CARDIOMYOCYTE SUBTYPES AND METHODS OF MAKING AND USING

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of U.S. Provisional Application Ser. No. 63/209,703, filed Jun. 11, 2022. The disclosure of the prior application is considered part of (and is incorporated by reference in) the disclosure of this application.

TECHNICAL FIELD

This disclosure generally relates to several different cardiomyoctye subtypes as well as methods of making and using such cardiomyocyte subtypes.

BACKGROUND

The adult heart is made-up of different cardiomyocyte subtypes that include left and right ventricular and atrial cardiomyocytes that form the working myocardium, the sinoatrial and atrioventricular nodal cells that represent the pacemakers and the outflow and inflow tract cells that connect the heart to the vasculature. The ability to differentiate human pluripotent stem cells (hPSCs) into different cardiovascular lineages has opened new and exciting avenues to study the earliest stages of human heart development, to generate models of heart disease and to create new therapies to treat some of the most devastating and debilitating of these diseases. As different cardiovascular diseases target different regions of the heart, the therapeutic applications of these models are entirely dependent on the ability to generate appropriate cell types from hPSCs.

This disclosure describes a number of different cardiomyocyte subtypes, as well as methods of making and using such cardiomyocyte subtypes.

SUMMARY

This disclosure provides a comprehensive landscape of human embryonic cardiogenesis, which can be used to model a broad spectrum of congenital heart diseases and chamber-specific cardiomyopathies with hPSCs. From these analyses, both novel and species-conserved markers were identified that provide a molecular signature for the different stages of human FHF, pSHF and aSHF development. Through the staged manipulation of signaling pathways identified from the scRNA-seq analysis, myocyte populations can be generated that display molecular characteristics of right ventricular cardiomyocytes (RVCMs), left ventricular cardiomyocytes (LVCMs), atrial cardiomyocytes (ACMs), atrioventricular canal cardiomyocytes (AVCCMs), sinus venosus cardiomyocytes (SVCMs), inflow tract cardiomyocytes (IFTCMs) and outflow tract cardiomyocytes (OFTCMs). Collectively, this disclosure provides new insights into human cardiac lineage development that enables the design of improved lineage-specific differentiation protocols as well as access to different cardiomyocyte subtypes for modeling chamber-specific cardiovascular diseases and congenital heart defects and for establishing novel therapeutic approaches to treat them.

In one aspect, methods of making first heart field (FHF) mesoderm cells, anterior second heart field (aSHF) mesoderm cells and/or posterior second heart field (pSHF) mesoderm cells are provided. Such methods typically include: culturing pluripotent stem cells (PSCs) in the presence of an appropriate amount of BMP4 and Activin A for about 1 to about 3 days (e.g., about 2 days); thereby producing FHF mesoderm cells, aSHF mesoderm cells, and/or pSHF mesoderm cells, wherein the FHF mesoderm cells are MESP1+, CXCR4−/low, GYPB+, CD1Dlow, TDGF1+, LHX1+, PITX2+, and GSC+, wherein the aSHF mesoderm cells are MESP1+, CXCR4+, ALDH1A2−, CD1Dlow, PHLDA1+, PCDH19+, FOXC2+, TWIST1+, and FOXC1+, and wherein the pSHF mesoderm cells are MESP1+, CXCR4−, ALDHIA2+, CD1Dhigh, HOXA1+, HOXB1+,

In one aspect, FHF mesoderm cells, aSHF mesoderm cells and/or pSHF mesoderm cells made by the methods described herein are provided.

In another aspect, methods of screening drugs are provided. Such methods typically include: contacting the FHF mesoderm cells, the aSHF mesoderm cells described herein with a test compound; and determining the effect of the compound on the differentiation of the FHF mesoderm cells, the aSHF mesoderm cells, or the pSHF mesoderm cells into progenitor cells and, optionally, into cardiomyocytes.

In another aspect, methods of making first heart field (FHF) mesoderm cells are provided. Such methods typically include: culturing pluripotent stem cells (PSCs) in the presence of an appropriate amount of BMP4 and Activin A for about 1 to about 3 days (e.g., about 2 days), thereby producing FHF mesoderm cells, wherein the FHF mesoderm cells are MESP1+, CXCR4−/low, GYPB+, CD1Dlow, TDGF1+, LHX1+, PITX2+, and GSC+.

In one aspect, FHF mesoderm cells made by the methods described herein are provided.

In still another aspect, methods of making first heart field (FHF) progenitor cells are provided. Such methods typically include: culturing the FHF mesoderm cells as described herein in the presence of an appropriate amount of IWP2 and VEGF for a period of about 1 to about 3 days (e.g., about 2 days), thereby producing FHF progenitor cells, wherein the FHF progenitor cells are ALDH1 A2−, HAND1, TBX5, HCN4, MYH6, LBH.

In another aspect, FHF progenitor cells made by the methods described herein are provided.

In yet another aspect, methods of making first heart field (FHF) cardiomyocytes are provided. Such methods typically include: culturing the FHF progenitor cells as described herein in base media for about 18 to about 22 days (e.g., about 20 days), thereby producing FHF cardiomyocytes, wherein the FHF cardiomyocytes comprise a first population of left ventricular cardiomyocytes (LVCMs) that are GJA1+, HAND1+, TMEM88+, and TBX5+ and a second population of atrioventricular canal cardiomyocytes (AVCCMs) that are BMP2+, TBX2+, RSPO3+, and MSX2+.

In yet another aspect, FHF cardiomyocytes made by the methods described herein are provided. In some embodiments, the FHF mesoderm cells and the FHF progenitor cells can be differentiated into left ventricular cardiomyocytes (LVCMs) and atrioventricular canal cardiomyocytes (AVCCMs).

In one aspect, methods of repairing damaged cardiac tissue are provided. Such methods typically include introducing the FHF mesoderm cells, the FHF progenitor cells, and/or the FHF cardiomyocytes described herein into damaged cardiac tissue. In some embodiments, the damaged cardiac tissue comprises ventricular myocardium.

In another aspect, methods of making anterior second heart field (aSHF) mesoderm cells are provided. Such methods typically include: culturing pluripotent stem cells (PSCs) in the presence of an appropriate amount of BMP4 and Activin-A for about 1 to about 3 days (e.g., about 2 days), thereby producing aSHF mesoderm cells, wherein the aSHF mesoderm cells are MESP1+, CXCR4+, ALDHIA2−, CD1Dlow, PHLDA1+, PCDH19+, FOXC2+, TWIST1+, and FOXC1+.

In another aspect, aSHF mesoderm cells made by the methods described herein are provided.

In still another aspect, methods of making anterior second heart field (aSHF) progenitor cells are provided. Such methods typically include: culturing the aSHF mesoderm cells as described herein as an (intact) embryoid body (EB) or isolated day 4 CXCR+ ALDH− mesoderm cells in the presence of an appropriate amount of IWP2 and VEGF for about 1 to about 3 days (e.g., about 1 to about 2 days), thereby producing aSHF progenitor cells, wherein the aSHF progenitor cells are ALDH1A2+, JAG1+, FGF10+, FGF8+, WNT5A+, and PHLDA1+.

In another aspect, aSHF progenitor cells made by the methods described herein are provided.

In yet another aspect, methods of making anterior second heart field (aSHF) cardiomyocytes are provided. Such methods typically include: culturing the aSHF progenitor cells as described herein or isolated day 4 CXCR+ALDH− mesoderm cells in the presence of an appropriate amount of BMP4 and RA for about 3 days and then in backbone media for about 12 to about 15 days, thereby making aSHF cardiomyocytes, wherein the aSHF cardiomyocytes comprise a first population of right ventricular cardiomyocytes (RVCMs) that are IRX1+, IRX2+, and NPPB+ and a second population of outflow tract cardiomyocytes (OFTCM) that are SEMA3C+, HAND2+, and FHL1+.

In another aspect, aSHF cardiomyocytes made by the methods described herein are provided. In some embodiments, the aSHF mesoderm and/or progenitors can be differentiated into right ventricular cardiomyocytes (RVCMs) and outflow tract (OFT) cardiomyocytes.

In still another aspect, methods of modeling chamber-specific diseases such as arrhythmogenic right ventricular cardiomyopathy (ARVC) and OFT defects are provided. Such methods typically include culturing the aSHF mesoderm cells, the aSHF progenitor cells, and/or the aSHF cardiomyocytes described herein under a variety of culture conditions and evaluating their characteristics.

In another aspect, methods of making posterior second heart field (pSHF) mesoderm cells are provided. Such methods typically include: culturing pluripotent stem cells (PSCs) in the presence of an appropriate amount of BMP4 and Activin A for about 1 to about 3 days (e.g., about 2 days), thereby producing pSHF mesoderm cells, wherein the pSHF mesoderm cells are MESP1+, CXCR4−, ALDH1A2+, CD1Dhigh, HOXA1+, HOXB1+, HOTAIRM1+, TBX6+, and CDX2+.

In still another aspect, pSHF mesoderm cells made by the methods described herein are provided.

In yet another aspect, methods of making posterior second heart field (pSHF) progenitor cells are provided. Such methods typically include: culturing the pSHF mesoderm cells as described herein or isolated day 4 CXCR4−ALDH+mesoderm cells in the presence of an appropriate amount of IWP2, VEGF, and retinol for about 2 to about 4 days (e.g., about 3 days), thereby producing pSHF progenitor cells, wherein the pSHF progenitor cells are ALDH1A2+, HOXB1+, HOTAIRM1+, NR2F2+, DUSP9+, and FOXF1+.

In one aspect, pSHF progenitor cells made by the methods described herein are provided.

In still another aspect, methods of making posterior second heart field (pSHF) cardiomyocytes are provided. Such methods typically include: culturing the pSHF progenitor cells described herein in the presence of an appropriate amount of retinol for about 2 to about 4 days (e.g., about 3 days) followed by culturing in base media for about 12 to about 15 days, thereby making pSHF cardiomyocytes, wherein the pSHF cardiomyocytes comprise a first population of atrial cardiomyocytes (ACMs) that are NKX2-5+, NR2F2+, and SCN5A+ and a second population of sinus venosus cardiomyocytes (SVCM) that are TBX18+ and SFRP5.

In one aspect, pSHF cardiomyocytes made by the methods described herein are provided. In some embodiments, the pSHF mesoderm, progenitor and/or cardiomyocytes can be differentiated into atrial (e.g., right and left atrial) or sinus venosus (SV) structures.

In still another aspect, methods of modelling atrial fibrillation using pSHF-derived ACMs are provided. Such methods typically include: culturing the pSHF mesoderm cells, the pSHF progenitor cells, and/or the pSHF cardiomyocytes as described herein under a variety of culture conditions and evaluating their characteristics.

In yet another aspect, methods of screening drugs are provided. Such methods typically include: contacting any of the cells described herein with a test compound; and determining the effect of the compound on the differentiation of those cells into downstream cells.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the methods and compositions of matter belong. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the methods and compositions of matter, suitable methods and materials are described below. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.

DESCRIPTION OF DRAWINGS

FIG. 1A-1H are results from experiments showing the generation of FHF and SHF mesoderm from hPSCs. (1A) Schematic representation of the protocol used to generate cardiomyocytes from hPSCs. (1B) Representation of flow cytometric analyses of ALDH activity and CD235a/b expression in day 4 cultures generated using different concentrations of Activin A and BMP4. (1C) RT-qPCR analyses of BRY and MESP1 expression in the 3B1.5A- and 16B8A-induced cultures (n≥3). (1D and 1E) RT-qPCR analyses of the expression levels of MIXL1, FGF8, EOMES and PITX2 (1D), as well those of FOXC2, CITED1, FOXC1, FOXH1, HOXB1, HOXA1 and TBX6 in the day 3 3B1.5A- and 16B8A-induced cultures (n≥4) (1E). (1F) RT-qPCR analyses of the expression levels of TBX5, ISL1, FGF10 and TBX1 in the days 4 to 6 cultures generated with 3B1.5A and 16B8A conditions. (1G and 1H) RT-qPCR analyses of the expression levels of HAND1, TBX5, HAND2 and NR2F2 in the days 12 and 20 cultures generated with 3B1.5A and 16B8A conditions (n≥5). Statistical comparison was performed using unpaired t test; * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001. All error bars represent SEM.

FIG. 2A-2K are results from experiments showing the characterization of heterogeneity and temporal specification of hPSC-derived cardiac mesoderm populations. (2A) UMAP plots of 3B1.5A- and 16B8A-specified mesoderm populations that contain aSHF, pSHF, FHF mesoderm clusters. (2B) UMAP plots demonstrating the expression of MESP1, FOXA2, FHF mesoderm markers (EOMES and LHX1), aSHF mesoderm markers (SIX1 and FOXC2) and pSHF mesoderm markers (HOXA1 and ALDH1A2). (2C) Venn diagrams showing the proportion of species-specific and conserved gene expression patterns in hPSC-derived and mouse FHF, aSHF, and pSHF mesoderm. (2D) Dot plot showing the species-conserved markers of aSHF, pSHF and FHF mesoderm. (2E-2G) RT-qPCR analyses of the expression levels of FHF mesoderm genes TDGF1, LHX1, GSC, FGF17, BMP4, BMP2, GATA6 and GYPB (2E), pSHF mesoderm genes GAL, PCDH19, ALDH1A2, PRICKLE1, HES7, RBP1, CRABP1 and HOTAIRM1 (2F), as well as aSHF mesoderm genes PHLDA1 and CXCR4 (2G) in the day 3 3B1.5A- and 16B8A-induced cultures (n≥5). Statistical analyses were performed using unpaired t test; * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001. All error bars represent SEM. (2H) Dot plot showing the species-conserved GO terms enriched in the mouse and hPSC-derived FHF, aSHF, and pSHF mesoderm clusters. (2I) UMAP plot of integrated hPSC-derived mesoderm and human gastrulating cells colored by pre-annotated cell identity. (2J) Pseudotime ordering of hPSC-derived and human gastrulating mesoderm. (2K) Dot plot showing the expression of pSHF and aSHF mesoderm markers in the nascent mesoderm and emergent mesoderm respectively.

FIG. 3A-3G are experimental results showing the generation of distinct cardiac progenitor populations from purified mesoderm populations. (3A) Bar plots showing the top 15 genes positively and negatively correlated with GYPB, CXCR4 and ALDH1A2; Pearson correlation; p<0.05. (3B-3C) Representation of flow cytometric analyses of the expression of CXCR4, PDGFR-alpha and CD235a/b, as well as ALDH activity in the day 4 population generated with 16B8A (3B) and 3B1.5A (3C) conditions. (3D-3F) RT-qPCR analyses of the expression levels of FHF progenitor markers (3D), pSHF progenitor markers (3E) and aSHF progenitor markers (3F) in the day 5 aSHF, pSHF and FHF populations (n≥5). Statistical analyses shown in FIGS. 3D-3F were performed using one-way ANOVA with Tukey's multiple comparisons. All error bars represent SEM. * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001. (3G) Immunostaining showing the expression of HAND1 and NR2F1 in day 6 FHF, aSHF, and pSHF progenitors. (3H-3I) RT-qPCR analyses of the expression levels of RA-responsive genes (CYP26A1, HOXA1 and HOXB1) (3H), as well as the aSHF genes FGF10, FOXC1 and FOXC2 (31) in the day 5 pSHF cells treated with either DMSO or ROH. Statistical analyses were performed using unpaired t test; * p<0.05, ** p<0.01, *** p<0.001. All error bars represent SEM.

FIG. 4A-4J are experimental data showing single cell transcriptomic analyses of day 6 progenitor populations. (4A) UMAP plots of day 6 aSHF, pSHF and FHF cardiac progenitors labelled by sample name (left) and cell identity (right). (4B) Violin plots showing the expression of known aSHF (ISL1, FOXC1, FOXC2, FGF10 and WNT5A), pSHF (ISL1, HOXB1, NR2F2 and HOTAIRM1), and FHF (TBX5, HAND1, HCN4 and MYH6) progenitor markers in the aSHF, pSHF and FHF progenitor clusters; corresponding p-values can be found in Appendix B. (4C) Venn diagrams showing the proportion of species-specific and conserved gene expression patterns in hPSC-derived and mouse FHF, aSHF, and pSHF progenitors. (4D) Dot plot showing species-conserved markers of the aSHF, pSHF and FHF progenitors. (4E) Dot plot representation of species-conserved GO terms enriched in aSHF, pSHF and FHF progenitors. (4F) UMAP plots of slingshot pseudotime inference of mesoderm (day 3), late mesoderm (day 4) and progenitor (day 6) populations of aSHF and pSHF lineages. (4G) Expression of ALDH1A2, RDH10 and RARB in aSHF (purple) and pSHF (blue) lineages along pseudotime. (4H) Flow cytometric analyses of ALDH activity and CD235a/b expression in the day 5 FHF, aSHF and pSHF cultures. (4I) Quantification of the percentages of ALDH⁺ cells in the day 5 aSHF, pSHF, and FHF cultures (n=4). Analysis was performed using one-way ANOVA with Tukey's multiple comparisons. All error bars represent SEM. **** p<0.0001. (4J) RT-qPCR analyses of the expression levels of CYP26A1 and HOXB1 in the day 6 aSHF cells treated with ROH or DMSO on day 5 (n≥5). Statistical analyses were performed using unpaired t test; * p<0.05, ** p<0.01. All error bars represent SEM.

FIG. 5A-5I are experimental data showing that Bmp signaling is required for ventricular cardiomyocyte differentiation of the aSHF lineage. (5A) GSEA analysis showing the enrichment of ‘Response to BMP’ and ‘Regulation pf BMP signaling pathway’ in the hPSC-derived aSHF progenitor. (5B) Heatmap summarizing the expression of genes related to Bmp signaling in the pSHF, aSHF and FHF progenitor clusters. (5C-5E) RT-qPCR analyses of the expression levels of FGF8, ISL1, HOXB1 and HAND1 (5C), SIX1 and FOXC2 (5D), as well as UNC45B and GATA4 (5E) in the day 6 aSHF, pSHF and FHF populations treated as indicated (n≥4). (5F-5G) Flow cytometric analyses of the expression of PDGFR-beta (CD140b) and SIRP-alpha (CD172a) (5F) or MYL2 and TNNT2 (5G) in the day 20 aSHF, pSHF and FHF populations treated as indicated. (5H) Quantification of cell numbers of day 20 aSHF population treated as indicated. (5I) RT-qPCR analyses of the expression levels of IRX4, MYL2, NR2F2 and PDGFRB in the day 20 aSHF, pSHF and FHF populations treated as indicated (n≥5). Statistical analyses shown in FIG. 5 were performed using one-way ANOVA with Tukey's multiple comparisons. All error bars represent SEM. *p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001.

FIG. 6A-6I are experimental data showing the characterization of transcriptional profiles of FHF-, aSHF- and pSHF-derived cardiomyocytes. (6A) UMAP plots of day 20 FHF, aSHF, and pSHF cultures that contain various cardiomyocyte subtypes labelled by sample name (left) and cell type (right). (6B) UMAP plots showing the expression of NKX2-5, TNNT2, MYL2, BMP2, HAND1, IRX1, SEMA3C, NR2F2, TBX18 and CAV1 in the day 20 hPSC-derived cardiomyocytes. (6C) Venn diagram showing the numbers of mouse and hPSC-derived RVCM and OFTCM markers; dot plot showing the top 10 species-conserved RVCM and OFTCM markers; corresponding p-values can be found in Appendix C. (6D) Dot plot showing the species-conserved GO terms enriched in the hPSC-derived and mouse RVCMs and OFTCMs. (6E) Venn diagram showing the numbers of mouse and hPSC-derived RVCM and LVCM markers; dot plot showing the top 10 species-conserved RVCM and LVCM markers; corresponding p-values can be found in Appendix C. (6F) Dot plot showing the species-conserved GO terms enriched in the hPSC-derived and mouse RVCMs and LVCMs. (6G-6H) RT-qPCR analyses of the expression levels of RVCM (6G), and LVCM genes (6H) in the day 20 aSHF-pSHF- and FHF-derived cardiomyocytes (n≥5). Statistical analyses were performed using one-way ANOVA with Tukey's multiple comparisons. All error bars represent SEM. * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001. (6I) Immunostaining of HAND1, IRX1 and TBX5 in the day 20 FHF, aSHF and pSHF cultures.

FIG. 7A-7F show experimental data of integration of hPSC-derived and human fetal cardiomyocytes and pseudotime analyses of the hPSC-derived FHF, aSHF and pSHF lineages. (7A) UMAP plots of the integrated human fetal and hPSC-derived cardiac cells labeled by data source (left), cell identity (middle) and cluster numbers (right). (7B) UMAP plots demonstrating the expression of NKX2-5, TNNT2, MYL2 and NR2F2 in the integrated data. (7C) Bar plots showing the compositions of cluster 0, cluster 1 and cluster 3 of the integrated data. (7D) Correlation matrix showing the correlation between all the human fetal and hPSC-derived cells in the clusters 0, 1 and 3; Pearson correlation; p<0.05. (7E) UMAP plot showing hPSC-derived data from various differentiation stages; UMAP plots showing pseudotime trajectories of FHF, aSHF and pSHF lineages. (7F) Schematic illustration of the development of human and mouse FHF, aSHF, and pSHF lineages. Mouse and human mesoderm populations contain molecularly and temporally distinct FHF, aSHF and pSHF sub-populations. FHF mesoderm develops FHF progenitor, which eventually generates LVCMs and AVCCMs. ASHF mesoderm develops aSHF progenitor. Following the activation of RA and BMP signaling, aSHF progenitors generate RVCMs and OFTCMs. PSHF mesoderm gives rise to ACM and SV-like cells upon the activating of RA signaling.

FIG. 8A-8F are experimental data related to FIG. 1. (8A) Flow cytometric analysis of PDGFRα expression in the day 4 cultures generated with various concentrations of BMP4 and Activin A. (8B) Violin plots showing the expression of Mesp1, early-emerging mesoderm markers (Mixll (p_adj=2.45E-48), Fgf8 (p_adj=8.47E-41), Eomes (p_adj=7.49E-12) and Pitx2 (p_adj=1.71E-43)), and late-emerging mesoderm markers (Foxc1 (p_adj=1.38E-12), Foxc2 (p_adj=8.85E-40), Foxh1 (p_adj=6.91E-17), Hoxb1 (p_adj=3.67E-6), Hoxa1 (p_adj=2.14E-5), Tbx6 (p_adj=2.45E-6), and Cited1 (p_adj=5.81E-6)) in the E6.75 and E7.25 Mesp1⁺ mouse mesoderm populations respectively; analyses were performed using Wilcoxon rank-sum test; Benjamini-Hochberg adjusted. (8C) UMAP plots of E6.75 and E7.25 mouse mesoderm populations labelled by stage and cell type. (8D) Dot plot demonstrating the markers of mouse FHF, aSHF and pSHF mesoderm; corresponding p-values were determined. (8E) Gene ontology analysis based on DEGs of mouse FHF, aSHF and pSHF mesoderm. (8F) Representation of flow cytometric analysis of CTNT expression in the day 20 3B1.5A- and 16B8A-induced cultures.

FIG. 9A-9H are experimental data related to FIG. 2. (9A) Dot plot showing the expression of markers of mesoderm, endoderm, ectoderm, paraxial mesoderm in the day 3 cells. (9B) GSEA analysis showing an enrichment of ARVC in the hPSC-derived aSHF mesoderm. (9C) UMAP plot of the integrated hPSC-derived mesoderm and human gastrulating cells labelled by data source. (9D) Correlation matrix showing the correlation between human gastrulating cells and hPSC-derived mesoderm; Pearson correlation; p<0.05. (9E) Expression of TBXT, MESP1, GATA6, BMP2, IRX1 and HOXA1 along pseudotime. (9F) UMAP plots of day 4 cells labelled by sample name (left) and cell identity (right). (9G) UMAP plots showing the expression of MESP1, FOXA2, GATA6, and PECAM1. (9H) Heatmap showing the top 10 markers of FHF, aSHF and pSHF late mesoderm, as well as those of mesoderm, endoderm and endothelium.

FIG. 10A-10I are experimental data related to FIG. 3. (10A) Violin plots showing the expression of CD1D (p_adj=8.12E-135) and ITGA3 (p_adj=3.93E-52) in the hPSC-derived FHF, aSHF and pSHF mesoderm clusters. (10B) RT-qPCR analyses of the expression levels of CD1D and ITGA3 in the day 3 3B1.5A- and 16B8A-induced cultures (n≥4); analyses were performed using unpaired t test; ** p<0.01, *** p<0.001. All error bars represent SEM. (10C-10D) Representation of flow cytometric analyses of the expression of CXCR4, ALDH, and CD1d (10C) or CD49c (10D) in the day 4 3B1.5A-induced culture. Quantification of the percentages of ALDH⁺ cells in the CD1d or CD49c high and low populations; analyses were performed using unpaired t test: ** p<0.01, *** p<0.001. All error bars represent SEM. (10E) UMAP plot showing the expression of FHF, aSHF and pSHF markers in mouse E7.75 cardiac progenitors. (10F) Immunostaining showing the expression of TBX5 and NR2F2 in day 6 FHF, aSHF, and pSHF progenitors. (10G-10H) RT-qPCR analyses of the expression levels of aSHF progenitor markers (ISL1, FGF10, SIX1 and FGF8) (10G), and pSHF progenitors (TBX5, HOXA1, HOXB1 and NR2F1) (10H) in the day 5 cells derived from CXCR4⁺CD1d^−/low and CXCR4⁻CD1d⁺mesoderm (n=4). Statistical analyses were performed using unpaired t test; * p<0.05, ** p<0.01, **** p<0.0001. All error bars represent SEM. (10I) Violin plots showing the expression of Aldh1a2, Rdh10, Rarb and Cyp26a1 in mouse E7.75 FHF, aSHF and pSHF progenitors.

FIG. 11A-11H are experimental data related to FIG. 4. (11A) UMAP plots showing MYH6 positive and negative cells in the hPSC-derived day 6 FHF, aSHF and pSHF cultures. (11B) Heatmap demonstrating the expression of aSHF, pSHF and FHF progenitor markers in the MYH6⁺ aSHF, pSHF and FHF cells. (11C) Violin plots showing the expression of ALDH1A2, RDH10 and RARB in hPSC-derived aSHF, pSHF and FHF progenitor clusters. (11D) UMAP plots showing ALDH1A2 positive and negative cells in the hPSC-derived day 6 aSHF and pSHF cultures. (11E) Dot plot showing the differential expression of aSHF (purple) and pSHF (blue) genes in ALDH1A2-expressing pSHF and aSHF cells. (11F) Dot plot showing the GOs enriched in the ALDH1A2-expressing pSHF and aSHF progenitors respectively. (11G) UMAP plots of the re-clustered aSHF progenitor cells that show the expression of myocyte markers (NKX2-5, ISL1, GATA6 and TNNT2) and aSHF progenitor markers (FGF8, FOXC2, ALDH1A2 and TBX1). (11H) UMAP plot showing the expression of Isl1, Nkx2-5, Gata6, Tnnt2, Fgf8, Foxc2, Aldh1a2 and Thx/in the E7.75 mouse aSHF sub-clusters.

FIG. 12A-12I are experimental data related to FIG. 6. (12A) UMAP plots showing the presence of various myocyte subtypes in the E9.25 mouse heart. (12B) Venn diagram showing the numbers of mouse and hPSC-derived ACM and SVCM markers; dot plot showing the top 10 species-conserved ACM and SVCM markers; corresponding p-values can be found in Appendix C. (12C) Dot plot showing the conserved GO terms enriched in the hPSC-derived and mouse ACMs and SVCMs. (12D) RT-qPCR analyses of the expression levels of TBX18, HOTAIRM1 and NR2F2 in the day 20 aSHF, pSHF and FHF cultures (n≥5). Statistical analyses were performed using one-way ANOVA with Tukey's multiple comparisons. All error bars represent SEM. *** p<0.001, **** p<0.0001. (12E) Venn diagram showing the numbers of mouse and hPSC-derived AVCCM and LVCM markers; dot plot showing the top 10 species-conserved AVCCM and LVCM markers; corresponding p-values can be found in Appendix C. (12F) Dot plot showing the conserved GO terms enriched in the hPSC-derived and mouse AVCCMs and LVCMs. (12G) GSEA analysis showing the enrichment of ARVC genes in the hPSC-derived RVCMs. (12H) Immunostaining of HEY2 and GJA1 in the day 20 FHF, aSHF and pSHF cardiomyocytes. (12I) Quantification of GJA1 and IRX1 expression in the day 20 FHF, aSHF and pSHF cultures. Statistical analyses were performed using one-way ANOVA with Tukey's multiple comparisons. All error bars represent SEM. *** p<0.001.

FIG. 13A-13G are experimental data related to pseudotime analyses of hPSC-derived FHF, aSHF and pSHF lineages. (13A) UMAP plot showing hPSC-derived cells of various lineages and stages. (13B) UMAP plot of pseudotime trajectory of FHF lineage inferred by Monocle. (13C) Heatmap showing gene modules enriched in various FHF populations. (13D) UMAP plot of pseudotime trajectory of aSHF lineage inferred by Monocle. (13E) Heatmap showing gene modules enriched in various aSHF populations. (13F) UMAP plot of pseudotime trajectory of pSHF lineage inferred by Monocle. (13G) Heatmap showing gene modules enriched in various pSHF populations.

FIG. 14A-14E are experimental data related to modeling FHF, aSHF and pSHF lineage development with HES3 line. (14A) RT-qPCR analyses of the expression levels of FHF, aSHF and pSHF mesoderm markers in the day 3 HES3-derived FHF (15B8A) and SHF (3B1A) cultures (n≥5). (14B-14C) Representation of flow cytometric analyses of the expression of CXCR4, PDGFRα and CD235a/b, as well as the ALDH activity in the day 4 cultures generated with 15B8A (14B) and 3B1A (14C) conditions. (14D) RT-qPCR analyses of the expression levels of FHF, aSHF and pSHF progenitor markers in the day 5 cultures derived from aSHF, pSHF and FHF mesoderm (n≥5). (14E) RT-qPCR analyses of the expression levels of LVCM, RVCM and pSHF-derived myocyte markers in the day 20 aSHF, pSHF and FHF cultures (n≥5). Statistical analyses were performed using one-way ANOVA with Tukey's multiple comparisons. All error bars represent SEM. * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001.

DETAILED DESCRIPTION

The cardiomyocyte subtypes in the different chambers derive from distinct progenitors known as the first heart field (FHF) and second heart field (SHF) progenitors. These progenitors are specified by E7.5-E8.0 and are distinguished at this stage by gene expression patterns and their position within cardiac crest region of the developing embryo. The FHF progenitors, identified by the expression of Hcn4, Hand1 and Tbx5, give rise predominantly to left ventricular cardiomyocytes (LVCMs), atrioventricular canal cardiomyocytes (AVCCMs) along with some atrial cardiomyocytes (ACMs). SHF progenitors, distinguished by expression of Isl1, Fgf10 and Fgf8, generate the majority of the right ventricular (RVCMs) and ACMs as well as the outflow tract (OFT) and inflow tract (IFT) cells collectively referred to as sinus venosus (SV) structures. Further delineation of anterior-posterior patterning within the SHF population revealed a degree of heterogeneity indicative of distinct progenitors with different fates. Those positioned anteriorly, the anterior SHF progenitors (aSHF) are characterized by expression of Tbx1, Fgf8 and Fgf10 and contribute to RVCMs and OFT lineages. By contrast, the progenitors found in the posterior region (pSHF) are identified by expression of Hoxb1 and Nr2f2 and give rise to ACMs and SV structures.

Studies aimed at identifying the signaling pathways that control FHF and SHF development have largely focused on the mesoderm and progenitor stages of development and have provided evidence that the two populations are regulated differently. BMP signaling plays a pivotal role in initiating the cardiac program of FHF lineage, which differentiates rapidly and forms the first contracting population within the heart tube. The SHF progenitors, by contrast, are exposed to an FGF/Wnt environment that promotes their proliferation, thereby delaying their differentiation. Following this proliferative phase, these cells differentiate and give rise to derivative cell types including ACMs, SV/IFT cells, OFTCMs and RVCMs. Specification of the atrial lineage from the pSHF progenitors is dependent on RA signaling whereas the generation of RVCMs from the aSHF progenitors is regulated by BMP signaling. Regulation of FHF/SHF mesoderm induction is less well understood, but likely will involve the pathways that control gastrulation, including BMP, Nodal, Wnt and FGF.

To map human cardiovascular development from the perspective of FHF and SHFs, comprehensive single-cell RNA sequencing (scRNA-seq) analyses were carried out on mesoderm, progenitor and contracting cardiomyocyte populations induced under different conditions. The findings from these analyses enabled the identification and characterization of distinct FHF, aSHF, and pSHF lineages, beginning at the stage of mesoderm induction and progressing through progenitors to the respective derivative cardiomyocyte subtypes. Thus, this disclosure describes an hPSC-based platform for multi-lineage human cardiogenesis from mesoderm specification to terminal myocyte differentiation. Such a platform can be used to produce different types of human cardiomyocytes.

It is shown herein that different levels of Activin/Nodal and BMP signaling play a pivotal role in the generation of the FHF and SHF populations from hPSCs. In addition to the BMP and Activin/Nodal pathways, it is shown herein that human pSHF mesoderm express components of the canonical Wnt pathway (FIG. 2H). In the hPSC differentiation protocol described herein, it is possible that endogenous levels of Wnt signaling in the presence of added BMP and Activin A agonists are sufficient to induce the pSHF lineage. Although we were able to establish different signaling environments in vitro with different concentrations of pathway agonists, the temporal patterns of FHF and SHF mesoderm are difficult to recapitulate in vitro. However, comparison of the hPSC-derived populations to those found in the human gastrulating embryo indicate that they likely represent temporally distinct subsets of mesoderm, with the pSHF mesoderm showing transcriptomic similarity to nascent mesoderm and the aSHF mesoderm to emergent mesoderm. Collectively, these observations indicate that the development of the hPSC-derived cardiac mesoderm subtypes are induced, in part, through different levels of TGF-beta signalling.

Although lineage tracing and retrospective studies established the lineage relationship between distinct mesoderm and cardiomyocyte subtypes, the transition from mesoderm to cardiovascular progenitors remains largely uncharacterized. Through the ability to isolate the hPSC-derived mesoderm subpopulations using markers identified from the scRNA-seq analyses described herein, we were able to formally establish lineage-specific mesoderm-progenitor relationships. It was found that CD235a/b⁺ mesoderm gives rise to a population that that displays a molecular profile of FHF progenitors, CXCR4⁺ALDH⁻ mesoderm to aSHF progenitors and CXCR4⁻ALDH⁺ (or CXCR4⁻CD1D⁺) mesoderm to pSHF progenitors. The analyses of the progenitor populations described herein identified several new insights into the regulation of derivative cell populations. The first is that the aSHF lineage upregulates ALDH activity (ALDH1A2) at the progenitor stage, approximately 24 hours following its upregulation in the pSHF lineage. These findings strongly suggest that progenitors of both the pSHF and aSHF lineages are ALDHA2⁺, distinguishing them from the FHF progenitors that are ALDH1A2⁻ (FIG. 4H). The second finding is that the aSHF population expresses components of the BMP pathway. Based on this observation, we were able to demonstrate that signaling through this pathway is required for the generation of VCMs from these progenitors.

In addition to establishing mesoderm-progenitor relationships, access to isolated populations of mesoderm have enabled us to track the origin of the different human cardiomyocyte subtypes and to establish a developmental map of human heart field lineages (FIG. 7F). These findings show that the human lineages display developmental potential, with the FHF giving rise to LVCMs and AVCCMs, the aSHF giving rise to RVCMs and OFTCMs, and the pSHF giving rise to ACMs and SVCMs (FIG. 7E). Significantly, methods for generating RVCMs, LVCMs, OFTCMs and AVCCMs previously have not been reported.

Distinguishing cardiomyocyte subtypes, in particular those that form left versus right chambers such as LVCMs and RVCMs in the absence of chamber structures can be challenging, as these cells express many ventricular lineage genes in common. Three lines of evidence from the findings herein, however, indicate that we have generated LVCMs and RVCMs. The first is the demonstration that these VCMs develop from different subpopulations of mesoderm; the LVCMs from the FHF mesoderm and the RVCMs from the aSHF mesoderm. The second is through species-conserved, chamber-specific gene expression patterns that distinguish the putative LVCMs and RVCMs. Third, the demonstration that the aSHF mesoderm as well as the RVCMs expressed genes associated with ARVC, a disease that primarily targets the right ventricle.

The ability to generate distinct populations of LVCMs and RVCMs from hPSCs is important for both cell therapy and disease modelling applications. For example, LVCMs are likely the best cell type for transplantation to remuscularize an infarcted region of the left ventricle, whereas RVCMs would be the appropriate population for modeling ARVC. The identification of subpopulations that show gene expression profiles of OFTCMs and AVCCMs is a first step to establishing optimized protocols for the generation of these cardiomyocyte subtypes. Access to these cells will provide a platform for modeling diseases that target these regions of the heart, including atrioventricular canal defect, outflow tract ventricular arrhythmias and persistent truncus arteriosus.

The map of human cardiac lineage development described herein differs from that of the mouse in that ACMs were not detected in the human FHF-derived population, whereas lineage tracing studies in the mouse suggest that the FHF does contribute to atrial formation.

These differences could reflect differences between mouse and human or result from suboptimal conditions for atrial development the FHF cultures. Alternatively, they may be due to the different approaches used to establish the potential of the population. In vivo lineage tracing studies or in vitro studies using reporter hPSC lines define cardiac lineage potential based on the expression of genes such as ISL1 and TBX5, which do show SHF and FHF bias expression patterns, respectively. The findings described herein, however, indicate that these patterns in the hPSC-derived populations are stage specific, as it was found that restriction of ISL1 expression to the SHF occurs beyond the progenitor stage of differentiation (day 5); prior to this, its expression was observed in both the FHF and SHF in day 4 late mesoderm populations. Similarly, it was found that the FHF marker TBX5 is expressed in the pSHF progenitors and derivative cardiomyocytes (FIGS. 3D and 6H). Given these patterns, lineage tracing studies based on TBX5 expression or analyses of NKX2-5⁺TBX5⁺ hPSC-derived populations are likely to assign atrial cells to the FHF lineage. In this study, the human FHF, aSHF and pSHF lineages were defined based on the developmental potential of isolated mesoderm populations and expression patterns of several sets of genes along differentiation, an approach that is not dependent on specific gene expression patterns.

Through the use of precise stage-specific induction strategies and extensive transcriptomic analyses, human FHF, aSHF and pSHF cardiac lineages were identified and characterized that, together, establish a comprehensive map of human cardiovascular development. This map identifies stage-specific molecular signatures for each of the lineages, enabling the characterization and identification of populations generated from different hPSC lines using different induction protocols (Table 1). Access to these different cell types will provide unprecedented opportunities for detailed genetic and epigenetic studies on human cardiac development, for modeling cardiovascular diseases that target specific regions of the heart, and for developing cell-based therapies with appropriate chamber specific populations.

TABLE 1
Summary of Stage and Lineage Markers

Mesoderm
	FHF	GYPB, EOMES, CYP26A1, LHX1, TDGF1, LITD1, BMP2, MIXL1,
		GSC, FGF17
	aSHF	CXCR4, FOXC2, FOXC1, PHLDA1, IRX1, SIX1, ITGA3, IRX3
	pSHF	ALDH1A2, HOTAIRM1, HES7, CDX2, GAL, TBX6, HOXB1, CD1D,
		RDH10
Progenitor
	FHF	TBX5, TBX20, HAND1, HCN4, LBH, MIF1, TNNT2, MYH6
	aSHF	FOXC2, FOXC1, PHLDA1, IRX1, SIX1, ITGA3, IRX3
	pSHF	NR2F2, NR2F1, TBX18, HOXB1, HOXA1, DUSP9, DACH1, VEGFC,
		FOXF1
Cardiomyocyte
	LVCM (FHF)	HAND1, GJA1, TBX5, TBX20, TMEM88, VCAM1, EFNB3
	AVCCM (FHF)	BMP2, TMSB4X, TBX3, RSPO3, CPNE5, MSX2, FAM78A
	RVCM (aSHF)	PLN, FHL2, IRX1, IRX2, NPPB, NPPA, TXLNM, MYOZ2
	OFTCM (aSHF)	HAND2, MEF2C, VCAN, SEMA3C, CFC1, WNT5A, FHL1, CDH11
	ACM (pSHF)	NPPA, MYL4, KCNJ5, CRYAB, NKX2-5, CAV1
	SVCM (pSHF)	CRABP2, SFRP5, SFRP1, TBX18, RBP1, FOXP2, COL1A2, PLAT

The term “pluripotent stem cell” as used herein refers to a cell with the capacity to differentiate into cells of the three germ cell layers. Pluripotency is also evidenced by the expression of embryonic stem (ES) cell markers (e.g., POU5F1+, SOX2+, NANOG+, SSEA3+. SSEA4+, and SSEA5+). Suitable pluripotent cells for use herein include embryonic stem cells (ESCs; e.g., human ESCs) such as, for example, mesoderm cells (e.g., human mesoderm cells that express, for example, KDR+CD56+CD34−), induced pluripotent stem (iPS) cells (e g., human iPS cells), or cells from embryoid bodies (e.g., cells from human embryoid bodies).

In accordance with the present invention, there may be employed conventional molecular biology, microbiology, biochemical, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. The invention will be further described in the following examples, which do not limit the scope of the methods and compositions of matter described in the claims.

EXAMPLES

Example 1—Directed Differentiation of hPSCs

For differentiating cardiomyocytes from hPSCs, published embryoid body (EB)-based protocol was used (Lee et al., 2017, Cell Stem Cell, 21:179-94). Briefly, at day 0 of the protocol, hPSCs at 80% confluency were dissociated into single cells (TrypLE, ThermoFisher) and re-aggregated to generate EBs in the base media (StemPro-34 media (ThermoFisher) containing 1% penicillin/streptomycin (ThermoFisher), 2 mM L-glutamine (ThermoFisher), 150 μg/mL transferrin (ROCHE), 50 μg/mL ascorbic acid (Sigma), and 50 μg/mL monothioglycerol (Sigma)) supplemented with 10 μM ROCK inhibitor Y-27632 (TOCRIS) and 1 ng/ml rhBMP4 (R&D) for 20 hours on an orbital shaker (70 rpm). Cultures were incubated in a low oxygen environment (5% CO₂, 5% O₂, 90% N₂).

At day 1, the EBs were transferred to mesoderm induction media consisting of base media, 5 ng/mL rhbFGF (R&D), and various concentration of rhBMP4 (R&D) and rhActivinA (R&D) as described in the results section. At day 3, the EBs were transferred to the media consisting of base media, 2 μM Wnt inhibitor IWP2 (TOCRIS) and 10 ng/ml rhVEGF (R&D). From day 5 to day 12, the EBs were transferred to base media with 5 ng/mL rhVEGF. From day 12 to day 20, the EBs were transferred to base media and cultured in a normoxic environment (5% CO₂, 20% O₂). For pSHF lineage differentiation, the day 4 sorted pSHF cells were treated with 2 μM Retinol (Sigma) from day 4 to day 8. Similarly, the sorted aSHF cells were treated with 2 μM Retinol and 10 ng/mL rhBMP4 from day 5 to day 8 of differentiation.

Example 2—Flow Cytometry

Cells of early stages (day 3 to day 6) were dissociated with TrypLE for 3-5 minutes at room temperature to single cells, which were then filtered and transferred to IMDM media. Day 20 EBs were dissociated with 0.5 mg/ml collagenase type 2 (Worthington) in HANKs buffer for 1.5 hours at 37° C. The filtered day 20 cells were then transferred to FACS buffer consisting of PBS with 5% fetal calf serum (Wisent) and 0.02% sodium azide. The following antibodies were used for staining samples obtained from various stages of differentiation: anti-PDGFRa-PE (R&D Systems, 1:20), anti-CD235a/b-APC (BD PharMingen, 1:200), anti-SIRPa-PeCy7 (Biolegend, 1:2000), anti-CXCR4 (Biolegend, 1:100), anti-CDId-PE (Biolegend, 1:100), anti-CD49c-PE (ThermoFisher, 1:100), anti-cardiac isoform of CTNT (ThermoFisher Scientific, 1:2000), or anti-myosin light chain 2 (Abcam, 1:1000). For unconjugated primary antibodies, the following secondary antibodies were used for detection: goat anti-mouse IgG-APC (BD Pharmigen, 1:250), or donkey anti-rabbit IgG-PE (Jackson ImmunoResearch, 1:250). Detailed antibody information is described in Table 2.

TABLE 2
Resources

REAGENT or RESOURCE	SOURCE	IDENTIFIER

Antibodies

Mouse monoclonal to SIRP-alpha	Biolegend	Cat.# 323808; RRID: AB_1236443
(clone SE5A5), PcCy7 conjugated
Mouse monoclonal to CD140b	BD Horizon	Cat.# 564124; RRID: AB_2738609
(PDGFRbeta) (clone 28D4), BV421
conjugated
Mouse monoclonal to PDGFRalpha,	BD Pharmingen	Cat.# 556002; RRID: AB_396286
PE conjugated
Mouse monoclonal to CD235a/b	BD PharMingen	Cat.# 551336; RRID: AB_398499
(GYPB) (clone HIR2), APC
conjugated
Mouse monoclonal to human CD49C	ThermoFisher	Cat.# 17-0494-42; RRID: AB_10670221
(ITGA3), APC conjugated
Mouse monoclonal to human CDID,	BioLegend	Cat.# 350306; RRID: AB_10641845
PE conjugated
Mouse monoclonal to CTNT (clone	ThermoFisher	Cat.# MS-295-P; RRID: AB_11000742
13-11), non-conjugated
Rabbit polyclonal to MLC2V (clone	Abcam	Cat.# ab79935; RRID: AB_1952220
13-11), non-conjugated
Monoclonal mouse ant-Human	BioLegend	Cat.# 306518; RRID: AB_11146018
CD184 (CXCR4) Antibody
Polyclonal Rabbit anti-Human	LSBio	Cat. # LS-C118745
HAND1 Antibody
Polyclonal Rabbit anti-TBX5	ThermoFisher	Cat. # 42-6500; RRID: AB_2533533
Antibody
Monoclonal Mouse anti-Human	R&D systems; Bio-Techne	Cat. # PP-H7147-00
NR2F2 Antibody
Monoclonal Mouse anti-Human	R&D systems; Bio-Techne	Cat. # PP-H8132-00
NR2F1 Antibody
Polyclonal Rabbit anti-Human IRX1	ThermoFisher	Cat. # PA5-60261; RRID: AB_2642783
Antibody
Polyclonal Rabbit anti-Human HEY2	Proteintech	Cat. # 10597-1-AP
Antibody
Polyclonal Rabbit anti-Human CX43	Abcam	Cat. #AB11370
(GJA1) Antibody
Goat anti-mouse IgG (H + L), APC	BD Pharmingen	Cat.# 550826; RRID: AB_398465
conjugated
Donkey anti-rabbit IgG (H + L), PE	Jackson ImmunoResearch	Cat.# 711-116-152; RRID: AB_2340599
conjugated
Donkey anti-rabbit IgG (H + L),	ThermoFisher	Cat.# A21206; RRID: AB_2535792
AlexaFluor488
Donkey anti-mouse IgG (H + L),	ThermoFisher	Cat.# A21202; RRID: AB_141607
AlexaFluor488
Donkey anti-rabbit IgG (H + L),	ThermoFisher	Cat.# A31572; RRID: AB_162543
AlexaFluor555
Donkey anti-mouse IgG (H + L),	ThermoFisher	Cat.# A31570; RRID: AB_2536180
AlexaFluor555

Chemicals, Peptides, and Recombinant Proteins

Penicillin/streptomycin	ThermoFisher	Cat.# 15070063
L-glutamine	ThermoFisher	Cat.# 25030081
Non-essential amino acids	ThermoFisher	Cat.# 11140-050
Transferrin	ROCHE	Cat.# 10652202001
Ascorbic acid	Sigma	Cat.# A4544-100G
Monothioglycerol	Sigma	Cat.# M-6145-25ml
beta-Mercaptoethanol	ThermoFisher	Cat.# 21985-023
ROCK inhibitor Y-27632	Tocris	Cat.# 1254
Recombinant human BMP4	R&D	Cat.# 314-BP
Recombinant human ActivinA	R&D	Cat.# 338-AC
Recombinant human bFGF	R&D	Cat.# 233-FB
Recombinant human VEGF	R&D	Cat.# 293-VE
Retinol	Sigma	Cat.# R7632
IWP2 (Wnt inhibitor)	Tocris	Cat.# 3533
LDN 193189 (BMP inhibitor)	Tocris	Cat.# 6053
Collagenase type2	Worthington	Cat.# LS004-176
DAPI	Biotium	Cat.# 40043
Fetal calf serum (FCS)	Wisent	Cat.# 080-150
Bovine serum albumin (BSA)	Sigma	Cat.# A1470

Critical Commercial Assays

RNAqueous-micro kit with RNase-	Ambion	Cat.# AM1931
free Dnase treatment
Superscript III Reverse Transcriptase	ThermoFisher	Cat.# 18080044
kit
QuantiFast SYBR Green PCR kit	QIAGEN	Cat.# 204057
Aldefluor assay kit	STEMCELL Technologies	Cat.# 1700
10x Genomics Single Cell 3′ v3.1	10x Genomics	Single Cell 3′ v3.1
Reagent Kit

Deposited Data

mouse mesoderm scRNA-seq	(Lescroart F et al., 2018)	GSE100471
human gastrulation scRNA-seq	(Richard C. V. Tyser et al.,	http://www.human-gastrula.net/
	2020)
mouse E7.75 - E9.25 cardiac cell	(T. Yvanka de Soysa et al.,	GSE126128
scRNA-seq	2019)
human fetal heart scRNA-seq	(Cui et al., 2019)	GSE106118
hPSC-derived cardiac mesoderm,	This study
early progenitor, progenitor and
cardiomyocyte scRNA-seq

Experimental models: Cell Lines

Human ESC: HES3-NKX2-5eGFP/w	Gift from Drs. E. Stanley	NA
line	and A. Elefanty, Monash
	University, AU (Elliott et
	al., 2011)
Human ESC: HES2 line	WiCell	Cat.# ES02

Oligonucleotides

PCR primer sequences

This study

Table 3

Software and Algorithms

FlowJo	Tree Star	https://www.flowjo.com
FV10-ASW	Olympus	https://www.olympus-lifescience.com
GraphPad Prism	GraphPad Software	http://www.graphpad.com/scientific-
		software/prism
10x Chromium Single Cell Software		https://support.10xgenomics.com/single-cell-
Suite v3.1		gene-expression/software/pipelines/
		latest/what-is-cell-ranger
R CRAN, Version 3.6.2		https://cran.r-project.org/
Batchelor	(Haghverdi L et al., 2018)
Seurat v3.2.2	(Tim Stuart et al., 2019)	https://github.com/satijalab/seurat
Monocle3	(Cao et al., 2019; Trapnell et	http://cole-trapnell-lab.github.io/monocle-
	al., 2014)	release/
ClusterProfiler v3.18	(Yu et al., 2012)	https://github.com/YuLab-SMU/clusterProfiler
MsigDB v7.2.1	(Aravind Subramanian et al.,
	2005; Arthur Liberzon et al.,
	2015)
Enrichplot v1.10.2	(Yu G et al., 2021)	https://yulab-smu.top/biomedical-knowledge-
		mining-book/
Slingshot	(Street K et al., 2018)	https://github.com/kstreet 13/slingshot
BiomaRt	(Durinck S et al., 2009)	https://m.ensembl.org/info/data/biomart/
		biomart_r_package.html
Org.Mm.eg.db	(Carlson M, 2019)
Org.Hs.eg.db	(Carlson M, 2019)
SingleCellExperiment	(Amezquita R et al., 2020)	https://github.com/drisso/SingleCellExperiment
Ggplot2	(Wickham H et al., 2016)	https://ggplot2.tidyverse.org/
dplyr	(Hadley Wickham et al.,	https://dplyr.tidyverse.org/
	2018)
Ggcorrplot	(Alboukadel Kassambara,
	2016)

Other

StemPro-34 media (kit)	ThermoFisher	Cat.# 10639011
DMEM/F12	Cellgro	Cat.# 10-092-CV
Hanks Buffered Salt solution	GIBCO	Cat.# 14175-079
KnockOut scrum replacement	ThermoFisher	Cat.# 10828028
TrypLE	ThermoFisher	Cat.# 12605010
96-well clear flat bottom TC-treated	Falcon	Cat.# 353072
culture microplate
24-well clear flat bottom TC-treated	Falcon	Cat.# 353047
culture microplate
96-well clear flat bottom ultra-low	Corning	Cat.# 3474
attachment microplate
Petri dishes 60 × 15 mm	VWR	Cat.# 25384-090
Micro cover glasses 12 mm	VWR	Cat.# 89015-725
ProLong diamond antifade mountant	ThermoFisher	Cat.# P36965

To stain live cells with cell-surface protein, dissociated single cells were stained for 15 minutes at room temperature in FACS buffer and washed twice before they were subject to further analyses. For intracellular staining, cells were fixed for 15 min at 4° C. in PBS containing 4% PFA followed by permeabilization using 90% methanol for 15 min at 4° C. The permeabilized cells were washed with PBS containing 0.5% BSA (Sigma) twice and stained with unconjugated primary antibodies in FACS buffer for 18 hours at 4° C. Stained cells were washed with PBS with 0.5% BSA and stained with proper secondary antibodies in FACS buffer for 30 mins at 4° C. Following washing steps, stained cells were processed with the Fortessa (BD) and analyzed using FlowJo software (Tree Star). For cell sorting, stained cells were kept in StemPro-34 media and sorted using Influx (BD), FACSAriall (BD), MoFlo-XDP (BD) and FACSAria Fusion (BD). Data were analyzed using FlowJo software (Tree Star).

