Patent application title:

Vector for transformation of

Publication number:

US20060286650A1

Publication date:
Application number:

11/413,141

Filed date:

2006-04-28

✅ Patent granted

Patent number:

US 7,759,097 B2

Grant date:

2010-07-20

PCT filing:

-

PCT publication:

-

Examiner:

Maria Marvich

Adjusted expiration:

2026-11-21

Abstract:

An object of the present invention is to provide a transformation system for Labyrinthulomycota that allows the elucidation of biosynthetic mechanisms of lipids such as PUFA and carotenoids as well as for the construction of a high production system and the design and development of novel functional lipid molecules by the control of the mechanisms. The present invention provides a vector for the transformation of Labyrinthulomycota with a transgene, which comprises at least (1) a nucleotide sequence which is homologous to a part of chromosomal DNA of Labyrinthulomycota and is capable of homologous recombination with the chromosomal DNA, (2) a selection marker gene having a promoter sequence located upstream and a terminator sequence located downstream, and (3) a cloning site for transgene insertion having a promoter sequence located upstream and a terminator sequence located downstream.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12P7/6463 »  CPC main

Preparation of oxygen-containing organic compounds; Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats; Fatty acid esters; Glycerides obtained from glyceride producing microorganisms, e.g. single cell oil

C12N15/79 »  CPC further

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression Vectors or expression systems specially adapted for eukaryotic hosts

C12P7/6409 »  CPC further

Preparation of oxygen-containing organic compounds; Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats Fatty acids

C12N15/74 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora

C12P7/64 IPC

Preparation of oxygen-containing organic compounds Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats

C12N15/00 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor

C12N15/09 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor Recombinant DNA-technology

C12N15/11 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology DNA or RNA fragments; Modified forms thereof

Description

TECHNICAL FIELD

The present invention relates to a vector capable for the transformation of Labyrinthulomycota and to a cell of Labyrinthulomycota transformed with the vector.

BACKGROUND ART

Labyrinthulomycota is a group of eukaryotic single-cell microorganisms widely distributed in the ocean, and is classified in stramenopile (Kingdom Chromista, Heterokontae) having flagella of unequal length. This organism is an oil-containing microorganism that accumulates therein C22 polyunsaturated fatty acid (PUFA) such as docosahexaenoic acid (DHA) known as a functional food ingredient, and has therefore received attention as a source of single cell oil. The single cell oils are lipids produced by microorganisms. Lipids produced by microorganisms include special one not contained in oil-containing plants and in animal fats and oils and one having different composition. Therefore, these lipids are expected to be applied as novel lipid resources to pharmaceutical drugs, functional foods, feed, and the like. Examples of characteristics of microorganism fats and oils include, in addition to its peculiarity different from animal and plant fats and oils as described above, high productivity resulting from rapid proliferation, and ease of breeding of microorganism strains suitable for specific fats and oils production. The oil-containing microorganisms include Mucor and Mortierella filamentous fungi as γ-linolenic acid (C18:3)-producing microorganisms as well as Mortierella filamentous fungi as arachidonic acid (C20:4)-producing microorganisms. The γ-linolenic acid production using the microorganisms has already been put in industrial use. Because C22 fatty acids such as DHA grow in demand by the discovery of a variety of its high physiological functions and one of microorganism species of Labyrinthulomycota has a characteristic of producing PUFA as well as carotenoids such as astaxanthin exhibiting similar high physiological functions, which is not seen in existing biological resources, the development of production systems of these functional lipids using Labyrinthulomycota and systems effectively using the functional lipids as microorganism feed has been demanded. However, production mechanisms of PUFA and carotenoid, which are key factors in the development of the production system such as the optimization of culture conditions or molecular breeding, remain unexplained. Particularly, synthetic pathways of DHA in microorganisms of Labyrinthulomycota have not been elucidated.

In Japanese Patent No. 2764572, Japanese Patent Publication (Kokai) No. 2003-189846A (2003), and Molecular Biology of the Gene, Watson et al., Chapter 19, p. 595-620, Toppan, microorganisms known to accumulate polyunsaturated fatty acid including docosahexaenoic acid and other unsaturated fatty acids or carotenoid in the bodies have been explored diligently, and Labyrinthulomycota with high productivity has been found from among a number of microorganism groups. However, the productivity of polyunsaturated fatty acid and carotenoid by these microorganisms of Labyrinthulomycota disclosed therein is less than sufficient.

DISCLOSURE OF THE INVENTION

The development of transformation systems for Labyrinthulomycota provides for gene disruption and the elucidation of synthetic pathways of DHA in Labyrinthulomycota. This solves problems as described above and also leads to the elucidation of biosynthetic mechanisms of carotenoid. Moreover, molecular breeding by this microorganism is also accomplished, leading to the development of production systems of a variety of functional lipids. Moreover, if a gene involved in the biosynthesis of DHA or carotenoid is isolated from such a microorganism, novel sources of DHA and carotenoid can be provided by introducing the gene into other microorganisms, plants, and the like. Phaeophyceae, Bacillariophyta, Oomycetes; and so on belong to the same stramenopile, and transformation systems for a few species of these microorganisms have already been developed. However, transformation systems for Labyrinthulomycota have not been developed at all. Thus, an object of the present invention is to provide a transformation system for Labyrinthulomycota that allows the elucidation of biosynthetic mechanisms of lipids such as PUFA and carotenoids as well as for the construction of a high production system and the design and development of novel functional lipid molecules by the control of the mechanisms. Namely, a problem to be solved by the present invention is to provide a vector capable for the transformation of Labyrinthulomycota by introducing an foreign gene into it. A further problem to be solved by the present invention is to provide a cell of Labyrinthulomycota transformed with the vector.

The present inventors have conducted diligent studies for solving the problems and have successfully constructed a vector capable for the transformation of Labyrinthulomycota with a foreign gene introduced for improving the ability of Labyrinthulomycota to produce useful substances, thereby completing the present invention.

Thus, the present invention provides a vector for the transformation of Labyrinthulomycota with a transgene, which comprises at least (1) a nucleotide sequence which is homologous to a part of chromosomal DNA of Labyrinthulomycota and is capable of homologous recombination with the chromosomal DNA, (2) a selection marker gene having a promoter sequence located upstream and a terminator sequence located downstream, and (3) a cloning site for transgene insertion having a promoter sequence located upstream and a terminator sequence located downstream.

Preferably, the nucleotide sequence which is homologous to a part of chromosomal DNA of Labyrinthulomycota and is capable of homologous recombination with the chromosomal DNA is an 18S rRNA gene sequence of Labyrinthulomycota.

Preferably, the nucleotide sequence which is homologous to a part of chromosomal DNA of Labyrinthulomycota and is capable of homologous recombination with the chromosomal DNA is a nucleotide sequence of 18S rRNA of Schizochytrium sp CB15-5 described in SEQ ID NO:1.

Preferably, the selection marker is a drug resistance gene.

Preferably, the selection marker is a Zeocin (bleomycin) resistance gene.

Preferably, the promoter and the terminator are derived from Labyrinthulomycota.

Preferably, the Labyrinthulomycota is Schizochytrium sp CB15-5.

Preferably, the promoter is a promoter of any of actin gene, elongation factor 1α (ef1α) gene, and glyceraldehyde-3-phosphate dehydrogenase (gapdh) gene.

Preferably, the promoter has a nucleotide sequence described in any of SEQ ID NOs: 2 to 4.

Preferably, the terminator is a terminator of any of actin gene, elongation factor 1α (ef1α) gene, and glyceraldehyde-3-phosphate dehydrogenase (gapdh) gene.

Preferably, the terminator has a nucleotide sequence described in any of SEQ ID NOs: 5 to 7.

Preferably, a pUC18 plasmid is used as a backbone of the vector, or a prGPZT plasmid is used as a backbone of the vector.

Another aspect of the present invention provides a recombinant vector comprising a transgene inserted in a cloning site of a vector according to the present invention.

Preferably, the transgene is a fatty acid synthase gene.

Further another aspect of the present invention provides a cell of Labyrinthulomycota transformed with the recombinant vector according to the present invention.

Further another aspect of the present invention provides a method for producing a lipid or fatty acid using a transformed cell of Labyrinthulomycota according to the present invention.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows a schematic diagram of homologous recombination with a plasmid having a gene homologous to genome;

FIG. 2 shows the Zeocin sensitivity of Schizochytrium sp. CB15-5;

FIG. 3 shows a phylogenetic tree of a 18S rRNA gene;

FIG. 4 shows the comparison of predicted amino acid sequences (actin). The amino acid sequence encoded by the actin gene was examined for its homology to those of related microorganisms.

Schizochytrium sp. CB15-5 AB200876 (Labyrinthulida)

Phytophthora brassicae AY244551-1 (Oomycetes)

Fucus distichus U11697 (Phaeophyceae)

Saccharomyces cerevisiae V01288-1 (Fungi)

Region conserved in Actin protein (54-64 Actins signature, 105-117 Actins and actin-related proteins signature, 357-365 Actins signature);

FIG. 5 shows the comparison of predicted amino acid sequences (ef1α). The amino acid sequence encoded by the ef1α gene was examined for its homology to those of related microorganisms.

Schizochytrium sp. CB15-5 AB200877 (Labyrinthulida)

Saccharomyces cerevisiae X78993-28 (Fungi)

Phytophthora infestans AJ249839-1 (Oomycetes)

Blastocystis hominis D64080-1 (Blastocystis)

Region conserved in Ef1α protein (14-21 ATP/GTP-binding site motif A (P-loop) 61-76 GTP binding elongation factors signature);

FIG. 6 shows the comparison of predicted amino acid sequences (gapdh). The amino acid sequence encoded by the gapdh gene was examined for its homology to those of related microorganisms.

Schizochytrium sp. CB15-5 AB200878 (Labyrinthulida)

Phaeodactylum tricornutum AAF34325 (Bacillariophyta)

Phytophthora palmivora AY292378-1 (Oomycetes)

Saccharomyces cerevisiae V01300-1 (Fungi)

Region conserved in Gapdh protein (151-158 Glyceraldehyde 3-phosphate dehydrogenase active site);

FIG. 7 shows real time PCR (actin) analysis. Data of real time PCR indicating the fluorescence value of each sample in the PCR cycle was analyzed by Fit Point Method of “Light-Cycler Software Ver. 3.5 (Roche),” and a standard curve was prepared with a cycle number of a standard sample at the fluorescence value 0.3615 as the vertical axis against a log value of concentration as the horizontal axis, and was used to calculate a sample concentration from the cycle number of the sample;

FIG. 8 shows real time PCR (ef1α) analysis. Data of real time PCR indicating the fluorescence value of each sample in the PCR cycle was analyzed by Fit Point Method of “Light-Cycler Software Ver. 3.5 (Roche),” and a standard curve was prepared with a cycle number of a standard sample at the fluorescence value 0.1235 as the vertical axis against a log value of concentration as the horizontal axis, and was used to calculate a sample concentration from the cycle number of the sample;

FIG. 9 shows real time PCR (gapdh) analysis. Data of real time PCR indicating the fluorescence value of each sample in the PCR cycle was analyzed by Fit Point Method of “Light-Cycler Software Ver. 3.5 (Roche),” and a standard curve was prepared with a cycle number of a standard sample at the fluorescence value 4.8276 as the vertical axis against a log value of concentration as the horizontal axis, and was used to calculate a sample concentration from the cycle number of the sample;

FIG. 10 shows expression levels of cloned genes. The expression level (M) was calculated from the sample concentration 10×(CO—CX) of each of the obtained genes by using a molecular weight of each PCR product, and was shown in graph form. Expression level (M)=10 (CO—CX)/PCR product MW;

FIG. 11 shows the isolation of promoter and terminator genes;

FIG. 12 shows inverse PCR products. Genomic DNA which was completely digested with a variety of restriction enzymes lacking a recognition sequence on each gene sequence and then self-ligated, was used as a template to perform inverse PCR using primers corresponding to each gene sequence, and the resulting PCR products were electrophoresed;

FIG. 13 shows the structure of the inverse PCR product. Bands obtained by inverse PCR were excised and incorporated into T-vectors. For determining the lengths of the obtained promoters and terminators, the positions of the enzymes used in the digestion of the respective samples were examined;

FIG. 14 shows the comparison of nucleotide sequences of actin promoters. The homology between 500-bp actin promoter (KpnI) and actin promoter (EcoRI) was examined. Actin promoter (KpnI) AB200876;

FIG. 15 shows the construction of a transformation vector. A transfer plasmid was designed to have sacI as the only one site that could be used therein. A set of the promoter and terminator of each gene, a bleomycin resistance gene, and the 18S rRNA gene was cloned into pUC18, which was in turn used as the transfer plasmid;

FIG. 16 shows the influence of a culture period on transformation efficiency. Cells of Labyrinthulomycota (CB15-5) (50 mM sucrose suspension) and linearized plasmids were added to a cuvette and subjected to electroporation under conditions of 500 V, 13Ω, 50 JF. The cells were seeded onto a medium containing 100 μg/ml Zeocin;

FIG. 17 shows the Zeocin resistance of the transformant. An 1-μl aliquot of the precultured microorganism cells was spotted onto GPY plate media having Zeocin concentration ranging from 0 to 6000 mg/ml and incubated at 28° C. for 48 hours in the shade;

FIG. 18 shows the detection of the bleomycin resistance protein gene. Genome of each of the obtained transformants was used as a template to perform PCR using bleomycin resistance gene-specific primers;

FIG. 19 shows the detection of the transgene at the 18S rRNA gene locus. For confirming that homologous recombination occurred at the 18S rRNA gene locus, primers corresponding to the downstream region of the 18S rRNA gene existing in only the genomic DNA and primers specific to the introduced bleomycin resistance gene were used to perform PCR; and

FIG. 20 shows the construction of an expression vector. The ef1 promoter (300 bp), a rat elongase 2 gene, and the ef1 terminator (300 bp) were introduced into the SacI site of prGPZT, which was designated as prGPZT-EPELOT (7999 bp). As a negative control, the ef1 promoter and the ef1 terminator were introduced into the SacI site of prGPZT in the same way, which was designated as prGPZT-EPT (7210 bp).

BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the embodiments of the present invention will be described.

The vector for the transformation of Labyrinthulomycota with a transgene according to the present invention is characterized by comprising at least (1) a nucleotide sequence which is homologous to a part of chromosomal DNA of Labyrinthulomycota and is capable of homologous recombination with the chromosomal DNA, (2) a selection marker gene having a promoter sequence located upstream and a terminator sequence located downstream, and (3) a cloning site for transgene insertion having a promoter sequence located upstream and a terminator sequence located downstream.

The nucleotide sequence used in the present invention which is homologous to a part of chromosomal DNA of Labyrinthulomycota and is capable of homologous recombination with the chromosomal DNA allows homologous recombination between the chromosomal DNA of Labyrinthulomycota and the nucleotide sequence, when introduced into a cell of Labyrinthulomycota. By this recombination, a transgene contained in the vector is incorporated into the chromosomal DNA of Labyrinthulomycota. Specific examples of such a nucleotide sequence which is homologous to a part of chromosomal DNA of Labyrinthulomycota can include an 18S rRNA gene sequence of Labyrinthulomycota. Specific examples thereof include a nucleotide sequence of 18S rRNA of Schizochytrium sp CB15-5 described in SEQ ID NO:1. The 18S rRNA gene sequence can be obtained by a PCR method or the like using genomic DNA of Schizochytrium sp CB15-5 and suitable primers.

A gene exhibiting an appropriate phenotype by which a transformant having the vector of the present invention can be selected can be used as the selection marker gene having a promoter sequence located upstream and a terminator sequence located downstream used in the present invention. For example, a drug resistance gene can be used as the selection marker gene. Specific examples of the drug resistance gene can include, but not limited to, a Zeocin (bleomycin) resistance gene. A promoter sequence and a terminator sequence are ligated upstream and downstream of the selection marker gene, respectively. Preferably, the promoter sequence and the terminator sequence used in the present invention are sequences that function in Labyrinthulomycota used as a host. It is preferred to use a promoter sequence and a terminator sequence derived from Labyrinthulomycota. Specific examples of the promoter and the terminator can include a promoter sequence and a terminator sequence of any of actin gene, elongation factor 1α (ef1α) gene, and glyceraldehyde 3-phosphate dehydrogenase (gapdh) gene.

The promoter sequences and the terminator sequences described above can be obtained by PCR using primer sequences designed on the basis of the information of nucleotide sequences described in SEQ ID NOs: 2 to 10 of Sequence Listing in the present specification, and genomic DNA of a cell of Labyrinthulomycota (e.g., Schizochytrium sp CB15-5).

The vector of the present invention has a cloning site for transgene insertion having a promoter sequence located upstream and a terminator sequence located downstream. The cloning site described herein refers to a restriction site for the insertion of a gene of interest. In this context, the promoter sequence and the terminator sequence used are not particularly limited as long as they permit the expression of the gene of interest. A promoter sequence and a terminator sequence of any of actin gene, elongation factor 1α (ef1α) gene, and glyceraldehyde 3-phosphate dehydrogenase (gapdh) gene as described above may be used. Alternatively, a promoter sequence and a terminator sequence of the gene itself of interest that is used may be used.

For example, a pUC18 or prGPZT plasmid can be used as a backbone of the vector of the present invention. These plasmids usually carry a replication origin (such as E. coli ori) and an antibiotic resistance gene (such as ampicillin resistance gene).

In the present invention, it is preferred to use a linearized vector. When a vector to be introduced is linearized by cleavage at a desired recombination site, homologous recombination occurs at the site. If a recombination site is not limited, a circular vector may be used for the transformation. Thus, the circular vector can be utilized in some applications.

The vector of the present invention can be used by inserting a transgene into the cloning site. The type of the transgene is not particularly limited and can be selected according to purposes such as the application of a transformant to be produced. For example, a fatty acid synthase gene can be used as the transgene.

A recombinant expression vector of the present invention comprising the transgene inserted in the cloning site as described above can be introduced into a cell of Labyrinthulomycota. The transformation of the cell of Labyrinthulomycota could be accomplished for the first time by using the vector of the present invention.

The type of the cell of Labyrinthulomycota to which the vector of the present invention is introduced is not particularly limited. For example, a cell of the genus Schizochytrium or Thraustochytrium can be used. Specific examples of the cell of the genus Schizochytrium can include cells of Schizochytrium aggregatum ATCC 28209, Schizochytrium limacinum NIBH SR21, and Schizochytrium sp CB15-5 used in Example of the present specification. Specific examples of the cell of the genus Thraustochytrium can include cells of Thraustochytrium aureum ATCC 34304, Thraustochytrium striatum ATCC 24473, and an LFF1 strain of the genus Thraustochytrium (Deposition No. FERM BP-08568 (transferred from FERM P-19159)) (JP Patent Publication (Kokai) No. 2005-102680A (2005)).

The LFF1 strain of the genus Thraustochytrium (JP Patent Publication (Kokai) No. 2005-102680A (2005)) can also be selected according to, for example, a screening method as described below. At first, the microorganisms are harvested by filtrating collected sea water through a 0.4-μm sterilized filter. This filter is attached onto an agar medium composed of 90% natural sea water, glucose, yeast extracts, and peptone, followed by culture at 20 to 30° C. Colonies formed on this filter of the agar plate medium are cultured on an agar medium of the same composition as above, and the obtained microorganism cells are collected with a spatula. Fatty acids are methyl-esterified directly from the cells according to a routine method, and the composition thereof is analyzed by gas chromatography to select a strain that produces docosahexaenoic acid. Furthermore, a strain that accumulates in the cell 10% or more by weight, preferably 20% or more by weight, of fats and oils relative to dried cell weight, and/or contains in fats and oils 10% or less of by weight of docosapentaenoic acid and 30% or more by weight of docosahexaenoic acid relative to the total amount of fatty acids can be selected.

The Schizochytrium sp CB15-5 has properties almost equal to those of the LFF1 strain of the genus Thraustochytrium, and can be handled in a similar way.

The transformation of Labyrinthulomycota with the vector of the present invention can be performed by electroporation, a gene gun, the drug treatment of the cell membrane, calcium phosphate transfection, or DEAE-dextran-mediated transfection, or the like. Preferably, the transformation can be performed by electroporation.

From a transformation efficiency standpoint, it is preferred that the recombinant vector of the present invention comprising the transgene should be introduced into a cell of Labyrinthulomycota collected from a culture medium that has reached stationary phase. For example, a strain that reaches stationary phase in approximately 2 days is used in Example of the present specification. In this case, it is preferred that the recombinant vector of the present invention comprising the transgene should be introduced into a cell of Labyrinthulomycota cultured for 3 to 4 days.

A transformant can be selected by using the expression of the selection marker gene contained in the vector of the present invention as an index. For example, when a drug resistance gene is used as the selection marker, only the transformant having the selection marker can be selected and obtained by culturing transformants in a medium containing the corresponding drug.

Any of those known in the art can be used as the medium for the culture of the transformant. Examples of a carbon source used in the medium can include: carbohydrate such as glucose, fructose, saccharose, and starch: fats and oils such as oleic acid and soybean oil; and glycerol and sodium acetate. These carbon sources can be used at a concentration of, for example, 20 to 300 g per litter of the medium. According to a particularly preferable aspect, the transformant can be cultured in two media having different carbon source concentrations, for example, in a medium having a carbon source concentration from 4% to 7% inclusive and subsequently in a medium having a carbon source concentration from 13% to 20% inclusive. Culture under such conditions allows increase in the amount of fats and oils produced, in some cases.

Moreover, organic nitrogen such as yeast extracts, corn steep liquor, polypeptone, sodium glutamate, and urea, or inorganic nitrogen such as ammonium acetate, ammonium sulfate, ammonium chloride, sodium nitrate, and ammonium nitrate can be used as a nitrogen source. Potassium phosphate and the like can be combined appropriately and used as an inorganic salt.

When the promotion of production of docosahexaenoic acid is intended, a precursor of docosahexaenoic acid can be added to the medium. Examples of the precursor can include, but not limited to, hydrocarbons such as tetradecane, hexadecane, and octadecane, fatty acids such as tetradecanoic acid, hexadecanoic acid, octadecanoic acid, and oleic acid or salts thereof (e.g., sodium salts or potassium salts), and fatty acid esters or fats and oils containing fatty acids as a component (e.g., olive oil, soybean oil, cottonseed oil, and coconut oil).

It is preferred that the prepared medium should be used after pH is adjusted to within the range of 4.0 to 9.5 by adding an appropriate acid or base, and subsequent sterilization with an autoclave is done.

A culture temperature for the microorganism is generally 10 to 45° C., preferably 20 to 37° C. Preferably, the culture temperature is controlled to a culture temperature capable of producing of a desired fats and oils composition. pH during the culture is generally 3.5 to 9.5, preferably 4.5 to 9.5. Particularly preferable pH differs depending on purposes.

A culture period can be, for example, 3 to 7 days, and the microorganism can be cultured by aerobic stirring culture, shake culture, or static culture.

In this way, microorganism cells that have accumulated high concentrations of desired lipids or fatty acids in the cultured product can be obtained. The culture medium and the microorganism cells can be separated from the cultured product by a routine method known by those skilled in the art. For example, the separation can be performed by a centrifugation, filtration, or the like, and the centrifugation is particularly preferable.

The microorganism cells separated from the cultured product can be disrupted using, for example, sonication or Dynomill, and then subjected to solvent extraction with chloroform, hexane, butanol, or the like to obtain the desired lipids and fatty acids.

Hereinafter, the present invention will be described more fully with reference to Example. However, the present invention is not intended to be limited to Example.

EXAMPLE

In this Example, Schizochytrium sp. CB15-5 having high proliferation and lipid accumulation properties was used as a model host. Gene transfer by homologous recombination was performed for stably maintaining a transgene. A transfer plasmid having a promoter working with reliability and a selection marker gene was first prepared to investigate a gene transfer method (FIG. 1).

(A) Materials and Method

(1) Strain Used

CB15-5 strain of the genus Schizochytrium

(2) Culture of Microorganism Cells

GPY medium (pH 7.4)

3.0% D-Glucose

1.5% Polypeptone

0.5% Yeast Extract

50.0% Sea water

GPYS medium (pH 7.4)

3.0% D-Glucose

0.6% Polypeptone

0.2% Yeast Extract

50.0% Sea water

50 mM sucrose

Shaking incubator: Bio-Shaker BR-300 CF (TAITEC)

Temperature: 28° C.

Shaking speed: 170 min-1

Preculture time: 1 day

Main culture time: 1 to 4 days

Culture temperature: 28° C.

(3) Test for Zeocin Sensitivity of CB15-5 Strain

The precultured microorganism cells were diluted 1000-fold, and 100 μl thereof was seeded onto GYP plate media having Zeocin concentration ranging from 0 to 50 μg/ml, and incubated at 28° C. for 72 hours in the shade. The number and size of the resulting colonies were measured.

(4) Genomic DNA Extraction from Labyrinthulomycota

Following main culture for 1 day, 5 ml of the microorganism cells was placed into a 15-ml Falcon tube and harvested by centrifugation. The cells were washed with cold PBS and then added with 5 ml of TNE buffer (10 mM Tris-HCl (pH 7.5)+0.1 M NaCl+0.1 mM EDTA), followed by suspension by vortex. Next, the resulting suspension was added with 50 μl of 10% SDS (already filter-sterilized) and 25 μl of 20 mg/ml Proteinase K and mildly stirred by inversion by hand. This solution was placed into a constant temperature bath at 60° C. and left for 2 hours. After the addition of an equal quantity of phenol (supplemented with 8-hydroxyquinoline and equilibrated with 1 M Tris-HCl to pH 8.0), the resulting mixture was mildly stirred by inversion for 20 minutes and then centrifuged at 3000 rpm for 15 minutes. The supernatant was placed into a new Falcon tube using a truncated chip and added with an equal quantity of phenol:chroloform:isoamyl alcohol (25:24:1). The resulting mixture was mildly stirred by inversion for 20 minutes and then centrifuged at 3000 rpm for 15 minutes. The supernatant was placed in small quantities into 1.5-ml microtubes, each of which was added with an equal quantity of cold isopropanol. The resulting mixtures were mildly stirred by inversion and then centrifuged at 15000 rpm for 15 minutes. The supernatant was discarded, and the pellet was added with 500 μl of 70% cold ethanol and centrifuged at 15000 rpm for 5 minutes. The supernatant was discarded, and the pellet of DNA was dried in speed vac for 5 minutes. 200 μl of TE buffer (10 mM Tris-HCl (pH 7.5)+1 mM EDTA) was added to dissolve the DNA, 2.5 μl of RNase (1 mg/ml) solution was then added and reaction was performed at 37° C. for 1 hour. The solutions in all of the tubes were put together into one tube. An equal quantity of phenol:chroloform:isoamyl alcohol (25:24:1) was then added to the tube, and the mixture was mildly stirred by inversion for 5 minutes and then centrifuged at 15000 rpm for 5 minutes. This procedure was repeated twice. The supernatant was transferred to a 1.5-ml microtube, to which 40 μl (1/10 volume) of 3 M sodium acetate and an equal quantity (1 ml) of cold ethanol were then added. The resulting mixture was mildly stirred by inversion and then centrifuged at 15000 rpm for 10 minutes. The supernatant was discarded, and the pellet was supplemented with 700 μl of 70% cold ethanol and centrifuged at 15000 rpm for 5 minutes. The supernatant was discarded, and the pellet of DNA was dried in speed vac for 5 minutes. 200 μl of TE buffer was added to dissolve the DNA and the mixture was stored at −20° C.

(5) Isolation of 18S rRNA Gene by PCR Method

PCR conditions

primers 18S1 and 18S12 0.5 μM each

genomic DNA 500 ng

10×Ex taq buffer 5 μl

dNTP 0.2 mM

Ex taq (5 units/μl) 0.25 μl

sterile water q.s.

Total 50.0 μl

Thermal Cycler

95° C. for 5 minutes, followed by 35 cycles (95° C. for 30 seconds, 55° C. for 30 seconds, and 72° C. for 1 minute)

(6) Purification of PCR Product

The PCR product was purified using a PCR purification kit “Marligen Rapid PCR Purification System (Marligen).”

(7) Cloning

Ligation

Vector 5 ng

Insert DNA 5 ng to 50 ng

2×Rapid ligation buffer 5.0 μl

T4 DNA Ligase (3 units/μl) 1.0 μl

sterile water q.s.

Total 10.0 μl

At 16° C. overnight

Transformation

After ligation, 10 μl of the DNA solution was added with 100 μl of competent cells, then cooled on ice for 5 minutes, and incubated (heat shock) at 37° C. for 3 minutes. The resulting solution was immediately put back on ice and left for 5 minutes. This microorganism cell suspension was seeded and cultured at 37° C. for 12 hours on an LB medium (containing 50 μg/ml ampicillin) over which 40 μl of IPTG (100 mM) and 40 μl of X-gal (20 mg/ml) were spread in advance.

(8) Plasmid Extraction

A plasmid was extracted according to the protocol of a plasmid extraction kit “Marligen Rapid Plasmid System (Marligen).”

(9) Protocol of Sequence Reaction

Sequence reaction was performed according to the protocols of “DYEnamic ET Terminator Cycle Sequencing Kit (Amersham Biosciences)” and “AutoSeq G-50 (Amersham Biosciences).” Sequence analysis was performed with “ABI PRISM(R) 310 Genetic Analyzer (Biosystem)” according to the operating guide.

Oligonucleotide Primers Used in Amplification and Sequencing

Primer sequence (5′-3′)
18S-1 CCAACCTGGTTGATCCTGCCAGTA (SEQ ID NO: 11)
18S-2 CATTCAAGTTTCTGCCCTATC (SEQ ID NO: 12)
18S-3 CAGGCTCCCTCTCCGGAATC (SEQ ID NO: 13)
18S-4 GCAGCCGCGGTAATTCCAGC (SEQ ID NO: 14)
18S-5 ACTACGAGCTTTTTAACTGG (SEQ ID NO: 15)
18S-6 GTCAGAGGTGAAATTCTTGG (SEQ ID NO: 16)
18S-7 TCCTTGGTAAATGCTTTCGC (SEQ ID NO: 17)
18S-8 GGATTGACAGATTGAGAGCT (SEQ ID NO: 18)
18S-9 AACTAAGAACGGCCATGCACC (SEQ ID NO: 19)
18S-10 AGGTCTGTGATGCCCTTAGA (SEQ ID NO: 20)
18S-11 CGTTTACTAGGAATTCCTCG (SEQ ID NO: 21)
18S-12 CCTTGTTACGACTTCACCTTCCTCT (SEQ ID NO: 22)

(10) Phylogenetic Analysis

A phylogenetic tree was prepared using a neighbor-joining (NJ) method (Saitou and Nei, 1987) and a maximum-likelihood (ML) method (Felsenstein, 1981). The NJ analysis was conducted using PAUP version 4.0d64 (Swofford, 1998). The distance was estimated by an ML method using Felsenstein's (1984) (F84) model.

(11) Inverse PCR of 18S rRNA Gene.

An enzyme that was not seen in the gene sequence was selected, and the genome was completely digested with the enzyme. Next, Ligase was added to the sample to allow reaction to prepare self ligation genome. The self ligation genome was used as a template to perform PCR using reverse primers specific to the gene.

Selected Restriction Enzyme: NheI

PCR conditions

primers 18SF3 and 18SR3 0.5 μM each

self ligation genomic DNA 100 ng

10×La PCR buffer 5 μl

dNTP 0.4 mM

MgCl2 2.5 mM

La taq (5 units/μl) 0.5 μl

sterile water q.s.

Total 50.0 μl

Thermal Cycler

94° C. for 2 minutes, followed by 25 cycles (94° C. for 20 seconds, 68° C. for minutes, and 72° C. for 10 minutes)

Oligonucleotide Primers Used in Amplification and Sequencing

Primer sequence (5′-3′)
18SF TACACTGATGGGTTCATCGG (SEQ ID NO: 23)
18SR CCCGTTATAGTCACCGTAGT (SEQ ID NO: 24)

(12) Gel Extraction

The PCR product was purified using a gel extraction kit “Marligen Rapid Gel Extraction System (Marligen).”

(13) Total RNA Extraction from Labyrinthulomycota

After main culture for 1 day, the microorganism cells (1 to 5 g) were harvested, then added with an appropriate amount of liquid nitrogen and 5 ml of Trizol (GIBCO), and pulverized into powder with quartz sand. To the powder, 5 ml of Trizol kept at 60° C. was added, and the mixture was stirred for 30 seconds by vortex and incubated at 60° C. for 15 minutes. Following centrifugation (14000 rpm, 15 min., 4° C.), 1-ml aliquots of the supernatant were dispensed into 1.5-ml microtubes. To each of the tubes, 200 μl of chloroform was added, and the mixture was incubated at room temperature for 5 minutes and then vigorously stirred by vortex until the solution became an emulsion. Following centrifugation (14000 rpm, 15 min., 4° C.), the upper layer of 2 separated layers was collected into another microtube, to which 500 μl of isopropanol was then added. The microtube was left undisturbed at room temperature for 10 minutes and centrifuged (14000 rpm, 10 min., 4° C.). The supernatant was discarded, and the remaining pellet was added with 300 μl of 4 M ice-cold LiCi and dissolved by pipetting, followed by centrifugation (6500 rpm, 10 min., RT). The supernatant was discarded, and the pellet was added with 200 μl of 0.5% SDS-TE buffer and 200 μl of chloroform and stirred by vortex, followed by centrifigation (6500 rpm, 5 min., RT). The upper aqueous layer was collected into another microtube, to which a 1/10 amount of 3 M sodium acetate and a 2.5-fold amount of ethanol were then added. The mixture was left undisturbed for 5 minutes and centrifuged (14000 rpm, 10 min., 4° C.). The supernatant was discarded, and the precipitated RNA was rinsed with 75% ethanol and dried in air. The resulting RNA was dissolved in DEPC-treated water and used as a total RNA sample.

(14) cDNA Synthesis

cDNA synthesis was performed according to the protocol of “3′ RACE System for Rapid Amplification of cDNA Ends (Invitrogen).”

(15) Isolation of Each Gene of Actin, Elongation Factor 1α, and gapdh by PCR Method

PCR conditions

primers for actin (a2 and a6), for ef1α (ef2 and ef5), and for gapdh (g1 and g4) 0.5 μM each

cDNA 50 ng 10×La PCR buffer 5 μl

dNTP 0.4 mM

MgCl2 2.5 mM

La taq (5 units/μl) 0.5 μl

sterile water q.s.

Total 50.0 μl

Thermal Cycler

94° C. for 2 minutes, followed by 30 cycles (94° C. for 20 seconds, 64° C. for 5 minutes, and

72° C. for 10 minutes)

Oligonucleotide Primers Used in Amplification and Sequencing

Primer sequence (5′-3′)
a2 GCTCCTCGCGCTGTGTTCCC (SEQ ID NO: 25)
a6 GAAGCACTTGCGGTGGACAAT (SEQ ID NO: 26)
ef2 ACCACCACTGGTCACCTGAT (SEQ ID NO: 27)
ef5 ACGTTGAAGCCCACGTTGTC (SEQ ID NO: 28)
gap1 GGTATCAACGGCTTTGGCCGCA (SEQ ID NO: 29)
gap4 ACCTTGCCCACAGCCTTGGC (SEQ ID NO: 30)

(16) 3′ RASE, Each Gene of Actin, Elongation Factor 1α, and gapdh

3′ RASE PCR was performed according to the protocol of “3′ RACE System for Rapid

Amplification of cDNA Ends (Invitrogen).”

GSP1-primers: actin (a1), ef1α (ef2), and gapdh (gap2)

GSP2-primers: actin (AF), ef1α (EF), and gapdh (GF)

Oligonucleotide Primers Used in Amplification and Sequencing

Primer sequence (5′-3′)
a1 GACAACGGTTCCGGTATGTGC (SEQ ID NO: 31)
AF GGTTATCATGGTCGGCATGG (SEQ ID NO: 32)
ef2 ACCACCACTGGTCACCTGAT (SEQ ID NO: 33)
EF CTCAAGGCCGAGCGTGAGCG (SEQ ID NO: 34)
gap2 AACGGCTTTGGCCGCATCGGTCG (SEQ ID NO: 35)
GF GCCTCCTGCACCACTAACTG (SEQ ID NO: 36)

(17) 5′ RASE, Each Gene of Actin, Elongation Factor 1α, and gapdh

5′ RACE PCR was performed according to the protocol of “5′ RACE System, Version 2.0 (Invitrogen).”

GSP1-primers:actin (a8), ef1α (ef7), and gapdh (gap4)

GSP2-primers: actin (AR), ef1α (e9), and gapdh (GR)

GSP3-primers:actin (a11), ef1α (ER), and gapdh (g8)

Oligonucleotide Primers Used in Amplification and Sequencing

Primer sequence (5′-3′)
a8 AGCGAGGCGCATCTCCTCGT (SEQ ID NO: 37)
AR ACGCGGAGCTCGTTGTAGAA (SEQ ID NO: 38)
a11 GGTCACGATACCGTGCTCAA (SEQ ID NO: 39)
ef7 GTACTCAGTGAAGGACTCAACG (SEQ ID NO: 40)
e9 CGTAGCCAGCGCGGATCTCA (SEQ ID NO: 41)
ER GGCAACATCGGCCTGGGAGG (SEQ ID NO: 42)
gap4 ACCTTGCCCACAGCCTTGGC (SEQ ID NO: 43)
GR CCAGCACGCCAGTCCTTTCC (SEQ ID NO: 44)
g8 CCATCCTTGATCTCAATAGT (SEQ ID NO: 45)

(18) Confirmation of Expression of Each Gene of Actin, ef1α, and gapdh by Real Time PCR Method
(i) Preparation of Standard Sample for Standard Curve

The fragment amplified by a PCR method using primers specific to each gene was gel-extracted, and its concentration was measured with an absorbance reader to prepare 1 μg/ml standard sample. Dilution series of 1×10−3 to 10−6 μg/ml were prepared for each of the samples and used in experiments.

PCR conditions

primers: actin (a7 and a8), ef1α (e8 and e9), and gapdh (g7 and g8) 0.5 μM each cDNA 100 ng

10×Ex taq buffer 5 μl

dNTP 0.2 mM

Ex taq (5 units/μl) 0.25 μl

sterile water q.s.

Total 50.0 μl

Thermal Cycler

94° C. for 2 minutes, followed by 30 cycles (94° C. for 30 seconds, 57° C. for 30 seconds, and 72° C. for 30 seconds)

(ii) Preparation of cDNA Sample

cDNA (0.2 μg/ml) was synthesized from 4.5 μg of the total RNA with SuperScript II, and the sample was designated as CO. In consideration of the contamination of the genome, a sample was prepared by the same procedure except that sterile water was used instead of SuperScript II, and this sample was designated as CX. Each of the samples was diluted 10-fold and used in experiments.

(iii) Real Time PCR

The standard samples and the cDNA samples were subjected to real time PCR according to the protocol of “Light-Cycler-FastStart DNA Master SYBR Green I (Roche).”

PCR conditions

primers: actin (a7 and a8), ef1α (e8 and e9), and gapdh (g7 and g8) 0.5 μM each

CO and CX standard samples 2 μl each

MgCl2 Stock Sol. 1.6 μl

LD-DNA Master Sybr Green 2 μl sterile water q.s.

Total 20.0 μl

CO=cDNA (0.02 μg/ml)

S10−3=standard (1×10−3 μg/ml)

S10−4=standard (1×10−4 μg/ml)

S105=standard (1×10−5 μg/ml)

S10−6=standard (1×10−6 μg/ml)

Thermal Cycler

95° C. for 10 minutes (denaturation)

95° C. for 10 seconds (PCR)

65° C. (actin), 60° C. (ef1), 63° C. (gapdh) for 5 seconds 72° C. for 10 seconds

87° C. (actin), 84° C. (ef1), 88° C. (gapdh) for 1 second (33 cycles)

95° C. for 0 second (melting)

70° C. (actin), 65° C. (ef1), 68° C. (gapdh) for 15 seconds

95° C. for 0 second

Oligonucleotide Primers Used in Amplification

Primer sequence (5′-3′)
a7 GGCCGTGACCTCACTGACTA (SEQ ID NO: 46)
(real time PCR of actin)
a8 AGCGAGGCGCATCTCCTCGT (SEQ ID NO: 47)
(real time PCR of actin)
e8 TTGGCTTCAACGTCAAGAAC (SEQ ID NO: 48)
(real time PCR of ef1α)
e9 CGTAGCCAGCGCGGATCTCA (SEQ ID NO: 49)
(real time PCR of ef1α)
g7 GACGCCTCGTGTTCCGCACG (SEQ ID NO: 50)
(real time PCR of gapdh)
g8 CCATCCTTGATCTCAATAGT (SEQ ID NO: 51)
(real time PCR of gapdh)

(19) Acquisition of Promoter and Terminator of Each Gene of Actin, ef1α, and gapdh by Inverse PCR Method

An enzyme that was not seen in the gene sequence was selected, and the genome was completely digested with the enzyme. Next, Ligase was added to the sample to allow reaction to prepare self ligation genome. The self ligation genome was used as a template to perform PCR using reverse primers specific to the gene. Selected enzymes: actin (KpnI, NheI, and EcoRI), ef1α (HindIII, NheI, and EcoRI), gapdh (KpnI, HindIII, and NheI)

PCR conditions

primers: actin (a9 and AR), ef1α (e10 and ER), and gapdh (g9 and g8) 0.5 μM each.

An enzyme used was La Taq, and PCR was performed under the same conditions as in the protocol for the 18S rRNA gene.

Oligonucleotide Primers Used in Amplification and Sequencing

Primer sequence (5′-3′)
a9 ATCTCCAAGCAGGAGTACGA (SEQ ID NO: 52)
(Inverse PCR of actin)
AR ACGCGGAGCTCGTTGTAGAA (SEQ ID NO: 53)
(Inverse PCR of actin)
e10 GGTGTCATCAAGGAGGTTGA (SEQ ID NO: 54)
(Inverse PCR of ef1α)
ER GGCAACATCGGCCTGGGAGG (SEQ ID NO: 55)
(Inverse PCR of ef1α)
g9 CTCATCAGCTGGTACGATAA (SEQ ID NO: 56)
(Inverse PCR of gapdh)
g8 CCATCCTTGATCTCAATAGT (SEQ ID NO: 57)
(Inverse PCR of gapdh)
a12 TGAACTTCGTCGTCAGCCAT (SEQ ID NO: 58)
(sequencing of actin)
a13 TCCACCGCAAGTGCTTCTAA (SEQ ID NO: 59)
(sequencing of actin)
ae14 TGTGCGTCTAGTCCAACCTT (SEQ ID NO: 60)
(sequencing of actin)
ak14 TTGGAAGACGCTCCTAGTAG (SEQ ID NO: 61)
(sequencing of actin)
ak15 GACTTCAACTATGTCCAGGC (SEQ ID NO: 62)
(sequencing of actin)
ak16 GTAGTCAGAGGTACTGAGTT (SEQ ID NO: 63)
(sequencing of actin)
ak17-2 CATGTGGTTATGTAGAACGGCA (SEQ ID NO: 64)
(sequencing of actin)
ak18 AGTATCTCGTGAAAGCGGGA (SEQ ID NO: 65)
(sequencing of actin)
e12 TGCTCCTTCGTCTTGCCCAT (SEQ ID NO: 66)
(sequencing of ef1α)
e13 TATGAAGCTAGGATGTGCGT (SEQ ID NO: 67)
(sequencing of ef1α)
e14 CACCTACCTTGGCTCCTCGT (SEQ ID NO: 68)
(sequencing of ef1α)
e15 CGATATCGCAACTGTGTCGA (SEQ ID NO: 69)
(sequencing of ef1α)
en16 GAAAACGTTGGAGAGCCTGA (SEQ ID NO: 70)
(sequencing of ef1α)
e17 ACAGTGACGGTATCTCTGCT (SEQ ID NO: 71)
(sequencing of ef1α)
en18 ACCGTAACGGCCATAAGAAG (SEQ ID NO: 72)
(sequencing of ef1α)
g12 ATAGGTGCGTCGGCAGACAT (SEQ ID NO: 73)
(sequencing of gapdh)
g13 TAAGCACTGAAGAAGCGAGT (SEQ ID NO: 74)
(sequencing of gapdh)
g14 CGTACCAGTCGGAACCTCTG (SEQ ID NO: 75)
(sequencing of gapdh)
g15 CTTAGGGCTCATCGTCAACA (SEQ ID NO: 76)
(sequencing of gapdh)
gh16 ACAGCACGCCTTACTTACCT (SEQ ID NO: 77)
(sequencing of gapdh)
g17 CCTTCAATCCTAAACACCATGC (SEQ ID NO: 78)
(sequencing of gapdh)
gh18 TGAGGAGAACTGCAAGCACC (SEQ ID NO: 79)
(sequencing of gapdh)

(20) Construction of Transfer Plasmid

(i) Preparation of Insert

Each fragment was amplified by PCR, then gel-extracted, and its concentration was measured. A terminator of each gene was digested with SalI and SphI and purified with a PCR purification kit. The 18S rRNA gene was subcloned once into a pUC18 plasmid, and the purified plasmid was digested with KpnI and gel-extracted.

PCR Conditions for Promoter, Terminator, and 18S rRNA Gene

Primers:

actin promoter (pAF and zAR)

ef1α promoter (pEF and zER)

gapdh promoter (pGF and zGR)

actin terminator (salAF and sphAR)

ef1α terminator (salEF and sphER)

gapdh terminator (salGF and sphGR), and

18S rRNA gene (kpn18rF and kpn18rR) 50 pmol each

genomic DNA 100 ng

buffer#1 5 μl

dNTP 0.2 mM

MgCl2 1 mM

KOD DNA polymerase 2.5 U

sterile water q.s.

Total 50.0 μl

PCR Conditions for Bleomycin Resistance Protein Gene

primers

actin (aZF and pZR)

ef1α (eZF and pZR), and

gapdh (gZF and pZR) 50 pmol each

pPhaT1 20 ng

buffer#1 5 μl

dNTP 0.2 mM

MgCl2 1 mM

KOD DNA polymerase 2.5 U

sterile water q.s.

Total 50.0 μl

Thermal Cycler for Promoter and 18S rRNA Gene

25 cycles (98° C. for 15 seconds, 63° C. (promoter) or 65° C. (18S rRNA) for 2 seconds, and 74° C. for 30 seconds)

Thermal Cycler for Terminator and Bleomycin Resistance Protein Gene

25 cycles (98° C. for 15 seconds and 68° C. for 30 seconds)

Oligonucleotide Primers Used in Amplification and Sequencing

Primer sequence (5′-3′)
(SEQ ID NO: 80)
pAF TCGAGCTCGGTACCCCTTCATACTCTCGCATTTCC
(SEQ ID NO: 81)
zAR TTGGCCATTTTGCTAGTTGGGTGCTTGTTCTT
(SEQ ID NO: 82)
pEF TCGAGCTCGGTACCCTCATGCTCCTTTCCCGCCAA
(SEQ ID NO: 83)
zER TTGGCCATTTTGTTTGGTGCTAGTAGCTTCGA
(SEQ ID NO: 84)
pGF TCGAGCTCGGTACCCTTGATCTTGTGAGGGCTCCA
(SEQ ID NO: 85)
zGR TTGGCCATTTTGCTTGGTGTTTATGTGTGCGC
(SEQ ID NO: 86)
aZF CTAGCAAAATGGCCAAGTTGACCAGTGCCGTT
(SEQ ID NO: 87)
eZF CAAACAAAATGGCCAAGTTGACCAGTGCCGTT
(SEQ ID NO: 88)
gZF CAAGCAAAATGGCCAAGTTGACCAGTGCCGTT
(SEQ ID NO: 89)
pZR CTCTAGAGGATCCCCTCAGTCCTGCTCCTCGGCCA
(SEQ ID NO: 90)
salAF AGAGTCGACATTGGAGTGATGGAATGCCC
(SEQ ID NO: 91)
sphAR CTTGCATGCTGTTGAAAGAGCTGAGGCCA
(SEQ ID NO: 92)
salEF AGAGTCGACGTGGTTTGACCTCTTATACT
(SEQ ID NO: 93)
sphER CTTGCATGCGTTTCCCAACTCACGTTGTG
(SEQ ID NO: 94)
salGF AGAGTCGACATGTACCCAATACCACACCG
(SEQ ID NO: 95)
sphGR CTTGCATGCCTTGAAGCACTAGAAGAGCA
(SEQ ID NO: 96)
kpn18rF CGGGGTACCCCAGTAGTCATATGCTCGTC
(SEQ ID NO: 97)
kpn18rR CGGGGTACCCCTTGTTACGACTTCACCTT

(ii) Workflow
(a) The pUC18 was digested with SmaI, then gel-extracted, and its concentration was measured. Each gene promoter and the bleomycin resistance protein gene were introduced into the SmaI site of the pUC18 using Fusion Enzyme according to the protocol of “BD In-Fusion™ Dry-Down PCR Cloning Kit (13D Biosciences).” Next, the absence of mutation in the bleomycin resistance protein gene was confirmed by sequencing.
(b) The plasmids (PAPZ (4568 bp), pEPZ (4547 bp), and pGPZ (4418 bp)) having each gene promoter and the bleomycin resistance protein gene constructed in the step (a) were digested with SalI and SphI and then gel-extracted. The terminators corresponding to the promoters were respectively introduced into the plasmids using Ligase.
(c) The plasmids (pAPZT (5562 bp), pEPZT (5545 bp), and pGPZT (5396 bp)) having each gene promoter, the bleomycin resistance protein gene, and the terminator constructed in the step (b) were digested with KpnI and then gel-extracted. The 18S rRNA gene was introduced into the plasmids using Ligase to prepare three transfer plasmids designated as prAPZT (5562 bp)<actin promoter>, prEPZT (5545 bp)<ef1α promoter>, and prGPZT(5396 bp)<gapdh promoter> (FIG. 15).
(21) Gene Transfer by Electroporation Method
(i) Preparation of Plasmid

Plasmids were extracted in large quantities according to the protocol of a high-speed plasmid large scale (midi) purification system “PureYield™ Plasmid Midiprep System (Promega)”, and their concentrations was measured by absorptiometer. The linear plasmid samples were digested with SacII. The samples (10 μg) were concentrated with Ethachinmate (NIPPON GENE) and dissolved in 10 μl of sterile water.

(ii) Preparation of Cell (5 μm or Less)

The main culture medium was put through a filter (5 μm (MILLIPORE)) and centrifuged (12000 g, 5 min., 4° C.). The supernatant was discarded, and the pellet was added with BSS buffer (10 mM KCl, 10 mM NaCl, and 3 mM CaCl2) and centrifuged (12000 g, 5 min., 4° C.). The supernatant was discarded. Next, the pellet was added with 50 mM sucrose and centrifuged (12000 g, 5 min., 4° C.), and the supernatant was discarded. This procedure was performed twice. The cells were counted using a hemocytometer. In the last stage, the cells were suspended at 4×107 cells/80 μl in 50 mM sucrose.

(iii) Preparation of Cell

The main culture medium was placed into a 1.5-ml microtube and centrifuged (12000 g, 5 min., 4° C.). The supernatant was discarded, and the pellet was added with BSS buffer and centrifuged (12000 g, 5 min., 4° C.). The supernatant was discarded. Next, the pellet was added with 50 mM sucrose and centrifuged (12000 g, 5 min., 4° C.), and the supernatant was discarded. This procedure was performed twice. In the last stage, 50 mM sucrose was added to the cells to adjust the total amount thereof to 100 μl, and the cells were suspended by vortex.

(iv) Transformation

An 80-μl aliquot of the prepared cells was mixed with 10 μl of the plasmids. The resulting mixture was placed in a cooled cuvette (2 mm gap (BM Equipment)) and incubated on ice for 5 minutes. Next, the cuvette was loaded in an electroporation apparatus (ECM600 (BTX)) and pulsed once under each condition of 200 V, 500 V, 1500 V, and 2500 V (50 μF, 13Ω). Then, 1 ml of GPYS liquid medium was added thereto, and the mixture was transferred to an Eppendorf tube and incubated in water bath at 28° C. for 1 hour. After centrifugation (12000 g, 5 min., RT), the supernatant was discarded to adjust the total amount thereof to 100 μl, followed by vortex. The resulting product was seeded onto a GPYS medium containing 100 μg/ml Zeocin and cultured at 28° C. for 2 days.

