Patent application title:

Immunostimulatory nucleic acid molecules

Publication number:

US20050049215A1

Publication date:
Application number:

10/888,449

Filed date:

2004-07-09

Abstract:

Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

A61K39/00 »  CPC main

Medicinal preparations containing antigens or antibodies

A61K31/00 »  CPC further

Medicinal preparations containing organic active ingredients

A61K31/4706 »  CPC further

Medicinal preparations containing organic active ingredients; Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom; Quinolines; Isoquinolines 4-Aminoquinolines; 8-Aminoquinolines, e.g. chloroquine, primaquine

A61K31/7048 »  CPC further

Medicinal preparations containing organic active ingredients; Carbohydrates; Sugars; Derivatives thereof; Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin

A61K31/711 »  CPC further

Medicinal preparations containing organic active ingredients; Carbohydrates; Sugars; Derivatives thereof; Compounds having three or more nucleosides or nucleotides Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links

A61K31/7125 »  CPC further

Medicinal preparations containing organic active ingredients; Carbohydrates; Sugars; Derivatives thereof; Compounds having three or more nucleosides or nucleotides Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters

A61K39/39 »  CPC further

Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants

A61P1/00 »  CPC further

Drugs for disorders of the alimentary tract or the digestive system

A61P1/02 »  CPC further

Drugs for disorders of the alimentary tract or the digestive system Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis

A61P1/04 »  CPC further

Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants

A61P1/16 »  CPC further

Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics

A61P7/00 »  CPC further

Drugs for disorders of the blood or the extracellular fluid

A61P11/06 »  CPC further

Drugs for disorders of the respiratory system Antiasthmatics

A61P17/00 »  CPC further

Drugs for dermatological disorders

A61P17/06 »  CPC further

Drugs for dermatological disorders Antipsoriatics

A61P19/02 »  CPC further

Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis

A61P31/00 »  CPC further

Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics

A61P31/04 »  CPC further

Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics Antibacterial agents

A61P31/10 »  CPC further

Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics Antimycotics

A61P31/12 »  CPC further

Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics Antivirals

A61P33/00 »  CPC further

Antiparasitic agents

A61P35/00 »  CPC further

Antineoplastic agents

A61P37/02 »  CPC further

Drugs for immunological or allergic disorders Immunomodulators

A61P37/04 »  CPC further

Drugs for immunological or allergic disorders; Immunomodulators Immunostimulants

A61P37/06 »  CPC further

Drugs for immunological or allergic disorders; Immunomodulators Immunosuppressants, e.g. drugs for graft rejection

A61P37/08 »  CPC further

Drugs for immunological or allergic disorders Antiallergic agents

A61P43/00 »  CPC further

Drugs for specific purposes, not provided for in groups -

C07H21/00 »  CPC further

Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids

C12N15/117 »  CPC further

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs

C12Q1/68 »  CPC further

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids

A61K2039/55561 »  CPC further

Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant; Organic adjuvants CpG containing adjuvants; Oligonucleotide containing adjuvants

C12N2310/17 »  CPC further

Structure or type of the nucleic acid; Type of nucleic acid Immunomodulatory nucleic acids

C12N2310/315 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the backbone Phosphorothioates

Y02A50/30 »  CPC further

in human health protection, e.g. against extreme weather Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Description

RELATED APPLICATIONS

This application is a divisional of co-pending U.S. patent application Ser. No. 08/738,652, filed Oct. 30, 1996, which is a continuation-in-part of U.S. patent application Ser. No. 08/386,063, filed Feb. 7, 1995, now issued as U.S. Pat. No. 6,194,388, which is a continuation-in-part of U.S. patent application Ser. No. 08/276,358, filed Jul. 15, 1994, now abandoned.

Government Support

The work resulting in this invention was supported in part by National Institute of Health Grant No. R29-AR42556-01. The U.S. Government may therefore be entitled to certain rights in the invention.

