Patent application title:

Self-avoiding molecular recognition systems in DNA priming

Publication number:

-

Publication date:
Application number:

14/524,227

Filed date:

2014-10-27

✅ Patent granted

Patent number:

US 9,249,458 B1

Grant date:

2016-02-02

PCT filing:

-

PCT publication:

-

Examiner:

Jezia Riley

Adjusted expiration:

2034-10-27

Smart Summary: A new method combines two advanced systems to improve how DNA and RNA are copied. It uses special tags that help identify the copied products, even when many different primers are mixed together. The system is designed to bind to natural DNA and RNA while avoiding binding too strongly to itself. This allows for more efficient and selective copying of genetic material. Overall, it enhances the ability to work with complex mixtures in genetic research and applications. 🚀 TL;DR

Abstract:

This invention combines artificially expanded genetic information systems (AEGIS) with self-avoiding molecular recognition systems (SAMRS), in processes that involve template-directed primer extension in highly multiplexed form in mixtures containing large numbers of primers. This process yields extension products, or in its PCR format, amplicons, that have AEGIS tags that can be cleanly captured in highly complex mixtures.

Inventors:

Applicant:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q1/6853 »  CPC main

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid amplification reactions using modified primers or templates

C07H21/04 »  CPC further

Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical

C12Q1/6848 »  CPC further

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction

C12Q1/6876 »  CPC further

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes

C12Q2525/117 »  CPC further

Reactions involving modified oligonucleotides, nucleic acids, or nucleotides; Modifications characterised by incorporating modified base

C12Q2600/16 »  CPC further

Oligonucleotides characterized by their use Primer sets for multiplex assays

C12Q1/68 IPC

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids

C12P19/34 IPC

Preparation of compounds containing saccharide radicals; Preparation of nitrogen-containing carbohydrates; N-glycosides; Nucleotides Polynucleotides, e.g. nucleic acids, oligoribonucleotides

C07H21/02 IPC

Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical

C07H19/04 IPC

Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides ; Anhydro-derivatives thereof sharing nitrogen Heterocyclic radicals containing only nitrogen atoms as ring hetero atom

Description

Continuation in part of U.S. patent application Ser. No. 12/229,159 filed 2008 Aug. 20 Which is a Continuation in part of U.S. patent application Ser. No. 11/647,609 filed 2008 Dec. 30 Which is a Continuation in part of U.S. patent application Ser. No. 11/271,366 filed 2005 Nov. 12 Which is based on provisional patent applications 60/627,460 and 60/627,459 filed 2004 Nov. 13 and 60/654,424 filed 2005 Dec. 20

This invention was made with government support under W911NF12C0059 awarded by The Office of the Secretary of Defense US Army RDECOM ACQ CTR. The government may have certain rights in the invention.

FIELD

This invention relates to the field of nucleic acid chemistry, more specifically to the field of compositions and processes that can serve as primers for the copying of DNA and RNA. Most specifically, this invention relates to compositions of matter that bind to natural DNA and RNA following simple rules as they serve as primers, without binding as strongly to themselves.

BACKGROUND

Scientists have long sought innovative molecular recognition systems that have binding properties that are useful in different ways. The structures of these systems have been modeled to resemble the structures of DNA and RNA which, in their polymeric form, are called “oligonucleotides”. Further, as with DNA and RNA, the molecular recognition systems have been useful because they bind to other components of the molecular recognition systems and/or to natural DNA and RNA following rules that can be expressed in a form that guides practitioners of ordinary skill in the art and enables them to do useful things.

DNA serves as an archetype to illustrate both molecular structure and rule base recognition. With DNA, three rules (A pairs with T, G pairs with C, the strands are antiparallel) permit the design of two DNA molecules that bind to each other in aqueous solution. When the rules are perfectly followed, two perfectly complementary DNA strands of a substantial length (15-20 nucleotides is normally sufficient in physiological buffers at 37° C.) will bind to each other with substantial selectivity even in complex mixtures containing many other DNA molecules. Heuristic rules have been developed over the years to permit the prediction of general trends in DNA:DNA binding affinity. These have come by performing substantial numbers of melting temperature experiments. For examples as heuristic rules, longer DNA strands generally bind to their partners with higher melting temperatures (Tms) than shorter strands. G:C pairs generally contribute more to duplex stability than A:T pairs. More highly parameterized models improve on the estimates of melting temperatures [All98a] [All98b] [Mar85] [Mat98]. While it remains true that the precise stability of duplexes may not be predictable, that imprecision does not defeat the utility of DNA:DNA binding or require undue experimentation to exploit, even though the number of different DNA sequences of length n (=4n) that would fall within a patent for the DNA molecular recognition system would be enormous.

It has been argued that this rule-based behavior arises because of the repeating charge in the backbone of nucleic acids [Ben04]. Certainly, analogs that have that repeating charges in their backbone maintain their rule-based pairing behavior even if they become quite long. In contrast, the few examples of useful nucleic acid analogs that lack a repeating charge in their backbone do not maintain their rule-based binding behavior in polymers built from two-dozen or more monomer units (fewer if the nucleobases are predominately guanine). The archetypal example of such an uncharged DNA analog is the peptide nucleic acids (PNAs) [Egh92], where rule-based molecular recognition does not survive in longer molecules.

Artificially Expanded Genetic Information Systems (AEGIS)

An archetype of a human-invented rule-based molecular recognition is the artificially expanded genetic information system (AEGIS) disclosed in U.S. Pat. No. 5,432,272. The design of this artificial molecular recognition system began with the observation that two principles of complementarity govern the Watson-Crick pairing of nucleic acids: size complementarity (large purines pair with small pyrimidines) and hydrogen bonding complementarity (hydrogen bond donors from one nucleobase pair with hydrogen bond acceptors from the other). These two principles give rise to the simple rules for base pairing (“A pairs with T, G pairs with C”) that underlie genetics, molecular biology, and biotechnology.

U.S. Pat. No. 5,432,272 pointed out that these principles can be met by nucleotides other than adenine (A) and thymine (T), and guanine (G) and cytosine (C). Rather, twelve nucleobases forming six base pairs joined by mutually exclusive hydrogen bonding patterns might be possible within the geometry of the Watson-Crick base pair. FIG. 1 shows some of the standard and non-standard nucleobase pairs, together with the nomenclature to designate them. Those nucleobase analogs presenting non-standard hydrogen bonding patterns are part of an Artificially Expanded Genetic Information System, or AEGIS.

U.S. Pat. No. 5,432,272 and subsequent patents all taught that the hydrogen bonding pattern that makes an AEGIS component useful as a unit of molecular recognition is distinguishable from the heterocycle that implements it. This means that different heterocycles can often serve interchangeably as molecular recognition elements. This, in turn, permits the elements of an artificial molecular recognition system to be chosen based on considerations other than simple recognition. Thus, the pyADA hydrogen bonding pattern in AEGIS is implemented by thymidine, uridine, uridine derivatives carrying a 5-position linker attached to a fluorescent moiety, uridine derivatives carrying a 5-position linker attached to a biotin, and pseudouridine, for example.

Four features of the AEGIS system make it suited for application:

  • (a) AEGIS supports rule-based design. Anyone of ordinary skill in the art can design two AEGIS-containing molecules that bind to each other, after learning only a few additional rules, just as they can design binding partners with standard DNA. Again, a critical mass of melting temperatures were collected to support heuristic rules that allow prediction of affinity. As with DNA, the precise Tms are not predictable even with these heuristic rules, but this imprecision does not defeat the utility of the system, or create a need for undue experimentation to design AEGIS pairing partners.
  • (b) This rule-based molecular recognition displayed by AEGIS is orthogonal to that displayed by standard DNA. If two strands incorporating standard DNA bases are mixed with two other strands incorporating AEGIS components, the first pair will bind to each other only, and the second pair will bind to each other only, without formation of hybrids between the strands containing canonical and non-canonical bases. This allows two molecular recognition processes to occur independently in the same vessel.
  • (c) Sequences built from AEGIS components have higher information density (more different sequences per unit length), especially when they incorporate the full 12 letters that the AEGIS technology allows. This allows fewer near-mismatches in complicated systems to slow hybridization, for example. Thus, AEGIS tags hybridize more quickly [Col97].
  • (d) Enzymes can be found that allow AEGIS systems to be manipulated in ways common in biotechnology with standard DNA. These enzymes include polymerases that do primer extension, copy templates that contain AEGIS components, and amplify AEGIS oligonucleotides a polymerase chain reaction (PCR). Here, undue experimentation is often required to obtain enzymes that do this effectively, as many natural enzymes regard non-standard nucleotides as “foreign”, and do not accept them or, if they do, do not accept them with useful affinity.

An archetypal application of AEGIS is in the branched DNA (bDNA) assay used to measure levels of HIV, hepatitis B, and hepatitis C viruses in human patients [Elb04a][Elb04b)]. As this example shows, even though the behavior of DNA duplexes built from AEGIS components having different sequences are not identical and may not be precisely predictable, this has not prevented the AEGIS molecular recognition system from improving the health care of some 400,000 patients annually [Ben04]. This is an illustration of the utility of orthogonality in the analytical chemistry of nucleic acids.

Self Avoiding Molecular Recognition Systems (SAMRS)

A self-avoiding molecular recognition system (SAMRS) has components that bind to natural DNA or RNA, but not to other components of the same unnatural system. In its general description, a SAMRS incorporates nucleobase analogs that replace T, A, G, and C by analogs that are indicated as T*, A*, G*, and C*, which are collectively called “* analogs” of T, A, G, and C respectively. In the simplest implementation of this concept, these * analogs are each able to form two hydrogen bonds to the complementary A, T, C, and G. This means that the T*:A, A*:T, C:*G, and G*:C nucleobase pairs contribute to duplex stability to approximately the same extent as an A:T pair. A SAMRS obtains its self-avoiding properties because the hydrogen bonding groups of the * analogs are chosen the T*:A* and C*:G* nucleobase pairs do not contribute as much to duplex stability because (in the simplest implementation) they are joined by only one hydrogen bond.

As with standard DNA, standard RNA, and oligonucleotides that add non-standard nucleobase pairing, within predicting the binding properties of any sequence within a SAMRS system will be subject to the same imprecision as predicting the properties of an arbitrary DNA or RNA molecule. Thus, as a general rule, if individuals of ordinary skill in the art wish to design a SAMRS sequence that binds to a preselected standard DNA molecule with a Tm of 25° C., they would write down the preselected sequence in the 5′-to-3′ direction, and then write below the SAMRS sequence in an antiparallel direction, matching a T* against every A in the preselected sequence, an A* against every T in the preselected sequence, a C* against every G in the preselected sequence, and a G* against every C in the preselected sequence. It is an open question as to whether such simple instructions allow one of ordinary skill in the art to obtain useful outcomes without undue experimentation. As elaborated below, attempts to obtain such utility failed when we took instruction from the prior art. One object of the instant invention is to provide SAMRS components that provide utility based on precisely this simple a set of rules and instructions.

The need for self-avoiding behaviors has long been pressing when an experimentalist sought to have mixtures containing more than two oligonucleotides, and especially pressing when making libraries of oligonucleotides (defined as having 10 or more oligonucleotide components), especially when those oligonucleotides were to interact with enzymes such as DNA polymerases. This problem is exemplified by multiplexed PCR, where the amplification is sought of many segments of DNA in one pot. This is attempted by adding in large excess two primers flanking each segment, contacting mixture with nucleoside triphosphates, and cycling the mixture up and down in temperature in the presence of a thermostable DNA polymerase. At low temperatures, the primers anneal to the template. At higher temperatures, the polymerase extends the primer to make a product copy of the template. At the highest temperature, the product copy falls off the template, allowing more primers to bind when the temperature is dropped. The primers compete with full length product copies for their binding sites on the template by being present in high concentrations.

While PCR can be successfully multiplexed up to a dozen or so amplicons, with careful design to avoid having the primers present in high concentrations interact with each other, eventually even the most careful design does not prevent primer-primer interactions. These create undesired amplicons, primer dimers, and other artifacts that defeat the utility of the PCR.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. An “artificially expanded genetic information system (AEGIS). Twelve nucleobases in a nucleic acid alphabet that form specific pairs with the constraints of the Watson-Crick geometry. Pyrimidine base analogs are designated “py”, purine by “pu”. Upper case letters following a designation indicate the hydrogen bonding pattern of acceptor (A) and donor (D) groups. Thus, cytosine is pyDAA.