(22) Test for Zeocin Sensitivity of Transformant

The precultured microorganism cells were diluted to 20 cells/μ, and 1 μl thereof was spotted onto GPY plate media having Zeocin concentration ranging from 0 to 6000 μg/ml and incubated in the shade at 28° C. for 60 hours.

(23) Confirmation of Transgene by PCR Method

PCR conditions

primers 0.5 μM each

genomic DNA 500 ng

10×Ex taq buffer 5 μl

dNTP 0.2 mM Ex taq (5 units/μl) 0.25 μl

sterile water q.s.

Total 50.0 μl

Thermal Cycler

94° C. for 2 minutes, followed by 30 cycles (94° C. for 30 seconds, 68° C. for 30 seconds, and 72° C. for 30 seconds)

Oligonucleotide Primers Used in Amplification

Primer sequence (5′-3′)
ZEOF TACCGGTTCAACTGGTCACGGC (SEQ ID NO: 98)
ZEOR TCAGTCCTGCTCCTCTTCCA (SEQ ID NO: 99)

(24) Confirmation of Homologous Recombination by PCR Method
PCR conditions
primers 18srDT and ZEOR 0.5 μM each
genomic DNA 500 ng
10×La PCR buffer 5 μl
dNTP 0.4 mM
MgCl2 2.5 mM
La taq (5 units/μl) 0.5 μl
sterile water q.s.
Total 50.0 μl
Thermal Cycler
94° C. for 2 minutes, followed by 30 cycles (94° C. for 20 seconds, 64° C. for 5 minutes, and 72° C. for 10 minutes)

Oligonucleotide Primers Used in Amplification

Primer sequence (5′-3′)
18srDT CGCAGGTTCACCTACGGAAA (SEQ ID NO: 100)
ZEOR TCAGTCCTGCTCCTCTTCCA (SEQ ID NO: 101)

(25) Preparation of Expression Plasmid
(i) Preparation of Insert

Each fragment was amplified by PCR, then gel-extracted, and its concentration was measured.

PCR Conditions for Rat Elongase 2 Gene

primers epELOF and etELOR 50 pmol each

pYES2 20 ng

buffer#1 5 μl

dNTP 0.2 mM

MgCl2 1 mM

KOD DNA polymerase 2.5 U

sterile water q.s.

Total 50 μl

Thermal Cycler for Rat Elongase 2 Gene

25 cycles (98° C. for 15 seconds and 68° C. for 30 seconds)

PCR Conditions for Promoter and Terminator

primers

ef1α promoter <elongase> (psac I EPF and eloEPR)

ef1α promoter <no elongase> (psac I EPF and etEPR)

ef1α terminator <elongase> (eloETF and psac I ETR), and

ef1α terminator <no elongase> (epETF and psac I ETR) 0.5 μM each

genomic DNA 500 ng

10αLa PCR buffer 5±1

dNTP 0.4 mM

MgCl2 2.5 mM

La taq (5 units/μl) 0.5 μl

sterile water q.s.

Total 50.0 μl

Thermal Cycler for Promoter and Terminator

94° C. for 2 minutes, followed by 25 cycles (94° C. for 30 seconds, 60° C. for 30 seconds, and 72° C. for 30 seconds)

Oligonucleotide Primers Used in Amplification and Sequencing

Primer sequence (5′-3′)
(SEQ ID NO: 102)
psac I EPF ATGATTACGAATTCGAATGACTGGCTTCAAGTTTG
(SEQ ID NO: 103)
eloEPR GACATGTTCATTTTGTTTGGTGCTAGTAGCTT
(SEQ ID NO: 104)
epELOF CAAACAAAATGAACATGTCAGTGTTGACTTTA
(SEQ ID NO: 105)
etELOR CAAACCACCTACTCGGCCTTCGTCGCTTTCTT
(SEQ ID NO: 106)
eloETF CCGAGTAGGTGGTTTGACCTCTTATACTTGATCGA
(SEQ ID NO: 107)
psac I ETR GATTGACAGATTGAGCTCTCAAACATACAAAAGAATT
(SEQ ID NO: 108)
etEPR ACCACTTACATTTTGTTTGGTGCTAGTAGCTT
(SEQ ID NO: 109)
epETF ACAAAATGTAAGTGGTTTGACCTCTTATACTTGAT

(ii) Workflow

The prGPZT (5396 bp) comprising the gapdh promoter, bleomycin resistance protein gene, terminator, 18S rRNA gene introduced therein was digested with SacI, then gel-extracted, and its concentration was measured. The ef1 promoter <elongase>, the rat elongase 2 gene, the ef1 terminator <elongase> were introduced into the SacI site of the prGPZT using Fusion Enzyme according to the protocol of “BD In-Fusion™ Dry-Down PCR Cloning Kit (BD Biosciences),” and the resulting plasmid was designated as prGPZT-EPELOT (7999 bp). The absence of mutation in the rat elongase 2 gene was confirmed by sequencing. As a negative control, the ef1 promoter <no elongase> and the ef1 terminator <no elongase> were introduced into the SacI site of the prGPZT in the same way, and the resulting plasmid was designated as prGPZT-EPT (7210 bp) (FIG. 20).

(B) Results

(1) Test for Drug Sensitivity of CB15-5 Strain

For determining a selection marker, drug sensitivity to Zeocin, a substance breaking DNA structure, was examined. As a result, a tendency of concentration-dependent decrease in the number and size of the colonies was observed in the medium containing 10 to 30 μg/ml Zeocin (FIG. 2). Therefore, a gene imparting resistance to bleomycin, a Zeocin analog, was used as a selection marker.

(2) Isolation of 18S rRNA Gene by PCR Method

The 18S rRNA gene considered to exist in many copies on the chromosome was used as a homologous recombination gene. The 18S rRNA gene was isolated by PCR on the basis of homology to microorganisms belonging to the same category, and the upstream and downstream regions thereof were further isolated by inverse PCR (SEQ ID NO: 1). For comparing it with 18S rRNA genes of other microorganisms of Labyrinthulomycota, a molecular phylogenetic tree was prepared. As a result, it was found that the 18S rRNA gene has high homology to those of Schizochytrium limacinum that is a high docosahexaenoic acid-producing microorganism and a KH105 strain of the genus Schizochytrium that is a carotenoid-producing microorganism (FIG. 3).

(3) Isolation of Each Gene of Actin, Elongation Factor 1α (Ef1α), and glyceraldehyde-3-phosphate Dehydrogenase (gapdh) by PCR Method

Those from each gene of actin, ef1α, and gapdh expected to provide constitutive expression were used as promoter and terminator genes controlling the expression of the bleomycin resistance gene. Therefore, a partial fragment of each gene of actin, ef1α, and gapdh lacking sequence information in Labyrinthulomycota was obtained from cDNA of the CB15-5 strain by a PCR method on the basis of homology to organisms of other species, and the full length thereof was obtained by 5′ RACE and 3′ RACE methods. The nucleotide sequence of the actin gene is shown in SEQ ID NO: 8 (coding region: nucleotide Nos. 1504 to 2634); the nucleotide sequence of the ef1α gene is shown in SEQ ID NO: 9 (coding region: nucleotide Nos. 1487 to 2791); and the nucleotide sequence of the gapdh gene is shown in SEQ ID NO: 10 (coding region: nucleotide Nos. 1358 to 2377). Amino acid sequences encoded by these nucleotide sequences were examined for their homology to those of related microorganisms. As a result, high homology was obtained, and the gene of interest was judged to be obtained because a region conserved in each of the proteins existed in the sequence of the CB15-5 (FIGS. 4 to 6).

(4) Confirmation of Expression of Each Gene of Actin, ef1α, and gapdh by Real Time PCR Method

Primers specific to each gene and cDNA of the CB15-5 strain were used to perform real time PCR using SYBR Green. Fluorescence value data of each gene obtained was analyzed by Fit Point Method of “Light-Cycler Software Ver. 3.5 (Roche),” and a standard curve was prepared with the standard to calculate a sample concentration (FIGS. 7 to 9). The sample concentration 10×(CO—CX) obtained therefrom was calculated in molarity using a molecular weight of each PCR product. As a result, an expression level was shown to be highest in actin, followed by ef1α, and gapdh (FIG. 10). The expression levels of actin and ef1α were shown to be larger than at least that of gapdh, suggesting that the actin and ef1α genes can be used as promoters. Because the expression of gapdh, though its absolute level was unknown, was confirmed, a promoter was also obtained therefrom.

(5) Acquisition of Promoter and Terminator of Each Gene of Actin, Ef1α, and gapdh by Inverse PCR Method

In a method for the acquisition, the genomic DNA which was completely digested with a restriction enzyme with no recognition sequence on each gene sequence and then self-ligated was used as a template to perform inverse PCR using primers corresponding to each gene sequence, and the obtained fragments were sequenced (FIG. 11). Three restriction enzymes absent in each gene were selected for each of the genes (KpnI, NheI, and EcoRI for actin, HindIII, NheI, and EcoRI for ef1α, KpnI, HindIII, and NheI for gapdh). The genomic DNA which was completely digested with each of the restriction enzymes and then self-ligated was used as a template to perform inverse PCR using primers corresponding to the gene sequence. As a result, bands of 2 to 9 Kb were obtained (FIG. 12).

The bands (KpnI<actin>4 Kb, EcoRI<actin>2 Kb, HindIII<ef1α>5 Kb, NheI<ef1α>5 Kb, HindIII<gapdh>6 Kb, NheI<gapdh>3 Kb) of samples of each gene digested with two different enzymes, were excised and inserted into T-vectors. For determining the lengths of the obtained promoters and terminators, the respective restriction maps of the samples were prepared (FIG. 13). Then, sequence information of the respective promoter and terminator regions of 0.5 to 1.5 Kb was obtained by sequence analysis. The promoter sequences of the actin, ef1α, and gapdh genes are shown in SEQ ID NOs: 2 to 4, while the terminator sequences of the actin, ef1α, and gapdh genes are shown in SEQ ID NOs: 5 to 7.

As a result of comparison of the sequences of the samples of each gene, the promoter and terminator regions were homologous in all of the ef1α and gapdh samples. In the actin samples, only the promoter regions of approximately 120 bp from the initiation codon were homologous (FIG. 14), and the promoters subsequent after 120 bp and the terminators were nonhomologous. Therefore, the sequence of the KpnI<actin>4 Kb sample from which the 1.5-Kb promoter and the 1-Kb terminator could be obtained was used for actin.

(6) Introduction of Plasmid by Electroporation

The transfer plasmid having the ef1α promoter (FIG. 15) was converted to a linear plasmid with sacII, and a main culture medium (3 days) of the strain was prepared. The linear plasmid was introduced into the cells of Labyrinthulomycota (50 mM sucrose suspension (3×107 cells/80 μl)) with a size of 5 μm or less by electroporation under each condition of 200 V, 500 V, 1500 V, and 2500 V (50 μF, 13Ω). The cells were seeded onto a medium containing 100 μg/ml Zeocin. As a result, colonies exhibiting Zeocin resistance were obtained from the electroporation at 200 V and 500 V. Moreover, the largest number of colonies was obtained from the electroporation at 500 V, whereas no colony was obtained from the electroporation at 1500 V and 2500 V (Table 1). Therefore, electroporation was performed at 500 V in subsequent experiments.

TABLE 1
Number of transformant
Voltage Transformant/μg DNA(plasmid)
 200 V 1.0
 500 V 2.0
1500 V
2500 V

Next, a main culture medium (3 days) of the strain was prepared, and the linearized transfer plasmid having the ef1α promoter was introduced into the cells of Labyrinthulomycota (50 mM sucrose suspension) with a size of 5 μm or less and a normal size by electroporation under the condition of 500 V, 50 μF, 13Ω. The cells were seeded onto a medium containing 100 μg/ml Zeocin. As a result of the introduction using the cell having the unfixed size, colonies exhibiting Zeocin resistance were also obtained, and therefore, subsequent experiments were performed with the size unfixed (Table 2).

TABLE 2
Number of transformant
Transformant/μg
Cell size DNA(plasmid)
<5 μm cell 1.2
Normal cell 2.5

Next, a main culture medium (4 days) of the strain was prepared, and the linearized transfer plasmid having each gene promoter was introduced into the cells of Labyrinthulomycota (50 mM sucrose suspension) with a normal size by electroporation under the condition of 500 V, 50 μF, 13Ω. The cells were seeded onto a medium containing 100 μg/ml Zeocin. As a result of the introduction of all of three plasmids under the determined condition, Zeocin resistance strains were obtained for all of the samples comprising the plasmid introduced (Table 3).

TABLE 3
Number of transformant
Transformant/μg
Plasmid DNA(plasmid)
Control
actin promoter 0.5-7
ef1α promoter  1.2-50
gapdh promoter 0.5-3

Next, transformation efficiency depending on the number of culture days of the cells to be transformed was compared. As a result, the cells on the 3 to 4 days were shown to be suitable for transformation (FIG. 16).

Next, a main culture medium (3 days) of the strain was prepared, the linearized and circular transfer plasmids having each gene promoter were introduced into the cells of Labyrinthulomycota (50 mM sucrose suspension) with a normal size by electroporation under the condition of 500 V, 50 μF, 13Ω. The cells were seeded onto a medium containing 100 μg/ml Zeocin. As a result of the introduction of the circular plasmid, colonies exhibiting Zeocin resistance were obtained as in the linear plasmid (Table 4).

TABLE 4
Number of transformant
Transformant/μg
Plasmid DNA(plasmid)
Linear 0.3-50
Circular 0.5-50

Next, culture media (1 day to 4 days) of a KH105 strain were used to introduce the plasmids in the same way as in the CB15-5 strain. However, resistance strains were not obtained.

(7) Test for Zeocin Sensitivity of Transformant

The obtained transformants were examined for their sensitivity to Zeocin. As a result, the wild type completely became nonviable in 20 μg/ml Zeocin, whereas the transformants having each gene promoter were viable in up to 4000 μg/ml (actin), 6000 μg/ml (ef1α), and 2000 μg/ml (gapdh) Zeocin (FIG. 17).

(8) Confirmation of Transgene by PCR Method

For confirming the introduction of the bleomycin resistance gene, the genomic DNA of the obtained transformant was used as a template to perform PCR using bleomycin resistance gene-specific primers. As a result, the gene transfer was shown to be successful because bands with the same size as that obtained in the control plasmid were obtained (FIG. 18).

(9) Confirmation of Homologous Recombination by PCR Method

For confirming that homologous recombination occurred at the 18S rRNA gene locus, primers corresponding to the downstream region of the 18S rRNA gene existing in only the genomic DNA and primers specific to the bleomycin resistance gene were used to perform PCR. As a result, the gene transfer to the chromosomal DNA by homologous recombination was shown to occur because an expected 3600-bp band was obtained in the transformant (FIG. 19).

INDUSTRIAL APPLICABILITY

The transformation of Labyrinthulomycota with an introduced foreign gene was achieved for the first time by using the vector of the present invention. The use of the vector of the present invention allows the improvement of production efficiency of lipid or carotenoid in Labyrinthulomycota.

Claims

1. A vector for the transformation of Labyrinthulomycota with a transgene, which comprises at least (1) a nucleotide sequence which is homologous to a part of chromosomal DNA of Labyrinthulomycota and is capable of homologous recombination with the chromosomal DNA, (2) a selection marker gene having a promoter sequence located upstream and a terminator sequence located downstream, and (3) a cloning site for transgene insertion having a promoter sequence located upstream and a terminator sequence located downstream.

2. The vector according to claim 1, wherein the nucleotide sequence which is homologous to a part of chromosomal DNA of Labyrinthulomycota and is capable of homologous recombination with the chromosomal DNA is an 18S rRNA gene sequence of Labyrinthulomycota.

3. The vector according to claim 1, wherein the nucleotide sequence which is homologous to a part of chromosomal DNA of Labyrinthulomycota and is capable of homologous recombination with the chromosomal DNA is a nucleotide sequence of 18S rRNA of Schizochytrium sp CB15-5 described in SEQ ID NO: 1.

4. The vector according to claim 1, wherein the selection marker is a drug resistance gene.

5. The vector according to claim 4, wherein the selection marker is a Zeocin (bleomycin) resistance gene.

6. The vector according to claim 1, wherein the promoter and the terminator are derived from Labyrinthulomycota.

7. The vector according to claim 6, wherein the Labyrinthulomycota is Schizochytrium sp CB15-5.

8. The vector according to claim 1, wherein the promoter is a promoter of any of actin gene, elongation factor 1α (ef1α) gene, and glyceraldehyde-3-phosphate dehydrogenase (gapdh) gene.

9. The vector according to claim 1, wherein the promoter has a nucleotide sequence described in any of SEQ ID NOs: 2 to 4.

10. The vector according to claim 1, wherein the terminator is a terminator of any of actin gene, elongation factor 1α (ef1α) gene, and glyceraldehyde-3-phosphate dehydrogenase (gapdh) gene.

11. The vector according to claim 1, wherein the terminator has a nucleotide sequence described in any of SEQ ID NOs: 5 to 7.

12. The vector according to claim 1, wherein a pUC18 plasmid is used as a backbone of the vector.

13. The vector according to claim 1, wherein a prGPZT plasmid is used as a backbone of the vector.

14. A recombinant vector comprising a transgene inserted in a cloning site of a vector according to claim 1.

15. The recombinant vector according to claim 14, wherein the transgene is a fatty acid synthase gene.

16. A cell of Labyrinthulomycota transformed with the recombinant vector according to claim 14.

17. A method for producing a lipid or fatty acid using a transformed cell of Labyrinthulomycota according to claim 16.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: