Patent application title:

Novel full-length cDNA

Publication number:

US20070015163A1

Publication date:
Application number:

11/166,372

Filed date:

2005-06-27

Abstract:

Novel full-length cDNAs are provided. 1639 cDNA derived from human have been isolated. The full-length nucleotide sequences of the cDNA and amino acid sequences encoded by the nucleotide sequences have been determined. Because the cDNA of the present invention are full-length and contain the translation start site, they provide information useful for analyzing the functions of the polypeptide.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q1/6883 »  CPC further

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material

C12Q1/6886 »  CPC further

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer

C12Q2600/158 »  CPC further

Oligonucleotides characterized by their use Expression markers

C12Q1/68 IPC

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids

C07H21/04 IPC

Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical

C12P21/06 IPC

Preparation of peptides or proteins produced by the hydrolysis of a peptide bond, e.g. hydrolysate products

C07K14/47 »  CPC main

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

C07K16/18 IPC

Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans

Description

FIELD OF THE INVENTION

The present invention relates to polynucleotides encoding novel polypeptides, polypeptides encoded by the polynucleotides, and new uses of these.

BACKGROUND OF THE INVENTION

Currently, the sequencing projects, the determination and analysis of the genomic DNA of various living organisms have been in progress all over the world. The whole genomic sequences of more than 40 species of prokaryotes, a lower eukaryote, yeast, a multicellular eukaryote, C. elegans, and a higher plants, arabidopsis, etc. are already determined. For human genome, presumably having 3 billion base pairs, the analysis was advanced under global cooperative organization, and a draft sequence was disclosed in 2001. Moreover, all the structures are to be clear and to be disclosed in 2002-2003. The aim of the determination of genomic sequence is to reveal the functions of all genes and their regulation and to understand living organisms as a network of interactions between genes, proteins, cells or individuals through deducing the information in a genome, which is a blueprint of the highly complicated living organisms. To understand living organisms by utilizing the genomic information from various species is not only important as an academic subject, but also socially significant from the viewpoint of industrial application.

However, determination of genomic sequences itself cannot identify the functions of all genes. For example, as for yeast, only the function of approximately half of the 6000 genes, which is predicted based on the genomic sequence, was able to be deduced. On the other hand, the human genome has been estimated to contain about 30,000 genes. Further, 100,000 or more types of mRNAs are said to exist when variants produced by alternative splicing are taken into consideration. Therefore, it is desirable to establish “a high throughput analysis system of the gene functions” which allows us to identify rapidly and efficiently the functions of vast amounts of the genes obtained by the genomic sequencing.

Many genes in the eukaryotic genome are split by introns into multiple exons. Thus, it is difficult to predict correctly the structure of encoded protein solely based on genomic information. In contrast, cDNA, which is produced from mRNA that lacks introns, encodes a protein as a single continuous amino acid sequence and allows us to identify the primary structure of the protein easily. In human cDNA research, to date, more than three million ESTs (Expression Sequence Tags) are publicly available, and the ESTs presumably cover not less than 80% of all human genes.

The information of ESTs is utilized for analyzing the structure of human genome, or for predicting the exon-regions of genomic sequences or their expression profile. However, many human ESTs have been derived from proximal regions to the 3′-end of cDNA, and information around the 5′-end of mRNA is extremely little. Among human cDNAs, the number of the corresponding mRNAs whose encoding full-length protein sequences are deduced is approximately 13,000.

It is possible to identify the transcription start site of mRNA on the genomic sequence based on the 5′-end sequence of a full-length cDNA, and to analyze factors involved in the stability of mRNA that is contained in the cDNA, or in its regulation of expression at the translation stage. Also, since a full-length cDNA contains atg codon, the translation start site, in the 5′-region, it can be translated into a protein in a correct frame. Therefore, it is possible to produce a large amount of the protein encoded by the cDNA or to analyze biological activity of the expressed protein by utilizing an appropriate expression system. Thus, analysis of a full-length cDNA provides valuable information which complements the information from genome sequencing. Also, full-length cDNA clones that can be expressed are extremely valuable in empirical analysis of gene function and in industrial application.

Therefore, if a novel human full-length cDNA is isolated, it can be used for developing medicines for diseases in which the gene is involved. The protein encoded by the gene can be used as a drug by itself. Thus, it has great significance to obtain a full-length cDNA encoding a novel human protein.

In particular, human secretory proteins or membrane proteins would be useful by itself as a medicine like tissue plasminogen activator (TPA), or as a target of medicines like membrane receptors. In addition, genes for signal transduction-related proteins (protein kinases, etc.), glycoprotein-related proteins, transcription-related proteins, etc. are genes whose relationships to human diseases have been elucidated. Moreover, genes for disease-related proteins form a gene group rich in genes whose relationships to human diseases have been elucidated.

Therefore, it has great significance to isolate novel full-length cDNA clones of human, only few of which has been isolated. Especially, isolation of a novel cDNA clone encoding a secretory protein or membrane protein is desired since the protein itself would be useful as a medicine, and also the clones potentially include a gene involved in diseases. In addition, genes encoding proteins that are involved in signal transduction, glycoprotein, transcription, or diseases are expected to be useful as target molecules for therapy, or as medicines themselves. These genes form a gene group predicted to be strongly involved in diseases. Thus, identification of the full-length cDNA clones encoding those proteins has great significance.

SUMMARY OF THE INVENTION

An objective of the present invention is to provide polynucleotides encoding novel polypeptides, polypeptides encoded by the polynucleotides, and novel usages of these.

The inventors have developed a method for efficiently cloning, from a cDNA library having very high fullness-ratio, a human full-length cDNA that is predicted to be a full-length cDNA clone, where the cDNA library is synthesized by an improved method (WO 01/04286) of the oligo-capping method (K. Maruyama and S. Sugano, Gene, 138: 171-174 (1994); Y. Suzuki et al., Gene, 200: 149-156 (1997)). Then, the nucleotide sequences of cDNA clones whose fullness ratio is high, obtained by this method, were determined mainly from their 5′-ends, and, if required, from 3′-ends.

Further, representative clones, which were estimated to be novel and full-length, among the clones obtained, were analyzed for their full-length nucleotide sequences. The determined full-length nucleotide sequences were analyzed by BLAST homology search of the databases shown below. Because the homology search of the present invention is carried out based on the information of full-length cDNAs including the entire coding regions, homology to every part of a polypeptide can be analyzed. Thus, in the present invention, the reliability of homology search has been greatly improved.

[1] SwissProt (http://www.ebi.ac.uk/ebi_docsSwissProt_db/swisshome.html),

[2] GenBank (http://www.ncbi.nlm.nih.gov/web/GenBank),

[3] UniGene (Human) (http://www.ncbi.nlm.nih.gov/UniGene), and

[4] nr (a protein database, which has been constructed by combining data of coding sequences (CDS) in nucleotide sequences deposited in GenBank, and data of SwissProt, PDB (http://www.rcsb.org/pdb/index.html), PIR (http://pir.georgetown.edu/pirwww/pirhome.shtml), and PRF (http://www.prf.or.jp/en/); overlapping sequences have been removed.)

Further, the gene expression profiles of cDNA clones whose full-length nucleotide sequence had been determined were studied by analyzing the large-scale cDNA database constructed based on the 5′-end nucleotide sequences of cDNAs obtained. In addition to the analysis for the expression profile by computer, the profiles of gene expression in living cells were also determined by PCR. The present inventors revealed the usefulness of the genes of the present invention based on these analysis results.

In the present invention, gene functions were revealed by the analysis of expression profiles in silico based on the information of full-length nucleotide sequences. The expression profiles used in the expression frequency analysis were studied based on the database containing sufficient amount of fragment sequence data. The expression frequency analysis was carried out by referring, for these expression profiles, to the full-length nucleotide sequences of many cDNA clones obtained in the present invention. Thus, a highly reliable analysis can be achieved by referring to the full-length nucleotide sequences of a wide variety of genes for the sufficiently large population for analysis (expression profiles). Namely, the results of expression frequency analysis using the full-length sequences of the present invention more precisely reflect the gene expression frequency in tissues and cells from which a certain cDNA library was derived. In other words, the information of full-length cDNA nucleotide sequence of the present invention made it possible to achieve the highly reliable expression frequency analysis.

The full-length cDNA clones of this invention were obtained by the method comprising the steps of [1] preparing libraries containing cDNAs with the high fullness ratio by oligo-capping, and [2] assembling 5′-end sequences and selecting one with the highest probability of completeness in length in the cluster formed (there are many clones longer in the 5′-end direction). However, the uses of primers designed based on the 5′- and 3′-end sequences of polynucleotides provided by the present invention enable readily obtaining full-length cDNAs without such a special technique. The primer, which is designed to be used for obtaining cDNAs capable of being expressed, is not limited to the 5′- and 3′-end sequences of polynucleotide.

Specifically, the present invention relates to a polynucleotide selected from the group consisting of the following (a) to (g):

(a) a polynucleotide comprising a protein-coding region of the nucleotide sequence of any one of SEQ ID NOs shown in Table 1;

(b) a polynucleotide encoding a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs shown in Table 1;

(c) a polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs shown in Table 1, wherein, in said amino acid sequence, one or more amino acids have been substituted, deleted, inserted, and/or added, and wherein said nucleotide sequence encodes a polypeptide functionally equivalent to a polypeptide comprising the selected amino acid sequence;

(d) a polynucleotide hybridizing under stringent conditions to a polynucleotide comprising the nucleotide sequence of any one of SEQ ID NOs shown in Table 1, wherein said nucleotide sequence encodes a polypeptide functionally equivalent to a polypeptide encoded by the selected nucleotide sequence;

(e) a polynucleotide comprising a nucleotide sequence encoding a partial amino acid sequence of a polypeptide encoded by the polynucleotide according to any one of (a) to (d);

(f) a polynucleotide comprising a nucleotide sequence having at least 70% identity to the nucleotide sequence of (a); and

(g) a polynucleotide comprising a nucleotide sequence having at least 90% identity to the nucleotide sequence of (a).

The present invention also relates to a polypeptide encoded by the above-mentioned polynucleotide or a partial peptide thereof, an antibody binding to the polypeptide or the peptide, and a method for immunologically assaying the polypeptide or the peptide, which comprises the steps of contacting the polypeptide or the peptide with the antibody, and observing the binding between the two.

Furthermore, the present invention features a vector comprising the above-mentioned polynucleotide, a transformant carrying the polynucleotide or the vector, a transformant carrying the polynucleotide or the vector in an expressible manner, and a method for producing the polypeptide or the peptide, which comprises the steps of culturing the transformant and recovering an expression product.

Another feature of the present invention is an oligonucleotide comprising at least 15 nucleotides, said oligonucleotide comprising a nucleotide sequence complementary to the nucleotide sequence of any one of SEQ ID NOs: 1 to 1639 or to a complementary strand thereof. This oligonucleotide can be used as a primer for synthesizing the above-mentioned polynucleotide or used as a probe for detecting the polynucleotide. The present invention includes an antisense polynucleotide against the polynucleotide or a part thereof, and a method for detecting the polynucleotide, which comprises the following steps of:

a) incubating a target polynucleotide with the oligonucleotide under hybridizable conditions, and

b) detecting hybridization of the target polynucleotide with the oligonucleotide.

Still another feature of the present invention is a database of polynucleotides and/or polypeptides, said database comprising information on at least one of the nucleotide sequences of SEQ ID NOs: 1 to 1639 and/or on at least one of the amino acid sequences of SEQ ID NOs: 1640 to 3278.

Herein, “polynucleotide” is defined as a molecule, such as DNA and RNA, in which multiple nucleotides are polymerized. There are no limitations on the number of the polymerized nucleotides. In case that the polymer contains relatively low number of nucleotides, it is also described as an “oligonucleotide”, which is included in the “polynucleotide” of the present invention. The polynucleotide or the oligonucleotide of the present invention can be a natural or chemically synthesized product. Alternatively, it can be synthesized using a template polynucleotide by an enzymatic reaction such as PCR. Furthermore, the polynucleotide of the present invention may be modified chemically. Moreover, not only a single-strand polynucleotide but also a double-strand polynucleotide is included in the present invention. In this specification, especially in claims, when the polynucleotide is described merely as “polynucleotide”, it means not only a single-strand polynucleotide but also a double-strand polynucleotide. When it means double-strand polynucleotide, the nucleotide sequence of only one chain is indicated. However, based on the nucleotide sequence of a sense chain, the nucleotide sequence of the complementary strand thereof is essentially determined.

As used herein, an “isolated polynucleotide” is a polynucleotide the structure of which is not identical to that of any naturally occurring polynucleotide or to that of any fragment of a naturally occurring genomic polynucleotide spanning more than three separate genes. The term therefore includes, for example, (a) a DNA which has the sequence of part of a naturally occurring genomic DNA molecule in the genome of the organism in which it naturally occurs; (b) a polynucleotide incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion polypeptide. Specifically excluded from this definition are polynucleotides of DNA molecules present in mixtures of different (i) DNA molecules, (ii) transfected cells, or (iii) cell clones; e.g., as these occur in a DNA library such as a cDNA or genomic DNA library.

The term “substantially pure” as used herein in reference to a given protein or polypeptide means that the protein or polypeptide is substantially free from other biological macromolecules. For example, the substantially pure protein or polypeptide is at least 75%, 80%, 85%, 95%, or 99% pure by dry weight. Purity can be measured by any appropriate standard method known in the art, for example, by column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

All the cDNAs provided by the present invention are full-length cDNAs. The “full-length cDNA” herein means that the cDNA contains the ATG codon, which is the start point of translation therein. The untranslated regions upstream and downstream of the protein-coding region, both of which are naturally contained in natural mRNAs, are not indispensable. It is preferable that the full-length cDNAs of the present invention contain the stop codon.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the restriction map of the vector pME18SFL3.

DETAILED DESCRIPTION OF THE INVENTION

All the clones (1639 clones) of the present invention are novel and encode the full-length polypeptides. Further, all the clones are cDNAs with the high fullness ratio, which were obtained by oligo-capping method, and also clones which are not identical to any of known human mRNAs (namely, novel clones) selected by searching, for the 5′-end sequences, mRNA sequences with the annotation of “complete cds” in the GenBank and UniGene databases by using the BLAST homology search [S. F. Altschul, W. Gish, W. Miller, E. W. Myers & D. J. Lipman, J. Mol. Biol., 215: 403-410 (1990); W. Gish & D. J. States, Nature Genet., 3: 266-272 (1993)]; they are also clones that were assumed to have higher fullness ratio among the members in the cluster formed by assembling. Most of the clones assessed to have high fullness ratio in the cluster had the nucleotide sequences longer in the 5′-end direction.

All the full-length cDNAs of the present invention can be synthesized by a method such as PCR (Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley & Sons Section 6.1-6.4) using primer sets designed based on the 5′-end and 3′-end sequences or using primer sets of primers designed based on the 5′-end sequences and a primer of oligo dT sequence corresponding to poly A sequence. Table 1 contains the clone names of full-length cDNA of 1639 clones of the present invention, SEQ ID NOs of the full-length nucleotide sequences, CDS portions deduced from the full-length nucleotide sequences, and SEQ ID NOs of the translated amino acids. The positions of CDS are shown according to the rule of “DDBJ/EMBL/GenBank Feature Table Definition” (http://www.ncbi.nlm.nih.gov/collab/FT/index.html). The start position number corresponds to the first letter of “ATG” that is the nucleotide triplet encoding methionine; the termination position number corresponds to the third letter of the stop codon. These are indicated being flanked with the mark “ . . . ”. However, with respect to the clones having no stop codon, the termination position is indicated by the mark “>” according to the above rule.

TABLE 1
SEQ ID NO. SEQ ID NO.
Clone of nucleotide Position of amino acid
name sequence of CDS sequence
3NB6910000180 1 505 . . . 1434 1640
3NB6910000850 2 132 . . . 836 1641
3NB6910001160 3 85 . . . 702 1642
3NB6910001290 4 194 . . . 706 1643
3NB6910001730 5 166 . . . >1755 1644
3NB6920000290 6 991 . . . 1335 1645
3NB6920002810 7 8 . . . 1375 1646
3NB6920003300 8 128 . . . 901 1647
3NB6920005450 9 21 . . . 809 1648
3NB6920009120 10 247 . . . 1983 1649
3NB6920010020 11 59 . . . 913 1650
3NB6920010220 12 108 . . . 1289 1651
3NB6920013490 13 402 . . . 1214 1652
3NB6920014330 14 674 . . . 1516 1653
3NB6920014710 15 369 . . . >1990 1654
3NB6920015110 16 306 . . . 1163 1655
3NB6920015280 17 162 . . . 1847 1656
3NB6920015570 18 407 . . . 1903 1657
3NB6920016370 19 25 . . . 348 1658
3NB6920017190 20 151 . . . 1068 1659
ADRGL10000020 21 7 . . . 1773 1660
ADRGL10000180 22 1742 . . . 2110 1661
ADRGL10000650 23 425 . . . 1072 1662
ADRGL10001600 24 10 . . . 1407 1663
ADRGL10001650 25 107 . . . 1387 1664
ADRGL10001820 26 2165 . . . 2467 1665
ADRGL20000740 27 114 . . . 1349 1666
ADRGL20003230 28 118 . . . 516 1667
ADRGL20004280 29 169 . . . 477 1668
ASTR010000180 30 158 . . . 2716 1669
ASTR020000950 31 110 . . . 1315 1670
ASTR020004170 32 1121 . . . 1732 1671
ASTR020004800 33 1177 . . . 1539 1672
BGGI110002850 34 1119 . . . 1460 1673
BGGI120001610 35 454 . . . 1185 1674
BGGI120005330 36 79 . . . 1548 1675
BGGI120005440 37 453 . . . 1661 1676
BGGI120006840 38 140 . . . 1303 1677
BGGI120006930 39 38 . . . 1627 1678
BGGI120010970 40 264 . . . 2078 1679
BGGI120017140 41 140 . . . 1009 1680
BNGH410000030 42 780 . . . 1967 1681
BNGH410000130 43 1087 . . . 1539 1682
BNGH410000170 44 1466 . . . 1801 1683
BNGH410000290 45 51 . . . 1661 1684
BNGH410000330 46 2453 . . . 2782 1685
BNGH410000340 47 539 . . . 1477 1686
BNGH410000390 48 134 . . . 1135 1687
BNGH410000800 49 232 . . . 549 1688
BNGH410001040 50 146 . . . 1651 1689
BNGH410001180 51 166 . . . >2624 1690
BNGH410001370 52 61 . . . 1740 1691
BNGH410001530 53 1368 . . . 1760 1692
BNGH410001770 54 82 . . . 1773 1693
BNGH410001900 55 113 . . . >2458 1694
BNGH410001980 56 97 . . . 1476 1695
BNGH420004740 57 1171 . . . 1473 1696
BNGH420005320 58 354 . . . 1937 1697
BRACE10000200 59 959 . . . 1267 1698
BRACE10000420 60 214 . . . 1332 1699
BRACE10000700 61 181 . . . 900 1700
BRACE10000730 62 168 . . . 698 1701
BRACE10000930 63 45 . . . 1388 1702
BRACE10001150 64 76 . . . 624 1703
BRACE10001590 65 225 . . . 767 1704
BRACE10001660 66 777 . . . 1325 1705
BRACE10001690 67 557 . . . 889 1706
BRACE10001870 68 85 . . . 1704 1707
BRACE20000770 69 162 . . . 605 1708
BRACE20001000 70 1122 . . . 1430 1709
BRACE20001410 71 229 . . . 975 1710
BRACE20002800 72 35 . . . 1663 1711
BRACE20003320 73 471 . . . 2063 1712
BRACE20004210 74 1562 . . . 2716 1713
BRACE20005050 75 711 . . . 1013 1714
BRACE20005250 76 617 . . . 1144 1715
BRACE20005450 77 184 . . . 498 1716
BRACE20005650 78 272 . . . 841 1717
BRACE20005770 79 514 . . . 816 1718
BRACE20006980 80 85 . . . 1446 1719
BRACE20007180 81 1263 . . . 1679 1720
BRACE20008850 82 596 . . . >1809 1721
BRACE20009880 83 1761 . . . 2069 1722
BRACE20010650 84 1257 . . . 1922 1723
BRACE20010700 85 1680 . . . >1989 1724
BRACE20011170 86 87 . . . 410 1725
BRACE20011430 87 1550 . . . 2041 1726
BRACE20011880 88 742 . . . 1104 1727
BRACE20013400 89 1495 . . . 1890 1728
BRACE20013520 90 677 . . . 1048 1729
BRACE20013740 91 1694 . . . 2317 1730
BRACE20013750 92 821 . . . 1192 1731
BRACE20014230 93 1523 . . . 1978 1732
BRACE20014530 94 1747 . . . 2205 1733
BRACE20014550 95 921 . . . 1838 1734
BRACE20014770 96 351 . . . 1286 1735
BRACE20014920 97 1306 . . . 1638 1736
BRACE20015080 98 39 . . . 545 1737
BRACE20015430 99 235 . . . 579 1738
BRACE20016730 100 445 . . . 828 1739
BRACE20016920 101 96 . . . 569 1740
BRACE20017370 102 1612 . . . 2082 1741
BRACE20018550 103 152 . . . 2008 1742
BRACE20018590 104 902 . . . 1408 1743
BRACE20018650 105 1143 . . . 1529 1744
BRACE20018980 106 2178 . . . 2558 1745
BRACE20019440 107 225 . . . 1205 1746
BRACE20020500 108 605 . . . 1372 1747
BRACE20020910 109 283 . . . 1176 1748
BRACE20021510 110 1003 . . . 1653 1749
BRACE20021760 111 393 . . . 1148 1750
BRACE20022020 112 717 . . . 1727 1751
BRACE20022270 113 3 . . . 353 1752
BRACE20024090 114 165 . . . 845 1753
BRACE20024310 115 2292 . . . 2618 1754
BRACE20024680 116 65 . . . 1129 1755
BRACE20024780 117 297 . . . 1154 1756
BRACE20024950 118 49 . . . 369 1757
BRACE20025900 119 636 . . . 941 1758
BRACE20026350 120 106 . . . 753 1759
BRACE20026850 121 113 . . . 1063 1760
BRACE20027360 122 1147 . . . 1680 1761
BRACE20027520 123 613 . . . 1215 1762
BRACE20027550 124 168 . . . 578 1763
BRACE20027720 125 169 . . . 777 1764
BRACE20027920 126 105 . . . 1496 1765
BRACE20027960 127 1731 . . . 2132 1766
BRACE20028120 128 408 . . . 917 1767
BRACE20028600 129 784 . . . 1593 1768
BRACE20028610 130 774 . . . 1196 1769
BRACE20028960 131 63 . . . 1472 1770
BRACE20030780 132 236 . . . 637 1771
BRACE20031100 133 214 . . . 2565 1772
BRACE20032850 134 698 . . . 1327 1773
BRACE20033190 135 202 . . . 531 1774
BRACE20033980 136 811 . . . 1215 1775
BRACE20034310 137 526 . . . 1461 1776
BRACE20034490 138 1316 . . . 1699 1777
BRACE20035160 139 492 . . . 896 1778
BRACE20035270 140 572 . . . 1099 1779
BRACE20035390 141 891 . . . 1211 1780
BRACE20035940 142 80 . . . 601 1781
BRACE20071380 143 190 . . . 1335 1782
BRACE20071530 144 62 . . . 604 1783
BRACE20071740 145 118 . . . 1800 1784
BRACE20071970 146 1584 . . . 1895 1785
BRACE20072010 147 422 . . . 1114 1786
BRACE20072320 148 266 . . . 583 1787
BRACE20072810 149 858 . . . 1193 1788
BRACE20074010 150 92 . . . 1246 1789
BRACE20074470 151 742 . . . 2109 1790
BRACE20075020 152 2248 . . . 2553 1791
BRACE20075270 153 1740 . . . 2285 1792
BRACE20075380 154 1455 . . . 1889 1793
BRACE20075630 155 996 . . . 1445 1794
BRACE20076210 156 850 . . . 1509 1795
BRACE20076410 157 78 . . . 1040 1796
BRACE20076460 158 1368 . . . 1709 1797
BRACE20076630 159 634 . . . 996 1798
BRACE20076850 160 598 . . . 984 1799
BRACE20077080 161 119 . . . 853 1800
BRACE20077270 162 95 . . . 445 1801
BRACE20077610 163 239 . . . 553 1802
BRACE20077640 164 595 . . . 900 1803
BRACE20077670 165 317 . . . 649 1804
BRACE20077680 166 2013 . . . 2390 1805
BRACE20077840 167 18 . . . 524 1806
BRACE20077980 168 855 . . . 1604 1807
BRACE20078680 169 1144 . . . >1753 1808
BRACE20078820 170 2 . . . 580 1809
BRACE20079020 171 1178 . . . 1681 1810
BRACE20079530 172 8 . . . 331 1811
BRACE20080970 173 1025 . . . 1348 1812
BRACE20081140 174 14 . . . 463 1813
BRACE20083800 175 71 . . . 1201 1814
BRACE20083850 176 183 . . . 1046 1815
BRACE20084430 177 1035 . . . 1649 1816
BRACE20084800 178 57 . . . 845 1817
BRACE20084880 179 1234 . . . 1617 1818
BRACE20086530 180 405 . . . 914 1819
BRACE20086550 181 219 . . . 632 1820
BRACE20087080 182 31 . . . 342 1821
BRACE20087540 183 1013 . . . 1459 1822
BRACE20088570 184 42 . . . 365 1823
BRACE20089600 185 121 . . . 630 1824
BRACE20089990 186 446 . . . 928 1825
BRACE20090140 187 677 . . . 979 1826
BRACE20091880 188 18 . . . 539 1827
BRACE20092120 189 160 . . . 1959 1828
BRACE20092740 190 255 . . . 905 1829
BRACE20092750 191 1450 . . . 1827 1830
BRACE20093070 192 562 . . . 1158 1831
BRACE20093110 193 1581 . . . 1940 1832
BRACE20093610 194 1337 . . . >1783 1833
BRACE20094370 195 826 . . . 1149 1834
BRACE20095170 196 1657 . . . 1959 1835
BRAWH10000010 197 1241 . . . 2050 1836
BRAWH10000020 198 869 . . . >1920 1837
BRAWH10000070 199 560 . . . 2242 1838
BRAWH10000370 200 161 . . . 787 1839
BRAWH10000940 201 203 . . . 2020 1840
BRAWH10001300 202 256 . . . 2025 1841
BRAWH10001620 203 109 . . . 1128 1842
BRAWH10001640 204 185 . . . 613 1843
BRAWH10001680 205 229 . . . 987 1844
BRAWH10001740 206 277 . . . 1383 1845
BRAWH10001800 207 182 . . . 601 1846
BRAWH20000340 208 2214 . . . 2537 1847
BRAWH20000480 209 218 . . . 1117 1848
BRAWH20000930 210 1521 . . . 1904 1849
BRAWH20001090 211 356 . . . 2014 1850
BRAWH20001770 212 69 . . . 476 1851
BRAWH20002480 213 1385 . . . 1777 1852
BRAWH20003230 214 232 . . . 780 1853
BRAWH20004430 215 222 . . . 2186 1854
BRAWH20004760 216 22 . . . 564 1855
BRAWH20005030 217 1431 . . . 1754 1856
BRAWH20005220 218 98 . . . 700 1857
BRAWH20005540 219 416 . . . 811 1858
BRAWH20006330 220 854 . . . 1741 1859
BRAWH20006510 221 438 . . . 1163 1860
BRAWH20006860 222 599 . . . 2179 1861
BRAWH20006970 223 1178 . . . 1579 1862
BRAWH20008660 224 505 . . . 924 1863
BRAWH20008920 225 2179 . . . 2529 1864
BRAWH20009010 226 1139 . . . 1540 1865
BRAWH20009440 227 422 . . . 1603 1866
BRAWH20009840 228 826 . . . 1764 1867
BRAWH20011030 229 1881 . . . 2186 1868
BRAWH20011290 230 71 . . . 1444 1869
BRAWH20011410 231 251 . . . 718 1870
BRAWH20011660 232 104 . . . 1411 1871
BRAWH20012030 233 55 . . . 684 1872
BRAWH20014180 234 5 . . . 751 1873
BRAWH20014380 235 795 . . . 1130 1874
BRAWH20014610 236 743 . . . 1216 1875
BRAWH20014840 237 404 . . . 2227 1876
BRAWH20015030 238 861 . . . 1232 1877
BRAWH20036890 239 319 . . . 864 1878
BRAWH20036930 240 28 . . . 3078 1879
BRAWH20038320 241 998 . . . 1306 1880
BRAWH20040950 242 1867 . . . 2205 1881
BRAWH20047310 243 47 . . . 547 1882
BRAWH20052250 244 30 . . . 398 1883
BRAWH20059980 245 161 . . . 1900 1884
BRAWH20060440 246 65 . . . 2083 1885
BRAWH20064500 247 209 . . . 1675 1886
BRAWH20064930 248 403 . . . 1908 1887
BRAWH20066220 249 1395 . . . >2080 1888
BRAWH20069600 250 1482 . . . 1976 1889
BRAWH20069890 251 444 . . . 1226 1890
BRAWH20074060 252 1028 . . . 1429 1891
BRAWH20076050 253 45 . . . 1469 1892
BRAWH20087060 254 1160 . . . 2053 1893
BRAWH20089030 255 346 . . . 825 1894
BRAWH20089560 256 87 . . . 2906 1895
BRAWH20092270 257 223 . . . 1062 1896
BRAWH20092610 258 258 . . . 791 1897
BRAWH20093600 259 21 . . . 644 1898
BRAWH20094850 260 1213 . . . 1536 1899
CD34C20000510 261 7 . . . 1380 1900
CTONG20003030 262 2228 . . . 2641 1901
CTONG20005890 263 294 . . . 3017 1902
CTONG20007710 264 1088 . . . 1468 1903
CTONG20008270 265 863 . . . 2080 1904
CTONG20011390 266 50 . . . 3337 1905
CTONG20013200 267 123 . . . 1823 1906
CTONG20013660 268 3 . . . 1571 1907
CTONG20015330 269 87 . . . 527 1908
CTONG20018200 270 42 . . . >3217 1909
CTONG20019110 271 511 . . . 1455 1910
CTONG20019550 272 162 . . . >3684 1911
CTONG20020730 273 20 . . . 1342 1912
CTONG20021430 274 74 . . . >2745 1913
CTONG20024180 275 641 . . . 2452 1914
CTONG20024530 276 618 . . . 986 1915
CTONG20025580 277 1281 . . . 2177 1916
CTONG20027210 278 366 . . . >2763 1917
CTONG20028030 279 837 . . . 1280 1918
CTONG20028160 280 301 . . . 2799 1919
CTONG20028200 281 148 . . . >3543 1920
CTONG20029650 282 118 . . . >2551 1921
CTONG20037820 283 332 . . . 895 1922
CTONG20047160 284 113 . . . 1021 1923
CTONG20055530 285 63 . . . >2305 1924
CTONG20064490 286 1533 . . . 1859 1925
D3OST20001840 287 77 . . . 1429 1926
DFNES20002120 288 1263 . . . 1940 1927
DFNES20002680 289 505 . . . 2571 1928
DFNES20002920 290 52 . . . 639 1929
DFNES20003350 291 33 . . . 1007 1930
DFNES20004320 292 1517 . . . 1849 1931
FCBBF10005980 293 375 . . . 2141 1932
FCBBF10006180 294 1161 . . . 1463 1933
FCBBF10006750 295 106 . . . 1023 1934
FCBBF10006860 296 521 . . . 865 1935
FCBBF10006870 297 410 . . . 1831 1936
FCBBF10006910 298 111 . . . 482 1937
FCBBF10007320 299 1236 . . . 1850 1938
FCBBF10007600 300 68 . . . 523 1939
FCBBF20000940 301 249 . . . 2147 1940
FCBBF20001050 302 29.421 1941
FCBBF20001950 303 1565 . . . 1888 1942
FCBBF20002320 304 921 . . . 2003 1943
FCBBF20002760 305 221 . . . 895 1944
FCBBF20005760 306 693 . . . 1073 1945
FCBBF20005910 307 29 . . . >2161 1946
FCBBF20006770 308 265 . . . 600 1947
FCBBF20007330 309 745 . . . 1077 1948
FCBBF20008080 310 180 . . . 821 1949
FCBBF20008150 311 641 . . . 1762 1950
FCBBF20009400 312 360 . . . 749 1951
FCBBF20009510 313 218 . . . 1333 1952
FCBBF20012110 314 136 . . . 1776 1953
FCBBF20012990 315 758 . . . 1168 1954
FCBBF20014800 316 146 . . . 1957 1955
FCBBF20015380 317 302 . . . 1246 1956
FCBBF20016720 318 51 . . . 488 1957
FCBBF20017180 319 236 . . . 598 1958
FCBBF20017200 320 2306 . . . 2767 1959
FCBBF40002820 321 207 . . . 1247 1960
FCBBF50002610 322 126 . . . 1634 1961
FEBRA20000350 323 724 . . . 1764 1962
FEBRA20000530 324 359 . . . 2221 1963
FEBRA20001050 325 496 . . . 2355 1964
FEBRA20001290 326 872 . . . 1192 1965
FEBRA20003110 327 386 . . . 964 1966
FEBRA20003300 328 1504 . . . 1881 1967
FEBRA20003770 329 398 . . . 2464 1968
FEBRA20003780 330 454 . . . 873 1969
FEBRA20003910 331 1728 . . . 2057 1970
FEBRA20003970 332 162 . . . 1469 1971
FEBRA20003990 333 845 . . . 2404 1972
FEBRA20004040 334 21 . . . 449 1973
FEBRA20004150 335 836 . . . 2494 1974
FEBRA20004520 336 113 . . . 442 1975
FEBRA20004540 337 934 . . . 2484 1976
FEBRA20004910 338 1417 . . . 1926 1977
FEBRA20005360 339 254 . . . 1453 1978
FEBRA20006560 340 34 . . . 615 1979
FEBRA20006800 341 303 . . . 1040 1980
FEBRA20006900 342 1268 . . . 1669 1981
FEBRA20007330 343 1486 . . . 2013 1982
FEBRA20007400 344 32 . . . 1123 1983
FEBRA20007570 345 222 . . . 1193 1984
FEBRA20007710 346 1059 . . . 1361 1985
FEBRA20007720 347 267 . . . 689 1986
FEBRA20007870 348 1174 . . . 1788 1987
FEBRA20008090 349 1319 . . . 1621 1988
FEBRA20008560 350 1500 . . . 1991 1989
FEBRA20008740 351 2051 . . . 2368 1990
FEBRA20008800 352 38 . . . 703 1991
FEBRA20008810 353 377 . . . 1495 1992
FEBRA20009010 354 243 . . . 638 1993
FEBRA20009590 355 1345 . . . 1677 1994
FEBRA20009720 356 530 . . . 2140 1995
FEBRA20010930 357 239 . . . 1249 1996
FEBRA20011330 358 1795 . . . 2322 1997
FEBRA20011460 359 2219 . . . 2602 1998
FEBRA20011970 360 1672 . . . 1977 1999
FEBRA20012270 361 1933 . . . 2238 2000
FEBRA20012450 362 519 . . . 2678 2001
FEBRA20012940 363 69 . . . 575 2002
FEBRA20013510 364 990 . . . 1313 2003
FEBRA20014870 365 1567 . . . 1884 2004
FEBRA20014920 366 77 . . . 2815 2005
FEBRA20015840 367 702 . . . 1853 2006
FEBRA20015900 368 1535 . . . 1882 2007
FEBRA20015910 369 246 . . . 617 2008
FEBRA20017060 370 730 . . . 1257 2009
FEBRA20017150 371 391 . . . 2799 2010
FEBRA20017900 372 72 . . . 647 2011
FEBRA20019890 373 497 . . . 2239 2012
FEBRA20020860 374 281 . . . 673 2013
FEBRA20021910 375 1455 . . . 1829 2014
FEBRA20021940 376 17 . . . 493 2015
FEBRA20024290 377 35 . . . 1933 2016
FEBRA20024420 378 991 . . . 1614 2017
FEBRA20025250 379 251 . . . 2164 2018
FEBRA20027270 380 10 . . . 930 2019
FEBRA20027830 381 293 . . . 610 2020
FEBRA20028820 382 1337 . . . 1678 2021
FEBRA20028970 383 824 . . . 1303 2022
FEBRA20029080 384 90 . . . 764 2023
FEBRA20030540 385 292 . . . 993 2024
FEBRA20031550 386 2000 . . . 2365 2025
FEBRA20033080 387 399 . . . 749 2026
FEBRA20034290 388 348 . . . 854 2027
FEBRA20037070 389 1830 . . . >2246 2028
FEBRA20041100 390 198 . . . 1010 2029
FEBRA20041910 391 39 . . . 425 2030
FEBRA20042240 392 1373 . . . 1714 2031
FEBRA20042370 393 51 . . . 938 2032
FEBRA20042930 394 2321 . . . >2652 2033
FEBRA20043250 395 394 . . . >2294 2034
FEBRA20043290 396 57 . . . 2984 2035
FEBRA20044120 397 928 . . . 1263 2036
FEBRA20044430 398 192 . . . 539 2037
FEBRA20044900 399 78 . . . 1763 2038
FEBRA20045920 400 344 . . . 1438 2039
FEBRA20048180 401 86 . . . 493 2040
FEBRA20050140 402 727 . . . 2325 2041
FEBRA20050790 403 780 . . . 1295 2042
FEBRA20052160 404 1055 . . . 1411 2043
FEBRA20053770 405 790 . . . 1197 2044
FEBRA20053800 406 213 . . . 521 2045
FEBRA20054270 407 1711 . . . 2058 2046
FEBRA20057260 408 8 . . . 1789 2047
FEBRA20057520 409 13 . . . 480 2048
FEBRA20057780 410 150 . . . 641 2049
FEBRA20057880 411 8 . . . >3165 2050
FEBRA20059980 412 1160 . . . 2017 2051
FEBRA20060920 413 26 . . . 661 2052
FEBRA20061500 414 77 . . . 460 2053
FEBRA20062700 415 32 . . . 778 2054
FEBRA20063150 416 236 . . . 538 2055
FEBRA20063540 417 1402 . . . 1737 2056
FEBRA20064760 418 340 . . . 2076 2057
FEBRA20066270 419 278 . . . 691 2058
FEBRA20066670 420 1933 . . . 2496 2059
FEBRA20067360 421 160 . . . 1713 2060
FEBRA20067930 422 1332 . . . 1973 2061
FEBRA20068730 423 171 . . . 2051 2062
FEBRA20069420 424 231 . . . 1439 2063
FEBRA20070170 425 88 . . . 921 2064
FEBRA20072000 426 47 . . . 2065 2065
FEBRA20072800 427 1850 . . . 2335 2066
FEBRA20074140 428 57 . . . 371 2067
FEBRA20074580 429 91 . . . 420 2068
FEBRA20075510 430 181 . . . 606 2069
FEBRA20075660 431 1960 . . . 2298 2070
FEBRA20076220 432 147 . . . 2525 2071
HCASM10000210 433 384 . . . 1154 2072
HCASM10000610 434 317 . . . 871 2073
HCASM10001150 435 473 . . . 868 2074
HCASM20002020 436 152 . . . 469 2075
HCASM20002140 437 408 . . . 1136 2076
HCASM20003070 438 48 . . . 1865 2077
HCASM20005340 439 1003 . . . 1368 2078
HCASM20005360 440 2211 . . . 2618 2079
HEART20000350 441 514 . . . 1290 2080
HEART20000990 442 1341 . . . 1670 2081
HEART20003090 443 1133 . . . 1657 2082
HEART20004110 444 39 . . . 1415 2083
HEART20004480 445 863 . . . 1171 2084
HEART20004920 446 159 . . . 851 2085
HEART20005060 447 95 . . . 1495 2086
HEART20005200 448 938 . . . 1375 2087
HEART20005680 449 783 . . . 1139 2088
HHDPC20000550 450 55 . . . 1320 2089
HHDPC20000950 451 338 . . . 1462 2090
HHDPC20001150 452 326 . . . 925 2091
HHDPC20001490 453 337 . . . 2265 2092
HHDPC20003150 454 506 . . . 1711 2093
HHDPC20004550 455 197 . . . 2065 2094
HHDPC20004560 456 174 . . . >2424 2095
HHDPC20004620 457 17 . . . 865 2096
HLUNG10000240 458 1439 . . . 1762 2097
HLUNG10000300 459 205 . . . 555 2098
HLUNG10000370 460 14 . . . 1930 2099
HLUNG10000640 461 144 . . . 1514 2100
HLUNG10000760 462 80 . . . 1246 2101
HLUNG10000990 463 67 . . . 2370 2102
HLUNG10001050 464 1081 . . . 1614 2103
HLUNG10001100 465 302 . . . 703 2104
HLUNG20000680 466 187 . . . 1527 2105
HLUNG20001160 467 391 . . . 1434 2106
HLUNG20001250 468 360 . . . 899 2107
HLUNG20001420 469 173 . . . 1600 2108
HLUNG20001760 470 6 . . . 524 2109
HLUNG20002550 471 1101 . . . 1865 2110
HLUNG20003140 472 36 . . . 359 2111
HLUNG20004120 473 416 . . . 820 2112
HLUNG20004800 474 1400 . . . 1711 2113
HLUNG20005010 475 37 . . . 966 2114
HSYRA10001190 476 159 . . . 1712 2115
HSYRA10001370 477 194 . . . 1903 2116
HSYRA10001480 478 27 . . . 614 2117
HSYRA10001680 479 59 . . . >2245 2118
HSYRA10001780 480 598 . . . 1023 2119
HSYRA20001350 481 218 . . . 2371 2120
HSYRA20002480 482 670 . . . 972 2121
HSYRA20002530 483 214 . . . 780 2122
HSYRA20003470 484 1134 . . . 1580 2123
HSYRA20005100 485 138 . . . 1379 2124
HSYRA20006050 486 66 . . . 1199 2125
HSYRA20006290 487 222 . . . 1160 2126
HSYRA20006400 488 648 . . . 1052 2127
HSYRA20007600 489 389 . . . 1207 2128
HSYRA20008280 490 1492 . . . 1821 2129
HSYRA20011030 491 572 . . . >2236 2130
HSYRA20011530 492 653 . . . 955 2131
HSYRA20013320 493 3 . . . 956 2132
HSYRA20014200 494 326 . . . 1237 2133
HSYRA20014760 495 46 . . . 783 2134
HSYRA20015740 496 117 . . . 947 2135
HSYRA20015800 497 1100 . . . 1435 2136
HSYRA20016210 498 81 . . . 470 2137
HSYRA20016310 499 317 . . . 1105 2138
IMR3210000440 500 313 . . . 1560 2139
IMR3210000740 501 1215 . . . 1616 2140
IMR3210000750 502 722 . . . 1054 2141
IMR3210001580 503 125 . . . 1249 2142
IMR3210001650 504 903 . . . 1391 2143
IMR3210002420 505 194 . . . 1255 2144
IMR3210002660 506 38 . . . 1423 2145
IMR3220002230 507 25 . . . 945 2146
IMR3220003020 508 403 . . . 1425 2147
IMR3220006090 509 8 . . . 442 2148
IMR3220007420 510 15 . . . 614 2149
IMR3220007750 511 197 . . . >1670 2150
IMR3220007910 512 934 . . . 1515 2151
IMR3220008380 513 228 . . . 1142 2152
IMR3220008590 514 756 . . . 1061 2153
IMR3220008630 515 94 . . . 1197 2154
IMR3220009190 516 31 . . . 1293 2155
IMR3220009350 517 20 . . . 421 2156
IMR3220009530 518 2 . . . 394 2157
IMR3220009730 519 102 . . . >2141 2158
IMR3220009840 520 246 . . . 554 2159
IMR3220011850 521 271 . . . 1026 2160
IMR3220012180 522 76 . . . 1521 2161
IMR3220013170 523 393 . . . 1028 2162
IMR3220013320 524 22 . . . 1140 2163
IMR3220014350 525 807 . . . 2027 2164
IMR3220014910 526 79 . . . 639 2165
IMR3220016000 527 8 . . . 532 2166
IMR3220017240 528 1114 . . . 1458 2167
KIDNE10000080 529 346 . . . 1233 2168
KIDNE10000280 530 1864 . . . 2181 2169
KIDNE10000500 531 662 . . . 1108 2170
KIDNE10001040 532 115 . . . 1656 2171
KIDNE10001430 533 560 . . . 1051 2172
KIDNE10001450 534 7 . . . 483 2173
KIDNE10001520 535 74 . . . 712 2174
KIDNE20000410 536 712 . . . 1215 2175
KIDNE20000510 537 188 . . . 1717 2176
KIDNE20000700 538 843 . . . 2135 2177
KIDNE20000850 539 19 . . . 1071 2178
KIDNE20001670 540 727 . . . 1725 2179
KIDNE20001920 541 1648 . . . 2070 2180
KIDNE20002440 542 163 . . . 468 2181
KIDNE20002450 543 1273 . . . 1653 2182
KIDNE20002660 544 1929 . . . 2249 2183
KIDNE20003150 545 926 . . . 1306 2184
KIDNE20003300 546 1205 . . . 2230 2185
KIDNE20003490 547 219 . . . 1523 2186
KIDNE20003750 548 732 . . . 1568 2187
KIDNE20004030 549 194 . . . 3142 2188
KIDNE20004220 550 1699 . . . 2217 2189
KIDNE20004970 551 274 . . . 1479 2190
KIDNE20005130 552 404 . . . 1417 2191
KIDNE20005170 553 57 . . . 944 2192
KIDNE20005190 554 530 . . . 1045 2193
KIDNE20005740 555 32 . . . 1309 2194
KIDNE20031850 556 1050 . . . >1998 2195
KIDNE20033050 557 121 . . . 1719 2196
KIDNE20033350 558 1999 . . . 2304 2197
KIDNE20033570 559 269 . . . 634 2198
KIDNE20033730 560 408 . . . 2366 2199
KIDNE20033770 561 1256 . . . 1603 2200
KIDNE20037520 562 1032 . . . 1637 2201
KIDNE20039410 563 263 . . . 928 2202
KIDNE20039940 564 133 . . . 1134 2203
KIDNE20040340 565 460 . . . 768 2204
KIDNE20040540 566 5 . . . 1276 2205
KIDNE20040840 567 5 . . . >3343 2206
KIDNE20042620 568 1312 . . . 1716 2207
KIDNE20042940 569 213 . . . 611 2208
KIDNE20042950 570 72 . . . 476 2209
KIDNE20043440 571 49 . . . 2136 2210
KIDNE20044110 572 167 . . . 1708 2211
KIDNE20045200 573 1455 . . . 1955 2212
KIDNE20045340 574 44 . . . 919 2213
KIDNE20045790 575 1561 . . . 2085 2214
KIDNE20046810 576 398 . . . 1066 2215
KIDNE20048280 577 124 . . . 2010 2216
KIDNE20048640 578 1437 . . . 1775 2217
KIDNE20048790 579 348 . . . 701 2218
KIDNE20049810 580 909 . . . 2108 2219
KIDNE20050420 581 183 . . . 2351 2220
KIDNE20052960 582 1105 . . . 1461 2221
KIDNE20053360 583 1054 . . . 1470 2222
KIDNE20054000 584 1246 . . . 1596 2223
KIDNE20054770 585 99 . . . 1511 2224
KIDNE20056290 586 398 . . . 1306 2225
KIDNE20056760 587 375 . . . 1493 2226
KIDNE20059080 588 44 . . . >2546 2227
KIDNE20059370 589 1683 . . . 2018 2228
KIDNE20060140 590 52 . . . 1572 2229
KIDNE20060300 591 42 . . . 530 2230
KIDNE20060530 592 136 . . . 2208 2231
KIDNE20060620 593 31 . . . 687 2232
KIDNE20061490 594 824 . . . 1327 2233
KIDNE20062480 595 649 . . . 963 2234
KIDNE20062990 596 72 . . . 1334 2235
KIDNE20063530 597 710 . . . 1105 2236
KIDNE20063760 598 1332 . . . 1724 2237
KIDNE20066520 599 112 . . . 435 2238
KIDNE20067600 600 677 . . . 1795 2239
KIDNE20067750 601 54 . . . 2228 2240
KIDNE20068800 602 1048 . . . 1473 2241
KIDNE20070050 603 1672 . . . 2001 2242
KIDNE20070770 604 610 . . . 1845 2243
KIDNE20071860 605 1662 . . . 1973 2244
KIDNE20073280 606 24 . . . 1898 2245
KIDNE20073520 607 332 . . . 2140 2246
KIDNE20073560 608 171 . . . 497 2247
KIDNE20074220 609 1496 . . . 1879 2248
KIDNE20075690 610 231 . . . 911 2249
KIDNE20078100 611 714 . . . 1373 2250
KIDNE20078110 612 166 . . . 1482 2251
LIVER10000580 613 1704 . . . 2108 2252
LIVER10000670 614 33 . . . 2063 2253
LIVER10000790 615 98 . . . 1072 2254
LIVER10000990 616 1451 . . . 2065 2255
LIVER10001040 617 710 . . . 1759 2256
LIVER10001110 618 549 . . . 878 2257
LIVER10001750 619 1737 . . . 2156 2258
LIVER10002300 620 861 . . . 1565 2259
LIVER10002780 621 2235 . . . 2699 2260
LIVER10003030 622 2310 . . . 2621 2261
LIVER10004330 623 22 . . . 2130 2262
LIVER10005420 624 131 . . . 2035 2263
LIVER20000330 625 135 . . . 839 2264
LIVER20000370 626 1158 . . . 2138 2265
LIVER20004160 627 1625 . . . 1966 2266
LIVER20004460 628 882 . . . 1307 2267
LIVER20005150 629 1453 . . . 2262 2268
MAMGL10000320 630 71 . . . 1792 2269
MAMGL10000350 631 307 . . . 2721 2270
MAMGL10000560 632 78 . . . 623 2271
MAMGL10001780 633 1019 . . . 1618 2272
MAMGL10001820 634 92 . . . 1405 2273
MAMGL10001840 635 636 . . . 1181 2274
MESAN10000350 636 362 . . . 1843 2275
MESAN10001010 637 54 . . . 2279 2276
MESAN10001470 638 1571 . . . 1906 2277
MESAN10001800 639 482 . . . 1900 2278
MESAN20000920 640 546 . . . 2213 2279
MESAN20001490 641 652 . . . >2706 2280
MESAN20002670 642 1092 . . . 1535 2281
MESAN20002910 643 1625 . . . 2269 2282
MESAN20003370 644 198 . . . 521 2283
MESAN20005010 645 183 . . . 1550 2284
NB9N410000470 646 329 . . . >1714 2285
NB9N410001210 647 74 . . . 1786 2286
NB9N410001350 648 194 . . . 619 2287
NB9N410001460 649 678 . . . 1136 2288
NB9N420000420 650 596 . . . 928 2289
NB9N420001040 651 12 . . . 2030 2290
NB9N420004950 652 1929 . . . 2648 2291
NES0P10000870 653 793 . . . 1554 2292
NHNPC10000840 654 720 . . . >1934 2293
NHNPC10001010 655 119 . . . 541 2294
NHNPC10001240 656 1513 . . . 1860 2295
NHNPC20002060 657 113 . . . 1351 2296
NHNPC20002120 658 98 . . . 1195 2297
NT2NE10000040 659 274 . . . 618 2298
NT2NE10000140 660 232 . . . >2244 2299
NT2NE10000180 661 131 . . . 1189 2300
NT2NE10000230 662 172 . . . 483 2301
NT2NE10000630 663 175 . . . 1317 2302
NT2NE10000730 664 585 . . . 1364 2303
NT2NE10000830 665 556 . . . 1179 2304
NT2NE10001200 666 431 . . . 874 2305
NT2NE10001630 667 600 . . . 1013 2306
NT2NE10001850 668 23 . . . 1960 2307
NT2NE20000380 669 408 . . . 962 2308
NT2NE20000560 670 93 . . . >1858 2309
NT2NE20000640 671 731 . . . 1063 2310
NT2NE20001740 672 1 . . . 1638 2311
NT2NE20002140 673 56 . . . 2053 2312
NT2NE20002590 674 233 . . . 961 2313
NT2NE20002990 675 117 . . . 1565 2314
NT2NE20003270 676 127 . . . >2256 2315
NT2NE20003690 677 534 . . . 893 2316
NT2NE20003840 678 91 . . . 2403 2317
NT2NE20003920 679 372 . . . 749 2318
NT2NE20004550 680 31 . . . 852 2319
NT2NE20004700 681 1569 . . . 2048 2320
NT2NE20005170 682 217 . . . 990 2321
NT2NE20005360 683 1412 . . . 1717 2322
NT2NE20005500 684 574 . . . 1605 2323
NT2NE20005860 685 289 . . . 996 2324
NT2NE20006360 686 1383 . . . >2954 2325
NT2NE20006580 687 937 . . . 2073 2326
NT2NE20007060 688 640 . . . 1053 2327
NT2NE20007630 689 11 . . . 679 2328
NT2NE20007870 690 508 . . . 1092 2329
NT2NE20008020 691 420 . . . 776 2330
NT2NE20008090 692 328 . . . 1995 2331
NT2NE20009800 693 547 . . . 1164 2332
NT2NE20011560 694 78 . . . 1037 2333
NT2NE20012470 695 204 . . . 614 2334
NT2NE20013240 696 747 . . . 1079 2335
NT2NE20013370 697 1229 . . . 2533 2336
NT2NE20013640 698 1854 . . . 2264 2337
NT2NE20013720 699 159 . . . 695 2338
NT2NE20014030 700 1466 . . . 2263 2339
NT2NE20014280 701 439 . . . 903 2340
NT2NE20014350 702 684 . . . 1190 2341
NT2NE20015300 703 120 . . . >2517 2342
NT2NE20016230 704 713 . . . 1111 2343
NT2NE20016260 705 528 . . . 1721 2344
NT2NE20016340 706 575 . . . 1945 2345
NT2NE20016480 707 5 . . . 388 2346
NT2NE20016660 708 349 . . . 918 2347
NT2NE20016970 709 48 . . . 566 2348
NT2NE20034080 710 119 . . . 1606 2349
NT2NE20035690 711 969 . . . >2204 2350
NT2NE20044900 712 431 . . . 1039 2351
NT2NE20047160 713 658 . . . 1707 2352
NT2NE20053710 714 406 . . . 1020 2353
NT2NE20054410 715 975 . . . 1715 2354
NT2NE20055170 716 50 . . . 955 2355
NT2NE20057200 717 205 . . . 879 2356
NT2RI10000160 718 290 . . . 1270 2357
NT2RI10000270 719 330 . . . 809 2358
NT2RI10000480 720 502 . . . 1068 2359
NT2RI10001640 721 4 . . . >2060 2360
NT2RI20000640 722 1391 . . . 1894 2361
NT2RI20002700 723 849 . . . 1253 2362
NT2RI20002820 724 195 . . . 1781 2363
NT2RI20002940 725 63 . . . 467 2364
NT2RI20003410 726 148 . . . 1878 2365
NT2RI20004120 727 23 . . . 1600 2366
NT2RI20004210 728 477 . . . 1367 2367
NT2RI20005970 729 309 . . . 1562 2368
NT2RI20006690 730 206 . . . >2507 2369
NT2RI20006710 731 884 . . . 1654 2370
NT2RI20006850 732 550 . . . 2235 2371
NT2RI20007380 733 843 . . . 1208 2372
NT2RI20008650 734 692 . . . 1045 2373
NT2RI20009740 735 287 . . . 595 2374
NT2RI20010100 736 150 . . . 1727 2375
NT2RI20010830 737 295 . . . 2325 2376
NT2RI20010910 738 361 . . . 1254 2377
NT2RI20012350 739 969 . . . 1331 2378
NT2RI20012440 740 1026 . . . 1367 2379
NT2RI20013420 741 6 . . . 506 2380
NT2RI20013850 742 838 . . . 1497 2381
NT2RI20014090 743 57 . . . 1739 2382
NT2RI20014100 744 1280 . . . 1612 2383
NT2RI20014490 745 244 . . . 2247 2384
NT2RI20014500 746 451 . . . 2331 2385
NT2RI20015190 747 388 . . . 1671 2386
NT2RI20015400 748 454 . . . 2277 2387
NT2RI20015950 749 575 . . . 1078 2388
NT2RI20016210 750 571 . . . 1113 2389
NT2RI20016570 751 238 . . . 1026 2390
NT2RI20017260 752 1143 . . . 1703 2391
NT2RI20018460 753 64 . . . >2603 2392
NT2RI20018660 754 245 . . . 1672 2393
NT2RI20020220 755 571 . . . 1485 2394
NT2RI20020410 756 398 . . . 850 2395
NT2RI20021520 757 505 . . . 1482 2396
NT2RI20022430 758 1 . . . 1350 2397
NT2RI20022520 759 1165 . . . 1629 2398
NT2RI20022700 760 532 . . . 1401 2399
NT2RI20025170 761 90 . . . 1727 2400
NT2RI20025300 762 570 . . . >2759 2401
NT2RI20025410 763 15 . . . 1757 2402
NT2RI20025540 764 170 . . . >2080 2403
NT2RI20025850 765 245 . . . 1816 2404
NT2RI20026540 766 191 . . . 1555 2405
NT2RI20028020 767 1 . . . 420 2406
NT2RI20028520 768 120 . . . 692 2407
NT2RI20029260 769 1253 . . . 1714 2408
NT2RI20029580 770 350 . . . 2023 2409
NT2RI20029700 771 312 . . . 881 2410
NT2RI20030110 772 248 . . . 862 2411
NT2RI20030190 773 43 . . . 357 2412
NT2RI20030510 774 1317 . . . 1715 2413
NT2RI20030670 775 714 . . . 1046 2414
NT2RI20031540 776 84 . . . 1538 2415
NT2RI20032050 777 698 . . . 2797 2416
NT2RI20032220 778 640 . . . >2800 2417
NT2RI20033010 779 652 . . . 2898 2418
NT2RI20033040 780 408 . . . 794 2419
NT2RI20033380 781 121 . . . 1374 2420
NT2RI20033440 782 650 . . . 1687 2421
NT2RI20033830 783 165 . . . 929 2422
NT2RI20035560 784 27 . . . 1883 2423
NT2RI20036780 785 513 . . . 2585 2424
NT2RI20036950 786 355 . . . 2445 2425
NT2RI20037510 787 591 . . . 1589 2426
NT2RI20040590 788 605 . . . 1597 2427
NT2RI20041900 789 86 . . . 442 2428
NT2RI20042840 790 760 . . . 1083 2429
NT2RI20043040 791 236 . . . 1867 2430
NT2RI20043980 792 76 . . . 549 2431
NT2RI20044420 793 1080 . . . 1454 2432
NT2RI20046060 794 782 . . . 1480 2433
NT2RI20047830 795 297 . . . 623 2434
NT2RI20048400 796 16 . . . 324 2435
NT2RI20049160 797 668 . . . 1054 2436
NT2RI20049840 798 1266 . . . 2060 2437
NT2RI20049850 799 783 . . . 1973 2438
NT2RI20050610 800 19 . . . 2301 2439
NT2RI20050870 801 101 . . . 2056 2440
NT2RI20051500 802 236 . . . 1246 2441
NT2RI20053350 803 128 . . . 2125 2442
NT2RI20053680 804 310 . . . >2430 2443
NT2RI20055640 805 68 . . . 1171 2444
NT2RI20056280 806 1493 . . . 1954 2445
NT2RI20056470 807 272 . . . 2098 2446
NT2RI20057230 808 118 . . . >1116 2447
NT2RI20058110 809 145 . . . 1566 2448
NT2RI20058510 810 107 . . . 2050 2449
NT2RI20060710 811 274 . . . 1278 2450
NT2RI20060720 812 78 . . . 2354 2451
NT2RI20061270 813 14 . . . 352 2452
NT2RI20061830 814 906 . . . 1580 2453
NT2RI20062100 815 1465 . . . 2487 2454
NT2RI20063450 816 278 . . . 745 2455
NT2RI20064120 817 281 . . . 1321 2456
NT2RI20064870 818 647 . . . 1138 2457
NT2RI20065060 819 63 . . . 1193 2458
NT2RI20065530 820 644 . . . 1135 2459
NT2RI20066670 821 23 . . . 598 2460
NT2RI20066790 822 272 . . . 1747 2461
NT2RI20066820 823 145 . . . 1173 2462
NT2RI20067030 824 58 . . . 1368 2463
NT2RI20067350 825 100 . . . >2451 2464
NT2RI20067880 826 25 . . . 732 2465
NT2RI20068250 827 123 . . . 2246 2466
NT2RI20068550 828 250 . . . 1656 2467
NT2RI20070480 829 483 . . . 1844 2468
NT2RI20070840 830 25 . . . 600 2469
NT2RI20070960 831 212 . . . >2749 2470
NT2RI20071160 832 921 . . . 1643 2471
NT2RI20071330 833 159 . . . 2105 2472
NT2RI20071480 834 82 . . . 1155 2473
NT2RI20072140 835 845 . . . 1192 2474
NT2RI20072540 836 483 . . . 1394 2475
NT2RI20073030 837 914 . . . 1351 2476
NT2RI20073840 838 202 . . . 1569 2477
NT2RI20073860 839 150 . . . 506 2478
NT2RI20074390 840 60 . . . 1916 2479
NT2RI20074690 841 430 . . . >2130 2480
NT2RI20074980 842 175 . . . 1269 2481
NT2RI20075070 843 1064 . . . 1513 2482
NT2RI20075720 844 193 . . . 1758 2483
NT2RI20075890 845 927 . . . 1520 2484
NT2RI20077230 846 79 . . . 741 2485
NT2RI20077290 847 101 . . . 793 2486
NT2RI20077510 848 455 . . . 766 2487
NT2RI20077540 849 527 . . . 1075 2488
NT2RI20078270 850 61 . . . 717 2489
NT2RI20078790 851 391 . . . 1020 2490
NT2RI20078840 852 635 . . . 2410 2491
NT2RI20078910 853 334 . . . 1524 2492
NT2RI20080500 854 229 . . . 1767 2493
NT2RI20081880 855 158 . . . 1180 2494
NT2RI20082210 856 449 . . . 1120 2495
NT2RI20083360 857 60 . . . 1898 2496
NT2RI20083960 858 164 . . . 919 2497
NT2RI20084810 859 863 . . . 1384 2498
NT2RI20085260 860 347 . . . 709 2499
NT2RI20085980 861 357 . . . >2020 2500
NT2RI20086560 862 478 . . . 798 2501
NT2RI20087140 863 108 . . . 443 2502
NT2RI20087490 864 498 . . . 1862 2503
NT2RI20087910 865 508 . . . 1011 2504
NT2RI20088010 866 316 . . . 759 2505
NT2RI20088120 867 10 . . . 684 2506
NT2RI20089420 868 626 . . . 1099 2507
NT2RI20090650 869 41 . . . 1594 2508
NT2RI20090660 870 65 . . . 1852 2509
NT2RI20090830 871 988 . . . 1713 2510
NT2RI20091440 872 216 . . . 1037 2511
NT2RI20092150 873 574 . . . >2918 2512
NT2RI20092890 874 651 . . . 2471 2513
NT2RI20094060 875 17 . . . 1030 2514
NT2RP60000080 876 2249 . . . 2614 2515
NT2RP60000170 877 128 . . . 928 2516
NT2RP60000320 878 27 . . . 2108 2517
NT2RP60000350 879 553 . . . 1734 2518
NT2RP60000390 880 455 . . . 829 2519
NT2RP60000590 881 2067 . . . 2381 2520
NT2RP60000720 882 1136 . . . 2104 2521
NT2RP60000860 883 7 . . . 660 2522
NT2RP60001000 884 474 . . . 1694 2523
NT2RP60001090 885 442 . . . 2136 2524
NT2RP60001230 886 78 . . . 1937 2525
NT2RP60001270 887 858 . . . 1652 2526
NT2RP70000410 888 801 . . . 1103 2527
NT2RP70000690 889 259 . . . 3270 2528
NT2RP70000760 890 954 . . . 1295 2529
NT2RP70002380 891 231 . . . 1208 2530
NT2RP70002590 892 202 . . . 993 2531
NT2RP70002710 893 264 . . . 1619 2532
NT2RP70003640 894 2617 . . . 2994 2533
NT2RP70003910 895 1492 . . . 1797 2534
NT2RP70004250 896 261 . . . 1115 2535
NT2RP70004770 897 1132 . . . 2541 2536
NT2RP70005790 898 940 . . . 1257 2537
NT2RP70006240 899 26 . . . 1756 2538
NT2RP70008120 900 90 . . . 476 2539
NT2RP70009060 901 2197 . . . 3105 2540
NT2RP70010800 902 132 . . . 2060 2541
NT2RP70011660 903 5 . . . 3619 2542
NT2RP70012310 904 8 . . . 1756 2543
NT2RP70013060 905 1533 . . . 2693 2544
NT2RP70013350 906 396 . . . 2096 2545
NT2RP70015910 907 14 . . . 1492 2546
NT2RP70018560 908 167 . . . 1561 2547
NT2RP70021510 909 209 . . . 538 2548
NT2RP70022430 910 269 . . . 2617 2549
NT2RP70023760 911 92 . . . 3292 2550
NT2RP70023790 912 1022 . . . 2797 2551
NT2RP70024490 913 223 . . . 888 2552
NT2RP70024500 914 333 . . . 1652 2553
NT2RP70025540 915 191 . . . 532 2554
NT2RP70026190 916 1277 . . . >3059 2555
NT2RP70028290 917 52 . . . 2169 2556
NT2RP70028410 918 363 . . . 983 2557
NT2RP70028750 919 69 . . . 1226 2558
NT2RP70029060 920 283 . . . 2847 2559
NT2RP70029820 921 199 . . . 2325 2560
NT2RP70030500 922 58 . . . 480 2561
NT2RP70030550 923 148 . . . 1854 2562
NT2RP70030910 924 2186 . . . 2785 2563
NT2RP70032030 925 214 . . . 1584 2564
NT2RP70033040 926 294 . . . 1166 2565
NT2RP70036290 927 490 . . . 2808 2566
NT2RP70036320 928 550 . . . 1002 2567
NT2RP70036470 929 340 . . . 3312 2568
NT2RP70036800 930 151 . . . 2307 2569
NT2RP70039600 931 254 . . . 3121 2570
NT2RP70040800 932 592 . . . 1587 2571
NT2RP70042040 933 855 . . . 1946 2572
NT2RP70042330 934 434 . . . 2908 2573
NT2RP70042600 935 428 . . . 2539 2574
NT2RP70043730 936 312 . . . 2828 2575
NT2RP70043960 937 17 . . . 3181 2576
NT2RP70045410 938 82 . . . >3154 2577
NT2RP70046560 939 41 . . . 2593 2578
NT2RP70046870 940 47 . . . 2995 2579
NT2RP70047510 941 29 . . . 394 2580
NT2RP70047660 942 958 . . . 1332 2581
NT2RP70047900 943 1553 . . . 1870 2582
NT2RP70049150 944 436 . . . 2349 2583
NT2RP70049250 945 100 . . . 1356 2584
NT2RP70049750 946 1483 . . . 2013 2585
NT2RP70052050 947 2014 . . . 2481 2586
NT2RP70052190 948 24 . . . 413 2587
NT2RP70054680 949 1192 . . . 1563 2588
NT2RP70054930 950 214 . . . 579 2589
NT2RP70055020 951 774 . . . 1142 2590
NT2RP70055130 952 175 . . . 1791 2591
NT2RP70055200 953 1388 . . . 1879 2592
NT2RP70061620 954 1241 . . . 2518 2593
NT2RP70061880 955 161 . . . >3222 2594
NT2RP70062960 956 604 . . . 3786 2595
NT2RP70063040 957 277 . . . 1701 2596
NT2RP70063740 958 525 . . . 908 2597
NT2RP70064080 959 189 . . . 974 2598
NT2RP70064900 960 74 . . . 2332 2599
NT2RP70065270 961 261 . . . 2756 2600
NT2RP70066210 962 1294 . . . 1926 2601
NT2RP70067010 963 342 . . . 662 2602
NT2RP70069800 964 1520 . . . 1972 2603
NT2RP70069860 965 132 . . . 1964 2604
NT2RP70071140 966 1812 . . . 2342 2605
NT2RP70071540 967 694 . . . 1776 2606
NT2RP70071770 968 28 . . . 2103 2607
NT2RP70072210 969 205 . . . 1944 2608
NT2RP70072520 970 79 . . . >3136 2609
NT2RP70073590 971 2133 . . . 2525 2610
NT2RP70073810 972 171 . . . 683 2611
NT2RP70074060 973 248 . . . 739 2612
NT2RP70074220 974 367 . . . 726 2613
NT2RP70075040 975 365 . . . >3111 2614
NT2RP70075370 976 253 . . . 1710 2615
NT2RP70076100 977 280 . . . 2415 2616
NT2RP70076170 978 74 . . . 1717 2617
NT2RP70076430 979 461 . . . 2788 2618
NT2RP70079250 980 365 . . . 3256 2619
NT2RP70079300 981 240 . . . 554 2620
NT2RP70079750 982 954 . . . 2867 2621
NT2RP70081330 983 187 . . . 1458 2622
NT2RP70081370 984 279 . . . 2876 2623
NT2RP70081420 985 1246 . . . 1719 2624
NT2RP70081440 986 1013 . . . 1501 2625
NT2RP70081670 987 47 . . . 3034 2626
NT2RP70083150 988 118 . . . >3979 2627
NT2RP70084060 989 47 . . . 847 2628
NT2RP70084410 990 115 . . . >3256 2629
NT2RP70084870 991 70 . . . 1422 2630
NT2RP70085500 992 170 . . . 3274 2631
NT2RP70085570 993 302 . . . 2035 2632
NT2RP70086230 994 799 . . . 1203 2633
NT2RP70087200 995 211 . . . 2583 2634
NT2RP70088550 996 57 . . . 1529 2635
NT2RP70090120 997 52 . . . 2397 2636
NT2RP70090190 998 1358 . . . 2545 2637
NT2RP70091490 999 18 . . . 764 2638
NT2RP70091680 1000 2064 . . . 2618 2639
NT2RP70092150 1001 5 . . . 481 2640
NT2RP70092360 1002 116 . . . >3870 2641
NT2RP70092590 1003 148 . . . 2256 2642
NT2RP70093220 1004 333 . . . 2783 2643
NT2RP70093630 1005 1372 . . . 1710 2644
NT2RP70093700 1006 124 . . . 2220 2645
NT2RP70093730 1007 212 . . . 2389 2646
NT2RP70093940 1008 135 . . . 2909 2647
NT2RP70093970 1009 830 . . . 1705 2648
NT2RP70094290 1010 705 . . . 1046 2649
NT2RP70094660 1011 76 . . . 393 2650
NT2RP70094810 1012 94 . . . 3705 2651
NT2RP70094980 1013 38 . . . 2905 2652
NT2RP70095020 1014 2451 . . . 2768 2653
NT2RP70095070 1015 228 . . . 638 2654
NTONG10000330 1016 9 . . . 2423 2655
NTONG10000520 1017 83 . . . 1501 2656
NTONG10000980 1018 576 . . . 1703 2657
NTONG10001230 1019 318 . . . 1967 2658
NTONG10001300 1020 223 . . . 1839 2659
NTONG10001820 1021 677 . . . 1558 2660
NTONG10002140 1022 14 . . . 1207 2661
NTONG10002460 1023 242 . . . 1561 2662
NTONG10002570 1024 107 . . . 658 2663
NTONG10002640 1025 263 . . . 2131 2664
NTONG20002650 1026 177 . . . 2696 2665
NTONG20003340 1027 322 . . . 996 2666
NTONG20003630 1028 183 . . . >2114 2667
NTONG20004920 1029 1693 . . . 1998 2668
NTONG20005830 1030 268 . . . 624 2669
NTONG20008000 1031 160 . . . 1503 2670
NTONG20008780 1032 264 . . . 1829 2671
NTONG20009660 1033 12 . . . 1199 2672
NTONG20009850 1034 32 . . . 388 2673
NTONG20011370 1035 123 . . . 440 2674
NTONG20012220 1036 109 . . . 447 2675
NTONG20014280 1037 47 . . . 367 2676
NTONG20015500 1038 388 . . . 1416 2677
NTONG20016120 1039 27 . . . 2267 2678
OCBBF10000420 1040 457 . . . 894 2679
OCBBF10000670 1041 694 . . . 1149 2680
OCBBF10000860 1042 1 . . . 465 2681
OCBBF10000910 1043 397 . . . 3999 2682
OCBBF10001040 1044 869 . . . 1288 2683
OCBBF10001180 1045 108 . . . 977 2684
OCBBF10001190 1046 171 . . . 2444 2685
OCBBF10001220 1047 235 . . . 2259 2686
OCBBF20000130 1048 211 . . . 2301 2687
OCBBF20001260 1049 1733 . . . 2107 2688
OCBBF20002310 1050 302 . . . 1870 2689
OCBBF20002770 1051 19 . . . 1374 2690
OCBBF20002870 1052 1874 . . . >2191 2691
OCBBF20007190 1053 457 . . . 2277 2692
OCBBF20008240 1054 46 . . . 2169 2693
OCBBF20009040 1055 273 . . . 2030 2694
OCBBF20009980 1056 152 . . . 526 2695
OCBBF20010750 1057 221 . . . 655 2696
OCBBF20011010 1058 1 . . . 1323 2697
OCBBF20011240 1059 313 . . . >2823 2698
OCBBF20011400 1060 144 . . . >3731 2699
OCBBF20011760 1061 139 . . . 1815 2700
OCBBF20012100 1062 107 . . . 1840 2701
OCBBF20013070 1063 177 . . . 1199 2702
OCBBF20014020 1064 174 . . . >2999 2703
OCBBF20014080 1065 80 . . . 646 2704
OCBBF20014940 1066 160 . . . 3648 2705
OCBBF20015270 1067 539 . . . >2338 2706
OCBBF20015280 1068 79 . . . >2727 2707
OCBBF20015860 1069 201 . . . 827 2708
OCBBF20017060 1070 1065 . . . 1463 2709
PANCR10000210 1071 42 . . . 863 2710
PANCR10001850 1072 77 . . . 379 2711
PEBLM10000290 1073 1294 . . . 1722 2712
PEBLM10000340 1074 12 . . . 1814 2713
PEBLM10000680 1075 1330 . . . 1923 2714
PEBLM10001440 1076 154 . . . 2799 2715
PEBLM10001800 1077 1072 . . . 1509 2716
PEBLM20000300 1078 1538 . . . 2563 2717
PEBLM20001120 1079 175 . . . 2934 2718
PEBLM20001260 1080 2535 . . . 2918 2719
PEBLM20001470 1081 306 . . . 698 2720
PEBLM20002130 1082 35 . . . 979 2721
PEBLM20002480 1083 162 . . . 1334 2722
PEBLM20002700 1084 170 . . . 1762 2723
PEBLM20003080 1085 669 . . . 1685 2724
PEBLM20003950 1086 285 . . . 881 2725
PEBLM20004790 1087 341 . . . 1798 2726
PLACE50000370 1088 986 . . . 1912 2727
PLACE50000580 1089 387 . . . 3224 2728
PLACE50000670 1090 2506 . . . 2874 2729
PLACE50000680 1091 407 . . . 2119 2730
PLACE50000800 1092 488 . . . >3266 2731
PLACE50001050 1093 417 . . . 2234 2732
PLACE50001130 1094 12 . . . 4397 2733
PLACE50001530 1095 1874 . . . 2224 2734
PLACE50001700 1096 80 . . . 2140 2735
PLACE60000440 1097 1255 . . . 1575 2736
PLACE60000700 1098 250 . . . 684 2737
PLACE60000800 1099 1570 . . . 1995 2738
PLACE60001370 1100 1126 . . . 1521 2739
PLACE60002050 1101 243 . . . 1175 2740
PLACE60002630 1102 1574 . . . 2191 2741
PLACE60003710 1103 1170 . . . 1517 2742
PLACE60003790 1104 908 . . . 1564 2743
PLACE60004240 1105 243 . . . 845 2744
PLACE60004290 1106 1792 . . . 2154 2745
PLACE60005230 1107 449 . . . 994 2746
PLACE60005500 1108 447 . . . 791 2747
PLACE60005550 1109 140 . . . 631 2748
PLACE60009530 1110 8 . . . 337 2749
PLACE60012810 1111 76 . . . 2601 2750
PLACE60012940 1112 159 . . . 587 2751
PLACE60014430 1113 215 . . . 1816 2752
PLACE60018860 1114 94 . . . 1614 2753
PLACE60019230 1115 174 . . . 524 2754
PLACE60019250 1116 1562 . . . >2068 2755
PLACE60020160 1117 41 . . . 412 2756
PLACE60020840 1118 654 . . . 1382 2757
PLACE60021020 1119 106 . . . 600 2758
PLACE60021510 1120 261 . . . 1871 2759
PLACE60024190 1121 15 . . . 1145 2760
PLACE60026680 1122 332 . . . 1924 2761
PLACE60026920 1123 1 . . . 333 2762
PLACE60026990 1124 39 . . . 836 2763
PLACE60029490 1125 130 . . . 477 2764
PLACE60030380 1126 28 . . . 1149 2765
PLACE60030940 1127 61 . . . 720 2766
PLACE60031090 1128 650 . . . 1270 2767
PLACE60032040 1129 110 . . . 448 2768
PLACE60033720 1130 595 . . . 1053 2769
PLACE60033990 1131 403 . . . 1173 2770
PLACE60037050 1132 485 . . . 1159 2771
PLACE60037400 1133 597 . . . 923 2772
PLACE60037450 1134 112 . . . 558 2773
PLACE60038500 1135 734 . . . 1264 2774
PLACE60040050 1136 15 . . . 599 2775
PLACE60043120 1137 162 . . . 731 2776
PLACE60043360 1138 1899 . . . 2225 2777
PLACE60043960 1139 129 . . . 1754 2778
PLACE60043970 1140 208 . . . 1842 2779
PLACE60044540 1141 22 . . . >2582 2780
PLACE60044640 1142 319 . . . 2100 2781
PLACE60044910 1143 1249 . . . 1572 2782
PLACE60046630 1144 1108 . . . 1620 2783
PLACE60046870 1145 37 . . . 471 2784
PLACE60047380 1146 384 . . . 1250 2785
PLACE60049310 1147 18 . . . 320 2786
PLACE60049930 1148 1324 . . . 1641 2787
PLACE60050290 1149 220 . . . 606 2788
PROST10001520 1150 1847 . . . 2149 2789
PROST10001670 1151 608 . . . 1660 2790
PROST10002200 1152 137 . . . 988 2791
PROST10002460 1153 1240 . . . 1713 2792
PROST10002720 1154 114 . . . 689 2793
PROST10003430 1155 259 . . . 2445 2794
PROST10005260 1156 1214 . . . 1591 2795
PROST10005360 1157 240 . . . 2477 2796
PROST10005640 1158 139 . . . 525 2797
PROST20000360 1159 1580 . . . 1969 2798
PROST20000530 1160 1439 . . . 1825 2799
PROST20001760 1161 44 . . . 1276 2800
PROST20002060 1162 1072 . . . 1506 2801
PROST20002670 1163 547 . . . 897 2802
PROST20002730 1164 1070 . . . 1477 2803
PROST20002740 1165 1557 . . . 1910 2804
PROST20003250 1166 96 . . . 965 2805
PROST20004630 1167 495 . . . 815 2806
PROST20017390 1168 122 . . . 505 2807
PROST20017960 1169 1401 . . . 1829 2808
PROST20018230 1170 89 . . . 1447 2809
PROST20018990 1171 2024 . . . 2953 2810
PROST20019980 1172 1544 . . . 1852 2811
PROST20021620 1173 1439 . . . 1918 2812
PROST20023380 1174 11 . . . 559 2813
PROST20025910 1175 94 . . . 408 2814
PROST20026820 1176 411 . . . 1511 2815
PROST20028420 1177 1173 . . . 1607 2816
PROST20029600 1178 245 . . . 856 2817
PROST20031020 1179 20 . . . 1456 2818
PROST20031170 1180 163 . . . 1578 2819
PROST20032100 1181 82 . . . 1671 2820
PROST20032320 1182 2537 . . . 3004 2821
PROST20033020 1183 1550 . . . 1906 2822
PROST20033030 1184 247 . . . 567 2823
PROST20033380 1185 19 . . . 1524 2824
PROST20033400 1186 294 . . . 647 2825
PROST20034720 1187 280 . . . 1764 2826
PROST20037320 1188 1001 . . . 1414 2827
PROST20039220 1189 1790 . . . 2416 2828
PROST20043320 1190 278 . . . 1843 2829
PROST20044160 1191 435 . . . 866 2830
PROST20044810 1192 1442 . . . 1759 2831
PROST20051210 1193 405 . . . 1217 2832
PROST20051430 1194 76 . . . 540 2833
PROST20054260 1195 56 . . . 952 2834
PROST20056040 1196 1235 . . . 1552 2835
PROST20058800 1197 179 . . . 493 2836
PROST20059190 1198 94 . . . 483 2837
PROST20059430 1199 1475 . . . 1792 2838
PROST20061960 1200 7 . . . 393 2839
PROST20062600 1201 145 . . . 2367 2840
PROST20064500 1202 146 . . . 466 2841
PROST20067370 1203 1219 . . . 1944 2842
PROST20069880 1204 45 . . . 2252 2843
PROST20072370 1205 139 . . . 2256 2844
PROST20072890 1206 1664 . . . 2632 2845
PROST20073170 1207 166 . . . 1905 2846
PROST20073890 1208 1022 . . . 1324 2847
PROST20079740 1209 147 . . . 527 2848
PROST20085160 1210 63 . . . 734 2849
PROST20094830 1211 58 . . . 2328 2850
PUAEN10000570 1212 127 . . . 2220 2851
PUAEN10000810 1213 318 . . . 2234 2852
PUAEN10001610 1214 582 . . . 3794 2853
PUAEN10003220 1215 173 . . . 946 2854
SALGL10000050 1216 298 . . . 933 2855
SALGL10000470 1217 11 . . . 619 2856
SALGL10000650 1218 193 . . . 543 2857
SALGL10001570 1219 269 . . . 1282 2858
SKMUS10000140 1220 68 . . . 1234 2859
SKMUS10000220 1221 102 . . . 1367 2860
SKMUS10000640 1222 137 . . . 1198 2861
SKMUS10001040 1223 240 . . . 1100 2862
SKMUS10001180 1224 300 . . . 1076 2863
SKMUS10001240 1225 35 . . . >1069 2864
SKMUS10001290 1226 66 . . . 749 2865
SKMUS10001770 1227 203 . . . 1276 2866
SKMUS20000740 1228 26 . . . 1135 2867
SKMUS20001170 1229 105 . . . 1019 2868
SKMUS20002710 1230 17 . . . 1174 2869
SKMUS20003430 1231 163 . . . 861 2870
SKMUS20003650 1232 32 . . . 388 2871
SKMUS20003900 1233 135 . . . 1112 2872
SKMUS20004580 1234 166 . . . >1905 2873
SKMUS20004670 1235 141 . . . 443 2874
SKMUS20004680 1236 4 . . . 453 2875
SKMUS20007240 1237 107 . . . 1120 2876
SKMUS20007740 1238 66 . . . 1061 2877
SKMUS20008470 1239 183 . . . 524 2878
SKMUS20008630 1240 294 . . . 1727 2879
SKMUS20009020 1241 396 . . . 1631 2880
SKMUS20009330 1242 96 . . . 752 2881
SKMUS20009450 1243 796 . . . 1149 2882
SKMUS20009540 1244 193 . . . 1260 2883
SKMUS20010080 1245 210 . . . 839 2884
SKMUS20011290 1246 116 . . . 1375 2885
SKMUS20011470 1247 255 . . . 968 2886
SKMUS20013640 1248 117 . . . 476 2887
SKMUS20014920 1249 199 . . . 942 2888
SKMUS20015010 1250 178 . . . 921 2889
SKMUS20015430 1251 53 . . . 847 2890
SKMUS20016080 1252 145 . . . 1026 2891
SKMUS20016310 1253 385 . . . 876 2892
SKMUS20016340 1254 274 . . . >1622 2893
SKMUS20016620 1255 30 . . . 806 2894
SKMUS20016680 1256 196 . . . 1290 2895
SKMUS20016710 1257 30 . . . 722 2896
SKNMC10000070 1258 1265 . . . 1594 2897
SKNMC10000100 1259 296 . . . 694 2898
SKNMC10000190 1260 1219 . . . 1578 2899
SKNMC10000290 1261 388 . . . 789 2900
SKNMC10001100 1262 405 . . . 920 2901
SKNMC10001590 1263 720 . . . 1991 2902
SKNMC10001680 1264 1187 . . . 1927 2903
SKNMC10002290 1265 1798 . . . 2472 2904
SKNMC10002510 1266 265 . . . 2565 2905
SKNMC10002640 1267 68 . . . 718 2906
SKNMC20000650 1268 55 . . . 1758 2907
SKNMC20000970 1269 340 . . . 2028 2908
SKNMC20002240 1270 797 . . . 1939 2909
SKNMC20003050 1271 154 . . . >1168 2910
SKNMC20003220 1272 351 . . . 1091 2911
SKNMC20003560 1273 69 . . . 650 2912
SKNMC20005930 1274 363 . . . 1262 2913
SKNMC20006120 1275 1176 . . . 1589 2914
SKNMC20010570 1276 79 . . . 2085 2915
SKNMC20011130 1277 98 . . . 955 2916
SKNMC20015030 1278 1129 . . . 1689 2917
SKNMC20015550 1279 463 . . . 1035 2918
SKNMC20015960 1280 74 . . . >3352 2919
SKNSH10000860 1281 786 . . . 1250 2920
SKNSH10001740 1282 361 . . . 1458 2921
SKNSH10003010 1283 464 . . . 1669 2922
SKNSH10003080 1284 389 . . . 871 2923
SKNSH20001510 1285 462 . . . 776 2924
SKNSH20001630 1286 1087 . . . 1596 2925
SKNSH20003470 1287 390 . . . 863 2926
SMINT10000160 1288 158 . . . 1729 2927
SMINT10000390 1289 740 . . . 1045 2928
SMINT10000420 1290 76 . . . >2645 2929
SMINT10000540 1291 97 . . . 636 2930
SMINT10000570 1292 70 . . . 1545 2931
SMINT10000710 1293 1763 . . . >2065 2932
SMINT10001000 1294 27 . . . 470 2933
SMINT10001030 1295 415 . . . 2226 2934
SMINT10001180 1296 1176 . . . 1487 2935
SMINT20000180 1297 1466 . . . 1879 2936
SMINT20000400 1298 243 . . . 548 2937
SMINT20001450 1299 11 . . . 718 2938
SMINT20002270 1300 1427 . . . 1819 2939
SMINT20002390 1301 517 . . . 885 2940
SMINT20002770 1302 220 . . . 1167 2941
SMINT20003960 1303 5 . . . 2851 2942
SMINT20004000 1304 408 . . . 899 2943
SMINT20005450 1305 1001 . . . 1387 2944
SMINT20005580 1306 1700 . . . 2029 2945
SPLEN10000490 1307 27 . . . 1364 2946
SPLEN10000910 1308 742 . . . 1347 2947
SPLEN10001430 1309 165 . . . 695 2948
SPLEN20000200 1310 1974 . . . 2282 2949
SPLEN20000470 1311 1030 . . . 1560 2950
SPLEN20000720 1312 808 . . . 1842 2951
SPLEN20001340 1313 61 . . . 1146 2952
SPLEN20001970 1314 414 . . . 1310 2953
SPLEN20002420 1315 661 . . . 1191 2954
SPLEN20002430 1316 344 . . . 763 2955
SPLEN20002670 1317 1638 . . . >3316 2956
SPLEN20002700 1318 69 . . . 440 2957
SPLEN20003100 1319 1001 . . . 1321 2958
SPLEN20003570 1320 928 . . . 2322 2959
SPLEN20004430 1321 509 . . . 817 2960
SPLEN20004960 1322 1792 . . . 2175 2961
SPLEN20005410 1323 12 . . . 824 2962
STOMA10000470 1324 135 . . . 533 2963
STOMA10000520 1325 1790 . . . 2170 2964
STOMA10001170 1326 196 . . . 1818 2965
STOMA10001330 1327 410 . . . 1858 2966
STOMA10001860 1328 364 . . . 1476 2967
STOMA20000320 1329 943 . . . 1278 2968
STOMA20000880 1330 1825 . . . 2286 2969
STOMA20001210 1331 196 . . . 1458 2970
STOMA20001880 1332 1068 . . . 1757 2971
STOMA20002570 1333 429 . . . 746 2972
STOMA20002890 1334 187 . . . 801 2973
STOMA20003960 1335 591 . . . 1748 2974
STOMA20004780 1336 129 . . . 554 2975
STOMA20004820 1337 206 . . . 1228 2976
SYNOV10001280 1338 111 . . . 2084 2977
SYNOV10001640 1339 206 . . . 1033 2978
SYNOV20001770 1340 359 . . . 673 2979
SYNOV20002910 1341 1085 . . . 1750 2980
SYNOV20008200 1342 461 . . . >2203 2981
SYNOV20010140 1343 72 . . . 458 2982
SYNOV20011440 1344 275 . . . 1468 2983
SYNOV20013740 1345 147 . . . 1472 2984
SYNOV20014510 1346 89 . . . 982 2985
SYNOV20014570 1347 1488 . . . 1811 2986
SYNOV20016480 1348 132 . . . 656 2987
TESTI10000230 1349 1101 . . . 1415 2988
TESTI10000250 1350 167 . . . 2032 2989
TESTI10000420 1351 175 . . . 1863 2990
TESTI10000510 1352 75 . . . 2297 2991
TESTI10000550 1353 46 . . . 1185 2992
TESTI10000640 1354 106 . . . 1950 2993
TESTI10000700 1355 225 . . . 2042 2994
TESTI10000960 1356 274 . . . 978 2995
TESTI10001250 1357 1027 . . . 1641 2996
TESTI10001270 1358 208 . . . 1581 2997
TESTI10001310 1359 38 . . . 1549 2998
TESTI10001380 1360 732 . . . 1868 2999
TESTI10001630 1361 249 . . . 1298 3000
TESTI10001680 1362 134 . . . 1390 3001
TESTI10001790 1363 1577 . . . 1936 3002
TESTI10001910 1364 935 . . . 1786 3003
TESTI20000180 1365 234 . . . 563 3004
TESTI20000440 1366 166 . . . 2238 3005
TESTI20001200 1367 664 . . . 1059 3006
TESTI20001540 1368 230 . . . 1684 3007
TESTI20001770 1369 1209 . . . 2447 3008
TESTI20001790 1370 154 . . . 747 3009
TESTI20001840 1371 16 . . . 1962 3010
TESTI20002070 1372 1161 . . . 1631 3011
TESTI20002080 1373 1784 . . . 2425 3012
TESTI20002380 1374 528 . . . 1859 3013
TESTI20002530 1375 289 . . . 1071 3014
TESTI20003560 1376 654 . . . 1013 3015
TESTI20003720 1377 578 . . . 1144 3016
TESTI20004350 1378 97 . . . 726 3017
TESTI20004620 1379 916 . . . 1833 3018
TESTI20005200 1380 192 . . . 1379 3019
TESTI20005910 1381 30 . . . 1469 3020
TESTI20006000 1382 645 . . . 1682 3021
TESTI20006270 1383 72 . . . >2174 3022
TESTI20006710 1384 334 . . . 645 3023
TESTI20006950 1385 68 . . . >2012 3024
TESTI20006990 1386 134 . . . 2155 3025
TESTI20007070 1387 56 . . . 1084 3026
TESTI20007620 1388 125 . . . 961 3027
TESTI20007840 1389 36 . . . 3281 3028
TESTI20008190 1390 820 . . . 1236 3029
TESTI20008300 1391 323 . . . 1186 3030
TESTI20008490 1392 59 . . . 1333 3031
TESTI20008830 1393 1131 . . . 1718 3032
TESTI20009090 1394 562 . . . 894 3033
TESTI20009510 1395 225 . . . 1115 3034
TESTI20009700 1396 84 . . . 1628 3035
TESTI20010080 1397 1565 . . . >2060 3036
TESTI20010490 1398 730 . . . 2349 3037
TESTI20010820 1399 1609 . . . 1926 3038
TESTI20011340 1400 243 . . . 1346 3039
TESTI20011410 1401 425 . . . 2725 3040
TESTI20011800 1402 228 . . . 1178 3041
TESTI20012370 1403 257 . . . 2071 3042
TESTI20012690 1404 660 . . . 2603 3043
TESTI20013060 1405 125 . . . 427 3044
TESTI20013300 1406 22 . . . >2563 3045
TESTI20013450 1407 187 . . . 1917 3046
TESTI20013520 1408 334 . . . 759 3047
TESTI20014120 1409 185 . . . 1384 3048
TESTI20014200 1410 214 . . . 1299 3049
TESTI20015110 1411 61 . . . 2058 3050
TESTI20015120 1412 565 . . . 1287 3051
TESTI20015560 1413 400 . . . 1326 3052
TESTI20015930 1414 1157 . . . 1468 3053
TESTI20016210 1415 1121 . . . 1474 3054
TESTI20016610 1416 280 . . . 3345 3055
TESTI20016650 1417 2190 . . . 2549 3056
TESTI20016710 1418 1071 . . . 2003 3057
TESTI20017580 1419 143 . . . 676 3058
TESTI20017660 1420 317 . . . 652 3059
TESTI20017920 1421 84 . . . 890 3060
TESTI20018150 1422 815 . . . 1993 3061
TESTI20018260 1423 310 . . . 1113 3062
TESTI20018270 1424 19 . . . 1899 3063
TESTI20018290 1425 337 . . . >2156 3064
TESTI20018520 1426 46 . . . 2211 3065
TESTI20018620 1427 1355 . . . 1729 3066
TESTI20018690 1428 1178 . . . 2425 3067
TESTI20018790 1429 481 . . . 1821 3068
TESTI20018980 1430 146 . . . 559 3069
TESTI20019500 1431 126 . . . 1403 3070
TESTI20019680 1432 1168 . . . 1509 3071
TESTI20019910 1433 345 . . . 1601 3072
TESTI20020020 1434 1547 . . . >1884 3073
TESTI20020480 1435 255 . . . 569 3074
TESTI20020570 1436 217 . . . 1317 3075
TESTI20020810 1437 194 . . . 1498 3076
TESTI20020900 1438 81 . . . 1547 3077
TESTI20021050 1439 68 . . . 2689 3078
TESTI20021490 1440 45 . . . 1814 3079
TESTI20022230 1441 205 . . . 783 3080
TESTI20022450 1442 59 . . . 1333 3081
TESTI20022510 1443 97 . . . 2217 3082
TESTI20022560 1444 17 . . . 2494 3083
TESTI20022640 1445 260 . . . 913 3084
TESTI20022940 1446 41 . . . 469 3085
TESTI20023610 1447 365 . . . 949 3086
TESTI20023690 1448 336 . . . 1160 3087
TESTI20024150 1449 400 . . . 1080 3088
TESTI20024230 1450 125 . . . 1339 3089
TESTI20024610 1451 181 . . . 1605 3090
TESTI20024650 1452 45 . . . 1829 3091
TESTI20024670 1453 1375 . . . 1845 3092
TESTI20024980 1454 261 . . . 1889 3093
TESTI20025160 1455 133 . . . 1164 3094
TESTI20025440 1456 293 . . . 1819 3095
TESTI20025800 1457 60 . . . 1022 3096
TESTI20026320 1458 31 . . . 414 3097
TESTI20026760 1459 830 . . . 1663 3098
TESTI20026980 1460 212 . . . 1354 3099
TESTI20027000 1461 22 . . . 573 3100
TESTI20027070 1462 88 . . . 1410 3101
TESTI20027290 1463 158 . . . 1333 3102
TESTI20027890 1464 104 . . . >1506 3103
TESTI20028060 1465 1596 . . . 1970 3104
TESTI20028400 1466 740 . . . 1066 3105
TESTI20028660 1467 1111 . . . 1995 3106
TESTI20029120 1468 295 . . . 1920 3107
TESTI20029650 1469 391 . . . 1446 3108
TESTI20030050 1470 21 . . . 800 3109
TESTI20030370 1471 271 . . . 1368 3110
TESTI20030590 1472 1028 . . . 1474 3111
TESTI20030710 1473 88 . . . 666 3112
TESTI20030740 1474 85 . . . 2055 3113
TESTI20031090 1475 28 . . . >2034 3114
TESTI20031170 1476 188 . . . 1660 3115
TESTI20031300 1477 157 . . . 2004 3116
TESTI20031520 1478 150 . . . 1862 3117
TESTI20031930 1479 474 . . . 1010 3118
TESTI20031960 1480 32 . . . >1839 3119
TESTI20032280 1481 189 . . . 560 3120
TESTI20032550 1482 242 . . . 670 3121
TESTI20032800 1483 1445 . . . 1873 3122
TESTI20032990 1484 49 . . . 411 3123
TESTI20033250 1485 98 . . . 2041 3124
TESTI20033270 1486 48 . . . 722 3125
TESTI20033540 1487 311 . . . 1930 3126
TESTI20033560 1488 193 . . . 1296 3127
TESTI20033760 1489 294 . . . 659 3128
TESTI20034130 1490 109 . . . >2444 3129
TESTI20034180 1491 1113 . . . 1484 3130
TESTI20034190 1492 120 . . . 1520 3131
TESTI20034980 1493 265 . . . 1185 3132
TESTI20035120 1494 321 . . . 2585 3133
TESTI20035410 1495 735 . . . 1208 3134
TESTI20035510 1496 734 . . . 1741 3135
TESTI20035740 1497 41 . . . 1651 3136
TESTI20035800 1498 1263 . . . 1583 3137
TESTI20035890 1499 206 . . . 1507 3138
TESTI20036250 1500 45 . . . 2216 3139
TESTI20036490 1501 88 . . . 459 3140
TESTI20037270 1502 33 . . . 1391 3141
TESTI20037810 1503 128 . . . 520 3142
TESTI20038940 1504 1166 . . . 1630 3143
TESTI20039140 1505 73 . . . 1530 3144
TESTI20039980 1506 2 . . . 514 3145
TESTI20040000 1507 291 . . . 881 3146
TESTI20040310 1508 126 . . . 1463 3147
TESTI20041110 1509 143 . . . 502 3148
TESTI20041220 1510 33 . . . 1703 3149
TESTI20042070 1511 95 . . . 1903 3150
TESTI20042290 1512 647 . . . 1711 3151
TESTI20042430 1513 1227 . . . 1535 3152
TESTI20042870 1514 1697 . . . 2263 3153
TESTI20042950 1515 187 . . . 1887 3154
TESTI20047120 1516 112 . . . 1002 3155
TESTI20049290 1517 402 . . . 1226 3156
TESTI20049820 1518 157 . . . 1875 3157
TESTI20049940 1519 50 . . . 550 3158
TESTI20051550 1520 79 . . . 501 3159
TESTI20052680 1521 60 . . . 1247 3160
TESTI20053960 1522 402 . . . 2522 3161
TESTI20054080 1523 108 . . . 929 3162
TESTI20054920 1524 137 . . . 568 3163
TESTI20055840 1525 210 . . . 1214 3164
TESTI20056900 1526 124 . . . 1788 3165
TESTI20057310 1527 287 . . . >1853 3166
TESTI20057420 1528 164 . . . 1636 3167
TESTI20058600 1529 430 . . . 1167 3168
TESTI20062380 1530 719 . . . 1567 3169
TESTI20062550 1531 511 . . . 837 3170
TESTI20064250 1532 537 . . . 1436 3171
TESTI20064830 1533 373 . . . 1614 3172
TESTI20065720 1534 222 . . . 644 3173
TESTI20067740 1535 382 . . . 1239 3174
TESTI20068660 1536 87 . . . 1337 3175
TESTI20068720 1537 378 . . . 1331 3176
TESTI20069780 1538 310 . . . 639 3177
TESTI20069790 1539 887 . . . 1189 3178
TESTI20071830 1540 352 . . . 1176 3179
TESTI20073580 1541 3 . . . 1394 3180
TESTI20074020 1542 1097 . . . 1426 3181
TESTI20074640 1543 204 . . . >1824 3182
TESTI20074660 1544 124 . . . 1683 3183
TESTI20074800 1545 81 . . . 2000 3184
TESTI20076130 1546 122 . . . >2107 3185
TESTI20077490 1547 852 . . . 1598 3186
TESTI20077500 1548 391 . . . 1722 3187
TESTI20078140 1549 897 . . . 1400 3188
TESTI20078640 1550 287 . . . 802 3189
TESTI20078670 1551 318 . . . 1952 3190
TESTI20078720 1552 92 . . . 1309 3191
TESTI20079510 1553 824 . . . 3025 3192
TESTI20080200 1554 153 . . . 2429 3193
TESTI20080330 1555 72 . . . 497 3194
TESTI20081390 1556 118 . . . 1839 3195
TESTI20081440 1557 147 . . . 545 3196
TESTI20082340 1558 931 . . . 1419 3197
TESTI20082400 1559 409 . . . 834 3198
TESTI20083430 1560 157 . . . 2979 3199
TESTI20083870 1561 31 . . . 552 3200
TESTI20084400 1562 1749 . . . 2078 3201
TESTI20086570 1563 246 . . . 1289 3202
TESTI20087740 1564 14 . . . 1900 3203
TESTI20088470 1565 362 . . . 757 3204
TESTI20136910 1566 1667 . . . 2026 3205
TESTI20138320 1567 98 . . . 1060 3206
TESTI20140360 1568 831 . . . 1349 3207
TESTI20177400 1569 70 . . . 1584 3208
TESTI30000020 1570 97 . . . 1914 3209
THYMU10000020 1571 286 . . . 1131 3210
THYMU10000320 1572 1299 . . . 1691 3211
THYMU10000830 1573 1169 . . . 1936 3212
THYMU10001050 1574 632 . . . 934 3213
THYMU10001760 1575 1 . . . 492 3214
THYMU10002910 1576 1598 . . . 2026 3215
THYMU10003290 1577 22 . . . 534 3216
THYMU10003590 1578 743 . . . 2005 3217
THYMU10003660 1579 1749 . . . 2084 3218
THYMU10003820 1580 1242 . . . 1601 3219
THYMU10004590 1581 594 . . . 1142 3220
THYMU10004730 1582 421 . . . 735 3221
THYMU10004910 1583 301 . . . 1119 3222
THYMU10005270 1584 1706 . . . >2057 3223
THYMU10005580 1585 896 . . . 1819 3224
THYMU20001400 1586 42 . . . 410 3225
THYMU20002360 1587 2 . . . 385 3226
THYMU20003170 1588 703 . . . 1041 3227
THYMU20003690 1589 328 . . . 1782 3228
TRACH10000180 1590 63 . . . 1205 3229
TRACH10000300 1591 384 . . . 902 3230
TRACH10000570 1592 722 . . . 1039 3231
TRACH10000630 1593 431 . . . 1372 3232
TRACH10000740 1594 80 . . . 1672 3233
TRACH10001000 1595 181 . . . 660 3234
TRACH10001060 1596 744 . . . 1121 3235
TRACH10001250 1597 21 . . . 1610 3236
TRACH10001400 1598 266 . . . 622 3237
TRACH20000150 1599 1303 . . . 1755 3238
TRACH20000790 1600 47 . . . 385 3239
TRACH20001850 1601 19 . . . 750 3240
TRACH20001960 1602 144 . . . 974 3241
TRACH20002350 1603 1123 . . . 1437 3242
TRACH20002370 1604 197 . . . 1471 3243
TRACH20002500 1605 120 . . . 1682 3244
TRACH20002890 1606 895 . . . 2022 3245
TRACH20003930 1607 1403 . . . >2562 3246
TRACH20004110 1608 150 . . . 1844 3247
TRACH20004200 1609 80 . . . >2895 3248
TRACH20004610 1610 498 . . . 2084 3249
TRACH20004720 1611 435 . . . 1940 3250
TRACH20004960 1612 115 . . . 1842 3251
TRACH20004970 1613 1083 . . . 1517 3252
TRACH20006650 1614 208 . . . 1866 3253
TRACH20006750 1615 232 . . . 1200 3254
TRACH20007670 1616 1147 . . . 1452 3255
TRACH20007800 1617 492 . . . 1937 3256
TRACH20008940 1618 701 . . . 1957 3257
TRACH20008980 1619 350 . . . 661 3258
TRACH20009260 1620 75 . . . 770 3259
TRACH20009440 1621 879 . . . 1235 3260
TRACH20011920 1622 530 . . . >2034 3261
TRACH20012890 1623 143 . . . 715 3262
TRACH20013950 1624 1697 . . . 2602 3263
TRACH20014000 1625 1626 . . . 1949 3264
TRACH20015920 1626 569 . . . 877 3265
TRACH20016070 1627 484 . . . 1176 3266
UMVEN10001220 1628 698 . . . 1339 3267
UMVEN20001330 1629 164 . . . 2242 3268
UTERU10000770 1630 2074 . . . 2418 3269
UTERU10000960 1631 952 . . . 1593 3270
UTERU10001600 1632 527 . . . 1747 3271
UTERU10001920 1633 112 . . . 474 3272
UTERU20000470 1634 1691 . . . >2197 3273
UTERU20003380 1635 130 . . . 816 3274
UTERU20003930 1636 514 . . . 1101 3275
UTERU20004850 1637 385 . . . 732 3276
UTERU20005410 1638 432 . . . 800 3277
UTERU20005690 1639 217 . . . 1899 3278

Namely, primers used to synthesize polynucleotides can be designed based on the nucleotide sequences of polynucleotides of the present invention shown in SEQ ID NOs in the above Table 1. When one intends to synthesize full-length cDNAs, an oligo dT primer can be used as the 3′-end primer. The length of the primers is usually 15-100 bp, and favorably between 15-35 bp. In case of LA PCR, which is described below, the primer length of 25-35 bp may provide a good result.

A method to design a primer that enables a specific amplification based on the aimed nucleotide sequence is known to those skilled in the art (Current Protocols in Molecular Biology, Ausubel et al. edit, (1987) John Wiley & Sons, Section 6.1-6.4). In designing a primer based on the 5′-end sequence, the primer is designed so as that, in principle, the amplification products will include the translation start site. Accordingly, for example, when the 5′-end primer is designed based on the nucleotide sequence of 5′ untranslated region (5′UTR), any part of the 5′-end, which ensures the specificity to the cDNA of interest, can be selected as the primer.

When synthesizing a full-length cDNA, the target nucleotide sequence to be amplified can extend to several thousand bp in some cDNA. However, it is possible to amplify such a long nucleotides by using such as LA PCR (Long and Accurate PCR). It is advantageous to use LA PCR when synthesizing long DNA. In LA PCR, in which a special DNA polymerase having 3′->5′ exonuclease activity is used, misincorporated nucleotides can be removed. Accordingly, accurate synthesis of the complementary strand can be achieved even with a long nucleotide sequence. By using LA PCR, it is reported that amplification of a nucleotide with 20 kb longer can be achieved under desirable conditions (Takeshi Hayashi (1996) Jikken-Igaku Bessatsu, “Advanced Technologies in PCR” Youdo-sha).

A template DNA for synthesizing the full-length cDNA of the present invention can be obtained by using cDNA libraries that are prepared by various methods. The full-length cDNA clones of the present invention are clones with high probability of completeness in length, which were obtained by the method comprising the steps of [1] preparing libraries containing cDNAs with the very high fullness ratio by oligo-capping, and [2] assembling the 5′-end sequences and selecting one with the highest probability of completeness in length in the cluster formed (there are many clones longer in the 5′-end direction).

However, the uses of primers designed based on the full-length nucleotide sequences provided by the present invention enable easily obtaining full-length cDNAs without such a special technique.

The problem with the cDNA libraries prepared by the known methods or commercially available is that mRNA contained in the libraries has very low fullness ratio. Thus, it is difficult to screen full-length cDNA clone directly from the library using ordinary cloning methods. The present invention has revealed a nucleotide sequence of novel full-length cDNA. If a full-length nucleotide sequence is provided, it is possible to synthesize a target full-length cDNA by using enzymatic reactions such as PCR. In particular, a full-length-enriched cDNA library, synthesized by methods such as oligo-capping, is desirable to synthesize a full-length cDNA with more reliability.

The 5′-end sequence of the full-length cDNA clones of the invention can be used to isolate the regulatory element of transcription including the promoter on the genome. A rough draft of the human genome (analysis of human genomic sequence with lower accuracy), which covers 90% of the genome, has been reported (Nature, Vol. 409, 814-823, 2001), and by the year 2003, analysis of the entire human genomic sequence is going to be finished. However, it is hard to analyze with software the transcription start sites on the human genome, in which long introns exist. By contrast, it is easy to specify the transcription start site on the genomic sequence using the nucleotide sequence which includes the 5′-end of the full-length cDNA clone of the present invention, and thus it is easy to obtain the genomic region involved in transcription regulation, which includes the promoter that is contained in the upstream of the transcription start site.

The polypeptide encoded by the full-length cDNA of the invention can be prepared as a recombinant polypeptide or as a natural polypeptide. For example, the recombinant polypeptide can be prepared by inserting the polynucleotide encoding the polypeptide of the invention into a vector, introducing the vector into an appropriate host cell and purifying the polypeptide expressed within the transformed host cell, as described below. In contrast, the natural polypeptide can be prepared, for example, by utilizing an affinity column to which an antibody against the polypeptide of the invention (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wiley & Sons, Section 16.1-16.19) is attached. The antibody used for affinity purification may be either a polyclonal antibody, or a monoclonal antibody. Alternatively, in vitro translation (See, for example, “On the fidelity of mRNA translation in the nuclease-treated rabbit reticulocyte lysate system.” Dasso M. C., and Jackson R. J. (1989) Nucleic Acids Res. 17: 3129-3144) may be used for preparing the polypeptide of the invention.

Polypeptides functionally equivalent to the polypeptides of the present invention can be prepared based on the activities, which were clarified in the above-mentioned manner, of the polypeptides of the present invention. Using the biological activity possessed by the polypeptide of the invention as an index, it is possible to verify whether or not a particular polypeptide is functionally equivalent to the polypeptide of the invention by examining whether or not the polypeptide has said activity.

Polypeptides functionally equivalent to the polypeptides of the present invention can be prepared by those skilled in the art, for example, by using a method for introducing mutations into an amino acid sequence of a polypeptide (for example, site-directed mutagenesis (Current Protocols in Molecular Biology, edit, Ausubel et al., (1987) John Wiley & Sons, Section 8.1-8.5) Besides, such polypeptides can be generated by spontaneous mutations. The present invention also includes a polypeptide comprising the amino acid sequence shown in Table 1 in which one or more amino acids are substituted, deleted, inserted, and/or added, as long as the polypeptides have the equivalent functions to those of the polypeptides identified in the present Examples described later.

There are no limitations on the number and sites of amino acid mutations, as long as the polypeptides maintain the functions thereof. The number of mutations typically corresponds to 30% or less, or 20% or less, or 10% or less, preferably 5% or less, or 3% or less of the total amino acids, more preferably 2% or less or 1% or less of the total amino acids. Alternatively, herein, substitution of one or more amino acids includes substitution of several amino acids. As used herein, the term “several amino acids” means, for example, 5 amino acids, preferably 4 or 3 amino acids, more preferably 2 amino acids, and further preferably 1 amino acid.

From the viewpoint of maintaining the polypeptide function, it is preferable that a substituted amino acid has a similar property to that of the original amino acid. For example, Ala, Val, Leu, Ile, Pro, Met, Phe and Trp are assumed to have similar properties to one another because they are all classified into a group of non-polar amino acids. Similarly, substitution can be performed among non-charged amino acid such as Gly, Ser, Thr, Cys, Tyr, Asn, and Gln, acidic amino acids such as Asp and Glu, and basic amino acids such as Lys, Arg, and His.

In addition, polypeptides functionally equivalent to the polypeptides of the present invention can be isolated by using techniques of hybridization or gene amplification known to those skilled in the art. Specifically, using the hybridization technique (Current Protocols in Molecular Biology, edit, Ausubel et al., (1987) John Wiley & Sons, Section 6.3-6.4)), those skilled in the art can usually isolate a polynucleotide highly homologous to the polynucleotide encoding the polypeptide identified in the present Example based on the identified nucleotide sequence (Table 1) or a portion thereof and obtain the functionally equivalent polypeptide from the isolated polynucleotide. The present invention include polypeptides encoded by the polynucleotides hybridizing with the polynucleotides encoding the polypeptides identified in the present Example, as long as the polypeptides are functionally equivalent to the polypeptides identified in the present Example. Organisms from which the functionally equivalent polypeptides are isolated are illustrated by vertebrates such as human, mouse, rat, rabbit, pig and bovine, but are not limited to these animals.

Washing conditions of hybridization for the isolation of polynucleotides encoding the functionally equivalent polypeptides are usually “1×SSC, 0.1% SDS, 37° C.”; more stringent conditions are “0.5×SSC, 0.1% SDS, 42° C.”; and still more stringent conditions are “0.1×SSC, 0.1% SDS, 65° C.”. Alternatively, the following conditions can be given as hybridization conditions of the present invention. Namely, conditions in which the hybridization is done at “6×SSC, 40% Formamide, 25° C.”, and the washing at “1×SSC, 55° C.” can be given. More preferable conditions are those in which the hybridization is done at “6×SSC, 40% Formamide, 37° C.”, and the washing at “0.2×SSC, 55° C.”. Even more preferable are those in which the hybridization is done at “6×SSC, 50% Formamide, 37° C.”, and the washing at “0.1×SSC, 62° C.”. The more stringent the conditions of hybridization are, the more frequently the polynucleotides highly homologous to the probe sequence are isolated. Therefore, it is preferable to conduct hybridization under stringent conditions. Examples of stringent conditions in the present invention are, washing conditions of “0.5×SSC, 0.1% SDS, 42° C.”, or alternatively, hybridization conditions of “6×SSC, 40% Formamide, 37° C.”, and the washing at “0.2×SSC, 55° C.”.

One skilled in the art can suitably select various conditions, such as dilution ratios of SSC, formamide concentrations, and temperatures to accomplish a similar stringency.

However, the above-mentioned combinations of SSC, SDS and temperature conditions are indicated just as examples. Those skilled in the art can select the hybridization conditions with similar stringency to those mentioned above by properly combining the above-mentioned or other factors (for example, probe concentration, probe length and duration of hybridization reaction) that determines the stringency of hybridization.

The amino acid sequences of polypeptides isolated by using the hybridization techniques usually have high identity to those of the polypeptides of the present invention, which are shown in Table 1. The present invention encompasses a polynucleotide comprising a nucleotide sequence that has a high identity to the nucleotide sequence of claim 1 (a). Furthermore, the present invention encompasses a peptide, or polypeptide comprising an amino acid sequence that has a high identity to the amino acid sequence encoded by the polynucleotide of claim 1 (b). The term “high identity” indicates sequence identity of at least 40% or more; preferably 60% or more; and more preferably 70% or more. Alternatively, more preferable is identity of 90% or more, or 93% or more, or 95% or more, furthermore, 97% or more, or 99% or more. The identity can be determined by using the BLAST search algorithm.

As used herein, “percent identity” of amino acid sequences or nucleic acids is determined using the algorithm BLAST of Karlin and Altschul (Proc. Natl. Acad. Sci. USA 90:5873-5877, 1993). Such an algorithm is incorporated into the BLASTN and BLASTX programs of Altschul et al. (J. Mol. Biol. 215:403-410, 1990). BLAST nucleotide searches are performed with the BLASTN program, for example, score=100, wordlength=12. BLAST protein searches are performed with the BLASTX program, for example, score=50, wordlength=3. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs are used. See http://www.ncbi.nlm.nih.gov.

With the gene amplification technique (PCR) (Current Protocols in Molecular Biology, edit, Ausubel et al., (1987) John Wiley & Sons, Section 6.1-6.4)) using primers designed based on the nucleotide sequence (Table 1) or a portion thereof identified in the present Example, it is possible to isolate a polynucleotide fragment highly homologous to the polynucleotide sequence or a portion thereof and to obtain functionally equivalent polypeptide to a particular polypeptide identified in the present Example based on the isolated polynucleotide fragment.

The present invention also provides a polynucleotide containing at least 15 nucleotides complementary to a polynucleotide comprising a nucleotide sequence of SEQ ID NOs shown in Table 1 or the complementary strand thereof. Herein, the term “complementary strand” is defined as one strand of a double strand DNA composed of A:T and G:C base pair to the other strand. Also, “complementary” is defined as not only those completely matching within a continuous region of at least 15 nucleotides, but also having a identity of at least 70%, favorably 80% or higher, more favorably 90% or higher, and most favorably 95% or higher within that region. The identity may be determined using the algorithm described herein.

Such a polynucleotide includes probes and primers used for the detection and amplification of a polynucleotide encoding the inventive polypeptide. When used as a primer, the polynucleotide usually comprises 15 to 100 bp, and preferably of 15 to 35 bp. When used as a probe, the polynucleotide comprises the whole or a part of the sequence of a polynucleotide of the invention, and comprises at least 15 bp. When used as primers, such polynucleotides are complementary at the 3′-end, and restriction enzyme recognition sequences or tags can be added to the 5′-end.

Furthermore, polynucleotides of the present invention include an antisense polynucleotide for suppressing the expression of a polypeptide of the invention, which comprises an amino acid sequence of SEQ ID NOs shown in Table 1. To exert an antisense effect, an antisense polynucleotide has at least 15 bp or more, for example 50 bp or more, preferably 100 bp or more, and more preferably 500 bp or more, and usually has 3000 bp or less, and preferably 2000 bp or less. Antisense polynucleotides can be used in the gene therapy of diseases caused by abnormalities of the polypeptides of the invention (abnormal function or abnormal expression). An antisense polynucleotide can be prepared, for example, by the phosphorothioate method (“Physicochemical properties of phosphorothioate oligodeoxynucleotides.” Stein (1988) Nucleic Acids Res. 16: 3209-3221) based on the sequence information of polynucleotide encoding a polypeptide of the invention (for example, the nucleotide sequences of SEQ ID NO: 1 to 1639).

The polynucleotides or antisense polynucleotides of the present invention can be used in, for example, gene therapy. As target diseases, for example, cancers or various inflammatory diseases may be preferable. These molecules can be used for gene therapy, for example, by administrating them to patients by the in vivo or ex vivo method using virus vectors such as retrovirus vectors, adenovirus vectors, and adeno-related virus vectors, or non-virus vectors such as liposomes.

The present invention also includes a partial peptide of the polypeptides of the invention. The partial peptide comprises a polypeptide generated as a result that a signal peptide has been removed from a secretory protein. If the polypeptide of the present invention has an activity as a receptor or a ligand, the partial peptide may function as a competitive inhibitor of the polypeptide and may bind to the receptor (or ligand). In addition, the present invention includes an antigen peptide for raising antibodies. For the peptides to be specific for the polypeptide of the invention, the peptides comprise at least 7 amino acids, preferably 8 amino acids or more, more preferably 9 amino acids or more, and even more preferably 10 amino acids or more. The peptide can be used for preparing antibodies against the polypeptide of the invention, or competitive inhibitors of them, and also screening for a receptor that binds to the polypeptide of the invention. The partial peptides of the invention can be produced, for example, by genetic engineering methods, known methods for synthesizing peptides, or digesting the polypeptide of the invention with an appropriate peptidase.

The present invention also relates to a vector into which a polynucleotide of the invention is inserted. The vector of the invention is not limited as long as it contains the inserted polynucleotide stably. For example, if E. coli is used as a host, vectors such as pBluescript vector (Stratagene) are preferable as a cloning vector. To produce the polypeptide of the invention, expression vectors are especially useful. Any expression vector can be used as long as it is capable of expressing the polypeptide in vitro, in E. coli, in cultured cells, or in vivo. For example, pBEST vector (Promega) is preferable for in vitro expression, pET vector (Invitrogen) for E. coli, pME18S-FL3 vector (GenBank Accession No. AB009864) for cultured cells, and pME18S vector (Mol. Cell. Biol. (1988) 8: 466-472) for in vivo expression. To insert the polynucleotide of the invention, ligation utilizing restriction sites can be performed according to the standard method (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wiley & Sons, Section 11.4-11.11).

Recently, the technique of GATEWAY™ system (Invitrogen), which is an expression vector construction system for polypeptide expression, has been developed (Experimental Medicine, Vol. 18, No. 19 (December), p2716-2717, 2000). This system includes two types of site-specific recombinases (BP CLONASE™ and LR CLONASE™) derived from lambda phage and uses BP CLONASE™-specific recombination sites for an Entry Vector and LR CLONASE™-specific recombination sites for a Destination Vector, which may comprise a tag useful for polypeptide purification. With this system, an expression vector can be obtained by using homologous recombination.

First, a polynucleotide fragment of interest is inserted into the entry vector using the first recombination. Then, the secondary recombination is allowed to take place between the entry vector, where the polynucleotide fragment of interest has been inserted, and the destination vector. Thus, the expression vector can be prepared rapidly and highly efficiently. With the above-mentioned typical method using restriction enzyme and ligase reactions, the step of expression vector construction and expression of polypeptide of interest takes about 7 to 10 days. However, with the GATEWAY™ system, the polypeptide of interest can be expressed and prepared in only 3 to 4 days. Thus, the system ensures a high-throughput functional analysis for expressed polypeptides (http://biotech.nikkeibp.co.jp/netlink/lto/gateway/).

The present invention also relates to a transformant carrying the vector of the invention. Any cell can be used as a host into which the vector of the invention is inserted, and various kinds of host cells can be used depending on the purposes. For strong expression of the polypeptide in eukaryotic cells, COS cells or CHO cells can be used, for example.

Introduction of the vector into host cells can be performed, for example, by calcium phosphate precipitation method, electroporation method (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wiley & Sons, Section 9.1-9.9), lipofectamine method (GIBCO-BRL), or microinjection method, etc.

Further, a polynucleotide containing at least 15 nucleotides comprising a nucleotide sequence of any one of the polynucleotides comprising the nucleotide sequences of SEQ ID NOs shown in Table 1 or the complementary strand thereof can be used not only as a primer for synthesizing full-length cDNAs but also for testing and diagnosing the abnormalities of the polypeptide encoded by the full-length cDNA of the present invention. For example, by utilizing polymerase chain reaction (genomic DNA-PCR, or RT-PCR) using the polynucleotide of the invention as a primer, polynucleotide encoding the polypeptide of the invention can be amplified. It is also possible to obtain the regulatory region of expression in the 5′-upstream by using PCR or hybridization since the transcription start site within the genomic sequence can be easily specified based on the 5′-end sequence of the full-length cDNA. The obtained genomic region can be used for detection and/or diagnosis of the abnormality of the sequence by RFLP analysis, SSCP, or sequencing. Especially, in the case where expression of the mRNA of the present invention varies according to a specific disease, analysis of the amount of expression of the mRNA using the polynucleotide of the present invention as a probe or a primer enables detection and diagnosis of the disease.

The present invention also relates to antibodies that bind to the polypeptide of the invention. There are no limitations in the form of the antibodies of the invention. They include polyclonal antibodies, monoclonal antibodies, or their portions that can bind to an antigen. They also include antibodies of all classes. Furthermore, special antibodies such as humanized antibodies and chimeric antibodies are also included.

The polyclonal antibody of the invention can be obtained according to the standard method by synthesizing an oligopeptide corresponding to the amino acid sequence and immunizing rabbits with the peptide (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wiley & Sons, Section 11.12-11.13). The monoclonal antibody of the invention can be obtained according to the standard method by purifying the polypeptide expressed in E. coli, immunizing mice with the polypeptide, and producing a hybridoma cell by fusing the spleen cells and myeloma cells (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wiley & Sons, Section 11.4-11.11).

The antibody binding to the polypeptide of the present invention can be used for purification of the polypeptide of the invention, and also for detection and/or diagnosis of the abnormalities of the expression and structure of the polypeptide. Specifically, polypeptides can be extracted, for example, from tissues, blood, or cells, and the polypeptide of the invention is detected by Western blotting, immunoprecipitation, or ELISA, etc. for the above purpose.

Furthermore, the antibody binding to the polypeptide of the present invention can be utilized for treating the diseases that associates with the polypeptide of the invention. If the antibodies are used for treating patients, human antibodies, humanized antibodies, or chimeric antibodies are preferable in terms of their low antigenicity. The human antibodies can be prepared by immunizing a mouse whose immune system is replaced with that of human (e.g., see “Functional transplant of megabase human immunoglobulin loci recapitulates human antibody response in mice” Mendez, M. J. et al. (1997) Nat. Genet. 15: 146-156). The humanized antibodies can be prepared by recombination of the hypervariable region of a monoclonal antibody (Methods in Enzymology (1991) 203: 99-121).

The use of the amino acid sequences of the polypeptides encoded by the cDNAs of the present invention enables predicting that the polypeptides have the following functions. It can be predict, from the results of homology search of SwissProt, GenBank, UniGene, or nr, that these polypeptides have such functions. Specifically, for instance, as shown in Examples, searching for a known gene or polypeptide that is homologous to the partial sequence of the full-length cDNA of the invention (1639 clone) and referring the function of the gene and of the polypeptide encoded by the gene make it possible to predict the function of the polypeptide encoded by the cDNA of the invention. In this way, each of 892 clones out of the 1639 full-length cDNA clones of the invention was predicted to encode a polypeptide that was classified into the following categories.

Secretory and/or membrane protein (439 clones)

Glycoprotein-related protein (87 clones)

Signal transduction-related protein (46 clones)

Transcription-related protein (140 clones)

Disease-related protein (219 clones)

Enzyme and/or metabolism-related protein (168 clones)

Cell division- and/or cell proliferation-related protein (23 clones)

Cytoskeleton-related protein (60 clones)

Nuclear protein and/or RNA synthesis-related protein (59 clones)

Protein synthesis- and/or transport-related protein (24 clones)

Cellular defense-related protein (6 clones)

Development and/or differentiation-related protein (19 clones)

DNA- and/or RNA-binding protein (158 clones)

ATP- and/or GTP-binding protein (63 clones)

The functions of the polypeptides encoded by the cDNAs of the present invention can be predicted by assessing the presence of signal sequence, transmembrane region, nuclear translocation signal, glycosylation signal, phosphorylation site, and zinc finger motif, SH3 domain, etc. in the amino acid sequences. The programs, PSORT (Nakai K., and Kanehisa M. (1992) Genomics 14: 897-911), SOSUI (Hirokawa T. et al. (1998) Bioinformatics 14: 378-379) (Mitsui Knowledge Industry), and MEMSAT (Jones D. T., Taylor W. R., and Thornton J. M. (1994) Biochemistry 33: 3038-3049) can be used to predict the existence of the signal sequence or transmembrane region. Alternatively, a partial amino acid sequence of the polypeptide is fused with another polypeptide such as GFP, the fusion polypeptide is transfected into cultured cells, and the localization is analyzed to predict the function of the original polypeptide.

Based on the determined nucleotide sequences of the full-length cDNAs obtained in the present invention, it is possible to predict more detailed functions of the polypeptides encoded by the cDNA clones, for example, by searching the databases such as GenBank, Swiss-Prot, UniGene, and nr for homologies of the cDNAs; or by searching the amino acid sequences deduced from the full-length cDNAs for signal sequences by using software programs such as PSORT, for transmembrane regions by using software programs such as SOSUI or for motifs by using software programs such as Pfam (http://www.sanger.ac.uk/Software/Pfam/index.shtml) and PROSITE (http://www.expasy.ch/prosite/). As a matter of course, the functions are often predictable by using partial sequence information (preferably 300 nucleotides or more) instead of the full-length nucleotide sequences. However, the result of the prediction by using partial nucleotide sequence does not always agree with the result obtained by using full-length nucleotide sequence, and thus, it is needless to say that the prediction of function is preferably performed based on the full-length nucleotide sequences.

GenBank, Swiss-Prot, UniGene and nr databases were searched for homologies of the full-length nucleotide sequences of the 1639 clones (see Example 6). The amino acid sequences deduced from the full-length nucleotide sequences were searched for functional domains by PSORT, SOSUI and Pfam. Prediction of functions of polypeptides encoded by the clones and the categorization thereof were performed based on these results obtained. The categorization was carried out by the following method.

[1] Firstly, the cDNA clones were classified into the above-mentioned 14 functional categories based on the results of annotation-based categorization (using the keywords in the case of Swiss-Prot hit data; using Definition or Reference information in the case of GenBank, UniGene, or nr hit data), and the signal sequence search of the deduced ORFs by PSORT and the transmembrane region search by SOSUI.

[2] Secondly, clones which had been unassignable to the categories by the method of [1] were searched for functional domains and/or motifs by Pfam. Based on the results, the clones were additionally classified into the above-mentioned 14 types of categories when they had a functional domain and/or motif assignable to any one of the categories.

The following 439 clones presumably belong to secretory and/or membrane proteins.

3NB6910000180, 3NB6910000850, 3NB6920000290, 3NB6920003300, 3NB6920005450, 3NB6920010020, ADRGL10000180, ADRGL10001600, ADRGL20003230, BGGI120010970, BNGH410000340, BNGH410001040, BNGH410001180, BNGH410001370, BNGH410001980, BRACE10000730, BRACE10001690, BRACE20002800, BRACE20007180, BRACE20010650, BRACE20011170, BRACE20011430, BRACE20013400, BRACE20013520, BRACE20014230, BRACE20014530, BRACE20014920, BRACE20015080, BRACE20018590, BRACE20022270, BRACE20024680, BRACE20026350, BRACE20026850, BRACE20030780, BRACE20031100, BRACE20034490, BRACE20071380, BRACE20071970, BRACE20072810, BRACE20074010, BRACE20074470, BRACE20075020, BRACE20075380, BRACE20076410, BRACE20076630, BRACE20076850, BRACE20077610, BRACE20077640, BRACE20077980, BRACE20078680, BRACE20079530, BRACE20084430, BRACE20086550, BRACE20089600, BRACE20091880, BRAWH10000010, BRAWH10000370, BRAWH10000940, BRAWH10001620, BRAWH10001800, BRAWH20001090, BRAWH20004430, BRAWH20006970, BRAWH20009840, BRAWH20011290, BRAWH20011410, BRAWH20011660, BRAWH20014380, BRAWH20014840, BRAWH20015030, BRAWH20036930, BRAWH20038320, BRAWH20040950, BRAWH20052250, BRAWH20059980, BRAWH20087060, BRAWH20092610, CD34C20000510, CTONG20013660, CTONG20015330, CTONG20028160, CTONG20037820, CTONG20047160, DFNES20003350, FCBBF10006180, FCBBF10006750, FCBBF20005910, FCBBF20007330, FCBBF20008150, FCBBF20009400, FCBBF20015380, FEBRA20003780, FEBRA20004040, FEBRA20004150, FEBRA20004520, FEBRA20004910, FEBRA20006560, FEBRA20006900, FEBRA20007330, FEBRA20008090, FEBRA20008800, FEBRA20010930, FEBRA20012270, FEBRA20012450, FEBRA20012940, FEBRA20013510, FEBRA20014870, FEBRA20014920, FEBRA20015840, FEBRA20020860, FEBRA20021910, FEBRA20025250, FEBRA20031550, FEBRA20037070, FEBRA20041100, FEBRA20041910, FEBRA20057780, FEBRA20063150, FEBRA20066670, FEBRA20067930, HCASM10000610, HCASM20002020, HEART20000990, HEART20004920, HHDPC20000950, HLUNG10000240, HLUNG10000370, HLUNG10001100, HLUNG20001160, HLUNG20001250, HLUNG20001420, HLUNG20001760, HLUNG20002550, HSYRA20003470, HSYRA20006290, HSYRA20008280, HSYRA20011030, HSYRA20013320, HSYRA20014200, HSYRA20015800, IMR3210000440, IMR3210001580, IMR3210002660, IMR3220007750, IMR3220008590, IMR3220009840, IMR3220014350, KIDNE10000080, KIDNE10001040, KIDNE10001430, KIDNE20000700, KIDNE20000850, KIDNE20001670, KIDNE20003150, KIDNE20003300, KIDNE20003490, KIDNE20004220, KIDNE20005170, KIDNE20005190, KIDNE20033050, KIDNE20033570, KIDNE20039410, KIDNE20042620, KIDNE20042950, KIDNE20044110, KIDNE20048280, KIDNE20049810, KIDNE20054000, KIDNE20054770, KIDNE20060530, KIDNE20060620, KIDNE20063530, KIDNE20063760, KIDNE20066520, KIDNE20067600, KIDNE20071860, KIDNE20073520, KIDNE20074220, KIDNE20075690, LIVER10000580, LIVER10000670, LIVER10001040, LIVER10001110, LIVER10001750, LIVER10005420, LIVER20004160, MAMGL10000320, MAMGL10001840, MESAN10000350, MESAN10001470, MESAN10001800, MESAN20001490, NB9N420000420, NHNPC20002060, NT2NE10000230, NT2NE10000830, NT2NE10001630, NT2NE20003270, NT2NE20003920, NT2NE20004550, NT2NE20004700, NT2NE20005500, NT2NE20012470, NT2NE20014350, NT2NE20016260, NT2NE20034080, NT2NE20047160, NT2NE20055170, NT2NE20057200, NT2RI20005970, NT2RI20009740, NT2RI20010100, NT2RI20014490, NT2RI20015400, NT2RI20015950, NT2RI20016570, NT2RI20018660, NT2RI20020220, NT2RI20021520, NT2RI20022430, NT2RI20022520, NT2RI20025300, NT2RI20030110, NT2RI20030510, NT2RI20031540, NT2RI20033010, NT2RI20033830, NT2RI20036780, NT2RI20042840, NT2RI20044420, NT2RI20049850, NT2RI20050870, NT2RI20051500, NT2RI20066820, NT2RI20068250, NT2RI20070480, NT2RI20070840, NT2RI20073030, NT2RI20074980, NT2RI20077540, NT2RI20078270, NT2RI20080500, NT2RI20081880, NT2RI20084810, NT2RI20085980, NT2RI20089420, NT2RI20092890, NT2RI20094060, NT2RP60000320, NT2RP60000390, NT2RP60001090, NT2RP70000690, NT2RP70002380, NT2RP70002590, NT2RP70003640, NT2RP70011660, NT2RP70015910, NT2RP70021510, NT2RP70023760, NT2RP70023790, NT2RP70026190, NT2RP70029820, NT2RP70040800, NT2RP70043730, NT2RP70047900, NT2RP70049250, NT2RP70055200, NT2RP70064080, NT2RP70071540, NT2RP70071770, NT2RP70073810, NT2RP70074220, NT2RP70075040, NT2RP70076170, NT2RP70079250, NT2RP70079750, NT2RP70081330, NT2RP70081370, NT2RP70083150, NT2RP70085500, NT2RP70090120, NT2RP70091490, NT2RP70091680, NT2RP70092360, NT2RP70093220, NT2RP70093730, NT2RP70094290, NT2RP70094810, NT2RP70094980, NT2RP70095070, NTONG10000980, NTONG10002140, NTONG10002570, NTONG20002650, NTONG20004920, NTONG20008000, NTONG20012220, OCBBF10000420, OCBBF20002310, OCBBF20009980, OCBBF20012100, PANCR10000210, PLACE50000670, PLACE50000680, PLACE50001050, PLACE50001130, PLACE60012810, PLACE60018860, PLACE60020160, PLACE60020840, PLACE60026990, PLACE60037050, PLACE60037450, PLACE60043960, PLACE60044540, PLACE60047380, PLACE60049930, PLACE60050290, PROST10002200, PROST10002720, PROST10005260, PROST10005360, PROST20000360, PROST20026820, PROST20029600, PROST20032320, PROST20033020, PROST20039220, PROST20044160, PROST20051430, PROST20054260, PROST20058800, PROST20059190, PROST20059430, PROST20069880, PROST20072370, PROST20073890, PUAEN10000570, PUAEN10003220, SALGL10001570, SKMUS20007740, SKNMC10000190, SKNMC10000290, SKNMC10002290, SKNMC10002510, SKNMC20011130, SKNMC20015030, SMINT10000160, SMINT10000420, SMINT10000570, SMINT10001180, SMINT20000180, SMINT20002770, SPLEN10000910, SPLEN20001340, SPLEN20002430, SPLEN20002700, SPLEN20003100, SPLEN20004960, STOMA10000520, STOMA10001170, STOMA20000320, STOMA20002570, SYNOV20001770, SYNOV20016480, TESTI10000420, TESTI10000960, TESTI10001270, TESTI10001380, TESTI20001770, TESTI20006000, TESTI20007620, TESTI20008830, TESTI20009090, TESTI20009700, TESTI20011340, TESTI20012370, TESTI20013520, TESTI20014200, TESTI20016210, TESTI20016710, TESTI20018520, TESTI20018620, TESTI20020020, TESTI20020810, TESTI20022510, TESTI20024230, TESTI20024650, TESTI20024670, TESTI20025800, TESTI20026320, TESTI20026980, TESTI20027000, TESTI20027070, TESTI20028660, TESTI20030370, TESTI20031930, TESTI20034190, TESTI20036490, TESTI20039980, TESTI20042870, TESTI20047120, TESTI20049940, TESTI20056900, TESTI20057420, TESTI20058600, TESTI20067740, TESTI20069780, TESTI20074800, TESTI20077490, TESTI20079510, TESTI20080200, TESTI20081440, TESTI20087740, TESTI20088470, TESTI20136910, THYMU10000830, THYMU10001760, THYMU10003290, THYMU10003820, THYMU10005580, TRACH10000630, TRACH10001000, TRACH10001400, TRACH20001850, TRACH20001960, TRACH20004200, TRACH20004960, TRACH20006650, TRACH20007670, TRACH20008980, TRACH20015920, UMVEN20001330, UTERU10000770, UTERU10000960, UTERU10001920, UTERU20000470, UTERU20003930, UTERU20004850

The following 87 clones presumably belong to glycoprotein-related proteins.

BNGH410000340, BNGH410001180, BRACE20014920, BRACE20015080, BRACE20018590, BRACE20024680, BRACE20026350, BRACE20031100, BRACE20074470, BRAWH10000370, BRAWH20001090, BRAWH20011660, BRAWH20014840, BRAWH20059980, CD34C20000510, CTONG20013660, CTONG20028160, CTONG20037820, FCBBF20007330, FEBRA20007330, FEBRA20008800, FEBRA20014920, FEBRA20015840, FEBRA20057780, HEART20005060, HLUNG10001100, HLUNG20002550, HSYRA20013320, IMR3210002660, IMR3220007750, IMR3220013320, KIDNE20044110, KIDNE20063760, KIDNE20067600, KIDNE20073520, LIVER20000370, MESAN10000350, NT2NE10000830, NT2NE10001850, NT2NE20003270, NT2NE20016260, NT2RI20018660, NT2RI20025300, NT2RI20036780, NT2RI20077540, NT2RI20080500, NT2RI20085980, NT2RI20089420, NT2RI20092890, NT2RP70000690, NT2RP70004770, NT2RP70055200, NT2RP70081370, NT2RP70083150, NT2RP70091490, NT2RP70092360, NT2RP70094980, NTONG10002140, OCBBF20002310, OCBBF20002770, PLACE50000680, PLACE50001130, PLACE60018860, PLACE60044540, PROST20018230, PROST20032320, PROST20073890, SALGL10001570, SKNMC20015030, SMINT10000160, SMINT20002770, SPLEN20001340, TESTI10001270, TESTI10001380, TESTI20001770, TESTI20024230, TESTI20027070, TESTI20036490, TESTI20039980, TESTI20056900, TESTI20057420, TESTI20079510, THYMU10001760, TRACH10000740, TRACH10001250, TRACH20004200, UTERU20000470

The following 46 clones presumably belong to signal transduction-related proteins.

ADRGL20000740, ASTRO10000180, BRACE20005770, BRACE20022020, BRACE20027360, BRACE20027920, BRAWH20006860, CTONG20005890, FEBRA20000350, HHDPC20000550, IMR3220003020, KIDNE20033730, KIDNE20040840, KIDNE20053360, KIDNE20062990, NT2RI20033440, NT2RI20058110, NT2RI20062100, NT2RI20073840, NT2RP70006240, NT2RP70043960, NT2RP70046870, NT2RP70061880, NT2RP70072520, NT2RP70081440, NT2RP70093700, NTONG10001820, PEBLM20004790, PLACE60026680, PROST20033400, PROST20043320, SKMUS10000220, SKMUS20016680, SPLEN20003570, TESTI20001540, TESTI20005910, TESTI20022560, TESTI20024980, TESTI20029120, TESTI20034980, TESTI20049820, TESTI20055840, THYMU10003590, THYMU20003690, TRACH20002500, TRACH20002890

The following 140 clones presumably belong to transcription-related proteins.

3NB6920010220, 3NB6920015110, 3NB6920015570, ADRGL10000650, BGGI120006840, BGGI120006930, BGGI120017140, BNGH410000800, BNGH420005320, BRACE10000930, BRACE20014550, BRACE20018550, BRACE20020910, BRACE20024090, BRACE20071740, BRAWH10000020, BRAWH10001640, BRAWH10001680, BRAWH20006330, BRAWH20009010, CTONG20025580, CTONG20028200, FCBBF10005980, FCBBF20000940, FCBBF20009510, FCBBF50002610, FEBRA20003970, FEBRA20003990, FEBRA20004540, FEBRA20009720, FEBRA20011460, FEBRA20017150, FEBRA20050140, FEBRA20064760, FEBRA20067360, FEBRA20069420, FEBRA20072800, HLUNG10000760, HLUNG20000680, HSYRA10001370, HSYRA20016310, IMR3210002420, IMR3220007420, KIDNE20000510, KIDNE20039940, KIDNE20061490, KIDNE20078110, NESOP10000870, NHNPC10001240, NHNPC20002120, NT2NE20002590, NT2NE20008090, NT2RI20003410, NT2RI20004120, NT2RI20004210, NT2RI20010830, NT2RI20018460, NT2RI20025410, NT2RI20025850, NT2RI20060710, NT2RI20067350, NT2RI20071330, NT2RI20074390, NT2RI20078790, NT2RI20087140, NT2RI20090650, NT2RI20092150, NT2RP60001000, NT2RP60001270, NT2RP70002710, NT2RP70008120, NT2RP70018560, NT2RP70024500, NT2RP70032030, NT2RP70036290, NT2RP70042040, NT2RP70045410, NT2RP70046560, NT2RP70055130, NT2RP70061620, NT2RP70062960, NT2RP70064900, NT2RP70069860, NT2RP70075370, NT2RP70085570, NT2RP70087200, NT2RP70090190, NTONG20003340, NTONG20003630, NTONG20015500, OCBBF20011010, OCBBF20011240, OCBBF20015860, PEBLM20002480, PEBLM20002700, PEBLM20003080, PEBLM20003950, PLACE60002050, PLACE60005550, PLACE60021510, PLACE60030380, PROST20018230, PROST20031170, PROST20073170, PUAEN10001610, SALGL10000650, SKMUS10000640, SKMUS20014920, SKNMC20000650, SKNMC20002240, SKNMC20003560, SMINT10001000, SMINT20005450, SPLEN20000200, SPLEN20000720, SYNOV20010140, SYNOV20013740, SYNOV20014510, TESTI10000550, TESTI20001200, TESTI20007070, TESTI20010490, TESTI20015560, TESTI20018150, TESTI20018790, TESTI20021490, TESTI20026760, TESTI20027890, TESTI20030710, TESTI20034130, TESTI20042290, TESTI20053960, TESTI20074640, TESTI20074660, TESTI20078640, THYMU10004590, TRACH20000790, TRACH20002370, TRACH20009440, UTERU10001600

The following 219 clones presumably belong to disease-related proteins.

ADRGL10000020, ADRGL10001600, ADRGL20000740, ASTRO20004170, BGGI120006840, BGGI120010970, BGGI120017140, BNGH410001770, BNGH420005320, BRACE10001870, BRACE20006980, BRACE20007180, BRACE20014550, BRACE20018550, BRACE20018590, BRACE20027550, BRACE20027720, BRACE20076850, BRACE20086550, BRAWH10000020, BRAWH10001640, BRAWH20001770, BRAWH20005030, BRAWH20005220, BRAWH20006330, BRAWH20006860, BRAWH20009840, BRAWH20011660, CD34C20000510, CTONG20005890, CTONG20019110, CTONG20024180, CTONG20025580, CTONG20037820, CTONG20055530, FCBBF20000940, FCBBF20009510, FCBBF40002820, FEBRA20001050, FEBRA20003990, FEBRA20004150, FEBRA20004540, FEBRA20009720, FEBRA20010930, FEBRA20011460, FEBRA20050790, FEBRA20057880, FEBRA20064760, FEBRA20067930, FEBRA20070170, FEBRA20075510, FEBRA20075660, HCASM20002140, HEART20004480, HLUNG10001050, HLUNG20000680, HSYRA10001370, HSYRA20006400, HSYRA20013320, HSYRA20016310, IMR3210000440, IMR3220007910, KIDNE10001040, KIDNE20003150, KIDNE20033730, KIDNE20042950, KIDNE20044110, KIDNE20050420, KIDNE20059080, KIDNE20063760, KIDNE20078110, LIVER10002300, LIVER10004330, LIVER20000330, LIVER20000370, MAMGL10001780, MESAN10001800, MESAN20002910, MESAN20005010, NB9N410001350, NHNPC10000840, NHNPC20002120, NT2NE10000730, NT2NE20002990, NT2NE20003690, NT2NE20005170, NT2NE20005360, NT2NE20006580, NT2NE20008090, NT2NE20013720, NT2NE20016340, NT2NE20055170, NT2RI20004120, NT2RI20004210, NT2RI20010910, NT2RI20014500, NT2RI20020410, NT2RI20029580, NT2RI20031540, NT2RI20033440, NT2RI20041900, NT2RI20056470, NT2RI20057230, NT2RI20067030, NT2RI20070960, NT2RI20074980, NT2RI20077540, NT2RI20080500, NT2RI20083960, NT2RI20084810, NT2RI20092150, NT2RI20092890, NT2RP60000350, NT2RP60001000, NT2RP60001230, NT2RP70000690, NT2RP70004250, NT2RP70028750, NT2RP70029060, NT2RP70032030, NT2RP70036290, NT2RP70042600, NT2RP70046560, NT2RP70049250, NT2RP70055020, NT2RP70062960, NT2RP70063040, NT2RP70065270, NT2RP70069860, NT2RP70071770, NT2RP70073810, NT2RP70074220, NT2RP70075370, NT2RP70079250, NT2RP70081440, NT2RP70090120, NT2RP70090190, NT2RP70093220, NT2RP70094980, NTONG10002460, NTONG20003630, NTONG20015500, OCBBF10001180, OCBBF20008240, PEBLM10000340, PEBLM20002480, PEBLM20003080, PEBLM20003950, PLACE50000800, PLACE60002050, PLACE60003790, PLACE60014430, PROST10001670, PROST10005360, PROST20002730, PROST20032320, PROST20033400, PROST20062600, PROST20072890, PROST20073890, PROST20085160, SALGL10001570, SKMUS10000140, SKMUS10001180, SKMUS10001290, SKMUS20000740, SKMUS20003900, SKMUS20007240, SKMUS20016340, SKNMC10002510, SKNMC20000650, SKNMC20003220, SMINT10000420, SMINT10000570, SMINT10001000, SMINT10001030, SMINT20004000, SPLEN10001430, SPLEN20001970, STOMA20000880, STOMA20003960, SYNOV20013740, SYNOV20014510, SYNOV20016480, TESTI10001270, TESTI10001310, TESTI20001200, TESTI20001770, TESTI20002530, TESTI20006000, TESTI20006990, TESTI20007620, TESTI20008830, TESTI20011800, TESTI20012690, TESTI20015120, TESTI20018520, TESTI20018790, TESTI20021490, TESTI20025160, TESTI20027070, TESTI20027290, TESTI20029120, TESTI20033250, TESTI20049820, TESTI20053960, TESTI20068660, TESTI20071830, TESTI20074640, TESTI20079510, TESTI20086570, TESTI20140360, THYMU10000830, THYMU10001760, THYMU10003590, THYMU10004910, TRACH20002370, UTERU10000960, UTERU20000470

The following 168 clones presumably belong to the category of enzymes and/or metabolism-related proteins.

3NB6920002810, ADRGL10001600, ADRGL10001650, BGGI120005330, BNGH410000340, BNGH410001770, BRACE10000420, BRACE20015080, BRACE20022020, BRACE20024680, BRACE20026850, BRACE20027360, BRACE20027720, BRACE20027920, BRACE20071380, BRACE20084430, BRAWH20001770, BRAWH20006510, BRAWH20006860, BRAWH20009840, BRAWH20011660, BRAWH20014180, BRAWH20014840, BRAWH20036890, BRAWH20059980, BRAWH20069890, BRAWH20089560, CTONG20013660, CTONG20019110, DFNES20002120, FCBBF20007330, FCBBF20015380, FEBRA20000350, FEBRA20001290, FEBRA20003110, FEBRA20024420, FEBRA20041100, FEBRA20045920, FEBRA20050790, FEBRA20052160, FEBRA20062700, FEBRA20063150, HEART20000350, HHDPC20000550, HHDPC20004550, HLUNG10001050, HLUNG20002550, HSYRA10001680, HSYRA20005100, HSYRA20015740, IMR3220008380, IMR3220009190, IMR3220012180, IMR3220013170, KIDNE20000410, KIDNE20003490, KIDNE20004220, KIDNE20005130, KIDNE20033050, KIDNE20040840, KIDNE20046810, KIDNE20056290, KIDNE20060530, KIDNE20063760, KIDNE20068800, KIDNE20073280, KIDNE20073520, KIDNE20078100, LIVER10000670, LIVER10002300, MAMGL10001780, MESAN20002910, MESAN20005010, NT2NE10000730, NT2NE10001850, NT2NE20002140, NT2NE20003270, NT2NE20003690, NT2NE20005860, NT2NE20013720, NT2NE20016340, NT2NE20016660, NT2RI10000480, NT2RI20010100, NT2RI20015400, NT2RI20020220, NT2RI20025300, NT2RI20033010, NT2RI20036780, NT2RI20037510, NT2RI20051500, NT2RI20068550, NT2RI20073840, NT2RI20074980, NT2RI20084810, NT2RI20087910, NT2RP70004770, NT2RP70006240, NT2RP70011660, NT2RP70026190, NT2RP70062960, NT2RP70072520, NT2RP70076100, NT2RP70081440, NT2RP70084060, NT2RP70085570, NT2RP70093700, NTONG10001820, OCBBF20008240, OCBBF20012100, OCBBF20014080, OCBBF20014940, PANCR10000210, PEBLM20004790, PLACE50001050, PLACE50001130, PLACE60003790, PLACE60012810, PLACE60018860, PLACE60044540, PROST20031170, PROST20032320, PROST20033400, PROST20051210, PROST20064500, SKMUS10001290, SKMUS10001770, SKMUS20000740, SKMUS20007240, SKMUS20008630, SKMUS20009330, SKMUS20011290, SKNSH10001740, SKNSH20003470, SMINT10000160, SPLEN20001340, STOMA10001860, STOMA20001210, STOMA20004820, SYNOV20016480, TESTI10000700, TESTI10001380, TESTI20001540, TESTI20005910, TESTI20012690, TESTI20018270, TESTI20022560, TESTI20027070, TESTI20029120, TESTI20034190, TESTI20034980, TESTI20040000, TESTI20042070, TESTI20042950, TESTI20047120, TESTI20049820, TESTI20138320, TESTI20140360, TESTI30000020, THYMU10000830, THYMU10004910, THYMU20003170, THYMU20003690, TRACH20000150, TRACH20004720, TRACH20004970, TRACH20009260, UTERU10000960

The following 23 clones presumably belong to the category of cell division- and/or cell proliferation-related proteins.

BGGI120001610, BRACE20027550, BRACE20076850, BRAWH20005030, BRAWH20005220, FEBRA20075660, HCASM20002140, HLUNG10000640, IMR3220009730, NT2NE20003840, NT2RI20006850, NT2RI20041900, NT2RI20058110, NTONG10002460, NTONG20008780, SKMUS20016340, SKNMC20003220, SPLEN10001430, TESTI10001680, TESTI20001840, TESTI20021050, TESTI20035120, TESTI20057310

The following 60 clones presumably belong to the category of cytoskeleton-related proteins.

ADRGL10000020, BRACE20006980, BRACE20008850, BRACE20027960, BRACE20074470, BRACE20076630, BRACE20078820, BRACE20093070, BRAWH20000480, BRAWH20066220, CTONG20019550, CTONG20028160, CTONG20055530, DFNES20002680, FCBBF20005910, FEBRA20007720, FEBRA20008810, FEBRA20034290, FEBRA20043290, FEBRA20072000, HEART20004480, HEART20005200, HLUNG10001100, HSYRA20006050, IMR3220007910, KIDNE20040840, KIDNE20052960, NT2RI20014090, NT2RI20032220, NT2RI20058510, NT2RI20090660, NT2RP70000690, NT2RP70004250, NT2RP70028750, NT2RP70042600, NT2RP70049250, NT2RP70074220, NTONG20009660, OCBBF20011760, OCBBF20015280, PEBLM10000680, PROST10001670, PROST20033380, TESTI10000420, TESTI10000510, TESTI20003560, TESTI20004350, TESTI20006000, TESTI20006990, TESTI20008490, TESTI20008830, TESTI20011410, TESTI20015110, TESTI20016610, TESTI20020570, TESTI20024230, TESTI20031090, TESTI20031170, TESTI20039140, TESTI20078720

The following 59 clones presumably belong to the category of nuclear proteins and/or RNA synthesis-related proteins.

3NB6920002810, 3NB6920015280, BGGI120005440, BRACE10001150, BRACE20024780, BRACE20027550, BRAWH20005030, BRAWH20014180, BRAWH20069890, CTONG20024180, FEBRA20001290, FEBRA20075660, HEART20003090, HLUNG10000640, HSYRA10001680, HSYRA20005100, IMR3220008630, IMR3220012180, MAMGL10001780, NT2NE10001850, NT2NE20002140, NT2NE20003840, NT2NE20016660, NT2NE20054410, NT2RI20002820, NT2RI20006850, NT2RI20010910, NT2RI20025540, NT2RI20041900, NT2RI20053350, NT2RI20057230, NT2RI20060720, NT2RI20067030, NT2RI20068550, NT2RI20078840, NT2RI20087490, NT2RP70004770, NT2RP70013060, NT2RP70076430, NTONG20008780, PEBLM10000340, PLACE50000580, PLACE60003790, PROST20001760, PROST20062600, SKMUS10000220, SKMUS20016340, SKNMC20003220, SPLEN10001430, SPLEN20001970, TESTI10001680, TESTI20002530, TESTI20007840, TESTI20021050, TESTI20029120, TESTI20035120, TESTI20057310, TRACH20003930, TRACH20012890

The following 24 clones presumably belong to the category of protein synthesis- and/or protein transport-related proteins.

BRACE20078680, FEBRA20075510, IMR3220008380, KIDNE20005190, KIDNE20050420, MESAN20002910, NB9N410001350, NT2NE20005360, NT2RI20032050, NT2RI20032220, NT2RP70000760, NT2RP70076430, NT2RP70093940, OCBBF20008240, PLACE50000580, PROST20000530, SKMUS20000740, SKMUS20008630, TESTI20007840, TESTI20015120, TESTI20018690, TESTI20078720, THYMU10005580, UMVEN20001330

The following 6 clones presumably belong to the category of cellular defense-related proteins.

BRACE20014550, NT2RI20037510, NT2RI20053350, NT2RP70029060, NT2RP70062960, PLACE50001700

The following 19 clones presumably belong to the category of development and/or differentiation-related proteins.

BGGI120006930, CTONG20028200, FCBBF50002610, FEBRA20014920, FEBRA20017150, FEBRA20060920, MAMGL10001820, NESOP10000870, NHNPC10001240, NT2RI20078790, NT2RP70008120, NT2RP70018560, NT2RP70045410, OCBBF20002770, SALGL10000650, SMINT10001000, TESTI10000550, TESTI20026760, TESTI20078140

The following 158 clones presumably belong to the category of DNA- and/or RNA-binding proteins.

3NB6920002810, 3NB6920010220, 3NB6920015110, 3NB6920015570, ADRGL10000650, BGGI120006840, BGGI120006930, BNGH410000800, BNGH420005320, BRACE20014550, BRACE20020910, BRACE20024090, BRACE20024780, BRACE20071740, BRAWH10001640, BRAWH10001680, BRAWH20000340, BRAWH20006330, BRAWH20009010, BRAWH20014180, BRAWH20069890, CTONG20025580, CTONG20028200, D3OST20001840, FCBBF10005980, FCBBF20009510, FCBBF50002610, FEBRA20003970, FEBRA20003990, FEBRA20004540, FEBRA20008560, FEBRA20009720, FEBRA20017150, FEBRA20017900, FEBRA20050140, FEBRA20064760, FEBRA20067360, FEBRA20069420, FEBRA20072800, HEART20003090, HLUNG10000760, HSYRA10001370, HSYRA20016310, IMR3210002420, IMR3220007420, IMR3220008630, KIDNE20000510, KIDNE20039940, KIDNE20061490, KIDNE20078110, NESOP10000870, NHNPC10000840, NHNPC10001240, NHNPC20002120, NT2NE20002590, NT2NE20003840, NT2NE20008090, NT2NE20016660, NT2NE20054410, NT2RI20003410, NT2RI20004210, NT2RI20006850, NT2RI20010830, NT2RI20010910, NT2RI20025410, NT2RI20025850, NT2RI20057230, NT2RI20060710, NT2RI20067350, NT2RI20071330, NT2RI20074390, NT2RI20078790, NT2RI20078840, NT2RI20087140, NT2RI20087490, NT2RI20090650, NT2RP60001000, NT2RP60001270, NT2RP70002710, NT2RP70008120, NT2RP70013060, NT2RP70018560, NT2RP70024500, NT2RP70032030, NT2RP70042040, NT2RP70045410, NT2RP70046560, NT2RP70055130, NT2RP70061620, NT2RP70062960, NT2RP70064900, NT2RP70069860, NT2RP70075370, NT2RP70081670, NT2RP70085570, NT2RP70087200, NT2RP70090190, NTONG20003340, NTONG20008780, NTONG20015500, OCBBF20011010, OCBBF20015860, PEBLM10000340, PEBLM20001120, PEBLM20002700, PEBLM20003080, PLACE60002050, PLACE60005550, PLACE60021510, PLACE60030380, PROST20001760, PROST20003250, PROST20018230, PROST20031170, PROST20062600, PROST20073170, SALGL10000650, SKMUS10000640, SKMUS20014920, SKMUS20016340, SKNMC20000650, SKNMC20002240, SKNMC20003220, SKNMC20003560, SMINT10001000, SMINT20005450, SPLEN10001430, SPLEN20000200, SPLEN20000720, SPLEN20001970, SYNOV20010140, SYNOV20013740, SYNOV20014510, TESTI10000550, TESTI20001200, TESTI20007070, TESTI20010490, TESTI20013450, TESTI20015560, TESTI20018150, TESTI20021050, TESTI20021490, TESTI20026760, TESTI20027890, TESTI20030710, TESTI20033270, TESTI20034130, TESTI20035120, TESTI20053960, TESTI20074640, TESTI20074660, TESTI20078640, THYMU10004590, TRACH20000790, TRACH20002370, TRACH20009440, TRACH20012890, UTERU10001600

The following 63 clones presumably belong to the category of ATP- and/or GTP-binding proteins.

3NB6920002810, BNGH410000390, BRACE20022020, BRACE20028120, BRACE20071380, BRAWH20000480, BRAWH20006860, BRAWH20066220, CTONG20013200, DFNES20002680, FEBRA20043290, FEBRA20052160, FEBRA20072000, FEBRA20075510, HHDPC20000550, HLUNG20001160, HSYRA10001680, HSYRA20005100, HSYRA20006050, KIDNE20040840, MAMGL10001780, MESAN20002910, NB9N410001350, NT2NE20003690, NT2NE20005170, NT2NE20016660, NT2NE20055170, NT2RI20068550, NT2RI20073840, NT2RP70004250, NT2RP70011660, NT2RP70029060, NT2RP70036290, NT2RP70042600, NT2RP70046870, NT2RP70062960, NT2RP70081370, NT2RP70081440, NT2RP70093700, OCBBF20008240, OCBBF20015280, PEBLM20004790, PLACE50001700, PLACE60003790, PROST20018990, PROST20033400, SKMUS20008630, SMINT10000420, TESTI20001540, TESTI20003560, TESTI20005910, TESTI20006950, TESTI20006990, TESTI20008490, TESTI20015110, TESTI20016610, TESTI20022560, TESTI20029120, TESTI20034980, TESTI20042290, TESTI20047120, TESTI20049820, TESTI20057310

Among the clones other than the ones shown above, NTONG10001300 is a clone which was predicted to highly possibly belong to the category of secretory protein and/or membrane protein based on the result of domain search by Pfam.

FEBRA20017060, NT2RI20066790, SMINT10000710

The three clones shown above are clones which were predicted to highly possibly belong to the category of glycoprotein-related protein based on the result of domain search by Pfam.

BRACE20080970, BRACE20092120, BRAWH10001300, FEBRA20019890, KIDNE20031850, KIDNE20060140, MESAN20000920, NB9N410000470, NT2RI20071480, NT2RI20078910, NT2RP70088550, NTONG20016120, OCBBF10000910, PROST20094830, SKNSH10003010, SPLEN20002670, TESTI20031960, TESTI20036250, TESTI20037810, TESTI20083870, TESTI20177400

The 21 clones shown above are clones which were predicted to highly possibly belong to the category of signal transduction-related protein based on the result of domain search by Pfam.

3NB6920009120, 3NB6920014710, BRACE10001660, BRACE20083850, BRAWH20004760, BRAWH20012030, CTONG20011390, CTONG20018200, FEBRA20007870, FEBRA20043250, HHDPC20003150, NT2RI10000270, NT2RI20036950, NT2RI20053680, NT2RI20072540, NT2RI20083360, NT2RP70030550, OCBBF20013070, OCBBF20015270, PLACE60046630, PROST10003430, PROST20067370, SKMUS10001040, SKNMC20015960, TESTI20030050, TESTI20033540, TESTI20035890, TESTI20068720, TRACH20004110

The 29 clones shown above are clones which were predicted to highly possibly belong to the category of transcription-related protein based on the result of domain search by Pfam.

BNGH410001900, BRACE20080970, BRACE20092120, BRAWH20093600, FEBRA20003770, FEBRA20024290, HLUNG10000990, KIDNE20004030, MESAN20000920, NB9N420001040, NT2NE10000140, NT2NE20001740, NT2RI20050610, NT2RI20055640, NT2RI20072540, NT2RI20074690, NT2RP60000860, NT2RP70036470, NT2RP70036800, NT2RP70072210, NT2RP70074060, NT2RP70084870, NTONG10001300, NTONG10002640, NTONG20016120, OCBBF10000910, OCBBF10001190, OCBBF20007190, SKMUS20001170, SKMUS20016620, SKNMC20000970, SKNMC20015960, SYNOV10001280, TESTI20002380, TESTI20006270, TESTI20013300, TESTI20031520, TESTI20036250, TESTI20037810, TESTI20064830, TESTI20083870, TRACH20006750, TRACH20016070

The 43 clones shown above are clones which were predicted to highly possibly belong to the category of enzyme and/or metabolism-related protein based on the result of domain search by Pfam.

NT2RI20064120

The 1 clone shown above is a clone which was predicted to highly possibly belong to the category of cell division and/or cell proliferation-related protein based on the result of domain search by Pfam.

BRACE20083800, KIDNE20004970

The 2 clones shown above are clones which were predicted to highly possibly belong to the category of cytoskeleton-related protein based on the result of domain search by Pfam.

3NB6920009120, 3NB6920014710, BRACE10001660, BRACE20083850, BRAWH20004760, BRAWH20012030, BRAWH20064500, CTONG20011390, CTONG20018200, FEBRA20007870, FEBRA20043250, HCASM20003070, HHDPC20003150, NT2RI10000270, NT2RI20036950, NT2RI20053680, NT2RI20072540, NT2RI20083360, NT2RP70012310, NT2RP70030550, NT2RP70036470, OCBBF20013070, OCBBF20015270, PLACE60046630, PROST10003430, PROST20067370, SKMUS10001040, SKNMC20000970, SKNMC20015960, TESTI20030050, TESTI20032280, TESTI20033540, TESTI20035890, TESTI20068720, TRACH20004110

The 34 clones shown above are clones which were predicted to highly possibly belong to the category of DNA- and/or RNA-binding protein based on the result of domain search by Pfam.

NT2RI20064120

The 1 clone shown above is a clone which was predicted to highly possibly belong to the category of ATP- and/or GTP-binding proteins based on the result of domain search by Pfam.

The 185 clones shown below are clones which were unassignable to any of the above-mentioned categories, but have been predicted to have some functions based on homology search using their full-length nucleotide sequences and motif search in their estimated ORFs.

3NB6910001160, ASTRO20004170, BNGH410000030, BNGH410001900, BRACE20005250, BRACE20014770, BRACE20016730, BRACE20017370, BRACE20024310, BRACE20028960, BRACE20077840, BRACE20083850, BRAWH20003230, BRAWH20009440, BRAWH20076050, CTONG20018200, CTONG20027210, CTONG20064490, DFNES20004320, FCBBF10006870, FCBBF20002760, FCBBF20012110, FEBRA20000530, FEBRA20005360, FEBRA20007570, FEBRA20011330, FEBRA20019890, FEBRA20030540, FEBRA20043250, FEBRA20044900, FEBRA20048180, FEBRA20053800, FEBRA20068730, FEBRA20070170, HCASM10000210, HCASM20005360, HHDPC20001150, HHDPC20001490, HLUNG10000990, HSYRA10001190, HSYRA20001350, HSYRA20006400, IMR3220002230, IMR3220014910, KIDNE10001520, KIDNE20003750, KIDNE20004970, KIDNE20005740, KIDNE20031850, KIDNE20043440, KIDNE20056760, KIDNE20059080, KIDNE20060140, KIDNE20060300, KIDNE20067750, LIVER10000790, LIVER10004330, MESAN10001010, MESAN20000920, NB9N410000470, NB9N420001040, NB9N420004950, NT2NE10000180, NT2NE10000630, NT2NE20013370, NT2NE20016970, NT2NE20035690, NT2NE20053710, NT2RI20006690, NT2RI20013420, NT2RI20013850, NT2RI20015190, NT2RI20016210, NT2RI20022700, NT2RI20025170, NT2RI20029260, NT2RI20029580, NT2RI20043040, NT2RI20061830, NT2RI20064120, NT2RI20065060, NT2RI20074690, NT2RI20077230, NT2RI20082210, NT2RI20083960, NT2RI20088120, NT2RP60000080, NT2RP60000350, NT2RP60000720, NT2RP60000860, NT2RP70009060, NT2RP70010800, NT2RP70022430, NT2RP70028290, NT2RP70033040, NT2RP70036320, NT2RP70036800, NT2RP70042330, NT2RP70049150, NT2RP70052050, NT2RP70055020, NT2RP70063040, NT2RP70072210, NT2RP70084410, NT2RP70084870, NTONG10000520, NTONG10001230, NTONG10001300, OCBBF10001220, OCBBF20007190, OCBBF20011400, OCBBF20014020, OCBBF20014940, PEBLM10001440, PEBLM20002130, PLACE50000370, PLACE50000800, PLACE60014430, PLACE60024190, PLACE60033990, PLACE60038500, PLACE60043970, PLACE60044640, PROST20023380, PROST20034720, PROST20067370, PROST20079740, SALGL10000470, SKMUS10000140, SKMUS10001040, SKMUS10001180, SKMUS20001170, SKMUS20003650, SKMUS20003900, SKMUS20004580, SKMUS20009020, SKMUS20009540, SKMUS20010080, SKMUS20011470, SKMUS20015430, SKMUS20016620, SKNMC20000970, SKNMC20015960, SMINT10001030, SMINT20001450, SMINT20003960, SMINT20004000, SPLEN20002670, SYNOV10001280, SYNOV20002910, SYNOV20008200, TESTI10000250, TESTI10000640, TESTI10001310, TESTI10001910, TESTI20000440, TESTI20002070, TESTI20002080, TESTI20014120, TESTI20016650, TESTI20022230, TESTI20022940, TESTI20024610, TESTI20027290, TESTI20030050, TESTI20030590, TESTI20030740, TESTI20035510, TESTI20035740, TESTI20041220, TESTI20052680, TESTI20054080, TESTI20064830, TESTI20065720, TESTI20068660, TESTI20071830, TESTI20078670, TESTI20083870, THYMU10000020, THYMU10002910, TRACH10000300, TRACH20006750, TRACH20007800, TRACH20008940, TRACH20013950

Further, the reason is that a polypeptide does not always belong solely to a single category of the above-described functional categories, and therefore, a polypeptide may belong to any of the predicted functional categories. Besides, additional functions can be found for the clones classified into these functional categories by further analyses.

Since the polypeptide encoded by clones of the invention contains full-length amino acid sequence, it is possible to analyze its biological activity, and its effect on cellular conditions such as cell proliferation and differentiation by expressing the polypeptide as a recombinant polypeptide using an appropriate expression system, injecting the recombinant into the cell, or raising a specific antibody against the polypeptide.

The biological activities of respective polypeptides can be analyzed by the methods as shown below.

Secretory Protein, Transmembrane Protein:

“Ion Channels” (Ed., R. H. Ashley, 1995) of “The Practical Approach Series” (IRL PRESS),

“Growth Factors” (Eds., I. McKay, I. Leigh, 1993),

“Extracellular Matrix” (Eds., M. A. Haralson, J. R. Hassell, 1995);

Glycoprotein-Related Protein:

“Glycobiology” (Eds., M. Fukuda, A. Kobata, 1993) of “The Practical Approach Series” (IRL PRESS),

“Glycoprotein Analysis in Biomedicine” (Ed., Elizabeth F. Hounsell, 1993) of “Method in Molecular Biology” (Humana Press) series;

Signal Transduction-Related Protein:

“Signal Transduction” (Ed., G. Milligan, 1992) of “The Practical Approach Series” (IRL PRESS),

“Protein Phosphorylation” (Ed., D. G. Hardie, 1993), or “Signal Transduction Protocols” (Eds., David A. Kendall, Stephen J. Hill, 1995) of “Method in Molecular Biology” (Humana Press) series;

Transcription-Related Protein:

“Gene Transcription” (Eds., B. D. Hames, S. J. Higgins, 1993) of “The Practical Approach Series” (IRL PRESS),

“Transcription Factors” (Ed., D. S. Latchman, 1993); Enzyme and/or metabolism-related protein:

“Enzyme Assays” (Eds., ROBERT EISENTHAL and MICHAEL J. DANSON, 1992) of “The Practical Approach Series” (IRL PRESS); Cell division and/or cell proliferation-related protein:

“Cell Growth, Differentiation and Senescence” (Ed., GEORGE STUDZINSKI, 2000) of “The Practical Approach Series” (IRL PRESS);

Cytoskeleton-Related Protein:

“Cytoskeleton: Signalling and Cell Regulation” (Eds., KERMIT L. CARRAWAY and CAROLIE A. CAROTHERS CARRAWAY, 2000) of “The Practical Approach Series” (IRL PRESS),

“Cytoskeleton Methods and Protocols” (Ed., Gavin, Ray H., 2000) of “Method in Molecular Biology” (Humana Press) series; Nuclear protein and/or RNA synthesis-related protein:

“Nuclear Receptors” (Ed., DIDIER PICARD, 1999) of “The Practical Approach Series” (IRL PRESS),

“RNA Processing” (Eds., STEPHEN J. HIGGINS and B. DAVID HAMES, 1994);

Protein Synthesis and/or Transport-Related Protein:

“Membrane Transport” (Ed., STEPHEN A. BALDWIN, 2000) of “The Practical Approach Series” (IRL PRESS),

“Protein Synthesis Methods and Protocols” (Eds., Martin, Robin, 1998) of “Method in Molecular Biology” (Humana Press) series;

Cellular Defense-Related Protein:

“DNA Repair Protocols” (Henderson, Daryl S., 1999) of “Method in Molecular Biology” (Humana Press) series,

“Chaperonin Protocols” (Eds., Schneider, Christine, 2000); Development and/or differentiation-related protein:

“Developmental Biology Protocols” (Eds., ROBERT EISENTHAL and MICHAEL J. DANSON, 1992) of “Method in Molecular Biology” (Humana Press) series;

DNA- and/or RNA-Binding Protein:

“DNA-Protein Interactions Principles and Protocols” (Eds., Kneale, G. Geoff, 1994) of “Method in Molecular Biology” (Humana Press) series,

“RNA-Protein Interaction Protocols” (Eds., Haynes, Susan R., 1999);

ATP- and/or GTP-Binding Protein:

“Signal Transduction Protocols” (Eds., David A. Kendall, Stephen J. Hill, 1995) of “Method in Molecular Biology” (Humana Press) series.

In the categorization, the clone predicted to belong to the category of secretory and/or membrane protein means a clone having hit data with some annotation, such as growth factor, cytokine, hormone, signal, transmembrane, membrane, extracellular matrix, receptor, G-protein coupled receptor, ionic channel, voltage-gated channel, calcium channel, cell adhesion, collagen, connective tissue, etc., suggesting that it was a secretory or membrane protein, or a clone in which the presence of nucleotide sequence encoding a signal sequence or transmembrane region was suggested by the results of PSORT and SOSUI analyses for deduced ORF.

The clone predicted to belong to the category of glycoprotein-related protein means a clone having hit data with some annotation, such as glycoprotein, suggesting that the clone encodes a glycoprotein-related protein.

The clone predicted to belong to the category of signal transduction-related protein means a clone having hit data with some annotation, such as serine/threonine-protein kinase, tyrosine-protein kinase, SH3 domain, SH2 domain, etc., suggesting that the clone encodes a signal transduction-related protein.

The clone predicted to belong to the category of transcription-related protein means a clone having hit data with some annotation, such as transcription regulation, zinc finger, homeobox, etc., suggesting that the clone encodes a transcription-related protein.

The clone predicted to belong to the category of disease-related protein means a clone having hit data with some annotation, such as disease mutation, syndrome, etc., suggesting that the clone encodes a disease-related protein, or a clone whose full-length nucleotide sequence has hit data for Swiss-Prot, GenBank, UniGene, or nr, where the hit data corresponds to genes or polypeptides which have been deposited in the Online Mendelian Inheritance in Man (OMIM) (http://www.ncbi.nlm.nih.gov/Omim/), which is the human gene and disease database described later.

The clone predicted to belong to the category of enzyme and/or metabolism-related protein means a clone having hit data with some annotation, such as metabolism, oxidoreductase, E. C. No. (Enzyme commission number), etc., suggesting that the clone encodes an enzyme and/or metabolism-related protein.

The clone predicted to belong to the category of cell division and/or cell proliferation-related protein means a clone having hit data with some annotation, such as cell division, cell cycle, mitosis, chromosomal protein, cell growth, apoptosis, etc., suggesting that the clone encodes a cell division and/or cell proliferation-related protein.

The clone predicted to belong to the category of cytoskeleton-related protein means a clone having hit data with some annotation, such as structural protein, cytoskeleton, actin-binding, microtubles, etc., suggesting that the clone encodes a cytoskeleton-related protein.

The clone predicted to belong to the category of nuclear protein and/or RNA synthesis-related protein means a clone having hit data with some annotation, such as nuclear protein, RNA splicing, RNA processing, RNA helicase, polyadenylation, etc., suggesting that the clone encodes a nuclear protein and/or RNA synthesis-related protein.

The clone predicted to belong to the category of protein synthesis and/or transport-related protein means a clone having hit data with some annotation, such as translation regulation, protein biosynthesis, amino-acid biosynthesis, ribosomal protein, protein transport, signal recognition particle, etc., suggesting that the clone encodes a protein synthesis and/or transport-related protein.

The clone predicted to belong to the category of cellular defense-related protein means a clone having hit data with some annotation, such as heat shock, DNA repair, DNA damage, etc., suggesting that the clone encodes a cellular defense-related protein.

The clone predicted to belong to the category of development and/or differentiation-related proteins means a clone having hit data with some annotation, such as developmental protein, etc., suggesting that the clone encodes a development and/or differentiation-related protein.

The clone predicted to belong to the category of DNA- and/or RNA-binding protein means a clone having hit data with some annotation, such as DNA-binding, RNA-binding, etc.

The clone predicted to belong to the category of ATP- and/or GTP-binding protein means a clone having hit data with some annotation, such as ATP-binding, GTP-binding, etc.

As to a protein involved in a disease, it is possible to perform a functional analysis as described above, but also possible to analyze correlation between the expression or the activity of the protein and a certain disease by using a specific antibody that is obtained by using expressed protein. Alternatively, it is possible to utilize the database OMIM, which is a database of human genes and diseases, to analyze the protein. Further, new information is constantly being deposited in the OMIM database. Therefore, it is possible for one skilled in the art to find a new relationship between a particular disease and a gene of the present invention in the most up-to-date database. The proteins involved in diseases are useful for developing a diagnostic marker or medicines for regulation of their expression and activity, or as a target of gene therapy.

Also, as for a secretory protein, membrane protein, signal transduction-related protein, glycoprotein-related protein, or transcription-related protein, etc., search of the OMIM with the following keywords resulted in the finding that the proteins are involved in many diseases (the result of the OMIM search for secrete and membrane proteins is shown below). Also, association between proteins associated to signal transduction or transcription and diseases is reported in “Transcription Factor Research-1999” (Fujii, Tamura, Morohashi, Kageyama, and Satake edit, (1999) Jikken-Igaku Zoukan, Vol. 17, No. 3), and “Gene Medicine” (1999) Vol. 3, No. 2). When cancer is used as an example, as described in “Biology of Cancer” (S. Matsubara, 1992) of Life Science series (Shokabo), many proteins are involved in cancers, which include enzyme and/or metabolism-related proteins, cytoskeleton-related proteins, cell division and/or cell proliferation-related proteins as well as secretory proteins, membrane proteins, signal transduction-related proteins, glycoprotein-related proteins, transcription-related proteins. As clearly seen by the above example, it is evident that not only disease-related proteins but also secretory proteins, membrane proteins, signal transduction-related proteins, glycoprotein-related proteins, transcription-related proteins, etc. are often involved in diseases, and thus they can be useful targets in the field of medical industry.

The result of the OMIM search for secretory and membrane proteins is shown below, in which the keywords,

(1) secretion protein,

(2) membrane protein,

(3) channel, and

(4) extracellular matrix were used.

Shown in the search result are only the accession numbers in the OMIM. Using the number, data showing the relationship between a disease and a gene or protein can be seen. The OMIM data has been renewed everyday.

