Patent application title:

Cell death-related nucleases and their uses

Publication number:

US20050142568A1

Publication date:
Application number:

10/830,828

Filed date:

2004-04-23

✅ Patent granted

Patent number:

US 7,368,237 B2

Grant date:

2008-05-06

PCT filing:

-

PCT publication:

-

Examiner:

Rebecca E. Prouty | Iqbal Chowdhury

Adjusted expiration:

2025-07-27

Abstract:

An assay uses apoptotic nucleases to screen for apoptosis modulators, in a method of modulating apoptosis, and in a method of aiding in a diagnosis of a disease, among other methods. materials for use in the assay include isolated or recombinant polypeptides and polynucleotides, compositions comprising those isolated or recombinant polypeptides and polynucleotides, vectors, transgenic organisms, and integrated systems among other aspects.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C07K1/00 IPC

General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length

C12Q1/44 »  CPC main

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving hydrolase involving esterase

A01K2217/058 »  CPC further

Genetically modified animals; Animals comprising random inserted nucleic acids (transgenic) inducing loss of function due to expression of inhibitory nucleic acid, e.g. siRNA, antisense

A01K2227/703 »  CPC further

Animals characterised by species; Invertebrates Worms, e.g. Caenorhabdities elegans

G01N2333/922 »  CPC further

Assays involving biological materials from specific organisms or of a specific nature; Enzymes; Proenzymes; Hydrolases (3) acting on ester bonds (3.1), e.g. phosphatases (3.1.3), phospholipases C or phospholipases D (3.1.4) Ribonucleases (RNAses); Deoxyribonucleases (DNAses)

G01N2510/00 »  CPC further

Detection of programmed cell death, i.e. apoptosis

C12Q1/68 IPC

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids

C12P21/06 IPC

Preparation of peptides or proteins produced by the hydrolysis of a peptide bond, e.g. hydrolysate products

C12N15/70 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression Vectors or expression systems specially adapted for E. coli

C07K16/00 IPC

Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies

C07H21/04 IPC

Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical

Description

RELATED APPLICATIONS

The present application claims benefit of priority to U.S. Provisional Patent Application Ser. No. 60/465,086 filed Apr. 23, 2003 and 60/498,065 filed Aug. 26, 2003, both of which applications are hereby incorporated by reference to the same extent as though fully replicated herein.

GOVERNMENT INTERESTS

This invention was made with government support under Grant Nos. GM59083-04 and DAMD17-01-1-0214 awarded by the National Institutes of Health and the U.S. Army Research Office, respectively. The government has certain rights in the invention.

SEQUENCE LISTING

This application is accompanied by a Sequence Listing in printed and computer readable forms that are identical to one another, which are hereby incorporated by reference to the same extent as though fully replicated herein.

BACKGROUND

1. Field of the Invention

The invention pertains to materials and methods that may be used in investigating the mechanisms of apoptosis and, more particularly, nucleases that are implicated in apoptotic DNA degradation. The invention also further relates to materials and methods that may be useful for identifying therapeutic agents that target the apoptotic pathways.

2. Description of the Related Art

As used in the discussion below, references by author name and publication year are more particularly cited in the References section. Programmed cell death or apoptosis is needed for the development and tissue homeostasis of metazoans, for example, as discussed in Steller (1995); and Vaux and Korsmeyer (1999). Despite its significant role in many biological processes; apoptosis and its associated biochemical pathways are poorly understood. There is a need to improve understanding about apoptosis pathways for the development of useful pharmacological agents.

One step in apoptosis is the fragmentation of chromosomal DNA at internucleosomal regions. This fragmentation generates DNA ladders approximately 180 base pairs (bp) in length, as described by Wyllie (1980); and Zhang and Xu (2002). Several nucleases have been implicated in mediating this chromosome fragmentation processes, including DFF40/CAD, a 40 kD DNA fragmentation factor (DFF)/Caspase-Activated Deoxyribonuclease (CAD) (see Enari et al., (1998); Liu et al. (1997); and Liu et al. (1998)) and mitochondrial endonuclease G (Endo G) (see Li et al., 2001; and Parrish et al. (2001). Parrish et al. (2001) is incorporated by reference to the same extent as though fully replicated herein.

DFF40/CAD normally associates tightly with its cognate inhibitor, DFF45/ICAD, but is activated during apoptosis when it is released from DFF45/ICAD as a result of caspase cleavage of DFF45/ICAD. In contrast, Endo G is released from mitochondria and translocates to nuclei during apoptosis to induce DNA fragmentation in a manner that is independent of caspase and DFF40, as reported by Li et al. (2001). These different mechanisms show that multiple DNA degradation pathways exist. In addition, several other mammalian proteins, including apoptosis-inducing factor (AIF), DNaseII, Topoisomerase II, and cyclophilins have been implicated in mediating apoptotic DNA degradation, mostly based on in vitro studies, as described in Zhang and Xu (2002).

In the nematode C. elegans, at least two nucleases have been shown to mediate apoptotic DNA degradation: NUC-1, a worm type-II DNase discussed in Wu et al. (2000), and CPS-6, which is the C. elegans ortholog of Endo G described in Parrish et al. (2001). Loss-of-function mutations in either cps-6 or nuc-1 genes result in accumulation of TUNEL (for “‘TdT-mediated dUTP nick end labeling’”)-positive nuclei in mutant embryos. Thus, both CPS-6 and NUC-1 proteins appear to function to play a role in resolving 3′OH DNA breaks labeled by TUNEL, that are generated during apoptosis, as described in Parrish et al. (2001; and Wu et al. (2000). In addition, cell deaths in the cps-6 mutant are delayed, and sometimes blocked in sensitized genetic backgrounds, suggesting that the DNA degradation process is implicated in apoptosis, as reported by Parrish et al. (2001).

Unlike cps-6, nuc-1 appears to be dispensable for apoptosis. NUC-1 likely acts in a different DNA degradation pathway because cps-6, nuc-1 double mutants have higher numbers of TUNEL-positive cells than those of either mutant alone, as reported by Parrish et al. (2001). Recently, WAH-1, a C. elegans homolog of human apoptosis-inducing factor (AIF), was found to associate with and cooperate with cps-6 to promote DNA degradation in C. elegans, as reported in Wang et al. (2002). These results indicate that other unidentified proteins may be involved in the regulation of apoptotic DNA degradation in C. elegans. It is problematic that neither nuc-1 or cps-6 mutants nor wah-1 RNA-mediated interference animals display easily detectable phenotypes which would encourage additional genetic screens for mutants with similar cell death defects. Thus, there is a need to develop a more powerful and systematic method to identify molecular components that are involved in apoptotic DNA degradation. There is also a need to identify proteins that are involved in the execution of apoptosis and to gain knowledge on their mechanisms of action, because knowledge about these proteins may prove valuable for the diagnosis as well as treatment of diseases.

SUMMARY

The instrumentalities described herein overcome the problems outlined above and advance the art by providing an assay together with related materials and methods that may be used to investigate the molecular components of apoptotic DNA degradation. The nucleases are particularly described herein in context of the nematode C. elegans and in mammalian systems; however, the nucleases have homologs or orthologs across many species of plants and animals.

In one aspect, the molecular components relate to the molecular genetic and biochemical characterization of proteins implicated in DNA fragmentation, which are exemplified by seven nucleases isolated from C. elegans and are referred to herein as cell death-related nucleases (CRN). Members of the CRN family of nucleases may be identified and/or characterized by genetic screening or biochemical methods, such as RNAi (RNA-mediated interference)-based screens or co-IP (immunoprecipitation) techniques. The CRN nucleases may act alone or form protein complexes with other nucleases and non-nuclease factors. The CRN nucleases and related materials may be provided in an assay kit that may be used for a variety of purposes including but not limited to, the screening of candidate apoptosis modulators to develop pharmacological agents, characterization of functional domains by use of the wild-type or mutated CRN nucleases, development and assessment of transgenic hosts capable of overexpressing or underexpressing the CRN nucleases, and development and assessment of host organisms or host cells in which the expression levels of the CRN nucleases are altered, or genes encoding the CRN nucleases are mutated, or disrupted.

As illustrated herein by way of example, genetic screening may be performed in C. elegans and other organisms, to isolate mutations that enhance or suppress CRN-mediated apoptosis. For example, this type of screening may be used to identify genes having protein expression products that cooperate with the CRN nucleases in C. elegans and other organisms to promote apoptosis.

In one example, a method of screening for an apoptosis modulator includes contacting at least one candidate apoptosis modulator with at least one CRN polypeptide including a sequence selected from SEQ ID NOS: 1-51, and/or at least one crn polynucleotide that encodes the CRN polypeptide. The method may also include detecting a modulated activity of the CRN polypeptide, thereby screening to confirm the apoptosis modulator. Alternatively, screening may be performed to modulate expression of a cm polynucleotide, for example, by imposing environmental conditions that activate or inactivate a promoter. Detection may be accomplished, for example, by antibody techniques such as ELISA to detect polypeptides or nucleic acids, or in the case of nucleic acids by amplification with polymerase chain reaction and/or micro array techniques.

In another aspect, the apoptosis modulator may be used in a method of modulating apoptosis. The method includes administering an effective amount of at least one apoptosis modulator to a test subject or host, where the apoptosis modulator modulates the activity of at least one CRN polypeptide including, for example, a sequence selected from SEQ ID NOS: 1-51. Alternatively, the method may entail administering an apoptosis modulator that modulates the expression of a crn gene. In certain embodiments, apoptosis modulators may be administered to tumor cells to increase the activity of one or more of these CRN polypeptides and kill the tumor cells. In other exemplary embodiments, apoptosis modulators are administered to subjects afflicted with autoimmune diseases, for example, systemic lupus erythematosus (SLE) among many other such autoimmune diseases, to modulate defects in apoptosis and clearance of apoptotic cellular debris. In some embodiments, nuclease activity is beneficially increased, for example, to degrade extracellular DNA such as in the kidneys of lupus patients. In other embodiments, inhibitors of the nucleases described herein are administered to inhibit apoptosis, which has the effect of decreasing certain autoimmune disease responses, e.g., by sustaining white blood cells in diseases that produce low white blood cell counts.

In yet another aspect, a method of diagnosing a disease, such as cancer or autoimmune diseases among many others, may include detecting the expression at either the mRNA or protein levels of at least one crn gene at either the mRNA or protein levels, for example, including crn polynucleotide that encodes the CRN polypeptide selected from SEQ ID NOS: 1-51, in one or more samples from a subject to produce expression data. The method may further include detecting in an organism, including but not limited to human, mutations in at least one crn gene, including crn polynucleotide that encodes the CRN polypeptide selected from SEQ ID NOS: 1-51. The method may further include correlating the expression data or the mutation data with a probable diagnosis of the disease or a negative diagnosis.

A kit may be provided for identifying apoptosis modulators. The kit may contain at least one CRN polypeptide or a fragment thereof, including, for example, a polypeptide sequence selected from SEQ ID NOS: 1-51, and/or at least one crn polynucleotide that encodes the CRN polypeptide or a fragment thereof. The kit may further contain instructions describing the use of the kit. Such kits may be used to screen for compounds or drugs that interact with the CRN polypeptides of SEQ ID NOS: 1-51 and/or at least one crn polynucleotide that encodes the CRN polypeptide to modulate apoptosis.

A kit may be used to diagnose a disease, where the kit may contain an antibody that specifically binds to a CRN polypeptide having a sequence selected from SEQ ID NOS: 1-51, wherein the antibody may form part of an antisera. Other diagnostic tools may include an antigen or antibody bound to a substrate, for example, to facilitate optical detection of an antibody/antigen interaction. Additional diagnostic tools may be included, for example, PCR primers targeting a cm polynucleotide for use in polymerase chain reaction amplification and/or microarrays capable of detecting the amplified polynucleotide. The kit may further include directions describing the use of the kit.

Various organisms, such as mammals including rodents, etc., may be genetically altered to disrupt one or more of the crn genes. crn gene-deficient organisms such as these are useful, for example, in examining potential pathological phenotypes or the like, which provide additional information on the pathological and physiological roles of CRN homologs or orthologs in other organisms, such as humans. In other contexts, expression of proteins encoded by the crn genes may be blocked, for example, using RNAi to modulate mammalian crn gene expression.

In a further aspect, an isolated CRN polypeptide may have a sequence selected or derived from SEQ ID NOS: 1-51. An isolated or recombinant crn polynucleotide may encode the CRN polypeptide or a variant thereof. The crn polynucleotide, either full-length or in its truncated version, may be inserted into a vector, and the resultant vector may be used to transform a host, such as a cell that is transduced by the vector. Moreover, chimeric higher organisms may contain the crn polynucleotide, variants of the crn polynucleotide and/or the vector.

The crn polynucleotide may be used to produce a CRN polypeptide. This can be achieved by introducing into a cell a crn polynucleotide that encodes a CRN polypeptide including, for example, a sequence selected from SEQ ID NOS: 1-51. The crn polynucleotide can be operatively linked to a regulatory sequence that controls the production of the encoded CRN polypeptide in the cells. The method may also include growing the cells in a culture medium to produce the polypeptide, and isolating the polypeptide from the cells or from the culture medium. Alternatively, the CRN polypeptide can be obtained using a crn polynucleotide as a template in an in vitro expression system.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 illustrates CRN nucleases grouped according to apoptosis activity level, as confirmed by TUNEL assay in screening data from the C. elegans genome;

FIGS. 2A through 2F show a comparison of bioinformatic data relating sequence identities between the crn nucleases and human homologues of the CRN nucleases;

FIG. 3 shows data indicating that CYP-13 but not CYP-1 is a nuclease in vitro;

FIGS. 4A through 4J show a time-course analysis of embryonic cell corpses;

FIG. 5 shows an interaction map for nucleases involved in apoptotic DNA degradation in C. elegans;

FIG. 6A shows sequence alignment of CRN-1 and human FEN-I where black shaded residues are identical and gray shaded residues are similar in two proteins;

FIGS. 6B to 6E show results from TUNEL assays on C. elegans larvae;

FIGS. 6F to I show time course analysis of embryonic cell corpses where N2 (F), ced-8(n1891) (G), cps-6(sml16) (H), cps-6(sml16); ced-8(n1891) (I) animals were treated with control (RNAi) or crn-1 (RNAi) and their progeny were scored for cell corpses in comma, 1.5 fold, 2 fold, 2.5 fold, 3 fold, 4 fold stage embryos, as well as early L1 larvae, with at least 15 animals scored for each stage;

FIG. 6J to M show data derived from control and crn-1(RNAi) treatment at the same stage with a comparison using an unpaired t test;

FIGS. 7A, 7B, 7C and 7D show results from GST pull down assays to characterize and compare activities of CRN-1 and CPS-6;

FIGS. 8A to 8D show a comparison of DNA degradation activity in a time-dependant introduction of CRN-1 and CPS-6;

FIG. 9 is a schematic apoptotic pathway involving CRN-1 and CPS-6; and

FIG. 10 depicts an assay kit in use to perform DNA degradation studies.

DETAILED DESCRIPTION

The methods and materials described herein relate to cell-death related or CRN nucleases, together with vectors and host cells that contain the nucleic acids encoding the CRN nucleases, homologs and orthologs of the CRN nucleases, methods for producing the CRN nucleases and methods for identifying compounds which bind to and/or modulate the activity of the CRN nucleases.

It is to be understood that the following text teaches by way of example, and not by limitation. the instrumentalities described herein are broader than the particular methods and materials, which may vary within the skill of the art. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. Further, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the related art. The following terminology and grammatical variants are used in accordance with the definitions set out below.

A “host cell,” as used herein, refers to a prokaryotic or eukaryotic cell that contains heterologous DNA which has been introduced into the cell by any means, e.g., electroporation, calcium phosphate precipitation, microinjection, transformation, viral infection, and/or the like.

A “vector” is a composition for facilitating introduction, replication and/or expression of a selected nucleic acid in a cell. Vectors include, for example, plasmids, cosmids, viruses, yeast artificial chromosomes (YACs), etc. A “vector nucleic acid” is a nucleic acid vector into which heterologous nucleic acid is optionally inserted and which can then be introduced into an appropriate host cell. Vectors preferably have one or more origins of replication, and one or more sites into which the recombinant DNA can be inserted. Vectors often have convenient markers by which cells with vectors can be selected from those without. By way of example, a vector may encode a drug resistance gene to facilitate selection of cells that are transformed with the vector. Common vectors include plasmids, phages and other viruses, and “artificial chromosomes.” “Expression vectors” are vectors that comprise elements that provide for or facilitate transcription of nucleic acids which are cloned into the vectors. Such elements can include, for example, promoters and/or enhancers operably coupled to a nucleic acid of interest.

A “CRN material” includes crn polynucleotides, CRN polypeptides, mutated forms of crn polynucleotides, mutated forms of CRN polypeptides, and fragments thereof. Unless otherwise indicated, this definition does not require the CRM material to be designated with a cm or CRN prefix in the discussion below, for example, in that CYP-13 is included as a CRN material unless otherwise indicated. The fragments may be of sufficient length to cover a region of interest in the polynucleotide or polypeptide, for example, in the case of a polypeptide the fragment may include 10 residues, 15 residues, 25 residues, 50 residues, 100 residues, 250 residues 500 residues, or more. A polynucleotide may be of sufficient length to encode the fragment. The fragments may be spliced, for example, as a fusion protein or synthetic gene. A mutated form may contain a single site mutation or a plurality of such mutations in a region compared to the native form of the crn polynucleotide or CRN polypeptide, but also retains high sequence identify over that region, such as at least 99%, 98% or 95% sequence identify. CRN materials at least include those shown in SEQ ID NOS. 1-51. Where the CRN material is a polynucleotide and an open reading frame is shown in any one of SEQ ID NOs. 1-51, the CRN material is hereby defined as the open reading frame exclusive of other nucleotides that are not in the open reading frame as shown.

“Plasmids” generally are designated herein by a lower case “p” preceded and/or followed by capital letters and/or numbers, in accordance with standard nomenclatures that are familiar to those of skill in the art. Starting plasmids disclosed herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids by routine application of well known, published procedures. Many plasmids and other cloning and expression vectors are well known and readily available to those of skill in the art. Moreover, those of skill readily may construct any number of other plasmids suitable for use as described below. The properties, construction and use of such plasmids, as well as other vectors, is readily apparent to those of ordinary skill upon reading the present disclosure.

The term “isolated” means that the material is removed from its original environment, such as the native or natural environment if the material is naturally occurring. For example, a naturally-occurring nucleic acid, polypeptide, or cell present in a living animal is not isolated, but the same polynucleotide, polypeptide, or cell separated from some or all of the coexisting materials in the natural system, is isolated, even if subsequently reintroduced into the natural system. Such nucleic acids can be part of a vector and/or such nucleic acids or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.

A “recombinant nucleic acid” is one that is made by recombining nucleic acids, e.g., during cloning, DNA evolution or other procedures. A “recombinant polypeptide” is a polypeptide which is produced by expression of a recombinant nucleic acid. An “amino acid sequence” is a polymer of amino acid residues (a protein, polypeptide, etc.) or a character string representing an amino acid polymer, depending on context. Either the given nucleic acid or the complementary nucleic acid can be determined from any specified polynucleotide sequence.

The terms “nucleic acid,” or “polynucleotide” refer to a deoxyribonucleotide, in the case of DNA, or ribonucleotide in the case of RNA polymer in either single- or double-stranded form, and unless otherwise specified, encompasses known analogues of natural nucleotides that can be incorporated into nucleic acids in a manner similar to naturally occurring nucleotides. A “polynucleotide sequence” is a nucleic acid which is a polymer of nucleotides (A,C,T,U,G, etc. or naturally occurring or artificial nucleotide analogues) or a character string representing a nucleic acid, depending on context. Either the given nucleic acid or the complementary nucleic acid can be determined from any specified polynucleotide sequence.

A “subsequence” or “fragment” is any portion of an entire sequence of a DNA, RNA or polypeptide molecule, up to and including the complete sequence. Typically a subsequence or fragment comprises less than the full-length sequence, and is sometimes referred to as the “truncated version.”

A “polynucleotide construct” is a polynucleotide, a fragment of a polynucleotide or a vector comprising a polynucleotide or fragment thereof. Polynucleotide constructs may be used prophylactically or therapeutically to modulate gene expression when administered in vivo or ex vivo to a cell or cell population of a subject.

Nucleic acids and/or nucleic acid sequences are “homologous” when they are derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence. Proteins and/or protein sequences are homologous when their encoding DNAs are derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence. Similarly, nucleic acids and/or nucleic acid sequences are homologous when they are derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence. For example, any naturally occurring nuclease-encoding nucleic acid, as described herein, can be modified by any available mutagenesis method. When expressed, this mutagenized nucleic acid encodes a polypeptide that is homologous to the protein encoded by the original nuclease-encoding nucleic acid. Homology is generally inferred from sequence identity between two or more nucleic acids or proteins (or sequences thereof). The precise percentage of identity between sequences that is useful in establishing homology varies with the nucleic acid and protein at issue, but as little as 25% sequence identity is routinely used to establish homology. Higher levels of sequence identity, e.g., 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more can also be used to establish homology. Methods for determining sequence identity percentages (e.g., BLASTP and BLASTN using default parameters) are described herein and are generally available.

The terms “identical”, “sequence identical” or “sequence identity” in the context of two nucleic acid sequences or amino acid sequences refers to the residues in the two sequences which are the same when aligned for maximum correspondence over a specified comparison window. A “comparison window”, as used herein, refers to a segment of at least about 20 contiguous positions, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are aligned optimally. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math. 2:482; by the alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443; by the search for similarity method of Pearson and Lipman (1988) Proc. Nat. Acad. Sci U.S.A. 85:2444; by computerized implementations of these algorithms (including, but not limited to CLUSTAL in the PC/Gene program by Intelligentics, Mountain View Calif., GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis., U.S.A.); the CLUSTAL program is well described by Higgins and Sharp (1988) Gene 73:237-244 and Higgins and Sharp (1989) CABIOS 5:151-153; Corpet et al. (1988) Nucleic Acids Res. 16:10881-10890; Huang et al (1992) Computer Applications in the Biosciences 8:155-165; and Pearson et al. (1994) Methods in Molecular Biology 24:307-331. Alignment is also often performed by inspection and manual alignment. In one class of embodiments, the polypeptides herein are at least 70%, generally at least 75%, optionally at least 80%, 85%, 90%, 95% or 99% or more identical to a reference polypeptide, e.g., as set forth at any one of SEQ ID NO: 1-51 or a fragment thereof, e.g., as measured by BLASTP (or CLUSTAL, or any other available alignment software) using default parameters. Similarly, nucleic acids can also be described with reference to a starting nucleic acid, e.g., they can be 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more identical to a reference nucleic acid, e.g., a polynucleotide that encodes a polypeptide as set forth at any one of SEQ ID NO: 1-51 or a fragment thereof, e.g., as measured by BLASTN (or CLUSTAL, or any other available alignment software) using default parameters.

The term “substantially identical” as applied to nucleic acid or amino acid sequences means that a nucleic acid or amino acid sequence comprises a sequence that has at least 90% sequence identity or more, preferably at least 95%, more preferably at least 98% and most preferably at least 99%, compared to a reference sequence using the programs described above (preferably BLAST) using standard parameters. For example, the BLASTN program (for nucleotide sequences) uses as defaults a word length (W) of 11, an expectation (E) of 10, M=5, N=−4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word length (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff& Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)). Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. Preferably, the substantial identity exists over a region of the sequences that is at least about 50 residues in length, more preferably over a region of at least about 100 residues, and most preferably the sequences are substantially identical over at least about 150 residues. In a most preferred embodiment, the sequences are substantially identical over the entire length of the coding regions.

“Stringent hybridization” conditions or “stringent conditions” in the context of nucleic acid hybridization assay formats highly stringent conditions are generally selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature, under defined other conditions of ionic strength and pH, at which 50% of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are selected to be equal to the Tm point for a particular nucleic acid, This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.

The term “polypeptide” is used interchangeably herein with the terms “polypeptides” and “protein(s)”, and refers to a polymer of amino acid residues, e.g., as typically found in proteins in nature. A ‘mature protein’ is a protein which is full-length and which, optionally, includes glycosylation or other modifications typical for the protein in a given cellular environment.

The term “modulate” with respect to a nuclease as described herein refers to a change in the activity of the nuclease or fragment thereof. For example, modulation may cause an increase or a decrease in catalytic activity, binding characteristics, membrane permeability, phosphorylation status, posttranslational modifications such as phosphorylation, or any other biological, functional, or immunological properties of such proteins. Modulation may result from protein degradation, a chemical change or mutation in the protein itself, the association between the protein and other cofactors, and a chemical change in a receptor or binding site on a substrate for the nuclease. For example, a molecule that binds to a receptor can cause an increase or decrease in the biological activity of the receptor. As applied to polynucleotides, the term modulate means a change in the level of expression from the polynucleotide. The change in expression level can arise from, for example, an increase or decrease in the transcription of the genes that encode the protein, the stability of the mRNA that encodes the protein, translation efficiency.

The term “variant” or “mutant” with respect to a polypeptide refers to an amino acid sequence that is altered by one or more amino acids with respect to a reference sequence. The variant can have “conservative” changes, wherein a substituted amino acid has similar structural or chemical properties, e.g., replacement of leucine with isoleucine. Alternatively, a variant can have “nonconservative” changes, e.g., replacement of a glycine with a tryptophan. Analogous minor variation can also include amino acid deletion or insertion, or both. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without eliminating biological or immunological activity can be found using computer programs well known in the art, for example, DNASTAR software.

As used herein, an “antibody” is a protein comprising one or more polypeptides substantially or partially encoded by immunoglobulin genes or fragments of immunoglobulin genes. A typical immunoglobulin (antibody) structural unit comprises a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains. The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. Antibodies exist as intact immunoglobulins or as a number of well characterized fragments produced by digestion with various peptidases. While various antibody fragments are defined in terms of the digestion of an intact antibody, one of skill will appreciate that such fragments may be synthesized de novo either chemically or by utilizing recombinant DNA methodology. Thus, the term antibody, as used herein, includes antibodies or fragments either produced by the modification of whole antibodies or synthesized de novo using recombinant DNA methodologies. Antibodies include multiple or single chain antibodies.

A variety of additional terms are defined or otherwise characterized herein.

In practicing the instrumentalities described herein, many conventional techniques in molecular biology, microbiology, and recombinant DNA are optionally used. These techniques are well known to those of ordinary skill in the art. For example, one skilled in the art would be familiar with techniques for in vitro amplification methods, including the polymerase chain reaction (PCR), Qβ-replicase amplification and other RNA polymerase mediated techniques such as NASBA, e.g., for the production of the homologous nucleic acids described herein.

In addition, commercially available kits may facilitate the purification of plasmids or other relevant nucleic acids from cells. See, for example, EasyPrep™ and FlexiPrep™ kits, both from Pharmacia Biotech; StrataClean™ from Stratagene; and, QIAprep™ from Qiagen. Any isolated and/or purified nucleic acid can be further manipulated to produce other nucleic acids, used to transfect cells, incorporated into related vectors to infect organisms, or the like. Typical cloning vectors contain transcription terminators, transcription initiation sequences, and promoters useful for regulation of the expression of the particular target nucleic acid. The vectors optionally comprise generic expression cassettes containing at least one independent terminator sequence, sequences permitting replication of the cassette in eukaryotes, or prokaryotes, or both, (e.g., shuttle vectors) and selection markers for both prokaryotic and eukaryotic systems. Vectors are suitable for replication and integration in prokaryotes, eukaryotes, or both.

Various types of mutagenesis are optionally used to modify nucleases, nucleic acids and encoded polypeptides, as described herein, to produce conservative or non-conservative variants. Any available mutagenesis procedure can be used. Such mutagenesis procedures optionally include selection of mutant nucleic acids and polypeptides for one or more activity of interest. Procedures that can be used include, but are not limited to: site-directed point mutagenesis, random point mutagenesis, in vitro or in vivo homologous recombination (DNA shuffling), mutagenesis using uracil-containing templates, oligonucleotide-directed mutagenesis, phosphorothioate-modified DNA mutagenesis, mutagenesis using gapped duplex DNA, point mismatch repair, mutagenesis using repair-deficient host strains, restriction-selection and restriction-purification, deletion mutagenesis, mutagenesis by total gene synthesis, double-strand break repair, mutagenesis by chimeric constructs, and many others known to persons of skill in the art.

In one embodiment, mutagenesis can be guided by known information about the naturally occurring molecule or altered or mutated naturally occurring molecule. By way of example, this known information may include sequence, sequence comparisons, physical properties, crystal structure and the like. In another class of mutagenesis, modification is essentially random, e.g., as in classical DNA shuffling.

Polypeptides include isolated polypeptides, e.g., variants, in which the amino acid sequence has at least 75% identity, preferably at least 80% identity, typically 90% identity, preferably at least 95% identity, more preferably at least 98% identity and most preferably at least 99% identity, to the amino acid sequences as set forth in any one of SEQ ID NO: 1-51.

The aforementioned polypeptides can be obtained by any of a variety of methods. Smaller peptides (less than 50 amino acids long) are conveniently synthesized by standard chemical techniques and can be chemically or enzymatically ligated to form larger polypeptides. Polypeptides can be purified from biological sources by methods well known in the art, for example, as described in Protein Purification, Principles and Practice, Second Edition Scopes, Springer Verlag, N.Y. (1987) Polypeptides are optionally but preferably produced in their naturally occurring, truncated, or fusion protein forms by recombinant DNA technology using techniques well known in the art. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques and in vivo genetic recombination. See, for example, the techniques described in Sambrook et al. (2001) Molecular Cloning, A Laboratory Manual, Third Edition, Cold Spring Harbor Press, N.Y.; and Ausubel et al., eds. (1997) Current Protocols in Molecular Biology, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., N.Y (supplemented through 2002). RNA encoding the proteins may also be chemically synthesized. See, for example, the techniques described in Oligonucleotide Synthesis, (1984) Gait ed., IRL Press, Oxford, which is incorporated by reference herein in its entirety.

The nucleic acid molecules described herein can be expressed in a suitable host cell or animal to produce active nucleases described herein. Expression occurs by placing a nucleotide sequence encoding these proteins into an appropriate expression vector and introducing the expression vector into a suitable host cell, culturing the transformed host cell under conditions suitable for expression of the proteins described or variants thereof, or a polypeptide that comprises one or more domains of such proteins, and purifying the recombinant proteins from the host cell to obtain purified and, preferably, active protein. Appropriate expression vectors are known in the art, and may be purchased or applied for use according to the manufacturer's instructions to incorporate suitable genetic modifications. For example, pET-14b, pcDNA1Amp, and pVL1392 are available from Novagen and Invitrogen, and are suitable vectors for expression in E. coli, mammalian cells and insect cells, respectively. These vectors are illustrative of those that are known in the art, and many other vectors can be used for the same purposes. Suitable host cells can be any cell capable of growth in a suitable media and allowing purification of the expressed protein. Examples of suitable host cells include bacterial cells, such as E. coli, Streptococci, Staphylococci, Streptomyces and Bacillus subtilis cells; fungal cells such as Saccharomyces and Aspergillus cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells, mammalian cells such as CHO, COS, HeLa, 293 cells; and plant cells.

Culturing and growth of the transformed host cells can occur under conditions that are known in the art. The conditions will generally depend upon the host cell and the type of vector used. Suitable culturing conditions may be used such as temperature and chemicals and will depend on the type of promoter utilized.

Purification of the proteins described herein, or domains of such proteins, can be accomplished using known techniques without performing undue experimentation. Generally, the transformed cells expressing one of these proteins are broken, crude purification occurs to remove debris and some contaminating proteins, followed by chromatography to further purify the protein to the desired level of purity. Cells can be broken by known techniques such as homogenization, sonication, detergent lysis and freeze-thaw techniques. Crude purification can occur using ammonium sulfate precipitation, centrifugation or other known techniques. Suitable chromatography includes anion exchange, cation exchange, high performance liquid chromatography (HPLC), gel filtration, affinity chromatography, hydrophobic interaction chromatography, etc. Well known techniques for refolding proteins can be used to obtain the active conformation of the protein when the protein is denatured during intracellular synthesis, isolation or purification.

In general, proteins that include nuclease sequences or domains, or antibodies to such proteins can be purified, either partially (e.g., achieving a 5×, 10×, 100×, 500×, or 1000× or greater purification), or even substantially to homogeneity (e.g., where the protein is the main component of a solution, typically excluding the solvent (e.g., water or DMSO) and buffer components (e.g., salts and stabilizers) that the protein is suspended in, e.g., if the protein is in a liquid phase), according to standard procedures known to and used by those of skill in the art. Accordingly, the polypeptides can be recovered and purified by any of a number of methods well known in the art, including, e.g., ammonium sulfate or ethanol precipitation, acid or base extraction, column chromatography, affinity column chromatography, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, hydroxylapatite chromatography, lectin chromatography, gel electrophoresis and the like. Protein refolding steps can be used, as desired, in making correctly folded mature proteins. High performance liquid chromatography (HPLC), affinity chromatography or other suitable methods can be employed in final purification steps where high purity is desired. In one embodiment, antibodies made against the proteins described herein are used as purification reagents, e.g., for affinity-based purification of proteins comprising one or more nuclease domains or antibodies thereto. Once purified, partially or to homogeneity, as desired, the polypeptides are optionally used e.g., as assay components, therapeutic reagents or as immunogens for antibody production.

In addition to other references noted herein, a variety of purification methods are well known in the art, including, for example, those set forth in R. Scopes, Protein Purification, Springer-Verlag, N.Y. (1982); Deutscher, Methods in Enzymology Vol. 182: Guide to Protein Purification, Academic Press, Inc. N.Y. (1990); Sandana, Bioseparation of Proteins, Academic Press, Inc. (1997); Bollag et al., Protein Methods, 2nd Edition Wiley-Liss, NY; Walker (1996) The Protein Protocols Handbook Humana Press, NJ; Harris and Angal Protein Purification Applications: A Practical Approach IRL Press at Oxford, Oxford, England (1990); Scopes, Protein Purification: Principles and Practice 3rd Edition Springer Verlag, NY (1993); Janson and Ryden, Protein Purification: Principles, High Resolution Methods and Applications, Second Edition Wiley-VCH, NY (1998); and Walker, Protein Protocols on CD-ROM Humana Press, NJ (1998); and the references cited therein.

After synthesis, expression and/or purification, proteins can possess a conformation different from the desired conformations of the relevant polypeptides. For example, polypeptides produced by prokaryotic systems often are optimized by exposure to chaotropic agents to achieve proper folding. During purification from, e.g., lysates derived from E. coli, the expressed protein is optionally denatured and then renatured. This is accomplished, e.g., by solubilizing the proteins in a chaotropic agent such as guanidine HCl. In general, it is occasionally desirable to denature and reduce expressed polypeptides and then to cause the polypeptides to re-fold into the preferred conformation. For example, guanidine, urea, DTT, DTE, and/or a chaperonin can be added to a translation product of interest. Methods of reducing, denaturing and renaturing proteins are well known to those of skill in the art. Debinski, et al., for example, describe the denaturation and reduction of inclusion body proteins in guanidine-DTE. The proteins can be refolded in a redox buffer containing, e.g., oxidized glutathione and L-arginine. Refolding reagents can be flowed or otherwise moved into contact with the one or more polypeptide or other expression product, or vice-versa.

In another aspect, antibodies to CRN nucleases or fragments thereof can be generated using methods that are well known in the art. The antibodies can be utilized for detecting and/or purifying the CRN nucleases, optionally discriminating the proteins from various homologues, and/or in biosensor nuclease activity detection applications. As used herein, the term “antibody” includes, but is not limited to, polyclonal antibodies, monoclonal antibodies, humanized or chimeric antibodies and biologically functional antibody fragments, which are those fragments sufficient for binding of the antibody fragment to the protein.

General protocols that may be adapted for detecting and measuring the expression of the described CRN nucleases using the above mentioned antibodies are known. Such methods include, but are not limited to, dot blotting, western blotting, competitive and noncompetitive protein binding assays, enzyme-linked immunosorbant assays (ELISA), immunohistochemistry, fluorescence-activated cell sorting (FACS), and other protocols that are commonly used and widely described in scientific and patent literature.

The roles of the CRN proteins in apoptosis suggest that mutations in the crn genes may be the cause of some diseases. Sequence of the crn polynucleotides may be used in genetic mapping of diseases. For example, DNA fragment derived from the full-length crn genes may be used in Southern blot analysis to detect the existence or deletion of the crn genes. This method can be applied to the mapping of disease locus, as well as to the generation of crn transgenic or knock-out animals.

The crn polynucleotides also provide information and materials for detecting naturally occurring or artificially introduced mutations in a cell or an organism. For example, cells may be removed from human bodies and tested for the existence of certain mutations in the crn genes. More particularly, oligonucleotides can be synthesized based on the DNA sequences of the crn genes disclosed in this invention. These oligonucleotides may be used as primers in a PCR to amplify crn genes from genomic DNA prepared from the organisms, for example, from human biopsies.

Sequence of the crn polynucleotides may also be used in genetic mapping of diseases. Polynucleotides derived from the crn gene sequences can be used in in situ hybridization to determine the chromosomal locus of the crn genes on the chromosomes. Given the significance of apoptosis in development, high resolution map of the crn genes on the arms of human chromosomes may be used in prenatal screening to detect deletion or other mutations in the crn genes.

Sequence information of the crn genes can be used to design oligonucleotides for detecting crn mRNA levels in the cells. For example, the oligonucleotides can be used in a Northern blot analysis to quantify the levels of crn mRNA. Moreover, full-length or fragment of the crn genes can also be used in microarray experiments. High-throughput screening can be conducted to measure expression levels of the crn genes in different cells or tissues. More importantly, large number of chemical compounds can be screened for their effects on apoptosis, more particularly, on the induction of crn gene expression.

Sequences of the crn genes and proteins also provide a tool for identification of other proteins that may be involved in DNA fragmentation during apoptosis. For example, chimeric CRN proteins can be used as a “bait” to identify other proteins that interact with CRN proteins in a yeast two-hybrid screening. Recombinant CRN proteins can also be used in pull-down experiment to identify their interacting proteins. These other proteins may be cofactors that possess no nuclease activity but are required for CRN proteins to effectively cleave DNAs, or they may be nucleases themselves and may cooperate with CRN proteins in DNA fragmentation.

The CRN polypeptides also provide structural features which can be recognized, for example, by using immunological assays. The generation of antisera which specifically bind the CRN polypeptides, as well as the polypeptides which are bound by such antisera, are a feature of the disclosed embodiments.

In order to produce antisera for use in an immunoassay, one or more of the immunogenic CRN polypeptides or fragments thereof are produced and purified as described herein. For example, recombinant protein can be produced in a host cell such as a bacterial or insect cell. The resultant proteins can be used to immunize a host organism in combination with a standard adjuvant, such as Freund's adjuvant. Commonly used host organisms include rabbits, mice, rats, donkeys, chickens, goats, horses, etc. An inbred strain of mice may also be used to obtain more reproducible results due to the virtual genetic identity of the mice. The mice are immunized with the immunogenic CRN polypeptides in combination with a standard adjuvant, such as Freund's adjuvant, and a standard mouse immunization protocol. See, for example, Harlow and Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York (1988), which provides comprehensive descriptions of antibody generation, immunoassay formats and conditions that can be used to determine specific immunoreactivity. Alternatively, one or more synthetic or recombinant CRN polypeptides or fragments thereof derived from the sequences disclosed herein is conjugated to a carrier protein and used as an immunogen.

Antisera that specifically bind the CRN proteins can be used in a range of applications, including but not limited to immunofluorescence staining of cells for the expression level and localization of the CRN nucleases, cytological staining for the expression of CRN nucleases in tissues, FACS analysis for determining CRN protein expression and for cell sorting.

Another aspect includes screening for potential or candidate modulators of CRN nuclease activity. For example, potential modulators may include small molecules, organic molecules, inorganic molecules, proteins, hormones, transcription factors, or the like, which can be contacted to a cell to assess the effects, if any, of the candidate modulator upon CRN nuclease activity.

Alternatively, candidate modulators may be screened to modulate expression of CRN nucleases. For example, potential modulators may include small molecules, organic molecules, inorganic molecules, proteins, hormones, transcription factors, or the like, which can be contacted to a cell to assess the effects, if any, of the candidate modulator upon CRN nuclease expression. Expression of a crn gene described herein can be detected, for example, via Northern blot analysis or quantitative (optionally real time) RT-PCR, before and after application of potential expression modulators. Alternatively, promoter regions of the various genes are generally sequences in the region of the start site of transcription, such as within 5 Kb of the start site, within 1 Kb or less of the start site, within 500 bp, 250 bp or 100 bp of the start site. These promoter regions can be coupled to reporter constructs including, without limitation, CAT, beta-galactosidase, luciferase or any other available reporter, and can similarly be tested for expression activity modulation by the candidate modulator.

In either case, whether the assay is to detect modulated activity or expression, a plurality of assays can be performed in a high-throughput fashion, for example, using automated fluid handling and/or detection systems in serial or parallel fashion. Similarly, candidate modulators can be tested by contacting a potential modulator to an appropriate cell using any of the activity detection methods herein, regardless of whether the activity that is detected is the result of activity modulation, expression modulation or both.

A method of therapeutically or prophylactically treating a disease or disorder may include administering to a subject one or more or the CRN polypeptides or apoptosis modulators described above. Treatment compositions may also contain a pharmaceutically acceptable excipient and one or more such nucleic acids or polypeptides. The subject may include a mammal, for example, a human, primate, rodent, mouse, pig, cow, goat, rabbit, rat, guinea pig, hamster, horse, or sheep. The subject may also include a non-mammalian vertebrate, such as a bird, a fish, or even an invertebrate.

Ex vivo methods of administration to a subject include genetic modification of cells followed by introducing the cells to the subject. For example, this may entail using genetically modified stem cells to perform gene therapy that introduces expression products including those from overexpression or underexpression of the CRN nucleases or use of an apoptosis modulator as an expression product. Other cells that may be used for this purpose include, for example, cells of interest taken from the subject, such as tumor cells, tumor tissue samples, organ cells, blood cells, cells of the skin, lung, heart, muscle, brain, mucosa, liver, intestine, spleen, stomach, lymphatic system, cervix, vagina, prostate, mouth, tongue, etc. These cells are obtained or removed from the subject and may be transformed using a vector to introduce a synthetic gene that is effective in prophylactically or therapeutically treating the disease, disorder, or other condition. The transformed cells may then be returned or delivered to the subject to the site from which they were obtained or to another site of interest in the subject to be treated, such as another site specified above other than the native site from which the cells were obtained. If desired, the contacted cells may be grafted onto a tissue, organ, or system site of interest in the subject using standard and well-known grafting techniques or, for example, delivered to the blood or lymph system using standard delivery or transfusion techniques.

In vivo methods of administration include those in which one or more cells or a population of cells of interest of the subject are contacted directly or indirectly with an amount of a material of interest, such as a modulator that is effective in prophylactically or therapeutically treating the disease, disorder, or other condition. In direct contact/administration formats, the modulator is typically administered or transferred directly to the cells to be treated or to the tissue site of interest. Cells or tissue that may be subject to this type of administration include, for example, tumor cells, tumor tissue sample, organ cells, blood cells, cells of the skin, lung, heart, muscle, brain, mucosa, liver, intestine, spleen, stomach, kidney, lymphatic system, cervix, vagina, prostate, mouth, tongue, etc. Contacting may occur by any of a variety of formats, including topical administration, injection by use of a needle or syringe, vaccine or gene gun delivery, pushing the modulator, nuclease or polypeptide into a tissue, organ, or skin site. The modulator can be delivered, for example, intramuscularly, intradermally, subdermally, subcutaneously, orally, intraperitoneally, intrathecally, intravenously, or placed within a cavity of the body including a surgical cavity, by inhalation, oral, vaginal or rectal administration.

In the in vivo indirect contact/administration formats, the modulator is typically administered or transferred indirectly to the cells to be treated or to the tissue site of interest, including those described above, such as skin cells, organ systems, lymphatic system, or blood cell system, etc. Administration is by contacting the modulator directly to one or more cells or population of cells from which treatment can be facilitated. For example, tumor cells within the body of the subject can be treated by contacting cells of the blood or lymphatic system, skin, or an organ with a sufficient amount of the modulator such that delivery of the modulator to the site of interest occurs to provide effective prophylactic or therapeutic treatment results. Such contact, administration, or transfer is typically made by using one or more of the routes or modes of administration described above.

In vivo methods may also include those in which one or more cells of interest or a population of cells of the subject are transformed in the body of the subject by contacting with, administering, or transferring to the cells a polynucleotide construct comprising a nucleic acid sequence that encodes a biologically active polypeptide of interest. The polypeptide may be effective in prophylactically or therapeutically treating the disease, disorder, or other condition.

Ex vivo methods may similarly include those in which one or more cells of interest or a population of cells of interest of the subject are obtained or removed from the subject. The cells may be transformed by contact with a polynucleotide construct including a nucleic acid sequence that encodes a biologically active polypeptide of interest. The polypeptide is effective in prophylactically or therapeutically treating the disease, disorder, or other condition. The polynucleotide construct also includes a promoter controlling expression of said nucleic acid sequence such that uptake of the polynucleotide construct into the cell(s) occurs. Sufficient expression of the target nucleic acid sequence results to produce an effective amount of the biologically active polypeptide to prophylactically or therapeutically treat the disease, disorder, or condition. The polynucleotide construct may include a promoter sequence that controls expression of the nucleic acid sequence and/or, if desired, one or more additional nucleotide sequences encoding at least one or more of, e.g., a cytokine, an adjuvant, or a co-stimulatory molecule, or other polypeptide of interest.

Following transfection, the transformed cells are returned, delivered, or transferred to the subject to the tissue site or system from which they were obtained or to another site that is to be treated in the subject. If desired, the cells may be grafted onto a tissue, skin, organ, or body system of interest in the subject using standard and well-known grafting techniques or delivered to the blood or lymphatic system using standard delivery or transfusion techniques. Such delivery, administration, or transfer of transformed cells is typically made by using one or more of the routes or modes of administration described above. Expression of the target nucleic acid occurs naturally or can be induced, as described in greater detail below. An amount of the encoded polypeptide is expressed and is sufficient and effective to treat the disease or condition at the site or tissue.

In each of the in vivo and ex vivo treatment methods as described above, a composition comprising an excipient and the modulator, polypeptide, nucleic acid, etc. of the invention can be administered or delivered. In one aspect, a composition comprising a pharmaceutically acceptable excipient and a polypeptide or nucleic acid of the invention is administered or delivered to the subject as described above in an amount effective to treat the disease or disorder.

In another aspect, in each in vivo and ex vivo treatment method described above, the amount of polynucleotide administered to the cell(s) or subject can be an amount sufficient that uptake of the polynucleotide into one or more cells of the subject occurs and sufficient expression of said nucleic acid sequence results to produce an amount of a biologically active polypeptide effective to enhance an immune response in the subject, including an immune response induced by an immunogen (e.g., antigen). In another aspect, for each such method, the amount of polypeptide administered to cell(s) or subject can be an amount sufficient to enhance an immune response in the subject, including that induced by an immunogen (e.g., antigen).

In yet another aspect, in an in vivo or ex vivo treatment method in which a polynucleotide construct is used to deliver a physiologically active polypeptide to a subject, the expression of the polynucleotide construct can be induced by using an inducible on- and off-gene expression system. Examples of such on- and off-gene expression systems include the Tet-On™ Gene Expression System and Tet-Off™ Gene Expression System (see, e.g., Clontech Catalog 2000, pg. 110-111 for a detailed description of each such systems), respectively. Other controllable or inducible on- and off-gene expression systems are known to those of ordinary skill in the art. With such system, expression of the target nucleic acid of the polynucleotide construct can be regulated in a precise, reversible, and quantitative manner. Gene expression of the target nucleic acid can be induced, for example, after the stable transfected cells containing the polynucleotide construct comprising the target nucleic acid are delivered or transferred to or made to contact the tissue site, organ or system of interest. Such systems are of particular benefit in treatment methods and formats in which it is advantageous to delay or precisely control expression of the target nucleic acid (e.g., to allow time for completion of surgery and/or healing following surgery; to allow time for the polynucleotide construct comprising the target nucleic acid to reach the site, cells, system, or tissue to be treated; to allow time for the graft containing cells transformed with the construct to become incorporated into the tissue or organ onto or into which it has been spliced or attached, etc.).

Bioinformatic systems are widely used in the art, and can be used to detect homology or similarity between different character strings, or can be used to perform other desirable functions such as to control output files, provide the basis for making presentations of information including the sequences and the like. Examples include BLAST, discussed supra. For example, commercially available databases, computers, computer readable media and systems may contain character strings corresponding to the sequence information herein for the CRN polypeptides and crn nucleic acids described herein. These sequences may include specifically the CRN or crn sequences listed herein and the various silent substitutions and conservative substitutions thereof.

The bioinformatic systems contain a wide variety of information that includes, for example, a complete sequence listings for the entire genome of an individual organism representing a species. Thus, for example, using the CRN or crn sequences as a basis for comparison, the bioinformatic systems may be used to compare different types of homology and similarity of various stringency and length on the basis of reported data. These comparisons are useful to identify homologs or orthologs where, for example, the basic crn gene ortholog is shown to be conserved across different organisms. Thus, the bioinformatic systems may be used to detect or recognize the homologs or orthologs, and to predict the function of recognized homologs or orthologs. By way of example, many homology determination methods have been designed for comparative analysis of sequences of biopolymers including nucleic acids, proteins, etc. With an understanding of hydrogen bonding between the principal nucleobases in natural polynucleotides, models that simulate annealing of complementary homologous polynucleotide strings can also be used as a foundation of sequence alignment or other operations typically performed on the character strings corresponding to the sequences herein. One example of a software package for calculating sequence similarity is BLAST, which can be adapted to the present invention by inputting character strings corresponding to the sequences herein. CLUSTAL provides another appropriate package.

Systems for analysis in the present invention typically include a digital computer with an appropriate data base and a sequence of the invention. Software for aligning sequences, as well as data sets entered into the software system comprising any of the sequences herein can be a feature of the invention. The computer can be, e.g., a PC (Intel x86 or Pentium chip-compatible DOS™, OS2™ WINDOWS™ WINDOWS NT™, WINDOWS95™, WINDOWS98™, WINDOWS2000™, WINDOWSME™, WINDOWSXP™, or LINUX based machine, a MACINTOSH™, Power PC, or a UNIX based (e.g., SUN™ work station or LINUX based machine) or other commercially common computer which is known to one of skill. Software for entering and aligning or otherwise manipulating sequences is available, or can easily be constructed by one of skill using a standard programming language such as Visualbasic, Fortran, Basic, Java, or the like.

Any controller or computer optionally includes a monitor which is often a cathode ray tube (“CRT”) display, a flat panel display (e.g., active matrix liquid crystal display, liquid crystal display, etc.), or other display devices. Computer circuitry is often placed in a box which includes numerous integrated circuit chips, such as a microprocessor, memory, interface circuits, and others. The box also optionally includes a hard disk drive, a floppy disk drive, a high capacity removable drive such as a writeable CD-ROM, and other common peripheral elements. Inputting devices such as a keyboard or mouse optionally provide for input from a user and for user selection of sequences to be compared or otherwise manipulated in the relevant computer system.

The computer typically includes appropriate software for receiving user instructions, either in the form of user input into a set parameter fields, e.g., in a GUI, or in the form of preprogrammed instructions, e.g., preprogrammed for a variety of different specific operations. The software then converts these instructions to appropriate language for instructing the operation of the fluid direction and transport controller to carry out the desired operation.

The software can also include output elements for controlling nucleic acid synthesis (e.g., based upon a sequence or an alignment of a sequences herein) or other operations which occur downstream from an alignment or other operation performed using a character string corresponding to a sequence herein.

In an additional aspect, kits may embody any of the methods, compositions, systems or apparatus described above. Kits may optionally comprise one or more of the following: (1) a composition, system, or system component as described herein; (2) instructions for practicing the methods described herein, and/or for using the compositions or operating the system or system components herein; (3) one or more nuclease compositions or components; (4) a container for holding components or compositions, and, (5) packaging materials.

EXAMPLES

The nonlimiting examples that follow report general procedures, reagents and characterization methods that teach by way of example, and should not be construed in a narrowing manner that limits the disclosure to what is specifically disclosed. Those skilled in the art will understand that numerous modifications may be made and still the result will fall within the spirit and scope of the present invention. These examples show, for example, a variety of tests and procedures that may derive from use of assay kits incorporating CRN materials. Instructions for use of such materials may be prepared as detailed instructions for performing the protocols with use of the CRN materials.

Example 1 General Procedures

In these examples, any conventional procedure may be adapted to incorporate the CRN nucleases or related genetic materials as a subject of study. C. elegans strains were maintained using standard procedures following those used and reported by Brenner, S., The genetics of Caenorhabditis elegans. Genetics 77, 71-94 (1974). All strains used in this study have been described previously in Parrish et al. (2001), and Riddle, D. L., Blumenthal, T., Meyer, B. J., and Priess, J. R., eds., C. elegans II, Cold Spring Harbor, Cold Spring Harbor Laboratory (1997).

Bioinformatic systems were used to screen reported nucleic acid sequences, and to assess which sequences might function as nucleases. For each Open Reference Frame (ORF) identified n this way, a partial cDNA (>200 bp) was cloned into a bacterial dsRNA (double stranded RNA) expression vector (pPD129.36), the expression vector was introduced into a bacterial host, TH115, and RNAi experiments were carried out using a bacterial feeding protocol, as described by Parrish et al. (2001). L1 larval C. elegans animals were fed with bacteria expressing a specific dsRNA. L2 hermaphrodite larvae were transferred to plates seeded with bacteria expressing either control or crn-1 dsRNA and the progeny of treated animals were scored for RNAi phenotypes. More than 60 open reading frames (ORFs) tested using RNAi did not produce significant TUNEL or cell death phenotypes. The progeny of the treated animals were then scored for TUNEL and other cell death phenotypes. RNAi results for approximately 20% of the ORFs were verified using dsRNAs corresponding to the full-length cDNAs, and no differences in phenotypes were noted. Effects of RNAi on each ORF were tested in three genetic backgrounds, N2 (wild-type), cps-6(sm116), and nuc-1(e1392), to identify genes that generate or resolve TUNEL-positive ends and to eliminate false positives. To further rule out false positives, ORFs that gave rise to TUNEL-phenotypes following RNAi treatment were retested in triplicate.

To obtain full-length cDNA clones corresponding to a specific ORF, total RNA was isolated from mixed-stage wild-type animals using TRI-Reagent (Sigma) at a ratio of 10:1 (TRI-Reagent:pelleted worms). The cDNAs were then PCR amplified using an Enhanced Avian RT-PCR kit (Sigma). Oligo-dT primers were used to reverse-transcribe 10 μg of total RNA and sequence-specific primers were used to amplify cDNAs by PCR from the resulting pool of the first strand cDNAs. Two crn-6 cDNAs (700 bp and 1.1 kb) were isolated using RT-PCR. The shorter cDNA clone is identical to yk720e2, a cDNA clone provided by Y. Kohara. The longer cDNA clone corresponded to the predicted crn-6 ORF and was used to make the GST fusion protein for protein binding studies.

GST fusion protein pull-down assays were performed as described in J. Parrish, H. Metters, L. Chen, D. Xue, Proc. Natl. Acad. Sci. U.S.A. 97, 11916 (2000). Purified GST or GST-fusion proteins (5 μg each) immobilized on glutathione sepharose beads were incubated with 35S-Methionine labeled proteins at 4° C. for 2 hours. The beads were washed extensively and the bound proteins were resolved on a 12% SDS-PAGE and visualized by autoradiography.

    • cDNAs corresponding to the ORFs were cloned into the pPD129.36 vector via its Nhe I and Xho I sites or the Xho I site alone. Full-length cDNAs were subcloned into the pGEX4T-2 vector for generating GST fusion proteins and for further protein purification and into the pcDNA3.1 vector for in vitro transcription/translation experiments.

35S Methionine-labeled proteins were synthesized using Promega TNT rabbit reticulocyte lysate system as instructed by the manufacturer. GST-fusion proteins were prepared by growing bacterial BL21 (DE3)pLysS cells harboring the expression vector to an OD595 of ˜0.6 and then inducing the expression of the fusion protein with 0.2 mM IPTG for 12 hours at 15° C. Cells were harvested by centrifugation and lysed in the PBS buffer via sonication. Following centrifugation of the lysate, supernatant was incubated with Glutathione Sepharose resin (Amersham). Bound proteins were washed extensively using PBST buffer (PBS buffer with 1% Triton-X100) and eluted in PBST containing 20 mM reduced glutathione. Eluted proteins were dialyzed against buffers containing 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM DTT, and 15% glycerol and were stored at −80° C.

10 μg of the purified GST fusion protein was incubated with 5 μl 35S Methionine-labeled proteins in PBST (0.5% Triton-X100) at 4° C. for one hour. 10 μl of Glutathione Sepharose resin were then added to each reaction and allowed to equilibrate with the proteins at 4° C. for one additional hour. The resin was washed 3 times (10 minutes each) with PBST (1% Triton-X100) and the bound proteins were eluted with sample buffer and resolved on a 10% SDS-Polyacrylamide gel, which was then fixed and dried before being subjected to Phosphorimager analysis.

For plasmid cleavage assays, recombinant proteins were incubated with 1}1 g of plasmid DNA in 20 mM HEPES (pH 1.5), 10 mM KCl, 3 mM MgC12, and 0.5 mM DTT for 0.5-1.5 ills at 31 C and reactions were resolved on 1% or 1.5% agarose gels. For example, an appropriate amount of purified protein was incubated with 1 μg of plasmid DNA in 20 mM HEPES (pH7.5), 10 mM NaCl, 3 mM MgCl2, 1 mM DTT, 1 mM CaCl2 and 2% glycerol at 37° C. for 2 hours. The reactions were then resolved on a 1.5% agarose gel and visualized with ethidium bromide.

The number of cell corpses in the head region of living C. elegans embryos and the number of extra cells in the anterior pharynx of L3-stage hermaphrodites were counted using Nomarski optics as previously described in Parrish et al. 2001.

TUNEL assays were carried out as described previously in Parrish et al. (2001) using an in situ cell death detection kit obtained on commercial order from Roche.

Early C. elegans embryos (one to four cell stage) were mounted on slides with agar pads in M9 and coverslips were sealed with mineral oil. Images in a 15 micron z series (1 micron/each layer) were captured every thirty seconds for 500 minutes using a Leica Nomarski microscope equipped with a Cohu CCD camera and Scion image 1.62c software. Images were compiled into a viewable 4D movie using a 4D Turnaround software and viewed using 4D Viewer.

Cell corpses in the head region of embryos or larvae and extra cells in anterior pharynges of L3 hermaphrodites were scored using the Nomarski optics. PLM survival was scored in the presence of an integrated array, bzIs8, using a Nomarski microscope equipped with epifluorescence. CRN-1 proteins (wild-type or mutant) or the CPS-6 protein were expressed under the control of the mec-7 promoter (S5) to assay their killing activities.

Germline transformation experiments were carried out as described in C. C. Mello, J. M. Krame, D. Stinchcomb, V. Ambros, EMBO J. 10, 3959 (1992). Constructs were injected into host strains (5-50}μg/ml) with pRP4 (50}μg/ml) as a co-injection marker.

Standard procedures following J. Sambrook, Fritsch, E. F., and Maniatis, T., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., ed. 2nd, (1989) were used for plasmid construction and a Quick-change mutagenesis kit (Stratagene) was used to generate mutations. To generate Pcrn-1crn-1::gfp, the entire crn-1 coding region with 3491 bp of 5′ untranslated region was Polymerase Chain Reaction (PCR) amplified using an expand long template PCR kit (Roche) and then subcloned into pPD95.77 via its Sph I and Sal I sites.

Recombinant His6CPS-6, CRN-1-His6, or GST-CRN-1 proteins were expressed in E. coli BL21(DE3)pLysS strain and purified using similar procedures as described in J. Parrish, H. Metters, L. Chen, D. Xue, Proc. Natl. Acad. Sci. U.S.A. 97, 11916 (2000).

For flap endonuclease assays, three oligonucleotides were annealed to generate a flap substrate, following the procedure of J. J. Harrington, M. R. Lieber, EMBO J. 13, 1235 (1994). These designations apply:

    • FLAP (5′ gatgtcaagcagtcctaactttgaggcagagtcc 3′), SEQ ID NO. 52
    • FLAP-Br (5′ ggactctgcctcaagacggtagtcaacgtg 3′), SEQ ID NO. 53 and
    • FLAP-Adj (5′ cacgttgactaccgtc 3′) SEQ ID NO. 54.

For exonuclease and gap-dependent endonuclease assays, these designations apply:

    • FLAP-Br long (5′ ggactctgcctcaagacggtagtcaacgtggtgtg 3′) SEQ ID NO. 55, and
    • FLAP-Blunt (5′ cttgaggcagagtcc 3′) SEQ ID NO. 56.

FLAP-Br long and FLAP-Blunt were annealed to generate a double-strand substrate with a 5′ recessive end. FLAP 3′ AS (5′cacaccacgttgactaccgt 3′) SEQ ID NO. 57 or its derivatives with 1, 2 or 4 fewer nucleotides at the 3′ end were annealed with FLAP-Br long and FLAP-Blunt to generate double stranded substrates with a nick or various single-stranded gaps. Prior to annealing, one of the oligonucleotides was either 5′-end labeled with ?-32P-ATP using T4 polynucleotide kinase or 3′-end labeled with a-32P cordycepin-5′-triphosphate using terminal deoxynucleotide transferase and subsequently purified on 1 M urea-polyacrylamide gels. For each substrate, 2 pmol of unlabeled oligonucleotides were mixed with 50 nmol of labeled oligonucleotides in 10 mM Tris (pH8.0), 50 mM KCl, and 1 mM EDT A, heated to 80 C, and slowly cooled to 25 C to facilitate annealing. Annealing efficiency was monitored on 5% non-denaturing polyacrylamide gels. Nuclease assays were carried out in 50 mM Tris (pH8.0), 5 mM MgCl2, 0.5 mM B-mercaptoethanol, and 0.1 μg/ml BSA. 100 fmol of the labeled substrate was incubated with 0.2 μl of the indicated protein (synthesized using Promega TNT coupled reticulocyte lysate system). Reactions were incubated at 30 C for 45 minutes, resolved on 1M Urea/15% polyacrylamide gels, and analyzed using a phosphorimager (Molecular Dynamics).

Example 2 RNAI Screening to Identify Cell-Death Related Nucleases (CRN)

C. elegans deoxyribonucleases and ribonucleases were tested as well as cyclophilins and topoisomerases for potential roles in apoptotic DNA degradation. Bioinformatic systems used for the initial screening included INTERPRO and PFAM motif searches, for example, as described generally by Apweiler, R., Attwood, T. K., Bairoch, A., Bateman, A., Birney, E., Biswas, M., Bucher, P., Cerutti, L., Corpet, F., Croning, M. D., et al., The InterPro database, an integrated documentation resource for protein families, domains andfunctional sites. Nucleic Acids Res. 29, 37-40 (2001); and Sonnhammer, E. L., Eddy, S. R., and Durbin, R., Pfam: a comprehensive database of protein domain families based on seed alignments. Proteins 28, 405-420 (1997).

The search identified a total of 77 Open Reading Frames (ORFs) in the search categories. RNAi experiments on these 77 ORFs were conducted in three different genetic backgrounds, wild-type (N2), the cps-6(sm116) mutant, and/or the nuc-1(e1392) mutant, to identify an increase or decrease of TUNEL staining in these RNAi-treated animals versus control animals treated by RNAi. Table 1 shows the results of observations in the test population documenting twenty one instances of embryonic lethality, hermaphrodite sterility, and/or developmental defects in the test population.

TABLE 1
ORFs screened and their respective RNAi phenotypes
Gene Locus Homology Emba Steb evc
Deoxyribonucleases
AH9.2 crn-4 3′-5′ exonuclease
B0432.8 TatD-related DNase
C05C8.5 exonuclease
C06A1.6 endonuclease III
C07B5.5 nuc-1 DNaseII-like
C08B6.6
C10G6.1 3′-5′ exonuclease
C14A4.4 crn-3 3′-5′ exonuclease with HRDC domain +/− +/− Gro
C41D11.8 cps-6 DNA/RNA non-specific endonuclease
CD4.2 crn-2 TatD-related DNase
F09G8.2 yls-2 DNaseII-related
F10C2.4 DNA polymerase, exonuclease domain + +
F10G7.2 Staphylococcal nuclease-like
F21E9.1 AP-endonuclease +
F31E3.4 Exonuclease, Ub. C-terminal hydorlase
F33H2.5 DNA polymerase exonuclease domain + +
F45G2.3 XPG-related nuclease
F57B10.6 5′-3′ exonuclease, XPG-related
H19N07.4 Endonuclease, O-acetyltransferase
K04F10.5 AP-endonuclease
K04H4.6a crn-6 DNase-II-related
K05G3.1 3′-5′ exonuclease
M02B7.2 exonuclease
R02D3.8 exonuclease
R09B3.1 exo-3 AP-endonuclease
R10E4.5 Endonuclease III, HhH-GPD base-excision
repair
R11E3.3 AP-endonuclease
T05H10.2 apn-1 AP-endonuclease
T07A9.5a Exonuclease, SAP domain
T12A2.8 5′-3′ exonuclease, XPG-related
W05H12.2 3′-5′ exonuclease + Gro
Y17G7B.12 exonuclease
Y24F12A.1 TatD-related DNase
Y37H2A.1 TatD-related DNase
Y47D3A.29 DNA polymerase exonuclease domain + + Lva
Y47G6A.8 crn-1 5′-3′ exonuclease, endonuclease, XPG- + Gro
related
Y56A3A.33 exonuclease
Y57A10A.13 3′-5′ exonuclease + +
Y63D3A.4 AP-endonuclease
ZC302.1 mre-11 DNA repair exonuclease
Ribonucleases
B0564.1 3′-5′ exoribonuclease
BE0003N10.1 3′-5′ exoribonuclease
C04G2.6 Ribonuclease II +? Sck, Sma
C14A4.5 crn-5 3′-5′ exoribonuclease Gro
F31D4.1 3′-5′ exoribonuclease Gro
F37C12.13 3′-5′ exoribonuclease Lva
F48E8.6 Ribonuclease II
K10C9.3 Ribonuclease T2
T13H5.7 Ribonuclease HII
Y6D11A.1 3′-5′ exoribonuclease Sck, Sma
ZK1098.3 Ribonuclease-D
ZK1098.8 mut-7 Ribonuclease-D
Cyclophilinsd
B0252.4 cyp-10 Peptidyl-prolyl cis-trans isomerase
C34D4.12 cyp-12 Peptidyl-prolyl cis-trans isomerase
D1009.2 cyp-8 Peptidyl-prolyl cis-trans isomerase
F31C3.1 cyp-5 Peptidyl-prolyl cis-trans isomerase
F39H2.2 cyp-14 Peptidyl-prolyl cis-trans isomerase
F42G9.2 cyp-6 Peptidyl-prolyl cis-trans isomerase
F59E10.2 cyp-4 Peptidyl-prolyl cis-trans isomerase
T01B7.4 cyp-11 Peptidyl-prolyl cis-trans isomerase +/− Gro
T27D1.1 cyp-9 Cyclophilin-related
Y116A8C.34 cyp-13 Peptidyl-prolyl cis-trans isomerase
Y17G7B.9 cyp-16 Peptidyl-prolyl cis-trans isomerase
Y17G9B.4 Peptidyl-prolyl cis-trans isomerase
Y49A3A.5 cyp-1 Peptidyl-prolyl cis-trans isomerase
Y75B12B.2 Peptidyl-prolyl cis-trans isomerase +?
Y75B12B.5 cyp-3 Peptidyl-prolyl cis-trans isomerase
Y87G2A.6 cyp-15 Peptidyl-prolyl cis-trans isomerase
ZC250.1 cyp-17 Peptidyl-prolyl cis-trans isomerase
ZK520.5 cyp-7 Peptidyl-prolyl cis-trans isomerase
Topoisomerases
F31E8.6 Topoisomerase II + +
F32A11.4 Topoisomerase II
F32A11.5 Topoisomerase II +
R05D3.1 Topoisomerase II
Y42G9A.1 Topoisomerase II Sck
Y46H3C.4 Topoisomerase IV +
Y48C3A.14 Topoisomerase I +
ZK1127.7 Topoisomerase II +

aF1 progeny of RNAi-treated hermaphrodites were examined for potential embryonic lethality (Emb) phenotypes which are classified as follows: “+/−” denotes less than 25% penetrance of embryonic lethality phenotype and “+” denotes more than 25% penetrance of embryonic lethality phenotype.

bF1 progeny of RNAi-treated hermaphrodites were examined for sterility (Ste) phenotypes and “+/−” or “+” denotes Ste phenotype with less than or more than 25% penetrance, respectively.

cP0 and F1 progeny of RNAi-treated hermaphrodites were monitored for a number of developmental defects (DEV) including dumpy (Dpy), uncoordinated (Unc), slow growth (Gro), larval arrest (Lva), sick (Sck), small (Sma), and long (Lon). Those that display more than 25% penetrance of these phenotypes are listed.

dSequence for cyp-2 not available.

The RNAi treatment in the case of nine ORFs gave rise to TUNEL phenotypes that were indicative of involvement in apoptotic DNA degradation. As will be explained in greater detail below, the CRN nucleases have apoptotic activity, as illustrated in FIG. 1 and shown in Table 2 which show the results of TUNEL assays that provide an initial confirmation of CRN nuclease activity. Two of the ORFs, namely, C07B5.5 (nuc-1) and C41D11.8 (cps-6), were previously known to function in DNA degradation, demonstrating the effectiveness of the screen in comparison to other reports including Parrish et al. (2001); Sulston, J. E., Post-embryonic development in the ventral cord of Caenorhabditis elegans. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 275, 287-297 (1976); and Wu, Y. C., Stanfield, G. M., and Horvitz, H. R., NUC-1, a Caenorhabditis elegans DNase II homolog, functions in an intermediate step of DNA degradation during apoptosis. Genes. Dev. 14, 536-548 (2000).

FIG. 1 shows 9 apoptotic nucleases identified from the C. elegans genome. The 77 ORFs screened for TUNEL phenotypes following RNAi treatment were categorized based on their chromosomal positions (Linkage Group; X-axis) and plotted according to the numbers of TUNEL-positive nuclei (on average) detected in 1.5-fold wild-type embryos (N2) treated with RNAi (Y-axis). RNAi of 68 ORFs (gray circles) resulted in TUNEL phenotypes that were not significantly different from that of N2 animals treated with control (RNAi) (black circle). RNAi of 9 ORFs resulted in significantly higher numbers of TUNEL-positive nuclei, including two genes (cps-6 and nuc-1) previously known to be involved in apoptotic DNA degradation (triangles), six new crn genes (cell death-related nucleases), and cyp-13, which was previously named (all in squares).

The remaining seven ORFs were novel in terms of their apoptotic phenotypes; including six previously uncharacterized genes, as shown in Table 2, and one cyclophilin homologue (cyp-13). RNAi of each of the nine genes led to an accumulation of TUNEL-positive nuclei that could be suppressed by a strong loss-of-function ced-3(n2433) mutation, which blocked most cell death in nematodes according to procedures following Ellis, H. M., and Horvitz, H. R., Genetic control of programmed cell death in the nematode C. elegans. Cell 44, 817-829 (1986). Furthermore, RNAi of crn-2 or crn-3 significantly enhanced the TUNEL phenotype of the cps-6(sm116) mutant, indicating that crn-2 and crn-3 function at least partially independently of cps-6, as shown in Table 2. However, double RNAi of crn-2 and crn-3 in N2, cps-6(sm 116), or nuc-1(e1392) animals did not result in a stronger TUNEL phenotype than either RNAi treatment alone. These results show that crn-2 and crn-3 may function in the same pathway to mediate apoptotic DNA degradation. Finally, RNAi of each of the seven new genes enhanced the TUNEL phenotype of nuc-1. These results show that nuc-1 functions in a different DNA degradation process from these seven genes, as shown in Table 2.

TABLE 2
TUNEL analysis of C. elegans genes involved in apoptotic DNA degradation
Strain treated by RNAi
ORF/Gene N2 ced-3(n2433) cps-6(sm116) nuc-1(e1392)
ORF Gene TUNEL n TUNEL n TUNEL n TUNEL n
Control  2.3 ± 2.1 16 0.3 ± 0.6 15 22.1 ± 2.1 15 35.2 ± 1.9 15
C41D11.8 cps-6 19.9 ± 1.9 15 1.7 ± 1.3 15 20.8 ± 2.6 15 46.7 ± 2.6 15
C07B5.5 nuc-1 30.9 ± 3.3 25 0.7 ± 1.2 15 43.7 ± 3.1 15 34.5 ± 1.9 15
Y47G6A.8 crn-1 11.1 ± 2.9 10 2.1 ± 2.6 18 21.5 ± 2.9 10 45.6 ± 3.9 10
CD4.2 crn-2 14.3 ± 3.8 12 0.9 ± 1.1 10 27.8 ± 2.3 16 48.9 ± 2.8 14
C14A4.4 crn-3 11.8 ± 3.1 16 0.8 ± 1.2 13 29.3 ± 2.3 10 47.4 ± 3.6 13
AH9.2 crn-4 10.3 ± 3.5 11 1.1 ± 0.9 12 19.3 ± 2.5 11 45.8 ± 2.5 13
C14A4.5 crn-5 13.9 ± 3.4 13 1.5 ± 1.3 13 20.0 ± 2.4 10 42.6 ± 6.6 18
K04H4.6a crn-6 11.8 ± 2.9 17 1.3 ± 1.0 10 20.6 ± 2.3 11 44.8 ± 3.1 12
Y116A8C.34 cyp-13 17.1 ± 3.5 10 0.6 ± 0.7 16 19.8 ± 2.4 10 49.0 ± 3.4 15

The TUNEL assays were carried out as previously described in Parrish et al. (2001). TUNEL-reactive nuclei were scored in 1.5-fold stage embryos. “n” indicates the number of embryos scored.

Example 3 Identification of Mammalian Homologues of the CRN Nucleases

Bioinformatic sequence analysis of the crn genes and cyp-13 reveals insightful information regarding their functions, as illustrated in FIGS. 2A through 2F.

FIG. 2A shows alignment (1) of CRN-2, CDA11, a human protein, and TatD, an E. coli nuclease. FIG. 2B shows alignment (2) of CRN-3 and 100 kD human polymyositis/scleroderma autoantigen (PM/SCL). FIG. 2C shows alignment (3) of CRN-4, E. coli RNase T, and MGC16943, a predicted human DNA polymerase epsilon subunit. FIG. 2D shows alignment (4) of CRN-5 and human RRP46, an exonuclease component of the exosome. FIG. 2E shows alignment (5) of CRN-6, NUC-1 and human DNase II. FIG. 2F shows alignment (6) of CYP-13 and human cyclophilin E (CYP-E). Primary amino acid sequences of the indicated proteins were aligned using the ClustalW program and shaded using a Boxshade software. Identical residues are shaded in black and conserved residues are shaded in gray.

The crn-1 sequence encodes a homologue of flap endonuclease 1 (FEN-1), which is a mammalian nuclease involved with DNA replication and damage repair, for example, as reported in Harrington, J. J., and Lieber, M. R. The characterization of a mammalian DNA structure-specific endonuclease. Embo J. 13, 1235-1246 (1994); and Lieber, M. R. (1997). The FEN-1 family of structure-specific nucleases in eukaryotic DNA replication, recombination and repair. Bioessays 19, 233-240. The apoptotic activity observed in Table 2 for crn-1 may represent a critical switch between DNA replication/repair and apoptotic DNA degradation during apoptosis. crn-1 (RNAi) causes embryonic lethality in C. elegans, as shown in Table 1. These results show that crn-1 affects cell survival and, like FEN-1, may be involved in DNA replication/repair in C. elegans.

crn-2 encodes a homologue of the TatD nuclease, as shown in FIG. 2A(1). TatD is a poorly characterized E. coli magnesium-dependant nuclease previously reported by Wexler, M., Sargent, F., Jack, R. L., Stanley, N. R., Bogsch, E. G., Robinson, C., Berks, B. C., and Palmer, T., TatD is a cytoplasmic protein with DNase activity. No requirement for TatD family proteins in sec-independent protein export. J. Biol. Chem. 275, 16717-16722 (2000). Mammalian TatD homologues exist, but have no known function. The present findings support a role for TatD-like nucleases in mammalian apoptosis.

crn-3 and crn-S encode homologues of the 100 kD polymyositis/scleroderma autoantigen PM/Scl-100 and Rrp46, as shown in FIG. 2A(2) and 2(4). PM/Scl-100 and Rrp46 have been reported by Brouwer, R., Pruijn, G. J., and van Venrooij, W. J., The human exosome: an autoantigenic complex of exoribonucleases in myositis and scleroderma, Arthritis Res. 3, 102-106 (2001). Both PM/Scl-100 and Rrp46 are ribonuclease components of the exosome, which is a multi-exonuclease complex. The exosome functions in processing or degrading several types of RNAs and is crucial for the survival of yeast cells, as reported in Perumal, K., and Reddy, R., The 3′ end formation in small RNAs. Gene Expr. 10, 59-78. (2002). Therefore, crn-3 and crn-5 appear to be shared components of two different machineries for RNA processing and for apoptotic DNA fragmentation. Both crn-3(RNAi) and crn-5(RNAi) cause retarded growth of treated animals. In the case of crn-3(RNAi), a low penetrance of embryonic lethality was observed and reported in Table 1. These observations are consistent with the potential roles of crn-3 and crn-S in RNA processing as components of the exosome in C. elegans, as confirmed by Table 1.

crn-4 is homologous to a family of 3′ to 5′ exonucleases including ribonuclease T and the epsilon subunit of DNA polymerase III, as shown in FIG. 2A(3). Ribonuclease T and the epsilon subunit of DNA polymerase III are involved in tRNA processing and DNA replication, respectively, as reported in Koonin, E. V., and Deutscher, M. P., RNase T shares conserved sequence motifs with DNA proofreading exonucleases. Nucleic Acids Res. 21, 2521-2522 (1993).

Like nuc-1, crn-6 encodes a type II DNase, as shown in FIG. 2A(5). CRN-6 and NUC-1 may function like an acid DNase implicated in degrading DNA from apoptotic cells engulfed by macrophages, as reported McIlroy, D., Tanaka, M., Sakahira, H., Fukuyama, H., Suzuki, M., Yamamura, K., Ohsawa, Y., Uchiyama, Y., and Nagata, S. An auxiliary mode of apoptotic DNA fragmentation provided by phagocytes, Genes. Dev. 14, 549-558 (2000).

Finally, cyp-13 is most homologous to mammalian cyclophilin E, as shown in FIG. 2B(6). Both sequences have a putative RNA-recognition motif (RRM) at the amino terminus and a peptidyl-prolyl cis-trans isomerase domain at the carboxyl terminus, where the mammalian sequence has bee observed by Andreeva, L., Heads, R., and Green, C. J., Cyclophilins and their possible role in the stress response, Int. J. Exp. Pathol. 80, 305-31 (1999). Cyclophilins have been implicated in apoptotic DNA degradation in mammalian cells, as reported in Montague, J. W., Hughes, F. M., Jr., and Cidlowski, J. A., Native recombinant cyclophilins A, B, and C degrade DNA independently of peptidylprolyl cis-trans-isomerase activity. Potential roles of cyclophilins in apoptosis, J. Biol. Chem. 272, 6677-6684 (1997).

Like some other cyclophilins, CYP-13 is a nuclease in vitro, and may directly mediate DNA degradation, as shown in FIG. 3. Although the function of cyclophilin E is not understood, other cyclophilins have generally been implicated in facilitating cellular protein folding, as discussed in Andreeva et al. (1999). Furthermore, recent studies have shown that cyclophilin E is a component of the human spliceosome, for example, as reported in Zhou, Z., Licklider, L. J., Gygi, S. P., and Reed, R., Comprehensive proteomic analysis of the human spliceosome, Nature 419, 182-185 (2002). Therefore, cyp-13 may additionally be involved in RNA splicing in C. elegans. In summary, the identification of crn-6 and cyp-13 during the screening process confirms previous observations that their mammalian counterparts are likely involved in apoptotic DNA degradation in vivo and the identification of the other five genes (crn-1 to crn-5) may reveal novel functions for their mammalian homologues in apoptosis.

FIG. 3 shows data indicating that CYP-13 but not CYP-1 is a nuclease in vitro. Increasing concentrations of purified recombinant CYP-13 (A) or CYP-1 (B), another C. elegans cyclophilin homologue, were incubated with 1 μl of plasmid DNA at 37° C. for one hour and the reactions were resolved on 1% agarose gels. Bands with slower mobility relative to that of plasmid DNA control represent nicked plasmids.

Example 4 CRN Nucleases Affect Progression of Apoptosis in C. Elegans

cps-6 is needed for normal progression of apoptosis, whereas nuc-1 appears dispensable for cell death, as reported in Parrish et al. (2001). Time-course analyses of embryonic cell corpses were conducted to determine whether cyp-13 and the six crn genes affect apoptosis in C. elegans, following the procedures of Parrish et al. (2001). RNAi of six genes, namely, crn-1, crn-2, crn-3, crn-4, crn-S and cyp-13, delayed appearance of embryonic cell corpses during development, generating profiles of embryonic cell corpses similar to that of cps-6(RNAi) animals. The peak of embryonic cell corpses shifted from the bean/comma stage in control(RNAi) animals to the 2-fold stage in cps-6(RNAi)-treated animals (FIG. 4). In contrast, RNAi of four other ORFs (B0438.2, F09G8.2, M02B7.2, and Y57A10A.4) that did not yield any TUNEL phenotype in the screen had no effect on the appearance of embryonic cell corpses in N2 animals (data not shown). Interestingly, crn-6(RNAi), like nuc-1(RNAi), did not change the profile of cell corpses, as shown in FIGS. 4B and 4G. This result shows that crn-6 may be dispensable for apoptosis. Since crn-6 encodes a type-II DNase similar to NUC-1, these two nucleases may play a similar role in DNA degradation.

FIG. 4 shows a time-course analysis of embryonic cell corpses. L1 larvae from N2 (A-H) or cps-6(sm116) (I and J) animals were treated with control(RNAi) or (A) cps-6(RNAi), (B) nuc-1(RNAi), (C) crn-2(RNAi), (D) crn-3(RNAi), (E) crn-4(RNAi), (F) crn-5(RNAi), (G) crn-6(RNAi), (H) cyp-13(RNAi), (I) crn-2(RNAi) or crn-3(RNAi), or (J) crn-4(RNAi). Cell corpses were scored at six embryonic stages (comma/bean—c/b, 1.5 fold, 2 fold, 2.5 fold, 3 fold, and 4 fold) from progeny of RNAi-treated animals. The Y-axis represents the mean of cell corpses scored at the head region of embryos (at least 15 animals for each developmental stage) and error bars represent one standard error of the mean (S.E.M.). Data derived from control(RNAi) and RNAi treatment of crn genes, cps-6, or nuc-1 at the same stage were compared using unpaired t test. * denotes P<0.05, ** denotes P<0.002, and *** denotes P<0.0005. All other points had P values>0.05.

crn-6(RNAi) was tested to determine if it could phenocopy or enhance two other DNA degradation defects associated with the nuc-1 mutant. In these results, there was observed a failure to digest DNA of ingested bacteria in the intestine and inability of engulfing cells to degrade DNA derived from postembryonic cell deaths. The postembryonic cell death material existed as pycnotic bodies when stained with fluorescent DNA dye, such as Syto-11 (see Wu et al., 2000). It was determined that neither crn-6(RNAi) nor RNAi of any other crn gene or cyp-13 in either N2 or nuc-1(e1392) animals could phenocopy or enhance these two specific DNA degradation defects of nuc-1 (data not shown), showing that these six crn genes and cyp-13 are likely involved in DNA degradation specific for cell deaths.

Since crn-2(RNAi) or crn-3(RNAi) enhanced the TUNEL phenotype of the cps-6(sm116) mutant, crn-2/crn-3 and cps-6 appear to function in two independent pathways, as confirmed by the results of Table 2. Intriguingly, more cell corpses were seen at every stage in cps-6(sm116); crn-2(RNAi) or cps-6(sm116); crn-3(RNAi) embryos than in cps-6(sm116) control(RNAi) embryos, as illustrated in FIG. 41. These results show that crn-2(RNAi) or crn-3(RNAi), when combined with cps-6(sm116), may impair cell corpse engulfment. RNAi of any other crn gene or cyp-13 did not affect the profile of cell corpse appearance in the cps-6(sm116) mutant, which is consistent with the findings that some of these genes (crn-1, crn-4, crn-5 and cyp-13) function in the same pathway as cps-6 and some (crn-6 and nuc-1) act at a later stage of DNA degradation as confirmed by FIG. 4J and additional data that is not shown.

Example 5 CRN Nucleases Promote Cell Killing

cps-6 promotes cell killing when assayed in sensitized genetic backgrounds, as reported in Parrish et al. (2001). The six crn genes and cyp-13 were similarly screened for cell killing modulation activity. Like the cps-6(sm116) mutation, RNAi of any of the six crn genes or cyp-13 alone has little effect on the deaths of 16 cells that normally occur in the anterior pharynx of animals. These results are observed as a cell count of no or few extra “undead” cells in the assayed region, as reported in Table 3; none of the six crn genes and cyp-13 alone can significantly contribute to cell killing. However, when combined with a weak ced-3(n2438) mutation, RNAi of any of these genes except crn-6 can significantly protect against cell deaths, generating a mean of 2.35 to 2.88 extra “undead” cells, compared with a mean of 1.56 extra cells seen in ced-3(n2438) animals treated with control(RNAi), as shown in Table 3. These observations indicate that five of the six crn genes (except crn-6) and cyp-13 can promote cell killing, just like cps-6.

Contributions of crn-2 and crn-4 to cell killing were examined in additional detail. These two genes act in two different DNA degradation pathways, with crn-4 and cps-6 being in the same pathway and crn-2 acting in a different one. It was determined that crn-2(RNAi), but not crn-4(RNAi), can further increase the number of extra cells observed in cps-6(sm116); ced-3(n2447) or cps-6(sm116); ced-4(n2273) mutants. Results are shown in Table 3. This is further evidence that crn-2 functions in a different DNA degradation pathway from cps-6 and that the two DNA degradation pathways in nematodes can independently promote cell killing.

TABLE 3
Multiple crn genes and cyp-13 can contribute to cell killing
Number of extra cellsb
Straina No. scored Mean ± s.e.m. Range P valued
N2; control(RNAi) 16 0 0 N/A
N2; crn-2 (RNAi) 17 0.06 ± 0.24 0-1 0.17
N2; crn-3(RNAi) 19 0.05 ± 0.23 0-1 0.18
N2; crn-4 (RNAi) 28 0.07 ± 0.26 0-1 0.14
N2; crn-5(RNAi) 21 0.05 ± 0.22 0-1 0.18
N2; crn-6(RNAi) 20 0 0 N/A
N2; cyp-13(RNAi) 15 0.07 ± 0.26 0-1 0.15
ced-3(n2438); control(RNAi) 16 1.56 ± 0.99 0-3 N/A
ced-3(n2438); crn-2 (RNAi) 17 2.88 ± 1.72 1-6 0.006
ced-3(n2438); crn-3(RNAi) 15 2.47 ± 1.25 1-4 0.006
ced-3(n2438); crn-4 (RNAi) 16 2.44 ± 1.36 0-5 0.02
ced-3(n2438); crn-5(RNAi) 15 2.35 ± 1.00 1-4 0.01
ced-3(n2438); crn-6(RNAi) 15 1.40 ± 0.91 0-3 0.41
ced-3(n2438); cyp-13 (RNAi) 15 2.53 ± 1.13 1-4 0.01
cps-6(sm116); ced-3(n2447); control(RNAi)c 16 2.63 ± 1.17 1-5 N/A
cps-6(sm116); ced-3(n2447); crn-2 (RNAi)c 13 3.38 ± 1.56 1-6 0.07
cps-6(sm116); ced-3(n2447); crn-4 (RNAi)c 15 2.67 ± 1.35 1-6 0.46
cps-6(sm116); ced-4(n2273); control(RNAi)c 17 3.65 ± 1.15 2-6 N/A
cps-6(sm116); ced-4(n2273); crn-2 (RNAi)c 11 4.55 ± 1.57 3-7 0.05
cps-6(sm116); ced-4(n2273); crn-4 (RNAi)c 15 3.80 ± 1.37 1-6 0.36

aControl(RNAi) indicates that animals were fed with bacteria containing an expression vector lacking an insert as a negative control.

bExtra cells were counted in the anterior pharynx of L3 hermaphrodites using Nomarski optics.

cThese strains contain dpy-5(e61).

dP values were determined using student's t-tests. Data from RNAi-treated animals was compared to the appropriate RNAi control. N/A, not available.

Recently it has been shown that each of the two partially redundant cell corpse engulfment pathways in C. elegans independently contributes to cell killing, as reported in Hoeppner, D. J., Hengartner, M. O., and Schnabel, R., Engulfment genes cooperate with ced-3 to promote cell death in Caenorhabditis elegans. Nature 412, 202-206 (2001); and Reddien, P. W., Cameron, S., and Horvitz, H. R., Phagocytosis promotes programmed cell death in C. elegans, Nature 412, 198-202 (2001). Similarly, it has herein been shown that each of the two DNA degradation pathways represented by crn-2 and cps-6/crn-4 also independently contributes to cell killing. Further investigations were conducted to determine whether defects in both cell corpse engulfment pathways and both DNA degradation pathways could additively affect cell killing. Interestingly, when the functions of both engulfment pathways and both DNA degradation pathways are reduced by mutations or RNAi, for example, in cps-6(sm116); ced-7(n1892); ced-5(n1812); crn-2(RNAi) animals, a mean of 1.2 extra cells were seen, whereas reduction of activity in any of these pathways alone has little effect on cell killing, as shown in Table 4. These results indicate that the cell corpse engulfment and the DNA degradation pathways, and likely other cell death execution pathways, can independently and additively contribute to cell killing. Table 4. DNA degradation and cell corpse engulfment pathways can additively contribute to cell killing

TABLE 4
DNA degradation and cell corpse engulfment pathways can additively
contribute to cell killing
Number of extra cellsb
Straina No. scored Mean ± s.e.m. Range
cps-6(sm116); control(RNAi) 18 0.06 ± 0.26 0-1
ced-5(n1812); control(RNAi) 20 0.07 ± 0.26 0-1
ced-7(n1892); control(RNAi) 25 0.12 ± 0.41 0-1
N2; crn-2 (RNAi) 17 0.06 ± 0.24 0-1
cps-6(sm116); ced-7(n1892); 20 1.20 ± 0.69 0-2
ced-5(n1812);
crn-2(RNAi)c

aControl(RNAi) indicates that animals were fed with bacteria containing an expression vector lacking an insert as a negative control. cps-6 and crn-2 represent two different DNA degradation pathways. ced-5 and ced-7 represent two different cell corpse engulfment pathways.

bExtra cells were counted in the anterior pharynx of L3 hermaphrodites using Nomarski optics.

cThis strain contains dpy-5(e61).

Example 6 Defects in Both DNA Degradation Pathways Affect Cell Corpse Engulfment

The cps-6(sm116) mutation and crn-2(RNAi) or crn-3(RNAi) cause a synthetic defect in cell corpse engulfment, which was verified by four-dimensional cell lineage analyses to examine the average duration of embryonic cell corpses. In N2 animals treated with control(RNAi), embryonic cell corpses persisted 21.9 minutes on average (Table 5). crn-2(RNAi) treatment of N2 animals or the cps-6(sm116) mutation with control(RNAi) did not prolong the persistence of embryonic cell corpses (Table 5). In contrast, crn-2(RNAi) treatment of the cps-6(sm116) mutant prolonged the persistence of embryonic cell corpses by 55%, indicative of a defect in cell corpse engulfment. To rule out the possibility that the observed differences in corpse durations resulted from different rates of development in different animals, the durations of four cell divisions in the MS cell lineage were simultaneously measured following the procedures of Sulston, J. E., Schierenberg, E., White, J. G., and Thomson, J. N., The embryonic cell lineage of the nematode Caenorhabditis elegans. Dev. Biol. 100, 64-119 (1983). The durations were found to be similar in all embryos analyzed, as shown in Table 5. These results show a significant, intrinsic connection between the apoptotic DNA degradation process and the cell corpse recognition/engulfment process.

TABLE 5
Inactivation of both cps-6 and crn-2 prolongs the persistence of cell
corpses
Duration of Cell
Strain Corpse durationa (n) Divisionsa,b
N2; control(RNAi) 21.9 ± 3.2 (7) 85.0
N2; crn-2(RNAi) 24.5 ± 1.7 (5) 91.5
cps-6(Sm116); control (RNAi) 23.4 ± 3.4 (7) 93.0
cps-6(sm116); crn-2(RNAi) 34.0 ± 4.9 (7) 91.5

aCorpse duration and duration of cell divisions are in minutes. At least three animals from each strain were examined and results from one representative animal are shown. “n” indicates the number of cell corpses examined in one embryo.

bThe duration of four cell divisions in the MS cell lineage from the MS cell to the MSpppp cell (Sulston et al., 1983) was followed in embryos monitored for the duration of cell corpses.

Example 7 Multiple CRN Nucleases and CPS-6 Likely Interact to Form a DNA Degradation Complex

Glutathione-S transferase (GST) fusion protein pull-down assays were performed to investigate how these nine nucleases affect apoptotic DNA degradation and potential protein-protein interactions among the nucleases. A number of in vitro interactions were identified among proteins functioning in the cps-6 pathway, as shown in FIG. 5 and Table 6. These interactions included interactions between cps-6 and CRN-1, as well as interactions among cps-6, CRN-4, CRN-5, and CYP-13. That these five nucleases may function together, possibly in a large complex along with non-nuclease components, for example, wah-1 as reported by Wang, X., Yang, C., Chai, J., Shi, Y., and Xue, D., Mechanisms of AIF-Mediated Apoptotic DNA Degradation in Caenorhabditis elegans, Science 298, 1587-1592 (2002). Complexing promotes apoptotic DNA degradation in vivo. These multi-nuclease complexes may be referred to as the “degradeosome.” Only one interaction, namely, that of CRN-3/CRN-5, was identified between proteins functioning in two different DNA degradation pathways. The corresponding mammalian homologues interact in the exosome, as reported in Brouwer et al. (2001), indicating that the complex or interaction may be further implicated in a shared role for RNA processing. No strong interactions were observed between NUC-1 or CRN-6 and proteins acting in either the CPS-6 or CRN-2 pathways, consistent with NUC-1 and CRN-6 functioning in later stages of the DNA degradation process or in their own DNA degradation pathways.

FIG. 5 shows an interaction map for nucleases involved in apoptotic DNA degradation in C. elegans. Interactions between proteins were examined using GST fusion protein pulldown assays. An arrow indicates an interaction between a GST-fusion protein (pointed by the arrow) and a 35S Methionine-labeled protein. For example, GST-CPS-6 bound 35S-CYP-13. Only strong protein interactions are depicted. The interaction between cps-6 and wah-1 was described previously (Wang et al., 2002). NUC-1 and CRN-6 likely function at later stages of apoptosis.

Summary of in vitro interactions among CPS-6, NUC-1, CPY-13 and six CRN proteins
35S- GST-fusion proteinsa
Proteins GST CPS-6 NUC-1 CRN-1 CRN-3 CRN-4 CRN-5 CRN-6 CYP-13
Luciferase
CPS-6 ++ + + +
NUC-1
CRN-1b ++ ND ND ND ND ND ND ND ND
CRN-2 +
CRN-3 + ++ ++
CRN-4 ++ + + ++ +
CRN-5 ++ + ++ ++ ++
CRN-6
CYP-13 ++ + ++ ++ ++

aInteractions were evaluated relative to background binding of 35S-Methionine labeled Luciferase to GST-fusion proteins and 35S-Methionine labeled proteins to GST. “−” indicates no detectable binding, “+” indicates an interaction consistently observed above background levels, and “++” indicates a strong interaction.

bBecause 35S-Methionine labeled CRN-1 binds GST tightly, it was not possible to evaluate interactions between 35S-CRN-1 and various GST-fusion proteins. ND, not determined.

Example 8 CRN-1: Assay Investigations Showing FLAP Endonuclease Ortholog Also Functions in Apoptosis

Oligonucleosomal fragmentation of chromosomes in dying cells is a hallmark of apoptosis. Little is known about how fragmentation is executed or what cellular components are involved. The present example shows the foregoing going assay methods in use to confirm crn-1 switch functionality of crn-I both as a flap endonuclease and as a fragmentation material. crn-1 is a C. elegans homologue of human flap endonuclease 1 (FEN-1). FEN-1 is involved in DNA replication and repair, but is now also shown to be involved in apoptosis.

In summary, reduction of crn-1 activity by RNA interference resulted in cell death phenotypes similar to those displayed by a mutant lacking the mitochondrial endonuclease CPS-6/endonuclease G. CRN-1 localizes to nuclei and can associate and cooperate with CPS-6 to promote stepwise DNA fragmentation, utilizing the endonuclease activity of CPS-6 and both the 5′-3′ exonuclease activity and a novel, gap-dependent endonuclease activity of CRN-1. These results show that CRN-1 and/or FEN-1 may play a facilitate switching the state of cells from DNA replication/repair to DNA degradation during apoptosis.

Two nucleases have been implicated in mediating apoptotic DNA degradation in mammals, namely, a 40 kD DNA fragmentation factor with caspase-activated deoxyribonuclease (DFF40/CAD) and mitochondrial endonuclease G (Endo G). DFF40/CAD is activated during apoptosis following caspase cleavage of its cognate inhibitor DFF45/ICAD. DFF40/CAD then associates with nuclear proteins, such as Histone HI and HMG proteins, to promote cleavage of internucleosomal DNA. Endo G is released from mitochondria during apoptosis and translocates to nuclei to mediate DNA fragmentation through a pathway that is independent of caspase and DFF40.

In C. elegans, the Endo G homologue is CPS-6. A type II DNase, NUC-I, has been implicated in apoptotic DNA degradation because TUNEL-positive nuclei accumulate in cps-6 or NUC-1 mutants. Additionally, reducing CPS-6 activity delays appearance of embryonic cell corpses and enhances the cell killing defect of other cell death mutants, which shows that CPS-6 may be used in normal progression of apoptosis and can promote cell killing. Since Endo G and/or CPS-6 define a conserved DNA degradation pathway, assays were run to investigate the mechanisms by which CPS-6 or Endo G affects apoptosis.

FIG. 6A shows a comparison of sequence similarity confirming that crn-1 encodes a FEN-1-like nuclear protein-one that is involved in apoptosis. Alignment of CRN-1 and human FEN-I is shown where black shaded residues are identical and gray shaded residues are similar in two proteins.

FIGS. 6B to E show results from TUNEL assays in which N2 (B), cps-6(sm116) (C), nuc-1(e1392) (D), and ced-3(n2433) (E) animals were treated with control(RNAi) (filled bars) or crn-1 (RNAi) (hatched bars) and their progeny were stained with TUNEL for examination of comma and 1.5 fold embryos. The y axis represents the mean number of TUNEL-positive cells present in the embryos. At least 12 embryos were scored at each stage.

FIGS. 6F to I show time course analysis of embryonic cell corpses where N2 (F), ced-8(n1891) (G), cps-6(sm116) (H), cps-6(sm116); ced-8(n1891) (I) animals were treated with control(RNAi) or crn-1 (RNAi) and their progeny were scored for cell corpses in comma, 1.5 fold, 2 fold, 2.5 fold, 3 fold, 4 fold stage embryos, as well as early L1 larvae, with at least 15 animals scored for each stage.

FIGS. 6J to M show data derived from control and crn-1(RNAi) treatment at the same stage with a comparison using an unpaired t test. The asterisk * denotes P<0.05, ** denotes P<0.002, and *** denotes P<0.0001. All other points have P values>0.05. Error bars indicate SEM.

FIGS. 6J to M show nuclear localization of CRN-1. Nomarski results are shown as FIGS. 6J and 6L for a 1.5-fold stage transgenic embryo. Fluorescent results are shown as FIGS. 6K and 6M for L1 transgenic larvae;

CRN-1 is a worm homologue of FEN-1, where the sequence comparison is illustrated in FIG. 6A. CRN-1 may be essential for nematode development; as crn-1 (RNAi)-treated L1 larvae developed normally but laid predominantly dead eggs (95% penetrance. Animals treated at later larval stages, L2 and L3 and thus with reduced exposure to crn-1 (RNAi), had many surviving progeny.

The viable crn-1(RNAi)-treated embryos accumulated TUNEL-positive nuclei. This TUNEL phenotype was suppressed by the ced-3(n2433) mutation, which blocks most C. elegans cell deaths. These results indicate that the TUNEL-positive nuclei observed in crn-1(RNAi) embryos correspond to apoptotic cells and that CRN-1 is involved in apoptotic DNA degradation, as confirmed by FIGS. 6B and 6E.

Interestingly, crn-1(RNAi) did not enhance the TUNEL phenotype of the cps-6(sm116) mutant but did so in nuc-1 (e1392) mutants, as shown in FIGS. 6C and 6D. These results show that CRN-1 functions in the same DNA degradation pathway as cps-6, which is different from that of nuc-1.

A time-course analysis of embryonic cell corpses indicate that CRN-1 affects the normal timing of apoptosis like cps-6. Specifically, crn-1 (RNAi) delays progression of apoptosis, shifting the peak of cell corpses from the comma embryonic stage in wild-type animal to the 2-fold embryonic stage in crn-1(RNAi) animals, as shown in FIG. 6F. crn-1(RNAi) also enhanced the delay-of-cell-death phenotype of the ced-8(n1891) mutant (13), further increasing the numbers of the late-appearing cell corpses in ced-8(n1891) embryos, as shown in FIG. 6G. However, crn-1(RNAi) treatment did not enhance the delayed corpse appearance phenotype of cps-6(sm116) or cps-6(sm116); ced-8(n1891) mutants, as shown in FIGS. 6H and 61. These results further show that CRN-1 and CSP-6 function in the same pathway to promote apoptosis.

Studies were performed to investigate whether crn-1(RNAi) could prevent cell deaths and generate extra “undead” cells in the anterior pharynx of C. elegans. On its own, crn-1 (RNAi) did not block apoptosis, since few extra cells were seen in crn-1 (RNAi) animals, as shown in Table 7.

crn-1(RNAi) did enhance the cell killing defect of other cell death mutants, including mutants that were partially or strongly defective in two essential cell-killing genes, ced-3 and ced-4, as shown in Table 7. For example, a mean of only 1.6 extra cells was seen in the anterior pharynx of weak ced-3(n2447) mutants, compared to a mean of 2.7 extra cells seen in ced-3(n2447) for crn-1(RNAi) animals, as shown in Table 7. crn-1 (RNAi) similarly enhanced cell survival in several other mutants including weak ced-4(n2273) mutant and strong ced-3(n2433) and ced-4(n1162) mutants, as shown in Table 7. However, crn-1(RNAi) did not increase the number of extra cells observed in cps-6(sm116), cps-6(sm116); ced-3(n2447), or cps-6(sml16), ced-4(n2273) mutants, as shown in Table 7. Taken together, these results show that crn-1 and cps-6 promote cell killing through the same cell death pathway.

TABLE 7
CRN-1 promotes cell killing in C. elegans.
Number Extra Cells‡
Strain* Scored Mean ± s.e.m. Range
N2; control(RNAi) 18 0 0
N2; crn-1(RNAi) 22 0.09 ± 0.29 0 to 1
ced-8(n1891); control(RNAi) 16 0.87 ± 0.64 0 to 2
ced-8(n1891),. crn-1(RNAi)§ 15 1.50 ± 0.98 0 to 3
ced-3(n2447); control(RNAi) 16 1.56 ± 0.99 0 to 3
ced-3(n2447); crn-1(RNAi) 16 2.69 ± 1.10 1 to 4
ced-3(n2433); control(RNAi) 15 13.3 ± 1.63 11 to 16
ced-3(n2433); crn-1(RNAi) 15 14.2 ± 1.40 12 to 16
ced-4(n2273); control(RNAi) 15 3.04 ± 1.42 1 to 6
ced-4(n2273); crn-1(RNAi)§ 16 4.50 ± 1.50 2 to 7
ced-4(nl162); control(RNAi) 17 12.7 ± 1.77 10 to 15
ced-4(nl162); crn-1(RNAi)§ 15 13.7 ± 1.50 11 to 15
cps-6(sml16); control(RNAi) 18 0.06 ± 0.26 0 to 1
cps-6(sml16); crn-1(RNAi) 15 0.07 ± 0.26 0 to 1
cps-6(sml16); ced-8(n1891); 17 1.35 ± 0.74 0 to 3
control(RNAi)
cps-6(sml16); ced-8(n1891); 16 1.31 ± 0.70 0 to 2
crn-1(RNAi)
cps-6(sml16); ced-3(n2447); 16 2.63 ± 1.12 1 to 5
control(RNAi)†
cps-6(sml16); ced-3(n2447); 15 2.74 ± 1.10 1 to 5
crn-1(RNAi)†
cps-6(sml16); ced-4(n2273); 15 3.80 ± 1.14 2 to 6
control(RNAI)†
cps-6(sml16); ced-4(n2273); 15 4.00 ± 1.13 2 to 6
crn-1(RNAi)†

*RNAi experiments were carried out using a bacterial feeding protocol (6).

†These strains also contain dpy-5(e61).

‡Extra cells were scored in the anterior pharynx of L3 hermaphrodites using Nomarski optics as described (6).

§Numbers of extra cells from animals treated with control(RNAi) and crn-1 (RNAi) were compared using unpaired t test, P < 0.01. P < 0.002, unpaired t-test.

FEN-1 is know to be implicated in DNA replication, and participates in Okazaki fragment processing together with DNA damage repair including base excision repair. Loss-of-function mutations in Rad-27, the S. cerivisiae FEN-1 homologue can cause conditional lethality, a mutator phenotype, and sensitivity to genotoxic stress. These reports underscore the importance of FEN-1 in genome maintenance.

In C. elegans, CRN-1 is needed for developmental viability, and these results show a possible developmental role in DNA replication and repair. Results from CRN-1 expression using a fusion protein composed of CRN-1 and green fluorescent protein (CRN-1::GFP) under the control of its own promoter (P cm-I) show that CRN-1 is ubiquitously expressed in C. elegans, beginning early in embryogenesis and lasting until late larval stages. The CRN-1::GFP fusion protein was found exclusively in nuclei, as shown in FIGS. 6J to 6M. These results are consistent with CRN-1 having a role in mediating chromosome fragmentation during apoptosis and a possible role in DNA replication and repair.

Since cps-6 and CRN-1 appear to act in the same cell death pathway, as confirmed by FIG. 6 and Table 7, further tests wee performed to ascertain whether CPS-6 and CRN-1 directly interact. FIGS. 7A to 7D are, generally, Western blot results characterizing the activity of CPS-6 and CRN-1, for example, by use of a GST pull down assay.

FIGS. 7A to 7D show nuclease activities of CRN-1 and its interaction with CPS-6, as results from a GST fusion protein pull down assay using a CRN-1 glutathione S-transferase (OST) fusion protein [OST-CRN-1(21-382)] bound full-length, with 35S-methionine labeled CPS-6. The observed CRN-1/CPS-6 interaction is specific, since OST alone did not bind CPS-6 and OST-CRN-1(21-382) did not pull down an unrelated protein, luciferase, as shown in FIG. 7A. Furthermore, CRN-1 interacted well with CPS-6(21-308), which is a truncated version of CPS-6 that lacks the mitochondria targeting sequence and localizes to nuclei instead of mitochondria.

FIG. 7A shows that CRN-1 binds CPS-6 in an assay using purified GST or GST-fusion proteins (5 μg each) to precipitate 35S-Methionine labeled proteins as indicated, where ?N denotes CPS-6(21-308) and 30% of input 35S-labeled proteins is shown.

FIG. 7B shows CRN-1 has flap endonuclease activity where FEN-1 or CRN-1 proteins (wild type or mutant) synthesized in the reticulocyte lysate were incubated with the labeled flap substrate, which is schematized below the image (lengths of oligonucleotides are indicated and * indicates the position of 32P labeling), where 19 and 21 nt cleavage products and their respective cleavage sites on the substrate (1 nucleotide 5′ or 3′ of the branch point) are indicated by arrows. WT, wild-type CRN-1; ED, CRN-1(EI60D); DY, CRN-1(DY-AA).

CRN-1 possesses a novel gap-dependent endonuclease activity, as represented in FIG. 7C. A different labeled substrate was incubated with FEN-1 or CRN-1 proteins. The 19 nt endonucleolytic cleavage product and its corresponding cleavage site on the substrate are indicated with an arrow. The bands (arrowheads) at the bottom of the gel are CRN-1 exonuclease products from the labeled 5′ end.

CRN-1 5′-3′ exonuclease activity is shown in FIG. 7D where a 3′ end-labeled substrate was incubated with FEN-1 or CRN-1 proteins. The sizes of multiple cleavage products (indicated by arrows) are consistent with successive removal of 1 nt from the 5′ end of the labeled strand by the exonuclease.

The mitochondria targeting sequence of Endo G, and likely CPS-6, is cleaved off following its importation into mitochondria, which suggests that the mature form of CPS-6 can interact with CRN-1 after it translocates from mitochondria to nuclei during apoptosis. These data further suggest that CPS-6 and CRN-1 may function together at the same step of apoptotic DNA degradation. FEN-1 is a structure-specific endonuclease that processes DNA flaps, bifurcated structures composed of double-stranded DNA and a displaced single-strand, and a 5′-3′ exonuclease. Like FEN-I, CRN-1 cleaved a synthetic flap substrate, generating two characteristic cleavage products of 19 and 21 nucleotides, as shown in FIG. 7B. Furthermore, mutations in CRN-1 (D233A and Y234A; DY-AA) that alter conserved residues important for FEN-1 nuclease activities also abolished the flap endonuclease activity of CRN-1, as shown in FIG. 7B. These results confirm that CRN-1 has flap endonuclease activity like that of FEN-I.

Interestingly, both CRN-1 and FEN-1 possess a second substrate-specific endonuclease activity that has not been reported previously. Both proteins could endonucleotically cleave a double stranded DNA substrate with a 4 nt single stranded gap at the 3′ end of the gap, as shown in FIG. 7C. This new gap-dependent endonuclease activity was also observed with a substrate that has 32 bp double stranded DNA flanking a similar 4 nt gap (8) and was lost in the CRN-1(DY-AA) mutant protein, as shown in FIG. 7C.

CRN-1 was tested for 5′-3′ exonuclease activity like that of FEN-1. Both FEN-1 and CRN-1 can process a labeled 5′ blunt end of a double-stranded oligonucleotide substrate to generate low molecular weight labeled nucleotides, indicative of 5′-3′ exonuclease activity, as shown in FIG. 7C. Additionally, both FEN-1 and CRN-1 cleaved a double-stranded substrate containing a 5′ recessed end and a labeled 3′ blunt end to generate a ladder of labeled products resulting from 5′-3′ exonuclease digestion, as shown in FIG. 7D. In both assays, CRN-1(DY-AA) protein lacked 5′-3′ exonuclease activity. as shown in FIGS. 7C and 7D. Interestingly, a mutation (E160D) in CRN-1 specifically abolished its 5′-3′ exonuclease activity but not its flap or gap-dependent endonuclease activity, as shown in FIGS. 7B to 7D. The similarities between CRN-1 and FEN-1 in their nuclease activities suggest that CRN-1 is a functional homologue or ortholog of FEN-I.

Since CRN-1 and CPS-6 interacted in vitro, further tests were performed to assess whether they affect each other's activity using a plasmid cleavage assay. FIGS. 8A to 8D depict electrophoretic gels that show results from different time dependant uses of CRN-1 and CPS-6 confirming that CRN-1 and CPS-6 operate to promote DNA degradation. FIG. 8A shows results from a plasmid cleavage assay where CPS-6 (“+” denoting 50 ng and “++” denoting 250 ng) or CRN-1 proteins (250 ng each) were incubated either alone or together as indicated with plasmid DNA (1!-tg). WT, wild-type CRN-1; ED, CRN-1(EI60D); DY, CRN-1(DY-AA).

FIG. 8B shows that simultaneous presence of CRN-1 and CPS-6 enhances DNA degradation. In lanes 2-4, plasmid DNA was mock treated with buffer and passed over Ni2+ NT A resin to simulate the depletion step. His6 CPS-6 or CRN-1-His6 was subsequently incubated either alone or together with plasmid DNA for 30 min. In lanes 6-9, His6 CPS-6 (lanes 6 and 8) or CRN-1-His6 (lanes 7 and 9) was first incubated with plasmid DNA for 30 min, depleted using Ni2+ NTA resin (181), and plasmid DNA was subsequently incubated with CRN-1-His6 (2nd; lane 8), or His6CPS-6 (2nd; lane 9), or mock treated (buffer alone; “-”) for another 30 min. 50 ng of His6CPS-6 and 250 ng of CRN-1-His6 were used in all reactions.

FIG. 8C shows that CPS-6 enhances CRN-1 gap-dependent endonuclease activity. CRN-proteins (WT or mutants) or CPS-6 were incubated either alone or together, as indicated, with different substrates (schematized below reactions in which they were used). The endonucleolytic product sizes (indicated with arrows) increase with the increasing lengths of the single stranded gaps in the substrates.

FIG. 8D shows that CPS-6 enhances CRN-1 5′-3′ exonuclease activity. Reactions were carried out as in the case of FIG. 8C, except that substrates were 3′-end labeled to monitor 5′-3′ exonuclease activity. 12, 11, and 10 nt exonucleolytic products were most prominent (indicated with arrows). In the presence of both CRN-1 and CPS-6, additional, smaller products were also visible.

At a low concentration, CPS-6 caused nicking of plasmid DNA, generating products with slower mobility, as shown in FIG. 8A. At a higher concentration, CPS-6 further fragmented plasmid DNA, generating a smear of smaller products, as shown in FIG. 8A.

CRN-1 alone had no detectable plasmid nicking or cleaving activity, even at high concentrations, as shown in FIG. 8A. However, adding CRN-1 to a reaction where CPS-6 alone only induced plasmid nicking resulted in complete plasmid degradation and approximately 500% increase in nuclease activity, as shown in FIG. 8A. These results shown that CRN-1 may potentate CPS-6 nuclease activity.

Interestingly, WAH-1, the C. elegans homologue of AIF (apoptosis-inducing factor), also enhances CPS-6 nuclease activity in vitro. However, WAH-1 did not affect CRN-1 activity alone and could not further stimulate CPS-6 activity in the presence of CRN-1, suggesting that CRN-1 and WAH-1 may use a similar mechanism to stimulate CPS-6 nuclease activity.

A test was performed to determine whether CRN-1 nuclease activities enhance CPS-6 nuclease activity using mutated proteins. The exonuclease-defective CRN-1(E 160D) protein or nuclease-defective CRN-1 (DY-AA) protein were used in plasmid cleavage reactions with CPS-6. Results show continuing enhancement of CPS-6 nuclease activity, though less potently than the wild type CRN-1 protein, as shown in FIG. 8A. These results indicate that CRN-1 can enhance CPS-6 nuclease activity through CRN-1 nuclease-dependent and -independent mechanisms. Interestingly, CRN-1(DY-AA) bound CPS-6 as well as did wild-type CRN-1, as shown in FIG. 7A, which indicates that association between CRN-1 and CPS-6 may be involved in CRN-1-mediated enhancement of CPS-6 nuclease activity.

Another test was performed to ascertain whether CPS-6 and CRN-1 act in a sequential manner to cleave DNA. The test entailed preincubating plasmid DNA with CPS-6 to deplete CPS-6 from the reaction before adding CRN-1, or reversing the incubation order of two CPS-6 and CRN-1. In both cases, there was no enhancement of the CPS-6 activity by CRN-1, as shown in FIG. 8B. These results indicate that CRN-1 and CPS-6 are preferably present at the same time for synergistic promotion of DNA degradation.

We also examined whether CPS-6 could enhance CRN-1 nuclease activities. Interestingly, CPS-6 had no effect on CRN-1 flap endonuclease activity, but could enhance the gap-dependent endonuclease activity of CRN-1, as shown in FIG. 8C). Ungapped single stranded DNA substrates (see lane 2, FIG. 8C) or double stranded DNA substrates with a nick (see no gap; lane 8, FIG. 8C) or a 1 nt gap were not endonucleotically cleaved by CRN-1. The gap-dependent endonuclease activity was apparent when the gap size was increased to 2 nt, and was enhanced when the gap size was increased to 4 nt (see lanes 14 and 20, FIG. 8C). Although CPS-6 was unable to process any of these substrates on its own, it enhanced the gap-dependent endonuclease activity of CRN-1 by more than 200% (see lanes 18 and 24, FIG. 8C).

Interestingly, CRN-1 had somewhat similar substrate preferences for its 5′-3′ exonuclease activity. Although it could process 5′ recessed ends (see lane 2, FIG. 8D) or 5′ ends near a nick (see lane 8, FIG. 8D) or 1 nt gap in double stranded substrates, CRN-1 had stronger 5′ to 3′ exonuclease activity when the single stranded gap was 2 or 4 nt long (see lanes 14 and 20, FIG. 8D). In these latter two cases, addition of CPS-6 significantly enhanced CRN-1 exonuclease activity, generating smaller cleavage products (see lanes 8, and 24, FIG. 8D). Again, CPS-6 alone had no activity in processing any of the substrates, as shown in FIG. 8D. Taken together, these observations demonstrate that CPS-6 can enhance both the novel endonuclease and 5′-3′ exonuclease activities of CRN-1 in a gap-dependent manner and offer important insights into the type of substrates or cleavage intermediates that CRN-1/CPS-6 might process or generate during apoptosis, providing the basis for a molecular model on how CRN-1 and CPS-6 may act together to promote stepwise chromosome fragmentation, as shown for example in FIG. 9.

FIG. 9 shows a schematic molecular model for chromosome fragmentation during apoptosis that is supported by the results described above. In stage 900, intact chromosomal DNA is likely nicked by CPS-6 aided by CRN-1 and/or another nuclease. Following nicking, stage 902 shows that the 5′-3′ exonuclease activities of CRN-1, aided by CPS-6 and possibly other exonucleases, turn the nicks into gaps. In stage 904, the resulting gapped substrates are cleaved by CRN-1 gap-dependent endonuclease activity (aided by CPS-6), resulting in fragmented substrates shown in stage 906, which either are further processed by a 3′-5′ exonuclease in stage 908 or can be directly processed in stage 910 through similar steps (900 to 910) to generate smaller DNA fragments.

A study was performed to determine whether CRN-1 nuclease activities and CRN-1 interaction with CPS-6 are implicated in CRN-1 cell killing activity. Expression of CRN-1 in six non-essential touch receptor neurons under the control of the mec-7 gene promoter (P mec-7crn-1) (24) induced ectopic neuronal deaths, killing 16% to 20% of the test population when expressed from low copy transgenes, or 60% to 77% when expressed from high copy trans genes of the PLM touch receptor neurons, as reported in Table 8. Expression of CRN-1(E160D) or CRN-1(DY-AA) in touch cells weakly induced cell killing, as reported in Table 8. These results indicate that both the exonuclease and the endonuclease activities of CRN-1 are implicated in CRN-1 killing activity.

CRN-1-induced ectopic neuronal deaths were significantly inhibited by the CPS-6(sm116) or the ced-3(n2433) mutation, as reported in Table 8. These results indicate that CRN-1 induced cell death through existing apoptotic programs is mediated by cps-6 and ced-3. Furthermore, a nuclease-defective CPS-6 protein [CPS-6(D134A, Y135A)], which by itself had very weak cell killing activity, as reported in Table 8, significantly inhibited CRN-1 killing activity when co-expressed with CRN-1 in touch cells. These results indicate that the mutant CPS-6 protein may dominant-negatively inhibit CRN-1 cell killing, as shown in Table 8. These results provide further evidence that CPS-6 and CRN-1 function together to promote cell killing.

In summary, CRN-1 is newly discovered as an apoptotic nuclease that has been identified from a functional genomic screen. CRN-1 associates and cooperates with the mitochondrial nuclease CPS-6 to promote apoptotic DNA degradation. This conclusion is supported by the in vitro observations that CRN-1 bound CPS-6 and these two proteins mutually stimulated each other's nuclease activities and the in vivo observations that crn-1 (RNAi) caused cell death defects very similar to the cps-6(sm116) mutation and did not enhance the cell death defects observed in cps-6(sm116) mutants, and that crn-1 induced ectopic cell deaths in a cps-6-dependent manner.

Bioinformatic studies show that crn-1 encodes a homologue of human FEN-1 and yeast Rad27p. These nucleases are used for DNA replication and damage repair. The need for crn-1 in C. elegans embryonic development and the finding that CRN-1 possesses key biochemical properties characteristic of FEN-1 indicates that CRN-1 likely plays an important role in DNA replication/repair in C. elegans, in addition to its newly discovered role in apoptosis. Therefore, CRN-1 may serve as a critical switch between DNA replication/repair and degradation, two opposing biological events. Normally, CRN-1/FEN-1 assists in nuclear DNA replication and repair to maintain genome stability and fidelity. Pro-apoptotic stimuli could trigger translocation of CPS-6/Endo G from mitochondria to nuclei, facilitating association of CPS-6/EndoG with CRN-1/FEN-1 in nuclei, which transforms CRN-1/FEN-1 from a genome stabilizer to a genome destroyer.

In addition to CRN-1, several other CRN genes that normally appear to play important roles in RNA processing, splicing and protein folding are involved in apoptotic DNA degradation. Thus, CRN-1/FEN-1 as well as these CRN proteins could act as “double agents” like cytochrome c in regulating both cell survival and cell death.

TABLE 8
Overexpression of crn-1 induces ectopic cell killing.
High Low
Concentration† Concentration†
% PLM % PLM
Strain* Array survival§ Array survival§
N2 100
ced-3(n2433) 100
cps-6(sml16) 100
N2; P mec-7CRN-1 1 38 1 82
2 40 2 84
3 23 3 80
N2; P mec-7CRN-1(EI60D) 1 80 1 93
2 90 2 90
3 87 3 90
N2; P mec-7CRN-1(DY-AA) 1 83 1 100
2 87 2 100
3 90 3 97
N2; P mec-7CPS-6(DY-AA) 1 93 1 100
2 93 2 97
3 87 3 100
N2; P mec-7CRN-I/P mec-7 1 69 1 97
CPS-6(DY-AA) 2 75 2 93
3 67 3 100
ced-3(n2433),. P mec-7CRN-1 1 75 1 97
2 70 2 97
3 69 3 100
cps-6(sml16),. mec-7-7CRN-1 1 66 1 93
2 72 2 93
3 60 3 97

*All strains contain an integrated trans gene, bzIs8, which directs GFP expression in six mechanosensory neurons under the control of the mec-4 gene promoter and is used to help identify the PLML/R neurons. N2 is the wild-type strain. CPS-6(DY-
# AA) denotes CPS-6(DI34A, YI35A). CRN-1(DY-AA) denotes CRN-1(D233A, Y234A).

†Transgenes were injected at a concentration of 50 μg/ml (high concentration) or 5 μg/ml (low concentration) with pRF4 (at 50 μg/ml), a dominant co-injection marker (26).

§PLM survival was scored in transgenic L4 larvae based on the number of fluorescent PLMR/L neurons detected using a fluorescent Nomarski microscope. At least 15 animals were scored for each transgenic line.

Example 9 CRN-1: Use of Bioinformatic Systems

The attached Sequence Listing contains evidence of comparison studies that commercially available bioinformatic systems can produce. Sequencing projects are currently underway to sequence the entire genomes of various organisms, and the genomes of certain organisms have been entirely sequenced. It is common practice to place this genetic information into commercially available bioinformatic databases for study and analysis. Although the data is available, there remains much to be learned from these genomic databases. Table 9 below shows the results of genomic comparisons that confirms conservation of homologous genes encoding the CRN nucleases across a wide variety of species including nematodes, humans, and plants. The comparison results shown in Table 9 were obtained using commercially available bioinformatic databases to compare sequences confirming high identity in comparison to the CRN materials that were isolated from C. elegans and confirmed by TUNEL analysis, as described above in Example 1.

TABLE 9
Trans-species conservation of CRN homologs.
C. elegans CRN Material or Homolog as shown in SEQ ID NO.
CYP-
Species CRN-1 CRN-2 CRN-3 CRN-4 CRN-5 CRN-6 13
C. elegans 1, 2, 3, 4, 34 5, 6, 7, 9, 10, 11, 12, 13, 14, 17, 18,
33 8, 35 36 37 15, 16, 39
38
Homo 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
sapiens 20, 40 41 42 43 44 45 46
(FEN- (CDA11) (PM- (MGC16943) (RRP46) (DNaseII) (Cycliphilin
1) SCL-100) E)
Arabidopsis 47 48 49 50 51
thaliana

One significance of observing highly conserved genetic sequences across plants, lower animals, and higher animals (and even bacteria) it that one homolog or ortholog may be substituted for another, for example, as FEN-1 may be substituted for CRN-1. These substitutions may modulate the activity of apoptotic complexes, cofactors, time dependant relationships, or synergystic cooperation of different nucleases in the degradeosome pathways, for example, as illustrated in FIG. 5. Furthermore, when these substitutions are made and subsequent assay observations indicate that activity of the substituted combinations has been altered, selected polynucleic acid portions of one homolog may be spliced, grafted or fused into counterpart nucleases to produce synthetic gene materials having still different activities.

FIG. 10 shows an assay kit 1000 that may be used according to the instrumentalities described herein. A plurality of CRN materials 1002 may include, for example, polypeptide or polynucleotide described in SEQ ID NOs. 1-15. These materials may, for example, be expressed and harvested from C. elegans according to procedures described above. For example, purification may be by affinity chromatography with the purified materials being diluted 50% in glycerol and stored indefinitely at a low temperature, such as −50° C.

An operator 1004 is not necessarily included in the assay kit and may be a laboratory technician, a computer assisted robotic device, and/or other laboratory equipment commonly used in procedures generally of the type described above. The operator 1004 may combine the CRN materials 1002 in any combination, at any concentration, or at any level of expression in a host organism, for use in any number of reactors 1006. By way of example, the reactors 1006 may be cell cultures, host organisms, or reaction beakers. Where the CRN materials 1002 include crn polynucleotides, the operator 1004 may transform a host organism to express one or more of the CRN materials as the reactors 1006. The operator 1004 may further contact the reactors 1006 with CRN polypeptides. Optionally, the operator 1004 may mix a DNA substrate 1008 into the reactors 1006 to observe DNA degradation. The assay kit 1000 may also contain a modulator composition 1010, or the operator 1004 may provide the modulator composition 1008 independently of the assay kit 1000. Suitable modulator compositions may include, for example, RNAi materials, small molecules designed by biochemists to interfere or enhance direct or indirect DNA degradation activity of the CRN materials 1002, small molecules that bind or react with the CRN materials 1002 to impair or enhance activity of the CRN materials 1002, bioactive chemicals that function as modulators, or a deactivated nuclease that may compete with the CRN materials 1002 or impair access of the CRN materials 1002 to the DNA substrate 1008.

An analytical agent 1012 is not necessarily part of assay kit 1000, and may be a laboratory technician, optical instrumentation, and/or other laboratory analytical equipment commonly used in procedures generally of the type described above. The analytical agent 1012 may use, for example, antibodies 1014 to assess the concentration of CRN materials 1012 and associated products in the reactors 1006.

Instructions 1016 may contain, for example, instructions for storage and use of the CRN materials 1002 according to any experimental protocol or any protocol for diagnosing a disease.

While the foregoing instrumentalities have been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the invention. For example, all the techniques and apparatus described above may be used in various combinations. All publications, patents, patent applications, or other documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, or other document were individually indicated to be incorporated by reference for all purposes.

References

Additional information is found in the following publications and references cited within:

