experiments. The prepared plasmid DNAs are summarized in Table 3.

TABLE 3
Gene Plasmid DNA
Blood coagulation factor VIII (F8) pGP-F8
Blood coagulation factor VIII variant (F8M) pGP-F8M
Blood coagulation factor IX (F9) pGP-F9

Examples

Example: Preparation of Pharmaceutical Composition Containing Composition for Increasing Expression of Gene and F8M (F8M-MP1 and F8M-MP2)

Composition for Increasing Gene Expression

Core-shell structured microparticles with a reference code of 62400210, having an average diameter of about 2.5 Îźm and composed of sulfur hexafluoride as a core and a lipid as a shell, were purchased from Bracco Imaging Korea (MP1). In addition, core-shell structured microparticles with a reference code of 646300210, having an average diameter of about 2.4-3.6 Îźm and composed of perfluorobutane as a core and a shell including a lipid and a surfactant, were purchased from GE Healthcare Korea (MP2).

Preparation of Pharmaceutical Composition Containing Composition for Increasing Gene Expression and F8M

Pharmaceutical compositions F8M-MP1 and F8M-MP2 were prepared by mixing 15 ÎźL of the compositions for increasing gene expression (MP1 and MP2), respectively, with the pGP-F8M prepared above (70 Îźg/35 ÎźL).

Comparative Example: Preparation of Pharmaceutical Composition Containing Composition for Increasing Gene Expression and F9 (F9-MP1 and F9-MP2)

Composition for Increasing Gene Expression

Compositions for increasing gene expression were prepared in the same manner as in Example.

Preparation of Pharmaceutical Composition Containing Composition for Increasing Gene Expression and F9

Pharmaceutical compositions F9-MP1 and F9-MP2 were prepared by mixing 15 ÎźL of the compositions for increasing gene expression (MP1 and MP2), respectively, with the pGP-F9 prepared above (70 Îźg/35 ÎźL).

Control Group

Composition for Increasing Gene Expression

A suspension (corresponding to a composition for increasing gene expression) was prepared by mixing 128 ÎźL of in vivo JetPEI (Polyplus, USA) with 2 mL of 5% glucose according to the manufacturer's manual.

Preparation of Pharmaceutical Composition Containing Composition for Increasing Gene Expression and Each Gene

A pharmaceutical compositions F8M-JetPEI was prepared by mixing 15 ÎźL of the composition with the pGP-F8M prepared above (70 Îźg/35 ÎźL).

Test Example

Test Example: Expression Level of Protein in Mouse

Each of the pharmaceutical compositions according to the control group, example and comparative example was injected into the lower calf muscle of C57bl/6 mouse with 75 Îźg/50 ÎźL/leg.

On day 7 after the administration, the mouse was sacrificed and the muscle at the injected area was excised. Then, total proteins were isolated after grinding the excised muscle was using liquid nitrogen and a protein extraction kit (Cell Biolabs, USA). The amounts of the isolated total proteins were measured using a DC protein assay kit (Bio-Rad laboratories, USA).

For measurement of the F8 protein, the expression level of each gene was measured using an ELISA kit (Stago Asserchrom VIII:Ag, France) for the same amount of protein. The result is shown in FIG. 3.

From FIG. 3, it can be seen that the administration of the pharmaceutical composition according to the present disclosure (Example) resulted in a statistically significantly higher expression level as compared to the administration of the gene only or the administration of the composition of the control group. Specifically, the group administered with the F8M-MP1 of Example showed 44% higher expression level as compared to group administered with the gene only (pGP-F8M), and the group administered with F8M-MP2 showed 116% higher expression level as compared to group administered with the gene only.

For measurement of the F9 protein, the expression level of each gene was measured using an ELISA kit (Abcam, USA) for the same amount of protein. The result is shown in FIG. 4.

From FIG. 4, it can be seen that the administration of the composition of Comparative Example hardly resulted in increased gene expression as compared to the administration of the gene only.

That is to say, from FIG. 3 and FIG. 4, it can be seen that the administration of the compositions according to the present disclosure (Example) results in a significantly higher expression level as compared to the administration of the gene only or the administration of the composition of the control group or comparative example.

Although the present disclosure was illustrated with the specific exemplary embodiments described above, various modifications or changes can be made thereto without departing from the subject matter and scope of the present disclosure. In addition, such modifications or changes within the subject matter of the present disclosure are included in the scope of the appended claims.

Claims

1. A method for increasing the expression of a blood coagulation factor gene in a subject in need thereof comprising administering to the subject the blood coagulation factor gene and a composition comprising core-shell structured microparticles, wherein

the core is sulfur hexafluoride or perfluorobutane as a biocompatible gas, and the shell is a lipid or a derivative thereof, and

the blood coagulation factor gene is one or more genes selected from a human blood coagulation factor VIII gene or a variant gene thereof.

2. The method for increasing the expression of a blood coagulation factor gene according to claim 1, wherein the lipid is one or more selected from a group consisting of a simple lipid, a phospholipid, a glyceroglycolipid, a sphingoglycolipid, a cholesterol and a cationic lipid.

3. The method for increasing the expression of a blood coagulation factor gene according to claim 2, wherein the phospholipid is selected from a group consisting of a phosphatidylcholine derivative, a phosphatidylethanolamine derivative, a phosphatidylserine derivative, a diacetylated phospholipid, L-Îą-dioleyl phosphatidylethanolamine, diolein, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, lysophosphatidylcholine, sphingomyelin, a polyethylene glycolated phospholipid, egg yolk lecithin, soy lecithin and a hydrogenated phospholipid.

4. The method for increasing the expression of a blood coagulation factor gene according to claim 2, wherein the glyceroglycolipid is selected from a group consisting of sulfoxyribosyl glyceride, diglycosyl diglyceride, digalactosyl diglyceride, galactosyl diglyceride and glycosyl diglyceride.

5. The method for increasing the expression of a blood coagulation factor gene according to claim 2, wherein the sphingoglycolipid is galactosyl cerebroside, lactosyl cerebroside or ganglioside.

6. The method for increasing the expression of a blood coagulation factor gene according to claim 2, wherein the cationic lipid is selected from a group consisting of 1,2-dioleoyl-3-trmethylammonium propane (DOTAP), N-(2,3-dioleyloxypropan-1-yl)-N,N,N-trmethylammonium chloride (DOTMA), 2,3-dioleyloxy-N-[2-(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE), 1,2-dioleoyloxypropyl-3-diethylhydroxyethylammonium bromide (DORIE) and 3β-[N—(N′N′-dimethylaminoethylhy)carbamoyl]cholesterol (DC-Chol).

7. The method for increasing the expression of a blood coagulation factor gene according to claim 1, wherein the blood coagulation factor VIII is composed of an amino acid sequence represented by SEQ ID NO 1, and the variant of blood coagulation factor VIII is composed of an amino acid sequence represented by SEQ ID NO 3.

8. The method for increasing the expression of a blood coagulation factor gene according to claim 1, wherein the composition increases the expression of the blood coagulation factor gene by 30% or more when the composition is administered along with the human blood coagulation factor VIII gene or a variant gene thereof.

9. A method for preventing or treating a bleeding disorder or bleeding in a subject, comprising administering to the subject the blood coagulation factor gene and a composition comprising core-shell structured microparticles, wherein

the core is sulfur hexafluoride or perfluorobutane as a biocompatible gas, and the shell is a lipid or a derivative thereof, and

the blood coagulation factor gene is one or more genes selected from a human blood coagulation factor VIII gene or a variant gene thereof.

10. The method for preventing or treating a bleeding disorder or bleeding according to claim 9, wherein the bleeding disorder is hemophilia A, hemophilia induced or complicated by an inhibitory antibody against blood coagulation factor VIII or blood coagulation factor VIIIa, or hemophilia B.

11. The method for preventing or treating a bleeding disorder or bleeding according to claim 9, wherein the bleeding disorder or bleeding is one of neonatal coagulopathy, severe liver disease, thrombocytopenia, congenital deficiency of factor V, VII, X or XI, and von Willebrand disease having an inhibitor against von Willebrand factor.

12. The method for preventing or treating a bleeding disorder or bleeding according to claim 9, wherein the bleeding is caused by blood loss associated with high-risk surgical procedures, traumatic blood loss, blood loss caused by bone marrow transplantation or blood loss caused by cerebral hemorrhage.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: