-
2011-10-04
10/365,620
2003-02-13
US 8,029,803 B2
2011-10-04
-
-
Bao Li
2026-08-11
Disclosed herein are the nucleotide sequences, deduced amino acid sequences as well as methods and compositions necessary to elicit immune responses against chronic Hepatitis B infections in animals and humans. Immune response is enhanced by fusing relevant viral antigens with xenotypic immunoglobulin heavy chain region through a peptide linker and producing the fusion proteins in Baculovirus expression system to incorporate high mannose glycosylation. By virtue of the antibody component, the fusion proteins bind to Fc receptors on the surface of antigen presenting cells, are taken up, processed and derived peptides are presented on MHC Class I, which elicit a CTL (Th1) response. In a similar fashion, due to cross priming and presentation on MHC Class II, will elicit a humoral (Th2) response. In addition, disclosed are the methods of cloning, expression and production of the fusion proteins.
Get notified when new applications in this technology area are published.
C12P21/00 IPC
Preparation of peptides or proteins
This Application claims benefit of U.S. Provisional Application Ser. No. 60/423,578, filed on Nov. 5, 2002 and claims benefit of U.S. Provisional Application Ser. No. 60/390,564, filed on Jun. 20, 2002.
The present invention relates to chimeric antigens (fusion proteins) for targeting and activating antigen presenting cells. In particular, the invention describes compositions and methods that contain or use one or more fusion proteins that contain a pre-selected HBV antigen or an HCV antigen, and a xenotypic immunoglobulin fragment, wherein the fusion molecule is capable of binding and activating antigen presenting cells, especially dendritic cells.
Viral infectious diseases are major public healthcare issues. Human Hepatitis B virus (HBV) is a member of a family of DNA viruses that primarily infect the liver (Gust, 1986). Other members of this family are woodchuck hepatitis B virus (WHV) ((Summers, Smolec et al. 1978), duck hepatitis B virus (DHBV) ((Mason, Seal et al. 1980) and heron hepatitis B virus (HHBV) (Sprengel, Kaleta et al. 1988). These viruses share a common morphology and replication mechanisms, but are species specific for infectivity (Marion, 1988).
HBV primarily infects liver cells and can cause acute and chronic liver disease resulting in cirrhosis and hepatocellular carcinoma. Infection occurs through blood and other body fluids. Approximately 90% of the individuals infected by HBV are able to clear the infection, while the remaining 10% become chronic carriers of the virus with a high probability of developing cirrhosis of the liver and hepatocellular carcinoma. The world Health Organization statistics show that more than 2 billion people have been infected by HBV and among these, 350 million are chronically infected by the virus (Beasley 1988) (Law J Y 1993). Prophylactic vaccines based on HBV surface antigen (HbSAg) have been very effective in providing protective immunity against HBV infections. These vaccines have been developed from HbSAg purified from plasma of chronic HBV carriers, produced by recombinant DNA techniques as well as through the use of synthetic peptides (Please see U.S. Pat. Nos. 4,599,230 and 4,599,231). These vaccines are highly effective in the prevention of infection, but are ineffective in eradicating established chronic infections.
Human Hepatitis B Virus (HBV) belongs to the family of Hepadnaviruses. Other members of this family are Duck Hepatitis B Virus (DHBV), Woodchuk Hepatitis Virus (WHV) Ground squirrel Hepatitis B Virus (GSHV) and Heron Hepatitis B Virus (HHBV). Although these viruses have similar morphology and replication mechanism, they are fairly species specific consequently, infect only very closely related species. These viruses have a DNA genome ranging in size of 3.0-3.2 Kb, with overlapping reading frames to encode several proteins. HBV genome encodes several proteins. Among these, the surface antigens: Large (S1/S2/S), Medium (S2/S) and Small (S) are proposed to be involved in the binding of the virus to the cellular receptors for uptake. The core protein (Core) forms capsids which encapsulate the partially double stranded DNA genome. Polymerase/Reverse Transcriptase (Pol) protein is a multifunctional enzyme necessary for the replication of the virus. The X protein has been proposed to have many properties, including the activation of Src kinases (Ganem and Schneider, 2001). The present invention describes DNA sequences and amino acid compositions of the surface antigen proteins S1/S2, S1/S2/S as well as Core protein fusion proteins with a xenotypic Mab fragment.
DHBV, another member of the hepdnaviral family, infects pekin ducks, are species specific, and have served as an animal model for studying the hepatitis B viruses. DHBV has a DNA genome and it codes for surface antigens PreS and PreS/S, Core protein (Core) and Polymerase/Reverse Transcriptase. The present invention also describes DNA sequences and deduced amino acid sequences of fusion proteins of the PreS, PreS/S and Core proteins with a fragment of a xenotypic Mab. These fusion proteins can be used to elicit a broad immune response in chronic viral infections, thus as therapeutic vaccine.
Hepatitis C virus (HCV) is a member of the flaviviridae family of RNA viruses. Route of infection is via blood and body fluids and over 50% of the patients become chronic carriers of the virus. Persistent infection result in chronic active hepatitis which may lead to liver cirrhosis and hepatocellular carcinoma (Saito et. al. (1990) PNAS USA 87: 6547-6549).
Approximately 170 million people worldwide are chronic carriers of HCV (Wild & Hall (2000) Mutation Res. 462: 381-393). There is no prophylactic vaccine available at present. Current therapy is Interferon α2b and Ribavirin, either alone or as combination therapy. The significant side effects for interferon treatment and the development of mutant strains are major drawbacks to the current therapy. Moreover, interferon therapy is effective only in 20% of the patients. Therapeutic vaccines to enhance host immune system to eliminate chronic HCV infection will be a major advancement in the treatment of this disease.
HCV genome is a positive sense single stranded RNA molecule of approximately 9.5 Kb in length. This RNA which contains both 5′ and 3′ untranslated regions that code for a single polyprotein which is cleaved into individual proteins and catalyzed by both viral and host proteases (Clarke, B. (1997) J. Gen. Virol. 78: 2397-2410). The structural proteins are Core, Envelope E1 & E2 and P7. The non-structural proteins are NS2, NS3, NS4A, NS4B, NS5A and NS5B. Core forms capsids. E1, E2 are envelope proteins, also called “Hypervariable region” due to the high rate of mutations. NS3 is a Serine Protease, the target of several protease inhibitors as antivirals for HCV. NS5B is the RNA Polymerase enzyme. NS5A has recently been suggested to have a direct role in the replication of the virus in the host by counteracting the interferon response Tan, S-L & Katze, M. G. (2001) Virology 284: 1-12) which augments the immune function.
When a healthy host (human or animal) encounters an antigen (such as proteins derived from a bacterium, virus and/or parasite), normally the host initiates an immune response. This immune response can be a humoral response and/or a cellular response. In the humoral response, antibodies are produced by B-cells and are secreted into the blood and/or lymph in response to an antigenic stimulus. The antibody then neutralizes the antigen, e.g. a virus, by binding specifically to antigens on its surface, marking it for destruction by phagocytotic cells and/or complement-mediated mechanisms. The cellular response is characterized by the selection and expansion of specific helper and cytotoxic T-lymphocytes capable of directly eliminating the cells which contain the antigen.
In many individuals, the immune system does not respond to certain antigens. When an antigen does not stimulate the production of a specific antibody and/or killer T-cells, the immune system is unable to prevent the resultant disease. As a result, the infectious agent, e.g. virus, can establish a chronic infection and the host immune system becomes tolerant to the antigens produced by the virus. The mechanism by which the virus evades the host immune machinery is not clearly established. The best-known examples of chronic viral infections include Hepatitis B, Hepatitis C, Human Immunodeficiency Virus and Herpes Simplex Virus.
In chronic states of viral infections, the virus escapes the host immune system. Viral antigens are recognized as “self,” and thus not recognized by the antigen-presenting cells. The lack of proper presentation of the appropriate viral antigen to the host immune system may be a contributing factor. The success in eliminating the virus will result from the manner in which the antigen is processed and presented by the antigen presenting cells (APCs) and the involvement of the regulatory and cytotoxic T cells. The major participant in this process is the Dendritic Cell (DC), which captures and processes antigens, expresses lymphocyte co-stimulatory molecules, migrates to lymphoid organs, and secretes cytokines to initiate immune responses. Dendritic cells also control the proliferation of B and T lymphocytes which are the mediators of immunity (Steinman et al 1999). The generation of a cytotoxic T cell (CTL) response is critical in the elimination of the virus infected cells and thus a cure of the infection.
Antigen Presenting Cells process the encountered antigens differently depending on the localization of the antigen (Steinman et al 1999). Exogenous antigens are processed within the endosomes of the APC and the generated peptide fragments are presented on the surface of the cell complexed with Major Histocompatibility Complex (MHC) Class II. The presentation of this complex to CD4+ T cells stimulate the CD4+ T helper cells. As a result, cytokines secreted by the helper cells stimulate B cells to produce antibodies against the exogenous antigen (humoral response). Immunizations using antigens typically generate antibody response through this endosomal antigen processing pathway.
On the other hand, intracellular antigens are processed in the proteasome and the resulting peptide fragments are presented as complexes with MHC Class I on the surface of APCs. Following binding of this complex to the co-receptor CD8 molecule, antigen presentation to CD8+ T cells occurs which result in cytotoxic T cell (CTL) immune response to remove the host cells that carry the antigen.
In patients with chronic viral infections, since the virus is actively replicating, viral antigens will be produced within the host cell. Secreted antigens will be present in the circulation. As an example, in the case of chronic HBV carriers, virions, the HBV surface antigens and the core antigens can be detected in the blood. An effective therapeutic vaccine should be able to induce strong CTL responses against an intracellular antigen or an antigen delivered into the appropriate cellular compartment so as to activate the MHC Class I processing pathway.
These findings would suggest that a therapeutic vaccine that can induce a strong CTL response should be processed through the proteasomal pathway and presented via the MHC Class I (Larsson, Fonteneau et al. 2001). This can be achieved either by producing the antigen within the host cell, or it can be delivered to the appropriate cellular compartment so that it gets processed and presented so as to elicit a cellular response. Several approaches have been documented in the literature for the intracellular delivery of the antigen. Among these, viral vectors ((Lorenz, Kantor et al. 1999), the use of cDNA-transfected cells (Donnelly, Ulmer et al. 1997) (Donnelly et al 1997) as well as the expression of the antigen through injected cDNA vectors (Lai and Bennett 1998) (U.S. Pat. No. 5,589,466), have been documented.
Delivery vehicles capable of carrying the antigens to the cytosolic compartment of the cell for MHC Class I pathway processing have also been used. The use of adjuvants to achieve the same goal has been described in detail by (Hilgers et al. 1999) Another approach is the use of biodegradable microspheres in the cytoplasmic delivery of antigens (Newman, Kwon et al. 2000), exemplified by the generation of a Th1 immune response against ovalbumin peptide (Newman, Samuel et al. 1998; Newman, Kwon et al. 2000). It has also been shown that PLGA nanospheres are taken up by the most potent antigen presenting cells, dendritic cells (Newman, Elamanchili et al. 2002).
Dendritic cells derived from blood monocytes, by virtue of their capability as professional antigen presenting cells have been shown to have great potential as immune modulators which stimulate primary T cell response (Steinman, Inaba et al. 1999), (Banchereau and Steinman 1998). This unique property of the DCs to capture, process, present the antigen and stimulate naïve T cells has made them very important tools for therapeutic vaccine development (Laupeze, Fardel et al. 1999). Targeting of the antigen to the DCs is the crucial step in the antigen presentation and the presence of several receptors on the DCs for the Fc region of monoclonal antibodies have been exploited for this purpose (Regnault, Lankar et al. 1999). Examples of this approach include ovarian cancer Mab-B43.13, Anti-PSA antibody as well as Anti-HBV antibody antigen complexes (Wen, Qu et al. 1999). Cancer immunotherapy using DCs loaded with tumor associated antigens have been shown to produce tumor-specific immune responses and anti-tumor activity (Campton, Ding et al. 2000; Fong and Engleman 2000). Promising results were obtained in clinical trials in vivo using tumor-antigen-pulsed DCs (Tarte and Klein 1999). These studies clearly demonstrate the efficacy of using DCs to generate immune responses against cancer antigens.
The present invention pertains to compositions and methods for targeting and activating antigen presenting cells, one of the first steps in eliciting an immune response. The compositions of the present invention include a novel class of bifunctional molecules (hereinafter designated as “chimeric antigens”) that include an immune response domain (IRD), for example a recombinant protein, linked to a target binding domain (TBD), for example, a xenotypic antibody fragment portion. More specifically, the chimeric antigens are molecules that couple viral antigens, such as Hepatitis B core and surface proteins, to a xenotypic Fc fragment, such as a murine immunoglobulin G fragment.
The compositions and methods of the present invention are useful for targeting and activating antigen presenting cells. The present invention may be useful for inducing cellular and humoral host immune responses against any viral antigen associated with a chronic viral infections, including but not limited to Hepatitis B, Hepatitis C, Human Immunodeficiency Virus, Human Papilloma Virus (HPV), and Herpes Simplex Virus. The invention may also be applicable to all autologous antigens in diseases such as cancer and autoimmune disorders.
The present invention relates to chronic infectious diseases, and in particular to chronic HBV infections. The presentation of HBV antigens to elicit a CTL response by the use of vaccine molecules designed to target the vaccines to DCs whereby the HBV-associated antigens treated as “self” during the chronic infection will be recognized as “foreign” and the host's immune system will mount a CTL response to eliminate HBV-infected cells. At the same time, through cross presentation, the antibody response to the circulating HBV antigen will bind to the antigen and remove it from the circulation. Accordingly, the present invention is designed to produce vaccines which can induce a broad immune response in patients who have chronic viral infections such as HBV.
One or more embodiments of the present invention include one or more chimeric antigens suitable for initiating an immune response against Hepatitis B virus (HBV). In these embodiments of the invention, the nucleotide and deduced amino acid sequences for pre-selected HBV antigens are linked to fragments of xenotypic antibodies. The resulting chimeric antigens are capable of targeting and activating antigen presenting cells, such as dendritic cells.
One or more embodiments of the present invention include one or more chimeric antigens suitable for initiating an immune response against Hepatitis C virus (HCV). In these embodiments of the invention, the nucleotide and deduced amino acid sequences for pre-selected HCV antigens are linked to fragments of xenotypic antibodies. The resulting chimeric antigens are capable of targeting and activating antigen presenting cells, such as dendritic cells.
The present invention also includes methods for cloning and producing fusion proteins in a heterologous expression system. In preferred embodiments of the invention, the cloning and production methods introduce unique post translational modifications including, but not limited to unique glycosylation on the expressed fusion proteins.
In order to make the efficient presentation of the antigens, the inventors have developed a novel murine monoclonal antibody Fc fragment-antigen (viral antigenic protein/peptide) fusion protein. This molecule, by virtue of the Fc fragment is recognized at a higher efficiency by the antigen-presenting cells (dendritic cells) as xenotypic, and the viral antigen is processed and presented as complexes with Major Histocompatibility Complex (MHC) Class I. This processing and antigen presentation is expected to result in the upregulation of the response by cytotoxic T-lymphocytes, resulting in the elimination of virus-infected cell population. In addition, due to cross priming and antigen presentation by MHC Class II molecules, humoral response also aids in the antibody response to the viral infection.
The bifunctional nature of the molecule targets the chimeric antigen to the proper antigen-presenting cells (dendritic cells), making it a unique approach in the therapy of chronic infectious diseases by specifically targeting the antigen presenting cells with the most effective stoichiometry of antigen to antibody. This is useful to the development of therapeutic vaccines to cure chronic viral infections such as Hepatitis B, Hepatitis C, Human Immunodeficiency Virus, Human Papilloma Virus and Herpes Simplex Virus, and may also be applicable to all autologous antigens in diseases such as cancer and autoimmune disorders.
The administration of these fusion proteins can elicit a broad immune response from the host, including both cellular and humoral responses, thus can be used as therapeutic vaccines to treat subjects that are immune tolerant to a particular infection.
FIG. 1 is a schematic diagram illustrating the structure of the chimeric antigen of the present invention as a monomer, wherein the chimeric antigen has two portions, namely a viral antigen and a xenotypic murine Fc fragment with the hinge region present.
FIG. 1a is a schematic diagram illustrating the structure of the chimeric antigen of FIG. 1 in its normal, assembled state as a dimer.
FIG. 2 is a schematic diagram illustrating the structure of a modified chimeric antigen as a monomer, wherein the chimeric antigen has two portions, namely a modified viral antigen portion which incorporates in the Complementarity Determining Regions (CDR) any viral antigen or antigens, antigenic protein fragments or peptides, or any of these with glycosylation at specific sites, and a xenotypic binding agent, namely a murine Fc fragment with the hinge region present.
FIG. 2a is a schematic diagram illustrating the structure of the modified chimeric antigen of FIG. 2 in its normal, assembled state as a dimer. The abbreviations “Ag1,” “Ag2,” and “Ag3” represent different viral antigenic peptides or proteins.
FIG. 3 is a schematic diagram illustrating the structure of a modified biotinylated viral protein and a fusion protein of a streptavidin-Fc fragment with the hinge region present.
FIG. 3a is a schematic diagram illustrating the structure of the modified chimeric antigen of FIG. 3 in its normal, assembled state as a dimer.
FIG. 4 is a schematic diagram illustrating a recombinant bacmid.
FIG. 5 is a schematic embodiment of TBD of the present invention.
FIG. 6 shows the nucleotide sequences (SEQ ID NO: 29) of the open reading frame encoding the TBD of FIG. 5.
FIG. 7 is a schematic embodiment of an exemplary chimeric antigen of the present invention, suitable for use with an insect cell expression system.
FIG. 8 shows the nucleotide (SEQ ID NO: 33) and deduced amino acid (SEQ ID NO: 34) sequences of the chimeric antigen molecule of FIG. 7.
FIG. 9 shows the nucleotide (SEQ ID NO: 33) and deuced amino acid (SEQ ID NO: 34) sequences of the expressed HBV S1/S2 protein.
FIG. 10 is a schematic embodiment of an exemplary chimeric antigen of the present invention, illustrating an exemplary IRD of the present invention.
FIG. 11 shows the nucleotide (SEQ ID NO: 35) and deduced amino acid (SEQ ID NO: 36) sequences of the chimeric antigen molecule of FIG. 10.
FIG. 12 shows the nucleotide (SEQ ID NO: 35) and deduced amino acid (SEQ ID NO: 36) sequences of the expressed HBV S1/S2/S protein.
FIG. 13 is a schematic embodiment of an exemplary chimeric antigen of the present invention, illustrating an exemplary IRD of the present invention.
FIG. 14 shows the nucleotide (SEQ ID NO: 37) and deduced amino acid (SEQ ID NO: 38) sequences of the chimeric antigen molecule of FIG. 13.
FIG. 15 shows the nucleotide (SEQ ID NO:39) and deduced amino acid (SEQ ID NO: 40) sequences of the expressed HBV core protein.
FIG. 16 is a schematic embodiment of an exemplary chimeric antigen of the present invention, illustrating an exemplary IRD of the present invention.
FIG. 17 shows the nucleotide (SEQ ID NO: 41) and deduced amino acid (SEQ ID NO: 42) sequences of the chimeric antigen molecule of FIG. 16.
FIG. 18 shows the nucleotide (SEQ ID NO: 43) and deduced amino acid (SEQ ID NO: 44) sequences of the expressed DHBV PreS protein.
FIG. 19 is a schematic embodiment of an exemplary chimeric antigen of the present invention, illustrating an exemplary IRD of the present invention.
FIG. 20 shows the nucleotide (SEQ ID NO: 45) and deduced amino acid (SEQ ID NO: 46) sequences of the chimeric antigen molecule of FIG. 19.
FIG. 21 shows the nucleotide (SEQ ID NO: 47) and deduced amino acid (SEQ ID NO: 48) sequences of the expressed DHBV PreS/S protein.
FIG. 22 is a schematic embodiment of an exemplary chimeric antigen of the present invention, illustrating an exemplary IRD of the present invention.
FIG. 23 shows the nucleotide (SEQ ID NO: 49) and deduced amino acid (SEQ ID NO: 50) sequences of the chimeric antigen molecule of FIG. 22.
FIG. 24 shows the nucleotide (SEQ ID NO: 51) and deduced amino acid (SEQ ID NO: 52) sequences of the expressed DHBV core protein.
FIG. 25 shows that a chimeric antigen embodiment of the invention can be taken up by dendritic cells.
FIG. 26 shows that dendritic cells uptake a chimeric antigen of the present invention (CS12), as compared to the target binding domain (TBD) alone, or the immune response domain (IRD) alone.
FIG. 27 shows the expression of MHC Class II by dendritic cells.
FIG. 28 shows that a cellular response is generated after contact with dendritic cells activated with a chimeric antigen of the present invention.
FIG. 29 shows T cell stimulation by a chemical conjugate of the present invention.
FIG. 30 shows the time course of expression of antigen binding receptors on maturing dendritic cells.
FIG. 31 shows the time course of expression of various dendritic cells activation markers.
FIG. 32 shows the nucleotide (A—SEQ ID NO: 29) and amino acid (B—SEQ ID NO: 30) sequences of the ORF of TBD protein in the plasmid pFastbachta-tbd.
FIG. 33 shows the nucleotide (A—SEQ ID NO: 31) and amino acid (B—SEQ ID NO: 32) sequences of the ORF of HBV S1/S2-TBD in the plasmid pFastbachta-tbd.
FIG. 34 shows the comparison of binding of HBV S1/S2-TBD, IgG1, and IgG2 over time.
FIG. 35 shows the comparison of HBV S1/S2-TBD, IgG1, and IgG2a binding to maturing dendritic cells on day 1.
FIG. 36 shows the comparison of HBV S1/S2-TBD, IgG1, and IgG2a binding to maturing dendritic cells on day 4.
FIG. 37 shows the comparison of uptake between HBV S1/S2-TBD, IgG1, and IgG2 as a function of concentration.
FIG. 38 shows the correlation of HBV S1/S2-TBD to CD32 and CD206 expression on dendritic cells.
FIG. 39 shows that the binding of HBV S1/S2-TBD to DC32 and DC206 receptors on dendritic cells is abolished by anti-Fc Mab.
FIG. 40 shows that glycosylation of S1/S2 antigen increases the uptake via the CD206 receptor.
FIG. 41 shows intracellular interferon-gamma positive T cells after antigen presentation.
FIG. 42 shows secretion of interferon-gamma after antigen presentation.
FIG. 43 shows intracellular interferon-gamma positive cells as a function of S1/S2-TBD concentration
FIG. 44 shows interferon-gamma secretion by T cells as a function of S1/S2-TBD concentration.
FIG. 45 shows the effect of glycosylation on intracellular interferon-gamma production in T cells.
FIG. 46 shows the effect of glycosylation on interferon-gamma secretion by T cells.
FIG. 47 shows the nucleotide (A—SEQ ID NO: 53) and amino acid (B—SEQ ID NO: 54) sequences of the ORF of HCV Core in the plasmid pFastbachta-HCV.
FIG. 48 shows the nucleotide (A—SEQ ID NO: 55) and amino acid (B—SEQ ID NO: 56) sequences of the ORF of HCV Core in the plasmid pFastbachta-HCV-TBD.
FIG. 49 shows the nucleotide (A—SEQ ID NO: 57) and amino acid (B—SEQ ID NO: 58) sequences of the ORF of HCV Core in the plasmid pFastbachta-HCV-core.
FIG. 50 shows the nucleotide (A—SEQ ID NO: 59) and amino acid (B—SEQ ID NO: 60) sequences of the ORF of HCV Core-TBD protein in the plasmid pFastbachta-HCV-core-TBD.
FIG. 51 shows the nucleotide (A) and amino acid (B) sequences of the ORF of HCV NS5A in the plasmid pFastbachta-HCV-NS5A.
FIG. 52 shows the nucleotide (A—SEQ ID NO: 63) and amino acid (B—SEQ ID NO: 64) sequences of the ORF of HCV NS5A-TBD in the plasmid pFastbachta-HCV-NS5A-TBD.
FIG. 53 shows the nucleotide (A—SEQ ID NO: 65) and amino acid (B—SEQ ID NO: 66) sequences of the ORF of HCV E1 in the plasmid pFastbachta-HCV-E1.
FIG. 54 shows the nucleotide (A—SEQ ID NO: 67) and amino acid (B—SEQ ID NO: 68) sequences of the ORF of HCV E1-TBD in the plasmid pFastbachta-HCV-E1-TBD.
FIG. 55 shows the nucleotide (A—SEQ ID NO: 69) and amino acid (B—SEQ ID NO: 70) sequences of the ORF of HCV E2 in the plasmid pFastbachta-HCV-E2.
FIG. 56 shows the nucleotide (A—SEQ ID NO: 71) and amino acid (B—SEQ ID NO: 72) sequences of the ORF of HCV E2-TBD in the plasmid pFastbachta-HCV-E2-TBD.
FIG. 57 shows the nucleotide (A—SEQ ID NO: 73) and amino acid (B—SEQ ID NO: 74) sequences of the ORF of HCV E1/E2 in the plasmid pFastbachta-HCV-E1/E2.
FIG. 58 shows the nucleotide (A—SEQ ID NO: 75) and amino acid (B—SEQ ID NO: 76) sequences of the ORF of HCV E1/E2-TBD in the plasmid pFastbachta-HCV-E1/E2-TBD.
A composition of the present invention includes a chimeric antigen comprising an immune response domain (IRD) and a target binding domain (TBD). In preferred embodiments of the invention, the protein portion is capable of inducing humoral and/or T cell responses, and the target binding portion is capable of binding an antigen presenting cell, such as a dendritic cell. The chimeric antigen of the present invention may also include one or more of the following: a hinge region of an immunoglobulin, a CH1 region of an immunoglobulin, a peptide linker, a protease cleavage site, and a tag suitable for use with a purification protocol. A chimeric antigen of the present invention is capable of binding to and activating an antigen presenting cell.
In some embodiments of the invention, the IRD of the chimeric antigen includes one or more proteins selected from the group comprising: one or more HBV proteins, one or more recombinant HBV proteins, one or more HCV proteins, or one or more recombinant HCV proteins.
In yet another embodiment of the invention, IRD of the chimeric antigen includes 6-His-peptide fused to one or more HBV proteins, one or more recombinant HBV proteins, one or more HCV proteins, or one or more recombinant HCV proteins.
In preferred embodiments of the invention, the target binding domain of the chimeric antigen is an antibody fragment xenotypic to the host. For example, if the host is a human, an exemplary xenotypic antibody fragment is a animal antibody fragment, such as from a mouse. In the preferred embodiments of the invention, the xenotypic antibody fragment comprises a murine Fc fragment. In the most preferred embodiments of the invention, the target binding domain comprises a xenotypic Fc fragment, a hinge region, a C1 region, and a peptide linkage suitable for linking the target binding domain to the IRD.
The present invention also comprises the use of linking molecules to join the IRD to the TBD. Exemplary linker molecules include leucine zippers, and biotin/avidin.
The present invention also comprises methods of using the compositions of the present invention to bind and activate antigen presenting cells, such as dendritic cells.
The present invention also comprises methods of using the compositions for the present invention to activate T-cells.
The present invention also comprises methods of making the chimeric antigens of the present invention.
The present invention also comprises a method of delivering an antigen to an immune system cell, such as an antigen presenting cell.
The present invention also comprises compositions and methods for activating a humoral and/or cellular immune response in an animal or human, said method comprising administering one or more chimeric antigens of the present invention.
The chimeric antigen of the present invention is a fusion protein having two portions, namely an IRD containing an antigenic sequence (such as a viral antigen(s)), and a TBD containing a xenotypic Fc fragment. The xenotypic murine Fc fragment with the hinge region present recruits the antigen-presenting cells, specifically dendritic cells, to take up the chimeric antigen. The binding region of the viral antigen thus targets antigen-presenting cells specifically. The internal machinery of the APC then processes the IRD to form an activated APC. The activated APC must then be capable of contacting and activating immune response cells for generating humoral and cellular immune responses to clear infected cells.
In a further embodiment, the chimeric antigen is a fusion protein having two portions, namely a modified viral antigen or antigens, antigenic protein fragments or peptides, or any of these with glycosylation at specific sites, and a xenotypic murine Fc fragment with the hinge region present.
In yet another embodiment, the invention provides a further modified chimeric antigen, wherein the antigen is biotinylated and the Fc fragment is generated with streptavidin as a fusion protein to facilitate the production of a wide assortment of antigen-Fc conjugates
In yet another embodiment, the invention provides an association between the antigen and the antibody Fc fragment through chemical conjugation.
As used herein and in the claims, the terms and phrases set out below have the meanings which follow.
“Antibody” refers to an immunoglobulin molecule produced by B lymphoid cells with a specific amino acid sequence evoked in humans or other animals by an antigen (immunogen). These molecules are characterized by reacting specifically with the antigen, each being defined in terms of the other.
“Antibody response” or “humoral response” refers to a type of immune response in which antibodies are produced by B lymphoid cells and are secreted into the blood and/or lymph in response to an antigenic stimulus. In a properly functioning immune response, the antibody binds specifically to antigens on the surface of cells (e.g., a pathogen), marking the cell for destruction by phagocytotic cells and/or complement-mediated mechanisms.
“Antigen” refers to any substance that, as a result of coming in contact with appropriate cells, induces a state of sensitivity and/or immune responsiveness and that reacts in a demonstrable way with antibodies and/or immune cells of the sensitized subject in vivo or in vitro.
“Native antigen” refers to an antigen that the body does not recognize as foreign and which will, through the present invention, be recognized as foreign.
“Antigen-presenting cell” refers to the accessory cells of antigen inductive events that function primarily by handling and presenting antigen to lymphocytes. The interaction of antigen presenting cells (APC) with antigens is an essential step in immune induction because it enables lymphocytes to encounter and recognize antigenic molecules and to become activated. Exemplary APCs include macrophages, Langerhans-dendritic cells, Follicular dendritic cells, and B cells.
“B-cell” refers to a type of lymphocyte that produces immunoglobulins or antibodies that interact with antigens.
“CH1 region” refers to the heavy chain constant domain on the antigen binding fragment of an antibody.
“Cellular response” or “cellular host response” refers to a type of immune response mediated by specific helper and killer T-cells capable of directly eliminating virally infected or cancerous cells.
“Complex” or “antigen-antibody complex” refers to the product of the reaction between an antibody and an antigen. Complexes formed with polyvalent antigens tend to be insoluble in aqueous systems.
“Cytotoxic T-lymphocyte” is a specialized type of lymphocyte capable of destructing foreign cells and host cells infected with the infectious agents which produce viral antigens.
“Epitope” refers to the simplest form of an antigenic determinant, on a complex antigen molecule; this is the specific portion of an antigen that is recognized by an immunoglobulin or T-cell receptor.
“Fusion protein” or “chimeric antigen” refers to a protein formed by expression of a hybrid gene made by combining two or more gene sequences.
“Hinge region” refers to the portion of an antibody that connects the Fab fragment to the Fc fragment; the hinge region contains disulfide bonds that covalently link the two heavy chains.
“Host” refers to human or animal.
“Immunity” or “immune response” refers to the ability of the body to resist or protect itself against infectious disease.
“Immune Response Domain (IRD)” refers to the variously configured antigenic portion of a bifunctional molecule The IRD comprises one or more antigens or one or more recombinant antigens. Viral antigens may include, but are not limited to, HBV PreS1/S2 HBV PreS1/S2/S, HBV Core, HBV Core ctm α-terminal modified), HBV e-antigen, HBV Polymerase, HCV Core, HCV E1-E2, HCV E1, HCV E2, HCV NS3-serine protease, HCV NS5A and NS4A, HIV GP120 and HSV Alkaline nuclease and HPV Antigens.
“Lymphocyte” refers to a subset of nucleated cells found in the blood, which mediate specific immune responses.
“Monoclonal antibody” or “MAb” refers to an antibody produced from a clone or genetically homogenous population of fused hybrid cells, i.e., a hybridoma cell. Hybrid cells are cloned to establish cells lines producing a specific monoclonal antibody that is chemically and immunologically homogenous, i.e., that recognizes only one type of antigen.
“Peptide linkage” or “peptide bond” refers to two or more amino acids covalently joined by a substituted amide linkage between the alpha-amino group of one amino acid and the alpha-carboxyl group of another amino acid.
“Protease cleavage site” refers to the site where proteolytic enzymes hydrolize (break) polypeptide chains.
“Tag” refers to marker or marker sequence used to isolate or purify a molecule containing the tag. An exemplary tag includes a His tag.
“T-cell” refers to a type of lymphocyte responsible for antigen-specific cellular interactions, and which mediates humoral and cellular immune responses.
“Target Binding Domain (TBD)” refers to the region of an immunoglobulin heavy chain constant region. In accordance with the present invention, the TBD is a portion capable of binding to an Fc receptor on an APC., particularly a dendritic cell, and is subsequently transported into the APC by receptor-mediated uptake. In accordance with the present invention, the presence of the Fc fragment augments the uptake of the chimeric antigen through the Fc receptor on antigen-presenting cells, specifically dendritic cells. By virtue of the specific uptake, the viral antigen is processed and presented as foreign; thus, an immune response is effectively elicited to the previously tolerant viral antigen.
“Xenotypic” refers to originating from a different species other than the host.
An embodiment of the present invention includes the use of recombinant antigens of HBV, HCV, or DHBV virus fused to a xenotypic antibody fragment by molecular biological techniques, production of the fusion proteins in baculovirus expression system and their use as therapeutic vaccines against chronic HBV and HCV infections. The present invention provides an efficient method to deliver a hitherto unrecognized antigen to APCs in vivo so as to generate a broad immune response, a Th1 response involving CTLs and a Th2 (antibody) response. The immunogenicity of the pre-selected viral antigen unrecognized by the host immune system is increased due to the presence of the xenotypic antibody fragment as well as by the presence of specific glycosylation introduced in the insect cell expression system. The antigen-antibody fragment fusion protein, due to the presence of the antibody component, will bind to specific receptors present on various immune cell types including dendritic cells, macrophages, B-cells and granulocytes. The fusion proteins administered to either humans or animals will be taken up by the APCs, especially DCs, will be hydrolysed to small peptides and presented on the cell surface, complexed with MHC Class I and/or MHC Class II, which can elicit a broad immune response and clear the viral infection.
As used herein, the term “Target Binding Domain (TBD)” refers to the region of an immunoglobulin heavy chain constant region, which is a portion capable of binding to an Fc receptor on an APC. This is derived from Mouse anti-HBVsAg Mab (Hybridoma 2C12) as cloned in pFASTBAC HTa expression vector, and expressed in High Five insect cell expression system (Invitrogen). The constant region of the heavy chain of the immunoglobulin molecule consists of part of CH1, and Hinge-CH2-CH3 from N-terminal to C-terminal. The constant region of the IgG1 molecule for the practice of the present invention contains a linker peptide, part of CH1-hinge and the regions CH2 and CH3. The hinge region portion of the monomeric TBD can form disulphide bonds with a second TBD molecule. FIG. 5 illustrates a schematic representation of the TBD molecule. The protein is expressed as an N-terminal fusion protein with 6-Histidine tag, a seven amino acid recombinant tobacco etch virus (herein referred to as rTEV) protease cleavage site and the N-terminal fusion of the Target Binding Domain (TBD) of the xenotypic (murine) Mab raised against HBV sAg (Hybridoma 2C12). TBD is a fragment of the constant chain of the IgG1 Mab from 2C12 with the sequence of amino acids comprising the 8 amino acid peptide linker, five amino acids of the CH1 region, the hinge sequences, CH2 and CH3 region sequences (FIG. 5). The TBD fragment defined herein forms the parent molecule for the generation of fusion proteins with antigens derived from viruses or other infectious agents. FIG. 1 A depicts the formation of dimeric TBD molecule formed via intermolecular disulphide bonds. FIG. 6 shows the nucleotide sequence of the Open Reading Frame (ORF) encoding the TBD protein and the deduced amino acid sequence as defined in FIG. 5.
FIG. 7 shows a schematic representation of chimeric antigen vaccine molecule, as produced in the insect cell expression system. This molecule is a fusion protein of N-terminal 6-His tag, rTEV protease cleavage site, HBV S1/S2 antigen, linker peptide, a part of the CH1 as well as CH2 and CH3 domains of the mouse monoclonal antibody from 2C12. Cleavage and purification will result in the generation of HBV S1/S2-TBD molecule. FIG. 8 shows the nucleotide and amino acid sequences of the chimeric antigen molecule. FIG. 9 shows the nucleotide and the deduced amino acid sequences of the expressed HBVS1/S2 protein.
FIG. 10 shows a schematic representation of the fusion protein of HBV S1/S2/S-TBD. FIG. 11 shows the nucleotide and deduced amino acid sequences of the ORF of the fusion protein. FIG. 12 shows the nucleotide and deduced amino acid sequences of the HBV S1/S2/S protein.
FIG. 13 illustrates the fusion protein of HBV core-TBD molecule as expressed in the insect cells. FIG. 14 shows the nucleotide and amino acid sequences in the ORF of the fusion protein. FIG. 15 shows the nucleotide and deduced amino acid sequences of the HBV Core protein.
Another embodiment of the present invention involves the production and use of fusion proteins generated from Duck Hepatitis B Virus (DHBV) antigens and murine TBD. DHBV has been used as a very versatile animal model for the development of therapies for HBV, its human counterpart. DHBV genome encodes Surface antigen PreS/S, Core protein (Core) which form capsids and the polymerase enzyme which serves multiple functions.
FIG. 16 depicts a schematic representation of the fusion protein of DHBV PreS-TBD, as produced in High Five (Invitrogen) insect cell expression system. The nucleotide and deduced amino acid sequences of the ORF of the fusion protein as cloned in the plasmid pFastBac HTa is shown in FIG. 17. The nucleotide and deduced amino acid sequences of the DHBV PreS protein shown in FIG. 18.
FIG. 19 shows schematically, another embodiment of the present invention viz. DHBV PreS/S-TBD. The nucleotide and amino acid sequences are presented in FIG. 20. The nucleotide and deduced amino acid sequences are presented in FIG. 21.
FIG. 22 shows a schematic representation of the fusion protein of DHBV Core-TBD. FIG. 23 shows the nucleotide and deduced amino acid sequences of the DHBV Core-TBD fusion protein. The nucleotide and deduced amino acid sequences of DHBV Core protein is shown in FIG. 24.
The present invention uses established recombinant DNA technology for producing the fusion proteins of pre-selected antigen(s) and the TBD which are necessary in the practice of the invention. Fusion protein constructs are generated at the DNA level incorporating specific restriction enzyme sites which are exploited in incorporating the desired DNA fragment into expression vectors and used to express the desired fusion proteins in a heterologous expression system. As used herein, the term “vector” denotes plasmids which are capable of carrying the complimentary DNA which encode the desired protein(s). The plasmid vectors used in the present invention include, but not limited to, pFASTBACHTa and the corresponding recombinant “BACMIDS” generated in DH10BAC E. Coli (Invitrogen). It is possible to mobilize the ORF of the desired proteins and produce other recombinant plasmids for expression of the proteins in other systems, (bacterial or mammalian), in addition to the Baculovirus Expression System (Invitrogen), employed in the present invention. The term “expression” is used to mean the transcription of the DNA sequence into mRNA, the translation of the mRNA transcript into the fusion protein.
This is achieved by the transposition of the gene of interest into the bacmids, tranfected into Sf9 insect cells and recombinant baculovirus produced. These are used to infect High Five insect cells which produce the protein of interest. All the recombinant proteins produced have an N-terminal 6-His tag which is exploited in the purification of the proteins by using Ni-NTA Agarose (Qiagen). The proteins also have an N-terminal rTEV protease cleavage site cloned in. The Ni-purified protein are subjected to digestion with rTEV protease (Invitrogen), which also has an N-terminal 6-His tag. Following the protease digestion, the mixture can be loaded on to a Ni-NTA agarose column and the pure protein can be eluted out, while the 6-His tagged fragments will be bound to the column. This method of purification is standard procedure and one skilled in the art would be able to understand the methodology without further explanation.
Cloning and expression of the DNA sequences which encode the viral antigen and the Fc fragment of the murine monoclonal antibody to generate the chimeric antigen can be achieved through two approaches. The first approach involves cloning the two proteins as a fusion protein, while the second approach involves incorporating specific “bio-linkers” such as biotin or streptavidin in either of the molecules, purifying them separately and generating the chimeric antigen.
A monoclonal antibody (2C12) is generated against the Hepatitis B virus surface antigen, and the hybridoma which produces this monoclonal antibody is used to isolate the total RNA for the murine immunoglobulin G. This total RNA is used to clone the murine Fc fragment. Specifically, the total RNA from a hybridoma cell that expresses murine IgG is isolated using Trizol™ reagent (Invitrogen/Gibco BRL, product catalog number 10551-018, 10298-016). The mRNA is purified from total RNA by affinity chromatography on an oligo-dT column (Invitrogen/Gibco BRL, product catalog number 15939-010). A complementary DNA (cDNA) is produced using reverse transcriptase in a polymerase chain reaction. The oligonucleotide primers are designed to add unique restriction enzyme recognition sites to facilitate cloning. This cDNA is cloned into Bac-To-Bac™ baculovirus expression system (Invitrogen/Gibco BRL, product catalog number 15939-010).
The baculovirus system is used because not only are large amounts of heterologous proteins produced, but post-translational modifications, such as phosphorylation and glycosylation, of eukaryotic proteins occur within the infected insect cell. In this expression system, the cDNA can be cloned into vectors called pFASTBAC™ as illustrated schematically in FIG. 4 (Invitrogen/Gibco BRL, product catalog number 15939-010). The advantage of the Bac-To-Bac™ system over other baculovirus systems involves the method of generating recombinant baculoviruses. In other systems, the protein of interest is cloned and then co-transfected with a wild-type baculovirus. Homologous recombination is required to generate recombinants; however, this method is very inefficient and requires laborious plaque purification and screening. In the Bac-To-Bac™ system, the generation of recombinants is based on site-specific transposition with the bacterial transposon Tn7. The gene of interest is cloned into pFASTBAC™, which has mini-Tn7 elements flanking the cloning sites. The plasmid is transformed into Escherichia coli strain DH10BAC™ (Invitrogen/Gibco BRL, product catalog number 10361-012), which has a baculovirus shuttle plasmid (bacmid) containing the attachment site of Tn7 within a LacZ gene. Transposition disrupts the LacZ gene so that only recombinants produce white colonies and are easily selected for. The advantage of using transposition in E. coli is that single colonies contain only recombinants so that plaque purification and screening are not required. The recombinant bacmids are transfected in insect cells to generate baculoviruses which express recombinant proteins.
The cDNA encoding proteins of interest are generated by PCR with oligonucleotide primers bearing unique restriction enzyme sites from plasmids which contain a copy of the entire viral genome and cloned with the Fc cDNA as a fusion protein. This chimeric protein is purified by protein A or G affinity chromatography using techniques known to those skilled in the art.
The second approach involves incorporating specific “bio-linkers” such as biotin or streptavidin in either of the molecules, purifying them separately and generating the chimeric antigen. The viral antigens of interest are cloned into plasmids that control the expression of proteins by the bacteriophage T7 promoter. The recombinant plasmid is then transformed into an E. coli strain, e.g. BL21(DE3) Codon Plus™ RIL cells (Stratagene, product catalog number 230245), which has production of T7 RNA polymerase regulated by the lac repressor. The T7 RNA polymerase is highly specific for T7 promoters and is much more processive (˜8 fold faster) than the E. coli host's RNA polymerase. When production of T7 RNA polymerase is induced by isopropyl-□-D-thiogalactoside, the specificity and processivity of T7 RNA polymerase results in a high level of transcription of genes under control of the T7 promoter. In order to couple two proteins together, the tight binding between biotin and streptavidin is exploited. In E. coli, the BirA enzyme catalyzes the covalent linkage of biotin to a defined lysine residue in a specific recognition sequence. Antigens which are thus biotinylated can be expressed at a specific site. The murine Fc fragment is expressed in the baculovirus system, as described above, as a fusion protein with streptavidin. These two proteins can be mixed to form a dimeric protein complex by biotin-streptavidin binding.
Following cloning and expression, the chimeric antigen is then evaluated for its efficacy in generating an immune response. Evaluation involves presenting the chimeric antigen to dendritic cells ex vivo or in vivo. The dendritic cells are presented to T-lymphocytes and evaluated for the production of interferon gamma as a marker of T-cell response. Specifically, in the ex vivo situation, naive dendritic cells are isolated from peripheral blood. Dendritic cells process and present antigen to naive T-lymphocytes. The chimeric antigen is then presented to naive dendritic cells for processing. These stimulated dendritic cells are in turn presented to a naive T-cells, which cause their activation into effector cells, e.g. helper T-cells or cytotoxic T-lymphocytes. Activation of the T-cells by the dendritic cells is then evaluated by measuring markers, e.g. interferon □levels, by a known procedure (Berlyn et al., 2001). In the case of the in vivo situation, the chimeric antigen is directly introduced parenterally in the host where available dendritic and other antigen-processing cells which have the capacity to interact with all antigens and process them accordingly.
The following non-limiting examples provide further illustration of the invention.
The mouse IgG1 DNA sequences encoding amino acids of CH1-Hinge-CH2-CH3 region was generated from mRNA isolated from the hybridoma (2C12) which produces Mab against HBV surface antigen (sAg). Total mRNA was isolated using TRizol reagent (Gibco BRL cat. No. 15596-026) and the cDNA of the TBD was generated by RT-PCR using Superscript First-strand Synthesis (Invitrogen Cat. No. 11904-018). The PCR primers contained linker sequences encoding the linker peptide—SRPQGGGS—(SEQ ID NO: 28) at the 5′ terminus, a unique Not I site at the 5′ and a unique Hind III restriction site at the 3′ end. The resulting cDNA contains (5′ Not I)-linker sequence-CH1 (VDKKI)-CH2-CH3-(3′ Hind III). Following digestion with the respective enzymes, the fragment is ligated with pFASTBACHTa expression vector plasmid (Invitrogen) using the same restriction enzyme sites. The 5′ primer used for PCR amplification was (Sense) 5′ TGTCATTCTGCGGCCGCAAGGCGGCGGGATCCGTGGACAAGAAAATTGTGCCAGG (Seq. ID No. 1) and the 3′ primer was (antisense) 5′ ACGAATCAAGCTTTGCAGCCCAGGAGA (Seq. ID No. 2), which contained the Not I and Hind III sites, respectively. The following is the protocol used for directional cloning. The generated fragment was digested with the respective enzymes, purified on agarose gel and cloned into the vector plasmid. The DNA sequence and the correctness of the ORF were verified by standard sequencing methods.
Following the cloning of the gene of interest (eg. TBD) into the pFastBac-HTa donor plasmid, the production of recombinant proteins is based upon the Bac-to-Bac baculovirus expression system (Invitrogen). The next step is site-specific transposition of the cloned gene into a baculovirus shuttle vector (Bacmid). This is accomplished in a strain of E. coli called DH10Bac. The DH10Bac cells contain the bacmid, which confers kanamycin resistance and a helper plasmid which encodes the transposase and confers resistance to tetracycline. The recombinant pFastBac-HTa plasmids with the gene of interest (TBD) are transformed into DH 10Bac cells for the transposition to generate recombinant bacmids. A 100 μl aliquot of competent DH10Bac cells is thawed on ice, the pFastBac-HTa based plasmids are added and the mixture is incubated on ice for 30 minutes. The mixture is given a heat shock for 45 seconds at 42° C. and then chilled on ice for 2 minutes. The mixture is then added to 900 μL of LB media and incubated for 4 hours at 37° C. The transformed cells are serially diluted with LB to 10−1 and 10−2 and 100 μl of each dilution is plated on LB agar plates supplemented with 50□g/ml kanamycin, 7 μg/ml gentamicin, 10□g/ml tetracycline, 100□g/ml X-gal, and 40□g/ml IPTG and incubated for at least 36 hours at 37° C. The gentamicin resistance is conferred by the pFastBac-HTa and the X-gal and IPTG are used to differentiate between white colonies (recombinant bacmids) from blue colonies (non recombinant). The white colonies are picked and inoculated into 2 ml of LB supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin and 10 μg/ml tetracycline and incubated overnight at 37° C., with shaking. A sterile loop is used to sample a small amount of the overnight culture and the sample is streaked onto a fresh LB agar plate supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml X-gal, and 40 μg/ml IPTG and incubated for at least 36 hours at 37° C. to confirm a white phenotype.
Recombinant bacmids were isolated by standard protocols (Maniatis), the DNA sample was dissolved in 40 μl of TE (10 mM Tris-HCL pH 8, 1 mM EDTA) and used for transfections.
In order to produce baculoviruses, the bacmid is transfected into Sf9 insect cells. Sf9 cells (9×105) were seeded into each well of a 6 well cell culture dish (35 mm wells) in 2 ml of EX-CELL 401 (JRH biosciences) and allowed to attach for at least 1 hour at 27° C. Transfections were carried out using CELLFECTIN Reagent (Invitrogen, Cat. No. 10362-010) as per the protocols provided by the supplier of the Sf 9 cells. Following transfection, the cells were incubated at 27° C. for 72 hours. The medium containing baculovirus was collected and stored at 4° C. in the dark.
The efficiency of the tranfection was verified by checking for production of baculoviral DNA. The isolated baculovirus DNA is subjected to PCR to screen for the inserted gene of interest (TBD). The primers used are pFastBac 5′ (sense) TAT TCC GGA TTA TTC ATA CCG (Seq. ID No. 3) and pFastBac 3′ (antisense) 5′ CTCTACAAATGTGGTATGGC (Seq. ID No 4). Amplified products were on an agarose gel (0.8%). The expression of the heterologous protein in the cells was verified by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and Western blots using the 6-His tag monoclonal antibody (Clonetech) as the probe.
Once production of baculovirus and the expression of protein have been confirmed, the virus production is amplified to produce a concentrated stock of the baculovirus that carry the gene of interest (e.g. TBD). It is standard practice in the art to amplify the baculovirus at least two times, and in all protocols described herein this standard practice was adhered to. After the second round of amplification, the concentration of the generated baculovirus was quantified using a plaque assay according to the protocols described by the manufacturer of the kit (Invitrogen). The most appropriate concentration of the virus to infect High Five cells and the optimum time point for the production of the desired protein was established as well.
The DNA encoding the HBV sAg fragment S1/S2 was generated from the plasmid pRSETB HBV S1/S2 template using PCR methodology. The primers used were: (sense) 5′ GGATCCTGTACGATGACG (Seq. ID No. 5) and the 3′ primer (antisense) 5′ AGTCATTCTGCGGCCGCGAGTTCGTCACAGGGTCCCCGG (Seq. ID No. 6) containing the restriction enzyme site Not I. The 5′ end contained a unique Bam H I site derived from the parent plasmid which was used for ligations. Amplified DNA was digested with Bam H I/Not I and ligated with pFastBacHTa expression vector to generate the expression plasmid for HBV S1/S2 protein. The fragment was ligated with the plasmid pFastBacHTa-TBD (described in example 1) following the digestion with the respective enzymes. This produced the expression plasmid pFastBacHTa HBV S1/S2-TBD. This plasmid was used to produce recombinant baculovirus (described in example 1) which expressed the chimeric antigen-TBD fusion protein: 6-His tag-rTEV protease cleavage site-HBVS1/S2-TBD (See FIGS. 7-9).
The DNA encoding the HBV sAg fragment S1/S2/S was generated from the plasmid pALT HBV 991 (University of Alberta) template using PCR methodology. The 5′ primer used for the PCR was (sense) 5′ GATAAGGATCCTATGGGAGGTTGGTCATCAAAAC (Seq. ID No. 7), containing the restriction enzyme Nco I site. The PCR primer for 3′ terminus was (antisense) 5′ GTCATACTGCGGCCGCGAAATGTATACCCAGAGACAAAAG (Seq. ID No. 8), containing the restriction enzyme Not I site. Amplified cDNA was digested with the respective enzymes and ligated with pFastBacHTa expression vector to generate either the expression plasmid for HBV S1/S2/S or the expression plasmid pFastBac HTa HBV S1/S2/S-TBD fusion protein (see FIGS. 10-11).
HBV produces the core proteins (Core) to encapsidate the replicating genome of the virus. There are two forms of the core one secreted into circulation, also known as the “e” antigen and the capsid forming core protein. The present invention also relates to the generation of expression plasmids to produce the Core protein as well as the core antigen-TBD fusion protein, in insect cells. The cDNA encoding the HBV Core protein was generated from the plasmid pALTHBV991 template using PCR technique. The 5′ primer used for the PCR was (sense) 5′ TGCGCTACCATGGACATTGACCCCTTATAAAG (Seq. ID No. 25) which contains the restriction enzyme Nco I site and the 3′ primer used was (antisense) 5′ TGTCATTCTGCGGCCGCGAACATTGAGATTCCCGAGATTGAG (Seq. ID No. 26), containing the restriction enzyme Not I site. The PCR-amplified cDNA was digested with the respective enzymes and ligated with pFastBacHTa expression vector to generate either the expression plasmid for HBV Core protein or the expression plasmid pFastBacHTa HBV Core-TBD fusion protein (see FIGS. 13-14).
DHBV has served as a powerful animal model in the development of antiviral therapy for HBV. Pekin ducks, congenitally infected with DHBV have been used to study the mechanism of replication of the virus and for the screening of antiviral compounds. The present invention also describes the chimeric DHBV antigen-TBD molecules which could be used as therapeutic vaccines in DHBV-infected ducks, thus providing a viable animal model for the feasibility studies for a HBV therapeutic vaccines.
The cDNA encoding DHBV PreS antigen was produced by PCR from a plasmid pFastBacHTaDHBV PreS/S (University of Alberta). The 5′ primer used for the PCR was (sense) 5′ TATTCCGGATTATTCATACCG (SEQ. ID No. 9). The unique restriction enzyme site EcoR I, resident on the parent plasmid was used for directional cloning. The 3′ primer used was (antisense) 5′ TGTCATTCTGCGGCCGCGTTTTCTTCTTCAAGGGGGGAGT (Seq. ID No. 27), containing the restriction enzyme Not I site. Following PCR amplification, the fragment was digested with the restriction enzymes EcoR I and Not I and the DNA fragment was purified on a 1% agarose gel. The fragment was ligated with the expression plasmid pFastBacHTa at the respective sites to produce pFastBacHTa DHBV PreS, which expressed the PreS antigen. The same fragment was also used to ligate with pFastBacHTa-TBD to generate the expression plasmid pFastBacHTa DHBV PreS-TBD. The production of baculovirus stocks from these plasmids and the expression of the PreS and PreS-TBD in High Five insect cells were done as described in example 1.
DHBV PreS/S cDNA was produced by PCR methods using 5′ primer (sense) 5′ TATTCCGGATTATTCATACCG (Seq. ID No. 9) and the 3′ primer (antisense) 5′ TGTCATTCAGCGGCCGCGAACTCTTGTAAAAAAGAGCAGA (Seq. ID No. 10), containing restriction enzyme Not I site. The unique restriction enzyme site Eco R I, resident on the parent plasmid pFastBacHTa PreS/S (University of Alberta) was used for directional cloning. This plasmid also was the template for generating the required cDNA by PCR. All other protocols for the production of either the DHBV PreS/S or the fusion protein PreS/S-TBD are the same as described in the example 5 above.
The cDNA coding for the DHBV Core was generated by PCR using the following primers. The 5′ terminus primer used was (sense) 5′ TGCGCTACCATGGATATCAATGCTTCTAGAGCC (Seq. ID No. 11), containing the restriction enzyme Nco I site. The 3′ terminus primer used was (antisense) 5′ TGTCATTCTGCGGCCGCGATTTCCTAGGCGAGGGAGATCTATG (Seq. ID No. 12), containing the restriction enzyme Not I site. All other protocols for the production of either the DHBV Core or the fusion protein DHBV Core-TBD are the same as described in the example 5 above.
HBV sAg was cross linked using the bifunctional cross linking agent DMS, a homobifunctional imidoester which react with amino groups on the proteins. The unreacted components were removed by gel filtration. The conjugate was characterized with respect to the stoichiometry of sAg/Fc in the conjugate and the fraction containing sAg:Fc at 1:1 ratio was chosen for antigen presentation assays using human monocyte-derived immature Dendritic cells (DCs). Immature DCs were cultured for four days with GM-CSF/IL4, incubated with the sAg-Fc conjugate and matured in the presence of TNFα/IFNα. Autologous CD3+ T cells were added to the mature DCs. Following three rounds of exposure to the mature DCs, T cell stimulation was quantitated by measuring the production of intracellular IFNγ, using flow cytometry.
Solutions of sAg (100 μg) and Mouse Fc fragment (100 μg), were dialyzed against the cross linking buffer overnight at 4° C. The protein solutions were mixed together, DMS reagent was added immediately to a final concentration of 10 mM, and the mixture was incubated at room temperature for 1 hr. The reaction was stopped by the addition of 0.1 M Tris Hcl pH 7.8. The reaction mixture was loaded on a Sephadex G 75 column (0.7×12 cm), and fractions were eluted using elution buffer. 0.5 ml fractions were collected and the fractions containing sAg/Fc at a molar ratio of 1:1, as estimated by Elisa using the respective antibodies were pooled and used for Antigen Presentation Assays.
Results:
The levels of intracellular IFNγ produced in T cells in the presence of conjugate was substantially higher than the sAg or the Fc fragment alone.
Hepatitis C virus (HCV) is a member of the flaviviridae family of RNA viruses. Route of infection is via blood and body fluids and over 50% of the patients become chronic carriers of the virus. Persistent infection result in chronic active hepatitis which may lead to liver cirrhosis and hepatocellular carcinoma (Saito et. al. (1990) PNAS USA 87: 6547-6549).
Approximately 170 million people worldwide are chronic carriers of HCV (Wild & Hall (2000) Mutation Res. 462: 381-393). There is no prophylactic vaccine available at present. Current therapy is Interferon α2b and Ribavirin, either alone or as combination therapy. The significant side effects for interferon treatment and the development of mutant strains are major drawbacks to the current therapy. Moreover, interferon therapy is effective only in 20% of the patients.
Therapeutic vaccines to enhance host immune system to eliminate chronic HCV infection will be a major advancement in the treatment of this disease.
Replication of HCV:
HCV genome is a positive sense single stranded RNA molecule of approximately 9.5 Kb in length. This RNA which contains both 5′ and 3′ untranslated regions codes for a single polyprotein which is cleaved into individual proteins catalyzed by both viral and host proteases (Clarke, B. (1997) J. Gen. Virol. 78: 2397-2410). The structural proteins are Core, Envelope E1 & E2 and P7. The non-structural proteins are NS2, NS3, NS4A, NS4B, NS5A and NS5B. Core forms capsids. E1, E2 are envelope proteins, also called “Hypervariable region” due to the high rate of mutations. NS3 is a Serine Protease, the target of several protease inhibitors as antivirals for HCV. NS5B is the RNA Polymerase enzyme. NS5A has recently been suggested to have a direct role in the replication of the virus in the host by counteracting the interferon response Tan, S-L & Katze, M. G. (2001) Virology 284: 1-12) which augments the immune function.
Chimeric HCV Antigens:
HCV Core-TBD:
This protein has been cloned using the pFASTBAC HTa vector and the baculovirus system and expressed in Sf-9 and High Five insect cells, similar to the HBV fusion proteins. This was done as follows. The DNA encoding the HCV core fragment was generated from the plasmid pCV-H77c (NIH) template using PCR methodology.
The primers used were: (sense) 5′CGGAATTCATGAGCACGAATCCTAAAC (SEQ ID NO: 13) containing the restriction enzyme site Eco RI and the 3′ primer (antisense) 5′ GGACTAGTCCGGCTGAAGCGGGCACAGTCAGGCAAGAG (SEQ ID NO: 14) containing the restriction enzyme site Spe I. Amplified DNA was digested with Eco RI/Spe I and ligated with fragment was ligated with the plasmid pFastBacHTa-TBD (described in example 1) following the digestion with the respective enzymes. This produced the expression plasmid pFastBacHTa HCV core-TBD. This plasmid was used to produce recombinant baculovirus (described in example 1) which expressed the chimeric antigen (HCVcore-TBD) fusion protein. 6-His tag-rTEV protease cleavage site-HCV core-TBD.
HCV Core Protein:
Amplified DNA was digested with Eco RI/Spe I and ligated with plasmid pFastBacHTa expression vector to generate the expression plasmid for HCV core protein. This protein is expressed with N-terminal 6His tag and rTEV protease cleavage site.
The following HCV antigens and their respective Chimeric antigens (Antigen-TBD) have been cloned and are ready for expression.
E1 & E1-TBD
E2 & E2-TBD
E1 E2 & E1 E2-TBD
NS5A & NS5A-TBD
Baculovirus Expression System is commercially available from Invitrogen and the procedures used were as described in the company protocols. The gene of interest is cloned into pFastBac-HTa donor plasmid and the production of recombinant proteins is based upon the Bac-to-Bac baculovirus expression system (Invitrogen).
In the next step, the pFastBac-HTa donor plasmid containing the gene of interest is used in a site-specific transposition in order to transfer the cloned gene into a baculovirus shuttle vector (bacmid). This is accomplished in E. coli strain DH10Bac. The DH10Bac cells contain the bacmid, which confers kanamycin resistance and a helper plasmid which encodes the transposase and confers resistance to tetracycline. The recombinant pFastBac-HTa plasmids with the gene of interest are transformed into DH10Bac cells for the transposition to generate recombinant bacmids. A 100 μl aliquot of competent DH10Bac cells is thawed on ice, the pFastBac-HTa based plasmids are added and the mixture is incubated on ice for 30 minutes. The mixture is given a heat shock for 45 seconds at 42° C. and then chilled on ice for 2 minutes. The mixture is then added to 900 μL of LB media and incubated for 4 hours at 37° C. The transformed cells are serially diluted with LB to 10−1 and 10−2 and 100 μl of each dilution is plated on Luria broth (LB) agar plates (supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml X-gal, and 40 μg/ml IPTG) and incubated for at least 36 hours at 37° C. The gentamicin resistance is conferred by the pFastBac-HTa and the X-gal and IPTG are used to differentiate between white colonies (recombinant bacmids) from blue colonies (non recombinant). The white colonies are picked and inoculated into 2 ml of LB (supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin and 10 μg/ml tetracycline) and incubated overnight at 37° C., with shaking. A sterile loop is used to sample a small amount of the overnight culture and the sample is streaked onto a fresh LB agar plate (supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml X-gal, and 40 μg/ml IPTG) and incubated for at least 36 hours at 37° C. to confirm a white phenotype.
Recombinant bacmids were isolated by standard protocols (Sambrook and Russell, 2001), the DNA sample was dissolved in 40 μl of TE (10 mM Tris-HCl pH 8, 1 mM EDTA) and used for transfections.
In order to produce baculoviruses, the bacmid is transfected into Sf9 insect cells. Sf9 cells (9×105) were seeded into each well of a 6 well cell culture dish (35 mm wells) in 2 ml of SFM 900 II and allowed to attach for at least 1 hour at 27° C. Transfections were carried out using CELLFECTIN Reagent (Invitrogen, Cat. No. 10362-010) as per the protocols provided by the supplier of the Sf 9 cells. Following transfection, the cells were incubated at 27° C. for 72 hours. The medium containing baculovirus was collected and stored at 4° C. in the dark.
The efficiency of the transfection was verified by checking for production of baculoviral DNA. The isolated baculovirus DNA is subjected to PCR to screen for the inserted gene of interest. The primers used are pFastBac 5′ (sense) TAT TCC GGA TTA TTC ATA CCG (Seq. ID No.3) and pFastBac 3′ (antisense) 5′ CTCTACAAATGTGGTATGGC (Seq. ID No 4). Amplified products were separated on an agarose gel (0.8%). The expression of the heterologous protein in the cells was verified by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and Western blots using the 6-His tag monoclonal antibody (Clontech) as the probe.
Once production of baculovirus and the expression of protein have been confirmed, the virus stock is amplified to produce a concentrated stock of the baculovirus that carry the gene of interest. It is standard practice in the art to amplify the baculovirus at least two times, and in all protocols described herein this standard practice was adhered to. After the second round of amplification, the concentration of the generated baculovirus was quantified using a plaque assay according to the protocols described by the manufacturer of the kit (Invitrogen). The most appropriate concentration of the virus to infect High Five cells and the optimum time point for the production of the desired protein was also established.
Recombinant bacmids of standardized multiplicity of infection (MOI) were used to infect High Five insect cells. For suspension cultures, cells were seeded at a density of 3×105 cells/mL and incubated at 27.5° C. with shaking at 138 rpm until the cell density reached 2-3×106 cells/mL. Standardized amounts of the respective recombinant baculovirus was added to the cells. The incubation temperature was 27.5° C. and the appropriate infection period was standardized for individual protein expression. The cells were harvested by centrifugation at 2,500 rpm for 10 minutes at 4° C. and used for the purification of the recombinant proteins. Unused portions of cells were snap frozen in liquid nitrogen and stored at −70° C.
For purification under denaturing conditions, the cells were lysed in a buffer containing 6 M guanidinium-HCl in 100 mM NaH2PO4, 10 mM Tris, 300 mM NaCl, 10 mM Imidazole, pH 8.0 (lysis buffer). The suspension was sonicated on ice with 5 pulses of 1 minute per pulse at a power setting of 60 watts, and was mixed at room temperature for 1 hour. The lysate was centrifuged at 10,000×g for 10 min to remove unbroken cells and cell debris. The supernatant was loaded on to a Ni-NTA agarose (Qiagen) bead column (1×5 cm/100 mL cell lysate), pre-equilibrated with lysis buffer. Following loading, the column was washed with 20 column volumes of 6 M guanidinium-HCl in 100 mM NaH2PO4, 10 mM Tris, 300 mM NaCl, 40 mM Imidazole, pH 8.0 (wash buffer 1), followed by washes with 20 column volumes of 8 M urea in 100 mM NaH2PO4, 10 mM Tris, 300 mM NaCl, 40 mM imidazole, pH 8.0 (wash buffer 2). The bound protein was eluted with a buffer containing 8 M urea, 100 mM NaH2PO4, 10 mM Tris, 300 mM NaCl, 250 mM imidazole, pH 8 (Elution Buffer). The fractions containing the protein was pooled and dialyzed against PBS, (Overnight, 4° C.).
Peripheral blood mononuclear cells (PBMC) were obtained from Ficoll/Histopaque (Sigma) treatment of a leukapheresis cell preparation as described above. Monocytes were separated from the PBMC population by negative selection using a monocyte isolation kit (Dynal) as previously described. The monocytes were greater than 95% pure as assessed by antibody analysis and flow cytometry (CD3−, CD19−, CD16−, CD11a+, CD14+). Monocytes were washed twice with AIM V media containing L-glutamine, streptomycin sulfate (50 μg/mL) and gentamicin sulfate (10 μg/mL) with 1% donor matched sera (isolated as described above). Next, the monocytes were cultured in AIM V media containing 2.5% donor matched sera and the cytokines GM-CSF and IL-4 to differentiate the cells toward the dendritic cell (DC) lineage. The cells were incubated in 12-well tissue culture plates at 37° C. under a 7% CO2 atmosphere. The DCs were used for APAs and ligand binding and uptake studies.
The monocyte-derived DCs (mDC) were harvested on days 1 through 4. The cells were subsequently washed once with AIM V media with 0.1% BSA (Sigma), and twice with Dulbecco's phosphate buffered saline (Invitrogen) with 0.1% (w/v) BSA (PBSB). The mDC were used in 4° C. labeling or binding assays or in 37° C. binding/uptake assays.
Antigen presentation assays were performed using human PBMC-derived dendritic cells according to established protocols (Berlyn, Schultes et al., 2001). Monocytes were generated from leukapheresis samples from healthy donors (described above) and were depleted of lineage cells by incubation with anti-CD3, CD19, and CD16 antibodies. This was followed by incubation with magnetic bead conjugated anti-mouse IgG and separation on a magnet (Dynal). Negatively selected cells were approximately 95% pure monocytes as characterized by flow cytometry using a broad CD marker panel. Next, monocytes were incubated with IL-4 and GM-CSF (R&D Systems) for 4 days in RPMI 1640+10% matched human serum to generate immature DC.
Again, an aliquot of the cells was stained with a broad CD marker panel to ensure purity and identity of the cells. The cells were harvested and loaded with antigens for 2-8 hours at 37° C., and matured with IFN-α and TNF-α for 3 days. Dendritic cell were checked again using flow cytometry for an array of CD markers to ensure that cells had undergone proper maturation. Mature DCs were washed thoroughly and added to T cells that were generated from the same monocytes as the DCs by means of negative selection using a magnetic T cell isolation kit (Dynal). T cells and DCs were incubated for 7 days and re-stimulated with loaded and matured DCs that were prepared as described above.
An aliquot of the cells was taken 24 hours later and prepared for intracellular cytokine staining (Day 15), while the remaining cells were incubated for another 7 days. The latter cells were stimulated with another batch of loaded and matured DCs and prepared for intracellular cytokine staining on Day 22.
For intracellular cytokine staining, cells were incubated with Brefeldin A (Golgi Plug, R&D Systems) 2 hours after DC addition and incubated for another 18 hours. Cells were stained with anti-CD3-FITC and anti-CD8-cytochrome for 30 minutes, washed, permeabilized, and stained with anti-IFN-γ-PE for 30 minutes on ice. The cells were washed, fixed and analyzed by flow cytometry (ACS Calibur, Becton Dickinson). After the third DC loading and presentation, a batch of the T cells was incubated for three days and the supernatant was used for measuring the level of secreted IFN-γ by ELISA (Pharmingen DouSet). A protocol summary for the APA is presented in schematic form.
There are several receptors on the APCs that bind and take up antigens. The abundance of these receptors on maturing DCs was evaluated using fluorescent labeled receptor-specific antibodies. FACS analysis was used to estimate percentage of specific positive cells in the total population of DCs and as a function of relative fluorescent intensity (FIG. 30). The expression of CD64 decreased with time in culture and at day 4 was almost negligible. In contrast, CD32, and to a lesser extent CD16, were expressed after 4 days of DC culture. On day 0 of culture, there was essentially no CD206 expression, but on culture with IL-4 and GM-CSF, the expression of CD206 was induced and at day 4 was expressed at very high levels. Thus at day 4, the day that antigen was loaded in the antigen presentation assays, the DCs possessed at least two potential receptors for the binding of chimeric antigens: CD32 and CD206. In addition, as shown in FIG. 30, they had the full complement of the co-stimulatory molecules. The expression of HLA-DR (Class II) and HLA-ABC (Class I) also increased with time in culture. Co-stimulatory molecules CD86 (B 7.2) and CD80 (B 7.1) were expressed at high levels throughout the period of the assay (FIG. 31). These results indicate that the monocyte-derived DCs were differentiating towards mature DCs and were capable of antigen presentation to T cells. The cells were used to evaluate the binding and uptake of the chimeric antigens in comparison to relevant antibodies.
For the phenotypic analysis and binding assay, all procedures using incubations were performed at 4° C., buffer solutions were also held at 4° C. The binding of antigens, chimeric antigens or antibodies was determined by incubating the cells with various concentrations of the agents for 60 minutes in PBSB.
For phenotypic analysis, cells were incubated with the various conjugated Mabs at the concentrations recommended by the manufacturer for 20 minutes. Incubations were performed with 1×105 cells/well in 96-well v-bottom plates in a volume of 25 μL. Subsequently, the cells were washed twice with PBSB.
Before conjugated Mab labeling, the cells were resuspended in PBS with 2% (w/v) paraformaldehyde (PF), and for the binding studies, the cells were treated with F(ab′)2 goat anti-mouse Alexa-488 (10 μg/mL) in PBSB for 20 minutes. The cells were washed twice with PBSB and either resuspended in PBSB with 2% PF and acquired by FACS or in PBSB and incubated with PE-conjugated CD32 or CD206 specific Mab for 20 minutes before washing twice with PBSB.
To determine the extent of uptake of chimeric antigens (e.g. HBV S1/S2-TBD) compared with IgG1 and IgG2a, cells were incubated with various concentrations of the antigen, IgG1 (2C12, the parent Mab from which TBD was produced) and IgG2a (G155-178) for 1 hour at 37° C. in AIM V media with 0.1% BSA. Cells were washed twice in PBSB and fixed with PBS with 2% PF overnight at 4° C. Subsequently, the cells were washed twice in PBSB and permeablized with PBS containing 0.1% (w/v) saponin (Sigma) for 40 minutes at 20° C.
The cells were washed twice with PBSB and incubated with F(ab′)2 goat anti-mouse Alexa-488 (10 μg/mL) in PBSB with 0.1% (w/v) saponin for 20 minutes at 4° C. After washing twice in PBSB, the cells were resuspended in PBSB. A variant of this assay involved treating the cells as above with chimeric antigen, IgG1, or IgG2a 10 minutes followed by the addition of F(ab′)2 goat anti-mouse Alexa-488 (10 μg/mL) for 50 minutes. Subsequently the cells were washed and resuspended in PBS with 2% PF. This procedure relied on the ability of the anti-mouse Alexa-488 Ab to directly bind the S1/S2-TBD, IgG1 or IgG2a molecules.
Cells were acquired by a Beckton Dickenson (BD) FACScan fitted with Cellquest acquisition and analysis software (BD). A gate was made on the viable cell population as determined by the FSC and SSC scatter profile and ≧10,000 events were acquired. To determine the percentage of positive cells, a gate was set based on negative control treated cells (isotype control labeled or cells labeled with F(ab′)2 goat anti-mouse Alexa-488 alone).
The percent of specific positive cells was calculated as:
% positive cells test sample - % positive cells control ) 100 - % positive cells of control × 100
The relative mean fluorescent intensity (MFI) was determined as the MFI of the test sample—MFI of the control sample.
The mouse IgG1 DNA sequences encoding amino acids of CH1-Hinge-CH2-CH3 region was generated from mRNA isolated from the hybridoma (2C12) which produces Mab against HBV surface antigen (sAg). Total mRNA was isolated using TRizol reagent (Gibco BRL cat. No. 15596-026) and the cDNA of the TBD was generated by RT-PCR using Superscript First-strand Synthesis (Invitrogen Cat. No. 11904-018). The PCR primers contained linker sequences encoding the linker peptide—SRPQGGGS—(SEQ ID NO: 28) at the 5′ terminus, a unique Not I site at the 5′ and a unique Hind III restriction site at the 3′ end. The resulting cDNA contains (5′ Not I)-liner sequence-CH1 (VDKKI)-CH2-CH3-(3′ Hind III). Following digestion with the respective enzymes, the fragment is ligated with pFASTBACHTa expression vector plasmid (invitrogen) using the same restriction enzyme sites to generate—pFASTBACHTa-TBD. The 5′ primer used for PCR amplification was (Sense) 5′ TGTCATTCTGCGGCCGCAAGGCGGCGGGAT CCGTGGACAAGAAAATTGTGCCAGG (SEQ ID NO: 1) and the 3′ primer was (antisense) 5′ ACGAATCAAGCTTTGCAGCCCAGGAGA (SEQ ID NO: 2), which contained the Not I and Hind III sites, respectively. The following is the protocol used for directional cloning. The generated fragment was digested with the respective enzymes, purified on agarose gel and cloned into the vector plasmid. The DNA sequence and the correctness of the ORF were verified by standard sequencing methods. Nucleotide sequence of the ORF of TBD in the plasmid pFASTBACHTa-TBD and the deduced amino acid sequences of the expressed TBD protein from the ORF is shown in FIG. 32.
Recombinant bacmids of standardized multiplicity of infection (MOI) were used to infect High Five insect cells. For suspension cultures, cells were seeded at a density of 3×105 cells/mL and incubated at 27.5° C. with shaking at 138 rpm until the cell density reached 2-3×106 cells/mL. Recombinant baculovirus was added to the cells. For the expression of TBD the MOI used was 10 pfu/cell. The incubation at 27.5° C. was continued for 48 hrs. The cells were harvested by centrifugation at 2,500 rpm for 10 minutes at 4° C. and used for the purification of the recombinant proteins.
TBD protein was expressed in Express Five Insect cells, purified as described in the methods section. The protein was subjected to electrophoresis on a 12% polyacrylamide gel and the coomassie blue-stained band is shown.
The DNA encoding the HBV sAg fragment S1/S2 was generated from the plasmid pRSETB HBV S1/S2 template using PCR methodology. The primers used were: (sense) 5′ GGATCCTGTACGATGACG (Seq. ID No. 5) and the 3′ primer (antisense) 5′ AGTCATTCTGCGGCCGCGAGTTCGTCACAGGGTCCCCGG (Seq. ID No. 6) containing the restriction enzyme site Not I. The 5′ end contained a unique Bam H I site derived from the parent plasmid which was used for ligations. Amplified DNA was digested with Bam H I/Not I and ligated with pFastBacHTa expression vector to generate the expression plasmid for HBV S1/S2 protein. The fragment was ligated with the plasmid pFastBacHTa-TBD (described in example 3) following the digestion with the respective enzymes. This produced the expression plasmid pFastBacHTa HBV S1/S2-TBD. This plasmid was used to produce recombinant baculovirus (described in example 10) which expressed the chimeric antigen-TBD fusion protein: 6-His tag-rTEV protease cleavage site-HBVS1/S2-TBD. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa HBV S1/S2 are shown in FIG. 8. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa HBV S1/S2-TBD are shown in FIG. 33.
Recombinant bacmids of standardized multiplicity of infection (MOI) were used to infect High Five insect cells. For suspension cultures, cells were seeded at a density of 3×105 cells/mL and incubated at 27.5° C. with shaking at 138 rpm until the cell density reached 2-3×106 cells/mL. Recombinant baculovirus was added to the cells. For the expression of the fusion protein HBV S1/S2-TBD, the MOI was 1 pfu/cell and for S1/S2, 2 pfu/cell were used. The incubation at 27.5° C. was continued for 48 hrs. The cells were harvested by centrifugation at 2,500 rpm for 10 minutes at 4° C. and used for the purification of the recombinant proteins.
HBV S1/S2 protein and the fusion protein HBV S1/S2-TBD fusion protein were expressed in Express Five Insect cells, purified as described in example 1.b. The proteins were subjected to electrophoresis on a 12% polyacrylamide gel and stained with coomassie blue.
The chimeric antigen S1/S2-TBD binds to maturing DCs with high efficiency (FIG. 34). The extent of binding of S1/S2-TBD relative to murine IgG1 and IgG2a to maturating DC was compared. DCs were isolated at various days of ex vivo culture (from day 0 to day 4) and treated with S1/S2-TBD (10 μg/mL) or with murine IgG1 (clone 2C12) or IgG2a (clone G155-178, 90 μg/mL) for 1 hour at 4° C. Subsequently, binding was detected with a F(ab′)2 anti-mouse IgG conjugated to Alexa 488 as described in the methods section. The binding of S1/S2-TBD relative to IgG1 and IgG2a on DC after 1 and 4 days of culture is shown in FIG. e. S1/S2-TBD binding was clearly much greater than the binding of either IgG1 or IgG2a with more S1/S2-TBD binding evident on day 1 than on day 4. These experiments clearly demonstrated that S1/S2-TBD was bound with high efficiency to the maturing DC.
A large proportion of maturing DCs bind S1/S2-TBD. The binding of S1/S2-TBD in comparison to murine IgG2a and IgG1 was measured as a function of phenotypic changes on day 2 of the maturation of DCs as described in the methods section. DCs were isolated at various days of culture (from day 0 to day 4) and were treated with S1/S2-TBD (10 μg/mL), murine IgG1 (clone 2C12), or IgG2a (clone G155-178, 90 μg/ml) for 1 hour at 4° C. Subsequently, binding was detected with a F(ab′)2 anti-mouse IgG conjugated to Alexa 488. The binding of S1/S2-TBD relative to IgG1 and IgG2a on DC after 1 and 4 days of culture is shown in FIGS. 35 and 36. S1/S2-TBD binding was clearly much greater than the binding of either IgG1 or IgG2a with more S1/S2-TBD binding evident on day 1 than day 4. Thus, these experiments demonstrated that a large proportion of maturing DCs bind S1/S2-TBD The proportion of DCs that bind S1/S2-TBD was much greater than either IgG2a or IgG1. Furthermore, the degree of binding of S1/S2-TBD was several orders of magnitude greater than that of the immunoglobulins.
The chimeric Antigen S1/S2-TBD binds to DCs more efficiently than IgG1 or IgG2a on days 1 and 4 of culture.
The uptake of S1/S2-TBD in comparison to murine IgG1 and IgG2a was estimated as a function of concentration on day 4 of DC maturation. The uptake was quantified at 37° C. for 1 hour and the results are shown in FIG. 37.
There was a linear increase in the uptake of S1/S2-TBD with concentration. IgG1 was taken up at a much lower level and there was very little uptake of IgG2a. Therefore, the chimeric antigen S1/S2-TBD is taken up by the DCs more efficiently than immunoglobulins.
There is a direct correlation between the expression of CD32/CD206 receptors and S1/S2-TBD binding to maturing DCs. Since it was known that murine IgG1 binds efficiently to CD32, it was expected that S1/S2-TBD which contains the murine Fc component of IgG1 would also bind CD32. Furthermore, S1/S2-TBD by virtue of its high mannose glycosylation, would also be expected to bind to DC through the CD206 receptor.
The dot plots in FIG. 38 show S1/S2-TBD binding (10 μg/mL) and CD32 expression as well as S1/S2-TBD binding and CD206 expression. There was a direct correlation between the extent of S1/S2-TBD binding and the degree of CD32 expression, which was relatively heterogeneous, i.e., there was a broad degree of expression. These results demonstrate that S1/S2-TBD binds to CD32, and that the greater the expression of CD32, the greater was the degree of binding of the chimeric antigen S1/S2-TBD. The dot plot of S1/S2-TBD binding and CD206 expression shows that the vast majority of cells expressing CD206 also bound S1/S2-TBD A small percentage of the cell population was CD206 negative and was consequently negative for S1/S2-TBD binding. Therefore both CD32 and CD206 receptors are involved in the binding of the S1/S2-TBD.
The uptake of S1/S2-TBD in comparison to murine IgG1 and IgG2a was estimated as a function of concentration on day 4 of DC maturation. The uptake was quantified at 37° C. for 1 hour in the presence and absence of inhibitors of CD32 and CD206 and the results are shown in FIG. 39. There was a progressive increase in the binding of the chimeric antigen with its concentration. Mab against mouse Fcγ fragment abolished this binding, whereas mannan, an inhibitor of CD206 receptor binding, had only marginal effect. Therefore, CD32 may be the primary receptor involved in the binding and uptake of the chimeric antigen.
The insect cell pathway of protein glycosylation is different from that of mammalian cells in that proteins synthesized in insect cells undergo glycosylation that results in high mannose content and a lack of terminal sialic acid residues in the secreted protein (Altman, Staudacher, et al 1999).
HBV S1/S2, the antigen component of the chimeric antigen was expressed in both E. coli (no glycosylation) and in High Five insect cells (high mannose glycosylation). These antigens were compared for their binding to DCs. Glycosylated protein showed better binding and uptake by DCs (FIG. 40).
The T cell response was greater with S1/S2-TBD treatment than with either of its two components measured individually. DCs were loaded with S1/S2 antigen, TBD, or S1/S2-TBD and presented to T cells in an APA as described in example 14. T cell stimulation was evaluated by measuring intracellular and secreted IFNγ levels. The results are presented in FIGS. 41 and 42. The chimeric antigen S1/S2-TBD induced the production of higher IFNγ levels compared to either the IRD or the TBD domain of the molecule when tested alone, at equivalent concentrations. It should be pointed out that 5 μg dose of S1/S2-TBD contains roughly 2.5 μg each of the components.
IFNγ production and secretion by CD3+ T cells increased in a concentration dependent manner following S1/S2-TBD antigen presentation by DCs. Purified S1/S2-TBD was used in APAs using human PBMC-derived DCs, and the secreted and intracellular IFNγ levels were measured in T cells following three rounds of antigen presentation. FIG. 43 presents intracellular levels and FIG. 44 shows the secreted levels. The results are the mean of three estimates.
Various concentrations of S1/S2-TBD were tested for the T cell response. The effect of S1/S2-TBD was greater than the tetanus toxoid treatment at similar concentrations. At concentrations lower than 5 μg/mL, the vaccine elicited a concentration dependent increase in the production and secretion of IFNγ. The positive response at low concentrations would be beneficial with respect to the dose necessary for vaccination and the cost of manufacturing of the vaccine.
Glycosylation of HBV S1/S2 elicits increased immunogenicity and T Cell responses. The insect cell pathway of protein glycosylation is different from that of mammalian cells in that proteins synthesized in insect cells undergo glycosylation that results in high mannose content and a lack of terminal sialic acid residues in the secreted protein (Altman, Staudacher, et al 1999).
HBV S1/S2, the antigen component of the chimeric antigen was expressed in both E. coli (no glycosylation) and in High Five insect cells (high mannose glycosylation). These antigens were compared for T cell responses when presented by DCs. Both intracellular and secreted IFNγ levels were measured and the results are presented in FIGS. 45 and 46.
HBV produces the core proteins (Core) to encapsidate the replicating genome of the virus. There are two forms of the core one secreted into circulation, also known as the “e” antigen and the capsid forming core protein. The present invention also relates to the generation of expression plasmids to produce the Core protein as well as the core antigen-TBD fusion protein, in insect cells similar to examples described in example 19. The DNA encoding the HBV Core protein was generated from the plasmid pALTHBV991 template using PCR technique. The 5′ primer used for the PCR was (sense) 5′ TGCGCTACCATGGACATTGACCCCTTATAA AG (SEQ ID NO: 25) which contains the restriction enzyme Nco I site and the 3′ primer used was (antisense) 5′ TGTCATTCTGCGGCCGCGAACATTGAGATTCCCGAGATTGAG (SEQ ID NO: 26), containing the restriction enzyme Not I site. The PCR-amplified cDNA was digested with the respective enzymes and ligated with pFastBacHTa expression vector to generate either the expression plasmid for HBV Core protein or the expression plasmid pFastBacHTa HBV Core-TBD fusion protein. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa HBV core are shown in FIG. 15. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa HBV Core-TBD are shown in FIG. 14.
DHBV has served as a powerful animal model in the development of antiviral therapy for HBV. Pekin ducks, congenitally infected with DHBV have been used to study the mechanism of replication of the virus and for the screening of antiviral compounds. The present invention also describes the chimeric DHBV antigen-TBD molecules which could be used as therapeutic vaccines in DHBV-infected ducks, thus providing a viable animal model for the feasibility studies for a HBV therapeutic vaccines.
DNA encoding DHBV PreS/S was produced by PCR methods from template plasmid pFastBacHTa PreS/S (University of Alberta) using 5′ primer (sense) 5′ TATTCCGGATTATTCATACCG (Seq. ID No 9) and the 3′ primer (antisense) 5′ TGTCATTCAGCGGCCGCGAACTCTTGTAAAAAAGAGCAGA (Seq. ID No 10), containing restriction enzyme Not I site. The unique restriction enzyme site Eco R I, resident on the parent plasmid pFastBacHTa PreS/S was used for directional cloning. All other protocols for the production of either the DHBV PreS/S or the fusion protein PreS/S-TBD are the same as described in example 19. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa DHBV PreS/S are shown in FIG. 21. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa DHBV PreS/S-TBD are shown in FIG. 17.
The cDNA coding for DHBV Core was generated by PCR using the following primers. The 5′ terminus primer used was (sense) 5′ TGCGCTACCATGGATATCAATGCTTCTAGAGCC (Seq. ID No.11), containing the restriction enzyme Nco I site. The 3′ terminus primer used was (antisense) 5′ TGTCATTCTGCGGCCGCGATTTCCTAGGCGAGGGAGATCTATG (Seq. ID No. 12), containing the restriction enzyme Not I site. All other protocols for the production of either the DHBV Core or the fusion protein DHBV Core-TBD are the same as described in the example 4 above. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa DHBV Core are shown in FIG. 24. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa DHBV Core-TBD are shown in FIG. 23.
The DNA encoding the HCV core was generated from the plasmid pCV-H77C template (University of Alberta) using PCR methodology. The primers used were: (sense) 5′ CGGAATTCATGAGCACGAATCCTAAAC (Sequence ID No. 13) containing the unique restriction enzyme site Eco RI and the 3′ primer (antisense) 5′ GGACTAGTCCGGCTGAAGCGGGCACAGTCAGGCAAGAG (Sequence ID No. 14) containing the unique restriction enzyme site Spe I. Amplified DNA was digested with EcoR I/Spe I and ligated with pFastBacHTa expression vector digested with the same two enzymes. The expression plasmid for HCV core protein was generated with this method. The fragment was ligated with the plasmid pFastBacHTa (described in example 19) following the digestion with the respective enzymes. This produced the expression plasmid pFastBacHTa HCV Core. This plasmid was used for the transposition in DH10Bac and the recombinant Bacmids used for Sf9 insect cell transfections. The resulting baculovirus carrying the gene of interest was optimized for MOI and the time for efficient protein expression (described in example 19). The generation of recombinant expression plasimd pFastBacHTa-HCV Core-TBD was achieved through similar protocols. The PCR-amplified DNA was digested with EcoR I/Spe 1 and the purified fragment was ligated with the plasmid pFastBacHTa-TBD (described in example 19) following the digestion with the respective enzymes. This produced the expression plasmid pFastBacHTa HCV Core-TBD. This plasmid was used to produce recombinant baculovirus which expressed the chimeric antigen-TBD fusion protein: 6-His tag-rTEV protease cleavage site-HCV Core-TBD. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa HCV Core (1-191) are shown in FIG. 47. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa HCV Score (1-191)-TBD are shown in FIG. 48. All other protocols are described in example 19.
Recombinant bacmids of standardized multiplicity of infection (MOI) were used to infect High Five insect cells. For suspension cultures, cells were seeded at a density of 3×1 cells/mL and incubated at 27.5° C. with shaking at 138 rpm until the cell density reached 2-3×106 cells/mL. Recombinant baculovirus was added to the cells. For HCV core, infections of High Five cells were performed at an MOI=1 pfu/cell. Cells in suspension were grown to mid-log phase and infected with the recombinant baculovirus at this MOI. These infected cultures were incubated for 48 hours then the cells were harvested. For HCV core-TBD, infections of High Five cells were done at an MOI of 1 pfu/cell and for 72 hours.
Purification of Proteins
The purification of HCV Core and HCV core-TBD was done under denaturing conditions as follows. The cells were lysed in a buffer containing 6 M Guanidinium HCl, 0.1 M Na2HPO4, 0.01 M Tris-HCl pH 8.0, 0.01 M Imidazole, (lysis buffer). The suspension was sonicated on ice with 5 pulses of 1 minute per pulse at a power setting of 60 watts, and was mixed at room temperature for 1 hour. The lysate was centrifuged at 10,000×g for 10 min to remove unbroken cells and cell debris. The supernatant was mixed for 1 hr with Ni-NTA agarose (Qiagen) beads (5 mL/100 mL cell lysate), pre-equilibrated with lysis buffer. The Following the mixing step, the beads were loaded on to a column and was washed with a minimum 20 column volumes of 8M Urea, 0.1 M Na2HPO4, 0.01 M Tris-HCl pH 8.0 0.02M Imidazole (wash buffer), until the OD280 was <0.01. The bound protein was eluted in a buffer containing 8M Urea, 0.1 M Na2HPO4, 0.01 M Tris-HCl pH 8, 0.25 mM imidazole.
HCV Core-TBD was separated from other proteins by gel filtration. The peak elution fractions from Ni-NTA agarose column were loaded on a Sephadex G100 (Pharmacia) gel filtration column and the column was eluted with 8M Urea, 0.1 M Na2HPO4, 0.01 M Tris-HCl pH 8, 0. The fractions containing HCV Core-TBD were pooled and dialyzed against PBS.
HCV core antigen and the fusion protein HCV Core-TBD fusion protein were expressed in Express Five Insect cells, and purified; coomassie blue-stained HCV core was run on a 12% polyacrylamide gel. Core-TBD was purified and a Western blot using 6-His monoclonal antibody.
The DNA coding for HCV core (1-177) was generated by PCR using the following primers. The 5′ terminus primer used was (sense) 5′CGGAATTCATGAGCACGMTCCTAAAC (Sequence ID No. 15), containing the restriction enzyme EcoR I site. The 3′ terminus primer used was (antisense) 5′ GGACTAGTCCGMGATAGAGAMGAGC (SEQUENCE ID NO.16), containing the restriction enzyme Spe I site. Following digestion with the two enzymes, the DNA fragment was ligated with plasmid pFastBacHTa to generate pFastBacHTaHCV (Core 1-177) and with pFastBacHTa-TBD to generate the expression plasmid pFastBacHTaHCV Core (1-177)-TBD. All other protocols for the production of either the HCV core (1-177) antigen or the chimeric antigen fusion protein HCV core (1-177)-TBD are the same as described in example 19. Nucleotide sequence and the deduced amino acid sequence of 6-His-rTEVprotease site-HCV Core (1-177) are shown in FIG. 49. Nucleotide sequence and the deduced amino acid sequence of 6-His-rTEVprotease site-HCV Core (1-177)-TBD are shown in FIG. 50.
The DNA encoding the HCV NS5A fragment was generated from the plasmid pCV-H77C (University of Alberta) template using PCR methodology. The 5′ primer used form the PCR was (sense) 5′CCGGAATTCTCCGGTTCCTGGCTAAGG (Sequence ID No. 17) containing the restriction enzyme EcoR I site. The PCR primer for 3′ terminus was (antisense) 5′GGACTAGTCCGCACACGACATCTTCCGT (Sequence ID No. 18) containing the restriction enzyme Spe I site. Amplified DNA was digested with the respective enzymes and ligated with pFastBacHTa expression vector to generate either the expression plasmid for HCV NS5A or it was ligated with the expression plasmid pFastBacHTa-TBD to generate the expression plasmid pFastBacHTa HCV NS5A-TBD fusion protein.
Nucleotide sequence and the deduced amino acid sequence of 6-His-rTEVprotease site-HCV NS5A are shown in FIG. 51. Nucleotide sequence and the deduced amino acid sequence of 6-His-rTEVprotease site-HCV NS5A-TBD are shown in FIG. 52.
Plasmid pFastBacHTa HCV E1 and pFastBacHTa HCV E1-TBD which are used to express HCV envelope protein E1 and the respective chimeric antigen E1-TBD fusion protein, were generated as follows. The DNA encoding the E1 protein was generated from the plasmid pCV-H77C template using PCR technique. The 5′ primer used for the PCR was (sense) 5′CCGGAATTCTACCAAGTGCGCAATTCCT (Sequence ID No. 19) which contains the restriction enzyme EcoR I site and the 3′ primer used was (antisense) 5′GGACTAGTCCTTCCGCGTCGACGCCGGCAAAT (Sequence ID No.20), containing the restriction enzyme Spe I site. The PCR-amplified cDNA was digested with the respective enzymes and ligated with pFastBacHTa expression vector to generate the expression plasmid pFastBacHTa HCV E1 for the expression of HCV E1 protein. The digested DNA fragment was ligated with pFastBacHTa-TBD to generate the plasmid pFastBacHTa HCV E1-TBD which was used to express HCV E-TBD fusion protein.
FIG. 53 shows the nucleotide and the deduced amino acid sequences of 6-His-rTEVprotease site-HCV E1 in the open reading frame of the expression plasmid. FIG. 54 shows nucleotide and the deduced amino acid sequences of 6-His-rTEVprotease site-HCV E1-TBD chimeric antigen fusion protein.
The DNA encoding HCV E2 antigen was produced by PCR from a plasmid pCV-H77C. The 5′ primer used for the PCR was (sense) 5′ GCGGAATTCACCCACGTCACCGGGGGAMTGC (Sequence ID No. 21) containing a unique restriction enzyme site EcoR I that is used for directional cloning. The 3′ primer used was (antisense) 5′ GGACTAGTCCAGCCGCCTCCGCTTGGGATATGAGT (Sequence ID No. 22) containing the restriction enzyme Spe I site. Following PCR amplification, the fragment was digested with the restriction enzymes EcoR I and Spe I an the DNA fragment was purified and ligated with the expression plasmid pFastBacHTa at the respective sites to produce pFastBacHTa HCV E2, which expressed the E2 antigen. The same fragment was also used to ligate with pFastBacHTa-TBD to generate the expression plasmid pFastBacHTa HCV E2-TBD, which expressed the chimeric antigen fusion protein HCV E2-TBD. The production of baculovirus stocks from these plasmids and the expression of the E2 and E2-TBD in High Five insect cells were done as described in previous examples.
FIG. 55 shows the nucleotide and the deduced amino acid sequences of 6-His-rTEVprotease site-HCV E2 in the open reading frame of the expression plasmid. FIG. 56 shows nucleotide and the deduced amino acid sequences of 6-His-rTEVprotease site-HCV E2-TBD chimeric antigen fusion protein.
DNA encoding HCV E1/E2 was produced by PCR methods from the plasmid pCV-H77C using 5′ primer (sense) 5′ CCGGAATTCTACCMGTGCGCAATTCCT (Sequence ID No. 23) containing the restriction enzyme site EcoR I and the 3′ primer (antisense) 5′ GGACTAGTCCAGCCGCCTCCGCTTGGGATATGAGT (Sequence ID No. 24) containing the restriction enzyme site Spe I. Restriction enzyme-digested DNA fragment was cloned into the respective sites of either pFastBacHTa to generate pFastBacHTaHCV E1/E2 or pFastBacHTa-TBD to generate pFastBacHTa HCV E1/E2-TBD. All other protocols for the production of either the E1/E2 antigen or the fusion protein E1/E2-TBD are the same as described in the example above.
FIG. 57 shows the nucleotide and the deduced amino acid sequences of 6-His-rTEVprotease site-HCV E1/E2 in the open reading frame of the expression plasmid. FIG. 58 shows nucleotide and the deduced amino acid sequences of 6-His-rTEVprotease site-HCV E1/E2-TBD chimeric antigen fusion protein.
Conclusions from Examples 10-39
1. A composition for eliciting a T-cell response in vivo, the composition comprising a purified chimeric fusion protein antigen, the chimeric fusion protein antigen comprising an immune response domain and a target binding domain expressed from an open reading frame encoding the immune response domain and the target binding domain fused together genetically,
wherein the immune response domain comprises one or more HBV surface antigens, or antigenic epitopes thereof, and
wherein the target binding domain consists of an Ig hinge region, at least a portion of a CH1 region and a xenotypic Fc antibody fragment comprising at least part of a CH2 and CH3 domain; and
wherein the chimeric fusion protein antigen comprises non-mammalian glycosylation.
2. The composition of claim 1, wherein the one or more HBV surface antigens are selected from the group consisting of one or more of HBV S polypeptide, HBV S1 polypeptide, and HBV S2 polypeptide.
3. The composition of claim 1, wherein a His tag is linked to the chimeric antigen.
4. The composition of claim 1, wherein the target binding domain is capable of binding to an antigen presenting cell.
5. The composition of claim 4, wherein the antigen presenting cell is a dendritic cell.
6. The composition of claim 1, wherein the antibody fragment is a murine antibody fragment.
7. The composition of claim 1, wherein the immune response domain comprises one or more antigenic sequences.
8. The composition of claim 1, wherein the composition has the ability to induce (a) a TH1 immune response, (b) a TH2 immune response, or (c) a TH1 immune response and a TH2 immune response.
9. The composition of claim 1, wherein the immune response domain is linked to a 6-His tag and a recombinant tobacco etch virus (rTEV) protease cleavage site.
10. The composition of claim 1, wherein the one or more HBV surface antigens comprises HBV S1/S2 protein.
11. The composition of claim 1, wherein the one or more HBV surface antigens are selected from the group consisting of HBV S1/S2/S protein and HBV S2/S protein.
12. The composition of claim 1, wherein the glycosylation comprises mannose glycosylation.
13. The composition of claim 1, further comprising a cell.
14. The composition of claim 13, wherein the cell is an antigen presenting cell.
15. The composition of claim 13, wherein the cell is a cultured cell.
16. The composition of claim 1, wherein the composition comprises a monomer comprising an immune response domain and a target binding domain.
17. The composition of claim 16, wherein the composition comprises a dimer of the monomer.
18. The composition of claim 3, wherein the His tag is a 6 His peptide.
19. The composition of claim 3, wherein the His tag is linked to immune response domain.
20. The composition of claim 3, wherein the His tag is linked to the target binding domain.
21. A composition for eliciting a T-cell response in vivo, the composition comprising a purified chimeric fusion protein antigen, the chimeric fusion protein antigen comprising an immune response domain and a target binding domain expressed from an open reading frame encoding the immune response domain and the target binding domain fused together genetically,
wherein the target binding domain consists of an Ig hinge region, at least a portion of a CH1 region and a xenotypic Fc antibody fragment comprising at least part of a CH2 and CH3 domain;
wherein the Fc antibody fragment is capable of binding to an Ig Fc receptor or an antigen presenting cell; and
wherein the chimeric fusion protein antigen comprises non-mammalian glycosylation.
22. The composition of claim 21, wherein the immune response domain comprises one or more HBV antigens, or antigenic epitopes thereof.
23. The composition of claim 22, wherein the one or more HBV antigens are HBV antigens comprising one or more HBV surface antigens.
24. The composition of claim 23, wherein the one or more HBV surface antigens are selected from the group consisting of one or more of HBV S protein, HBV S1 protein, and HBV S2 protein.
25. The composition of claim 24, wherein the one or more HBV surface antigens comprise HBV S1/S2 protein.
26. The composition of claim 24, wherein the one or more HBV surface antigens are selected from the group consisting of HBV S1/S2/S protein and HBV S2/S protein.
27. The composition of claim 21, wherein a 6-His-peptide is linked to the immune response domain.
28. The composition of claim 21, wherein the target binding domain is capable of binding to an antigen presenting cell.
29. The composition of claim 28, wherein the antigen presenting cell is a dendritic cell.
30. The composition of claim 21, wherein the immune response domain comprises one or more antigenic sequences.
31. The composition of claim 21, wherein the composition has the ability to induce (a) a TH1 immune response, (b) a TH2 immune response, or (c) a TH1 immune response and a TH2 immune response.
32. The composition of claim 21, wherein the glycosylation comprises mannose glycosylation.
33. The composition of claim 21, wherein the immune response domain is linked to a 6-His tag and a recombinant tobacco etch virus (rTEV) protease cleavage site.
34. The composition of claim 21, further comprising a cell.
35. The composition of claim 34, wherein the cell is an antigen presenting cell.
36. The composition of claim 34, wherein the cell is a cultured cell.
37. The composition of claim 23, wherein the one or more HBV antigens comprise human HBV antigens.
38. The composition of claim 21, wherein the composition comprises a monomer comprising an immune response domain and a target binding domain.
39. The composition of claim 38, wherein the composition comprises a dimer of the monomer.
40. The composition of claim 21, wherein a 6-His-peptide is linked to the target binding domain.