BACKGROUND OF THE INVENTION

DNA binds to cell membranes and is internalized In the 1970's, several investigators reported the binding of high molecular weight DNA to cell membranes (Lerner, R. A., W. Meinke, and D. A. Goldstein. 1971. “Membrane-associated DNA in the cytoplasm of diploid human lymphocytes”. Proc. Natl. Acad. Sci. USA 68:1212; Agrawal, S. K., R. W. Wagner, P. K. McAllister, and B. Rosenberg. 1975. “Cell-surface-associated nucleic acid in tumorigenic cells made visible with platinum-pyrimidine complexes by electron microscopy”. Proc. Natl. Acad. Sci. USA 72:928). In 1985, Bennett et al. presented the first evidence that DNA binding to lymphocytes is similar to a ligand receptor interaction: binding is saturable, competitive, and leads to DNA endocytosis and degradation into oligonucleotides (Bennett, R. M., G. T. Gabor, and M. M. Merritt. 1985. “DNA binding to human leukocytes. Evidence for a receptor-mediated association, internalization, and degradation of DNA”. J. Clin. Invest. 76:2182). Like DNA, oligodeoxyribonucleotides (ODNs) are able to enter cells in a saturable, sequence independent, and temperature and energy dependent fashion (reviewed in Jaroszewski, J. W., and J. S. Cohen. 1991. “Cellular uptake of antisense oligodeoxynucleotides”. Advanced Drug Delivery Reviews 6:235; Akhtar, S., Y. Shoji, and R. L. Juliano. 1992. “Pharmaceutical aspects of the biological stability and membrane transport characteristics of antisense oligonucleotides”. In: Gene Regulation: Biology of Antisense RNA and DNA. R. P. Erickson, and J. G. Izant, eds. Raven Press, Ltd. New York, pp. 133; and Zhao, Q., T. Waldschmidt, E. Fisher, C. J. Herrera, and A. M. Krieg., 1994. “Stage specific oligonucleotide uptake in murine bone marrow B cell precursors”. Blood, 84:3660). No receptor for DNA or ODN uptake has yet been cloned, and it is not yet clear whether ODN binding and cell uptake occurs through the same or a different mechanism from that of high molecular weight DNA.

Lymphocyte ODN uptake has been shown to be regulated by cell activation. Spleen cells stimulated with the B cell mitogen LPS had dramatically enhanced ODN uptake in the B cell population, while spleen cells treated with the T cell mitogen Con A showed enhanced ODN uptake by T but not B cells (Krieg, A. M., F. Gmelig-Meyling, M. F. Gourley, W. J. Kisch, L. A. Chrisey, and A. D. Steinberg. 1991. “Uptake of oligodeoxyribonucleotides by lymphoid cells is heterogeneous and inducible”. Antisense Research and Development 1:161).

Immune Effects of Nucleic Acids

Several polynucleotides have been extensively evaluated as biological response modifiers. Perhaps the best example is poly (I,C) which is a potent inducer of IFN production as well as a macrophage activator and inducer of NK activity (Talmadge, J. E., J. Adams, H. Phillips, M. Collins, B. Lenz, M. Schneider, E. Schlick, R. Ruffmann, R. H. Wiltrout, and M. A. Chirigos. 1985. “Immunomodulatory effects in mice of polyinosinic-polycytidylic acid complexed with poly-L-lysine and carboxymethylcellulose”. Cancer Res. 45:1058; Wiltrout, R. H., R. R. Salup, T. A. Twilley, and J. E. Talmadge. 1985. “Immunomodulation of natural killer activity by polyribonucleotides”. J. Biol. Resp. Mod. 4:512; Krown, S. E. 1986. “Interferons and interferon inducers in cancer treatment”. Sem. Oncol. 13:207; and Ewel, C. H., S. J. Urba, W. C. Kopp, J. W. Smith II, R. G. Steis, J. L. Rossio, D. L. Longo, M. J. Jones, W. G. Alvord, C. M. Pinsky, J. M. Beveridge, K. L. McNitt, and S. P. Creekmore. 1992. “Polyinosinic-polycytidylic acid complexed with poly-L-lysine and carboxymethylcellulose in combination with interleukin-2 in patients with cancer: clinical and immunological effects”. Canc. Res. 52:3005). It appears that this murine NK activation may be due solely to induction of IFN-β secretion (Ishikawa, R., and C. A. Biron. 1993. “IFN induction and associated changes in splenic leukocyte distribution”. J. Immunol. 150:3713). This activation was specific for the ribose sugar since deoxyribose was ineffective. Its potent in vitro antitumor activity led to several clinical trials using poly (I,C) complexed with poly-L-lysine and carboxymethylcellulose (to reduce degradation by RNAse) (Talmadge, J. E., et al., 1985. cited supra; Wiltrout, R. H., et al., 1985. cited supra); Krown, S. E., 1986. cited supra); and Ewel, C. H., et al., 1992. cited supra). Unfortunately, toxic side effects have thus far prevented poly (I,C) from becoming a useful therapeutic agent.

Guanine ribonucleotides substituted at the C8 position with either a bromine or a thiol group are B cell mitogens and may replace “B cell differentiation factors” (Feldbush, T. L., and Z. K. Ballas. 1985. “Lymphokine-like activity of 8-mercaptoguanosine: induction of T and B cell differentiation”. J. Immunol. 134:3204; and Goodman, M. G. 1986. “Mechanism of synergy between T cell signals and C8-substituted guanine nucleosides in humoral immunity: B lymphotropic cytokines induce responsiveness to 8-mercaptoguanosine”. J. Immunol. 136:3335). 8-mercaptoguanosine and 8-bromoguanosine also can substitute for the cytokine requirement for the generation of MHC restricted CTL (Feldbush, T. L., 1985. cited supra), augment murine NK activity (Koo, G. C., M. E. Jewell, C. L. Manyak, N. H. Sigal, and L. S. Wicker. 1988. “Activation of murine natural killer cells and macrophages by 8-bromoguanosine”. J. Immunol. 140:3249), and synergize with IL-2 in inducing murine LAK generation (Thompson, R. A., and Z. K. Ballas. 1990. “Lymphokine-activated killer (LAK) cells. V. 8-Mercaptoguanosine as an IL-2-sparing agent in LAK generation”. J. Immunol. 145:3524). The NK and LAK augmenting activities of these C8-substituted guanosines appear to be due to their induction of IFN (Thompson, R. A., et al. 1990. cited supra). Recently, a 5′ triphosphorylated thymidine produced by a mycobacterium was found to be mitogenic for a subset of human γδ T cells (Constant, P., F. Davodeau, M. -A. Peyrat, Y. Poquet, G. Puzo, M. Bonneville, and J. -J. Foumie. 1994. “Stimulation of human γδ T cells by nonpeptidic mycobacterial ligands” Science 264:267). This report indicated the possibility that the immune system may have evolved ways to preferentially respond to microbial nucleic acids.

Several observations suggest that certain DNA structures may also have the potential to activate lymphocytes. For example, Bell et al. reported that nucleosomal protein-DNA complexes (but not naked DNA) in spleen cell supernatants caused B cell proliferation and immunoglobulin secretion (Bell, D. A., B. Morrison, and P. VandenBygaart. 1990. “Immunogenic DNA-related factors”. J. Clin. Invest. 85:1487). In other cases, naked DNA has been reported to have immune effects. For example, Messina et al. have recently reported that 260 to 800 bp fragments of poly (dG)·(dC) and poly (dG·dC) were mitogenic for B cells (Messina, J. P., G. S. Gilkeson, and D. S. Pisetsky. 1993. “The influence of DNA structure on the in vitro stimulation of murine lymphocytes by natural and synthetic polynucleotide antigens”. Cell. Immunol. 147:148). Tokunaga, et al. have reported that dG·dC induces IFN-γ and NK activity (Tokunaga, S. Yamamoto, and K. Namba. 1988. “A synthetic single-stranded DNA, poly(dG,dC), induces interferon-α/β and -γ, augments natural killer activity, and suppresses tumor growth” Jpn. J Cancer Res. 79:682). Aside from such artificial homopolymer sequences, Pisetsky et al. reported that pure mammalian DNA has no detectable immune effects, but that DNA from certain bacteria induces B cell activation and immunoglobulin secretion (Messina, J. P., G. S. Gilkeson, and D. S. Pisetsky. 1991. “Stimulation of in vitro murine lymphocyte proliferation by bacterial DNA”. J. Immunol. 147:1759). Assuming that these data did not result from some unusual contaminant, these studies suggested that a particular structure or other characteristic of bacterial DNA renders it capable of triggering B cell activation. Investigations of mycobacterial DNA sequences have demonstrated that ODN which contain certain palindrome sequences can activate NK cells (Yamamoto, S., T. Yamamoto, T. Kataoka, E. Kuramoto, O. Yano, and T. Tokunaga. 1992. “Unique palindromic sequences in synthetic oligonucleotides are required to induce INF and augment INF-mediated natural killer activity”. J. Immunol. 148:4072; Kuramoto, E., O. Yano, Y. Kimura, M. Baba, T. Makino, S. Yamamoto, T. Yamamoto, T. Kataoka, and T. Tokunaga. 1992. “Oligonucleotide sequences required for natural killer cell activation”. Jpn. J. Cancer Res. 83:1128).

Several phosphorothioate modified ODN have been reported to induce in vitro or in vivo B cell stimulation (Tanaka, T., C. C. Chu, and W. E. Paul. 1992. “An antisense oligonucleotide complementary to a sequence in Iγ2b increases γ2b germline transcripts, stimulates B cell DNA synthesis, and inhibits immunoglobulin secretion”. J. Exp. Med. 175:597; Branda, R. F., A. L. Moore, L. Mathews, J. J. McCormack, and G. Zon. 1993. “Immune stimulation by an antisense oligomer complementary to the rev gene of HIV-1”. Biochem. Pharmacol. 45:2037; McIntyre, K. W., K. Lombard-Gillooly, J. R. Perez, C. Kunsch, U. M. Sarmiento, J. D. Larigan, K. T. Landreth, and R. Narayanan. 1993. “A sense phosphorothioate oligonucleotide directed to the initiation codon of transcription factor NFκB T65 causes sequence-specific immune stimulation”. Antisense Res. Develop. 3:309; and Pisetsky, D. S., and C. F. Reich. 1993. “Stimulation of murine lymphocyte proliferation by a phosphorothioate oligonucleotide with antisense activity for herpes simplex virus”. Life Sciences 54:101). These reports do not suggest a common structural motif or sequence element in these ODN that might explain their effects.

The CREB/ATF Family of Transcription Factors and Their Role in Replication

The cAMP response element binding protein (CREB) and activating transcription factor (ATF) or CREB/ATF family of transcription factors is a ubiquitously expressed class of transcription factors of which 11 members have so far been cloned (reviewed in de Groot, R. P., and P. Sassone-Corsi: “Hormonal control of gene expression: Multiplicity and versatility of cyclic adenosine 3′,5′-monophosphate-responsive nuclear regulators”. Mol. Endocrin. 7:145, 1993; Lee, K. A. W., and N. Masson: “Transcriptional regulation by CREB and its relatives”. Biochim. Biophys. Acta 1174:221, 1993.). They all belong to the basic region/leucine zipper (bZip) class of proteins. All cells appear to express one or more CREB/ATF proteins, but the members expressed and the regulation of mRNA splicing appear to be tissue-specific. Differential splicing of activation domains can determine whether a particular CREB/ATF protein will be a transcriptional inhibitor or activator. Many CREB/ATF proteins activate viral transcription, but some splicing variants which lack the activation domain are inhibitory. CREB/ATF proteins can bind DNA as homo- or hetero-dimers through the cAMP response element, the CRE, the consensus form of which is the umethylated sequence TGACGTC (binding is abolished if the CpG is methylated) (Iguchi-Ariga, S. M. M., and W. Schaffner: “CpG methylation of the cAMP-responsive enhancer/promoter sequence TGACGTCA abolishes specific factor binding as well as transcriptional activation”. Genes & Develop. 3:612, 1989.).