FIG. 2. Another “artificially expanded genetic information system (AEGIS). Twelve nucleobases in a nucleic acid alphabet that form specific pairs with the constraints of the Watson-Crick geometry. Note different implementations of the same hydrogen bonding pattern in many cases, including the addition of an amino group to complete the hydrogen bonding pattern of standard adenosine, by making the nucleobase diaminopurine.

FIG. 3. Self-Avoiding Molecular Recognition System (SAMRS) in their presently preferred implementation. A molecular recognition system that binds to complementary natural DNA, but not to complementary SAMRS sequences. The pairing of each of the complements of the SAMRS heterocycles (denoted by an asterisk *) with a standard nucleobase is joined by two hydrogen bonds, while pairs between any two size-complementary SAMRS components are joined by (at most) one hydrogen bond. Note that the G*-C* and A*-T* pairs in the wobble structure do not have two productive hydrogen bonds. Diaminopurine (not shown) is a presently preferred alternative implementation of A*.

SUMMARY OF THE INVENTION

This invention combines AEGIS with SAMRS, where a tag containing one or more AEGIS nucleotides is appended to the 5′-end of the molecules that are claimed in the parent application, U.S. patent application Ser. No. 12/229,159, which is incorporated herein in its entirety by reference. This tag has utility, for example, by allowing multiplexed primer extension that is directed by templates built from only natural nucleotides to yield products that have tags that contain one or more AEGIS nucleotides, and therefore do not fully complement any natural oligonucleotide. It also has utility in a process for multiplexed nested PCR of multiple targets [Bro97], where the product amplicons carry one or more tags that contain one or more AEGIS nucleotides, and therefore do not fully complement any natural oligonucleotide.

DETAILED DESCRIPTION OF THE INVENTION

The goal of the instant invention is to provide primers that could be extended by DNA polymerases when templated on a natural DNA, and to provide primers that could support PCR (which requires that a primer, after being extended, must also be accepted as a template by a DNA polymerase), where the products of these processes have an AEGIS tag.

With both SAMRS and AEGIS, the instant invention teaches a distinction between the hydrogen bonding pattern of a SAMRS system and the heterocycle used to implement it. As is well known in the art, appendages may be attached the 5-position of pyrimidines without interfering with the hydrogen bonding that supports duplex formation. Indeed, 5-position alkyl, allyl, and acetylenic substituents at those positions generally encourage duplex formation. Likewise, substituents at this position may carry tags useful for capture (such as biotin) or detection (such as fluorescent species). The instant invention teaches that similar substituents can be attached at the “5-equivalent” position of the heterocycle that implements the SAMRS and AEGIS, noting that the IUPAC numbering of the heterocycle may assign a different numbering to the 5-equivalent position of any given heterocycle.

Analogous substitutions may be placed at the 7-equivalent position of a 7-deazapurine analog that is a part of a SAMRS and AEGIS. Further, the 7-equivalent nitrogen may be replaced by a CH unit simply to prevent Hoogsteen binding.

Likewise, while 2′-deoxyribose is the preferred backbone when it is desired to have the SAMRS component be recognized by natural DNA polymerases, RNA polymerases, and reverse transcriptases, tighter binding is obtained by placing the SAMRS- and AEGIS-enabling heterocycles on 2′-OMe, 2′-O-alkyl, and/or 2′-O-allyl ribose, PNA, or LNA, which are all taught here as part of the instant invention (such disclosure not being obvious without such a teaching).

The discussion of the inventive steps by which the presently preferred implementations of the SAMRS concept were developed is provided in U.S. patent application Ser. No. 12/229,159, of which this is a continuation-in-part. U.S. patent application Ser. No. 12/229,159 is incorporated in its entirety by reference. The presently preferred implementations of the SAMRS heterocycles are in FIG. 3.

As noted in U.S. patent application Ser. No. 12/229,159, reduction to practice discovered as an unexpected phenomenon that the melting temperatures of duplexes supported by only base pairs joined by two hydrogen bonds were abnormally low. Thus, while the 2-thioT:A pair was modestly more stable on average (with the metric being a higher Tm in a variety of contexts) than the T:A pair, a fact well known in the literature, and the I:C pair was significantly less stable than the G:C pair (a fact also well known), duplexes joined by only 2-thioT:A, 2-AP:T, I:C, and 4EtC:G pairs were significantly less stable than expected.

This observation prompted the exploration of primers having the self-avoiding property at the 3′-end of the primer more than at the 5′-end of the primer, as it is overlap of the 3′-ends of primers in primer libraries that causes primer-primer interactions that defeat the PCR analysis. Thus, this would direct one of ordinary skill in the art to place standard nucleobases at the 5′-end.

As a consequence, rules were developed that give the presently preferred embodiments for the primer segments. The preferred 5′-end of the primer is a moiety commonly used in primers, including without limitation OH (the 5′-OH group is free), O-phosphate (allowing the 5′-end to be ligatable), O-oligonucleotide, —NH2, or a phosphate or an amino group linked to a biotin or a fluorescent tag. The 3′-terminal nucleotide preferably has one of the standard nucleotides, adenine (or diaminopurine), thymine, guanine, cytosine, or uracil, or one of the A*, T*, G*, and C* nucleobases, with the most preferred application being a standard nucleotide at the 3′-end. The SAMRS-containing segment next in from the 3′-end is preferably 4 to 6 nucleotides in length, and entirely composed of A*, T*, G*, and C* nucleotides, although a single standard nucleotide can be in segment. The next segments, proceeding away from the 3′-end, are presently preferred to be constructed exclusively from A, T, G, and C, although single SAMRS nucleotides in this region can function as well, preferably if they are thiothymidine or thiouracil. This segment is chosen to give a desired affinity to its complement, and is preferably 10 to 20 nucleotides long. In any case, the presently preferred sum of these two segments primers is at least 15, so as to achieve useful affinity to a target oligonucleotide.

These segments, including the 3′-nucleotide, the SAMRS-rich segment, and the SAMRS-poor segments, are designed to be substantially complementary to a portion of the sequence of a target oligonucleotides, to which it will hybridize in the claimed process.

The preferred AEGIS tag contains nucleobases independently selected from the group consisting of A, T, G, C, K, X, V, J, S, B, Z and P, wherein K, X, V, J, S, B, Z and P are the nucleobases disclosed in FIG. 1 or FIG. 2. The tag must contain at least one K, X, V, J, S, B, Z and P, but more preferably it contains at least two, and is preferably 5 to 30 nucleotides long.

EXAMPLES

Example 1

Multiplexed Detection of Mosquito-Borne Arboviruses

Mosquito-borne arboviruses must be detected in public health surveillance environments. This example combined the self avoiding molecular recognition system (SAMRS), which enables high levels of multiplexing, with an artificially expanded genetic information system (AEGIS), which enables very clean PCR amplification in nested PCR formats. Luminex “liquid microarrays” were exploited for downstream multiplexed detection.

Targets

This example showed this combination supporting single-tube PCR amplification assays to seek RNA from 21 mosquito-borne RNA viruses from the genera Flavivirus, Alphavirus, and Orthobunyavirus. This assay differentiated between many closely-related viral targets, including dengue, West Nile, Japanese encephalitis, and the California serological group viruses.

TABLE 1
Viruses targeted.
Family/Genus Viruses and abbreviations Primer identity
Flaviviridae/ West Nile (WN) Forward-WNm1, Reverse-WNm1
Flavivirus Japanese encephalitis (JE) Forward-JE m1, Reverse-JE m1
Group IV, Saint Louis encephalitis (SLE) Forward-SLEVm1, Reverse-SLEVm1
positive ssRNA Yellow fever (YF) Forward-YF m3, Reverse-YF m3
Dengue serotype 1 (D1) Forward-D1, Reverse-Den (1, 3)
Dengue serotype 2 (D2) Forward-D2, Reverse-D (2, 4)
Dengue serotype 3 (D3) Forward-D3, Reverse-D (1, 3)
Dengue serotype 4 (D4) Forward-D4, Reverse-D (2, 4)
Murray valley encephalitis (MVE) Forward-MVE, Reverse-MVE
Rocio (Rocio) Forward-Rocio, Reverse-Rocio
Togaviridae/ Eastern Equine Encephalitis (EEE) Forward-EEEm1, Reverse-EEEm1
Alphavirus Venezuelan Equine Encephalitis (VEE) Forward-VEEm1, Reverse-VEEm1
Group IV, Western Equine Encephalitis (WEE) Forward-WEEm1, Reverse-WEEm1
positive ssRNA
Bunyaviridae/ California encephalitis (CE) Forward-CE, Reverse-CE
Orthobunyavirus Jamestown Canyon Forward-JTC Reverse-JTC
Group V La Crosse encephalitis (LAC) Forward-LAC, Reverse-LAC
negative ssRNA Keystone (KS) Forward-KS, Reverse-KS
Snowshoe Hare (SSH) Forward-SSH, Reverse-SSH
San Angelo (SA) Forward2-CAcom, Reverse 1-CAcom
Serra do Navio (SN) Forward2-CAcom, Reverse 1-CA-com
Melao (Mel) Forward-Mel, Reverse-Mel

Primers and Probes

Primers and capture probes containing artificial SAMRS and AEGIS nucleotides (Table 2) were synthesized on ABI 394 and ABI 3900 synthesizers in-house. Primers and capture probes were designed to complement a majority of the strains from each of the target viruses. For the simulants, ssDNA oligonucleotides (Amplimers, Appendix A. Supplementary data Table 2) were chosen arbitrarily to represent a single strain.

TABLE 2
Hybrid SAMRES-AEGIS primers and AEGIS (APTC) probes used in this study.
All reverse primers are 5′-biotinylated; the probes are 5′-amino-
C12- modified. The AEGIS tags in the primers are underlined.
Oligos Genome GB
primers/probes Sequences 5′-3′ Region Accession No.
Forward WNm1 CTAPTCCPCCAPCPAPC 163-181 NC-009942
primer CGCGTGTTGTCCTTG*A*T*T*G SEQ ID NO 1
Reverse WNm1 CAGPAAGPGGTPGPTPG 312-293 NC-009942
primer CACACCTCTCCATCGA*T*C*C*A SEQ ID NO 2
WN probe APPTTCACAPCAATTPCTCC 259-278 NC-009942
SEQ ID NO 3
Forward JE m1 CTAPTCCPCCAPCPAPC 10612-10628 NC_001437
primer GACCAACGTCAGG*C*C*A*C SEQ ID NO 4
Reverse JE m1 CAGPAAGPGGTPGPTPG 10769-10748 NC_001437
primer GGGTCTCCTCTAACCTCT*A*G*T*C SEQ ID NO 5
JE probe CACPPCCCAAPCCTCPTCTA 10705-10724 NC_001437
SEQ ID NO 6
Forward SLE CTAPTCCPCCAPCPAPC 10561-10577 NC_007580
m1 primer TGGCACGTAGGCT*G*G*A*G SEQ ID NO 7
Reverse SLEm1 CAGPAAGPGGTPGPTPG 10634-10614 NC_007580
primer CAGACAGCACCTTTAGC*A*T*G*C SEQ ID NO 8
SLE probe CAPACCAPAAATPCCACCT 10591-10610 NC_007580
SEQ ID NO 9
Forward YF m3 CTAPTCCPCCAPCPAPC 25-44 NC_002031
primer GTGCATTGGTCTGCAA*A*T*C*G SEQ ID NO 10
Reverse YF m3 CAGPAAGPGGTPGPTPG 164-146 NC_002031
primer CCATATTGACGCCCA*G*G*G*T SEQ ID NO 11
YF probe PAPCPATTAPCAPAPAACTPAC 91-112 NC_002031
SEQ ID NO 12
Forward D1 CTAPTCCPCCAPCPAPC 105-127 FJ639679.1
primer GTCTTTCAATATGCTGAAA*C*G*C*G SEQ ID NO 13
Forward D2 CTAPTCCPCCAPCPAPC 10433-10452 EU482570.1
primer GAGGCCACAAACCATG*G*A*A*G SEQ ID NO 14
Forward D3 CTAPTCCPCCAPCPAPC 103-128 EU482596.1
primer GTCTATCAATATGCTGAAA*C*G*C*G SEQ ID NO 15
Forward D4 CTAPTCCPCCAPCPAPC 10363-10379 GQ199883.1
primer ATGCGCCACGGAA*G*C*T*G SEQ ID NO 16
Reverse D (1,3) CAGPAAGPGGTPGPTPG 174-152 (D1) FJ639679.1
primer TGAGAATCTCTTCGCCAAC*T*G*T*G SEQ ID NO 17
Reverse D (2,4) CAGPAAGPGGTPGPTPG 10497-10479 EU482570.1
primer GGAGGGGTCTCCTCT*A*A*C*C (D2) SEQ ID NO 18
D1 probe CPAPAAACCPCPTPTCAACT 128-147 FJ639679.1
SEQ ID NO 19
D2 probe CPCATPPCPTAPTPPACTAP 10457-10476 EU482570.1
SEQ ID NO 20
D3 probe APAAACCPTPTPTCAACTPP 131-151 EU482596.1
SEQ ID NO 21
D4 probe PCPTPPCATATTPPACTAPC 10383-10402 GQ199883.1
SEQ ID NO 22
Forward MVE CTAPTCCPCCAPCPAPC 535-551 NC_000943
primer TGATCGCCATTCC*A*A*C*C SEQ ID NO 23
Reverse MVE CAGPAAGPGGTPGPTPG 614-594 NC_000943
primer GGTGTCATCACACATAA*A*T*C*C SEQ ID NO 24
MVE probe PTCPPATTCPAPCCATTPAC 571-590 NC_000943
SEQ ID NO 25
Forward-Rocio CTAPTCCPCCAPCPAPC 1883-1903 AY632542
primer CAAGAACCCAGTTGACA*C*A*G*G SEQ ID NO 26
Reverse-Rocio CAGPAAGPGGTPGPTPG 2036-2015 AY632542
primer GGGAACAAATGGATTGAC*C*G*T*C SEQ ID NO 27
Rocio probe PAPAACCTACATPATCTCACTCC 1977-1999 AY632542
SEQ ID NO 28
Forward- CTAPTCCPCCAPCPAPC 11034-11057 NC_003899
EEEm1 primer CTGAGAGCGGATCATTTACA*T*T*C*C SEQ ID NO 29
Reverse- CAGPAAGPGGTPGPTPG 11133-11111 NC_003899
EEEm1 primer CAATCTCCTTTGCAGGTAA*C*T*G*C SEQ ID NO 30
EEE probe PCTTTTAAPCTPCAPPTCTPC 11084-11104 NC_003899
SEQ ID NO 31
Forward- CTAPTCCPCCAPCPAPC 4339-4360 NC_001449
VEEm1 primer CAGTAGCGATTCCACTGT*T*G*T*C SEQ ID NO 32
Reverse- CAGPAAGPGGTPGPTPG 4485-4462 NC_001449
VEEm1 primer GAGTCATTTCCCATTTCTTG*T*C*C*C SEQ ID NO 33
VEE probe PCTPACAPCTTTAPACACCAC 4415-4435 NC_001449
SEQ ID NO 34
Forward- CTAPTCCPCCAPCPAPC 345-366 NC_003908
WEEm1 primer CAAGAACATAGCCTCTAA*G*G*C*G SEQ ID NO 35
Reverse- CAGPAAGPGGTPGPTPG 482-460 NC_003908
WEEm1 primer GCGTACACATCTTGGTATA*C*T*G*C SEQ ID NO 36
WEE probe TPTATPCACACAPACPCCAC 418-437 NC_003908
SEQ ID NO 37
Forward-CE CTAPTCCPCCAPCPAPC 675-694 U12800
primer CGGCATGATTGCAAAG*A*G*T*C SEQ ID NO 38
Reverse-CE CAGPAAGPGGTPGPTPG 792-770 U12800
primer CGGAGCTTATGGCAACTTT*A*T*C*C SEQ ID NO 39
CE probe PTTTPAPCPACACTPCTAPAAC 731-752 U12800
SEQ ID NO 40
Forward JTC CTAPTCCPCCAPCPAPC 283-304 EF681804
primer CAACGATCTTACCATCCA*T*C*G*G SEQ ID NO 41
Reverse JTC CAGPAAGPGGTPGPTPG 435-412 EF681804
primer CCATTGTTCCAATGAATGCC*A*T*T*G SEQ ID NO 42
JTC probe1 CAPAPAPAACTCATAAPPAPCAC 365-387 EF681804
SEQ ID NO 43
JTC probe2 PCACCATCATAAATCCAATTPCAPA 384-408 EF681804
SEQ ID NO 44
Forward LAC CTAPTCCPCCAPCPAPC 577-597 NC_004110
primer CACAGAGTCAAGCAAGG*C*A*T*G SEQ ID NO 45
Reverse LAC CAGPAAGPGGTPGPTPG 736-715 NC_004110
primer GGCCTCCTTTTCCCCATT*T*A*A*G SEQ ID NO 46
LAC probe PATPTCACAPAAPPTTPCAPC 663-683 NC_004110
SEQ ID NO 47
Forward KS CTAPTCCPCCAPCPAPC 376-396 U12801
primer GTGAGGACGAGTCACAA*A*A*G*G SEQ ID NO 48
Reverse KS CAGPAAGPGGTPGPTPG 476-453 U12801
primer GAGATAGATTTCTACACCGT*T*G*C*C SEQ ID NO 49
KS probe PATCAAPAPCACTPTCATCAATCC 401-424 U12801
SEQ ID NO 50
Forward SSH CTAPTCCPCCAPCPAPC 687-707 J02390
primer CCAAGAGCCTGAAGGAA*G*T*A*G SEQ ID NO 51
Reverse SSH CAGPAAGPGGTPGPTPG 793-772 J02390
primer CCTTACTTATGGGAGCCT*G*A*T*G SEQ ID NO 52
SSH probe PACACTPCCAPATCATTCTTPC 740-761 J02390
SEQ ID NO 53
Forward 2 CA CTAPTCCPCCAPCPAPC 112-132 (SA) U47139
common primer CGGTGCAAATGGATTTG*A*T*C*C SEQ ID NO 54
Forward 2 CA CTAPTCCPCCAPCPAPC 111-131 (SN) U47140
common primer CGGTGCAAATGGATTTG*A*T*C*C SEQ ID NO 54
Reverse 1 CA CAGPAAGPGGTPGPTPG 235-216 (SA) U47139
common primer GAGAGCAGCTTTGGCT*T*T*T*G SEQ ID NO 55
Reverse 1 CA CAGPAAGPGGTPGPTPG 234-215 (SN) U47140
common primer GAGAGCAGCTTTGGCT*T*T*T*G SEQ ID NO 55
SA probe CPATCAPTTTPTCTTCAPTTAPPATC 174-199 U47139
SEQ ID NO 56
SN probe CTTACAPCCPTTAPAATCTTCTTCC 181-205 U47140
SEQ ID NO 57
Forward Mel CTAPTCCPCCAPCPAPC 659-679 U12802
primer CTGAAGGATGTAGAGCA*G*C*T*G SEQ ID NO 58
Reverse Mel CAGPAAGPGGTPGPTPG 777-755 U12802
primer GCCGAATTCATTAGAGGAC*C*A*T*C SEQ ID NO 59
Mel probe capaapttcpptpttapacttcc 725-747 U12802
SEQ ID NO 60

PCR and Simulant Preparation

PCR targeting RNA virus simulants was set up in 1× JumpStart reaction buffer (10 mM Tris-HCl, pH 8.3; 50 mM KCl; 1.5 mM MgCl2; 0.001% (w/v) gelatin) (Sigma-Aldrich, St. Louis, Mo.). The other components of the reaction mixture were (in a total volume of 100 μL): 2.5 ng/μL DNA oligo; 0.4 mM dNTPs; 0.4 μM each, Forward T7 primer and Reverse target-specific primer; JumpStart Taq DNA polymerase (2 units, Sigma), nuclease-free ddH2O (added to create a final volume of 100 μL). After the initial denaturation at 95° C. for 2 minutes, 35 cycles of amplification were performed (94° C. for 30 seconds, 55° C. for 30 seconds, and 72° C. for 1 minute). A final extension cycle was run at 72° C. for 5 minutes. Each PCR product (in 100 μL) was ethanol-precipitated and dissolved in nuclease-free dd H2O (12 μL). The resulting PCR products were sequenced in both directions (University of Florida, ICBR) and 5 pmol (about 2 μL) of the concentrated PCR product was used as a T7-DNA template to make RNA simulants.

For simulant production, a T7 RNA polymerase-dependent transcription reaction mixture (20 μL) was set up in a 1× transcription buffer (40 mM Tris, pH7.8, 20 mM NaCl, 18 mM MgCl2, 2 mM spermidine HCl, 10 mM DTT). The reaction mixture contained ATP, CTP, GTP, and UTP (75 mM stock concentration 2 μL each), DNA template (2.5-5 pmol, purified and concentrated PCR product); T7 RNA polymerase (2 μL of a 200 U/μL to give 20 U/μL final concentration). Reaction mixtures were incubated at 37° C. for 8-12 hours. Turbo DNase was then added (2 U per reaction mixture, Life Technologies) to remove DNA template. The mixtures were then incubated at 37° C. for 15-20 minutes. RNA products were isolated by phenol-chloroform extraction and dissolved in nuclease-free water (20 μL). RNA products were resolved by 3% TBE agarose-gel electrophoresis and quantitated by their UV absorbance at 260 nm. The purity of RNAs was evaluated from their A260/A280 ratio. For pure RNA, a ratio of 1.8-2.1 is expected. The absence of template DNA in the RNA samples was confirmed by conventional PCR with Platinum Taq DNA polymerase (Life Technologies) and the ethidium-bromide gel. Samples were aliquoted and kept at −80° C.

Monoplex PCRs were first performed using each target RNA simulant separately to assess the efficacy of the primers in PCR cycling, as well as to determine the sensitivity of the assay. Reactions were then optimized under multiplexed conditions to minimize cross-amplification or cross-hybridization resulting from possible sequence similarity between targets.

Mono- and 21-Fold Multiplexed Nested One-Step RT-PCRs with SAMRS-AEGIS Primers

These were carried out in 1× Reaction mix (Life Technologies) with RNA simulant (4 ng/μL) in a final volume of 20 μL accordingly to the Invitrogen protocol for the SuperScript One-Step RT-PCR with Platinum Taq (Life Technologies). The reaction mixture contained 0.2 mM of dZTP; 0.025 μM each of 21 pairs forward and Reverse hybrid SAMRS-AEGIS target-specific primers; 0.25 μM External AEGIS Forward and Reverse-biotinylated primers; 2.5 units RT/Platinum Taq enzyme Mix. Additional 1.5 mM MgSO4 were added to the RT-PCR buffer. Cycling conditions were: one cycle of the cDNA synthesis and pre-denaturation (53° C. for 30 minutes and 94° C. for 2 minutes), 55 cycles of PCR (94° C. for 15 seconds, 53° C. for 30 seconds, and 70° C. for 30 seconds) and final extension at 72° C. for 5 minute. A “no-target” PCR negative control was included with each assay run. To favor incorporation of biotin-labelled reverse primers to maximize hybridization sensitivity, the second PCR was performed with only reverse biotinylated primer (reverse primer extension reaction, RPER).

Digestion of Excess Primers and dNTPs

To destroy excess primers and deactivate dNTPs prior to RPER, ExoSAP-IT enzyme mixture (2 ΟL, Affymetrix, Cleveland, Ohio USA) were added to aliquots (5 ΟL) of standard or SAMRS-AEGIS nested PCR. Reaction mixtures were incubated at 37° C. for 30 minutes and the enzyme mixture was destroyed by heating at 80° C. for 20 minutes. Treated PCR products were added directly to the Reverse Primer Extension reaction.

Reverse Primer Extension Reaction (RPER)

Briefly, a RPER (20 μL) was set up in 1× ThermoPol Buffer (20 mM Tris-HCl, 10 mM (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, 0.1% Triton X-100, pH 8.8 at 25° C.) with 3 μL of each ExoSAP-treated RT-PCR product, 5′-biotinylated external (common) Reverse AEGIS primer (0.2 μM), and Vent (exo-) DNA polymerase (1 unit NEB). Without conversion (an “extension” reaction), dNTPs (final 0.2 mM each) were added. For the dZ incorporation into the final amplicon (“conversion”), nucleoside triphosphates (dATP, dTTP, dGTP, and dZTP, final concentration 0.2 mM of each) were added. The “extension” and “conversion” reaction mixtures were incubated in s BioRad (DNA Engine) Peltier Thermal Cycler at 95° C. for 1 min, followed by 20 cycles (94° C. for 20 seconds, 55° C. for 30 seconds, 72° C. for 30 seconds). A final incubation was run at 72° C. for 1 minute. Reaction mixtures were then held at 4° C. and quenched with 4 mM EDTA.

For standard RT-PCR products, a set of 21 reverse target-specific primers (0.2 μM each) was added to the “extension” or “conversion” reactions. The other reaction components were the same as above.

Probe Coupling to Beads

Capture probes modified with an amino-C12 linker at the 5′-end were coupled to Luminex MicroPlex carboxylated micro-spheres (“beads”) by a carbodiimide-based procedure according to the manufacturer's protocol. Briefly, for each combination of probe and bead set (Table 5), 2.5 million Luminex beads were resuspended in 0.1 M MES buffer (morpholine ethane sulfonic acid, 50 μL, pH 4.5) with probe (4 μL of 0.1 mM stock to give 0.4 nanomole final concentration), and treated twice with 1-ethyl-3-[3-dimethylamino-propyl]-carbodiimide hydrochloride (EDC, 5 μL of a 10 mg/mL solution, Thermo Scientific/Pierce, Rockford, Ill.) at room temperature for 30 min, rinsed in Tween 20 (0.02% aqueous solution), then rinsed with a sodium dodecylsulfate solution (0.1%), and resuspended in Tris-EDTA buffer (pH 8.0) to 5.0.

Luminex Direct Hybridization (DHA)

This was performed accordingly to the “no wash” Luminex protocol (http://www.luminexcorp.com/Support/SupportResources/). In a pilot experiment “wash” and “no wash” Luminex protocols were compared; no differences were found between two protocols when applied to our target-specific probes' design. Briefly, aliquots (5 μL) of each extension or conversion reaction were transferred to 96-well plates (96-well PCR thermo polystyrene plates; Costar). Hybridization buffer (25 μL of 2×Tm 0.4 M NaCl; 0.2 M Tris, 0.16 Triton X-100, pH 8.0) containing 100 of each target-specific probe-coupled microsphere set per μL or totally 2,500 target-specific probe-coupled each microsphere types. Microspheres were vortexed and sonicated for 20 seconds. The total volume was adjusted to 50 μL by 20 μl of ddH20. 25 μl of ddH20 were added to each Background well (negative control). Hybridization was performed at 55° C. accordingly to the direct hybridization protocol (DHA) provided by Luminex: 95° C. for 5 min, cool to 55° C. at a speed of 0.1° C./second, 15 mM at the hybridization T 55° C. Tm buffer (25 μL of 1×) containing streptavidin-R-phycoerythrin (2 μg, PJRS14, PROzyme) were added to the each hybridization mixture, which was then incubated at 56° C. for 5 min. Hybridization reactions were carried out in triplicate, and “no-target” controls were run in replicates of 6. Beads were analyzed for internal bead color and R-phycoerythrin reporter fluorescence using a Luminex 200 analyzer (Luminex xMAP Technology, Luminex Corporation) and the xPonent Software solutions. The median reporter fluorescence intensity (MFI) was computed for each bead type in the sample. The instrument's gate setting was established before the samples were run, and was maintained throughout the course of the study.

Results

Twenty-one mosquito-borne arboviruses were selected (Table 1) to assemble and develop xMAP Luminex assays diagnostic panel based on PCR amplification and using the artificial SAMRS-AEGIS technology [Yan10; Yan13].

Viral simulant RNAs were produced in vitro by transcription of the appropriate templates using T7 RNA polymerase. In pilot experiments, SuperScript One-Step RT-PCR with Platinum Taq (Life Technology) was found to be more sensitive and robust than other enzyme combinations tested, and thus able to support the nested PCR amplification with external primers containing the nonstandard P nucleotide, which pairs with the Z nucleotide. The target-specific standard or hybrid SAMRS-AEGIS forward and reverse primer pairs designed for the panel were tested first by monoplexed one-step RT-PCR with viral RNA simulants. Each monoplexed RT-PCR produced the expected amplicons, which were visualized by the ethidium-bromide staining following electrophoresis. Multiplexed RT-PCR conditions were established in a series of preliminary experiments (data not shown). Finally, multiplexed nested RT-PCRs were executed with each viral target using 21 pairs of specific SAMRS-AEGIS primers and AEGIS external primers (Table 2). PCR amplicons generated under optimized conditions were visualized on ethidium bromide gel as clearly resolved bands of the expected sizes ranging from 59 to 160 base pairs. The PCR negative control showed non-substantial level of primer-dimerization.

Amplicons containing only standard nucleotides were also produced by multiplexed one-step RT-PCRs and analyzed by agarose-gel electrophoresis. The 21-fold multiplexed reactions were primed with full set of target-specific primers, each at the final concentration of 0.4 The standard PCR amplicons were visualized on the ethidium bromide gel as clearly resolved bands of the expected sizes.

REFERENCES

  • [All98a] Allawi, H. T., SantaLucia, J. (1998) Nearest-neighbor thermodynamics of internal A•C mismatches in DNA: Sequence dependence and pH effects. Biochemistry 37, 9435-9444
  • [All98b] Allawi, H. T., SantaLucia, J. (1998) Thermodynamics of internal C:T mismatches in DNA. Nucleic Acids Res. 26, 2694-2701.
  • [Ben04] Benner, S. A. (2004) Understanding nucleic acids using synthetic chemistry. Acc. Chem. Res. 37, 784-797.
  • [Bro97] Brownie, J., Shawcross, S., Theaker, J., Whitcombe, D., Ferrie, R., Newton, C., Little, S. (1997). The elimination of primer-dimer accumulation in PCR. Nucleic Acids Res. 25, 3235-3241
  • [Col97] Collins, M. L., Irvine, B., Tyner, D., Fine, E., Zayati, C., Chang, C. A., Horn, T., Ahle, D., Detmer, J., Shen, L. P., Kolberg, J., Bushnell, S., Urdea, M. S., Ho, D. D. (1997) A branched DNA signal amplification assay for quantification of nucleic acid targets below 100 molecules/mL. Nucl. Acids Res. 25, 2979-2984
  • [Egh92] Egholm, M., Buchardt, O., Nielsen, P. E., Berg, R. H. (1992) Peptide nucleic-acids (PNA); Oligonucleotide analogs with an achiral peptide backbone J. Am. Chem. Soc. 114, 1895-1897
  • [Elb04a] Elbeik, T., Markowitz, N., Nassos, P., Kumar, U., Beringer, S., Haller, B. and Ng, V. (2004) Simultaneous runs of the Bayer VERSANT HIV-1 version 3.0 and HCV bDNA version 3.0 quantitative assays on the system 340 platform provide reliable quantitation and improved work flow. J. Clin. Microbiol. 42, 3120-3127
  • [Elb04b] Elbeik, T., Surtihadi, J., Destree, M., Gorlin, J., Holodniy, M., Jortani, S. A., Kuramoto, K., Ng, V., Valdes, R., Valsamakis, A. Terrault, N. A. (2004) Multicenter evaluation of the performance characteristics of the Bayer VERSANT HCV RNA 3.0 assay (bDNA) J. Clin. Microbiol. 42, 563-569
  • [Mar85] Martin, F. H., Castro, M. M., Aboul-ela, F., Tinoco, I. Jr. (1985) Base-pairing involving deoxyinosine—implications for probe design. Nucl. Acids Res. 13, 8927-8938.
  • [Mat98] Mathews, D. H., Andre, T. C., Kim, J., Turner, D. H., Zuker, M. (1998) An updated recursive algorithm for RNA secondary structure prediction with improved thermodynamic parameters. Molecular Modeling of Nucleic Acids. ACS Symposium Series 682, 246-257.
  • [Yan10] Yang, Z., Chen, F., Chamberlin, S. G., Benner, S. A. (2010) Expanded genetic alphabets in the polymerase chain reaction. Angew. Chem. Int Ed. 49, 177-180
  • [Yan13] Yang, Z., Durante, M., Glushakova, L. G., Sharma, N., Leal, N. A., Bradley, K. M., Chen, F., Benner, S. A. (2013a) Conversion strategy using an expanded genetic alphabet to assay nucleic acids. Anal. Chem. 85, 4705-4712

Claims

What is claimed is:

1. A template-directed process for extending one of a plurality of primers by enzymatic polymerization, wherein the template is one of a plurality of oligonucleotides, wherein said process comprises (a) contacting in aqueous solution the said plurality of primers with one or more of said oligonucleotides, a polymerase, and standard nucleoside triphosphates, and (b) incubating the mixture for a preselected length of time, wherein each of said primers has the structure:

wherein X is selected from the group consisting of OH, O-phosphate, O-oligonucleotide, —NH2, and a phosphate or an amino group linked to a biotin or a fluorescent tag, N is independently selected from the group consisting of adenine, thymine, guanine, cytosine, diaminopurine, uracil, A*, T*, G*, and C*, D is independently selected from the group consisting of A*, T*, G*, and C*, E is independently selected from the group consisting of A, T, G, and C, and F is independently selected from the group consisting of A, T, G, C, K, X, V, J, S, B, Z and P, wherein K, X, V, J, S, B, Z and P are the nucleobases disclosed in FIG. 1 or FIG. 2, wherein at least one F is selected from the group K, X, V, J, S, B, Z and P, wherein n is an integer from 4 to 6, m is an integer from 10 to 20, and f is an integer from 5 to 30, wherein the sequence of said primer at its 3′-end is substantially complementary to a portion of the sequence of one of said oligonucleotides, where A* does not contribute to the stability of a duplex when paired with T* but does when it is paired with thymine, T* does not contribute to the stability of a duplex when paired with A* but does when it is paired with adenine, G* does not contribute to the stability of a duplex when paired with C* but does when it is paired with cytosine, and C* does not contribute to the stability of a duplex when paired with G* but does when it is paired with guanine.

2. The process of claim 1 wherein A* is selected from the group consisting of 2-aminopurine and 2,6-diaminopurine.

3. The process of claim 1 wherein T* is selected from the group consisting of 2-thiothymidine and 2-thiouracil.

4. The process of claim 1 wherein G* is hypoxanthine.

5. The process of claim 1 wherein C* is selected from the group consisting of N4-ethylcytosine and N4-methylcytosine.

6. The process of claim 1 wherein the sum of m and n in said primers is at least 15.

7. The process of claim 1 wherein the D units are independently selected from the group consisting of T*, A*, G* and C*.

8. The process of claim 1 wherein the B units are independently selected from the group consisting of thymine, adenine, guanine, cytosine.

9. The process of claim 1 wherein A* is selected from the group consisting of 2-aminopurine and 2,6-diaminopurine.

10. The process of claim 1 wherein T* is selected from the group consisting of 2-thiothymidine and 2-thiouracil.

11. The process of claim 1 wherein G* is hypoxanthine.

12. The process of claim 1 wherein C* is selected from the group consisting of N4-ethylcytosine and N4-methylcytosine.

13. The process of claim 1 wherein more than 5 of said primer pairs are contacted.

14. The process of claim 1 wherein A* is either 2-aminopurine or 2,6-diaminopurine, G* is hypoxanthine, T* is either 2-thiothymidine or 2-thiouracil, and C* is either N-ethylcytosine or N-methylcytosine, n is between 4 and 6, F contains at least two nucleobases selected from the group consisting of K, X, V, J, S, B, Z and P, and N is either thymine, adenine, guanine, or cytosine.

15. A composition of matter that comprises a plurality of oligonucleotides, wherein each oligonucleotide having the formula

wherein X is selected from the group consisting of OH, O-phosphate, O-oligonucleotide, —NH2, and a phosphate or an amino group linked to a biotin or a fluorescent tag, N is independently selected from the group consisting of adenine, thymine, guanine, cytosine, diaminopurine, uracil, A*, T*, G*, and C*, D is independently selected from the group consisting of A*, T*, G*, and C*, E is independently selected from the group consisting of A, T, G, and C, and F is independently selected from the group consisting of A, T, G, C, K, X, V, J, S, B, Z and P, wherein K, X, V, J, S, B, Z and P are the nucleobases described in FIG. 1 or FIG. 2, wherein at least one F is selected from the group K, X, V, J, S, B, Z and P, wherein n is an integer from 4 to 6, m is an integer from 10 to 20, and f is an integer from 5 to 30, wherein A* is either 2-aminopurine or 2,6-diaminopurine, G* is hypoxanthine, T* is either 2-thiothymidine or 2-thiouracil, and C* is either N-ethylcytosine or N-methylcytosine.

16. The composition of claim 15 wherein at least one D is selected from the group consisting of N-ethylcytosine and N-methylcytosine.

17. The composition of claim 15 wherein said oligonucleotides are dissolved in water at a concentration of 100 nanomolar or greater.

18. The composition of claim 15 wherein A* is either 2-aminopurine or 2,6-diaminopurine, G* is hypoxanthine, T* is either 2-thiothymidine or 2-thiouracil, and C* is either N-ethylcytosine or N-methylcytosine, n is between 4 and 6, F contains at least two nucleobases selected from the group consisting of K, X, V, J, S, B, Z and P, and N is either thymine, adenine, guanine, or cytosine.