US20060257426A1
2006-11-16
11/403,316
2006-04-13
The present invention provides methods and compositions for the stimulation of immune responses. Specifically, the present invention provides methods and compositions for the use of nanoemulsion compounds as mucosal adjuvants to induce immunity against environmental pathogens. Accordingly, in some embodiments, the present invention provides nanoemulsion vaccines comprising a nanoemulsion and an inactivated pathogen or protein derived from the pathogen. The present invention thus provides improved vaccines against a variety of environmental and human-released pathogens.
Get notified when new applications in this technology area are published.
A61K39/39 » CPC main
Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
A01N25/04 » CPC further
Biocides, pest repellants or attractants, or plant growth regulators, characterised by their forms, or by their non-active ingredients or by their methods of application, e.g. seed treatment or sequential application ; Substances for reducing the noxious effect of the active ingredients to organisms other than pests containing liquids as carriers, diluents or solvents Dispersions, emulsions, suspoemulsions, suspension concentrates or gels
A61K9/0043 » CPC further
Medicinal preparations characterised by special physical form; Galenical forms characterised by the site of application Nose
A61K9/1075 » CPC further
Medicinal preparations characterised by special physical form; Dispersions; Emulsions; Emulsions ; Emulsion preconcentrates; Micelles Microemulsions or submicron emulsions; Preconcentrates or solids thereof; Micelles, e.g. made of phospholipids or block copolymers
A61P31/00 » CPC further
Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
A61P31/04 » CPC further
Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics Antibacterial agents
A61P31/10 » CPC further
Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics Antimycotics
A61P31/12 » CPC further
Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics Antivirals
A61P31/16 » CPC further
Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics; Antivirals for RNA viruses for influenza or rhinoviruses
A61P31/18 » CPC further
Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics; Antivirals for RNA viruses for HIV
A61P37/00 » CPC further
Drugs for immunological or allergic disorders
A61P37/04 » CPC further
Drugs for immunological or allergic disorders; Immunomodulators Immunostimulants
A61K2039/521 » CPC further
Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA; Bacterial cells; Fungal cells; Protozoal cells inactivated (killed)
A61K2039/55566 » CPC further
Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant; Organic adjuvants Emulsions, e.g. Freund's adjuvant, MF59
C12N2760/16134 » CPC further
ssRNA viruses negative-sense; Details; Orthomyxoviridae; Influenzavirus A, i.e. influenza A virus Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Y02A50/30 » CPC further
in human health protection, e.g. against extreme weather Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
A61K39/12 IPC
Medicinal preparations containing antigens or antibodies Viral antigens
A61K39/21 IPC
Medicinal preparations containing antigens or antibodies; Viral antigens Retroviridae, e.g. equine infectious anemia virus
A61K39/275 IPC
Medicinal preparations containing antigens or antibodies; Viral antigens Poxviridae, e.g. avipoxvirus
A61K39/07 » CPC further
Medicinal preparations containing antigens or antibodies; Bacterial antigens Bacillus
This application is a continuation-in-part of U.S. patent application Ser. No. 10/162,970, filed Jun. 5, 2002, which claims priority to U.S. Provisional Patent App. No. 60/296,048, filed Jun. 5, 2001.
This work was supported, in part, by Defense Advanced Research Project Agency contract #MDA 972-97-1-0007; and NIH contract # U54 AI57153-02. The government may have certain rights in this invention.
FIELD OF THE INVENTIONThe present invention provides methods and compositions for the stimulation of immune responses. Specifically, the present invention provides methods and compositions for the use of nanoemulsion compounds as mucosal adjuvants to induce immunity against environmental pathogens.
BACKGROUNDImmunization is a principal feature for improving the health of people. Despite the availability of a variety of successful vaccines against many common illnesses, infectious diseases remain a leading cause of health problems and death. Significant problems inherent in existing vaccines include the need for repeated immunizations, and the ineffectiveness of the current vaccine delivery systems for a broad spectrum of diseases.
In order to develop vaccines against pathogens that have been recalcitrant to vaccine development, and/or to overcome the failings of commercially available vaccines due to expense, complexity, and underutilization, new methods of antigen presentation must be developed which will allow for fewer immunizations, more efficient usage, and/or fewer side effects to the vaccine.
SUMMARY OF THE INVENTIONThe present invention provides methods and compositions for the stimulation of immune responses. Specifically, the present invention provides methods and compositions for the use of nanoemulsion compounds as mucosal adjuvants to induce immunity against environmental pathogens.
Accordingly, in some embodiments, the present invention provides a composition comprising a vaccine, the vaccine comprising an emulsion and an immunogen, the emulsion comprising an aqueous phase, an oil phase, and a solvent. In some embodiment, the immunogen comprises a pathogen (e.g., an inactivated pathogen). In other embodiments, the immunogen comprises a pathogen product (e.g., including, but not limited to, a protein, peptide, polypeptide, nucleic acid, polysaccharide, or a membrane component derived from the pathogen). In some embodiments, the immunogen and the emulsion are combined in a single vessel.
In some embodiments, the present invention provides a method of inducing an immune response to an immunogen, comprising providing a nanoemulsion; and an immunogen; combining the nanoemulsion with the immunogen; and administering the combined nanoemulsion and immunogen to a subject under conditions such that the subject produces an immune response to the immunogen.
In some embodiments, inducing an immune response induces immunity to the immunogen in the subject. In some embodiments, inducing immunity to the immunogen induces immunity to a pathogen from which the immunogen is derived. In some embodiments, immunity comprises systemic immunity. In some embodiments, immunity comprises mucosal immunity. In some embodiments, the immune response comprises increased expression of IFN-γ in the subject. In some embodiments, the immune response comprises a systemic IgG response to the immunogen. In some embodiments, the immune response comprises a mucosal IgA response to the immunogen. In some embodiments, the composition comprises between 15 and 75 μg of a recombinant immunogen. The present invention is not limited to this amount of immunogen. Indeed, a variety of doses of immunogen are contemplated to be useful in the present invention. For example, in some embodiments, it is expected that each dose (e.g., of a composition comprising a NE and an immunogen (e.g., administered to a subject to induce an immune response (e.g., a protective immune response (e.g., protective immunity))) comprises 0.05-5000 μg of each immunogen (e.g., recombinant and/or purified protein), in some embodiments, each dose will comprise 1-500 μg, in some embodiments, each dose will comprise 350-750 μg, in some embodiments, each dose will comprise 50-200 μg, in some embodiments, each dose will comprise 25-75 μg of immunogen (e.g., recombinant and/or purifed protein). In some embodiments, each dose comprises an amount of the immunogen sufficient to generate an immune response. An effective amount of the immunogen in a dose need not be quantified, as long as the amount of immunogen generates an immune response in a subject when administered to the subject. In some embodiments, when a nanoemulsion of the present invention is utilized to inactivate a live microorganism (e.g., virus (e.g., HIV)), it is expected that each dose (e.g., administered to a subject to induce and immune response)) comprises between 10 and 109 pfu of the virus per dose; in some embodiments, each dose comprises between 105 and 108 pfu of the virus per dose; in some embodiments, each dose comprises between 103 and 105 pfu of the virus per dose; in some embodiments, each dose comprises between 102 and 104 pfu of the virus per dose; in some embodiments, each dose comprises 10 pfu of the virus per dose; in some embodiments, each dose comprises 102 pfu of the virus per dose; and in some embodiments, each dose comprises 104 pfu of the virus per dose. In some embodiments, each dose comprises more than 109 pfu of the virus per dose. In some preferred embodiments, each dose comprises 103 pfu of the virus per dose. In some embodiments, when a NE of the present invention is utilized to inactivate a live microorganism (e.g., a population of bacteria (e.g., of the genus Bacillus (B. anthracis))), it is expected that each dose (e.g., administered to a subject to induce and immune response)) comprises between 10 and 1010 bacteria per dose; in some embodiments, each dose comprises between 105 and 108 bacteria per dose; in some embodiments, each dose comprises between 103 and 105 bacteria per dose; in some embodiments, each dose comprises between 102 and 104 bacteria per dose; in some embodiments, each dose comprises 10 bacteria per dose; in some embodiments, each dose comprises 102 bacteria per dose; and in some embodiments, each dose comprises 104 bacteria per dose. In some embodiments, each dose comprises more than 1010 bacteria per dose. In some embodiments, each dose comprises 103 bacteria per dose. In some embodiments, the recombinant immunogen is gp120 from HIV or protective antigen from B. anthracis. However, the present invention is not limited to any particular immunogen. For example, multiple immunogens may be used in the present invention including, but not limited to, gp160, gp41, Tat, Nef, lethal factor, edema factor, and protective antigen degradation products. In some embodiments, the composition comprises a 10% nanoemulsion solution. However, the present invention is not limited to this amount of nanoemulsion solution. Indeed, a variety of amounts of nanoemulsion may be utilized including those disclosed herein. In some embodiments, immunity protects the subject from displaying signs or symptoms of disease caused by a bacterial or viral pathogen. The present invention is not limited by the type of disease from which a subject is protected. Indeed, a subject can be protected from a variety of diseases including, but not limited to, AIDS, smallpox and anthrax. In some embodiments, immunity protects the subject from challenge with a subsequent exposure to live pathogen (e.g., HIV, vaccinia virus, B. anthracis, etc.). In some embodiments, the composition further comprises an adjuvant. The present invention is not limited by the type of adjuvant used. Indeed, a variety of adjuvants may be used in a composition of the present invention including, but not limited to a CpG oligonucleotide, monophosphoryl lipid A, and other adjuvants disclosed herein. In some embodiments, the subject is a human.
The present invention is not limited to a particular oil. A variety of oils are contemplated, including, but not limited to, soybean, avocado, squalene, olive, canola, corn, rapeseed, safflower, sunflower, fish, flavor, and water insoluble vitamins. The present invention is also not limited to a particular solvent. A variety of solvents are contemplated including, but not limited to, an alcohol (e.g., including, but not limited to, methanol, ethanol, propanol, and octanol), glycerol, polyethylene glycol, and an organic phosphate based solvent.
In some embodiments, the emulsion further comprises a surfactant. The present invention is not limited to a particular surfactant. A variety of surfactants are contemplated including, but not limited to, nonionic and ionic surfactants (e.g., TRITON X-100; TWEEN 20; and TYLOXAPOL).
In certain embodiments, the emulsion further comprises a cationic halogen containing compound. The present invention is not limited to a particular cationic halogen containing compound. A variety of cationic halogen containing compounds are contemplated including, but not limited to, cetylpyridinium halides, cetyltrimethylammonium halides, cetyldimethylethylammonium halides, cetyldimethylbenzylammonium halides, cetyltributylphosphonium halides, dodecyltrimethylammonium halides, and tetradecyltrimethylammonium halides. The present invention is also not limited to a particular halide. A variety of halides are contemplated including, but not limited to, halide selected from the group consisting of chloride, fluoride, bromide, and iodide.
In still further embodiments, the emulsion further comprises a quaternary ammonium containing compound. The present invention is not limited to a particular quaternary ammonium containing compound. A variety of quaternary ammonium containing compounds are contemplated including, but not limited to, Alkyl dimethyl benzyl ammonium chloride, dialkyl dimethyl ammonium chloride, n-Alkyl dimethyl benzyl ammonium chloride, n-Alkyl dimethyl ethylbenzyl ammonium chloride, Dialkyl dimethyl ammonium chloride, and n-Alkyl dimethyl benzyl ammonium chloride.
In certain embodiments, the immunogen is selected from the group consisting of virus, bacteria, fungus and pathogen products derived from the virus, bacteria, or fungus. The present invention is not limited to a particular virus. A variety of viral immunogens are contemplated including, but not limited to, influenza A virus, avian influenza virus, H5N1 influenza virus, West Nile virus, SARS virus, Marburg virus, Arenaviruses, Nipah virus, alphaviruses, filoviruses, herpes simplex virus I, herpes simplex virus II, sendai virus, sindbis virus, vaccinia virus, parvovirus, human immunodeficiency virus, hepatitis B virus, hepatitis C virus, hepatitis A virus, cytomegalovirus, human papilloma virus, picornavirus, hantavirus, junin virus, and ebola virus. The present invention is not limited to a particular bacteria. A variety of bacterial immunogens are contemplated including, but not limited to, Bacillus cereus, Bacillus circulans and Bacillus megaterium, Bacillus anthracis, bacterial of the genus Brucella, Vibrio cholera, Coxiella burnetii, Francisella tularensis, Chlamydia psittaci, Ricinus communis, Rickettsia prowazekii, bacteria of the genus Salmonella, Cryptosporidium parvum, Burkholderia pseudomallei, Clostridium perfringens, Clostridium botulinum, Vibrio cholerae, Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus pneumonia, Staphylococcus aureus, Neisseria gonorrhea, Haemophilus influenzae, Escherichia coli, Salmonella typhimurium, Shigella dysenteriae, Proteus mirabilis, Pseudomonas aeruginosa, Yersinia pestis, Yersinia enterocolitica, and Yersinia pseudotuberculosis. The present invention is also not limited to a particular fungus. A variety of fungal immunogens are contemplated including, but not limited to, Candida and Aspergillus.
The present invention further provides a kit comprising a vaccine, the vaccine comprising an emulsion and an immunogen, the emulsion comprising an aqueous phase, an oil phase, and a solvent. In some embodiments, the kit further comprises instructions for using the kit for vaccinating a subject against the immunogen.
In some embodiment, the immunogen comprises a pathogen (e.g., an inactivated pathogen). In other embodiments, the immunogen comprises a pathogen product (e.g., including, but not limited to, a protein, peptide, polypeptide, nucleic acid, polysaccharide, or membrane component derived from the pathogen). In some embodiments, the immunogen and the emulsion are combined in a single vessel.
The present invention is not limited to a particular oil. A variety of oils are contemplated, including, but not limited to, soybean, avocado, squalene, olive, canola, corn, rapeseed, safflower, sunflower, fish, flavor, and water insoluble vitamins. The present invention is also not limited to a particular solvent. A variety of solvents are contemplated including, but not limited to, an alcohol (e.g., including, but not limited to, methanol, ethanol, propanol, and octanol), glycerol, polyethylene glycol, and an organic phosphate based solvent.
In some embodiments, the emulsion further comprises a surfactant. The present invention is not limited to a particular surfactant. A variety of surfactants are contemplated including, but not limited to, nonionic and ionic surfactants (e.g., TRITON X-100; TWEEN 20; and TYLOXAPOL).
In certain embodiments, the emulsion further comprises a cationic halogen containing compound. The present invention is not limited to a particular cationic halogen containing compound. A variety of cationic halogen containing compounds are contemplated including, but not limited to, cetylpyridinium halides, cetyltrimethylammonium halides, cetyldimethylethylammonium halides, cetyldimethylbenzylammonium halides, cetyltributylphosphonium halides, dodecyltrimethylammonium halides, and tetradecyltrimethylammonium halides. The present invention is also not limited to a particular halide. A variety of halides are contemplated including, but not limited to, halide selected from the group consisting of chloride, fluoride, bromide, and iodide.
In still further embodiments, the emulsion further comprises a quaternary ammonium containing compound. The present invention is not limited to a particular quaternary ammonium containing compound. A variety of quaternary ammonium containing compounds are contemplated including, but not limited to, Alkyl dimethyl benzyl ammonium chloride, dialkyl dimethyl ammonium chloride, n-Alkyl dimethyl benzyl ammonium chloride, n-Alkyl dimethyl ethylbenzyl ammonium chloride, Dialkyl dimethyl ammonium chloride, and n-Alkyl dimethyl benzyl ammonium chloride.
In certain embodiments, the immunogen is selected from the group consisting of virus, bacteria, fungus and pathogen products derived from the virus, bacteria, or fungus. The present invention is not limited to a particular virus. A variety of viral immunogens are contemplated including, but not limited to, influenza A, herpes simplex virus I, herpes simplex virus II, sendai, sindbis, vaccinia, parvo, human immunodeficiency virus, hepatitis B, virus hepatitis C virus, hepatitis A virus, cytomegalovirus, and human papilloma virus, picornavirus, hantavirus, junin virus, and ebola virus. The present invention is not limited to a particular bacteria. A variety of bacterial immunogens are contemplated including, but not limited to, Bacillus cereus, Bacillus circulans and Bacillus megaterium, Bacillus anthracis, Clostridium perfringens, Vibrio cholerae, Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus pneumonia, Staphylococcus aureus, Neisseria gonorrhoeae, Haemophilus influenzae, Escherichia coli, Salmonella typhimurium, Shigella dysenteriae, Proteus mirabilis, Pseudomonas aeruginosa, Yersinia enterocolitica, and Yersinia pseudotuberculosis. The present invention is also not limited to a particular fungus. A variety of fungal immunogens are contemplated including, but not limited to, Candida and Aspergillus.
In still further embodiments, the present invention provides a method of inducing immunity to an immunogen, comprising providing an emulsion comprising an aqueous phase, an oil phase, and a solvent; and an immunogen; combining the emulsion with the immunogen to generate a vaccine composition; and administering the vaccine composition to a subject. In some embodiments, administering comprises contacting the vaccine composition with a mucosal surface of the subject. For example, in some embodiments, administering comprises intranasal administration. In some preferred embodiments, the administering in under conditions such that the subject is immune to the immunogen.
In some embodiment, the immunogen comprises a pathogen (e.g., an inactivated pathogen). In other embodiments, the immunogen comprises a pathogen product (e.g., including, but not limited to, a protein, peptide, polypeptide, nucleic acid, polysaccharide, or membrane component derived from the pathogen). In some embodiments, the immunogen and the emulsion are combined in a single vessel.
The present invention is not limited to a particular oil. A variety of oils are contemplated, including, but not limited to, soybean, avocado, squalene, olive, canola, corn, rapeseed, safflower, sunflower, fish, flavor, and water insoluble vitamins. The present invention is also not limited to a particular solvent. A variety of solvents are contemplated including, but not limited to, an alcohol (e.g., including, but not limited to, methanol, ethanol, propanol, and octanol), glycerol, polyethylene glycol, and an organic phosphate based solvent.
In some embodiments, the emulsion further comprises a surfactant. The present invention is not limited to a particular surfactant. A variety of surfactants are contemplated including, but not limited to, nonionic and ionic surfactants (e.g., TRITON X-100; TWEEN 20; and TYLOXAPOL).
In certain embodiments, the emulsion further comprises a cationic halogen containing compound. The present invention is not limited to a particular cationic halogen containing compound. A variety of cationic halogen containing compounds are contemplated including, but not limited to, cetylpyridinium halides, cetyltrimethylammonium halides, cetyldimethylethylammonium halides, cetyldimethylbenzylammonium halides, cetyltributylphosphonium halides, dodecyltrimethylammonium halides, and tetradecyltrimethylammonium halides. The present invention is also not limited to a particular halide. A variety of halides are contemplated including, but not limited to, halide selected from the group consisting of chloride, fluoride, bromide, and iodide.
In still further embodiments, the emulsion further comprises a quaternary ammonium containing compound. The present invention is not limited to a particular quaternary ammonium containing compound. A variety of quaternary ammonium containing compounds are contemplated including, but not limited to, Alkyl dimethyl benzyl ammonium chloride, dialkyl dimethyl ammonium chloride, n-Alkyl dimethyl benzyl ammonium chloride, n-Alkyl dimethyl ethylbenzyl ammonium chloride, Dialkyl dimethyl ammonium chloride, and n-Alkyl dimethyl benzyl ammonium chloride.
In certain embodiments, the immunogen is selected from the group consisting of virus, bacteria, fungus and pathogen products derived from the virus, bacteria, or fungus. The present invention is not limited to a particular virus. A variety of viral immunogens are contemplated including, but not limited to, influenza A, herpes simplex virus I, herpes simplex virus II, sendai, sindbis, vaccinia, parvo, human immunodeficiency virus, hepatitis B, virus hepatitis C virus, hepatitis A virus, cytomegalovirus, and human papilloma virus, picornavirus, hantavirus, junin virus, and ebola virus. The present invention is not limited to a particular bacteria. A variety of bacterial immunogens are contemplated including, but not limited to, Bacillus cereus, Bacillus circulans and Bacillus megaterium, Bacillus anthracis, Clostridium perfringens, Vibrio cholerae, Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus pneumonia, Staphylococcus aureus, Neisseria gonorrhoeae, Haemophilus influenzae, Escherichia coli, Salmonella typhimurium, Shigella dysenteriae, Proteus mirabilis, Pseudomonas aeruginosa, Yersinia enterocolitica, and Yersinia pseudotuberculosis. The present invention is also not limited to a particular fungus. A variety of fungal immunogens are contemplated including, but not limited to, Candida and Aspergillus.
In some embodiments, the present invention provides a method of inducing an immune response to an immunogen in a subject comprising providing a composition comprising a nanoemulsion and an immunogen (e.g., a pathogen inactivated by a nanoemulsion of the present invention, and/or a protein or peptide antigen derived from a pathogen); and administering the composition to the subject under conditions such that the subject generates an immune response to the immunogen. The present invention is not limited by the immunogen utilized. For example, in some embodiments, the immunogen is a pathogen inactivated by a nanoemulsion of the present invention or is an isolated, purified or recombinant protein or peptide antigen, or derivative or variant thereof, derived from the pathogen (e.g., vaccinia virus inactivated by a nanoemulsion, or, a protein antigen (e.g., including, but not limited to, protective antigen (PA), lethal factor (LF), edema factor (EF), and PA degradation products from B anthracis or gp160, gp120, gp41, Tat or Nef from HIV). The present invention is not limited by the nature of the immune response generated. Indeed, a variety of immune responses may be generated and measured in a subject administered a composition comprising a nanoemulsion and an immunogen of the present invention including, but not limited to, activation, proliferation or differentiation of cells of the immune system (e.g., B cells, T cells, dendritic cells, antigen presenting cells (APCs), macrophages, natural killer (NK) cells, etc.); up-regulated or down-regulated expression of markers and cytokines; stimulation of IgA, IgM, or IgG titer; splenomegaly (e.g., increased spleen cellularity); hyperplasia, mixed cellular infiltrates in various organs, and other responses (e.g., of cells) of the immune system that can be assessed with respect to immune stimulation known in the art. In some embodiments, administering comprises contacting a mucosal surface of the subject with the composition. The present invention is not limited by the mucosal surface contacted. In some preferred embodiments, the mucosal surface comprises nasal mucosa. In some embodiments, the mucosal surface comprises vaginal mucosa. In some embodiments, administrating comprises parenteral administration. The present invention is not limited by the route chosen for administration of a composition of the present invention. In some embodiments, inducing an immune response induces immunity to the pathogen (e.g., B. anthracis, vaccinia virus and/or HIV) in the subject. In some embodiments, the immunity comprises systemic immunity. In some embodiments, the immunity comprises mucosal immunity. In some embodiments, the immune response comprises increased expression of IFN-γ in the subject. In some embodiments, the immune response comprises a systemic IgG response. In some embodiments, the immune response comprises a mucosal IgA response. In some embodiments, the composition comprises between 1 and 300 μg of protein antigen (e.g., derived from or a recombinant form) from the pathogen. However, the present invention is not limited to this amount of protein antigen administered. For example, in some embodiments, more than 300 μg of protein antigen is present in a dose administered to the subject. In some embodiments, less than 1 μg of protein antigen is present in a dose administered to a subject. In some embodiments, the a pathogen (e.g., a virus) inactivated by the nanoemulsion is administered to the subject under conditions such that between 10 and 103 pfu of the inactivated pathogen is present in a dose administered to the subject. However, the present invention is not limited to this amount of pathogen administered. For example, in some embodiments, more than 103 pfu of the inactivated pathogen (e.g., 104 pfu, 105 pfu, or more) is present in a dose administered to the subject. In some embodiments, the composition comprises a 10% nanoemulsion solution. However, the present invention is not limited to this amount (e.g., percentage) of nanoemusion. For example, in some embodiments, a composition comprises less than 10% nanoemulsion. In some embodiments, a composition comprises more than 10% nanoemulsion. In some embodiments, a composition of the present invention comprises any of the nanoemulsions described herein. In some embodiments, the nanoemulsion comprises W205EC. In some embodiments, the nanoemulsion is X8P. In some embodiments, immunity protects the subject from displaying signs or symptoms of disease caused by the pathogen (e.g., vaccinia virus, B. anthracis or HIV). In some embodiments, immunity protects the subject from challenge with a subsequent exposure to live pathogen. In some embodiments, the composition further comprises an adjuvant. The present invention is not limited by the type of adjuvant utilized. In some embodiments, the adjuvant is a CpG oligonucleotide. In some embodiments, the adjuvant is monophosphoryl lipid A. A number of other adjuvants that find use in the present invention are described herein. In some embodiments, the subject is a human. In some embodiments, the immunity protects the subject from displaying signs or symptoms of a disease (e.g., the flu, AIDS, anthrax, smallpox, etc.). In some embodiments, immunity reduces the risk of infection upon one or more exposures to a pathogen.
The present invention also provides a composition for stimulating an immune response comprising a nanoemulsion and an immunogen (e.g., recombinant gp120), wherein the composition is configured to induce immunity to the pathogen from which the immunogen is derived in a subject. In some embodiments, the nanoemulsion comprises any nanoemulsion described herein. In some embodiments, the nanoemulsion comprises W205EC. In some embodiments, the nanoemulsion comprises X8P. In some embodiments, the composition provides a subject between 1 and 500 μg of immunogen (e.g., recombinant immunogen (e.g., gp120)) when administered to the subject. In some embodiments, a dose of the composition administered to a subject comprises between a 0.1% and 20% nanoemulsion solution. In some embodiments, a dose of the composition administered to a subject comprises a 1% nanoemulsion solution. In some embodiments, the immunogen is heat stable in the nanoemulsion. In some embodiments, the composition is diluted prior to administration to a subject. In some embodiments, the subject is a human. In some embodiments, immunity is systemic immunity. In some embodiments, immunity is mucosal immunity. In some embodiments, the composition further comprises an adjuvant. In some embodiments, the adjuvant comprises a CpG oligonucleotide. In some embodiments, the adjuvant comprises monophosphoryl lipid A.
The present invention also provides a kit comprising a composition for stimulating an immune response comprising a nanoemulsion and an immunogen (e.g., recombinant gp120 or protective antigen or pathogen inactivated by a nanoemulsion), wherein the composition is configured to induce immunity to a pathogen in a subject, and instructions for administering the composition. In some embodiments, the kit comprises a nanoemulsion in contact with an object (e.g., an applicator). In some embodiments, the kit comprises a device for administering the composition. The present invention is not limited by the type of device included in the kit for administering the composition. Indeed, many different devices may be included in the kit including, but not limited to, a nasal applicator, a syringe, a nasal inhaler and a nasal mister. In some embodiments, the kit comprises a vaginal applicator, vaginal mister or other type of device for vaginal administration (e.g., to the vaginal mucosa) of a composition of the present invention. In some embodiments, a kit comprises a birth control device (e.g., a condom, an IUD, sponge, etc.) coated with a nanoemulsion composition of the present invention. In some embodiments, a nanoemulsion composition of the present invention is mixed in a douche or a suppository or a lubricant (e.g., sexual lubricant). In some embodiments, the present invention provides systems and methods (e.g., using a nanoemulsion composition of the present invention) for large scale administration (e.g., to a population of a city, village, town, state or country). In preferred embodiments, such large scale administrations are carried out in a manner that is easy to use (e.g., nasal administration) and that is culturally sensitive (e.g., so as not to offend those being administered a composition of the present invention).
DESCRIPTION OF THE FIGURESThe following figures form part of the present specification and are included to further demonstrate certain aspects and embodiments of the present invention. The invention may be better understood by reference to one or more of these figures in combination with the description of specific embodiments presented herein.
FIG. 1 illustrates the antibacterial properties of 1% and 10% X8P. The bactericidal effect (% killing) was calculated as:
cfu(initial)−cfu(post-treatment)/cfu(initial)×100
FIG. 2 illustrates the antiviral properties of 10% and 1% X8P as assessed by plaque reduction assays.
FIG. 3 illustrates several particular embodiments of the various pathogens of the present invention.
FIG. 4 illustrates several particular embodiments of the various emulsion compositions of the invention.
FIG. 5 schematically depicts various generalized formulations and uses of certain embodiments of the present invention.
FIG. 6 shows serum IgG titers two weeks after a single intranasal treatment with certain exemplary nanoemulsion vaccines of the present invention.
FIG. 7 shows bronchial IgA influenza titers in mice administered two intranasal doses of certain exemplary nanoemulsion vaccines of the present invention.
FIG. 8 shows serum IgG influenza titers in mice administered two intranasal doses of certain exemplary nanoemulsion vaccines of the present invention.
FIG. 9 shows the log redution of pathogens by nanoemulsions of the present invention. FIG. 9A shows the log reduction of E. coli by various emulsions. FIG. 9B shows the log reduction of B. globigii by various emulsions. FIG. 9C shows the log reduction of influenza A by various emulsions.
FIG. 10A shows the virucidal activity of 2% nanoemulsion on different concentrations of influenza A/AA virus. FIG. 10B shows the time dependent virucidal activity of nanoemulsions during incubation with influenza A/AA strain. FIG. 10C shows the detection of viral RNA template during incubation of virus with nanoemulsion. Compared with plaque reduction assay (FIG. 10B) RT-PCR of viral RNA from virus/nanoemulsion formulation showed full correlation in a time-dependant manner. Viral RNA was still present at 2 h, and was not detectable after 3 h of incubation.
FIG. 11 shows the core body temperature of animals vaccinated with different vaccines and 20 days later challenged with lethal dose of influenza A Ann Arbor strain virus. *—N=3; two animals died before day 5.
FIG. 12 shows survival curves of animals treated with different vaccines intranasally and challenged with lethal dose of influenza A Ann Arbor strain virus.
FIG. 13 shows that intranasal treatment of animals with virus/nanoemulsion mixture induced high levels of anti-influenza A, Ann Arbor strain IgG antibodies in serum. *—p<0.05 (nanoemulsion alone vs. virus/nanoemulsion, day 20); **—p<0.01 (virus/nanoemulsion, day 20 vs. day 35).
FIG. 14 shows the detection of influenza A virus RNA in virus/emulsion vaccinated animals. RT-PCR showed the presence of viral template until day 6 after treatment which was not detectable on day 7 and thereafter (FIG. 14a). Signal generated from total lung RNA during the first 6 days after treatment was equal to 1 and not greater than 10 pfu of virus (FIG. 14b).
FIG. 15 shows early cytokine responses in splenocytes and serum of mice 72 hours after treatment with influenza A 100 pfu/mouse, formalin-killed virus 5×105 pfu, virus (5×105 pfu)/2% nanoemulsion mixture, nanoemulsion alone. FIG. 15A shows IFN-γ levels. FIG. 15B shows TNF-α levels. FIG. 15C shows IL-12 p40 levels. FIG. 15D shows IL-4 levels. FIG. 15E shows IL-2 levels. FIG. 15F shows IL-10 levels. FIG. 15G shows IFN-γ levels on day 20 after treatment.
FIG. 16 shows stimulation indices of splenocytes harvested on day 20 and 35 of experiment from mice treated with virus/nanoemulsion.
FIG. 17 shows antigen-specific activation of cytokine production by splenocytes harvested from mice after treatment with virus/nanoemulsion preparation. Splenocytes were harvested from animals on two occasions: on day 20 (before challenge) and day 35 (after challenge) of experiment. FIG. 17A shows IFN-γ levels. FIG. 17bB shows IK-2 levels. FIG. 17C shows IL-4 levels.
FIG. 18 shows the percentage of T (CD3 positive cells) and cytotoxic cells (CD8 positive cells) in splenocytes. Percentage was calculated as follows: T-cells (%)=(CD3 cells/(CD3+CD19 cells))*100; CD8 cells (%)=(CD8 cells/(CD8+CD4 cells))*100. p-value described the significance between the percentage of T-cells before and after the challenge.
FIG. 19 shows survival curves of animals treated with different preparations intranasally and challenged with lethal dose of influenza A virus either Ann Arbor or Puerto Rico strain.
FIG. 20 shows the expansion of the influenza epitope recognition of immunized mice before (FIG. 20A) and after (FIG. 20B) challenge with live virus.
FIG. 21 shows that administration of X8P nanoemulsion with gp120 resulted in an increased immune response when the gp120 was administered intranasally.
FIG. 22 shows that administration of X8P nanoemulsion with gp120 resulted in an increased immune response when the gp120 was administered intramuscularly.
FIG. 23 shows development of anti-VV IgG responses after intranasal vaccination with nanoemulsion-killed vaccines. Mice were immunized intranasaly with primary vaccination, and boosted twice at 5 and 9 weeks. Arrows indicate vaccine administrations. The insert shows a comparison of serum anti-VV IgG at 12 weeks after 1 and 3 vaccinations.
FIG. 24 shows that intranasal immunization with a composition comprising nanoemulsion (NE)-inactivated VV induces high level of anti-VV IgA in mucosal secretions. Secretory IgA antibody toward whole virus was measured in bronchial fluids obtained from vaccinated animals at the conclusion of the experiment (T=16 weeks).
FIG. 25 shows neutralization of VV by sera and bronchial secretions from vaccinated mice. (A) NT50 of neutralizing antibodies in serum was performed using standard PRA and luciferase inhibition assays. Results from assays were normalized and presented as NT50 of the viral plaque reduction. Neutralizing titer 50 “NT50” is the serum dilution which kills 50% of virus. (B) Neutralizing activity in bronchoalveolar lavage (BAL) was detected using luciferase inhibition assays with individual and pooled BAL fluids collected at the conclusion of experiment (T=16 weeks). Results were normalized and presented as NT50 of the viral plaque reduction.
FIG. 26 shows vaccinia-specific splenocyte activation in vitro. Individual cultures of mouse splenocytes obtained 7 weeks after vaccination were stimulated with 103 and 104 pfu of VV.
FIG. 27 shows in vitro and in vivo evaluation of complete virus inactivation in nanoemulsion vaccine. (A) PCR analysis revealed the absence of viral DNA in mice vaccinated with various preparations of vaccine. Upper panel: Lane 1: DNA size marker; lane 2: no DNA ctrl; lane 3: no Taq 1 ctrl, lanes: 4, 5, 6, 7,—DNA from lung of mice vaccinated with 105/Fk/NE; lanes 8, 9, 10—DNA from lung of mice vaccinated with 105 NE, lane 11: VV-template DNA. Arrows indicate amplified viral template, and primers. (B) Bioluminescence imaging of mice infected intranasally with two doses of live Vaccinia (1×106 and 1×105 pfu) and with 1×105/NE vaccine (1×105 pfu of nanoemulsion killed virus).
FIG. 28 shows intranasal challenge with live vaccine virus. (A) Mice vaccinated with nanoemulsion-killed VV are protected against challenge with 10×LD50 of infectious virus. (B). The bioluminescence image of Balb/c mice challenged with VACWR-Luc. (C) Virus replication. Photon flux analysis in heads and chests of vaccinated mice indicates self-limiting replication.
FIG. 29 shows that administration of VV/NE vaccine produces anti-VV IgG antibodies recognizing “native” viral epitopes.
FIG. 30 shows live virus challenge (10×LD50) of Balb/c mice intranasally vaccinated with VV/NE, VV/Fk/NE and VV/Fk vaccines.
FIG. 31 shows characterization of the nanoemulsion and rPA formulation. Panel A: A number-weighted size distribution of 0.5% NE analyzed by the dynamic light scattering (DLS). Panels B and C: Photomicrographs of nanoemulsion alone (B) and after incubation with 50 μg/ml rPA for 1 hr at RT (C).
FIG. 32 shows that (A) mixing with NE prevents rapid degradation of rPA protein compared to saline and (B) that nanoemulsion droplets ar stable when mixed with rPA. (A) PAGE analysis of rPA antigen. 0.5 μg of rPA protein incubated in saline or 1% NE for 30 min at RT and analyzed using non-denturing 10% gel. (B) Microphotographs of a 1% NE and rPA/1% NE mixture showing the short term stability of rPA protein/NE mixture.
FIG. 33 shows time course of anti-PA IgG antibody induction in serum. Panels A and B show the results of immunization with vaccines containing 30 μg of rPA (A) and 2.5 μg of rPA (B). Immunization with: PA/NE (filled circle), PAINE/CpG (filled square), PA alone (filled triangle) and PA/CpG (filled diamond). Arrows indicate dates of immunization. The ELISA results are presented as median absorbance values obtained with serum at 2×102 dilutions. (*) indicates statistical difference between anti-PA IgG levels in mice immunized with PA/NE/CpG vs. PA/NE.
FIG. 34 shows final titer of anti-PA IgG in serum. Panels A and B show the results of immunization with 30 μg rPA (A) and 2.5 μg rPA (B). The results are expressed as the mean log10 of end point antibody titer+/−SEM.
FIG. 35 shows the pattern of anti-PA IgG distribution in mice immunized intranasally with various vaccine formulations. Mice immunized with 30 μg rPA are shown in Panel A and those with 2.5 μg rPA are shown in Panel B. The results are expressed as the mean log10 of end point antibody titer. Number of animals per group in Panel A is identified in parentheses; in Panel B each group is representative of 5 mice.
FIG. 36 shows anti-PA IgA (panel A) and IgG (panel B) antibodies in bronchial lavage from mice after six immunizations with 30 μg PA and NE adjuvant. The levels of secretory anti-PA IgA and anti-PA IgG antibodies in BAL are expressed as the mean+/−SEM of a specific absorbance obtained in ELISA using diluted BAL samples. Panel C: Western blot detection of anti-PA IgA in serum. One thousand fold serum sample dilutions were used for Western blots. Bar indicates anti-PA IgA binding to rPA.
FIG. 37 shows anti-PA IgG subclass antibodies in serum after mucosal immunization. Mice were immunized with 30 μg rPA in various vaccine formulations. The results are presented as the mean+/−SEM of Ab concentrations.
FIG. 38 shows that (A) neutralizing anti-PA Abs are present in the serum of mice immunized with rPA and nanoemulsion adjuvant; (B) lethal toxin neutralization by serum antibody titer generated via nasal vaccination with rPA/NE; and (C) rPA/NE vaccinated animals survive lethal challenge with 1000×LD50 of B. anthracis Ames spores. (A) Pooled serum from mice vaccinated with PA/NE/CpG was serially diluted and incubated with rPA. Each sample was added to CHO-K1 cells and binding of rPA with the cell receptor was analyzed by flow cytometry. The results represent the percentage of the neutralized rPA, calculated from the binding curve of free rPA with cell receptor. The control represents rPA binding without addition of anti-PA serum. (B) Lethal toxin cytotoxicity and neutralizing antibodies assay. (C) All immunized guinea pigs survive lethal challenge with 1000×LD50 of B. anthracis Ames spores six months after immunization with rPA/NE vaccine.
FIG. 39 shows rPA-specific induction of splenocyte proliferation in vitro. Splenocytes isolated from immunized animals were stimulated with rPA (5 μg/ml) for 72 hr. Values of proliferation indexes were calculated as a ratio of the mean absorbance in rPA-stimulated cells by the mean absorbance in the resting splenocytes. (*) indicates no statistical difference between these groups.
FIG. 40 shows antigen specific cytokine expression in animals immunized with PA/NE and PA/NE/CpG. PA-stimulated cytokine responses in splenocytes in vitro. Th1-type cytokines IFN-γ (A), IL-2 (B), TNF-α (C) and the Th2-type cytokine IL-4 (D) production was evaluated by specific ELISA in culture supernatant from control (resting, dotted columns) and rPA stimulated (filled columns) cells. The results are expressed as the mean+/−SEM. (*) indicates statistically significant differences in cytokine concentrations between resting and stimulated cells (p value<0.05).
FIG. 41 shows the effect of TWEEN derivatives on anti-PA IgG immunogenicity kinetes.
FIG. 42 shows anti-PA IgG titer distribution after a single vaccination dose.
FIG. 43 shows the kinetics of anti-PA IgG development after intranasal immunization with rPA/NE vaccine.
FIG. 44 shows induction of (A) anti-gp120Bal IgG and (B) anti-gp120SF 162 IgG in mice immunized with gp120BaL and gp120SF 162, respectively.
FIG. 45 shows cross-reactivity of (A) anti-gp120BaL; and (B) anti-gp120SF162 antibodies from mice after intranasal administration of either (A) gp120BaL-X8P; or (B) gp120SF 162-W205EC.
FIG. 46 shows secretory anti-gp120 IgA (A) in bronchial lavage (BAL); and (B) in vaginal washes of mice nasally administered gp120BaL and NE adjuvant (X8P).
FIG. 47 shows antigen-specific splenocyte proliferation following intranasal administration with gp120BaL in nanoemulsion. IFN-g secretion of activated splenocytes is shown in (A). Splenocyte proliferation is shown in (B).
FIG. 48 shows anti-gp120 IgG from a guinea pig mucosal immunization model.
FIG. 49 shows neutralization of HIV Virus in terms of ID50 values.
GENERAL DESCRIPTION OF THE INVENTIONThe present invention provides methods and compositions for the stimulation of immune responses. Specifically, the present invention provides methods of inducing an immune response against a pathogen (e.g., vaccinia virus, H5N1 influenza virus, Bacillus anthracis, HIV, etc.) in a subject (e.g., a human subject) and compositions useful in such methods (e.g., a nanoemulsion comprising a pathogen inactivated by the nanoemulsion, or an immunogenic portion thereof). Compositions and methods of the present invention find use in, among other things, clinical (e.g. therapeutic and preventative medicine (e.g., vaccination)) and research applications. In some embodiments, the pathogen is mixed with the nanoemulsion prior to administration for a time period sufficient to inactivate the pathogen. In others, protein components (e.g., isolated or purified protein, or recombinant protein) from a pathogen are mixed with the nanoemulsion.
Although an understanding of the mechanism is not necessary to practice the present invention and the present invention is not limited to any particular mechanism of action, in some embodiments, NE treatment (e.g., neutralization of a pathogen) with a NE of the present invention) preserves important antigenic epitopes (e.g., recognizable by a subject's immune system), stabilizing their hydrophobic and hydrophilic components in the oil and water interface of the emulsion (e.g., thereby providing one or more immunogens (e.g., stabilized antigens) against which a subject can mount an immune response). In other embodiments, because NE formulations are known to penetrate the mucosa through pores, they may carry immunogens to the submucosal location of dendritic cells (e.g., thereby initiating and/or stimulating an immune response). Although an understanding of the mechanism is not necessary to practice the present invention and the present invention is not limited to any particular mechanism of action, in some embodiments, combining a NE and an immunogenic protein (e.g., rPA from B. anthracis, or gp120 from HIV, etc.) stabilizes the immunogen and provides a proper immunogenic material for generation of an immune response.
Dendritic cells avidly phagocytose NE oil droplets and this could provide a means to internalize immunogens (e.g., antigenic proteins or peptide fragments thereof) for antigen presentation. While other vaccines rely on inflammatory toxins or other immune stimuli for adjuvant activity (See, e.g., Holmgren and Czerkinsky, Nature Med. 2005, 11; 45-53), NEs have not been shown to be inflammatory when placed on the skin or mucous membranes in studies on animals and in humans. Thus, although an understanding of the mechanism is not necessary to practice the present invention and the present invention is not limited to any particular mechanism of action, in some embodiments, a composition comprising a NE of the present invention (e.g., a composition comprising NE and an immunogen (e.g., a NE inactivated pathogen (e.g., a virus (e.g., VV))) may act as a “physical” adjuvant (e.g., that transports and/or presents immunogens (e.g., Vaccina proteins) to the immune system. In some preferred embodiments, mucosal administration of a composition of the present invention generates mucosal (e.g., signs of mucosal immunity (e.g., generation of IgA antibody titers) as well as systemic immunity.
Both cellular and humoral immunity play a role in protection against multiple pathogens and both can be induced with the NE formulations of the present invention. For example, vaccinia-specific antibody titers are considered important for the estimate of protective immunity in human subjects and in animal models of vaccination (See, e.g., Hammarlund et al, Nat. Med. 2003, 9; 1131-1137). Several studies have identified proteins important for the elicitation of neutralizing antibodies (See, e.g., Galmiche et al, Virology, 1999, 254; 71-80; Hooper et al, Virology, 2003, 306; 181-195). A recent trial of dilutions of the licensed smallpox vaccine (Dryvax) in human volunteers, confirmed that pustule formation strongly correlated with development of both specific antibodies and induction of cytotoxic T lymphocytes (CTL) and elevated INF-γ T cell responses (See, e.g., Greenberg et al, 2005, 365; 398-409). Induction of IFN-γ is suggestive of activation of specific MHC class I-restricted CD8+ T cells. These types of cells have been implicated in the recognition and clearance of Vaccinia infected cells, and for maintenance of immunity after vaccination (See, e.g., Earl et al, Nature, 2004; 482; 182-185; Hammarlund et al, Nat. Med. 2003, 9; 1131-1137; Edghill-Smith et all, Nature Med. 2005, 11; 740-747).
Thus, in some embodiments, administration (e.g., mucosal administration) of a composition of the present invention (e.g., NE-killed orthopox virus (e.g., VV)) to a subject results in the induction of both humoral (e.g., development of specific antibodies) and cellular (e.g., cytotoxic T lymphocyte) immune responses (e.g., against the orthopox virus). In some preferred embodiments, a composition of the present invention (e.g., NE-killed orthopox virus (e.g., VV) or a NE and one or more immunogens) is used as a vaccine (e.g., a smallpox vaccine, an anthrax vaccine, an influenza vaccine, etc.).
Furthermore, in some embodiments, a composition of the present invention (e.g., a composition comprising a NE and an immunogen) induces (e.g., when administered to a subject) both systemic and mucosal immunity. Thus, in some preferred embodiments, administration of a composition of the present invention to a subject results in protection against an exposure (e.g., a lethal mucosal exposure) to a pathogen (e.g., a virus (e.g., an orthopox virus (e.g., VV))). Although an understanding of the mechanism is not necessary to practice the present invention and the present invention is not limited to any particular mechanism of action, mucosal administration (e.g., vaccination) provides protection against pathogen infection (e.g., that initiates at a mucosal surface). Although it has heretofore proven difficult to stimulate secretory IgA responses and protection against pathogens that invade at mucosal surfaces (See, e.g., Mestecky et al, Mucosal Immunology. 3ed edn. (Academic Press, San Diego, 2005)), the present invention provides compositions and methods for stimulating mucosal immunity (e.g., a protective IgA response) from a pathogen in a subject.
In some embodiments, the present invention provides a composition (e.g., comprising a NE and an immunogen) to serve as a mucosal vaccine. This material can easily be produced from purified virus and/or protein or recombinant protein and induces both mucosal and systemic immunity. The ability to produce this formulation rapidly and administer it via mucosal instillation provides a vaccine that can be used for general vaccination needs as well as in large-scale outbreaks or emergent situations.
Definitions
To facilitate an understanding of the present invention, a number of terms and phrases are defined below:
As used herein, the term “microorganism” refers to any species or type of microorganism, including but not limited to, bacteria, viruses, archaea, fungi, protozoans, mycoplasma, prions, and parasitic organisms. The term microorganism encompasses both those organisms that are in and of themselves pathogenic to another organism (e.g., animals, including humans, and plants) and those organisms that produce agents that are pathogenic to another organism, while the organism itself is not directly pathogenic or infective to the other organism.
As used herein the term “pathogen,” and grammatical equivalents, refers to an organism (e.g., biological agent), including microorganisms, that causes a disease state (e.g., infection, pathologic condition, disease, etc.) in another organism (e.g., animals and plants) by directly infecting the other organism, or by producing agents that causes disease in another organism (e.g., bacteria that produce pathogenic toxins and the like). “Pathogens” include, but are not limited to, viruses, bacteria, archaea, fungi, protozoans, mycoplasma, prions, and parasitic organisms.
The terms “bacteria” and “bacterium” refer to all prokaryotic organisms, including those within all of the phyla in the Kingdom Procaryotae. It is intended that the term encompass all microorganisms considered to be bacteria including Mycoplasma, Chlamydia, Actinomyces, Streptomyces, and Rickettsia. All forms of bacteria are included within this definition including cocci, bacilli, spirochetes, spheroplasts, protoplasts, etc.
As used herein, the term “fungi” is used in reference to eukaryotic organisms such as molds and yeasts, including dimorphic fungi.
As used herein the terms “disease” and “pathologic condition” are used interchangeably, unless indicated otherwise herein, to describe a deviation from the condition regarded as normal or average for members of a species or group (e.g., humans), and which is detrimental to an affected individual under conditions that are not inimical to the majority of individuals of that species or group. Such a deviation can manifest as a state, signs, and/or symptoms (e.g., diarrhea, nausea, fever, pain, blisters, boils, rash, immune suppression, inflammation, etc.) that are associated with any impairment of the normal state of a subject or of any of its organs or tissues that interrupts or modifies the performance of normal functions. A disease or pathological condition may be caused by or result from contact with a microorganism (e.g., a pathogen or other infective agent (e.g., a virus or bacteria)), may be responsive to environmental factors (e.g., malnutrition, industrial hazards, and/or climate), may be responsive to an inherent defect of the organism (e.g., genetic anomalies) or to combinations of these and other factors.
The terms “host” or “subject,” as used herein, refer to an individual to be treated by (e.g., administered) the compositions and methods of the present invention. Subjects include, but are not limited to, mammals (e.g., murines, simians, equines, bovines, porcines, canines, felines, and the like), and most preferably includes humans. In the context of the invention, the term “subject” generally refers to an individual who will be administered or who has been administered one or more compositions of the present invention (e.g., a composition for inducing an immune response).
As used herein, the terms “inactivating,” “inactivation” and grammatical equivalents, when used in reference to a microorganism (e.g., a pathogen (e.g., a bacterium or a virus)), refer to the killing, elimination, neutralization and/or reducing of the capacity of the mircroorganism (e.g., a pathogen (e.g., a bacterium or a virus)) to infect and/or cause a pathological response and/or disease in a host. For example, in some embodiments, the present invention provides a composition comprising nanoemulsion (NE)-inactivated vaccinia virus (VV). Accordingly, as referred to herein, compositions comprising “NE-inactivated VV,” “NE-killed V,” NE-neutralized V” or grammatical equivalents refer to compositions that, when administered to a subject, are characterized by the absence of, or significantly reduced presence of, VV replication (e.g., over a period of time (e.g., over a period of days, weeks, months, or longer)) within the host.
As used herein, the term “fusigenic” is intended to refer to an emulsion that is capable of fusing with the membrane of a microbial agent (e.g., a bacterium or bacterial spore). Specific examples of fusigenic emulsions are described herein.
As used herein, the term “lysogenic” refers to an emulsion (e.g., a nanoemulsion) that is capable of disrupting the membrane of a microbial agent (e.g., a virus (e.g., viral envelope) or a bacterium or bacterial spore). In preferred embodiments of the present invention, the presence of a lysogenic and a fusigenic agent in the same composition produces an enhanced inactivating effect compared to either agent alone. Methods and compositions (e.g., for inducing an immune response (e.g., used as a vaccine) using this improved antimicrobial composition are described in detail herein.
The term “emulsion,” as used herein, includes classic oil-in-water or water in oil dispersions or droplets, as well as other lipid structures that can form as a result of hydrophobic forces that drive apolar residues (e.g., long hydrocarbon chains) away from water and drive polar head groups toward water, when a water immiscible oily phase is mixed with an aqueous phase. These other lipid structures include, but are not limited to, unilamellar, paucilamellar, and multilamellar lipid vesicles, micelles, and lamellar phases. Similarly, the term “nanoemulsion,” as used herein, refers to oil-in-water dispersions comprising small lipid structures. For example, in preferred embodiments, the nanoemulsions comprise an oil phase having droplets with a mean particle size of approximately 0.1 to 5 microns (e.g., 150+/−25 nm in diameter), although smaller and larger particle sizes are contemplated. The terms “emulsion” and “nanoemulsion” are often used herein, interchangeably, to refer to the nanoemulsions of the present invention.
As used herein, the terms “contact,” “contacted,” “expose,” and “exposed,” when used in reference to a nanoemulsion and a live microorganism, refer to bringing one or more nanoemulsions into contact with a microorganism (e.g., a pathogen) such that the nanoemulsion inactivates the microorganism or pathogenic agent, if present. The present invention is not limited by the amount or type of nanoemulsion used for microorganism inactivation. A variety of nanoemulsion that find use in the present invention are described herein and elsewhere (e.g., nanoemulsions described in U.S. Pat. Apps. 20020045667 and 20040043041, and U.S. Pat. Nos. 6,015,832, 6,506,803, 6,635,676, and 6,559,189, each of which is incorporated herein by reference in its entirety for all purposes). Ratios and amounts of nanoemulsion (e.g., sufficient for inactivating the microorganism (e.g., virus inactivation)) and microorganisms (e.g., sufficient to provide an antigenic composition (e.g., a composition capable of inducing an immune response)) are contemplated in the present invention including, but not limited to, those described herein.
The term “surfactant” refers to any molecule having both a polar head group, which energetically prefers solvation by water, and a hydrophobic tail that is not well solvated by water. The term “cationic surfactant” refers to a surfactant with a cationic head group. The term “anionic surfactant” refers to a surfactant with an anionic head group.
The terms “Hydrophile-Lipophile Balance Index Number” and “HLB Index Number” refer to an index for correlating the chemical structure of surfactant molecules with their surface activity. The HLB Index Number may be calculated by a variety of empirical formulas as described, for example, by Meyers, (See, e.g., Meyers, Surfactant Science and Technology, VCH Publishers Inc., New York, pp. 231-245 (1992)), incorporated herein by reference. As used herein where appropriate, the HLB Index Number of a surfactant is the HLB Index Number assigned to that surfactant in McCutcheon's Volume 1: Emulsifiers and Detergents North American Edition, 1996 (incorporated herein by reference). The HLB Index Number ranges from 0 to about 70 or more for commercial surfactants. Hydrophilic surfactants with high solubility in water and solubilizing properties are at the high end of the scale, while surfactants with low solubility in water that are good solubilizers of water in oils are at the low end of the scale.
As used herein the term “interaction enhancers” refers to compounds that act to enhance the interaction of an emulsion with a microorganism (e.g., with a cell wall of a bacteria (e.g., a Gram negative bacteria) or with a viral envelope (e.g., Vaccinia virus envelope)). Contemplated interaction enhancers include, but are not limited to, chelating agents (e.g., ethylenediaminetetraacetic acid (EDTA), ethylenebis(oxyethylenenitrilo)tetraacetic acid (EGTA), and the like) and certain biological agents (e.g., bovine serum abulmin (BSA) and the like).
The terms “buffer” or “buffering agents” refer to materials, that when added to a solution, cause the solution to resist changes in pH.
The terms “reducing agent” and “electron donor” refer to a material that donates electrons to a second material to reduce the oxidation state of one or more of the second material's atoms.
The term “monovalent salt” refers to any salt in which the metal (e.g., Na, K, or Li) has a net 1+ charge in solution (i.e., one more proton than electron).
The term “divalent salt” refers to any salt in which a metal (e.g., Mg, Ca, or Sr) has a net 2+ charge in solution.
The terms “chelator” or “chelating agent” refer to any materials having more than one atom with a lone pair of electrons that are available to bond to a metal ion.
The term “solution” refers to an aqueous or non-aqueous mixture.
As used herein, the term “a composition for inducing an immune response” refers to a composition that, once administered to a subject (e.g., once, twice, three times or more (e.g., separated by weeks, months or years)), stimulates, generates and/or elicits an immune response in the subject (e.g., resulting in total or partial immunity to a microorganism (e.g., pathogen) capable of causing disease). In preferred embodiments of the invention, the composition comprises a nanoemulsion and an immunogen. In further preferred embodiments, the composition comprising a nanoemulsion and an immunogen comprises one or more other compounds or agents including, but not limited to, therapeutic agents, physiologically tolerable liquids, gels, carriers, diluents, adjuvants, excipients, salicylates, steroids, immunosuppressants, immunostimulants, antibodies, cytokines, antibiotics, binders, fillers, preservatives, stabilizing agents, emulsifiers, and/or buffers. An immune response may be an innate (e.g., a non-specific) immune response or a learned (e.g., acquired) immune response (e.g. that decreases the infectivity, morbidity, or onset of mortality in a subject (e.g., caused by exposure to a pathogenic microorganism) or that prevents infectivity, morbidity, or onset of mortality in a subject (e.g., caused by exposure to a pathogenic microorganism)). Thus, in some preferred embodiments, a composition comprising a nanoemulsion and an immunogen is administered to a subject as a vaccine (e.g., to prevent or attenuate a disease (e.g., by providing to the subject total or partial immunity against the disease or the total or partial attenuation (e.g., suppression) of a sign, symptom or condition of the disease.
As used herein, the term “adjuvant” refers to any substance that can stimulate an immune response (e.g., a mucosal immune response). Some adjuvants can cause activation of a cell of the immune system (e.g., an adjuvant can cause an immune cell to produce and secrete a cytokine). Examples of adjuvants that can cause activation of a cell of the immune system include, but are not limited to, saponins purified from the bark of the Q. saponaria tree, such as QS21 (a glycolipid that elutes in the 21.sup.st peak with HPLC fractionation; Aquila Biopharmaceuticals, Inc., Worcester, Mass.); poly(di(carboxylatophenoxy)phosphazene (PCPP polymer; Virus Research Institute, USA); derivatives of lipopolysaccharides such as monophosphoryl lipid A (MPL; Ribi ImmunoChem Research, Inc., Hamilton, Mont.), muramyl dipeptide (MDP; Ribi) and threonyl-muramyl dipeptide (t-MDP; Ribi); OM-174 (a glucosamine disaccharide related to lipid A; OM Pharma SA, Meyrin, Switzerland); and Leishmania elongation factor (a purified Leishmania protein; Corixa Corporation, Seattle, Wash.). Traditional adjuvants are well known in the art and include, for example, aluminum phosphate or hydroxide salts (“alum”). In some embodiments, compositions of the present invention (e.g., comprising HIV or an immunogenic epitope thereof (e.g., gp120)) are administered with one or more adjuvants (e.g., to skew the immune response towards a Th1 or Th2 type response).
As used herein, the term “an amount effective to induce an immune response” (e.g., of a composition for inducing an immune response), refers to the dosage level required (e.g., when administered to a subject) to stimulate, generate and/or elicit an immune response in the subject. An effective amount can be administered in one or more administrations (e.g., via the same or different route), applications or dosages and is not intended to be limited to a particular formulation or administration route.
As used herein, the term “under conditions such that said subject generates an immune response” refers to any qualitative or quantitative induction, generation, and/or stimulation of an immune response (e.g., innate or acquired).
A used herein, the term “immune response” refers to a response by the immune system of a subject. For example, immune responses include, but are not limited to, a detectable alteration (e.g., increase) in Toll receptor activation, lymphokine (e.g., cytokine (e.g., Th1 or Th2 type cytokines) or chemokine) expression and/or secretion, macrophage activation, dendritic cell activation, T cell activation (e.g., CD4+ or CD8+ T cells), NK cell activation, and/or B cell activation (e.g., antibody generation and/or secretion). Additional examples of immune responses include binding of an immunogen (e.g., antigen (e.g., immunogenic polypeptide)) to an MHC molecule and inducing a cytotoxic T lymphocyte (“CTL”) response, inducing a B cell response (e.g., antibody production), and/or T-helper lymphocyte response, and/or a delayed type hypersensitivity (DTH) response against the antigen from which the immunogenic polypeptide is derived, expansion (e.g., growth of a population of cells) of cells of the immune system (e.g., T cells, B cells (e.g., of any stage of development (e.g., plasma cells), and increased processing and presentation of antigen by antigen presenting cells. An immune response may be to immunogens that the subject's immune system recognizes as foreign (e.g., non-self antigens from microorganisms (e.g., pathogens), or self-antigens recognized as foreign). Thus, it is to be understood that, as used herein, “immune response” refers to any type of immune response, including, but not limited to, innate immune responses (e.g., activation of Toll receptor signaling cascade) cell-mediated immune responses (e.g., responses mediated by T cells (e.g., antigen-specific T cells) and non-specific cells of the immune system) and humoral immune responses (e.g., responses mediated by B cells (e.g., via generation and secretion of antibodies into the plasma, lymph, and/or tissue fluids). The term “immune response” is meant to encompass all aspects of the capability of a subject's immune system to respond to antigens and/or immunogens (e.g., both the initial response to an immunogen (e.g., a pathogen) as well as acquired (e.g., memory) responses that are a result of an adaptive immune response).
As used herein, the term “immunity” refers to protection from disease (e.g., preventing or attenuating (e.g., suppression) of a sign, symptom or condition of the disease) upon exposure to a microorganism (e.g., pathogen) capable of causing the disease. Immunity can be innate (e.g., non-adaptive (e.g., non-acquired) immune responses that exist in the absence of a previous exposure to an antigen) and/or acquired (e.g., immune responses that are mediated by B and T cells following a previous exposure to antigen (e.g., that exhibit increased specificity and reactivity to the antigen)).
As used herein, the term “immunogen” refers to an agent (e.g., a microorganism (e.g., bacterium, virus or fungus) or portion thereof (e.g., a protein antigen (e.g., gp120 or rPA))) that is capable of eliciting an immune response in a subject. In preferred embodiments, immunogens elicit immunity against the immunogen (e.g., microorganism (e.g., pathogen or a pathogen product)) when administered in combination with a nanoemulsion of the present invention.
As used herein, the term “pathogen product” refers to any component or product derived from a pathogen including, but not limited to, polypeptides, peptides, proteins, nucleic acids, membrane fractions, and polysaccharides.
As used herein, the term “enhanced immunity” refers to an increase in the level of adaptive and/or acquired immunity in a subject to a given immunogen (e.g., microorganism (e.g., pathogen)) following administration of a composition (e.g., composition for inducing an immune response of the present invention) relative to the level of adaptive and/or acquired immunity in a subject that has not been administered the composition (e.g., composition for inducing an immune response of the present invention).
As used herein, the terms “purified” or “to purify” refer to the removal of contaminants or undesired compounds from a sample or composition. As used herein, the term “substantially purified” refers to the removal of from about 70 to 90%, up to 100%, of the contaminants or undesired compounds from a sample or composition.
As used herein, the terms “administration” and “administering” refer to the act of giving a composition of the present invention (e.g., a composition for inducing an immune response (e.g., a composition comprising a nanoemulsion and an immunogen)) to a subject. Exemplary routes of administration to the human body include, but are not limited to, through the eyes (ophthalmic), mouth (oral), skin (transdermal), nose (nasal), lungs (inhalant), oral mucosa (buccal), ear, rectal, by injection (e.g., intravenously, subcutaneously, intraperitoneally, etc.), topically, and the like.
As used herein, the terms “co-administration” and “co-administering” refer to the administration of at least two agent(s) (e.g., a composition comprising a nanoemulsion and an immunogen and one or more other agents—e.g., an adjuvant) or therapies to a subject. In some embodiments, the co-administration of two or more agents or therapies is concurrent. In other embodiments, a first agent/therapy is administered prior to a second agent/therapy. In some embodiments, co-administration can be via the same or different route of administration. Those of skill in the art understand that the formulations and/or routes of administration of the various agents or therapies used may vary. The appropriate dosage for co-administration can be readily determined by one skilled in the art. In some embodiments, when agents or therapies are co-administered, the respective agents or therapies are administered at lower dosages than appropriate for their administration alone. Thus, co-administration is especially desirable in embodiments where the co-administration of the agents or therapies lowers the requisite dosage of a potentially harmful (e.g., toxic) agent(s), and/or when co-administration of two or more agents results in sensitization of a subject to beneficial effects of one of the agents via co-administration of the other agent. In other embodiments, co-administration is preferable to elicit an immune response in a subject to two or more different immunogens (e.g., microorganisms (e.g., pathogens)) at or near the same time (e.g., when a subject is unlikely to be available for subsequent administration of a second, third, or more composition for inducing an immune response).
As used herein, the term “topically” refers to application of a compositions of the present invention (e.g., a composition comprising a nanoemulsion and an immunogen) to the surface of the skin and/or mucosal cells and tissues (e.g., alveolar, buccal, lingual, masticatory, vaginal or nasal mucosa, and other tissues and cells which line hollow organs or body cavities).
In some embodiments, the compositions of the present invention are administered in the form of topical emulsions, injectable compositions, ingestible solutions, and the like. When the route is topical, the form may be, for example, a spray (e.g., a nasal spray), a cream, or other viscous solution (e.g., a composition comprising a nanoemulsion and an immunogen in polyethylene glycol).
The terms “pharmaceutically acceptable” or “pharmacologically acceptable,” as used herein, refer to compositions that do not substantially produce adverse reactions (e.g., toxic, allergic or immunological reactions) when administered to a subject.
As used herein, the term “pharmaceutically acceptable carrier” refers to any of the standard pharmaceutical carriers including, but not limited to, phosphate buffered saline solution, water, and various types of wetting agents (e.g., sodium lauryl sulfate), any and all solvents, dispersion media, coatings, sodium lauryl sulfate, isotonic and absorption delaying agents, disintrigrants (e.g., potato starch or sodium starch glycolate), polyethylethe glycol, and the like. The compositions also can include stabilizers and preservatives. Examples of carriers, stabilizers and adjuvants have been described and are known in the art (See e.g., Martin, Remington's Pharmaceutical Sciences, 15th Ed., Mack Publ. Co., Easton, Pa. (1975), incorporated herein by reference).
As used herein, the term “pharmaceutically acceptable salt” refers to any salt (e.g., obtained by reaction with an acid or a base) of a composition of the present invention that is physiologically tolerated in the target subject. “Salts” of the compositions of the present invention may be derived from inorganic or organic acids and bases. Examples of acids include, but are not limited to, hydrochloric, hydrobromic, sulfuric, nitric, perchloric, fumaric, maleic, phosphoric, glycolic, lactic, salicylic, succinic, toluene-p-sulfonic, tartaric, acetic, citric, methanesulfonic, ethanesulfonic, formic, benzoic, malonic, sulfonic, naphthalene-2-sulfonic, benzenesulfonic acid, and the like. Other acids, such as oxalic, while not in themselves pharmaceutically acceptable, may be employed in the preparation of salts useful as intermediates in obtaining the compositions of the invention and their pharmaceutically acceptable acid addition salts.
Examples of bases include, but are not limited to, alkali metal (e.g., sodium) hydroxides, alkaline earth metal (e.g., magnesium) hydroxides, ammonia, and compounds of formula NW4+, wherein W is C1-4 alkyl, and the like.
Examples of salts include, but are not limited to: acetate, adipate, alginate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, citrate, camphorate, camphorsulfonate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, flucoheptanoate, glycerophosphate, hemisulfate, heptanoate, hexanoate, chloride, bromide, iodide, 2-hydroxyethanesulfonate, lactate, maleate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, oxalate, palmoate, pectinate, persulfate, phenylpropionate, picrate, pivalate, propionate, succinate, tartrate, thiocyanate, tosylate, undecanoate, and the like. Other examples of salts include anions of the compounds of the present invention compounded with a suitable cation such as Na+, NH4+, and NW4+ (wherein W is a C1-4 alkyl group), and the like. For therapeutic use, salts of the compounds of the present invention are contemplated as being pharmaceutically acceptable. However, salts of acids and bases that are non-pharmaceutically acceptable may also find use, for example, in the preparation or purification of a pharmaceutically acceptable compound.
For therapeutic use, salts of the compositions of the present invention are contemplated as being pharmaceutically acceptable. However, salts of acids and bases that are non-pharmaceutically acceptable may also find use, for example, in the preparation or purification of a pharmaceutically acceptable composition.
As used herein, the term “at risk for disease” refers to a subject that is predisposed to experiencing a particular disease. This predisposition may be genetic (e.g., a particular genetic tendency to experience the disease, such as heritable disorders), or due to other factors (e.g., environmental conditions, exposures to detrimental compounds present in the environment, etc.).
Thus, it is not intended that the present invention be limited to any particular risk (e.g., a subject may be “at risk for disease” simply by being exposed to and interacting with other people), nor is it intended that the present invention be limited to any particular disease.
“Nasal application”, as used herein, means applied through the nose into the nasal or sinus passages or both. The application may, for example, be done by drops, sprays, mists, coatings or mixtures thereof applied to the nasal and sinus passages.
“Vaginal application”, as used herein, means applied into or through the vagina so as to contact vaginal mucosa. The application may contact the urethra, cervix, fornix, uterus or other area surrounding the vagina. The application may, for example, be done by drops, sprays, mists, coatings, lubricants or mixtures thereof applied to the vagina or surrounding tissue.
As used herein, the term “kit” refers to any delivery system for delivering materials. In the context of immunogenic agents (e.g., compositions comprising a nanoemulsion and an immunogen), such delivery systems include systems that allow for the storage, transport, or delivery of immunogenic agents and/or supporting materials (e.g., written instructions for using the materials, etc.) from one location to another. For example, kits include one or more enclosures (e.g., boxes) containing the relevant immunogenic agents (e.g., nanoemulsions) and/or supporting materials. As used herein, the term “fragmented kit” refers to delivery systems comprising two or more separate containers that each contain a subportion of the total kit components. The containers may be delivered to the intended recipient together or separately. For example, a first container may contain a composition comprising a nanoemulsion and an immunogen for a particular use, while a second container contains a second agent (e.g., an antibiotic or spray applicator). Indeed, any delivery system comprising two or more separate containers that each contains a subportion of the total kit components are included in the term “fragmented kit.” In contrast, a “combined kit” refers to a delivery system containing all of the components of an immunogenic agent needed for a particular use in a single container (e.g., in a single box housing each of the desired components). The term “kit” includes both fragmented and combined kits.
DETAILED DESCRIPTION OF THE INVENTIONThe present invention provides methods and compositions for the stimulation of specific immune response. Accordingly, in some embodiments, the present invention provides vaccines for the stimulation of immunity against pathogens. In some embodiments, the present invention provides nanoemulsion vaccine compositions comprising an inactivated pathogen and a nanoemulsion. The present invention is not limited to any particular nanoemulsion or pathogen. Exemplary vaccine compositions and methods of administering vaccine compositions are described in more detail below.
I. Nanoemulsions as Anti-Pathogen Compositions
The nanoemulsion compositions utilized in some embodiments of the present invention have demonstrated anti-pathogen effect. For example, nanoemulsion compositions have been shown to inactivate bacteria (both vegetative and spore forms), virus, and fungi. In preferred embodiments of the present invention, pathogens are inactivated by exposure to nanoemulsions before being administered as vaccines.
A. Microbicidal and Microbistatic Activity
Nanoemulsion compositions can be used to rapidly inactivate bacteria. In certain embodiments, the compositions are particularly effective at inactivating Gram positive bacteria. In preferred embodiments, the inactivation of bacteria occurs after about five to ten minutes. Thus, bacteria may be contacted with an emulsion and will be inactivated in a rapid and efficient manner. It is expected that the period of time between the contacting and inactivation may be as little as 5-10 minutes where the bacteria is directly exposed to the emulsion. However, it is understood that when nanoemulsions are employed in a therapeutic context and applied systemically, the inactivation may occur over a longer period of time including, but not limited to, 5, 10, 15, 20, 25 30, 60 minutes post application. Further, in additional embodiments, inactivation may take two, three, four, five or six hours to occur.
Nanoemulsions can also rapidly inactivate certain Gram negative bacteria for use in generating the vaccines of the present invention. In such methods, the bacteria inactivating emulsions are premixed with a compound that increases the interaction of the emulsion by the cell wall. The use of these enhancers in the vaccine compositions of the present invention is discussed herein below. It should be noted that certain emulsions (e.g., those comprising enhancers) are effective against certain Gram positive and negative bacteria.
In specific illustrative examples (Examples 3-4), nanoemulsions useful in the compositions and methods of the present invention were shown to have potent, selective biocidal activity with minimal toxicity against vegetative bacteria. For example, X8P was highly effective against B. cereus, B. circulans and B. megaterium, C. perfringens, H. influenzae, N. gonorrhoeae, S. agalactiae, S. pneumonia, S. pyogenes and V. cholerae classical and Eltor (FIG. 26). This inactivation starts immediately on contact and is complete within 15 to 30 minutes for most of the susceptible microorganisms.
B. Sporicidial and Sporistatic Activity
In certain specific examples (e.g., Examples 5 and 11), nanoemulsions have been shown to have anti-sporicidal activity. Without being bound to any theory (an understanding of the mechanism is not necessary to practice the present invention, and the present invention is not limited to any particular mechanism), it is proposed the that the sporicidal ability of these emulsions occurs through initiation of germination without complete reversion to the vegetative form leaving the spore susceptible to disruption by the emulsions. The initiation of germination could be mediated by the action of the emulsion or its components.
The results of electron microscopy studies show disruption of the spore coat and cortex with disintegration of the core contents following X8P treatment. Sporicidal activity appears to be mediated by both the TRITON X-100 and tri-n-butyl phosphate components since nanoemulsions lacking either component are inactive in vivo. This unique action of the emulsions, which is similar in efficiency to 1% bleach, is interesting because Bacillus spores are generally resistant to most disinfectants including many commonly used detergents (Russell, Clin. Micro. 3; 99 (1990)).
Certain illustrative examples of the present invention demonstrate that mixing X8P with B. cereus spores before injecting into mice prevents the pathological effect of B. cereus (Example 5). Further, illustrative examples of the present invention show that X8P treatment of simulated wounds contaminated with B. cereus spores markedly reduced the risk of infection and mortality in mice (Example 5). The control animals, injected with X8P alone diluted 1:10, did not show any inflammatory effects, thus demonstrating that X8P does not have cutaneous toxicity in mice. These results suggest that immediate treatment of spores prior to or following exposure can effectively reduce the severity of tissue damage of the experimental cutaneous infection.
Other experiments conducted during the development of the present invention compared the effects of X8P and other emulsions derived from X8P to inactivate different Bacillus spores (Example 11). X8P diluted up to 1:1000 (v/v) inactivated more than 90% of B. anthracis spores in four hours, and was also sporicidal against three other Bacillus species through the apparent disruption of spore coat. X8W60PC diluted 1:1000 had more sporicidal activity against B. anthracis, B. cereus, and B. subtilis and had an onset of action in less than 30 minutes. In mice, mixing X8P with B. cereus before subcutaneous injection or wound irrigation with X8P 1 hour following spore inoculation resulted in over 98% reduction in skin lesion size. Mortality was reduced 4-fold in the latter experiment. The present compositions are stable, easily dispersed, non-irritant and nontoxic compared to the other available sporicidal agents.
The bacteria-inactivating oil-in-water emulsions used in some embodiments of the present invention can be used to inactivate a variety of bacteria and bacterial spores upon contact. For example, the presently disclosed emulsions can be used to inactivate Bacillus including B. cereus, B. circulans and B. megatetium, also including Clostridium (e.g., C. botulinum and C. tetani). The nanoemulsions utilized in some embodiments of the present invention may be particularly useful in inactivating certain biological warfare agents (e.g., B. anthracis). In addition, the formulations of the present invention also find use in combating C. perfringens, H. influenzae, N. gonorrhoeae, S. agalactiae, S. pneumonia, S. pyogenes and V. cholerae classical and Eltor (FIG. 1).
C. Viricidal and Viralstatic Activity
In additional illustrative examples (e.g., Example 12) of the present invention, it was demonstrated that the nanoemulsion compositions of the present invention have anti-viral properties. The effect of these emulsions on viral agents was monitored using plaque reduction assay (PRA), cellular enzyme-linked immunosorbent assay (ELISA), β-galactosidase assay, and electron microscopy (EM) and the cellular toxicity of lipid preparations was assessed using a (4,5-dimethylthiazole-2-yl)-2,5 diphenyltetrazolium (MTT) staining assay (Mosmann, J. Immunol. Methods., 65:55 (1983)).
There was a marked reduction of influenza A infectivity of MDCK cells as measured by cellular ELISA with subsequent confirmation by PRA. X8P and SS at a dilution of 1:10 reduced virus infectivity over 95%. Two other emulsions showed only intermediate effects on the virus reducing infectivity by approximately 40% at dilution 1:10. X8P was the most potent preparation and showed undiminished viricidal effect even at dilution 1:100. Kinetic studies showed that 5 min incubation of virus with X8P at 1:10 dilution completely abolished its infectivity. TRITON X-100, an active compound of X8P, at dilution 1:5000 only partially inhibited the infectivity of virus as compared to X8P, indicating that the nanoemulsion itself contributes to the anti-viral efficacy. To further examine the anti-viral properties of X8P, its action on non-enveloped viruses was investigated. The X8P treatment did not affect the replication of lacZ adenovirus construct in 293 cells as measured using β-galactosidase assay. When examined with EM, influenza A virus was completely disrupted after incubation with X8P while adenovirus remained intact.
In addition, pre-incubation of virus with 10% and 1% X8P in PBS completely eliminates herpes, sendai, sindbis and vaccinia viruses as assessed by plaque reduction assays (FIG. 2). Time course analyses showed the onset of inactivation to be rapid and complete within 5 minutes of incubation with 10% X8P and within 30 minutes with 1% X8P. Adenovirus treated with different dilutions of X8P showed no reduction in infectivity.
The efficacy of certain X8P based compositions against various viral onslaught and their minimal toxicity to mucous membranes demonstrate their potential as effective disinfectants and agents for prevention of diseases resulting from infection with enveloped viruses.
D. Fungicidal and Fungistatic Activity
Yet another property of the nanoemulsions used in some embodiments of the present invention is that they possess antifungal activity. Common agents of fungal infections include various species of the genii Candida and Aspergillus, and types thereof, as well as others. While external fungus infections can be relatively minor, systemic fungal infections can give rise to serious medical consequences. There is an increasing incidence of fungal infections in humans, attributable in part to an increasing number of patients having impaired immune systems. Fungal disease, particularly when systemic, can be life threatening to patients having an impaired immune system.
Experiments conducted during the development of the present invention have shown that 1% X8P has a greater than 92% fungistatic activity when applied to Candida albicans. Candida was grown at 37° C. overnight. Cells were then washed and counted using a hemacytometer. A known amount of cells were mixed with different concentrations of X8P and incubated for 24 hours. The Candida was then grown on dextrose agar, incubated overnight, and the colonies were counted. The fungistatic effect of the X8P was determined as follows: Fungistatic effect ( FSE ) = 1 - # of treated cells - Initial # of cells # of untreated cells - Initial # of cells × 100
It is contemplated that other nanoemulsion formulations useful in the methods and compositions of the present invention (e.g., described below) are also fungistatic. One of skill in the art will be able to test additional formulations for their ability to inactivate fungi (e.g., using methods described herein).
E. In Vivo Effects
In other illustrative examples of the present invention, nanoemulsion formulations were shown to combat and prevent pathogen infection in animals. Bacillus cereus infection in experimental animals has been used previously as a model system for the study of anthrax (See e.g., Burdon and Wende, J Infect. Diseas. 170(2):272 (1960); Lamanna and Jones, J. Bact. 85:532 (1963); and Burdon et al., J Infect. Diseas. 117:307 (1967)). The disease syndrome induced in animals experimentally infected with B. cereus is similar to B. anthracis (Drobniewski, Clin. microbio. Rev. 6:324 (1993); and Fritz et al., Lab. Invest. 73:691 (1995)). Experiments conducted during the development of the present invention demonstrated that mixing X8P with B. cereus spores before injecting into mice prevented the pathological effect of B. cereus. Further, it was demonstrated that X8P treatment of simulated wounds contaminated with B. cereus spores markedly reduced the risk of infection and mortality in mice. The control animals, which were injected with X8P alone diluted 1:10, did not show any inflammatory effects proving that X8P does not have cutaneous toxicity in mice. These results suggest that immediate treatment of spores prior to or following exposure can effectively reduce the severity of tissue damage of the experimental cutaneous infection.
In a particular example, Guinea Pigs were employed as experimental animals for the study of C. perfringens infection. A 1.5 cm skin wound was made, the underlying muscle was crushed and infected with 5×107 cfu of C. perftingens without any further treatment. Another group was infected with the same number of bacteria, then 1 hour later it was irrigated with either saline or X8P to simulate post-exposure decontamination. Irrigation of experimentally infected wounds with saline did not result in any apparent benefit. However, X8P irrigation of the wound infected with C. perfringens showed marked reduction of edema, inflammatory reaction and necrosis. As such, it was demonstrated that certain nanoemulsion formulations are able to combat a bacterial infection.
Further, a subcutaneous injection of 10% X8P did not cause distress in experimental animals and resulted in no gross histological tissue damage. All rats in the nasal toxicity study showed weight gain over the study period. No adverse clinical signs were noted and all tissues appeared within normal limits on gross examination. Bacterial cultures from the stools of treated animals were not significantly different from those of untreated animals.
II. Nanoemulsion Vaccine Compositions and Compositions for Inducing Immune Responses
In some embodiments, the present invention provides compositions for inducing immune responses comprising a nanoemulsion and one or more immunogens (e.g., inactivated pathogens or pathogen products). The present invention provides immunogenic compositions capable of generating an immune response against any number of pathogens (e.g., vaccines for any number of pathogens). A variety of nanoemulsion that find use in the present invention are described herein and elsewhere (e.g., nanoemulsions described in U.S. Pat. Apps. 20020045667 and 20040043041, and U.S. Pat. Nos. 6,015,832, 6,506,803, 6,635,676, and 6,559,189, each of which is incorporated herein by reference in its entirety for all purposes).
Immunogens (e.g., pathogens or pathogen products) and nanoemulsions of the present invention may be combined in any suitable amount utilizing a variety of delivery methods. Any suitable pharmaceutical formulation may be utilized, including, but not limited to, those disclosed herein. Suitable formulations may be tested for immunogenicity using any suitable method. For example, in some embodiments, immunogenicity is investigated by quantitating both antibody titer and specific T-cell responses. Nanoemulsion compositions of the present invention may also be tested in animal models of infectious disease states. Suitable animal models, pathogens, and assays for immunogenicity include, but are not limited to, those described below.
A. Nanoemulsion Compositions Induce Immunity when Administered to a Subject
The ability of nanoemulsions to prevent infections in a prophylactic manner when applied to either wounds, skin or mucous membranes has been documented (Hamouda et al., J. Infect. Dis., 180:1939 (1999); Donovan et al., Antivir Chem Chemother., 11:41 (2000)). During the development of the present invention, in several studies, mice were pretreated with nasally-applied nanoemulsion before exposure to influenza virus to document the ability of the nanoemulsions to prevent inhalation influenza pneumonitis. Morbidity from pretreatment with nanoemulsion was minimal and, as compared to control animals, mortality was greatly diminished (20% with pretreatment vs. 80% in controls; Example 13). Several of the surviving, emulsion pretreated animals were found to have evidence of a few areas of immune reactivity and giant-cell formation in the lung that were not present in control animals treated with emulsion but not exposed to virus. All of the pretreated animals had evidence of lipid uptake in lung macrophages. The present invention is not limited to any one mechanism. Indeed, an understanding of the mechanism is not necessary to practice the present invention. Nonetheless, it is contemplated that the treatment with a nanoemulsion/virus composition resulted in the development of immunity to the influenza virus.
Therefore, in one illustrative example (Example 13) antibody titers to influenza virus in the serum of exposed animals were investigated. It was found that animals receiving emulsion and virus had high titers of virus-specific antibody (FIG. 6). This immune response was not observed in control animals exposed to virus without pretreatment.
Experiments were conducted to investigate whether administration of emulsion and virus would yield protective immunity without toxicity (Example 13). A mixture of virus (LD80; 5×104 pfu) with the nanoemulsion was administered to animals on two occasions, two weeks apart. As controls, animals were given either an equal amount of formalin-killed virus, nanoemulsion alone or saline. The results of these studies demonstrated that only the emulsion/virus mixture elicited significant antibody response when applied to the nares of animals. The titers were extremely high and included both serum IgG and bronchial IgA responses that were specific for the virus (FIGS. 7 and 8). More importantly, in two repeated experiments, complete protection from death was observed in the emulsion/virus pretreatment group (Table 25). None of the 15 animals died from exposure to a LD80 of virus after two administrations of 5×104 pfu of virus mixed in nanoemulsion, whereas the expected 80% of control animals died from this exposure. The same dose of formalin killed virus applied to the nares provided no protection from death and resulted in much lower titers of virus-specific antibody (FIGS. 7 and 8).
Experiments were also conducted to investigate the possibility that a small amount of residual, live virus in the nanoemulsion was producing a subclinical infection that provided immunity (Example 13). An additional group of animals were given approximately 100 pfu of live virus intranasally in an attempt to induce a low-level infection (approximately four times the amount of live virus present after 15 minutes of treatment with nanoemulsion). While there was a slight reduction in death rates of these animals, suggesting a sub-clinical infection, the amount of protection observed was significantly less than what was seen in the emulsion treated group and none of these animals developed virus-specific antibodies (Table 25). This documented that it was not merely a sub-lethal viral infection mediating the immune response but that the emulsion was specifically enhancing the virus-specific immune response. The protective immunity was obtained following only two applications of the emulsion/virus mix, and appeared to increase after each application suggesting a booster effect. Virus-specific antibody titers were maintained for six weeks following administration of the emulsion/virus mix.
Illustrative Example 15 demonstrates the ability of intranasaly administered influenza virus/nanoemulsion was able to induce immunity in mice against further challenge with live virus.
The present invention is not limited to the intranasal administration of vaccine compounds. Parenteral methods of administration are also contemplated. For example, illustrative example 16 demonstrates that parenteral administration of HIV gp120 protein/nanoemulsion induced an immune response in mice. The present invention is also not limited to the use of vaccines comprising whole pathogens. The use of pathogen products (e.g., including, but not limited to, proteins, polypeptides, peptides, nucleic acids, membrane fractions, and polysaccharides) is contemplated. Illustrative example 16 demonstrates the generation of an immune response against HIV gp120 protein.
In some embodiments, the present invention describes the development of immunity (e.g., immunity towards an orthopox virus (e.g., vaccinia virus (VV))) in a subject after mucosal administration (e.g., mucosal vaccination) of a composition comprising nanoemulson (NE)-inactivated orthopox virus (e.g., VV) identified and characterized during development of the present invention. NE was mixed with highly purified, cell culture-derived VV, resulting in a formulation (e.g., NE-killed VV composition) that is stable at room temperature (e.g., in some embodiments, for more than 2 weeks, more preferably more than 3 weeks, even more preferably more than 4 weeks, and most preferably for more than 5 weeks) and that can be used to induce an immune response against orthopox viruses (e.g., VV) in a subject (e.g., that can be used either alone or as an adjuvant for inducing an anti-VV immune response).
Mucosal administration of a composition comprising NE and VV (e.g., NE-killed VV) to a subject resulted in high-titer mucosal and systemic antibody responses and specific Th1 cellular immunity (See, e.g., Examples 18-24). Further, all animals were fully protected against an inhalation challenge with 100×LD50 VV (See, e.g., Example 24). In the vaccinated animals, infection was completely prevented or was of a low level and self-limiting and infection resolved in four to five days. In contrast, all naive animals died within this time period. Subsequent re-challenge of immunized mice with a 100×LD of VV-WR validated protective immunity. Mice administered even a single dose of a composition comprising NE-killed VV developed significant serum concentrations of anti-VV IgG 10 to 12 weeks after administration (See, e.g., Example 18). This level of response is comparable to the results obtained in Balb/c mice immunized by intramuscular injection with live VV Wyeth at similar time point (See, e.g., Coulibaly et al., Virology, 2005; 341; 91-101). Thus, in some embodiments, the present invention provides that a single administration (e.g., mucosal administration) of a composition comprising NE-killed VV is sufficient to induce a protective immune response in a subject (e.g., protective immunity (e.g., mucosal and systemic immunity)). In some embodiments, a subsequent administration (e.g., one or more boost administrations subsequent to a primary administration) to a subject provides the induction of an enhanced immune response to VV in the subject. Thus, the present invention demonstrates that administration of a composition comprising NE-killed VV to a subject provides protective immunity against smallpox.
In contrast, intranasal instillations of formalin-killed VV with or without nanoemulsion produced inconsistent and low antibody responses, which did not augment even after a third immunization (See, e.g., Example 18). A similar pattern of neutralizing activity was also detected in serum and bronchoalveolar lavage (BAL), with neutralizing activity being absent in mice mucosally vaccinated with formalin-killed virus. Neutralizing activity was not detected in BAL of animals vaccinated with either IP or SQ injections of a live virus.
Both cellular and humoral immunity play a role in protection against orthopoxviruses, and both were induced with the NE formulations (See, e.g., Examples 18-20). Vaccinia-specific antibody titers are considered important for the estimate of protective immunity in human subjects and in animal models of vaccination (See, e.g., Hammarlund et al, Nat. Med. 2003, 9; 1131-1137). Several studies have identified proteins important for the elicitation of neutralizing antibodies (See, e.g., Galmiche et al, Virology, 1999, 254; 71-80; Hooper et al, Virology, 2003, 306; 181-195). A recent trial of dilutions of the licensed smallpox vaccine (Dryvax) in human volunteers, confirmed that pustule formation strongly correlated with development of both specific antibodies and induction of cytotoxic T lymphocytes (CTL) and elevated INF-65 T cell responses (See, e.g., Greenberg et al, 2005, 365; 398-409). Induction of IFN-γ is suggestive of activation of specific MHC class I-restricted CD8+ T cells. These types of cells have been implicated in the recognition and clearance of Vaccinia infected cells, and for maintenance of immunity after vaccination (See, e.g., Earl et al, Nature, 2004; 482; 182-185; Hammarlund et al, Nat. Med. 2003, 9; 1131-1137; Edghill-Smith et all, Nature Med. 2005, 11; 740-747).
Thus, in some embodiments, administration (e.g., mucosal administration) of a composition of the present invention (e.g., NE-killed orthopox virus (e.g., VV) to a subject results in the induction of both humoral (e.g., development of specific antibodies) and cellular (e.g., cytotoxic T lymphocyte) immune responses (e.g., against the orthopox virus). In some preferred embodiments, a composition of the present invention (e.g., NE-killed orthopox virus (e.g., VV) is used as a smallpox vaccine.
In some embodiments, the present invention provides methods of inducing an immune response to bacteria of the genus Bacillus (e.g., B. anthracis) in a subject (e.g., a human subject) and compositions useful in such methods (e.g., a nanoemulsion comprising bacteria or bacterial components (e.g., isolated or recombinant proteins) of the genus Bacillus (e.g., B. anthracis)). In preferred embodiments, methods of inducing an immune response provided by the present invention are used for vaccination. Due to the rate of adverse events with existing Bacillus (e.g., B. anthracis) vaccines, the present invention provides a significant improvement in Bacillus (e.g., B. anthracis) vaccination safety without compromising vaccine efficacy.
For example, the present invention describes the development of immunity (e.g., B. anthracis immunity) in a subject after mucosal administration (e.g., mucosal vaccination) with a composition comprising a nenoemulsion and an immunogenic protein from B. anthracis (e.g., rPA) generated and characterized during development of the present invention (See Examples 25-30). Nanoemulsion (NE), a surface-active antimicrobial material, was mixed with recombinant protective antigen (rPA), resulting in an immunogenic composition comprising NE and rPA that is stable at room temperature (e.g., in some embodiments, for more than 2 weeks, more preferably more than 3 weeks, even more preferably more than 4 weeks, and most preferably for more than 5 weeks) and that can be used to induce an immune response against B. anthracis in a subject (e.g., that can be used either alone or as an adjuvant for inducing an anti-B. anthracis immune response).
Mucosal administration of a composition comprising NE and rPA to a subject resulted in high-titer mucosal and systemic antibody responses and specific Th1 cellular immunity (See, e.g., Examples 27-30). Further, serum from mice immunized intranasally with a composition comprising NE and rPA was capable of neutralizing binding of PA to its receptor (ATR receptor) (See Example 29). Mice administered three doses of a composition comprising NE and rPA developed significant serum concentrations of anti-rPA IgG after administration (See, e.g., Example 27). Moreover, mice administered this composition generated IgA antibodies toward rPA, indicating the presence of a mucosal immune response.
Thus, in some embodiments, the present invention provides that administration (e.g., mucosal administration) of a composition comprising NE and a B. anthracis immunogen (e.g., rPA) is sufficient to induce a protective immune response against B. anthracis in a subject (e.g., protective immunity (e.g., mucosal and systemic immunity)). In some embodiments, a subsequent administration (e.g., one or more boost administrations subsequent to a primary administration) to a subject provides the induction of an enhanced immune response to B. anthracis in the subject. Thus, the present invention demonstrates that administration of a composition comprising NE and a B. anthracis immunogen (e.g., rPA) to a subject provides protective immunity against anthrax.
In contrast, intranasal instillations of NE alone or NE with CpG adjuvant was not able to induce an immune response against B. anthracis (See Examples 27-30). Furthermore, administration of rPA alone (e.g., in saline) did not induce significant IgG or IgA antibody production in mice.
Both cellular and humoral immunity play a role in protection against Bacillus (e.g., B. anthracis), and both were induced with the NE formulations (See, e.g., Examples 27-30). Thus, in some embodiments, administration (e.g., mucosal administration) of a composition of the present invention to a subject results in the induction of both humoral (e.g., development of specific antibodies) and cellular (e.g., cytotoxic T lymphocyte) immune responses (e.g., against Bacillus proteins). In some preferred embodiments, a composition of the present invention (e.g., a composition comprising a NE and Bacillus proteins (e.g., rPA) is used as an anthrax vaccine.
In some embodiments, the present invention provides methods of inducing an immune response to HIV in a subject (e.g., a human subject) and compositions useful in such methods (e.g., a nanoemulsion comprising HIV or HIV components (e.g., isolated or recombinant HIV proteins). In some embodiments, methods of inducing an immune response provided by the present invention are used for vaccination. Due to the rate of adverse events with existing HIV vaccines, the present invention provides a significant improvement in HIV vaccination safety without compromising vaccine efficacy.
For example, the present invention describes the development of immunity (e.g., HIV immunity) in a subject after mucosal administration (e.g., mucosal vaccination) with a composition comprising a nenoemulsion and an immunogenic protein from HIV (e.g., recombinant gp120) generated and characterized during development of the present invention (See Examples 31-36). Nanoemulsion (NE), a surface-active antimicrobial material, was mixed with recombinant gp120 from either BaL or SF162 serotypes, resulting in an immunogenic composition comprising NE and recombinant gp120 that is stable at room temperature (e.g., in some embodiments, for more than 2 weeks, more preferably more than 3 weeks, even more preferably more than 4 weeks, and most preferably for more than 5 weeks) and that can be used to induce an immune response against HIV in a subject (e.g., that can be used either alone or as an adjuvant for inducing an anti-HIV immune response).
Mucosal administration of a composition comprising NE and an HIV immunogen (e.g., recombinant gp120) to a subject resulted in high-titer mucosal and systemic antibody responses and generated a Th1 type cellular immune response (See, e.g., Examples 31, 32, and 35). Further, antibodies generated against one serotype of gp120 cross-reacted with other gp120 serotypes (See, e.g., Example 33). Moreover, mice immunized intranasally with a composition comprising NE and recombinant gp120 generated mucosally secreted, anti-gp120 specific IgA antibodies that were detectable in both bronchial as well as vaginal mucosal surfaces (See Example 34). Thus, mice administered a composition of the present invention generated a mucosal immune response to HIV. The immune response generated in mice administered a composition comprising a NE and recombinant gp120 was also capable of neutralizing HIV (See Example 37).
Thus, in some embodiments, the present invention provides that administration (e.g., mucosal administration) of a composition comprising NE and an HIV immunogen (e.g., recombinant gp120) is sufficient to induce a protective immune response against HIV in a subject (e.g., protective immunity (e.g., mucosal and systemic immunity)). In some embodiments, a subsequent administration (e.g., one or more boost administrations subsequent to a primary administration) to a subject provides the induction of an enhanced immune response to HIV in the subject. Thus, the present invention demonstrates that administration of a composition comprising NE and an HIV immunogen (e.g., recombinant gp120) to a subject provides protective immunity against AIDS.
Both cellular and humoral immunity play a role in protection against HIV and both were induced with the NE formulations (See, e.g., Examples 32-37). Thus, in some embodiments, administration (e.g., mucosal administration) of a composition of the present invention to a subject results in the induction of both humoral (e.g., development of specific antibodies) and cellular (e.g., cytotoxic T lymphocyte) immune responses (e.g., against HIV proteins (gp120)). In some preferred embodiments, a composition of the present invention (e.g., a composition comprising a NE and recombinant gp120 from one or more serotypes of HIV) is used as a AIDS vaccine.
B. Pathogens
The present invention is not limited to the use of any one specific type of pathogen. Indeed, compositions (e.g., comprising a NE and an immunogen) useful for generating an immune response (e.g., for use as a vaccine) to a variety of pathogens are within the scope of the present invention. Accordingly, in some embodiments, the present invention provides compositions for generating an immune response to bacterial pathogens (e.g., in vegetative or spore forms) including, but not limited to, Bacillus cereus, Bacillus circulans and Bacillus megaterium, Bacillus anthracis, bacteria of the genus Brucella, Vibrio cholera, Coxiella burnetii, Francisella tularensis, Chlamydia psittaci, Ricinus communis, Rickettsia prowazekii, bacterial of the genus Salmonella (e.g., S. typhi), bacteria of the genus Shigella, Cryptosporidium parvum, Burkholderia pseudomallei, Clostridium perfringens, Clostridium botulinum, Vibrio cholerae, Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus pneumonia, Staphylococcus aureus, Neisseria gonorrhea, Haemophilus influenzae, Escherichia coli, Salmonella typhimurium, Shigella dysenteriae, Proteus mirabilis, Pseudomonas aeruginosa, Yersinia pestis, Yersinia enterocolitica, and Yersinia pseudotuberculosis). In other embodiments, the present invention provides compositions for generating an immune response to viral pathogens including, but not limited to, influenza A virus, avian influenza virus, H5N1 influenza virus, West Nile virus, SARS virus, Marburg virus, Arenaviruses, Nipah virus, alphaviruses, filoviruses, herpes simplex virus I, herpes simplex virus II, sendai, sindbis, vaccinia, parvovirus, human immunodeficiency virus, hepatitis B virus, hepatitis C virus, hepatitis A virus, cytomegalovirus, human papilloma virus, picornavirus, hantavirus, junin virus, and ebola virus). In still further embodiments, the present invention provides compositions for generating an immune response to fungal pathogens, including, but not limited to, Candida albicnas and parapsilosis, Aspergillus fumigatus and niger, Fusarium spp, Trychophyton spp.
Bacteria for use in formulating a composition for generating an immune response of the present invention can be obtained from commercial sources, including, but not limited to, American Type Culture Collection (ATCC). In some embodiments, bacteria are passed in animals prior to being mixed with nanoemulsions in order to enhance their pathogenicity for each specific animal host for 5-10 passages (Sinai et al., J. Infect. Dis., 141:193 (1980)). In some embodiments, the bacteria then are then isolated from the host animals, expanded in culture and stored at −80° C. Just before use, the bacteria are thawed and grown on an appropriate solid bacterial culture medium overnight. The next day, the bacteria are collected from the agar plate and suspended in a suitable liquid solution (e.g., Brain Heart Infusion (BHI) broth). The concentration of bacteria is adjusted so that the bacteria count is approximately 1.5×108 colony forming units per ml (CFU/ml), based on the McFarland standard for bactericidal testing (Hendrichson and Krenz, 1991).
Viruses for use in formulating a composition for generating an immune response of the present invention can be obtained from commercial sources, including, but not limited to, ATCC. In some embodiments, viruses are passed in the prospective animal model for 5-10 times to enhance pathogenicity for each specific animal (Ginsberg and Johnson, Infect. Immun., 13:1221 (1976)). In some embodiments, the virus is collected and propagated in tissue culture and then purified using density gradient concentration and ultracentrifugation (Garlinghouse et al., Lab Anim Sci., 37:437 (1987); and Mahy, Br. Med. Bull., 41:50 (1985)). The Plaque Forming Units (PFU) are calculated in the appropriate tissue culture cells.
Lethal dose and/or infectious dose for each pathogen can be calculated using any suitable method, including, but not limited to, by administering different doses of the pathogens to the animals by the infective route and identifying the doses which result in the expected result of either animal sickness or death based on previous publications (Fortier et al., Infect Immun., 59:2922 (1991); Jacoby, Exp Gerontol., 29:89 (1994); and Salit et al., Can J Microbiol., 30:1022 (1984)).
C. Nanoemulsions
The nanoemulsion vaccine compositions of the present invention are not limited to any particular nanoemulsion. Any number of suitable nanoemulsion compositions may be utilized in the vaccine compositions of the present invention, including, but not limited to, those disclosed in Hamouda et al., J. Infect Dis., 180:1939 (1999); Hamouda and Baker, J. Appl. Microbiol., 89:397 (2000); and Donovan et al., Antivir. Chem. Chemother., 11:41 (2000), as well as those shown in Tables 1 and 2 and FIGS. 4 and 9. Preferred nanoemulsions of the present invention are those that are effective in killing or inactivating pathogens and that are non-toxic to animals. Accordingly, preferred emulsion formulations utilize non-toxic solvents, such as ethanol, and achieve more effective killing at lower concentrations of emulsion. In preferred embodiments, nanoemulsions utilized in the methods of the present invention are stable, and do not decompose even after long storage periods (e.g., one or more years). Additionally, preferred emulsions maintain stability even after exposure to high temperature and freezing. This is especially useful if they are to be applied in extreme conditions (e.g., on a battlefield). In some embodiments, one of the nanoemulsions described in Table 1 and or FIG. 4 or 9 is utilized.
In some preferred embodiments, the emulsions comprise (i) an aqueous phase; (ii) an oil phase; and at least one additional compound. In some embodiments of the present invention, these additional compounds are admixed into either the aqueous or oil phases of the composition. In other embodiments, these additional compounds are admixed into a composition of previously emulsified oil and aqueous phases. In certain of these embodiments, one or more additional compounds are admixed into an existing emulsion composition immediately prior to its use. In other embodiments, one or more additional compounds are admixed into an existing emulsion composition prior to the compositions immediate use.
Additional compounds suitable for use in the compositions of the present invention include but are not limited to one or more, organic, and more particularly, organic phosphate based solvents, surfactants and detergents, quaternary ammonium containing compounds, cationic halogen containing compounds, germination enhancers, interaction enhancers, and pharmaceutically acceptable compounds. Certain exemplary embodiments of the various compounds contemplated for use in the compositions of the present invention are presented below.
| TABLE 1 |
| Nanoemulsion Formulations |
| Water to Oil Phase | ||
| Name | Oil Phase Formula | Ratio (Vol/Vol) |
| X8P | 1 vol. Tri(N-butyl)phosphate | 4:1 |
| 1 vol. TRITON X-100 | ||
| 8 vol. Soybean oil | ||
| NN | 86.5 g Glycerol monooleate | 3:1 |
| 60.1 ml Nonoxynol-9 | ||
| 24.2 g GENEROL 122 | ||
| 3.27 g Cetylpyridinium chloride | ||
| 554 g Soybean oil | ||
| W808P | 86.5 g Glycerol monooleate | 3.2:1 |
| 21.2 g Polysorbate 60 | ||
| 24.2 g GENEROL 122 | ||
| 3.27 g Cetylpyddinium chloride | ||
| 4 ml Peppermint oil | ||
| 554 g Soybean oil | ||
| SS | 86.5 g Glycerol monooleate | 3.2:1 |
| 21.2 g Polysorbate 60 | (1% bismuth in water) | |
| 24.2 g GENEROL 122 | ||
| 3.27 g Cetylpyridinium chloride | ||
| 554 g Soybean oil | ||
| TABLE 2 |
| Nanoemulsion Formulations |
| Nanoemulsion | Composition |
| X8P | 8% TRITON X-100; 8% Tributyl phosphate; |
| 64% Soybean oil; 20% Water | |
| W205EC | 5% TWEEN 20; 8% Ethanol; 1% Cetylpyridinium |
| Chloride; 64% Soybean oil; 22% Water | |
| EC | 1% Cetylpyridinium Chloride; 8% Ethanol; |
| 64% Soybean oil; 27% Water | |
| Y3EC | 3% TYLOXAPOL; 1% Cetylpyridinium Chloride; |
| 8% Ethanol; 64% Soybean oil; 24% Water | |
| X4E | 4% TRITON X-100; 8% Ethanol; 64% Soybean oil; |
| 24% Water | |
Some embodiments of the present invention employ an oil phase containing ethanol. For example, in some embodiments, the emulsions of the present invention contain (i) an aqueous phase and (ii) an oil phase containing ethanol as the organic solvent and optionally a germination enhancer, and (iii) TYLOXAPOL as the surfactant (preferably 2-5%, more preferably 3%). This formulation is highly efficacious against microbes and is also non-irritating and non-toxic to mammalian users (and can thus be contacted with mucosal membranes).
In some other embodiments, the emulsions of the present invention comprise a first emulsion emulsified within a second emulsion, wherein (a) the first emulsion comprises (i) an aqueous phase; and (ii) an oil phase comprising an oil and an organic solvent; and (iii) a surfactant; and (b) the second emulsion comprises (i) an aqueous phase; and (ii) an oil phase comprising an oil and a cationic containing compound; and (iii) a surfactant.
The following description provides a number of exemplary emulsions including formulations for compositions X8P and X8W60PC. X8P comprises a water-in oil nanoemulsion, in which the oil phase was made from soybean oil, tri-n-butyl phosphate, and TRITON X-100 in 80% water. X8W60PC comprises a mixture of equal volumes of X8P with W808P. W808P is a liposome-like compound made of glycerol monostearate, refined soya sterols (e.g., GENEROL sterols), TWEEN 60, soybean oil, a cationic ion halogen-containing CPC and peppermint oil. The GENEROL family are a group of a polyethoxylated soya sterols (Henkel Corporation, Ambler, Pa.). Emulsion formulations are given in Table 1 for certain embodiments of the present invention. These particular formulations may be found in U.S. Pat. No. 5,700,679 (NN); U.S. Pat. Nos. 5,618,840; 5,549,901 (W808P); and U.S. Pat. No. 5,547,677, herein incorporated by reference in their entireties.
The X8W60PC emulsion is manufactured by first making the W808P emulsion and X8P emulsions separately. A mixture of these two emulsions is then re-emulsified to produce a fresh emulsion composition termed X8W60PC. Methods of producing such emulsions are described in U.S. Pat. Nos. 5,103,497 and 4,895,452 (herein incorporated by reference in their entireties). These compounds have broad-spectrum antimicrobial activity, and are able to inactivate vegetative bacteria through membrane disruption.
The compositions listed above are only exemplary and those of skill in the art will be able to alter the amounts of the components to arrive at a nanoemulsion composition suitable for the purposes of the present invention. Those skilled in the art will understand that the ratio of oil phase to water as well as the individual oil carrier, surfactant CPC and organic phosphate buffer, components of each composition may vary.
Although certain compositions comprising X8P have a water to oil ratio of 4:1, it is understood that the X8P may be formulated to have more or less of a water phase. For example, in some embodiments, there is 3, 4, 5, 6, 7, 8, 9, 10, or more parts of the water phase to each part of the oil phase. The same holds true for the W808P formulation. Similarly, the ratio of Tri(N-butyl)phosphate:TRITON X-100:soybean oil also may be varied.
Although Table 1 lists specific amounts of glycerol monooleate, polysorbate 60, GENEROL 122, cetylpyridinium chloride, and carrier oil for W808P, these are merely exemplary. An emulsion that has the properties of W808P may be formulated that has different concentrations of each of these components or indeed different components that will fulfill the same function. For example, the emulsion may have between about 80 to about 100 g of glycerol monooleate in the initial oil phase. In other embodiments, the emulsion may have between about 15 to about 30 g polysorbate 60 in the initial oil phase. In yet another embodiment the composition may comprise between about 20 to about 30 g of a GENEROL sterol, in the initial oil phase.
The nanoemulsions structure of the certain embodiments of the emulsions of the present invention may play a role in their biocidal activity as well as contributing to the non-toxicity of these emulsions. For example, the active component in X8P, TRITON-X100 shows less biocidal activity against virus at concentrations equivalent to 11% X8P. Adding the oil phase to the detergent and solvent markedly reduces the toxicity of these agents in tissue culture at the same concentrations. While not being bound to any theory (an understanding of the mechanism is not necessary to practice the present invention, and the present invention is not limited to any particular mechanism), it is suggested that the nanoemulsion enhances the interaction of its components with the pathogens thereby facilitating the inactivation of the pathogen and reducing the toxicity of the individual components. It should be noted that when all the components of X8P are combined in one composition but are not in a nanoemulsion structure, the mixture is not as effective as an antimicrobial as when the components are in a nanoemulsion structure.
Numerous additional embodiments presented in classes of formulations with like compositions are presented below. The effect of a number of these compositions as antipathogenic materials is provided in FIG. 9. The following compositions recite various ratios and mixtures of active components. One skilled in the art will appreciate that the below recited formulation are exemplary and that additional formulations comprising similar percent ranges of the recited components are within the scope of the present invention.
In certain embodiments of the present invention, the inventive formulation comprise from about 3 to 8 vol. % of TYLOXAPOL, about 8 vol. % of ethanol, about 1 vol. % of cetylpyridinium chloride (CPC), about 60 to 70 vol. % oil (e.g., soybean oil), about 15 to 25 vol. % of aqueous phase (e.g., DiH2O or PBS), and in some formulations less than about 1 vol. % of 1N NaOH. Some of these embodiments comprise PBS. It is contemplated that the addition of 1N NaOH and/or PBS in some of these embodiments, allows the user to advantageously control the pH of the formulations, such that pH ranges from about 4.0 to about 10.0, and more preferably from about 7.1 to 8.5 are achieved. For example, one embodiment of the present invention comprises about 3 vol. % of TYLOXAPOL, about 8 vol. % of ethanol, about 1 vol. % of CPC, about 64 vol. % of soybean oil, and about 24 vol. % of DiH2O (designated herein as Y3EC). Another similar embodiment comprises about 3.5 vol. % of TYLOXAPOL, about 8 vol. % of ethanol, and about 1 vol. % of CPC, about 64 vol. % of soybean oil, and about 23.5 vol. % of DiH2O (designated herein as Y3.5EC). Yet another embodiment comprises about 3 vol. % of TYLOXAPOL, about 8 vol. % of ethanol, about 1 vol. % of CPC, about 0.067 vol. % of 1N NaOH, such that the pH of the formulation is about 7.1, about 64 vol. % of soybean oil, and about 23.93 vol. % of DiH2O (designated herein as Y3EC pH 7.1). Still another embodiment comprises about 3 vol. % of TYLOXAPOL, about 8 vol. % of ethanol, about 1 vol. % of CPC, about 0.67 vol. % of 1N NaOH, such that the pH of the formulation is about 8.5, and about 64 vol. % of soybean oil, and about 23.33 vol. % of DiH2O (designated herein as Y3EC pH 8.5). Another similar embodiment comprises about 4% TYLOXAPOL, about 8 vol. % ethanol, about 1% CPC, and about 64 vol. % of soybean oil, and about 23 vol. % of DiH2O (designated herein as Y4EC). In still another embodiment the formulation comprises about 8% TYLOXAPOL, about 8% ethanol, about 1 vol. % of CPC, and about 64 vol. % of soybean oil, and about 19 vol. % of DiH2O (designated herein as Y8EC). A further embodiment comprises about 8 vol. % of TYLOXAPOL, about 8 vol. % of ethanol, about 1 vol. % of CPC, about 64 vol. % of soybean oil, and about 19 vol. % of 1×PBS (designated herein as Y8EC PBS).
In some embodiments of the present invention, the inventive formulations comprise about 8 vol. % of ethanol, and about 1 vol. % of CPC, and about 64 vol. % of oil (e.g., soybean oil), and about 27 vol. % of aqueous phase (e.g., DiH2O or PBS) (designated herein as EC).
In the present invention, some embodiments comprise from about 8 vol. % of sodium dodecyl sulfate (SDS), about 8 vol. % of tributyl phosphate (TBP), and about 64 vol. % of oil (e.g., soybean oil), and about 20 vol. % of aqueous phase (e.g., DiH2O or PBS) (designated herein as S8P).
In certain embodiments of the present invention, the inventive formulation comprise from about 1 to 2 vol. % of TRITON X-100, from about 1 to 2 vol. % of TYLOXAPOL, from about 7 to 8 vol. % of ethanol, about 1 vol. % of cetylpyridinium chloride (CPC), about 64 to 57.6 vol. % of oil (e.g., soybean oil), and about 23 vol. % of aqueous phase (e.g., DiH2O or PBS). Additionally, some of these formulations further comprise about 5 mM of L-alanine/Inosine, and about 10 mM ammonium chloride. Some of these formulations comprise PBS. It is contemplated that the addition of PBS in some of these embodiments, allows the user to advantageously control the pH of the formulations. For example, one embodiment of the present invention comprises about 2 vol. % of TRITON X-100, about 2 vol. % of TYLOXAPOL, about 8 vol. % of ethanol, about 1 vol. % CPC, about 64 vol. % of soybean oil, and about 23 vol. % of aqueous phase DiH2O. In another embodiment the formulation comprises about 1.8 vol. % of TRITON X-100, about 1.8 vol. % of TYLOXAPOL, about 7.2 vol. % of ethanol, about 0.9 vol. % of CPC, about 5 mM L-alanine/Inosine, and about 10 mM ammonium chloride, about 57.6 vol. % of soybean oil, and the remainder of 1×PBS (designated herein as 90% X2Y2EC/GE).
In alternative embodiments of the present invention, the formulations comprise from about 5 vol. % of TWEEN 80, from about 8 vol. % of ethanol, from about 1 vol. % of CPC, about 64 vol. % of oil (e.g., soybean oil), and about 22 vol. % of DiH2O (designated herein as W805EC).
In still other embodiments of the present invention, the formulations comprise from about 5 vol. % of TWEEN 20, from about 8 vol. % of ethanol, from about 1 vol. % of CPC, about 64 vol. % of oil (e.g., soybean oil), and about 22 vol. % of DiH2O (designated herein as W205EC).
In still other embodiments of the present invention, the formulations comprise from about 2 to 8 vol. % of TRITON X-100, about 8 vol. % of ethanol, about 1 vol. % of CPC, about 60 to 70 vol. % of oil (e.g., soybean, or olive oil), and about 15 to 25 vol. % of aqueous phase (e.g., DiH2O or PBS). For example, the present invention contemplates formulations comprising about 2 vol. % of TRITON X-100, about 8 vol. % of ethanol, about 64 vol. % of soybean oil, and about 26 vol. % of DiH2O (designated herein as X2E). In other similar embodiments, the formulations comprise about 3 vol. % of TRITON X-100, about 8 vol. % of ethanol, about 64 vol. % of soybean oil, and about 25 vol. % of DiH2O (designated herein as X3E). In still further embodiments, the formulations comprise about 4 vol. % TRITON X-100, about 8 vol. % of ethanol, about 64 vol. % of soybean oil, and about 24 vol. % of DiH2O (designated herein as X4E). In yet other embodiments, the formulations comprise about 5 vol. % of TRITON X-100, about 8 vol. % of ethanol, about 64 vol. % of soybean oil, and about 23 vol. % of DiH2O (designated herein as X5E). Another embodiment of the present invention comprises about 6 vol. % of TRITON X-100, about 8 vol. % of ethanol, about 64 vol. % of soybean oil, and about 22 vol. % of DiH2O (designated herein as X6E). In still further embodiments of the present invention, the formulations comprise about 8 vol. % of TRITON X-100, about 8 vol. % of ethanol, about 64 vol. % of soybean oil, and about 20 vol. % of DiH2O (designated herein as X8E). In still further embodiments of the present invention, the formulations comprise about 8 vol. % of TRITON X-100, about 8 vol. % of ethanol, about 64 vol. % of olive oil, and about 20 vol. % of DiH2O (designated herein as X8E 0). In yet another embodiment comprises 8 vol. % of TRITON X-100, about 8 vol. % ethanol, about 1 vol. % CPC, about 64 vol. % of soybean oil, and about 19 vol. % of DiH2O (designated herein as X8EC).
In alternative embodiments of the present invention, the formulations comprise from about 1 to 2 vol. % of TRITON X-100, from about 1 to 2 vol. % of TYLOXAPOL, from about 6 to 8 vol. % TBP, from about 0.5 to 1.0 vol. % of CPC, from about 60 to 70 vol. % of oil (e.g., soybean), and about 1 to 35 vol. % of aqueous phase (e.g., DiH2O or PBS). Additionally, certain of these formulations may comprise from about 1 to 5 vol. % of trypticase soy broth, from about 0.5 to 1.5 vol. % of yeast extract, about 5 mM L-alanine/Inosine, about 10 mM ammonium chloride, and from about 20-40 vol. % of liquid baby formula. In some of the embodiments comprising liquid baby formula, the formula comprises a casein hydrolysate (e.g., Neutramigen, or Progestimil, and the like). In some of these embodiments, the inventive formulations further comprise from about 0.1 to 1.0 vol. % of sodium thiosulfate, and from about 0.1 to 1.0 vol. % of sodium citrate. Other similar embodiments comprising these basic components employ phosphate buffered saline (PBS) as the aqueous phase. For example, one embodiment comprises about 2 vol. % of TRITON X-100, about 2 vol. % TYLOXAPOL, about 8 vol. % TBP, about 1 vol. % of CPC, about 64 vol. % of soybean oil, and about 23 vol. % of DiH2O (designated herein as X2Y2EC). In still other embodiments, the inventive formulation comprises about 2 vol. % of TRITON X-100, about 2 vol. % TYLOXAPOL, about 8 vol. % TBP, about 1 vol. % of CPC, about 0.9 vol. % of sodium thiosulfate, about 0.1 vol. % of sodium citrate, about 64 vol. % of soybean oil, and about 22 vol. % of DiH2O (designated herein as X2Y2PC STS1). In another similar embodiment, the formulations comprise about 1.7 vol. % TRITON X-100, about 1.7 vol. % TYLOXAPOL, about 6.8 vol. % TBP, about 0.85% CPC, about 29.2% NEUTRAMIGEN, about 54.4 vol. % of soybean oil, and about 4.9 vol. % of DiH2O (designated herein as 85% X2Y2PC/baby). In yet another embodiment of the present invention, the formulations comprise about 1.8 vol. % of TRITON X-100, about 1.8 vol. % of TYLOXAPOL, about 7.2 vol. % of TBP, about 0.9 vol. % of CPC, about 5 mM L-alanine/Inosine, about 10 mM ammonium chloride, about 57.6 vol. % of soybean oil, and the remainder vol. % of 0.1×PBS (designated herein as 90% X2Y2 PC/GE). In still another embodiment, the formulations comprise about 1.8 vol. % of TRITON X-100, about 1.8 vol. % of TYLOXAPOL, about 7.2 vol. % TBP, about 0.9 vol. % of CPC, and about 3 vol. % trypticase soy broth, about 57.6 vol. % of soybean oil, and about 27.7 vol. % of DiH2O (designated herein as 90% X2Y2PC/TSB). In another embodiment of the present invention, the formulations comprise about 1.8 vol. % TRITON X-100, about 1.8 vol. % TYLOXAPOL, about 7.2 vol. % TBP, about 0.9 vol. % CPC, about 1 vol. % yeast extract, about 57.6 vol. % of soybean oil, and about 29.7 vol. % of DiH2O (designated herein as 90% X2Y2PC/YE).
In some embodiments of the present invention, the inventive formulations comprise about 3 vol. % of TYLOXAPOL, about 8 vol. % of TBP, and about 1 vol. % of CPC, about 60 to 70 vol. % of oil (e.g., soybean or olive oil), and about 15 to 30 vol. % of aqueous phase (e.g., DiH2O or PBS). In a particular embodiment of the present invention, the inventive formulations comprise about 3 vol. % of TYLOXAPOL, about 8 vol. % of TBP, and about 1 vol. % of CPC, about 64 vol. % of soybean, and about 24 vol. % of DiH2O (designated herein as Y3PC).
In some embodiments of the present invention, the inventive formulations comprise from about 4 to 8 vol. % of TRITON X-100, from about 5 to 8 vol. % of TBP, about 30 to 70 vol. % of oil (e.g., soybean or olive oil), and about 0 to 30 vol. % of aqueous phase (e.g., DiH2O or PBS). Additionally, certain of these embodiments further comprise about 1 vol. % of CPC, about 1 vol. % of benzalkonium chloride, about 1 vol. % cetylyridinium bromide, about 1 vol. % cetyldimethyletylammonium bromide, 500 μM EDTA, about 10 mM ammonium chloride, about 5 mM Inosine, and about 5 mM L-alanine. For example, in certain of these embodiments, the inventive formulations comprise about 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 64 vol. % of soybean oil, and about 20 vol. % of DiH2O (designated herein as X8P). In another embodiment of the present invention, the inventive formulations comprise about 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 1% of CPC, about 64 vol. % of soybean oil, and about 19 vol. % of DiH2O (designated herein as X8PC). In still another embodiment, the formulations comprise about 8 vol. % TRITON X-100, about 8 vol. % of TBP, about 1 vol. % of CPC, about 50 vol. % of soybean oil, and about 33 vol. % of DiH2O (designated herein as ATB-X1001). In yet another embodiment, the formulations comprise about 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 2 vol. % of CPC, about 50 vol. % of soybean oil, and about 32 vol. % of DiH2O (designated herein as ATB-X002). Another embodiment of the present invention comprises about 4 vol. % TRITON X-100, about 4 vol. % of TBP, about 0.5 vol. % of CPC, about 32 vol. % of soybean oil, and about 59.5 vol. % of DiH2O (designated herein as 50% X8PC). Still another related embodiment comprises about 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 0.5 vol. % CPC, about 64 vol. % of soybean oil, and about 19.5 vol. % of DiH2O (designated herein as X8PC1/2). In some embodiments of the present invention, the inventive formulations comprise about 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 2 vol. % of CPC, about 64 vol. % of soybean oil, and about 18 vol. % of DiH2O (designated herein as X8PC2). In other embodiments, the inventive formulations comprise about 8 vol. % of TRITON X-100, about 8% of TBP, about 1% of benzalkonium chloride, about 50 vol. % of soybean oil, and about 33 vol. % of DiH2O (designated herein as X8P BC). In an alternative embodiment of the present invention, the formulation comprise about 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 1 vol. % of cetylyridinium bromide, about 50 vol. % of soybean oil, and about 33 vol. % of DiH2O (designated herein as X8P CPB). In another exemplary embodiment of the present invention, the formulations comprise about 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 1 vol. % of cetyldimethyletylammonium bromide, about 50 vol. % of soybean oil, and about 33 vol. % of DiH2O (designated herein as X8P CTAB). In still further embodiments, the present invention comprises about 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 1 vol. % of CPC, about 500 μM EDTA, about 64 vol. % of soybean oil, and about 15.8 vol. % DiH2O (designated herein as X8PC EDTA). Additional similar embodiments comprise 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 1 vol. % of CPC, about 10 mM ammonium chloride, about 5 mM Inosine, about 5 mM L-alanine, about 64 vol. % of soybean oil, and about 19 vol. % of DiH2O or PBS (designated herein as X8PC GE1x). In another embodiment of the present invention, the inventive formulations further comprise about 5 vol. % of TRITON X-100, about 5% of TBP, about 1 vol. % of CPC, about 40 vol. % of soybean oil, and about 49 vol. % of DiH2O (designated herein as X5P5C).
In some embodiments of the present invention, the inventive formulations comprise about 2 vol. % TRITON X-100, about 6 vol. % TYLOXAPOL, about 8 vol. % ethanol, about 64 vol. % of soybean oil, and about 20 vol. % of DiH2O. (designated herein as X2Y6E).
In an additional embodiment of the present invention, the formulations comprise about 8 vol. % of TRITON X-100, and about 8 vol. % of glycerol, about 60 to 70 vol. % of oil (e.g., soybean or olive oil), and about 15 to 25 vol. % of aqueous phase (e.g., DiH2O or PBS). Certain related embodiments further comprise about 1 vol. % L-ascorbic acid. For example, one particular embodiment comprises about 8 vol. % of TRITON X-100, about 8 vol. % of glycerol, about 64 vol. % of soybean oil, and about 20 vol. % of DiH2O (designated herein as X8G). In still another embodiment, the inventive formulations comprise about 8 vol. % of TRITON X-100, about 8 vol. % of glycerol, about 1 vol. % of L-ascorbic acid, about 64 vol. % of soybean oil, and about 19 vol. % of DiH2O (designated herein as X8GVc).
In still further embodiments, the inventive formulations comprise about 8 vol. % of TRITON X-100, from about 0.5 to 0.8 vol. % of TWEEN 60, from about 0.5 to 2.0 vol. % of CPC, about 8 vol. % of TBP, about 60 to 70 vol. % of oil (e.g., soybean or olive oil), and about 15 to 25 vol. % of aqueous phase (e.g., DiH2O or PBS). For example, in one particular embodiment the formulations comprise about 8 vol. % of TRITON X-100, about 0.70 vol. % of TWEEN 60, about 1 vol. % of CPC, about 8 vol. % of TBP, about 64 vol. % of soybean oil, and about 18.3 vol. % of DiH2O (designated herein as X8W60PC1). Another related embodiment comprises about 8 vol. % of TRITON X-100, about 0.71 vol. % of TWEEN 60, about 1 vol. % of CPC, about 8 vol. % of TBP, about 64 vol. % of soybean oil, and about 18.29 vol. % of DiH2O (designated herein as W600.7X8PC). In yet other embodiments, the inventive formulations comprise from about 8 vol. % of TRITON X-100, about 0.7 vol. % of TWEEN 60, about 0.5 vol. % of CPC, about 8 vol. % of TBP, about 64 to 70 vol. % of soybean oil, and about 18.8 vol. % of DiH2O (designated herein as X8W60PC2). In still other embodiments, the present invention comprises about 8 vol. % of TRITON X-100, about 0.71 vol. % of TWEEN 60, about 2 vol. % of CPC, about 8 vol. % of TBP, about 64 vol. % of soybean oil, and about 17.3 vol. % of DiH2O. In another embodiment of the present invention, the formulations comprise about 0.71 vol. % of TWEEN 60, about 1 vol. % of CPC, about 8 vol. % of TBP, about 64 vol. % of soybean oil, and about 25.29 vol. % of DiH2O (designated herein as W600.7PC).
In another embodiment of the present invention, the inventive formulations comprise about 2 vol. % of dioctyl sulfosuccinate, either about 8 vol. % of glycerol, or about 8 vol. % TBP, in addition to, about 60 to 70 vol. % of oil (e.g., soybean or olive oil), and about 20 to 30 vol. % of aqueous phase (e.g., DiH2O or PBS). For example, one embodiment of the present invention comprises about 2 vol. % of dioctyl sulfosuccinate, about 8 vol. % of glycerol, about 64 vol. % of soybean oil, and about 26 vol. % of DiH2O (designated herein as D2G). In another related embodiment, the inventive formulations comprise about 2 vol. % of dioctyl sulfosuccinate, and about 8 vol. % of TBP, about 64 vol. % of soybean oil, and about 26 vol. % of DiH2O (designated herein as D2P).
In still other embodiments of the present invention, the inventive formulations comprise about 8 to 10 vol. % of glycerol, and about 1 to 10 vol. % of CPC, about 50 to 70 vol. % of oil (e.g., soybean or olive oil), and about 15 to 30 vol. % of aqueous phase (e.g., DiH2O or PBS). Additionally, in certain of these embodiments, the compositions further comprise about 1 vol. % of L-ascorbic acid. For example, one particular embodiment comprises about 8 vol. % of glycerol, about 1 vol. % of CPC, about 64 vol. % of soybean oil, and about 27 vol. % of DiH2O (designated herein as GC). An additional related embodiment comprises about 10 vol. % of glycerol, about 10 vol. % of CPC, about 60 vol. % of soybean oil, and about 20 vol. % of DiH2O (designated herein as GC10). In still another embodiment of the present invention, the inventive formulations comprise about 10 vol. % of glycerol, about 1 vol. % of CPC, about 1 vol. % of L-ascorbic acid, about 64 vol. % of soybean or oil, and about 24 vol. % of DiH2O (designated herein as GCVc).
In some embodiments of the present invention, the inventive formulations comprise about 8 to 10 vol. % of glycerol, about 8 to 10 vol. % of SDS, about 50 to 70 vol. % of oil (e.g., soybean or olive oil), and about 15 to 30 vol. % of aqueous phase (e.g., DiH2O or PBS). Additionally, in certain of these embodiments, the compositions further comprise about 1 vol. % of lecithin, and about 1 vol. % of p-Hydroxybenzoic acid methyl ester. Exemplary embodiments of such formulations comprise about 8 vol. % SDS, 8 vol. % of glycerol, about 64 vol. % of soybean oil, and about 20 vol. % of DiH2O (designated herein as S8G). A related formulation comprises about 8 vol. % of glycerol, about 8 vol. % of SDS, about 1 vol. % of lecithin, about 1 vol. % of p-Hydroxybenzoic acid methyl ester, about 64 vol. % of soybean oil, and about 18 vol. % of DiH2O (designated herein as S8GL1B1).
In yet another embodiment of the present invention, the inventive formulations comprise about 4 vol. % of TWEEN 80, about 4 vol. % of TYLOXAPOL, about 1 vol. % of CPC, about 8 vol. % of ethanol, about 64 vol. % of soybean oil, and about 19 vol. % of DiH2O (designated herein as W804Y4EC).
In some embodiments of the present invention, the inventive formulations comprise about 0.01 vol. % of CPC, about 0.08 vol. % of TYLOXAPOL, about 10 vol. % of ethanol, about 70 vol. % of soybean oil, and about 19.91 vol. % of DiH2O (designated herein as Y.08EC.01).
In yet another embodiment of the present invention, the inventive formulations comprise about 8 vol. % of sodium lauryl sulfate, and about 8 vol. % of glycerol, about 64 vol. % of soybean oil, and about 20 vol. % of DiH2O (designated herein as SLS8G).
The specific formulations described above are simply examples to illustrate the variety of compositions that find use in the present invention. The present invention contemplates that many variations of the above formulation, as well as additional nanoemulsions, find use in the methods of the present invention. To determine if a candidate emulsion is suitable for use with the present invention, three criteria may be analyzed. Using the methods and standards described herein, candidate emulsions can be easily tested to determine if they are suitable. First, the desired ingredients are prepared using the methods described herein, to determine if an emulsion can be formed. If an emulsion cannot be formed, the candidate is rejected. For example, a candidate composition made of 4.5% sodium thiosulfate, 0.5% sodium citrate, 10% n-butanol, 64% soybean oil, and 21% DiH2O did not form an emulsion.
Second, in preferred embodiments, the candidate emulsion should form a stable emulsion. An emulsion is stable if it remains in emulsion form for a sufficient period to allow its intended use. For example, for emulsions that are to be stored, shipped, etc., it may be desired that the composition remain in emulsion form for months to years. Typical emulsions that are relatively unstable, will lose their form within a day. For example, a candidate composition made of 8% 1-butanol, 5% TWEEN 10, 1% CPC, 64% soybean oil, and 22% DiH2O did not form a stable emulsion. The following candidate emulsions were shown to be stable using the methods described herein: 0.08% TRITON X-100, 0.08% Glycerol, 0.01% Cetylpyridinium Chloride, 99% Butter, and 0.83% diH2O (designated herein as 1% X8GC Butter); 0.8% TRITON X-100, 0.8% Glycerol, 0.1% Cetylpyridinium Chloride, 6.4% Soybean Oil, 1.9% diH2O, and 90% Butter (designated herein as 10% X8GC Butter); 2% W205EC, 1% Natrosol 250L NF, and 97% diH2O (designated herein as 2% W205EC L GEL); 1% Cetylpyridinium Chloride, 5% TWEEN 20, 8% Ethanol, 64% 70 Viscosity Mineral Oil, and 22% diH2O (designated herein as W205EC 70 Mineral Oil); 1% Cetylpyridinium Chloride, 5% TWEEN 20, 8% Ethanol, 64% 350 Viscosity Mineral Oil, and 22% diH2O (designated herein as W205EC 350 Mineral Oil).
Third, the candidate emulsion should have efficacy for its intended use. For example, an anti-bacterial emulsion should kill or disable pathogens to a detectable level. As shown herein, certain emulsions of the present invention have efficacy against specific microorganisms, but not against others. Using the methods described herein, one is capable of determining the suitability of a particular candidate emulsion against the desired microorganism. Generally, this involves exposing the microorganism to the emulsion for one or more time periods in a side-by-side experiment with the appropriate control samples (e.g., a negative control such as water) and determining if, and to what degree, the emulsion kills or disables the microorganism. For example, a candidate composition made of 1% ammonium chloride, 5% TWEEN 20, 8% ethanol, 64% soybean oil, and 22% DiH2O was shown not to be an effective emulsion. The following candidate emulsions were shown to be effective using the methods described herein: 5% TWEEN 20, 5% Cetylpyridinium Chloride, 10% Glycerol, 60% Soybean Oil, and 20% diH2O (designated herein as W205GC5); 1% Cetylpyridinium Chloride, 5% TWEEN 20, 10% Glycerol, 64% Soybean Oil, and 20% diH2O (designated herein as W205GC); 1% Cetylpyridinium Chloride, 5% TWEEN 20, 8% Ethanol, 64% Olive Oil, and 22% diH2O (designated herein as W205EC Olive Oil); 1% Cetylpyridinium Chloride, 5% TWEEN 20, 8% Ethanol, 64% Flaxseed Oil, and 22% diH2O (designated herein as W205EC Flaxseed Oil); 1% Cetylpyridinium Chloride, 5% TWEEN 20, 8% Ethanol, 64% Corn Oil, and 22% diH2O (designated herein as W205EC Corn Oil); 1% Cetylpyridinium Chloride, 5% TWEEN 20, 8% Ethanol, 64% Coconut Oil, and 22% diH2O (designated herein as W205EC Coconut Oil); 1% Cetylpyridinium Chloride, 5% TWEEN 20, 8% Ethanol, 64% Cottonseed Oil, and 22% diH2O (designated herein as W205EC Cottonseed Oil); 8% Dextrose, 5% TWEEN 10, 1% Cetylpyridinium Chloride, 64% Soybean Oil, and 22% diH2O (designated herein as W205C Dextrose); 8% PEG 200, 5% TWEEN 10, 1% Cetylpyridinium Chloride, 64% Soybean Oil, and 22% diH2O (designated herein as W205C PEG 200); 8% Methanol, 5% TWEEN 10, 1% Cetylpyridinium Chloride, 64% Soybean Oil, and 22% diH2O (designated herein as W205C Methanol); 8% PEG 1000, 5% TWEEN 10, 1% Cetylpyridinium Chloride, 64% Soybean Oil, and 22% diH2O (designated herein as W205C PEG 1000); 2% W205EC, 2% Natrosol 250H NF, and 96% diH2O (designated herein as 2% W205EC Natrosol 2, also called 2% W205EC GEL); 2% W205EC, 1% Natrosol 250H NF, and 97% diH2O (designated herein as 2% W205EC Natrosol 1); 2% W205EC, 3% Natrosol 250H NF, and 95% diH2O (designated herein as 2% W205EC Natrosol 3); 2% W205EC, 0.5% Natrosol 250H NF, and 97.5% diH2O (designated herein as 2% W205EC Natrosol 0.5); 2% W205EC, 2% Methocel A, and 96% diH2O (designated herein as 2% W205EC Methocel A); 2% W205EC, 2% Methocel K, and 96% diH2O (designated herein as 2% W205EC Methocel K); 2% Natrosol, 0.1% X8PC, 0.1×PBS, 5 mM L-alanine, 5 mM Inosine, 10 mM Ammonium Chloride, and diH2O (designated herein as 0.1% X8PC/GE+2% Natrosol); 2% Natrosol, 0.8% TRITON X-100, 0.8% Tributyl Phosphate, 6.4% Soybean Oil, 0.1% Cetylpyridinium Chloride, 0.1×PBS, 5 mM L-alanine, 5 mM Inosine, 10 mM Ammonium Chloride, and diH2O (designated herein as 10% X8PC/GE+2% Natrosol); 1% Cetylpyridinium Chloride, 5% TWEEN 20, 8% Ethanol, 64% Lard, and 22% diH2O (designated herein as W205EC Lard); 1% Cetylpyridinium Chloride, 5% TWEEN 20, 8% Ethanol, 64% Mineral Oil, and 22% diH2O (designated herein as W205EC Mineral Oil); 0.1% Cetylpyridinium Chloride, 2% Nerolidol, 5% TWEEN 20, 10% Ethanol, 64% Soybean Oil, and 18.9% diH2O (designated herein as W205EC0.1N); 0.1% Cetylpyridinium Chloride, 2% Farnesol, 5% TWEEN 20, 10% Ethanol, 64% Soybean Oil, and 18.9% diH2O (designated herein as W205ECO1F); 0.1% Cetylpyridinium Chloride, 5% TWEEN 20, 10% Ethanol, 64% Soybean Oil, and 20.9% diH2O (designated herein as W205ECO1); 10% Cetylpyridinium Chloride, 8% Tributyl Phosphate, 8% TRITON X-100, 54% Soybean Oil, and 20% diH2O (designated herein as X8PC10); 5% Cetylpyridinium Chloride, 8% TRITON X-100, 8% Tributyl Phosphate, 59% Soybean Oil, and 20% diH2O (designated herein as X8PC5); 0.02% Cetylpyridinium Chloride, 0.1% TWEEN 20, 10% Ethanol, 70% Soybean Oil, and 19.88% diH2O (designated herein as W200.1EC0.02); 1% Cetylpyridinium Chloride, 5% TWEEN 20, 8% Glycerol, 64% Mobil 1, and 22% diH2O (designated herein as W205GC Mobil 1); 7.2% TRITON X-100, 7.2% Tributyl Phosphate, 0.9% Cetylpyridinium Chloride, 57.6% Soybean Oil, 0.1×PBS, 5 mM L-alanine, 5 mM Inosine, 10 mM Ammonium Chloride, and 25.87% diH2O (designated herein as 90% X8PC/GE); 7.2% TRITON X-100, 7.2% Tributyl Phosphate, 0.9% Cetylpyridinium Chloride, 57.6% Soybean Oil, 1% EDTA, 5 mM L-alanine, 5 mM Inosine, 10 mM Ammonium Chloride, 0.1×PBS, and diH2O (designated herein as 90% X8PC/GE EDTA); and 7.2% TRITON X-100, 7.2% Tributyl Phosphate, 0.9% Cetylpyridinium Chloride, 57.6% Soybean Oil, 1% Sodium Thiosulfate, 5 mM L-alanine, 5 mM Inosine, 10 mM Ammonium Chloride, 0.1×PBS, and diH2O (designated herein as 90% X8PC/GE STS).
1. Aqueous Phase
In some embodiments, the emulsion comprises an aqueous phase. In certain preferred embodiments, the emulsion comprises about 5 to 50, preferably 10 to 40, more preferably 15 to 30, vol. % aqueous phase, based on the total volume of the emulsion (although other concentrations are also contemplated). In preferred embodiments, the aqueous phase comprises water at a pH of about 4 to 10, preferably about 6 to 8. The water is preferably deionized (hereinafter “DiH2O”). In some embodiments, the aqueous phase comprises phosphate buffered saline (PBS). In some preferred embodiments, the aqueous phase is sterile and pyrogen free.
2. Oil Phase
In some embodiments, the emulsion comprises an oil phase. In certain preferred embodiments, the oil phase (e.g., carrier oil) of the emulsion of the present invention comprises 30-90, preferably 60-80, and more preferably 60-70, vol. % of oil, based on the total volume of the emulsion (although other concentrations are also contemplated). Suitable oils include, but are not limited to, soybean oil, avocado oil, squalene oil, squalene oil, olive oil, canola oil, corn oil, rapeseed oil, safflower oil, sunflower oil, fish oils, flavor oils, water insoluble vitamins and mixtures thereof. In particularly preferred embodiments, soybean oil is used. In preferred embodiments of the present invention, the oil phase is preferably distributed throughout the aqueous phase as droplets having a mean particle size in the range from about 1-2 microns, more preferably from 0.2 to 0.8, and most preferably about 0.8 microns. In other embodiments, the aqueous phase can be distributed in the oil phase.
In some embodiments, the oil phase comprises 3-15, and preferably 5-10 vol. % of an organic solvent, based on the total volume of the emulsion. While the present invention is not limited to any particular mechanism, it is contemplated that the organic phosphate-based solvents employed in the emulsions serve to remove or disrupt the lipids in the membranes of the pathogens. Thus, any solvent that removes the sterols or phospholipids in the microbial membranes finds use in the methods of the present invention. Suitable organic solvents include, but are not limited to, organic phosphate based solvents or alcohols. In some preferred embodiments, non-toxic alcohols (e.g., ethanol) are used as a solvent. The oil phase, and any additional compounds provided in the oil phase, are preferably sterile and pyrogen free.
3. Surfactants and Detergents
In some embodiments, the emulsions further comprises a surfactant or detergent. In some preferred embodiments, the emulsion comprises from about 3 to 15%, and preferably about 10% of one or more surfactants or detergents (although other concentrations are also contemplated). While the present invention is not limited to any particular mechanism, it is contemplated that surfactants, when present in the emulsions, help to stabilize the emulsions. Both non-ionic (non-anionic) and ionic surfactants are contemplated. Additionally, surfactants from the BRIJ family of surfactants find use in the compositions of the present invention. The surfactant can be provided in either the aqueous or the oil phase. Surfactants suitable for use with the emulsions include a variety of anionic and nonionic surfactants, as well as other emulsifying compounds that are capable of promoting the formation of oil-in-water emulsions. In general, emulsifying compounds are relatively hydrophilic, and blends of emulsifying compounds can be used to achieve the necessary qualities. In some formulations, nonionic surfactants have advantages over ionic emulsifiers in that they are substantially more compatible with a broad pH range and often form more stable emulsions than do ionic (e.g., soap-type) emulsifiers. Thus, in certain preferred embodiments, the compositions of the present invention comprise one or more non-ionic surfactants such as polysorbate surfactants (e.g., polyoxyethylene ethers), polysorbate detergents, pheoxypolyethoxyethanols, and the like. Examples of polysorbate detergents useful in the present invention include, but are not limited to, TWEEN 20, TWEEN 40, TWEEN 60, TWEEN 80, etc.
TWEEN 60 (polyoxyethylenesorbitan monostearate), together with TWEEN 20, TWEEN 40 and TWEEN 80, comprise polysorbates that are used as emulsifiers in a number of pharmaceutical compositions. In some embodiments of the present invention, these compounds are also used as co-components with adjuvants. TWEEN surfactants also appear to have virucidal effects on lipid-enveloped viruses (See e.g., Eriksson et al., Blood Coagulation and Fibtinolysis 5 (Suppl. 3):S37-S44 (1994)).
Examples of pheoxypolyethoxyethanols, and polymers thereof, useful in the present invention include, but are not limited to, TRITON (e.g., X-100, X-301, X-165, X-102, X-200), and TYLOXAPOL. TRITON X-100 is a strong non-ionic detergent and dispersing agent widely used to extract lipids and proteins from biological structures. It also has virucidal effect against broad spectrum of enveloped viruses (See e.g., Maha and Igarashi, Southeast Asian J. Trop. Med. Pub. Health 28:718 (1997); and Portocala et al., Virologie 27:261 (1976)). Due to this anti-viral activity, it is employed to inactivate viral pathogens in fresh frozen human plasma (See e.g., Horowitz et al., Blood 79:826 (1992)).
The present invention is not limited to the surfactants disclosed herein. Additional surfactants and detergents useful in the compositions of the present invention may be ascertained from reference works (e.g., including, but not limited to, McCutheon's Volume 1: Emulsions and Detergents—North American Edition, 2000) and commercial sources.
4. Cationic Halogens Containg Compounds
In some embodiments, the emulsions further comprise a cationic halogen containing compound. In some preferred embodiments, the emulsion comprises from about 0.5 to 1.0 wt. % or more of a cationic halogen containing compound, based on the total weight of the emulsion (although other concentrations are also contemplated). In preferred embodiments, the cationic halogen-containing compound is preferably premixed with the oil phase; however, it should be understood that the cationic halogen-containing compound may be provided in combination with the emulsion composition in a distinct formulation. Suitable halogen containing compounds may be selected from compounds comprising chloride, fluoride, bromide and iodide ions. In preferred embodiments, suitable cationic halogen containing compounds include, but are not limited to, cetylpyridinium halides, cetyltrimethylammonium halides, cetyldimethylethylammonium halides, cetyldimethylbenzylammonium halides, cetyltributylphosphonium halides, dodecyltrimethylammonium halides, or tetradecyltrimethylammonium halides. In some particular embodiments, suitable cationic halogen containing compounds comprise, but are not limited to, cetylpyridinium chloride (CPC), cetyltrimethylammonium chloride, cetylbenzyldimethylammonium chloride, cetylpyridinium bromide (CPB), and cetyltrimethylammonium bromide (CTAB), cetyidimethylethylammonium bromide, cetyltributylphosphonium bromide, dodecyltrimethylammonium bromide, and tetrad ecyltrimethylammonium bromide. In particularly preferred embodiments, the cationic halogen-containing compound is CPC, although the compositions of the present invention are not limited to formulation with any particular cationic containing compound.
5. Germination Enhancers
In other embodiments of the present invention, the nanoemulsions further comprise a germination enhancer. In some preferred embodiments, the emulsions comprise from about 1 mM to 15 mM, and more preferably from about 5 mM to 10 mM of one or more germination enhancing compounds (although other concentrations are also contemplated). In preferred embodiments, the germination enhancing compound is provided in the aqueous phase prior to formation of the emulsion. The present invention contemplates that when germination enhancers are added to the nanoemulsion compositions, the sporicidal properties of the nanoemulsions are enhanced. The present invention further contemplates that such germination enhancers initiate sporicidal activity near neutral pH (between pH 6-8, and preferably 7). Such neutral pH emulsions can be obtained, for example, by diluting with phosphate buffer saline (PBS) or by preparations of neutral emulsions. The sporicidal activity of the nanoemulsion preferentially occurs when the spores initiate germination.
In specific embodiments, it has been demonstrated that the emulsions utilized in the vaccines of the present invention have sporicidal activity. While the present invention is not limited to any particular mechanism and an understanding of the mechanism is not required to practice the present invention, it is believed that the fusigenic component of the emulsions acts to initiate germination and before reversion to the vegetative form is complete the lysogenic component of the emulsion acts to lyse the newly germinating spore. These components of the emulsion thus act in concert to leave the spore susceptible to disruption by the emulsions. The addition of germination enhancer further facilitates the anti-sporicidal activity of the emulsions, for example, by speeding up the rate at which the sporicidal activity occurs.
Germination of bacterial endospores and fungal spores is associated with increased metabolism and decreased resistance to heat and chemical reactants. For germination to occur, the spore must sense that the environment is adequate to support vegetation and reproduction. The amino acid L-alanine stimulates bacterial spore germination (See e.g., Hills, J. Gen. Micro. 4:38 (1950); and Halvorson and Church, Bacteriol Rev. 21:112 (1957)). L-alanine and L-proline have also been reported to initiate fungal spore germination (Yanagita, Arch Mikrobiol 26:329 (1957)). Simple α-amino acids, such as glycine and L-alanine, occupy a central position in metabolism. Transamination or deamination of α-amino acids yields the glycogenic or ketogenic carbohydrates and the nitrogen needed for metabolism and growth. For example, transamination or deamination of L-alanine yields pyruvate, which is the end product of glycolytic metabolism (Embden-Meyerhof-Parnas Pathway). Oxidation of pyruvate by pyruvate dehydrogenase complex yields acetyl-CoA, NADH, H+, and CO2. Acetyl-CoA is the initiator substrate for the tricarboxylic acid cycle (Kreb's Cycle), which in turns feeds the mitochondrial electron transport chain. Acetyl-CoA is also the ultimate carbon source for fatty acid synthesis as well as for sterol synthesis. Simple α-amino acids can provide the nitrogen, CO2, glycogenic and/or ketogenic equivalents required for germination and the metabolic activity that follows.
In certain embodiments, suitable germination enhancing agents of the invention include, but are not limited to, α-amino acids comprising glycine and the L-enantiomers of alanine, valine, leucine, isoleucine, serine, threonine, lysine, phenylalanine, tyrosine, and the alkyl esters thereof. Additional information on the effects of amino acids on germination may be found in U.S. Pat. No. 5,510,104; herein incorporated by reference in its entirety. In some embodiments, a mixture of glucose, fructose, asparagine, sodium chloride (NaCl), ammonium chloride (NH4Cl), calcium chloride (CaCl2) and potassium chloride (KCl) also may be used. In particularly preferred embodiments of the present invention, the formulation comprises the germination enhancers L-alanine, CaCl2, Inosine and NH4Cl. In some embodiments, the compositions further comprise one or more common forms of growth media (e.g., trypticase soy broth, and the like) that additionally may or may not itself comprise germination enhancers and buffers.
The above compounds are merely exemplary germination enhancers and it is understood that other known germination enhancers will find use in the nanoemulsions utilized in some embodiments of the present invention. A candidate germination enhancer should meet two criteria for inclusion in the compositions of the present invention: it should be capable of being associated with the emulsions disclosed herein and it should increase the rate of germination of a target spore when incorporated in the emulsions disclosed herein. One skilled in the art can determine whether a particular agent has the desired function of acting as an germination enhancer by applying such an agent in combination with the nanoemulsions disclosed herein to a target and comparing the inactivation of the target when contacted by the admixture with inactivation of like targets by the composition of the present invention without the agent. Any agent that increases germination, and thereby decreases or inhibits the growth of the organisms, is considered a suitable enhancer for use in the nanoemulsion compositions disclosed herein.
In still other embodiments, addition of a germination enhancer (or growth medium) to a neutral emulsion composition produces a composition that is useful in inactivating bacterial spores in addition to enveloped viruses, Gram negative bacteria, and Gram positive bacteria for use in the vaccine compositions of the present invention.
6. Interaction Enhancers
In still other embodiments, nanoemulsions comprise one or more compounds capable of increasing the interaction of the compositions (i.e., “interaction enhancer”) with target pathogens (e.g., the cell wall of Gram negative bacteria such as Vibrio, Salmonella, Shigella and Pseudomonas). In preferred embodiments, the interaction enhancer is preferably premixed with the oil phase; however, in other embodiments the interaction enhancer is provided in combination with the compositions after emulsification. In certain preferred embodiments, the interaction enhancer is a chelating agent (e.g., ethylenediaminetetraacetic acid (EDTA) or ethylenebis(oxyethylenenitrilo)tetraacetic acid (EGTA) in a buffer (e.g., tris buffer)). It is understood that chelating agents are merely exemplary interaction enhancing compounds. Indeed, other agents that increase the interaction of the nanoemulsions used in some embodiments of the present invention with microbial agents and/or pathogens are contemplated. In particularly preferred embodiments, the interaction enhancer is at a concentration of about 50 to about 250 μM. One skilled in the art will be able to determine whether a particular agent has the desired function of acting as an interaction enhancer by applying such an agent in combination with the compositions of the present invention to a target and comparing the inactivation of the target when contacted by the admixture with inactivation of like targets by the composition of the present invention without the agent. Any agent that increases the interaction of an emulsion with bacteria and thereby decreases or inhibits the growth of the bacteria, in comparison to that parameter in its absence, is considered an interaction enhancer.
In some embodiments, the addition of an interaction enhancer to nanoemulsion produces a composition that is useful in inactivating enveloped viruses, some Gram positive bacteria and some Gram negative bacteria for use in the vaccine compositions of the present invention.
7. Quaternary Ammonium Compounds
In some embodiments, nanoemulsions of the present invention include a quaternary ammonium containing compound. Exemplary quaternary ammonium compounds include, but are not limited to, Alkyl dimethyl benzyl ammonium chloride, didecyl dimethyl ammonium chloride, Alkyl dimethyl benzyl and dialkyl dimethyl ammonium chloride, N,N-Dimethyl-2-hydroxypropylammonium chloride polymer, Didecyl dimethyl ammonium chloride, n-Alkyl dimethyl benzyl ammonium chloride, n-Alkyl dimethyl ethylbenzyl ammonium chloride, Dialkyl dimethyl ammonium chloride, n-Alkyl dimethyl benzyl ammonium chloride, n-Tetradecyl dimethyl benzyl ammonium chloride monohydrate, n-Alkyl dimethyl benzyl ammonium chloride, Dialkyl dimethyl ammonium chloride, Hexahydro-1,3,5-tris(2-hydroxyethyl)-s-triazine, Myristalkonium chloride (and) Quat RNIUM 14, Alkyl bis(2-hydroxyethyl)benzyl ammonium chloride, Alkyl demethyl benzyl ammonium chloride, Alkyl dimethyl 3,4-dichlorobenzyl ammonium chloride, Alkyl dimethyl benzyl ammonium chloride, Alkyl dimethyl benzyl dimethylbenzyl ammonium, Alkyl dimethyl dimethybenzyl ammonium chloride, Alkyl dimethyl ethyl ammonium bromide, Alkyl dimethyl ethyl ammonium bromide, Alkyl dimethyl ethylbenzyl ammonium chloride, Alkyl dimethyl isopropylbenzyl ammonium chloride, Alkyl trimethyl ammonium chloride, Alkyl 1 or 3 benzyl-1-(2-hydroxethyl)-2-imidazolinium chloride, Dialkyl methyl benzyl ammonium chloride, Dialkyl dimethyl ammonium chloride, Didecyl dimethyl ammonium chloride, 2-(2-(p-(Diisobutyl)cresosxy)ethoxy)ethyl dimethyl benzyl ammonium chloride, 2-(2-(p-(Diisobutyl)phenoxy)ethoxy)ethyl dimethyl benzyl ammonium chloride, Dioctyl dimethyl ammonium chloride, Dodecyl bis(2-hydroxyethyl) octyl hydrogen ammonium chloride, Dodecyl dimethyl benzyl ammonium chloride, Dodecylcarbamoyl methyl dinethyl benzyl ammonium chloride, Heptadecyl hydroxyethylimidazolinium chloride, Hexahydro-1,3,5-tris(2-hydroxyethyl)-s-triazine, Octyl decyl dimethyl ammonium chloride, Octyl dodecyl dimethyl ammonium chloride, Octyphenoxyethoxyethyl dimethyl benzyl ammonium chloride, Oxydiethylenebis(alkyl dimethyl ammonium chloride), Quaternary ammonium compounds, dicoco alkyldimethyl, chloride, Trimethoxysilyl quats, and Trimethyl dodecylbenzyl ammonium chloride.
8. Other Components
In some embodiments, a nanoemulsion comprises one or more additional components that provide a desired property or functionality to the nanoemulsions. These components may be incorporated into the aqueous phase or the oil phase of the nanoemulsions and/or may be added prior to or following emulsification. For example, in some embodiments, the nanoemulsions further comprise phenols (e.g., triclosan, phenyl phenol), acidifying agents (e.g., citric acid (e.g., 1.5-6%), acetic acid, lemon juice), alkylating agents (e.g., sodium hydroxide (e.g., 0.3%)), buffers (e.g., citrate buffer, acetate buffer, and other buffers useful to maintain a specific pH), and halogens (e.g., polyvinylpyrrolidone, sodium hypochlorite, hydrogen peroxide).
Exemplary techniques for making a nanoemulsion (e.g., used to inactivate a pathogen and/or generation of an immunogenic composition of the present ivention) are described below. Additionally, a number of specific, although exemplary, formulation recipes are also set forth below.
Formulation Techniques
Nanoemulsions of the present invention can be formed using classic emulsion forming techniques. In brief, the oil phase is mixed with the aqueous phase under relatively high shear forces (e.g., using high hydraulic and mechanical forces) to obtain an oil-in-water nanoemulsion. The emulsion is formed by blending the oil phase with an aqueous phase on a volume-to-volume basis ranging from about 1:9 to 5:1, preferably about 5:1 to 3:1, most preferably 4:1, oil phase to aqueous phase. The oil and aqueous phases can be blended using any apparatus capable of producing shear forces sufficient to form an emulsion such as French Presses or high shear mixers (e.g., FDA approved high shear mixers are available, for example, from Admix, Inc., Manchester, N.H.). Methods of producing such emulsions are described in U.S. Pat. Nos. 5,103,497 and 4,895,452, herein incorporated by reference in their entireties.
In preferred embodiments, compositions used in the methods of the present invention comprise droplets of an oily discontinuous phase dispersed in an aqueous continuous phase, such as water. In preferred embodiments, nanoemulsions of the present invention are stable, and do not decompose even after long storage periods (e.g., greater than one or more years). Furthermore, in some embodiments, nanoemulsions are stable (e.g., in some embodiments for greater than 3 months, in some embodiments for greater than 6 months, in some embodiments for greater than 12 months, in some embodiments for greater than 18 months) after combination with an immunogen (e.g., a pathogen). In preferred embodiments, nanoemulsions of the present invention are non-toxic and safe when administered (e.g., via spraying or contacting mucosal surfaces, swallowed, inhaled, etc.) to a subject.
In some embodiments, a portion of the emulsion may be in the form of lipid structures including, but not limited to, unilamellar, multilamellar, and paucliamellar lipid vesicles, micelles, and lamellar phases.
Some embodiments of the present invention employ an oil phase containing ethanol. For example, in some embodiments, the emulsions of the present invention contain (i) an aqueous phase and (ii) an oil phase containing ethanol as the organic solvent and optionally a germination enhancer, and (iii) TYLOXAPOL as the surfactant (preferably 2-5%, more preferably 3%). This formulation is highly efficacious for inactivation of pathogens and is also non-irritating and non-toxic to mammalian subjects (e.g., and thus can be used for administration to a mucosal surface).
In some other embodiments, the emulsions of the present invention comprise a first emulsion emulsified within a second emulsion, wherein (a) the first emulsion comprises (i) an aqueous phase; and (ii) an oil phase comprising an oil and an organic solvent; and (iii) a surfactant; and (b) the second emulsion comprises (i) an aqueous phase; and (ii) an oil phase comprising an oil and a cationic containing compound; and (iii) a surfactant.
Exemplary Formulations
The following description provides a number of exemplary emulsions including formulations for compositions BCTP and X8W60PC. BCTP comprises a water-in oil nanoemulsion, in which the oil phase was made from soybean oil, tri-n-butyl phosphate, and TRITON X-100 in 80% water. X8W60PC comprises a mixture of equal volumes of BCTP with W808P. W808P is a liposome-like compound made of glycerol monostearate, refined oya sterols (e.g., GENEROL sterols), TWEEN 60, soybean oil, a cationic ion halogen-containing CPC and peppermint oil. The GENEROL family are a group of a polyethoxylated soya sterols (Henkel Corporation, Ambler, Pa.). Exemplary emulsion formulations useful in the present invention are provided in Table 1B. These particular formulations may be found in U.S. Pat. No. 5,700,679 (NN); U.S. Pat. Nos. 5,618,840; 5,549,901 (W808P); and U.S. Pat. No. 5,547,677, each of which is hereby incorporated by reference in their entireties. Certain other emulsion formulations are presented U.S. patent application Ser. No. 10/669,865, hereby incorporated by reference in its entirety.
The X8W60PC emulsion is manufactured by first making the W808P emulsion and BCTP emulsions separately. A mixture of these two emulsions is then re-emulsified to produce a fresh emulsion composition termed XSW60PC. Methods of producing such emulsions are described in U.S. Pat. Nos. 5,103,497 and 4,895,452 (each of which is herein incorporated by reference in their entireties).
| TABLE 1B | ||
| Water to Oil | ||
| Oil Phase Formula | Phase Ratio (Vol/Vol) | |
| BCTP | 1 vol. Tri(N-butyl)phosphate | 4:1 |
| 1 vol. TRITON X-100 | ||
| 8 vol. Soybean oil | ||
| NN | 86.5 g Glycerol monooleate | 3:1 |
| 60.1 ml Nonoxynol-9 | ||
| 24.2 g GENEROL 122 | ||
| 3.27 g Cetylpyridinium chloride | ||
| 554 g Soybean oil | ||
| W808P | 86.5 g Glycerol monooleate | 3.2:1 |
| 21.2 g Polysorbate 60 | ||
| 24.2 g GENEROL 122 | ||
| 3.27 g Cetylpyddinium chloride | ||
| 4 ml Peppermint oil | ||
| 554 g Soybean oil | ||
| SS | 86.5 g Glycerol monooleate | 3.2:1 |
| 21.2 g Polysorbate 60 | (1% bismuth in water) | |
| 24.2 g GENEROL 122 | ||
| 3.27 g Cetylpyridinium chloride | ||
| 554 g Soybean oil | ||
The compositions listed above are only exemplary and those of skill in the art will be able to alter the amounts of the components to arrive at a nanoemulsion composition suitable for the purposes of the present invention. Those skilled in the art will understand that the ratio of oil phase to water as well as the individual oil carrier, surfactant CPC and organic phosphate buffer, components of each composition may vary.
Although certain compositions comprising BCTP have a water to oil ratio of 4:1, it is understood that the BCTP may be formulated to have more or less of a water phase. For example, in some embodiments, there is 3, 4, 5, 6, 7, 8, 9, 10, or more parts of the water phase to each part of the oil phase. The same holds true for the W808P formulation. Similarly, the ratio of Tri(N-butyl)phosphate:TRITON X-100:soybean oil also may be varied.
Although Table 1B lists specific amounts of glycerol monooleate, polysorbate 60, GENEROL 122, cetylpyridinium chloride, and carrier oil for W808P, these are merely exemplary. An emulsion that has the properties of W808P may be formulated that has different concentrations of each of these components or indeed different components that will fulfill the same function. For example, the emulsion may have between about 80 to about 100 g of glycerol monooleate in the initial oil phase. In other embodiments, the emulsion may have between about 15 to about 30 g polysorbate 60 in the initial oil phase. In yet another embodiment the composition may comprise between about 20 to about 30 g of a GENEROL sterol, in the initial oil phase.
Individual components of nanoemulsions (e.g. in an immunogenic composition of the present invention) can function both to inactivate a pathogen as well as to contribute to the non-toxicity of the emulsions. For example, the active component in BCTP, TRITON-X100, shows less ability to inactivate a virus at concentrations equivalent to 11% BCTP. Adding the oil phase to the detergent and solvent markedly reduces the toxicity of these agents in tissue culture at the same concentrations. While not being bound to any theory (an understanding of the mechanism is not necessary to practice the present invention, and the present invention is not limited to any particular mechanism), it is suggested that the nanoemulsion enhances the interaction of its components with the pathogens thereby facilitating the inactivation of the pathogen and reducing the toxicity of the individual components. Furthermore, when all the components of BCTP are combined in one composition but are not in a nanoemulsion structure, the mixture is not as effective at inactivating a pathogen as when the components are in a nanoemulsion structure.
Numerous additional embodiments presented in classes of formulations with like compositions are presented below. The following compositions recite various ratios and mixtures of active components. One skilled in the art will appreciate that the below recited formulation are exemplary and that additional formulations comprising similar percent ranges of the recited components are within the scope of the present invention.
In certain embodiments of the present invention, a nanoemulsion comprises from about 3 to 8 vol. % of TYLOXAPOL, about 8 vol. % of ethanol, about 1 vol. % of cetylpyridinium chloride (CPC), about 60 to 70 vol. % oil (e.g., soybean oil), about 15 to 25 vol. % of aqueous phase (e.g., DiH2O or PBS), and in some formulations less than about 1 vol. % of 1N NaOH. Some of these embodiments comprise PBS. It is contemplated that the addition of 1N NaOH and/or PBS in some of these embodiments, allows the user to advantageously control the pH of the formulations, such that pH ranges from about 7.0 to about 9.0, and more preferably from about 7.1 to 8.5 are achieved. For example, one embodiment of the present invention comprises about 3 vol. % of TYLOXAPOL, about 8 vol. % of ethanol, about 1 vol. % of CPC, about 64 vol. % of soybean oil, and about 24 vol. % of DiH2O (designated herein as Y3EC). Another similar embodiment comprises about 3.5 vol. % of TYLOXAPOL, about 8 vol. % of ethanol, and about 1 vol. % of CPC, about 64 vol. % of soybean oil, and about 23.5 vol. % of DiH2O (designated herein as Y3.5EC). Yet another embodiment comprises about 3 vol. % of TYLOXAPOL, about 8 vol. % of ethanol, about 1 vol. % of CPC, about 0.067 vol. % of 1N NaOH, such that the pH of the formulation is about 7.1, about 64 vol. % of soybean oil, and about 23.93 vol. % of DiH2O (designated herein as Y3EC pH 7.1). Still another embodiment comprises about 3 vol. % of TYLOXAPOL, about 8 vol. % of ethanol, about 1 vol. % of CPC, about 0.67 vol. % of 1N NaOH, such that the pH of the formulation is about 8.5, and about 64 vol. % of soybean oil, and about 23.33 vol. % of DiH2O (designated herein as Y3EC pH 8.5). Another similar embodiment comprises about 4% TYLOXAPOL, about 8 vol. % ethanol, about 1% CPC, and about 64 vol. % of soybean oil, and about 23 vol. % of DiH2O (designated herein as Y4EC). In still another embodiment the formulation comprises about 8% TYLOXAPOL, about 8% ethanol, about 1 vol. % of CPC, and about 64 vol. % of soybean oil, and about 19 vol. % of DiH2O (designated herein as Y8EC). A further embodiment comprises about 8 vol. % of TYLOXAPOL, about 8 vol. % of ethanol, about 1 vol. % of CPC, about 64 vol. % of soybean oil, and about 19 vol. % of 1×PBS (designated herein as Y8EC PBS).
In some embodiments of the present invention, a nanoemulsion comprises about 8 vol. % of ethanol, and about 1 vol. % of CPC, and about 64 vol. % of oil (e.g., soybean oil), and about 27 vol. % of aqueous phase (e.g., DiH2O or PBS) (designated herein as EC).
In some embodiments, a nanoemulsion comprises from about 8 vol. % of sodium dodecyl sulfate (SDS), about 8 vol. % of tributyl phosphate (TBP), and about 64 vol. % of oil (e.g., soybean oil), and about 20 vol. % of aqueous phase (e.g., DiH2O or PBS) (designated herein as S8P).
In some embodiments, a nanoemulsion comprises from about 1 to 2 vol. % of TRITON X-100, from about 1 to 2 vol. % of TYLOXAPOL, from about 7 to 8 vol. % of ethanol, about 1 vol. % of cetylpyridinium chloride (CPC), about 64 to 57.6 vol. % of oil (e.g., soybean oil), and about 23 vol. % of aqueous phase (e.g., DiH2O or PBS). Additionally, some of these formulations further comprise about 5 mM of L-alanine/Inosine, and about 10 mM ammonium chloride. Some of these formulations comprise PBS. It is contemplated that the addition of PBS in some of these embodiments, allows the user to advantageously control the pH of the formulations. For example, one embodiment of the present invention comprises about 2 vol. % of TRITON X-100, about 2 vol. % of TYLOXAPOL, about 8 vol. % of ethanol, about 1 vol. % CPC, about 64 vol. % of soybean oil, and about 23 vol. % of aqueous phase DiH2O. In another embodiment the formulation comprises about 1.8 vol. % of TRITON X-100, about 1.8 vol. % of TYLOXAPOL, about 7.2 vol. % of ethanol, about 0.9 vol. % of CPC, about 5 mM L-alanine/Inosine, and about 10 mM ammonium chloride, about 57.6 vol. % of soybean oil, and the remainder of 1×PBS (designated herein as 90% X2Y2EC/GE).
In alternative embodiments, a nanoemulsion comprises from about 5 vol. % of TWEEN 80, from about 8 vol. % of ethanol, from about 1 vol. % of CPC, about 64 vol. % of oil (e.g., soybean oil), and about 22 vol. % of DiH2O (designated herein as W805EC).
In still other embodiments of the present invention, a nanoemulsion comprises from about 5 vol. % of TWEEN 20, from about 8 vol. % of ethanol, from about 1 vol. % of CPC, about 64 vol. % of oil (e.g., soybean oil), and about 22 vol. % of DiH2O (designated herein as W205EC).
In still other embodiments of the present invention, a nanoemulsion comprises from about 2 to 8 vol. % of TRITON X-100, about 8 vol. % of ethanol, about 1 vol. % of CPC, about 60 to 70 vol. % of oil (e.g., soybean, or olive oil), and about 15 to 25 vol. % of aqueous phase (e.g., DiH2O or PBS). For example, the present invention contemplates formulations comprising about 2 vol. % of TRITON X-100, about 8 vol. % of ethanol, about 64 vol. % of soybean oil, and about 26 vol. % of DiH2O (designated herein as X2E). In other similar embodiments, a nanoemulsion comprises about 3 vol. % of TRITON X-100, about 8 vol. % of ethanol, about 64 vol. % of soybean oil, and about 25 vol. % of DiH2O (designated herein as X3E). In still further embodiments, the formulations comprise about 4 vol. % Triton of X-100, about 8 vol. % of ethanol, about 64 vol. % of soybean oil, and about 24 vol. % of DiH2O (designated herein as X4E). In yet other embodiments, a nanoemulsion comprises about 5 vol. % of TRITON X-100, about 8 vol. % of ethanol, about 64 vol. % of soybean oil, and about 23 vol. % of DiH2O (designated herein as X5E). In some embodiments, a nanoemulsion comprises about 6 vol. % of TRITON X-100, about 8 vol. % of ethanol, about 64 vol. % of soybean oil, and about 22 vol. % of DiH2O (designated herein as X6E). In still further embodiments of the present invention, a nanoemulsion comprises about 8 vol. % of TRITON X-100, about 8 vol. % of ethanol, about 64 vol. % of soybean oil, and about 20 vol. % of DiH2O (designated herein as X8E). In still further embodiments, a nanoemulsion comprises about 8 vol. % of TRITON X-100, about 8 vol. % of ethanol, about 64 vol. % of olive oil, and about 20 vol. % of DiH2O (designated herein as X8E 0). In yet another embodiment, a nanoemulsion comprises 8 vol. % of TRITON X-100, about 8 vol. % ethanol, about 1 vol. % CPC, about 64 vol. % of soybean oil, and about 19 vol. % of DiH2O (designated herein as X8EC).
In alternative embodiments of the present invention, a nanoemulsion comprises from about 1 to 2 vol. % of TRITON X-100, from about 1 to 2 vol. % of TYLOXAPOL, from about 6 to 8 vol. % TBP, from about 0.5 to 1.0 vol. % of CPC, from about 60 to 70 vol. % of oil (e.g., soybean), and about 1 to 35 vol. % of aqueous phase (e.g., DiH2O or PBS). Additionally, certain of these nanoemulsions may comprise from about 1 to 5 vol. % of trypticase soy broth, from about 0.5 to 1.5 vol. % of yeast extract, about 5 mM L-alanine/Inosine, about 10 mM ammonium chloride, and from about 20-40 vol. % of liquid baby formula. In some embodiments comprising liquid baby formula, the formula comprises a casein hydrolysate (e.g., Neutramigen, or Progestimil, and the like). In some of these embodiments, a nanoemulsion further comprises from about 0.1 to 1.0 vol. % of sodium thiosulfate, and from about 0.1 to 1.0 vol. % of sodium citrate. Other similar embodiments comprising these basic components employ phosphate buffered saline (PBS) as the aqueous phase. For example, one embodiment comprises about 2 vol. % of TRITON X-100, about 2 vol. % TYLOXAPOL, about 8 vol. % TBP, about 1 vol. % of CPC, about 64 vol. % of soybean oil, and about 23 vol. % of DiH2O (designated herein as X2Y2EC). In still other embodiments, the inventive formulation comprises about 2 vol. % of TRITON X-100, about 2 vol. % TYLOXAPOL, about 8 vol. % TBP, about 1 vol. % of CPC, about 0.9 vol. % of sodium thiosulfate, about 0.1 vol. % of sodium citrate, about 64 vol. % of soybean oil, and about 22 vol. % of DiH2O (designated herein as X2Y2PC STS1). In another similar embodiment, a nanoemulsion comprises about 1.7 vol. % TRITON X-100, about 1.7 vol. % TYLOXAPOL, about 6.8 vol. % TBP, about 0.85% CPC, about 29.2% NEUTRAMIGEN, about 54.4 vol. % of soybean oil, and about 4.9 vol. % of DiH2O (designated herein as 85% X2Y2PC/baby). In yet another embodiment of the present invention, a nanoemulsion comprises about 1.8 vol. % of TRITON X-100, about 1.8 vol. % of TYLOXAPOL, about 7.2 vol. % of TBP, about 0.9 vol. % of CPC, about 5 mM L-alanine/Inosine, about 10 mM ammonium chloride, about 57.6 vol. % of soybean oil, and the remainder vol. % of 0.1×PBS (designated herein as 90% X2Y2 PC/GE). In still another embodiment, a nanoemulsion comprises about 1.8 vol. % of TRITON X-100, about 1.8 vol. % of TYLOXAPOL, about 7.2 vol. % TBP, about 0.9 vol. % of CPC, and about 3 vol. % trypticase soy broth, about 57.6 vol. % of soybean oil, and about 27.7 vol. % of DiH2O (designated herein as 90% X2Y2PC/TSB). In another embodiment of the present invention, a nanoemulsion comprises about 1.8 vol. % TRITON X-100, about 1.8 vol. % TYLOXAPOL, about 7.2 vol. % TBP, about 0.9 vol. % CPC, about 1 vol. % yeast extract, about 57.6 vol. % of soybean oil, and about 29.7 vol. % of DiH2O (designated herein as 90% X2Y2PC/YE).
In some embodiments of the present invention, a nanoemulsion comprises about 3 vol. % of TYLOXAPOL, about 8 vol. % of TBP, and about 1 vol. % of CPC, about 60 to 70 vol. % of oil (e.g., soybean or olive oil), and about 15 to 30 vol. % of aqueous phase (e.g., DiH2O or PBS). In a particular embodiment of the present invention, a nanoemulsion comprises about 3 vol. % of TYLOXAPOL, about 8 vol. % of TBP, and about 1 vol. % of CPC, about 64 vol. % of soybean, and about 24 vol. % of DiH2O (designated herein as Y3PC).
In some embodiments of the present invention, a nanoemulsion comprises from about 4 to 8 vol. % of TRITON X-100, from about 5 to 8 vol. % of TBP, about 30 to 70 vol. % of oil (e.g., soybean or olive oil), and about 0 to 30 vol. % of aqueous phase (e.g., DiH2O or PBS). Additionally, certain of these embodiments further comprise about 1 vol. % of CPC, about 1 vol. % of benzalkonium chloride, about 1 vol. % cetylyridinium bromide, about 1 vol. % cetyldimethyletylammonium bromide, 500 μM EDTA, about 10 mM ammonium chloride, about 5 mM Inosine, and about 5 mM L-alanine. For example, in a certain preferred embodiment, a nanoemulsion comprises about 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 64 vol. % of soybean oil, and about 20 vol. % of DiH2O (designated herein as X8P). In another embodiment of the present invention, a nanoemulsion comprises about 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 1% of CPC, about 64 vol. % of soybean oil, and about 19 vol. % of DiH2O (designated herein as X8PC). In still another embodiment, a nanoemulsion comprises about 8 vol. % TRITON X-100, about 8 vol. % of TBP, about 1 vol. % of CPC, about 50 vol. % of soybean oil, and about 33 vol. % of DiH2O (designated herein as ATB-X1001). In yet another embodiment, the formulations comprise about 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 2 vol. % of CPC, about 50 vol. % of soybean oil, and about 32 vol. % of DiH2O (designated herein as ATB-X002). In some embodiments, a nanoemulsion comprises about 4 vol. % TRITON X-100, about 4 vol. % of TBP, about 0.5 vol. % of CPC, about 32 vol. % of soybean oil, and about 59.5 vol. % of DiH2O (designated herein as 50% X8PC). In some embodiments, a nanoemulsion comprises about 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 0.5 vol. % CPC, about 64 vol. % of soybean oil, and about 19.5 vol. % of DiH2O (designated herein as X8PC1/2). In some embodiments of the present invention, a nanoemulsion comprises about 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 2 vol. % of CPC, about 64 vol. % of soybean oil, and about 18 vol. % of DiH2O (designated herein as X8PC2). In other embodiments, a nanoemulsion comprises about 8 vol. % of TRITON X-100, about 8% of TBP, about 1% of benzalkonium chloride, about 50 vol. % of soybean oil, and about 33 vol. % of DiH2O (designated herein as X8P BC). In an alternative embodiment of the present invention, a nanoemulsion comprises about 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 1 vol. % of cetylyridinium bromide, about 50 vol. % of soybean oil, and about 33 vol. % of DiH2O (designated herein as X8P CPB). In another exemplary embodiment of the present invention, a nanoemulsion comprises about 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 1 vol. % of cetyldimethyletylammonium bromide, about 50 vol. % of soybean oil, and about 33 vol. % of DiH2O (designated herein as X8P CTAB). In still further embodiments, a nanoemulsion comprises about 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 1 vol. % of CPC, about 500 μM EDTA, about 64 vol. % of soybean oil, and about 15.8 vol. % DiH2O (designated herein as X8PC EDTA). In some embodiments, a nanoemulsion comprises 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 1 vol. % of CPC, about 10 mM ammonium chloride, about 5 mM Inosine, about 5 mM L-alanine, about 64 vol. % of soybean oil, and about 19 vol. % of DiH2O or PBS (designated herein as X8PC GE1x). In another embodiment of the present invention, a nanoemulsion comprises about 5 vol. % of TRITON X-100, about 5% of TBP, about 1 vol. % of CPC, about 40 vol. % of soybean oil, and about 49 vol. % of DiH2O (designated herein as X5P5C).
In some embodiments of the present invention, a nanoemulsion comprises about 2 vol. % TRITON X-100, about 6 vol. % TYLOXAPOL, about 8 vol. % ethanol, about 64 vol. % of soybean oil, and about 20 vol. % of DiH2O (designated herein as X2Y6E).
In an additional embodiment of the present invention, a nanoemulsion comprises about 8 vol. % of TRITON X-100, and about 8 vol. % of glycerol, about 60 to 70 vol. % of oil (e.g., soybean or olive oil), and about 15 to 25 vol. % of aqueous phase (e.g., DiH2O or PBS). Certain nanoemulsion compositions (e.g., used to generate an immune response (e.g., for use as a vaccine) comprise about 1 vol. % L-ascorbic acid. For example, one particular embodiment comprises about 8 vol. % of TRITON X-100, about 8 vol. % of glycerol, about 64 vol. % of soybean oil, and about 20 vol. % of DiH2O (designated herein as X8G). In still another embodiment, a nanoemulsion comprises about 8 vol. % of TRITON X-100, about 8 vol. % of glycerol, about 1 vol. % of L-ascorbic acid, about 64 vol. % of soybean oil, and about 19 vol. % of DiH2O (designated herein as X8GVc).
In still further embodiments, a nanoemulsion comprises about 8 vol. % of TRITON X-100, from about 0.5 to 0.8 vol. % of TWEEN 60, from about 0.5 to 2.0 vol. % of CPC, about 8 vol. % of TBP, about 60 to 70 vol. % of oil (e.g., soybean or olive oil), and about 15 to 25 vol. % of aqueous phase (e.g., DiH2O or PBS). For example, in one particular embodiment a nanoemulsion comprises about 8 vol. % of TRITON X-100, about 0.70 vol. % of TWEEN 60, about 1 vol. % of CPC, about 8 vol. % of TBP, about 64 vol. % of soybean oil, and about 18.3 vol. % of DiH2O (designated herein as X8W60PC1). In some embodiments, a nanoemulsion comprises about 8 vol. % of TRITON X-100, about 0.71 vol. % of TWEEN 60, about 1 vol. % of CPC, about 8 vol. % of TBP, about 64 vol. % of soybean oil, and about 18.29 vol. % of DiH2O (designated herein as W600.7X8PC). In yet other embodiments, a nanoemulsion comprises from about 8 vol. % of TRITON X-100, about 0.7 vol. % of TWEEN 60, about 0.5 vol. % of CPC, about 8 vol. % of TBP, about 64 to 70 vol. % of soybean oil, and about 18.8 vol. % of DiH2O (designated herein as X8W60PC2). In still other embodiments, a nanoemulsion comprises about 8 vol. % of TRITON X-100, about 0.71 vol. % of TWEEN 60, about 2 vol. % of CPC, about 8 vol. % of TBP, about 64 vol. % of soybean oil, and about 17.3 vol. % of DiH2O. In another embodiment of the present invention, a nanoemulsion comprises about 0.71 vol. % of TWEEN 60, about 1 vol. % of CPC, about 8 vol. % of TBP, about 64 vol. % of soybean oil, and about 25.29 vol. % of DiH2O (designated herein as W600.7PC).
In another embodiment of the present invention, a nanoemulsion comprises about 2 vol. % of dioctyl sulfosuccinate, either about 8 vol. % of glycerol, or about 8 vol. % TBP, in addition to, about 60 to 70 vol. % of oil (e.g., soybean or olive oil), and about 20 to 30 vol. % of aqueous phase (e.g., DiH2O or PBS). For example, in some embodiments, a nanoemulsion comprises about 2 vol. % of dioctyl sulfosuccinate, about 8 vol. % of glycerol, about 64 vol. % of soybean oil, and about 26 vol. % of DiH2O (designated herein as D2G). In another related embodiment, a nanoemulsion comprises about 2 vol. % of dioctyl sulfosuccinate, and about 8 vol. % of TBP, about 64 vol. % of soybean oil, and about 26 vol. % of DiH2O (designated herein as D2P).
In still other embodiments of the present invention, a nanoemulsion comprises about 8 to 10 vol. % of glycerol, and about 1 to 10 vol. % of CPC, about 50 to 70 vol. % of oil (e.g., soybean or olive oil), and about 15 to 30 vol. % of aqueous phase (e.g., DiH2O or PBS). Additionally, in certain of these embodiments, a nanoemulsion further comprises about 1 vol. % of L-ascorbic acid. For example, in some embodiments, a nanoemulsion comprises about 8 vol. % of glycerol, about 1 vol. % of CPC, about 64 vol. % of soybean oil, and about 27 vol. % of DiH2O (designated herein as GC). In some embodiments, a nanoemulsion comprises about 10 vol. % of glycerol, about 10 vol. % of CPC, about 60 vol. % of soybean oil, and about 20 vol. % of DiH2O (designated herein as GC10). In still another embodiment of the present invention, a nanoemulsion comprises about 10 vol. % of glycerol, about 1 vol. % of CPC, about 1 vol. % of L-ascorbic acid, about 64 vol. % of soybean or oil, and about 24 vol. % of DiH2O (designated herein as GCVc).
In some embodiments of the present invention, a nanoemulsion comprises about 8 to 10 vol. % of glycerol, about 8 to 10 vol. % of SDS, about 50 to 70 vol. % of oil (e.g., soybean or olive oil), and about 15 to 30 vol. % of aqueous phase (e.g., DiH2O or PBS). Additionally, in certain of these embodiments, a nanoemulsion further comprise about 1 vol. % of lecithin, and about 1 vol. % of p-Hydroxybenzoic acid methyl ester. Exemplary embodiments of such formulations comprise about 8 vol. % SDS, 8 vol. % of glycerol, about 64 vol. % of soybean oil, and about 20 vol. % of DiH2O (designated herein as S8G). A related formulation comprises about 8 vol. % of glycerol, about 8 vol. % of SDS, about 1 vol. % of lecithin, about 1 vol. % of p-Hydroxybenzoic acid methyl ester, about 64 vol. % of soybean oil, and about 18 vol. % of DiH2O (designated herein as S8GL1B1).
In yet another embodiment of the present invention, a nanoemulsion comprises about 4 vol. % of TWEEN 80, about 4 vol. % of TYLOXAPOL, about 1 vol. % of CPC, about 8 vol. % of ethanol, about 64 vol. % of soybean oil, and about 19 vol. % of DiH2O (designated herein as W804Y4EC).
In some embodiments of the present invention, a nanoemulsion comprises about 0.01 vol. % of CPC, about 0.08 vol. % of TYLOXAPOL, about 10 vol. % of ethanol, about 70 vol. % of soybean oil, and about 19.91 vol. % of DiH2O (designated herein as Y.08EC.01).
In yet another embodiment of the present invention, a nanoemulsion comprises about 8 vol. % of sodium lauryl sulfate, and about 8 vol. % of glycerol, about 64 vol. % of soybean oil, and about 20 vol. % of DiH2O (designated herein as SLS8G).
The specific formulations described above are simply examples to illustrate the variety of nanoemulsions that find use (e.g., to inactivate and/or neutralize a pathogen, and for generating an immune response in a subject (e.g., for use as a vaccine)) in the present invention. The present invention contemplates that many variations of the above formulations, as well as additional nanoemulsions, find use in the methods of the present invention. Candidate emulsions can be easily tested to determine if they are suitable. First, the desired ingredients are prepared using the methods described herein, to determine if an emulsion can be formed. If an emulsion cannot be formed, the candidate is rejected. For example, a candidate composition made of 4.5% sodium thiosulfate, 0.5% sodium citrate, 10% n-butanol, 64% soybean oil, and 21% DiH2O does not form an emulsion.
Second, the candidate emulsion should form a stable emulsion. An emulsion is stable if it remains in emulsion form for a sufficient period to allow its intended use (e.g., to generate an immune response in a subject). For example, for emulsions that are to be stored, shipped, etc., it may be desired that the composition remain in emulsion form for months to years. Typical emulsions that are relatively unstable, will lose their form within a day. For example, a candidate composition made of 8% 1-butanol, 5% Tween 10, 1% CPC, 64% soybean oil, and 22% DiH2O does not form a stable emulsion. Nanoemulsions that have been shown to be stable include, but are not limited to, 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 64 vol. % of soybean oil, and about 20 vol. % of DiH2O (designated herein as X8P); 5 vol. % of TWEEN 20, from about 8 vol. % of ethanol, from about 1 vol. % of CPC, about 64 vol. % of oil (e.g., soybean oil), and about 22 vol. % of DiH2O (designated herein as W205EC); 0.08% Triton X-100, 0.08% Glycerol, 0.01% Cetylpyridinium Chloride, 99% Butter, and 0.83% diH2O (designated herein as 1% X8GC Butter); 0.8% Triton X-100, 0.8% Glycerol, 0.1% Cetylpyridinium Chloride, 6.4% Soybean Oil, 1.9% diH2O, and 90% Butter (designated herein as 10% X8GC Butter); 2% W205EC, 1% Natrosol 250L NF, and 97% diH2O (designated herein as 2% W205EC L GEL); 1% Cetylpyridinium Chloride, 5% Tween 20, 8% Ethanol, 64% 70 Viscosity Mineral Oil, and 22% diH2O (designated herein as W205EC 70 Mineral Oil); 1% Cetylpyridinium Chloride, 5% Tween 20, 8% Ethanol, 64% 350 Viscosity Mineral Oil, and 22% diH2O (designated herein as W205EC 350 Mineral Oil). In some embodiments, nanoemulsions of the present invention are stable for over a week, over a month, or over a year.
Third, the candidate emulsion should have efficacy for its intended use. For example, a nanoemuslion should inactivate (e.g., kill or inhibit growth of) a pathogen to a desired level (e.g., 1 log, 2 log, 3 log, 4 log, . . . reduction). Using the methods described herein, one is capable of determining the suitability of a particular candidate emulsion against the desired pathogen. Generally, this involves exposing the pathogen to the emulsion for one or more time periods in a side-by-side experiment with the appropriate control samples (e.g., a negative control such as water) and determining if, and to what degree, the emulsion inactivates (e.g., kills and/or neutralizes) the microorganism. For example, a candidate composition made of 1% ammonium chloride, 5% Tween 20, 8% ethanol, 64% soybean oil, and 22% DiH2O was shown not to be an effective emulsion. The following candidate emulsions were shown to be effective using the methods described herein: 5% Tween 20, 5% Cetylpyridinium Chloride, 10% Glycerol, 60% Soybean Oil, and 20% diH2O (designated herein as W205GC5); 1% Cetylpyridinium Chloride, 5% Tween 20, 10% Glycerol, 64% Soybean Oil, and 20% diH2O (designated herein as W205GC); 1% Cetylpyridinium Chloride, 5% Tween 20, 8% Ethanol, 64% Olive Oil, and 22% diH2O (designated herein as W205EC Olive Oil); 1% Cetylpyridinium Chloride, 5% Tween 20, 8% Ethanol, 64% Flaxseed Oil, and 22% diH2O (designated herein as W205EC Flaxseed Oil); 1% Cetylpyridinium Chloride, 5% Tween 20, 8% Ethanol, 64% Corn Oil, and 22% diH2O (designated herein as W205EC Corn Oil); 1% Cetylpyridinium Chloride, 5% Tween 20, 8% Ethanol, 64% Coconut Oil, and 22% diH2O (designated herein as W205EC Coconut Oil); 1% Cetylpyridinium Chloride, 5% Tween 20, 8% Ethanol, 64% Cottonseed Oil, and 22% diH2O (designated herein as W205EC Cottonseed Oil); 8% Dextrose, 5% Tween 10, 1% Cetylpyridinium Chloride, 64% Soybean Oil, and 22% diH2O (designated herein as W205C Dextrose); 8% PEG 200, 5% Tween 10, 1% Cetylpyridinium Chloride, 64% Soybean Oil, and 22% diH2O (designated herein as W205C PEG 200); 8% Methanol, 5% Tween 10, 1% Cetylpyridinium Chloride, 64% Soybean Oil, and 22% diH2O (designated herein as W205C Methanol); 8% PEG 1000, 5% Tween 10, 1% Cetylpyridinium Chloride, 64% Soybean Oil, and 22% diH2O (designated herein as W205C PEG 1000); 2% W205EC, 2% Natrosol 250H NF, and 96% diH2O (designated herein as 2% W205EC Natrosol 2, also called 2% W205EC GEL); 2% W205EC, 1% Natrosol 250H NF, and 97% diH2O (designated herein as 2% W205EC Natrosol 1); 2% W205EC, 3% Natrosol 250H NF, and 95% diH2O (designated herein as 2% W205EC Natrosol 3); 2% W205EC, 0.5% Natrosol 250H NF, and 97.5% diH2O (designated herein as 2% W205EC Natrosol 0.5); 2% W205EC, 2% Methocel A, and 96% diH2O (designated herein as 2% W205EC Methocel A); 2% W205EC, 2% Methocel K, and 96% diH2O (designated herein as 2% W205EC Methocel K); 2% Natrosol, 0.1% X8PC, 0.1×PBS, 5 mM L-alanine, 5 mM Inosine, 10 mM Ammonium Chloride, and diH2O (designated herein as 0.1% X8PC/GE+2% Natrosol); 2% Natrosol, 0.8% Triton X-100, 0.8% Tributyl Phosphate, 6.4% Soybean Oil, 0.1% Cetylpyridinium Chloride, 0.1×PBS, 5 mM L-alanine, 5 mM Inosine, 10 mM Ammonium Chloride, and diH2O (designated herein as 10% X8PC/GE+2% Natrosol); 1% Cetylpyridinium Chloride, 5% Tween 20, 8% Ethanol, 64% Lard, and 22% diH2O (designated herein as W205EC Lard); 1% Cetylpyridinium Chloride, 5% Tween 20, 8% Ethanol, 64% Mineral Oil, and 22% diH2O (designated herein as W205EC Mineral Oil); 0.1% Cetylpyridinium Chloride, 2% Nerolidol, 5% Tween 20, 10% Ethanol, 64% Soybean Oil, and 18.9% diH2O (designated herein as W205EC0.1N); 0.1% Cetylpyridinium Chloride, 2% Farnesol, 5% Tween 20, 10% Ethanol, 64% Soybean Oil, and 18.9% diH2O (designated herein as W205EC0.1F); 0.1% Cetylpyridinium Chloride, 5% Tween 20, 10% Ethanol, 64% Soybean Oil, and 20.9% diH2O (designated herein as W205EC0.1); 10% Cetylpyridinium Chloride, 8% Tributyl Phosphate, 8% Triton X-100, 54% Soybean Oil, and 20% diH2O (designated herein as X8PC10); 5% Cetylpyridinium Chloride, 8% Triton X-100, 8% Tributyl Phosphate, 59% Soybean Oil, and 20% diH2O (designated herein as X8PC5); 0.02% Cetylpyridinium Chloride, 0.1% Tween 20, 10% Ethanol, 70% Soybean Oil, and 19.88% diH2O (designated herein as W200.1EC0.02); 1% Cetylpyridinium Chloride, 5% Tween 20, 8% Glycerol, 64% Mobil 1, and 22% diH2O (designated herein as W205GC Mobil 1); 7.2% Triton X-100, 7.2% Tributyl Phosphate, 0.9% Cetylpyridinium Chloride, 57.6% Soybean Oil, 0.1×PBS, 5 mM L-alanine, 5 mM Inosine, 10 mM Ammonium Chloride, and 25.87% diH2O (designated herein as 90% X8PC/GE); 7.2% Triton X-100, 7.2% Tributyl Phosphate, 0.9% Cetylpyridinium Chloride, 57.6% Soybean Oil, 1% EDTA, 5 mM L-alanine, 5 mM Inosine, 10 mM Ammonium Chloride, 0.1×PBS, and diH2O (designated herein as 90% X8PC/GE EDTA); and 7.2% Triton X-100, 7.2% Tributyl Phosphate, 0.9% Cetylpyridinium Chloride, 57.6% Soybean Oil, 1% Sodium Thiosulfate, 5 mM L-alanine, 5 mM Inosine, 10 mM Ammonium Chloride, 0.1×PBS, and diH2O (designated herein as 90% X8PC/GE STS).
In preferred embodiments of the present invention, the nanoemulsions are non-toxic (e.g., to humans, plants, or animals), non-irritant (e.g., to humans, plants, or animals), and non-corrosive (e.g., to humans, plants, or animals or the environment), while possessing potency against a broad range of microorganisms including bacteria, fungi, viruses, and spores. While a number of the above described nanoemulsions meet these qualifications, the following description provides a number of preferred non-toxic, non-irritant, non-corrosive, anti-microbial nanoemulsions of the present invention (hereinafter in this section referred to as “non-toxic nanoemulsions”).
In some embodiments the non-toxic nanoemulsions comprise surfactant lipid preparations (SLPs) for use as broad-spectrum antimicrobial agents that are effective against bacteria and their spores, enveloped viruses, and fungi. In preferred embodiments, these SLPs comprises a mixture of oils, detergents, solvents, and cationic halogen-containing compounds in addition to several ions that enhance their biocidal activities. These SLPs are characterized as stable, non-irritant, and non-toxic compounds compared to commercially available bactericidal and sporicidal agents, which are highly irritant and/or toxic.
Ingredients for use in the non-toxic nanoemulsions include, but are not limited to: detergents (e.g., TRITON X-100 (5-15%) or other members of the TRITON family, TWEEN 60 (0.5-2%) or other members of the TWEEN family, or TYLOXAPOL (1-10%)); solvents (e.g., tributyl phosphate (5-15%)); alcohols (e.g., ethanol (5-15%) or glycerol (5-15%)); oils (e.g., soybean oil (40-70%)); cationic halogen-containing compounds (e.g., cetylpyridinium chloride (0.5-2%), cetylpyridinium bromide (0.5-2%)), or cetyldimethylethyl ammonium bromide (0.5-2%)); quaternary ammonium compounds (e.g., benzalkonium chloride (0.5-2%), N-alkyldimethylbenzyl ammonium chloride (0.5-2%)); ions (calcium chloride (1 mM-40 mM), ammonium chloride (1 mM-20 mM), sodium chloride (5 mM-200 mM), sodium phosphate (1 mM-20 mM)); nucleosides (e.g., inosine (50 μM-20 mM)); and amino acids (e.g., L-alanine (50 μM-20 mM)). Emulsions are prepared, for example, by mixing in a high shear mixer for 3-10 minutes. The emulsions may or may not be heated before mixing at 82° C. for 1 hour.
Quaternary ammonium compounds for use in the present include, but are not limited to, N-alkyldimethyl benzyl ammonium saccharinate; 1,3,5-Triazine-1,3,5(2H,4H,6H)-triethanol; 1-Decanaminium, N-decyl-N,N-dimethyl-, chloride (or) Didecyl dimethyl ammonium chloride; 2-(2-(p-(Diisobuyl)cresosxy)ethoxy)ehyl dimethyl benzyl ammonium chloride; 2-(2-(p-(Diisobutyl)phenoxy)ethoxy)ethyl dimethyl benzyl ammonium chloride; alkyl 1 or 3 benzyl-1-(2-hydroxethyl)-2-imidazolinium chloride; alkyl bis(2-hydroxyethyl)benzyl ammonium chloride; alkyl demethyl benzyl ammonium chloride; alkyl dimethyl 3,4-dichlorobenzyl ammonium chloride (100% C12); alkyl dimethyl 3,4-dichlorobenzyl ammonium chloride (50% C14, 40% C12, 10% C16); alkyl dimethyl 3,4-dichlorobenzyl ammonium chloride (55% C14, 23% C12, 20% C16); alkyl dimethyl benzyl ammonium chloride; alkyl dimethyl benzyl ammonium chloride (100% C14); alkyl dimethyl benzyl ammonium chloride (100% C16); alkyl dimethyl benzyl ammonium chloride (41% C14, 28% C12); alkyl dimethyl benzyl ammonium chloride (47% C12, 18% C14); alkyl dimethyl benzyl ammonium chloride (55% C16, 20% C14); alkyl dimethyl benzyl ammonium chloride (58% C14, 28% C16); alkyl dimethyl benzyl ammonium chloride (60% C14, 25% C12); alkyl dimethyl benzyl ammonium chloride (61% C11, 23% C14); alkyl dimethyl benzyl ammonium chloride (61% C12, 23% C14); alkyl dimethyl benzyl ammonium chloride (65% C12, 25% C14); alkyl dimethyl benzyl ammonium chloride (67% C12, 24% C14); alkyl dimethyl benzyl ammonium chloride (67% C12, 25% C14); alkyl dimethyl benzyl ammonium chloride (90% C14, 5% C12); alkyl dimethyl benzyl ammonium chloride (93% C14, 4% C12); alkyl dimethyl benzyl ammonium chloride (95% C16, 5% C18); alkyl dimethyl benzyl ammonium chloride (and) didecyl dimethyl ammonium chloride; alkyl dimethyl benzyl ammonium chloride (as in fatty acids); alkyl dimethyl benzyl ammonium chloride (C12-C16); alkyl dimethyl benzyl ammonium chloride (C12-C18); alkyl dimethyl benzyl and dialkyl dimethyl ammonium chloride; alkyl dimethyl dimethybenzyl ammonium chloride; alkyl dimethyl ethyl ammonium bromide (90% C14, 5% C16, 5% C12); alkyl dimethyl ethyl ammonium bromide (mixed alkyl and alkenyl groups as in the fatty acids of soybean oil); alkyl dimethyl ethylbenzyl ammonium chloride; alkyl dimethyl ethylbenzyl ammonium chloride (60% C14); alkyl dimethyl isoproylbenzyl ammonium chloride (50% C12, 30% C14, 17% C16, 3% C18); alkyl trimethyl ammonium chloride (58% C18, 40% C16, 1% C14, 1% C12); alkyl trimethyl ammonium chloride (90% C18, 10% C16); alkyldimethyl(ethylbenzyl)ammonium chloride (C12-18); Di-(C8-10)-alkyl dimethyl ammonium chlorides; dialkyl dimethyl ammonium chloride; dialkyl dimethyl ammonium chloride; dialkyl dimethyl ammonium chloride; dialkyl methyl benzyl ammonium chloride; didecyl dimethyl ammonium chloride; diisodecyl dimethyl ammonium chloride; dioctyl dimethyl ammonium chloride; dodecyl bis(2-hydroxyethyl) octyl hydrogen ammonium chloride; dodecyl dimethyl benzyl ammonium chloride; dodecylcarbamoyl methyl dinethyl benzyl ammonium chloride; heptadecyl hydroxyethylimidazolinium chloride; hexahydro-1,3,5-thris(2-hydroxyethyl)-s-triazine; myristalkonium chloride (and) Quat RNIUM 14; N,N-Dimethyl-2-hydroxypropylammonium chloride polymer; n-alkyl dimethyl benzyl ammonium chloride; n-alkyl dimethyl ethylbenzyl ammonium chloride; n-tetradecyl dimethyl benzyl ammonium chloride monohydrate; octyl decyl dimethyl ammonium chloride; octyl dodecyl dimethyl ammonium chloride; octyphenoxyethoxyethyl dimethyl benzyl ammonium chloride; oxydiethylenebis(alkyl dimethyl ammonium chloride); quaternary ammonium compounds, dicoco alkyldimethyl, chloride; trimethoxysily propyl dimethyl octadecyl ammonium chloride; trimethoxysilyl quats, trimethyl dodecylbenzyl ammonium chloride; n-dodecyl dimethyl ethylbenzyl ammonium chloride; n-hexadecyl dimethyl benzyl ammonium chloride; n-tetradecyl dimethyl benzyl ammonium chloride; n-tetradecyl dimethyl ethyylbenzyl ammonium chloride; and n-octadecyl dimethyl benzyl ammonium chloride.
In general, the preferred non-toxic nanoemulsions are characterized by the following: they are approximately 200-800 nm in diameter, although both larger and smaller diameter nanoemulsions are contemplated; the charge depends on the ingredients; they are stable for relatively long periods of time (e.g., up to two years), with preservation of their biocidal activity; they are non-irritant and non-toxic compared to their individual components due, at least in part, to their oil contents that markedly reduce the toxicity of the detergents and the solvents; they are effective at concentrations as low as 0.1%; they have antimicrobial activity against most vegetative bacteria (including Gram-positive and Gram-negative organisms), fungi, and enveloped and nonenveloped viruses in 15 minutes (e.g., 99.99% killing); and they have sporicidal activity in 1-4 hours (e.g., 99.99% killing) when produced with germination enhancers.
D. Animal Models
In some embodiments, potential nanoemulsion compositions (e.g., for generating an immune response (e.g., for use as a vaccine) are tested in animal models of infectious diseases. The use of well-developed animal models provides a method of measuring the effectiveness and safety of a vaccine before administration to human subjects. Exemplary animal models of disease are shown in Table 3. These animals are commercially available (e.g., from Jackson Laboratories Charles River; Portage, Mich.).
Animal models of Bacillus cereus (closely related to Bacillus anthracis) are utilized to test Anthrax vaccines of the present invention. Both bacteria are spore forming Gram positive rods and the disease syndrome produced by each bacteria is largely due to toxin production and the effects of these toxins on the infected host (Brown et al., J. Bact., 75:499 (1958); Burdon and Wende, J. Infect Dis., 107:224 (1960); Burdon et al., J. Infect. Dis., 117:307 (1967)). Bacillus cereus infection mimics the disease syndrome caused by Bacillus anthracis. Mice are reported to rapidly succumb to the effects of B. cereus toxin and are a useful model for acute infection. Guinea pigs develop a skin lesion subsequent to subcutaneous infection with B. cereus that resembles the cutaneous form of anthrax.
Clostridium perfringens infection in both mice and guinea pigs has been used as a model system for the in vivo testing of antibiotic drugs (Stevens et al., Antimicrob. Agents Chemother., 31:312 (1987); Stevens et al., J. Infect. Dis., 155:220 (1987); Alttemeier et al., Surgery, 28:621 (1950); Sandusky et al., Surgery, 28:632 (1950)). Clostridium tetani is well known to infect and cause disease in a variety of mammalian species. Mice, guinea pigs, and rabbits have all been used experimentally (Willis, Topley and Wilson's Principles of Bacteriology, Virology and Immunity. Wilson, G., A. Miles, and M. T. Parker, eds. pages 442-475 1983).
Vibrio cholerae infection has been successfully initiated in mice, guinea pigs, and rabbits. According to published reports it is preferred to alter the normal intestinal bacterial flora for the infection to be established in these experimental hosts. This is accomplished by administration of antibiotics to suppress the normal intestinal flora and, in some cases, withholding food from the animals (Butterton et al., Infect. Immun., 64:4373 (1996); Levine et al., Microbiol. Rev., 47:510 (1983); Finkelstein et al., J. Infect. Dis., 114:203 (1964); Freter, J. Exp. Med., 104:411 (1956); and Freter, J. Infect. Dis., 97:57 (1955)).
Shigella flexnerii infection has been successfully initiated in mice and guinea pigs. As is the case with vibrio infections, it is preferred that the normal intestinal bacterial flora be altered to aid in the establishment of infection in these experimental hosts. This is accomplished by administration of antibiotics to suppress the normal intestinal flora and, in some cases, withholding food from the animals (Levine et al., Microbiol. Rev., 47:510 (1983); Freter, J. Exp. Med., 104:411 (1956); Formal et al., J. Bact., 85:119 (1963); LaBrec et al., J. Bact. 88:1503 (1964); Takeuchi et al., Am. J. Pathol., 47:1011 (1965)).
Mice and rats have been used extensively in experimental studies with Salmonella typhimurium and Salmonella enteriditis (Naughton et al., J. Appl. Bact., 81:651 (1996); Carter and Collins, J. Exp. Med., 139:1189 (1974); Collins, Infect. Immun., 5:191 (1972); Collins and Carter, Infect. Immun., 6:451 (1972)).
Mice and rats are well established experimental models for infection with Sendai virus (Jacoby et al., Exp. Gerontol., 29:89 (1994); Massion et al., Am. J. Respir. Cell Mol. Biol. 9:361 (1993); Castleman et al., Am. J. Path., 129:277 (1987); Castleman, Am. J. Vet. Res., 44:1024 (1983); Mims and Murphy, Am. J. Path., 70:315 (1973)).
Sindbis virus infection of mice is usually accomplished by intracerebral inoculation of newborn mice. Alternatively, weanling mice are inoculated subcutaneously in the footpad (Johnson et al., J. Infect. Dis., 125:257 (1972); Johnson, Am. J. Path., 46:929 (1965)).
It is preferred that animals are housed for 3-5 days to rest from shipping and adapt to new housing environments before use in experiments. At the start of each experiment, control animals are sacrificed and tissue is harvested to establish baseline parameters. Animals are anesthetized by any suitable method (e.g., including, but not limited to, inhalation of Isofluorane for short procedures or ketamine/xylazine injection for longer procedure).
| TABLE 3 |
| Animal Models of Infectious Diseases |
| Experimental | |||||
| Experimental | Animal | Route of | |||
| Microorganism | Animal Species | Strains | Sex | Age | Infection |
| Francisella | mice | BALB/C | M | 6 W | Intraperitoneal |
| philomiraga | |||||
| Neisseria | mice | BALB/C | F | 6-10 W | Intraperitoneal |
| meningitidis | rats | COBS/CD | M/F | 4 D | Intranasal |
| Streptococcus | mice | BALB/C | F | 6 W | Intranasal |
| pneumoniae | rats | COBS/CD | M | 6-8 W | Intranasal |
| guinea Pigs | Hartley | M/F | 4-5 W | Intranasal | |
| Yersinia | mice | BALB/C | F | 6 W | Intranasal |
| pseudotuberculosis | |||||
| Influenza virus | mice | BALB/C | F | 6 W | Intranasal |
| Sendai virus | mice | CD-1 | F | 6 W | Intranasal |
| rats | Sprague- | M | 6-8 W | Intranasal | |
| Dawley | |||||
| Sindbis | mice | CD-1 | M/F | 1-2 D | Intracerebral/SC |
| Vaccinia | mice | BALB/C | F | 2-3 W | Intradermal |
E. Assays For Evaluation of Vaccines
In some embodiments, candidate nanoemulsion vaccines are evaluated using one of several suitable model systems. For example, cell-mediated immune responses can be evaluated in vitro. In addition, an animal model may be used to evaluate in vivo immune response and immunity to pathogen challenge. Any suitable animal model may be utilized, including, but not limited to, those disclosed in Table 3.
Before testing a nanoemulsion vaccine in an animal system, the amount of exposure of the pathogen to a nanoemulsion sufficient to inactivate the pathogen is investigated. It is contemplated that pathogens such as bacterial spores require longer periods of time for inactivation by the nanoemulsion in order to be sufficiently neutralized to allow for immunization. The time period required for inactivation may be investigated using any suitable method, including, but not limited to, those described in the illustrative examples below.
In addition, the stability of emulsion-developed vaccines is evaluated, particularly over time and storage condition, to ensure that vaccines are effective long-term. The ability of other stabilizing materials (e.g., dendritic polymers) to enhance the stability and immunogenicity of vaccines is also evaluated.
Once a given nanoemulsion/pathogen vaccine has been formulated to result in pathogen inactivation, the ability of the vaccine to elicit an immune response and provide immunity is optimized. Non-limiting examples of methods for assaying vaccine effectiveness are described in Example 14 below. For example, the timing and dosage of the vaccine can be varied and the most effective dosage and administration schedule determined. The level of immune response is quantitated by measuring serum antibody levels. In addition, in vitro assays are used to monitor proliferation activity by measuring H3-thymidine uptake. In addition to proliferation, Th1 and Th2 cytokine responses (e.g., including but not limited to, levels of include IL-2, TNF-γ, IFN-γ, IL-4, IL-6, IL-11, IL-12, etc.) are measured to qualitatively evaluate the immune response.
Finally, animal models are utilized to evaluate the effect of a nanoemulsion mucosal vaccine. Purified pathogens are mixed in emulsions (or emulsions are contact with a pre-infected animal), administered, and the immune response is determined. The level of protection is then evaluated by challenging the animal with the specific pathogen and subsequently evaluating the level of disease symptoms. The level of immunity is measured over time to determine the necessity and spacing of booster immunizations.
III. Therapeutics and Prophylactics
Furthermore, in preferred embodiments, a composition of the present invention induces (e.g., when administered to a subject) both systemic and mucosal immunity. Thus, in some preferred embodiments, administration of a composition of the present invention to a subject results in protection against an exposure (e.g., a mucosal exposure) to HIV. Although an understanding of the mechanism is not necessary to practice the present invention and the present invention is not limited to any particular mechanism of action, mucosal administration (e.g., vaccination) provides protection against HIV infection (e.g., that initiates at a mucosal surface). Although it has heretofore proven difficult to stimulate secretory IgA responses and protection against pathogens that invade at mucosal surfaces (See, e.g., Mestecky et al, Mucosal Immunology. 3ed edn. (Academic Press, San Diego, 2005)), the present invention provides compositions and methods for stimulating mucosal immunity (e.g., a protective IgA response) from a pathogen in a subject.
In some embodiments, the present invention provides a composition (e.g., a composition comprising a NE and immunogenic protein antigens from HIV (e.g., gp120) to serve as a mucosal vaccine. This material can easily be produced with NE and HIV protein (e.g., viral-derived gp120, live-virus-vector-derived gp120 and gp160, recombinant mammalian gp120, recombinant denatured antigens, small peptide segments of gp120 and gp41, V3 loop peptides, and induces both mucosal and systemic immunity. The ability to produce this formulation rapidly and administer it via mucosal (e.g., nasal or vaginal) instillation provides a vaccine that can be used in large-scale administrations (e.g., to a population of a town, village, city, state or country).
In some preferred embodiments, the present invention provides a composition for generating an immune response comprising a NE and an immunogen (e.g., a purified, isolated or synthetic HIV protein or derivative, variant, or analogue thereof; or, one or more serotypes of HIV inactivated by the nanoemulsion). When administered to a subject, a composition of the present invention stimulates an immune response against the immunogen within the subject. Although an understanding of the mechanism is not necessary to practice the present invention and the present invention is not limited to any particular mechanism of action, in some embodiments, generation of an immune response (e.g., resulting from administration of a composition comprising a nanoemulsion and an immunogen) provides total or partial immunity to the subject (e.g., from signs, symptoms or conditions of a disease (e.g., AIDS)). Without being bound to any specific theory, protection and/or immunity from disease (e.g., the ability of a subject's immune system to prevent or attenuate (e.g., suppress) a sign, symptom or condition of disease) after exposure to an immunogenic composition of the present invention is due to adaptive (e.g., acquired) immune responses (e.g., immune responses mediated by B and T cells following exposure to a NE comprising an immunogen of the present invention (e.g., immune responses that exhibit increased specificity and reactivity towards HIV). Thus, in some embodiments, the compositions and methods of the present invention are used prophylactically or therapeutically to prevent or attenuate a sign, symptom or condition associated with AIDS.
In some embodiments, a NE comprising an immunogen (e.g., a recombinant HIV protein) is administered alone. In some embodiments, a composition comprising a NE and an immunogen (e.g., a recombinant HIV protein) comprises one or more other agents (e.g., a pharmaceutically acceptable carrier, adjuvant, excipient, and the like). In some embodiments, a composition for stimulating an immune response of the present invention is administered in a manner to induce a humoral immune response. In some embodiments, a composition for stimulating an immune response of the present invention is administered in a manner to induce a cellular (e.g., cytotoxic T lymphocyte) immune response, rather than a humoral response. In some embodiments, a composition comprising a NE and an immunogen of the present invention induces both a cellular and humoral immune response.
The present invention is not limited by the type or strain of orthopox virus used (e.g., in a composition comprising a NE and immunogen (e.g., orthopox virus inactivated by the nanoemulsion). Indeed, each orthopox virus family member alone, or in combination with another family member, may be used to generate a composition comprising a NE and an immunogen (e.g., used to generate an immune response) of the present invention. Orthopox virus family member include, but are not limited to, variola virus, vaccinia virus, cowpox, monkeypox, gergilpox, camelpox, and others. The present invention is not limited by the strain of vaccinia virus used. Indeed, a variety of vaccinia virus strains are contemplated to be useful in the present invention including, but not limited to, classical strains of vaccinia virus (e.g., EM-63, Lister, New York City Board of Health, Elestree, and Temple of Heaven strains), attenuated strains (e.g., Ankara), non-replicating strains, modified strains (e.g., genetically or mechanically modified strains (e.g., to become more or less virulent)), Copenhagen strain, modified vaccinia Ankara, New York vaccinia virus, Vaccinia VirusWR and Vaccinia VirusWR-Luc, or other serially diluted strain of vaccinia virus. A composition comprising a NE and immunogen may comprise one or more strains of vaccinia virus and/or other type of orthopox virus. Additionally, a composition comprising a NE and immunogen may comprise one or more strains of vaccinia virus, and, in addition, one or more strains of a non-vaccinia virus immunogen or immunogenic epitope thereof (e.g., a bacteria (e.g., B. anthracis) or immunogenic epitope thereof (e.g., recombinant protective antigen) or a virus (e.g., West Nile virus, Avian Influenza virus, Ebola virus, HSV, HPV, HCV, HIV, etc.) or an immunogenic epitope thereof (e.g., gp120)).
In some embodiments, the immunogen may comprise one or more antigens derived from a pathogen (e.g., orthopox virus). For example, in some embodiments, the immunogen is a purified, recombinant, synthetic, or otherwise isolated protein (e.g., added to the NE to generate an immunogenic composition). Similarly, the immunogenic protein may be a derivative, analogue or otherwise modified (e.g., PEGylated) form of a protein from a pathogen.
The present invention is not limited by the type or strain of Bacillus used or immunogenic protein derived therefrom. For example, 89 different strains of B. anthracis have been identified, ranging from virulent Ames and Vollum strains with biological warfare and bioterrorism applications to benign Sterne strain used for inoculations (See, e.g., Easterday et al., J Clin Microbiol. 2005 43(4):1995-7). The strains differ in presence and activity of various genes, determining their virulence and production of antigens and toxins. Any one of these or yet to be identified or generated strains may be used in an immunogenic composition comprising a NE of the present invention.
In some embodiments, the immunogen may comprise one or more antigens derived from a pathogen (e.g., B. anthracis). For example, in some embodiments, the immunogen is a purified, recombinant, synthetic, or otherwise isolated protein (e.g., added to the NE to generate an immunogenic composition). Similarly, the immunogenic protein may be a derivative, variant, analogue or otherwise modified form of a protein from a pathogen. The present invention is not limited by the type of protein (e.g., derived from bacteria of the genus Bacillus) used for generation of an immunogenic composition of the present invention. Indeed, a variety of immunogenic proteins may be used including, but not limited to, protective antigen (PA), lethal factor (LF), edema factor (EF), PA degradation products (See, e.g., Farchaus, J., et al., Applied & Environmental Microbiol., 64(3):982-991 (1998)), as well as analogues, derivatives and modified forms thereof.
For example, Bacillus proteins of the present invention may be used in their native conformation, or more preferably, may be modified for vaccine use. These modifications may either be required for technical reasons relating to the method of purification, or they may be used to biologically inactivate one or several functional properties of the Bacillus proteins (e.g., that would otherwise be toxic). Thus the invention encompasses derivatives of Bacillus proteins that may be, for example, mutated proteins (e.g., that has undergone deletion, addition or substitution of one or more amino acids using well known techniques for site directed mutagenesis or any other conventional method).
Bacillus proteins (e.g., rPA) of the present invention may be modified by chemical methods during a purification process to render the proteins stable and monomeric. One method to prevent oxidative aggregation of a protein is the use of chemical modifications of the protein's thiol groups. In a first step the disulphide bridges are reduced by treatment with a reducing agent such as DTT, β-mercaptoethanol, or gluthatione. In a second step the resulting thiols are blocked by reaction with an alkylating agent (e.g., the protein can be carboxyamidated/carbamidomethylated using iodoacetamide).
Each Bacillus family member alone, or in combination with another family member, may be used to generate a composition comprising a NE and an immunogen (e.g., used to generate an immune response) of the present invention. A composition comprising a NE and immunogen may comprise one or more strains of B. anthracis. Additionally, a composition comprising a NE and immunogen may comprise one or more strains of B. anthracis, and, in addition, one or more strains of a non-B. anthracis immunogen (e.g., a virus such as West Nile virus, Avian Influenza virus, Ebola virus, HSV, HPV, HCV, HIV, etc. or an immunogenic epitope thereof (e.g., gp120)).
The present invention is not limited by the type (e.g., serotype, group, or clade) of HIV used or immunogenic protein derived therefrom. For example, there are currently two types of HIV: HIV-1 and HIV-2. Both types are transmitted by sexual contact, through blood, and from mother to child, and they appear to cause clinically indistinguishable AIDS. However, it seems that HIV-2 is less easily transmitted, and the period between initial infection and illness is longer in the case of HIV-2. Worldwide, the predominant virus is HIV-1, and generally when people refer to HIV without specifying the type of virus they will be referring to HIV-1. The relatively uncommon HIV-2 type is concentrated in West Africa and is rarely found elsewhere.
Different levels of HIV classification exist. Each type is divided into groups, and each group is divided into subtypes and circulating recombinant forms (CRFs). The strains of HIV-1 can be classified into three groups: the “major” group M, the “outlier” group O and the “new” group N.
Within group M there are known to be at least nine genetically distinct subtypes (or clades) of HIV-1. These are subtypes A, B, C, D, F, G, H, J and K.
Any one of these or yet to be identified or generated serotypes, groups, or clades may be used in an immunogenic composition comprising a NE of the present invention.
In some embodiments, the immunogen may comprise one or more antigens derived from a pathogen (e.g., HIV). For example, in some embodiments, the immunogen is a purified, recombinant, synthetic, or otherwise isolated protein (e.g., added to the NE to generate an immunogenic composition). Similarly, the immunogenic protein may be a derivative, analogue or otherwise modified form of a protein from a pathogen. The present invention is not limited by the type of protein (e.g., derived from HIV) used for generation of an immunogenic composition of the present invention. Indeed, a variety of immunogenic proteins may be used including, but not limited to, gp160, gp120, gp41, Tat, and Nef, as well as analogues, derivatives and modified forms thereof.
For example, HIV proteins of the present invention may be used in their native conformation, or more preferably, may be modified for vaccine use. These modifications may either be required for technical reasons relating to the method of purification, or they may be used to biologically inactivate one or several functional properties of HIV protein. Thus the invention encompasses derivatives of HIV proteins which may be, for example mutated proteins (e.g., that has undergone deletion, addition or substitution of one or more amino acids using well known techniques for site directed mutagenesis or any other conventional method.
For example, a HIV protein may be mutated so that it is biologically inactive while maintaining its immunogenic epitopes (See, e.g., Clements, Virology 235: 48-64, 1997).
Additionally, HIV proteins of the present invention may be modified by chemical methods during the purification process to render the proteins stable and monomeric. One method to prevent oxidative aggregation of a HIV protein is the use of chemical modifications of the protein's thiol groups. In a first step the disulphide bridges are reduced by treatment with a reducing agent such as DTT, β-mercaptoethanol, or gluthatione. In a second step the resulting thiols are blocked by reaction with an alkylating agent (e.g., the protein can be carboxyamidated/carbamidomethylated using iodoacetamide).
Each HIV serotype, group or clade alone, or in combination with another family member, may be used to generate a composition comprising a NE and an immunogen (e.g., used to generate an immune response) of the present invention. A composition comprising a NE and immunogen may comprise one or more serotypes, groups or clades of HIV. Additionally, a composition comprising a NE and immunogen may comprise one or more serotypes, groups or clades of HIV, and, in addition, one or more strains of a non-HIV immunogen (e.g., a virus such as West Nile virus, Avian Influenza virus, Ebola virus, HSV, HPV, HCV, etc. or an immunogenic epitope thereof).
The present invention is not limited by the particular formulation of a composition comprising a NE and immunogen of the present invention. Indeed, a composition comprising a NE and immunogen of the present invention may comprise one or more different agents in addition to the NE and immunogen. These agents or cofactors include, but are not limited to, adjuvants, surfactants, additives, buffers, solubilizers, chelators, oils, salts, therapeutic agents, drugs, bioactive agents, antibacterials, and antimicrobial agents (e.g., antibiotics, antivirals, etc.). In some embodiments, a composition comprising a NE and immunogen of the present invention comprises an agent and/or co-factor that enhance the ability of the immunogen to induce an immune response (e.g., an adjuvant). In some preferred embodiments, the presence of one or more co-factors or agents reduces the amount of immunogen required for induction of an immune response (e.g., a protective immune respone (e.g., protective immunization)). In some embodiments, the presence of one or more co-factors or agents can be used to skew the immune response towards a cellular (e.g., T cell mediated) or humoral (e.g., antibody mediated) immune response. The present invention is not limited by the type of co-factor or agent used in a therapeutic agent of the present invention.
Adjuvants are described in general in Vaccine Design—the Subunit and Adjuvant Approach, edited by Powell and Newman, Plenum Press, New York, 1995. The present invention is not limited by the type of adjuvant utilized (e.g., for use in a composition (e.g., pharmaceutical composition) comprising a NE and immunogen). For example, in some embodiments, suitable adjuvants include an aluminium salt such as aluminium hydroxide gel (alum) or aluminium phosphate. In some embodiments, an adjuvant may be a salt of calcium, iron or zinc, or may be an insoluble suspension of acylated tyrosine, or acylated sugars, cationically or anionically derivatised polysaccharides, or polyphosphazenes.
In some embodiments, it is preferred that a composition comprising a NE and immunogen of the present invention comprises one or more adjuvants that induce a Th1-type response. However, in other embodiments, it will be preferred that a composition comprising a NE and immunogen of the present invention comprises one or more adjuvants that induce a Th2-type response.
In general, an immune response is generated to an antigen through the interaction of the antigen with the cells of the immune system. Immune responses may be broadly categorized into two categories: humoral and cell mediated immune responses (e.g., traditionally characterized by antibody and cellular effector mechanisms of protection, respectively). These categories of response have been termed Th1-type responses (cell-mediated response), and Th2-type immune responses (humoral response).
Stimulation of an immune response can result from a direct or indirect response of a cell or component of the immune system to an intervention (e.g., exposure to an immunogen). Immune responses can be measured in many ways including activation, proliferation or differentiation of cells of the immune system (e.g., B cells, T cells, dendritic cells, APCs, macrophages, NK cells, NKT cells etc.); up-regulated or down-regulated expression of markers and cytokines; stimulation of IgA, IgM, or IgG titer; splenomegaly (including increased spleen cellularity); hyperplasia and mixed cellular infiltrates in various organs. Other responses, cells, and components of the immune system that can be assessed with respect to immune stimulation are known in the art.
Although an understanding of the mechanism is not necessary to practice the present invention and the present invention is not limited to any particular mechanism of action, in some embodiments, compositions and methods of the present invention induce expression and secretion of cytokines (e.g., by macrophages, dendritic cells and CD4+ T cells). Modulation of expression of a particular cytokine can occur locally or systemically. It is known that cytokine profiles can determine T cell regulatory and effector functions in immune responses. In some embodiments, Th1-type cytokines can be induced, and thus, the immunostimulatory compositions of the present invention can promote a Th1 type antigen-specific immune response including cytotoxic T-cells. However in other embodiments, Th2-type cytokines can be induced thereby promoting a Th2 type antigen-specific immune response.
Cytokines play a role in directing the T cell response. Helper (CD4+) T cells orchestrate the immune response of mammals through production of soluble factors that act on other immune system cells, including B and other T cells. Most mature CD4+ T helper cells express one of two cytokine profiles: Th1 or Th2. Th1-type CD4+ T cells secrete IL-2, IL-3, IFN-γ, GM-CSF and high levels of TNF-α. Th2 cells express IL-3, IL-4, IL-5, IL-6, IL-9, IL-10, IL-13, GM-CSF and low levels of TNF-α. Th1 type cytokines promote both cell-mediated immunity, and humoral immunity that is characterized by immunoglobulin class switching to IgG2a in mice and IgG1 in humans. Th1 responses may also be associated with delayed-type hypersensitivity and autoimmune disease. Th2 type cytokines induce primarily humoral immunity and induce class switching to IgG1 and IgE. The antibody isotypes associated with Th1 responses generally have neutralizing and opsonizing capabilities whereas those associated with Th2 responses are associated more with allergic responses.
Several factors have been shown to influence skewing of an immune response towards either a Th1 or Th2 type response. The best characterized regulators are cytokines. IL-12 and IFN-7 are positive Th1 and negative Th2 regulators. IL-12 promotes IFN-γ production, and IFN-γ provides positive feedback for IL-12. IL-4 and IL-10 appear important for the establishment of the Th2 cytokine profile and to down-regulate Th1 cytokine production.
Thus, in some preferred embodiments, the present invention provides a method of stimulating a Th1-type immune response in a subject comprising administering to a subject a composition comprising a NE and an immunogen. However, in other preferred embodiments, the present invention provides a method of stimulating a Th2-type immune response in a subject comprising administering to a subject a composition comprising a NE and an immunogen. In further preferred embodiments, adjuvants can be used (e.g., can be co-administered with a composition of the present invention) to skew an immune response toward either a Th1 or Th2 type immune response. For example, adjuvants that induce Th2 or weak Th1 responses include, but are not limited to, alum, saponins, and SB-As4. Adjuvants that induce Th1 responses include but are not limited to MPL, MDP, ISCOMS, IL-12, IFN-γ, and SB-AS2.
Several other types of Th1-type immunogens can be used (e.g., as an adjuvant) in compositions and methods of the present invention. These include, but are not limited to, the following. In some embodiments, monophosphoryl lipid A (e.g., in particular 3-de-O-acylated monophosphoryl lipid A (3D-MPL)), is used. 3D-MPL is a well known adjuvant manufactured by Ribi Immunochem, Montana. Chemically it is often supplied as a mixture of 3-de-O-acylated monophosphoryl lipid A with either 4, 5, or 6 acylated chains. In some embodiments, diphosphoryl lipid A, and 3-O-deacylated variants thereof are used. Each of these immunogens can be purified and prepared by methods described in GB 2122204B, hereby incorporated by reference in its entirety. Other purified and synthetic lipopolysaccharides have been described (See, e.g., U.S. Pat. No. 6,005,099 and EP 0 729 473; Hilgers et al., 1986, Int. Arch. Allergy. Immunol., 79(4):392-6; Hilgers et al., 1987, Immunology, 60(1):141-6; and EP 0 549 074, each of which is hereby incorporated by reference in its entirety). In some embodiments, 3D-MPL is used in the form of a particulate formulation (e.g., having a small particle size less than 0.2 μm in diameter, described in EP 0 689 454, hereby incorporated by reference in its entirety).
In some embodiments, saponins are used as an immunogen (e.g., Th1-type adjuvant) in a composition of the present invention. Saponins are well known adjuvants (See, e.g., Lacaille-Dubois and Wagner (1996) Phytomedicine vol 2 pp 363-386). Examples of saponins include Quil A (derived from the bark of the South American tree Quillaja Saponaria Molina), and fractions thereof (See, e.g., U.S. Pat. No. 5,057,540; Kensil, Crit Rev Ther Drug Carrier Syst, 1996, 12 (1-2):1-55; and EP 0 362 279, each of which is hereby incorporated by reference in its entirety). Also contemplated to be useful in the present invention are the haemolytic saponins QS7, QS17, and QS21 (HPLC purified fractions of Quil A; See, e.g., Kensil et al. (1991). J. Immunology 146,431-437, U.S. Pat. No. 5,057,540; WO 96/33739; WO 96/11711 and EP 0 362 279, each of which is hereby incorporated by reference in its entirety). Also contemplated to be useful are combinations of QS21 and polysorbate or cyclodextrin (See, e.g., WO 99/10008, hereby incorporated by reference in its entirety.
In some embodiments, an immunogenic oligonucleotide containing unmethylated CpG dinucleotides (“CpG”) is used as an adjuvant in the present invention. CpG is an abbreviation for cytosine-guanosine dinucleotide motifs present in DNA. CpG is known in the art as being an adjuvant when administered by both systemic and mucosal routes (See, e.g., WO 96/02555, EP 468520, Davis et al., J. Immunol, 1998, 160(2):870-876; McCluskie and Davis, J. Immunol., 1998, 161(9):4463-6; and U.S. Pat. App. No. 20050238660, each of which is hereby incorporated by reference in its entirety). For example, in some embodiments, the immunostimulatory sequence is Purine-Purine-C-G-pyrimidine-pyrimidine; wherein the CG motif is not methylated.
Although an understanding of the mechanism is not necessary to practice the present invention and the present invention is not limited to any particular mechanism of action, in some embodiments, the presence of one or more CpG oligonucleotides activate various immune subsets including natural killer cells (which produce IFN-γ) and macrophages. In some embodiments, CpG oligonucleotides are formulated into a composition of the present invention for inducing an immune response. In some embodiments, a free solution of CpG is co-administered together with an antigen (e.g., present within a NE solution (See, e.g., WO 96/02555; hereby incorporated by reference). In some embodiments, a CpG oligonucleotide is covalently conjugated to an antigen (See, e.g., WO 98/16247, hereby incorporated by reference), or formulated with a carrier such as aluminium hydroxide (See, e.g., Brazolot-Millan et al., Proc. Natl. Acad Sci., USA, 1998, 95(26), 15553-8).
In some embodiments, adjuvants such as Complete Freunds Adjuvant and Incomplete Freunds Adjuvant, cytokines (e.g., interleukins (e.g., IL-2, IFN-γ, IL-4, etc.), macrophage colony stimulating factor, tumor necrosis factor, etc.), detoxified mutants of a bacterial ADP-ribosylating toxin such as a cholera toxin (CT), a pertussis toxin (PT), or an E. Coli heat-labile toxin (LT), particularly LT-K63 (where lysine is substituted for the wild-type amino acid at position 63) LT-R72 (where arginine is substituted for the wild-type amino acid at position 72), CT-S109 (where serine is substituted for the wild-type amino acid at position 109), and PT-K9/G129 (where lysine is substituted for the wild-type amino acid at position 9 and glycine substituted at position 129) (See, e.g., WO93/13202 and WO92/19265, each of which is hereby incorporated by reference), and other immunogenic substances (e.g., that enhance the effectiveness of a composition of the present invention) are used with a composition comprising a NE and immunogen of the present invention.
Additional examples of adjuvants that find use in the present invention include poly(di(carboxylatophenoxy)phosphazene (PCPP polymer; Virus Research Institute, USA); derivatives of lipopolysaccharides such as monophosphoryl lipid A (MPL; Ribi ImmunoChem Research, Inc., Hamilton, Mont.), muramyl dipeptide (MDP; Ribi) and threonyl-muramyl dipeptide (t-MDP; Ribi); OM-174 (a glucosamine disaccharide related to lipid A; OM Pharma SA, Meyrin, Switzerland); and Leishmania elongation factor (a purified Leishmania protein; Corixa Corporation, Seattle, Wash.).
Adjuvants may be added to a composition comprising a NE and an immunogen, or, the adjuvant may be formulated with carriers, for example liposomes, or metallic salts (e.g., aluminium salts (e.g., aluminium hydroxide)) prior to combining with or co-administration with a composition comprising a NE and an immunogen.
In some embodiments, a composition comprising a NE and an immunogen comprises a single adjuvant. In other embodiments, a composition comprising a NE and an immunogen comprises two or more adjuvants (See, e.g., WO 94/00153; WO 95/17210; WO 96/33739; WO 98/56414; WO 99/12565; WO 99/11241; and WO 94/00153, each of which is hereby incorporated by reference in its entirety).
In some embodiments, a composition comprising a NE and an immunogen of the present invention comprises one or more mucoadhesives (See, e.g., U.S. Pat. App. No. 20050281843, hereby incorporated by reference in its entirety). The present invention is not limited by the type of mucoadhesive utilized. Indeed, a variety of mucoadhesives are contemplated to be useful in the present invention including, but not limited to, cross-linked derivatives of poly(acrylic acid) (e.g., carbopol and polycarbophil), polyvinyl alcohol, polyvinyl pyrollidone, polysaccharides (e.g., alginate and chitosan), hydroxypropyl methylcellulose, lectins, fimbrial proteins, and carboxymethylcellulose. Although an understanding of the mechanism is not necessary to practice the present invention and the present invention is not limited to any particular mechanism of action, in some embodiments, use of a mucoadhesive (e.g., in a composition comprising a NE and immunogen) enhances induction of an immune response in a subject (e.g., administered a composition of the present invention) due to an increase in duration and/or amount of exposure to an immunogen that a subject experiences when a mucoadhesive is used compared to the duration and/or amount of exposure to an immunogen in the absence of using the mucoadhesive.
In some embodiments, a composition of the present invention may comprise sterile aqueous preparations. Acceptable vehicles and solvents include, but are not limited to, water, Ringer's solution, phosphate buffered saline and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed mineral or non-mineral oil may be employed including synthetic mono-ordi-glycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables. Carrier formulations suitable for mucosal, subcutaneous, intramuscular, intraperitoneal, intravenous, or administration via other routes may be found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa.
A composition comprising a NE and an immunogen of the present invention can be used therapeutically (e.g., to enhance an immune response) or as a prophylactic (e.g., for immunization (e.g., to prevent signs or symptoms of disease)). A composition comprising a NE and an immunogen of the present invention can be administered to a subject via a number of different delivery routes and methods.
For example, the compositions of the present invention can be administered to a subject (e.g., mucosally (e.g., nasal mucosa, vaginal mucosa, etc.)) by multiple methods, including, but not limited to: being suspended in a solution and applied to a surface; being suspended in a solution and sprayed onto a surface using a spray applicator; being mixed with a mucoadhesive and applied (e.g., sprayed or wiped) onto a surface (e.g., mucosal surface); being placed on or impregnated onto a nasal and/or vaginal applicator and applied; being applied by a controlled-release mechanism; being applied as a liposome; or being applied on a polymer.
In some preferred embodiments, compositions of the present invention are administered mucosally (e.g., using standard techniques; See, e.g., Remington: The Science and Practice of Pharmacy, Mack Publishing Company, Easton, Pa., 19th edition, 1995 (e.g., for mucosal delivery techniques, including intranasal, pulmonary, vaginal and rectal techniques), as well as European Publication No. 517,565 and Illum et al., J. Controlled Rel., 1994, 29:133-141 (e.g., for techniques of intranasal administration), each of which is hereby incorporated by reference in its entirety). Alternatively, the compositions of the present invention may be administered dermally or transdermally, using standard techniques (See, e.g., Remington: The Science arid Practice of Pharmacy, Mack Publishing Company, Easton, Pa., 19th edition, 1995). The present invention is not limited by the route of administration.
Although an understanding of the mechanism is not necessary to practice the present invention and the present invention is not limited to any particular mechanism of action, in some embodiments, mucosal vaccination is the preferred route of administration as it has been shown that mucosal administration of antigens has a greater efficacy of inducing protective immune responses at mucosal surfaces (e.g., mucosal immunity), the route of entry of many pathogens. In addition, mucosal vaccination, such as intranasal vaccination, may induce mucosal immunity not only in the nasal mucosa, but also in distant mucosal sites such as the genital mucosa (See, e.g., Mestecky, Journal of Clinical Immunology, 7:265-276, 1987). More advantageously, in further preferred embodiments, in addition to inducing mucosal immune responses, mucosal vaccination also induces systemic immunity. In some embodiments, non-parenteral administration (e.g., muscosal administration of vaccines) provides an efficient and convenient way to boost systemic immunity (e.g., induced by parenteral or mucosal vaccination (e.g., in cases where multiple boosts are used to sustain a vigorous systemic immunity)).
In some embodiments, a composition comprising a NE and an immunogen of the present invention may be used to protect or treat a subject susceptible to, or suffering from, disease by means of administering a composition of the present invention via a mucosal route (e.g., an oral/alimentary or nasal route). Alternative mucosal routes include intravaginal and intra-rectal routes. In preferred embodiments of the present invention, a nasal route of administration is used, termed “intranasal administration” or “intranasal vaccination” herein. Methods of intranasal vaccination are well known in the art, including the administration of a droplet or spray form of the vaccine into the nasopharynx of a sujbect to be immunized. In some embodiments, a nebulized or aerosolized composition comprising a NE and immunogen is provided. Enteric formulations such as gastro resistant capsules for oral administration, suppositories for rectal or vaginal administration also form part of this invention. Compositions of the present invention may also be administered via the oral route. Under these circumstances, a composition comprising a NE and an immunogen may comprise a pharmaceutically acceptable excipient and/or include alkaline buffers, or enteric capsules. Formulations for nasal delivery may include those with dextran or cyclodextran and saponin as an adjuvant.
Compositions of the present invention may also be administered via a vaginal route. In such cases, a composition comprising a NE and an immunogen may comprise pharmaceutically acceptable excipients and/or emulsifiers, polymers (e.g., CARBOPOL), and other known stabilizers of vaginal creams and suppositories. In some embodiments, compositions of the present invention are administered via a rectal route. In such cases, a composition comprising a NE and an immunogen may comprise excipients and/or waxes and polymers known in the art for forming rectal suppositories.
In some embodiments, the same route of administration (e.g., mucosal administration) is chosen for both a priming and boosting vaccination. In some embodiments, multiple routes of administration are utilized (e.g., at the same time, or, alternatively, sequentially) in order to stimulate an immune response (e.g., using a composition comprising a NE and immunogen of the present invention).
For example, in some embodiments, a composition comprising a NE and an immunogen is administered to a mucosal surface of a subject in either a priming or boosting vaccination regime. Alternatively, in some embodiments, a composition comprising a NE and an immunogen is administered systemically in either a priming or boosting vaccination regime. In some embodiments, a composition comprising a NE and an immunogen is administered to a subject in a priming vaccination regimen via mucosal administration and a boosting regimen via systemic administration. In some embodiments, a composition comprising a NE and an immunogen is administered to a subject in a priming vaccination regimen via systemic administration and a boosting regimen via mucosal administration. Examples of systemic routes of administration include, but are not limited to, a parenteral, intramuscular, intradermal, transdermal, subcutaneous, intraperitoneal or intravenous administration. A composition comprising a NE and an immunogen may be used for both prophylactic and therapeutic purposes.
In some embodiments, compositions of the present invention are administered by pulmonary delivery. For example, a composition of the present invention can be delivered to the lungs of a subject (e.g., a human) via inhalation (e.g., thereby traversing across the lung epithelial lining to the blood stream (See, e.g., Adjei, et al. Pharmaceutical Research 1990; 7:565-569; Adjei, et al. Int. J. Pharmaceutics 1990; 63:135-144; Braquet, et al. J. Cardiovascular Pharmacology 1989 143-146; Hubbard, et al. (1989) Annals of Internal Medicine, Vol. III, pp. 206-212; Smith, et al. J. Clin. Invest. 1989; 84:1145-1146; Oswein, et al. “Aerosolization of Proteins”, 1990; Proceedings of Symposium on Respiratory Drug Delivery II Keystone, Colo.; Debs, et al. J. Immunol. 1988; 140:3482-3488; and U.S. Pat. No. 5,284,656 to Platz, et al, each of which are hereby incorporated by reference in its entirety). A method and composition for pulmonary delivery of drugs for systemic effect is described in U.S. Pat. No. 5,451,569 to Wong, et al., hereby incorporated by reference; See also U.S. Pat. No. 6,651,655 to Licalsi et al., hereby incorporated by reference in its entirety)).
Further contemplated for use in the practice of this invention are a wide range of mechanical devices designed for pulmonary and/or nasal mucosal delivery of pharmaceutical agents including, but not limited to, nebulizers, metered dose inhalers, and powder inhalers, all of which are familiar to those skilled in the art. Some specific examples of commercially available devices suitable for the practice of this invention are the Ultravent nebulizer (Mallinckrodt Inc., St. Louis, Mo.); the Acorn II nebulizer (Marquest Medical Products, Englewood, Colo.); the Ventolin metered dose inhaler (Glaxo Inc., Research Triangle Park, N.C.); and the Spinhaler powder inhaler (Fisons Corp., Bedford, Mass.). All such devices require the use of formulations suitable for dispensing of the therapeutic agent. Typically, each formulation is specific to the type of device employed and may involve the use of an appropriate propellant material, in addition to the usual diluents, adjuvants, surfactants, carriers and/or other agents useful in therapy. Also, the use of liposomes, microcapsules or microspheres, inclusion complexes, or other types of carriers is contemplated.
Thus, in some embodiments, a composition comprising a NE and an immunogen of the present invention may be used to protect and/or treat a subject susceptible to, or suffering from, a disease by means of administering a compositions comprising a NE and an immunogen by mucosal, intramuscular, intraperitoneal, intradermal, transdermal, pulmonary, intravenous, subcutaneous or other route of administration described herein. Methods of systemic administration of the vaccine preparations may include conventional syringes and needles, or devices designed for ballistic delivery of solid vaccines (See, e.g., WO 99/27961, hereby incorporated by reference), or needleless pressure liquid jet device (See, e.g., U.S. Pat. No. 4,596,556; U.S. Pat. No. 5,993,412, each of which are hereby incorporated by reference), or transdermal patches (See, e.g., WO 97/48440; WO 98/28037, each of which are hereby incorporated by reference). The present invention may also be used to enhance the immunogenicity of antigens applied to the skin (transdermal or transcutaneous delivery, See, e.g., WO 98/20734; WO 98/28037, each of which are hereby incorporated by reference). Thus, in some embodiments, the present invention provides a delivery device for systemic administration, pre-filled with the vaccine composition of the present invention.
The present invention is not limited by the type of subject administered (e.g., in order to stimulate an immune response (e.g., in order to generate protective immunity (e.g., mucosal and/or systemic immunity))) a composition of the present invention. Indeed, a wide variety of subjects are contemplated to be benefited from administration of a composition of the present invention. In preferred embodiments, the subject is a human. In some embodiments, human subjects are of any age (e.g., adults, children, infants, etc.) that have been or are likely to become exposed to a microorganism. In some embodiments, the human subjects are subjects that are more likely to receive a direct exposure to pathogenic microorganisms or that are more likely to display signs and symptoms of disease after exposure to a pathogen (e.g., immune suppressed subjects). In some embodiments, the general public is administered (e.g., vaccinated with) a composition of the present invention (e.g., to prevent the occurrence or spread of disease). For example, in some embodiments, compositions and methods of the present invention are utilized to vaccinate a group of people (e.g., a population of a region, city, state and/or country) for their own health (e.g., to prevent or treat disease). In some embodiments, the subjects are non-human mammals (e.g., pigs, cattle, goats, horses, sheep, or other livestock; or mice, rats, rabbits or other animal). In some embodiments, compositions and methods of the present invention are utilized in research settings (e.g., with research animals).
A composition of the present invention may be formulated for administration by any route, such as mucosal, oral, topical, parenteral or other route described herein. The compositions may be in any one or more different forms including, but not limited to, tablets, capsules, powders, granules, lozenges, foams, creams or liquid preparations.
Topical formulations of the present invention may be presented as, for instance, ointments, creams or lotions, foams, and aerosols, and may contain appropriate conventional additives such as preservatives, solvents (e.g., to assist penetration), and emollients in ointments and creams.
Topical formulations may also include agents that enhance penetration of the active ingredients through the skin. Exemplary agents include a binary combination of N-(hydroxyethyl) pyrrolidone and a cell-envelope disordering compound, a sugar ester in combination with a sulfoxide or phosphine oxide, and sucrose monooleate, decyl methyl sulfoxide, and alcohol.
Other exemplary materials that increase skin penetration include surfactants or wetting agents including, but not limited to, polyoxyethylene sorbitan mono-oleoate (Polysorbate 80); sorbitan mono-oleate (Span 80); p-isooctyl polyoxyethylene-phenol polymer (Triton WR-1330); polyoxyethylene sorbitan tri-oleate (Tween 85); dioctyl sodium sulfosuccinate; and sodium sarcosinate (Sarcosyl NL-97); and other pharmaceutically acceptable surfactants.
In certain embodiments of the invention, compositions may further comprise one or more alcohols, zinc-containing compounds, emollients, humectants, thickening and/or gelling agents, neutralizing agents, and surfactants. Water used in the formulations is preferably deionized water having a neutral pH. Additional additives in the topical formulations include, but are not limited to, silicone fluids, dyes, fragrances, pH adjusters, and vitamins.
Topical formulations may also contain compatible conventional carriers, such as cream or ointment bases and ethanol or oleyl alcohol for lotions. Such carriers may be present as from about 1% up to about 98% of the formulation. The ointment base can comprise one or more of petrolatum, mineral oil, ceresin, lanolin alcohol, panthenol, glycerin, bisabolol, cocoa butter and the like.
In some embodiments, pharmaceutical compositions of the present invention may be formulated and used as foams. Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product.
The compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, preferably do not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents (e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like) that do not deleteriously interact with the NE and immunogen of the formulation. In some embodiments, immunostimulatory compositions of the present invention are administered in the form of a pharmaceutically acceptable salt. When used the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof. Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group.
Suitable buffering agents include, but are not limited to, acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v). Suitable preservatives may include benzalkonium chloride (0.003-0.03% w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% w/v).
In some embodiments, a composition comprising a NE and an immunogen is co-administered with one or more antibiotics. For example, one or more antibiotics may be administered with, before and/or after administration of a composition comprising a NE and an immunogen. The present invention is not limited by the type of antibiotic co-administered.
Indeed, a variety of antibiotics may be co-administered including, but not limited to, β-lactam antibiotics, penicillins (such as natural penicillins, aminopenicillins, penicillinase-resistant penicillins, carboxy penicillins, ureido penicillins), cephalosporins (first generation, second generation, and third generation cephalosporins), and other β-lactams (such as imipenem, monobactams,), β-lactamase inhibitors, vancomycin, aminoglycosides and spectinomycin, tetracyclines, chloramphenicol, erythromycin, lincomycin, clindamycin, rifampin, metronidazole, polymyxins, doxycycline, quinolones (e.g., ciprofloxacin), sulfonamides, trimethoprim, and quinolines.
There are an enormous amount of antimicrobial agents currently available for use in treating bacterial, fungal and viral infections. For a comprehensive treatise on the general classes of such drugs and their mechanisms of action, the skilled artisan is referred to Goodman & Gilman's “The Pharmacological Basis of Therapeutics” Eds. Hardman et al., 9th Edition, Pub. McGraw Hill, chapters 43 through 50, 1996, (herein incorporated by reference in its entirety). Generally, these agents include agents that inhibit cell wall synthesis (e.g., penicillins, cephalosporins, cycloserine, vancomycin, bacitracin); and the imidazole antifungal agents (e.g., miconazole, ketoconazole and clotrimazole); agents that act directly to disrupt the cell membrane of the microorganism (e.g., detergents such as polmyxin and colistimethate and the antifungals nystatin and amphotericin B); agents that affect the ribosomal subunits to inhibit protein synthesis (e.g., chloramphenicol, the tetracyclines, erthromycin and clindamycin); agents that alter protein synthesis and lead to cell death (e.g., aminoglycosides); agents that affect nucleic acid metabolism (e.g., the rifamycins and the quinolones); the antimetabolites (e.g., trimethoprim and sulfonamides); and the nucleic acid analogues such as zidovudine, gangcyclovir, vidarabine, and acyclovir which act to inhibit viral enzymes essential for DNA synthesis. Various combinations of antimicrobials may be employed.
The present invention also includes methods involving co-administration of a composition comprising a NE and an immunogen with one or more additional active and/or immunostimulatory agents (e.g., a composition comprising a NE and a different immunogen, an antibiotic, anti-oxidant, etc.). Indeed, it is a further aspect of this invention to provide methods for enhancing prior art immunostimulatory methods (e.g., immunization methods) and/or pharmaceutical compositions by co-administering a composition of the present invention. In co-administration procedures, the agents may be administered concurrently or sequentially. In one embodiment, the compositions described herein are administered prior to the other active agent(s). The pharmaceutical formulations and modes of administration may be any of those described herein. In addition, the two or more co-administered agents may each be administered using different modes (e.g., routes) or different formulations. The additional agents to be co-administered (e.g., antibiotics, adjuvants, etc.) can be any of the well-known agents in the art, including, but not limited to, those that are currently in clinical use.
In some embodiments, a composition comprising a NE and immunogen is administered to a subject via more than one route. For example, a subject that would benefit from having a protective immune response (e.g., immunity) towards a pathogenic microorganism may benefit from receiving mucosal administration (e.g., nasal administration or other mucosal routes described herein) and, additionally, receiving one or more other routes of administration (e.g., parenteral or pulmonary administration (e.g., via a nebulizer, inhaler, or other methods described herein). In some preferred embodiments, administration via mucosal route is sufficient to induce both mucosal as well as systemic immunity towards an immunogen or organism from which the immunogen is derived. In other embodiments, administration via multiple routes serves to provide both mucosal and systemic immunity. Thus, although an understanding of the mechanism is not necessary to practice the present invention and the present invention is not limited to any particular mechanism of action, in some embodiments, it is contemplated that a subject administered a composition of the present invention via multiple routes of administration (e.g., immunization (e.g., mucosal as well as airway or parenteral administration of a composition comprising a NE and immunogen of the present invention) may have a stronger immune response to an immunogen than a subject administered a composition via just one route.
Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the compositions, increasing convenience to the subject and a physician. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer based systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Pat. No. 5,075,109, hereby incorporated by reference. Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-di- and tri-glycerides; hydrogel release systems; sylastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which an agent of the invention is contained in a form within a matrix such as those described in U.S. Pat. Nos. 4,452,775, 4,675,189, and 5,736,152, each of which is hereby incorporated by reference and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686, each of which is hereby incorporated by reference. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.
In preferred embodiments, a composition comprising a NE and an immunogen of the present invention comprises a suitable amount of the immunogen to induce an immune response in a subject when administered to the subject. In preferred embodiments, the immune response is sufficient to provide the subject protection (e.g., immune protection) against a subsequent exposure to the immunogen or the microorganism (e.g., bacteria or virus) from which the immunogen was derived. The present invention is not limited by the amount of immunogen used. In some preferred embodiments, the amount of immunogen (e.g., virus or bacteria neutralized by the NE, or, recombinant protein) in a composition comprising a NE and immunogen (e.g., for use as an immunization dose) is selected as that amount which induces an immunoprotective response without significant, adverse side effects. The amount will vary depending upon which specific immunogen or combination thereof is/are employed, and can vary from subject to subject, depending on a number of factors including, but not limited to, the species, age and general condition (e.g., health) of the subject, and the mode of administration. Procedures for determining the appropriate amount of immunogen administered to a subject to elicit an immune response (e.g., a protective immune response (e.g., protective immunity)) in a subject are well known to those skilled in the art.
In some embodiments, it is expected that each dose (e.g., of a composition comprising a NE and an immunogen (e.g., administered to a subject to induce an immune response (e.g., a protective immune response (e.g., protective immunity))) comprises 0.05-5000 μg of each immunogen (e.g., recombinant and/or purified protein), in some embodiments, each dose will comprise 1-500 μg, in some embodiments, each dose will comprise 350-750 μg, in some embodiments, each dose will comprise 50-200 μg, in some embodiments, each dose will comprise 25-75 μg of immunogen (e.g., recombinant and/or purifed protein). In some embodiments, each dose comprises an amount of the immunogen sufficient to generate an immune response. An effective amount of the immunogen in a dose need not be quantified, as long as the amount of immunogen generates an immune response in a subject when administered to the subject. An optimal amount for a particular administration (e.g., to induce an immune response (e.g., a protective immune response (e.g., protective immunity))) can be ascertained by one of skill in the art using standard studies involving observation of antibody titers and other responses in subjects.
In some embodiments, it is expected that each dose (e.g., of a composition comprising a NE and an immunogen (e.g., administered to a subject to induce and immune response)) is from 0.001 to 15% or more (e.g., 0.001-10%, 0.5-5%, 1-3%, 2%, 6%, 10%, 15% or more) by weight immunogen (e.g., neutralized bacteria or virus, or recombinant and/or purified protein). In some embodiments, an initial or prime administration dose contains more immunogen than a subsequent boost dose In some embodiments, when a NE of the present invention is utilized to inactivate a live microorganism (e.g., virus (e.g., HIV)), it is expected that each dose (e.g., administered to a subject to induce and immune response)) comprises between 10 and 109 pfu of the virus per dose; in some embodiments, each dose comprises between 105 and 108 pfu of the virus per dose; in some embodiments, each dose comprises between 103 and 105 pfu of the virus per dose; in some embodiments, each dose comprises between 102 and 104 pfu of the virus per dose; in some embodiments, each dose comprises 10 pfu of the virus per dose; in some embodiments, each dose comprises 102 pfu of the virus per dose; and in some embodiments, each dose comprises 104 pfu of the virus per dose. In some embodiments, each dose comprises more than 109 pfu of the virus per dose. In some preferred embodiments, each dose comprises 103 pfu of the virus per dose.
In some embodiments, when a NE of the present invention is utilized to inactivate a live microorganism (e.g., a population of bacteria (e.g., of the genus Bacillus (B. anthracis))), it is expected that each dose (e.g., administered to a subject to induce and immune response)) comprises between 10 and 1010 bacteria per dose; in some embodiments, each dose comprises between 105 and 108 bacteria per dose; in some embodiments, each dose comprises between 103 and 105 bacteria per dose; in some embodiments, each dose comprises between 102 and 104 bacteria per dose; in some embodiments, each dose comprises 10 bacteria per dose; in some embodiments, each dose comprises 102 bacteria per dose; and in some embodiments, each dose comprises 104 bacteria per dose. In some embodiments, each dose comprises more than 1010 bacteria per dose. In some embodiments, each dose comprises 103 bacteria per dose.
The present invention is not limited by the amount of NE used to inactivate live microorganisms (e.g., a virus (e.g., one or more types of HIV)). In some embodiments, a 0.1%-5% NE solution is used, in some embodiments, a 5%-20% NE solution is used, in some embodiments, a 20% NE solution is used, and in some embodiments, a NE solution greater than 20% is used order to inactivate a pathogenic microorganism. In preferred embodiments, a 10% NE solution is used.
Similarly, the present invention is not limited by the duration of time a live microorganism is incubated in a NE of the present invention in order to become inactivated. In some embodiments, the microorganism is incubated for 1-3 hours in NE. In some embodiments, the microorganism is incubated for 3-6 hours in NE. In some embodiments, the microorganism is incubated for more than 6 hours in NE. In preferred embodiments, the microorganism is incubated for 3 hours in NE (e.g., a 10% NE solution). In some embodiments, the incubation is carried out at 37° C. In some embodiments, the incubation is carried out at a temperature greater than or less than 37° C. The present invention is also not limited by the amount of microorganism used for inactivation. The amount of microorganism may depend upon a number of factors including, but not limited to, the total amount of immunogenic composition (e.g., NE and immunogen) desired, the concentration of solution desired (e.g., prior to dilution for administration), the microorganism and the NE. In some preferred embodiments, the amount of microorganism used in an inactivation procedure is that amount that produces the desired amount of immunogen (e.g., as described herein) to be administered in a single dose (e.g., diluted from a concentrated stock) to a subject.
In some embodiments, a composition comprising a NE and an immunogen of the present invention is formulated in a concentrated dose that can be diluted prior to administration to a subject. For example, dilutions of a concentrated composition may be administered to a subject such that the subject receives any one or more of the specific dosages provided herein. In some embodiments, dilution of a concentrated composition may be made such that a subject is administered (e.g., in a single dose) a composition comprising 0.5-50% of the NE and immunogen present in the concentrated composition. In some preferred embodiments, a subject is administered in a single dose a composition comprising 1% of the NE and immunogen present in the concentrated composition. Concentrated compositions are contemplated to be useful in a setting in which large numbers of subjects may be administered a composition of the present invention (e.g., an immunization clinic, hospital, school, etc.). In some embodiments, a composition comprising a NE and an immunogen of the present invention (e.g., a concentrated composition) is stable at room temperature for more than 1 week, in some embodiments for more than 2 weeks, in some embodiments for more than 3 weeks, in some embodiments for more than 4 weeks, in some embodiments for more than 5 weeks, and in some embodiments for more than 6 weeks.
Generally, the emulsion compositions of the invention will comprise at least 0.001% to 100%, preferably 0.01 to 90%, of emulsion per ml of liquid composition. It is envisioned that the formulations may comprise about 0.001%, about 0.0025%, about 0.005%, about 0.0075%, about 0.01%, about 0.025%, about 0.05%, about 0.075%, about 0.1%, about 0.25%, about 0.5%, about 1.0%, about 2.5%, about 5%, about 7.5%, about 10%, about 12.5%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or about 100% of emulsion per ml of liquid composition. It should be understood that a range between any two figures listed above is specifically contemplated to be encompassed within the metes and bounds of the present invention. Some variation in dosage will necessarily occur depending on the condition of the specific pathogen and the subject being immunized.
In some embodiments, following an initial administration of a composition of the present invention (e.g., an initial vaccination), a subject may receive one or more boost administrations (e.g., around 2 weeks, around 3 weeks, around 4 weeks, around 5 weeks, around 6 weeks, around 7 weeks, around 8 weeks, around 10 weeks, around 3 months, around 4 months, around 6 months, around 9 months, around 1 year, around 2 years, around 3 years, around 5 years, around 10 years) subsequent to a first, second, third, fourth, fifth, sixth, seventh, eights, ninth, tenth, and/or more than tenth administration. Although an understanding of the mechanism is not necessary to practice the present invention and the present invention is not limited to any particular mechanism of action, in some embodiments, reintroduction of an immunogen in a boost dose enables vigorous systemic immunity in a subject. The boost can be with the same formulation given for the primary immune response, or can be with a different formulation that contains the immunogen. The dosage regimen will also, at least in part, be determined by the need of the subject and be dependent on the judgment of a practitioner.
Dosage units may be proportionately increased or decreased based on several factors including, but not limited to, the weight, age, and health status of the subject. In addition, dosage units may be increased or decreased for subsequent administrations (e.g., boost administrations).
A composition comprising an immunogen of the present invention finds use where the nature of the infectious and/or disease causing agent (e.g., for which protective immunity is sought to be elicited) is known, as well as where the nature of the infectious and/or disease causing agent is unknown (e.g., in emerging disease (e.g., of pandemic proportion (e.g., influenza or other outbreaks of disease))). For example, the present invention contemplates use of the compositions of the present invention in treatment of or prevention of (e.g., via immunization with an infectious and/or disease causing HIV or HIV-like agent neutralized via a NE of the present invention) infections associated with an emergent infectious and/or disease causing agent yet to be identified (e.g., isolated and/or cultured from a diseased person but without genetic, biochemical or other characterization of the infectious and/or disease causing agent).
It is contemplated that the compositions and methods of the present invention will find use in various settings, including research settings. For example, compositions and methods of the present invention also find use in studies of the immune system (e.g., characterization of adaptive immune responses (e.g., protective immune responses (e.g., mucosal or systemic immunity))). Uses of the compositions and methods provided by the present invention encompass human and non-human subjects and samples from those subjects, and also encompass research applications using these subjects. Compositions and methods of the present invention are also useful in studying and optimizing nanoemulsions, immunogens, and other components and for screening for new components. Thus, it is not intended that the present invention be limited to any particular subject and/or application setting. The formulations can be tested in vivo in a number of animal models developed for the study of mucosal and other routes of delivery. As is readily apparent, the compositions of the present invention are useful for preventing and/or treating a wide variety of diseases and infections caused by viruses, bacteria, parasites, and fungi, as well as for eliciting an immune response against a variety of antigens. Not only can the compositions be used prophylactically or therapeutically, as described above, the compositions can also be used in order to prepare antibodies, both polyclonal and monoclonal (e.g., for diagnostic purposes), as well as for immunopurification of an antigen of interest. If polyclonal antibodies are desired, a selected mammal, (e.g., mouse, rabbit, goat, horse, etc.) can be immunized with the compositions of the present invention. The animal is usually boosted 2-6 weeks later with one or more—administrations of the antigen. Polyclonal antisera can then be obtained from the immunized animal and used according to known procedures (See, e.g., Jurgens et al., J. Chrom. 1985, 348:363-370).
In some embodiments, the present invention provides a kit comprising a composition comprising a NE and an immunogen. In some embodiments, the kit further provides a device for administering the composition. The present invention is not limited by the type of device included in the kit. In some embodiments, the device is configured for nasal application of the composition of the present invention (e.g., a nasal applicator (e.g., a syringe) or nasal inhaler or nasal mister). In some embodiments, a kit comprises a composition comprising a NE and an immunogen in a concentrated form (e.g., that can be diluted prior to administration to a subject). In some embodiments, all kit components are present within a single container (e.g., vial or tube). In some embodiments, each kit component is located in a single container (e.g., vial or tube). In some embodiments, one or more kit component are located in a single container (e.g., vial or tube) with other components of the same kit being located in a separate container (e.g., vial or tube). In some embodiments, a kit comprises a buffer. In some embodiments, the kit further comprises instructions for use.
EXAMPLESThe following examples serve to illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.
In the experimental disclosure which follows, the following abbreviations apply: eq (equivalents); μ (micron); M (Molar); μM (micromolar); mM (millimolar); N (Normal); mol (moles); mmol (millimoles); μmol (micromoles); nmol (nanomoles); g (grams); mg (milligrams); μg (micrograms); ng (nanograms); L (liters); ml (milliliters); μl (microliters); cm (centimeters); mm (millimeters); μm (micrometers); nM (nanomolar); ° C. (degrees Centigrade); and PBS (phosphate buffered saline).
Example 1 Methods of Formulating EmulsionsThe emulsion is produced as follows: an oil phase is made by blending organic solvent, oil, and surfactant and then heating the resulting mixture at 37-90° C. for up to one hour. The emulsion is formed either with a reciprocating syringe instrumentation or Silverson high sheer mixer. The water phase is added to the oil phase and mixed for 1-30 minutes, preferably for 5 minutes. For emulsions containing volatile ingredients, the volatile ingredients are added along with the aqueous phase.
In one example, the emulsion was formed as follows: an oil phase was made by blending tri-butyl phosphate, soybean oil, and a surfactant (e.g., TRITON X-100) and then heating the resulting mixture at 86° C. for one hour. An emulsion was then produced by injecting water into the oil phase at a volume/volume ratio of one part oil phase to four parts water. The emulsion can be produced manually, with reciprocating syringe instrumentation, or with batch or continuous flow instrumentation. Methods of producing these emulsions are well known to those of skill in the art and are described in e.g., U.S. Pat. Nos. 5,103,497; and 4,895,452, (herein incorporated by reference in their entireties). Table 4 shows the proportions of each component, the pH, and the size of the emulsion as measured on a Coulter LS 130 laser sizing instrument equipped with a circulating water bath.
| TABLE 4 | ||||
| Chemical | Percentage | Mean | Mean Coulter | |
| Components | of Each | Coulter Size | Range | |
| of Emulsion | Component | pH | (in Microns) | (in Microns) |
| X8P | ||||
| TRITON X-100 | 2% | |||
| Tributyl phosphate | 2% | 5.16 | 1.074 | 0.758-1.428 |
| Oil (ex. Soybean) | 16% | |||
| Water | 80% | |||
| X8P 0.1* | ||||
| TRITON X-100 | 0.20% | 5.37 | 0.944 | 0.625-1.333 |
| Tributyl phosphate | 0.20% | |||
| Oil (ex. Soy bean) | 1.60% | |||
| Water | 98% | |||
*This emulsion was obtained by diluting the X8P emulsion with water in a ratio of 1:9 |
The emulsions utilized in the present invention are highly stable. Indeed, emulsions were produced as described above and allowed to stand overnight at room temperature in sealed, different sizes of polypropylene tubes, beakers or flasks. The emulsions were then monitored for signs of separation. Emulsions that showed no signs of separation were considered “stable.” Stable emulsions were then monitored over 1 year and were found to maintain stability.
Emulsions were again produced as described above and allowed to stand overnight at −20° C. in sealed 50 mL polypropylene tubes. The emulsions were then monitored for signs of separation. Emulsions that showed no signs of separation were considered “stable.” The X8P and X8P 0.1, emulsions have been found to be substantially unchanged after storage at room temperature for at least 24 months.
Example 2 Characterization of an Exemplary Bacteria-Inactivating Emulsion as an Emulsified Liposome Formed in Lipid DropletsA bacteria inactivating emulsion, designated X8W60PC, was formed by mixing a lipid-containing oil-in-water emulsion with X8P. In particular, a lipid-containing oil-in-water emulsion having glycerol monooleate (GMO) as the primary lipid and cetylpyridinium chloride (CPC) as a positive charge producing agent (referred to herein as GMO/CPC lipid emulsion or “W808P”) and X8P were mixed in a 1:1 (volume to volume) ratio. U.S. Pat. No. 5,547,677 (herein incorporated by reference in its entirety) describes the GMO/CPC lipid emulsion and other related lipid emulsions that may be combined with X8P to provide bacteria-inactivating oil-in-water emulsions utilized in the vaccines of the present invention.
Example 3 In Vitro Bactericidal Efficacy Study I—Gram Positive BacteriaIn order to study the bactericidal efficacy of the emulsions utilized in the vaccines of the present invention, the emulsions were mixed with various bacteria for 10 minutes and then plated on standard microbiological media at varying dilutions. Colony counts were then compared to untreated cultures to determine the percent of bacteria killed by the treatment. Table 5 summarizes the results of the experiment.
| TABLE 5 | ||||
| Inoculum | Emulsion | |||
| Organism | (CFU) | % Killing | Tested | |
| Vibrio cholerae classical | 1.3 × 108 | 100 | X8P | |
| Vibrio cholerae Eltor | 5.1 × 108 | 100 | X8P | |
| Vibrio parahemolytica | 4.0 × 107 | 98-100 | X8P | |
In order to study the bactericidal effect of the emulsions on various vegetative forms of Bacillus species, an emulsion at three dilutions was mixed with four Bacillus species for 10 minutes and then plated on microbiological medium. Colony counts were then compared with untreated cultures to determine the percent of bacteria killed by the treatment. Table 6 contains a summary of the bactericidal results from several experiments with the mean percentage kill in parenthesis.
| TABLE 6 | ||||
| X8P/ | ||||
| Dilution | B. cereus | B. circulans | B. megaterium | B. subtilis |
| 1:10 | 99% | 95-99% | 99% | 99% |
| (99%) | (97%) | (99%) | (99%) | |
| 1:100 | 97-99% | 74-93% | 96-97% | 99% |
| (98%) | (84%) | (96%) | (99%) | |
| 1:1000 | 0% | 45-60% | 0-32% | 0-39% |
| (0%) | (52%) | (16%) | (20%) | |
To increase the uptake of the bacteria inactivating emulsions by the cell walls of Gram negative bacteria, thereby enhancing the microbicidal effect of the emulsions on the resistant Gram negative bacteria, EDTA (ethylenediamine-tetraacetic acid) was premixed with the emulsions. The EDTA was used in low concentration (50-25 μM) and the mix was incubated with the various Gram negative bacteria for 15 minutes. The microbicidal effect of the mix was then measured on trypticase soy broth. The results are set forth in Table 7 below. There was over 99% reduction of the bacterial count using X8P in 1/100 dilutions. This reduction of count was not due to the killing effect of EDTA alone as shown from the control group in which 250 μM of EDTA alone could not reduce the bacterial count in 15 minutes.
| TABLE 7 | ||||
| Bacteria + | ||||
| Bacteria | Bacteria + | X8P + | Bacteria + | |
| alone | X8P | EDTA | EDTA | |
| Bacterium | (CFU) | (CFU) | (CFU) | (CFU) |
| S. typhimurium | 1,830,000 | 1,370,000 | 40 | 790,000 |
| S. dysenteriae | 910,000 | 690,000 | 0 | 320,000 |
Bacillus cereus (B. cereus, ATCC #14579) was utilized as a model system for Bacillus anthracis. Experiments with X8P diluted preparations to study the bactericidal effect of the compounds of the present invention on the vegetative form (actively growing) of B. cereus were performed. Treatment in medium for 10 minutes at 37° C. was evaluated. As summarized in Table 8, the X8P emulsion is efficacious against the vegetative form of B. cereus. A 10 minute exposure with this preparation is sufficient for virtually complete killing of vegetative forms of B. cereus at all concentrations tested including dilutions as high as 1:100.
| TABLE 8 | ||||
| Emulsion | Undiluted | 1:10 | 1:100 | |
| X8P | >99% | >99% | 59->99% | |
| Avg = >99% | Avg = >99% | Avg = 82% | ||
Number of experiments = 4 |
The spore form of B. anthracis is one of the most likely organisms to be used as a biological weapon. Spores are well known to be highly resistant to most disinfectants. As describe above, effective killing of spores usually requires the use of toxic and irritating chemicals such as formaldehyde or sodium hypochlorite (i.e., bleach). The same experiment was therefore performed with the spore form of B. cereus. As shown in Table 9, treatment in both medium for 10 minutes at 37° C. was not sufficient to kill B. cereus spores.
| TABLE 9 | ||||
| Emulsion | Undiluted | 1:10 | 1:100 | |
| X8P | 0%-12% | 0% | 0% | |
| Avg = 6% | Avg = 0% | Avg = 0% | ||
Number of experiments = 2 |
To evaluate the efficacy of the nanoemulsion compounds utilized in the vaccines of the present invention on the spore form of B. cereus over a period of time, X8P was incorporated into solid agar medium at 1:100 dilution and the spores spread uniformly on the surface and incubated for 96 hours at 37° C. No growth occurred on solid agar medium wherein X8P had been incorporated, out to 96 hours (i.e., >99% killing, average>99% killing, 3 experiments).
In an attempt to more closely define the time at which killing of spores by X8P occurred, the following experiment was performed. Briefly, a spore preparation was treated with X8P at a dilution of 1:100 and compared to an untreated control. The number of colony forming units per milliliter (CFU/ml) was quantitated after 0.5, 1, 2, 4, 6, and 8 hours. CFU/ml in the untreated control increased over the first 4 hours of incubation and then reached a plateau. Bacterial smears prepared at time zero, 1, 2, 4 and 6 hours, and stained for spore structures, revealed that by 2 hours no spore structures remained (FIGS. 2A-2C). Thus, 100% germination of spores occurred in the untreated control by the 2 hour time point. In the spore preparation treated with X8P, CFU/ml showed no increase over the first 2 hours and then declined rapidly over the time period from 2-4 hours. The decline from baseline CFU/ml over 2-4 hours was approximately 1000-fold. Bacterial smears prepared at the same time points and stained for spore structures revealed that spore structures remained to the end of the experiment at 8 hours. Hence, germination of spores did not occur in the X8P treated culture due to either inhibition of the germination process or because the spores were damaged and unable to germinate. In order to determine whether the emulsions were effective in killing other Bacillus species in addition to B. cereus, a similar experiment was performed as described above, wherein spore preparations were treated with emulsions and compared to an untreated control after four hours of incubation. The following Table 10 shows the results wherein the numbers represent the mean sporicidal activity from several experiments.
| TABLE 10 | ||||
| X8P/ | ||||
| Dilution | B. cereus | B. circulans | B. megaterium | B. subtilis |
| 1:10 | 82% | 61% | 93% | 31% |
| 1:100 | 91% | 80% | 92% | 39% |
| 1:1000 | 47% | 73% | 94% | 22% |
Animal studies were preformed to demonstrate the protective and therapeutic effect of the emulsions in vivo. Bacillus cereus infection in experimental animals has been used previously as a model system for the study of anthrax (Burdon and Wende, 1960; Burdon et al., 1967; Lamanna and Jones, 1963). The disease syndrome induced in animals experimentally infected with B. cereus in some respects similar to anthrax (Drobniewski, 1993; Fritz et al., 1995). The emulsions were mixed with B. cereus spores before injecting into mice.
Irrigation of Skin Wounds
A 1 cm skin wound was infected with 2.5×107 B. cereus spores then closed without any further treatment. The other groups were infected with the same number of spores. One hour later, the wounds were irrigated with either inventive emulsion or saline to simulate post-exposure decontamination. By 48 hours, there were large necrotic areas surrounding the wounds with an average area of 4.86 cm2. In addition, 60% of the animals in this group died as a result of the infection. Histology of these lesions indicated total necrosis of the dermis and subdermis and large numbers of vegetative Bacillus organisms. Irrigation of experimentally infected wounds with saline did not result in any apparent benefit.
Irrigation of wounds infected with B. cereus spores with emulsion showed substantial benefit, resulting in a consistent 98% reduction in the lesion size from 4.86 cm2 to 0.06 cm2. This reduction in lesion size was accompanied by a three-fold reduction in mortality (60% to 20%) when compared to experimental animals receiving either no treatment or saline irrigation. Histology of these lesions showed no evidence of vegetative Bacillus organisms and minimal disruption of the epidermis (Hamouda et al., 1999).
Subcutaneous Injection
CD-1 mice were injected with emulsion diluted 1:10 in saline as a control and did not exhibit signs of distress or inflammatory reaction, either in gross or histological analysis. To test the pathogenic effect of B. cereus spores in vivo and the sporicidal effect of emulsion, a suspension of 4×107 B. cereus spores was mixed with saline or with inventive emulsion at a final dilution of 1:10 and then immediately injected subcutaneously into the back of CD-1 mice.
Mice that were infected subcutaneously with B. cereus spores without emulsion developed severe edema at 6-8 hours. This was followed by a gray, necrotic area surrounding the injection site at 18-24 hours, with severe sloughing of the skin present by 48 hours, leaving a dry, red-colored lesion.
Simultaneous injection of spores and emulsion resulted in a greater than 98% reduction in the size of the necrotic lesion from 1.68 cm2 to 0.02 cm2 when the spores were premixed with inventive emulsion. This was associated with minimal edema or inflammation (Hamouda et al., 1999).
Rabbit Cornea
The cornea of rabbits were irrigated with various concentrations of emulsions and monitored at 24 and 48 hours. No irritations or abnormalities were observed when compositions were used in therapeutic amounts.
Mucous Membrane
Intranasal toxicity was preformed in mice by installation of 25 μL of 4% of the nanoemulsion per nare. No clinical or histopathological changes were observed in these mice.
Nasal toxicity testing in rats was performed by gavaging up to 8 mL per kg of 25% nanoemulsion. The rats did not lose weight or show signs of toxicity either clinically or histopathologically. There were no observed changes in the gut bacterial flora as a result of nasal administration of the emulsions.
In a particular embodiment, Bacillus cereus was passed three times on blood agar (TSA with 5% sheep blood, REMEL). B. cereus was scraped from the third passage plate and resuspended in trypticase soy broth (TSB) (available from BBL). The B. cereus suspension was divided into two tubes. An equal volume of sterile saline was added to one tube and mixed 0.1 ml of the B. cereus suspension/saline was injected subcutaneously into 5 CD-1 mice. An equal volume of X8P (diluted 1:5 in sterile saline) was added to one tube and mixed, giving a final dilution of X8P at 1:10. The B. cereus suspension/X8P was incubated at 37° C. for 10 minutes while being mixed 0.1 ml of the B. cereus suspension/X8P was injected subcutaneously into 5 CD-1 mice. Equal volumes of X8P (diluted 1:5 in sterile saline) and TSB were mixed, giving a final dilution of X8P at 1:10. 0.1 ml of the X8P/TSB was injected subcutaneously into 5 CD-1 mice.
The number of colony forming units (cfu) of B. cereus in the inocula were quantitated as follows: 10-fold serial dilutions of the B. cereus and B. cereus/X8P suspensions were made in distilled H20. Duplicate plates of TSA were inoculated from each dilution (10 μl per plate). The TSA plates were incubated overnight at 37° C. Colony counts were made and the number of cfu/ml was calculated. Necrotic lesions appears to be smaller in mice which were inoculated with B. cereus which was pretreated with X8P. The following Table 11 shows the results of the experiment.
| TABLE 11 | |||
| Observation | |||
| Inoculum | ID#(24 hours) | ||
| B. cereus | 1528 | necrosis at injection | |
| 3.1 × 107 cfu/ | Site | ||
| mouse | 1529 | necrosis at injection site | |
| 1530 | Dead | ||
| 1531 | Dead | ||
| 1532 | necrosis at injection site | ||
| B. cereus | 1348 | necrosis at injection site | |
| 8.0 × 105 cfu/ | 1349 | no reaction | |
| mouse | 1360 | no reaction | |
| (X8P treated) | 1526 | necrosis at injection site | |
| 1527 | necrosis at injection site | ||
| X8P/TSB | 1326 | no reaction | |
| 1400 | no reaction | ||
| 1375 | no reaction | ||
| 1346 | no reaction | ||
| 1347 | no reaction | ||
Bacillus cereus was grown on Nutrient Agar (Difco) with 0.1% Yeast Extract (Difco) and 50 μg/ml MnSO4 for induction of spore formation. The plate was scraped and suspended in sterile 50% ethanol and incubated at room temperature for 2 hours with agitation in order to lyse remaining vegetative bacteria. The suspension was centrifuged at 2,500×g for 20 minutes and the supernatant discarded. The pellet was resuspended in diH2O, centrifuged at 2,500×g for 20 minutes, and the supernatant discarded. The spore suspension was divided. The pellet was resuspended in TSB. 0.1 ml of the B. cereus spore suspension diluted 1:2 with saline was injected subcutaneously into 3 CD-1 mice. Equal volumes of X8P (diluted 1:5 in sterile saline) and B. cereus spore suspension were mixed, giving a final dilution of X8P at 1:10 (preincubation time). 0.1 ml of the X8P/B. cereus spore suspension was injected subcutaneously into 3 CD-1 mice. The number of colony forming units (cfu) of B. cereus in the inoculum was quantitated as follows. 10-fold serial dilutions of the B. cereus and B. cereus/X8P suspensions were made in distilled H2O. Duplicate plates of TSA were inoculated from each dilution (10 μl per plate). The TSA plates were incubated overnight at 37° C. Colony counts were made and the number of cfu/ml was calculated. Necrotic lesions appeared to be smaller in mice that were inoculated with B. cereus spores that were pretreated with X8P. The observations from these studies are shown in Table 12.
| TABLE 12 | |
| Inoculum | Observation (24 hours) |
| B. cereus | 2/3 (66%) mice exhibited necrosis at injection site |
| 6.4 × 106 | |
| spores/mouse | |
| B. cereus | 1/3 (33%) mice exhibited necrosis at injection site |
| 4.8 × 106 | |
| spores/mouse | |
| (X8P treated) | |
| B. cereus | 3/3 (100%) mice exhibited necrosis at injection site |
| 4.8 × 106 | |
| vegetative | |
| forms/mouse | |
| Lysed B. cereus | 3/3 (100%) mice did not exhibit symptoms |
| 4.8 × 106 cfu/ | |
| mouse | |
| X8P/TSB | 1/3 (33%) mice appeared to have some skin necrosis |
Bacillus cereus was grown on Nutrient Agar (Difco) with 0.1% Yeast Extract (Difco) and 50 (g/ml MnSO4 for induction of spore formation). The plate was scraped and suspended in sterile 50% ethanol and incubated at room temperature for 2 hours with agitation in order to lyse remaining vegetative bacteria. The suspension was centrifuged at 2,500×g for 20 minutes and the supernatant discarded. The pellet was resuspended in distilled H2O, centrifuged at 2,500×g for 20 minutes, and the supernatant discarded. The pellet was resuspended in TSB. The B. cereus spore suspension was divided into three tubes. An equal volume of sterile saline was added to one tube and mixed. 0.1 ml of the B. cereus suspension/saline was injected subcutaneously into 10 CD-1 mice. An equal volume of X8P (diluted 1:5 in sterile saline) was added to the second tube and mixed, giving a final dilution of X8P at 1:10. The B. cereus spore suspesion/X8P (1:10) was incubated at 37° C. for 4 hours while being mixed. 0.1 ml of the B. cereus spore suspension/X8P (1:10) was injected subcutaneously into 10 CD-1 mice. An equal volume of X8P (diluted 1:50 in sterile saline) was added to the third tube and mixed, giving a final dilution of X8P at 1:100. The B. cereus spore suspension/X8P (1:100) was incubated at 37° C. for 4 hours while being mixed. 0.1 ml of the B. cereus spore suspension/X8P (1:100) was injected subcutaneously into 10 CD-1 mice. Equal volumes of X8P (diluted 1:5 in sterile saline) and TSB were mixed, giving a final dilution of X8P at 1:10. 0.1 ml of the X8 PFTSB was injected subcutaneously into 10 CD-1 mice. Equal volumes of X8P (diluted 1:50 in sterile saline) and TSB were mixed, giving a final dilution of X8P at 1:100. 0.1 ml of the X8P/TSB was injected subcutaneously into 10 CD-1 mice. The observations from these studies are shown in
| TABLE 13 | ||
| Inoculum sc | ID# | Observation at 24 hours |
| B. cereus | 1 | 2.4 cm2 skin lesion with 0.08 cm2 necrotic area |
| 5.5 × 107 | 2 | no abnormalities observed |
| Spores/mouse | 3 | Moribund with 8 cm2 skin lesion and Hind limb |
| No treatment | paralysis | |
| group | ||
| 4 | 3.52 cm2 skin lesion | |
| 5 | 1.44 cm2 skin lesion | |
| 6 | 3.4 cm2 skin lesion | |
| 7 | 5.5 cm2 skin lesion | |
| 8 | 5.5 cm2 skin lesion | |
| 9 | 3.3 cm2 skin lesion with 0.72 cm2 necrotic area | |
| 10 | 2.64 cm2 skin lesion with two necrotic areas | |
| (0.33 cm2 and 0.1 cm2) |
| Mean lesion size in Spore group alone 3.97 cm2 (1/10 (10%) with no |
| abnormalities observed) |
Note: |
Skin lesions grey in color with edema, necrotic areas red/dry. |
| TABLE 14 | ||
| Inoculum sc | ID # | Observation at 24 hours |
| B. cereus | 41 | no abnormalities observed |
| 2.8 × 107 | 42 | no abnormalities observed |
| spores/mouse | 43 | 1.2 cm2 white skin lesion with grey center, |
| in the | slight edema | |
| X8P 1:10 | 44 | 0.78 cm2 white skin lesion |
| treated group | 45 | 0.13 cm2 white skin lesion |
| 46 | 2.2 cm2 white skin lesion | |
| 47 | 1.8 cm2 white skin lesion with 0.1 cm2 brown | |
| area in center | ||
| 48 | 1 cm2 white skin lesion with grey center | |
| 49 | 0.78 cm2 white skin lesion | |
| 50 | no abnormalities observed | |
| Mean lesion size in X8P 1:10 treatment | ||
| group = 1.13 cm2 | ||
| (3/10 (30%) with no abnormalities observed) | ||
| B. cereus | 51 | 2.1 cm2 grey skin lesion |
| 1.8 × 107 | 52 | 0.72 cm2 grey skin lesion |
| spores/mouse | 53 | 1.5 cm2 grey skin lesion |
| in the | 54 | 1.2 cm2 grey skin lesion |
| X8P 1:100 | 55 | 3.15 cm2 grey skin lesion |
| treated group | 56 | 0.6 cm2 grey skin lesion |
| 57 | 0.5 cm2 grey skin lesion | |
| 58 | 2.25 cm2 grey skin lesion | |
| 59 | 4.8 cm2 grey skin lesion with necrotic area | |
| 1 cm diameter | ||
| 60 | 2.7 cm2 grey skin lesion | |
| Mean lesion size In X8P 1:100 treatment | ||
| group = 1.9 cm2 | ||
| (0/10 (0%) with no abnormalities observed) | ||
| X8P 1:10 alone | 11 | 2.6 cm2 white area |
| 12 | 0.15 cm2 white area | |
| 13 | no abnormalities observed | |
| 14 | 0.15 cm2 white area | |
| 15 | 0.35 cm2 white area | |
| 16 | no abnormalities observed | |
| 17 | 0.12 cm2 white area | |
| 18 | no abnormalities observed | |
| 19 | 0.56 cm2 white area | |
| 20 | 0.3 cm2 white area | |
| Mean lesion size In X8P 1:10 alone group = | ||
| 0.60 cm2 | ||
| (3/10 (30%) with no abnormalities observed) | ||
| X8P 1:100 | 21-30 | no abnormalities observed |
| alone | Mean lesion size in X8P 1:100 alone | |
| group = 0 cm2 | ||
| (10/10 (100%) with no abnormalities observed) | ||
| TSB | 31-40 | no abnormalities observed |
| alone | Mean lesion size In the TSB alone | |
| group = 0 cm2 | ||
| (10/10 (100%) with no abnormalities observed) | ||
Re-isolation of B. cereus was attempted from skin lesions, blood, liver, and spleen (Table 15). Skin lesions were cleansed with betadine followed by 70% sterile isopropyl alcohol. An incision was made at the margin of the lesion and swabbed. The chest was cleansed with betadine followed by 70% sterile isopropyl alcohol. Blood was drawn by cardiac puncture. The abdomen was cleansed with betadine followed by 70% sterile isopropyl alcohol. The skin and abdominal muscles were opened with separate sterile instruments. Samples of liver and spleen were removed using separate sterile instruments. Liver and spleen samples were passed briefly through a flame and cut using sterile instruments. The freshly exposed surface was used for culture. BHI agar (Difco) was inoculated and incubated aerobically at 37° C. overnight.
| TABLE 15 | |||
| B. cereus Re-isolation | |||
| Inoculum sc | ID# | Necrospy | From site of skin lesion |
| B. cereus | 3 | 24 hours | skin lesion >300 cfu |
| 5.5 × 107 | 6 | 48 hours | skin lesion >300 cfu |
| spores/mouse | 7 | 48 hours | skin lesion >300 cfu |
| in the | 8 | 72 hours | skin lesion 100 cfu |
| Untreated group | 9 | 72 hours | skin lesion 25 cfu |
| 10 | 72 hours | skin lesion 100 | |
| 1 | 96 hours | skin lesion >300 cfu | |
| 4 | 96 hours | skin lesion >300 cfu | |
| 5 | 96 hours | skin lesion >300 cfu |
| Mean CFU In Untreated Spore | |
| group = 214* *(6/9 (67%) > 300 CFU) |
| B. cereus | 48 | 48 hours | skin lesion 17 cfu |
| 2.8 × 107 | 50 | 48 hours | skin lesion >300 cfu |
| spores/mouse | 46 | 72 hours | skin lesion >200 cfu |
| in the | 47 | 72 hours | skin lesion 100 cfu |
| X8P 1:10 | 49 | 72 hours | skin lesion >300 cfu |
| treated group | 41 | 96 hours | skin lesion >300 cfu |
| 42* | 96 hours | skin lesion 20 cfu | |
| 43 | cultures not done | ||
| 44 | 96 hours | skin lesion >300 cfu | |
| 45 | cultures not done | ||
| 46 | cultures not done |
| Mean CFU in X8P | |
| 1:10 group = 192* | |
| *(318 (38%) > 300 CFU) |
| B. cereus | 48 | 48 hours | skin lesion 18 cfu |
| 1.8 × 107 | 50* | 48 hours | skin lesion>300 cfu |
| spores/mouse | 52 | 72 hours | skin lesion I cfu |
| in the | 54 | 72 hours | re-isolation negative |
| X8P 1:100 | 56 | 72 hours | skin lesion >300 cfu |
| treated group | 58 | 96 hours | skin lesion 173 cfu |
| 59 | 96 hours | skin lesion 4 cfu | |
| 60 | 96 hours | skin lesion 6 cfu |
| Mean CFU in X8P 1:100 group = 100 | |
| *(2/8 (25%) > 00 CFU) | |
*Although no lesions were present in these mice, organisms were removed from the injection site. |
Pretreatment of both vegetative B. cereus and B. cereus spores reduce their ability to cause disease symptoms when introduced into experimental animals. This is reflected in the smaller size of skin lesions and the generally lower numbers of B. cereus recovered from the lesions. In addition, less frequent re-isolation of B. cereus from blood, liver, and spleen occurs suggesting that septicemia may be preventable.
Example 7 In Vivo Toxicity Study ICD-1 mice were injected subcutaneously with 0.1 ml of nanoemulsion and observed for 4 days for signs of inflammation and/or necrosis. Dilutions of the compounds were made in sterile saline. Tissue samples from mice were preserved in 10% neutral buffered formalin for histopathologic examination. Samples of skin and muscle (from mice which were injected with undiluted compounds) sent for histological review were reported to show indications of tissue necrosis. Tissue samples from mice which were injected with diluted compounds were not histologically examined. Tables 16 and 17 show the results of two individual experiments.
| TABLE 16 | ||||
| Compound | Mouse ID # | Dilution | Observation | |
| X8P | 1326 | Undiluted | necrosis | |
| 1327 | Undiluted | no reaction | ||
| 1328 | 1:10 | no reaction | ||
| 1329 | 1:10 | no reaction | ||
| 1324 | 1:100 | no reaction | ||
| 1331 | 1:100 | no reaction | ||
| Saline | 1344 | no reaction | ||
| 1345 | no reaction | |||
| TABLE 17 | ||||
| Compound | Mouse ID # | Dilution | Observation | |
| X8P | 1376 | Undiluted | necrosis | |
| 1377 | Undiluted | minimal necrosis | ||
| 1378 | 1:10 | no reaction | ||
| 1379 | 1:10 | no reaction | ||
| 1380 | 1:100 | no reaction | ||
| 1381 | 1:100 | no reaction | ||
| Saline | 1394 | no reaction | ||
| 1395 | no reaction | |||
Guinea pigs were injected intramuscularly (in both hind legs) with 1.0 ml of compounds of the present invention per site and observed for 4 days for signs of inflammation and/or necrosis. Dilutions of the compounds were made in sterile saline.
Tissue samples from guinea pigs were preserved in 10% neutral buffered formalin for histological examination. Tissue samples were not histologically examined.
| TABLE 18 | ||||
| Compound | Guinea Pig | Dilution | Observation | |
| X8P | 1023-1 | undiluted | no reaction | |
| 1023-2 | 1:10 | no reaction | ||
| 1023-3 | 1:100 | no reaction | ||
| Saline | 1023-10 | no reaction | ||
The results of In Vivo Toxicity Study I show that subcutaneous and intramuscular injection of the compounds tested did not result in grossly observable tissue damage and did not appear to cause distress in the experimental animals (Table 18).
Example 8 In Vivo Toxicity Study IIOne group of Sprague-Dawley rats each consisting of five males and five females were placed in individual cages and acclimated for five days before dosing. Rats were dosed daily for 14 days. On day 0-13, for 14 consecutive days each rat in Group 1 received by gavage three milliliters of X8P, 1:100 concentration, respectively. The three-milliliter volume was determined to be the maximum allowable nasal dose for rats. Prior to dosing on Day 0 and Day 7, each rat was weighed. Thereafter rats were weighed weekly for the duration of the study. Animals were observed daily for sickness or mortality. Animals were allowed to rest for 14 days. On day 28 the rats were weighed and euthanized. The mean weight results of the nasal toxicity study are shown in Table 19. Mean weights for males and females on days 0, 7, and 14, 21 and 28 and the mean weight gains from day 0-day 28, are also shown in Table 18. One rat died due to mechanical trauma from manipulation of the gavage tubing during dosing on day 14. All surviving rats gained weight over the 28 day course of the study and there was no illness reported. Thus, although tributyl phosphate alone is known to be toxic and irritating to mucous membranes, when incorporated into the emulsions utilized in the vaccines of the present invention, these characteristics are not in evidence. The X8P emulsion, 1:100 concentration, was also tested for dermal toxicity in rabbits according to the protocols provided in 16 CFR § 1500.3. The emulsion was not irritating to skin in the animals tested.
| TABLE 19 | ||||||||
| Weight | ||||||||
| Dose | Body | Body | Body | Body | Body | Gain | ||
| Rat | Volume | Weight | Weight | Weight (g) | Weight (g) | Weight (g) | (g) Day 0 | |
| Number | Sex | mL | (g) Day 0 | (g) Day 7 | Day 14 | Day 21 | Day 28 | Day 28 |
| 9028 | m | 3 | 332.01 | 356.52 | 388.66 | 429.9 | 394.07 | 62.06 |
| 9029 | m | 3 | 278.62 | 294.65 | 296.23 | 310.7 | 392.6 | 113.98 |
| 9030 | m | 3 | 329.02 | 360.67 | 325.26 | 403.43 | 443.16 | 114.14 |
| 9031 | m | 3 | 334.64 | 297.04 | 338.82 | 357.5 | 416.89 | 82.25 |
| 9032 | m | 3 | 339.03 | 394.39 | 347.9 | 331.38 | 357.53 | 18.5 |
| MEAN | 266.26 | 340.65 | 339.37 | 400.85 | 78.18 | |||
| WTS | ||||||||
| 9063 | F | 3 | 302 | 298.08 | 388.66 | 338.41 | 347.98 | 45.98 |
| 9064 | F | 3 | 254.54 | 247.97 | 256.78 | 278.17 | 279.2 | 24.66 |
| 9065 | F | 3 | 225.99 | 253.81 | 273.38 | 290.54 | 308.68 | 82.69 |
| 9066 | F | 3 | 246.56 | 260.38 | 266.21 | 235.12 | 272.6 | 26.04 |
| 9067 | F | 3 | 279.39 | 250.97 | deceased | |||
| MEAN | 261.69 | 262.24 | 296.25 | 285.56 | 302.11 | 53 | ||
| WTS | ||||||||
Experiments with X8W60PC preparations to study the bactericidal effect of the compounds of the present invention on the spore form of B. anthracis were performed. The sporicidal activity of different dilutions of X8W60PC (in water) on six different strains of B. anthracis was tested. X8W60PC killed over 98% of seven different strains of anthrax (Del Rio, Tex.; Bison, Canada; South Africa (2 strains); Mozambique; S. Dakota; and Ames, USAMRID) within 4 hours and is as efficient as 1-10% bleach. Similar sporicidal activity is found with different dilutions of X8W60PC in media (1:10, 1:100, 1:1000, and 1:5000). X8W60PC can kill anthrax spores in as little as 30 minutes.
Example 10 Mechanisms of ActionThe following example provides an insight into the proposed mechanisms of action of several nanoemulsions. This example also demonstrates the sporicidal activity of several nanoemulsions utilized in the vaccines of the present invention. This mechanism is not intended to limit the scope of the invention. An understanding of the mechanism is not necessary to practice the present invention, and the present invention is not limited to any particular mechanism. The effect of a GMO/CPC lipid emulsion (“W808P”) and X8P on E. coli was examined. W808P killed the E. coli (in deionized H2O) but X8P was ineffective against this organism. X8P treated E. coli look normal, with defined structure and intact lipid membranes. W808P treated E. coli have vacuoles inside and the contents have swollen so that the defined structure of the organism is lost. Without being bound to a particular theory (an understanding of the mechanism is not necessary to practice the present invention, and the present invention is not limited to any particular mechanism), this observation suggests that W808P kills the bacteria without lysing them and instead causes a change in the internal structure, evident by the vacuolization and swelling. A second study was performed with Vibrio cholerae. Despite Vibrio cholerae being closely related to E. coli, X8P, W808P and X8W60PC all killed this organism. Compared to the control, the W808P treated Vibrio cholerae again shows swelling and changes in the interior of the organism, but the cells remain intact. In contrast, the X8P treated Vibrio cholerae are completely lysed with only cellular debris remaining. X8W60PC showed a combination of effects, where some of the organisms are swelled but intact and some are lysed. This clearly suggests that X8P, W808P and X8W60PC work by different mechanisms.
A third comparative study was performed to evaluate efficacy of the emulsions at various concentrations. As shown in Table 20, X8W60PC is more effective as a biocide at lower concentrations (higher dilutions) in bacteria sensitive to either W808P or X8P. In addition, six other bacteria that are resistant to W808P and X8P are all susceptible to X8W60PC. This difference in activity is also seen when comparing W808P and X8P and X8W60PC in influenza infectivity assays. Both X8P and X8W60PC are effective at a 1:10 and 1:100 dilutions and additionally, X8W60PC is effective at the lowest concentration, 1:1,000 dilution. In contrast, W808P has little activity even at 1:10 dilution, suggesting that it is not an effective treatment for this enveloped organism. In addition, X8W60PC kills yeast species that are not killed by either W808P or X8P.
| TABLE 20 |
| Lowest Nanoemulsion Concentration Required to Achieve |
| Over 90% Killing of Selected Microorganisms |
| Bacteria | W808P | X8P | X8W60PC |
| Streptococcus pyogenes | No killing | 10% | 0.1% |
| Streptococcus aglactiae | 1%* | 1% | ND |
| Streptococcus pneumonia | 10%* | 1% | 0.1% |
| Staphylococcus aureus | No killing | No killing | 0.1% |
| Neisseria gonorrhoeae | ND | 1% | 0.1% |
| Haemophilus influenzae | 10% | 1% | 0.1% |
| Vibrio cholerae | 1% | 0.1% | 0.1% |
| E. coli | No killing # | No killing | 0.1% |
| Salmonella typhimurium | No killing # | No killing | 10% |
| Shigella dysenteriae | No killing # | No killing | 0.1% |
| Proteus mirabilis | No killing # | No killing | 1% |
| Pseudomonas aeruginosa | No killing | No killing | 10% |
| Bacillus anthracis spores | No killing @ 4 H | 0.1% @ 4 H | 0.1%-0.02% @ 4 H |
| Bacillus cereus spores | 10% @ 4 H | 1% @ 4 H | 0.1% @ 4 H |
| Bacillus subtilis spores | No killing @ 24 H | No killing @ 24 H | 0.1% @ 4 H |
| Yersinia enterocolitica | ND | ND | 0.1% |
| Yersinia pseudotuberculosis | ND | ND | 0.1% |
| Fungi | |||
| Candida albicans | No Killing | No Killing | 1% |
| (ATCC 90028) | |||
| Candida tropicalis | No Killing | No Killing | 1% |
| Viruses | |||
| Influenza A H2N2 | No Killing | 1% | 0.1% |
| Influenza B/Hong Kong/ | ND | 1% | ND |
| 5/72 | |||
| Vaccinia | ND | 1% | % |
| Herpes simplex type I | ND | 1% | 0.1% |
| Sendai | ND | 1% | ND |
| Sindbis | ND | 1% | ND |
| Adenovirus | ND | No Killing | ND |
*Data for lower concentrations not available. |
|||
# No killing except in deionized water. |
|||
10 ND = Not determined. |
The present Example provides the results of additional investigations of the ability of nanoemulsions to inactivate different Bacillus spores. The methods and results of these studies are outlined below.
Surfactant lipid preparations: X8P, a water-in-oil nanoemulsion, in which the oil phase was made from soybean oil, tri-n-butyl phosphate, and TRITON X-100 in 80% water. X8W60PC was prepared by mixing equal volumes of X8P with W808P which is a liposome-like compound made of glycerol monostearate, refined Soya sterols, TWEEN 60, soybean oil, a cationic ion halogen-containing CPC and peppermint oil.
Spore preparation: For induction of spore formation, Bacillus cereus (ATTC 14579), B. circulans (ATC 4513), B. megaterium (ATCC 14581), and B. subtilis (ATCC 11774) were grown for a week at 37° C. on NAYEMn agar (Nutrient Agar with 0.1% Yeast Extract and 5 mg/l MnS04). The plates were scraped and the bacteria/spores suspended in sterile 50% ethanol and incubated at room temperature (27° C.) for 2 hours with agitation in order to lyse the remaining vegetative bacteria. The suspension was centrifuged at 2,500×g for 20 minutes and the pellet washed twice in cold diH2O. The spore pellet was resuspended in trypticase soy broth (TSB) and used immediately for experiments. B. anthracis spores, Ames and Vollum 1 B strains, were kindly supplied by Dr. Bruce Ivins (USAMRIID, Fort Detrick, Frederick, Md.), and prepared as previously described (Ivins et al., Vaccine 13:1779 (1995)). Four other strains of anthrax were kindly provided by Dr. Martin Hugh-Jones (LSU, Baton Rouge, La.). These strains represent isolates with high allelic dissimilarity from South Africa; Mozambique; Bison, Canada; and Del Rio, Tex.
In vitro sporicidal assays: For assessment of sporicidal activity of solid medium, trypticase Soy Agar (TSA) was autoclaved and cooled to 55° C. The X8P was added to the TSA at a 1:100 final dilution and continuously stirred while the plates were poured. The spore preparations were serially diluted (ten-fold) and 10 μl aliquots were plated in duplicate (highest inoculum was 105 spores per plate). Plates were incubated for 48 hours aerobically at 37° C. and evaluated for growth.
For assessment of sporicidal activity in liquid medium, spores were resuspended in TSB. 1 ml of spore suspension containing 2×106 spores (final concentration 106 spores/ml) was mixed with 1 ml of X8P or X8W60PC (at 2× final concentration in diH2O) in a test tube. The tubes were incubated in a tube rotator at 37° C. for four hours. After treatment, the suspensions were diluted 10-fold in diH2O. Duplicate aliquots (25 μl) from each dilution were streaked on TSA, incubated overnight at 37° C., and then colonies were counted. Sporicidal activity expressed as a percentage killing was calculated: cfu ( initial ) - cfu ( post - treatment ) cfu ( initial ) × 100.
The experiments were repeated at least 3 times and the mean of the percentage killing was calculated.
Electron microscopy: B. cereus spores were treated with X8P at a 1:100 final dilution in TSB using Erlenmeyer flasks in a 37° C. shaker incubator. Fifty ml samples were taken at intervals and centrifuged at 2,500×g for 20 minutes and the supernatant discarded. The pellet was fixed in 4% glutaraldehyde in 0.1 M cacodylate (pH 7.3). Spore pellets were processed for transmission electron microscopy and thin sections examined after staining with uranyl acetate and lead citrate.
Germination inhibitors/simulators: B. cereus spores (at a final concentration 106 spores/ml) were suspended in TSB with either the germination inhibitor D-alanine (at final concentration of 1 μM) or with the germination stimulator L-alanine+inosine (at final concentration of 50 μM each) (Titball and Manchee, J. Appl Bacteriol. 62:269 (1987); Shibata et al., Jpn J Microbiol. 20:529 (1976)) and then immediately mixed with X8P (at a final dilution of 1:100) and incubated for variable intervals. The mixtures were then serially diluted, plated and incubated overnight. The next day the plates were counted and percentage sporicidal activity was calculated.
In vivo sporicidal activity: Two animal models were developed; in the first B. cereus spores (suspended in sterile saline) were mixed with an equal volume of X8P at a final dilution of 1:10. As a control, the same B. cereus spore suspension was mixed with an equal volume of sterile saline. 100 μl of the suspensions containing 4×107 spores was then immediately injected subcutaneously into CD-1 mice.
In the second model, a simulated wound was created by making an incision in the skin of the back of the mice. The skin was separated from the underlying muscle by blunt dissection. The “pocket” was inoculated with 200 μl containing 2.5×107 spores (in saline) and closed using wound clips. One hour later, the clips were removed and the wound irrigated with either 2 ml of sterile saline or with 2 ml of X8P (1:10 in sterile saline). The wounds were then closed using wound clips. The animals were observed for clinical signs. Gross and histopathology were performed when the animals were euthanized 5 days later. The wound size was calculated by the following formula: ½a×½b×π where a and b are two perpendicular diameters of the wound.
In vitro sporicidal activity: To assess the sporicidal activity of X8P, spores from four species of Bacillus genus, B. cereus, B. circulans, B. megatetium, and B. subtilis were tested. X8P at 1:100 dilution showed over 91% sporicidal activity against B. cereus and B. megaterium in 4 hours. B. circulans was less sensitive to X8P showing 80% reduction in spore count, while B. subtilis appeared resistant to X8P in 4 hours. A comparison of the sporicidal effect of X8P (at dilutions of 1:10 and 1:100) on B. cereus spores was made with a 1:100 dilution of bleach (i.e., 0.0525% sodium hypochlorite), and no significant difference was apparent in either the rate or extent of sporicidal effect. The other nanoemulsion, X8W60PC, was more efficient in killing the Bacillus spores. At 1:1000 dilution, it showed 98% killing of B. cereus spores in 4 hours (compared to 47% with 1:1000 dilution of X8P). X8W60PC at a 1:1000 dilution resulted in 97.6% killing of B. subtilis spores in 4 hours, in contrast to its resistance to X8P.
B. cereus sporicidal time course: A time course was performed to analyze the sporicidal activity of X8P diluted 1:100 and X8W60PC diluted 1:1000 against B. cereus over an eight hour period. Incubation of X8P diluted 1:100 with B. cereus spores resulted in a 77% reduction in the number of viable spores in one hour and a 95% reduction after 4 hours. Again, X8W60PC diluted 1:1000 was more effective than X8P 1:100 and resulted in about 95% reduction in count after 30 minutes.
X8P B. anthracis sporicidal activity: Following initial in vitro experiments, X8P sporicidal activity was tested against two virulent strains of B. anthracis (Ames and Vollum 1B). It was found that X8P at a 1:100 final dilution incorporated into growth medium completely inhibited the growth of 1×105 B. anthracis spores. Also, 4 hours incubation with X8P at dilutions up to 1:1000 with either the Ames or the Vollum 1 B spores resulted in over 91% sporicidal activity when the mixtures were incubated at RT, and over 96% sporicidal activity when the mixtures were incubated at 37° C. (Table 21).
Table 21: X8P sporicidal activity against 2 different strains of Bacillus anthracis spores as determined by colony reduction assay (% killing). X8P at dilutions up to 1:1000 effectively killed >91% of both spore strains in 4 hours at either 27 or 37° C.; conditions that differed markedly in the extent of spore germination. Sporicidal activity was consistent at spore concentrations up to 1×106/ml.
| TABLE 21 | |||
| Ames | Ames (cont) | Vollum 1 B |
| B. anthracis | Room Temp. | 37° C. | Room Temp. | 37° C. |
| X8P 1:10 | 91% | 96% | 97% | 99% |
| X8P 1:100 | 93% | 97% | 97% | 98% |
| X8P 1:1000 | 93% | 97% | 98% | 99% |
X8W60PC B. anthracis sporicidal activity: Since X8W60PC was effective at higher dilutions and against more species of Bacillus spores than X8P, it was tested against 4 different strains of B. anthracis at dilutions up to 1:10,000 at RT to prevent germination. X8W60PC showed peak killing between 86% and 99.9% at 1:1000 dilution (Table 22).
Table 22: X8W60PC sporicidal activity against 4 different strains of B. anthracis representing different clinical isolates. The spores were treated with X8W60PC at different dilutions in RT to reduce germination. There was no significant killing at low dilutions. The maximum sporicidal effect was observed at 1:1000 dilution.
| TABLE 22 | ||||
| South | Bison, | Del Rio, | ||
| B. anthracis | Africa | Canada | Mozambigue | Texas |
| X8W60PC 1:10 | 81.8 | 85.9 | 41.9 | 38 |
| X8W60PC 1:100 | 84 | 88.9 | 96.5 | 91.3 |
| X8W60PC 1:1000 | 98.4 | 91.1 | 99.9 | 86 |
| X8W60PC 1:5,000 | 79.7 | 41.3 | 95.7 | 97.1 |
| X8W60PC 1:10,000 | 52.4 | 80 | ND | ND |
Electron microscopy examination of the spores: Investigations were carried out using B. cereus because it is the most closely related to B. anthracis. Transmission electron microscopy examination of the B. cereus spores treated with X8P diluted 1:100 in TSB for four hours revealed physical damage to the B. cereus spores, including extensive disruption of the spore coat and cortex with distortion and loss of density in the core.
Germination stimulation and inhibition: To investigate the effect of initiation of germination on the sporicidal effect of X8P on Bacillus spores, the germination inhibitors D-alanine (Titball and Manchee, 1987, supra), and germination simulators L-alanine and inosine (Shibata et al., 1976, supra) were incubated with the spores and X8P for 1 hour. The sporicidal effect of X8P was delayed in the presence of 10 mM D-alanine and accelerated in the presence of 50 μM L-alanine and 50 μM inosine.
In vivo sporicidal activity: Bacillus cereus infection in experimental animals had been previously used as a model system for the study of anthrax and causes an illness similar to experimental anthrax infection (Welkos et al., Infect Immun. 51:795 (1986); Drobniewski, Clin Microbiol Rev. 6:324 (1993); Burdon et al., J Infect Dis. 117:307 (1967); Fritz et al. Lab Invest. 73:691 (1995); Welkos and Friedlander, Microb Pathog 5:127 (1988)). Two animal models of cutaneous B. cereus disease were developed to assess the in vivo efficacy of X8P. Because these models involve subcutaneous administration of the nanoemulsion, in vivo toxicity testing of X8P was performed prior to this application. CD-1 mice injected with X8P diluted 1:10 in saline as a control did not exhibit signs of distress or inflammatory reaction, either in gross or histological analysis. To test the pathogenic effect of B. cereus spores in vivo and the sporicidal effect of X8P, a suspension of 4×107 B. cereus spores was mixed with saline or with X8P at a final dilution of 1:10 and then immediately injected subcutaneously into the backs of CD-1 mice. Mice which were infected subcutaneously with B. cereus spores without X8P developed severe edema at 6-8 hours. This was followed by a gray, necrotic area surrounding the injection site at 18-24 hours, with severe sloughing of the skin present by 48 hours, leaving a dry, red-colored lesion. Simultaneous injection of spores and X8P resulted in a greater than 98% reduction in the size of the necrotic lesion from 1.68 cm2 to 0.02 cm2 when the spores were premixed with X8P. This was associated with minimal edema or inflammation.
In additional studies, a 1 cm skin wound was infected with 2.5×107 B. cereus spores then closed without any further treatment. The other groups were infected with the same number of spores, then 1 hour later the wounds were irrigated with either X8P or saline to simulate post-exposure decontamination. Irrigation of experimentally infected wounds with saline did not result in any apparent benefit. X8P irrigation of wounds infected with B. cereus spores showed substantial benefit, resulting in a consistent 98% reduction in the lesion size from 4.86 cm2 to 0.06 cm2. This reduction in lesion size was accompanied by a four-fold reduction in mortality (80% to 20%) when compared to experimental animals receiving either no treatment or saline irrigation.
Example 12 Effect of Surfactant Lipid Preparations (SLPS) on Influenza A Virus Infectivity in VitroThe following example describes the effect of emulsions on Influenza A virus infectivity Enveloped viruses are of great concern as pathogens. They spread rapidly and are capable of surviving out of a host for extended periods. Influenza A virus was chosen because it is a well accepted model to test anti-viral agents (Karaivanova and Spiro, Biochem J. 329(Pt 3):511 (1998); Mammen et al., J Med Chem 38:4179 (1995)). Influenza is a clinically important respiratory pathogen that is highly contagious and responsible for severe pandemic disease.
The envelope glycoproteins, hemagglutinin (HA) and neuraminidase (NA) not only determine the antigenic specificity of influenza subtypes, but they mutate readily and, as a result, may allow the virus to evade host defense systems. This may result in the initiation of disease in individuals that are immune to closely related strains. The following is a description of the methods and composition used for determining the efficacy of SLPs in preventing influenza A infectivity.
Surfactant lipid preparations (SLPs): The SLPs were made in a two-step procedure. An oil phase was prepared by blending soybean oil with reagents listed in Table 1 and heating at 86° C. for one hour (Florence, 1993). The SLPs were then formed by injecting water or 1% bismuth in water (SS) into the oil phase at a volume/volume ratio using a reciprocating syringe pump.
Viruses: Influenza virus A/AA/6/60 was kindly provided by Dr. Hunein F. Maassab (School of Public Health, University of Michigan). Influenza A virus was propagated in the allantoic cavities of fertilized pathogen-free hen eggs (SPAFAS, Norwich, Conn.) using standard methods (Barrett and Inglis, 1985). Virus stock was kept in aliquots (108 pfu/ml) of infectious allantoic fluids at −80° C. Adenoviral vector (AD.RSV ntlacZ) was provided by Vector Core Facility (University of Michigan Medical Center, Ann Arbor, Mich.) and was kept in aliquots (1012 pfu/ml at −80° C.). The vector is based on a human adenoviral (serotype 5) genomic backbone deleted of the nucleotide sequence spanning E1A and E1B and a portion of E3 region. This impairs the ability of the virus to replicate or transform nonpermissive cells. It carries the E. coli LacZ gene, encoding β-galactosidase under control of the promoter from the Rouse sarcoma virus long terminal repeat (RSV-LTR). The vector also contains a nuclear targeting (designated as nt) epitope linked to the 5′ end of the LacZ gene to facilitate the detection of protein expression (Baragi et al., 1995).
Cells: Madin Darby Canine Kidney (MDCK) cells were purchased from the American Type Culture Collection (ATCC; Rockville, Md.) and 293 cells (CRL 1573; transformed primary embryonic human kidney) were obtained from the Vector Core Facility (University of Michigan Medical Center, Ann Arbor, Mich.). The 293 cells express the transforming gene of adenovirus 5 and therefore restore the ability of Ad.RSV ntlacZ vector to replicate in the host cell.
Cell maintenance media: MDCK cells were maintained in Eagle's minimal essential medium with Earle's salts, 2 mM L-glutamine, and 1.5 g/l sodium bicarbonate (Mediatech, Inc., Hemdon, Va.) containing 10% fetal bovine serum (FBS; Hyclone Laboratories, Logan, Utah). The medium was supplemented with 0.1 mM non-essential amino acids, 1.0 mM sodium pyruvate, 100 U penicillin/ml and streptomycin 100 μg/ml (Life Technologies, Gaithersburg, Md.). The 293 cells were maintained in Dulbecco's modified Eagle medium (Mediatech, Inc., Herndon, Va.), containing 2 mM L-glutamine, 0.1 mM non-essential amino acids, and 1.0 mM sodium pyruvate. It also contained 100 U penicillin/ml and streptomycin 100 μg/ml (Life Technologies, Gaithersburg, Md.) and was supplemented with 10% FBS (Hyclone Laboratories, Logan, Utah).
Virus infection media: Influenza A infection medium was the MDCK cell maintenance medium (without FBS) supplemented with 3.0 μg/ml of tolylsulfonyl phenylalanyl chloromethyl ketone (TPCK)-treated trypsin (Worthington Biochemical Corporation, Lakewood, N.J.). Adenovirus infection medium was 293T cell maintenance medium with a reduced concentration of serum (2% FBS).
Influenza A overlay medium: Overlay medium consisted of equal amounts of 2× infection medium and 1.6% SEAKEM ME agarose (FMC BioProducts, Rockland, Md.). Staining agarose overlay medium consisted of agarose overlay medium plus 0.01% neutral red solution (Life Technologies, Gaithersburg, Md.) without TPCK-treated trypsin.
Plaque reduction assays (PRA): The plaque reduction assay was performed with a modification of the method described elsewhere (Hayden et al., 1980). MDCK cells were seeded at 1×105 cells/well in 12-well FALCON plates and incubated at 37° C./5% CO2 for 3 days. Approximately 1×108 pfu of influenza A virus was incubated with surfactant lipid preparations as described below. The influenza A virus-SLP treatments and controls were diluted in infection medium to contain 30-100 pfu/250 μl. Confluent cell monolayers were inoculated in triplicate on 3 plates and incubated at 37° C./5% CO2 for 1 h. The inoculum/medium was aspirated and 1 ml of agarose overlay medium/well was added and plates were incubated at 37° C./5% CO2 until plaques appeared. Monolayers were stained with the agarose overlay medium and incubation was continued at 37° C./5% CO2. Plaques were counted 6-12 h after staining. The average plaque count from 9 wells with lipid preparation concentration was compared with the average plaque count of untreated virus wells.
In situ cellular enzyme-linked immunosorbent assay (ELISA): To detect and quantitate viral proteins in MDCK cells infected with influenza A virus, the in situ cellular ELISA was optimized. Briefly, 2×104 MDCK cells in 100 μl complete medium were added to flat-bottom 96-well microtiter plates and incubated overnight. On the next day, the culture medium was removed and cells were washed with serum free maintenance medium. One hundred μl of viral inoculum was added to the wells and incubated for 1 hour. The viral inoculum was removed and replaced with 100 μl of MDCK cell maintained medium plus 2% FBS. The infected MDCK cells were incubated for an additional 24 h. Then the cells were washed once with PBS and fixed with ice cold ethanol:acetone mixture (1:1) and stored at −20° C. On the day of the assay, the wells of fixed cells were washed with PBS and blocked with 1% dry milk in PBS for 30 min. at 37° C. One hundred μl of ferret anti-influenza A virus polyclonal antibody at 1:1000 dilution (kindly provided by Dr. Hunein F. Maassab, School of Public Health, University of Michigan) was added to the wells for 1 hr at 37° C. The cells were washed 4 times with washing buffer (PBS and 0.05% TWEEN-20), and incubated with 100 μl at 1:1000 dilution of goat anti-ferret peroxidase conjugated antibody (Kirkegaard & Perry Laboratories, Gaithersburg, Mass.) for 30 min. at 37° C. Cells were washed 4 times and incubated with 100 μl of 1-STEP TURBO TMB-ELISA substrate (Pierce, Rockford, Ill.) until color had developed. The reaction was stopped with 1 N sulfuric acid and plates were read at a wavelength of 450 nm in an ELISA microtiter reader.
β-galactosidase assay: β-galactosidase assay was performed on cell extracts as described elsewhere (Lim, 1989). Briefly, 293 cells were seeded on 96-well “U”-bottom tissue culture plates at approximately 4×104 cells/well and incubated overnight at 37° C./5% CO2 in maintenance medium. The next day, the medium was removed and the cells were washed with 100 μl Dulbecco's phosphate buffered saline (DPBS). Adenovirus stock was diluted in infection medium to a concentration of 5×107 pfu/ml and mixed with different concentrations of X8P as described below. After treatment with X8P, virus was diluted with infection medium to a concentration of 1×104 pfu/ml and overlaid on 293 cells. Cells were incubated at 37° C./5% CO2 for 5 days, after which the plates were centrifuged, the medium was removed and the cells were washed three times with PBS without Ca++ and Mg++. After the third wash, the PBS was aspirated and 100 μl of 1× Reporter Lysis Buffer (Promega, Madison, Wis.) was placed in each well. To enhance cell lysis, plates were frozen and thawed three times and the β-galactosidase assay was performed following the instruction provided by the vendor of β-galactosidase (Promega, Madison, Wis.) with some modifications. Five microliters of cell extract was transferred to a 96-well flat bottom plate and mixed with 45 of μl of 1× Reporter Lysis Buffer (1:10). Subsequently 50 of 2× assay buffer (120 mM Na2HPO4, 80 mM NaH2PO4, 2 mM MgCl2, 100 mM β-mercaptoethanol, 1.33 mg/ml ONPG (Sigma, St. Louis, Mo.) were added and mixed with the cell extract. The plates were incubated at RT until a faint yellow color developed. At that time the reaction was stopped by adding 100 μl of 1 M sodium bicarbonate. Plates were read at a wavelength of 420 nm in an ELISA microplate reader. The units of β-galactosidase in each cell extract was calculated by regression analysis by reference to the levels in the standard and divided by milligrams of protein in the cell extract sample.
Cellular toxicity and virus treatment with lipid preparations: Prior to viral susceptibility testing, cytotoxicity of SLPs on MDCK and 293 cells was assessed by microscope inspection and MTT assay. The dilutions of the mixture of virus and SLPs applied in susceptibility testing were made to be at least one order of magnitude higher than the safe concentration of SLP assessed. Approximately 1×108 pfu of either influenza A or adenovirus were incubated with lipid preparation at final concentrations of 1:10, 1:100, and 1:1000 for different time periods as indicated in results on a shaker. After incubation, serial dilutions of the SLP/virus mixture were made in proper infection media and overlaid on MDCK (influenza A) or 293 (adenovirus) cells to perform PRA, cellular ELISA or β-galactosidase assays as described above.
Electron microscopy: Influenza A virus was semi-purified from allantoic fluid by passing through a 30% sucrose cushion prepared with GTNE (glycine 200 mM, Tris-HCl 10 mM (pH 8.8), NaCl 100 mM, and EDTA 1 mM) using ultra centrifugation (Beckman rotor SW 28 Ti, at 20,000 rpm for 16 hours). Pelleted virus was reconstituted in GTNE. Ten microliters of respective samples (adenovirus, influenza virus, adenovirus+X8P, influenza virus+X8P) were incubated for 15 and 60 min, then placed on parlodian coated 200 mesh copper grids for 2 min. Five μl of 2% cacodylated-buffered glutaraldehyde was then added. The fluid was removed with filter paper after 3 min. Ten microliters of 7% uranyl acetate was added to the grid and drawn off with filter paper after 30 sec. The grids were allowed to dry 10 min and examined on a Philips EM400T transmission electron microscope. Micrographs were recorded in Fuji FG film at magnifications of 200,000×.
Susceptibility testing of influenza A to SLPS: The effect of four surfactant lipid preparations (X8P, NN, W808P, and SS) on influenza A infection of MDCK cells was investigated. All tested preparations inhibited influenza A virus infection to varying degrees. X8P and SS exhibited over 95% inhibition of influenza A infection at a 1:10 dilution. NN and W808P showed only an intermediate effect on influenza A virus, reducing infection by approximately 40%. X8P's virucidal effect was undiminished even at a 1:100 dilution. SS showed less effect at a 1:100 dilution inhibiting influenza A infection by 55%. These two lipid preparations at 1:1000 dilution displayed only weak inhibitory effect on virus infectivity at the range of 22-29%.
Since X8P and SS both showed strong inhibitory effect on virus infectivity, PRA was used to verify data obtained from cellular ELISA. PRA confirmed the efficacy of X8P and SS. X8P reduced the number of plaques from an average of 50.88 to 0 at a 1:10 dilution (Table 23). At dilution 1:100, X8P maintained virucidal effectiveness. At dilution 1:100 SS reduced the number of plaques only approximately 7% as compared with untreated virus.
| TABLE 23 | |||
| Plaque forming | Plaque forming | ||
| Treatment | units | units | |
| Dilution of the agent: | X8P | SS | |
| 1:10a | 0.00b (+/−0.00)c | 0.00 (+/−0.00) | |
| 1:100 | 0.00 (+/−0.00) | 1.55 (+1-0.12) | |
| Untreated virus | 50.88 (+/−1-0.25) | 23.52 (+/−0.18) | |
aVirus was incubated with SLPs for 30 minutes. |
|||
bNumber of plaques. |
Kinetics of X8P action on influenza A virus: To investigate the time requirement for X8P to act on influenza A infectivity, virus was incubated with X8P at two dilutions (1:10, 1:100) and four different time intervals (5, 10, 15, 30 min). Subsequently, a plaque reduction assay was performed. As shown in Table 24, after five min of incubation with X8P at either dilution, influenza A virus infectivity of MDCK cells was completely abolished. There was no significant difference between the interaction of X8P with influenza A virus regardless of concentration or time.
| TABLE 24 |
| Plaque Forming Units after |
| X8P Treatment/Dilution |
| Time | ||||
| (min) | 1:10 | 1:100 | untreated | |
| 5 | 0.00a | 0.00 | 35.25 | |
| (+/−0.00)b | (+/−0.00) | (+/−0.94) | ||
| 10 | 0.00 | 0.25 | 39.25 | |
| (+/−0.00) | (+/−0.12) | (+/−1.95) | ||
| 15 | 0.00 | 0.25 | 31.50 | |
| (+/−0.00) | (+/−0.12) | (+/−1.05) | ||
| 30 | 0.00 | 0.00 | 26.50 | |
| (+/−0.00) | (+/−0.00) | (+/−0.08) | ||
Anti-influenza A efficacy of X8P: Since TRITON X-100 detergent has anti-viral activity (Maha and Igarashi, Southeast Asian J Trop Med Public Health 28:718 (1997)), it was investigated whether TRITON X-100 alone or combined with individual X8P components inhibits influenza A infectivity to the same extent as X8P. Influenza A virus was treated with: 1) X8P, 2) the combination of tri(n-butyl)phosphate, TRITON X-100, and soybean oil (TTO), 3) TRITON X-100 and soybean oil (TO), or 4) TRITON X-100 (T) alone. X8P was significantly more effective against influenza A virus at 1:10 and 1:100 dilutions (TRITON X-100 dilution of 1:500, and 1:5000) than TRITON X-100 alone or mixed with the other components tested. At the dilution 1:1000, X8P (TRITON X-100 dilution of 1:50,000) was able to reduce influenza A infection of MDCK cells by approximately 50% while TRITON X-100 alone at the same concentration was completely ineffective.
X8P does not affect infectivity of non-enveloped virus: To investigate whether X8P may affect the infectivity of non-enveloped virus, genetically engineered adenovirus containing LacZ gene was used, encoding β-galactosidase. This adenovirus construct is deficient in the transforming gene and therefore can replicate and transform only permissive cells containing the transforming gene of adenovirus 5. The 293 cells, which constitutively express transforming gene, were employed to promote adenovirus replication and production of β-galactosidase enzyme. X8P treatment did not affect the ability of adenovirus to replicate and express β-galactosidase activity in 293 cells. Both X8P treated and untreated adenovirus produced approximately 0.11 units of β-galactosidase enzyme.
Action of X8P on enveloped virus: Since X8P only altered the infectivity of enveloped viruses, the action of this nanoemulsion on enveloped virus integrity was further investigated using electron microscopy. After a 60 min incubation with 1:100 dilution of X8P, the structure of adenovirus is unchanged. A few recognizable influenza A virions were located after 15 min incubation with X8P, however, no recognizable influenza A virions were found after 1 h incubation. X8P's efficacy against influenza A virus and its minimal toxicity to mucous membranes demonstrates its potential as an effective disinfectant and agent for prevention of diseases resulting from infection with enveloped viruses.
Example 13 The Ability of Nanoemulsion/Influenza Compositions to Induce an Immune Response in MiceThis Example describes the ability of an exemplary nanoemulsion composition to elicit a specific immune response in mice.
A. The Effect of Pre-Treatment with Nanoemulsion on Immune Response to Influenza A
Mice were pretreated with nasally-applied nanoemulsion (1.0% 8N8 and 1.0% or 0.2% 20N10) 90 minutes before exposure to influenza virus (5×105 p.f.u./ml) by nebulized aerosol. Morbidity from pretreatment with nanoemulsion was minimal and, as compared to control animals, mortality was greatly diminished (20% with pretreatment vs. 80% in controls, Donovan et al., Antivir Chem Chemother., 11:41 (2000)). Several of the surviving, emulsion pretreated animals had evidence of immune reactivity and giant-cell formation in the lung that were not present in control animals treated with emulsion but not exposed to virus. All of the pretreated animals had evidence of lipid uptake in lung macrophages.
FIG. 6 shows serum anti-influenza titers in mice treated with different preparations of virus. Only animals whose nares were exposed to virus/nanoemulsion show significant IgG titers. In animals exposed to virus without pretreatment or emulsion alone, no immune response to influenza virus was observed. Antibody titers to influenza virus in the serum of exposed animals was measured and found that animals pretreated with emulsion and exposed to virus had high titers of virus-specific antibody (FIG. 6). This immune response was not observed in control animals exposed to virus without pretreatment. The high titers of antibody in these animals prompted experiments to determine whether or not the co-administration of emulsion and virus would yield protective immunity without toxicity.
B. The Effect of Nanoemulsion/Influenza A Virus Co-Administration on Immune Response
X8P emulsion was pre-mixed with the virus. The final emulsion concentration was 2% and virus concentration was 2×106 pfu/ml. The emulsion/virus solution (25 μl) of the emulsion/virus solution was administered to the nares of mice under mild anesthesia. A control group received the same viral dose inactivated using 1:4000 dilution of formaldehyde solution incubated for 3 days to ensure complete inactivation. Another control group included mice that received a reduced dose of virus (100 pfu/mouse). Additional controls received nanoemulsion alone or saline alone.
Three weeks later, mice received a second dose of the emulsion/virus vaccine. Representatives of the group were tested for the development of serum antibodies and some were challenged with a lethal dose of influenza A virus to check for any developed immunity. Two weeks later, mice were tested for the development of a protective immune response in their serum. Some mice were challenged with a lethal dose of influenza virus to check for the development of protective immunity. All the challenged mice were observed for 14 days for signs of disease. Sera were tested for the presence of specific antibodies against influenza virus.
The results of the experiment are shown in Table 25 and FIGS. 7-8. None of the 15 animals died from exposure to a LD80 of virus after two administrations of 5×104 pfu of virus mixed in nanoemulsion, whereas the expected 80% of control animals died from this exposure. The same dose of formalin killed virus applied to the nares provided no protection from death and resulted in much lower titers of virus-specific antibody.
FIG. 7 shows bronchial IgA anti-influenza titers in mice treated with different preparations of virus. Animals whose nares were exposed to virus/nanoemulsion show significant IgA titers. In animals exposed to killed virus or emulsion alone, a much lower IgA titer was observed.
FIG. 8 shows serum anti-influenza titers in mice treated with two doses of several different preparations of virus. As compared to the animals in FIG. 6, the titers are much higher, particularly in the virus/emulsion treated animals. This indicates a “booster” response to the second administration. This example demonstrates that the administration of both nanoemulsion and killed virus is both necessary and sufficient to elicit a specific immune response in mice.
| TABLE 25 |
| Mortality of Influenza Exposed Animals Receiving |
| Intranasal Pretreatment |
| Mortality | Death (%) | ||
| No Pre-treatment | 13/15 | 87 | |
| (5 × 104 pfu) | |||
| Emulsion Alone | 12/15 | 80 | |
| Formalin Killed Virus | 10/15 | 75 | |
| (5 × 104 pfu) | |||
| Emulsion and Virus | 0/15 | 0 | |
| Reduced Virus alone | 6/15 | 40 | |
| (100 pfu) | |||
Additional experiments were performed to investigate the possibility that a small amount of residual, live virus in the nanoemulsion was producing a subclinical infection that provided immunity. An additional group of animals were given approximately 100 pfu of live virus intranasally in an attempt to induce a low-level infection (approximately four times the amount of live virus present after 15 minutes of treatment with nanoemulsion). While there was a reduction in death rates of these animals, the amount of protection observed was insignificant and none of these animals developed virus-specific antibodies (Table 25). This result indicates that it was not merely a sub-lethal viral infection mediating the immune response but that the emulsion was specifically enhancing the virus-specific immune response. The protective immunity was obtained following only two applications (immunizations) of the emulsion/virus mix, and appeared to increase after each application suggesting a “booster effect.” Virus-specific antibody titers were maintained for six weeks until the end of the experiment.
Example 14 Testing of Nanoemulsion VaccinesThis Example describes experiments useful in testing potential nanoemulsion vaccines for their safety and efficacy.
A. Pre-Exposure Prophylaxis and Induction of Immunity
Intranasal prophylaxis: 6 groups of animals (Table 26) receive the following schedule of treatments intranasally with 15-60 minute intervals in between. Animals are monitored for any sign of diseases. Blood, broncho-alveolar lavage fluid and nasal washing are collected and tested for pathogen specific antibody titer using ELISA (Fortier et al., (1991); Jacoby et al., (1983), and Takao et al., (1997)). Two weeks later, surviving animals are challenged with a lethal dose of the pathogen to test for the development of a protective immune-response. Terminally ill animals are sacrificed humanely as soon as identified, as are all other animals at the end of the experiment (at least two weeks after the challenge). Blood and tissue are harvested for histopathological examination and both the serologic and cell-mediated immune responses are determined.
| TABLE 26 |
| Treatment Groups of Animal in Exposure Trials |
| Group | Pre-treatment | Treatment |
| 1 | Diluted Nanoemulsion | Live Pathogen |
| 2 | Diluted Nanoemulsion | Formalin Killed Pathogen |
| 3 | Diluted Nanoemulsion | PBS |
| 4 | PBS | Live Pathogen |
| 5 | PBS | Formalin Killed Pathogen |
| 6 | PBS | PBS |
B. Evaluation of the Adjuvant Activity of the Nanoemulsion
Cell-mediated immune responses are evaluated in vitro. The evaluation is performed on immunocompetent cells harvested from euthanized animals obtained from the experiment described above (section A). T-cells proliferation response is assessed after re-stimulation with antigen. Cells are re-stimulated with whole pathogen or pathogen constituents such as DNA, RNA or proteins alone or mixed with nanoemulsion. Proliferation activity is measured by H3-thymidine uptake or Cell Proliferation ELISA chemiluminiscence. In addition to proliferation, Th1 and Th2 cytokine responses are measured to qualitatively evaluate the immune response. These include IL-2, TNF-γ, IFN-γ, IL-4, IL-6, IL-11, IL-12, etc.
Proliferation and cytokine response patterns are compared with the results obtained in Section A above. After careful analysis of the data, nanoemulsions are modified by substituting specific components with other oils, detergents or solvents. Other desired adjuvants such as CpG, chemokines and dendrimers are added to the emulsion/pathogen mix to evaluate their enhancement of immune responses, along with potential toxicity.
C. Development of Rapid and Effective Mucosal Vaccines
This example provides a non-limiting example of methods for testing the nanoemulsion vaccines of the present invention. Intranasal vaccination: Animals are divided into 6 groups. Each group receives a different intranasal challenge to evaluate the resulting immune response:
1. Nanoemulsion alone (Negative control)
2. Pathogen alone (Positive control).
3. Nanoemulsion/pathogen mixture, prepared immediately prior to administration.
4. Nanoemulsion/pathogen mixture, prepared 3 days before administration.
5. Formaldehyde killed pathogen.
Table 27 shows the challenge protocol for vaccine studies. All challenged animals are monitored daily for any signs of illness. Serum is tested for pathogen specific antibody titer using ELISA (Fortier et al., Infect. Immun., 59:2922 (1991), Jacoby et al., Lab. Anim. Sci., 33:435 (1983), and Takao et al., J. Virol., 71:832 (1997)). Any terminally ill animals are humanely euthanized, with serum harvested for antibody titer and tissues collected for histopathologic examination. Harvested spleen cell and lymph node cell suspensions are used to determine cell-mediated immune responses. At the end of the experiment, all remaining animals are humanely sacrificed for similar analysis.
| TABLE 27 |
| Challenge Protocol for Vaccine Studies |
| Day | Procedure |
| 0 | Start of the treatment for all groups. |
| 14 | Blood samples are collected from all the animals. |
| One group of animals is sacrificed for | |
| BAL, nasal washing, organs and histopathology. | |
| One group of animals is challenged | |
| with a lethal dose of the pathogen. | |
| The rest of the animals receive second dose of the | |
| emulsion/vaccine treatment. | |
| 35 | Blood samples are collected from all the animals. |
| One group of animals is sacrificed for | |
| BAL, nasal washing, organs and histopathology. | |
| One group of animals is challenged | |
| with a lethal dose of the pathogen. | |
| 49 | Blood samples are collected from all the animals. |
| The remaining animals are sacrificed | |
| for BAL, nasal washing, organs and histopathology. | |
A. Material and Methods
Animals
Female C3H/HeNHsd (Harlan, Indianapolis, Ind.) 5-week-old, specific-pathogen-free mice were used in all experiments.
Virus
Influenza A/Ann Arbor/6/60 virus (H2N2), mouse adapted, F-14-95, E1, M3, E1, SE1 was provided by Dr. Hunein Maassab (School of Public Health, University of Michigan, Ann Arbor, Mich.). Influenza A/Puerto Rico/8/34 virus (H1N1), mouse adapted, F8, M593, E173, SE1 was from ATCC (Rockville, Md.). All viruses were propagated in allantoic cavities of fertilized pathogen-free hen eggs (SPAFAS, Norwich, Conn.) using standard methods described elsewhere (Herlocher et al., Virus Res., 42:11 (1996)). Virus stocks were kept in aliquots of infectious allantoic fluids at −80° C. The virus was purified on sucrose gradient 15-60% solution at 100,000 g for 90 min at 4° C., as described previously (Merton et al., Production of influenza virus in cell cultures for vaccine preparation. In: Novel Strategies in Design and Production of Vaccines. Edited by S. Cohen and A. Shafferman, Plenum Press, New York, 1996. pp. 141-151). The band containing the virus was collected, diluted in NTE buffer (100 mM NaCl, 10 mM Tris-HCl, 1 mM EDTA, pH=7.5) and spun down at 100,000×g for 60 min at 4° C. The virus pellet was resuspended in NTE buffer and stored at −80° C.
Inactivation of Virus with Formaldehyde
Virus inactivation was performed as previously described (Chen et al., J. Virol. 61:7 (1987); Novak et al., Vaccine 11:1 (1993)). Briefly, different doses (103-105 pfu) of virus were incubated in formaldehyde solution (dilution 1:4000) for 3 days and subsequently administrated to animals.
Inactivation of Virus with X8P Nanoemulsion
Intact influenza A virus at various concentrations of 2×104-5×105 pfu was mixed with equal volume of 4% X8P nanoemulsion (final concentration: 2%) and incubated at 37° C. for 60 mm.
Preparation of Nanoemulsion and Toxicity Testing
The X8P surfactant nanoemulsion was prepared in a two-step procedure. An oil phase was prepared by blending the following ingredients: TBP (final concentration 8%), TRITON X-100 (4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol) (8%) and soybean oil (64%) and heating at 70° C. for 30 minutes (See e.g., U.S. Pat. No. 6,015,832 and U.S. Patent Application 20020045667, each of which is herein incorporated by reference). The surfactant nanoemulsion was then formed by mixing with water (20%) using a Silverson L4RT Mixer for 3 minutes at 10,000 rpm. TRITON X-100 was purchased from Sigma Chemicals (St. Louis, Mo.), TBP was purchased from Aldrich (Milwaukee, Wis.), and soybean oil was purchased from Croda Inc. (Mill Hill, Pa.). The X8P nanoemulsion was tested for animal toxicity as previously described (See e.g., above examples). Briefly, the mice were anaesthetized with metofane and different concentrations of nanoemulsion (1, 2, and 4%) at a volume of 50 μl (25 μl/nare) were administrated to mice intranasally. All tested concentrations of nanoemulsion were well tolerated after direct intranasal instillation in mice. Based on these data, 2% X8P was chosen for the immunization study.
Plaque and Plaque Reduction Assays
Plaque assays (PA) were performed on MDCK monolayer cells in six-well plates as previously described (Myc et al., J. Virol. Meth. 77:165 (1999)). Plaque reduction assays (PRA) were performed with a modification of the method described by Hayden et al. (Antimicrob. Agents and Chemother., 17:865 (1980)). MDCK cells were grown in 150×25 mm petri dishes to 80% confluency. Approximately 1×108 pfu influenza A virus was incubated either with nanoemulsion or PBS for 30 min at room temperature (RT). After incubation, nanoemulsion-treated and untreated virus were resuspended in 250 ml medium and the entire volume of viral suspension was placed on separate cell monolayers and incubated for 1 h, following the plaque assay method as previously described (Myc et al., supra).
Immunizations and Experimental Design
All groups of mice were treated intranasally with viral or control solutions in a total volume of 50 μl (25 μl/nare) as described in the Results section below. Briefly, each mouse was halothane anesthetized and held inverted with the nose down until droplets of emulsion applied to external nares were completely inhaled. All mice were treated once on day 1 of the experiment. On day 21, mice were challenged with LD100 either with congenic virus (used for intranasal treatment) or heterogenic virus. After the challenge, mice were monitored daily for clinical signs of illness for 14 days. Clinical signs of illness were graded on a scale of 0-3, where 0 indicated no significant clinical abnormality; 1 indicated mild symptoms including piloerection, hunched back and loss of movement; 2 indicated cyanosis, dyspnea, circulatory compromise tachypnea and a rectal temperatures<33° C.; and 3 indicated death of the animal. Rectal core body temperatures were recorded with a Model BAT-12 digital thermometer fitted with a RET-3 type T mouse rectal probe (Physitem, Clifton, N.J.) (Rozen et al., Meth. Mol. Biol., 132:365 (2000)). Mice with core body temperatures falling below 33° C. were judged to be terminally moribund and humanely euthanized (Stevenson et al., J. Immunol., 157:3064 (1996)). Mice that survived 14 days after challenge had normal body temperatures and no clinical signs of illness.
Collection of Blood and Tissue Samples
Blood samples were obtained either from the tail vein or from euthanized animals by cardiac puncture at different time intervals during the course of experiment. Samples of lungs, regional lymph nodes, spleen, and liver were collected from euthanized animals and processed following the RT PCR or proliferation assay protocols as described below.
RT-PCR Detection of Viral RNA
The following primers for 246 bp fragment of M gene, conserved for A strains, were used for PCR: 5′ catggaatggctaaagacaagacc (forward; SEQ ID NO:1), and 5′aagtgcaccagcagaataactgag (reverse; SEQ ID NO:2), as described previously (Schweiger et al., J. Clin. Microbiol., 38:1552 (2000)). The primers were ordered from Operon Technologies, Inc. (Alameda, Calif.). Viral RNA was isolated from tissue homogenates with the use of Tri Reagent (MRC, Cincinnati, Ohio). Lung, mediastinal lymph node, spleen and liver were used for RNA extraction. The cDNA synthesis was carried out with 2.0 μg of total tissue RNA using 5.0 mM MgCl2, 500 μM of each dNTP, 2.5 μM random hexamer primers, 0.4 U/μl of RNase inhibitor and 2.5 U/μl of Superscript II RT (Invitrogen, Rockville, Md.). Thermal cycling was performed in a total volume of 20 μl using 3 single cycles at 25° C. for 12 min, at 42° C. for 50 min, then 70° C. for 15 min (GeneAmp PCR System 2400/Perkin Elmer). The PCR amplification was carried out with 0.01-0.1 μg of cDNA using 0.2 μM of each primer, 0.2 mM of each dNTP, 1.5 mM MgCl2, 0.1 U/μl of Taq DNA Polymerase (Roche Molecular Biochemicals, Indianapolis, Ind.). PCR reactions in a total volume of 20 μl were incubated at 94° C. for 2 min, and then 35 cycles were performed with annealing at 62° C., extension at 72° C. and denaturation at 94° C. Post-PCR analysis was performed on a 2% Nusive/1% agarose gel using Tris-acetate buffer for electrophoresis and ethidium bromide for DNA staining. Analysis was performed using a photoimaging camera and software from BioRad (Hercules, Calif.).
Specific Anti-Virus IgG Determination
IgG-specific Ab titers were determined in ELISA. Microtiter plates (NUNC) were pretreated with 0.5% glutaraldehyde (Sigma, St. Louis, Mo.) in PBS for one hour at 56° C. and washed 4 times with PBS. Influenza A virus (5×103 pfu/well) in PBS was placed on the pre-treated plates and incubated either at 37° C. for two hours or overnight at 4° C. The virus was aspirated; plates were washed with PBS and fixed with ethanol-acetone (1:1) fixative for 15 min at −20° C. After fixation, plates were washed again and blocked for 30 min with blocking buffer (1% dry milk in PBS). Blocking buffer was removed and plates were sealed and stored at 4° C. until used. Serum samples and positive and negative control sera were serially diluted in dilution buffer (0.1% BSA in PBS) and incubated on virus coated plates at 37° C. for 30 min. After washing with washing buffer (0.05% Tween 20 in PBS), biotinylated anti-mouse IgG antibody was added and plates were incubated at 37° C. for 30 min. Plates were washed again and incubated with streptavidin-AP (Sigma, St. Louis, Mo.), following wash and incubation with AP substrate (Sigma, St. Louis, Mo.). Plates were incubated at room temperature until color developed. The reaction was stopped with 1N NaOH and the plates were read on an ELISA reader at 405 nm. Antibody titers were determined arbitrarily as the highest serum dilution yielding absorbency three times above the background (Kremer et al., Infection and Immunity 66:5669 (1998)).
Proliferation Assay
Mouse spleens were disrupted in PBS to obtain the single cell suspension. Cells were washed in PBS and red blood cells were lysed using ammonium chloride lysis buffer. Splenocytes were then resuspended in the culture medium (RPMI 1640 supplemented with 10% FBS, L-glutamine and penicillin/streptomycin) and seeded 1.5×105 cells/250 μl/well in 96-well microtiter plate. Cells were then incubated either with the mitogen PHA-P (2.5 μg/well) for 3 days (Stevenson et al., supra) or influenza A virus at concentration of 6×103 pfu/well for 6 days, following overnight BrdU labeling. Cell proliferation was measured using a Cell Proliferation Chemiluminescence ELISA following the manufacturer's instruction (Roche Diagnostics, Indianapolis, Ind.). Measurement of relative light units was performed using a standard luminometer.
In Vitro Cytokine Production
Splenocytes were resuspended in culture medium (RPMI 1640 supplemented with 10% FBS, L-glutamine and penicillin/streptomycin) and seeded 1.5×105 cells/250 μl/well in microtiter flat-bottom plates. Cells were then incubated either with the mitogen PHA-P (2.5 μg/well) for 3 days (Stevenson et al., supra) or influenza A virus at a concentration of 6×103 pfu/well for 6 days. Supernatant was then harvested and subjected to quantitate cytokine concentration.
Quantitation of Cytokines
IL-2, IL-4, IL-12, and IFN-γ cytokine levels in serum and splenocyte supernatants were performed using QUANTIKINE M ELISA kits (R&D Systems, Inc.) according to manufacturers' instructions.
Flow Cytometric Analysis
Antibodies specific to mouse molecules CD3, CD4, CD8 and CD19 (BD PharMingen, San Diego, Calif.) directly labeled with either PE or FITC were used in flow cytometric analysis. Single cell suspensions of splenocytes were incubated with antibodies for 30 min on ice and washed with PBS containing 0.1% BSA. Samples were acquired on a Coulter EPICS-XL MCL Beckman-Coulter flow cytometer and data were analyzed using Expo32 software (Beckman-Coulter, Miami, Fla.).
Histology
Lungs were fixed by inflation with 1 ml of 10% neutral buffered formalin, excised en bloc and immersed in neutral buffered formalin. After paraffin embedding, 5 μm sections were cut and stained with hematoxylin and eosin, and viewed by light microscopy.
Statistical Methods
The means, standard deviation, standard error and χ2 analysis with Yate's correction were calculated. To compare the control group to the study groups, Cox regression was used (Cox et al., Journal of the Royal Statistical Society. Series B, 34:187 (1972)). The difference between the study groups and the control group was tested using the log-likelihood ratio test.
B. Results
Virucidal Activity of Nanoemulsion on Influenza A Virus
The virucidal effect of X8P nanoemulsion on influenza A virus, Ann Arbor strain was tested prior to intranasal treatment of animals with the virus/nanoemulsion mixture. The virus at concentrations of 2×104, 5×104 2×105 and 5×105 pfu in 2% X8P nanoemulsion in a total volume of 50 μl was incubated at 37° C. for 60 min prior to inoculation of influenza-sensitive cells. The plaque reduction quality of the nanoemulsion was assayed using MDCK cells. As shown in FIG. 10a, nanoemulsion reduced the ability of virus to form plaques by more than three logs. Prolonged incubation of virus with nanoemulsion reduced number of plaque forming units in a time dependent manner (FIG. 10b). After 3-hour incubation of 5×105 pfu of virus with nanoemulsion, no pfu were detected (FIG. 10b). RT-PCR performed on virus/nanoemulsion preparation at the same time points showed complete correlation with plaque reduction assay (PRA). Viral RNA was still detectable at 2 h but none was present at 3 and 4 h (FIG. 10c).
Influenza A Virus/Nanoemulsion Mixture Protects Mice from Lethal Challenge with Congenic Strain of Virus
Mice were treated intranasally with either 2% nanoemulsion alone, formalin killed influenza A virus “AA” strain (5×105 pfu), formalin killed virus mixed with 2% nanoemulsion or virus (5×105 pfu) inactivated with 2% nanoemulsion. Twenty days later all 4 experimental groups were challenged with a lethal dose (2×105 pfu) of the congenic virus. The animals treated with influenza/nanoemulsion mixture did not have any signs of illness; their core body temperature was within a normal range until the term of experiment (FIG. 11) and all animals survived the challenge. Animals treated with nanoemulsion alone succumbed to viral pneumonitis after the challenge and all died by day 27 (day 6 after challenge). All animals treated with formalin-killed virus and nanoemulsion died by day 26 (day 5 after challenge). In the group treated with formalin-killed virus alone only one mouse survived (FIG. 12).
The experiment also examined whether viral RNA mixed with nanoemulsion and administrated intranasally would protect mice from the lethal challenge. Neither viral RNA (0.5 μg; an equivalent of 105 pfu of virus) alone nor viral RNA/nanoemulsion mixture had any protective effect on animals challenged with lethal dose of virus.
In order to examine whether intact virus particles could mimic the same protection effect as nanoemulsion/virus mixture, the animals were treated with 5 doses of virus (2×105, 2×104, 2×103, 2×102, and 2×101 pfu) alone or mixed with nanoemulsion (Tables 28 and 29). Within the first 14 days after treatment, all animals treated with 2×105 pfu virus succumbed to pneumonitis. Only one mouse survived the treatment with 2×104 pfu virus. All animals in other experimental groups survived the treatment and became healthy 14 days later. On day 21 all survived animals were challenged with lethal dose of the virus and observed for additional 14 days. The mice treated with 5×105 pfu of virus and nanoemulsion survived the challenge; in the group of animals pretreated with 2×105 pfu of virus and nanoemulsion only 4 out of 7 mice survived. Animals from all other experimental groups developed pneumonitis and all died by day 28.
| TABLES 28 AND 29 |
| Survival of mice after intranasal treatment with different doses of influenza A virus (Table 28) |
| and lethal challenge with congenic virus (Table 29) |
| TABLE 28 |
| Intranasal treatment: |
| X8P | X8P | X8P | X8P | X8P | X8P | |||||||
| Time | X8P | 5 × 105 | 2 × 105 | 2 × 105 | 2 × 104 | 2 × 104 | 2 × 103 | 2 × 103 | 2 × 102 | 2 × 102 | 2 × 101 | 2 × 101 |
| (days) | 0 | pfu | pfu | pfu | pfu | pfu | pfu | pfu | pfu | pfu | pfu | pfu |
| 0 | 5 | 6 | 7 | 8 | 7 | 9 | 7 | 7 | 7 | 7 | 7 | 7 |
| 1 | 5 | 6 | 7 | 7 | 7 | 9 | 7 | 7 | 7 | 7 | 7 | 7 |
| 2 | 5 | 6 | 7 | 3 | 7 | 9 | 7 | 7 | 7 | 7 | 7 | 7 |
| 3 | 5 | 6 | 7 | 0 | 7 | 2 | 7 | 7 | 7 | 7 | 7 | 7 |
| 4 | 5 | 6 | 7 | 0 | 7 | 1 | 7 | 7 | 7 | 7 | 7 | 7 |
| 5 | 5 | 6 | 7 | 0 | 7 | 1 | 7 | 7 | 7 | 7 | 7 | 7 |
| 6 | 5 | 6 | 7 | 0 | 7 | 1 | 7 | 7 | 7 | 7 | 7 | 7 |
| 7 | 5 | 6 | 7 | 0 | 7 | 1 | 7 | 7 | 7 | 7 | 7 | 7 |
| 8 | 5 | 6 | 7 | 0 | 7 | 1 | 7 | 7 | 7 | 7 | 7 | 7 |
| 9 | 5 | 6 | 7 | 0 | 7 | 1 | 7 | 7 | 7 | 7 | 7 | 7 |
| 10 | 5 | 6 | 7 | 0 | 7 | 1 | 7 | 7 | 7 | 7 | 7 | 7 |
| 11 | 5 | 6 | 7 | 0 | 7 | 1 | 7 | 7 | 6 | 7 | 7 | 7 |
| 12 | 5 | 6 | 7 | 0 | 7 | 1 | 7 | 7 | 6 | 7 | 7 | 7 |
| 13 | 5 | 6 | 7 | 0 | 7 | 1 | 7 | 7 | 6 | 7 | 7 | 7 |
| 14 | 5 | 6 | 7 | 0 | 7 | 1 | 7 | 7 | 6 | 7 | 7 | 7 |
| TABLE 29 |
| Intranasal treatment: |
| X8P | X8P | X8P | X8P | X8P | X8P | X8P | ||||||
| Time | 0 | 5 × 105 pfu | 2 × 105 pfu | 2 × 105 pfu | 2 × 104 | 2 × 104 | 2 × 103 | 2 × 103 | 2 × 102 | 2 × 102 | 2 × 101 | 2 × 101 |
| (days) | Challenge with 2 × 105 pfu/mouse | pfu | pfu | pfu | pfu | pfu | pfu | pfu | pfu |
| 21 | 5 | 6 | 7 | 7 | 1 | 7 | 7 | 6 | 7 | 7 | 7 | |
| 22 | 5 | 6 | 7 | 6 | 1 | 5 | 7 | 5 | 5 | 7 | 7 | |
| 23 | 5 | 6 | 7 | 6 | 1 | 5 | 6 | 3 | 2 | 6 | 7 | |
| 24 | 5 | 6 | 7 | 5 | 1 | 5 | 6 | 1 | 1 | 5 | 4 | |
| 25 | 5 | 6 | 6 | 5 | 1 | 4 | 0 | 0 | 0 | 0 | 0 | |
| 26 | 1 | 6 | 6 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | |
| 27 | 0 | 6 | 4 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | |
| 28 | 0 | 6 | 4 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | |
| 29 | 0 | 6 | 4 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
| 30 | 0 | 6 | 4 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
| 31 | 0 | 6 | 4 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
| 32 | 0 | 6 | 4 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
| 33 | 0 | 6 | 4 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
| 34 | 0 | 6 | 4 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
| 35 | 0 | 6 | 4 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
Histological examination of animals treated with nanoemulsion alone and challenged with a lethal dose of influenza A virus Ann Arbor strain (5×105 pfu) showed profound lobar pneumonia at days 25-27 of experiment (day 5-7 post-infection). Large areas of pulmonary tissue showed uniform consolidation caused by a massive influx of inflammatory cells (neutrophils and macrophages) filling the alveolar spaces and infiltrating the interstitium. Areas of pulmonary tissue destruction as evidenced by the intra-alveolar bleeding, presence of abscesses with central necrosis, and by formation of empty caverns filled with traces of cellular debris were observed. Additionally, areas of fibrosis were found in the lungs of these mice, suggesting massive destruction of lung tissue that became replaced by proliferating fibroblasts. Thus, the histological picture of severe pneumonia and pulmonary tissue damage observed in these mice is consistent with rapid pulmonary death of animals caused by influenza infection.
Pathology of the virus-infected lungs from animals treated with intact virus/nanoemulsion mixture was less pronounced than pathology from the animals treated with nanoemulsion alone. In these animals both areas of pathologically unaltered lungs and areas with remaining pathology were found. Affected areas showed inflammatory infiltrates in lung interstitium (alveolar septa) but the alveolar space was free of exudates or inflammatory cells. The interstitial infiltrates contained predominantly mononuclear cells. The remaining lung tissue possessed well-preserved pulmonary architecture and appeared similar to the lungs from uninfected animals. This histological picture is consistent with less severe infection and recovery from infection observed in these mice.
Serum Levels of Specific Anti-Influenza A Virus IgG
The levels of specific anti-influenza IgG antibodies were examined following a single treatment with either virus/nanoemulsion or nanoemulsion alone. The levels of IgG antibodies were evaluated in sera of animals on day 10, 20, and 35 after initial vaccination (or treatment). On day 10, all mice showed background levels of anti-influenza A IgG antibodies in serum (titer 1:100). On day 20, mice that had been treated with virus/nanoemulsion produced significantly higher antibody response (p<0.05) as compared to control group treated with nanoemulsion alone. On day 35, virus/nanoemulsion treated mice that survived the challenge produced 10 times higher serum levels of IgG antibody compared with the levels found within the same animals before the challenge (FIG. 13).
Detection of Viral RNA in Mice Treated with Influenza A Virus and Nanoemulsion Formulation.
The RT-PCR results from the total lung RNA indicated the presence of influenza A virus RNA in virus/nanoemulsion vaccinated animals until day 6 after treatment, but not on day 7 and thereafter (FIG. 14a). Signal generated in RT-PCR reaction from 0.1 μg of total RNA from mouse lung during the first 6 days after treatment correlated to a total of less than 10 plaque forming units (pfu) of virus (FIG. 14b).
Early Immune Status of Mice Immunized with Influenza A Virus/Nanoemulsion Formulation
The specificity of early immune responses in mice treated with various viral preparations was characterized by the analysis of cytokines. The level of cytokines produced by animals was measured both in media from cultured splenocytes and in serum of experimental animals (FIGS. 16a and 16b). On day 4 after treatment with virus/nanoemulsion preparation, elevated levels of IL-12, IL-2, TNF-α, and particularly IFN-γ, were detected (FIG. 16a). In the control group of animals, there were no detected levels of these cytokines. Elevated levels of IL-10 and no detectable levels of IL-4 were observed across all experimental groups.
Since elevated IFN-γ was shown to indicate initial immune response, IFN-γ levels in serum of experimental animals were monitory up to day 20 after initial treatment. The levels of IFN-γ in serum obtained from mice treated with virus/nanoemulsion reached over 230 pg/ml at 24 h and gradually decreased to undetectable levels over a period of 20 days. The IFN-γ levels of the other experimental groups were low compared to the levels detected in the control group (FIG. 15g).
Antigen Specificity of Immune Response in Mice Treated with Virus/Nanoemulsion.
The antigen specificity of immune responses was assessed using splenocyte proliferation and cytokine activation assays. Splenocytes were harvested on day 20 of the experiment from mice treated with virus/nanoemulsion and nanoemulsion alone. Cells were stimulated with congenic virus (AA strain used for intranasal treatment) for 5 days. As shown in FIG. 16, influenza A/AA strain specifically stimulated splenocytes harvested from mice treated with congenic virus/nanoemulsion mixture while no proliferation was detected in splenocytes harvested from any other group of animals. The stimulation index was less than 1, indicating that during 5 days of incubation virus killed some cells in the tissue culture. On day 35 of experiment (14 days after lethal challenge), splenocytes harvested from animals that survived the challenge showed greater proliferation index compared with the proliferation response of splenocytes obtained from the same group of animals on day 20.
Cytokine production was analyzed to characterize the nature of the immune response and confirm antigen specificity. The conditioned media obtained form splenocytes treated the same way as for the proliferation assay and incubated for 72 h was used to quantitate cytokine concentration. On day 20 splenocytes obtained from mice treated with virus/nanoemulsion produced high levels of IFN-γ and slightly increased levels of IL-2 (FIGS. 17a and 17b). There was no detectable production of IL-4 in resting or virus-stimulated cells (FIG. 17c). In splenocytes obtained from animals after challenge, viral stimulation resulted in further amplification of IFN-γ and IL-2 expression, reaching concentrations at least five fold higher than in animals before challenge (day 20). Major differences were also detected in the IL-4 expression. In contrast to their pre-challenge status, IL-4 was detected in non-stimulated, and over five-fold increased in congenic virus stimulated splenocytes (FIG. 17c). No specific activation of IFN-γ, or other cytokines in splenocytes obtained from animals treated with nanoemulsion alone, viral RNA/nanoemulsion or with formaline-killed virus/nanoemulsion was observed.
Characteristics of Immunocompetent Cells
The ratios of T:B (CD3:CD19) and Th:Tc (CD4:CD8) cells in spleens of experimental animals were examined. In spleens of naïve mice 32% of T cells and 39% of CD8 positive cells were detected using immunostaining and flow cytometry analysis. Twenty one days after intranasal vaccination the percentage of T cells remained unchanged in groups of animals treated with virus/nanoemulsion mixture and nanoemulsion alone while CD8 positive cells were elevated in these groups to 48% and 44%, respectively. Fourteen days after lethal challenge (day 35 after immunization), the only surviving animals were in the group treated with virus/nanoemulsion mixture. All animals had significantly (p<0.0001) elevated T cells and slightly elevated CD8 positive cells compared with the same group before the challenge (FIG. 18). While T cells remained at the same level, the CD8 positive cells increased in the groups treated with nanoemulsion alone and virus pre-incubated with nanoemulsion.
Expansion of Epitope Recognition
20 days after intranasal instillation of virus Ann Arbor strain/nanoemulsion or nanaoemulsion alone, mice were challenged with either congenic (AA) or heterogenic (Puerto Rico) strain of virus and observed for 14 days. Animals treated with virus Ann Arbor strain/nanoemulsion and challenged with congenic virus survived and recovered, animals from all other groups succumbed to pneumonia and died by day 26 of experiment (FIG. 19). The analysis of IFN-γ cytokine production in animals after the challenge revealed that splenocytes from this group of animals responded to in vitro stimulation with both congenic and heterogenic virus by profound production of cytokine (FIG. 20b). The present invention is not limited to a particular mechanism. Indeed, an understanding of the mechanism is not necessary to practice the present invention. Nonetheless, it is contemplated that animals that survived the challenge with congenic virus acquired immunity also against heterogenic virus and thereby expanded their epitope recognition. In order to examine such possibility, animals that survived the challenge with congneic virus were rechallenged with heterogenic virus (Puerto Rico strain) and observed for additional 14 days. All animals survived the rechallenge with heterogenic virus without any signs of sickness (Table 30).
In conclusion, the present example demonstrates in vivo the adjuvanticity of nanoemulsion for influenza vaccine given intranasally. The results establish that a single intranasal administration of nanoemulsion mixed with virus produces the full protection against influenza pnemonitis, resulting in survival of all animals challenged with lethal dose of the virus. During the course of challenge, immunized animals did not show any signs of illness and their core body temperature was within a normal range for 14 days. Moreover, lungs of survived animals did not show gross pathological changes characteristic for influenza pneumonitis.
| TABLE 30 |
| Survival (%) of animals after vaccination, challenge and cross |
| challenge with influenza A virus Puerto Rico strain |
| Vaccination with: |
| nanoemulsion + | |||
| Time (days) | nanoemulsion | 2 × 105 pfu of AA | nanoemulsion |
| 0 | 100* | 100 | 100 |
| 1 | 100 | 100 | 100 |
| 2 | 100 | 100 | 100 |
| 3 | 100 | 100 | 100 |
| 4 | 100 | 100 | 100 |
| 5 | 100 | 100 | 100 |
| 6 | 100 | 100 | 100 |
| 7 | 100 | 100 | 100 |
| 8 | 100 | 100 | 100 |
| 9 | 100 | 100 | 100 |
| 10 | 100 | 100 | 100 |
| 11 | 100 | 100 | 100 |
| 12 | 100 | 100 | 100 |
| 13 | 100 | 100 | 100 |
| 14 | 100 | 100 | 100 |
| 15 | 100 | 100 | 100 |
| 16 | 100 | 100 | 100 |
| 17 | 100 | 100 | 100 |
| 18 | 100 | 100 | 100 |
| 19 | 100 | 100 | 100 |
| 20 | 100 | 100 | 100 |
| Challenge | 1 × 105 pfu | 1 × 105 pfu of AA | 1 × 104 pfu of PR |
| with: | of AA | ||
| 21 | 100 | 100 | 100 |
| 22 | 100 | 100 | 100 |
| 23 | 100 | 100 | 100 |
| 24 | 0 | 100 | 100 |
| 25 | 0 | 100 | 100 |
| 26 | 0 | 100 | 100 |
| 27 | 0 | 100 | 20 |
| 28 | 0 | 100 | 0 |
| 29 | 0 | 100 | 0 |
| 30 | 0 | 100 | 0 |
| 31 | 0 | 100 | 0 |
| 32 | 0 | 100 | 0 |
| 33 | 0 | 100 | 0 |
| 34 | 0 | 100 | 0 |
| Challenge with: | 1 × 104 pfu of PR | ||
| 35 | none available | 100 | none available |
| 36 | 100 | ||
| 37 | 100 | ||
| 38 | 100 | ||
| 39 | 100 | ||
| 40 | 100 | ||
| 41 | 100 | ||
| 42 | 100 | ||
| 43 | 100 | ||
| 44 | 100 | ||
| 45 | 100 | ||
| 46 | 100 | ||
| 47 | 100 | ||
| 48 | 100 | ||
| 49 | 100 | ||
*number of animals used was 5-8 per group |
This example describes the immune response of mice to recombinant HIV-1 envelope glycoprotein (gp120). Recombinant gp120 glycoprotein at concentrations of 2 and 20 μg per dose mixed with varying concentrations of X8P nanoemulsion (final concentration: 0.1 to 1%) in 100 μl volume was administered intranasally or intramuscularly into mice. Dose administration was repeated within three weeks after the first immunization. Protein in saline was placed in the nose of control animals. GP120/X8P was also injected intramuscularly in order to determine if it could adjunct intramuscularly administered vaccines.
Results are shown in FIGS. 21 and 22. Serum levels of specific anti-gp120 IgG were detected six weeks after initial immunization. Increased and comparable levels of immune responses were detected for both routes of immunization. FIG. 21 demonstrates that administration of X8P nanoemulsion with gp120 resulted in an increased immune response when the gp120 was administered intranasally. FIG. 22 demonstrates that administration of X8P nanoemulsion with gp120 resulted in an increased immune response when the gp120 was administered intramuscularly.
Example 17 Compositions and Methods for Generating an Immune Response to an Orthopox Virus in a SubjectAnimals. Pathogen-free, 5 to 6-week-old, female Balb/c mice were purchased from Charles River Laboratories. Vaccination groups were housed separately, five animals to a cage, in accordance with the American Association for Accreditation of Laboratory Animal Care standards. All procedures involving mice were performed according to the University Committee on Use and Care of Animals (UCUCA) at the University of Michigan.
Viruses. Two exemplary vaccinia viruses (VV) were used during the development of the present invention, VVWR and VVWR-Luc. VVWR (NIH TC-adapted) was obtained from the American Type Culture Collection (ATCC). Recombinant VVWR-Luc expresses firefly luciferase from the p7.5 early/late promoter and has been described (See, e.g., Luker et al., Virology. 2005, 341(2):284-300). VVWR-Luc is not attenuated in vitro or in vivo because the virus was constructed with a method that does not require deletion of any viral genes (See, e.g., Blasco and Moss (1995). Gene 158(2), 157-162; Luker et al., Virology. 2005, 341(2):284-300).
Stocks of all viruses were generated using the method of Lorenzo et al (See, e.g., Lorenzo et al., Methods Mol Biol. 2004; 269:15-30) with some modification. Virus was propagated on Vero cells infected at a multiplicity of infection of 0.5. Cells were harvested at 48 to 72 h and virus was isolated from culture supernatants and cells lysates. Cell lysates were obtained by rapidly freeze-thawing the cell pellet followed by homogenization in Dounce homogenizer in 1 mM Tris pH 9.0. Cell debris was removed by centrifugation at 2000 rpm. The purified virus stocks were obtained from clarified supernatants by layering on 4% to 40% sucrose gradients which were centrifuged for 1 hr at 25,000×g. Turbid bands, containing viral particles, were collected, diluted in 1 mM Tris pH 9 and then concentrated by 1 hr centrifugation at 25,000×g. Viral pellets were re-suspended in 1 mM Tris pH 9 and stored frozen at −80° C. as virus stock. The VVWR stocks were titered on Vero cells (See, e.g., Myc et al., Vaccine. 21:3801-3814).
Nanoemulsion (NE). NE (W205EC) was obtained from NanoBio Corporation, Ann Arbor, Mich. Nanoemulsions are manufactured by emulsification of cetyl pyridum chloride 1%, Tween 20 5% and Ethanol 8% in water with soybean oil (64%) using a high speed emulsifier. Resultant droplets have a mean particle size of 150+/−25 nm in diameter. W205EC has been formulated with surfactants and food substances considered “Generally Recognized as Safe” (GRAS) by the FDA. W205EC can be economically manufactured under Good Manufacturing Practices (GMP) and is stable for at least 18 months at 40° C.
Preparation of the NE-based vaccine. Vaccinia virus (VV) neutralization data generated during the development of the present invention indicated that 1 hr incubation with 10% NE or 0.1% formalin was sufficient for inactivation of the virus (e.g., six log VV titer reduction). On the basis of these results several formulations (e.g., compositions) for inducing an immune response (e.g., vaccine formulations) were produced for animal immunization. The compositions (e.g., for stimulating an immune response) were prepared as follow: To assure complete virus neutralization (e.g., virus inactivation) for the NE-killed VV, samples containing 1×103 pfu to 5×105 pfu per dose of VV were incubated for 3 hrs at 37° C. in 10% W205EC NE, and were subsequently diluted to 1% NE for intranasal instillation. For the vaccine formulations containing formalin-killed virus, the formalin (Sigma) inactivation of VV was performed at RT for 3 hrs in 0.1% formalin. Formalin-killed virus was diluted in either saline or 1% NE to 103 or 105 pfu per dose to reduce the formalin to nontoxic concentrations for intranasal immunization. For every formulation in each experiment, virus inactivation by either NE or fomalin was confirmed using a plaque reduction assay. Additionally, PCR-detection assays of viral DNA in lungs of treated animals were performed as described below to confirm the absence of live, replicating virus.
Immunization. Samples of pre-immune serum were collected from mice prior to initial immunization. All animals were anesthetized with Isoflurene and vaccinated (e.g., with 10-15 μl of vaccine formulation per nare) using a pipette tip. Emulsion was administered slowly to minimize the swallowing of material. After vaccination, animals were observed for adverse reactions. Specific anti-VV antibody response was measured in blood samples 3 weeks after the initial (e.g., prime) administration (e.g., immunization) and one to two weeks after second and third administrations (e.g., immunizations) when additional administrations were performed.
Bioluminescence imaging. Bioluminescence imaging was performed with a cryogenically-cooled CCD camera (UVIS) as described elsewhere (See, e.g., Luker et al., (2002). J Virol 76(23), 12149-12161; Cook and Griffin, (2003). J Virol 77(9), 5333-5338). Data for photon flux were quantified by region-of-interest (ROI) analysis of the head and chest of infected mice. Background photon flux from an uninfected mouse injected with luciferin was subtracted from all measurements.
Collection of blood, bronchial alveolar lavage (BAL) and splenocytes. Blood samples were obtained from the saphenous vein at various time points during the course of trials conducted during the development of the present ivention. Final samples were obtained by cardiac puncture from euthanized, premorbid mice. Serum was obtained from blood by centrifugation at 1500×g for 5 minutes after the blood coagulated for 30-60 minutes at room temperature. Serum samples were stored at −20° C. until used.
BAL fluid was obtained from mice euthanized by Isoflurane inhalation. After the trachea was dissected, a 22 gauge catheter (Angiocath, B-D) attached to a 1 ml syringe was inserted into the trachea. The lungs were infused with 0.5 ml of PBS containing 10 μM DTT and 0.5 mg/ml aprotinin. Approximately 0.4-0.5 ml of aspirate was recovered with a syringe. This procedure was repeated twice. BAL samples were stored at −20° C.
Murine splenocytes were mechanically isolated to obtain single-cell suspension in PBS. Red blood cells (RBC) were removed by lysis with ACK buffer (150 mM NH4Cl, 10 mM KHCO3, 0.1 mM Na2EDTA), and the remaining cells washed twice in PBS. For antigen-specific proliferation or cytokine expression assays, splenocytes (2-4×106/ml) were resuspended in RPMI 1640 medium supplemented with 5% FBS, 200 nM L-glutamine, and penicillin/streptomycin (100 U/ml and 100 μg/ml).
PCR detection of viral DNA. Forward primer (SEQ ID NO. 3: 5′-ATG ACA CGA TTG CCA ATA C 3′) and reverse primer (SEQ ID NO. 4: 5′-CTA GAC TTT GTT TTC TG 3) were used (See, e.g., Ropp et al., J. Clin. Microbiol., 1995: 2069-2076). These primers are for conserved regions of the HA gene of all orthopox viruses (e.g., VV) and were synthesized by Integrated DNA Technologies (IDT, Coralville, Iowa). DNA was isolated from lung tissue homogenates with Trireagent per the manufacturer's protocol (MRC, Cincinnati, Ohio). PCR amplification was performed with 1 μg of total DNA using 0.5 μM of each primer, 0.2 mM of each dNTP, 2.5 mM of MgCl2, and 0.1 U/μl of Taq DNA Polymerase (Roche Molecular Biochemicals, Indianapolis, Ind.). PCR reactions were carried out in a total volume of 20 μl, incubated at 94° C. for 1 min, followed by 25 cycles with annealing at 55° C., extension at 72° C. and denaturation at 94° C. PCR product analysis was performed using electrophoresis on 1% agarose gel in Tris-borate buffer for electrophoresis and ethidium bromide for DNA staining. Analysis was performed using a photoimaging camera and software from BioRad (Hercules, Calif.). DNA isolated from purified VV served as a positive control.
Vaccinia virus challenge. Immunized mice were challenged with live VV to evaluate the effectiveness of the vaccine. Serum samples were collected two days before challenge with live, infective VV. Animals were weighed on the day of the challenge. For viral challenge, an aliquot of purified VVWR that was tittered and then frozen was thawed and diluted in saline. Mice were anesthetized by inhalation of isoflurane and administered (e.g., inoculated/immunized) by intranasal route with a 20 μl suspension of 2×106 or 2×107 pfu of VV (i.e., NE inactivated VV prepared as described above). These doses of VV correspond to 10× and 100× of the 50% lethal dose (LD50), respectively. Weight and body temperature were measured daily for 3 weeks following challenge. Mice that demonstrated a 30% loss in initial body weight were euthanized.
Specific anti-virus IgA and IgG determination. 96-well flat bottom polystyrene plates (Corning, Inc.) were coated with a 1:1000 dilution of infected cell lysate containing at least 5×104 pfu/100 ul of VV in PBS by overnight incubation at 4° C. Plates were fixed with 50% acetone/ethanol mixture followed by washing with PBS containing 0.001% Tween 20. Plates were then blocked for 1 h at 37° C. with 1% nonfat dry milk in PBS with 0.2% Tween 20). Mouse sera or BAL fluid were serially diluted in blocking buffer and added to wells, and the plates incubated for 2 hr at 37° C. and then washed. Anti-mouse IgG or anti-mouse IgA alkaline phosphatase-conjugated antibody diluted 1:2,000 in blocking buffer was added, and the plates were incubated for 1 h at 37° C. with alkaline phosphatase substrate, SIGMA FAST (Sigma, St. Louis, Mo.). The reaction was stopped with 1N NaOH and the plates read on an ELISA reader (Spectra Max 340, Molecular Devices, Sunnyvale, Calif.) at 405 nm with the reference wavelength at 650 nm. The endpoint titer and antibody concentration was calculated as the serum dilution resulting in an absorbance greater than 2 standard deviations above the absorbance in control wells (e.g., not incubated with mouse serum). IgG antibody concentration was calculated according to the logarithmic transformation of the linear portion of the standard curve generated with the AP-conjugated anti-IgG antibody and multiplied by the serum dilution factor. The serum concentration was presented as a mean value+/−standard error (sem). Serum from the naïve mice was used as a control for non-specific absorbance.
Neutralizing antibodies. Neutralizing antibodies were determined with a standard plaque reduction assay (PRA) (See, e.g., Newman et al., J. Chem. Microbiol. 2003, 3154-3157) and the inhibition of luciferase activity using recombinant VVWR-Luc. The PRA was conducted by mixing 10 μl of heat-inactivated mouse serum in serial, two-fold dilutions with 101 μl of serum-free RPMI medium containing 200 pfu of VV. Sera were incubated 6 hr at 37° C. and subsequently placed in 0.5 ml of serum-free medium an overlaid on Vero cell monolayer. After 1 hr incubation, virus/serum inocula were removed and a fresh medium was placed on the cell monolayers. After 48 to 72 hrs, cells were fixed and stained with 0.1% crystal blue. Plaques were counted by two independent observers and the neutralization titer calculated using non-immune serum as a control.
For the assessment of neutralization titer with VVWR-Luc, 10 μl of heat-inactivated mouse serum in serial, two-fold dilutions were mixed with 10 μl of serum-free RPMI medium containing 2×103 pfu of virus. As in the PRA based neutralization assay, samples were incubated for 6 hr at 37° C., resuspended in 100 μl of serum-free RPMI and incubated for 1 hr with Vero cells in 24 well plates. After 24-36 hrs, infected cells were lysed and virus-dependent luciferase activity was assessed by the addition of luciferin substrate (10 μl/well, Promega, Madison, Wis.) to the lysate. Light emission was measured in a luminometer (LB96P; EG & G/Berthold, Gaithersburg, Md.) and adjusted for protein content. Neutralization titer was calculated from inhibition of luciferase expression using non-immune sera and virus in PBS as positive and negative controls, respectively. Correlations between PRA and luciferase inhibition activity were made for each sample.
Vaccinia specific cytokine expression in splenocytes. Splenocytes were harvested from mechanically disrupted spleens and were suspended at 3×106 cells/ml in RPMI 1640 supplemented with 5% FBS, L-glutamine and penicillin/streptomycin. Cells were incubated with VV at either 1×103 pfu or 1×104 pfu per well for 3 days and then the supernatant harvested and analyzed for cytokine production. PHA-P (1 μg per well) was incubated with the cells as a positive control. IFN-γ concentrations in splenocyte supernatants were determined using QUANTIKINE M ELISA kits (R&D Systems Inc., Minneapolis, Minn.) according to the manufacturer's directions.
Assay for determining anti-VV IgG antibody activity in mice administered NE-killed VV versus formalin killed VV. Anti-VV IgG antibody activity was measured using ELISA. NUNC-PolySorp 96 well plates were coated with 1×105 pfu/well of VV and incubated overnight at 4° C. After virus was removed the wells were treated with 1:1 mixture of ethyl alcohol and acetone (EtOH:acetone) or with 2% formalin solution (Formalin) in PBS for 2 hours at 4° C. Plates were washed 2× with PBS and blocked for 1 h at 37° C. with 1% nonfat dry milk in PBS containing 0.2% Tween 20. Pooled sera from mice vaccinated with VV/NE, VV/Fk/NE, VV/Fk and sera from mice which survived sub-lethal infection with live VV (live) were serially diluted in blocking buffer and added to EtOH:acetone and formalin fixed wells, and the plates were incubated for 2 hr at 37° C. and washed. Anti-mouse IgG alkaline phosphatase-conjugated antibody diluted 1:2,000 in blocking buffer, was added, and the plates were incubated for 1 h at 37° C. with alkaline phosphatase substrate, SIGMAFAST (Sigma, St. Louis, Mo.). The reaction was stopped with 1N NaOH and the plates were read on an ELISA reader (Spectra Max 340, Molecular Devices, Sunnyvale, Calif.) at 405 nm with the reference wavelength at 650 nm. The OD values at 405 nm at IgG titers were compared between EtOH:acetone and formalin fixed VV antigens. The activity of specifiv anti-VV antibodies are presented as ratio of anti-VV titers on EtOH: acetone/formalin at the same OD405 value (See FIG. 7).
Example 18 Nasal Immunization with Nanoemulsion-Inactivated Vaccinia Virus Results in the Induction Specific Systemic IgG ResponseExperiments were designed to evaluate if compositions of the present invention (e.g., NE-killed VV) could produce protective immunity similar to that seen in humans vaccinated by scarification with live, replicating VV (See, e.g., Hammarlund et al., Nat. Med. 2003, 9; 1131-1137). Mice were nasally immunized with a total of 25 μl containing either 105 pfu or 103 pfu of Vaccinia virus in 1% nanoemulsion (denoted 105/NE and 103/NE), 103 pfu or 105 pfu of formalin-killed virus mixed with 1% nanoemulsion (105/Fk/NE and 103/Fk/NE), or either 103 pfu or 105 pfu of formalin-killed virus in saline (105/Fk and 103/Fk). Antibody responses were characterized three weeks after initial vaccine administration (See FIG. 23). Immune responses were boosted with subsequent administrations (See FIG. 23).
Anti-VV IgG responses were detected in serum from mice vaccinated with a prime and single boost of either 105/NE or 105/Fk/NE (T=7 weeks after initial immunization). Mean anti-VV IgG concentrations were 1.5 μg/ml and 1 μg/ml, respectively. After a second booster immunization, at T=9 weeks, anti-VV antibody concentrations increased in all groups to varying degrees (FIG. 23), while at the conclusion of the experiment (T=16 weeks), the NE-killed virus administration of 103/NE and 105/NE, resulted in 45 μg/ml and 80 μg/ml VV-specific IgG, respectively. Mice immunized with 105/Fk/NE did not show increased antibody concentrations above 20 μg/ml, despite boost administration. Animals immunized with lower concentrations (103) of VV, whether NE or formalin inactivated, consistently produced lower levels of anti-VV antibodies that did not significantly boost after a the third vaccination.
Thus, in some embodiments, the present invention provides that an efficient IgG response results from a threshold level of antigenic viral proteins (e.g., present with or without an adjuvant). All animals administered a single dose of 105/NE had a significant (˜4 μg/ml) concentration of serum anti-VV IgG 10 to 12 weeks after vaccination. However, no detectable levels of anti-VV IgG were observed before the booster immunization. Thus, in some embodiments, a single administration of NE-killed VV is sufficient to initiate immune responses (e.g., mucosal or systemic immune responses). In further embodiments, immune responses (e.g., mucosal or systemic immune responses) are enhanced by subsequent administration (e.g., booster administrations) (See FIG. 23). No specific anti-VV antibodies were detected in control mice.
Additionally, administration of NE-killed VV produced anti-VV IgG antibodies capable of recognizing “native” viral epitopes. Briefly, sera from mice administered (e.g., vaccinated with) NE-killed VV recognize both formalin-crosslinked (non-native) and alcohol-fixed, not crosslinked (more “native”) viral protein epitopes. The sera have high reactivity to the native epitopes (e.g., similar to sera from mice exposed to live virus) (See FIG. 29). In contrast, sera from animals administered (e.g., vaccinated with) formalin-killed virus alone or mixed with NE, do not have increased specific reactivity toward native vaccine virus protein antigens (See FIG. 29).
Example 19 Subjects Administered Nanoemulsion-Killed Vaccinia Virus Possess Mucosal Immunity to Vaccinia VirusVV-specific secretory IgA antibodies were identified and characterized in bronchial lavages (BAL) to demonstrate mucosal humoral immunity. Anti-VV IgA (See FIG. 24) was detected in BAL from animals administered either 103/NE or 105/NE. Animals administered formulations containing formalin-killed virus alone, or mixed with saline or nanoemulsion, did not produce a measurable mucosal response, despite detectable levels of serum anti-VV IgG (See FIG. 24). Thus, the present invention provides that a composition comprising NE-killed VV generates mucosal immunity in a subject (e.g., as demonstrated by the presence of VV-specific secretory IgA antibodies in the BAL of the subject) whereas compositions that do not contain NE-killed VV (e.g., formalin-killed VV) are not capable of generating mucosal immunity to VV.
Example 20 Serum and Bronchial Alveolar Lavage (BAL) from Subjects Administered Nanoemulsion-Inactivated Vaccinia Virus Possess Virus-Neutralizing AntibodiesThe biological relevance of the anti-VV antibody responses observed in Example 18 was further characterized using virus neutralization assays. Neutralizing activity was detected in the serum of mice after a single administration of NE-killed VV (See FIG. 25A). Additionally, significant titers of neutralizing antibodies were detected in the serum of mice after two administrations with either 105/NE or 103/NE, and 105/Fk/NE (week seven, See FIG. 25A). The mean 50% inhibition titer (NT50) for each of these groups was ≧20. Subsequent administrations produced at least a ten fold increase in neutralizing titers, but only in mice immunized with 103/NE or 105/NE (NT50=180 and NT50=500, respectively). In contrast, animals vaccinated with either 103/Fk/NE, 103/Fk or 105/Fk minimum virus neutralizing activity detected only in the highest serum dilution (See FIG. 25). In addition, subsequent immunization with either 103/Fk/NE, 105/Fk/NE, 103/Fk or 105/Fk brought only a slight increase in the NT50. Vaccination with 103/NE resulted in the highest titer of neutralizing antibodies while producing lower levels of serum IgG comparable with 105/Fk/NE vaccine (See FIG. 25A)
Significant neutralizing activity was also detected in BAL fluids from mice vaccinated with either 103/NE or 105/NE, and was present in lower amounts in BAL from mice immunized with either 103/Fk/NE or 105/Fk/NE (See FIG. 25B). However, neutralization activity was absent in BAL of mice immunized with formalin-killed virus diluted in saline. No neutralizing activity was detected in the control, untreated animals. Thus, the present invention provides that despite inactivation (e.g. complete neutralization) of VV, nanoemulsions comprising inactivated VV of the present invention retain important immunogenic eptitopes (e.g., recognized and responded to by the immune system (e.g., humoral immune system) of a subject).
Example 21 Comparison of Response to Native VV-WR and VV-WR-LucVV-WR-Luc has identical surface proteins as the native strain, but expresses luciferase protein during infection. This allows for mortality assessment and monitoring of viral infection in challenged animals with imaging techniques. Comparison of antibodies in VV-WR immunized animals versus both viral strains either in ELISA, Western blot or virus neutralization assays showed no difference between VV-WR and VV-WR-Luc.
Example 22 Administration of NE-Killed VV Generates VV Specific Cellular Immune ResponsesVV-specific cellular immune responses in animals were demonstrated by VV-specific IFN-γ expression in splenocytes in vitro from animals immunized with either 103/NE or 105/NE. In contrast, VV-specific IFN-γ production was not observed in splenocytes from animals immunized with formaline-killed virus either with or without nanoemulsion (See FIG. 26).
Example 23 Presence of Replicating VV in Immunized AnimalsLive, infective VV is not present within subjects administered NE-killed VV. Two different methods were used to determine if any virus survived inactivation and replicated in animals after immunization. PCR amplification of 10 μg of lung DNA isolated from animals immunized with all of the vaccine formulations at 4 and 5 days after immunization did not result in detectable viral DNA by PCR (See FIG. 27A). A PCR control reaction containing 1 ng of purified VV DNA mixed with 1 μl control lung DNA resulted in amplification of product of the expected size (>950 bp, See FIG. 27A). Evidence of replicating virus in the VV/NE preparations was also tested in live mice using recombinant VVWR-Luc virus. Naive mice infected with 105/NE showed no evidence of virus amplification in image analysis (See FIG. 27B).
Example 24 Subjects Administered NE-Killed VV are Protected Against Challenge with Live, Infectious VVMice administered (e.g., vaccinated) with three doses of 105/NE and control animals (treated with saline or 1% NE) were challenged with LD10 (2×106 pfu) of live VV-WR-Luc. Body weight, and temperature were measured two times a day and animals were imaged for VV-WR-Luc luminescence once a day. All animals vaccinated with VV/NE vaccine survived challenge (See FIG. 28A). Imaging studies demonstrated that two of five VV/NE immunized mice exhibited minimally detectable virus replication, while the other three had more progressive replication that resolved within six days after administration. None of these animals had clinical evidence of infection (See FIG. 28B). In contrast, all non-vaccinated control animals became ill and died or were humanely euthanized within 4 to 7 days of virus challenge. These animals had massive virus replication with spreading throughout the nasopharyngeal passage, lung and abdomen (See FIG. 28C). The presence of self-limiting infection in some immunized mice correlated with the levels of neutralizing antibodies in the individual animals. Subsequent challenge with LD100 (2×107 pfu) of the VV-WR also resulted in survival of all animals previously administered (e.g., vaccinated with) 105/NE.
Additionally, live virus challenge (10×LD50) was performed on Balb/c mice intranasally vaccinated with VV/NE, VV/Fk/NE and VV/Fk vaccines (See FIG. 30). Briefly, groups of vaccinated and control mice were intranasally infected with 2×106 pfu of live vaccinia virus. Animals were monitored daily for 21 days and body temperature, weight and time of death were recorded. All (100%) of mice vaccinated with nanoemulsion-killed virus (VV/NE) survived viral challenge. Mice vaccinated with formalin-killed virus mixed with NE (VV/Fk/NE) and with formalin-killed virus (VV/Fk) had 40% and 20% survival rates, respectively. Vaccination with NE-based vaccine (VV/Fk/NE) also extended mean time till death (TTD) from 5 days to 7 days. None of control animals survived challenge.
Example 25 Compositions and Methods for Generating an Immune Response Toward Bacteria of the Genus Bacillus in a SubjectAnimals. Five to six week old, pathogen-free female BALB/c mice purchased from Charles River Laboratories were used for experiments.
Reagents. Recombinant B. anthracis protective antigen (rPA) was purchased from List Biological Laboratories, Inc. (Campbell, Calif.). The 26-mer oligonucleotide 5′-TGCATGACGTTCCGTTCGTG-3′ (SEQ ID NO.:5), containing three non-methylated CpG repeats, was synthesized by Integrated DNA Technologies (IDT, Coralville, Iowa). Cell culture media and serum were purchased from GIBCO (Grand Island, N.Y.) and HyClone (Logan, Utah), respectively. PHA-P, BSA, DTT and other chemicals used in buffers were purchased from Sigma-Aldrich Corporation (St. Louis, Mo.). The alkaline phosphatase (AP)-conjugated antibodies, goat anti-mouse IgG (whole molecule, #A-3562) and goat anti-mouse IgA (α chain specific, #A-4937) were purchased from Sigma (St. Louis, Mo.).
Preparation of the nanoemulsion (NE). The NE nanoemulsion used in these studies was prepared by a two-step procedure according to U.S. Pat. No. 6,015,832 issued to NanoBio Corporation (Ann Arbor, Mich.), herein incorporated by reference in its entirety. Briefly, an oil phase was obtained by blending tributyl phosphate (final concentration 8%), Triton X-100 (final concentration 8%) and soybean oil (final concentration 64%), and heating at 70° C. for 30 min. The nanoemulsion was formed by mixing the oil phase with water (20% volume) in a Silverstone Mixer L4RT for 3 min at 10,000 rpm. To prepare an antigen and nanoemulsion mix for the immunization experiments, a 10% solution of the nanoemulsion in saline was combined with the appropriate rPA solution to obtain a 1% final concentration of the emulsion. All samples were prepared 30 min to 1 hr before use, by vigorous mixing for 20 seconds using a vortex.
Nanoemusion size analysis. Nanoemulsion size was analyzed by dynamic light scattering (DLS), using a Zeta-Potentiometer/Particle Sizer, NICOMP 380 ZLS (PSS NICOMP Particle Sizing Systems, Santa Barbara, Calif.).
Microscopy. The photomicrographs were taken with an Olympus IX70 microscope with an 1×FLA inverted reflected fluorescence observation attachment. The images were processed using the SPOT imaging programs.
PAGE analysis of the recombinant PA. Western blotting and silver staining was performed using Invitrogen systems. Typically, 0.5 μg rPA protein was analyzed on 10% Nu PAGE Novex Bis-Tris gel (cat # NP0301BOX) using X Cell SureLock Mini-Cell platform for electrophoresis. Size of rPA protein was determined with molecular weight marker Mark12 (Invitrogen, cat# LC5677). The silver stain procedure followed the Invitrogen SilverXpress (cat # LC6100) method.
Immunization and experimental design. Mice were vaccinated intranasally with 50 μl of preparations containing 2.5 μg rPA or 30 μg rPA in combinations of 1% NE with or without 10 μg of the CpG oligonucleotide (PA/NE/CpG and PA/NE, respectively), a physiological solution of NaCl as a control (PA only), or with rPA and CpG (PA/CpG). For intranasal immunization, all animals were anaesthetized with Isoflurane, and held in an inverted position until droplets, delivered with a pipette tip at 25 μl per nare, were inhaled completely. Animals were immunized three and six times during a period of 16 or 22 weeks respectively.
Collection of blood, bronchial alveolar lavage (BAL) and splenocytes. Blood samples were obtained either from the saphenous vein, at various time points during the course of the trials, or by cardiac puncture from euthanized premorbid mice. Serum was obtained by separation of blood (coagulated 30-60 min, RT) by centrifugation at 1500 g for 5 min. Serum samples were stored at −20° C. until needed.
BAL fluid was obtained from mice sacrificed humanly by Isoflurane inhalation. After the trachea was dissected, a 22GA catheter (Angiocath, B-D) attached to a 1 ml syringe was inserted into the trachea. The lung was injected with 0.5 ml of PBS containing 10 μM DTT and 0.5 mg/ml aprotinin (protease inhibitors). Approximately 0.4-0.5 ml of aspirate was recovered with a syringe. This procedure was repeated twice with 0.5 ml of the same solution, and BAL samples were stored at −20° C. for further study.
Murine splenocytes were mechanically isolated from the spleens to obtain single cell suspension in PBS. The red blood cells (RBC) were removed by lysis with ACK buffer (150 mM NH4Cl, 10 mM KHCO3, 0.1 mM Na2EDTA) and the remaining cells were washed twice in PBS. For antigen-specific proliferation or cytokine expression assays, splenocytes (4×106/ml) were resuspended in RPMI 1640 medium, supplemented with FBS, L-glutamine, and penicillin/streptomycin, according to the manufacturer's specification.
Determination of specific anti-PA IgG and IgA. The PA-specific IgG and IgA levels were determined by ELISA. Microtiter plates (NUNC) were coated with 5 μg/ml (100 μl) of rPA in the coating buffer (50 mM sodium carbonate, 50 mM sodium bicarbonate, pH 9.6) and incubated either at 37° C. for 2 hrs or overnight at 4° C. After the protein solution was removed, plates were blocked for 30 min with PBS containing 1% dry milk. The blocking solution was aspirated and plates were used for immediate antibody detection, or stored sealed at 4° C. until needed. Serum and BAL samples were serially diluted in 0.1% BSA in PBS, and 100 μl/well aliquots were incubated in rPA coated plates for 1 hr at 37° C. Plates were washed three times with PBS-0.05% TWEEN 20, followed by 60 min incubation with either anti-mouse IgG or anti-mouse IgA alkaline phosphatase-conjugated antibodies (AP), than washed three times and incubated with alkaline phosphatase substrate Sigma Fast (Sigma, St. Louis, Mo.). The colorimetric reaction was stopped with 1 N NaOH according to the manufacturer's protocol and readouts were performed using Spectra Max 340 ELISA reader (Molecular Devices, Sunnyvale, Calif.) at 405 nm and the reference wavelength of 690 nm. The end-point titers were determined as the reciprocal of the highest dilution that had an absorbance of three times above negative control.
Evaluation of the PA-specific IgG subclass response. For determination of IgG subclass antibodies, 1:200 and 1:1000 dilutions of serum were analyzed by ELISA using a series of subclass-specific alkaline phosphatase conjugated rabbit antibodies. Anti-mouse IgG (H&L, 610-4502), anti-mouse IgG1 (γ1 chain, 610-4540), anti-mouse IgG2a (γ2a chain, 610-4541), anti-mouse IgG2b (γ2b chain, 610-4542), and anti-mouse IgG3 (γ3 chain, 610-4543) were purchased from Rockland, Inc. (Gilbertsville, Pa.). Spectrophotometric analysis was performed as described above.
Antigen neutralization assay. PA-specific inhibitory activity was determined by the ability of immunized animals' serum to prevent PA binding to cell surface PA-binding receptors. CHO-K1 cells, which abundantly express PA-binding receptors, were cultured in F12-K medium, supplemented with 10% FBS and penicillin-streptomycin, until 90% confluent (See, e.g., Escuyer and Collier, Infect Immun 1991; 59:3381-3386). Pooled sera from mice vaccinated with rPA/NE/CpG were diluted 1:100, 1:1000 1:10000 and 1:50000 in 100 μl of 10 pM rPA in PBS/0.1% BSA buffer, and incubated together with rPA for 30 min at RT. For receptor binding, 1×106 CHO-K1 cells were incubated with 10 pM rPA alone or with rPA protein preincubated with increasing dilutions of serum in PBS buffer, supplemented with 1 mM CaCl2 and 1 mM MgCl2. After 30 min at RT, cells were washed three times with ice cold PBS (1 mM Ca2+, 1 MM Mg2+, 0.1% BSA). Cellular receptor-bound PA was detected by incubation with a 1:200 dilution of polyclonal anti-PA antiserum from a single mouse, and subsequently with FITC-conjugated anti-mouse IgG antibody for flow cytometric analysis. Controls consisted of CHO-K1 cells without rPA, incubated with or without anti-PA serum, and incubated with an isotype control antibody. The concentration of PA bound with anti-PA antibody was calculated from a receptor binding curve obtained with 1 pM, 10 pM, and 100 pM solutions of rPA.
Western blot detection of immunoglobulins in serum and BAL. Western blots were used to detect specific anti-PA antibodies in either serum or BAL. Samples of 0.5 μg of rPA per well were separated by PAGE as described above. Following electrophoresis, proteins were transferred to a PVDF membrane according to the the manufacturer's protocol (Invitrogen Western Transfer Protocol) at 25 V for 90 min. The PVDF membrane was allowed to dry overnight and then soaked in methanol for 30 seconds. Following a PBST buffer (PBS and 0.1% TWEEN) wash, the membrane was blocked with 5% dry milk in buffer for one hour at RT. After another PBST wash, membranes were cut into strips to be used for anti-PA antibody detection. Separate strips were incubated for one hour at a 1:2000 dilution of serum in PBST buffer. After a PBST wash, the membrane strips were incubated with a 1:2000 dilution of goat anti-mouse IgA alkaline phosphatase-conjugated antibodies in PBST. After a final wash the PVDF blots were developed in a BCIP/NBT-Blue Liquid Substrate System for Membranes (Sigma, cat#B-3804). After the membrane was developed, the membrane was washed in milli-Q water.
Proliferation assay. The proliferation of mouse splenocytes was measured by an assay of 5-bromo-2-deoxyuridine (BrdU) incorporation using a commercially available labeling and detection kit (Cell Proliferation ELISA, Roche Molecular Biochemicals, Mannheim, Germany). In brief, the cells were incubated in the presence of rPA (5 μg/ml) or PHA-P mitogen (2 μg/ml) for 48 hrs and then pulsed with BrdU for 24 hr. Cell proliferation was measured according to manufacturer's instructions using a Spectra Max 340 ELISA Reader (Molecular Devices, Sunnyvale, Calif.) at 370 nm and reference wavelength of 492 nm.
Analysis of cytokine expression in vitro. Mouse splenocytes were seeded at 2×106 cells/0.5 ml (RPMI 1640, 2% FBS) and incubated with rPA (5 μg/ml) or PHA-P mitogen (2 μg/ml) for 72 hrs. Cell culture supernatants were harvested and analyzed for the presence of cytokines. IL-2, IL-4, IFN-γ and TNF-α cytokine assays were performed using QUANTIKINE ELISA kits (R&D Systems, Inc., Minneapolis, Minn.) according to the manufacturer's instructions.
Example 26 Characterization of the Recombinant PA (rPA) and Nanoemulsion (NE) Adjuvant MixData obtained from the NICOMP 380 Particle Sizer and from microscopic observation indicated that nanoemulsion (NE) used for immunizations comprise narrowly distributed vesicles with an average diameter of 500 nm (See FIGS. 31A and 31B). Addition of the rPA protein in saline solution did not have an effect on the size distribution or on the stability of the nanoemulsion (See FIG. 31C). Incubation of rPA with nanoemulsion did not appear to affect antigen structure. It appeared as a single discrete band on a non-denaturing PAGE representing an intact full length protein with a molecular weight of 83 kD (See FIG. 32). Importantly, NE appeared to improve the stability of rPA, which showed progressive degradation when incubated in a buffer solution (See FIG. 32A; and See, e.g., Gupta et al., FEBS Lett 2003; 554(3):505-510; Gupta et al., Biochem Biophys Res Commun 2003; 311:229-232).
Additionally, microphotographs of the 1% NE and rPA/1% NE mixture indicate that addition of protein into NE does not cause coalescing of the emulsion droplets (See FIG. 32B). Additional measurement using particle sizer indicated no change in the droplets size in the presence of rPA protein.
Example 27 Serum Anti-PA Antibody Titers in Animals Immunized Intranasally with an rPA VaccineThe serum antibody responses in a six dose schedule of intranasal vaccination with 30 μg of rPA administered over the course of 22 weeks was characterized during the development of the present invention. Recombinant PA was used either alone in saline (PA only), mixed with 1% nanoemulsion (PA/NE), mixed with 1% nanoemulsion and 10 μg CpG ODN (PA/NE/CpG), or with 10 μg CpG ODN in saline (PA/CpG). The CpG ODN was added to the nanoemulsion preparations because non-methylated CpG sequences are considered a potent inducer of innate immune responses (See, e.g., McCluskie et al., Vaccine. 2001; 19:2657-2660). CpG ODNs may also contribute to specific mucosal immunity for anthrax, since the bacilli and spores contain CpG-rich DNA. Nanoemulsion adjuvant alone lacks toxicity and does not result in the induction of immune response in experimental animals (See, e.g., Myc et al., Vaccine 2003; 21:3801-3814)
Initially, mice were immunized every three weeks. No IgG responses were detected in any group of animals after the prime and first boost vaccinations, when measured at three and five weeks after initiation of the trial. After a third vaccination, four out of five mice immunized with PA/NE/CpG, and one animal immunized with PA/NE became seropositive for anti-PA IgG. In contrast, no antibody responses were detected in mice immunized either with PA alone (in NaCl) or with PA/CpG. The difference between mean anti-PA IgG levels in the PA/NE and PA/NE/CpG groups disappeared after the fourth vaccination. In both groups, all animals were highly seropositive and displayed similar high levels of anti-PA IgG antibodies during the remainder of the experiment (See FIG. 33A). In animals vaccinated with PA alone and PA/CpG, a single positive responder was detected in each group of animals only after a sixth vaccination at 21 weeks (See FIG. 33A).
Induction of specific immune responses with lower doses of rPA in adjuvant were also evaluated. Mice were vaccinated with 2.5 μg of rPA, used either alone in saline (PA only), mixed with 1% nanoemulsion (PA/NE), mixed with 1% nanoemulsion and 10 μg CpG ODN (PA/NE/CpG), or with 10 μg CpG ODN in saline (PA/CpG), administered in three doses over a 16-week trial. There was no detectable anti-PA IgG in serum after two vaccinations. Mice from the PA/NE and PA/NE/CpG groups became PA-seropositive after three doses, while none of the animals from the PA only or the PA/CpG group developed immune responses. The presence of CpG ODN in addition to NE seemed to enhance the anti-PA response in the low dose PA vaccination (See FIG. 33B). The specific anti-PA IgG antibody levels in serum at 16 weeks were higher for the 30 μg than for the 2.5 μg dose of rPA. At the end of experiments, the mean serum anti-PA IgG titer in animals vaccinated with either 30 μg PA/NE or PA/NE/CpG reached 2.5×105, while it was two orders of magnitude lower for the 2.5 μg dose of rPA protein in the same adjuvant formulations (See FIGS. 34A and 34B). The pattern of immune responses indicated that nanoemulsion is critical (e.g., as an adjuvant) for the development of systemic humoral responses after intranasal vaccination. Addition of CpG ODN resulted in a more consistent distribution of anti-PA IgG levels in animals but generally did not increase final antibody titers (See FIGS. 35A and 35B).
Mucosal immunization with rPA and nanoemulsion adjuvant resulted in a pattern of IgG subclass responses characterized by high levels of serum IgG1, and an order of magnitude lower levels of IgG2a and IgG2b, with almost no detectable IgG3 (See FIG. 36). Examining the pattern of IgG2 and IgG3 subclass antibodies revealed that PA-specific IgG2a and IgG2b are significantly higher in animals immunized with PA/NE and PA/NE/CpG, than in single positive responders from groups immunized with PA alone or PA/CpG. Levels of IgG3 antibodies were very low and similar for all groups of animals.
Anti-PA IgG titer distributions were characterized after single doses of rPA/NE with various TWEEN derivatives. First, the effect of TWEEN derivatives on immunogenicity kinetics was analyzed (See FIG. 41). For example, NEs W205EC, W205S201EC, W605EC and W805EC were all tested for the ability to generate anti-PA titers. Anti-PA IgG titers in PA/W805EC reached >104 titers at three weeks after a single vaccination. Futhermore, animals vaccinated with PA in 20% TWEEN 80 (6 μl) NE display elevated IgG titers with a tight distribution after just one dose (See. FIG. 42).
Additionally, the kinetics of anti-PA IgG development in guinea pigs intranasaly immunized with a rPA/NE vaccine was characterized (See FIG. 43). Female Hartley guinea pigs were intranasaly vaccinated with two doses (prime and at 4 weeks) of various doses of rPA (10, 50 and 100 μg) mixed with 1% W205EC NE (100 μl). The anti-PA IgG levels in serum were measured at 3 weeks (after single vaccination) and at 2 to 3 week intervals after booster vaccination over a six month period.
Example 28 Administration of a Composition Comprising rPA and Nanoemulsion Induces PA-Specific Secretory IgA AntibodiesNasal immunization is considered the a reliable route for the induction of mucosal immunity and for protection of the mucosal membrane against pathogen infection (See, e.g., McGhee et al., Mucosal vaccines: an overview. In: Orgra et al., editors. Mucosal Immunology. San Diego, Academic Press, 1999: 741-757; Davis, Advanced Drug Delivery Reviews 2001; 51:21-42; Zuercher, Viral Immunology 2003; 16:279-289). Analysis of bronchial lavage samples (BAL) obtained from vaccinated animals demonstrated significant levels of PA-specific secretory IgA antibodies only in BALs from animals vaccinated with PA/NE and PA/NE/CpG (See FIG. 37A). Similar results were obtained for the secretory anti-PA IgG antibodies present in BAL (See FIG. 37B). Thus, the present invention demonstrates that significant mucosal responses to PA (e.g., characterized by secretion of both IgA and IgG antibodies) are only induced with a composition (e.g., a vaccine) comprising rPA and NE (e.g., as an adjuvant).
ELISA results were confirmed and expanded by detection of anti-PA IgA using Western blot. Only one of the animals vaccinated intranasally with PA alone and none with PA/CpG had detectable levels of BAL secretory anti-PA IgA. The inclusion of CpG ODNs into the vaccine did not increase IgA levels in BAL. Animals with a high titer of the secretory IgA in BAL also displayed substantial levels of anti-PA IgA in serum, as shown by Western blot (See FIG. 37C). Control animals immunized with intramuscular injections of the same rPA and nanoemulsion adjuvant formulations did not develop anti-PA IgA antibodies in mucosal secretions or serum, despite robust immune response characterized by significant levels of anti-PA IgG antibodies in serum. Thus, the present invention also demonstrates that a composition comprising rPA and NE can induce mucosal immunity against PA antigen (e.g., as evidenced by significant levels of anti-PA IgA antibodies in mucosal secretions) if administered intranasally.
Example 29 PA Neutralizing Antibodies in Serum and Protection from Lethal Dose ChallengeIt was next determined whether serum from mice immunized intranasally with PA/NE/CpG had the ability to neutralize PA and prevent its binding to the anthrax toxin receptor (ATR) (See, e.g., Bradley et al., Nature 2001; 414:225-229). Pre-incubation of rPA with serial dilutions of serum from immunized animals resulted in a significant lowering of the binding of PA with the ATR receptor in a concentration-dependent manner (See FIG. 38). Inhibition of receptor binding indicated considerable concentrations of PA-neutralizing antibodies in the serum. For example, at 1:10,000 to 1:100 dilutions, levels of anti-PA antibodies in the serum were capable of neutralizing (e.g., inhibiting the binding of PA to the ATR receptor) between 50% and 80% of the rPA in the 10 pM solution used for the assay (See FIG. 38).
Additionally, lethal toxin (LT) cytotoxicity and neutralization antibody assays were performed (See FIG. 38B). Specifically, the cytotoxic concentration range of LT was established using a RAW264.7 mouse macrophage cell line. Briefly, triplicates of 20,000-30,000 cells/well in 96 well plates were incubated with increasing concentrations of PA and LF, each ranging from 0.1 mg/ml to 1 mg/ml for four hours at 37° C. PA or LF alone was not cytotoxic to cells in the entire range of concentrations. The cell viability was determined using XTT assay. Neutralizing antibody assay was performed using serial dilutions of pooled sera incubated for 30 minutes with LT (consisting of 0.5 mg/ml PA and 0.3 mg/ml LT in PBS). The antibody-toxin mixtures were then added to RAW264.7 and incubated for 4 to 6 hours at 37° C. Cell viability was assessed with XTT assay as above. The serum dilution resulting in 50% protection against LT cytotoxicity (neutralizing concentration NC50) was calculated from the cell viability curves (See FIG. 38B).
Furthermore, the ability of guinea pigs nasaly immunized with rPA/NE to survive challenge with 1000×LD50 of B. anthracis Ames spores six months after immunization was determined. As shown in FIG. 38C, all immunized guinea pigs survived lethal challenge, whereas control (not-immunized) animals died within 96 hours after injection.
Example 30 Generation of Specific Cellular Immune Responses in Mice Immunized with a Composition Comprising rPA and NanoemulsionMost studies on anthrax immunity concentrate on the humoral responses and protection against lethal challenge with the pathogen (See, e.g., Reuveny et al., Infect Immun 2001; 69:2888-2893; McBride et al., Vaccine 1998; 16:801-817). Data collected during the development of the present invention also included an assessment of the antigen specificity and type of cellular immune response induced by mucosal administration of a composition comprising rPA and nanoemulsion (e.g., used as an adjuvant). Antigen-specific cellular responses were measured using a proliferation assay (See FIG. 39) and by analyzing cytokine secretion from splenocytes stimulated in vitro with rPA (See FIG. 40). Splenocytes were harvested from animals 22 weeks after initial mucosal immunizations. Cells were either incubated alone or with 5 μg/ml of rPA protein. rPA protein only stimulated proliferation of splenocytes obtained from mice immunized with the PA/NE and PA/NE/CpG vaccines (See FIG. 39). There was no statistical difference in the proliferation index between these two groups.
In contrast, no antigen-specific proliferation was detected in splenocytes from animals immunized with rPA alone or rPA with CpG ODNs. Control non-stimulated (resting) cells secreted low levels of detectable cytokines, but the PA-activated spleen cells showed marked expression of INF-γ, TNF-α, and IL-2, but a lack of IL-4 secretion. This suggested that immunization with PA/NE and PA/NE/CpG yielded Th1-type responses (See FIGS. 40A, 40B, 40C and 40D). As a control, splenocyte cultures were incubated with PHA, known in the art to induce significant proliferation and secretion of both Th1 and Th2 cytokines. Thus, the present invention demonstrates that nasal administration of a composition comprising rPA and NE (e.g., used as an adjuvant) induces systemic immunity against PA antigen (e.g., as evidenced by expansion of spenocytes (e.g., B cells, T cells, and antigen presenting cells) when challenged in vitro with rPA), and further, that the immune response generated is skewed toward a Th1-type response.
Example 31 Compositions and Methods for Generating an Immune Response Toward HIV in a SubjectAnimals. Five to six week old, pathogen-free female BALB/c mice and female Hartley guinea pigs were used (Charles River Laboratories). Mice and guinea pigs were housed in accordance with the American Association for Accreditation of Laboratory Animal Care standards. Mice were housed five to a cage. Guinea pigs were housed one per cage. All procedures involving animals were performed according to the University Committee on Use and Care of Animals (UCUCA) at the University of Michigan.
Reagents. Recombinant HIV gp120 BAL and SF162 proteins and V3 loop peptide produced in yeast were obtained from Dr. David Markovitz (University of Michigan). The 20-mer oligonucleotide 5′-TGC ATG ACG TTC CGT TCG TG-3′ (SEQ ID NO.:6), containing three non-methylated CpG repeats, was purchased from Integrated DNA Technologies (IDT, Coralville, Iowa). Cell culture media and serum were purchased from GIBCO (Grand Island, N.Y.) and HyClone (Logan, Utah), respectively. MPL A PHA-P, BSA, DTT and other chemicals used in buffers were purchased from Sigma-Aldrich Corporation (St. Louis, Mo.). Alkaline phosphatase (AP)-conjugated antibodies, goat anti-mouse IgG (whole molecule, #A-3562) and goat anti-mouse IgA (a chain specific, #A-4937) were purchased from Sigma (St. Louis, Mo.).
Preparation of the nanoemulsion. Nanoemulsion (NE) used in these studies was prepared by a two-step procedure described (See, U.S. Pat. No. 6,015,832, to NanoBio Corporation, Ann Arbor, Mich., hereby incorporated by reference in its entirety for all purposes. Antigen/nanoemulsion mix was prepared by combining a 10% solution of NE in saline with gp120 protein solution to obtain a 0.1%, 0.5% and 1% final concentration of the adjuvant. All samples were prepared 30 min to 1 hr before use, by vigorous mixing for 20 seconds using a vortex.
Mice immunization and experimental design. Mice were vaccinated intranasally using a prime-boost regiment with preparations containing 20 μg gp120 of BaL or SF162 serotypes mixed with various concentrations of NE (from 0.1% to 2%). The effect of co-administration of CpG oligonucleotide or monophosphoryl lipid A (MPLA) were tested by adding 10 μg and 5 μg, respectively, to the antigen/nanoemulsion mix. gp120 in a physiological solution of NaCl (gp120/saline) was used as a control. For intranasal immunization, all animals were anaesthetized with Isoflurane, and held in an inverted position until droplets, delivered with a pipette tip at 25 μl per nare, were inhaled completely. Serum samples were collected from test bleeds on weeks 0, 3, 6, and 8 postimmunization.
Guinea pig immunizations. Three guinea pigs were inoculated intranasally with 100 μl of gp120 BaL (50 μg) mixed with 1% nanoemulsion in a prime-boost regiment. Serum samples were collected from test bleeds on weeks 0, 2, 6, and 8 postimmunization for the determination of anti-gp120 IgG, IgA and neutralizing antibody levels.
Collection of blood, bronchial alveolar lavage (BAL) and splenocytes. Blood samples were obtained either from the saphenous vein at various time points during the course of the trials, or by cardiac puncture from euthanized premorbid mice. Serum was obtained (coagulated 30-60 min, RT) by blood centrifugation at 1500 g for 5 min. Serum samples were heat inactived (56° C., 1 h) and stored at −20° C. until analyzed.
Mice BAL fluid was obtained from animals sacrificed humanely by inhalation of Isoflurane. The lung was injected with 0.5 ml of PBS with 10 μM DTT and 0.5 mg/ml aprotinin. The procedure was repeated twice with 0.5 ml of the same solution and resulted in approximately 1 ml of fluid. BAL samples were stored at −20° C. for further study.
Murine splenocytes were mechanically isolated from the spleens to obtain single cell suspension in PBS. The red blood cells (RBC) were removed by lysis with ACK buffer (150 mM NH4Cl, 10 mM KHCO3, 0.1 mM Na2EDTA) and the remaining cells washed twice in PBS. For antigen-specific proliferation or cytokine expression assays, splenocytes (2-3×106/ml) were resuspended in RPMI 1640 medium, supplemented with FBS, L-glutamine, and penicillin/streptomycin, according to the manufacturer's specification.
Determination of specific anti-gp120 IgG and IgA. gp120-specific IgG and IgA levels were determined by ELISA. High-protein-binding-capacity microtiter plates (MaxiSorp; Nalge Nunc International, Rochester, N.Y.) were coated with 3-5 μg/ml (100 μl) of gp120 in PBS. Serum and BAL samples were serially diluted in 0.1% BSA in PBS, and 100 μl/well aliquots were incubated in gp120 coated plates for 1 hr at 37° C. followed by three washes. Primary antibody detection with either anti-mouse IgG, anti guinea-pig IgG or anti-mouse IgA alkaline phosphatase-conjugated antibodies (AP) was performed by reaction with alkaline phosphatase substrate SIGMA FAST (Sigma, St. Louis, Mo.) according to the manufacturer's protocol. Readouts were performed using a Spectra Max 340 ELISA reader (Molecular Devices, Sunnyvale, Calif.) at 405 nm and reference wavelength of 690 nm. Endpoint antibody titers were defined as the last reciprocal serial serum dilution at which the absorption at 405 nm was greater than two times absorbance above negative control.
HIV-1 single-round neutralization assay. Neutralization was measured as a function of the reduction in luciferase reporter gene expression after a single round of virus infection in TZM-b1 cells as described previously (See, e.g., Montefiori et al 2004). TZM-b1 cells are engineered to express CD4 and CCR5 and contain integrated reporter genes for firefly luciferase and E. coli β-galactosidase under control of an HIV-1 LTR. Primary HIV-1 isolates (TCID50, 100 to 200) were incubated in triplicate with serial dilutions of sera for 1 hour at 37° C. Subsequently, virus/serum mixtures were added to the 96-well flat-bottom culture plate containing adherent TZM-b1 cells. Controls comprised cells plus virus (virus control), and cells only (background control). Bioluminescence was measured after 48 h using BRIGHT GLO substrate solution as described by the supplier (Promega, Madison, Wis.). Neutralization titers are the dilutions at which relative light units (RLU) were reduced by 50% compared to those of virus control wells after subtraction of background RLUs.
PAGE analysis of the recombinant gp120. Western blots and silver stained gels were performed using Invitrogen systems. Typically, 0.5 μg gp120 protein was analyzed on 10% Nu PAGE Novex Bis-Tris gel (cat # NP0301BOX) using X Cell SURELOCK Mini-Cell platform for electrophoresis. Silver staining (Invitrogen SilverXpress, cat # LC6100) was used for the visualization of proteins.
Western blot detection of immunoglobulins in serum. Western blots were used to detect specific anti-gp120 antibodies in serum. Samples of 0.5 μg of gp120 per well were separated by PAGE as described above. Following electrophoresis, the proteins were transferred to a PVDF membrane according to the Invitrogen Western Transfer Protocol at 25 V for 90 min. The PVDF membrane was allowed to dry overnight and then soaked in methanol for 30 seconds. Following a PBST buffer (PBS and 0.1% TWEEN) wash, the membrane was blocked with 5% dry milk in buffer for one hour at RT. After another PBST wash, membranes were cut into strips to be used for anti-gp120 antibody detection. Separate strips were incubated for one hour at a 1:2000 dilution of serum in PBST buffer. After a PBST wash, the membrane strips were incubated with a 1:2000 dilution of goat anti-guinea pig IgG alkaline phosphatase-conjugated antibodies in PBST. After a final wash the PVDF blots were developed in a BCIP/NBT-Blue Liquid Substrate System for Membranes (Sigma, cat#B-3804).
Proliferation assay. The proliferation of mouse splenocytes was measured by an assay of 5-bromo-2-deoxyuridine (BrdU) incorporation using a commercially available labeling and detection kit (Cell Proliferation ELISA, Roche Molecular Biochemicals, Mannheim, Germany). In brief, cells were incubated in the presence of gp120 BaL (5 μg/ml) or as control PHA-P mitogen (2 μg/ml) for 48 hrs and then pulsed with BrdU for 24 hr. Cell proliferation was measured according to the manufacturer's instructions using Spectra Max 340 ELISA Reader (Molecular Devices, Sunnyvale, Calif.) at 370 nm and reference wavelength of 492 nm.
Analysis of cytokine expression in vitro. Mouse splenocytes were seeded at 2-4×106 cells/0.5 ml (RPMI 1640, 2% FBS) and incubated with gp120 BaL or V3 loop peptide (20 nM, gift from dr. Steven King)) or PHA-P mitogen (2 μg/ml) for 72 hrs. Cell culture supernatants were harvested and analyzed for the presence of cytokines. IFN-γ cytokine assays were performed using QUANTIKINE ELISA kits (R&D Systems, Inc., Minneapolis, Minn.) according to the manufacturer's instructions.
Statistical Analysis. Statistical analysis of results was preformed using ANOVA, and Student's T-test for the determination ofp values.
Example 32 Development of Humoral Immune Responses in Mice Administered Recombinant gp120 and Nanoemulsion AdjuvantMice were intranasally administered either gp120Bal or gp120SF162 as described in Example 1, above. Induction of anti-gp120BaL IgG in Balb/c mice immunized with gp120BaL mixed with 0.1%, 0.5% and 1% nanoemulsion (X8P) is shown in FIG. 44A. Levels of anti-gp120 antibodies were measured at 6 weeks (after two doses) and 12 weeks (after three doses) and are presented as log10 of the average reciprocal titers (+/−sem) in serum of individual animals. FIG. 44B shows induction of anti-gp120SF162 IgG in mice immunized with two doses of gp120 SF162 in 1% NE (W205EC) alone or with addition of CpG or MPL A. Anti-gp120 SF162 IgG concentrations at 7 weeks after primary immunization were calculated according to standard curve and are presented as a mean value of the individual sera+/−sem.
Example 33 Antibodies Generated Against One Serotype of gp120 Cross-React with Other gp120 SerotypesCross-reactivity of anti-gp120 antibodies after intranasal administration of a nanoemulsion based-compound of the present invention is shown in FIGS. 45A and 45B. Serum IgG from mice vaccinated with either (A) gp120BaL-X8P or (B) gp120SF162-W205EC reacts with both a homologous and with a heterologous serotype of antigen used in ELISA. The antibody determination was performed as in (FIG. 44A) for gp120BaL/NE (X8P) administration and as in (FIG. 44B) for gp120SF162/NE (W205EC) administration.
Example 34 Nasal Administration of gp120/Nanoemulsion Generates Anti-gp120 Specific IgA Antibodies Detectable in Bronchial and Vaginal Mucosal SurfacesDetectable levels of anti-gp120 specific, secretory IgA antibodies were detected (A) in bronchial lavage (BAL) and (B) in the vaginal washes of mice administered gp120BaL and NE adjuvant (X8P) (See FIGS. 46A and 46B, respectively). Anti-gp120 IgA concentration in BAL was calculated using a standard curve and is presented as a mean of individual lavages+/−sem. Presence of anti-gp120 IgA in vaginal washes is shown as a mean absorption (OD 405 nm, +/−sem) of individual samples. Statistically significant difference was observed between gp120/saline and all gp120/NE groups (p<0.05).
Example 35 Antigen-Specific Splenocytes Proliferate Following Intranasal Administration of gp120BaL in NanoemulsionAntigen-specific splenocyte proliferation was observed following intranasal administration of gp120BaL in nanoemulsion (See FIG. 47). Splenocytes from mice administered gp120BaL in nanoemulsion or controls were activated with 2 mg/ml of homologous and heterologous gp120 (BaL and SF162, respectively) and with 20 mM of the V3 loop peptide. Released IFN-γ was determined by ELISA with concentration presented as a mean of individual samples+/−sem.
Splenocytes from animals were stimulated in vitro with 2 μg/ml of homologous recombinant gp120BaL. Cell proliferation was normalized to controls and presented as mean+/−sem of individual proliferation indexes (See FIG. 47B). The differences between the gp120/saline group and the gp120/nanoemulsion groups were all statistically significant (p<0.05).
Example 36 Guinea Pig Mucosal Immunization ModelHartly guinea pigs were vaccinated in a prime-boost schedule with 50 μg gp120SF162 in 1% nanoemulsion (W205EC). Serum IgG antibody responses toward SF162 and BaL serotypes were generated and measured at six weeks. Anti-gp120 IgG are presented as absorption values (OD 405 nm, +/−sem) obtained in ELISA using 1:200 dilution of serum (See, FIG. 48).
Example 37 Neutralization of HIV Virus in Terms of ID 50 ValuesGuinea pigs were nasally administered SF-162/W205 EC. Neutralization of the laboratory amplified strains and the primary isolates of HIV was performed in M7-Luc cells (See, e.g., Montefiori et al 2004). ID50 values represent the serum dilution at which relative luminescence units (RLU) were reduced 50% compared to virus control (See FIG. 49). Pre-immune sera were used to evaluate non-specific antiviral activity.
All publications and patents mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described compositions and methods of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the relevant fields are intended to be within the scope of the present invention.
1. A method of inducing an immune response to an immunogen, comprising:
a) providing:
(i) a nanoemulsion; and
(ii) an immunogen;
b) combining said emulsion with said immunogen; and
c) administering said combined emulsion and immunogen to a subject under conditions such that said subject produces an immune response to said immunogen.
2. The method of claim 1, wherein said immunogen is a pathogen.
3. The method of claim 2, wherein said pathogen comprises an inactivated pathogen.
4. The method of claim 1, wherein said immunogen comprises a pathogen product.
5. The method of claim 1, wherein said administering comprises contacting said combined nanoemulsion and immunogen with a mucosal surface of said subject.
6. The method of claim 1, wherein said administering comprises intranasal administration.
7. The method of claim 1, wherein said nanoemulsion comprises an aqueous phase, an oil phase, and a solvent.
8. The method of claim 1, wherein said immunogen is selected from the group consisting of virus, bacteria, fungus and pathogen products derived from said virus, bacteria, or fungus.
9. The method of claim 8, wherein said virus is selected from the group consisting of influenza A virus, avian influenza virus, H5N1 influenza virus, West Nile virus, SARS virus, Marburg virus, Arenaviruses, Nipah virus, alphaviruses, filoviruses, herpes simplex virus I, herpes simplex virus II, sendai virus, sindbis virus, vaccinia virus, parvovirus, human immunodeficiency virus, hepatitis B virus, hepatitis C virus, hepatitis A virus, cytomegalovirus, human papilloma virus, picornavirus, hantavirus, junin virus, and ebola virus.
10. The method of claim 8, wherein said bacteria is selected from the group consisting of Bacillus cereus, Bacillus circulans and Bacillus megaterium, Bacillus anthracis, bacterial of the genus Brucella, Vibrio cholera, Coxiella burnetii, Francisella tularensis, Chlamydia psittaci, Ricinus communis, Rickettsia prowazekii, bacteria of the genus Salmonella, Cryptosporidium parvum, Burkholderia pseudomallei, Clostridium perfringens, Clostridium botulinum, Vibrio cholerae, Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus pneumonia, Staphylococcus aureus, Neisseria gonorrhea, Haemophilus influenzae, Escherichia coli, Salmonella typhimurium, Shigella dysenteriae, Proteus mirabilis, Pseudomonas aeruginosa, Yersinia pestis, Yersinia enterocolitica, and Yersinia pseudotuberculosis.
11. The method of claim 1, wherein said immune response comprises increased expression of IFN-γ in said subject.
12. The method of claim 1, wherein said immune response comprises a systemic IgG response to said immunogen.
13. The method of claim 1, wherein said immune response comprises a mucosal IgA response to said immunogen.
14. The method of claim 1, wherein said immunity protects said subject from displaying signs or symptoms of disease, wherein said disease is selected from the group consisting of AIDS, smallpox and anthrax.
15. A composition comprising a vaccine, said vaccine comprising a nanoemulsion and an immunogen, wherein said vaccine is configured to induce immunity to said immunogen in a subject.
16. The composition of claim 15, wherein said immunogen is selected from the group consisting of virus, bacteria, fungus and pathogen products derived from said virus, bacteria, or fungus.
17. The method of claim 16, wherein said virus is selected from the group consisting of influenza A virus, avian influenza virus, H5N1 influenza virus, West Nile virus, SARS virus, Marburg virus, Arenaviruses, Nipah virus, alphaviruses, filoviruses, herpes simplex virus I, herpes simplex virus II, sendai virus, sindbis virus, vaccinia virus, parvovirus, human immunodeficiency virus, hepatitis B virus, hepatitis C virus, hepatitis A virus, cytomegalovirus, human papilloma virus, picornavirus, hantavirus, junin virus, and ebola virus.
18. The method of claim 16, wherein said bacteria is selected from the group consisting of Bacillus cereus, Bacillus circulans and Bacillus megaterium, Bacillus anthracis, bacterial of the genus Brucella, Vibrio cholera, Coxiella burnetii, Francisella tularensis, Chlamydia psittaci, Ricinus communis, Rickettsia prowazekii, bacteria of the genus Salmonella, Cryptosporidium parvum, Burkholderia pseudomallei, Clostridium perfringens, Clostridium botulinum, Vibrio cholerae, Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus pneumonia, Staphylococcus aureus, Neisseria gonorrhea, Haemophilus influenzae, Escherichia coli, Salmonella typhimurium, Shigella dysenteriae, Proteus mirabilis, Pseudomonas aeruginosa, Yersinia pestis, Yersinia enterocolitica, and Yersinia pseudotuberculosis.
19. A kit comprising a composition for inducing an immune response, said composition comprising a nanoemulsion and an immunogen, wherein said composition is configured to induce immunity to said immunogen in a subject.
20. The kit of claim 19, further comprising instructions for using said kit for vaccinating a subject against said immunogen.