-
2005-09-13
10/272,459
2002-10-15
US 6,942,965 B2
2005-09-13
-
-
Laurie Scheiner
2023-02-22
Hepatitis A virus primers and probes derived from the capsid proteins and junction between the capsid precursor P1 and 2A of the HAV genome are disclosed. Also disclosed are nucleic acid-based assays using the primers and probes, antigen detection of HAV, and immunoassay for detecting the antibodies that bind to HAV.
Get notified when new applications in this technology area are published.
This application is related to provisional patent applications Ser. No. 60/328,933 filed Oct. 12, 2001, from which priority is claimed under 35 USC §119(e)(1) and which application is incorporated herein by reference in its entireties.
The present invention pertains generally to viral diagnostics. In particular, the invention relates to nucleic acid and antibody-based as says for accurately diagnosing hepatitis A virus infection.
Hepatitis A is an enterically transmitted disease that causes fever, malaise, anorexia, nausea, abdominal discomfort and jaundice. The etiologic agent of hepatitis A, the hepatitis A virus, is a small, nonenveloped, spherical virus classified in the genus Hepatovirus of the Picornaviridae family. The HAV genome consists of a single-strand, linear, 7.5 kb RNA molecule encoding a polyprotein precursor that is processed to yield the structural proteins and enzymatic activities required for viral replication. HAV grows poorly in cell culture, is not cytopathic, and produces low yields of virus. Although HAV RNA extracted from virions is infectious in cell culture (Locarnini et al., J. Virol. 37:216-225, 1981 and Siegl et al., J. Gen. Virol. 57:331-341, 1981), direct manipulation of the viral genome becomes difficult because of its RNA composition.
HAV encodes four capsid proteins (A, B, C and D) which contain the major antigenic domains recognized by antibodies of infected individuals. In addition to the capsid proteins, antigenic domains have been reported in nonstructural proteins such as 2A and the viral encoded protease. Another important HAV antigenic domain has been described in the junction between the capsid precursor P1 and 2A.
HAV is normally acquired by fecal-oral route, by either person-to-person contact or ingestion of contaminated food or water. However, there is the potential for HAV transmission by pooled plasma products. The absence of a lipid envelope makes HAV very resistant to physicochemical inactivation, and the virus can withstand conventional heat treatment of blood products. Thus, HAV, as well as Parvovirus B19, have been transmitted through the administration of pooled plasma derivatives. The development of sensitive and specific diagnostic assays to identify HAV antigens and/or antibodies in infected individuals as well as nucleic acid-based tests to detect viremic samples to exclude them from transfusion represents an important public health challenge.
Therefore, there remains a need for the development of reliable diagnostic tests to detect hepatitis A virus in viremic samples, in order to prevent transmission of the virus through blood and plasma derivatives or by close personal contact.
The present invention is based on the development of a sensitive, reliable nucleic acid-based diagnostic test for the detection of hepatitis A virus (HAV) in biological samples from potentially infected individuals. The techniques described herein utilize extracted sample RNA as a template for amplification of HAV genomic sequence using transcription-mediated amplification (TMA), as well as in a 5′ nuclease assay, such as the TaqMan™ technique. The methods allow for the detection of HAV in viremic samples. Accordingly, infected samples can be identified and excluded from transfusion, as well as from the preparation of blood derivatives.
In one aspect, the invention is directed to an isolated polynucleotide comprising (a) a nucleotide sequence comprising any one of the nucleotide sequences depicted in SEQ ID NOs: 1-39; (b) an isolated polynucleotide encoding a polypeptide comprising any one of SEQ ID NOs: 40-48; (c) a sequence complementary to any one of the sequences of (a) or (b); or (d) a fragment of any of the sequences in (a) or (b) wherein the fragment is at least 10 nucleotides.
In another embodiment, the invention is directed to an oligonucleotide primer consisting of a promoter region recognized by a DNA-dependent RNA polymerase operably linked to a HAV-specific complexing sequence of about 10 to about 75 nucleotides. In certain embodiments, the promoter region is the T7 promoter and said polymerase is T7 RNA polymerase. Additionally, the HAV-specific sequence may be from the HAV genome, such as a nucleotide sequence comprising any one of the nucleotide sequences depicted in SEQ ID NOs: 1-39.
In yet further embodiments, the invention is directed an oligonucleotide primer consisting of a T7 promoter operably linked to a HAV-specific complexing sequence of about 10 to about 75 nucleotides, wherein the HAV-specific complexing sequence is derived from any one of the polynucleotide sequences of SEQ ID NOs: 1-39.
In another embodiment, the invention is directed to an oligonucleotide probe comprising a HAV-specific hybridizing sequence of about 10 to about 50 nucleotides linked to an acridinium ester label. In certain embodiments, the HAV-specific hybridizing sequence is a polynucleotide sequence derived from any one of the polynucleotide sequences of SEQ ID NOs: 1-39.
In another embodiment, the invention is directed to a vaccine composition comprising an isolated immunogenic Hepatitis A virus (HAV) polypeptide, and a pharmaceutically acceptable excipient, wherein the HAV polypeptide is a polypeptide with at least 80% sequence identity to any one of the sequences of SEQ ID NOs: 40-48, or an immunogenic fragment thereof comprising at least 10 amino acids.
In yet an additional embodiment, the invention is directed to a diagnostic test kit comprising one or more oligonucleotide primers described herein, and instructions for conducting the diagnostic test. In certain embodiments, the test kit further comprises an oligonucleotide probe comprising a HAV hybridizing sequence of about 10 to about 50 nucleotides linked to an acridinium ester label.
In another embodiment, the invention is directed to an immunoassay for detecting antibodies that bind to a hepatitis A virus polypeptide comprising: providing an antigen comprising a sequence having at least 80% sequence identity to any one of the sequences of SEQ ID NOs: 40-48, or fragment thereof; incubating the antigen with a biological sample under conditions that allow for formation of an antibody-antigen complex; and detecting any antibody-antigen complexes comprised of said antigen. The antigen may be immobilized on a solid support, and may be at least 10 amino acids. In addition, the biological sample can be bodily fluid, tissue, or organ, such as human blood or a fraction thereof.
In yet another embodiment, the invention is directed to a method for detecting Hepatitis A virus (HAV) infection in a biological sample, the method comprising (a) isolating nucleic acid from a biological sample suspected of containing Hepatitis A virus (HAV) RNA, wherein said nucleic acid comprises a target sequence, (b) reacting the HAV nucleic acid with a detectably labeled probe sufficiently complementary to and capable of hybridizing with the target sequence, wherein the probe is derived from any one of SEQ ID NOs: 1-39, and further wherein said reacting is done under conditions that provide for the formation of a probe/target sequence complex, and (c) detecting the presence or absence of label as an indication of the presence or absence of the target sequence.
These and other aspects of the present invention will become evident upon reference to the following detailed description and attached drawings. In addition, various references are set forth herein which describe in more detail certain procedures or compositions, and are therefore incorporated by reference in their entirety.
FIG. 1 illustrates the nucleotide sequence of the 243 base pair VP3/VP1 HAV fragment determined for thirteen Indonesian (IND) (SEQ ID NOs: 1-13) and fourteen Chilean (SCL) (SEQ ID NOs: 14-27) isolates.
FIG. 2 illustrates the nucleotide sequence (SEQ ID NO: 28) of a 2,950 bp KpnI/SphI insert encoding the HAV P1/2A precursor.
FIG. 3 illustrates the nucleotide sequence (SEQ ID NO: 29) of a 6,696 bp KpnI/SphI insert encoding the full length HAV open reading frame.
FIG. 4 illustrates the nucleotide sequence (SEQ ID NO: 30) of a 6,757 bp KpnI/SphI insert encoding the full length HAV open reading frame plus additional 3′ untranslated sequences.
FIG. 5 illustrates the nucleotide (SEQ ID NO: 31) and corresponding amino acid sequence (SEQ ID NO: 40) of the recombinant protein of 94 kDa consisting of the capsid precursor P1 (methionine1-glutamic acid791) plus the 45 amino terminal residues of the nonstructural protein 2A (serine792 through glutamine836).
FIG. 6 illustrates the nucleotide (SEQ ID NO: 32) and corresponding amino acid sequence (SEQ ID NO: 41) of the recombinant protein of 115.5 kDa consisting of precursor P1 (Met1-Glu791) fused with the nonstructural protein 2A (Ser792-Gln980).
FIG. 7 illustrates the nucleotide (SEQ ID NO: 33) and corresponding amino acid sequence (SEQ ID NO: 42) of the recombinant protein of 25 kDa (Asp24-Gln245) representing HAV capsid protein 1B (VP2 gene product).
FIG. 8 illustrates the nucleotide (SEQ ID NO: 34) and corresponding amino acid sequence (SEQ ID NO: 43) of the recombinant protein of 28 kDa (Met246-Gln491) representing HAV capsid protein 1C (VP3 gene product).
FIG. 9 illustrates the nucleotide (SEQ ID NO: 35) and corresponding amino acid sequence (SEQ ID NO: 44) of the recombinant protein of 33.3 kDa (Val492-Glu791) representing HAV capsid protein 1D (VP1 gene, product).
FIG. 10 illustrates the nucleotide (SEQ ID NO: 36) and corresponding amino acid sequence (SEQ ID NO: 45) of the recombinant protein of 38.8 kDa consisting of human superoxide dismutase (153 aminoacids) fused with the HAV nonstructural protein 2A (Ser792-Gln980).
FIG. 11 illustrates the nucleotide (SEQ ID NO: 37) and corresponding amino acid sequence (SEQ ID NO: 46) of the recombinant protein of 24.9 kDa consisting of human superoxide dismutase (153 amino acids) fused with the HAV nonstructural protein 3A (Gly1423 -Glu1496).
FIG. 12 illustrates the nucleotide (SEQ ID NO: 38) and corresponding amino acid sequence (SEQ ID NO: 47) of the recombinant protein of 41 kDa consisting of human superoxide dismutase (153 amino acids) fused with the HAV nonstructural protein 3C (Protease: Ser1520-Gln1678).
FIG. 13 illustrates the nucleotide (SEQ ID NO: 39) and corresponding amino acid sequence (SEQ ID NO: 48) of the recombinant protein of human superoxide dismutase (153 amino acids) fused with the HAV nonstructural protein 3D (RNA dependent RNA polymerase: Arg1739-Ser2227).
The practice of the present invention will employ, unless otherwise indicated, conventional methods of chemistry, biochemistry, recombinant DNA techniques and virology, within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Fundamental Virology, 2nd Edition, vol. I & II (B. N. Fields and D. M. Knipe, eds.); A. L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Oligonucleotide Synthesis (N. Gait, ed., 1984); A Practical Guide to Molecular Cloning (1984).
All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.
It must be noted that, as used in this specification and the appended claims, the singular forms “a”, “an” and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “an antigen” includes a mixture of two or more antigens, and the like.
The following amino acid abbreviations are used throughout the text:
In describing the present invention, the following terms will be employed, and are intended to be defined as indicated below.
The terms “polypeptide” and “protein” refer to a polymer of amino acid residues and are not limited to a minimum length of the product. Thus, peptides, oligopeptides, dimers, multimers, and the like, are included within the definition. Both full-length proteins and fragments thereof are encompassed by the definition. The terms also include postexpression modifications of the polypeptide, for example, glycosylation, acetylation, phosphorylation and the like. Furthermore, for purposes of the present invention, a “polypeptide” refers to a protein which includes modifications, such as deletions, additions and substitutions (generally conservative in nature), to the native sequence, so long as the protein maintains the desired activity. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the proteins or errors due to PCR amplification.
The terms “analog” and “mutein” refer to biologically active derivatives of the reference molecule, or fragments of such derivatives, that retain desired activity, such as immunoreactivity in diagnostic assays. In general, the term “analog” refers to compounds having a native polypeptide sequence and structure with one or more amino acid additions, substitutions (generally conservative in nature) and/or deletions, relative to the native molecule, so long as the modifications do not destroy immunogenic activity. The term “mutein” refers to peptides having one or more peptide mimics (“peptoids”), such as those described in International Publication No. WO 91/04282. Preferably, the analog or mutein has at least the same immunoactivity as the native molecule. Methods for making polypeptide analogs and muteins are known in the art and are described further below.
Particularly preferred analogs include substitutions that are conservative in nature, i.e., those substitutions that take place within a family of amino acids that are related in their side chains. Specifically, amino acids are generally divided into four families: (1) acidic—aspartate and glutamate; (2) basic—lysine, arginine, histidine; (3) non-polar—alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar—glycine, asparagine, glutamine, cysteine, serine threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. For example, it is reasonably predictable that an isolated replacement of leucine with isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar conservative replacement of an amino acid with a structurally related amino acid, will not have a major effect on the biological activity. For example, the polypeptide of interest may include up to about 5-10 conservative or non-conservative amino acid substitutions, or even up to about 15-25 conservative or non-conservative amino acid substitutions, or any integer between 5-25, so long as the desired function of the molecule remains intact. One of skill in the art may readily determine regions of the molecule of interest that can tolerate change by reference to Hopp/Woods and Kyte-Doolittle plots, well known in the art.
By “isolated” is meant, when referring to a polypeptide, that the indicated molecule is separate and discrete from the whole organism with which the molecule is found in nature or is present in the substantial absence of other biological macro-molecules of the same type. The term “isolated” with respect to a polynucleotide is a nucleic acid molecule devoid, in whole or part, of sequences normally associated with it in nature; or a sequence, as it exists in nature, but having heterologous sequences in association therewith; or a molecule disassociated from the chromosome.
A polynucleotide “derived from” or “specific for” a designated sequence refers to a polynucleotide sequence which comprises a contiguous sequence of approximately at least about 6 nucleotides, preferably at least about 8 nucleotides, more preferably at least about 10-12 nucleotides, and even more preferably at least about 15-20 nucleotides corresponding, i.e., identical or complementary to, a region of the designated nucleotide sequence. The derived polynucleotide will not necessarily be derived physically from the nucleotide sequence of interest, but may be generated in any manner, including, but not limited to, chemical synthesis, replication, reverse transcription or transcription, which is based on the information provided by the sequence of bases in the region(s) from which the polynucleotide is derived. As such, it may represent either a sense or an antisense orientation of the original polynucleotide.
“Homology” refers to the percent similarity between two polynucleotide or two polypeptide moieties. Two DNA, or two polypeptide sequences are “substantially homologous” to each other when the sequences exhibit at least about 50%, preferably at least about 75%, more preferably at least about 80%-85%, preferably at least about 90%, and most preferably at least about 95%-98% sequence similarity over a defined length of the molecules. As used herein, substantially homologous also refers to sequences showing complete identity to the specified DNA or polypeptide sequence.
In general, “identity” refers to an exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Percent identity can be determined by a direct comparison of the sequence information between two molecules by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the shorter sequence, and multiplying the result by 100.
Readily available computer programs can be used to aid in the analysis of homology and identity, such as ALIGN, Dayhoff, M. O. in Atlas of Protein Sequence and Structure M. O. Dayhoff ed., 5 Suppl. 3:353-358, National biomedical Research Foundation, Washington, D.C., which adapts the local homology algorithm of Smith and Waterman Advances in Appl. Math. 2:482-489, 1981 for peptide analysis. Programs for determining nucleotide sequence homology are available in the Wisconsin Sequence Analysis Package, Version 8 (available from Genetics Computer Group, Madison, Wis.) for example, the BESTFIT, FASTA and GAP programs, which also rely on the Smith and Waterman algorithm. These programs are readily utilized with the default parameters recommended by the manufacturer and described in the Wisconsin Sequence Analysis Package referred to above. For example, percent homology of a particular nucleotide sequence to a reference sequence can be determined using the homology algorithm of Smith and Waterman with a default scoring table and a gap penalty of six nucleotide positions.
Another method of establishing percent homology in the context of the present invention is to use the MPSRCH package of programs copyrighted by the University of Edinburgh, developed by John F. Collins and Shane S. Sturrok, and distributed by IntelliGenetics, Inc. (Mountain View, Calif.). From this suite of packages the Smith-Waterman algorithm can be employed where default parameters are used for the scoring table (for example, gap open penalty of 12, gap extension penalty of one, and a gap of six). From the data generated the “Match” value reflects “sequence homology.” Other suitable programs for calculating the percent identity or similarity between sequences are generally known in the art, for example, another alignment program is BLAST, used with default parameters. For example, BLASTN and BLASTP can be used using the following default parameters: genetic code=standard; filter=none; strand=both; cutoff=60; expect=10; Matrix=BLOSUM62; Descriptions=50 sequences; sort by=HIGH SCORE; Databases=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+Swiss protein+Spupdate+PIR. Details of these programs can be found at the following internet address: http://www.ncbi.nlm.gov/cgi-bin/BLAST:
Alternatively, homology can be determined by hybridization of polynucleotides under conditions which form stable duplexes between homologous regions, followed by digestion with single-stranded-specific nuclease(s), and size determination of the digested fragments. DNA sequences that are substantially homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions, as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Sambrook et al., supra; DNA Cloning, supra; Nucleic Acid Hybridization, supra.
“Operably linked” refers to an arrangement of elements wherein the components so described are configured so as to perform their desired function. Thus, a given promoter operably linked to a nucleic acid sequence is capable of effecting the transcription, and in the case of a coding sequence, the expression of the coding sequence when the proper transcription factors, etc., are present. The promoter need not be contiguous with the nucleic acid sequence, so long as it functions to direct the transcription and/or expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between the promoter sequence and the coding sequence, as can transcribed introns, and the promoter sequence can still be considered “operably linked” to the coding sequence.
“Recombinant” as used herein to describe a nucleic acid molecule means a polynucleotide of genomic, cDNA, viral, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation is not associated with all or a portion of the polynucleotide with which it is associated in nature. The term “recombinant” as used with respect to a protein or polypeptide means a polypeptide produced by expression of a recombinant polynucleotide. In general, the gene of interest is cloned and then expressed in transformed organisms, as described further below. The host organism expresses the foreign gene to produce the protein under expression conditions.
A “control element” refers to a polynucleotide sequence which aids in the transcription and/or translation of a nucleotide sequence to which it is linked. The term includes promoters, transcription termination sequences, upstream regulatory domains, polyadenylation signals, untranslated regions, including 5′-UTRs and 3′-UTRs and when appropriate, leader sequences and enhancers, which collectively provide for the transcription and translation of a coding sequence in a host cell.
A “promoter” as used herein is a regulatory region capable of binding a polymerase and initiating transcription of a downstream (3′ direction) nucleotide sequence operably linked thereto. For purposes of the present invention, a promoter sequence includes the minimum number of bases or elements necessary to initiate transcription of a sequence of interest at levels detectable above background. Within the promoter sequence is a transcription initiation site, as well as protein binding domains (consensus sequences) responsible for the binding of RNA or DNA polymerase. For example, promoter may be a nucleic acid sequence that is recognized by a DNA-dependent RNA polymerase (“transcriptase”) as a signal to bind to the nucleic acid and begin the transcription of RNA at a specific site. For binding, such transcriptases generally require DNA which is double-stranded in the portion comprising the promoter sequence and its complement; the template portion (sequence to be transcribed) need not be double-stranded. Individual DNA-dependent RNA polymerases recognize a variety of different promoter sequences which can vary markedly in their efficiency in promoting transcription. When an RNA polymerase binds to a promoter sequence to initiate transcription, that promoter sequence is not part of the sequence transcribed. Thus, the RNA transcripts produced thereby will not include that sequence.
A control sequence “directs the transcription” of a nucleotide sequence when RNA or DNA polymerase will bind the promoter sequence and transcribe the adjacent sequence.
A “DNA-dependent DNA polymerase” is an enzyme that synthesizes a complementary DNA copy from a DNA template. Examples are DNA polymerase I from E. coli and bacteriophage T7 DNA polymerase. All known DNA-dependent DNA polymerases require a complementary primer to initiate synthesis. Under suitable conditions, a DNA-dependent DNA polymerase may synthesize a complementary DNA copy from an RNA template.
A “DNA-dependent RNA polymerase” or a “transcriptase” is an enzyme that synthesizes multiple RNA copies from a double-stranded or partially-double stranded DNA molecule having a (usually double-stranded) promoter sequence. The RNA molecules (“transcripts”) are synthesized in the 5′ to 3′ direction beginning at a specific position just downstream of the promoter. Examples of transcriptases are the DNA-dependent RNA polymerase from E. coli and bacteriophages T7, T3, and SP6.
An “RNA-dependent DNA polymerase” or “reverse transcriptase” is an enzyme that synthesizes a complementary DNA copy from an RNA template. All known reverse transcriptases also have the ability to make a complementary DNA copy from a DNA template; thus, they are both RNA- and DNA-dependent DNA polymerases. A primer is required to initiate synthesis with both RNA and DNA templates.
“RNAse H” is an enzyme that degrades the RNA portion of an RNA:DNA duplex. These enzymes may be endonucleases or exonucleases. Most reverse transcriptase enzymes normally contain an RNAse H activity in addition to their polymerase activity. However, other sources of the RNAse H are available without an associated polymerase activity. The degradation may result in separation of RNA from a RNA:DNA complex. Alternatively, the RNAse H may simply cut the RNA at various locations such that portions of the RNA melt off or permit enzymes to unwind portions of the RNA.
The terms “polynucleotide,” “oligonucleotide,” “nucleic acid” and “nucleic acid molecule” are used herein to include a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, the term includes triple-, double- and single-stranded DNA, as well as triple-, double- and single-stranded RNA. It also includes modifications, such as by methylation and/or by capping, and unmodified forms of the polynucleotide. More particularly, the terms “polynucleotide,” “oligonucleotide,” “nucleic acid” and “nucleic acid molecule” include polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing nonnucleotidic backbones, for example, polyamide (e.g., peptide nucleic acids (PNAs)) and polymorpholino (commercially available from the Anti-Virals, Inc., Corvallis, Ore., as Neugene) polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA. There is no intended distinction in length between the terms “polynucleotide,” “oligonucleotide,” “nucleic acid” and “nucleic acid molecule,” and these terms will be used interchangeably. These terms refer only to the primary structure of the molecule. Thus, these terms include, for example, 3′-deoxy-2′,5′-DNA, oligodeoxyribonucleotide N3′ P5′ phosphoramidates, 2′-O-alkyl-substituted RNA, double- and single-stranded DNA, as well as double- and single-stranded RNA, DNA:RNA hybrids, and hybrids between PNAs and DNA or RNA, and also include known types of modifications, for example, labels which are known in the art, methylation, “caps,” substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), with negatively charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), and with positively charged linkages (e.g., aminoalklyphosphoramidates, aminoalkylphosphotriesters), those containing pendant moieties, such as, for example, proteins (including nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylators, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.), as well as unmodified forms of the polynucleotide or oligonucleotide. In particular, DNA is deoxyribonucleic acid.
As used herein, the term “target nucleic acid region” or “target nucleic acid” denotes a nucleic acid molecule with a “target sequence” to be amplified. The target nucleic acid may be either single-stranded or double-stranded and may include other sequences besides the target sequence, which may not be amplified. The term “target sequence” refers to the particular nucleotide sequence of the target nucleic acid which is to be amplified. The target sequence may include a probe-hybridizing region contained within the target molecule with which a probe will form a stable hybrid under desired conditions. The “target sequence” may also include the complexing sequences to which the oligonucleotide primers complex and be extended using the target sequence as a template. Where the target nucleic acid is originally single-stranded, the term “target sequence” also refers to the sequence complementary to the “target sequence” as present in the target nucleic acid. If the “target nucleic acid” is originally double-stranded, the term “target sequence” refers to both the plus (+) and minus (−) strands.
The term “primer” or “oligonucleotide primer” as used herein, refers to an oligonucleotide which acts to initiate synthesis of a complementary DNA strand when placed under conditions in which synthesis of a primer extension product is induced, i.e., in the presence of nucleotides and a polymerization-inducing agent such as a DNA or RNA polymerase and at suitable temperature, pH, metal concentration, and salt concentration. The primer is preferably single-stranded for maximum efficiency in amplification, but may alternatively be double-stranded. If double-stranded, the primer is first treated to separate its strands before being used to prepare extension products. This denaturation step is typically effected by heat, but may alternatively be carried out using alkali, followed by neutralization. Thus, a “primer” is complementary to a template, and complexes by hydrogen bonding or hybridization with the template to give a primer/template complex for initiation of synthesis by a polymerase, which is extended by the addition of covalently bonded bases linked at its 3′ end complementary to the template in the process of DNA synthesis.
As used herein, the term “probe” or “oligonucleotide probe” refers to a structure comprised of a polynucleotide, as defined above, that contains a nucleic acid sequence complementary to a nucleic acid sequence present in the target nucleic acid analyte. The polynucleotide regions of probes may be composed of DNA, and/or RNA, and/or synthetic nucleotide analogs. When an “oligonucleotide probe” is to be used in a 5′ nuclease assay, such as the TaqMan™ technique, the probe will contain at least one fluorescer and at least one quencher which is digested by the 5′ endonuclease activity of a polymerase used in the reaction in order to detect any amplified target oligonucleotide sequences. In this context, the oligonucleotide probe will have a sufficient number of phosphodiester linkages adjacent to its 5′ end so that the 5′ to 3′ nuclease activity employed can efficiently degrade the bound probe to separate the fluorescers and quenchers. When an oligonucleotide probe is used in the TMA technique, it will be suitably labeled, as described below.
It will be appreciated that the hybridizing sequences need not have perfect complementarity to provide stable hybrids. In many situations, stable hybrids will form where fewer than about 10% of the bases are mismatches, ignoring loops of four or more nucleotides. Accordingly, as used herein the term “complementary” refers to an oligonucleotide that forms a stable duplex with its “complement” under assay conditions, generally where there is about 90% or greater homology.
The terms “hybridize” and “hybridization” refer to the formation of complexes between nucleotide sequences which are sufficiently complementary to form complexes via Watson-Crick base pairing. Where a primer “hybridizes” with target (template), such complexes (or hybrids) are sufficiently stable to serve the priming function required by, e.g., the DNA polymerase to initiate DNA synthesis.
Stringent hybridization conditions will typically include salt concentrations of less than about 1 M, more usually less than about 500 mM and preferably less than about 200 mM. Hybridization temperatures can be as low as 5° C., but are typically greater than 22° C., more typically greater than about 30° C., and preferably in excess of about 37° C. Longer fragments may require higher hybridization temperatures for specific hybridization. Other factors may affect the stringency of hybridization, including base composition and length of the complementary strands, presence of organic solvents and extent of base mismatching, and the combination of parameters used is more important than the absolute measure of any one alone. Other hybridization conditions which may be controlled include buffer type and concentration, solution pH, presence and concentration of blocking reagents to decrease background binding such as repeat sequences or blocking protein solutions, detergent type(s) and concentrations, molecules such as polymers which increase the relative concentration of the polynucleotides, metal ion(s) and their concentration(s), chelator(s) and their concentrations, and other conditions known in the art. Less stringent, and/or more physiological, hybridization conditions are used where a labeled polynucleotide amplification product cycles on and off a substrate linked to a complementary probe polynucleotide during a real-time assay which is monitored during PCR amplification such as a molecular beacon assay. Such less stringent hybridization conditions can also comprise solution conditions effective for other aspects of the method, for example reverse transcription or PCR.
As used herein, the term “binding pair” refers to first and second molecules that specifically bind to each other, such as complementary polynucleotide pairs capable of forming nucleic acid duplexes. “Specific binding” of the first member of the binding pair to the second member of the binding pair in a sample is evidenced by the binding of the first member to the second member, or vice versa, with greater affinity and specificity than to other components in the sample. The binding between the members of the binding pair is typically noncovalent. Unless the context clearly indicates otherwise, the terms “affinity molecule” and “target analyte” are used herein to refer to first and second members of a binding pair, respectively.
The terms “specific-binding molecule” and “affinity molecule” are used interchangeably herein and refer to a molecule that will selectively bind, through chemical or physical means to a detectable substance present in a sample. By “selectively bind” is meant that the molecule binds preferentially to the target of interest or binds with greater affinity to the target than to other molecules. For example, a DNA molecule will bind to a substantially complementary sequence and not to unrelated sequences.
The “melting temperature” or “Tm” of double-stranded DNA is defined as the temperature at which half of the helical structure of DNA is lost due to heating or other dissociation of the hydrogen bonding between base pairs, for example, by acid or alkali treatment, or the like. The Tm of a DNA molecule depends on its length and on its base composition. DNA molecules rich in GC base pairs have a higher Tm than those having an abundance of AT base pairs. Separated complementary strands of DNA spontaneously reassociate or anneal to form duplex DNA when the temperature is lowered below the Tm. The highest rate of nucleic acid hybridization occurs approximately 25° C. below the Tm. The Tm may be estimated using the following relationship: Tm=69.3+0.41(GC)% (Marmur et al. (1962) J. Mol. Biol. 5:109-118).
As used herein, a “biological sample” refers to a sample of tissue or fluid isolated from a subject, that commonly includes antibodies produced by the subject. Typical samples that include such antibodies are known in the art and include but not limited to, blood, plasma, serum, fecal matter, urine, bone marrow, bile, spinal fluid, lymph fluid, samples of the skin, secretions of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, organs, biopsies and also samples of in vitro cell culture constituents including but not limited to conditioned media resulting from the growth of cells and tissues in culture medium, e.g., recombinant cells, and cell components.
As used herein, the terms “label” and “detectable label” refer to a molecule capable of detection, including, but not limited to, radioactive isotopes, fluorescers, chemiluminescers, chromophores, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, chromophores, dyes, metal ions, metal sols, ligands (e.g., biotin, avidin, strepavidin or haptens) and the like. The term “fluorescer” refers to a substance or a portion thereof which is capable of exhibiting fluorescence in the detectable range.
An “antigen” includes any substance that may be specifically bound by an antibody molecule. Thus, the term “antigen” encompasses biologic molecules including, but not limited to, simple intermediary metabolites, sugars, lipids, autoacids, and hormones, as well as macromolecules such as complex carbohydrates, phopholipids, nucleic acids and proteins.
An “immunogen” is a macromolecular antigen that is capable of initiating lymphocyte activation resulting in an antigen-specific immune response. An immunogen therefore includes any molecule which contains one or more epitopes that will stimulate a host's immune system to initiate a secretory, humoral and/or cellular antigen-specific response.
The term “antibody” encompasses polyclonal and monoclonal antibody preparations, as well as preparations including hybrid antibodies, altered antibodies, chimeric antibodies and, humanized antibodies, as well as: hybrid (chimeric) antibody molecules (see, for example, Winter et al. (1991) Nature 349:293-299; and U.S. Pat. No. 4,816,567); F(ab′)2 and F(ab) fragments; Fv molecules (noncovalent heterodimers, see, for example, Inbar et al. (1972) Proc Natl Acad Sci USA 69:2659-2662; and Ehrlich et al. (1980) Biochem 19:4091-4096); single-chain Fv molecules (sFv) (see, e.g., Huston et al. (1988) Proc Natl Acad Sci USA 85:5879-5883); dimeric and trimeric antibody fragment constructs; minibodies (see, e.g., Pack et al. (1992) Biochem 31:1579-1584; Cumber et al. (1992) J Immunology 149B:120-126); humanized antibody molecules (see, e.g., Riechmann et al. (1988) Nature 332:323-327; Verhoeyan et al. (1988) Science 239:1534-1536; and U.K. Patent Publication No. GB 2,276,169, published 21 Sep. 1994); and, any functional fragments obtained from such molecules, wherein such fragments retain specific-binding properties of the parent antibody molecule.
As used herein, the term “monoclonal antibody” refers to an antibody composition having a homogeneous antibody population. The term is not limited regarding the species or source of the antibody, nor is it intended to be limited by the manner in which it is made. The term encompasses whole immunoglobulins.
Methods of making polyclonal and monoclonal antibodies are known in the art. Polyclonal antibodies are generated by immunizing a suitable animal, such as a mouse, rat, rabbit, sheep or goat, with an antigen of interest. In order to enhance immunogenicity, the antigen can be linked to a carrier prior to immunization. Suitable carriers are typically large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, lipid aggregates (such as oil droplets or liposomes), and inactive virus particles. Such carriers are well known to those of ordinary skill in the art. Furthermore, the antigen may be conjugated to a bacterial toxoid, such as toxoid from diphtheria, tetanus, cholera, etc., in order to enhance the immunogenicity thereof.
Rabbits, sheep and goats are preferred for the preparation of polyclonal sera when large volumes of sera are desired. These animals are good design choices also because of the availability of labeled anti-rabbit, anti-sheep and anti-goat antibodies. Immunization is generally performed by mixing or emulsifying the antigen in saline, preferably in an adjuvant such as Freund's complete adjuvant (“FCA”), and injecting the mixture or emulsion parenterally (generally subcutaneously or intramuscularly). The animal is generally boosted 2-6 weeks later with one or more injections of the antigen in saline, preferably using Freund's incomplete adjuvant (“FIA”). Antibodies may also be generated by in vitro immunization, using methods known in the art. Polyclonal antisera is then obtained from the immunized animal.
Monoclonal antibodies are generally prepared using the method of Kohler and Milstein, Nature (1975) 256:495-497, or a modification thereof. Typically, a mouse or rat is immunized as described above. However, rather than bleeding the animal to extract serum, the spleen (and optionally several large lymph nodes) is removed and dissociated into single cells. If desired, the spleen cells may be screened (after removal of non-specifically adherent cells) by applying a cell suspension to a plate or well coated with the antigen. B-cells, expressing membrane-bound immunoglobulin specific for the antigen, will bind to the plate, and are not rinsed away with the rest of the suspension. Resulting B-cells, or all dissociated spleen cells, are then induced to fuse with myeloma cells to form hybridomas, and are cultured in a selective medium (e.g., hypoxanthine, aminopterin, thymidine medium, “HAT”). The resulting hybridomas are plated by limiting dilution, and are assayed for the production of antibodies which bind specifically to the immunizing antigen (and which do not bind to unrelated antigens). The selected monoclonal antibody-secreting hybridomas are then cultured either in vitro (e.g., in tissue culture bottles or hollow fiber reactors), or in vivo (e.g., as ascites in mice).
II. Modes of Carrying Out the Invention
Before describing the present invention in detail, it is to be understood that this invention is not limited to particular formulations or process parameters as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting.
Although a number of compositions and methods similar or equivalent to those described herein can be used in the practice of the present invention, the preferred materials and methods are described herein.
As noted above, the present invention is based on the discovery of novel diagnostic methods for accurately detecting HAV infection in a biological sample. The methods rely on sensitive nucleic acid-based detection techniques that allow identification of HAV target nucleic acid sequences in samples containing small amounts of virus.
In particular, the inventors herein have characterized regions within the HAV genome which are desirable targets for diagnostic tests. Primers and probes derived from these regions are extremely useful for detection of HAV infection in biological samples.
HAV primers and probes described above are used in nucleic acid-based assays for the detection of HAV infection in biological samples. In particular, primers and probes for use in these assays are preferably derived from the nucleotide sequences depicted in FIGS. 1-13 herein.
Particularly preferred primers and probes for use with the present assays are designed from HAV genome to allow detection of HAV infection caused by a variety of isolates.
The four capsid proteins, nonstructural proteins, protease and the junction between the capsid precursor P1 and 2A are readily obtained from additional isolates using portions of the HAV sequence found within these particular regions as primers in PCR reactions such as those described herein. Another method of obtaining nucleotide sequences with the desired sequences is by annealing complementary sets of overlapping synthetic oligonucleotides produced in a conventional, automated polynucleotide synthesizer, followed by ligation with an appropriate DNA ligase and amplification of the ligated nucleotide sequence via PCR. See, e.g., Jayaraman et al. (1991) Proc. Natl. Acad. Sci. USA 88:4084-4088. Once the sequences have been prepared or isolated, they can be cloned into any suitable vector or replicon. Numerous cloning vectors are known to those of skill in the art, and the selection of an appropriate cloning vector is a matter of choice. Suitable vectors include, but are not limited to, plasmids, phages, transposons, cosmids, chromosomes or viruses which are capable of replication when associated with the proper control elements.
Recombinant clones are readily identified by restriction enzyme analysis and polyacryamide or agarose gel electrophresis, using techniques well known in the art, and described in the examples below.
Polynucleotides of the invention encoding the HAV proteins are useful for designing hybridization probes for isolating and identifying cDNA clones and genomic clones encoding HAV proteins or allelic forms thereof. Such hybridization techniques are known to those of skill in the art. Sequence of polynucleotides that encode HAV proteins are also useful for designing primers for polymerase chain reaction (PCR). Also encompassed by the present invention, are single stranded polynucleotides, hereinafter referred to as antisense polynucleotides, having sequences which are complementary to the RNA sequences which encode the HAV proteins.
Primers and probes for use in the assays herein are derived from these sequences and are readily synthesized by standard techniques, e.g., solid phase synthesis via phosphoramidite chemistry, as disclosed in U.S. Pat. Nos. 4,458,066 and 4,415,732, incorporated herein by reference; Beaucage et al. (1992) Tetrahedron 48:2223-2311; and Applied Biosystems User Bulletin No. 13 (1 Apr. 1987). Other chemical synthesis methods include, for example, the phosphotriester method described by Narang et al., Meth. Enzymol. (1979) 68:90 and the phosphodiester method disclosed by Brown et al., Meth. Enzymol. (1979) 68:109. Poly(A) or poly(C), or other non-complementary nucleotide extensions may be incorporated into probes using these same methods. Hexaethylene oxide extensions may be coupled to probes by methods known in the art. Cload et al. (1991) J. Am. Chem. Soc. 113:6324-6326; U.S. Pat. No. 4,914,210 to Levenson et al.; Durand et al. (1990) Nucleic Acids Res. 18:6353-6359; and Horn et al. (1986) Tet. Lett. 27:4705-4708. Typically, the primer sequences are in the range of between 10-100 nucleotides in length, such as 15-60, 20-40 and so on, more typically in the range of between 20-40 nucleotides long, and any length between the stated ranges. The typical probe is in the range of between 10-100 nucleotides long, such as 10-50, 15-40, 18-30, and so on, and any length between the stated ranges.
Thus, one aspect of the invention encompasses oligonucleotides that are used as primers and probes in polymerase chain reaction (PCR) technologies to amplify transcripts of the genes which encode HAV proteins or portions of such transcripts. Preferably, the primers have a G+C content of 40% or greater. Such oligonucleotides are at least 80% complementary with a sequence of SEQ ID NOs: 1-39. Preferably, the primers and probes are at least 85% complementarity, 90% complementary, 95% complementary or more preferably 98% or 99% complementary with the sense strand or its corresponding antisense strand of SEQ ID NOs: 1-39.
Moreover, the probes may be coupled to labels for detection. There are several means known for derivatizing oligonucleotides with reactive functionalities which permit the addition of a label. For example, several approaches are available for biotinylating probes so that radioactive, fluorescent, chemiluminescent, enzymatic, or electron dense labels can be attached via avidin. See, e.g., Broken et al. (1978) Nucl. Acids Res. 5:363-384 which discloses the use of ferritin-avidin-biotin labels; and Chollet et al. (1985) Nucl. Acids Res. 13:1529-1541 which discloses biotinylation of the 5′ termini of oligonucleotides via an aminoalkylphosphoramide linker arm. Several methods are also available for synthesizing amino-derivatized oligonucleotides which are readily labeled by fluorescent or other types of compounds derivatized by amino-reactive groups, such as isothiocyanate, N-hydroxysuccinimide, or the like, see, e.g., Connolly (1987) Nucl. Acids Res. 15:3131-3139, Gibson et al. (1987) Nucl. Acids Res. 15:6455-6467 and U.S. Pat. No. 4,605,735 to Miyoshi et al. Methods are also available for synthesizing sulfhydryl-derivatized oligonucleotides which can be reacted with thiol-specific labels, see, e.g., U.S. Pat. No. 4,757,141 to Fung et al., Connolly et al. (1985) Nucl. Acids Res. 13:4485-4502 and Spoat et al. (1987) Nucl. Acids Res. 15:4837-4848. A comprehensive review of methodologies for labeling DNA fragments is provided in Matthews et al., Anal. Biochem. (1988) 169:1-25.
For example, probes may be fluorescently labeled by linking a fluorescent molecule to the non-ligating terminus of the probe. Guidance for selecting appropriate fluorescent labels can be found in Smith et al., Meth. Enzymol. (1987) 155:260-301; Karger et al., Nucl. Acids Res. (1991) 19:4955-4962; Haugland (1989) Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Inc., Eugene, Ore.). Preferred fluorescent labels include fluorescein and derivatives thereof, such as disclosed in U.S. Pat. No. 4,318,846 and Lee et al., Cytometry (1989) 10:151-164. Dyes for use in the present invention include 3-pheniyl-7-isocyanatocoumarini, acridines, such as 9-isothiocyanatoacridine and acridine orange, pyrenes, benzoxadiazoles, and stilbenes. Additional dyes include 3-(ε-carboxypentyl)-3′-ethyl-5,5′-dimethyloxa-carbocyanine (CYA); 6-carboxy fluorescein (FAM); 5,6-carboxyrhodamine-110 (R110); 6-carboxyrhodamine-6G (R6G); N′,N′,N′,N′-tetramethyl-6-carboxyrhodamine (TAMRA); 6-carboxy-X-rhodamine (ROX); 2′,4′,5′,7′, -tetrachloro-4-7-dichlorofluorescein (TET); 2′,7′-dimethoxy-4′,5′-6 carboxyrhodamine (JOE); 6-carboxy-2′,4,4′,5′,7,7′-hexachlorofluorescein (HEX); ALEXA; Cy3 and Cy5. These dyes are commercially available from various suppliers such as Applied Biosystems Division of Perkin Elmer Corporation (Foster City, Calif.), and Molecular Probes, Inc. (Eugene, Ore.). Preferred fluorescent labels include fluorescein and derivatives thereof, such as disclosed in U.S. Pat. No. 4,318,846 and Lee et al., Cytometry (1989) 10:151-164, and 6-FAM, JOE, TAMRA, ROX, HEX-1, HEX-2, ZOE, TET-1 or NAN-2, and the like.
Additionally, probes can be labeled with an acridinium ester (AE) using the techniques described below. Current technologies allow the AE label to be placed at any location within the probe. See, e.g., Nelson et al. (1995) “Detection of Acridinium Esters by Chemiluminescence” in Nonisotopic Probing, Blotting and Sequencing, Kricka L. J.(ed) Academic Press, San Diego, Calif.; Nelson et al. (1994) “Application of the Hybridization Protection Assay (HPA) to PCR” in The Polymerase Chain Reaction, Mullis et al. (eds.) Birkhauser, Boston, Mass.; Weeks et al., Clin. Chem. (1983) 29:1474-1479; Berry et al., Clin. Chem. (1988) 34:2087-2090. An AE molecule can be directly attached to the probe using non-nucleotide-based linker arm chemistry that allows placement of the label at any location within the probe. See, e.g., U.S. Pat. Nos. 5,585,481 and 5,185,439.
The primers and probes described above may be used in polymerase chain reaction (PCR)-based techniques to detect HAV infection in biological samples. PCR is a technique for amplifying a desired target nucleic acid sequence contained in a nucleic acid molecule or mixture of molecules. In PCR, a pair of primers is employed in excess to hybridize to the complementary strands of the target nucleic acid. The primers are each extended by a polymerase using the target nucleic acid as a template. The extension products become target sequences themselves after dissociation from the original target strand. New primers are then hybridized and extended by a polymerase, and the cycle is repeated to geometrically increase the number of target sequence molecules. The PCR method for amplifying target nucleic acid sequences in a sample is well known in the art and has been described in, e.g., Innis et al. (eds.) PCR Protocols (Academic Press, NY 1990); Taylor (1991) Polymerase chain reaction: basic principles and automation, in PCR: A Practical Approach, McPherson et al. (eds.) IRL Press, Oxford; Saiki et al. (1986) Nature 324:163; as well as in U.S. Pat. Nos. 4,683,195, 4,683,202 and 4,889,818, all incorporated herein by reference in their entireties.
In particular, PCR uses relatively short oligonucleotide primers which flank the target nucleotide sequence to be amplified, oriented such that their 3′ ends face each other, each primer extending toward the other. The polynucleotide sample is extracted and denatured, preferably by heat, and hybridized with first and second primers which are present in molar excess. Polymerization is catalyzed in the presence of the four deoxyribonucleotide triphosphates (dNTPs—dATP, dGTP, dCTP and dTTP) using a primer- and template-dependent polynucleotide polymerizing agent, such as any enzyme capable of producing primer extension products, for example, E. coli DNA polymerase I, Klenow fragment of DNA polymerase I, T4 DNA polymerase, thermostable DNA polymerases isolated from Thermus aquaticus (Taq), available from a variety of sources (for example, Perkin Elmer), Thermus thermophilus (United States Biochemicals), Bacillus stereothermophilus (Bio-Rad), or Thermococcus litoralis (“Vent” polymerase, New England Biolabs). This results in two “long products” which contain the respective primers at their 5′ ends covalently linked to the newly synthesized complements of the original strands. The reaction mixture is then returned to polymerizing conditions, e.g., by lowering the temperature, inactivating a denaturing agent, or adding more polymerase, and a second cycle is initiated. The second cycle provides the two original strands, the two long products from the first cycle, two new long products replicated from the original strands, and two “short products” replicated from the long products. The short products have the sequence of the target sequence with a primer at each end. On each additional cycle, an additional two long products are produced, and a number of short products equal to the number of long and short products remaining at the end of the previous cycle. Thus, the number of short products containing the target sequence grow exponentially with each cycle. Preferably, PCR is carried out with a commercially available thermal cycler, e.g., Perkin Elmer.
RNAs may be amplified by reverse transcribing the mRNA into cDNA, and then performing PCR (RT-PCR), as described above. Alternatively, a single enzyme may be used for both steps as described in U.S. Pat. No. 5,322,770. mRNA may also be reverse transcribed into cDNA, followed by asymmetric gap ligase chain reaction (RT-AGLCR) as described by Marshall et al. (1994) PCR Meth. App. 4:80-84.
The fluorogenic 5′ nuclease assay, known as the TaqMan™ assay (Perkin-Elmer), is a powerful and versatile PCR-based detection system for nucleic acid targets. Hence, primers and probes derived from regions of the HAV genome described herein can be used in TaqMan™ analyses to detect the presence of infection in a biological sample. Analysis is performed in conjunction with thermal cycling by monitoring the generation of fluorescence signals. The assay system dispenses with the need for gel electrophoretic analysis, and has the capability to generate quantitative data allowing the determination of target copy numbers.
The fluorogenic 5′ nuclease assay is conveniently performed using, for example, AmpliTaq Gold™ DNA polymerase, which has endogenous 5′ nuclease activity, to digest an internal oligonucleotide probe labeled with both a fluorescent reporter dye and a quencher (see, Holland et al. (1991) Proc. Natl. Acad.Sci. USA 88:7276-7280; and Lee et al. (1993) Nucl. Acids Res. 21:3761-3766). Assay results are detected by measuring changes in fluorescence that occur during the amplification cycle as the fluorescent probe is digested, uncoupling the dye and quencher labels and causing an increase in the fluorescent signal that is proportional to the amplification of target DNA.
The amplification products can be detected in solution or using solid supports. In this method, the TaqMan™ probe is designed to hybridize to a target sequence within the desired PCR product. The 5′ end of the TaqMan™ probe contains a fluorescent reporter dye. The 3′ end of the probe is blocked to prevent probe extension and contains a dye that will quench the fluorescence of the 5′ fluorophore. During subsequent amplification, the 5′ fluorescent label is cleaved off if a polymerase with 5′ exonuclease activity is present in the reaction. Excision of the 5′ fluorophore results in an increase in fluorescence which can be detected.
In particular, the oligonucleotide probe is constructed such that the probe exists in at least one single-stranded conformation when unhybridized where the quencher molecule is near enough to the reporter molecule to quench the fluorescence of the reporter molecule. The oligonucleotide probe also exists in at least one conformation when hybridized to a target polynucleotide such that the quencher molecule is not positioned close enough to the reporter molecule to quench the fluorescence of the reporter molecule. By adopting these hybridized and unhybridized conformations, the reporter molecule and quencher molecule on the probe exhibit different fluorescence signal intensities when the probe is hybridized and unhybridized. As a result, it is possible to determine whether the probe is hybridized or unhybridized based on a change in the fluorescence intensity of the reporter molecule, the quencher molecule, or a combination thereof. In addition, because the probe can be designed such that the quencher molecule quenches the reporter molecule when the probe is not hybridized, the probe can be designed such that the reporter molecule exhibits limited fluorescence unless the probe is either hybridized or digested.
Accordingly, the present invention relates to methods for amplifying a target HAV nucleotide sequence using a nucleic acid polymerase having 5′ to 3′ nuclease activity, one or more primers capable of hybridizing to the target HAV sequence, and an oligonucleotide probe capable of hybridizing to the target HAV sequence 3′ relative to the primer. During amplification, the polymerase digests the oligonucleotide probe when it is hybridized to the target sequence, thereby separating the reporter molecule from the quencher molecule. As the amplification is conducted, the fluorescence of the reporter molecule is monitored, with fluorescence corresponding to the occurrence of nucleic acid amplification. The reporter molecule is preferably a fluorescein dye and the quencher molecule is preferably a rhodamine dye.
While the length of the primers and probes can vary, the probe sequences are selected such that they have a lower melt temperature than the primer sequences. Hence, the primer sequences are generally longer than the probe sequences. Typically, the primer sequences are in the range of between 10-75 nucleotides long, more typically in the range of 20-45. The typical probe is in the range of between 10-50 nucleotides long, more typically 15-40 nucleotides in length.
If a solid support is used, the oligonucleotide probe may be attached to the solid support in a variety of manners. For example, the probe may be attached to the solid support by attachment of the 3′ or 5′ terminal nucleotide of the probe to the solid support. More preferably, the probe is attached to the solid support by a linker which serves to distance the probe from the solid support. The linker is usually at least 15-30 atoms in length, more preferably at least 15-50 atoms in length. The required length of the linker will depend on the particular solid support used. For example, a six atom linker is generally sufficient when high cross-linked polystyrene is used as the solid support.
A wide variety of linkers are known in the art which may be used to attach the oligonucleotide probe to the solid support. The linker may be formed of any compound which does not significantly interfere with the hybridization of the target sequence to the probe attached to the solid support. The linker may be formed of a homopolymeric oligonucleotide which can be readily added on to the linker by automated synthesis. Alternatively, polymers such as functionalized polyethylene glycol can be used as the linker. Such polymers are preferred over homopolymeric oligonucleotides because they do not significantly interfere with the hybridization of probe to the target oligonucleotide. Polyethylene glycol is particularly preferred.
The linkages between the solid support, the linker and the probe are preferably not cleaved during removal of base protecting groups under basic conditions at high temperature. Examples of preferred linkages include carbamate and amide linkages.
Examples of preferred types of solid supports for immobilization of the oligonucleotide probe include controlled pore glass, glass plates, polystyrene, avidin-coated polystyrene beads, cellulose, nylon, acrylamide gel and activated dextran.
For a detailed description of the TaqMan™ assay, reagents and conditions for use therein, see, e.g., Holland et al. (1991) Proc. Natl. Acad. Sci, U.S.A. 88:7276-7280; U.S. Pat. Nos. 5,538,848, 5,723,591, and 5,876,930, all incorporated herein by reference in their entireties.
The HAV sequences described herein may also be used as a basis for transcription-mediated amplification (TMA) assays. TMA provides a method of identifying target nucleic acid sequences present in very small amounts in a biological sample. Such sequences may be difficult or impossible to detect using direct assay methods. In particular, TMA is an isothemal, autocatalytic nucleic acid target amplification system that can provide more than a billion RNA copies of a target sequence. The assay can be done qualitatively, to accurately detect the presence or absence of the target sequence in a biological sample. The assay can also provide a quantitative measure of the amount of target sequence over a concentration range of several orders of magnitude. TMA provides a method for autocatalytically synthesizing multiple copies of a target nucleic acid sequence without repetitive manipulation of reaction conditions such as temperature, ionic strength and pH.
Generally, TMA includes the following steps: (a) isolating nucleic acid, including RNA, from the biological sample of interest suspected of being infected with HAV; and (b) combining into a reaction mixture (i) the isolated nucleic acid, (ii) first and second oligonucleotide primers, the first primer having a complexing sequence sufficiently complementary to the 3′ terminal portion of an RNA target sequence, if present (for example the (+) strand), to complex therewith, and the second primer having a complexing sequence sufficiently complementary to the 3′ terminal portion of the target sequence of its complement (for example, the (−) strand) to complex therewith, wherein the first oligonucleotide further comprises a sequence 5′ to the complexing sequence which includes a promoter, (iii) a reverse transcriptase or RNA and DNA dependent DNA polymerases, (iv) an enzyme activity which selectively degrades the RNA strand of an RNA-DNA complex (such as an RNAse H) and (v) an RNA polymerase which recognizes the promoter.
The components of the reaction mixture may be combined stepwise or at once. The reaction mixture is incubated under conditions whereby an oligonucleotide/target sequence is formed, including DNA priming and nucleic acid synthesizing conditions (including ribonucleotide triphosphates and deoxyribonucleotide triphosphates) for a period of time sufficient to provide multiple copies of the target sequence. The reaction advantageously takes place under conditions suitable for maintaining the stability of reaction components such as the component enzymes and without requiring modification or manipulation of reaction conditions during the course of the amplification reaction. Accordingly, the reaction may take place under conditions that are substantially isothermal and include substantially constant ionic strength and pH. The reaction conveniently does not require a denaturation step to separate the RNA-DNA complex produced by the first DNA extension reaction.
Suitable DNA polymerases include reverse transcriptases, such as avian myeloblastosis virus (AMV) reverse transcriptase (available from, e.g., Seikagaku America, Inc.) and Moloney murine leukemia virus (MMLV) reverse transcriptase (available from, e.g., Bethesda Research Laboratories).
Promoters or promoter sequences suitable for incorporation in the primers are nucleic acid sequences (either naturally occurring, produced synthetically or a product of a restriction digest) that are specifically recognized by an RNA polymerase that recognizes and binds to that sequence and initiates the process of transcription whereby RNA transcripts are produced. The sequence may optionally include nucleotide bases extending beyond the actual recognition site for the RNA polymerase which may impart added stability or susceptibility to degradation processes or increased transcription efficiency. Examples of useful promoters include those which are recognized by certain bacteriophage polymerases such as those from bacteriophage T3, T7 or SP6, or a promoter from E. coli. These RNA polymerases are readily available from commercial sources, such as New England Biolabs and Epicentre.
Some of the reverse transcriptases suitable for use in the methods herein have an RNAse H activity, such as AMV reverse transcriptase. It may, however, be preferable to add exogenous RNAse H, such as E. coli RNAse H, even when AMV reverse transcriptase is used. RNAse H is readily available from, e.g., Bethesda Research Laboratories.
The RNA transcripts produced by these methods may serve as templates to produce additional copies of the target sequence through the above-described mechanisms. The system is autocatalytic and amplification occurs autocatalytically without the need for repeatedly modifying or changing reaction conditions such as temperature, pH, ionic strength or the like.
Detection may be done using a wide variety of methods, including direct sequencing, hybridization with sequence-specific oligomers, gel electrophoresis and mass spectrometry. these methods can use heterogeneous or homogeneous formats, isotopic or nonisotopic labels, as well as no labels at all.
One preferable method of detection is the use of target sequence-specific oligonucleotide probes, derived from the sequences described in FIGS. 1-13 and fragments thereof. The probes may be used in hybridization protection assays (HPA). In this embodiment, the probes are conveniently labeled with acridinium ester (AE), a highly chemiluminescent molecule. See, e.g., Nelson et al. (1995) “Detection of Acridinium Esters by Chemiluminescence” in Nonisotopic Probing, Blotting and Sequencing, Kricka L. J.(ed) Academic Press, San Diego, Calif.; Nelson et al. (1994) “Application of the Hybridization Protection Assay (HPA) to PCR” in The Polymerase Chain Reaction, Mullis et al. (eds.) Birkhauser, Boston, Mass.; Weeks et al. (1983) Clin. Chem. 29:1474-1479; Berry et al. (1988) Clin. Chem. 34:2087-2090. One AE molecule is directly attached to the probe using a non-nucleotide-based linker arm chemistry that allows placement of the label at any location within the probe. See, e.g., U.S. Pat. Nos. 5,585,481 and 5,185,439. Chemiluminescence is triggered by reaction with alkaline hydrogen peroxide which yields an excited N-methyl acridone that subsequently collapses to ground state with the emission of a photon. Additionally, AE causes ester hydrolysis which yields the nonchemiluminescent-methyl acridinium carboxylic acid.
When the AE molecule is covalently attached to a nucleic acid probe, hydrolysis is rapid under mildly alkaline conditions. When the AE-labeled probe is exactly complementary to the target nucleic acid, the rate of AE hydrolysis is greatly reduced. Thus, hybridized and unhybridized AE-labeled probe can be detected directly in solution, without the need for physical separation.
HPA generally consists of the following steps: (a) the AE-labeled probe is hybridized with the target nucleic acid in solution for about 15 to about 30 minutes. A mild alkaline solution is then added and AE coupled to the unhybridized probe is hydrolyzed. This reaction takes approximately 5 to 10 minutes. The remaining hybrid-associated AE is detected as a measure of the amount of target present. This step takes approximately 2 to 5 seconds. Preferably, the differential hydrolysis step is conducted at the same temperature as the hybridization step, typically at 50 to 70° C. Alternatively, a second differential hydrolysis step may be conducted at room temperature. This allows elevated pHs to be used, for example in the range of 10-11, which yields larger differences in the rate of hydrolysis between hybridized and unhybridized AE-labeled probe. HPA is described in detail in, e.g., U.S. Pat. Nos. 6,004,745; 5,948,899; and 5,283,174, the disclosures of which are incorporated by reference herein in their entireties.
TMA is described in detail in, e.g., U.S. Pat. No. 5,399,491, the disclosure of which is incorporated herein by reference in its entirety. In one example of a typical assay, an isolated nucleic acid sample, suspected of containing a HAV target sequence, is mixed with a buffer concentrate containing the buffer, salts, magnesium, nucleotide triphosphates, primers, dithiothreitol, and spermidine. The reaction is optionally incubated at about 100° C. for approximately two minutes to denature any secondary structure. After cooling to room temperature, reverse transcriptase, RNA polymerase, and RNAse H are added and the mixture is incubated for two to four hours at 37° C. The reaction can then be assayed by denaturing the product, adding a probe solution, incubating 20 minutes at 60° C., adding a solution to selectively hydrolyze the unhybridized probe, incubating the reaction six minutes at 60° C., and measuring the remaining chemiluminescence in a luminometer.
As is readily apparent, design of the assays described herein are subject to a great deal of variation, and many formats are known in the art. The above descriptions are merely provided as guidance and one of skill in the art can readily modify the described protocols, using techniques well known in the art.
The above-described assay reagents, including the primers, probes, solid support with bound probes, as well as other detection reagents, can be provided in kits, with suitable instructions and other necessary reagents, in order to conduct the assays as described above. The kit will normally contain in separate containers the combination of primers and probes (either already bound to a solid matrix or separate with reagents for binding them to the matrix), control formulations (positive and/or negative), labeled reagents when the assay format requires sane and signal generating reagents (e.g., enzyme substrate) if the label does not generate a signal directly. Instructions (e.g., written, tape, VCR, CD-ROM, etc.) for carrying out the assay usually will be included in the kit. The kit can also contain, depending on the particular assay used, other packaged reagents and materials (i.e. wash buffers and the like). Standard assays, such as those described above, can be conducted using these kits.
Recombinant or synthetic HAV polypeptides can be used as diagnostics, or those which produce an immunological response, such as those that give rise to neutralizing antibodies, may be formulated into vaccines. Antibodies raised against these polypeptides can also be used as diagnostics, or for passive immunotherapy. In addition, antibodies to these polypeptides are useful for isolating and identifying HAV particles. The HAV antigens may also be isolated from HAV virions. The virions may be grown in HAV infected cells in tissue culture, or in an infected host.
Particularly, the antibodies may be polyclonal or monoclonal, may be a human antibody, or may be a hybrid or chimeric antibody, such as a humanized antibody, an altered antibody, F(ab′)2 fragments, F(ab) fragments, Fv fragments, a single-domain antibody, a dimeric or trimeric antibody fragment construct, a minibody, or functional fragments thereof which bind to the analyte of interest. Antibodies are produced using techniques well known to those of skill in the art and disclosed in, for example, U.S. Pat. Nos. 4,011,308; 4,722,890; 4,016,043; 3,876,504; 3,770,380; and 4,372,745.
For example, polyclonal antibodies are generated by immunizing a suitable animal, such as a mouse, rat, rabbit, sheep or goat, with an antigen of interest. In order to enhance immunogenicity, the antigen can be linked to a carrier prior to immunization. Such carriers are well known to those of ordinary skill in the art. Immunization is generally performed by mixing or emulsifying the antigen in saline, preferably in an adjuvant such as Freund's complete adjuvant, and injecting the mixture or emulsion parenterally (generally subcutaneously or intramuscularly). The animal is generally boosted 2-6 weeks later with one or more injections of the antigen in saline, preferably using Freund's incomplete adjuvant. Antibodies may also be generated by in vitro immunization, using methods known in the art. Polyclonal antiserum is then obtained from the immunized animal.
Monoclonal antibodies are generally prepared using the method of Kohler and Milstein (1975) Nature 256:495-497, or a modification thereof. Typically, a mouse or rat is immunized as described above. However, rather than bleeding the animal to extract serum, the spleen (and optionally several large lymph nodes) is removed and dissociated into single cells. If desired, the spleen cells may be screened (after removal of nonspecifically adherent cells) by applying a cell suspension to a plate or well coated with the antigen. B-cells, expressing membrane-bound immunoglobulin specific for the antigen, will bind to the plate, and are not rinsed away with the rest of the suspension. Resulting B-cells, or all dissociated spleen cells, are then induced to fuse with myeloma cells to form hybridomas, and are cultured in a selective medium (e.g., hypoxanthine, aminopterin, thymidine medium, “HAT”). The resulting hybridomas are plated by limiting dilution, and are assayed for the production of antibodies which bind specifically to the immunizing antigen (and which do not bind to unrelated antigens). The selected monoclonal antibody-secreting hybridomas are then cultured either in vitro (e.g., in tissue culture bottles or hollow fiber reactors), or in vivo (e.g., as ascites in mice). Human monoclonal antibodies are obtained by using human rather than murine hybridomas. See, e.g., Cote, et. al. Monclonal Antibodies and Cancer Therapy, Alan R. Liss, 1985, p. 77
Monoclonal antibodies or portions thereof may be identified by first screening a B-cell cDNA library for DNA molecules that encode antibodies that specifically bind to p185, according to the method generally set forth by Huse et al. (1989) Science 246:1275-1281. The DNA molecule may then be cloned and amplified to obtain sequences that encode the antibody (or binding domain) of the desired specificity.
As explained above, antibody fragments which retain the ability to recognize the molecule of interest, will also find use in the subject invention. A number of antibody fragments are known in the art which comprise antigen-binding sites capable of exhibiting immunological binding properties of an intact antibody molecule. For example, functional antibody fragments can be produced by cleaving a constant region, not responsible for antigen binding, from the antibody molecule, using e.g., pepsin, to produce F(ab′)2 fragments. These fragments will contain two antigen binding sites, but lack a portion of the constant region from each of the heavy chains. Similarly, if desired, Fab fragments, comprising a single antigen binding site, can be produced, e.g., by digestion of polyclonal or monoclonal antibodies with papain. Functional fragments, including only the variable regions of the heavy and light chains, can also be produced, using standard techniques such as recombinant production or preferential proteolytic cleavage of immunoglobulin molecules. These fragments are known as Fv. See, e.g., Inbar et al. (1972) Proc. Nat. Acad. Sci. USA 69:2659-2662; Hochman et al. (1976) Biochem 15:2706-2710; and Ehrlich et al. (1980) Biochem 19:4091-4096.
A single-chain Fv (“sFv”or “scFv”) polypeptide is a covalently linked VH-VL heterodimer which is expressed from a gene fusion including VH- and VL-encoding genes linked by a peptide-encoding linker. Huston et al. (1988) Proc. Nat. Acad. Sci. USA 85:5879-5883. A number of methods have been described to discern and develop chemical structures (linkers) for converting the naturally aggregated, but chemically separated, light and heavy polypeptide chains from an antibody V region into an sFv molecule which will fold into a three dimensional structure substantially similar to the structure of an antigen-binding site. See, e.g., U.S. Pat. Nos. 5,091,513, 5,132,405 and 4,946,778. The sFv molecules may be produced using methods described in the art. See, e.g., Huston et al. (1988) Proc. Nat. Acad. Sci. USA 85:5879-5883; U.S. Pat. Nos. 5,091,513, 5,132,405 and 4,946,778. Design criteria include determining the appropriate length to span the distance between the C-terminus of one chain and the N-terminus of the other, wherein the linker is generally formed from small hydrophilic amino acid residues that do not tend to coil or form secondary structures. Such methods have been described in the art. See, e.g., U.S. Pat. Nos. 5,091,513, 5,132,405 and 4,946,778. Suitable linkers generally comprise polypeptide chains of alternating sets of glycine and serine residues, and may include glutamic acid and lysine residues inserted to enhance solubility.
“Mini-antibodies” or “minibodies” will also find use with the present invention. Minibodies are sFv polypeptide chains which include oligomerization domains at their C-termini, separated from the sFv by a hinge region. Pack et al. (1992) Biochem 31: 1579-1584. The oligomerization domain comprises self-associating α-helices, e.g., leucine zippers, that can be further stabilized by additional disulfide bonds. The oligomerization domain is designed to be compatible with vectorial folding across a membrane, a process thought to facilitate in vivo folding of the polypeptide into a functional binding protein. Generally, minibodies are produced using recombinant methods well known in the art. See, e.g., Pack et al. (1992) Biochem 31:1579-1584; Cumber et al. (1992) J Immunology 149B:120-126.
While the polypeptides of the present invention may comprise a substantially complete viral domain, in many applications all that is required is that the polypeptide comprise an antigenic or immunogenic region of the virus. Thus, in one aspect of the invention, the polypeptides of SEQ ID Nos: 40-48 are used to elicit an immunological response. In another aspect of the invention, an immunological region of a polypeptide is generally relatively small—typically 8 to 10 amino acids or less in length. Fragments of as few as 5 amino acids may characterize an antigenic region. These segments may correspond to regions encoding for capsid proteins, nonstructural proteins, and the junction between the capsid precursor P1 and 2A. Accordingly, using the cDNAs of these regions as a basis, DNAs encoding short segments of these polypeptides can be expressed recombinantly either as fusion proteins, or as isolated polypeptides. In addition, short amino acid sequences can be conveniently obtained by chemical synthesis.
In instances wherein the synthesized polypeptide is correctly configured so as to provide the correct epitope, but is too small to be immunogenic, the polypeptide may be linked to a suitable carrier. A number of techniques for obtaining such linkage are known in the art, including the formation of disulfide linkages using N-succinimidyl-3-(2-pyridyl-thio)propionate (SPDP) and succinimidyl 4-(N-maleimido-methyl)cyclohexane-1-carboxylate (SMCC) obtained from Pierce Company, Rockford, Ill., (if the peptide lacks a sulfhydryl group, this can be provided by addition of a cysteine residue). These reagents create a disulfide linkage between themselves and peptide cysteine residues on one protein and an amide linkage through the epsilon-amino on a lysine, or other free amino group in the other. A variety of such disulfide/amide-forming agents are known. See, for example, Immun. Rev. (1982) 62:185. Other bifunctional coupling agents form a thioether rather than a disulfide linkage. Many of these thio-ether-forming agents are commercially available and include reactive esters of 6maleimidocaproic acid, 2-bromoacetic acid, 2-iodoacetic acid, 4-(N-maleimido-methyl)cyclohexane-1-carboxylic acid, and the like. The carboxyl groups can be activated by combining them with succinimide or 1-hydroxyl-2-nitro-4sulfonic acid, sodium salt. Additional methods of coupling antigens employs the rotavirus/“binding peptide” system described in EPO Pub. No. 259,149, the disclosure of which is incorporated herein by reference. The foregoing list is not meant to be exhaustive, and modifications of the named compounds can clearly be used.
Any carrier may be used which does not itself induce the production of antibodies harmful to the host. Suitable carriers are typically large, slowly metabolized macromolecules such as proteins; polysaccharides, such as latex functionalized Sepharose™, agarose, cellulose, cellulose beads and the like; polymeric amino acids, such as polyglutamic acid, polylysine, and the like; amino acid copolymers; and inactive virus particles. Especially useful protein substrates are serum albumins, keyhole limpet hemocyanin, immunoglobulin molecules, thyroglobulin, ovalbumin, tetanus toxoid, and other proteins well known to those skilled in the art.
In addition to the polypeptides comprising SEQ ID NOs: 40-48, polypeptides comprising truncated HAV amino acid sequences encoding at least one viral epitope are useful immunological reagents. For example, polypeptides comprising such truncated sequences can be used as reagents in an immunoassay. These polypeptides also are candidate subunit antigens in compositions for antiserum production or vaccines. While these truncated sequences can be produced by various known treatments of native viral protein, it is generally preferred to make synthetic or recombinant polypeptides comprising an HAV sequence. Polypeptides comprising these truncated HAV sequences can be made up entirely of HAV sequences (one or more epitopes, either contiguous or noncontiguous), or HAV sequences and heterologous sequences in a fusion protein. Useful heterologous sequences include sequences that provide for secretion from a recombinant host, enhance the immunological reactivity of the HAV epitope(s), or facilitate the coupling of the polypeptide to an immunoassay support or a vaccine carrier. See, e.g., EPO Pub. No. 116,201; U.S. Pat. No. 4,722,840; EPO Pub. No. 259,149; U.S. Pat. No. 4,629,783, the disclosures of which are incorporated herein by reference.
The size of polypeptides comprising the truncated HAV sequences can vary widely, the minimum size being a sequence of sufficient size to provide an HAV epitope, while the maximum size is not critical. In some applications, the maximum size usually is not substantially greater than that required to provide the desired HAV epitopes and function(s) of the heterologous sequence, if any. Typically, the truncated HAV amino acid sequence will range from about 5 to about 100 amino acids in length. More typically, however, the HAV sequence will be a maximum of about 50 amino acids in length, preferably a maximum of about 30 amino acids. It is usually desirable to select HAV sequences of at least about 10, 12 or 15 amino acids, up to a maximum of about 20 or 25 amino acids. In another aspect, the truncated HAV amino acid sequence are selected from SEQ ID NOs: 40-48. In yet another aspect of the invention, the polynucleotides or the truncated amino acid sequences have at least about 50% homology to the polynucleotides of SEQ ID NOs: 40-48, preferably about 80% homology to the polynucleotides of SEQ ID NOs: 40-48, more preferably about 90%, 95%, or 99% homology to the polynucleotides of SEQ ID NOs: 40-48.
Truncated HAV amino acid sequences comprising epitopes can be identified in a number of ways. For example, the entire viral protein sequence can be screened by preparing a series of short peptides that together span the entire protein sequence. By starting with, for example, 100-mer polypeptides, it would be routine to test each polypeptide for the presence of epitope(s) showing a desired reactivity, and then testing progressively smaller and overlapping fragments from an identified 100-mer to map the epitope of interest. Screening such peptides in an immunoassay is within the skill of the art. It is also known to carry out a computer analysis of a protein sequence to identify potential epitopes, and then prepare oligopeptides comprising the identified regions for screening. It is appreciated by those of skill in the art that such computer analysis of antigenicity does not always identify an epitope that actually exists, and can also incorrectly identify a region of the protein as containing an epitope.
The immunogenicity of the HAV sequences may also be enhanced by preparing the sequences fused to or assembled with particle-forming proteins such as, for example, hepatitis B surface antigen or rotavirus VP6 antigen. Constructs wherein the HAV epitope is linked directly to the particle-forming protein coding sequences produce hybrids which are immunogenic with respect to the HAV epitope. In addition, all of the vectors prepared include epitopes specific to HAV, having various degrees of immunogenicity, such as, for example, the pre-S peptide. Thus, particles constructed from particle forming protein which include HAV sequences are immunogenic with respect to HAV and particle-form protein.
III. Experimental
Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.
Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.
In the following examples, enzymes were purchased from commercial sources, and used according to the manufacturers' directions. Nitrocellulose filters and the like were also purchased from commercial sources.
In the isolation of DNA fragments, except where noted, all DNA manipulations were done according to standard procedures. See, Sambrook et al., supra. Restriction enzymes, T4 DNA ligase, E. coli, DNA polymerase I, Klenow fragment, and other biological reagents can be purchased from commercial suppliers and used according to the manufacturers' directions. Double stranded DNA fragments were separated on agarose gels.
Human serum samples that had previously tested positive for HAV by IgM anti-HAV ELISA [ETI-HA-IgMK PLUS; DiaSorin, Inc; Saluggia (VC), Italy] were used to isolate RNA for subsequent experiments. Samples were stored at −80° C. until used. RNA was extracted from 0.14 mL of serum using the QIAamp Viral Mini Spin Kit (QIAGEN, Valencia, Calif.) following the manufacturer's specifications.
The RT-PCR was performed using the Titan One Tube RT-PCR Kit (Roche, Mannheim, Germany) to amplify a 243bp fragment in the VP3/VP1 region. The 243bp fragment corresponds to nucleotide positions 2172-2415 of the HAV genome as reported by Cohen et al. (1987) J. Virol. 61: 50-59.
Experiments were performed using the primers shown in Table 1 and the procedures described below.
| TABLE 1 |
| Primers used in the “RT-PCR” Experiments |
| Primer | Sequence | PCR product | Genomic region | SEQ ID NO: |
| SN2172 | GCTCCTCTTTATCATGCTATGGAT | 243 bp | VP3/VP1 | 49 |
| SN2415 | CAGGAAATGTCTCAGGTACTTTCT | 243 bp | VP3/VP1 | 50 |
PCR products were electrophoresed on 4-20% polyacrylamide gels, stained with ethidium bromide and visualized under an UV source. Purification of amplified fragments was carried out using the QiaQuick PCR purification kit (QIAGEN, Valencia, Calif.).
The PCR fragments were cloned into TOPO-TA vectors (Invitrogen, Carlsbad, Calif.). Cloning into these vectors is highly facilitated when the amplified DNA contains a single deoxyadenosine (A) at its 3′ end. Accordingly, a catalytic reaction to add the 3′ (A) overhead was used. The reaction mix contained 1.25 mM of dATP, 0.5 units of Taq polymerase (Perkin Elmer, Boston, Mass.) and proceeded at 72 C for 15 min.
PCR fragments were cloned into the pCR2.1-TOPO vector using the Invitrogen's TA cloning kit (TOPO™ TA CloningR Kit with One Shot TOP10 Electrocompetent Cells) following the manufacturer's specifications. Bacterial cells were incubated at 37° C. on Luria Broth plates containing ampicillin at 100 μg/mL, 0.66 mM IPTG and 0.033% X-Gal. A number of white colonies were inoculated in 4 mL of Luria-Broth ampicillin (100 μg/ml) and incubated overnight at 37° C. with shaking. Three mL of the overnight cultures were used to prepare plasmid DNA using the QIAprep Miniprep kit (QIAGEN). Recombinant clones were identified by restriction enzyme analysis with EcoRI (New England and Biolabs) and 4-20% polyacryamide electrophoresis as described above.
In order to determine the DNA sequences of the clones, large amounts of plasmids from recombinant clones were prepared as above and the DNA suspended in TE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) at 0.2 mg/mL. Nucleotide sequence determination of the Hepatitis A fragments was performed using an Applied Biosystems Model 373 or Model 377 DNA Sequencer system (Foster City, Calif.). The nucleotide sequence of the 243 bp VP3/VP1 fragment determined for 13 Indonesian (IND) (SEQ ID NOs: 1-13) and 14 Chilean (SCL) (SEQ ID NOs: 14-27) HAV isolates is shown in FIG. 1.
Cloning of HAV P1/2A precursor and full length open reading frame nucleotide fragments of interest include PCR of fragments of interest from the Chiron plasmid pHAVFL 18.3 #2 already containing a full length ORF of HAV and cloning those fragments of interest into the pGEM-4z vector (Promega, Madison Wis.). The pGEM vector has both an SP6 and T7 promoter to facilitate in vitro RNA synthesis of cloned products. The pGEM-4z vector was made by restriction digest of the plasmid using KpnI and SphI restriction enzymes (Roche Applied Science, Indianapolis, Ind.) followed by a phosphatase reaction using shrimp alkaline phosphatase (Roche Applied Science). The vector was then electrophoresed on an agarose gel and purified using the Promega Wizard PCR Purification kit (Promega).
Primers were designed to flank the regions of interest and included the KpnI and SphI restriction sites to facilitate cloning. Primers were ordered from an in-house DNA synthesis facility. PCR reactions using pHAVFL 18.3 #2 as template were done using the Roche Expand High Fidelity PCR System following the manufacturer's recommendations. The PCR products were electrophoresed on an agarose gel and purified using the Promega Wizard PCR Purification kit (Promega).
The PCR products were ligated into the pGEM-4z vector using Roche Rapid DNA Ligation kit (Roche Applied Science) and transformed into HB101 competent cells. Bacterial cells were incubated at 37° C. on Luria Broth plates containing ampicillin at 100 μg/mL overnight. Three mL of overnight cultures were used to prepare plasmid DNA using the QIAprep Miniprep kit (QIAGEN, Valencia Calif.). Recombinant clones were identified by restriction enzyme analysis with KpnI and SphI (Roche Applied Science) and gel electrophoresed.
Cloning of HAV full length open reading frame plus additional 3′ untranslated sequences include insertion of the HAV fragment from KpnI-DrdI from the above described HAV full length cloned fragment and a synthetic DNA region from DrdI-SphI into the pGEM-4z KpnI-SphI vector described above.
Restriction enzyme digest was done on the pGEM-4z full length HAV construct described above to isolate a fragment using KpnI and DrdI enzymes (Roche Applied Science). The digest was electrophoresed and purified using the Promega Wizard PCR Purification kit (Promega). Synthetic DNA oligos were designed and ordered from an in-house DNA synthesis facility. The synthetic DrdI-SphI region was annealed from separate oligos and kinased according to standard molecular biology protocol. The two separate fragments were then ligated into the pGEM-4z vector using Roche Rapid DNA Ligation kit (Roche Applied Science) and transformed into HB101 competent cells. Bacterial cells were incubated at 37° C. on Luria Broth plates containing ampicillin at 100 μg/mL overnight. Three mL of the overnight cultures were used to prepare plasmid DNA using the QIAprep Miniprep kit (Qiagen, Valencia Calif.). Recombinant clones were identified by restriction enzyme analysis with KpnI and SphI (Roche Applied Science) and gel electrophoresed.
Large amounts of plasmids from recombinant clones were prepared using Qiagen Maxi Plasmid kit (Qiagen) and the DNA suspended in ddH2O at 0.2 mg/mL. Nucleotide sequence determination of the HAV fragments was performed using an Applied BioSystems Model 373 or Model 377 DNA Sequencer system. The nucleotide sequence of the HAV inserts cloned in the pGEM-4z vector is shown in FIGS. 2-4.
Fragments encoding for P1, P1-2A, 1B, 1C, 1D, 2A and 3A were amplified using the DNA of a recombinant plasmid obtained in Chiron Corporation which contains the full-length HAV coding reading frame cloned in pUC18. PCR primers were designed to PCR out the P1, P1-2A, 1B, 1C, 1D, 2A and 3A regions of HAV. To facilitate the cloning of these regions into Chiron yeast expression vectors the NcoI, XhoI, and SalI restriction sites were introduced in the primers as required.
PCR primers were synthesized in the DNA synthesis facility of Chiron Corporation. Synthetic oligonucleotides were purified, suspended in 300 ul of dH2O and their optical densities at 260 nm determined. The reaction mix contained 0.25 ng of template, 100 pmol of each primer, 10 ul of 1.25 mM of each DNTP and 1 unit of Taq polymerase (Vendor) in a final volume of 50 uL. Amplification conditions were 94° C. for 1 min., 50° C. for 2 min. and 68° C. for 4 min. for 35 cycles. A 7-min. post incubation at 75° C. was added to ensure the full extension of fragments. Aliquots of 5 μL were used to check PCR synthesis by electrophoresis on 1% agarose gels. The entire PCR product was then electrophoresed and fragments exhibiting the expected sizes were purified from the gels using the PCR Purification kit (Promega) following the vendor's recommendations. Approximately 0.8 μg of purified PCR DNA was digested with the appropriate restriction enzymes (Roche) for 3h at 37° C. and the products were further purified using the Promega PCR Purification kit.
Plasmid pBS24.1, that was engineered to contain the yeast hybrid promoter ADH2/GAPDH (Cousens et al. (1987) Gene 61, 265-275) and an Xhol restriction site, was used for heterologous expression of the HAV recombinant proteins. This yeast expression vector contains 2μ sequences and inverted repeats (IR) for autonomous replication in yeast, the α-factor terminator to ensure transcription termination, and the yeast leu2-d and URA3 for selection. The ColE1 origin of replication and the β-lactamase gene are also present for propagation and selection in E. coli (Pichuantes et al. (1996) “Expression of Heterologous Gene Products in Yeast” in Protein Engineering A Guide to Design and Production, Chapter 5. J. L. Cleland and C. Craik, eds., Wiley-Liss, Inc., New York, N.Y. pp 129-161). Plasmid pBS24.1 was digested with BamHI/SalI or XhoI/SalI and dephosphorylated with 10 units of calf intestine alkaline phosphatase (Boheringer Manheim, Indianapolis, Ind.) under the conditions recommended by the vendor. The HAV nucleotide sequences coding for HAV 2A and 3A were fused to DNA sequences coding for the human superoxide dismutase (SOD) prior to the cloning. The digested and purified HAV recombinant fragments were ligated with digested pBS24.1 using the Roche Rapid Ligation kit and protocol. The ligation mix was then used to transform Escherichia coli HB101 competent cells and transformants were selected in Luria-Broth plates containing ampicillin at 100 μg/mL after an overnight incubation at 37° C. Several colonies of each transformation were picked and inoculated in 3 mL of Luria-Broth with ampicillin at 100 μg/mL and incubated at 37° C. with shaking overnight. Plasmid DNA was prepared using 1.5 mL of cultures and the QIAprep Miniprep kit (QIAGEN). Recombinant clones were identified by analytical restriction enzyme analysis with BamHI-SalI. Large-scale preparations of recombinant plasmids were made to perform sequencing to confirm the nucleotide sequence of the cloned HAV fragments. Yeast expression plasmids exhibiting the expected sequence for HAV P1, P1-2A, 1B, 1C, 1D, SOD-2A and SOD-3A were used in experiments of yeast transformation as follows. Competent Saccharomyces cerevisiae AD3 cells [Mat a, trp1+, ura3-52, prb1-1122, pep4-3, prc1-407, [cir0],::pDM15(pGAP/ADR1::G418R)], leu2(ΔAD)]were transformed with plasmid DNAs encoding for NS1, VP1 or VP2. Selection of yeast recombinants was achieved by two rounds of uracil-deficient plates followed by one round of leucine-deficient plates after incubation at 30° C. for 48-72 hours. Cultures were then grown in leucine-deficient media and then in YEP supplemented with 2% glucose (Pichuantes et al. (1989) Proteins: Struct. Funct. Genet. 6: 324-337) for 48 h before checking expression of the recombinant proteins.
The nucleotide (SEQ ID NOs: 31-39) and corresponding amino acid sequences for the various proteins (SEQ ID NOs: 40-48) are shown in FIGS. 5-13. The amino acid sequence of the polypeptides was deduced from the nucleotide sequences. The nucleotide sequences and the amino acid sequences were compared to the wild-type HAV nucleotide and protein sequences reported by Cohen et al. (1987) J. Virol. 61:50-59. The polynucleotide sequences from the Indonesian samples have a 93.8-96.7% homology, while the polynucleotide sequences from the Chilean samples have a 90.5-94.7% homology. The amino acid sequences from the Indonesian and the Chilean samples have a homology of 98.8-100% and 97.5-98.8%, respectively.
Accordingly, novel hepatitis A virus sequences and detection assays using these sequences have been disclosed. From the foregoing, it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope thereof.
1. An isolated polynucleotide comprising:
(a) a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 15;
(b) a sequence complementary to the sequence of (a); or
(c) a fragment of either of the sequences in (a) or (b) wherein the fragment comprises at least 15 contiguous nucleotides of SEQ ID NO: 15 or of the complement of SEQ ID NO: 15.
2. The polynucleotide of claim 1, wherein the nucleotide sequence comprises the sequence of SEQ ID NO: 15.
3. A method for detecting Hepatitis A virus (HAV) infection in a biological sample, the method comprising:
(a) isolating nucleic acid from a biological sample suspected of containing Hepatitis A virus (HAV) RNA, wherein said nucleic acid comprises a target sequence;
(b) reacting the HAV nucleic acid with a detectably labeled probe sufficiently complementary to and capable of hybridizing with the target sequence, wherein the probe is a polynucleotide according to claim 1, and further wherein said reacting is done under conditions that provide for the formation of a probe/target sequence complex; and
(c) detecting the presence or absence of label as an indication of the presence or absence of the target sequence.
4. The method of claim 3, wherein the probe comprises a detectable label at the 5′-end and/or at the 3′-end.
5. The method of claim 3, wherein the detectable label is a fluorescent label selected from the group consisting of 6-carboxyfluorescein (6-FAM), tetramethyl rhodamine (TAMRA), and 2′, 4′, 5′, 7′,-tetrachloro-4-7-dichlorofluorescein (TET).
6. A method for detecting Hepatitis A virus (HAV) infection in a biological sample, the method comprising:
isolating nucleic acids from a biological sample suspected of containing HAV;
amplifying the nucleic acids using at least two primers wherein each of the primers is not more than about 50 nucleotides in length and comprises a nucleotide sequence of at least 10 contiguous nucleotides from a polynucleotide according to claim 1 or a nucleotide sequence having 90% sequence identity thereto, wherein each of the two primer is sufficiently complementary to a portion of the sense and antisense strands, respectively, of the isolated nucleic acid to hybridize therewith; and
detecting the of the amplified nucleic acids as an indication of the presence or absence of HAV in the sample.