US20050246793A1
2005-11-03
11/038,284
2005-01-21
Disclosed is a nucleotide sequence encoding an effective portion of a class A starch branching enzyme (SBE) obtainable from potato plants, or a functional equivalent thereof, together with, inter alia, a corresponding polypeptide, a method of altering the characteristics of a plant, a plant having altered characteristics; and starch, particularly starch obtained from a potato plant, having novel properties.
Get notified when new applications in this technology area are published.
C12N9/107 » CPC main
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Transferases (2.); Glycosyltransferases (2.4); Hexosyltransferases (2.4.1) 1,4-Alpha-glucan branching enzyme (2.4.1.18)
C08B30/00 » CPC further
Preparation of starch, degraded or non-chemically modified starch, amylose, or amylopectin
C12N9/1051 » CPC further
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Transferases (2.); Glycosyltransferases (2.4) Hexosyltransferases (2.4.1)
C12P19/04 » CPC further
Preparation of compounds containing saccharide radicals Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
This invention relates to novel nucleotide sequences, polypeptides encoded thereby, vectors and host cells and host organisms comprising one or more of the novel sequences, and to a method of altering one or more characteristics of an organism. The invention al;so relates to starch having novel properties and to uses thereof.
BACKGROUND OF THE INVENTIONStarch is the major form of carbon reserve in plants, constituting 50% or more of the dry weight of many storage organs—e.g. tubers, seeds of cereals. Starch is used in numerous food and industrial applications. In many cases, however, it is necessary to modify the native starches, via chemical or physical means, in order to produce distinct properties to suit particular applications. It would be highly desirable to be able to produce starches with the required properties directly in the plant, thereby removing the need for additional modification. To achieve this via genetic engineering requires knowledge of the metabolic pathway of starch biosynthesis. This includes characterisation of genes and encoded gene products which catalyse the synthesis of starch. Knowledge about the regulation of starch biosynthesis raises the possibility of “re-programming” biosynthetic pathways to create starches with novel properties that could have new commercial applications.
The commercially useful properties of starch derive from the ability of the native granular form to swell and absorb water upon suitable treatment. Usually heat is required to cause granules to swell in a process known as gelatinization, which has been defined (W A Atwell et al, Cereal Foods World 33, 306-311, 1988) as “. . . the collapse (disruption) of molecular orders within the starch granule manifested in irreversible changes in properties such as granular swelling, native crystallite melting, loss of birefringence, and starch solubilization. The point of initial gelatinization and the range over which it occurs is governed by starch concentration, method of observation, granule type, and heterogeneities within the granule population under observation”. A number of techniques are available for the determination of gelatinization as induced by heating, a convenient and accurate method being differential scanning calorimetry, which detects the temperature range and enthalpy associated with the collapse of molecular orders within the granule. To obtain accurate and meaningful results, the peak and/or onset temperature of the endotherm observed by differential scanning calorimetry is usually determined.
The consequence of the collapse of molecular orders within starch granules is that the granules are capable of taking up water in a process known as pasting, which has been defined (W A Atwell et al, Cereal Foods World 33, 306-311, 1988) as “. . . the phenomenon following gelatinization in the dissolution of starch. It involves granular swelling, exudation of molecular components from the granule, and eventually, total disruption of the granules”. The best method of evaluating pasting properties is considered to be the viscoamylograph (Atwell et al, 1988 cited above) in which the viscosity of a stirred starch suspension is monitored under a defined time/temperature regime. A typical viscoamylograph profile for potato starch shows an initial rise in viscosity, which is considered to be due to granule swelling. In addition to the overall shape of the viscosity response in a viscoamylograph, a convenient quantitative measure is the temperature of initial viscosity development (onset). FIG. 1 shows such a typical viscosity profile for potato starch, during and after cooking, and includes stages A-D which correspond to viscosity onset (A), maximum viscosity (B), complete dispersion (C) and reassociation of molecules (or retrogradation, D). In the figure, the dotted line represents viscosity (in stirring number units) of a 10% w/w starch suspension and the unbroken line shows the temperature in degrees centigrade. At a certain point, defined by the viscosity peak, granule swelling is so extensive that the resulting highly expanded structures are susceptible to mechanically-induced fragmentation under the stirring conditions used. With increased heating and holding at 95° C., further reduction in viscosity is observed due to increased fragmentation of swollen granules. This general profile has previously always been found for native potato starch.
After heating starches in water to 95° C. and holding at that temperature (for typically 15 minutes), subsequent cooling to 50° C. results in an increase in viscosity due to the process of retrogradation or set-back. Retrogradation (or set-back) is defined. (Atwell et al., 1988 cited above) as “. . . a process which occurs when the molecules comprising gelatinised starch begin to reassociate in an ordered structure . . . ”At 50° C., it is primarily the amylose component which reassociates, as indicated by the increase in viscoamylograph viscosity for starch from normal maize (21.6% amylose) compared with starch from waxy maize (1.1% amylose) as shown in FIG. 2. FIG. 2 is a viscoamylograph of 10% w/w starch suspensions from waxy maize (solid line), conventional maize (dots and dashes), high amylose variety (HYLON® V starch, dotted line) and a very high amylose variety (HYLON® VII starch, crosses). The temperature profile is also shown by a solid line, as in FIG. 1. The extent of viscosity increase in the viscoamylograph on cooling and holding at 50° C. depends on the amount of amylose which is able to reassociate due to its exudation from starch granules during the gelatinization and pasting processes. A characteristic of amylose-rich starches from maize plants is that very little amylose is exuded from granules by gelatinization and pasting up to 95° C., probably due to the restricted swelling of the granules. This is illustrated in FIG. 2 which shows low viscosities for a high amylose (44.9%) starch (HYLON® V starch) from maize during gelatinization and pasting at 95° C. and little increase in viscosity on cooling and holding at 50° C. This effect is more extreme for a higher amylose content (58%, as in HYLON® VII starch), which shows even lower viscosities in the viscoamylograph test (FIG. 2). For commercially-available high amylose starches (currently available from maize plants, such as those described above), processing at greater than 100° C. is usually necessary in order to generate the benefits of high amylose contents with respect to increased rates and strengths of reassociation, but use of such high temperatures is energetically unfavourable and costly. Accordingly, there is an unmet need for starches of high amylose content which can be processed below 100° C. and still show enhanced levels of reassociation, as indicated for example by viscoamylograph measurements.
The properties of potato starch are useful in a variety of both food and non-food (paper, textiles, adhesives etc.) applications. However, for many applications, properties are not optimum and various chemical and physical modifications well known in the art are undertaken in order to improve useful properties. Two types of property manipulation which would be of use are: the controlled alteration of gelatinization and pasting temperatures; and starches which suffer less granular fragmentation during pasting than conventional starches.
Currently the only ways of manipulating the gelatinization and pasting temperatures of potato starch are by the inclusion of additives such as sugars, polyhydroxy compounds of salts (Evans & Haisman, Starke 34, 224-231, 1982) or by extensive physical or chemical pre-treatments (e.g. Stute, Starke 44, 205-214, 1992). The reduction of granule fragmentation during pasting can be achieved either by extensive physical pretreatments (Stute, Starke 44, 205-214, 1992) or by chemical cross-linking. Such processes are inconvenient and inefficient. It is therefore desirable to obtain plants which produce starch which intrinsically possesses such advantageous properties.
Starch consists of two main polysaccharides, amylose and amylopectin. Amylose is a generally linear polymer containing α-1,4 linked glucose units, while amylopectin is a highly branched polymer consisting of a α-1,4 linked glucan backbone with α-1,6 linked glucan branches. In most plant storage reserves amylopectin constitutes about 75% of the starch content. Amylopectin is synthesized by the concerted action of soluble starch synthase and starch branching enzyme [α-1,4 glucan: α-1,4 glucan 6-glycosyltransferase, EC 2.4.1.18]. Starch branching enzyme (SBE) hydrolyses α-1,4 linkages and rejoins the cleaved glucan, via an α-1,6 linkage, to an acceptor chain to produce a branched structure. The physical properties of starch are strongly affected by the relative abundance of amylose and amylopectin, and SBE is therefore a crucial enzyme in determining both the quantity and quality of starches produced in plant systems.
In most plants studied to date e.g. maize (Boyer & Preiss, 1978 Biochem. Biophys. Res. Comm. 80, 169-175), rice (Smyth, 1988 Plant Sci. 57, 1-8) and pea (Smith, Planta 175, 270-279), two forms of SBE have been identified, each encoded by a separate gene. A recent review by Burton et al., (1995 The Plant Journal 7, 3-15) has demonstrated that the two forms of SBE constitute distinct classes of the enzyme such that, in general, enzymes of the same class from different plants may exhibit greater similarity than enzymes of different classes from the same plant. In their review, Burton et al. termed the two respective enzyme families class “A” and class “B”, and the reader is referred thereto (and to the references cited therein) for a detailed discussion of the distinctions between the two classes. One general distinction of note would appear to be the presence, in class A SBE molecules, of a flexible N-terminal domain, which is not found in class B molecules. The distinctions noted by Burton et al. are relied on herein to defme class A and class B SBE molecules, which terms are to be interpreted accordingly.
However in potato, only one isoform of the SBE molecule (belonging to class B) has thus far been reported and only one gene cloned (Blennow & Johansson, 1991 Phytochem. 30, 437-444, and Koβmann et al., 1991 Mol. Gen. Genet. 230, 39-44). Further, published attempts to modify the properties of starch in potato plants (by preventing expression of the single known SBE) have generally not succeeded (e.g. Muller-Rober & Koβmann 1994 Plant Cell and Environment 17, 601-613).
SUMMARY OF THE INVENTIONIn a first aspect the invention provides a nucleotide sequence encoding an effective portion of a class A starch branching enzyme (SBE) obtainable from potato plants.
Preferably the nucleotide sequence encodes a polypeptide comprising an effective portion of the amino acid sequence shown in FIG. 5 (excluding the sequence MNKRIDL, which does not represent part of the SBE molecule), or a functional e quivalent t hereof (which term is discussed below). The amino acid sequence shown in FIG. 5 (Seq ID No. 15) includes a leader sequence which directs the polypeptide, when synthesised in potato cells, to the amyloplast. Those skilled in the art will recognise that the leader sequence is removed to produce a mature enzyme and that the leader sequence is therefore not essential for enzyme activity. Accordingly, an “effective portion” of the polypeptide is one which possesses sufficient SBE activity to complement the branching enzyme mutation in E. coli KV 832 cells (described below) and which is active when expressed in E. coli in the phosphorylation stimulation assay. An example of an incomplete polypeptide which nevertheless constitutes an “effective portion” is the mature enzyme lacking the leader sequence. By analogy with the pea class A SBE sequence, the potato class A sequence shown in FIG. 5 probably possesses a leader sequence of about 48 amino acid residues, such that the N terminal amino acid sequence is thought to commence around the glutamic acid residue (E) at position 49 (EKSSYN . . . etc.). Those skilled in the art will appreciate that an effective portion of the enzyme may well omit other parts of the sequence shown in the figure without substantial detrimental effect. For example, the C-terminal glutamic acid-rich region could be reduced in length, or possibly deleted entirely, without abolishing class A SBE activity. A comparison with other known SBE sequences, especially other class A SBE sequences (see for example, Burton et al, 1995 cited above), should indicate those portions which are highly conserved (and thus likely to be essential for activity) and those portions which are less well conserved (and thus are more likely to tolerate sequence changes without substantial loss of enzyme activity).
Conveniently the nucleotide sequence will comprise substantially nucleotides 289 to 2790 of the DNA sequence (Seq ID No. 14) shown in FIG. 5 (which nucleotides encode the mature enzyme) or a functional equivalent thereof, and may also include further nucleotides at the 5′ or 3′ end. For example, for ease of expression, the sequence will desirably also comprise an in-frame ATG start codon, and may also encode a leader sequence. Thus, in one embodiment, the sequence firther comprises nucleotides 145 to 288 of the sequence shown in FIG. 5. Other embodiments are nucleotides 228 to 2855 of the sequence labelled “psbe2con.seq” in FIG. 8, and nucleotides 57 to 2564 of the sequence shown in FIG. 12 (preferably comprising an in-frame ATG start codon, such as the sequence of nucleotides 24 to 56 in the same Figure), or functional equivalents of the aforesaid sequences.
The term “functional equivalent” as applied herein to nucleotide sequences is intended to encompass those sequences which differ in their nucleotide composition to that shown in FIG. 5 but which, by virtue of the degeneracy of the genetic code, encode polypeptides having identical or substantially identical amino acid sequences. It is intended that the term should also apply to sequences which are sufficiently homologous to the sequence of the invention that they can hybridise to the complement thereof under stringent hybridisation conditions—such equivalents will preferably possess at least 85%, more preferably at least 90%, and most preferably at least 95% sequence homology with the sequence of the invention as exemplified by nucleotides 289 to 2790 of the DNA sequence shown in FIG. 5. It will be apparent to those skilled in the art that the nucleotide sequence of the invention may also find useful application when present as an “antisense” sequence. Accordingly, functionally equivalent sequences will also include those sequences which can hybridise, under stringent hybridisation conditions, to the sequence of the invention (rather than the complement thereof). Such “antisense” equivalents will preferably possess at least 85%, more preferably at least 90%, and most preferably 95% sequence homology with the complement of the sequence of the invention as exemplified by nucleotides 289 to 2790 of the DNA sequence shown in FIG. 5. Particular functional equivalents are shown, for example, in FIGS. 8 and 10 (if one disregards the various frameshift mutations noted therein).
The invention also provides vectors, particularly expression vectors, comprising the nucleotide sequence of the invention. The vector will typically comprise a promoter and one or more regulatory signals of the type well known to those skilled in the art. The invention also includes provision of cells transformed (which term encompasses transduction and transfection) with a vector comprising the nucleotide sequence of the invention.
The invention further provides a class A SBE polypeptide, obtainable from potato plants. In particular the invention provides the polypeptide in substantially pure form, especially in a form free from other plant-derived (especially potato plant-derived) components, which can be readily accomplished by expression of the relevant nucleotide sequence in a suitable non-plant host (such as any one of the yeast strains routinely used for expression purposes, e.g. Pichia spp. or Saccharomyces spp). Typically the enzyme will substantially comprise the sequence of amino acid residues 49 to 882 shown in FIG. 5 (disregarding the sequence MNKRIDL, which is not part of the enzyme), or a functional equivalent thereof. The polypeptide of the invention may be used in a method of modifying starch in vitro, comprising treating starch under suitable conditions (e.g. appropriate temperature, pH, etc.) with an effective amount of the polypeptide according to the invention.
The term “functional equivalent”, as applied herein to amino acid sequences, is intended to encompass amino acid sequences substantially similar to that shown in FIG. 5, such that the polypeptide possesses sufficient activity to complement the branching enzyme mutation in E. coli KV 832 cells (described below) and which is active in E. coli in the phosphorylation stimulation assay. Typically such functionally equivalent amino acid sequences will preferably possess at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity with the amino acid sequence of the mature enzyme (i.e. minus leader sequence) shown in FIG. 5. Those skilled in the art will appreciate that conservative substitutions may be made generally throughout the molecule without substantially affecting the activity of the enzyme. Moreover, some non-conservative substitutions may be tolerated, especially in the less highly -conserved regions of the molecule. Such substitutions may be made, for example, to modify slightly the activity of the enzyme. The polypeptide may, if desired, include a leader sequence, such as that exemplified by residues 1 to 48 of the amino acid sequence shown in FIG. 5, although other leader sequences and signal peptides and the like are known and may be included.
A portion of the nucleotide sequence of the invention has been introduced into a plant and found to affect the characteristics of the plant. In particular, introduction of the sequence of the invention, operably linked in the antisense orientation to a suitable promoter, was found to reduce the amount of branched starch molecules in the plant. Additionally, it has recently been demonstrated in other experimental systems that “sense suppression” can also occur (i.e. expression of an introduced sequence operably linked in the sense orientation can interfere, by some unknown mechanism, with the expression of the native gene), as described by Matzke & Matzke (1995 Plant Physiol. 107, 679-685). Any one of the methods mentioned by Matzke & Matzke could, in theory, be used to affect the expression in a host of a homologous SBE gene.
It is believed that antisense methods are mainly operable by the production of antisense MRNA which hybridises to the sense mRNA, preventing its translation into functional polypeptide, possibly by causing the hybrid RNA to be degraded (e.g. Sheehy et al., 1988 PNAS 85, 8805-8809; Van der Krol et al., Mol. Gen. Genet. 220, 204-212). Sense suppression also requires homology between the introduced sequence and the target gene, but the exact mechanism is unclear. It is apparent however that, in relation to both antisense and sense suppression, neither a full length nucleotide sequence, nor a “native” sequence is essential. Preferably the “effective portion” used in the method will comprise at least one third of the full length sequence, but by simple trial and error other fragments (smaller or larger) may be found which are functional in altering the characteristics of the plant.
Thus, in a further aspect the invention provides a method of altering the characteristics of a plant, comprising introducing into the plant an effective portion of the sequence of the invention operably linked to a suitable promoter active in the plant. Conveniently the sequence will be linked in the anti-sense orientation to the promoter. Preferably the plant is a potato plant. Conveniently, the characteristic altered relates to the starch content and/or starch composition of the plant (i.e. amount and/or type of starch present in the plant).
Preferably the method of altering the characteristics of the plant will also comprise the introduction of one or more further sequences, in addition to an effective portion of the sequence of the invention. The introduced sequence of the invention and the one or more further sequences (which may be sense or antisense sequences) may be operably linked to a single promoter (which would ensure both sequences were transcribed at essentially the same time), or may be operably linked to separate promoters (which may be necessary for optimal expression). Where separate promoters are employed they may be identical to each other or different. Suitable promoters are well known to those skilled in the art and include both constitutive and inducible types. Examples include the CaMV 35S promoter (e.g. single or tandem repeat) and the patatin promoter. Advantageously the promoter will be tissue-specific. Desirably the promoter will cause expression of the operably linked sequence at substantial levels only in the tissue of the plant where starch synthesis and/or starch storage mainly occurs. Thus, for example, where the sequence is introduced into a potato plant, the operably linked promoter may be tuber-specific, such as the patatin promoter.
Desirably, for example, the method will also comprise the introduction of an effective portion of a sequence encoding a class B SBE, operably linked in the antisense orientation to a suitable promoter active in the plant. Desirably the further sequence will comprise an effective portion of the sequence encoding the potato class B SBE molecule. Conveniently the further sequence will comprise an effective portion of the sequence described by Blennow & Johansson (1991 Phytochem. 30, 437-444) or that disclosed in WO92/11375. More preferably, the further sequence will comprise at least an effective portion of the sequence disclosed in International Patent Application No. WO 95/26407. Use of antisense sequences against both class A and class B SBE in combination has now been found by the present inventors to result in the production of starch having very greatly altered properties (see below). Those skilled in the art will appreciate the possibility that, if the plant already comprises a sense or antisense sequence which efficiently inhibits the class B SBE activity, introduction of a sense or antisense sequence to inhibit class A SBE activity (thereby producing a plant with inhibition of both class A and class B activity) might alter greatly the properties of the starch in the plant, without the need for introduction of one or more further sequences. Thus the sequence of the invention is conveniently introduced into plants already having low levels of class A and/or class B SBE activity, such that the inhibition resulting from the introduction of the sequence of the invention is likely to have a more pronounced effect.
The sequence of the invention, and the one or more further sequences if desired, can be introduced into the plant by any one of a number of well-known techniques (e.g. Agrobacterium-mediated transformation, or by “biolistic” methods). The sequences are likely to be most effective in inhibiting SBE activity in potato plants, but theoretically could be introduced into any plant. Desirable examples include pea, tomato, maize, wheat, rice, barley, sweet potato and cassava plants. Preferably the plant will comprise a natural gene encoding an SBE molecule which exhibits reasonable homology with the introduced nucleic acid sequence of the invention.
In another aspect, the invention provides a plant cell, or a plant or the progeny thereof, which has been altered by the method defined above. The progeny of the altered plant may be obtained, for example, by vegetative propagation, or by crossing the altered plant and reserving the seed so obtained. The invention also provides parts of the altered plant, such as storage organs. Conveniently, for example, the invention provides tubers comprising altered starch, said tubers being obtained from an altered plant or the progeny thereof. Potato tubers obtained from altered plants (or the progeny thereof) will be particularly useful materials in certain industrial applications and for the preparation and/or processing of foodstuffs and may be used, for example, to prepare low-fat waffles and chips (amylose generally being used as a coating to prevent fat uptake), and to prepare mashed potato (especially “instant” mashed potato) having particular characteristics.
In particular relation to potato plants, the invention provides a potato plant or part thereof which, in its wild type possesses an e ffective S BE A gene, but which plant has been altered such that there is no effective expression of an SBE A polypeptide within the cells of at least part of the plant. The plant may have been altered by the method defined above, or may have been selected by conventional breeding to be deleted for the class A SBE gene, presence or absence of which can be readily determined by screening samples of the plants with a nucleic acid probe or antibody specific for the potato class A gene or gene product respectively.
The invention also provides starch extracted from a plant altered by the method defined above, or the progeny of such a plant, the starch having altered properties compared to starch extracted from equivalent, but unaltered, plants. The invention further provides a method of making altered starch, comprising altering a plant by the method defined above and extracting therefrom starch having altered properties compared to starch extracted from equivalent, but unaltered, plants. Use of nucleotide sequences in accordance with the invention has allowed the present inventors to produce potato starches having a wide variety of novel properties.
In particular the invention provides the following: a plant (especially a potato plant) altered by the method defined above, containing starch which, when extracted from the plant, has an elevated endotherm peak temperature as judged by DSC, compared to starch extracted from a similar, but unaltered, plant; a plant (especially a potato plant) altered by the method defined above, containing starch which, when extracted from the plant, has an elevated viscosity onset temperature (conveniently elevated by 10-25° C.) as judged by viscoamylograph compared to starch extracted from a similar, but unaltered, plant; a plant (especially a potato plant) altered by the method defined above, containing starch which, when extracted from the plant, has a decreased peak viscosity (conveniently decreased by 240-700SNUs) as judged by viscoamylograph compared to starch extracted from a similar, but unaltered, plant; a plant (especially a potato plant) altered by the method defined above, containing starch which, when extracted from the plant, has an increased pasting viscosity (conveniently increased by 37-260SNUs) as judged by viscoamylograph compared to starch extracted from a similar, but unaltered, plant; a plant (especially a potato plant) altered by the method defined above, containing starch which, when extracted from the plant, has an increased set-back viscosity (conveniently increased by 224-313 SNUs) as judged by viscoamylograph compared to starch extracted from a similar, but unaltered, plant; a plant (especially a potato plant) altered by the method defined above, containing starch which, when extracted from the plant, has a decreased set-back viscosity as judged by viscoamylograph compared to starch extracted from a similar, but unaltered, plant; and a plant (especially a potato plant) altered by the method defined above, containing starch which, when extracted from the plant, has an elevated amylose content as judged by iodometric assay (i.e. by the method of Morrison & Laignelet 1983, cited a bove) compared to starch extracted from a similar, but unaltered, plant. The invention also provides for starch obtainable or obtained from such plants as aforesaid.
In particular the invention provides for starch which, as extracted from a potato plant by wet milling at ambient temperature, has one or more of the following properties, as judged by viscoamylograph analysis performed according to the conditions defined below:
viscosity onset temperature in the range 70-95° C. (preferably 75-95° C.); peak viscosity in the range 500-12 stirring number units; pasting viscosity in the range 214-434 stirring number units; set-back viscosity in the range 450-618 o r 14-192 stirring number units; or displays no significant increase in viscosity during viscoamylograph. Peak, pasting and set-back viscosities are defined below. Viscosity onset temperature is the temperature at which there is a sudden, marked increase in viscosity from baseline levels during viscoamylograph, and is a term well-known to those skilled in the art.
In other particular embodiments, the invention provides starch which as extracted from a potato plant by wet milling at ambient temperature has a peak viscosity in the range 200-500 SNUs and a set-back viscosity in the range 275-618 SNUs as judged by viscoamylograph according to the protocol defined below; and starch which as extracted from a potato plant by wet milling at ambient temperature has a viscosity which does not decrease between the start of the heating phase (step 2) and the start of the final holding phase (step 5) and has a set-back viscosity of 303 SNUs or less as judged by viscoamylograph according to the protocol defined below.
For the purposes of the present invention, viscoamylograph conditions are understood to pertain to analysis of a 10% (w/w) aqueous suspension of starch at atmospheric pressure, using a Newport Scientific Rapid Visco Analyser with a heating profile of: holding at 50° C. for 2 minutes (step 1), heating from 50 to 95° C. at a rate of 1.5° C. per minute (step 2), holding at 95° C. for 15 minutes (step 3), cooling from 95 to 50° C. at a rate of 1.5° C. per minute (step 4), and then holding at 50° C. for 15 minutes (step 5). Peak viscosity may be defined for present purposes as the maximum viscosity attained during the heating phase (step 2) or the holding phase (step 3) of the viscoamylograph. Pasting viscosity may be defined as the viscosity attained by the starch suspensions at the end ofthe holding phase (step 3) of the viscoamylograph. Set-back viscosity may be defined as the viscosity of the starch suspension at the end of step 5 of the viscoamylograph.
In yet another aspect the invention provides starch from a potato plant having an apparent amylose content (% w/w) of at least 35%, as judged by iodometric assay according to the method described by Morrison & Laignelet (1983 J. Cereal Science 1, 9-20). Preferably the starch will have an amylose content of at least 40%, more preferably at least 50%, and most preferably at least 66%. Starch obtained directly from a potato plant and having such properties has not hitherto been produced. Indeed, as a result of the present invention, it is now possible to generate in vivo potato starch which has some properties analogous to the very high amylose starches (e.g. HYLON® VII starch) obtainable from maize.
Starches with high (at least 35%) amylose contents fmd commercial application as, amongst other reasons, the a mylose component of starch reassociates more strongly and rapidly than the amylopectin component during retrogradation processes. This may result, for example, in pastes with higher viscosities, gels of greater cohesion, or films of greater strength for starches with high (at least 35%) compared with normal (less than 35%) amylose contents. Alternatively, starches may be obtained with very high amylose contents, such that the granule structure is substantially preserved during heating, resulting in starch suspensions which demonstrate substantially no increase in viscosity during cooking (i.e. there is no significant viscosity increase during viscoamylograph conditions defined above). Such starches typically exhibit a viscosity increase of less than 10% (preferably less than 5%) during viscoamylograph under the conditions defined above.
In commerce, these valuable properties are currently obtained from starches of high amylose content derived from maize plants. It would be of commercial value to have an alternative source of high amylose starches from potato as other characteristics such as granule size, organoleptic properties and textural qualities may distinguish application performances of high amylose starches from maize and potato plants.
Thus high a mylose starch obtained by the method of the present invention may find application in many different technological fields, which may be broadly categorised into two groups: food products and processing; and “Industrial” applications. Under the heading of food products, the novel starches of the present invention may find application as, for example, films, barriers, coatings or gelling agents. In general, high amylose content starches absorb less fat during frying than starches with low amylose content, thus the high amylose content starches of the invention may be advantageously used in preparing low fat fried products (e.g. potato chips, crisps and the like). The novel starches may also be employed with advantage in preparing confectionery and in granular and retrograded “resistant” starches. “Resistant” starch is starch which is resistant to digestion by α-amylase. As such, resistant starch is not digested by α-amylases present in the human small intestine, but passes into the colon where it exhibits properties similar to soluble and insoluble dietary fibre. Resistant starch is thus of great benefit in foodstuffs due to its low calorific value and its high dietary fibre content. Resistant starch is formed by the retrogradation (akin to recrystallization) of a mylose from starch gels. Such retrogradation is inhibited by amylopectin. Accordingly, the high amylose starches of the present invention are excellent starting materials for the preparation of resistant starch. Suitable methods for the preparation of resistant starch are well-known to those skilled in the art and include, for example, those described in U.S. Pat. No. 5,051,271 and U.S. Pat. No. 5,281,276. Conveniently the resistant starches provided by the present invention comprise at least 5% total dietary fibre, as judged by the method of Prosky et al., (1985 J. Assoc. Off. Anal. Chenm 68, 677), mentioned in U.S. Pat. No. 5,281, 276.
Under the heading of “Industrial” applications, the novel starches of the invention may be advantageously employed, for example, in corrugating adhesives, in biodegradable products such as loose fill packaging and foamed shapes, and in the production of glass fibers and textiles.
Those skilled in the art will appreciate that the novel starches of the invention may, if desired, be subjected in vitro to conventional enzymatic, physical and/or chemical modification, such as cross-linking, introduction of hydrophobic groups (e.g. octenyl succinic acid, dodecyl succinic acid), or derivatization (e.g. by means of esterification or etherification).
In yet another aspect the invention provides high (35% or more) amylose starches which generate paste viscosities greater than those obtained from high amylose starches from maize plants after processing at temperatures below 100° C. This provides the advantage of more economical starch gelatinization and pasting treatments through the use of lower processing temperatures than are currently required for high amylose starches from maize plants.
The invention will now be further described by way of illustrative example and with reference to the drawings, of which:
FIG. 1 shows a typical viscoamylograph for a 10% w/w suspension of potato starch;
FIG. 2 shows vsicoamylographs for 10% suspensions of starch from various maize varieties;
FIG. 3 is a schematic representation of the cloning strategy used by the present inventors;
FIG. 4a shows the amino acid alignment of the C-terminal portion of starch branching enzyme isoforms from various sources; amino acid residues matching the consensus sequence are shaded;
FIG. 4b shows the alignment of DNA sequences of various starch branching enzyme isoforms which encode a conserved amino acid sequence;
FIG. 5 shows the DNA sequence (Seq ID No. 14) and predicted amino acid sequence (Seq ID No. 15) of a full length potato class A SBE cDNA clone obtained by PCR;
FIG. 6 shows a comparison of the most highly conserved part of the amino acid sequences of potato class A (uppermost sequence) and class B (lowermost sequence) SBE molecules;
FIG. 7 shows a comparison of the amino acid sequence of the full length potato class A (uppermost sequence) and pea (lowermost sequence) class A SBE molecules;
FIG. 8 shows a DNA alignment of various full length potato class A SBE clones obtained by the inventors;
FIG. 9 shows the DNA sequence of a potato class A SBE clone determined by direct sequencing of PCR products, together with the predicted amino acid sequence;
FIG. 10 is a multiple DNA alignment of various full length potato SBE-A clones obtained by the inventors;
FIG. 11 is a schematic illustration of the plasmid pSJ64;
FIG. 12 shows the DNA sequence and predicted amino acid sequence of the full length potato class A SBE clone as present in the plasmid pSJ90; and
FIG. 13 shows viscoamylographs for 10% w/w suspensions of starch from various transgenic potato plants made by the relevant method aspect of the invention.
EXAMPLES Example 1Cloning of Potato Class A SBE
The strategy for cloning the second form of starch branching enzyme from potato is shown in FIG. 3. The small arrowheads represent primers used by the inventors in PCR and RACE protocols. The approximate size of the fragments isolated is indicated by the numerals on the right of the Figure. By way of explanation, a comparison of t he a mino a cid s equences of s everal c loned plant starch branching enzymes (SBE) from maize (class A), pea (class A), maize (class B), rice (class B) and potato (class B), as well as human glycogen branching enzyme, allowed the inventors to identify a region in the carboxy-terminal one third of the protein which is almost completely conserved (GYLNFMGNEFGHPEWIDFPR) (FIG. 4a). A multiple alignment of the DNA sequences (human, pea class A, potato class B, maize class B, maize class A and rice class B, respectively) corresponding to this region is shown in FIG. 4b and was used to design an oligo which would potentially hybridize to all known plant starch branching enzymes: AATTT(C/T)ATGGGIAA(C/T)GA(A/G)TT(C/T)GG (Seq ID No. 20).
Library PCR
The initial isolation of a partial potato class A SBE cDNA clone was from an amplified potato tuber cDNA library in the λZap vector (Stratagene). One half μL of a potato cDNA library (titre 2.3×109pfu/rnL) was used as template in a 50 μL reaction containing 100 pmol of a 16 fold degenerate POTSBE primer and 25 pmol of a T7 primer (present in the λZap vector 3′ to the cDNA sequences—see FIG. 3), 100 μM dNTPs, 2.5 U Taq polymerase and the buffer supplied with the Taq polymerase (Stratagene). All components except the enzyme were added to a 0.5 mL microcentrifuge tube, covered with mineral oil and incubated at 94° C. for 7 minutes and then held at 55° C., while the Taq polymerase was added and mixed by pipetting. PCR was then performed by incubating for 1 min at 94° C., 1 min at 58° C. and 3 minutes at 72° C., for 35 cycles. The PCR products were extracted with phenol/chloroform, ethanol precipitated and resuspended in TE pH 8.0 before cloning into the T/A cloning vector pT7BlueR (Invitrogen).
Several fragments between 600 and 1300 bp were amplified. These were isolated from an agarose gel and cloned into the pT7BlueR T/A cloning vector. Restriction mapping of 24 randomly selected clones showed that they belonged to several different groups (based on size and presence/absence of restriction sites). Initially four clones were chosen for sequencing. Of these four, two were found to correspond to the known potato class B SBE sequence, however the other two, although homologous, differed significantly and were more similar to the pea class A SBE sequence, suggesting that they belonged to the class A family of branching enzymes (Burton et al., 1995 The Plant Journal, cited above). The latter two clones (˜800bp) were sequenced fully. They both contained at the 5′ end the sequence corresponding to the degenerate oligonucleotide used in the PCR and had a predicted open reading frame of 192 amino acids. The deduced amino acid sequence was highly homologous to that of the pea class A SBE.
The ˜800 bp PCR derived cDNA fragment (corresponding to nucleotides 2281 to 3076 of the psbe2 con.seq sequence shown in FIG. 8) was used as a probe to screen the potato tuber cDNA library. From one hundred and eighty thousand plaques, seven positives were obtained in the primary screen. PCR analysis showed that five of these clones were smaller than the original 800 bp cDNA clone, so these were not analysed further. The two other clones (designated 3.2.1 and 3.1.1) were approximately 1200 and 1500 bp in length respectively. These were sequenced from their 5′ ends and the combined consensus sequence aligned with the sequence from the PCR generated clones. The cDNA clone 3.2.1 was excised from the phage vector and plasmid DNA was prepared and the insert fully sequenced. Several attempts to obtain longer clones from the library were unsuccessful, therefore clones containing the 5′ end of the full length gene were obtained using RACE (rapid amplification of cDNA ends).
Rapid Amplification of cDNA Ends (RACE) and PCR Conditions
RACE was performed essentially according to Frohman (1992 Amplifications 11-15). Two μg of total RNA from mature potato tubers was heated to 65° C. for 5 mnin and quick cooled on ice. The RNA was then reverse transcribed in a 20 μL reaction for 1 hour at 37° C. using BRL's M-MLV reverse transcriptase and buffer with 1 mM DTT, 1 mM dNTPs, 1 U/μL RNAsin (Promega) and 500 pmol random hexamers (Pharmacia) as primer. Excess primers were removed on a Centricon 100 column and cDNA was recovered and precipitated with isopropanol. cDNA was A-tailed in a volume of 20 μl using 10 units terminal transferase (BRL), 200 μgM DATP for 10 min at 37° C., followed by 5 min at 65° C. The reaction was then diluted to 0.5 ml with TE pH 8 and stored at 4 °C. as the cDNA pool. cDNA clones were isolated by PCR amplification using the primers RoRIdT17, Ro and POTSBE24. The PCR was performed in 50 μL using a hot start technique: 10 μL of the cDNA pool was heated to 94° C. in water for 5 min with 25 pmol POTSBE24, 25 pmol Ro and 2.5 pmol of RoRIdT17 and cooled to 75° C. Five μL of 10×PCR buffer (Stratagene), 200 μM dNTPs and 1.25 units of Taq polymerase were added, the mixture heated at 45° C. for 2 min and 72° C. for 40 min followed by 35 cycles of 94° C. for 45 sec, 50° C. for 25 sec, 72° C. for 1.5 min and a final incubation at 72° C. for 10 min. PCR products were separated by electrophoresis on 1% low melting agarose gels and the smear covering the range 600-800 bp fragments was excised and used in a second PCR amplification with 25 pmol of RI and POTSBE25 primers in a 50 μL reaction (28 cycles of 94° C. for 1 min, 50° C. 1 min, 72° C. 2 min). Products were purified by chloroform extraction and cloned into pT7 Blue. PCR was used to screen the colonies and the longest clones were sequenced.
The first round of RACE only extended the length of the SBE sequence approximately 100 bases, therefore a new A-tailed cDNA library was constructed using the class A SBE specific oligo POTSBE24 (10 pmol) in an attempt to recover longer RACE products. The first and second round PCR reactions were performed using new class A SBE primers (POTSBE 28 and 29 respectively) derived from the new sequence data. Conditions were as before except that the elongation step in the first PCR was for 3 min and the second PCR consisted of 28 cycles at 94 ° C. for 45 seconds, 55 ° C. for 25 sec and 72 ° C. for 1 min 45 sec.
Clones ranging in size from 400 bp to 1.4 kb were isolated and sequenced. The combined sequence of the longest RACE products and cDNA clones predicted a full length gene of about 3150 nucleotides, excluding the poly(A) tail (psbe 2con.seq in FIG. 8).
As the sequence of the 5′ half of the gene was compiled from the sequence of several RACE products generated using Taq polymerase, it was possible that the compiled sequence did not represent that of a single rnRNA species and/or had nucleotide sequence changes. The 5′ 1600 bases of the gene was therefore re-isolated by PCR using Ultma, a thermostable DNA polymerase which, because it possesses a 3′-5′ exonuclease activity, has a lower error rate compared to Taq polymerase. Several PCR products were cloned and restriction mapped and found to differ in the number of Hind HII, Ssp I, and EcoR I sites. These differences do not represent PCR artefacts as they were observed in clones obtained from independent PCR reactions (data not shown) and indicate that there are several forms of the class A SBE gene transcribed in potato tubers.
In order to ensure that the sequence of the full length cDNA clone was derived from a single MnRNA species it was therefore necessary to PCR the entire gene in one piece. cDNA was prepared according to the RACE protocol except that the adaptor oligo RoRdT17 (5 pmol) was used as a primer and after synthesis the reaction was diluted to 200 μL with TE pH 8 and stored at 4° C. Two μL of the cDNA was used in a PCR reaction of 50 μL using 25 pmol of class A SBE specific primers PBER1 and PBERT (see below), and thirty cycles of 94° for 1 min, 60° C. for 1 min and 72° C. for 3 min. If Taq polymerase was used the PCR products were cloned into pT7Blue whereas if Ultma polymerase was used the PCR products were purified by chloroform extraction, ethanol precipitation and kinased in a volume of 20 μL (and then cloned into pBSSK IIP which had been cut with EcoRV and dephosphorylated). At least four classes of cDNA were isolated, which again differed in the presence or absence of Hind III, Ssp I and EcoR I sites. Three of these clones were sequenced fully, however one clone could not be isolated in sufficient quantity to sequence.
The sequence of one of the clones (number 19) is shown in FIG. 5. The first methionine (initiation) codon starts a short open reading frame (ORF) of 7 amino acids which is out of frame with the next predicted ORF of 882 amino acids which has a molecular mass (Mr) of approximately 100 Kd. Nucleotides 6-2996 correspond to SBE sequence—the rest of the sequence shown is vector derived. FIG. 6 shows a comparison of the most highly conserved part of the amino acid sequence of potato class A SBE (residues 180-871, top, row) and potato class B SBE (bottom row, residues 98-792); the middle row indicates the degree of similarity, identical residues being denoted by the common letter, conservative changes by two dots and neutral changes by a single dot. Dashes indicate gaps introduced to optimnise the alignment. The class A SBE protein has 44% identity over the entire length with potato class B SBE, and 56% identity therewith in the central conserved domain (FIG. 6), as judged by the “Megalign” program (DNASTAR). However, FIG. 7 shows a comparison between potato class A SBE (top row, residues 1-873) and pea class A SBE (bottom row, residues 1-861), from which it can be observed that cloned potato gene is more homologous to the class A pea enzyme, where the identity is 70% over nearly the entire length, and this increases to 83% over the central conserved region (starting at IPPP at position ˜170). It is clear from this analysis that this cloned potato SBE gene belongs to the class A family of SBE genes.
An E. coli culture, containing the plasmid pSJ78 (which directs the expression of a full length potato SBE Class A gene), has been deposited (on 3 Jan. 1996) under the terms of the Budapest Treaty at The National Collections of Industrial and Marine Bacteria Limited (23 St Machar Drive, Aberdeen, AB2 lRY, United Kingdom), under accession number NCIMB 40781. Plasmid pSJ78 is equivalent to clone 19 described above. It represents a full length SBE A cDNA blunt-end ligated into the vector pBSSKIIP.
Polymorphism of Class A SBE Genes
Sequence analysis of the other two full length class A SBE genes showed that they contain frameshift mutations and are therefore unable to encode full length proteins and indeed they were unable to complement the branching enzyme deficiency in the KV832 mutant (described below). An alignment of the full length DNA sequences is shown in FIG. 8: “10con.seq” (Seq ID No. 12), “19con.seq” (Seq ID No. 14) and “11 con.seq” (Seq ID No. 13) represent the sequence of full length clones 10, 19 and 11 obtained by PCR using the PBER1 and PBERT primers (see below), whilst “psbe2con.seq” (Seq ID No. 18) represents the consensus sequence of the RACE clones and cDNA clone 3.2.1. Those nucleotides which differ from the overall consensus sequence (not shown) are shaded. Dashes indicate gaps introduced to optimise the alignment. Apart from the frameshift mutations these clones are highly homologous. It should be noted that the 5′ sequence of psbe2con is longer because this is the longest RACE product and it also contains several changes compared to the other clones. The upstream methionine codon is still present in this clone but the upstream ORF is shortened to just 3 amino acids and in addition there is a 10 base deletion in the 5′ untranslated leader.
The other significant area of variation is in the carboxy terminal region of the protein coding region. Closer examination of this area reveals a GAA trinucleotide repeat structure which varies in length between the four clones. These are typical characteristics of a microsatellite repeat region. The most divergent clone is #11 which has only one GAA triplet whereas clone 19 has eleven perfect repeats and the other two clones have five and seven GAA repeats. All of these deletions maintain the ORF but change the number of glutamic acid residues at the carboxy terminus of the protein.
Most of the other differences between the clones are single base changes. It is quite possible that some of these are PCR errors. To address this question direct sequencing of PCR fragments amplified from first strand cDNA was performed. FIG. 9 shows the DNA sequence, and predicted amino acid sequence, obtained by such direct sequencing. Certain restriction sites are also marked. Nucleotides which could not be unambiguously assigned are indicated using standard IUPAC notation and, where this uncertainty affects the predicted amino acid sequence, a question mark is used. Sequence at the extreme 5′ and 3′ ends of the gene could not be determined because of the heterogeneity observed in the different cloned genes in these regions (see previous paragraph). However this can be taken as direct evidence that these differences are real and are not PCR or cloning artefacts.
There is absolutely no evidence for the frameshift mutations in the PCR derived sequence and it would appear that these mutations are an artefact of the cloning process, resulting from negative selection pressure in E. coli. This is supported by the fact that it proved extremely difficult to clone the full length PCR products intact as many large deletions were seen and the full length clones obtained were all cloned in one orientation (away from the LacZ promoter), perhaps suggesting that expression of the gene is toxic to the cells. Difficulties of this nature may have been responsible, at least in part, for the previous failure of other researchers to obtain the present invention.
A comparison of all the full length sequences is shown in FIG. 10. In addition to clones 10, 11 and 19 are shown the sequences of a Bgl II—Xho I product cloned directly into the QE32 expression vector (“86CON.SEQ”, Seq ID No. 16) and the consensus sequence of the directly sequenced PCR products (“pcrsbe2con.seq”, Seq ID No. 17). Those nucleotides which differ from the consensus sequence (not shown) are shaded. Dashes indicate gaps introduced to optimise the a lignment. There are 11 nucleotide differences predicted to be present in the MRNA population, which are indicated by asterisks above and below the sequence. The other differences are probably PCR artefacts or possibly sequencing errors.
Complementation of a Branching Enzyme Deficient E. coli Mutant
To determine if the isolated SBE gene encodes an active protein i.e. one that has branching enzyme activity, a complementation test was performed in the E. coli strain KV832. This strain is unable to make bacterial glycogen as the gene for the glycogen branching enzyme has been deleted (Keil et al., 1987 Mol. Gen. Genet. 207, 294-301). When wild type cells are grown in the presence of glucose they synthesise glycogen (a highly branched glucose polymer) which stains a brown colour with iodine, whereas the KV832 cells make only a linear chain glucose polymer which stains bluish green with iodine. To determine if the cloned SBE gene could restore the ability of the KV832 cells to make a branched polymer, the clone pSJ90 (Seq ID No. 19) was used and constructed as below. The construct is a PCR-derived, substantially full length fragment (made using primers PBE 2B and PBE 2X, detailed below), which was cut with Bgl II and Xho I and cloned into the BamH I/Sal I sites of the His-tag expression vector pQE32 (Qiagen). This clone, pSJ86, was sequenced and found to have a frameshift mutation of two bases in the 5′ half of the gene. This frameshift was removed by digestion with Nsi I and SnaB I and replaced with the corresponding fragment from a Taq-generated PCR clone to produce the plasmid pSJ90 (sequence shown in FIG. 12; the first 10 amino acids are derived from the expression vector). The polypeptide encoded by pSJ90 would be predicted to correspond to amino acids 46-882 of the full SBE coding sequence. The construct pSJ90 was transformed into the branching enzyme deficient KV832 cells and transformants were grown on solid PYG medium (0.85% KH2PO4, 1.1% K2HPO4, 0.6% yeast extract) containing 1.0% glucose. To test for complementation, a loop of cells was scraped off and resuspended in 150 μl of water, to which was added 15 μl Lugol's solution (2g KI and 1 g I2 per 300 ml water). It was found that the potato SBE fragment-transformed KV832 cells now stained a yellow-brown colour with iodine whereas control cells containing only the pQE32 vector continued to stain blue-green.
Expression of Potato Class A SBE in E. coli
Single colonies of KV832, containing one of the plasmids pQE32, pAGCR1 or pSJ90, were picked into 50 mil of 2×YT medium containing carbenicillin, kanamycin and streptomycin as appropriate (100, 50 and 25 mg/L, respectively) in a 250 ml flask and grown for 5 hours, with shaking, at 37° C. IPTG was then added to a fmal concentration of 1 mM to induce expression and the flasks were further incubated overnight at 25° C. The cells were harvested by centrifugation and resuspended in 50 mM sodium phosphate buffer (pH 8.0), containing 300 mM NaCl, 1 mg/ml lysozyme and 1 mM PMSF and left on ice for 1 hour. The cell lysates were then sonicated (3 pulses of 10 seconds at 40% power using a microprobe) and cleared by centrifugation at 12,000 g for 10 minutes at 4° C. Cleared lysates were concentrated approximately 10 fold in a Centricon™ 30 filtration unit. Duplicate 10 μl samples of the resulting extract were assayed for SBE activity by the phosphorylation stimulation method, as described in International Patent Application No. PCT/GB95/00634. In brief, the standard assay reaction mixture (0.2 ml) was 200 mM 2-(N-morpholino) ethanesulphonic acid (MES) buffer pH6.5, containing 100 nCi of 14C glucose-1-phosphate at 50 mM, 0.05 mg rabbit phosphorylase A, and E. coli lysate. The reaction mixture was incubated for 60 minutes at 30° C. and the reaction terminated and glucan polymer precipitated by the addition of 1 ml of 75% (v/v) methanol, 1% (w/v) potassium hydroxide, and then 0.1 ml glycogen (10 mg/ml). The results are presented below:
| Construct | SBE Activity (cpm) | |
| pQE32 (control) | 1,829 | |
| pSJ90 (potato class A SBE) | 14,327 | |
| pAGCR1 (pea class A SBE) | 29,707 | |
The potato class A SBE activity is 7-8 fold above background levels. It was concluded therefore that the potato class A SBE gene was able to complement the BE mutation in the phosphorylation stimulation assay and that the cloned gene does indeed code for a protein with branching enzyme activity.
Oligonucleotides
The following synthetic oligonucleotides (Seq ID No.s 1-11 respectively) were used:
| RORIdT17 | AAGGATCCGTCGACATCGATAATACGACTCACTATAGGGA | |
| (T)17 | ||
| RO | AAGGATCCGTCGACATC | |
| RI | GACATCGATAATACGAC | |
| POTSBE24 | CATCCAACCACCATCTCGCA | |
| POTSBE25 | TTGAGAGAAGATACCTAAGT | |
| POTSBE28 | ATGTTCAGTCCATCTAAAGT | |
| POTSBE29 | AGAACAACAATTCCTAGCTC | |
| PBER 1 | GGGGCCTTGAACTCAGCAAT | |
| PBERT | CGTCCCAGCATTCGACATAA | |
| PBE 2B | CTTGGATCCTTGAACTCAGCAATTTG | |
| PBE 2X | TAACTCGAGCAACGCGATCACAAGTTCGT |
Production of Transgenic Plants
Construction of Plant Transformation Vectors with Antisense Starch Branching Enzyme Genes
A 1200 bp Sac I-Xho I fragment, encoding approximately the —COOH half of the potato class A SBE (isolated from the rescued μZap clone 3.2.1), was cloned into the Sac 1-Sal 1 sites of the plant transformation vector pSJ29 to create plasnid pSJ64, which is illustrated schematically in FIG. 11. In the figure, the black line represents the DNA sequence. The broken line represents the bacterial plasmid backbone (containing the origin of replication and bacterial selection marker), which is not shown in full. The filled triangles on the line denote the T-DNA borders (RB=right border, LB=left border). Relevant restriction sites are shown above the black line, with the approximate distances (in kilobases) between the sites (marked by an asterisk) given by the numerals below the line. The thinnest arrows indicate polyadenylation signals (pAnos=nopaline synthase, pAg7=Agrobacterium gene 7), the arrows intermediate in thickness denote protein coding regions (SBE II=potato class A SBE, HYG=h ygromycin resistance gene) and the thickest arrows represent promoter regions (P-2×35=double CaMV 35S promoter, Pnos=nopaline synthase promoter). Thus pSJ64 contained the class A SBE gene fragment in an antisense orientation between the 2X 35S CaMV promoter and the nopaline synthase polyadenylation signal.
For information, pSJ29 is a derivative of the binary vector pGPTV-HYG (Becker et al., 1992 Plant Molecular Biology 20, 1195-1197) modified as follows: an approximately 750 bp (Sac I, T4 DNA polymerase blunted—Sal I) fragment of pJIT60 (Guerineau et al., 1992 Plant Mol. Biol. 18, 815-818) fr containing the duplicated cauliflower mosaic virus (CaMV) 35S promoter (Cabb-JI strain, equivalent to nucleotides 7040 to 7376 duplicated upstream of 7040 to 7433, Frank et al., 1980 Cell 21, 285-294) was cloned into the Hind III (Klenow polymerase repaired)—Sal I sites of pGPTV-HYG to create pSJ29.
Plant Transformation
Transformation was conducted on two types of potato plant explants; either wild type untransformed minitubers (in order to give single transformants containing the class A antisense construct alone) or minitubers from three tissue culture lines (which gave rise to plants #12, #15, #17 and #18 indicated in Table 1) which had already been successfully transformned with the class B (SBE I). antisense construct containing the tandem 35S promoter (so as to obtain double transformant plants, containing antisense sequences for both the class A and class B enzymes).
Details of the method of Agrobacterium transformation, and of the growth of transformed plants, are described in International Patent Application No. WO 95/26407, except that the medium used contained 3% sucrose (not 1%) until the final transfer and that the initial incubation with Agrobacterium (strain 3850) was performed in darkness. Transformants containing the class A antisense sequence were selected by growth in medium containing 15 mg/L hygromycin (the class A antisense construct comprising the HYG gene, i.e. hygromycin phosphotransferase).
Transformation was confirmed in all cases by production of a DNA fragment from the antisense gene after PCR in the p resence of appropriate primers and a crude extract of genomic DNA from each regenerated shoot.
Characterisation of Starch from Potato Plants
Starch was extracted from plants as follows: potato tubers were homogenised in water for 2 minutes in a Waring blender operating at high speed. The homogenate was washed and filtered (initially through 2 mm, then through 1 mm filters) using about 4 litres of water per 100 gms of tubers (6 extractions). Washed starch granules were finally extracted with acetone and air dried.
Starch extracted from singly transformed potato plants (class A/SBE II antisense, or class B/SBE I antisense), or from double transformants (class A/SBE II and class B/SBE I antisense), or from untransformed control plants, was partially characterised. The results are shown in Table 1. The table shows the amount of SBE activity (units/gram tissue) in tubers from each transformed plant. The endotherm peak temperature (° C.) of starch extracted from several plants was determined by DSC, and the onset temperature (° C.) of pasting was determined by reference to a viscoamylograph (“RVA”), as described in WO 95/26407. The viscoamylograph profile was as follows: step 1—50° C. for 2 minutes; step 2—increase in temperature from 50° C. to 95° C. at a rate of 1.5° C. per minute; step 3—holding at 95° C. for 15 minutes; step 4—cooling from 95° C. to 50° C. at a rate of 1.5° C. per minute; and finally, step 5—holding at 50° C. for 15 minutes. Table 1 shows the peak, pasting and set-back viscosities in stirring number units (SNUs), which is a measure of the amount of torque required to stir the suspensions. Peak viscosity may be defined for present purposes as the maximum viscosity attained during the heating phase (step 2) or the holding phase (step 3) of the viscoamylograph. Pasting viscosity may be defined as the viscosity attained by the starch suspensions at the end of the holding phase (step 3) of the viscoamylograph. Set-back viscosity may be defined as the viscosity of the starch suspension at the end of step 5 of the viscoamylograph.
A determination of apparent amylose content (% w/w) was also performed, using the iodometric assay method of Morrison & Laignelet (1983 J. Cereal Sci. 1, 9-20). The results (percentage apparent amylose) are shown in Table 1. The untransformed and transformed control plants gave rise to starches having apparent amylose contents in the range 29(+/−3)%.
Generally sirmilar values for amylose content were obtained for starch extracted from most of the singly transformed plants containing the class A (SBE II) antisense sequence. However, some plants (#152, 249) gave rise to starch having an apparent amylose content of 37-38%, notably higher than the control value. Starch extracted from these plants had markedly elevated pasting onset temperatures, and starch from plant 152 also exhibited an elevated endotherm peak temperature (starch from plant 249 was not tested by DSC).
It should be noted that, even if other single transformants were not to provide starch with an altered amylose/amylopectin ratio, the starch from such plants might still have different properties relative to starch from conventional plants (e.g. different average molecular weight or different amylopectin branching patterns), which might be useful.
Double transformant plants, containing antisense sequences for both the class A and class B enzymes, had greatly reduced SBE activity (units/gm) compared to untransformed plants or single anti-sense class A transformants, (as shown in Table 1). Moreover, certain of the double transformant plants contained starch having very significantly altered properties. For example, starch extracted from plants #201, 202, 208, 208a, 236 and 236a had drastically altered amylose/amylopectin ratios, to the extent that amylose was the main constituent of starch from these plants. The pasting onset temperatures of starch from these plants were also the most greatly increased (by about 25-30° C.). Starch from plants such as #150, 161, 212, 220 and 230a represented a range of intermediates, in that such starch displayed a more modest rise in both amylose content and pasting onset temperature. The results would tend to suggest that there is generally a correlation between % amylose content and pasting onset temperature, which is in agreement with the known behaviour of starches from other sources, notably maize.
The marked increase in amylose content obtained by inhibition of class A SBE alone, compared to inhibition of class B SBE alone (see PCT/GB95/00634) might suggest that it would be advantageous to transform plants first with a construct to suppress class A SBE expression (probably, in practice, an antisense construct), select those plants giving rise to starch with the most altered properties, and then to re-transform with a construct to suppress class B SBE expression (again, in practice, probably an antisense construct), so as to maximise the degree of starch modification.
In addition to pasting onset temperatures, other features of the viscoamylograph profile e.g. for starches from plants #149, 150, 152, 161, 201, 236 and 236a showed significant differences to starches from control plants, as illustrated in FIG. 13. Referring to FIG. 13, anumber of viscoamylograph traces are shown. The legend is as follows: shaded box—normal potato starch control (29.8% a mylose content); shaded circle—starch from plant 149 (35.6% amylose); shaded triangle, pointing upwards—plant 152 (37.5%); shaded triangle, pointing downwards—plant 161 (40.9%); shaded diamond—plant 150 (53.1%); unshaded box—plant 236a (56.7%); unshaded circle—plant 236 (60.4%); unshaded triangle, pointing upwards—plant 201 (66.4%); unshaded triangle, pointing downwards—HYLONO® starch, from maize (44.9% amylose). The thin line denotes the heating profile.
With increasing amylose content, peak viscosities during processing to 95° C. decrease, and the drop in viscosity from the peak until the end of the holding period at 95° C. also generally decreases (indeed, for some of the starch samples there is an increase in viscosity during this period). Both of these results are indicative of reduced granule fragmentation, and hence increased granule stability during pasting. This property has not previously been available in potato starch without extensive prior chemical or physical modification. For applications where a maximal viscosity after processing to 95° C. is desirable (i.e. corresponding to the viscosity after 47 minutes in the viscoamylograph test), starch from plant #152 would be selected as starches with both lower (Controls, #149) and higher (#161, #150) amylose contents have lower viscosities following this gelatinization and pasting regime (FIG. 13 and Table 1). It is believed that the viscosity at this stage is determined by a combination of the extent of granule swelling and the resistance of swollen granules to mechanical fragmentation. For any desired viscosity behaviour, one skilled in the art would select a potato starch from a range containing different amylose contents produced according to the invention by performing suitable standard viscosity tests.
Upon cooling pastes from 95° C. to 50° C., potato starches from most plants transformed in accordance with the invention showed an increase in viscoamylograph viscosity as expected for partial reassociation of amylose. Starches from plants #149, 152 and 161 all show viscosities at 50° C. significantly in excess of those for starches from control plants (FIG. 13 and Table 1). T his contrasts with the e ffect of elevated amylose contents in starches from maize plants (FIG. 2) which show very low viscosities throughout the viscoamylograph test. Of particular note is the fact that, for similar amylose contents, starch from potato plant 150 (53% amylose) shows markedly increased viscosity compared with HYLON® V starch (44.9% amylose) as illustrated in FIG. 13. This demonstrates that useful properties which require elevated (35% or greater) a mylose levels can be obtained by processing starches from potato plants below 100° C., whereas more energy-intensive processing is required in order to generate similarly useful properties from high amylose starches derived from maize plants.
Final viscosity in the viscoamylograph test (set-back viscosity after 92 minutes) is greatest for starch from plant #161 (40.9% amylose) amongst those tested (FIG. 13 and Table 1). Decreasing final viscosities are obtained for starches from plant #152 (37.5% amylose), #149 (35.6% amylose) and #150 (53.1% amylose). Set-back viscosity occurs where amylose molecules, exuded from the starch granule during pasting, start to re-associate outside the granule and form a viscous gel-like substance. It is believed that the set-back viscosity values of starches from transgenic potato plants represent a balance between the inherent amylose content of the starches and the ability of the amylose fraction to be exuded from the granule during pasting and therefore be available for the reassociation process which results in viscosity increase. For starches with low amylose content, increasing the amylose content tends to make more amylose available for re-association, thus increasing the set-back viscosity. However, above a threshold value, increased amylose content is thought to inhibit granule swelling, thus preventing exudation of amylose from the starch granule and reducing the amount of amylose available for re-association. This is supported by the RVA results obtained for the very high amylose content potato starches seen in the viscoamylograph profiles in FIG. 13. For any desired viscosity behaviour following set-back or retrogradation to any desired temperature over any desired timescale, one skilled in the art would select a potato starch from a range containing different amylose contents produced according to the invention by performing standard viscosity tests.
Further experiments with starch from plants #201 and 208 showed that this had an apparent amylose content of over 62% (see Table 1). Viscoamylograph studies showed that starch from these plants had radically altered properties and behaved in a manner similar to HYLON® V starch from maize plants (FIG. 13). Under the conditions employed in the viscoamylograph, this starch exhibited extremely limited (nearly undetectable) granule swelling. Thus, for example, unlike starch from control plants, starch from plants 201, 208 and 208a did not display a clearly defined pasting viscosity peak during the heating phase. Microscopic analysis confirmed that the starch granule structure underwent only minor swelling during the experimental heating process. This property may well be particularly useful in certain applications, as will be apparent to those skilled in the art.
Some re-grown plants have so far been found to increase still further the apparent amylose content of starch extracted therefrom. Such increases may be due to:
Accordingly, it should be possible to obtain potato plants giving rise to tubers with starch having an amylose content in excess of the 66% level so far attained, simply by analysing a greater number of transformed plants and/or by re-growing transgenic plants through one or more generations under field conditions.
Table 1 shows that another characteristic of starch which is affected by the presence of anti-sense sequences to SBE is the phosphorus content. Starch from untransformed control plants had a phosphorus content of about 60-70 mg/100 gram dry weight (as determined according to the AOAC Official Methods of Analysis, 15th Edition, Method 948.09 “Phosphorus in Flour”). Introduction into the plant of an anti-sense SBE B sequence was found to cause a modest increase (about two-fold) in phosphorus content, which is in agreement with the previous findings reported at scientific meetings. Similarly, anti-sense to SBE A alone causes only a small rise in phosphorus content relative to untransformed controls. However, use of anti-sense to both SBE A and B in combination results in up to a four-fold increase in phosphorus content, which is far greater than any in planta phosphorus content previously demonstrated for potato starch.
This is useful in that, for certain applications, starch must be phosphorylated in vitro by chemical modification. The ability to obtain potato starch which, as extracted from the plant, already has a high phosphorus content will reduce the amount of in vitro phosphorylation required suitably to modify the starch. Thus, in another aspect the invention provides potato starch which, as extracted from the plant, has a phosphorus content in excess of 200 mg/100 gram dry weight starch. Typically the starch will have a phosphorus content in the range 200-240 mg/100 gram dry weight starch.
1. Starch extracted from a potato plant and having an amylose content of at least 35%, as judged by the iodometric assay method of Morrison & Laignelet (1983 J. Cereal Science 1, 9-20).
2-16. (canceled)
17. Starch which as extracted from a potato plant, has a phosphorus content in excess of 2000 mg/100 grams dry weight starch.
16-26. (canceled)
27. A nucleotide sequence encoding an effective portion of a class A starch branching enzyme (SBE) obtainable from potato plants.
28-68. (canceled)