Example 3—Aldefluor Assay

The ALDEFLUOR™ assay (STEMCELL Technologies) was used to detect the cellular ALDH function as an indicator of cell autonomous production of retinoic acid. To perform this assay, cells were dissociated using the method described in ‘Flow Cytometry’ and then stained in the aldefluor assay buffer containing 0.1% BSA and BAAA substrate (0.12 mg/ml) for 40 min at 37° C. This step was done in an environment free of light. Aldehyde dehydrogenase inhibitor DEAB (0.75 nM) was added in the negative control. To end the reaction, cells were washed with cold wash media consisting of IMDM and 10% aldefluor assay buffer. During analyses, the cells were kept in cold wash media. For SHF mesoderm sorting, which requires the ALDEFLUOR™ assay, stained cells were maintained in cold StemPro-34 containing 10% aldefluor assay buffer throughout the sorting process. The sorted cells were collected and re-aggregated in base media containing 1 mM IWP2 and 5 ng/mL rhVEGF.

Example 4—Quantitative Real-Time PCR

RNA extraction was performed using the RNAqueous-micro Kit (Invitrogen). Purified RNA was treated with RNase-free DNase (Invitrogen), and then reverse transcribed into cDNA using oligo (dT) primers and random hexamers and iscript Reverse Transcriptase (ThermoFisher). QRT-PCR was performed on an EP Real-Plex MasterCycler (Eppendorf) using QuantiFast SYBR Green PCR kit (QIAGEN). The copy number of each gene was determined based on a standard curve plotted with human genome DNA with known copy number. The relative expression levels of genes were obtained by normalizing their copy number to that of TBP. The detailed primer sequences are provided in Table 3.

TABLE 3
RT-qPCR primer sequences

		SEQ		SEQ
		ID		ID
Gene	Forward 5′-3′	NO	Reverse 5′-3′	NO
BRY (T)	TGTCCCAGGTGGCTTACAGATGAA	1	GGTGTGCCAAAGTTGCCAATACAC	2
MESP1	AGCCCAAGTGACAAGGGACAACT	3	AAGGAACCACTTCGAAGGTGCTGA	4
MIXL1	CTGTGCTCCTGGAACTGAAA	5	TGGGAGCTAGAGTCAGAGATG	6
FGF8	CTGCGTCTTCACGGAGATT	7	GGTGAAGGCCATGTACCAG	8
EOMES	CCCACTACAATGTGTTCGTAGA	9	TGCATGTTATTGTCGGCTTTG	10
LHX1	GTTTGTCTCCGGATTCCCAA	11	CAGGTTCTGGTCGTCATTCTC	12
FOXC2	CAACATGTTCGAGAACGGCAGCTT	13	CGCTCTTGATCACCACCTTCTTCT	14
GATA4	CGAATGACGGCATCTGTTTGCCAT	15	ATTTGGTATTAGGGATGCAGGGCG	16
CITED1	TCTCCAATAGGCTCTCCTACAA	17	TAAGTTTCTGCAGGTGCATACT	18
FOXC1	ACCCGGACTCCTACAACAT	19	TCCTTCTCCTCCTTGTCCTT	20
HEY2	GAGTGAGAGAGTCGTGTTTC	21	ACTTCTGTCCCTTTCCTTTC	22
FOXH1	CCACCTCCTACTTGCCTATCTA	23	GCTGGTTGACGGACACTG	24
ISL1	GAAGGTGGAGCTGCATTGGTTTGA	25	TAAACCAGCTACAGGACAGGCCAA	26
JAG1	TGCTACAACCGTGCCAGTGACTAT	27	AGTGGTCTTTCAGGTGTGAGCAGT	28
HOXB1	AGAAGGAGACGGAGGCTATT	29	GGTCTGCTCGTTCCCATAAG	30
MYL2	TGTCCCTACCTTGTCTGTTAGCCA	31	ATTGGAACATGGCCTCTGGATGGA	32
HOXA1	GAAAGTTGGAGAGTACGGCTAC	33	TGTTGAAGTGGAACTCCTTCTC	34
TBX6	GCCCGCTACTTGTTTCTTCT	35	GTGAATGTAGACACGGTCAGG	36
TBX5	ACAAAGTGAAGGTGACGGGCCTTA	37	ATCTGTGATCGTCGGCAGGTACAA	38
TBX1	GTGAAGAAGAACGCGAAGGT	39	TGGTGACGATCATCTCGGT	40
FGF10	TGTGGAAATGGATACTGACACA	41	GACGGAAGACACCAAGAACA	42
HAND1	GCTGGAGTTAAACCAGTGA	43	GATGCGTAGCACCAGTC	44
HAND2	GCGTGAATGTTCCCTCTT	45	CTAGTGCCCACTGTCTTTATC	46
NR2F2	TGATGTAGCCCATGTGGAAAG	47	GCTGCCGGACAGTAACATATC	48
ALDH1A2	TTTGCCAAGTTCCATTGTGCCAGG	49	TGGTGGAGTCACTGGAAAGCAGAA	50
CXCR4	AGGGAACTGAACATTCCAGAGCGT	51	TTT GTA CAC CAA GCA CCT ATT T	52
TDGF1	AGGAATTTGCTCGTCCATCTC	53	AAGACCGAGGCCGAATTG	54
PITX2	AGACTGAAAGCAAAGCAGCACTCC	55	ATACTGGCAAGCACTCAGGTTGGA	56
GSC	ACGATGCTACTTTCTTGCACACGC	57	ACCCTCCCGGCTCTGTACACTATTTA	58
FGF17	TCCGCGAGTACCAACTCTA	59	CAAACTTGTTGCCGTCCTC	60
BMP4	TCAGGCAGTCCTTGAGGATAGACA	61	AAGCAGTCTGTGTAGTGTGTGGGT	62
GATA6	GAGAACAGCGAGCTCAAGTAT	63	CACGGAGGACGTGACTT	64
GYPB	CACCTGCTGTTCTCTTGTTTATG	65	CAGTAATAGTGAGGCAGGAGAAC	66
GAL	TGGCAACCACAGGTCATT	67	CTGGTTTCATGTCATCTTCGG	68
PCDH19	CTGACCTCCTCCCTCAACTATT	69	GGGTATTCTGGTTCTCCACATTC	70
PRICKLE1	GATCAAGAGACTCCCGAAGAAG	71	GTAGTTCAGAGCAGGCGATAAG	72
HES7	GCTGCTACTTGTCCGGTTT	73	CGCAGATAGCCGTGCAG	74
RBP1	CAACTGGCTCCAGTCACTC	75	GCAGGTACTCCTCGAAATTCT	76
CRABP1	AACGCCATGCTGAGGAAA	77	CGTGGTGGATGTCTTGATGT	78
HOTAIRM1	GCCAGAAACCAGCCATAGT	79	CATAGGTTTGCTCCCTACCTTC	80
PHLDA1	TGTACTTCACTGTGGTGATGG	81	GATGGCCTGACGATTCTTGTA	82
CYP26A1	CCAAGGGCTGGAATGTTATCT	83	GGAGATTGTCCACAGGATACAC	84
CD1D	CCTGGGAACGCCTCAAATAA	85	GAATGGCCAAGTTTACCCAAAG	86
ITGA3	CAGACCTACCACAACGAGATG	87	ACACAGTGTTCTGGGTGAAG	88
NR2F1	TACCTGTCCGGCTACATCTC	89	CAGATGTTCTCGATGCCCATAA	90
SIX1	TGCCGTCGTTTGGCTTTA	91	CTTGAGTACGCTCTCGTTCTTG	92
UNC45B	CGGACATCAAGGCTCTGTATC	93	CATCTCCTGGAAGTTCTGGTTC	94
IRX4	TTGGACTCCTGGGAACATGGACAA	95	ATGCTTCAGGGTATCTGGCCTCTT	96
PDGFRB	TGGGCTAGACACGGGAGAATACTT	97	AAGATGTAGAGCCGTTTCCGCTCA	98
IRX1	GACTGTACACCTGCCACATC	99	CAGGAAGGAGCGCATGTT	100
MEIS2	GGTTCACCACCTGAACCAC	101	TGACAGCGGATCCCATACT	102
MYOZ1	GCTGGTCAGGGATTCTCATAC	103	CTGCTGATCAGAGCCATACTG	104
IRX2	GCTAGCCATCATCACCAAGAT	105	CCAGGTCATCTTGTTCTCCTTC	106
TXLNB	GTCCAACCACCAGAGAAAGAG	107	GCAGCAGACCCATAAGTGTTA	108
COX7A1	GCTGATCCGCTCCTTCAG	109	TGGAAGAGCTTCTGTTTCTCG	110
PLN	ACCATTGAAATGCCTCAACAAG	111	ACGATGATACAGATCAGCAAGAG	112
TBX20	GCTCCTGGGTATCATCTTCT	113	GAGGAATGGGTGTTGCTATG	114
TMEM88	CTGTTCTTGTAACAGCCCAGAA	115	TAGCAAGATGGTCCCTAGCA	116
TBX18	TTAACCTTGTCCGTCTGCCTGAGT	117	GTAATGGGCTTTGGCCTTTGCACT	118
DKK1	TCTTTGTCGCGATGGTAGC	119	GGTTCTTGATAGCGTTGGAATTG	120
TBP	TGAGTTGCTCATACCGTGCTGCTA	121	CCCTCAAACCAACTTGTCAACAGC	122

Example 5—Immunocytochemistry and Imaging

EBs were fixed by 4% paraformaldehyde, embedded, and sectioned. After the deparaffinization and rehydration, heat-induced epitope retrieval was performed followed by immunostaining. The following antibodies were used for immunostaining: mouse anti-cardiac isoform of cTNT (ThermoFisher Scientific, 1:200), rabbit anti-human cTNT (abcam, 1:200), rabbit anti-CX43 (abcam, 1:800), rabbit anti-TBX5 (ThermoFisher, 1:200), rabbit anti-HAND1 (LSBio, 1:200), rabbit anti-HEY2 (Proteintech, 1:200), mouse anti-NR2F2 (Bio-Techne, 1:200), mouse anti-NR2F1 (Bio-Techne, 1:200), rabbit anti-IRX1 (ThermoFisher Scientific, 1:200). For detecting unconjugated primary antibodies, the following secondary antibodies were used: donkey anti-mouse IgG-Alexa488 (ThermoFisher, 1:500), donkey anti-rabbit IgG-Alexa488 (ThermoFisher, 1:500), donkey anti-mouse IgG-Alexa555 (ThermoFisher, 1:500), or donkey anti-rabbit IgG-Alexa555 (ThermoFisher, 1:500). IRX1 and CX43 expression was measured by counting the number of CX43+staining in one field of view (×40 magnification) in cTNT+cardiomyocytes randomly selected from 1 area in each EB. Data were collected from 3 independent experiments. All imaging was taken by Zeiss LSM700 confocal microscope.

Example 6—Quantification and Statistical Analysis

Standard statistical analyses were performed using GraphPad Prism 8. The number of replicates, type of statistical test and test result are described in the Detailed Description of the Drawings. All data are represented as mean±standard error of mean (SEM). Statistical significance of two-group comparison was determined by unpaired student's t test and that of three or more groups was determined by one-way ANOVA analysis with Bonferroni post-hoc test in GraphPad Prism 8 software. Results are significant at p<0.05 (*), p<0.01 (**), p<0.001 (***), p<0.0001 (****). Sample size of all the experiments was not pre-determined, and no randomization or investigator blinding approaches were implemented during the experiments and data analyses given the natures of the study.

Example 7—Sample Preparation, Single-Cell Library Generation and Raw Data Processing

Mesoderm (day 3), late mesoderm (day 4), progenitor (day 6) and myocyte (day 20) populations were generated from HES2 hPSC line. Cells were dissociated to single cells as described above and stained with DAPI. Live cells were then sorted using FACSAria Fusion (BD) at the Sick Kids/UHN flow cytometry facility. Single-cell libraries from these cell suspensions were generated in the 10× Genomics Chromium controller using Chromium Single Cell 3′ Reagent Kit v3. FHF, aSHF and pSHF cells of the same developmental stage/differentiation phase were sequenced together and all libraries were sequenced simultaneously. Chromium Single Cell Software Suite v3 was used for processing the single cell RNA-seq raw data produced in the 10× Chromium Platform, which includes sample demultiplexing, read alignment, barcode processing, and UMI counting. “Cellranger mkfastq” was used to generate FASTQ files from BCL files. Next, “cellranger count” was used to generate single-cell gene counts for a single library. Reads in the FASTQ files were mapped to the human reference genome (NCBI build38/UCSC hg38) with STAR software. Reads were confidently mapped to the exonic loci with MAPQ 255. Chromium cellular barcodes were used to generate gene-barcode matrices. Only reads that were confidently (uniquely) mapped to the transcriptome were used for the UMI count. Filtered gene-barcode matrices containing only cellular barcodes were used for downstream analyses.

Example 8—Cell Filtering and Cell-Type Clustering Analysis

The transcriptomes of 2672 day 3 FHF cells, 5228 day 3 SHF cells, 4108 day 4 FHF cells, 8606 day 4 SHF cells, 3146 day 6 FHF cells, 3241 day 6 aSHF cells, 3231 day 6 pSHF cells, 2352 day 20 FHF cells, 2909 day 20 aSHF cells and 3535 day 20 pSHF cells were captured and sequenced. Prior to the downstream analyses, raw data of cells of the same stage and various lineages (FHF, aSHF and pSHF) were aggregated as a single object. Further filtering of low-quality cells and doublets, regressing of mitochondrial and cell cycle factors and clustering analyses of these cells were performed with the Seurat v.3.2.2 R package (Macosko et al., 2015, Cell, 161:1202-14; Satija et al., 2015, Nat. Biotechnol., 33:495-502). For the analyses of hPSC datasets, filtered cells were analyzed using the ‘SCTransform’ pipeline before principal component analysis (Hafemeister & Satija, 2019, Genome Biol., 20:296), whereas aggregated mouse datasets were normalized for genes expressed per cell and total expression, then multiplied by a scale factor of 10,000 and log-transformed (NormalizeData and ScaleData functions) using the standard Seurat pipeline. Following data normalization and scaling, significant principal components were calculated (RunPCA function) and the top 25 PCAs were used for downstream graph-based, semi-unsupervised clustering into distinct populations (FindClusters function) and uniform manifold approximation and projection (UMAP) dimensionality reduction was used to project these cells in two dimensions (RunUMAP function). For clustering, the resolution parameter was approximated based on the number of cells and distinct marker expressed in discernible clusters. Specifically, resolutions from 0.4 to 0.8 were used for aggregated datasets in the present study (0.4 for days 3, 4, 6 data and 0.8 for day 20 data). To identify marker genes or upregulated genes, the clusters of interest were subset and compared for differential gene expression using the Wilcoxon rank-sum test (FindAllMarkers function; only.pos=TRUE, min.pct=0.1, logfc.threshold=0.1, p-value cut-off=0.05).

Example 9—Batch Correction, Integration of Multiple Datasets and Correlation Analysis

Batch effects in hPSC-derived cells of multiple lineages and stages used for downstream pseudotime analyses were corrected by matching mutual nearest neighbors (mnn) with the package batchelor (Haghverdi et al., 2018, Nat. Biotechnol., 36:421-7) and Seurat wrapper. The corrected data were then transformed to appropriate formats for downstream analyses (single cell experiment object for slingshot analysis). The integration of human fetal and hPSC data was achieved by canonical correlation analysis (CCA) provided in the Seurat package (Stuart et al., 2019, Cell, 177:1888-1902). Correlation between human fetal and hPSC-derived cells was estimated with Pearson correlation based on the mean expression values of 3000 variable genes stored in the integrated data after CCA correction. The resulting Pearson correlation scores were visualized with the package ggcorrplot following hierarchical clustering.

Example 10—Gene Ontology, Gene Set Enrichment Analyses and Human to Mouse Gene Transformation

Gene ontology and gene set enrichment analyses were performed with the ClusterProfiler, MSigDB, org. Hs.eg.db and org.Mm.eg.db packages (Carlson et al., 2016, Genomic Annotation Resources in R/Bioconductor. In Statistical Genomics: Methods and Protocols, Mathé and Davis, eds. (New York, NY: Springer), pp. 67-90; Subramanian et al., 2005, PNAS USA, 102:15545-50; Yu et al., 2012, Omics J. Integr. Biol., 16:284-7). Upregulated genes in the clusters of interest were obtained using the FindAllMarkers function provided in the Seurat package (only.pos=TRUE, min.pct=0.1, logfc.threshold=0.1, p-value cut-off=0.05). The gene symbols were transformed to Entrez Gene IDs using the annotations provided in the org. Hs.eg.db package. Note that org. Mm.eg.db package was used for mouse data analysis. In the cases where transformation between human and mouse genes were required (analysis of human and mouse conserved genes), the useMart and getLDS functions provided in the biomaRt package were used (Durinck et al., 2005, Bioinforma. Oxf. Engl., 21:3439-40; Durinck et al., 2009, Nat. Protoc., 4:1184-91). The genes enriched in these clusters were subsequently analyzed for the enrichment of biological processes (BP) using the compareCluster function (function=enrichGO, ontology=BP, pvalueCutoff=0.05) with the package ClusterProfiler. To generate dot plots, the analyzed data (containing gene number, adjusted p values, cluster identities and others) were retrieved and visualized with the package ggplot2. For GSEA analysis, all the genes in a given cluster were retrieved and the ranked by their expression level (LogFC). With the sorted/ranked data frame, KEGG and GSEA analyses were performed with the packages ClusterProfiler and MSigDB. Finally, the results were visualized with the package enrichplot.

Example 11—Pseudotime Trajectory Analysis

Pseudotime and cell trajectory analyses were performed with the Monocle3 and slingshot packages as described in the papers and tutorials (Qiu et al., 2017, Nat. Methods, 14:979-82; Street et al., 2018, BMC Genomics, 19:477; Trapnell et al., 2014, Nat. Biotechnol., 32:381-6). The analysis of integrated hPSC-derived mesoderm and human gastrulation dataset was performed with slingshot. The processed Seurat object was transformed to a single cell experiment object, which was then analyzed with the slingshot package (slingshot and getLineages functions). Note that the start cluster was pre-determined for the slingshot analysis (epiblast for the integrated mesoderm data). Monocle3 package was used to perform pseudotime inference for the aggregated hPSC data shown in FIG. 13 given that this package provides a function (find_gene_modules function; resolution=1e-3, reduction_method=c (“UMAP”)) that reveals upregulated gene modules as cells transition through different stages. For these analyses, different lineages (FHF, aSHF and pSHF) that encompass all the developmental stages described in this paper were transformed to CellDataSet objects (as.cell_data_set function) and analyzed separately (learn_graph, plot_cells and order_cells functions). The resulting pseudotime values of all the cell types were added to the meta data of their corresponding Seurat objects for downstream visualization.

Example 12—Generation of FHF and SHF Cardiac Mesoderm Populations from hPSCs

Previous findings that distinct ventricular and atrial mesoderm populations can be induced through the staged manipulation of BMP and Activin A signaling suggested that a similar strategy could be used to segregate the FHF and SHF fates at this early stage of development. To test this, Activin A and BMP4 concentrations were varied between days 1 and 3 of differentiation to induce mesoderm subsets that display the defining features of populations with FHF and SHF potential (FIG. 1A). At day 4, mesoderm induction was monitored by expression of PDGFR-alpha together with either CD235a/b or ALDH1A2, markers that have previously been shown to track with the induction of ventricular and atrial mesoderm, respectively (FIGS. 1B and 8A). For these analyses, the Aldefluor (ALDH) assay was used as a measure of ALDH1A2 activity (Jones et al., 1995, Blood, 85:2742-6).

As observed in previous studies, most of the cells in the mesoderm populations generated with high concentrations of BMP4 and Activin A (over 5 ng/ml of BMP4 and 3 ng/ml of Activin A) expressed CD235a/b and lacked ALDH activity (FIG. 1B). In contrast, mesoderm specified by lower concentrations of BMP4 and Activin A (3 ng/ml BMP4 and 0.5-1.5 ng/mL Activin A) contained significantly more ALDH⁺ cells and fewer CD235a/b⁺ cells than the populations induced with high concentrations of cytokines (FIG. 1B). Notably, small changes in the concentration of Activin A dramatically impacted the proportion of ALDH⁺ cells induced. Comparison between populations generated using 3B1.5A, 5B6A, 16B4A and 16B8A showed that 16B8A-induced mesoderm contained the highest frequency of PDGFR-alpha⁺ CD235a/b⁺ cells, whereas 3B1.5A-induced mesoderm contained ALDH⁺ and CD235a/b⁺ cells (FIGS. 1B and 8A). These findings are consistent with previous studies and show that proper levels and ratios of BMP4 and Activin A are required for inducing different mesoderm populations.

Molecular analyses of the populations induced with 3B1.5A and 16B8A showed similar kinetics of brachyury (T) and MESP1 expression, indicating that the temporal development of the primitive streak-like (brachyury⁺) and mesoderm (MESP1⁺*) populations was not impacted by the different concentrations of cytokines (FIG. 1C). To determine if the two hPSC-derived mesoderm subsets share similarities to the mouse FHF and SHF mesoderm identified previously (Lescroart et al., 2014, Nat. Cell Biol., 16:829-40; Lescroart et al., 2018, Science, 359:1177-81), the two hPSC-derived mesoderm subsets were analyzed for expression of genes that distinguish the mouse populations, identified through re-analyses of the Lescroart data. These analyses showed that the early emerging (E6.75) mesoderm expressed higher levels of Mixl1, Fgf8, Eomes and Pitx2, whereas Foxc1, Foxc2, Foxh1, Hoxb1, Cited1, Hoxa1 and Tbx6 were found at higher levels in the later emerging (E7.25) mesoderm (FIG. 8B). In addition to these differences, more detailed analyses provided further resolution and showed that the early emerging population expressed elevated levels of additional genes associated with the formation of FHF-like mesoderm, whereas the later population contained distinct subpopulations that showed molecular profiles of aSHF and pSHF mesoderm (FIGS. 8C and 8D). Gene ontology (GO) analysis of the genes upregulated in these mesoderm subtypes revealed an enrichment of Nodal/Activin signaling in the FHF mesoderm (FIG. 8E), supporting the requirement of high Nodal concentration for the generation of this mesoderm type in mouse embryo. RT-qPCR analyses of the two hPSC-derived populations identified above showed that the FHF genes (MIXL1, FGF8, EOMES and PITX2) were expressed at higher levels in the 16B8A-induced mesoderm, whereas the levels of genes associated with SHF mesoderm including FOXC2, CITED1, FOXC1, FOXH1, HOXB1, HOXA1 and TBX6 were significantly higher in the 3B1.5A mesoderm (FIGS. 1D and 1E).

To evaluate the potential of the two hPSC-derived mesoderm populations with respect to FHF and SHF potential, the cells were cultured for additional periods of time under cardiogenic conditions and the resulting populations analyzed for expression of genes indicative of the two heart fields. At days 5 and 6 of differentiation, the stage at which cardiovascular progenitors are specified, the cells generated from the 16B8A-induced mesoderm expressed higher levels of the FHF progenitor marker TBX5 and lower levels of the SHF progenitor markers FGF10, TBX1 and ISL1 than the derivatives of the 3B1.5A-induced mesoderm (FIG. 1F). While both populations efficiently generated cardiomyocytes (FIG. 8F), they displayed differential gene expression patterns at days 12 and/or 20 of differentiation. Cardiomyocytes generated from the 16B8A induction expressed higher levels of the left ventricular (FHF) genes HAND1 and TBX5 than those derived from the 3B1.5A induction (FIG. 1H). In contrast, expression of HAND2 (day 12) associated with right ventricular (SHF) development and NR2F2 indicative of atrial (SHF) differentiation were expressed at higher levels in the 3B1.5A-derived cardiomyocytes (FIGS. 1G and 1H). Taken together, these findings support the interpretation that the 16B8A-induced population represents FHF mesoderm, whereas the one induced with 3B1.5A displays molecular profiles and developmental potential of SHF mesoderm.

Example 13—Characterization of Heterogeneity and Temporal Specification of hPSC-Derived Cardiac Mesoderm Populations

To further investigate the molecular characteristics of the 3B1.5A- and 16B8A-induced mesoderm populations, scRNA-seq was carried out at day 3 of differentiation. Analyses of combined data sets revealed the presence of 7 distinct clusters that included 6 PDGFRA⁺MESP1⁺ mesoderm clusters and an endoderm cluster identified by the expression FOXA2 and SOX17 (FIGS. 2A and 9A). The 16B8A-induced population consisted of a single mesoderm cluster, while that induced with 3B1.5A resolved into 3 main clusters (FIG. 2A). To annotate the different clusters, expression was analyzed for FHF as well as for both aSHF, and pSHF mesoderm markers obtained from the analysis of Mesp1′ E6.75 and E7.5 mouse mesoderm (FIG. 8D). As expected from the initial analyses, the 16B8A-induced population expressed the highest levels of EOMES and LHX1, indicating it represents FHF mesoderm (FIG. 2B and Appendix A). Within the 3B1.5A-induced mesoderm, a putative aSHF cluster was identified that expressed SIX1 and FOXC2, a putative pSHF cluster that expressed HOXA1 and ALDH1A2, as well as an additional cluster that co-expressed aSHF and pSHF mesoderm markers (FIG. 2B and Appendix A). None of the clusters expressed genes indicative of the presence of paraxial mesoderm (PAX3, MEOX1 and MYF5) or neuroectoderm (PAX6 and SOX1), consistent with the interpretation that they represent lateral plate mesoderm (FIG. 9A).

We next sought to identify the molecular features of each mesoderm subtype that are conserved between human and mouse by performing differential expression analyses on the human and mouse FHF, aSHF, and pSHF mesoderm clusters. Overall, 382 differentially expressed genes (DEGs) (219 pSHF genes, 60 aSHF genes and 103 FHF genes) were detected that showed conserved cross-species patterns in the different mesoderm subtypes (Appendix A and FIG. 2C). The list contained some of the known genes that distinguish these mesoderm populations as well as many others that have not been previously described as showing differential expression patterns between them (Appendix A and FIG. 2D). For example, it was found that PITX2 and GSC, conventionally used as primitive streak laterality and polarity markers, are preferentially expressed in the FHF-like mesoderm, whereas HOTAIRM1, a long non-coding RNA located in the HOXA gene cluster between HOXA1 and HOXA2, is expressed at the highest levels in pSHF-like mesoderm. RT-qPCR analyses confirmed some of the differential expression patterns and showed that the 16B8A-induced mesoderm expressed higher levels of the newly identified FHF genes including TDGF1, LHX1, GSC, FGF17, BMP4, BMP2, GATA6 and GYPB (FIG. 2E) than the 3B1.5A-induced mesoderm. By contrast, the pSHF markers GAL, PCDH19, ALDH1A2, PRICKLE1, HES7, RBP1, CRABP1 and HOTAIRM1 (FIG. 2F), as well as the aSHF markers PHLDA1 and CXCR4 (FIG. 2G), identified in these analyses were detected at significantly higher levels in the 3B1.5A-induced mesoderm. The findings from these different molecular analyses further support the interpretation that 16B8A-induced population represents FHF mesoderm whereas the one induced with 3B1.5A contains both aSHF and pSHF mesoderm.

To gain insights into pathways involved in regulating biological dynamics within distinct mesoderm populations, knowledge base-driven enrichment analyses was performed with the pathway annotations from publicly available databases. Interestingly, GO analysis of the species conserved DEGs of each population indicated an enrichment of pattern specification process and regionalization in all the clusters, suggesting that these genes may reflect the spatiotemporal dynamics observed within the primitive streak during gastrulation (FIG. 2H). Terms relevant to BMP signaling and cardiac muscle development were mainly enriched in the FHF mesoderm (FIG. 2H), suggesting that these cells are committed to the cardiomyocyte lineage through early onset of BMP signaling (Lescroart et al., 2018, Science, 359:1177-81). Components of the Wnt signaling pathway and retinoic metabolic processes were enriched in the pSHF clusters (FIG. 2H), an assignment consistent with the known roles of these pathways in pSHF development in the mouse. Similarly, the gene set involved in outflow tract morphogenesis was enriched in the aSHF cluster (FIG. 2H), the origin of outflow tract cardiomyocytes in the mouse. Gene set enrichment analysis (GSEA) with KEGG pathway annotations revealed an enrichment for genes annotated to arrhythmogenic right ventricular cardiomyopathy (ARVC) in the aSHF mesoderm (FIG. 9B). As ARVC primarily affects the right ventricle, this observation supports the interpretation that the aSHF mesoderm is the source of RVCMs in the human.

To determine if the hPSC-derived FHF, aSHF and pSHF populations represent temporally distinct stages of mesoderm development as observed in the mouse, our data was integrated with scRNA-seq data from a human gastrulating embryo that contained temporally distinct mesoderm subpopulations (nascent, emergent and advanced) (Tyser et al., 2020, Cold Spring Harbor Perspect. Biol., 12:a037135). These integration analyses revealed a significant overlap between the hPSC- and human embryo-derived data (FIGS. 2I and 9C) as demonstrated by the co-clustering of the hPSC and embryonic endoderm, as well as that of the hPSC and embryonic mesoderm populations. Correlation and pseudotime analyses of the integrated data suggest that hPSC-derived FHF mesoderm represents the most advanced population whereas the pSHF mesoderm showed the highest correlation with embryonic nascent mesoderm (Pearson correlation score=0.91) that occupied the earliest pseudotime (FIGS. 2J and 9D). The aSHF mesoderm was positioned between the pSHF and FHF populations and correlated with the embryonic emergent mesoderm (Pearson correlation score=0.89) (FIGS. 2J and 9D). An enrichment of pSHF mesoderm markers in the nascent mesoderm and aSHF mesoderm markers in the emergent mesoderm was confirmed (FIG. 2K). As a reflection of the transition from primitive streak to mesoderm, analyses of the stage-specific markers along pseudotime suggested that the primitive streak marker TBXT was upregulated prior to the mesoderm marker MESP1, followed by the upregulation of GATA6 indicative of cardiac differentiation (FIG. 9E). Markers of FHF (BMP2), aSHF (IRX1) and pSHF (HOXA1) were expressed at distinct pseudotimes in a sequential order, supporting the temporal specificity of these mesoderm subtypes (FIG. 9E). Taken together, these findings support the interpretation that the hPSC-derived FHF, aSHF, and pSHF populations indeed represent temporally distinct mesoderm subsets that emerge in a pattern identical to that of their mouse counterparts.

In addition to the day 3 populations, scRNA-seq also was performed on day 4 populations induced with either FHF or SHF conditions. Analyses of these populations showed a marked reduction in the proportion of MESP1⁺ cells compared to day 3 and a high proportion of GATA6′ cells indicative of the specification of cardiac lineage. Populations of FOXA2⁺ endoderm and PECAM1⁺ endothelial cells were also detected (FIGS. 9F and 9G). More detailed analyses revealed the presence of a HAND1^high BMP4^high FHF cluster, a FOXC2^high TBX1^high aSHF cluster and a NR2F1^high HOXB1^high pSHF cluster (FIG. 9H). Based on these expression patterns, the day 4 population was considered to represent late-stage mesoderm, undergoing the initial specification steps to cardiac progenitors.

Example 14—Generation of Distinct Cardiac Progenitors from Purified Mesoderm Populations

To be able to separate the FHF, aSHF and pSHF mesoderm populations for functional analyses, our data sets were queried to identify FACS-compatible markers that could be used to isolate these populations. Among the DEGs, it was found that CXCR4 and ITGA3 expression was highest in the aSHF cluster, CD1D and ALDH1A2 levels were highest in pSHF cluster and, as expected from our flow cytometric analyses, GYPB was preferentially expressed in the FHF cluster (FIG. 10A and Appendix A). RT-qPCR analyses further supported the differential expression of these markers in the 3B1.5A- and 16B8A-specified mesoderm cultures (FIGS. 2E-G and 10B). To determine if the expression of these FACS-compatible markers correlated with the expression patterns of the lineage-specific markers, we carried out Pearson correlation analyses. As shown in FIG. 3A, expression of GYPB positively correlated with the FHF mesoderm markers including DKK1, CYP26A1 and LHX1, whereas it negatively correlated with pSHF markers, such as RBP1 and TBX6. The expression of CXCR4 positively correlated with the aSHF markers FOXC1, FOXC2, PHLDA1 and TWIST1 and negatively with the FHF mesoderm marker TDGF1. Finally, ALDH1A2 expression positively correlated with the pSHF markers HOXA1, HOXB1, CDX2, and HOTAIRM1 and negatively with FHF markers LHX1, EOMES, CYP26A1 and TDGF1 (FIG. 3A).

Flow cytometric analyses of PDGFR-alpha⁺ mesoderm from day 4 3B1.5A- and 16B8A-induced populations were consistent with the assignment of these markers based on molecular profiling. The 16B8A-induced FHF population predominantly expressed CD235a/b but not CXCR4, and it did not show any ALDH activity (FIG. 3B). In contrast, the 3B1.5A-induced population could be segregated into a CXCR4⁺ fraction that lacked ALDH activity indicative of aSHF identity and a CXCR4⁻ fraction that contained ALDH⁺ cells reflective of pSHF mesoderm (FIG. 3C). Although CD235a/b protein was also expressed in the aSHF mesoderm, its transcript does not correlate with aSHF mesoderm markers. Using similar strategies, CD1D and ITGA3 (CD49c) were validated as novel cell-surface markers of pSHF and aSHF mesoderm respectively (FIGS. 10C and 10D).

To determine the potential of these different fractions, the cells were isolated by FACS at day 4 and cultured overnight as aggregates. The resulting populations were analyzed for expression of cardiac progenitor markers identified from analyses of E7.75 mouse FHF, aSHF and pSHF progenitors (FIG. 10E) as described in de Soysa et al. (2019, Nature, 572:120-4). As shown in FIG. 3D, the FHF mesoderm (ALDH⁻CD235a/b⁺CXCR4^−/low)-derived population displayed the FHF progenitor signature identified in the mouse that includes expression of TBX5, HAND1, BMP4 and GATA4. The cells generated from the ALDH⁺CXCR4⁻ pSHF mesoderm expressed the pSHF markers NR2F2, HOXB1, HOXA1 and ALDH1A2 (FIG. 3E), whereas those derived from the ALDH CXCR4⁺ aSHF mesoderm expressed the aSHF markers FGF8, FGF10, FOXC1 and ISL1 (FIG. 3F). Given these expression patterns, the day 5 populations were considered as representative of the onset of the progenitor stage of development. In addition to transcriptomic analyses, higher expression levels of HAND1 and TBX5 protein were shown in the FHF progenitors and those of NR2F1 and NR2F2 protein in the pSHF progenitors by immunocytochemistry (FIGS. 3G and 10F).

To determine if CD1d could be used in place of ALDH as a marker for isolating pSHF mesoderm, the CD1d⁺CXCR4⁻ and CD1d⁻CXCR4⁺ fractions were isolated by FACS from day 4 SHF population, cultured for 24 hours and then the resulting populations analyzed by RT-qPCR for expression of pSHF and aSHF progenitor markers (FIGS. 10G and 10H). The CD1d⁺CXCR4⁻ mesoderm-derived population expressed the spectrum of genes indicative of pSHF progenitors, whereas the cells generated from the CD1d⁻CXCR4⁺ population displayed an expression pattern consistent with that of aSHF progenitors. Taken together, the findings from these cell fractionation studies demonstrate that it is possible to isolate day 4 mesoderm populations with FHF, aSHF and pSHF potential based on expression of CXCR4, GYPB, CD1d and the presence ALDH activity.

The expression of Aldh1a2 as well as other components of the RA signaling pathway including Rdh10, Rarb, and Cyp26a1 in the pSHF of the E7.75 mouse embryo is consistent with the known role of this pathway in maintaining the pSHF fate and in generating the derivative lineages in vivo (FIG. 10I). The expression of ALDH1A2 in the day 5 hPSC-derived pSHF population (FIG. 3E) suggests that RA signaling could play a similar role in the establishment and/or maintenance of the pSHF progenitor fate in the human. To test this, isolated day 4 pSHF cells (ALDH CXCR4⁻) were treated with either DMSO or retinol (2 μM) and the expression of cardiac progenitor markers examined 24 hours later. RT-qPCR analyses showed that treatment with ROH led to upregulation of the RA responsive gene CYP26A1, and the pSHF progenitor markers HOXA1 and HOXB1 (FIG. 3H). Interestingly, aSHF progenitor markers FGF10, FOXC1 and FOXC2 were downregulated as a result of ROH treatment (FIG. 3I). These findings indicate that RA signaling at this stage does function to enforce the pSHF molecular signature in the ALDH⁺CXCR4⁻-derived progenitor population.

Example 15—Single Cell Transcriptomic Analyses of the Day 6 Progenitor Populations

Following the generation of FHF, aSHF and pSHF progenitors, scRNA-seq was performed on these distinct populations (day 6) to investigate their cellular diversity and molecular profiles at the single cell level. Clustering analysis of all the populations identified clusters that represent FHF, aSHF, and pSHF lineages based on the expression of the lineage-specific markers: ISL1, HOXB1, NR2F2 and HOTAIRM1 for pSHF; FOXC1, FOXC2, FGF10 and WNT5A for aSHF; and TBX5, HAND1, HCN4 and MYH6 for FHF (FIGS. 4A and 4B). Expression of the cardiac myosin gene MYH6 in the majority (85%) of the FHF population indicates that these cells are undergoing differentiation towards cardiomyocytes. Significantly fewer MYH6′ cells were detected in the aSHF cluster (26%) and almost none were present the pSHF cluster (4.6%) (FIG. 11A). These differences recapitulate the temporal pattern observed at the onset of cardiogenesis in the mouse where the FHF lineage differentiates to cardiomyocytes prior to those of SHF lineages. Furthermore, analyses of these MYHG⁺ cells suggest that they retain lineage-specific markers expressed by their respective progenitors (FIG. 11B), highlighting the molecular differences between the earliest-emerging myocytes derived from distinct cardiac progenitors.

Having annotated hPSC-derived cardiac progenitors analogous to those in E7.75 mice, we then sought to identify markers of aSHF, pSHF and FHF progenitors that are conserved between humans and mice. Combined analyses of hPSC-derived progenitors and E7.75 mouse progenitors revealed 142 conserved FHF markers, 122 conserved aSHF markers and 97 conserved pSHF markers (FIGS. 4C and 4D; Appendix B). Among these markers, genes known to be differentially expressed in these populations were identified including WNT5A, SIX1, ISL1 and FGF10 in aSHF progenitors, DACH1, FOXF1, HOXB1 and NR22 in the pSHF progenitors and HAND1 in FHF progenitors. Additionally, expression patterns of genes were identified that have not been previously shown to differ between these progenitors, such as S100A10 and CSRP2 in FHF progenitors, RGS5, JAG1 and IRX genes in aSHF progenitors, as well as MEIS3 and CPE in pSHF progenitors (FIG. 4D and Appendix B).

Following the identification of species-conserved transcriptional features of FHF, aSHF and pSHF progenitors, the underlying signaling pathways involved in their development were investigated. GO analyses based on these markers showed that genes associated with cardiac ventricle development are enriched in the aSHF and FHF clusters (FIG. 4E), a finding consistent with the lineage tracing studies showing that LVCMs and RVCMs develop from FHF and aSHF progenitors respectively. Genes implicated in outflow tract morphogenesis and pharyngeal development were preferentially expressed in the aSHF progenitors, the progenitors that give rise to these cell types in the developing mouse heart. The pSHF cluster was enriched in genes involved in retinoic acid (RA) signaling, a pathway required for the specification of atrial cardiomyocytes from these progenitors (FIG. 4E).

While RA signaling is a well-established regulator of the pSHF-derived lineages, detail analyses revealed that the aSHF progenitors also express components of this pathway including RDH10, ALDH1A2 and RARB (FIG. 11C). Pseudotime ordering of the expression patterns of these genes in the day 3 mesoderm, day 4 late mesoderm and day 6 progenitor populations revealed different temporal expression patterns in the aSHF and pSHF lineages (FIGS. 4F and 4G). The pSHF lineage expressed ALDH1A2 and RDH10, from the day 3 mesoderm stage onward, whereas expression of these genes was not detected until day 4 of differentiation in the aSHF lineage (FIG. 4G). These patterns correlate well with ALDH activity, which was detected in more than 90% of the days 4 and 5 pSHF cells. By contrast, the day 4 aSHF cells were ALDH and less than 50% of the day 5 aSHF population showed this activity (FIGS. 4H, 4I and 3C). ALDH was not detected in the day 5 FHF population. Treatment of the day 5 aSHF cells with ROH for 24 hours led to an upregulation of the RA-responsive gene CYP26A1 as well as HOXB1 (FIG. 4J), known to be expressed in the IFT and OFT progenitors. Collectively, these findings show that pSHF and aSHF lineages upregulate the cellular machinery required for RA signaling at different developmental stages.

To further characterize the aSHF and pSHF ALDH1A2⁺ populations, DEG and GO analyses were performed to interrogate their transcriptomic differences. These analyses showed that the ALDH1A2⁺ pSHF cells express higher levels of the pSHF progenitor markers and lower levels of the aSHF progenitor markers than the ALDH1A2⁺ aSHF cells; the opposite pattern was found in the ALDH1A2⁺ aSHF cells (FIG. 11E). GO analysis based on the DEGs revealed that genes associated with outflow tract and right ventricle morphogenesis, pharyngeal system development and BMP signaling pathway are enriched in the ALDH1A2⁺ aSHF population (FIG. 11F). Re-clustering of the aSHF cells based on these observations revealed the presence of a large ALDH1A2′ cluster (cluster 0) that expressed the aSHF progenitor markers ISL1, FGF8, FOXC2 and TBX1. The aSHF cells also contained an ALDH1A2⁻ cluster (cluster 1) that expressed genes indicative of cardiomyocyte differentiation including TNNT2 and NKX-2.5 and lower levels of the progenitor markers (FIG. 11G), indicating the presence of cells undergoing differentiation to cardiomyocytes. Analyses of data from the E7.75 mouse embryo aSHF population identified a comparable Aldh1a2^high cluster (E7.75_aSHF2) that expressed aSHF progenitor markers (Tbx1 and Foxc2) as well as an Aldh1a2^low cluster (E7.75_aSHF1) that expressed genes associated with cardiomyocyte differentiation (FIG. 11H). Taken together, these findings strongly suggest that ALDH1A2 expression in the aSHF population marks the progenitor stage of lineage development.

The above observation that the aSHF progenitors express genes involved in Bmp signaling is consistent with the known role of this pathway in the development of right ventricular cardiomyocytes from aSHF progenitors in the mouse. The presence of BMP signaling in the hPSC-derived aSHF lineage is further supported by GSEA analysis that showed an enrichment of ‘response to Bmp’ and ‘regulation of Bmp signaling pathway’ in the aSHF progenitors and a corresponding downregulation in pSHF and FHF progenitors (FIG. 5A). In line with this, it was found that the expression of specific genes involved in different aspects of Bmp signaling were upregulated in aSHF progenitors compare to the pSHF and FHF progenitors (FIG. 5B). The notable exception is the genes for the ligands BMP2 and BMP4, which are also highly expressed in the FHF lineage (FIG. 5B). To determine if BMP plays a role in the differentiation of the aSHF progenitors to derivative lineages, the day 5 cells were treated with either a pathway agonist (10 ng/mL BMP4) or antagonist (0.1 μM LDN) and then the population was analyzed 24 hours after the treatments. FHF and pSHF progenitors were included in the analyses, and ROH was added to the cultures of pSHF and aSHF progenitor, given that both populations display ALDH activity. As shown in FIG. 5C, manipulation of the BMP pathway did not alter the expression of genes indicative of aSHF (FGF8 and ISL1), pSHF (HOXB1) and FHF (HAND1) fates in the aSHF population. Inhibition of the pathway did, however, lead to upregulation of genes associated with pharyngeal progenitors (FOXC2 and SIX1) (FIG. 5D) and downregulation of those indicative of cardiomyocyte development (UNC45B and GATA4) (FIG. 5E). To further investigate the consequences of BMP manipulation, the agonist/antagonist treatment was extended for an additional 48 hours and then the treated cells were cultured for 12 days to promote cardiomyocyte development. FHF and pSHF progenitors also were cultured for 20 days without manipulation of BMP signaling. All 3 progenitor populations generated TNNT2⁺/SIRPa⁺ cardiomyocytes by day 20 of differentiation (FIGS. 5F and 5G). In addition to the cardiomyocytes, the aSHF-derived population also contained PDGFR-beta⁺ mesenchymal cells (FIG. 5F). Treatment with BMP4 increased the proportion and number of cardiomyocytes while reducing the number of the PDGFR-beta⁺ cells in the population, inhibition of the pathway had an opposite effect and increased the size of the PDGFR-beta⁺ fraction and reduced the proportion of cardiomyocytes (FIGS. 5F and 5H). Molecular analyses showed that both FHF- and aSHF-derived cardiomyocytes expressed the ventricular cardiomyocyte markers IRX4 and MYL2, whereas the cells generated from the pSHF progenitors expressed the atrial marker NR2F2 (FIG. 51). As expected from the flow cytometry analyses (FIGS. 5F and 5G), treatment of the aSHF cells with LDN resulted in a decrease in expression of the ventricular cardiomyocyte markers IRX4 and MY1.2 and elevated levels of PDGFRB (FIG. 51). Taken together, these findings show that the 3 different progenitors have cardiogenic potential and that the FHF and aSHF generate ventricular cells, whereas the pSHF gives rise to atrial cells. Additionally, they demonstrate that the generation of cardiomyocytes from the aSHF progenitors is dependent on BMP signaling.

Example 16—Transcriptional Profiles of Cardiomyocytes Generated from hPSC-Derived FHF, aSHF and pSHF Progenitors

ScRNA-seq analyses of the day 20 cardiomyocyte populations generated from the FHF, aSHF and pSHF progenitors revealed developmental trajectories similar to those described in the mouse. Analyses of the clusters that express TNNT2 showed that the FHF progenitors gave rise to MYL2⁻HAND1^highIRX1^low LVCMs as well as to a population that displayed a gene signature of AVCCMs (MYL2⁺BMP2^highTBX2^highMSX2^high). The population derived from the aSHF progenitors contained a MYL2⁺HAND1⁻IRX1^high RVCM cluster as well as a MYL2^lowHAND2⁺SEMA3C⁺ OFTCM cluster. The pSHF progenitors gave rise to NR2F2⁺TBX18⁻CAV1⁺NKX2-5⁺ ACMs and a SVCM/IFT cluster identified as a NR2F2⁺TBX18⁺CAV1⁻NKX2-5⁻ population (FIGS. 6A and 6B). In contrast to findings from mouse studies, ACMs were not detected in the hPSC FHF-derived population.

The data from the hPSC-derived cardiomyocytes was compared to published mouse E9.25 heart data (FIG. 12A) to identify conserved lineage-specific gene expression patterns for each of the CM subtypes. For these analyses, myocardium subtypes derived from the same heart field lineage were compared including ACM vs. SVCM (pSHF), RVCM vs. OFTCM (aSHF) and AVCCM vs. LVCM (FHF). Additionally, the putative LVCM and RVCM populations were compared. Analysis of the aSHF derivatives identified 112 RVCM markers (NPPB, MY1.2, PIN, IRX1 and others) and 153 OFTCM markers (CFC1, FHL1, SEMA3C and others) that are shared by humans and mice (FIG. 6C and Appendix C). GO analysis of these RVCM and OFT markers indicated that OFTCMs express elevated levels of genes related to outflow tract morphogenesis as well as those associated with transforming growth factor beta (TGF-β) production and responsiveness to TGF-beta. The link to a TGF-beta signaling is relevant as this pathway plays a pivotal role in endocardial cushion formation in the OFT region (FIG. 6D). As expected, RVCMs are enriched for genes associated with VCM development and functions including ventricle morphogenesis, sarcomere organization and muscle contraction (FIG. 6D). The comparison between mouse and hPSC-derived ACMs and SVCMs revealed 217 conserved ACM and 322 SVCM markers (FIG. 12B and Appendix C). This list includes previously reported mouse ACM (NPPA, KCNJ5 and NKX2-5) and SVCM markers (TBX18 and SFRP5) as well as genes that have not been shown to display differential expression between these populations (FIG. 12B and Appendix C). GO analysis indicated that ACMs express genes involved in cardiac muscle contraction and chamber morphogenesis, whereas SVCMs are enriched for axonogenesis and synapsis related genes (FIG. 12C). Analysis of the FHF derivatives identified 203 AVCCM and 144 LVCM conserved markers (FIG. 12E and Appendix C). GO analysis showed that LVCMs express genes involved in translation and transcription, whereas the AVCCMs express genes associated with endocardial cushion formation, septum development, cardiac conduction and electrical coupling (FIG. 12F), defining characteristics of AVCCMs. Finally, comparison between LVCMs and RVCMs revealed differential expression of known chamber-specific markers including HAND1 and TBX5 in LVCMs and IRX1, PLN and NPPB in RVCMs (FIG. 6E and Appendix C). This analysis also identified other genes that showed differential expression between the LVCMs and RVCMs. GO analysis based on the 260 LVCM and 127 RVCM markers indicated that RNA processing related genes are highly expressed in LVCMs whereas those associated with calcium signaling are preferentially expressed in RVCMs (FIG. 6F). Lastly, KEGG analyses of hPSC-derived RVCMs, OFTCMs and LVCMs demonstrated that the RVCMs are enriched for ARVC-associated genes, an assignment consistent with that of the day 3 aSHF mesoderm and further supports the interpretation that this population represent RVCMs (FIG. 12G).

To further verify the expression patterns of these genes, RT-qPCR and immunostaining analyses were carried out on the different CM subpopulations. As shown in FIGS. 6G and 6H, LV (FIG. 6H) and RV (FIG. 6G) genes identified in the above analyses showed differential expression between the FHF and aSHF-derived ventricular cardiomyocytes, strongly suggesting that they represent LV and RV cardiomyocytes respectively. Additionally, ACM and SV markers including TBX18, HOTAIRM1 and NR2F2 were highly expressed in the pSHF day 20 culture (FIG. 12D). Immunostaining analyses supported this lineage assignment, and showed that the FHF-derived cells expressed higher levels of HAND1, TBX5 and GJA1 protein than those generated from the aSHF progenitors; in contrast, the aSHF derivatives expressed higher levels of IRX1 (FIGS. 6I, 12H and 12I). HEY2, a compact ventricular myocyte marker, is only expressed in the FHF and aSHF derivatives (FIG. 12H).

To determine if these in vitro generated cardiomyocytes have similar molecular profiles to those in the human heart, the data from the day 20 hPSC-derived populations was integrated with a published human fetal heart dataset (Cui et al., 2019, Cell Rep., 26:1934-50) (FIG. 7A). This analysis revealed significant overlap between hPSC-derived VCMs and fetal VCMs, hPSC-derived ACMs and fetal ACMs and hPSC-derived mesenchyme and fetal valvular cells (FIG. 7A). The overlapping VCMs (NKX2-5⁺TNNT2⁺MYL2⁺) and pSHF CMs (TNNT2⁺NR2F2⁺) formed three distinct clusters 0, 1 and 3 (FIGS. 7A and 7B). Cluster 0 consists primarily of fetal and hPSC-derived ACMs, whereas clusters 1 and 3 represent fetal VCMs and hPSC-derived AVCCMs, LVCMs, OFTCMs and RVCMs (FIG. 7C). Correlation analysis of the cells in these three clusters confirmed transcriptional similarities between the hPSC-derived and fetal heart ACMs and VCMs (FIG. 7D).

