Patent application title:

CHIMERIC ANTIGENS FOR ELICITING AN IMMUNE RESPONSE

Publication number:

US20130295610A1

Publication date:
Application number:

13/900,276

Filed date:

2013-05-22

Abstract:

Disclosed herein are compositions and methods for eliciting immune responses against antigens. In particular embodiments, the compounds and methods elicit immune responses against antigens that are otherwise recognized by the host as “self” antigens. The immune response is enhanced by presenting the host immune system with a chimeric antigen comprising an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. By virtue of the target binding domain, antigen presenting cells take up, process, and present the chimeric antigen, eliciting both a humoral and cellular immune response.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12P21/005 »  CPC further

Preparation of peptides or proteins Glycopeptides, glycoproteins

C07K16/46 »  CPC main

Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies Hybrid immunoglobulins

C07K14/005 »  CPC further

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses

C12P21/00 IPC

Preparation of peptides or proteins

Description

RELATED APPLICATIONS

The present invention is a continuation-in-part of co-pending U.S. Ser. No. 10/365,620, filed Feb. 13, 2003, which application claims benefit of U.S. Provisional Application Nos. 60/390,564 filed Jun. 20, 2002 and 60/423,578 filed Nov. 5, 2002. The present application is also a continuation-in-part of co-pending international application PCT/IB04/000373, filed Feb. 14, 2004, which application designates the United States. The entire disclosure of each of these priority applications is hereby incorporated by reference.

I. INTRODUCTION

1. Technical Field

The present invention relates to chimeric antigens (fusion proteins) for targeting and activating antigen presenting cells. In particular, the invention describes compositions and methods that contain or use one or more fusion proteins that contain a pre-selected HBV antigen or HCV antigen, and a xenotypic immunoglobulin fragment, wherein the fusion molecule is capable of binding and activating antigen presenting cells, especially dendritic cells.

2. Background

Viral infectious diseases are major public healthcare issues. Human Hepatitis B virus (HBV) is a member of a family of DNA viruses that primarily infect the liver (Gust, et al., Intervirology 25:14-29 (1986). Other members of this family are woodchuck hepatitis B virus (WHV) (Summers, et al., Proc Natl Acad Sci USA 75(9): 4533-7 (1978)), duck hepatitis B virus (DHBV) (Mason, et al., J Virol 36(3): 829-36 (1980)) and heron hepatitis B virus (HHBV) (Sprengel, et al., J Virol 62(10): 3832-9 (1988)). These viruses share a common morphology and replication mechanisms, but are species specific for infectivity (Marion, Prog Med Virol. 35:43-75 (1988)).

HBV primarily infects liver cells and can cause acute and chronic liver disease resulting in cirrhosis and hepatocellular carcinoma. Infection occurs through blood and other body fluids. Approximately 90% of the individuals infected by HBV are able to clear the infection, while the remaining 10% become chronic carriers of the virus with a high probability of developing cirrhosis of the liver and hepatocellular carcinoma. The World Health Organization statistics show that more than 2 billion people have been infected by HBV and among these, 370 million are chronically infected by the virus (Beasley, Cancer 61(10):1942-56 (1988); Kane Vaccine 12:547-49 (1995)). Prophylactic vaccines based on HBV surface antigen (HBsAg) have been very effective in providing protective immunity against HBV infections. These vaccines have been developed from HBsAg purified from plasma of chronic HBV carriers, produced by recombinant DNA techniques as well as through the use of synthetic peptides (see, e.g. U.S. Pat. Nos. 4,599,230 and 4,599,231). These vaccines are highly effective in the prevention of infection, but are ineffective in eradicating established chronic infections.

Human Hepatitis B Virus (HBV) belongs to the family of Hepadnaviruses. Other members of this family are Duck Hepatitis B Virus (DHBV), Woodchuck Hepatitis Virus (WHV) Ground Squirrel Hepatitis B Virus (GSHV) and Heron Hepatitis B Virus (HHBV). Although these viruses have similar morphology and replication mechanism, they are fairly species specific. Consequently, they infect only very closely related species. These viruses have a DNA genome ranging in size from 3.0-3.2 Kb, with overlapping reading frames to encode several proteins. HBV genome encodes several proteins. Among these, the surface antigens: Large (S1/S2/S), Medium (S2/S) and Small (S) are proposed to be involved in the binding of the virus to the cellular receptors for uptake. The Core protein (Core) forms capsids, which encapsulate the partially double stranded DNA genome. Polymerase/Reverse Transcriptase (Pol) protein is a multifunctional enzyme necessary for the replication of the virus. The X protein has been proposed to have many properties, including the activation of Src kinases (Ganem, Science 294(5550):2299-300 (2001)). The present invention describes DNA sequences and amino acid compositions of the surface antigen proteins S1/S2, S1/S2/S as well as Core protein fusion proteins with a xenotypic monoclonal antibody (mAb) fragment.

DHBV, another member of the hepadnaviral family, infects pekin ducks, is species specific, and has served as an animal model for studying the hepatitis B viruses. DHBV has a DNA genome and it codes for surface antigens PreS and PreS/S, Core protein (Core) and Polymerase/Reverse Transcriptase. The present invention also describes DNA sequences and deduced amino acid sequences of fusion proteins of the PreS, PreS/S and Core proteins with a fragment of a xenotypic mAb. These fusion proteins can be used to elicit a broad immune response in chronic viral infections, thus as therapeutic vaccine.

Hepatitis C virus (HCV) is a member of the flaviviridae family of RNA viruses. The route of infection is via blood and body fluids and over 50% of the patients become chronic carriers of the virus. Persistent infection results in chronic active hepatitis, which may lead to liver cirrhosis and hepatocellular carcinoma (Saito et. al., PNAS USA 87:6547-6549 (1990)).

Approximately 170 million people worldwide are chronic carriers of HCV (Wild and Hall, Mutation Res. 462: 381-393 (2000)). There is no prophylactic vaccine available at present. Current therapy is interferon α-2b and ribavirin, either alone or as combination therapy. The significant side effects for interferon treatment and the development of mutant strains are major drawbacks to the current therapy. Moreover, interferon therapy is effective only in 20% of the patients. Therapeutic vaccines to enhance host immune system to eliminate chronic HCV infection will be a major advancement in the treatment of this disease.

HCV genome is a positive sense single stranded RNA molecule of approximately 9.5 Kb in length. This RNA, which contains both 5′ and 3′ untranslated regions, codes for a single polyprotein that is cleaved into individual proteins and catalyzed by both viral and host proteases (Clarke, J. Gen. Virol. 78: 2397-2410 (1997)). The structural proteins are Core, Envelope E1 & E2 and P7. The non-structural proteins are NS2, NS3, NS4A, NS4B, NS5A and NS5B. Core forms capsids. E1, E2 are envelope proteins, also called “Hypervariable region” due to the high rate of mutations. NS3 is a Serine Protease, the target of several protease inhibitors as antivirals for HCV. NS5B is the RNA Polymerase enzyme. NS5A has recently been suggested to have a direct role in the replication of the virus in the host by counteracting the interferon response (Tan, and Katze, Virology 284:1-12 (2001)) that augments the immune function.

When a healthy host (human or animal) encounters an antigen (such as a protein derived from a bacterium, virus or parasite), normally the host initiates an immune response. This immune response can be a humoral response and/or a cellular response. In the humoral response antibodies are produced by B cells and are secreted into the blood and/or lymph in response to an antigenic stimulus. The antibody then neutralizes the antigen, e.g. a virus, by binding specifically to antigens on its surface, marking it for destruction by phagocytotic cells and/or complement-mediated mechanisms. The cellular response is characterized by the selection and expansion of specific helper and cytotoxic T-lymphocytes capable of directly eliminating the cells that contain the antigen.

In many individuals, the immune system does not respond to certain antigens. When an antigen does not stimulate the production of a specific antibody and/or killer T cells, the immune system is unable to prevent the resultant disease. As a result, the infectious agent, e.g. a virus, can establish a chronic infection and the host immune system becomes tolerant to the antigens produced by the virus. The mechanism by which the virus evades the host immune machinery is not clearly established. The best-known examples of chronic viral infections include Hepatitis B, Hepatitis C, Human Immunodeficiency Virus, Human Papilloma Virus and Herpes Simplex Virus.

In chronic states of viral infections, the virus escapes the host immune system. Viral antigens are recognized as “self,” and thus not recognized by the antigen-presenting cells. The lack of proper presentation of the appropriate viral antigen to the host immune system may be a contributing factor. The success in eliminating the virus will result from the manner in which the antigen is processed and presented by the antigen presenting cells (APCs) and the involvement of the regulatory and cytotoxic T cells. The major participant in this process is the Dendritic Cell (DC), which captures and processes antigens, expresses lymphocyte co-stimulatory molecules, migrates to lymphoid organs, and secretes cytokines to initiate immune responses. Dendritic cells also control the proliferation of B and T lymphocytes, which are the mediators of immunity (Steinman, et al., Hum Immunol 60(7):562-7 (1999)). The generation of a cytotoxic T lymphocyte (CTL) response is critical in the elimination of the virus infected cells and thus a cure of the infection.

Antigen presenting cells process the encountered antigens differently depending on the localization of the antigen (Steinman et al., 1999, supra). Exogenous antigens are processed within the endosomes of the APC and the generated peptide fragments are presented on the surface of the cell complexed with Major Histocompatibility Complex (MHC) Class II. The presentation of this complex to CD4+ T cells stimulates the CD4+ T helper cells. As a result, cytokines secreted by the helper cells stimulate B cells to produce antibodies against the exogenous antigen (humoral response). Immunizations using antigens typically generate antibody response through this endosomal antigen processing pathway.

On the other hand, intracellular antigens are processed in the proteasome and the resulting peptide fragments are presented as complexes with MHC Class I on the surface of APCs. Following binding of this complex to the co-receptor CD8 molecule, antigen presentation to CD8+ T cells occurs which results in a cytotoxic T lymphocyte (CTL) immune response to remove the host cells that carry the antigen.

In patients with chronic viral infections, since the virus is actively replicating, viral antigens will be produced within the host cell. Secreted antigens will be present in the circulation. As an example, in the case of chronic HBV carriers, virions and HBV surface antigens and a surrogate for core antigens (in the form of e-antigen) can be detected in the blood. An effective therapeutic vaccine should be able to induce strong CTL responses against an intracellular antigen or an antigen delivered into the appropriate cellular compartment so as to activate the MHC Class I processing pathway. An effective prophylactic vaccine will induce a strong humoral immune response, thus producing antibodies to neutralize circulating virions.

These findings would suggest that a therapeutic vaccine that can induce a strong CTL response should be processed through the proteasomal pathway and presented via the MHC Class I (Larsson, et al., Trends Immunol 22(3):141-8 (2001)). This can be achieved either by producing the antigen within the host cell, or it can be delivered to the appropriate cellular compartment so that it gets processed and presented so as to elicit a cellular response. Several approaches have been documented in the literature for the intracellular delivery of the antigen. Among these, viral vectors (Lorenz, et al., Hum Gene Ther 10(7):1095-103 (1999)), the use of cDNA-transfected cells (Donnelly, et al., Annu Rev Immunol 15: 617-48 (1997)) as well as the expression of the antigen through injected cDNA vectors (Lai and Bennett, Crit Rev Immunol 18(5): 449-84 (1998); U.S. Pat. No. 5,589,466), have been documented. Further, DNA vaccines expressing antigens targeted to dendritic cells have been described (You, et al., Cancer Res 61:3704-3711 (2001)).

Delivery vehicles capable of carrying the antigens to the cytosolic compartment of the cell for MHC Class I pathway processing have also been used. The use of adjuvants to achieve the same goal has been described in detail by (Hilgers, et al., Vaccine 17(3):219-28 (1999)) Another approach is the use of biodegradable microspheres in the cytoplasmic delivery of antigens (Newman, et al., J Biomed Mater Res 50(4):591-7 (2000)), exemplified by the generation of a Th1 immune response against ovalbumin peptide (Newman, et al., J Control Release 54(1):49-59 (1998); Newman, et al., J Biomed Mater Res 50(4): 591-7 (2000)). It has also been shown that PLGA nanospheres are taken up by the most potent antigen presenting cells, dendritic cells (Newman, et al., J Biomed Mater Res 60(3): 480-6 (2002)).

Dendritic cells derived from blood monocytes, by virtue of their capability as professional antigen presenting cells have been shown to have great potential as immune modulators that stimulate primary T cell response (Steinman, et al., Hum Immunol 60(7): 562-7 (1999); Banchereau and Steinman, Nature 392(6673):245-52 (1998)). This property of the DCs to capture, process, present the antigen and stimulate naive T cells has made them very important tools for therapeutic vaccine development (Laupeze, et al., Hum Immunol 60(7): 591-7 (1999)). Targeting of the antigen to the DCs is the crucial step in the antigen presentation and the presence of receptors on the DCs for the Fc region of monoclonal antibodies have been exploited for this purpose (Regnault, et al., J Exp Med 189(2): 371-80 (1999)). Examples of this approach include ovarian cancer mAb-B43.13, Anti-PSA antibody as well as Anti-HBV antibody antigen complexes (Wen, et al., Int Rev Immunol 18(3): 251-8 (1999)). Cancer immunotherapy using DCs loaded with tumor associated antigens have been shown to produce tumor-specific immune responses and anti-tumor activity (Campton, et al., J Invest Dermatol 115(1):57-61 (2000); Fong and Engleman, Annu Rev Immunol 18: 245-73 (2000)). Promising results were obtained in clinical trials in vivo using tumor-antigen-pulsed DCs (Tarte and Klein, Leukemia 13(5): 653-63 (1999)). These studies clearly demonstrate the efficacy of using DCs to generate immune responses against cancer antigens.

The primary goal in antiviral therapy is the complete elimination of the infectious virus. In the case of chronic hepatitis B, this will result in the eradication of hepatitis B viremia, the arrest of progressive liver injury, normalization of liver transaminase activity, resolution of hepatic inflammation, elimination of HBV cccDNA (covalently closed circular DNA) reservoir, and improve the quality of life of the patient.

Two forms of antiviral therapies are currently in use for the treatment of chronic hepatitis B infections. First, antiviral compounds, particularly nucleoside analogues, which are DNA chain terminators, suppress the viral replication resulting in a decrease in HBV DNA and HBV antigens. The effectiveness of the antiviral compound depends on the level of immune help from the host. The second therapy involves the use of immune modulators, such as interferons (e.g., interferon α-2b), to stimulate the immune system into mounting a generalized humoral and cellular response against the viral infection.

The most widely used antiviral nucleoside agent is lamivudine, a cytosine analogue that acts as a chain terminator and inhibits HBV replication. The drug is well tolerated and has marked virus-suppressive activity in the majority of patients; complete clearance of the virus occurs if the patient has elevated levels of liver inflammatory enzymes. This suggests that a strong involvement of the host immune system is needed to clear the HBV infection. While lamivudine suppresses HBV replication in HBV carriers, replication recurs if therapy is stopped. The emergence of resistant mutants also is a possibility.

Interferons are biologic response modifiers that have a variety of therapeutic activities, including antiviral, immunomodulatory, and antiproliferative effects. They enhance T cell helper activity, cause maturation of B lymphocytes, inhibit T cell suppressors, and enhance HLA type I expression. While interferons have only mild to moderate virus-suppressive activities, they induce a generalized, non-specific but clinically important immune response in receptive individuals.

The indications for interferon therapy are specific: patients must be HbeAg-positive, have detectable HBV DNA in the serum, and have a serum ALT level double the upper limit of normal. When these patients are treated with a standard course of interferon-α therapy (30-35 MU interferon/week for 16-26 weeks), the response rate is 40-50%. A response is defined as loss of HBeAg, development of anti-HBe, loss of HBV DNA (by non-PCR assays), and normalization of ALT. A sustained response encompasses the foregoing outcomes plus generating effective immune responses. The responses are usually durable, are associated with improvement in liver histology, and produce a better long-term outcome, e.g., with fewer patients progressing to cirrhosis and/or hepatocellular carcinoma.

For most chronic hepatitis B patients, monotherapy with a standard 16 week course of interferon-α or a one year course of lamivudine is effective in only 30-40% of patients. It is reasonable to assume that combining the antiviral effect of one drug with a second agent promoting immune modulation may improve the response rate beyond that seen with either agent alone. However, in order to produce more effective and specific immune responses against chronic hepatitis B infections than are currently achievable with current biological response modifiers, an agent that induces highly specific cellular immune responses directed against cells harboring the viruses, viral antigens or cccDNA must be employed. The chimeric antigens described in the present invention are such agents.

The goals of treatment of chronic hepatitis C include eradication of the HCV infection, improvement or normalization of liver histology, prevention of progression of the viral liver infection to cirrhosis and hepatocellular carcinoma, extension of patient survival, improvement of the quality of life, and a reduction in the size of the infectious pool of hepatitis C virus patients in order to reduce the wide spread transmission of the disease.

Two forms of treatment of chronic hepatitis C are currently in use: pegylated interferon-α used alone and conventional or pegylated interferon-α used in combination with ribavirin. Ribavirin is a purine nucleoside analogue that as monotherapy has little effect on HCV viremia, despite the fact that it significantly reduces serum ALT levels in some patients. While the exact nature of the synergism of ribavirin and interferon has not been elucidated, the efficacy of the combination exceeds that of either agent used alone.

While the mechanism of action of ribavirin in hepatitis C infection is not understood, a number of mechanisms have been proposed including: (a) the enhancement of host T cell-mediated immunity against viral infection through switching the T cell phenotype from type 2 to type 1; (b) the inhibition of the host enzyme inosine monophosphate dehydrogenase (IMPDH); (c) the direct inhibition of HCV, including NS5B-encoded RNA-dependent RNA polymerase (RdRp); and (d) its action as an RNA mutagen that drives a rapidly mutating RNA virus over the threshold to “error catastrophe.”

Interferons are biologic response modifiers that have a variety of therapeutic activities including antiviral, immunomodulatory, and antiproliferative effects. They enhance T cell helper activity, cause maturation of B lymphocytes, inhibit T cell suppressors, and enhance HLA type I expression. While interferons have only mild to moderate virus-suppressive activities, they induce a generalized, non-specific but clinically important immune response in receptive individuals that reduces viral levels.

The treatment options for previously untreated patients with hepatitis C include pegylated interferon monotherapy and a combination of conventional or pegylated interferon with ribavirin. The overall sustained response rate (SR) of ribavirin combined with conventional interferon α-2b therapy for 48 weeks is about 40%. The SR for patients infected with genotype 2 or 3 patients is about 60%, whereas the SR is about 30% for patients infected with genotype 1 (Lauer and Walker, NEJ Med 345:41-42 (2001)). However, the combination is associated with significantly more side effects than conventional interferon alone. Up 20% of patients receiving the combination required a reduction of dose or discontinuation of therapy because of the side effects. Nevertheless, the combination represents a significant improvement in the treatment of chronic hepatitis C and has become the current standard of care.

Conventional interferon-α is rapidly cleared from the circulation by the kidneys. During the first 12 hours after interferon administration, interferon-α causes the viral levels to decrease significantly, but after that time, the viral levels begin to increase because of low blood levels of interferon. Sustained viral suppression can be achieved by the administration of pegylated interferon, which is administered only once a week and produces constant blood levels of interferon for 7 days. Thus, there is no need for the daily dosing that is required with conventional interferon. Per the Peg-Intron® product insert, the overall SR in previously untreated chronic hepatitis C patients who received pegylated interferon for 48 weeks was about 39%, which is comparable to the previously reported SR with combined conventional interferon α-2b and ribavirin combination (Rebetron®).

In studies comparing combined pegylated interferon and ribavirin to the Rebetron® combination, the pegylated interferon and ribavirin combinations appeared to be more effective, especially in patients infected with HCV genotype 1. For patients infected with this genotype, the sustained response rate (SR) was about 45% for the pegylated interferon and ribavirin combination compared with about 35% for the Rebetron® combination. As expected, the overall response rates in HCV genotype 2 or 3 patients for each of these treatment groups were better than those obtained with HCV genotype 1 patients (SR 60% to 80%).

In a trial comparing Rebetron® with varying doses of PEG-Intron® (pegylated interferon α-2a) and ribavirin, the patients were predominately male Caucasians, more frequently infected with HCV genotype 1, and had a mean age of 44 years (Mann, et al., Lancet 358:958-965 (2001)). The best-sustained virologic response of 54% was obtained with PEG-Intron® plus ribavirin given for 48 weeks. Patients with HCV genotype 1 had an SR of about 40%, while patients with HCV genotypes 2 and 3 after 48 weeks of therapy had the best sustained virologic response rate of approximately 80%, regardless of whether they received Rebetron® or PEG-Intron® and ribavirin. Adverse events in the PEG-Intron® plus ribavirin group that were more than 10% more frequent than in the standard interferon and ribavirin group included fever, nausea, and injection site reaction. Twelve percent of patients on PEG-Intron® plus ribavirin required dose modifications due to an adverse event, while 34% had dose modifications due to a lab abnormality.

In another large, multinational, multicenter trial of plus ribavirin, the three arms of the study were Pegasys® plus placebo, standard interferon α-2b plus ribavirin (Rebetron®), and Pegasys® plus ribavirin, which were all given for 48 weeks (Fried et al., N Engl J. Med. 347(13):975-982 (2002)). There were 1,149 predominantly male patients in the trial with an average age of about 40; 12% to 15% of patients had cirrhosis and approximately two-thirds had infection with HCV genotype 1. The overall sustained virologic response with Pegasys® plus ribavirin was 56% compared to 30% in the Pegasys® plus placebo group, and 45% in the standard interferon α-2b plus ribavirin (Rebetron®) group. Patients with HCV genotype I had a 46% SR with Pegasys® plus ribavirin, while patients with genotypes 2 and 3 had a 76% SR. Fever, myalgia, rigors, and depression were relatively less frequent with Pegasys® plus ribavirin compared to standard interferon α-2b plus ribavirin (Rebetron®). In the Pegasys® plus ribavirin group, the rate of discontinuation of therapy due to an adverse event was 7% and due to a lab abnormality was 3%.

Despite vigorous treatment with the current standard combination therapy of interferon-α and ribavirin, there are still a large proportion of patients with chronic HCV who do not respond. In order to produce an improved sustained response rate in the treatment of chronic hepatitis C infection, an agent that induces highly specific cellular immune responses directed against cells harboring the hepatitis C viruses must be employed. Such an agent is the chimeric antigen hepatitis C vaccine.

There is no prophylactic vaccine available to prevent new HCV infections. The attempts to develop preventative vaccines using the envelope proteins of HCV have been unsuccessful due to the high rate of mutation of the virus. Similarly, no therapeutic vaccine is available for the treatment of existing and/or chronic HCV infections. Chimeric antigens described in the present invention incorporating immunological attributes of HBV antigen and xenotypic monoclonal antibody have been shown to elicit both a strong humoral and strong cellular immune response against viral antigen in animal models. Chimeric antigens described in the present invention incorporating HCV antigens and xenotypic monoclonal antibody fragment could be used for prophylaxis and/or treatment.

II. SUMMARY OF THE INVENTION

The present invention pertains to compositions and methods for targeting and activating antigen presenting cells, one of the first steps in eliciting an immune response. The compositions of the present invention include a novel class of bifunctional molecules (hereinafter designated as “chimeric antigens”) that include an immune response domain (IRD), for example a recombinant protein, linked to a target binding domain (TBD), for example, a xenotypic antibody fragment portion. More specifically, the chimeric antigens are molecules that couple viral antigens, such as Hepatitis B Core or surface proteins, to a xenotypic Fc fragment, such as a murine immunoglobulin G fragment.

The compositions and methods of the present invention are useful for targeting and activating antigen presenting cells. The present invention may be useful for inducing cellular and humoral host immune responses against any viral antigen associated with a chronic viral infection, including but not limited to Hepatitis B, Hepatitis C, Human Immunodeficiency Virus, Human Papilloma Virus (HPV), and Herpes Simplex Virus. The invention may also be applicable to prophylactic vaccines, especially for viral disease, and to all autologous antigens in diseases such as cancer and autoimmune disorders.

The present invention relates to chronic infectious diseases, and in particular to chronic HBV infections. The presentation of HBV antigens to elicit a cellular or humoral immune response by the use of vaccine molecules designed to target the vaccines to DCs whereby the HBV-associated antigens treated as “self” during the chronic infection will be recognized as “foreign” and the host's immune system will mount a CTL response to eliminate HBV-infected cells is provided. At the same time, the antibody response to the circulating HBV antigen will bind to the antigen and remove it from the circulation. Accordingly, the present invention is designed to produce vaccines that can induce a broad immune response in patients who have chronic viral infections such as HBV.

One or more embodiments of the present invention include one or more chimeric antigens suitable for initiating an immune response against Hepatitis B virus (HBV). In these embodiments of the invention, selected HBV antigens are linked to fragments of xenotypic antibodies. The resulting chimeric antigens are capable of targeting and activating antigen presenting cells, such as dendritic cells.

One or more embodiments of the present invention include one or more chimeric antigens suitable for initiating an immune response against Hepatitis C virus (HCV). In these embodiments of the invention, selected HCV antigens are linked to fragments of xenotypic antibodies. The resulting chimeric antigens are capable of targeting and activating antigen presenting cells, such as dendritic cells.

The present invention also includes methods for cloning and producing fusion proteins in a heterologous expression system. In preferred embodiments of the invention, the cloning and production methods introduce unique post-translational modifications including, but not limited to glycosylation on the expressed fusion proteins.

In order to provide efficient presentation of the antigens, the inventors have developed a novel murine monoclonal antibody Fc fragment-antigen (viral antigenic protein/peptide) fusion protein. This molecule, by virtue of the Fc fragment is recognized at a higher efficiency by the antigen-presenting cells (dendritic cells) as xenotypic, and the viral antigen is processed and presented as complexes with Major Histocompatibility Complex (MHC) Class I. This processing and antigen presentation is expected to result in the up-regulation of the response by cytotoxic T-lymphocytes, resulting in the elimination of virus-infected cell population. In addition, due to antigen presentation by MHC Class II molecules, humoral response also aids in the antibody response to the viral infection.

The bifunctional nature of the molecule helps to target the antigen to the proper antigen-presenting cells (dendritic cells), making it a unique approach in the therapy of chronic infectious diseases by specifically targeting the antigen presenting cells with the most effective stoichiometry of antigen to antibody. This is useful to the development of therapeutic vaccines to cure chronic viral infections such as Hepatitis B, Hepatitis C, Human Immunodeficiency Virus, Human Papilloma Virus and Herpes Simplex Virus, and may also be applicable to all autologous antigens in diseases such as cancer and autoimmune disorders.

The administration of these fusion proteins can elicit a broad immune response from the host, including both cellular and humoral responses. Thus, they can be used as therapeutic vaccines to treat subjects that are immune tolerant to a particular infection.

One aspect of the invention provides chimeric antigens for eliciting an immune response, said chimeric antigen comprising an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. The immune response can be a humoral and/or cellular response, elicited in vivo or ex vivo. In the case where a cellular response is elicited, the immune response can be a Th1 response, a Th2 response and/or a CTL response. The chimeric antigen can comprise more than one immune response domain, or an immune response domain that can confer immunity to more than one antigen. In certain embodiments, the chimeric antigen of the invention further comprises a 6×His-peptide, a protease cleavage site, and/or a linker for linking the immune response domain and the target binding domain. In preferred embodiments, the immune response domain comprises one or more immunogenic portions of a protein selected from the group consisting of a hepatitis B virus (HBV) protein, a duck hepatitis B virus (DHBV) protein, a hepatitis C virus (HCV) protein or a protein from Human Papilloma Virus (HPV), Human Immunodeficiency Virus (HIV), Herpes Simplex Virus (HSV) or a cancer antigen. In other preferred embodiments, the xenotypic antibody fragment comprises an Fc fragment, an antibody hinge region, a portion of or an entire CH1 domain, a portion of or an entire CH2 domain and/or a portion of or an entire CH3 domain. In a particularly preferred embodiment, the xenotypic antibody fragment is a mouse antibody fragment. The target binding domain, optionally, can also comprise a 6×His tag, a protease cleavage site (preferably a rTEV protease cleavage site) and/or a linker for linking the immune response domain and the target binding domain. The linker may be leucine zippers, biotin/avidin or a covalent peptide linkage, such as SRPQGGGS (SEQ ID NO: 28). In a preferred embodiment, the chimeric antigen is glycosylated. The immune response domain and/or the target binding domain can be glycosylated. In a particularly preferred embodiment, the chimeric antigen is mannose glycosylated by either high mannose glycosylation or by pauci mannose glycosylation.

Another aspect of the invention provides chimeric antigens for eliciting an immune response to HBV, said chimeric antigen comprising an immune response domain and a target binding domain, wherein the immune response domain comprises a protein selected from the group consisting of a HBV Core protein, a HBV S protein, a HBV S1 protein, a HBV S2 protein, and combinations thereof, and wherein the target binding domain comprises a xenotypic antibody fragment. The immune response can be a humoral and/or cellular response, elicited in vivo or ex vivo. When a cellular response is elicited, the immune response can be a Th1 response and or a Th2 response.

Yet another aspect of the invention relates to chimeric antigens for eliciting an immune response to DHBV, said chimeric antigens comprising an immune response domain and a target binding domain, wherein the immune response domain comprises a protein selected from the group consisting of a DHBV Core protein, a DHBV Pre-S protein, a DHBV PreS/S protein, and combinations thereof, and wherein the target binding domain comprises a xenotypic antibody fragment. The immune response can be a humoral and/or cellular response, elicited in vivo or ex vivo. When a cellular response is elicited, the immune response can be a Th1 response and or a Th2 response.

An aspect of the invention provides chimeric antigens for eliciting an immune response to HCV, said chimeric antigens comprising an immune response domain and a target binding domain, wherein the immune response domain comprises a protein selected from the group consisting of a HCV Core (1-191) protein, a HCV Core (1-177) protein, a HCV E1 protein, a HCV E2 protein, a HCV E1-E2 protein, a HCV NS3 protein, a HCV NS5A protein, and combinations thereof, and wherein the target binding domain comprises a xenotypic antibody fragment. The immune response can be a humoral and/or cellular response, elicited in vivo or ex vivo. When a cellular response is elicited, the immune response can be a Th1 response and or a Th2 response.

Another aspect of the invention provides methods of enhancing antigen presentation in antigen presenting cells, said method comprising administering, to the antigen presenting cells, a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. In a preferred embodiment, the antigen presenting cells are dendritic cells.

An aspect of the invention relates to methods of activating antigen presenting cells comprising contacting an antigen presenting cell with a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. The antigen presenting cell can be contacted with the chimeric antigen in vivo or ex vivo. In another preferred embodiment, the contacting takes place in a human.

Yet another aspect of the invention provides methods of eliciting an immune response, said method comprising administering to a subject a composition comprising a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. The immune response can be a humoral and/or cellular response, elicited in vivo or ex vivo. When a cellular response is elicited, the immune response can be a Th1 response and/or a Th2 response. In a preferred embodiment, the cellular immune response is a Th1 response, a Th2 response or both a Th1 and a Th2 response.

Another aspect of the invention provides methods of treating immune-treatable conditions comprising administering, to a subject in need thereof, a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. Preferably, the immune-treatable condition is an infection or a cancer. More preferably, the immune-treatable condition is a viral infection, even more preferably, a chronic viral infection. Most preferably, the immune-treatable condition is a chronic hepatitis B viral infection or a chronic hepatitis C viral infection. For the treatment of HBV, preferably the immune response domain comprises an antigenic portion of a protein selected from the group consisting of a HBV Core protein, a HBV S protein, a HBV S1 protein, a HBV S2 protein, and combinations thereof. For the treatment of HCV, preferably the immune response domain comprises an antigenic portion of a protein selected from the group consisting of a HCV Core (1-191) protein, a HCV Core (1-177) protein, a HCV E1 protein, a HCV E2 protein, a HCV E1-E2 protein, a HCV NS3 protein, a HCV NS5A protein, and combinations thereof.

Another aspect of the invention provides methods of vaccinating a subject against an infection comprising administering to the subject a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. Preferably, the infection is a viral infection. The method of the invention can prophylactically vaccinate the animal against the infection or therapeutically vaccinate a subject having a preexisting infection.

Yet another aspect of the invention provides polynucleotides encoding a chimeric antigen, said polynucleotide comprising a first polynucleotide portion encoding an immune response domain and a second polynucleotide portion encoding a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. In one embodiment, the polynucleotide comprises a nucleotide sequence selected from the group consisting of nucleotides 1 to 1326 of SEQ ID NO: 31, nucleotides 1 to 2004 of SEQ ID NO: 35, nucleotides 1 to 1350 of SEQ ID NO: 39, nucleotides 1 to 1293 of SEQ ID NO: 43, nucleotides 1 to 1794 of SEQ ID NO: 47, nucleotides 1 to 1581 of SEQ ID NO: 51, nucleotides 1 to 1389 of SEQ ID NO: 57, nucleotides 1 to 1347 of SEQ ID NO: 61, nucleotides 1 to 2157 of SEQ ID NO: 65, nucleotides 1 to 1395 of SEQ ID NO: 69, nucleotides 1 to 1905 of SEQ ID NO: 73 and nucleotides 1 to 2484 of SEQ ID NO: 77. Yet another embodiment provides polynucleotides that encodes a chimeric antigen that is at least 90% identical to an amino acid sequence selected from the group consisting of amino acids 1 to 442 of SEQ ID NO: 32, amino acids 1 to 668 of SEQ ID NO: 36, amino acids 1 to 450 of SEQ ID NO: 40, amino acids 1 to 431 of SEQ ID NO: 44, amino acids 1 to 598 of SEQ ID NO: 48, amino acids 1 to 527 of SEQ ID NO: 52, amino acids 1 to 463 of SEQ ID NO: 58, amino acids 1 to 449 of SEQ ID NO: 62, amino acids 1 to 719 of SEQ ID NO: 66, amino acids 1 to 465 of SEQ ID NO: 70, amino acids 1 to 635 of SEQ ID NO: 74 and amino acids 1 to 828 of SEQ ID NO: 78. One preferred embodiment includes polynucleotides that selectively hybridize under stringent conditions to a polynucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 31, 35, 39, 43, 47, 51, 57, 61, 65, 69, 73 and 77.

The invention also provides microorganisms and cell lines comprising a polynucleotide of the invention. Preferably, the microorganism or cell line is a eukaryotic microorganism or cell line. More preferably the microorganism or cell line is a non-mammalian eukaryotic microorganism or cell line. In a preferred embodiment the microorganism or cell line is a yeast, a plant cell line or an insect cell line. In a particularly preferred embodiment, the cell line is an insect cell line selected from the group consisting of Sf9, Sf21, Drosophila S2 and High Five™.

One aspect of the invention provides methods for producing a chimeric antigen comprising (a) providing a microorganism or cell line that comprises a polynucleotide encoding a chimeric antigen; and (b) culturing said microorganism or cell line under conditions whereby the chimeric antigen is expressed. Preferably, the microorganism or cell line is eukaryotic, more preferably a non-mammalian eukaryotic, microorganism or cell line. In a preferred embodiment, the microorganism or cell line is a yeast, a plant cell line or an insect cell line. In a particularly preferred embodiment, the cell line is an insect cell line selected from the group consisting of Sf9, Sf21, Drosophila S2 and High Five™. In another particularly preferred embodiment, the yeast is selected from the group consisting of Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, and Pichia august.

Another aspect of the invention relates to articles of manufacture comprising a chimeric antigen of the invention and instructions for administering the chimeric antigen to a subject, in need thereof.

Yet another aspect of the invention relates to a pharmaceutical composition comprising a pharmaceutically acceptable excipient and a chimeric antigen that comprises an immune response domain and a target binding domain comprising a xenotypic antibody fragment. Preferably the pharmaceutical composition is formulated for parenteral, transdermal, intradermal, nasal, pulmonary or oral administration.

III. DESCRIPTION OF DRAWINGS

FIG. 1a provides a schematic diagram illustrating the structure of the chimeric antigen of the present invention as a monomer, wherein the chimeric antigen has two portions, namely an antigen and a xenotypic murine Fc fragment. In a preferred embodiment, a hinge region is present. FIG. 1b provides a schematic diagram illustrating the structure of the chimeric antigen of FIG. 1 in its normal, assembled state as a dimer. FIG. 1b illustrates a particularly preferred embodiment, in which the chimeric antigen comprises a 6×His tag and peptide linker in addition to the IRD and TBD.

FIG. 2a provides a schematic diagram illustrating the structure of an exemplary modified chimeric antigen as a monomer, wherein the chimeric antigen has two portions, namely a modified viral antigen portion which incorporates any viral antigen or antigens, antigenic protein fragments or peptides, or any of these with glycosylation at specific sites, and a xenotypic binding agent, namely a murine Fc fragment with the hinge region present. FIG. 2b is a schematic diagram illustrating the structure of the modified chimeric antigen of FIG. 2a in its normal, assembled state as a dimer. The abbreviations “Ag1,” “Ag2,” and “Ag3” represent different viral antigenic peptides or proteins.

FIG. 3a provides a schematic diagram illustrating the structure of a modified biotinylated immune response domain comprising an antigen and a fusion protein of a streptavidin and a target binding domain comprising a Fc fragment with the hinge region present. FIG. 3b provides a schematic diagram illustrating the structure of the modified chimeric antigen of FIG. 3 in its normal, assembled state as a dimer.

FIG. 4 is a schematic diagram illustrating a recombinant bacmid, capable of expressing a chimeric antigen.

FIG. 5 is a schematic embodiment of TBD of the present invention.

FIG. 6a provides the nucleotide sequences of the open reading frame encoding the TBD of FIG. 5 (SEQ ID NO: 29). FIG. 6b provides the amino acid sequence of the TBD of FIG. 5 (SEQ ID NO: 30).

FIG. 7 provides a schematic embodiment of an exemplary chimeric antigen of the present invention, suitable for use with an insect cell expression system.

FIG. 8a provides the nucleotide and deduced amino acid sequences of the chimeric antigen molecule of FIG. 7 (SEQ ID NO: 31). FIG. 8b provides the amino acid sequence of the chimeric antigen of FIG. 7 (SEQ ID NO: 32).

FIG. 9 shows the nucleotide (FIG. 9a; SEQ ID NO: 33) and deduced amino acid (FIG. 9b; SEQ ID NO: 34) sequences of HBV S1/S2 protein, expressed as described in Example 2.

FIG. 10 provides a schematic embodiment of an exemplary chimeric antigen of the present invention, illustrating an exemplary IRD of the present invention.

FIG. 11 shows the nucleotide (FIG. 11a; SEQ ID NO: 35) and deduced amino acid (FIG. 11b; SEQ ID NO: 36) sequences of the chimeric antigen molecule of FIG. 10.

FIG. 12 shows the nucleotide (FIG. 12a; SEQ ID NO: 37) and deduced amino acid (FIG. 12b; SEQ ID NO: 38) sequences of the HBV S1/S2/S protein, expressed as described in Example 3.

FIG. 13 is a schematic embodiment of an exemplary chimeric antigen of the present invention, illustrating an exemplary IRD of the present invention.

FIG. 14 shows the nucleotide (FIG. 14a; SEQ ID NO: 39) and deduced amino acid (FIG. 14b; SEQ ID NO: 40) sequences of the chimeric antigen molecule of FIG. 13.

FIG. 15 shows the nucleotide (FIG. 15a; SEQ ID NO: 41) and deduced amino acid (FIG. 15b; SEQ ID NO: 42) sequences of the HBV Core protein, expressed as described in Example 4.

FIG. 16 is a schematic embodiment of an exemplary chimeric antigen of the present invention, illustrating an exemplary IRD of the present invention.

FIG. 17 shows the nucleotide (FIG. 17a; SEQ ID NO: 43) and deduced amino acid (FIG. 17b; SEQ ID NO: 44) sequences of the chimeric antigen molecule of FIG. 16.

FIG. 18 shows the nucleotide (FIG. 18a; SEQ ID NO: 45) and deduced amino acid (FIG. 18b; SEQ ID NO: 46) sequences of the DHBV PreS protein, expressed as described in Example 5.

FIG. 19 is a schematic embodiment of an exemplary chimeric antigen of the present invention, illustrating an exemplary IRD of the present invention.

FIG. 20 shows the nucleotide (FIG. 20a; SEQ ID NO: 47) and deduced amino acid (FIG. 20b; SEQ ID NO: 48) sequences of the chimeric antigen molecule of FIG. 19.

FIG. 21 shows the nucleotide (FIG. 21a; SEQ ID NO: 49) and deduced amino acid (FIG. 21b; SEQ ID NO: 50) sequences of the DHBV PreS/S protein, expressed as described in Example 6.

FIG. 22 is a schematic embodiment of an exemplary chimeric antigen of the present invention, illustrating an exemplary IRD of the present invention.

FIG. 23 shows the nucleotide (FIG. 23a; SEQ ID NO: 51) and deduced amino acid (FIG. 23b; SEQ ID NO: 52) sequences of the chimeric antigen molecule of FIG. 22.

FIG. 24 shows the nucleotide (FIG. 24a; SEQ ID NO: 53) and deduced amino acid (FIG. 24b; SEQ ID NO: 54) sequences of the DHBV Core protein, expressed as described in Example 7.

FIG. 25 shows that a chimeric antigen embodiment of the invention can be taken up by dendritic cells.

FIG. 26 shows that dendritic cells maturation is higher in the presence of a chimeric antigen of the present invention (S1/S2-TBD), as compared to the target binding domain (TBD) alone, or the immune response domain (S1/S2) alone.

FIG. 27 shows the expression of MHC Class II by dendritic cells in response to the chimeric antigen (S1/S2-TBD), the target binding domain alone (TBD) or the immune response domain alone (S1/S2).

FIG. 28 shows that a cellular response is generated after contact with dendritic cells activated with a chimeric antigen of the present invention.

FIG. 29 shows T cell stimulation by a chimeric antigen of the present invention over a period of 2-4 days.

FIG. 30 shows a time course of expression of antigen binding receptors on maturing dendritic cells.

FIG. 31 shows a time course of expression of various dendritic cells activation markers.

FIG. 32 shows the comparison of binding of HBV S1/S2-TBD, IgG1, and IgG2 to dendritic cells over time.

FIG. 33 shows a comparison of HBV S1/S2-TBD, IgG1, and IgG2a binding to maturing dendritic cells on day 1.

FIG. 34 shows the comparison of HBV S1/S2-TBD, IgG1, and IgG2a binding to maturing dendritic cells on day 4.

FIG. 35 shows the comparison of uptake between HBV S1/S2-TBD, IgG1, and IgG2 as a function of concentration.

FIG. 36 shows the correlation of HBV S1/S2-TBD binding to CD32 and CD206 expression on dendritic cells.

FIG. 37 demonstrates that the binding of HBV S1/S2-TBD to CD32 and CD206 receptors on dendritic cells is abolished by Fcγ fragment.

FIG. 38 shows that glycosylation of S 1/S2 antigen increases the uptake by dendritic cells via the CD206 receptor.

FIG. 39 shows an increase in intracellular interferon-γ positive T cells after antigen presentation.

FIG. 40 shows an increase in secretion of interferon-γ after antigen presentation.

FIG. 41 shows an increase in intracellular interferon-γ positive T cells as a function of S1/S2-TBD concentration

FIG. 42 shows interferon-γ secretion by T cells as a function of S 1/S2-TBD concentration.

FIG. 43 shows the effect of glycosylation on intracellular interferon-γ production in T cells.

FIG. 44 shows the effect of glycosylation on interferon-γ secretion by T cells.

FIG. 45 shows the nucleotide (FIG. 45a; SEQ ID NO: 55) and amino acid (FIG. 45b; SEQ ID NO: 56) sequences of the ORF of HCV Core (1-191) in the plasmid pFastBac HTa-HCV.

FIG. 46 shows the nucleotide (FIG. 46a; SEQ ID NO: 57) and amino acid (FIG. 46b; SEQ ID NO: 58) sequences of the ORF of HCV Core-TBD in the plasmid pFastBac HTa-HCV-TBD.

FIG. 47 shows the nucleotide (FIG. 47a; SEQ ID NO: 59) and amino acid (FIG. 47b; SEQ ID NO: 60) sequences of the ORF of HCV Core (1-177) in the plasmid pFastBac HTa-HCV-Core (1-177).

FIG. 48 shows the nucleotide (FIG. 48a; SEQ ID NO: 61) and amino acid (FIG. 48b; SEQ ID NO: 62) sequences of the ORF of HCV Core-TBD protein in the plasmid pFastBac HTa-HCV-Core-TBD.

FIG. 49 shows the nucleotide (FIG. 49a; SEQ ID NO: 63) and amino acid (FIG. 49b; SEQ ID NO: 64) sequences of the ORF of HCV NS5A in the plasmid pFastBac HTa-HCV-NS5A.

FIG. 50 shows the nucleotide (FIG. 50a; SEQ ID NO: 65) and amino acid (FIG. 50b; SEQ ID NO: 66) sequences of the ORF of HCV NS5A-TBD in the plasmid pFastBac HTa-HCV-NS5A-TBD

FIG. 51 shows the nucleotide (FIG. 51a; SEQ ID NO: 67) and amino acid (FIG. 51 b; SEQ ID NO: 68) sequences of the ORF of HCV E1 in the plasmid pFastBac HTa-HCV-E1.

FIG. 52 shows the nucleotide (FIG. 52a; SEQ ID NO: 69) and amino acid (FIG. 52b; SEQ ID NO: 70) sequences of the ORF of HCV E1-TBD in the plasmid pFastBac HTa-HCV-E1-TBD.

FIG. 53 shows the nucleotide (FIG. 53a; SEQ ID NO: 71) and amino acid (FIG. 53b; SEQ ID NO: 72) sequences of the ORF of HCV E2 in the plasmid pFastBac HTa-HCV-E2.

FIG. 54 shows the nucleotide (FIG. 54a; SEQ ID NO: 73) and amino acid (FIG. 54b; SEQ ID NO: 74) sequences of the ORF of HCV E2-TBD in the plasmid pFastBac HTa-HCV-E2-TBD.

FIG. 55 shows the nucleotide (FIG. 55a; SEQ ID NO: 75) and amino acid (FIG. 55b; SEQ ID NO: 76) sequences of the ORF of HCV E1/E2 in the plasmid pFastBac HTa-HCV-E1/E2.

FIG. 56 shows the nucleotide (FIG. 56a; SEQ ID NO: 77) and amino acid (FIG. 56b; SEQ ID NO: 78) sequences of the ORF of HCV E1/E2-TBD in the plasmid pFastBac HTa-HCV-E1/E2-TBD.

IV. DETAILED DESCRIPTION

A. Overview

Disclosed herein are compositions and methods for eliciting immune responses against antigens. In particular embodiments, the compounds and methods elicit immune responses against antigens that are otherwise recognized by the host as “self” antigens. The immune response is enhanced by presenting the host immune system with a chimeric antigen comprising an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. By virtue of the target binding domain, antigen presenting cells take up, process and present the chimeric antigen, eliciting both a humoral and cellular immune response.

B. Definitions

Prior to describing the invention in further detail, the terms used in this application are defined as follows unless otherwise indicated.

“Antibody” refers to an immunoglobulin molecule produced by B lymphoid cells with a specific amino acid sequence evoked in humans or other animals by an antigen (immunogen). These molecules are characterized by reacting specifically with the antigen, each being defined in terms of the other.

“Antibody response” or “humoral response” refers to a type of immune response in which antibodies are produced by B lymphoid cells and are secreted into the blood and/or lymph in response to an antigenic stimulus. In a properly functioning immune response, the antibody binds specifically to antigens on the surface of cells (e.g., a pathogen), marking the cell for destruction by phagocytotic cells and/or complement-mediated mechanisms. Antibodies also circulate systemically and can bind to free virions. This antibody binding can neutralize the virion and prevent it from infecting a cell as well as marking the virion for elimination from circulation by phagocytosis or filtration in the kidneys.

“Antigen” refers to any substance that, as a result of coming in contact with appropriate cells, induces a state of sensitivity and/or immune responsiveness and that reacts in a demonstrable way with antibodies and/or immune cells of the sensitized subject in vivo or in vitro.

“Antigen-presenting cell” refers to the accessory cells of antigen-inductive events that function primarily by handling and presenting antigen to lymphocytes. The interaction of antigen presenting cells (APC) with antigens is an essential step in immune induction because it enables lymphocytes to encounter and recognize antigenic molecules and to become activated. Exemplary APCs include macrophages, Langerhans-dendritic cells, Follicular dendritic cells, and B cells.

“B cell” refers to a type of lymphocyte that produces immunoglobulins or antibodies that interact with antigens.

“CH1 region” refers to a region of the heavy chain constant domain on the antigen binding fragment of an antibody.

“Cellular response” or “cellular host response” refers to a type of immune response mediated by specific helper and killer T cells capable of directly or indirectly eliminating virally infected or cancerous cells.

As used herein, the term “chimeric antigen” refers to a polypeptide comprising an immune response domain and a target binding domain. The immune response domain and target binding domains may be directly or indirectly linked by covalent or non-covalent means. “Complex” or “antigen-antibody complex” refers to the product of the reaction between an antibody and an antigen. Complexes formed with polyvalent antigens tend to be insoluble in aqueous systems.

“Cytotoxic T-lymphocyte” is a specialized type of lymphocyte capable of destroying foreign cells and host cells infected with the infectious agents that produce viral antigens.

“Epitope” refers to the simplest form of an antigenic determinant, on a complex antigen molecule; this is the specific portion of an antigen that is recognized by an immunoglobulin or T cell receptor.

“Fusion protein” refers to a protein formed by expression of a hybrid gene made by combining two or more gene sequences.

“Hinge region” refers to the portion of an antibody that connects the Fab fragment to the Fc fragment; the hinge region contains disulfide bonds that covalently link the two heavy chains.

The term “homolog” refers to a molecule which exhibits homology to another molecule, by for example, having sequences of chemical residues that are the same or similar at corresponding positions. The phrase “% homologous” or “% homology” refers to the percent of nucleotides or amino acids at the same position of homologous polynucleotides or polypeptides that are identical or similar. For example, if 75 of 80 residues in two proteins are identical, the two proteins are 93.75% homologous. Percent homology can be determined using various software programs known to one of skill in the art.

“Host” refers to a warm-blooded animal, including a human, which suffers from an immune-treatable condition, such as an infection or a cancer. As used herein, “host” also refers to a warm-blooded animal, including a human, to which a chimeric antigen is administered.

In the context of this invention, “hybridization” means the pairing of complementary strands of oligomeric compounds. In the present invention, the preferred mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds. For example, adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds. Hybridization can occur under varying circumstances. The terms “hybridize”, “hybridizing”, “hybridizes” and the like, used in the context of polynucleotides, are meant to refer to conventional hybridization conditions, preferably such as hybridization in 50% formamide/6×SSC/0.1% SDS/100 μg/ml mDNA, in which temperatures for hybridization are above 37° C. and temperatures for washing in 0.1×SSC/0.1% SDS are above 55° C.

“Immunity” or “immune response” refers to the body's response to an antigen. In particular embodiments, it refers to the ability of the body to resist or protect itself against infectious disease.

“Immune Response Domain (IRD)” refers to the variously configured antigenic portion of a bifunctional molecule. The IRD comprises one or more antigens or one or more recombinant antigens. Preferred viral antigens include, but are not limited to, HBV PreS1/S2 HBV PreS1/S2/S, HBV Core, HBV Core ctm (C-terminal modified), HBV e-antigen, HBV Polymerase, HCV Core, HCV E1-E2, HCV E1, HCV E2, HCV NS3-serine protease, HCV NS5A and NS4A, HIV gp120 and HSV Alkaline nuclease and HPV Antigens.

As used herein, the phrase “immune-treatable condition” refers to a condition or disease that can be prevented, inhibited or relieved by eliciting or modulating an immune response in the subject.

“Lymphocyte” refers to a subset of nucleated cells found in the blood, which mediate specific immune responses.

“Monoclonal antibody” or “mAb” refers to an antibody produced from a clone or genetically homogenous population of fused hybrid cells, i.e., a hybridoma cell. Hybrid cells are cloned to establish cells lines producing a specific monoclonal antibody that is chemically and immunologically homogenous, i.e., that recognizes only one type of antigen.

“Peptide linkage” or “peptide bond” refers to two or more amino acids covalently joined by a substituted amide linkage between the α-amino group of one amino acid and the α-carboxyl group of another amino acid.

A “pharmaceutical excipient” comprises a material such as an adjuvant, a carrier, a pH-adjusting and buffering agent, a tonicity adjusting agent, a wetting agent, a preservative, and the like.

“Pharmaceutically acceptable” refers to a non-toxic composition that is physiologically compatible with humans or other animals.

The term “polynucleotide” as used herein refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, this term includes double- and single-stranded DNA and RNA. It also includes known types of modifications, for example, labels which are known in the art, methylation, “caps”, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) and with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties, such as, for example proteins (including e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylators, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.), as well as unmodified forms of the polynucleotide.

“Protease cleavage site” refers to a site where proteolytic enzymes hydrolize (break) polypeptide chains.

In the present invention, the phrase “stringent hybridization conditions” or “stringent conditions” refers to conditions under which a compound of the invention will hybridize to its target sequence, but to a minimal number of other sequences.

The term “subject” refers to any warm-blooded animal, preferably a human.

“Tag” refers to a marker or marker sequence used to isolate or purify a molecule containing the tag. An exemplary tag includes a 6×His tag.

“T cell” refers to a type of lymphocyte responsible for antigen-specific cellular interactions, and which mediates humoral and cellular immune responses.

“Target Binding Domain (TBD)” refers to a region of an immunoglobulin heavy chain constant region.

The phrase “therapeutically effective amount” refers to an amount of chimeric antigen, or polynucleotide encoding a chimeric antigen, sufficient to elicit an effective B cell, cytotoxic T lymphocyte (CTL) and/or helper T lymphocyte (Th) response to the antigen and to block or to cure or at least partially arrest or slow symptoms and/or complications of a disease or disorder.

The terms “treating” and “treatment” as used herein cover any treatment of a condition treatable by a chimeric antigen in an animal, particularly a human, and include: (i) preventing the condition from occurring in a subject which may be predisposed to the condition but has not yet been diagnosed as having it; (ii) inhibiting the condition, e.g., arresting or slowing its development; or (iii) relieving the condition, e.g., causing regression of the condition or its symptoms

“Xenotypic” refers to originating from a different species other than the host. For example, a recombinantly expressed antibody cloned from a mouse genome would be xenotypic to a human but not to a mouse, regardless of whether that recombinantly expressed antibody was produced in a bacterial, insect or mouse cell.

C. Chimeric Antigens

A composition of the present invention includes a chimeric antigen comprising an immune response domain (IRD) and a target binding domain (TBD). In preferred embodiments of the invention, the protein portion is capable of inducing humoral and/or T cell responses, and the target binding portion is capable of binding an antigen presenting cell, such as a dendritic cell. The chimeric antigen of the present invention may also include one or more of the following: a hinge region of an immunoglobulin, a CH1 region of an immunoglobulin, a peptide linker, a protease cleavage site, and a tag suitable for use with a purification protocol. A chimeric antigen of the present invention is capable of binding to and activating an antigen presenting cell.

In some embodiments of the invention, the IRD of the chimeric antigen includes one or more proteins selected from the group comprising: one or more HBV proteins, one or more recombinant HBV proteins, one or more HCV proteins, or one or more recombinant HCV proteins.

In yet another embodiment of the invention, the IRD of the chimeric antigen includes a 6×His-peptide fused to one or more HBV proteins, one or more recombinant HBV proteins, one or more HCV proteins, or one or more recombinant HCV proteins.

In preferred embodiments of the invention, the target binding domain of the chimeric antigen is an antibody fragment xenotypic to the host. For example, if the host is a human, an exemplary xenotypic antibody fragment is a non-human animal antibody fragment, such as from a mouse. In the preferred embodiments of the invention, the xenotypic antibody fragment comprises a murine Fc fragment. In the most preferred embodiments of the invention, the target binding domain comprises a xenotypic Fc fragment, a hinge region, a CH1 region, and a peptide linkage suitable for linking the target binding domain to the IRD.

The present invention also comprises the use of linking molecules to join the IRD to the TBD. Exemplary linker molecules include leucine zippers, and biotin/avidin.

In one embodiment, the chimeric antigen of the present invention is a fusion protein having two portions, namely an IRD containing an antigenic sequence (such as a viral antigen(s)), and a TBD containing a xenotypic Fc fragment. The xenotypic murine Fc fragment with the hinge region present recruits the antigen-presenting cells, specifically dendritic cells, to take up the chimeric antigen. The binding region of the chimeric antigen thus targets antigen-presenting cells specifically. The internal machinery of the APC then processes the IRD to form an activated APC. The activated APC must then be capable of contacting and activating immune response cells for generating humoral and cellular immune responses to clear infected cells.

In a further embodiment, the chimeric antigen is a fusion protein having two portions, namely a modified viral antigen or antigens, antigenic protein fragments or peptides, or any of these with glycosylation at specific sites, and a xenotypic murine Fc fragment with the hinge region present, which can also be, optionally, glycosylated.

In yet another embodiment, the invention provides a further modified chimeric antigen, wherein the antigen is biotinylated and the Fc fragment is generated with streptavidin as a fusion protein to facilitate the production of a wide assortment of antigen-Fc conjugates.

In yet another embodiment, the invention provides an association between the antigen and the antibody Fc fragment through chemical conjugation.

An embodiment of the present invention includes the use of recombinant antigens of HBV, HCV, or DHBV fused to a xenotypic antibody fragment by molecular biological techniques, production of the fusion proteins in a baculovirus expression system and their use as therapeutic vaccines against chronic HBV and HCV infections. The present invention provides an efficient method to deliver a hitherto unrecognized antigen to APCs in vivo so as to generate a broad immune response, a Th1 response involving CTLs and a Th2 (antibody) response. The immunogenicity of the pre-selected viral antigen unrecognized by the host immune system is increased due to the presence of the xenotypic antibody fragment as well as by the presence of specific glycosylation introduced in the insect cell expression system. The antigen-antibody fragment fusion protein, due to the presence of the antibody component, will bind to specific receptors present on various immune cell types including dendritic cells, macrophages, B cells and granulocytes. The fusion proteins administered to either humans or animals will be taken up by the APCs, especially DCs, will be hydrolyzed to small peptides and presented on the cell surface, complexed with MHC Class I and/or MHC Class II, which can elicit a broad immune response and clear the viral infection.

As used herein, the term “Target Binding Domain (TBD)” refers to a region of an immunoglobulin heavy chain constant region, which is an antibody fragment capable of binding to an Fc receptor on an APC. In accordance with the present invention, the TBD is a protein capable of binding to an Fc receptor on an APC, particularly a dendritic cell, and is subsequently transported into the APC by receptor-mediated uptake. In accordance with the present invention, the presence of an Fc fragment augments the uptake of the chimeric antigen through the Fc receptor on antigen-presenting cells, specifically dendritic cells. By virtue of the specific uptake, the viral antigen is processed and presented as foreign; thus, an immune response is effectively elicited to the previously tolerated viral antigen.

Also, in accordance with the present invention, the chimeric antigen, preferably, is capable of binding to a macrophage mannose receptor. The macrophage mannose receptor (MMR), also known as CD206, is expressed on antigen presenting cells (APC) such as dendritic cells (DC). This molecule is a member of the C-type lectin family of endocytic receptors. Mannosylated chimeric antigen can be bound and internalized by CD206. In general, exogenous antigen is thought to be processed and presented primarily through the MHC class II pathway. However, in the case of targeting through CD206, there is evidence that both the MHC class I and class II pathways are involved (Apostolopoulos et al., Eur. J. Immunol. 30:1714 (2000); Apostolopoulos and McKenzie, Curr. Mol. Med. 1:469 (2001); Ramakrishna et al., J. Immunol. 172:2845-2852 (2004)). Thus, monocyte-derived dendritic cells loaded with chimeric antigen that specifically targeted CD206 will induce both a potent class I-dependent CD8+ CTL response and a class II-dependent proliferative T helper response (Ramakrishna et al., supra (2004)).

An exemplary TBD is derived from Mouse anti-HBVsAg mAb (Hybridoma 2C12) as cloned in pFastBac HTa expression vector, and expressed in a High Five™ insect cell expression system (Invitrogen). This TBD consists of part of CH1, and Hinge-CH2-CH3 from N-terminal to C-terminal of the mouse anti-HBVs Ag mAb. The constant region of the IgG1 molecule for the practice of the present invention contains a linker peptide, part of CH1-hinge and the regions CH2 and CH3. The hinge region portion of the monomeric TBD can form disulphide bonds with a second TBD molecule. FIG. 5 illustrates a schematic representation of a TBD molecule. The protein is expressed as an N-terminal fusion protein with a 6×His tag, a seven amino acid rTEV (recombinant tobacco etch virus) protease cleavage site and the N-terminal fusion of the Target Binding Domain (TBD) of the xenotypic (murine) mAb raised against HBV sAg (Hybridoma 2C12). The exemplary TBD is a fragment of the constant chain of the IgG1 mAb from 2C12 with the sequence of amino acids comprising the 8 amino acid peptide linker, five amino acids of the CH1 region, the hinge sequences, CH2 and CH3 region sequences (FIG. 5) and ten additional amino acids from the expression vector. The exemplary TBD fragment defined herein forms the parent molecule for the generation of fusion proteins with antigens derived from viruses or other infectious agents. FIG. 1b depicts the formation of dimeric chimeric antigen molecule formed via intermolecular disulphide bonds. FIG. 6 shows the nucleotide sequence of the Open Reading Frame (ORF) encoding the exemplary TBD protein and the deduced amino acid sequence as defined in FIG. 5.

FIG. 7 shows a schematic representation of an exemplary chimeric antigen vaccine molecule, as produced in the insect cell expression system. This molecule is a fusion protein of N-terminal 6×His tag, rTEV protease cleavage site, HBV S1/S2 antigen, linker peptide, a part of the CH1 as well as CH2 and CH3 domains of the mouse monoclonal antibody from 2C12 plus eight additional amino acids introduced as a cloning artifact. Cleavage and purification will result in the generation of HBV S1/S2-TBD molecule. FIG. 8 shows the nucleotide and amino acid sequences of the HBV S 1/S2-TBD chimeric antigen molecule. FIG. 9 shows the nucleotide and the deduced amino acid sequences of the expressed HBV S1/S2 protein.

FIG. 10 shows a schematic representation of the fusion protein of HBV S1/S2/S-TBD. This molecule is a fusion protein of N-terminal 6×His tag, rTEV protease cleavage site, HBV S1/S2/S antigen, linker peptide, a part of the CH1 as well as CH2 and CH3 domains of the mouse monoclonal antibody from 2C12 plus eight additional amino acids introduced as a cloning artifact. FIG. 11 shows the nucleotide and deduced amino acid sequences of the ORF of the fusion protein. FIG. 12 shows the nucleotide and deduced amino acid sequences of the HBV S1/S2/S protein.

FIG. 13 illustrates the fusion protein of HBV Core-TBD molecule as expressed in the insect cells. This molecule is a fusion protein of N-terminal 6×His tag, rTEV protease cleavage site, HBV S1/S2 Core, linker peptide, a part of the CH1 as well as CH2 and CH3 domains of the mouse monoclonal antibody from 2C12 plus eight additional amino acids introduced as a cloning artifact. FIG. 14 shows the nucleotide and amino acid sequences in the ORF of the fusion protein. FIG. 15 shows the nucleotide and deduced amino acid sequences of the HBV Core protein.

Another embodiment of the present invention involves the production and use of fusion proteins generated from Duck Hepatitis B Virus (DHBV) antigens and murine TBD. DHBV has been used as a very versatile animal model for the development of therapies for HBV, its human counterpart. DHBV genome encodes Surface antigens (PreS/S), the Core protein (Core), which form capsids, and the polymerase enzyme, which serves multiple functions.

FIG. 16 depicts a schematic representation of the fusion protein of DHBV PreS-TBD, as produced in High Five™ (Invitrogen) insect cell expression system. This molecule is a fusion protein of N-terminal 6×His tag, rTEV protease cleavage site, DHBV PreS, linker peptide, a part of the CH1 as well as CH2 and CH3 domains of the mouse monoclonal antibody from 2C12 plus eight additional amino acids introduced as a cloning artifact. The nucleotide and deduced amino acid sequences of the ORF of the fusion protein as cloned in the plasmid pFastBac HTa are shown in FIG. 17. The nucleotide and deduced amino acid sequences of the DHBV PreS protein are shown in FIG. 18.

FIG. 19 shows schematically, another embodiment of the present invention viz. DHBV PreS/S-TBD. This molecule is a fusion protein of N-terminal 6×His tag, rTEV protease cleavage site, DHBV PreS/S, linker peptide, a part of the CH1 as well as CH2 and CH3 domains of the mouse monoclonal antibody from 2C12 plus eight additional amino acids introduced as a cloning artifact. The nucleotide and amino acid sequences are presented in FIG. 20. The nucleotide and deduced amino acid sequences of PreS/S are presented in FIG. 21.

FIG. 22 shows a schematic representation of the fusion protein of DHBV Core-TBD. This molecule is a fusion protein of N-terminal 6×His tag, rTEV protease cleavage site, DHBV Core, linker peptide, a part of the CH1 as well as CH2 and CH3 domains of the mouse monoclonal antibody from 2C12 plus eight additional amino acids introduced as a cloning artifact. FIG. 23 shows the nucleotide and deduced amino acid sequences of the DHBV Core-TBD fusion protein. The nucleotide and deduced amino acid sequences of DHBV Core protein are shown in FIG. 24.

D. Novel Polynucleotides

Another aspect of the invention provides polynucleotides encoding a chimeric antigen comprising a first polynucleotide portion encoding an immune response domain and a second polynucleotide portion encoding a target binding domain. The first and second polynucleotide portions may be located on the same or different nucleotide chains.

The invention provides polynucleotides corresponding or complementary to genes encoding chimeric antigens, mRNAs, and/or coding sequences, preferably in isolated form, including polynucleotides encoding chimeric antigen variant proteins; DNA, RNA, DNA/RNA hybrids, and related molecules, polynucleotides or oligonucleotides complementary or having at least a 90% homology to the genes encoding a chimeric antigen or mRNA sequences or parts thereof; and polynucleotides or oligonucleotides that hybridize to the genes encoding a chimeric antigen, mRNAs, or to chimeric antigen-encoding polynucleotides.

Additionally, the invention includes analogs of the genes encoding a chimeric antigen specifically disclosed herein. Analogs include, e.g., mutants, that retain the ability to elicit an immune response, and preferably have a homology of at least 80%, more preferably 90%, and most preferably 95% to any of polynucleotides encoding a chimeric antigen, as specifically described by SEQ ID NOs: 31, 35, 39, 43, 47, 51, 57, 61, 65, 69, 73 and 77. Typically, such analogs differ by only 1 to 10 codon changes. Examples include polypeptides with minor amino acid variations from the natural amino acid sequence of a viral antigen or of an antibody fragment; in particular, conservative amino acid replacements. Conservative replacements are those that take place within a family of amino acids that are related in their side chains. Genetically-encoded amino acids are generally divided into four families: (1) acidic=aspartate, glutamate; (2) basic=lysine, arginine, histidine; (3) non-polar=alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar=glycine, asparagine, glutamine, cystine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids. For example, it is reasonable to expect that an isolated replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar conservative replacement of an amino acid with a structurally related amino acid will not have a major effect on biological activity. Polypeptide molecules having substantially the same amino acid sequence as any of the polypeptides disclosed in any one of SEQ ID NOs: 32, 36, 40, 44, 48, 52, 58, 62, 66, 70, 74 and 78 but possessing minor amino acid substitutions that do not substantially affect the ability of the chimeric antigens to elicit an immune response, are within the definition of a chimeric antigen. Derivatives include aggregative conjugates with other chimeric antigen molecules and covalent conjugates with unrelated chemical moieties. Covalent derivatives are prepared by linkage of functionalities to groups that are found in chimeric antigen amino acid chains or at the N- or C-terminal residues by means known in the art.

Amino acid abbreviations are provided in Table 1.

TABLE 1
Amino Acid Abbreviations
Alanine Ala A
Arginine Arg R
Asparagine Asn N
Aspartate Asp D
Cysteine Cys C
Glutamate Glu E
Glutamine Gln Q
Glycine Gly G
Histidine His H
Isoleucine Ile I
Leucine Leu L
Lysine Lys K
Methionine Met M
Phenylalanine Phe F
Proline Pro P
Serine Ser S
Threonine Thr T
Tryptophan Trp W
Tyrosine Tyr Y
Valine Val V

Conservative amino acid substitutions can be made in a protein without altering either the conformation or the function of the protein. Proteins of the invention can comprise 1 to 15 conservative substitutions. Such changes include substituting any of isoleucine (I), valine (V), and leucine (L) for any other of these hydrophobic amino acids; aspartic acid (D) for glutamic acid (E) and vice versa; glutamine (Q) for asparagine (N) and vice versa; and serine (S) for threonine (T) and vice versa. Other substitutions can also be considered conservative, depending on the environment of the particular amino acid and its role in the three dimensional structure of the protein. For example, glycine (G) and alanine (A) can frequently be interchangeable, as can alanine (A) and valine (V). Methionine (M), which is relatively hydrophobic, can frequently be interchanged with leucine and isoleucine, and sometimes with valine. Lysine (K) and arginine (R) are frequently interchangeable in locations in which the significant feature of the amino acid residue is its charge and the differing pK's of these two amino acid residues are not significant Still other changes can be considered “conservative” in particular environments (see, e.g. Biochemistry 4th Ed., Lubert Stryer ed. (W.H. Freeman and Co.), pages 18-23; Henikoff and Henikoff, Proc Nat'l Acad Sci USA 89:10915-10919 (1992); Lei et al., J Biol Chem 270(20):11882-6 (1995)).

The invention also includes polynucleotides that selectively hybridize to polynucleotides that encode chimeric antigens. Preferably a polynucleotide of the invention will hybridize under stringent conditions to a sequence selected from SEQ ID NOs: 31, 35, 39, 43, 47, 51, 57, 61, 65, 69, 73 and 77. Stringency of hybridization reactions is readily determinable by one of ordinary skill in the art and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured nucleic acid sequences to re-anneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature that can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see, e.g., Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (©1995, as Supplemented April 2004, Supplement 66) at pages 2.9.1-2.10.8 and 4.9.1-4.9.13.

“Stringent conditions” or “high stringency conditions”, as defined herein, are identified by, but not limited to, those that (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50° C.; (2) employ, during hybridization, a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42° C.; or (3) employ 50% formamide, 5×SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5×Denhardt's solution, sonicated salmon sperm DNA (50 μg/ml), 0.1% SDS, and 10% dextran sulfate at 42° C., with washes at 42° C. in 0.2×SSC (sodium chloride/sodium citrate) and 50% formamide at 55° C., followed by a high-stringency wash consisting of 0.1×SSC containing EDTA at 55° C. “Moderately stringent conditions” are described by, but not limited to, those in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and % SDS) less stringent than those described above. An example of moderately stringent conditions is overnight incubation at 37° C. in a solution comprising: 20% formamide, 5×SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5×Denhardt's solution, 10% dextran sulfate, and 20 mg/mL denatured sheared salmon sperm DNA, followed by washing the filters in 1×SSC at about 37-50° C. The skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like.

Embodiments of a polynucleotide of the invention include: a polynucleotide encoding a chimeric antigen having a sequence selected from any of the sequences shown in FIGS. 32, 36, 40, 44, 48, 52, 58, 62, 66, 70, 74 and 78, a nucleotide sequence of chimeric antigen selected from any of the sequences shown in FIGS. 31, 35, 39, 43, 47, 51, 57, 61, 65, 69, 73 and 77, wherein T may be U. For example, embodiments of chimeric antigen nucleotides comprise, without limitation:

    • (a) a polynucleotide comprising or consisting of a sequence as shown in FIG. 8a, 11a, 14a, 17a, 20a, 23a, 46a, 48a, 50a, 52a, 54a or 56a (SEQ ID NOs: 31, 35, 39, 43, 47, 51, 57, 61, 65, 69, 73 or 77), wherein T can also be U;
    • (b) a polynucleotide whose sequence is at least 80% homologous to a sequence shown in FIG. 8a, 11a, 41a, 17a, 20a, 23a, 46a, 48a, 50a, 52a, 54a or 56a (SEQ ID NOs: 31, 35, 39, 43, 47, 51, 57, 61, 65, 69, 73 or 77);
    • (c) a polynucleotide that encodes a chimeric antigen whose sequence encoded by a DNA contained in one of the plasmids designated pFastBacHTa HBV S1/S2-TBD, pFastBacHTa HBV core-TBD, pFastBacHTa HCV core(1-177)-TBD, pFastBacHTa HCV NS5A-TBD, and pFastBacHTa HCV E2-TBD;
    • (d) a polynucleotide that encodes a chimeric antigen whose sequence is shown in FIG. 8b, 11b, 14b, 20b, 23b, 46b, 48b, 50b, 52b, 54b or 56b (SEQ ID NOs: 32, 36, 40, 44, 48, 52, 58, 62, 66, 70, 74 or 78);
    • (e) a polynucleotide that encodes a chimeric antigen-related protein that is at least 90% identical to an entire amino acid sequence shown in FIG. 8b, 11b, 14b, 20b, 23b, 46b, 48b, 50b, 52b, 54b or 56b (SEQ ID NOs: 32, 36, 40, 44, 48, 52, 58, 62, 66, 70, 74 or 78);
    • (f) a polynucleotide that is fully complementary to a polynucleotide of any one of (a)-(e); and
    • (g) a polynucleotide that selectively hybridizes under stringent conditions to a polynucleotide of (a)-(f).

The invention also provides recombinant DNA or RNA molecules containing a chimeric antigen polynucleotide, an analog or homologue thereof, including but not limited to phages, plasmids, phagemids, cosmids, YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes), as well as various viral and non-viral vectors well known in the art, and cells transformed or transfected with such recombinant DNA or RNA molecules. Methods for generating such molecules are well known (see, for example, Sambrook et al., 1989, supra).

The invention further provides a host-vector system comprising a recombinant DNA molecule containing a chimeric antigen polynucleotide, analog or homologue thereof within a suitable prokaryotic or eukaryotic host cell. Examples of suitable eukaryotic host cells include a yeast cell, a plant cell, or an animal cell, such as a mammalian cell or an insect cell (e.g., a baculovirus-infectible cell such as an Sf9, Sf21, Drosophila S2 or High Five™ cell). Examples of suitable mammalian cells include various prostate cancer cell lines such as DU145 and TsuPr1, other transfectable or transducible prostate cancer cell lines, primary cells (PrEC), as well as a number of mammalian cells routinely used for the expression of recombinant proteins (e.g., COS, CHO, 293, 293T cells). More particularly, a polynucleotide comprising the coding sequence of chimeric antigen or a fragment, analog or homolog thereof can be used to generate chimeric antigen thereof using any number of host-vector systems routinely used and widely known in the art.

A wide range of host-vector systems suitable for the expression of chimeric antigens thereof are available, see for example, Sambrook et al., 1989, supra; Ausubel, Current Protocols in Molecular Biology, 1995, supra). Preferred vectors for insect cell expression include, but are not limited to, pFastBac HTa (Invitrogen). Using such expression vectors, chimeric antigens can be expressed in several insect cell lines, including for example Sf9, Sf21, Drosophila S2 or High Five™. Alternatively, preferred yeast expression systems include Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, and Pichia august. The host-vector systems of the invention are useful for the production of a chimeric antigen.

A chimeric antigen or an analog or homolog thereof can be produced by cells transfected with a construct encoding a chimeric antigen. For example, Sf9 cells can be transfected with an expression plasmid encoding a chimeric antigen or analog or homolog thereof, the chimeric antigen or related protein is expressed in the Sf9 cells, and the chimeric antigen is isolated using standard purification methods. Various other expression systems well known in the art can also be employed. Expression constructs encoding a leader peptide joined in frame to the chimeric antigen coding sequence can be used for the generation of a secreted form of chimeric antigen.

As discussed herein, redundancy in the genetic code permits variation in chimeric antigen gene sequences. In particular, it is known in the art that specific host species often have specific codon preferences, and thus one can adapt the disclosed sequence as preferred for a desired host. For example, preferred analog codon sequences typically have rare codons (i.e., codons having a usage frequency of less than about 20% in known sequences of the desired host) replaced with higher frequency codons. Codon preferences for a specific species are calculated, for example, by utilizing codon usage tables available on the INTERNET such as at world wide web URL www.kazusa.or.jp/codon.

Additional sequence modifications are known to enhance protein expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon/intron splice site signals, transposon-like repeats, and/or other such well-characterized sequences that are deleterious to gene expression. The GC content of the sequence is adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. Where possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures. Other useful modifications include the addition of a translational initiation consensus sequence at the start of the open reading frame, as described in Kozak, Mol. Cell Biol. 9:5073-5080 (1989). Skilled artisans understand that the general rule that eukaryotic ribosomes initiate translation exclusively at the 5′ proximal AUG codon is abrogated only under rare conditions (see, e.g., Kozak PNAS 92(7):2662-2666 (1995) and Kozak Nucl Acids Res 15(20):8125-8148 (1987)).

E. Pharmaceutical Compositions of the Invention

One aspect of the invention relates to pharmaceutical compositions comprising a pharmaceutically acceptable excipient and a chimeric antigen comprising an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. In therapeutic applications, the pharmaceutical compositions can be administered to a subject in an amount sufficient to elicit an effective B cell, cytotoxic T lymphocyte (CTL) and/or helper T lymphocyte (Th) response to the antigen and to prevent infenction or to cure or at least partially arrest or slow symptoms and/or complications. Amounts effective for this use will depend on, e.g., the particular composition administered, the manner of administration, the stage and severity of the disease being treated, the weight and general state of health of the subject, and the judgment of the prescribing physician.

The dosage for an initial therapeutic immunization (with chimeric antigen) generally occurs in a unit dosage range where the lower value is about 1, 5, 50, 500, or 1,000 ng and the higher value is about 10,000; 20,000; 30,000; or 50,000 μg. Dosage values for a human typically range from about 500 ng to about 50,000 μg per 70 kilogram subject. Boosting dosages of between about 1.0 ng to about 50,000 μg of chimeric antigen pursuant to a boosting regimen over weeks to months may be administered depending upon the subject's response and condition. Administration should continue until at least clinical symptoms or laboratory tests indicate that the condition has been prevented, arrested, slowed or eliminated and for a period thereafter. The dosages, routes of administration, and dose schedules are adjusted in accordance with methodologies known in the art.

A human unit dose form of a chimeric antigen is typically included in a pharmaceutical composition that comprises a human unit dose of an acceptable carrier, in one embodiment an aqueous carrier, and is administered in a volume/quantity that is known by those of skill in the art to be useful for administration of such polypeptides to humans (see, e.g., Remington: The Science and Practice of Pharmacy, 20th Edition, A. Gennaro, Editor, Lippincott Williams & Wilkins, Baltimore, Md., 2000). As appreciated by those of skill in the art, various factors can influence the ideal dose in a particular case. Such factors include, for example, half life of the chimeric antigen, the binding affinity of the chimeric antigen, the immunogenicity of the composition, the desired steady-state concentration level, route of administration, frequency of treatment, and the influence of other agents used in combination with the treatment method of the invention, as well as the health status of a particular subject.

In certain embodiments, the compositions of the present invention are employed in serious disease states, that is, life-threatening or potentially life-threatening situations. In such cases, as a result of the relative nontoxic nature of the chimeric antigen in preferred compositions of the invention, it is possible and may be felt desirable by the treating physician to administer substantial excesses of these chimeric antigens relative to these stated dosage amounts.

The concentration of chimeric antigen of the invention in the pharmaceutical formulations can vary widely, i.e., from less than about 0.1%, usually at or at least about 2% to as much as 20% to 50% or more by weight, and will be selected primarily by fluid volumes, viscosities, etc., in accordance with the particular mode of administration selected.

The pharmaceutical compositions can be delivered via any route known in the art, such as parenterally, intrathecally, intravascularly, intravenously, intramuscularly, transdermally, intradermally, subcutaneously, intranasally, topically, orally, rectally, vaginally, pulmonarily or intraperitoneally. Preferably, the composition is delivered by parenteral routes, such as subcutaneous or intradermal administration.

The pharmaceutical compositions can be prepared by mixing the desired chimeric antigens with an appropriate vehicle suitable for the intended route of administration. In making the pharmaceutical compositions of this invention, the chimeric antigen is usually mixed with an excipient, diluted by an excipient or enclosed within a carrier that can be in the form of a capsule, sachet, paper or other container. When the pharmaceutically acceptable excipient serves as a diluent, it can be a solid, semi-solid, or liquid material, which acts as a vehicle, carrier or medium for the therapeutic agent. Thus, the compositions can be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as a solid or in a liquid medium), ointments containing, for example, up to 10% by weight of the chimeric antigen, soft and hard gelatin capsules, suppositories, sterile injectable solutions, and sterile packaged powders.

Some examples of suitable excipients include, but are not limited to, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, sterile water, syrup, and methyl cellulose. The formulations can additionally include: lubricating agents such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifying and suspending agents; preserving agents such as methyl- and propylhydroxy-benzoates; sweetening agents; and flavoring agents. The compositions of the invention can be formulated so as to provide quick, sustained or delayed release of the chimeric antigen after administration to the subject by employing procedures known in the art. See, e.g., Remington, supra, at pages 903-92 and pages 1015-1050.

For preparing solid compositions such as tablets, the chimeric antigen is mixed with a pharmaceutical excipient to form a solid preformulation composition containing a homogeneous mixture of a chimeric antigen of the present invention. When referring to these preformulation compositions as homogeneous, it is meant that the chimeric antigen is dispersed evenly throughout the composition so that the composition may be readily subdivided into equally effective unit dosage forms such as tablets, pills and capsules.

The tablets or pills of the present invention may be coated or otherwise compounded to provide a dosage form affording the advantage of prolonged action. For example, the tablet or pill can comprise an inner dosage and an outer dosage component, the latter being in the form of an envelope over the former. The two components can be separated by an enteric layer, which serves to resist disintegration in the stomach and permit the inner component to pass intact into the duodenum or to be delayed in release. A variety of materials can be used for such enteric layers or coatings, such materials including a number of polymeric acids and mixtures of polymeric acids with such materials as shellac, cetyl alcohol, and cellulose acetate.

The liquid forms in which the novel compositions of the present invention may be incorporated for administration orally or by injection include aqueous solutions, suitably flavored syrups, aqueous or oil suspensions, and flavored emulsions with edible oils such as corn oil, cottonseed oil, sesame oil, coconut oil, or peanut oil, as well as elixirs and similar pharmaceutical vehicles.

In preparing a composition for parenteral administration strict attention must be paid to tonicity adjustment to reduce irritation. A reconstitutable composition is a sterile solid packaged in a dry form. A reconstitutable composition is preferred because it is more stable when stored as a dry solid rather than in a solution ready for immediate administration. The dry solid is usually packaged in a sterile container with a butyl rubber closure to ensure the solid is kept at an optimal moisture range. A reconstitutable dry solid is formed by dry fill, spray drying, or freeze-drying methods. Descriptions of these methods may be found, e.g., in Remington, supra, at pages 681-685 and 802-803.

Compositions for parenteral injection are generally dilute, and the component present in the higher proportion is the vehicle. The vehicle normally has no therapeutic activity and is nontoxic, but presents the chimeric antigen to the body tissues in a form appropriate for absorption. Absorption normally will occur most rapidly and completely when the chimeric antigen is presented as an aqueous solution. However, modification of the vehicle with water-miscible liquids or substitution with water-immiscible liquids can affect the rate of absorption. Preferably, the vehicle of greatest value for this composition is isotonic saline. In preparing the compositions that are suitable for injection, one can use aqueous vehicles, water-miscible vehicles, and nonaqueous vehicles

Additional substances may be included in the injectable compositions of this invention to improve or safeguard the quality of the composition. Thus, an added substance may affect solubility, provide for subject comfort, enhance the chemical stability, or protect the preparation against the growth of microorganisms. Thus, the composition may include an appropriate solubilizer, substances to act as antioxidants, and substances that act as a preservative to prevent the growth of microorganisms. These substances will be present in an amount that is appropriate for their function, but will not adversely affect the action of the composition. Examples of appropriate antimicrobial agents include thimerosal, benzethonium chloride, benzalkonium chloride, phenol, methyl p-hydroxybenzoate, and propyl p-hyrodxybenzoate. Appropriate antioxidants may be found in Remington, supra, at p. 1015-1017.

In certain embodiments, liposomes, nanocapsules, microparticles, lipid particles, vesicles, and the like, are used for the administration of the chimeric antigens of the present invention. In particular, the compositions of the present invention may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like. Alternatively, compositions of the present invention can be bound, either covalently or non-covalently, to the surface of such carrier vehicles.

Compositions administered via liposomes may also serve: 1) to target the chimeric antigen to a particular tissue, such as lymphoid tissue; 2) to target selectively to antigen presenting cells; or, 3) to increase the half-life of the peptide composition. Liposomes include emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers and the like. In these preparations, the chimeric antigen to be delivered is incorporated as part of a liposome, alone or in conjunction with a molecule that binds to a receptor prevalent among lymphoid cells, such as monoclonal antibodies that bind to the CD45 antigen, or with other therapeutic or immunogenic compositions. Thus, liposomes either filled or decorated with a desired chimeric antigen of the invention can be directed to the site of lymphoid cells, where the liposomes then deliver the chimeric antigens. Liposomes for use in accordance with the invention are formed from standard vesicle-forming lipids, which generally include neutral and negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally guided by consideration of, e.g., liposome size, acid lability and stability of the liposomes in the blood stream. A variety of methods are available for preparing liposomes, as described in, e.g., Szoka, et al., Ann. Rev. Biophys. Bioeng. 9:467-508 (1980), and U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369. A liposome suspension containing a chimeric antigen may be administered intravenously, locally, topically, etc. in a dose which varies according to, inter alia, the manner of administration, the chimeric antigen being delivered, and the stage of the disease being treated.

Compositions for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable, aqueous or organic solvents, or mixtures thereof, and powders. The liquid or solid compositions may contain suitable pharmaceutically acceptable excipients as described herein. The compositions can be administered by the oral or nasal respiratory route for local or systemic effect. Compositions in pharmaceutically acceptable solvents may be nebulized by use of inert gases. Nebulized solutions may be inhaled directly from the nebulizing device or the nebulizing device may be attached to a facemask tent, or intermittent positive pressure breathing machine. Solution, suspension, or powder compositions may be administered, preferably orally or nasally, from devices that deliver the formulation in an appropriate manner.

Another formulation employed in the methods of the present invention employs transdermal delivery devices (“patches”). Such transdermal patches may be used to provide continuous or discontinuous infusion of the chimeric antigen of the present invention in controlled amounts. The construction and use of transdermal patches for the delivery of pharmaceutical agents is well known in the art. See, for example, U.S. Pat. No. 5,023,252, herein incorporated by reference. Such patches may be constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents.

Additionally, it may be advantageous to include at least one antiviral therapeutic or chemotherapeutic in addition to the chimeric antigen and pharmaceutical excipient. Antiviral therapeutics include, but are not limited to, peptidomimetics (such as amprenavir, indinavir, lopinavir, nelfinavir, ritonavir, and saquinavir), polynucleotides (such as ampligen and fomivirsen), purine/pyrimidinones (such as abacavir, acyclovir, adefovir, cidofovir, cytarabine, didanosine, dideoxyadenosine, dipivoxil, edoxudine, emtricitabine, entecovir, famciclovir, ganciclovir, idoxuridine, inosine pranobex, lamivudine, MADU, penciclovir, sorivudine, stavudine, tenofovir, trifluridine, valacyclovir, valganciclovir, vidarabine, zalcitabine, and zidovudine), sialic acid analogs (such as oseltamivir and zanamivir), acemannan, acetylleucine monoethanolamine, amantadine, amidinomycin, ateviridine, capravirine, delavirdine, n-docosanol, efavirenz, foscarnet sodium, interferon-α, interferon-β, interferon-γ, kethoxal, lysozyme, methisazone, moroxydine, nevirapine, pentafuside, pleconaril, podophyllotoxin, ribavirin, rimantidine, stallimycin, statolon, termacamra, and traomantadine. Other appropriate antiviral agents are discussed in Remington: supra, at Chapter 87: Anti-Infectives, pp. 1507-1561, particularly pp. 1555-1560. Preferred antiviral therapeutics for inclusion in the pharmaceutical compositions of the present invention include adefovir, dipivoxil, entecovir, lamivudine and ribavirin.

In some embodiments it may be desirable to include in the pharmaceutical compositions of the invention at least one component which primes B-Lymphocytes or T lymphocytes. Lipids have been identified as agents capable of priming CTL in vivo. For example, palmitic acid residues can be attached to the ε- and α-amino groups of a lysine residue and then linked, e.g., via one or more linking residues such as Gly, Gly-Gly-, Ser, Ser-Ser, or the like, to an immunogenic peptide. The lipidated peptide can then be administered either directly in a micelle or particle, incorporated into a liposome, or emulsified in an adjuvant, e.g., incomplete Freund's adjuvant. In a preferred embodiment, a particularly effective immunogenic composition comprises palmitic acid attached to s- and α-amino groups of Lys, which is attached via linkage, e.g., Ser-Ser, to the amino terminus of the immunogenic peptide.

As another example of lipid priming of CTL responses, E. coli lipoproteins, such as tripalmitoyl-S-glycerylcysteinlyseryl-serine (P3CSS) can be used to prime virus specific CTL when covalently attached to an appropriate peptide (see, e.g., Deres, et al., Nature 342:561 (1989)). Chimeric antigens of the invention can be coupled to P3CSS, for example, and the lipopeptide administered to an individual to specifically prime an immune response to the target antigen.

While the compositions of the present invention should not require the use of adjuvants, adjuvant can be used. Various adjuvants may be used to increase the immunological response, depending on the host species, and including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, detergents, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, immunostimulatory polynucleotide sequences, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and corynebacterium parvum. Additional adjuvants are also well known in the art.

F. Methods of Using Chimeric Antigens

Another aspect of the invention provides methods of enhancing antigen presentation in antigen presenting cells, said method comprising administering, to the antigen presenting cells, a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. In a preferred embodiment, the antigen presenting cells are dendritic cells.

An aspect of the invention relates to methods of activating antigen presenting cells comprising contacting the antigen presenting cell with a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. In a preferred embodiment, the antigen presenting cell is contacted with the chimeric antigen in vivo. In another preferred embodiment, the contacting takes place in a human.

Yet another aspect of the invention provides methods of eliciting an immune response, said method comprising administering to an animal a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. The immune response can be a humoral and/or cellular immune response. In a preferred embodiment, the cellular immune response is both a Th1 and a Th2 response.

Another aspect of the invention provides methods of treating immune-treatable conditions comprising administering, to an animal in need thereof, a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. Preferably, the immune-treatable condition is a viral infection or cancer. More preferably, the immune-treatable condition is a chronic viral infection. Most preferably, the immune-treatable condition is a chronic hepatitis B viral infection or a chronic hepatitis C viral infection. For the treatment of HBV, preferably the immune response domain comprises a protein selected from the group consisting of a HBV Core protein, a HBV S protein, a HBV S1 protein, a HBV S2 protein, and combinations thereof. For the treatment of HCV, preferably the immune response domain comprises a protein selected from the group consisting of a HCV Core (1-191) protein, a HCV Core (1-177) protein, a HCV E1 protein, a HCV E2 protein, a HCV E1-E2 protein, a HCV NS3A protein, a HCV NS5A protein, and combinations thereof.

Another aspect of the invention provides methods of vaccinating an animal against a viral infection comprising administering to the animal a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. The method of the invention can prophylactically or therapeutically vaccinate the animal against the viral infection.

The present invention also comprises methods of using the compositions of the present invention to bind and activate antigen presenting cells, such as dendritic cells. The present invention also comprises methods of using the compositions of the present invention to activate T cells. The present invention also comprises a method of delivering an antigen to an immune system cell, such as an antigen presenting cell. The present invention also comprises compositions and methods for activating a humoral and/or cellular immune response in an animal or human, said method comprising administering one or more chimeric antigens of the present invention.

Following cloning and expression, the chimeric antigen is evaluated for its efficacy in generating an immune response. Evaluation involves presenting the chimeric antigen to dendritic cells ex vivo or in vivo. The dendritic cells are presented to T-lymphocytes and evaluated for the production of interferon-γ as a marker of T cell response. Specifically, in the ex vivo situation, naive dendritic cells are isolated from peripheral blood. Dendritic cells process and present antigen to naive T-lymphocytes. The chimeric antigen is then presented to naive dendritic cells for processing. These stimulated dendritic cells are in turn presented to a naive T cells, which cause their activation into effector cells, e.g. helper T cells or cytotoxic T-lymphocytes. Activation of the T cells by the dendritic cells is then evaluated by measuring markers, e.g. interferon-γ levels, by a known procedure (Berlyn, et al., Clin. Immunol 101(3):276-283 (2001)). An increase in the percentage of T cells that secrete interferon-γ by at least 50% over background predicts efficacy in vivo. In preferred embodiments, the percentage increase is at least 55%, 60%, 65%, 70%, 75%, 80%, 90% or 100%. In the case of the in vivo situation, the chimeric antigen is directly introduced parenterally in the host, where available dendritic and other antigen-processing cells have the capacity to interact with all antigens and process them accordingly.

G. Combination Therapy

Another aspect of the invention provides compositions for treating viral infections comprising a chimeric antigen and an antiviral agent. The invention also provides methods of treating viral infections comprising administering a chimeric antigen and an antiviral agent, either concurrently or sequentially.

Chimeric antigens have been shown to induce specific anti-HBV S1/S2 cytotoxic T cell functions ex vivo, to induce anti-HBV S1/S2 humoral responses in mice, and transiently reduce the viral load in ducks infected with the hepatitis B duck virus (DHBV). The use of a chimeric antigen in combination with an antiviral agent, such as a nucleoside analogue, may prove to be highly efficacious in inducing sustained responses in the treatment of subjects suffering from chronic hepatitis B. The mechanisms of action of the two agents used in combination may produce synergistic effects in treatment of hepatitis B subjects. While not being limited to a particular therapy, a nucleoside analogue, for example, would reduce the number of viral particles circulating in the blood and hence reduce the antigenic load that the immune system must eliminate, and the chimeric antigen would induce a highly specific cellular immune response that would eliminate cells that harbor virus, viral antigens and viral DNA/RNA. In addition, the chimeric antigen would induce a humoral immune response that would neutralize and remove circulating viral particles. Furthermore, the immune mechanism of action of the chimeric antigen could also minimize the toxicity of antiviral agents by permitting lower doses of the antiviral agent to be administered over a shorter period of time. A reduction in the length of time to achieve a sustained response may reduce the chances of development of drug-resistant viral mutants normally induced by antiviral agents, especially nucleoside analogue antiviral agents, when used alone in long-term therapy.

In brief, combination therapy with the hepatitis B chimeric antigen (e.g. S1/S2-TBD) and a nucleoside analogue in the treatment of hepatitis B has the potential to effect a complete cure of chronic HBV infection. Likewise, a combination of an HCV antiviral such as ribavirin along with the HCV chimeric antigens described herein will produce antigen-specific cellular as well as humoral immune response and thus clear HCV infection in chronically infected subjects.

H. Methods of Preparation

One aspect of the invention provides methods for producing a chimeric antigen comprising (a) providing a microorganism or cell line, preferably a eukaryotic, more preferably, a non-mammalian microorganism or cell line, that comprises a polynucleotide encoding a chimeric antigen; and (b) culturing said microorganism or cell line under conditions whereby the chimeric antigen is expressed. Preferably, the microorganism or cell line is a yeast, a plant cell line or an insect cell line. More preferably, the cell line is an insect cell line selected from the group consisting of Sf9, Sf21, Drosophila S2, and High Five™.

The present invention uses established recombinant DNA technology for producing the fusion proteins of selected antigen(s) and the TBD that are necessary in the practice of the invention. Fusion protein constructs are generated at the DNA level incorporating specific restriction enzyme sites, which are exploited in incorporating the desired DNA fragment into expression vectors, and used to express the desired fusion proteins in a heterologous expression system. As used herein, the term “vector” denotes plasmids that are capable of carrying the DNA, which encode the desired protein(s). The plasmid vectors used in the present invention include, but are not limited to, pFastBac HTa and the corresponding recombinant “BACMIDS” generated in DH10Bac™ E. coli (Invitrogen). It is possible to mobilize the ORF of the desired proteins and produce other recombinant plasmids for expression of the proteins in other systems, (bacterial or mammalian), in addition to the Bac-To-Bac™ baculovirus expression system (Invitrogen), employed in the present invention. The term “expression” is used to mean the transcription of the DNA sequence into mRNA, the translation of the mRNA transcript into the fusion protein.

This is achieved by the transposition of the gene of interest into the bacmids, transfected into Sf9 insect cells and recombinant baculovirus produced. These are used to infect Sf9 or High Five™ insect cells, which produce the protein of interest. All the recombinant proteins produced have an N-terminal 6×His tag, which is exploited in the purification of the proteins by using Ni-NTA Agarose (Qiagen). The proteins also have an N-terminal rTEV protease cleavage site cloned in. The Ni-purified protein is subjected to digestion with rTEV protease (Invitrogen), which also has an N-terminal 6×His tag. Following the protease digestion, the mixture can be loaded on to a Ni-NTA agarose column and the pure protein can be eluted out, while the 6×His tagged fragments will be bound to the column. This method of purification is standard procedure and one skilled in the art would be able to understand the methodology without further explanation.

Cloning and expression of the DNA sequences which encode the viral antigen and the Fc fragment of the murine monoclonal antibody to generate the chimeric antigen can be achieved through two approaches. The first approach involves cloning the two proteins as a fusion protein, while the second approach involves incorporating specific “bio-linkers” such as biotin or streptavidin in either of the molecules, purifying them separately and generating the chimeric antigen.

In an exemplary embodiment, a monoclonal antibody (2C12) was generated against the Hepatitis B virus surface antigen, and the hybridoma, which produced this monoclonal antibody, was used to isolate the total RNA for the murine immunoglobulin G. Total RNA was isolated and used to clone the murine Fc fragment. Specifically, the total RNA from a hybridoma cell that expresses murine IgG is isolated using Trizol® reagent (Invitrogen/Gibco BRL, product catalog number 10551-018, 10298-016; a monophasic solution of phenol and guanidine isothiocyante, as described in U.S. Pat. No. 5,346,994). The mRNA was purified from total RNA by affinity chromatography on an oligo-dT column (Invitrogen/Gibco BRL, product catalog number 15939-010). A complementary DNA (cDNA) was produced using reverse transcriptase in a polymerase chain reaction. The oligonucleotide primers were designed to add unique restriction enzyme recognition sites to facilitate cloning. This cDNA was cloned using the Bac-To-Bac™ baculovirus expression system (Invitrogen/Gibco BRL, product catalog number 15939-010).

The baculovirus system, preferentially, is used because not only are large amounts of heterologous proteins are produced, but also because post-translational modifications, such as phosphorylation and glycosylation, of eukaryotic proteins occur within the infected insect cell. In this expression system, the DNA can be cloned into vectors called pFastBac™ as illustrated schematically in FIG. 4 (Invitrogen/Gibco BRL, product catalog number 15939-010). In the Bac-To-Bac™ system, the generation of recombinants is based on site-specific transposition with the bacterial transposon Tn7. The gene of interest is cloned into pFastBac™, which has mini-Tn7 elements flanking the cloning sites. The plasmid is transformed into Escherichia coli strain DH10Bac™ (Invitrogen/Gibco BRL, product catalog number 10361-012), which has a baculovirus shuttle plasmid (bacmid) containing the attachment site of Tn7 within a LacZ gene. Transposition disrupts the LacZ gene so that only recombinants produce white colonies and are easily selected for. The advantage of using transposition in E. coli is that single colonies contain only recombinants so that plaque purification and screening are not required. The recombinant bacmids are transfected in insect cells to generate baculoviruses that express recombinant proteins.

The Bac-To-Bac™ baculovirus expression system is commercially available from Invitrogen and the procedures used were as described in the company protocols, available, for example, at www.invitrogen.com. The gene of interest is cloned into pFastBac HTa donor plasmid and the production of recombinant proteins is based upon the Bac-To-Bac™ baculovirus expression system (Invitrogen).

In the next step, the pFastBac HTa donor plasmid containing the gene of interest is used in a site-specific transposition in order to transfer the cloned gene into a baculovirus shuttle vector (bacmid). This is accomplished in E. coli strain DH10Bac™. The DH10Bac™ cells contain the bacmid, which confers kanamycin resistance and a helper plasmid, which encodes the transposase and confers resistance to tetracycline. The recombinant pFastBac HTa plasmids with the gene of interest are transformed into DH10Bac™ cells for the transposition to generate recombinant bacmids. A 100 μl aliquot of competent DH10Bac™ cells is thawed on ice, the pFastBac HTa based plasmids are added and the mixture is incubated on ice for 30 minutes. The mixture is given a heat shock for 45 seconds at 42° C. and then chilled on ice for 2 minutes. The mixture is then added to 900 μL of LB media and incubated for 4 hours at 37° C. The transformed cells are serially diluted with LB to 10−1 and 10−2 and 100 μl of each dilution is plated on Luria broth (LB) agar plates (supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml X-gal, and 40 μg/ml IPTG) and incubated for at least 36 hours at 37° C. The gentamicin resistance is conferred by the pFastBac HTa and the X-gal and IPTG are used to differentiate between white colonies (recombinant bacmids) from blue colonies (non recombinant). The white colonies are picked and inoculated into 2 ml of LB (supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin and 10 μg/ml tetracycline) and incubated overnight at 37° C., with shaking. A sterile loop is used to sample a small amount of the overnight culture and the sample is streaked onto a fresh LB agar plate (supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml X-gal, and 40 μg/ml isopropylthio-β-D-galactoside (IPTG)) and incubated for at least 36 hours at 37° C. to confirm a white phenotype.

Recombinant bacmids were isolated by standard protocols (Sambrook, supra); the DNA sample was dissolved in 40 μl of TE (10 mM Tris-HCl pH 8, 1 mM EDTA (ethylenediaminetetraacetic acid)) and used for transfections.

In order to produce baculoviruses, the bacmid is transfected into Sf9 insect cells. Sf9 cells (9×105) were seeded into each well of a 6-well cell culture dish (35 mm wells) in 2 ml of ESF 921 (Expression Systems) and allowed to attach for at least 1 hour at 27° C. Transfections were carried out using Cellfectin® Reagent (Invitrogen, Cat. No. 10362-010; a 1:1.5 (M/M) liposome formulation of the cationic lipid N,NI,NII, NIII-Tetramethyl-N,NI, NII, NIII-tetrapalmitylspermine and dioleoyl phosphatidylethanolammine in membrane filtered water) as per the protocols provided by the supplier of the Sf9 cells. Following transfection, the cells were incubated at 27° C. for 72 hours. The medium containing baculovirus was collected and stored at 4° C. in the dark.

The efficiency of the transfection was verified by checking for production of baculoviral DNA. The isolated baculovirus DNA is subjected to PCR to screen for the inserted gene of interest. The primers used are pFastBac HTa 5′ (sense) TATTCCGGATTATTCATACCG (SEQ ID NO: 3) and pFastBac HTa 3′ (antisense) 5′ CTCTACAAATGTGGTATGGC (SEQ ID NO: 4). Amplified products were separated on an agarose gel (0.8%). The expression of the heterologous protein in the cells was verified by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and Western blots using the 6×His tag monoclonal antibody (Clontech) as the probe.

Once production of baculovirus and the expression of protein have been confirmed, the virus stock is amplified to produce a concentrated stock of the baculovirus that carry the gene of interest. It is standard practice in the art to amplify the baculovirus at least two times, and in all protocols described herein this standard practice was adhered to. After the second round of amplification, the concentration of the generated baculovirus was quantified using a plaque assay according to the protocols described by the manufacturer of the kit (Invitrogen). The most appropriate concentration of the virus to infect insect cells and the optimum time point for the production of the desired protein was also established.

The DNA encoding proteins of interest are generated by PCR with oligonucleotide primers bearing unique restriction enzyme sites from plasmids that contain a copy of the entire viral genome and cloned with the Fc DNA as a fusion protein. This chimeric protein is purified by protein A or G affinity chromatography using techniques known to those skilled in the art.

The second approach for linking the IRD and TBD involves incorporating specific “bio-linkers” such as biotin or streptavidin in either of the molecules, purifying them separately and generating the chimeric antigen. The viral antigens of interest are cloned into plasmids that control the expression of proteins by the bacteriophage T7 promoter. The recombinant plasmid is then transformed into an E. coli strain, e.g. BL21(DE3) Codon Plus™ RIL cells (Stratagene, product catalog number 230245), which has production of T7 RNA polymerase regulated by the lac repressor. The T7 RNA polymerase is highly specific for T7 promoters and is much more processive (˜8 fold faster) than the E. coli host's RNA polymerase. When production of T7 RNA polymerase is induced by isopropylthio-β-D-galactoside (IPTG), the specificity and processivity of T7 RNA polymerase results in a high level of transcription of genes under control of the T7 promoter. In order to couple two proteins together, the tight binding between biotin and streptavidin is exploited. In E. coli, the BirA enzyme catalyzes the covalent linkage of biotin to a defined lysine residue in a specific recognition sequence. The murine Fc fragment is expressed in the baculovirus system, as described above, as a fusion protein with streptavidin. These two proteins can be mixed to form a dimeric protein complex by biotin-streptavidin binding.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See e.g., Sambrook, supra; and Ausubel, supra.

I. Article of Manufacture

Another aspect of this invention provides an article of manufacture that comprises a container holding a composition, comprising a chimeric antigen, that is suitable for injection or reconstitution for injection in combination with printed labeling instructions providing a discussion of how to administer the composition parenterally, e.g. subcutaneously, intramuscularly, intradermally, nasally or intravascularly. The composition will be contained in any suitable container that will not significantly interact with the composition and will be labeled with the appropriate labeling that indicates it will be for parenteral use. Associated with the container will be the labeling instructions consistent with the method of treatment as described hereinbefore. The container that holds the composition of this invention may be a container having a liquid composition suitable for injection that has an appropriate needle for injection and a syringe so that the patient, doctor, nurse, or other practitioner can administer the chimeric antigen. Alternatively, the composition may be a dry or concentrated composition containing a soluble version of the chimeric antigen, to be combined or diluted with an aqueous or nonaqueous vehicle to dissolve or suspend the composition. Alternatively, the container may have a suspension in a liquid or may be an insoluble version of the salt for combination with a vehicle in which the insoluble version will be suspended. Appropriate containers are discussed in Remington, supra, pages 788-789, 805, 850-851 and 1005-1014

The kit of the invention will typically comprise the container described above and one or more other containers comprising materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for use. A label can be present on the container to indicate that the composition is used for a specific therapy or non-therapeutic application, and can also indicate directions for either in vivo or ex vivo use, such as those described above. Directions and or other information can also be included on an insert which is included with the kit

V. EXAMPLES

The following non-limiting examples provide further illustration of the invention.

Example 1

Construction of Murine TBD Protein Expression Vector

The mouse IgG1 DNA sequences encoding amino acids of a portion of CH1-Hinge-CH2-CH3 region was generated from mRNA isolated from the hybridoma (2C12), which produces mAb against HBV surface antigen (sAg). Total RNA was isolated from 2C12 using Trizol® reagent (Gibco BRL cat. No. 15596-026) and the DNA of the TBD was generated by RT-PCR using Superscript First-strand Synthesis (Invitrogen Cat. No. 11904-018). The PCR primers contained linker sequences encoding the linker peptide—SRPQGGGS—(SEQ ID NO: 28) at the 5′ terminus, a unique Not I site at the 5′ and a unique Hind III restriction site at the 3′ end. The resulting cDNA contains (5′ Not I)-linker sequence-Ch1 (VDKKI)-CH2-CH3-(3′ Hind III). Following digestion with the respective enzymes, the fragment is ligated with pFastBac HTa expression vector plasmid (Invitrogen) using the same restriction enzyme sites. The 5′ primer used for PCR amplification was (Sense) 5′ TGTCATTCTGCGGCCGCAAGGCGGCGGATCCGTGGACAAGAAAATTGTGCCC AGG (SEQ ID NO: 1) and the 3′ primer was (antisense) 5′ ACGAATCAAGCTTTGCAGCCCAGGAGAGTGGGAGAG (SEQ ID NO: 2), which contained the Not I and Hind III sites, respectively. The following protocol was used for directional cloning. The generated fragment was digested with the respective enzymes, purified on agarose gel and cloned into the vector plasmid. The DNA sequence and the correctness of the ORF were verified by standard sequencing methods.

Following the cloning of the gene of interest (e.g. TBD) into the pFastBac HTa donor plasmid, the production of recombinant proteins was based upon the Bac-To-Bac™ baculovirus expression system (Invitrogen). The next step was site-specific transposition of the cloned gene into a baculovirus shuttle vector (Bacmid). This was accomplished in a strain of E. coli called DH10Bac™. The DH10Bac™ cells contain the bacmid, which confers kanamycin resistance and a helper plasmid, which encodes the transposase and confers resistance to tetracycline. The recombinant pFastBac HTa plasmids with the gene of interest (TBD) were transformed into DH10Bac™ cells for the transposition to generate recombinant bacmids. A 100 μl aliquot of competent DH10Bac™ cells was thawed on ice, the pFastBac HTa based plasmids were added and the mixture was incubated on ice for 30 minutes. The mixture was given a heat shock for 45 seconds at 42° C. and then chilled on ice for 2 minutes. The mixture was then added to 900 μL of LB media and incubated for 4 hours at 37° C. The transformed cells were serially diluted with LB to 10−1 and 10−2 and 100 μl of each dilution was plated on LB agar plates supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml X-gal, and 40 μg/ml IPTG and incubated for at least 36 hours at 37° C. The gentamicin resistance was conferred by the pFastBac HTa and the X-gal and IPTG were used to differentiate between white colonies (recombinant bacmids) from blue colonies (non recombinant). The white colonies were picked and inoculated into 2 ml of LB supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin and 10 μg/ml tetracycline and incubated overnight at 37° C., with shaking. A sterile loop was used to sample a small amount of the overnight culture and the sample was streaked onto a fresh LB agar plate supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml X-gal, and 40 μg/ml IPTG and incubated for at least 36 hours at 37° C. to confirm a white phenotype.

Recombinant bacmids were isolated by standard protocols (Sambrook, supra). The DNA sample was dissolved in 40 μl of TE (10 mM Tris-HCl pH 8, 1 mM EDTA) and used for transfections.

In order to produce baculoviruses, the bacmid was transfected into Sf9 insect cells. Sf9 cells (9×105) were seeded into each well of a 6-well cell culture dish (35 mm wells) in 2 ml of ESF 921 (Expression Systems) and allowed to attach for at least 1 hour at 27° C. Transfections were carried out using Cellfectin® Reagent (Invitrogen, Cat. No. 10362-010) as per the protocols provided by the supplier of the Sf9 cells. Following transfection, the cells were incubated at 27° C. for 72 hours. The medium containing baculovirus was collected and stored at 4° C. in the dark.

The efficiency of the transfection was verified by checking for production of baculoviral DNA. The isolated baculovirus DNA was subjected to PCR to screen for the inserted gene of interest (TBD). The primers used are pFastBac HTa 5′ (sense) TATTCCGGATTATTCATACCG (SEQ ID NO: 3) and pFastBac HTa 3′ (antisense) 5′ CTCTACAAATGTGGTATGGC (SEQ ID NO: 4). Amplified products were visualized on an agarose gel (0.8%). The expression of the heterologous protein in the cells was verified by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and Western blots using the 6×His tag monoclonal antibody (Clonetech) as the probe.

Once production of baculovirus and the expression of protein had been confirmed, the virus production was amplified to produce a concentrated stock of the baculovirus that carry the gene of interest (e.g. TBD). It is standard practice in the art to amplify the baculovirus at least two times, and in all protocols described herein this standard practice was adhered to. After the second round of amplification, the concentration of the generated baculovirus was quantified using a plaque assay according to the protocols described by the manufacturer of the kit (Invitrogen). The most appropriate concentration of the virus to infect Sf9 and High Five™ cells and the optimum time point for the production of the desired protein was established as well.

Example 2

Construction of HBV Surface Antigen S1/S2 and HBV S1/S2-TBD Fusion Protein Expression Vectors

The DNA encoding the HBV sAg fragment S1/S2 was generated from the plasmid pRSetB HBV S1/S2 template using PCR methodology. The primers used were: (sense) 5′ GGATCTGTACGACGATGACG (SEQ ID NO: 5) and the 3′ primer (antisense) 5′ AGTCATTCTGCGGCCGCGAGTTCGTCACAGGGTCCCCGG (SEQ ID NO: 6) containing the restriction enzyme site Not I. The 5′ end contained a unique Bam HI site derived from the parent plasmid that was used for ligations. Amplified DNA was digested with Bam HI/Not I and ligated with pFastBac HTa expression vector to generate the expression plasmid for HBV S1/S2 protein. The fragment was ligated with the plasmid pFastBac HTa-TBD (described in example 1) following the digestion with the respective enzymes. This produced the expression plasmid pFastBac HTa HBV S 1/S2-TBD. This plasmid was used to produce recombinant baculovirus (described in example 1), which expressed the chimeric antigen-TBD fusion protein: 6×His tag-rTEV protease cleavage site-HBV S1/S2-TBD (See FIGS. 7-9).

Example 3

Construction of HBV Surface Antigen S1/S2/S and HBV S1/S2/S-TBD Fusion Protein Expression Vectors

The DNA encoding the HBV sAg fragment S 1/S2/S was generated from the plasmid pAlt HBV 991 (University of Alberta) template using PCR methodology. The 5′ primer used for the PCR was (sense) 5′ GATAAGGATCCTATGGGAGGTTGGTCATCAAAAC (SEQ ID NO: 7), containing the restriction enzyme Bam HI site. The PCR primer for 3′ terminus was (antisense) 5′ GTCATACTGCGGCCGCGAAATGTATACCCAGAGACAAAAG (SEQ ID NO: 8), containing the restriction enzyme Not I site. Amplified DNA was digested with the respective enzymes and ligated with pFastBac HTa expression vector to generate either the expression plasmid for HBV S1/S2/S or the expression plasmid pFastBac HTa HBV S1/S2/S-TBD for the fusion protein (see FIGS. 10-11).

Example 4

Construction of HBV Core Antigen and HBV Core-TBD Fusion Protein Expression Vectors

HBV produces the Core proteins (Core) to encapsidate the replicating genome of the virus. There are two forms of the Core one secreted into circulation, also known as the “e” antigen and the capsid forming Core protein. The present invention also relates to the generation of expression plasmids to produce the Core protein as well as the Core antigen-TBD fusion protein, in insect cells. The DNA encoding the HBV Core protein was generated from the plasmid pAlt HBV 991 template using PCR technique. The 5′ primer used for the PCR was (sense) 5′ TGCGCTACCATGGACATTGACCCTTATAAAG (SEQ ID NO: 9), which contains the restriction enzyme Nco I site and the 3′ primer used was (antisense) 5′ TGTCATTCTGCGGCCGCGAACATTGAGATTCCCGAGATTGAG (SEQ ID NO: 10), containing the restriction enzyme Not I site. The PCR-amplified DNA was digested with the respective enzymes and ligated with pFastBac HTa expression vector to generate either the expression plasmid for HBV Core protein or the expression plasmid pFastBac HTa HBV Core-TBD for the fusion protein (see FIGS. 13-14).

Example 5

Construction of DHBV Surface Antigen Fragment PreS and DHBV PreS-TBD Fusion Protein Expression Vectors

DHBV has served as a powerful animal model in the development of antiviral therapy for HBV. Pekin ducks, congenitally infected with DHBV have been used to study the mechanism of replication of the virus and for the screening of antiviral compounds. The present invention also describes the chimeric DHBV antigen-TBD molecules that could be used as therapeutic vaccines in DHBV-infected ducks, thus providing a viable animal model for the feasibility studies for HBV therapeutic vaccines.

The DNA encoding DHBV PreS antigen was produced by PCR from a plasmid pFastBac Hta-DHBV PreS/S (University of Alberta). The 5′ primer used for the PCR was (sense) 5′ TATTCCGGATTATTCATACCG (SEQ ID NO: 11). The unique restriction enzyme site EcoRI, resident on the parent plasmid was used for directional cloning. The 3′ primer used was (antisense) 5′ TGTCATTCTGCGGCCGCGTTTTCTTCTTCAAGGGGGGAGT (SEQ ID NO: 12), containing the restriction enzyme Not I site. Following PCR amplification, the fragment was digested with the restriction enzymes EcoRI and Not I and the DNA fragment was purified on a 1% agarose gel. The fragment was ligated with the expression plasmid pFastBac HTa at the respective sites to produce pFastBac HTa DHBV PreS, which expressed the PreS antigen. The same fragment was also used to ligate with pFastBac HTa-TBD to generate the expression plasmid pFastBac HTa DHBV PreS-TBD. The production of baculovirus stocks from these plasmids and the expression of the PreS and PreS-TBD in High Five™ insect cells were done as described in example 1.

Example 6

Construction of DHBV Surface Antigen Fragment PreS/S and DHBV PreS/S-TBD Fusion Protein Expression Vectors

DHBV PreS/S DNA was produced by PCR methods using 5′ primer (sense) 5′ TATTCCGGATTATTCATACCG (SEQ ID NO: 11) and the 3′ primer (antisense) 5′ TGTCATTCAGCGGCCGCGAACTCTTGTAAAAAAGAGCAGA (SEQ ID NO: 13), containing restriction enzyme Not I site. The unique restriction enzyme site EcoRI, resident on the parent plasmid pFastBac HTa PreS/S (University of Alberta) was used for directional cloning. This plasmid also was the template for generating the required DNA by PCR. All other protocols for the production of either the DHBV PreS/S or the fusion protein PreS/S-TBD are the same as described in the example 5 above.

Example 7

Construction of DHBV Core Antigen and DHBV Core-TBD Fusion Protein Expression Vectors

The DNA coding for DHBV Core was generated from pRSet B DHBV Core by PCR using the following primers. The 5′ terminus primer used was (sense) 5′ TGCGCTACCATGGATATCAATGCTTCTAGAGCC (SEQ ID NO: 14), containing the restriction enzyme Nco I site. The 3′ terminus primer used was (antisense) 5′ TGTCATTCTGCGGCCGCGATTTCCTAGGCGAGGGAGATCTATG (SEQ ID NO: 15), containing the restriction enzyme Not I site. All other protocols for the production of either the DHBV Core or the fusion protein DHBV Core-TBD are the same as described in the example 5 above.

Example 8

Chemically Cross-Linked HBV sAg-Fc (Murine)

HBV sAg was cross linked using the bifunctional cross linking agent dimethyl suberimidate (DMS), a homobifunctional imidoester that reacts with amino groups on the proteins. The unreacted components were removed by gel filtration. The conjugate was characterized with respect to the stoichiometry of sAg/Fc in the conjugate and the fraction containing sAg:Fc at 1:1 ratio was chosen for antigen presentation assays using human monocyte-derived immature Dendritic cells (DCs). Immature DCs were cultured for four days with GM-CSF/IL4, incubated with the sAg-Fc conjugate and matured in the presence of TNFα/IFNα. Autologous CD3+ T cells were added to the mature DCs. Following three rounds of exposure to the mature DCs, T cell stimulation was quantitated by measuring the production of intracellular interferon-γ, using flow cytometry.

Materials:

HBV sAg (US Biologicals; Cat#H 1910-27)

Mouse Polyclonal IgG Fc fragment (Harlan Sera-Lab Ltd., Cat#PP-19-01)
DMS (Dimethyl suberimidate. 2HCl) (Pierce Cat #20700)

Cross-linking Buffer 0.1M HEPES pH 8.7

Stop Buffer 0.1 M Tris HCl pH 7.8

Elution Buffer Phosphate Buffered Saline (PBS) pH 8.3

Sephadex G 75 (Pharmacia)

Methods: Solutions of sAg (100 μg) and Mouse Fc fragment (100 μg), were dialyzed against the cross linking buffer overnight at 4° C. The protein solutions were mixed together, DMS reagent was added immediately to a final concentration of 10 mM, and the mixture was incubated at room temperature for 1 hr. The reaction was stopped by the addition of 0.1 M Tris HCl pH 7.8. The reaction mixture was loaded on a Sephadex G 75 column (0.7×12 cm), and fractions were eluted using elution buffer. 0.5 ml fractions were collected and the fractions containing sAg/Fc at a molar ratio of 1:1, as estimated by ELISA using the respective antibodies were pooled and used for Antigen Presentation Assays. (Berlyn, et al., supra (2001)).

Results: The levels of intracellular interferon-γ produced in T cells in the presence of conjugate was substantially higher than the sAg or the Fc fragment alone.

Example 9

Chimeric Antigens of Hepatitis C Virus (HCV)

HCV Core-TBD was cloned using the pFastBac HTa vector and the baculovirus system and expressed in Sf9 and High Five™ insect cells, similar to the HBV fusion proteins. This was done as follows. The DNA encoding the HCV Core fragment was generated from the plasmid pCV-H77c (NIH) template using PCR methodology.

The primers used were: (sense) 5′ CGGAATTCATGAGCACGAATCCTAAAC (SEQ ID NO: 16) containing the restriction enzyme site EcoRI and the 3′ primer (antisense) 5′ GGACTAGTCCGGCTGAAGCGGGCACAGTCAGGCAAGAG (SEQ ID NO: 17) containing the restriction enzyme site Spe I. Amplified DNA was digested with EcoRI/Spe I and the fragment was ligated into the plasmid pFastBac HTa TBD (described in example 1) following the digestion with the respective enzymes. This produced the expression plasmid pFastBac HTa HCV Core-TBD. This plasmid was used to produce recombinant baculovirus (described in example 1), which expressed the chimeric antigen (HCV Core-TBD) fusion protein 6×His tag-rTEV protease cleavage site-HCV Core-TBD.

HCV Core Protein was cloned as follows. Amplified DNA was digested with EcoRI/Spe I and ligated with plasmid pFastBac HTa expression vector to generate the expression plasmid for HCV Core protein. This protein is expressed with N-terminal 6×His tag and rTEV protease cleavage site.

The following HCV antigens and their respective chimeric antigens (antigen-TBD) have been cloned and are ready for expression.

E1 & E1-TBD:

E2 & E2-TBD

E1 E2 & E1 E2-TBD

NS5A & NS5A-TBD

Example 10

Cloning, Expression and Purification of Recombinant Proteins Using a Baculovirus Expression System

Bac-to-Bac™ Baculovirus Expresssion System is commercially available from Invitrogen and the procedures used were as described in the company protocols. The gene of interest was cloned into pFastBac HTa donor plasmid and the production of recombinant proteins was based upon the Bac-to-Bac™ baculovirus expression system (Invitrogen).

In the next step, the pFastBac HTa donor plasmid containing the gene of interest was used in a site-specific transposition in order to transfer the cloned gene into a baculovirus shuttle vector (bacmid). This was accomplished in E. coli strain DH10Bac™. The DH10Bac™ cells contain the bacmid, which conferred kanamycin resistance and a helper plasmid, which encoded the transposase and conferred resistance to tetracycline. The recombinant pFastBac HTa plasmids with the gene of interest were transformed into DH10Bac™ cells for the transposition to generate recombinant bacmids. A 100 μl aliquot of competent DH10Bac™ cells was thawed on ice, the pFastBac HTa based plasmids were added and the mixture was incubated on ice for 30 minutes. The mixture was given a heat shock for 45 seconds at 42° C. and then chilled on ice for 2 minutes. The mixture was then added to 900 μL of LB media and incubated for 4 hours at 37° C. The transformed cells were serially diluted with LB to 10−1 and 10−2 and 100 μl of each dilution was plated on Luria broth (LB) agar plates (supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml X-gal, and 40 μg/ml IPTG) and incubated for at least 36 hours at 37° C. The gentamicin resistance was conferred by the pFastBac HTa and the X-gal and IPTG were used to differentiate between white colonies (recombinant bacmids) from blue colonies (non recombinant). The white colonies were picked and inoculated into 2 ml of LB (supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin and 10 μg/ml tetracycline) and incubated overnight at 37° C., with shaking. A sterile loop was used to sample a small amount of the overnight culture and the sample was streaked onto a fresh LB agar plate (supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml X-gal, and 40 μg/ml IPTG) and incubated for at least 36 hours at 37° C. to confirm a white phenotype.

Recombinant bacmids were isolated by standard protocols (Sambrook, supra); the DNA sample was dissolved in 40 μl of TE (10 mM Tris-HCl pH 8, 1 mM EDTA) and used for transfections.

In order to produce baculoviruses, the bacmid was transfected into Sf9 insect cells. Sf9 cells (9×105) were seeded into each well of a 6-well cell culture dish (35 mm wells) in 2 ml of SFM 900 II and allowed to attach for at least 1 hour at 27° C. Transfections were carried out using Cellfectin® Reagent (Invitrogen, Cat. No. 10362-010) as per the protocols provided by the supplier of the Sf9 cells. Following transfection, the cells were incubated at 27° C. for 72 hours. The medium containing baculovirus was collected and stored at 4° C. in the dark.

The efficiency of the transfection was verified by checking for production of baculoviral DNA. The isolated baculovirus DNA is subjected to PCR to screen for the inserted gene of interest. The primers used are pFastBac HTa 5′ (sense) TATTCCGGATTATTCATACCG (SEQ ID NO: 3) and pFastBac HTa 3′ (antisense) 5′ CTCTACAAATGTGGTATGGC (SEQ ID NO: 4). Amplified products were separated on an agarose gel (0.8%). The expression of the heterologous protein in the cells was verified by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and Western blots using the 6×His tag monoclonal antibody (Clontech) as the probe.

Once production of baculovirus and the expression of protein were been confirmed, the virus stock was amplified to produce a concentrated stock of the baculovirus that carry the gene of interest. It is standard practice in the art to amplify the baculovirus at least two times, and in all protocols described herein this standard practice was adhered to. After the second round of amplification, the concentration of the generated baculovirus was quantified using a plaque assay according to the protocols described by the manufacturer of the kit (Invitrogen). The most appropriate concentration of the virus to infect insect cells and the optimum time point for the production of the desired protein was also established.

Example 11

Expression of the Recombinant Proteins

Recombinant baculovirus of standardized multiplicity of infection (MOI) were used to infect High Five™ insect cells. For suspension cultures, cells were seeded at a density of 3×105 cells/mL and incubated at 27.5° C. with shaking at 138 rpm until the cell density reached 2-3×106 cells/mL. Standardized amounts of the respective recombinant baculovirus was added to the cells. The incubation temperature was 27.5° C. and the appropriate infection period was standardized for individual protein expression. The cells were harvested by centrifugation at 2,500 rpm for 10 minutes at 4° C. and used for the purification of the recombinant proteins. Unused portions of cells were snap frozen in liquid nitrogen and stored at −70° C.

Example 12

Purification of Proteins

For purification under denaturing conditions, the cells were lysed in a buffer containing 6 M guanidinium-HCl in 100 mM NaH2PO4, 10 mM Tris, 300 mM NaCl, 10 mM Imidazole, pH 8.0 (lysis buffer). The suspension was sonicated on ice with 5 pulses of 1 minute per pulse at a power setting of 60 watts, and was mixed at room temperature for 1 hour. The lysate was centrifuged at 27,000×g for 30 min to remove unbroken cells and cell debris. The supernatant was loaded on to a Ni-NTA agarose (Qiagen) bead column (1×5 cm/100 mL cell lysate), pre-equilibrated with lysis buffer. Following loading, the column was washed with 20 column volumes of 6 M guanidinium-HCl in 100 mM NaH2PO4, 10 mM Tris, 300 mM NaCl, 40 mM Imidazole, pH 8.0 (wash buffer 1), followed by washes with 20 column volumes of 8 M urea in 100 mM NaH2PO4, 10 mM Tris, 300 mM NaCl, 40 mM imidazole, pH 8.0 (wash buffer 2). The bound protein was eluted with a buffer containing 8 M urea, 100 mM NaH2PO4, 10 mM Tris, 300 mM NaCl, 250 mM imidazole, pH 8 (Elution Buffer). The fractions containing the protein was pooled and dialyzed against PBS, (Overnight, 4° C.).

Examples 13-16

Use of Chimeric Antigens to Enhance Antigen Presentation by Human PBMC-Derived Dendritic Cells and to Elicit an Immune Response in T Lymphocytes

Example 13

Human PBMC Monocyte Isolation and Differentiation to DCs

Peripheral blood mononuclear cells (PBMC) were obtained from Ficoll/Histopaque (Sigma) treatment of a leukapheresis cell preparation (Berlyn, et al., supra (2001)). Monocytes were separated from the PBMC population by negative selection using a monocyte isolation kit (Dynal) following the manufacturer's directions. The monocytes were greater than 95% pure as assessed by antibody analysis and flow cytometry (CD3, CD19, CD16, CD11a+, CD14+). Monocytes were washed twice with AIM V (Invitrogen) media containing L-glutamine, streptomycin sulfate (50 μg/mL) and gentamicin sulfate (10 μg/mL) with 1% donor matched sera (isolated as described in Berlyn, et al., supra (2001)). Next, the monocytes were cultured in AIM V media containing 2.5% donor matched sera and the cytokines GM-CSF and IL-4 to differentiate the cells toward the dendritic cell (DC) lineage. The cells were incubated in 12-well tissue culture plates at 37° C. under a 7% CO2 atmosphere. The DCs were used for APAs and ligand binding and uptake studies.

The monocyte-derived DCs (mDC) were harvested on days 1 through 4. The cells were subsequently washed once with AIM V media with 0.1% BSA (Sigma), and twice with Dulbecco's phosphate buffered saline (Invitrogen) with 0.1% (w/v) BSA (PBSB). The mDC were used in 4° C. labeling or binding assays or in 37° C. binding/uptake assays.

Example 14

Human Dendritic Cell T Cell Stimulation Assay

Antigen presentation assays were performed using human PBMC-derived dendritic cells according to established protocols (Berlyn, et al., supra (2001)). Monocytes were generated from leukapheresis samples from healthy donors and were depleted of lymphocytes and granulocytes by incubation with anti-CD2, CD7, CD16, CD19, and CD56 antibodies. This was followed by incubation with magnetic bead conjugated anti-mouse IgG and separation on a magnet (Dynal). Negatively selected cells were greater than 95% pure monocytes as characterized by flow cytometry using a broad CD marker panel. Next, monocytes were incubated with IL-4 and GM-CSF (R&D Systems) for 4 days in AIM V plus 2.5% matched human serum to generate immature dendritic cells. Again, an aliquot of the cells was stained with a broad CD marker panel to ensure purity and identity of the cells. The cells then were loaded with various antigens for 2-4 hours at 37° C., and matured with interferon-α and TNF-α for 3 days. Dendritic cells were checked again using flow cytometry for an array of CD markers to ensure that cells had undergone proper maturation. The resulting mature, loaded dendritic cells were used for the T cell stimulation assay. A protocol summary for the T cell stimulation assay is presented in schematic form.

T cells were generated from the same monocytes as the dendritic cells by means of negative selection using a magnetic T cell isolation kit (Dynal) according to the manufacturer's directions. Mature, loaded dendritic cells (DC-1) were washed thoroughly and added to the T cells (Day 0). The T cells and dendritic cells were incubated for 7 days

On Day 7, the T cells were re-stimulated with matured, loaded dendritic cells (DC-2). An aliquot of the cells was taken 2 hours later (the Day 7 aliquot). The Day 7 aliquot was incubated with Brefeldin A (GolgiPlug™, R&D Systems) for 18 hours. The cells of the Day 7 aliquot were then assayed for intracellular cytokine staining as described below.

The remaining cells were incubated for another 7 days. On Day 14, the remaining cells were stimulated with another batch of mature, loaded dendritic cells (DC-3). An aliquot of the cells was taken 2 hours later (the Day 14 aliquot). The Day 14 aliquot was incubated with Brefeldin A (GolgiPlug™, R&D Systems) for 18 hours. The cells of the Day 14 aliquot were then assayed for intracellular cytokine staining as described below.

After removal of the D14 aliquot, the remaining cells were incubated for three days and the supernatant was used for measuring the level of secreted interferon-γ by ELISA (Opt E1A ELISA kit, BD Biosciences).

For intracellular cytokine staining, cells were stained with anti-CD3-FITC and anti-CD8-Cy-Chrome for 30 minutes, washed, fixed, permeabilized, and then stained with anti-interferon-γ-PE for 30 minutes on ice. The cells were washed and analyzed by flow cytometry (FACScan, BD Biosciences).

Example 15

Expression of Fc-γ Receptors and CD206 on Maturing DC

There are several receptors on the APCs that bind and take up antigens. The abundance of these receptors on maturing dendritic cells was evaluated using fluorescent labeled receptor-specific antibodies. FACS analysis was used to estimate percentage of specific receptor positive cells in the total population of dendritic cells. The degree of receptor expression was assessed by determination of the relative mean fluorescent intensity and as a function of relative fluorescent intensity (FIG. 30). The expression of CD64 decreased with time in culture and at day 4 was almost negligible. In contrast, CD32, and to a lesser extent CD16, continued to be expressed after 4 days of DC culture. On day 0 of culture, there was essentially no CD206 expression, but expression was induced upon culture with IL-4 and GM-CSF, and by day 4 CD206 was expressed at very high levels. Thus at day 4, when antigen was loaded in the antigen presentation assays, the DCs possessed at least two potential receptors for the binding of chimeric antigens: CD32 and CD206. In addition, as shown in FIG. 31, they had the full complement of the co-stimulatory molecules. The expression of HLA-DR (Class II) and HLA-ABC (Class I) also increased with time in culture. Co-stimulatory molecules CD86 (B7.2) and CD80 (B7.1) were expressed throughout the period of the assay (FIG. 31). These results indicate that the monocyte-derived DCs were differentiating towards mature DCs and were capable of antigen processing and presentation to T cells. The cells were used to evaluate the binding and uptake of the chimeric antigens in comparison to relevant antibodies.

Example 16

Phenotypic Analysis, Binding and Uptake Assay

For the phenotypic analysis and binding assay, all procedures using incubations were performed at 4° C.; buffer solutions were also held at 4° C. The binding of antigens, chimeric antigens or antibodies was determined by incubating the cells with various concentrations of the agents for 60 minutes in Dulbecco's phosphate buffered saline with 0.1% (u/v) BSA (PBSB).

For phenotypic analysis, cells were incubated with the various conjugated mAbs at the concentrations recommended by the manufacturer for 20 minutes. Incubations were performed with 1×105 cells/well in 96-well v-bottom plates in a volume of 25 μL/well. Subsequently, the cells were washed twice with PBSB.

For binding analysis, the cells were treated with F(ab′)2 goat anti-mouse Alexa-488 (10 μg/mL) in PBSB for 20 minutes. The cells were washed twice with PBSB and either resuspended in PBSB with 2% PF and acquired by FACS or in PBSB and incubated with PE-conjugated CD32 or CD206 specific mAb for 20 minutes before washing twice with PBSB.

To determine the extent of uptake of chimeric antigens (e.g. HBV S1/S2-TBD) compared with IgG1 and IgG2a, cells were incubated with various concentrations of the antigen, IgG1 (2C12, the parent mAb from which TBD was produced) or IgG2a (G155-178) for 1 hour at 37° C. in AIM V media with 0.1% BSA. Cells were washed twice in PBSB and fixed with PBS with 2% PF overnight at 4° C. Subsequently, the cells were washed twice in PBSB and permeabilized with PBS containing 0.1% (w/v) saponin (Sigma) for 40 minutes at 20° C.

The cells were washed twice with PBSB and incubated with F(ab′)2 goat anti-mouse Alexa-488 (10 μg/mL) in PBSB with 0.1% (w/v) saponin for 20 minutes at 4° C. After washing twice in PBSB, the cells were resuspended in PBSB. A variant of this assay involved treating the cells as above with chimeric antigen, IgG1, or IgG2a for 10 minutes followed by the addition of F(ab′)2 goat anti-mouse Alexa-488 (10 μg/mL) for 50 minutes. Subsequently the cells were washed and resuspended in PBS with 2% PF. This procedure relied on the ability of the anti-mouse Alexa-488 Ab to directly bind the S1/S2-TBD, IgG1 or IgG2a molecules.

Cells were acquired by a Becton Dickinson (BD) FACScan fitted with Cellquest acquisition and analysis software (BD). A gate was made on the viable cell population as determined by the FSC and SSC scatter profile and ≧10,000 events were acquired. To determine the percentage of positive cells, a gate was set based on negative control treated cells (isotype control labeled or cells labeled with F(ab′)2 goat anti-mouse Alexa-488 alone).

The percent of specific positive cells was calculated as:

%   positive   cells   test   sample - %   positive   cells   control 100 - %   positive   cells   of   control × 100

The relative mean fluorescent intensity (MFI) was determined as the MFI of the test sample minus the MFI of the control sample.

Example 17

Construction of pFastBac HTa-TBD, TBD Protein Expression Vector

The mouse IgG 1 DNA sequences encoding amino acids of CH1-Hinge-CH2-CH3 region was generated from mRNA isolated from the hybridoma (2C12), which produces mAb against HBV surface antigen (sAg). Total mRNA was isolated using Trizol® reagent (Gibco BRL cat. No. 15596-026) and the cDNA of the TBD was generated by RT-PCR using Superscript First-strand Synthesis (Invitrogen Cat. No. 11904-018). The PCR primers contained linker sequences encoding the linker peptide —SRPQGGGS— (SEQ ID NO: 28) at the 5′ terminus, a unique Not I site at the 5′-end and a unique Hind III restriction site at the 3′ end. The resulting cDNA contains (5′ Not I)-linker sequence-CH1 (VDKKI)-CH2-CH3-(3′ Hind III). Following digestion with the respective enzymes, the fragment is ligated with pFastBac HTa expression vector plasmid (Invitrogen) using the same restriction enzyme sites to generate pFastBac HTa-TBD. The 5′ primer used for PCR amplification was (Sense) 5′ TGTCATTCTGCGGCCGCAAGGCGGCGGATCCGTGGACAAGAAAATTGTG CCCAGG (SEQ ID NO: 1) and the 3′ primer was (antisense) 5′ ACGAATCAAGCTTTGCAGCCCAGGAGAGTGGGAGAG (SEQ ID NO: 2), which contained the Not I and Hind III sites, respectively. The following is the protocol used for directional cloning. The generated fragment was digested with the respective enzymes, purified on agarose gel and cloned into the vector plasmid. The DNA sequence and the correctness of the ORF were verified by standard sequencing methods. Nucleotide sequence of the ORF of TBD in the plasmid pFastBac HTa-TBD and the deduced amino acid sequences of the expressed TBD protein from the ORF are shown in FIG. 6.

Example 18

Expression and Purification of TBD Protein

Recombinant baculovirus of standardized multiplicity of infection (MOI) were used to infect High Five™ insect cells. For suspension cultures, cells were seeded at a density of 3×105 cells/mL and incubated at 27.5° C. with shaking at 138 rpm until the cell density reached 2−3×106 cells/mL. Recombinant baculovirus was added to the cells. For the expression of TBD the MOI used was 10 pfu/cell. The incubation at 27.5° C. was continued for 48 hrs. The cells were harvested by centrifugation at 2,500 rpm for 10 minutes at 4° C. and used for the purification of the recombinant proteins.

TBD protein was expressed in Express Five Insect cells, purified as described in Example 12. The protein was subjected to electrophoresis on a 12% polyacrylamide gel and the coomassie blue-stained band is shown.

Example 19

Construction of HBV Surface Antigen S1/S2 and HBV S1/S2-TBD Chimeric Fusion Protein Plasmids

The DNA encoding the HBV sAg fragment S1/S2 was generated from the plasmid pRSetB HBV S1/S2 template using PCR methodology. The primers used were: (sense) 5′ GGATCTGTACGACGATGACG (SEQ ID NO: 5) and the 3′ primer (antisense) 5′ AGTCATTCTGCGGCCGCGAGTTCGTCACAGGGTCCCCGG (SEQ ID NO: 6) containing the restriction enzyme site Not I. The 5′ end contained a unique Bam HI site derived from the parent plasmid that was used for ligations. Amplified DNA was digested with Bam HI/Not I and ligated with pFastBac HTa expression vector to generate the expression plasmid for HBV S1/S2 protein. The fragment was ligated with the plasmid pFastBac HTa-TBD (described in Example 1) following the digestion with the respective enzymes. This produced the expression plasmid pFastBac HTa HBV S1/S2-TBD. This plasmid was used to produce recombinant baculovirus (as described in Example 1), which expressed the chimeric antigen-TBD fusion protein: 6×His tag-rTEV protease cleavage site-HBV S1/S2-TBD. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa HBV S1/S2 are shown in FIG. 9. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa HBV S1/S2-TBD are shown in FIG. 8.

Example 20

Expression and Purification of HBV Surface Antigen S1/S2 and HBV S1/S2-TBD Chimeric Fusion Proteins

Recombinant bacmids of standardized multiplicity of infection (MOI) were used to infect High Five™ insect cells. For suspension cultures, cells were seeded at a density of 3×105 cells/mL and incubated at 27.5° C. with shaking at 138 rpm until the cell density reached 2−3×106 cells/mL. Recombinant baculovirus was added to the cells. For the expression of the fusion protein HBV S 1/S2-TBD, the MOI was 1 pfu/cell and for S1/S2, 2 pfu/cell was used. The incubation at 27.5° C. was continued for 48 hrs. The cells were harvested by centrifugation at 2,500 rpm for 10 minutes at 4° C. and used for the purification of the recombinant proteins.

Expression of S1/S2-TBD was performed in High Five™ cells (Trichoplusia ni BTI-Tn-5B1-4) grown in Express Five SFM media. The High Five™ cells were grown in a shaker culture at 27.5° C. until the cell density reached 2.5×106 cells/ml. Usually, a 250 ml culture is prepared. The culture was infected with HBV S1/S2-TBD baculovirus at a multiplicity of infection (MOI) of 1 pfu/cell and incubated at 27.5° C. for 48 hrs with shaking. Infected cells were harvested by centrifugation at 4000×g on a JA-10 (Beckman) rotor for 10 minutes. The cells were stored at −70° C. until purification were performed.

For purification, 40 ml of ice-cold lysis buffer (6M guanidine hydrochloride, 0.1 M NaH2PO4, 10 mM Tris, 500 mM NaCl, 10 mM imidazole, pH 8.0) was added to a frozen cell pellet. The cells were sonicated on ice for 5 pulses at 1 minute per pulse at 78-81 W and stirred at room temperature for 1 hour. The lysate was clarified by centrifugation at 27000×g on a JA-25.50 rotor (Beckman) for 30 min. Purification was performed on Ni-NTA Superflow. A 1.5×12 cm column was packed with 3 ml of Ni-NTA Superflow and equilibrated with 10 column volumes of lysis buffer. The clarified lysate was loaded onto the column. First, the column was washed with lysis buffer until the OD280 was <0.01. Next, the column was washed with 6M guanidine hydrochloride, 0.1 M NaH2PO4, 10 mM Tris, 500 mM NaCl, 40 mM imidazole, pH 8.0 until the OD280 is <0.01. Then the column was washed with 8 M urea, 0.1 M NaH2PO4, 10 mM Tris, 500 mM NaCl, 40 mM imidazole, pH 8.0 until the OD280 was <0.01. Elution was performed with 8M urea, 0.1 M NaH2PO4, 10 mM Tris, 500 mM NaCl, 250 mM imidazole, pH 8.0 and 0.5 ml fractions were collected. The fractions were analyzed by OD280 for protein. HBV S1/S2 and TBD protein fractions were dialyzed against 10 mM NaH2PO4, 0.3 M NaCl, pH 8.0.

S1/S2-TBD was dialyzed against 8M urea, 0.1 M NaH2PO4, 10 mM Tris, pH 8.0 with 3 changes and was subjected to further purification as follows. A 1 ml bed of DEAE Sepharose Fast Flow was equilibrated with 8M urea, 0.1 M NaH2PO4, 10 mM Tris, pH 8.0. The dialyzed S1/S2-TBD was added to the DEAE Sepharose Fast Flow and mixed together for 2 hours at room temperature. The mixture was centrifuged at 2500 rpm for 2 mM and the supernatant was collected.

Purified S1/S2-TBD was subjected to refolding. The DEAE purified S1/S2-TBD was reduced by adding 10 mM DTT and incubated for 30 minutes at room temperature. The reduced S1/S2-TBD was dialyzed against 4 M urea, 0.1 M NaH2PO4, 10 mM Tris, 150 mM NaCl, pH 8.0 at 4° C. for at least 6 hrs. The buffer was changed to 2M urea, 0.1 M NaH2PO4, 10 mM Tris, 150 mM NaCl, pH 8.0 and dialysis was continued at 4° C. After at least 6 hrs, the dialysis buffer was changed to 1 M urea, 0.1 M NaH2PO4, 10 mM Tris, 150 mM NaCl, 200 mM L-arginine, 0.5 mM oxidized glutathione (GSSG), pH 8.0 and dialysis was continued at 4° C. overnight. Following this, the buffer was changed to 0.5 M urea, 0.1 M NaH2PO4, 10 mM Tris, 150 mM NaCl, 200 mM L-arginine, 0.5 mM GSSG, pH 8.0 and dialysis was continued at 4° C. overnight. Finally, the sample was dialyzed against 10 mM NaH2PO4, 150 mM NaCl, pH 8.0 at 4° C. for at least 6 hrs. The last step was repeated 2 more times.

Example 21

Binding of Chimeric Antigens to Maturing DCs

The chimeric antigen S1/S2-TBD binds to maturing DCs with high efficiency (FIG. 32). The extent of binding of S1/S2-TBD relative to murine IgG1 and IgG2a to maturating DC was compared. DCs were isolated at various days of ex vivo culture (from day 0 to day 4) and treated with S1/S2-TBD (10 μg/mL) or with murine IgG1 (clone 2C12) or IgG2a (clone G155-178, 90 μg/mL) for 1 hour at 4° C. Subsequently, binding was detected with a F(ab′)2 anti-mouse IgG conjugated to Alexa 488 as described in Example 16. The binding of S1/S2-TBD relative to IgG1 and IgG2a on DC after 1 and 4 days of culture is shown in FIGS. 33 and 34. S1/S2-TBD binding was clearly much greater than the binding of either IgG1 or IgG2a with more S1/S2-TBD binding evident on day 1 than on day 4. These experiments clearly demonstrated that S1/S2-TBD was bound with high efficiency to the maturing DC.

Example 22

A High Proportion of Maturing DCs Bind Chimeric Antigen S1/S2-TBD

A large proportion of maturing DCs bind S1/S2-TBD. The binding of S1/S2-TBD in comparison to murine IgG2a and IgG1 was measured as a function of phenotypic changes on day 2 of the maturation of DCs as described in Example 16. DCs were isolated at various days of culture (from day 0 to day 4) and were treated with S1/S2-TBD (10 μg/mL), murine IgG1 (clone 2C12), or IgG2a (clone G155-178, 90 μg/rap for 1 hour at 4° C. Subsequently, binding was detected with a F(ab)2 anti-mouse IgG conjugated to Alexa 488. The binding of S1/S2-TBD relative to IgG1 and IgG2a on DC after 1 and 4 days of culture is shown in FIGS. 33 and 34. S1/S2-TBD binding was clearly much greater than the binding of either IgG1 or IgG2a with more S1/S2-TBD binding evident on day 1 than day 4. Thus, these experiments demonstrated that a large proportion of maturing DCs bind S1/S2-TBD The proportion of DCs that bind S1/S2-TBD was much greater than either IgG2a or IgG1. Furthermore, the degree of binding of S1/S2-TBD was several orders of magnitude greater than that of the immunoglobulins.

The chimeric Antigen S1/S2-TBD binds to DCs more efficiently than IgG1 or IgG2a on days 1 and 4 of culture.

Example 23

Chimeric Antigen S1/S2-TBD is Taken up by DCs with High Efficiency

The uptake of S1/S2-TBD in comparison to murine IgG1 and IgG2a was estimated as a function of concentration on day 4 of DC maturation. The uptake was quantified at 37° C. for 1 hour and the results are shown in FIG. 35.

There was a linear increase in the uptake of S1/S2-TBD with concentration. IgG 1 was taken up at a much lower level and there was very little uptake of IgG2a. Therefore, the chimeric antigen S1/S2-TBD is taken up by the DCs more efficiently than immunoglobulins.

Example 24

Correlation of CD32/CD206 Expression and S1/S2-TBD Binding to Maturing DCs

There is a direct correlation between the expression of CD32/CD206 receptors and S1/S2-TBD binding to maturing DCs. Since it was known that murine IgG1 binds to human CD32, it was expected that S1/S2-TBD, which contains the murine Fc component of IgG1, would also bind CD32. Furthermore, S1/S2-TBD by virtue of its high mannose glycosylation, would also be expected to bind to DC through the CD206 receptor.

The dot plots in FIG. 36 show S1/S2-TBD binding (10 μg/mL) and CD32 expression as well as S1/S2-TBD binding and CD206 expression. There was a direct correlation between the extent of S1/S2-TBD binding and the degree of CD32 expression, which was relatively heterogeneous, i.e., there was a broad degree of expression. These results demonstrate that S1/S2-TBD binds to CD32, and that the greater the expression of CD32, the greater was the degree of binding of the chimeric antigen S 1/S2-TBD. The dot plot of S 1/S2-TBD binding and CD206 expression shows that the vast majority of cells expressing CD206 also bound S 1/S2-TBD A small percentage of the cell population was CD206 negative and was consequently negative for S1/S2-TBD binding. Therefore both CD32 and CD206 receptors correlate with the binding of S1/S2-TBD.

Example 25

The Binding and Uptake of S1/S2-TBD is Primarily Via CD32 with CD206 Involved to a Lesser Extent

The uptake of S1/S2-TBD in comparison to murine IgG1 and IgG2a was estimated as a function of concentration on day 4 of DC maturation. The uptake was quantified at 37° C. for 1 hour in the presence and absence of inhibitors of CD32 and CD206 and the results are shown in FIG. 37. There was a progressive increase in the binding of the chimeric antigen with its concentration. Incubation of the cells with a high concentration of mouse Fcγ fragment abolished this binding, whereas mannan, an inhibitor of CD206 receptor binding, had only a marginal effect. Therefore, CD32 may be the primary receptor involved in the binding and uptake of the chimeric antigen.

Example 26

Glycosylated HBV S1/S2 Antigen Produced in Insect Cells Binds to DCs Through CD206 Receptors

The insect cell pathway of protein glycosylation is different from that of mammalian cells in that proteins synthesized in insect cells undergo glycosylation that results in high mannose content and a lack of terminal sialic acid residues in the secreted protein (Altman, et al., Glycoconjug 16:109-123 (1999)).

HBV S1/S2, the antigen component of the chimeric antigen was expressed in both E. coli (no glycosylation) and in High Five™ insect cells (high mannose glycosylation). These antigens were compared for their binding to DCs. Glycosylated protein showed better binding and uptake by DCs (FIG. 38).

Example 27

Chimeric Antigen S1/S2-TBD Elicited T Cell Responses as Measured by Interferon-γ Production

The T cell response was greater with S1/S2-TBD treatment than with either of its two components measured individually. DCs were loaded with S1/S2 antigen, TBD, or S1/S2-TBD and presented to T cells in an antigen presentation assay as described in example 14. T cell stimulation was evaluated by measuring intracellular and secreted interferon-γ levels. The results are presented in FIGS. 39 and 40. The chimeric antigen S 1/S2-TBD induced the production of higher interferon-γ levels compared to either the IRD or the TBD domain of the molecule when tested alone, at equivalent concentrations. It should be pointed out that 5 μg dose of S1/S2-TBD contains roughly 2.5 μg each of the components.

Example 28

Interferon-γ Production Following S1/S2-TBD Antigen Presentation by DCs

Interferon-γ production and secretion by CD3+ T cells increased in a concentration dependent manner following S 1/S2-TBD antigen presentation by DCs. Purified S1/S2-TBD was used in antigen presentation assays using human PBMC-derived DCs, and the secreted and intracellular interferon-γ levels were measured in T cells following three rounds of antigen presentation. FIG. 41 presents intracellular levels and FIG. 42 shows the secreted levels. The results are the mean of three estimates.

Various concentrations of S1/S2-TBD were tested for the T cell response. The effect of S1/S2-TBD was greater than the tetanus toxoid treatment at similar concentrations. At concentrations lower than 5 μg/mL, the chimeric antigen elicited a concentration dependent increase in the production and secretion of interferon-γ. The positive response at low concentrations would be beneficial with respect to the dose necessary for vaccination and the cost of manufacturing of a vaccine.

Example 29

Glycosylation of HBV S1/S2 Antigen Imparts Immunogenicity to the Antigen and Generates Higher T Cell Responses

Glycosylation of HBV S1/S2 elicits increased immunogenicity and T Cell responses. The insect cell pathway of protein glycosylation is different from that of mammalian cells in that proteins synthesized in insect cells undergo glycosylation that results in high mannose content and a lack of terminal sialic acid residues in the secreted protein (Altman, et al., supra).

HBV S1/S2, the antigen component of the chimeric antigen was expressed in both E. coli (no glycosylation) and in High Five™ insect cells (high mannose glycosylation). These antigens were compared for T cell responses when presented by DCs. Both intracellular and secreted interferon-γ levels were measured and the results are presented in FIGS. 43 and 44. HBV S 1/S2 expressed in insect cells generated a higher level of both intracellular and secreted interferon, as compared to the unglycosylated protein expressed in E-coli.

Example 30

Construction of HBV Core Antigen and HBV Core-TBD Fusion Protein Expression Vectors

HBV produces the Core proteins (Core) to encapsidate the replicating genome of the virus. There are two forms of the Core; one secreted into circulation, also known as the “e” antigen; and other is the capsid forming Core protein. The present invention also relates to the generation of expression plasmids to produce the Core protein as well as the Core antigen-TBD fusion protein in insect cells, similar to examples described in Example 19. The DNA encoding the HBV Core protein was generated from the plasmid pAlt HBV 991 template using PCR technique. The 5′ primer used for the PCR was (sense) 5′ TGCGCTACCATGGACATTGACCCTTATAAAG (SEQ ID NO: 9) that contains the restriction enzyme Nco I site and the 3′ primer used was (antisense) 5′ TGTCATTCTGCGGCCGCGAACATTGAGATTCCCGAGATTGAG (SEQ ID NO: 10), containing the restriction enzyme Not I site. The PCR-amplified cDNA was digested with the respective enzymes and ligated with pFastBac HTa expression vector to generate either the expression plasmid for HBV Core protein or the expression plasmid pFastBac HTa HBV Core-TBD fusion protein. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa HBV Core are shown in FIG. 15. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa HBV Core-TBD are shown in FIG. 14.

Example 31

Construction of DHBV Surface Antigen PreS/S and DHBV PreS/S-TBD Fusion Protein Expression Vectors

DHBV has served as a powerful animal model in the development of antiviral therapy for HBV. Pekin ducks, congenitally infected with DHBV have been used to study the mechanism of replication of the virus and for the screening of antiviral compounds. The present invention also describes the chimeric DHBV antigen-TBD molecules that could be used as therapeutic vaccines in DHBV-infected ducks, thus providing a viable animal model for the feasibility studies for a HBV therapeutic vaccines.

DNA encoding DHBV PreS/S was produced by PCR methods from template plasmid pFastBac HTa PreS/S (University of Alberta) using 5′ primer (sense) 5′ TATTCCGGATTATTCATACCG (SEQ ID NO: 11) and the 3′ primer (antisense) 5′ TGTCATTCAGCGGCCGCGAACTCTTGTAAAAAAGAGCAGA (SEQ ID NO: 13), containing restriction enzyme Not I site. The unique restriction enzyme site EcoRI, resident on the parent plasmid pFastBac HTa PreS/S was used for directional cloning. All other protocols for the production of either the DHBV PreS/S or the fusion protein PreS/S-TBD are the same as described in Example 19. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa DHBV PreS/S are shown in FIG. 21. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa DHBV PreS/S-TBD are shown in FIG. 19.

Example 32

Construction of DHBV Core antigen and DHBV Core-TBD Fusion Protein Vector Plasmids

The DNA coding for DHBV Core was generated by PCR using the following primers. The 5′ terminus primer used was (sense) 5′ TGCGCTACCATGGATATCAATGCTTCTAGAGCC (SEQ ID NO: 14), containing the restriction enzyme Nco I site. The 3′ terminus primer used was (antisense) 5′ TGTCATTCTGCGGCCGCGATTTCCTAGGCGAGGGAGATCTATG (SEQ ID NO: 15), containing the restriction enzyme Not I site. All other protocols for the production of either the DHBV Core or the fusion protein DHBV Core-TBD are the same as described in the example 4 above. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa DHBV Core are shown in FIG. 24. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa DHBV Core-TBD are shown in FIG. 23.

Example 33

Construction of pFastBac HTa HCV Core (1-191) Antigen and the Chimeric Antigen pFastBac HTa HCV Core (1-191)-TBD Fusion Protein Vector Plasmids

The DNA encoding the HCV Core was generated from the plasmid pCV-H77C template (University of Alberta) using PCR methodology. The primers used were: (sense) 5′ CGGAATTCATGAGCACGAATCCTAAAC (SEQ ID NO: 16) containing the unique restriction enzyme site EcoRI and the 3′ primer (antisense) 5′ GGACTAGTCCGGCTGAAGCGGGCACAGTCAGGCAAGAG (SEQ ID NO: 17) containing the unique restriction enzyme site Spe I. Amplified DNA was digested with EcoRI/Spe I and ligated with pFastBac HTa expression vector digested with the same two enzymes. The expression plasmid for HCV Core protein was generated with this method. The fragment was ligated with the plasmid pFastBac HTa (described in Example 19) following the digestion with the respective enzymes. This produced the expression plasmid pFastBac HTa HCV Core. This plasmid was used for the transposition in DH10Bac™ and the recombinant Bacmids used for Sf9 insect cell transfections. The resulting baculovirus carrying the gene of interest was optimized for MOI and the time for efficient protein expression (described in example 19). The generation of recombinant expression plasmid pFastBac HTa-HCV Core-TBD was achieved through similar protocols. The PCR-amplified DNA was digested with EcoRI/Spe I and the purified fragment was ligated with the plasmid pFastBac HTa-TBD (described in example 19) following the digestion with the respective enzymes. This produced the expression plasmid pFastBac HTa HCV Core-TBD. This plasmid was used to produce recombinant baculovirus that expressed the chimeric antigen-TBD fusion protein: 6×His tag-rTEV protease cleavage site-HCV Core-TBD. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa HCV Core (1-191) are shown in FIG. 45. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa HCV Core (1-191)-TBD are shown in FIG. 46. All other protocols are described in example 19.

Example 34

Expression and Purification of HCV Core Antigen and HCV Core-TBD Chimeric Fusion Protein

Recombinant bacmids of standardized multiplicity of infection (MOI) were used to infect High Five™ insect cells. For suspension cultures, cells were seeded at a density of 3×105 cells/mL and incubated at 27.5° C. with shaking at 138 rpm until the cell density reached 2−3×106 cells/mL. Recombinant baculovirus was added to the cells. For HCV Core, infections of High Five™ cells were performed at an MOI of 1 pfu/cell. Cells in suspension were grown to mid-log phase and infected with the recombinant baculovirus at this MOI. These infected cultures were incubated for 48 hours and then the cells were harvested. For HCV Core-TBD, infections of High Five™ cells were done at an MOI of 1 pfu/cell and for 72 hours.

Purification of Proteins: The purification of HCV Core and HCV Core-TBD was done under denaturing conditions as follows. The cells were lysed in a buffer containing 6 M Guanidinium-HCl, 0.1 M Na2HPO4, 0.01 M Tris-HCl pH 8.0, 0.01 M Imidazole, (lysis buffer). The suspension was sonicated on ice with 5 pulses of 1 minute per pulse at a power setting of 60 watts, and was mixed at room temperature for 1 hour. The lysate was centrifuged at 27,000×g for 30 min to remove unbroken cells and cell debris. The supernatant was mixed for 1 hr with Ni-NTA agarose (Qiagen) beads (5 mL/100 mL cell lysate), pre-equilibrated with lysis buffer. Following the mixing step, the beads were loaded on to a column and was washed with a minimum of 20 column volumes of 8M Urea, 0.1 M Na2HPO4, 0.01 M Tris-HCl pH 8.0, 0.02M Imidazole (wash buffer), until the OD280 was <0.01. The bound protein was eluted in a buffer containing 8M Urea, 0.1 M Na2HPO4, 0.01 M Tris-HCl pH 8, 0.25 M imidazole.

HCV Core-TBD was separated from other proteins by gel filtration. The peak elution fractions from Ni-NTA agarose column were loaded on a Sephadex G100 (Pharmacia) gel filtration column and the column was eluted with 8M Urea, 0.1 M Na2HPO4, 0.01 M Tris-HCl, pH 8.0. The fractions containing HCV Core-TBD were pooled and dialyzed against PBS (phosphate buffered saline).

HCV Core antigen and the fusion protein HCV Core-TBD fusion protein were expressed in High Five™ insect cells, and purified; Coomassie blue-stained HCV Core was run on a 12% polyacrylamide gel. Core-TBD was purified and a Western blot using 6×His monoclonal antibody.

Example 35

Construction of pFastBac HTa HCV Core (1-177) Antigen and pFastBac HTa HCV Core (1-177)-TBD Fusion Protein Plasmid Vectors

The DNA coding for HCV Core (1-177) was generated by PCR using the following primers. The 5′ terminus primer used was (sense) 5′ CGGAATTCATGAGCACGAATCCTAAAC (SEQ ID NO: 18), containing the restriction enzyme EcoRI site. The 3′ terminus primer used was (antisense) 5′ GGACTAGTCCGAAGATAGAGAAAGAGC (SEQ ID NO: 19), containing the restriction enzyme Spe I site. Following digestion with the two enzymes, the DNA fragment was ligated with plasmid pFastBac HTa to generate pFastBac HTa HCV (Core 1-177) and with pFastBac HTa-TBD to generate the expression plasmid pFastBac HTa HCV Core (1-177)-TBD. All other protocols for the production of either the HCV Core (1-177) antigen or the chimeric antigen fusion protein HCV Core (1-177)-TBD are the same as described in example 19. Nucleotide sequence and the deduced amino acid sequence of 6×His-rTEVprotease site-HCV Core (1-177) are shown in FIG. 47. Nucleotide sequence and the deduced amino acid sequence of 6×His-rTEVprotease site-HCV Core (1-177)-TBD are shown in FIG. 48.

Example 36

Construction of pFastBac HTa HCV NS5A Antigen and pFastBac HTa HCV NS5A-TBD Fusion Protein Expression Vector Plasmids

The DNA encoding the HCV NS5A fragment was generated from the plasmid pCV-H77C (University of Alberta) template using PCR methodology. The 5′ primer used form the PCR was (sense) 5′ CCGGAATTCTCCGGTTCCTGGCTAAGG (SEQ ID NO: 20) containing the restriction enzyme EcoRI site. The PCR primer for 3′ terminus was (antisense) 5′ GGACTAGTCCGCACACGACATCTTCCGT (SEQ ID NO: 21) containing the restriction enzyme Spe I site. Amplified DNA was digested with the respective enzymes and ligated with pFastBac HTa expression vector to generate either the expression plasmid for HCV NS5A or it was ligated with the expression plasmid pFastBac HTa-TBD to generate the expression plasmid pFastBac HTa HCV NS5A-TBD fusion protein.

Nucleotide sequence and the deduced amino acid sequence of 6×His-rTEVprotease site-HCV NS5A are shown in FIG. 49. Nucleotide sequence and the deduced amino acid sequence of 6×His-rTEVprotease site-HCV NS5A-TBD are shown in FIG. 50.

Example 37

Construction of pFastBac HTa HCV E1 Antigen and pFastBac HTa HCV E1-TBD Fusion Protein Expression Vectors

Plasmid pFastBac HTa HCV E1 and pFastBac HTa HCV E1-TBD, which are used to express HCV envelope protein E1 and the respective chimeric antigen E1-TBD fusion protein, were generated as follows. The DNA encoding the E1 protein was generated from the plasmid pCV-H77C template using PCR technique. The 5′ primer used for the PCR was (sense) 5′ CCGGAATTCTACCAAGTGCGCAATTCCT (SEQ ID NO: 22), which contains the restriction enzyme EcoRI site and the 3′ primer used was (antisense) 5′ GGACTAGTCCTTCCGCGTCGACGCCGGCAAAT (SEQ ID NO: 23), containing the restriction enzyme Spe I site. The PCR-amplified cDNA was digested with the respective enzymes and ligated with pFastBac HTa expression vector to generate the expression plasmid pFastBac HTa HCV E1 for the expression of HCV E1 protein. The digested DNA fragment was ligated with pFastBac HTa-TBD to generate the plasmid pFastBac HTa HCV E1-TBD, which was used to express HCV E1-TBD fusion protein.

FIG. 51 shows the nucleotide and the deduced amino acid sequences of 6×His-rTEVprotease site-HCV E1 in the open reading frame of the expression plasmid. FIG. 52 shows nucleotide and the deduced amino acid sequences of 6×His-rTEVprotease site-HCV E1-TBD chimeric antigen fusion protein.

Example 38

Construction of pFastBac HTa HCV E2 Antigen and pFastBac HTa HCV E2-TBD Fusion Protein Expression Vectors

The DNA encoding HCV E2 antigen was produced by PCR from a plasmid pCV-H77C. The 5′ primer used for the PCR was (sense) 5′ GCGGAATTCACCCACGTCACCGGGGGAAATGC (SEQ ID NO: 24) containing a unique restriction enzyme site EcoRI that is used for directional cloning. The 3′ primer used was (antisense) 5′ GGACTAGTCCAGCCGCCTCCGCTTGGGATATGAGT (SEQ ID NO: 25) containing the restriction enzyme Spe I site. Following PCR amplification, the fragment was digested with the restriction enzymes EcoRI and Spe I an the DNA fragment was purified and ligated with the expression plasmid pFastBac HTa at the respective sites to produce pFastBac HTa HCV E2, which expressed the E2 antigen. The same fragment was also used to ligate with pFastBac HTa-TBD to generate the expression plasmid pFastBac HTa HCV E2-TBD, which expressed the chimeric antigen fusion protein HCV E2-TBD. The production of baculovirus stocks from these plasmids and the expression of the E2 and E2-TBD in High Five™ insect cells were done as described in previous examples.

FIG. 53 shows the nucleotide and the deduced amino acid sequences of 6×His-rTEVprotease site-HCV E2 in the open reading frame of the expression plasmid. FIG. 54 shows nucleotide and the deduced amino acid sequences of 6×His-rTEVprotease site-HCV E2-TBD chimeric antigen fusion protein.

DNA encoding HCV E1/E2 was produced by PCR methods from the plasmid pCV-H77C using 5′ primer (sense) 5′ CCGGAATTCTACCAAGTGCGCAATTCCT (SEQ ID NO: 26) containing the restriction enzyme site EcoRI and the 3′ primer (antisense) 5′ GGACTAGTCCAGCCGCCTCCGCTTGGGATATGAGT (SEQ ID NO: 27) containing the restriction enzyme site Spe I. Restriction enzyme-digested DNA fragment was cloned into the respective sites of either pFastBac HTa to generate pFastBac HTa HCV E1/E2 or pFastBac HTa-TBD to generate pFastBac HTa HCV E1/E2-TBD. All other protocols for the production of either the E1/E2 antigen or the fusion protein E1/E2-TBD are the same as described in the example above.

FIG. 55 shows the nucleotide and the deduced amino acid sequences of 6×His-rTEVprotease site-HCV E1/E2 in the open reading frame of the expression plasmid. FIG. 56 shows nucleotide and the deduced amino acid sequences of 6×His-rTEVprotease site-HCV E1/E2-TBD chimeric antigen fusion protein.

Conclusions from Examples 10-38

1. A new class of Chimeric Antigens is designed in order to incorporate antigen and antibody components in the molecule.
2. Antigen components can be derived from infectious agents or cancer antigen.
3. Antibody components are xenotypic, preferably of murine origin, in the case of chimeric antigens for administration to humans.
4. Chimeric antigen fusion proteins, TBD and the respective antigens have been produced by recombinant techniques.
5. Chimeric antigen fusion proteins, TBD and the respective antigens have been produced (expressed) in a heterologous expression system (insect cells).
6. By virtue of the expression in insect cells, the proteins have mannose glycosylation content.
7. Chimeric antigens include fusion proteins from HBV surface antigens (S1/S2), and/or HBV Core and TBD, derived from the murine mAb 2C12.
8. Chimeric antigens include fusion proteins of DHBV surface antigens PreS/S, Core and TBD.
9. The following antigens from HCV have been cloned and expressed in insect cell expression systems. HCV Core (1-191), HCV Core (1-177), HCV NS3, HCV NS5A, HCV E1, HCV E2, HCV E1/E2.
10. Chimeric antigen fusion proteins of HCV include HCV Core (1-191), HCV Core (1-177), HCV NS3, HCV NS5A, HCV E1, HCV E2, HCV E1/E2 and TBD.
11. Chimeric antigen fusion protein HCV Core (1-191)-TBD and HCV Core (1-191) have been expressed and purified.
12. Chimeric antigen fusion protein HBV surface antigen S1/S2-TBD and HBV surface antigen S1/S2 have been expressed and purified.
13. The fusion proteins bind to and are internalized by antigen presenting cells (Human PBMC-derived DCs).
14. Binding and uptake is via Fey receptors CD32 and possibly through CD64.
15. Binding and uptake can occur via CD206, the mannose macrophage receptor.
16. Mannose glycosylation augments the binding and uptake of the antigens via CD206.
17. Chimeric antigen fusion protein HBV surface antigen S1/S2-TBD enhances the antigen presentation by professional antigen presenting cells (DCs).
18. DCs loaded with the Chimeric antigen fusion protein HBV surface antigen S1/S2-TBD, on presentation to T cells, elicit an immune response.
19. The immune response can be measured as an increase in intracellular and secreted interferon-γ.

Example 39

Maturation and Loading of Dendritic Cells

Peripheral blood mononuclear cells (PBMCs) were thawed by the addition of AIM-V (ratio of 9 ml of AIM-V added to 1 ml of frozen cells). The cells were then centrifuged at 200×g for 5 min, the supernatant removed, and the cells resuspended in AIM-V/1% matched serum and added to either a 100 mm culture dish or a T-25 culture flask. The PBMCs were incubated for 1 hr at 37° C. in a humidified incubator under 7% CO2. To remove non-adherent cells, the culture was triturated several times, the supernatant discarded, and the cells washed once with AIM-V medium. Monocytes were harvested with a cell scraper and centrifuged at 300×g for 5 min. The cell pellet was re-suspended in AIM-V/2.5% matched serum at 2×106 cells/ml and seeded into a 24-well dish. Th IL-4 and GM-CSF (1000 IU/ml each) were added to drive the differentiation of monocytes into immature DCs. Antigen was added to immature DCs within 4 to 24 hr of isolation. After a further 24 hr, antigen loaded immature monocytes were induced to mature by culturing with PGE2 (1 μM), IL-1b (10 ng/ml), and TNF-a (10 ng/ml) for 24 hr.

Example 40

Combination Therapy using DHBV Core-TBD and Lamivudine in Pekin Ducks

Normal ducklings were infected with DHBV-containing duck serum a day after the ducklings were hatched. This is standard practice in the field of DHBV research. The presence of persistent viremia was verified using established techniques at week four before the start of the immunizations. Congenitally DHBV-infected animals at four weeks of age also were used for the experiments reported herein.

Congenitally DHBV-infected and post-hatch infected ducks were divided into three groups. A sample of blood (1.0 mL) was collected for reference of pre-immunization antibody levels and blood samples were collected every week before the vaccinations. The first experimental group received DHBV Core-TBD chimeric antigen fusion protein 40 μg/dose injected intramuscularly every other week on the same day until week 22. The second experimental group received DHBV Core protein 19.9 μg/dose injected intramuscularly every other week on the same day until week 22. The third (control) group received buffer (20 mM Sodium Phosphate pH 8.0, 300 mM NaCl) injected intramuscularly every other week on the same day until week 22. In addition, each group also received 20 mg/kg lamivudine injected intramuscularly b.i.d. until week 12, at which point the lamivudine dose was increased to 40 mg/kg injected intramuscularly b.i.d.

No observable local reaction to the injections of the DHBV core-chimeric antigen vaccine. No other adverse reaction was noticed. Lamivudine alone (control) decreased serum viremia in both congenitally and post-hatch DHBV infected ducks.

In the control group of ducks, the viremia rebounded at an earlier time point compared to the vaccinated group, i.e., ducks receiving DHBV Core-TBD. Thus a trend towards increased viral suppression exists in response to vaccination with the chimerica antigen, although a complete elimination of the viremia was not seen in any of the experimental animals. A trend towards increased inflammatory response also was observed in the group receiving DHBV Core-TBD compared to the control group (lamibviudine alone). Such a trend indicates that the DHBV Core-chimeric antigen induces immune responses in the duck animal model.

In post-hatch DHBV-infected ducks, there was an elevation of serum anti-core antibody levels in core-chimeric antigen treated group compared to the control groups. This suggests a humoral response to the vaccination with the chimeric antigen in a chronic virus-infected animal model.

All publications and patents mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art are intended to be within the scope of the following claims.

Claims

1-49. (canceled)

50. A method of producing a chimeric antigen comprising:

(a) providing a microorganism or a cell;

(b) culturing said microorganism or cell under conditions whereby the chimeric antigen is expressed.

51. The method of claim 50, wherein the microorganism or cell is a eukaryotic microorganism or cell.

52. The method of claim 50, wherein the cell is a yeast cell, a plant cell or an insect cell.

53. The method of claim 52, wherein the chimeric antigen is post-translationally modified to comprise glycosylation.

54. The method of claim 50, wherein the chimeric antigen is post-translationally modified to comprise a mannose glycosylation.

55. A method of producing a chimeric antigen comprising:

(a) providing a microorganism or a cell, the microorganism or cell comprising a polynucleotide that encodes a target binding domain bound to a linker molecule;

(b) culturing said microorganism or cell under conditions whereby the target binding domain-linker molecule is expressed; and

(c) contacting the target binding domain-linker molecule and an immune response domain under conditions that allow for the binding of the linker to the immune response domain, the binding resulting in a chimeric antigen.

56. A polynucleotide encoding a chimeric antigen, said polynucleotide comprising a first polynucleotide portion encoding an immune response domain and a second polynucleotide portion encoding a target binding domain, wherein the target binding domain comprises an antibody fragment.

57. The polynucleotide of claim 56, wherein the antibody fragment is a xenotypic antibody fragment.

58. The polynucleotide of claim 56, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOs:39 and 41-51.

59. The polynucleotide of claim 56, wherein the polynucleotide encodes a chimeric antigen that is at least 90% identical to an entire amino acid sequence selected from the group consisting of the amino acid sequences set forth in SEQ ID NOs:40 and 52-62.

60. The polynucleotide of claim 56, wherein the polynucleotide selectively hybridizes under stringent conditions to a polynucleotide having a nucleotide sequence selected from the group consisting of nucleotide sequences set forth in SEQ ID NOs:39 and 41-51.

61. A vector comprising the polynucleotide of claim 57.

62. The vector of claim 61, wherein the polynucleotide is operably linked to a transcriptional regulatory element (TRE).

63. A microorganism or cell comprising the polynucleotide of claim 57.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class: