Patent application title:

Microorganisms and assays for the identification of antibiotics

Publication number:

US20050158842A1

Publication date:
Application number:

11/011,979

Filed date:

2004-12-13

Abstract:

The present invention features methods for the identification of compounds and compositions useful as antibiotics and antibacterial agents. In particular, the invention features methods for the identification of modulators of a previously unidentified target protein, termed CoaX. High-throughput assay systems are featured as well as assay kits for the identification of CoaX modulators. Also featured are coaX nucleic acid molecules and purified CoaX proteins, as well as recombinant vectors and microorganisms including the gene, coaX.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N9/1205 »  CPC main

Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7) Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases

C12N15/52 »  CPC further

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Genes encoding for enzymes or proenzymes

C12P13/02 »  CPC further

Preparation of nitrogen-containing organic compounds Amides, e.g. chloramphenicol or polyamides; Imides or polyimides; Urethanes, i.e. compounds comprising N-C=O structural element or polyurethanes

C12P17/04 »  CPC further

Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms; Oxygen as only ring hetero atoms containing a five-membered hetero ring, e.g. griseofulvin, vitamin C

Description

RELATED APPLICATIONS

This application is a divisional application of U.S. patent application Ser. No. 09/813,453, entitled “Microorganisms and Assays for the Identification of Antibiotics” filed Mar. 20, 2001, which claims the benefit of prior filed provisional U.S. patent application Ser. No. 60/227,860, entitled “Novel Microbial Pantothenate Kinase Gene and Methods of Use”, filed Aug. 24, 2000, which is also. related to U.S. patent application Ser. No. 09/667,569, entitled “Methods and Microorganisms for Production of Panto-Compounds”, filed Sep. 21, 2000 The entire content of the above-referenced patent applications is incorporated herein by this reference.

BACKGROUND OF THE INVENTION

Antimicrobial or antibiotic treatment is a well-accepted therapy for fighting microbial infections that takes advantage of the existence of biological processes that are unique to bacteria or fungi, that can be safely inhibited to the detriment of the bacteria, without producing undesired or harmful side effects in the individual receiving such therapy. However, due at least in part to the continual evolution of microbial resistance to the available classes of antibiotics, and in part to the recent slowdown in the introduction of novel antimicrobials to market, there exists a need for the development of screening assays that target previously unexploited biochemical systems in microbes. In particular, there exists the need for the identification of new bacterial targets for use in drug discover programs designed to identify agents having potential use as anti-infective agents with novel modes of actions.

SUMMARY OF THE INVENTION

The present invention is based at least in part, on the identification of a novel target for use in screening assays designed to identify antimicrobial agents. In particular, the present invention is based on the identification and characterization of a previously unidentified microbial pantothenate kinase gene, coaX. The coaX gene was first identified in B. subtilis where it is one of two genes encoding functional pantothenate kinase. Initially the present inventors identified and cloned the B. subtilis coaA gene (previously termed yqjS) that encodes a pantothenate kinase homologous to the CoaA enzyme previously characterized in E. coli. A second gene (previously termed yacB) has also been identified and cloned by the present inventors that is not homologous to any previously described pantothenate kinase. This latter pantothenate kinase-encoding gene has been renamed coaX. The coaX gene could be deleted from B. subtilis strains with an intact coaA gene, but it could not be deleted from a strain containing a deletion in the coaA gene, indicating that the coaX gene is not essential in B. subtilis strains with a wild-type coaA gene. Homologs of the coaX gene can be found in a number of bacterial species, including but not limited to Aquifex aeolicus, Bacillus anthracis, Bacillus halodurans, Bacillus stearothermophilus, Caulobacter crescentus, Chlorobium tepidum, Clostridium acetobutylicum, Dehalococcoides ethenogenes, Deinococcus radiodurans, Desulfovibrio vulgaris, Geobacter sulfurreducens, Pseudomonas putida, Rhodobacter capsulatus, Thiobacillus ferrooxidans, Streptomyces coelicolor, Synechocystis sp., Thermotoga maritima, Bordetella pertussis, Borrelia burgdorferi, Campylobacter jejuni, Clostridium difficile, Helicobacter pylori, Neisseria meningitidis, Neisseria gonorrhoeae, Porphyromonas gingivalis, Pseudomonas aeruginosa, Pseudomonas syringae pv tomato, Treponema pallidum, Xylella fastidiosa and Mycobacterium tuberculosis. More importantly, however, this novel pantothenate kinase gene has been found to be the sole essential pantothenate kinase in troublesome pathogens including, but not limited to, Bordetella pertussis, Borrelia burgdorferi, Campylobacter jejuni, Helicobacter pylori, Neisseria meningitidis, Pseudomonas aeruginosa, Treponema pallidum and Xylella fastidiosa. Accordingly, the coaX gene represents an attractive target for screening for new antibacterial compounds to combat these pathogenic microorganisms, particularly microorganisms in which coaX is the sole pantothenate kinase-encoding gene.

Accordingly, the present invention features isolated CoaX proteins, in particular, proteins encoded by the coaX gene in bacteria. The invention also features isolated nucleic acid molecules and/or genes, e.g., bacterial nucleic acid molecules and/or genes, in particular, isolated bacterial coaX nucleic acid molecules and/or genes. Also featured are vectors that contain isolated coaX nucleic acid molecules and/or genes as well as mutant coaX nucleic acid molecules and/or genes. Also featured are recombinant microorganisms (e.g., microorganisms belonging to the genus Escherchia or Bacillus, for example, E. coli or B. subtilis) containing isolated coaX nucleic acid molecules and/or genes or mutant coaX nucleic acid molecules and/or genes of the present invention. In particular, the invention features recombinant microorganisms that produce the CoaX proteins of the present invention, e.g., pantohthenate kinase proteins encodes by the coaX nucleic acid molecules and/or genes of the present invention.

Also featured are methods for identifying CoaX modulators utilizing, for example, isolated CoaX proteins of the present invention or recombinant microorganisms expressing the CoaX proteins of the present invention.

Other features and advantages of the invention will be apparent from the following detailed description and claims.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a schematic representation of the Coenzyme A biosynthetic pathway in E. coli.

FIG. 2 is a schematic representation of the structure of the Bacillus subtilis genome in the region of the coaA gene. The scale is in base pairs and the significant open reading frames are shown by open arrows.

FIG. 3 is a schematic representation of the structure of pAN296, a plasmid designed to delete most of the B. subtilis coaA gene and substitute a chloramphenicol resistance gene.

FIG. 4 is a schematic representation of the structure of the Bacillus subtilis genome in the region of the coaX (yacB) gene. The scale is in base pairs, the significant open reading frames are shown by open arrows and certain predicted restriction fragments are indicated by thick bars.

FIG. 5 is a schematic representation of the structure of pAN341 and pAN342, two independent PCR-derived clones of B. subtilis yacB (renamed herein as coaX).

FIG. 6A-D depicts a multiple sequence alignment (MSA) of the amino acid sequences encoded by fourteen known or predicted microbial coaX genes. SEQ ID NOs:2-15 correspond to the amino acid sequences of Bacillus subtilis (SwissProt™ Accession No. P37564), Clostridium acetobulyticum (WIT™ Accession No. RCA03301, Argonne National Laboratories), Streptomyces coelicolor (PIR™ Accession No. T36391), Mycobacterium tuberculosis (Swissprot™ Accession No. O06282), Rhodobacter capsulatus (WIT™ Accession No. RRC02473), Desulfovibrio vulgaris (DBJ™ Accession No. BAA21476.1), Deinococcus radiodurans (SwissProt™ Accession No. Q9RX54), Thermotoga maritima (GenBank™ Accession No. AAD35964.1), Treponema pallidum (SwissProt™ Accession No. O83446), Borrelia burgdorferi (SwissProt™ Accession No.O51477), Aquifex aeolicus (SwissProt™ Accession No. O67753), Synechocystis sp. (SwissProt™ Accession No. P74045), Helicobacter pylori (SwissProt™ Accession No. O25533), and Bordetella pertussis (SwissProt™ Accession No. Q45338), respectively. The alignment was generated using ClustalW MSA software at the GenomeNet CLUSTALW Server at the Institute for Chemical Research, Kyoto University. The following parameters were used: Pairwise Alignment, K-tuple (word) size=1, Window size=5, Gap Penalty=3, Number of Top Diagonals=5, Scoring Method=Percent; Multiple Alignment, Gap Open Penalty=10, Gap Extension Penalty=0.0, Weight Transition=No, Hydrophilic residues=Gly, Pro, Ser, Asn, Asp, Gln, Glu, Arg and Lys, Hydrophobic Gaps=Yes; and Scoring Matrix=BLOSUM.

FIG. 7 is a schematic representation of the structure of pAN336, a plasmid designed to delete B. subtilis coaX from its chromosomal locus and replace it with a kanamycin resistence gene.

FIG. 8 is a schematic representation of the construction of pOTP72, a plasmid containing the H. pylori coaX gene.

FIG. 9 is a schematic representation of the construction of pOTP73, a plasmid containing the P. aeruginosa coaX gene.

FIG. 10 is a schematic representation of the construction of pOTP71, a plasmid containing the B. subtilis coaX gene.

DETAILED DESCRIPTION OF THE INVENTION

The present invention is based at least in part, on the identification of a novel target for use in screening assays designed to identify antimicrobial agents. In particular, the present invention is based on the identification and characterization of a previously unidentified microbial pantothenate kinase. This pantothenate kinase, encoded by a gene, termed coaX herein, is structurally unrelated to the previously characterized E. coli pantothenate gene, coaA, however, both genes encode functional pantothenate kinase enzymes, pantothenate kinase being essential for the synthesis of Coenzyme A (CoA). CoA is an essential coenzyme in all cells, participating in over 100 different intermediary reactions in cellular metabolism including, but not limited to, the tricarboxylic acid (TCA) cycle, fatty acid metabolism, vitamin biosynthesis and numerous other reactions of intermediary metabolism. Accordingly, pantothenate kinase production is essential for microbial growth. Coenzyme A (CoA) is synthesized in both eukaryotes and prokaryotes from pantothenate, also known as pantothenic acid or vitamin B5. The initial (and possibly rate-controlling) step in the conversion of pantothenate to Coenzyme A (CoA) is phosphorylation of pantothenate by pantothenate kinase. A schematic representation of the pathway leading to CoaA biosynthesis in E. coli, i.e., the E. coli CoA biosynthetic pathway is set forth as FIG. 1. The term “CoA biosynthetic pathway”, as used herein, includes the biosynthetic pathway involving CoA biosynthetic enzymes (e.g., polypeptides encoded by biosynthetic enzyme-encoding genes), compounds (e.g., precursors, substrates, intermediates or products), cofactors and the like utilized in the formation or synthesis of CoA from pantothenate. The CoA biosynthetic pathway depicted is also presumed to be that utilized by other microorganisms. The term “CoA biosynthetic pathway” includes the biosynthetic pathway leading to the synthesis of CoA in microorganisms (e.g., in vivo) as well as the biosynthetic pathway leading to the synthesis of CoA in vitro.

The term “Coenzyme A or CoA biosynthetic enzyme” includes any enzyme utilized in the formation of a compound (e.g., intermediate or product) of the CoA biosynthetic pathway, for example, the coaA, panK or coaX gene product which catalyzes the phosphorylation of pantothenate to form 4′-phosphopantothenate, or the coaD gene product which catalyzes the conversion of 4′-phosphopantetheine to dephosphocoenzyme A.

The coaX gene was first identified in B. subtilis, a microorganism in which it is one of two pantothenate kinase-encoding genes. Initially, the present inventors identified and cloned the B. subtilis coaA gene (previously termed yqjS) that encodes a pantothenate kinase homologous to the CoaA enzyme previously characterized in E. coli. A second gene (previously termed yacB) has also been identified and cloned by the present inventors that is not homologous to any previously described pantothenate kinase. This latter pantothenate kinase-encoding gene has been renamed coaX. The coaX gene could be deleted from B. subtilis strains with an intact coaA gene, but it could not be deleted from a strain containing a deletion in the coaA gene, indicating that the coaX gene is not essential in B. subtilis strains with a wild-type coaA gene.

Homologs of the coaX gene can be found in a number of bacterial species, including but not limited to Aquifex aeolicus, Bacillus anthracis, Bacillus halodurans, Bacillus stearothermophilus, Caulobacter crescentus, Chlorobium tepidum, Clostridium acetobutylicum, Dehalococcoides ethenogenes, Deinococcus radiodurans, Desulfovibrio vulgaris, Geobacter sulfurreducens, Pseudomonas putida, Rhodobacter capsulatus, Thiobacillus ferrooxidans, Streptomyces coelicolor, Synechocystis sp., Thermotoga maritima, Bordetella pertussis, Borrelia burgdorferi, Campylobacter jejuni, Clostridium difficile, Helicobacter pylori, Neisseria meningitidis, Neisseria gonorrhoeae, Porphyromonas gingivalis, Pseudomonas aeruginosa, Legionella pneumophila, Treponema pallidum, Xylella fastidiosa and Mycobacterium tuberculosis. More importantly, however, this novel pantothenate kinase gene has been found to be the sole essential pantothenate kinase in troublesome pathogens including, but not limited to, Bordetella pertussis, Borrelia burgdorferi, Campylobacter jejuni, Helicobacter pylori, Neisseria meningitidis, Pseudomonas aeruginosa, Treponema pallidum and Xylella fastidiosa. Accordingly, the coaX gene represents an attractive target for screening for new antibacterial compounds to combat these pathogenic microorganisms, particularly microorganisms in which coaX is the sole pantothenate kinase-encoding gene.

Accordingly, in one aspect the present invention features assays for the identification an antibiotic that involve contacting a composition comprising a CoaX protein with a test compound; and determining the ability of the test compound to inhibit the activity of the CoaX protein; wherein the compound is identified as an antibiotic based on the ability of the compound to inhibit the activity of the CoaX protein. In another aspect, the invention features an assay for the identification a potential antibiotic that involves contacting an assay composition comprising CoaX with a test compound; and determining the ability of the test compound to bind to the CoaX; wherein the compound is identified as a potential antibiotic based on the ability of the compound to bind to the CoaX. In a preferred assay format, the composition is also contacted with pantothenate or a pantothenate analog and activity determined.

In another aspect, the invention features methods for identifying pantothenate kinase modulators that involve contacting a recombinant cell expressing a single pantothenate kinase encoded by a coaX gene with a test compound and determining the ability of the test compound to modulate pantothenate kinase activity in said cell. In another aspect, the invention features methods for identifying pantothenate kinase modulators that involve contacting a recombinant cell expressing a first and second pantothenate kinase, with a test compound and determining the ability of the test compound to modulate pantothenate kinase activity in said cell, wherein the first or second pantothenate kinase has reduced activity. Preferred recombinant microorganisms are of the genus Bacillus or Escherchia (e.g., Bacillus subtilis or Escherchia coli).

Also featured are isolated nucleic acid molecules that include a coaX gene of the present invention, isolated proteins encoded by the coaX genes of the present invention and biologically active portions thereof. In one embodiment, the invention features a coaX gene derived from a microorganism selected from the group consisting of Aquifex aeolicus, Bacillus anthracis, Bacillus halodurans, Bacillus stearothermophilus, Bacillus subtilis, Caulobacter crescentus, Chlorobium tepidum, Clostridium acetobutylicum, Dehalococcoides ethenogenes, Deinococcus radiodurans, Desulfovibrio vulgaris, Geobacter sulfurreducens, Pseudomonas putida, Rhodobacter capsulatus, Thiobacillus ferrooxidans, Streptomyces coelicolor, Synechocystis sp., Thermotoga maritima, Bordetella pertussis, Borrelia burgdorferi, Campylobacter jejuni, Clostridium difficile, Helicobacter pylori, Neisseria meningitidis, Neisseria gonorrhoeae, Porphyromonas gingivalis, Pseudomonas aeruginosa, Legionella pneumophila, Treponema pallidum, Xylella fastidiosa and Mycobacterium tuberculosis, or a protein encoded by said coaX gene.

In another embodiment, the invention features isolated nucleic acid molecules that include a coaX gene derived from a pathogenic bacterium selected from the group consisting of Bacillus anthracis, Bordetella pertussis, Borrelia burgdorferi, Campylobacter jejuni, Clostridium difficile, Helicobacter pylori, Neisseria meningitidis, Neisseria gonorrhoeae, Pseudomonas aeruginosa, Porphyromonas gingivalis, Legionella pneumophila, Treponema pallidum and Xylella fastidiosa, or a protein encoded by said coaX gene. In a preferred embodiment, the invention features isolated nucleic acid molecules that include a coaX gene derived from a pathogenic bacterium selected from the group consisting of Bordetella pertussis, Borrelia burgdorferi, Campylobacter jejuni, Helicobacter pylori, Neisseria meningitidis, Pseudomonas aeruginosa, Treponema pallidum and Xylella fastidiosa, or a protein encoded by said coaX gene.

Also featured are recombinant vectors that include the isolated coaX genes of the present invention and recombinant microorganisms that include said vectors.

I. General Background

A pantothenate kinase activity was first identified in Salmonella typhimurium by screening for temperature-sensitive mutants which synthesized CoA at permissive temperatures but excreted pantothenate at non-permissive temperatures. The mutations were mapped in the Salmonella chromosome and the genetic locus was designated coaA. The gene encodes the enzyme that catalyzes the first step in the biosynthesis of coenzyme A from pantothenate (Dunn and Snell (1979) J. Bacteriol. 140:805-808). Escherichia coli temperature sensitive mutants have also been isolated and characterized (Vallari and Rock (1987) J. Bacteriol. 169:5795-5800). These mutants (named coaA15(Ts)) are defective in the conversion of pantothenate to CoA and further exhibit a temperature-sensitive growth phenotype, indicating that pantothenate kinase activity is essential for growth. Moreover, it was noted that CoA inhibited pantothenate kinase activity to the same degree in the mutant as compared to the wild-type enzyme.

Feedback resistant E. coli mutants (named coaA16(Fr)) have also been isolated that possess a pantothenate kinase activity that is refractory to feedback inhibition by CoA (Vallari and Jackowski (1988) J. Bacteriol. 170:3961-3966). The mutation responsible for the reversion is, suprisingly, not genetically linked to the coaA gene by transduction. Additional data described therein support the view that the total cellular CoA content is controlled by both modulation of biosynthesis at the pantothenate kinase step and possibly by degradation of CoA to 4′-phosphopantetheine.

The wild-type E. coli coaA gene was cloned by functional complementation of E. coli temperature-sensitive mutants. The sequence of the wild-type gene was determined (Song and Jackowski (1992) J. Bacteriol. 174:6411-6417 and Flamm et al. (1988) Gene (Amst.) 74:555-558). Strains containing multiple copies of the coaA gene possessed 76-fold higher specific activity of pantothenate kinase, however, there was only a 2.7-fold increase in the steady state level of CoA (Song and Jackowski, supra). It has further been reported that the prokaryotic enzyme (encoded by coaA in E. coli and a variety of other microorganisms) is feedback inhibited by CoA both in vivo and in vitro with CoA being about five times more potent than acetyl-CoA in inhibiting the enzyme (Song and Jackowski, supra and Vallari et al., supra). These data further support the view that feedback inhibition of pantothenate kinase activity is a critical factor controlling intracellular CoA concentration. The E. coli CoaA protein has been crystalized and the structure solved (Yun et al. (2000) J. Biol. Chem. 275(36): 28093-28099).

Using standard search and alignment tools, coaA homologues have been identified in Hemophilus influenzae, Mycobacterium tuberculosis, Vibrio cholerae, Streptococcus pyogenes and Bacillus subtilis. By contrast, proteins with significant similarity could not be identified in eukaryotic cells including Saccharomyces cerevisiae or in mammalian expressed sequence tag (EST) databases. Using a genetic selection strategy, a cDNA encoding pantothenate kinase activity has recently been identified from Aspergillus nidulans (Calder et al. (1999) J. Biol. Chem. 274:2014-2020). The eukaryotic pantothenate kinase gene (panK) has distinct primary structure and unique regulatory properties that clearly distinguish it from its prokaryotic counterpart. A mammalian pantothenate kinase gene (mpanK1a) has also been isolated which encodes a protein having homology to the A. nidulans PanK protein and to the predicted gene product of GenBank™ Accession Number 927798 identified in the S. cerevisiae genome (Rock et al. (2000) J. Biol. Chem. 275:1377-1383).

II. CoaX Nucleic Acid Molecules

The present invention relates, at least in part, to the identification of a novel microbial pantothenate kinase encoding gene, coaX, that is structurally distinct from a previously identified microbial pantothenate kinase encoding gene, coaA. Accordingly, one aspect of the present invention features isolated coaX nucleic acid molecules and/or genes useful, for example, for encoding pantothenate kinase enzymes for use in screening assays.

The term “nucleic acid molecule” includes DNA molecules (e.g., linear, circular, cDNA or chromosomal DNA) and RNA molecules (e.g., tRNA, rRNA, mRNA) and analogs of the DNA or RNA generated using nucleotide analogs. The nucleic acid molecule can be single-stranded or double-stranded, but preferably is double-stranded DNA. The term “isolated” nucleic acid molecule includes a nucleic acid molecule that is free of sequences that naturally flank the nucleic acid molecule (i.e., sequences located at the 5′ and 3′ ends of the nucleic acid molecule) in the chromosomal DNA of the organism from which the nucleic acid is derived. In various embodiments, an isolated nucleic acid molecule can contain less than about 10 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, 0.1 kb, 50 bp, 25 bp or 10 bp of nucleotide sequences which naturally flank the nucleic acid molecule in chromosomal DNA of the microorganism from which the nucleic acid molecule is derived. Moreover, an “isolated” nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular materials when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.

The term “gene”, as used herein, includes a nucleic acid molecule (e.g., a DNA molecule or segment thereof), for example, a protein or RNA-encoding nucleic acid molecule, that in an organism, is separated from another gene or other genes, by intergenic DNA (i.e., intervening or spacer DNA which naturally flanks the gene and/or separates genes in the chromosomal DNA of the organism). A gene may direct synthesis of an enzyme or other protein molecule (e.g., may comprise coding sequences, for example, a contiguous open reading frame (ORF) which encodes a protein) or may itself be functional in the organism. A gene in an organism, may be clustered in an operon, as defined herein, said operon being separated from other genes and/or operons by the intergenic DNA. Individual genes contained within an operon may overlap without intergenic DNA between said individual genes. An “isolated gene”, as used herein, includes a gene which is essentially free of sequences which naturally flank the gene in the chromosomal DNA of the organism from which the gene is derived (i.e., is free of adjacent coding sequences which encode a second or distinct protein or RNA molecule, adjacent structural sequences or the like) and optionally includes 5′ and 3′ regulatory sequences, for example promoter sequences and/or terminator sequences. In one embodiment, an isolated gene includes predominantly coding sequences for a protein (e.g., sequences which encode Bacillus proteins). In another embodiment, an isolated gene includes coding sequences for a protein (e.g., for a Bacillus protein) and adjacent 5′ and/or 3′ regulatory sequences from the chromosomal DNA of the organism from which the gene is derived (e.g., adjacent 5′ and/or 3′ Bacillus regulatory sequences). Preferably, an isolated gene contains less than about 10 kb, 5 kb, 2 kb, 1 kb, 0.5 kb, 0.2 kb, 0.1 kb, 50 bp, 25 bp or 10 bp of nucleotide sequences which naturally flank the gene in the chromosomal DNA of the organism from which the gene is derived.

In one embodiment, an isolated nucleic acid molecule is or includes a coaX gene. In another embodiment, an isolated nucleic acid molecule is or includes a portion or fragment of a coaX gene. In one embodiment, an isolated coaX nucleic acid molecule is derived from a microorganism selected form the group consisting of Aquifex aeolicus, Bacillus anthracis, Bacillus halodurans, Bacillus stearothermophilus, Bacillus subtilis, Caulobacter crescentus, Chlorobium tepidum, Clostridium acetobutylicum, Dehalococcoides ethenogenes, Deinococcus radiodurans, Desulfovibrio vulgaris, Geobacter sulfurreducens, Pseudomonas putida, Rhodobacter capsulatus, Thiobacillus ferrooxidans, Streptomyces coelicolor, Synechocystis sp., Thermotoga maritima, Bordetella pertussis, Borrelia burgdorferi, Campylobacter jejuni, Clostridium difficile, Helicobacter pylori, Neisseria meningitidis, Neisseria gonorrhoeae, Porphyromonas gingivalis, Pseudomonas aeruginosa, Pseudomonas syringae pv tomato, Treponema pallidum, Xylella fastidiosa, Legionella pneumophila and Mycobacterium tuberculosis. In another embodiment, an isolated coaX nucleic acid molecule is derived from a microorganism selected from the group consisting of Bacillus anthracis, Bordetella pertussis, Borrelia burgdorferi, Campylobacter jejuni, Clostridium difficile, Helicobacter pylori, Neisseria meningitidis, Neisseria gonorrhoeae, Porphyromonas gingivalis, Pseudomonas aeruginosa, Treponema pallidum, Xylella fastidiosa and Legionella pneumophila. In another embodiment, an isolated coaX nucleic acid molecule is derived from a microorganism selected from the group consisting of Bordetella pertussis, Borrelia burgdorferi, Campylobacter jejuni, Clostridium difficile, Helicobacter pylori, Neisseria meningitidis, Pseudomonas aeruginosa, Treponema pallidum and Xylella fastidiosa. In another embodiment, an isolated coaX nucleic acid molecule or gene comprises a nucleotide sequence set forth as any one of SEQ ID NOs:SEQ ID NO:32, SEQ ID NO:69, SEQ ID NO:46, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:1, SEQ ID NO:38, SEQ ID NO:31, SEQ ID NO:36, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:23, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:28, SEQ ID NO:60, SEQ ID NO:27, SEQ ID NO:34 or SEQ ID NO:68, SEQ ID NO:25, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:42, SEQ ID NO:35 or SEQ ID NO:37, SEQ ID NO:62, SEQ ID NO:26, SEQ ID NO:24, SEQ ID NO:33, SEQ ID NO:29, SEQ ID NO:64, SEQ ID NO:30 and SEQ ID NO:66. In another embodiment, an isolated nucleic acid molecule of the present invention comprises a nucleotide sequence which is at least about 50-55%, preferably at least about 60-65%, more preferably at least about 70-75%, more preferably at least about 80-85%, and even more preferably at least about 90-95% or more identical to a nucleotide sequence set forth as any one of SEQ ID NOs:SEQ ID NO:32, SEQ ID NO:69, SEQ ID NO:46, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:1, SEQ ID NO:38, SEQ ID NO:31, SEQ ID NO:36, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:23, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:28, SEQ ID NO:60, SEQ ID NO:27, SEQ ID NO:34 or SEQ ID NO:68, SEQ ID NO:25, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:42, SEQ ID NO:35 or SEQ ID NO:37, SEQ ID NO:62, SEQ ID NO:26, SEQ ID NO:24, SEQ ID NO:33, SEQ ID NO:29, SEQ ID NO:64, SEQ ID NO:30 and SEQ ID NO:66.

In yet another embodiment, an isolated coaX nucleic acid molecule or gene comprises a nucleotide sequence that encodes a protein having an amino acid sequence as set forth in any one of SEQ ID NOs:SEQ ID NO:12, SEQ ID NO:70, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:2, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:3, SEQ ID NO:57, SEQ ID NO:8, SEQ ID NO:59, SEQ ID NO:7, SEQ ID NO:61, SEQ ID NO:6, SEQ ID NO:63, SEQ ID NO:4, SEQ ID NO:13, SEQ ID NO:9, SEQ ID NO:15, SEQ ID NO:11, SEQ ID NO:21, SEQ ID NO:55, SEQ ID NO:14 or SEQ ID NO:67, SEQ ID NO:43 or SEQ ID NO:22, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:20, SEQ ID NO:10, SEQ ID NO:65 and SEQ ID NO:5. In yet another embodiment, an isolated coaXnucleic acid molecule or gene encodes a homologue of the CoaX proteins having the amino acid sequences of SEQ ID NOs:SEQ ID NO:12, SEQ ID NO:70, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:2, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:3, SEQ ID NO:57, SEQ ID NO:8, SEQ ID NO:59, SEQ ID NO:7, SEQ ID NO:61, SEQ ID NO:6, SEQ ID NO:63, SEQ ID NO:4, SEQ ID NO:13, SEQ ID NO:9, SEQ ID NO:15, SEQ ID NO:11, SEQ ID NO:21, SEQ ID NO:55, SEQ ID NO:14 or SEQ ID NO:67, SEQ ID NO:43 or SEQ ID NO:22, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:20, SEQ ID NO:10, SEQ ID NO:65 and SEQ ID NO:5. As used herein, the term “homologue” includes a protein or polypeptide sharing at least about 30-35%, preferably at least about 35-40%, more preferably at least about 40-50%, and even more preferably at least about 60%, 70%, 80%, 90% or more identity with the amino acid sequence of a wild-type protein or polypeptide described herein and having a substantially equivalent functional or biological activity as said wild-type protein or polypeptide. For example, a CoaX homologue shares at least about 30-35%, preferably at least about 35-40%, more preferably at least about 40-50%, and even more preferably at least about 60%, 70%, 80%, 90% or more identity with any one of the proteins having the amino acid sequences set forth as SEQ ID NOs:SEQ ID NO:12, SEQ ID NO:70, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:2, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:3, SEQ ID NO:57, SEQ ID NO:8, SEQ ID NO:59, SEQ ID NO:7, SEQ ID NO:61, SEQ ID NO:6, SEQ ID NO:63, SEQ ID NO:4, SEQ ID NO:13, SEQ ID NO:9, SEQ ID NO:15, SEQ ID NO:11, SEQ ID NO:21, SEQ ID NO:55, SEQ ID NO:14 or SEQ ID NO:67, SEQ ID NO:43 or SEQ ID NO:22, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:20, SEQ ID NO:10, SEQ ID NO:65 and SEQ ID NO:5 and has a substantially equivalent functional or biological activity (i.e., is a functional equivalent) of the proteins having the amino acid sequences set forth as SEQ ID NOs:SEQ ID NO:12, SEQ ID NO:70, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:2, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:3, SEQ ID NO:57, SEQ ID NO:8, SEQ ID NO:59, SEQ ID NO:7, SEQ ID NO:61, SEQ ID NO:6, SEQ ID NO:63, SEQ ID NO:4, SEQ ID NO:13, SEQ ID NO:9, SEQ ID NO:15, SEQ ID NO:1, SEQ ID NO:21, SEQ ID NO:55, SEQ ID NO:14 or SEQ ID NO:67, SEQ ID NO:43 or SEQ ID NO:22, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:20, SEQ ID NO:10, SEQ ID NO:65 and SEQ ID NO:5 (e.g., has a substantially equivalent CoaX activity). In a preferred embodiment, an isolated coaX nucleic acid molecule or gene comprises a nucleotide sequence that encodes a polypeptide as set forth in any one of SEQ ID NOs:SEQ ID NO:12, SEQ ID NO:70, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:8, SEQ ID NO:59, SEQ ID NO:7, SEQ ID NO:61, SEQ ID NO:6, SEQ ID NO:63, SEQ ID NO:4, SEQ ID NO:13, SEQ ID NO:9, SEQ ID NO:15, SEQ ID NO:11, SEQ ID NO:21, SEQ ID NO:55, SEQ ID NO:14 or SEQ ID NO:67, SEQ ID NO:43 or SEQ ID NO:22, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:20, SEQ ID NO:10, SEQ ID NO:65 and SEQ ID NO:5.

In another embodiment, an isolated coaX nucleic acid molecule hybridizes to all or a portion of a nucleic acid molecule having the nucleotide sequence set forth in any one of SEQ ID NOs:SEQ ID NO:32, SEQ ID NO:69, SEQ ID NO:46, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:1, SEQ ID NO:38, SEQ ID NO:31, SEQ ID NO:36, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:23, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:28, SEQ ID NO:60, SEQ ID NO:27, SEQ ID NO:34 or SEQ ID NO:68, SEQ ID NO:25, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:42, SEQ ID NO:35 or SEQ ID NO:37, SEQ ID NO:62, SEQ ID NO:26, SEQ ID NO:24, SEQ ID NO:33, SEQ ID NO:29, SEQ ID NO:64, SEQ ID NO:30 and SEQ ID NO:66 or hybridizes to all or a portion of a nucleic acid molecule having a nucleotide sequence that encodes a polypeptide having the amino acid sequence of any of SEQ ID NOs:SEQ ID NO:12, SEQ ID NO:70, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:2, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:3, SEQ ID NO:57, SEQ ID NO:8, SEQ ID NO:59, SEQ ID NO:7, SEQ ID NO:61, SEQ ID NO:6, SEQ ID NO:63, SEQ ID NO:4, SEQ ID NO:13, SEQ ID NO:9, SEQ ID NO:15, SEQ ID NO:11, SEQ ID NO:21, SEQ ID NO:55, SEQ ID NO:14 or SEQ ID NO:67, SEQ ID NO:43 or SEQ ID NO:22, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:20, SEQ ID NO:10, SEQ ID NO:65 and SEQ ID NO:5. Such hybridization conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, Ausubel et al., eds., John Wiley & Sons, Inc. (1995), sections 2, 4 and 6. Additional stringent conditions can be found in Molecular Cloning: A Laboratory Manual, Sambrook et al., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989), chapters 7, 9 and 11. A preferred, non-limiting example of stringent hybridization conditions includes hybridization in 4×sodium chloride/sodium citrate (SSC), at about 65-70° C. (or hybridization in 4×SSC plus 50% formamide at about 42-50° C.) followed by one or more washes in 1×SSC, at about 65-70° C. A preferred, non-limiting example of highly stringent hybridization conditions includes hybridization in 1×SSC, at about 65-70° C. (or hybridization in 1×SSC plus 50% formamide at about 42-50° C.) followed by one or more washes in 0.3×SSC, at about 65-70° C. A preferred, non-limiting example of reduced stringency hybridization conditions includes hybridization in 4×SSC, at about 50-60° C. (or alternatively hybridization in 6×SSC plus 50% formamide at about 40-45° C.) followed by one or more washes in 2×SSC, at about 50-60° C. Ranges intermediate to the above-recited values, e.g., at 65-70° C. or at 42-50° C. are also intended to be encompassed by the present invention. SSPE (1×SSPE is 0.15 M NaCl, 10 mM NaH2PO4, and 1.25 mM EDTA, pH 7.4) can be substituted for SSC (1×SSC is 0.15 M NaCl and 15 mM sodium citrate) in the hybridization and wash buffers; washes are performed for 15 minutes each after hybridization is complete. The hybridization temperature for hybrids anticipated to be less than 50 base pairs in length should be 5-10° C. less than the melting temperature (Tm) of the hybrid, where Tm is determined according to the following equations. For hybrids less than 18 base pairs in length, Tm(° C.)=2(# of A+T bases)+4(# of G+C bases). For hybrids between 18 and 49 base pairs in length, Tm(° C.)=81.5+16.6(log10[Na+])+0.41(% G+C)−(600/N), where N is the number of bases in the hybrid, and [Na+] is the concentration of sodium ions in the hybridization buffer ([Na+] for 1×SSC=0.165 M). It will also be recognized by the skilled practitioner that additional reagents may be added to hybridization and/or wash buffers to decrease non-specific hybridization of nucleic acid molecules to membranes, for example, nitrocellulose or nylon membranes, including but not limited to blocking agents (e.g., BSA or salmon or herring sperm carrier DNA), detergents (e.g., SDS), chelating agents (e.g., EDTA), Ficoll, PVP and the like. When using nylon membranes, in particular, an additional preferred, non-limiting example of stringent hybridization conditions is hybridization in 0.25-0.5M NaH2PO4, 7% SDS at about 65° C., followed by one or more washes at 0.02M NaH2PO4, 1% SDS at 65° C., see e.g., Church and Gilbert (1984) Proc. Natl. Acad. Sci. USA 81:1991-1995, (or, alternatively, 0.2×SSC, 1% SDS). In another preferred embodiment, an isolated nucleic acid molecule comprises a nucleotide sequence that is complementary to a coaX nucleotide sequence as set forth herein (e.g., is the full complement of the nucleotide sequence set forth as SEQ ID NO:19). Preferably, an isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to the sequence of SEQ ID NO:SEQ ID NO:32, SEQ ID NO:69, SEQ ID NO:46, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:1, SEQ ID NO:38, SEQ ID NO:31, SEQ ID NO:36, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:23, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:28, SEQ ID NO:60, SEQ ID NO:27, SEQ ID NO:34 or SEQ ID NO:68, SEQ ID NO:25, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:42, SEQ ID NO:35 or SEQ ID NO:37, SEQ ID NO:62, SEQ ID NO:26, SEQ ID NO:24, SEQ ID NO:33, SEQ ID NO:29, SEQ ID NO:64, SEQ ID NO:30 and SEQ ID NO:66, or to a complement thereof, corresponds to a naturally-occurring nucleic acid molecule. As used herein, a “naturally-occurring” nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature.

A nucleic acid molecule of the present invention (e.g., a coaX nucleic acid molecule or gene), can be isolated using standard molecular biology techniques and the sequence information provided herein. For example, nucleic acid molecules can be isolated using standard hybridization and cloning techniques (e.g., as described in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989) or can be isolated by the polymerase chain reaction using synthetic oligonucleotide primers designed based upon the coaX nucleotide sequences set forth herein, or flanking sequences thereof. A nucleic acid of the invention (e.g., a coaX nucleic acid molecule or gene), can be amplified using cDNA, mRNA or alternatively, chromosomal DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. Assays for identifying coaX gene of the present invention or homologues thereof can be accomplished, for example, by expressing the coaX gene in a microorganism, for example, a microorganism which expresses pantothenate kinase in a temperature-sensitive manner, and assaying the gene for the ability to complement a temperature sensitive (Ts) mutant for pantothenate kinase activity. A coaX gene that encodes a functional pantothenate kinase is one that complements the Ts mutant.

Yet another embodiment of the present invention features mutant coaX and coaA nucleic acid molecules or genes. The phrase “mutant nucleic acid molecule” or “mutant gene” as used herein, includes a nucleic acid molecule or gene having a nucleotide sequence which includes at least one alteration (e.g., substitution, insertion, deletion) such that the polypeptide or protein that may be encoded by said mutant exhibits an activity that differs from the polypeptide or protein encoded by the wild-type nucleic acid molecule or gene. Preferably, a mutant nucleic acid molecule or mutant gene (e.g., a mutant coaA or coaX gene) encodes a polypeptide or protein having a reduced activity (e.g., having a reduced pantothenate kinase activity) as compared to the polypeptide or protein encoded by the wild-type nucleic acid molecule or gene, for example, when assayed under similar conditions (e.g., assayed in microorganisms cultured at the same temperature). A mutant gene also can encode no polypeptide or have a reduced level of production of the wild-type polypeptide.

As used herein, a “reduced activity” or “reduced enzymatic activity” is one that is at least 5% less than that of the polypeptide or protein encoded by the wild-type nucleic acid molecule or gene, preferably at least 5-10% less, more preferably at least 10-25% less and even more preferably at least 25-50%, 50-75% or 75-100% less than that of the polypeptide or protein encoded by the wild-type nucleic acid molecule or gene. Ranges intermediate to the above-recited values, e.g., 75-85%, 85-90%, 90-95%, are also intended to be encompassed by the present invention. As used herein, a “reduced activity” or “reduced enzymatic activity” also includes an activity that has been deleted or “knocked out” (e.g., approximately 100% less activity than that of the polypeptide or protein encoded by the wild-type nucleic acid molecule or gene). Activity can be determined according to any well accepted assay for measuring activity of a particular protein of interest. Activity can be measured or assayed directly, for example, measuring an activity of a protein isolated or purified from a cell. Alternatively, an activity can be measured or assayed within a cell or in an extracellular medium or in a crude extract of cells.

It will be appreciated by the skilled artisan that even a single substitution in a nucleic acid or gene sequence (e.g., a base substitution that encodes an amino acid change in the corresponding amino acid sequence) can dramatically affect the activity of an encoded polypeptide or protein as compared to the corresponding wild-type polypeptide or protein. A mutant nucleic acid or mutant gene (e.g., encoding a mutant polypeptide or protein), as defined herein, is readily distinguishable from a nucleic acid or gene encoding a protein homologue, as described above, in that a mutant nucleic acid or mutant gene encodes a protein or polypeptide having an altered activity, optionally observable as a different or distinct phenotype in a microorganism expressing said mutant gene or nucleic acid or producing said mutant protein or polypeptide (i.e., a mutant microorganism) as compared to a corresponding microorganism expressing the wild-type gene or nucleic acid or producing said mutant protein or polypeptide. By contrast, a protein homologue has an identical or substantially similar activity, optionally phenotypically indiscernable when produced in a microorganism, as compared to a corresponding microorganism expressing the wild-type gene or nucleic acid. Accordingly it is not, for example, the degree of sequence identity between nucleic acid molecules, genes, protein or polypeptides that serves to distinguish between homologues and mutants, rather it is the activity of the encoded protein or polypeptide that distinguishes between homologues and mutants: homologues having, for example, low (e.g., 30-50% sequence identity) sequence identity yet having substantially equivalent functional activities, and mutants, for example sharing 99% sequence identity yet having dramatically different or altered functional activities. Exemplary homologues are set forth as SEQ ID NOs:SEQ ID NO:12, SEQ ID NO:70, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:3, SEQ ID NO:57, SEQ ID NO:8, SEQ ID NO:59, SEQ ID NO:7, SEQ ID NO:61, SEQ ID NO:6, SEQ ID NO:63, SEQ ID NO:4, SEQ ID NO:13, SEQ ID NO:9, SEQ ID NO:15, SEQ ID NO:11, SEQ ID NO:21, SEQ ID NO:55, SEQ ID NO:14 or SEQ ID NO:67, SEQ ID NO:43 or SEQ ID NO:22, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:20, SEQ ID NO:10, SEQ ID NO:65 and SEQ ID NO:5 (i.e., CoaX homologues). Exemplary mutants are described in Examples III-IV herein.

III. CoaX Proteins

Another aspect of the present invention features isolated proteins (e.g., isolated CoaX proteins encoded, for example, by any one of the coaX genes or nucleic acids described herein). In one embodiment, the isolated proteins are produced by recombinant DNA techniques and can be isolated from microorganisms expressing, for example, any one of the coaX genes or nucleic acids described herein, by an appropriate purification scheme using standard protein purification techniques. In another embodiment, proteins are synthesized chemically using standard peptide synthesis techniques.

An “isolated” or “purified” protein (e.g., an isolated or purified CoaX enzyme) is substantially free of cellular material or other contaminating proteins from the microorganism from which the protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized. In one embodiment, an isolated or purified protein has less than about 30% (by dry weight) of contaminating protein or chemicals, more preferably less than about 20% of contaminating protein or chemicals, still more preferably less than about 10% of contaminating protein or chemicals, and most preferably less than about 5% contaminating protein or chemicals.

A “partially purified” protein (e.g., a partially purified CoaX enzyme) is a compostion comprising a protein of interest where the composition has been subjected to at least one purification step, separation step, concentration step, or the like, such that the protein of interest is present at a greater concentration or level than prior to the purification step, separation step, concentration step, or the like. In one embodiment, a partially purified protein has between about 50-65% (by dry weight) of contaminating protein or chemicals, preferably between about 40%-50% of contaminating protein or chemicals, more preferably between about 30-40% of contaminating protein or chemicals.

Included within the scope of the present invention are CoaX proteins encoded by naturally-occurring bacterial or microbial genes, for example, by coaX genes derived from a microorganism selected from the group consisting of Aquifex aeolicus, Bacillus anthracis, Bacillus halodurans, Bacillus stearothermophilus, Bacillus subtilis, Caulobacter crescentus, Chlorobium tepidum, Clostridium acetobutylicum, Dehalococcoides ethenogenes, Deinococcus radiodurans, Desulfovibrio vulgaris, Geobacter sulfurreducens, Pseudomonas putida, Rhodobacter capsulatus, Thiobacillus ferrooxidans, Streptomyces coelicolor, Synechocystis sp., Thermotoga maritima, Bordetella pertussis, Borrelia burgdorferi, Campylobacter jejuni, Clostridium difficile, Helicobacter pylori, Neisseria meningitidis, Neisseria gonorrhoeae, Porphyromonas gingivalis, Pseudomonas aeruginosa, Treponema pallidum, Xylella fastidiosa and Mycobacterium tuberculosis. Further included within the scope of the present invention are CoaX proteins that are encoded bacterial or microbial genes which differ from naturally-occurring bacterial or microbial genes described herein, for example, genes which have nucleic acids that are mutated, inserted or deleted, but which encode proteins substantially similar to the naturally-occurring gene products of the present invention. For example, it is well understood that one of skill in the art can mutate (e.g., substitute) nucleic acids which, due to the degeneracy of the genetic code, encode for an identical amino acid as that encoded by the naturally-occurring gene. Moreover, it is well understood that one of skill in the art can mutate (e.g., substitute) nucleic acids which encode for conservative amino acid substitutions. It is further well understood that one of skill in the art can substitute, add or delete amino acids to a certain degree without substantially affecting the function of a gene product as compared with a naturally-occurring gene product, each instance of which is intended to be included within the scope of the present invention.

In one embodiment, an isolated protein of the present invention is encoded by a coaX gene derived from a microorganism selected from the group consisting of Aquifex aeolicus, Bacillus anthracis, Bacillus halodurans, Bacillus stearothermophilus, Bacillus subtilis, Caulobacter crescentus, Chlorobium tepidum, Clostridium acetobutylicum, Dehalococcoides ethenogenes, Deinococcus radiodurans, Desulfovibrio vulgaris, Geobacter sulfurreducens, Pseudomonas putida, Rhodobacter capsulatus, Thiobacillus ferrooxidans, Streptomyces coelicolor, Synechocystis sp., Thermotoga maritima, Bordetella pertussis, Borrelia burgdorferi, Campylobacter jejuni, Clostridium difficile, Helicobacter pylori, Neisseria meningitidis, Neisseria gonorrhoeae, Porphyromonas gingivalis, Pseudomonas aeruginosa, Treponema pallidum, Xylella fastidiosa and Mycobacterium tuberculosis. In another embodiment, an isolated protein of the present invention is encoded by a coaX gene derived from a microorganism selected from the group consisting of Bacillus anthracis, Bordetella pertussis, Borrelia burgdorferi, Campylobacter jejuni, Clostridium difficile, Helicobacter pylori, Neisseria meningitidis, Neisseria gonorrhoeae, Porphyromonas gingivalis, Pseudomonas aeruginosa, Legionella pneumophila, Treponema pallidum and Xylella fastidiosa (e.g., is encoded by a coaX gene derived from a pathogenic bacteria). In yet another embodiment, an isolated protein of the present invention is encoded by a coaX gene derived from a microorganism selected from the group consisting of Bordetella pertussis, Borrelia burgdorferi, Campylobacter jejuni, Clostridium difficile, Helicobacter pylori, Neisseria meningitidis, Pseudomonas aeruginosa, Treponema pallidum and Xylella fastidiosa (e.g., is encoded by a coaX gene derived from a pathogenic bacteria which has coaX as it's sole pantothenate kinase encoding enzyme). In a preferred embodiment, an isolated protein of the present invention (e.g., a CoaX) has an amino acid sequence as set forth in any one of SEQ ID NOs:SEQ ID NO:12, SEQ ID NO:70, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:2, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:3, SEQ ID NO:57, SEQ ID NO:8, SEQ ID NO:59, SEQ ID NO:7, SEQ ID NO:61, SEQ ID NO:6, SEQ ID NO:63, SEQ ID NO:4, SEQ ID NO:13, SEQ ID NO:9, SEQ ID NO:15, SEQ ID NO:11, SEQ ID NO:21, SEQ ID NO:55, SEQ ID NO:14 or SEQ ID NO:67, SEQ ID NO:43 or SEQ ID NO:22, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:20, SEQ ID NO:10, SEQ ID NO:65 and SEQ ID NO:5. In other embodiments, an isolated protein of the present invention (e.g., a CoaX) is a homologue of the at least one of the proteins set forth as SEQ ID NOs:SEQ ID NO:12, SEQ ID NO:70, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:2, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:3, SEQ ID NO:57, SEQ ID NO:8, SEQ ID NO:59, SEQ ID NO:7, SEQ ID NO:61, SEQ ID NO:6, SEQ ID NO:63, SEQ ID NO:4, SEQ ID NO:13, SEQ ID NO:9, SEQ ID NO:15, SEQ ID NO:11, SEQ ID NO:21, SEQ ID NO:55, SEQ ID NO:14 or SEQ ID NO:67, SEQ ID NO:43 or SEQ ID NO:22, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:20, SEQ ID NO:10, SEQ ID NO:65 and SEQ ID NO:5 (e.g., comprises an amino acid sequence at least about 30-40% identical, preferably about 40-50% identical, more preferably about 50-60% identical, and even more preferably about 60-70%, 70-80%, 80-90%, 90-95% or more identical to the amino acid sequence of SEQ ID NOs:SEQ ID NO:12, SEQ ID NO:70, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:2, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:3, SEQ ID NO:57, SEQ ID NO:8, SEQ ID NO:59, SEQ ID NO:7, SEQ ID NO:61, SEQ ID NO:6, SEQ ID NO:63, SEQ ID NO:4, SEQ ID NO:13, SEQ ID NO:9, SEQ ID NO:15, SEQ ID NO:11, SEQ ID NO:21, SEQ ID NO:55, SEQ ID NO:14 or SEQ ID NO:67, SEQ ID NO:43 or SEQ ID NO:22, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:20, SEQ ID NO:10, SEQ ID NO:65 and SEQ ID NO:5, and has an activity that is substantially similar to that of the protein encoded by the amino acid sequence of SEQ ID NOs:SEQ ID NO:12, SEQ ID NO:70, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:2, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:3, SEQ ID NO:57, SEQ ID NO:8, SEQ ID NO:59, SEQ ID NO:7, SEQ ID NO:61, SEQ ID NO:6, SEQ ID NO:63, SEQ ID NO:4, SEQ ID NO:13, SEQ ID NO:9, SEQ ID NO:15, SEQ ID NO:11, SEQ ID NO:21, SEQ ID NO:55, SEQ ID NO:14 or SEQ ID NO:67, SEQ ID NO:43 or SEQ ID NO:22, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:20, SEQ ID NO:10, SEQ ID NO:65 and SEQ ID NO:5, respectively.

To determine the percent homology of two amino acid sequences or of two nucleic acids, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence). When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity=# of identical positions/total # of positions×100), preferably taking into account the number of gaps and size of said gaps necessary to produce an optimal alignment.

The comparison of sequences and determination of percent homology between two sequences can be accomplished using a mathematical algorithm. A preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) of Altschul et al. (1990) J. Mol. Biol. 215:403-10. BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997) Nucleic Acids Research 25(17): 3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See http://www.ncbi.nlm.nih.gov. Another preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller (1988) Comput Appl Biosci. 4:11-17. Such an algorithm is incorporated into the ALIGN program available, for example, at the GENESTREAM network server, IGH Montpellier, FRANCE (http://vega.igh.cnrs.fr) or at the ISREC server (http://www.ch.embnet.org). When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

In another preferred embodiment, the percent homology between two amino acid sequences can be determined using the GAP program in the GCG software package (available at http://www.gcg.com), using either a Blossom 62 matrix or a PAM250 matrix, and a gap weight of 12, 10, 8, 6, or 4 and a length weight of 2, 3, or 4. In yet another preferred embodiment, the percent homology between two nucleic acid sequences can be accomplished using the GAP program in the GCG software package (available at http://www.gcg.com), using a gap weight of 50 and a length weight of 3.

VI. Recombinant Nucleic Acid Molecules, Vectors and Microorganisms

The present invention further features recombinant nucleic acid molecules (e.g., recombinant DNA molecules) that include nucleic acid molecules and/or genes described herein (e.g., isolated nucleic acid molecules and/or genes), preferably pantothenate kinase-encoding genes (e.g. coaX genes). The present invention further features vectors (e.g., recombinant vectors) that include nucleic acid molecules (e.g., isolated or recombinant nucleic acid molecules and/or genes) described herein. In particular, recombinant vectors are featured that include nucleic acid sequences that encode bacterial gene products as described herein, preferably bacterial nucleic acid sequences that encode bacterial pantothenate kinase proteins.

The term “recombinant nucleic acid molecule” includes a nucleic acid molecule (e.g., a DNA molecule) that has been altered, modified or engineered such that it differs in nucleotide sequence from the native or natural nucleic acid molecule from which the recombinant nucleic acid molecule was derived (e.g., by addition, deletion or substitution of one or more nucleotides). Preferably, a recombinant nucleic acid molecule (e.g., a recombinant DNA molecule) includes an isolated nucleic acid molecule or gene of the present invention (e.g., an isolated coaX gene) operably linked to regulatory sequences.

The term “recombinant vector” includes a vector (e.g., plasmid, phage, phasmid, virus, cosmid or other purified nucleic acid vector) that has been altered, modified or engineered such that it contains greater, fewer or different nucleic acid sequences than those included in the native or natural nucleic acid molecule from which the recombinant vector was derived. Preferably, the recombinant vector includes a coaX gene or recombinant nucleic acid molecule including such coaX gene, operably linked to regulatory sequences, for example, promoter sequences, terminator sequences and/or artificial ribosome binding sites (RBSs), as defined herein.

The phrase “operably linked to regulatory sequence(s)” means that the nucleotide sequence of the nucleic acid molecule or gene of interest is linked to the regulatory sequence(s) in a manner which allows for expression (e.g., enhanced, increased, constitutive, basal, attenuated, decreased or repressed expression) of the nucleotide sequence, preferably expression of a gene product encoded by the nucleotide sequence (e.g., when the recombinant nucleic acid molecule is included in a recombinant vector, as defined herein, and is introduced into a microorganism).

The term “regulatory sequence” includes nucleic acid sequences which affect (e.g., modulate or regulate) expression of other nucleic acid sequences. In one embodiment, a regulatory sequence is included in a recombinant nucleic acid molecule or recombinant vector in a similar or identical position and/or orientation relative to a particular gene of interest as is observed for the regulatory sequence and gene of interest as it appears in nature, e.g., in a native position and/or orientation. For example, a gene of interest can be included in a recombinant nucleic acid molecule or recombinant vector operably linked to a regulatory sequence which accompanies or is adjacent to the gene of interest in the natural organism (e.g., operably linked to “native” regulatory sequences, for example, to the “native” promoter). Alternatively, a gene of interest can be included in a recombinant nucleic acid molecule or recombinant vector operably linked to a regulatory sequence which accompanies or is adjacent to another (e.g., a different) gene in the natural organism. Alternatively, a gene of interest can be included in a recombinant nucleic acid molecule or recombinant vector operably linked to a regulatory sequence from another organism. For example, regulatory sequences from other microbes (e.g., other bacterial regulatory sequences, bacteriophage regulatory sequences and the like) can be operably linked to a particular gene of interest.

In one embodiment, a regulatory sequence is a non-native or non-naturally-occurring sequence (e.g., a sequence which has been modified, mutated, substituted, derivatized, deleted including sequences which are chemically synthesized). Preferred regulatory sequences include promoters, enhancers, termination signals, anti-termination signals and other expression control elements (e.g., sequences to which repressors or inducers bind and/or binding sites for transcriptional and/or translational regulatory proteins, for example, in the transcribed mRNA). Such regulatory sequences are described, for example, in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in a microorganism (e.g., constitutive promoters and strong constitutive promoters), those which direct inducible expression of a nucleotide sequence in a microorganism (e.g., inducible promoters, for example, xylose inducible promoters) and those which attenuate or repress expression of a nucleotide sequence in a microorganism (e.g., attenuation signals or repressor sequences). It is also within the scope of the present invention to regulate expression of a gene of interest by removing or deleting regulatory sequences. For example, sequences involved in the negative regulation of transcription can be removed such that expression of a gene of interest is enhanced.

In one embodiment, a recombinant nucleic acid molecule or recombinant vector of the present invention includes a nucleic acid sequence or gene that encodes at least one bacterial gene product (e.g., a gene product encoded by coaX) operably linked to a promoter or promoter sequence. Preferred promoters of the present invention include E. coli promoters or Bacillus promoters and/or bacteriophage promoters (e.g., bacteriophage which infect E. coli or Bacillus). In one embodiment, a promoter is a Bacillus promoter, preferably a strong Bacillus promoter (e.g., a promoter associated with a biochemical housekeeping gene in Bacillus or a promoter associated with a glycolytic pathway gene in Bacillus). In another embodiment, a promoter is a bacteriophage promoter. In a preferred embodiment, the promoter is from the bacteriophage SP01. In a particularly preferred embodiment, a promoter is the P26 promoter set forth as SEQ ID NO:18 or the P15 promoter set forth as SEQ ID NO:19. Additional preferred promoters include tef (the translational elongation factor (TEF) promoter) and pyc (the pyruvate carboxylase (PYC) promoter), which promote high level expression in Bacillus (e.g., Bacillus subtilis). Additional preferred promoters, for example, for use in Gram positive microorganisms include, but are not limited to, the amyE promoter or phage SP02 promoters. Additional preferred promoters, for example, for use in Gram negative microorganisms include, but are not limited to tac, trp, tet, trp-tet, lpp, lac, lpp-lac, laciq, T7, T5, T3, gal, trc, ara, SP6, Îť-PR or Îť-PL.

In another embodiment, a recombinant nucleic acid molecule or recombinant vector of the present invention includes a terminator sequence or terminator sequences (e.g., transcription terminator sequences). The term “terminator sequences” includes regulatory sequences which serve to terminate transcription of a gene. Terminator sequences (or tandem transcription terminators) can further serve to stabilize mRNA (e.g., by adding structure to mRNA), for example, against nucleases.

In yet another embodiment, a recombinant nucleic acid molecule or recombinant vector of the present invention includes sequences which allow for detection of the vector containing said sequences (i.e., detectable and/or selectable markers), for example, sequences that overcome auxotrophic mutations, for example, trpC or leuB, etc., fluorescent markers, and/or colorimetric markers (e.g., lacZ/β-galactosidase), and/or antibiotic resistance genes (e.g., amp or tet).

In yet another embodiment, a recombinant nucleic acid molecule or recombinant vector of the present invention includes an artificial ribosome binding site (RBS). The term “artificial ribosome binding site (RBS)” includes a site within an mRNA molecule (e.g., coded within DNA) to which a ribosome binds (e.g., to initiate translation) which differs from a native RBS (e.g., a RBS found in a naturally-occurring gene) by at least one nucleotide. Preferred artificial RBSs include about 5-6, 7-8, 9-10, 11-12, 13-14, 15-16, 17-18, 19-20, 21-22, 23-24, 25-26, 27-28, 29-30 or more nucleotides of which about 1-2, 3-4, 5-6, 7-8, 9-10, 11-12, 13-15 or more differ from the native RBS (e.g., the native RBS of a gene of interest). Preferably, nucleotides which differ are substituted such that they are identical to one or more nucleotides of an ideal RBS for a particular gene. Artificial RBSs can be used to replace the naturally-occurring or native RBS associated with a particular gene. Artificial RBSs preferably increase translation of a particular gene.

In another embodiment, a recombinant vector of the present invention includes sequences that enhance replication in bacteria (e.g., replication-enhancing sequences). In one embodiment, replication-enhancing sequences are derived from E. coli. In another embodiment, replication-enhancing sequences are derived from pBR322.

In yet another embodiment, a recombinant vector of the present invention includes antibiotic resistance genes. The term “antibiotic resistance genes” includes sequences which promote or confer resistance to antibiotics on the host organism. In one embodiment, the antibiotic resistance genes are selected from the group consisting of cat (chloramphenicol resistance) genes, tet (tetracycline resistance) genes, amp (ampicillin resistence), erm (erythromycin resistance) genes, neo (neomycin resistance) genes and spec (spectinomycin resistance) genes. Recombinant vectors of the present invention can further include homologous recombination sequences (e.g., sequences designed to allow recombination of the gene of interest into the chromosome of the host organism). For example, amyE sequences can be used as homology targets for recombination into the host chromosome.

Preferred vectors of the present invention include, but are not limited to, vectors set forth in FIGS. 8-10. It will further be appreciated by one of skill in the art that the design of a vector can be tailored depending on such factors as the choice of microorganism to be genetically engineered, the level of expression of gene product desired and the like.

The methodologies of the present invention feature microorganisms, e.g., recombinant microorganisms, preferably including genes or vectors as described herein, in particular, pantothenate kinase encoding genes or vectos. The term “recombinant” microorganism includes a microorganism (e.g., bacteria, yeast cell, fungal cell, etc.) which has been genetically altered, modified or engineered (e.g., genetically engineered) such that it exhibits an altered, modified or different genotype and/or phenotype (e.g., when the genetic modification affects coding nucleic acid sequences of the microorganism) as compared to the naturally-occurring microorganism from which it was derived. Preferably, a “recombinant” microorganism of the present invention has been genetically engineered such that it overexpresses at least one bacterial gene or gene product (e.g., a pantothenate kinase encoding gene) as described herein, preferably a pantothenate kinase encoding-gene included within a recombinant vector as described herein. The ordinary skilled will appreciate that a microorganism expressing or overexpressing a gene product produces or overproduces the gene product as a result of expression or overexpression of nucleic acid sequences and/or genes encoding the gene product.

The term “overexpressed” or “overexpression” includes expression of a gene product (e.g., a pantothenate kinase) at a level greater than that expressed prior to manipulation of a microorganism or in a comparable microorganism that has not been manipulated. In one embodiment, a microorganism is genetically manipulated (e.g., genetically engineered) to overexpress a level of gene product greater than that expressed prior to manipulation of the microorganism or in a comparable microorganism which has not been manipulated. Genetic manipulation can include, but is not limited to, altering or modifying regulatory sequences or sites associated with expression of a particular gene (e.g., by adding strong promoters, inducible promoters or multiple promoters or by removing regulatory sequences such that expression is constitutive), modifying the chromosomal location of a particular gene, altering nucleic acid sequences adjacent to a particular gene such as a ribosome binding site or transcription terminator, increasing the copy number of a particular gene, modifying proteins (e.g., regulatory proteins, suppressors, enhancers, transcriptional activators and the like) involved in transcription of a particular gene and/or translation of a particular gene product, or any other conventional means of deregulating expression of a particular gene routine in the art (including but not limited to use of antisense nucleic acid molecules, for example, to block expression of repressor proteins).

In another embodiment, the microorganism can be physically or environmentally manipulated to overexpress a level of gene product greater than that expressed prior to manipulation of the microorganism or in a comparable microorganism which has not been manipulated. For example, a microorganism can be treated with or cultured in the presence of an agent known or suspected to increase transcription of a particular gene and/or translation of a particular gene product such that transcription and/or translation are enhanced or increased. Alternatively, a microorganism can be cultured at a temperature selected to increase transcription of a particular gene and/or translation of a particular gene product such that transcription and/or translation are enhanced or increased.

Still other preferred recombinant microorganisms of the present invention are mutant microorganisms. As used herein, the term “mutant microorganism” includes a recombinant microorganism that has been genetically engineered to express a mutated gene or protein that is normally or naturally expressed by the microorganism. Preferably, a mutant microorganism expresses a mutated gene or protein such that the microorganism exhibits an altered, modified or different phenotype (e.g., has been engineered to express a mutated CoaA biosynthetic enzyme, for example, pantothenate kinase). In one embodiment, a mutant microorganism is designed or engineered such that it includes a mutant coaX gene, as defined herein. In another embodiment, a recombinant microorganism is designed or engineered such that it includes a mutant coaA gene, as defined herein. In another embodiment, a mutant microorganism is designed or engineered such that a coaX gene has been deleted (i.e., the protein encoded by the coaX gene is not produced). In another embodiment, a mutant microorganism is designed or engineered such that a coaA gene has been deleted (i.e., the protein encoded by the coaA gene is not produced). Preferably, a mutant microorganism has a mutant coaX gene or a mutant coaA gene, or has been engineered to have a coaX gene and/or coaA deleted, such that that the mutant microorganism encodes a “reduced pantothenate kinase activity”. In the context of a whole microorganism, pantothenate kinase activity can be determined by measuring or assaying for a decrease in an intermediate or product of the CoA biosynthetic pathway, for example, measuring or assaying for 4′-phosphopantothenate, 4′-phosphopantothenylcysteine, 4′-phosphopantetheine, dephosphocoenzyme A, Coenzyme A, apo-acyl carrier protein (apo-ACP) or holo-acyl carrier protein (ACP) in the microorganism (e.g., in a lysate isolated or derived from the microorganism) or in the medium in which the microorganism is cultured. Alternatively, pantothenate kinase or CoaX activity can be determined by measuring or assaying for increased or decreased growth of the microorganism. Alternatively, pantothenate kinase activity can be determined indirectly by measuring or assaying for an increase in pantothenate which is the immediate precursor of pantothenate kinase.

In one embodiment, a recombinant microorganism of the present invention is a Gram negative organism (e.g., a microorganism which excludes basic dye, for example, crystal violet, due to the presence of a Gram-negative wall surrounding the microorganism). In another embodiment, a recombinant microorganism of the present invention is a Gram positive organism (e.g., a microorganism which retains basic dye, for example, crystal violet, due to the presence of a Gram-positive wall surrounding the microorganism). In a preferred embodiment, the recombinant microorganism is a microorganism belonging to a genus selected from the group consisting of Escherichia, Heliobacter, Pseudomonas, Bordetella and Bacillus. In a more preferred embodiment, the recombinant microorganism is of the genus Escherichia or Bacillus.

In another embodiment, the recombinant microorganism is a Gram negative (excludes basic dye) organism. In a preferred embodiment, the recombinant microorganism is a microorganism belonging to a genus selected from the group consisting of Salmonella, Escherichia, Klebsiella, Serratia, and Proteus. In a more preferred embodiment, the recombinant microorganism is of the genus Escherichia. In an even more preferred embodiment, the recombinant microorganism is Escherichia coli. In another embodiment, the recombinant microorganism is Saccharomyces (e.g., S. cerevisiae).

V. Screening Assays

Because CoaX is an essential factor in bacteria, proteins (e.g., enzymes) involved in the biosynthesis of CoA provide valuable tools in the search for novel antibiotics. In particular, the CoaX protein is a valuable target for identifying bacteriocidal compounds because it bears no resemblance in primary sequence to mammalian pantothenate kinase enzymes or CoaA's that are essential for beneficial enteric bacteria such as E. coli. Accordingly, the present invention also provides a method (also referred to herein as a “screening assay”) for identifying modulators, i.e., candidate or test compounds or agents (e.g., peptides, peptidomimetics, small molecules or other drugs) that bind to CoaX, or have a stimulatory or inhibitory effect on, for example, coaX expression or CoaX activity.

In one embodiment, the invention provides assays for screening candidate or test compounds that are capable of binding to CoaX proteins or a biologically active portion thereof. In another embodiment, the invention provides assays for screening candidate or test compounds that modulate the activity of CoaX proteins or biologically active portions thereof. As used herein, the phrase “CoaX” activity includes any detectable or measurable activity of the CoaX protein, i.e., the protein encoded by the coaX gene of the present invention, for example, the coaX gene derived from a microorganism selected from the group consisting of Aquifex aeolicus, Bacillus anthracis, Bacillus halodurans, Bacillus stearothermophilus, Bacillus subtilis, Caulobacter crescentus, Chlorobium tepidum, Clostridium acetobutylicum, Dehalococcoides ethenogenes, Deinococcus radiodurans, Desulfovibrio vulgaris, Geobacter sulfurreducens, Pseudomonas putida, Rhodobacter capsulatus, Thiobacillus ferrooxidans, Streptomyces coelicolor, Synechocystis sp., Thermotoga maritima, Bordetella pertussis, Borrelia burgdorferi, Campylobacter jejuni, Clostridium difficile, Helicobacter pylori, Neisseria meningitidis, Neisseria gonorrhoeae, Porphyromonas gingivalis, Pseudomonas aeruginosa, Treponema pallidum, Xylella fastidiosa, Legionella pneumophila, and Mycobacterium tuberculosis. In a preferred embodiment, a CoaX activity is at least one of the following: (1) modulation of at least one step in the CoA biosynthetic pathway; (2) promotion of CoA biosynthesis; (3) phosphorylation of a CoaX substrate; (4) a pantothenate kinase activity; and (4) complementation of a CoaX mutant.

The test compounds of the present invention can be obtained using any of the numerous approaches in chemical compound library methods known in the art, including: natural compound libraries; biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the ‘one-bead one-compound’ library method; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, K. S. (1997) Anticancer Drug Des. 12:145).

Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al. (1993) Proc. Natl. Acad. Sci. U.S.A. 90:6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91:11422; Zuckermann et al. (1994). J. Med. Chem. 37:2678; Cho et al. (1993) Science 261:1303; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061; and in Gallop et al. (1994) J Med Chem. 37:1233. Libraries of compounds may be presented in solution (e.g., Houghten (1992) Biotechniques 13:412-421), or on beads (Lam (1991) Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556), bacteria (Ladner U.S. Pat. No. 5,223,409), spores (Ladner U.S. Pat. No. '409), plasmids (Cull et al. (1992) Proc Natl Acad Sci USA 89:1865-1869) or on phage (Scott and Smith (1990) Science 249:386-390); (Devlin (1990) Science 249:404-406); (Cwirla et al. (1990) Proc. Natl. Acad. Sci. 87:6378-6382); (Felici (1991) J. Mol. Biol. 222:301-310); (Ladner supra.).

In one embodiment, an assay is a microorganism-based assay in which a recombinant microorganism that expresses a CoaX protein or biologically active portion thereof is contacted with a test compound and the ability of the test compound to modulate CoaX activity is determined. Determining the ability of the test compound to modulate CoaX activity can be accomplished by monitoring, for example, growth, intracellular phosphopanthoate or CoA concentrations, or secreted pantothenate concentrations (as compounds that inhibit CoaX will result in a buildup of pantothenate in the test microorganism). CoaX substrate can be labeled with a radioisotope or enzymatic label such that modulation of CoaX activity can be determined by detecting a conversion of labeled substrate to intermediate or product. For example, CoaX substrates can be labeled with 32p, 14C, or 3H, either directly or indirectly, and the radioisotope detected by direct counting of radioemmission or by scintillation counting. Determining the ability of a compound to modulate CoaX activity can alternatively be determined by detecting the induction of a reporter gene (comprising a CoA-responsive regulatory element operatively linked to a nucleic acid encoding a detectable marker, e.g., luciferase), or detecting a CoA-regulated cellular response.

In yet another embodiment, a screening assay of the present invention is a cell-free assay in which a CoaX protein or biologically active portion thereof is contacted with a test compound in vitro and the ability of the test compound to bind to or modulate the activity of the CoaX protein or biologically active portion thereof is determined. In a preferred embodiment, the assay includes contacting the CoaX protein or biologically active portion thereof with known substrates to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability of the test compound to modulate enzymatic activity of the CoaX on its substrates.

Screening assays can be accomplished in any vessel suitable for containing the microorganisms, proteins, and/or reactants. Examples of such vessels include microtiter plates, test tubes, and micro-centrifuge tubes. In more than one embodiment of the above assay methods of the present invention, it may be desirable to immobilize either CoaX protein, CoaX substrate, substrate analogs or a recombinant microorganism expressing CoaX protein to facilitate separation of products, ligands, and/or substrates, as well as to accommodate automation of the assay. For example, glutathione-S-transferase/CoaX fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates. Other techniques for immobilizing proteins on matrices (e.g., biotin-conjugation and streptavidin immobilization or antibody conjugation) can also be used in the screening assays of the invention.

This invention further pertains to novel agents identified by the above-described screening assays. Accordingly, it is within the scope of this invention to further use an agent identified as described herein in an appropriate animal model. For example, a CoaX modulating agent identified as described herein (e.g., an anti-bactericidal compound) can be used in an infectious animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent.

CoaX modulators can further be designed based on the crystal structure of any one of the CoaX proteins of the present invention. In particular, based at least in part on the discovery of CoaX as an essential bacterial protein, one can produce significant quantities of the CoaX protein, for example using the recombinant methodologies as described herein, purify and crystallize said protein, subject said protein to Xray crystallographic procedures and, based on the determined crystal structure, design modulators (e.g., active site modulators, for example, competitor molecules, active site inhibitors, and the like), and test said designed modulators according to any one of the assays described herein.

This invention is further illustrated by the following examples which should not be construed as limiting. The contents of all references, patents and published patent applications cited throughout this application are incorporated herein by reference.

EXAMPLES Example I Assays for CoaX Genes or Activities

Assay for Pantothenate Kinase Genes or in Vivo Pantothenate Kinase Activity

In order to assay for genes encoding pantothenate kinase, the ability of plasmids containing these genes to complement the coaA15 (Ts15) mutation in E. coli strain YH1 is tested at the non-permissive temperature of 43°-44° C. The defect in E. coli coaA15(Ts) has been identified as an S177L mutation that lies in a region that is highly conserved among bacterial pantothenate kinases, including CoaA of B. subtilis. Strain YH1 was constructed by P1 transduction from publically available strain DV62 (Coli Genetic Stock Center) to publically available strain YMC9 (ATCC), selecting for tetracycline resistance and screening for temperature sensitivity at 43° C.

In Vitro Assay for Pantothenate Kinase Activity

The assay for pantothenate kinase is based on the fact that under appropriate mildly acidic conditions (1% acetic acid in 95% ethanol), the product of the reaction, 4′-phosphopantothenate, binds to positively charged ion exchange paper, while the substrate, pantothenate, does not (see Vallari, D., Jackowski, S., and Rock, C., (1987), Journal of Biological Chemistry, Vol. 262, pp2468-2471, hereby incorporated by reference).

Cells of the strain to be assayed (bacteria, yeast, fungi, animal, or plant cells) are grown to late logarithmic phase or stationary phase, in 200 ml of an appropriate medium, for example Luria Broth or M9 minimal salts plus 0.5% glucose plus any necessary additives (for bacterial cells), at an appropriate temperature (25 to 44° C.). All subsequent steps are carried out at 0 to 40° C. The culture is cooled on ice for 10 minutes and the cells are concentrated by centrifugation at 7,000×g for 10 minutes. The cell pellet is rinsed by resuspending it in ice cold Buffer A (50 mM Tris-HCl, pH 7.4, 2.5 mM MgCl2) and recentrifugation.

The rinsed cells are resuspended in the minimum possible volume (2-5 ml, depending on the size of the pellet) of Buffer A. The cells are then broken open by sonication in an inverted stainless steel test tube cap on ice for four bursts of 15 seconds each with 30 seconds of cooling between each burst. Cell debris is then removed from the lysed cells by centrifugation at 10,000×g for 10 minutes. The supernatant solution is then dialyzed for 12-16 hrs against two changes of one liter of Buffer A with 0.1 mM dithiothreitol added. Dialysis may be necessary to prevent the reaction product from undergoing further reactions catalyzed by the crude cell extract. Protein concentration in the dialyzed extracts is measured with a BCA Protein Assay Kit from BioRad.

The assay mix contains (final amounts or concentrations) about zero to 150 Οg protein, 80 ΟM 14C-D-pantothenate, specific activity about 60,000 dpm/nmole (purchased from American Radiolabeled Chemicals, Inc.), 2.5 mM ATP (Sigma Chemical Company, sodium salt), 2.5 mM MgCl2, and 100 mM Tris HCl, pH 7.4, in a total volume of 40 Οl. The reaction mix, minus the ATP, can be preincubated for about 1 to 10 minutes at an appropriate temperature (25 to 55° C.), in which case the reaction is started by addition of the ATP from a concentrated stock, also preincubated at the assay temperature.

After incubation for 1 to 10 minutes, the reaction is stopped by pipetting 35 Îźl of the reaction mix into an Eppendorf tube containing 1 ml of 95% ethanol, 1% acetic acid. After thorough mixing, the precipitated protein is pelleted in a microcentrifuge at top speed for one minute. The resulting supernatant solution is then applied to a one inch (or other appropriate size) disk of Whatman DE81 ion exchange filter paper prewetted with distilled water in a vacuum filtration manifold (for example Millipore 1225 Sampling Manifold). Each disk is then rinsed three times with 10 ml of 1% acetic acid in 95% ethanol. The top plate is then removed from the manifold and the completely exposed filter disks are each rinsed once more with 5 ml of the same rinse solution. The rinsed filters are then counted in a scintillation counter appropriatly set for 14C in 10 ml of Ecolume scintillation fluid. The specific activity of the pantothenate kinase can be calculated by determining the number of moles of substrate converted to product per mg protein per minute under various appropriate conditions of the assay.

Appropriate assay blanks include, but are not limited to, the standard mix except without ATP or without protein extract, or a complete mix incubated on ice for the shortest possible time before pipetting to the filter disk (preferably less than 10 seconds).

The assay should be checked for linearity with time up to 10 minutes, and for linearity with protein between zero and 150 Îźg. No more than 10% of the input 14C-pantothenate should be converted to phosphorylated product for the most accurate measurment of activity.

Temperature sensitivity of the pantothenate kinase enzyme can be tested by preincubating the reaction mix at various temperatures (25 to 55° C.) for various lengths of time (zero to 60 minutes) before addition of ATP to start the reaction.

For pantothenate kinases other than that encoded by the E. coli coaA gene, the optimum temperature, pH, MgCl2 concentration, buffering ion, ATP (or other substrate containing a high energy phosphate donor) concentration, salt type and concentration, total ionic strength, etc., may need to be determined. For accurate determination of enzyme activity, it may be necessary to purify or partially purify the pantothenate kinase enzyme from crude extracts, for example by ammonium sulfate fractionation and/or by column chromatography.

The assay may be adapted for high throughput screening, for example by using Îł-thio-ATP instead of ATP and then reacting the transfered thio group with a conveniently detectable signalling molecule (see Jeong, S., and Nikiforov, T., (1999), Biotechniques Vol. 27, pp 1232-1238; and Facemyer, K., and Cremo, C., (1992), Bioconjug. Chem. Vol. 3, pp 408-413, both of which are hereby incorporated by reference).

Example II Identification and Characterization of a First B. subtilis Gene Encoding Pantothenate Kinase, the coaA Gene

The annotated version of the B. subtilis genome sequence available on the “Subtilist” web site contained no gene labeled as coaA. However a homology search using the protein sequence of E. coli pantothenate kinase as a query sequence gave a good match with B. subtilis gene yqjS, which is annotated as “unknown; similar to pantothenate kinase.” This gene appears to be the penultimate gene in an operon containing five open reading frames (FIG. 2). Two of the open reading frames encode proteins which are similar to D-serine dehydratase and to “ketoacyl reductase”; the other two have no known homologies. For the open reading frame corresponding to coaA, there are three possible start codons; each having a possible ribosome-binding site (RBS) associated with it. The three potential coaA ORFs were named coaA1, coaA2, and coaA3, from longest to shortest.

All three potential coaA open reading frames were cloned along with their respective RBSs by PCR followed by ligation into expression plasmid pAN229 to form plasmids pAN281, pAN282 and pAN283. pAN229 is a low copy vector in E. coli that provides expression from the SP01 phage P15 promoter and can integrate by single crossover at bpr with tetracycline selection.

To determine if the cloned putative coaA ORFs actually encode a pantothenate kinase activity, several isolates of all three plasmids were transformed into the E. coli strain YH1, that contains the coaA15(Ts) allele. Transformants were streaked to plates incubated at 30° and 43° C. to test for complementation of the temperature sensitive allele. Isolates of all three coaA variants complemented well at 43° C., indicating that all three plasmid constructs encode an active pantothenate kinase. Accordingly, it can be concluded that the B. subtilis yqjS open reading frame codes for an active pantothenate kinase.

Example III Deletion of the coaA Gene from the B. subtilis Genome

The coaA gene of B. subtilis (yqjS) was deleted from the chromosome of a B. subtilis strain by conventional means. The majority of the coaA coding sequence was deleted from a plasmid clone and replaced by a chloramphenicol resistance gene (cat), while leaving approximately 1 kb of upstream and downstream sequence to allow homologous recombination with the chromosome, to give plasmid pAN296 (see FIG. 3). pAN296 was then used to transform a B. subtilis strain (PY79), selecting for chloramphenicol resistance. The majority of transformants result from a double crossover event that effectively substitutes the cat gene for the coaA gene. The transformed strain containing the coaA deletion-cat insertion, named PA861) grew normally indicating the presence of a second B. subtilis pantothenate kinase encoding gene described herein.

Example IV Identification and Characterization of a Second B. subtilis Gene Encoding Pantothenate Kinase Activity, the coaX Gene

After finding that deletion of the coaA gene from the chromosome of B. subtilis is not a lethal event (see Example III), it was concluded that B. subtilis must contain a second gene that encodes an active pantothenate kinase, since pantothenate kinase is an essential enzyme activity.

A second pantothenate kinase-encoding gene was identified by complementing the E. coli strain YH1 (coaA15(Ts)) with a B. subtilis gene bank and selecting for transformants that were able to grow at 43° C. Found among the transformants were two families of plasmids that had overlapping restriction maps within each family, but not between the families. As expected, the restriction map of one family was identical to that predicted from the B. subtilis genome sequence for the homologue of the E. coli coaA gene (which we named coaA also, see above) and surrounding sequences. The other family had a restriction map that was completely non-overlapping with the first.

DNA sequencing of the ends of the cloned inserts from the second family showed that the clones came from a region of the B. subtilis chromosome that includes the 3′ end of the ftsH gene, the 5′ end of the sul gene, and all of the yacB, yacC, yacD, cysK, pabB, pabA and pabC genes. None of the open reading frames of these cloned inserts showed homology to any known pantothenate kinase sequences, either prokaryotic or eukaryotic.

Several deletions were created through the B. subtilis genomic sequences in the cloned inserts. Each deletion was tested for complementation of the E. coli temperature sensitive pantothenate kinase. In particular, a deletion that removed all DNA between a Stu I site in the cloning vector and a Swa I site in the yacC gene, leaves yacB as the only intact open reading frame in the cloned insert (see FIG. 4). This deleted plasmid still complemented the E. coli pantothenate kinase mutant. However, another deletion that removed DNA from the Swa I site in yacC through a Bst1107I site in the (already truncated) ftsH gene, could not complement the E. coli pantothenate kinase mutant. From these results, it was concluded that the yacB open reading frame was responsible for the complementation activity. To confirm that yacB is a pantothenate kinase gene, the yacB ORF plus 112 base pairs of downstream flanking sequence was amplified by PCR in two independent reactions and cloned downstream of a constitutive promote to give plasmids pAN341 and pAN342 (FIG. 5). Both pAN341 and pAN342 complemented the defect in YH1 at 44° C., while a control plasmid, which has the same backbone, but expresses panBCD instead of yacB did not. This confirmed that the yacB open reading frame was responsible for the complementation of YH1.

As such, a novel gene that encodes pantothenate kinase activity in B. subtilis has been discovered that is not related by homology to any previously known pantothenate kinase gene. This gene has been renamed coaX, as a second, alternative gene that encodes an enzyme that catalyzes the first step in the pathway from pantothenate to CoaA. In B. subtilis strains deleted for coaA, coaX is an essential gene.

Several homologues of the B. subtilis coaX gene were identified by homology searching of various publically available databases using the published yacB (coaX) open reading frame sequence and predicted amino acid sequence (as set forth in SEQ ID NOs:15 and 16 respectively). In two cases (Mycobacterium tuberculosis and Streptomyces coelicolor) the homologous coaX genes are adjacent to, or almost adjacent to, pantothenate biosynthetic genes, consistent with these homologs having a role in pantothenate metabolism. The CoaX proteins show no homology to the CoaA family of pantothenate kinases, nor to the eukaryotic family of pantothenate kinases exemplified by PanK of Saccharomyces cerevisiae.

Alignment of the amino acid sequences of several bacterial CoaX homologs with the amino acid sequence predicted from translating the B. subtilis yacB ORF described in the published B. subtilis genome sequence revealed that the CoaX proteins from other bacteria contained additional amino acid residues at their carboxy-terminal ends. Moreover, these extensions beyond the end of the predicted amino acid sequence for the B. subtilis gene product contained two relatively well conserved segments of sequence.

Translation of nucleotide sequences just downstream from the stop codon of the B. subtilis yacB ORF in a different reading frame revealed the existence of amino acid sequences very similar to the carboxy-terminal extensions of the other bacterial CoaX proteins. It is thus believed that an error exists in the published DNA sequence of the B. subtilis yacB ORF sequence that causes a frame shift leading to an artifactual downstream amino acid sequence and premature termination.

The PCR-generated sequences of B. subtilis coaX in pAN341 and pAN342 (described above) contain enough downstream flanking sequence to encode the putative carboxy-terminal extension described above, which is consistent with the result that the clones were functional in the complementation assay. However when the 3′ PCR primer was positioned to include only the shorter yacB ORF predicted from the published sequence, but not to include the putative carboxy-terminal extension, then the resulting plasmids, pAN329 and pAN330 (similar in structure to pAN341 and pAN342; see FIG. 5), did not complement the defect in YH1. This result supports the notion that the published yacB coding sequence contains a frame-shift error, and that the carboxy-terminal end of CoaX is necessary for pantothenate kinase activity. A predicted correct nucleotide sequence for B. subtilis coaX is set forth as SEQ ID NO:1 and the translated amino acid sequence is set forth as SEQ ID NO:2. A multiple sequence alignment of the CoaX amino acid sequences of B. subtilis and 11 homologues thereof is set forth in FIG. 6.

Example V Deleting the Second Pantothenate Kinase Gene, coaX Gene from B. subtilis

With the knowledge gained above concerning the existence and nature of coaX, one can create a deletion of the coaX open reading frame from the B. subtilis chromosome that will remove the encoded activity, and that will not adversely affect the expression of the genes downstream from coaX. In such a deleted strain, the coaA gene will be the only gene that encodes pantothenate kinase.

To delete the coaX gene from B. subtilis, plasmid pAN336, which contains upstream and downstream homology for double crossover, was constructed with a kanamycin resistance gene replacing most of the coaX ORF (FIG. 7). Strain PY79 was transformed to kanamycin resistance by pAN336, and an isolate confirmed to have resulted from a double crossover by PCR was named PA876. As predicted, deletion of coaX by itself is not lethal for B. subtilis. Furthermore, chromosomal DNA from PA876 would not transform competent PA861 (PY79 ΔcoaA ::cat) to kanamycin resistance. These results indicate that it is the combination of ΔcoaA::cat and ΔcoaX :: kan that is lethal for B. subtilis, confirming that B. subtilis contains two unlinked genes that encode pantothenate kinase, coaA and coaX, and that either gene alone is capable of supplying sufficient pantothenate kinase for a normal rate of growth.

Example VI Identification of coaX Homologs in other Microbes

Database analyses reveal that many bacteria, in addition to B. subtilis, contain homologs of the CoaX pantothenate kinase. As shown in Tables 1 and 2, both nonpathogenic and pathogenic bacteria can be found that contain homologs of this novel gene.

TABLE 1
CoaX homologs in Non-Pathogens
Genome CoaA
Species complete homolog CoaX homolog
Aquifex aeolicus Yes NONE RAA00700
aq_1924
AAC07720.1
pir||E70465
Bacillus halodurans Yes BH2875 BH0086
BAB06594.1
Bacillus No NONE? gnl|UOKNOR_1422|bstear_.Contig467
stearothermophilus
Bacillus subtilis Yes RBS02372 YqjS RBS00070 YacB
BAA12625.1 BAA05305.1
CAB14308.1 CAB11846.1
pir||C69965 pir||S66100
Caulobacter crescentus No NONE? gnl|TIGR|C.crescentus_12574
Chlorobium tepidum No NONE? gnl|TIGR|C.tepidum_3499
Clostridium No NONE? RCA03301
acetobutylicum gnl|GTC|C.aceto_gnl
Dehalococcoides No NONE? gnl|TIGR_61435|deth_1587
ethenogenes
Deinococcus Yes NONE AAF10040.1
radiodurans pir||E75516
Desulfovibrio vulgaris No NONE? BAA21476.1
P37564
gnl|TIGR_881|dvulg_1371
Geobacter No NONE? gnl|TIGR_35554|gsulf_121
sulfurreducens
Pseudomonas putida No NONE? gnl|TIGR|pputida_10724
KT2440
Rhodobacter No NONE? RRC02473
capsulatus
Thiobacillus No NONE? gnl|TIGR|t_ferrooxidans_6155
ferrooxidans
Streptomyces No COAA_STRCO SCE94.31c
coelicolor g8469186 CAB40880.1
pir||T35567
Synechocystis sp. Yes NONE ORF_ID:slr0812
BAA18120
Thermotoga maritima Yes NONE TM0883
AAD35964.1
pir||D72320

TABLE 2
CoaX homologs in Pathogens
Genome CoaA
Pathogen complete homolog CoaX homolog Comments
Haemophilus Yes RHI13313 NONE
influenzae
Streptococcus No RST01295 NONE
pyogenes
Yersinia pestis No RYP02180 NONE
Vibrio cholerae Yes VC0320 NONE
Bacillus anthracis No NONE? YES
Bordetella No NONE? BAF (BVG ACCESSORY
pertussis FACTOR)
Borrelia Yes NONE BB0527
burgdorferi
Campylobacter Yes NONE Cj0394c
jejuni
Clostridium No NONE? YES
difficile
Helicobacter Yes NONE jhp0796 (strain J99)
pylori HP0862 (strain 26695)
AAD07916.1
Neisseria Yes NONE NMA0357 (strain Z2491) CoaX is fused
meningitidis NMB2075 (strain MC58) to BirA
Neisseria No NONE? RNG00193 CoaX is fused
gonorrhoeae to BirA
Porphyromonas No NONE? RPG01037
gingivalis gnl|TIGR|P.gingivalis_GP
G.con
Pseudomonas Yes NONE RPA06755
aeruginosa PA4279
AAG07667.1
Treponema Yes NONE RTP00155 (TP0431)
pallidum
Xylella fastidiosa Yes NONE XF1795
Legionella No gnl|CUCGC_446|lpneumo—
pneumophila C030598.2F12.S
Mycobacterium No MLCB1222.23
leprae
Mycobacterium Yes RMT04257 RMT02984 (Rv3600c) RMT04257
tuberculosis

Of particular interest are the seven human pathogens Helicobacter pylori, Borrelia burgdorferi, Pseudomonas aeruginosa, Campylobacter jejuni, Neisseria meningitidis, Treponema pallidum, and Bordetella pertussis, that contain the CoaX pantothenate kinase as their sole pantothenate kinase activity. For these bacteria, the CoaX pantothenate kinase represents an attractive target for screening for new antibiotics effective against one or more of these pathogens. One can overproduce the particular CoaX pantothenate kinase and use the isolated protein, partially purified protein or crude cell extracts to screen in vitro for compounds that modulate (e.g. inhibit) the pantothenate kinase activity. Alternatively, one can isolate compounds that specifically bind to the enzyme and test their ability to block the enzyme's activity. A known kinase activity represents a particularly favorable target for high-throughput screening for compounds that modulate or decrease that activity.

Also of interest are other pathogens which contain a coaX gene, in particular, if it is demonstrated that these other pathogens contain only a single pantothenate kinase encoded by the coaX gene. Examples of such bacteria are Porphyromonas gingivalis, Neisseria gonorrhoeae, Clostridium difficile, and Bacillus anthracis, all of which have been shown to contain a coaX homolog. Determination whether or not they also contain a second pantothenate kinase encoded by a coaA homolog can be determined according to the methodologies taught in Examples II-IV.

Example VII Identification of coaX Homologs in Human Pathogens Lacking a Conventional Prokaryotic Pantothenate Kinase

Human pathogens Helicobacter pylori (agent in gastoenteritus, stomach ulcers, and potentially stomach cancer), Borrelia burgdorferi (agent in Lyme's disease), Bordetella pertussis (agent in whooping cough), and Pseudomonas aeruginosa (opportunistic pathogen in cystic fibrous) all contain homologs of the coaX gene of B. subtilis and no homologs of the coaA gene of E. coli or B. subtilis. This is also true for the pathogens Treponema pallidum, Campylobacter jejuni, and Neisseria meningitidis. We have shown in B. subtilis that in the absence of the coaA gene product (ΔcoaA mutant), the coaX gene product is essential, providing the only pantothenate kinase activity required for the synthesis of the essential compound, Coenzyme A. Therefore it can be predicted that the pantothenate kinase encoded by the coaX homolog in the above listed pathogens is an essential enzyme for each mentioned pathogen and is required for the survival and growth of the pathogen. In fact it has been reported that the coaX homolog in Bordetella pertussis, called baf, and classified as an auxiliary regulatory factor rather than a critical enzyme, is an essential gene (see Wood, G. E. and R. L. Friedman (2000) FEMS Microbial. Lett. 193(1): 25-30).

The CoaX protein is a favorable target for the development and screening of new antibiotics. First, the pantothenate kinase encoded by the coaX gene is an essential enzyme in a group of human pathogens, making it a good target for inactivation. Second, the enzyme activity (kinase) of the isolated CoaX protein or its homologs provides an ideal assay to screen large numbers of compounds (combinatorial libraries, etc.) for their ability to specifically inhibit the pantothenate kinase activity both in vitro and in vivo.

Example VIII Production of CoaX Proteins from Pathogens for use in Screening Assays

To provide the pantothenate kinase proteins for screening assays, the coaX gene homolog was obtained by PCR from isolated, whole genome DNA of Helicobacter pylori (ATCC 700392), Borrelia burgdorferi (ATCC 35210), Bordetella pertussis (ATCC 9797), and Pseudomonas aeruginosa (ATCC 47085). Coding sequences for proteins with homology to B. subtilis CoaX were amplified by PCR using the primers and templates given in Table 3 with Pfx DNA polymerase (Life Technologies) according to the manufacture's specifications. The PCR primers incorporate a XbaI restriction enzyme recognition site at the 5′ end of each product and a BamHI restriction enzyme recognition site at the 3′ end of each product. PCR products were digested with a mixture of XbaI and BamHI and then purified by preparative agarose gel electrophoresis.

TABLE 3
PCR primers and template DNAs used to amplify coding
sequences homologous to B. subtilis coaX.
coaX Template
Organism homolog DNA 5′ amplification primer 3′ amplification primer
Bacillus subtilis 168 yacB Strain RL-1 TP175 TP176
genomic DNA 5′-GGGTCTAGAAAAGGAGGAA 5′-GGGATCCTTATACACTTCCT
TTTAAATGTTACTGGTTATCGA ACGCGGTTTCTTTCATAAATCAA
TGTGGGGAACACC-3′ TTCC-3′
Bordetella pertussis baf Strain TP177 TP178
ATCC 9797 5′-GGGTCTAGAAAAGGAGGAA 5′-GGGATCCTTAGGCCGTTGGC
genomic DNA TTTAAATGATTATCCTCATCGA GCGCCTTGCGCGGCG-3′
CTCCGGC-3′
Borrelia burgdorferi BB0527 Strain TP171 TP172
ATCC 35210 5′-GGGTCTAGAAAAGGAGGAA 5′-GGGATCCTTAATTAACAAAC
genomic DNA TTTAAATGAATAAACCTTTATT TTAAAGTCAATAGAATTTCCTAA
ATCAGAATTGATAATTGATATT AATTCTAACGCCTTCTACAG-3′
GGAAATACCAGC-3′
Helicobacter pylori 26695 HP0862 Strain TP167 TP168
ATCC 700392 5′-GGGTCTAGAAAAGGAGGAA 5′-GGGATCCTTATTTGCATTCT
genomic DNA TTTAAATGCCAGCTAGGCAATC AGTATCCCTGCTTTTTTAAGAGC
TTTTACAGATTTGAAAAACCTG GATTTCCATCCCGTC-3′
G-3′
Pseudomonas aeruginosa PA4279 Strain TP169 TP170
PA01 ATCC 47085 5′-GGGTCTAGAAAAGGAGGAA 5′-GGGATCCTTACTCAATCGG
genomic DNA TTTAAATGATTCTTGAGCTCGA GCAAGCCAGTGCCAGCCCTAC
CTGTGGAAACTCGCTG-3′ G-3′

The purified PCR products were cloned by ligation with plasmid vector pASK-1BA3 (Sigma-Genosys) which had been digested with XbaI and BamHI followed by transformation into strains LH-1 and XL1-Blue/MRF'kan. Plasmids containing inserts were identified by restriction enzyme digestion of plasmid DNA isolated from selected transformants. Examples of plasmids containing the H. pylori (pOTP72), P. aeruginosa (pOTP73), or B. subtilis (pOTP71) coaX gene are shown in FIGS. 8, 9 and 10, respectively. The identity of inserts in plasmids is confirmed by DNA sequence analysis.

The pantothenate kinase activity of each of the above cloned coaX homologs can be demonstrated by transforming the plasmids described above into E. coli strain YH1 containing the coaA15(Ts) mutation and looking for complementation at the non-permissive temperature of 43′-44° C. For example, as shown in Table 4, transformation of E. coli YH1 containing the coaA15(Ts) with plasmid pOTP72 containing the cloned H. pylori coaX gene (HP0862) or plasmid pOTP73 containing the cloned P. aeruginosa coaX gene (PA4279) enabled the E. coli cells with the temperature sensitive coaA gene product to grow at 44° C. as is also the case when these cells were transformed with the plasmid containing the B. subtilis coaX gene (pOTP71). These experiments confirm that the coaX homologs in H. pylori and P. aeruginosa due indeed each encode an active pantothenate kinase.

TABLE 4
Transformation of YH1 (coaA15(Ts)) with coaX ligation
mixtures and control plasmid DNA
Number of colonies Number of colonies
DNA at 30° C. at 44° C.
NONE zero zero
Ligated, cut vector 5 zero
Uncut vector >500 zero
(pASK-1BA3)
B. subtilis coaX, 74 67
pool A ligation
B. subtilis coaX, 230 160
pool B ligation
H. pylori coaX 53 38
(HP0862) pool A
ligation
H. pylori coaX 99 56
(HP0862) pool B
ligation
P. aeruginosa coaX 366 279
(PA4279) pool A
ligation
P. aeruginosa coaX 282 359
(PA4279) pool B
ligation

Since the coaX homologs cloned in pASK-1BA3 were inserted downstream of a Tet-inducible promoter, enzyme for in vitro screening assays can be obtained by inducing gene expression as described by Sigma-Genosys, and then isolating the overproduced pantothenate kinase by conventional protein purification procedure. Alternatively, the coaX gene can be cloned into any of various protein or peptide fusion expression vectors that facilitate purification of the protein. For example, Helicobacter pylori, Borrelia burgdorferi, Bordetella pertussis, and Pseudomonas aeruginosa coaX genes can be cloned into protein fusion expression vectors such as those available from companies including but not limited to Qiagen™ or Invitrogen™ to produce a His tagged CoaX fusion proteins or glutathione-S-transferase/CoaX fusion proteins which can be isolated by binding to nickel affinity or glutathione sepharose resins, respectively.

Equivalents Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

1. An isolated nucleic acid molecule comprising a coaX gene.

2. A recombinant vector comprising an isolated coaX gene.

3. A recombinant microorganism comprising the vector of claim 2.

4. A recombinant microorganism selected from the group consisting of PA861, PA876, YH1 comprising pOTP71, YH1 comprising pOTP72, YH1 comprising pOTP73, and YH1 comprising pAN341.