1) Secretion Protein

354 entries found, searching for “secretion protein”

*604667, *104760, *176860, *151675, *139320, *107400, *604029, *118910, #200100, *176880, *603850, *147572, *604028, *179513, *125950, *139250, *246700, *600946, *600560, *602926, 185860, *605083, *603215, *602421, *157147, *179512, *600174, *109270, *604710, *138120, *179510, *600998, *179509, *170280, *179511, *600626, *603831, *601489, *154545, *179490, *603826, *122559, *603216, *102720, *147290, *164160, *603062, *112262, *602672, *605435, *605322, *131230, *601652, *603166, *601746, *601591, *179508, #160900, *104311, *600759, *147545, *167805, #104300, *167770, #219700, *168470, *601684, *602049, *601146, *605227, *602434, *602534, *114840, *603489, *604323, *107470, *600753, *600768, *118825, *600564, *604252, *173120, *134370, *192340, *308230, *600322, *605359, *600046, *300090, 106160, *600041, #262500, *605563, *150390, *158106, *182590, #103580, *104610, #173900, *134797, *143890, #145980, *306900, *308700, *176300, *227500, *137350, #154700, *138079, *600760, *107730, *142410, *147670, *124092, *590050, *152760, *600509, *605646, *201910, *227600, *152790, *300200, *300300, 300800, *138160, *107741, *120150, *601199, *120180, *120160, *176730, *133170, *122560, *107300, *137241, *120140, *101000, *193400, *217000, *272800, *600937, #201710, *600377, #174800, *106100, #274600, *173350, #177170, *147620, *214500, *131244, *202110, *120120, *601007, *191160, *147470, *603372, *600733, *252800, *190160, *138040, *158070, *162151, #125700, #130070, *113811, *603355, *171060, *136435, #184700, *603732, *190180, *164008, *186590, *120220, *604312, *152200, *138130, *605085, *605353, *600840, #166210, *188545, *207750, *173360, *601933, #194050, *153450, *138850, *253200, *307030, *157145, *600514, *600262, *264080, *147380, *600281, #204000, #227810, *232200, *188826, *232800, *161561, #166200, *188400, *153620, *182099, *218040, #265800, *172400, #177200, *176805, #211600, #214700, #176410, *152780, *600633, *601771, *301500, *605402, *601922, *307800, *147892, *147720, *312060, #520000, *147660, *106150, *602358, *107270, *601769, *147440, *604558, *131530, *600270, *601610, *603692, *603401, *600423, *601604, *603345, #125853, *602843, *142640, *603044, *605740, *134830, *602779, *130660, *139191, *137035, *600761, *601340, *600823, *107740, *130160, *600877, *605110, *600945, *130080, *600957, #130050, *605580, *118444, *601124, *124020, 122470, *120700, *603201, *137216, *601185, *138945, *218030, *600839, #240600, #262400, #162300, *162330, *188450, #265850, *263200, *162641, *300159, *601038, #191390, *201810, *601398, *602384, *131240, *602423, *139392, *142703, *602663, *232700, *602682, #602722, *602730, *600734, *188540, *182452, *601538, *603061, *146880, *603140, *603160, *142704, #252650, *182280, *125255, *603252, #131750, *182139, *182100, #259420, #261100, *603493, *601745, *182098, *603795, *123812, *600264, *147940, *180246, *180245, *118888, #604284, *168450, *118455, *604398, *604433, *601919, *118445, *600031, *604961, *605032, *605033, *171050, #171300, *131243, *109160, *605254, 274900, #171400, *600042, *151670, *184600, *605470, *605546, *176760, *602008, *102200, *605720, *600732, *605901

2) Membrane Protein

1489 entries found, searching for “membrane protein”

*130500, *605704, *305360, *153330, *173610, *109270, *170995, *170993, *104776, *602333, *309060, *605703, *120920, *605943, *602690, *159430, *600897, *133090, *601178, *602413, *602003, *604405, *605940, *603237, *109280, *600378, *602173, *107776, *602334, *602335, *125305, *601134, *309845, *605731, *154045, *603241, *603718, *600594, *603214, *185881, *603657, *600182, *603177, *605331, *601476, *605456, *601114, *605190, *600723, *603904, *136950, *300222, *602879, *185880, *605348, *300096, *602257, *177070, *310200, *603062, *603344, *600039, *602977, *300100, *128240, *600959, *600322, *227400, *186945, *600946, *602534, *602048, *182900, *601097, *600267, *602625, *136430, *602421, *601047, *107450, *143450, *603141, *184756, *164730, *159440, *154050, *600579, *312080, *604202, *603700, *600447, *256540, *604691, *158343, *600403, *602414, *137290, *176640, *176981, *600179, *600754, *604456, *604693, *605875, *604605, *188860, *300172, *602910, *604323, *219800, *601848, *603179, *600279, *602251, #222700, *603831, *605072, *605377, *601028, *604155, *108733, *104225, *601896, *601510, *173335, *107770, *601767, *600046, *603850, *600040, *603784, *603234, 188560, *605863, *121015, *605862, *605861, *186946, *604252, *603215, *142461, *604597, *603143, *605264, *603735, *176860, *605536, *176801, *180721, *603355, *104760, *131560, *310300, *602631, *304700, #309400, *603142, *143890, *605431, *600753, *115501, *176790, *600266, *601691, *168468, *601239, *602216, #104300, *605613, *601595, *605550, *125950, *605475, *602217, *602261, *603534, *602262, *604631, *190315, *601313, *604306, *104311, *604672, *605000, *602461, *605548, *602296, *604376, *121014, *121011, *600691, *604262, *139310, *304040, *605445, *179514, *179512, *151460, #160900, *120130, *128239, *601158, *601403, *176943, *601014, 300800, *300294, *601757, *185470, *273800, *605034, *602887, #185000, *604871, *603593, *603583, *605454, *104775, *605872, *141180, *602713, *603531, *139150, *601531, *601832, *605452, *134651, *604156, *120620, *605883, *604142, *166945, *605324, *600816, *604699, *300112, *605182, *600164, *182180, *605071, *300023, *605057, *308240, *300249, *176947, *176894, *605081, *605035, *602044, *182860, *107271, *305100, *153390, *113730, *602689, *180069, *603518, *300017, *191275, *177061, *601693, *601789, *604241, *600934, *138160, *604424, *603868, *600174, *600718, *600523, *604141, *601009, *605251, *600481, *600874, *155550, *605227, *601017, *162230, 601138, *604157, *601212, *600763, *604110, *604158, *601107, *601326, 600621, *600587, 601137, *600917, *600855, *605058, *194355, *605194, *603291, *102720, *136425, *170715, *603216, *605547, *135630, *602926, *600168, *605002, *602474, *600157, *603025, *603893, *231200, *120090, *601966, *131230, *604722, *604721, *604515, *246700, *602101, *605628, *303630, *605787, *602857, *602285, *605708, *602488, *605025, *603817, *300051, *603293, *176878, *603646, 605707, 185860, *112205, *300187, *602654, *120070, *603648, *604850, *602655, *602514, *300118, *182309, *179590, *602701, *600759, *204200, *604170, *175100, #103580, *147670, *306400, *143100, *182870, *257220, *180380, #116920, *301000, *193300, *157147, *131550, *139200, *139130, *190195, *605406, *155760, *155960, *605734, *155970, *605385, *111700, *155975, *150370, 605709, *151430, *605438, *151510, *116952, *157655, *158105, *605777, *176877, *153619, *120131, *185430, *109190, *120190, *109170, *605093, *605250, *153432, *107777, *186590, *160993, *605699, *605698, *605813, *605697, *605616, *605300, *162060, *605219, *163970, *135620, *165040, *605478, *604964, *103195, *604932, *604923, *605906, *605496, *605914, *166490, 138277, *604915, *114070, *605213, *605933, *180297, *101000, *191163, *191164, *605101, *603167, *600772, *603164, *600708, *604001, *191328, *313440, *602672, *604009, *604299, *192974, *604256, *603048, *600515, *604221, *602632, *604196, *601179, 603290, *604661, *601023, *601110, *304800, *203200, *300212, *602933, *603352, *208900, *604418, *604838, *600551, #212140, *604837, *602049, *600552, *600553, *300213, *602574, *600583, *600932, *603452, *604775, *516020, *604617, *604464, *603498, *300145, *601523, *602694, *600632, *604762, *604492, *400015, *604504, *601717, *601728, *300242, *602426, *604194, *603821, *604730, *600695, *603823, *603869, *300241, *600707, *603822, *602370, *602202, *604193, *601181, *604089, *602507, *604195, *602306, *300284, *601805, *601895, *601275, *604660, *600752, *603820, *604192, *602207, *308230, *600894, *312600, *603199, *604029, *602500, *102680, *235200, #256300, *601633, #219700, 262890, *156225, *173470, *193400, *173910, *600354, *113705, *600065, *107741, *107400, *600024, *131195, *113811, #118220, *601638, *300011, *276903, *604144, *311770, *601758, #173900, *604592, *120120, *179605, *603130, *603372, *110750, *222900, *602509, *256100, *602469, *602281, *229300, *224100, *110900, *190180, *261600, *602997, *603616, *603189, 601791, *601567, *312700, *171060, *308700, *604027, *162643, *516000, *176261, *604028, *314850, #145980, *601383, *600930, *305900, *601253, *136350, *605537, *138140, *604033, *605070, *139250, *300500, *603967, *300041, *603866, #130600, *120150, *601050, *604942, *605204, *605248, *272750, *600163, *604235, *600682, *107266, *306900, *191092, #262500, *600106, *152790, *186720, *227650, *153700, *308380, *103390, *605646, *164920, *604478, #252650, *173850, *173350, *602505, *246530, *194380, *602575, *603030, #209920, *212138, #214100, *605767, *600582, *189980, #176200, *604653, *604678, *256550, *300037, *253700, #253300, #226700, *604766, #244400, *190000, *188040, *604824, *214500, #237500, *232300, *605014, *604477, *190930, *605124, *604475, *604594, #227810, *306700, #301050, *600135, *600143, *605145, #269920, *300104, *277900, *300135, *300231, *192500, *182138, *191190, *176805, *600185, *186591, *604889, *603051, *165360, *147545, *601040, #156575, *107269, *603009, *602934, *123825, *601081, *602924, *163890, *600381, *602909, *150330, *109690, *123900, *603434, *603491, *110700, *602581, *125647, #154700, *114760, *141900, *603690, *120220, *601199, #145500, *601309, *602382, *120325, *600877, *604205, *604090, *601497, *602377, *605464, *138720, *603728, *120950, *604026, *600580, *601610, *137167, *603960, *603931, *601880, *603126, *138190, *130130, *601997, *601975, *600395, *516040, *600418, *600650, *605245, *605172, *600509, *164761, *310400, *600308, *605109, *600544, *600359, *600103, *605267, *312610, *176100, *308100, *158070, *605123, *173325, #312750, *600839, *158120, #604369, *604465, *173510, #161200, *151525, *605369, *604237, *516050, #600886, *604517, *165180, *605381, *605399, *307800, *604365, *155740, *147795, 601709, *604673, *147730, *602122, *147557, *193245, *600978, *604990, *603261, *603274, *601007, *131100, *602941, *107941, *146710, *276901, *131244, *602872, *603411, *186357, *176290, *601066, *185050, *232200, *143030, *601843, #236700, *604122, *142800, *134638, *604985, *182380, *603930, *142410, *137060, *604586, *601193, *120650, *252500, *253800, *120930, *604858, *605874, 601274, *602158, *605873, *193210, *203100, *601295, *604095, #201710, *126150, *108740, #205400, *601373, *300167, *109545, *602894, *603361, #300257, *266200, *603401, *131390, *180470, *605908, *604798, #221770, *223360, *180901, *605641, *605745, *604018, *300200, *604603, *230800, *602676, #604004, *605692, *602640, *601599, *134637, *245900, *118425, 601614, *605725, *120110, *300189, *300035, *603102, *250800, *602282, *602458, *123610, *603754, *300278, *601463, *300224, *601581, *182160, *601653, *139191, *601733, *600748, *142460, *601194, *152390, *153620, *601615, *601814, *601617, *601613, *300191, #308300, *600798, 601858, *601872, *601597, #601588, *600821, *147840, *152427, *138850, *600823, *601492, *300256, *600840, *300267, *601411, *139080, *139090, 600851, *300334, *179080, *602095, *601284, *601282, #177200, *601681, *601252, *176000, *602184, *602188, #266510, #154020, *186711, *257200, *601711, *600667, *602241, *186745, *255125, *300126, *600644, *123890, #255120, #175200, *600004, *302060, *123580, *186760, *122561, *602316, *600017, *120940, 140300, *151690, *120700, *602354, *600019, *600857, *182175, *600536, *158380, *600516, *120290, *600493, *182310, #252010, *182530, *186830, *601839, *142790, *159465, *118990, *250790, *248600, #248250, *186845, *601153, *142600, *116930, *114860, *171834, #303600, *186880, *600444, *142871, *601852, *602602, *602607, *114207, *186910, #232220, 600880, *134635, *112203, #112100, *111680, *231680, *311030, *111250, *111200, *134390, #226670, #145600, *226200, *602714, *171760, *133550, *602727, *161555, *602744, *602746, #131705, *602835, *600423, *176267, *602859, #600918, 277175, *602874, *601020, *109770, *600170, *217070, *173515, *602893, *147280, *154360, *171050, *108780, *176257, *600979, *600377, *108360, *204500, *170260, *146880, *154582, *601011, *600997, *602992, *201475, *603005, *190198, *147360, #270400, *600238, #164970, *306250, #126600, *193065, #181350, *106180, *602136, *600937, *603086, *603087, *307030, *182099, *103320, *601683, #192430, *103180, *102681, *192321, *600244, *191740, *191315, *603152, *102642, *191305, #266140, *100500, *600867, *604585, *604404, *604345, *603201, *605430, *603207, *603208, *605433, *604101, *603969, *605896, *604616, *605851, *605768, *604576, *605754, *605730, *605477, *603263, *605538, *603283, *604402, *605453, *605427, *603302, *605458, 603313, *604415, *603345, *605541, *603353, *605295, *603879, *605268, *605266, *605246, *603377, *603380, *605181, *604203, *603425, *603867, *605106, *605017, *603842, *604936, *603510, *604857, *605932, *605816, *603765, *603551, *605357, *605237, *604204, *603594, *605110, *604190, *603861, *604962, *603639, *603644, *605007, *605349, *604943, *604918, *604907, *603667, *603681, *605396, *605561, *603712, *603713, *605688, *605942, *604878, *604843, *604659, *604671, *603798, *604682, *604056, *604705, *603749, 602586, *603647, *602515, #602475, *603717, *602359, *602372, *602380, *602518, *603652, *602573, *603626, 602587, *603598, *602871, *603613, *603750, *603875, *602608, *602666, *602345, *602935, *603564, *603548, *603927, 601876, *602343, *603943, *603787, *601730, *601611, *602679, *603788, *602243, 603790, *601535, *603796, *601488, *601485, *602314, *601478, *604047, *604048, *602297, *604057, *602715, *602192, *601459, *601416, *603833, *602190, *604102, *602106, *604111, *602724, *603499, *602736, *601123, *601002, *600923, *601987, *604149, *601929, *600910, *600900, *600864, *604165, *600782, *602836, *600769, *600742, *602783, *601905, *600535, *604198, *601901, *600534, *602876, *603356, *600530, *604216, *604217, *602890, *602905, *600465, *600464, *600446, *602891, *603366, *601894, *604272, *603926, *603312, *600368, *602914, *600327, *603151, *603202, 602911, *602974, *603006, *601883, *603008, *600074, *603007, *603046, #603903, *604433, *600016, *603925, *516005, *516004, *516003, *601756, *604487, *516001, *313475, *313470, #307810, *604527, *604528, *601745, *604551, *604555, *603243, *603242, *603061, *603063, *603217, *300335, *300283, *300281, *604600, *300197, *603097, *603220, *601625, *604623, *603118, *601590, *604646, *300008, *601568, *300007, *275630, *601533, #275200, *270200, #261550, *604031, *604683, #254800, *251100, #242300, *604058, *604720, *240500, *233690, #232240, #226730, *223100, *222100, #220100, *216950, *604832, 212750, 212067, *604066, *193067, 601315, *193001, *604862, *604870, *191306, *600385, *604879, *191191, *601296, *604914, *190181, *604119, #188550, *604925, *188410, #601287, *604939, *188380, *604126, *604945, *604148, *188060, *604982, *186854, *604988, *186360, *186355, *185250, *600916, *605008, *605009, 185020, *600734, *605024, *182331, *605032, *605033, *182305, *180903, #179800, *179610, *605060, *179410, *178990, *176802, *605080, *176266, *176263, *176260, *600732, *173490, *604199, *173445, *173391, 172290, *605147, *605149, *171890, *600528, *171833, *605185, #170500, *605193, #168000, *605196, *167055, *605205, *605208, 166900, *605216, *162651, *162010, *600504, #161400, *604253, #160800, *159460, *154540, *605254, *605261, *153634, *600429, *153337, *600424, *605292, #604286, #152700, 152423, *152310, *151625, *600153, *604313, *151523, *150325, *150320, *150292, *603150, *150290, *150210, *605410, *605415, *605416, *605417, *605421, *603149, *604349, *147940, *600282, *147880, *146928, *146661, *600150, *146630, *142622, *600018, *605461, *138981, *138590, *600023, *138330, *605495, *138297, *605512, *138230, #136900, #301310, *516006, *605545, *605546, *136131, *134660, *134350, *516002, *605589, *131235, #130050, *605625, *126455, *126064, #125310, *605670, *604534, *125240, *123836, *123830, *123620, *605702, #122200, *120980, *120360, *118510, *114835, *605710, *605716, *605722, *114217, *604561, *113810, *111740, #110800, *605748, *605752, *604564, *110600, *603160, *109610, *605784, #107480, *107273, *603192, *300169, *106195, *105210, *104615, *104614, *104210, *103850, 103581, *605876, *605877, *605879, *103220, *605887, *300150, *102910, *102670, *102576, *605916, *604629, *102575, *102573, *300132, *101800, *605947

3) Channel (Member of Membrane Protein)

361 entries found, searching for “channel”

*176266, *600724, *182390, *123825, *114208, *114206, *176267, *114205, *601784, *600937, *114204, *603415, *600053, *114207, *114209, *605427, *604527, *604528, *600760, *601011, *192500, *118425, *600228, *176261, *602235, *600761, *600359, *300008, *182389, *600877, *602232, *176263, *182391, *601328, *600054, *603939, *602208, *601534, *600504, *602323, *603208, *601958, *603537, *601012, *601327, *600734, *602780, *602781, *604433, *603220, *182392, *605874, *605873, *601745, *603888, *603219, *602604, *603796, *302910, *602866, *601013, *602905, *602906, *603967, *600163, #170500, *152427, *180901, *176260, #601462, *603951, *601141, *604492, *600702, *602023, *600308, *602754, *107776, *176257, *602024, *601949, *605222, *601142, *602983, *193245, *600681, *176265, *600235, *176262, *176258, *605206, *604427, *605411, *603305, *601219, *600150, *604065, *602343, *605223, *605720, *603906, *138249, *138253, *600843, *604385, *600003, *600935, *603940, *602727, *602158, 602911, *600397, *602726, *600845, *605080, *600580, *602872, *602106, *176264, *603953, *605722, *300110, *138252, *604111, *602717, *602420, *600570, 600844, *603493, *600932, *605716, *138254, *603652, *300138, *605410, *176268, *605214, *605696, *300334, *604660, *176256, *605879, *603749, *603583, *602345, *604661, *603787, 603313, *602982, *604337, *600846, *604662, *300328, *300281, *602566, *602836, *604003, *603788, *603651, *602421, *107777, #177200, *100725, #219700, *100690, *100710, #160800, #603830, #183086, *600509, #220400, #601144, *173910, *180902, *605692, #264350, #160900, #145600, #255700, *602076, *603061, *601313, *154275, #604233, *604532, #108500, #121201, #170400, *300225, *121014, *139311, #125800, #160120, *118503, 601439, #141500, #168300, *304040, #601887, #256450, *186945, *154276, #300009, #216900, *600040, *601014, *601042, *602512, *601383, *605445, *602368, *603831, #117000, *601218, *108745, *605248, #177735, #173900, *601212, *182139, *601059, *600039, *601485, *180903, *186360, *603319, #600101, *118509, *600109, #121200, *600170, *604187, *176975, *137163, #310468, #263800, #262300, *603750, *600229, *124030, *602251, #603829, *137143, #145500, *600669, *147450, *154050, *603353, *600516, *601157, *600855, *601154, *602522, *249210, *600968, #252650, *171060, *600919, *156490, #259700, #601678, *601764, #310500, *131244, *300041, *121011, *125950, *114180, *602974, *600637, *113730, *118504, *605145, *604669, *118800, *121013, *121015, *138491, *600421, *104610, *604045, *604594, *131230, *605487, *138247, *600467, #602485, *602481, *138251, *137192, *602403, 600851, *277900, *603785, *603152, *603199, *603475, #168600, #272120, *170280, *603852, #241200, *603053, *600465, #603034, *142461, *164920, *137164, *600884, *600442, *123885, *604001, *600232, *232200, *171050, *602103, *602014, *300211, *600983, *602887, *604415, *604418, *300242, #300071, *604471, *600837, 168350, *118511, 193007, *600300, *604654, #601820, *180297, *600046, *603853, *604678, *604693, #604772, *118508, *603855, *605204, #254210, *182099, *182307, #130600, *601109, *114080, *300103, *182860, *605438, *601129, *603964, *600019, *516060, #185000, *138079, *104210, *605818, *603418, *305990, *305450

4) Extracellular Matrix

218 entries found, searching for “extracellular matrix”

*605912, *603479, *602201, *604633, *601418, *601548, *115437, *154870, *600754, *602261, *602285, *602262, *134797, *120361, *604629, *604871, *603321, *603320, *601807, #154700, *116935, *185261, *120360, *185250, *605470, *603767, *253700, *190180, *128239, *308700, *276901, *193300, *120324, *188826, *602109, *155760, *600514, *600261, #177170, *600536, *147557, #116920, *150240, *601313, *120140, 601614, *605158, *120150, *120180, #200610, *605127, *193400, *192240, #173900, *152200, #136900, *135821, #130070, *120320, *120220, *112260, *310200, *600900, *600262, *605670, *600985, *179590, #245150, *602574, *601463, 183850, *601211, *604241, *600758, *186745, *604710, *602369, *602090, *190182, *192975, *602178, *230740, *600065, *601652, *158106, *190181, *156790, #158810, *193210, *155120, *192977, *193065, #226700, *187380, *231050, *182120, *188060, *186355, 163200, *164010, #156550, *151510, *150370, *253800, *156225, *150325, #194050, *150290, *216550, *147620, *600215, *222600, *147559, *165380, *182888, *600491, *146650, *146640, *600564, *600596, *600616, *600700, *600742, *138297, *182889, *154705, *600930, *301870, *153619, *601050, *601090, *601105, *165070, *305370, *135820, *130660, *310300, *601492, *128240, *601587, #126600, *601636, *600119, *601692, *601728, *125485, 601858, *601915, *602048, *175100, *602108, *121010, *600245, *120470, *120328, *120325, *602264, *120280, *602366, *600309, *602402, *602415, *602428, *602453, *602505, #166210, *602600, *602941, *603005, *603196, 603209, *603221, *603234, *603319, *120250, *120210, *120120, *603489, *603551, *118938, *603799, *603842, *603924, *603963, *604042, *604063, *604149, *604160, *601028, *604467, *604510, *604592, *116930, *116806, *601284, *604724, *604806, *604807, *604808, *107269, *605007, *605008, *605009, *600214, *600076, *605174, *605175, *605292, *605343, *605351, #600204, *605497, *605546, *605587, *605623, *600211, *605702, *103320

In addition to these, the various keywords shown in the above-mentioned categorization or others can be used for the OMIM search and the result may suggest the involvement thereof in diseases.

Further, the use of nucleotide sequences of cDNAs of the present invention enables analyzing the expression frequency of genes corresponding to the cDNAs. In addition, functions of the genes can be predicted based on the information obtained by the expression frequency analysis.

There are several methods for analyzing the expression levels of genes involved in diseases. Differences in gene expression levels between diseased and normal tissues are studied by the analytical methods using, for example, Northern hybridization, RT-PCR, DNA microarray, etc. (Experimental Medicine, Vol. 17, No. 8, 980-1056 (1999); Cell Engineering (additional volume) DNA Microarray and Advanced PCR Methods, Muramatsu & Nawa (eds.), Shujunsya (2000)). By computer analysis, in addition to these analysis methods, the nucleotide sequences of expressed genes can be compared to analyze the expression frequency. For example, there is a database called “BODYMAP”; gene clones are extracted at random from cDNA libraries of various tissues and/or cells, and the clones homologous to one another are assigned to a single cluster based on the information of nucleotide sequence homology at the 3′-end; genes are classified into any clusters, and the numbers of clones in the respective clusters are compared to gain the information on expression frequency (http://bodymap.ims.u-tokyo.ac.jp/).

When explicit difference in the expression levels between diseased tissues and normal tissues is observed for a gene by these analytical methods, it can be conclude that the gene is closely involved in a disease or disorder. Instead of diseased tissues, when gene expression is explicitly different between normal cells and cells reproducing disease-associated specific features, it can be concluded that the gene is closely involved in a disease or disorder.

From the 1639 clones whose full-length nucleotide sequences had been revealed, genes involved in particular pathology or functions were selected by the use of databases shown below (see Example 7; “Expression frequency analysis in silico”). The database used in the analyses of the present invention contains nucleotide sequences of 770,546 clones, and the population of the database is large enough for the analysis. The sequence information in the database was obtained by selecting cDNA clones at random from cDNA libraries derived from the various tissues and cells shown in Example 1 and determining the 5′-end sequences thereof.

Then, the nucleotide sequences of respective clones in this database were categorized (clustered) based on the nucleotide sequence homology determined with a search program; the number of clones belonging to every cluster of each library was determined and normalized; thus, the ratio of a certain gene in a cDNA library was determined. This analysis provided the information of the expression frequency of a gene in a tissue or cell that is the source of the cDNA library.

Then, in order to analyze the expression of genes corresponding to the nucleotide sequences of cDNAs of the present invention in tissues and cells, the libraries from the tissues or cells, which had been used in the large-scale cDNA analyses, were taken as subjects to compare the expression levels between different tissues or cells. Namely, the expression frequency was analyzed by comparing the previously normalized values between tissues or cells from which 600 or more cDNA clones whose nucleotide sequences had been analyzed were derived. The result of this analysis showed that the cDNA clones corresponded to the genes involved in the pathology and functions, which are indicated below. Each value in Tables 3 to 39 indicated below represents a relative expression frequency; the higher the value, the higher the expression level.

Osteoporosis-Related Genes

Osteoporosis is a pathology in which bones are easily broken owing to overall decrease in components of bone. The onset correlates to the balance between the functions of osteoblast producing bone and osteoclast absorbing bone, namely bone metabolism. Thus, the genes involved in the increase of osteoclasts differentiating from precursor cells of monocyte/macrophage line (Molecular Medicine 38. 642-648. (2001)) are genes involved in bone metabolism involved in osteoporosis.

A nucleotide sequence information-based analysis was carried out to identify the genes whose expression frequencies are higher or lower in CD34+ cell (cell expressing a glycoprotein CD34) treated with the osteoclast differentiation factor (Molecular Medicine 38. 642-648. (2001)) than in the untreated CD34+ cell, which is the precursor cell of monocyte/macrophage line. The result of comparative analysis for the frequency between the cDNA libraries prepared from the RNA of CD34+ cells (CD34C) and from the RNA of CD34+ cells treated with the osteoclast differentiation factor (D30ST, D60ST or D90ST) showed that the genes whose expression levels were different between the two were 41 clones indicated in Table 3. These clones are involved in osteoporosis.

Genes Involved in Neural Cell Differentiation

Genes involved in neural cell differentiation are useful for treating neurological diseases. Genes with varying expression levels in response to induction of cellular differentiation in neural cells are thought to be involved in neurological diseases.

A survey was performed for genes whose expression levels are varied in response to induction of differentiation (stimulation by retinoic acid (RA) or growth inhibitor treatment after RA stimulation) in cultured cells of a neural strain, NT2. The result of comparative analysis of cDNA libraries derived from undifferentiated NT2 cells (NT2RM) and the cells subjected to the differentiation treatment (NT2RP, NT2RI or NT2NE) showed that the genes whose expression levels were different between the two were 500 clones indicated in Table 4. These genes are neurological disease-related genes.

Cancer-Related Genes

It has been assumed that, distinct from normal tissues, cancer tissues express a distinct set of genes, and thus the expression thereof can contribute to the carcinogenesis in tissues and cells. Thus, genes whose expression patterns in cancer tissues are different from those in normal tissues are cancer-related genes. Search was carried out for the genes whose expression levels in cancer tissues were different from those in normal tissues.

The result of comparative analysis of cDNA libraries derived from breast tumor (TBAES) and normal breast (BEAST) showed that the genes whose expression levels were different between the two were 11 clones indicated in Table 5.

The result of comparative analysis of cDNA libraries derived cervical tumor (TCERX) and normal cervical duct (CERVX) showed that the genes whose expression levels were different between the two were 10 clones indicated in Table 6.

The result of comparative analysis of cDNA libraries derived from colon tumor (TCOLN) and normal colon (COLON) showed that the genes whose expression levels were different between the two were 5 clones indicated in Table 7.

The result of comparative analysis of cDNA libraries derived from esophageal tumor (TESOP) and normal esophagus (NESOP) showed that the genes whose expression levels were different between the two were 5 clones indicated in Table 8.

The result of comparative analysis of cDNA libraries derived from kidney tumor (TKIDN) and normal kidney (KIDNE) showed that the genes whose expression levels were different between the two were 205 clones indicated in Table 9.

The result of comparative analysis of cDNA libraries derived from liver tumor (TLIVE) and normal liver (LIVER) showed that the genes whose expression levels were different between the two were 35 clones indicated in Table 10.

The result of comparative analysis of cDNA libraries derived from lung tumor (TLUNG) and normal lung (HLUNG) showed that the genes whose expression levels were different between the two were 62 clones indicated in Table 11.

The result of comparative analysis of cDNA libraries derived from ovary tumor (TOVER) and normal ovary (NOVER) showed the genes whose expression levels were different between the two were 7 clones indicated in Table 12.

The result of comparative analysis of cDNA libraries derived from stomach tumor (TSTOM) and normal stomach (STOMA) showed that the genes whose expression levels were different between the two were 41 clones indicated in Table 13.

The result of comparative analysis of cDNA libraries derived from uterine tumor (TUTER) and normal uterus (UTERU) showed that the genes whose expression levels were different between the two were 94 clones indicated in Table 14.

The result of comparative analysis of cDNA libraries derived from tongue cancer (CTONG) and normal tongue (NTONG) showed that the genes whose expression levels were different between the two were 178 clones indicated in Table 15.

These genes are involved in cancers.

Further, there is a method to search for genes involved in development and differentiation, which is the expression frequency analysis in which the expression levels of genes are compared between developing and/or differentiating tissues and/or cells and adult tissues and/or cells. The genes involved in tissue development and/or differentiation are genes participating in tissue construction and expression of function, and thus are useful genes, which are available for regenerative medicine aiming at convenient regeneration of injured tissues.

By using the information of gene expression frequency gained from the database of 5′-end nucleotide sequences described above, genes involved in development or differentiation of particular tissues were selected from the 1639 clones whose full-length nucleotide sequence had been revealed (see Example 7).

The result of comparative analysis of cDNA libraries derived from fetal brain (FCBBF, FEBRA or OCBBF) and adult brain (BRACE, BRALZ, BRAMY, BRAWH, BRCAN, BRCOC, BRHIP, BRSSN, BRSTN or BRTHA) showed that the genes whose expression levels were different between the two were 745 clones indicated in Tables 16 to 36.

The result of comparative analysis of cDNA libraries derived from fetal heart (FEHRT) and adult heart (HEART) showed that the genes whose expression levels were different between the two were 54 clones indicated in Table 37.

The result of comparative analysis of cDNA libraries derived from fetal kidney (FEKID) and adult kidney (KIDNE) showed that the genes whose expression levels were different between the two were 145 clones indicated in Table 38.

The result of comparative analysis of cDNA libraries derived from fetal lung (FELNG) and adult lung (HLUNG) showed that the genes whose expression levels were different between the two were 63 clones indicated in Table 39. These genes are involved in regeneration of tissues and/or cells.

The expression frequency or the like can be analyzed by PCR based on the nucleotide sequences of cDNAs of the present invention. There are some known methods for comparing the quantities of amplification products obtained by PCR. For example, the band intensities can be determined by ethidium bromide staining. With RI-labeled or fluorescently labeled primers, the RI signal or fluorescence intensity can be assayed for the quantity of labeled amplification products. Alternatively, the quantity of amplification products can also be determined by measuring the RI signal or the fluorescence intensity from the RI-labeled or fluorescently labeled probe hybridizing to the products. The assay results thus obtained are compared and then the clones exhibiting differences in the expression levels can be selected.

There are some quantitative PCR methods: a PCR method using internal standards; a competitive PCR, in which the quantification is achieved by adding, to a sample, a dilution series of a known quantity of a template RNA and by comparing the quantity of an amplification product derived from the RNA of interest with the quantity of an amplification product derived from the template RNA. These methods overcome the problems of errors in the amount of amplification products among tubes and of the plateau effect. ATAC-PCR (Adaptor-tagged competitive PCR) is a method of competitive PCR which is practiced by using multiple adapters of different sizes attached to a gene whose 3′-end nucleotide sequence has previously been determined. The ratio of expression frequency of a single mRNA species from a number of tissues (cells) can be assayed in a single step (Nucleic Acids Research 1997, 25(22): 4694-4696; “DNA Micro-array and Advanced PCR Techniques”, Cell Technology, supplement, Eds., Muramatsu and Nawa (Shujunsha, 2000): 104-112).

If it is observed, by using these analytical methods, that the expression levels of genes are evidently varied during major cellular events (such as differentiation and apoptosis), the genes are involved in the cellular events and accordingly are candidates for disease- and/or disorder-related genes. Further, genes exhibiting tissue-specific expression are genes playing important parts in the tissue functions and, therefore, can be candidates for genes involved in diseases and/or disorders affecting the tissues.

For example, inflammation is an important biological response that is known to be involved in various diseases. The representative inflammation-inducing factors include TNF-α (Tumor Necrosis Factor-alpha), LPS (Lipopolysaccharides), etc. Many genes have been identified as genes located downstream of the TNF-α or LPS stimulation. The respective stimulations are transduced through independent pathways of signaling cascade. There exists another signaling cascade for both stimulations, wherein NF-κB is a common transducing molecule shared by the two stimulations (Cell 1995, 80:529-532). It has also been revealed that many inflammation-related genes, including IL-2, IL-6 and G-CSF, are varied in the expression levels thereof in response to the signal through the common pathway (Trends Genet. 1999, 15(6): 229-235). It is assumed that genes whose expression levels are varied in response to the stimulation of TNF-α or LPS also participate in inflammation.

Further, the infection of Helicobacter pylori to the gastric epithelia is known to cause gastritis and gastroduodenal ulcer (Mebio 2000, Jul., 17(7): 16-33). Thus, the genes whose expression levels are altered depending on co-culturing cells with Helicobacter pylori may be involved in gastritis and gastroduodenal ulcer. A recent study has suggested that Helicobacter pylori strongly activates the NF-κB pathway, via the TRAF2/6-IKKβ pathway, namely, via the same pathway shared by TNF-α (Gastroenterology 2000, 119: 97-108).

THP-1 cell, which is a human monocyte cell line, was cultured in the presence of TNF-α (Tumor Necrosis Factor-alpha) or LPS (Lipopolysaccharides). The genes whose expression levels were altered owing to the presence of the agent were searched for, and the result showed that the clones whose expression levels were increased owing to the presence of TNF-α were ADRGL10000180, BRACE20030780, BRACE20077640, BRACE20083850, BRAWH20004430, FCBBF10006180, FEBRA20003780, FEBRA20006800, FEBRA20012940, FEBRA20015840, HEART20004480, HLUNG10000370, HLUNG20001160, HSYRA20013320, IMR3220008380, KIDNE10001520, KIDNE20040540, KIDNE20061490, KIDNE20062990, NT2NE10001630, NT2NE20003920, NT2NE20005500, NT2RI20014500, NT2RI20016570, NT2RI20078270, NT2RI20083360, NTONG10002570, PUAEN10003220, SKNMC10000290, STOMA20002570, TESTI20011340, UTERU20004850.

On the other hand, the clones whose expression levels were decreased owing to the presence of TNF-α were BRACE20013400, BRACE20091880, HEART20005060, HLUNG20001760, IMR3220008590, NT2NE10001850, NT2RI20018660, NT2RI20053350, NT2RI20070480, PLACE60047380, STOMA20002890, SYNOV20001770, TRACH20001960.

Further, the clones whose expression levels were increased owing to the presence of LPS were FCBBF10006180, FEBRA20015840, HLUNG10000370, HLUNG20001160, HSYRA20013320, KIDNE20040540, KIDNE20061490, NT2NE10001630, NT2NE20003920, NT2NE20005500, NT2RI20014500, NT2RI20016570, NT2RI20078270, NTONG10002570, PUAEN10003220, STOMA20002570, TESTI20011340. On the other hand, the clones whose expression levels were decreased owing to the presence of LPS were BRACE20013400, BRACE20091880, HEART20005060, HLUNG20001760, NT2RI20070480, UMVEN20001330.

These clones are involved in inflammation.

MKN45, which is a gastric cancer cell line, was co-cultured with Helicobacter pylori. The genes whose expression levels were altered owing to the presence of Helicobacter pylori were searched for, and the result showed that the clones whose expression levels were increased owing to the presence of Helicobacter pylori were BRACE10001590, BRACE20079530, BRAWH10001620, FEBRA20006800, KIDNE20003490, KIDNE20040540, KIDNE20050420, NT2NE10001850, STOMA20002890, SYNOV20001770, TESTI10000550, UTERU20004850. On the other hand, the clones whose expression levels were decreased owing to the presence of Helicobacter pylori were BRACE20034490, BRACE20077640, BRACE20083850, KIDNE20005170, LIVER20000330, NT2RP60000390, NTONG10000980, UMVEN20001330.

These clones are involved in gastritis or gastroduodenal ulcer.

For example, if the polypeptide encoded by the cDNA of the present invention is a regulatory factor of cellular conditions such as growth and differentiation, it can be used for developing medicines as follows. The polypeptide or antibody provided by the invention is injected into a certain kind of cells by microinjection. Then, using the cells, it is possible to screen low molecular weight compounds, etc. by measuring the change in the cellular conditions, or the activation or inhibition of a particular gene. The screening can be performed as follows.

First, the polypeptide is expressed and purified as recombinant. The purified polypeptide is microinjected into cells such as various cell lines, or primary culture cells, and the cellular change such as growth and differentiation can be examined. Alternatively, the induction of genes whose expression is known to be involved in a particular change of cellular conditions may be detected by the amount of mRNA or polypeptide. Alternatively, the amount of intracellular molecules (low molecular weight compounds, etc.) that is changed by the function of the gene product (polypeptide) which is known to be involved in a particular change of cellular conditions may be detected. The compounds to be screened (both low and high molecular compounds are acceptable) can be added to the culture media and assessed for their activity by measuring the change of the cellular conditions.

Instead of microinjection, cell lines introduced with the gene obtained in the invention can be used for the screening. If the gene product is turn out to be involved in a particular change in the cellular conditions, the change of the product can be used as a measurement for screening. Once a compound is screened out which can activate or inhibit the function of the polypeptide of the invention, it can be applied for developing medicines.

If the polypeptide encoded by the cDNA of the present invention is a secretory protein, membrane protein, or protein involved in signal transduction, glycoprotein, transcription, or diseases, it can be used in functional assays for developing medicines.

In case of a membrane protein, it is most likely to be a polypeptide that functions as a receptor or ligand on the cell surface. Therefore, it is possible to reveal a new relationship between a ligand and receptor by screening the membrane protein of the invention based on the binding activity with the known ligand or receptor. Screening can be performed according to the known methods.

For example, a ligand against the polypeptide of the invention can be screened in the following manner. Namely, a ligand that binds to a specific polypeptide can be screened by a method comprising the steps of: (a) contacting a test sample with the polypeptide of the invention or a partial peptide thereof, or cells expressing these, and (b) selecting a test sample that binds to said polypeptide, said partial peptide, or said cells.

On the other hand, for example, screening using cells expressing the polypeptide of the present invention that is a receptor protein can also be performed as follows. It is possible to screen receptors that is capable of binding to a specific polypeptide by using procedures (a) attaching the sample cells to the polypeptide of the invention or its partial peptide, and (b) selecting cells that can bind to the said polypeptide or its partial peptide.

In a following screening as an example, first the polypeptide of the invention is expressed, and the recombinant polypeptide is purified. Next, the purified polypeptide is labeled, binding assay is performed using a various cell lines or primary cultured cells, and cells that are expressing a receptor are selected (Growth and differentiation factors and their receptors, Shin-Seikagaku Jikken Kouza Vol. 7 (1991) Honjyo, Arai, Taniguchi, and Muramatsu edit, p 203-236, Tokyo-Kagaku-Doujin). A polypeptide of the invention can be labeled with RI such as 125I, and enzyme (alkaline phosphatase etc.).

Alternatively, a polypeptide of the invention may be used without labeling and then detected by using a labeled antibody against the polypeptide. The cells that are selected by the above screening methods, which express a receptor of the polypeptide of the invention, can be used for the further screening of an agonists or antagonists of the said receptor.

Once the ligand binding to the polypeptide of the invention, the receptor of the polypeptide of the invention or the cells expressing the receptor are obtained by screening, it is possible to screen a compound that binds to the ligand and receptor. Also it is possible to screen a compound that can inhibit both bindings (agonists or antagonists of the receptor, for example) by utilizing the binding activities.

When the polypeptide of the invention is a receptor, the screening method comprises the steps of (a) contacting the polypeptide of the invention or cells expressing the polypeptide of the invention with the ligand, in the presence of a test sample, (b) detecting the binding activity between said polypeptide or cells expressing said polypeptide and the ligand, and (c) selecting a compound that reduces said binding activity when compared to the activity in the absence of the test sample. Furthermore, when the polypeptide of the invention is a ligand, the screening method comprises the steps of (a) contacting the polypeptide of the invention with its receptor or cells expressing the receptor in the presence of samples, (b) detecting the binding activity between the polypeptide and its receptor or the cells expressing the receptor, and (c) selecting a compound that can potentially reduce the binding activity compared to the activity in the absence of the sample.

Samples to screen include cell extracts, expressed products from a gene library, synthesized low molecular compound, synthesized peptide, and natural compounds, for example, but are not construed to be listed here. A compound that is isolated by the above screening using a binding activity of the polypeptide of the invention can also be used as a sample.

A compound isolated by the screening may be a candidate to be an agonist or an antagonist of the receptor of the polypeptide. By utilizing an assay that monitors a change in the intracellular signaling such as phosphorylation which results from reduction of the binding between the polypeptide and its receptor, it is possible to identify whether the obtained compound is an agonist or antagonist of the receptor. Also, the compound may be a candidate of a molecule that can inhibit the interaction between the polypeptide and its associated proteins (including a receptor) in vivo. Such compounds can be used for developing drugs for precaution or cures of a disease in which the polypeptide is involved.

Secretory proteins may regulate cellular conditions such as growth and differentiation. It is possible to find out a novel factor that regulates cellular conditions by adding the secretory protein of the invention to a certain kind of cell, and performing a screening by utilizing the cellular changes in growth or differentiation, or activation of a particular gene.

The screening can be performed, for example, as follows. First, the polypeptide of the invention is expressed and purified in a recombinant form. Then, the purified polypeptide is added to a various kind of cell lines or primary cultured cells, and the change in the cell growth and differentiation is monitored. The induction of a particular gene that is known to be involved in a certain cellular change is detected by the amounts of mRNA and polypeptide. Alternatively, the amount of an intracellular molecule (low-molecular-weight compounds, etc.) that is changed by the function of a gene product (polypeptide) that is known to function in a certain cellular change is used for the detection.

Once the screening reveals that the polypeptide of the invention can regulate cellular conditions or the functions, it is possible to apply the polypeptide as a pharmaceutical and diagnostic medicine for related diseases by itself or by altering a part of it into an appropriate composition.

As is above described for membrane proteins, the secretory protein provided by the invention may be used to explore a novel ligand-receptor interaction using a screening based on the binding activity to a known ligand or receptor. A similar method can be used to identify an agonist or antagonist. The resulting compounds obtained by the methods can be a candidate of a compound that can inhibit the interaction between the polypeptide of the invention and an interacting molecule (including a receptor). The compounds may be able to use as a preventive, therapeutic, and diagnostic medicine for the diseases, in which the polypeptide may play a certain role.

Proteins involved in signal transduction or transcription may be a factor that affects a certain polypeptide or gene in response to intracellular/extracellular stimuli. It is possible to find out a novel factor that can affect a polypeptide or gene by expressing the polypeptide provided by the invention in a certain types of cells, and performing a screening utilizing the activation of a certain intracellular polypeptide or gene.

The screening may be performed as follows. First, a transformed cell line expressing the polypeptide is obtained. Then, the transformed cell line and the untransformed original cell line are compared for the changes in the expression of a certain gene by detecting the amount of its mRNA or polypeptide. Alternatively, the amount of an intracellular molecule (low molecular weight compounds, etc.) that is changed by the function of a certain gene product (polypeptide) may be used for the detection. Furthermore, the change of the expression of a certain gene can be detected by introducing a fusion gene that comprises a regulatory region of the gene and a marker gene (luciferase, β-galactosidase, etc.) into a cell, expressing the polypeptide provided by the invention into the cell, and estimating the activity of a marker gene product (polypeptide).

If the polypeptide or gene of the invention is involved in diseases, it is possible to screen a gene or compound that can regulate its expression and/or activity either directly or indirectly by utilizing the polypeptide of the present invention.

For example, the polypeptide of the invention is expressed and purified as a recombinant polypeptide. Then, the polypeptide or gene that interacts with the polypeptide of the invention is purified, and screened based on the binding. Alternatively, the screening can be performed by adding with a compound of a candidate of the inhibitor added in advance and monitoring the change of binding activity. In another method, a transcription regulatory region locating in the 5′-upstream of the gene encoding the polypeptide of the invention that is capable of regulating the expression of other genes is obtained, and fused with a marker gene. The fusion is introduced into a cell, and the cell is added with compounds to explore a regulatory factor of the expression of the said gene.

The compound obtained by the screening can be used for developing pharmaceutical and diagnostic medicines for the diseases in which the polypeptide of the present invention is involved. Similarly, if the regulatory factor obtained in the screening is turn out to be a polypeptide, compounds that can newly affect the expression or activity of the polypeptide may be used as a medicine for the diseases in which the polypeptide of the invention is involved.

If the polypeptide of the invention has an enzymatic activity, regardless as to whether it is a secretory protein, membrane protein, or proteins involved in signal transduction, glycoprotein, transcription, or diseases, a screening may be performed by adding a compound to the polypeptide of the invention and monitoring the change of the compound. The enzymatic activity may also be utilized to screen a compound that can inhibit the activity of the polypeptide.

In a screening given as an example, the polypeptide of the invention is expressed and the recombinant polypeptide is purified. Then, compounds are contacted with the purified polypeptide, and the amount of the compound and the reaction products is examined. Alternatively, compounds that are candidates of an inhibitor are pretreated, then a compound (substrate) that can react with the purified polypeptide is added, and the amount of the substrate and the reaction products is examined.

The compounds obtained in the screening may be used as a medicine for diseases in which the polypeptide of the invention is involved. Also they can be applied for tests that examine whether the polypeptide of the invention functions normally in vivo.

Whether the secretory protein, membrane protein, signal transduction-related protein, glycoprotein-related protein, or transcription-related protein of the present invention is a novel protein involved in diseases or not is determined in another method than described above, by obtaining a specific antibody against the polypeptide of the invention, and examining the relationship between the expression or activity of the polypeptide and a certain disease. In an alternative way, it may be analyzed referred to the methods in “Molecular Diagnosis of Genetic Diseases” (Elles R. edit, (1996) in the series of “Method in Molecular Biology” (Humana Press).

Proteins involved in diseases are targets of screening as mentioned, and thus are very useful in developing drugs which regulate their expression and activity. Also, the proteins are useful in the medicinal industry as a diagnostic marker of the related disease or a target of gene therapy.

Compounds isolated as mentioned above can be administered patients as it is, or after formulated into a pharmaceutical composition according to the known methods. For example, a pharmaceutically acceptable carrier or vehicle, specifically sterilized water, saline, plant oil, emulsifier, or suspending agent can be mixed with the compounds appropriately. The pharmaceutical compositions can be administered to patients by a method known to those skilled in the art, such as intraarterial, intravenous, or subcutaneous injections. The dosage may vary depending on the weight or age of a patient, or the method of administration, but those skilled in the art can choose an appropriate dosage properly. If the compound is encoded by polynucleotide, the polynucleotide can be cloned into a vector for gene therapy, and used for gene therapy. The dosage of the polynucleotide and the method of its administration may vary depending on the weight or age of a patient, or the symptoms, but those skilled in the art can choose properly.

The present invention further relates to databases comprising at least a sequence of polynucleotide and/or polypeptide, or a medium recorded in such databases, selected from the sequence data of the nucleotide and/or the amino acids indicated in Table 1. The term “database” means a set of accumulated information as machine-searchable and readable information of nucleotide sequence. The databases of the present invention comprise at least one of the novel nucleotide sequences of polynucleotides provided by the present invention. The databases of the present invention can consist of only the sequence data of the novel polynucleotides provided by the present invention or can comprise other information on nucleotide sequences of known full-length cDNAs or ESTs. The databases of the present invention can be comprised of not only the information on the nucleotide sequences but also the information on the gene functions revealed by the present invention. Additional information such as names of DNA clones carrying the full-length cDNAs can be recorded or linked together with the sequence data in the databases.

The database of the present invention is useful for gaining complete gene sequence information from partial sequence information of a gene of interest. The database of the present invention comprises nucleotide sequence information of full-length cDNAs. Consequently, by comparing the information in this database with the nucleotide sequence of a partial gene fragment yielded by differential display method or subtraction method, the information on the full-length nucleotide sequence of interest can be gained from the sequence of the partial fragment as a starting clue.

The sequence information of the full-length cDNAs constituting the database of the present invention contains not only the information on the complete sequences but also extra information on expression frequency of the genes as well as homology of the genes to known genes and known polypeptides. Thus the extra information facilitates rapid functional analyses of partial gene fragments. Further, the information on human genes is accumulated in the database of the present invention, and therefore, the database is useful for isolating a human homologue of a gene originating from other species. The human homologue can be isolated based on the nucleotide sequence of the gene from the original species.

At present, information on a wide variety of gene fragments can be obtained by differential display method and subtraction method. In general, these gene fragments are utilized as tools for isolating the full-length sequences thereof. When the gene fragment corresponds to an already-known gene, the full-length sequence is easily obtained by comparing the partial sequence with the information in known databases. However, when there exists no information corresponding to the partial sequence of interest in the known databases, cDNA cloning should be carried out for the full-length cDNA. It is often difficult to obtain the full-length nucleotide sequence using the partial sequence information as an initial clue. If the full-length of the gene is not available, the amino acid sequence of the polypeptide encoded by the gene remains unidentified. Thus the database of the present invention can contribute to the identification of full-length cDNAs corresponding to gene fragments, which cannot be revealed by using databases of known genes.

The present invention has provided 1639 polynucleotides. As has not yet proceeded the isolation of full-length cDNA within the human, the invention has great significance. It is known that secretory proteins, membrane proteins, signal transduction-related proteins, glycoprotein-related proteins, transcription-related proteins, and so on are involved in many diseases. The genes and proteins involved in diseases are useful for developing a diagnostic marker or medicines for regulation of their expression and activity, or as a target of gene therapy.

In particular, cDNA assumed to encode secretory proteins, which were provided by this invention, are very important for the industry since the encoded proteins themselves are expected to be useful as pharmaceutical agents and many disease-related genes may be included in them. In addition, membrane proteins, signal transduction-related proteins, transcription-related proteins, disease-related proteins, and genes encoding them can be used as indicators for diseases, etc. These cDNA are also very important for the industry, which are expected to regulate the activity or expression of the encoded protein to treat diseases, etc.

Any patents, patent applications, and publications cited herein are incorporated by reference.

The invention is illustrated more specifically with reference to the following examples, but is not to be construed as being limited thereto.

EXAMPLE 1 Preparation of cDNA Library by Oligo-Capping

(1) Extraction and Purchase of mRNA

Total RNAs as mRNA sources were extracted from human tissues (shown below) by the method as described in the reference (J. Sambrook, E. F. Fritsch & T. Maniatis, Molecular Cloning Second edition, Cold Spring harbor Laboratory Press, 1989). Further, by the method as described in the reference (J. Sambrook, E. F. Fritsch & T. Maniatis, Molecular Cloning Second edition, Cold Spring harbor Laboratory Press, 1989), total RNAs as mRNA sources were extracted from human culture cells and human primary culture cells (shown below) which had been cultivated by the methods described in the catalogs.

The library names and the origins are indicated below in the order of “Library name: Origin”. When a library was prepared by the subtraction method, the item is followed by a description of how to prepare the subtracted library.

<Extraction of mRNA from Human Tissues>

NTONG: Normal tongue;

CTONG: Tongue cancer;

FCBBF: Fetal brain;

OCBBF: Fetal brain;

PLACE: Placenta;

SYNOV: Synovial membrane tissue (from rheumatioid arthritis).

<Extraction of mRNA from Culture Cells>

BNGH4: H4 cells (ATCC #HTB-148);

IMR32: IMR32 cells (ATCC #CCL-127);

SKNMC: SK-N-MC cells (ATCC #HTB-10);

3NB69: NB69 cells (RCB #RCB0480);

BGGI1: GI1 cells (RCB #RCB0763);

NB9N4: NB9 cells (RCB #RCB0477);

SKNSH: SK-N-SH cells (RCB #RCB0426);

NT2RM: NT2 cells (STARATAGENE #204101);

NT2RP: NT2 cells treated with retinoic acid (RA) for 5 weeks to induce the differentiation;

NT2RI: NT2 cells treated with RA for 5 weeks to induce the differentiation, followed by the treatment with the growth inhibitor for 2 weeks;

NT2NE: NT2 cells were treated with RA and the growth inhibitor for the neuronal differentiation, and the resultant neurons were concentrated and harvested (NT2 Neuron);

NTISM: NT2 cells (STARATAGENE #204101) were treated with RA for weeks to induce the differentiation, and then treated with the growth inhibitor for 2 weeks; mRNA was prepared from the cells and a cDNA library was constructed from the mRNA; the cDNAs of the library whose nucleotide sequences were shared by those of mRNAs from undifferentiated NT2 cells were subtracted by using a Subtract Kit (Invitrogen #K4320-01); the subtracted library (NT2RI-NT2RM) was provided by this procedure.

RCB indicates that the cell was provided by the Cell Bank, RIKEN GENE BANK, The Institute of Physical and Chemical Research; ATCC indicates that the cell was provided by American Type Culture Collection.

<Extraction of mRNA from Primary Culture Cells>

ASTRO: Normal human astrocyte NHA5732, Takara Shuzo #CC2565;

DFNES: Normal human dermal fibroblast (neonatal skin); NHDF-Neo NHDF2564, Takara Shuzo #CC2509;

MESAN: Normal human mesangial cell NHMC56046-2, Takara Shuzo #CC2559;

NHNPC: Normal human neural progenitor cell NHNP5958, Takara Shuzo #CC2599;

PEBLM: Normal human peripheral blood mononuclear cell HPBMC5939, Takara Shuzo #CC2702;

HSYRA: Human synoviocyte HS-RA (from rheumatioid arthritis), Toyobo #T404K-05;

PUAEN: Normal human pulmonary artery endothelial cells, Toyobo #T302K-05;

UMVEN: Normal human umbilical vein endothelial cell HUVEC, Toyobo #T200K-05;

HCASM: Normal human coronary artery smooth muscle cell HCASMC, Toyobo #T305K-05;

HCHON: Normal human chondrocyte HC, Toyobo #T402K-05;

HHDPC: Normal human dermal papilla cell HDPC, Toyobo #THPCK-001;

CD34C: CD34+ cells (AllCells, LLC #CB14435M);

D3OST: CD34+ cells treated with the osteoclast differentiation factor (ODF) for 3 days to induce the differentiation;

D6OST: CD34+ cells treated with ODF for 6 days to induce the differentiation;

D9OST: CD34+ cells treated with ODF for 9 days to induce the differentiation.

Then, total RNAs extracted from the following human tissues were purchased and used as mRNA sources. The library names and the origins are indicated below in the order of “Library name: Origin”. When a library was prepared by the subtraction method, the item is followed by a description of how to prepare the subtracted library.

<Purchase of Total RNA Containing mRNA Extracted from Human Tissues>

ADRGL: Adrenal gland, CLONTECH #64016-1;

BRACE: Brain (cerebellum), CLONTECH #64035-1;

BRAWH: Whole brain, CLONTECH #64020-1;

FEBRA: Fetal brain, CLONTECH #64019-1;

FELIV: Fetal liver, CLONTECH #64018-1;

HEART: Heart, CLONTECH #64025-1;

HLUNG: Lung, CLONTECH #64023-1;

KIDNE: Kidney, CLONTECH #64030-1;

LIVER: Liver, CLONTECH #64022-1;

MAMGL: Mammary Gland, CLONTECH #64037-1;

PANCR: Pancreas, CLONTECH #64031-1;

PROST: Prostate, CLONTECH #64038-1;

SALGL: Salivary Gland, CLONTECH #64026-1;

SKMUS: Skeletal Muscle, CLONTECH #64033-1;

SMINT: Small Intestine, CLONTECH #64039-1;

SPLEN: Spleen, CLONTECH #64034-1;

STOMA: Stomach, CLONTECH #64090-1;

TBAES: Breast (Tumor), CLONTECH #64015-1;

TCERX: Cervix (Tumor), CLONTECH #64010-1;

TCOLN: Colon (Tumor), CLONTECH #64014-1;

TESTI: Testis, CLONTECH #64027-1;

THYMU: Thymus, CLONTECH #64028-1;

TLUNG: Lung (Tumor), CLONTECH #64013-1;

TOVAR: Ovary (Tumor), CLONTECH #64011-1;

TRACH: Trachea, CLONTECH #64091-1;

TUTER: Uterus (Tumor), CLONTECH #64008-1;

UTERU: Uterus, CLONTECH #64029-1;

ADIPS: Adipose, Invitrogen #D6005-01;

BLADE: Bladder, Invitrogen #D6020-01;

BRALZ: Cerebral cortex from an Alzheimer patient (Brain, cortex, Alzheimer), Invitrogen #D6830-01;

CERVX: Cervix, Invitrogen #D6047-01;

COLON: Colon, Invitrogen #D6050-0;

NESOP: Esophagus, Invitrogen #D6060-01;

PERIC: Pericardium, Invitrogen #D6105-01;

RECTM: Rectum, Invitrogen #D6110-01;

TESOP: Esophageal (Tumor), Invitrogen #D6860-01;

TKIDN: Kidney (Tumor), Invitrogen #D6870-01;

TLIVE: Liver (Tumor), Invitrogen #D6880-01;

TSTOM: Stomach (Tumor), Invitrogen #D6920-01;

BEAST: Adult breast, STARATAGENE #735044;

FEHRT: Fetal heart, STARATAGENE #738012;

FEKID: Fetal kidney, STARATAGENE #738014;

FELNG: Fetal lung, STARATAGENE #738020;

NOVAR: Adult ovary, STARATAGENE #735260;

BRASW: subtracted library (BRALZ-BRAWH).

A cDNA library was constructed from mRNA prepared from tissues of cerebral cortex obtained from an Alzheimer patient [BRALZ: Cerebral cortex from an Alzheimer patient (Brain, cortex, Alzheimer), Invitrogen #D6830-01]; the cDNAs of this library whose nucleotide sequences were shared by those of mRNAs from whole brain tissue [BRAWH: Whole brain, CLONTECH #64020-1] were subtracted by using a Subtract Kit (Invitrogen #K4320-01).

Further, mRNAs extracted and purified as poly A(+) RNAs from the human tissues shown below were purchased. A cDNA library was prepared from an RNA mixture in which the poly A(+) RNA from each tissue had been combined with poly A(−) RNA. The poly A(−) RNA was prepared by removing poly A(+) RNA from the total RNA of whole brain tissue (CLONTECH #64020-1) by using oligo dT cellulose. The library names and the origins are indicated below in the order of “Library name: Origin”.

<Purchase of mRNAs of Human Tissues as Poly A(+) RNAs>

BRAMY: Brain (amygdala), CLONTECH #6574-1;

BRCAN: Brain (caudate nucleus), CLONTECH #6575-1;

BRCOC: Brain (corpus callosum), CLONTECH #6577-1;

BRHIP: Brain (hippocampus), CLONTECH #6578-1;

BRSSN: Brain (substantia nigra), CLONTECH #6580-1;

BRSTN: Brain (subthalamic nucleus), CLONTECH #6581-1;

BRTHA: Brain (thalamus), CLONTECH #6582-1.

(2) Preparation of cDNA Library

cDNA library was prepared from each RNA by the improved method (WO 01/04286) of oligo capping [M. Maruyama and S. Sugano, Gene, 138: 171-174 (1994)]. A series of procedures, BAP (Bacterial Alkaline Phosphatase) treatment, TAP (Tobacco Acid Pyrophosphatase) treatment, RNA ligation, first strand cDNA synthesis and RNA removal, were carried out using the oligo-cap linker (SEQ ID NO: 3279) and oligo dT primer (SEQ ID NO: 3280), as described in WO 01/04286. Then, the single-stranded cDNA was converted to a double-stranded cDNA by PCR (polymerase chain reaction) using 5′ (SEQ ID NO: 3281) and 3′ (SEQ ID NO: 3282) PCR primers, and then digested with SfiI. Then, a fraction of cDNA fragments, typically 2-kb or longer (3-kb or longer in some cases), was unidirectionally cloned into a DraIII-digested pME18SFL3 vector (FIG. 1) (GenBank AB009864, Expression vector); the cDNA library was thus prepared.

The names of cDNA libraries, which were used in the analysis of full-length cDNA sequences, and their origins are shown in Table 2.

TABLE 2
Library Type Origin, etc.
3NB69 Culture cell NB69 cells (RCB #RCB0480)
ADRGL Tissue Adrenal gland (CLONTECH #64016-1)
ASTRO Primary Normal Human Astrocyte NHA5732 (Takara Shuzo #CC2565)
culture cell
BGGI1 Culture cell GI1 cells (RCB #RCB0763)
BNGH4 Culture cell H4 cells (ATCC #HTB-148)
BRACE Tissue Brain, cerebellum (CLONTECH #64035-1)
BRAWH Tissue Brain, whole (CLONTECH #64020-1)
CD34C Primary CD34+ cells (AllCells, LLC #CB14435M)
culture cell
CTONG Tissue Tongue, Cancer
D3OST Primary CD34+ cells (ODF induction for 3 days)
culture cell
DFNES Primary Normal Human Dermal Fibroblasts (Neonatal Skin); NHDF-Neo
culture cell NHDF2564 (Takara Shuzo #CC2509)
FCBBF Tissue Brain, Fetal
FEBRA Tissue Brain, Fetal (CLONTECH #64019-1)
HCASM Primary Human coronary artery smooth muscle cells HCASMC
culture cell (Toyobo #T305K-05)
HEART Tissue Heart (CLONTECH #64025-1)
HHDPC Primary Human dermal papilla cells HDPC (Toyobo #THPCK-001)
culture cell
HLUNG Tissue Lung (CLONTECH #64023-1)
HSYRA Primary Human synoviocytes from rheumatioid arthritis HS-RA(Toyobo
culture cell #T404K-05)
IMR32 Culture cell IMR32 cells (ATCC #CCL-127)
KIDNE Tissue Kidney (CLONTECH #64030-1)
LIVER Tissue Liver (CLONTECH #64022-1)
MAMGL Tissue Mammary Gland (CLONTECH #64037-1)
MESAN Primary Normal human mesangial cells NHMC56046-2 (Takara Shuzo
culture cell #CC2559)
NB9N4 Culture cell NB9 cells (RCB #RCB0477)
NESOP Tissue Esophagus (Invitrogen #D6060-01)
NHNPC Primary Normal human neural progenitor cells NHNP5958 (Takara
culture cell Shuzo #CC2599)
NT2NE Culture cell NT2 cells concentrated after differentiation (NT2 Neuron)
NT2RI Culture cell NT2 cells treated by growth inhibitor for 2 weeks after RA
induction for 5 weeks
NT2RP Culture cell NT2 cells treated by RA for 5 weeks
NTONG Tissue Tongue
OCBBF Tissue Brain, Fetal
PANCR Tissue Pancreas (CLONTECH #64031-1)
PEBLM Primary Human peripheral blood mononuclear cells HPBMC5939
culture cell (Takara Shuzo #CC2702)
PLACE Tissue Placenta
PROST Tissue Prostate (CLONTECH #64038-1)
PUAEN Primary Human pulmonary artery endothelial cells (Toyobo #T302K-05)
culture cell
SALGL Tissue Salivary Gland (CLONTECH #64026-1)
SKMUS Tissue Skeletal Muscle (CLONTECH #64033-1)
SKNMC Culture cell SK-N-MC cells (ATCC #HTB-10)
SKNSH Culture cell SK-N-SH cells (RCB #RCB0426)
SMINT Tissue Small Intestine (CLONTECH #64039-1)
SPLEN Tissue Spleen (CLONTECH #64034-1)
STOMA Tissue Stomach (CLONTECH #64090-1)
SYNOV Tissue Synovial membrane tissue from rheumatioid arthritis
TESTI Tissue Testis (CLONTECH #64027-1)
THYMU Tissue Thymus (CLONTECH #64028-1)
TRACH Tissue Trachea (CLONTECH #64091-1)
UMVEN Primary Human umbilical vein endothelial cells HUVEC (Toyobo
culture cell #T200K-05)
UTERU Tissue Uterus (CLONTECH #64029-1)

The cDNA library with the high fullness ratio (the fullness ratio of 5′-end, which was calculated for each cDNA library by using the protein coding region found in known mRNA species as an index, was 90% in average) prepared by the improved oligo-capping method was constructed by using a eukaryotic expression vector pME18SFL3. The vector contains SRα promoter and SV40 small t intron in the upstream of the cloning site, and SV40 polyA added signal sequence site in the downstream. As the cloning site of pME18SFL3 has asymmetrical DraIII sites, and the ends of cDNA fragments contain SfiI sites complementary to the DraIII sites, the cloned cDNA fragments can be inserted into the downstream of the SRα promoter unidirectionally. Therefore, clones containing full-length cDNA can be expressed transiently by introducing the obtained plasmid directly into COS cells, etc. Thus, the clones can be analyzed very easily in terms of the proteins that are the gene products of the clones, or in terms of the biological activities of the proteins.

(3) Assessment of the 5′-End Completeness of Clones Derived from the cDNA Library Prepared by Oligo-Capping

With respect to the plasmid DNAs of clones derived from the libraries, the nucleotide sequences of cDNA 5′-ends (3′-ends as well in some cases) were determined in a DNA sequencer (ABI PRISM 3700, PE Biosystems), after sequencing reaction was conducted by using a DNA sequencing reagent (BigDye Terminator Cycle Sequencing FS Ready Reaction Kit, PE Biosystems) according to the manual. A database was constructed based on the obtained data.

The 5′-end completeness of about 770,000 clones derived from the human cDNA libraries prepared by the improved oligo-capping method was determined by the following method. The clones whose 5′-end sequences were consistent with those of known human mRNA in the public database were judged to be “full-length” if they had a longer 5′-end sequence than that of the known human mRNA; or even though the 5′-end sequence was shorter, if it contained the translation initiation codon it was judged to have the “full-length” sequence. Clones which did not contain the translation initiation codon were judged to be “not-full-length”. The fullness ratio ((the number of full-length clones)/(the number of full-length and not-full-length clones)) at the 5′-end of the cDNA clones was determined by comparing with known human mRNA. As a result, the fullness ratio of the 5′-ends was 90%. The result indicates that the fullness ratio at the 5′-end sequence was extremely high in the human cDNA clones obtained by the oligo-capping method.

EXAMPLE 2 Sequencing Analysis of cDNA Ends and Selection of Full-Length Clones

With respect to the plasmid DNAs of clones obtained from each cDNA library, the 5′-end nucleotide sequences of the cDNAs were determined in a DNA sequencer (ABI PRISM 3700, PE Biosystems), after sequencing reaction was conducted by using a DNA sequencing reagent (Dye Terminator Cycle Sequencing FS Ready Reaction Kit, dRhodamine Terminator Cycle Sequencing FS Ready Reaction Kit or BigDye Terminator Cycle Sequencing FS Ready Reaction Kit, PE Biosystems) according to the manual. A database was constructed using the data obtained.

For the analyzed 5′-end sequences of cDNA clones, the data with the annotation of “complete cds” in the GenBank and UniGene were searched by BLAST homology search. When identical to certain human mRNA sequences, such cDNA clones were excluded. Then, clustering was carried out. When the identity was 90% or higher, and the length of consensus sequence was 50 base pairs or longer, the cDNA clones were assumed to belong to an identical cluster, and thus clustered. cDNA clones longer in the 5′ direction were selected from the members belonging to a cluster; if required, the 3′-end sequences of the selected clones were determined by the same analysis method as used to determine the 5′-end sequences. The data of the end sequences obtained were analyzed, and then the clones forming a sequence contig at 5′- and 3′-ends were excluded. Further, as mentioned above, the data was analyzed again by BLAST homology search; when identical to certain human mRNA sequences (including sequences patented and applied for), the cDNA clones were excluded. Thus, the cDNAs clones to be analyzed for their nucleotide sequence were obtained.

EXAMPLE 3 Analysis of the Full-Length Nucleotide Sequences

The full-length nucleotide sequences of the selected clones were determined. The nucleotide sequence determination was mainly performed by primer walking method comprising the dideoxy terminator method using custom-made synthetic DNA primers. Namely, the nucleotide sequences of the DNAs were determined in a sequencer from PE Biosystems, after sequencing reaction was carried out with a DNA sequencing reagent from the same supplier using the custom-made synthetic DNA primers according to the manual. A part of the clones were analyzed with a DNA sequencer from Licor.

Further, the nucleotide sequences of a part of the clones were determined by the shotgun method where the plasmids containing the cDNAs were digested at random were used, instead of the use of custom-made primers, by the same method in the DNA sequencer. The full-length nucleotide sequences were finally determined by completely assembling the partial nucleotide sequences obtained by the above method.

Then, the regions translatable to proteins were deduced from the determined full-length nucleotide sequences, and thereby the amino acid sequences were determined. SEQ ID NOs corresponding to the respective sequences are shown in Table 1.

EXAMPLE 4 Functional Prediction by Homology Search

For the determined nucleotide sequences, GenBank, SwissProt, UniGene, and nr were searched by BLAST. The clones exhibiting higher homology, which were convenient to predict their functions based on the nucleotide sequences and deduced amino acid sequences, were selected based on the BLAST search hit data whose P value or E value was 10−4 or lower and for which the length of consensus sequence×homology=30 or higher in the amino acid database search. Further, from them, representative clones were selected, which are shown as Homology Search Result Data in the last part herein. Accordingly, the data shown herein are merely the representative data, and the molecule exhibiting homology to each clone is not limited thereto. Further, with respect to a part of clones, the BLAST search hit data that did not meet the criteria as described above are not shown herein.

EXAMPLE 5 Search for Signal Sequence, Transmembrane Domain and Other Functional Domains in the Deduced Amino Acid Sequences

With respect to the amino acid sequences deduced from the full-length nucleotide sequences, the prediction was made for the presence of signal sequence at the amino terminus, the presence of transmembrane domain, and the presence of functional protein domains (motifs). The signal sequence at the amino terminus was searched for by PSORT [K. Nakai & M. Kanehisa, Genomics, 14: 897-911 (1992)]; the transmembrane domain, by SOSUI [T. Hirokawa et al., Bioinformatics, 14: 378-379 (1998)] (Mitsui Knowledge Industry); the function domain, by Pfam (http://www.sanger.ac.uk/Software/Pfam/index.shtml). The amino acid sequence in which the signal sequence at the amino terminus or transmembrane domain had been predicted to be present by PSORT or SOSUI were assumed to be a secretory or membrane protein. Further, when the amino acid sequence hit a certain functional domain by the Pfam functional domain search, the protein function can be predicted based on the hit data, for example, by referring to the function categories on the PROSITE (http://www.expasy.ch/cgi-bin/prosite-list.pl). In addition, the functional domain search can also be carried out on the PROSITE.

The search results obtained with the respective programs are shown below.

The clones whose deduced amino acid sequences were detected to have the signal sequences by PSORT are as follows.

ADRGL10001600, BGGI120010970, BNGH410001180, BNGH410001370, BRACE10001690, BRACE20010650, BRACE20014920, BRACE20079530, BRACE20086550, BRACE20089600, BRAWH20004430, BRAWH20040950, BRAWH20052250, BRAWH20092610, CD34C20000510, CTONG20028160, FEBRA20003780, FEBRA20004150, FEBRA20006900, FEBRA20008090, FEBRA20012270, FEBRA20015840, FEBRA20020860, FEBRA20021910, FEBRA20037070, HHDPC20000950, HLUNG10000240, HLUNG20001250, HSYRA20003470, HSYRA20014200, IMR3210001580, IMR3220007750, IMR3220008590, KIDNE10001430, KIDNE20001670, KIDNE20003300, KIDNE20042620, KIDNE20054000, KIDNE20060530, KIDNE20066520, LIVER10005420, MAMGL10000320, NHNPC20002060, NT2NE10001630, NT2NE20016260, NT2NE20055170, NT2RI20009740, NT2RI20015400, NT2RI20030110, NT2RI20042840, NT2RI20053350, NT2RI20070840, NT2RI20073030, NT2RI20074980, NT2RI20078270, NT2RI20092890, NT2RP70015910, NT2RP70021510, NT2RP70029820, NT2RP70047900, NT2RP70074220, NT2RP70079250, NT2RP70091680, NT2RP70094290, NT2RP70094980, NT2RP70095070, NTONG10000980, NTONG10002140, NTONG10002570, OCBBF10000420, PANCR10000210, PLACE60020840, PLACE60026990, PLACE60043960, PLACE60049930, PLACE60050290, PROST10005260, PROST10005360, PROST20000360, PROST20029600, PROST20044160, PROST20054260, PROST20058800, SMINT10000160, SPLEN10000910, SPLEN20001340, STOMA20002570, TESTI20026320, TESTI20026980, TESTI20027070, TESTI20028660, TESTI20042870, TESTI20049940, THYMU10000830, UTERU10001920, UTERU20003930, UTERU20004850

The clones whose deduced amino acid sequences were detected to have the transmembrane domains by SOSUI are as follows. Numerals indicate the numbers of transmembrane domains detected in the deduced amino acid sequences. Of the search result, the clone name and the number of transmembrane domains are demarcated by a double slash mark (//).

3NB6910000180//4, 3NB6910000850//1, 3NB6920000290//2, 3NB6920003300//5, 3NB6920005450//2, ADRGL10000180//1, ADRGL10001600//1, ADRGL20003230//2, BGGI120010970//1, BNGH410000800//2, BNGH410001040//2, BNGH410001370//1, BNGH410001980//11, BRACE20007180//1, BRACE20010650//1, BRACE20011170//2, BRACE20013400//2, BRACE20013520//2, BRACE20014230//2, BRACE20014530//1, BRACE20014920//1, BRACE20018590//1, BRACE20022270//1, BRACE20026850//1, BRACE20030780//3, BRACE20031100//10, BRACE20034490//2, BRACE20071380//3, BRACE20071970//1, BRACE20072810//2, BRACE20075020//1, BRACE20075380//3, BRACE20076410//1, BRACE20076850//1, BRACE20077610//2, BRACE20077640//2, BRACE20077980//1, BRACE20086550//1, BRACE20089600//1, BRACE20091880//1, BRAWH10000010//1, BRAWH10000370//1, BRAWH10000940//1, BRAWH10001620//1, BRAWH10001800//1, BRAWH20004430//8, BRAWH20006970//1, BRAWH20011290//4, BRAWH20014380//2, BRAWH20015030//2, BRAWH20036930//1, BRAWH20038320//2, BRAWH20059980//1, BRAWH20087060//1, BRAWH20092610//3, CD34C20000510//1, CTONG20015330//1, CTONG20028160//2, CTONG20037820//1, CTONG20047160//4, FCBBF10006180//3, FCBBF10006750//2, FCBBF20005910//1, FCBBF20009400//3, FCBBF20015380//5, FEBRA20004040//2, FEBRA20004150//3, FEBRA20004520//3, FEBRA20004910//2, FEBRA20006560//3, FEBRA20008800//1, FEBRA20010930//7, FEBRA20012450//3, FEBRA20012940//1, FEBRA20013510//2, FEBRA20014870//1, FEBRA20015840//2, FEBRA20020860//2, FEBRA20021910//1, FEBRA20031550//2, FEBRA20041910//1, FEBRA20063150//1, FEBRA20066670//2, HCASM10000610//2, HCASM20002020//1, HEART20000990//1, HEART20004920//2, HHDPC20000950//2, HLUNG10000370//2, HLUNG20001160//1, HLUNG20001420//12, HLUNG20001760//2, HSYRA20003470//1, HSYRA20008280//1, HSYRA20011030//1, HSYRA20015800//2, IMR3210000440//1, IMR3210001580//2, IMR3210002660//6, IMR3220008590//1, IMR3220009840//2, KIDNE10001040//1, KIDNE10001430//1, KIDNE20000700//1, KIDNE20000850//1, KIDNE20001670//7, KIDNE20003150//1, KIDNE20003300//7, KIDNE20003490//4, KIDNE20004220//1, KIDNE20005170//7, KIDNE20033050//2, KIDNE20033570//1, KIDNE20039410//5, KIDNE20044110//3, KIDNE20048280//12, KIDNE20049810//2, KIDNE20054770//12, KIDNE20060530//2, KIDNE20060620//2, KIDNE20063530//1, KIDNE20066520//2, KIDNE20067600//1, KIDNE20071860//1, KIDNE20074220//1, KIDNE20075690//5, LIVER10000580//3, LIVER10000670//1, LIVER10001040//2, LIVER10001110//1, LIVER10001750//1, LIVER20004160//1, MAMGL10001780//1, MAMGL10001840//2, MESAN10001470//1, MESAN10001800//7, MESAN20001490//2, NB9N420000420//1, NHNPC20002060//2, NT2NE10000230//1, NT2NE10001850//6, NT2NE20003920//1, NT2NE20004550//1, NT2NE20004700//1, NT2NE20005500//1, NT2NE20012470//2, NT2NE20014350//1, NT2NE20016260//4, NT2NE20034080//2, NT2NE20047160//1, NT2NE20055170//3, NT2NE20057200//1, NT2RI20005970//7, NT2RI20014490//11, NT2RI20016570//2, NT2RI20018460//1, NT2RI20018660//2, NT2RI20021520//7, NT2RI20022430//4, NT2RI20022520//3, NT2RI20030110//1, NT2RI20030510//2, NT2RI20033830//2, NT2RI20036780//1, NT2RI20044420//1, NT2RI20049850//2, NT2RI20050870//8, NT2RI20051500//1, NT2RI20066820//1, NT2RI20068250//11, NT2RI20070480//1, NT2RI20077540//4, NT2RI20078790//1, NT2RI20081880//3, NT2RI20085980//3, NT2RI20092890//2, NT2RI20094060//4, NT2RP60000320//10, NT2RP60000390//1, NT2RP60001090//1, NT2RP70002380//4, NT2RP70002590//5, NT2RP70003640//1, NT2RP70004770//4, NT2RP70006240//1, NT2RP70011660//11, NT2RP70015910//2, NT2RP70021510//1, NT2RP70023790//2, NT2RP70026190//1, NT2RP70043730//3, NT2RP70047900//2, NT2RP70049250//1, NT2RP70064080//3, NT2RP70071540//2, NT2RP70071770//13, NT2RP70072520//2, NT2RP70073810//3, NT2RP70075040//4, NT2RP70076170//2, NT2RP70079750//2, NT2RP70081330//2, NT2RP70081370//8, NT2RP70085500//2, NT2RP70090120//10, NT2RP70091490//3, NT2RP70093220//11, NT2RP70093730//1, NT2RP70094290//1, NT2RP70094810//12, NT2RP70094980//3, NTONG10002570//2, NTONG20002650//4, NTONG20004920//1, NTONG20008000//1, NTONG20012220//1, OCBBF20002310//2, OCBBF20009980//1, OCBBF20012100//2, PLACE50000670//1, PLACE50001050//1, PLACE60005550//2, PLACE60012810//2, PLACE60018860//7, PLACE60020160//1, PLACE60020840//6, PLACE60037050//1, PLACE60037450//1, PLACE60047380//1, PLACE60049930//1, PLACE60050290//1, PROST10002200//2, PROST10002720//1, PROST10005360//1, PROST20000360//1, PROST20001760//4, PROST20029600//2, PROST20033020//1, PROST20039220//3, PROST20044160//1, PROST20051430//1, PROST20054260//5, PROST20059190//3, PROST20059430//3, PROST20069880//1, PROST20072370//1, PUAEN10000570//1, PUAEN10001610//1, PUAEN10003220//1, SKMUS20007740//1, SKNMC10000190//1, SKNMC10000290//1, SKNMC10002290//2, SKNMC10002510//8, SMINT10000160//2, SMINT10000420//8, SMINT10000570//2, SMINT10001180//1, SMINT20000180//2, SMINT20002770//3, SPLEN20001340//1, SPLEN20002430//1, SPLEN20002700//1, SPLEN20003100//1, SPLEN20004960//2, STOMA10000520//2, STOMA10001170//1, STOMA20000320//1, STOMA20002570//3, SYNOV20001770//2, TESTI10000420//1, TESTI10000960//1, TESTI20006000//1, TESTI20009090//1, TESTI20009700//7, TESTI20011340//5, TESTI20012370//1, TESTI20013520//4, TESTI20014200//9, TESTI20016210//2, TESTI20016710//1, TESTI20018620//2, TESTI20020020//2, TESTI20020810//8, TESTI20022510//3, TESTI20024670//2, TESTI20025800//2, TESTI20026980//2, TESTI20027000//1, TESTI20030370//1, TESTI20031930//1, TESTI20042870//3, TESTI20047120//5, TESTI20049940//2, TESTI20057420//1, TESTI20058600//6, TESTI20067740//2, TESTI20069780//3, TESTI20074800//5, TESTI20077490//4, TESTI20079510//3, TESTI20080200//7, TESTI20081440//1, TESTI20087740//2, TESTI20088470//2, TESTI20136910//1, THYMU10001760//1, THYMU10003290//1, THYMU10003820//4, THYMU10005580//4, TRACH10000630//3, TRACH10001000//1, TRACH10001400//1, TRACH20001850//2, TRACH20001960//2, TRACH20004960//2, TRACH20006650//11, TRACH20007670//2, TRACH20008980//2, TRACH20015920//2, UMVEN20001330//2, UTERU10000770//2

The Names of clones whose deduced amino acid sequences were detected to have functional domains with Pfam, and the name of hit functional domains are as follows. The search result is indicated as “clone name//functional domain name”. When the clone has multiple hit functional domains, they are listed and demarcated by a double slash mark (//). When the clone has multiple hits of an identical functional domain, each is listed without abridgment.

3NB6910000180//TS-N domain//UBA domain

3NB6910001160//START domain

3NB6910001290//KRAB box

3NB6910001730//RI01/ZK632.3/MJ0444 family

3NB6920002810//DEAD/DEAH box helicase//Helicases conserved C-terminal domain

3NB6920009120//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Frataxin-like domain

3NB6920010020//Regulator of G protein signaling domain

3NB6920014330//Domain of unknown function

3NB6920014710//DNA binding domain with preference for A/T rich regions//Zinc finger, C2H2 type

3NB6920015110//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

3NB6920015570//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

ADRGL10000020//BTB/POZ domain//Kelch motif//Kelch motif

ADRGL10000650//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

ADRGL10001600//Cytochrome P450//Cytochrome P450

ADRGL10001650//Urease//Chlorohydrolase//Dihydroorotase-like

ADRGL20000740//Dockerin domain type I//RhoGAP domain

ASTRO10000180//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat

ASTRO20000950//SNAP-25 family

ASTRO20004170//Ribonuclease T2 family

BGGI120005330//IMP dehydrogenase/GMP reductase N terminus//CBS domain//CBS domain//Dihydroorotate dehydrogenase//Histidine biosynthesis protein//FMN-dependent dehydrogenase//Conserved region in glutamate synthase//IMP dehydrogenase/GMP reductase C terminus

BGGI120005440//Importin beta binding domain

BGGI120006840//Sir2 family

BGGI120006930//Collagen triple helix repeat (20 copies)//SAM domain (Sterile alpha motif)

BGGI120010970//F5/8 type C domain//Laminin G domain//Laminin G domain//Fibrinogen beta and gamma chains, C-terminal globular domain

BGGI120017140//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Transcription factor S-II (TFIIS)//Zinc finger, C2H2 type//Zinc finger, C2H2 type

BNGH410000290//SPRY domain

BNGH410000340//Prolyl oligopeptidase family//Phospholipase/Carboxylesterase

BNGH410001040//Eukaryotic protein kinase domain

BNGH410001180//Low-density lipoprotein receptor domain class A//Low-density lipoprotein receptor domain class A//Low-density lipoprotein receptor domain class A//WAP-type (Whey Acidic Protein) ‘four-disulfide core’//Low-density lipoprotein receptor domain class A//Low-density lipoprotein receptor domain class A//Low-density lipoprotein receptor domain class A//Low-density lipoprotein receptor domain class A//long chain scorpion toxins//Chitin binding Peritrophin-A domain//Low-density lipoprotein receptor repeat class B//Low-density lipoprotein receptor repeat class B//Low-density lipoprotein receptor repeat class B//Low-density lipoprotein receptor repeat class B//Low-density lipoprotein receptor repeat class B

BNGH410001370//Filamin/ABP280 repeat.

BNGH410001770//IMP dehydrogenase/GMP reductase N terminus//CBS domain//CBS domain//Dihydroorotate dehydrogenase//Histidine biosynthesis protein//FMN-dependent dehydrogenase//Conserved region in glutamate synthase//IMP dehydrogenase/GMP reductase C terminus

BNGH410001900//Viral (Superfamily 1) RNA helicase

BNGH410001980//POT family//Bacteriorhodopsin//Sugar (and other) transporter

BNGH420005320//SCAN domain//KRAB box//Zinc finger, C2H2 type//GATA zinc finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Transcription factor S-II (TFIIS)//Zinc finger, C2H2 type

BRACE10000420//Fatty acid desaturase//Protein phosphatase 2C

BRACE10000930//Zinc finger, C3HC4 type (RING finger)//TRAF-type zinc finger//TRAF-type zinc finger//MATH domain

BRACE10001150//DNA gyrase/topoisomerase IV, subunit A//Nucleosome assembly protein (NAP)

BRACE10001660//Zinc finger, C2H2 type

BRACE20002800//IQ calmodulin-binding motif

BRACE20005650//ATP synthase ab C terminal

BRACE20006980//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat

BRACE20007180//Calcitonin/CGRP/IAPP family

BRACE20008850//Zinc finger, C3HC4 type (RING finger)

BRACE20010650//F-box domain.

BRACE20013750//Hepatitis C virus non-structural protein NS4a

BRACE20014920//Protein-tyrosine phosphatase

BRACE20018550//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat

BRACE20018590//Transmembrane 4 family

BRACE20019440//Protein of unknown function DUF82

BRACE20020910//Zinc finger, C3HC4 type (RING finger)//Zinc finger, C3HC4 type (RING finger)//E7 protein, Early protein//B-box zinc finger.

BRACE20022020//Eukaryotic protein kinase domain

BRACE20024090//Homeobox domain

BRACE20024680//Similarity to lectin domain of ricin beta-chain, 3 copies.

BRACE20026850//short chain dehydrogenase

BRACE20027720//Metallo-beta-lactamase superfamily

BRACE20027920//FGGY family of carbohydrate kinases

BRACE20028120//Ras family//ADP-ribosylation factor family

BRACE20031100//Domain of unknown function DUF20//Patched family

BRACE20071740//KRAB box//Zinc finger, C2H2 type//Transcription factor S-II (TFIIS)//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

BRACE20074010//EF hand//EF hand//Mitochondrial carrier proteins//Mitochondrial carrier proteins//Mitochondrial carrier proteins

BRACE20074470//Cadherin domain//Cadherin domain//Glutathione peroxidases//Cadherin domain

BRACE20076410//Sushi domain (SCR repeat)//Sushi domain (SCR repeat)//Sushi domain (SCR repeat)

BRACE20076630//PH domain

BRACE20080970//Phosphofructokinase

BRACE20083800//Fibronectin type III domain

BRACE20083850//bZIP transcription factor//Homeobox associated leucine zipper

BRACE20084430//Thioredoxin//Thioredoxin

BRACE20092120//3′-5′ exonuclease//Adenylylsulfate kinase//Protein of unknown function DUF82

BRACE20093610//Bacterial type II secretion system protein

BRAWH10000940//Rieske [2Fe-2S] domain//Phosphoglucose isomerase//FAD binding domain//Pyridine nucleotide-disulphide oxidoreductase//Phytoene dehydrogenase related enzyme

BRAWH10001300//PH domainH/RhoGAP domain//Tropomyosins

BRAWH10001620//alpha/beta hydrolase fold

BRAWH10001640//KRAB box//ENV polyprotein (coat polyprotein)

BRAWH10001680//Homeobox domain

BRAWH20000480//Transposase//Kinesin motor domain

BRAWH20001770//Serine hydroxymethyltransferase

BRAWH20003230//Wiskott Aldrich syndrome homology region 2

BRAWH20004430//Lectin (probable mannose binding)//Surfactant associated polypeptide

BRAWH20004760//Zinc finger, C2H2 type//Zinc finger, C2H2 type

BRAWH20006330//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

BRAWH20006510//HMGL-like

BRAWH20006860//Eukaryotic protein kinase domain//Protein kinase C terminal domain

BRAWH20009840//Cytochrome P450

BRAWH20011660//Glycosyl hydrolases family 35

BRAWH20012030//Phorbol esters/diacylglycerol binding domain (C1 domain)//Zinc finger, C3HC4 type (RING finger)//PHD-finger

BRAWH20014180//Adenosine-deaminase (editase) domain

BRAWH20014610//TS-N domain//UBA domain

BRAWH20014840//Glycosyl transferases//Similarity to lectin domain of ricin beta-chain, 3 copies.

BRAWH20036890//Protein phosphatase 2C

BRAWH20059980//CUB domain//Low-density lipoprotein receptor domain class A//CUB domain//Low-density lipoprotein receptor domain class A//Fz domain

BRAWH20060440//PPR repeat

BRAWH20064500//Nuclear transition protein 2//HMG (high mobility group) box

BRAWH20076050//Keratin, high sulfur B2 protein

BRAWH20089560//Poly-adenylate binding protein, unique domain.//Magnesium chelatase, subunit ChII//Uncharacterized protein family UPF0034//KE2 family protein//Formin Homology 2 Domain

BRAWH20093600//Family 4 glycosyl hydrolase

CD34C20000510//Glycosyl hydrolases family 18//Glycosyl hydrolases family 18//Chitin binding Peritrophin-A domain

CTONG20005890//DNA gyrase/topoisomerase IV, subunit A//PDZ domain (Also known as DHR or GLGF).//PDZ domain (Also known as DHR or GLGF).

CTONG20011390//Prokaryotic dksA/traR C4-type zinc finger//Hepatitis C virus non-structural protein NS2

CTONG20013200//Uncharacterized protein family UPF0020

CTONG20018200//PHD-finger//PHD-finger//PWWP domain//SET domain

CTONG20019550//Spectrin repeat//Xylose isomerase//Spectrin repeat//Spectrin repeat//Spectrin repeat//Flagellar hook-associated protein 2//Adhesin lipoprotein//Spectrin repeat//Spectrin repeat//Protein of unknown function DUF118//Spectrin repeat//Bacterial flagellin N-terminus//Spectrin repeat//Spectrin repeat//Spectrin repeat//Caulimovirus movement protein//Spectrin repeat

CTONG20025580//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//PHD-finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

CTONG20028030//Domain of unknown function DUF19//Ribosomal protein S18

CTONG20028160//Cadherin domain//Cadherin domain//Cadherin domain//Cadherin domain//Cadherin cytoplasmic region

CTONG20028200//Papain family cysteine protease//E2 (early) protein, N terminal//T-box

CTONG20037820//Neurotransmitter-gated ion-channel//Neurotransmitter-gated ion-channel

CTONG20047160//PCI domain//Latrophilin/CL-1-like GPS domain

CTONG20055530//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Pyridoxal-dependent decarboxylase conserved domain//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat

CTONG20064490//PCI domain D30ST20001840//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

DFNES20002120//Queuine tRNA-ribosyltransferase

DFNES20002680//Protozoan/cyanobacterial globin//KE2 family protein//Adhesin lipoprotein

FCBBF10005980//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//AN1-like Zinc finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

FCBBF10006870//Corticotropin-releasing factor family

FCBBF20000940//Homeobox domain

FCBBF20002320//T-box

FCBBF20002760//Kelch motif//Kelch motif//Kelch motif

FCBBF20005910//Adenylate kinase//Viral (Superfamily 1) RNA helicase//TPR Domain//TPR Domain

FCBBF20008150//LIM domain containing proteins//LIM domain containing proteins//LIM domain containing proteins

FCBBF20009510//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//PHD-finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

FCBBF20012110//Myc amino-terminal region

FCBBF20015380//GNS1/SUR4 family

FCBBF20016720//Domain of unknown function DUF94

FCBBF40002820//Electron transfer flavoprotein beta subunit

FCBBF50002610//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//PHD-finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Transcription factor S-II (TFIIS)//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

FEBRA20000530//BTB/POZ domain//Kelch motif//Kelch motif//Kelch motif//Kelch motif//Kelch motif

FEBRA20001050//TPR Domain//TPR Domain//TPR Domain//TPR Domain//PPR repeat//TPR Domain

FEBRA20003770//Ank repeat//Iron/manganese superoxide dismutases (SODM)//Ras association (RaIGDS/AF-6) domain//FERM domain (Band 4.1 family)

FEBRA20003970//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Transcription factor S-II (TFIIS)//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//TRAF-type zinc finger//Zinc finger, C2H2 type

FEBRA20003990//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

FEBRA20004150//STAS domain

FEBRA20004540//Zinc finger, C2H2 type//Zinc finger, C2H2 type//BolA-like protein//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Transcription factor S-II (TFIIS)//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

FEBRA20005360//Cystatin domain

FEBRA20007330//EF hand//EF hand

FEBRA20007870//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

FEBRA20008560//Importin beta binding domain//Armadillo/beta-catenin-like repeats

FEBRA20008810//Actin

FEBRA20009720//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//BolA-like protein//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

FEBRA20011330//Trypsin and protease inhibitors//PCI domain

FEBRA20011460//SCAN domain

FEBRA20012450//Leucine rich repeat N-terminal domain//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine rich repeat C-terminal domain//Immunoglobulin domain//Fibronectin type III domain

FEBRA20014920//S-adenosylmethionine synthetase

FEBRA20015840//EGF-like domain//EGF-like domain//EGF-like domain//EGF-like domain//EB module//EGF-like domain//EGF-like domain

FEBRA20017060//Immunoglobulin domain

FEBRA20017150//Zinc finger, C3HC4 type (RING finger)//Zinc finger, C3HC4 type (RING finger)//Insulin-like growth factor binding proteins//B-box zinc finger.//CONSTANS family zinc finger//B-box zinc finger.//Putative zinc finger in N-recognin//Fibronectin type III domain//SPRY domain

FEBRA20019890//PH domain//Putative GTP-ase activating protein for Arf//Ank repeat//Ank repeat

FEBRA20024290//RNA polymerase alpha subunit

FEBRA20024420//GMC oxidoreductases

FEBRA20025250//TBC domain

FEBRA20034290//CAP-Gly domain

FEBRA20043250//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Homeobox associated leucine zipper

FEBRA20043290//Myosin tail//lactate/malate dehydrogenase//Troponin//Domain present in Hsp70 regulators//Interleukin-6/G-CSF/MGF family//Myosin tail

FEBRA20044900//Pou domain—N-terminal to homeobox domain//Spectrin repeat//Spectrin repeat

FEBRA20045920//Glycoprotease family

FEBRA20050140//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

FEBRA20050790//Protein-tyrosine phosphatase//Dual specificity phosphatase, catalytic domain

FEBRA20057260//TBC domain

FEBRA20057880//PDZ domain (Also known as DHR or GLGF).

FEBRA20060920//DIX domain

FEBRA20062700//haloacid dehalogenase-like hydrolase

FEBRA20064760//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//DM DNA binding domain//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//GATA zinc finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//PHD-finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Transcription factor S-II (TFIIS)//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

FEBRA20066670//Transthyretin precursor (formerly prealbumin)

FEBRA20067360//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

FEBRA20069420//KRAB box//Zinc finger, C2H2 type//Ribosomal protein L37e//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

FEBRA20070170//PX domain

FEBRA20072000//TPR Domain//TPR Domain//TPR Domain//TPR Domain//TPR Domain//TPR Domain

FEBRA20075510//Ras family

HCASM20002140//Cyclin

HCASM20003070//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

HEART20004110//POT family

HEART20005060//Occludin/ELL family//K-box region

HEART20005680//Nerve growth factor family

HHDPC20000550//Viral (Superfamily 1) RNA helicase//NB-ARC domain//Adenylate kinase//Adenylate kinase

HHDPC20000950//Extracellular link domain//Lectin C-type domain

HHDPC20001150//Collagen triple helix repeat (20 copies)//C1q domain

HHDPC20001490//UBA domain//Integrase Zinc binding domain//IBR domain//IBR domain

HHDPC20003150//Zn-finger in Ran binding protein and others.//Zinc knuckle

HHDPC20004550//FERM domain (Band 4.1 family)

HHDPC20004560//2S seed storage family

HHDPC20004620//FAD binding domain

HLUNG10000240//Transforming growth factor beta like domain

HLUNG10000370//TPR Domain//TPR Domain//TPR Domain//TPR Domain

HLUNG10000760//HMG (high mobility group) box

HLUNG10000990//Adenosylmethionine decarboxylase

HLUNG20000680//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//PHD-finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

HLUNG20001420//REV protein (anti-repression trans-activator protein)//Bacteriorhodopsin//Photosystem II reaction centre T protein//Sugar (and other) transporter//FecCD transport family

HLUNG20001760//Transthyretin precursor (formerly prealbumin)

HLUNG20002550//Trypsin

HSYRA10001190//TBC domain

HSYRA10001370//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//PHD-finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//BolA-like protein//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

HSYRA10001680//DEAD/DEAH box helicase

HSYRA10001780//Alpha-2-macroglobulin family N-terminal region

HSYRA20001350//F-box domain.//Kelch motif//Kelch motif//Kelch motif

HSYRA20005100//UvrD/REP helicase

HSYRA20013320//Insulin-like growth factor binding proteins//Thyroglobulin type-1 repeat

HSYRA20014760//von Willebrand factor type A domain

HSYRA20015740//Glucosamine-6-phosphate isomerase

HSYRA20016210//HesB-like domain

HSYRA20016310//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//PHD-finger//Zinc finger, C2H2 type//Phorbol esters/diacylglycerol binding domain (C1 domain)//Zinc finger, C2H2 type

IMR3210000440//ATP1G1/PLM/MAT8 family//Eukaryotic protein kinase domain

IMR3210001580//Extracellular link domain//Lectin C-type domain

IMR3210002420//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

IMR3210002660//Cation efflux family

IMR3220002230//FHA domain//HIT family

IMR3220003020//Src homology domain 2

IMR3220007420//Zinc finger, C2H2 type

IMR3220007750//Nerve growth factor family//Kazal-type serine protease inhibitor domain//Thyroglobulin type-1 repeat//EF hand//Immunoglobulin domain//Immunoglobulin domain

IMR3220008380//Formyl transferase

IMR3220009190//Influenza Matrix protein (M1)//metallopeptidase family M24

IMR3220009730//Kinesin motor domain

IMR3220012180//tRNA pseudouridine synthase

IMR3220013170//Dual specificity phosphatase, catalytic domain

KIDNE10001040//Myb-like DNA-binding domain//Apolipoprotein A1/A4/E family//Thymidylate kinase//SNAP-25 family//Syntaxin

KIDNE20000410//Aminotransferases class-II pyridoxal-phosphate

KIDNE20000510//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//AN1-like Zinc finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//PHD-finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

KIDNE20001670//Sugar (and other) transporter

KIDNE20003150//Major intrinsic protein

KIDNE20003300//DnaJ domain

KIDNE20003490//Ubiquitin family//Viral matrix protein//Src homology domain 2//Acyltransferase

KIDNE20003750//C2 domain

KIDNE20004030//RNA helicase

KIDNE20004970//Kinesin motor domain//K-box region

KIDNE20005130//Aminotransferases class-III pyridoxal-phosphate//Aminotransferases class-III pyridoxal-phosphate

KIDNE20005170//Uncharacterized membrane protein family UPF0013

KIDNE20031850//Ras association (RalGDS/AF-6) domain

KIDNE20033050//Amidase//Amidase

KIDNE20033730//SH3 domain//RhoGEF domain//PH domain

KIDNE20039940//DNA gyrase/topoisomerase IV, subunit A//SCAN domain//Zinc finger, C2H2 type//Zinc finger, C2H2 type

KIDNE20040840//Eukaryotic protein kinase domain//Phosphoribulokinase//Myosin head (motor domain)//Myosin head (motor domain)

KIDNE20043440//Ribosomal protein L36

KIDNE20044110//Viral methyltransferase//V-type ATPase 116 kDa subunit family

KIDNE20046810//Dienelactone hydrolase family

KIDNE20048280//Amino acid permease//Sodium:neurotransmitter symporter family

KIDNE20050420//Herpesvirus UL25 family//Beige/BEACH domain//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//AN1-like Zinc finger//FYVE zinc finger

KIDNE20052960//Actin

KIDNE20054770//Transmembrane amino acid transporter protein//Ion transport protein//Amino acid permease

KIDNE20056290//Acetyltransferase (GNAT) family

KIDNE20056760//Calponin homology (CH) domain

KIDNE20059080//Armadillo/beta-catenin-like repeats//Armadillo/beta-catenin-like repeats//Armadillo/beta-catenin-like repeats

KIDNE20060140//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat

KIDNE20060300//MutT-like domain

KIDNE20060530//Glycosyl transferase family 8

KIDNE20061490//SPRY domain

KIDNE20062480//Scorpion short toxins

KIDNE20062990//PH domain

KIDNE20066520//Bacterial extracellular solute-binding proteins, family 5

KIDNE20067600//Immunoglobulin domain//Immunoglobulin domain

KIDNE20073520//WW domain

KIDNE20075690//PMP-22/EMP/MP20/Claudin family

KIDNE20078100//Ribosomal protein L15//Integrase core domain//dUTPase

KIDNE20078110//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//PHD-finger//Zinc finger, C2H2 type

LIVER10000670//Urocanase

LIVER10001040//AMP-binding enzyme

LIVER10002300//Respiratory-chain NADH dehydrogenase 51 Kd subunit

LIVER10004330//Cyclic nucleotide-binding domain//Glutathione S-transferases.//Uncharacterized protein family UPF0028

LIVER10005420//Bowman-Birk serine protease inhibitor family

LIVER20000330//Peptidase family M1//K+ channel tetramerisation domain

LIVER20000370//Immunoglobulin domain//Immunoglobulin domain//Immunoglobulin domain

MAMGL10000560//K-box region MAMGL10001780//Lumenal portion of Cytochrome b559, alpha (gene psbE) subunit.

MAMGL10001820//DIX domain

MESAN10000350//Neurohypophysial hormones, C-terminal Domain

MESAN10001800//Sterol O-acyltransferase

MESAN20000920//SAM domain (Sterile alpha motif)//PDZ domain (Also known as DHR or GLGF).//Phosphatidylinositol 3- and 4-kinases

MESAN20005010//PWWP domain

NB9N410000470//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat

NB9N410001350//lactate/malate dehydrogenase//Ras family

NB9N420001040//Na+/K+ ATPase C-terminus

NHNPC10000840//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

NHNPC20002060//DnaJ domain

NHNPC20002120//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Putative zinc finger in N-recognin//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2NE10000140//Zinc knuckle//Nucleotidyltransferase domain//Zinc knuckle

NT2NE10000730//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat

NT2NE10000830//7 transmembrane receptor (rhodopsin family)

NT2NE10001850//Divalent cation transporter//TPR Domain//TPR Domain//TPR Domain//TPR Domain//TPR Domain//TPR Domain//TPR Domain//TPR Domain//TPR Domain//TPR Domain

NT2NE20001740//RNA pseudouridylate synthase

NT2NE20002140//Rhodanese-like domain//Protein-tyrosine phosphatase//Dual specificity phosphatase, catalytic domain

NT2NE20002590//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//TRAF-type zinc finger//Zinc finger, C2H2 type

NT2NE20003690//Carbamoyl-phosphate synthase (CPSase)

NT2NE20003840//TPR Domain//TPR Domain//TPR Domain

NT2NE20005360//Ribosomal protein S2

NT2NE20005500//Retroviral aspartyl protease//Retroviral aspartyl protease

NT2NE20006580//Zinc finger, C3HC4 type (RING finger)//ICE-like protease (caspase) p10 domain//SPRY domain

NT2NE20007630//Matrix protein (MA), p15

NT2NE20008090//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//PHD-finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2NE20013370//SPRY domain

NT2NE20013720//Tryptophan synthase alpha chain//Ribulose-phosphate 3 epimerase family//Indole-3-glycerol phosphate synthases

NT2NE20016260//7 transmembrane receptor (rhodopsin family)

NT2NE20016660//DEAD/DEAH box helicase

NT2NE20034080//EGF-like domain//Laminin EGF-like (Domains III and V)

NT2NE20047160//Glycosyl transferase family 8

NT2NE20053710//Ank repeat

NT2NE20057200//Ubiquitin-conjugating enzyme//DNA mismatch repair proteins, mutS family

NT2RI10000270//Zinc finger C-x8-C-x5-C-x3-H type (and similar).

NT2RI10000480//Dual specificity phosphatase, catalytic domain

NT2RI20003410//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//DM DNA binding domain//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//PHD-finger//Zinc finger, C2H2 type

NT2RI20004120//ENTH domain//DNA polymerase (viral) C-terminal domain

NT2RI20004210//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2RI20006690//Plant thionins

NT2RI20006850//Collagen triple helix repeat (20 copies)//Histone-like transcription factor (CBF/NF-Y) and archaeal histone

NT2RI20010100//Carboxylesterases//Carboxylesterases

NT2RI20010830//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Transcription factor S-II (TFIIS)//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2RI20014090//ROK family//Spectrin repeat//Tropomyosins//Spectrin repeat//Spectrin repeat

NT2RI20014500//Xylose isomerase

NT2RI20015400//TPR Domain

NT2RI20015950//Keratin, high sulfur B2 protein

NT2RI20016210//Bacterial regulatory proteins, luxR family

NT2RI20016570//DnaJ central domain (4 repeats)

NT2RI20018460//Glutamine synthetase//Notch (DSL) domain//Notch (DSL) domain

NT2RI20018660//Immunoglobulin domain//SPRY domain

NT2RI20020220//Phosphatidylinositol-specific phospholipase C, X domain

NT2RI20025170//PDZ domain (Also known as DHR or GLGF).//PDZ domain (Also known as DHR or GLGF).

NT2RI20025300//Ubiquitin family

NT2RI20025410//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Putative zinc finger in N-recognin//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Transcription factor S-II (TFIIS)//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zn-finger in ubiquitin-hydrolases and other proteins//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2RI20025540//TPR Domain//TPR Domain//TPR Domain

NT2RI20025850//jmjN domain//jmjC domain

NT2RI20029580//C2 domain//C2 domain

NT2RI20029700//EF hand//EF hand

NT2RI20030110//Immunoglobulin domain

NT2RI20031540//Interleukin-6/G-CSF/MGF family

NT2RI20032050//Armadillo/beta-catenin-like repeats//Armadillo/beta-catenin-like repeats

NT2RI20033440//PDZ domain (Also known as DHR or GLGF).

NT2RI20036780//Subtilase family//Proprotein convertase P-domain

NT2RI20036950//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Insulin/IGF/Relaxin family//Ribosomal RNA adenine dimethylases//SAM domain (Sterile alpha motif)//TFIIE alpha subunit//Zinc finger, C3HC4 type (RING finger)

NT2RI20037510//Formamidopyrimidine-DNA glycosylase

NT2RI20046060//K+ channel tetramerisation domain

NT2RI20049850//Domain of unknown function

NT2RI20050610//Peptidase family M1

NT2RI20050870//Voltage gated chloride channels//Xanthine/uracil permeases family//Sulfate transporter family//STAS domain

NT2RI20051500//Sialyltransferase family//Photosynthetic reaction center protein

NT2RI20053680//Zinc finger, C2H2 type

NT2RI20055640//Glutathione S-transferases.//Protein of unknown function DUF61//Glutathione S-transferases.

NT2RI20056470//bZIP transcription factor//Transposase//bZIP transcription factor//Outer membrane efflux protein//Intermediate filament proteins

NT2RI20058110//Guanine nucleotide exchange factor for Ras-like GTPases; N-terminal motif//RasGEF domain

NT2RI20060710//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//TRAF-type zinc finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2RI20062100//Src homology domain 2

NT2RI20064120//Ras family//Cell division protein

NT2RI20066790//Immunoglobulin domain

NT2RI20067030//L1 (late) protein

NT2RI20067350//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//TRAF-type zinc finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2RI20068250//Dolichyl-phosphate-mannose-protein mannosyltransferase//S-adenosylmethionine synthetase

NT2RI20068550//Helicases conserved C-terminal domain

NT2RI20070480//Atrial natriuretic peptide

NT2RI20070840//Immunoglobulin domain

NT2RI20070960//Hydroxymethylglutaryl-coenzyme A reductase//RhoGEF domain//Hpt domain//PH domain

NT2RI20071330//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Transcription factor S-II (TFIIS)//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2RI20071480//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat

NT2RI20072540//Ribosomal RNA adenine dimethylases//SAM domain (Sterile alpha motif)//TFIIE alpha subunit//Zinc finger, C3HC4 type (RING finger)

NT2RI20073840//Eukaryotic protein kinase domain

NT2RI20074390//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2RI20074690//Ubiquinol-cytochrome C reductase complex 14 kD subunit

NT2RI20074980//Fz domain//Zinc carboxypeptidase//Zinc carboxypeptidase

NT2RI20078270//Acyl-CoA oxidase

NT2RI20078840//Homeobox domain//Bacterial regulatory proteins, crp family//Site-specific recombinases//Bacterial regulatory proteins, luxR family

NT2RI20078910//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat

NT2RI20080500//Immunoglobul in domain//Immunoglobul in domain//Immunoglobulin domain//Immunoglobulin domain//Immunoglobulin domain//Immunoglobulin domain

NT2RI20083360//bZIP transcription factor

NT2RI20084810//Acyltransferase

NT2RI20085980//Bacterial regulatory proteins, crp family//CUB domain//F5/8 type C domain

NT2RI20087140//SET domain

NT2RI20088120//Bindin//HupF/HypC family

NT2RI20089420//Immunoglobulin domain//PKD domain

NT2RI20090650//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C3HC4 type (RING finger)//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C3HC4 type (RING finger)//Zinc finger, C2H2 type//Putative zinc finger in N-recognin//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2RI20091440//SPRY domain

NT2RI20092150//SCAN domain//Integrase core domain

NT2RI20092890//Leucine rich repeat N-terminal domain//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine rich repeat C-terminal domain//Immunoglobulin domain

NT2RI20094060//DHHC zinc finger domain

NT2RP60000320//Cytochrome c oxidase subunit III//7 transmembrane receptor (Secretin family)//Domain found in Dishevelled, Egl-10, and Pleckstrin

NT2RP60000720//Molluscan rhodopsin C-terminal tail

NT2RP60000860//Ubiquitin-conjugating enzyme

NT2RP60001000//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//TRAF-type zinc finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2RP60001090//BTB/POZ domain//HMG (high mobility group) box//Kelch motif//Kelch motif//Kelch motif//Kelch motif//Kelch motif

NT2RP60001230//TPR Domain//TPR Domain//TPR Domain//TPR Domain//PPR repeat//TPR Domain

NT2RP60001270//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//TRAF-type zinc finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2RP70000690//Methyl-CpG binding domain

NT2RP70002380//Bacterial export proteins, family 3

NT2RP70002710//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2RP70004770//TPR Domain//TPR Domain//TPR Domain//TPR Domain//TPR Domain//TPR Domain//TPR Domain

NT2RP70006240//Integrins, beta chain//RhoGEF domain//PH domain//MORN motif//MORN motif//MORN motif//MORN motif//MORN motif//Coproporphyrinogen III oxidase//MORN motif

NT2RP70010800//ZAP domain

NT2RP70011660//Iron/manganese superoxide dismutases (SODM)//E1-E2 ATPase//Domain of unknown function DUF19//Photosystem II reaction centre T protein

NT2RP70012310//Alphavirus E3 glycoprotein//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

NT2RP70015910//Kringle domain//WSC domain//CUB domain

NT2RP70018560//SAM domain (Sterile alpha motif)//Sterile alpha motif (SAM)/Pointed domain

NT2RP70023760//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//TBC domain

NT2RP70024500//Picornavirus coat protein (VP4)//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//IBR domain//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2RP70028750//Ank repeat//Ank repeat//Ank repeat//CAP-Gly domain

NT2RP70029060//Oxysterol-binding protein//Hsp90 protein

NT2RP70030550//PHD-finger

NT2RP70032030//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//GATA zinc finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2RP70033040//Rhodanese-like domain//Integrase Zinc binding domain//Integrase Zinc binding domain//DnaJ central domain (4 repeats)

NT2RP70036290//Glypican//Leucine Rich Repeat//Leucine Rich Repeat

NT2RP70036470//Porphobilinogen deaminase//GHMP kinases putative ATP-binding proteins

NT2RP70036800//Methanol dehydrogenase beta subunit//BTB/POZ domain//Kelch motif//Kelch motif//Kelch motif//Kelch motif//Kelch motif//Kelch motif

NT2RP70039600//Calpain inhibitor repeat

NT2RP70042040//PHD-finger//FYVE zinc finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2RP70042330//TPR Domain//TPR Domain//TPR Domain//TPR Domain//TPR Domain//TPR Domain//TPR Domain

NT2RP70043960//SH3 domain//SH3 domain//SH3 domain//SH3 domain//SH3 domain

NT2RP70045410//Helix-loop-helix DNA-binding domain

NT2RP70046560//PHD-finger//PHD-finger

NT2RP70046870//Macrophage migration inhibitory factor (MIF)//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//Arenavirus glycoprotein//WD domain, G-beta repeat

NT2RP70049150//PWWP domain

NT2RP70049250//WH1 domain

NT2RP70055020//Sigma-54 interaction domain//ATPases associated with various cellular activities (AAA)

NT2RP70055130//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//TRAF-type zinc finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//DM DNA binding domain//Zinc finger, C2H2 type

NT2RP70061620//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2RP70061880//GTPase-activator protein for Ras-like GTPase

NT2RP70062960//SNF2 and others N-terminal domain//SNF2 and others N-terminal domain//Leishmanolysin//Helicases conserved C-terminal domain

NT2RP70063040//Plant PEC family metallothionein//Cell division protein

NT2RP70064900//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//PHD-finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Transcription factor S-II (TFIIS)//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//TRAF-type zinc finger//Zinc finger, C2H2 type

NT2RP70065270//LIM domain containing proteins//LIM domain containing proteins//LIM domain containing proteins//Helper component proteinase

NT2RP70069860//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Putative zinc finger in N-recognin//Zinc finger, C2H2 type//DM DNA binding domain//Zinc finger, C2H2 type

NT2RP70071770//STAT protein//Zinc finger, C3HC4 type (RING finger)

NT2RP70072210//Viral (Superfamily 1) RNA helicase

NT2RP70072520//PAS domain//PAS domain//PAS domain//Eukaryotic protein kinase domain

NT2RP70074060//Glutamine synthetase

NT2RP70075370//Zinc finger, C3HC4 type (RING finger)//B-box zinc finger.//CONSTANS family zinc finger//Putative zinc finger in N-recognin//SPRY domain

NT2RP70076100//SAM domain (Sterile alpha motif)

NT2RP70076430//Apolipoprotein A1/A4/E family

NT2RP70079250//F5/8 type C domain//Laminin G domain//Laminin G domain//EGF-like domain//Thrombospondin N-terminal-like domains//Laminin G domain

NT2RP70079750//Laminin G domain

NT2RP70081370//Herpesvirus glycoprotein M//ABC transporter//Ribosomal S17

NT2RP70081440//Eukaryotic protein kinase domain

NT2RP70081670//Helix-hairpin-helix motif.//S1 RNA binding domain

NT2RP70084060//Glycosyl transferases group 1

NT2RP70084410//Bromodomain//Bromodomain//Bromodomain//Bromodomain//Bromodomain//Bromodomain//BAH domain

NT2RP70084870//Sulfotransferase proteins

NT2RP70085500//Immunoglobulin domain//Immunoglobulin domain//Immunoglobulin domain//Immunoglobulin domain//Immunoglobulin domain//Fibronectin type III domain//Fibronectin type III domain//Fibronectin type III domain

NT2RP70085570//Heavy-metal-associated domain//HECT-domain (ubiquitin-transferase).

NT2RP70087200//KRAB box//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//DM DNA binding domain//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2RP70088550//PH domain

NT2RP70090120//Cytochrome oxidase subunit II//Voltage gated chloride channels//CBS domain//CBS domain

NT2RP70090190//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Transcription factor S-II (TFIIS)//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NT2RP70091490//Sugar (and other) transporter

NT2RP70092360//Immunoglobulin domain//Immunoglobulin domain//Immunoglobulin domain//Immunoglobulin domain//Immunoglobulin domain//Immunoglobulin domain//Thioredoxin//Immunoglobulin domain//Immunoglobulin domain//Immunoglobulin domain//Thioredoxin//Immunoglobulin domain//Adenovirus E3 region protein CR1//Immunoglobulin domain//Immunoglobulin domain//Immunoglobulin domain//Immunoglobulin domain

NT2RP70093220//CbiM//Voltage gated chloride channels//CBS domain//CBS domain

NT2RP70093700//WD domain, G-beta repeat//Virion host shutoff protein//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat

NT2RP70093940//IPT/TIG domain

NT2RP70094810//Myelin proteolipid protein (PLP or lipophilin)//Influenza non-structural protein (NS1)//Protein of unknown function DUF67//Patched family//7 transmembrane receptor (metabotropic glutamate family)

NT2RP70094980//EGF-like domain//EGF-like domain//Trypsin Inhibitor like cysteine rich domain//EGF-like domain//EGF-like domain//Trypsin Inhibitor like cysteine rich domain//EGF-like domain//von Willebrand factor type C domain//von Willebrand factor type C domain//Metallothionein//von Willebrand factor type C domain//von Willebrand factor type C domain//von Willebrand factor type C domain//von Willebrand factor type C domain

NTONG10000520//BTB/POZ domain//Kelch motif//Kelch motif

NTONG10001300//HlyD family secretion protein//Biopterin-dependent aromatic amino acid hydroxylase//Caspase recruitment domain

NTONG10002570//Rhabdovirus spike glycoprotein

NTONG10002640//Phosphoglucomutase/phosphomannomutase

NTONG20003340//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NTONG20008780//Bacterial regulatory proteins, lacI family//Site-specific recombinases

NTONG20009660//Nebulin repeat//Nebulin repeat//Nebulin repeat//Nebulin repeat//Nebulin repeat//Nebulin repeat//Nebulin repeat//Nebulin repeat

NTONG20015500//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//BolA-like protein//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Transcription factor S-II (TFIIS)//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

NTONG20016120//PH domain//Phosphoglycerate mutase family//Oxysterol-binding protein

OCBBF10000910//Sorbin homologous domain//Peptidase family M1//SH3 domain//SH3 domain//SH3 domain

OCBBF10001180//K+ channel tetramerisation domain

OCBBF10001190//DNA topoisomerase II (N-terminal region)

OCBBF10001220//BTB/POZ domain//Ketch motif//Kelch motif//Kelch motif//Kelch motif//Kelch motif

OCBBF20002310//Leucine rich repeat N-terminal domain//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine rich repeat C-terminal domain

OCBBF20007190//Metallo-beta-lactamase superfamily

OCBBF20008240//bZIP transcription factor//tRNA synthetase class II (G, H, P, S and T)

OCBBF20010750//Spectrin repeat

OCBBF20011010//Zinc finger, C2H2 type//Zinc finger, C2H2 type//PHD-finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//FYVE zinc finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Transcription factor S-II (TFIIS)//Zinc finger, C2H2 type//Zinc finger, C2H2 type

OCBBF20011240//Glutathione S-transferases.

OCBBF20011400//WD domain, G-beta repeat//K+ channel tetramerisation domain//7-fold repeat in Clathrin and VPS

OCBBF20011760//BTB/POZ domain//Kelch motif//Kelch motif//Kelch motif//Kelch motif//Kelch motif

OCBBF20012100//PAP2 superfamily

OCBBF20013070//Zinc finger, C2H2 type//Zinc finger, C2H2 type

OCBBF20014940//UBA domain

OCBBF20015270//Zinc finger, C2H2 type//Bacterial type II secretion system protein

OCBBF20015280//lactate/malate dehydrogenase

OCBBF20015860//ATP synthase Alpha chain, C terminal

PEBLM10000340//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)//Zn-finger in Ran binding protein and others.

PEBLM10000680//Actin

PEBLM20001120//Thymidylate kinase//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat

PEBLM20002480//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//TRAF-type zinc finger//Zinc finger, C2H2 type//Transcription factor S-II (TFIIS)//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

PEBLM20002700//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//PHD-finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

PEBLM20003080//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

PEBLM20003950//SCAN domain

PEBLM20004790//Src homology domain 2//Eukaryotic protein kinase domain

PLACE50000370//7-fold repeat in Clathrin and VPS

PLACE50000580//Apolipoprotein A1/A4/E family

PLACE50000680//Sushi domain (SCR repeat)//Sushi domain (SCR repeat)

PLACE60002050//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

PLACE60003790//Lumenal portion of Cytochrome b559, alpha (gene psbE) subunit.

PLACE60004290//Gag P30 core shell protein

PLACE60012810//AMP-binding enzyme

PLACE60014430//moaA/nifB/pqqE family//MoaC family

PLACE60018860//Adenylate and Guanylate cyclase catalytic domain

PLACE60021020//Integrase Zinc binding domain//Integrase Zinc binding domain//DnaJ central domain (4 repeats)

PLACE60021510//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Putative zinc finger in N-recognin//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

PLACE60026680//Sorbin homologous domain//SH3 domain//SH3 domain

PLACE60030380//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

PLACE60032040//Hirudin

PLACE60037050//ENV polyprotein (coat polyprotein)

PLACE60038500//Mitochondrial carrier proteins//Mitochondrial carrier proteins

PLACE60044640//Small cytokines (intecrine/chemokine), interleukin-8 like

PLACE60046630//Phorbol esters/diacylglycerol binding domain (C1 domain)//PHD-finger

PROST10003430//PHD-finger//Zinc finger, C3HC4 type (RING finger)//TRAF-type zinc finger//PDZ domain (Also known as DHR or GLGF).//PDZ domain (Also known as DHR or GLGF).//PDZ domain (Also known as DHR or GLGF).//WHEP-TRS domain containing proteins//PDZ domain (Also known as DHR or GLGF).

PROST10005360//F5/8 type C domain//Laminin G domain//Laminin G domain//EGF-like domain//Fibrinogen beta and gamma chains, C-terminal globular domain

PROST20003250//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

PROST20018230//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

PROST20018990//ADP-ribosylation factor family//Ras family

PROST20023380//K+ channel tetramerisation domain//BTB/POZ domain

PROST20029600//Small cytokines (intecrine/chemokine), interleukin-8 like//Immunoglobulin domain

PROST20031170//Heavy-metal-associated domain//HECT-domain (ubiquitin-transferase).

PROST20033380//TPR Domain//TPR Domain//TPR Domain

PROST20033400//Eukaryotic protein kinase domain

PROST20043320//Paramyxovirus nucleocapsid protein//SH3 domain

PROST20044160//Tropomyosins

PROST20051210//Protein phosphatase 2C//Protein phosphatase 2C

PROST20064500//Sulfotransferase proteins

PROST20067370//TRAF-type zinc finger//DnaJ central domain (4 repeats)

PROST20069880//Atrial natriuretic peptide

PROST20072890//K+ channel tetramerisation domain//BTB/POZ domain

PROST20073170//K+ channel tetramerisation domain//BTB/POZ domain//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger present in dystrophin, CBP/p300

PROST20073890//Platelet-derived growth factor (PDGF)

PROST20085160//Tropomyosins//Tropomyosins

PROST20094830//PH domain

PUAEN10003220//Photosystem I reaction centre subunit VIII

SALGL10000050//Permeases for cytosine/purines, uracil, thiamine, allantoin

SALGL10000650//SAM domain (Sterile alpha motif)//Sterile alpha motif (SAM)/Pointed domain

SALGL10001570//Colicin pore forming domain//MotA/TolQ/ExbB proton channel family

SKMUS10000140//Ubiquitin family//Ubiquitin family//Ubiquitin family//Ubiquitin family//Ubiquitin family//Ubiquitin family

SKMUS10000220//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat

SKMUS10000640//Zinc finger, C3HC4 type (RING finger)//Zinc finger, C3HC4 type (RING finger)//PHD-finger//B-box zinc finger.//3′5′-cyclic nucleotide phosphodiesterase

SKMUS10001040//bZIP transcription factor

SKMUS10001180//Coronavirus S2 glycoprotein

SKMUS10001290//MutT-like domain

SKMUS10001770//Protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT)

SKMUS20000740//ubiE/COQ5 methyltransferase family//Cyclopropane-fatty-acyl-phospholipid synthase

SKMUS20001170//ATP synthase Alpha chain, C terminal//MAGE family

SKMUS20002710//Hepatitis C virus capsid protein

SKMUS20003900//Mov34/MPN/PAD-1 family

SKMUS20004580//LIM domain containing proteins//Nebulin repeat//Nebulin repeat//Nebulin repeat//Nebulin repeat//Nebulin repeat//Nebulin repeat//Nebulin repeat//Nebulin repeat//Nebulin repeat

SKMUS20007240//Thiamine pyrophosphate enzymes//Thiamine pyrophosphate enzymes//Thiamine pyrophosphate enzymes

SKMUS20008630//OB-fold nucleic acid binding domain//tRNA synthetases class II (F)//tRNA synthetases class II (D, K and N)

SKMUS20009540//F-box domain.

SKMUS20011290//Iron-containing alcohol dehydrogenases//Iron-containing alcohol dehydrogenases

SKMUS20013640//Laminin EGF-like (Domains III and V)

SKMUS20016340//HMG (high mobility group) box

SKMUS20016620//Ank repeat//Ank repeat//Glutamine amidotransferases class-II//Ank repeat

SKMUS20016680//Phorbol esters/diacylglycerol binding domain (C1 domain)//CONSTANS family zinc finger//SH3 domain

SKNMC10000290//Zinc finger C-x8-C-x5-C-x3-H type (and similar).

SKNMC10002510//ABC transporter transmembrane region.//Phosphoribulokinase//ATPases associated with various cellular activities (AAA)//ABC transporter

SKNMC20000650//Zinc finger, C2H2 type//Protein phosphatase 2C//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

SKNMC20000970//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)//Elongation factor TS//Protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT)//Met-10+ like-proteins

SKNMC20002240//KRAB box//Zinc finger, C2H2 type//LIM domain containing proteins//Zinc finger, C2H2 type//TRAF-type zinc finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//LIM domain containing proteins//PHD-finger//Zinc finger, C2H2 type

SKNMC20003560//Helix-loop-helix DNA-binding domain

SKNMC20010570//F-box domain.

SKNMC20015030//Keratin, high sulfur B2 protein

SKNMC20015960//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Bacterial stress protein//Ank repeat//Formylmethanofuran-tetrahydromethanopterin formyltransferase//Ank repeat//Ank repeat//Ank repeat//Neuraxin and MAP1B proteins//FYVE zinc finger

SKNSH10001740//Pyridoxal-dependent decarboxylase

SKNSH10003010//SH3 domain

SKNSH20003470//Heme-binding domain in cytochrome b5 and oxidoreductases

SMINT10000160//UDP-glucoronosyl and UDP-glucosyl transferases

SMINT10000420//Cytochrome oxidase subunit II//ABC transporter//Biopterin-dependent aromatic amino acid hydroxylase

SMINT10000570//Immunoglobulin domain//Immunoglobulin domain//Immunoglobulin domain

SMINT10000710//Immunoglobulin domain

SMINT10001030//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat//Ank repeat

SMINT20002270//Disintegrin//Trans-activation protein X

SMINT20002770//Transcriptional regulatory protein, C terminal//Immunoglobulin domain

SPLEN10001430//HMG (high mobility group) box

SPLEN20000720//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//TRAF-type zinc finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

SPLEN20001340//Peptidase family M20/M25/M40

SPLEN20001970//Transcription factor TFIIB repeat

SPLEN20002670//WD domain, G-beta repeat

SPLEN20003570//RasGEF domain//Ras association (RaIGDS/AF-6) domain

STOMA10001860//Cytosolic long-chain acyl-CoA thioester hydrolase//OB-fold nucleic acid binding domain//Cytosolic long-chain acyl-CoA thioester hydrolase

STOMA20000880//Immunoglobulin domain

STOMA20001210//Cys/Met metabolism PLP-dependent enzyme//Aminotransferases class-I

STOMA20002570//MgtC family

STOMA20002890//Adaptin N terminal region

STOMA20003960//LIM domain containing proteins//LIM domain containing proteins

STOMA20004820//PH domain//EF hand//EF hand//Phosphatidylinositol-specific phospholipase C, X domain

SYNOV10001280//Lipoate-protein ligase B

SYNOV20013740//KRAB box//Bacterial type II secretion system protein I/J//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

SYNOV20014510//SRF-type transcription factor (DNA-binding and dimerisation domain)

SYNOV20016480//glycosyl transferase family

TESTI10000420//K-box region//Penicillin amidase

TESTI10000510//Transient receptor

TESTI10000550//Homeobox domain

TESTI10000640//K+ channel tetramerisation domain//BTB/POZ domain//Kelch motif//Kelch motif//Kelch motif//Kelch motif//Kelch motif

TESTI10000700//Ubiquitin carboxyl-terminal hydrolases family 2//Ubiquitin carboxyl-terminal hydrolase family 2

TESTI10001270//PLAT/LH2 domain//PLAT/LH2 domain//PLAT/LH2 domain

TESTI10001380//Subtilase family//Proprotein convertase P-domain

TESTI10001680//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat

TESTI20001200//KRAB box

TESTI20001540//Eukaryotic protein kinase domain

TESTI20001770//von Willebrand factor type A domain//Proprotein convertase P-domain

TESTI20002070//NifU-like N terminal domain

TESTI20002380//Exonuclease//3′-5′ exonuclease

TESTI20002530//Ubiquitin family

TESTI20003560//Tubulin/FtsZ family

TESTI20005910//Adenylate kinase//Elongation factor Tu family//Adenylate kinase//6-phosphofructo-2-kinase//Shikimate kinase//pKID domain//Adenylate kinase//Thymidylate kinase//ATPases associated with various cellular activities (AAA)

TESTI20006000//Ank repeat//CAP-Gly domain

TESTI20006270//TPR Domain//TPR Domain//TPR Domain//4-hydroxyphenylpyruvate dioxygenase C terminal domain//TPR Domain//TPR Domain

TESTI20006950//Tudor domain//Stathmin family

TESTI20006990//KOW motif//Kinesin motor domain

TESTI20007070//DM DNA binding domain

TESTI20007840//Apolipoprotein A1/A4/E family

TESTI20008490//Apolipoprotein A1/A4/E family

TESTI20008830//Immunoglobulin domain

TESTI20010490//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

TESTI20011410//RhoGEF domain//PH domain//Phorbol esters/diacylglycerol binding domain (C1 domain)//CXXC zinc finger//FYVE zinc finger//PH domain

TESTI20012370//K+ channel tetramerisation domain//BTB/POZ domain//Ornithine decarboxylase antizyme//Kelch motif//Kelch motif//Kelch motif//Kelch motif//Kelch motif

TESTI20012690//Biotin-requiring enzymes//Biotin-requiring enzymes//2-oxo acid dehydrogenases acyltransferase (catalytic domain)

TESTI20013300//EF hand//EF hand//Ubiquitin carboxyl-terminal hydrolases family 2

TESTI20013450//Double-stranded RNA binding motif//Aldehyde oxidase and xanthine dehydrogenase, C terminus//Adenosine-deaminase (editase) domain

TESTI20014200//ABC 3 transport family//Sugar (and other) transporter

TESTI20015110//bZIP transcription factor//Troponin//Domain of unknown function DUF87

TESTI20015560//K+ channel tetramerisation domain//BTB/POZ domain

TESTI20016610//Leptin

TESTI20018150//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

TESTI20018270//Transketolase//Dehydrogenase E1 component//Transketolase

TESTI20018520//F5/8 type C domain//Laminin G domain//Ribosomal protein L11//Thrombospondin N-terminal-like domains//Laminin G domain//EGF-like domain//Fibrinogen beta and gamma chains, C-terminal globular domain

TESTI20018690//SAM domain (Sterile alpha motif)

TESTI20018790//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

TESTI20020570//E1 Protein, N terminal domain//Actin

TESTI20020810//7 transmembrane receptor (metabotropic glutamate family)//Transmembrane amino acid transporter protein

TESTI20021050//TPR Domain//TPR Domain//TPR Domain//TPR Domain//TPR Domain//TPR Domain//TPR Domain

TESTI20021490//BTB/POZ domain//Zinc finger, C2H2 type//PHD-finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

TESTI20022230//Nucleosome assembly protein (NAP)

TESTI20022510//Calreticulin family//PHD-finger

TESTI20022560//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Leucine Rich Repeat//Guanylate kinase//Vesiculovirus phosphoprotein

TESTI20024980//PDZ domain (Also known as DHR or GLGF).//SH3 domain//Guanylate kinase

TESTI20025160//MAGE family

TESTI20025800//lactate/malate dehydrogenase//Pyridine nucleotide-disulphide oxidoreductase

TESTI20026760//SPRY domain

TESTI20027070//Type I phosphodiesterase/nucleotide pyrophosphatase

TESTI20027290//RhoGAP domain

TESTI20027890//KRAB box//Dictyostelium (s lime mold) repeats//Dictyostelium (slime mold) repeats//Zinc finger, C2H2 type//Dictyostelium (slime mold) repeats//Zinc finger, C2H2 type//Dictyostelium (slime mold) repeats

TESTI20029120//Eukaryotic protein kinase domain

TESTI20030050//Histone-like transcription factor (CBF/NF-Y) and archaeal histone

TESTI20030370//MYND finger//TPR Domain//TPR Domain//TPR Domain//Adaptin N terminal region

TESTI20030710//Herpesvirus UL25 family

TESTI20031090//Armadillo/beta-catenin-like repeats//Armadillo/beta-catenin-like repeats//Armadillo/beta-catenin-like repeats//Armadillo/beta-catenin-like repeats//Armadillo/beta-catenin-like repeats//Armadillo/beta-catenin-like repeats//Armadillo/beta-catenin-like repeats

TESTI20031300//TPR Domain

TESTI20031520//mRNA capping enzyme

TESTI20031960//WD domain, G-beta repeat

TESTI20032280//Myb-like DNA-binding domain

TESTI20033250//UBX domain//Orotidine 5′-phosphate decarboxylases

TESTI20033270//DM DNA binding domain

TESTI20033540//Zinc finger, C2H2 type

TESTI20033560//F-box domain.

TESTI20034190//ATP synthase Alpha chain, C terminal//AMP-binding enzyme

TESTI20034980//RhoGEF domain

TESTI20035120//C2 domain//Kinesin motor domain

TESTI20035510//NOL1/NOP2/sun family

TESTI20035890//UBA domain//Zinc finger C-x8-C-x5-C-x3-H type (and similar).

TESTI20036250//TSC-22/dip/bun family//NAD dependent epimerase/dehydratase family//Adenylate kinase//ATPases associated with various cellular activities (AAA)

TESTI20037810//Eukaryotic protein kinase domain

TESTI20038940//IQ calmodulin-binding motif//IQ calmodulin-binding motif//IQ calmodulin-binding motif

TESTI20040000//short chain dehydrogenase//3-beta hydroxysteroid dehydrogenase/isomerase family

TESTI20040310//Protein of unknown function DUF84

TESTI20041220//VPR/VPX protein

TESTI20042870//ET module

TESTI20042950//3′5′-cyclic nucleotide phosphodiesterase//Peptidase family M1

TESTI20049820//Cyclic nucleotide-binding domain

TESTI20053960//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Transcription factor S-II (TFIIS)//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//TRAF-type zinc finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Phorbol esters/diacylglycerol binding domain (C1 domain)//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

TESTI20055840//PH domain//PH domain

TESTI20056900//Urease, gamma subunit//IQ calmodulin-binding motif//IQ calmodulin-binding motif

TESTI20057310//Tropomyosins

TESTI20057420//Acyl CoA binding protein//Ribosomal Proteins L2

TESTI20064830//Tetrahydrofolate dehydrogenase/cyclohydrolase

TESTI20068660//Domain of unknown function DUF19//TPR Domain//TPR Domain//TPR Domain

TESTI20068720//Zinc finger, C2H2 type//Zinc finger, C2H2 type

TESTI20074640//KRAB box//Zinc finger, C2H2 type//MYND finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

TESTI20074660//KRAB box//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//PHD-finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//MYND finger//Zinc finger, C2H2 type

TESTI20074800//Glypican

TESTI20077490//Signal peptidase (SPase) II

TESTI20078640//SCAN domain

TESTI20078720//ATP synthase B/B′ CF(0)//Ribosomal L29 protein

TESTI20079510//Immunoglobulin domain//Immunoglobulin domain//Adenovirus E3 region protein CR1//Immunoglobulin domain//Immunoglobulin domain//Fibronectin type III domain//Fibronectin type III domain

TESTI20080200//MttB family UPF0032

TESTI20080330//Ribosomal protein L14p/L23e

TESTI20083430//TPR Domain

TESTI20083870//EF hand//EF hand//EF hand//Phosphatidylinositol 3- and 4-kinases//EF hand

TESTI20086570//MAGE family

TESTI20087740//TPR Domain//TPR Domain//Outer membrane efflux protein//TPR Domain//TPR Domain

TESTI20138320//Transketolase

TESTI20140360//metallopeptidase family M24

TESTI20177400//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat

THYMU10000830//FAD binding domain

THYMU10001760//Immunoglobulin domain

THYMU10002910//Adaptin N terminal region

THYMU10003590//PH domain//RhoGAP domain

THYMU10004590//HMG (high mobility group) box

THYMU10005580//Synaptobrevin

THYMU20002360//Pumilio-family RNA binding domains (aka PUM-HD, Pumilio homology domain)

THYMU20003690//Prokaryotic DNA topoisomerase//Protein of unknown function DUF122//Eukaryotic protein kinase domain

TRACH10000740//Immunoglobulin domain//Immunoglobulin domain//Immunoglobulin domain//Immunoglobulin domain

TRACH10001250//Immunoglobulin domain//Immunoglobulin domain//Immunoglobulin domain//Immunoglobulin domain

TRACH20000150//Fatty acid desaturase//Protein phosphatase 2C

TRACH20001850//Molluscan rhodopsin C-terminal tail

TRACH20002370//KRAB box//Zinc finger, C2H2 type//FYVE zinc finger//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

TRACH20002500//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat//WD domain, G-beta repeat

TRACH20002890//PH domain//Src homology domain 2

TRACH20003930//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

TRACH20004110//Zinc finger, C2H2 type

TRACH20004200//Neurohypophysial hormones, C-terminal Domain//Keratin, high sulfur B2 protein

TRACH20004720//Aminotransferases class-II//Aminotransferases class-I

TRACH20004960//AMP-binding enzyme

TRACH20006650//LacY proton/sugar symporter//Sugar (and other) transporter

TRACH20006750//E1 Protein, N terminal domain//ATP synthase (E/31 kDa) subunit

TRACH20009260//short chain dehydrogenase

TRACH20012890//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

TRACH20016070//Adenylate cyclase

UMVEN10001220//Corticotropin-releasing factor family

UMVEN20001330//C2 domain//C2 domain//C2 domain

UTERU10001600//SCAN domain//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type//Zinc finger, C2H2 type

UTERU10001920//Integrase core domain

EXAMPLE 6 Functional Categorization Based on the Full-Length Nucleotide Sequences

The functional prediction and categorization of the proteins encoded by the clones were carried out based on the result of homology search of the databases of GenBank, Swiss-Prot, UniGene and nr (see the Homology Search Result Data) for the full-length nucleotide sequences and the result of domain search of the amino acid sequences deduced from the full-length nucleotide sequences (see Example 5).

The clone predicted to belong to the category of secretory protein/membrane protein means a clone having hit data with some annotation, such as growth factor, cytokine, hormone, signal, transmembrane, membrane, extracellular matrix, receptor, G-protein coupled receptor, ionic channel, voltage-gated channel, calcium channel, cell adhesion, collagen, connective tissue, etc., suggesting that it is a secretory or membrane protein, or means a clone in which the presence of nucleotide sequence encoding a signal sequence or transmembrane domain was suggested by the results of PSORT and SOSUI analyses for deduced ORF.

The clone predicted to belong to the category of glycoprotein-related protein means a clone having hit data with some annotation, such as glycoprotein, suggesting that the clone encodes a glycoprotein-related protein.

The clone predicted to belong to the category of signal transduction-related protein means a clone having hit data with some annotation, such as serine/threonine-protein kinase, tyrosine-protein kinase, SH3 domain, SH2 domain, etc., suggesting that the clone encodes a signal transduction-related protein.

The clone predicted to belong to the category of transcription-related protein means a clone having hit data with some annotation, such as transcription regulation, zinc finger, homeobox, etc., suggesting that the clone encodes a transcription-related protein.

The clone predicted to belong to the category of disease-related protein means a clone having hit data with some annotation, such as disease mutation, syndrome, etc., suggesting that the clone encodes a disease-related protein, or means a clone whose full-length nucleotide sequence has hit data for Swiss-Prot, GenBank, or UniGene, where the hit data corresponds to genes or proteins which have been deposited in the Online Mendelian Inheritance in Man (OMIM) (http://www.ncbi.nlm.nih.gov/Omim/), which is the human gene and disease database.

The clone predicted to belong to the category of enzyme and/or metabolism-related protein means a clone having hit data with some annotation, such as metabolism, oxidoreductase, E. C. No. (Enzyme commission number), etc., suggesting that the clone encodes an enzyme and/or metabolism-related protein.

The clone predicted to belong to the category of cell division and/or cell proliferation-related protein means a clone having hit data with some annotation, such as cell division, cell cycle, mitosis, chromosomal protein, cell growth, apoptosis, etc., suggesting that the clone encodes a cell division and/or cell proliferation-related protein.

The clone predicted to belong to the category of cytoskeleton-related protein means a clone having hit data with some annotation, such as structural protein, cytoskeleton, actin-binding, microtubles, etc., suggesting that the clone encodes a cytoskeleton-related protein.

The clone which is predicted to belong to the category of nuclear protein and/or RNA synthesis-related protein means a clone having hit data with some annotation, such as nuclear protein, RNA splicing, RNA processing, RNA helicase, polyadenylation, etc., suggesting that the clone encodes a nuclear protein and/or RNA synthesis-related protein.

The clone predicted to belong to the category of protein synthesis and/or transport-related protein means a clone having hit data with some annotation, such as translation regulation, protein biosynthesis, amino-acid biosynthesis, ribosomal protein, protein transport, signal recognition particle, etc., suggesting that the clone encodes a protein synthesis and/or transport-related protein.

The clone predicted to belong to the category of cellular defense-related protein means a clone having hit data with some annotation, such as heat shock, DNA repair, DNA damage, etc., suggesting that the clone encodes a cellular defense-related protein.

The clone predicted to belong to the category of development and/or differentiation-related proteins means a clone having hit data with some annotation, such as developmental protein, etc., suggesting that the clone encodes a development and/or differentiation-related protein.

The clone predicted to belong to the category of DNA-binding and/or RNA-binding protein means a clone having hit data with some annotation, such as DNA-binding, RNA-binding, etc.

The clone predicted to belong to the category of ATP-binding and/or GTP-binding protein means a clone having hit data with some annotation, such as ATP-binding, GTP-binding, etc.

In this functional categorization, when a single clone corresponded to multiple categories of those shown above, the clone was assigned to the multiple categories. However, the function of a protein is not restricted to the functional category in this classification, and there is the possibility that other functions are newly assigned to the protein.

The clones predicted to belong to the category of secretory protein and/or membrane protein are the following 439 clones.

3NB6910000180, 3NB6910000850, 3NB6920000290, 3NB6920003300, 3NB6920005450, 3NB6920010020, ADRGL10000180, ADRGL10001600, ADRGL20003230, BGGI120010970, BNGH410000340, BNGH410001040, BNGH410001180, BNGH410001370, BNGH410001980, BRACE10000730, BRACE10001690, BRACE20002800, BRACE20007180, BRACE20010650, BRACE20011170, BRACE20011430, BRACE20013400, BRACE20013520, BRACE20014230, BRACE20014530, BRACE20014920, BRACE20015080, BRACE20018590, BRACE20022270, BRACE20024680, BRACE20026350, BRACE20026850, BRACE20030780, BRACE20031100, BRACE20034490, BRACE20071380, BRACE20071970, BRACE20072810, BRACE20074010, BRACE20074470, BRACE20075020, BRACE20075380, BRACE20076410, BRACE20076630, BRACE20076850, BRACE20077610, BRACE20077640, BRACE20077980, BRACE20078680, BRACE20079530, BRACE20084430, BRACE20086550, BRACE20089600, BRACE20091880, BRAWH10000010, BRAWH10000370, BRAWH10000940, BRAWH10001620, BRAWH10001800, BRAWH20001090, BRAWH20004430, BRAWH20006970, BRAWH20009840, BRAWH20011290, BRAWH20011410, BRAWH20011660, BRAWH20014380, BRAWH20014840, BRAWH20015030, BRAWH20036930, BRAWH20038320, BRAWH20040950, BRAWH20052250, BRAWH20059980, BRAWH20087060, BRAWH20092610, CD34C20000510, CTONG20013660, CTONG20015330, CTONG20028160, CTONG20037820, CTONG20047160, DFNES20003350, FCBBF10006180, FCBBF10006750, FCBBF20005910, FCBBF20007330, FCBBF20008150, FCBBF20009400, FCBBF20015380, FEBRA20003780, FEBRA20004040, FEBRA20004150, FEBRA20004520, FEBRA20004910, FEBRA20006560, FEBRA20006900, FEBRA20007330, FEBRA20008090, FEBRA20008800, FEBRA20010930, FEBRA20012270, FEBRA20012450, FEBRA20012940, FEBRA20013510, FEBRA20014870, FEBRA20014920, FEBRA20015840, FEBRA20020860, FEBRA20021910, FEBRA20025250, FEBRA20031550, FEBRA20037070, FEBRA20041100, FEBRA20041910, FEBRA20057780, FEBRA20063150, FEBRA20066670, FEBRA20067930, HCASM10000610, HCASM20002020, HEART20000990, HEART20004920, HHDPC20000950, HLUNG10000240, HLUNG10000370, HLUNG10001100, HLUNG20001160, HLUNG20001250, HLUNG20001420, HLUNG20001760, HLUNG20002550, HSYRA20003470, HSYRA20006290, HSYRA20008280, HSYRA20011030, HSYRA20013320, HSYRA20014200, HSYRA20015800, IMR3210000440, IMR3210001580, IMR3210002660, IMR3220007750, IMR3220008590, IMR3220009840, IMR3220014350, KIDNE10000080, KIDNE10001040, KIDNE10001430, KIDNE20000700, KIDNE20000850, KIDNE20001670, KIDNE20003150, KIDNE20003300, KIDNE20003490, KIDNE20004220, KIDNE20005170, KIDNE20005190, KIDNE20033050, KIDNE20033570, KIDNE20039410, KIDNE20042620, KIDNE20042950, KIDNE20044110, KIDNE20048280, KIDNE20049810, KIDNE20054000, KIDNE20054770, KIDNE20060530, KIDNE20060620, KIDNE20063530, KIDNE20063760, KIDNE20066520, KIDNE20067600, KIDNE20071860, KIDNE20073520, KIDNE20074220, KIDNE20075690, LIVER10000580, LIVER10000670, LIVER10001040, LIVER10001110, LIVER10001750, LIVER10005420, LIVER20004160, MAMGL10000320, MAMGL10001840, MESAN10000350, MESAN10001470, MESAN10001800, MESAN20001490, NB9N420000420, NHNPC20002060, NT2NE10000230, NT2NE10000830, NT2NE10001630, NT2NE20003270, NT2NE20003920, NT2NE20004550, NT2NE20004700, NT2NE20005500, NT2NE20012470, NT2NE20014350, NT2NE20016260, NT2NE20034080, NT2NE20047160, NT2NE20055170, NT2NE20057200, NT2RI20005970, NT2RI20009740, NT2RI20010100, NT2RI20014490, NT2RI20015400, NT2RI20015950, NT2RI20016570, NT2RI20018660, NT2RI20020220, NT2RI20021520, NT2RI20022430, NT2RI20022520, NT2RI20025300, NT2RI20030110, NT2RI20030510, NT2RI20031540, NT2RI20033010, NT2RI20033830, NT2RI20036780, NT2RI20042840, NT2RI20044420, NT2RI20049850, NT2RI20050870, NT2RI20051500, NT2RI20066820, NT2RI20068250, NT2RI20070480, NT2RI20070840, NT2RI20073030, NT2RI20074980, NT2RI20077540, NT2RI20078270, NT2RI20080500, NT2RI20081880, NT2RI20084810, NT2RI20085980, NT2RI20089420, NT2RI20092890, NT2RI20094060, NT2RP60000320, NT2RP60000390, NT2RP60001090, NT2RP70000690, NT2RP70002380, NT2RP70002590, NT2RP70003640, NT2RP70011660, NT2RP70015910, NT2RP70021510, NT2RP70023760, NT2RP70023790, NT2RP70026190, NT2RP70029820, NT2RP70040800, NT2RP70043730, NT2RP70047900, NT2RP70049250, NT2RP70055200, NT2RP70064080, NT2RP70071540, NT2RP70071770, NT2RP70073810, NT2RP70074220, NT2RP70075040, NT2RP70076170, NT2RP70079250, NT2RP70079750, NT2RP70081330, NT2RP70081370, NT2RP70083150, NT2RP70085500, NT2RP70090120, NT2RP70091490, NT2RP70091680, NT2RP70092360, NT2RP70093220, NT2RP70093730, NT2RP70094290, NT2RP70094810, NT2RP70094980, NT2RP70095070, NTONG10000980, NTONG10002140, NTONG10002570, NTONG20002650, NTONG20004920, NTONG20008000, NTONG20012220, OCBBF10000420, OCBBF20002310, OCBBF20009980, OCBBF20012100, PANCR10000210, PLACE50000670, PLACE50000680, PLACE50001050, PLACE50001130, PLACE60012810, PLACE60018860, PLACE60020160, PLACE60020840, PLACE60026990, PLACE60037050, PLACE60037450, PLACE60043960, PLACE60044540, PLACE60047380, PLACE60049930, PLACE60050290, PROST10002200, PROST10002720, PROST10005260, PROST10005360, PROST20000360, PROST20026820, PROST20029600, PROST20032320, PROST20033020, PROST20039220, PROST20044160, PROST20051430, PROST20054260, PROST20058800, PROST20059190, PROST20059430, PROST20069880, PROST20072370, PROST20073890, PUAEN10000570, PUAEN10003220, SALGL10001570, SKMUS20007740, SKNMC10000190, SKNMC10000290, SKNMC10002290, SKNMC10002510, SKNMC20011130, SKNMC20015030, SMINT10000160, SMINT10000420, SMINT10000570, SMINT10001180, SMINT20000180, SMINT20002770, SPLEN10000910, SPLEN20001340, SPLEN20002430, SPLEN20002700, SPLEN20003100, SPLEN20004960, STOMA10000520, STOMA10001170, STOMA20000320, STOMA20002570, SYNOV20001770, SYNOV20016480, TESTI10000420, TESTI10000960, TESTI10001270, TESTI10001380, TESTI20001770, TESTI20006000, TESTI20007620, TESTI20008830, TESTI20009090, TESTI20009700, TESTI20011340, TESTI20012370, TESTI20013520, TESTI20014200, TESTI20016210, TESTI20016710, TESTI20018520, TESTI20018620, TESTI20020020, TESTI20020810, TESTI20022510, TESTI20024230, TESTI20024650, TESTI20024670, TESTI20025800, TESTI20026320, TESTI20026980, TESTI20027000, TESTI20027070, TESTI20028660, TESTI20030370, TESTI20031930, TESTI20034190, TESTI20036490, TESTI20039980, TESTI20042870, TESTI20047120, TESTI20049940, TESTI20056900, TESTI20057420, TESTI20058600, TESTI20067740, TESTI20069780, TESTI20074800, TESTI20077490, TESTI20079510, TESTI20080200, TESTI20081440, TESTI20087740, TESTI20088470, TESTI20136910, THYMU10000830, THYMU10001760, THYMU10003290, THYMU10003820, THYMU10005580, TRACH10000630, TRACH10001000, TRACH10001400, TRACH20001850, TRACH20001960, TRACH20004200, TRACH20004960, TRACH20006650, TRACH20007670, TRACH20008980, TRACH20015920, UMVEN20001330, UTERU10000770, UTERU10000960, UTERU10001920, UTERU20000470, UTERU20003930, UTERU20004850

The clones predicted to belong to the category of glycoprotein-related protein are the following 87 clones.

BNGH410000340, BNGH410001180, BRACE20014920, BRACE20015080, BRACE20018590, BRACE20024680, BRACE20026350, BRACE20031100, BRACE20074470, BRAWH10000370, BRAWH20001090, BRAWH20011660, BRAWH20014840, BRAWH20059980, CD34C20000510, CTONG20013660, CTONG20028160, CTONG20037820, FCBBF20007330, FEBRA20007330, FEBRA20008800, FEBRA20014920, FEBRA20015840, FEBRA20057780, HEART20005060, HLUNG10001100, HLUNG20002550, HSYRA20013320, IMR3210002660, IMR3220007750, IMR3220013320, KIDNE20044110, KIDNE20063760, KIDNE20067600, KIDNE20073520, LIVER20000370, MESAN10000350, NT2NE10000830, NT2NE10001850, NT2NE20003270, NT2NE20016260, NT2RI20018660, NT2RI20025300, NT2RI20036780, NT2RI20077540, NT2RI20080500, NT2RI20085980, NT2RI20089420, NT2RI20092890, NT2RP70000690, NT2RP70004770, NT2RP70055200, NT2RP70081370, NT2RP70083150, NT2RP70091490, NT2RP70092360, NT2RP70094980, NTONG10002140, OCBBF20002310, OCBBF20002770, PLACE50000680, PLACE50001130, PLACE60018860, PLACE60044540, PROST20018230, PROST20032320, PROST20073890, SALGL10001570, SKNMC20015030, SMINT10000160, SMINT20002770, SPLEN20001340, TESTI10001270, TESTI10001380, TESTI20001770, TESTI20024230, TESTI20027070, TESTI20036490, TESTI20039980, TESTI20056900, TESTI20057420, TESTI20079510, THYMU10001760, TRACH10000740, TRACH10001250, TRACH20004200, UTERU20000470

The clones predicted to belong to the category of signal transduction-related protein are the following 46 clones.

ADRGL20000740, ASTRO10000180, BRACE20005770, BRACE20022020, BRACE20027360, BRACE20027920, BRAWH20006860, CTONG20005890, FEBRA20000350, HHDPC20000550, IMR3220003020, KIDNE20033730, KIDNE20040840, KIDNE20053360, KIDNE20062990, NT2RI20033440, NT2RI20058110, NT2RI20062100, NT2RI20073840, NT2RP70006240, NT2RP70043960, NT2RP70046870, NT2RP70061880, NT2RP70072520, NT2RP70081440, NT2RP70093700, NTONG10001820, PEBLM20004790, PLACE60026680, PROST20033400, PROST20043320, SKMUS10000220, SKMUS20016680, SPLEN20003570, TESTI20001540, TESTI20005910, TESTI20022560, TESTI20024980, TESTI20029120, TESTI20034980, TESTI20049820, TESTI20055840, THYMU10003590, THYMU20003690, TRACH20002500, TRACH20002890

The clones predicted to belong to the category of transcription-related protein are the following 140 clones.

3NB6920010220, 3NB6920015110, 3NB6920015570, ADRGL10000650, BGGI120006840, BGGI120006930, BGGI120017140, BNGH410000800, BNGH420005320, BRACE10000930, BRACE20014550, BRACE20018550, BRACE20020910, BRACE20024090, BRACE20071740, BRAWH10000020, BRAWH10001640, BRAWH10001680, BRAWH20006330, BRAWH20009010, CTONG20025580, CTONG20028200, FCBBF10005980, FCBBF20000940, FCBBF20009510, FCBBF50002610, FEBRA20003970, FEBRA20003990, FEBRA20004540, FEBRA20009720, FEBRA20011460, FEBRA20017150, FEBRA20050140, FEBRA20064760, FEBRA20067360, FEBRA20069420, FEBRA20072800, HLUNG10000760, HLUNG20000680, HSYRA10001370, HSYRA20016310, IMR3210002420, IMR3220007420, KIDNE20000510, KIDNE20039940, KIDNE20061490, KIDNE20078110, NESOP10000870, NHNPC10001240, NHNPC20002120, NT2NE20002590, NT2NE20008090, NT2RI20003410, NT2RI20004120, NT2RI20004210, NT2RI20010830, NT2RI20018460, NT2RI20025410, NT2RI20025850, NT2RI20060710, NT2RI20067350, NT2RI20071330, NT2RI20074390, NT2RI20078790, NT2RI20087140, NT2RI20090650, NT2RI20092150, NT2RP60001000, NT2RP60001270, NT2RP70002710, NT2RP70008120, NT2RP70018560, NT2RP70024500, NT2RP70032030, NT2RP70036290, NT2RP70042040, NT2RP70045410, NT2RP70046560, NT2RP70055130, NT2RP70061620, NT2RP70062960, NT2RP70064900, NT2RP70069860, NT2RP70075370, NT2RP70085570, NT2RP70087200, NT2RP70090190, NTONG20003340, NTONG20003630, NTONG20015500, OCBBF20011010, OCBBF20011240, OCBBF20015860, PEBLM20002480, PEBLM20002700, PEBLM20003080, PEBLM20003950, PLACE60002050, PLACE60005550, PLACE60021510, PLACE60030380, PROST20018230, PROST20031170, PROST20073170, PUAEN10001610, SALGL10000650, SKMUS10000640, SKMUS20014920, SKNMC20000650, SKNMC20002240, SKNMC20003560, SMINT10001000, SMINT20005450, SPLEN20000200, SPLEN20000720, SYNOV20010140, SYNOV20013740, SYNOV20014510, TESTI10000550, TESTI20001200, TESTI20007070, TESTI20010490, TESTI20015560, TESTI20018150, TESTI20018790, TESTI20021490, TESTI20026760, TESTI20027890, TESTI20030710, TESTI20034130, TESTI20042290, TESTI20053960, TESTI20074640, TESTI20074660, TESTI20078640, THYMU10004590, TRACH20000790, TRACH20002370, TRACH20009440, UTERU10001600

The clones predicted to belong to the category of disease-related protein are the following 219 clones. Further, hit data of all the clones for Swiss-Prot, or GenBank, UniGene, or nr corresponded to genes or proteins which had been deposited in the Online Mendelian Inheritance in Man (OMIM), which is the human gene and disease database, (the OMIM Number is shown in the parenthesis after the Clone Name).

ADRGL10000020 (605332), ADRGL10001600 (201910), ADRGL20000740 (300118), ASTRO20004170 (605937), BGGI120006840 (604480), BGGI120010970 (602346), BGGI120017140 (194631), BNGH410001770 (146690), BNGH420005320 (601260), BRACE10001870 (157132), BRACE20006980 (106410), BRACE20007180 (114160), BRACE20014550 (140580), BRACE20018550 (109560), BRACE20018590 (602644), BRACE20027550 (179715), BRACE20027720 (138760), BRACE20076850 (605209), BRACE20086550 (603540), BRAWH10000020 (605678), BRAWH10001640 (606043), BRAWH20001770 (138450), BRAWH20005030 (179715), BRAWH20005220 (603747), BRAWH20006330 (194500), BRAWH20006860 (602958), BRAWH20009840 (601258), BRAWH20011660 (230500; 230600; 230650; 253010), CD34C20000510 (600031), CTONG20005890 (603583), CTONG20019110 (603486), CTONG20024180 (602895), CTONG20025580 (601856), CTONG20037820 (602729), CTONG20055530 (106410), FCBBF20000940 (601408), FCBBF20009510 (194531), FCBBF40002820 (130410), FEBRA20001050 (600025), FEBRA20003990 (601781), FEBRA20004150 (126650; 214700), FEBRA20004540 (194558), FEBRA20009720 (602277), FEBRA20010930 (603878), FEBRA20011460 (603900), FEBRA20050790 (176879), FEBRA20057880 (604362), FEBRA20064760 (602277), FEBRA20067930 (602921), FEBRA20070170 (606098), FEBRA20075510 (179513), FEBRA20075660 (179715), HCASM20002140 (123834), HEART20004480 (191045; 115195), HLUNG10001050 (310400), HLUNG20000680 (300024), HSYRA10001370 (602277), HSYRA20006400 (601278), HSYRA20013320 (146732), HSYRA20016310 (604080), IMR3210000440 (601890), IMR3220007910 (313440), KIDNE10001040 (603217), KIDNE20003150 (602417), KIDNE20033730 (605216), KIDNE20042950 (120160), KIDNE20044110 (605239), KIDNE20050420 (214500), KIDNE20059080 (604276), KIDNE20063760 (231950), KIDNE20078110 (603430), LIVER10002300 (161015), LIVER10004330 (603197), LIVER20000330 (191161), LIVER20000370 (138670), MAMGL10001780 (603403), MESAN10001800 (606048), MESAN20002910 (142810), MESAN20005010 (602769), NB9N410001350 (179508), NHNPC10000840 (604819), NHNPC20002120 (194558), NT2NE10000730 (601905), NT2NE20002990 (147625), NT2NE20003690 (232000), NT2NE20005170 (603330), NT2NE20005360 (150370), NT2NE20006580 (605969), NT2NE20008090 (603899), NT2NE20013720 (180480), NT2NE20016340 (602184), NT2NE20055170 (128100), NT2RI20004120 (600140), NT2RI20004210 (314997), NT2RI20010910 (601940), NT2RI20014500 (190370), NT2RI20020410 (168730; 180990), NT2RI20029580 (605689), NT2RI20031540 (300061), NT2RI20033440 (601014), NT2RI20041900 (179715), NT2RI20056470 (123940), NT2RI20057230 (601940), NT2RI20067030 (603577), NT2RI20070960 (311030), NT2RI20074980 (603105), NT2RI20077540 (300112), NT2RI20080500 (142461), NT2RI20083960 (605612), NT2RI20084810 (603099), NT2RI20092150 (600834), NT2RI20092890 (603104), NT2RP60000350 (605612), NT2RP60001000 (314995), NT2RP60001230 (600025), NT2RP70000690 (158340; 113720), NT2RP70004250 (160776), NT2RP70028750 (179838), NT2RP70029060 (140571), NT2RP70032030 (602277), NT2RP70036290 (600005; 209920), NT2RP70042600 (160776), NT2RP70046560 (602410), NT2RP70049250 (601703), NT2RP70055020 (604581), NT2RP70062960 (133540), NT2RP70063040 (604061), NT2RP70065270 (300111), NT2RP70069860 (602277), NT2RP70071770 (603046), NT2RP70073810 (601439), NT2RP70074220 (313440), NT2RP70075370 (109092), NT2RP70079250 (602346), NT2RP70081440 (601335), NT2RP70090120 (602727), NT2RP70090190 (194558), NT2RP70093220 (300008; 300009; 310468), NT2RP70094980 (135820), NTONG10002460 (600856), NTONG20003630 (600140), NTONG20015500 (604077), OCBBF10001180 (191161), OCBBF20008240 (187790), PEBLM10000340 (133450), PEBLM20002480 (300024), PEBLM20003080 (604077), PEBLM20003950 (600834), PLACE50000800 (601797), PLACE60002050 (600013), PLACE60003790 (603403), PLACE60014430 (603707), PROST10001670 (313440), PROST10005360 (602346), PROST20002730 (601985; 188550), PROST20032320 (253220), PROST20033400 (300203), PROST20062600 (601940), PROST20072890 (191161), PROST20073890 (192240), PROST20085160 (191030; 164970), SALGL10001570 (603743), SKMUS10000140 (191340), SKMUS10001180 (601402), SKMUS10001290 (604055), SKMUS20000740 (605196), SKMUS20003900 (604850), SKMUS20007240 (604300), SKMUS20016340 (163906), SKNMC10002510 (605452), SKNMC20000650 (604078), SKNMC20003220 (117140), SMINT10000420 (601615), SMINT10000570 (604814), SMINT10001000 (603851), SMINT10001030 (605759), SMINT20004000 (601278), SPLEN10001430 (163905), SPLEN20001970 (601940), STOMA20000880 (147220), STOMA20003960 (300111), SYNOV20013740 (604076), SYNOV20014510 (600661), SYNOV20016480 (131222; 603041), TESTI10001270 (601313; 173900), TESTI10001310 (186982), TESTI20001200 (194510), TESTI20001770 (146650), TESTI20002530 (605440), TESTI20006000 (179838), TESTI20006990 (602591), TESTI20007620 (126650; 214700), TESTI20008830 (160794), TESTI20011800 (190370), TESTI20012690 (109720), TESTI20015120 (604700), TESTI20018520 (602346), TESTI20018790 (300024), TESTI20021490 (604073), TESTI20025160 (300097), TESTI20027070 (173335), TESTI20027290 (300127), TESTI20029120 (600855), TESTI20033250 (168730), TESTI20049820 (176894), TESTI20053960 (604074), TESTI20068660 (603395), TESTI20071830 (605769), TESTI20074640 (603899), TESTI20079510 (116930), TESTI20086570 (300153), TESTI20140360 (170100), THYMU10000830 (600857), THYMU10001760 (116930), THYMU10003590 (602857), THYMU10004910 (604908), TRACH20002370 (602277), UTERU10000960 (603931), UTERU20000470 (602070)

The clones predicted to belong to the category of enzyme and/or metabolism-related protein are the following 168 clones.

3NB6920002810, ADRGL10001600, ADRGL10001650, BGGI120005330, BNGH410000340, BNGH410001770, BRACE10000420, BRACE20015080, BRACE20022020, BRACE20024680, BRACE20026850, BRACE20027360, BRACE20027720, BRACE20027920, BRACE20071380, BRACE20084430, BRAWH20001770, BRAWH20006510, BRAWH20006860, BRAWH20009840, BRAWH20011660, BRAWH20014180, BRAWH20014840, BRAWH20036890, BRAWH20059980, BRAWH20069890, BRAWH20089560, CTONG20013660, CTONG20019110, DFNES20002120, FCBBF20007330, FCBBF20015380, FEBRA20000350, FEBRA20001290, FEBRA20003110, FEBRA20024420, FEBRA20041100, FEBRA20045920, FEBRA20050790, FEBRA20052160, FEBRA20062700, FEBRA20063150, HEART20000350, HHDPC20000550, HHDPC20004550, HLUNG10001050, HLUNG20002550, HSYRA10001680, HSYRA20005100, HSYRA20015740, IMR3220008380, IMR3220009190, IMR3220012180, IMR3220013170, KIDNE20000410, KIDNE20003490, KIDNE20004220, KIDNE20005130, KIDNE20033050, KIDNE20040840, KIDNE20046810, KIDNE20056290, KIDNE20060530, KIDNE20063760, KIDNE20068800, KIDNE20073280, KIDNE20073520, KIDNE20078100, LIVER10000670, LIVER10002300, MAMGL10001780, MESAN20002910, MESAN20005010, NT2NE10000730, NT2NE10001850, NT2NE20002140, NT2NE20003270, NT2NE20003690, NT2NE20005860, NT2NE20013720, NT2NE20016340, NT2NE20016660, NT2RI10000480, NT2RI20010100, NT2RI20015400, NT2RI20020220, NT2RI20025300, NT2RI20033010, NT2RI20036780, NT2RI20037510, NT2RI20051500, NT2RI20068550, NT2RI20073840, NT2RI20074980, NT2RI20084810, NT2RI20087910, NT2RP70004770, NT2RP70006240, NT2RP70011660, NT2RP70026190, NT2RP70062960, NT2RP70072520, NT2RP70076100, NT2RP70081440, NT2RP70084060, NT2RP70085570, NT2RP70093700, NTONG10001820, OCBBF20008240, OCBBF20012100, OCBBF20014080, OCBBF20014940, PANCR10000210, PEBLM20004790, PLACE50001050, PLACE50001130, PLACE60003790, PLACE60012810, PLACE60018860, PLACE60044540, PROST20031170, PROST20032320, PROST20033400, PROST20051210, PROST20064500, SKMUS10001290, SKMUS10001770, SKMUS20000740, SKMUS20007240, SKMUS20008630, SKMUS20009330, SKMUS20011290, SKNSH10001740, SKNSH20003470, SMINT10000160, SPLEN20001340, STOMA10001860, STOMA20001210, STOMA20004820, SYNOV20016480, TESTI10000700, TESTI10001380, TESTI20001540, TESTI20005910, TESTI20012690, TESTI20018270, TESTI20022560, TESTI20027070, TESTI20029120, TESTI20034190, TESTI20034980, TESTI20040000, TESTI20042070, TESTI20042950, TESTI20047120, TESTI20049820, TESTI20138320, TESTI20140360, TESTI30000020, THYMU10000830, THYMU10004910, THYMU20003170, THYMU20003690, TRACH20000150, TRACH20004720, TRACH20004970, TRACH20009260, UTERU10000960

The clones predicted to belong to the category of cell division and/or cell proliferation-related protein are the following 23 clones.

BGGI120001610, BRACE20027550, BRACE20076850, BRAWH20005030, BRAWH20005220, FEBRA20075660, HCASM20002140, HLUNG10000640, IMR3220009730, NT2NE20003840, NT2RI20006850, NT2RI20041900, NT2RI20058110, NTONG10002460, NTONG20008780, SKMUS20016340, SKNMC20003220, SPLEN10001430, TESTI10001680, TESTI20001840, TESTI20021050, TESTI20035120, TESTI20057310

The clones predicted to belong to the category of cytoskeleton-related protein are the following 60 clones.

ADRGL10000020, BRACE20006980, BRACE20008850, BRACE20027960, BRACE20074470, BRACE20076630, BRACE20078820, BRACE20093070, BRAWH20000480, BRAWH20066220, CTONG20019550, CTONG20028160, CTONG20055530, DFNES20002680, FCBBF20005910, FEBRA20007720, FEBRA20008810, FEBRA20034290, FEBRA20043290, FEBRA20072000, HEART20004480, HEART20005200, HLUNG10001100, HSYRA20006050, IMR3220007910, KIDNE20040840, KIDNE20052960, NT2RI20014090, NT2RI20032220, NT2RI20058510, NT2RI20090660, NT2RP70000690, NT2RP70004250, NT2RP70028750, NT2RP70042600, NT2RP70049250, NT2RP70074220, NTONG20009660, OCBBF20011760, OCBBF20015280, PEBLM10000680, PROST10001670, PROST20033380, TESTI10000420, TESTI10000510, TESTI20003560, TESTI20004350, TESTI20006000, TESTI20006990, TESTI20008490, TESTI20008830, TESTI20011410, TESTI20015110, TESTI20016610, TESTI20020570, TESTI20024230, TESTI20031090, TESTI20031170, TESTI20039140, TESTI20078720

The clones predicted to belong to the category of nuclear protein and/or RNA synthesis-related protein are the following 59 clones.

3NB6920002810, 3NB6920015280, BGGI120005440, BRACE10001150, BRACE20024780, BRACE20027550, BRAWH20005030, BRAWH20014180, BRAWH20069890, CTONG20024180, FEBRA20001290, FEBRA20075660, HEART20003090, HLUNG10000640, HSYRA10001680, HSYRA20005100, IMR3220008630, IMR3220012180, MAMGL10001780, NT2NE10001850, NT2NE20002140, NT2NE20003840, NT2NE20016660, NT2NE20054410, NT2RI20002820, NT2RI20006850, NT2RI20010910, NT2RI20025540, NT2RI20041900, NT2RI20053350, NT2RI20057230, NT2RI20060720, NT2RI20067030, NT2RI20068550, NT2RI20078840, NT2RI20087490, NT2RP70004770, NT2RP70013060, NT2RP70076430, NTONG20008780, PEBLM10000340, PLACE50000580, PLACE60003790, PROST20001760, PROST20062600, SKMUS10000220, SKMUS20016340, SKNMC20003220, SPLEN10001430, SPLEN20001970, TESTI10001680, TESTI20002530, TESTI20007840, TESTI20021050, TESTI20029120, TESTI20035120, TESTI20057310, TRACH20003930, TRACH20012890

The clones predicted to belong to the category of protein synthesis and/or transport-related protein are the following 24 clones.

BRACE20078680, FEBRA20075510, IMR3220008380, KIDNE20005190, KIDNE20050420, MESAN20002910, NB9N410001350, NT2NE20005360, NT2RI20032050, NT2RI20032220, NT2RP70000760, NT2RP70076430, NT2RP70093940, OCBBF20008240, PLACE50000580, PROST20000530, SKMUS20000740, SKMUS20008630, TESTI20007840, TESTI20015120, TESTI20018690, TESTI20078720, THYMU10005580, UMVEN20001330

The clones predicted to belong to the category of cellular defense-related protein are the following 6 clones.

BRACE20014550, NT2RI20037510, NT2RI20053350, NT2RP70029060, NT2RP70062960, PLACE50001700

The clones predicted to belong to the category of development and/or differentiation-related protein are the following 19 clones.

BGGI120006930, CTONG20028200, FCBBF50002610, FEBRA20014920, FEBRA20017150, FEBRA20060920, MAMGL10001820, NESOP10000870, NHNPC10001240, NT2RI20078790, NT2RP70008120, NT2RP70018560, NT2RP70045410, OCBBF20002770, SALGL10000650, SMINT10001000, TESTI10000550, TESTI20026760, TESTI20078140

The clones predicted to belong to the category of DNA-binding and/or RNA-binding protein are the following 158 clones.

3NB6920002810, 3NB6920010220, 3NB6920015110, 3NB6920015570, ADRGL10000650, BGGI120006840, BGGI120006930, BNGH410000800, BNGH420005320, BRACE20014550, BRACE20020910, BRACE20024090, BRACE20024780, BRACE20071740, BRAWH10001640, BRAWH10001680, BRAWH20000340, BRAWH20006330, BRAWH20009010, BRAWH20014180, BRAWH20069890, CTONG20025580, CTONG20028200, D3OST20001840, FCBBF10005980, FCBBF20009510, FCBBF50002610, FEBRA20003970, FEBRA20003990, FEBRA20004540, FEBRA20008560, FEBRA20009720, FEBRA20017150, FEBRA20017900, FEBRA20050140, FEBRA20064760, FEBRA20067360, FEBRA20069420, FEBRA20072800, HEART20003090, HLUNG10000760, HSYRA10001370, HSYRA20016310, IMR3210002420, IMR3220007420, IMR3220008630, KIDNE20000510, KIDNE20039940, KIDNE20061490, KIDNE20078110, NESOP10000870, NHNPC10000840, NHNPC10001240, NHNPC20002120, NT2NE20002590, NT2NE20003840, NT2NE20008090, NT2NE20016660, NT2NE20054410, NT2RI20003410, NT2RI20004210, NT2RI20006850, NT2RI20010830, NT2RI20010910, NT2RI20025410, NT2RI20025850, NT2RI20057230, NT2RI20060710, NT2RI20067350, NT2RI20071330, NT2RI20074390, NT2RI20078790, NT2RI20078840, NT2RI20087140, NT2RI20087490, NT2RI20090650, NT2RP60001000, NT2RP60001270, NT2RP70002710, NT2RP70008120, NT2RP70013060, NT2RP70018560, NT2RP70024500, NT2RP70032030, NT2RP70042040, NT2RP70045410, NT2RP70046560, NT2RP70055130, NT2RP70061620, NT2RP70062960, NT2RP70064900, NT2RP70069860, NT2RP70075370, NT2RP70081670, NT2RP70085570, NT2RP70087200, NT2RP70090190, NTONG20003340, NTONG20008780, NTONG20015500, OCBBF20011010, OCBBF20015860, PEBLM10000340, PEBLM20001120, PEBLM20002700, PEBLM20003080, PLACE60002050, PLACE60005550, PLACE60021510, PLACE60030380, PROST20001760, PROST20003250, PROST20018230, PROST20031170, PROST20062600, PROST20073170, SALGL10000650, SKMUS10000640, SKMUS20014920, SKMUS20016340, SKNMC20000650, SKNMC20002240, SKNMC20003220, SKNMC20003560, SMINT10001000, SMINT20005450, SPLEN10001430, SPLEN20000200, SPLEN20000720, SPLEN20001970, SYNOV20010140, SYNOV20013740, SYNOV20014510, TESTI10000550, TESTI20001200, TESTI20007070, TESTI20010490, TESTI20013450, TESTI20015560, TESTI20018150, TESTI20021050, TESTI20021490, TESTI20026760, TESTI20027890, TESTI20030710, TESTI20033270, TESTI20034130, TESTI20035120, TESTI20053960, TESTI20074640, TESTI20074660, TESTI20078640, THYMU10004590, TRACH20000790, TRACH20002370, TRACH20009440, TRACH20012890, UTERU10001600

The clones predicted to belong to the category of ATP binding and/or GTP-binding protein are the following 63 clones.

3NB6920002810, BNGH410000390, BRACE20022020, BRACE20028120, BRACE20071380, BRAWH20000480, BRAWH20006860, BRAWH20066220, CTONG20013200, DFNES20002680, FEBRA20043290, FEBRA20052160, FEBRA20072000, FEBRA20075510, HHDPC20000550, HLUNG20001160, HSYRA10001680, HSYRA20005100, HSYRA20006050, KIDNE20040840, MAMGL10001780, MESAN20002910, NB9N410001350, NT2NE20003690, NT2NE20005170, NT2NE20016660, NT2NE20055170, NT2RI20068550, NT2RI20073840, NT2RP70004250, NT2RP70011660, NT2RP70029060, NT2RP70036290, NT2RP70042600, NT2RP70046870, NT2RP70062960, NT2RP70081370, NT2RP70081440, NT2RP70093700, OCBBF20008240, OCBBF20015280, PEBLM20004790, PLACE50001700, PLACE60003790, PROST20018990, PROST20033400, SKMUS20008630, SMINT10000420, TESTI20001540, TESTI20003560, TESTI20005910, TESTI20006950, TESTI20006990, TESTI20008490, TESTI20015110, TESTI20016610, TESTI20022560, TESTI20029120, TESTI20034980, TESTI20042290, TESTI20047120, TESTI20049820, TESTI20057310

Among the clones other than the ones shown above, NTONG10001300 is a clone which was predicted to highly possibly belong to the category of secretory protein and/or membrane protein based on the result of domain search by Pfam.

FEBRA20017060, NT2RI20066790, SMINT10000710

The three clones shown above are clones which were predicted to highly possibly belong to the category of glycoprotein-related protein based on the result of domain search by Pfam.

BRACE20080970, BRACE20092120, BRAWH10001300, FEBRA20019890, KIDNE20031850, KIDNE20060140, MESAN20000920, NB9N410000470, NT2RI20071480, NT2RI20078910, NT2RP70088550, NTONG20016120, OCBBF10000910, PROST20094830, SKNSH10003010, SPLEN20002670, TESTI20031960, TESTI20036250, TESTI20037810, TESTI20083870, TESTI20177400

The 21 clones shown above are clones which were predicted to highly possibly belong to the category of signal transduction-related protein based on the result of domain search by Pfam.

3NB6920009120, 3NB6920014710, BRACE10001660, BRACE20083850, BRAWH20004760, BRAWH20012030, CTONG20011390, CTONG20018200, FEBRA20007870, FEBRA20043250, HHDPC20003150, NT2RI10000270, NT2RI20036950, NT2RI20053680, NT2RI20072540, NT2RI20083360, NT2RP70030550, OCBBF20013070, OCBBF20015270, PLACE60046630, PROST10003430, PROST20067370, SKMUS10001040, SKNMC20015960, TESTI20030050, TESTI20033540, TESTI20035890, TESTI20068720, TRACH20004110

The 29 clones shown above are clones which were predicted to highly possibly belong to the category of transcription-related protein based on the result of domain search by Pfam.

BNGH410001900, BRACE20080970, BRACE20092120, BRAWH20093600, FEBRA20003770, FEBRA20024290, HLUNG10000990, KIDNE20004030, MESAN20000920, NB9N420001040, NT2NE10000140, NT2NE20001740, NT2RI20050610, NT2RI20055640, NT2RI20072540, NT2RI20074690, NT2RP60000860, NT2RP70036470, NT2RP70036800, NT2RP70072210, NT2RP70074060, NT2RP70084870, NTONG10001300, NTONG10002640, NTONG20016120, OCBBF10000910, OCBBF10001190, OCBBF20007190, SKMUS20001170, SKMUS20016620, SKNMC20000970, SKNMC20015960, SYNOV10001280, TESTI20002380, TESTI20006270, TESTI20013300, TESTI20031520, TESTI20036250, TESTI20037810, TESTI20064830, TESTI20083870, TRACH20006750, TRACH20016070

The 43 clones shown above are clones which were predicted to highly possibly belong to the category of enzyme and/or metabolism-related protein based on the result of domain search by Pfam.

NT2RI20064120

The clone shown above is a clone which were predicted to highly possibly belong to the category of cell division and/or cell proliferation-related protein based on the result of domain search by Pfam.

BRACE20083800, KIDNE20004970

The two clones shown above are clones which were predicted to highly possibly belong to the category of cytoskeleton-related protein based on the result of domain search by Pfam.

3NB6920009120, 3NB6920014710, BRACE10001660, BRACE20083850, BRAWH20004760, BRAWH20012030, BRAWH20064500, CTONG20011390, CTONG20018200, FEBRA20007870, FEBRA20043250, HCASM20003070, HHDPC20003150, NT2RI10000270, NT2RI20036950, NT2RI20053680, NT2RI20072540, NT2RI20083360, NT2RP70012310, NT2RP70030550, NT2RP70036470, OCBBF20013070, OCBBF20015270, PLACE60046630, PROST10003430, PROST20067370, SKMUS10001040, SKNMC20000970, SKNMC20015960, TESTI20030050, TESTI20032280, TESTI20033540, TESTI20035890, TESTI20068720, TRACH20004110

The 34 clones shown above are clones which were predicted to highly possibly belong to the category of DNA-binding and/or RNA-binding protein based on the result of domain search by Pfam.

NT2RI20064120

The clone shown above is a clone which was predicted to highly possibly belong to the category of ATP-binding and/or GTP-binding protein based on the result of domain search by Pfam.

The 178 clones shown below are clones which were unassignable to any of the above-mentioned categories, but have been predicted to have some functions based on homology search for their full-length nucleotide sequences and motif search in their deduced ORFs. Clone Name, Definition in the result of homology search or Motif Name in the motif search, demarcated by a double slash mark (//), are shown below.

3NB6910001160//STEROIDOGENIC ACUTE REGULATORY PROTEIN PRECURSOR.

3NB6910001290//KRAB box

3NB6910001730//RI01/ZK632.3/MJ0444 family

3NB6920014330//Domain of unknown function

ASTRO20000950//SNAP-25 family

BNGH410000030//R. norvegicus trg mRNA.

BNGH410000290//SPRY domain

BRACE20005250//DRR1 PROTEIN (TU3A PROTEIN).

BRACE20005650//ATP synthase ab C terminal

BRACE20013750//Hepatitis C virus non-structural protein NS4a

BRACE20014770//HUNTINGTIN ASSOCIATED PROTEIN 1 (HAP1).

BRACE20016730//Mus musculus mdgl-1 mRNA, complete cds.

BRACE20017370//P. vivax pva1 gene.

BRACE20019440//Protein of unknown function DUF82

BRACE20024310//P53-INDUCED PROTEIN 11.

BRACE20028960//Mus musculus mRNA for Ca2+ dependent activator protein for secretion, complete cds.

BRACE20077840//Putative Protein that mediates attachment of autophagosomes to microtubules, by similarity to yeast aut2 [Schizosaccharomyces pombe].

BRACE20093610//Bacterial type II secretion system protein

BRAWH20003230//Proline rich protein

BRAWH20009440//Arabidopsis thaliana pollenless3 (178) gene, complete cds;

beta-9 tubulin (TUB9) gene, partial cds; and unknown gene.

BRAWH20014610//TS-N domain//UBA domain

BRAWH20060440//PPR repeat

BRAWH20076050//LORICRIN.

CTONG20027210//VACUOLAR PROTEIN SORTING-ASSOCIATED PROTEIN VPS13.

CTONG20028030//Domain of unknown function DUF19//Ribosomal protein S18

CTONG20064490//Drosophila melanogaster 26S proteasome regulatory complex subunit p42A mRNA, complete cds.

DFNES20004320//Homo sapiens ubiquitous TPR-motif protein Y isoform (UTY) gene, partial cds; alternatively spliced.

FCBBF10006870//Mus musculus Rap2 interacting protein 8 (RPIP8) mRNA, complete cds.

FCBBF20002320//T-box

FCBBF20002760//ALPHA SCRUIN.

FCBBF20012110//Leishmania major partial ppg1 gene for proteophosphoglycan.

FCBBF20016720//Domain of unknown function DUF94

FEBRA20000530//Drosophila melanogaster Diablo (dbo) mRNA, complete cds.

FEBRA20005360//Homo sapiens paraneoplastic cancer-testis-brain antigen (MA5) mRNA, complete cds.

FEBRA20007570//Homo sapiens BM-009 mRNA, complete cds.

FEBRA20011330//26S PROTEASOME REGULATORY SUBUNIT S3 (PROTEASOME SUBUNIT P58).

FEBRA20030540//Halocynthia roretzi mRNA for HrPET-1, complete cds.

FEBRA20044900//R. norvegicus mRNA for CPG2 protein.

FEBRA20048180//DRR1 PROTEIN (TU3A PROTEIN).

FEBRA20053800//Homo sapiens ubiquitous TPR-motif protein Y isoform (UTY) gene, partial cds; alternatively spliced.

FEBRA20057260//TBC domain

FEBRA20068730//Trg protein

HCASM10000210//Plasmodium berghei strain NYU2 merozoite surface protein-1 mRNA, partial cds.

HCASM20005360//Macrophage migration inhibitory factor

HEART20004110//POT family

HEART20005680//Nerve growth factor family

HHDPC20001150//Mus musculus putative secreted protein ZSIG37 (Zsig37) mRNA, complete cds.

HHDPC20001490//Mus musculus partial mRNA for muscle protein 534 (mg534 gene).

HHDPC20004560//2S seed storage family

HHDPC20004620//FAD binding domain

HSYRA10001190//PROBABLE GYP7 PROTEIN (FRAGMENT).

HSYRA10001780//Alpha-2-macroglobulin family N-terminal region

HSYRA20001350//CELL POLARITY PROTEIN TEA1.

HSYRA20014760//von Willebrand factor type A domain

HSYRA20016210//HesB-like domain

IMR3220002230//HINT PROTEIN (PROTEIN KINASE C INHIBITOR 1) (PKCI-1) (17 KD INHIBITOR OF PROTEIN KINASE C).

IMR3220014910//Rattus norvegicus tricarboxylate carrier-like protein mRNA, complete cds.

KIDNE10001520//Mus musculus yolk sac permease-like molecule 1 (YSPL-1) mRNA, complete cds.

KIDNE20003750//Mus musculus mRNA for granuphilin-a, complete cds.

KIDNE20005740//Staphylococcus epidermidis putative cell-surface adhesin SdrF (sdrF) gene, complete cds.

KIDNE20043440//Vacuolar protein sorting-associated protein—fission yeast

KIDNE20056760//NEURONAL PROTEIN.

KIDNE20060300//Gallus gallus syndesmos mRNA, complete cds.

KIDNE20062480//Scorpion short toxins

KIDNE20067750//Homo sapiens PTOV1 (PTOV1) gene, complete cds.

LIVER10000790//Rattus norvegicus fertility related protein WMP1 mRNA, complete cds.

MAMGL10000560//K-box region

MESAN10001010//Rat trg gene product

NB9N420004950//PROBABLE NUCLEAR ANTIGEN.

NT2NE10000180//SUPPRESSOR PROTEIN SRP40.

NT2NE10000630//Gallus gallus Dach2 protein (Dach2) mRNA, complete cds.

NT2NE20007630//Matrix protein (MA), p15

NT2NE20013370//Homo sapiens estrogen-responsive B box protein (EBBP) mRNA, complete cds.

NT2NE20016970//MSF1 PROTEIN.

NT2NE20035690//Homo sapiens phosphoinositol 3-phosphate-binding protein-2 (PEPP2) mRNA, complete cds.

NT2NE20053710//Ank repeat

NT2RI20006690//TRICHOHYALIN.

NT2RI20013420//Mus musculus cyclin ania-6b mRNA, partial cds.

NT2RI20013850//Homo sapiens P38IP (P381P) mRNA, complete cds.

NT2RI20015190//Homo sapiens misato mRNA, partial cds.