Example 17—Pseudotime Analyses of FHF, aSHE, and pSHF Development

Having characterized the transcriptomic profiles of mesoderm, late mesoderm, progenitor, and cardiomyocytes derived from FHF, aSHF, and pSHF lineages, we next sought to characterize the gene expression dynamics as the cells transition through developmental stages by performing pseudotime inference for the annotated clusters that encompass a broad spectrum of cardiac lineages (FIGS. 13A and 7E). As expected, day 3 mesoderm occupies the earliest pseudotime, followed by day 4 late mesoderm and day 6 progenitors, and subsequently day 20 CMs. Notably, the cells from the different heart fields form complimentary trajectories representing FHF, aSHF and pSHF lineage development (FIGS. 7E, 13B, 13D and 13F). It was next investigated whether the in-silico trajectories captured known lineage- and stage-specific gene expression dynamics by analyzing the upregulated gene modules of all the cell types throughout differentiation. These analyses identified distinct gene modules as signatures of cells of different stages and lineages (FIGS. 13C, 13E and 13G). For example, module 6, the aggregate of genes enriched in the aSHF mesoderm, is comprised of MESP1 and aSHF mesoderm markers including FOXC1, CXCR4 and TWIST1; similarly, the modules corresponding to aSHF progenitors and myocytes consist of aSHF progenitor markers (SIX1, FOXC2, TBX1, FGF10 and FGF8) and aSHF-derived myocyte markers (IRX1, MYOZ1, SEMA3C, MYL2 and others) (FIG. 13E). Similar gene expression dynamics was observed in the FHF and pSHF trajectories (FIGS. 13C and 13G).

Example 18—Development of the FHF, aSHF and pSHF Lineages from the HES3 Line

To determine if the approach for modeling FHF, aSHF, and pSHF development is applicable to other hPSC lines, the development of these lineages was investigated in populations generated from HES3-NKX2-5eGFP/w hESCs. Titration of BMP4 and Activin A concentrations between days 1 and 3 of differentiation revealed that 15B8A was optimal to induce a population that expressed FHF mesoderm markers, whereas 3B1A induced a mesoderm that expressed pSHF and aSHF genes (FIG. 14A). Flow cytometric analyses of the day 4 populations showed patterns almost identical to those observed with the HES2 cells. The majority of the FHF PDGFR-alpha⁺ population was CD235a/b⁺ and CXCR4^−/low ALDH⁻, whereas the SHF PDGFR-alpha⁺ population contained CXCR4⁺ALDH⁻ and CXCR4⁻ALDH⁺ fractions (FIGS. 14B and 14C). When isolated and cultured for 24 hours, the FHF mesoderm gave rise to cells that expressed markers indicative of FHF progenitors, whereas the CXCR4⁺ ALDH⁻ and CXCR4⁻ALDH⁺ fractions generated progeny that expressed genes indicative of aSHF and pSHF progenitors, respectively (FIG. 14D). Further culture of the FHF, aSHF and pSHF progenitors resulted in the development of cardiomyocytes from each population. Molecular analyses of the day 20 cardiomyocyte populations showed that those generated from the FHF progenitors expressed genes indicative of LVCM development, those from the aSHF progenitors expressed RVCM markers and those from the pSHF progenitors showed a profile indicative of ACM and SVCM (FIG. 14E). Collectively, these findings indicate that the strategy developed to model the development of FHF, aSHF and pSHF lineages can be translated to other hPSC lines.

It is to be understood that, while the methods and compositions of matter have been described herein in conjunction with a number of different aspects, the foregoing description of the various aspects is intended to illustrate and not limit the scope of the methods and compositions of matter. Other aspects, advantages, and modifications are within the scope of the following claims.

Disclosed are methods and compositions that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed methods and compositions. These and other materials are disclosed herein, and it is understood that combinations, subsets, interactions, groups, etc. of these methods and compositions are disclosed. That is, while specific reference to each various individual and collective combinations and permutations of these compositions and methods may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular composition of matter or a particular method is disclosed and discussed and a number of compositions or methods are discussed, each and every combination and permutation of the compositions and the methods are specifically contemplated unless specifically indicated to the contrary. Likewise, any subset or combination of these is also specifically contemplated and disclosed.

gene	cell type	p_val_adj	gene	cell type	p_val_adj	gene	cell type	p_val_adj
CER1	FHF_mesoderm	0	PHLDA1	aSHF_mesoderm	1.07E−299	CDX2	pSHF_mesoderm	0
CYP26A1	FHF_mesoderm	0	CRABP2	aSHF_mesoderm	6.29E−257	POU5F1	pSHF_mesoderm	0

LHX1	FHF_mesoderm	0	COLEC12	aSHF_mesoderm	1.47E−173	UCHL1	pSHF_mesoderm	1.72E−297
TDGF1	FHF_mesoderm	0	FBN2	aSHF_mesoderm	4.86E−132	GAL	pSHF_mesoderm	1.23E−279
NPC2	FHF_mesoderm	0	CDK6	aSHF_mesoderm	1.28E−116	RSPO3	pSHF_mesoderm	1.06E−266
TAOK3	FHF_mesoderm	0	AHNAK	aSHF_mesoderm	6.13E−116	CSRP2	pSHF_mesoderm	1.36E−243
L1TD1	FHF_mesoderm	0	SFRP1	aSHF_mesoderm	3.88E−96	TBXT	pSHF_mesoderm	1.39E−241
GYPB	FHF_mesoderm	2.75E−301	IRX1	aSHF_mesoderm	5.01E−84	GPC3	pSHF_mesoderm	1.60E−235
GYPE	FHF_mesoderm	5.04E−288	MN1	aSHF_mesoderm	1.67E−63	HES7	pSHF_mesoderm	4.16E−235
LRRC2	FHF_mesoderm	1.80E−284	JCAD	aSHF_mesoderm	3.57E−63	LMO4	pSHF_mesoderm	6.33E−222
GATA6	FHF_mesoderm	1.78E−260	CXCR4	aSHF_mesoderm	4.18E−60	PRICKLE1	pSHF_mesoderm	4.95E−214
FGF17	FHF_mesoderm	1.91E−238	GREB1L	aSHF_mesoderm	5.39E−56	WNT3A	pSHF_mesoderm	1.06E−199
COBLL1	FHF_mesoderm	5.79E−229	JAG1	aSHF_mesoderm	1.37E−54	TBX6	pSHF_mesoderm	1.71E−195
GSC	FHF_mesoderm	4.19E−211	SIX1	aSHF_mesoderm	7.69E−49	RBP11	pSHF_mesoderm	1.80E−195
ATP6V1B2	FHF_mesoderm	6.27E−210	SH3KBP1	aSHF_mesoderm	7.12E−47	WNT8A	pSHF_mesoderm	2.39E−184
LZTS1	FHF_mesoderm	1.64E−209	PCDH171	aSHF_mesoderm	8.48E−47	HOXA1	pSHF_mesoderm	6.67E−183
BMP2	FHF_mesoderm	3.22E−199	RUNX1T1	aSHF_mesoderm	3.79E−45	DCLK1	pSHF_mesoderm	2.89E−177
DAAM1	FHF_mesoderm	1.70E−198	ANPEP	aSHF_mesoderm	7.04E−41	IFITM3	pSHF_mesoderm	1.51E−165
APOC1	FHF_mesoderm	8.16E−195	PDGFRA	aSHF_mesoderm	3.15E−40	CITED2	pSHF_mesoderm	9.33E−165
EOMES	FHF_mesoderm	3.60E−189	PGF	aSHF_mesoderm	5.52E−38	FOXH1	pSHF_mesoderm	2.64E−160
HLX	FHF_mesoderm	1.06E−173	IGSF3	aSHF_mesoderm	8.01E−36	FGF4	pSHF_mesoderm	2.52E−153
OTX2	FHF_mesoderm	4.74E−160	PAPPA	aSHF_mesoderm	3.93E−33	ALDH1A2	pSHF_mesoderm	1.08E−151
UPP1	FHF_mesoderm	6.23E−156	ADD3	aSHF_mesoderm	3.23E−32	IFITM2	pSHF_mesoderm	1.86E−147
FAM89A	FHF_mesoderm	9.25E−149	RCN1	aSHF_mesoderm	8.69E−30	CTBP21	pSHF_mesoderm	1.24E−141
APOA2	FHF_mesoderm	3.43E−148	PITX1	aSHF_mesoderm	3.61E−29	CCND2	pSHF_mesoderm	3.06E−137
PDHA1	FHF_mesoderm	4.99E−139	ITGA9	aSHF_mesoderm	6.36E−29	CNTFR1	pSHF_mesoderm	1.88E−126
PLCXD3	FHF_mesoderm	1.74E−128	CHRNA3	aSHF_mesoderm	3.28E−27	EFEMP1	pSHF_mesoderm	9.45E−113
ABCD4	FHF_mesoderm	4.11E−126	ANTXR2	aSHF_mesoderm	8.16E−26	DLL11	pSHF_mesoderm	2.15E−104
NPM3	FHF_mesoderm	2.52E−109	IRX3	aSHF_mesoderm	1.69E−25	DDX58	pSHF_mesoderm	4.68E−103
AATF	FHF_mesoderm	6.88E−100	TMEM88	aSHF_mesoderm	2.89E−25	MEST	pSHF_mesoderm	1.02E−102
KAZN	FHF_mesoderm	1.11E−98	CREG1	aSHF_mesoderm	1.90E−24	ARL4C1	pSHF_mesoderm	1.87E−101
VRTN	FHF_mesoderm	5.98E−94	FLNC	aSHF_mesoderm	1.35E−23	STMN1	pSHF_mesoderm	3.57E−101
MYC	FHF_mesoderm	2.26E−91	TMEM51	aSHF_mesoderm	2.31E−23	HMGB3	pSHF_mesoderm	5.96E−96
PMEPA1	FHF_mesoderm	8.52E−82	RND3	aSHF_mesoderm	3.25E−23	GRM4	pSHF_mesoderm	5.81E−94
CKB	FHF_mesoderm	2.98E−79	EFNB1	aSHF_mesoderm	5.63E−23	SEPHS1	pSHF_mesoderm	3.68E−93
YBX3	FHF_mesoderm	1.39E−70	SQLE	aSHF_mesoderm	2.30E−22	LIMCH1	pSHF_mesoderm	1.01E−87
LDB2	FHF_mesoderm	6.07E−70	SOX9	aSHF_mesoderm	2.41E−22	AP3B2	pSHF_mesoderm	1.90E−82
ELMO1	FHF_mesoderm	1.86E−68	CALU	aSHF_mesoderm	3.86E−22	PCLAF	pSHF_mesoderm	3.59E−82
TUBB4B	FHF_mesoderm	3.21E−66	RPP25	aSHF_mesoderm	2.71E−17	LARP7	pSHF_mesoderm	3.43E−79
VDAC2	FHF_mesoderm	2.12E−65	KDELR1	aSHF_mesoderm	9.82E−16	HMGA1	pSHF_mesoderm	1.10E−73
TGFB1	FHF_mesoderm	1.60E−53	CAP2	aSHF_mesoderm	2.22E−15	SHROOM3	pSHF_mesoderm	4.32E−73
GATA4	FHF_mesoderm	8.94E−52	COTL1	aSHF_mesoderm	2.74E−15	HAPLN3	pSHF_mesoderm	7.61E−71
MIXL1	FHF_mesoderm	9.48E−52	BRI3	aSHF_mesoderm	3.87E−15	LEF11	pSHF_mesoderm	1.09E−68
PIK3R1	FHF_mesoderm	1.63E−51	NEO1	aSHF_mesoderm	4.00E−15	TMEM59L	pSHF_mesoderm	2.70E−68
DIAPH2	FHF_mesoderm	8.48E−51	BNIP3	aSHF_mesoderm	5.43E−15	MTCL1	pSHF_mesoderm	1.71E−66
RRBP1	FHF_mesoderm	1.24E−48	ROBO1	aSHF_mesoderm	2.09E−13	KIF5C1	pSHF_mesoderm	9.58E−64
OST4	FHF_mesoderm	1.85E−45	CLU	aSHF_mesoderm	2.29E−13	MFGE8	pSHF_mesoderm	2.46E−61
ELL2	FHF_mesoderm	5.40E−43	CASP6	aSHF_mesoderm	4.05E−10	FN1	pSHF_mesoderm	3.35E−60
PLEKHA6	FHF_mesoderm	6.23E−42	JUN	aSHF_mesoderm	4.09E−09	SEMA6A	pSHF_mesoderm	2.04E−57
SLC35A3	FHF_mesoderm	2.21E−39	SNX24	aSHF_mesoderm	7.89E−09	TCF7	pSHF_mesoderm	2.78E−57
PA2G4	FHF_mesoderm	2.09E−38	SERINC3	aSHF_mesoderm	1.16E−08	TPM1	pSHF_mesoderm	3.52E−57
LIFR	FHF_mesoderm	2.65E−38	SERINC5	aSHF_mesoderm	1.51E−08	PSAT1	pSHF_mesoderm	7.48E−57
BCAT2	FHF_mesoderm	5.54E−37	SLC16A1	aSHF_mesoderm	2.31E−08	CENPW	pSHF_mesoderm	9.96E−57
BBX	FHF_mesoderm	1.96E−34	CNN3	aSHF_mesoderm	4.88E−07	PHC2	pSHF_mesoderm	4.96E−55
HAS2	FHF_mesoderm	1.38E−32	PLIN3	aSHF_mesoderm	1.25E−06	JAKMIP2	pSHF_mesoderm	1.29E−51
STK26	FHF_mesoderm	1.65E−30	ZNF462	aSHF_mesoderm	4.03E−06	GALNT1	pSHF_mesoderm	8.67E−48
CYCS	FHF_mesoderm	1.34E−29	SLC16A3	aSHF_mesoderm	1.77E−05	CCDC160	pSHF_mesoderm	2.21E−47
CHCHD10	FHF_mesoderm	1.32E−28	ASPH	aSHF_mesoderm	0.0003907	ACTC1	pSHF_mesoderm	2.72E−47
MDN1	FHF_mesoderm	4.82E−26	CECR2	aSHF_mesoderm	0.0043529	IFITM1	pSHF_mesoderm	5.68E−47
EIF4A1	FHF_mesoderm	1.16E−25	CTNNB1	aSHF_mesoderm	0.005793	NSG1	pSHF_mesoderm	2.09E−44
KIF16B	FHF_mesoderm	1.47E−25				DPYSL21	pSHF_mesoderm	3.74E−44
ZC3HAV1	FHF_mesoderm	1.62E−25				PIMREG	pSHF_mesoderm	9.39E−44
TRMT10C	FHF_mesoderm	4.21E−25				STT3B	pSHF_mesoderm	2.05E−42
RUNX1	FHF_mesoderm	7.08E−25				FABP7	pSHF_mesoderm	1.84E−41
APC	FHF_mesoderm	6.36E−24				HOXB1	pSHF_mesoderm	3.27E−41
LGR5	FHF_mesoderm	1.09E−23				FSTL1	pSHF_mesoderm	2.48E−39
UQCRQ	FHF_mesoderm	1.28E−23				MAGI1	pSHF_mesoderm	4.20E−39
MT-ND5	FHF_mesoderm	9.15E−23				PTK7	pSHF_mesoderm	7.46E−39
CXCL12	FHF_mesoderm	2.28E−21				ODC1	pSHF_mesoderm	9.00E−39
ATF7IP2	FHF_mesoderm	3.02E−21				PBX1	pSHF_mesoderm	3.62E−38
ZCCHC18	FHF_mesoderm	3.89E−19				EPHA1	pSHF_mesoderm	5.58E−38
SOCS2	FHF_mesoderm	7.58E−19				GABBR1	pSHF_mesoderm	3.11E−37
EIF3J	FHF_mesoderm	1.29E−18				STXBP6	pSHF_mesoderm	3.20E−37
ABHD4	FHF_mesoderm	1.87E−18				ITGB5	pSHF_mesoderm	1.11E−36
DLC1	FHF_mesoderm	2.70E−18				ZNF423	pSHF_mesoderm	7.12E−36
L1CAM	FHF_mesoderm	1.74E−17				CHD71	pSHF_mesoderm	1.01E−35
SPINT2	FHF_mesoderm	5.94E−17				CITED1	pSHF_mesoderm	2.56E−34
TMCO1	FHF_mesoderm	2.76E−16				WIPF3	pSHF_mesoderm	2.71E−34
JAKMIP1	FHF_mesoderm	2.88E−16				PCDH191	pSHF_mesoderm	4.03E−34
TIPARP	FHF_mesoderm	1.76E−15				PTPRK	pSHF_mesoderm	6.10E−34
ALDH2	FHF_mesoderm	5.30E−15				PHLDA2	pSHF_mesoderm	1.40E−33
CHSY1	FHF_mesoderm	7.91E−15				HVCN11	pSHF_mesoderm	3.24E−33
TRAPPC4	FHF_mesoderm	4.63E−14				TCEAL3	pSHF_mesoderm	3.63E−33
TRIP10	FHF_mesoderm	2.91E−12				ALDH3A2	pSHF_mesoderm	4.48E−33
SEC11C	FHF_mesoderm	5.55E−12				MEIS21	pSHF_mesoderm	7.67E−33
IMPDH2	FHF_mesoderm	5.72E−12				NAV2	pSHF_mesoderm	3.64E−32
PAIP2	FHF_mesoderm	6.50E−11				TCEAL8	pSHF_mesoderm	1.04E−31
AKAP13	FHF_mesoderm	6.68E−11				TSPAN18	pSHF_mesoderm	2.22E−31
AGPAT2	FHF_mesoderm	1.55E−10				FGFR11	pSHF_mesoderm	1.08E−30
ZNHIT3	FHF_mesoderm	6.48E−10				RAP2B	pSHF_mesoderm	2.65E−30
CCNDBP1	FHF_mesoderm	2.33E−09				C12orf75	pSHF_mesoderm	1.38E−29
CERS4	FHF_mesoderm	2.39E−09				CRMP1	pSHF_mesoderm	1.93E−29
GTPBP4	FHF_mesoderm	7.55E−09				GNAS	pSHF_mesoderm	2.70E−29
ABHD14A	FHF_mesoderm	3.21E−07				HMGN5	pSHF_mesoderm	4.10E−29
BRIX1	FHF_mesoderm	5.68E−07				MAPRE2	pSHF_mesoderm	4.43E−29
CDC40	FHF_mesoderm	9.18E−07				RDH10	pSHF_mesoderm	4.48E−29
GPATCH4	FHF_mesoderm	2.38E−06				IVNS1ABP	pSHF_mesoderm	7.68E−29
RNMT	FHF_mesoderm	3.41E−06				AMOTL2	pSHF_mesoderm	8.52E−29
RREB1	FHF_mesoderm	4.73E−06				NUDT11	pSHF_mesoderm	1.02E−28
CBR1	FHF_mesoderm	7.38E−06				VASH2	pSHF_mesoderm	2.33E−28
UCHL3	FHF_mesoderm	1.15E−05				YWHAQ	pSHF_mesoderm	6.41E−28
MYO10	FHF_mesoderm	1.90E−05				SDC1	pSHF_mesoderm	1.27E−27
IFRD2	FHF_mesoderm	3.13E−05				MELK	pSHF_mesoderm	1.33E−27
ARID4B	FHF_mesoderm	0.0004734				FHL1	pSHF_mesoderm	3.29E−26
PDCD11	FHF_mesoderm	0.0006255				GORASP21	pSHF_mesoderm	4.10E−26
						FOXM1	pSHF_mesoderm	4.26E−26
						IGFBP4	pSHF_mesoderm	4.56E−26
						CRABP11	pSHF_mesoderm	7.76E−26
						IRAK1BP1	pSHF_mesoderm	1.65E−25
						PRMT6	pSHF_mesoderm	2.04E−24
						DDR1	pSHF_mesoderm	8.19E−24
						LHFPL6	pSHF_mesoderm	1.27E−23
						LRP1	pSHF_mesoderm	2.75E−23
						ING2	pSHF_mesoderm	5.46E−23
						RCN21	pSHF_mesoderm	6.15E−23
						GABARAPL	pSHF_mesoderm	7.98E−23
						PSMC5	pSHF_mesoderm	3.03E−22
						PARP1	pSHF_mesoderm	3.15E−22
						DMKN1	pSHF_mesoderm	4.83E−22
						ZCRB11	pSHF_mesoderm	5.09E−22
						LSM6	pSHF_mesoderm	5.53E−22
						ETV4	pSHF_mesoderm	1.07E−21
						NOVA1	pSHF_mesoderm	1.44E−21
						POLA2	pSHF_mesoderm	3.61E−21
						LFNG	pSHF_mesoderm	3.93E−21
						TCEAL5	pSHF_mesoderm	6.84E−21
						CRISPLD1	pSHF_mesoderm	1.08E−20
						USP18	pSHF_mesoderm	2.50E−20
						FGF31	pSHF_mesoderm	6.81E−20
						YWHAB	pSHF_mesoderm	8.04E−20
						SPRED2	pSHF_mesoderm	8.73E−20
						TRMT11	pSHF_mesoderm	1.32E−19
						MMP21	pSHF_mesoderm	1.63E−19
						PDLIM5	pSHF_mesoderm	4.72E−19
						CHCHD7	pSHF_mesoderm	6.57E−19
						OAT	pSHF_mesoderm	1.27E−18
						GINS4	pSHF_mesoderm	2.08E−18
						LIG1	pSHF_mesoderm	8.89E−18
						TACC21	pSHF_mesoderm	1.96E−17
						RAI14	pSHF_mesoderm	2.30E−17
						RGS10	pSHF_mesoderm	2.49E−17
						CASP3	pSHF_mesoderm	3.93E−17
						SS18L2	pSHF_mesoderm	7.43E−17
						FEN1	pSHF_mesoderm	9.27E−17
						MCM7	pSHF_mesoderm	1.16E−16
						UHRF1	pSHF_mesoderm	1.32E−16
						LHPP	pSHF_mesoderm	1.56E−16
						KLF131	pSHF_mesoderm	1.77E−16
						METTL91	pSHF_mesoderm	1.97E−16
						SMARCD2	pSHF_mesoderm	3.47E−16
						HDGFL3	pSHF_mesoderm	3.60E−16
						NDRG3	pSHF_mesoderm	3.95E−16
						CLIC4	pSHF_mesoderm	7.97E−16
						DYNC1LI1	pSHF_mesoderm	8.54E−16
						PAFAH1B3	pSHF_mesoderm	1.04E−15
						ABCD3	pSHF_mesoderm	2.01E−15
						PREP	pSHF_mesoderm	2.12E−15
						CHAF1B	pSHF_mesoderm	2.64E−15
						FUBP11	pSHF_mesoderm	4.88E−15
						C8orf76	pSHF_mesoderm	5.03E−15
						GPX8	pSHF_mesoderm	7.57E−15
						SCAP	pSHF_mesoderm	9.34E−15
						LPP	pSHF_mesoderm	1.15E−14
						DIXDC1	pSHF_mesoderm	1.65E−14
						NSD2	pSHF_mesoderm	1.18E−13
						ADGRA3	pSHF_mesoderm	1.87E−13
						DUSP12	pSHF_mesoderm	2.15E−13
						PSMG4	pSHF_mesoderm	2.94E−13
						TM7SF3	pSHF_mesoderm	4.16E−13
						CAPN2	pSHF_mesoderm	8.21E−13
						ALDH18A1	pSHF_mesoderm	1.06E−12
						BCAT1	pSHF_mesoderm	1.27E−12
						FST1	pSHF_mesoderm	1.28E−12
						DPH6	pSHF_mesoderm	1.76E−12
						HEBP2	pSHF_mesoderm	3.05E−12
						MMD	pSHF_mesoderm	3.41E−12
						PPP2R5E	pSHF_mesoderm	4.07E−12
						KLHL42	pSHF_mesoderm	6.51E−12
						DLL31	pSHF_mesoderm	7.26E−12
						ARMCX2	pSHF_mesoderm	1.50E−11
						GPX3	pSHF_mesoderm	2.03E−11
						FOXN3	pSHF_mesoderm	2.44E−11
						DPP3	pSHF_mesoderm	2.55E−11
						TM9SF4	pSHF_mesoderm	2.56E−11
						SBK1	pSHF_mesoderm	4.09E−11
						AP3M2	pSHF_mesoderm	5.26E−11
						B3GAT3	pSHF_mesoderm	7.71E−11
						RECQL	pSHF_mesoderm	8.36E−11
						SUV39H2	pSHF_mesoderm	9.04E−11
						FLRT3	pSHF_mesoderm	9.47E−11
						DCTPP1	pSHF_mesoderm	9.69E−11
						CDCA3	pSHF_mesoderm	1.34E−10
						HPF1	pSHF_mesoderm	1.39E−10
						RAB8B	pSHF_mesoderm	2.89E−10
						ZDHHC6	pSHF_mesoderm	1.41E−09
						ARL2BP	pSHF_mesoderm	2.36E−09
						COIL	pSHF_mesoderm	2.61E−09
						C18orf21	pSHF_mesoderm	3.29E−09
						ZYX	pSHF_mesoderm	3.67E−09
						AKR1B1	pSHF_mesoderm	4.31E−09
						SALL2	pSHF_mesoderm	6.19E−09
						CBX11	pSHF_mesoderm	6.25E−09
						ANXA11	pSHF_mesoderm	1.38E−08
						GOLPH3	pSHF_mesoderm	1.47E−08
						NDUFAF4	pSHF_mesoderm	1.48E−08
						RNF167	pSHF_mesoderm	3.00E−08
						FXN	pSHF_mesoderm	3.02E−08
						RAB10	pSHF_mesoderm	3.78E−08
						RNF26	pSHF_mesoderm	7.49E−08
						TP53111	pSHF_mesoderm	1.06E−07
						MRPS61	pSHF_mesoderm	1.18E−07
						COL13A11	pSHF_mesoderm	1.69E−07
						SUMO3	pSHF_mesoderm	3.87E−07
						FBXO21	pSHF_mesoderm	6.06E−07
						UBE2D1	pSHF_mesoderm	7.16E−07
						PNP1	pSHF_mesoderm	7.54E−07
						B2M	pSHF_mesoderm	8.16E−05
						BEX2	pSHF_mesoderm	0.000123
						SP51	pSHF_mesoderm	0.001251
gene	cell type	p_val_adj	gene	cell type	p_val_adj	gene	cell type	p_val_adj
CCDC80	FHF_progenitor	0	HAPLN1	aSHF_progenitor	0	NR2F1	pSHF_progenitor	0
TNNI1	FHF_progenitor	0	JAG1	aSHF_progenitor	0	NR2F2	pSHF_progenitor	0
TNNT2	FHF_progenitor	0	FN1	aSHF_progenitor	0	HOXB1	pSHF_progenitor	0
TNNC1	FHF_progenitor	0	IRX3	aSHF_progenitor	0	CPE	pSHF_progenitor	0
CSRP2	FHF_progenitor	0	VCAN	aSHF_progenitor	0	TUBA1B	pSHF_progenitor	0
TPM1	FHF_progenitor	0	MYOCD	aSHF_progenitor	0	DACH1	pSHF_progenitor	0
KRT8	FHF_progenitor	1.69E−297	RGS5	aSHF_progenitor	0	TUBB	pSHF_progenitor	0
EMP2	FHF_progenitor	6.43E−296	SALL1	aSHF_progenitor	0	CDH2	pSHF_progenitor	0
ACTC1	FHF_progenitor	9.08E−277	TP53111	aSHF_progenitor	0	MEIS3	pSHF_progenitor	0
MYL41	FHF_progenitor	4.14E−271	CDH11	aSHF_progenitor	0	DUSP9	pSHF_progenitor	0
CRIP2	FHF_progenitor	6.02E−248	RPL36A	aSHF_progenitor	0	METRN	pSHF_progenitor	0
S100A10	FHF_progenitor	4.94E−222	RPS21	aSHF_progenitor	0	CYP26A1	pSHF_progenitor	0
FRMD4B	FHF_progenitor	4.08E−220	LAPTM4B	aSHF_progenitor	0	RBMX	pSHF_progenitor	0
BAMBI1	FHF_progenitor	1.85E−202	RPL38	aSHF_progenitor	0	STMN1	pSHF_progenitor	0
CALD11	FHF_progenitor	3.44E−201	CITED2	aSHF_progenitor	0	MARCKSL1	pSHF_progenitor	0

VIM1	FHF_progenitor	1.22E−196	MT-ND3	aSHF_progenitor	0	PBX1	pSHF_progenitor	5.70E−277
SLC1A3	FHF_progenitor	8.62E−150	PDLIM1	aSHF_progenitor	0	CRABP2	pSHF_progenitor	9.31E−262
TMEM881	FHF_progenitor	2.50E−149	FBN2	aSHF_progenitor	0	VEGFC	pSHF_progenitor	1.67E−245
SIPA1L2	FHF_progenitor	2.31E−140	RBM24	aSHF_progenitor	0	ODC1	pSHF_progenitor	3.85E−234
CRYAB	FHF_progenitor	2.25E−126	RPL37	aSHF_progenitor	0	YWHAQ	pSHF_progenitor	1.24E−194
MAB21L2	FHF_progenitor	1.28E−123	MEIS1	aSHF_progenitor	0	HOXA2	pSHF_progenitor	1.27E−179
SOX4	FHF_progenitor	4.60E−116	TOMM7	aSHF_progenitor	0	FZD7	pSHF_progenitor	3.76E−174
UNC45B	FHF_progenitor	5.23E−116	CA2	aSHF_progenitor	0	PPP1R14B	pSHF_progenitor	4.40E−172
CSRP3	FHF_progenitor	2.70E−114	WNT5A	aSHF_progenitor	0	HOXA1	pSHF_progenitor	6.83E−171
NPC2	FHF_progenitor	9.28E−108	ELMO1	aSHF_progenitor	0	PSIP1	pSHF_progenitor	2.37E−157
NID21	FHF_progenitor	5.00E−107	IRX5	aSHF_progenitor	0	HOMER3	pSHF_progenitor	2.27E−152
LBH1	FHF_progenitor	2.47E−106	JARID2	aSHF_progenitor	0	TLE1	pSHF_progenitor	5.01E−150
HAND1	FHF_progenitor	1.22E−102	SEC61G	aSHF_progenitor	0	MAD2L2	pSHF_progenitor	3.71E−149
HCN4	FHF_progenitor	2.38E−101	RPL37A	aSHF_progenitor	0	SKAP2	pSHF_progenitor	6.45E−139
EZR1	FHF_progenitor	4.30E−98	FGF10	aSHF_progenitor	0	COX5A	pSHF_progenitor	2.23E−134
MYL61	FHF_progenitor	5.01E−94	RPL34	aSHF_progenitor	0	HMGB1	pSHF_progenitor	5.95E−108
PPIC1	FHF_progenitor	4.23E−89	IL17RD	aSHF_progenitor	0	UBE2E3	pSHF_progenitor	1.95E−101
AHNAK1	FHF_progenitor	1.17E−88	RPL27A	aSHF_progenitor	0	HMGN1	pSHF_progenitor	5.56E−95
PRDM6	FHF_progenitor	1.39E−82	RPS28	aSHF_progenitor	0	NASP	pSHF_progenitor	7.04E−95
HSPB2	FHF_progenitor	3.07E−81	RPL23	aSHF_progenitor	0	CBX1	pSHF_progenitor	9.03E−91
EIF4EBP1	FHF_progenitor	1.81E−80	RPS15A	aSHF_progenitor	0	SLC25A5	pSHF_progenitor	9.29E−87
SH3BGR	FHF_progenitor	2.28E−80	RPS23	aSHF_progenitor	0	ANP32B	pSHF_progenitor	7.57E−83
TLN2	FHF_progenitor	1.17E−76	RPS26	aSHF_progenitor	0	SSRP1	pSHF_progenitor	1.35E−82
MGARP	FHF_progenitor	5.74E−76	RPL36	aSHF_progenitor	0	TOX3	pSHF_progenitor	2.80E−76
COBLL1	FHF_progenitor	1.12E−75	RPL22	aSHF_progenitor	0	MYEF2	pSHF_progenitor	3.29E−71
TBX5	FHF_progenitor	1.36E−75	RPL30	aSHF_progenitor	0	FUNDC2	pSHF_progenitor	1.49E−66
VCAM1	FHF_progenitor	2.28E−75	RPL35A	aSHF_progenitor	0	BAZ1A	pSHF_progenitor	3.14E−62
ACTA2	FHF_progenitor	1.32E−67	RPS7	aSHF_progenitor	0	ENY2	pSHF_progenitor	5.18E−57
BVES	FHF_progenitor	4.64E−67	NPM3	aSHF_progenitor	2.49E−303	NRIP1	pSHF_progenitor	1.20E−56
BEX11	FHF_progenitor	5.20E−63	ATP5F1E	aSHF_progenitor	2.23E−300	NAA38	pSHF_progenitor	1.84E−54
ATP2B1	FHF_progenitor	5.44E−61	PRDM1	aSHF_progenitor	1.89E−295	NAP1L1	pSHF_progenitor	7.02E−54
GPRC5C1	FHF_progenitor	5.72E−59	APOE	aSHF_progenitor	3.29E−261	CYC1	pSHF_progenitor	1.51E−53
POPDC3	FHF_progenitor	9.45E−59	RPL22L1	aSHF_progenitor	5.79E−259	PHF6	pSHF_progenitor	3.47E−49
IDH21	FHF_progenitor	9.59E−58	SH3KBP1	aSHF_progenitor	1.12E−257	SMARCA5	pSHF_progenitor	3.02E−43
FSCN11	FHF_progenitor	2.91E−57	WLS	aSHF_progenitor	1.62E−256	TEAD2	pSHF_progenitor	2.30E−42
TTN1	FHF_progenitor	3.42E−54	CAP2	aSHF_progenitor	1.18E−253	FOXF1	pSHF_progenitor	1.03E−41
CDKN1C1	FHF_progenitor	7.22E−51	RPS25	aSHF_progenitor	8.90E−253	CCAR1	pSHF_progenitor	8.94E−41
MAGED2	FHF_progenitor	4.47E−49	RPS12	aSHF_progenitor	1.59E−248	TSPAN13	pSHF_progenitor	3.26E−40
SH3BGRL3	FHF_progenitor	4.18E−47	IRX2	aSHF_progenitor	3.26E−247	HNRNPAO	pSHF_progenitor	1.42E−39
CALM21	FHF_progenitor	8.23E−47	RPS27A	aSHF_progenitor	3.42E−247	NDUFS8	pSHF_progenitor	5.27E−30
PLS31	FHF_progenitor	5.16E−46	RPL35	aSHF_progenitor	8.66E−243	CDC20	pSHF_progenitor	5.64E−28
TAGLN1	FHF_progenitor	1.42E−45	NAV1	aSHF_progenitor	1.44E−235	RANBP1	pSHF_progenitor	6.01E−25
NEXN1	FHF_progenitor	4.86E−43	SPRY2	aSHF_progenitor	1.10E−225	SRRM2	pSHF_progenitor	3.96E−24
POPDC2	FHF_progenitor	1.40E−42	DLC1	aSHF_progenitor	3.46E−219	RAB34	pSHF_progenitor	7.37E−24
MDH21	FHF_progenitor	3.81E−42	IFITM3	aSHF_progenitor	1.97E−218	SNRPB	pSHF_progenitor	2.39E−23
PODXL	FHF_progenitor	2.20E−40	RPS13	aSHF_progenitor	3.77E−215	PSMD7	pSHF_progenitor	7.88E−23
FBXO32	FHF_progenitor	7.51E−39	MID1	aSHF_progenitor	2.31E−212	SRSF11	pSHF_progenitor	2.85E−22
P4HA1	FHF_progenitor	2.16E−37	LIFR	aSHF_progenitor	2.72E−211	THYN1	pSHF_progenitor	7.96E−22
SPEG	FHF_progenitor	1.38E−36	DKK1.00	aSHF_progenitor	6.08E−202	HEY1	pSHF_progenitor	5.73E−21
LGALS1	FHF_progenitor	4.09E−36	MEF2C	aSHF_progenitor	2.96E−190	WNT2	pSHF_progenitor	1.55E−19
RHOC1	FHF_progenitor	1.20E−34	NKX2-5	aSHF_progenitor	1.00E−173	ACIN1	pSHF_progenitor	4.14E−19
DPF3	FHF_progenitor	4.57E−32	DAB2	aSHF_progenitor	6.14E−155	NME1	pSHF_progenitor	8.92E−19
CD81	FHF_progenitor	4.05E−31	RPS17	aSHF_progenitor	3.58E−150	CTCF	pSHF_progenitor	1.84E−18
ITM2A	FHF_progenitor	6.41E−31	RPL32	aSHF_progenitor	8.20E−147	PRPF40A	pSHF_progenitor	2.13E−18
PCOLCE1	FHF_progenitor	1.73E−30	FLNA	aSHF_progenitor	2.07E−146	RRM2	pSHF_progenitor	3.01E−17
GLIPR21	FHF_progenitor	1.53E−28	MT-ND2	aSHF_progenitor	2.50E−144	RBM8A	pSHF_progenitor	4.62E−17
BMP21	FHF_progenitor	5.36E−27	FGF8	aSHF_progenitor	1.71E−143	MTF2	pSHF_progenitor	9.73E−17
HOXB41	FHF_progenitor	2.88E−24	UBL5	aSHF_progenitor	5.88E−123	JAK1	pSHF_progenitor	9.88E−17
TBX20	FHF_progenitor	6.56E−23	RPL17	aSHF_progenitor	3.22E−110	HOXB2	pSHF_progenitor	1.51E−16
TMED9	FHF_progenitor	1.53E−21	RPLP2	aSHF_progenitor	7.38E−104	MTCH2	pSHF_progenitor	6.57E−16
DNPEP	FHF_progenitor	1.76E−21	DUSP6	aSHF_progenitor	4.90E−101	TBL1X	pSHF_progenitor	1.58E−15
GNB4	FHF_progenitor	1.41E−20	MYL9	aSHF_progenitor	8.94E−101	C1orf35	pSHF_progenitor	1.60E−15
BCAM1	FHF_progenitor	1.87E−19	RPL11	aSHF_progenitor	4.55E−100	TMPO	pSHF_progenitor	3.72E−14
SMARCD3	FHF_progenitor	2.52E−19	ROMO1	aSHF_progenitor	1.38E−98	CEP57	pSHF_progenitor	1.54E−13
MRPL12	FHF_progenitor	1.19E−18	SALL4	aSHF_progenitor	1.02E−97	HDAC2	pSHF_progenitor	2.85E−13
ANKRD13	FHF_progenitor	1.69E−18	EPHA4	aSHF_progenitor	1.13E−95	ANP32E	pSHF_progenitor	7.10E−13
NRP11	FHF_progenitor	1.36E−17	IRX1	aSHF_progenitor	9.57E−87	MCM7	pSHF_progenitor	7.72E−13
FDPS1	FHF_progenitor	1.74E−17	HAND2	aSHF_progenitor	2.22E−83	SNN	pSHF_progenitor	2.34E−12
BAG3	FHF_progenitor	1.43E−16	MSI2	aSHF_progenitor	5.77E−83	ZNF706	pSHF_progenitor	8.80E−12
ATP1A11	FHF_progenitor	1.93E−16	ACSL3	aSHF_progenitor	8.76E−83	SPSB4	pSHF_progenitor	5.54E−11
ATP5F1B1	FHF_progenitor	2.58E−16	SPRY1	aSHF_progenitor	6.12E−76	NHP2	pSHF_progenitor	3.81E−10
TRAPPC4	FHF_progenitor	1.67E−15	SPRED1	aSHF_progenitor	1.54E−74	CFL2	pSHF_progenitor	2.82E−09
PKP21	FHF_progenitor	1.85E−15	PRTG	aSHF_progenitor	1.17E−73	RBCK1	pSHF_progenitor	5.73E−08
CCND2	FHF_progenitor	3.91E−15	MGST1	aSHF_progenitor	4.38E−72	KIF20A	pSHF_progenitor	1.22E−07
CREB3L1	FHF_progenitor	1.43E−14	ISL1	aSHF_progenitor	1.24E−71	TRIM27	pSHF_progenitor	1.24E−07
CGNL11	FHF_progenitor	1.75E−13	PDLIM7	aSHF_progenitor	5.03E−68	NSMCE2	pSHF_progenitor	5.15E−07
AKR1A11	FHF_progenitor	1.97E−13	BMP7	aSHF_progenitor	1.50E−67	PABPC4	pSHF_progenitor	1.94E−06
CIAPIN11	FHF_progenitor	2.01E−13	COX7B	aSHF_progenitor	1.95E−64	SHISA2	pSHF_progenitor	1.17E−05
ACAA21	FHF_progenitor	2.54E−13	B3GALNT1	aSHF_progenitor	6.29E−64	E2F5	pSHF_progenitor	1.36E−05
COX171	FHF_progenitor	5.53E−13	SIX1	aSHF_progenitor	1.67E−60	C1orf43	pSHF_progenitor	1.39E−05
CMTM71	FHF_progenitor	6.09E−13	FSTL1	aSHF_progenitor	2.82E−59	HSPH1	pSHF_progenitor	1.84E−05
PTH1R1	FHF_progenitor	7.65E−13	LOXL2	aSHF_progenitor	1.14E−58	VEZF1	pSHF_progenitor	1.98E−05
EMILIN21	FHF_progenitor	7.70E−13	PAM	aSHF_progenitor	3.72E−58
PPIB	FHF_progenitor	1.04E−12	RCSD1	aSHF_progenitor	8.81E−54
PIM31	FHF_progenitor	1.34E−12	CTDSPL2	aSHF_progenitor	6.02E−53
LRRFIP11	FHF_progenitor	7.95E−12	MPPED2	aSHF_progenitor	7.07E−53
EIF2B3	FHF_progenitor	1.35E−11	PFN1	aSHF_progenitor	1.36E−52
ANXA61	FHF_progenitor	5.51E−11	TPM2	aSHF_progenitor	1.44E−50
UBC1	FHF_progenitor	7.13E−11	DNMT3B	aSHF_progenitor	1.58E−50
TBCB1	FHF_progenitor	2.25E−10	OGT	aSHF_progenitor	4.78E−47
CALU	FHF_progenitor	3.07E−10	FLNC	aSHF_progenitor	4.22E−44
BTG3	FHF_progenitor	3.64E−10	GNG11	aSHF_progenitor	4.52E−43
ATP2A21	FHF_progenitor	3.93E−10	YWHAZ	aSHF_progenitor	3.58E−40
ADK	FHF_progenitor	6.76E−10	ATP5ME	aSHF_progenitor	8.80E−40
PRR5	FHF_progenitor	7.48E−10	EML4	aSHF_progenitor	2.78E−38
SPARC1	FHF_progenitor	9.88E−10	MT-CO1	aSHF_progenitor	6.52E−38
KLF13	FHF_progenitor	1.13E−09	ACTN1	aSHF_progenitor	1.30E−36
RNH1	FHF_progenitor	2.02E−09	RHOU	aSHF_progenitor	7.72E−30
MSX1	FHF_progenitor	2.31E−09	WDR76	aSHF_progenitor	3.02E−25
ARPC2	FHF_progenitor	2.58E−09	BNIP3	aSHF_progenitor	5.04E−22
PDIA3	FHF_progenitor	2.90E−09	SMS	aSHF_progenitor	1.55E−21
ID3	FHF_progenitor	4.12E−09	TGFB1	aSHF_progenitor	4.89E−18
EIF2S21	FHF_progenitor	7.14E−09	DHX9	aSHF_progenitor	2.11E−17
APBB1	FHF_progenitor	8.63E−09	HIGD1A	aSHF_progenitor	6.81E−17
ERCC11	FHF_progenitor	1.24E−08	VASP	aSHF_progenitor	3.00E−15
IRF2BPL	FHF_progenitor	2.55E−08	PTBP1	aSHF_progenitor	1.51E−10
SH3GLB11	FHF_progenitor	6.26E−08	IFITM2	aSHF_progenitor	4.28E−09
CST31	FHF_progenitor	7.40E−08
CYCS1	FHF_progenitor	8.23E−08
SNRPN1	FHF_progenitor	1.92E−07
P4HB	FHF_progenitor	2.00E−07
POLR2G1	FHF_progenitor	4.95E−07
ATP6VOB	FHF_progenitor	5.51E−07
UBA3	FHF_progenitor	1.16E−06
ARF1	FHF_progenitor	1.80E−06
YIF1B	FHF_progenitor	5.18E−06
DAD1	FHF_progenitor	5.73E−06
ATP1B1	FHF_progenitor	9.49E−06
DYNC1LI1	FHF_progenitor	2.21E−05
PSMD61	FHF_progenitor	2.57E−05
TSPAN4	FHF_progenitor	2.69E−05
MRPS18B	FHF_progenitor	7.02E−05
RBPMS2	FHF_progenitor	7.47E−05
BMP41	FHF_progenitor	9.87E−05
TUBB4B1	FHF_progenitor	0.0001183
RHEB	FHF_progenitor	0.0001978
EFNB3	FHF_progenitor	0.0014556
AK3	FHF_progenitor	0.0038194
HMMR1	FHF_progenitor	0.0361776

gene	cell type	p_val_adj	gene	cell type	p_val_adj
BMP2	AVCCM	2.61E−110	RPL29	LVCM	5.68E−131
ATP1B1	AVCCM	4.01E−96	RPL12	LVCM	3.02E−129
CPNE5	AVCCM	5.80E−85	RPL13	LVCM	3.34E−125
ATP1A1	AVCCM	1.20E−73	RPS14	LVCM	1.32E−110
TNNT2	AVCCM	1.76E−59	RPL18	LVCM	1.35E−105
BAMBI	AVCCM	1.40E−48	RPL18A	LVCM	5.08E−97
STMN1	AVCCM	2.31E−43	RPS8	LVCM	1.48E−96
NDUFA4	AVCCM	3.25E−42	RPL32	LVCM	2.30E−94
TMSB4X	AVCCM	3.97E−40	RPS3	LVCM	8.40E−94
BTG1	AVCCM	5.54E−40	RPS7	LVCM	9.00E−94
FHL2	AVCCM	6.71E−40	RPL15	LVCM	7.05E−91
CRIP2	AVCCM	4.29E−38	RPL11	LVCM	2.10E−90
LTBP1	AVCCM	1.41E−37	RPL3	LVCM	3.83E−90
CHCHD10	AVCCM	1.06E−36	RPL5	LVCM	7.28E−89
RSPO3	AVCCM	6.28E−35	RPL8	LVCM	5.00E−86
SERF2	AVCCM	6.77E−35	RPS12	LVCM	1.39E−84
ASAH1	AVCCM	2.42E−33	RPS6	LVCM	6.84E−84
ATP5F1E	AVCCM	3.68E−32	RPL19	LVCM	1.63E−82
TBX2	AVCCM	6.05E−32	RPS5	LVCM	6.46E−82
PRDX2	AVCCM	3.53E−30	RPS23	LVCM	8.33E−81
ATP5PF	AVCCM	1.35E−27	RPL7	LVCM	4.06E−78
FAM78A	AVCCM	1.91E−26	RPS19	LVCM	3.75E−76
COX6B1	AVCCM	1.03E−25	EEF1B2	LVCM	3.57E−70
DSTN	AVCCM	1.57E−25	RPL6	LVCM	6.22E−70
MTCH1	AVCCM	7.34E−25	HEY2	LVCM	3.65E−69
CACNA1D	AVCCM	1.15E−24	HSP90AB1	LVCM	3.12E−66
MYL9	AVCCM	2.56E−21	NACA	LVCM	3.23E−65
MAGED2	AVCCM	6.53E−21	RPL30	LVCM	4.51E−65
ID4	AVCCM	1.45E−20	RPL13A	LVCM	1.07E−64
TBX3	AVCCM	2.28E−20	RPS9	LVCM	7.77E−64
COX6C	AVCCM	1.75E−18	NPM1	LVCM	1.11E−59
COX7A1	AVCCM	4.11E−18	RPS16	LVCM	3.18E−56
GOLIM4	AVCCM	6.37E−18	RPS15A	LVCM	1.45E−49
FBXO32	AVCCM	9.34E−18	RPL24	LVCM	1.57E−48
BEX4	AVCCM	1.33E−17	RPL35A	LVCM	1.60E−48
LMOD2	AVCCM	1.52E−17	RPS27A	LVCM	1.62E−45
ITM2C	AVCCM	8.81E−17	RPL28	LVCM	5.19E−42
NDUFA11	AVCCM	1.55E−16	BTF3	LVCM	6.29E−42
ATP1B3	AVCCM	1.68E−16	RPSA	LVCM	2.58E−39
B2M	AVCCM	1.94E−16	NAV1	LVCM	1.59E−38
NKX2-5	AVCCM	2.58E−16	RPS15	LVCM	3.78E−37
MGST3	AVCCM	6.72E−16	FABP5	LVCM	6.61E−37
MAP1LC3A	AVCCM	7.02E−16	RPL37	LVCM	2.70E−33
TRDN	AVCCM	1.47E−15	RPL35	LVCM	5.22E−33
WNT2	AVCCM	3.06E−15	RPL37A	LVCM	5.58E−33
CFL1	AVCCM	4.19E−15	RPS11	LVCM	7.63E−33
TLN1	AVCCM	5.52E−15	RPL22	LVCM	1.70E−30
NDUFA1	AVCCM	7.81E−15	RPL34	LVCM	1.65E−29
UBL5	AVCCM	1.40E−14	HMGA1	LVCM	9.10E−29
MRPS6	AVCCM	3.18E−14	RPL21	LVCM	2.36E−28
NDUFA13	AVCCM	1.08E−13	MTUS2	LVCM	2.26E−27
TNNI3	AVCCM	1.35E−13	RPS13	LVCM	6.45E−27
MORF4L1	AVCCM	7.57E−13	RPL23	LVCM	2.39E−26
GSN	AVCCM	2.59E−12	FITM1	LVCM	2.43E−26
ATP5PO	AVCCM	3.57E−12	RPL27A	LVCM	2.17E−23
TMEM50A	AVCCM	3.88E−12	RPL36	LVCM	1.78E−22
TRIM8	AVCCM	4.38E−12	ARHGAP29	LVCM	3.25E−22
NDUFC1	AVCCM	1.10E−11	SERBP1	LVCM	3.74E−22
SLC25A4	AVCCM	2.87E−11	IRX4	LVCM	1.42E−21
TUBA1A	AVCCM	3.01E−11	HAND1	LVCM	8.81E−21
MYL4	AVCCM	3.73E−11	EFNB3	LVCM	3.24E−20
FBLIM1	AVCCM	4.52E−11	XIRP1	LVCM	4.38E−20
ETFB	AVCCM	4.72E−11	RBM3	LVCM	2.04E−18
MYOZ1	AVCCM	5.90E−11	TOMM20	LVCM	6.99E−18
ATP5IF1	AVCCM	9.03E−11	LAMA4	LVCM	2.05E−17
HMOX2	AVCCM	1.05E−10	ANP32B	LVCM	4.71E−17
NDUFA6	AVCCM	1.28E−10	EIF3M	LVCM	5.38E−17
ARMCX3	AVCCM	1.33E−10	RSL1D1	LVCM	9.98E−17
TPGS1	AVCCM	1.41E−10	IMPDH2	LVCM	1.02E−15
PDLIM7	AVCCM	2.34E−10	NAP1L1	LVCM	1.39E−15
RTN4	AVCCM	3.22E−10	FBXL22	LVCM	1.72E−15
MPC2	AVCCM	3.31E−10	EIF3D	LVCM	2.66E−15
FBN2	AVCCM	1.12E−09	EIF4EBP1	LVCM	5.15E−15
ITM2B	AVCCM	1.45E−09	RPS27	LVCM	5.84E−15
CAMTA1	AVCCM	1.69E−09	PCDH7	LVCM	1.20E−14
NDRG2	AVCCM	2.94E−09	APEX1	LVCM	1.73E−14
EID1	AVCCM	3.58E−09	TLN2	LVCM	2.98E−14
NDUFB3	AVCCM	3.64E−09	RPS25	LVCM	1.53E−12
CAPNS1	AVCCM	4.16E−09	ANGPT1	LVCN	1.69E−12
FERMT2	AVCCM	5.39E−09	RPLP2	LVCM	3.08E−12
ANXA6	AVCCM	6.58E−09	SMYD2	LVCM	3.50E−12
GABARAPL2	AVCCM	6.66E−09	EIF3A	LVCM	1.10E−11
MSX2	AVCCM	8.92E−09	TYMS	LVCM	2.99E−10
IGFBP5	AVCCM	9.43E−09	POLR1D	LVCM	4.32E−10
RCAN1	AVCCM	9.90E−09	AHCY	LVCM	5.55E−10
PBXIP1	AVCCM	2.22E−08	CCND2	LVCM	8.06E−10
DBN1	AVCCM	4.50E−08	PHGDH	LVCM	1.38E−09
CLIC1	AVCCM	5.68E−08	EIF4A1	LVCM	1.69E−09
UBB	AVCCM	9.70E−08	IGFBP2	LVCM	6.01E−09
ACAA2	AVCCM	1.14E−07	HSPD1	LVCM	8.68E−09
PDLIM5	AVCCM	1.16E−07	NOB1	LVCM	3.10E−08
MICAL2	AVCCM	1.17E−07	SNRPB	LVCM	4.50E−08
ATP5ME	AVCCM	2.08E−07	NRP1	LVCM	6.56E−08
SPARC	AVCCM	2.31E−07	CCT7	LVCM	2.50E−07
TCEAL8	AVCCM	2.58E−07	TPM4	LVCM	8.28E−07
HOXB2	AVCCM	2.78E−07	PABPC4	LVCM	1.58E−06
SLC39A8	AVCCM	2.96E−07	RAN	LVCM	2.18E−06
CCDC141	AVCCM	3.54E−07	TAF1D	LVCM	2.42E−06
ATP5PD	AVCCM	4.01E−07	CDV3	LVCM	5.13E−06
PTP4A2	AVCCM	8.65E−07	MYH7	LVCM	7.24E−06
CAPZA2	AVCCM	1.03E−06	MIF	LVCM	8.65E−06
DYNLRB1	AVCCM	1.93E−06	CCT4	LVCM	8.88E−06
NFE2L2	AVCCM	2.34E−06	CCT2	LVCM	2.97E−05
CCDC28B	AVCCM	2.41E−06	SMS	LVCM	5.25E−05
MAST4	AVCCM	2.57E−06	TAGLN	LVCM	0.00015247
RABAC1	AVCCM	2.75E−06	C1QBP	LVCM	0.00025991
S100A13	AVCCM	3.00E−06	RBMX	LVCM	0.00028054
ECH1	AVCCM	3.02E−06	MTHFD2	LVCM	0.00029777
RAB14	AVCCM	3.20E−06	BOP1	LVCM	0.00034669
HK1	AVCCM	3.42E−06	EIF3B	LVCM	0.00042155
SQLE	AVCCM	3.52E−06	NOP58	LVCM	0.00051688
PPP1R12A	AVCCM	3.77E−06	TKT	LVCM	0.00063685
DPYSL3	AVCCM	6.37E−06	CCT3	LVCM	0.00069585
GLRX	AVCCM	8.77E−06	GADD45G	LVCM	0.00082898
VDAC3	AVCCM	9.13E−06	LRPPRC	LVCM	0.00134791
ITGB1	AVCCM	1.01E−05	FBL	LVCM	0.00308971
ATP5MF	AVCCM	1.07E−05	WNT5A	LVCM	0.00323285
SLC25A11	AVCCM	1.14E−05	OLA1	LVCM	0.00369838
TBX5	AVCCM	1.31E−05	CHKA	LVCM	0.00505275
BEX2	AVCCM	1.32E−05	EIF2S3	LVCM	0.00511693
COMMD6	AVCCM	1.48E−05	CKS2	LVCM	0.00528231
ATP6VOB	AVCCM	1.71E−05	SMCHD1	LVCM	0.00729422
THRA	AVCCM	1.85E−05	C4orf3	LVCM	0.01194317
CALM2	AVCCM	2.09E−05	SUCLG2	LVCM	0.01242707
PEA15	AVCCM	2.28E−05	C12orf45	LVCM	0.01417031
PGAM2	AVCCM	6.49E−05	CYBA	LVCM	0.01502716
PPP1R3A	AVCCM	7.80E−05	ST13	LVCM	0.01912399
TMA7	AVCCM	7.96E−05	SNRPD1	LVCM	0.0231748
MYH6	AVCCM	8.88E−05	DDX21	LVCM	0.04961646
HADHA	AVCCM	0.000104523
HIPK2	AVCCM	0.000111496
BEX1	AVCCM	0.000174876
PPARGC1A	AVCCM	0.000184801
DUSP6	AVCCM	0.000255731
TRAPPC1	AVCCM	0.000336336
DACT1	AVCCM	0.000349512
ARHGAP1	AVCCM	0.000701187
TGFB2	AVCCM	0.00079094
DRAP1	AVCCM	0.001023401
YWHAB	AVCCM	0.001186618
TCEA3	AVCCM	0.001234083
HSD17B12	AVCCM	0.001361998
REEP5	AVCCM	0.001551709
ATP6AP2	AVCCM	0.001711567
TUBB2A	AVCCM	0.002135619
EPHA7	AVCCM	0.002310982
ASPH	AVCCM	0.002557134
TXLNB	AVCCM	0.005313325
VAMP2	AVCCM	0.007595862
ARL3	AVCCM	0.008788277
NDN	AVCCM	0.009218734
ATOX1	AVCCM	0.010241494
TBCB	AVCCM	0.010435354
TSPAN13	AVCCM	0.01077701
NCOR1	AVCCM	0.012296565
SGCB	AVCCM	0.014526151
TMBIM6	AVCCM	0.014723328
RBFOX2	AVCCM	0.01477042
PJA2	AVCCM	0.014843082
LAMTOR2	AVCCM	0.018881237
TCTA	AVCCM	0.021976205
APOE	AVCCM	0.026199094
BTBD1	AVCCM	0.026347112
RAP2C	AVCCM	0.032323025
ANAPC13	AVCCM	0.0329497
AKR1A1	AVCCM	0.034387841
CTSB	AVCCM	0.036808459
FDPS	AVCCM	0.036990836
GINM1	AVCCM	0.037327226
UBE2L6	AVCCM	0.040574651
TMEM59	AVCCM	0.044081957
SYPL1	AVCCM	0.045149844

	gene	cell type	p_val_adj	gene	cell type	p_val_adj
	CSRP2	OFTCM	1.04E−166	PGK1	RVCM	4.62E−154
	PEG10	OFTCM	2.13E−90	LDHA	RVCM	3.52E−147
	LAPTM4A	OFTCM	7.96E−82	GAPDH	RVCM	1.78E−133
	PLCXD3	OFTCM	4.70E−70	TPI1	RVCM	6.98E−122
	MTUS2	OFTCM	3.55E−65	CSRP3	RVCM	5.56E−120
	ANK3	OFTCM	1.60E−64	PLN	RVCM	6.23E−119
	MYL6	OFTCM	4.57E−63	EPHA4	RVCM	9.30E−115
	VEGFC	OFTCM	2.36E−61	ATP1B1	RVCM	4.36E−107
	HAND2	OFTCM	1.84E−56	GPI	RVCM	1.02E−101
	VCAN	OFTCM	6.57E−54	FHL2	RVCM	2.00E−99
	LAPTM4B	OFTCM	2.63E−52	C1QTNF4	RVCM	4.14E−96
	CFC1	OFTCM	1.14E−47	MYL2	RVCM	2.55E−91
	DUSP1	OFTCM	2.37E−44	MIF	RVCM	8.25E−91
	IFITM3	OFTCM	2.69E−43	LMOD2	RVCM	2.73E−78
	SEMA3C	OFTCM	1.85E−39	CRIP2	RVCM	2.80E−77
	TGFB111	OFTCM	2.22E−38	TRDN	RVCM	3.12E−73
	ID1	OFTCM	5.09E−37	IRX1	RVCM	4.21E−72
	PCDH7	OFTCM	7.63E−35	COX6A2	RVCM	4.35E−69
	SSR3	OFTCM	2.87E−34	LRRC10	RVCM	7.41E−65
	TXN	OFTCM	6.53E−33	TNNI3	RVCM	1.59E−62
	CSRP1	OFTCM	1.63E−32	CHCHD10	RVCM	2.69E−61
	TPM2	OFTCM	1.17E−30	TCAP	RVCM	1.60E−59
	NFIL3	OFTCM	4.66E−29	NPPB	RVCM	1.71E−57
	SGCE	OFTCM	8.22E−26	PFKP	RVCM	1.02E−55
	MEIS2	OFTCM	8.51E−25	HSPB8	RVCM	7.52E−55
	SRSF3	OFTCM	2.11E−24	NPPA	RVCM	1.43E−51
	CPE	OFTCM	7.12E−24	ASPH	RVCM	5.36E−50
	ID3	OFTCM	6.86E−23	IRX2	RVCM	1.22E−49
	RHOA	OFTCM	2.28E−21	ADPRHL1	RVCM	2.83E−41
	OST4	OFTCM	2.56E−21	PDK1	RVCM	3.65E−41
	PRNP	OFTCM	3.91E−21	TFRC	RVCM	1.43E−39
	HMGN1	OFTCM	1.84E−20	DSP	RVCM	7.27E−38
	IFITM2	OFTCM	3.62E−20	MYL3	RVCM	8.58E−37
	OCIAD2	OFTCM	5.84E−20	MT-ND6	RVCM	2.30E−35
	GNG12	OFTCM	4.23E−19	VDAC1	RVCM	3.79E−35
	PIM1	OFTCM	1.70E−18	ALCAM	RVCM	2.14E−34
	IGSF3	OFTCM	1.81E−18	DKK3.00	RVCM	4.90E−32
	TGIF1	OFTCM	9.21E−18	MYH6	RVCM	5.48E−31
	CNN2	OFTCM	2.45E−17	FLNC	RVCM	2.90E−30
	PFN1	OFTCM	1.16E−16	LRRC39	RVCM	3.82E−30
	FZD1	OFTCM	3.61E−16	VDAC2	RVCM	1.44E−29
	TIPARP	OFTCM	5.54E−16	ALDOA	RVCM	3.71E−29
	TAGLN	OFTCM	7.40E−16	HK1	RVCM	4.69E−29
	CDK6	OFTCM	1.37E−15	MYL4	RVCM	1.88E−27
	NRP2	OFTCM	1.61E−15	VEGFB	RVCM	1.31E−25
	DOK4	OFTCM	2.32E−15	COX5B	RVCM	2.44E−24
	NUAK1	OFTCM	2.79E−15	NDUFA4	RVCM	4.39E−23
	B3GALNT1	OFTCM	4.55E−15	PDE4DIP	RVCM	2.25E−22
	TMEM65	OFTCM	4.98E−15	MYBPC3	RVCM	7.66E−21
	ARL2BP	OFTCM	5.86E−15	PDLIM5	RVCM	2.48E−20
	DYNLL1	OFTCM	8.31E−15	ATP5PO	RVCM	3.88E−19
	OSTC	OFTCM	1.17E−14	BSG	RVCM	6.22E−19
	SRSF7	OFTCM	2.39E−14	SYNPO2L	RVCM	6.41E−19
	WNT5A	OFTCM	1.44E−13	MYH7	RVCM	3.24E−18
	SFPQ	OFTCM	2.59E−13	ATP5PF	RVCM	1.14E−16
	TENM3	OFTCM	3.11E−13	DUSP10	RVCM	3.95E−16
	HAND1	OFTCM	4.67E−13	GAMT	RVCM	3.66E−15
	RCN1	OFTCM	5.64E−13	NDUFB4	RVCM	4.39E−15
	MPHOSPH6	OFTCM	6.73E−13	TTN	RVCM	1.61E−14
	ACTA2	OFTCM	1.02E−12	NDUFA8	RVCM	7.30E−14
	KLF6	OFTCM	2.29E−12	MYOZ1	RVCM	7.71E−14
	KLF3	OFTCM	1.51E−11	ECI1	RVCM	8.72E−14
	PARD6B	OFTCM	3.17E−11	MYOZ2	RVCM	2.96E−13
	MFAP4	OFTCM	6.57E−11	TRIM54	RVCM	3.03E−13
	SDCBP	OFTCM	7.50E−11	ACTN2	RVCM	4.39E−12
	CKAP4	OFTCM	1.05E−10	SOD2	RVCM	6.19E−12
	CALR	OFTCM	1.66E−10	COX7B	RVCM	6.51E−12
	CALD1	OFTCM	1.94E−10	SLC39A8	RVCM	6.99E−12
	SRSF2	OFTCM	2.98E−10	NDUFA6	RVCM	1.10E−11
	LMOD1	OFTCM	7.61E−10	CPNE5	RVCM	1.21E−11
	TBX20	OFTCM	7.87E−10	COX7A2	RVCM	1.57E−11
	PLS3	OFTCM	1.59E−09	COX8A	RVCM	6.27E−11
	CDH3	OFTCM	2.60E−09	MLIP	RVCM	6.47E−11
	UBE2E2	OFTCM	3.67E−09	MGST3	RVCM	2.75E−10
	ATP2B1	OFTCM	4.17E−09	LBH	RVCM	4.42E−10
	PARVA	OFTCM	8.76E−09	TNNC1	RVCM	5.22E−10
	PFN2	OFTCM	1.34E−08	ATP5F1B	RVCM	5.93E−10
	CFL1	OFTCM	1.76E−08	MYZAP	RVCM	1.70E−09
	DERL1	OFTCM	2.03E−08	TCEA3	RVCM	1.94E−09
	TMEM237	OFTCM	2.48E−08	FABP3	RVCM	6.51E−09
	BLMH	OFTCM	2.93E−08	CYCS	RVCM	8.31E−09
	PPIB	OFTCM	7.36E−08	COX6C	RVCM	4.21E−08
	COL1A1	OFTCM	7.45E−08	SNTA1	RVCM	1.23E−07
	RBP1	OFTCM	7.51E−08	MRPL41	RVCM	1.31E−07
	HMGB3	OFTCM	7.72E−08	ATP2A2	RVCM	2.15E−07
	DDOST	OFTCM	2.41E−07	CISD1	RVCM	2.89E−07
	SOX4	OFTCM	2.49E−07	TMEM38A	RVCM	7.55E−07
	PAWR	OFTCM	2.73E−07	SERPINE2	RVCM	1.08E−06
	ACTB	OFTCM	2.94E−07	PPP1R12B	RVCM	2.05E−06
	FHL1	OFTCM	5.80E−07	WVNK1	RVCM	4.70E−06
	LPP	OFTCM	7.91E−07	SLC8A1	RVCM	4.75E−06
	RSU1	OFTCM	8.39E−07	OBSCN	RVCM	4.76E−06
	ARF4	OFTCM	1.18E−06	ACO2	RVCM	4.78E−06
	HMBOX1	OFTCM	2.03E−06	ZBTB20	RVCM	4.79E−06
	ASAP1	OFTCM	2.21E−06	COX6A1	RVCM	2.24E−05
	NPNT	OFTCM	2.46E−06	CRYAB	RVCM	3.38E−05
	CNN3	OFTCM	2.49E−06	IDH3A	RVCM	0.00013972
	GATA6	OFTCM	3.16E−06	TXLNB	RVCM	0.00015406
	ZC3H15	OFTCM	3.43E−06	ATP5PD	RVCM	0.00015519
	CDH11	OFTCM	3.77E−06	MPC2	RVCM	0.00023456
	WAC	OFTCM	4.25E−06	USP13	RVCM	0.00061919
	CEP290	OFTCM	5.13E−06	GOT1	RVCM	0.00462426
	SRSF10	OFTCM	7.04E−06	SDHA	RVCM	0.00472314
	CCT2	OFTCM	1.39E−05	FUNDC2	RVCM	0.00668935
	SGMS1	OFTCM	1.56E−05	HOMER1	RVCM	0.01013301
	LIMD2	OFTCM	1.64E−05	TRIB2	RVCM	0.01176992
	SNX6	OFTCM	1.98E−05	MYO18B	RVCM	0.05092774
	HNRNPM	OFTCM	3.15E−05
	EML4	OFTCM	3.65E−05
	PACSIN3	OFTCM	4.66E−05
	KRT8	OFTCM	6.52E−05
	SH3GLB1	OFTCM	9.21E−05
	ACTN1	OFTCM	9.67E−05
	TP53111	OFTCM	0.00010784
	GLYR1	OFTCM	0.00011513
	ACTG1	OFTCM	0.00011687
	RBM25	OFTCM	0.00013318
	CLINT1	OFTCM	0.00017126
	IMPACT	OFTCM	0.00019227
	FRG1	OFTCM	0.00022095
	IGF2BP3	OFTCM	0.00024547
	FAM177A1	OFTCM	0.00024596
	PSMD14	OFTCM	0.00024704
	GADD45G	OFTCM	0.00029438
	CCT3	OFTCM	0.0004271
	COPZ1	OFTCM	0.00045236
	GTF3C6	OFTCM	0.00048091
	TRA2A	OFTCM	0.00077822
	BAZ2B	OFTCM	0.00095342
	SUMO3	OFTCM	0.000969
	KCTD10	OFTCM	0.00126661
	RBBP4	OFTCM	0.00169212
	TRMT112	OFTCM	0.00250653
	LMO4	OFTCM	0.00337401
	ACTN4	OFTCM	0.0038488
	PUF60	OFTCM	0.00398678
	DNAJB11	OFTCM	0.00421731
	MLLT11	OFTCM	0.00476554
	TPM4	OFTCM	0.00537186
	KRT18	OFTCM	0.00619594
	CTBP1	OFTCM	0.00701469
	BCLAF1	OFTCM	0.00762463
	SNX2	OFTCM	0.00829119
	SERP1	OFTCM	0.00928003
	HNRNPD	OFTCM	0.00972623
	FRMD4B	OFTCM	0.00981603
	PCGF5	OFTCM	0.01196855
	LIMS1	OFTCM	0.01227844
	MEF2C	OFTCM	0.01420594
	GCC2	OFTCM	0.01507451
	SEC13	OFTCM	0.04376187
	SMYD1	OFTCM	0.09180249
	ARPC5	OFTCM	0.15146355
	PGK1	OFTCM	4.62E−154
	LDHA	OFTCM	3.52E−147
	GAPDH	OFTCM	1.78E−133
	TPI1	OFTCM	6.98E−122
	CSRP3	OFTCM	5.56E−120
	PLN	OFTCM	6.23E−119
	EPHA4	OFTCM	9.30E−115
	ATP1B1	OFTCM	4.36E−107
	GPI	OFTCM	1.02E−101
	FHL2	OFTCM	2.00E−99
	C1QTNF4	OFTCM	4.14E−96
	MYL2	OFTCM	2.55E−91
	MIF	OFTCM	8.25E−91
	LMOD2	OFTCM	2.73E−78
	CRIP2	OFTCM	2.80E−77
	TRDN	OFTCM	3.12E−73
	IRX1	OFTCM	4.21E−72
	COX6A2	OFTCM	4.35E−69
	LRRC10	OFTCM	7.41E−65
	LRRC39	OFTCM	3.82E−30
	VDAC2	OFTCM	1.44E−29
	ALDOA	OFTCM	3.71E−29
	HK1	OFTCM	4.69E−29
	MYL4	OFTCM	1.88E−27
	VEGFB	OFTCM	1.31E−25
	COX5B	OFTCM	2.44E−24
	NDUFA4	OFTCM	4.39E−23
	PDE4DIP	OFTCM	2.25E−22
	MYBPC3	OFTCM	7.66E−21
	PDLIM5	OFTCM	2.48E−20
	ATP5PO	OFTCM	3.88E−19
	BSG	OFTCM	6.22E−19
	SYNPO2L	OFTCM	6.41E−19
	MYH7	OFTCM	3.24E−18
	ATP5PF	OFTCM	1.14E−16
	DUSP10	OFTCM	3.95E−16
	GAMT	OFTCM	3.66E−15
	NDUFB4	OFTCM	4.39E−15
	TTN	OFTCM	1.61E−14
	NDUFA8	OFTCM	7.30E−14
	MYOZ1	OFTCM	7.71E−14
	ECI1	OFTCM	8.72E−14
	MYOZ2	OFTCM	2.96E−13
	TRIM54	OFTCM	3.03E−13
	ACTN2	OFTCM	4.39E−12
	SOD2	OFTCM	6.19E−12
	COX7B	OFTCM	6.51E−12
	SLC39A8	OFTCM	6.99E−12
	NDUFA6	OFTCM	1.10E−11
	CPNE5	OFTCM	1.21E−11
	COX7A2	OFTCM	1.57E−11
	COX8A	OFTCM	6.27E−11
	MLIP	OFTCM	6.47E−11
	MGST3	OFTCM	2.75E−10
	LBH	OFTCM	4.42E−10
	TNNC1	OFTCM	5.22E−10
	ATP5F1B	OFTCM	5.93E−10
	MYZAP	OFTCM	1.70E−09
	TCEA3	OFTCM	1.94E−09
	FABP3	OFTCM	6.51E−09
	CYCS	OFTCM	8.31E−09
	COX6C	OFTCM	4.21E−08
	SNTA1	OFTCM	1.23E−07
	MRPL41	OFTCM	1.31E−07
	ATP2A2	OFTCM	2.15E−07
	CISD1	OFTCM	2.89E−07
	TMEM38A	OFTCM	7.55E−07
	SERPINE2	OFTCM	1.08E−06
	PPP1R12B	OFTCM	2.05E−06
	WNK1	OFTCM	4.70E−06
	SLC8A1	OFTCM	4.75E−06
	OBSCN	OFTCM	4.76E−06
	ACO2	OFTCM	4.78E−06
	ZBTB20	OFTCM	4.79E−06
	COX6A1	OFTCM	2.24E−05
	CRYAB	OFTCM	3.38E−05
	IDH3A	OFTCM	0.00013972
	TXLNB	OFTCM	0.00015406
	ATP5PD	OFTCM	0.00015519
	MPC2	OFTCM	0.00023456
	USP13	OFTCM	0.00061919
	GOT1	OFTCM	0.00462426
	SDHA	OFTCM	0.00472314
	FUNDC2	OFTCM	0.00668935
	HOMER1	OFTCM	0.01013301
	TRIB2	OFTCM	0.01176992
	MYO18B	OFTCM	0.05092774

gene	cell type	p_val_adj	gene	cell type	p_val_adj
COL1A2	SVCM	1.14E−210	MYH6	ACM	3.17E−115
TMSB4X	SVCM	1.06E−120	TNNC1	ACM	5.37E−115
FLNA	SVCM	4.29E−106	MYL3	ACM	8.80E−108
PLAT	SVCM	4.17E−103	TTN	ACM	3.22E−93
SPARC	SVCM	3.34E−102	TNNT2	ACM	1.33E−88
ACTB	SVCM	6.16E−97	COX6A2	ACM	1.40E−88
S100A10	SVCM	2.83E−96	MYBPC3	ACM	5.20E−79
CALD1	SVCM	3.51E−92	ENO3	ACM	1.03E−78
IFITM3	SVCM	7.10E−91	ACTN2	ACM	1.59E−78
CRABP2	SVCM	9.33E−89	NPPA	ACM	1.65E−68
ACTG1	SVCM	8.78E−88	FABP3	ACM	1.43E−66
CNN3	SVCM	1.31E−85	CRYAB	ACM	1.65E−66
C4orf48	SVCM	2.29E−85	PGAM2	ACM	6.00E−66
FN1	SVCM	1.33E−84	MYL7	ACM	1.13E−65
MARCKS	SVCM	4.82E−80	BMP7	ACM	2.07E−65
LIMA1	SVCM	1.54E−76	CSRP3	ACM	4.40E−64
SH3BGRL3	SVCM	1.29E−67	SLC25A4	ACM	3.08E−62
TUBA1A	SVCM	1.57E−67	TCAP	ACM	1.55E−60
TMSB10	SVCM	4.03E−67	CRIP2	ACM	3.21E−60
MARCKSL1	SVCM	3.20E−66	ATP2A2	ACM	6.68E−60
FLRT2	SVCM	8.92E−65	LDB3	ACM	1.77E−54
MFAP4	SVCM	3.30E−64	SMPX	ACM	4.25E−52
VIM	SVCM	2.39E−63	CITED4	ACM	1.54E−47
SFRP1	SVCM	8.29E−57	LMOD2	ACM	1.55E−41
TGFB2	SVCM	4.72E−56	NDUFA4	ACM	3.94E−39
HMGN1	SVCM	5.19E−55	TCEA3	ACM	4.24E−39
CADM1	SVCM	8.55E−55	COX5A	ACM	3.92E−37
COTL1	SVCM	4.78E−52	TMOD1	ACM	1.70E−36
TPM4	SVCM	2.42E−49	MYLK3	ACM	3.34E−36
SLC9A3R1	SVCM	1.48E−46	MYL4	ACM	4.16E−36
S100A11	SVCM	4.87E−42	PAM	ACM	2.62E−34
ATP2B1	SVCM	4.85E−41	RYR2	ACM	9.39E−32
FBLN1	SVCM	6.84E−41	TNNI3	ACM	1.24E−31
GNAS	SVCM	7.28E−41	NKX2-5	ACM	2.11E−31
SESN3	SVCM	1.33E−39	ATP1B1	ACM	4.57E−30
PTN	SVCM	1.38E−39	QKI	ACM	9.77E−28
CXCL12	SVCM	3.21E−38	TRIM54	ACM	3.40E−27
PPP1R14A	SVCM	1.26E−37	EIF1B	ACM	5.26E−27
TAGLN2	SVCM	1.76E−37	FSD2	ACM	5.32E−27
IGFBP4	SVCM	1.24E−35	HSPB2	ACM	4.38E−26
PRDX6	SVCM	4.38E−35	ATP5F1D	ACM	5.88E−26
LBH	SVCM	1.50E−33	GOT1	ACM	1.06E−25
SFRP5	SVCM	3.43E−33	COX8A	ACM	6.20E−25
RRBP1	SVCM	3.74E−33	HSPB7	ACM	7.18E−24
MEST	SVCM	7.43E−33	NDUFA11	ACM	9.28E−24
FTL	SVCM	1.02E−32	SYNPO2L	ACM	1.21E−23
RBP1	SVCM	4.82E−32	SLCO3A1	ACM	1.84E−23
CD63	SVCM	5.94E−31	ATP5F1C	ACM	3.14E−23
FOXP2	SVCM	9.26E−31	NDUFB10	ACM	3.58E−23
CFL1	SVCM	1.47E−30	GAPDH	ACM	2.71E−22
GPC3	SVCM	1.98E−29	APOBEC2	ACM	5.37E−22
TENM3	SVCM	4.59E−28	KLHL31	ACM	1.49E−21
IFITM2	SVCM	7.51E−28	VDAC2	ACM	8.98E−21
SOX4	SVCM	1.19E−27	CAV1	ACM	1.11E−20
PPIB	SVCM	2.55E−27	RBM38	ACM	5.06E−20
NME4	SVCM	2.65E−27	VDAC1	ACM	1.71E−19
TPM3	SVCM	2.82E−27	LMO7	ACM	3.47E−19
SRSF9	SVCM	1.35E−26	KCNJ5	ACM	8.36E−19
RCN2	SVCM	1.64E−26	MYO18B	ACM	9.23E−19
IQGAP1	SVCM	1.24E−25	MT-ND4	ACM	1.62E−18
TBX18	SVCM	1.33E−25	FITM1	ACM	2.06E−18
BEX1	SVCM	1.25E−24	MYBPHL	ACM	6.42E−18
FABP5	SVCM	2.41E−24	TRIM55	ACM	9.69E−18
DLK1	SVCM	3.31E−24	SLC25A3	ACM	1.98E−17
CTHRC1	SVCM	4.28E−24	HSPB3	ACM	3.71E−17
TMOD3	SVCM	7.16E−24	TMEM163	ACM	7.45E−17
PGRMC1	SVCM	8.53E−23	SH3KBP1	ACM	3.76E−16
SH3BGRL	SVCM	1.09E−22	ITGB1BP2	ACM	2.12E−15
SEMA3C	SVCM	5.99E−22	IDH2	ACM	3.88E−15
SEC61B	SVCM	6.15E−22	COX411	ACM	6.37E−15
DDX5	SVCM	8.54E−22	COX5B	ACM	1.50E−14
LYAR	SVCM	3.26E−21	PFKP	ACM	1.73E−14
CALR	SVCM	4.65E−21	SORBS2	ACM	1.92E−14
PBX3	SVCM	7.34E−21	SLC25A5	ACM	4.41E−14
PDIA3	SVCM	5.68E−20	BNIP3	ACM	5.88E−14
MAGED2	SVCM	1.56E−19	HADHB	ACM	4.97E−13
DPYSL3	SVCM	1.75E−19	DSP	ACM	5.91E−13
CTXN1	SVCM	4.14E−19	HINT1	ACM	2.08E−12
SEC11A	SVCM	1.56E−18	POPDC2	ACM	2.65E−12
BZW1	SVCM	7.14E−18	NDUFA6	ACM	4.97E−12
WFDC2	SVCM	7.48E−18	GAMT	ACM	8.28E−12
CYFIP1	SVCM	3.68E−17	MT-CYB	ACM	2.12E−11
NPM1	SVCM	6.97E−17	DKK3.00	ACM	2.34E−11
MFAP2	SVCM	8.50E−17	NDUFV3	ACM	2.47E−11
MYH10	SVCM	1.36E−16	COX7C	ACM	2.79E−11
LITAF	SVCM	1.75E−16	FHOD3	ACM	5.20E−11
CORO1C	SVCM	1.78E−16	RRAD	ACM	7.45E−11
ZFP36L1	SVCM	4.05E−16	CYCS	ACM	7.86E−11
TENM4	SVCM	5.01E−16	ITGA6	ACM	1.12E−10
PLK2	SVCM	5.75E−16	ATP5F1B	ACM	1.23E−10
TUBB	SVCM	2.18E−15	GALK1	ACM	1.99E−10
PPP1R14B	SVCM	2.73E−15	UQCR10	ACM	3.45E−10
RHOC	SVCM	3.62E−15	CORO6	ACM	6.32E−10
ECE1	SVCM	4.03E−15	GHITM	ACM	1.17E−09
F2R	SVCM	4.29E−15	COX7B	ACM	1.25E−09
STMN1	SVCM	4.58E−15	ATP5PO	ACM	1.28E−09
RSPO3	SVCM	5.42E−15	COX6C	ACM	1.39E−09
RAB5C	SVCM	3.52E−14	ATP5PF	ACM	1.64E−09
TCF4	SVCM	5.12E−14	CHCHD10	ACM	2.91E−09
RPL12	SVCM	5.33E−14	FBXL22	ACM	4.08E−09
HNRNPAO	SVCM	6.61E−14	VDAC3	ACM	5.33E−09
CMTM3	SVCM	7.22E−14	RBPMS2	ACM	8.13E−09
DUSP5	SVCM	7.91E−14	USP13	ACM	1.73E−08
AKAP5	SVCM	8.97E−14	PDK1	ACM	1.87E−08
TOP1	SVCM	9.77E−14	UQCRFS1	ACM	2.30E−08
RPS9	SVCM	9.78E−14	SDHA	ACM	4.15E−08
PDCD4	SVCM	1.32E−13	ATP5F1A	ACM	4.46E−08
RCN1	SVCM	1.46E−13	NDUFA5	ACM	4.77E−08
RPL3	SVCM	1.69E−13	PTGES3L	ACM	4.93E−08
SMOC2	SVCM	2.05E−13	ATP5PD	ACM	9.95E−08
TGIF1	SVCM	3.25E−13	PPP1R14C	ACM	1.50E−07
TUBA1B	SVCM	9.57E−13	BCAM	ACM	2.05E−07
BIN1	SVCM	9.81E−13	PTP4A3	ACM	2.31E−07
HOMER3	SVCM	2.22E−12	COX6B1	ACM	2.46E−07
ADAMTS1	SVCM	4.76E−12	TPM1	ACM	2.66E−07
MGARP	SVCM	5.07E−12	ATP1A1	ACM	4.61E−07
GADD45G	SVCM	7.27E−12	FLNC	ACM	6.26E−07
HSP90B1	SVCM	3.32E−11	ACO2	ACM	6.65E−07
RPS6	SVCM	5.06E−11	ANKRD1	ACM	9.58E−07
ARL6IP1	SVCM	5.93E−11	MDH1	ACM	1.11E−06
RPS7	SVCM	6.15E−11	NDUFA8	ACM	1.74E−06
ARF4	SVCM	6.67E−11	LPGAT1	ACM	1.94E−06
RANBP1	SVCM	7.14E−11	NDRG2	ACM	4.11E−06
PNRC2	SVCM	1.03E−10	LRRC39	ACM	8.05E−06
EIF4G2	SVCM	1.81E−10	SMARCD3	ACM	9.43E−06
NOS1AP	SVCM	6.65E−10	EMP2	ACM	1.40E−05
CNTFR	SVCM	9.75E−10	IDH3A	ACM	1.48E−05
DDOST	SVCM	1.22E−09	ALPK3	ACM	1.57E−05
UNC5C	SVCM	2.38E−09	OBSCN	ACM	2.68E−05
SLIT3	SVCM	3.66E−09	SOD2	ACM	2.84E−05
FNDC3A	SVCM	1.67E−08	NDUFB11	ACM	3.77E−05
HSPA8	SVCM	1.73E−08	CPNE5	ACM	4.07E−05
GNAI3	SVCM	1.89E−08	PGK1	ACM	4.32E−05
PLAGL1	SVCM	2.27E−08	HRC	ACM	8.28E−05
FUS	SVCM	2.35E−08	HADHA	ACM	9.19E−05
PEG10	SVCM	4.11E−08	FAM162A	ACM	0.000119208
AKR1A1	SVCM	5.77E−08	MDH2	ACM	0.000130433
TMEM98	SVCM	6.90E−08	ATP5MC3	ACM	0.000138457
RPS12	SVCM	1.53E−07	ASPH	ACM	0.000201845
CALM2	SVCM	1.77E−07	ATP5ME	ACM	0.000262567
CLTA	SVCM	1.83E−07	SUCLG1	ACM	0.000364436
RPL6	SVCM	2.72E−07	FBLIM1	ACM	0.000519504
ENY2	SVCM	2.97E−07	GPI	ACM	0.000666012
MXD4	SVCM	3.19E−07	NDUFS6	ACM	0.000730636
RPL28	SVCM	3.20E−07	NDUFS7	ACM	0.001497415
RPL36	SVCM	3.24E−07	XIRP1	ACM	0.001606398
NEDD4	SVCM	3.27E−07	UNC45B	ACM	0.001917287
JAM3	SVCM	3.77E−07	RASSF5	ACM	0.001955651
PDIA6	SVCM	7.39E−07	BVES	ACM	0.002639301
RAI14	SVCM	8.51E−07	NEXN	ACM	0.003558541
DDAH2	SVCM	1.43E−06	NDUFB7	ACM	0.003806481
GSN	SVCM	1.53E−06	SUCLA2	ACM	0.004286155
RPL15	SVCM	1.63E−06	NDUFB5	ACM	0.004799068
SPTSSA	SVCM	1.80E−06	UQCR11	ACM	0.006452374
PDIA4	SVCM	1.95E−06	ABRA	ACM	0.006860025
CCT2	SVCM	2.04E−06	NPPB	ACM	0.010490844
DBN1	SVCM	3.00E−06	RAD23A	ACM	0.01288501
EFNB1	SVCM	3.20E−06	HAGH	ACM	0.020593587
DUT	SVCM	3.57E−06	TRDN	ACM	0.020960299
CNPY2	SVCM	6.78E−06	PDLIM5	ACM	0.021924528
TSPAN3	SVCM	7.14E−06	ALKBH7	ACM	0.027207251
NME1	SVCM	9.05E−06	GPX3	ACM	0.037085974
NDN	SVCM	1.02E−05
NPC2	SVCM	1.17E−05
HMGB1	SVCM	1.61E−05
SRSF11	SVCM	2.33E−05
HP1BP3	SVCM	3.68E−05
PHF14	SVCM	5.56E−05
MYL12B	SVCM	7.85E−05
NACA	SVCM	9.36E−05
PTBP2	SVCM	9.70E−05
TSPAN6	SVCM	0.000108403
MIDN	SVCM	0.000142218
LMAN2	SVCM	0.000198106
COL18A1	SVCM	0.000286358
RAB34	SVCM	0.000288482
SSR2	SVCM	0.000449014
MEX3C	SVCM	0.00055014
CCND3	SVCM	0.000551267
RPN2	SVCM	0.000553553
ALYREF	SVCM	0.000652392
LIMD2	SVCM	0.000693598
BCL7C	SVCM	0.000718712
YWHAQ	SVCM	0.000978751
PPFIBP1	SVCM	0.001091885
RPL37	SVCM	0.001156565
ARL2BP	SVCM	0.001266944
EIF4A1	SVCM	0.001323651
PFN2	SVCM	0.001341568
SMARCB1	SVCM	0.001375417
SFPQ	SVCM	0.001586955
APEX1	SVCM	0.001989924
PRRC2C	SVCM	0.002232754
SRP72	SVCM	0.002389675
RBM3	SVCM	0.002457787
NCBP2	SVCM	0.0025136
RBM39	SVCM	0.002686733
PPDPF	SVCM	0.002883048
PALM	SVCM	0.002958699
DYNLT1	SVCM	0.003167772
UBB	SVCM	0.003450451
IGSF3	SVCM	0.004335328
RPS8	SVCM	0.004376366
ERH	SVCM	0.004451114
CDK4	SVCM	0.004703628
UBE2V2	SVCM	0.004863735
FRMD4A	SVCM	0.005365243
NHP2	SVCM	0.00561124
PLIN2	SVCM	0.006631859
SSR3	SVCM	0.007658092
SNRPB	SVCM	0.007905315
DDX3X	SVCM	0.008374448
MEX3A	SVCM	0.010832848
SLC39A6	SVCM	0.013711442
SRSF10	SVCM	0.014963938
CCNL1	SVCM	0.016317268
HDAC1	SVCM	0.016649521
SERP1	SVCM	0.018149373
HSPA5	SVCM	0.018786636
TLN2	SVCM	0.020357464
MEF2C	SVCM	0.021911837
RPL19	SVCM	0.022952859
RPS19	SVCM	0.025584362
NCL	SVCM	0.029496025
TSEN34	SVCM	0.03200975
DYNC112	SVCM	0.03979637
JUND	SVCM	0.040603337
CCNL2	SVCM	0.041091284
LUC7L	SVCM	0.042662408
MTPN	SVCM	0.046536579

gene	cell type	p_val_adj	gene	cell type	p_val_adj
EEF1B2	LVCM	2.88E−165	NDUFA13	RVCM	8.23E−267
RPL19	LVCM	2.41E−157	PLN	RVCM	7.71E−242
RPS6	LVCM	1.20E−150	PDLIM1	RVCM	2.69E−237
EIF4EBP1	LVCM	1.02E−127	COX6C	RVCM	1.25E−190
DOK4	LVCM	2.89E−121	UBL5	RVCM	3.05E−183
RPL5	LVCM	4.93E−117	CRIP2	RVCM	8.15E−177
RPL18	LVCM	2.30E−115	FHL2	RVCM	2.42E−172
VCAM1	LVCM	3.52E−109	IRX1	RVCM	1.07E−158
RPL12	LVCM	1.90E−108	C1QTNF4	RVCM	3.33E−149
HAND1	LVCM	8.84E−93	DES	RVCM	1.18E−145
TBX20	LVCM	1.48E−85	ATP1A1	RVCM	1.55E−145
APEX1	LVCM	7.09E−81	ATP1B1	RVCM	1.98E−133
NPM1	LVCM	1.74E−78	IRX2	RVCM	1.50E−132
NME1	LVCM	3.87E−69	ASPH	RVCM	2.43E−129
PPIC	LVCM	3.19E−66	NDUFB4	RVCM	2.07E−125
FITM1	LVCM	2.30E−57	BNIP3	RVCM	5.62E−124
TMEM88	LVCM	1.58E−55	UQCR10	RVCM	1.98E−122
PYGB	LVCM	1.69E−55	NDUFC1	RVCM	1.30E−120
PHGDH	LVCM	5.52E−54	COX7A1	RVCM	2.46E−118
PPA1	LVCM	1.23E−52	MEIS2	RVCM	2.13E−110
POLE4	LVCM	1.63E−50	COX6B1	RVCM	7.77E−109
EFNB3	LVCM	1.35E−49	EPHA4	RVCM	1.43E−104
GPATCH4	LVCM	3.68E−49	FXYD1	RVCM	3.59E−103
SERBP1	LVCM	1.56E−47	LDHA	RVCM	4.84E−101
MTUS2	LVCM	1.37E−46	MYL3	RVCM	1.19E−97
STK39	LVCM	2.02E−43	ATP5MF	RVCM	5.96E−97
NME4	LVCM	9.10E−43	CXCL12	RVCM	1.09E−96
CCT3	LVCM	3.04E−42	MYL2	RVCM	7.44E−87
SRSF2	LVCM	9.35E−42	PBX1	RVCM	1.76E−77
AIMP2	LVCM	2.92E−41	TGM2	RVCM	7.67E−77
EIF3A	LVCM	2.87E−38	MTCH1	RVCM	1.48E−76
TMEM97	LVCM	6.17E−37	IGFBP5	RVCM	1.26E−72
HMGB3	LVCM	1.29E−36	COX6A2	RVCM	4.07E−72
TKT	LVCM	2.85E−35	GAPDH	RVCM	3.21E−68
EZR	LVCM	3.71E−35	GABARAPL2	RVCM	3.63E−68
TLN2	LVCM	7.86E−35	TMSB4X	RVCM	1.04E−66
MARCKSL1	LVCM	8.69E−35	FILIP1	RVCM	1.01E−64
FRMD4B	LVCM	9.12E−35	PDLIM3	RVCM	5.65E−62
SRSF3	LVCM	1.30E−34	LMOD2	RVCM	1.01E−57
SORBS2	LVCM	7.31E−34	ATOX1	RVCM	1.47E−56
FN1	LVCM	7.70E−33	GPI	RVCM	4.20E−56
SLC3A2	LVCM	4.88E−32	ITM2B	RVCM	2.69E−48
PRDX6	LVCM	1.02E−31	UQCRB	RVCM	2.66E−46
BTF3	LVCM	1.32E−31	TRDN	RVCM	2.92E−46
DNMT1	LVCM	1.85E−31	MFGE8	RVCM	3.61E−44
CCT2	LVCM	1.13E−30	LTBP1	RVCM	1.09E−42
ODC1	LVCM	5.79E−30	TXLNB	RVCM	2.12E−42
LAP3	LVCM	1.16E−29	BSG	RVCM	1.69E−41
SNX24	LVCM	1.74E−29	NDUFA6	RVCM	6.77E−39
SNRPD1	LVCM	2.16E−29	CKB	RVCM	3.01E−38
ATIC	LVCM	2.45E−29	PDLIM7	RVCM	4.46E−36
UCHL3	LVCM	3.38E−29	TMEM59	RVCM	5.20E−34
SFPQ	LVCM	4.17E−29	CTSB	RVCM	8.92E−34
C1QBP	LVCM	6.16E−29	WNK1	RVCM	8.55E−30
SNRPA	LVCM	1.14E−28	RSPO3	RVCM	9.71E−30
EMP2	LVCM	6.17E−28	TSC22D3	RVCM	2.65E−28
SNRNP40	LVCM	1.56E−27	WDR1	RVCM	4.28E−28
EIF1	LVCM	2.37E−27	PDLIM5	RVCM	1.70E−27
NOP58	LVCM	2.99E−27	MYOZ1	RVCM	6.49E−27
RBMX	LVCM	6.06E−27	S100A13	RVCM	6.04E−26
CSE1L	LVCM	8.46E−27	PRKACA	RVCM	1.94E−24
ZC3H15	LVCM	3.50E−26	RCAN1	RVCM	2.39E−24
BAZ1A	LVCM	3.84E−26	PPP1R12A	RVCM	9.25E−24
LSM2	LVCM	6.40E−26	TUBA1A	RVCM	7.71E−23
MTHFD2	LVCM	1.32E−25	HMGN3	RVCM	9.14E−23
TSFM	LVCM	2.66E−25	HRC	RVCM	2.11E−22
WNT5A	LVCM	7.13E−25	CNN1	RVCM	2.70E−22
NUP37	LVCM	1.82E−24	MYOZ2	RVCM	3.23E−22
TCERG1	LVCM	3.27E−24	LBH	RVCM	5.57E−21
WDR77	LVCM	7.68E−24	PAIP2	RVCM	7.45E−21
MYH10	LVCM	1.96E−23	CCDC107	RVCM	5.98E−20
SRM	LVCM	3.38E−23	DUSP10	RVCM	2.40E−19
RPS12	LVCM	4.07E−23	CYB5R3	RVCM	6.03E−18
AKR1B1	LVCM	4.39E−23	SLC6A6	RVCM	5.31E−17
WDR12	LVCM	8.75E−23	MAST4	RVCM	5.74E−17
ME1	LVCM	9.01E−23	MAP1LC3A	RVCM	6.04E−17
EIF4G1	LVCM	1.07E−22	CAPNS1	RVCM	5.89E−16
SRPK1	LVCM	1.11E−22	DSP	RVCM	7.99E−16
GRB14	LVCM	3.51E−22	MYH7	RVCM	8.54E−16
MRPS15	LVCM	4.64E−22	GABARAP	RVCM	5.10E−15
LTV1	LVCM	5.76E−22	PKM	RVCM	8.26E−15
BVES	LVCM	8.43E−22	NDUFA7	RVCM	6.42E−14
IGF2BP1	LVCM	1.77E−21	HIPK2	RVCM	2.23E−13
CDK6	LVCM	2.91E−21	MTUS1	RVCM	6.99E−13
POLR2G	LVCM	6.46E−21	ARL3	RVCM	1.19E−12
EEF1E1	LVCM	1.18E−20	ACTC1	RVCM	1.62E−12
PSMG1	LVCM	1.39E−20	TNNT2	RVCM	1.68E−12
SF3B3	LVCM	2.16E−20	YPEL3	RVCM	1.80E−12
IPO5	LVCM	6.53E−20	UBC	RVCM	5.32E−12
NAA15	LVCM	6.61E−20	MYL4	RVCM	5.92E−12
PNO1	LVCM	1.52E−19	BTG2	RVCM	1.43E−11
ABCE1	LVCM	1.85E−19	TMEM50A	RVCM	3.23E−10
BYSL	LVCM	3.44E−19	TECR	RVCM	2.63E−08
FSCN1	LVCM	3.72E−19	WBP2	RVCM	4.23E−08
MRPS22	LVCM	4.00E−19	ATP5PD	RVCM	4.28E−08
RSL1D1	LVCM	4.65E−19	ACADVL	RVCM	9.60E−08
TP53	LVCM	6.50E−19	FGF10	RVCM	4.22E−07
TOMM70	LVCM	7.05E−19	FBN2	RVCM	5.59E−07
DDX21	LVCM	1.27E−18	RABAC1	RVCM	1.65E−06
PPP1R14B	LVCM	1.38E−18	ETFB	RVCM	2.02E−06
ITPA	LVCM	1.55E−18	BNIP3L	RVCM	2.33E−06
OLA1	LVCM	2.15E−18	SSBP2	RVCM	2.91E−06
MPP6	LVCM	2.28E−18	AP1S2	RVCM	3.44E−06
HSPA8	LVCM	7.42E−18	TTC3	RVCM	5.06E−06
POLR1D	LVCM	1.62E−17	LRRC10	RVCM	2.10E−05
MRTO4	LVCM	1.64E−17	BTG1	RVCM	2.44E−05
LMNB1	LVCM	1.71E−17	GRB10	RVCM	3.02E−05
MAN1A2	LVCM	1.81E−17	PLK2	RVCM	7.64E−05
TMPO	LVCM	2.92E−17	CGNL1	RVCM	0.000451583
EIF3G	LVCM	3.92E−17	RAB11A	RVCM	0.000992302
DCTPP1	LVCM	4.22E−17	LMNA	RVCM	0.001613405
HMGB2	LVCM	4.39E−17	PTOV1	RVCM	0.002043216
NOLC1	LVCM	1.27E−16	CHMP5	RVCM	0.002471188
HSPH1	LVCM	1.41E−16	MTSS1	RVCM	0.003362609
PLA2G12A	LVCM	1.62E−16	RTN2	RVCM	0.008864217
MRPL37	LVCM	1.94E−16	SERINC1	RVCM	0.011700929
RPS11	LVCM	2.18E−16	HSPB2	RVCM	0.016119166
GART	LVCM	2.20E−16	DUSP6	RVCM	0.02787035
SRSF7	LVCM	2.33E−16	PSAP	RVCM	0.030468014
RPS8	LVCM	3.28E−16
NOL11	LVCM	3.82E−16
HELLS	LVCM	3.97E−16
RAN	LVCM	6.76E−16
PPIL1	LVCM	6.81E−16
NOP14	LVCM	1.13E−15
GTPBP4	LVCM	2.28E−15
BAG2	LVCM	5.31E−15
SSRP1	LVCM	7.29E−15
IMP4	LVCM	1.41E−14
TOMM40	LVCM	1.44E−14
HNRNPAB	LVCM	1.64E−14
WDR74	LVCM	2.40E−14
RPS16	LVCM	4.03E−14
WDR43	LVCM	4.67E−14
CTPS1	LVCM	4.99E−14
RBM25	LVCM	5.85E−14
CDV3	LVCM	6.85E−14
CKS2	LVCM	8.52E−14
APRT	LVCM	8.58E−14
SDF2L1	LVCM	1.03E−13
NME6	LVCM	1.04E−13
YTHDF2	LVCM	2.02E−13
SNRPB	LVCM	2.28E−13
FTSJ3	LVCM	2.42E−13
SAP30L	LVCM	4.68E−13
MRPL12	LVCM	5.94E−13
EIF4A1	LVCM	7.24E−13
CKAP5	LVCM	9.82E−13
RRP9	LVCM	2.70E−12
PPID	LVCM	2.91E−12
SRSF6	LVCM	6.10E−12
CCT6A	LVCM	6.89E−12
CDH3	LVCM	9.64E−12
RANBP1	LVCM	1.05E−11
CCDC86	LVCM	1.27E−11
RRP1B	LVCM	1.30E−11
HNRNPAO	LVCM	1.69E−11
YARS2	LVCM	2.02E−11
SRSF1	LVCM	2.66E−11
C16orf91	LVCM	3.39E−11
FBLN1	LVCM	7.81E−11
RCC2	LVCM	1.10E−10
REXO2	LVCM	1.18E−10
SLC1A3	LVCM	1.77E−10
BOP1	LVCM	2.95E−10
MCM3	LVCM	3.07E−10
HNRNPD	LVCM	3.23E−10
PPAT	LVCM	3.41E−10
HDDC2	LVCM	4.81E−10
CDK4	LVCM	5.24E−10
BEX1	LVCM	7.07E−10
RUVBL2	LVCM	8.06E−10
PFDN4	LVCM	8.85E−10
SIGMAR1	LVCM	9.44E−10
SF3B4	LVCM	1.17E−09
GMFB	LVCM	1.93E−09
CCNB1	LVCM	2.05E−09
MRPL19	LVCM	2.66E−09
TXNRD1	LVCM	3.24E−09
NUDCD2	LVCM	4.29E−09
TSR1	LVCM	5.56E−09
SEC61A1	LVCM	5.92E−09
DLST	LVCM	6.21E−09
HSPD1	LVCM	6.53E−09
UNG	LVCM	6.56E−09
DDX39A	LVCM	6.79E−09
UBE21	LVCM	8.34E−09
MRPS26	LVCM	8.41E−09
EMC8	LVCM	9.10E−09
TYMS	LVCM	9.50E−09
NOC2L	LVCM	9.71E−09
THRAP3	LVCM	9.84E−09
GNL3	LVCM	1.04E−08
DNAJC11	LVCM	1.37E−08
DCTD	LVCM	1.54E−08
HSPA4	LVCM	1.56E−08
RRAS2	LVCM	1.59E−08
STARD7	LVCM	2.12E−08
AURKA	LVCM	2.38E−08
TARDBP	LVCM	3.25E−08
PRTG	LVCM	3.25E−08
DNAJC2	LVCM	3.75E−08
NUDT21	LVCM	4.55E−08
POLR3D	LVCM	5.31E−08
CLINT1	LVCM	7.81E−08
EIF4A3	LVCM	1.05E−07
HDGF	LVCM	1.06E−07
EBNA1BP2	LVCM	1.11E−07
OTUD4	LVCM	1.25E−07
MTAP	LVCM	1.42E−07
MAGOHB	LVCM	1.70E−07
FEN1	LVCM	2.19E−07
TRIM27	LVCM	2.36E−07
PHB	LVCM	3.22E−07
CNOT1	LVCM	3.24E−07
DNAJC3	LVCM	3.59E−07
DCUN1D5	LVCM	3.67E−07
TBX5	LVCM	4.85E−07
FARSB	LVCM	6.09E−07
WDR46	LVCM	7.42E−07
PRPF4B	LVCM	9.04E−07
ATAD3A	LVCM	1.25E−06
SMARCA5	LVCM	1.28E−06
PPM1G	LVCM	2.28E−06
DEK	LVCM	2.48E−06
TCOF1	LVCM	2.63E−06
UTP18	LVCM	2.64E−06
CAPRIN1	LVCM	3.69E−06
CHD4	LVCM	3.71E−06
CASP8AP2	LVCM	3.87E−06
EXOSC1	LVCM	4.75E−06
KPNB1	LVCM	6.22E−06
ANP32B	LVCM	6.80E−06
RRP7A	LVCM	6.95E−06
SYNCRIP	LVCM	7.02E−06
RCOR2	LVCM	7.32E−06
GOT1	LVCM	1.38E−05
DDX46	LVCM	1.50E−05
DNAJC21	LVCM	2.20E−05
NAA25	LVCM	2.34E−05
DDA1	LVCM	3.72E−05
IWS1	LVCM	4.43E−05
KDELR2	LVCM	5.88E−05
MRPL15	LVCM	6.00E−05
PPIF	LVCM	7.56E−05
PSMA4	LVCM	0.000121744
PABPC4	LVCM	0.000124615
SMARCC1	LVCM	0.00021718
ILF3	LVCM	0.000235316
MRPL47	LVCM	0.000438104
PTPN11	LVCM	0.000468729
FAM136A	LVCM	0.000886127
PHB2	LVCM	0.001248031
GMNN	LVCM	0.001894969
C1orf43	LVCM	0.002274767
TIMM9	LVCM	0.00288776
NOP56	LVCM	0.004193245
NCL	LVCM	0.048031567
RPL22L1	LVCM	0.050574511