The transcriptional activity of the CRE is increased during B cell activation (Xie, H. T. C. Chiles, and T. L. Rothstein: “Induction of CREB activity via the surface Ig receptor of B cells”. J. Immunol. 151:880, 1993.). CREB/ATF proteins appear to regulate the expression of multiple genes through the CRE including immunologically important genes such as fos, jun B, Rb-1, IL-6, IL-1 (Tsukada, J., K. Saito, W. R. Waterman, A. C. Webb, and P. E. Auron: “Transcription factors NF-IL6 and CREB recognize a common essential site in the human prointerleukin 1β gene”. Mol. Cell. Biol. 14:7285, 1994; Gray, G. D., O. M. Hernandez, D. Hebel, M. Root, J. M. Pow-Sang, and E. Wickstrom: “Antisense DNA inhibition of tumor growth induced by c-Ha-ras oncogene in nude mice”. Cancer Res. 53:577, 1993), IFN-β (Du, W., and T. Maniatis: “An ATF/CREB binding site protein is required for virus induction of the human interferon B gene”. Proc. Natl. Acad. Sci. USA 89:2150, 1992), TGF-β1 (Asiedu, C. K., L. Scott, R. K. Assoian, M. Ehrlich: “Binding of AP-1/CREB proteins and of MDBP to contiguous sites downstream of the human TGF-B1 gene”. Biochim. Biophys. Acta 1219:55, 1994.), TGF-β2, class II MHC (Cox, P. M., and C. R. Goding: “An ATF/CREB binding motif is required for aberrant constitutive expression of the MHC class II DRa promoter and activation by SV40 T-antigen”. Nucl. Acids Res. 20:4881, 1992.), E-selectin, GM-CSF, CD-8α, the germline Igα constant region gene, the TCR Vβ gene, and the proliferating cell nuclear antigen (Huang, D., P. M. Shipman-Appasamy, D. J. Orten, S. H. Hinrichs, and M. B. Prystowsky: “Promoter activity of the proliferating-cell nuclear antigen gene is associated with inducible CRE-binding proteins in interleukin 2-stimulated T lymphocytes”. Mol. Cell. Biol. 14:4233, 1994.). In addition to activation through the cAMP pathway, CREB can also mediate transcriptional responses to changes in intracellular Ca++ concentration (Sheng, M., G. McFadden, and M. E. Greenberg: “Membrane depolarization and calcium induce c-fos transcription via phosphorylation of transcription factor CREB”. Neuron 4:571, 1990).

The role of protein-protein interactions in transcriptional activation by CREB/ATF proteins appears to be extremely important. There are several published studies reporting direct or indirect interactions between NFκB proteins and CREB/ATF proteins (Whitley, et. al., (1994) Mol. & Cell. Biol. 14:6464; Cogswell, et al., (1994) J. Immun. 153:712; Hines, et al., (1993) Oncogene 8:3189; and Du, et al., (1993) Cell 74:887. Activation of CREB through the cyclic AMP pathway requires protein kinase A (PKA), which phosphorylates CREB341 on ser133 and allows it to bind to a recently cloned protein, CBP (Kwok, R. P. S., J. R. Lundblad, J. C. Chrivia, J. P. Richards, H. P. Bachinger, R. G. Brennan, S. G. E. Roberts, M. R. Green, and R. H. Goodman: “Nuclear protein CBP is a coactivator for the transcription factor CREB”. Nature 370:223, 1994; Arias, J., A. S. Alberts, P. Brindle, F. X. Claret, T. Smea, M. Karin, J. Feramisco, and M. Montminy: “Activation of cAMP and mitogen responsive genes relies on a common nuclear factor”. Nature 370:226, 1994.). CBP in turn interacts with the basal transcription factor TFIIB causing increased transcription. CREB also has been reported to interact with dTAFII 110, a TATA binding protein-associated factor whose binding may regulate transcription (Ferreri, K., G. Gill, and M. Montminy: “The cAMP-regulated transcription factor CREB interacts with a component of the TFIID complex”. Proc. Natl. Acad. Sci. USA 91:1210, 1994.). In addition to these interactions, CREB/ATF proteins can specifically bind multiple other nuclear factors (Hoeffler, J. P., J. W. Lustbader, and C. -Y. Chen: “Identification of multiple nuclear factors that interact with cyclic adenosine 3′,5′-monophosphate response element-binding protein and activating transcription factor-2 by protein-protein interactions”. Mol. Endocrinol. 5:256, 1991) but the biologic significance of most of these interactions is unknown. CREB is normally thought to bind DNA either as a homodimer or as a heterodimer with several other proteins. Surprisingly, CREB monomers constitutively activate transcription (Krajewski, W., and K. A. W. Lee: “A monomeric derivative of the cellular transcription factor CREB functions as a constitutive activator”. Mol. Cell. Biol. 14:7204, 1994.).