NT2RI20016210//Probable transposase—human transposon MER37

NT2RI20022700//X123 protein

NT2RI20025170//Homo sapiens PAR3 (PAR3) mRNA, complete cds.

NT2RI20029260//ARP2/3 COMPLEX 16 KDA SUBUNIT (P16-ARC).

NT2RI20029700//EF hand//EF hand

NT2RI20043040//Homo sapiens NY-REN-2 antigen mRNA, complete cds.

NT2RI20046060//K+ channel tetramerisation domain

NT2RI20061830//Proline-rich protein M14 precursor

NT2RI20065060//Drosophila melanogaster rudimentary gene, intron 3; anon-15AB gene, complete cds.

NT2RI20077230//Homo sapiens BRI3 mRNA, complete cds.

NT2RI20082210//CORNIFIN B (SMALL PROLINE-RICH PROTEIN 1B) (SPR1B) (SPR1 B).

NT2RI20088120//AXONEME-ASSOCIATED PROTEIN MST101(2).

NT2RI20091440//SPRY domain

NT2RP60000080//Homo sapiens Pig11 (PIG11) mRNA, complete cds.

NT2RP60000720//Pinus taeda clone PtaAGP6 putative arabinogalactan protein mRNA, complete cds.

NT2RP70009060//Medicago truncatula mRNA for 85p protein (85p gene).

NT2RP70010800//Mus musculus mRNA for MILI (Miwi like), complete cds.

NT2RP70022430//Tax1-binding protein TRX—human.

NT2RP70028290//Scm-related gene containing four mbt domains [Mus musculus].

NT2RP70033040//YceA protein homolog ybfQ—Bacillus subtilis.

NT2RP70036320//Microfilarial sheath protein

NT2RP70039600//Calpain inhibitor repeat

NT2RP70042330//HYPOTHETICAL PROTEIN MJ0941.

NT2RP70049150//Mus musculus mRNA for UBE-1c1, UBE-1c2, UBE-1c3, complete cds.

NT2RP70052050//Human transformation-related protein mRNA, 3′ end.

NT2RP70084410//Polybromo 1 protein—chicken

NTONG10000520//Rattus norvegicus mRNA for Kelch related protein 1 (krp1 gene).

NTONG10001230//Mus msuculus mRNA, partial cds, clone CLFEST42.

OCBBF10001220//RING CANAL PROTEIN (KELCH PROTEIN).

OCBBF20010750//Spectrin repeat

OCBBF20011400//VACUOLAR PROTEIN SORTING-ASSOCIATED PROTEIN VPS8.

OCBBF20014020//Mus musculus NSD1 protein mRNA, complete cds.

PEBLM10001440//Trg

PEBLM20002130//Mus musculus genes for integrin aM290, hapsin, partial and complete cds.

PLACE50000370//Homo sapiens mRNA for hVPS11, complete cds.

PLACE60004290//Gag P30 core shell protein

PLACE60021020//Integrase Zinc binding domain//Integrase Zinc binding domain//DnaJ central domain (4 repeats)

PLACE60024190//TRICHOHYALIN.

PLACE60032040//Hirudin

PLACE60033990//SPIDROIN 1 (DRAGLINE SILK FIBROIN 1) (FRAGMENT).

PLACE60038500//Homo sapiens mitochondrial solute carrier mRNA, complete cds.

PLACE60043970//Takifugu rubripes retinitis pigmentosa GTPase regulator-like protein gene, partial cds.

PLACE60044640//Human placenta (Diff48) mRNA, complete cds.

PROST20023380//Cca3 protein

PROST20034720//IMMEDIATE-EARLY PROTEIN.

PROST20079740//ANTER-SPECIFIC PROLINE-RICH PROTEIN APG (PROTEIN CEX) (FRAGMENT).

SALGL10000050//Permeases for cytosine/purines, uracil, thiamine, allantoin

SALGL10000470//NG36 [Homo sappiens]

SKMUS20002710//Hepatitis C virus capsid protein

SKMUS20003650//Human (p23) mRNA, complete cds.

SKMUS20004580//Mus musculus N-RAP mRNA, complete cds.

SKMUS20009020//BRO1 PROTEIN.

SKMUS20009540//Homo sapiens F-box protein Fbx25 (FBX25) mRNA, partial cds.

SKMUS20010080//Mus musculus mRNA for a skeletal muscle and cardiac protein.

SKMUS20011470//Mus musculus RP42 mRNA, complete cds.

SKMUS20013640//Laminin EGF-like (Domains III and V)

SKMUS20015430//Homo sapiens HDCMC29P mRNA, partial cds.

SKNMC20010570//F-box domain.

SMINT20001450//Halocynthia roretzi mRNA for HrPET-3, complete cds.

SMINT20002270//Disintegrin//Trans-activation protein X

SMINT20003960//A kinase anchor protein AKAP-KL isoform 2

STOMA20002890//Adaptin N terminal region

SYNOV20002910//Arabinogalactan-like protein

SYNOV20008200//Trichoplusia ni transposon IFP2.

TESTI10000250//M. musculus mRNA for testis-specific protein, DDC8.

TESTI10000640//Fugu rubripes sex comb on midleg-like 2 protein (SCML2) gene, complete cds.

TESTI10001910//Homo sapiens 88-kDa Golgi protein (GM88) mRNA, complete cds.

TESTI20000440//TRICHOHYALIN.

TESTI20002070//NIFU-LIKE PROTEIN.

TESTI20002080//Homo sapiens mRNA for Gab2, complete cds.

TESTI20014120//TRICHOHYALIN.

TESTI20016650//IMMEDIATE-EARLY PROTEIN.

TESTI20022230//Chlamydomonas reinhardtii strain 1132D-flagellar protofilament ribbon protein (RIB43a) mRNA, complete cds.

TESTI20022940//MOB2 PROTEIN (MPS1 BINDER 2).

TESTI20024610//TRICHOHYALIN.

TESTI20030590//TESTIS-SPECIFIC PROTEIN PBS13.

TESTI20030740//TRICHOHYALIN.

TESTI20031300//TPR Domain

TESTI20033560//F-box domain.

TESTI20035510//Proliferating-cell nucleolar antigen P120-like protein—Archaeoglobus fulgidus.

TESTI20035740//A-KINASE ANCHOR PROTEIN 150 (AKAP 150) (CAMP-DEPENDENT PROTEIN KINASE REGULATORY SUBUNIT II HIGH AFFINITY BINDING PROTEIN) (P150) (FRAGMENT).

TESTI20038940//IQ calmodulin-binding motif//IQ calmodulin-binding motif//IQ calmodulin-binding motif

TESTI20040310//Protein of unknown function DUF84

TESTI20041220//Babesia bigemina 200 kDa antigen p200 mRNA, partial cds.

TESTI20052680//Rattus norvegicus RSD-6 mRNA, complete cds.

TESTI20054080//SER/THR-RICH PROTEIN T10 IN DGCR REGION.

TESTI20065720//PROTEIN D52 (N8 PROTEIN).

TESTI20078670//RING CANAL PROTEIN (KELCH PROTEIN).

TESTI20080330//Ribosomal protein L14p/L23e

TESTI20083430//TPR Domain

THYMU10000020//Homo sapiens mRNA for Golgi protein (GPP34 gene).

THYMU10002910//Homo sapiens AP-4 adaptor complex beta4 subunit mRNA, complete cds.

THYMU20002360//Pumilio-family RNA binding domains (aka PUM-HD, Pumilio homology domain)

TRACH10000300//Anabaena PCC7120 hetC gene, complete cds.

TRACH20007800//Homo sapiens PTH-responsive osteosarcoma B1 protein (B1) mRNA, complete cds.

TRACH20008940//PROTEIN TSG24 (MEIOTIC CHECK POINT REGULATOR).

TRACH20013950//Homo sapiens NY-REN-25 antigen mRNA, partial cds.

UMVEN10001220//Corticotropin-releasing factor family

With respect to the remaining 476 clones, there are so far no information available for estimating their functions. However, there is the possibility that the functions of these clones will be revealed in future. Their Clone Names are indicated below.

3NB6920013490, 3NB6920016370, 3NB6920017190, ADRGL10001820, ADRGL20004280, ASTRO20004800, BGGI110002850, BNGH410000130, BNGH410000170, BNGH410000330, BNGH410001530, BNGH420004740, BRACE10000200, BRACE10000700, BRACE10001590, BRACE20000770, BRACE20001000, BRACE20001410, BRACE20003320, BRACE20004210, BRACE20005050, BRACE20005450, BRACE20009880, BRACE20010700, BRACE20011880, BRACE20013740, BRACE20015430, BRACE20016920, BRACE20018650, BRACE20018980, BRACE20020500, BRACE20021510, BRACE20021760, BRACE20024950, BRACE20025900, BRACE20027520, BRACE20028600, BRACE20028610, BRACE20032850, BRACE20033190, BRACE20033980, BRACE20034310, BRACE20035160, BRACE20035270, BRACE20035390, BRACE20035940, BRACE20071530, BRACE20072010, BRACE20072320, BRACE20075270, BRACE20075630, BRACE20076210, BRACE20076460, BRACE20077080, BRACE20077270, BRACE20077670, BRACE20077680, BRACE20079020, BRACE20081140, BRACE20084800, BRACE20084880, BRACE20086530, BRACE20087080, BRACE20087540, BRACE20088570, BRACE20089990, BRACE20090140, BRACE20092740, BRACE20092750, BRACE20093110, BRACE20094370, BRACE20095170, BRAWH10000070, BRAWH10001740, BRAWH20000930, BRAWH20002480, BRAWH20005540, BRAWH20008660, BRAWH20008920, BRAWH20011030, BRAWH20047310, BRAWH20064930, BRAWH20069600, BRAWH20074060, BRAWH20089030, BRAWH20092270, BRAWH20094850, CTONG20003030, CTONG20007710, CTONG20008270, CTONG20020730, CTONG20021430, CTONG20024530, CTONG20029650, DFNES20002920, FCBBF10006860, FCBBF10006910, FCBBF10007320, FCBBF10007600, FCBBF20001050, FCBBF20001950, FCBBF20005760, FCBBF20006770, FCBBF20008080, FCBBF20012990, FCBBF20014800, FCBBF20017180, FCBBF20017200, FEBRA20003300, FEBRA20003910, FEBRA20006800, FEBRA20007400, FEBRA20007710, FEBRA20008740, FEBRA20009010, FEBRA20009590, FEBRA20011970, FEBRA20015900, FEBRA20015910, FEBRA20021940, FEBRA20027270, FEBRA20027830, FEBRA20028820, FEBRA20028970, FEBRA20029080, FEBRA20033080, FEBRA20042240, FEBRA20042370, FEBRA20042930, FEBRA20044120, FEBRA20044430, FEBRA20053770, FEBRA20054270, FEBRA20057520, FEBRA20059980, FEBRA20061500, FEBRA20063540, FEBRA20066270, FEBRA20074140, FEBRA20074580, FEBRA20076220, HCASM10001150, HCASM20005340, HLUNG10000300, HLUNG20003140, HLUNG20004120, HLUNG20004800, HLUNG20005010, HSYRA10001480, HSYRA20002480, HSYRA20002530, HSYRA20007600, HSYRA20011530, IMR3210000740, IMR3210000750, IMR3210001650, IMR3220006090, IMR3220009350, IMR3220009530, IMR3220011850, IMR3220016000, IMR3220017240, KIDNE10000280, KIDNE10000500, KIDNE10001450, KIDNE20001920, KIDNE20002440, KIDNE20002450, KIDNE20002660, KIDNE20033350, KIDNE20033770, KIDNE20037520, KIDNE20040340, KIDNE20040540, KIDNE20042940, KIDNE20045200, KIDNE20045340, KIDNE20045790, KIDNE20048640, KIDNE20048790, KIDNE20059370, KIDNE20070050, KIDNE20070770, KIDNE20073560, LIVER10000990, LIVER10002780, LIVER10003030, LIVER20004460, LIVER20005150, MAMGL10000350, MESAN20002670, MESAN20003370, NB9N410001210, NB9N410001460, NHNPC10001010, NT2NE10000040, NT2NE10001200, NT2NE20000380, NT2NE20000560, NT2NE20000640, NT2NE20006360, NT2NE20007060, NT2NE20007870, NT2NE20008020, NT2NE20009800, NT2NE20011560, NT2NE20013240, NT2NE20013640, NT2NE20014030, NT2NE20014280, NT2NE20015300, NT2NE20016230, NT2NE20016480, NT2NE20044900, NT2RI10000160, NT2RI10001640, NT2RI20000640, NT2RI20002700, NT2RI20002940, NT2RI20006710, NT2RI20007380, NT2RI20008650, NT2RI20012350, NT2RI20012440, NT2RI20014100, NT2RI20017260, NT2RI20026540, NT2RI20028020, NT2RI20028520, NT2RI20030190, NT2RI20030670, NT2RI20033040, NT2RI20033380, NT2RI20035560, NT2RI20040590, NT2RI20043980, NT2RI20047830, NT2RI20048400, NT2RI20049160, NT2RI20049840, NT2RI20056280, NT2RI20061270, NT2RI20063450, NT2RI20064870, NT2RI20065530, NT2RI20066670, NT2RI20067880, NT2RI20071160, NT2RI20072140, NT2RI20073860, NT2RI20075070, NT2RI20075720, NT2RI20075890, NT2RI20077290, NT2RI20077510, NT2RI20085260, NT2RI20086560, NT2RI20088010, NT2RI20090830, NT2RP60000170, NT2RP60000590, NT2RP70000410, NT2RP70003910, NT2RP70005790, NT2RP70013350, NT2RP70024490, NT2RP70025540, NT2RP70028410, NT2RP70030500, NT2RP70030910, NT2RP70047510, NT2RP70047660, NT2RP70049750, NT2RP70052190, NT2RP70054680, NT2RP70054930, NT2RP70063740, NT2RP70066210, NT2RP70067010, NT2RP70069800, NT2RP70071140, NT2RP70073590, NT2RP70079300, NT2RP70081420, NT2RP70086230, NT2RP70092150, NT2RP70092590, NT2RP70093630, NT2RP70093970, NT2RP70094660, NT2RP70095020, NTONG10000330, NTONG20005830, NTONG20009850, NTONG20011370, NTONG20014280, OCBBF10000670, OCBBF10000860, OCBBF10001040, OCBBF20000130, OCBBF20001260, OCBBF20002870, OCBBF20009040, OCBBF20017060, PANCR10001850, PEBLM10000290, PEBLM10001800, PEBLM20000300, PEBLM20001260, PEBLM20001470, PLACE50001530, PLACE60000440, PLACE60000700, PLACE60000800, PLACE60001370, PLACE60002630, PLACE60003710, PLACE60004240, PLACE60005230, PLACE60005500, PLACE60009530, PLACE60012940, PLACE60019230, PLACE60019250, PLACE60026920, PLACE60029490, PLACE60030940, PLACE60031090, PLACE60033720, PLACE60037400, PLACE60040050, PLACE60043120, PLACE60043360, PLACE60044910, PLACE60046870, PLACE60049310, PROST10001520, PROST10002460, PROST10005640, PROST20002060, PROST20002670, PROST20002740, PROST20004630, PROST20017390, PROST20017960, PROST20019980, PROST20021620, PROST20025910, PROST20028420, PROST20031020, PROST20032100, PROST20033030, PROST20037320, PROST20044810, PROST20056040, PROST20061960, PUAEN10000810, SKMUS10001240, SKMUS20003430, SKMUS20004670, SKMUS20004680, SKMUS20008470, SKMUS20009450, SKMUS20015010, SKMUS20016080, SKMUS20016310, SKMUS20016710, SKNMC10000070, SKNMC10000100, SKNMC10001100, SKNMC10001590, SKNMC10001680, SKNMC10002640, SKNMC20003050, SKNMC20005930, SKNMC20006120, SKNMC20015550, SKNSH10000860, SKNSH10003080, SKNSH20001510, SKNSH20001630, SMINT10000390, SMINT10000540, SMINT20000400, SMINT20002390, SMINT20005580, SPLEN10000490, SPLEN20000470, SPLEN20002420, SPLEN20004430, SPLEN20005410, STOMA10000470, STOMA10001330, STOMA20001880, STOMA20004780, SYNOV10001640, SYNOV20011440, SYNOV20014570, TESTI10000230, TESTI10001250, TESTI10001630, TESTI10001790, TESTI20000180, TESTI20001790, TESTI20003720, TESTI20004620, TESTI20005200, TESTI20006710, TESTI20008190, TESTI20008300, TESTI20009510, TESTI20010080, TESTI20010820, TESTI20013060, TESTI20015930, TESTI20017580, TESTI20017660, TESTI20017920, TESTI20018260, TESTI20018290, TESTI20018980, TESTI20019500, TESTI20019680, TESTI20019910, TESTI20020480, TESTI20020900, TESTI20022450, TESTI20022640, TESTI20023610, TESTI20023690, TESTI20024150, TESTI20025440, TESTI20028060, TESTI20028400, TESTI20029650, TESTI20032550, TESTI20032800, TESTI20032990, TESTI20033760, TESTI20034180, TESTI20035410, TESTI20035800, TESTI20037270, TESTI20041110, TESTI20042430, TESTI20049290, TESTI20051550, TESTI20054920, TESTI20062380, TESTI20062550, TESTI20064250, TESTI20069790, TESTI20073580, TESTI20074020, TESTI20076130, TESTI20077500, TESTI20081390, TESTI20082340, TESTI20082400, TESTI20084400, THYMU10000320, THYMU10001050, THYMU10003660, THYMU10004730, THYMU10005270, THYMU20001400, TRACH10000180, TRACH10000570, TRACH10001060, TRACH20002350, TRACH20004610, TRACH20011920, TRACH20014000, UTERU20003380, UTERU20005410, UTERU20005690

EXAMPLE 7 Expression Frequency Analysis In Silico

The cDNA libraries derived from various tissues and cells as indicated in Example 1 were prepared, and cDNA clones were selected from each library at random. The 5′-end sequences were determined and the database was constructed based on the data. The database was constructed based on the nucleotide sequences of 770,546 clones, and thus the population of the database is large enough for the analysis.

Then, clones having a homologous sequence are categorized into a single cluster (clustering) by searching the nucleotide sequences of respective clones in this database with the program of nucleotide sequence homology search; the number of clones belonging to each cluster was determined and normalized for every library; thus, the ratio of a certain gene in each cDNA library was determined. This analysis gave the information of the expression frequency of genes in tissues and cells which were sources of the cDNA libraries.

Then, in order to analyze the expression of a gene containing the nucleotide sequence of the cDNA of the present invention in tissues and cells, the library derived from a tissue or a cell used in the large-scale cDNA analysis was subjected to the comparison of the expression levels between tissues or cells. Namely, the expression frequency was analyzed by comparing the previously normalized values between tissues and/or cells for which the nucleotide sequences of 600 or more cDNA clones had been analyzed. By this analysis, some of the genes were revealed to be involved in the pathology and functions indicated below. Each value in Tables 3 to 39 shown below represents a relative expression frequency; the higher the value, the higher the expression level.

Osteoporosis-Related Genes

Osteoporosis is a pathology in which bones are easily broken owing to overall decrease in components of bone. The onset involves the balance between the functions of osteoblast producing bone and osteoclast absorbing bone, namely bone metabolism. Thus, the genes involved in the increase of osteoclasts differentiating from precursor cells of monocyte/macrophage line (Molecular Medicine 38. 642-648. (2001)) are genes involved in bone metabolism associated with osteoporosis.

A nucleotide sequence information-based analysis was carried out to identify the genes whose expression frequencies are higher or lower in CD34+ cell (cell expressing a glycoprotein CD34) treated with the osteoclast differentiation factor (Molecular Medicine 38. 642-648. (2001)) than in the untreated CD34+ cell, which is the precursor cell of monocyte/macrophage line. The result of comparative analysis for the frequency between the two cDNA libraries prepared from the RNA of CD34+ cells (CD34C) and from the RNA of CD34+ cells treated with the osteoclast differentiation factor (D30ST, D60ST or D90ST) showed that the genes whose expression levels were different between the two were the following clones (Table 3).

KIDNE20062480, NT2RI20016570, PLACE60020840, 3NB6920002810, BRACE20035270, BRAWH20000340, FEBRA20062700, HSYRA20011030, NT2RP70030910, OCBBF20011240, PLACE60043120, SYNOV20011440, HCASM10001150, IMR3220016000, NT2RI20082210, D3OST20001840, FEBRA20012940, FEBRA20021910, IMR3220002230, IMR3220012180, NT2RI20000640, NT2RI20010910, NT2RI20058110, NT2RP60000350, NT2RP70011660, PEBLM20003950, PLACE60049310, PROST20062600, TESTI20007840, TESTI20040310, TESTI20080200, THYMU10003590, TRACH10000630, TRACH20007800, CD34C20000510, HSYRA20016210, KIDNE20004030, KIDNE20073280, NT2RP70055020, PLACE60043960, SKMUS10000220

These genes are involved in osteoporosis.

Genes Involved in Neural Cell Differentiation

Genes involved in neural cell differentiation are useful for treating neurological diseases. Genes with varying expression levels in response to induction of cellular differentiation in neural cells are thought to be involved in neurological diseases.

A survey was performed for genes whose expression levels are varied in response to induction of differentiation (stimulation by retinoic acid (RA) or growth inhibitor treatment after RA stimulation) in cultured cells of a neural strain, NT2. The result of comparative analysis of cDNA libraries derived from undifferentiated NT2 cells (NT2RM) and the cells subjected to the differentiation treatment (NT2RP, NT2RI or NT2NE) showed that the genes whose expression levels were different between the two were the following clones (Table 4).

SKNMC20000970, 3NB6920009120, BRAWH20006970, KIDNE20062480, NHNPC20002060, NT2NE20053710, NT2RI20000640, NT2RI20004210, NT2RI20006710, NT2RI20009740, NT2RI20013420, NT2RI20013850, NT2RI20014100, NT2RI20025410, NT2RI20033040, NT2RI20035560, NT2RI20036950, NT2RI20051500, NT2RI20053350, NT2RI20057230, NT2RI20071330, NT2RI20075720, NT2RI20083960, NT2RI20087910, NT2RI20090650, NT2RI20094060, NT2RP60000350, NT2RP70000760, NT2RP70036800, NT2RP70071770, NT2RP70074220, TESTI20007840, TESTI20080200, 3NB6920002810, 3NB6920005450, HSYRA20015740, HSYRA20016210, IMR3220016000, KIDNE20060140, NT2RI20014490, NT2RI20015950, NT2RI20022520, NT2RI20025170, NT2RI20025540, NT2RI20030510, NT2RI20040590, NT2RI20046060, NT2RI20053680, NT2RI20058510, NT2RI20066820, NT2RI20067030, NT2RI20074980, NT2RI20075890, NT2RI20078840, NT2RI20084810, NT2RI20089420, NT2RP70002380, NT2RP70023790, NT2RP70029820, NT2RP70049150, NT2RP70055020, NT2RP70065270, NT2RP70069860, NT2RP70075370, NT2RP70079750, NT2RP70092590, OCBBF20000130, PLACE60043970, TESTI20053960, BNGH420004740, HSYRA20002480, NT2NE10000730, NT2NE20000560, NT2NE20003270, NT2NE20008090, NT2NE20014030, NT2RP60000720, NT2RP60001090, NT2RP70004770, NT2RP70010800, NT2RP70011660, NT2RP70028750, NT2RP70029060, NT2RP70030550, NT2RP70032030, NT2RP70036320, NT2RP70064900, NT2RP70093220, NT2RP70093730, SYNOV20013740, TESTI20021490, TRACH20004720, TRACH20007800, 3NB6920003300, BRACE10000200, BRACE20018550, FEBRA20008740, FEBRA20074580, FEBRA20076220, KIDNE20073520, MAMGL10000320, NT2NE20002140, NT2NE20006360, NT2NE20007870, NT2NE20009800, NT2NE20035690, NT2RI20002940, NT2RI20014500, NT2RI20016210, NT2RI20029260, NT2RI20037510, NT2RI20055640, NT2RI20064120, NT2RI20074390, NT2RI20077230, NT2RI20090660, PLACE60040050, TRACH20012890, 3NB6910001730, BRACE10001150, BRACE20011170, BRACE20020910, BRACE20035270, BRAWH20005220, FEBRA20003970, FEBRA20012450, HLUNG20003140, IMR3220009350, IMR3220013170, IMR3220013320, IMR3220014350, NT2NE10000040, NT2NE10000140, NT2NE10000180, NT2NE10000230, NT2NE10000630, NT2NE10000830, NT2NE10001200, NT2NE10001630, NT2NE10001850, NT2NE20000380, NT2NE20000640, NT2NE20001740, NT2NE20002590, NT2NE20002990, NT2NE20003690, NT2NE20003840, NT2NE20003920, NT2NE20004550, NT2NE20004700, NT2NE20005170, NT2NE20005360, NT2NE20005500, NT2NE20005860, NT2NE20006580, NT2NE20007060, NT2NE20007630, NT2NE20008020, NT2NE20011560, NT2NE20012470, NT2NE20013240, NT2NE20013370, NT2NE20013640, NT2NE20013720, NT2NE20014280, NT2NE20014350, NT2NE20015300, NT2NE20016230, NT2NE20016260, NT2NE20016340, NT2NE20016480, NT2NE20016660, NT2NE20016970, NT2NE20034080, NT2NE20044900, NT2NE20047160, NT2NE20054410, NT2NE20055170, NT2NE20057200, OCBBF20009040, OCBBF20015860, PLACE60020840, PROST10005260, SKMUS20008630, SMINT20003960, STOMA20001210, SYNOV20011440, TESTI10000230, TESTI20009700, TESTI20040310, THYMU10003290, TRACH20013950, BGGI120010970, BNGH410001980, BRACE10001660, BRACE20014770, BRACE20034490, BRACE20071740, BRAWH20009440, BRAWH20036930, CTONG20020730, CTONG20028030, FCBBF10006750, FCBBF20012110, FCBBF20015380, FEBRA20007570, FEBRA20043250, FEBRA20068730, HCASM10001150, HCASM20002140, HHDPC20000950, HHDPC20004620, HSYRA10001370, HSYRA10001780, HSYRA20001350, HSYRA20006050, IMR3210001580, IMR3220002230, IMR3220003020, KIDNE20004030, KIDNE20060300, KIDNE20073280, MESAN20005010, NT2RI10000160, NT2RI10000270, NT2RI10000480, NT2RI10001640, NT2RI20002700, NT2RI20002820, NT2RI20003410, NT2RI20004120, NT2RI20005970, NT2RI20006690, NT2RI20006850, NT2RI20007380, NT2RI20008650, NT2RI20010100, NT2RI20010830, NT2RI20010910, NT2RI20012350, NT2RI20012440, NT2RI20014090, NT2RI20015190, NT2RI20015400, NT2RI20016570, NT2RI20017260, NT2RI20018460, NT2RI20018660, NT2RI20020220, NT2RI20020410, NT2RI20021520, NT2RI20022430, NT2RI20022700, NT2RI20025300, NT2RI20025850, NT2RI20026540, NT2RI20028020, NT2RI20028520, NT2RI20029580, NT2RI20029700, NT2RI20030110, NT2RI20030190, NT2RI20030670, NT2RI20031540, NT2RI20032050, NT2RI20032220, NT2RI20033010, NT2RI20033380, NT2RI20033440, NT2RI20033830, NT2RI20036780, NT2RI20041900, NT2RI20042840, NT2RI20043040, NT2RI20043980, NT2RI20044420, NT2RI20047830, NT2RI20048400, NT2RI20049160, NT2RI20049840, NT2RI20049850, NT2RI20050610, NT2RI20050870, NT2RI20056280, NT2RI20056470, NT2RI20058110, NT2RI20060710, NT2RI20060720, NT2RI20061270, NT2RI20061830, NT2RI20062100, NT2RI20063450, NT2RI20064870, NT2RI20065060, NT2RI20065530, NT2RI20066670, NT2RI20066790, NT2RI20067350, NT2RI20067880, NT2RI20068250, NT2RI20068550, NT2RI20070480, NT2RI20070840, NT2RI20070960, NT2RI20071160, NT2RI20071480, NT2RI20072140, NT2RI20072540, NT2RI20073030, NT2RI20073840, NT2RI20073860, NT2RI20074690, NT2RI20075070, NT2RI20077290, NT2RI20077510, NT2RI20077540, NT2RI20078270, NT2RI20078790, NT2RI20078910, NT2RI20080500, NT2RI20081880, NT2RI20082210, NT2RI20083360, NT2RI20085260, NT2RI20085980, NT2RI20086560, NT2RI20087140, NT2RI20087490, NT2RI20088010, NT2RI20088120, NT2RI20090830, NT2RI20091440, NT2RI2009215-0, NT2RI20092890, NTONG10001820, OCBBF20002770, OCBBF20011240, PEBLM10001440, PLACE50001130, PLACE60014430, PROST20029600, PUAEN10000570, SALGL10001570, SKMUS10000220, SKMUS20004670, STOMA20002890, SYNOV10001280, TESTI20012690, TESTI20023690, TESTI20028660, TESTI20068720, THYMU10000020, THYMU10000830, TRACH20002370, 3NB6910001290, BRACE10000700, BRACE20003320, BRACE20015080, BRACE20079020, BRACE20083800, BRACE20092740, FEBRA20008810, FEBRA20017150, FEBRA20067930, HHDPC20000550, HSYRA20008280, HSYRA20014760, KIDNE10001450, KIDNE20000850, KIDNE20002660, KIDNE20003300, KIDNE20033050, KIDNE20045340, NT2RP60000080, NT2RP60000170, NT2RP60000320, NT2RP60000390, NT2RP60000590, NT2RP60000860, NT2RP60001000, NT2RP60001230, NT2RP60001270, NT2RP70000410, NT2RP70000690, NT2RP70002590, NT2RP70002710, NT2RP70003640, NT2RP70003910, NT2RP70004250, NT2RP70005790, NT2RP70006240, NT2RP70008120, NT2RP70009060, NT2RP70012310, NT2RP70013060, NT2RP70013350, NT2RP70015910, NT2RP70018560, NT2RP70021510, NT2RP70022430, NT2RP70023760, NT2RP70024490, NT2RP70024500, NT2RP70025540, NT2RP70026190, NT2RP70028290, NT2RP70028410, NT2RP70030500, NT2RP70030910, NT2RP70033040, NT2RP70036290, NT2RP70036470, NT2RP70039600, NT2RP70040800, NT2RP70042040, NT2RP70042330, NT2RP70042600, NT2RP70043730, NT2RP70043960, NT2RP70045410, NT2RP70046560, NT2RP70046870, NT2RP70047510, NT2RP70047660, NT2RP70047900, NT2RP70049250, NT2RP70049750, NT2RP70052050, NT2RP70052190, NT2RP70054680, NT2RP70054930, NT2RP70055130, NT2RP70055200, NT2RP70061620, NT2RP70061880, NT2RP70062960, NT2RP70063040, NT2RP70063740, NT2RP70064080, NT2RP70066210, NT2RP70067010, NT2RP70069800, NT2RP70071140, NT2RP70071540, NT2RP70072210, NT2RP70072520, NT2RP70073590, NT2RP70073810, NT2RP7.0074060, NT2RP70075040, NT2RP70076100, NT2RP70076170, NT2RP70076430, NT2RP70079250, NT2RP70079300, NT2RP70081330, NT2RP70081370, NT2RP70081420, NT2RP70081440, NT2RP70081670, NT2RP70083150, NT2RP70084060, NT2RP70084410, NT2RP70084870, NT2RP70085500, NT2RP70085570, NT2RP70086230, NT2RP70087200, NT2RP70088550, NT2RP70090120, NT2RP70090190, NT2RP70091490, NT2RP70091680, NT2RP70092150, NT2RP70092360, NT2RP70093630, NT2RP70093700, NT2RP70093940, NT2RP70093970, NT2RP70094290, NT2RP70094660, NT2RP70094810, NT2RP70094980, NT2RP70095020, NT2RP70095070, NTONG10000980, NTONG10002140, NTONG20002650, NTONG20016120, PEBLM20003950, PROST10005640, PROST20003250, SKNMC20000650, SKNSH10000860, SKNSH20003470, TESTI10000510, TESTI10000960, TESTI20015110, TESTI20074640, TRACH20004610

These genes are neurological disease-related genes.

Cancer-Related Genes

It has been assumed that, distinct from normal tissues, cancer tissues express a distinct set of genes, and thus the expression can contribute to the carcinogenesis in tissues and cells. Thus, the genes whose expression patterns in cancer tissues are different from those in normal tissues are cancer-related genes. Search was carried out for the genes whose expression levels in cancer tissues were different from those in normal tissues.

The result of comparative analysis of cDNA libraries derived from breast tumor (TBAES) and normal breast (BEAST) showed that the genes whose expression levels were different between the two were the following clones (Table 5).

3NB6910001730, FCBBF10007600, KIDNE20033050, KIDNE20060300, NT2RI20065530, NT2RP60000720, NT2RP70075370, TRACH20004200, LIVER10000670, LIVER10005420, LIVER20000370

The result of comparative analysis of cDNA libraries derived cervical tumor (TCERX) and normal cervical duct (CERVX) showed that the genes whose expression levels were different between the two were the following clones (Table 6).

BRACE10001590, HHDPC20000950, HSYRA20016210, NT2RI20074980, 3NB6920014330, NT2RI20087490, NT2RP60001090, PROST10002200, SKNMC20003220, STOMA20001210

The result of comparative analysis of cDNA libraries derived from colon tumor (TCOLN) and normal colon (COLON) showed that the genes whose expression levels were different between the two were the following clones (Table 7).

BRACE20028610, BRACE20011170, BRACE20035940, IMR3220013320, NT2NE20053710

The result of comparative analysis of cDNA libraries derived from esophageal tumor (TESOP) and normal esophagus (NESOP) showed that the genes whose expression levels were different between the two were the following clones (Table 8).

KIDNE20005740, MAMGL10000320, NESOP10000870, NT2RI20056470, NTONG20008000

The result of comparative analysis of cDNA libraries derived from kidney tumor (TKIDN) and normal kidney (KIDNE) showed that the genes whose expression levels were different between the two were the following clones (Table 9).

3NB6920002810, ADRGL10000020, BNGH420004740, BRACE10000200, BRACE10000420, BRACE10000730, BRACE10001590, BRACE20005650, BRACE20016730, BRACE20028120, BRACE20077980, BRACE20083800, BRACE20083850, BRAWH10001740, BRAWH20036930, BRAWH20064500, BRAWH20064930, CTONG20028030, FCBBF20015380, FEBRA20005360, FEBRA20007570, FEBRA20008740, FEBRA20012270, FEBRA20025250, HSYRA20002480, HSYRA20006400, HSYRA20008280, HSYRA20015740, HSYRA20016210, IMR3220009350, LIVER10001110, NT2NE20003920, NT2NE20007630, NT2NE20007870, NT2RI20025410, NT2RI20026540, NT2RI20029580, NT2RI20033380, NT2RI20033830, NT2RI20051500, NT2RI20058110, NT2RI20090650, NT2RP60000720, NT2RP70013350, NT2RP70023790, NT2RP70024490, NT2RP70028750, NT2RP70029060, NT2RP70036800, NT2RP70075370, NT2RP70076100, NTONG10000980, NTONG10002460, NTONG20015500, OCBBF20002310, OCBBF20013070, PEBLM20001470, PEBLM20003950, PLACE60021510, PLACE60040050, PLACE60043970, PROST20051430, STOMA20001210, STOMA20002570, STOMA20002890, SYNOV20011440, TESTI10000230, TESTI20009700, TESTI20021490, TESTI20032800, TESTI20053960, TESTI20080200, TESTI20082400, BGGI120010970, BRACE20004210, BRACE20005250, BRACE20011170, BRACE20020910, BRACE20080970, BRAWH20000340, BRAWH20006970, BRAWH20011660, FCBBF20001950, FEBRA20043250, HLUNG10000640, IMR3220007420, IMR3220014350, KIDNE10000080, KIDNE10000280, KIDNE10000500, KIDNE10001040, KIDNE10001430, KIDNE10001450, KIDNE10001520, KIDNE20000410, KIDNE20000510, KIDNE20000700, KIDNE20000850, KIDNE20001670, KIDNE20001920, KIDNE20002440, KIDNE20002450, KIDNE20002660, KIDNE20003150, KIDNE20003300, KIDNE20003490, KIDNE20003750, KIDNE20004030, KIDNE20004220, KIDNE20004970, KIDNE20005130, KIDNE20005170, KIDNE20005190, KIDNE20005740, KIDNE20031850, KIDNE20033050, KIDNE20033350, KIDNE20033570, KIDNE20033730, KIDNE20033770, KIDNE20037520, KIDNE20039410, KIDNE20039940, KIDNE20040340, KIDNE20040540, KIDNE20040840, KIDNE20042620, KIDNE20042940, KIDNE20042950, KIDNE20043440, KIDNE20044110, KIDNE20045200, KIDNE20045340, KIDNE20045790, KIDNE20046810, KIDNE20048280, KIDNE20048640, KIDNE20048790, KIDNE20049810, KIDNE20050420, KIDNE20052960, KIDNE20053360, KIDNE20054000, KIDNE20054770, KIDNE20056290, KIDNE20056760, KIDNE20059080, KIDNE20059370, KIDNE20060140, KIDNE20060300, KIDNE20060530, KIDNE20060620, KIDNE20061490, KIDNE20062990, KIDNE20063530, KIDNE20063760, KIDNE20066520, KIDNE20067600, KIDNE20067750, KIDNE20068800, KIDNE20070050, KIDNE20070770, KIDNE20071860, KIDNE20073280, KIDNE20073520, KIDNE20073560, KIDNE20074220, KIDNE20075690, KIDNE20078100, KIDNE20078110, LIVER10000790, MAMGL10000320, NB9N410000470, NT2NE20053710, NT2RI20006710, NT2RI20013420, NT2RI20016570, NT2RI20018460, NT2RI20025540, NT2RI20040590, NT2RI20065530, NT2RI20087490, NT2RI20087910, NT2RP60000350, NT2RP60001230, NT2RP70043730, NT2RP70069860, NT2RP70074220, OCBBF20014940, PLACE60020840, PLACE60043120, PROST10003430, SKNSH20001510, SMINT10000160, SPLEN20000470, SPLEN20001340, SPLEN20003570, STOMA10000470, TESTI10000700, TESTI20027070, TESTI20040310, TRACH10000300, TRACH20000790, TRACH20002500, TRACH20007800

The result of comparative analysis of cDNA libraries derived from liver tumor (TLIVE) and normal liver (LIVER) showed that the genes whose expression levels were different between the two were the following clones (Table 10).

FCBBF50002610, FEBRA20076220, KIDNE20033050, NT2NE20003840, KIDNE20062480, KIDNE20068800, LIVER10000580, LIVER10000670, LIVER10000790, LIVER10000990, LIVER10001040, LIVER10001110, LIVER10001750, LIVER10002300, LIVER10002780, LIVER10003030, LIVER10004330, LIVER10005420, LIVER20000330, LIVER20004160, LIVER20004460, LIVER20005150, NT2NE20002140, NT2RI20030510, NT2RI20043040, NT2RI20090650, PROST10005640, PROST20032320, SALGL10001570, SMINT10000160, SPLEN20002420, TESTI20002530, TESTI20080200, THYMU10003590, TRACH20004720

The result of comparative analysis of cDNA libraries derived from lung tumor (TLUNG) and normal lung (HLUNG) showed that the genes whose expression levels were different between the two were the following clones (Table 11).

NT2RI20030110, BNGH410001980, BRACE10000420, BRACE10001150, BRACE20014770, BRACE20018550, BRAWH20006970, BRAWH20014610, FEBRA20008810, FEBRA20015840, FEBRA20044120, HHDPC20001490, HLUNG10000240, HLUNG1000300, HLUNG10000370, HLUNG10000640, HLUNG10000760, HLUNG10000990, HLUNG10001050, HLUNG10001100, HLUNG20000680, HLUNG20001160, HLUNG20001250, HLUNG20001420, HLUNG20001760, HLUNG20002550, HLUNG20003140, HLUNG20004120, HLUNG20004800, HLUNG20005010, HSYRA20014200, KIDNE20002660, KIDNE20033050, NT2NE20014350, NT2RI20016570, NT2RI20026540, NT2RI20051500, NT2RI20064120, NT2RI20083960, NT2RI20085260, NT2RI20087490, NT2RP70009060, NT2RP70011660, NT2RP70029060, NT2RP70055020, NT2RP70074220, NT2RP70076100, NTONG10002460, NTONG20008000, PLACE60043120, SKMUS20016340, SKNMC20005930, SMINT20000180, SMINT20002390, SMINT20002770, SMINT20003960, STOMA10000470, STOMA20001880, SYNOV20013740, TESTI20036250, TESTI20080200, TRACH20004610

The result of comparative analysis of cDNA libraries derived from ovary tumor (TOVER) and normal ovary (NOVER) showed the genes whose expression levels were different between the two were the following clones (Table 12).

BRACE20011880, TESTI20030710, BRACE20076210, NT2RI20053680, SKMUS20008630, TESTI20005910, TESTI20040310

The result of comparative analysis of cDNA libraries derived from stomach tumor (TSTOM) and normal stomach (STOMA) showed that the genes whose expression levels were different between the two were the following clones (Table 13).

HSYRA20011030, NT2RI20013420, NT2RP70079750, BRACE20003320, HEART20005060, HHDPC20000950, HLUNG20004120, HLUNG20005010, HSYRA20006400, KIDNE10000500, KIDNE20062480, NT2NE20053710, NT2NE20054410, NT2RI20015400, NT2RI20016570, NT2RI20064120, NT2RI20070840, NT2RI20071330, NT2RI20074980, NT2RI20077230, NT2RI20089420, NT2RP70000760, NT2RP70028750, PLACE60014430, PLACE60024190, SKNMC20000970, STOMA10000470, STOMA10000520, STOMA10001170, STOMA10001330, STOMA10001860, STOMA20000320, STOMA20000880, STOMA20001210, STOMA20001880, STOMA20002570, STOMA20002890, STOMA20003960, STOMA20004780, STOMA20004820, THYMU10003590

The result of comparative analysis of cDNA libraries derived from uterine tumor (TUTER) and normal uterus (UTERU) showed that the genes whose expression levels were different between the two were the following clones (Table 14).

NT2RI20085260, 3NB6920002810, BRACE10000420, BRACE20089990, BRACE20092120, BRAWH10001680, BRAWH20011410, BRAWH20011660, FCBBF20005910, FCBBF50002610, FEBRA20005360, FEBRA20006800, FEBRA20008800, FEBRA20044120, FEBRA20057520, HEART20005060, HHDPC20000950, HLUNG10000760, HLUNG20003140, HSYRA20014200, HSYRA20014760, HSYRA20015800, IMR3210002420, IMR3220002230, IMR3220009350, IMR3220014350, IMR3220016000, KIDNE20000850, KIDNE20060140, KIDNE20060300, MAMGL10000350, NT2NE20035690, NT2NE20053710, NT2RI10000270, NT2RI20000640, NT2RI20002940, NT2RI20010910, NT2RI20013420, NT2RI20016570, NT2RI20033380, NT2RI20036950, NT2RI20037510, NT2RI20053350, NT2RI20057230, NT2RI20058110, NT2RI20071480, NT2RI20074980, NT2RI20084810, NT2RI20087490, NT2RI20087910, NT2RP60000350, NT2RP70032030, NT2RP70043730, NTONG10000980, NTONG10002460, PLACE60014430, PLACE60026680, PLACE60043960, PLACE60044910, PLACE60047380, PROST10002200, PROST10005260, PROST20025910, PROST20033380, PUAEN10000570, SALGL10001570, SKMUS10000140, SKMUS20003430, SKMUS20009540, SKNMC10002510, SKNMC20000970, SKNSH10000860, SMINT20002770, STOMA20002890, SYNOV20011440, TESTI10000230, TESTI20018290, TESTI20021490, TESTI20080200, TESTI20082400, TRACH10000300, TRACH20002370, TRACH20007800, TRACH20012890, UTERU10000770, UTERU10000960, UTERU10001600, UTERU10001920, UTERU20000470, UTERU20003380, UTERU20003930, UTERU20004850, UTERU20005410, UTERU20005690

The result of comparative analysis of cDNA libraries derived from tongue cancer (CTONG) and normal tongue (NTONG) showed that the genes whose expression levels were different between the two were the following clones (Table 15).

3NB6910001160, 3NB6910001290, 3NB6910001730, BNGH420004740, BRACE20008850, BRACE20020910, BRACE20074010, BRAWH20014840, BRAWH20089560, CTONG20003030, CTONG20005890, CTONG20007710, CTONG20008270, CTONG20011390, CTONG20013200, CTONG20013660, CTONG20015330, CTONG20018200, CTONG20019110, CTONG20019550, CTONG20020730, CTONG20021430, CTONG20024180, CTONG20024530, CTONG20025580, CTONG20027210, CTONG20028030, CTONG20028160, CTONG20028200, CTONG20029650, CTONG20037820, CTONG20047160, CTONG20055530, CTONG20064490, FEBRA20003770, FEBRA20004520, FEBRA20007400, FEBRA20007570, FEBRA20012940, FEBRA20021940, FEBRA20044120, HCASM10001150, HHDPC20004560, HLUNG20003140, HSYRA20002480, IMR3220009350, IMR3220012180, KIDNE20000850, KIDNE20002660, KIDNE20004220, KIDNE20005740, KIDNE20056760, KIDNE20060140, KIDNE20062480, MESAN20000920, MESAN20003370, NHNPC20002060, NT2NE10001850, NT2NE20000560, NT2NE20002140, NT2NE20003270, NT2NE20003840, NT2NE20014350, NT2NE20053710, NT2RI20006690, NT2RI20006710, NT2RI20016570, NT2RI20018660, NT2RI20025300, NT2RI20025410, NT2RI20030190, NT2RI20030510, NT2RI20036950, NT2RI20046060, NT2RI20053350, NT2RI20067350, NT2RI20075720, NT2RI20078790, NT2RI20083960, NT2RI20087140, NT2RI20094060, NT2RP60000350, NT2RP60001230, NT2RP70000760, NT2RP70004770, NT2RP70009060, NT2RP70011660, NT2RP70023760, NT2RP70023790, NT2RP70024500, NT2RP70026190, NT2RP70029820, NT2RP70036470, NT2RP70043730, NT2RP70061880, NT2RP70071770, NT2RP70076100, NT2RP70079750, NT2RP70084870, NT2RP70093730, OCBBF20013070, PEBLM20003950, PLACE60037450, PLACE60043120, PROST10003430, PROST10005260, PROST20032320, PROST20033020, PROST20056040, SKNMC10002510, SKNMC20000650, SKNMC20010570, SKNSH20003470, SMINT20000180, SYNOV20013740, TESTI10000230, TESTI10001680, TESTI20007840, TESTI20021490, TESTI20022230, TESTI20023690, TESTI20030050, TESTI20042950, TESTI20068720, TESTI20080200, TRACH20012890, BRACE20006980, BRACE20092740, BRAWH20006970, FCBBF10007600, FEBRA20062700, IMR3220016000, KIDNE20073280, MAMGL10000350, NT2NE20035690, NT2RI20056470, NT2RI20058110, NT2RI20084810, NT2RI20085260, NT2RP70015910, NT2RP70036290, NT2RP70036320, NT2RP70074220, NT2RP70075370, NTONG10000330, NTONG10000520, NTONG10001230, NTONG10001300, NTONG10001820, NTONG10002140, NTONG10002460, NTONG10002570, NTONG10002640, NTONG20002650, NTONG20003340, NTONG20003630, NTONG20004920, NTONG20005830, NTONG20008000, NTONG20008780, NTONG20009660, NTONG20009850, NTONG20011370, NTONG20012220, NTONG20014280, NTONG20015500, NTONG20016120, OCBBF20011240, OCBBF20015860, PROST10002200, SKMUS20016340, SKNMC20000970, STOMA20004820, SYNOV10001280, SYNOV20011440, THYMU10000830, TRACH20000790, TRACH20009260

These genes are involved in cancers.

Further, there is a method to search for genes involved in development and differentiation: the expression frequency analysis in which the expression levels of genes are compared between developing or differentiating tissues and/or cells and adult tissues and/or cells. The genes involved in tissue development and/or differentiation are genes participating in tissue construction and expression of function, and thus are useful genes, which are available for regenerative medicine aiming at convenient regeneration of injured tissues.

Search was carried out for the genes whose expression frequencies were different between developing and/or differentiating tissues and/or cells, and adult tissues and/or cells, by using the information of gene expression frequency based on the database of the nucleotide sequences of 770,546 clones shown above.

The result of comparative analysis of cDNA libraries derived from fetal brain (FCBBF, FEBRA or OCBBF) and adult brain (BRACE, BRALZ, BRAMY, BRAWH, BRCAN, BRCOC, BRHIP, BRSSN, BRSTN or BRTHA) showed that the genes whose expression levels were different between the two were the following clones (Tables 16 to 36).

BRACE20028960, BRACE20074010, BRACE20077080, BRACE20077980, BRACE20083800, BRACE20088570, BRAWH10000010, BRAWH10000020, BRAWH10000070, BRAWH10000370, BRAWH10000940, BRAWH10001300, BRAWH10001640, BRAWH10001680, BRAWH10001740, BRAWH10001800, BRAWH20000340, BRAWH20000340, BRAWH20000480, BRAWH20000930, BRAWH20001770, BRAWH20002480, BRAWH20003230, BRAWH20004430, BRAWH20004760, BRAWH20005030, BRAWH20005540, BRAWH20006330, BRAWH20006510, BRAWH20006970, BRAWH20008660, BRAWH20008920, BRAWH20009010, BRAWH20009440, BRAWH20009840, BRAWH20011030, BRAWH20011290, BRAWH20011660, BRAWH20012030, BRAWH20014180, BRAWH20014380, BRAWH20014610, BRAWH20015030, BRAWH20036890, BRAWH20038320, BRAWH20047310, BRAWH20059980, BRAWH20060440, BRAWH20064930, BRAWH20066220, BRAWH20069600, BRAWH20069890, BRAWH20074060, BRAWH20076050, BRAWH20089560, BRAWH20092270, BRAWH20092610, BRAWH20093600, BRAWH20094850, IMR3220013170, KIDNE20000850, KIDNE20004220, KIDNE20031850, KIDNE20050420, MAMGL10000350, NT2NE20001740, NT2RI20042840, NT2RI20086560, NT2RP70002590, NT2RP70065270, NT2RP70074220, NTONG10001820, PEBLM20001470, PLACE60032040, SKMUS10000140, SMINT20005450, TESTI20004350, TESTI20008830, TRACH20007800, TRACH20016070, UMVEN20001330, 3NB6910001730, 3NB6920002810, ADRGL20000740, BNGH410001370, BNGH410001980, BRACE10000200, BRACE10000730, BRACE10000930, BRACE20000770, BRACE20001000, BRACE20001410, BRACE20002800, BRACE20003320, BRACE20005050, BRACE20005250, BRACE20005450, BRACE20005650, BRACE20005650, BRACE20005770, BRACE20006980, BRACE20007180, BRACE20008850, BRACE20009880, BRACE20010650, BRACE20010700, BRACE20011170, BRACE20011430, BRACE20011430, BRACE20011880, BRACE20013400, BRACE20013520, BRACE20013740, BRACE20013750, BRACE20014230, BRACE20014530, BRACE20014550, BRACE20014770, BRACE20014920, BRACE20015080, BRACE20015430, BRACE20016730, BRACE20016920, BRACE20017370, BRACE20018550, BRACE20018590, BRACE20018650, BRACE20018980, BRACE20021510, BRACE20021760, BRACE20022020, BRACE20022270, BRACE20024090, BRACE20024090, BRACE20024310, BRACE20024680, BRACE20024950, BRACE20025900, BRACE20026350, BRACE20026850, BRACE20027360, BRACE20027520, BRACE20027550, BRACE20027720, BRACE20027920, BRACE20027960, BRACE20028120, BRACE20028600, BRACE20030780, BRACE20032850, BRACE20033190, BRACE20033980, BRACE20034310, BRACE20035160, BRACE20035940, BRACE20071380, BRACE20071530, BRACE20071970, BRACE20072010, BRACE20072320, BRACE20072810, BRACE20074470, BRACE20075020, BRACE20075270, BRACE20075380, BRACE20075630, BRACE20076210, BRACE20076460, BRACE20076630, BRACE20076850, BRACE20077610, BRACE20077640, BRACE20077670, BRACE20077840, BRACE20078680, BRACE20079020, BRACE20079530, BRACE20080970, BRACE20081140, BRACE20083850, BRACE20084430, BRACE20084880, BRACE20086530, BRACE20086550, BRACE20087080, BRACE20087540, BRACE20089600, BRACE20089990, BRACE20090140, BRACE20091880, BRACE20092120, BRACE20092750, BRACE20093070, BRACE20093110, BRACE20094370, CTONG20008270, CTONG20013200, CTONG20020730, CTONG20064490, HHDPC20000950, HHDPC20001150, HHDPC20004560, HSYRA10001780, HSYRA20008280, HSYRA20011530, IMR3210002660, IMR3220003020, IMR3220009350, KIDNE20003300, KIDNE20004970, KIDNE20005170, KIDNE20059370, KIDNE20068800, KIDNE20073280, LIVER20000370, MESAN20002670, NT2NE20005170, NT2NE20011560, NT2NE20013640, NT2NE20016970, NT2RI20006710, NT2RI20009740, NT2RI20022430, NT2RI20025300, NT2RI20028020, NT2RI20029260, NT2RI20030110, NT2RI20030510, NT2RI20040590, NT2RI20046060, NT2RI20049840, NT2RI20049850, NT2RI20056470, NT2RI20060720, NT2RI20062100, NT2RI20067350, NT2RI20068250, NT2RI20070840, NT2RI20070960, NT2RI20071480, NT2RI20072540, NT2RI20074980, NT2RI20085260, NT2RI20088120, NT2RI20090660, NT2RI20090830, NT2RP70013060, NT2RP70013350, NT2RP70023760, NT2RP70024500, NT2RP70030910, NT2RP70036320, NT2RP70036470, NT2RP70042330, NT2RP70054930, NT2RP70064900, NT2RP70071140, NT2RP70075370, NT2RP70076100, NT2RP70079750, NT2RP70081370, NT2RP70090120, NT2RP70091490, NT2RP70093730, NTONG20014280, NTONG20015500, PEBLM10000340, PLACE60014430, PLACE60020840, PLACE60024190, PLACE60026920, PLACE60030380, PLACE60038500, PLACE60043970, PROST10002720, PROST20000530, PROST20021620, PROST20032320, PROST20033380, PROST20062600, SALGL10000050, SALGL10001570, SKMUS10000220, SKMUS20001170, SKMUS20002710, SKMUS20009540, SKMUS20011290, SKMUS20015010, SKMUS20015430, SKMUS20016340, SKNMC20002240, SKNMC20015030, SKNSH20001510, SMINT10001000, SMINT20002390, SPLEN20001970, STOMA20001210, STOMA20002570, SYNOV20002910, SYNOV20011440, TESTI10000510, TESTI10000700, TESTI10001680, TESTI20005200, TESTI20015110, TESTI20018290, TESTI20018690, TESTI20018980, TESTI20024670, TESTI20032800, TESTI20033250, TESTI20036250, TESTI20136910, THYMU10000830, THYMU10003290, THYMU10003590, UTERU10000960, UTERU20005690, ADRGL10000650, BGGI120010970, BRACE20004210, BRACE20020500, BRACE20020910, BRACE20024780, BRACE20028610, BRACE20031100, BRACE20035270, BRACE20035390, BRACE20071740, BRACE20077270, BRAWH20001090, CTONG20024530, CTONG20028200, CTONG20055530, FCBBF10005980, FCBBF10006180, FCBBF10006870, FCBBF10006910, FCBBF10007320, FCBBF10007600, FCBBF20000940, FCBBF20001050, FCBBF20001950, FCBBF20002320, FCBBF20002760, FCBBF20005760, FCBBF20005910, FCBBF20006770, FCBBF20007330, FCBBF20008080, FCBBF20008150, FCBBF20009400, FCBBF20009510, FCBBF20012110, FCBBF20012990, FCBBF20014800, FCBBF20016720, FCBBF20017180, FCBBF20017200, FCBBF40002820, HCASM10001150, HHDPC20001490, HLUNG10000640, HLUNG20003140, HLUNG20005010, HSYRA20001350, HSYRA20014760, HSYRA20016310, IMR3220007420, IMR3220009730, IMR3220009840, IMR3220012180, IMR3220013320, KIDNE20002660, KIDNE20056760, KIDNE20073520, LIVER20004160, MESAN20000920, NT2NE20015300, NT2NE20035690, NT2RI20010910, NT2RI20016210, NT2RI20016570, NT2RI20033040, NT2RI20033440, NT2RI20058110, NT2RI20065060, NT2RI20087490, NT2RP60000720, NT2RP70002710, NT2RP70012310, NT2RP70036800, NT2RP70055020, NT2RP70055130, NT2RP70061880, NT2RP70084410, PLACE60037450, PLACE60049310, PROST10005260, PROST20018230, PROST20051430, SKMUS20000740, SKMUS20011470, SKNMC20003560, SKNSH20001630, SPLEN10000490, STOMA20002890, SYNOV20013740, TESTI20011410, TESTI20033760, TESTI20074640, TRACH10000300, TRACH20013950, 3NB6920003300, 3NB6920009120, ADRGL10000180, BRACE10001150, BRACE10001590, BRACE10001690, BRACE20077680, BRACE20092740, BRACE20093610, BRACE20095170, BRAWH20011410, BRAWH20036930, BRAWH20064500, BRAWH20087060, CTONG20019110, FEBRA20000350, FEBRA20000530, FEBRA20001050, FEBRA20001290, FEBRA20003110, FEBRA20003300, FEBRA20003780, FEBRA20003910, FEBRA20003970, FEBRA20003990, FEBRA20004040, FEBRA20004150, FEBRA20004540, FEBRA20004910, FEBRA20006560, FEBRA20006800, FEBRA20006900, FEBRA20007330, FEBRA20007400, FEBRA20007710, FEBRA20007720, FEBRA20007870, FEBRA20008090, FEBRA20008560, FEBRA20008800, FEBRA20008810, FEBRA20009590, FEBRA20009720, FEBRA20010930, FEBRA20011330, FEBRA20011460, FEBRA20012270, FEBRA20012940, FEBRA20013510, FEBRA20014870, FEBRA20015900, FEBRA20015910, FEBRA20017060, FEBRA20017900, FEBRA20019890, FEBRA20020860, FEBRA20024290, FEBRA20024420, FEBRA20027270, FEBRA20027830, FEBRA20028820, FEBRA20028970, FEBRA20029080, FEBRA20030540, FEBRA20031550, FEBRA20033080, FEBRA20034290, FEBRA20037070, FEBRA20041100, FEBRA20041910, FEBRA20042240, FEBRA20042370, FEBRA20042930, FEBRA20043290, FEBRA20044430, FEBRA20044900, FEBRA20045920, FEBRA20048180, FEBRA20050140, FEBRA20050790, FEBRA20052160, FEBRA20053770, FEBRA20053800, FEBRA20054270, FEBRA20057260, FEBRA20057520, FEBRA20059980, FEBRA20060920, FEBRA20061500, FEBRA20062700, FEBRA20063150, FEBRA20063540, FEBRA20064760, FEBRA20066670, FEBRA20067360, FEBRA20067930, FEBRA20068730, FEBRA20069420, FEBRA20070170, FEBRA20072000, FEBRA20072800, FEBRA20074140, FEBRA20075510, FEBRA20075660, HSYRA20006400, HSYRA20015800, IMR3220002230, KIDNE20005740, KIDNE20053360, NT2NE20002140, NT2NE20003270, NT2NE20003840, NT2NE20007870, NT2NE20047160, NT2NE20053710, NT2RI20025410, NT2RI20051500, NT2RI20055640, NT2RI20058510, NT2RI20061830, NT2RI20064120, NT2RI20071330, NT2RI20075890, NT2RI20077230, NT2RI20094060, NT2RP70002380, NT2RP70009060, NT2RP70015910, NT2RP70094810, NT2RP70094980, PLACE60012810, PLACE60040050, SKMUS20008630, SKNMC20003050, SKNSH20003470, TESTI20003560, TESTI20012690, TESTI20030710, TESTI20082400, TRACH20009260, 3NB6910001160, 3NB6920015280, BRACE10000700, BRACE20019440, BRAWH20052250, KIDNE20045340, NT2NE20002590, NT2NE20014030, NT2RI20020220, NT2RI20026540, NT2RI20060710, NT2RI20083960, NT2RI20084810, NT2RP70011660, NT2RP70021510, NT2RP70024490, NT2RP70026190, NT2RP70039600, NT2RP70049250, NT2RP70071770, NT2RP70093940, NTONG10002640, NTONG20002650, OCBBF10000420, OCBBF10000670, OCBBF10000860, OCBBF10000910, OCBBF10001040, OCBBF10001180, OCBBF10001190, OCBBF10001220, OCBBF20002770, OCBBF20002870, OCBBF20007190, OCBBF20008240, OCBBF20009980, OCBBF20010750, OCBBF20011010, OCBBF20011400, OCBBF20011760, OCBBF20014080, OCBBF20014940, OCBBF20015270, OCBBF20015280, OCBBF20015860, OCBBF20017060, PLACE60043960, SMINT20002770, TESTI20001790, TESTI20007840, TESTI20009700, TESTI20027070, TESTI20053960, TRACH20000790, 3NB6920010220, BRACE10001870, BRAWH20014840, BRAWH20040950, FEBRA20011970, KIDNE20062480, NT2RI20029580, NT2RI20035560, NT2RI20043980, NT2RP70000760, NT2RP70042040, NT2RP70069860, NT2RP70088550, OCBBF20001260, TESTI10000230, 3NB6920017190, ADRGL10000020, BRACE10001660, BRAWH10001620, CTONG20028030, KIDNE20004030, KIDNE20060300, NB9N420000420, NT2NE20000560, NT2NE20004700, NT2NE20007630, NT2RI20004120, NT2RI20013420, NT2RI20033380, NT2RI20036950, NT2RI20053350, NT2RI20053680, NT2RI20078840, NT2RI20083360, NT2RI20090650, NT2RP60001090, NT2RP70004770, NT2RP70023790, NT2RP70055200, NT2RP70085570, NTONG10000980, NTONG20016120, OCBBF20011240, OCBBF20012100, OCBBF20013070, OCBBF20014020, PEBLM20003950, PLACE50001130, PLACE60021510, PUAEN10000570, SKNMC20000970, TESTI20040310, TRACH20004610, 3NB6920005450, BRACE10000420, BRACE20076410, BRACE20078820, BRAWH20006860, BRAWH20089030, FCBBF10006750, FCBBF10006860, FCBBF20015380, FCBBF50002610, FEBRA20004520, FEBRA20005360, FEBRA20009010, FEBRA20014920, FEBRA20015840, FEBRA20021910, FEBRA20021940, FEBRA20043250, FEBRA20057780, FEBRA20057880, FEBRA20066270, FEBRA20074580, HHDPC20000550, HSYRA20015740, HSYRA20016210, IMR3210002420, IMR3220016000, KIDNE20060140, MAMGL10000320, NT2NE20008090, NT2NE20014350, NT2RI20000640, NT2RI20002940, NT2RI20015400, NT2RI20033830, NT2RI20037510, NT2RI20057230, NT2RI20087910, NT2RI20089420, NT2RP70043730, NT2RP70047900, PLACE60043120, PROST20033020, SYNOV10001280, TESTI20021490, THYMU20002360, TRACH20012890, 3NB6910001290, BNGH420004740, BRACE20034490, BRAWH20005220, FEBRA20003770, FEBRA20007570, FEBRA20008740, FEBRA20012450, FEBRA20012450, FEBRA20017150, FEBRA20025250, FEBRA20044120, FEBRA20076220, HSYRA20002480, IMR3220014350, MESAN20001490, NHNPC20002060, NT2NE10000180, NT2NE20003920, NT2RI20006690, NT2RI20013850, NT2RI20014500, NT2RI20025540, NT2RI20033010, NT2RI20075720, NT2RP60000350, NT2RP60001230, NT2RP70028750, NT2RP70029060, NT2RP70032030, NTONG20003340, OCBBF20000130, OCBBF20002310, OCBBF20009040, SKNMC20000650, SMINT20003960, TESTI20026320, TESTI20080200

The result of comparative analysis of cDNA libraries derived from fetal heart (FEHRT) and adult heart (HEART) showed that the genes whose expression levels were different between the two were the following clones (Table 37).

KIDNE20062480, NT2RI20033040, NT2RP60000350, BGGI120010970, BRACE10000420, BRACE10001150, BRACE20003320, BRACE20077980, BRAWH10000370, BRAWH20000340, BRAWH20011660, BRAWH20014840, FEBRA20008740, FEBRA20072800, HEART20000350, HEART20000990, HEART20003090, HEART20004110, HEART20004480, HEART20004920, HEART20005060, HEART20005200, HEART20005680, HHDPC20001150, HLUNG20005010, HSYRA20014200, IMR3220013170, KIDNE20004970, NT2RI20000640, NT2RI20006710, NT2RI20015400, NT2RI20026540, NT2RI20037510, NT2RI20057230, NT2RI20064120, NT2RI20071330, NT2RI20071480, NT2RI20077540, NT2RI20084810, NT2RI20087910, NT2RP70000760, NT2RP70024500, NT2RP70029060, NTONG10001820, PLACE60012810, PLACE60043120, PROST20000530, SKMUS10000640, SKMUS20004580, SKMUS20015010, SMINT20002770, TESTI20033250, TESTI20074640, UMVEN20001330

The result of comparative analysis of cDNA libraries derived from fetal kidney (FEKID) and adult kidney (KIDNE) showed that the genes whose expression levels were different between the two were the following clones (Table 38).

3NB6920003300, 3NB6920009120, BGGI120010970, BRACE20004210, BRACE20005250, BRACE20011170, BRACE20020910, BRACE20026850, BRACE20080970, BRAWH20000340, BRAWH20006970, BRAWH20011660, FCBBF20001950, FEBRA20021940, FEBRA20043250, HLUNG10000640, IMR3220007420, IMR3220014350, KIDNE10000280, KIDNE10000500, KIDNE10001040, KIDNE10001430, KIDNE10001450, KIDNE10001520, KIDNE20000410, KIDNE20000510, KIDNE20000700, KIDNE20000850, KIDNE20001670, KIDNE20001920, KIDNE20002440, KIDNE20002450, KIDNE20002660, KIDNE20003150, KIDNE20003300, KIDNE20003490, KIDNE20003750, KIDNE20004030, KIDNE20004220, KIDNE20004970, KIDNE20005130, KIDNE20005170, KIDNE20005190, KIDNE20005740, KIDNE20031850, KIDNE20033050, KIDNE20033350, KIDNE20033570, KIDNE20033730, KIDNE20033770, KIDNE20037520, KIDNE20039410, KIDNE20039940, KIDNE20040340, KIDNE20040540, KIDNE20040840, KIDNE20042620, KIDNE20042940, KIDNE20042950, KIDNE20043440, KIDNE20045200, KIDNE20045340, KIDNE20045790, KIDNE20046810, KIDNE20048280, KIDNE20048640, KIDNE20048790, KIDNE20049810, KIDNE20050420, KIDNE20052960, KIDNE20053360, KIDNE20054000, KIDNE20054770, KIDNE20056290, KIDNE20056760, KIDNE20059080, KIDNE20059370, KIDNE20060140, KIDNE20060300, KIDNE20060530, KIDNE20060620, KIDNE20061490, KIDNE20062480, KIDNE20062990, KIDNE20063530, KIDNE20063760, KIDNE20066520, KIDNE20067600, KIDNE20067750, KIDNE20068800, KIDNE20070050, KIDNE20070770, KIDNE20071860, KIDNE20073280, KIDNE20073520, KIDNE20073560, KIDNE20074220, KIDNE20075690, KIDNE20078100, KIDNE20078110, LIVER10000790, MAMGL10000320, NB9N410000470, NT2NE20053710, NT2RI20006710, NT2RI20013420, NT2RI20016570, NT2RI20018460, NT2RI20025540, NT2RI20040590, NT2RI20065530, NT2RI20087490, NT2RI20087910, NT2RP60000350, NT2RP60001230, NT2RP70043730, NT2RP70069860, NT2RP70074220, OCBBF20014940, PLACE60014430, PLACE60020840, PLACE60043120, PROST10003430, SKNMC20000970, SKNSH20001510, SMINT10000160, SMINT20003960, SPLEN20000470, SPLEN20001340, SPLEN20003570, STOMA10000470, SYNOV10001280, TESTI10000700, TESTI20027070, TESTI20040310, TRACH10000300, TRACH20000790, TRACH20002500, TRACH20007800, KIDNE10000080, KIDNE20044110, NT2RI20033040, NT2RI20037510, NT2RP70065270, TRACH20012890

The result of comparative analysis of cDNA libraries derived from fetal lung (FELNG) and adult lung (HLUNG) showed that the genes whose expression levels were different between the two were the following clones (Table 39).

BNGH410001980, BRACE10000420, BRACE10001150, BRACE20014770, BRACE20018550, BRAWH20006970, BRAWH20014610, FEBRA20008810, FEBRA20015840, FEBRA20044120, HHDPC20001490, HLUNG10000240, HLUNG10000300, HLUNG10000370, HLUNG10000640, HLUNG10000760, HLUNG10000990, HLUNG10001050, HLUNG10001100, HLUNG20000680, HLUNG20001160, HLUNG20001250, HLUNG20001420, HLUNG20001760, HLUNG20002550, HLUNG20003140, HLUNG20004120, HLUNG20004800, HLUNG20005010, HSYRA20014200, KIDNE20002660, KIDNE20033050, NT2NE20014350, NT2RI20016570, NT2RI20026540, NT2RI20051500, NT2RI20064120, NT2RI20083960, NT2RI20085260, NT2RI20087490, NT2RP70009060, NT2RP70011660, NT2RP70029060, NT2RP70055020, NT2RP70074220, NT2RP70076100, NTONG10002460, NTONG20008000, PLACE60043120, SKMUS20016340, SKNMC20005930, SMINT20000180, SMINT20002390, SMINT20002770, SMINT20003960, STOMA10000470, STOMA20001880, SYNOV20013740, TESTI20036250, TESTI20080200, TRACH20004610, BRACE20004210, IMR3220007420

These genes are involved in regeneration of tissues and/or cells.

EXAMPLE 8 Expression Frequency Analysis by PCR

Specific PCR primers were prepared based on the full-length nucleotide sequences, and the expression frequency was analyzed by the ATAC-PCR method (Adaptor-tagged competitive PCR method: Nucleic Acids Research 1997, 25(22): 4694-4696; “DNA Micro-array and Advanced PCR Techniques”, Cell Technology, supplement, Eds., Muramatsu and Nawa (Shujunsha, 2000): 104-112). Inflammation-related genes can be identified by revealing the genes whose expression levels are altered depending on the presence of an inflammation-inducing factor. Then, by using THP-1 cell line, which is a cell line of monocyte line, and TNF-α and LPS, both of which are inflammation-inducing factors, suitable for this system, the genes whose expression levels are altered depending on the presence of the factors were searched for by the system.

THP-1 cell line (purchased from DAINIPPON PHARMACEUTICAL) was cultured to be confluent in RPMI1640 medium (sigma) containing 5% fetal calf serum (GIBCO BRL). Then, the medium was changed with the medium containing 10 ng/ml TNF-α (human recombinant TNF-α; Pharmacia Biotech) or 1 μg/mL LPS (Lipopolysaccharides; sigma), and the culture was continued at 37° C. under 5% CO2. After three hours, the cells were harvested, and total RNA was extracted from them by using ISOGEN reagent (Nippon Gene). The extraction was carried out according to the method in the document attached to ISOGEN reagent. In addition, total RNA was also extracted from the cells cultured without stimulation of TNF-α or LPS.

The genes involved in the onset of gastritis and gastroduodenal ulcer induced by the infection of Helicobacter pylori to the epithelia of stomach can be identified by revealing the genes whose expression levels are altered depending on co-culturing the cells with Helicobacter pylori. Then, by using co-culture of a gastric cancer cell line with Helicobacter pylori, suitable for this system, the genes whose expression levels are altered depending on the presence of Helicobacter pylori, were searched for by the system.

A gastric cancer cell line MKN45 (provided by the Cell Bank, RIKEN GENE BANK, The Institute of Physical and Chemical Research) was cultured to be confluent in RPMI1640 medium (sigma) containing 10% fetal calf serum (GIBCO BRL). Then, the medium was changed with the medium containing 100-fold excess (in terms of the number of cells or the number of colonies) of Helicobacter pylori (TN2 strain: provided by Prof. Omata, Faculty of Medicine, The University of Tokyo), as compared with the number of the cancer cells. The culture was continued at 37° C. under 5% CO2. After three hours, the cells were harvested, and total RNA was extracted from them by using ISOGEN reagent (Nippon Gene). The extraction was carried out according to the method in the document attached to ISOGEN reagent. In addition, total RNA was also extracted from the cells cultured without Helicobacter pylori.

The analysis by the ATAC-PCR method was carried out basically according to “DNA Micro-array and Advanced PCR Techniques”, Cell Technology, supplement (Genome Science Series 1, Eds., Muramatsu and Nawa (Shujunsha, 2000): 104-112). Adapter ligation to the internal standard sample (sample to make the calibration curve for the clone of interest) and test sample was carried out in the two separate reaction systems indicated below. The combination of 6 types of adapters (AD-1, AD-2, AD-3, AD-4, AD-5 and AD-6: see the sequences indicated below) and the samples are as follows.

Reaction System A

AD1; internal standard, 10-fold

AD2; THP-1 cells, unstimulated

AD3; internal standard, 3-fold

AD4; THP-1 cells, TNF-α stimulation

AD5; THP-1 cells, LPS stimulation

AD6; internal standard, 1-fold

Reaction System B

AD1; internal standard, 1-fold

AD2; MKN45 cells, unstimulated

AD3; internal standard, 3-fold

AD4; MKN45 cells, co-cultured with Helicobacter pylori

AD5; internal standard, 10-fold

Adapter Sequences:

AD1;
SEQ ID NO:
3283//5′-GTACATATTGTCGTTAGAACGCG-3′
SEQ ID NO:
3284//3′-CATGTATAACAGCAATCTTGCGCCTAG-5′
AD2;
SEQ ID NO:
3285//5′-GTACATATTGTGGTTAGAACGCGACT-3′
SEQ ID NO:
3286//3′-CATGTATAACAGCAATCTTGCGCTGACTAG-5′
AD3;
SEQ ID NO:
3287//5′-GTACATATTGTCGTTAGAACGCGCATACT-3′
SEQ ID NO:
3288//3′-CATGTATAACAGCAATCTTGCGCGTATGACTAG-5′
AD4;
SEQ ID NO:
3289//5′-GTACATATTGTCGTTAGAACGCGATCCATACT-3′
SEQ ID NO:
3290//3′-CATGTATAACAGCAATCTTGCGCTAGGTATGACTAG-5′
AD5;
SEQ ID NO:
3291//5′-GTACATATTGTCGTTAGAACGCGTCAATCCATAcT-3′
SEQ ID NO:
3292//3′-CATGTATAACAGCAATCTTGCGCAGTTAGGTATGAcTA
G-5′
AD6;
SEQ ID NO:
3293//5′-GTACATATTGTCGTTAGAACGCGTACTCAATCCATACT-3′
SEQ ID NO:
3294//3′-CATGTATAACAGCAATCTTGCGCATGAGTTAGGTATGACTA
G-5′

The internal standard sample used for this assay was a mixture of total RNAs of THP-1 Control, MKN45 Control, NT2 (Stratagene; catalog No. 204101). RNA preparation from the culture cells was carried out according to the standard method.

The sequences of primers specific to the genes and the names of clones of interest in the analysis are as follows. The gene specific primers were designed to produce the PCR products of 70 to 200 bp, which are derived from the adapter-containing cDNA. The sequence of adapter-specific primer (labeled with fluorescence (FAM)) used in the competitive PCR was GTACATATTGTCGTTAGAACGC (22 nucleotides; SEQ ID NO: 3295). PCR was basically carried out with a cycling profile of preheating at 94° C. for 3 minutes, and 30 cycles of denaturation at 94° C. for 30 seconds/annealing at 50° C. for 60 seconds/extension at 72° C. for 90 seconds; in some cases, merely the annealing temperature was changed.

The Nucleotide Sequences of Clone Specific Primers Used in the Experiments

Clone name, primer sequence and SEQ ID NO are indicated below in this order. Each is demarcated by a double slash mark (//).

SEQ ID NO: 3296
3NB6920000290//CTCCTCCAGCAGAACTTG//
SEQ ID NO: 3297
ADRGL10000180//TTTAGAGCTGATTCCCCATT//
SEQ ID NO: 3298
BNGH410001370//TAAAAGcAGGAAATTGTAAA//
SEQ ID NO: 3299
BRACE10001590//ATATGGACAAAGGACCAATT//
SEQ ID NO: 3300
BRACE10001690//AGGACTAGATTCACTGCTTA//
SEQ ID NO: 3301
BRACE20010650//CAACTCTCAACACCACAATC//
SEQ ID NO: 3302
BRACE20013400//CTACTCAAGGACAGCCACAC//
SEQ ID NO: 3303
BRACE20030780//AGATAGAGGCTTGCTGGTGT//
SEQ ID NO: 3304
BRACE20034490//CCTTATGTCAAACTGCGATT//
SEQ ID NO: 3305
BRACE20077640//TTTGCCTTATTCATTGGTTG//
SEQ ID NO: 3306
BRACE20079530//GTAATATCACCCCACAGAGG//
SEQ ID NO: 3307
BRACE20083850//TATCATCTTTTGGGGCTTTG//
SEQ ID NO: 3308
BRACE20091880//AATAAGCCAGTTGCATCCTC//
SEQ ID NO: 3309
BRAWH10001620//TCTCTGATCTCCAACATGC//
SEQ ID NO: 3310
BRAWH20004430//TGAATTGAAGAGACACACT//
SEQ ID NO: 3311
FCBBF10006180//CTTAATCCAGTTCATCAGCT//
SEQ ID NO: 3312
FEBRA20003780//TTTTGAGACAGAGTTTCGCT//
SEQ ID NO: 3313
FEBRA20006800//ATGTTTTACGATTGCCTTTG//
SEQ ID NO: 3314
FEBRA20008810//GAAGCATCTTTGGTGTACTA//
SEQ ID NO: 3315
FEBRA20012940//TGTCCGTGGAGTATATA//
SEQ ID NO: 3316
FEBRA20015840//AACACAGTAGCCAGACCAG//
SEQ ID NO: 3317
HCASM10000610//AAGAGCCTACTACACGCCAG//
SEQ ID NO: 3318
HEART20000350//TTTAAGAGCACACAGAGTC//
SEQ ID NO: 3319
HEART20004480//ATTACTGGTGTGGAGTGGGT//
SEQ ID NO: 3320
HEART20005060//ACTCTGCCTTCACTTTCCTT//
SEQ ID NO: 3321
HHDPC20000950//GATAAAGGATACAGCCApA//
SEQ ID NO: 3322
HLUNG10000370//ATCATGGTCGTTACAGAATT//
SEQ ID NO: 3323
HLUNG20001160//ACTGCCTTCATCTCAGGTT//
SEQ ID NO: 3324
HLUNG20001760//ATCACTGCCAATTTCACA//
SEQ ID NO: 3325
HSYRA20003470//CCACCGAGTTCTGTTG//
SEQ ID NO: 3326
HSYRA20013320//GTCATGGCCACAGTTGTATC//
SEQ ID NO: 3327
IMR3210001580//GATAAAGGATACAGCCApA//
SEQ ID NO: 3328
IMR3210002660//CCCAAAATGTGTATTATTCA//
SEQ ID NO: 3329
IMR3220008380//TTCGGCAATAATCTTCTCTT//
SEQ ID NO: 3330
IMR3220008590//CCACCAACACTTAGACATCA//
SEQ ID NO: 3331
KIDNE10001520//GAATTATAGGTGCACACAC//
SEQ ID NO: 3332
KIDNE20000850//TCTTCTAGTGGAAGAGGTTTA//
SEQ ID NO: 3333
KIDNE20003490//TATCTGAAAATGTGTTTGGT//
SEQ ID NO: 3334
KIDNE20005170//ACTCCTGGCTTTCTATTTCC//
SEQ ID NO: 3335
KIDNE20033730//GACAGTCTCGCTGTATCTCC//
SEQ ID NO: 3336
KIDNE20040540//ACATCCAGTACACCTTCTCC//
SEQ ID NO: 3337
KIDNE20050420//GTCGAAAGTGTTGCTCCTAG//
SEQ ID NO: 3338
KIDNE20061490//TCATAGCTGAGGGGTTAGT//
SEQ ID NO: 3339
KIDNE20062990//ATAGCTCTTGTTTCAGTGTG//
SEQ ID NO: 3340
LIVER20000330//AAGCATGTGGGAGTTATTTA//
SEQ ID NO: 3341
NT2NE10001630//CTTGAGAGTCCAGGTTTCCT//
SEQ ID NO: 3342
NT2NE10001850//CCCATAAAGAATAGAGCTC//
SEQ ID NO: 3343
NT2NE20003920//CTCATGGGGCTAGTCTATT//
SEQ ID NO: 3344
NT2NE20005500//TCAAAGTCCAGGATAGCATT//
SEQ ID NO: 3345
NT2R120009740//ACTGATTTGGTTCTGCGATT//
SEQ ID NO: 3346
NT2R120014500//GTTACTTCGAGTTCTAGCAC//
SEQ ID NO: 3347
NT2R120016570//TGCTGCTCATGTTWCTTG//
SEQ ID NO: 3348
NT2R120018660//AAACATCATCTCTTCCTTGG//
SEQ ID NO: 3349
NT2RI2002152Q//GCTGAGAGACATAGTC//
SEQ ID NO: 3350
NT2R120050870//GACAGAGTAGTGGGGCATCT//
SEQ ID NO: 3351
NT2RI20053350//TTCAGCAGGTAGACACATC//
SEQ ID NO: 3352
NT2R120070480//CCTCTCTTTCAGTTGAGCAT//
SEQ ID NO: 3353
NT2R120073030//GGGCTTGTTTTAGGC//
SEQ ID NO: 3354
NT2RI20078270//CCTAGGCAGTAGATGA//
SEQ ID NO: 3355
NT2R120078790//GCAGACAGGTACAGCTGAGT//
SEQ ID NO: 3356
NT2R120083360//TTATTTTAGTTACCTTGGCA//
SEQ ID NO: 3357
NT2RP60000080//ACTGTAAATCTCCTTGCCTT//
SEQ ID NO: 3358
NT2RP60000390//GAGTTTGGGGACAGTCAGT//
SEQ ID NO: 3359
NT2RP60000590//AAATGCAAAATTGCTGAGAT//
SEQ ID NO: 3360
NTONG10000980//TTCAGCAGGTAGACAACATC//
SEQ ID NO: 3361
NTONG10002570//GTCGCTGAAATTTGCTTCTT//
SEQ ID NO: 3362
PLACE60020160//CCATATCCACTTTCATCATC//
SEQ ID NO: 3363
PLACE60026990//CAAGAAACTGACAATCACGG//
SEQ ID NO: 3364
PLACE60047380//AAGGAGTTGACATTTTGCTG//
SEQ ID NO: 3365
PUAEN10003220//TTTTCAGAGGGCTTTGTGTT//
SEQ ID NO: 3366
SKNMC10000290//ATAACTGAACCCATGGAAAG//
SEQ ID NO: 3367
SKNMC10001590//ACATCCAGTACACCTTCTCC//
SEQ ID NO: 3368
SKNMC20000650//GCACTAGGAGACTGTCAAAA//
SEQ ID NO: 3369
STOMA20002570//GGTATCTTGGAGCTCCTCAG//
SEQ ID NO: 3370
STOMA20002890//GTCAGCATCTACTCTGGGTC//
SEQ ID NO: 3371
SYNOV20001770//AAGAAATAAACACACGAAAA//
SEQ ID NO: 3372
TESTI10000230//AAATGCAAAATTGCTGAGAT//
SEQ ID NO: 3373
TESTI10000550//CAGAACACTCCTCATACCTC//
SEQ ID NO: 3374
TESTI20011340//AAAGTACAGCAGAAGATGGG//
SEQ ID NO: 3375
THYMU10005580//AACAGCTTCTTCATCACAGT//
SEQ ID NO: 3376
TPACH10000630//ATAGAGGAAGGTGGCAACTG//
SEQ ID NO: 3377
TRACH20001960//CTCTTTTCCATCACATTCCC//
SEQ ID NO: 3378
UMVEN10001220//CCAAGTTCTCATTCCACATT//
SEQ ID NO: 3379
UMVEN2000133Q//AGCTAACAAGGTTTTGACAC//
SEQ ID NO: 3380
UTERU20004850//AGACTGGGTCTTGCCATACT//

The result of expression frequency analysis is shown in Table 40. The clones not shown in the table contain clones whose expression levels could not be measured because the levels were too low or the sizes of the PCR products were different from the expected. It was confirmed that the expression levels of TNF-α, IL-1, and IL-8 genes used as positive control genes were elevated.

The result obtained by the search for the genes whose expression levels were altered depending on the presence of TNF-α or LPS in culturing THP-1 cell, which is a human monocyte cell line, showed that the clones whose expression levels were elevated by twofold or more depending on the TNF-α stimulation (the clones whose expression levels were 0.1 or lower both before and after the stimulation were excluded), were ADRGL10000180, BRACE20030780, BRACE20077640, BRACE20083850, BRAWH20004430, FCBBF10006180, FEBRA20003780, FEBRA20006800, FEBRA20012940, FEBRA20015840, HEART20004480, HLUNG10000370, HLUNG20001160, HSYRA20013320, IMR3220008380, KIDNE10001520, KIDNE20040540, KIDNE20061490, KIDNE20062990, NT2NE10001630, NT2NE20003920, NT2NE20005500, NT2RI20014500, NT2RI20016570, NT2RI20078270, NT2RI20083360, NTONG10002570, PUAEN10003220, SKNMC10000290, STOMA20002570, TESTI20011340, UTERU20004850.

Further, the clones whose expression levels were elevated by twofold or more depending on the LPS stimulation (the clones whose expression levels were 0.1 or lower both before and after the stimulation were excluded), were FCBBF10006180, FEBRA20015840, HLUNG10000370, HLUNG20001160, HSYRA20013320, KIDNE20040540, KIDNE20061490, NT2NE10001630, NT2NE20003920, NT2NE20005500, NT2RI20014500, NT2RI20016570, NT2RI20078270, NTONG10002570, PUAEN10003220, STOMA20002570, TESTI20011340. These genes whose expression levels were elevated by LPS stimulation, were all up-regulated by the TNF-α stimulation.

On the other hand, with respect to the genes whose expression is suppressed, in particular cases where the expression levels were relatively high in the unstimulated cells (the relative value were 1 or higher), the clones whose expression levels were decreased by twofold or more by the TNF-α stimulation, were BRACE20013400, BRACE20091880, HEART20005060, HLUNG20001760, IMR3220008590, NT2NE10001850, NT2RI20018660, NT2RI20053350, NT2RI20070480, PLACE60047380, STOMA20002890, SYNOV20001770, TRACH20001960. Further, when the levels were normalized by using the ratio of the expression level of β-actin widely used in data normalization for gene expression level, the clones whose expression levels were decreased by tenfold or more depending on the LPS stimulation, were BRACE20013400, BRACE20091880, HEART20005060, HLUNG20001760, NT2RI20070480, UMVEN20001330. Among the genes whose expression levels were decreased by TNF-α stimulation, the genes whose expression levels were also decreased by the LPS stimulation were BRACE20013400, BRACE20091880, HEART20005060, HLUNG20001760, NT2RI20070480.

These clones were thus revealed to be involved in the inflammation reaction induced by TNF-α or LPS.

The result obtained by the search for the genes whose expression levels were altered depending on co-culturing gastric cancer cell line MKN45 with Helicobacter pylori, showed that the clones whose expression levels were elevated by twofold or more depending on the presence of Helicobacter pylori (the clones whose expression levels were 0.1 or lower both before and after the stimulation were excluded), were BRACE10001590, BRACE20079530, BRAWH10001620, FEBRA20006800, KIDNE20003490, KIDNE20040540, KIDNE20050420, NT2NE10001850, STOMA20002890, SYNOV20001770, TESTI10000550, UTERU20004850. Of the clones, FEBRA20006800, KIDNE20040540 and UTERU20004850 were also up-regulated by TNF-α stimulation in the human monocyte cell line THP-1.

On the other hand, with respect to the genes whose expression is suppressed, in particular cases where the expression levels were relatively high in the unstimulated cells in (the relative value were 1 or higher), when the levels were normalized by using the ratio of the expression level of β-actin widely used in data normalization for gene expression level, the clones whose expression levels were decreased by fivefold or more in the presence of Helicobacter pylori, were BRACE20034490, BRACE20077640, BRACE20083850, KIDNE20005170, LIVER20000330, NT2RP60000390, NTONG10000980, UMVEN20001330.

These clones are involved in gastritis or gastroduodenal ulcer.

TABLE 3
Clone ID CD34C D30ST D60ST D90ST
KIDNE20062480 0 4.908 0 5.748
NT2RI20016570 0 7.035 0 8.24
PLACE60020840 0 8.776 0 20.558
3NB6920002810 0 0 0 4.74
BRACE20035270 0 0 0 33.245
BRAWH20000340 0 0 0 40.521
FEBRA20062700 0 0 0 35.533
HSYRA20011030 0 0 0 9.617
NT2RP70030910 0 0 0 39.804
OCBBF20011240 0 0 0 44.145
PLACE60043120 0 0 0 15.442
SYNOV20011440 0 0 0 15.55
HCASM10001150 0 0 40.145 0
IMR3220016000 0 0 13.886 0
NT2RI20082210 0 0 79.241 0
D3OST20001840 0 100 0 0
FEBRA20012940 0 37.059 0 0
FEBRA20021910 0 63.399 0 0
IMR3220002230 0 10.991 0 0
IMR3220012180 0 18.197 0 0
NT2RI20000640 0 9.996 0 0
NT2RI20010910 0 46.971 0 0
NT2RI20058110 0 20.306 0 0
NT2RP60000350 0 4.385 0 0
NT2RP70011660 0 8.936 0 0
PEBLM20003950 0 14.226 0 0
PLACE60049310 0 68.294 0 0
PROST20062600 0 66.053 0 0
TESTI20007840 0 7.864 0 0
TESTI20040310 0 8.52 0 0
TESTI20080200 0 4.493 0 0
THYMU10003590 0 9.698 0 0
TRACH10000630 0 34.338 0 0
TRACH20007800 0 18.508 0 0
CD34C20000510 100 0 0 0
HSYRA20016210 5.607 0 0 3.6
KIDNE20004030 66.99 0 0 0
KIDNE20073280 54.663 0 0 0
NT2RP70055020 58.521 0 0 0
PLACE60043960 58.654 16.078 0 0
SKMUS10000220 57.743 0 0 0

TABLE 4
Clone ID NT2RM NT2RP NT2RI NT2NE
SKNMC20000970 19 2.312 0.784 1.188
3NB6920009120 0 2.916 1.978 8.993
BRAWH20006970 0 4.004 2.717 4.117
KIDNE20062480 0 1.503 7.137 3.09
NHNPC20002060 0 1.674 1.136 5.165
NT2NE20053710 0 7.977 0.773 2.343
NT2RI20000640 0 1.53 1.038 3.147
NT2RI20004210 0 29.541 40.087 30.373
NT2RI20006710 0 2.481 1.683 2.551
NT2RI20009740 0 13.985 9.489 14.379
NT2RI20013420 0 4.074 1.382 2.094
NT2RI20013850 0 6.297 4.273 2.158
NT2RI20014100 0 53.957 18.305 27.738
NT2RI20025410 0 17.546 11.905 18.04
NT2RI20033040 0 3.342 3.401 3.436
NT2RI20035560 0 28.514 3.869 5.864
NT2RI20036950 0 4.691 9.549 4.823
NT2RI20051500 0 3.392 9.205 10.462
NT2RI20053350 0 2.329 1.581 2.395
NT2RI20057230 0 2.418 1.641 7.458
NT2RI20071330 0 13.599 9.227 6.991
NT2RI20075720 0 4.321 2.932 4.443
NT2RI20083960 0 8.389 5.692 8.625
NT2RI20087910 0 5.711 1.938 2.936
NT2RI20090650 0 2.967 6.039 3.051
NT2RI20094060 0 26.699 18.115 13.726
NT2RP60000350 0 5.37 4.554 4.141
NT2RP70000760 0 4.602 3.122 4.732
NT2RP70036800 0 6.556 8.897 6.741
NT2RP70071770 0 18.93 6.422 9.732
NT2RP70074220 0 4.004 2.717 4.117
TESTI20007840 0 19.261 3.267 4.951
TESTI20080200 0 1.375 1.867 1.414
3NB6920002810 0 1.239 0.841 0
3NB6920005450 0 7.198 4.884 0
HSYRA20015740 0 8.09 5.489 0
HSYRA20016210 0 2.353 1.277 0
IMR3220016000 0 1.458 0.989 0
KIDNE20060140 0 14.005 9.502 0
NT2RI20014490 0 29.632 70.368 0
NT2RI20015950 0 59.577 40.423 0
NT2RI20022520 0 59.577 40.423 0
NT2RI20025170 0 59.577 40.423 0
NT2RI20025540 0 5.634 3.823 0
NT2RI20030510 0 15.012 10.186 0
NT2RI20040590 0 13.827 9.381 0
NT2RI20046060 0 9.661 13.11 0
NT2RI20053680 0 3.443 4.672 0
NT2RI20058510 0 12.325 16.726 0
NT2RI20066820 0 32.943 67.057 0
NT2RI20067030 0 59.577 40.423 0
NT2RI20074980 0 6.002 24.433 0
NT2RI20075890 0 12.002 8.144 0
NT2RI20078840 0 22.336 7.578 0
NT2RI20084810 0 12.646 12.87 0
NT2RI20089420 0 17.837 18.153 0
NT2RP70002380 0 44.979 15.259 0
NT2RP70023790 0 2.283 1.549 0
NT2RP70029820 0 15.713 10.661 0
NT2RP70049150 0 59.577 40.423 0
NT2RP70055020 0 4.911 3.332 0
NT2RP70065270 0 1.664 1.129 0
NT2RP70069860 0 10.864 7.371 0
NT2RP70075370 0 7.229 1.635 0
NT2RP70079750 0 3.104 2.106 0
NT2RP70092590 0 17.381 11.793 0
OCBBF20000130 0 7.346 19.936 0
PLACE60043970 0 12.827 4.352 0
TESTI20053960 0 24.609 5.566 0
BNGH420004740 0 2.789 0 2.867
HSYRA20002480 0 2.789 0 2.867
NT2NE10000730 0 24.483 0 75.517
NT2NE20000560 0 4.458 0 4.584
NT2NE20003270 0 28.131 0 14.462
NT2NE20008090 0 34.048 0 17.504
NT2NE20014030 0 17.216 0 35.403
NT2RP60000720 0 5.865 0 3.015
NT2RP60001090 0 3.47 0 3.568
NT2RP70004770 0 22.083 0 11.353
NT2RP70010800 0 59.331 0 40.669
NT2RP70011660 0 5.472 0 2.813
NT2RP70028750 0 7.823 0 1.609
NT2RP70029060 0 3.063 0 9.449
NT2RP70030550 0 49.305 0 50.695
NT2RP70032030 0 8.843 0 4.546
NT2RP70036320 0 8.861 0 9.111
NT2RP70064900 0 32.803 0 33.727
NT2RP70093220 0 32.957 0 33.885
NT2RP70093730 0 29.95 0 30.794
SYNOV20013740 0 11.184 0 11.499
TESTI20021490 0 20.062 0 6.876
TRACH20004720 0 5.169 0 2.657
TRACH20007800 0 11.333 0 11.652
3NB6920003300 0 0 0.71 1.076
BRACE10000200 0 0 18.865 28.588
BRACE20018550 0 0 16.357 12.393
FEBRA20008740 0 0 2.493 3.778
FEBRA20074580 0 0 23.056 34.938
FEBRA20076220 0 0 6.122 2.319
KIDNE20073520 0 0 4.038 3.06
MAMGL10000320 0 0 0.39 0.591
NT2NE20002140 0 0 7.614 11.538
NT2NE20006360 0 0 18.047 54.696
NT2NE20007870 0 0 3.883 11.767
NT2NE20009800 0 0 39.756 60.244
NT2NE20035690 0 0 14.209 10.766
NT2RI20002940 0 0 12.546 19.012
NT2RI20014500 0 0 3.454 5.235
NT2RI20016210 0 0 21.272 16.117
NT2RI20029260 0 0 18.069 54.761
NT2RI20037510 0 0 3.361 5.094
NT2RI20055640 0 0 19.702 29.855
NT2RI20064120 0 0 2.899 4.393
NT2RI20074390 0 0 39.756 60.244
NT2RI20077230 0 0 14.643 11.094
NT2RI20090660 0 0 5.676 17.202
PLACE60040050 0 0 3.883 11.767
TRACH20012890 0 0 4.391 2.218
3NB6910001730 0 0 0 2.934
BRACE10001150 0 0 0 1.941
BRACE20011170 0 0 0 3.434
BRACE20020910 0 0 0 19.866
BRACE20035270 0 0 0 8.935
BRAWH20005220 0 0 0 12.892
FEBRA20003970 0 0 0 36.013
FEBRA20012450 0 0 0 13.643
HLUNG20003140 0 0 0 13.547
IMR3220009350 0 0 0 4.198
IMR3220013170 0 0 0 4.4
IMR3220013320 0 0 0 2.646
IMR3220014350 0 0 0 4.254
NT2NE10000040 0 0 0 49.427
NT2NE10000140 0 0 0 100
NT2NE10000180 0 0 0 9.321
NT2NE10000230 0 0 0 100
NT2NE10000630 0 0 0 100
NT2NE10000830 0 0 0 100
NT2NE10001200 0 0 0 100
NT2NE10001630 0 0 0 100
NT2NE10001850 0 0 0 60.858
NT2NE20000380 0 0 0 64.993
NT2NE20000640 0 0 0 100
NT2NE20001740 0 0 0 11.757
NT2NE20002590 0 0 0 30.217
NT2NE20002990 0 0 0 100
NT2NE20003690 0 0 0 100
NT2NE20003840 0 0 0 3.017
NT2NE20003920 0 0 0 9.486
NT2NE20004550 0 0 0 100
NT2NE20004700 0 0 0 33.507
NT2NE20005170 0 0 0 61.289
NT2NE20005360 0 0 0 100
NT2NE20005500 0 0 0 100
NT2NE20005860 0 0 0 100
NT2NE20006580 0 0 0 100
NT2NE20007060 0 0 0 100
NT2NE20007630 0 0 0 15.634
NT2NE20008020 0 0 0 100
NT2NE20011560 0 0 0 40.371
NT2NE20012470 0 0 0 100
NT2NE20013240 0 0 0 100
NT2NE20013370 0 0 0 100
NT2NE20013640 0 0 0 49.334
NT2NE20013720 0 0 0 100
NT2NE20014280 0 0 0 100
NT2NE20014350 0 0 0 7.004
NT2NE20015300 0 0 0 22.636
NT2NE20016230 0 0 0 100
NT2NE20016260 0 0 0 100
NT2NE20016340 0 0 0 100
NT2NE20016480 0 0 0 100
NT2NE20016660 0 0 0 100
NT2NE20016970 0 0 0 61.289
NT2NE20034080 0 0 0 100
NT2NE20044900 0 0 0 100
NT2NE20047160 0 0 0 43
NT2NE20054410 0 0 0 34.749
NT2NE20055170 0 0 0 100
NT2NE20057200 0 0 0 71.845
OCBBF20009040 0 0 0 38.34
OCBBF20015860 0 0 0 24.825
PLACE60020840 0 0 0 8.288
PROST10005260 0 0 0 11.86
SKMUS20008630 0 0 0 2.785
SMINT20003960 0 0 0 1.689
STOMA20001210 0 0 0 2.199
SYNOV20011440 0 0 0 4.179
TESTI10000230 0 0 0 4.142
TESTI20009700 0 0 0 15.218
TESTI20040310 0 0 0 5.364
THYMU10003290 0 0 0 34.388
TRACH20013950 0 0 0 12.004
BGGI120010970 0 0 2.974 0
BNGH410001980 0 0 20.55 0
BRACE10001660 0 0 11.3 0
BRACE20014770 0 0 8.968 0
BRACE20034490 0 0 6.108 0
BRACE20071740 0 0 27.924 0
BRAWH20009440 0 0 11.189 0
BRAWH20036930 0 0 19.379 0
CTONG20020730 0 0 25.686 0
CTONG20028030 0 0 26.479 0
FCBBF10006750 0 0 26.462 0
FCBBF20012110 0 0 19.363 0
FCBBF20015380 0 0 3.168 0
FEBRA20007570 0 0 1.649 0
FEBRA20043250 0 0 8.353 0
FEBRA20068730 0 0 6.35 0
HCASM10001150 0 0 1.43 0
HCASM20002140 0 0 2.71 0
HHDPC20000950 0 0 4.733 0
HHDPC20004620 0 0 25.354 0
HSYRA10001370 0 0 10.795 0
HSYRA10001780 0 0 7.211 0
HSYRA20001350 0 0 7.505 0
HSYRA20006050 0 0 17.911 0
IMR3210001580 0 0 5.369 0
IMR3220002230 0 0 4.566 0
IMR3220003020 0 0 4.387 0
KIDNE20004030 0 0 3.815 0
KIDNE20060300 0 0 1.994 0
KIDNE20073280 0 0 6.225 0
MESAN20005010 0 0 24.967 0
NT2RI10000160 0 0 100 0
NT2RI10000270 0 0 38.568 0
NT2RI10000480 0 0 55.06 0
NT2RI10001640 0 0 100 0
NT2RI20002700 0 0 100 0
NT2RI20002820 0 0 100 0
NT2RI20003410 0 0 100 0
NT2RI20004120 0 0 15.349 0
NT2RI20005970 0 0 100 0
NT2RI20006690 0 0 6.222 0
NT2RI20006850 0 0 29.216 0
NT2RI20007380 0 0 100 0
NT2RI20008650 0 0 100 0
NT2RI20010100 0 0 55.06 0
NT2RI20010830 0 0 100 0
NT2RI20010910 0 0 9.758 0
NT2RI20012350 0 0 100 0
NT2RI20012440 0 0 100 0
NT2RI20014090 0 0 23.941 0
NT2RI20015190 0 0 100 0
NT2RI20015400 0 0 0.383 0
NT2RI20016570 0 0 1.461 0
NT2RI20017260 0 0 73.33 0
NT2RI20018460 0 0 14.383 0
NT2RI20018660 0 0 50.642 0
NT2RI20020220 0 0 39.883 0
NT2RI20020410 0 0 100 0
NT2RI20021520 0 0 14.03 0
NT2RI20022430 0 0 22.43 0
NT2RI20022700 0 0 100 0
NT2RI20025300 0 0 25.585 0
NT2RI20025850 0 0 25.193 0
NT2RI20026540 0 0 5.201 0
NT2RI20028020 0 0 39.201 0
NT2RI20028520 0 0 62.741 0
NT2RI20029580 0 0 8.861 0
NT2RI20029700 0 0 100 0
NT2RI20030110 0 0 2.725 0
NT2RI20030190 0 0 28.31 0
NT2RI20030670 0 0 100 0
NT2RI20031540 0 0 100 0
NT2RI20032050 0 0 100 0
NT2RI20032220 0 0 100 0
NT2RI20033010 0 0 17.133 0
NT2RI20033380 0 0 6.678 0
NT2RI20033440 0 0 31.421 0
NT2RI20033830 0 0 21.125 0
NT2RI20036780 0 0 100 0
NT2RI20041900 0 0 100 0
NT2RI20042840 0 0 21.943 0
NT2RI20043040 0 0 28.031 0
NT2RI20043980 0 0 16.393 0
NT2RI20044420 0 0 100 0
NT2RI20047830 0 0 100 0
NT2RI20048400 0 0 100 0
NT2RI20049160 0 0 100 0
NT2RI20049840 0 0 51.095 0
NT2RI20049850 0 0 17.16 0
NT2RI20050610 0 0 34.993 0
NT2RI20050870 0 0 100 0
NT2RI20056280 0 0 100 0
NT2RI20056470 0 0 0.508 0
NT2RI20058110 0 0 12.655 0
NT2RI20060710 0 0 18.232 0
NT2RI20060720 0 0 36.029 0
NT2RI20061270 0 0 100 0
NT2RI20061830 0 0 32.269 0
NT2RI20062100 0 0 4.387 0
NT2RI20063450 0 0 100 0
NT2RI20064870 0 0 100 0
NT2RI20065060 0 0 56.418 0
NT2RI20065530 0 0 2.339 0
NT2RI20066670 0 0 100 0
NT2RI20066790 0 0 100 0
NT2RI20067350 0 0 28.093 0
NT2RI20067880 0 0 100 0
NT2RI20068250 0 0 39.94 0
NT2RI20068550 0 0 34.304 0
NT2RI20070480 0 0 100 0
NT2RI20070840 0 0 5.538 0
NT2RI20070960 0 0 39.827 0
NT2RI20071160 0 0 100 0
NT2RI20071480 0 0 8.058 0
NT2RI20072140 0 0 100 0
NT2RI20072540 0 0 21.715 0
NT2RI20073030 0 0 100 0
NT2RI20073840 0 0 57.89 0
NT2RI20073860 0 0 100 0
NT2RI20074690 0 0 100 0
NT2RI20075070 0 0 100 0
NT2RI20077290 0 0 100 0
NT2RI20077510 0 0 100 0
NT2RI20077540 0 0 39.213 0
NT2RI20078270 0 0 39.208 0
NT2RI20078790 0 0 9.741 0
NT2RI20078910 0 0 100 0
NT2RI20080500 0 0 100 0
NT2RI20081880 0 0 100 0
NT2RI20082210 0 0 2.823 0
NT2RI20083360 0 0 5.348 0
NT2RI20085260 0 0 3.491 0
NT2RI20085980 0 0 2.71 0
NT2RI20086560 0 0 13.947 0
NT2RI20087140 0 0 50.642 0
NT2RI20087490 0 0 1.932 0
NT2RI20088010 0 0 100 0
NT2RI20088120 0 0 15.273 0
NT2RI20090830 0 0 24.964 0
NT2RI20091440 0 0 100 0
NT2RI20092150 0 0 100 0
NT2RI20092890 0 0 100 0
NTONG10001820 0 0 8.461 0
OCBBF20002770 0 0 39.883 0
OCBBF20011240 0 0 7.83 0
PEBLM10001440 0 0 18.541 0
PLACE50001130 0 0 16.492 0
PLACE60014430 0 0 3.227 0
PROST20029600 0 0 40.276 0
PUAEN10000570 0 0 8.916 0
SALGL10001570 0 0 1.34 0
SKMUS10000220 0 0 3.288 0
SKMUS20004670 0 0 25.34 0
STOMA20002890 0 0 1.705 0
SYNOV10001280 0 0 4.538 0
TESTI20012690 0 0 3.275 0
TESTI20023690 0 0 44.022 0
TESTI20028660 0 0 10.313 0
TESTI20068720 0 0 21.478 0
THYMU10000020 0 0 27.219 0
THYMU10000830 0 0 8.95 0
TRACH20002370 0 0 13.11 0
3NB6910001290 0 9.099 0 0
BRACE10000700 0 22.972 0 0
BRACE20003320 0 14.937 0 0
BRACE20015080 0 26.275 0 0
BRACE20079020 0 59.759 0 0
BRACE20083800 0 4.248 0 0
BRACE20092740 0 42.609 0 0
FEBRA20008810 0 9.264 0 0
FEBRA20017150 0 30.227 0 0
FEBRA20067930 0 58.409 0 0
HHDPC20000550 0 14.432 0 0
HSYRA20008280 0 7.137 0 0
HSYRA20014760 0 5.313 0 0
KIDNE10001450 0 19.263 0 0
KIDNE20000850 0 4.841 0 0
KIDNE20002660 0 7.078 0 0
KIDNE20003300 0 20.763 0 0
KIDNE20033050 0 1.709 0 0
KIDNE20045340 0 17.723 0 0
NT2RP60000080 0 100 0 0
NT2RP60000170 0 100 0 0
NT2RP60000320 0 100 0 0
NT2RP60000390 0 100 0 0
NT2RP60000590 0 100 0 0
NT2RP60000860 0 100 0 0
NT2RP60001000 0 100 0 0
NT2RP60001230 0 5.146 0 0
NT2RP60001270 0 100 0 0
NT2RP70000410 0 100 0 0
NT2RP70000690 0 66.955 0 0
NT2RP70002590 0 31.56 0 0
NT2RP70002710 0 14.558 0 0
NT2RP70003640 0 100 0 0
NT2RP70003910 0 100 0 0
NT2RP70004250 0 100 0 0
NT2RP70005790 0 100 0 0
NT2RP70006240 0 100 0 0
NT2RP70008120 0 100 0 0
NT2RP70009060 0 8.617 0 0
NT2RP70012310 0 24.404 0 0
NT2RP70013060 0 49.874 0 0
NT2RP70013350 0 30.221 0 0
NT2RP70015910 0 22.4 0 0
NT2RP70018560 0 100 0 0
NT2RP70021510 0 49.439 0 0
NT2RP70022430 0 33.36 0 0
NT2RP70023760 0 17.87 0 0
NT2RP70024490 0 22.701 0 0
NT2RP70024500 0 19.57 0 0
NT2RP70025540 0 100 0 0
NT2RP70026190 0 9.482 0 0
NT2RP70028290 0 49.972 0 0
NT2RP70028410 0 100 0 0
NT2RP70030500 0 100 0 0
NT2RP70030910 0 20.809 0 0
NT2RP70033040 0 100 0 0
NT2RP70036290 0 9.965 0 0
NT2RP70036470 0 24.999 0 0
NT2RP70039600 0 15.306 0 0
NT2RP70040800 0 100 0 0
NT2RP70042040 0 9.773 0 0
NT2RP70042330 0 60.574 0 0
NT2RP70042600 0 71.279 0 0
NT2RP70043730 0 7.505 0 0
NT2RP70043960 0 100 0 0
NT2RP70045410 0 24.679 0 0
NT2RP70046560 0 100 0 0
NT2RP70046870 0 100 0 0
NT2RP70047510 0 100 0 0
NT2RP70047660 0 100 0 0
NT2RP70047900 0 18.549 0 0
NT2RP70049250 0 27.784 0 0
NT2RP70049750 0 100 0 0
NT2RP70052050 0 64.358 0 0
NT2RP70052190 0 100 0 0
NT2RP70054680 0 100 0 0
NT2RP70054930 0 49.38 0 0
NT2RP70055130 0 3.248 0 0
NT2RP70055200 0 19.133 0 0
NT2RP70061620 0 100 0 0
NT2RP70061880 0 20.642 0 0
NT2RP70062960 0 100 0 0
NT2RP70063040 0 100 0 0
NT2RP70063740 0 100 0 0
NT2RP70064080 0 100 0 0
NT2RP70066210 0 100 0 0
NT2RP70067010 0 100 0 0
NT2RP70069800 0 40.229 0 0
NT2RP70071140 0 33.145 0 0
NT2RP70071540 0 49.972 0 0
NT2RP70072210 0 100 0 0
NT2RP70072520 0 100 0 0
NT2RP70073590 0 100 0 0
NT2RP70073810 0 100 0 0
NT2RP70074060 0 100 0 0
NT2RP70075040 0 100 0 0
NT2RP70076100 0 36.014 0 0
NT2RP70076170 0 100 0 0
NT2RP70076430 0 100 0 0
NT2RP70079250 0 100 0 0
NT2RP70079300 0 71.279 0 0
NT2RP70081330 0 100 0 0
NT2RP70081370 0 26.129 0 0
NT2RP70081420 0 100 0 0
NT2RP70081440 0 100 0 0
NT2RP70081670 0 100 0 0
NT2RP70083150 0 100 0 0
NT2RP70084060 0 100 0 0
NT2RP70084410 0 65.611 0 0
NT2RP70084870 0 48.444 0 0
NT2RP70085500 0 100 0 0
NT2RP70085570 0 9.069 0 0
NT2RP70086230 0 100 0 0
NT2RP70087200 0 100 0 0
NT2RP70088550 0 15.625 0 0
NT2RP70090120 0 49.497 0 0
NT2RP70090190 0 100 0 0
NT2RP70091490 0 49.38 0 0
NT2RP70091680 0 100 0 0
NT2RP70092150 0 100 0 0
NT2RP70092360 0 100 0 0
NT2RP70093630 0 100 0 0
NT2RP70093700 0 100 0 0
NT2RP70093940 0 24.073 0 0
NT2RP70093970 0 100 0 0
NT2RP70094290 0 100 0 0
NT2RP70094660 0 100 0 0
NT2RP70094810 0 58.409 0 0
NT2RP70094980 0 44.133 0 0
NT2RP70095020 0 100 0 0
NT2RP70095070 0 100 0 0
NTONG10000980 0 10.097 0 0
NTONG10002140 0 12.777 0 0
NTONG20002650 0 10.048 0 0
NTONG20016120 0 21.562 0 0
PEBLM20003950 0 8.711 0 0
PROST10005640 0 10.708 0 0
PROST20003250 0 24.163 0 0
SKNMC20000650 0 3.384 0 0
SKNSH10000860 0 23.605 0 0
SKNSH20003470 0 15.832 0 0
TESTI10000510 0 11.33 0 0
TESTI10000960 0 51.106 0 0
TESTI20015110 0 65.524 0 0
TESTI20074640 0 12.147 0 0
TRACH20004610 0 13.344 0 0

TABLE 5
Clone ID BEAST TBAES
3NB6910001730 0 33.793
FCBBF10007600 0 75.606
KIDNE20033050 0 40.478
KIDNE20060300 0 69.585
NT2RI20065530 0 81.65
NT2RP60000720 0 69.448
NT2RP70075370 0 57.062
TRACH20004200 0 94.946
LIVER10000670 68.212 0
LIVER10005420 78.818 0
LIVER20000370 73.799 0

TABLE 6
Clone ID CERVX TCERX
BRACE10001590 0 57.778
HHDPC20000950 0 40.177
HSYRA20016210 0 10.84
NT2RI20074980 0 46.086
3NB6920014330 69.325 0
NT2RI20087490 33.161 0
NT2RP60001090 80.827 0
PROST10002200 42.592 0
SKNMC20003220 58.42 0
STOMA20001210 49.81 0

TABLE 7
Clone ID COLON TCOLN
BRACE20028610 0 95.142
BRACE20011170 78.541 0
BRACE20035940 95.04 0
IMR3220013320 60.529 0
NT2NE20053710 26.798 0

TABLE 8
Clone ID NESOP TESOP
KIDNE20005740 0 54.924
MAMGL10000320 0 13.581
NESOP10000870 49.196 0
NT2RI20056470 69.766 0
NTONG20008000 78.683 0

TABLE 9
Clone ID KIDNE TKIDN
3NB6920002810 0 1.507
ADRGL10000020 0 12.08
BNGH420004740 0 3.392
BRACE10000200 0 33.823
BRACE10000420 0 4.476
BRACE10000730 0 35.7
BRACE10001590 0 3.051
BRACE20005650 0 55.211
BRACE20016730 0 41.8
BRACE20028120 0 21.571
BRACE20077980 0 4.39
BRACE20083800 0 15.501
BRACE20083850 0 25.281
BRAWH10001740 0 23
BRAWH20036930 0 11.581
BRAWH20064500 0 14.412
BRAWH20064930 0 40.792
CTONG20028030 0 15.825
FCBBF20015380 0 17.038
FEBRA20005360 0 7.956
FEBRA20007570 0 2.956
FEBRA20008740 0 4.47
FEBRA20012270 0 24.184
FEBRA20025250 0 20.688
HSYRA20002480 0 3.392
HSYRA20006400 0 4.833
HSYRA20008280 0 2.894
HSYRA20015740 0 9.842
HSYRA20016210 0 2.862
IMR3220009350 0 4.967
LIVER10001110 0 25.88
NT2NE20003920 0 3.741
NT2NE20007630 0 18.497
NT2NE20007870 0 6.961
NT2RI20025410 0 21.344
NT2RI20026540 0 4.662
NT2RI20029580 0 15.887
NT2RI20033380 0 23.947
NT2RI20033830 0 12.625
NT2RI20051500 0 4.126
NT2RI20058110 0 7.563
NT2RI20090650 0 3.609
NT2RP60000720 0 3.567
NT2RP70013350 0 9.191
NT2RP70023790 0 2.777
NT2RP70024490 0 27.614
NT2RP70028750 0 3.807
NT2RP70029060 0 11.18
NT2RP70036800 0 7.976
NT2RP70075370 0 2.931
NT2RP70076100 0 14.603
NTONG10000980 0 8.189
NTONG10002460 0 4.695
NTONG20015500 0 30.566
OCBBF20002310 0 20.844
OCBBF20013070 0 18.625
PEBLM20001470 0 8.936
PEBLM20003950 0 5.298
PLACE60021510 0 12.663
PLACE60040050 0 6.961
PLACE60043970 0 7.802
PROST20051430 0 37.542
STOMA20001210 0 2.602
STOMA20002570 0 14.983
STOMA20002890 0 1.528
SYNOV20011440 0 4.944
TESTI10000230 0 4.9
TESTI20009700 0 18.005
TESTI20021490 0 8.135
TESTI20032800 0 21.55
TESTI20053960 0 9.979
TESTI20080200 0 1.673
TESTI20082400 0 2.876
BGGI120010970 4.336 0
BRACE20004210 3.583 0
BRACE20005250 6.242 23.03
BRACE20011170 3.303 0
BRACE20020910 19.111 0
BRACE20080970 20.33 0
BRAWH20000340 10.476 0
BRAWH20006970 3.96 0
BRAWH20011660 5.897 0
FCBBF20001950 65.363 0
FEBRA20043250 12.177 0
HLUNG10000640 23.921 0
IMR3220007420 2.375 0
IMR3220014350 4.092 0
KIDNE10000080 22.13 0
KIDNE10000280 100 0
KIDNE10000500 15.868 0
KIDNE10001040 100 0
KIDNE10001430 100 0
KIDNE10001450 19.052 0
KIDNE10001520 100 0
KIDNE20000410 100 0
KIDNE20000510 100 0
KIDNE20000700 100 0
KIDNE20000850 4.788 0
KIDNE20001670 100 0
KIDNE20001920 100 0
KIDNE20002440 37.565 0
KIDNE20002450 100 0
KIDNE20002660 7 0
KIDNE20003150 100 0
KIDNE20003300 20.536 0
KIDNE20003490 64.026 5.625
KIDNE20003750 100 0
KIDNE20004030 5.561 0
KIDNE20004220 35.77 0
KIDNE20004970 12.49 0
KIDNE20005130 100 0
KIDNE20005170 81.524 0
KIDNE20005190 100 0
KIDNE20005740 2.3 0
KIDNE20031850 16.193 0
KIDNE20033050 3.381 0
KIDNE20033350 100 0
KIDNE20033570 53.825 0
KIDNE20033730 100 0
KIDNE20033770 100 0
KIDNE20037520 100 0
KIDNE20039410 100 0
KIDNE20039940 43.968 0
KIDNE20040340 100 0
KIDNE20040540 49.114 0
KIDNE20040840 100 0
KIDNE20042620 100 0
KIDNE20042940 100 0
KIDNE20042950 100 0
KIDNE20043440 100 0
KIDNE20044110 7.51 0
KIDNE20045200 100 0
KIDNE20045340 17.53 0
KIDNE20045790 100 0
KIDNE20046810 100 0
KIDNE20048280 100 0
KIDNE20048640 34.264 0
KIDNE20048790 100 0
KIDNE20049810 100 0
KIDNE20050420 35.626 0
KIDNE20052960 100 0
KIDNE20053360 58.142 0
KIDNE20054000 49.697 0
KIDNE20054770 100 0
KIDNE20056290 100 0
KIDNE20056760 16.262 0
KIDNE20059080 100 0
KIDNE20059370 88.03 0
KIDNE20060140 13.852 0
KIDNE20060300 2.906 0
KIDNE20060530 100 0
KIDNE20060620 100 0
KIDNE20061490 100 0
KIDNE20062990 31.685 0
KIDNE20063530 26.747 0
KIDNE20063760 100 0
KIDNE20066520 70.185 0
KIDNE20067600 100 0
KIDNE20067750 8.487 0
KIDNE20068800 24.137 0
KIDNE20070050 66.711 0
KIDNE20070770 100 0
KIDNE20071860 39.822 0
KIDNE20073280 4.537 0
KIDNE20073520 8.83 3.62
KIDNE20073560 100 0
KIDNE20074220 100 0
KIDNE20075690 100 0
KIDNE20078100 100 0
KIDNE20078110 100 0
LIVER10000790 15.673 0
MAMGL10000320 1.138 0
NB9N410000470 3.598 0
NT2NE20053710 1.127 0
NT2RI20006710 2.454 0
NT2RI20013420 2.015 0
NT2RI20016570 23.435 0
NT2RI20018460 20.967 0
NT2RI20025540 5.573 0
NT2RI20040590 13.676 0
NT2RI20065530 3.41 0
NT2RI20087490 1.408 0
NT2RI20087910 2.824 0
NT2RP60000350 5.311 0
NT2RP60001230 5.09 0
NT2RP70043730 14.846 0
NT2RP70069860 10.745 26.431
NT2RP70074220 3.96 0
OCBBF20014940 49.164 0
PLACE60020840 2.658 0
PLACE60043120 3.992 9.82
PROST10003430 25.547 0
SKNSH20001510 20.208 0
SMINT10000160 38.817 15.914
SPLEN20000470 66.711 0
SPLEN20001340 88.909 0
SPLEN20003570 31.635 0
STOMA10000470 17.849 0
TESTI10000700 25.214 0
TESTI20027070 14.795 0
TESTI20040310 2.58 0
TRACH10000300 11.119 0
TRACH20000790 4.534 11.153
TRACH20002500 35.282 0
TRACH20007800 5.605 0

TABLE 10
Clone ID LIVER TLIVE
FCBBF50002610 0 88.758
FEBRA20076220 0 53.946
KIDNE20033050 0 40.878
NT2NE20003840 0 70.165
KIDNE20062480 7.391 0
KIDNE20068800 60.015 0
LIVER10000580 100 0
LIVER10000670 31.788 0
LIVER10000790 77.941 0
LIVER10000990 100 0
LIVER10001040 100 0
LIVER10001110 52.319 0
LIVER10001750 100 0
LIVER10002300 66.114 0
LIVER10002780 100 0
LIVER10003030 100 0
LIVER10004330 100 0
LIVER10005420 13.604 0
LIVER20000330 100 0
LIVER20004160 33.27 0
LIVER20004460 100 0
LIVER20005150 100 0
NT2NE20002140 27.596 0
NT2RI20030510 18.459 0
NT2RI20043040 50.8 0
NT2RI20090650 7.296 0
PROST10005640 26.335 0
PROST20032320 15.404 0
SALGL10001570 2.428 0
SMINT10000160 32.172 0
SPLEN20002420 83.286 0
TESTI20002530 26.418 0
TESTI20080200 3.383 0
THYMU10003590 7.302 0
TRACH20004720 6.356 0

TABLE 11
Clone ID HLUNG TLUNG
NT2RI20030110 0 94.571
BNGH410001980 16.113 0
BRACE10000420 7.831 0
BRACE10001150 1.339 0
BRACE20014770 28.126 0
BRACE20018550 25.65 0
BRAWH20006970 8.521 0
BRAWH20014610 7.03 77.801
FEBRA20008810 19.713 0
FEBRA20015840 53.019 0
FEBRA20044120 15.75 0
HHDPC20001490 25.611 0
HLUNG10000240 100 0
HLUNG10000300 100 0
HLUNG10000370 100 0
HLUNG10000640 51.466 0
HLUNG10000760 12.838 0
HLUNG10000990 100 0
HLUNG10001050 100 0
HLUNG10001100 100 0
HLUNG20000680 72.532 0
HLUNG20001160 100 0
HLUNG20001250 100 0
HLUNG20001420 79.349 0
HLUNG20001760 100 0
HLUNG20002550 100 0
HLUNG20003140 14.018 0
HLUNG20004120 42.131 0
HLUNG20004800 100 0
HLUNG20005010 5.302 0
HSYRA20014200 12.578 0
KIDNE20002660 15.061 0
KIDNE20033050 3.637 0
NT2NE20014350 28.99 0
NT2RI20016570 9.167 0
NT2RI20026540 8.156 0
NT2RI20051500 21.652 0
NT2RI20064120 9.093 0
NT2RI20083960 17.851 0
NT2RI20085260 5.474 0
NT2RI20087490 3.03 0
NT2RP70009060 18.337 0
NT2RP70011660 5.822 0
NT2RP70029060 6.519 0
NT2RP70055020 10.451 0
NT2RP70074220 8.521 0
NT2RP70076100 25.546 0
NTONG10002460 16.426 0
NTONG20008000 7.189 0
PLACE60043120 8.589 0
SKMUS20016340 15.317 0
SKNMC20005930 13.727 0
SMINT20000180 38.989 0
SMINT20002390 51.283 0
SMINT20002770 12.776 0
SMINT20003960 10.489 0
STOMA10000470 38.402 0
STOMA20001880 52.43 0
SYNOV20013740 23.798 0
TESTI20036250 32.684 0
TESTI20080200 2.927 0
TRACH20004610 28.395 0

TABLE 12
Clone ID NOVAR TOVAR
BRACE20011880 0 93.107
TESTI20030710 0 79.631
BRACE20076210 97.13 0
NT2RI20053680 78.467 0
SKMUS20008630 61.727 0
TESTI20005910 94.963 0
TESTI20040310 59.442 0

TABLE 13
Clone ID STOMA TSTOM
HSYRA20011030 0 60.206
NT2RI20013420 0 48.779
NT2RP70079750 0 74.336
BRACE20003320 28.838 0
HEART20005060 8.996 0
HHDPC20000950 3.367 0
HLUNG20004120 38.225 0
HLUNG20005010 4.81 0
HSYRA20006400 23.013 0
KIDNE10000500 30.974 0
KIDNE20062480 2.901 0
NT2NE20053710 2.2 0
NT2NE20054410 65.251 0
NT2RI20015400 0.544 0
NT2RI20016570 4.159 0
NT2RI20064120 8.25 0
NT2RI20070840 15.758 0
NT2RI20071330 13.128 0
NT2RI20074980 3.862 0
NT2RI20077230 20.833 0
NT2RI20089420 17.218 0
NT2RP70000760 4.442 0
NT2RP70028750 3.021 0
PLACE60014430 9.182 0
PLACE60024190 54.046 0
SKNMC20000970 4.463 0
STOMA10000470 34.842 0
STOMA10000520 100 0
STOMA10001170 100 0
STOMA10001330 100 0
STOMA10001860 100 0
STOMA20000320 100 0
STOMA20000880 100 0
STOMA20001210 4.129 0
STOMA20001880 47.57 0
STOMA20002570 23.78 0
STOMA20002890 4.851 0
STOMA20003960 100 0
STOMA20004780 100 0
STOMA20004820 28.859 0
THYMU10003590 5.733 0

TABLE 14
Clone ID UTERU TUTER
NT2RI20085260 0 60.829
3NB6920002810 1.339 0
BRACE10000420 15.908 0
BRACE20089990 28.795 0
BRACE20092120 61.611 0
BRAWH10001680 49.225 0
BRAWH20011410 14.576 0
BRAWH20011660 3.222 0
FCBBF20005910 17.567 0
FCBBF50002610 4.011 0
FEBRA20005360 7.069 0
FEBRA20006800 81.993 0
FEBRA20008800 29.932 0
FEBRA20044120 7.999 0
FEBRA20057520 14.823 0
HEART20005060 5.036 0
HHDPC20000950 1.885 0
HLUNG10000760 3.26 0
HLUNG20003140 7.12 0
HSYRA20014200 6.388 0
HSYRA20014760 5.742 0
HSYRA20015800 36.126 0
IMR3210002420 7.465 0
IMR3220002230 3.637 0
IMR3220009350 4.412 0
IMR3220014350 4.472 0
IMR3220016000 0.788 0
KIDNE20000850 5.232 0
KIDNE20060140 15.135 0
KIDNE20060300 3.176 0
MAMGL10000350 1.122 0
NT2NE20035690 11.316 0
NT2NE20053710 1.232 0
NT2RI10000270 61.432 0
NT2RI20000640 3.308 0
NT2RI20002940 19.984 0
NT2RI20010910 15.542 0
NT2RI20013420 2.201 0
NT2RI20016570 2.328 0
NT2RI20033380 10.637 0
NT2RI20036950 5.07 0
NT2RI20037510 2.677 0
NT2RI20053350 2.517 0
NT2RI20057230 2.613 0
NT2RI20058110 6.719 0
NT2RI20071480 25.67 0
NT2RI20074980 4.324 0
NT2RI20084810 20.5 0
NT2RI20087490 1.539 0
NT2RI20087910 12.345 0
NT2RP60000350 1.451 0
NT2RP70032030 4.778 0
NT2RP70043730 8.111 0
NTONG10000980 7.275 0
NTONG10002460 4.171 0
PLACE60014430 10.28 0
PLACE60026680 15.19 0
PLACE60043960 10.64 0
PLACE60044910 52.136 0
PLACE60047380 52.136 0
PROST10002200 1.976 0
PROST10005260 12.466 0
PROST20025910 51.788 0
PROST20033380 16.15 0
PUAEN10000570 14.201 0
SALGL10001570 1.067 0
SKMUS10000140 23.507 0
SKMUS20003430 35.091 0
SKMUS20009540 9.414 0
SKNMC10002510 6.618 0
SKNMC20000970 2.498 0
SKNSH10000860 25.511 0
SMINT20002770 3.244 0
STOMA20002890 2.716 0
SYNOV20011440 4.393 0
TESTI10000230 8.707 0
TESTI20018290 12.741 0
TESTI20021490 14.455 0
TESTI20080200 2.973 0
TESTI20082400 2.555 0
TRACH10000300 12.149 0
TRACH20002370 20.883 0
TRACH20007800 12.248 0
TRACH20012890 4.662 0
UTERU10000770 100 0
UTERU10000960 50.58 0
UTERU10001600 100 0
UTERU10001920 100 0
UTERU20000470 100 0
UTERU20003380 35.158 0
UTERU20003930 100 0
UTERU20004850 100 0
UTERU20005410 33.583 0
UTERU20005690 50.58 0

TABLE 15
Clone ID NTONG CTONG
3NB6910001160 0 6.048
3NB6910001290 0 3.009
3NB6910001730 0 0.944
BNGH420004740 0 3.688
BRACE20008850 0 15.357
BRACE20020910 0 12.778
BRACE20074010 0 5.637
BRAWH20014840 0 5.251
BRAWH20089560 0 21.778
CTONG20003030 0 100
CTONG20005890 0 39.66
CTONG20007710 0 100
CTONG20008270 0 18.957
CTONG20011390 0 100
CTONG20013200 0 19.93
CTONG20013660 0 100
CTONG20015330 0 100
CTONG20018200 0 100
CTONG20019110 0 48.152
CTONG20019550 0 100
CTONG20020730 0 25.035
CTONG20021430 0 100
CTONG20024180 0 100
CTONG20024530 0 23.734
CTONG20025580 0 57.263
CTONG20027210 0 100
CTONG20028030 0 8.603
CTONG20028160 0 100
CTONG20028200 0 55.786
CTONG20029650 0 100
CTONG20037820 0 100
CTONG20047160 0 100
CTONG20055530 0 38.023
CTONG20064490 0 24.327
FEBRA20003770 0 22.646
FEBRA20004520 0 19.228
FEBRA20007400 0 4.377
FEBRA20007570 0 1.607
FEBRA20012940 0 7.503
FEBRA20021940 0 1.128
FEBRA20044120 0 4.895
HCASM10001150 0 1.394
HHDPC20004560 0 18.986
HLUNG20003140 0 4.356
HSYRA20002480 0 3.688
IMR3220009350 0 2.7
IMR3220012180 0 3.684
KIDNE20000850 0 1.601
KIDNE20002660 0 9.361
KIDNE20004220 0 23.916
KIDNE20005740 0 1.538
KIDNE20056760 0 21.746
KIDNE20060140 0 9.261
KIDNE20062480 0 2.981
MESAN20000920 0 19.727
MESAN20003370 0 17.82
NHNPC20002060 0 4.429
NT2NE10001850 0 39.142
NT2NE20000560 0 8.845
NT2NE20002140 0 7.421
NT2NE20003270 0 27.905
NT2NE20003840 0 1.94
NT2NE20014350 0 4.505
NT2NE20053710 0 3.014
NT2RI20006690 0 12.129
NT2RI20006710 0 1.64
NT2RI20016570 0 1.424
NT2RI20018660 0 49.358
NT2RI20025300 0 49.872
NT2RI20025410 0 11.603
NT2RI20030190 0 27.593
NT2RI20030510 0 9.928
NT2RI20036950 0 6.205
NT2RI20046060 0 12.778
NT2RI20053350 0 4.621
NT2RI20067350 0 27.381
NT2RI20075720 0 8.573
NT2RI20078790 0 3.165
NT2RI20083960 0 5.548
NT2RI20087140 0 49.358
NT2RI20094060 0 8.828
NT2RP60000350 0 5.327
NT2RP60001230 0 6.806
NT2RP70000760 0 12.173
NT2RP70004770 0 36.51
NT2RP70009060 0 5.699
NT2RP70011660 0 5.428
NT2RP70023760 0 11.817
NT2RP70023790 0 3.02
NT2RP70024500 0 12.942
NT2RP70026190 0 12.541
NT2RP70029820 0 10.391
NT2RP70036470 0 33.064
NT2RP70043730 0 4.963
NT2RP70061880 0 27.302
NT2RP70071770 0 18.778
NT2RP70076100 0 7.939
NT2RP70079750 0 4.105
NT2RP70084870 0 32.036
NT2RP70093730 0 19.806
OCBBF20013070 0 5.063
PEBLM20003950 0 5.761
PLACE60037450 0 33.178
PLACE60043120 0 2.669
PROST10003430 0 34.162
PROST10005260 0 7.628
PROST20032320 0 8.285
PROST20033020 0 6.218
PROST20056040 0 29.772
SKNMC10002510 0 8.098
SKNMC20000650 0 4.476
SKNMC20010570 0 4.712
SKNSH20003470 0 10.47
SMINT20000180 0 24.233
SYNOV20013740 0 7.396
TESTI10000230 0 7.991
TESTI10001680 0 8.412
TESTI20007840 0 17.514
TESTI20021490 0 4.422
TESTI20022230 0 62.139
TESTI20023690 0 42.906
TESTI20030050 0 1.535
TESTI20042950 0 76.649
TESTI20068720 0 10.467
TESTI20080200 0 0.91
TRACH20012890 0 1.426
BRACE20006980 55.471 0
BRACE20092740 22.273 0
BRAWH20006970 8.372 0
FCBBF10007600 6.676 0
FEBRA20062700 19.42 6.142
IMR3220016000 3.049 0.482
KIDNE20073280 9.592 3.034
MAMGL10000350 2.171 0
NT2NE20035690 21.893 0
NT2RI20056470 23.487 5.448
NT2RI20058110 12.999 0
NT2RI20084810 13.22 0
NT2RI20085260 5.378 0
NT2RP70015910 46.836 14.813
NT2RP70036290 20.836 59.311
NT2RP70036320 18.528 46.879
NT2RP70074220 8.372 0
NT2RP70075370 5.038 0
NTONG10000330 100 0
NTONG10000520 44.434 0
NTONG10001230 100 0
NTONG10001300 100 0
NTONG10001820 39.112 0
NTONG10002140 80.147 0
NTONG10002460 8.07 0
NTONG10002570 100 0
NTONG10002640 67.153 0
NTONG20002650 21.01 6.645
NTONG20003340 27.701 0
NTONG20003630 100 0
NTONG20004920 100 0
NTONG20005830 100 0
NTONG20008000 14.128 0
NTONG20008780 100 0
NTONG20009660 100 0
NTONG20009850 100 0
NTONG20011370 100 0
NTONG20012220 100 0
NTONG20014280 76.302 0
NTONG20015500 52.537 0
NTONG20016120 45.084 0
OCBBF20011240 24.128 0
OCBBF20015860 50.483 0
PROST10002200 22.942 1.209
SKMUS20016340 15.05 4.76
SKNMC20000970 4.833 1.529
STOMA20004820 31.253 9.885
SYNOV10001280 13.986 0
SYNOV20011440 8.499 0
THYMU10000830 27.581 0
TRACH20000790 19.169 0
TRACH20009260 30.323 9.59

TABLE 16
Clone ID FCBBF FEBRA OCBBF BRACE BRALZ BRAMY BRAWH BRCAN BRCOC BRHIP BRSSN BRSTN BRTHA
BRACE- 0 0 0 37.659 0 0 62.341 0 0 0 0 0 0
20028960
BRACE- 0 0 0 17.222 8.739 16.608 28.509 5.549 8.568 5.733 0 0 0
20074010
BRACE- 0 0 0 8.944 0 0 14.807 17.29 26.699 0 0 0 0
20077080
BRACE- 0 0 0 7.291 7.4 2.344 8.046 9.396 3.627 4.854 19.055 18.412 0
20077980
BRACE- 0 0 0 2.86 8.709 8.275 4.735 11.059 12.807 5.713 4.485 17.335 0
20083800
BRACE- 0 0 0 24.099 0 0 39.894 0 0 0 0 0 0
20088570
BRAWH- 0 0 0 0 15.441 0 33.582 9.804 15.139 10.129 15.905 0 0
10000010
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
10000020
BRAWH- 0 0 0 0 0 0 34.097 0 0 0 0 0 0
10000070
BRAWH- 0 0 0 0 0 0 34.637 0 0 0 0 0 0
10000370
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
10000940
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
10001300
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
10001640
BRAWH- 0 0 0 0 0 0 50.775 0 0 0 0 0 0
10001680
BRAWH- 0 0 0 0 0 0 21.077 36.92 19.003 0 0 0 0
10001740
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
10001800
BRAWH- 0 0 0 0 0 0 11.808 0 10.646 0 0 0 0
20000340
BRAWH- 0 0 0 0 0 0 11.808 0 10.646 0 0 0 0
20000340
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20000480
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20000930
BRAWH- 0 0 0 0 0 0 11.171 6.522 0 6.739 0 0 0
20001770
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20002480
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20003230
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20004430
BRAWH- 0 0 0 0 0 0 62.374 0 0 37.626 0 0 0
20004760
BRAWH- 0 0 0 0 0 0 32.294 0 0 38.962 0 0 0
20005030
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20005540
BRAWH- 0 0 0 0 0 3.43 5.888 0 0 0 0 0 0
20006330
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20006510
BRAWH- 0 0 0 0 8.209 0 8.927 2.606 12.073 2.693 8.456 8.171 0
20006970
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20008660
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20008920
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20009010
BRAWH- 0 0 0 0 0 0 18.383 0 0 0 0 0 0
20009440
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20009840

TABLE 17
BRAWH- 0 0 0 0 0 0 69.012 0 0 0 0 0 0
20011030
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20011290
BRAWH- 0 0 0 0 0 1.936 3.323 0 0 0 0 3.042 0
20011660
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20012030
BRAWH- 0 0 0 14.525 11.056 7.004 24.046 7.02 10.84 14.505 0 11.004 0
20014180
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20014380
BRAWH- 0 0 0 0 0 2.145 3.683 0 0 0 0 0 9.34
20014610
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20015030
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20036890
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20038320
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20047310
BRAWH- 0 0 0 0 0 0 63.136 36.864 0 0 0 0 0
20059980
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20060440
BRAWH- 0 0 0 0 0 0 37.381 21.826 0 0 0 0 0
20064930
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20066220
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20069600
BRAWH- 0 0 0 27.609 0 0 45.705 26.686 0 0 0 0 0
20069890
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20074060
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20076050
BRAWH- 0 0 0 0 0 0 36.711 0 0 0 0 0 0
20089560
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20092270
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20092610
BRAWH- 0 0 0 0 0 0 32.978 0 29.733 0 0 0 0
20093600
BRAWH- 0 0 0 0 0 0 100 0 0 0 0 0 0
20094850
IMR32- 0 0 0 5.763 6.58 0 2.385 1.393 0 0 0 15.282 0
20013170
KIDNE- 0 0 0 1.63 0 0 2.698 0 0 0 2.556 0 0
20000850
KIDNE- 0 0 0 0 0 0 40.315 0 0 0 0 0 0
20004220
KIDNE- 0 0 0 0 0 0 9.125 0 0 0 0 0 46.286
20031850
KIDNE- 0 0 0 0 0 0 40.153 0 0 24.222 0 0 0
20050420
MAMGL- 0 0 0 0 0 0 1.157 0 0 0 0 0 0
10000350
NT2NE- 0 0 0 2.567 0 0 4.249 2.481 3.831 0 8.049 0 0
20001740
NT2RI- 0 0 0 0 0 42.005 36.052 0 0 0 0 0 0
20042840
NT2RI- 0 0 0 0 0 0 22.915 0 0 0 0 0 0
20086560
NT2RP- 0 0 0 0 0 0 35.182 20.542 0 0 0 0 0
70002590
NT2RP- 0 0 0 0 0 0 1.855 0 0 1.119 0 0 0
70065270
NT2RP- 0 0 0 0 8.209 0 8.927 2.606 12.073 2.693 8.456 8.171 0
70074220

TABLE 18
NTONG- 0 0 0 0 0 0 6.951 0 6.267 4.193 0 6.362 0
10001820
PEBLM- 0 0 0 0 0 19.082 8.189 0 0 9.88 0 0 0
20001470
PLACE- 0 0 0 0 0 0 35.969 0 0 0 0 0 0
60032040
SKMUS- 0 0 0 0 0 0 24.247 0 0 0 0 0 0
10000140
SMINT- 0 0 0 0 0 0 22.035 0 0 0 0 0 0
20005450
TESTI- 0 0 0 0 0 0 44.17 0 0 0 0 0 0
20004350
TESTI- 0 0 0 0 0 0 20.762 0 18.719 0 0 38.006 0
20008830
TRACH- 0 0 0 0 0 3.68 6.317 0 5.695 0 0 0 0
20007800
TRACH- 0 0 0 0 0 11.565 19.852 0 0 0 0 0 0
20016070
UMVEN- 0 0 0 0 0 0 3.329 0 0 0 0 0 0
20001330
3NB69- 0 0 0 0 2.926 0 0 0 0 0.96 0 1.456 0
10001730
3NB69- 0 0 0 0 0 0.805 0 1.613 1.245 0.833 0 0 0
20002810
ADRGL- 0 0 0 0 0 19.598 0 0 0 0 0 30.792 0
20000740
BNGH4- 0 0 0 0 0 15.04 0 0 0 0 0 0 0
10001370
BNGH4- 0 0 0 0 0 0 0 0 0 0 0 15.451 0
10001980
BRACE- 0 0 0 18.724 0 0 0 0 0 0 0 0 0
10000200
BRACE- 0 0 0 19.762 15.042 0 0 0 29.495 0 0 0 0
10000730
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
10000930
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20000770
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20001000
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20001410
BRACE- 0 0 0 28.46 0 0 0 0 0 28.42 0 43.121 0
20002800
BRACE- 0 0 0 10.059 0 0 0 0 0 0 0 0 0
20003320
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20005050
BRACE- 0 0 0 12.749 6.469 0 0 8.215 6.342 8.487 6.664 0 0
20005250
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20005450
BRACE- 0 0 0 15.282 0 14.737 0 14.771 0 0 0 0 0
20005650
BRACE- 0 0 0 15.282 0 14.737 0 14.771 0 0 0 0 0
20005650
BRACE- 0 0 0 62.564 0 0 0 0 0 0 0 0 0
20005770
BRACE- 0 0 0 17.865 0 0 0 0 26.664 0 0 0 0
20006980
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20007180
BRACE- 0 0 0 15.638 0 0 0 0 0 0 0 0 0
20008850
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20009880
BRACE- 0 0 0 16.902 51.46 0 0 0 0 0 0 0 0
20010650
BRACE- 0 0 0 38.94 0 0 0 0 0 0 61.06 0 0
20010700
BRACE- 0 0 0 2.249 3.424 0 0 0 0 0 0 0 0
20011170

TABLE 19
BRACE- 0 0 0 23.186 0 0 0 0 0 0 0 0 0
20011430
BRACE- 0 0 0 23.186 0 0 0 0 0 0 0 0 0
20011430
BRACE- 0 0 0 2.733 4.16 0 0 0 0 0 0 0 0
20011880
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20013400
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20013520
BRACE- 0 0 0 50.907 0 49.093 0 0 0 0 0 0 0
20013740
BRACE- 0 0 0 24 0 0 0 0 0 0 0 0 0
20013750
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20014230
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20014530
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20014550
BRACE- 0 0 0 8.901 0 0 0 0 0 8.888 0 0 0
20014770
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20014920
BRACE- 0 0 0 17.694 0 0 0 0 0 0 0 0 0
20015080
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20015430
BRACE- 0 0 0 23.14 0 0 0 0 0 0 0 35.06 0
20016730
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20016920
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20017370
BRACE- 0 0 0 8.117 0 0 0 0 0 0 0 0 0
20018550
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20018590
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20018650
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20018980
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20021510
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20021760
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20022020
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20022270
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20024090
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20024090
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20024310
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20024680
BRACE- 0 0 0 39.759 0 0 0 0 0 0 0 60.241 0
20024950
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20025900
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20026350
BRACE- 0 0 0 23.391 0 0 0 0 0 0 0 0 0
20026850
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20027360
BRACE- 0 0 0 29.06 0 0 0 0 0 0 0 0 0
20027520
BRACE- 0 0 0 34.821 0 0 0 0 0 0 0 0 0
20027550

TABLE 20
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20027720
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20027920
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20027960
BRACE- 0 0 0 59.705 0 0 0 0 0 0 18.724 0 0
20028120
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20028600
BRACE- 0 0 0 39.759 0 0 0 0 0 0 0 60.241 0
20030780
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20032850
BRACE- 0 0 0 23.804 0 0 0 0 0 0 0 0 0
20033190
BRACE- 0 0 0 39.646 60.354 0 0 0 0 0 0 0 0
20033980
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20034310
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20035160
BRACE- 0 0 0 2.721 0 0 0 0 0 0 0 0 0
20035940
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20071380
BRACE- 0 0 0 50.85 0 0 0 49.15 0 0 0 0 0
20071530
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20071970
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20072010
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20072320
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20072810
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20074470
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20075020
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20075270
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20075380
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20075630
BRACE- 0 0 0 2.87 0 0 0 0 0 0 0 0 0
20076210
BRACE- 0 0 0 50.907 0 49.093 0 0 0 0 0 0 0
20076460
BRACE- 0 0 0 75.026 0 0 0 0 0 24.974 0 0 0
20076630
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20076850
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20077610
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20077640
BRACE- 0 0 0 18.376 0 0 0 0 0 0 0 0 0
20077670
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20077840
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20078680
BRACE- 0 0 0 40.241 0 0 0 0 0 0 0 0 0
20079020
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20079530
BRACE- 0 0 0 13.841 0 0 0 0 20.658 0 0 0 0
20080970
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20081140

TABLE 21
BRACE- 0 0 0 13.995 0 0 0 0 20.888 0 0 21.205 0
20083850
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20084430
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20084880
BRACE- 0 0 0 24.161 0 0 0 0 0 0 0 0 0
20086530
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20086550
BRACE- 0 0 0 56.896 0 0 0 0 0 0 0 43.104 0
20087080
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20087540
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20089600
BRACE- 0 0 0 17.942 0 0 0 0 0 0 0 0 0
20089990
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20090140
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20091880
BRACE- 0 0 0 38.389 0 0 0 0 0 0 0 0 0
20092120
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20092750
BRACE- 0 0 0 26.36 0 0 0 0 0 26.323 0 0 0
20093070
BRACE- 0 0 0 50.907 0 49.093 0 0 0 0 0 0 0
20093110
BRACE- 0 0 0 100 0 0 0 0 0 0 0 0 0
20094370
CTONG- 0 0 0 0 0 0 0 0 0 0 0 0 81.043
20008270
CTONG- 0 0 0 0 0 0 0 0 0 0 31.824 0 0
20013200
CTONG- 0 0 0 0 0 0 0 49.28 0 0 0 0 0
20020730
CTONG- 0 0 0 0 0 0 0 0 36.973 0 0 0 0
20064490
HHDPC- 0 0 0 0 0 0 0 2.27 0 0 0 1.779 0
20000950
HHDPC- 0 0 0 0 0 7.181 0 0 0 0 0 0 0
20001150
HHDPC- 0 0 0 0 0 0 0 0 0 0 0 14.647 0
20004560
HSYRA- 0 0 0 0 0 6.902 0 0 0 14.294 0 0 0
10001780
HSYRA- 0 0 0 0 2.439 0 0 0 0 0 2.512 2.427 0
20008280
HSYRA- 0 0 0 0 19.869 0 0 0 0 0 0 0 0
20011530
IMR32- 0 0 0 0 0 0 0 0 0 12.063 0 0 0
10002660
IMR32- 0 0 0 0 0 0 0 0 0 4.348 0 0 0
20003020
IMR32- 0 0 0 0 0 0 0 0 0 5.491 12.933 0 0
20009350
KIDNE- 0 0 0 0 0 0 0 0 0 0 0 0 58.701
20003300
KIDNE- 0 0 0 0 0 0 0 0 0 0 0 0 35.702
20004970
KIDNE- 0 0 0 0 0 0 0 0 0 18.476 0 0 0
20005170
KIDNE- 0 0 0 0 0 0 0 0 0 11.97 0 0 0
20059370
KIDNE- 0 0 0 0 0 15.848 0 0 0 0 0 0 0
20068800
KIDNE- 0 0 0 0 0 0 0 0 0 3.085 0 0 0
20073280
LIVER- 0 0 0 0 0.637 0 0 0 0 0 0 0 0
20000370

TABLE 22
MESAN- 0 0 0 30.348 0 0 0 0 0 0 0 0 0
20002670
NT2NE- 0 0 0 0 0 38.711 0 0 0 0 0 0 0
20005170
NT2NE- 0 0 0 0 40.251 0 0 0 0 0 0 0 0
20011560
NT2NE- 0 0 0 0 0 0 0 0 0 0 50.666 0 0
20013640
NT2NE- 0 0 0 0 0 38.711 0 0 0 0 0 0 0
20016970
NT2RI- 0 0 0 0 0 1.611 0 0 0 0 2.619 0 0
20006710
NT2RI- 0 0 0 0 0 0 0 9.103 0 0 0 0 0
20009740
NT2RI- 0 0 0 0 0 21.469 0 0 0 0 0 0 0
20022430
NT2RI- 0 0 0 0 0 0 0 24.543 0 0 0 0 0
20025300
NT2RI- 0 0 0 0 0 37.52 0 0 0 0 0 0 0
20028020
NT2RI- 0 0 0 0 0 0 0 0 0 0 0 27.171 0
20029260
NT2RI- 0 0 0 2.704 0 0 0 0 0 0 0 0 0
20030110
NT2RI- 0 0 0 0 0 0 0 0 7.544 0 0 0 0
20030510
NT2RI- 0 0 0 0 14.174 0 0 0 0 0 0 0 0
20040590
NT2RI- 0 0 0 6.506 0 0 0 0 0 0 0 0 0
20046060
NT2RI- 0 0 0 0 0 48.905 0 0 0 0 0 0 0
20049840
NT2RI- 0 0 0 0 25.927 16.425 0 0 0 0 0 0 0
20049850
NT2RI- 0 0 0 0 0 0 0 0 0 0 0.791 0 0
20056470
NT2RI- 0 0 0 0 0 0 0 34.563 0 0 0 0 0
20060720
NT2RI- 0 0 0 0 0 0 0 0 0 4.348 0 0 0
20062100
NT2RI- 0 0 0 0 0 0 0 0 0 27.843 0 0 0
20067350
NT2RI- 0 0 0 0 0 0 0 0 0 0 0 60.06 0
20068250
NT2RI- 0 0 0 0 0 0 0 0 8.203 0 0 0 0
20070840
NT2RI- 0 0 0 0 60.173 0 0 0 0 0 0 0 0
20070960
NT2RI- 0 0 0 0 0 7.713 0 0 0 0 0 0 33.576
20071480
NT2RI- 0 0 0 0 0 0 0 20.831 0 0 0 0 0
20072540
NT2RI- 0 0 0 0 0 0 0 0 0 0 0 0 5.656
20074980
NT2RI- 0 0 0 0 0 0 0 0 0 1.73 0 0 0
20085260
NT2RI- 0 0 0 0 0 14.618 0 0 0 0 0 22.966 0
20088120
NT2RI- 0 0 0 5.633 0 0 0 5.445 0 11.251 0 0 0
20090660
NT2RI- 0 0 0 0 0 23.893 0 0 0 0 0 0 0
20090830
NT2RP- 0 0 0 0 0 0 0 0 50.126 0 0 0 0
70013060
NT2RP- 0 0 0 0 0 0 0 19.67 22.78 10.161 7.978 0 0
70013350
NT2RP- 0 0 0 0 0 0 0 0 0 0 0 0 50.521
70023760
NT2RP- 0 0 0 0 0 0 0 0 0 26.32 0 0 0
70024500
NT2RP- 0 0 0 0 0 0 0 0 0 6.997 21.973 0 0
70030910

TABLE 23
NT2RP- 0 0 0 0 0 5.755 0 0 0 5.959 0 0 0
70036320
NT2RP- 0 0 0 0 0 0 0 0 25.125 16.811 0 0 0
70036470
NT2RP- 0 0 0 0 0 0 0 39.426 0 0 0 0 0
70042330
NT2RP- 0 0 0 0 50.62 0 0 0 0 0 0 0 0
70054930
NT2RP- 0 0 0 0 0 0 0 0 0 0 0 33.469 0
70064900
NT2RP- 0 0 0 0 0 0 0 0 16.656 0 0 0 0
70071140
NT2RP- 0 0 0 0 0 0 0 0 0 3.241 0 0 0
70075370
NT2RP- 0 0 0 8.084 0 0 0 7.814 0 0 0 0 0
70076100
NT2RP- 0 0 0 6.271 0 2.016 0 0 0 0 0 0 0
70079750
NT2RP- 0 0 0 0 0 0 0 0 0 0 0 0 73.871
70081370
NT2RP- 0 0 0 0 0 0 0 0 0 0 0 50.503 0
70090120
NT2RP- 0 0 0 0 50.62 0 0 0 0 0 0 0 0
70091490
NT2RP- 0 0 0 0 0 19.45 0 0 0 0 0 0 0
70093730
NTONG- 0 0 0 0 0 23.698 0 0 0 0 0 0 0
20014280
NTONG- 0 0 0 0 0 0 0 0 0 16.897 0 0 0
20015500
PEBLM- 0 0 0 0 0 23.344 0 0 0 0 0 0 0
10000340
PLACE- 0 0 0 0 0 0 0 0 0 3.198 0 0 0
60014430
PLACE- 0 0 0 0 0 0 0 0 0 1.807 0 0 0
60020840
PLACE- 0 0 0 0 0 18.179 0 0 0 0 0 0 0
60024190
PLACE- 0 0 0 0 0 39.559 0 0 0 0 0 0 0
60026920
PLACE- 0 0 0 0 0 31.763 0 0 0 0 0 0 0
60030380
PLACE- 0 0 0 0 0 0 0 0 0 0 0 33.856 0
60038500
PLACE- 0 0 0 0 13.149 0 0 8.349 12.892 0 6.772 0 0
60043970
PROST- 0 0 0 40.095 0 0 0 0 0 0 0 0 0
10002720
PROST- 0 0 0 0 11.605 0 0 0 0 0 0 0 0
20000530
PROST- 0 0 0 0 0 39.227 0 0 0 0 0 0 0
20021620
PROST- 0 0 0 8.436 0 4.068 0 0 6.295 8.424 6.614 0 0
20032320
PROST- 0 0 0 40.252 0 0 0 9.726 0 0 0 0 0
20033380
PROST- 0 0 0 0 0 0 0 0 0 13.599 0 0 0
20062600
SALGL- 0 0 0 0 0 0 0 0 0 0 0 1.103 0
10000050
SALGL- 0 0 0 0 0 0 0 0 0 0 1.042 0 0
10001570
SKMUS- 0 0 0 3.263 0 0 0 6.308 9.741 0 5.117 0 0
10000220
SKMUS- 0 0 0 0 33.898 0 0 0 0 0 0 0 0
20001170
SKMUS- 0 0 0 14.288 0 0 0 0 0 0 0 43.297 0
20002710
SKMUS- 0 0 0 5.866 0 0 0 5.67 0 0 9.198 8.888 0
20009540
SKMUS- 0 0 0 0 0 17.838 0 0 0 0 0 0 0
20011290

TABLE 24
SKMUS- 0 0 0 11.766 0 0 0 0 0 0 0 0 0
20015010
SKMUS- 0 0 0 25.198 0 0 0 0 0 0 0 0 0
20015430
SKMUS- 0 0 0 0 7.379 0 0 0 7.234 0 0 0 0
20016340
SKNMC- 0 0 0 0 0 4.105 0 0 0 0 0 0 0
20002240
SKNMC- 0 0 0 0 0 6.882 0 0 0 0 0 5.406 0
20015030
SKNSH- 0 0 0 27.517 0 0 0 0 0 0 0 0 0
20001510
SMINT- 0 0 0 0 0 39.345 0 0 0 0 0 0 0
10001000
SMINT- 0 0 0 0 0 0 0 0 0 0 0 24.589 0
20002390
SPLEN- 0 0 0 0 0 0 0 0 0 0 0 0 85.137
20001970
STOMA- 0 0 0 0 0 0 0 0 0 0 0 0 6.046
20001210
STOMA- 0 0 0 0 0 0 0 0 0 0 13.006 0 0
20002570
SYNOV- 0 0 0 0 0 0 0 0 0 44.213 0 0 0
20002910
SYNOV- 0 0 0 2.737 0 0 0 0 0 0 12.876 4.147 11.491
20011440
TESTI- 0 0 0 0 0 0 0 0 0 7.619 0 0 0
10000510
TESTI- 0 0 0 0 0 16.555 0 0 0 17.143 0 0 0
10000700
TESTI- 0 0 0 0 0 8.261 0 0 0 0 0 0 0
10001680
TESTI- 0 0 0 0 0 0 0 0 0 0 0 38.108 0
20005200
TESTI- 0 0 0 0 0 21.276 0 0 0 0 0 0 0
20015110
TESTI- 0 0 0 0 0 0 0 7.673 0 0 0 0 0
20018290
TESTI- 0 0 0 0 0 0 0 61.764 0 0 0 0 0
20018690
TESTI- 0 0 0 0 0 0 0 0 0 62.532 0 0 0
20018980
TESTI- 0 0 0 0 0 0 0 0 0 0 0 25.049 0
20024670
TESTI- 0 0 0 11.93 36.321 0 0 23.061 0 0 0 0 0
20032800
TESTI- 0 0 0 18.795 0 0 0 0 0 0 0 0 0
20033250
TESTI- 0 0 0 0 0 0 0 0 0 0 16.219 0 0
20036250
TESTI- 0 0 0 0 0 0 0 61.764 0 0 0 0 0
20136910
THYMU- 0 0 0 0 0 8.566 0 0 0 0 0 0 0
10000830
THYMU- 0 0 0 0 0 0 0 0 33.614 0 0 0 0
10003290
THYMU- 0 0 0 0 0 0 0 0 0 0 0 3.029 0
10003590
UTERU- 0 0 0 0 0 0 0 0 0 0 49.42 0 0
10000960
UTERU- 0 0 0 0 0 0 0 0 0 0 49.42 0 0
20005690
ADRGL- 48.889 0 0 0 0 0 0 0 0 0 0 0 0
10000650
BGGI1- 2.298 0 0 0 0 2.847 0 0 0 0 0 0 0
20010970
BRACE- 1.899 0 0 2.44 0 0 0 0 0 0 0 0 0
20004210
BRACE- 9.224 0 0 23.701 0 0 0 11.454 17.687 0 0 0 0
20020500
BRACE- 10.127 0 0 13.011 0 0 0 0 0 0 0 0 0
20020910

TABLE 25
BRACE- 28.014 0 0 71.986 0 0 0 0 0 0 0 0 0
20024780
BRACE- 2.126 0 0 2.732 0 0 0 0 0 0 0 0 0
20028610
BRACE- 43.768 0 0 56.232 0 0 0 0 0 0 0 0 0
20031100
BRACE- 9.11 0 0 11.704 0 0 0 5.656 0 0 9.176 0 0
20035270
BRACE- 13.023 0 0 16.732 0 0 0 0 0 0 0 0 70.246
20035390
BRACE- 21.571 0 0 27.714 0 0 0 0 0 0 0 0 0
20071740
BRACE- 23.581 0 0 30.297 46.122 0 0 0 0 0 0 0 0
20077270
BRAWH- 31.981 0 0 0 0 0 68.019 0 0 0 0 0 0
20001090
CTONG- 18.811 0 0 0 0 0 0 0 0 0 0 0 0
20024530
CTONG- 44.214 0 0 0 0 0 0 0 0 0 0 0 0
20028200
CTONG- 30.136 0 0 0 0 0 0 0 0 0 0 0 0
20055530
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
10005980
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
10006180
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
10006870
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
10006910
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
10007320
FCBBF- 8.367 0 0 0 0 0 3.559 0 0 0 0 0 0
10007600
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
20000940
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
20001050
FCBBF- 34.637 0 0 0 0 0 0 0 0 0 0 0 0
20001950
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
20002320
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
20002760
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
20005760
FCBBF- 8.519 0 0 0 0 0 0 0 0 0 0 0 0
20005910
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
20006770
FCBBF- 33.171 0 0 0 0 0 0 0 0 0 66.829 0 0
20007330
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
20008080
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
20008150
FCBBF- 23.045 0 0 14.804 0 0 0 0 0 0 0 0 62.152
20009400
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
20009510
FCBBF- 14.958 0 0 0 0 18.533 0 18.575 0 0 0 0 0
20012110
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
20012990
FCBBF- 44.606 0 0 0 0 0 0 55.394 0 0 0 0 0
20014800
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
20016720
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
20017180
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
20017200

TABLE 26
FCBBF- 100 0 0 0 0 0 0 0 0 0 0 0 0
40002820
HCASM- 1.105 0 0 0 0 1.369 0 0 0 1.417 0 0 0
10001150
HHDPC- 6.308 0 0 8.105 0 0 0 0 0 0 0 0 0
20001490
HLUNG- 12.676 0 0 0 0 0 0 0 0 0 0 0 0
10000640
HLUNG- 6.906 0 0 0 0 4.278 7.344 8.576 0 0 0 6.722 0
20003140
HLUNG- 1.306 0 0 0 5.108 0 2.778 4.865 0 1.676 2.631 0 0
20005010
HSYRA- 5.798 0 0 0 0 7.183 0 0 0 7.438 0 0 0
20001350
HSYRA- 5.57 0 0 0 0 0 0 0 5.34 0 0 0 0
20014760
HSYRA- 20.226 0 0 0 0 0 0 0 0 0 0 0 0
20016310
IMR32- 1.259 0 0 1.617 7.386 0 0 0 0 0 0 0 0
20007420
IMR32- 1.911 0 0 0 0 0 0 0 0 0 0 0 0
20009730
IMR32- 5.075 0 0 0 0 0 0 0 0 0 0 0 0
20009840
IMR32- 2.92 0 0 3.752 0 0 0 0 0 0 0 5.685 0
20012180
IMR32- 1.349 0 0 3.466 0 0 0 0 0 0 0 2.626 0
20013320
KIDNE- 3.71 0 0 9.532 0 4.596 0 0 0 0 14.947 0 0
20002660
KIDNE- 25.852 0 0 0 0 0 0 0 0 0 0 0 0
20056760
KIDNE- 4.679 0 0 8.016 0 0 6.635 0 0 10.006 0 0 0
20073520
LIVER- 7.091 0 0 0 0 0 15.081 0 0 9.098 0 13.803 0
20004160
MESAN- 15.635 0 0 0 0 0 33.255 0 0 0 0 0 0
20000920
NT2NE- 11.539 0 0 0 0 0 0 0 0 0 0 0 0
20015300
NT2NE- 5.488 0 0 0 0 6.8 0 0 0 0 0 0 0
20035690
NT2RI- 7.537 0 0 0 0 0 0 0 0 0 0 0 0
20010910
NT2RI- 8.216 0 0 0 0 0 17.474 0 0 0 16.552 0 0
20016210
NT2RI- 1.129 0 0 0 0 0 0 0 2.165 0 0 0 0
20016570
NT2RI- 0.876 0 0 0 0 0 1.863 0 0 0 1.764 0 0
20033040
NT2RI- 24.272 0 0 0 0 0 0 0 0 0 0 0 0
20033440
NT2RI- 6.517 0 0 0 0 4.037 0 0 6.248 0 0 0 0
20058110
NT2RI- 43.582 0 0 0 0 0 0 0 0 0 0 0 0
20065060
NT2RI- 1.493 0 0 0 0 0 1.587 1.853 0 0 1.503 0 4.025
20087490
NT2RP- 1.537 0 0 0 0 0 0 0 2.947 0 0 0 0
60000720
NT2RP- 7.63 0 0 0 0 9.454 0 0 14.632 9.79 0 14.854 0
70002710
NT2RP- 51.164 0 0 0 0 0 0 0 0 0 0 0 0
70012310
NT2RP- 6.873 0 0 0 0 0 7.309 4.267 6.589 0 13.846 0 0
70036800
NT2RP- 2.574 0 0 0 0 0 5.475 0 0 0 0 0 0
70055020
NT2RP- 1.702 0 0 0 0 0 0 0 0 2.184 0 0 0
70055130
NT2RP- 10.819 0 0 0 0 0 0 0 0 0 0 0 0
70061880

TABLE 27
NT2RP- 34.389 0 0 0 0 0 0 0 0 0 0 0 0
70084410
PLACE- 2.922 0 0 0 0 0 0 0 0 3.749 0 0 15.76
60037450
PLACE- 10.959 0 0 0 0 0 0 0 0 0 0 0 0
60049310
PROST- 6.046 0 0 0 0 0 12.858 7.508 0 0 0 0 0
10005260
PROST- 34.251 0 0 0 0 0 0 0 0 0 0 0 0
20018230
PROST- 16.176 0 0 0 0 0 0 0 0 0 0 0 0
20051430
SKMUS- 9.448 0 0 0 18.48 0 0 0 0 0 0 0 0
20000740
SKMUS- 11.578 0 0 0 0 0 0 0 0 0 0 0 0
20011470
SKNMC- 3.771 0 0 0 0 0 0 0 0 0 0 0 0
20003560
SKNSH- 19.559 0 0 0 0 0 0 0 0 0 0 0 0
20001630
SPLEN- 51.503 0 0 0 0 0 0 0 0 0 0 0 0
10000490
STOMA- 0.658 0 0 1.692 3.864 2.448 0 4.906 2.525 0.845 0 2.564 0
20002890
SYNOV- 5.862 0 0 0 0 0 0 0 0 0 0 0 0
20013740
TESTI- 21.79 0 0 0 0 0 0 0 0 27.957 0 0 0
20011410
TESTI- 32.749 0 0 42.075 0 0 0 0 0 0 0 0 0
20033760
TESTI- 6.367 0 0 0 0 0 0 0 0 0 0 0 0
20074640
TRACH- 11.784 0 0 0 0 0 12.532 0 0 0 0 0 0
10000300
TRACH- 6.119 0 0 0 0 7.582 0 0 0 0 0 0 0
20013950
3NB69- 0 2.236 0 2.115 1.073 0.68 0 0 0 0 2.211 2.136 0
20003300
3NB69- 0 2.076 0 7.854 0 0 0 0 0 0 3.079 0 0
20009120
ADRGL- 0 11.553 0 32.778 0 0 18.087 0 0 10.911 0 0 0
10000180
BRACE- 0 0.896 0 5.51 7.743 0.409 3.508 1.639 0 0 2.658 3.211 0
10001150
BRACE- 0 1.786 0 3.378 5.142 0 0 3.265 0 0 0 0 0
10001590
BRACE- 0 26.07 0 49.31 0 0 0 0 0 24.62 0 0 0
10001690
BRACE- 0 61.348 0 19.339 0 0 0 0 0 19.312 0 0 0
20077680
BRACE- 0 7.585 0 7.173 0 0 0 6.933 0 0 0 0 0
20092740
BRACE- 0 34.081 0 16.116 24.533 0 0 0 0 0 25.27 0 0
20093610
BRACE- 0 8.101 0 22.983 0 7.388 0 0 0 7.65 0 0 0
20095170
BRAWH- 0 9.604 0 27.247 0 0 15.035 0 0 0 0 0 0
20011410
BRAWH- 0 6.779 0 12.822 0 0 10.613 0 0 0 10.053 0 0
20036930
BRAWH- 0 8.436 0 0 0 0 52.827 7.711 0 0 0 0 0
20064500
BRAWH- 0 11.947 0 0 0 0 37.407 0 0 33.848 0 0 0
20087060
CTONG- 0 51.848 0 0 0 0 0 0 0 0 0 0 0
20019110
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20000350
FEBRA- 0 51.43 0 0 0 0 0 0 0 48.57 0 0 0
20000530
FEBRA- 0 26.32 0 0 0 0 0 0 0 0 0 0 0
20001050

TABLE 28
FEBRA- 0 2.84 0 0 0 0 0 0 0 0 0 0 0
20001290
FEBRA- 0 56.251 0 0 0 0 0 0 0 0 0 0 0
20003110
FEBRA- 0 61.348 0 19.339 0 0 0 0 0 19.312 0 0 0
20003300
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20003780
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20003910
FEBRA- 0 24.941 0 0 0 0 39.046 0 0 0 0 0 0
20003970
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20003990
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20004040
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20004150
FEBRA- 0 30.224 0 0 0 0 0 0 0 0 0 0 0
20004540
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20004910
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20006560
FEBRA- 0 18.007 0 0 0 0 0 0 0 0 0 0 0
20006800
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20006900
FEBRA- 0 27.886 0 0 0 0 0 12.745 0 0 0 0 0
20007330
FEBRA- 0 2.356 0 0 0 0 3.689 0 0 0 0 3.376 0
20007400
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20007710
FEBRA- 0 52.244 0 0 0 0 0 47.756 0 0 0 0 0
20007720
FEBRA- 0 11.14 0 10.535 0 30.48 0 0 15.724 0 0 0 0
20007870
FEBRA- 0 51.395 0 48.605 0 0 0 0 0 0 0 0 0
20008090
FEBRA- 0 46.91 0 0 0 0 0 0 0 0 0 0 0
20008560
FEBRA- 0 19.721 0 18.651 0 0 0 18.027 0 0 0 0 0
20008800
FEBRA- 0 6.596 0 0 0 0 0 0 0 0 0 0 0
20008810
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20009590
FEBRA- 0 27.255 0 0 0 0 0 0 0 0 0 0 0
20009720
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20010930
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20011330
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20011460
FEBRA- 0 42.467 0 0 0 0 0 0 19.98 13.369 0 0 0
20012270
FEBRA- 0 8.079 0 0 0 0 0 0 0 0 0 0 0
20012940
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20013510
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20014870
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20015900
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20015910
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20017060
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20017900

TABLE 29
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20019890
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20020860
FEBRA- 0 56.251 0 0 0 0 0 0 0 0 0 0 0
20024290
FEBRA- 0 52.244 0 0 0 0 0 47.756 0 0 0 0 0
20024420
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20027270
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20027830
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20028820
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20028970
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20029080
FEBRA- 0 51.395 0 48.605 0 0 0 0 0 0 0 0 0
20030540
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20031550
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20033080
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20034290
FEBRA- 0 52.244 0 0 0 0 0 47.756 0 0 0 0 0
20037070
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20041100
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20041910
FEBRA- 0 1.855 0 0 2.67 0 0 0 0 1.752 5.501 5.315 0
20042240
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20042370
FEBRA- 0 63.862 0 0 0 0 0 0 0 0 0 0 0
20042930
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20043290
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20044430
FEBRA- 0 76.687 0 0 0 23.313 0 0 0 0 0 0 0
20044900
FEBRA- 0 40.275 0 0 0 0 0 0 0 0 59.725 0 0
20045920
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20048180
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20050140
FEBRA- 0 68.681 0 0 0 31.319 0 0 0 0 0 0 0
20050790
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20052160
FEBRA- 0 26.264 0 0 0 0 0 0 0 0 0 0 0
20053770
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20053800
FEBRA- 0 38.978 0 0 0 0 61.022 0 0 0 0 0 0
20054270
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20057260
FEBRA- 0 9.767 0 0 14.061 0 0 0 0 0 0 13.994 0
20057520
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20059980
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20060920
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20061500
FEBRA- 0 6.614 0 0 0 6.032 0 0 0 0 0 0 26.259
20062700

TABLE 30
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20063150
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20063540
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20064760
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20066670
FEBRA- 0 29.836 0 28.216 0 0 0 0 0 0 0 0 0
20067360
FEBRA- 0 41.591 0 0 0 0 0 0 0 0 0 0 0
20067930
FEBRA- 0 13.327 0 0 0 0 0 6.091 0 6.293 0 0 0
20068730
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20069420
FEBRA- 0 58.145 0 0 41.855 0 0 0 0 0 0 0 0
20070170
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20072000
FEBRA- 0 25.289 0 0 0 0 0 0 0 0 0 0 0
20072800
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20074140
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20075510
FEBRA- 0 100 0 0 0 0 0 0 0 0 0 0 0
20075660
HSYRA- 0 8.487 0 0 0 10.321 0 0 0 2.672 0 0 11.233
20006400
HSYRA- 0 11.901 0 0 0 0 0 0 0 0 0 0 0
20015800
IMR32- 0 2.396 0 4.532 3.45 0 3.751 0 0 0 0 3.433 0
20002230
KIDNE- 0 3.312 0 3.132 2.384 3.021 2.593 0 2.338 4.692 0 9.492 0
20005740
KIDNE- 0 41.858 0 0 0 0 0 0 0 0 0 0 0
20053360
NT2NE- 0 7.99 0 0 0 0 0 0 0 7.546 11.849 0 0
20002140
NT2NE- 0 20.031 0 9.472 0 0 0 0 0 0 0 0 0
20003270
NT2NE- 0 4.178 0 0 0 0 0 0 5.897 0 0 0 0
20003840
NT2NE- 0 12.224 0 11.56 5.866 3.716 12.758 0 0 3.848 0 0 0
20007870
NT2NE- 0 29.779 0 0 0 0 0 27.221 0 0 0 0 0
20047160
NT2NE- 0 4.057 0 0 0 0 3.811 2.225 1.145 1.533 0 1.163 3.222
20053710
NT2RI- 0 12.493 0 0 0 0 0 0 0 0 0 0 0
20025410
NT2RI- 0 4.83 0 0 0 6.608 0 0 0 9.123 3.581 0 0
20051500
NT2RI- 0 20.676 0 0 29.767 0 0 0 0 0 0 0 0
20055640
NT2RI- 0 8.776 0 0 0 16.008 0 8.022 0 0 0 0 0
20058510
NT2RI- 0 67.731 0 0 0 0 0 0 0 0 0 0 0
20061830
NT2RI- 0 3.043 0 2.877 0 24.975 4.763 8.344 4.295 2.873 0 0 0
20064120
NT2RI- 0 4.842 0 0 0 0 0 0 0 0 0 0 0
20071330
NT2RI- 0 17.093 0 4.041 6.152 0 13.38 3.906 0 0 12.674 0 0
20075890
NT2RI- 0 7.683 0 0 0 7.007 0 0 0 0 0 0 0
20077230
NT2RI- 0 19.011 0 0 0 0 0 0 0 0 0 13.621 0
20094060
NT2RP- 0 16.014 0 0 0 0 0 0 0 0 23.748 0 0
70002380

TABLE 31
NT2RP- 0 6.136 0 0 0 0 0 0 0 0 0 8.792 0
70009060
NT2RP- 0 15.95 0 0 0 0 0 0 0 0 0 0 0
70015910
NT2RP- 0 41.591 0 0 0 0 0 0 0 0 0 0 0
70094810
NT2RP- 0 31.425 0 0 0 0 0 0 0 0 0 0 0
70094980
PLACE- 0 10.915 0 0 0 0 17.088 0 0 0 0 0 0
60012810
PLACE- 0 12.224 0 11.56 5.866 3.716 12.758 0 0 3.848 0 0 0
60040050
SKMUS- 0 1.929 0 0 0 0 3.019 1.763 2.722 0 2.86 0 0
20008630
SKNMC- 0 4.704 0 0 0 0 0 0 0 0 0 0 0
20003050
SKNSH- 0 11.274 0 0 0 0 17.649 0 0 10.647 0 0 0
20003470
TESTI- 0 32.494 0 30.73 0 0 0 0 0 0 0 0 0
20003560
TESTI- 0 6.873 0 0 0 0 0 0 0 3.245 0 0 0
20012690
TESTI- 0 2.471 0 2.337 0 0 0 0 0 0 0 0 0
20030710
TESTI- 0 10.101 0 12.736 0 7.677 5.271 1.539 0 6.359 4.993 28.947 0
20082400
TRACH- 0 10.327 0 0 0 0 16.167 0 0 0 15.314 0 0
20009260
3NB69- 0 0 4.677 0 0 2.97 0 2.977 0 0 0 0 12.929
10001160
3NB69- 0 0 7.604 0 0 0 8.289 0 0 0 0 0 0
20015280
BRACE- 0 0 23.494 15.469 0 0 0 14.952 0 0 0 0 0
10000700
BRACE- 0 0 18.376 24.2 18.42 0 20.03 0 0 0 18.974 0 0
20019440
BRAWH- 0 0 49.094 0 0 0 26.756 0 0 0 0 0 0
20052250
KIDNE- 0 0 18.126 0 0 0 0 0 0 0 0 0 0
20045340
NT2NE- 0 0 10.019 0 0 0 0 0 0 0 0 0 0
20002590
NT2NE- 0 0 17.607 11.594 0 0 0 0 0 0 18.18 0 0
20014030
NT2RI- 0 0 60.117 0 0 0 0 0 0 0 0 0 0
20020220
NT2RI- 0 0 7.839 2.581 7.858 2.489 0 7.484 0 5.155 0 0 10.836
20026540
NT2RI- 0 0 27.482 54.286 0 0 0 0 0 0 0 0 0
20060710
NT2RI- 0 0 17.159 0 0 0 0 5.46 0 5.641 0 0 0
20083960
NT2RI- 0 0 6.466 0 0 4.106 0 0 0 4.252 0 0 0
20084810
NT2RP- 0 0 2.798 0 0 0 0 1.781 0 0 0 0 7.735
70011660
NT2RP- 0 0 50.561 0 0 0 0 0 0 0 0 0 0
70021510
NT2RP- 0 0 23.216 0 0 0 0 0 0 15.265 0 0 0
70024490
NT2RP- 0 0 19.395 0 0 0 0 0 0 0 0 0 0
70026190
NT2RP- 0 0 15.654 0 0 0 0 0 0 0 0 0 0
70039600
NT2RP- 0 0 56.829 0 0 0 0 0 0 0 0 0 0
70049250
NT2RP- 0 0 9.68 0 0 0 0 0 0 6.365 0 0 0
70071770
NT2RP- 0 0 24.62 0 0 0 0 0 0 16.188 25.42 0 0
70093940
NTONG- 0 0 32.847 0 0 0 0 0 0 0 0 0 0
10002640

TABLE 32
NTONG- 0 0 10.276 0 0 0 0 0 0 6.757 0 0 0
20002650
OCBBF- 0 0 100 0 0 0 0 0 0 0 0 0 0
10000420
OCBBF- 0 0 100 0 0 0 0 0 0 0 0 0 0
10000670
OCBBF- 0 0 100 0 0 0 0 0 0 0 0 0 0
10000860
OCBBF- 0 0 100 0 0 0 0 0 0 0 0 0 0
10000910
OCBBF- 0 0 100 0 0 0 0 0 0 0 0 0 0
10001040
OCBBF- 0 0 100 0 0 0 0 0 0 0 0 0 0
10001180
OCBBF- 0 0 100 0 0 0 0 0 0 0 0 0 0
10001190
OCBBF- 0 0 100 0 0 0 0 0 0 0 0 0 0
10001220
OCBBF- 0 0 60.117 0 0 0 0 0 0 0 0 0 0
20002770
OCBBF- 0 0 50.533 0 0 0 0 0 0 0 0 0 0
20002870
OCBBF- 0 0 100 0 0 0 0 0 0 0 0 0 0
20007190
OCBBF- 0 0 100 0 0 0 0 0 0 0 0 0 0
20008240
OCBBF- 0 0 100 0 0 0 0 0 0 0 0 0 0
20009980
OCBBF- 0 0 100 0 0 0 0 0 0 0 0 0 0
20010750
OCBBF- 0 0 100 0 0 0 0 0 0 0 0 0 0
20011010
OCBBF- 0 0 100 0 0 0 0 0 0 0 0 0 0
20011400
OCBBF- 0 0 100 0 0 0 0 0 0 0 0 0 0
20011760
OCBBF- 0 0 60.331 0 0 0 0 0 0 39.669 0 0 0
20014080
OCBBF- 0 0 50.836 0 0 0 0 0 0 0 0 0 0
20014940
OCBBF- 0 0 100 0 0 0 0 0 0 0 0 0 0
20015270
OCBBF- 0 0 71.737 0 0 0 0 0 0 0 0 0 0
20015280
OCBBF- 0 0 24.693 0 0 0 0 0 0 0 0 0 0
20015860
OCBBF- 0 0 64.872 0 0 0 0 0 0 0 0 0 0
20017060
PLACE- 0 0 5.034 0 0 0 0 0 0 0 0 0 0
60043960
SMINT- 0 0 3.07 0 0 0 0 0 0 0 0 0 0
20002770
TESTI- 0 0 51.667 0 0 0 0 0 0 0 0 0 0
20001790
TESTI- 0 0 9.849 0 0 0 2.684 0 0 0 0 0 0
20007840
TESTI- 0 0 15.137 0 15.173 0 0 0 14.875 0 15.629 0 0
20009700
TESTI- 0 0 15.298 0 7.667 4.857 16.674 9.736 15.033 5.029 7.897 0 0
20027070
TESTI- 0 0 16.779 0 0 0 9.144 5.339 8.244 5.516 0 0 0
20053960
TRACH- 0 0 4.688 0 0 5.954 5.11 0 4.607 0 0 0 0
20000790
3NB69- 0 2.443 3.509 2.31 3.517 0 0 0 0 2.307 3.623 0 0
20010220
BRACE- 0 29.559 21.228 13.977 21.278 0 0 0 0 13.958 0 0 0
10001870
BRAWH- 0 5.654 8.12 5.347 8.139 0 8.851 0 7.98 5.339 0 0 0
20014840
BRAWH- 0 9.758 14.015 9.228 0 8.899 15.276 0 0 27.646 0 0 0
20040950

TABLE 33
FEBRA- 0 41.046 58.954 0 0 0 0 0 0 0 0 0 0
20011970
KIDNE- 0 1.07 1.537 1.012 0 1.952 0 0.978 1.51 0 0 3.066 0
20062480
NT2RI- 0 18.599 13.356 0 0 2.827 0 0 4.375 2.927 4.597 4.442 0
20029580
NT2RI- 0 4.061 5.832 0 5.846 3.704 0 0 0 0 0 0 0
20035560
NT2RI- 0 17.204 24.709 16.27 0 15.69 0 0 0 0 0 0 0
20043980
NT2RP- 0 6.554 2.353 0 2.359 0 2.565 0 6.938 0 2.43 0 0
70000760
NT2RP- 0 6.959 9.994 0 0 0 0 6.361 0 19.715 10.319 0 0
70042040
NT2RP- 0 7.736 11.11 0 0 0 0 0 0 14.611 0 0 0
70069860
NT2RP- 0 22.251 15.98 0 0 30.441 0 0 15.704 0 0 0 0
70088550
OCBBF- 0 25.989 37.328 0 0 0 0 0 36.683 0 0 0 0
20001260
TESTI- 0 11.473 8.239 0 0 15.695 0 2.622 0 2.709 0 4.11 0
10000230
3NB69- 3.131 0 6.11 4.023 0 0 0 0 6.005 4.018 0 12.192 0
20017190
ADRGL- 20.819 0 50.778 0 0 0 0 0 0 0 0 0 0
10000020
BRACE- 17.458 0 34.065 11.215 0 0 0 0 16.738 0 0 0 0
10001660
BRAWH- 12.03 0 46.948 0 0 0 25.587 0 0 15.435 0 0 0
10001620
CTONG- 13.637 0 13.304 0 0 0 0 8.467 0 0 0 0 0
20028030
KIDNE- 2.947 0 5.75 0 0 0 0 3.659 5.65 0 0 0 0
20004030
KIDNE- 1.54 0 3.005 0 0 0 0 1.913 5.907 3.952 0 0 0
20060300
NB9N4- 1.74 0 3.395 0 0 0 0 0 0 0 3.505 0 0
20000420
NT2NE- 9.347 0 4.56 0 0 5.79 0 0 4.481 14.99 4.708 0 12.604
20000560
NT2NE- 17.081 0 33.329 0 0 0 0 0 0 0 0 0 0
20004700
NT2NE- 7.97 0 15.551 0 0 0 0 0 15.282 10.225 0 0 0
20007630
NT2RI- 11.856 0 23.135 0 0 29.381 0 0 0 0 0 0 0
20004120
NT2RI- 5.338 0 4.166 1.372 0 0 0 0 0 0 0 0 0
20013420
NT2RI- 5.159 0 10.066 0 0 0 0 0 0 0 0 0 0
20033380
NT2RI- 9.835 0 4.798 0 0 6.093 10.459 6.107 0 0 0 0 0
20036950
NT2RI- 2.442 0 2.382 1.569 0 0 0 0 0 4.699 0 0 0
20053350
NT2RI- 1.805 0 3.521 0 0 0 0 0 3.461 4.631 0 0 0
20053680
NT2RI- 5.854 0 11.422 0 0 0 0 7.269 22.449 0 0 11.395 0
20078840
NT2RI- 2.754 0 8.061 1.769 0 0 0 0 0 1.767 2.774 0 0
20083360
NT2RI- 4.665 0 6.069 3.996 6.083 1.927 6.615 0 2.982 0 3.133 0 0
20090650
NT2RP- 3.638 0 7.098 0 0 0 0 0 0 0 0 0 0
60001090
NT2RP- 11.575 0 11.293 0 0 0 0 7.187 0 0 0 0 0
70004770
NT2RP- 7.18 0 4.67 0 0 2.966 0 0 0 1.535 2.411 0 0
70023790
NT2RP- 20.056 0 19.568 0 0 0 0 0 0 0 0 0 0
70055200
NT2RP- 9.507 0 18.55 0 0 0 0 0 0 6.099 0 0 0
70085570

TABLE 34
NTONG- 3.528 0 6.884 2.266 0 0 3.752 0 0 4.527 3.554 0 0
10000980
NTONG- 11.301 0 22.052 0 0 0 0 0 0 0 0 0 0
20016120
OCBBF- 12.096 0 11.802 0 0 0 0 0 0 0 0 0 0
20011240
OCBBF- 42.373 0 41.34 0 0 0 0 0 0 0 0 0 0
20012100
OCBBF- 4.012 0 7.829 0 0 9.943 0 4.983 23.082 10.296 16.167 0 0
20013070
OCBBF- 33.884 0 66.116 0 0 0 0 0 0 0 0 0 0
20014020
PEBLM- 9.132 0 4.455 0 0 0 4.855 0 0 0 0 0 0
20003950
PLACE- 12.74 0 24.859 0 0 0 0 0 0 0 0 0 0
50001130
PLACE- 27.281 0 10.646 0 0 0 0 13.551 0 0 0 0 0
60021510
PUAEN- 3.444 0 13.439 0 0 0 7.324 4.276 0 0 0 0 0
10000570
SKNMC- 2.423 0 1.182 1.557 0 0 2.577 0 0 0.777 0 0 0
20000970
TESTI- 1.367 0 2.668 0 0 0 0 0 0 0 2.754 0 0
20040310
TRACH- 6.994 0 13.647 0 0 0 0 0 13.411 0 0 0 0
20004610
3NB69- 3.772 5.125 0 4.847 0 0 0 0 0 0 0 0 0
2005450
BRACE- 3.858 2.62 0 2.478 3.772 2.39 4.102 2.395 7.397 7.424 0 0 0
10000420
BRACE- 27.681 18.803 0 8.891 13.535 17.149 0 0 0 0 13.942 0 0
20076410
BRACE- 7.698 10.458 0 39.561 0 9.538 32.745 0 0 0 0 0 0
20078820
BRAWH- 6.302 25.683 0 0 0 0 26.805 0 12.084 0 0 12.267 0
20006860
BRAWH- 9.281 12.609 0 0 0 11.5 19.741 23.052 0 23.817 0 0 0
20089030
FCBBF- 20.441 27.77 0 0 0 25.327 0 0 0 0 0 0 0
10006750
FCBBF- 42.399 57.601 0 0 0 0 0 0 0 0 0 0 0
10006860
FCBBF- 7.341 3.324 0 6.288 0 9.096 0 6.078 0 15.698 9.86 4.764 0
20015380
FCBBF- 1.945 5.285 0 0 0 0 0 0 0 0 0 0 0
50002610
FEBRA- 45.718 20.704 0 0 0 0 0 0 0 0 0 0 0
20004520
FEBRA- 3.428 9.315 0 17.618 0 4.247 0 4.257 0 4.398 0 0 0
20005360
FEBRA- 23.228 31.556 0 0 0 0 0 0 0 0 0 45.216 0
20009010
FEBRA- 42.399 57.601 0 0 0 0 0 0 0 0 0 0 0
20014920
FEBRA- 13.059 17.741 0 0 0 16.18 0 0 0 0 0 0 0
20015840
FEBRA- 10.174 13.822 0 0 0 12.605 0 0 0 0 0 0 0
20021910
FEBRA- 0.894 2.429 0 2.297 3.497 1.108 0 1.11 0 0 0 1.74 0
20021940
FEBRA- 6.453 8.767 0 0 0 0 0 0 0 0 0 0 0
20043250
FEBRA- 12.772 34.702 0 0 0 0 0 0 0 0 0 0 0
20057780
FEBRA- 22.294 30.288 0 0 0 0 47.417 0 0 0 0 0 0
20057880
FEBRA- 59.549 40.451 0 0 0 0 0 0 0 0 0 0 0
20066270
FEBRA- 17.81 24.196 0 0 0 0 0 0 0 0 0 0 0
20074580
HHDPC- 15.129 10.276 0 0 0 0 0 0 14.505 9.705 0 0 0
20000550

TABLE 35
HSYRA- 4.24 11.522 0 0 0 5.254 0 0 8.131 5.44 8.543 0 0
20015740
HSYRA- 1.233 1.005 0 0 3.859 5.5 0 8.575 3.31 0.949 7.453 5.281 1.33
20016210
IMR32- 3.621 4.919 0 0 0 0 0 0 0 0 7.294 0 0
10002420
IMR32- 0.382 0.519 0 0 0 0 0 0 0 0.49 0 0.744 0
20016000
KIDNE- 7.34 9.972 0 0 0 0 0 0 0 0 0 0 0
20060140
MAMGL- 0.301 0.409 0 0 0.59 0.747 0 0.374 0.578 0.387 0 0.587 1.626
10000320
NT2NE- 8.923 12.122 0 0 0 0 0 0 0 0 17.976 0 0
20008090
NT2NE- 10.711 9.701 0 4.587 13.966 4.424 0 0 0 0 0 0 0
20014350
NT2RI- 1.604 1.09 0 0 0 0 1.706 0 0 1.029 0 0 0
20000640
NT2RI- 9.692 26.333 0 0 0 0 0 0 0 12.434 0 0 0
20002940
NT2RI- 0.148 0.402 0 21.074 0 0.183 0 0.367 0 0 0 0 0
20015400
NT2RI- 5.44 14.78 0 20.966 0 6.74 11.569 6.755 0 0 0 0 0
20033830
NT2RI- 1.298 1.764 0 0 0 0 2.761 3.224 0 0 2.616 0 0
20037510
NT2RI- 2.535 3.444 0 4.885 0 3.141 5.391 4.722 0 3.252 2.553 4.934 0
20057230
NT2RI- 2.993 2.033 0 0 2.927 3.709 3.183 0 2.87 3.841 0 2.914 0
20087910
NT2RI- 14.023 12.701 0 0 0 5.792 0 0 0 0 0 0 0
20089420
NT2RP- 3.934 5.344 0 0 0 0 0 0 0 5.047 7.925 0 0
70043730
NT2RP- 4.861 6.604 0 6.246 0 0 0 6.037 0 12.474 0 0 26.221
70047900
PLACE- 2.116 2.874 0 5.436 0 5.243 4.5 0 0 2.714 0 4.118 0
60043120
PROST- 4.928 6.695 0 6.331 0 6.106 10.481 12.239 0 6.322 0 0 26.581
20033020
SYNOV- 3.506 4.763 0 0 0 0 0 0 0 0 7.063 0 0
10001280
TESTI- 14.02 4.762 0 0 0 0 0 0 0 0 0 0 0
20021490
THYMU- 10.405 14.136 0 0 20.352 0 0 0 0 13.35 20.963 0 0
20002360
TRACH- 4.522 1.536 0 0 0 1.401 0 1.404 0 2.901 2.278 2.201 0
20012890
3NB69- 2.384 3.239 4.653 0 0 0 10.143 0 0 3.059 0 0 0
10001290
BNGH4- 4.385 9.928 2.852 1.878 0 0 0 0 0 1.875 0 0 0
20004740
BRACE- 9.437 32.053 27.622 6.063 9.229 0 0 5.86 0 0 0 0 0
20034490
BRAWH- 3.286 4.464 6.412 0 6.427 4.071 6.989 4.081 0 4.216 6.62 0 0
20005220
FEBRA- 17.948 24.384 35.022 0 0 0 0 0 0 0 0 0 0
20003770
FEBRA- 26.742 10.38 29.818 0 0 3.156 0 0 2.442 3.268 0 7.437 0
20007570
FEBRA- 19.259 26.164 26.305 2.474 0 2.386 0 0 0 4.942 0 0 0
20008740
FEBRA- 13.91 9.449 27.141 0 0 0 0 0 13.336 8.923 0 0 0
20012450
FEBRA- 13.91 9.449 27.141 0 0 0 0 0 13.336 8.923 0 0 0
20012450
FEBRA- 31.686 7.174 30.913 0 0 0 0 0 0 0 0 0 0
20017150
FEBRA- 8.913 24.219 17.392 0 0 0 0 0 0 11.436 0 17.352 0
20025250
FEBRA- 19.397 10.541 15.139 0 0 0 0 0 0 0 0 0 0
20044120

TABLE 36
FEBRA20076220 7.094 1.606 4.614 1.519 0 1.465 0 0 0 1.517 2.382 0 0
HSYRA20002480 4.385 9.928 2.852 1.878 0 0 0 0 0 1.875 0 0 0
IMR3220014350 4.337 2.946 4.232 5.572 0 0 4.612 0 0 0 0 0 0
MESAN20001490 4.119 5.596 8.037 0 0 0 0 0 15.797 0 8.298 0 22.218
NHNPC20002060 0.878 1.192 1.713 0 0 0 0 1.09 1.683 0 0 0 0
NT2NE10000180 4.752 6.455 9.271 0 0 17.662 0 5.901 0 12.193 0 0 0
NT2NE20003920 24.178 24.087 9.435 4.142 0 1.997 0 2.002 0 8.272 3.247 9.413 0
NT2RI20006690 14.42 6.53 18.758 0 0 0 10.223 0 0 0 0 0 0
NT2RI20013850 7.701 1.495 2.147 1.413 2.152 0 2.34 0 0 0 2.216 0 0
NT2RI20014500 8.005 14.501 5.207 3.428 0 16.531 11.351 6.628 5.117 20.542 0 0 0
NT2RI20025540 5.906 8.024 28.812 0 0 3.659 0 0 0 0 5.95 0 0
NT2RI20033010 13.235 17.981 51.651 0 0 0 0 0 0 0 0 0 0
NT2RI20075720 9.059 3.077 22.096 0 0 0 4.817 2.812 0 0 0 4.409 0
NT2RP60000350 1.407 2.868 9.611 0 0 0.872 0 0 0 2.708 0 0 0
NT2RP60001230 26.971 10.992 5.263 0 0 3.342 5.736 0 0 3.46 0 0 0
NT2RP70028750 4.921 7.799 14.402 3.161 3.208 1.016 8.721 0 0 5.261 4.957 3.193 4.424
NT2RP70029060 3.211 2.181 6.266 2.063 0 9.947 0 1.994 0 4.12 6.47 3.126 0
NT2RP70032030 18.539 6.297 18.088 0 0 0 14.787 5.756 0 0 0 4.511 0
NTONG20003340 6.944 9.434 13.549 8.922 13.581 0 0 0 0 0 0 0 0
OCBBF20000130 3.85 15.691 22.537 0 0 0 0 0 0 0 0 0 0
OCBBF20002310 8.981 6.1 26.286 0 0 5.564 9.55 11.153 0 11.522 0 0 0
OCBBF20009040 29.316 13.276 19.068 0 0 0 0 0 0 0 0 0 0
SKNMC20000650 7.095 7.229 10.382 0 0 0 0 0 0 2.276 3.573 0 9.567
SMINT20003960 3.445 1.17 3.361 0 0 0 0 0 0 0 0 0 0
TESTI20026320 6.566 8.92 12.811 0 0 0 0 0 0 0 13.228 0 0
TESTI20080200 4.326 1.959 7.033 0.926 0 0 9.2 0.895 0 1.85 0 0 3.889

TABLE 37
Clone ID FEHRT HEART
KIDNE20062480 36.242 0
NT2RI20033040 40.301 0
NT2RP60000350 32.381 0
BGGI120010970 0 9.222
BRACE10000420 0 23.223
BRACE10001150 0 1.324
BRACE20003320 0 31.422
BRACE20077980 0 15.184
BRAWH10000370 0 65.363
BRAWH20000340 0 22.282
BRAWH20011660 0 6.271
BRAWH20014840 0 16.703
FEBRA20008740 0 7.73
FEBRA20072800 0 74.711
HEART20000350 0 100
HEART20000990 0 100
HEART20003090 0 100
HEART20004110 0 100
HEART20004480 0 100
HEART20004920 0 100
HEART20005060 0 58.813
HEART20005200 0 100
HEART20005680 0 100
HHDPC20001150 0 23.261
HLUNG20005010 0 5.241
HSYRA20014200 0 12.434
IMR3220013170 0 9.002
KIDNE20004970 0 26.564
NT2RI20000640 0 3.219
NT2RI20006710 0 5.218
NT2RI20015400 0 0.593
NT2RI20026540 0 8.062
NT2RI20037510 0 5.211
NT2RI20057230 0 20.346
NT2RI20064120 0 17.978
NT2RI20071330 0 14.303
NT2RI20071480 0 24.983
NT2RI20077540 0 60.787
NT2RI20084810 0 13.301
NT2RI20087910 0 6.007
NT2RP70000760 0 9.681
NT2RP70024500 0 41.168
NT2RP70029060 0 6.444
NTONG10001820 0 13.117
PLACE60012810 0 32.247
PLACE60043120 0 8.491
PROST20000530 0 23.813
SKMUS10000640 0 27.233
SKMUS20004580 0 8.731
SKMUS20015010 0 18.378
SMINT20002770 0 6.315
TESTI20033250 0 58.713
TESTI20074640 0 25.552
UMVEN20001330 0 6.282

TABLE 38
Clone ID FEKID KIDNE
3NB6920003300 0 2.071
3NB6920009120 0 2.884
BGGI120010970 0 4.336
BRACE20004210 0 3.583
BRACE20005250 0 6.242
BRACE20011170 0 3.303
BRACE20020910 0 19.111
BRACE20026850 0 34.356
BRACE20080970 0 20.33
BRAWH20000340 0 10.476
BRAWH20006970 0 3.96
BRAWH20011660 0 5.897
FCBBF20001950 0 65.363
FEBRA20021940 0 1.687
FEBRA20043250 0 12.177
HLUNG10000640 0 23.921
IMR3220007420 0 2.375
IMR3220014350 0 4.092
KIDNE10000280 0 100
KIDNE10000500 0 15.868
KIDNE10001040 0 100
KIDNE10001430 0 100
KIDNE10001450 0 19.052
KIDNE10001520 0 100
KIDNE20000410 0 100
KIDNE20000510 0 100
KIDNE20000700 0 100
KIDNE20000850 0 4.788
KIDNE20001670 0 100
KIDNE20001920 0 100
KIDNE20002440 0 37.565
KIDNE20002450 0 100
KIDNE20002660 0 7
KIDNE20003150 0 100
KIDNE20003300 0 20.536
KIDNE20003490 0 64.026
KIDNE20003750 0 100
KIDNE20004030 0 5.561
KIDNE20004220 0 35.77
KIDNE20004970 0 12.49
KIDNE20005130 0 100
KIDNE20005170 0 81.524
KIDNE20005190 0 100
KIDNE20005740 0 2.3
KIDNE20031850 0 16.193
KIDNE20033050 0 3.381
KIDNE20033350 0 100
KIDNE20033570 0 53.825
KIDNE20033730 0 100
KIDNE20033770 0 100
KIDNE20037520 0 100
KIDNE20039410 0 100
KIDNE20039940 0 43.968
KIDNE20040340 0 100
KIDNE20040540 0 49.114
KIDNE20040840 0 100
KIDNE20042620 0 100
KIDNE20042940 0 100
KIDNE20042950 0 100
KIDNE20043440 0 100
KIDNE20045200 0 100
KIDNE20045340 0 17.53
KIDNE20045790 0 100
KIDNE20046810 0 100
KIDNE20048280 0 100
KIDNE20048640 0 34.264
KIDNE20048790 0 100
KIDNE20049810 0 100
KIDNE20050420 0 35.626
KIDNE20052960 0 100
KIDNE20053360 0 58.142
KIDNE20054000 0 49.697
KIDNE20054770 0 100
KIDNE20056290 0 100
KIDNE20056760 0 16.262
KIDNE20059080 0 100
KIDNE20059370 0 88.03
KIDNE20060140 0 13.852
KIDNE20060300 0 2.906
KIDNE20060530 0 100
KIDNE20060620 0 100
KIDNE20061490 0 100
KIDNE20062480 0 2.972
KIDNE20062990 0 31.685
KIDNE20063530 0 26.747
KIDNE20063760 0 100
KIDNE20066520 0 70.185
KIDNE20067600 0 100
KIDNE20067750 0 8.487
KIDNE20068800 0 24.137
KIDNE20070050 0 66.711
KIDNE20070770 0 100
KIDNE20071860 0 39.822
KIDNE20073280 0 4.537
KIDNE20073520 0 8.83
KIDNE20073560 0 100
KIDNE20074220 0 100
KIDNE20075690 0 100
KIDNE20078100 0 100
KIDNE20078110 0 100
LIVER10000790 0 15.673
MAMGL10000320 0 1.138
NB9N410000470 0 3.598
NT2NE20053710 0 1.127
NT2RI20006710 0 2.454
NT2RI20013420 0 2.015
NT2RI20016570 0 23.435
NT2RI20018460 0 20.967
NT2RI20025540 0 5.573
NT2RI20040590 0 13.676
NT2RI20065530 0 3.41
NT2RI20087490 0 1.408
NT2RI20087910 0 2.824
NT2RP60000350 0 5.311
NT2RP60001230 0 5.09
NT2RP70043730 0 14.846
NT2RP70069860 0 10.745
NT2RP70074220 0 3.96
OCBBF20014940 0 49.164
PLACE60014430 0 4.704
PLACE60020840 0 2.658
PLACE60043120 0 3.992
PROST10003430 0 25.547
SKNMC20000970 0 1.143
SKNSH20001510 0 20.208
SMINT10000160 0 38.817
SMINT20003960 0 1.625
SPLEN20000470 0 66.711
SPLEN20001340 0 88.909
SPLEN20003570 0 31.635
STOMA10000470 0 17.849
SYNOV10001280 0 6.616
TESTI10000700 0 25.214
TESTI20027070 0 14.795
TESTI20040310 0 2.58
TRACH10000300 0 11.119
TRACH20000790 0 4.534
TRACH20002500 0 35.282
TRACH20007800 0 5.605
KIDNE10000080 77.87 22.13
KIDNE20044110 92.49 7.51
NT2RI20033040 40.707 0
NT2RI20037510 60.346 0
NT2RP70065270 40.543 0
TRACH20012890 52.552 0

TABLE 39
Clone ID FELNG HLUNG
BNGH410001980 0 16.113
BRACE10000420 0 7.831
BRACE10001150 0 1.339
BRACE20014770 0 28.126
BRACE20018550 0 25.65
BRAWH20006970 0 8.521
BRAWH20014610 0 7.03
FEBRA20008810 0 19.713
FEBRA20015840 0 53.019
FEBRA20044120 0 15.75
HHDPC20001490 0 25.611
HLUNG10000240 0 100
HLUNG10000300 0 100
HLUNG10000370 0 100
HLUNG10000640 0 51.466
HLUNG10000760 0 12.838
HLUNG10000990 0 100
HLUNG10001050 0 100
HLUNG10001100 0 100
HLUNG20000680 0 72.532
HLUNG20001160 0 100
HLUNG20001250 0 100
HLUNG20001420 0 79.349
HLUNG20001760 0 100
HLUNG20002550 0 100
HLUNG20003140 0 14.018
HLUNG20004120 0 42.131
HLUNG20004800 0 100
HLUNG20005010 0 5.302
HSYRA20014200 0 12.578
KIDNE20002660 0 15.061
KIDNE20033050 0 3.637
NT2NE20014350 0 28.99
NT2RI20016570 0 9.167
NT2RI20026540 0 8.156
NT2RI20051500 0 21.652
NT2RI20064120 0 9.093
NT2RI20083960 0 17.851
NT2RI20085260 0 5.474
NT2RI20087490 0 3.03
NT2RP70009060 0 18.337
NT2RP70011660 0 5.822
NT2RP70029060 0 6.519
NT2RP70055020 0 10.451
NT2RP70074220 0 8.521
NT2RP70076100 0 25.546
NTONG10002460 0 16.426
NTONG20008000 0 7.189
PLACE60043120 0 8.589
SKMUS20016340 0 15.317
SKNMC20005930 0 13.727
SMINT20000180 0 38.989
SMINT20002390 0 51.283
SMINT20002770 0 12.776
SMINT20003960 0 10.489
STOMA10000470 0 38.402
STOMA20001880 0 52.43
SYNOV20013740 0 23.798
TESTI20036250 0 32.684
TESTI20080200 0 2.927
TRACH20004610 0 28.395
BRACE20004210 86.645 0
IMR3220007420 57.437 0

TABLE 40
Alteration of the expression level of each clone due to
TNF-α or LPS stimulation to human monocyte cell line THP-1 and
alteration of the expression level of each clone due to co-
culture of gastric cancer cell line MKN45 with Helicobacter
pylori. ctl, TNF and LPS in the column of THP-1, respectively,
indicate the relative expression levels in unstimulated THP-1,
in the cell stimulated with 10 ng/mL TNF-α for 3 hours, and in
the cell stimulated with 1 μg/mL LPS for 3 hours; ctl and H. pylori
in the column of MKN45 indicate the relative expression
levels in MKN45 cultured without Helicobacter pylori and in
MKN45 co-cultured with Helicobacter pylori
(at a ratio of MKN45:Helicobacter pylori = 1:100
cells (colonies) for 3 hours, respectively
[ATAC-PCR]
THP-1 MKN45
Clone name ctl TNF LPS ctl H. pylori
3NB6920000290 2.0 1.9 0.4 0.1 0.0
ADRGL10000180 2.2 5.1 2.0 3.3 5.7
BNGH410001370 0.8 1.4 0.3 0.4 0.5
BRACE10001590 1.5 2.3 1.6 0.4 0.8
BRACE10001690 2.3 3.6 2.9 2.2 1.8
BRACE20010650 2.1 2.2 2.1 2.2 2.1
BRACE20013400 2.6 0.8 0.2 1.5 1.1
BRACE20030780 0.3 1.3 0.0 2.2 1.7
BRACE20034490 2.0 1.6 0.6 2.5 0.3
BRACE20077640 0.4 1.0 0.1 1.7 0.3
BRACE20079530 0.6 0.1 0.1 0.0 0.2
BRACE20083850 0.9 2.5 1.3 1.1 0.0
BRACE20091880 1.5 0.5 0.1 0.5 0.0
BRAWH10001620 1.8 1.0 0.3 1.1 3.1
BRAWH20004430 0.2 1.4 0.2 0.5 0.5
FCBBF10006180 0.1 3.6 1.3 2.1 0.7
FEBRA20003780 1.5 3.0 2.8 1.7 1.3
FEBRA20006800 0.7 2.4 0.9 0.0 1.6
FEBRA20008810 2.3 1.4 0.9 2.3 1.3
FEBRA20012940 0.4 1.0 0.2 0.7 0.6
FEBRA20015840 0.1 3.3 2.6 0.1 0.0
HCASM10000610 1.8 2.0 2.1 2.3 2.2
HEART20000350 2.0 3.3 1.8 2.3 0.5
HEART20004480 0.0 0.3 0.0 3.5 3.0
HEART20005060 1.2 0.6 0.0 4.8 4.5
HHDPC20000950 0.4 0.2 0.1 1.4 0.7
HLUNG10000370 0.0 1.3 0.2 2.6 0.7
HLUNG20001160 0.6 3.7 1.7 0.1 0.0
HLUNG20001760 1.4 0.5 0.0 0.3 0.0
HSYRA20003470 1.1 1.5 0.6 1.1 0.3
HSYRA20013320 0.1 1.7 0.7 1.4 0.7
IMR3210001580 0.4 0.0 0.0 0.3 0.2
IMR3210002660 0.8 0.4 0.2 0.5 0.4
IMR3220008380 0.4 0.9 0.4 1.1 0.5
IMR3220008590 2.0 0.3 0.9 2.1 3.4
KIDNE10001520 0.4 1.2 0.7 3.4 2.2
KIDNE20000850 0.7 0.7 0.4 1.1 0.5
KIDNE20003490 0.9 1.7 0.9 0.3 1.9
KIDNE20005170 0.9 0.7 0.3 6.4 0.2
KIDNE20033730 1.2 1.6 1.8 0.5 0.5
KIDNE20040540 0.1 2.5 0.8 0.1 0.2
KIDNE20050420 0.7 0.5 0.7 0.2 0.3
KIDNE20061490 0.1 1.2 0.6 0.2 0.1
KIDNE20062990 0.7 3.5 0.7 0.0 0.0
LIVER20000330 6.0 7.4 1.1 7.3 0.6
NT2NE10001630 0.1 2.6 1.4 2.5 2.7
NT2NE10001850 1.1 0.3 0.1 0.4 1.1
NT2NE20003920 0.6 3.3 1.6 0.5 0.2
NT2NE20005500 0.6 2.6 2.2 0.1 0.2
NT2RI20009740 1.2 1.9 0.9 0.1 0.0
NT2RI20014500 0.2 3.5 1.7 0.0 0.0
NT2RI20016570 1.2 3.6 3.1 0.0 0.1
NT2RI20018660 4.3 0.5 1.3 1.9 1.8
NT2RI20021520 1.1 1.5 1.1 1.1 0.5
NT2RI20050870 1.0 0.6 0.3 0.7 0.8
NT2RI20053350 2.2 1.0 0.9 1.5 0.6
NT2RI20070480 1.5 0.3 0.0 0.0 0.0
NT2RI20073030 0.4 0.6 0.4 2.0 0.8
NT2RI20078270 0.2 2.6 0.5 1.4 0.3
NT2RI20078790 1.7 2.4 0.7 2.2 1.6
NT2RI20083360 0.1 0.4 0.2 0.1 0.3
NT2RP60000080 2.2 2.5 1.5 2.0 1.1
NT2RP60000390 1.6 2.3 1.2 2.3 0.4
NT2RP60000590 1.6 2.0 1.3 2.5 1.3
NTONG10000980 0.9 0.8 0.8 1.9 0.0
NTONG10002570 0.1 5.4 0.5 0.0 0.0
PLACE60020160 0.8 1.2 0.6 0.0 0.0
PLACE60026990 0.5 0.2 0.1 3.2 2.1
PLACE60047380 1.6 0.7 0.9 1.8 2.2
PUAEN10003220 0.1 1.9 1.2 0.0 0.1
SKNMC10000290 0.4 1.2 0.5 0.9 0.2
SKNMC10001590 1.7 1.9 0.8 1.0 0.4
SKNMC20000650 1.1 1.1 0.8 0.1 0.1
STOMA20002570 0.3 3.1 1.5 0.6 0.6
STOMA20002890 1.8 0.8 0.4 0.1 0.2
SYNOV20001770 1.7 0.5 0.5 1.7 4.2
TESTI10000230 2.7 4.6 3.1 2.3 1.7
TESTI10000550 0.4 0.1 0.3 0.1 2.8
TESTI20011340 0.3 2.3 2.2 2.2 1.9
THYMU10005580 1.1 2.1 1.1 1.5 1.1
TRACH10000630 0.3 0.5 0.2 2.7 2.6
TRACH20001960 9.4 2.7 1.3 1.0 0.4
UMVEN10001220 1.9 2.8 1.0 0.8 0.2
UMVEN20001330 2.2 2.2 0.0 1.0 0.1
UTERU20004850 1.7 6.3 2.3 0.0 0.3

Homology Search Result Data

Data obtained by the homology search for full-length nucleotide sequences and deduced amino acid sequences.

In the result of the search shown below, both units, aa and bp, are used as length units for the sequences to be compared.

Each data includes Clone name, Definition in hit data, P value, Length of sequence to be compared, Homology, and Accession number (No.) of hit data. These items are shown in this order and separated by a double-slash mark, //.

3NB6910000180

3NB6910000850

3NB6910001160//STEROIDOGENIC ACUTE REGULATORY PROTEIN PRECURSOR.//9.70E-08//160aa//21%//Q28996

3NB6910001290

3NB6910001730

3NB6920000290

3NB6920002810//PUTATIVE ATP-DEPENDENT RNA HELICASE T26G10.1 IN CHROMOSOME III.//4.70E-154//442aa//64%//P34580

3NB6920003300//YIP1 PROTEIN.//1.80E-35//181aa//41%//P53039

3NB6920005450

3NB6920009120

3NB6920010020//REGULATOR OF G-PROTEIN SIGNALING 3 (RGS3) (RGP3).//1.60E-89//179aa//95%//P49796

3NB6920010220//putative C3HC4-type RING zinc finger protein//3.70E-38//374aa//29%//MC27460

3NB6920013490

3NB6920014330

3NB6920014710//Homo sapiens hepatocellular carcinoma-associated antigen 58 (HCA58) mRNA, complete cds.//5.40E-130//236aa//100%//AF220416

3NB6920015110//CARG-BINDING FACTOR-A (CBF-A).//7.50E-140//290aa//90%//Q99020

3NB6920015280//LIGHT-MEDIATED DEVELOPMENT PROTEIN DET1.//4.6.0E-55//263aa//35%//P48732

3NB6920015570//ZINC FINGER PROTEIN 135.//7.90E-129//365aa//60%//P52742

3NB6920016370

3NB6920017190

ADRGL10000020//Homo sapiens Kelch-like 1 protein (KLHL1) mRNA, complete cds.//2.90E-298//546aa//100%//AF252283

ADRGL10000180

ADRGL10000650//ZINC FINGER PROTEIN 135.//2.20E-76//205aa//64%//P52742

ADRGL10001600//CYTOCHROME P450 XXIB (EC 1.14.99.10) (STEROID 21-HYDROXYLASE) (P450-C21B).//2.50E-248//397aa//98%//P08686

ADRGL10001650//IMIDAZOLONEPROPIONASE (EC 3.5.2.7) (IMIDAZOLONE-5-PROPIONATE HYDROLASE).//6.10E-67H/418aa//37%//P42084

ADRGL10001820

ADRGL20000740//RHO-GTPASE-ACTIVATING PROTEIN 6 (RHO-TYPE GTPASE-ACTIVATING PROTEIN RHOGAPX-1).//1.50E-67//327aa//43%//Q43182

ADRGL20003230

ADRGL20004280

ASTRO10000180//DYNEIN INTERMEDIATE CHAIN 3, CILIARY.//1.10E-32//207aa//33%//Q16960

ASTRO20000950

ASTRO20004170//Homo sapiens sorting nexin 5 (SNX5) mRNA, complete cds.//5.20E-47//98aa//100%//AF121855

ASTRO20004800

BGGI110002850

BGGI120001610//CELL DIVISION CONTROL PROTEIN 1.//3.10E-14//218aa//28%//P40986

BGGI120005330//INOSINE-5′-MONOPHOSPHATE DEHYDROGENASE 2 (EC 1.1.1.205) (IMP DEHYDROGENASE 2) (IMPDH-II) (IMPD 2).//1.40E-218//415aa//80%//P12269

BGGI120005440//Homo sapiens snurportin1 mRNA, complete cds.//3.50E-199//360aa//99%//AF039029

BGGI120006840//Homo sapiens sirtuin type 2 (SIRT2) mRNA, complete cds.//7.60E-197H/371aa//98%//AF083107

BGGI120006930//POLYHOMEOTIC-PROXIMAL CHROMATIN PROTEIN.//2.30E-11//100aa//42%//P39769

BGGI120010970//Homo sapiens contactin associated protein (Caspr) mRNA, complete cds.//3.50E-103//464aa//36%//U87223

BGGI120017140//ZINC FINGER PROTEIN 124 (HZF-16).//1.60E-127//217aa//100%//Q15973

BNGH410000030//R. norvegicus trg mRNA.//3.10E-111//361aa//60%//X68101

BNGH410000130

BNGH410000170

BNGH410000290

BNGH410000330

BNGH410000340//DIPEPTIDYL PEPTIDASE IV (EC 3.4.14.5) (DPP IV) (THYMOCYTE-ACTIVATING MOLECULE) (THAM).//3.20E-36//262aa//38%//P28843

BNGH410000390//DYNEIN BETA CHAIN, CILIARY./4.80E-136//331 aa//72%//P23098

BNGH410000800//Homo sapiens zinc finger protein dp mRNA, complete cds./2.80E-11//103aa//41%//AF153201

BNGH410001040

BNGH410001180//Homo sapiens low density lipoprotein receptor related protein-deleted in tumor (LRPDIT) mRNA, complete cds.//Q//752aa//96%//AF176832

BNGH410001370//BRUSH BORDER 61.9 KD PROTEIN PRECURSOR.//6.30E-72//555aa//31%//Q05004

BNGH410001530

BNGH410001770//INOSINE-5′-MONOPHOSPHATE DEHYDROGENASE 1 (EC 1.1.1.205) (IMP DEHYDROGENASE 1) (IMPDH-I) (IMPD 1).//2.10E-270//514aa//99%//P20839

BNGH410001900//Rattus norvegicus schlafen-4 (SLFN-4) mRNA, complete cds.//3.80E-81//568aa//35%//AF168795

BNGH410001980//TETRACYCLINE RESISTANCE PROTEIN, CLASS E (TETA(E)).//1.20E-15//345aa//26%//Q07282

BNGH420004740

BNGH420005320//ZINC FINGER PROTEIN 36 (ZINC FINGER PROTEIN KOX18) (FRAGMENT).//6.40E-179//322aa//99%//P17029

BRACE10000200

BRACE10000420//PROTEIN PHOSPHATASE 2C ABI2 (EC 3.1.3.16) (PP2C).//2.10E-31//202aa//37%//Q04719

BRACE10000700

BRACE10000730//HYPOTHETICAL 37.2 KDA PROTEIN C12C2.09C IN CHROMOSOME II.//9.60E-05//100aa//34%//Q09749

BRACE10000930//TNF RECEPTOR ASSOCIATED FACTOR 2 (TRAF2).//2.10E-96//197aa//92%//P39429

BRACE10001150//NUCLEOSOME ASSEMBLY PROTEIN 1-LIKE 2 (BRAIN-SPECIFIC PROTEIN, X-LINKED).//3.60E-17//144aa//36%//P51860

BRACE10001590

BRACE10001660

BRACE10001690

BRACE10001870//MICROTUBULE-ASSOCIATED PROTEIN 4.//8.30E-12//49aa//81%//P27816

BRACE20000770

BRACE20001000

BRACE20001410

BRACE20002800//MNN4 PROTEIN./8.50E-10//237aa//29%//P36044

BRACE20003320

BRACE20004210

BRACE20005050

BRACE20005250//DRR1 PROTEIN (TU3A PROTEIN).//5.20E-74//144aa//100%//Q95990

BRACE20005450

BRACE20005650

BRACE20005770//Homo sapiens PHR1 isoform 4 (PHRET1) mRNA, alternatively spliced, complete cds.//5.80E-48//91aa//100%//AF093249

BRACE20006980//ANKYRIN 2 (BRAIN ANKYRIN) (ANKYRIN B) (ANKYRIN, NONERYTHROID).//2.40E-16//279aa//30%//Q01484

BRACE20007180//CALCITONIN GENE-RELATED PEPTIDE II PRECURSOR (CGRP-II) (BETA-TYPE CGRP).//2.70E-61//127aa//99%//P10092

BRACE20008850//CALDESMON (CDM).//3.50E-08//203aa//29%//P12957

BRACE20009880

BRACE20010650

BRACE20010700

BRACE20011170

BRACE20011430//Zea mays clone AGPZm1 arabinogalactan protein (agp) mRNA, partial cds.//3.70E-06//176aa//33%//AF134579

BRACE20011880

BRACE20013400

BRACE20013520

BRACE20013740

BRACE20013750

BRACE20014230

BRACE20014530//36.4 KDA PROLINE-RICH PROTEIN.//5.50E-10//102aa//34%//Q00451

BRACE20014550//HEAT SHOCK FACTOR PROTEIN 1 (HSF 1) (HEAT SHOCK TRANSCRIPTION FACTOR 1) (HSTF 1).//1.00E-118//229aa//99%//Q00613

BRACE20014770//HUNTINGTIN ASSOCIATED PROTEIN 1 (HAP1).//1.70E-22//81 aa//39%//P54256

BRACE20014920//PROTEIN-TYROSINE PHOSPHATASE-LIKE N PRECURSOR (R-PTP-N) (ISLET CELL AUTOANTIGEN 512) (ICA512).//3.10E-42//110aa//84%//P56722

BRACE20015080//PROTEIN-LYSINE 6-OXIDASE PRECURSOR (EC 1.4.3.13) (LYSYL OXIDASE).//1.30E-06//110aa//35%//Q05063

BRACE20015430

BRACE20016730//Mus musculus mdgl-1 mRNA, complete cds.//3.00E-54//118aa//83%//AF190624

BRACE20016920

BRACE20017370//P. vivax pva1 gene./2.70E-20//99aa//49%//X92485

BRACE20018550//B-CELL LYMPHOMA 3-ENCODED PROTEIN (BCL-3 PROTEIN).//9.20E-16//300aa//30%//P20749

BRACE20018590//NOVEL ANTIGEN 2 (NAG-2) (TSPAN-4).//8.30E-28//69aa//91%//Q14817

BRACE20018650

BRACE20018980

BRACE20019440

BRACE20020500

BRACE20020910//ZINC-FINGER PROTEIN RFP (RET FINGER PROTEIN).//1.10E-31//91aa//49%//Q62158

BRACE20021510

BRACE20021760

BRACE20022020//SERINE/THREONINE-PROTEIN KINASE SNK (EC 2.7.1.-) (SERUM INDUCIBLE KINASE).//1.60E-41//102aa//47%//P53351

BRACE20022270

BRACE20024090//HOMEOBOX PROTEIN MEIS3 (MEIS1-RELATED PROTEIN 2).//1.50E-108//210aa//89%//P97368

BRACE20024310//P53-INDUCED PROTEIN 11.//5.00E-37//111aa//69%//Q14683

BRACE20024680//Homo sapiens GalNAc-T9 mRNA for UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase, complete cds.//3.00E-153//244aa//99%//AB040672

BRACE20024780//NEURALIZED PROTEIN.//1.20E-14//95aa//38%//P29503

BRACE20024950

BRACE20025900

BRACE20026350//SODIUM/NUCLEOSIDE COTRANSPORTER (NA(+)/NUCLEOSIDE COTRANSPORTER).//3.40E-25//53aa//96%//P26430

BRACE20026850//Homo sapiens androgen-regulated short-chain dehydrogenase/reductase 1 (ARSDR1) mRNA, complete cds.//6.50E-120//313aa//72%//AF167438

BRACE20027360//Homo sapiens mRNA for fructosamine-3-kinase (FN3K gene)//3.00E-80//150aa//91%//AJ404615

BRACE20027520

BRACE20027550//REGULATOR OF MITOTIC SPINDLE ASSEMBLY 1 (RMSA-1).//1.40E-19//128aa//44%//P49646

BRACE20027720//HYDROXYACYLGLUTATHIONE HYDROLASE (EC 3.1.2.6) (GLYOXALASE II) (GLX II).//2.50E-35//133aa//50%//Q16775

BRACE20027920//L-RIBULOKINASE (EC 2.7.1.16).//5.20E-40//387aa//29%//P94524

BRACE20027960//Rattus norvegicus neurabin mRNA, complete cds.//2.70E-10//48aa//66%//U72994

BRACE20028120//Mus musculus GTPase Rab37 (Rab37) mRNA, complete cds.//4.60E-48//129aa//78%//AF233582

BRACE20028600

BRACE20028610

BRACE20028960//Mus musculus mRNA for Ca2+ dependent activator protein for secretion, complete cds.//6.10E-195//473aa//74%//D86214

BRACE20030780

BRACE20031100//PATCHED PROTEIN HOMOLOG 1-(PTC1) (PTC).//3.00E-23//234aa//25%//Q61115

BRACE20032850

BRACE20033190

BRACE20033980

BRACE20034310

BRACE20034490

BRACE20035160

BRACE20035270

BRACE20035390

BRACE20035940

BRACE20071380//PROBABLE CALCIUM-TRANSPORTING ATPASE 3 (EC 3.6.1.38) (ENDOPLASMIC RETICULUM CA2+-ATPASE).//3.50E-65//343aa//39%//P39524

BRACE20071530

BRACE20071740//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//4.90E-157//380aa//61%//P51523

BRACE20071970

BRACE20072010

BRACE20072320

BRACE20072810

BRACE20074010//Oryctolagus cuniculus peroxisomal Ca-dependent solute carrier mRNA, complete cds.//2.30E-140//383aa//65%//AF004161

BRACE20074470//Mus musculus partial mRNA for mouse fat 1 cadherin (mfat1 gene).//3.90E-131//454aa//57%//AJ250768

BRACE20075020

BRACE20075270

BRACE20075380

BRACE20075630

BRACE20076210

BRACE20076410//Mouse mRNA for seizure-related gene product 6 type 2 precursor, complete cds.//5.10E-173//320aa//94%//D64009

BRACE20076460

BRACE20076630//Dog nonerythroid beta-spectrin mRNA//1.60E-05//86aa//37%//L02897

BRACE20076850//Homo sapiens cell cycle checkpoint protein CHFR mRNA, complete cds.//1.20E-54//104aa//99%//AF170724

BRACE20077080

BRACE20077270

BRACE20077610

BRACE20077640

BRACE20077670

BRACE20077680

BRACE20077840//Putative Protein that mediates attachment of autophagosomes to microtubules, by similarity to yeast aut2 [Schizosaccharomyces pombe].//1.00E-08//200aa//26%//CAC00556

BRACE20077980

BRACE20078680//TOLA PROTEIN.//2.40E-05//140aa//30%//P44678

BRACE20078820//actin-depolymerizing protein N-WASP//5.50E-06//116aa//37%//S72273

BRACE20079020

BRACE20079530

BRACE20080970

BRACE20081140

BRACE20083800

BRACE20083850//Rattus norvegicus NRBF-2 mRNA for nuclear receptor binding factor-2, complete cds.//1.30E-135//288aa//90%//AB024930

BRACE20084430//PROTEIN DISULFIDE ISOMERASE-RELATED PROTEIN PRECURSOR (EC 5.3.4.1) (PDIR).//8.30E-102//186aa//98%//Q14554

BRACE20084800

BRACE20084880

BRACE20086530

BRACE20086550//Homo sapiens mRNA for GABAB receptor, subunit 1b.//8.30E-22//55aa//90%//AJ012186

BRACE20087080

BRACE20087540

BRACE20088570

BRACE20089600

BRACE20089990

BRACE20090140

BRACE20091880//Mus musculus mRNA for synaptotagmin V, complete cds.//9.90E-85//166aa//96%//AB026802

BRACE20092120

BRACE20092740

BRACE20092750

BRACE20093070//P120 PROTEIN.//1.40E-13//121aa//41%//P30999

BRACE20093110

BRACE20093610

BRACE20094370

BRACE20095170

BRAWH10000010//Homo sapiens PMEPA1-protein (PMEPA1) mRNA, complete cds.//2.00E-84//250aa//67%//AF224278

BRAWH10000020//Homo sapiens putative hepatic transcription factor (WBSCR14) mRNA, complete cds.//1.20E-168//345aa//89%//AF156603

BRAWH10000070

BRAWH10000370//UROKINASE PLASMINOGEN ACTIVATOR SURFACE RECEPTOR PRECURSOR (U-PAR) (CD87).//9.40E-08//155aa//29%//Q05588

BRAWH10000940//Xenopus laevis mRNA for NfrI, complete cds.//6.10E-257//606aa//77%//D86491

BRAWH10001300

BRAWH10001620//Rattus norvegicus development-related protein mRNA, complete cds//1.90E-115//339aa//93%//AF045564

BRAWH10001640//Homo sapiens KRAB zinc finger protein (RITA) mRNA, complete cds.//5.10E-14//57aa//68%//AF272148

BRAWH10001680//Homeotic protein emx2//9.60E-126//252aa//92%//151737

BRAWH10001740

BRAWH10001800

BRAWH20000340//TRP-185 protein//7.20E-28//68aa//97%//S62356

BRAWH20000480//Mus musculus kinesin motor protein KIFC2 mRNA, complete cds.//1.50E-120//270aa//85%//U92949

BRAWH20000930

BRAWH20001090//SARCALUMENIN PRECURSOR.//1.90E-05//363aa//24%//P13666

BRAWH20001770//SERINE HYDROXYMETHYLTRANSFERASE, MITOCHONDRIAL PRECURSOR (EC 2.1.2.1) (SERINE METHYLASE) (GLYCINE HYDROXYMETHYLTRANSFERASE) (SHMT).//3.20E-41//77aa//100%//P34897

BRAWH20002480

BRAWH20003230//Proline rich protein//2.00E-29//142aa//52%//CAA48321

BRAWH20004430//Human breast cancer, estrogen regulated LIV-1 protein (LIV-1) mRNA, partial cds.//1.00E-46//164aa//46%//U41060

BRAWH20004760//Mus musculus mRNA for Eos protein, complete cds.//1.80E-92//180aa//92%//AB017615

BRAWH20005030//REGULATOR OF MITOTIC SPINDLE ASSEMBLY 1 (RMSA-1).//6.50E-18//103aa//52%//P49646

BRAWH20005220//Homo sapiens hD54+ins2 isoform (hD54) mRNA, complete cds.//1.20E-77//206aa//80%//AF004430

BRAWH20005540

BRAWH20006330//Homo sapiens mRNA for zinc finger 2 (ZNF2 gene).//1.20E-120//214aa//98%//X60152

BRAWH20006510//HYDROXYMETHYLGLUTARYL-COA LYASE (EC 4.1.3.4) (HMG-COA LYASE) (HL) (3-HYDROXY-3-METHYLGLUTARATE-COA LYASE).//1.60E-96//238aa//73%//p35915

BRAWH20006860//SERINE/THREONINE-PROTEIN KINASE SGK (EC 2.7.1.-) (SERUM/GLUCOCORTICOID-REGULATED KINASE).//4.20E-223//406aa//99%//Q00141

BRAWH20006970

BRAWH20008660

BRAWH20008920

BRAWH20009010//Human (c-myb) gene, complete primary cds, and five complete alternatively spliced cds.//9.70E-28//105aa//59%//U22376

BRAWH20009440//Arabidopsis thaliana pollenless3 (178) gene, complete cds: beta-9 tubulin (TUB9) gene, partial cds; and unknown gene.//7.90E-31//271aa//34%//AF060248

BRAWH20009840//CYTOCHROME P450 2J2 (EC 1.14.14.1) (CYPIIJ2) (ARACHIDONIC ACID EPOXYGENASE).//1.10E-146//273aa//98%//P51589

BRAWH20011030

BRAWH20011290//OCCLUDIN.//2.90E-07//174aa//29%//Q61146

BRAWH20011410//CUTICLE COLLAGEN 2.//2.30E-05//129aa//35%//P17656

BRAWH20011660//BETA-GALACTOSIDASE PRECURSOR (EC 3.2.1.23) (LACTASE) (ACID BETA-GALACTOSIDASE).//1.40E-105//421aa//49%//P16278

BRAWH20012030

BRAWH20014180//Homo sapiens double-stranded RNA specific adenosine deaminase (ADAR3) mRNA, complete cds.//3.60E-97//179aa//100%//AF034837

BRAWH20014380

BRAWH20014610

BRAWH20014840//POLYPEPTIDE N-ACETYLGALACTOSAMINYLTRANSFERASE (EC 2.4.1.41) (PROTEIN-UDP ACETYLGALACTOSAMINYLTRANSFERASE) (UDP-GALNAC:POLYPEPTIDE, N-ACETYLGALACTOSAMINYLTRANSFERASE) (GALNAC-T1).//4.50E-84//511aa//36%//Q07537

BRAWH20015030

BRAWH20036890//Mus musculus clone mouse1-9 putative protein phosphatase type 2C mRNA, partial cds.//2.70E-59//120aa//98%//AF117832

BRAWH20036930

BRAWH20038320

BRAWH20040950

BRAWH20047310

BRAWH20052250

BRAWH20059980//BONE MORPHOGENETIC PROTEIN 1 PRECURSOR (EC 3.4.24.-) (BMP-1).//8.60E-37//282aa//32%//P98070

BRAWH20060440

BRAWH20064500//Homo sapiens CAGF9 mRNA, partial cds.//8.00E-25//148aa//51%//U80736

BRAWH20064930

BRAWH20066220//DYNEIN GAMMA CHAIN, FLAGELLAR OUTER ARM.//3.20E-41//221aa//39%//Q39575

BRAWH20069600

BRAWH20069890//DNA-DIRECTED RNA POLYMERASE II LARGEST SUBUNIT (EC 2.7.7.6) (RPB1) (FRAGMENT).//9.50E-07//188aa//30%//P11414

BRAWH20074060

BRAWH20076050//LORICRIN.//2.80E-05//160aa//31%//P18165

BRAWH20087060

BRAWH20089030

BRAWH20089560//Protein-tyrosine-phosphatase (EC 3.1.3.48)

TD14//0//736aa//90%//T14355

BRAWH20092270

BRAWH20092610//TLM PROTEIN (TLM ONCOGENE).//3.90E-15//122aa//43%//P17408

BRAWH20093600

BRAWH20094850

CD34C20000510//Human chitotriosidase precursor mRNA, complete cds.//7.80E-247//366aa//98%//U29615

CTONG20003030

CTONG20005890//CHANNEL ASSOCIATED PROTEIN OF SYNAPSE-110 (CHAPSYN-110).//3.10E-18//241aa//31%//15700

CTONG20007710

CTONG20008270

CTONG20011390

CTONG20013200//HYPOTHETICAL PROTEIN C2G11.15C IN CHROMOSOME I (FRAGMENT).//1.60E-15//130aa//36%//Q09814

CTONG20013660//GLUCOAMYLASE S1/S2 PRECURSOR (EC 3.2.1.3) (GLUCAN 1,4-ALPHA-GLUCOSIDASE) (1,4-ALPHA-D-GLUCAN GLUCOHYDROLASE).//5.00E-11//468aa//23%//P08640

CTONG20015330

CTONG20018200//Mus musculus NSD1 protein mRNA, complete cds.//Q//1061aa//87%//AF064553

CTONG20019110//UBIOUITIN CARBOXYL-TERMINAL HYDROLASE 4 (EC 3.1.2.15) (UBIOUITIN THIOLESTERASE 4) (UBIOUITIN-SPECIFIC PROCESSING PROTEASE 4) (DEUBIOUITINATING ENZYME 4) (UBIQUITOUS NUCLEAR PROTEIN HOMOLOG).//5.40E-19//116aa//39%//Q3107

CTONG20019550//Homo sapiens mRNA for actin binding protein ABP620, complete cds.//Q//1175aa//53%//AB029290

CTONG20020730

CTONG20021430

CTONG20024180//Homo sapiens scaffold attachment factor B (SAF-B) mRNA, partial cds.//3.10E-52//366aa//40%//L43631

CTONG20024530

CTONG20025580//ZINC FINGER PROTEIN 211 (ZINC FINGER PROTEIN C2H2-25).//2.00E-58//223aa//45%//Q13398

CTONG20027210//VACUOLAR PROTEIN SORTING-ASSOCIATED PROTEIN VPS13.//7.90E-06//224aa//24%//Q07878

CTONG20028030

CTONG20028160//Homo sapiens cadherin-like protein VR20 mRNA, partial cds.//9.70E-170//290aa//100%//AF169690

CTONG20028200//Mus musculus MGA protein mRNA, complete cds.//Q//1132aa//85%//AF205935

CTONG20029650

CTONG20037820//GAMMA-AMINOBUTYRIC-ACID RECEPTOR PI SUBUNIT PRECURSOR (GABA(A) RECEPTOR).//4.30E-94//164aa//93%//Q00591

CTONG20047160//Rattus norvegicus mRNA for seven transmembrane receptor, complete cds.//1.10E-26//319aa//29%//AB019120

CTONG20055530//ANKYRIN 2 (BRAIN ANKYRIN) (ANKYRIN B) (ANKYRIN, NONERYTHROID).//1.90E-59//598aa//30%//Q01484

CTONG20064490//Drosophila melanogaster 26S proteasome regulatory complex subunit p42A mRNA, complete cds.//1.00E-41//108aa//77%//AF145308

D30ST20001840//RNA binding motif protein 9 [Homo sapiens].//1.00E-139//297aa//91%//NP055124

DFNES20002120//Mus musculus tgt mRNA for tRNA-guanine transglycosylase, complete cds.//1.40E-62//140aa//83%//AB034632

DFNES20002680//MYOSIN HEAVY CHAIN, STRIATED MUSCLE.//9.00E-26//620aa//24%//P24733

DFNES20002920

DFNES20003350//CELL SURFACE GLYCOPROTEIN 1 PRECURSOR (OUTER LAYER PROTEIN B) (S-LAYER PROTEIN 1).//5.30E-05//277aa//25%//Q06852

DFNES20004320//Homo sapiens ubiquitous TPR-motif protein Y isoform (UTY) gene, partial cds; alternatively spliced.//3.20E-15//85aa//50%//AF265575

FCBBF10005980//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//3.20E-151//395aa//57%//P51523

FCBBF10006180

FCBBF10006750

FCBBF10006860

FCBBF10006870//Mus musculus Rap2 interacting protein 8 (RPIP8) mRNA, complete cds.//3.10E-113//456aa//53%//U73941

FCBBF10006910

FCBBF10007320

FCBBF10007600

FCBBF20000940//MONOCYTIC LEUKEMIA ZINC FINGER PROTEIN (ZINC FINGER PROTEIN 220).//2.70E-05//194aa//28%//Q92794

FCBBF20001050

FCBBF20001950

FCBBF20002320

FCBBF20002760//ALPHA SCRUIN.//2.70E-05//214aa//24%//Q25390

FCBBF20005760

FCBBF20005910//KINESIN LIGHT CHAIN (KLC).//6.40E-10//114aa//39%//P46825

FCBBF20006770

FCBBF20007330//DIPEPTIDYL PEPTIDASE IV LIKE PROTEIN (DIPEPTIDYL AMINOPEPTIDASE-RELATED PROTEIN) (DIPEPTIDYLPEPTIDASE VI) (DPPX-L/DPPX-S).//1.70E-19//96aa//45%//P46101

FCBBF20008080

FCBBF20008150//ZYXIN.//7.60E-57//350aa//34%//Q04584

FCBBF20009400

FCBBF20009510//ZINC FINGER PROTEIN 7 (ZINC FINGER PROTEIN KOX4) (ZINC FINGER PROTEIN HF.16).//2.30E-76//225aa//43%//P17097

FCBBF20012110//Leishmania major partial ppg1 gene for proteophosphoglycan.//3.50E-05//256aa//24%//AJ243460

FCBBF20012990

FCBBF20014800

FCBBF20015380//Homo sapiens long chain polyunsaturated fatty acid elongation enzyme (HEL01) mRNA, complete cds.//7.00E-61//319aa//44%//AF231981

FCBBF20016720

FCBBF20017180

FCBBF20017200

FCBBF40002820//ELECTRON TRANSFER FLAVOPROTEIN BETA-SUBUNIT (BETA-ETF).//3.60E-121//239aa//99%//P38117

FCBBF50002610//ZINC FINGER PROTEIN 35 (ZFP-35).//1.40E-137//489aa//50%//P15620

FEBRA20000350//Mus musculus MAST205 protein kinase mRNA, complete cds./6.20E-71//190aa//76%//U02313

FEBRA20000530//Drosophila melanogaster Diablo (dbo) mRNA, complete cds./6.40E-58//495aa//32%//AF237711

FEBRA20001050//KINESIN LIGHT CHAIN (KLC).//4.20E-207//566aa//69%//Q07866

FEBRA20001290//PROBABLE TRNA (5-METHYLAMINOMETHYL-2-THIOURIDYLATE)-METHYLTRANSFERASE (EC 2.1.1.61)./14.60E-43//82aa//100%//Q75648

FEBRA20003110//Homo sapiens UDP-GlcNAc:a-3-D-mannoside b1,2-N-acetylglucosaminyltransferase 1.2 (MGAT1.2) mRNA, partial cds.//3.80E-92//172aa//98%//AF250859

FEBRA20003300

FEBRA20003770//Homo sapiens ankyrin repeat-containing protein (CCM1) mRNA, complete cds.//Q//406aa//100%//AF296765

FEBRA20003780

FEBRA20003910

FEBRA20003970//ZINC FINGER PROTEIN 228.//1.60E-118//423aa//52%//Q9UJU3-FEBRA20003990//ZINC FINGER PROTEIN 45 (BRC1744).//4.60E-130//502aa//50%//Q02386

FEBRA20004040

FEBRA20004150//DRA PROTEIN (DOWN-REGULATED IN ADENOMA).//2.70E-30//150aa//37%//P40879

FEBRA20004520

FEBRA20004540//ZINC FINGER PROTEIN 83 (ZINC FINGER PROTEIN HPF1).//2.40E-252//425aa//99%//P51522

FEBRA20004910

FEBRA20005360//Homo sapiens paraneoplastic cancer-testis-brain antigen (MA5) mRNA, complete cds.//5.50E-75//375aa//44%//AF083116

FEBRA20006560

FEBRA20006800

FEBRA20006900

FEBRA20007330//45 KDA CALCIUM-BINDING PROTEIN PRECURSOR (STROMAL CELL-DERIVED FACTOR 4) (SDF-4).//3.30E-63//117aa//94%//Q61112

FEBRA20007400

FEBRA20007570//Homo sapiens BM-009 mRNA, complete cds.//1.30E-59//189aa//66%//AF208851

FEBRA20007710

FEBRA20007720//Mus musculus strain ICR 90 kDa actin-associated protein palladin mRNA, partial cds.//8.10E-06//144aa//29%//AF205079

FEBRA20007870//Homo sapiens putative transcription factor CR53 (CR53) mRNA, partial cds.//6.60E-79//144aa//100%//AF017433

FEBRA20008090

FEBRA20008560//HYPOTHETICAL 40.9 KDA PROTEIN C08B11.5 IN CHROMOSOME II.//4.30E-05//91aa//31%//Q09442

FEBRA20008740

FEBRA20008800//SARCALUMENIN PRECURSOR.//2.10E-07//199aa//30%//P13666

FEBRA20008810//ACTIN 6 (FRAGMENT).//1.00E-103//369aa//50%//P53459

FEBRA20009010

FEBRA20009590

FEBRA20009720//ZINC FINGER PROTEIN 184 (FRAGMENT).//2.30E-145//514aa//51%//Q99676

FEBRA20010930//MONOCARBOXYLATE TRANSPORTER 4 (MCT 4).//9.00E-22//333aa//28%//Q15374

FEBRA20011330//26S PROTEASOME REGULATORY SUBUNIT S3 (PROTEASOME SUBUNIT P58).//2.10E-54//113aa//100%//Q43242

FEBRA20011460//ZINC FINGER PROTEIN 174 (AW-1).//1.90E-12//60aa//55%//Q15697

FEBRA20011970

FEBRA20012270

FEBRA20012450//NAG14//4.90E-24//399aa//27%//AF196976

FEBRA20012940

FEBRA20013510

FEBRA20014870

FEBRA20014920//Mus musculus pecanex 1 mRNA, complete cds.//6.50E-120//313aa//72%//AF096286

FEBRA20015840//DELTA-LIKE PROTEIN PRECURSOR (DLK) (PREADIPOCYTE FACTOR 1) (PREF-1) (ADIPOCYTE DIFFERENTIATION INHIBITOR PROTEIN) [CONTAINS: FETAL ANTIGEN 1 (FA1)].//2.90E-64//323aa//39%//Q09163

FEBRA20015900

FEBRA20015910

FEBRA20017060//Human APEG-1 mRNA, complete cds.//7.10E-57//113aa//100%//U57099

FEBRA20017150//ZINC-BINDING PROTEIN A33.//4.00E-10//322aa//21%//Q02084

FEBRA20017900//Xenopus laevis RRM-containing protein SEB-4 mRNA, complete cds.//1.20E-79//180aa//88%//AF223427

FEBRA20019890//HYPOTHETICAL PROTEIN KIAA0167.//1.70E-180//339aa//56%//Q99490

FEBRA20020860

FEBRA20021910

FEBRA20021940

FEBRA20024290

FEBRA20024420//Homo sapiens partial mRNA for choline dehydrogenase (chdh gene).//1.10E-71//143aa//98%//AJ272267

FEBRA20025250//HYPOTHETICAL 73.0 KDA PROTEIN IN CLA4-PUS4 INTERGENIC REGION.//1.40E-09//172aa//29%//P48566

FEBRA20027270

FEBRA20027830

FEBRA20028820

FEBRA20028970

FEBRA20029080

FEBRA20030540//Halocynthia roretzi mRNA for HrPET-1, complete cds.//2.80E-25//155aa//34%//AB029334

FEBRA20031550

FEBRA20033080

FEBRA20034290//RESTIN (CYTOPLASMIC LINKER PROTEIN-170) (CLIP-170).//6.90E-21//87aa//51%//Q42184

FEBRA20037070

FEBRA20041100//PHOSPHOLIPASE ADRAB-B PRECURSOR (EC 3.1.-.-).//1.10E-119//259aa//83%//Q05017

FEBRA20041910

FEBRA20042240

FEBRA20042370

FEBRA20042930

FEBRA20043250//Canis familiaris mRNA for C3VS protein.//1.90E-191//589aa//66%//X99145

FEBRA20043290//MYOSIN HEAVY CHAIN, CARDIAC MUSCLE ISOFORM (FRAGMENT).//Q//975aa//65%//P29616

FEBRA20044120

FEBRA20044430

FEBRA20044900//R. norvegicus mRNA for CPG2 protein.//8.60E-244//509aa//89%//X95466

FEBRA20045920//Homo sapiens mRNA for putative sialoglycoprotease type 2.//5.70E-187//273aa//98%//AJ295148

FEBRA20048180//DRR1 PROTEIN (TU3A PROTEIN).//8.80E-56//131aa//87%//Q95990

FEBRA20050140//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//4.40E-125//505aa//45%//P51523

FEBRA20050790//PROTEIN-TYROSINE PHOSPHATASE STRIATUM-ENRICHED (EC 3.1.3.48) (STEP) (NEURAL-SPECIFIC PROTEIN-TYROSINE PHOSPHATASE) (FRAGMENT).//3.60E-66//149aa//83%//P54829

FEBRA20052160//PUTATIVE GLUTAMINE-DEPENDENT NAD(+) SYNTHETASE (EC 6.3.5.1) (NAD(+) SYNTHASE [GLUTAMINE-HYDROLYSING]).//6.50E-33//105aa//64%//P38795

FEBRA20053770

FEBRA20053800//Homo sapiens ubiquitous TPR-motif protein Y isoform (UTY) gene, partial cds; alternatively spliced.//3.20E-08//65aa//49%//AF265575

FEBRA20054270

FEBRA20057260

FEBRA20057520

FEBRA20057780//INTEGUMENTARY MUCIN A.1 PRECURSOR (FIM-A.1) (PREPROSPASMOLYSIN)./2.40E-07//120aa//27%//P10667

FEBRA20057880//LIM domain only 7 isoform c [Homo sapiens]//1.20E-287//545aa//99%//NP056667

FEBRA20059980

FEBRA20060920//SEGMENT POLARITY PROTEIN DISHEVELLED.//6.60E-15//84aa//41%//P51140

FEBRA20061500

FEBRA20062700//PUTATIVE novel haloacid dehalogenase-like hydrolase family protein similar to (archaea) bacterial proteins) [Homo sapiens].//Q//209aa//100%//CAB43550

FEBRA20063150//Homo sapiens topoisomerase II alpha-4 (TOP2A) mRNA, partial cds./8.20E-22//73aa//73%//AF285159

FEBRA20063540

FEBRA20064760//ZINC FINGER PROTEIN 184 (FRAGMENT).//2.10E-182//547aa//54%//Q99676

FEBRA20066270

FEBRA20066670

FEBRA20067360//HYPOTHETICAL ZINC FINGER PROTEIN KIAA0961.//7.00E-134//472aa//54%//Q9Y2G7

FEBRA20067930//PERSEPHIN PRECURSOR (PSP).//7.90E-23//50aa//100%//Q60542

FEBRA20068730//Trg protein//1.00E-82//560aa//37%//160486

FEBRA20069420//ZINC FINGER PROTEIN 33A (ZINC FINGER PROTEIN KOX31) (KIAA0065) (HA0946) (FRAGMENT).//3.60E-103//264aa//58%//Q06730

FEBRA20070170//Homo sapiens TRAF4-associated factor 2 mRNA, partial cds.//1.40E-87//220aa//75%//U83194

FEBRA20072000//MYOSIN II HEAVY CHAIN, NON MUSCLE.//3.00E-08//645aa//21%//P08799

FEBRA20072800//Human (c-myb) gene, complete primary cds, and five complete alternatively spliced cds.//4.10E-30//97aa//74%//U22376

FEBRA20074140

FEBRA20074580

FEBRA20075510//RAS-RELATED PROTEIN RAB-6.//1.00E-36//88aa//88%//P20340

FEBRA20075660//REGULATOR OF MITOTIC SPINDLE ASSEMBLY-1 (RMSA-1).//6.00E-09//84aa//46%//P49646

FEBRA20076220

HCASM10000210//Plasmodium berghei strain NYU2 merozoite surface protein-1 mRNA, partial cds.//1.50E-08//122aa//28%//AF000413

HCASM10000610//HYPOTHETICAL 63.9 KD PROTEIN C1F12.09 IN CHROMOSOME I.//2.80E-14//116aa//31%//Q10351

HCASM10001150

HCASM20002020

HCASM20002140//G1/S-SPECIFIC CYCLIN D3.//8.90E-118//226aa//99%//P30281

HCASM20003070

HCASM20005340

HCASM20005360//Macrophage migration inhibitory factor//2.50E-17//45aa//100%//XP 000858

HEART20000350//Transacylases//7.50E-35//267aa//35%//AAB94954

HEART20000990

HEART20003090//PTB-ASSOCIATED SPLICING FACTOR (PSF).//3.70E-07//143aa//30%//P23246

HEART20004110

HEART20004480//TROPONIN T, CARDIAC MUSCLE ISOFORMS (TNTC).//2.80E-39//81aa//98%//P45379

HEART20004920

HEART20005060//ENAMELIN (TUFTELIN).//1.80E-23//215aa//30%//P27628

HEART20005200//ANKYRIN 1//5.00E-24//250aa//37%//P16157

HEART20005680

HHDPC20000550//ADENYLATE KINASE, CHLOROPLAST (EC 2.7.4.3) (ATP-AMP TRANSPHOSPHORYLASE).//1.60E-14//201aa//24%//P43188

HHDPC20000950//Cricetulus griseus layilin mRNA, complete cds.//8.00E-177//373aa//84%//AF093673

HHDPC20001150//Mus musculus putative secreted protein ZSIG37 (Zsig37) mRNA, complete cds.//2.00E-91//199aa//83%//AF192499

HHDPC20001490//Mus musculus partial mRNA for muscle protein 534 (mg534 gene).//2.10E-80//167aa//88%//AJ250189

HHDPC20003150

HHDPC20004550//H. sapiens PTPL1 mRNA for protein tyrosine phosphatase.//3.60E-32//371aa//26%//X80289

HHDPC20004560

HHDPC20004620

HLUNG10000240

HLUNG10000300

HLUNG10000370

HLUNG10000640//KARYOGAMY PROTEIN KAR4.//2.20E-27//324aa//27%//P25583

HLUNG10000760//Mus musculus mRNA for mSox7, complete cds.//9.90E-186//388aa//87%//AB023419

HLUNG10000990//TRICHOHYALIN.//7.00E-06//454aa//21%//P22793

HLUNG10001050//MYOTUBULARIN.//4.60E-12//95aa//37%//Q13496

HLUNG10001100//PISTIL-SPECIFIC EXTENSIN-LIKE PROTEIN PRECURSOR (PELP).//6.20E-06//117aa//30%//Q03211

HLUNG20000680//ZINC FINGER PROTEIN 157.//6.30E-104//443aa//45%//P51786

HLUNG20001160//AIG1 PROTEIN.//3.10E-24//271aa//28%//P54120

HLUNG20001250

HLUNG20001420//Mus musculus putative thymic stromal co-transporter TSCOT mRNA, complete cds.//1.20E-189//478aa//76%//AF148145

HLUNG20001760

HLUNG20002550//MAST CELL TRYPTASE PRECURSOR (EC 3.4.21.59).//1.10E-43//178aa//47%//P50342

HLUNG20003140

HLUNG20004120

HLUNG20004800

HLUNG20005010

HSYRA10001190//PROBABLE GYP7 PROTEIN (FRAGMENT).//7.90E-08//157aa//25%//P09379

HSYRA10001370//ZINC FINGER PROTEIN 184 (FRAGMENT).//1.70E-149//556aa//50%//Q99676

HSYRA10001480

HSYRA10001680//HYPOTHETICAL HELICASE C28H8.3 IN CHROMOSOME III./9.30E-61//540aa//32%//Q09475

HSYRA10001780

HSYRA20001350//CELL POLARITY PROTEIN TEA1.//9.10E-16//211aa//28%//P87061

HSYRA20002480

HSYRA20002530

HSYRA20003470

HSYRA20005100//NAM7 PROTEIN (NONSENSE-MEDIATED MRNA DECAY PROTEIN 1) (UP-FRAMESHIFT SUPPRESSOR 1).//6.70E-31//374aa//31%//P30771

HSYRA20006050//MYOSIN HEAVY CHAIN, CLONE 203 (FRAGMENT).//3.40E-11//282aa//20%//P39922

HSYRA20006290//SKIN SECRETORY PROTEIN XP2 PRECURSOR (APEG PROTEIN).//2.10E-07//168aa//30%//P17437

HSYRA20006400//Homo sapiens FRG1 mRNA, complete cds.//1.00E-50//112aa//91%//L76159

HSYRA20007600

HSYRA20008280

HSYRA20011030

HSYRA20011530

HSYRA20013320//INSULIN-LIKE GROWTH FACTOR BINDING PROTEIN 3 PRECURSOR (IGFBP-3) (IBP-3) (IGF-BINDING PROTEIN 3).//1.60E-130//236aa//99%//P17936

HSYRA20014200

HSYRA20014760

HSYRA20015740//GLUCOSAMINE-6-PHOSPHATE ISOMERASE (EC 5.3.1.10) (GLUCOSAMINE-6-PHOSPHATE DEAMINASE) (GNPDA) (GLCN6P DEAMINASE) (OSCILLIN).//1.70E-133//274aa//87%//Q64422

HSYRA20015800

HSYRA20016210

HSYRA20016310//ZINC FINGER PROTEIN 138 (FRAGMENT).//3.80E-136//237aa//100%//P52744

IMR3210000440//Human transmembrane receptor precursor (PTK7) mRNA, complete cds.//1.60E-208//388aa//99%//U40271

IMR3210000740

IMR3210000750

IMR3210001580//Cricetulus griseus layilin mRNA, complete cds.//2.30E-177//373aa//84%//AF093673

IMR3210001650

IMR3210002420//ZINC FINGER PROTEIN 33A (ZINC FINGER PROTEIN KOX31) (KIMA0065) (HA0946) (FRAGMENT).//3.80E-81//281aa//47%//Q06730

IMR3210002660//ZINC/CADMIUM RESISTANCE PROTEIN.//2.50E-10//148aa//25%//P20107

IMR3220002230//HINT PROTEIN (PROTEIN KINASE C INHIBITOR 1) (PKCI-1) (17 KD INHIBITOR OF PROTEIN KINASE C).//7.90E-08//97aa//32%//P16436

IMR3220003020//Mus. musculus shid mRNA, complete cds.//3.80E-138//337aa//77%//AB018423

IMR3220006090

IMR3220007420//HYPOTHETICAL ZINC FINGER PROTEIN ZK686.4 IN CHROMOSOME III.//5.50E-50//211aa//48%//P34670

IMR3220007750//FOLLISTATIN-RELATED PROTEIN PRECURSOR (TGF-BETA-INDUCIBLE PROTEIN TSC-36).//3.60E-19//229aa//30%//Q62356

IMR3220007910//SYNAPSINS IA AND IB (BRAIN PROTEIN 4.1).//5.00E-07//167aa//31%//P17600

IMR3220008380//METHIONYL-TRNA FORMYLTRANSFERASE, MITOCHONDRIAL PRECURSOR (EC 2.1.2.9) (MTFMT) (FRAGMENT).//1.10E-147//301aa//90%//Q77480

IMR3220008590

IMR3220008630//PUTATIVE SPLICING FACTOR, ARGININE/SERINE-RICH 2 (SPLICING FACTOR SC35) (SC-35) (SPLICING COMPONENT, 35 KD).//3.50E-05//98aa//40%//Q09511

IMR3220009190//METHIONINE AMINOPEPTIDASE 2 (EC 3.4.11.18) (METAP 2) (PEPTIDASE M 2) (INITIATION FACTOR 2 ASSOCIATED 67 KD GLYCOPROTEIN) (P67).//1.90E-230//418aa//92%//Q08663

IMR3220009350

IMR3220009530

IMR3220009730//DNA43 PROTEIN./6.20E-13//367aa//23%//P32354

IMR3220009840

IMR3220011850

IMR3220012180//Mus musculus pseudouridine synthase 3 (Pus3) mRNA, complete cds.//3.10E-221//483aa//84%//AF266505

IMR3220013170//Homo sapiens mRNA for protein phosphatase, complete cds.//9.10E-41//195aa//48%//AB027004

IMR3220013320//NEUROFILAMENT TRIPLET M PROTEIN (160 KD NEUROFILAMENT PROTEIN) (NF-M).//5.10E-08//357aa//22%//P08553

IMR3220014350//HYPOTHETICAL PROTEIN KIAA0025.//9.70E-60//408aa//37%//Q15011

IMR3220014910//Rattus norvegicus tricarboxylate carrier-like protein mRNA, complete cds.//3.90E-43//137aa//57%//AF276997

IMR3220016000

IMR3220017240

KIDNE10000080//Xenopus laevis alpha-1 collagen type II′ mRNA, complete cds.//8.60E-07//244aa//29%//M63596

KIDNE10000280

KIDNE10000500

KIDNE10001040//SYNTAXIN 7.//1.10E-32//249aa//32%//Q15400

KIDNE10001430

KIDNE10001450

KIDNE10001520//Mus musculus yolk sac permease-like molecule 1 (YSPL-1) mRNA, complete cds.1/6.40E-73//159aa//77%//U25739

KIDNE20000410//ALANINE-GLYOXYLATE AMINOTRANSFERASE 2 PRECURSOR (EC 2.6.1.44) (AGT 2) (BETA-ALANINE-PYRUVATE AMINOTRANSFERASE) (BETA-ALAMT II).//1.00E-71//167aa//85%//Q64565

KIDNE20000510//ZINC FINGER PROTEIN 133.//5.10E-156//503aa//56%//P52736

KIDNE20000700

KIDNE20000850

KIDNE20001670//Mus musculus mRNA for RST, complete cds.//6.80E-123//331aa//72%//AB005451

KIDNE20001920

KIDNE20002440

KIDNE20002450

KIDNE20002660

KIDNE20003150//AQUAPORIN-7 LIKE (AQUAPORIN ADIPOSE) (AOPAP).//1.80E-44//95aa//92%//Q14520

KIDNE20003300//Ikaros-like protein//1.50E-45//160aa//41%//AMC34387

KIDNE20003490//Mus musculus putative lysophosphatidic acid acyltransferase mRNA, complete cds.//6.10E-124//291aa//77%//AF015811

KIDNE20003750//Mus musculus mRNA for granuphilin-a, complete cds.//1.30E-31//173aa//42%//AB025258

KIDNE20004030

KIDNE20004220//Homo sapiens topoisomerase II alpha-4 (TOP2A) mRNA, partial cds.//3.70E-21//76aa//72%//AF285159

KIDNE20004970//TRICHOHYALIN.//1.50E-06//244aa//27%//P37709

KIDNE20005130//ALANINE-GLYOXYLATE AMINOTRANSFERASE 2 PRECURSOR (EC 2.6.1.44) (AGT 2) (BETA-ALANINE-PYRUVATE AMINOTRANSFERASE) (BETA-ALAAT II).//1.30E-153//337aa//84%//Q64565

KIDNE20005170//HYPOTHETICAL 49.1 KD PROTEIN C11D3.06 IN CHROMOSOME I.//2.20E-30//247aa//31%//Q10085

KIDNE20005190//TONB PROTEIN.//2.60E-08//93aa//34%//Q06432

KIDNE20005740//Staphylococcus epidermidis putative cell-surface adhesin SdrF (sdrF) gene, complete cds.//3.10E-34//372aa//28%//AF245041

KIDNE20031850//Ras association (RalGDS/AF-6) domain family 2; KIMA0168 gene product [Homo sapiens]//4.00E-66//250aa//59%//NP055552

KIDNE20033050//PUTATIVE AMIDASE AF1954 (EC 3.5.1.4).//8.30E-34//242aa//32%//Q28325

KIDNE20033350

KIDNE20033570

KIDNE20033730//Homo sapiens Asef mRNA for APC-stimulated guanine nucleotide exchange factor, complete cds.//3.90E-184//572aa//61%//AB042199

KIDNE20033770

KIDNE20037520

KIDNE20039410//HYPOTHETICAL 37.2 KDA PROTEIN C12C2.09C IN CHROMOSOME II.//3.20E-19//209aa//22%//Q09749

KIDNE20039940//ZINC FINGER PROTEIN 191.//1.40E-82//308aa//56%//Q14754

KIDNE20040340

KIDNE20040540

KIDNE20040840//Morone saxatilis myosin heavy chain FM3A (FM3A) mRNA, complete cds.//Q//1135aa//64%//AF003249

KIDNE20042620

KIDNE20042940

KIDNE20042950//Human mRNA for prepro-alpha2(1) collagen (COL1A2).//1.40E-05//96aa//37%//Y00724

KIDNE20043440//Vacuolar protein sorting-associated protein—fission yeast//9.00E-34//400aa//33%//T39106

KIDNE20044110//Homo sapiens vacuolar proton pump 116 kDa accessory subunit (ATP6N1B) mRNA, complete cds, alternatively spliced.//3.80E-278//322aa//91%//AF245517

KIDNE20045200

KIDNE20045340

KIDNE20045790

KIDNE20046810//Mus musculus peroxisomal long chain acyl-CoA thioesterase Ib (Pte1b) gene, exon 3 and complete cds.//2.80E-87//219aa//73%//AF180801

KIDNE20048280//Mus musculus orphan transporter isoform A12 (Xtrp2) mRNA, alternatively spliced, complete cds.//2.70E-265//600aa//76%//AF075262

KIDNE20048640

KIDNE20048790

KIDNE20049810

KIDNE20050420//LYSOSOMAL TRAFFICKING REGULATOR (BEIGE HOMOLOG).//5.00E-97//283aa//50%//Q99698

KIDNE20052960//ACTIN, CYTOPLASMIC 1 (BETA-ACTIN).//2.70E-16//68aa//67%//P12714

KIDNE20053360//Homo sapiens antigen NY-C0-31 (NY-C0-31) mRNA, partial cds.//6.40E-12//66aa//54%//AF039697

KIDNE20054000

KIDNE20054770//Drosophila melanogaster minidiscs (mnd) mRNA, complete cds.//4.80E-69//474aa//34%//AF139834

KIDNE20056290//Bos taurus mRNA for mitochondrial aralkyl acylCoA:amino acid N-acyltransferase.//6.40E-58//297aa//40%//AJ223301

KIDNE20056760//NEURONAL PROTEIN.//6.50E-44//118aa//75%//P41737

KIDNE20059080//Plakophilin 4 [Homo sapiens].//Q//669aa//98%//NP003619

KIDNE20059370

KIDNE20060140//Rattus norvegicus selective LIM binding factor mRNA, complete cds.//1.30E-255//339aa//94%//AF226993

KIDNE20060300//Gallus gallus syndesmos mRNA, complete cds.//3.10E-42//149aa//62%//AF095446

KIDNE20060530//Mus musculus mRNA for acetylglucosaminyltransferase-like protein.//3.70E-252//633aa//69%//AJ006278

KIDNE20060620

KIDNE20061490//Xenopus laevis RING finger protein mRNA, complete cds.//6.80E-19//36aa//40%//U63817

KIDNE20062480

KIDNE20062990//BOB1 PROTEIN (BEM1-BINDING PROTEIN).//8.00E-06//332aa//22%//P38041

KIDNE20063530

KIDNE20063760//GAMMA-GLUTAMYLTRANSPEPTIDASE 1 PRECURSOR (EC 2.3.2.2) (GAMMA-GLUTAMYLTRANSFERASE 1).//7.70E-20//62aa//83%//P19440

KIDNE20066520

KIDNE20067600//PROSTAGLANDIN F2-ALPHA RECEPTOR REGULATORY PROTEIN PRECURSOR (PROSTAGLANDIN F2-ALPHA RECEPTOR ASSOCIATED PROTEIN).//1.90E-23//293aa//26%//Q62786

KIDNE20067750//Homo sapiens PTOV1 (PTOV1) gene, complete cds.//7.60E-62//283aa//53%//AF238381

KIDNE20068800//ACTIN INTERACTING PROTEIN 2.//4.60E-33//143aa//51%//P46681

KIDNE20070050

KIDNE20070770

KIDNE20071860

KIDNE20073280//L. mexicana Imsap2 gene for secreted acid phosphatase 2 (SAP2).//3.30E-05//365aa//23%//Z46970

KIDNE20073520//GLUCOAMYLASE S1/S2 PRECURSOR (EC 3.2.1.3) (GLUCAN 1,4-ALPHA-GLUCOSIDASE) (1,4-ALPHA-D-GLUCAN GLUCOHYDROLASE).//3.00E-15//536aa//23%//P08640

KIDNE20073560

KIDNE20074220

KIDNE20075690//CLAUDIN-10 (OSP LIKE PROTEIN).//6.60E-90//224aa//77%//P78369

KIDNE20078100//DEOXYURIDINE 5′-TRIPHOSPHATE NUCLEOTIDOHYDROLASE (EC 3.6.1.23) (DUTPASE) (DUTP PYROPHOSPHATASE).//7.80E-16//100aa//44%//Q41033

KIDNE20078110//ZINC FINGER PROTEIN 202.//3.10E-67//427aa//40%//Q95125

LIVER10000580

LIVER10000670//UROCANATE HYDRATASE (EC 4.2.1.49) (UROCANASE) (IMIDAZOLONEPROPIONATE HYDROLASE).//1.50E-87//380aa//35%//P53385

LIVER10000790//Rattus norvegicus fertility related protein WMP1 mRNA, complete cds.//2.70E-82//254aa//65%//AF094609

LIVER10000990

LIVER10001040//Rattus norvegicus kidney-specific protein (KS) mRNA, complete cds.//6.00E-149//333aa//79%//AF062389

LIVER10001110

LIVER10001750

LIVER10002300//NADH-UBIOUINONE OXIDOREDUCTASE 51 KD SUBUNIT PRECURSOR (EC 1.6.5.3) (EC 1.6.99.3) (COMPLEX I-51 KD) (CI-51 KD).//1.80E-99//183aa//100%//P49821

LIVER10002780

LIVER10003030

LIVER10004330//Homo sapiens mRNA for neuropathy target esterase.//1.30E-256//710aa//68%//AJ004832

LIVER10005420//Mus musculus TAGL-alpha mRNA, complete cds.//1.20E-204//373aa//76%//AF149837

LIVER20000330//TUMOR NECROSIS FACTOR, ALPHA-INDUCED PROTEIN 1, ENDOTHELIAL (B12 PROTEIN).//1.80E-10//193aa//27%//Q13829

LIVER20000370//ALPHA-1B-GLYCOPROTEIN.//5.00E-159//304aa//96%//P04217

LIVER20004160

LIVER20004460

LIVER20005150

MAMGL10000320

MAMGL10000350

MAMGL10000560

MAMGL10001780//PUTATIVE PRE-MRNA SPLICING FACTOR RNA HELICASE (DEAH BOX PROTEIN 15) (ATP-DEPENDENT RNA HELICASE #46).//2.10E-80//166aa//92%//Q43143

MAMGL10001820//SEGMENT POLARITY PROTEIN DISHEVELLED.//1.10E-12//84aa//41%//P51140

MAMGL10001840

MESAN10000350//MAJOR SURFACE-LABELED TROPHOZOITE ANTIGEN PRECURSOR.//2.10E-06//179aa//29%//P21849

MESAN10001010//Rat trg gene product//6.00E-94//600aa//36%//160486

MESAN10001470

MESAN10001800//BB1=malignant cell expression-enhanced gene/tumor progression-enhanced gene [human, UM-UC-9 bladder carcinoma cell line, mRNA, 1897 nt].//1.60E-162//348aa//87%//S82470

MESAN20000920//Guanylate kinase-interacting protein 1 Maguin-1, membrane-associated//7.60E-155//477aa//62%//T18293

MESAN20001490//HYPOTHETICAL 175.8 KD PROTEIN IN GND1-IKI1 INTERGENIC REGION.//6.70E-163//346aa//58%//P38873

MESAN20002670

MESAN20002910//HISTIDYL-TRNA SYNTHETASE (EC 6.1.1.21) (HISTIDINE-TRNA LIGASE) (HISRS).//3.60E-98//202aa//96%//P12081

MESAN20003370

MESAN20005010//Homo sapiens DNA cytosine methyltransferase 3 alpha (DNMT3A) mRNA, complete cds.//6.60E-09//95aa//33%//AF067972

NB9N410000470//Homo sapiens NY-REN-45 antigen mRNA, complete cds.//9.70E-247//250aa//99%//AF155110

NB9N410001210

NB9N410001350//RAS-RELATED PROTEIN RAB-LA (YPT1-RELATED PROTEIN).//1.00E-70//109aa//100%//P11476

NB9N410001460

NB9N420000420

NB9N420001040//Mus musculus Shc binding protein (mPAL) mRNA, complete cds.//4.40E-286//672aa//77%//AF017152

NB9N420004950//PROBABLE NUCLEAR ANTIGEN.//5.00E-05//246aa//31%//P33485

NESOP10000870//HOMEOBOX PROTEIN SAX-1 (CHOX-3) (FRAGMENT).//1.70E-05//88aa//38%//P19601

NHNPC10000840//Homo sapiens poly-U binding splicing factor PUF60 (PUF60) mRNA, partial cds.//6.80E-196//380aa//99%//AF190744

NHNPC10001010

NHNPC10001240//PAIRED MESODERM HOMEOBOX PROTEIN 2A (PAIRED-LIKE HOMEOBOX 2A) (PHOX2A HOMEODOMAIN PROTEIN)./8.00E-05//109aa//28%//Q62066

NHNPC20002060//Bovine viral diarrhea virus type 2 strain BVDV2-SD1630c polyprotein gene, partial cds./8.70E-77//153aa//92%//AF268178

NHNPC20002120//ZINC FINGER PROTEIN 83 (ZINC FINGER PROTEIN HPF1).//2.20E-130//357aa//63%//P51522

NT2NE10000040

NT2NE10000140//Schizosaccharomyces pombe caffeine-induced death protein 1 (cid1)mRNA, complete cds.//1.00E-31//350aa//29%//AF105076

NT2NE10000180//SUPPRESSOR PROTEIN SRP40./2.50E-06//219aa//23%//P32583

NT2NE10000230

NT2NE10000630//Gallus gallus Dach2 protein (Dach2) mRNA, complete cds.//1.90E-147//194aa//78%//AF198349

NT2NE10000730//RAB GERANYLGERANYLTRANSFERASE ALPHA SUBUNIT (EC 2.5.1.-) (RAB GERANYL-GERANYLTRANSFERASE ALPHA SUBUNIT) (RAB GG TRANSFERASE) (RAB GGTASE).//3.30E-07//142aa//33%//Q92696

NT2NE10000830//POSSIBLE GUSTATORY RECEPTOR CLONE PTEO1 (FRAGMENT).//2.40E-56//182aa//62%//P35894

NT2NE10001200

NT2NE10001630

NT2NE10001850//UDP-N-ACETYLGLUCOSAMINE-PEPTIDE N-ACETYLGLUCOSAMINYLTRANSFERASE 110 KDA SUBUNIT (EC 2.4.1.-) (O-GLCNAC TRANSFERASE P110 SUBUNIT).//6.80E-30//395aa//28%//P56558

NT2NE20000380

NT2NE20000560

NT2NE20000640

NT2NE20001740

NT2NE20002140//DUAL SPECIFICITY PROTEIN PHOSPHATASE 8 (EC 3.1.3.48) (EC 3.1.3.16) (NEURONAL TYROSINE THREONINE PHOSPHATASE 1).//1.00E-131//487aa//51%//Q09112

NT2NE20002590//OOCYTE ZINC FINGER PROTEIN XLCOF6.1 (FRAGMENT).//6.30E-30//77aa//53%//P18750

NT2NE20002990//69 KD ISLET CELL AUTOANTIGEN (ICA69) (ISLET CELL AUTOANTIGEN 1).//3.30E-113//335aa//57%//Q05084

NT2NE20003270//GLUCOAMYLASE S1/S2 PRECURSOR (EC 3.2.1.3) (GLUCAN 1,4-ALPHA-GLUCOSIDASE) (1,4-ALPHA-D-GLUCAN GLUCOHYDROLASE).//7.00E-21//739aa//22%//P08640

NT2NE20003690//PROPIONYL-COA CARBOXYLASE ALPHA CHAIN PRECURSOR (EC 6.4.1.3) (PCCASE) (PROPANOYL-COA:CARBON DIOXIDE LIGASE).//1.80E-26//68aa//86%//P05165

NT2NE20003840//MICRONUCLEAR LINKER HISTONE POLYPROTEIN (MIC LH) [CONTAINS: LINKER HISTONE PROTEINS ALPHA, BETA, DELTA AND GAMMA].//7.80E-10//366aa//22%//P40631

NT2NE20003920

NT2NE20004550//sdk (sidekick) protein//4.90E-11//177aa//31%//T13924

NT2NE20004700

NT2NE20005170//Homo sapiens ciliary-dynein heavy chain 9 (DNAH9) mRNA, complete cds.//1.20E-103//226aa//90%//AF257737

NT2NE20005360//40S RIBOSOMAL PROTEIN SA (P40) (34/67 KD LAMININ RECEPTOR) (COLON CARCINOMA LAMININ-BINDING PROTEIN) (NEM/1CHD4)./1.50E-47//91aa//98%//P08865

NT2NE20005500

NT2NE20005860//Rattus norvegicus endo-alpha-D-mannosidase (Enman) mRNA, complete cds.//1.70E-85//207aa//69%//AF023657

NT2NE20006360

NT2NE20006580//Homo sapiens mRNA for RET finger protein-like 2//1.10E-152//288aa//98%//AJ010231

NT2NE20007060

NT2NE20007630

NT2NE20007870

NT2NE20008020

NT2NE20008090//ZINC FINGER PROTEIN 85 (ZINC FINGER PROTEIN HPF4) (HTF1).//1.90E-207//511aa//71%//Q03923

NT2NE20009800

NT2NE20011560

NT2NE20012470

NT2NE20013240

NT2NE203370//Homo sapiens estrogen-responsive B box protein (EBBP) mRNA, complete cds.//4.30E-208//394aa//97%//AF096870

NT2NE20013640

NT2NE20013720//Homo sapiens mRNA for putative ribulose-5-phosphate-epimerase, partial cds.//7.90E-58//116aa//98%//AJ224326

NT2NE20014030

NT2NE20014280

NT2NE20014350

NT2NE20015300

NT2NE20016230

NT2NE20016260//Homo sapiens G-protein coupled receptor RE2 mRNA, complete cds.//2.00E-148//270aa//100%//AF091890

NT2NE20016340//NADH-UBIQUINONE OXIDOREDUCTASE 9 KD SUBUNIT PRECURSOR (EC 1.6.5.3) (EC 1.6.99.3) (COMPLEX I-9 KD) (CI-9 KD).//5.50E-26//86aa//68%//P56181

NT2NE20016480

NT2NE20016660//PUTATIVE ATP-DEPENDENT RNA HELICASE YDLO31W.//3.90E-15//176aa//30%//Q12389

NT2NE20016970//MSF1 PROTEIN.//3.00E-23//169aa//34%//P35200

NT2NE20034080//Rattus norvegicus neurestin alpha mRNA, complete cds.//3.70E-258//449aa//99%//AF086607

NT2NE20035690//Homo sapiens phosphoinositol 3-phosphate-binding protein-2 (PEPP2) mRNA, complete cds.//1.60E-180//227aa//98%//AF302150

NT2NE20044900

NT2NE20047160//Homo sapiens AD-017 protein mRNA, complete cds.//2.70E-91//357aa//47%//AF157318

NT2NE20053710

NT2NE20054410//SPLICEOSOME ASSOCIATED PROTEIN 49 (SAP 49) (SF3B53).//4.50E-06//121aa//33%//Q15427

NT2NE20055170//Homo sapiens torsinA (DYT1) mRNA, complete cds.//9.50E-159//232aa//89%//AF007871

NT2NE20057200//Mus musculus Ubc6p homolog mRNA, complete cds.//3.80E-108//222aa//91%//U93242

NT2RI10000160

NT2RI10000270

NT2RI10000480//Homo sapiens MKP-1 like protein tyrosine phosphatase mRNA, complete cds.//8.30E-49//179aa//50%//AF038844

NT2RI10001640

NT2RI20000640

NT2RI20002700

NT2RI20002820//NUCLEOLAR AUTOANTIGEN N055.//5.00E-243//437aa//100%//Q92791

NT2RI20002940

NT2RI20003410//ZINC FINGER PROTEIN 43 (ZINC PROTEIN HTF6).//9.30E-226//578aa//70%//P28160

NT2RI20004120//CREB-BINDING PROTEIN.//4.40E-05//170aa//30%//Q92793

NT2RI20004210//ZINC FINGER PROTEIN 75.//1.10E-96//225aa//76%//P51815

NT2RI20005970

NT2RI20006690//TRICHOHYALIN./7.10E-17//222aa//32%//P37709

NT2RI20006710

NT2RI20006850//HISTONE H1.2 (H1 VAR. 1) (H1C).//3.30E-05//54aa//25%//P15864

NT2RI20007380

NT2RI20008650

NT2RI20009740

NT2RI20010100//FATTY ACYL-COA HYDROLASE PRECURSOR, MEDIUM CHAIN (EC 3.1.2.14) (THIOESTERASE B).1//1.10E-114//425aa//46%//Q04791

NT2RI20010830//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//2.30E-174//554aa//51%//P51523

NT2RI20010910//SPLICING FACTOR, ARGININE/SERINE-RICH 4 (PRE-MRNA SPLICING FACTOR SRP75).//3.40E-22//195aa//36%//Q08170

NT2RI20012350

NT2RI20012440

NT2RI20013420//Mus musculus cyclin ania-6b mRNA, partial cds.//2.70E-73//163aa//91%//AF211859

NT2RI20013850//Homo sapiens P381P (P381P) mRNA, complete cds.//7.70E-101//213aa//95%//AF093250

NT2RI20014090//DYSTROPHIN.//3.60E-15//546aa//20%//P11531

NT2RI20014100

NT2RI20014490//Mus musculus retinoic acid-responsive protein (Stra6) mRNA, complete cds.//1.30E-263//672aa//73%//AF062476

NT2RI20014500//TRICHOHYALIN.//4.80E-19//610aa//23%//Q07283

NT2RI20015190//Homo sapiens misato mRNA, partial cds.//7.60E-149//271aa//100%//AF272833

NT2RI20015400//Alcohol dehydrogenase/ribitol dehydrogenase//4.30E-107//469aa//44%//AAB93456

NT2RI20015950//Zea mays clone AGPZm1 arabinogalactan protein (agp) mRNA, partial cds.//5.60E-05//180aa//32%//AF134579

NT2RI20016210//Probable transposase—human transposon MER37//3.50E-19//156aa//35%//S72481

NT2RI20016570

NT2RI20017260

NT2RI20018460//basic domain/leucine zipper transcription factor//3.00E-52//203aa//59%//AAA65688

NT2RI20018660//Mus musculus erythroid membrane-associated protein ERMAP (Ermap) mRNA, complete cds.//9.20E-187//385aa//72%//AF153906

NT2RI20020220//VARIANT-SURFACE-GLYCOPROTEIN PHOSPHOLIPASE C (EC 3.1.4.47) (VSG LIPASE) (GLYCOSYLPHOSPHATIDYLINOSITOL-SPECIFIC PHOSPHOLIPASE C) (GPI-PLC).//5.60E-21//271aa//27%//Q15886

NT2RI20020410//SALIVARY PROLINE-RICH PROTEIN PO (ALLELE K) [CONTAINS: PEPTIDE P-D] (FRAGMENT).//1.20E-05//127aa//32%//P10162

NT2RI20021520

NT2RI20022430

NT2RI20022520

NT2RI20022700//X123 protein//7.20E-80//165aa//97%//168673

NT2RI20025170//Homo sapiens PAR3 (PAR3) mRNA, complete cds.//1.30E-113//373aa//45%//AF252293

NT2RI20025300//GLUCOAMYLASE S1/S2 PRECURSOR (EC 3.2.1.3) (GLUCAN 1,4-ALPHA-GLUCOSIDASE) (1,4-ALPHA-D-GLUCAN GLUCOHYDROLASE).//1.40E-14//628aa//21%//P08640

NT2RI20025410//ZINC FINGER PROTEIN 135.//3.90E-72//301aa//42%//P52742

NT2RI20025540//NUCLEAR AUTOANTIGENIC SPERM PROTEIN (NASP).//1.1E-312//604aa//98%//P49321

NT2RI20025850//PUTATIVE 90.2 KD ZINC FINGER PROTEIN IN CCA1-ADK2 INTERGENIC REGION.//1.40E-73//246aa//42%//P39956

NT2RI20026540

NT2RI20028020

NT2RI20028520

NT2RI20029260//ARP2/3 COMPLEX 16 KDA SUBUNIT (P16-ARC).//1.00E-52//154aa//68%//Q15511

NT2RI20029580//Homo sapiens mRNA for copine VI protein.//1.00E-207//425aa//73%//AJ133798

NT2RI20029700

NT2RI20030110//Mus musculus clone:2-65 mRNA, complete cds.//2.30E-28//124aa//50%//AB030198

NT2RI20030190

NT2RI20030510

NT2RI20030670

NT2RI20031540//DXS6673E PROTEIN.//2.80E-05//240aa//22%//Q14202

NT2RI20032050//Homo sapiens transportin2 mRNA, complete cds.//Q//663aa//98%//AF019039

NT2RI20032220//INTRACELLULAR PROTEIN TRANSPORT PROTEIN US01.//4.90E-16//582aa//23%//P25386

NT2RI20033010//Homo sapiens UDP-GlcNAc:a-3-D-mannoside b1,2-N-acetylglucosaminyltransferase 1.2 (MGAT1.2) mRNA, partial cds.//1.40E-293//579aa//93%//AF250859

NT2RI20033040

NT2RI20033380

NT2RI20033440//PRESYNAPTIC PROTEIN SAP97 (SYNAPSE-ASSOCIATED PROTEIN 97) (DISCS, LARGE HOMOLOG 1).//2.20E-08//128aa//36%//Q12959

NT2RI20033830//Homo sapiens SGC32445 protein (SGC32445) mRNA, complete cds.//1.80E-67//134aa//100%//AF251041

NT2RI20035560

NT2RI20036780//SERINE PROTEASE PC6 PRECURSOR (EC 3.4.21.-) (SUBTILISIN/KEXIN-LIKE PROTEASE PC5) (CONVERTASE PC5).//Q//633aa//97%//P41413

NT2RI20036950//TRICHOHYALIN.//1.70E-13//313aa//25%//P37709

NT2RI20037510//FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE (EC 3.2.2.23) (FAPY-DNA GLYCOSYLASE).//1.20E-05//238aa//28%//P74290

NT2RI20040590

NT2RI20041900//REGULATOR OF MITOTIC SPINDLE ASSEMBLY 1 (RMSA-1).//3.20E-13//108aa//44%//P49646

NT2RI20042840

NT2RI20043040//Homo sapiens NY-REN-2 antigen mRNA, complete cds.//2.80E-188//539aa//65%//AF155095

NT2RI20043980

NT2RI20044420

NT2RI20046060

NT2RI20047830

NT2RI20048400

NT2RI20049160

NT2RI20049840

NT2RI20049850

NT2RI20050610

NT2RI20050870//Homo sapiens putative anion transporter 1 mRNA, complete cds.//8.10E-262//533aa//96%//AF279265

NT2RI20051500//Mus musculus ST6GalNAc V mRNA for GD1 alpha synthase, complete cds.//2.40E-168//336aa//90%//AB030836

NT2RI20053350//DNA REPAIR/TRANSCRIPTION PROTEIN MET18/MMS19.//2.00E-23//234aa//32%//P40469

NT2RI20053680//Homo sapiens NY-REN-36 antigen mRNA, partial cds.//5.80E-62//124aa//100%//AF155106

NT2RI20055640//Mus musculus mRNA for ganglioside-induced differentiation associated protein 1.//2.50E-100//319aa//58%//Y17850

NT2RI20056280

NT2RI20056470//KERATIN, TYPE II CYTOSKELETAL 4 (CYTOKERATIN 4) (K4) (CK4).//2.40E-278//534aa//99%//P19013

NT2RI20057230//SPLICING FACTOR, ARGININE/SERINE-RICH 4 (PRE-MRNA SPLICING FACTOR SRP75).//3.00E-28//241aa//36%//Q08170

NT2RI20058110//CELL DIVISION CONTROL PROTEIN 25.//3.30E-18//419aa//25%//P04821

NT2RI20058510//PLECTIN.//3.50E-07//551aa//21%//P30427

NT2RI20060710//ZINC FINGER PROTEIN ZIC4 (ZINC FINGER PROTEIN OF THE CEREBELLUM 4).//2.10E-153//312aa//86%//Q61467

NT2RI20060720//HYPOTHETICAL PROTEIN KIAA0179.//0//692aa//99%//Q14684

NT2RI20061270

NT2RI20061830//Proline-rich protein M14 precursor//1.50E-17//170aa//37%//A28996

NT2RI20062100//Mus musculus shd mRNA, complete cds.//1.00E-137//337aa//77%//AB018423

NT2RI20063450

NT2RI20064120//Rattus norvegicus mRNA for CDCrel-1A, complete cds.//6.70E-148//280aa//98%//AB027143

NT2RI20064870

NT2RI20065060//Drosophila melanogaster rudimentary gene, intron 3; anon-15AB gene, complete cds.//1.40E-07//212aa//23%//AF172941

NT2RI20065530

NT2RI20066670

NT2RI20066790

NT2RI20066820//Human WW domain binding protein-1 mRNA, complete cds.//5.70E-46//181aa//46%//U79457

NT2RI20067030//Homo sapiens nolp mRNA, complete cds.//1.80E-85//406aa//51%//AB017800

NT2RI20067350//Neofelis nebulosa strain nnex zinc finger protein Zfx (Zfx) gene, partial cds.//2.10E-23//245aa//27%//AF252979

NT2RI20067880

NT2RI20068250

NT2RI20068550//Homo sapiens RNA helicase (RIG-I) mRNA, complete cds.//1.20E-52//340aa//34%//AF038963

NT2RI20070480//Mus musculus DXImx48e protein (DXImx48e) mRNA, complete cds.//3.40E-169//467aa//72%//AF229644

NT2RI20070840

NT2RI20070960//PROTO-ONCOGENE DBL PRECURSOR [CONTAINS: MCF2].//4.10E-30//431aa//27%//P10911

NT2RI20071160

NT2RI20071330//ZINC FINGER PROTEIN 91 (ZINC FINGER PROTEIN HTF10) (HPF7)./2.80E-240//647aa//64%//Q05481

NT2RI20071480

NT2RI20072140

NT2RI20072540//Arabidopsis thaliana ZCF61 mRNA, complete cds.//2.20E-12//113aa//35%//AB028228

NT2RI20073030

NT2RI20073840//Homo sapiens mixed lineage kinase mRNA, complete cds.//2.30E-179//362aa//93%//AF238255

NT2RI20073860

NT2RI20074390//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//2.30E-97//489aa//41%//P51523

NT2RI20074690//Homo sapiens NY-REN-58 antigen mRNA, complete cds.//4.00E-221//438aa//99%//AF155115

NT2RI20074980//Homo sapiens carboxypeptidase Z precursor, mRNA, complete cds.//3.10E-189//357aa//96%//U83411

NT2RI20075070

NT2RI20075720

NT2RI20075890

NT2RI20077230//Homo sapiens BRI3 mRNA, complete cds.//1.80E-114//182aa//99%//AF272043

NT2RI20077290

NT2RI20077510

NT2RI20077540//INTESTINAL MEMBRANE A4 PROTEIN (DIFFERENTIATION-DEPENDENT PROTEIN A4) (PROTEOLIPID PROTEIN 2).//2.30E-12//111aa//33%//Q04941

NT2RI20078270

NT2RI20078790//HOMEOBOX PROTEIN HOX-A4 (CHOX-1.4).//7.80E-08//83aa//43%//P17277

NT2RI20078840//ARS BINDING PROTEIN 1.//1.50E-17/313aa//27%//P49777

NT2RI20078910//DMR-N9 PROTEIN.//1.40E-122//398aa//59%//Q08274

NT2RI20080500//BASEMENT MEMBRANE-SPECIFIC HEPARAN SULFATE PROTEOGLYCAN CORE PROTEIN PRECURSOR (HSPG) (PERLECAN) (PLC).//5.90E-43//528aa//28%//P98160

NT2RI20081880//Mus musculus Mporc-b mRNA for porcupine-B, complete cds.//4.40E-64//125aa//97%//AB036746

NT2RI20082210//CORNIFIN B (SMALL PROLINE-RICH PROTEIN 1B) (SPR1B) (SPR1 B).//4.70E-12//110aa//37%//Q62267

NT2RI20083360

NT2RI20083960//Homo sapiens mRNA for SH3 binding protein, complete cds.//3.60E-31//159aa//44%//AB005047

NT2RI20084810//1-ACYL-SN-GLYCEROL-3-PHOSPHATE ACYLTRANSFERASE ALPHA (EC 2.3.1.51) (1-AGP ACYLTRANSFERASE) (1-AGPAT) (LYSOPHOSPHATIDIC ACID ACYLTRANSFERASE-ALPHA) (LPAMT-ALPHA).//4.70E-60//114aa//99%//Q99943

NT2RI20085260

NT2RI20085980//MILK FAT GLOBULE-EGF FACTOR 8 PRECURSOR (MFG-E8) (MGP57/53) (PAS-6/PAS-7 GLYCOPROTEIN) (MFGM) (SPERM SURFACE PROTEIN SP47) (BP47) (COMPONENTS 15/16).//5.40E-31//174aa//41%//Q95114

NT2RI20086560

NT2RI20087140//Homo sapiens PR-domain zinc finger protein 5 (PRDM5) mRNA, complete cds.//6.10E-51//101aa//99%//AF272897

NT2RI20087490//SPLICEOSOME ASSOCIATED PROTEIN 49 (SAP 49) (SF3B53).//2.00E-08//156aa//37%//Q15427

NT2RI20087910//PROBABLE URACIL PHOSPHORIBOSYLTRANSFERASE (EC 2.4.2.9) (UMP PYROPHOSPHORYLASE) (UPRTASE).//1.80E-42//159aa//54%//Q13867

NT2RI20088010

NT2RI20088120//AXONEME-ASSOCIATED PROTEIN MST101(2).//4.00E-05//185aa//24%//Q08696

NT2RI20089420//NEURAL CELL ADHESION MOLECULE L1 PRECURSOR (N-CAM L1).//3.00E-07//104aa//31%//Q05695

NT2RI20090650//ZINC FINGER PROTEIN 26 (ZFP-26) (MKR3 PROTEIN) (FRAGMENT).//2.10E-30//194aa//37%//P10076

NT2RI20090660//PLECTIN.//7.20E-14//450aa//24%//P30427

NT2RI20090830

NT2RI20091440

NT2RI20092150//ZINC FINGER PROTEIN 165.//3.10E-46//179aa//56%//P49910

NT2RI20092890//CARBOXYPEPTIDASE N 83 KD CHAIN (CARBOXYPEPTIDASE N REGULATORY SUBUNIT) (FRAGMENT).//3.70E-29//293aa//31%//P22792

NT2RI20094060//Homo sapiens rec mRNA, complete cds.//1.40E-112//293aa//62%//AB023584

NT2RP60000080//Homo sapiens Pig11 (PIG11) mRNA, complete cds.//6.60E-38//117aa//71%//AF010315

NT2RP60000170

NT2RP60000320

NT2RP60000350//Homo sapiens mRNA for SH3 binding protein, complete cds.//1.30E-54//253aa//45%//AB005047

NT2RP60000390

NT2RP60000590

NT2RP60000720//Pinus taeda clone PtaAGP6 putative arabinogalactan protein mRNA, complete cds.//1.50E-05//165aa//29%//AF101785

NT2RP60000866//Homo sapiens mRNA for NICE-5 protein.//6.30E-192//883 bp//99%//AJ243666

NT2RP60001000//ZINC FINGER PROTEIN 41 (FRAGMENT).//7.10E-128//366aa//59%//P51814

NT2RP60001090//RING CANAL PROTEIN (KELCH PROTEIN).//6.40E-0.79//553aa//33%//Q04652

NT2RP60001230//KINESIN LIGHT CHAIN (KLC).//1.10E-206//566aa//69%//Q07866

NT2RP60001270//ZINC FINGER PROTEIN ZIC4 (ZINC FINGER PROTEIN OF THE CEREBELLUM 4).//3.70E-131//264aa//87%//Q61467

NT2RP70000410

NT2RP70000690//MUCIN 1 PRECURSOR (POLYMORPHIC EPITHELIAL MUCIN) (PEM), (PEMT) (EPISIALIN) (TUMOR-ASSOCIATED MUCIN) (CARCINOMA-ASSOCIATED MUCIN) (TUMOR-ASSOCIATED EPITHELIAL MEMBRANE. ANTIGEN) (EMA) (H23AG) (PEANUT-REACTIVE URINARY MUCIN) (PUM) (BREAST CARCINOMA-ASSOCIATED ANTIGEN DF3).//2.00E-26//911aa//25%//P15941

NT2RP70000760//TRANSLATION INITIATION FACTOR EIF-2B EPSILON SUBUNIT (EIF-2B GDP-GTP EXCHANGE FACTOR).//1.70E-23//66aa//81%//P47823

NT2RP70002380//Adiantum capillus-veneris AcExt1 mRNA for Extensin, complete cds.//2.00E-05//93aa//37%//AB008227

NT2RP70002590//HYPOTHETICAL 32.0 KDA PROTEIN IN NNF1-STE24 INTERGENIC REGION.//2.20E-12//251aa//28%//P47153

NT2RP70002710//Mus musculus zinc finger protein 276 C2H2 type (Zfp276) mRNA, complete cds.//1.80E-101//253aa//77%//AF178935

NT2RP70003640

NT2RP70003910

NT2RP70004250//MYOSIN HEAVY CHAIN, NONMUSCLE TYPE B (CELLULAR MYOSIN HEAVY CHAIN, TYPE B) (NMMHC-B).//4.30E-08//244aa//24%//P35580

NT2RP70004770//UDP-N-ACETYLGLUCOSAMINE-PEPTIDE N-ACETYLGLUCOSAMINYLTRANSFERASE 110 KDA SUBUNIT (EC 2.4.1.-) (0-GLCNAC TRANSFERASE P110 SUBUNIT).//1.00E-22//213aa//32%//P56558

NT2RP70005790

NT2RP70006240//Phosphatidylinositol-4-phosphate 5-kinase homolog T3K9.2//1.90E-16//204aa//30%//T02098

NT2RP70008120//HOMEOBOX PROTEIN HOX-B9 (HOX-2.5).//2.40E-53//117aa//87%//P20615

NT2RP70009060//Medicago truncatula mRNA for 85p protein (85p gene).//5.10E-07//229aa//23%//AJ249679

NT2RP70010800//Mus musculus mRNA for MILI (Miwi like), complete cds.//2.40E-280//614aa//83%//AB032605

NT2RP70011660//PROBABLE CATION-TRANSPORTING ATPASE C10C6.6 IN CHROMOSOME IV (EC 3.6.1.-).//1/H1165aa//53%//P90747

NT2RP70012310

NT2RP70013060//U1 SMALL NUCLEAR RIBONUCLEOPROTEIN 70 KDA (U1 SNRNP 70 KDA).//1.50E-30//241aa//32%//P09406

NT2RP70013350

NT2RP70015910//bK57G9.1 (novel Kringle and CUB domain protein) [Homo sapiens].//1.00E-140//247aa//95%//CAB62952

NT2RP70018560//Mus musculus polyhomeotic (mPh2) mRNA, complete cds.//5.00E-232//465aa//91%//U81491

NT2RP70021510

NT2RP70022430//Tax1-binding protein TRX—human.//6.00E-71//180aa//93%//S68091

NT2RP70023760//M PROTEIN, SEROTYPE 2.1 PRECURSOR.//2.20E-13//331 aa//25%//P50468

NT2RP70023790//110 KDA ANTIGEN (PK110) (FRAGMENT).//7.00E-07//162aa//23%//P13813

NT2RP70024490

NT2RP70024500//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//4.80E-66//312aa//38%//P51523

NT2RP70025540

NT2RP70026190//Mus musculus ubiquitin-protein ligase E3-alpha (Ubr1) mRNA, complete cds.//6.20E-305//597aa//93%//AF061555

NT2RP70028290//Scm-related gene containing four mbt domains [Mus musculus].//6.00E-59//500aa//31%//NP062333

NT2RP70028410

NT2RP70028750//RESTIN (CYTOPLASMIC LINKER PROTEIN-170 ALPHA-2) (CLIP-170) (REED-STERNBERG INTERMEDIATE FILAMENT ASSOCIATED PROTEIN).//2.60E-11//87aa//44%//P30622

NT2RP70029060//HEAT SHOCK PROTEIN HSP 90ALPHA (HSP 86).//Q//731aa//99%//P07900

NT2RP70029820//Homo sapiens GROS1-L protein mRNA, complete cds.//2.40E-177//680aa//51%//AF097432

NT2RP70030500

NT2RP70030550

NT2RP70030910

NT2RP70032030//ZINC FINGER PROTEIN 184 (FRAGMENT).//3.50E-139//366aa//55%//Q99676

NT2RP70033040//YceA protein homolog ybfQ—Bacillus subtilis.//1.00E-35//300aa//33%//C69750

NT2RP70036290//MHC CLASS II TRANSACTIVATOR CIITA.//4.80E-09//116aa//31%//P33076

NT2RP70036320//Microfilarial sheath protein//5.00E-06//92aa//35%//S46966

NT2RP70036470

NT2RP70036800//RING CANAL PROTEIN (KELCH PROTEIN).//4.50E-107//652aa//38%//Q04652

NT2RP70039600

NT2RP70040800//CELL SURFACE GLYCOPROTEIN 1 PRECURSOR (OUTER LAYER PROTEIN B) (S-LAYER PROTEIN 1).//5.60E-20//307aa//28%//Q06852

NT2RP70042040//ZINC FINGER PROTEIN MLZ-4 (ZINC FINGER PROTEIN 46).//9.20E-61//254aa//46%//Q03309

NT2RP70042330//HYPOTHETICAL PROTEIN MJ0941.//8.80E-06//133aa//24%//Q57711

NT2RP70042600//MYOSIN HEAVY CHAIN, NONMUSCLE TYPE B (CELLULAR MYOSIN HEAVY CHAIN, TYPE B) (NMMHC-B).//4.50E-21//715aa//21%//P35580

NT2RP70043730

NT2RP70043960//Mus musculus mRNA for Fish protein.//Q//866aa//88%//AJ007012

NT2RP70045410//Mus musculus MGA protein mRNA, complete cds.//2.70E-265//1040aa//57%//AF205935

NT2RP70046560//PEREGRIN (BR140 PROTEIN).//1.30E-48//304aa//36%//P55201

NT2RP70046870//VEGETATIBLE INCOMPATIBILITY PROTEIN HET-E-1.//9.70E-07//395aa//24%//Q00808

NT2RP70047510

NT2RP70047660

NT2RP70047900

NT2RP70049150//Mus musculus mRNA for UBE-1c1, UBE-1c2, UBE-1c3, complete cds.//6.60E-56//209aa//52%//AB030505

NT2RP70049250//VASODILATOR-STIMULATED PHOSPHOPROTEIN (VASP).//1.90E-08//118aa//33%//P50552

NT2RP70049750

NT2RP70052050//Human transformation-related protein mRNA, 3′ end.//2.20E-12//74aa//52%//L24521

NT2RP70052190

NT2RP70054680

NT2RP70054930

NT2RP70055020//Homo sapiens mRNA for paraplegin-like protein.//3.00E-29//68aa//94%//Y18314

NT2RP70055130//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//7.00E-130//461aa//46%//P51523

NT2RP70055200//INTEGUMENTARY MUCIN A.1 PRECURSOR (FIM-A.1) (PREPROSPASMOLYSIN).//2.40E-07//120aa//27%//P10667

NT2RP70061620//ZINC FINGER PROTEIN MFG-3./3.60E-16//266aa//27%//P16374

NT2RP70061880//GTPASE-ACTIVATING PROTEIN.//1.70E-08//265aa//21%//P33277

NT2RP70062960//EXCISION REPAIR PROTEIN ERCC-6 (COCKAYNE SYNDROME PROTEIN CSB).//5.80E-67//185aa//46%//Q03468

NT2RP70063040//Homo sapiens MLL septin-like fusion protein (MSF) mRNA, complete cds.//1.00E-187//348aa//99%//AF123052

NT2RP70063740

NT2RP70064080//Drosophila melanogaster F protein (olf186) mRNA, complete cds./2.50E-54//203aa//56%//AF188634

NT2RP70064900//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//1.20E-149//580aa//40%//P51523

NT2RP70065270//LIM-ONLY PROTEIN 6 (TRIPLE LIM DOMAIN PROTEIN 6).//2.40E-136//341aa//61%//Q43900

NT2RP70066210

NT2RP70067010

NT2RP70069800

NT2RP70069860//ZINC FINGER PROTEIN 184 (FRAGMENT).//4.40E-141//566aa//46%//Q99676

NT2RP70071140

NT2RP70071540

NT2RP70071770//Homo sapiens multiple membrane spanning receptor TRC8 (TRC8) mRNA, complete cds.//8.50E-61//599aa//29%//AF064801

NT2RP70072210//Rattus norvegicus schlafen-4 (SLFN-4) mRNA, complete cds.//1.10E-19//244aa//32%//AF168795

NT2RP70072520//Human serine/threonine kinase mRNA, partial cds.//1.20E-79//154aa//100%//U79240

NT2RP70073590

NT2RP70073810//Sulfonylurea receptor 2A//4.50E-70//135aa//100%//NP064694

NT2RP70074060

NT2RP70074220//SYNAPSIN I (BRAIN PROTEIN 4.1).//2.20E-05//116aa//34%//P17600

NT2RP70075040

NT2RP70075370//52 KDA RO PROTEIN (SJOGREN SYNDROME TYPE A ANTIGEN (SS-A)) (RO(SS-A)).//1.20E-97//482aa//42%//P19474

NT2RP70076100//Homo sapiens mRNA for putative phospholipase, complete cds.//7.10E-189//424aa//53%//AB019435

NT2RP70076170

NT2RP70076430//PUTATIVE IMPORTIN BETA-4 SUBUNIT (KARYOPHERIN BETA-4 SUBUNIT).//1.70E-42//692aa//26%//Q60100

NT2RP70079250//Homo sapiens contactin associated protein (Caspr) mRNA, complete cds.//2.30E-218//963aa//42%//U87223

NT2RP70079300

NT2RP70079750//Homo sapiens BAC526N18 neurexin III gene, partial cds.//5.00E-177//334aa//100%/AF123462

NT2RP70081330

NT2RP70081370//ATP-BINDING CASSETTE, SUB-FAMILY A, MEMBER 1 (ATP-BINDING CASSETTE TRANSPORTER 1) (ATP-BINDING CASSETTE 1).//1.10E-56//364aa//36%//P41233

NT2RP70081420

NT2RP70081440//DUAL SPECIFICITY MITOGEN-ACTIVATED PROTEIN KINASE KINASE 4 (EC 2.7.1.-) (MAP KINASE KINASE 4) (JNK ACTIVATING KINASE 1) (C-JUN N-TERMINAL KINASE KINASE 1) (JNKK) (SAPK/ERK KINASE 1) (SEK1).//7.20E-77//162aa//91%//P45985

NT2RP70081670//85.1 KDA PROTEIN IN GREB-FEOA INTERGENIC REGION.//3.10E-108//568aa//38%//P46837

NT2RP70083150//ENVELOPE GLYCOPROTEIN GP340 (MEMBRANE ANTIGEN) (MA) [CONTAINS: GLYCOPROTEIN GP220].//3.60E-09//431aa//23%//P03200

NT2RP70084060//Probable hexosyltransferase (EC 2.4.1.-) SC2G5.06//4.90E-07//127aa//32%//T34839

NT2RP70084410//Polybromo 1 protein—chicken//Q//985aa//88%//S60678

NT2RP70084870//TRICHOHYALIN.//9.20E-16//452aa//21%//P37709

NT2RP70085500//Mus musculus rig-1 protein mRNA, complete cds.//Q//976aa//86%//AF060570

NT2RP70085570//DNA BINDING PROTEIN URE-B1 (EC 6.3.2.-).//3.40E-23//282aa//27%//P51593

NT2RP70086230

NT2RP70087200//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//1.20E-164//689aa//42%//P51523

NT2RP70088550//Rattus norvegicus membrane-associated guanylate kinase-interacting protein 2 Maguin-2 mRNA, complete cds.//7.90E-267//434aa//98%//AF102854

NT2RP70090120//CHLORIDE CHANNEL PROTEIN 7 (CLC-7) (FRAGMENT).//Q//734aa//99%//P51798

NT2RP70090190//ZINC FINGER PROTEIN 83 (ZINC FINGER PROTEIN HPF1).//3.60E-146//395aa//61%//P51522

NT2RP70091490//GLUCOSE TRANSPORTER TYPE 2, LIVER.//3.30E-17//109aa//37%//P14246

NT2RP70091680

NT2RP70092150

NT2RP70092360//BASEMENT MEMBRANE-SPECIFIC HEPARAN SULFATE PROTEOGLYCAN CORE PROTEIN PRECURSOR (HSPG) (PERLECAN) (PLC).//4.50E-91//1310aa//26%//Q05793

NT2RP70092590

NT2RP70093220//CHLORIDE CHANNEL PROTEIN 5 (CLC-5).//Q//746aa//99%//P51795

NT2RP70093630

NT2RP70093700//PUTATIVE SERINE/THREONINE-PROTEIN KINASE PKWA (EC 2.7.1.-).//9.90E-11//241aa//21%//P49695

NT2RP70093730

NT2RP70093940//Exocyst complex protein sec5//0//924aa//93%//T09220

NT2RP70093970

NT2RP70094290

NT2RP70094660

NT2RP70094810//Drosophila melanogaster Dispatched (dispatched) mRNA, complete cds.//1.00E-105//579aa//38%//AF200691

NT2RP70094980//FIBULIN-1, ISOFORM A PRECURSOR.//6.50E-30//211aa//38%//P23142

NT2RP70095020

NT2RP70095070

NTONG10000330

NTONG10000520//Rattus norvegicus mRNA for Kelch related protein 1 (krp1 gene).//2.00E-118//439aa//49%//AJ293948

NTONG10000980

NTONG10001230//Mus msuculus mRNA, partial cds, clone CLFEST42.//6.10E-07//217aa//25%//D82816

NTONG10001300//Gallus gallus kinectin mRNA, complete cds.//1.30E-15//534aa//22%//U15617

NTONG10001820//Mus musculus mammalian inositol hexakisphosphate kinase 1 (Ip6k1) mRNA, complete cds.//5.20E-77//294aa//53%//AF177144

NTONG10002140//SARCALUMENIN PRECURSOR.//3.50E-204//376aa//97%//P13666

NTONG10002460//CYCLIN-DEPENDENT KINASE INHIBITOR 1C (CYCLIN-DEPENDENT KINASE INHIBITOR P57) (P57KIP2).//1.10E-16//156aa//40%//P49918

NTONG10002570

NTONG10002640//HYPOTHETICAL 71.1 KD PROTEIN IN DSK2-CAT8 INTERGENIC REGION.//6.90E-98//603aa//39%//Q03262

NTONG20002650//Probable transmembrane protein of fission yeast//8.50E-63//539aa//28%//T39483

NTONG20003340//ZINC FINGER PROTEIN 90 (ZFP-90) (ZINC FINGER PROTEIN NK10).//3.10E-108//225aa//83%//Q61967

NTONG20003630//CREB-BINDING PROTEIN.//3.00E-05//160aa//31%//Q92793

NTONG20004920

NTONG20005830

NTONG20008000

NTONG20008780//MAJOR CENTROMERE AUTOANTIGEN B (CENTROMERE PROTEIN B) (CENP-B).//1.40E-42//330aa//31%//P27790

NTONG20009660//Mus musculus N-RAP mRNA, complete cds.//2.50E-56//393aa//38%//U76618

NTONG20009850

NTONG20011370

NTONG20012220

NTONG20014280

NTONG20015500//ZINC FINGER PROTEIN 135.//1.40E-128//340aa//64%//P52742

NTONG20016120//Oxystyrol-binding protein homologue 1 [Mus musculus domesticus].//3.00E-43//342aa//37%//AJ278263

OCBBF10000420

OCBBF10000670

OCBBF10000860

OCBBF10000910//SORBIN.//1.30E-71//145aa//91%//P28220

OCBBF10001040

OCBBF10001180//TUMOR NECROSIS FACTOR, ALPHA-INDUCED PROTEIN 1, ENDOTHELIAL (B12 PROTEIN).//1.00E-12//124aa//37%//Q13829

OCBBF10001190

OCBBF10001220//RING CANAL PROTEIN (KELCH PROTEIN).//8.50E-32//274aa//31%//Q04652

OCBBF20000130

OCBBF20001260

OCBBF20002310//PHOSPHOLIPASE A2 INHIBITOR SUBUNIT B PRECURSOR (PLI-B).//3.50E-27//307aa//29%//Q93233

OCBBF20002770//EARLY EMBRYOGENESIS ZYG-11 PROTEIN.//1.40E-46//348aa//34%//P21541

OCBBF20002870

OCBBF20007190//Putative cleavage and polyadenylation specifity factor [Arabidopsis thaliana].//1.00E-142//450aa//53%//M D12712

OCBBF20008240//THREONYL-TRNA SYNTHETASE, CYTOPLASMIC (EC 6.1.1.3) (THREONINE-TRNA LIGASE) (THRRS).//1.10E-244//484aa//77%//P26639

OCBBF20009040

OCBBF20009980

OCBBF20010750

OCBBF20011010//ZINC FINGER PROTEIN 91 (ZINC FINGER PROTEIN HTF10) (HPF7).//1.10E-133//405aa//55%//Q05481

OCBBF20011240//TESTIS SPECIFIC PROTEIN A (ZINC FINGER PROTEIN TSGA).//1.60E-81//391aa//42%//Q63679

OCBBF20011400//VACUOLAR PROTEIN SORTING-ASSOCIATED PROTEIN VPS8.//3.30E-17//199aa//23%//P39702

OCBBF20011760//Mus musculus actin-binding protein (ENC-1) mRNA, complete cds.//2.30E-236//527aa//75%//U65079

OCBBF20012100//Cavia porcellus phosphatidic acid phosphatase 2a (PAP2a) mRNA, complete cds.//6.30E-29//285aa//29%//AF088283

OCBBF20013070

OCBBF20014020//Mus musculus NSD1 protein mRNA, complete cds.//Q//886aa//73%//AF064553

OCBBF20014080//H. sapiens mRNA for thioesterase II.//3.00E-67//163aa//83%//X86032

OCBBF20014940//ubiquitin-protein ligase 1 [Arabidopsis thaliana]//2.00E-15//200aa//30%//AAF36454

OCBBF20015270

OCBBF20015280//MYOSIN HEAVY CHAIN, SMOOTH MUSCLE ISOFORM (SMMHC).//4.90E-23//415aa//22%//P35748

OCBBF20015860//TRANSCRIPTION ELONGATION FACTOR S-II (TFIIS).//7.70E-06//104aa//33%//P49373

OCBBF20017060

PANCR10000210//PROTEIN DISULFIDE ISOMERASE PRECURSOR (PDI) (EC 5.3.4.1) (PROLYL 4-HYDROXYLASE BETA SUBUNIT) (CELLULAR THYROID HORMONE BINDING PROTEIN) (P55).//9.10E-31//231aa//33%//P05307

PANCR10001850

PEBLM10000290

PEBLM10000340//RNA-BINDING PROTEIN EWS.//1.80E-284//615aa//83%//Q01844

PEBLM10000680//ACTIN, CYTOPLASMIC TYPE 5.//1.30E-70//158aa//86%//P53505

PEBLM10001440//Trg//2.40E-212//385aa//60%//CAM48220

PEBLM10001800

PEBLM20000300

PEBLM20001120//Homo sapiens nucleotide-binding site protein 1 mRNA, complete cds.//1.90E-127//899aa//34%//AF298547

PEBLM20001260

PEBLM20001470

PEBLM20002130//Mus musculus genes for integrin aM290, hapsin, partial and complete cds.//8.20E-44//246aa//47%//AB036930

PEBLM20002480//ZINC FINGER PROTEIN 157.//8.70E-71//210aa//47%//P51786

PEBLM20002700//Homo sapiens, tissue-type bone marrow zinc finger protein 4 mRNA, complete cds.//6.70E-237//537aa//80%//AF070651

PEBLM20003080//ZINC FINGER PROTEIN 135.//2.40E-133//335aa//65%//P52742

PEBLM20003950//ZINC FINGER PROTEIN 165.//3.20E-35//143aa//59%//P49910

PEBLM20004790//PROTO-ONCOGENE TYROSINE-PROTEIN KINASE FYN (EC 2.7.1.112) (P59-FYN).//4.70E-264//410aa//95%//P39688

PLACE50000370//Homo sapiens mRNA for hVPS11, complete cds.//1.80E-149//281 aa//98%//AB027508

PLACE50000580//PUTATIVE IMPORTIN BETA-4 SUBUNIT (KARYOPHERIN BETA-4 SUBUNIT).//9.60E-76//937aa//27%//Q60100

PLACE50000670

PLACE50000680//C4B-BINDING PROTEIN PRECURSOR (C4BP).//5.10E-09//136aa//30%//P08607

PLACE50000800//Human non-lens beta gamma-crystallin like protein (AIM1) mRNA, partial cds.//Q//840aa//99%//U83115

PLACE50001050//Mus musculus mRNA for heparan sulfate 6-sulfotransferase 2, complete cds.//6.10E-236//300aa//89%//AB024565

PLACE50001130//GLUCOAMYLASE S1/S2 PRECURSOR (EC 3.2.1.3) (GLUCAN 1,4-ALPHA-GLUCOSIDASE) (1,4-ALPHA-D-GLUCAN GLUCOHYDROLASE).//2.20E-23//729aa//24%//P08640

PLACE50001530

PLACE50001700//DNAK PROTEIN (HEAT SHOCK PROTEIN 70) (HSP70).//3.00E-05//108aa//30%//Q56235

PLACE60000440

PLACE60000700

PLACE60000800

PLACE60001370

PLACE60002050//TRANSCRIPTIONAL REPRESSOR PROTEIN YY1 (YIN AND YANG 1) (YY-1) (DELTA TRANSCRIPTION FACTOR) (NF-E1).//6.00E-73//212aa//66%//P25490

PLACE60002630

PLACE60003710

PLACE60003790//PUTATIVE PRE-MRNA SPLICING FACTOR RNA HELICASE (DEAH BOX PROTEIN 15) (ATP-DEPENDENT RNA HELICASE #46).//5.30E-104//191aa//99%//Q43143

PLACE60004240

PLACE60004290

PLACE60005230

PLACE60005500

PLACE60005550//Human (c-myb) gene, complete primary cds, and five complete alternatively spliced cds.//4.60E-20//71aa//66%//U22376

PLACE60009530

PLACE60012810//Probable acyl-CoA synthetase (EC 6.2.1.-)—Mycobacterium tuberculosis (strain H37RV)//3.00E-11//600aa//24%//C70669

PLACE60012940

PLACE60014430//Homo sapiens mRNA for MOCS1A & MOCS1B proteins, complete CDSs.//1.60E-146//283aa//98%//AJ224328

PLACE60018860//ADENYLATE CYCLASE, TYPE IV (EC 4.6.1.1) (ATP PYROPHOSPHATE-LYASE) (ADENYLYL CYCLASE).//1.30E-244//504aa//90%//P26770

PLACE60019230

PLACE60019250

PLACE60020160

PLACE60020840//CYTOCHROME B561 (CYTOCHROME B-561).//1.00E-45//211aa//47%//Q95245

PLACE60021020

PLACE60021510//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//5.00E-140//351aa//61%//P51523

PLACE60024190//TRICHOHYALIN.//1.40E-09//299aa//24%//P37709

PLACE60026680//Homo sapiens Arg/Abl-interacting protein ArgBP2b (ArgBP2b) mRNA, partial cds.//1.00E-254//484aa//96%//AF049885

PLACE60026920

PLACE60026990//Human PMS2 related (hPMSR6) mRNA, complete cds.//5.70E-42//112aa//75%//U38980

PLACE60029490

PLACE60030380//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//3.60E-34//335aa//30%//P51523

PLACE60030940

PLACE60031090

PLACE60032040

PLACE60033720

PLACE60033990//SPIDROIN 1 (DRAGLINE SILK FIBROIN 1) (FRAGMENT).//1.40E-08//234aa//27%//P19837

PLACE60037050

PLACE60037400

PLACE60037450

PLACE60038500//Homo sapiens mitochondrial solute carrier mRNA, complete cds.//5.10E-65//171aa//70%//AF155660

PLACE60040050

PLACE60043120

PLACE60043360

PLACE60043960

PLACE60043970//Takifugu rubripes retinitis pigmentosa GTPase regulator-like protein gene, partial cds.//2.60E-14//329aa//21%//AF286475

PLACE60044540//GLUCOAMYLASE S1/S2 PRECURSOR (EC 3.2.1.3) (GLUCAN 1,4-ALPHA-GLUCOSIDASE) (1,4-ALPHA-D-GLUCAN GLUCOHYDROLASE).//1.90E-46//865aa//26%//P08640

PLACE60044640//Human placenta (Diff48) mRNA, complete cds.//2.60E-88//414aa//45%//U49187

PLACE60044910

PLACE60046630

PLACE60046870

PLACE60047380

PLACE60049310

PLACE60049930

PLACE60050290

PROST10001520

PROST10001670//SYNAPSIN I (BRAIN PROTEIN 4.1).//2.20E-07//239aa//28%//P17600

PROST10002200

PROST10002460

PROST10002720//Homo sapiens mRNA for calsyntenin-2 (CS2 gene).//7.00E-23//153aa//42%//AJ278018

PROST10003430//Numb-binding protein LNXP80//0//732aa//87%//T09457

PROST10005260

PROST10005360//Homo sapiens contactin associated protein (Caspr) mRNA, complete cds.//1.30E-152//719aa//38%//U87223

PROST10005640

PROST20000360

PROST20000530//60S RIBOSOMAL PROTEIN L13A (23 KDA HIGHLY BASIC PROTEIN).//2.00E-33//73aa//95%//P40429

PROST20001760//RD PROTEIN (WL623).//7.30E-12//104aa//41%//P19426

PROST20002060

PROST20002670

PROST20002730//H4(D10S170) PROTEIN.//2.60E-63//118aa//98%//Q16204

PROST20002740

PROST20003250//Homo sapiens DAZ associated protein 1 (DAZAP1) mRNA, complete cds.//2.50E-150//264aa//98%//AF181719

PROST20004630

PROST20017390

PROST20017960

PROST20018230//TRANSCRIPTION FACTOR SP1.//4.60E-59//287aa//42%//Q01714

PROST20018990//Human Rar protein mRNA, complete cds.//1.20E-127//278aa//88%//U05227

PROST20019980

PROST20021620

PROST20023380//Cca3 protein//5.20E-68//142aa//94%//T31081

PROST20025910

PROST20026820//DENTIN MATRIX ACIDIC PHOSPHOPROTEIN 1 PRECURSOR (DENTIN MATRIX PROTEIN-1) (DMP-1) (AG1).//6.90E-05//255aa//27%//Q55188

PROST20028420

PROST20029600//Human butyrophilin (BTF1) mRNA, complete cds.//2.00E-61//144aa//87%//U90543

PROST20031020

PROST20031170//DNA BINDING PROTEIN URE-B1 (EC 6.3.2.-).//1.70E-23//282aa//27%//P51593

PROST20032100

PROST20032320//BETA-GLUCURONIDASE PRECURSOR (EC 3.2.1.31) (BETA-G1).//1.20E-18//46aa//91%//P08236

PROST20033020

PROST20033030

PROST20033380//KINESIN LIGHT CHAIN (KLC).//7.70E-08//146aa//27%//P46824

PROST20033400//SERINE/THREONINE-PROTEIN KINASE 9 (EC 2.7.1.-).//1.80E-25//55aa//100%//Q76039

PROST20034720//IMMEDIATE-EARLY PROTEIN.//7.80E-11//180aa//24%//Q01042

PROST20037320

PROST20039220

PROST20043320//Homo sapiens mRNA for BAP2-beta protein, complete cds.//3.70E-227//431aa//99%//AB015020

PROST20044160//TROPOMYOSIN 5, CYTOSKELETAL TYPE.//7.80E-48//100aa//97%//P21107

PROST20044810

PROST20051210//PROBABLE PROTEIN PHOSPHATASE 2C T23F11.1 (EC 3.1.3.16) (PP2C).//7.00E-16//74aa//41%//P49596

PROST20051430

PROST20054260

PROST20056040

PROST20058800

PROST20059190//Human breast cancer, estrogen regulated LIV-1 protein (LIV-1) mRNA, partial cds.//1.50E-28//109aa//55%//U41060

PROST20059430

PROST20061960

PROST20062600//SPLICING FACTOR, ARGININE/SERINE-RICH 4 (PRE-MRNA SPLICING FACTOR SRP75).//2.20E-07//269aa//22%//Q08170

PROST20064500//N-HYDROXYARYLAMINE SULFOTRANSFERASE (EC 2.8.2.-) (HAST-I).//9.10E-38//102aa//70%//P50237

PROST20067370//H. sapiens mRNA for XIAP associated factor-1.//2.40E-122//223aa//99%//X99699

PROST20069880//Mus musculus DXImx48e protein (DXImx48e) mRNA, complete cds.//9.6e-316//750aa//79%//AF229644

PROST20072370

PROST20072890//TUMOR NECROSIS FACTOR, ALPHA-INDUCED PROTEIN 1, ENDOTHELIAL (B12 PROTEIN).//1.50E-117//314aa//70%//Q13829

PROST20073170//Rattus norvegicus zinc finger protein RIN ZF mRNA, complete cds.//1.80E-268//559aa//87%//AF091457

PROST20073890//VASCULAR ENDOTHELIAL GROWTH FACTOR PRECURSOR (VEGF) (VASCULAR PERMEABILITY FACTOR) (VPF).//5.30E-33//63aa//98%//P15692

PROST20079740//ANTER-SPECIFIC PROLINE-RICH PROTEIN APG (PROTEIN CEX) (FRAGMENT).//4.10E-09//97aa//36%//P40603

PROST20085160//TROPOMYOSIN, CYTOSKELETAL TYPE (TM30-NM).//2.10E-93//220aa//87%//P12324

PROST20094830

PUAEN10000570

PUAEN10000810

PUAEN10001610//GENERAL NEGATIVE REGULATOR OF TRANSCRIPTION SUBUNIT 1.//2.10E-68//448aa//32%//P25655

PUAEN10003220

SALGL10000050

SALGL10000470//NG36 [Homo sappiens]//3.00E-53//184aa//96%//AAD21811

SALGL10000650//POLYHOMEOTIC-PROXIMAL CHROMATIN PROTEIN.//4.60E-08//71aa//43%//P39769

SALGL10001570//APOLIPOPROTEIN L PRECURSOR (APO-L).//5.10E-99//338aa//61%//Q14791

SKMUS10000140//Polyubiquitin 9—human.//2.10E-199//280aa//96%//M26880

SKMUS10000220//NUCLEAR PORE PROTEIN SEH1 HOMOLOG.//2.00E-58//346aa//39%//Q10099

SKMUS10000640//Mus musculus RING-finger protein MURF mRNA, complete cds./4.10E-111//348aa//60%//AF294790

SKMUS10001040//Homo sapiens mRNA for HEXIM1 protein, complete cds.//2.40E-49//256aa//47%//AB021179

SKMUS10001180//Homo sapiens t(3:5)(q25.1:p34) fusion gene NPM-MLF1 mRNA, complete cds.//3.60E-126//258aa//94%//L49054

SKMUS10001240

SKMUS10001290//ISOPENTENYL-DIPHOSPHATE DELTA-ISOMERASE (EC 5.3.3.2) (IPP ISOMERASE) (ISOPENTENYL PYROPHOSPHATE ISOMERASE).//4.10E-81//227aa//64%//Q13907

SKMUS10001770//PROTEIN-L-ISOASPARTATE O-METHYLTRANSFERASE (EC 2.1.1.77) (PROTEIN-BETA-ASPARTATE METHYLTRANSFERASE) (PIMT) (PROTEIN L-ISOASPARTYL METHYLTRANSFERASE) (L-ISOASPARTYL PROTEIN CARBOXYL METHYLTRANSFERASE).//2.50E-18//213aa//29%//Q26915

SKMUS20000740//Homo sapiens methyltransferase C003 (C003) mRNA, complete cds.//8.50E-166//309aa//99%//AF193016

SKMUS20001170//Homo sapiens MAGEF1 (MAGEF1) mRNA, complete cds.//1.50E-74//305aa//50%//AF295378

SKMUS20002710

SKMUS20003430

SKMUS20003650//Human (p23) mRNA, complete cds.//7.00E-20//110aa//39%//L24804

SKMUS20003900//Homo sapiens 38 kDa Mov34 homolog mRNA, complete cds.//1.20E-152//286aa//99%//U70734

SKMUS20004580//Mus musculus N-RAP mRNA, complete cds.//4.50E-160//591aa//56%//U76618

SKMUS20004670

SKMUS20004680

SKMUS20007240//Homo sapiens mRNA for 2-hydroxyphytanoyl-CoA lyase.//2.60E-148//318aa//88%//AJ131753

SKMUS20007740//BALBIANI RING PROTEIN 1 (GIANT SECRETORY PROTEIN I-A) (GSP-IA) (FRAGMENT).//1.30E-08//138aa//26%//P02849

SKMUS20008470

SKMUS20008630//PROBABLE ASPARAGINYL-TRNA SYNTHETASE (EC 6.1.1.22) (ASPARAGINE-TRNA LIGASE) (ASNRS).//1.10E-103//445aa//46%//P52276

SKMUS20009020//BRO1 PROTEIN.//2.30E-08//232aa//26%//P48582

SKMUS20009330//RNA polymerase III subunit [Homo sapiens]//1.80E-44//216aa//47%//U93868

SKMUS20009450

SKMUS20009540//Homo sapiens F-box protein Fbx25 (FBX25) mRNA, partial cds.//4.20E-93//263aa//64%//AF174605

SKMUS20010080//Mus musculus mRNA for a skeletal muscle and cardiac protein.//1.00E-75//178aa//87%//AJ011118

SKMUS20011290//NAD-DEPENDENT METHANOL DEHYDROGENASE (EC 1.1.1.244) (MEDH).//3.70E-45//195aa//32%//P31005

SKMUS20011470//Mus musculus RP42 mRNA, complete cds.//1.30E-32//186aa//36%//AF198092

SKMUS20013640

SKMUS20014920//Zinc finger protein//4.40E-05//153aa//24%//T37771

SKMUS20015010

SKMUS20015430//Homo sapiens HDCMC29P mRNA, partial cds.//3.50E-128//248aa//97%//AF068295

SKMUS20016080

SKMUS20016310

SKMUS20016340//HIGH MOBILITY GROUP PROTEIN HMG2 (HMG-2).//6.00E-11//170aa//25%//P26583

SKMUS20016620//Oryctolagus cuniculus CARP mRNA, complete cds.//2.70E-43//196aa//51%//AF131883

SKMUS20016680//Neuron-specific signal trunduction protein Stac//8.30E-33//218aa//38%//NP058549

SKMUS20016710

SKNMC10000070

SKNMC10000100

SKNMC10000190

SKNMC10000290

SKNMC10001100

SKNMC10001590

SKNMC10001680

SKNMC10002290

SKNMC10002510//Homo sapiens MT-ABC transporter (MTABC) mRNA, complete cds.//Q//672aa//93%//AF076775

SKNMC10002640

SKNMC20000650//ZINC FINGER PROTEIN 136.//7.20E-05//311aa//23%//P52737

SKNMC20000970//M. musculus mRNA for protein Htf9C.//9.80E-220//552aa//75%//X56044

SKNMC20002240//ZINC FINGER PROTEIN 228.//1.80E-68//226aa//53%//Q9UJU3

SKNMC20003050

SKNMC20003220//MAJOR CENTROMERE AUTOANTIGEN B (CENTROMERE PROTEIN B) (CENP-B).//3.70E-10//153aa//32%//P07199

SKNMC20003560//Mus musculus Max-interacting transcriptional repressor (Mad3) mRNA, complete cds.//1.90E-72//168aa//86%//U32394

SKNMC20005930

SKNMC20006120

SKNMC20010570

SKNMC20011130//Rattus norvegicus golgi peripheral membrane protein p65 (GRASP65) mRNA, complete cds.//6.90E-90//244aa//66%//AF015264

SKNMC20015030//P-SELECTIN GLYCOPROTEIN LIGAND 1 PRECURSOR (PSGL-1) (SELECTIN P LIGAND).//3.60E-11//152aa//32%//Q62170

SKNMC20015550

SKNMC20015960//Homo sapiens mRNA for ANKHZN, complete cds.//0//1046aa//95%//AB037360

SKNSH10000860

SKNSH10001740//ORNITHINE DECARBOXYLASE (EC 4.1.1.17) (ODC).//9.00E-102//352aa//53%//P00860

SKNSH10003010//Homo sapiens DRC3 mRNA, complete cds.//3.00E-154//305aa//91%//AF282167

SKNSH10003080

SKNSH20001510

SKNSH20001630

SKNSH20003470//CYTOCHROME B2 PRECURSOR (EC 1.1.2.3) (L-LACTATE DEHYDROGENASE (CYTOCHROME)) (L-LACTATE FERRICYTOCHROME C OXIDOREDUCTASE) (L-LCR).//2.60E-07//107aa//32%//P00175

SMINT10000160//2-HYDROXYACYLSPHINGOSINE 1-BETA-GALACTOSYLTRANSFERASE PRECURSOR (EC 2.4.1.45) (UDP-GALACTOSE-CERAMIDE GALACTOSYLTRANSFERASE) (CERAMIDE UDP-GALACTOSYLTRANSFERASE) (CEREBROSIDE SYNTHASE).//3.80E-71//492aa//33%//Q64676

SMINT10000390

SMINT10000420//ATP-BINDING CASSETTE, SUB-FAMILY A, MEMBER 3 (ATP-BINDING CASSETTE TRANSPORTER 3) (ATP-BINDING CASSETTE 3) (ABC-C TRANSPORTER).//2.70E-92//662aa//34%//Q99758

SMINT10000540

SMINT10000570//Homo sapiens leucocyte immunoglobulin-like receptor-8 (LIR-8) mRNA, complete cds.//5.30E-212//481aa//84%//AF025534

SMINT10000710

SMINT10001000//PAIRED MESODERM HOMEOBOX PROTEIN 2B (PAIRED-LIKE HOMEOBOX 2B) (PHOX2B HOMEODOMAIN PROTEIN) (NEUROBLASTOMA PHOX) (NBPHOX).//1.60E-05//87aa//39%//Q99453

SMINT10001030//Homo sapiens ankyrin repeat-containing protein ASB-2 mRNA, complete-cds.//1.20E-292//546aa//99%//AF159164

SMINT10001180

SMINT20000180

SMINT20000400

SMINT20001450//Halocynthia roretzi mRNA for HrPET-3, complete cds.//2.30E-20//125aa//40%//AB029335

SMINT20002270

SMINT20002390

SMINT20002770//BUTYROPHILIN PRECURSOR (BT).//3.20E-51//269aa//41%//P18892

SMINT20003960//A kinase anchor protein AKAP-KL isoform 2//5.00E-254//738aa//70%//T09226

SMINT20004000//Homo sapiens FRG1 mRNA, complete cds.//7.00E-52//116aa//90%//L76159

SMINT20005450//Mus musculus Zfp228 (Znf228) mRNA, complete cds.//1.20E-31//125aa//49%//AF282919

SMINT20005580

SPLEN10000490

SPLEN10000910//Homo sapiens HRIHFB2007 mRNA, partial cds.//5.20E-95//199aa//90%//AB015330

SPLEN10001430//HIGH MOBILITY GROUP PROTEIN HMG1 (HMG-1).//3.00E-78//147aa//100%//P09429

SPLEN20000200//Human (c-myb) gene, complete primary cds, and five complete alternatively spliced cds.//3.10E-11//64aa//57%//U22376

SPLEN20000470

SPLEN20000720//ZINC FINGER PROTEIN CKR1.//3.10E-37//235aa//37%//P30373

SPLEN20001340//CARBOXYPEPTIDASE S PRECURSOR (EC 3.4.17.4) (YSCS) (GLY-X CARBOXYPEPTIDASE).//3.30E-29//250aa//37%//P27614

SPLEN20001970//SPLICING FACTOR, ARGININE/SERINE-RICH 4 (PRE-MRNA SPLICING FACTOR SRP75).//2.70E-14//243aa//28%//Q08170

SPLEN20002420

SPLEN20002430

SPLEN20002670//Rattus norvegicus TGF-beta resistance-associated protein (TRAG) mRNA, complete cds.//Q//559aa//84%//AF305813

SPLEN20002700

SPLEN20003100

SPLEN20003570//Mus musculus RaIGDS-like protein 3 mRNA, complete cds.//8.30E-191//453aa//81%//AF237669

SPLEN20004430

SPLEN20004960

SPLEN20005410

STOMA10000470

STOMA10000520

STOMA10001170

STOMA10001330

STOMA10001860//CYTOSOLIC ACYL COENZYME A THIOESTER HYDROLASE (EC 3.1.2.2) (LONG CHAIN ACYL-COA THIOESTER HYDROLASE) (CTE-II).//2.70E-173//328aa//99%//Q00154

STOMA20000320

STOMA20000880//IG LAMBDA CHAIN C REGIONS.//1.50E-51//105aa//96%//P01842

STOMA20001210//Fugu rubripes CCBL1 gene, exons 1 to 12.//1.90E-127//415aa//55%//Y17462

STOMA20001880

STOMA20002570

STOMA20002890

STOMA20003960//LIM-ONLY PROTEIN 6 (TRIPLE LIM DOMAIN PROTEIN 6).//3.60E-59//352aa//39%//Q43900

STOMA20004780

STOMA20004820//1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase (EC 3.1.4.11) delta-2//6.90E-148//325aa//84%//S14113

SYNOV10001280//Homo sapiens colon cancer-associated protein Mic1 (MIC1) mRNA, complete cds.//1.1e-316//609aa//97%//AF143536

SYNOV10001640

SYNOV20001770

SYNOV20002910//Arabinogalactan-like protein//2.90E-07//124aa//31%//S52994

SYNOV20008200//Trichoplusia ni transposon IFP2.//4.10E-13//254aa//27%//J04364

SYNOV20010140//Mus musculus Zfp228 (Znf228) mRNA, complete cds.//2.50E-31//125aa//49%//AF282919

SYNOV20011440

SYNOV20013740//ZINC FINGER PROTEIN 134.//1.90E-108//332aa//53%//P52741

SYNOV20014510//MYOCYTE-SPECIFIC ENHANCER FACTOR 2B (SERUM RESPONSE FACTOR-LIKE PROTEIN 2) (XMEF2) (RSRFR2).//6.40E-140//302aa//88%//Q02080

SYNOV20014570

SYNOV20016480//THYMIDINE PHOSPHORYLASE PRECURSOR (EC 2.4.2.4) (TDRPASE) (TP) (PLATELET-DERIVED ENDOTHELIAL CELL GROWTH FACTOR) (PD-ECGF) (GLIOSTATIN)./2.80E-35//69aa//100%/P19971

TESTI10000230

TESTI10000250//M. musculus mRNA for testis-specific protein, DDC8./2.60E-68//462aa//42%//Y09878

TESTI10000420//PARAMYOSIN (ANTIGEN SJ97).//2.50E-08//367aa//23%//Q05870

TESTI10000510//CYTADHERENCE HIGH MOLECULAR WEIGHT PROTEIN 2 (CYTADHERENCE ACCESSORY PROTEIN 2).//4.00E-13//648aa//22%//P75471

TESTI10000550//HOMEOBOX PROTEIN SIX1 (FRAGMENT)./8.90E-11//199aa//30%//Q62231

TESTI10000640//Fugu rubripes sex comb on midleg-like 2 protein (SCML2) gene, complete cds.//2.20E-140//513aa//49%//AF146688

TESTI10000700//Rattus norvegicus deubiquitinating enzyme Ubp69 (ubp69) mRNA, complete cds.//7.00E-297//618aa//88%//AF106659

TESTI10000960

TESTI10001250

TESTI10001270//POLYCYSTIN PRECURSOR (AUTOSOMAL DOMINANT POLYCYSTIC KIDNEY DISEASE PROTEIN 1).//3.60E-11//161aa//33%//P98161

TESTI10001310//Homo sapiens TCP11 (TCP11) mRNA, complete cds.//1.90E-223//425aa//100%//AF269223

TESTI10001380//NEUROENDOCRINE CONVERTASE 3 PRECURSOR (EC 3.4.21.61) (NEC 3) (PC4) (PROHORMONE CONVERTASE 3) (KEX2-LIKE ENDOPROTEASE 3).//1.10E-140//303aa//85%//P29121

TESTI10001630

TESTI10001680//PROTEIN PHOSPHATASES PP1 REGULATORY SUBUNIT SDS22.//4.30E-14//158aa//35%//P36047

TESTI10001790

TESTI10001910//Homo sapiens 88-kDa Golgi protein (GM88) mRNA, complete cds.//8.70E-77//274aa//59%//AF204231

TESTI20000180

TESTI20000440//TRICHOHYALIN.//3.00E-16//476aa//26%//P22793

TESTI20001200//Homo sapiens mRNA for zinc finger 3 (ZF3 gene).//6.90E-13//108aa//40%//X60153

TESTI20001540//PUTATIVE SERINE/THREONINE-PROTEIN KINASE D1044.3 IN CHROMOSOME III (EC 2.7.1.-).//1.30E-32//103aa//48%//P41951

TESTI20001770//INTER-ALPHA-TRYPSIN INHIBITOR HEAVY CHAIN H3 PRECURSOR (ITI HEAVY CHAIN H3) (SERUM-DERIVED HYALURONAN-ASSOCIATED PROTEIN) (SHAP).//5.10E-05//57aa//22%//Q06033

TESTI20001790

TESTI20001840//SIT4-ASSOCIATING PROTEIN SAP185.//7.90E-08//109aa//33%//P40856

TESTI20002070//NIFU-LIKE PROTEIN.//3.60E-43//105aa//80%//Q9ZD61

TESTI20002080//Homo sapiens mRNA for Gab2, complete cds.//7.60E-62//222aa//60%//AB018413

TESTI20002380

TESTI20002530//Homo sapiens A1U mRNA, complete cds.//6.60E-17//220aa//31%//AF188240

TESTI20003560//TUBULIN ALPHA-3/ALPHA-7 CHAIN.//2.00E-40//119aa//73%//P05214

TESTI20003720

TESTI20004350//CALDESMON (CDM).//1.20E-09//180aa//23%//P12957

TESTI20004620

TESTI20005200

TESTI20005910//ADENYLATE KINASE, CHLOROPLAST (EC 2.7.4.3) (ATP-AMP TRANSPHOSPHORYLASE).//3.60E-34//209aa//37%//P43188

TESTI20006000//RESTIN (CYTOPLASMIC LINKER PROTEIN-170 ALPHA-2) (CLIP-170) (REED-STERNBERG INTERMEDIATE FILAMENT ASSOCIATED PROTEIN).//6.80E-21//196aa//32%//P30622

TESTI20006270

TESTI20006710

TESTI20006950//KINESIN HEAVY CHAIN.//7.80E-07//391aa//22%//P21613

TESTI20006990//KINESIN-LIKE PROTEIN KIF2 (KINESIN-2) (HK2).//2.00E-184//539aa//63%//Q00139

TESTI20007070//DOUBLESEX PROTEIN, MALE-SPECIFIC.//3.00E-13//163aa//31%//P23023

TESTI20007620//DRA PROTEIN (DOWN-REGULATED IN ADENOMA).//1.60E-09//88aa//38%//P40879

TESTI20007840//PUTATIVE IMPORTIN BETA-4 SUBUNIT (KARYOPHERIN BETA-4 SUBUNIT).//6.00E-89//092aa//26%//Q60100

TESTI20008190

TESTI20008300

TESTI20008490//MYOSIN HEAVY CHAIN, CLONE 203 (FRAGMENT).//4.90E-09//331aa//24%//P39922

TESTI20008830//MYOSIN-BINDING PROTEIN C, SLOW-TYPE (SLOW MYBP-C) (C-PROTEIN, SKELETAL MUSCLE SLOW-ISOFORM)./4.20E-88//162aa//100%//Q00872

TESTI20009090

TESTI20009510

TESTI20009700

TESTI20010080

TESTI20010490//HYPOTHETICAL ZINC FINGER PROTEIN KIAA0961.//2.70E-155//504aa//56%//Q9Y2G7

TESTI20010820

TESTI20011340

TESTI20011410//Rattus norvegicus actin-filament binding protein Frabin mRNA, complete cds.//0//766aa//83%//AF038388

TESTI20011800//TRICHOHYALIN.//5.80E-07//322aa//22%//Q07283

TESTI20012370//RING CANAL PROTEIN (KELCH PROTEIN).//1.60E-38//438aa//26%//Q04652

TESTI20012690//DIHYDROLIPOAMIDE ACETYLTRANSFERASE COMPONENT OF PYRUVATE DEHYDROGENASE COMPLEX, MITOCHONDRIAL PRECURSOR (EC 2.3.1.12) (E2) (PDC-E2) (70 KDA MITOCHONDRIAL AUTOANTIGEN OF PRIMARY BILIARY CIRRHOSIS) (PBC) (M2 ANTIGEN COMPLEX 70 KDA SUBUNIT).//3.40E-308//575aa//99%//P10515

TESTI20013060

TESTI20013300//Homo sapiens NY-REN-60 antigen mRNA, partial cds.//1.10E-172//315aa//99%//AF155116

TESTI20013450//M. musculus Tenr mRNA for RNA binding protein.//3.00E-273//576aa//88%//X84693

TESTI20013520

TESTI20014120//TRICHOHYALIN.//1.40E-28//370aa//27%//P37709

TESTI20014200//D. melanogaster mRNA for putative organic cation transporter, 2064 bp.//4.20E-54//357aa//33%//Y12400

TESTI20015110//MYOSIN II HEAVY CHAIN, NON MUSCLE.//3.50E-07//255aa//24%//P08799

TESTI20015120//TOM1 (target of myb 1)//1.00E-57//245aa//56%//NP005479

TESTI20015560//ZINC FINGER PROTEIN 151 (MYC-INTERACTING ZINC FINGER PROTEIN) (MIZ-1 PROTEIN).//9.50E-16//278aa//28%//Q13105

TESTI20015930

TESTI20016210

TESTI20016610//DYNEIN BETA CHAIN, FLAGELLAR OUTER ARM.//1.10E-17//432aa//25%//Q39565

TESTI20016650//IMMEDIATE-EARLY PROTEIN.//9.50E-06//111aa//28%//Q01042

TESTI20016710

TESTI20017580

TESTI20017660

TESTI20017920

TESTI20018150//GASTRULA ZINC FINGER PROTEIN XLCGF7.1 (FRAGMENT).//7.20E-13//98aa//37%//P18735

TESTI20018260

TESTI20018270//TRANSKETOLASE (EC 2.2.1.1) (TK) (P68).//6.90E-230//614aa//67%//P40142

TESTI20018290

TESTI20018520//Homo sapiens contactin associated protein (Caspr) mRNA, complete cds.//5.40E-167//724aa//40%//U87223

TESTI20018620

TESTI20018690//Xenopus laevis bicaudal-C (Bic-C) mRNA, complete cds.//1.20E-08//189aa//30%//AF224746

TESTI20018790//ZINC FINGER PROTEIN 157.//8.70E-104//443aa//45%//P51786

TESTI20018980

TESTI20019500

TESTI20019680

TESTI20019910

TESTI20020020

TESTI20020480

TESTI20020570//Human actin-like peptide mRNA, partial cds.//6.10E-140//307aa//88%//U20582

TESTI20020810//HYPOTHETICAL 80.0 KDA PROTEIN IN POL1-RAS2 INTERGENIC REGION.//5.30E-40//235aa//35%//P50944

TESTI20020900

TESTI20021050//MICRONUCLEAR LINKER HISTONE POLYPROTEIN (MIC LH) [CONTAINS: LINKER HISTONE PROTEINS ALPHA, BETA, DELTA AND GAMMA].//3.90E-11//365aa//24%//P40631

TESTI20021490//ZINC FINGER PROTEIN 131 (FRAGMENT).//5.30E-191//347aa//99%//P52739

TESTI20022230//Chlamydomonas reinhardtii strain 1132D-flagellar protofilament ribbon protein (RIB43a) mRNA, complete cds.//7.70E-12//137aa//31%//AF196576

TESTI20022450

TESTI20022510

TESTI20022560//GUANYLATE KINASE (EC 2.7.4.8) (GMP KINASE).//2.20E-20//88aa//31%//Q64520

TESTI20022640

TESTI20022940//MOB2 PROTEIN (MPS1 BINDER 2).//4.80E-16//133aa//31%//P43563

TESTI20023610

TESTI20023690

TESTI20024150

TESTI20024230//PISTIL-SPECIFIC EXTENSIN-LIKE PROTEIN PRECURSOR (PELP).//8.40E-15//155aa//34%//Q03211

TESTI20024610//TRICHOHYALIN.//3.60E-13//423aa//23%//P37709

TESTI20024650//FIBROIN HEAVY CHAIN PRECURSOR (FIB-H) (FRAGMENTS).//4.70E-06//142aa//33%//P05790

TESTI20024670

TESTI20024980//Danio rerio p55-related MAGUK protein DLG3 (dlg3) mRNA, complete cds.//2.00E-221//532aa//75%//AF124435

TESTI20025160//MELANOMA-ASSOCIATED ANTIGEN B1 (MAGE-B1 ANTIGEN) (MAGE-XP ANTIGEN) (DAM10).//1.40E-89//349aa//54%//P43366

TESTI20025440

TESTI20025800

TESTI20026320

TESTI20026760//ZINC-BINDING PROTEIN A33.//1.60E-38//235aa//37%//Q02084

TESTI20026980

TESTI20027000

TESTI20027070//PLASMA-CELL MEMBRANE GLYCOPROTEIN PC-1 [INCLUDES: ALKALINE PHOSPHODIESTERASE I (EC 3.1.4.1); NUCLEOTIDE PYROPHOSPHATASE (EC 3.6.1.9) (NPPASE)].//1.50E-50//406aa//33%//P22413

TESTI20027290//Homo sapiens mRNA for oligophrenin 1.//2.50E-56//393aa//38%//AJ001189

TESTI20027890//ZINC FINGER PROTEIN 33A (ZINC FINGER PROTEIN KOX31) (KIAA0065) (HA0946) (FRAGMENT).//9.40E-91//472aa//42%//Q06730

TESTI20028060

TESTI20028400

TESTI20028660

TESTI20029120//DUAL-SPECIFICITY TYROSINE-(Y)-PHOSPHORYLATION REGULATED KINASE (EC 2.7.1.-) (PROTEIN KINASE MINIBRAIN HOMOLOG) (HP86).//1.90E-47//253aa//41%//Q13627

TESTI20029650

TESTI20030050//Mus musculus taube nuss mRNA, complete cds.//1.70E-119//260aa//91%//AF222802

TESTI20030370

TESTI20030590//TESTIS-SPECIFIC PROTEIN PBS13.//1.70E-33//117aa//61%//Q01755

TESTI20030710//Homo sapiens C2H2 (Kruppel-type) zinc finger protein mRNA, complete cds.//9.80E-18//139aa//46%//AF159567

TESTI20030740//TRICHOHYALIN.//8.30E-12//368aa//24%//P22793

TESTI20031090//VACUOLAR PROTEIN 8.//3.80E-23//367aa//27%//P39968

TESTI20031170//Tektin A1 [Strongylocentrotus purpuratus]//3.40E-91//397aa//45%//M97188

TESTI20031300

TESTI20031520

TESTI20031930

TESTI20031960

TESTI20032280

TESTI20032550

TESTI20032800

TESTI20032990

TESTI20033250//SALIVARY PROLINE-RICH PROTEIN PRECURSOR (CLONE CP7) [CONTAINS: BASIC PEPTIDE P-F] (FRAGMENT).//4.50E-05//138aa//28%//P02812

TESTI20033270//Testis-specific protein [Homo sapiens].//1.00E-22//120aa//47%//NP067063

TESTI20033540//TRICHOHYALIN.//1.80E-13//443aa//22%//P37709

TESTI20033560

TESTI20033760

TESTI20034130//Zinc finger protein 106//9.30E-263//781aa//66%//T14273

TESTI20034180

TESTI20034190//Homo sapiens very long-chain acyl-CoA synthetase (BG1) mRNA, complete cds.//3.00E-131//468aa//53%//AF179481

TESTI20034980//TRIPLE FUNCTIONAL DOMAIN PROTEIN//1.00E-77//250aa//55%//Q75962

TESTI20035120//SYNAPTONEMAL COMPLEX PROTEIN 1 (SCP-1 PROTEIN).//9.30E-06//459aa//20%//Q62209

TESTI20035410

TESTI20035510//Proliferating-cell nucleolar antigen P120-like protein—Archaeoglobus fulgidus.//3.00E-12//200aa//35%//F69504

TESTI20035740//A-KINASE ANCHOR PROTEIN 150 (AKAP 150) (CAMP-DEPENDENT PROTEIN KINASE REGULATORY SUBUNIT II HIGH AFFINITY BINDING PROTEIN) (P150) (FRAGMENT).//4.50E-09//357aa//21%//P24587

TESTI20035800

TESTI20035890

TESTI20036250//IMMEDIATE-EARLY PROTEIN.//1.60E-07//120aa//35%//Q01042

TESTI20036490//GLYCOPROTEIN X PRECURSOR.//7.40E-06//107aa//31%//P28968

TESTI20037270

TESTI20037810

TESTI20038940

TESTI20039140//Tektin A11//2.10E-68//410aa//36%//A46170

TESTI20039980//T-CELL RECEPTOR BETA CHAIN ANA 11.//4.40E-13//123aa//40%//P06333

TESTI20040000//Rattus norvegicus cca2 mRNA, complete ods.//5.60E-82//179aa//86%//AB000199

TESTI20040310

TESTI20041110

TESTI20041220//Babesia bigemina 200 kDa antigen p200 mRNA, partial cds.//4.60E-05//481aa//19%//AF142406

TESTI20042070//Columba livia mRNA for 5′-nucleotidase.//8.20E-113//317aa//67%//AJ131243

TESTI20042290//MHC CLASS II TRANSACTIVATOR CIITA.//6.30E-05//89aa//43%//P79621

TESTI20042430

TESTI20042870//X INACTIVE SPECIFIC TRANSCRIPT PROTEIN (FRAGMENT).//2.40E-06//155aa//32%//P27571

TESTI20042950//AMINOPEPTIDASE B (EC 3.4.11.6) (ARGINYL AMINOPEPTIDASE) (ARGININE AMINOPEPTIDASE) (CYTOSOL AMINOPEPTIDASE IV) (AP-B).//4.40E-19//141aa//33%//Q09175

TESTI20047120//POTENTIAL PHOSPHOLIPID-TRANSPORTING ATPASE IK (EC 3.6.1.-) (FRAGMENT).//1.00E-86//169aa//98%//Q60423

TESTI20049290

TESTI20049820//CGMP-DEPENDENT PROTEIN KINASE 1, ALPHA ISOZYME (EC 2.7.1.37) (CGK 1 ALPHA) (CGKI-ALPHA).//6.60E-07//187aa//26%//Q13976

TESTI20049940

TESTI20051550

TESTI20052680//Rattus norvegicus RSD-6 mRNA, complete cds.//4.20E-61//261aa//55%//AF271155

TESTI20053960//ZINC FINGER PROTEIN 132.//0//589aa//99%//P52740

TESTI20054080//SER/THR-RICH PROTEIN T10 IN DGCR REGION.//4.90E-117//263aa//82%//P54797

TESTI20054920

TESTI20055840//Homo sapiens Tandem PH Domain Containing Protein-1 mRNA, complete cds.//2.70E-162//331aa//92%//AF286160

TESTI20056900//ENVELOPE GLYCOPROTEIN GP340 (MEMBRANE ANTIGEN) (MA) [CONTAINS: GLYCOPROTEIN GP220].//1.50E-06//171aa//32%//P03200

TESTI20057310//CHROMOSOME SCAFFOLD PROTEIN SCII.//1.90E-05//297aa//20%//Q90988

TESTI20057420//ENDOZEPINE-RELATED PROTEIN PRECURSOR (MEMBRANE-ASSOCIATED DIAZEPAM BINDING INHIBITOR) (MA-DBI).//5.20E-225//501aa//83%//P07106

TESTI20058600//MYELOID UPREGULATED PROTEIN.//2.20E-68//167aa//74%//Q35682

TESTI20062380

TESTI20062550

TESTI20064250

TESTI20064830//Homo sapiens RAN binding protein 16 mRNA, complete cds.//5.00E-163//414aa//64%//AF064729

TESTI20065720//PROTEIN D52 (N8 PROTEIN).//1.00E-22//129aa//46%//P55327

TESTI20067740

TESTI20068660//Homo sapiens infertility-related sperm protein mRNA, complete cds.//5.90E-197//365aa//99%//AF311312

TESTI20068720

TESTI20069780

TESTI20069790

TESTI20071830//Homo sapiens transcriptional intermediary factor 1 gamma mRNA, complete cds.//1.40E-125//233aa//99%//AF119043

TESTI20073580

TESTI20074020

TESTI20074640//ZINC FINGER PROTEIN 85 (ZINC FINGER PROTEIN HPF4) (HTF1).//3.20E-119//428aa//45%//Q03923

TESTI20074660//ZINC FINGER PROTEIN 91 (ZINC FINGER PROTEIN HTF10) (HPF7).//1.30E-194//509aa//68%//Q05481

TESTI20074800

TESTI20076130

TESTI20077490

TESTI20077500

TESTI20078140//D7 PROTEIN.//1.10E-25//99aa//49%//P13007

TESTI20078640//Homo sapiens zinc finger protein ZNF232, exon 4 and complete cds.//2.60E-61//119aa//99%//AF080171

TESTI20078670//RING CANAL PROTEIN (KELCH PROTEIN).//8.90E-09//269aa//20%//Q04652

TESTI20078720//INTRACELLULAR PROTEIN TRANSPORT PROTEIN US01.//2.90E-17//417aa//24%//P25386

TESTI20079510//NEURAL CELL ADHESION MOLECULE, 140 KDA ISOFORM PRECURSOR (N-CAM 140) (NCAM-140) (CD56 ANTIGEN).//Q//723aa//96%//P13591

TESTI20080200//DPY-19 PROTEIN.//7.50E-114H/621 aa//38%//P34413

TESTI20080330

TESTI20081390

TESTI20081440

TESTI20082340

TESTI20082400

TESTI20083430

TESTI20083870//CALCINEURIN B-LIKE PROTEIN (CBLP).//1.80E-73//169aa//82%//P28470

TESTI20084400

TESTI20086570//MELANOMA-ASSOCIATED ANTIGEN B4 (MAGE-B4 ANTIGEN).//4.20E-88//347aa//52%//Q15481

TESTI20087740

TESTI20088470

TESTI20136910

TESTI20138320//Xenopus laevis transketolase mRNA, complete cds.//1.30E-128//315aa//75%//AF270484

TESTI20140360//XAA-PRO DIPEPTIDASE (EC 3.4.13.9) (X-PRO DIPEPTIDASE) (PROLINE DIPEPTIDASE) (PROLIDASE) (IMIDODIPEPTIDASE).//1.40E-55//111aa//98%//P12955

TESTI20177400

TESTI30000020//L. mexicana Imsap2 gene for secreted acid phosphatase 2 (SAP2).//2.00E-11//361aa//24%//Z46970

THYMU10000020//Homo sapiens mRNA for Golgi protein (GPP34 gene).//2.20E-135//274aa//95%//AJ296152

THYMU10000320

THYMU10000830//SUCCINATE DEHYDROGENASE [UBIOUINONE] FLAVOPROTEIN SUBUNIT, MITOCHONDRIAL PRECURSOR (EC 1.3.5.1) (FP) (FLAVOPROTEIN SUBUNIT OF COMPLEX II).//7.30E-84//185aa//87%//P31040

THYMU10001050

THYMU10001760//SIALOADHESIN PRECURSOR (SER).//2.50E-42//127aa//71%//Q62230

THYMU10002910//Homo sapiens AP-4 adaptor complex beta4 subunit mRNA, complete cds.//1.30E-64//129aa//97%//AF092094

THYMU10003290

THYMU10003590//BETA-CHIMAERIN//2.00E-23//200aa//31%//P52757

THYMU10003660

THYMU10003820

THYMU10004590//T-CELL-SPECIFIC TRANSCRIPTION FACTOR 1 (TCF-1) (T-CELL FACTOR 1) (TRANSCRIPTION FACTOR-7).//3.70E-89//172aa//97%//Q00417

THYMU10004730

THYMU10004910//Homo sapiens protein serine/threonine phosphatase 4 regulatory subunit 1 (PP4R1) mRNA, complete cds.//3.70E-49//144aa//65%//AF111106

THYMU10005270

THYMU10005580//Homo sapiens Sec22 homolog mRNA, complete cds.//7.00E-139//264aa//98%//AF100749

THYMU20001400

THYMU20002360

THYMU20003170//Homo sapiens topoisomerase II alpha-4 (TOP2A) mRNA, partial cds.//5.80E-09//92aa//42%//AF285159

THYMU20003690//Mus musculus syntrophin-associated serine-threonine protein kinase mRNA, complete cds.//3.20E-189//481aa//73%//AF077818

TRACH10000180

TRACH10000300//Anabaena PCC7120 hetC gene, complete cds.//7.00E-12//200aa//29%//U55386

TRACH10000570

TRACH10000630//CDM PROTEIN (6C6-AG TUMOR-ASSOCIATED ANTIGEN) (DXS1357E).//5.00E-124//246aa//100%//P51572

TRACH10000740//Ig delta chain (WIE)//6.90E-251//513aa//90%//S17597

TRACH10001000//Oryctolagus cuniculus PiUS mRNA, complete cds.//6.50E-33//68aa//95%//U74297

TRACH10001060

TRACH10001250//Ig delta chain (WIE)/1.60E-233//513aa//85%//S17597

TRACH10001400

TRACH20000150//DPP2C1//4.70E-05//152aa//30%//AMC28998

TRACH20000790//Xenopus laevis Churchill protein mRNA, complete cds.//4.10E-47//112aa//71%//AF238862

TRACH20001850

TRACH20001960

TRACH20002350

TRACH20002370//ZINC FINGER PROTEIN 184 (FRAGMENT).//5.40E-61//275aa//38%//Q99676

TRACH20002500//HYPOTHETICAL 65.2 KDA TRP-ASP REPEATS CONTAINING PROTEIN D2030.9 IN CHROMOSOME I.//1.10E-82//375aa//42%//P90794

TRACH20002890//GROWTH FACTOR RECEPTOR-BOUND PROTEIN 7 (GRB7 ADAPTER PROTEIN) (EPIDERMAL GROWTH FACTOR RECEPTOR GRB-7).//3.90E-188//346aa//98%//Q03160

TRACH20003930//Rattus norvegicus matrin 3 mRNA, complete cds.//4.40E-192//371aa//96%//M63485

TRACH20004110

TRACH20004200//MAJOR SURFACE-LABELED TROPHOZOITE ANTIGEN PRECURSOR.//4.40E-06//96aa//33%//P21849

TRACH20004610

TRACH20004720//1-AMINOCYCLOPROPANE-1-CARBOXYLATE SYNTHASE 2 (EC 4.4.1.14) (ACC SYNTHASE 2) (S-ADENOSYL-L-METHIONINE METHYLTHIOADENOSINE-LYASE 2) (ACS-2).//5.40E-56//396aa//31%//P18485

TRACH20004960//Rattus norvegicus kidney-specific protein (KS) mRNA, complete cds.//2.90E-282//573aa//88%//AF062389

TRACH20004970//Transacylases//7.70E-11//151aa//32%//AAB94954

TRACH20006650//Rattus norvegicus mRNA for putative integral membrane transport protein (UST1r).//3.30E-187//552aa//62%//Y09945

TRACH20006750//RADIAL SPOKE PROTEIN 3.//1.90E-50//156aa//48%//P12759

TRACH20007670

TRACH20007800//Homo sapiens PTH-responsive osteosarcoma B1 protein (B1) mRNA, complete cds.//8.40E-230//339aa//98%//AF095771

TRACH20008940//PROTEIN TSG24 (MEIOTIC CHECK POINT REGULATOR).//1.50E-202//384aa//97%//P53995

TRACH20008980

TRACH20009260//PROBABLE OXIDOREDUCTASE EPHD (EC 1.-.-.-).//5.80E-22//201 aa//33%//Q10402

TRACH20009440//ZINC FINGER PROTEIN 91 (ZINC FINGER PROTEIN HTF10) (HPF7).//3.80E-07//89aa//39%//Q05481

TRACH20011920

TRACH20012890//SEX-LETHAL PROTEIN HOMOLOG.//1.20E-07//115aa//33%//Q17310

TRACH20013950//Homo sapiens NY-REN-25 antigen mRNA, partial cds.//2.20E-50//104aa//56%//AF155103

TRACH20014000

TRACH20015920

TRACH20016070

UMVEN10001220

UMVEN20001330//RABPHILIN-3A.//2.00E-18//272aa//30%//P47709

UTERU10000770//GAMETOGENESIS EXPRESSED PROTEIN GEG-154.//5.30E-33//73aa//97%//P50636

UTERU10000960//VACUOLAR ATP SYNTHASE SUBUNIT H (EC 3.6.1.34) (V-ATPASE H SUBUNIT) (V-ATPASE M9.2 SUBUNIT) (9.2 KDA MEMBRANE ACCESSORY PROTEIN).//1.60E-15//68aa//51%//Q15342

UTERU10001600//ZINC FINGER PROTEIN 191.//3.20E-90//346aa//52%//Q14754

UTERU10001920

UTERU20000470//Homo sapiens neuropilin-2(a0) mRNA, complete cds.//5.00E-20//61aa//80%//AF022859

UTERU20003380

UTERU20003930

UTERU20004850//X-linked retinopathy protein//1.10E-16//97aa//51%//A46010

UTERU20005410

UTERU20005690

This application claims the benefit of priority of Japanese Application No. 2001-328381 filed Sep. 14, 2001, and U.S. Provisional Application No. 60/350,435 filed Jan. 24, 2002, the respective disclosures of which Japanese application and U.S. provisional application are hereby incorporated by reference herein.

Claims

1. A polynucleotide selected from the group consisting of the following (a) to (g):

(a) a polynucleotide comprising a protein-coding region of the nucleotide sequence of any one of SEQ ID NOs: 1 to 1639;

(b) a polynucleotide encoding a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 1640 to 3278;

(c) a polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 1640 to 3278, wherein, in said amino acid sequence, one or more amino acids have been substituted, deleted, inserted, and/or added, and wherein said nucleotide sequence encodes a polypeptide functionally equivalent to a polypeptide comprising the selected amino acid sequence;

(d) a polynucleotide hybridizing to a polynucleotide comprising the nucleotide sequence of any one of SEQ ID NOs: 1 to 1639, wherein said nucleotide sequence encodes a polypeptide functionally equivalent to a polypeptide encoded by the selected nucleotide sequence;

(e) a polynucleotide comprising a nucleotide sequence encoding a partial amino acid sequence of a polypeptide encoded by the polynucleotide according to any one of (a) to (d);

(f) a polynucleotide comprising a nucleotide sequence having at least 70% identity to the nucleotide sequence of any one of SEQ ID NOs: 1 to 1639; and

(g) a polynucleotide comprising a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOs: 1 to 1639.

2. A polypeptide encoded by the polynucleotide of claim 1, or a partial peptide thereof.

3. An antibody binding to the polypeptide or the peptide of claim 2.

4. A method for immunologically assaying the polypeptide or the peptide of claim 2, said method comprising the steps of contacting the polypeptide or the peptide of claim 2 with an antibody binding to the polypeptide of claim 2, and observing the binding between the two.

5. A vector comprising the polynucleotide of claim 1.

6. A transformant carrying the polynucleotide of claim 1.

7. A transformant carrying the polynucleotide of claim 1.

8. A method for producing a polypeptide, said method comprising the steps of culturing the transformant of claim 7 and recovering an expression product.

9. An oligonucleotide comprising at least 15 nucleotides, said oligonucleotide comprising a nucleotide sequence complementary to the nucleotide sequence of any one of SEQ ID NOs: 1 to 1639 or to a complementary strand thereof.

10. A method for synthesizing a polypeptide, said method comprising utilizing the oligonucleotide of claim 9.

11. A method for detecting a polypeptide, said method comprising utilizing the oligonucleotide of claim 9.

12. An antisense polynucleotide against the polynucleotide of claim 1 or a part thereof.

13. A method for detecting a polypeptide, said method comprising the following steps of:

a) incubating a target polynucleotide with the oligonucleotide of claim 9 under hybridizable conditions, and

b) detecting hybridization of the target polynucleotide with the oligonucleotide of claim 9.

14. A database of polynucleotides and/or polypeptides, said database comprising information on at least one of the nucleotide sequences of SEQ ID NOs: 1 to 1639 and/or on at least one of the amino acid sequences of SEQ ID NOs: 1640 to 3278.