  • Andreeva, L., Heads, R., and Green, C. J. (1999). Cyclophilins and their possible role in the stress response. Int. J. Exp. Pathol. 80, 305-315.
  • Apweiler, R., Attwood, T. K., Bairoch, A., Bateman, A., Birney, E., Biswas, M., Bucher, P., Cerutti, L., Corpet, F., Croning, M. D., et al. (2001). The InterPro database, an integrated documentation resource for protein families, domains and functional sites. Nucleic Acids Res. 29, 37-40.
  • Arnold, Protein engineering for unusual environments, Current Opinion in Biotechnology 4:450-455 (1993);
  • Bass et al., Mutant Trp repressors with new DNA-binding specificities, Science 242:240-245 (1988);
  • Bell, D. A., Morrison, B., and VandenBygaart, P. (1990). Immunogenic DNA-related factors. Nucleosomes spontaneously released from normal murine lymphoid cells stimulate proliferation and immunoglobulin synthesis of normal mouse lymphocytes. J. Clin. Invest. 85, 1487-1496.
  • Blumenthal, T., Evans, D., Link, C. D., Guffanti, A., Lawson, D., Thierry-Mieg, J., Thierry-Mieg, D., Chiu, W. L., Duke, K., Kiraly, M., and Kim, S. K. (2002). A global analysis of Caenorhabditis elegans operons. Nature 417, 851-854.
  • Botstein & Shortle, Strategies and applications of in vitro mutagenesis, Science 229:1193-1201(1985);
  • Boulton, S. J., Gartner, A., Reboul, J., Vaglio, P., Dyson, N., Hill, D. E., and Vidal, M. (2002). Combined functional genomic maps of the C. elegans DNA damage response. Science 295, 127-131.
  • Brenner, S. (1974). he genetics of Caenorhabditis elegans. Genetics 77, 71-94.
  • Brouwer, R., Pruijn, G. J., and van Venrooij, W. J. (2001). The human exosome: an autoantigenic complex of exoribonucleases in myositis and scleroderma. Arthritis Res. 3, 102-106.
  • Carter et al., Improved oligonucleotide site-directed mutagenesis using M13 vectors, Nucl. Acids Res. 13: 4431-4443 (1985);
  • Carter, Improved oligonucleotide-directed mutagenesis using M13 vectors, Methods in Enzymol. 154: 382-403 (1987);
  • Carter, Site-directed mutagenesis, Biochem. J. 237:1-7 (1986);
  • Consortium, T. C. e. S. (1998). Genome sequence of the nematode C. elegans: a platform for investigating biology. The C. elegans Sequencing Consortium. Science 282, 2012-2018.
  • Dale et al., Oligonucleotide-directed random mutagenesis using the phosphorothioate method, Methods Mol. Biol. 57:369-374 (1996);
  • Eghtedarzadeh & Henikoff, Use of oligonucleotides to generate large deletions, Nucl. Acids Res. 14: 5115 (1986);
  • Ellis, H. M., and Horvitz, H. R. (1986). Genetic control of programmed cell death in the nematode C. elegans. Cell 44, 817-829.
  • Enari, M., Sakahira, H., Yokoyama, H., Okawa, K., Iwamatsu, A., and Nagata, S. (1998). A caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD. Nature 391, 43-50.
  • Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806-811.
  • Fraser, A. G., Kamath, R. S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M., and Ahringer, J. (2000). Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408, 325-330.
  • Fritz et al., Oligonucleotide-directed construction of mutations: a gapped duplex DNA procedure without enzymatic reactions in vitro, Nucl. Acids Res. 16: 6987-6999 (1988);
  • Gonczy, P., Echeverri, C., Oegema, K., Coulson, A., Jones, S. J., Copley, R. R., Duperon, J., Oegema, J., Brehm, M., Cassin, E., et al. (2000). Functional genomic analysis of cell division in C. elegans using RNAi of genes on chromosome III. Nature 408, 331-336.
  • Grundström et al., Oligonucleotide-directed mutagenesis by microscale ‘shot-gun’ gene synthesis, Nucl. Acids Res. 13: 3305-3316 (1985);
  • Halenbeck, R., MacDonald, H., Roulston, A., Chen, T. T., Conroy, L., and Williams, L. T. (1998). CPAN, a human nuclease regulated by the caspase-sensitive inhibitor DFF45. Curr. Biol. 8, 537-540.
  • Harrington, J. J., and Lieber, M. R. (1994). The characterization of a mammalian DNA structure-specific endonuclease. Embo J. 13, 1235-1246.
  • Hoeppner, D. J., Hengartner, M. O., and Schnabel, R. (2001). Engulfment genes cooperate with ced-3 to promote cell death in Caenorhabditis elegans. Nature 412, 202-206.
  • Klein, J. A., Longo-Guess, C. M., Rossmann, M. P., Seburn, K. L., Hurd, R. E., Frankel, W. N., Bronson, R. T., and Ackerman, S. L. (2002). The harlequin mouse mutation downregulates apoptosis-inducing factor. Nature 419, 367-374.
  • Koonin, E. V., and Deutscher, M. P. (1993). RNase T shares conserved sequence motifs with DNA proofreading exonucleases. Nucleic Acids Res. 21, 2521-2522.
  • Kramer & Fritz Oligonucleotide-directed construction of mutations via gapped duplex DNA, Methods in Enzymol. 154:350-367 (1987);
  • Kramer et al., Point Mismatch Repair, Cell 38:879-887 (1984); Kramer et al., Improved enzymatic in vitro reactions in the gapped duplex DNA approach to oligonucleotide-directed construction of mutations, Nucl. Acids Res. 16: 7207 (1988);
  • Kramer et al., The gapped duplex DNA approach to oligonucleotide-directed mutation construction, Nucl. Acids Res. 12: 9441-9456 (1984);
  • Kunkel et al., Rapid and efficient site-specific mutagenesis without phenotypic selection, Methods in Enzymol. 154, 367-382 (1987);
  • Kunkel, Rapid and efficient site-specific mutagenesis without phenotypic selection, Proc. Natl. Acad. Sci. USA 82:488-492 (1985);
  • Kunkel, The efficiency of oligonucleotide directed mutagenesis, in Nucleic Acids & Molecular Biology (Eckstein, F. and Lilley, D. M. J. eds., Springer Verlag, Berlin)) (1987);
  • Li, L. Y., Luo, X., and Wang, X. (2001). Endonuclease G is an apoptotic DNase when released from mitochondria. Nature 412, 95-99.
  • Lieber, M. R. (1997). The FEN-1 family of structure-specific nucleases in eukaryotic DNA replication, recombination and repair. Bioessays 19, 233-240.
  • Ling et al., Approaches to DNA mutagenesis: an overview, Anal Biochem. 254(2): 157-178 (1997);
  • Liu, X., Kim, C. N., Yang, J., Jemmerson, R., and Wang, X. (1996). Induction of apoptotic program in cell-free extracts: requirement for dATP and cytochrome c. Cell 86, 147-157.
  • Liu, X., L1, P., Widlak, P., Zou, H., Luo, X., Garrard, W. T., and Wang, X. (1998). The 40-kDa subunit of DNA fragmentation factor induces DNA fragmentation and chromatin condensation during apoptosis. Proc. Natl. Acad. Sci. USA 95, 8461-8466.
  • Liu, X., Zou, H., Slaughter, C., and Wang, X. (1997). DFF, a heterodimeric protein that functions downstream of caspase-3 to trigger DNA fragmentation during apoptosis. Cell 89, 175-184.
  • Lorimer and Pastan Nucleic Acids Res. 23, 3067-8 (1995);
  • Mandecki, Oligonucleotide-directed double-strand break repair in plasmids of Escherichia coli: a method for site-specific mutagenesis, Proc. Natl. Acad. Sci. USA, 83:7177-7181 (1986);
  • McIlroy, D., Tanaka, M., Sakahira, H., Fukuyama, H., Suzuki, M., Yamamura, K., Ohsawa, Y., Uchiyama, Y., and Nagata, S. (2000). An auxiliary mode of apoptotic DNA fragmentation provided by phagocytes. Genes. Dev. 14, 549-558.
  • Mi, H., Kops, O., Zimmermann, E., Jaschke, A., and Tropschug, M. (1996). A nuclear RNA-binding cyclophilin in human T cells. FEBS Lett. 398, 201-205.
  • Montague, J. W., Hughes, F. M., Jr., and Cidlowski, J. A. (1997). Native recombinant cyclophilins A, B, and C degrade DNA independently of peptidylprolyl cis-trans-isomerase activity. Potential roles of cyclophilins in apoptosis. J. Biol. Chem. 272, 6677-6684.
  • Nakamaye & Eckstein, Inhibition of restriction endonuclease Nci I cleavage by phosphorothioate groups and its application to oligonucleotide-directed mutagenesis, Nucl. Acids Res. 14: 9679-9698 (1986);
  • Nambiar et al., Total synthesis and cloning of a gene coding for the ribonuclease S protein, Science 223: 1299-1301 (1984);
  • Parrish, J., L1, L., Klotz, K., Ledwich, D., Wang, X., and Xue, D. (2001). Mitochondrial endonuclease G is important for apoptosis in C. elegans. Nature 412, 90-94.
  • Perumal, K., and Reddy, R. (2002). The 3′ end formation in small RNAs. Gene Expr. 10, 59-78.
  • Platt, N., da Silva, R. P., and Gordon, S. (1998). Recognizing death: the phagocytosis of apoptotic cells. Trends Cell Biol. 8, 365-372.
  • Reddien, P. W., Cameron, S., and Horvitz, H. R. (2001). Phagocytosis promotes programmed cell death in C. elegans. Nature 412, 198-202.
  • Reed, J. C. (1997). Cytochrome c: can't live with it—can't live without it. Cell 91, 559-562.
  • Riddle, D. L., Blumenthal, T., Meyer, B. J., and Priess, J. R., eds. (1997). C. elegans II (Cold Spring Harbor, Cold Spring Harbor Laboratory).
  • Sakamar and Khorana, Total synthesis and expression of a gene for the a-subunit of bovine rod outer segment guanine nucleotide-binding protein (transducin), Nucl. Acids Res. 14: 6361-6372 (1988);
  • Samejima, K., Tone, S., and Earnshaw, W. C. (2001). CAD/DFF40 nuclease is dispensable for high molecular weight DNA cleavage and stage I chromatin condensation in apoptosis. J. Biol. Chem. 276, 45427-45432.
  • Sayers et al., Strand specific cleavage of phosphorothioate-containing DNA by reaction with restriction endonucleases in the presence of ethidium bromide, (1988) Nucl. Acids Res. 16: 803-814;
  • Sayers et al., Y-T Exonucleases in phosphorothioate-based oligonucleotide-directed mutagenesis, Nucl. Acids Res. 16:791-802 (1988);
  • Sieber, et al., Nature Biotechnology, 19:456-460 (2001); Smith, In vitro mutagenesis, Ann. Rev. Genet. 19:423-462(1985); Methods in Enzymol. 100: 468-500 (1983); Methods in Enzymol. 154: 329-350 (1987);
  • Sonnhammer, E. L., Eddy, S. R., and Durbin, R. (1997). Pfam: a comprehensive database of protein domain families based on seed alignments. Proteins 28, 405-420.
  • Steller, H. (1995). Mechanisms and genes of cellular suicide. Science 267, 1445-1449.
  • Stemmer, Nature 370, 389-91 (1994); Taylor et al., The use of phosphorothioate-modified DNA in restriction enzyme reactions to prepare nicked DNA, Nucl. Acids Res. 13: 8749-8764 (1985);
  • Sulston, J. E. (1976). Post-embryonic development in the ventral cord of Caenorhabditis elegans. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 275, 287-297.
  • Sulston, J. E., Schierenberg, E., White, J. G., and Thomson, J. N. (1983). The embryonic cell lineage of the nematode Caenorhabditis elegans. Dev. Biol. 100, 64-119.
  • Susin, S. A., Lorenzo, H. K., Zamzami, N., Marzo, I., Snow, B. E., Brothers, G. M., Mangion, J., Jacotot, E., Costantini, P., Loeffler, M., et al. (1999). Molecular characterization of mitochondrial apoptosis-inducing factor. Nature 397, 441-446.
  • Taylor et al., The rapid generation of oligonucleotide-directed mutations at high frequency using phosphorothioate-modified DNA, Nucl. Acids Res. 13: 8765-8787 (1985);
  • Vaux, D. L., and Korsmeyer, S. J. (1999). Cell death in development. Cell 96, 245-254.
  • Walhout, A. J., Sordella, R., Lu, X., Hartley, J. L., Temple, G. F., Brasch, M. A., Thierry-Mieg, N., and Vidal, M. (2000). Protein interaction mapping in C. elegans using proteins involved in vulval development. Science 287, 116-122.
  • Wang, X., Yang, C., Chai, J., Shi, Y., and Xue, D. (2002). Mechanisms of AIF-Mediated Apoptotic DNA Degradation in Caenorhabditis elegans. Science 298, 1587-1592.
  • Wells et al., Importance of hydrogen-bond formation in stabilizing the transition state of subtilisin, Phil. Trans. R. Soc. Lond. A 317: 415-423 (1986); Wells et al., Cassette mutagenesis: an efficient method for generation of multiple mutations at defined sites, Gene 34:315-323 (1985);
  • Wexler, M., Sargent, F., Jack, R. L., Stanley, N. R., Bogsch, E. G., Robinson, C., Berks, B. C., and Palmer, T. (2000). TatD is a cytoplasmic protein with DNase activity. No requirement for TatD family proteins in sec-independent protein export. J. Biol. Chem. 275, 16717-16722.
  • Wu, Y. C., Stanfield, G. M., and Horvitz, H. R. (2000). NUC-1, a Caenorhabditis elegans DNase II homolog, functions in an intermediate step of DNA degradation during apoptosis. Genes. Dev. 14, 536-548.
  • Wyllie, A. H. (1980). Glucocorticoid-induced thymocyte apoptosis is associated with endogenous endonuclease activation. Nature 284, 555-556.
  • Zhang, J., and Xu, M. (2002). Apoptotic DNA fragmentation and tissue homeostasis. Trends Cell Biol. 12, 84-89.
  • Zhang, J., Liu, X., Scherer, D. C., van Kaer, L., Wang, X., and Xu, M. (1998). Resistance to DNA fragmentation and chromatin condensation in mice lacking the DNA fragmentation factor 45. Proc. Natl. Acad. Sci. U.S.A. 95, 12480-12485.
  • Zhou, Z., Licklider, L. J., Gygi, S. P., and Reed, R. (2002). Comprehensive proteomic analysis of the human spliceosome. Nature 419, 182-185.
  • Zoller & Smith, Oligonucleotide-directed mutagenesis of DNA fragments cloned into M13 vectors, Methods in Enzymol. 100:468-500 (1983); and
  • Zoller & Smith, Oligonucleotide-directed mutagenesis using M13-derived vectors: an efficient and general procedure for the production of point mutations in any DNA fragment, Nucleic Acids Res. 10:6487-6500 (1982);
  • Zoller & Smith, Oligonucleotide-directed mutagenesis: a simple method using two oligonucleotide primers and a single-stranded DNA template, Methods in Enzymol. 154:329-350 (1987). Additional details on many of the above methods can be found in Methods in Enzymology Volume 154, which also describes useful controls for trouble-shooting problems with various mutagenesis methods.
  • Zou, H., Henzel, W. J., Liu, X., Lutschg, A., and Wang, X. (1997). Apaf-1, a human protein homologous to C. elegans CED-4, participates in cytochrome c-dependent activation of caspase-3. Cell 90, 405-413.
  • Zou, H., L1, Y., Liu, X., and Wang, X. (1999). An APAF-1.Cytochrome c multimeric complex is a functional apoptosome that activates procaspase-9. J. Biol. Chem. 274, 11549-11556.

Claims

1. An assay kit for screening for an apoptosis modulator, comprising:

an isolated CRN material selected from the group consisting of a polypeptide having at least 80% sequence identity with respect to a sequence of SEQ ID NOS. 1-51 or a fragment thereof at least fifteen residues in length, a polynucleotide encoding the polypeptide, a polynucleotide encoding the fragment, an ortholog of the polypeptide, an ortholog of the polynucleotide, and combinations thereof; and

instructions describing the use of the kit in screening for apoptosis modulators that affect DNA degradation activity of the CRN material.

2. The assay kit of claim 1, wherein the kit comprises a DNA substrate and the instructions document use of the kit in assessing degradation of the DNA substrate.

3. The assay kit of claim 1, further comprising at least one of an antibody that specifically binds to the CRN material.

4. The assay kit of claim 1, wherein the CRN material includes the polypeptide and further comprising a host organism capable of expressing the polypeptide.

5. The assay kit of claim 4, wherein the host organism comprises C. elegans.

6. The assay kit of claim 4, wherein the host organism comprises a microorganism.

7. The assay kit of claim 4, wherein the host organism comprises a mammal.

8. The assay kit of claim 4, wherein the host organism comprises an invertebrate.

9. The assay kit of claim 1, further comprising a candidate apoptosis modulator.

10. The assay kit of claim 9, wherein the CRN material comprises the polynucleotide and the candidate apoptosis modulator comprises RNAi material targeting the polynucleotide.

11. The assay kit of claim 1, wherein the CRN material comprises at least two polypeptides of SEQ ID NOS. 1-51.

12. The assay kit of claim 1, wherein the CRN material comprises at least three polypeptides of SEQ ID NOS. 1-51.

13. The assay kit of claim 1, wherein the CRN material comprises at least three polypeptides of SEQ ID NOS. 1-51.

14. The assay kit of claim 1, wherein the CRN material comprises at least one polypeptide of SEQ ID NOS. 1-18.

15. The assay kit of claim 1, wherein the CRN material comprises at least two polypeptides of SEQ ID NOS. 1-18.

16. The assay kit of claim 1, wherein the CRN material comprises at least three polypeptides of SEQ ID NOS. 1-18.

17. A method of screening for an apoptosis modulator, the method comprising:

(a) contacting at least one candidate apoptosis modulator with a CRN material selected from the group consisting of a polypeptide having at least 75% sequence identity with respect to a sequence of SEQ ID NOS. 1-51 or a fragment thereof, a polynucleotide encoding the polypeptide, an ortholog of the polypeptide, an ortholog of the polynucleotide, and combinations thereof; and

(b) detecting a modulated activity and/or expression of the polypeptide, thereby screening for the apoptosis modulator.

18. The method of claim 17, wherein the step of detecting comprises detecting DNA degradation

19. The method of claim 17, wherein the CRN material comprises the polynucleotide and the candidate apoptosis modulator comprises RNAi material targeting the polynucleotide.

20. The method of claim 17, wherein the CRN material comprises at least two polypeptides of SEQ ID NOS. 1-51.

21. The method of claim 17, wherein the CRN material comprises at least three polypeptides of SEQ ID NOS. 1-51.

22. The method of claim 17, wherein the CRN material comprises at least two polypeptides of SEQ ID NOS. 1-51.

23. The method of claim 17, wherein the CRN material comprises at least one polypeptide of SEQ ID NOS. 1-18.

24. The method of claim 17, wherein the CRN material comprises at least two polypeptides of SEQ ID NOS. 1-18.

25. The method of claim 17, wherein the CRN material comprises at least three polypeptides of SEQ ID NOS. 1-18.

26. The method of claim 17, further comprising steps of

isolating the apoptosis modulator; and

converting the apoptosis modulator into a dosage form in an effective amount for modulating apoptosis in an organism.

27. An apoptosis modulator in dosage form produced by the method of claim 26.

28. An antibody or antisera which specifically binds to a polypeptide, the polypeptide comprising a sequence selected from the group consisting of: SEQ ID NOS: 1-51.

29. The antibody of claim 28, further comprising a tag on the antibody.

30. An isolated or recombinant polypeptide or a fragment thereof comprising a sequence selected from the group consisting of: SEQ ID NOS: 1-18.

31. An isolated or recombinant polynucleotide that encodes the polypeptide of claim 27 or a fragment thereof.

32. A vector comprising the polynucleotide of claim 31.

33. A cell transduced by the vector of claim 32.

34. A transgenic organism comprising the polynucleotide of claim 31.

35. A method of producing a polypeptide comprising:

(a) introducing into a cell a polynucleotide or a fragment thereof that encodes a polypeptide or a fragment thereof comprising a sequence selected from the group consisting of: SEQ ID NOS: 1-18, which polynucleotide is optionally linked to a regulatory sequence effective to produce the encoded polypeptide or the fragment thereof;

(b) culturing the cells in a culture medium to produce the polypeptide or the fragment thereof; and

(c) isolating the polypeptide or the fragment thereof from the cells or from the culture medium.

36. A method of chemically modifying a biological molecule, the method comprising contacting a biological molecule that is a substrate of one or more polypeptides comprising sequences selected from the group consisting of: SEQ ID NOS: 1-51 with the polypeptides, whereby the polypeptides chemically modify the biological molecule.

37. A protein complex comprising CPS-6 (SEQ ID NO: 52) and at least one polypeptide selected from the group consisting of SEQ ID NOS: 1-51 and combinations thereof, the complex displaying enhanced modulation of apoptosis relative to the modulation displayed by a single polypeptide selected from the group consisting of SEQ ID NOS: 1-51.

38. The protein complex of claim 37 further comprising WAH-1 (SEQ ID NO: 53).

39. A method of detecting gene mutations in the wild-type or mutated CRN genes comprising

a) using polynucleotides with a minimum length of 10 bp that are derived and substantially identical to SEQ ID NOS. 1-51.

40. The method of claim 39, wherein the polynucleotides are used in a DNA hybridization analysis, such as Southern Blot.

41. The method of claim 39, wherein the polynucleotide is used as a primer for a PCR.

42. The method of claim 39, wherein the analyses are performed in an organism including but not limited to human.

43. The method of claim 39, wherein the analyses are performed in cells taken from an organism including but not limited to a human organism.

44. A method of detecting the expression levels of the crn genes using antibodies.

45. A method of detecting expression levels of the crn genes by measuring the mRNA level of a crn polynucleotide.

46. The method of claim 45, wherein mRNA levels are measured by an RNA hybridization assay.

47. The method of claim 45, wherein mRNA levels are measured by a microarray analysis.

48. A method of identifying proteins that play a role in apoptosis by screening for proteins that interact with the CRN family of proteins.

49. A method of screening for modulators that alter the functions of the CRN proteins, comprising the steps of:

providing a candidate modulator; and

a further step selected from the group consisting of contacting the candidate modulator with a CRN polypeptide; and

contacting the candidate modulator with a receptor for a CRN polypeptide to provide a modified receptor followed by introducing the CRN polypeptide to the receptor; and

assessing DNA degradation activity of the CRN polypeptide.

50. The method of claim 47 wherein the further step comprises that of contacting the candidate modulator with a CRN polypeptide.

51. The method of claim 49, wherein the step of providing a candidate modulator comprises designing a small molecule that inhibits CRN nuclease activities.

52. The method of claim 49, wherein the step of providing a candidate modulator comprises designing a small molecule that blocks interaction between CRN nucleases and other proteins.

53. A method of detecting apoptosis in a cell or an organism through an assay measuring the activities of at least one polypeptide selected from the group consisting of: SEQ ID NOS: 1-51.

54. The method of claim 53, wherein the assay is conducted by measuring the expression levels of the polypeptides.

55. The method of claim 53, wherein the assay is conducted by monitoring DNA fragmentation in the cells.

56. The method of claim 53, wherein the assay is conducted by measuring the nuclease activities of the polypeptides.

57. A method of mapping the chromosomal locus of at least one genes encoding the polypeptides selected from the group consisting of: SEQ ID NOS: 1-51.

58. The method of claim 54, wherein the mapping is conducted by in situ DNA hybridization.