Aside from their critical role in regulating cellular transcription, it has recently been shown that CREB/ATF proteins are subverted by some infectious viruses and retroviruses, which require them for viral replication. For example, the cytomegalovirus immediate early promoter, one of the strongest known mammalian promoters, contains eleven copies of the CRE which are essential for promoter function (Chang, Y. -N., S. Crawford, J. Stall, D. R. Rawlins, K. -T. Jeang, and G. S. Hayward: “The palindromic series I repeats in the simian cytomegalovirus major immediate-early promoter behave as both strong basal enhancers and cyclic AMP response elements”. J. Virol. 64:264, 1990). At least some of the transcriptional activating effects of the adenovirus E1A protein, which induces many promoters, are due to its binding to the DNA binding domain of the CREB/ATF protein, ATF-2, which mediates E1A inducible transcription activation (Liu, F., and M. R. Green: “Promoter targeting by adenovirus E1a through interaction with different cellular DNA-binding domains”. Nature 368:520, 1994). It has also been suggested that E1A binds to the CREB-binding protein, CBP (Arany, Z., W. R. Sellers, D. M. Livingston, and R. Eckner: “E1A-associated p300 and CREB-associated CBP belong to a conserved family of coactivators”. Cell 77:799, 1994). Human T lymphotropic virus-I (HTLV-1), the retrovirus which causes human T cell leukemia and tropical spastic paresis, also requires CREB/ATF proteins for replication. In this case, the retrovirus produces a protein, Tax, oligonucleotides do not include a GCG trinucleotide sequence at or near the 5′ and/or 3′ terminals and/or the consensus mitogenic CpG motif is not a palindrome. Prolonged immunostimulation can be obtained using stabilized oligonucleotides, particularly phosphorothioate stabilized oligonucleotides.

In a second aspect, the invention features useful therapies, which are based on the immunostimulatory activity of the nucleic acid molecules. For example, the immunostimulatory nucleic acid molecules can be used to treat, prevent or ameliorate an immune system deficiency (e.g., a tumor or cancer or a viral, fungal, bacterial or parasitic infection in a subject). In addition, immunostimulatory nucleic acid molecules can be administered to stimulate a subject's response to a vaccine.

Further, by redirecting a subject's immune response from Th2 to Th1, the instant claimed nucleic acid molecules can be administered to treat or prevent the symptoms of asthma. In addition, the instant claimed nucleic acid molecules can be administered in conjunction with a particular allergen to a subject as a type of desensitization therapy to treat or prevent the occurrence of an allergic reaction.

Further, the ability of immunostimulatory nucleic acid molecules to induce leukemic cells to enter the cell cycle supports the use of immunostimulatory nucleic acid molecules in treating leukemia by increasing the sensitivity of chronic leukemia cells and then administering conventional ablative chemotherapy, or combining the immunostimulatory nucleic acid molecules with another immunotherapy.

Other features and advantages of the invention will become more apparent from the following detailed description and claims.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1A-C are graphs plotting dose-dependent IL-6 production in response to various DNA sequences in T cell depleted spleen cell cultures. A. E. coli DNA (●) and calf thymus DNA (▪) sequences and LPS (at 10× the concentration of E. coli and calf thymus DNA) (♦). B. Control phosphodiester oligodeoxynucleotide (ODN) 5′ATGGAAGGTCCAGTGTTCTC3′ (SEQ ID NO:1) (▪) and two phosphodiester CpG ODN5′ATCGACCTACGTGCGTTCTC3′ (SEQ ID NO:2) (♦) and 5′TCCATAACGTTCCTGATGCT3′ (SEQ ID NO:3) (●). C. Control phosphorothioate ODN5′GCTAGATGTTAGCGT3′ (SEQ ID NO:4) (▪) and two phosphorothioate CpG ODN5′GAGAACGTCGACCTTCGAT3′ (SEQ ID NO:5) (♦) and 5′GCATGACGTTGAGCT3′ (SEQ ID NO:6) (●). Data present the mean±standard deviation of triplicates.

FIG. 2 is a graph plotting IL-6 production induced by CpG DNA in vivo as determined 1-8 hrs after injection. Data represent the mean from duplicate analyses of sera from two mice. BALB/c mice (two mice/group) were injected iv. with 100 ill of PBS (□) or 200 μg of CpG phosphorothioate ODN 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) (ζ) or non-CpG phosphorothioate ODN 5′ TCCATGAGCTTCCTGAGTCT 3′ (SEQ ID NO:8) (♦).

FIG. 3 is an autoradiograph showing IL-6 mRNA expression as determined by reverse transcription polymerase chain reaction in liver, spleen, and thymus at various time periods after in vivo stimulation of BALB/c mice (two mice/group) injected iv with 100 μl of PBS, 200 μg of CpG phosphorothioate ODN 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) or non-CpG phosphorothioate ODN 5′ TCCATGAGCTTCCTGAGTCT 3′ (SEQ ID NO:8).

FIG. 4A is a graph plotting dose-dependent inhibition of CpG-induced IgM production by anti-IL-6. Splenic B-cells from DBA/2 mice were stimulated with CpG ODN5′TCCAAGACGTTCCTGATGCT3′ (SEQ ID NO:9) in the presence of the indicated concentrations of neutralizing anti-IL-6 (♦) or isotype control Ab (●) and IgM levels in culture supernatants determined by ELISA. In the absence of CpG ODN, the anti-IL-6 Ab had no effect on IgM secretion (▪).

FIG. 4B is a graph plotting the stimulation index of CpG-induced splenic B cells cultured with anti-IL-6 and CpG S-ODN 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) (♦) or anti-IL-6 antibody only (▪). Data present the mean±standard deviation of triplicates.

FIG. 5 is a bar graph plotting chloramphenicol acetyltransferase (CAT) activity in WEHI-231 cells transfected with a promoter-less CAT construct (pCAT), positive control plasmid (RSV), or IL-6 promoter-CAT construct alone or cultured with CpG 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) or non-CpG 5′ TCCATGAGCTTCCTGAGTCT 3′ (SEQ ID NO:8) phosphorothioate ODN at the indicated concentrations. Data present the mean of triplicates.

FIG. 6 is a schematic overview of the immune effects of the immunostimulatory unmethylated CpG containing nucleic acids, which can directly activate both B cells and monocytic cells (including macrophages and dendritic cells) as shown. The immunostimulatory oligonucleotides do not directly activate purified NK cells, but render them competent to respond to IL-12 with a marked increase in their IFN-Îł production. By inducing IL-12 production and the subsequent increased IFN-Îł secretion by NK cells, the immunostimulatory nucleic acids promote a Th1 type immune response. No direct activation of proliferation of cytokine secretion by highly purified T cells has been found. However, the induction of Th1 cytokine secretion by the immunostimulatory oligonucleotides promotes the development of a cytotoxic lymphocyte response.

FIG. 7 is an autoradiograph showing NFÎşB mRNA induction in monocytes treated with E. coli (EC) DNA (containing unmethylated CpG motifs), control (CT) DNA (containing no unmethylated CpG motifs) and lipopolysaccharide (LPS) at various measured times, 15 and 30 minutes after contact.

FIG. 8A shows the results from a flow cytometry study using mouse B cells with the dihydrorhodamine 123 dye to determine levels of reactive oxygen species. The dye only sample in Panel A of the figure shows the background level of cells positive for the dye at 28.6%. This level of reactive oxygen species was greatly increased to 80% in the cells treated for 20 minutes with PMA and ionomycin, a positive control (Panel B). The cells treated with the CpG oligo (TCCATGACGTTCCTGACGTT SEQ ID NO:10) also showed an increase in the level of reactive oxygen species such that more than 50% of the cells became positive (Panel D). However, cells treated with an oligonucleotide with the identical sequence except that the CpGs were switched (TCCATGAGCTTCCTGAGTGCT SEQ ID NO:11) did not show this significant increase in the level of reactive oxygen species (Panel E).

FIG. 8B shows the results from a flow cytometry study using mouse B cells in the presence of chloroquine with the dihydrorhodamine 123 dye to determine levels of reactive oxygen species. Chloroquine slightly lowers the background level of reactive oxygen species in the cells such that the untreated cells in Panel A have only 4.3% that are positive. Chloroquine completely abolishes the induction of reactive oxygen species in the cells treated with CpG DNA (Panel B) but does not reduce the level of reactive oxygen species in the cells treated with PMA and ionomycin (Panel E).

FIG. 9 is a graph plotting lung lavage cell count over time. The graph shows that when the mice are initially injected with Schistosoma mansoni eggs “egg”, which induces a Th2 immune response, and subsequently inhale Schistosoma mansoni egg antigen “SEA” (open circle), many inflammatory cells are present in the lungs. However, when the mice are initially given CpG oligo (SEQ ID NO:10) along with egg, the

Claims

1-18. (Cancelled)

19. A method of stimulating interferon-alpha in a subject comprising administering to a subject an immunostimulatory oligonucleotide/delivery complex, said delivery complex comprising a oligonucleotide linked to a biodegradable delivery complex, wherein the oligonucleotide comprises the sequence 5′-C, G-3′, in an amount sufficient to increase interferon-alpha in the subject.

20. The method of claim 19, wherein said complex is antigen-free.

21. The method of claim 19, wherein said complex further comprises an antigen.

22. The method of claim 19, wherein said delivery complex is a liquid phase microcarrier.

23. The method of claim 19, wherein said immunostimulatory oligonucleotide is covalently linked to said delivery complex.

24. The method of claim 19, wherein said immunostimulatory oligonucleotide is non-covalently linked to said delivery complex.

25. The method of claim 19, wherein said immunostimulatory oligonucleotide comprises a phosphate backbone modification.

26. The method of claim 25, wherein said phosphate backbone modification is a phosphorothioate.

27. The method of claim 19, wherein the immunostimulatory oligonucleotide is 8 to 40 nucleotides in length and comprises:

5′X1X2CGX3X43′, wherein C and G are unmethylated and X1, X2, X3, and X4 are nucleotides.

28. The method of claim 27, wherein the immunostimulatory oligonucleotide does not include a GCG trinucleotide at a 5′ and/or 3′ terminal.

29. The method of claim 19 wherein the immunostimulatory oligonucleotide does not contain a 5′X1X2CGX3X43′ palindrome.

30. The method of claim 27 wherein the immunostimulatory oligonucleotide does not contain a 5′X1X2CGX3X43′ palindrome.

31. The method of claim 19, wherein said oligonucleotide comprises the sequence 5′-T, C, G-3′.

32. The method of claim 19, wherein the individual has a viral infection.

33. The method of claim 19, wherein said delivery complex is less than 10 ÎĽm in size.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: