US20060105376A1
2006-05-18
11/293,697
2005-12-05
Novel full-length cDNAs are provided. 2443 cDNA derived from human have been isolated. The full-length nucleotide sequences of the cDNA and amino acid sequences encoded by the nucleotide sequences have been determined. Because the cDNA of the present invention are full-length and contain the translation start site, they provide information useful for analyzing the functions of the polypeptide.
Get notified when new applications in this technology area are published.
G01N33/566 » CPC main
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
C07K14/47 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
G01N2500/00 » CPC further
Screening for compounds of potential therapeutic value
C12Q1/68 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
G01N33/53 IPC
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing Immunoassay; Biospecific binding assay; Materials therefor
C07H21/04 IPC
Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
C12P21/06 IPC
Preparation of peptides or proteins produced by the hydrolysis of a peptide bond, e.g. hydrolysate products
The present invention relates to polynucleotides encoding novel polypeptides, polypeptides encoded by the polynucleotides, and new uses of these.
BACKGROUND OF THE INVENTIONCurrently, the sequencing projects, the determination and analysis of the genomic DNA of various living organisms have been in progress all over the world. The whole genomic sequences of more than 40 species of prokaryotes, a lower eukaryote, yeast, a multicellular eukaryote, C. elegans, and a higher plants, arabidopsis, etc. are already determined. For human genome, presumably having 3 billion base pairs, the analysis was advanced under global cooperative organization, and a draft sequence was disclosed in 2001. Moreover, all the structures are to be clear and to be disclosed in 2002-2003. The aim of the determination of genomic sequence is to reveal the functions of all genes and their regulation and to understand living organisms as a network of interactions between genes, proteins, cells or individuals through deducing the information in a genome, which is a blueprint of the highly complicated living organisms. To understand living organisms by utilizing the genomic information from various species is not only important as an academic subject, but also socially significant from the viewpoint of industrial application.
However, determination of genomic sequences itself cannot identify the functions of all genes. For example, as for yeast, only the function of approximately half of the 6000 genes, which is predicted based on the genomic sequence, was able to be deduced. On the other hand, the human genome has been estimated to contain about 30,000-40,000 genes. Further, 100,000 or more types of mRNAs are said to exist when variants produced by alternative splicing are taken into consideration. Therefore, it is desirable to establish “a high throughput analysis system of the gene functions” which allows us to identify rapidly and efficiently the functions of vast amounts of the genes obtained by the genomic sequencing.
Many genes in the eukaryotic genome are split by introns into multiple exons. Thus, it is difficult to predict correctly the structure of encoded protein solely based on genomic information. In contrast, cDNA, which is produced from mRNA that lacks introns, encodes a protein as a single continuous amino acid sequence and allows us to identify the primary structure of the protein easily. In human cDNA research, to date, more than three million ESTs (Expression Sequence Tags) are publicly available, and the ESTs presumably cover not less than 80% of all human genes.
The information of ESTs is utilized for analyzing the structure of human genome, or for predicting the exon-regions of genomic sequences or their expression profile. However, many human ESTs have been derived from proximal regions to the 3′-end of cDNA, and information around the 5′-end of mRNA is extremely little. Among human cDNAs, the number of the corresponding mRNAs whose encoding full-length protein sequences are deduced is approximately 13,000.
It is possible to identify the transcription start site of mRNA on the genomic sequence based on the 5′-end sequence of a full-length cDNA, and to analyze factors involved in the stability of mRNA that is contained in the cDNA, or in its regulation of expression at the translation stage. Also, since a full-length cDNA contains atg codon, the translation start site, in the 5′-region, it can be translated into a protein in a correct frame. Therefore, it is possible to produce a large amount of the protein encoded by the cDNA or to analyze biological activity of the expressed protein by utilizing an appropriate expression system. Thus, analysis of a full-length cDNA provides valuable information which complements the information from genome sequencing. Also, full-length cDNA clones that can be expressed are extremely valuable in empirical analysis of gene function and in industrial application.
Therefore, if a novel human full-length cDNA is isolated, it can be used for developing medicines for diseases in which the gene is involved. The protein encoded by the gene can be used as a drug by itself. Thus, it has great significance to obtain a full-length cDNA encoding a novel human protein.
In particular, human secretory proteins or membrane proteins would be useful by itself as a medicine like tissue plasminogen activator (TPA), or as a target of medicines like membrane receptors. In addition, genes for signal transduction-related proteins (protein kinases, etc.), glycoprotein-related proteins, transcription-related proteins, etc. are genes whose relationships to human diseases have been elucidated. Moreover, genes for disease-related proteins form a gene group rich in genes whose relationships to human diseases have been elucidated.
Therefore, it has great significance to isolate novel full-length cDNA clones of human, only few of which has been isolated. Especially, isolation of a novel cDNA clone encoding a secretory protein or membrane protein is desired since the protein itself would be useful as a medicine, and also the clones potentially include a gene involved in diseases. In addition, genes encoding proteins that are involved in signal transduction, glycoprotein, transcription, or diseases are expected to be useful as target molecules for therapy, or as medicines themselves. These genes form a gene group predicted to be strongly involved in diseases. Thus, identification of the full-length cDNA clones encoding those proteins has great significance.
SUMMARY OF THE INVENTIONAn objective of the present invention is to provide polynucleotides encoding novel polypeptides, polypeptides encoded by the polynucleotides, and novel usages of these.
The inventors have developed a method for efficiently cloning, from a cDNA library having very high fullness-ratio, a human full-length cDNA that is predicted to be a full-length cDNA clone, where the cDNA library is synthesized by an improved method (WO 01/04286) of the oligo-capping method (K. Maruyama and S. Sugano, Gene, 138: 171-174 (1994); Y. Suzuki et al., Gene, 200: 149-156 (1997)). Then, the nucleotide sequences of cDNA clones whose fullness ratio is high, obtained by this method, were determined mainly from their 5′-ends, and, if required, from 3′-ends.
Further, representative clones, which were estimated to be novel and full-length, among the clones obtained, were analyzed for their full-length nucleotide sequences. The determined full-length nucleotide sequences were analyzed by BLAST homology search of the databases shown below. Because the homology search of the present invention is carried out based on the information of full-length cDNAs including the entire coding regions, homology to every part of a polypeptide can be analyzed. Thus, in the present invention, the reliability of homology search has been greatly improved.
[1] SwissProt (http://www.ebi.ac.uk/ebi_docsSwissProt_db/swisshome.html),
[2] GenBank (http://www.ncbi.nlm.nih.gov/web/GenBank),
[3] UniGene (Human) (http://www.ncbi.nlm.nih.gov/UniGene), and
[4] nr (a protein database, which has been constructed by combining data of coding sequences (CDS) in nucleotide sequences deposited in GenBank, and data of SwissProt, PDB (http://www.rcsb.org/pdb/index.html), PIR (http://pir.georgetown.edu/pirwww/pirhome.shtml), and PRF (http://www.prf.or.jp/en/); overlapping sequences have been removed.)
Further, the gene expression profiles of cDNA clones whose full-length nucleotide sequence had been determined were studied by analyzing the large-scale cDNA database constructed based on the 5′-end nucleotide sequences of cDNAs obtained. In addition to the analysis for the expression profile by computer, the profiles of gene expression in living cells were also determined by PCR. The present inventors revealed the usefulness of the genes of the present invention based on these analysis results.
In the present invention, gene functions were revealed by the analysis of expression profiles in silico based on the information of full-length nucleotide sequences. The expression profiles used in the expression frequency analysis were studied based on the database containing sufficient amount of fragment sequence data. The expression frequency analysis was carried out by referring, for these expression profiles, to the full-length nucleotide sequences of many cDNA clones obtained in the present invention. Thus, a highly reliable analysis can be achieved by referring to the full-length nucleotide sequences of a wide variety of genes for the sufficiently large population for analysis (expression profiles). Namely, the results of expression frequency analysis using the full-length sequences of the present invention more precisely reflect the gene expression frequency in tissues and cells from which a certain cDNA library was derived. In other words, the information of full-length cDNA nucleotide sequence of the present invention made it possible to achieve the highly reliable expression frequency analysis.
The full-length cDNA clones of this invention were obtained by the method comprising the steps of [1] preparing libraries containing cDNAs with the high fullness ratio by oligo-capping, and [2] assembling 5′-end sequences and selecting one with the highest probability of completeness in length in the cluster formed (there are many clones longer in the 5′-end direction). However, the uses of primers designed based on the 5′- and 3′-end sequences of polynucleotides provided by the present invention enable readily obtaining full-length cDNAs without such a special technique. The primer, which is designed to be used for obtaining cDNAs capable of being expressed, is not limited to the 5′- and 3′-end sequences of polynucleotide.
Specifically, the present invention relates to a polynucleotide selected from the group consisting of the following (a) to (g):
(a) a polynucleotide comprising a protein-coding region of the nucleotide sequence of any one of SEQ ID NOs shown in Table 1;
(b) a polynucleotide encoding a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs shown in Table 1;
(c) a polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs shown in Table 1, wherein, in said amino acid sequence, one or more amino acids have been substituted, deleted, inserted, and/or added, and wherein said nucleotide sequence encodes a polypeptide functionally equivalent to a polypeptide comprising the selected amino acid sequence;
(d) a polynucleotide hybridizing under stringent conditions to a polynucleotide comprising the nucleotide sequence of any one of SEQ ID NOs shown in Table 1, wherein said nucleotide sequence encodes a polypeptide functionally equivalent to a polypeptide encoded by the selected nucleotide sequence;
(e) a polynucleotide comprising a′ nucleotide sequence encoding a partial amino acid sequence of a polypeptide encoded by the polynucleotide according to any one of (a) to (d);
(f) a polynucleotide comprising a nucleotide sequence having at least 70% identity to the nucleotide sequence of (a); and
(g) a polynucleotide comprising a nucleotide sequence having at least 90% identity to the nucleotide sequence of (a).
The present invention also relates to a polypeptide encoded by the above-mentioned polynucleotide or a partial peptide thereof, an antibody binding to the polypeptide or the peptide, and a method for immunologically assaying the polypeptide or the peptide, which comprises the steps of contacting the polypeptide or the peptide with the antibody, and observing the binding between the two.
Furthermore, the present invention features a vector comprising the above-mentioned polynucleotide, a transformant carrying the polynucleotide or the vector, a transformant carrying the polynucleotide or the vector in an expressible manner, and a method for producing the polypeptide or the peptide, which comprises the steps of culturing the transformant and recovering an expression product.
Another feature of the present invention is an oligonucleotide comprising at least 15 nucleotides, said oligonucleotide comprising a nucleotide sequence complementary to the nucleotide sequence of any one of SEQ ID NOs: 1 to 2443 or to a complementary strand thereof. This oligonucleotide can be used as a primer for synthesizing the above-mentioned polynucleotide or used as a probe for detecting the polynucleotide. The present invention includes an antisense polynucleotide against the polynucleotide or a part thereof, and a method for detecting the polynucleotide, which comprises the following steps of:
a) incubating a target polynucleotide with the oligonucleotide under hybridizable conditions, and
b) detecting hybridization of the target polynucleotide with the oligonucleotide.
Still another feature of the present invention is database of polynucleotides and/or polypeptides, said database comprising information on at least one of the nucleotide sequences of SEQ ID NOs: 1 to 2443 and/or on at least one of the amino acid sequences of SEQ ID NOs: 2444 to 4886.
Herein, “polynucleotide” is defined as a molecule, such as DNA and RNA, in which multiple nucleotides are polymerized. There are no limitations on the number of the polymerized nucleotides. In case that the polymer contains relatively low number of nucleotides, it is also described as an “oligonucleotide”, which is included in the “polynucleotide” of the present invention. The polynucleotide or the oligonucleotide of the present invention can be a natural or chemically synthesized product. Alternatively, it can be synthesized using a template polynucleotide by an enzymatic reaction such as PCR. Furthermore, the polynucleotide of the present invention may be modified chemically. Moreover, not only a single-strand polynucleotide but also a double-strand polynucleotide is included in the present invention. In this specification, especially in claims, when the polynucleotide is described merely as “polynucleotide”, it means not only a single-strand polynucleotide but also a double-strand polynucleotide. When it means double-strand polynucleotide, the nucleotide sequence of only one chain is indicated. However, based on the nucleotide sequence of a sense chain, the nucleotide sequence of the complementary strand thereof is essentially determined.
As used herein, an “isolated polynucleotide” is a polynucleotide the structure of which is not identical to that of any naturally occurring polynucleotide or to that of any fragment of a naturally occurring genomic polynucleotide spanning more than three separate genes. The term therefore includes, for example, (a) a DNA which has the sequence of part of a naturally occurring genomic DNA molecule in the genome of the organism in which it naturally occurs; (b) a polynucleotide incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion polypeptide. Specifically excluded from this definition are polynucleotides of DNA molecules present in mixtures of different (i) DNA molecules, (ii) transfected cells, or (iii) cell clones; e.g., as these occur in a DNA library such as a cDNA or genomic DNA library.
The term “substantially pure” as used herein in reference to a given protein or polypeptide means that the protein or polypeptide is substantially free from other biological macromolecules. For example, the substantially pure protein or polypeptide is at least 75%, 80%, 85%, 95%, or 99% pure by dry weight. Purity can be measured by any appropriate standard method known in the art, for example, by column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.
All the cDNAs provided by the present invention are full-length cDNAs. The “full-length cDNA” herein means that the cDNA contains the ATG codon, which is the start point of translation therein. The untranslated regions upstream and downstream of the protein-coding region, both of which are naturally contained in natural mRNAs, are not indispensable. It is preferable that the full-length cDNAs of the present invention contain the stop codon.
BRIEF DESCRIPTION OF THE DRAWINGSFIG. 1 shows the restriction map of the vector pME18SFL3.
DETAILED DESCRIPTION OF THE INVENTIONAll the clones (2443 clones) of the present invention are novel and encode the full-length polypeptides. Further, all the clones are cDNAs with the high fullness ratio, which were obtained by oligo-capping method, and also clones which are not identical to any of known human mRNAs (namely, novel clones) selected by searching, for the 5′-end sequences, mRNA sequences with the annotation of “complete cds” in the GenBank and UniGene databases by using the BLAST homology search [S. F. Altschul, W. Gish, W. Miller, E. W. Myers & D. J. Lipman, J. Mol. Biol., 215: 403-410 (1990); W. Gish & D. J. States, Nature Genet., 3: 266-272 (1993)]; they are also clones that were assumed to have higher fullness ratio among the members in the cluster formed by assembling. Most of the clones assessed to have high fullness ratio in the cluster had the nucleotide sequences longer in the 5′-end direction.
All the full-length cDNAs of the present invention can be synthesized by a method such as PCR (Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley & Sons Section 6.1-6.4) using primer sets designed based on the 5′-end and 3′-end sequences or using primer sets of primers designed based on the 5′-end sequences and a primer of oligo dT sequence corresponding to poly A sequence. Table 1 contains the clone names of full-length cDNA of 2443 clones of the present invention, SEQ ID NOs of the full-length nucleotide sequences, CDS portions deduced from the full-length nucleotide sequences, and SEQ ID NOs of the translated amino acids. The positions of CDS are shown according to the rule of “DDBJ/EMBL/GenBank Feature Table Definition” (http://www.ncbi.nlm.nih.gov/collab/FT/index.html). The start position number corresponds to the first letter of “ATG” that is the nucleotide triplet encoding methionine; the termination position number corresponds to the third letter of the stop codon. These are indicated being flanked with the mark “..”. However, with respect to the clones having no stop codon, the termination position is indicated by the mark “>” according to the above rule.
| TABLE 1 | |||
| SEQ ID NO. | SEQ ID NO. | ||
| Clone | of nucleotide | Position | of amino acid |
| name | sequence | of CDS | sequence |
| 3NB6910001910 | 1 | 30..1661 | 2444 |
| 3NB6920014080 | 2 | 80..922 | 2445 |
| 3NB6920014590 | 3 | 1..693 | 2446 |
| ADIPS10000640 | 4 | 127..1098 | 2447 |
| ADIPS20004250 | 5 | 170..2212 | 2448 |
| ADRGL10001470 | 6 | 368..829 | 2449 |
| ADRGL20000640 | 7 | 599..1345 | 2450 |
| ADRGL20011190 | 8 | 61..>2254 | 2451 |
| ADRGL20012870 | 9 | 827..1300 | 2452 |
| ADRGL20013010 | 10 | 1127..1444 | 2453 |
| ADRGL20013520 | 11 | 226..837 | 2454 |
| ADRGL20018300 | 12 | 320..2233 | 2455 |
| ADRGL20018540 | 13 | 55..363 | 2456 |
| ADRGL20028570 | 14 | 218..976 | 2457 |
| ADRGL20035850 | 15 | 55..522 | 2458 |
| ADRGL20044590 | 16 | 692..1042 | 2459 |
| ADRGL20048330 | 17 | 189..2204 | 2460 |
| ADRGL20061930 | 18 | 293..>1899 | 2461 |
| ADRGL20067670 | 19 | 108..512 | 2462 |
| ADRGL20068170 | 20 | 217..615 | 2463 |
| ADRGL20068460 | 21 | 576..1280 | 2464 |
| ADRGL20073570 | 22 | 556..891 | 2465 |
| ADRGL20076360 | 23 | 159..515 | 2466 |
| ADRGL20078100 | 24 | 418..1563 | 2467 |
| ADRGL20083310 | 25 | 871..1368 | 2468 |
| ASTRO10001650 | 26 | 369..2168 | 2469 |
| ASTRO20001410 | 27 | 319..744 | 2470 |
| ASTRO20005330 | 28 | 196..642 | 2471 |
| ASTRO20008010 | 29 | 735..1169 | 2472 |
| ASTRO20012490 | 30 | 286..783 | 2473 |
| ASTRO20027430 | 31 | 129..848 | 2474 |
| ASTRO20032120 | 32 | 860..1189 | 2475 |
| ASTRO20033160 | 33 | 139..1014 | 2476 |
| ASTRO20055750 | 34 | 16..2007 | 2477 |
| ASTRO20058630 | 35 | 28..957 | 2478 |
| ASTRO20064750 | 36 | 1381..>2654 | 2479 |
| ASTRO20072210 | 37 | 274..>1868 | 2480 |
| ASTRO20084250 | 38 | 35..1381 | 2481 |
| ASTRO20100720 | 39 | 394..714 | 2482 |
| ASTRO20105820 | 40 | 205..1368 | 2483 |
| ASTRO20106150 | 41 | 138..1811 | 2484 |
| ASTRO20108190 | 42 | 791..2539 | 2485 |
| ASTRO20111490 | 43 | 517..921 | 2486 |
| ASTRO20114370 | 44 | 145..1782 | 2487 |
| ASTRO20114610 | 45 | 53..433 | 2488 |
| ASTRO20125520 | 46 | 1674..2456 | 2489 |
| ASTRO20130500 | 47 | 15..2417 | 2490 |
| ASTRO20136710 | 48 | 319..657 | 2491 |
| ASTRO20138020 | 49 | 285..995 | 2492 |
| ASTRO20141350 | 50 | 394..1767 | 2493 |
| ASTRO20143630 | 51 | 103..1305 | 2494 |
| ASTRO20145760 | 52 | 347..2008 | 2495 |
| ASTRO20152140 | 53 | 760..1233 | 2496 |
| ASTRO20155290 | 54 | 208..2298 | 2497 |
| ASTRO20166810 | 55 | 7..381 | 2498 |
| ASTRO20168470 | 56 | 334..1329 | 2499 |
| ASTRO20173480 | 57 | 119..724 | 2500 |
| ASTRO20181690 | 58 | 84..1967 | 2501 |
| ASTRO20190390 | 59 | 2282..2662 | 2502 |
| BEAST20004540 | 60 | 1022..1513 | 2503 |
| BGGI110000240 | 61 | 123..1649 | 2504 |
| BGGI110001930 | 62 | 81..1307 | 2505 |
| BGGI120006160 | 63 | 6..680 | 2506 |
| BLADE20003400 | 64 | 17..1876 | 2507 |
| BLADE20003890 | 65 | 555..2405 | 2508 |
| BLADE20004630 | 66 | 58..405 | 2509 |
| BNGH420088500 | 67 | 2..1270 | 2510 |
| BRACE20003070 | 68 | 310..1563 | 2511 |
| BRACE20006400 | 69 | 32..364 | 2512 |
| BRACE20011070 | 70 | 21..1553 | 2513 |
| BRACE20019540 | 71 | 538..993 | 2514 |
| BRACE20027620 | 72 | 24..1289 | 2515 |
| BRACE20037660 | 73 | 143..469 | 2516 |
| BRACE20038000 | 74 | 646..2187 | 2517 |
| BRACE20038470 | 75 | 963..1307 | 2518 |
| BRACE20038480 | 76 | 1838..2626 | 2519 |
| BRACE20038850 | 77 | 1099..1413 | 2520 |
| BRACE20039040 | 78 | 1273..1671 | 2521 |
| BRACE20039440 | 79 | 216..797 | 2522 |
| BRACE20039540 | 80 | 1153..1905 | 2523 |
| BRACE20050900 | 81 | 115..1788 | 2524 |
| BRACE20051380 | 82 | 1433..1783 | 2525 |
| BRACE20051690 | 83 | 380..742 | 2526 |
| BRACE20052160 | 84 | 20..1024 | 2527 |
| BRACE20053280 | 85 | 736..1524 | 2528 |
| BRACE20053480 | 86 | 24..875 | 2529 |
| BRACE20053630 | 87 | 81..950 | 2530 |
| BRACE20054500 | 88 | 364..669 | 2531 |
| BRACE20055180 | 89 | 156..656 | 2532 |
| BRACE20056810 | 90 | 338..940 | 2533 |
| BRACE20057190 | 91 | 1016..1660 | 2534 |
| BRACE20057420 | 92 | 539..856 | 2535 |
| BRACE20057620 | 93 | 1226..1588 | 2536 |
| BRACE20057730 | 94 | 819..1592 | 2537 |
| BRACE20058580 | 95 | 146..1330 | 2538 |
| BRACE20058810 | 96 | 40..345 | 2539 |
| BRACE20059370 | 97 | 192..1574 | 2540 |
| BRACE20060550 | 98 | 197..1687 | 2541 |
| BRACE20060720 | 99 | 220..618 | 2542 |
| BRACE20060840 | 100 | 37..927 | 2543 |
| BRACE20060890 | 101 | 170..964 | 2544 |
| BRACE20061050 | 102 | 1130..1573 | 2545 |
| BRACE20061740 | 103 | 434..865 | 2546 |
| BRACE20062400 | 104 | 1310..1732 | 2547 |
| BRACE20062640 | 105 | 278..2089 | 2548 |
| BRACE20062740 | 106 | 753..1151 | 2549 |
| BRACE20063630 | 107 | 414..800 | 2550 |
| BRACE20063780 | 108 | 11..892 | 2551 |
| BRACE20063800 | 109 | 70..435 | 2552 |
| BRACE20063930 | 110 | 1795..2433 | 2553 |
| BRACE20064880 | 111 | 365..1420 | 2554 |
| BRACE20067430 | 112 | 875..1189 | 2555 |
| BRACE20068590 | 113 | 260..1759 | 2556 |
| BRACE20069090 | 114 | 1484..1960 | 2557 |
| BRACE20081720 | 115 | 1182..1565 | 2558 |
| BRACE20082950 | 116 | 1713..2018 | 2559 |
| BRACE20090440 | 117 | 58..444 | 2560 |
| BRACE20096200 | 118 | 168..1130 | 2561 |
| BRACE20096540 | 119 | 43..729 | 2562 |
| BRACE20097320 | 120 | 51..509 | 2563 |
| BRACE20099570 | 121 | 3..425 | 2564 |
| BRACE20101700 | 122 | 579..968 | 2565 |
| BRACE20101710 | 123 | 187..681 | 2566 |
| BRACE20106690 | 124 | 335..691 | 2567 |
| BRACE20106840 | 125 | 19..402 | 2568 |
| BRACE20107530 | 126 | 437..1063 | 2569 |
| BRACE20108130 | 127 | 927..1229 | 2570 |
| BRACE20108880 | 128 | 417..782 | 2571 |
| BRACE20109370 | 129 | 1197..1778 | 2572 |
| BRACE20109830 | 130 | 747..1382 | 2573 |
| BRACE20111830 | 131 | 366..737 | 2574 |
| BRACE20114780 | 132 | 515..886 | 2575 |
| BRACE20115450 | 133 | 399..764 | 2576 |
| BRACE20115920 | 134 | 41..937 | 2577 |
| BRACE20116110 | 135 | 830..1150 | 2578 |
| BRACE20116460 | 136 | 84..509 | 2579 |
| BRACE20118380 | 137 | 657..1421 | 2580 |
| BRACE20121850 | 138 | 474..857 | 2581 |
| BRACE20136240 | 139 | 111..518 | 2582 |
| BRACE20141080 | 140 | 148..534 | 2583 |
| BRACE20142320 | 141 | 164..499 | 2584 |
| BRACE20142570 | 142 | 591..926 | 2585 |
| BRACE20147800 | 143 | 133..513 | 2586 |
| BRACE20148210 | 144 | 1101..1541 | 2587 |
| BRACE20148240 | 145 | 713..2128 | 2588 |
| BRACE20150310 | 146 | 94..408 | 2589 |
| BRACE20151320 | 147 | 137..1189 | 2590 |
| BRACE20152870 | 148 | 207..653 | 2591 |
| BRACE20153680 | 149 | 87..956 | 2592 |
| BRACE20154120 | 150 | 351..989 | 2593 |
| BRACE20163150 | 151 | 699..1085 | 2594 |
| BRACE20163350 | 152 | 443..1597 | 2595 |
| BRACE20165830 | 153 | 401..709 | 2596 |
| BRACE20171240 | 154 | 62..439 | 2597 |
| BRACE20172980 | 155 | 20..445 | 2598 |
| BRACE20175870 | 156 | 67..396 | 2599 |
| BRACE20177200 | 157 | 1178..1675 | 2600 |
| BRACE20179340 | 158 | 47..1171 | 2601 |
| BRACE20185680 | 159 | 880..1341 | 2602 |
| BRACE20188470 | 160 | 1247..2926 | 2603 |
| BRACE20190040 | 161 | 6..464 | 2604 |
| BRACE20190440 | 162 | 382..1287 | 2605 |
| BRACE20192440 | 163 | 1199..2062 | 2606 |
| BRACE20195100 | 164 | 251..736 | 2607 |
| BRACE20201570 | 165 | 661..1056 | 2608 |
| BRACE20210140 | 166 | 248..550 | 2609 |
| BRACE20220300 | 167 | 1057..1392 | 2610 |
| BRACE20223280 | 168 | 6..1976 | 2611 |
| BRACE20223330 | 169 | 97..2373 | 2612 |
| BRACE20224480 | 170 | 1568..1924 | 2613 |
| BRACE20224500 | 171 | 1674..2081 | 2614 |
| BRACE20228480 | 172 | 1268..2176 | 2615 |
| BRACE20229280 | 173 | 239..700 | 2616 |
| BRACE20230700 | 174 | 354..752 | 2617 |
| BRACE20232840 | 175 | 79..2019 | 2618 |
| BRACE20235400 | 176 | 213..593 | 2619 |
| BRACE20237270 | 177 | 3..494 | 2620 |
| BRACE20238000 | 178 | 135..437 | 2621 |
| BRACE20240740 | 179 | 83..1546 | 2622 |
| BRACE20248260 | 180 | 682..1533 | 2623 |
| BRACE20253160 | 181 | 26..559 | 2624 |
| BRACE20253330 | 182 | 220..1041 | 2625 |
| BRACE20257100 | 183 | 1638..2021 | 2626 |
| BRACE20262930 | 184 | 256..681 | 2627 |
| BRACE20262940 | 185 | 259..591 | 2628 |
| BRACE20266750 | 186 | 58..1143 | 2629 |
| BRACE20267250 | 187 | 139..612 | 2630 |
| BRACE20269200 | 188 | 4..408 | 2631 |
| BRACE20269710 | 189 | 338.1063 | 2632 |
| BRACE20273890 | 190 | 1365..1766 | 2633 |
| BRACE20274080 | 191 | 350..655 | 2634 |
| BRACE20276430 | 192 | 232..>2028 | 2635 |
| BRACE20283920 | 193 | 717..1025 | 2636 |
| BRACE20284100 | 194 | 1026..1865 | 2637 |
| BRACE20286360 | 195 | 170..727 | 2638 |
| BRACE20287410 | 196 | 603..956 | 2639 |
| BRALZ20013500 | 197 | 215..640 | 2640 |
| BRALZ20014450 | 198 | 6..374 | 2641 |
| BRALZ20017430 | 199 | 232..747 | 2642 |
| BRALZ20018340 | 200 | 879..1481 | 2643 |
| BRALZ20019660 | 201 | 180..773 | 2644 |
| BRALZ20054710 | 202 | 135..1223 | 2645 |
| BRALZ20058880 | 203 | 102..1607 | 2646 |
| BRALZ20059500 | 204 | 722..1081 | 2647 |
| BRALZ20064740 | 205 | 24..350 | 2648 |
| BRALZ20065600 | 206 | 25..624 | 2649 |
| BRALZ20069760 | 207 | 14..319 | 2650 |
| BRALZ20073760 | 208 | 576..1124 | 2651 |
| BRALZ20075450 | 209 | 775..1200 | 2652 |
| BRALZ20075760 | 210 | 148..726 | 2653 |
| BRALZ20077900 | 211 | 1900..2529 | 2654 |
| BRALZ20077930 | 212 | 50..2077 | 2655 |
| BRALZ20080310 | 213 | 1304..2005 | 2656 |
| BRALZ20088690 | 214 | 104..661 | 2657 |
| BRAMY10001300 | 215 | 2352..2795 | 2658 |
| BRAMY20001570 | 216 | 696..1604 | 2659 |
| BRAMY20000520 | 217 | 329..1204 | 2660 |
| BRAMY20000860 | 218 | 246..548 | 2661 |
| BRAMY20002770 | 219 | 76..447 | 2662 |
| BRAMY20004110 | 220 | 145..540 | 2663 |
| BRAMY20011140 | 221 | 2661..3011 | 2664 |
| BRAMY20025840 | 222 | 1058..2002 | 2665 |
| BRAMY20039260 | 223 | 101..424 | 2666 |
| BRAMY20045240 | 224 | 662..1792 | 2667 |
| BRAMY20054880 | 225 | 508..981 | 2668 |
| BRAMY20060920 | 226 | 110..439 | 2669 |
| BRAMY20063970 | 227 | 246..551 | 2670 |
| BRAMY20071850 | 228 | 178..705 | 2671 |
| BRAMY20102080 | 229 | 513..1136 | 2672 |
| BRAMY20103570 | 230 | 114..1001 | 2673 |
| BRAMY20104640 | 231 | 334..1410 | 2674 |
| BRAMY20110640 | 232 | 1400.1735 | 2675 |
| BRAMY20111960 | 233 | 534..854 | 2676 |
| BRAMY20112800 | 234 | 31..606 | 2677 |
| BRAMY20116790 | 235 | 2348..2794 | 2678 |
| BRAMY20120910 | 236 | 182..976 | 2679 |
| BRAMY20121190 | 237 | 81..398 | 2680 |
| BRAMY20121620 | 238 | 51..1688 | 2681 |
| BRAMY20124260 | 239 | 95..1759 | 2682 |
| BRAMY20134140 | 240 | 1..510 | 2683 |
| BRAMY20135900 | 241 | 4..1053 | 2684 |
| BRAMY20136210 | 242 | 1810..2145 | 2685 |
| BRAMY20137560 | 243 | 2220..2795 | 2686 |
| BRAMY20144620 | 244 | 892..1326 | 2687 |
| BRAMY20147540 | 245 | 147..611 | 2688 |
| BRAMY20148130 | 246 | 204..2138 | 2689 |
| BRAMY20152110 | 247 | 1257..1580 | 2690 |
| BRAMY20153110 | 248 | 11..763 | 2691 |
| BRAMY20157820 | 249 | 94..1740 | 2692 |
| BRAMY20160700 | 250 | 1686..2015 | 2693 |
| BRAMY20162510 | 251 | 186..1757 | 2694 |
| BRAMY20163250 | 252 | 96..719 | 2695 |
| BRAMY20163270 | 253 | 531..1010 | 2696 |
| BRAMY20167060 | 254 | 347..865 | 2697 |
| BRAMY20167710 | 255 | 900..1532 | 2698 |
| BRAMY20168920 | 256 | 91..1275 | 2699 |
| BRAMY20170140 | 257 | 115..681 | 2700 |
| BRAMY20174550 | 258 | 74..2179 | 2701 |
| BRAMY20178640 | 259 | 226..2025 | 2702 |
| BRAMY20181220 | 260 | 678..980 | 2703 |
| BRAMY20182730 | 261 | 208..738 | 2704 |
| BRAMY20183080 | 262 | 213..653 | 2705 |
| BRAMY20184670 | 263 | 871..1548 | 2706 |
| BRAMY20195090 | 264 | 2087..2476 | 2707 |
| BRAMY20196000 | 265 | 50..439 | 2708 |
| BRAMY20204450 | 266 | 34..462 | 2709 |
| BRAMY20205740 | 267 | 177..554 | 2710 |
| BRAMY20210400 | 268 | 131..703 | 2711 |
| BRAMY20211390 | 269 | 1407..2303 | 2712 |
| BRAMY20211420 | 270 | 131..2407 | 2713 |
| BRAMY20213100 | 271 | 245..2026 | 2714 |
| BRAMY20215230 | 272 | 207..515 | 2715 |
| BRAMY20217460 | 273 | 612..1217 | 2716 |
| BRAMY20218250 | 274 | 161..2167 | 2717 |
| BRAMY20218670 | 275 | 338..652 | 2718 |
| BRAMY20229800 | 276 | 1270..1662 | 2719 |
| BRAMY20229840 | 277 | 1022..1678 | 2720 |
| BRAMY20230600 | 278 | 614..1840 | 2721 |
| BRAMY20231720 | 279 | 429..773 | 2722 |
| BRAMY20240040 | 280 | 693..2660 | 2723 |
| BRAMY20242470 | 281 | 1527..2243 | 2724 |
| BRAMY20245300 | 282 | 59..2482 | 2725 |
| BRAMY20247110 | 283 | 321..1382 | 2726 |
| BRAMY20247280 | 284 | 611..925 | 2727 |
| BRAMY20248490 | 285 | 1723..2079 | 2728 |
| BRAMY20250240 | 286 | 1179..1619 | 2729 |
| BRAMY20250320 | 287 | 18..323 | 2730 |
| BRAMY20252180 | 288 | 1150..1506 | 2731 |
| BRAMY20252720 | 289 | 595..1113 | 2732 |
| BRAMY20260910 | 290 | 67..2646 | 2733 |
| BRAMY20261680 | 291 | 298..1041 | 2734 |
| BRAMY20266850 | 292 | 26..685 | 2735 |
| BRAMY20267130 | 293 | 235..708 | 2736 |
| BRAMY20268990 | 294 | 137..460 | 2737 |
| BRAMY20270730 | 295 | 124..2118 | 2738 |
| BRAMY20271400 | 296 | 177..>3011 | 2739 |
| BRAMY20273960 | 297 | 48..1826 | 2740 |
| BRAMY20277140 | 298 | 1135..1485 | 2741 |
| BRAMY20277170 | 299 | 545..2221 | 2742 |
| BRAMY20280720 | 300 | 103..489 | 2743 |
| BRAMY20284910 | 301 | 1059..1415 | 2744 |
| BRAMY20285160 | 302 | 1483..1977 | 2745 |
| BRAMY20285930 | 303 | 811..1143 | 2746 |
| BRAMY20286820 | 304 | 1463..1777 | 2747 |
| BRAWH10000930 | 305 | 843..1454 | 2748 |
| BRAWH20002320 | 306 | 162..716 | 2749 |
| BRAWH20004600 | 307 | 66..1361 | 2750 |
| BRAWH20011710 | 308 | 229..1872 | 2751 |
| BRAWH20012390 | 309 | 71..562 | 2752 |
| BRAWH20012410 | 310 | 291..593 | 2753 |
| BRAWH20014920 | 311 | 353..1378 | 2754 |
| BRAWH20015350 | 312 | 1285..1641 | 2755 |
| BRAWH20015890 | 313 | 806..1837 | 2756 |
| BRAWH20016620 | 314 | 1721..2254 | 2757 |
| BRAWH20016660 | 315 | 51..1205 | 2758 |
| BRAWH20016860 | 316 | 548..877 | 2759 |
| BRAWH20017010 | 317 | 155..628 | 2760 |
| BRAWH20018730 | 318 | 56..1570 | 2761 |
| BRAWH20028110 | 319 | 123..1718 | 2762 |
| BRAWH20029630 | 320 | 929..1276 | 2763 |
| BRAWH20030250 | 321 | 264..1421 | 2764 |
| BRAWH20064050 | 322 | 272..1591 | 2765 |
| BRAWH20075700 | 323 | 349..1407 | 2766 |
| BRAWH20096780 | 324 | 272..1840 | 2767 |
| BRAWH20100690 | 325 | 1430..1849 | 2768 |
| BRAWH20101360 | 326 | 163..852 | 2769 |
| BRAWH20103180 | 327 | 1081..1659 | 2770 |
| BRAWH20103290 | 328 | 71..2626 | 2771 |
| BRAWH20105840 | 329 | 139..1083 | 2772 |
| BRAWH20106180 | 330 | 628..933 | 2773 |
| BRAWH20107540 | 331 | 1..540 | 2774 |
| BRAWH20110660 | 332 | 156..578 | 2775 |
| BRAWH20110790 | 333 | 1994..2338 | 2776 |
| BRAWH20110960 | 334 | 74..1210 | 2777 |
| BRAWH20111550 | 335 | 569..949 | 2778 |
| BRAWH20112940 | 336 | 850..1968 | 2779 |
| BRAWH20113430 | 337 | 135..869 | 2780 |
| BRAWH20114000 | 338 | 72..1619 | 2781 |
| BRAWH20117950 | 339 | 465..1568 | 2782 |
| BRAWH20118230 | 340 | 146..565 | 2783 |
| BRAWH20121640 | 341 | 98..1516 | 2784 |
| BRAWH20122580 | 342 | 104..721 | 2785 |
| BRAWH20122770 | 343 | 1283..1612 | 2786 |
| BRAWH20125380 | 344 | 382..918 | 2787 |
| BRAWH20126190 | 345 | 154..459 | 2788 |
| BRAWH20126980 | 346 | 222..686 | 2789 |
| BRAWH20128270 | 347 | 295..1020 | 2790 |
| BRAWH20132190 | 348 | 157..561 | 2791 |
| BRAWH20137480 | 349 | 273..1313 | 2792 |
| BRAWH20138660 | 350 | 261..1376 | 2793 |
| BRAWH20139410 | 351 | 13..354 | 2794 |
| BRAWH20142340 | 352 | 99..413 | 2795 |
| BRAWH20147290 | 353 | 460..810 | 2796 |
| BRAWH20149340 | 354 | 442..1620 | 2797 |
| BRAWH20155950 | 355 | 8..2074 | 2798 |
| BRAWH20158530 | 356 | 138..1136 | 2799 |
| BRAWH20160280 | 357 | 2093..2587 | 2800 |
| BRAWH20162690 | 358 | 33..1085 | 2801 |
| BRAWH20164460 | 359 | 345..>2067 | 2802 |
| BRAWH20166790 | 360 | 224..571 | 2803 |
| BRAWH20171030 | 361 | 152..1996 | 2804 |
| BRAWH20173050 | 362 | 1272..1604 | 2805 |
| BRAWH20182060 | 363 | 118..1740 | 2806 |
| BRAWH20185060 | 364 | 248..607 | 2807 |
| BRCAN10001490 | 365 | 60..452 | 2808 |
| BRCAN20003460 | 366 | 239..1030 | 2809 |
| BRCAN20006200 | 367 | 908..1234 | 2810 |
| BRCAN20006390 | 368 | 252..743 | 2811 |
| BRCAN20054490 | 369 | 345..1067 | 2812 |
| BRCAN20060190 | 370 | 206..595 | 2813 |
| BRCAN20064010 | 371 | 134..685 | 2814 |
| BRCAN20071190 | 372 | 192..1586 | 2815 |
| BRCAN20091560 | 373 | 190..2004 | 2816 |
| BRCAN20103740 | 374 | 207..530 | 2817 |
| BRCAN20124080 | 375 | 187..2079 | 2818 |
| BRCAN20126130 | 376 | 580..897 | 2819 |
| BRCAN20143700 | 377 | 14..817 | 2820 |
| BRCAN20147880 | 378 | 121..519 | 2821 |
| BRCAN20216690 | 379 | 66..383 | 2822 |
| BRCAN20224720 | 380 | 549..1544 | 2823 |
| BRCAN20237240 | 381 | 23..796 | 2824 |
| BRCAN20263400 | 382 | 316..729 | 2825 |
| BRCAN20273100 | 383 | 76..468 | 2826 |
| BRCAN20273340 | 384 | 50..352 | 2827 |
| BRCAN20273550 | 385 | 652..1848 | 2828 |
| BRCAN20273640 | 386 | 131..1201 | 2829 |
| BRCAN20275130 | 387 | 374..847 | 2830 |
| BRCAN20279700 | 388 | 2372..2839 | 2831 |
| BRCAN20280210 | 389 | 644..1393 | 2832 |
| BRCAN20280360 | 390 | 265..1548 | 2833 |
| BRCAN20280400 | 391 | 1280..1618 | 2834 |
| BRCAN20283190 | 392 | 416..1321 | 2835 |
| BRCAN20283380 | 393 | 93..533 | 2836 |
| BRCAN20284600 | 394 | 97..549 | 2837 |
| BRCAN20285450 | 395 | 118..567 | 2838 |
| BRCOC10000870 | 396 | 186..602 | 2839 |
| BRCOC20001860 | 397 | 1061..2179 | 2840 |
| BRCOC20004040 | 398 | 383..1171 | 2841 |
| BRCOC20004870 | 399 | 199..765 | 2842 |
| BRCOC20006370 | 400 | 21..455 | 2843 |
| BRCOC20008160 | 401 | 166..>2490 | 2844 |
| BRCOC20008500 | 402 | 151..>2854 | 2845 |
| BRCOC20020850 | 403 | 1371..1820 | 2846 |
| BRCOC20021550 | 404 | 1121..2110 | 2847 |
| BRCOC20023230 | 405 | 682..1500 | 2848 |
| BRCOC20026640 | 406 | 148..516 | 2849 |
| BRCOC20027510 | 407 | 369..1088 | 2850 |
| BRCOC20031000 | 408 | 207..581 | 2851 |
| BRCOC20031250 | 409 | 799..1122 | 2852 |
| BRCOC20031870 | 410 | 375..1031 | 2853 |
| BRCOC20035130 | 411 | 171..527 | 2854 |
| BRCOC20037320 | 412 | 547..3384 | 2855 |
| BRCOC20037400 | 413 | 152..493 | 2856 |
| BRCOC20041750 | 414 | 230..535 | 2857 |
| BRCOC20055420 | 415 | 99..1556 | 2858 |
| BRCOC20059510 | 416 | 199..582 | 2859 |
| BRCOC20074760 | 417 | 10..>1918 | 2860 |
| BRCOC20077690 | 418 | 867..1202 | 2861 |
| BRCOC20078640 | 419 | 849..1208 | 2862 |
| BRCOC20090520 | 420 | 1157..1663 | 2863 |
| BRCOC20091960 | 421 | 1371..1895 | 2864 |
| BRCOC20093800 | 422 | 204..590 | 2865 |
| BRCOC20099370 | 423 | 1..1890 | 2866 |
| BRCOC20101230 | 424 | 94..810 | 2867 |
| BRCOC20105100 | 425 | 2393..2716 | 2868 |
| BRCOC20107300 | 426 | 709..1086 | 2869 |
| BRCOC20110100 | 427 | 369..713 | 2870 |
| BRCOC20114180 | 428 | 167..487 | 2871 |
| BRCOC20117690 | 429 | 152..781 | 2872 |
| BRCOC20119960 | 430 | 147..500 | 2873 |
| BRCOC20121720 | 431 | 26..2983 | 2874 |
| BRCOC20122290 | 432 | 92..448 | 2875 |
| BRCOC20128130 | 433 | 150..1364 | 2876 |
| BRCOC20134480 | 434 | 587..1060 | 2877 |
| BRCOC20135730 | 435 | 1603..2064 | 2878 |
| BRCOC20136750 | 436 | 2876..3229 | 2879 |
| BRCOC20144000 | 437 | 64..459 | 2880 |
| BRCOC20147480 | 438 | 228..578 | 2881 |
| BRCOC20148330 | 439 | 169..1290 | 2882 |
| BRCOC20155970 | 440 | 111..632 | 2883 |
| BRCOC20158240 | 441 | 1357..2178 | 2884 |
| BRCOC20176520 | 442 | 185..1153 | 2885 |
| BRCOC20178270 | 443 | 244..1257 | 2886 |
| BRCOC20178560 | 444 | 65..1000 | 2887 |
| BRHIP10001290 | 445 | 838..1731 | 2888 |
| BRHIP10001740 | 446 | 148..594 | 2889 |
| BRHIP20000870 | 447 | 1235..1540 | 2890 |
| BRHIP20001630 | 448 | 287..1486 | 2891 |
| BRHIP20003120 | 449 | 170..1951 | 2892 |
| BRHIP20005340 | 450 | 597..1853 | 2893 |
| BRHIP20005530 | 451 | 30..1052 | 2894 |
| BRHIP20096170 | 452 | 119..817 | 2895 |
| BRHIP20096850 | 453 | 311..1582 | 2896 |
| BRHIP20103090 | 454 | 1345..1737 | 2897 |
| BRHIP20104440 | 455 | 166..576 | 2898 |
| BRHIP20105710 | 456 | 1056..1466 | 2899 |
| BRHIP20106100 | 457 | 314..1060 | 2900 |
| BRHIP20107440 | 458 | 827..1528 | 2901 |
| BRHIP20110800 | 459 | 577..1083 | 2902 |
| BRHIP20111200 | 460 | 261..578 | 2903 |
| BRHIP20115080 | 461 | 762..1751 | 2904 |
| BRHIP20115760 | 462 | 877..1182 | 2905 |
| BRHIP20118380 | 463 | 2..316 | 2906 |
| BRHIP20118910 | 464 | 82..426 | 2907 |
| BRHIP20119330 | 465 | 420..2564 | 2908 |
| BRHIP20121410 | 466 | 68..505 | 2909 |
| BRHIP20123140 | 467 | 73..432 | 2910 |
| BRHIP20129720 | 468 | 934..1809 | 2911 |
| BRHIP20132860 | 469 | 1..897 | 2912 |
| BRHIP20135100 | 470 | 423..743 | 2913 |
| BRHIP20137230 | 471 | 71..1180 | 2914 |
| BRHIP20139720 | 472 | 33..3254 | 2915 |
| BRHIP20140630 | 473 | 3521..3922 | 2916 |
| BRHIP20142850 | 474 | 259..612 | 2917 |
| BRHIP20143730 | 475 | 229..1638 | 2918 |
| BRHIP20143860 | 476 | 1159..1638 | 2919 |
| BRHIP20149540 | 477 | 155..544 | 2920 |
| BRHIP20153560 | 478 | 1134..1445 | 2921 |
| BRHIP20153600 | 479 | 40..675 | 2922 |
| BRHIP20167880 | 480 | 183..656 | 2923 |
| BRHIP20169680 | 481 | 27..347 | 2924 |
| BRHIP20169900 | 482 | 68..502 | 2925 |
| BRHIP20170100 | 483 | 166..936 | 2926 |
| BRHIP20173150 | 484 | 494..820 | 2927 |
| BRHIP20174040 | 485 | 71..2923 | 2928 |
| BRHIP20175420 | 486 | 3..872 | 2929 |
| BRHIP20176420 | 487 | 914..1756 | 2930 |
| BRHIP20179200 | 488 | 2532..2870 | 2931 |
| BRHIP20180140 | 489 | 1028..1345 | 2932 |
| BRHIP20183690 | 490 | 148..1620 | 2933 |
| BRHIP20186120 | 491 | 322..723 | 2934 |
| BRHIP20186500 | 492 | 3089..3727 | 2935 |
| BRHIP20189980 | 493 | 247..1002 | 2936 |
| BRHIP20190070 | 494 | 65..433 | 2937 |
| BRHIP20191490 | 495 | 1929..2270 | 2938 |
| BRHIP20191770 | 496 | 191..502 | 2939 |
| BRHIP20191860 | 497 | 282..2084 | 2940 |
| BRHIP20194940 | 498 | 119..1312 | 2941 |
| BRHIP20195890 | 499 | 1002..1376 | 2942 |
| BRHIP20196410 | 500 | 2371..2706 | 2943 |
| BRHIP20198190 | 501 | 2979..3407 | 2944 |
| BRHIP20205090 | 502 | 270..593 | 2945 |
| BRHIP20207430 | 503 | 370..687 | 2946 |
| BRHIP20207990 | 504 | 90..1628 | 2947 |
| BRHIP20208270 | 505 | 967..1353 | 2948 |
| BRHIP20208420 | 506 | 103..462 | 2949 |
| BRHIP20208590 | 507 | 212..607 | 2950 |
| BRHIP20214950 | 508 | 1637..2020 | 2951 |
| BRHIP20217620 | 509 | 2731..3087 | 2952 |
| BRHIP20218580 | 510 | 1930..2589 | 2953 |
| BRHIP20222280 | 511 | 269..1768 | 2954 |
| BRHIP20227080 | 512 | 1613..2011 | 2955 |
| BRHIP20230710 | 513 | 198..554 | 2956 |
| BRHIP20232290 | 514 | 110..502 | 2957 |
| BRHIP20233090 | 515 | 1782..2105 | 2958 |
| BRHIP20234380 | 516 | 15..1079 | 2959 |
| BRHIP20236950 | 517 | 29..>2580 | 2960 |
| BRHIP20238600 | 518 | 154..729 | 2961 |
| BRHIP20238690 | 519 | 51..383 | 2962 |
| BRHIP20238880 | 520 | 13..2625 | 2963 |
| BRHIP20240460 | 521 | 2151..2540 | 2964 |
| BRHIP20243470 | 522 | 2929..3579 | 2965 |
| BRHIP20249110 | 523 | 134..2887 | 2966 |
| BRHIP20252450 | 524 | 123..>3738 | 2967 |
| BRHIP20253660 | 525 | 255..1031 | 2968 |
| BRHIP20254480 | 526 | 362..994 | 2969 |
| BRHIP20277620 | 527 | 124..1074 | 2970 |
| BRHIP20283030 | 528 | 219..4088 | 2971 |
| BRHIP20284800 | 529 | 217..606 | 2972 |
| BRHIP20285830 | 530 | 611..1321 | 2973 |
| BRHIP20285930 | 531 | 105..779 | 2974 |
| BRHIP30001110 | 532 | 1740..2294 | 2975 |
| BRHIP30004570 | 533 | 189..1034 | 2976 |
| BRHIP30004880 | 534 | 191..2902 | 2977 |
| BRSSN10000920 | 535 | 1850..2215 | 2978 |
| BRSSN20003120 | 536 | 359..>2933 | 2979 |
| BRSSN20006340 | 537 | 937..1401 | 2980 |
| BRSSN20013420 | 538 | 111..2741 | 2981 |
| BRSSN20014260 | 539 | 167..1069 | 2982 |
| BRSSN20015030 | 540 | 105..458 | 2983 |
| BRSSN20015790 | 541 | 542..1639 | 2984 |
| BRSSN20018690 | 542 | 110..463 | 2985 |
| BRSSN20021600 | 543 | 13..1497 | 2986 |
| BRSSN20028570 | 544 | 424..726 | 2987 |
| BRSSN20038200 | 545 | 86..1555 | 2988 |
| BRSSN20038410 | 546 | 187..852 | 2989 |
| BRSSN20039370 | 547 | 900..1628 | 2990 |
| BRSSN20043040 | 548 | 1959..2342 | 2991 |
| BRSSN20046570 | 549 | 18..368 | 2992 |
| BRSSN20046790 | 550 | 253..1014 | 2993 |
| BRSSN20046860 | 551 | 406..1461 | 2994 |
| BRSSN20066110 | 552 | 725..1165 | 2995 |
| BRSSN20097020 | 553 | 1352..2092 | 2996 |
| BRSSN20101100 | 554 | 1851..2330 | 2997 |
| BRSSN20105870 | 555 | 8..3064 | 2998 |
| BRSSN20105960 | 556 | 183..497 | 2999 |
| BRSSN20108300 | 557 | 92..415 | 3000 |
| BRSSN20117990 | 558 | 733..1428 | 3001 |
| BRSSN20120810 | 559 | 770..1687 | 3002 |
| BRSSN20121030 | 560 | 18..890 | 3003 |
| BRSSN20137020 | 561 | 1097..1429 | 3004 |
| BRSSN20142940 | 562 | 1411..1803 | 3005 |
| BRSSN20146100 | 563 | 181..2376 | 3006 |
| BRSSN20151990 | 564 | 15..401 | 3007 |
| BRSSN20152380 | 565 | 17..418 | 3008 |
| BRSSN20159070 | 566 | 393..728 | 3009 |
| BRSSN20159820 | 567 | 867..1661 | 3010 |
| BRSSN20169050 | 568 | 118..636 | 3011 |
| BRSSN20176820 | 569 | 13..1917 | 3012 |
| BRSSN20177570 | 570 | 303..2651 | 3013 |
| BRSSN20187310 | 571 | 163..1332 | 3014 |
| BRSTN10000830 | 572 | 216..959 | 3015 |
| BRSTN20000580 | 573 | 617..1672 | 3016 |
| BRSTN20002200 | 574 | 159..515 | 3017 |
| BRSTN20005360 | 575 | 43..1173 | 3018 |
| BRTHA20000570 | 576 | 641..988 | 3019 |
| BRTHA20004740 | 577 | 192..1082 | 3020 |
| BRTHA20046290 | 578 | 1657..2298 | 3021 |
| BRTHA20046390 | 579 | 191..571 | 3022 |
| BRTHA20046420 | 580 | 446..835 | 3023 |
| CD34C30001250 | 581 | 59..>3188 | 3024 |
| CD34C30003140 | 582 | 458..2803 | 3025 |
| CD34C30004240 | 583 | 430..1290 | 3026 |
| CD34C30004940 | 584 | 970..1299 | 3027 |
| COLON10001350 | 585 | 18..1544 | 3028 |
| COLON20043180 | 586 | 451..867 | 3029 |
| COLON20093370 | 587 | 1261..1779 | 3030 |
| CTONG10000100 | 588 | 90..1118 | 3031 |
| CTONG10000220 | 589 | 191..847 | 3032 |
| CTONG10000620 | 590 | 94..2943 | 3033 |
| CTONG10000930 | 591 | 18..2621 | 3034 |
| CTONG10000940 | 592 | 182..868 | 3035 |
| CTONG10001650 | 593 | 1916..2512 | 3036 |
| CTONG10002770 | 594 | 182..>3049 | 3037 |
| CTONG20002180 | 595 | 90..554 | 3038 |
| CTONG20004690 | 596 | 301..885 | 3039 |
| CTONG20009770 | 597 | 321..3287 | 3040 |
| CTONG20014280 | 598 | 176..1723 | 3041 |
| CTONG20027090 | 599 | 280..2370 | 3042 |
| CTONG20028410 | 600 | 600..2936 | 3043 |
| CTONG20038890 | 601 | 961..1371 | 3044 |
| CTONG20049410 | 602 | 157..669 | 3045 |
| CTONG20050280 | 603 | 157..1944 | 3046 |
| CTONG20052650 | 604 | 1210..1647 | 3047 |
| CTONG20052900 | 605 | 130..1548 | 3048 |
| CTONG20075860 | 606 | 63..1391 | 3049 |
| CTONG20076130 | 607 | 11..994 | 3050 |
| CTONG20077790 | 608 | 270..635 | 3051 |
| CTONG20082690 | 609 | 75..896 | 3052 |
| CTONG20085950 | 610 | 905..2125 | 3053 |
| CTONG20091080 | 611 | 166..717 | 3054 |
| CTONG20091320 | 612 | 1223..1627 | 3055 |
| CTONG20092570 | 613 | 690..1601 | 3056 |
| CTONG20092580 | 614 | 1555..1920 | 3057 |
| CTONG20092680 | 615 | 365..823 | 3058 |
| CTONG20092700 | 616 | 224..928 | 3059 |
| CTONG20093950 | 617 | 205..2388 | 3060 |
| CTONG20095270 | 618 | 1147..1611 | 3061 |
| CTONG20095290 | 619 | 312..749 | 3062 |
| CTONG20095340 | 620 | 109..2631 | 3063 |
| CTONG20096430 | 621 | 311..1384 | 3064 |
| CTONG20096750 | 622 | 738..1184 | 3065 |
| CTONG20097660 | 623 | 133..876 | 3066 |
| CTONG20098440 | 624 | 206..1132 | 3067 |
| CTONG20099380 | 625 | 1417..1806 | 3068 |
| CTONG20099550 | 626 | 74..1939 | 3069 |
| CTONG20099630 | 627 | 99..2060 | 3070 |
| CTONG20100240 | 628 | 620..2155 | 3071 |
| CTONG20101480 | 629 | 13..411 | 3072 |
| CTONG20103480 | 630 | 30..356 | 3073 |
| CTONG20105080 | 631 | 28..1260 | 3074 |
| CTONG20105660 | 632 | 75..674 | 3075 |
| CTONG20106230 | 633 | 2015..>3067 | 3076 |
| CTONG20106520 | 634 | 1693..3147 | 3077 |
| CTONG20108210 | 635 | 234..1319 | 3078 |
| CTONG20114290 | 636 | 388..3225 | 3079 |
| CTONG20114740 | 637 | 1191..1832 | 3080 |
| CTONG20118150 | 638 | 144..2831 | 3081 |
| CTONG20118250 | 639 | 52..840 | 3082 |
| CTONG20119200 | 640 | 2128..2637 | 3083 |
| CTONG20120770 | 641 | 2946..3341 | 3084 |
| CTONG20121010 | 642 | 143..1732 | 3085 |
| CTONG20121580 | 643 | 97..>2930 | 3086 |
| CTONG20124010 | 644 | 206..1369 | 3087 |
| CTONG20124220 | 645 | 177..2477 | 3088 |
| CTONG20124470 | 646 | 701..1237 | 3089 |
| CTONG20124730 | 647 | 894..1280 | 3090 |
| CTONG20125540 | 648 | 616..1071 | 3091 |
| CTONG20125640 | 649 | 756..1688 | 3092 |
| CTONG20126070 | 650 | 42..2843 | 3093 |
| CTONG20127450 | 651 | 2271..2624 | 3094 |
| CTONG20128430 | 652 | 330..2180 | 3095 |
| CTONG20128470 | 653 | 916..1479 | 3096 |
| CTONG20129960 | 654 | 118..3249 | 3097 |
| CTONG20131490 | 655 | 1191..1553 | 3098 |
| CTONG20131560 | 656 | 242..>2879 | 3099 |
| CTONG20132220 | 657 | 1155..1598 | 3100 |
| CTONG20133390 | 658 | 679..2304 | 3101 |
| CTONG20133480 | 659 | 86..391 | 3102 |
| CTONG20133520 | 660 | 128..2140 | 3103 |
| CTONG20136300 | 661 | 1078..1521 | 3104 |
| CTONG20138030 | 662 | 3061..3396 | 3105 |
| CTONG20139070 | 663 | 2508..2819 | 3106 |
| CTONG20139340 | 664 | 1182..1535 | 3107 |
| CTONG20139860 | 665 | 28..2169 | 3108 |
| CTONG20140320 | 666 | 2454..2786 | 3109 |
| CTONG20140580 | 667 | 74..1180 | 3110 |
| CTONG20141650 | 668 | 190..570 | 3111 |
| CTONG20143690 | 669 | 169..2583 | 3112 |
| CTONG20146300 | 670 | 1195..1674 | 3113 |
| CTONG20146970 | 671 | 1201..1536 | 3114 |
| CTONG20147050 | 672 | 1304..1648 | 3115 |
| CTONG20149460 | 673 | 149..1942 | 3116 |
| CTONG20149950 | 674 | 42..371 | 3117 |
| CTONG20150910 | 675 | 792..1130 | 3118 |
| CTONG20153300 | 676 | 755..2338 | 3119 |
| CTONG20153580 | 677 | 488..1858 | 3120 |
| CTONG20155180 | 678 | 486..>3005 | 3121 |
| CTONG20155400 | 679 | 1940..2458 | 3122 |
| CTONG20156780 | 680 | 33..3104 | 3123 |
| CTONG20158040 | 681 | 152..1297 | 3124 |
| CTONG20158150 | 682 | 66..2057 | 3125 |
| CTONG20158660 | 683 | 171..2258 | 3126 |
| CTONG20159530 | 684 | 231..1094 | 3127 |
| CTONG20160560 | 685 | 79..>2796 | 3128 |
| CTONG20161850 | 686 | 27..734 | 3129 |
| CTONG20162170 | 687 | 156..734 | 3130 |
| CTONG20163550 | 688 | 772..1134 | 3131 |
| CTONG20164990 | 689 | 1343..1753 | 3132 |
| CTONG20165050 | 690 | 1575..2018 | 3133 |
| CTONG20186320 | 691 | 78..1595 | 3134 |
| CTONG20200310 | 692 | 2..2254 | 3135 |
| CTONG20265130 | 693 | 419..892 | 3136 |
| CTONG20267700 | 694 | 2046..2432 | 3137 |
| CTONG20273610 | 695 | 513..923 | 3138 |
| D3OST10001090 | 696 | 50..1462 | 3139 |
| D3OST10002670 | 697 | 77..853 | 3140 |
| D3OST10002700 | 698 | 84..461 | 3141 |
| D3OST20006180 | 699 | 148..2259 | 3142 |
| D3OST20006540 | 700 | 140..442 | 3143 |
| D3OST20007340 | 701 | 369..1220 | 3144 |
| D3OST20013280 | 702 | 756..1118 | 3145 |
| D3OST20024170 | 703 | 1373..1714 | 3146 |
| D3OST20024360 | 704 | 1984..2361 | 3147 |
| D3OST20024520 | 705 | 3..422 | 3148 |
| D3OST20036070 | 706 | 122..1039 | 3149 |
| D3OST20037970 | 707 | 256..735 | 3150 |
| D3OST20038560 | 708 | 1976..2350 | 3151 |
| D3OST30002580 | 709 | 1509..2957 | 3152 |
| D3OST30002910 | 710 | 1811..2248 | 3153 |
| D6OST20003580 | 711 | 1760..2167 | 3154 |
| D6OST20004450 | 712 | 1513..2547 | 3155 |
| D6OST20005070 | 713 | 2835..3398 | 3156 |
| D9OST20000310 | 714 | 239..637 | 3157 |
| D9OST20002780 | 715 | 644..1360 | 3158 |
| D9OST20015470 | 716 | 187..1386 | 3159 |
| D9OST20023970 | 717 | 872..1327 | 3160 |
| D9OST20026730 | 718 | 145..3159 | 3161 |
| D9OST20031370 | 719 | 616..1251 | 3162 |
| D9OST20033970 | 720 | 24..1181 | 3163 |
| D9OST20035800 | 721 | 524..1057 | 3164 |
| D9OST20035940 | 722 | 217..867 | 3165 |
| D9OST20040180 | 723 | 189..1127 | 3166 |
| DFNES10000030 | 724 | 897..1322 | 3167 |
| DFNES10001850 | 725 | 471..899 | 3168 |
| DFNES20001530 | 726 | 26..382 | 3169 |
| DFNES20010910 | 727 | 159..1136 | 3170 |
| DFNES20014040 | 728 | 148..1272 | 3171 |
| DFNES20025880 | 729 | 1080..1415 | 3172 |
| DFNES20031920 | 730 | 631..1104 | 3173 |
| DFNES20037420 | 731 | 186..2090 | 3174 |
| DFNES20055270 | 732 | 159..818 | 3175 |
| DFNES20071130 | 733 | 248..1156 | 3176 |
| DFNES20082800 | 734 | 258..698 | 3177 |
| FCBBF10000240 | 735 | 507..2942 | 3178 |
| FCBBF10000380 | 736 | 1024..1344 | 3179 |
| FCBBF10000630 | 737 | 533..1654 | 3180 |
| FCBBF10000770 | 738 | 56..1810 | 3181 |
| FCBBF10001150 | 739 | 351..2555 | 3182 |
| FCBBF10001210 | 740 | 38..1066 | 3183 |
| FCBBF10001550 | 741 | 60..653 | 3184 |
| FCBBF10001710 | 742 | 322..2133 | 3185 |
| FCBBF10001820 | 743 | 10..1032 | 3186 |
| FCBBF10002430 | 744 | 349..1158 | 3187 |
| FCBBF10002700 | 745 | 189..551 | 3188 |
| FCBBF10002800 | 746 | 485..2818 | 3189 |
| FCBBF10003220 | 747 | 479..832 | 3190 |
| FCBBF10003670 | 748 | 139..1266 | 3191 |
| FCBBF10003740 | 749 | 407..2365 | 3192 |
| FCBBF10003760 | 750 | 1044..1358 | 3193 |
| FCBBF10003770 | 751 | 242..>3001 | 3194 |
| FCBBF10004120 | 752 | 142..816 | 3195 |
| FCBBF10004370 | 753 | 432..1511 | 3196 |
| FCBBF10005060 | 754 | 1340..2323 | 3197 |
| FCBBF10005460 | 755 | 179..2092 | 3198 |
| FCBBF10005500 | 756 | 1518..2123 | 3199 |
| FCBBF10005740 | 757 | 954..1667 | 3200 |
| FCBBF20006780 | 758 | 356..679 | 3201 |
| FCBBF20014270 | 759 | 49..315 | 3202 |
| FCBBF20023700 | 760 | 251..589 | 3203 |
| FCBBF20032970 | 761 | 845..1186 | 3204 |
| FCBBF20035280 | 762 | 13..393 | 3205 |
| FCBBF20042170 | 763 | 186..1337 | 3206 |
| FCBBF20042560 | 764 | 115..576 | 3207 |
| FCBBF20049300 | 765 | 32..631 | 3208 |
| FCBBF20051220 | 766 | 523..948 | 3209 |
| FCBBF20054280 | 767 | 119..535 | 3210 |
| FCBBF20056370 | 768 | 57..704 | 3211 |
| FCBBF20059090 | 769 | 928..1245 | 3212 |
| FCBBF20064520 | 770 | 368..1243 | 3213 |
| FCBBF20067810 | 771 | 68..1231 | 3214 |
| FCBBF20068820 | 772 | 74..712 | 3215 |
| FCBBF20071860 | 773 | 384..911 | 3216 |
| FCBBF20072650 | 774 | 1471..1944 | 3217 |
| FCBBF20075560 | 775 | 730..1086 | 3218 |
| FCBBF20076330 | 776 | 684..998 | 3219 |
| FCBBF30001840 | 777 | 1503..1832 | 3220 |
| FCBBF30007680 | 778 | 9..2117 | 3221 |
| FCBBF30008470 | 779 | 1157..1504 | 3222 |
| FCBBF30010810 | 780 | 149..1483 | 3223 |
| FCBBF30012350 | 781 | 419..1507 | 3224 |
| FCBBF30012810 | 782 | 372..>2409 | 3225 |
| FCBBF30013770 | 783 | 375..2795 | 3226 |
| FCBBF30015940 | 784 | 24..>2507 | 3227 |
| FCBBF30016320 | 785 | 990..1877 | 3228 |
| FCBBF30016570 | 786 | 574..999 | 3229 |
| FCBBF30018550 | 787 | 231..>3402 | 3230 |
| FCBBF30019120 | 788 | 54..398 | 3231 |
| FCBBF30024750 | 789 | 126..560 | 3232 |
| FCBBF30025560 | 790 | 171..1301 | 3233 |
| FCBBF30028180 | 791 | 258..830 | 3234 |
| FCBBF30033050 | 792 | 7..1089 | 3235 |
| FCBBF30039020 | 793 | 955..2727 | 3236 |
| FCBBF30049550 | 794 | 222..>4213 | 3237 |
| FCBBF30052180 | 795 | 2829..4214 | 3238 |
| FCBBF30054440 | 796 | 33..2822 | 3239 |
| FCBBF30057290 | 797 | 143..2068 | 3240 |
| FCBBF30062880 | 798 | 1135..>3256 | 3241 |
| FCBBF30070770 | 799 | 1049..2113 | 3242 |
| FCBBF30071520 | 800 | 280..735 | 3243 |
| FCBBF30078290 | 801 | 280..1875 | 3244 |
| FCBBF30083620 | 802 | 125..1159 | 3245 |
| FCBBF30083820 | 803 | 298..774 | 3246 |
| FCBBF30086440 | 804 | 192..863 | 3247 |
| FCBBF30090690 | 805 | 545..1657 | 3248 |
| FCBBF30095260 | 806 | 204..686 | 3249 |
| FCBBF30123470 | 807 | 1084..1614 | 3250 |
| FCBBF30129630 | 808 | 257..973 | 3251 |
| FCBBF30170590 | 809 | 1313..1672 | 3252 |
| FCBBF30172550 | 810 | 1350..1703 | 3253 |
| FCBBF30175310 | 811 | 120..1280 | 3254 |
| FCBBF30178730 | 812 | 348..833 | 3255 |
| FCBBF30189490 | 813 | 1935..2468 | 3256 |
| FCBBF30190850 | 814 | 43..1560 | 3257 |
| FCBBF30195640 | 815 | 577..>2751 | 3258 |
| FCBBF30199610 | 816 | 972..1391 | 3259 |
| FCBBF30215060 | 817 | 42..446 | 3260 |
| FCBBF30225660 | 818 | 231..2750 | 3261 |
| FCBBF30233680 | 819 | 28..>4395 | 3262 |
| FCBBF30238870 | 820 | 587..2761 | 3263 |
| FCBBF30240020 | 821 | 248..1747 | 3264 |
| FCBBF30240960 | 822 | 465..1520 | 3265 |
| FCBBF30242250 | 823 | 271..>2723 | 3266 |
| FCBBF30243640 | 824 | 339..665 | 3267 |
| FCBBF30246230 | 825 | 1893..2357 | 3268 |
| FCBBF30246630 | 826 | 19..2070 | 3269 |
| FCBBF30247930 | 827 | 558..1187 | 3270 |
| FCBBF30250730 | 828 | 116..>2647 | 3271 |
| FCBBF30251420 | 829 | 2590..2904 | 3272 |
| FCBBF30252520 | 830 | 27..380 | 3273 |
| FCBBF30252800 | 831 | 139..1110 | 3274 |
| FCBBF30252850 | 832 | 45..1022 | 3275 |
| FCBBF30262360 | 833 | 51..446 | 3276 |
| FCBBF30262510 | 834 | 36..2327 | 3277 |
| FCBBF30266780 | 835 | 2080..2382 | 3278 |
| FCBBF30266920 | 836 | 5..316 | 3279 |
| FCBBF30278630 | 837 | 492..821 | 3280 |
| FCBBF30279030 | 838 | 1653..2447 | 3281 |
| FCBBF30281880 | 839 | 83..2221 | 3282 |
| FCBBF30284720 | 840 | 230..751 | 3283 |
| FCBBF30285280 | 841 | 185..3043 | 3284 |
| FCBBF40001420 | 842 | 364..681 | 3285 |
| FCBBF40001730 | 843 | 105..932 | 3286 |
| FCBBF40005480 | 844 | 119..589 | 3287 |
| FEBRA10001880 | 845 | 494..2236 | 3288 |
| FEBRA10001900 | 846 | 6..389 | 3289 |
| FEBRA20002100 | 847 | 375..1064 | 3290 |
| FEBRA20003210 | 848 | 10..414 | 3291 |
| FEBRA20004620 | 849 | 297..1568 | 3292 |
| FEBRA20007620 | 850 | 61..2400 | 3293 |
| FEBRA20009090 | 851 | 667..1032 | 3294 |
| FEBRA20010120 | 852 | 608..1216 | 3295 |
| FEBRA20017050 | 853 | 1775..2197 | 3296 |
| FEBRA20018280 | 854 | 16..678 | 3297 |
| FEBRA20018690 | 855 | 664..981 | 3298 |
| FEBRA20024100 | 856 | 68..2659 | 3299 |
| FEBRA20025270 | 857 | 116..>2317 | 3300 |
| FEBRA20025520 | 858 | 669..1133 | 3301 |
| FEBRA20026110 | 859 | 233..2692 | 3302 |
| FEBRA20026280 | 860 | 54..623 | 3303 |
| FEBRA20027810 | 861 | 155..2740 | 3304 |
| FEBRA20029860 | 862 | 29..757 | 3305 |
| FEBRA20034360 | 863 | 1288..2013 | 3306 |
| FEBRA20034680 | 864 | 240..1955 | 3307 |
| FEBRA20037260 | 865 | 2376..2702 | 3308 |
| FEBRA20037500 | 866 | 10..1308 | 3309 |
| FEBRA20040530 | 867 | 76..1407 | 3310 |
| FEBRA20042190 | 868 | 1590..1925 | 3311 |
| FEBRA20052910 | 869 | 1136..1486 | 3312 |
| FEBRA20060610 | 870 | 599..1201 | 3313 |
| FEBRA20072120 | 871 | 106..2877 | 3314 |
| FEBRA20079310 | 872 | 2384..2806 | 3315 |
| FEBRA20080810 | 873 | 679..1401 | 3316 |
| FEBRA20082010 | 874 | 106..1779 | 3317 |
| FEBRA20082100 | 875 | 1042..1524 | 3318 |
| FEBRA20086620 | 876 | 215..1591 | 3319 |
| FEBRA20088360 | 877 | 2964..3521 | 3320 |
| FEBRA20090290 | 878 | 383..823 | 3321 |
| FEBRA20092890 | 879 | 198..2297 | 3322 |
| FEBRA20093520 | 880 | 651..1070 | 3323 |
| FEBRA20095140 | 881 | 264..>2245 | 3324 |
| FEBRA20095880 | 882 | 1872..2186 | 3325 |
| FEBRA20097310 | 883 | 74..2101 | 3326 |
| FEBRA20098460 | 884 | 291..686 | 3327 |
| FEBRA20111460 | 885 | 859..1221 | 3328 |
| FEBRA20113560 | 886 | 22..558 | 3329 |
| FEBRA20125070 | 887 | 10..1002 | 3330 |
| FEBRA20130190 | 888 | 131..1192 | 3331 |
| FEBRA20132740 | 889 | 770..1111 | 3332 |
| FEBRA20140100 | 890 | 1664..2377 | 3333 |
| FEBRA20144170 | 891 | 342..1976 | 3334 |
| FEBRA20145780 | 892 | 1262..1564 | 3335 |
| FEBRA20161120 | 893 | 173..484 | 3336 |
| FEBRA20166540 | 894 | 101..511 | 3337 |
| FEBRA20167390 | 895 | 429..869 | 3338 |
| FEBRA20171380 | 896 | 338..2002 | 3339 |
| FEBRA20174410 | 897 | 125..2029 | 3340 |
| FEBRA20176800 | 898 | 1320..1877 | 3341 |
| FEBRA20184330 | 899 | 36..533 | 3342 |
| FEBRA20192420 | 900 | 2120..3799 | 3343 |
| FEBRA20195820 | 901 | 175..678 | 3344 |
| FEBRA20196370 | 902 | 353..2032 | 3345 |
| FEBRA20196630 | 903 | 482..2359 | 3346 |
| FEBRA20197110 | 904 | 632..1222 | 3347 |
| FEBRA20204000 | 905 | 1958..2482 | 3348 |
| FEBRA20204060 | 906 | 366..728 | 3349 |
| FEBRA20211710 | 907 | 282..929 | 3350 |
| FEBRA20214970 | 908 | 620..1264 | 3351 |
| FEBRA20215500 | 909 | 726..1256 | 3352 |
| FEBRA20216360 | 910 | 1398..1904 | 3353 |
| FEBRA20222040 | 911 | 954..1391 | 3354 |
| FEBRA20223220 | 912 | 1254..1898 | 3355 |
| FEBRA20225040 | 913 | 13..1692 | 3356 |
| FEBRA20226010 | 914 | 1439..1933 | 3357 |
| FEBRA20229560 | 915 | 37..381 | 3358 |
| FEBRA20229630 | 916 | 184..987 | 3359 |
| FEBRA20232850 | 917 | 774..1193 | 3360 |
| FEBRA20233770 | 918 | 64..636 | 3361 |
| FEBRA20235500 | 919 | 1206..>2520 | 3362 |
| FEBRA20237640 | 920 | 331..933 | 3363 |
| FEHRT20003250 | 921 | 173..1243 | 3364 |
| FELNG20002410 | 922 | 1257..1577 | 3365 |
| HCASM10000500 | 923 | 300..1754 | 3366 |
| HCHON10001760 | 924 | 238..1182 | 3367 |
| HCHON20000380 | 925 | 210..644 | 3368 |
| HCHON20001560 | 926 | 565..1611 | 3369 |
| HCHON20002260 | 927 | 694..1389 | 3370 |
| HCHON20003220 | 928 | 23..>2278 | 3371 |
| HCHON20003440 | 929 | 1982..>2519 | 3372 |
| HCHON20007380 | 930 | 163..1248 | 3373 |
| HCHON20007510 | 931 | 189..2636 | 3374 |
| HCHON20008150 | 932 | 204..>2358 | 3375 |
| HCHON20008180 | 933 | 671..1087 | 3376 |
| HCHON20008320 | 934 | 1240..>2284 | 3377 |
| HCHON20008980 | 935 | 578..904 | 3378 |
| HCHON20009350 | 936 | 63..422 | 3379 |
| HCHON20009560 | 937 | 1644..2489 | 3380 |
| HCHON20010990 | 938 | 531..1085 | 3381 |
| HCHON20011160 | 939 | 839..1156 | 3382 |
| HCHON20014970 | 940 | 302..2143 | 3383 |
| HCHON20015230 | 941 | 950..1453 | 3384 |
| HCHON20015350 | 942 | 647..>2887 | 3385 |
| HCHON20015980 | 943 | 100..1413 | 3386 |
| HCHON20016040 | 944 | 3..323 | 3387 |
| HCHON20016650 | 945 | 44..3418 | 3388 |
| HCHON20022470 | 946 | 1526..1978 | 3389 |
| HCHON20035130 | 947 | 1192..1614 | 3390 |
| HCHON20036420 | 948 | 356..811 | 3391 |
| HCHON20036760 | 949 | 228..647 | 3392 |
| HCHON20040020 | 950 | 257..1288 | 3393 |
| HCHON20043590 | 951 | 263..712 | 3394 |
| HCHON20059870 | 952 | 198..2297 | 3395 |
| HCHON20064590 | 953 | 66..2063 | 3396 |
| HCHON20067220 | 954 | 313..642 | 3397 |
| HCHON20067700 | 955 | 160..591 | 3398 |
| HCHON20068410 | 956 | 116..>2811 | 3399 |
| HCHON20068710 | 957 | 335..688 | 3400 |
| HCHON20074820 | 958 | 19..735 | 3401 |
| HCHON20076500 | 959 | 1778..2473 | 3402 |
| HCHON20086720 | 960 | 133..864 | 3403 |
| HCHON20097490 | 961 | 1434..2819 | 3404 |
| HCHON20100740 | 962 | 138..1277 | 3405 |
| HEART20003060 | 963 | 109..1407 | 3406 |
| HEART20005410 | 964 | 302..784 | 3407 |
| HEART20017730 | 965 | 19..2064 | 3408 |
| HEART20021840 | 966 | 22..507 | 3409 |
| HEART20025980 | 967 | 293..1180 | 3410 |
| HEART20034320 | 968 | 31..2013 | 3411 |
| HEART20037810 | 969 | 803..1108 | 3412 |
| HEART20049400 | 970 | 178..549 | 3413 |
| HEART20049410 | 971 | 44..613 | 3414 |
| HEART20049800 | 972 | 15..509 | 3415 |
| HEART20061950 | 973 | 153..1961 | 3416 |
| HEART20063340 | 974 | 220..1281 | 3417 |
| HEART20067870 | 975 | 256..855 | 3418 |
| HEART20067890 | 976 | 3..338 | 3419 |
| HEART20072310 | 977 | 47..1057 | 3420 |
| HEART20074430 | 978 | 205..540 | 3421 |
| HEART20077670 | 979 | 90..1223 | 3422 |
| HEART20083640 | 980 | 192..1376 | 3423 |
| HEART20089940 | 981 | 150..1523 | 3424 |
| HEART20090000 | 982 | 197..2116 | 3425 |
| HEART20095990 | 983 | 523..1077 | 3426 |
| HHDPC10000650 | 984 | 920..1531 | 3427 |
| HHDPC10000830 | 985 | 110..520 | 3428 |
| HHDPC20001040 | 986 | 2080..2442 | 3429 |
| HHDPC20006920 | 987 | 1758..2066 | 3430 |
| HHDPC20014320 | 988 | 5..526 | 3431 |
| HHDPC20030490 | 989 | 71..529 | 3432 |
| HHDPC20031130 | 990 | 369..2249 | 3433 |
| HHDPC20034390 | 991 | 94..705 | 3434 |
| HHDPC20034720 | 992 | 167..868 | 3435 |
| HHDPC20057420 | 993 | 44..484 | 3436 |
| HHDPC20057940 | 994 | 1..393 | 3437 |
| HHDPC20064600 | 995 | 231..1493 | 3438 |
| HHDPC20068620 | 996 | 515..1816 | 3439 |
| HHDPC20084140 | 997 | 163..2109 | 3440 |
| HHDPC20091140 | 998 | 160..504 | 3441 |
| HHDPC20091780 | 999 | 49..1623 | 3442 |
| HHDPC20092080 | 1000 | 133..702 | 3443 |
| HHDPC20095280 | 1001 | 332..745 | 3444 |
| HLUNG10000550 | 1002 | 729..1058 | 3445 |
| HLUNG20016330 | 1003 | 86..>1958 | 3446 |
| HLUNG20016770 | 1004 | 919..1242 | 3447 |
| HLUNG20017120 | 1005 | 644..1144 | 3448 |
| HLUNG20023340 | 1006 | 228..1181 | 3449 |
| HLUNG20033780 | 1007 | 156..2285 | 3450 |
| HLUNG20084390 | 1008 | 542..997 | 3451 |
| IMR3220002430 | 1009 | 34..1176 | 3452 |
| KIDNE20002520 | 1010 | 22..1593 | 3453 |
| KIDNE20003940 | 1011 | 187..1986 | 3454 |
| KIDNE20006780 | 1012 | 164..829 | 3455 |
| KIDNE20007210 | 1013 | 27..350 | 3456 |
| KIDNE20007770 | 1014 | 27..1415 | 3457 |
| KIDNE20008010 | 1015 | 127..>1986 | 3458 |
| KIDNE20009470 | 1016 | 9..>2664 | 3459 |
| KIDNE20011170 | 1017 | 347..817 | 3460 |
| KIDNE20011400 | 1018 | 1798..2334 | 3461 |
| KIDNE20013730 | 1019 | 373..777 | 3462 |
| KIDNE20017130 | 1020 | 226..1740 | 3463 |
| KIDNE20018730 | 1021 | 35..631 | 3464 |
| KIDNE20018970 | 1022 | 232..546 | 3465 |
| KIDNE20020150 | 1023 | 215..1645 | 3466 |
| KIDNE20021680 | 1024 | 140..1096 | 3467 |
| KIDNE20021910 | 1025 | 15..2018 | 3468 |
| KIDNE20021980 | 1026 | 1578..1910 | 3469 |
| KIDNE20022620 | 1027 | 112..2277 | 3470 |
| KIDNE20024830 | 1028 | 1912..>2715 | 3471 |
| KIDNE20027250 | 1029 | 359..955 | 3472 |
| KIDNE20027950 | 1030 | 97..543 | 3473 |
| KIDNE20028390 | 1031 | 31..519 | 3474 |
| KIDNE20028720 | 1032 | 70..1122 | 3475 |
| KIDNE20028830 | 1033 | 107..1258 | 3476 |
| KIDNE20029800 | 1034 | 1056..1358 | 3477 |
| KIDNE20067330 | 1035 | 930..1865 | 3478 |
| KIDNE20079440 | 1036 | 192..539 | 3479 |
| KIDNE20096280 | 1037 | 266..1354 | 3480 |
| KIDNE20096470 | 1038 | 31..639 | 3481 |
| KIDNE20100070 | 1039 | 471..2204 | 3482 |
| KIDNE20100840 | 1040 | 167..778 | 3483 |
| KIDNE20101370 | 1041 | 9..503 | 3484 |
| KIDNE20101510 | 1042 | 62..1795 | 3485 |
| KIDNE20102650 | 1043 | 322..1614 | 3486 |
| KIDNE20102710 | 1044 | 791..1501 | 3487 |
| KIDNE20104300 | 1045 | 188..>1957 | 3488 |
| KIDNE20106740 | 1046 | 55..411 | 3489 |
| KIDNE20107390 | 1047 | 85..399 | 3490 |
| KIDNE20107500 | 1048 | 180..641 | 3491 |
| KIDNE20107620 | 1049 | 222..2213 | 3492 |
| KIDNE20109730 | 1050 | 57..1121 | 3493 |
| KIDNE20109890 | 1051 | 254..>2578 | 3494 |
| KIDNE20112000 | 1052 | 430..750 | 3495 |
| KIDNE20115080 | 1053 | 76..1092 | 3496 |
| KIDNE20118580 | 1054 | 962..1387 | 3497 |
| KIDNE20120090 | 1055 | 1334..1813 | 3498 |
| KIDNE20121880 | 1056 | 192..866 | 3499 |
| KIDNE20122910 | 1057 | 1623..2006 | 3500 |
| KIDNE20124400 | 1058 | 532..2499 | 3501 |
| KIDNE20125630 | 1059 | 67..504 | 3502 |
| KIDNE20126010 | 1060 | 991..1407 | 3503 |
| KIDNE20126130 | 1061 | 285..701 | 3504 |
| KIDNE20127100 | 1062 | 265..1944 | 3505 |
| KIDNE20127450 | 1063 | 570..1088 | 3506 |
| KIDNE20127750 | 1064 | 175..1488 | 3507 |
| KIDNE20130450 | 1065 | 177..512 | 3508 |
| KIDNE20131580 | 1066 | 194..1912 | 3509 |
| KIDNE20132180 | 1067 | 894..1256 | 3510 |
| KIDNE20137340 | 1068 | 889..1710 | 3511 |
| KIDNE20138010 | 1069 | 1564..2046 | 3512 |
| KIDNE20141190 | 1070 | 71..856 | 3513 |
| KIDNE20144890 | 1071 | 385..738 | 3514 |
| KIDNE20148900 | 1072 | 487..981 | 3515 |
| KIDNE20163880 | 1073 | 327..1364 | 3516 |
| KIDNE20180710 | 1074 | 379..855 | 3517 |
| KIDNE20181660 | 1075 | 1109..1564 | 3518 |
| KIDNE20182690 | 1076 | 553..2019 | 3519 |
| KIDNE20186780 | 1077 | 837..1541 | 3520 |
| KIDNE20190740 | 1078 | 321..653 | 3521 |
| LIVER10001260 | 1079 | 1413..1748 | 3522 |
| LIVER10004790 | 1080 | 112..1113 | 3523 |
| LIVER20002160 | 1081 | 79..1944 | 3524 |
| LIVER20011130 | 1082 | 898..1569 | 3525 |
| LIVER20011910 | 1083 | 27..425 | 3526 |
| LIVER20028420 | 1084 | 1305..1724 | 3527 |
| LIVER20035110 | 1085 | 551..940 | 3528 |
| LIVER20035680 | 1086 | 873..1283 | 3529 |
| LIVER20038540 | 1087 | 6..308 | 3530 |
| LIVER20045650 | 1088 | 2359..2886 | 3531 |
| LIVER20055200 | 1089 | 82..618 | 3532 |
| LIVER20055440 | 1090 | 1611..2240 | 3533 |
| LIVER20059810 | 1091 | 1597..1899 | 3534 |
| LIVER20062510 | 1092 | 631..999 | 3535 |
| LIVER20064100 | 1093 | 279..785 | 3536 |
| LIVER20064690 | 1094 | 172..1161 | 3537 |
| LIVER20075680 | 1095 | 2568..2939 | 3538 |
| LIVER20080530 | 1096 | 44..1426 | 3539 |
| LIVER20084730 | 1097 | 240..788 | 3540 |
| LIVER20085800 | 1098 | 99..416 | 3541 |
| LIVER20087060 | 1099 | 140..2056 | 3542 |
| LIVER20087510 | 1100 | 478..1200 | 3543 |
| LIVER20091180 | 1101 | 18..374 | 3544 |
| MAMGL10000830 | 1102 | 40..1551 | 3545 |
| MESAN10001260 | 1103 | 80..2137 | 3546 |
| MESAN20004570 | 1104 | 354..>2589 | 3547 |
| MESAN20014500 | 1105 | 78..1976 | 3548 |
| MESAN20025190 | 1106 | 1679..2323 | 3549 |
| MESAN20027090 | 1107 | 144..653 | 3550 |
| MESAN20029400 | 1108 | 210..>2998 | 3551 |
| MESAN20031900 | 1109 | 138..2348 | 3552 |
| MESAN20035290 | 1110 | 99..797 | 3553 |
| MESAN20036460 | 1111 | 1203..1844 | 3554 |
| MESAN20038510 | 1112 | 639..1016 | 3555 |
| MESAN20089360 | 1113 | 386..802 | 3556 |
| MESAN20101140 | 1114 | 250..504 | 3557 |
| MESAN20103120 | 1115 | 143..1201 | 3558 |
| MESAN20106640 | 1116 | 71..712 | 3559 |
| MESAN20115970 | 1117 | 234..644 | 3560 |
| MESAN20121130 | 1118 | 7..942 | 3561 |
| MESAN20125860 | 1119 | 1396..1875 | 3562 |
| MESAN20127350 | 1120 | 297..1724 | 3563 |
| MESAN20130220 | 1121 | 106..1626 | 3564 |
| MESAN20132110 | 1122 | 1363..2433 | 3565 |
| MESAN20136110 | 1123 | 188..1582 | 3566 |
| MESAN20138450 | 1124 | 249..647 | 3567 |
| MESAN20139360 | 1125 | 195..611 | 3568 |
| MESAN20141920 | 1126 | 250..2724 | 3569 |
| MESAN20152770 | 1127 | 64..585 | 3570 |
| MESAN20153910 | 1128 | 141..443 | 3571 |
| MESAN20154010 | 1129 | 24..620 | 3572 |
| MESAN20157080 | 1130 | 1336..1677 | 3573 |
| MESAN20161590 | 1131 | 767..1081 | 3574 |
| MESAN20164090 | 1132 | 273..2471 | 3575 |
| MESAN20171520 | 1133 | 103..774 | 3576 |
| MESAN20174170 | 1134 | 1375..1743 | 3577 |
| MESAN20182090 | 1135 | 5..>2440 | 3578 |
| MESAN20186700 | 1136 | 1333..>3058 | 3579 |
| NESOP10001080 | 1137 | 149..1489 | 3580 |
| NOVAR10000150 | 1138 | 1470..1895 | 3581 |
| NOVAR10000910 | 1139 | 247..1482 | 3582 |
| NOVAR10001020 | 1140 | 136..519 | 3583 |
| NOVAR20000380 | 1141 | 422..844 | 3584 |
| NOVAR20003520 | 1142 | 898..1377 | 3585 |
| NT2NE20003740 | 1143 | 28..555 | 3586 |
| NT2NE20010050 | 1144 | 1240..1725 | 3587 |
| NT2NE20010210 | 1145 | 231..626 | 3588 |
| NT2NE20010400 | 1146 | 923..1546 | 3589 |
| NT2NE20010490 | 1147 | 105..1499 | 3590 |
| NT2NE20015240 | 1148 | 251..646 | 3591 |
| NT2NE20021620 | 1149 | 785..2266 | 3592 |
| NT2NE20043780 | 1150 | 815..1285 | 3593 |
| NT2NE20053580 | 1151 | 9..413 | 3594 |
| NT2NE20068130 | 1152 | 237..1601 | 3595 |
| NT2NE20072200 | 1153 | 94..855 | 3596 |
| NT2NE20074250 | 1154 | 9..377 | 3597 |
| NT2NE20080170 | 1155 | 129..2219 | 3598 |
| NT2NE20089610 | 1156 | 1976..2329 | 3599 |
| NT2NE20089970 | 1157 | 150..488 | 3600 |
| NT2NE20108540 | 1158 | 504..806 | 3601 |
| NT2NE20110360 | 1159 | 44..415 | 3602 |
| NT2NE20118960 | 1160 | 197..2044 | 3603 |
| NT2NE20122430 | 1161 | 1474..2016 | 3604 |
| NT2NE20124480 | 1162 | 135..482 | 3605 |
| NT2NE20125050 | 1163 | 59..1462 | 3606 |
| NT2NE20130190 | 1164 | 728..1438 | 3607 |
| NT2NE20131890 | 1165 | 2276..2611 | 3608 |
| NT2NE20132170 | 1166 | 585..1694 | 3609 |
| NT2NE20142210 | 1167 | 177..2585 | 3610 |
| NT2NE20146810 | 1168 | 387..707 | 3611 |
| NT2NE20152750 | 1169 | 190..726 | 3612 |
| NT2NE20155110 | 1170 | 486..893 | 3613 |
| NT2NE20156260 | 1171 | 286..633 | 3614 |
| NT2NE20157470 | 1172 | 222..1199 | 3615 |
| NT2NE20158600 | 1173 | 348..749 | 3616 |
| NT2NE20159740 | 1174 | 68..664 | 3617 |
| NT2NE20172590 | 1175 | 799..1131 | 3618 |
| NT2NE20174800 | 1176 | 525..860 | 3619 |
| NT2NE20174920 | 1177 | 53..538 | 3620 |
| NT2NE20177520 | 1178 | 636..2108 | 3621 |
| NT2NE20181650 | 1179 | 496..1605 | 3622 |
| NT2NE20183760 | 1180 | 1087..1548 | 3623 |
| NT2NE20184900 | 1181 | 2947..>3371 | 3624 |
| NT2NE20187390 | 1182 | 170..580 | 3625 |
| NT2RI20001330 | 1183 | 84..1901 | 3626 |
| NT2RI20003480 | 1184 | 166..1905 | 3627 |
| NT2RI20005750 | 1185 | 66..1088 | 3628 |
| NT2RI20009870 | 1186 | 127..1053 | 3629 |
| NT2RI20022600 | 1187 | 1040..1621 | 3630 |
| NT2RI20023160 | 1188 | 165..947 | 3631 |
| NT2RI20023590 | 1189 | 666..1058 | 3632 |
| NT2RI20023910 | 1190 | 546..2945 | 3633 |
| NT2RI20025400 | 1191 | 315..902 | 3634 |
| NT2RI20025640 | 1192 | 989..1660 | 3635 |
| NT2RI20028470 | 1193 | 140..1297 | 3636 |
| NT2RI20036670 | 1194 | 334..852 | 3637 |
| NT2RI20040930 | 1195 | 362..1075 | 3638 |
| NT2RI20040990 | 1196 | 124..2169 | 3639 |
| NT2RI20041880 | 1197 | 79..1368 | 3640 |
| NT2RI20046080 | 1198 | 36..824 | 3641 |
| NT2RI20048840 | 1199 | 330..1349 | 3642 |
| NT2RI20050960 | 1200 | 223..1701 | 3643 |
| NT2RI20054050 | 1201 | 172..2154 | 3644 |
| NT2RI20055790 | 1202 | 489..1178 | 3645 |
| NT2RI20056700 | 1203 | 115..1491 | 3646 |
| NT2RI20069730 | 1204 | 607..1209 | 3647 |
| NT2RI20076290 | 1205 | 145..1197 | 3648 |
| NT2RI20086220 | 1206 | 67..1068 | 3649 |
| NT2RI20091730 | 1207 | 113..>2585 | 3650 |
| NT2RI20091940 | 1208 | 699..1181 | 3651 |
| NT2RI20198260 | 1209 | 70..372 | 3652 |
| NT2RI20203900 | 1210 | 176..481 | 3653 |
| NT2RI20207030 | 1211 | 33..1181 | 3654 |
| NT2RI20216250 | 1212 | 812..1312 | 3655 |
| NT2RI20240080 | 1213 | 176..1090 | 3656 |
| NT2RI20244600 | 1214 | 195..1010 | 3657 |
| NT2RI20244960 | 1215 | 161..595 | 3658 |
| NT2RI20250750 | 1216 | 263..1186 | 3659 |
| NT2RI20252550 | 1217 | 927..1622 | 3660 |
| NT2RI20273230 | 1218 | 40..1215 | 3661 |
| NT2RP60000770 | 1219 | 1147..2223 | 3662 |
| NT2RP60000850 | 1220 | 44..>2927 | 3663 |
| NT2RP70010740 | 1221 | 23..466 | 3664 |
| NT2RP70027380 | 1222 | 86..3466 | 3665 |
| NT2RP70032610 | 1223 | 1348..2514 | 3666 |
| NT2RP70036880 | 1224 | 145..1491 | 3667 |
| NT2RP70037240 | 1225 | 221..2002 | 3668 |
| NT2RP70043480 | 1226 | 134..1912 | 3669 |
| NT2RP70044280 | 1227 | 91..1506 | 3670 |
| NT2RP70045590 | 1228 | 29..877 | 3671 |
| NT2RP70056750 | 1229 | 177..3578 | 3672 |
| NT2RP70062230 | 1230 | 310..2748 | 3673 |
| NT2RP70063950 | 1231 | 499..3750 | 3674 |
| NT2RP70072690 | 1232 | 1108..1545 | 3675 |
| NT2RP70075240 | 1233 | 308..814 | 3676 |
| NT2RP70077660 | 1234 | 2025..2441 | 3677 |
| NT2RP70078420 | 1235 | 622..2025 | 3678 |
| NT2RP70080850 | 1236 | 59..4003 | 3679 |
| NT2RP70081610 | 1237 | 41..730 | 3680 |
| NT2RP70085440 | 1238 | 1856..2317 | 3681 |
| NT2RP70102350 | 1239 | 225..1043 | 3682 |
| NT2RP70105210 | 1240 | 132..1880 | 3683 |
| NT2RP70110860 | 1241 | 803..1129 | 3684 |
| NT2RP70111320 | 1242 | 271..627 | 3685 |
| NT2RP70122910 | 1243 | 789..1112 | 3686 |
| NT2RP70125160 | 1244 | 10..624 | 3687 |
| NT2RP70130020 | 1245 | 372..692 | 3688 |
| NT2RP70133740 | 1246 | 109..972 | 3689 |
| NT2RP70134990 | 1247 | 24..392 | 3690 |
| NT2RP70137290 | 1248 | 10..381 | 3691 |
| NT2RP70137640 | 1249 | 315..>2113 | 3692 |
| NT2RP70143480 | 1250 | 482..1177 | 3693 |
| NT2RP70147210 | 1251 | 258..566 | 3694 |
| NT2RP70150800 | 1252 | 32..445 | 3695 |
| NT2RP70157890 | 1253 | 170..1006 | 3696 |
| NT2RP70159960 | 1254 | 308..967 | 3697 |
| NT2RP70169110 | 1255 | 123..485 | 3698 |
| NT2RP70175670 | 1256 | 89..421 | 3699 |
| NT2RP70179710 | 1257 | 94..2604 | 3700 |
| NT2RP70181970 | 1258 | 59..364 | 3701 |
| NT2RP70188020 | 1259 | 380..796 | 3702 |
| NT2RP70188710 | 1260 | 491..1024 | 3703 |
| NT2RP70190640 | 1261 | 72..1880 | 3704 |
| NT2RP70192730 | 1262 | 180..1253 | 3705 |
| NT2RP70194450 | 1263 | 1074..1901 | 3706 |
| NT2RP70195430 | 1264 | 201..1256 | 3707 |
| NT2RP70198350 | 1265 | 131..832 | 3708 |
| NT2RP70203790 | 1266 | 2156..>2479 | 3709 |
| NTONG20009770 | 1267 | 124..1947 | 3710 |
| NTONG20013620 | 1268 | 1798..2325 | 3711 |
| NTONG20015870 | 1269 | 65..1627 | 3712 |
| NTONG20028070 | 1270 | 9..545 | 3713 |
| NTONG20029480 | 1271 | 318..1898 | 3714 |
| NTONG20029700 | 1272 | 242..1693 | 3715 |
| NTONG20046140 | 1273 | 308..1108 | 3716 |
| NTONG20048060 | 1274 | 1488..1961 | 3717 |
| NTONG20049910 | 1275 | 47..679 | 3718 |
| NTONG20050620 | 1276 | 141..521 | 3719 |
| NTONG20050860 | 1277 | 59..877 | 3720 |
| NTONG20051530 | 1278 | 78..1697 | 3721 |
| NTONG20052650 | 1279 | 84..>2351 | 3722 |
| NTONG20056570 | 1280 | 226..1326 | 3723 |
| NTONG20061870 | 1281 | 100..996 | 3724 |
| NTONG20063010 | 1282 | 219..1856 | 3725 |
| NTONG20064400 | 1283 | 11..1330 | 3726 |
| NTONG20064840 | 1284 | 1500..2447 | 3727 |
| NTONG20065010 | 1285 | 156..494 | 3728 |
| NTONG20066460 | 1286 | 121..1458 | 3729 |
| NTONG20067090 | 1287 | 1046..1513 | 3730 |
| NTONG20067830 | 1288 | 17..1006 | 3731 |
| NTONG20070200 | 1289 | 318..1418 | 3732 |
| NTONG20070340 | 1290 | 284..1228 | 3733 |
| NTONG20075220 | 1291 | 242..>2591 | 3734 |
| NTONG20076930 | 1292 | 26..1534 | 3735 |
| NTONG20077560 | 1293 | 241..567 | 3736 |
| NTONG20083650 | 1294 | 242..1711 | 3737 |
| NTONG20088620 | 1295 | 60..>2536 | 3738 |
| NTONG20090600 | 1296 | 517..1134 | 3739 |
| NTONG20090680 | 1297 | 673..1389 | 3740 |
| NTONG20092290 | 1298 | 307..1539 | 3741 |
| NTONG20092330 | 1299 | 229..2235 | 3742 |
| OCBBF10000540 | 1300 | 858..1916 | 3743 |
| OCBBF10001750 | 1301 | 245..1144 | 3744 |
| OCBBF10001850 | 1302 | 419..2233 | 3745 |
| OCBBF20005230 | 1303 | 56..640 | 3746 |
| OCBBF20006770 | 1304 | 29..2275 | 3747 |
| OCBBF20013890 | 1305 | 1978..2289 | 3748 |
| OCBBF20019380 | 1306 | 69..1364 | 3749 |
| OCBBF20019830 | 1307 | 325..1536 | 3750 |
| OCBBF20020150 | 1308 | 2507..2917 | 3751 |
| OCBBF20020830 | 1309 | 92..2869 | 3752 |
| OCBBF20022900 | 1310 | 88..1779 | 3753 |
| OCBBF20023570 | 1311 | 47..1276 | 3754 |
| OCBBF20026630 | 1312 | 18..455 | 3755 |
| OCBBF20028050 | 1313 | 128..1108 | 3756 |
| OCBBF20028650 | 1314 | 706..2286 | 3757 |
| OCBBF20029800 | 1315 | 334..699 | 3758 |
| OCBBF20030280 | 1316 | 263..898 | 3759 |
| OCBBF20030910 | 1317 | 383..1258 | 3760 |
| OCBBF20032460 | 1318 | 347..805 | 3761 |
| OCBBF20035930 | 1319 | 65..895 | 3762 |
| OCBBF20037440 | 1320 | 413..1024 | 3763 |
| OCBBF20039250 | 1321 | 24..821 | 3764 |
| OCBBF20041680 | 1322 | 967..1278 | 3765 |
| OCBBF20045330 | 1323 | 1407..1886 | 3766 |
| OCBBF20046120 | 1324 | 82..1641 | 3767 |
| OCBBF20046470 | 1325 | 400..1137 | 3768 |
| OCBBF20046690 | 1326 | 156..1730 | 3769 |
| OCBBF20047570 | 1327 | 182..577 | 3770 |
| OCBBF20048660 | 1328 | 292..663 | 3771 |
| OCBBF20049300 | 1329 | 721..2553 | 3772 |
| OCBBF20049840 | 1330 | 246..>2607 | 3773 |
| OCBBF20050770 | 1331 | 724..>2679 | 3774 |
| OCBBF20051610 | 1332 | 41..493 | 3775 |
| OCBBF20053430 | 1333 | 586..2478 | 3776 |
| OCBBF20053490 | 1334 | 736..1068 | 3777 |
| OCBBF20053730 | 1335 | 87..2090 | 3778 |
| OCBBF20054200 | 1336 | 315..869 | 3779 |
| OCBBF20054760 | 1337 | 195..1016 | 3780 |
| OCBBF20059560 | 1338 | 224..>3045 | 3781 |
| OCBBF20060300 | 1339 | 1389..2171 | 3782 |
| OCBBF20061720 | 1340 | 711..1139 | 3783 |
| OCBBF20062140 | 1341 | 444..749 | 3784 |
| OCBBF20062410 | 1342 | 1920..2240 | 3785 |
| OCBBF20063320 | 1343 | 145..519 | 3786 |
| OCBBF20066390 | 1344 | 2159..2713 | 3787 |
| OCBBF20068490 | 1345 | 15..2702 | 3788 |
| OCBBF20071210 | 1346 | 2029..3486 | 3789 |
| OCBBF20071840 | 1347 | 45..1670 | 3790 |
| OCBBF20071960 | 1348 | 1294..1698 | 3791 |
| OCBBF20072240 | 1349 | 335..1432 | 3792 |
| OCBBF20072320 | 1350 | 1749..2087 | 3793 |
| OCBBF20073540 | 1351 | 56..1132 | 3794 |
| OCBBF20074140 | 1352 | 81..>3793 | 3795 |
| OCBBF20076220 | 1353 | 1552..2013 | 3796 |
| OCBBF20078920 | 1354 | 849..1340 | 3797 |
| OCBBF20079310 | 1355 | 240..1349 | 3798 |
| OCBBF20079460 | 1356 | 12..2099 | 3799 |
| OCBBF20080050 | 1357 | 159..2150 | 3800 |
| OCBBF20080410 | 1358 | 122..1672 | 3801 |
| OCBBF20081380 | 1359 | 742..1140 | 3802 |
| OCBBF20082830 | 1360 | 139..1209 | 3803 |
| OCBBF20084660 | 1361 | 74..1621 | 3804 |
| OCBBF20085200 | 1362 | 659..1207 | 3805 |
| OCBBF20086400 | 1363 | 63..797 | 3806 |
| OCBBF20086910 | 1364 | 541..2304 | 3807 |
| OCBBF20087010 | 1365 | 325..633 | 3808 |
| OCBBF20088140 | 1366 | 1575..1916 | 3809 |
| OCBBF20088220 | 1367 | 2505..2915 | 3810 |
| OCBBF20091150 | 1368 | 256..648 | 3811 |
| OCBBF20094240 | 1369 | 82..1122 | 3812 |
| OCBBF20097720 | 1370 | 471..815 | 3813 |
| OCBBF20100400 | 1371 | 407..3043 | 3814 |
| OCBBF20103130 | 1372 | 114..1439 | 3815 |
| OCBBF20104040 | 1373 | 310..612 | 3816 |
| OCBBF20105570 | 1374 | 2404..2874 | 3817 |
| OCBBF20107090 | 1375 | 127..1935 | 3818 |
| OCBBF20107920 | 1376 | 1692..2018 | 3819 |
| OCBBF20108190 | 1377 | 278..1591 | 3820 |
| OCBBF20108430 | 1378 | 832..1851 | 3821 |
| OCBBF20108580 | 1379 | 1152..2354 | 3822 |
| OCBBF20108630 | 1380 | 249..1133 | 3823 |
| OCBBF20109310 | 1381 | 34..2355 | 3824 |
| OCBBF20111770 | 1382 | 291..629 | 3825 |
| OCBBF20116850 | 1383 | 117..2354 | 3826 |
| OCBBF20118970 | 1384 | 361..855 | 3827 |
| OCBBF20120390 | 1385 | 129..2282 | 3828 |
| OCBBF20121390 | 1386 | 524..2254 | 3829 |
| OCBBF20122620 | 1387 | 990..1544 | 3830 |
| OCBBF20124360 | 1388 | 1223..1951 | 3831 |
| OCBBF20125530 | 1389 | 379..2310 | 3832 |
| OCBBF20126780 | 1390 | 1270..1599 | 3833 |
| OCBBF20127040 | 1391 | 177..2327 | 3834 |
| OCBBF20127140 | 1392 | 1018..1530 | 3835 |
| OCBBF20127550 | 1393 | 103..>2362 | 3836 |
| OCBBF20128120 | 1394 | 118..1311 | 3837 |
| OCBBF20129360 | 1395 | 378..>3283 | 3838 |
| OCBBF20130110 | 1396 | 132..452 | 3839 |
| OCBBF20130910 | 1397 | 2527..2892 | 3840 |
| OCBBF20132850 | 1398 | 1172..3331 | 3841 |
| OCBBF20139260 | 1399 | 772..2592 | 3842 |
| OCBBF20140640 | 1400 | 241..894 | 3843 |
| OCBBF20140890 | 1401 | 39..>4369 | 3844 |
| OCBBF20145760 | 1402 | 894..1757 | 3845 |
| OCBBF20148280 | 1403 | 87..1787 | 3846 |
| OCBBF20148730 | 1404 | 50..1855 | 3847 |
| OCBBF20149280 | 1405 | 1385..2035 | 3848 |
| OCBBF20151150 | 1406 | 135..2216 | 3849 |
| OCBBF20153340 | 1407 | 135..>2621 | 3850 |
| OCBBF20153350 | 1408 | 1616..1942 | 3851 |
| OCBBF20155060 | 1409 | 102..3245 | 3852 |
| OCBBF20164050 | 1410 | 50..370 | 3853 |
| OCBBF20164670 | 1411 | 40..1077 | 3854 |
| OCBBF20170690 | 1412 | 159..503 | 3855 |
| OCBBF20173060 | 1413 | 63..383 | 3856 |
| OCBBF20173250 | 1414 | 315..692 | 3857 |
| OCBBF20173980 | 1415 | 262..1857 | 3858 |
| OCBBF20178150 | 1416 | 1245..2231 | 3859 |
| OCBBF20178880 | 1417 | 2740..3207 | 3860 |
| OCBBF20178990 | 1418 | 1328..1819 | 3861 |
| OCBBF20180120 | 1419 | 218..1780 | 3862 |
| OCBBF20180840 | 1420 | 1169..1540 | 3863 |
| OCBBF20186870 | 1421 | 1278..1736 | 3864 |
| OCBBF20188730 | 1422 | 320..766 | 3865 |
| OCBBF20189560 | 1423 | 1512..2165 | 3866 |
| PANCR10000910 | 1424 | 1219..>1943 | 3867 |
| PEBLM10000240 | 1425 | 306..674 | 3868 |
| PEBLM10000710 | 1426 | 1719..1940 | 3869 |
| PEBLM20013120 | 1427 | 26..952 | 3870 |
| PEBLM20024320 | 1428 | 612..1406 | 3871 |
| PEBLM20024550 | 1429 | 1179..1499 | 3872 |
| PEBLM20040150 | 1430 | 1731..2165 | 3873 |
| PEBLM20042900 | 1431 | 226..>2439 | 3874 |
| PEBLM20044520 | 1432 | 922..1974 | 3875 |
| PEBLM20052820 | 1433 | 411..782 | 3876 |
| PEBLM20060310 | 1434 | 1731..>2083 | 3877 |
| PEBLM20060360 | 1435 | 58..330 | 3878 |
| PEBLM20060490 | 1436 | 431..892 | 3879 |
| PEBLM20071880 | 1437 | 497..814 | 3880 |
| PEBLM20072960 | 1438 | 128..1093 | 3881 |
| PEBLM20074370 | 1439 | 60..458 | 3882 |
| PEBLM20075980 | 1440 | 53..1153 | 3883 |
| PEBLM20078320 | 1441 | 5..1672 | 3884 |
| PEBLM20085760 | 1442 | 122..763 | 3885 |
| PERIC10000250 | 1443 | 689..1516 | 3886 |
| PERIC20002140 | 1444 | 151..1239 | 3887 |
| PERIC20003860 | 1445 | 33..359 | 3888 |
| PERIC20003870 | 1446 | 40..2817 | 3889 |
| PERIC20004220 | 1447 | 130..1935 | 3890 |
| PERIC20004780 | 1448 | 132..956 | 3891 |
| PLACE50000660 | 1449 | 329..2527 | 3892 |
| PLACE60003480 | 1450 | 35..877 | 3893 |
| PLACE60004630 | 1451 | 216..533 | 3894 |
| PLACE60060420 | 1452 | 34..246 | 3895 |
| PLACE60079250 | 1453 | 336..>3307 | 3896 |
| PLACE60086400 | 1454 | 279..764 | 3897 |
| PLACE60119750 | 1455 | 28..570 | 3898 |
| PLACE60121080 | 1456 | 769..1182 | 3899 |
| PLACE60136500 | 1457 | 1900..2241 | 3900 |
| PLACE60136720 | 1458 | 78..2519 | 3901 |
| PLACE60138830 | 1459 | 750..1202 | 3902 |
| PLACE60153220 | 1460 | 247..561 | 3903 |
| PLACE60155130 | 1461 | 833..1171 | 3904 |
| PLACE60161600 | 1462 | 77..1099 | 3905 |
| PLACE60169420 | 1463 | 165..1097 | 3906 |
| PLACE60177140 | 1464 | 1321..2190 | 3907 |
| PLACE60181070 | 1465 | 1355..1708 | 3908 |
| PLACE60187690 | 1466 | 1606..1941 | 3909 |
| PLACE60188340 | 1467 | 430..1224 | 3910 |
| PROST10003220 | 1468 | 187..933 | 3911 |
| PROST10004800 | 1469 | 87..419 | 3912 |
| PROST20005050 | 1470 | 673..1164 | 3913 |
| PROST20005670 | 1471 | 1132..>2293 | 3914 |
| PROST20021010 | 1472 | 612..926 | 3915 |
| PROST20024890 | 1473 | 14..514 | 3916 |
| PROST20029270 | 1474 | 1016..1363 | 3917 |
| PROST20047270 | 1475 | 1300..2250 | 3918 |
| PROST20047390 | 1476 | 163..2283 | 3919 |
| PROST20050670 | 1477 | 1622..2074 | 3920 |
| PROST20052280 | 1478 | 326..634 | 3921 |
| PROST20057930 | 1479 | 237..>2116 | 3922 |
| PROST20059040 | 1480 | 1047..1355 | 3923 |
| PROST20066880 | 1481 | 1937..2521 | 3924 |
| PROST20079500 | 1482 | 863..1957 | 3925 |
| PROST20083600 | 1483 | 209..1087 | 3926 |
| PROST20087700 | 1484 | 481..1287 | 3927 |
| PROST20097950 | 1485 | 91..405 | 3928 |
| PROST20100460 | 1486 | 63..1796 | 3929 |
| PROST20104000 | 1487 | 1059..2012 | 3930 |
| PROST20107820 | 1488 | 304..1524 | 3931 |
| PROST20111050 | 1489 | 772..1281 | 3932 |
| PROST20112970 | 1490 | 66..671 | 3933 |
| PROST20114390 | 1491 | 1291..1749 | 3934 |
| PROST20116600 | 1492 | 4..339 | 3935 |
| PROST20120050 | 1493 | 176..589 | 3936 |
| PROST20120160 | 1494 | 283..597 | 3937 |
| PROST20121900 | 1495 | 68..385 | 3938 |
| PROST20123530 | 1496 | 1619..2044 | 3939 |
| PROST20127400 | 1497 | 1156..1524 | 3940 |
| PROST20127800 | 1498 | 942..2120 | 3941 |
| PROST20130530 | 1499 | 416..1588 | 3942 |
| PROST20132600 | 1500 | 1447..2040 | 3943 |
| PROST20133270 | 1501 | 2..529 | 3944 |
| PROST20144220 | 1502 | 1011..1367 | 3945 |
| PROST20146010 | 1503 | 298..1953 | 3946 |
| PROST20149160 | 1504 | 1677..1991 | 3947 |
| PROST20149250 | 1505 | 635..1201 | 3948 |
| PROST20151240 | 1506 | 300..938 | 3949 |
| PROST20152460 | 1507 | 1542..2084 | 3950 |
| PROST20153320 | 1508 | 184..540 | 3951 |
| PROST20159240 | 1509 | 286..612 | 3952 |
| PROST20161950 | 1510 | 90..716 | 3953 |
| PROST20164440 | 1511 | 2570..3004 | 3954 |
| PROST20166680 | 1512 | 53..874 | 3955 |
| PROST20168290 | 1513 | 1757..2143 | 3956 |
| PROST20169800 | 1514 | 168..1763 | 3957 |
| PROST20170980 | 1515 | 28..1245 | 3958 |
| PROST20171280 | 1516 | 306..1493 | 3959 |
| PROST20175290 | 1517 | 1538..2323 | 3960 |
| PROST20176170 | 1518 | 998..2053 | 3961 |
| PROST20178360 | 1519 | 72..566 | 3962 |
| PROST20185830 | 1520 | 1200..2015 | 3963 |
| PROST20189770 | 1521 | 219..2018 | 3964 |
| PROST20191640 | 1522 | 318..1229 | 3965 |
| PUAEN10000850 | 1523 | 121..2040 | 3966 |
| PUAEN20003740 | 1524 | 104..409 | 3967 |
| PUAEN20011880 | 1525 | 28..2028 | 3968 |
| PUAEN20015260 | 1526 | 141..881 | 3969 |
| PUAEN20015860 | 1527 | 71..1846 | 3970 |
| PUAEN20018820 | 1528 | 41..1870 | 3971 |
| PUAEN20025680 | 1529 | 667..1584 | 3972 |
| PUAEN20027580 | 1530 | 36..512 | 3973 |
| PUAEN20030180 | 1531 | 127..978 | 3974 |
| PUAEN20040670 | 1532 | 326..2644 | 3975 |
| PUAEN20044000 | 1533 | 541..957 | 3976 |
| PUAEN20045110 | 1534 | 335..886 | 3977 |
| PUAEN20045250 | 1535 | 335..1054 | 3978 |
| PUAEN20051100 | 1536 | 228..1319 | 3979 |
| PUAEN20052470 | 1537 | 1699..2046 | 3980 |
| PUAEN20055020 | 1538 | 295..2553 | 3981 |
| PUAEN20078980 | 1539 | 6..989 | 3982 |
| PUAEN20081230 | 1540 | 62..469 | 3983 |
| PUAEN20083140 | 1541 | 104..1687 | 3984 |
| PUAEN20085150 | 1542 | 167..502 | 3985 |
| PUAEN20108240 | 1543 | 2..1993 | 3986 |
| RECTM10001410 | 1544 | 426..1631 | 3987 |
| RECTM20003490 | 1545 | 876..1193 | 3988 |
| RECTM20005100 | 1546 | 149..1273 | 3989 |
| SALGL10001710 | 1547 | 271..1722 | 3990 |
| SKMUS20001980 | 1548 | 75..1034 | 3991 |
| SKMUS20003610 | 1549 | 86..910 | 3992 |
| SKMUS20007010 | 1550 | 24..977 | 3993 |
| SKMUS20007800 | 1551 | 708..>1835 | 3994 |
| SKMUS20011640 | 1552 | 16..408 | 3995 |
| SKMUS20012010 | 1553 | 300..1019 | 3996 |
| SKMUS20016220 | 1554 | 80..1267 | 3997 |
| SKMUS20018230 | 1555 | 98..442 | 3998 |
| SKMUS20018500 | 1556 | 273..1172 | 3999 |
| SKMUS20020840 | 1557 | 79..1014 | 4000 |
| SKMUS20021530 | 1558 | 432..2135 | 4001 |
| SKMUS20024750 | 1559 | 201..1208 | 4002 |
| SKMUS20028210 | 1560 | 358..753 | 4003 |
| SKMUS20028400 | 1561 | 18..644 | 4004 |
| SKMUS20029200 | 1562 | 174..1130 | 4005 |
| SKMUS20031680 | 1563 | 171..485 | 4006 |
| SKMUS20046670 | 1564 | 234..617 | 4007 |
| SKMUS20048970 | 1565 | 104..1132 | 4008 |
| SKMUS20049030 | 1566 | 191..1096 | 4009 |
| SKMUS20077400 | 1567 | 170..772 | 4010 |
| SKMUS20084740 | 1568 | 83..>1516 | 4011 |
| SKNMC20006220 | 1569 | 1176..1856 | 4012 |
| SKNSH20008190 | 1570 | 490..2289 | 4013 |
| SKNSH20020540 | 1571 | 2184..2924 | 4014 |
| SKNSH20028660 | 1572 | 192..581 | 4015 |
| SKNSH20031740 | 1573 | 120..563 | 4016 |
| SKNSH20034660 | 1574 | 562..996 | 4017 |
| SKNSH20051940 | 1575 | 1006..1488 | 4018 |
| SKNSH20062340 | 1576 | 85..453 | 4019 |
| SKNSH20063040 | 1577 | 91..768 | 4020 |
| SKNSH20080430 | 1578 | 81..524 | 4021 |
| SKNSH20087770 | 1579 | 107..>1808 | 4022 |
| SKNSH20089400 | 1580 | 34..1092 | 4023 |
| SKNSH20091970 | 1581 | 181..489 | 4024 |
| SMINT20001760 | 1582 | 267..1706 | 4025 |
| SMINT20005410 | 1583 | 138..557 | 4026 |
| SMINT20008240 | 1584 | 1123..1500 | 4027 |
| SMINT20009840 | 1585 | 31..750 | 4028 |
| SMINT20011140 | 1586 | 1254..1664 | 4029 |
| SMINT20011580 | 1587 | 131..811 | 4030 |
| SMINT20011990 | 1588 | 132..512 | 4031 |
| SMINT20013480 | 1589 | 87..686 | 4032 |
| SMINT20014580 | 1590 | 57..410 | 4033 |
| SMINT20015590 | 1591 | 1375..1818 | 4034 |
| SMINT20022020 | 1592 | 133..726 | 4035 |
| SMINT20023280 | 1593 | 890..1345 | 4036 |
| SMINT20024570 | 1594 | 1852..2370 | 4037 |
| SMINT20026890 | 1595 | 541..2790 | 4038 |
| SMINT20028820 | 1596 | 1240..1749 | 4039 |
| SMINT20029760 | 1597 | 236..1282 | 4040 |
| SMINT20033170 | 1598 | 539..931 | 4041 |
| SMINT20033400 | 1599 | 20..778 | 4042 |
| SMINT20035690 | 1600 | 11..1411 | 4043 |
| SMINT20040860 | 1601 | 39..1169 | 4044 |
| SMINT20042990 | 1602 | 397..750 | 4045 |
| SMINT20047810 | 1603 | 109..588 | 4046 |
| SMINT20049090 | 1604 | 99..641 | 4047 |
| SMINT20050750 | 1605 | 101..907 | 4048 |
| SMINT20051610 | 1606 | 56..1513 | 4049 |
| SMINT20053300 | 1607 | 1251..1598 | 4050 |
| SMINT20053870 | 1608 | 85..894 | 4051 |
| SMINT20056210 | 1609 | 356..754 | 4052 |
| SMINT20058000 | 1610 | 200..565 | 4053 |
| SMINT20060780 | 1611 | 18..554 | 4054 |
| SMINT20065960 | 1612 | 859..1314 | 4055 |
| SMINT20068010 | 1613 | 136..1026 | 4056 |
| SMINT20071400 | 1614 | 212..1183 | 4057 |
| SMINT20073650 | 1615 | 59..1549 | 4058 |
| SMINT20076470 | 1616 | 1678..1983 | 4059 |
| SMINT20080540 | 1617 | 1280..1606 | 4060 |
| SMINT20089170 | 1618 | 54..530 | 4061 |
| SMINT20092330 | 1619 | 169..858 | 4062 |
| SMINT20092720 | 1620 | 1640..2293 | 4063 |
| SMINT20095050 | 1621 | 733..1107 | 4064 |
| SMINT20098320 | 1622 | 112..465 | 4065 |
| SMINT20100680 | 1623 | 237..614 | 4066 |
| SMINT20101440 | 1624 | 187..2109 | 4067 |
| SMINT20102780 | 1625 | 26..1642 | 4068 |
| SMINT20103690 | 1626 | 208..960 | 4069 |
| SMINT20105000 | 1627 | 194..514 | 4070 |
| SMINT20105330 | 1628 | 1580..2020 | 4071 |
| SMINT20106290 | 1629 | 501..1802 | 4072 |
| SMINT20106720 | 1630 | 80..1498 | 4073 |
| SMINT20108530 | 1631 | 185..523 | 4074 |
| SMINT20109970 | 1632 | 1444..>1974 | 4075 |
| SMINT20110330 | 1633 | 1398..2222 | 4076 |
| SMINT20110660 | 1634 | 1108..1500 | 4077 |
| SMINT20112730 | 1635 | 80..1564 | 4078 |
| SMINT20115880 | 1636 | 679..1746 | 4079 |
| SMINT20121220 | 1637 | 263..>1798 | 4080 |
| SMINT20121950 | 1638 | 6..443 | 4081 |
| SMINT20122850 | 1639 | 454..777 | 4082 |
| SMINT20122910 | 1640 | 1516..2094 | 4083 |
| SMINT20127350 | 1641 | 622..1449 | 4084 |
| SMINT20127930 | 1642 | 67..1554 | 4085 |
| SMINT20130320 | 1643 | 178..2601 | 4086 |
| SMINT20131810 | 1644 | 583..1257 | 4087 |
| SMINT20132280 | 1645 | 293..655 | 4088 |
| SMINT20136130 | 1646 | 1291..1752 | 4089 |
| SMINT20138900 | 1647 | 87..1439 | 4090 |
| SMINT20144430 | 1648 | 54..647 | 4091 |
| SMINT20144800 | 1649 | 171..1394 | 4092 |
| SMINT20144890 | 1650 | 209..520 | 4093 |
| SMINT20152940 | 1651 | 386..985 | 4094 |
| SMINT20153260 | 1652 | 135..1838 | 4095 |
| SMINT20153530 | 1653 | 1186..1524 | 4096 |
| SMINT20154540 | 1654 | 107..1339 | 4097 |
| SMINT20155180 | 1655 | 20..763 | 4098 |
| SMINT20157450 | 1656 | 669..1118 | 4099 |
| SMINT20158100 | 1657 | 30..587 | 4100 |
| SMINT20161220 | 1658 | 397..1977 | 4101 |
| SMINT20162860 | 1659 | 36..494 | 4102 |
| SMINT20163960 | 1660 | 665..1036 | 4103 |
| SMINT20164400 | 1661 | 125..706 | 4104 |
| SMINT20164770 | 1662 | 529..870 | 4105 |
| SMINT20168570 | 1663 | 1593..2069 | 4106 |
| SMINT20173190 | 1664 | 251..829 | 4107 |
| SMINT20173240 | 1665 | 253..582 | 4108 |
| SMINT20174360 | 1666 | 978..1733 | 4109 |
| SMINT20177360 | 1667 | 172..771 | 4110 |
| SMINT20178550 | 1668 | 51..692 | 4111 |
| SMINT20179740 | 1669 | 78..1865 | 4112 |
| SMINT20183530 | 1670 | 1130..2530 | 4113 |
| SMINT20190170 | 1671 | 80..1567 | 4114 |
| SMINT20191420 | 1672 | 49..1365 | 4115 |
| SMINT20191530 | 1673 | 40..2040 | 4116 |
| SMINT20192000 | 1674 | 49..435 | 4117 |
| SPLEN10000830 | 1675 | 1586..2053 | 4118 |
| SPLEN20000640 | 1676 | 27..755 | 4119 |
| SPLEN20002220 | 1677 | 87..434 | 4120 |
| SPLEN20003070 | 1678 | 684..1046 | 4121 |
| SPLEN20006070 | 1679 | 78..2837 | 4122 |
| SPLEN20008390 | 1680 | 375..2378 | 4123 |
| SPLEN20008740 | 1681 | 66..1547 | 4124 |
| SPLEN20008820 | 1682 | 31..1872 | 4125 |
| SPLEN20011410 | 1683 | 199..2394 | 4126 |
| SPLEN20013540 | 1684 | 978..1310 | 4127 |
| SPLEN20016260 | 1685 | 906..1748 | 4128 |
| SPLEN20019450 | 1686 | 180..680 | 4129 |
| SPLEN20020070 | 1687 | 65..451 | 4130 |
| SPLEN20021660 | 1688 | 130..771 | 4131 |
| SPLEN20022230 | 1689 | 133..1026 | 4132 |
| SPLEN20023140 | 1690 | 1153..1605 | 4133 |
| SPLEN20026950 | 1691 | 855..3383 | 4134 |
| SPLEN20027440 | 1692 | 29..2488 | 4135 |
| SPLEN20029310 | 1693 | 70..585 | 4136 |
| SPLEN20031600 | 1694 | 1658..2083 | 4137 |
| SPLEN20032040 | 1695 | 357..746 | 4138 |
| SPLEN20032190 | 1696 | 441..785 | 4139 |
| SPLEN20033960 | 1697 | 16..1026 | 4140 |
| SPLEN20039240 | 1698 | 1177..1929 | 4141 |
| SPLEN20040600 | 1699 | 60..368 | 4142 |
| SPLEN20054290 | 1700 | 187..2421 | 4143 |
| SPLEN20076530 | 1701 | 254..586 | 4144 |
| SPLEN20077500 | 1702 | 79..1941 | 4145 |
| SPLEN20079260 | 1703 | 535..1506 | 4146 |
| SPLEN20079510 | 1704 | 1880..>2197 | 4147 |
| SPLEN20084600 | 1705 | 13..1878 | 4148 |
| SPLEN20095410 | 1706 | 816..1541 | 4149 |
| SPLEN20095550 | 1707 | 193..>2558 | 4150 |
| SPLEN20095810 | 1708 | 248..670 | 4151 |
| SPLEN20097330 | 1709 | 1448..1849 | 4152 |
| SPLEN20099700 | 1710 | 91..>3025 | 4153 |
| SPLEN20101190 | 1711 | 1864..2250 | 4154 |
| SPLEN20103950 | 1712 | 25..507 | 4155 |
| SPLEN20106250 | 1713 | 295..711 | 4156 |
| SPLEN20117660 | 1714 | 662..1099 | 4157 |
| SPLEN20118300 | 1715 | 332..1486 | 4158 |
| SPLEN20119810 | 1716 | 526..1644 | 4159 |
| SPLEN20121750 | 1717 | 464..1021 | 4160 |
| SPLEN20126190 | 1718 | 274..2688 | 4161 |
| SPLEN20128000 | 1719 | 96..1664 | 4162 |
| SPLEN20129610 | 1720 | 207..557 | 4163 |
| SPLEN20140800 | 1721 | 387..2144 | 4164 |
| SPLEN20141360 | 1722 | 491..799 | 4165 |
| SPLEN20141990 | 1723 | 443..745 | 4166 |
| SPLEN20142100 | 1724 | 301..996 | 4167 |
| SPLEN20143180 | 1725 | 50..448 | 4168 |
| SPLEN20144520 | 1726 | 2002..2463 | 4169 |
| SPLEN20145720 | 1727 | 1205..>1939 | 4170 |
| SPLEN20146450 | 1728 | 362..862 | 4171 |
| SPLEN20146690 | 1729 | 1966..2550 | 4172 |
| SPLEN20147110 | 1730 | 313..2067 | 4173 |
| SPLEN20147390 | 1731 | 169..1479 | 4174 |
| SPLEN20149110 | 1732 | 2..769 | 4175 |
| SPLEN20149190 | 1733 | 26..364 | 4176 |
| SPLEN20149240 | 1734 | 787..2490 | 4177 |
| SPLEN20150940 | 1735 | 79..2385 | 4178 |
| SPLEN20151210 | 1736 | 66..1715 | 4179 |
| SPLEN20152610 | 1737 | 986..1453 | 4180 |
| SPLEN20152760 | 1738 | 284..628 | 4181 |
| SPLEN20157300 | 1739 | 426..728 | 4182 |
| SPLEN20157880 | 1740 | 35..769 | 4183 |
| SPLEN20158900 | 1741 | 1643..2032 | 4184 |
| SPLEN20158990 | 1742 | 843..1172 | 4185 |
| SPLEN20160450 | 1743 | 552..1115 | 4186 |
| SPLEN20160690 | 1744 | 734..1099 | 4187 |
| SPLEN20160980 | 1745 | 124..456 | 4188 |
| SPLEN20162680 | 1746 | 646..2007 | 4189 |
| SPLEN20163560 | 1747 | 86..2173 | 4190 |
| SPLEN20165310 | 1748 | 80..1492 | 4191 |
| SPLEN20166270 | 1749 | 1134..1814 | 4192 |
| SPLEN20167200 | 1750 | 223..570 | 4193 |
| SPLEN20169220 | 1751 | 160..576 | 4194 |
| SPLEN20169720 | 1752 | 72..2492 | 4195 |
| SPLEN20170310 | 1753 | 125..1039 | 4196 |
| SPLEN20171210 | 1754 | 7..837 | 4197 |
| SPLEN20171470 | 1755 | 41..2272 | 4198 |
| SPLEN20171890 | 1756 | 1312..1716 | 4199 |
| SPLEN20172120 | 1757 | 138..500 | 4200 |
| SPLEN20173510 | 1758 | 235..1785 | 4201 |
| SPLEN20174260 | 1759 | 99..428 | 4202 |
| SPLEN20176200 | 1760 | 36..431 | 4203 |
| SPLEN20179180 | 1761 | 173..1201 | 4204 |
| SPLEN20179810 | 1762 | 1374..3224 | 4205 |
| SPLEN20181810 | 1763 | 641..1183 | 4206 |
| SPLEN20186430 | 1764 | 80..979 | 4207 |
| SPLEN20193110 | 1765 | 1744..2118 | 4208 |
| SPLEN20194050 | 1766 | 1351..2331 | 4209 |
| SPLEN20198110 | 1767 | 1260..1562 | 4210 |
| SPLEN20204170 | 1768 | 202..594 | 4211 |
| SPLEN20211220 | 1769 | 601..1500 | 4212 |
| SPLEN20211570 | 1770 | 174..521 | 4213 |
| SPLEN20211940 | 1771 | 241..1155 | 4214 |
| SPLEN20212730 | 1772 | 979..1830 | 4215 |
| SPLEN20212950 | 1773 | 283..2055 | 4216 |
| SPLEN20213830 | 1774 | 137..460 | 4217 |
| SPLEN20214400 | 1775 | 28..387 | 4218 |
| SPLEN20214580 | 1776 | 300..602 | 4219 |
| SPLEN20222270 | 1777 | 241..927 | 4220 |
| SPLEN20225220 | 1778 | 672..1199 | 4221 |
| SPLEN20242320 | 1779 | 136..522 | 4222 |
| SPLEN20242730 | 1780 | 2343..2732 | 4223 |
| SPLEN20243830 | 1781 | 197..556 | 4224 |
| SPLEN20245300 | 1782 | 945..1529 | 4225 |
| SPLEN20249560 | 1783 | 889..1584 | 4226 |
| SPLEN20250170 | 1784 | 457..3012 | 4227 |
| SPLEN20250390 | 1785 | 1327..1788 | 4228 |
| SPLEN20252190 | 1786 | 1413..2609 | 4229 |
| SPLEN20261440 | 1787 | 511..894 | 4230 |
| SPLEN20264110 | 1788 | 1195..1662 | 4231 |
| SPLEN20267650 | 1789 | 39..1331 | 4232 |
| SPLEN20273950 | 1790 | 608..1222 | 4233 |
| SPLEN20279950 | 1791 | 1874..2518 | 4234 |
| SPLEN20280660 | 1792 | 1286..1612 | 4235 |
| SPLEN20283650 | 1793 | 13..621 | 4236 |
| SPLEN20284240 | 1794 | 282..1175 | 4237 |
| SPLEN20292950 | 1795 | 9..2456 | 4238 |
| SPLEN20293800 | 1796 | 73..858 | 4239 |
| SPLEN20303970 | 1797 | 778..1104 | 4240 |
| SPLEN20304950 | 1798 | 7..1011 | 4241 |
| SPLEN20305620 | 1799 | 1356..1853 | 4242 |
| SPLEN20329240 | 1800 | 5..361 | 4243 |
| STOMA20001830 | 1801 | 81..1574 | 4244 |
| STOMA20005390 | 1802 | 59..1567 | 4245 |
| STOMA20005670 | 1803 | 81..1478 | 4246 |
| STOMA20006400 | 1804 | 80..1687 | 4247 |
| STOMA20006780 | 1805 | 41..1975 | 4248 |
| STOMA20006860 | 1806 | 1272..1988 | 4249 |
| STOMA20008880 | 1807 | 112..1485 | 4250 |
| STOMA20010250 | 1808 | 66..419 | 4251 |
| STOMA20013890 | 1809 | 2151..2486 | 4252 |
| STOMA20026880 | 1810 | 548..874 | 4253 |
| STOMA20032890 | 1811 | 1710..2600 | 4254 |
| STOMA20034770 | 1812 | 81..1583 | 4255 |
| STOMA20036460 | 1813 | 311..772 | 4256 |
| STOMA20046680 | 1814 | 768..1154 | 4257 |
| STOMA20048520 | 1815 | 160..663 | 4258 |
| STOMA20048840 | 1816 | 936..1487 | 4259 |
| STOMA20051200 | 1817 | 140..619 | 4260 |
| STOMA20056640 | 1818 | 49..555 | 4261 |
| STOMA20056670 | 1819 | 81..1556 | 4262 |
| STOMA20057820 | 1820 | 60..1226 | 4263 |
| STOMA20062130 | 1821 | 35..427 | 4264 |
| STOMA20062290 | 1822 | 289..693 | 4265 |
| STOMA20063250 | 1823 | 109..438 | 4266 |
| STOMA20063980 | 1824 | 97..480 | 4267 |
| STOMA20064470 | 1825 | 78..1118 | 4268 |
| STOMA20067800 | 1826 | 35..397 | 4269 |
| STOMA20069040 | 1827 | 364..792 | 4270 |
| STOMA20072690 | 1828 | 351..701 | 4271 |
| STOMA20076800 | 1829 | 311..784 | 4272 |
| STOMA20077450 | 1830 | 780..2300 | 4273 |
| STOMA20080500 | 1831 | 59..1735 | 4274 |
| STOMA20083610 | 1832 | 80..1564 | 4275 |
| STOMA20086140 | 1833 | 201..746 | 4276 |
| STOMA20088380 | 1834 | 48..1535 | 4277 |
| STOMA20092530 | 1835 | 80..1501 | 4278 |
| STOMA20092560 | 1836 | 68..439 | 4279 |
| STOMA20092890 | 1837 | 105..1223 | 4280 |
| SYNOV20001520 | 1838 | 25..735 | 4281 |
| SYNOV20001730 | 1839 | 56..1480 | 4282 |
| SYNOV20002510 | 1840 | 79..1629 | 4283 |
| SYNOV20002790 | 1841 | 59..1480 | 4284 |
| SYNOV20002970 | 1842 | 56..1471 | 4285 |
| SYNOV20003970 | 1843 | 357..881 | 4286 |
| SYNOV20004260 | 1844 | 80..1489 | 4287 |
| SYNOV20007000 | 1845 | 55..1485 | 4288 |
| SYNOV20008240 | 1846 | 61..1494 | 4289 |
| SYNOV20009230 | 1847 | 40..1515 | 4290 |
| SYNOV20010880 | 1848 | 61..1479 | 4291 |
| SYNOV20011110 | 1849 | 56..1468 | 4292 |
| SYNOV20013000 | 1850 | 30..1433 | 4293 |
| SYNOV20013560 | 1851 | 79..1494 | 4294 |
| SYNOV20013900 | 1852 | 81..1499 | 4295 |
| SYNOV20017080 | 1853 | 466..1905 | 4296 |
| SYNOV30001840 | 1854 | 146..2443 | 4297 |
| TBAES20000590 | 1855 | 1697..>2237 | 4298 |
| TBAES20002550 | 1856 | 16..1896 | 4299 |
| TBAES20003150 | 1857 | 42..1064 | 4300 |
| TBAES20003770 | 1858 | 117..3437 | 4301 |
| TCOLN20001390 | 1859 | 237..1106 | 4302 |
| TESOP20000900 | 1860 | 110..448 | 4303 |
| TESOP20003120 | 1861 | 42..929 | 4304 |
| TESOP20004000 | 1862 | 295..1125 | 4305 |
| TESOP20005270 | 1863 | 568..921 | 4306 |
| TESOP20005690 | 1864 | 230..574 | 4307 |
| TESTI10000940 | 1865 | 127..1752 | 4308 |
| TESTI20001000 | 1866 | 129..944 | 4309 |
| TESTI20001170 | 1867 | 107..1291 | 4310 |
| TESTI20001720 | 1868 | 204..722 | 4311 |
| TESTI20002720 | 1869 | 92..>2187 | 4312 |
| TESTI20002780 | 1870 | 821..1471 | 4313 |
| TESTI20004890 | 1871 | 140..1231 | 4314 |
| TESTI20011200 | 1872 | 1615..1968 | 4315 |
| TESTI20017950 | 1873 | 62..2023 | 4316 |
| TESTI20018230 | 1874 | 506..1024 | 4317 |
| TESTI20023510 | 1875 | 100..1935 | 4318 |
| TESTI20029930 | 1876 | 597..1847 | 4319 |
| TESTI20030310 | 1877 | 1362..1757 | 4320 |
| TESTI20030890 | 1878 | 1736..2167 | 4321 |
| TESTI20031270 | 1879 | 820..1332 | 4322 |
| TESTI20031810 | 1880 | 235..1926 | 4323 |
| TESTI20035960 | 1881 | 80..1327 | 4324 |
| TESTI20036380 | 1882 | 125..2110 | 4325 |
| TESTI20037560 | 1883 | 16..1986 | 4326 |
| TESTI20038270 | 1884 | 42..347 | 4327 |
| TESTI20039400 | 1885 | 63..1430 | 4328 |
| TESTI20041690 | 1886 | 194..2320 | 4329 |
| TESTI20044230 | 1887 | 76..1308 | 4330 |
| TESTI20044310 | 1888 | 307..1899 | 4331 |
| TESTI20046750 | 1889 | 56..871 | 4332 |
| TESTI20057750 | 1890 | 154..495 | 4333 |
| TESTI20060400 | 1891 | 102..1754 | 4334 |
| TESTI20061110 | 1892 | 102..1574 | 4335 |
| TESTI20063830 | 1893 | 186..1793 | 4336 |
| TESTI20066670 | 1894 | 345..1823 | 4337 |
| TESTI20066770 | 1895 | 867..1937 | 4338 |
| TESTI20067200 | 1896 | 25..1149 | 4339 |
| TESTI20076850 | 1897 | 864..1307 | 4340 |
| TESTI20082330 | 1898 | 12..2249 | 4341 |
| TESTI20083200 | 1899 | 80..967 | 4342 |
| TESTI20083940 | 1900 | 60..1973 | 4343 |
| TESTI20086210 | 1901 | 65..1465 | 4344 |
| TESTI20087620 | 1902 | 116..2191 | 4345 |
| TESTI20088220 | 1903 | 318..2435 | 4346 |
| TESTI20094020 | 1904 | 341..1885 | 4347 |
| TESTI20094120 | 1905 | 402..1184 | 4348 |
| TESTI20094230 | 1906 | 1397..2158 | 4349 |
| TESTI20094470 | 1907 | 428..1540 | 4350 |
| TESTI20098350 | 1908 | 137..1849 | 4351 |
| TESTI20098530 | 1909 | 220..564 | 4352 |
| TESTI20102800 | 1910 | 278..640 | 4353 |
| TESTI20105720 | 1911 | 1542..1901 | 4354 |
| TESTI20108720 | 1912 | 101..1123 | 4355 |
| TESTI20110280 | 1913 | 212..1396 | 4356 |
| TESTI20112940 | 1914 | 579..899 | 4357 |
| TESTI20114070 | 1915 | 1575..1937 | 4358 |
| TESTI20116650 | 1916 | 43..387 | 4359 |
| TESTI20116830 | 1917 | 825..1208 | 4360 |
| TESTI20121550 | 1918 | 191..1900 | 4361 |
| TESTI20122310 | 1919 | 149..826 | 4362 |
| TESTI20123080 | 1920 | 432..767 | 4363 |
| TESTI20123560 | 1921 | 249..>816 | 4364 |
| TESTI20127760 | 1922 | 149..1141 | 4365 |
| TESTI20128350 | 1923 | 178..591 | 4366 |
| TESTI20129150 | 1924 | 241..969 | 4367 |
| TESTI20129220 | 1925 | 366..773 | 4368 |
| TESTI20130010 | 1926 | 866..1420 | 4369 |
| TESTI20130120 | 1927 | 119..748 | 4370 |
| TESTI20135660 | 1928 | 961..1374 | 4371 |
| TESTI20136100 | 1929 | 71..406 | 4372 |
| TESTI20136710 | 1930 | 14..>1826 | 4373 |
| TESTI20136990 | 1931 | 1903..2292 | 4374 |
| TESTI20137370 | 1932 | 37..339 | 4375 |
| TESTI20137670 | 1933 | 181..561 | 4376 |
| TESTI20143240 | 1934 | 486..908 | 4377 |
| TESTI20143390 | 1935 | 52..1068 | 4378 |
| TESTI20143620 | 1936 | 970..1332 | 4379 |
| TESTI20148000 | 1937 | 250..2004 | 4380 |
| TESTI20152460 | 1938 | 222..1499 | 4381 |
| TESTI20155900 | 1939 | 1095..1499 | 4382 |
| TESTI20156100 | 1940 | 31..1200 | 4383 |
| TESTI20157100 | 1941 | 481..1149 | 4384 |
| TESTI20157520 | 1942 | 55..>1880 | 4385 |
| TESTI20159140 | 1943 | 424..>1611 | 4386 |
| TESTI20161970 | 1944 | 138..1658 | 4387 |
| TESTI20164100 | 1945 | 60..470 | 4388 |
| TESTI20168480 | 1946 | 91..1341 | 4389 |
| TESTI20168630 | 1947 | 1219..1608 | 4390 |
| TESTI20168960 | 1948 | 37..570 | 4391 |
| TESTI20169960 | 1949 | 801..1139 | 4392 |
| TESTI20170350 | 1950 | 1106..1429 | 4393 |
| TESTI20171020 | 1951 | 11..>2194 | 4394 |
| TESTI20178160 | 1952 | 1084..1452 | 4395 |
| TESTI20179320 | 1953 | 191..664 | 4396 |
| TESTI20183370 | 1954 | 190..870 | 4397 |
| TESTI20184620 | 1955 | 123..2417 | 4398 |
| TESTI20185650 | 1956 | 75..1904 | 4399 |
| TESTI20185810 | 1957 | 243..587 | 4400 |
| TESTI20189410 | 1958 | 16..>1759 | 4401 |
| TESTI20192280 | 1959 | 10..906 | 4402 |
| TESTI20192800 | 1960 | 193..>2366 | 4403 |
| TESTI20193360 | 1961 | 66..854 | 4404 |
| TESTI20194300 | 1962 | 70..576 | 4405 |
| TESTI20194810 | 1963 | 78..473 | 4406 |
| TESTI20197940 | 1964 | 771..>1987 | 4407 |
| TESTI20199170 | 1965 | 244..558 | 4408 |
| TESTI20199750 | 1966 | 92..1957 | 4409 |
| TESTI20200260 | 1967 | 307..846 | 4410 |
| TESTI20200710 | 1968 | 190..1749 | 4411 |
| TESTI20202650 | 1969 | 55..1299 | 4412 |
| TESTI20203440 | 1970 | 1109..1600 | 4413 |
| TESTI20204450 | 1971 | 417..1916 | 4414 |
| TESTI20208400 | 1972 | 1027..1782 | 4415 |
| TESTI20208710 | 1973 | 70..2046 | 4416 |
| TESTI20209460 | 1974 | 1035..1400 | 4417 |
| TESTI20209810 | 1975 | 872..1405 | 4418 |
| TESTI20209990 | 1976 | 106..549 | 4419 |
| TESTI20211160 | 1977 | 627..1424 | 4420 |
| TESTI20211220 | 1978 | 1561..1944 | 4421 |
| TESTI20211240 | 1979 | 150..>1469 | 4422 |
| TESTI20213150 | 1980 | 380..1303 | 4423 |
| TESTI20213580 | 1981 | 338..697 | 4424 |
| TESTI20214250 | 1982 | 46..933 | 4425 |
| TESTI20215990 | 1983 | 428..2635 | 4426 |
| TESTI20216370 | 1984 | 572..1195 | 4427 |
| TESTI20220100 | 1985 | 539..1264 | 4428 |
| TESTI20220650 | 1986 | 164..481 | 4429 |
| TESTI20224620 | 1987 | 221..532 | 4430 |
| TESTI20226230 | 1988 | 335..>1500 | 4431 |
| TESTI20226490 | 1989 | 1044..1367 | 4432 |
| TESTI20229600 | 1990 | 342..2669 | 4433 |
| TESTI20230250 | 1991 | 1310..1693 | 4434 |
| TESTI20230850 | 1992 | 246..2567 | 4435 |
| TESTI20231920 | 1993 | 949..1392 | 4436 |
| TESTI20231940 | 1994 | 382..975 | 4437 |
| TESTI20232140 | 1995 | 26..1237 | 4438 |
| TESTI20234140 | 1996 | 182..1738 | 4439 |
| TESTI20234270 | 1997 | 334..642 | 4440 |
| TESTI20234360 | 1998 | 23..460 | 4441 |
| TESTI20237520 | 1999 | 172..1734 | 4442 |
| TESTI20238000 | 2000 | 978..1322 | 4443 |
| TESTI20238610 | 2001 | 150..1373 | 4444 |
| TESTI20239470 | 2002 | 132..2294 | 4445 |
| TESTI20239510 | 2003 | 701..1333 | 4446 |
| TESTI20240090 | 2004 | 10..1179 | 4447 |
| TESTI20241530 | 2005 | 594..1985 | 4448 |
| TESTI20241920 | 2006 | 1309..1632 | 4449 |
| TESTI20242830 | 2007 | 42..2306 | 4450 |
| TESTI20242990 | 2008 | 968..1330 | 4451 |
| TESTI20244190 | 2009 | 80..1630 | 4452 |
| TESTI20244760 | 2010 | 1258..1647 | 4453 |
| TESTI20249990 | 2011 | 698..1960 | 4454 |
| TESTI20254220 | 2012 | 81..1376 | 4455 |
| TESTI20254540 | 2013 | 997..1830 | 4456 |
| TESTI20254860 | 2014 | 205..>2004 | 4457 |
| TESTI20255820 | 2015 | 120..1565 | 4458 |
| TESTI20258460 | 2016 | 37..1212 | 4459 |
| TESTI20262330 | 2017 | 928..1521 | 4460 |
| TESTI20262910 | 2018 | 335..1336 | 4461 |
| TESTI20265250 | 2019 | 1751..2095 | 4462 |
| TESTI20265370 | 2020 | 46..378 | 4463 |
| TESTI20265970 | 2021 | 258..1961 | 4464 |
| TESTI20266740 | 2022 | 88..1203 | 4465 |
| TESTI20269570 | 2023 | 643..1047 | 4466 |
| TESTI20271850 | 2024 | 202..504 | 4467 |
| TESTI20272060 | 2025 | 1379..3253 | 4468 |
| TESTI20272390 | 2026 | 123..767 | 4469 |
| TESTI20272960 | 2027 | 982..1932 | 4470 |
| TESTI20275030 | 2028 | 98..583 | 4471 |
| TESTI20275620 | 2029 | 1508..1840 | 4472 |
| TESTI20277360 | 2030 | 298..1704 | 4473 |
| TESTI20278200 | 2031 | 48..698 | 4474 |
| TESTI20278400 | 2032 | 70..>1856 | 4475 |
| TESTI20280980 | 2033 | 619..1071 | 4476 |
| TESTI20282540 | 2034 | 310..1356 | 4477 |
| TESTI20284880 | 2035 | 683..1114 | 4478 |
| TESTI20285830 | 2036 | 494..853 | 4479 |
| TESTI20288110 | 2037 | 234..899 | 4480 |
| TESTI20288910 | 2038 | 51..965 | 4481 |
| TESTI20289850 | 2039 | 198..698 | 4482 |
| TESTI20291310 | 2040 | 106..2034 | 4483 |
| TESTI20291620 | 2041 | 1611..2021 | 4484 |
| TESTI20291960 | 2042 | 809..1921 | 4485 |
| TESTI20294700 | 2043 | 898..1236 | 4486 |
| TESTI20297850 | 2044 | 1..837 | 4487 |
| TESTI20301360 | 2045 | 114..506 | 4488 |
| TESTI20303220 | 2046 | 288..2711 | 4489 |
| TESTI20303360 | 2047 | 767..2050 | 4490 |
| TESTI20303420 | 2048 | 34..768 | 4491 |
| TESTI20305540 | 2049 | 97..2949 | 4492 |
| TESTI20305560 | 2050 | 49..582 | 4493 |
| TESTI20307540 | 2051 | 88..513 | 4494 |
| TESTI20307700 | 2052 | 32..412 | 4495 |
| TESTI20308600 | 2053 | 72..1307 | 4496 |
| TESTI20309170 | 2054 | 722..2233 | 4497 |
| TESTI20310070 | 2055 | 205..2097 | 4498 |
| TESTI20311290 | 2056 | 940..1398 | 4499 |
| TESTI20314180 | 2057 | 1073..1744 | 4500 |
| TESTI20316870 | 2058 | 25..813 | 4501 |
| TESTI20317600 | 2059 | 107..1420 | 4502 |
| TESTI20318090 | 2060 | 1012..1644 | 4503 |
| TESTI20319190 | 2061 | 384..1481 | 4504 |
| TESTI20320440 | 2062 | 200..1861 | 4505 |
| TESTI20320670 | 2063 | 259..1257 | 4506 |
| TESTI20326810 | 2064 | 832..1377 | 4507 |
| TESTI20327680 | 2065 | 135..1730 | 4508 |
| TESTI20327740 | 2066 | 132..518 | 4509 |
| TESTI20328280 | 2067 | 87..2135 | 4510 |
| TESTI20330310 | 2068 | 315..1307 | 4511 |
| TESTI20332420 | 2069 | 682..1461 | 4512 |
| TESTI20333000 | 2070 | 366..1586 | 4513 |
| TESTI20333950 | 2071 | 76..1500 | 4514 |
| TESTI20334410 | 2072 | 167..1630 | 4515 |
| TESTI20335050 | 2073 | 340..1389 | 4516 |
| TESTI20335200 | 2074 | 612..968 | 4517 |
| TESTI20336410 | 2075 | 17..325 | 4518 |
| TESTI20337100 | 2076 | 40..384 | 4519 |
| TESTI20342430 | 2077 | 322..642 | 4520 |
| TESTI20343070 | 2078 | 530..2563 | 4521 |
| TESTI20343570 | 2079 | 900..1568 | 4522 |
| TESTI20345060 | 2080 | 15..1382 | 4523 |
| TESTI20347180 | 2081 | 3..710 | 4524 |
| TESTI20347300 | 2082 | 623..931 | 4525 |
| TESTI20347740 | 2083 | 100..1599 | 4526 |
| TESTI20347770 | 2084 | 37..351 | 4527 |
| TESTI20351830 | 2085 | 919..1773 | 4528 |
| TESTI20352620 | 2086 | 182..907 | 4529 |
| TESTI20355020 | 2087 | 8..1651 | 4530 |
| TESTI20357750 | 2088 | 547..951 | 4531 |
| TESTI20357930 | 2089 | 1148..1498 | 4532 |
| TESTI20357960 | 2090 | 363..725 | 4533 |
| TESTI20358980 | 2091 | 85..1332 | 4534 |
| TESTI20361140 | 2092 | 801..1514 | 4535 |
| TESTI20366910 | 2093 | 5..1396 | 4536 |
| TESTI20367360 | 2094 | 324..629 | 4537 |
| TESTI20368330 | 2095 | 201..1856 | 4538 |
| TESTI20369130 | 2096 | 243..611 | 4539 |
| TESTI20369220 | 2097 | 118..441 | 4540 |
| TESTI20369650 | 2098 | 633..2204 | 4541 |
| TESTI20369690 | 2099 | 306..1208 | 4542 |
| TESTI20370020 | 2100 | 346..1830 | 4543 |
| TESTI20370550 | 2101 | 160..462 | 4544 |
| TESTI20370810 | 2102 | 223..2334 | 4545 |
| TESTI20371030 | 2103 | 209..1180 | 4546 |
| TESTI20371060 | 2104 | 140..1177 | 4547 |
| TESTI20373820 | 2105 | 237..1109 | 4548 |
| TESTI20375340 | 2106 | 387..1559 | 4549 |
| TESTI20377230 | 2107 | 574..1314 | 4550 |
| TESTI20378190 | 2108 | 380..1795 | 4551 |
| TESTI20378450 | 2109 | 489..>2419 | 4552 |
| TESTI20380650 | 2110 | 961..1272 | 4553 |
| TESTI20381040 | 2111 | 339..1394 | 4554 |
| TESTI20382750 | 2112 | 1159..1797 | 4555 |
| TESTI20383880 | 2113 | 419..988 | 4556 |
| TESTI20385960 | 2114 | 684..1637 | 4557 |
| TESTI20386230 | 2115 | 748..1059 | 4558 |
| TESTI20386440 | 2116 | 185..514 | 4559 |
| TESTI20388580 | 2117 | 405..788 | 4560 |
| TESTI20390260 | 2118 | 142..522 | 4561 |
| TESTI20390410 | 2119 | 1604..1969 | 4562 |
| TESTI20391130 | 2120 | 185..2224 | 4563 |
| TESTI20391210 | 2121 | 1259..1801 | 4564 |
| TESTI20391770 | 2122 | 237..1634 | 4565 |
| TESTI20392090 | 2123 | 405..881 | 4566 |
| TESTI20392250 | 2124 | 1057..1941 | 4567 |
| TESTI20392270 | 2125 | 316..1185 | 4568 |
| TESTI20392760 | 2126 | 306..2279 | 4569 |
| TESTI20393530 | 2127 | 194..1198 | 4570 |
| TESTI20396130 | 2128 | 338..682 | 4571 |
| TESTI20397760 | 2129 | 371..1129 | 4572 |
| TESTI20400940 | 2130 | 231..2705 | 4573 |
| TESTI20401020 | 2131 | 583..1281 | 4574 |
| TESTI20401280 | 2132 | 53..379 | 4575 |
| TESTI20401430 | 2133 | 340..651 | 4576 |
| TESTI20404240 | 2134 | 1110..1550 | 4577 |
| TESTI20406420 | 2135 | 186..1340 | 4578 |
| TESTI20408150 | 2136 | 195..752 | 4579 |
| TESTI20408970 | 2137 | 247..1170 | 4580 |
| TESTI20409440 | 2138 | 17..337 | 4581 |
| TESTI20409890 | 2139 | 120..1082 | 4582 |
| TESTI20413300 | 2140 | 66..503 | 4583 |
| TESTI20415170 | 2141 | 45..419 | 4584 |
| TESTI20415640 | 2142 | 1..324 | 4585 |
| TESTI20416640 | 2143 | 1092..1574 | 4586 |
| TESTI20417300 | 2144 | 107..1807 | 4587 |
| TESTI20419560 | 2145 | 5..331 | 4588 |
| TESTI20420620 | 2146 | 334..2139 | 4589 |
| TESTI20421490 | 2147 | 2188..2628 | 4590 |
| TESTI20422640 | 2148 | 974..2149 | 4591 |
| TESTI20423020 | 2149 | 252..>1770 | 4592 |
| TESTI20424000 | 2150 | 339..842 | 4593 |
| TESTI20424730 | 2151 | 928..1263 | 4594 |
| TESTI20425070 | 2152 | 1145..1726 | 4595 |
| TESTI20427830 | 2153 | 42..380 | 4596 |
| TESTI20428060 | 2154 | 230..598 | 4597 |
| TESTI20429280 | 2155 | 925..1551 | 4598 |
| TESTI20429580 | 2156 | 970..1458 | 4599 |
| TESTI20432750 | 2157 | 56..1399 | 4600 |
| TESTI20432820 | 2158 | 18..1232 | 4601 |
| TESTI20433130 | 2159 | 247..549 | 4602 |
| TESTI20436560 | 2160 | 103..1578 | 4603 |
| TESTI20438570 | 2161 | 1252..1719 | 4604 |
| TESTI20438660 | 2162 | 2227..2622 | 4605 |
| TESTI20441940 | 2163 | 613..1596 | 4606 |
| TESTI20442760 | 2164 | 82..>2054 | 4607 |
| TESTI20443090 | 2165 | 201..1019 | 4608 |
| TESTI20444130 | 2166 | 79..417 | 4609 |
| TESTI20444180 | 2167 | 26..547 | 4610 |
| TESTI20447540 | 2168 | 184..516 | 4611 |
| TESTI20449200 | 2169 | 672..1766 | 4612 |
| TESTI20451710 | 2170 | 429..731 | 4613 |
| TESTI20451990 | 2171 | 210..2264 | 4614 |
| TESTI20455090 | 2172 | 489..1268 | 4615 |
| TESTI20455620 | 2173 | 110..1351 | 4616 |
| TESTI20456110 | 2174 | 4..1191 | 4617 |
| TESTI20458190 | 2175 | 235..579 | 4618 |
| TESTI20463520 | 2176 | 998..1402 | 4619 |
| TESTI20463580 | 2177 | 577..2037 | 4620 |
| TESTI20465350 | 2178 | 317..1258 | 4621 |
| TESTI20465520 | 2179 | 535..1026 | 4622 |
| TESTI20465690 | 2180 | 214..1074 | 4623 |
| TESTI20467210 | 2181 | 435..1613 | 4624 |
| TESTI20467320 | 2182 | 951..1922 | 4625 |
| TESTI20467970 | 2183 | 332..1690 | 4626 |
| TESTI20468630 | 2184 | 380..688 | 4627 |
| TESTI20471410 | 2185 | 97..1464 | 4628 |
| TESTI20471470 | 2186 | 31..369 | 4629 |
| TESTI20471530 | 2187 | 2264..2641 | 4630 |
| TESTI20472120 | 2188 | 517..876 | 4631 |
| TESTI20473420 | 2189 | 140..607 | 4632 |
| TESTI20473830 | 2190 | 951..1532 | 4633 |
| TESTI20477920 | 2191 | 1387..1860 | 4634 |
| TESTI20478010 | 2192 | 169..558 | 4635 |
| TESTI20478180 | 2193 | 428..754 | 4636 |
| TESTI20478850 | 2194 | 949..1323 | 4637 |
| TESTI20479300 | 2195 | 663..1205 | 4638 |
| THYMU10005360 | 2196 | 48..899 | 4639 |
| THYMU10005540 | 2197 | 84..1508 | 4640 |
| THYMU20000570 | 2198 | 216..728 | 4641 |
| THYMU20011950 | 2199 | 45..626 | 4642 |
| THYMU20015210 | 2200 | 1003..1314 | 4643 |
| THYMU20018190 | 2201 | 336..758 | 4644 |
| THYMU20023380 | 2202 | 1426..1728 | 4645 |
| THYMU20027560 | 2203 | 63..602 | 4646 |
| THYMU20029100 | 2204 | 215..928 | 4647 |
| THYMU20032870 | 2205 | 1042..1404 | 4648 |
| THYMU20039810 | 2206 | 54..2204 | 4649 |
| THYMU20045120 | 2207 | 66..425 | 4650 |
| THYMU20058070 | 2208 | 984..1388 | 4651 |
| THYMU20061700 | 2209 | 40..435 | 4652 |
| THYMU20066100 | 2210 | 188..814 | 4653 |
| THYMU20070360 | 2211 | 1333..1635 | 4654 |
| THYMU20075320 | 2212 | 1186..1767 | 4655 |
| THYMU20081490 | 2213 | 127..>2055 | 4656 |
| THYMU20095960 | 2214 | 304..945 | 4657 |
| THYMU20100410 | 2215 | 219..1415 | 4658 |
| THYMU20101610 | 2216 | 1087..1446 | 4659 |
| THYMU20101920 | 2217 | 765..1310 | 4660 |
| THYMU20105190 | 2218 | 850..1713 | 4661 |
| THYMU20106710 | 2219 | 89..493 | 4662 |
| THYMU20108310 | 2220 | 97..642 | 4663 |
| THYMU20111180 | 2221 | 33..1367 | 4664 |
| THYMU20111420 | 2222 | 914..1303 | 4665 |
| THYMU20111830 | 2223 | 38..796 | 4666 |
| THYMU20114470 | 2224 | 122..502 | 4667 |
| THYMU20115850 | 2225 | 1500..1805 | 4668 |
| THYMU20118060 | 2226 | 355..687 | 4669 |
| THYMU20118520 | 2227 | 220..567 | 4670 |
| THYMU20119390 | 2228 | 118..525 | 4671 |
| THYMU20122730 | 2229 | 343..1140 | 4672 |
| THYMU20126900 | 2230 | 163..1446 | 4673 |
| THYMU20128070 | 2231 | 2..349 | 4674 |
| THYMU20128260 | 2232 | 76..411 | 4675 |
| THYMU20130890 | 2233 | 221..757 | 4676 |
| THYMU20141670 | 2234 | 196..1152 | 4677 |
| THYMU20142040 | 2235 | 24..653 | 4678 |
| THYMU20142970 | 2236 | 495..1499 | 4679 |
| THYMU20143270 | 2237 | 524..1549 | 4680 |
| THYMU20147770 | 2238 | 80..1501 | 4681 |
| THYMU20153160 | 2239 | 1303..1920 | 4682 |
| THYMU20158250 | 2240 | 117..488 | 4683 |
| THYMU20159430 | 2241 | 79..1581 | 4684 |
| THYMU20161640 | 2242 | 110..679 | 4685 |
| THYMU20162190 | 2243 | 299..646 | 4686 |
| THYMU20169680 | 2244 | 718..1395 | 4687 |
| THYMU20172150 | 2245 | 375..956 | 4688 |
| THYMU20173980 | 2246 | 355..813 | 4689 |
| THYMU20180280 | 2247 | 1352..1699 | 4690 |
| THYMU20186390 | 2248 | 461..1495 | 4691 |
| THYMU20186730 | 2249 | 194..535 | 4692 |
| THYMU20187720 | 2250 | 284..661 | 4693 |
| THYMU20193640 | 2251 | 659..1165 | 4694 |
| THYMU20194360 | 2252 | 257..955 | 4695 |
| THYMU20194420 | 2253 | 1080..1403 | 4696 |
| THYMU20195990 | 2254 | 344..673 | 4697 |
| THYMU20201980 | 2255 | 1094..2023 | 4698 |
| THYMU20202890 | 2256 | 935..2188 | 4699 |
| THYMU20204160 | 2257 | 654..1199 | 4700 |
| THYMU20204990 | 2258 | 65..385 | 4701 |
| THYMU20208300 | 2259 | 144..542 | 4702 |
| THYMU20209590 | 2260 | 193..2061 | 4703 |
| THYMU20215090 | 2261 | 862..1380 | 4704 |
| THYMU20215970 | 2262 | 1004..1552 | 4705 |
| THYMU20216840 | 2263 | 605..2074 | 4706 |
| THYMU20222890 | 2264 | 1896..2198 | 4707 |
| THYMU20226600 | 2265 | 246..1232 | 4708 |
| THYMU20228540 | 2266 | 109..426 | 4709 |
| THYMU20229220 | 2267 | 259..894 | 4710 |
| THYMU20232090 | 2268 | 111..539 | 4711 |
| THYMU20235760 | 2269 | 357..674 | 4712 |
| THYMU20239000 | 2270 | 44..1672 | 4713 |
| THYMU20239430 | 2271 | 656..982 | 4714 |
| THYMU20240710 | 2272 | 680..2077 | 4715 |
| THYMU20241210 | 2273 | 77..511 | 4716 |
| THYMU20241850 | 2274 | 63..890 | 4717 |
| THYMU20246840 | 2275 | 110..415 | 4718 |
| THYMU20247480 | 2276 | 4..1176 | 4719 |
| THYMU20250420 | 2277 | 222..707 | 4720 |
| THYMU20251890 | 2278 | 1433..1777 | 4721 |
| THYMU20253250 | 2279 | 713..1540 | 4722 |
| THYMU20255570 | 2280 | 882..1550 | 4723 |
| THYMU20255720 | 2281 | 88..645 | 4724 |
| THYMU20259090 | 2282 | 1763..2092 | 4725 |
| THYMU20265300 | 2283 | 60..1949 | 4726 |
| THYMU20271250 | 2284 | 681..1628 | 4727 |
| THYMU20272490 | 2285 | 174..560 | 4728 |
| THYMU20277390 | 2286 | 930..1541 | 4729 |
| THYMU20279750 | 2287 | 716..1114 | 4730 |
| THYMU20283790 | 2288 | 253..804 | 4731 |
| THYMU20284120 | 2289 | 178..525 | 4732 |
| THYMU20286290 | 2290 | 287..1981 | 4733 |
| THYMU20286320 | 2291 | 1214..1594 | 4734 |
| TKIDN10000010 | 2292 | 386..838 | 4735 |
| TKIDN20004640 | 2293 | 549..1172 | 4736 |
| TKIDN20005210 | 2294 | 294..1133 | 4737 |
| TKIDN20030590 | 2295 | 143..1558 | 4738 |
| TKIDN20030620 | 2296 | 25..531 | 4739 |
| TKIDN20047480 | 2297 | 1038..1460 | 4740 |
| TOVAR20004760 | 2298 | 675..1454 | 4741 |
| TOVAR20005750 | 2299 | 348..713 | 4742 |
| TRACH20002870 | 2300 | 77..613 | 4743 |
| TRACH20003590 | 2301 | 244..1773 | 4744 |
| TRACH20005020 | 2302 | 75..1463 | 4745 |
| TRACH20005400 | 2303 | 57..728 | 4746 |
| TRACH20007020 | 2304 | 271..1830 | 4747 |
| TRACH20016210 | 2305 | 122..1132 | 4748 |
| TRACH20019960 | 2306 | 112..1410 | 4749 |
| TRACH20027840 | 2307 | 61..384 | 4750 |
| TRACH20028030 | 2308 | 161..1441 | 4751 |
| TRACH20029540 | 2309 | 1410..1859 | 4752 |
| TRACH20032720 | 2310 | 830..1354 | 4753 |
| TRACH20033230 | 2311 | 560..2110 | 4754 |
| TRACH20034840 | 2312 | 1985..>3328 | 4755 |
| TRACH20037360 | 2313 | 1..309 | 4756 |
| TRACH20041830 | 2314 | 424..1035 | 4757 |
| TRACH20042920 | 2315 | 77..1540 | 4758 |
| TRACH20048450 | 2316 | 511..1845 | 4759 |
| TRACH20050040 | 2317 | 70..594 | 4760 |
| TRACH20056980 | 2318 | 405..1055 | 4761 |
| TRACH20057690 | 2319 | 1448..1993 | 4762 |
| TRACH20060150 | 2320 | 3..329 | 4763 |
| TRACH20067620 | 2321 | 166..603 | 4764 |
| TRACH20068660 | 2322 | 63..890 | 4765 |
| TRACH20068700 | 2323 | 144..1811 | 4766 |
| TRACH20069180 | 2324 | 63..1625 | 4767 |
| TRACH20076740 | 2325 | 779..1669 | 4768 |
| TRACH20076760 | 2326 | 1737..2183 | 4769 |
| TRACH20077540 | 2327 | 1859..2455 | 4770 |
| TRACH20079690 | 2328 | 144..2144 | 4771 |
| TRACH20082780 | 2329 | 1675..2103 | 4772 |
| TRACH20084720 | 2330 | 38..1819 | 4773 |
| TRACH20085400 | 2331 | 223..2346 | 4774 |
| TRACH20085830 | 2332 | 41..1567 | 4775 |
| TRACH20091230 | 2333 | 1660..2067 | 4776 |
| TRACH20092680 | 2334 | 56..457 | 4777 |
| TRACH20096610 | 2335 | 417..935 | 4778 |
| TRACH20099340 | 2336 | 156..494 | 4779 |
| TRACH20105870 | 2337 | 1418..2176 | 4780 |
| TRACH20107710 | 2338 | 13..474 | 4781 |
| TRACH20109650 | 2339 | 1421..1849 | 4782 |
| TRACH20111130 | 2340 | 1548..1937 | 4783 |
| TRACH20115740 | 2341 | 507..893 | 4784 |
| TRACH20118940 | 2342 | 1781..2083 | 4785 |
| TRACH20121380 | 2343 | 795..1808 | 4786 |
| TRACH20128110 | 2344 | 1233..1796 | 4787 |
| TRACH20128230 | 2345 | 80..1657 | 4788 |
| TRACH20134950 | 2346 | 675..1001 | 4789 |
| TRACH20135520 | 2347 | 425..2335 | 4790 |
| TRACH20136710 | 2348 | 42..545 | 4791 |
| TRACH20139820 | 2349 | 1630..1998 | 4792 |
| TRACH20140820 | 2350 | 196..738 | 4793 |
| TRACH20141240 | 2351 | 270..875 | 4794 |
| TRACH20145440 | 2352 | 243..1511 | 4795 |
| TRACH20147250 | 2353 | 834..1196 | 4796 |
| TRACH20149970 | 2354 | 124..1776 | 4797 |
| TRACH20153810 | 2355 | 216..635 | 4798 |
| TRACH20154860 | 2356 | 3..1439 | 4799 |
| TRACH20162860 | 2357 | 98..364 | 4800 |
| TRACH20163170 | 2358 | 267..1028 | 4801 |
| TRACH20164980 | 2359 | 657..2165 | 4802 |
| TRACH20167220 | 2360 | 986..2422 | 4803 |
| TRACH20168350 | 2361 | 200..589 | 4804 |
| TRACH20169800 | 2362 | 1922..2359 | 4805 |
| TRACH20180840 | 2363 | 1288..1593 | 4806 |
| TRACH20183170 | 2364 | 1029..2252 | 4807 |
| TRACH20184490 | 2365 | 214..1596 | 4808 |
| TRACH20187180 | 2366 | 1322..1639 | 4809 |
| TRACH20190240 | 2367 | 1624..2313 | 4810 |
| TSTOM10001860 | 2368 | 96..1859 | 4811 |
| TSTOM20001390 | 2369 | 241..1671 | 4812 |
| TSTOM20003150 | 2370 | 103..1245 | 4813 |
| TSTOM20005690 | 2371 | 370..1626 | 4814 |
| TUTER20002830 | 2372 | 172..930 | 4815 |
| UMVEN10001560 | 2373 | 130..669 | 4816 |
| UMVEN10001860 | 2374 | 198..>2048 | 4817 |
| UMVEN20000690 | 2375 | 6..1118 | 4818 |
| UMVEN20003540 | 2376 | 4..519 | 4819 |
| UTERU20000740 | 2377 | 2062..2400 | 4820 |
| UTERU20004240 | 2378 | 38..385 | 4821 |
| UTERU20006290 | 2379 | 101..406 | 4822 |
| UTERU20006960 | 2380 | 106..555 | 4823 |
| UTERU20020010 | 2381 | 54..431 | 4824 |
| UTERU20022940 | 2382 | 735..1232 | 4825 |
| UTERU20030570 | 2383 | 184..1737 | 4826 |
| UTERU20040610 | 2384 | 92..409 | 4827 |
| UTERU20046640 | 2385 | 15..2699 | 4828 |
| UTERU20046980 | 2386 | 216..926 | 4829 |
| UTERU20050690 | 2387 | 619..924 | 4830 |
| UTERU20054460 | 2388 | 557..>2294 | 4831 |
| UTERU20055330 | 2389 | 45..632 | 4832 |
| UTERU20055480 | 2390 | 92..1765 | 4833 |
| UTERU20055930 | 2391 | 90..869 | 4834 |
| UTERU20056010 | 2392 | 65..484 | 4835 |
| UTERU20059050 | 2393 | 809..1459 | 4836 |
| UTERU20061030 | 2394 | 994..1389 | 4837 |
| UTERU20064000 | 2395 | 153..479 | 4838 |
| UTERU20064860 | 2396 | 26..1780 | 4839 |
| UTERU20065930 | 2397 | 37..2097 | 4840 |
| UTERU20067050 | 2398 | 641..952 | 4841 |
| UTERU20068990 | 2399 | 945..1319 | 4842 |
| UTERU20070040 | 2400 | 36..383 | 4843 |
| UTERU20070810 | 2401 | 761..1219 | 4844 |
| UTERU20076390 | 2402 | 71..499 | 4845 |
| UTERU20081300 | 2403 | 2063..2464 | 4846 |
| UTERU20084260 | 2404 | 494..1321 | 4847 |
| UTERU20094350 | 2405 | 293..802 | 4848 |
| UTERU20095380 | 2406 | 872..1213 | 4849 |
| UTERU20095400 | 2407 | 737..1456 | 4850 |
| UTERU20097760 | 2408 | 1232..1759 | 4851 |
| UTERU20099720 | 2409 | 201..746 | 4852 |
| UTERU20101240 | 2410 | 210..602 | 4853 |
| UTERU20114100 | 2411 | 538..963 | 4854 |
| UTERU20115740 | 2412 | 469..933 | 4855 |
| UTERU20116570 | 2413 | 327..1694 | 4856 |
| UTERU20118110 | 2414 | 87..485 | 4857 |
| UTERU20118970 | 2415 | 229..549 | 4858 |
| UTERU20119060 | 2416 | 1192..2436 | 4859 |
| UTERU20119680 | 2417 | 676..1185 | 4860 |
| UTERU20120310 | 2418 | 68..1066 | 4861 |
| UTERU20124070 | 2419 | 368..733 | 4862 |
| UTERU20126880 | 2420 | 524..1045 | 4863 |
| UTERU20134910 | 2421 | 1070..1489 | 4864 |
| UTERU20135860 | 2422 | 676..1965 | 4865 |
| UTERU20143980 | 2423 | 68..370 | 4866 |
| UTERU20144640 | 2424 | 231..1148 | 4867 |
| UTERU20145480 | 2425 | 172..2193 | 4868 |
| UTERU20146310 | 2426 | 114..1580 | 4869 |
| UTERU20146680 | 2427 | 524..1045 | 4870 |
| UTERU20150870 | 2428 | 47..499 | 4871 |
| UTERU20151980 | 2429 | 220..981 | 4872 |
| UTERU20158300 | 2430 | 342..686 | 4873 |
| UTERU20158800 | 2431 | 161..1318 | 4874 |
| UTERU20161570 | 2432 | 295..1209 | 4875 |
| UTERU20164260 | 2433 | 54..890 | 4876 |
| UTERU20168220 | 2434 | 835..1530 | 4877 |
| UTERU20176130 | 2435 | 27..1184 | 4878 |
| UTERU20176320 | 2436 | 108..1364 | 4879 |
| UTERU20178100 | 2437 | 2178..2528 | 4880 |
| UTERU20179880 | 2438 | 172..2379 | 4881 |
| UTERU20183640 | 2439 | 2289..2828 | 4882 |
| UTERU20185230 | 2440 | 125..1927 | 4883 |
| UTERU20186740 | 2441 | 851..1156 | 4884 |
| UTERU20188110 | 2442 | 125..1135 | 4885 |
| UTERU20188810 | 2443 | 84..389 | 4886 |
Namely, primers used to synthesize polynucleotides can be designed based on the nucleotide sequences of polynucleotides of the present invention shown in SEQ ID NOs in the above Table 1. When one intends to synthesize full-length cDNAs, an oligo dT primer can be used as the 3′-end primer. The length of the primers is usually 15-100 bp, and favorably between 15-35 bp. In case of LA PCR, which is described below, the primer length of 25-35 bp may provide a good result.
A method to design a primer that enables a specific amplification based on the aimed nucleotide sequence is known to those skilled in the art (Current Protocols in Molecular Biology, Ausubel et al. edit, (1987) John Wiley & Sons, Section 6.1-6.4). In designing a primer based on the 5′-end sequence, the primer is designed so as that, in principle, the amplification products will include the translation start site. Accordingly, for example, when the 5′-end primer is designed based on the nucleotide sequence of 5′ untranslated region (5′UTR), any part of the 5′-end, which ensures the specificity to the cDNA of interest, can be selected as the primer.
When synthesizing a full-length cDNA, the target nucleotide sequence to be amplified can extend to several thousand bp in some cDNA. However, it is possible to amplify such a long nucleotides by using such as LA PCR (Long and Accurate PCR). It is advantageous to use LA PCR when synthesizing long DNA. In LA PCR, in which a special DNA polymerase having 3′->5′ exonuclease activity is used, misincorporated nucleotides can be removed. Accordingly, accurate synthesis of the complementary strand can be achieved even with a long nucleotide sequence. By using LA PCR, it is reported that amplification of a nucleotide with 20 kb longer can be achieved under desirable conditions (Takeshi Hayashi (1996) Jikken-Igaku Bessatsu, “Advanced Technologies in PCR” Youdo-sha).
A template DNA for synthesizing the full-length cDNA of the present invention can be obtained by using cDNA libraries that are prepared by various methods. The full-length cDNA clones of the present invention are clones with high probability of completeness in length, which were obtained by the method comprising the steps of [1] preparing libraries containing cDNAs with the very high fullness ratio by oligo-capping, and [2] assembling the 5′-end sequences and selecting one with the highest probability of completeness in length in the cluster formed (there are many clones longer in the 5′-end direction).
However, the uses of primers designed based on the full-length nucleotide sequences provided by the present invention enable easily obtaining full-length cDNAs without such a special technique.
The problem with the cDNA libraries prepared by the known methods or commercially available is that mRNA contained in the libraries has very low fullness ratio. Thus, it is difficult to screen full-length cDNA clone directly from the library using ordinary cloning methods. The present invention has revealed a nucleotide sequence of novel full-length cDNA. If a full-length nucleotide sequence is provided, it is possible to synthesize a target full-length cDNA by using enzymatic reactions such as PCR. In particular, a full-length-enriched cDNA library, synthesized by methods such as oligo-capping, is desirable to synthesize a full-length cDNA with more reliability.
The 5′-end sequence of the full-length cDNA clones of the invention can be used to isolate the regulatory element of transcription including the promoter on the genome. A rough draft of the human genome (analysis of human genomic sequence with lower accuracy), which covers 90% of the genome, has been reported (Nature, Vol. 409, 814-823, 2001), and by the year 2003, analysis of the entire human genomic sequence is going to be finished. However, it is hard to analyze with software the transcription start sites on the human genome, in which long introns exist. By contrast, it is easy to specify the transcription start site on the genomic sequence using the nucleotide sequence which includes the 5′-end of the full-length cDNA clone of the present invention, and thus it is easy to obtain the genomic region involved in transcription regulation, which includes the promoter that is contained in the upstream of the transcription start site.
The polypeptide encoded by the full-length cDNA of the invention can be prepared as a recombinant polypeptide or as a natural polypeptide. For example, the recombinant polypeptide can be prepared by inserting the polynucleotide encoding the polypeptide of the invention into a vector, introducing the vector into an appropriate host cell and purifying the polypeptide expressed within the transformed host cell, as described below. In contrast, the natural polypeptide can be prepared, for example, by utilizing an affinity column to which an antibody against the polypeptide of the invention (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wiley & Sons, Section 16.1-16.19) is attached. The antibody used for affinity purification may be either a polyclonal antibody, or a monoclonal antibody. Alternatively, in vitro translation (See, for example, “On the fidelity of mRNA translation in the nuclease-treated rabbit reticulocyte lysate system.” Dasso M. C., and Jackson R. J. (1989) Nucleic Acids Res. 17: 3129-3144) may be used for preparing the polypeptide of the invention.
Polypeptides functionally equivalent to the polypeptides of the present invention can be prepared based on the activities, which were clarified in the above-mentioned manner, of the polypeptides of the present invention. Using the biological activity possessed by the polypeptide of the invention as an index, it is possible to verify whether or not a particular polypeptide is functionally equivalent to the polypeptide of the invention by examining whether or not the polypeptide has said activity.
Polypeptides functionally equivalent to the polypeptides of the present invention can be prepared by those skilled in the art, for example, by using a method for introducing mutations into an amino acid sequence of a polypeptide (for example, site-directed mutagenesis (Current Protocols in Molecular Biology, edit, Ausubel et al., (1987) John Wiley & Sons, Section 8.1-8.5) Besides, such polypeptides can be generated by spontaneous mutations. The present invention also includes a polypeptide comprising the amino acid sequence shown in Table 1 in which one or more amino acids are substituted, deleted, inserted, and/or added, as long as the polypeptides have the equivalent functions to those of the polypeptides identified in the present Examples described later.
There are no limitations on the number and sites of amino acid mutations, as long as the polypeptides maintain the functions thereof. The number of mutations typically corresponds to 30% or less, or 20% or less, or 10% or less, preferably 5% or less, or 3% or less of the total amino acids, more preferably 2% or less or 1% or less of the total amino acids. Alternatively, herein, substitution of one or more amino acids includes substitution of several amino acids. As used herein, the term “several amino acids” means, for example, 5 amino acids, preferably 4 or 3 amino acids, more preferably 2 amino acids, and further preferably 1 amino acid.
From the viewpoint of maintaining the polypeptide function, it is preferable that a substituted amino acid has a similar property to that of the original amino acid. For example, Ala, Val, Leu, Ile, Pro, Met, Phe and Trp are assumed to have similar properties to one another because they are all classified into a group of non-polar amino acids. Similarly, substitution can be performed among non-charged amino acid such as Gly, Ser, Thr, Cys, Tyr, Asn, and Gln, acidic amino acids such as Asp and Glu, and basic amino acids such as Lys, Arg, and His.
In addition, polypeptides functionally equivalent to the polypeptides of the present invention can be isolated by using techniques of hybridization or gene amplification known to those skilled in the art. Specifically, using the hybridization technique (Current Protocols in Molecular Biology, edit, Ausubel et al., (1987) John Wiley & Sons, Section 6.3-6.4)), those skilled in the art can usually isolate a polynucleotide highly homologous to the polynucleotide encoding the polypeptide identified in the present Example based on the identified nucleotide sequence (Table 1) or a portion thereof and obtain the functionally equivalent polypeptide from the isolated polynucleotide. The present invention include polypeptides encoded by the polynucleotides hybridizing with the polynucleotides encoding the polypeptides identified in the present Example, as long as the polypeptides are functionally equivalent to the polypeptides identified in the present Example. Organisms from which the functionally equivalent polypeptides are isolated are illustrated by vertebrates such as human, mouse, rat, rabbit, pig and bovine, but are not limited to these animals.
Washing conditions of hybridization for the isolation of polynucleotides encoding the functionally equivalent polypeptides are usually “1×SSC, 0.1% SDS, 37° C.”; more stringent conditions are “0.5×SSC, 0.1% SDS, 42° C.”; and still more stringent conditions are “0.1×SSC, 0.1% SDS, 65° C.”. Alternatively, the following conditions can be given as hybridization conditions of the present invention. Namely, conditions in which the hybridization is done at “6×SSC, 40% Formamide, 25° C.”, and the washing at “1×SSC, 55° C.” can be given. More preferable conditions are those in which the hybridization is done at “6×SSC, 40% Formamide, 37° C.”, and the washing at “0.2×SSC, 55° C.”. Even more preferable are those in which the hybridization is done at “6×SSC, 50% Formamide, 37° C.”, and the washing at “0.1×SSC, 62° C.”. The more stringent the conditions of hybridization are, the more frequently the polynucleotides highly homologous to the probe sequence are isolated. Therefore, it is preferable to conduct hybridization under stringent conditions. Examples of stringent conditions in the present invention are, washing conditions of “0.5×SSC, 0.1% SDS, 42° C.”, or alternatively, hybridization conditions of “6×SSC, 40% Formamide, 37° C.”, and the washing at “0.2×SSC, 55° C.”.
One skilled in the art can suitably select various conditions, such as dilution ratios of SSC, formamide concentrations, and temperatures to accomplish a similar stringency.
However, the above-mentioned combinations of SSC, SDS and temperature conditions are indicated just as examples. Those skilled in the art can select the hybridization conditions with similar stringency to those mentioned above by properly combining the above-mentioned or other factors (for example, probe concentration, probe length and duration of hybridization reaction) that determines the stringency of hybridization.
The amino acid sequences of polypeptides isolated by using the hybridization techniques usually have high identity to those of the polypeptides of the present invention, which are shown in Table 1. The present invention encompasses a polynucleotide comprising a nucleotide sequence that has a high identity to the nucleotide sequence of claim 1(a). Furthermore, the present invention encompasses a peptide, or polypeptide comprising an amino acid sequence that has a high identity to the amino acid sequence encoded by the polynucleotide of claim 1(b). The term “high identity” indicates sequence identity of at least 40% or more; preferably 60% or more; and more preferably 70% or more. Alternatively, more preferable is identity of 90% or more, or 93% or more, or 95% or more, furthermore, 97% or more, or 99% or more. The identity can be determined by using the BLAST search algorithm.
As used herein, “percent identity” of amino acid sequences or nucleic acids is determined using the algorithm BLAST of Karlin and Altschul (Proc. Natl. Acad. Sci. USA 90:5873-5877, 1993). Such an algorithm is incorporated into the BLASTN and BLASTX programs of Altschul et al. (J. Mol. Biol.215:403-410, 1990). BLAST nucleotide searches are performed with the BLASTN program, for example, score=100, wordlength=12. BLAST protein searches are performed with the BLASTX program, for example, score=50, wordlength=3. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs are used. See http://www.ncbi.nlm.nih.gov.
With the gene amplification technique (PCR) (Current Protocols in Molecular Biology, edit, Ausubel et al., (1987) John Wiley & Sons, Section 6.1-6.4)) using primers designed based on the nucleotide sequence (Table 1) or a portion thereof identified in the present Example, it is possible to isolate a polynucleotide fragment highly homologous to the polynucleotide sequence or a portion thereof and to obtain functionally equivalent polypeptide to a particular polypeptide identified in the present Example based on the isolated polynucleotide fragment.
The present invention also provides a polynucleotide containing at least 15 nucleotides complementary to a polynucleotide comprising a nucleotide sequence of SEQ ID NOs shown in Table 1 or the complementary strand thereof. Herein, the term “complementary strand” is defined as one strand of a double strand DNA composed of A:T and G:C base pair to the other strand. Also, “complementary” is defined as not only those completely matching within a continuous region of at least 15 nucleotides, but also having a identity of at least 70%, favorably 80% or higher, more favorably 90% or higher, and most favorably 95% or higher within that region. The identity may be determined using the algorithm described herein.
Such a polynucleotide includes probes and primers used for the detection and amplification of a polynucleotide encoding the inventive polypeptide. When used as a primer, the polynucleotide usually comprises 15 to 100 bp, and preferably of 15 to 35 bp. When used as a probe, the polynucleotide comprises the whole or a part of the sequence of a polynucleotide of the invention, and comprises at least 15 bp. When used as primers, such polynucleotides are complementary at the 3′-end, and restriction enzyme recognition sequences or tags can be added to the 5′-end.
Furthermore, polynucleotides of the present invention include an antisense polynucleotide for suppressing the expression of a polypeptide of the invention, which comprises an amino acid sequence of SEQ ID NOs shown in Table 1. To exert an antisense effect, an antisense polynucleotide has at least 15 bp or more, for example 50 bp or more, preferably 100 bp or more, and more preferably 500 bp or more, and usually has 3000 bp or less, and preferably 2000 bp or less. Antisense polynucleotides can be used in the gene therapy of diseases caused by abnormalities of the polypeptides of the invention (abnormal function or abnormal expression). An antisense polynucleotide can be prepared, for example, by the phosphorothioate method (“Physicochemical properties of phosphorothioate oligodeoxynucleotides.” Stein (1988) Nucleic Acids Res. 16: 3209-3221) based on the sequence information of polynucleotide encoding a polypeptide of the invention (for example, the nucleotide sequences of SEQ ID NO: 1 to 2443).
The polynucleotides or antisense polynucleotides of the present invention can be used in, for example, gene therapy. As target diseases, for example, cancers or various inflammatory diseases may be preferable. These molecules can be used for gene therapy, for example, by administrating them to patients by the in vivo or ex vivo method using virus vectors such as retrovirus vectors, adenovirus vectors, and adeno-related virus vectors, or non-virus vectors such as liposomes.
The present invention also includes a partial peptide of the polypeptides of the invention. The partial peptide comprises a polypeptide generated as a result that a signal peptide has been removed from a secretory protein. If the polypeptide of the present invention has an activity as a receptor or a ligand, the partial peptide may function as a competitive inhibitor of the polypeptide and may bind to the receptor (or ligand). In addition, the present invention includes an antigen peptide for raising antibodies. For the peptides to be specific for the polypeptide of the invention, the peptides comprise at least 7 amino acids, preferably 8 amino acids or more, more preferably 9 amino acids or more, and even more preferably 10 amino acids or more. The peptide can be used for preparing antibodies against the polypeptide of the invention, or competitive inhibitors of them, and also screening for a receptor that binds to the polypeptide of the invention. The partial peptides of the invention can be produced, for example, by genetic engineering methods, known methods for synthesizing peptides, or digesting the polypeptide of the invention with an appropriate peptidase.
The present invention also relates to a vector into which a polynucleotide of the invention is inserted. The vector of the invention is not limited as long as it contains the inserted polynucleotide stably. For example, if E. coli is used as a host, vectors such as pBluescript vector (Stratagene) are preferable as a cloning vector. To produce the polypeptide of the invention, expression vectors are especially useful. Any expression vector can be used as long as it is capable of expressing the polypeptide in vitro, in E. coli, in cultured cells, or in vivo. For example, PBEST vector (Promega) is preferable for in vitro expression, pET vector (Invitrogen) for E. coli, pME18S-FL3 vector (GenBank Accession No. AB009864) for cultured cells, and pME18S vector (Mol. Cell. Biol. (1988) 8: 466-472) for in vivo expression. To insert the polynucleotide of the invention, ligation utilizing restriction sites can be performed according to the standard method (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wiley & Sons, Section 11.4-11.11).
Recently, the technique of GATEWAY™ system (Invitrogen), which is an expression vector construction system for polypeptide expression, has been developed (Experimental Medicine, Vol. 18, No. 19 (December), p2716-2717, 2000). This system includes two types of site-specific recombinases (BP CLONASE™ and LR CLONASE™) derived from lambda phage and uses BP CLONASE™-specific recombination sites for an Entry Vector and LR CLONASE™-specific recombination sites for a Destination Vector, which may comprise a tag useful for polypeptide purification. With this system, an expression vector can be obtained by using homologous recombination.
First, a polynucleotide fragment of interest is inserted into the entry vector using the first recombination. Then, the secondary recombination is allowed to take place between the entry vector, where the polynucleotide fragment of interest has been inserted, and the destination vector. Thus, the expression vector can be prepared rapidly and highly efficiently. With the above-mentioned typical method using restriction enzyme and ligase reactions, the step of expression vector construction and expression of polypeptide of interest takes about 7 to 10 days. However, with the GATEWAY™ system, the polypeptide of interest can be expressed and prepared in only 3 to 4 days. Thus, the system ensures a high-throughput functional analysis for expressed polypeptides (http://biotech.nikkeibp.co.jp/netlink/lto/gateway/).
The present invention also relates to a transformant carrying the vector of the invention. Any cell can be used as a host into which the vector of the invention is inserted, and various kinds of host cells can be used depending on the purposes. For strong expression of the polypeptide in eukaryotic cells, COS cells or CHO cells can be used, for example.
Introduction of the vector into host cells can be performed, for example, by calcium phosphate precipitation method, electroporation method (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wiley & Sons, Section 9.1-9.9), lipofectamine method (GIBCO-BRL), or microinjection method, etc.
Further, a polynucleotide containing at least 15 nucleotides comprising a nucleotide sequence of any one of the polynucleotides comprising the nucleotide sequences of SEQ ID NOs shown in Table 1 or the complementary strand thereof can be used not only as a primer for synthesizing full-length cDNAs but also for testing and diagnosing the abnormalities of the polypeptide encoded by the full-length cDNA of the present invention. For example, by utilizing polymerase chain reaction (genomic DNA-PCR, or RT-PCR) using the polynucleotide of the invention as a primer, polynucleotide encoding the polypeptide of the invention can be amplified. It is also possible to obtain the regulatory region of expression in the 5′-upstream by using PCR or hybridization since the transcription start site within the genomic sequence can be easily specified based on the 5′-end sequence of the full-length cDNA. The obtained genomic region can be used for detection and/or diagnosis of the abnormality of the sequence by RFLP analysis, SSCP, or sequencing. Especially, in the case where expression of the mRNA of the present invention varies according to a specific disease, analysis of the amount of expression of the mRNA using the polynucleotide of the present invention as a probe or a primer enables detection and diagnosis of the disease.
The present invention also relates to antibodies that bind to the polypeptide of the invention. There are no limitations in the form of the antibodies of the invention. They include polyclonal antibodies, monoclonal antibodies, or their portions that can bind to an antigen. They also include antibodies of all classes. Furthermore, special antibodies such as humanized antibodies and chimeric antibodies are also included.
The polyclonal antibody of the invention can be obtained according to the standard method by synthesizing an oligopeptide corresponding to the amino acid sequence and immunizing rabbits with the peptide (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wiley & Sons, Section 11.12-11.13). The monoclonal antibody of the invention can be obtained according to the standard method by purifying the polypeptide expressed in E. coli, immunizing mice with the polypeptide, and producing a hybridoma cell by fusing the spleen cells and myeloma cells (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wiley & Sons, Section 11.4-11.11).
The antibody binding to the polypeptide of the present invention can be used for purification of the polypeptide of the invention, and also for detection and/or diagnosis of the abnormalities of the expression and structure of the polypeptide. Specifically, polypeptides can be extracted, for example, from tissues, blood, or cells, and the polypeptide of the invention is detected by Western blotting, immunoprecipitation, or ELISA, etc. for the above purpose.
Furthermore, the antibody binding to the polypeptide of the present invention can be utilized for treating the diseases that associates with the polypeptide of the invention. If the antibodies are used for treating patients, human antibodies, humanized antibodies, or chimeric antibodies are preferable in terms of their low antigenicity. The human antibodies can be prepared by immunizing a mouse whose immune system is replaced with that of human (e.g., see “Functional transplant of megabase human immunoglobulin loci recapitulates human antibody response in mice” Mendez, M. J. et al. (1997) Nat. Genet. 15: 146-156). The humanized antibodies can be prepared by recombination of the hypervariable region of a monoclonal antibody (Methods in Enzymology (1991) 203: 99-121).
A cDNA of the present invention encodes, for example, an amino acid sequence of a protein that is predicted to have the following function. The use of the amino acid sequences of the polypeptides encoded by the cDNAs of the present invention enables predicting that the polypeptides have the following functions. It can be predict, from the results of homology search of SwissProt, GenBank, UniGene, or nr, that these polypeptides have such functions. Specifically, for instance, as shown in Examples, searching for a known gene or polypeptide that is homologous to the partial sequence of the full-length cDNA of the invention (2443 clone) and referring the function of the gene and of the polypeptide encoded by the gene make it possible to predict the function of the polypeptide encoded by the cDNA of the invention. In this way, each of 1216 clones out of the 2443 full-length cDNA clones of the invention was predicted to encode a polypeptide that was classified into the following categories.
Secretory and/or membrane protein (632 clones)
Glycoprotein-related protein (128 clones)
Signal transduction-related protein (84 clones)
Transcription-related protein (144 clones)
Disease-related protein (387 clones)
Enzyme and/or metabolism-related protein (206 clones)
Cell division- and/or cell proliferation-related protein (33 clones)
Cytoskeleton-related protein (75 clones)
Nuclear protein and/or RNA synthesis-related protein (65 clones)
Protein synthesis- and/or transport-related protein (62 clones)
Cellular defense-related protein (15 clones)
Development and/or differentiation-related protein (13 clones)
DNA- and/or RNA-binding protein (174 clones)
ATP- and/or GTP-binding protein (68 clones)
The functions of the polypeptides encoded by the cDNAs of the present invention can be predicted by assessing the presence of signal sequence, transmembrane region, nuclear translocation signal, glycosylation signal, phosphorylation site, and zinc finger motif, SH3 domain, etc. in the amino acid sequences. The programs, PSORT (Nakai K., and Kanehisa M. (1992) Genomics 14: 897-911), SOSUI (Hirokawa T. et al. (1998) Bioinformatics 14: 378-379) (Mitsui Knowledge Industry), and MEMSAT (Jones D. T., Taylor W. R., and Thornton J. M. (1994) Biochemistry 33: 3038-3049) can be used to predict the existence of the signal sequence or transmembrane region. Alternatively, a partial amino acid sequence of the polypeptide is fused with another polypeptide such as GFP, the fusion polypeptide is transfected into cultured cells, and the localization is analyzed to predict the function of the original polypeptide.
Based on the determined nucleotide sequences of the full-length cDNAs obtained in the present invention, it is possible to predict more detailed functions of the polypeptides encoded by the cDNA clones, for example, by searching the databases such as GenBank, Swiss-Prot, UniGene, and nr for homologies of the cDNAs; or by searching the amino acid sequences deduced from the full-length cDNAs for signal sequences by using software programs such as PSORT, for transmembrane regions by using software programs such as SOSUI or for motifs by using software programs such as Pfam (http://www.sanger.ac.uk/Software/Pfam/index.shtml) and PROSITE (http://www.expasy.ch/prosite/). As a matter of course, the functions are often predictable by using partial sequence information (preferably 300 nucleotides or more) instead of the full-length nucleotide sequences. However, the result of the prediction by using partial nucleotide sequence does not always agree with the result obtained by using full-length nucleotide sequence, and thus, it is needless to say that the prediction of function is preferably performed based on the full-length nucleotide sequences.
GenBank, Swiss-Prot, UniGene and nr databases were searched for homologies of the full-length nucleotide sequences of the 2443 clones (see Example 6). The amino acid sequences deduced from the full-length nucleotide sequences were searched for functional domains by PSORT, SOSUI and Pfam. Prediction of functions of polypeptides encoded by the clones and the categorization thereof were performed based on these results obtained. The categorization was carried out by the following method.
[1] Firstly, the cDNA clones were classified into the above-mentioned 14 functional categories based on the results of annotation-based categorization (using the keywords in the case of Swiss-Prot hit data; using Definition or Reference information in the case of GenBank, UniGene, or nr hit data), and the signal sequence search of the deduced ORFs by PSORT and the transmembrane region search by SOSUI.
[2] Secondly, clones which had been unassignable to the categories by the method of [1] were searched for functional domains and/or motifs by Pfam. Based on the results, the clones were additionally classified into the above-mentioned 14 types of categories when they had a functional domain and/or motif assignable to any one of the categories.
The following 632 clones presumably belong to secretory and/or membrane proteins.
ADIPS10000640, ADRGL10001470, ADRGL20013520, ADRGL20018540, ADRGL20035850, ASTRO20001410, ASTRO20005330, ASTRO20033160, ASTRO20055750, ASTRO20058630, ASTRO20190390, BEAST20004540, BGGI110000240, BNGH420088500, BRACE20006400, BRACE20038000, BRACE20038470, BRACE20039040, BRACE20039540, BRACE20051380, BRACE20053630, BRACE20059370, BRACE20060550, BRACE20061050, BRACE20063630, BRACE20067430, BRACE20069090, BRACE20081720, BRACE20101700, BRACE20101710, BRACE20116110, BRACE20147800, BRACE20153680, BRACE20163350, BRACE20179340, BRACE20188470, BRACE20195100, BRACE20201570, BRACE20210140, BRACE20224480, BRACE20224500, BRACE20228480, BRACE20232840, BRACE20238000, BRACE20273890, BRACE20274080, BRALZ20013500, BRALZ20054710, BRALZ20064740, BRALZ20069760, BRALZ20073760, BRALZ20077930, BRAMY20000860, BRAMY20002770, BRAMY20025840, BRAMY20039260, BRAMY20060920, BRAMY20063970, BRAMY20111960, BRAMY20112800, BRAMY20124260, BRAMY20134140, BRAMY20135900, BRAMY20136210, BRAMY20144620, BRAMY20152110, BRAMY20174550, BRAMY20181220, BRAMY20195090, BRAMY20211390, BRAMY20211420, BRAMY20215230, BRAMY20218250, BRAMY20218670, BRAMY20229800, BRAMY20231720, BRAMY20247280, BRAMY20252180, BRAMY20273960, BRAMY20277170, BRAMY20284910, BRAMY20285160, BRAWH20015350, BRAWH20015890, BRAWH20016860, BRAWH20018730, BRAWH20030250, BRAWH20064050, BRAWH20110790, BRAWH20112940, BRAWH20117950, BRAWH20118230, BRAWH20121640, BRAWH20122580, BRAWH20132190, BRCAN20064010, BRCAN20071190, BRCAN20091560, BRCAN20103740, BRCAN20224720, BRCAN20273550, BRCAN20280360, BRCAN20285450, BRCOC10000870, BRCOC20004040, BRCOC20006370, BRCOC20041750, BRCOC20077690, BRCOC20078640, BRCOC20090520, BRCOC20101230, BRCOC20107300, BRCOC20114180, BRCOC20121720, BRCOC20134480, BRCOC20136750, BRHIP10001290, BRHIP20000870, BRHIP20003120, BRHIP20103090, BRHIP20111200, BRHIP20118380, BRHIP20118910, BRHIP20121410, BRHIP20135100, BRHIP20174040, BRHIP20179200, BRHIP20183690, BRHIP20191490, BRHIP20191770, BRHIP20198190, BRHIP20207430, BRHIP20208270, BRHIP20208590, BRHIP20217620, BRHIP20233090, BRHIP20234380, BRHIP20238880, BRHIP20283030, BRHIP30004570, BRSSN20003120, BRSSN20043040, BRSSN20066110, BRSSN20120810, BRSSN20137020, BRSSN20142940, BRSSN20146100, BRSSN20151990, BRSSN20169050, BRSTN20002200, BRTHA20004740, BRTHA20046290, BRTHA20046420, COLON10001350, COLON20093370, CTONG10000100, CTONG10000940, CTONG10001650, CTONG20004690, CTONG20009770, CTONG20092570, CTONG20092580, CTONG20095340, CTONG20099380, CTONG20103480, CTONG20105080, CTONG20114740, CTONG20119200, CTONG20120770, CTONG20124730, CTONG20131490, CTONG20132220, CTONG20133480, CTONG20139340, CTONG20149950, CTONG20155400, CTONG20158660, CTONG20159530, CTONG20161850, CTONG20267700, D3OST10001090, D3OST20036070, D3OST20038560, D3OST30002580, D6OST20005070, D9OST20002780, D9OST20015470, D9OST20023970, D9OST20026730, D9OST20035940, D9OST20040180, DFNES20025880, FCBBF10000240, FCBBF10000380, FCBBF10001150, FCBBF10001210, FCBBF10001550, FCBBF10002430, FCBBF10002700, FCBBF10003220, FCBBF10003760, FCBBF10005460, FCBBF10005740, FCBBF20032970, FCBBF20042560, FCBBF20049300, FCBBF20051220, FCBBF30008470, FCBBF30024750, FCBBF30078290, FCBBF30083620, FCBBF30086440, FCBBF30090690, FCBBF30095260, FCBBF30123470, FCBBF30172550, FCBBF30175310, FCBBF30190850, FCBBF30215060, FCBBF30238870, FCBBF30251420, FCBBF30279030, FEBRA20002100, FEBRA20004620, FEBRA20009090, FEBRA20029860, FEBRA20037260, FEBRA20080810, FEBRA20086620, FEBRA20092890, FEBRA20093520, FEBRA20095880, FEBRA20111460, FEBRA20125070, FEBRA20130190, FEBRA20140100, FEBRA20145780, FEBRA20211710, FEBRA20223220, FEBRA20229630, FEBRA20235500, HCHON20000380, HCHON20008180, HCHON20015980, HCHON20016040, HCHON20016650, HCHON20040020, HCHON20064590, HCHON20067700, HCHON20068710, HCHON20086720, HCHON20100740, HEART20003060, HEART20005410, HEART20034320, HEART20049410, HEART20049800, HEART20072310, HHDPC20001040, HHDPC20014320, HHDPC20034720, HHDPC20068620, HHDPC20084140, HHDPC20091780, HHDPC20092080, HLUNG10000550, KIDNE20003940, KIDNE20007770, KIDNE20011400, KIDNE20021910, KIDNE20022620, KIDNE20100070, KIDNE20101510, KIDNE20109730, KIDNE20121880, KIDNE20125630, KIDNE20126010, KIDNE20126130, KIDNE20127450, KIDNE20130450, KIDNE20131580, KIDNE20137340, KIDNE20181660, LIVER20035110, LIVER20045650, LIVER20055200, LIVER20062510, LIVER20064690, LIVER20075680, LIVER20087060, LIVER20091180, MESAN10001260, MESAN20014500, MESAN20027090, MESAN20038510, MESAN20089360, MESAN20103120, MESAN20115970, MESAN20125860, MESAN20139360, MESAN20152770, MESAN20153910, MESAN20174170, NOVAR20000380, NT2NE20010050, NT2NE20021620, NT2NE20068130, NT2NE20118960, NT2NE20124480, NT2NE20131890, NT2NE20132170, NT2NE20155110, NT2NE20156260, NT2NE20157470, NT2NE20159740, NT2NE20177520, NT2NE20183760, NT2RI20003480, NT2RI20023910, NT2RI20025400, NT2RI20028470, NT2RI20040930, NT2RI20054050, NT2RI20056700, NT2RI20076290, NT2RI20086220, NT2RI20091940, NT2RI20244600, NT2RP70072690, NT2RP70081610, NT2RP70122910, NT2RP70125160, NT2RP70133740, NT2RP70134990, NT2RP70137290, NT2RP70179710, NT2RP70188020, NT2RP70192730, NT2RP70198350, NTONG20028070, NTONG20029700, NTONG20048060, NTONG20049910, NTONG20051530, NTONG20061870, NTONG20063010, NTONG20067830, NTONG20076930, NTONG20092330, OCBBF10001750, OCBBF20013890, OCBBF20019830, OCBBF20023570, OCBBF20026630, OCBBF20046690, OCBBF20050770, OCBBF20059560, OCBBF20063320, OCBBF20071210, OCBBF20072320, OCBBF20080050, OCBBF20086400, OCBBF20086910, OCBBF20087010, OCBBF20088140, OCBBF20091150, OCBBF20107090, OCBBF20108630, OCBBF20116850, OCBBF20120390, OCBBF20122620, OCBBF20130910, OCBBF20132850, OCBBF20145760, OCBBF20155060, OCBBF20178880, OCBBF20180120, OCBBF20180840, OCBBF20188730, PANCR10000910, PEBLM10000710, PEBLM20024320, PEBLM20040150, PEBLM20074370, PEBLM20075980, PERIC20004220, PLACE60086400, PLACE60121080, PLACE60161600, PLACE60177140, PROST20005050, PROST20050670, PROST20107820, PROST20116600, PROST20120160, PROST20127800, PROST20146010, PROST20164440, PROST20169800, PROST20170980, PROST20175290, PUAEN20003740, PUAEN20030180, SALGL10001710, SKMUS20003610, SKMUS20007800, SKMUS20011640, SKMUS20020840, SKMUS20028210, SKMUS20028400, SKMUS20077400, SKNSH20028660, SKNSH20031740, SKNSH20051940, SKNSH20063040, SMINT20009840, SMINT20011990, SMINT20022020, SMINT20029760, SMINT20040860, SMINT20050750, SMINT20053870, SMINT20073650, SMINT20095050, SMINT20100680, SMINT20105330, SMINT20106720, SMINT20121950, SMINT20127930, SMINT20144430, SMINT20144890, SMINT20153260, SMINT20154540, SMINT20157450, SMINT20173240, SMINT20178550, SMINT20191420, SMINT20192000, SPLEN20003070, SPLEN20021660, SPLEN20029310, SPLEN20079510, SPLEN20095810, SPLEN20097330, SPLEN20118300, SPLEN20141360, SPLEN20141990, SPLEN20142100, SPLEN20144520, SPLEN20152760, SPLEN20157880, SPLEN20165310, SPLEN20167200, SPLEN20169220, SPLEN20169720, SPLEN20171890, SPLEN20172120, SPLEN20179810, SPLEN20186430, SPLEN20211570, SPLEN20211940, SPLEN20213830, SPLEN20273950, SPLEN20292950, SPLEN20293800, SPLEN20304950, SPLEN20329240, STOMA20005390, STOMA20005670, STOMA20006400, STOMA20006780, STOMA20008880, STOMA20051200, STOMA20056640, STOMA20056670, STOMA20062130, STOMA20077450, STOMA20080500, STOMA20088380, STOMA20092530, SYNOV20001520, SYNOV20001730, SYNOV20002510, SYNOV20002790, SYNOV20002970, SYNOV20004260, SYNOV20007000, SYNOV20008240, SYNOV20009230, SYNOV20010880, SYNOV20011110, SYNOV20013000, SYNOV20013560, SYNOV20013900, SYNOV30001840, TBAES20003150, TESOP20004000, TESOP20005690, TESTI20001720, TESTI20036380, TESTI20037560, TESTI20094120, TESTI20110280, TESTI20123080, TESTI20123560, TESTI20128350, TESTI20136100, TESTI20136710, TESTI20143390, TESTI20148000, TESTI20164100, TESTI20193360, TESTI20209810, TESTI20209990, TESTI20211220, TESTI20214250, TESTI20216370, TESTI20230250, TESTI20231940, TESTI20242990, TESTI20244190, TESTI20254220, TESTI20254860, TESTI20265970, TESTI20271850, TESTI20272960, TESTI20284880, TESTI20291310, TESTI20291960, TESTI20303220, TESTI20303360, TESTI20303420, TESTI20307700, TESTI20309170, TESTI20314180, TESTI20316870, TESTI20333000, TESTI20335200, TESTI20347180, TESTI20347300, TESTI20352620, TESTI20357960, TESTI20370810, TESTI20373820, TESTI20383880, TESTI20390260, TESTI20390410, TESTI20391770, TESTI20393530, TESTI20396130, TESTI20397760, TESTI20401020, TESTI20401280, TESTI20415170, TESTI20421490, TESTI20422640, TESTI20441940, TESTI20442760, TESTI20444130, TESTI20444180, TESTI20449200, TESTI20463520, TESTI20463580, TESTI20465350, THYMU10005360, THYMU10005540, THYMU20027560, THYMU20032870, THYMU20039810, THYMU20066100, THYMU20081490, THYMU20100410, THYMU20106710, THYMU20111830, THYMU20141670, THYMU20147770, THYMU20159430, THYMU20161640, THYMU20162190, THYMU20173980, THYMU20194420, THYMU20208300, THYMU20216840, THYMU20222890, THYMU20229220, THYMU20241850, THYMU20277390, TKIDN20005210, TRACH20002870, TRACH20003590, TRACH20016210, TRACH20019960, TRACH20029540, TRACH20033230, TRACH20034840, TRACH20042920, TRACH20050040, TRACH20067620, TRACH20068660, TRACH20069180, TRACH20076740, TRACH20085400, TRACH20085830, TRACH20109650, TRACH20111130, TRACH20121380, TRACH20128110, TRACH20128230, TRACH20134950, TRACH20136710, TRACH20139820, TRACH20140820, TRACH20145440, TRACH20168350, TRACH20180840, TRACH20190240, UMVEN20000690, UTERU20030570, UTERU20040610, UTERU20046980, UTERU20055480, UTERU20064860, UTERU20076390, UTERU20094350, UTERU20135860, UTERU20144640, UTERU20158300, UTERU20158800, UTERU20161570, UTERU20178100, UTERU20183640, UTERU20186740
The following 128 clones presumably belong to glycoprotein-related proteins. ADIPS10000640, BRACE20059370, BRACE20163350, BRAMY20277170, BRAMY20285160, BRAWH20064050, BRAWH20112940, BRAWH20117950, BRAWH20118230, BRCAN20103740, BRCOC20004040, BRCOC20006370, BRHIP10001290, BRHIP20103090, BRHIP20283030, BRHIP30004570, BRSSN20003120, BRSSN20146100, BRTHA20046290, COLON10001350, CTONG20159530, D9OST20023970, D9OST20040180, FCBBF10001150, FCBBF20049300, FCBBF30024750, FCBBF30083620, FCBBF30190850, FCBBF30238870, FEBRA20086620, FEBRA20092890, HCHON20015980, HCHON20016040, HCHON20064590, HCHON20086720, HCHON20100740, HEART20003060, HHDPC20014320, HHDPC20068620, HHDPC20092080, KIDNE20003940, KIDNE20007770, KIDNE20101510, LIVER20064690, MESAN20125860, NT2NE20118960, NT2NE20157470, NT2NE20177520, NT2RI20003480, NT2RI20056700, NT2RP70192730, NTONG20051530, NTONG20076930, OCBBF20107090, OCBBF20108630, OCBBF20120390, OCBBF20145760, OCBBF20155060, PLACE60177140, SMINT20050750, SMINT20073650, SMINT20105330, SMINT20106720, SMINT20112730, SMINT20127930, SMINT20153260, SMINT20179740, SMINT20190170, SPLEN20021660, SPLEN20142100, SPLEN20157880, SPLEN20165310, SPLEN20179810, SPLEN20186430, STOMA20001830, STOMA20005390, STOMA20005670, STOMA20006400, STOMA20008880, STOMA20034770, STOMA20056640, STOMA20056670, STOMA20083610, STOMA20088380, STOMA20092530, SYNOV20001520, SYNOV20001730, SYNOV20002510, SYNOV20002790, SYNOV20002970, SYNOV20004260, SYNOV20007000, SYNOV20008240, SYNOV20009230, SYNOV20010880, SYNOV20011110, SYNOV20013000, SYNOV20013560, SYNOV20013900, TESOP20004000, TESTI20136100, TESTI20216370, TESTI20244190, TESTI20254860, TESTI20303220, TESTI20335200, TESTI20352620, TESTI20358980, TESTI20442760, TESTI20449200, TESTI20455090, THYMU10005360, THYMU10005540, THYMU20147770, THYMU20159430, THYMU20241850, TRACH20016210, TRACH20050040, TRACH20067620, TRACH20069180, TRACH20076740, TRACH20128230, UTERU20046980, UTERU20064860, UTERU20144640, UTERU20158800, UTERU20161570, UTERU20183640
The following 84 clones presumably belong to signal transduction-related proteins.
ASTRO20108190, BRACE20115920, BRACE20154120, BRACE20177200, BRACE20237270, BRAMY20104640, BRAMY20242470, BRAMY20271400, BRAWH20016620, BRAWH20103290, BRAWH20149340, BRCOC20021550, BRCOC20091960, BRHIP20189980, BRHIP20218580, BRHIP20238600, BRSSN20038200, CD34C30004240, CTONG20118150, CTONG20127450, CTONG20200310, FCBBF30012350, FCBBF40001730, FEBRA10001880, FEBRA20004620, FEBRA20132740, FEBRA20144170, FEHRT20003250, HCHON20007510, HLUNG20033780, IMR3220002430, KIDNE20008010, KIDNE20102710, KIDNE20107620, NT2NE20080170, NT2NE20181650, NT2RP70027380, NT2RP70036880, NT2RP70063950, NT2RP70078420, NT2RP70159960, NTONG20046140, NTONG20056570, OCBBF20028050, OCBBF20053430, OCBBF20054760, OCBBF20124360, OCBBF20127140, OCBBF20149280, OCBBF20173980, PEBLM20013120, PEBLM20085760, PROST20161950, PUAEN20015260, PUAEN20015860, PUAEN20083140, SMINT20028820, SMINT20049090, SMINT20110660, SPLEN20011410, SPLEN20121750, SPLEN20170310, SPLEN20181810, SPLEN20222270, SPLEN20250170, SPLEN20283650, TESTI20035960, TESTI20288910, TESTI20305540, TESTI20326810, TESTI20369650, TESTI20392250, TESTI20416640, TESTI20432750, TESTI20467320, THYMU20169680, THYMU20172150, THYMU20201980, THYMU20202890, TKIDN20004640, TKIDN20047480, TRACH20057690, UMVEN10001860, UTERU20146310
The following 144 clones presumably belong to transcription-related proteins.
3NB6920014590, ADIPS20004250, ASTRO20008010, ASTRO20168470, BLADE20003400, BLADE20003890, BRACE20060890, BRACE20068590, BRACE20257100, BRAMY20210400, BRAMY20260910, BRAMY20270730, BRAWH20028110, BRAWH20075700, BRAWH20096780, BRCAN20280210, BRCOC20144000, BRCOC20178270, BRHIP20005340, BRHIP20096170, BRHIP20119330, BRHIP20191860, BRHIP20195890, BRHIP20222280, BRSSN20039370, BRSSN20046790, BRSSN20176820, CTONG20050280, CTONG20075860, CTONG20085950, CTONG20091080, CTONG20092700, CTONG20121010, CTONG20124220, CTONG20133390, CTONG20133520, D9OST20033970, FCBBF10001710, FCBBF10004370, FCBBF20059090, FCBBF20068820, FCBBF30007680, FCBBF30010810, FCBBF30018550, FCBBF30025560, FCBBF30057290, FCBBF30083820, FCBBF30129630, FCBBF30240960, FCBBF30246230, FEBRA20018690, FEBRA20026110, FEBRA20034680, FEBRA20040530, FEBRA20082010, FEBRA20171380, FEBRA20195820, FEBRA20233770, HCHON20008320, HCHON20009560, HCHON20035130, HHDPC10000830, HHDPC20030490, HHDPC20031130, KIDNE20027250, KIDNE20027950, KIDNE20182690, LIVER20055440, NT2NE20010490, NT2NE20089970, NT2NE20142210, NT2NE20184900, NT2RP60000770, NT2RP70043480, NT2RP70063950, NT2RP70102350, NT2RP70157890, NTONG20070200, OCBBF10001850, OCBBF20020830, OCBBF20037440, OCBBF20046120, OCBBF20049300, OCBBF20054200, OCBBF20066390, OCBBF20071840, OCBBF20080410, OCBBF20108190, OCBBF20125530, OCBBF20148280, PEBLM20060360, PEBLM20078320, PERIC20003870, PROST10003220, PROST20047390, PROST20066880, PROST20185830, PROST20189770, PROST20191640, SKNSH20008190, SMINT20001760, SMINT20028820, SMINT20130320, SMINT20144800, SPLEN20026950, SPLEN20054290, SPLEN20079260, SPLEN20095410, SPLEN20117660, SPLEN20140800, SPLEN20147390, SPLEN20160450, SPLEN20162680, SPLEN20243830, SPLEN20250170, SPLEN20252190, SPLEN20267650, STOMA20032890, STOMA20063250, TESTI20039400, TESTI20041690, TESTI20067200, TESTI20088220, TESTI20130010, TESTI20156100, TESTI20230850, TESTI20318090, TESTI20320670, TESTI20378190, TESTI20385960, TESTI20409890, TESTI20420620, TESTI20432820, TESTI20456110, THYMU20247480, TRACH20079690, TRACH20154860, TRACH20163170, TRACH20164980, TRACH20184490, UTERU20099720, UTERU20116570, UTERU20145480, UTERU20176130
The following 387 clones presumably belong to disease-related proteins.
ADIPS20004250, ADRGL10001470, ADRGL20011190, ADRGL20018300, ADRGL20035850, ADRGL20078100, ASTRO10001650, ASTRO20008010, ASTRO20027430, ASTRO20106150, ASTRO20108190, ASTRO20168470, BLADE20003400, BLADE20003890, BRACE20038480, BRACE20039540, BRACE20059370, BRACE20108130, BRACE20108880, BRACE20115920, BRACE20116460, BRACE20232840, BRACE20248260, BRACE20253330, BRACE20284100, BRALZ20013500, BRALZ20017430, BRALZ20018340, BRAMY20000520, BRAMY20025840, BRAMY20120910, BRAMY20134140, BRAMY20135900, BRAMY20162510, BRAMY20174550, BRAMY20210400, BRAMY20211390, BRAMY20242470, BRAMY20245300, BRAMY20266850, BRAMY20285160, BRAWH20016620, BRAWH20028110, BRAWH20064050, BRAWH20096780, BRAWH20110960, BRAWH20113430, BRAWH20114000, BRAWH20118230, BRAWH20121640, BRAWH20128270, BRAWH20137480, BRCAN20103740, BRCAN20224720, BRCAN20279700, BRCAN20280210, BRCAN20283190, BRCOC20001860, BRCOC20006370, BRCOC20027510, BRCOC20055420, BRCOC20099370, BRCOC20178270, BRCOC20178560, BRHIP20003120, BRHIP20005340, BRHIP20174040, BRHIP20176420, BRHIP20191490, BRHIP20191860, BRHIP20194940, BRHIP20195890, BRHIP20222280, BRHIP20249110, BRHIP20285930, BRHIP30004880, BRSSN20013420, BRSSN20038200, BRSSN20039370, BRSSN20046790, BRSSN20066110, BRSSN20101100, BRSSN20120810, BRSSN20187310, BRTHA20046290, CD34C30004240, COLON10001350, CTONG20004690, CTONG20052650, CTONG20099550, CTONG20124220, CTONG20125640, CTONG20128430, CTONG20131560, CTONG20133390, CTONG20153300, CTONG20153580, CTONG20158040, CTONG20159530, D6OST20003580, D9OST20023970, DFNES20001530, DFNES20037420, FCBBF10001210, FCBBF10001710, FCBBF10003770, FCBBF20059090, FCBBF20064520, FCBBF20068820, FCBBF30010810, FCBBF30024750, FCBBF30025560, FCBBF30039020, FCBBF30049550, FCBBF30057290, FCBBF30083620, FCBBF30129630, FCBBF30190850, FCBBF30238870, FCBBF30240960, FCBBF30243640, FCBBF30279030, FCBBF30281880, FCBBF40001730, FEBRA10001880, FEBRA20004620, FEBRA20010120, FEBRA20018690, FEBRA20082010, FEBRA20097310, FEBRA20130190, FEBRA20132740, FEBRA20144170, FEBRA20195820, FEBRA20223220, FEBRA20233770, FEBRA20235500, FEHRT20003250, HCHON10001760, HCHON20007380, HCHON20008320, HCHON20009560, HCHON20015230, HCHON20015980, HCHON20016040, HCHON20035130, HCHON20036420, HCHON20064590, HCHON20067700, HCHON20086720, HCHON20100740, HEART20003060, HEART20017730, HEART20025980, HEART20049410, HHDPC20014320, HHDPC20030490, HHDPC20084140, HHDPC20091140, HHDPC20091780, HHDPC20092080, HLUNG20033780, IMR3220002430, KIDNE20007770, KIDNE20020150, KIDNE20021680, KIDNE20022620, KIDNE20024830, KIDNE20027950, KIDNE20101370, KIDNE20101510, KIDNE20182690, LIVER20002160, LIVER20055200, LIVER20055440, LIVER20059810, LIVER20064690, MESAN20101140, MESAN20125860, MESAN20130220, MESAN20154010, MESAN20174170, NOVAR10000910, NT2NE20010490, NT2NE20118960, NT2NE20157470, NT2RI20040990, NT2RI20041880, NT2RI20048840, NT2RI20050960, NT2RI20240080, NT2RP60000770, NT2RP70027380, NT2RP70032610, NT2RP70037240, NT2RP70192730, NT2RP70198350, NTONG20013620, NTONG20015870, NTONG20028070, NTONG20067830, NTONG20070200, NTONG20090600, NTONG20092330, OCBBF20006770, OCBBF2003744.0, OCBBF20046120, OCBBF20049300, OCBBF20053490, OCBBF20053730, OCBBF20054760, OCBBF20071840, OCBBF20072240, OCBBF20078920, OCBBF20108430, OCBBF20108580, OCBBF20127140, OCBBF20129360, OCBBF20145760, OCBBF20153350, OCBBF20173980, OCBBF20178880, PEBLM10000710, PEBLM20013120, PERIC10000250, PLACE60060420, PLACE60177140, PROST20100460, PROST20159240, PROST20169800, PROST20176170, PUAEN20018820, PUAEN20030180, PUAEN20055020, PUAEN20083140, SKMUS20018230, SKMUS20018500, SKMUS20021530, SKMUS20024750, SKMUS20029200, SKMUS20048970, SKMUS20049030, SKNSH20008190, SKNSH20089400, SMINT20001760, SMINT20026890, SMINT20028820, SMINT20050750, SMINT20073650, SMINT20105330, SMINT20112730, SMINT20121220, SMINT20127350, SMINT20127930, SMINT20136130, SMINT20138900, SMINT20153260, SMINT20155180, SMINT20179740, SMINT20190170, SMINT20191420, SPLEN20006070, SPLEN20011410, SPLEN20026950, SPLEN20027440, SPLEN20039240, SPLEN20079260, SPLEN20095410, SPLEN20146450, SPLEN20147390, SPLEN20151210, SPLEN20160450, SPLEN20170310, SPLEN20179180, SPLEN20186430, SPLEN20212730, SPLEN20243830, SPLEN20245300, SPLEN20250390, SPLEN20252190, SPLEN20267650, SPLEN20305620, STOMA20001830, STOMA20005390, STOMA20008880, STOMA20010250, STOMA20034770, STOMA20046680, STOMA20056670, STOMA20064470, STOMA20077450, STOMA20080500, STOMA20083610, STOMA20088380, SYNOV20001520, SYNOV20001730, SYNOV20002790, SYNOV20002970, SYNOV20007000, SYNOV20008240, SYNOV20009230, SYNOV20010880, SYNOV20011110, TBAES20003770, TESOP20004000, TESOP20005270, TESTI20031270, TESTI20036380, TESTI20044310, TESTI20067200, TESTI20116830, TESTI20121550, TESTI20156100, TESTI20168480, TESTI20208400, TESTI20215990, TESTI20231940, TESTI20234360, TESTI20237520, TESTI20238610, TESTI20239510, TESTI20249990, TESTI20266740, TESTI20316870, TESTI20318090, TESTI20335050, TESTI20335200, TESTI20343570, TESTI20352620, TESTI20368330, TESTI20369650, TESTI20385960, TESTI20392250, TESTI20400940, TESTI20404240, TESTI20420620, TESTI20436560, TESTI20438570, TESTI20441940, TESTI20442760, TESTI20443090, TESTI20449200, TESTI20455090, TESTI20455620, TESTI20456110, TESTI20463580, TESTI20465350, TESTI20465690, TESTI20467210, THYMU20122730, THYMU20126900, THYMU20130890, THYMU20159430, THYMU20169680, THYMU20172150, THYMU20180280, THYMU20193640, THYMU20209590, THYMU20232090, THYMU20247480, TKIDN10000010, TKIDN20004640, TKIDN20047480, TRACH20016210, TRACH20019960, TRACH20050040, TRACH20057690, TRACH20067620, TRACH20077540, TRACH20079690, TRACH20096610, TRACH20105870, TRACH20121380, TRACH20154860, TRACH20162860, TRACH20163170, TRACH20164980, TRACH20190240, TSTOM20005690, TUTER20002830, UTERU20030570, UTERU20116570, UTERU20144640, UTERU20151980, UTERU20158800, UTERU20183640, UTERU20185230
The following 206 clones presumably belong to the category of enzymes and/or metabolism-related proteins.
3NB6910001910, ADRGL10001470, ADRGL20035850, ADRGL20078100, ASTRO20105820, ASTRO20106150, ASTRO20130500, ASTRO20145760, BRACE20027620, BRACE20038000, BRACE20062640, BRACE20096200, BRACE20107530, BRACE20108130, BRACE20108880, BRACE20116460, BRACE20148240, BRACE20185680, BRACE20253160, BRALZ20017430, BRALZ20018340, BRAMY20104640, BRAMY20134140, BRAMY20153110, BRAMY20213100, BRAMY20252720, BRAWH20016620, BRAWH20105840, BRAWH20112940, BRAWH20114000, BRAWH20117950, BRAWH20125380, BRAWH20132190, BRAWH20171030, BRCAN20054490, BRCAN20224720, BRCAN20280360, BRCAN20283190, BRCAN20283380, BRCOC20001860, BRCOC20031250, BRCOC20055420, BRCOC20091960, BRCOC20144000, BRHIP10001290, BRHIP20005530, BRHIP20096850, BRHIP20103090, BRHIP20174040, BRHIP20249110, BRSSN20013420, BRSSN20015790, BRSSN20120810, BRSSN20146100, CTONG20095340, CTONG20106520, CTONG20118250, CTONG20127450, CTONG20140580, CTONG20153300, CTONG20158040, D3OST20006180, D6OST20003580, DFNES20031920, DFNES20071130, FCBBF10001820, FCBBF10003670, FCBBF30012350, FCBBF30012810, FCBBF30175310, FCBBF30243640, FEBRA10001880, FEBRA20007620, FEBRA20130190, FEBRA20144170, FEBRA20167390, FEBRA20196630, FEHRT20003250, HCHON10001760, HCHON20003220, HCHON20015350, HEART20034320, HEART20090000, HHDPC20014320; KIDNE20002520, KIDNE20008010, KIDNE20021680, KIDNE20022620, KIDNE20028390, KIDNE20028720, KIDNE20107620, LIVER20059810, MESAN20154010, NT2NE20118960, NT2NE20157470, NT2RI20005750, NT2RI20244600, NT2RI20273230, NT2RP70032610, NT2RP70045590, NT2RP70192730, NT2RP70195430, NTONG20009770, NTONG20013620, NTONG20046140, OCBBF20028650, OCBBF20030910, OCBBF20046690, OCBBF20050770, OCBBF20053430, OCBBF20053490, OCBBF20053730, OCBBF20054760, OCBBF20078920, OCBBF20124360, OCBBF20129360, OCBBF20178880, PEBLM20044520, PEBLM20052820, PEBLM20060490, PERIC10000250, PLACE50000660, PROST20083600, PROST20169800, PUAEN20015260, PUAEN20030180, SKMUS20018230, SMINT20028820, SMINT20049090, SMINT20102780, SMINT20105330, SMINT20106290, SMINT20110660, SMINT20152940, SMINT20191420, SMINT20191530, SPLEN20021660, SPLEN20026950, SPLEN20121750, SPLEN20145720, SPLEN20149240, SPLEN20150940, SPLEN20151210, SPLEN20173510, SPLEN20212730, SPLEN20250390, SPLEN20305620, STOMA20006860, STOMA20077450, TBAES20002550, TBAES20003150, TESOP20004000, TESOP20005270, TESTI20001000, TESTI20002720, TESTI20002780, TESTI20060400, TESTI20066670, TESTI20082330, TESTI20083200, TESTI20108720, TESTI20116830, TESTI20143390, TESTI20148000, TESTI20216370, TESTI20232140, TESTI20234360, TESTI20237520, TESTI20239510, TESTI20266740, TESTI20314180, TESTI20334410, TESTI20343570, TESTI20352620, TESTI20355020, TESTI20366910, TESTI20368330, TESTI20369650, TESTI20375340, TESTI20397760, TESTI20416640, TESTI20432750, TESTI20463580, TESTI20465350, TESTI20471410, TESTI20473830, THYMU20023380, THYMU20111830, THYMU20126900, THYMU20169680, THYMU20202890, TKIDN20004640, TKIDN20047480, TRACH20003590, TRACH20016210, TRACH20019960, TRACH20041830, TRACH20057690, TRACH20067620, TRACH20084720, TRACH20085830, TRACH20162860, UTERU20064860, UTERU20144640, UTERU20146310, UTERU20151980
The following 33 clones presumably belong to the category of cell division- and/or cell proliferation-related proteins.
BRALZ20077900, BRAMY20135900, BRAWH20002320, BRAWH20128270, BRCAN20071190, BRCAN20273640, BRHIP20096170, CTONG10000940, CTONG20124220, FCBBF30247930, FEBRA20113560, HCASM10000500, HCHON20097490, MESAN20025190, NT2RI20050960, OCBBF20039250, OCBBF20054760, OCBBF20072240, SMINT20051610, SPLEN20147110, SPLEN20284240, TESOP20005690, TESTI20234360, TESTI20305540, TESTI20332420, TESTI20335050, TESTI20368330, TESTI20392760, TESTI20400940, THYMU20161640, TKIDN20047480, UTERU20097760, UTERU20185230
The following 75 clones presumably belong to the category of cytoskeleton-related proteins.
ADRGL20011190, ADRGL20018300, ASTRO10001650, ASTRO20055750, BRACE20003070, BRACE20059370, BRACE20163350, BRAMY20121620, BRAMY20157820, BRAMY20242470, BRAWH20028110, BRAWH20137480, BRCAN20003460, BRCOC20008160, BRCOC20059510, BRHIP20115080, BRHIP20137230, BRHIP20167880, BRHIP20283030, BRHIP20285830, BRSSN20187310, CTONG10002770, CTONG20052900, CTONG20121580, FCBBF10001150, FCBBF30013770, FCBBF30015940, FCBBF30049550, FEBRA20024100, FEBRA20237640, HCHON20015980, HCHON20068410, HEART20017730, HEART20025980, HEART20061950, HEART20077670, HLUNG20016330, KIDNE20118580, MESAN20004570, NT2RI20040990, NT2RI20041880, NT2RP70037240, NT2RP70062230, NTONG20015870, NTONG20056570, NTONG20067830, NTONG20090600, OCBBF20107090, OCBBF20155060, PLACE60079250, PUAEN20040670, SKMUS20001980, SKMUS20016220, SKMUS20048970, SKMUS20049030, SMINT20024570, SMINT20026890, SMINT20121220, SMINT20138900, SPLEN20006070, SPLEN20027440, SPLEN20142100, TESTI20063830, TESTI20094230, TESTI20278400, TESTI20371030, TESTI20417300, TESTI20436560, TESTI20455090, THYMU20105190, THYMU20172150, THYMU20209590, TRACH20096610, UMVEN10001560, UTERU20116570
The following 65 clones presumably belong to the category of nuclear proteins and/or RNA synthesis-related proteins.
BRACE20057190, BRACE20064880, BRACE20248260, BRACE20253160, BRAMY20000520, BRAMY20120910, BRAWH20113430, BRAWH20171030, BRCAN10001490, BRCAN20283190, BRCOC20037320, BRCOC20178560, BRHIP20106100, BRHIP20176420, BRHIP20243470, BRSSN20101100, CTONG20114290, CTONG20125540, CTONG20131560, CTONG20140580, DFNES20001530, FCBBF20064520, FEBRA20007620, FEBRA20010120, FEBRA20097310, FEBRA20144170, FEBRA20174410, FEBRA20215500, IMR3220002430, MESAN20101140, NT2RI20273230, OCBBF20028650, OCBBF20030910, OCBBF20078920, PROST20104000, PUAEN20018820, SKMUS20007010, SMINT20127350, SMINT20177360, SMINT20191530, SPLEN20008740, SPLEN20146450, STOMA20046680, TESTI20082330, TESTI20094470, TESTI20121550, TESTI20208400, TESTI20234360, TESTI20237520, TESTI20249990, TESTI20334410, TESTI20355020, TESTI20368330, TESTI20392760, TESTI20408970, TESTI20436560, TESTI20438570, TESTI20443090, THYMU20193640, THYMU20202890, THYMU20241210, TRACH20096610, TUTER20002830, UTERU20151980, UTERU20176320
The following 62 clones presumably belong to the category of protein synthesis- and/or protein transport-related proteins.
3NB6910001910, ASTRO20106150, ASTRO20130500, ASTRO20141350, BRACE20038480, BRACE20052160, BRACE20057620, BRACE20106840, BRACE20172980, BRACE20192440, BRAWH20110960, BRCOC20037320, BRHIP20005530, BRSSN20120810, BRSTN20005360, CTONG20009770, CTONG20114290, CTONG20125640, CTONG20153300, D6OST20003580, DFNES20037420, FCBBF30012810, FEBRA20080810, HCHON20064590, HHDPC20014320, HHDPC20084140, HLUNG20017120, LIVER20064690, NT2NE20132170, NT2NE20157470, NT2RP70133740, NTONG20009770, NTONG20075220, NTONG20076930, OCBBF20030910, OCBBF20035930, OCBBF20153340, PLACE60060420, SMINT20152940, SPLEN20008740, SPLEN20103950, SPLEN20118300, SPLEN20212730, SPLEN20250390, STOMA20077450, TBAES20002550, TESOP20004000, TESTI20239510, TESTI20278400, TESTI20314180, TESTI20463580, THYMU20111830, THYMU20122730, THYMU20130890, THYMU20232090, TKIDN10000010, TRACH20084720, TRACH20105870, TRACH20139820, TRACH20149970, UTERU20120310, UTERU20188110
The following 15 clones presumably belong to the category of cellular defense-related proteins.
BRCOC20144000, CTONG20092680, KIDNE20020150, LIVER20002160, NT2RI20050960, NT2RP70045590, OCBBF20128120, PLACE60003480, SKNSH20089400, SMINT20106290, SPLEN20039240, TESTI20001000, TESTI20455620, TRACH20028030, UTERU20176320
The following 13 clones presumably belong to the category of development and/or differentiation-related proteins.
3NB6920014590, BRAMY20211390, CTONG20091080, CTONG20121010, FCBBF30024750, KIDNE20027250, NT2NE20142210, OCBBF20054200, PROST10003220, SKMUS20007010, SPLEN20179810, STOMA20063250, TESTI20291960
The following 174 clones presumably belong to the category of DNA- and/or RNA-binding proteins.
3NB6920014590, ADIPS20004250, ASTRO20008010, ASTRO20168470, BLADE20003400, BLADE20003890, BRACE20057620, BRACE20060890, BRACE20064880, BRACE20068590, BRACE20248260, BRACE20253160, BRAMY20000520, BRAMY20213100, BRAMY20260910, BRAMY20270730, BRAWH20028110, BRAWH20075700, BRAWH20096780, BRAWH20113430, BRCAN10001490, BRCAN20280210, BRCAN20283190, BRCOC20144000, BRCOC20178270, BRCOC20178560, BRHIP20005340, BRHIP20106100, BRHIP20119330, BRHIP20153600, BRHIP20176420, BRHIP20191860, BRHIP20195890, BRHIP20222280, BRSSN20039370, BRSSN20046790, BRSSN20176820, CTONG20050280, CTONG20075860, CTONG20085950, CTONG20091080, CTONG20092700, CTONG20121010, CTONG20124220, CTONG20125540, CTONG20133390, CTONG20133520, CTONG20140580, CTONG20156780, D9OST20033970, FCBBF10001710, FCBBF10004370, FCBBF20059090, FCBBF20064520, FCBBF20068820, FCBBF30007680, FCBBF30010810, FCBBF30018550, FCBBF30025560, FCBBF30057290, FCBBF30083820, FCBBF30129630, FCBBF30240960, FCBBF30246230, FEBRA20010120, FEBRA20018690, FEBRA20026110, FEBRA20034680, FEBRA20040530, FEBRA20082010, FEBRA20097310, FEBRA20171380, FEBRA20195820, FEBRA20196630, FEBRA20233770, HCHON20008320, HCHON20009560, HCHON20035130, HHDPC10000830, HHDPC20031130, KIDNE20017130, KIDNE20027250, KIDNE20027950, KIDNE20107390, KIDNE20182690, LIVER20055440, MESAN20101140, NT2NE20010490, NT2NE20089970, NT2NE20142210, NT2NE20184900, NT2RP60000770, NT2RP70044280, NT2RP70102350, NT2RP70157890, NTONG20070200, OCBBF10001850, OCBBF20020830, OCBBF20037440, OCBBF20046120, OCBBF20049300, OCBBF20066390, OCBBF20071840, OCBBF20078920, OCBBF20080410, OCBBF20108190, OCBBF20125530, OCBBF20148280, PEBLM20060360, PEBLM20060490, PEBLM20078320, PERIC10000250, PROST10003220, PROST20047390, PROST20066880, PROST20185830, PROST20189770, PROST20191640, PUAEN20018820, SKNSH20008190, SKNSH20089400, SMINT20001760, SMINT20127350, SMINT20144800, SMINT20177360, SMINT20191530, SPLEN20054290, SPLEN20079260, SPLEN20095410, SPLEN20140800, SPLEN20147390, SPLEN20160450, SPLEN20252190, SPLEN20267650, STOMA20010250, STOMA20032890, STOMA20046680, STOMA20063250, TESTI20039400, TESTI20067200, TESTI20088220, TESTI20094470, TESTI20121550, TESTI20130010, TESTI20156100, TESTI20204450, TESTI20230850, TESTI20237520, TESTI20266740, TESTI20318090, TESTI20320670, TESTI20334410, TESTI20355020, TESTI20378190, TESTI20385960, TESTI20432820, TESTI20443090, TESTI20456110, THYMU20193640, THYMU20241210, THYMU20247480, TRACH20079690, TRACH20105870, TRACH20139820, TRACH20154860, TRACH20163170, TRACH20164980, TRACH20184490, TUTER20002830, UTERU20099720, UTERU20116570, UTERU20145480, UTERU20176130, UTERU20185230
The following 68 clones presumably belong to the category of ATP- and/or GTP-binding proteins.
3NB6910001910, BRACE20108130, BRACE20148240, BRAMY20134140, BRAMY20157820, BRAMY20174550, BRAWH20164460, BRCAN20003460, BRCAN20054490, BRCAN20283190, BRCOC20059510, BRCOC20144000, BRHIP20103090, BRHIP20115080, BRHIP20167880, BRSTN20005360, CD34C30004240, CTONG20095340, CTONG20121580, CTONG20200310, DFNES20037420, FCBBF20067810, FCBBF30012350, FCBBF30015940, FEBRA20007620, FEBRA20024100, FEBRA20144170, KIDNE20020150, KIDNE20028720, LIVER20002160, LIVER20087060, NT2RI20005750, NT2RI20041880, NT2RI20048840, NT2RI20273230, OCBBF20028650, OCBBF20046690, OCBBF20054760, OCBBF20108430, OCBBF20108630, SMINT20121220, SMINT20183530, SMINT20191530, SPLEN20026950, SPLEN20039240, SPLEN20099700, SPLEN20145720, SPLEN20179180, STOMA20006860, TESTI20035960, TESTI20355020, TESTI20397760, TESTI20400940, TESTI20417300, TESTI20443090, TESTI20455620, THYMU20105190, THYMU20202890, THYMU20209590, TKIDN20004640, TKIDN20047480, TRACH20005400, TRACH20019960, TRACH20057690, TRACH20084720, UTERU20168220, UTERU20176320, UTERU20185230
Among the clones other than the ones shown above, BRAMY20248490, FCBBF10002800, NTONG20092290, OCBBF20127040, SMINT20163960, THYMU20279750, TRACH20167220, are clones which were predicted to highly possibly belong to the category of secretory protein and/or membrane protein based on the result of domain search by Pfam.
FCBBF10002800, NTONG20092290, OCBBF20127040, SMINT20163960, TESTI20478850, THYMU20279750
The 6 clones shown above are clones which were predicted to highly possibly belong to the category of glycoprotein-related protein based on the result of domain search by Pfam. BRACE20060720, BRACE20223330, BRALZ20058880, BRAMY20148130, BRAWH20101360, BRCAN20124080, BRHIP20253660, CTONG10000620, CTONG20014280, CTONG20124010, KIDNE20109890, MESAN20171520, OCBBF20109310, OCBBF20140640, PROST20079500, PUAEN20078980, SPLEN20077500, SPLEN20143180, TESTI20017950, TESTI20184620, TESTI20208710, TESTI20211160, TESTI20226230, TESTI20234140, TESTI20258460, TESTI20275030
The 26 clones shown above are clones which were predicted to highly possibly belong to the category of signal transduction-related protein based on the result of domain search by Pfam.
ADRGL20048330, ASTRO20064750, ASTRO20084250, BRACE20151320, BRALZ20058880, BRHIP20207990, CTONG20093950, FCBBF30195640, FEBRA10001900, FEBRA20090290, FEBRA20214970, FEBRA20222040, KIDNE20109890, LIVER20087510, MESAN20029400, MESAN20031900, MESAN20035290, MESAN20136110, NT2NE20130190, PEBLM20060310, PERIC20004780, PROST20171280, PUAEN20078980, SMINT20115880, SPLEN20095550, TESTI20023510, TESTI20083940, TESTI20152460, TESTI20185650, TESTI20189410, TESTI20200710, TESTI20308600, TESTI20343070, TESTI20369690, TESTI20381040, UTERU20050690
The 36 clones shown above are clones which were predicted to highly possibly belong to the category of transcription-related protein based on the result of domain search by Pfam. BGGI120006160, BRACE20053480, BRACE20190040, BRACE20223330, BRAWH20101360, BRAWH20185060, BRCOC20023230, BRHIP20252450, BRSSN20105870, BRSSN20117990, BRTHA20000570, CTONG20098440, CTONG20129960, CTONG20146300, CTONG20155180, FEBRA20025270, HEART20083640, KIDNE20009470, LIVER20035680, MESAN20029400, MESAN20031900, MESAN20186700, NOVAR10000150, NTONG20029480, OCBBF20079310, OCBBF20082830, PEBLM20042900, PLACE60136500, PLACE60136720, PROST20114390, SKNSH20020540, SMINT20013480, SMINT20174360, SPLEN20077500, SPLEN20119810, SPLEN20126190, SPLEN20174260, SPLEN20211220, TESTI20046750, TESTI20057750, TESTI20061110, TESTI20197940, TESTI20211160, TESTI20226230, TESTI20255820, TESTI20317600, TESTI20377230, THYMU20111180, THYMU20115850, THYMU20143270, THYMU20240710, UTERU20055330, UTERU20055930, UTERU20064000, UTERU20119060
The 55 clones shown above are clones which were predicted to highly possibly belong to the category of enzyme and/or metabolism-related protein based on the result of domain search by Pfam.
TESTI20127760, TESTI20392270
The 2 clone shown above is a clone which was predicted to highly possibly belong to the category of cell division and/or cell proliferation-related protein based on the result of domain search by Pfam.
FCBBF30262510, MESAN20031900, NT2NE20125050, SMINT20068010, SPLEN20163560, STOMA20092890, TESTI20382750
The 7 clones shown above are clones which were predicted to highly possibly belong to the category of cytoskeleton-related protein based on the result of domain search by Pfam.
THYMU20118520
The clone shown above is clone which was predicted to highly possibly belong to the category of Nuclear protein and/or RNA synthesis-related protein based on the result of domain search by Pfam.
BRACE20053480, BRACE20240740, KIDNE20009470, OCBBF20140890, SMINT20035690, UTERU20064000
The 6 clones shown above are clones which were predicted to highly possibly belong to the category of Protein synthesis-and/or transport-related protein based on the result of domain search by Pfam.
ADRGL20048330, ASTRO20064750, ASTRO20084250, BRACE20151320, BRACE20190040, BRACE20223330, BRALZ20058880, BRAMY20103570, BRCOC20023230, BRHIP20207990, BRTHA20000570, CTONG20093950, CTONG20129960, CTONG20146300, CTONG20155180, CTONG20160560, FCBBF10004120, FCBBF30195640, FEBRA10001900, FEBRA20090290, FEBRA20214970, FEBRA20222040, HCHON20008150, HEART20083640, KIDNE20109890, LIVER20035680, LIVER20087510, MESAN20029400, MESAN20031900, MESAN20035290, MESAN20136110, MESAN20186700, NT2NE20130190, NT2RI20025640, NTONG20029480, PEBLM20060310, PERIC20004780, PROST20114390, PROST20171280, PUAEN20078980, SMINT20115880, SPLEN20095550, SPLEN20119810, TESTI20023510, TESTI20057750, TESTI20083940, TESTI20152460, TESTI20185650, TESTI20189410, TESTI20200710, TESTI20308600, TESTI20343070, TESTI20369690, TESTI20381040, THYMU20115850, UTERU20050690, UTERU20055330
The 57 clones shown above are clones which were predicted to highly possibly belong to the category of DNA- and/or RNA-binding protein based on the result of domain search by Pfam.
PLACE60136720
The clone shown above is a clone which was predicted to highly possibly belong to the category of ATP- and/or GTP-binding proteins based on the result of domain search by Pfam.
The 213 clones shown below are clones which were unassignable to any of the above-mentioned categories, but have been predicted to have some functions based on homology search using their full-length nucleotide sequences and motif search in their estimated ORFs. Clone Name, Definition in the result of homology search or Motif Name in the motif search, demarcated by a double slash mark (//), are shown below.
ADRGL20028570//Rattus norvegicus MG87 mRNA, complete cds.
ADRGL20061930//transposon-derived Buster1 transposase-like protein
ASTRO20012490//Eukaryotic initiation factor 1A
ASTRO20072210//PERIAXIN.
ASTRO20114370//Mus musculus SMAR1 mRNA, complete cds.
ASTRO20125520//dnaj protein [Schizosaccharomyces pombe]
ASTRO20143630//KH domain// Bacterial regulatory proteins, crp family
ASTRO20155290//TPR Domain// TPR Domain// TPR Domain
ASTRO20181690//oocyte-specific protein P100
BGGI110001930//UBX domain
BRACE20011070//Mus musculus F-box protein FBX15 mRNA, partial cds.
BRACE20039440//Drosophila melanogaster CHARYBDE (charybde) mRNA, complete cds.
BRACE20050900//TPR Domain// TPR Domain// TPR Domain// TPR Domain
BRACE20053280//Mus musculus Pdz-containing protein (Pdzx) mRNA, complete cds.
BRACE20057730//toxin sensitivity protein KTI12 homolog
BRACE20058580//Homo sapiens HCMOGT-1 mRNA for sperm antigen, complete cds.
BRACE20063780//NOL1/NOP2/sun family
BRACE20269200//Heat-labile enterotoxin alpha chain
BRACE20276430//Homo sapiens retinoblastoma-associated protein RAP140 mRNA, complete cds.
BRACE20286360//Alpha adaptin carboxyl-terminal domain
BRAMY10001300//Homo sapiens MAGE-E1b mRNA, complete cds.
BRAMY20045240//Flagellar L-ring protein
BRAMY20054880//Rattus norvegicus KPL2 (Kp12) mRNA, complete cds.
BRAMY20167060//Collagen triple helix repeat (20 copies)
BRAMY20184670//Homo sapiens mRNA for ALEX1, complete cds.
BRAMY20217460//Homo sapiens cardiac voltage gated potassium channel modulatory subunit mRNA, complete cds, alternatively spliced.
BRAMY20240040//Homo sapiens suppressor of white apricot homolog 2 (SWAP2) mRNA, complete cds.
BRAMY20247110//Mus musculus semaphorin cytoplasmic domain-associated protein 3A (Semcap3) mRNA, complete cds.
BRAWH20004600//Mus musculus mRNA for NAKAP95, complete cds.
BRAWH20011710//cytoplasmic linker 2
BRAWH20012390//Trichomonas vaginalis mRNA for centrin (ce1 gene).
BRAWH20017010//Homo sapiens testes development-related NYD-SP22 mRNA, complete cds.
BRAWH20029630//Homo sapiens bet3 (BET3) mRNA, complete cds.
BRAWH20138660//Homo sapiens stonin 2 mRNA, complete cds.
BRCOC20008500//Human ras inhibitor mRNA, 3′ end.
BRCOC20026640//Gag P30 core shell protein
BRCOC20035130//14-3-3 PROTEIN EPSILON (MITOCHONDRIAL IMPORT STIMULATION FACTOR L SUBUNIT) (PROTEIN KINASE C INHIBITOR PROTEIN-1) (KCIP-1) (14-3-3E).
BRCOC20074760//CDC4-LIKE PROTEIN (FRAGMENT).
BRCOC20110100//Integrase core domain
BRCOC20176520//Rattus norvegicus mRNA for type II brain 4.1, complete cds.
BRHIP20001630//Protein of unknown function DUF16
BRHIP20132860//Homo sapiens rhophilin-like protein mRNA, complete cds.
BRHIP20143730//MYND finger
BRHIP20175420//Mus musculus partial mRNA for stretch responsive protein 278 (sr278 gene).
BRHIP20236950//Outer Capsid protein VP4 (Hemagglutinin)
BRSSN20014260//RIBONUCLEASE INHIBITOR.
BRSSN20018690//Homo sapiens NY-REN-25 antigen mRNA, partial cds.
BRSSN20021600//RING CANAL PROTEIN (KELCH PROTEIN).
BRSSN20177570//Phosducin
BRSTN10000830//Kelch motif// Kelch motif// Kelch motif// Kelch motif
CTONG10000220//Mus musculus cerebellar postnatal development protein-1 (Cpd1) mRNA, partial cds.
CTONG10000930//Armadillo/beta-catenin-like repeats
CTONG20027090//Glypican// Leucine Rich Repeat// Leucine Rich Repeat
CTONG20076130//ZINC FINGER PROTEIN 185 (LIM-DOMAIN PROTEIN ZNF185) (P1-A).
CTONG20096750//Disintegrin
CTONG20100240//Mus musculus radial spokehead-L protein (Rshl1) mRNA, complete cds.
CTONG20139860//Homo sapiens nasopharyngeal carcinoma susceptibility protein LZ16 mRNA, complete cds.
CTONG20143690//MYND finger
CTONG20149460//RING CANAL PROTEIN (KELCH PROTEIN).
CTONG20165050//Keratin, high sulfur B2 protein
CTONG20186320//RING CANAL PROTEIN (KELCH PROTEIN).
D3OST20013280//ARP2/3 COMPLEX 16 KDA SUBUNIT (P16-ARC).
D3OST20024360//Homo sapiens neuroendocrine differentiation factor mRNA, complete cds.
D9OST20031370//Homo sapiens mRNA for partial putative TCPTP-interacting protein (ptpip5 gene).
DFNES20014040//TRICHOHYALIN.
FCBBF10000630//Homo sapiens huntingtin interacting protein HYPB mRNA, partial cds.
FCBBF10000770//Homo sapiens REC8 mRNA, partial cds.
FCBBF10005060//CELLULAR RETINALDEHYDE-BINDING PROTEIN (CRALBP).
FCBBF10005500//Keratin, high sulfur B2 protein
FCBBF20014270//ACYL-COA-BINDING PROTEIN (ACBP) (DIAZEPAM BINDING INHIBITOR) (DBI) (ENDOZEPINE) (EP).
FCBBF20042170//Homo sapiens NIBAN mRNA, complete cds.
FCBBF30016320//SecA protein, amino terminal region
FCBBF30033050//Sm protein
FCBBF30054440//PLAT/LH2 domain
FCBBF30225660//Ank repeat// Ank repeat// Ank repeat// K+ channel tetramerisation domain// BTB/POZ domain
FCBBF30233680//G10 protein
FCBBF30246630//H. sapiens mRNA for ZYG homologue.
FCBBF30250730//TRICHOHYALIN.
FCBBF30252520//Homo sapiens bicaudal-D (BICD) mRNA, alternatively spliced, partial cds.
FCBBF30252800//NDRG1 PROTEIN (DIFFERENTIATION-RELATED GENE 1 PROTEIN) (DRG1) (REDUCING AGENTS AND TUNICAMYCIN-RESPONSIVE PROTEIN) (RTP) (NICKEL-SPECIFIC INDUCTION PROTEIN CAP43).
FCBBF30252850//Mus musculus peripherial benzodiazepine receptor associated protein (Pap7) mRNA, complete cds.
FCBBF30285280//Keratin, high sulfur B2 protein// Bacterial regulatory proteins, gntR family
FEBRA20088360//ALPHA-ADAPTIN C (CLATHRIN ASSEMBLY PROTEIN COMPLEX 2 ALPHA-C LARGE CHAIN) (100 KDA COATED VESICLE PROTEIN C) (PLASMA MEMBRANE ADAPTOR HA2/AP2 ADAPTIN ALPHA C SUBUNIT).
FEBRA20184330//Rattus norvegicus glutamate receptor interacting protein 2 (GRIP2) mRNA, complete cds.
FEBRA20192420//Cyclin-dependent kinase inhibitor// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif FEBRA20196370//Cyclin-dependent kinase inhibitor// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif
FEBRA20225040//high-glucose-regulated protein 8
HCHON20001560//TRANSCRIPTION FACTOR-LIKE PROTEIN MORF4.
HCHON20003440//Homo sapiens cyclin-D binding Myb-like protein mRNA, complete cds.
HCHON20010990//TPR Domain
HCHON20059870//Hypothetical protein.
HHDPC20034390//Cereal trypsin/alpha-amylase inhibito
HHDPC20057420//Mus musculus proline-rich protein (Bprp) mRNA, complete cds.
HHDPC20064600//SUPPRESSOR PROTEIN SRP40.
HLUNG20023340//Mus musculus SLM-1 (Slm1) mRNA, complete cds.
KIDNE20007210//Xenopus laevis mRNA for RPA interacting protein alpha (ripalpha gene).
KIDNE20028830//K-box region
KIDNE20115080//Homo sapiens mRNA for hNBL4, complete cds.
KIDNE20124400//Homo sapiens mRNA for ALEX1, complete cds.
KIDNE20127100//Drosophila melanogaster Diablo (dbo) mRNA, complete cds.
KIDNE20127750//Homo sapiens partial mRNA for transport-secretion protein 2.1 (TTS-2.1 gene).
KIDNE20190740//Rattus norvegicus SNIP-b mRNA, complete cds.
LIVER10004790//EF hand
LIVER20011130//Homo sapiens F-box protein FBL9 mRNA, partial cds.
LIVER20064100//Ciona intestinalis mRNA for myoplasmin-C1, complete cds.
LIVER20080530//Drosophila melanogaster forked mRNA for large Forked protein, complete cds.
MAMGL10000830//Drosophila melanogaster L82B (L82) mRNA, complete cds.
MESAN20036460//Corticotropin-releasing factor family
MESAN20127350//myelin expression factor-3
MESAN20141920//Human ovarian cancer downregulated myosin heavy chain homolog (Doc1) mRNA, complete cds.
NT2NE20010400//Homo sapiens GL013 mRNA, complete cds.
NT2NE20122430//GLYOXYLATE-INDUCED PROTEIN.
NT2NE20158600//erythroid ankyrin-Synechocystis sp. (strain PCC 6803).
NT2RI20001330//Homo sapiens KE03 protein mRNA, partial cds.
NT2RI20009870//lunatic fringe precursor [Mus musculus]
NT2RI20046080//recA bacterial DNA recombination proteins
NT2RI20091730//Molluscan rhodopsin C-terminal tail
NT2RP60000850//Bos taurus RPGR-interacting protein-1 (RPGRIP1) mRNA, complete cds.
NT2RP70080850//SPRY domain// Adenovirus EB1 55K protein/large t-an
NT2RP70105210//Myc amino-terminal region
NT2RP70188710//Yeast PIR proteins
NT2RP70194450//Bacterial regulatory proteins, crp family NTONG20052650//Gallus gallus Xin mRNA, complete cds.
NTONG20064400//REPETIN.
NTONG20064840//Mus musculus slp1 mRNA for synaptotagmin-like protein 1, complete cds.
NTONG20066460//Mus musculus Gd mRNA for gasdermin, complete cds.
NTONG20067090//Mus musculus mRNA for Sh3yl1, complete cds.
NTONG20070340//collagen alpha 1 (IX) chain
NTONG20083650//TPR Domain// TPR Domain// TPR Domain// PPR repeat// TPR Domain// PPR repeat// TPR Domain
NTONG20088620//Homo sapiens genethonin 3 mRNA, partial cds.
OCBBF10000540//Mus musculus rjs (rjs) mRNA, complete cds.
OCBBF20019380//seizure related gene 6
OCBBF20022900//Homo sapiens SCHIP-1 mRNA, complete cds.
OCBBF20030280//Rattus norvegicus hfb2 mRNA, complete cds.
OCBBF20046470//ARFAPTIN 1.
OCBBF20049840//Homo sapiens mRNA for neurabin II protein.
OCBBF20068490//Mus musculus RW1 protein mRNA, complete cds.
OCBBF20071960//Coturnix coturnix japonica qMEF2D gene.
OCBBF20073540//Homo sapiens p30 DBC mRNA, complete cds.
OCBBF20121390//RING CANAL PROTEIN (KELCH PROTEIN).
OCBBF20127550//Outer Capsid protein VP4 (Hemagglutinin)
OCBBF20148730//RING CANAL PROTEIN (KELCH PROTEIN).
OCBBF20178150//Plasmodium falciparum ADA2-like protein gene, partial cds.
PEBLM10000240//Domain found in Dishevelled, Eg1-10, and Ple
PROST20047270//CRAL/TRI0 domain.
PROST20112970//Sterile alpha motif (SAM)/Pointed domain// SAM domain (Sterile alpha motif)
PUAEN10000850//Uncharacterized protein family UPF0025// Sec1 family
PUAEN20011880//Mus musculus mRNA for MIWI (piwi), complete cds.
PUAEN20051100//Mus musculus otogelin mRNA, complete cds.
PUAEN20108240//Drosophila melanogaster ankyrin 2 (Ank2) mRNA, complete cds.
SKMUS20084740//Syndecan domain
SMINT20053300//Homo sapiens hepatocellular carcinoma-associated antigen 59 mRNA, complete cds.
SMINT20071400//NOL1/NOP2/sun family
SMINT20101440//Human cisplatin resistance associated alpha protein (hCRA alpha) mRNA, complete cds.
SMINT20110330//pKID domain
SMINT20122910//Mus musculus StAR-related protein 1-4E mRNA, partial cds.
SMINT20131810//ENV polyprotein (coat polyprotein)
SMINT20168570//Homo sapiens mRNA for stabilin-1 (stab1 gene).
SPLEN20008390//Human placenta (Diff48) mRNA, complete cds.
SPLEN20084600//RING CANAL PROTEIN (KELCH PROTEIN).
SPLEN20128000//Xenopus laevis XMAB21 (Xmab-21) mRNA, complete cds.
SPLEN20149110//Dishevelled specific domain
SPLEN20171470//Keratin, high sulfur B2 protein
SPLEN20194050//Homo sapiens HOTTL protein mRNA, complete cds.
SPLEN20214580//Mus musculus mdg1-1 mRNA, complete cds.
STOMA20057820//Uncharacterized protein family UPF0024
STOMA20063980//Collagen triple helix repeat (20 copies)
STOMA20069040//Keratin, high sulfur B2 protein
SYNOV20017080//UBX domain
TBAES20000590//Cytochrome P450// Cytochrome P450
TESTI20001170//HORMA domain
TESTI20031810//Bacterial luciferase// Domain of unknown function DUF28
TESTI20044230//Mus musculus testis-specific Y-encoded-like protein (Tspy11) mRNA, complete cds.
TESTI20098350//VAT-Nn domain
TESTI20157520//K+ channel tetramerisation domain// K+ channel tetramerisation domain
TESTI20170350//Cystine-knot domain
TESTI20192800//Homo sapiens nasopharyngeal carcinoma susceptibility protein LZ16 mRNA, complete cds.
TESTI20199750//TRICHOHYALIN.
TESTI20202650//Repeat in HS1/Cortactin
TESTI20229600//Drosophila melanogaster SP2353 mRNA, complete cds.
TESTI20231920//Gag P30 core shell protein
TESTI20242830//E2 (early) protein, C terminal// Syndecan domain
TESTI20254540//Homo sapiens hepatocellular carcinoma-associated antigen 59 mRNA, complete cds.
TESTI20320440//THIOREDOXIN.
TESTI20327680//EF hand// EF hand
TESTI20328280//KE2 family protein// Troponin
TESTI20351830//K-box region
TESTI20370020//Bleomycin resistance protein
TESTI20391210//IQ calmodulin-binding motif
TESTI20408150//Keratin, high sulfur B2 protein
TESTI20451990//SAP domain
TESTI20467970//Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain
THYMU20108310//Mouse NCBP-29 mRNA for PW29, complete cds.
THYMU20142040//WISKOTT-ALDRICH SYNDROME PROTEIN HOMOLOG (WASP).
THYMU20194360//Kelch motif
THYMU20239000//collagen alpha 1(XI) chain
TOVAR20004760//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat
TRACH20005020//Ank repeat// MutT-like domain
TRACH20007020//TRICHOHYALIN.
TRACH20048450//PROTEIN K4 (PROTEIN K3).
TRACH20068700//Homo sapiens adaptor protein CIKS mRNA, complete cds.
TRACH20076760//Keratin, high sulfur B2 protein
TRACH20135520//TBC domain// Rhodanese-like domain
TRACH20141240//Mus musculus G21 protein mRNA, complete cds.
TRACH20183170//Rattus norvegicus Sprague-Dawley SM-20 mRNA, complete cds.
UTERU20000740//Human fusion protein mRNA, complete cds.
UTERU20004240//CGI-96 protein
UTERU20006960//endoplasmic reticulum resident protein 58
UTERU20022940//Human (p23) mRNA, complete cds.
UTERU20046640//Mus musculus ldlBp (LDLB) mRNA, complete cds.
UTERU20065930//GTP-RHO BINDING PROTEIN 1 (RHOPHILIN).
UTERU20115740//Human PMS2 related (hPMSR3) gene, complete cds.
UTERU20179880//TPR Domain// TPR Domain// TPR Domain// TPR Domain
Further, the reason is that a polypeptide does not always belong solely to a single category of the above-described functional categories, and therefore, a polypeptide may belong to any of the predicted functional categories. Besides, additional functions can be found for the clones classified into these functional categories by further analyses.
Since the polypeptide encoded by clones of the invention contains full-length amino acid sequence, it is possible to analyze its biological activity, and its effect on cellular conditions such as cell proliferation and differentiation by expressing the polypeptide as a recombinant polypeptide using an appropriate expression system, injecting the recombinant into the cell, or raising a specific antibody against the polypeptide.
The biological activities of respective polypeptides can be analyzed by the methods as shown below.
Secretory Protein, Transmembrane Protein:
In the categorization, the clone predicted to belong to the category of secretory and/or membrane protein means a clone having hit data with some annotation, such as growth factor, cytokine, hormone, signal, transmembrane, membrane, extracellular matrix, receptor, G-protein coupled receptor, ionic channel, voltage-gated channel, calcium channel, cell adhesion, collagen, connective tissue, etc., suggesting that it was a secretory or membrane protein, or a clone in which the presence of nucleotide sequence encoding a signal sequence or transmembrane region was suggested by the results of PSORT and SOSUI analyses for deduced ORF.
The clone predicted to belong to the category of glycoprotein-related protein means a clone having hit data with some annotation, such as glycoprotein, suggesting that the clone encodes a glycoprotein-related protein.
The clone predicted to belong to the category of signal transduction-related protein means a clone having hit data with some annotation, such as serine/threonine-protein kinase, tyrosine-protein kinase, SH3 domain, SH2 domain, etc., suggesting that the clone encodes a signal transduction-related protein.
The clone predicted to belong to the category of transcription-related protein means a clone having hit data with some annotation, such as transcription regulation, zinc finger, homeobox, etc., suggesting that the clone encodes a transcription-related protein.
The clone predicted to belong to the category of disease-related protein means a clone having hit data with some annotation, such as disease mutation, syndrome, etc., suggesting that the clone encodes a disease-related protein, or a clone whose full-length nucleotide sequence has hit data for Swiss-Prot, GenBank, UniGene, or nr, where the hit data corresponds to genes or polypeptides which have been deposited in the Online Mendelian Inheritance in Man (OMIM) (http://www.ncbi.nlm.nih.gov/Omim/), which is the human gene and disease database described later.
The clone predicted to belong to the category of enzyme and/or metabolism-related protein means a clone having hit data with some annotation, such as metabolism, oxidoreductase, E. C. No. (Enzyme commission number), etc., suggesting that the clone encodes an enzyme and/or metabolism-related protein.
The clone predicted to belong to the category of cell division and/or cell proliferation-related protein means a clone having hit data with some annotation, such as cell division, cell cycle, mitosis, chromosomal protein, cell growth, apoptosis, etc., suggesting that the clone encodes a cell division and/or cell proliferation-related protein.
The clone predicted to belong to the category of cytoskeleton-related protein means a clone having hit data with some annotation, such as structural protein, cytoskeleton, actin-binding, microtubles, etc., suggesting that the clone encodes a cytoskeleton-related protein.
The clone predicted to belong to the category of nuclear protein and/or RNA synthesis-related protein means a clone having hit data with some annotation, such as nuclear protein, RNA splicing, RNA processing, RNA helicase, polyadenylation, etc., suggesting that the clone encodes a nuclear protein and/or RNA synthesis-related protein.
The clone predicted to belong to the category of protein synthesis and/or transport-related protein means a clone having hit data with some annotation, such as translation regulation, protein biosynthesis, amino-acid biosynthesis, ribosomal protein, protein transport, signal recognition particle, etc., suggesting that the clone encodes a protein synthesis and/or transport-related protein.
The clone predicted to belong to the category of cellular defense-related protein means a clone having hit data with some annotation, such as heat shock, DNA repair, DNA damage, etc., suggesting that the clone encodes a cellular defense-related protein.
The clone predicted to belong to the category of development and/or differentiation-related proteins means a clone having hit data with some annotation, such as developmental protein, etc., suggesting that the clone encodes a development and/or differentiation-related protein.
The clone predicted to belong to the category of DNA-and/or RNA-binding protein means a clone having hit data with some annotation, such as DNA-binding, RNA-binding, etc.
The clone predicted to belong to the category of ATP-and/or GTP-binding protein means a clone having hit data with some annotation, such as ATP-binding, GTP-binding, etc.
As to a protein involved in a disease, it is possible to perform a functional analysis as described above, but also possible to analyze correlation between the expression or the activity of the protein and a certain disease by using a specific antibody that is obtained by using expressed protein. Alternatively, it is possible to utilize the database OMIM, which is a database of human genes and diseases, to analyze the protein. Further, new information is constantly being deposited in the OMIM database. Therefore, it is possible for one skilled in the art to find a new relationship between a particular disease and a gene of the present invention in the most up-to-date database. The proteins involved in diseases are useful for developing a diagnostic marker or medicines for regulation of their expression and activity, or as a target of gene therapy.
Also, as for a secretory protein, membrane protein, signal transduction-related protein, glycoprotein-related protein, or transcription-related protein, etc., search of the OMIM with the following keywords resulted in the finding that the proteins are involved in many diseases (the result of the OMIM search for secrete and membrane proteins is shown below). Also, association between proteins related to signal transduction or transcription and diseases is reported in “Transcription Factor Research-1999” (Fujii, Tamura, Morohashi, Kageyama, and Satake edit, (1999) Jikken-Igaku Zoukan, Vol. 17, No.3), and “Gene Medicine” (1999) Vol. 3, No.2). When cancer is used as an example, as described in “Biology of Cancer” (S. Matsubara, 1992) of Life Science series (Shokabo), many proteins are involved in cancers, which include enzyme and/or metabolism-related proteins, cytoskeleton-related proteins, cell division and/or cell proliferation-related proteins as well as secretory proteins, membrane proteins, signal transduction-related proteins, glycoprotein-related proteins, transcription-related proteins. As clearly seen by the above example, it is evident that not only disease-related proteins but also secretory proteins, membrane proteins, signal transduction-related proteins, glycoprotein-related proteins, transcription-related proteins, etc. are often involved in diseases, and thus they can be useful targets in the field of medical industry.
The result of the OMIM search for secretory and membrane proteins is shown below, in which the keywords,
(1) secretion protein,
(2) membrane protein,
(3) channel, and
(4) extracellular matrix were used.
Shown in the search result are only the accession numbers in the OMIM. Using the number, data showing the relationship between a disease and a gene or protein can be seen. The OMIM data has been renewed everyday.
1) Secretion Protein
354 entries found, searching for “secretion protein”
*604667, *104760, *176860, *151675, *139320, *107400, *604029, *118910, #200100, *176880, *603850, *147572, *604028, *179513, *125950, *139250, *246700, *600946, *600560, *602926, 185860, *605083, *603215, *602421, *157147, *179512, *600174, *109270, *604710, *138120, *179510, *600998, *179509, *170280, *179511, *600626, *603831, *601489, *154545, *179490,
*603826, *122559, *603216, *102720, *147290, *164160, *603062, *112262, *602672, *605435, *605322, *131230, *601652, *603166, *601746, *601591, *179508, #160900, *104311, *600759, *147545, *167805, #104300, *167770, #219700, *168470, *601684, *602049, *601146, *605227, *602434, *602534, *114840, *603489, *604323, *107470, *600753, *600768, *118825, *600564,
*604252, *173120, *134370, *192340, *308230, *600322, *605359, *600046, *300090, 106160, *600041, #262500, *605563, *150390, *158106, *182590, #103580, *104610, #173900, *134797, *143890, #145980, *306900, *308700, *176300, *227500, *137350, #154700, *138079, *600760, *107730, *142410, *147670, *124092, *590050, *152760, *600509, *605646, *201910, *227600,
*152790, *300200, *300300, 300800, *138160, *107741, *120150, *601199, *120180, *120160, *176730, *133170, *122560, *107300, *137241, *120140, *101000, *193400, *217000, *272800, *600937, #201710, *600377, #174800, *106100, #274600, *173350, #177170, *147620, *214500, *131244, *202110, *120120, *601007, *191160, *147470, *603372, *600733, *252800, *190160,
*138040, *158070, *162151, #125700, #130070, *113811, *603355, *171060, *136435, #184700, *603732, *190180, *164008, *186590, *120220, *604312, *152200, *138130, *605085, *605353, *600840, #166210, *188545, *207750, *173360, *601933, #194050, *153450, *138850, *253200, *307030, *157145, *600514, *600262, *264080, *147380, *600281, #204000, #227810, *232200,
*188826, *232800, *161561, #166200, *188400, *153620, *182099, *218040, #265800, *172400, #177200, *176805, #211600, #214700, #176410, *152780, *600633, *601771, *301500, *605402, *601922, *307800, *147892, *147720, *312060, #520000, *147660, *106150, *602358, *107270, *601769, *147440, *604558, *131530, *600270, *601610, *603692, *603401, *600423, *601604,
*603345, #125853, *602843, *142640, *603044, *605740, *134830, *602779, *130660, *139191, *137035, *600761, *601340, *600823, *107740, *130160, *600877, *605110, *600945, *130080, *600957, #130050, *605580, *118444, *601124, *124020, 122470, *120700, *603201, *137216, *601185, *138945, *218030, *600839, #240600, #262400, #162300, *162330, *188450, #265850,
*263200, *162641, *300159, *601038, #191390, *201810, *601398, *602384, *131240, *602423, *139392, *142703, *602663, *232700, *602682, #602722, *602730, *600734, *188540, *182452, *601538, *603061, *146880, *603140, *603160, *142704, #252650, *182280, *125255, *603252, #131750, *182139, *182100, #259420, #261100, *603493, *601745, *182098, *603795, *123812,
*600264, *147940, *180246, *180245, *118888, #604284, *168450, *118455, *604398, *604433, *601919, *118445, *600031, *604961, *605032, *605033, *171050, #171300, *131243, *109160, *605254, 274900, #171400, *600042, *151670, *184600, *605470, *605546, *176760, *602008, *102200, *605720, *600732, *605901
2) Membrane Protein
1489 entries found, searching for “membrane protein”
*130500, *605704, *305360, *153330, *173610, *109270, *170995, *170993, *104776, *602333, *309060, *605703, *120920, *605943, *602690, *159430, *600897, *133090, *601178, *602413, *602003, *604405, *605940, *603237, *109280, *600378, *602173, *107776, *602334, *602335, *125305, *601134, *309845, *605731, *154045, *603241, *603718, *600594, *603214, *185881,
*603657, *600182, *603177, *605331, *601476, *605456, *601114, *605190, *600723, *603904, *136950, *300222, *602879, *185880, *605348, *300096, *602257, *177070, *310200, *603062, *603344, *600039, *602977, *300100, *128240, *600959, *600322, *227400, *186945, *600946, *602534, *602048, *182900, *601097, *600267, *602625, *136430, *602421, *601047, *107450,
*143450, *603141, *184756, *164730, *159440, *154050, *600579, *312080, *604202, *603700, *600447, *256540, *604691, *158343, *600403, *602414, *137290, *176640, *176981, *600179, *600754, *604456, *604693, *605875, *604605, *188860, *300172, *602910, *604323, *219800, *601848, *60.3179, *600279, *602251, #222700, *603831, *605072, *605377, *601028, *604155,
*108733, *104225, *601896, *601510, *173335, *107770, *601767, *600046, *603850, *600040, *603784, *603234, 188560, *605863, *121015, *605862, *605861, *186946, *604252, *603215, *142461, *604597, *603143, *605264, *603735, *176860, *605536, *176801, *180721, *603355, *104760, *131560, *310300, *602631, *304700, #309400, *603142, *143890, *605431, *600753,
*115501, *176790, *600266, *601691, *168468, *601239, *602216, #104300, *605613, *601595, *605550, *125950, *605475, *602217, *602261, *603534, *602262, *604631, *190315, *601313, *604306, *104311, *604672, *605000, *602461, *605548, *602296, *604376, *121014, *121011, *600691, *604262, *139310, *304040, *605445, *179514, *179512, *151460, #160900, *120130,
*128239, *601158, *601403, *176943, *601014, 300800, *300294, *601757, *185470, *273800, *605034, *602887, #185000, *604871, *603593, *603583, *605454, *104775, *605872, *141180, *602713, *603531, *139150, *601531, *601832, *605452, *134651, *604156, *120620, *605883, *604142, *166945, *605324, *600816, *604699, *300112, *605182, *600164, *182180, *605071,
*300023, *605057, *308240, *300249, *176947, *176894, *605081, *605035, *602044, *182860, *107271, *305100, *153390, *113730, *602689, *180069, *603518, *300017, *191275, *177061, *601693, *601789, *604241, *600934, *138160, *604424, *603868, *600174, *600718, *600523, *604141, *601009, *605251, *600481, *600874, *155550, *605227, *601017, *162230, 601138,
*604157, *601212, *600763, *604110, *604158, *601107, *601326, 600621, *600587, 601137, *600917, *600855, *605058, *194355, *605194, *603291, *102720, *136425, *170715, *603216, *605547, *135630, *602926, *600168, *605002, *602474, *600157, *603025, *603893, *231200, *120090, *601966, *131230, *604722, *604721, *604515, *246700, *602101, *605628, *303630,
*605787, *602857, *602285, *605708, *602488, *605025, *603817, *300051, *603293, *176878, *603646, 605707, 185860, *112205, *300187, *602654, *120070, *603648, *604850, *602655, *602514, *300118, *182309, *179590, *602701, *600759, *204200, *604170, *175100, #103580, *147670, *306400, *143100, *182870, *257220, *180380, #116920, *301000, *193300, *157147,
*131550, *139200, *139130, *190195, *605406, *155760, *155960, *605734, *155970, *605385, *111700, *155975, *150370, 605709, *151430, *605438, *151510, *116952, *157655, *158105, *605777, *176877, *153619, *120131, *185430, *109190, *120190, *109170, *605093, *605250, *153432, *107777, *186590, *160993, *605699, *605698, *605813, *605697, *605616, *605300,
*162060, *605219, *163970, *135620, *165040, *605478, *604964, *103195, *604932, *604923, *605906, *605496, *605914, *166490, 138277, *604915, *114070, *605213, *605933, *180297, *101000, *191163, *191164, *605101, *603167, *600772, *603164, *600708, *604001, *191328, *313440, *602672, *604009, *604299, *192974, *604256, *603048, *600515, *604221, *602632,
*604196, *601179, 603290, *604661, *601023, *601110, *304800, *203200, *300212, *602933, *603352, *208900, *604418, *604838, *600551, #212140, *604837, *602049, *600552, *600553, *300213, *602574, *600583, *600932, *603452, *604775, *516020, *604617, *604464, *603498, *300145, *601523, *602694, *600632, *604762, *604492, *400015, *604504, *601717, *601728,
*300242, *602426, *604194, *603821, *604730, *600695, *603823, *603869, *300241, *600707, *603822, *602370, *602202, *604193, *601181, *604089, *602507, *604195, *602306, *300284, *601805, *601895, *601275, *604660, *600752, *603820, *604192, *602207, *308230, *600894, *312600, *603199, *604029, *602500, *102680, *235200, #256300, *601633, #219700, 262890,
*156225, *173470, *193400, *173910, *600354, *113705, *600065, *107741, *107400, *600024, *131195, *113811, #118220, *601638, *300011, *276903, *604144, *311770, *601758, #173900, *604592, *120120, *179605, *603130, *603372, *110750, *222900, *602509, *256100, *602469, *602281, *229300, *224100, *110900, *190180, *261600, *602997, *603616, *603189, 601791,
*601567, *312700, *171060, *308700, *604027, *162643, *516000, *176261, *604028, *314850, #145980, *601383, *600930, *305900, *601253, *136350, *605537, *138140, *604033, *605070, *139250, *300500, *603967, *300041, *603866, #130600, *120150, *601050, *604942, *605204, *605248, *272750, *600163, *604235, *600682, *107266, *306900, *191092, #262500, *600106,
*152790, *186720, *227650, *153700, *308380, *103390, *605646, *164920, *604478, #252650, *173850, *173350, *602505, *246530, *194380, *602575, *603030, #209920, *212138, #214100, *605767, *600582, *189980, #176200, *604653, *604678, *256550, *300037, *253700, #253300, #226700, *604766, #244400, *190000, *188040, *604824, *214500, #237500, *232300, *605014,
*604477, *190930, *605124, *604475, *604594, #227810, *306700, #301050, *600135, *600143, *605145, #269920, *300104, *277900, *300135, *300231, *192500, *182138, *191190, *176805, *600185, *186591, *604889, *603051, *165360, *147545, *601040, #156575, *107269, *603009, *602934, *123825, *601081, *602924, *163890, *600381, *602909, *150330, *109690, *123900,
*603434, *603491, *110700, *602581, *125647, #154700, *114760, *141900, *603690, *120220, *601199, #145500, *601309, *602382, *120325, *600877, *604205, *604090, *601497, *602377, *605464, *138720, *603728, *120950, *604026, *600580, *601610, *137167, *603960, *603931, *601880, *603126, *138190, *130130, *601997, *601975, *600395, *516040, *600418, *600650,
*605245, *605172, *600509, *164761, *310400, *600308, *605109, *600544, *600359, *600103, *605267, *312610, *176100, *308100, *158070, *605123, *173325, #312750, *600839, *158120, #604369, *604465, *173510, #161200, *151525, *605369, *604237, *516050, #600886, *604517, *165180, *605381, *605399, *307800, *604365, *155740, *147795, 601709, *604673, *147730,
*602122, *147557, *193245, *600978, *604990, *603261, *603274, *601007, *131100, *602941, *107941, *146710, *276901, *131244, *602872, *603411, *186357, *176290, *601066, *185050, *232200, *143030, *601843, #236700, *604122, *142800, *134638, *604985, *182380, *603930, *142410, *137060, *604586, *601193, *120650, *252500, *253800, *120930, *604858, *605874,
601274, *602158, *605873, *193210, *203100, *601295, *604095, #201710, *126150, *108740, #205400, *601373, *300167, *109545, *602894, *603361, #300257, *266200, *603401, *131390, *180470, *605908, *604798, #221770, *223360, *180901, *605641, *605745, *604018, *300200, *604603, *230800, *602676, #604004, *605692, *602640, *601599, *134637, *245900, *118425,
601614, *605725, *120110, *300189, *300035, *603102, *250800, *602282, *602458, *123610, *603754, *300278, *601463, *300224, *601581, *182160, *601653, *139191, *601733, *600748, *142460, *601194, *152390, *153620, *601615, *601814, *601617, *601613, *300191, #308300, *600798, 601858, *601872, *601597, #601588, *600821, *147840, *152427, *138850, *600823,
*601492, *300256, *600840, *300267, *601411, *139080, *139090, 600851, *300334, *179080, *602095, *601284, *601282, #177200, *601681, *601252, *176000, *602184, *602188, #266510, #154020, *186711, *257200, *601711, *600667, *602241, *186745, *255125, *300126, *600644, *123890, #255120, #175200, *600004, *302060, *123580, *186760, *122561, *602316, *600017,
*120940, 140300, *151690, *120700, *602354, *600019, *600857, *182175, *600536, *158380, *600516, *120290, *600493, *182310, #252010, *182530, *186830, *601839, *142790, *159465, *118990, *250790, *248600, #248250, *186845, *601153, *142600, *116930, *114860, *171834, #303600, *186880, *600444, *142871, *601852, *602602, *602607, *114207, *186910, #232220,
600880, *134635, *112203, #112100, *111680, *231680, *311030, *111250, *111200, *134390, #226670, #145600, *226200, *602714, *171760, *133550, *602727, *161555, *602744, *602746, #131705, *602835, *600423, *176267, *602859, #600918, 277175, *602874, *601020, *109770, *600170, *217070, *173515, *602893, *147280, *154360, *171050, *108780, *176257, *600979,
*600377, *108360, *204500, *170260, *146880, *154582, *601011, *600997, *602992, *201475, *603005, *190198, *147360, #270400, *600238, #164970, *306250, #126600, *193065, #181350, *106180, *602136, *600937, *603086, *603087, *307030, *182099, *103320, *601683, #192430, *103180, *102681, *192321, *600244, *191740, *191315, *603152, *102642, *191305, #266140,
*100500, *600867, *604585, *604404, *604345, *603201, *605430, *603207, *603208, *605433, *604101, *603969, *605896, *604616, *605851, *605768, *604576, *605754, *605730, *605477, *603263, *605538, *603283, *604402, *605453, *605427, *603302, *605458, 603313, *604415, *603345, *605541, *603353, *605295, *603879, *605268, *605266, *605246, *603377, *603380,
*605181, *604203, *603425, *603867, *605106, *605017, *603842, *604936, *603510, *604857, *605932, *605816, *603765, *603551, *605357, *605237, *604204, *603594, *605110, *604190, *603861, *604962, *603639, *603644, *605007, *605349, *604943, *604918, *604907, *603667, *603681, *605396, *605561, *603712, *603713, *605688, *605942, *604878, *604843, *604659,
*604671, *603798, *604682, *604056, *604705, *603749, 602586, *603647, *602515, #602475, *603717, *602359, *602372, *602380, *602518, *603652, *602573, *603626, 602587, *603598, *602871, *603613, *603750, *603875, *602608, *602666, *602345, *602935, *603564, *603548, *603927, 601876, *602343, *603943, *603787, *601730, *601611, *602679, *603788, *602243,
603790, *601535, *603796, *601488, *601485, *602314, *601478, *604047, *604048, *602297, *604057, *602715, *602192, *601459, *601416, *603833, *602190, *604102, *602106, *604111, *602724, *603499, *602736, *601123, *601002, *600923, *601987, *604149, *601929, *600910, *600900, *600864, *604165, *600782, *602836, *600769, *600742, *602783, *601905, *600535,
*604198, *601901, *600534, *602876, *603356, *600530, *604216, *604217, *602890, *602905, *600465, *600464, *600446, *602891, *603366, *601894, *604272, *603926, *603312, *600368, *602914, *600327, *603151, *603202, 602911, *602974, *603006, *601883, *603008, *600074, *603007, *603046, #603903, *604433, *600016, *603925, *516005, *516004, *516003, *601756,
*604487, *516001, *313475, *313470, #307810, *604527, *604528, *601745, *604551, *604555, *603243, *603242, *603061, *603063, *603217, *300335, *300283, *300281, *604600, *300197, *603097, *603220, *601625, *604623, *603118, *601590, *604646, *300008, *601568, *300007, *275630, *601533, #275200, *270200, #261550, *604031, *604683, #254800, *251100, #242300,
*604058, *604720, *240500, *233690, #232240, #226730, *223100, *222100, #220100, *216950, *604832, 212750, 212067, *604066, *193067, 601315, *193001, *604862, *604870, *191306, *600385, *604879, *191191, *601296, *604914, *190181, *604119, #188550, *604925, *188410, #601287, *604939, *188380, *604126, *604945, *604148, *188060, *604982, *186854, *604988,
*186360, *186355, *185250, *600916, *605008, *605009, 185020, *600734, *605024, *182331, *605032, *605033, *182305, *180903, #179800, *179610, *605060, *179410, *178990, *176802, *605080, *176266, *176263, *176260, *600732, *173490, *604199, *173445, *173391, 172290, *605147, *605149, *171890, *600528, *171833, *605185, #170500, *605193, #168000, *605196,
*167055, *605205, *605208, 166900, *605216, *162651, *162010, *600504, #161400, *604253, #160800, *159460, *154540, *605254, *605261, *153634, *600429, *153337, *600424, *605292, #604286, #152700, 152423, *152310, *151625, *600153, *604313, *151523, *150325, *150320, *150292, *603150, *150290, *150210, *605410, *605415, *605416, *605417, *605421, *603149,
*604349, *147940, *600282, *147880, *146928, *146661, *600150, *146630, *142622, *600018, *605461, *138981, *138590, *600023, *138330, *605495, *138297, *605512, *138230, #136900, #301310, *516006, *605545, *605546, *136131, *134660, *134350, *516002, *605589, *131235, #130050, *605625, *126455, *126064, #125310, *605670, *604534, *125240, *123836, *123830,
*123620, *605702, #122200, *120980, *120360, *118510, *114835, *605710, *605716, *605722, *114217, *604561, *113810, *111740, #110800, *605748, *605752, *604564, *110600, *603160, *109610, *605784, #107480, *107273, *603192, *300169, *106195, *105210, *104615, *104614, *104210, *103850, 103581, *605876, *605877, *605879, *103220, *605887, *300150, *102910,
*102670, *102576, *605916, *604629, *102575, *102573, *300132, *101800, *605947
3) Channel (Member of Membrane Protein)
361 entries found, searching for “channel”
*176266, *600724, *182390, *123825, *114208, *114206, *176267, *114205, *601784, *600937, *114204, *603415, *600053, *114207, *114209, *605427, *604527, *604528, *600760, *601011, *192500, *118425, *600228, *176261, *602235, *600761, *600359, *300008, *182389, *600877, *602232, *176263, *182391, *601328, *600054, *603939, *602208, *601534, *600504, *602323,
*603208, *601958, *603537, *601012, *601327, *600734, *602780, *602781, *604433, *603220, *182392, *605874, *605873, *601745, *603888, *603219, *602604, *603796, *302910, *602866, *601013, *602905, *602906, *603967, *600163, #170500, *152427, *180901, *176260, #601462, *603951, *601141, *604492, *600702, *602023, *600308, *602754, *107776, *176257, *602024,
*601949, *605222, *601142, *602983, *193245, *600681, *176265, *600235, *176262, *176258, *605206, *604427, *605411, *603305, *601219, *600150, *604065, *602343, *605223, *605720, *603906, *138249, *138253, *600843, *604385, *600003, *600935, *603940, *602727, *602158, 602911, *600397, *602726, *600845, *605080, *600580, *602872, *602106, *176264, *603953,
*605722, *300110, *138252, *604111, *602717, *602420, *600570, 600844, *603493, *600932, *605716, *138254, *603652, *300138, *605410, *176268, *605214, *605696, *300334, *604660, *176256, *605879, *603749, *603583, *602345, *604661, *603787, 603313, *602982, *604337, *600846, *604662, *300328, *300281, *602566, *602836, *604003, *603788, *603651, *602421,
*107777, #177200, *100725, #219700, *100690, *100710, #160800, #603830, #183086, *600509, #220400, #601144, *173910, *180902, *605692, #264350, #160900, #145600, #255700, *602076, *603061, *601313, *154275, #604233, *604532, #108500, #121201, #170400, *300225, *121014, *139311, #125800, #160120, *118503, 601439, #141500, #168300, *304040, #601887, #256450,
*186945, *154276, #300009, #216900, *600040, *601014, *601042, *602512, *601383, *605445, *602368, *603831, #117000, *601218, *108745, *605248, #177735, #173900, *601212, *182139, *601059, *600039, *601485, *180903, *186360, *603319, #600101, *118509, *600109, #121200, *600170, *604187, *176975, *137163, #310468, #263800, #262300, *603750, *600229, *124030,
*602251, #603829, *137143, #145500, *600669, *147450, *154050, *603353, *600516, *601157, *600855, *601154, *602522, *249210, *600968, #252650, *171060, *600919, *156490, #259700, #601678, *601764, #310500, *131244, *300041, *121011, *125950, *114180, *602974, *600637, *113730, *118504, *605145, *604669, *118800, *121013, *121015, *138491, *600421, *104610,
*604045, *604594, *131230, *605487, *138247, *600467, #602485, *602481, *138251, *137192, *602403, 600851, *277900, *603785, *603152, *603199, *603475, #168600, #272120, *170280, *603852, #241200, *603053, *600465, #603034, *142461, *164920, *137164, *600884, *600442, *123885, *604001, *600232, *232200, *171050, *602103, *602014, *300211, *600983, *602887,
*604415, *604418, *300242, #300071, *604471, *600837, 168350, *118511, 193007, *600300, *604654, #601820, *180297, *600046, *603853, *604678, *604693, #604772, *118508, *603855, *605204, #254210, *182099, *182307, #130600, *601109, *114080, *300103, *182860, *605438, *601129, *603964, *600019, *516060, #185000, *138079, *104210, *605818, *603418, *305990, *305450
4) Extracellular Matrix
218 entries found, searching for “extracellular matrix”
*605912, *603479, *602201, *604633, *601418, *601548, *115437, *154870, *600754, *602261, *602285, *602262, *134797, *120361, *604629, *604871, *603321, *603320, *601807, #154700, *116935, *185261, *120360, *185250, *605470, *603767, *253700, *190180, *128239, *308700, *276901, *193300, *120324, *188826, *602109, *155760, *600514, *600261, #177170, *600536,
*147557, #116920, *150240, *601313, *120140, 601614, *605158, *120150, *120180, #200610, *605127, *193400, *192240, #173900, *152200, #136900, *135821, #130070, *120320, *120220, *112260, *310200, *600900, *600262, *605670, *600985, *179590, #245150, *602574, *601463, 183850, *601211, *604241, *600758, *186745, *604710, *602369, *602090, *190182, *192975,
*602178, *230740, *600065, *601652, *158106, *190181, *156790, #158810, *193210, *155120, *192977, *193065, #226700, *187380, *231050, *182120, *188060, *186355, 163200, *164010, #156550, *151510, *150370, *253800, *156225, *150325, #194050, *150290, *216550, *147620, *600215, *222600, *147559, *165380, *182888, *600491, *146650, *146640, *600564, *600596,
*600616, *600700, *600742, *138297, *182889, *154705, *600930, *301870, *153619, *601050, *601090, *601105, *165070, *305370, *135820, *130660, *310300, *601492, *128240, *601587, #126600, *601636, *600119, *601692, *601728, *125485, 601858, *601915, *602048, *175100, *602108, *121010, *600245, *120470, *120328, *120325, *602264, *120280, *602366, *600309,
*602402, *602415, *602428, *602453, *602505, #166210, *602600, *602941, *603005, *603196, 603209, *603221, *603234, *603319, *120250, *120210, *120120, *603489, *603551, *118938, *603799, *603842, *603924, *603963, *604042, *604063, *604149, *604160, *601028, *604467, *604510, *604592, *116930, *116806, *601284, *604724, *604806, *604807, *604808, *107269,
*605007, *605008, *605009, *600214, *600076, *605174, *605175, *605292, *605343, *605351, #600204, *605497, *605546, *605587, *605623, *600211, *605702, *103320
In addition to these, the various keywords shown in the above-mentioned categorization or others can be used for the OMIM search and the result may suggest the involvement thereof in diseases.
Further, the use of nucleotide sequences of cDNAs of the present invention enables analyzing the expression frequency of genes corresponding to the cDNAs. In addition, functions of the genes can be predicted based on the information obtained by the expression frequency analysis.
There are several methods for analyzing the expression levels of genes involved in diseases. Differences in gene expression levels between diseased and normal tissues are studied by the analytical methods using, for example, Northern hybridization, RT-PCR, DNA microarray, etc. (Experimental Medicine, Vol. 17, No. 8, 980-1056 (1999); Cell Engineering (additional volume) DNA Microarray and Advanced PCR Methods, Muramatsu & Nawa (eds.), Shujunsya (2000)). By computer analysis, in addition to these analysis methods, the nucleotide sequences of expressed genes can be compared to analyze the expression frequency. For example, there is a database called “BODYMAP”; gene clones are extracted at random from cDNA libraries of various tissues and/or cells, and the clones homologous to one another are assigned to a single cluster based on the information of nucleotide sequence homology at the 3′-end; genes are classified into any clusters, and the numbers of clones in the respective clusters are compared to gain the information on expression frequency (http://bodymap.ims.utokyo.ac.jp/).
When explicit difference in the expression levels between diseased tissues and normal tissues is observed for a gene by these analytical methods, it can be conclude that the gene is closely involved in a disease or disorder. Instead of diseased tissues, when gene expression is explicitly different between normal cells and cells reproducing disease-associated specific features, it can be concluded that the gene is closely involved in a disease or disorder.
From the 2443 clones whose full-length nucleotide sequences had been revealed, genes involved in particular pathology or functions were selected by the use of databases shown below (see Example 7; “Expression frequency analysis in silico”). The database used in the analyses of the present invention contains nucleotide sequences of 1,402,070 clones, and the population of the database is large enough for the analysis. The sequence information in the database was obtained by selecting cDNA clones at random from cDNA libraries derived from the various tissues and cells shown in Example 1 and determining the 5′-end sequences thereof.
Then, the nucleotide sequences of respective clones in this database were categorized (clustered) based on the nucleotide sequence homology determined with a search program; the number of clones belonging to every cluster of each library was determined and normalized; thus, the ratio of a certain gene in a cDNA library was determined. This analysis provided the information of the expression frequency of a gene in a tissue or cell that is the source of the cDNA library.
Then, in order to analyze the expression of genes corresponding to the nucleotide sequences of cDNAs of the present invention in tissues and cells, the libraries from the tissues or cells, which had been used in the large-scale cDNA analyses, were taken as subjects to compare the expression levels between different tissues or cells. Namely, the expression frequency was analyzed by comparing the previously normalized values between tissues or cells from which 600 or more cDNA clones whose nucleotide sequences had been analyzed were derived. The result of this analysis showed that the cDNA clones corresponded to the genes involved in the pathology and functions, which are indicated below. Each value in Tables 3 to 51 indicated below represents a relative expression frequency; the higher the value, the higher the expression level.
Osteoporosis-Related Genes
Osteoporosis is a pathology in which bones are easily broken owing to overall decrease in components of bone. The onset correlates to the balance between the functions of osteoblast producing bone and osteoclast absorbing bone, namely bone metabolism. Thus, the genes involved in the increase of osteoclasts differentiating from precursor cells of monocyte/macrophage line (Molecular Medicine 38. 642-648. (2001)) are genes involved in osteoporosis relevant to bone metabolism.
A nucleotide sequence information-based analysis was carried out to identify the genes whose expression frequencies are higher or lower in CD34+ cell (cell expressing a glycoprotein CD34) treated with the osteoclast differentiation factor (Molecular Medicine 38. 642-648. (2001)) than in the untreated CD34+ cell, which is the precursor cell of monocyte/macrophage line. The result of comparative analysis for the frequency between the cDNA libraries prepared from the RNA of CD34+ cells (CD34C) and from the RNA of CD34+ cells treated with the osteoclast differentiation factor (D30ST, D60ST or D90ST) showed that the genes whose expression levels were different between the two were 56 clones indicated in Table 3. These clones are involved in osteoporosis.
Genes Involved in Neural Cell Differentiation
Genes involved in neural cell differentiation are useful for treating neurological diseases. Genes with varying expression levels in response to induction of cellular differentiation in neural cells are thought to be involved in neurological diseases.
A survey was performed for genes whose expression levels are varied in response to induction of differentiation (stimulation by retinoic acid (RA) or growth inhibitor treatment after RA stimulation) in cultured cells of a neural strain, NT2. The result of comparative analysis of cDNA libraries derived from undifferentiated NT2 cells (NT2RM) and the cells subjected to the differentiation treatment (NT2RP, NT2R1 or NT2NE) showed that the genes whose expression levels were different between the two were 288 clones indicated in Table 4. These genes are neurological disease-related genes.
Cancer-Related Genes
It has been assumed that, distinct from normal tissues, cancer tissues express a distinct set of genes, and thus the expression thereof can contribute to the carcinogenesis in tissues and cells. Thus, genes whose expression patterns in cancer tissues are different from those in normal tissues are cancer-related genes. Search was carried out for the genes whose expression levels in cancer tissues were different from those in normal tissues.
The result of comparative analysis of cDNA libraries derived from breast tumor (TBAES) and normal breast (BEAST) showed that the genes whose expression levels were different between the two were 35 clones indicated in Table 5.
The result of comparative analysis of cDNA libraries derived cervical tumor (TCERX) and normal cervical duct (CERVX) showed that the genes whose expression levels were different between the two were 11 clones indicated in Table 6.
The result of comparative analysis of cDNA libraries derived from colon tumor (TCOLN) and normal colon (COLON) showed that the genes whose expression levels were different between the two were 25 clones indicated in Table 7.
The result of comparative analysis of cDNA libraries derived from esophageal tumor (TESOP) and normal esophagus (NESOP) showed that the genes whose expression levels were different between the two were 41 clones indicated in Table 8.
The result of comparative analysis of cDNA libraries derived from kidney tumor (TKIDN) and normal kidney (KIDNE) showed that the genes whose expression levels were different between the two were 175 clones indicated in Table 9.
The result of comparative analysis of cDNA libraries derived from liver tumor (TLIVE) and normal liver (LIVER) showed that the genes whose expression levels were different between the two were 47 clones indicated in Table 10.
The result of comparative analysis of cDNA libraries derived from lung tumor (TLUNG) and normal lung (HLUNG) showed that the genes whose expression levels were different between the two were 62 clones indicated in Table 11.
The result of comparative analysis of cDNA libraries derived from ovary tumor (TOVER) and normal ovary (NOVER) showed the genes whose expression levels were different between the two were 23 clones indicated in Table 12.
The result of comparative analysis of cDNA libraries derived from stomach tumor (TSTOM) and normal stomach (STOMA) showed that the genes whose expression levels were different between the two were 70 clones indicated in Table 13.
The result of comparative analysis of cDNA libraries derived from uterine tumor (TUTER) and normal uterus (UTERU) showed that the genes whose expression levels were different between the two were 236 clones indicated in Table 14.
The result of comparative analysis of cDNA libraries derived from tongue cancer (CTONG) and normal tongue (NTONG) showed that the genes whose expression levels were different between the two were 232 clones indicated in Table 15.
These genes are involved in cancers.
Further, there is a method to search for genes involved in development and differentiation, which is the expression frequency analysis in which the expression levels of genes are compared between developing and/or differentiating tissues and/or cells and adult tissues and/or cells. The genes involved in tissue development and/or differentiation are genes participating in tissue construction and expression of function, and thus are useful genes, which are available for regenerative medicine aiming at convenient regeneration of injured tissues.
By using the information of gene expression frequency gained from the database of 5′-end nucleotide sequences described above, genes involved in development or differentiation of particular tissues were selected from the 2443 clones whose full-length nucleotide sequence had been revealed (see Example 7).
The result of comparative analysis of cDNA libraries derived from fetal brain (FCBBF, FEBRA or OCBBF) and adult brain (BRACE, BRALZ, BRAMY, BRAWH, BRCAN, BRCOC, BRHIP, BRSSN, BRSTN or BRTHA) showed that the genes whose expression levels were different between the two were 1195 clones indicated in Tables 16 to 48.
The result of comparative analysis of cDNA libraries derived from fetal heart (FEHRT) and adult heart (HEART) showed that the genes whose expression levels were different between the two were 45 clones indicated in Table 49.
The result of comparative analysis of cDNA libraries derived from fetal kidney (FEKID) and adult kidney (KIDNE) showed that the genes whose expression levels were different between the two were 118 clones indicated in Table 50.
The result of comparative analysis of cDNA libraries derived from fetal lung (FELNG) and adult lung (HLUNG) showed that the genes whose expression levels were different between the two were 63 clones indicated in Table 51. These genes are involved in regeneration of tissues and/or cells.
The expression frequency or the like can be analyzed by PCR based on the nucleotide sequences of cDNAs of the present invention. There are some known methods for comparing the quantities of amplification products obtained by PCR. For example, the band intensities can be determined by ethidium bromide staining. With R1-labeled or fluorescently labeled primers, the R1 signal or fluorescence intensity can be assayed for the quantity of labeled amplification products. Alternatively, the quantity of amplification products can also be determined by measuring the R1 signal or the fluorescence intensity from the R1-labeled or fluorescently labeled probe hybridizing to the products. The assay results thus obtained are compared and then the clones exhibiting differences in the expression levels can be selected.
There are some quantitative PCR methods: a PCR method using internal standards; a competitive PCR, in which the quantification is achieved by adding, to a sample, a dilution series of a known quantity of a template RNA and by comparing the quantity of an amplification product derived from the RNA of interest with the quantity of an amplification product derived from the template RNA. These methods overcome the problems of errors in the amount of amplification products among tubes and of the plateau effect. ATAC-PCR (Adaptor-tagged competitive PCR) is a method of competitive PCR which is practiced by using multiple adapters of different sizes attached to a gene whose 3′-end nucleotide sequence has previously been determined. The ratio of expression frequency of a single mRNA species from a number of tissues (cells) can be assayed in a single step (Nucleic Acids Research 1997, 25(22): 4694-4696; “DNA Micro-array and Advanced PCR Techniques”, Cell Technology, supplement, Eds., Muramatsu and Nawa (Shujunsha, 2000): 104-112).
If it is observed, by using these analytical methods, that the expression levels of genes are evidently varied during major cellular events (such as differentiation and apoptosis), the genes are involved in the cellular events and accordingly are candidates for disease- and/or disorder-related genes. Further, genes exhibiting tissue-specific expression are genes playing important parts in the tissue functions and, therefore, can be candidates for genes involved in diseases and/or disorders affecting the tissues.
For example, inflammation is an important biological response that is known to be involved in various diseases. The representative inflammation-inducing factors include TNF-a (Tumor Necrosis Factor-alpha). There exists a signaling cascade activated by TNF-α stimulations, wherein NF-κB is a transducing molecule (Cell 1995, 80:529-532). It has also been revealed that many inflammation-related genes, including IL-2, IL-6 and G-CSF, are varied in the expression levels thereof in response to the signal through the pathway (Trends Genet. 1999, 15(6): 229-235). It is assumed that genes whose expression levels are varied in response to the stimulation of TNF-α also participate in inflammation.
Further, the infection of Helicobacter pylori to the gastric epithelia is known to cause gastritis and gastroduodenal ulcer (Mebio 2000, July, 17(7): 16-33). Thus, the genes whose expression levels are altered depending on co-culturing cells with Helicobacter pylori may be involved in gastritis and gastroduodenal ulcer. A recent study has suggested that Helicobacter pylori strongly activates the NF-KB pathway(Gastroenterology 2000, 119: 97-108).
THP-1 cell, which is a human monocyte cell line, was cultured in the presence of TNF-α (Tumor Necrosis Factor-alpha) The genes whose expression levels were altered owing to the presence of TNF-α were searched for, and the result showed that the clones whose expression levels were increased owing to the presence of TNF-α were ASTRO20152140, BRACE20057620,
BRACE20060720, BRACE20090440, BRACE20152870, BRACE20229280, BRAMY20002770, BRAMY20266850, BRAMY20280720, BRAWH20106180, BRAWH20122770, BRHIP20096170, BRHIP20111200, BRHIP20186120, BRHIP20194940, BRHIP20207430, BRSSN20152380, CTONG20095270, CTONG20100240, CTONG20158150,
CTONG20265130, D3OST20006540, D9OST20031370, FCBBF20071860, FCBBF30251420, FCBBF30252520, FCBBF40001420, FEBRA20017050, FEBRA20082100, HCHON20011160, KIDNE20141190, KIDNE20163880, KIDNE20182690, LIVER10004790, LIVER20038540, LIVER20085800, MESAN20130220, MESAN20174170, NT2NE20158600, NT2RI20005750, NT2RP70110860, NT2RP70169110, NT2RP70175670, NT2RP70188710, PERIC20002140, PLACE60155130, PROST20120160, PROST20149250, PROST20161950, PUAEN20015260, SKNSH20080430, SMINT20051610, SMINT20060780, SMINT20161220, SMINT20163960, SPLEN20101190, SPLEN20157300, SPLEN20163560, SPLEN20214580, SPLEN20279950, STOMA20048520, TESTI20076850, TESTI20087620, TESTI20108720, TESTI20220100, TESTI20239510, TESTI20266740, TESTI20342430, TESTI20370020, TESTI20391210, TESTI20401020, TESTI20415640, THYMU20130890, THYMU20286290, TRACH20060150, TRACH20099340, UTERU20004240, UTERU20068990, UTERU20119060.
On the other hand, the clones whose expression levels were decreased owing to the presence of TNF-αwere ASTRO20032120,
ASTRO20084250, ASTRO20181690, BRACE20062640, BRACE20067430, BRACE20235400, BRALZ20018340, BRALZ20069760, BRALZ20075450, BRAMY20163270, BRAMY20204450, BRAMY20218670, BRAMY20229800, BRAWH10000930, BRAWH20107540, BRAWH20132190, BRAWH20158530, BRCAN20273340, BRHIP20105710, BRHIP20186120,
BRSSN20176820, CTONG20095290, DFNES20031920, FCBBF30033050, FCBBF30071520, FCBBF30083820, HCHON20008980, HCHON20022470, HHDPC20034390, KIDNE20028720, KIDNE20079440, KIDNE20127750, KIDNE20148900, LIVER20011130, MAMGL10000830, MESAN20127350, NT2NE20181650, NT2RI20023160, NT2RP70102350, NT2RP70157890, NTONG20029480, OCBBF20020830, OCBBF20041680, OCBBF20061720, OCBBF20127040, OCBBF20139260, OCBBF20178990, PEBLM20013120, PLACE60003480, PLACE60181070, PROST20151240, PUAEN20003740, PUAEN20011880, PUAEN20078980, PUAEN20085150, SKNSH20080430, SMINT20001760, SMINT20047810, SMINT20108530, SPLEN20158990, SPLEN20283650, STOMA20010250, STOMA20057820, TESTI20060400, TESTI20161970, TESTI20275620, TESTI20369690, TESTI20386230, TESTI20392250, TESTI20409440, TESTI20424730, THYMU20095960, THYMU20111180, THYMU20226600, THYMU20253250, THYMU20272490, TRACH20153810, UTERU20176130, UTERU20186740.
These clones are inflammation-related genes.
MKN45, which is a gastric cancer cell line, was co-cultured with Helicobacter pylori. The genes whose expression levels were altered owing to the presence of Helicobacter pylori were searched for, and the result showed that the clones whose expression levels were increased owing to the presence of Helicobacter pylori were ADRGL20067670, BLADE20004630,
BRACE20039040, BRACE20151320, BRACE20229280, BRACE20235400, BRALZ20058880, BRAMY20060920, BRAMY20184670, BRAMY20218670, BRAMY20229800, BRCAN20147880, BRHIP20196410, BRHIP30004880, BRSSN20187310, CD34C30004940, CTONG20265130, DFNES20031920, FCBBF30278630, FCBBF40001420,
HHDPC20095280, KIDNE20130450, LIVER20011130, LIVER20038540, NT2NE20172590, NT2RP70169110, OCBBF20085200, OCBBF20180840, PEBLM10000240, PLACE60003480, PROST20120160, PROST20151240, PUAEN20011880, SKMUS20031680, SKNSH20080430, SMINT20056210, SMINT20105000, SPLEN20019450, SPLEN20211570, STOMA20048520, TESTI20004890, TESTI20083940, TESTI20168480, TESTI20239510, TESTI20308600, TESTI20478010, UTERU20126880.
On the other hand, the clones whose expression levels were decreased owing to the presence of Helicobacter pylori were
ASTRO20032120, BRACE20090440, BRACE20114780, BRALZ20064740, BRAMY20002770, BRAMY20210400, BRAMY20215230, BRAMY20247280, BRAMY20267130, BRAWH20029630, BRAWH20100690, BRAWH20118230, BRCOC20105100, BRHIP20218580, BRSSN20046570, CTONG20138030, CTONG20146970, CTONG20158150, D3OST20037970, FCBBF30001840, FCBBF30033050, FEBRA20082100, HCHON20035130, HCHON20043590, HCHON20067220, NT2NE20174920, NT2RI20009870, NT2RI20023160, NT2RP70062230, NT2RP70130020, NTONG20070340, OCBBF20020150, OCBBF20094240, OCBBF20107920, PROST20144220, PROST20149160, PROST20153320, PUAEN20003740, PUAEN20025680, PUAEN20040670, SMINT20014580, SPLEN20101190, STOMA20076800, TESTI20087620, TESTI20098530, TESTI20123080, TESTI20161970, TESTI20234140, TESTI20288110, TESTI20357960, TESTI20391210, TESTI20424730, THYMU20158250, THYMU20226600, TRACH20005020, TRACH20134950, TRACH20184490, TSTOM20001390, UTERU20119060, UTERU20134910, UTERU20176130.
These clones are involved in gastritis or gastroduodenal ulcer.
For example, if the polypeptide encoded by the cDNA of the present invention is a regulatory factor of cellular conditions such as growth and differentiation, it can be used for developing medicines as follows. The polypeptide or antibody provided by the invention is injected into a certain kind of cells by microinjection. Then, using the cells, it is possible to screen low molecular weight compounds, etc. by measuring the change in the cellular conditions, or the activation or inhibition of a particular gene. The screening can be performed as follows.
First, the polypeptide is expressed and purified as recombinant. The purified polypeptide is microinjected into cells such as various cell lines, or primary culture cells, and the cellular change such as growth and differentiation can be examined. Alternatively, the induction of genes whose expression is known to be involved in a particular change of cellular conditions may be detected by the amount of mRNA or polypeptide. Alternatively, the amount of intracellular molecules (low molecular weight compounds, etc.) that is changed by the function of the gene product (polypeptide) which is known to be involved in a particular change of cellular conditions may be detected. The compounds to be screened (both low and high molecular compounds are acceptable) can be added to the culture media and assessed for their activity by measuring the change of the cellular conditions.
Instead of microinjection, cell lines introduced with the gene obtained in the invention can be used for the screening. If the gene product is turn out to be involved in a particular change in the cellular conditions, the change of the product can be used as a measurement for screening. Once a compound is screened out which can activate or inhibit the function of the polypeptide of the invention, it can be applied for developing medicines.
If the polypeptide encoded by the cDNA of the present invention is a secretory protein, membrane protein, or protein involved in signal transduction, glycoprotein, transcription, or diseases, it can be used in functional assays for developing medicines.
In case of a membrane protein, it is most likely to be a polypeptide that functions as a receptor or ligand on the cell surface. Therefore, it is possible to reveal a new relationship between a ligand and receptor by screening the membrane protein of the invention based on the binding activity with the known ligand or receptor. Screening can be performed according to the known methods.
For example, a ligand against the polypeptide of the invention can be screened in the following manner. Namely, a ligand that binds to a specific polypeptide can be screened by a method comprising the steps of: (a) contacting a test sample with the polypeptide of the invention or a partial peptide thereof, or cells expressing these, and (b) selecting a test sample that binds to said polypeptide, said partial peptide, or said cells.
On the other hand, for example, screening using cells expressing the polypeptide of the present invention that is a receptor protein can also be performed as follows. It is possible to screen receptors that is capable of binding to a specific polypeptide by using procedures (a) attaching the sample cells to the polypeptide of the invention or its partial peptide, and (b) selecting cells that can bind to the said polypeptide or its partial peptide.
In a following screening as an example, first the polypeptide of the invention is expressed, and the recombinant polypeptide is purified. Next, the purified polypeptide is labeled, binding assay is performed using a various cell lines or primary cultured cells, and cells that are expressing a receptor are selected (Growth and differentiation factors and their receptors, Shin-Seikagaku Jikken Kouza Vol. 7 (1991) Honjyo, Arai, Taniguchi, and Muramatsu edit, p203-236, Tokyo-Kagaku-Doujin). A polypeptide of the invention can be labeled with RI such as 125I, and enzyme (alkaline phosphatase etc.).
Alternatively, a polypeptide of the invention may be used without labeling and then detected by using a labeled antibody against the polypeptide. The cells that are selected by the above screening methods, which express a receptor of the polypeptide of the invention, can be used for the further screening of an agonists or antagonists of the said receptor.
Once the ligand binding to the polypeptide of the invention, the receptor of the polypeptide of the invention or the cells expressing the receptor are obtained by screening, it is possible to screen a compound that binds to the ligand and receptor. Also it is possible to screen a compound that can inhibit both bindings (agonists or antagonists of the receptor, for example) by utilizing the binding activities.
When the polypeptide of the invention is a receptor, the screening method comprises the steps of (a) contacting the polypeptide of the invention or cells expressing the polypeptide of the invention with the ligand, in the presence of a test sample, (b) detecting the binding activity between said polypeptide or cells expressing said polypeptide and the ligand, and (c) selecting a compound that reduces said binding activity when compared to the activity in the absence of the test sample. Furthermore, when the polypeptide of the invention is a ligand, the screening method comprises the steps of (a) contacting the polypeptide of the invention with its receptor or cells expressing the receptor in the presence of samples, (b) detecting the binding activity between the polypeptide and its receptor or the cells expressing the receptor, and (c) selecting a compound that can potentially reduce the binding activity compared to the activity in the absence of the sample.
Samples to screen include cell extracts, expressed products from a gene library, synthesized low molecular compound, synthesized peptide, and natural compounds, for example, but are not construed to be listed here. A compound that is isolated by the above screening using a binding activity of the polypeptide of the invention can also be used as a sample.
A compound isolated by the screening may be a candidate to be an agonist or an antagonist of the receptor of the polypeptide. By utilizing an assay that monitors a change in the intracellular signaling such as phosphorylation which results from reduction of the binding between the polypeptide and its receptor, it is possible to identify whether the obtained compound is an agonist or antagonist of the receptor. Also, the compound may be a candidate of a molecule that can inhibit the interaction between the polypeptide and its associated proteins (including a receptor) in vivo. Such compounds can be used for developing drugs for precaution or cures of a disease in which the polypeptide is involved.
Secretory proteins may regulate cellular conditions such as growth and differentiation. It is possible to find out a novel factor that regulates cellular conditions by adding the secretory protein of the invention to a certain kind of cell, and performing a screening by utilizing the cellular changes in growth or differentiation, or activation of a particular gene.
The screening can be performed, for example, as follows. First, the polypeptide of the invention is expressed and purified in a recombinant form. Then, the purified polypeptide is added to a various kind of cell lines or primary cultured cells, and the change in the cell growth and differentiation is monitored. The induction of a particular gene that is known to be involved in a certain cellular change is detected by the amounts of mRNA and polypeptide. Alternatively, the amount of an intracellular molecule (low-molecular-weight compounds, etc.) that is changed by the function of a gene product (polypeptide) that is known to function in a certain cellular change is used for the detection.
Once the screening reveals that the polypeptide of the invention can regulate cellular conditions or the functions, it is possible to apply the polypeptide as a pharmaceutical and diagnostic medicine for related diseases by itself or by altering a part of it into an appropriate composition.
As is above described for membrane proteins, the secretory protein provided by the invention may be used to explore a novel ligand-receptor interaction using a screening based on the binding activity to a known ligand or receptor. A similar method can be used to identify an agonist or antagonist. The resulting compounds obtained by the methods can be a candidate of a compound that can inhibit the interaction between the polypeptide of the invention and an interacting molecule (including a receptor). The compounds may be able to use as a preventive, therapeutic, and diagnostic medicine for the diseases, in which the polypeptide may play a certain role.
Proteins involved in signal transduction or transcription may be a factor that affects a certain polypeptide or gene in response to intracellular/extracellular stimuli. It is possible to find out a novel factor that can affect a polypeptide or gene by expressing the polypeptide provided by the invention in a certain types of cells, and performing a screening utilizing the activation of a certain intracellular polypeptide or gene.
The screening may be performed as follows. First, a transformed cell line expressing the polypeptide is obtained. Then, the transformed cell line and the untransformed original cell line are compared for the changes in the expression of a certain gene by detecting the amount of its mRNA or polypeptide. Alternatively, the amount of an intracellular molecule (low molecular weight compounds, etc.) that is changed by the function of a certain gene product (polypeptide) may be used for the detection. Furthermore, the change of the expression of a certain gene can be detected by introducing a fusion gene that comprises a regulatory region of the gene and a marker gene (luciferase, β-galactosidase, etc.) into a cell, expressing the polypeptide provided by the invention into the cell, and estimating the activity of a marker gene product (polypeptide).
If the polypeptide or gene of the invention is involved in diseases, it is possible to screen a gene or compound that can regulate its expression and/or activity either directly or indirectly by utilizing the polypeptide of the present invention.
For example, the polypeptide of the invention is expressed and purified as a recombinant polypeptide. Then, the polypeptide or gene that interacts with the polypeptide of the invention is purified, and screened based on the binding. Alternatively, the screening can be performed by adding with a compound of a candidate of the inhibitor added in advance and monitoring the change of binding activity. In another method, a transcription regulatory region locating in the 5′-upstream of the gene encoding the polypeptide of the invention that is capable of regulating the expression of other genes is obtained, and fused with a marker gene. The fusion is introduced into a cell, and the cell is added with compounds to explore a regulatory factor of the expression of the said gene.
The compound obtained by the screening can be used for developing pharmaceutical and diagnostic medicines for the diseases in which the polypeptide of the present invention is involved. Similarly, if the regulatory factor obtained in the screening is turn out to be a polypeptide, compounds that can newly affect the expression or activity of the polypeptide may be used as a medicine for the diseases in which the polypeptide of the invention is involved.
If the polypeptide of the invention has an enzymatic activity, regardless as to whether it is a secretory protein, membrane protein, or proteins involved in signal transduction, glycoprotein, transcription, or diseases, a screening may be performed by adding a compound to the polypeptide of the invention and monitoring the change of the compound. The enzymatic activity may also be utilized to screen a compound that can inhibit the activity of the polypeptide.
In a screening given as an example, the polypeptide of the invention is expressed and the recombinant polypeptide is purified. Then, compounds are contacted with the purified polypeptide, and the amount of the compound and the reaction products is examined. Alternatively, compounds that are candidates of an inhibitor are pretreated, then a compound (substrate) that can react with the purified polypeptide is added, and the amount of the substrate and the reaction products is examined.
The compounds obtained in the screening may be used as a medicine for diseases in which the polypeptide of the invention is involved. Also they can be applied for tests that examine whether the polypeptide of the invention functions normally in vivo.
Whether the secretory protein, membrane protein, signal transduction-related protein, glycoprotein-related protein, or transcription-related protein of the present invention is a novel protein involved in diseases or not is determined in another method than described above, by obtaining a specific antibody against the polypeptide of the invention, and examining the relationship between the expression or activity of the polypeptide and a certain disease. In an alternative way, it may be analyzed referred to the methods in “Molecular Diagnosis of Genetic Diseases” (Elles R. edit, (1996) in the series of “Method in Molecular Biology” (Humana Press).
Proteins involved in diseases are targets of screening as mentioned, and thus are very useful in developing drugs which regulate their expression and activity. Also, the proteins are useful in the medicinal industry as a diagnostic marker of the related disease or a target of gene therapy.
Compounds isolated as mentioned above can be administered patients as it is, or after formulated into a pharmaceutical composition according to the known methods. For example, a pharmaceutically acceptable carrier or vehicle, specifically sterilized water, saline, plant oil, emulsifier, or suspending agent can be mixed with the compounds appropriately. The pharmaceutical compositions can be administered to patients by a method known to those skilled in the art, such as intraarterial, intravenous, or subcutaneous injections. The dosage may vary depending on the weight or age of a patient, or the method of administration, but those skilled in the art can choose an appropriate dosage properly. If the compound is encoded by polynucleotide, the polynucleotide can be cloned into a vector for gene therapy, and used for gene therapy. The dosage of the polynucleotide and the method of its administration may vary depending on the weight or age of a patient, or the symptoms, but those skilled in the art can choose properly.
The present invention further relates to databases comprising at least a sequence of polynucleotide and/or polypeptide, or a medium recorded in such databases, selected from the sequence data of the nucleotide and/or the amino acids indicated in Table 1. The term “database” means a set of accumulated information as machine-searchable and readable information of nucleotide sequence. The databases of the present invention comprise at least one of the novel nucleotide sequences of polynucleotides provided by the present invention. The databases of the present invention can consist of only the sequence data of the novel polynucleotides provided by the present invention or can comprise other information on nucleotide sequences of known full-length cDNAs or ESTs. The databases of the present invention can be comprised of not only the information on the nucleotide sequences but also the information on the gene functions revealed by the present invention. Additional information such as names of DNA clones carrying the full-length cDNAs can be recorded or linked together with the sequence data in the databases.
The database of the present invention is useful for gaining complete gene sequence information from partial sequence information of a gene of interest. The database of the present invention comprises nucleotide sequence information of full-length cDNAs. Consequently, by comparing the information in this database with the nucleotide sequence of a partial gene fragment yielded by differential display method or subtraction method, the information on the full-length nucleotide sequence of interest can be gained from the sequence of the partial fragment as a starting clue.
The sequence information of the full-length cDNAs constituting the database of the present invention contains not only the information on the complete sequences but also extra information on expression frequency of the genes as well as homology of the genes to known genes and known polypeptides. Thus the extra information facilitates rapid functional analyses of partial gene fragments. Further, the information on human genes is accumulated in the database of the present invention, and therefore, the database is useful for isolating a human homologue of a gene originating from other species. The human homologue can be isolated based on the nucleotide sequence of the gene from the original species.
At present, information on a wide variety of gene fragments can be obtained by differential display method and subtraction method. In general, these gene fragments are utilized as tools for isolating the full-length sequences thereof. When the gene fragment corresponds to an already-known gene, the full-length sequence is easily obtained by comparing the partial sequence with the information in known databases. However, when there exists no information corresponding to the partial sequence of interest in the known databases, cDNA cloning should be carried out for the full-length cDNA. It is often difficult to obtain the full-length nucleotide sequence using the partial sequence information as an initial clue. If the full-length of the gene is not available, the amino acid sequence of the polypeptide encoded by the gene remains unidentified. Thus the database of the present invention can contribute to the identification of full-length cDNAs corresponding to gene fragments, which cannot be revealed by using databases of known genes.
The present invention has provided 2443 polynucleotides. As has not yet proceeded the isolation of full-length cDNA within the human, the invention has great significance. It is known that secretory proteins, membrane proteins, signal transduction-related proteins, glycoprotein-related proteins, transcription-related proteins, and so on are involved in many diseases. The genes and proteins involved in diseases are useful for developing a diagnostic marker or medicines for regulation of their expression and activity, or as a target of gene therapy.
In particular, cDNA assumed to encode secretory proteins, which were provided by this invention, are very important for the industry since the encoded proteins themselves are expected to be useful as pharmaceutical agents and many disease-related genes may be included in them. In addition, membrane proteins, signal transduction-related proteins, transcription-related proteins, disease-related proteins, and genes encoding them can be used as indicators for diseases, etc. These cDNA are also very important for the industry, which are expected to regulate the activity or expression of the encoded protein to treat diseases, etc.
Any patents, patent applications, and publications cited herein are incorporated by reference.
The invention is illustrated more specifically with reference to the following examples, but is not to be construed as being limited thereto.
EXAMPLE 1 Preparation of cDNA Library by Oligo-Capping(1) Extraction and Purchase of mRNA
Total RNAs as mRNA sources were extracted from human tissues (shown below) by the method as described in the reference (J. Sambrook, E. F. Fritsch & T. Maniatis, Molecular Cloning Second edition, Cold Spring harbor Laboratory Press, 1989). Further, by the method as described in the reference (J. Sambrook, E. F. Fritsch & T. Maniatis, Molecular Cloning Second edition, Cold Spring harbor Laboratory Press, 1989), total RNAs as mRNA sources were extracted from human culture cells and human primary culture cells (shown below) which had been cultivated by the methods described in the catalogs.
The library names and the origins are indicated below in the order of “Library name: Origin”. When a library was prepared by the subtraction method, the item is followed by a description of how to prepare the subtracted library.
<Extraction of mRNA From Human Tissues>
NTONG: Normal tongue;
CTONG: Tongue cancer;
FCBBF: Fetal brain;
OCBBF: Fetal brain;
PLACE: Placenta;
SYNOV: Synovial membrane tissue (from rheumatioid arthritis);
CORDB: Cord blood.
<Extraction of mRNA from Culture Cells>
BNGH4: H4 cells (ATCC #HTB-148);
IMR32: IMR32 cells (ATCC #CCL-127);
SKNMC: SK-N-MC cells (ATCC #HTB-10);
3NB69: NB69 cells (RCB #RCB0480);
BGGI1: GI1 cells (RCB #RCB0763);
NB9N4: NB9 cells (RCB #RCB0477);
SKNSH: SK-N-SH cells (RCB #RCB0426);
AHMSC: Human mesenchymal (HMSC) cells;
CHONS: Chondrocytes;
ERLTF: TF-1 cells (erythroleukemia);
HELAC: HeLa cells;
JCMLC: Leukemia, myelogenous;
MESTC: Mesenchyme stem cells;
N1ESE: Mesenchymal stem cells;
NCRRM: Embryonal carcinoma;
NCRRP: Embryonal carcinoma treated with retinoic acid (RA) to induce the differentiation;
T1ESE: Mesenchymal stem cells treated with trichostatin and 5-azacytidine to induce the differentiation;
NT2RM: NT2 cells (STARATAGENE #204101);
NT2RP: NT2 cells treated with retinoic acid (RA) for 5 weeks to induce the differentiation;
NT2R1: NT2 cells treated with RA for 5 weeks to induce the differentiation, followed by the treatment with the growth inhibitor for 2 weeks;
NT2NE: NT2 cells were treated with RA and the growth inhibitor for the neuronal differentiation, and the resultant neurons were concentrated and harvested (NT2 Neuron);
NTISM: NT2 cells (STARATAGENE #204101) were treated with RA for 5 weeks to induce the differentiation, and then treated with the growth inhibitor for 2 weeks; mRNA was prepared from the cells and a cDNA library was constructed from the mRNA; the cDNAs of the library whose nucleotide sequences were shared by those of mRNAs from undifferentiated NT2 cells were subtracted by using a Subtract Kit (Invitrogen #K4320-01); the subtracted library (NT2R1-NT2RM) was provided by this procedure.
RCB indicates that the cell was provided by the Cell Bank, RIKEN GENE BANK, The Institute of Physical and Chemical Research; ATCC indicates that the cell was provided by American Type Culture Collection.
<Extraction of mRNA from Primary Culture Cells>
ASTRO: Normal human astrocyte NHA5732, Takara Shuzo #CC2565;
DFNES: Normal human dermal fibroblast (neonatal skin); NHDF-Neo
NHDF2564, Takara Shuzo #CC2509;
MESAN: Normal human mesangial cell NHMC56046-2, Takara Shuzo #CC2559;
NHNPC: Normal human neural progenitor cell NHNP5958, Takara Shuzo #CC2599;
PEBLM: Normal human peripheral blood mononuclear cell HPBMC5939, Takara Shuzo #CC2702;
HSYRA: Human synoviocyte HS-RA (from rheumatioid arthritis), Toyobo #T404K-05;
PUAEN: Normal human pulmonary artery endothelial cells, Toyobo #T302K-05;
UMVEN: Normal human umbilical vein endothelial cell HUVEC, Toyobo #T200K-05;
HCASM: Normal human coronary artery smooth muscle cell HCASMC, Toyobo #T305K-05;
HCHON: Normal human chondrocyte HC, Toyobo #T402K-05;
HHDPC: Normal human dermal papilla cell HDPC, Toyobo #THPCK-001;
CD34C: CD34+ cells (AllCells, LLC #CB14435M);
D3OST: CD34+ cells treated with the osteoclast differentiation factor (ODF) for 3 days to induce the differentiation;
D6OST: CD34+ cells treated with ODF for 6 days to induce the differentiation;
D9OST: CD34+ cells treated with ODF for 9 days to induce the differentiation;
ACTVT: Activated T-cells;
LYMPB: Lymphoblasts, EB virus transferred B cells;
NETRP: Neutrophils.
Then, total RNAs extracted from the following human tissues were purchased and used as mRNA sources. The library names and the origins are indicated below in the order of “Library name: Origin”. When a library was prepared by the subtraction method, the item is followed by a description of how to prepare the subtracted library.
<Purchase of Total RNA Containing mRNA Extracted From Human Tissues>
ADRGL: Adrenal gland, CLONTECH #64016-1;
BRACE: Brain (cerebellum), CLONTECH #64035-1;
BRAWH: Whole brain, CLONTECH #64020-1;
FEBRA: Fetal brain, CLONTECH #64019-1;
FELIV: Fetal liver, CLONTECH #64018-1;
HEART: Heart, CLONTECH #64025-1;
HLUNG: Lung, CLONTECH #64023-1;
KIDNE: Kidney, CLONTECH #64030-1;
LIVER: Liver, CLONTECH #64022-1;
MAMGL: Mammary Gland, CLONTECH #64037-1;
PANCR: Pancreas, CLONTECH #64031-1;
PROST: Prostate, CLONTECH #64038-1;
SALGL: Salivary Gland, CLONTECH #64026-1;
SKMUS: Skeletal Muscle, CLONTECH #64033-1;
SMINT: Small Intestine, CLONTECH #64039-1;
SPLEN: Spleen, CLONTECH #64034-1;
STOMA: Stomach, CLONTECH #64090-1;
TBAES: Breast (Tumor), CLONTECH #64015-1;
TCERX: Cervix (Tumor), CLONTECH #64010-1;
TCOLN: Colon (Tumor), CLONTECH #64014-1;
TESTI: Testis, CLONTECH #64027-1;
THYMU: Thymus, CLONTECH #64028-1;
TLUNG: Lung (Tumor), CLONTECH #64013-1;
TOVAR: Ovary (Tumor), CLONTECH #64011-1;
TRACH: Trachea, CLONTECH #64091-1;
TUTER: Uterus (Tumor), CLONTECH #64008-1;
UTERU: Uterus, CLONTECH #64029-1;
ADIPS: Adipose, Invitrogen #D6005-01;
BLADE: Bladder, Invitrogen #D6020-01;
BRALZ: Cerebral cortex from an Alzheimer patient (Brain, cortex, Alzheimer), Invitrogen #D6830-01;
CERVX: Cervix, Invitrogen #D6047-01;
COLON: Colon, Invitrogen #D6050-0;
NESOP: Esophagus, Invitrogen #D6060-01;
PERIC: Pericardium, Invitrogen #D6105-01;
RECTM: Rectum, Invitrogen #D6110-01;
TESOP: Esophageal (Tumor), Invitrogen #D6860-01;
TKIDN: Kidney (Tumor), Invitrogen #D6870-01;
TLIVE: Liver (Tumor), Invitrogen #D6880-01;
TSTOM: Stomach (Tumor), Invitrogen #D6920-01;
BEAST: Adult breast, STARATAGENE #735044;
FEHRT: Fetal heart, STARATAGENE #738012;
FEKID: Fetal kidney, STARATAGENE #738014;
FELNG: Fetal lung, STARATAGENE #738020;
NOVAR: Adult ovary, STARATAGENE #735260;
BRASW: subtracted library (BRALZ-BRAWH). A cDNA library was constructed from mRNA prepared from tissues of cerebral cortex obtained from an Alzheimer patient [BRALZ: Cerebral cortex from an Alzheimer patient (Brain, cortex, Alzheimer), Invitrogen #D6830-01]; the cDNAs of this library whose nucleotide sequences were shared by those of mRNAs from whole brain tissue [BRAWH: Whole brain, CLONTECH #64020-1] were subtracted by using a Subtract Kit (Invitrogen #K4320-01).
Further, mRNAs extracted and purified as poly A(+) RNAs from the human tissues shown below were purchased. A cDNA library was prepared from an RNA mixture in which the poly A(+) RNA from each tissue had been combined with poly A(−) RNA. The poly A(−) RNA was prepared by removing poly A(+) RNA from the total RNA of whole brain tissue (CLONTECH #64020-1) by using oligo dT cellulose. The library names and the origins are indicated below in the order of “Library name: Origin”.
<Purchase of mRNAs of Human Tissues as Poly A(+) RNAs>
BRAMY: Brain (amygdala), CLONTECH #6574-1;
BRCAN: Brain (caudate nucleus), CLONTECH #6575-1;
BRCOC: Brain (corpus callosum), CLONTECH #6577-1;
BRHIP: Brain (hippocampus), CLONTECH #6578-1;
BRSSN: Brain (substantia nigra), CLONTECH #6580-1;
BRSTN: Brain (subthalamic nucleus), CLONTECH #6581-1;
BRTHA: Brain (thalamus), CLONTECH #6582-1.
(2) Preparation of cDNA Library
cDNA library was prepared from each RNA by the improved method (WO 01/04286) of oligo capping [M. Maruyama and S. Sugano, Gene, 138: 171-174 (1994)]. A series of procedures, BAP (Bacterial Alkaline Phosphatase) treatment, TAP (Tobacco Acid Pyrophosphatase) treatment, RNA ligation, first strand cDNA synthesis and RNA removal, were carried out using the oligo-cap linker (SEQ ID NO: 5455) and oligo dT primer (SEQ ID NO: 5456), as described in WO 01/04286. Then, the single-stranded cDNA was converted to a double-stranded cDNA by PCR (polymerase chain reaction) using 5′ (SEQ ID NO: 5457) and 3′ (SEQ ID NO: 5458) PCR primers, and then digested with SfiI. Then, a fraction of cDNA fragments, typically 2-kb or longer (3-kb or longer in some cases), was unidirectionally cloned into a DraIII-digested pME18SFL3 vector (FIG. 1) (GenBank AB009864, Expression vector); the cDNA library was thus prepared.
The names of cDNA libraries, which were used in the analysis of full-length cDNA sequences, and their origins are shown in Table 2.
| TABLE 2 | ||
| Library | Type | Origin, etc. |
| 3NB69 | Culture cell | NB69 cells (RCB #RCB0480) |
| ADIPS | Tissue | Adipose (Invitrogen #D6005-01) |
| ADRGL | Tissue | Adrenal gland (CLONTECH #64016-1) |
| ASTRO | Primary culture cell | Normal Human Astrocyte NHA5732 (Takara Shuzo |
| #CC2565) | ||
| BEAST | Tissue | Adult Breast (STARATAGENE #735044) |
| BGGI1 | Culture cell | GI1 cells (RCB #RCB0763) |
| BLADE | Tissue | Bladder (Invitrogen #D6020-01) |
| BNGH4 | Culture cell | H4 cells (ATCC #HTB-148) |
| BRACE | Tissue | Brain, cerebellum (CLONTECH #64035-1) |
| BRALZ | Tissue | Brain, cortex, Alzheimer (Invitrogen #D6830-01) |
| BRAMY | Tissue | Brain, amygdala (CLONTECH #6574-1) |
| BRAWH | Tissue | Brain, whole (CLONTECH #64020-1) |
| BRCAN | Tissue | Brain, caudate nucleus (CLONTECH #6575-1) |
| BRCOC | Tissue | Brain, corpus callosum (CLONTECH #6577-1) |
| BRHIP | Tissue | Brain, hippocampus (CLONTECH #6578-1) |
| BRSSN | Tissue | Brain, substantia nigra (CLONTECH #6580-1) |
| BRSTN | Tissue | Brain, subthalamic nucleus (CLONTECH #6581-1) |
| BRTHA | Tissue | Brain, thalamus (CLONTECH #6582-1) |
| CD34C | Primary culture cell | CD34+ cells (AllCells, LLC #CB14435M) |
| COLON | Tissue | Colon (Invitrogen #D6050-0) |
| CTONG | Tissue | Tongue, Cancer |
| D3OST | Primary culture cell | CD34+ cells (ODF induction for 3 days) |
| D6OST | Primary culture cell | CD34+ cells (ODF induction for 6 days) |
| D9OST | Primary culture cell | CD34+ cells (ODF induction for 9 days) |
| DFNES | Primary culture cell | Normal Human Dermal Fibroblasts (Neonatal Skin); |
| NHDF-Neo NHDF2564 (Takara Shuzo #CC2509) | ||
| FCBBF | Tissue | Brain, Fetal |
| FEBRA | Tissue | Brain, Fetal (CLONTECH #64019-1) |
| FEHRT | Tissue | Heart, Fetal (STARATAGENE #738012) |
| FELNG | Tissue | Lung, Fetal (STARATAGENE #738020) |
| HCASM | Primary culture cell | Human coronary artery smooth muscle cells HCASMC |
| (Toyobo #T305K-05) | ||
| HCHON | Primary culture cell | Human Chondrocytes HC (Toyobo #T402K-05) |
| HEART | Tissue | Heart (CLONTECH #64025-1) |
| HHDPC | Primary culture cell | Human dermal papilla cells HDPC (Toyobo #THPCK- |
| 001) | ||
| HLUNG | Tissue | Lung (CLONTECH #64023-1) |
| IMR32 | Culture cell | IMR32 cells (ATCC #CCL-127) |
| KIDNE | Tissue | Kidney (CLONTECH #64030-1) |
| LIVER | Tissue | Liver (CLONTECH #64022-1) |
| MAMGL | Tissue | Mammary Gland (CLONTECH #64037-1) |
| MESAN | Primary culture cell | Normal human mesangial cells NHMC56046-2 (Takara |
| Shuzo #CC2559) | ||
| NESOP | Tissue | Esophagus (Invitrogen #D6060-01) |
| NOVAR | Tissue | Adult Ovary (STARATAGENE #735260) |
| NT2NE | Culture cell | NT2 cells concentrated after differenciation (NT2 |
| Neuron) | ||
| NT2RI | Culture cell | NT2 cells treated by growth inhibitor for 2 weeks after |
| RA induction for 5 weeks | ||
| NT2RP | Culture cell | NT2 cells treated by RA for 5 weeks |
| NTONG | Tissue | Tongue |
| OCBBF | Tissue | Brain, Fetal |
| PANCR | Tissue | Pancreas (CLONTECH #64031-1) |
| PEBLM | Primary culture cell | Human peripheral blood mononuclear cells HPBMC5939 |
| (Takara Shuzo #CC2702) | ||
| PERIC | Tissue | Pericardium (Invitrogen #D6105-01) |
| PLACE | Tissue | Placenta |
| PROST | Tissue | Prostate (CLONTECH #64038-1) |
| PUAEN | Primary culture cell | Human pulmonary artery endothelial cells (Toyobo |
| #T302K-05) | ||
| RECTM | Tissue | Rectum (Invitrogen #D6110-01) |
| SALGL | Tissue | Salivary Gland (CLONTECH #64026-1) |
| SKMUS | Tissue | Skeletal Muscle (CLONTECH #64033-1) |
| SKNMC | Culture cell | SK-N-MC cells (ATCC #HTB-10) |
| SKNSH | Culture cell | SK-N-SH cells (RCB #RCB0426) |
| SMINT | Tissue | Small Intestine (CLONTECH #64039-1) |
| SPLEN | Tissue | Spleen (CLONTECH #64034-1) |
| STOMA | Tissue | Stomach (CLONTECH #64090-1) |
| SYNOV | Tissue | Synovial membrane tissue from rheumatioid arthritis |
| TBAES | Tissue | Breast, Tumor (CLONTECH #64015-1) |
| TCOLN | Tissue | Colon, Tumor (CLONTECH #64014-1) |
| TESOP | Tissue | Esophageal, Tumor (Invitrogen #D6860-01) |
| TESTI | Tissue | Testis (CLONTECH #64027-1) |
| THYMU | Tissue | Thymus (CLONTECH #64028-1) |
| TKIDN | Tissue | Kidney, Tumor (Invitrogen #D6870-01) |
| TOVAR | Tissue | Ovary, Tumor (CLONTECH #64011-1) |
| TRACH | Tissue | Trachea (CLONTECH #64091-1) |
| TSTOM | Tissue | Stomach, Tumor (Invitrogen #D6920-01) |
| TUTER | Tissue | Uterus, Tumor (CLONTECH #64008-1) |
| UMVEN | Primary culture cell | Human umbilical vein endothelial cells HUVEC (Toyobo |
| #T200K-05) | ||
| UTERU | Tissue | Uterus (CLONTECH #64029-1) |
The cDNA library with the high fullness ratio (the fullness ratio of 5′-end, which was calculated for each cDNA library by using the protein coding region found in known mRNA species as an index, was 90% in average) prepared by the improved oligo-capping method was constructed by using a eukaryotic expression vector pME18SFL3. The vector contains SR α promoter and SV40 small t intron in the upstream of the cloning site, and SV40 polyA added signal sequence site in the downstream. As the cloning site of pME18SFL3 has asymmetrical DraIII sites, and the ends of cDNA fragments contain SfiI sites complementary to the DraIII sites, the cloned cDNA fragments can be inserted into the downstream of the SR α promoter unidirectionally. Therefore, clones containing full-length cDNA can be expressed transiently by introducing the obtained plasmid directly into COS cells, etc. Thus, the clones can be analyzed very easily in terms of the proteins that are the gene products of the clones, or in terms of the biological activities of the proteins.
(3) Assessment of the 5′-end Completeness of Clones Derived from the cDNA Library Prepared by Oligo-Capping
With respect to the plasmid DNAs of clones derived from the libraries, the nucleotide sequences of cDNA 5′-ends (3′-ends as well in some cases) were determined in a DNA sequencer (ABI PRISM 3700, PE Biosystems), after sequencing reaction was conducted by using a DNA sequencing reagent (BigDye Terminator Cycle Sequencing FS Ready Reaction Kit, PE Biosystems) according to the manual. A database was constructed based on the obtained data.
The 5′-end completeness of about 1110,000 clones derived from the human cDNA libraries prepared by the improved oligo-capping method was determined by the following method. The clones whose 5′-end sequences were consistent with those of known human mRNA in the public database were judged to be “full-length” if they had a longer 5′-end sequence than that of the known human mRNA; or even though the 5′-end sequence was shorter, if it contained the translation initiation codon it was judged to have the “full-length” sequence. Clones which did not contain the translation initiation codon were judged to be “not-full-length”. The fullness ratio ((the number of full-length clones)/(the number of full-length and not-full-length clones)) at the 5′-end of the cDNA clones was determined by comparing with known human mRNA. As a result, the fullness ratio of the 5′-ends was 90%. The result indicates that the fullness ratio at the 5′-end sequence was extremely high in the human cDNA clones obtained by the oligo-capping method.
EXAMPLE 2 Sequencing Analysis of cDNA Ends and Selection of Full-Length ClonesWith respect to the plasmid DNAs of clones obtained from each cDNA library, the 5′-end nucleotide sequences of the cDNAs were determined in a DNA sequencer (ABI PRISM 3700, PE Biosystems), after sequencing reaction was conducted by using a DNA sequencing reagent (Dye Terminator Cycle Sequencing FS Ready Reaction Kit, dRhodamine Terminator Cycle Sequencing FS Ready Reaction Kit or BigDye Terminator Cycle Sequencing FS Ready Reaction Kit, PE Biosystems) according to the manual. A database was constructed using the data obtained.
For the analyzed 5′-end sequences of cDNA clones, the data with the annotation of “complete cds” in the GenBank and UniGene were searched by BLAST homology search. When identical to certain human mRNA sequences, such cDNA clones were excluded. Then, clustering was carried out. When the identity was 90% or higher, and the length of consensus sequence was 50 base pairs or longer, the cDNA clones were assumed to belong to an identical cluster, and thus clustered. cDNA clones longer in the 5′ direction were selected from the members belonging to a cluster; if required, the 3′-end sequences of the selected clones were determined by the same analysis method as used to determine the 5′-end sequences. The data of the end sequences obtained were analyzed, and then the clones forming a sequence contig at 5′- and 3′-ends were excluded. Further, as mentioned above, the data was analyzed again by BLAST homology search; when identical to certain human mRNA sequences (including sequences patented and applied for), the cDNA clones were excluded. Thus, the cDNAs clones to be analyzed for their nucleotide sequence were obtained.
EXAMPLE 3 Analysis of the Full-Length Nucleotide SequencesThe full-length nucleotide sequences of the selected clones were determined. The nucleotide sequence determination was mainly performed by primer walking method comprising the dideoxy terminator method using custom-made synthetic DNA primers. Namely, the nucleotide sequences of the DNAs were determined in a sequencer from PE Biosystems, after sequencing reaction was carried out with a DNA sequencing reagent from the same supplier using the custom-made synthetic DNA primers according to the manual. A part of the clones were analyzed with a DNA sequencer from Licor.
Further, the nucleotide sequences of a part of the clones were determined by the shotgun method where the plasmids containing the cDNAs were digested at random were used, instead of the use of custom-made primers, by the same method in the DNA sequencer. The full-length nucleotide sequences were finally determined by completely assembling the partial nucleotide sequences obtained by the above method.
Then, the regions translatable to proteins were deduced from the determined full-length nucleotide sequences, and thereby the amino acid sequences were determined. SEQ ID NOs corresponding to the respective sequences are shown in Table 1.
EXAMPLE 4 Functional Prediction by Homology SearchFor the determined nucleotide sequences, GenBank, SwissProt, UniGene, and nr were searched by BLAST. The clones exhibiting higher homology, which were convenient to predict their functions based on the nucleotide sequences and deduced amino acid sequences, were selected based on the BLAST search hit data whose P value or E value was 10−4 or lower and for which the length of consensus sequence×homology=30 or higher in the amino acid database search. Further, from them, representative clones were selected, which are shown as Homology Search Result Data in the last part herein. Accordingly, the data shown herein are merely the representative data, and the molecule exhibiting homology to each clone is not limited thereto. Further, with respect to a part of clones, the BLAST search hit data that did not meet the criteria as described above are not shown herein.
EXAMPLE 5 Search for Signal Sequence, Transmembrane Domain and Other Functional Domains in the Deduced Amino Acid SequencesWith respect to the amino acid sequences deduced from the full-length nucleotide sequences, the prediction was made for the presence of signal sequence at the amino terminus, the presence of transmembrane domain, and the presence of functional protein domains (motifs). The signal sequence at the amino terminus was searched for by PSORT [K. Nakai & M. Kanehisa, Genomics, 14: 897-911 (1992)]; the transmembrane domain, by SOSUI [T. Hirokawa et al., Bioinformatics, 14: 378-379 (1998)] (Mitsui Knowledge Industry); the function domain, by Pfam (http://www.sanger.ac.uk/Software/Pfam/index.shtml). The amino acid sequence in which the signal sequence at the amino terminus or transmembrane domain had been predicted to be present by PSORT or SOSUI were assumed to be a secretory or membrane protein. Further, when the amino acid sequence hit a certain functional domain by the Pfam functional domain search, the protein function can be predicted based on the hit data, for example, by referring to the function categories on the PROSITE (http://www.expasy.ch/cgi-bin/prosite-list.pl). In addition, the functional domain search can also be carried out on the PROSITE.
The search results obtained with the respective programs are shown below.
The clones whose deduced amino acid sequences were detected to have the signal sequences by PSORT are as follows.
ADRGL20013520, ASTRO20005330, ASTRO20055750, BNGH420088500, BRACE20038000, BRACE20081720, BRACE20101710, BRACE20224480, BRACE20257100, BRACE20273890, BRALZ20013500, BRALZ20054710, BRALZ20077930, BRAMY20063970, BRAMY20284910, BRAWH20016860, BRAWH20064050, BRCOC10000870, BRCOC20078640, BRCOC20090520, BRCOC20101230, BRCOC20114180, BRCOC20121720, BRCOC20134480, BRCOC20136750, BRHIP20179200, BRHIP20198190, BRHIP20217620, BRSSN20003120, BRSSN20137020, COLON10001350, COLON20093370, CTONG20158660, CTONG20267700, D3OST20036070, D3OST20038560, D6OST20005070, FCBBF10001210, FCBBF10002430, FCBBF10003760, FCBBF10005740, FCBBF20042560, FCBBF30086440, FCBBF30095260, FCBBF30172550, FCBBF30238870, FEBRA20009090, FEBRA20029860, FEBRA20086620, FEBRA20092890, FEBRA20111460, FEBRA20130190, FEBRA20145780, FEBRA20235500, HCHON20064590, HCHON20067700, HCHON20086720, HEART20049410, HHDPC20001040, HHDPC20014320, KIDNE20011400, KIDNE20022620, KIDNE20126130, KIDNE20127450, LIVER20064690, MESAN10001260, MESAN20038510, MESAN20115970, MESAN20152770, MESAN20153910, NT2NE20118960, NT2NE20124480, NT2NE20183760, NT2RI20003480, NT2RI20023910, NT2RI20028470, NT2RI20040930, NT2RP70134990, NTONG20029700, NTONG20063010, OCBBF20019830, OCBBF20078920, OCBBF20086400, OCBBF20087010, OCBBF20116850, OCBBF20122620, OCBBF20130910, OCBBF20188730, PEBLM20075980, PLACE60086400, PROST20175290, SKNSH20028660, SMINT20009840, SMINT20022020, SMINT20073650, SMINT20095050, SMINT20105330, SMINT20127930, SMINT20153260, SMINT20157450, SMINT20173240, SMINT20178550, SMINT20191420, SMINT20192000, SPLEN20079510, SPLEN20095810, SPLEN20118300, SPLEN20141360, SPLEN20157880, SPLEN20171890, SPLEN20213830, STOMA20005390, STOMA20056640, STOMA20080500, STOMA20088380, SYNOV20001520, SYNOV20001730, SYNOV20002790, SYNOV20002970, SYNOV20004260, SYNOV20007000, SYNOV20008240, SYNOV20009230, SYNOV20010880, SYNOV20011110, SYNOV20013000, TESOP20005690, TESTI20123560, TESTI20208400, TESTI20211220, TESTI20272960, TESTI20309170, TESTI20316870, TESTI20385960, TESTI20390260, TESTI20391770, TESTI20396130, TESTI20415170, TESTI20421490, TESTI20441940, TESTI20444180, TESTI20463580, THYMU10005360, THYMU20027560, THYMU20032870, THYMU20039810, THYMU20066100, THYMU20106710, THYMU20111830, THYMU20161640, THYMU20162190, THYMU20194420, THYMU20222890, THYMU20241850, TKIDN20005210, TRACH20029540, TRACH20034840, TRACH20050040, TRACH20069180, TRACH20085400, TRACH20136710, TRACH20145440, TRACH20180840, UTERU20158300, UTERU20158800, UTERU20161570
The clones whose deduced amino acid sequences were detected to have the transmembrane domains by SOSUI are as follows. Numerals indicate the numbers of transmembrane domains detected in the deduced amino acid sequences. Of the search result, the clone name and the number of transmembrane domains are demarcated by a double slash mark (//).
ADIPS10000640//3, ADRGL20018540//1, ADRGL20035850//2, ASTRO20001410//1, ASTRO20005330//3, ASTRO20058630//4, ASTRO20190390//1, BEAST20004540//1, BGGI110000240//2, BRACE20006400//1, BRACE20038470//1, BRACE20039040//1, BRACE20039540//1, BRACE20051380//1, BRACE20059370//1, BRACE20061050//1, BRACE20063630//2, BRACE20067430//1, BRACE20069090//2, BRACE20101700//2,
BRACE20116110//2, BRACE20147800//1, BRACE20153680//5, BRACE20163350//1, BRACE20179340//6, BRACE20188470//4, BRACE20195100//1, BRACE20201570//1, BRACE20210140//1, BRACE20224480//1, BRACE20224500//1, BRACE20228480//1, BRACE20232840//1, BRACE20238000//2, BRACE20274080//1, BRALZ20013500//2, BRALZ20064740//1, BRALZ20069760//3, BRALZ20073760//3, BRAMY20000860//2,
BRAMY20002770//2, BRAMY20025840//1, BRAMY20039260//3, BRAMY20060920//1, BRAMY20063970//3, BRAMY20111960//1, BRAMY20112800//2, BRAMY20134140//2, BRAMY20135900//1, BRAMY20136210//1, BRAMY20144620//3, BRAMY20152110//1, BRAMY20174550//4, BRAMY20181220//2, BRAMY20195090//1, BRAMY20211390//1, BRAMY20211420//10, BRAMY20215230//1, BRAMY20218250//10, BRAMY20218670//3,
BRAMY20229800//1, BRAMY20231720//1, BRAMY20247280//1, BRAMY20252180//2, BRAMY20273960//1, BRAMY20277170//5, BRAWH20015350//1, BRAWH20015890//2, BRAWH20016860//3, BRAWH20018730//10, BRAWH20030250//4, BRAWH20110790//3, BRAWH20121640//11, BRAWH20122580//2, BRAWH20132190//2, BRCAN20064010//2, BRCAN20071190//1, BRCAN20091560//1, BRCAN20103740//1, BRCAN20224720//1,
BRCAN20273550//5, BRCAN20280360//6, BRCAN20285450//2, BRCOC20004040//4, BRCOC20006370//2, BRCOC20041750//1, BRCOC20077690//2, BRCOC20090520//1, BRCOC20091960//2, BRCOC20101230//6, BRCOC20107300//1, BRCOC20114180//3, BRCOC20121720//7, BRCOC20134480//3, BRCOC20136750//2, BRHIP20000870//2, BRHIP20003120//3, BRHIP20111200//1, BRHIP20118380//1, BRHIP20118910//2,
BRHIP20121410//3, BRHIP20135100//1, BRHIP20183690//9, BRHIP20191490//2, BRHIP20191770//1, BRHIP20207430//1, BRHIP20208270//1, BRHIP20208590//2, BRHIP20217620//1, BRHIP20233090//1, BRHIP20234380//1, BRHIP20238880//1, BRHIP20283030//1, BRSSN20003120//7, BRSSN20043040//2, BRSSN20066110//2, BRSSN20137020//2, BRSSN20142940//1, BRSSN20146100//3, BRSSN20151990//2,
BRSSN20169050//2, BRSTN20002200//1, BRTHA20046290//2, BRTHA20046420//5, CTONG10000100//6, CTONG10000940//1, CTONG10001650//1, CTONG20004690//5, CTONG20092570//7, CTONG20092580//2, CTONG20095340//5, CTONG20099380//2, CTONG20103480//1, CTONG20105080//9, CTONG20114290//2, CTONG20114740//3, CTONG20119200//2, CTONG20120770//1, CTONG20124220//3, CTONG20124730//1,
CTONG20131490//1, CTONG20132220//1, CTONG20133480//2, CTONG20139340//2, CTONG20149950//1, CTONG20155400//1, CTONG20158660//9, CTONG20161850//2, CTONG20267700//1, D3OST10001090//5, D3OST20036070//1, D3OST20038560//1, D3OST30002580//2, D9OST20002780//2, D9OST20015470//2, D9OST20026730//1, D9OST20040180//7, DFNES20025880//1, FCBBF10000240//8, FCBBF10000380//1,
FCBBF10001150//1, FCBBF10001210//2, FCBBF10001550//1, FCBBF10002700//2, FCBBF10003220//1, FCBBF10005460//1, FCBBF20032970//1, FCBBF20042560//3, FCBBF20051220//2, FCBBF30008470//2, FCBBF30012350//1, FCBBF30024750//1, FCBBF30078290//1, FCBBF30086440//3, FCBBF30090690//1, FCBBF30095260//2, FCBBF30123470//3, FCBBF30172550//1, FCBBF30175310//9, FCBBF30190850//1,
FCBBF30215060//4, FCBBF30238870//1, FCBBF30251420//1, FCBBF30279030//5, FEBRA20002100//5, FEBRA20037260//1, FEBRA20080810//5, FEBRA20093520//1, FEBRA20095880//1, FEBRA20111460//1, FEBRA20125070//1, FEBRA20130190//1, FEBRA20140100//3, FEBRA20145780//2, FEBRA20211710//1, FEBRA20229630//3, FEBRA20235500//10, HCHON20000380//2, HCHON20007510//1, HCHON20008180//1,
HCHON20016650//7, HCHON20035130//1, HCHON20040020//1, HCHON20067700//1, HCHON20068710//4, HEART20003060//1, HEART20005410//1, HEART20034320//2, HEART20049800//1, HEART20072310//2, HHDPC10000830//3, HHDPC20001040//1, HHDPC20014320//1, HHDPC20034720//1, HHDPC20068620//1, HHDPC20084140//1, HHDPC20091780//2, HLUNG10000550//2, KIDNE20003940//10, KIDNE20007770//2,
KIDNE20021910//4, KIDNE20022620//1, KIDNE20100070//2, KIDNE20101510//2, KIDNE20109730//2, KIDNE20121880//5, KIDNE20125630//2, KIDNE20126010//1, KIDNE20130450//2, KIDNE20131580//7, KIDNE20137340//4, KIDNE20181660//1, LIVER20035110//1, LIVER20045650//1, LIVER20062510//1, LIVER20075680//1, LIVER20087060//1, LIVER20091180//1, MESAN20014500//6, MESAN20027090//2,
MESAN20038510//1, MESAN20089360//1, MESAN20103120//5, MESAN20115970//4, MESAN20139360//1, MESAN20153910//1, NOVAR20000380//1, NT2NE20010050//1, NT2NE20021620//1, NT2NE20118960//4, NT2NE20131890//1, NT2NE20132170//9, NT2NE20155110//1, NT2NE20156260//1, NT2NE20159740//3, NT2NE20177520//2, NT2RI20023910//2, NT2RI20025400//2, NT2RI20054050//8, NT2RI20076290//8,
NT2RI20086220//4, NT2RI20091940//3, NT2RI20244600//6, NT2RP70072690//1, NT2RP70081610//6, NT2RP70122910//2, NT2RP70125160//3, NT2RP70133740//4, NT2RP70137290//1, NT2RP70179710//1, NT2RP70188020//1, NTONG20028070//1, NTONG20048060//1, NTONG20049910//1, NTONG20051530//1, NTONG20061870//1, NTONG20067830//1, NTONG20092330//2, OCBBF10001750//2, OCBBF20013890//3,
OCBBF20023570//1, OCBBF20026630//1, OCBBF20037440//1, OCBBF20050770//1, OCBBF20059560//2, OCBBF20063320//1, OCBBF20072320//1, OCBBF20080050//2, OCBBF20086400//1, OCBBF20086910//1, OCBBF20088140//1, OCBBF20091150//1, OCBBF20107090//2, OCBBF20116850//2, OCBBF20120390//12, OCBBF20130910//2, OCBBF20132850//3, OCBBF20155060//2, OCBBF20178880//1, OCBBF20180120//10,
OCBBF20180840//1, PANCR10000910//3, PEBLM20024320//2, PEBLM20040150//2, PEBLM20074370//1, PERIC20004220//4, PLACE60121080//1, PLACE60161600//2, PLACE60177140//6, PROST20005050//1, PROST20050670//1, PROST20107820//4, PROST20116600//2, PROST20120160//1, PROST20127800//3, PROST20146010//3, PROST20164440//3, PROST20169800//1, PROST20170980//1, PROST20191640//1,
PUAEN20003740//2, PUAEN20030180//2, SALGL10001710//5, SKMUS20007800//7, SKMUS20011640//3, SKMUS20020840//3, SKMUS20028210//1, SKMUS20028400//1, SKMUS20077400//1, SKNSH20031740//1, SKNSH20051940//1, SKNSH20063040//3, SMINT20011990//1, SMINT20022020//4, SMINT20029760//1, SMINT20040860//7, SMINT20049090//1, SMINT20053870//1, SMINT20095050//2, SMINT20100680//1,
SMINT20105330//1, SMINT20144890//1, SMINT20157450//5, SMINT20173240//3, SMINT20178550//3, SMINT20192000//1, SPLEN20003070//2, SPLEN20008740//4, SPLEN20026950//1, SPLEN20029310//3, SPLEN20095810//1, SPLEN20097330//1, SPLEN20118300//9, SPLEN20141360//1, SPLEN20141990//1, SPLEN20144520//3, SPLEN20152760//2, SPLEN20157880//1, SPLEN20165310//1, SPLEN20167200//1,
SPLEN20169220//2, SPLEN20169720//1, SPLEN20171890//4, SPLEN20172120//2, SPLEN20186430//6, SPLEN20211570//2, SPLEN20211940//3, SPLEN20213830//2, SPLEN20273950//1, SPLEN20292950//7, SPLEN20293800//4, SPLEN20304950//2, SPLEN20329240//1, STOMA20006780//2, STOMA20008880//1, STOMA20051200//1, STOMA20056670//1, STOMA20062130//1, STOMA20077450//2, STOMA20080500//4,
SYNOV20013560//1, SYNOV30001840//4, TBAES20003150//2, TESOP20005690//3, TESTI20001720//3, TESTI20036380//6, TESTI20037560//1, TESTI20082330//1, TESTI20094120//8, TESTI20110280//1, TESTI20123080//1, TESTI20123560//3, TESTI20128350//1, TESTI20136100//2, TESTI20136710//2, TESTI20143390//8, TESTI20148000//1, TESTI20164100//3, TESTI20193360//1, TESTI20209810//1,
TESTI20209990//1, TESTI20214250//2, TESTI20230250//1, TESTI20231940//1, TESTI20237520//2, TESTI20242990//2, TESTI20254220//7, TESTI20254860//1, TESTI20265970//2, TESTI20271850//2, TESTI20272960//8, TESTI20284880//2, TESTI20291310//4, TESTI20291960//5, TESTI20303360//1, TESTI20303420//1, TESTI20307700//2, TESTI20316870//1, TESTI20333000//2, TESTI20347180//6,
TESTI20347300//1, TESTI20355020//1, TESTI20357960//1, TESTI20370810//9, TESTI20373820//1, TESTI20383880//1, TESTI20390410//1, TESTI20391770//3, TESTI20393530//1, TESTI20397760//2, TESTI20401280//1, TESTI20422640//2, TESTI20441940//5, TESTI20444130//1, TESTI20449200//6, TESTI20463520//1, TESTI20463580//1, THYMU20027560//4,
THYMU20032870//1, THYMU20039810//3, THYMU20100410//2, THYMU20106710//1, THYMU20111830//1, THYMU20141670//1, THYMU20147770//1, THYMU20159430//1, THYMU20161640//4, THYMU20162190//2, THYMU20173980//2, THYMU20208300//1, THYMU20216840//2, THYMU20229220//1, THYMU20241850//2, THYMU20277390//7, TRACH20002870//3, TRACH20003590//1, TRACH20016210//1, TRACH20029540//1, TRACH20033230//6, TRACH20042920//6,
TRACH20050040//2, TRACH20068660//6, TRACH20076740//4, TRACH20085400//2, TRACH20085830//1, TRACH20109650//2, TRACH20111130//1, TRACH20128110//5, TRACH20134950//1, TRACH20140820//1, TRACH20145440//1, TRACH20168350//1, UMVEN20000690//1, UTERU20030570//5, UTERU20040610//1, UTERU20055480//2, UTERU20076390//4, UTERU20094350//1, UTERU20135860//2, UTERU20158300//3,
UTERU20158800//2, UTERU20161570//6, UTERU20178100//1, UTERU20186740//1
The Names of clones whose deduced amino acid sequences were detected to have functional domains with Pfam, and the name of hit functional domains are as follows. The search result is indicated as “clone name//functional domain name”. When the clone has multiple hit functional domains, they are listed and demarcated by a double slash mark (//). When the clone has multiple hits of an identical functional domain, each is listed without abridgment.
3NB6910001910//tRNA synthetases class II (A)// tRNA synthetases class II (A)// DHHA1 domain
3NB6920014590//Homeobox domain
ADIPS20004250//Zinc finger, C2H2 type// DNA binding domain with preference for// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type// UvrD/REP helicase// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
ADRGL10001470//Cytochrome P450//Cytochrome P450
ADRGL20011190//Calponin homology (CH) domain// Calponin homology (CH) domain// Pou domain-N-terminal to homeobox domain
ADRGL20018300//TPR Domain// TPR Domain// TPR Domain// TPR Domain// PPR repeat// TPR Domain
ADRGL20035850//Cytochrome P450
ADRGL20048330//PHD-finger// Rabphilin-3A effector domain// C2 domain// C2 domain
ASTRO20008010//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
ASTRO20012490//Eukaryotic initiation factor 1A
ASTRO20027430//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat
ASTRO20033160//Mitochondrial carrier proteins// Mitochondrial carrier proteins// Mitochondrial carrier proteins
ASTRO20055750//Collagen triple helix repeat (20 copies)// Heavy-metal-associated domain
ASTRO20058630//Vacuolar sorting protein 9 (VPS9) domain
ASTRO20064750//Zinc finger, C2H2 type// Nuclear transition protein 2
ASTRO20072210//PDZ domain (Also known as DHR or GLGF).
ASTRO20084250//KH domain// Zinc finger, C3HC4 type (RING finger)
ASTRO20105820//FAD binding domain
ASTRO20106150//Calpain family cysteine protease// Calpain large subunit, domain III
ASTRO20108190//Rap/ran-GAP
ASTRO20125520//DnaJ domain
ASTRO20130500//ThiF family// Repeat in ubiquitin-activating (UBA) pro
ASTRO20143630//KH domain// Bacterial regulatory proteins, crp family
ASTRO20155290//TPR Domain// TPR Domain// TPR Domain
ASTRO20168470//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type
BGGI110001930//UBX domain
BGGI120006160//Fumarylacetoacetate (FAA) hydrolase fam
BLADE20003400//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type
BLADE20003890//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Src homology domain 2//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Src homology domain 2//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
BNGH420088500//SAM domain (Sterile alpha motif)
BRACE20003070//SAM domain (Sterile alpha motif)
BRACE20011070//F-box domain.
BRACE20027620//Dienelactone hydrolase family// Dienelactone hydrolase family
BRACE20038000//ATP synthase, Delta/Epsilon chain// Dual specificity phosphatase, catalytic d
BRACE20039540//Immunoglobulin domain// Adenovirus E3 region protein CR2
BRACE20050900//TPR Domain// TPR Domain// TPR Domain// TPR Domain
BRACE20052160//SAM domain (Sterile alpha motif)
BRACE20053280//PDZ domain (Also known as DHR or GLGF).
BRACE20053480//Ribosomal protein L22p/L17e// Glycosyl hydrolases family 38
BRACE20053630//Plant thionins// Mitochondrial carrier proteins// Mitochondrial carrier proteins
BRACE20057620//Eukaryotic initiation factor 4E
BRACE20058580//L1 (late) protein
BRACE20059370//FERM domain (Band 4.1 family)
BRACE20060550//Ank repeat// Ank repeat// Ank repeat// PEP-utilizing enzymes
BRACE20060720//WD domain, G-beta repeat// WD domain, G-beta repeat
BRACE20060890//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type
BRACE20062640//Alanine racemase// RNB-like proteins
BRACE20063780//NOL1/NOP2/sun family
BRACE20064880//KH domain// KH domain// KH domain
BRACE20068590//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
BRACE20096200//Sir2 family// Sir2 family
BRACE20107530//short chain dehydrogenase
BRACE20115920//Spectrin repeat// Fes/CIP4 homology domain// Interleukin 10
BRACE20148240//Ras family
BRACE20151320//Zinc finger, C3HC4 type (RING finger)
BRACE20153680//Sir2 family// Ion transport protein
BRACE20163350//Immunoglobulin domain// Immunoglobulin domain
BRACE20177200//RanBP1 domain.
BRACE20188470//ABC transporter// Thymidylate kinase
BRACE20190040//Integrase DNA binding domain
BRACE20192440//Translation initiation factor IF-3
BRACE20223330//3′-5′ exonuclease// Adenylylsulfate kinase// Protein of unknown function DUF82.
BRACE20232840//4Fe-4S binding domain// ABC transporter// ABC transporter// ATPases associated with various cellular act
BRACE20240740//Ribosomal protein L36
BRACE20253330//PDZ domain (Also known as DHR or GLGF).
BRACE20269200//Heat-labile enterotoxin alpha chain
BRACE20273890//UBA domain
BRACE20284100//Polysaccharide lyase family 8
BRACE20286360//Alpha adaptin carboxyl-terminal domain
BRALZ20013500//Keratin, high sulfur B2 protein// u-PAR/Ly-6 domain
BRALZ20054710//Zinc finger, C3HC4 type (RING finger)// TRAF-type zinc finger
BRALZ20058880//STAT protein
BRALZ20077930//Ribosomal protein S27a
BRAMY20000520//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)
BRAMY20002770//DB module
BRAMY20025840//Sec7 domain
BRAMY20045240//Flagellar L-ring protein
BRAMY20054880//Pou domain-N-terminal to homeobox domain
BRAMY20103570//DNA binding domain with preference for A/T r
BRAMY20104640//Eukaryotic protein kinase domain// Protein kinase C terminal domain
BRAMY20111960//Ribosomal protein L36
BRAMY20121620//TPR Domain// TPR Domain// TPR Domain// TPR Domain// PPR repeat
BRAMY20124260//ZU5 domain// Death domain
BRAMY20148130//WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// TBC domain
BRAMY20153110//ACT domain// Biopterin-dependent aromatic amino acid hydroxylase
BRAMY20157820//Kinesin motor domain
BRAMY20162510//MAGE family
BRAMY20167060//Collagen triple helix repeat (20 copies)
BRAMY20174550//ABC transporter transmembrane region.// Phosphoribulokinase// Adenylylsulfate kinase// FtsK/SpoIIIE family// ABC transporter
BRAMY20211390//Zinc finger, C3HC4 type (RING finger)
BRAMY20211420//Transient receptor// GGL domain
BRAMY20213100//LIM domain containing proteins// GATA zinc finger// ‘Paired box’ domain
BRAMY20215230//ribonuclease.
BRAMY20217460//EF hand// EF hand// EF hand
BRAMY20218250//Ion transport protein// Sir2 family// Ion transport protein
BRAMY20240040//Nuclear transition protein 2
BRAMY20245300//Fanconi anaemia group C protein// Metallo-beta-lactamase superfamily
BRAMY20248490//Sodium:sulfate symporter transmembrane
BRAMY20260910//Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
BRAMY20270730//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C3HC4 type (RING finger)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
BRAMY20271400//Phorbol esters/diacylglycerol binding dom// PHD-finger
BRAMY20277170//K+ channel tetramerisation domain// NADH-ubiquinone/plastoquinone oxidoreduc// Ion transport protein// Transmembrane region cyclic Nucleotide G
BRAMY20285160//NTR/C345C module
BRAWH20002320//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat
BRAWH20011710//Ank repeat// Ank repeat// Ank repeat// CAP-Gly domain// CAP-Gly domain
BRAWH20012390//EF hand// EF hand// EF hand
BRAWH20016620//Eukaryotic protein kinase domain// EIAV coat protein, gp90
BRAWH20018730//Sugar (and other) transporter
BRAWH20028110//4Fe-4S binding domain// LIM domain containing proteins// LIM domain containing proteins// LIM domain containing proteins// LIM domain containing proteins// Villin headpiece domain
BRAWH20030250//jmjN domain
BRAWH20064050//Sushi domain (SCR repeat)// EGF-like domain// Trypsin Inhibitor like cysteine rich domain// EGF-like domain// Granulins// Granulins// EGF-like domain
BRAWH20075700//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
BRAWH20096780//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
BRAWH20101360//Hexokinase
BRAWH20103290//CRAL/TR10 domain.// Spectrin repeat// Extracellular link domain// RhoGEF domain// PH domain
BRAWH20110960//PCI domain
BRAWH20112940//Similarity to lectin domain of ricin beta-chain, 3 copies.
BRAWH20114000//Glutamate/Leucine/Phenylalanine/Valine dehydrogenase
BRAWH20117950//Carboxylesterases
BRAWH20118230//Transforming growth factor beta like domain
BRAWH20121640//eubacterial secY protein// Transmembrane amino acid transporter protein
BRAWH20132190//Acetyltransferase (GNAT) family
BRAWH20137480//Villin headpiece domain
BRAWH20138660//Adaptor complexes medium subunit family
BRAWH20149340//IQ calmodulin-binding motif// RhoGEF domain
BRAWH20164460//Sigma-54 interaction domain// ATPases associated with various cellular activities (AAA)
BRAWH20171030//Adenylate kinase// NB-ARC domain// ATPases associated with various cellu
BRAWH20185060//Integrase core domain
BRCAN10001490//‘chromo’ (CHRromatin Organization MOdifier)
BRCAN20003460//Thioredoxin
BRCAN20071190//Ubiquitin family// UBX domain
BRCAN20091560//Rieske [2Fe-2S] domain// Phosphoglucose isomerase// FAD binding domain// Pyridine nucleotide-disulphide oxidoreductase// Phytoene dehydrogenase related enzyme
BRCAN20124080//WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat
BRCAN20273550//FATC domain
BRCAN20273640//Formin Homology 2 Domain
BRCAN20280210//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
BRCAN20280360//PAP2 superfamily
BRCOC20001860//FliP family// Glycosyl hydrolase family 47
BRCOC20004040//7 transmembrane receptor (rhodopsin family)// Neurohypophysial hormones, C-terminal Domain
BRCOC20006370//Plexin repeat
BRCOC20008160//Spectrin repeat// Spectrin repeat// Tropomyosins// Spectrin repeat// Adenylate cyclase// Spectrin repeat// FF domain// Spectrin repeat// Spectrin repeat// Spectrin repeat
BRCOC20008500//Vacuolar sorting protein 9 (VPS9) domain// Ras association (RalGDS/AF-6) domain
BRCOC20023230//Reverse transcriptase (RNA-dependent DNA polymerase)
BRCOC20026640//Gag P30 core shell protein
BRCOC20027510//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat
BRCOC20031250//Triosephosphate isomerase
BRCOC20035130//14-3-3 proteins
BRCOC20037320//Apolipoprotein A1/A4/E family
BRCOC20055420//Helix-loop-helix DNA-binding domain// Myristoyl-CoA
BRCOC20074760//Herpesvirus UL25 family// Beige/BEACH domain
BRCOC20110100//Integrase core domain
BRCOC20121720//PHD-finger
BRCOC20144000//Helicases conserved C-terminal domain
BRCOC20178270//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
BRCOC20178560//LIM domain containing proteins// LIM domain containing proteins// LIM domain containing proteins// Ribosomal protein L24e// LIM domain containing proteins
BRHIP10001290//Ribosomal protein S3, C-terminal domai// Similarity to lectin domain of ricin b
BRHIP20001630//Protein of unknown function DUF16
BRHIP20003120//Dehydrins// Reticulon
BRHIP20005530//ThiF family
BRHIP20096850//ICE-like protease (caspase) p20 domain// Aminotransferases class-I
BRHIP20115080//PH domain
BRHIP20118910//Fibronectin type I domain
BRHIP20119330//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
BRHIP20132860//PDZ domain (Also known as DHR or GLGF).
BRHIP20143730//MYND finger
BRHIP20153600//RNA recognition motif. (a.k.a. RRM, RBD, or
BRHIP20174040//GAF domain// GAF domain// Transposase, Mutator family//3′5′-cyclic nucleotide phosphodiesterase
BRHIP20176420//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)
BRHIP20183690//DEAD/DEAH box helicase// Integral membrane protein DUF6// Integral membrane protein DUF7
BRHIP20189980//bZIP transcription factor
BRHIP20191860//Helix-loop-helix DNA-binding domain
BRHIP20207990//Phorbol esters/diacylglycerol binding dom// Zinc finger, C3HC4 type (RING finger)// PHD-finger
BRHIP20222280//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
BRHIP20236950//Outer Capsid protein VP4 (Hemagglutinin)
BRHIP20238600//WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat
BRHIP20238880//wnt family of developmental signaling protei
BRHIP20249110//Hexokinase// Hexokinase
BRHIP20252450//Spectrin repeat// Spectrin repeat// Spectrin repeat// Phosphoenolpyruvate carboxykinase// Spectrin repeat// Spectrin repeat// Spectrin repeat// eRF1-like proteins// Spectrin repeat
BRHIP20253660//SH3 domain
BRHIP20283030//Cadherin domain// Cadherin domain// Cadherin domain// Cadherin domain// Cadherin domain// Cadherin domain// Cadherin domain// Cadherin domain
BRHIP20285830//Intermediate filament proteins
BRHIP30004570//Sushi domain (SCR repeat)// Sushi domain (SCR repeat)// Sushi domain (SCR repeat)// Sushi domain (SCR repeat)
BRHIP30004880//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Fibronectin type III domain// Fibronectin type III domain
BRSSN20003120//7 transmembrane receptor (metabotropic gluta
BRSSN20013420//Histone deacetylase family// Zn-finger in ubiquitin-hydrolases and o
BRSSN20014260//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat
BRSSN20015790//Pyridoxal-dependent decarboxylase
BRSSN20021600//BTB/POZ domain// Kelch motif// Kelch motif// Kelch motif// Kelch motif// Kelch motif// Kelch motif
BRSSN20038200//Guanine nucleotide exchange factor for Ras-like GTPases; N-terminal motif// Initiator RepB protein// RasGEF domain
BRSSN20039370//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type
BRSSN20046790//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type
BRSSN20101100//‘Cold-shock’ DNA-binding domain
BRSSN20105870//ATPases associated with various cellular activities (AAA)
BRSSN20117990//short chain dehydrogenase
BRSSN20120810//Trypsin
BRSSN20146100//Adenylate and Guanylate cyclase catalytic domain// Adenylate and Guanylate cyclase catalytic domain// Zinc finger, C4 type (two domains)// Adenylate and Guanylate cyclase catalytic domain
BRSSN20176820//Wiskott Aldrich syndrome homology region 2
BRSSN20177570//Phosducin
BRSSN20187310//Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat
BRSTN10000830//Kelch motif// Kelch motif// Kelch motif// Kelch motif
BRSTN20005360//TPR Domain// TPR Domain
BRTHA20000570//Reverse transcriptase (RNA-dependent DNA pol
BRTHA20004740//Phosphoglycerate kinases// lactate/malate dehydrogenase// Flavoprotein// short chain dehydrogenase// Zinc-binding dehydrogenases
BRTHA20046290//Transmembrane 4 family CD34C30004240//RhoGAP domain
COLON10001350//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
CTONG10000220//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat
CTONG10000620//Sec7 domain// PH domain// Josephin
CTONG10000930//Armadillo/beta-catenin-like repeats
CTONG10000940//Ank repeat// Ank repeat// Ank repeat
CTONG10002770//Calponin homology (CH) domain// Calponin homology (CH) domain
CTONG20009770//Proteasome/cyclosome repeat// Proteasome/cyclosome repeat// Proteasome/cyclosome repeat// Proteasome/cyclosome repeat// Proteasome/cyclosome repeat// Proteasome/cyclosome repeat//Proteasome/cyclosome repeat
CTONG20014280//WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat
CTONG20027090//Glypican// Leucine Rich Repeat// Leucine Rich Repeat
CTONG20050280//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
CTONG20075860//Ribulose bisphosphate carboxylase, smal
CTONG20076130//Hepatitis C virus non-structural protein NS2
CTONG20085950//SCAN domain// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
CTONG20092570//Integral membrane protein DUF6//Uncharacterized protein family UPF0005
CTONG20092700//BTB/POZ domain
CTONG20093950//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
CTONG20095340//E1-E2 ATPase
CTONG20096750//Disintegrin
CTONG20098440//Acyltransferase
CTONG20099550//GGL domain
CTONG20105080//Integral membrane protein DUF6
CTONG20106520//Pyridoxal-phosphate dependent enzyme
CTONG20114290//Apolipoprotein A1/A4/E family
CTONG20118150//WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat
CTONG20118250//Eukaryotic-type carbonic anhydrase
CTONG20121010//Zinc finger, C2H2 type// CONSTANS family zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
CTONG20121580//Kinesin motor domain// FHA domain// Histidine carboxylase PI chain
CTONG20124010//WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat
CTONG20125640//Ribosomal protein L10//60s Acidic ribosomal protein
CTONG20128430//Beta/Gamma crystallin// Beta/Gamma crystallin// Beta/Gamma crystallin// Beta/Gamma crystallin// Beta/Gamma crystallin// Similarity to lectin domain of ricin b
CTONG20129960//F-box domain.// UvrD/REP helicase// UvrD/REP helicase// Viral (Superfamily 1) RNA helicase
CTONG20131560//PDZ domain (Also known as DHR or GLGF).
CTONG20133390//Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C3HC4 type (RING finger)// Zinc finger, C2H2 type// Zinc finger, C2H2 type
CTONG20133520//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
CTONG20139860//Ank repeat// Ank repeat// Ank repeat
CTONG20140580//Domain of unknown function DUF25//SNF2 and others N-terminal domain// SNF2 and others N-terminal domain// Small cytokines (intecrine/chemokine), inter
CTONG20143690//MYND finger
CTONG20146300//Reverse transcriptase (RNA-dependent DNA pol
CTONG20149460//BTB/POZ domain// Kelch motif// Kelch motif// Kelch motif// Domain of unknown function// Kelch motif// Kelch motif// Kelch motif
CTONG20153300//C. elegans Srg family integral membrane prote// TBC domain
CTONG20153580//F-box domain.// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat
CTONG20155180//RNA helicase
CTONG20156780//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)
CTONG20158040//UTP-glucose-1-phosphate uridylyltransferase
CTONG20158660//Latrophilin/CL-1-like GPS domain//7 transmembrane receptor (Secretin family)
CTONG20159530//Glypican
CTONG20160560//DNA binding domain with preference for A/T rich regions
CTONG20161850//Immunoglobulin domain
CTONG20165050//Keratin, high sulfur B2 protein
CTONG20186320//Kelch motif// Kelch motif// Kelch motif// Kelch motif
CTONG20200310//RNB-like proteins
D3OST20006180//Dual specificity phosphatase, catalytic domain
D3OST20036070//Leucine Rich Repeat
D9OST20023970//Glycosyl hydrolases family 18//Glycosyl-hydrolases family 18
D9OST20026730//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat
D9OST20033970//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Putative zinc finger in N-recognin// Zinc finger, C2H2 type// Zinc finger, C2H2 type
D9OST20035940//Mitochondrial carrier proteins// Mitochondrial carrier proteins
D9OST20040180//7 transmembrane receptor (rhodopsin family)
DFNES20037420//Elongation factor Tu family
DFNES20071130//Phosphotriesterase family// Phosphotriesterase family// Phosphotriesterase family
FCBBF10000240//Phosphoenolpyruvate carboxylase// Bacterial Cytochrome Ubiquinol Oxidas// Glycosyl transferase
FCBBF10000630//Molluscan rhodopsin C-terminal tail// WW domain
FCBBF10001150//Cadherin domain// Cadherin domain// Cadherin domain// Cadherin domain// Cadherin domain
FCBBF10001210//Immunoglobulin domain// Immunoglobulin domain
FCBBF10001550//Glutamate/Leucine/Phenylalanine/Valine dehydrogenase
FCBBF10001710//DM DNA binding domain// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
FCBBF10002800//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
FCBBF10003670//Ubiquitin carboxyl-terminal hydrolases famil
FCBBF10003770//PDZ domain (Also known as DHR or GLGF).// PDZ domain (Also known as DHR or GLGF).// pf kB family carbohydrate kinase// PDZ domain (Also known as DHR or GLGF).// ThiC family// PDZ domain (Also known as DHR or GLGF).// PDZ domain (Also known as DHR or GLGF).// PDZ domain (Also known as DHR or GLGF).// TIR domain
FCBBF10004120//RNA recognition motif. (a.k.a. RRM, RBD, or
FCBBF10004370//KRAB box// Zinc finger, C2H2 type// Ribosomal protein L37e// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
FCBBF10005060//CRAL/TRIO domain.
FCBBF10005460//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Fibronectin type III domain// Fibronectin type III domain
FCBBF10005500//Keratin, high sulfur B2 protein
FCBBF10005740//Mitochondrial carrier proteins// Mitochondrial carrier proteins
FCBBF20014270//Acyl CoA binding protein
FCBBF20042170//Fibrillar collagen C-terminal domain
FCBBF20049300//Olfactomedin-like domain
FCBBF20059090//Zinc finger, C2H2 type
FCBBF20064520//RNA recognition motif. (a.k.a. RRM, RBD, or
FCBBF20067810//Nerve growth factor family// GTP1/OBG family// GTP1/OBG family// GTPase of unknown function// ADP-ribosylation factor family// Ras family
FCBBF20068820//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
FCBBF30010810//KRAB box// Rieske [2Fe-2S] domain// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
FCBBF30012350//Eukaryotic protein kinase domain
FCBBF30012810//Ubiquitin carboxyl-terminal hydrolases famil
FCBBF30015940//Methyl-accepting chemotaxis protein (MCP) signaling domain
FCBBF30016320//SecA protein, amino terminal region
FCBBF30018550//Oxysterol-binding protein
FCBBF30025560//Prolyl oligopeptidase family// Pou domain-N-terminal to homeobox doma// Homeobox domain
FCBBF30033050//Sm protein
FCBBF30039020//Herpesvirus UL6 like// Growth-Arrest-Specific Protein 2 Domain
FCBBF30049550//Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Glutamine amidotransferases class-II// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// ZU5 domain
FCBBF30054440//PLAT/LH2 domain
FCBBF30057290//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
FCBBF30078290//DNA binding domain with preference for A/T r
FCBBF30086440//Pilin (bacterial filament)
FCBBF30090690//Leucine rich repeat N-terminal domain// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine rich repeat C-terminal domain
FCBBF30095260//DHHC zinc finger domain
FCBBF30129630//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
FCBBF30175310//C1q domain// CDP-alcohol phosphatidyltransferase
FCBBF30190850//Sushi domain (SCR repeat)// Sushi domain (SCR repeat)// Sushi domain (SCR repeat)// Keratin, high sulfur B2 protein// Sushi domain (SCR repeat)// Phosphate transporter family
FCBBF30195640//PHD-finger// CONSTANS family zinc finger// PHD-finger// PHD-finger// Hsp20/alpha crystallin family
FCBBF30225660//Ank repeat// Ank repeat// Ank repeat// K+ channel tetramerisation domain// BTB/POZ domain
FCBBF30233680//G10 protein
FCBBF30238870//Laminin G domain// Thrombospondin N-terminal-like domains// Laminin G domain// von Willebrand factor type C domain// von Willebrand factor type C domain// EGF-like domain// EB module// EGF-like domain// EGF-like domain// Trypsin Inhibitor like cysteine rich domain// Metallothionein// EGF-like domain// EGF-like domain// EGF-like domain
FCBBF30240960//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
FCBBF30246630//Leucine Rich Repeat// Leucine Rich Repeat
FCBBF30247930//Uncharacterized protein family UPF0004
FCBBF30262510//Ank repeat// Fibronectin type III domain
FCBBF30281880//Regulator of G protein signaling domain// PX domain
FCBBF30285280//Keratin, high sulfur B2 protein// Bacterial regulatory proteins, gntR family
FCBBF40001730//WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat
FEBRA10001880//Eukaryotic protein kinase domain// Eukaryotic protein kinase domain
FEBRA10001900//Zinc finger, C2H2 type
FEBRA20004620//Rap/ran-GAP
FEBRA20007620//Bacterial type II secretion system protein// DEAD/DEAH box helicase// Helicases conserved C-terminal domain
FEBRA20018690//Zinc finger, C2H2 type
FEBRA20024100//Ank repeat// Ank repeat// Myosin head (motor domain)// Myosin head (motor domain)
FEBRA20025270//Sulfotransferase proteins
FEBRA20026110//Dictyostelium (slime mold) repeats// Zinc finger, C2H2 type// Dictyostelium (slime mold) repeats// Zinc finger, C2H2 type// Dictyostelium (slime mold) repeats// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Dictyostelium (slime mold) repeats// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Dictyostelium (slime mold) repeats// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Dictyostelium (slime mold) repeats// Zinc finger, C2H2 type
FEBRA20034680//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// DnaJ central domain (4 repeats)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type
FEBRA20040530//KRAB box// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Bacterial dnaA protein// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
FEBRA20080810//POT family
FEBRA20082010//KRAB box// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
FEBRA20086620//Olfactomedin-like domain
FEBRA20088360//Alpha adaptin carboxyl-terminal domai
FEBRA20090290//Zinc finger, C3HC4 type (RING finger)
FEBRA20092890//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Fibronectin type III domain
FEBRA20097310//SAP domain// RNA recognition motif. (a.k.a. RRM, RBD, or
FEBRA20111460//Hemagglutinin
FEBRA20130190//Galactosyltransferase// Fringe-like
FEBRA20132740//PH domain
FEBRA20144170//Eukaryotic protein kinase domain// Protein kinase C terminal domain// Eukaryotic protein kinase domain
FEBRA20167390//Sialyltransferase family
FEBRA20171380//KRAB box// wnt family of developmental signaling protei// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Putative zinc finger in N-recognin// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
FEBRA20184330//PDZ domain (Also known as DHR or GLGF).
FEBRA20192420//Cyclin-dependent kinase inhibitor// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif
FEBRA20195820//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type
FEBRA20196370//Cyclin-dependent kinase inhibitor// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif
FEBRA20196630//DEAD/DEAH box helicase// Helicases conserved C-terminal domain
FEBRA20214970//Reverse transcriptase (RNA-dependent DNA pol
FEBRA20222040//bZIP transcription factor// K-box region
FEBRA20223220//EGF-like domain// EGF-like domain// Cadherin domain
FEBRA20229630//NADH-Ubiquinone/plastoquinone (complex I)
FEBRA20235500//Sodium Bile acid symporter family// ABC 3 transport family
FEBRA20237640//SAM domain (Sterile alpha motif)
FEHRT20003250//Phosphatidylinositol 3- and 4-kinases
HCASM10000500//Ribonucleotide reductases// Nucleotidyltransferase domain
HCHON10001760//Histone deacetylase family
HCHON20000380//Glucose-6-phosphate dehydrogenase
HCHON20003220//Formyl transferase// Phosphopantetheine attachment site// Protein of unknown function DUF132//Aldehyde dehydrogenase family
HCHON20007510//Phosphotyrosine interaction domain (PTB/PID)// TBC domain
HCHON20008150//RNA recognition motif. (a.k.a. RRM, RBD, or
HCHON20008320//Glutamine synthetase// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type
HCHON20009560//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
HCHON20010990//TPR Domain
HCHON20015350//FtsJ cell division protein
HCHON20015980//FG-GAP repeat// von Willebrand factor type A domain
HCHON20016040//Insulin-like growth factor binding proteins
HCHON20016650//Leucine rich repeat C-terminal domain// Immunoglobulin domain// Latrophilin/CL-1-like GPS domain//7 transmembrane receptor (Secretin family)
HCHON20035130//Zinc finger, C2H2 type// Zinc finger, C2H2 type
HCHON20036420//Death effector domain
HCHON20040020//Syntaxin
HCHON20059870//Bromodomain// Bromodomain
HCHON20064590//Alpha-2-macroglobulin family N-terminal regi// Alpha-2-macroglobulin family N-terminal regi
HCHON20068410//IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif
HCHON20086720//Insulin-like growth factor binding pr// Thyroglobulin type-1 repeat
HCHON20100740//EGF-like domain// F5/8 type C domain// F5/8 type C domain
HEART20003060//Immunoglobulin domain// Immunoglobulin domain
HEART20005410//u-PAR/Ly-6 domain
HEART20017730//Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat
HEART20025980//Calponin homology (CH) domain
HEART20034320//Glycosyl hydrolase family 9//Glycosyl hydrolase family 9
HEART20061950//PDZ domain (Also known as DHR or GLGF).
HEART20077670//Protein phosphatase 2A regulatory B subunit
HEART20083640//NAD-dependent DNA ligase
HEART20090000//Inositol polyphosphate phosphatase family, c
HHDPC10000830//Zinc finger, C3HC4 type (RING finger)
HHDPC20014320//Reprolysin family propeptide
HHDPC20031130//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
HHDPC20034390//Cereal trypsin/alpha-amylase inhibito
HHDPC20034720//Glutathione S-transferases.
HHDPC20068620//Immunoglobulin domain// Immunoglobulin domain
HHDPC20091780//CUB domain// F5/8 type C domain
HHDPC20092080//Thyroglobulin type-1 repeat
HLUNG20016330//Methyl-accepting chemotaxis protein (MCP) s// PH domain// PH domain// Methanol dehydrogenase beta subunit
HLUNG20017120//Peptidyl-tRNA hydrolase domain
HLUNG20023340//KH domain
HLUNG20033780//Birnavirus VP3 protein// RhoGEF domain// PH domain// SH3 domain
IMR3220002430//WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat
KIDNE20002520//tRNA synthetases class I (E and Q)// tRNA synthetases class I (K)// tRNA synthetases class I (E and Q)
KIDNE20003940//Phosphotransferase system, EIIC// FecCD transport family// ABC 3 transport family
KIDNE20007770//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
KIDNE20008010//Dihydropyridine sensitive L-type calcium
KIDNE20009470//G-patch domain// Peptidase family M1
KIDNE20017130//MYND finger// DM DNA binding domain// Ribosomal protein L36
KIDNE20020150//Ribosomal protein S13/S18//Hsp70 protein
KIDNE20021680//3-hydroxyacyl-CoA dehydrogenase
KIDNE20022620//Glycosyl transferase family 8
KIDNE20024830//C2 domain// C2 domain
KIDNE20027250//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
KIDNE20027950//KRAB box
KIDNE20028390//Galactose-1-phosphate uridyl transfer// Galactose-1-phosphate uridyl transfer
KIDNE20028720//ATP synthase (C/AC39) subunit
KIDNE20028830//K-box region
KIDNE20100070//AMP-binding enzyme
KIDNE20101510//EGF-like domain// Trypsin Inhibitor like cysteine rich d// EGF-like domain// Keratin, high sulfur B2 protein// Zona pellucida-like domain
KIDNE20102710//Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat
KIDNE20107390//Histone-like transcription factor (CBF/// GHMP kinases putative ATP-binding prote
KIDNE20107620//Eukaryotic protein kinase domain// Dihydropyridine sensitive L-type calcium
KIDNE20109730//Sodium
KIDNE20109890//WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// Zinc finger, C4 type (two domains)// WD domain, G-beta repeat// WD domain, G-beta repeat
KIDNE20121880//PMP-22/EMP/MP20/Claudin family
KIDNE20125630//ATP1G1/PLM/MAT8 family
KIDNE20127100//Kelch motif// Kelch motif// Kelch motif
KIDNE20127750//Bacterial regulatory proteins, tetR family
KIDNE20137340//Uncharacterized membrane protein family UPFO
KIDNE20182690//BAH domain// ELM2 domain
LIVER10004790//EF hand
LIVER20002160//Hsp70 protein
LIVER20035680//UvrD/REP helicase
LIVER20055440//RhoGAP domain
LIVER20064690//Serpins (serine protease inhibitors)
LIVER20080530//Ank repeat// Ank repeat// Ank repeat// SAM domain (Sterile alpha motif)
LIVER20087060//Guanylate-binding protein
LIVER20087510//PHD-finger
MAMGL10000830//LysM domain
MESAN10001260//von Willebrand factor type C domain// von Willebrand factor type C domain// von Willebrand factor type C domain// von Willebrand factor type C domain// TILa domain// von Willebrand factor type C domain// Keratin, high sulfur B2 protein// PEP-utilizing enzymes// von Willebrand factor type D domain// Plant PEC family metallothionein// Trypsin Inhibitor like cysteine rich
MESAN20029400//Zinc finger, C3HC4 type (RING finger)// RNA polymerases M/15 Kd subunits
MESAN20031900//Zinc finger, C3HC4 type (RING finger)// Peroxidase// Zinc finger, C3HC4 type (RING finger)// B-box zinc finger.// Fibronectin type III domain
MESAN20035290//FYVE zinc finger
MESAN20036460//Corticotropin-releasing factor family
MESAN20038510//Oxidoreductase molybdopterin binding d
MESAN20101140//LIM domain containing proteins
MESAN20103120//Sodium/calcium exchanger protein
MESAN20125860//Transferrin
MESAN20127350//Zinc knuckle
MESAN20130220//‘chromo’ (CHRromatin Organization MOdifier)// Enoyl-CoA hydratase/isomerase family
MESAN20136110//KH domain// KH domain// Zinc finger, C3HC4 type (RING finger)
MESAN20141920//Troponin// Tropomyosins// Borrelia ORF-A
MESAN20154010//Tryptophan synthase alpha chain// Ribulose-phosphate 3 epimerase family// Indole-3-glycerol phosphate synthases
MESAN20171520//PH domain
MESAN20174170//Regulator of G protein signaling domain
MESAN20186700//Hepatitis C virus RNA dependent RNA polymerase
NOVAR10000150//Cytosolic long-chain acyl-CoA thioester hydrolase
NT2NE20010490//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// DM DNA binding domain// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type
NT2NE20021620//Vacuolar sorting protein 9 (VPS9) domain
NT2NE20080170//CRAL/TR10 domain.
NT2NE20089970//KRAB box
NT2NE20118960//Gram-negative pili assembly chaperone
NT2NE20125050//Ezrin/radixin/moesin family
NT2NE20130190//Zinc finger, C2H2 type
NT2NE20132170//GNS1/SUR4 family// Transmembrane amino acid transporter protein
NT2NE20142210//PAS domain// PAS domain
NT2NE20157470//von Willebrand factor type A domain// Trypsin
NT2NE20158600//Ank repeat// Ank repeat
NT2NE20177520//Sushi domain (SCR repeat)// Sushi domain (SCR repeat)// Sushi domain (SCR repeat)// Sushi domain (SCR repeat)
NT2NE20181650//Src homology domain 2
NT2NE20183760//Calcitonin/CGRP/IAPP family
NT2NE20184900//FF domain
NT2RI20001330//Ank repeat// Ank repeat
NT2RI20003480//Glypican
NT2RI20005750//Cell division protein// Sigma-54 interaction domain// ADP-ribosylation factor family// ABC transporter// Ras family
NT2RI20009870//Fringe-like
NT2RI20025640//Reverse transcriptase (RNA-dependent DNA pol
NT2RI20040930//Mitochondrial carrier proteins// Mitochondrial carrier proteins
NT2RI20040990//Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat
NT2RI20046080//recA bacterial DNA recombination proteins
NT2RI20048840//ADP-ribosylation factor family// G-protein alpha subunit
NT2RI20054050//HSF-type DNA-binding domain
NT2RI20056700//Spectrin repeat// Apolipoprotein A1/A4/E family// Olfactomedin-like domain
NT2RI20091730//Molluscan rhodopsin C-terminal tail
NT2RI20240080//TPR Domain// TPR Domain// TPR Domain
NT2RI20244600//PAP2 superfamily
NT2RI20273230//DEAD/DEAH box helicase
NT2RP60000770//Zinc finger, C2H2 type// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
NT2RP60000850//C2 domain
NT2RP70027380//PX domain// SH3 domain// RhoGAP domain
NT2RP70032610//Peptidase family M20/M25/M40//Enol-ase
NT2RP70036880//TBC domain
NT2RP70043480//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type
NT2RP70044280//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)
NT2RP70062230//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Pancreatic hormone peptides// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
NT2RP70063950//RhoGEF domain// Extracellular link domain// PH domain
NT2RP70078420//PH domain// Putative GTP-ase activating protein for Arf// Ank repeat// Ank repeat
NT2RP70080850//SPRY domain// Adenovirus EB1 55K protein/large t-an
NT2RP70102350//Viral methyltransferase// Helix-loop-helix DNA-binding domain
NT2RP70105210//Myc amino-terminal region
NT2RP70157890//KRAB box
NT2RP70159960//PH domain
NT2RP70179710//Zinc finger, C3HC4 type (RING finger)// PHD-finger
NT2RP70188710//Yeast PIR proteins
NT2RP70192730//alpha/beta hydrolase fold
NT2RP70194450//Bacterial regulatory proteins, crp family
NT2RP70195430//Zinc-binding dehydrogenases
NT2RP70198350//PWWP domain
NTONG20009770//Coronavirus S2 glycoprotein// Peptidase family M3
NTONG20013620//Sulfotransferase proteins
NTONG20015870//Transposase// Outer membrane efflux protein// Intermediate filament proteins
NTONG20028070//von Willebrand factor type C domain
NTONG20029480//NAD-dependent DNA ligase
NTONG20029700//Laminin N-terminal (Domain VI)// Laminin EGF-like (Domains III and V)// Laminin EGF-like (Domains III and V)// Laminin EGF-like (Domains III and V)
NTONG20046140//Eukaryotic protein kinase domain// Aminoglycoside phosphotransferase
NTONG20051530//Mov34/MPN/PAD-1 family// Extracellular link domain// Adhesin lipoprotein// Lectin C-type domain
NTONG20056570//WD domain, G-beta repeat// WD domain, G-beta repeat
NTONG20063010//EGF-like domain// Trypsin Inhibitor like cysteine rich domain// EGF-like domain// EGF-like domain// Keratin, high sulfur B2 protein// Chitin binding Peritrophin-A domain// Zona pellucida-like domain
NTONG20064840//C2 domain// C2 domain
NTONG20067830//Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat
NTONG20070200//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
NTONG20070340//Collagen triple helix repeat (20 copies)// Collagen triple helix repeat (20 copies)// Collagen triple helix repeat (20 copies)
NTONG20075220//RyR domain
NTONG20076930//Alpha-2-macroglobulin family
NTONG20083650//TPR Domain// TPR Domain// TPR Domain// PPR repeat// TPR Domain// PPR repeat// TPR Domain
NTONG20092290//Immunoglobulin domain// Immunoglobulin domain
NTONG20092330//Putative membrane protein
OCBBF10001850//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// DM DNA binding domain// Zinc finger, C2H2 type// Zinc finger, C2H2 type// MYND finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
OCBBF20019380//Sushi domain (SCR repeat)// CUB domain
OCBBF20019830//Fibronectin type III domain// Fibronectin type III domain// EGF-like domain// Metallothionein family 5
OCBBF20020830//Pumilio-family RNA binding domains (aka PUM-HD, Pumilio homology domain)// Pumilio-family RNA binding domains (aka PUM-HD, Pumilio homology domain)// Pumilio-family RNA binding domains (aka PUM-HD, Pumilio homology domain)// Pumilio-family RNA binding domains (aka PUM-HD, Pumilio homology domain)// Pumilio family RNA binding domains (aka PUM-HD, Pumilio homology domain)// Putative GTP-ase activating protein for Arf// Pumilio-family RNA binding domains (aka PUM-HD, Pumilio homology domain)// Pumilio-family RNA binding domains (aka PUM-HD, Pumilio homology domain)// Pumilio-family RNA binding domains (aka PUM-HD, Pumilio homology domain)
OCBBF20022900//IQ calmodulin-binding motif// Dishevelled specific domain// Kunitz/Bovine pancreatic trypsin inhibitor domain
OCBBF20028050//Phorbol esters/diacylglycerol binding domain (C1 domain)// Zinc finger, C3HC4 type (RING finger)// PHD-finger
OCBBF20028650//Ank repeat// Ank repeat// Helicases conserved C-terminal domain
OCBBF20030280//Lipoprotein amino terminal region
OCBBF20035930//NSF attachment protein
OCBBF20037440//Zinc finger, C3HC4 type (RING finger)
OCBBF20046120//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
OCBBF20049300//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Putative zinc finger in N-recognin// Zinc finger, C2H2 type// DM DNA binding domain// Zinc finger, C2H2 type
OCBBF20049840//PDZ domain (Also known as DHR or GLGF).
OCBBF20050770//Dehydrins// Carnitate acyltransferase
OCBBF20053430//Extracellular link domain// Eukaryotic protein kinase domain// Protein kinase C terminal domain
OCBBF20053730//Ank repeat// Ank repeat// Ank repeat// Patatin
OCBBF20054760//Death domain
OCBBF20059560//UvrB/uvrC motif
OCBBF20066390//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
OCBBF20071210//Spectrin repeat
OCBBF20071840//Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C3HC4 type (RING finger)// Zinc finger, C2H2 type// Zinc finger, C2H2 type
OCBBF20079310//Acetyltransferase (GNAT) family
OCBBF20080410//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
OCBBF20082830//alpha/beta hydrolase fold
OCBBF20086400//ADP-ribosylation factor family// ABC transporter// FtsK/SpoIIIE family// Ras family
OCBBF20086910//HMG (high mobility group) box
OCBBF20107090//Cadherin domain
OCBBF20108190//Zinc finger, C2H2 type// Zinc finger, C2H2 type// IBR domain// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
OCBBF20108430//ADP-ribosylation factor family// G-protein alpha subunit
OCBBF20108580//Caspase recruitment domain
OCBBF20108630//ABC transporter
OCBBF20109310//PH domain// Arrestin (or S-antigen)
OCBBF20116850//Leucine rich repeat N-terminal domain// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine rich repeat C-terminal domain// Immunoglobulin domain
OCBBF20120390//Caveolin// Hepatitis C virus core protein// Sodium:neurotransmitter symporter family
OCBBF20121390//BTB/POZ domain// Kelch motif// Kelch motif// Kelch motif// Kelch motif// Kelch motif
OCBBF20124360//CNH domain
OCBBF20125530//Vpu protein// Zinc finger, C3HC4 type (RING finger)
OCBBF20127040//Interleukin-6/G-CSF/MGF family
OCBBF20127140//WD domain, G-beta repeat// WD domain, G-beta repeat
OCBBF20127550//Outer Capsid protein VP4 (Hemagglutinin)
OCBBF20128120//DnaJ domain// DnaJ central domain (4 repeats)// DnaJ C terminal region
OCBBF20129360//PH domain// EF hand// Ribosomal RNA adenine dimethylases// EF hand// Sulfotransferase proteins// Somatotropin hormone family// Phosphatidylinositol-specific phospholi// Phosphatidylinositol-specific phospholi// C2 domain
OCBBF20132850//Leucine rich repeat N-terminal domain// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine rich repeat C-terminal domain// Immunoglobulin domain// Fibronectin type III domain
OCBBF20140640//Phosphotyrosine interaction domain (PTB/PID)
OCBBF20140890//Ribosomal protein L11
OCBBF20145760//Glypican
OCBBF20148280//Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
OCBBF20148730//BTB/POZ domain// Kelch motif// Kelch motif// Kelch motif// Kelch motif
OCBBF20155060//EGF-like domain// Laminin EGF-like (Domains III and V)// Laminin G domain// EGF-like domain// Laminin G domain// EGF-like domain
OCBBF20173980//Regulator of chromosome condensation// Regulator of chromosome condensation// Regulator of chromosome condensation// Regulator of chromosome condensation// Regulator of chromosome condensation// BTB/POZ domain// Thymidylate synthase
OCBBF20178880//Granulins
OCBBF20180120//Sodium:sulfate symporter transmembrane// Sodium:sulfate symporter transmembrane// Sodium:sulfate symporter transmembrane
PEBLM10000240//Domain found in Dishevelled, Eg1-10, and Ple
PEBLM20013120//PH domain
PEBLM20024320//Cation efflux family
PEBLM20042900//Chitin synthase
PEBLM20044520//Ubiquitin carboxyl-terminal hydrolase fam// Exonuclease
PEBLM20052820//Protein phosphatase 2C
PEBLM20060310//IBR domain// Zinc finger, C3HC4 type (RING finger)
PEBLM20060360//KRAB box
PEBLM20075980//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
PEBLM20078320//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// DnaJ central domain (4 repeats)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
PERIC10000250//Prokaryotic DNA topoisomerase
PERIC20003870//Ribosomal L32p protein family// NAC domain// TS-N domain
PERIC20004220//Domain of unknown function
PERIC20004780//bZIP transcription factor
PLACE60003480//Chorismate synthase
PLACE60060420//Ribosomal protein L44
PLACE60079250//Bacterial flagellin N-terminus// Spectrin repeat// Spectrin repeat// Spectrin repeat// Caulimovirus movement protein// Spectrin repeat// Spectrin repeat// Spectrin repeat// UvrB/uvrC motif// Spectrin repeat// Spectrin repeat// Flagellar hook-associated protein 2//Spectrin repeat// KE2 family protein
PLACE60136500//dUTPase
PLACE60136720//Porphobilinogen deaminase// GHMP kinases putative ATP-binding prot
PLACE60177140//7 transmembrane receptor (rhodopsin family)
PROST20047270//CRAL/TR10 domain.
PROST20047390//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
PROST20050670//Endothelin family
PROST20066880//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
PROST20079500//Hepatitis C virus non-structural protein NS4b// Ras association (RalGDS/AF-6) domain
PROST20100460//Cystine-knot domain
PROST20112970//Sterile alpha motif (SAM)/Pointed domain// SAM domain (Sterile alpha motif)
PROST20114390//Integrase DNA binding domain
PROST20161950//RasGEF domain
PROST20169800//Cytochrome P450
PROST20170980//Immunoglobulin domain// Adenovirus E3 region protein CR1
PROST20171280//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
PROST20176170//LIM domain containing proteins// LIM domain containing proteins// LIM domain containing proteins
PROST20185830//GATA zinc finger
PROST20189770//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
PROST20191640//Zinc finger, C3HC4 type (RING finger)// IBR domain// Keratin, high sulfur B2 protein// Zinc finger, C3HC4 type (RING finger)
PUAEN10000850//Uncharacterized protein family UPF0025//Sec1 family
PUAEN20011880//ZAP domain// Piwi domain
PUAEN20015860//PDZ domain (Also known as DHR or GLGF).// Regulator of G protein signaling domain
PUAEN20018820//Sterile alpha motif (SAM)/Pointed domain// Ets-domain
PUAEN20030180//Eukaryotic-type carbonic anhydrase
PUAEN20040670//FERM domain (Band 4.1 family)// FERM domain (Band 4.1 family)
PUAEN2055020//PH domain// START domain
PUAEN20078980//PH domain// FYVE zinc finger// Domain of unknown function
DUF123//PH domain
PUAEN20083140//EF hand// PH domain// Neuregulin family
PUAEN20108240//Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat
SALGL10001710//ENV polyprotein (coat polyprotein)
SKMUS20001980//Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat
SKMUS20003610//Syndecan domain// Mitochondrial carrier proteins// Mitochondrial carrier proteins// Mitochondrial carrier proteins SKMUS20007800//Matrix protein (MA), p15//Prenyltransferase and squalene oxidase re
SKMUS20016220//Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat
SKMUS20018230//Ank repeat
SKMUS20018500//Coronavirus S2 glycoprotein
SKMUS20024750//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat
SKMUS20029200//Ank repeat// Respiratory-chain NADH dehydrogenase, 4//Ank repeat// Ank repeat// Ank repeat// Ank repeat
SKMUS20048970//Actin// Actin
SKMUS20049030//Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat
SKMUS20084740//Syndecan domain
SKNSH20008190//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// AN1-like Zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
SKNSH20020540//Arginase family
SKNSH20063040//Transmembrane 4 family// Transmembrane 4 family
SMINT20001760//PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
SMINT20009840//Immunoglobulin domain// Immunoglobulin domain
SMINT20013480//Metallo-beta-lactamase superfamily
SMINT20028820//Eukaryotic protein kinase domain
SMINT20035690//Ribosomal L29 protein
SMINT20049090//Eukaryotic protein kinase domain
SMINT20050750//Kazal-type serine protease inhibitor domain
SMINT20068010//Kinesin motor domain
SMINT20071400//NOL1/NOP2/sun family
SMINT20073650//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SMINT20102780//Quinolinate phosphoribosyl transferase
SMINT20106290//Formamidopyrimidine-DNA glycosylase
SMINT20106720//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SMINT20110330//pKID domain
SMINT20112730//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SMINT20115880//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
SMINT20121220//Myosin tail
SMINT20121950//2Fe-2S iron-sulfur cluster binding domains
SMINT20122910//START domain
SMINT20127930//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SMINT20130320//NB-ARC domain// ATPases associated with various cellular act
SMINT20131810//ENV polyprotein (coat polyprotein)
SMINT20136130//Immunoglobulin domain
SMINT20138900//Hr1 repeat motif// Apolipoprotein A1/A4/E family// Intermediate filament proteins
SMINT20144430//Immunoglobulin domain
SMINT20144800//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
SMINT20152940//Sigma-54 interaction domain// ATPases associated with various cellular activities (AAA)
SMINT20154540//Glutathione S-transferases.
SMINT20163960//Immunoglobulin domain
SMINT20168570//Fasciclin domain
SMINT20174360//haloacid dehalogenase-like hydrolase
SMINT20177360//RNA recognition motif. (a.k.a. RRM, RBD, or
SMINT20179740//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SMINT20183530//ABC transporter// ABC transporter
SMINT20190170//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SMINT20191530//DEAD/DEAH box helicase// Helicases conserved C-terminal domain
SPLEN20006070//Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat
SPLEN20008740//Importin beta binding domain// Armadillo/beta-catenin-like repeats// Armadillo/beta-catenin-like repeats
SPLEN20011410//RhoGAP domain
SPLEN20026950//SNF2 and others N-terminal domain// Bromodomain// Helicases conserved C-terminal domain// Bromodomain
SPLEN20027440//Zinc finger present in dystrophin, CBP/p300//Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat
SPLEN20039240//Ribosomal protein S13/S18//Hsp70 protein
SPLEN20054290//Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
SPLEN20077500//PH domain// Transposase
SPLEN20079260//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
SPLEN20084600//BTB/POZ domain// Kelch motif// Kelch motif// Kelch motif// Keich motif// Kelch motif
SPLEN20095410//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
SPLEN20095550//bZIP transcription factor// bZIP transcription factor// Hpt domain
SPLEN20099700//Sigma-54 interaction domain// ATPases associated with various cellular ac// Thymidine kinase from herpesvirus
SPLEN20103950//Ribosomal S17
SPLEN20118300//Transmembrane amino acid transporter protein
SPLEN20119810//Reverse transcriptase (RNA-dependent DNA polymerase)
SPLEN20126190//Lipoate-protein ligase B
SPLEN20140800//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// DnaJ central domain (4 repeats)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
SPLEN20142100//von Willebrand factor type A domain
SPLEN20143180//Src homology domain 2
SPLEN20145720//PH domain
SPLEN20147110//HECT-domain (ubiquitin-transferase).
SPLEN20147390//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
SPLEN20149110//Dishevelled specific domain
SPLEN20150940//Histone deacetylase family
SPLEN20151210//FERM domain (Band 4.1 family)// FERM domain (Band 4.1 family)// Isocitrate lyase
SPLEN20157880//Immunoglobulin domain
SPLEN20163560//Kinesin motor domain
SPLEN20165310//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SPLEN20170310//PH domain
SPLEN20171470//Keratin, high sulfur B2 protein
SPLEN20173510//TPR Domain// TPR Domain// TPR Domain// TPR Domain// TPR Domain// NADH-ubiquinone/plastoquinone oxidoreduct
SPLEN20174260//Penicillin amidase// Bacterial regulatory proteins, lacI f// Vacuolar sorting protein 9 (VPS9) dom
SPLEN20179180//EF hand
SPLEN20179810//S-adenosylmethionine synthetase
SPLEN20181810//Phorbol esters/diacylglycerol binding domain (C1 domain)// FYVE zinc finger
SPLEN20186430//7 transmembrane receptor (rhodopsin family)//7 transmembrane receptor (rhodopsin family)
SPLEN20211220//Metalloenzyme superfamily
SPLEN20212730//Calpain large subunit, domain III// EF hand// EF hand// EF hand
SPLEN20222270//PTB domain (IRS-1 type)
SPLEN20245300//Pancreatic hormone peptides
SPLEN20250170//RhoGEF domain// PH domain// FYVE zinc finger// Domain of unknown function DUF123//PH domain
SPLEN20250390//EF hand// EF hand
SPLEN20252190//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type
SPLEN20267650//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type
SPLEN20292950//Phosphoribulokinase// ABC transporter// Aldehyde oxidase and xanthine dehydrogenase, C terminus
SPLEN20304950//Transmembrane 4 family
SPLEN20305620//Dihydroorotate dehydrogenase
STOMA20001830//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
STOMA20005390//Sodium and potassium ATPases// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
STOMA20005670//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
STOMA20006400//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
STOMA20006780//Hepatitis C virus RNA dependent RNA polymera// Somatotropin hormone family
STOMA20008880//Olfactomedin-like domain
STOMA20032890//Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
STOMA20034770//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
STOMA20046680//bZIP transcription factor
STOMA20056640//Immunoglobulin domain
STOMA20056670//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
STOMA20057820//Uncharacterized protein family UPF0024
STOMA20062130//Immunoglobulin domain
STOMA20063980//Collagen triple helix repeat (20 copies)
STOMA20064470//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat
STOMA20069040//Keratin, high sulfur B2 protein
STOMA20077450//Repeat in ubiquitin-activating (UBA) pro// Repeat in ubiquitin-activating (UBA) pro
STOMA20080500//ABC transporter STOMA20083610//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
STOMA20088380//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
STOMA20092530//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
STOMA20092890//Myosin head (motor domain)
SYNOV20001520//Immunoglobulin domain// Immunoglobulin domain
SYNOV20001730//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SYNOV20002510//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SYNOV20002790//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SYNOV20002970//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SYNOV20004260//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SYNOV20007000//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SYNOV20008240//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SYNOV20009230//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SYNOV20010880//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SYNOV20011110//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SYNOV20013000//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SYNOV20013560//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SYNOV20013900//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
SYNOV20017080//UBX domain
SYNOV30001840//Asparagine synthase// AMP-binding enzyme
TBAES20000590//Cytochrome P450// Cytochrome P450
TBAES20002550//Peptidase family M1// Sigma-70 factor (ECF subfamily)
TBAES20003150//Cytochrome P450
TESOP20004000//Papain family cysteine protease
TESOP20005270//Sulfotransferase proteins
TESTI20001000//Formamidopyrimidine-DNA glycosylase
TESTI20001170//HORMA domain
TESTI20002780//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// PEP-utilizing enzymes
TESTI20017950//Regulator of G protein signaling domain
TESTI20023510//Transcription termination factor nusG
TESTI20031810//Bacterial luciferase// Domain of unknown function DUF28
TESTI20035960//Coproporphyrinogen III oxidase// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat
TESTI20036380//Sulfate transporter family// Sodium Bile acid symporter family// STAS domain
TESTI20041690//Zinc finger, C3HC4 type (RING finger)// PHD-finger// IBR domain// Zinc finger, C3HC4 type (RING finger)// B-box zinc finger.// lactate/malate dehydrogenase// Fibronectin type III domain
TESTI20044230//Nucleosome assembly protein (NAP)// Nucleosome assembly protein (NAP)// Nucleosome assembly protein (NAP)
TESTI20044310//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Chorismate synthase// UvrB/uvrC motif
TESTI20046750//Respiratory-chain NADH dehydrogenase, 4
TESTI20057750//RNase H// Integrase Zinc binding domain
TESTI20061110//Heavy-metal-associated domain// ATPases associated with various cellular act
TESTI20063830//Transposase
TESTI20066670//Acyl-CoA dehydrogenase
TESTI20067200//K-box region// Homeobox domain
TESTI20082330//Tudor domain
TESTI20083200//Dual specificity phosphatase, catalytic doma
TESTI20083940//Progesterone receptor
TESTI20088220//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// BolA-like protein// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Snake toxin// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
TESTI20094470//Ets-domain
TESTI20098350//VAT-Nn domain
TESTI20108720//Protein phosphatase 2C
TESTI20121550//Putative GTP-ase activating protein for Arf
TESTI20127760//Cyclin// Calcitonin/CGRP/IAPP family
TESTI20130010//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
TESTI20136710//Glypican// PHD-finger
TESTI20143390//Integral membrane protein DUF6//Integral membrane protein DUF6
TESTI20148000//Thioredoxin// Calsequestrin// Thioredoxin
TESTI20152460//Putative zinc finger in N-recognin// PHD-finger
TESTI20156100//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
TESTI20157520//K+ channel tetramerisation domain// K+ channel tetramerisation domain
TESTI20168480//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// MAM domain.// Immunoglobulin domain
TESTI20170350//Cystine-knot domain
TESTI20184620//PH domain// Oxysterol-binding protein
TESTI20185650//AN1-like Zinc finger
TESTI20189410//PHD-finger
TESTI20192800//HCO3-transporter family// Ank repeat// Ank repeat// Ank repeat// Alpha-2-macroglobulin family
TESTI20197940//Domain of unknown function DUF27//Aconitase family (aconitate hydratase)
TESTI20200710//PHD-finger// LIM domain containing proteins
TESTI20202650//Repeat in HS1/Cortactin
TESTI20204450//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Homeobox domain
TESTI20208400//NOL1/NOP2/sun family
TESTI20208710//WD domain, G-beta repeat// WD domain, G-beta repeat
TESTI20211160//Hydroxyethylthiazole kinase family
TESTI20214250//Mitochondrial carrier proteins// Mitochondrial carrier proteins
TESTI20215990//F-box domain.// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat
TESTI20216370//Carboxylesterases
TESTI20226230//Adenylate kinase// Pou domain-N-terminal to homeobox d
TESTI20229600//EGF-like domain// Metallothionein family 5//Replication protein// Laminin G domain// EGF-like domain// Laminin G domain// Insulin-like growth factor binding prot// EGF-like domain// Laminin G domain
TESTI20230850//PAS domain
TESTI20231920//Gag P30 core shell protein
TESTI20232140//Phosphatidylinositol-specific phospholipase// Phosphatidylinositol-specific phospholipase
TESTI20234140//EF hand// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat
TESTI20234360//WW domain// PPIC-type PPIASE domain.
TESTI20238610//MAGE family// Uncharacterized protein family UPF0057
TESTI20242830//E2 (early) protein, C terminal// Syndecan domain
TESTI20244190//Immunoglobulin domain// Immunoglobulin domain//-Immunoglobulin domain// Immunoglobulin domain
TESTI20254860//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Reeler domain// Fibronectin type III domain// Fibronectin type III domain
TESTI20255820//FERM domain (Band 4.1 family)// FERM domain (Band 4.1 family)// Isocitrate lyase
TESTI20258460//PH domain
TESTI20265970//Guanylate-binding protein
TESTI20266740//Nucleotidyltransferase domain
TESTI20272960//7 transmembrane receptor (rhodopsin family)
TESTI20275030//WD domain, G-beta repeat// WD domain, G-beta repeat
TESTI20288910//SH3 domain
TESTI20291960//Rhomboid family
TESTI20303220//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Fibronectin type III domain// Alphaherpesvirus glycoprotein E// Fibronectin type III domain// Fibronectin type III domain// Fibronectin type III domain
TESTI20303360//ENV polyprotein (coat polyprotein)
TESTI20305540//Hantavirus nucleocapsid protein// Troponin// Apolipoprotein A1/A4/E family
TESTI20308600//Homeobox domain
TESTI20309170//TPR Domain// Zinc finger, C3HC4 type (RING finger)// Aldo/keto reductase family// ATP-dependent protease La (LON) domain
TESTI20314180//Trypsin// Trypsin
TESTI20317600//Terpene synthase family
TESTI20318090//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
TESTI20320440//Thioredoxin
TESTI20320670//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)// RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)
TESTI20326810//RanBP1 domain.
TESTI20327680//EF hand// EF hand
TESTI20328280//KE2 family protein// Troponin
TESTI20333000//Immunoglobulin domain// Immunoglobulin domain
TESTI20334410//DEAD/DEAH box helicase// Helicases conserved C-terminal domain
TESTI20335050//Zinc finger, C3HC4 type (RING finger)
TESTI20335200//Immunoglobulin domain
TESTI20343070//Transcription factor E2F/dimerisation partner (TDP)
TESTI20351830//K-box region
TESTI20352620//Saposin A-type domain
TESTI20355020//Tudor domain
TESTI20358980//Homeobox domain// Collagen triple helix repeat (20 copies)
TESTI20366910//Pyridine nucleotide-disulphide oxidoreductase
TESTI20368330//Rhodanese-like domain
TESTI20369690//PHD-finger
TESTI20370020//Bleomycin resistance protein
TESTI20370810//Ion transport protein// Polysaccharide biosynthesis protein// Sugar (and other) transporter
TESTI20371030//Kelch motif// Kelch motif// Kelch motif// Kelch motif// Kelch motif
TESTI20375340//Phosphatidylinositol-specific phospholi// UvrD/REP helicase// Phosphatidylinositol-specific phospholi// C2 domain
TESTI20377230//Thymidylate synthase
TESTI20378190//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
TESTI20381040//Putative zinc finger in N-recognin
TESTI20382750//Kinesin motor domain
TESTI20383880//DnaJ domain
TESTI20385960//Zinc finger, C3HC4 type (RING finger)// SPRY domain
TESTI20390410//Arsenical pump membrane protein
TESTI20391210//IQ calmodulin-binding motif
TESTI20391770//Domain of unknown function DUF19//Thioredoxin
TESTI20392250//PH domain// Phorbol esters/diacylglycerol binding domain (C1 domain)
TESTI20392270//Cyclin
TESTI20392760//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat
TESTI20393530//Mitochondrial carrier proteins
TESTI20397760//E1-E2 ATPase
TESTI20400940//K-box region
TESTI20401020//Mitochondrial carrier proteins// Mitochondrial carrier proteins
TESTI20408150//Keratin, high sulfur B2 protein
TESTI20416640//Choline/ethanolamine kinase
TESTI20432750//Cytochrome C and Quinol oxidase polypeptide
TESTI20432820//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
TESTI20436560//Spectrin repeat// Intermediate filament proteins// Intermediate filament tail domain
TESTI20442760//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
TESTI20443090//SAP domain// Zinc knuckle// Zinc finger, C3HC4 type (RING finger)
TESTI20444130//ENV polyprotein (coat polyprotein)
TESTI20449200//7 transmembrane receptor (metabotropic gluta
TESTI20451990//SAP domain
TESTI20455090//Intermediate filament proteins
TESTI20455620//Hsp70 protein
TESTI20456110//B-box zinc finger.// Spectrin repeat// SPRY domain
TESTI20463580//Ubiquitin carboxyl-terminal hydrolases famil// Immunoglobulin domain// Ubiquitin carboxyl-terminal hydrolase family
TESTI20467320//Wiskott Aldrich syndrome homology region 2
TESTI20467970//Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain
TESTI20471410//Protein phosphatase 2C
TESTI20478850//Herpesvirus Glycoprotein B
THYMU10005360//Immunoglobulin domain// Viral coat protein// Immunoglobulin domain
THYMU10005540//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
THYMU20023380//Copper/zinc superoxide dismutase (SODC)
THYMU20027560//Domain of unknown function
THYMU20039810//MAC/Perforin domain
THYMU20105190//Myosin head (motor domain)
THYMU20106710//Immunoglobulin domain
THYMU20111180//Domain of unknown function DUF27//Aconitase family (aconitate hydratase)
THYMU20115850//Reverse transcriptase (RNA-dependent DNA pol
THYMU20118520//Ubiquitin family
THYMU20122730//VHS domain
THYMU20126900//3-hydroxyacyl-CoA dehydrogenase// UDP-glucose/GDP-mannose dehydrogenase fa
THYMU20130890//Ribosomal protein S9/S16
THYMU20141670//Phorbol esters/diacylglycerol binding dom// PHD-finger// FYVE zinc finger
THYMU20142040//Wiskott Aldrich syndrome homology region 2
THYMU20143270//Cytochrome C oxidase subunit II
THYMU20147770//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
THYMU20159430//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
THYMU20161640//PMP-22/EMP/MP20/Claudin family// Integral membrane protein DUF6
THYMU20169680//Ank repeat// Ank repeat
THYMU20172150//WD domain, G-beta repeat
THYMU20194360//Kelch motif
THYMU20201980//PH domain// Phorbol esters/diacylglycerol binding domain (C1 domain)// FYVE zinc finger// PH domain
THYMU20202890//Eukaryotic protein kinase domain
THYMU20209590//PH domain// Dynamin GTPase effector domain
THYMU20216840//PHD-finger
THYMU20229220//Closterovirus coat protein
THYMU20239000//Collagen triple helix repeat (20 copies)
THYMU20240710//tRNA synthetases class I (E and Q)
THYMU20241850//Class II histocompatibility antigen, beta// Immunoglobulin domain
THYMU20247480//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
THYMU20279750//Immunoglobulin domain
TKIDN10000010//Mitochondrial import inner membrane transloc
TKIDN20004640//GHMP kinases putative ATP-binding protei
TKIDN20047480//Eukaryotic protein kinase domain
TOVAR20004760//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat
TRACH20002870//PMP-22/EMP/MP20/Claudin family
TRACH20003590//Cytochrome P450
TRACH20005020//Ank repeat// MutT-like domain
TRACH20005400//ADP-ribosylation factor family// Ras family
TRACH20016210//Fucosyl transferase
TRACH20019960//Na+/K+ ATPase C-terminus
TRACH20028030//DnaJ domain// DnaJ central domain (4 repeats)// DnaJ C terminal region
TRACH20033230//Nucleoside transporter// Sugar (and other) transporter// Influenza RNA-dependent RNA polymerase subunit PB2
TRACH20041830//Thioredoxin// Thioredoxin
TRACH20042920//Glutamine synthetase
TRACH20048450//Phospholipase D. Active site motif// Phospholipase D. Active site motif
TRACH20050040//Plexin repeat
TRACH20067620//Core-2/1-Branching enzyme
TRACH20069180//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
TRACH20076740//Reduced folate carrier
TRACH20076760//Keratin, high sulfur B2 protein
TRACH20077540//Zinc finger, C2H2 type// G-patch domain
TRACH20079690//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type//
TRAF-type zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type
TRACH20084720//tRNA synthetases class I (C)// tRNA synthetases class I (I, L, M and V)
TRACH20085400//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
TRACH20085830//Cytochrome P450
TRACH20096610//Intermediate filament proteins// Intermediate filament tail domain
TRACH20105870//Regulatory subunit of type II PKA R-subunit// eIF4-gamma/eIF5/eIF2-epsilon
TRACH20121380//Raf-like Ras-binding domain// Leptin// Raf-like Ras-binding domain// LGN motif, putative GEF specific for G-alpha GTPase
TRACH20128230//Immunoglobulin domain// Chitin synthase// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain
TRACH20135520//TBC domain// Rhodanese-like domain
TRACH20136710//Immunoglobulin domain
TRACH20141240//Granulins
TRACH20145440//von Willebrand factor type D domain
TRACH20154860//Squash family of serine protease inhibito// Zinc finger, C4 type (two domains)// T-box// Zinc finger, C4 type (two domains)// Ligand-binding domain of nuclear hormone
TRACH20163170//Homeobox domain
TRACH20164980//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
TRACH20167220//wnt family of developmental signaling protei// PLAT/LH2 domain// Fibroblast growth factor
TRACH20184490//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
TRACH20190240//EGF-like domain// EGF-like domain// Trypsin Inhibitor like cysteine rich domain// EGF-like domain
TSTOM20005690//BTB/POZ domain// Kelch motif// Kelch motif// Kelch motif
TUTER20002830//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)
UMVEN10001860//PH domain// RhoGAP domain// bZIP transcription factor
UMVEN20000690//F5/8 type C domain
UTERU20030570//ABC 3 transport family// Voltage gated chloride channels// CBS domain// CBS domain
UTERU20046640//Rotavirus NS26
UTERU20046980//EB module// TNFR/NGFR cysteine-rich region// Furin-like cysteine rich region// Thrombospondin type 1 domain
UTERU20050690//Androgen receptor
UTERU20055330//Reverse transcriptase (RNA-dependent DNA polymerase)
UTERU20055480//AMP-binding enzyme
UTERU20055930//Helper component proteinase
UTERU20064000//Peptidase family M1
UTERU20065930//Hr1 repeat motif// PDZ domain (Also known as DHR or GLGF).
UTERU20115740//KRAB box
UTERU20116570//Villin headpiece domain
UTERU20119060//ADP-ribosyl cyclase
UTERU20144640//Choloylglycine hydrolase
UTERU20145480//KRAB box// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// wnt family of developmental signaling proteins// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type
UTERU20146310//Diacylglycerol kinase accessory domain (pres
UTERU20161570//7 transmembrane receptor (rhodopsin family)
UTERU20168220//Cell division protein// Integrase Zinc binding domain// GTPase of unknown function
UTERU20176130//Putative GTP-ase activating protein for Arf
UTERU20176320//SMC domain N terminal domain// Tropomyosins
UTERU20178100//Aminotransferases class-III pyridoxal-pho
UTERU20179880//TPR Domain// TPR Domain// TPR Domain// TPR Domain
UTERU20183640//Immunoglobulin domain
UTERU20185230//DUP family of yeast membrane proteins
EXAMPLE 6 Functional Categorization Based on the Full-Length Nucleotide SequencesThe functional prediction and categorization of the proteins encoded by the clones were carried out based on the result of homology search of the databases of GenBank, Swiss-Prot, UniGene and nr (see the Homology Search Result Data) for the full-length nucleotide sequences and the result of domain search of the amino acid sequences deduced from the full-length nucleotide sequences (see Example 5).
The clone predicted to belong to the category of secretory protein/membrane protein means a clone having hit data with some annotation, such as growth factor, cytokine, hormone, signal, transmembrane, membrane, extracellular matrix, receptor, G-protein coupled receptor, ionic channel, voltage-gated channel, calcium channel, cell adhesion, collagen, connective tissue, etc., suggesting that it is a secretory or membrane protein, or means a clone in which the presence of nucleotide sequence encoding a signal sequence or transmembrane domain was suggested by the results of PSORT and SOSUI analyses for deduced ORF.
The clone predicted to belong to the category of glycoprotein-related protein means a clone having hit data with some annotation, such as glycoprotein, suggesting that the clone encodes a glycoprotein-related protein.
The clone predicted to belong to the category of signal transduction-related protein means a clone having hit data with some annotation, such as serine/threonine-protein kinase, tyrosine-protein kinase, SH3 domain, SH2 domain, etc., suggesting that the clone encodes a signal transduction-related protein.
The clone predicted to belong to the category of transcription-related protein means a clone having hit data with some annotation, such as transcription regulation, zinc finger, homeobox, etc., suggesting that the clone encodes a transcription-related protein.
The clone predicted to belong to the category of disease-related protein means a clone having hit data with some annotation, such as disease mutation, syndrome, etc., suggesting that the clone encodes a disease-related protein, or means a clone whose full-length nucleotide sequence has hit data for Swiss-Prot, GenBank, or UniGene, where the hit data corresponds to genes or proteins which have been deposited in the Online Mendelian Inheritance in Man (OMIM) (http://www.ncbi.nlm.nih.gov/Omim/), which is the human gene and disease database.
The clone predicted to belong to the category of enzyme and/or metabolism-related protein means a clone having hit data with some annotation, such as metabolism, oxidoreductase, E. C. No. (Enzyme commission number), etc., suggesting that the clone encodes an enzyme and/or metabolism-related protein.
The clone predicted to belong to the category of cell division and/or cell proliferation-related protein means a clone having hit data with some annotation, such as cell division, cell cycle, mitosis, chromosomal protein, cell growth, apoptosis, etc., suggesting that the clone encodes a cell division and/or cell proliferation-related protein.
The clone predicted to belong to the category of cytoskeleton-related protein means a clone having hit data with some annotation, such as structural protein, cytoskeleton, actin-binding, microtubles, etc., suggesting that the clone encodes a cytoskeleton-related protein.
The clone which is predicted to belong to the category of nuclear protein and/or RNA synthesis-related protein means a clone having hit data with some annotation, such as nuclear protein, RNA splicing, RNA processing, RNA helicase, polyadenylation, etc., suggesting that the clone encodes a nuclear protein and/or RNA synthesis-related protein.
The clone predicted to belong to the category of protein synthesis and/or transport-related protein means a clone having hit data with some annotation, such as translation regulation, protein biosynthesis, amino-acid biosynthesis, ribosomal protein, protein transport, signal recognition particle, etc., suggesting that the clone encodes a protein synthesis and/or transport-related protein.
The clone predicted to belong to the category of cellular defense-related protein means a clone having hit data with some annotation, such as heat shock, DNA repair, DNA damage, etc., suggesting that the clone encodes a cellular defense-related protein.
The clone predicted to belong to the category of development and/or differentiation-related proteins means a clone having hit data with some annotation, such as developmental protein, etc., suggesting that the clone encodes a development and/or differentiation-related protein.
The clone predicted to belong to the category of DNA-binding and/or RNA-binding protein means a clone having hit data with some annotation, such as DNA-binding, RNA-binding, etc.
The clone predicted to belong to the category of ATP-binding and/or GTP-binding protein means a clone having hit data with some annotation, such as ATP-binding, GTP-binding, etc.
In this functional categorization, when a single clone corresponded to multiple categories of those shown above, the clone was assigned to the multiple categories. However, the function of a protein is not restricted to the functional category in this classification, and there is the possibility that other functions are newly assigned to the protein.
The clones predicted to belong to the category of secretory protein and/or membrane protein are the following 632 clones.
ADIPS10000640, ADRGL10001470, ADRGL20013520, ADRGL20018540, ADRGL20035850, ASTRO20001410, ASTRO20005330, ASTRO20033160, ASTRO20055750, ASTRO20058630, ASTRO20190390, BEAST20004540, BGGI110000240, BNGH420088500, BRACE20006400, BRACE20038000, BRACE20038470, BRACE20039040, BRACE20039540, BRACE20051380, BRACE20053630, BRACE20059370, BRACE20060550, BRACE20061050, BRACE20063630, BRACE20067430, BRACE20069090, BRACE20081720, BRACE20101700, BRACE20101710, BRACE20116110, BRACE20147800, BRACE20153680, BRACE20163350, BRACE20179340, BRACE20188470, BRACE20195100, BRACE20201570, BRACE20210140, BRACE20224480, BRACE20224500, BRACE20228480, BRACE20232840, BRACE20238000, BRACE20273890, BRACE20274080, BRALZ20013500, BRALZ20054710, BRALZ20064740, BRALZ20069760, BRALZ20073760, BRALZ20077930, BRAMY20000860, BRAMY20002770, BRAMY20025840, BRAMY20039260, BRAMY20060920, BRAMY20063970, BRAMY20111960, BRAMY20112800, BRAMY20124260, BRAMY20134140, BRAMY20135900, BRAMY20136210, BRAMY20144620, BRAMY20152110, BRAMY20174550, BRAMY20181220, BRAMY20195090, BRAMY20211390, BRAMY20211420, BRAMY20215230, BRAMY20218250, BRAMY20218670, BRAMY20229800, BRAMY20231720, BRAMY20247280, BRAMY20252180, BRAMY20273960, BRAMY20277170, BRAMY20284910, BRAMY20285160, BRAWH20015350, BRAWH20015890, BRAWH20016860, BRAWH20018730, BRAWH20030250, BRAWH20064050, BRAWH20110790, BRAWH20112940, BRAWH20117950, BRAWH20118230, BRAWH20121640, BRAWH20122580, BRAWH20132190, BRCAN20064010, BRCAN20071190, BRCAN20091560, BRCAN20103740, BRCAN20224720, BRCAN20273550, BRCAN20280360, BRCAN20285450, BRCOC10000870, BRCOC20004040, BRCOC20006370, BRCOC20041750, BRCOC20077690, BRCOC20078640, BRCOC20090520, BRCOC20101230, BRCOC20107300, BRCOC20114180, BRCOC20121720, BRCOC20134480, BRCOC20136750, BRHIP10001290, BRHIP20000870, BRHIP20003120, BRHIP20103090, BRHIP20111200, BRHIP20118380, BRHIP20118910, BRHIP20121410, BRHIP20135100, BRHIP20174040, BRHIP20179200, BRHIP20183690, BRHIP20191490, BRHIP20191770, BRHIP20198190, BRHIP20207430, BRHIP20208270, BRHIP20208590, BRHIP20217620, BRHIP20233090, BRHIP20234380, BRHIP20238880, BRHIP20283030, BRHIP30004570, BRSSN20003120, BRSSN20043040, BRSSN20066110, BRSSN20120810, BRSSN20137020, BRSSN20142940, BRSSN20146100, BRSSN20151990, BRSSN20169050, BRSTN20002200, BRTHA20004740, BRTHA20046290, BRTHA20046420, COLON10001350, COLON20093370, CTONG10000100, CTONG10000940, CTONG10001650, CTONG20004690, CTONG20009770, CTONG20092570, CTONG20092580, CTONG20095340, CTONG20099380, CTONG20103480, CTONG20105080, CTONG20114740, CTONG20119200, CTONG20120770, CTONG20124730, CTONG20131490, CTONG20132220, CTONG20133480, CTONG20139340, CTONG20149950, CTONG20155400, CTONG20158660, CTONG20159530, CTONG20161850, CTONG20267700, D3OST10001090, D3OST20036070, D3OST20038560, D3OST30002580, D6OST20005070, D9OST20002780, D9OST20015470, D9OST20023970, D9OST20026730, D9OST20035940, D9OST20040180, DFNES20025880, FCBBF10000240, FCBBF10000380, FCBBF10001150, FCBBF10001210, FCBBF10001550, FCBBF10002430, FCBBF10002700, FCBBF10003220, FCBBF10003760, FCBBF10005460, FCBBF10005740, FCBBF20032970, FCBBF20042560, FCBBF20049300, FCBBF20051220, FCBBF30008470, FCBBF30024750, FCBBF30078290, FCBBF30083620, FCBBF30086440, FCBBF30090690, FCBBF30095260, FCBBF30123470, FCBBF30172550, FCBBF30175310, FCBBF30190850, FCBBF30215060, FCBBF30238870, FCBBF30251420, FCBBF30279030, FEBRA20002100, FEBRA20004620, FEBRA20009090, FEBRA20029860, FEBRA20037260, FEBRA20080810, FEBRA20086620, FEBRA20092890, FEBRA20093520, FEBRA20095880, FEBRA20111460, FEBRA20125070, FEBRA20130190, FEBRA20140100, FEBRA20145780, FEBRA20211710, FEBRA20223220, FEBRA20229630, FEBRA20235500, HCHON20000380, HCHON20008180, HCHON20015980, HCHON20016040, HCHON20016650, HCHON20040020, HCHON20064590, HCHON20067700, HCHON20068710, HCHON20086720, HCHON20100740, HEART20003060, HEART20005410, HEART20034320, HEART20049410, HEART20049800, HEART20072310, HHDPC20001040, HHDPC20014320, HHDPC20034720, HHDPC20068620, HHDPC20084140, HHDPC20091780, HHDPC20092080, HLUNG10000550, KIDNE20003940, KIDNE20007770, KIDNE20011400, KIDNE20021910, KIDNE20022620, KIDNE20100070, KIDNE20101510, KIDNE20109730, KIDNE20121880, KIDNE20125630, KIDNE20126010, KIDNE20126130, KIDNE20127450, KIDNE20130450, KIDNE20131580, KIDNE20137340, KIDNE20181660, LIVER20035110, LIVER20045650, LIVER20055200, LIVER20062510, LIVER20064690, LIVER20075680, LIVER20087060, LIVER20091180, MESAN10001260, MESAN20014500, MESAN20027090, MESAN20038510, MESAN20089360, MESAN20103120, MESAN20115970, MESAN20125860, MESAN20139360, MESAN20152770, MESAN20153910, MESAN20174170, NOVAR20000380, NT2NE20010050, NT2NE20021620, NT2NE20068130, NT2NE20118960, NT2NE20124480, NT2NE20131890, NT2NE20132170, NT2NE20155110, NT2NE20156260, NT2NE20157470, NT2NE20159740, NT2NE20177520, NT2NE20183760, NT2RI20003480, NT2RI20023910, NT2RI20025400, NT2RI20028470, NT2RI20040930, NT2RI20054050, NT2RI20056700, NT2RI20076290, NT2RI20086220, NT2RI20091940, NT2RI20244600, NT2RP70072690, NT2RP70081610, NT2RP70122910, NT2RP70125160, NT2RP70133740, NT2RP70134990, NT2RP70137290, NT2RP70179710, NT2RP70188020, NT2RP70192730, NT2RP70198350, NTONG20028070, NTONG20029700, NTONG20048060, NTONG20049910, NTONG20051530, NTONG20061870, NTONG20063010, NTONG20067830, NTONG20076930, NTONG20092330, OCBBF10001750, OCBBF20013890, OCBBF20019830, OCBBF20023570, OCBBF20026630, OCBBF20046690, OCBBF20050770, OCBBF20059560, OCBBF20063320, OCBBF20071210, OCBBF20072320, OCBBF20080050, OCBBF20086400, OCBBF20086910, OCBBF20087010, OCBBF20088140, OCBBF20091150, OCBBF20107090, OCBBF20108630, OCBBF20116850, OCBBF20120390, OCBBF20122620, OCBBF20130910, OCBBF20132850, OCBBF20145760, OCBBF20155060, OCBBF20178880, OCBBF20180120, OCBBF20180840, OCBBF20188730, PANCR10000910, PEBLM10000710, PEBLM20024320, PEBLM20040150, PEBLM20074370, PEBLM20075980, PERIC20004220, PLACE60086400, PLACE60121080, PLACE60161600, PLACE60177140, PROST20005050, PROST20050670, PROST20107820, PROST20116600, PROST20120160, PROST20127800, PROST20146010, PROST20164440, PROST20169800, PROST20170980, PROST20175290, PUAEN20003740, PUAEN20030180, SALGL10001710, SKMUS20003610, SKMUS20007800, SKMUS20011640, SKMUS20020840, SKMUS20028210, SKMUS20028400, SKMUS20077400, SKNSH20028660, SKNSH20031740, SKNSH20051940, SKNSH20063040, SMINT20009840, SMINT20011990, SMINT20022020, SMINT20029760, SMINT20040860, SMINT20050750, SMINT20053870, SMINT20073650, SMINT20095050, SMINT20100680, SMINT20105330, SMINT20106720, SMINT20121950, SMINT20127930, SMINT20144430, SMINT201448.90, SMINT20153260, SMINT20154540, SMINT20157450, SMINT20173240, SMINT20178550, SMINT20191420, SMINT20192000, SPLEN20003070, SPLEN20021660, SPLEN20029310, SPLEN20079510, SPLEN20095810, SPLEN20097330, SPLEN20118300, SPLEN20141360, SPLEN20141990, SPLEN20142100, SPLEN20144520, SPLEN20152760, SPLEN20157880, SPLEN20165310, SPLEN20167200, SPLEN20169220, SPLEN20169720, SPLEN20171890, SPLEN20172120, SPLEN20179810, SPLEN20186430, SPLEN20211570, SPLEN20211940, SPLEN20213830, SPLEN20273950, SPLEN20292950, SPLEN20293800, SPLEN20304950, SPLEN20329240, STOMA20005390, STOMA20005670, STOMA20006400, STOMA20006780, STOMA20008880, STOMA20051200, STOMA20056640, STOMA20056670, STOMA20062130, STOMA20077450, STOMA20080500, STOMA20088380, STOMA20092530, SYNOV20001520, SYNOV20001730, SYNOV20002510, SYNOV20002790, SYNOV20002970, SYNOV20004260, SYNOV20007000, SYNOV20008240, SYNOV20009230, SYNOV20010880, SYNOV20011110, SYNOV20013000, SYNOV20013560, SYNOV20013900, SYNOV30001840, TBAES20003150, TESOP20004000, TESOP20005690, TESTI20001720, TESTI20036380, TESTI20037560, TESTI20094120, TESTI20110280, TESTI20123080, TESTI20123560, TESTI20128350, TESTI20136100, TESTI20136710, TESTI20143390, TESTI20148000, TESTI20164100, TESTI20193360, TESTI20209810, TESTI20209990, TESTI20211220, TESTI20214250, TESTI20216370, TESTI20230250, TESTI20231940, TESTI20242990, TESTI20244190, TESTI20254220, TESTI20254860, TESTI20265970, TESTI20271850, TESTI20272960, TESTI20284880, TESTI20291310, TESTI20291960, TESTI20303220, TESTI20303360, TESTI20303420, TESTI20307700, TESTI20309170, TESTI20314180, TESTI20316870, TESTI20333000, TESTI20335200, TESTI20347180, TESTI20347300, TESTI20352620, TESTI20357960, TESTI20370810, TESTI20373820, TESTI20383880, TESTI20390260, TESTI20390410, TESTI20391770, TESTI20393530, TESTI20396130, TESTI20397760, TESTI20401020, TESTI20401280, TESTI20415170, TESTI20421490, TESTI20422640, TESTI20441940, TESTI20442760, TESTI20444130, TESTI20444180, TESTI20449200, TESTI20463520, TESTI20463580, TESTI20465350, THYMU10005360, THYMU10005540, THYMU20027560, THYMU20032870, THYMU20039810, THYMU20066100, THYMU20081490, THYMU20100410, THYMU20106710, THYMU20111830, THYMU20141670, THYMU20147770, THYMU20159430, THYMU20161640, THYMU20162190, THYMU20173980, THYMU20194420, THYMU20208300, THYMU20216840, THYMU20222890, THYMU20229220, THYMU20241850, THYMU20277390, TKIDN20005210, TRACH20002870, TRACH20003590, TRACH20016210, TRACH20019960, TRACH20029540, TRACH20033230, TRACH20034840, TRACH20042920, TRACH20050040, TRACH20067620, TRACH20068660, TRACH20069180, TRACH20076740, TRACH20085400, TRACH20085830, TRACH20109650, TRACH20111130, TRACH20121380, TRACH20128110, TRACH20128230, TRACH20134950, TRACH20136710, TRACH20139820, TRACH20140820, TRACH20145440, TRACH20168350, TRACH20180840, TRACH20190240, UMVEN20000690, UTERU20030570, UTERU20040610, UTERU20046980, UTERU20055480, UTERU20064860, UTERU20076390, UTERU20094350, UTERU20135860, UTERU20144640, UTERU20158300, UTERU20158800, UTERU20161570, UTERU20178100, UTERU20183640, UTERU20186740
The clones predicted to belong to the category of glycoprotein-related protein are the following 128 clones.
ADIPS10000640, BRACE20059370, BRACE20163350, BRAMY20277170, BRAMY20285160, BRAWH20064050, BRAWH20112940, BRAWH20117950, BRAWH20118230, BRCAN20103740, BRCOC20004040, BRCOC20006370, BRHIP10001290, BRHIP20103090, BRHIP20283030, BRHIP30004570, BRSSN20003120, BRSSN20146100, BRTHA20046290, COLON10001350, CTONG20159530, D9OST20023970, D9OST20040180, FCBBF10001150, FCBBF20049300, FCBBF30024750, FCBBF30083620, FCBBF30190850, FCBBF30238870, FEBRA20086620, FEBRA20092890, HCHON20015980, HCHON20016040, HCHON20064590, HCHON20086720, HCHON20100740, HEART20003060, HHDPC20014320, HHDPC20068620, HHDPC20092080, KIDNE20003940, KIDNE20007770, KIDNE20101510, LIVER20064690, MESAN20125860, NT2NE20118960, NT2NE20157470, NT2NE20177520, NT2RI20003480, NT2RI20056700, NT2RP70192730, NTONG20051530, NTONG20076930, OCBBF20107090, OCBBF20108630, OCBBF20120390, OCBBF20145760, OCBBF20155060, PLACE60177140, SMINT20050750, SMINT20073650, SMINT20105330, SMINT20106720, SMINT20112730, SMINT20127930, SMINT20153260, SMINT20179740, SMINT20190170, SPLEN20021660, SPLEN20142100, SPLEN20157880, SPLEN20165310, SPLEN20179810, SPLEN20186430, STOMA20001830, STOMA20005390, STOMA20005670, STOMA20006400, STOMA20008880, STOMA20034770, STOMA20056640, STOMA20056670, STOMA20083610, STOMA20088380, STOMA20092530, SYNOV20001520, SYNOV20001730, SYNOV20002510, SYNOV20002790, SYNOV20002970, SYNOV20004260, SYNOV20007000, SYNOV20008240, SYNOV20009230, SYNOV20010880, SYNOV20011110, SYNOV20013000, SYNOV20013560, SYNOV20013900, TESOP20004000, TESTI20136100, TESTI20216370, TESTI20244190, TESTI20254860, TESTI20303220, TESTI20335200, TESTI20352620, TESTI20358980, TESTI20442760, TESTI20449200, TESTI20455090, THYMU10005360, THYMU10005540, THYMU20147770, THYMU20159430, THYMU20241850, TRACH20016210, TRACH20050040, TRACH20067620, TRACH20069180, TRACH20076740, TRACH20128230, UTERU20046980, UTERU20064860, UTERU20144640, UTERU20158800, UTERU20161570, UTERU20183640
The clones predicted to belong to the category of signal transduction-related protein are the following 84 clones.
ASTRO20108190, BRACE20115920, BRACE20154120, BRACE20177200, BRACE20237270, BRAMY20104640, BRAMY20242470, BRAMY20271400, BRAWH20016620, BRAWH20103290, BRAWH20149340, BRCOC20021550, BRCOC20091960, BRHIP20189980, BRHIP20218580, BRHIP20238600, BRSSN20038200, CD34C30004240, CTONG20118150, CTONG20127450, CTONG20200310, FCBBF30012350, FCBBF40001730, FEBRA10001880, FEBRA20004620, FEBRA20132740, FEBRA20144170, FEHRT20003250, HCHON20007510, HLUNG20033780, IMR3220002430, KIDNE20008010, KIDNE20102710, KIDNE20107620, NT2NE20080170, NT2NE20181650, NT2RP70027380, NT2RP70036880, NT2RP70063950, NT2RP70078420, NT2RP70159960, NTONG20046140, NTONG20056570, OCBBF20028050, OCBBF20053430, OCBBF20054760, OCBBF20124360, OCBBF20127140, OCBBF20149280, OCBBF20173980, PEBLM20013120, PEBLM20085760, PROST20161950, PUAEN20015260, PUAEN20015860, PUAEN20083140, SMINT20028820, SMINT20049090, SMINT20110660, SPLEN20011410, SPLEN20121750, SPLEN20170310, SPLEN20181810, SPLEN20222270, SPLEN20250170, SPLEN20283650, TESTI20035960, TESTI20288910, TESTI20305540, TESTI20326810, TESTI20369650, TESTI20392250, TESTI20416640, TESTI20432750, TESTI20467320, THYMU20169680, THYMU20172150, THYMU20201980, THYMU20202890, TKIDN20004640, TKIDN20047480, TRACH20057690, UMVEN10001860, UTERU20146310
The clones predicted to belong to the category of transcription-related protein are the following 144 clones.
3NB6920014590, ADIPS20004250, ASTRO20008010, ASTRO20168470, BLADE20003400, BLADE20003890, BRACE20060890, BRACE20068590, BRACE20257100, BRAMY20210400, BRAMY20260910, BRAMY20270730, BRAWH20028110, BRAWH20075700, BRAWH20096780, BRCAN20280210, BRCOC20144000, BRCOC20178270, BRHIP20005340, BRHIP20096170, BRHIP20119330, BRHIP20191860, BRHIP20195890, BRHIP20222280, BRSSN20039370, BRSSN20046790, BRSSN20176820, CTONG20050280, CTONG20075860, CTONG20085950, CTONG20091080, CTONG20092700, CTONG20121010, CTONG20124220, CTONG20133390, CTONG20133520, D9OST20033970, FCBBF10001710, FCBBF10004370, FCBBF20059090, FCBBF20068820, FCBBF30007680, FCBBF30010810, FCBBF30018550, FCBBF30025560, FCBBF30057290, FCBBF30083820, FCBBF30129630, FCBBF30240960, FCBBF30246230, FEBRA20018690, FEBRA20026110, FEBRA20034680, FEBRA20040530, FEBRA20082010, FEBRA20171380, FEBRA20195820, FEBRA20233770, HCHON20008320, HCHON20009560, HCHON20035130, HHDPC10000830, HHDPC20030490, HHDPC20031130, KIDNE20027250, KIDNE20027950, KIDNE20182690, LIVER20055440, NT2NE20010490, NT2NE20089970, NT2NE20142210, NT2NE20184900, NT2RP60000770, NT2RP70043480, NT2RP70063950, NT2RP70102350, NT2RP70157890, NTONG20070200, OCBBF10001850, OCBBF20020830, OCBBF20037440, OCBBF20046120, OCBBF20049300, OCBBF20054200, OCBBF20066390, OCBBF20071840, OCBBF20080410, OCBBF20108190, OCBBF20125530, OCBBF20148280, PEBLM20060360, PEBLM20078320, PERIC20003870, PROST10003220, PROST20047390, PROST20066880, PROST20185830, PROST20189770, PROST20191640, SKNSH20008190, SMINT20001760, SMINT20028820, SMINT20130320, SMINT20144800, SPLEN20026950, SPLEN20054290, SPLEN20079260, SPLEN20095410, SPLEN20117660, SPLEN20140800, SPLEN20147390, SPLEN20160450, SPLEN20162680, SPLEN20243830, SPLEN20250170, SPLEN20252190, SPLEN20267650, STOMA20032890, STOMA20063250, TESTI20039400, TESTI20041690, TESTI20067200, TESTI20088220, TESTI20130010, TESTI20156100, TESTI20230850, TESTI20318090, TESTI20320670, TESTI20378190, TESTI20385960, TESTI20409890, TESTI20420620, TESTI20432820, TESTI20456110, THYMU20247480, TRACH20079690, TRACH20154860, TRACH20163170, TRACH20164980, TRACH20184490, UTERU20099720, UTERU20116570, UTERU20145480, UTERU20176130
The clones predicted to belong to the category of disease-related protein are the following 387 clones.
ADIPS20004250, ADRGL10001470, ADRGL20011190, ADRGL20018300, ADRGL20035850, ADRGL20078100, ASTRO10001650, ASTRO20008010, ASTRO20027430, ASTRO20106150, ASTRO20108190, ASTRO20168470, BLADE20003400, BLADE20003890, BRACE20038480, BRACE20039540, BRACE20059370, BRACE20108130, BRACE20108880, BRACE20115920, BRACE20116460, BRACE20232840, BRACE20248260, BRACE20253330, BRACE20284100, BRALZ20013500, BRALZ20017430, BRALZ20018340, BRAMY20000520, BRAMY20025840, BRAMY20120910, BRAMY20134140, BRAMY20135900, BRAMY20162510, BRAMY20174550, BRAMY20210400, BRAMY20211390, BRAMY20242470, BRAMY20245300, BRAMY20266850, BRAMY20285160, BRAWH20016620, BRAWH20028110, BRAWH20064050, BRAWH20096780, BRAWH20110960, BRAWH20113430, BRAWH20114000, BRAWH20118230, BRAWH20121640, BRAWH20128270, BRAWH20137480, BRCAN20103740, BRCAN20224720, BRCAN20279700, BRCAN20280210, BRCAN20283190, BRCOC20001860, BRCOC20006370, BRCOC20027510, BRCOC20055420, BRCOC20099370, BRCOC20178270, BRCOC20178560, BRHIP20003120, BRHIP20005340, BRHIP20174040, BRHIP20176420, BRHIP20191490, BRHIP20191860, BRHIP20194940, BRHIP20195890, BRHIP20222280, BRHIP20249110, BRHIP20285930, BRHIP30004880, BRSSN20013420, BRSSN20038200, BRSSN20039370, BRSSN20046790, BRSSN20066110, BRSSN20101100, BRSSN20120810, BRSSN20187310, BRTHA20046290, CD34C30004240, COLON10001350, CTONG20004690, CTONG20052650, CTONG20099550, CTONG20124220, CTONG20125640, CTONG20128430, CTONG20131560, CTONG20133390, CTONG20153300, CTONG20153580, CTONG20158040, CTONG20159530, D6OST20003580, D9OST20023970, DFNES20001530, DFNES20037420, FCBBF10001210, FCBBF10001710, FCBBF10003770, FCBBF20059090, FCBBF20064520, FCBBF20068820, FCBBF30010810, FCBBF30024750, FCBBF30025560, FCBBF30039020, FCBBF30049550, FCBBF30057290, FCBBF30083620, FCBBF30129630, FCBBF30190850, FCBBF30238870, FCBBF30240960, FCBBF30243640, FCBBF30279030, FCBBF30281880, FCBBF40001730, FEBRA10001880, FEBRA20004620, FEBRA20010120, FEBRA20018690, FEBRA20082010, FEBRA20097310, FEBRA20130190, FEBRA20132740, FEBRA20144170, FEBRA20195820, FEBRA20223220, FEBRA20233770, FEBRA20235500, FEHRT20003250, HCHON10001760, HCHON20007380, HCHON20008320, HCHON20009560, HCHON20015230, HCHON20015980, HCHON20016040, HCHON20035130, HCHON20036420, HCHON20064590, HCHON20067700, HCHON20086720, HCHON20100740, HEART20003060, HEART20017730, HEART20025980, HEART20049410, HHDPC20014320, HHDPC20030490, HHDPC20084140, HHDPC20091140, HHDPC20091780, HHDPC20092080, HLUNG20033780, IMR3220002430, KIDNE20007770, KIDNE20020150, KIDNE20021680, KIDNE20022620, KIDNE20024830, KIDNE20027950, KIDNE20101370, KIDNE20101510, KIDNE20182690, LIVER20002160, LIVER20055200, LIVER20055440, LIVER20059810, LIVER20064690, MESAN20101140, MESAN20125860, MESAN20130220, MESAN20154010, MESAN20174170, NOVAR10000910, NT2NE20010490, NT2NE20118960, NT2NE20157470, NT2RI20040990, NT2RI20041880, NT2RI20048840, NT2RI20050960, NT2RI20240080, NT2RP60000770, NT2RP70027380, NT2RP70032610, NT2RP70037240, NT2RP70192730, NT2RP70198350, NTONG20013620, NTONG20015870, NTONG20028070, NTONG20067830, NTONG20070200, NTONG20090600, NTONG20092330, OCBBF20006770, OCBBF20037440, OCBBF20046120, OCBBF20049300, OCBBF20053490, OCBBF20053730, OCBBF20054760, OCBBF20071840, OCBBF20072240, OCBBF20078920, OCBBF20108430, OCBBF20108580, OCBBF20127140, OCBBF20129360, OCBBF20145760, OCBBF20153350, OCBBF20173980, OCBBF20178880, PEBLM10000710, PEBLM20013120, PERIC10000250, PLACE60060420, PLACE60177140, PROST20100460, PROST20159240, PROST20169800, PROST20176170, PUAEN20018820, PUAEN20030180, PUAEN20055020, PUAEN20083140, SKMUS20018230, SKMUS20018500, SKMUS20021530, SKMUS20024750, SKMUS20029200, SKMUS20048970, SKMUS20049030, SKNSH20008190, SKNSH20089400, SMINT20001760, SMINT20026890, SMINT20028820, SMINT20050750, SMINT20073650, SMINT20105330, SMINT20112730, SMINT20121220, SMINT20127350, SMINT20127930, SMINT20136130, SMINT20138900, SMINT20153260, SMINT20155180, SMINT20179740, SMINT20190170, SMINT20191420, SPLEN20006070, SPLEN20011410, SPLEN20026950, SPLEN20027440, SPLEN20039240, SPLEN20079260, SPLEN20095410, SPLEN20146450, SPLEN20147390, SPLEN20151210, SPLEN20160450, SPLEN20170310, SPLEN20179180, SPLEN20186430, SPLEN20212730, SPLEN20243830, SPLEN20245300, SPLEN20250390, SPLEN20252190, SPLEN20267650, SPLEN20305620, STOMA20001830, STOMA20005390, STOMA20008880, STOMA20010250, STOMA20034770, STOMA20046680, STOMA20056670, STOMA20064470, STOMA20077450, STOMA20080500, STOMA20083610, STOMA20088380, SYNOV20001520, SYNOV20001730, SYNOV2.0002790, SYNOV20002970, SYNOV20007000, SYNOV20008240, SYNOV20009230, SYNOV20010880, SYNOV20011110, TBAES20003770, TESOP20004000, TESOP20005270, TESTI20031270, TESTI20036380, TESTI20044310, TESTI20067200, TESTI20116830, TESTI20121550, TESTI20156100, TESTI20168480, TESTI20208400, TESTI20215990, TESTI20231940, TESTI20234360, TESTI20237520, TESTI20238610, TESTI20239510, TESTI20249990, TESTI20266740, TESTI20316870, TESTI20318090, TESTI20335050, TESTI20335200, TESTI20343570, TESTI20352620, TESTI20368330, TESTI20369650, TESTI20385960, TESTI20392250, TESTI20400940, TESTI20404240, TESTI20420620, TESTI20436560, TESTI20438570, TESTI20441940, TESTI20442760, TESTI20443090, TESTI20449200, TESTI20455090, TESTI20455620, TESTI20456110, TESTI20463580, TESTI20465350, TESTI20465690, TESTI20467210, THYMU20122730, THYMU20126900, THYMU20130890, THYMU20159430, THYMU20169680, THYMU20172150, THYMU20180280, THYMU20193640, THYMU20209590, THYMU20232090, THYMU20247480, TKIDN10000010, TKIDN20004640, TKIDN20047480, TRACH20016210, TRACH20019960, TRACH20050040, TRACH20057690, TRACH20067620, TRACH20077540, TRACH20079690, TRACH20096610, TRACH20105870, TRACH20121380, TRACH20154860, TRACH20162860, TRACH20163170, TRACH20164980, TRACH20190240, TSTOM20005690, TUTER20002830, UTERU20030570, UTERU20116570, UTERU20144640, UTERU20151980, UTERU20158800, UTERU20183640, UTERU20185230
In particular, hit data of the following 386 clones for Swiss-Prot, or GenBank, UniGene, or nr corresponded to genes or proteins which had been deposited in the Online Mendelian Inheritance in Man (OMIM), which is the human gene and disease database, (the OMIM Number is shown in the parenthesis after the Clone Name).
ADIPS20004250 (601505), ADRGL10001470 (202010;103900), ADRGL20011190 (182790), ADRGL20018300 (600025), ADRGL20035850 (202110), ADRGL20078100 (103270), ASTRO10001650 (126660), ASTRO20008010 (603899), ASTRO20027430 (179555), ASTRO20106150 (602537), ASTRO20108190 (191092), ASTRO20168470 (604077), BLADE20003400 (601276), BLADE20003890 (604077), BRACE20038480 (601504), BRACE20039540 (600169), BRACE20059370 (130500;266140), BRACE20108130 (605413), BRACE20108880 (603758), BRACE20115920 (300023),
BRACE20116460 (603150), BRACE20232840 (601213), BRACE20248260 (600813), BRACE20253330 (604990), BRACE20284100 (602415), BRALZ20013500 (602470), BRALZ20017430 (600658), BRALZ20018340 (600547), BRAMY20000520 (164020), BRAMY20025840 (602327), BRAMY20120910 (600188), BRAMY20134140 (603931), BRAMY20135900 (601342), BRAMY20162510 (300098), BRAMY20174550 (605464), BRAMY20210400 (603809), BRAMY20211390 (602212), BRAMY20242470 (605000), BRAMY20245300 (605367), BRAMY20266850 (605609), BRAMY20285160 (120700), BRAWH20016620 (605762), BRAWH20028110 (602330), BRAWH20064050 (135820), BRAWH20096780 (602277), BRAWH20110960 (603481), BRAWH20113430 (602649), BRAWH20114000 (138130), BRAWH20118230 (112267), BRAWH20121640 (604437), BRAWH20128270 (601997), BRAWH20137480 (602330), BRCAN20103740 (602566), BRCAN20224720 (600923;176200), BRCAN20279700 (604205), BRCAN20280210 (194538), BRCAN20283190 (602118), BRCOC20001860 (604346), BRCOC20006370 (603784), BRCOC20027510 (179555), BRCOC20055420 (603801), BRCOC20099370 (606045), BRCOC20178270 (194558), BRCOC20178560 (602567), BRHIP20003120 (604249), BRHIP20005340 (147586), BRHIP20174040 (602658), BRHIP20176420 (164020), BRHIP20191490 (600009), BRHIP20191860 (602272), BRHIP20194940 (604696), BRHIP20195890 (602211), BRHIP20222280 (603899), BRHIP20249110 (142600), BRHIP20285930 (602626), BRHIP30004880 (188840), BRSSN20013420 (300272), BRSSN20038200 (602306), BRSSN20039370 (194531), BRSSN20046790 (604077), BRSSN20066110 (605248), BRSSN20101100 (600188), BRSSN20120810 (142440), BRSSN20187310 (182900), BRTHA20046290 (602644), COLON10001350 (146900), CTONG20004690 (600019), CTONG20052650 (603871), CTONG20099550 (190370), CTONG20124220 (184756), CTONG20125640 (180510), CTONG20128430 (601797), CTONG20131560 (103390), CTONG20133390 (604077), CTONG20153300 (604334), CTONG20153580 (605652), CTONG20158040 (602862), CTONG20159530 (600395), D6OST20003580 (602443), D9OST20023970 (601525), DFNES20001530 (164500), DFNES20037420 (139259), FCBBF10001210 (602461), FCBBF10001710 (194558), FCBBF10003770 (604597), FCBBF20059090 (194542), FCBBF20064520 (164020), FCBBF20068820 (194558), FCBBF30010810 (603899), FCBBF30024750 (603706), FCBBF30025560 (600494), FCBBF30039020 (602835), FCBBF30049550 (106410), FCBBF30057290 (194556), FCBBF30083620 (300022), FCBBF30129630 (603899), FCBBF30190850 (131210), FCBBF30238870 (602320), FCBBF30240960 (604078), FCBBF30243640 (601961), FCBBF30279030 (605208), FCBBF30281880 (602517), FCBBF40001730 (176981), FEBRA10001880 (605451), FEBRA20004620 (600278), FEBRA20010120 (600368), FEBRA20018690 (194542), FEBRA20082010 (602187), FEBRA20097310 (602895), FEBRA20130190 (605863), FEBRA20132740 (602654), FEBRA20144170 (601685), FEBRA20195820 (604074), FEBRA20223220 (604633), FEBRA20233770 (603347), FEBRA20235500 (312090), FEHRT20003250 (600286), HCHON10001760 (605315), HCHON20007380 (600833), HCHON20008320 (604077), HCHON20009560 (194548), HCHON20015230 (604646), HCHON20015980 (604789), HCHON20016040 (146732), HCHON20035130 (194529), HCHON20036420 (603434), HCHON20064590 (103950), HCHON20067700 (603054), HCHON20086720 (146732), HCHON20100740 (602281), HEART20003060 (109480), HEART20017730 (106410), HEART20025980 (602127), HEART20049410 (603777), HHDPC20014320 (602714), HHDPC20030490 (603795), HHDPC20084140 (605184), HHDPC20091140 (603054), HHDPC20091780 (227400), HHDPC20092080 (146732), HLUNG20033780 (600888), IMR3220002430 (602923), KIDNE20007770 (114890), KIDNE20020150 (140550;603012), KIDNE20021680 (601609), KIDNE20022620 (603590), KIDNE20024830 (604205), KIDNE20027950 (194531), KIDNE20101370 (602580), KIDNE20101510 (191845), KIDNE20182690 (605226), LIVER20002160 (600816), LIVER20055200 (604814), LIVER20055440 (605277), LIVER20059810 (230350), LIVER20064690 (601841), MESAN20101140 (602567), MESAN20125860 (155750), MESAN20130220 (603778), MESAN20154010 (180480), MESAN20174170 (602516), NOVAR10000910 (159350), NT2NE20010490 (603899), NT2NE20118960 (180490), NT2NE20157470 (217000), NT2RI20040990 (106410), NT2RI20041880 (160775), NT2RI20048840 (139360), NT2RI20050960 (606103), NT2RI20240080 (603419), NT2RP60000770 (603044), NT2RP70027380 (118423), NT2RP70032610 (172430), NT2RP70037240 (604108), NT2RP70192730 (278000), NT2RP70198350 (300043), NTONG20013620 (604125), NTONG20015870 (123940), NTONG20028070 (602369), NTONG20067830 (182900), NTONG20070200 (194558), NTONG20090600 (313440), NTONG20092330 (153700), OCBBF20006770 (154500), OCBBF20037440 (602290), OCBBF20046120 (601262), OCBBF20049300 (602277), OCBBF20053490 (154550;602579), OCBBF20053730 (603604), OCBBF20054760 (603453), OCBBF20071840 (604077), OCBBF20072240 (604331), OCBBF20078920 (602120), OCBBF20108430 (139360), OCBBF20108580 (300103), OCBBF20127140 (139380), OCBBF20129360 (602142), OCBBF20145760 (600395), OCBBF20153350 (601935), OCBBF20173980 (603524), OCBBF20178880 (601617), PEBLM10000710 (601007), PEBLM20013120 (602288), PERIC10000250 (603582), PLACE60060420 (180469), PLACE60177140 (600022), PROST20100460 (158374), PROST20159240 (606019), PROST20169800 (604426), PROST20176170 (605903), PUAEN20018820 (164740), PUAEN20030180 (603263), PUAEN20055020 (604677), PUAEN20083140 (604762), SKMUS20018230 (603768), SKMUS20018500 (601402), SKMUS20021530 (606045), SKMUS20024750 (179555), SKMUS20029200 (605758), SKMUS20048970 (102610), SKMUS20049030 (161650), SKNSH20008190 (604075), SKNSH20089400 (603070), SMINT20001760 (194558), SMINT20026890 (602127), SMINT20028820 (604719), SMINT20050750 (182120), SMINT20073650 (146900), SMINT20105330 (230500;230600;230650;253010), SMINT20112730 (146900), SMINT20121220 (160776), SMINT20127350 (180740), SMINT20127930 (146900), SMINT20136130 (147220), SMINT20138900 (125660;601419), SMINT20153260 (602201), SMINT20155180 (603004), SMINT20179740 (147020), SMINT20190170 (146900), SMINT20191420 (102770),
SPLEN20006070 (182900), SPLEN20011410 (602732), SPLEN20026950 (600014), SPLEN20027440 (106410), SPLEN20039240 (140550;603012), SPLEN20079260 (604074), SPLEN20095410 (602277), SPLEN20146450 (602861), SPLEN20147390 (604078), SPLEN20151210 (600267), SPLEN20160450 (604375), SPLEN20170310 (605216), SPLEN20179180 (605890), SPLEN20186430 (600052), SPLEN20212730 (114230), SPLEN20243830 (601796), SPLEN20245300 (606004), SPLEN20250390 (114220), SPLEN20252190 (604077), SPLEN20267650 (602277), SPLEN20305620 (126064), STOMA20001830 (146900), STOMA20005390 (146900), STOMA20008880 (601652;137750), STOMA20010250 (605786), STOMA20034770 (146900), STOMA20046680 (164772), STOMA20056670 (146900), STOMA20064470 (173320), STOMA20077450 (314370), STOMA20080500 (605414), STOMA20083610 (146900), STOMA20088380 (146900), SYNOV20001520 (147200), SYNOV20001730 (147120), SYNOV20002790 (147120), SYNOV20002970 (147120), SYNOV20007000 (147120), SYNOV20008240 (147120), SYNOV20009230 (146900), SYNOV20010880 (147120), SYNOV20011110 (147120), TBAES20003770 (118990), TESOP20004000 (116810), TESOP20005270 (600641), TESTI20031270 (191161), TESTI20036380 (126650;214700), TESTI20044310 (179555), TESTI20067200 (176312), TESTI20116830 (603142), TESTI20121550 (600862), TESTI20156100 (602253), TESTI20168480 (188840), TESTI20208400 (164031), TESTI20215990 (605652), TESTI20231940 (604200), TESTI20234360 (601052), TESTI20237520 (604212), TESTI20238610 (300097), TESTI20239510 (604334),
TESTI20249990 (164500), TESTI20266740 (605198), TESTI20316870 (605497), TESTI20318090 (604077), TESTI20335050 (605209), TESTI20335200 (109770), TESTI20343570 (190470), TESTI20352620 (176801;249900), TESTI20368330 (157680), TESTI20369650 (602052), TESTI20385960 (605970), TESTI20392250 (605541), TESTI20400940 (117143), TESTI20404240 (602725), TESTI20420620 (602955), TESTI20436560 (150330), TESTI20438570 (603577), TESTI20441940 (604119), TESTI20442760 (603491), TESTI20443090 (602954), TESTI20449200 (604101),
TESTI20455090 (148070), TESTI20455620 (140560), TESTI20456110 (109092), TESTI20463580 (603486), TESTI20465350 (123830), TESTI20465690 (605468), TESTI20467210 (600833), THYMU20122730 (604700), THYMU20126900 (603370), THYMU20130890 (603675), THYMU20159430 (146900), THYMU20169680 (601441), THYMU20172150 (605000), THYMU20180280 (600549), THYMU20193640 (603083;164021), THYMU20209590 (602378), THYMU20232090 (601717), THYMU20247480 (604077), TKIDN10000010 (605034), TKIDN20004640 (137028), TKIDN20047480 (602399), TRACH20016210 (136836), TRACH20019960 (182310), TRACH20050040 (603784), TRACH20057690 (164731), TRACH20067620 (600429;110800), TRACH20077540 (300080), TRACH20079690 (604078), TRACH20096610 (150330), TRACH20105870 (600495), TRACH20121380 (602513), TRACH20154860 (180240), TRACH20162860 (603845), TRACH20163170 (601739), TRACH20164980 (602277), TRACH20190240 (604633), TSTOM20005690 (605775), TUTER20002830 (602719), UTERU20030570 (602023;241200), UTERU20116570 (602330),
UTERU20144640 (228000), UTERU20151980 (602038), UTERU20158800 (600738), UTERU20183640 (601281), UTERU20185230 (605333)
The clones predicted to belong to the category of enzyme and/or metabolism-related protein are the following 206 clones.
3NB6910001910, ADRGL10001470, ADRGL20035850, ADRGL20078100, ASTRO20105820, ASTRO20106150, ASTRO20130500, ASTRO20145760, BRACE20027620, BRACE20038000, BRACE20062640, BRACE20096200, BRACE20107530, BRACE20108130, BRACE20108880, BRACE20116460, BRACE20148240, BRACE20185680, BRACE20253160, BRALZ20017430, BRALZ20018340, BRAMY20104640, BRAMY20134140, BRAMY20153110, BRAMY20213100, BRAMY20252720, BRAWH20016620, BRAWH20105840, BRAWH20112940, BRAWH20114000, BRAWH20117950, BRAWH20125380, BRAWH20132190, BRAWH20171030, BRCAN20054490, BRCAN20224720, BRCAN20280360, BRCAN20283190, BRCAN20283380, BRCOC20001860, BRCOC20031250, BRCOC20055420, BRCOC20091960, BRCOC20144000, BRHIP10001290, BRHIP20005530, BRHIP20096850, BRHIP20103090, BRHIP20174040, BRHIP20249110, BRSSN20013420, BRSSN20015790, BRSSN20120810, BRSSN20146100, CTONG20095340, CTONG20106520, CTONG20118250, CTONG20127450, CTONG20140580, CTONG20153300, CTONG20158040, D3OST20006180, D6OST20003580, DFNES20031920, DFNES20071130, FCBBF10001820, FCBBF10003670, FCBBF30012350, FCBBF30012810, FCBBF30175310, FCBBF30243640, FEBRA10001880, FEBRA20007620, FEBRA20130190, FEBRA20144170, FEBRA20167390, FEBRA20196630, FEHRT20003250, HCHON10001760, HCHON20003220, HCHON20015350, HEART20034320, HEART20090000, HHDPC20014320, KIDNE20002520, KIDNE20008010, KIDNE20021680, KIDNE20022620, KIDNE20028390, KIDNE20028720, KIDNE20107620, LIVER20059810, MESAN20154010, NT2NE20118960, NT2NE20157470, NT2RI20005750, NT2RI20244600, NT2RI20273230, NT2RP70032610, NT2RP70045590, NT2RP70192730, NT2RP70195430, NTONG20009770, NTONG20013620, NTONG20046140, OCBBF20028650, OCBBF20030910, OCBBF20046690, OCBBF20050770, OCBBF20053430, OCBBF20053490, OCBBF20053730, OCBBF20054760, OCBBF20078920, OCBBF20124360, OCBBF20129360, OCBBF20178880, PEBLM20044520, PEBLM20052820, PEBLM20060490, PERIC10000250, PLACE50000660, PROST20083600, PROST20169800, PUAEN20015260, PUAEN20030180, SKMUS20018230, SMINT20028820, SMINT20049090, SMINT20102780, SMINT20105330, SMINT20106290, SMINT20110660, SMINT20152940, SMINT20191420, SMINT20191530, SPLEN20021660, SPLEN20026950, SPLEN20121750, SPLEN20145720, SPLEN20149240, SPLEN20150940, SPLEN20151210, SPLEN20173510, SPLEN20212730, SPLEN20250390, SPLEN20305620, STOMA20006860, STOMA20077450, TBAES20002550, TBAES20003150, TESOP20004000, TESOP20005270, TESTI20001000, TESTI20002720, TESTI20002780, TESTI20060400, TESTI20066670, TESTI20082330, TESTI20083200, TESTI20108720, TESTI20116830, TESTI20143390, TESTI20148000, TESTI20216370, TESTI20232140, TESTI20234360, TESTI20237520, TESTI20239510, TESTI20266740, TESTI20314180, TESTI20334410, TESTI20343570, TESTI20352620, TESTI20355020, TESTI20366910, TESTI20368330, TESTI20369650, TESTI20375340, TESTI20397760, TESTI20416640, TESTI20432750, TESTI20463580, TESTI20465350, TESTI20471410, TESTI20473830, THYMU20023380, THYMU20111830, THYMU20126900, THYMU20169680, THYMU20202890, TKIDN20004640, TKIDN20047480, TRACH20003590, TRACH20016210, TRACH20019960, TRACH20041830, TRACH20057690, TRACH20067620, TRACH20084720, TRACH20085830, TRACH20162860, UTERU20064860, UTERU20144640, UTERU20146310, UTERU20151980
The clones predicted to belong to the category of cytoskeleton-related protein are the following 75 clones.
ADRGL20011190, ADRGL20018300, ASTRO10001650, ASTRO20055750, BRACE20003070, BRACE20059370, BRACE20163350, BRAMY20121620, BRAMY20157820, BRAMY20242470, BRAWH20028110, BRAWH20137480, BRCAN20003460, BRCOC20008160, BRCOC20059510, BRHIP20115080, BRHIP20137230, BRHIP20167880, BRHIP20283030, BRHIP20285830, BRSSN20187310, CTONG10002770, CTONG20052900, CTONG20121580, FCBBF10001150, FCBBF30013770, FCBBF30015940, FCBBF30049550, FEBRA20024100, FEBRA20237640, HCHON20015980, HCHON20068410, HEART20017730, HEART20025980, HEART20061950, HEART20077670, HLUNG20016330, KIDNE20118580, MESAN20004570, NT2RI20040990, NT2RI20041880, NT2RP70037240, NT2RP70062230, NTONG20015870, NTONG20056570, NTONG20067830, NTONG20090600, OCBBF20107090, OCBBF20155060, PLACE60079250, PUAEN20040670, SKMUS20001980, SKMUS20016220, SKMUS20048970, SKMUS20049030, SMINT20024570, SMINT20026890, SMINT20121220, SMINT20138900, SPLEN20006070, SPLEN20027440, SPLEN20142100, TESTI20063830, TESTI20094230, TESTI20278400, TESTI20371030, TESTI20417300, TESTI20436560, TESTI20455090, THYMU20105190, THYMU20172150, THYMU20209590, TRACH20096610, UMVEN10001560, UTERU20116570
The clones predicted to belong to the category of nuclear protein and/or RNA synthesis-related protein are the following 65 clones.
BRACE20057190, BRACE20064880, BRACE20248260, BRACE20253160, BRAMY20000520, BRAMY20120910, BRAWH20113430, BRAWH20171030, BRCAN10001490, BRCAN20283190, BRCOC20037320, BRCOC20178560, BRHIP20106100, BRHIP20176420, BRHIP20243470, BRSSN20101100, CTONG20114290, CTONG20125540, CTONG20131560, CTONG20140580, DFNES20001530, FCBBF20064520, FEBRA20007620, FEBRA20010120, FEBRA20097310, FEBRA20144170, FEBRA20174410, FEBRA20215500, IMR3220002430, MESAN20101140, NT2RI20273230, OCBBF20028650, OCBBF20030910, OCBBF20078920, PROST20104000, PUAEN20018820, SKMUS20007010, SMINT20127350, SMINT20177360, SMINT20191530, SPLEN20008740, SPLEN20146450, STOMA20046680, TESTI20082330, TESTI20094470, TESTI20121550, TESTI20208400, TESTI20234360, TESTI20237520, TESTI20249990, TESTI20334410, TESTI20355020, TESTI20368330, TESTI20392760, TESTI20408970, TESTI20436560, TESTI20438570, TESTI20443090, THYMU20193640, THYMU20202890, THYMU20241210, TRACH20096610, TUTER20002830, UTERU20151980, UTERU20176320
The clones predicted to belong to the category of protein synthesis and/or transport-related protein are the following 62 clones.
3NB6910001910, ASTRO20106150, ASTRO20130500, ASTRO20141350, BRACE20038480, BRACE20052160, BRACE20057620, BRACE20106840, BRACE20172980, BRACE20192440, BRAWH20110960, BRCOC20037320, BRHIP20005530, BRSSN20120810, BRSTN20005360, CTONG20009770, CTONG20114290, CTONG20125640, CTONG20153300, D6OST20003580, DFNES20037420, FCBBF30012810, FEBRA20080810, HCHON20064590, HHDPC20014320, HHDPC20084140, HLUNG20017120, LIVER20064690, NT2NE20132170, NT2NE20157470, NT2RP70133740, NTONG20009770, NTONG20075220, NTONG20076930, OCBBF20030910, OCBBF20035930, OCBBF20153340, PLACE60060420, SMINT20152940, SPLEN20008740, SPLEN20103950, SPLEN20118300, SPLEN20212730, SPLEN20250390, STOMA20077450, TBAES20002550, TESOP20004000, TESTI20239510, TESTI20278400, TESTI20314180, TESTI20463580, THYMU20111830, THYMU20122730, THYMU20130890, THYMU20232090, TKIDN10000010, TRACH20084720, TRACH20105870, TRACH20139820, TRACH20149970, UTERU20120310, UTERU20188110
The clones predicted to belong to the category of cellular defense-related protein are the following 15 clones.
BRCOC20144000, CTONG20092680, KIDNE20020150, LIVER20002160, NT2RI20050960, NT2RP70045590, OCBBF20128120, PLACE60003480, SKNSH20089400, SMINT20106290, SPLEN20039240, TESTI20001000, TESTI20455620, TRACH20028030, UTERU20176320
The clones predicted to belong to the category of development and/or differentiation-related protein are the following 13 clones.
3NB6920014590, BRAMY20211390, CTONG20091080, CTONG20121010, FCBBF30024750, KIDNE20027250, NT2NE20142210, OCBBF20054200, PROST10003220, SKMUS20007010, SPLEN20179810, STOMA20063250, TESTI20291960
The clones predicted to belong to the category of DNA-binding and/or RNA-binding protein are the following 174 clones.
3NB6920014590, ADIPS20004250, ASTRO20008010, ASTRO20168470, BLADE20003400, BLADE20003890, BRACE20057620, BRACE20060890, BRACE20064880, BRACE20068590, BRACE20248260, BRACE20253160, BRAMY20000520, BRAMY20213100, BRAMY20260910, BRAMY20270730, BRAWH20028110, BRAWH20075700, BRAWH20096780, BRAWH20113430, BRCAN10001490, BRCAN20280210, BRCAN20283190, BRCOC20144000, BRCOC20178270, BRCOC20178560, BRHIP20005340, BRHIP20106100, BRHIP20119330, BRHIP20153600, BRHIP20176420, BRHIP20191860, BRHIP20195890, BRHIP20222280, BRSSN20039370, BRSSN20046790, BRSSN20176820, CTONG20050280, CTONG20075860, CTONG20085950, CTONG20091080, CTONG20092700, CTONG20121010, CTONG20124220, CTONG20125540, CTONG20133390, CTONG20133520, CTONG20140580, CTONG20156780, D9OST20033970, FCBBF10001710, FCBBF10004370, FCBBF20059090, FCBBF20064520, FCBBF20068820, FCBBF30007680, FCBBF30010810, FCBBF30018550, FCBBF30025560, FCBBF30057290, FCBBF30083820, FCBBF30129630, FCBBF30240960, FCBBF30246230, FEBRA20010120, FEBRA20018690, FEBRA20026110, FEBRA20034680, FEBRA20040530, FEBRA20082010, FEBRA20097310, FEBRA20171380, FEBRA20195820, FEBRA20196630, FEBRA20233770, HCHON20008320, HCHON20009560, HCHON20035130, HHDPC10000830, HHDPC20031130, KIDNE20017130, KIDNE20027250, KIDNE20027950, KIDNE20107390, KIDNE20182690, LIVER20055440, MESAN20101140, NT2NE20010490, NT2NE20089970, NT2NE20142210, NT2NE20184900, NT2RP60000770, NT2RP70044280, NT2RP70102350, NT2RP70157890, NTONG20070200, OCBBF10001850, OCBBF20020830, OCBBF20037440, OCBBF20046120, OCBBF20049300, OCBBF20066390, OCBBF20071840, OCBBF20078920, OCBBF20080410, OCBBF20108190, OCBBF20125530, OCBBF20148280, PEBLM20060360, PEBLM20060490, PEBLM20078320, PERIC10000250, PROST10003220, PROST20047390, PROST20066880, PROST20185830, PROST20189770, PROST20191640, PUAEN20018820, SKNSH20008190, SKNSH20089400, SMINT20001760, SMINT20127350, SMINT20144800, SMINT20177360, SMINT20191530, SPLEN20054290, SPLEN20079260, SPLEN20095410, SPLEN20140800, SPLEN20147390, SPLEN20160450, SPLEN20252190, SPLEN20267650, STOMA20010250, STOMA20032890, STOMA20046680, STOMA20063250, TESTI20039400, TESTI20067200, TESTI20088220, TESTI20094470, TESTI20121550, TESTI20130010, TESTI20156100, TESTI20204450, TESTI20230850, TESTI20237520, TESTI20266740, TESTI20318090, TESTI20320670, TESTI20334410, TESTI20355020, TESTI20378190, TESTI20385960, TESTI20432820, TESTI20443090, TESTI20456110, THYMU20193640, THYMU20241210, THYMU20247480, TRACH20079690, TRACH20105870, TRACH20139820, TRACH20154860, TRACH20163170, TRACH20164980, TRACH20184490, TUTER20002830, UTERU20099720, UTERU20116570, UTERU20145480, UTERU20176130, UTERU20185230
The clones predicted to belong to the category of ATP binding and/or GTP-binding protein are the following 68 clones.
3NB6910001910, BRACE20108130, BRACE20148240, BRAMY20134140, BRAMY20157820, BRAMY20174550, BRAWH20164460, BRCAN20003460, BRCAN20054490, BRCAN20283190, BRCOC20059510, BRCOC20144000, BRHIP20103090, BRHIP20115080, BRHIP20167880, BRSTN20005360, CD34C30004240, CTONG20095340, CTONG20121580, CTONG20200310, DFNES20037420, FCBBF20067810, FCBBF30012350, FCBBF30015940, FEBRA20007620, FEBRA20024100, FEBRA20144170, KIDNE20020150, KIDNE20028720, LIVER20002160, LIVER20087060, NT2RI20005750, NT2RI20041880, NT2RI20048840, NT2RI20273230, OCBBF20028650, OCBBF20046690, OCBBF20054760, OCBBF20108430, OCBBF20108630, SMINT20121220, SMINT20183530, SMINT20191530, SPLEN20026950, SPLEN20039240, SPLEN20099700, SPLEN20145720, SPLEN20179180, STOMA20006860, TESTI20035960, TESTI20355020, TESTI20397760, TESTI20400940, TESTI20417300, TESTI20443090, TESTI20455620, THYMU20105190, THYMU20202890, THYMU20209590, TKIDN20004640, TKIDN20047480, TRACH20005400, TRACH20019960, TRACH20057690, TRACH20084720, UTERU20168220, UTERU20176320, UTERU20185230
Among the clones other than the ones shown above, BRAMY20248490, FCBBF10002800, NTONG20092290, OCBBF20127040, SMINT20163960, THYMU20279750, TRACH20167220, are clones which were predicted to highly possibly belong to the category of secretory protein and/or membrane protein based on the result of domain search by Pfam.
FCBBF10002800, NTONG20092290, OCBBF20127040, SMINT20163960, TESTI20478850, THYMU20279750
The 6 clones shown above are clones which were predicted to highly possibly belong to the category of glycoprotein-related protein based on the result of domain search by Pfam.
BRACE20060720, BRACE20223330, BRALZ20058880, BRAMY20148130, BRAWH20101360, BRCAN20124080, BRHIP20253660, CTONG10000620, CTONG20014280, CTONG20124010, KIDNE20109890, MESAN20171520, OCBBF20109310, OCBBF20140640, PROST20079500, PUAEN20078980, SPLEN20077500, SPLEN20143180, TESTI20017950, TESTI20184620,
TESTI20208710, TESTI20211160, TESTI20226230, TESTI20234140, TESTI20258460, TESTI20275030
The 26 clones shown above are clones which were predicted to highly possibly belong to the category of signal transduction-related protein based on the result of domain search by Pfam.
ADRGL20048330, ASTRO20064750, ASTRO20084250, BRACE20151320, BRALZ20058880, BRHIP20207990, CTONG20093950, FCBBF30195640, FEBRA10001900, FEBRA20090290, FEBRA20214970, FEBRA20222040, KIDNE20109890, LIVER20087510, MESAN20029400, MESAN20031900, MESAN20035290, MESAN20136110, NT2NE20130190, PEBLM20060310, PERIC20004780, PROST20171280, PUAEN20078980, SMINT20115880, SPLEN20095550, TESTI20023510, TESTI20083940, TESTI20152460, TESTI20185650, TESTI20189410, TESTI20200710, TESTI20308600, TESTI20343070, TESTI20369690, TESTI20381040, UTERU20050690
The 36 clones shown above are clones which were predicted to highly possibly belong to the category of transcription-related protein based on the result of domain search by Pfam.
BGGI120006160, BRACE20053480, BRACE20190040, BRACE20223330, BRAWH20101360, BRAWH20185060, BRCOC20023230, BRHIP20252450, BRSSN20105870, BRSSN20117990, BRTHA20000570, CTONG20098440, CTONG20129960, CTONG20146300, CTONG20155180, FEBRA20025270, HEART20083640, KIDNE20009470, LIVER20035680, MESAN20029400, MESAN20031900, MESAN20186700, NOVAR10000150, NTONG20029480, OCBBF20079310, OCBBF20082830, PEBLM20042900, PLACE60136500, PLACE60136720, PROST20114390, SKNSH20020540, SMINT20013480, SMINT20174360, SPLEN20077500, SPLEN20119810, SPLEN20126190, SPLEN20174260, SPLEN20211220, TESTI20046750, TESTI20057750, TESTI20061110, TESTI20197940, TESTI20211160, TESTI20226230, TESTI20255820, TESTI20317600, TESTI20377230, THYMU20111180, THYMU20115850, THYMU20143270, THYMU20240710, UTERU20055330, UTERU20055930, UTERU20064000, UTERU20119060
The 55 clones shown above are clones which were predicted to highly possibly belong to the category of enzyme and/or metabolism-related protein based on the result of domain search by Pfam.
TESTI20127760, TESTI20392270
The 2 clones shown above are clones which were predicted to highly possibly belong to the category of cell division and/or cell proliferation-related protein based on the result of domain search by Pfam.
FCBBF30262510, MESAN20031900, NT2NE20125050, SMINT20068010, SPLEN20163560, STOMA20092890, TESTI20382750
The 7 clones shown above are clones which were predicted to highly possibly belong to the category of cytoskeleton-related protein based on the result of domain search by Pfam.
THYMU20118520
The clone shown above is clone which were predicted to highly possibly belong to the category of nuclear protein and/or RNA synthesis-related protein based on the result of domain search by Pfam.
BRACE20053480, BRACE20240740, KIDNE20009470, OCBBF20140890, SMINT20035690, UTERU20064000
The 6 clones shown above are clones which were predicted to highly possibly belong to the category of protein synthesis and/or transport-related protein based on the result of domain search by Pfam.
ADRGL20048330, ASTRO20064750, ASTRO20084250, BRACE20151320, BRACE20190040, BRACE20223330, BRALZ20058880, BRAMY20103570, BRCOC20023230, BRHIP20207990, BRTHA20000570, CTONG20093950, CTONG20129960, CTONG20146300, CTONG20155180, CTONG20160560, FCBBF10004120, FCBBF30195640, FEBRA10001900, FEBRA20090290, FEBRA20214970, FEBRA20222040, HCHON20008150, HEART20083640, KIDNE20109890, LIVER20035680, LIVER20087510, MESAN20029400, MESAN20031900, MESAN20035290, MESAN20136110, MESAN20186700, NT2NE20130190, NT2RI20025640, NTONG20029480, PEBLM20060310, PERIC20004780, PROST20114390, PROST20171280, PUAEN20078980, SMINT20115880, SPLEN20095550, SPLEN20119810, TESTI20023510, TESTI20057750, TESTI20083940, TESTI20152460, TESTI20185650, TESTI20189410, TESTI20200710, TESTI20308600, TESTI20343070, TESTI20369690, TESTI20381040, THYMU20115850, UTERU20050690, UTERU20055330
The 57 clones shown above are clones which were predicted to highly possibly belong to the category of DNA-binding and/or RNA-binding protein based on the result of domain search by Pfam.
PLACE60136720
The clone shown above is a clone which was predicted to highly possibly belong to the category of ATP-binding and/or GTP-binding protein based on the result of domain search by Pfam.
The 213 clones shown below are clones which were unassignable to any of the above-mentioned categories, but have been predicted to have some functions based on homology search for their full-length nucleotide sequences and motif search in their deduced ORFs. Clone Name, Definition in the result of homology search or Motif Name in the motif search, demarcated by a double slash mark (//), are shown below.
ADRGL20028570//Rattus norvegicus MG87 mRNA, complete cds.
ADRGL20061930//transposon-derived Buster1 transposase-like protein
ASTRO20012490//Eukaryotic initiation factor 1A
ASTRO20072210//PERIAXIN.
ASTRO20114370//Mus musculus SMAR1 mRNA, complete cds.
ASTRO20125520//dnaj protein [Schizosaccharomyces pombe]
ASTRO20143630//KH domain// Bacterial regulatory proteins, crp family
ASTRO20155290//TPR Domain// TPR Domain// TPR Domain
ASTRO20181690//oocyte-specific protein P100
BGGI110001930//UBX domain
BRACE20011070//Mus musculus F-box protein FBX15 mRNA, partial cds.
BRACE20039440//Drosophila melanogaster CHARYBDE (charybde) mRNA, complete cds.
BRACE20050900//TPR Domain// TPR Domain// TPR Domain// TPR Domain
BRACE20053280//Mus musculus Pdz-containing protein (Pdzx) mRNA, complete cds.
BRACE20057730//toxin sensitivity protein KTI12 homolog
BRACE20058580//Homo sapiens HCMOGT-1 mRNA for sperm antigen, complete cds.
BRACE20063780//NOL1/NOP2/sun family
BRACE20269200//Heat-labile enterotoxin alpha chain
BRACE20276430//Homo sapiens retinoblastoma-associated protein RAP140 mRNA, complete cds.
BRACE20286360//Alpha adaptin carboxyl-terminal domain
BRAMY10001300//Homo sapiens MAGE-E1b mRNA, complete cds.
BRAMY20045240//Flagellar L-ring protein
BRAMY20054880//Rattus norvegicus KPL2 (Kpl2) mRNA, complete cds.
BRAMY20167060//Collagen triple helix repeat (20 copies)
BRAMY20184670//Homo sapiens mRNA for ALEX1, complete cds.
BRAMY20217460//Homo sapiens cardiac voltage gated potassium channel modulatory subunit mRNA, complete cds, alternatively spliced.
BRAMY20240040//Homo sapiens suppressor of white apricot homolog 2 (SWAP2) mRNA, complete cds.
BRAMY20247110//Mus musculus semaphorin cytoplasmic domain-associated protein 3A (Semcap3) mRNA, complete cds.
BRAWH20004600//Mus musculus mRNA for NAKAP95, complete cds.
BRAWH20011710//cytoplasmic linker 2
BRAWH20012390//Trichomonas vaginalis mRNA for centrin (ce1 gene).
BRAWH20017010//Homo sapiens testes development-related NYD-SP22 mRNA, complete cds.
BRAWH20029630//Homo sapiens bet3 (BET3) mRNA, complete cds.
BRAWH20138660//Homo sapiens stonin 2 mRNA, complete cds.
BRCOC20008500//Human ras inhibitor mRNA, 3′ end.
BRCOC20026640//Gag P30 core shell protein
BRCOC20035130//14-3-3 PROTEIN EPSILON (MITOCHONDRIAL IMPORT STIMULATION FACTOR L SUBUNIT) (PROTEIN KINASE C INHIBITOR PROTEIN-1) (KCIP-1) (14-3-3E).
BRCOC20074760//CDC4-LIKE PROTEIN (FRAGMENT).
BRCOC20110100//Integrase core domain
BRCOC20176520//Rattus norvegicus mRNA for type II brain 4.1, complete cds.
BRHIP20001630//Protein of unknown function DUF16
BRHIP20132860//Homo sapiens rhophilin-like protein mRNA, complete cds.
BRHIP20143730//MYND finger
BRHIP20175420//Mus musculus partial mRNA for stretch responsive protein 278 (sr278 gene).
BRHIP20236950//Outer Capsid protein VP4 (Hemagglutinin)
BRSSN20014260//RIBONUCLEASE INHIBITOR.
BRSSN20018690//Homo sapiens NY-REN-25 antigen mRNA, partial cds.
BRSSN20021600//RING CANAL PROTEIN (KELCH PROTEIN).
BRSSN20177570//Phosducin
BRSTN10000830//Kelch motif// Kelch motif// Kelch motif// Kelch motif
CTONG10000220//Mus musculus cerebellar postnatal development protein-1 (Cpd1) mRNA, partial cds.
CTONG10000930//Armadillo/beta-catenin-like repeats
CTONG20027090//Glypican// Leucine Rich Repeat// Leucine Rich Repeat
CTONG20076130//ZINC FINGER PROTEIN 185 (LIM-DOMAIN PROTEIN ZNF185) (P1-A).
CTONG20096750//Disintegrin
CTONG20100240//Mus musculus radial spokehead-L protein (Rshl1) mRNA, complete cds.
CTONG20139860//Homo sapiens nasopharyngeal carcinoma susceptibility protein LZ16 mRNA, complete cds.
CTONG20143690//MYND finger
CTONG20149460//RING CANAL PROTEIN (KELCH PROTEIN).
CTONG20165050//Keratin, high sulfur B2 protein
CTONG20186320//RING CANAL PROTEIN (KELCH PROTEIN).
D3OST20013280//ARP2/3 COMPLEX 16 KDA SUBUNIT (P16-ARC).
D3OST20024360//Homo sapiens neuroendocrine differentiation factor mRNA, complete cds.
D9OST20031370//Homo sapiens mRNA for partial putative TCPTP-interacting protein (ptpip5 gene).
DFNES20014040//TRICHOHYALIN.
FCBBF10000630//Homo sapiens huntingtin interacting protein HYPB mRNA, partial cds.
FCBBF10000770//Homo sapiens REC8 mRNA, partial cds.
FCBBF10005060//CELLULAR RETINALDEHYDE-BINDING PROTEIN (CRALBP).
FCBBF10005500//Keratin, high sulfur B2 protein
FCBBF20014270//ACYL-COA-BINDING PROTEIN (ACBP) (DIAZEPAM BINDING INHIBITOR) (DBI) (ENDOZEPINE) (EP).
FCBBF20042170//Homo sapiens NIBAN mRNA, complete cds.
FCBBF30016320//SecA protein, amino terminal region
FCBBF30033050//Sm protein
FCBBF30054440//PLAT/LH2 domain
FCBBF30225660//Ank repeat// Ank repeat// Ank repeat// K+ channel tetramerisation domain// BTB/POZ domain
FCBBF30233680//G10 protein
FCBBF30246630//H. sapiens mRNA for ZYG homologue.
FCBBF30250730//TRICHOHYALIN.
FCBBF30252520//Homo sapiens bicaudal-D (BICD) mRNA, alternatively spliced, partial cds.
FCBBF30252800//NDRG1 PROTEIN (DIFFERENTIATION-RELATED GENE 1 PROTEIN) (DRG1) (REDUCING AGENTS AND TUNICAMYCIN-RESPONSIVE PROTEIN) (RTP) (NICKEL-SPECIFIC INDUCTION PROTEIN CAP43).
FCBBF30252850//Mus musculus peripherial benzodiazepine receptor associated protein (Pap7) mRNA, complete cds.
FCBBF30285280//Keratin, high sulfur B2 protein// Bacterial regulatory proteins, gntR family
FEBRA20088360//ALPHA-ADAPTIN C (CLATHRIN ASSEMBLY PROTEIN COMPLEX 2 ALPHA-C LARGE CHAIN) (100 KDA COATED VESICLE PROTEIN C) (PLASMA MEMBRANE ADAPTOR HA2/AP2 ADAPTIN ALPHA C SUBUNIT).
FEBRA20184330//Rattus norvegicus glutamate receptor interacting protein 2 (GRIP2) mRNA, complete cds.
FEBRA20192420//Cyclin-dependent kinase inhibitor// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif
FEBRA20196370//Cyclin-dependent kinase inhibitor// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif
FEBRA20225040//high-glucose-regulated protein 8
HCHON20001560//TRANSCRIPTION FACTOR-LIKE PROTEIN MORF4.
HCHON20003440//Homo sapiens cyclin-D binding Myb-like protein mRNA, complete cds.
HCHON20010990//TPR Domain
HCHON20059870//Hypothetical protein.
HHDPC20034390//Cereal trypsin/alpha-amylase inhibito
HHDPC20057420//Mus musculus proline-rich protein (Bprp) mRNA, complete cds.
HHDPC20064600//SUPPRESSOR PROTEIN SRP40.
HLUNG20023340//Mus musculus SLM-1 (Slm1) mRNA, complete cds.
KIDNE20007210//Xenopus laevis mRNA for RPA interacting protein alpha (ripalpha gene).
KIDNE20028830//K-box region
KIDNE20115080//Homo sapiens mRNA for hNBL4, complete cds.
KIDNE20124400//Homo sapiens mRNA for ALEX1, complete cds.
KIDNE20127100//Drosophila melanogaster Diablo (dbo) mRNA, complete cds.
KIDNE20127750//Homo sapiens partial mRNA for transport-secretion protein 2.1 (TTS-2.1 gene).
KIDNE20190740//Rattus norvegicus SNIP-b mRNA, complete cds.
LIVER10004790//EF hand
LIVER20011130//Homo sapiens F-box protein FBL9 mRNA, partial cds.
LIVER20064100//Ciona intestinalis mRNA for myoplasmin-C1, complete cds.
LIVER20080530//Drosophila melanogaster forked mRNA for large Forked protein, complete cds.
MAMGL10000830//Drosophila melanogaster L82B (L82) mRNA, complete cds.
MESAN20036460//Corticotropin-releasing factor family
MESAN20127350//myelin expression factor-3
MESAN20141920//Human ovarian cancer downregulated myosin heavy chain homolog (Doc1) mRNA, complete cds.
NT2NE20010400//Homo sapiens GLO13 mRNA, complete cds.
NT2NE20122430//GLYOXYLATE-INDUCED PROTEIN.
NT2NE20158600//erythroid ankyrin—Synechocystis sp. (strain PCC 6803).
NT2RI20001330//Homo sapiens KE03 protein mRNA, partial cds.
NT2RI20009870//lunatic fringe precursor [Mus musculus]
NT2RI20046080//recA bacterial DNA recombination proteins
NT2RI20091730//Molluscan rhodopsin C-terminal tail
NT2RP60000850//Bos taurus RPGR-interacting protein-1 (RPGRIP1) mRNA, complete cds.
NT2RP70080850//SPRY domain// Adenovirus EB1 55K protein/large t-an
NT2RP70105210//Myc amino-terminal region
NT2RP70188710//Yeast PIR proteins
NT2RP70194450//Bacterial regulatory proteins, crp family
NTONG20052650//Gallus gallus Xin mRNA, complete cds.
NTONG20064400//REPETIN.
NTONG20064840//Mus musculus slp1 mRNA for synaptotagmin-like protein 1, complete cds.
NTONG20066460//Mus musculus Gd mRNA for gasdermin, complete cds.
NTONG20067090//Mus musculus mRNA for Sh3yl1, complete cds.
NTONG20070340//collagen alpha 1(IX) chain
NTONG20083650//TPR Domain// TPR Domain// TPR Domain// PPR repeat// TPR Domain// PPR repeat// TPR Domain
NTONG20088620//Homo sapiens genethonin 3 mRNA, partial cds.
OCBBF10000540//Mus musculus ris (rjs) mRNA, complete cds.
OCBBF20019380//seizure related gene 6
OCBBF20022900//Homo sapiens SCHIP-1 mRNA, complete cds.
OCBBF20030280//Rattus norvegicus hfb2 mRNA, complete cds.
OCBBF20046470//ARFAPTIN 1.
OCBBF20049840//Homo sapiens mRNA for neurabin II protein.
OCBBF20068490//Mus musculus RW1 protein mRNA, complete cds.
OCBBF20071960//Coturnix coturnix japonica qMEF2D gene.
OCBBF20073540//Homo sapiens p30 DBC mRNA, complete cds.
OCBBF20121390//RING CANAL PROTEIN (KELCH PROTEIN).
OCBBF20127550//Outer Capsid protein VP4 (Hemagglutinin)
OCBBF20148730//RING CANAL PROTEIN (KELCH PROTEIN).
OCBBF20178150//Plasmodium falciparum ADA2-like protein gene, partial cds.
PEBLM10000240//Domain found in Dishevelled, Eg1-10, and Ple PROST20047270//CRAL/TR10 domain.
PROST20112970//Sterile alpha motif (SAM)/Pointed domain// SAM domain (Sterile alpha motif)
PUAEN10000850//Uncharacterized protein family UPF0025//Sec1 family
PUAEN20011880//Mus musculus mRNA for MIWI (piwi), complete cds.
PUAEN20051100//Mus musculus otogelin mRNA, complete cds.
PUAEN20108240//Drosophila melanogaster ankyrin 2 (Ank2) mRNA, complete cds.
SKMUS20084740//Syndecan domain
SMINT20053300//Homo sapiens hepatocellular carcinoma-associated antigen 59 mRNA, complete cds.
SMINT20071400//NOL1/NOP2/sun family
SMINT20101440//Human cisplatin resistance associated alpha protein (hCRA alpha) mRNA, complete cds.
SMINT20110330//pKID domain
SMINT20122910//Mus musculus StAR-related protein 1-4E mRNA, partial cds.
SMINT20131810//ENV polyprotein (coat polyprotein)
SMINT20168570//Homo sapiens mRNA for stabilin-1 (stab1 gene).
SPLEN20008390//Human placenta (Diff48) mRNA, complete cds.
SPLEN20084600//RING CANAL PROTEIN (KELCH PROTEIN).
SPLEN20128000//Xenopus laevis XMAB21 (Xmab-21) mRNA, complete cds.
SPLEN20149110//Dishevelled specific domain
SPLEN20171470//Keratin, high sulfur B2 protein
SPLEN20194050//Homo sapiens HOTTL protein mRNA, complete cds.
SPLEN20214580//Mus musculus mdg1-1 mRNA, complete cds.
STOMA20057820//Uncharacterized protein family UPF0024
STOMA20063980//Collagen triple helix repeat (20 copies)
STOMA20069040//Keratin, high sulfur B2 protein
SYNOV20017080//UBX domain
TBAES20000590//Cytochrome P450// Cytochrome P450
TESTI20001170//HORMA domain
TESTI20031810//Bacterial luciferase// Domain of unknown function DUF28
TESTI20044230//Mus musculus testis-specific Y-encoded-like protein (Tspyl1) mRNA, complete cds.
TESTI20098350//VAT-Nn domain
TESTI20157520//K+ channel tetramerisation domain// K+ channel tetramerisation domain
TESTI20170350//Cystine-knot domain
TESTI20192800//Homo sapiens nasopharyngeal carcinoma susceptibility protein LZ16 mRNA, complete cds.
TESTI20199750//TRICHOHYALIN.
TESTI20202650//Repeat in HS1/Cortactin
TESTI20229600//Drosophila melanogaster SP2353 mRNA, complete cds.
TESTI20231920//Gag P30 core shell protein
TESTI20242830//E2 (early) protein, C terminal// Syndecan domain
TESTI20254540//Homo sapiens hepatocellular carcinoma-associated antigen 59 mRNA, complete cds.
TESTI20320440//THIOREDOXIN.
TESTI20327680//EF hand// EF hand
TESTI20328280//KE2 family protein// Troponin
TESTI20351830//K-box region
TESTI20370020//Bleomycin resistance protein
TESTI20391210//IQ calmodulin-binding motif
TESTI20408150//Keratin, high sulfur B2 protein
TESTI20451990//SAP domain
TESTI20467970//Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain
THYMU20108310//Mouse NCBP-29 mRNA for PW29, complete cds.
THYMU20142040//WISKOTT-ALDRICH SYNDROME PROTEIN HOMOLOG (WASP).
THYMU20194360//Kelch motif
THYMU20239000//collagen alpha 1(XI) chain
TOVAR20004760//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat
TRACH20005020//Ank repeat// MutT-like domain
TRACH20007020//TRICHOHYALIN.
TRACH20048450//PROTEIN K4 (PROTEIN K3).
TRACH20068700//Homo sapiens adaptor protein CIKS mRNA, complete cds.
TRACH20076760//Keratin, high sulfur B2 protein
TRACH20135520//TBC domain// Rhodanese-like domain
TRACH20141240//Mus musculus G21 protein mRNA, complete cds.
TRACH20183170//Rattus norvegicus Sprague-Dawley SM-20 mRNA, complete cds.
UTERU20000740//Human fusion protein mRNA, complete cds.
UTERU20004240//CGI-96 protein
UTERU20006960//endoplasmic reticulum resident protein 58
UTERU20022940//Human (p23) mRNA, complete cds.
UTERU20046640//Mus musculus ld1Bp (LDLB) mRNA, complete cds.
UTERU20065930//GTP-RHO BINDING PROTEIN 1 (RHOPHILIN).
UTERU20115740//Human PMS2 related (hPMSR3) gene, complete cds.
UTERU20179880//TPR Domain// TPR Domain// TPR Domain// TPR Domain
With respect to the remaining 882 clones, there are so far no information available for estimating their functions. However, there is the possibility that the functions of these clones will be revealed in future. Their Clone Names are indicated below.
3NB6920014080, ADRGL20000640, ADRGL20012870, ADRGL20013010, ADRGL20044590, ADRGL20067670, ADRGL20068170, ADRGL20068460, ADRGL20073570, ADRGL20076360, ADRGL20083310, ASTRO20032120, ASTRO20100720, ASTRO20111490, ASTRO20114610, ASTRO20136710, ASTRO20138020, ASTRO20152140, ASTRO20166810, ASTRO20173480, BLADE20004630, BRACE20019540, BRACE20037660, BRACE20038850, BRACE20051690, BRACE20054500, BRACE20055180, BRACE20056810, BRACE20057420, BRACE20058810, BRACE20060840, BRACE20061740, BRACE20062400, BRACE20062740, BRACE20063800, BRACE20063930, BRACE20082950, BRACE20090440, BRACE20096540, BRACE20097320, BRACE20099570, BRACE20106690, BRACE20109370, BRACE20109830, BRACE20111830, BRACE20114780, BRACE20115450, BRACE20118380, BRACE20121850, BRACE20136240, BRACE20141080, BRACE20142320, BRACE20142570, BRACE20148210, BRACE20150310, BRACE20152870, BRACE20163150, BRACE20165830, BRACE20171240, BRACE20175870, BRACE20190440, BRACE20220300, BRACE20223280, BRACE20229280, BRACE20230700, BRACE20235400, BRACE20262930, BRACE20262940, BRACE20266750, BRACE20267250, BRACE20269710, BRACE20283920, BRACE20287410, BRALZ20014450, BRALZ20019660, BRALZ20059500, BRALZ20065600, BRALZ20075450, BRALZ20075760, BRALZ20080310, BRALZ20088690, BRAMY10001570, BRAMY20004110, BRAMY20011140, BRAMY20071850, BRAMY20102080, BRAMY20110640, BRAMY20116790, BRAMY20121190, BRAMY20137560, BRAMY20147540, BRAMY20160700, BRAMY20163250, BRAMY20163270, BRAMY20167710, BRAMY20168920, BRAMY20170140, BRAMY20178640, BRAMY20182730, BRAMY20183080, BRAMY20196000, BRAMY20204450, BRAMY20205740, BRAMY20229840, BRAMY20230600, BRAMY20250240, BRAMY20250320, BRAMY20261680, BRAMY20267130, BRAMY20268990, BRAMY20277140, BRAMY20280720, BRAMY20285930, BRAMY20286820, BRAWH10000930, BRAWH20012410, BRAWH20014920, BRAWH20016660, BRAWH20100690, BRAWH20103180, BRAWH20106180, BRAWH20107540, BRAWH20110660, BRAWH20111550, BRAWH20122770, BRAWH20126190, BRAWH20126980, BRAWH20139410, BRAWH20142340, BRAWH20147290, BRAWH20155950, BRAWH20158530, BRAWH20160280, BRAWH20162690, BRAWH20166790, BRAWH20173050, BRAWH20182060, BRCAN20006200, BRCAN20006390, BRCAN20060190, BRCAN20126130, BRCAN20143700, BRCAN20147880, BRCAN20216690, BRCAN2.0237240, BRCAN20263400, BRCAN20273100, BRCAN20273340, BRCAN20275130, BRCAN20280400, BRCAN20284600, BRCOC20004870, BRCOC20020850, BRCOC20031000, BRCOC20031870, BRCOC20037400, BRCOC20093800, BRCOC20105100, BRCOC20117690, BRCOC20119960, BRCOC20122290, BRCOC20128130, BRCOC20135730, BRCOC20147480, BRCOC20148330, BRCOC20155970, BRCOC20158240, BRHIP10001740, BRHIP20104440, BRHIP20105710, BRHIP20107440, BRHIP20110800, BRHIP20115760, BRHIP20123140, BRHIP20129720, BRHIP20139720, BRHIP20140630, BRHIP20142850, BRHIP20143860, BRHIP20149540, BRHIP20153560, BRHIP20169680, BRHIP20169900, BRHIP20170100, BRHIP20173150, BRHIP20180140, BRHIP20186120, BRHIP20186500, BRHIP20190070, BRHIP20196410, BRHIP20205090, BRHIP20208420, BRHIP20214950, BRHIP20227080, BRHIP20230710, BRHIP20232290, BRHIP20238690, BRHIP20240460, BRHIP20254480, BRHIP20277620, BRHIP20284800, BRHIP30001110, BRSSN10000920, BRSSN20006340, BRSSN20015030, BRSSN20028570, BRSSN20038410, BRSSN20046570, BRSSN20046860, BRSSN20097020, BRSSN20105960, BRSSN20108300, BRSSN20121030, BRSSN20152380, BRSSN20159070, BRSSN20159820, BRSTN20000580, BRTHA20046390, CD34C30001250, CD34C30003140, CD34C30004940, COLON20043180, CTONG20002180, CTONG20028410, CTONG20038890, CTONG20049410, CTONG20077790, CTONG20082690, CTONG20091320, CTONG20095270, CTONG20095290, CTONG20096430, CTONG20097660, CTONG20099630, CTONG20101480, CTONG20105660, CTONG20106230, CTONG20108210, CTONG20124470, CTONG20126070, CTONG20128470, CTONG20136300, CTONG20138030, CTONG20139070, CTONG20140320, CTONG20141650, CTONG20146970, CTONG20147050, CTONG20150910, CTONG20158150, CTONG20162170, CTONG20163550, CTONG20164990, CTONG20265130, CTONG20273610, D3OST10002670, D3OST10002700, D3OST20006540, D3OST20007340, D3OST20024170, D3OST20024520, D3OST20037970, D3OST30002910, D6OST20004450, D9OST20000310, D9OST20035800, DFNES10000030, DFNES10001850, DFNES20010910, DFNES20055270, DFNES20082800, FCBBF10003740, FCBBF20006780, FCBBF20023700, FCBBF20035280, FCBBF20054280, FCBBF20056370, FCBBF20071860, FCBBF20072650, FCBBF20075560, FCBBF20076330, FCBBF30001840, FCBBF30016570, FCBBF30019120, FCBBF30028180, FCBBF30052180, FCBBF30062880, FCBBF30070770, FCBBF30071520, FCBBF30170590, FCBBF30178730, FCBBF30189490, FCBBF30199610, FCBBF30240020, FCBBF30242250, FCBBF30262360, FCBBF30266780, FCBBF30266920, FCBBF30278630, FCBBF30284720, FCBBF40001420, FCBBF40005480, FEBRA20003210, FEBRA20017050, FEBRA20018280, FEBRA20025520, FEBRA20026280, FEBRA20027810, FEBRA20034360, FEBRA20037500, FEBRA20042190, FEBRA20052910, FEBRA20060610, FEBRA20072120, FEBRA20079310, FEBRA20082100, FEBRA20095140, FEBRA20098460, FEBRA20161120, FEBRA20166540, FEBRA20176800, FEBRA20197110, FEBRA20204000, FEBRA20204060, FEBRA20216360, FEBRA20226010, FEBRA20229560, FEBRA20232850, FELNG20002410, HCHON20002260, HCHON20008980, HCHON20009350, HCHON20011160, HCHON20014970, HCHON20022470, HCHON20036760, HCHON20043590, HCHON20067220, HCHON20074820, HCHON20076500, HEART20021840, HEART20037810, HEART20049400, HEART20063340, HEART20067870, HEART20067890, HEART20074430, HEART20089940, HEART20095990, HHDPC10000650, HHDPC20006920, HHDPC20057940, HHDPC20095280, HLUNG20016770, HLUNG20084390, KIDNE20006780, KIDNE20011170, KIDNE20013730, KIDNE20018730, KIDNE20018970, KIDNE20021980, KIDNE20029800, KIDNE20067330, KIDNE20079440, KIDNE20096280, KIDNE20096470, KIDNE20100840, KIDNE20102650, KIDNE20104300, KIDNE20106740, KIDNE20107500, KIDNE20112000, KIDNE20120090, KIDNE20122910, KIDNE20132180, KIDNE20138010, KIDNE20141190, KIDNE20144890, KIDNE20148900, KIDNE20163880, KIDNE20180710, KIDNE20186780, LIVER10001260, LIVER20011910, LIVER20028420, LIVER20038540, LIVER20084730, LIVER20085800, MESAN20106640, MESAN20121130, MESAN20132110, MESAN20138450, MESAN20157080, MESAN20161590, MESAN20164090, MESAN20182090, NESOP10001080, NOVAR10001020, NOVAR20003520, NT2NE20003740, NT2NE20010210, NT2NE20015240, NT2NE20043780, NT2NE20053580, NT2NE20072200, NT2NE20074250, NT2NE20089610, NT2NE20108540, NT2NE20110360, NT2NE20146810, NT2NE20152750, NT2NE20172590, NT2NE20174800, NT2NE20174920, NT2NE20187390, NT2RI20022600, NT2RI20023160, NT2RI20023590, NT2RI20036670, NT2RI20055790, NT2RI20069730, NT2RI20198260, NT2RI20203900, NT2RI20207030, NT2RI20216250, NT2RI20244960, NT2RI20250750, NT2RI20252550, NT2RP70010740, NT2RP70056750, NT2RP70075240, NT2RP70077660, NT2RP70085440, NT2RP70110860, NT2RP70111320, NT2RP70130020, NT2RP70137640, NT2RP70143480, NT2RP70147210, NT2RP70150800, NT2RP70169110, NT2RP70175670, NT2RP70181970, NT2RP70190640, NT2RP70203790, NTONG20050620, NTONG20050860, NTONG20065010, NTONG20077560, NTONG20090680, OCBBF20005230, OCBBF20020150, OCBBF20029800, OCBBF20032460, OCBBF20041680, OCBBF20045330, OCBBF20047570, OCBBF20048660, OCBBF20051610, OCBBF20060300, OCBBF20061720, OCBBF20062140, OCBBF20062410, OCBBF20074140, OCBBF20076220, OCBBF20079460, OCBBF20081380, OCBBF20084660, OCBBF20085200, OCBBF20088220, OCBBF20094240, OCBBF20097720, OCBBF20100400, OCBBF20103130, OCBBF20104040, OCBBF20105570, OCBBF20107920, OCBBF20111770, OCBBF20118970, OCBBF20126780, OCBBF20130110, OCBBF20139260, OCBBF20151150, OCBBF20164050, OCBBF20164670, OCBBF20170690, OCBBF20173060, OCBBF20173250, OCBBF20178990, OCBBF20186870, OCBBF20189560, PEBLM20024550, PEBLM20071880, PEBLM20072960, PERIC20002140, PERIC20003860, PLACE60004630, PLACE60119750, PLACE60138830, PLACE60153220, PLACE60155130, PLACE60169420, PLACE60181070, PLACE60187690, PLACE60188340, PROST10004800, PROST20005670, PROST20021010, PROST20024890, PROST20029270, PROST20052280, PROST20057930, PROST20059040, PROST20087700, PROST20097950, PROST20111050, PROST20120050, PROST20121900, PROST20123530, PROST20127400, PROST20130530, PROST20132600, PROST20133270, PROST20144220, PROST20149160, PROST20149250, PROST20151240, PROST20152460, PROST20153320, PROST20166680, PROST20168290, PROST20178360, PUAEN20025680, PUAEN20027580, PUAEN20044000, PUAEN20045110, PUAEN20045250, PUAEN20052470, PUAEN20081230, PUAEN20085150, RECTM10001410, RECTM20003490, RECTM20005100, SKMUS20012010, SKMUS20031680, SKMUS20046670, SKNMC20006220, SKNSH20034660, SKNSH20062340, SKNSH20080430, SKNSH20087770, SKNSH20091970, SMINT20005410, SMINT20008240, SMINT20011140, SMINT20011580, SMINT20014580, SMINT20015590, SMINT20023280, SMINT20033170, SMINT20033400, SMINT20042990, SMINT20047810, SMINT20056210, SMINT20058000, SMINT20060780, SMINT20065960, SMINT20076470, SMINT20080540, SMINT20089170, SMINT20092330, SMINT20092720, SMINT20098320, SMINT20103690, SMINT20105000, SMINT20108530, SMINT20109970, SMINT20122850, SMINT20132280, SMINT20153530, SMINT20158100, SMINT20161220, SMINT20162860, SMINT20164400, SMINT20164770, SMINT20173190, SPLEN10000830, SPLEN20000640, SPLEN20002220, SPLEN20008820, SPLEN20013540, SPLEN20016260, SPLEN20019450, SPLEN20020070, SPLEN20022230, SPLEN20023140, SPLEN20031600, SPLEN20032040, SPLEN20032190, SPLEN20033960, SPLEN20040600, SPLEN20076530, SPLEN20101190, SPLEN20106250, SPLEN20129610, SPLEN20146690, SPLEN20149190, SPLEN20152610, SPLEN20157300, SPLEN20158900, SPLEN20158990, SPLEN20160690, SPLEN20160980, SPLEN20166270, SPLEN20171210, SPLEN20176200, SPLEN20193110, SPLEN20198110, SPLEN20204170, SPLEN20212950, SPLEN20214400, SPLEN20225220, SPLEN20242320, SPLEN20242730, SPLEN20249560, SPLEN20261440, SPLEN20264110, SPLEN20279950, SPLEN20280660, SPLEN20303970, STOMA20013890, STOMA20026880, STOMA20036460, STOMA20048520, STOMA20048840, STOMA20062290, STOMA20067800, STOMA20072690, STOMA20076800, STOMA20086140, STOMA20092560, SYNOV20003970, TCOLN20001390, TESOP20000900, TESOP20003120, TESTI10000940, TESTI20004890, TESTI20011200, TESTI20018230, TESTI20029930, TESTI20030310, TESTI20030890, TESTI20038270, TESTI20066770, TESTI20076850, TESTI20086210, TESTI20087620, TESTI20094020, TESTI20098530, TESTI20102800, TESTI20105720, TESTI20112940, TESTI20114070, TESTI20116650, TESTI20122310, TESTI20129150, TESTI20129220, TESTI20130120, TESTI20135660, TESTI20136990, TESTI20137370′, TESTI20137670, TESTI20143240, TESTI20143620, TESTI20155900, TESTI20157100, TESTI20159140, TESTI20161970, TESTI20168630, TESTI20168960, TESTI20169960, TESTI20171020, TESTI20178160, TESTI20179320, TESTI20183370, TESTI20185810, TESTI20192280, TESTI20194300, TESTI20194810, TESTI20199170, TESTI20200260, TESTI20203440, TESTI20209460, TESTI20211240, TESTI20213150, TESTI20213580, TESTI20220100, TESTI20220650, TESTI20224620, TESTI20226490, TESTI20234270, TESTI20238000, TESTI20239470, TESTI20240090, TESTI20241530, TESTI20241920, TESTI20244760, TESTI20262330, TESTI20262910, TESTI20265250, TESTI20265370, TESTI20269570, TESTI20272060, TESTI20272390, TESTI20275620, TESTI20277360, TESTI20278200, TESTI20280980, TESTI20282540, TESTI20285830, TESTI20288110, TESTI20289850, TESTI20291620, TESTI20294700, TESTI20297850, TESTI20301360, TESTI20305560, TESTI20307540, TESTI20310070, TESTI20311290, TESTI20319190, TESTI20327740, TESTI20330310, TESTI20333950, TESTI20336410, TESTI20337100, TESTI20342430, TESTI20345060, TESTI20347740, TESTI20347770, TESTI20357750, TESTI20357930, TESTI20361140, TESTI20367360, TESTI20369130, TESTI20369220, TESTI20370550, TESTI20371060, TESTI20378450, TESTI20380650, TESTI20386230, TESTI20386440, TESTI20388580, TESTI20391130, TESTI20392090, TESTI20401430, TESTI20406420, TESTI20409440, TESTI20413300, TESTI20415640, TESTI20419560, TESTI20423020, TESTI20424000, TESTI20424730, TESTI20425070, TESTI20427830, TESTI20428060, TESTI20429280, TESTI20429580, TESTI20433130, TESTI20438660, TESTI20447540, TESTI20451710, TESTI20458190, TESTI20465520, TESTI20468630, TESTI20471470, TESTI20471530, TESTI20472120, TESTI20473420, TESTI20477920, TESTI20478010, TESTI20478180, TESTI20479300, THYMU20000570, THYMU20011950, THYMU20015210, THYMU20018190, THYMU20029100, THYMU20045120, THYMU20058070, THYMU20061700, THYMU20070360, THYMU20075320, THYMU20095960, THYMU20101610, THYMU20101920, THYMU20111420, THYMU20114470, THYMU20118060, THYMU20119390, THYMU20128070, THYMU20128260, THYMU20142970, THYMU20153160, THYMU20158250, THYMU20186390, THYMU20186730, THYMU20187720, THYMU20195990, THYMU20204160, THYMU20204990, THYMU20215090, THYMU20215970, THYMU20226600, THYMU20228540, THYMU20235760, THYMU20239430, THYMU20246840, THYMU20250420, THYMU20251890, THYMU20253250, THYMU20255570, THYMU20255720, THYMU20259090, THYMU20265300, THYMU20271250, THYMU20272490, THYMU20283790, THYMU20284120, THYMU20286290, THYMU20286320, TKIDN20030590, TKIDN20030620, TOVAR20005750, TRACH20027840, TRACH20032720, TRACH20037360, TRACH20056980, TRACH20060150, TRACH20082780, TRACH20091230, TRACH20092680, TRACH20099340, TRACH20107710, TRACH20115740, TRACH20118940, TRACH20147250, TRACH20153810, TRACH20169800, TRACH20187180, TSTOM10001860, TSTOM20001390, TSTOM20003150, UMVEN20003540, UTERU20006290, UTERU20020010, UTERU20054460, UTERU20056010, UTERU20059050, UTERU20061030, UTERU20067050, UTERU20068990, UTERU20070040, UTERU20070810, UTERU20081300, UTERU20084260, UTERU20095380, UTERU20095400, UTERU20101240, UTERU20114100, UTERU20118110, UTERU20118970, UTERU20119680, UTERU20124070, UTERU20126880, UTERU20134910, UTERU20143980, UTERU20146680, UTERU20150870, UTERU20164260, UTERU20188810
EXAMPLE 7 Expression Frequency Analysis in SilicoThe cDNA libraries derived from various tissues and cells as indicated in Example 1 were prepared, and cDNA clones were selected from each library at random. The 5′-end sequences were determined and the database was constructed based on the data. The database was constructed based on the nucleotide sequences of 1,402,070 clones, and thus the population of the database is large enough for the analysis.
Then, clones having a homologous sequence are categorized into a single cluster (clustering) by searching the nucleotide sequences of respective clones in this database with the program of nucleotide sequence homology search; the number of clones belonging to each cluster was determined and normalized for every library; thus, the ratio of a certain gene in each cDNA library was determined. This analysis gave the information of the expression frequency of genes in tissues and cells which were sources of the cDNA libraries.
Then, in order to analyze the expression of a gene containing the nucleotide sequence of the cDNA of the present invention in tissues and cells, the library derived from a tissue or a cell used in the large-scale cDNA analysis was subjected to the comparison of the expression levels between tissues or cells. Namely, the expression frequency was analyzed by comparing the previously normalized values between tissues and/or cells for which the nucleotide sequences of 600 or more cDNA clones had been analyzed. By this analysis, some of the genes were revealed to be involved in the pathology and functions indicated below. Each value in Tables 3 to 51 shown below represents a relative expression frequency; the higher the value, the higher the expression level.
Osteoporosis-Related Genes
Osteoporosis is a pathology in which bones are easily broken owing to overall decrease in components of bone. The onset involves the balance between the functions of osteoblast producing bone and osteoclast absorbing bone, namely bone metabolism. Thus, the genes involved in the increase of osteoclasts differentiating from precursor cells of monocyte/macrophage line (Molecular Medicine 38. 642-648. (2001)) are genes involved in osteoporosis relevant to bone metabolism.
A nucleotide sequence information-based analysis was carried out to identify the genes whose expression frequencies are higher or lower in CD34+ cell (cell expressing a glycoprotein CD34) treated with the osteoclast differentiation factor (Molecular Medicine 38. 642-648. (2001)) than in the untreated CD34+ cell, which is the precursor cell of monocyte/macrophage line. The result of comparative analysis for the frequency between the two cDNA libraries prepared from the RNA of CD34+ cells (CD34C) and from the RNA of CD34+ cells treated with the osteoclast differentiation factor (D30ST, D60ST or D90ST) showed that the genes whose expression levels were different between the two were the following clones (Table 3).
ASTRO20001410, D30ST10001090, D30ST20036070, THYMU20039810, KIDNE20028720, BRAWH10000930, BRHIP20005340, CTONG20141650, D9OST20000310, D90ST20002780, D90ST20023970, D90ST20026730, D9OST20031370, D9OST20033970, D9OST20035800, D9OST20035940, D9OST20040180, FCBBF30018550, FCBBF30233680, KIDNE20102650, NT2RI20023160, PROST20107820, SKNSH20089400, SMINT20033400, CTONG20108210, D60ST20003580, D60ST20005070, ASTRO20155290, D3OST10002670, D3OST10002700, D3OST20006180, D3OST20006540, D3OST20007340, D3OST20013280, D3OST20024170, D3OST20024360, D3OST20037970, D3OST30002580, D3OST30002910, FCBBF10004120, NT2RI20001330, NTONG20009770, SPLEN20084600, SPLEN20140800, THYMU20169680, TRACH20141240, CD34C30001250, CD34C30003140, CD34C30004240, CD34C30004940, DFNES10001850, HHDPC20034390, NT2RI20091730, SKMUS20003610, SPLEN20225220, BRCOC20101230
These genes are involved in osteoporosis.
Genes involved in neural cell differentiation
Genes involved in neural cell differentiation are useful for treating neurological diseases. Genes with varying expression levels in response to induction of cellular differentiation in neural cells are thought to be involved in neurological diseases.
A survey was performed for genes whose expression levels are varied in response to induction of differentiation (stimulation by retinoic acid (RA) or growth inhibitor treatment after RA stimulation) in cultured cells of a neural strain, NT2. The result of comparative analysis of cDNA libraries derived from undifferentiated NT2 cells (NT2RM) and the cells subjected to the differentiation treatment (NT2RP, NT2R1 or NT2NE) showed that the genes whose expression levels were different between the two were the following clones (Table 4).
CTONG20027090, CTONG20160560, NT2RP70032610, OCBBF20188730, SPLEN20162680, BRCOC20101230, BRHIP20005340, BRHIP20238880, FCBBF30016320, FEBRA20080810, FEBRA20225040, HCHON20008320, HHDPC20034390, HLUNG10000550, NT2RI20028470, NT2RI20054050, NT2RI20091730, NT2RP70078420, PUAEN20003740, THYMU20271250, BRACE20003070, BRACE20039040, BRAWH20004600, BRAWH20011710, BRCOC20121720, BRHIP20005530, D3OST10002700, HCHON20007380, HEART20072310, KIDNE20121880, MESAN20121130, NT2RI20022600, NT2RI20023160, NT2RI20086220, NT2RI20216250, NT2RP60000850, NT2RP70036880, NT2RP70043480, NT2RP70062230, NT2RP70081610, NT2RP70102350, NT2RP70130020, NT2RP70190640, OCBBF10001850, OCBBF20097720, OCBBF20173980, PEBLM20044520, SPLEN20173510, TRACH20007020, UTERU20065930, HCHON20022470, NT2NE20010490, NT2NE20174800, NT2NE20177520, PROST20087700, PROST20107820, SMINT20028820, TESTI20063830, ASTRO20125520, BRHIP30001110, HCHON20002260, HCHON20008150, KIDNE20002520, NT2NE20130190, NT2NE20158600, NT2RI20001330, NT2RI20025400, NT2RI20036670, NT2RI20048840, SKMUS20020840, BRACE20057190, BRACE20060550, BRACE20267250, BRAWH20107540, BRAWH20118230, CTONG20075860, CTONG20095290, FEBRA20086620, FEBRA20144170, FEBRA20196370, HLUNG20023340, NT2NE20003740, NT2NE20010050, NT2NE20010210, NT2NE20010400, NT2NE20015240, NT2NE20021620, NT2NE20043780, NT2NE20053580, NT2NE20068130, NT2NE20072200, NT2NE20074250, NT2NE20080170, NT2NE20089610, NT2NE20089970, NT2NE20108540, NT2NE20110360, NT2NE20118960, NT2NE20122430, NT2NE20124480, NT2NE20125050, NT2NE20131890, NT2NE20132170, NT2NE20142210, NT2NE20146810, NT2NE20152750, NT2NE20155110, NT2NE20156260, NT2NE20157470, NT2NE20159740, NT2NE20172590, NT2NE20174920, NT2NE20181650, NT2NE20183760, NT2NE20184900, NT2NE20187390, OCBBF20108430, RECTM20005100, SMINT20001760, SPLEN20169720, TESTI20265250, ASTRO10001650, ASTRO20033160, BRACE20011070, BRACE20039440, BRACE20151320, BRAMY20104640, BRAMY20137560, BRAMY20167060, BRAWH20028110, BRCAN20280360, BRCOC20004870, BRHIP20207990, BRHIP20217620, BRHIP20249110, BRSTN10000830, CTONG10000940, CTONG20004690, CTONG20050280, CTONG20105660, CTONG20125640, CTONG20133520, CTONG20186320, FCBBF10000770, FCBBF10002800, FCBBF10003770, FCBBF30018550, FCBBF30123470, FCBBF30246230, FEBRA20018280, FEBRA20095140, FEBRA20192420, HCHON20064590, HHDPC10000830, HLUNG20016770, HLUNG20033780, IMR3220002430, KIDNE20104300, MESAN20004570, MESAN20089360, NOVAR10000910, NT2RI20003480, NT2RI20005750, NT2RI20009870, NT2RI20023590, NT2RI20023910, NT2RI20025640, NT2RI20040930, NT2RI20041880, NT2RI20046080, NT2RI20050960, NT2RI20055790, NT2RI20056700, NT2RI20069730, NT2RI20076290, NT2RI20091940, NT2RI20198260, NT2RI20203900, NT2RI20207030, NT2RI20240080, NT2RI20244600, NT2RI20244960, NT2RI20250750, NT2RI20252550, NT2RI20273230, NTONG20067090, OCBBF10001750, OCBBF20047570, OCBBF20054760, OCBBF20059560, OCBBF20073540, OCBBF20125530, OCBBF20126780, OCBBF20127040, OCBBF20140890, SKMUS20003610, SKNSH20008190, SKNSH20080430, SMINT20144800, SPLEN20027440, SPLEN20095550, SPLEN20140800, TESTI20094020, TESTI20369690, TESTI20391770, TESTI20442760, TRACH20084720, TRACH20107710, TRACH20118940, UTERU20022940, ASTRO20108190, BGGI120006160, BRAMY20136210, BRAWH20016620, BRAWH20164460, BRCOC20144000, BRHIP20132860, BRSSN20146100, CTONG10000100, CTONG20103480, CTONG20108210, CTONG20139070, FCBBF10000240, FCBBF10000630, FCBBF20067810, FCBBF30010810, FCBBF30012810, FCBBF30013770, FCBBF30039020, FCBBF40001420, FEBRA10001880, FEBRA20082010, HHDPC20001040, KIDNE20021910, NT2RP60000770, NT2RP70010740, NT2RP70027380, NT2RP70037240, NT2RP70044280, NT2RP70045590, NT2RP70056750, NT2RP70063950, NT2RP70072690, NT2RP70077660, NT2RP70085440, NT2RP70105210, NT2RP70110860, NT2RP70111320, NT2RP70122910, NT2RP70125160, NT2RP70133740, NT2RP70134990, NT2RP70137290, NT2RP70137640, NT2RP70143480, NT2RP70147210, NT2RP70150800, NT2RP70157890, NT2RP70159960, NT2RP70169110, NT2RP70175670, NT2RP70179710, NT2RP70181970, NT2RP70188020, NT2RP70188710, NT2RP70192730, NT2RP70194450, NT2RP70195430, NT2RP70198350, NT2RP70203790, OCBBF20039250, OCBBF20080410, OCBBF20108190, OCBBF20108580, OCBBF20122620, OCBBF20130110, OCBBF20151150, OCBBF20189560, PROST10003220, TESTI20001720, TESTI20121550, TESTI20152460, TESTI20211240, TESTI20234140, UMVEN20003540, UTERU20006960, UTERU20094350, UTERU20164260
These genes are neurological disease-related genes. Cancer-related genes
It has been assumed that, distinct from normal tissues, cancer tissues express a distinct set of genes, and thus the expression can contribute to the carcinogenesis in tissues and cells. Thus, the genes whose expression patterns in cancer tissues are different from those in normal tissues are cancer-related genes. Search was carried out for the genes whose expression levels in cancer tissues were different from those in normal tissues.
The result of comparative analysis of cDNA libraries derived from breast tumor (TBAES) and normal breast (BEAST) showed that the genes whose expression levels were different between the two were the following clones (Table 5).
BRACE20039040, BRAMY20163250, BRCOC20031250, BRHIP20005340, BRHIP20217620, BRHIP30001110, FCBBF10000770, FCBBF30010810, FEBRA20080810, FEBRA20144170, FEBRA20196630, FEBRA20197110, HCHON20002260, HCHON20040020, HHDPC20034390, HLUNG10000550, NOVAR10000910, NT2RI20023160, NT2RI20054050, NT2RI20091730, OCBBF20188730, SMINT20144800, SPLEN20128000, SPLEN20171210, SPLEN20264110, TBAES20000590, TBAES20002550, TBAES20003150, TESTI20334410, TESTI20432750, TRACH20003590, TRACH20084720, UTERU20046640, BEAST20004540, SPLEN20008740
The result of comparative analysis of cDNA libraries derived cervical tumor (TCERX) and normal cervical duct (CERVX) showed that the genes whose expression levels were different between the two were the following clones (Table 6).
BGGI120006160, BRAMY20063970, BRHIP20218580, FEBRA20002100, SPLEN20162680, TESTI20214250, CTONG20105080, HCHON20015980, PROST20175290, TESTI20254220, THYMU20279750
The result of comparative analysis of cDNA libraries derived from colon tumor (TCOLN) and normal colon (COLON) showed that the genes whose expression levels were different between the two were the following clones (Table 7).
ASTRO20001410, BRAWH20162690, CTONG20132220, HCHON20002260, NT2RI20001330, TCOLN20001390, 3NB6910001910, BRAMY20120910, BRAWH20004600, BRCOC20031250, BRCOC20031870, COLON10001350, COLON20043180, COLON20093370, FEBRA20002100, FEBRA20082010, FEBRA20197110, KIDNE20007770, KIDNE20013730, NT2RP70045590, OCBBF20078920, PROST20083600, SPLEN20011410, TRACH20084720, THYMU20271250
The result of comparative analysis of cDNA libraries derived from esophageal tumor (TESOP) and normal esophagus (NESOP) showed that the genes whose expression levels were different between the two were the following clones (Table 8).
ASTRO20033160, ASTRO20125520, BRAMY20266850, BRAWH20164460, BRHIP20005340, BRHIP20191490, CTONG20095290, CTONG20143690, CTONG20161850, DFNES20001530, DFNES20071130, FCBBF30123470, FCBBF30175310, FEBRA20095140, HCHON20016650, MESAN20025190, NT2RI20028470, NT2RI20054050, NT2RP70036880, NTONG20009770, NTONG20064840, NTONG20076930, SMINT20042990, SPLEN20008820, SPLEN20128000, SPLEN20149110, STOMA20013890, TESOP20000900, TESOP20003120, TESOP20004000, TESOP20005270, TESOP20005690, TESTI20334410, THYMU20271250, TRACH20141240, UTERU20022940, NESOP10001080, NT2RI20023160, NTONG20013620, TRACH20077540, NTONG20015870
The result of comparative analysis of cDNA libraries derived from kidney tumor (TKIDN) and normal kidney (KIDNE) showed that the genes whose expression levels were different between the two were the following clones (Table 9).
ASTRO20008010, ASTRO20181690, BRACE20111830, BRACE20152870, BRACE20237270, BRAMY20147540, BRAMY20286820, BRAWH20015350, BRAWH20096780, BRAWH20132190, BRAWH20182060, BRCAN20060190, BRCOC20004870, BRCOC20176520, BRHIP20000870, BRHIP20198190, BRHIP20233090, BRHIP30001110, BRSSN20015790, BRSTN20000580, CTONG10000940, CTONG20098440, CTONG20150910, CTONG20165050, DFNES20014040, DFNES20037420, FCBBF10000770, FCBBF30083820, FCBBF30247930, FEBRA20037500, FEBRA20072120, FEBRA20080810, FEBRA20086620, FEBRA20140100, FEBRA20144170, FEBRA20176800, HCHON20008320, HCHON20059870, HLUNG10000550, MESAN20106640, NT2RI20025400, NT2RI20076290, NT2RI20091940, OCBBF20019830, OCBBF20022900, OCBBF20039250, OCBBF20080050, OCBBF20097720, OCBBF20125530, OCBBF20130110, OCBBF20140640, OCBBF20173980, PANCR10000910, PROST20087700, PUAEN20044000, SPLEN20144520, SPLEN20160980, TKIDN10000010, TKIDN20004640, TKIDN20005210, TKIDN20030590, TKIDN20030620, TKIDN20047480, TRACH20003590, TRACH20028030, TRACH20183170, TRACH20184490, UMVEN20003540, UTERU20004240, UTERU20055930, ASTRO10001650, ASTRO20108190, BGGI120006160, BRACE20039040, BRAMY20102080, BRAWH20004600, BRAWH20125380, BRAWH20162690, BRHIP20115760, BRHIP20205090, CTONG20052650, CTONG20108210, CTONG20128470, CTONG20133480, CTONG20139070, D90ST20000310, DFNES20001530, FCBBF10001820, FEBRA20002100, HCHON20008980, HCHON20016650, HLUNG20033780, KIDNE20002520, KIDNE20003940, KIDNE20006780, KIDNE20007210, KIDNE20007770, KIDNE20008010, KIDNE20009470, KIDNE20011170, KIDNE20011400, KIDNE20013730, KIDNE20017130, KIDNE20018730, KIDNE20018970, KIDNE20020150, KIDNE20021680, KIDNE20021910, KIDNE20021980, KIDNE20022620, KIDNE20024830, KIDNE20027250, KIDNE20027950, KIDNE20028390, KIDNE20028720, KIDNE20028830, KIDNE20029800, KIDNE20067330, KIDNE20079440, KIDNE20096280, KIDNE20096470, KIDNE20100070, KIDNE20100840, KIDNE20101370, KIDNE20101510, KIDNE20102650, KIDNE20102710, KIDNE20104300, KIDNE20106740, KIDNE20107390, KIDNE20107500, KIDNE20107620, KIDNE20109730, KIDNE20109890, KIDNE20112000, KIDNE20115080, KIDNE20118580, KIDNE20120090, KIDNE20121880, KIDNE20122910, KIDNE20124400, KIDNE20125630, KIDNE20126010, KIDNE20126130, KIDNE20127100, KIDNE20127450, KIDNE20127750, KIDNE20130450, KIDNE20131580, KIDNE20132180, KIDNE20137340, KIDNE20138010, KIDNE20141190, KIDNE20144890, KIDNE20148900, KIDNE20163880, KIDNE20180710, KIDNE20181660, KIDNE20182690, KIDNE20186780, KIDNE20190740, LIVER20035110, MESAN20025190, NT2RP70043480, PROST20107820, PROST20123530, PROST20161950, PUAEN20030180, SKMUS20003610, SMINT20033400, TBAES20000590, TESTI20044310, TESTI20082330, TRACH20032720, UTERU20099720
The result of comparative analysis of cDNA libraries derived from liver tumor (TLIVE) and normal liver (LIVER) showed that the genes whose expression levels were different between the two were the following clones (Table 10).
BRAWH20166790, CTONG20103480, HEART20005410, LIVER10001260, LIVER10004790, LIVER20002160, LIVER20011130, LIVER20011910, LIVER20028420, LIVER20035110, LIVER20035680, LIVER20038540, LIVER20045650, LIVER20055200, LIVER20055440, LIVER20059810, LIVER20062510, LIVER20064100, LIVER20064690, LIVER20075680, LIVER20080530, LIVER20084730, LIVER20085800, LIVER20087510, LIVER20091180, NTONG20063010, PROST20087700, PROST20107820, TRACH20005400, ASTRO20001410, ASTRO20125520, BRACE20152870, BRAMY20167060, BRAMY20181220, BRAMY20285160, BRCOC20001860, FEBRA20144170, HLUNG10000550, OCBBF20073540, OCBBF20088220, PLACE60169420, SMINT20152940, SPLEN20242320, THYMU20000570, TRACH20077540, UTERU20055930, UTERU20065930
The result of comparative analysis of cDNA libraries derived from lung tumor (TLUNG) and normal lung (HLUNG) showed that the genes whose expression levels were different between the two were the following clones (Table 11).
BRACE20096200, BRAWH20004600, BRAWH20030250, BRCAN20006390, BRCAN20280360, BRHIP20238880, CTONG10000940, CTONG20103480, CTONG20129960, CTONG20155180, FCBBF10001210, FEBRA20144170, FEBRA20197110, HCHON20002260, HHDPC20034390, HLUNG10000550, HLUNG20016330, HLUNG20016770, HLUNG20017120, HLUNG20023340, HLUNG20033780, HLUNG20084390, IMR3220002430, LIVER20028420, NOVAR20000380, NT2RI20023910, NT2RI20054050, NT2RI20091730, NT2RP70044280, OCBBF20020830, OCBBF20125530, PLACE60004630, PROST20057930, PROST20107820, PROST20185830, PUAEN20030180, SMINT20121220, SPLEN20002220, SPLEN20008740, SPLEN20054290, SPLEN20128000, SPLEN20157300, SPLEN20176200, SPLEN20179180, SPLEN20211940, STOMA20013890, TBAES20000590, TESTI20094230, TESTI20184620, TESTI20334410, THYMU20000570, THYMU20039810, TRACH20007020, TRACH20141240, TRACH20183170, ASTRO20108190, ASTRO20155290, BRHIP20096850, FEBRA20080810, MESAN20014500, SMINT20028820, SPLEN20162680
The result of comparative analysis of cDNA libraries derived from ovary tumor (TOVER) and normal ovary (NOVER) showed the genes whose expression levels were different between the two were the following clones (Table 12).
BGGI120006160, BRHIP20005340, BRHIP20191860, HHDPC20001040, NOVAR10000150, NOVAR10000910, NOVAR10001020, NOVAR20000380, NOVAR20003520, THYMU20271250, ASTRO20141350, BRAMY20157820, BRCOC20001860, HLUNG20016770, NT2RI20054050, NTONG20090600, PROST20087700, PUAEN20015860, SPLEN20029310, TOVAR20004760, TOVAR20005750, TRACH20079690, UTERU20004240
The result of comparative analysis of cDNA libraries derived from stomach tumor (TSTOM) and normal stomach (STOMA) showed that the genes whose expression levels were different between the two were the following clones (Table 13).
BRACE20060840, FEBRA20052910, HCHON20002260, HLUNG10000550, NTONG20009770, PROST20107820, THYMU20039810, TSTOM10001860, TSTOM20001390, TSTOM20003150, TSTOM20005690, ASTRO20125520, BRACE20039040, BRAMY20124260, BRCOC20031870, BRHIP20191860, CTONG20128470, FEBRA20037500, HCHON20040020, HHDPC10000830, IMR3220002430, KIDNE20007770, NOVAR20000380, NT2RI20054050, NT2RI20091730, PROST20130530, SPLEN20149110, SPLEN20157880, STOMA20001830, STOMA20005390, STOMA20005670, STOMA20006400, STOMA20006780, STOMA20006860, STOMA20008880, STOMA20010250, STOMA20013890, STOMA20026880, STOMA20032890, STOMA20034770, STOMA20036460, STOMA20046680, STOMA20048520, STOMA20048840, STOMA20051200, STOMA20056640, STOMA20056670, STOMA20057820, STOMA20062130, STOMA20062290, STOMA20063250, STOMA20063980, STOMA20064470, STOMA20067800, STOMA20069040, STOMA20072690, STOMA20076800, STOMA20077450, STOMA20080500, STOMA20083610, STOMA20086140, STOMA20088380, STOMA20092530, STOMA20092560, STOMA20092890, TESTI20184620, TRACH20003590, TRACH20183170, PROST20083600, TRACH20068660
The result of comparative analysis of cDNA libraries derived from uterine tumor (TUTER) and normal uterus (UTERU) showed that the genes whose expression levels were different between the two were the following clones (Table 14). DFNES10001850, NT2RI20023910, SMINT20144800, SPLEN20162680, TOVAR20004760, TUTER20002830, ASTRO20008010, ASTRO20033160, ASTRO20058630, ASTRO20105820, ASTRO20108190, BRACE20039040, BRACE20057190, BRACE20060840, BRACE20111830, BRACE20223330, BRAMY20266850, BRAWH20113430, BRAWH20126980, BRCOC20031870, BRCOC20107300, BRCOC20121720, BRCOC20155970, BRHIP20105710, BRHIP20191490, BRHIP20207990, BRHIP20217620, BRHIP20222280, BRHIP20238880, BRHIP20249110, BRSSN20018690, BRTHA20000570, CTONG10000940, CTONG10002770, CTONG20095290, CTONG20099380, CTONG20103480, CTONG20108210, CTONG20118250, CTONG20129960, CTONG20131560, CTONG20139070, CTONG20139340, CTONG20143690, CTONG20160560, D30ST30002580, FCBBF10000240, FCBBF10001820, FCBBF10003670, FCBBF10004120, FCBBF10005740, FCBBF30175310, FCBBF30240020, FCBBF30246230, FCBBF40001420, FEBRA20002100, FEBRA20004620, FEBRA20018280, FEBRA20025270, FEBRA20034360, FEBRA20037500, FEBRA20080810, FEBRA20082100, FEBRA20144170, FEBRA20225040, HCHON20002260, HCHON20007380, HCHON20015980, HCHON20016650, HCHON20022470, HCHON20040020, HCHON20076500, HEART20072310, HHDPC20034390, HLUNG10000550, HLUNG20016770, KIDNE20131580, LIVER20028420, MAMGL10000830, MESAN20171520, NOVAR10000150, NOVAR10000910, NT2NE20053580, NT2NE20159740, NT2NE20174920, NT2RI20023160, NT2RI20041880, NT2RI20054050, NT2RI20076290, NT2RI20273230, NT2RP60000770, NT2RP60000850, NT2RP70036880, NT2RP70043480, NT2RP70045590, NT2RP70056750, NT2RP70062230, NT2RP70081610, OCBBF10001750, OCBBF20006770, OCBBF20032460, OCBBF20039250, OCBBF20047570, OCBBF20054760, OCBBF20059560, OCBBF20068490, OCBBF20080050, OCBBF20094240, OCBBF20097720, OCBBF20103130, OCBBF20105570, OCBBF20140640, OCBBF20173980, OCBBF20180120, OCBBF20188730, OCBBF20189560, PEBLM20044520, PLACE60060420, PROST20087700, PROST20107820, PROST20149160, PROST20159240, PROST20176170, PROST20189770, PUAEN20003740, PUAEN20015860, SKMUS20003610, SKNSH20008190, SKNSH20080430, SMINT20026890, SMINT20029760, SMINT20068010, SMINT20110330, SMINT20121220, SPLEN20008390, SPLEN20011410, SPLEN20054290, SPLEN20128000, SPLEN20140800, SPLEN20145720, SPLEN20169720, SPLEN20179180, SPLEN20193110, SPLEN20194050, SPLEN20211940, SPLEN20212730, SPLEN20225220, TBAES20000590, TESTI20061110, TESTI20116830, TESTI20184620, TESTI20208710, TESTI20211240, TESTI20213580, TESTI20214250, TESTI20334410, TESTI20369130, TESTI20369690, TESTI20391770, THYMU20039810, THYMU20216840, THYMU20240710, TRACH20003590, TRACH20032720, TRACH20033230, TRACH20141240, TRACH20149970, UMVEN10001860, UTERU20000740, UTERU20004240, UTERU20006290, UTERU20020010, UTERU20022940, UTERU20030570, UTERU20040610, UTERU20046640, UTERU20046980, UTERU20050690, UTERU20054460, UTERU20055330, UTERU20055930, UTERU20056010, UTERU20059050, UTERU20061030, UTERU20064000, UTERU20064860, UTERU20065930, UTERU20067050, UTERU20068990, UTERU20070040, UTERU20070810, UTERU20076390, UTERU20081300, UTERU20084260, UTERU20094350, UTERU20095380, UTERU20095400, UTERU20097760, UTERU20099720, UTERU20101240, UTERU20114100, UTERU20115740, UTERU20116570, UTERU20118110, UTERU20118970, UTERU20119060, UTERU20119680, UTERU20120310, UTERU20124070, UTERU20126880, UTERU20134910, UTERU20135860, UTERU20143980, UTERU20144640, UTERU20145480, UTERU20146310, UTERU20146680, UTERU20150870, UTERU20151980, UTERU20158300, UTERU20158800, UTERU20161570, UTERU20164260, UTERU20168220, UTERU20176130, UTERU20176320, UTERU20178100, UTERU20179880, UTERU20183640, UTERU20185230, UTERU20186740, UTERU20188110, UTERU20188810, BRAWH10000930, CTONG20128470, UTERU20006960
The result of comparative analysis of cDNA libraries derived from tongue cancer (CTONG) and normal tongue (NTONG) showed that the genes whose expression levels were different between the two were the following clones (Table 15).
ADRGL20018300, ASTRO20058630, ASTRO20072210, ASTRO20108190, BRACE20003070, BRACE20039040, BRACE20060720, BRACE20061050, BRACE20210140, BRACE20276430, BRAMY20152110, BRAMY20266850, BRAMY20271400, BRAWH10000930, BRAWH20004600, BRCAN20280360, BRCOC20004870, BRHIP20005340, BRHIP20005530, BRHIP20238880, BRSSN20146100, CTONG10000100, CTONG10000220, CTONG10000620, CTONG10000930, CTONG10000940, CTONG10001650, CTONG10002770, CTONG20002180, CTONG20004690, CTONG20009770, CTONG20014280, CTONG20027090, CTONG20028410, CTONG20038890, CTONG20049410, CTONG20050280, CTONG20052650, CTONG20052900, CTONG20075860, CTONG20076130, CTONG20077790, CTONG20082690, CTONG20085950, CTONG20091080, CTONG20091320, CTONG20092570, CTONG20092580, CTONG20092680, CTONG20092700, CTONG20093950, CTONG20095270, CTONG20095290, CTONG20095340, CTONG20096430, CTONG20096750, CTONG20097660, CTONG20098440, CTONG20099380, CTONG20099550, CTONG20099630, CTONG20100240, CTONG20101480, CTONG20103480, CTONG20105080, CTONG20105660, CTONG20106230, CTONG20106520, CTONG20108210, CTONG20114290, CTONG20114740, CTONG20118150, CTONG20118250, CTONG20119200, CTONG20120770, CTONG20121010, CTONG20121580, CTONG20124010, CTONG20124220, CTONG20124470, CTONG20124730, CTONG20125540, CTONG20125640, CTONG20126070, CTONG20127450, CTONG20128470, CTONG20129960, CTONG20131490, CTONG20131560, CTONG20132220, CTONG20133390, CTONG20133480, CTONG20133520, CTONG20136300, CTONG20138030, CTONG20139070, CTONG20139340, CTONG20139860, CTONG20140320, CTONG20140580, CTONG20141650, CTONG20146300, CTONG20147050, CTONG20149460, CTONG20149950, CTONG20153300, CTONG20153580, CTONG20155180, CTONG20155400, CTONG20156780, CTONG20158040, CTONG20158150, CTONG20158660, CTONG20159530, CTONG20160560, CTONG20161850, CTONG20162170, CTONG20163550, CTONG20164990, CTONG20165050, CTONG20186320, CTONG20200310, CTONG20265130, CTONG20267700, CTONG20273610, FCBBF10000240, FCBBF10005740, FCBBF30123470, FCBBF30233680, FEBRA20025270, FEBRA20037500, HCHON20002260, HCHON20007380, HCHON20007510, HCHON20015350, HCHON20040020, HHDPC20034390, HLUNG10000550, KIDNE20002520, KIDNE20009470, KIDNE20115080, KIDNE20127100, LIVER20028420, MESAN20029400, NT2RI20023160, NT2RI20023910, NT2RI20091730, NT2RP70043480, NT2RP70078420, NT2RP70081610, OCBBF20006770, OCBBF20059560, OCBBF20073540, OCBBF20094240, OCBBF20108580, PEBLM20044520, PEBLM20071880, PROST20107820, PUAEN20030180, SKNSH20008190, SMINT20023280, SMINT20089170, SPLEN20179180, TESTI20094020, TESTI20094230, TESTI20152460, TESTI20184620, TESTI20211240, TESTI20442760, THYMU20039810, TRACH20028030, TRACH20141240, TSTOM20003150, UTERU20004240, UTERU20055930, UTERU20065930, UTERU20119060, UTERU20124070, BRACE20039440, BRACE20068590, FCBBF30018550, IMR3220002430, KIDNE20028830, NT2RI20028470, NT2RI20054050, NT2RI20086220, NTONG20009770, NTONG20013620, NTONG20028070, NTONG20029480, NTONG20029700, NTONG20046140, NTONG20048060, NTONG20049910, NTONG20050620, NTONG20050860, NTONG20051530, NTONG20052650, NTONG20056570, NTONG20061870, NTONG20063010, NTONG20064400, NTONG20064840, NTONG20065010, NTONG20066460, NTONG20067090, NTONG20067830, NTONG20070200, NTONG20070340, NTONG20075220, NTONG20076930, NTONG20077560, NTONG20083650, NTONG20088620, NTONG20090600, NTONG20090680, NTONG20092290, NTONG20092330, OCBBF20068490, SKMUS20001980, SMINT20138900, SPLEN20008390, SPLEN20162680, UTERU20134910, ASTRO20155290, FEBRA20080810, NT2RP70032610, NT2RP70036880, NTONG20015870, OCBBF20188730, SMINT20122910, SPLEN20099700
These genes are involved in cancers.
Further, there is a method to search for genes involved in development and differentiation: the expression frequency analysis in which the expression levels of genes are compared between developing or differentiating tissues and/or cells and adult tissues and/or cells. The genes involved in tissue development and/or differentiation are genes participating in tissue construction and expression of function, and thus are useful genes, which are available for regenerative medicine aiming at convenient regeneration of injured tissues.
Search was carried out for the genes whose expression frequencies were different between developing and/or differentiating tissues and/or cells, and adult tissues and/or cells, by using the information of gene expression frequency based on the database of the nucleotide sequences of 1,402,070 clones shown above.
The result of comparative analysis of cDNA libraries derived from fetal brain (FCBBF, FEBRA or OCBBF) and adult brain (BRACE, BRALZ, BRAMY, BRAWH, BRCAN, BRCOC, BRHIP, BRSSN, BRSTN or BRTHA) showed that the genes whose expression levels were different between the two were the following clones (Tables 16 to 48).
3NB6910001910, ADRGL20018300, ASTRO20001410, ASTRO20033160, ASTRO20058630, ASTRO20064750, ASTRO20100720, ASTRO20141350, ASTRO20145760, ASTRO20181690, BGGI120006160, BRACE20006400, BRACE20011070, BRACE20019540, BRACE20027620, BRACE20037660, BRACE20038000, BRACE20038470, BRACE20038480, BRACE20038850, BRACE20039440, BRACE20039540, BRACE20050900, BRACE20051380, BRACE20051690, BRACE20052160, BRACE20053280, BRACE20053480, BRACE20053630, BRACE20054500, BRACE20055180, BRACE20057420, BRACE20057620, BRACE20057730, BRACE20058580, BRACE20058810, BRACE20060840, BRACE20060890, BRACE20061050, BRACE20061740, BRACE20062400, BRACE20062740, BRACE20063630, BRACE20063780, BRACE20063800, BRACE20063930, BRACE20064880, BRACE20068590, BRACE20069090, BRACE20081720, BRACE20082950, BRACE20096200, BRACE20096540, BRACE20097320, BRACE20101700, BRACE20101710, BRACE20106840, BRACE20107530, BRACE20108130, BRACE20108880, BRACE20109370, BRACE20109830, BRACE20114780, BRACE20115450, BRACE20115920, BRACE20116110, BRACE20116460, BRACE20118380, BRACE20121850, BRACE20141080, BRACE20142320, BRACE20147800, BRACE2014.8210, BRACE20148240, BRACE20150310, BRACE20151320, BRACE20152870, BRACE20153680, BRACE20154120, BRACE20163150, BRACE20163350, BRACE20165830, BRACE20171240, BRACE20172980, BRACE20175870, BRACE20177200, BRACE20179340, BRACE20185680, BRACE20188470, BRACE20190040, BRACE20190440, BRACE20192440, BRACE20195100, BRACE20201570, BRACE20220300, BRACE20223280, BRACE20223330, BRACE20224480, BRACE20224500, BRACE20228480, BRACE20229280, BRACE20230700, BRACE20232840, BRACE20235400, BRACE20237270, BRACE20238000, BRACE20240740, BRACE20248260, BRACE20253160, BRACE20253330, BRACE20257100, BRACE20262930, BRACE20262940, BRACE20266750, BRACE20267250, BRACE20269200, BRACE20269710, BRACE20273890, BRACE20274080, BRACE20283920, BRACE20284100, BRACE20286360, BRACE20287410, BRALZ20013500, BRALZ20014450, BRALZ20017430, BRALZ20018340, BRALZ20054710, BRALZ20058880, BRALZ20059500, BRALZ20064740, BRALZ20065600, BRALZ20069760, BRALZ20073760, BRALZ20075450, BRALZ20075760, BRALZ20077900, BRALZ20077930, BRALZ20080310, BRALZ20088690, BRAMY10001300, BRAMY10001570, BRAMY20000520, BRAMY20000860, BRAMY20002770, BRAMY20004110, BRAMY20011140, BRAMY20025840, BRAMY20039260, BRAMY20045240, BRAMY20054880, BRAMY20060920, BRAMY20063970, BRAMY20071850, BRAMY20102080, BRAMY20104640, BRAMY20110640, BRAMY20111960, BRAMY20116790, BRAMY20121190, BRAMY20121620, BRAMY20124260, BRAMY20134140, BRAMY20135900, BRAMY20136210, BRAMY20137560, BRAMY20144620, BRAMY20147540, BRAMY20148130, BRAMY20152110, BRAMY20153110, BRAMY20157820, BRAMY20160700, BRAMY20163250, BRAMY20163270, BRAMY20167060, BRAMY20167710, BRAMY20168920, BRAMY20170140, BRAMY20174550, BRAMY20178640, BRAMY20181220, BRAMY20182730, BRAMY20183080, BRAMY20184670, BRAMY20195090, BRAMY20204450, BRAMY20205740, BRAMY20210400, BRAMY20211390, BRAMY20211420, BRAMY20213100, BRAMY20215230, BRAMY20217460, BRAMY20218250, BRAMY20218670, BRAMY20229800, BRAMY20229840, BRAMY20230600, BRAMY20231720, BRAMY20240040, BRAMY20245300, BRAMY20247110, BRAMY20247280, BRAMY20248490, BRAMY20250240, BRAMY20250320, BRAMY20252180, BRAMY20252720, BRAMY20260910, BRAMY20261680, BRAMY20266850, BRAMY20267130, BRAMY20268990, BRAMY20270730, BRAMY20271400, BRAMY20273960, BRAMY20277140, BRAMY20277170, BRAMY20280720, BRAMY20284910, BRAMY20285160, BRAMY20285930, BRAMY20286820, BRAWH20002320, BRAWH20012390, BRAWH20014920, BRAWH20015350, BRAWH20015890, BRAWH20016660, BRAWH20016860, BRAWH20017010, BRAWH20018730, BRAWH20028110, BRAWH20029630, BRAWH20064050, BRAWH20075700, BRAWH20096780, BRAWH20100690, BRAWH20101360, BRAWH20103180, BRAWH20105840, BRAWH20106180, BRAWH20107540, BRAWH20110660, BRAWH20110790, BRAWH20110960, BRAWH20111550, BRAWH20112940, BRAWH20114000, BRAWH20117950, BRAWH20118230, BRAWH20122580, BRAWH20125380, BRAWH20126190, BRAWH20126980, BRAWH20132190, BRAWH20137480, BRAWH20138660, BRAWH20139410, BRAWH20142340, BRAWH20147290, BRAWH20149340, BRAWH20155950, BRAWH20158530, BRAWH20160280, BRAWH20162690, BRAWH20166790, BRAWH20171030, BRAWH20173050, BRAWH20182060, BRAWH20185060, BRCAN10001490, BRCAN20003460, BRCAN20006200, BRCAN20006390, BRCAN20054490, BRCAN20060190, BRCAN20064010, BRCAN20071190, BRCAN20091560, BRCAN20103740, BRCAN20124080, BRCAN20126130, BRCAN20143700, BRCAN20147880, BRCAN20216690, BRCAN20224720, BRCAN20237240, BRCAN20263400, BRCAN20273100, BRCAN20273340, BRCAN20273550, BRCAN20275130, BRCAN20279700, BRCAN20280210, BRCAN20280400, BRCAN20283190, BRCAN20283380, BRCAN2028460b, BRCAN20285450, BRCOC10000870, BRCOC20001860, BRCOC20004040, BRCOC20004870, BRCOC20006370, BRCOC20008160, BRCOC20008500, BRCOC20020850, BRCOC20021550, BRCOC20023230, BRCOC20026640, BRCOC20027510, BRCOC20031000, BRCOC20031250, BRCOC20031870, BRCOC20035130, BRCOC20037320, BRCOC20037400, BRCOC20041750, BRCOC20055420, BRCOC20059510, BRCOC20077690, BRCOC20090520, BRCOC20091960, BRCOC20093800, BRCOC20099370, BRCOC20101230, BRCOC20107300, BRCOC20110100, BRCOC20114180, BRCOC20117690, BRCOC20119960, BRCOC20121720, BRCOC20122290, BRCOC20128130, BRCOC20134480, BRCOC20135730, BRCOC20136750, BRCOC20144000, BRCOC20147480, BRCOC20148330, BRCOC20155970, BRCOC20158240, BRCOC20176520, BRCOC20178560, BRHIP10001290, BRHIP20000870, BRHIP20001630, BRHIP20096170, BRHIP20096850, BRHIP20103090, BRHIP20104440, BRHIP20105710, BRHIP20106100, BRHIP20107440, BRHIP20111200, BRHIP20115080, BRHIP20115760, BRHIP20118380, BRHIP20118910, BRHIP20119330, BRHIP20121410, BRHIP20123140, BRHIP20129720, BRHIP20132860, BRHIP20135100, BRHIP20137230, BRHIP20139720, BRHIP20140630, BRHIP20142850, BRHIP20143730, BRHIP20143860, BRHIP20149540, BRHIP20153560, BRHIP20153600, BRHIP20167880, BRHIP20169680, BRHIP20169900, BRHIP20170100, BRHIP20173150, BRHIP20174040, BRHIP20175420, BRHIP20180140, BRHIP20183690, BRHIP20186120, BRHIP20186500, BRHIP20189980, BRHIP20190070, BRHIP20191490, BRHIP20191770, BRHIP20194940, BRHIP20195890, BRHIP20196410, BRHIP20205090, BRHIP20207430, BRHIP20207990, BRHIP20208420, BRHIP20208590, BRHIP20227080, BRHIP20230710, BRHIP20232290, BRHIP20233090, BRHIP20234380, BRHIP20236950, BRHIP20238600, BRHIP20238690, BRHIP20240460, BRHIP20243470, BRHIP20249110, BRHIP20252450, BRHIP20253660, BRHIP20277620, BRHIP20283030, BRHIP20284800, BRHIP20285830, BRHIP20285930, BRHIP30004880, BRSSN10000920, BRSSN20013420, BRSSN20014260, BRSSN20015030, BRSSN20015790, BRSSN20018690, BRSSN20028570, BRSSN20038200, BRSSN20038410, BRSSN20039370, BRSSN20043040, BRSSN20046570, BRSSN20046790, BRSSN20046860, BRSSN20066110, BRSSN20097020, BRSSN20101100, BRSSN20105870, BRSSN20105960, BRSSN20108300, BRSSN20120810, BRSSN20121030, BRSSN20137020, BRSSN20142940, BRSSN20146100, BRSSN20151990, BRSSN20159070, BRSSN20159820, BRSSN20169050, BRSSN20176820, BRSSN20177570, BRSSN20187310, BRSTN20000580, BRSTN20005360, BRTHA20000570, BRTHA20004740, BRTHA20046290, BRTHA20046390, BRTHA20046420, CD34C30001250, CD34C30004240, CTONG10000100, CTONG20004690, CTONG20027090, CTONG20050280, CTONG20076130, CTONG20077790, CTONG20095290, CTONG20095340, CTONG20099380, CTONG20106520, CTONG20118250, CTONG20121010, CTONG20127450, CTONG20128470, CTONG20141650, CTONG20143690, CTONG20153300, CTONG20155180, CTONG20158150, CTONG20161850, CTONG20164990, CTONG20186320, D3OST10002700, D6OST20003580, D9OST20000310, D9OST20035800, DFNES20010910, DFNES20071130, HCHON20002260, HCHON20003220, HCHON20010990, HCHON20015350, HCHON20022470, HCHON20067220, HCHON20067700, HEART20003060, HEART20005410, HEART20061950, HEART20090000, HHDPC10000650, HHDPC20057940, HLUNG20033780, KIDNE20011170, KIDNE20027250, KIDNE20104300, KIDNE20107500, KIDNE20122910, KIDNE20127100, KIDNE20180710, LIVER10001260, LIVER20064100, LIVER20087510, MAMGL10000830, MESAN20031900, MESAN20036460, MESAN20106640, MESAN20164090, NOVAR10000150, NOVAR20000380, NT2NE20010400, NT2NE20010490, NT2NE20021620, NT2NE20122430, NT2NE20125050, NT2NE20174920, NT2RI20001330, NT2RI20023590, NT2RI20041880, NT2RI20046080, NT2RI20216250, NT2RI20252550, NT2RP60000770, NT2RP70045590, NT2RP70063950, NT2RP70195430, NT2RP70198350, NTONG20028070, NTONG20046140, NTONG20064840, NTONG20067830, NTONG20077560, PANCR10000910, PEBLM20024550, PEBLM20052820, PEBLM20074370, PERIC20004780, PLACE50000660, PLACE60079250, PLACE60136720, PLACE60138830, PROST20005670, PROST20050670, PROST20107820, PROST20111050, PROST20116600, PROST20120160, PROST20123530, PROST20161950, PROST20171280, PROST20175290, PROST20185830, PROST20191640, PUAEN20015860, PUAEN20030180, PUAEN20044000, PUAEN20078980, PUAEN20085150, PUAEN20108240, SKMUS20012010, SKNSH20062340, SMINT20013480, SMINT20042990, SMINT20053300, SMINT20076470, SMINT20092330, SMINT20101440, SMINT20121220, SMINT20121950, SMINT20122910, SMINT20130320, SMINT20131810, SMINT20144800, SMINT20163960, SPLEN20002220, SPLEN20008740, SPLEN20011410, SPLEN20016260, SPLEN20027440, SPLEN20029310, SPLEN20033960, SPLEN20054290, SPLEN20126190, SPLEN20128000, SPLEN20145720, SPLEN20146450, SPLEN20147110, SPLEN20149110, SPLEN20157880, SPLEN20158900, SPLEN20171210, SPLEN20179180, SPLEN20186430, SPLEN20204170, SPLEN20212730, SPLEN20214580, SPLEN20250390, STOMA20051200, STOMA20062290, STOMA20092890, SYNOV20003970, TESOP20005270, TESTI10000940, TESTI20001720, TESTI20002720, TESTI20004890, TESTI20011200, TESTI20035960, TESTI20037560, TESTI20044310, TESTI20061110, TESTI20063830, TESTI20086210, TESTI20152460, TESTI20168960, TESTI20170350, TESTI20208400, TESTI20213580, TESTI20214250, TESTI20254220, TESTI20258460, TESTI20330310, TESTI20334410, TESTI20366910, TESTI20391770, TESTI20432750, TESTI20455620, THYMU20000570, THYMU20058070, THYMU20066100, THYMU20075320, THYMU20081490, THYMU20100410, THYMU20101920, THYMU20108310, THYMU20119390, THYMU20126900, THYMU20128260, THYMU20169680, THYMU20193640, THYMU20209590, THYMU20235760, THYMU20239430, THYMU20240710, THYMU20253250, THYMU20286290, TKIDN10000010, TKIDN20005210, TKIDN20030590, TRACH20005020, TRACH20005400, TRACH20007020, TRACH20019960, TRACH20034840, TRACH20079690, TRACH20128110, TRACH20149970, TRACH20183170, UMVEN10001860, UMVEN20003540, UTERU20000740, UTERU20030570, UTERU20054460, UTERU20055930, UTERU20056010, UTERU20064860, UTERU20065930, UTERU20070040, UTERU20081300, UTERU20084260, UTERU20094350, UTERU20120310, UTERU20124070, UTERU20164260, UTERU20168220, UTERU20183640, ASTRO20032120, ASTRO20125520, BRACE20039040, BRACE20060720, BRACE20062640, BRACE20090440, BRACE20099570, BRACE20111830, BRACE20142570, BRAWH20128270, BRCAN20280360, BRHIP20110800, BRHIP20176420, BRSSN20003120, CTONG20105660, CTONG20124010, CTONG20133480, CTONG20139070, CTONG20160560, FCBBF10001210, FCBBF10001550, FCBBF10001710, FCBBF10001820, FCBBF10002430, FCBBF10002700, FCBBF10002800, FCBBF10003220, FCBBF10003740, FCBBF10003760, FCBBF10005060, FCBBF10005460, FCBBF10005500, FCBBF20006780, FCBBF20014270, FCBBF20023700, FCBBF20032970, FCBBF20035280, FCBBF20042170, FCBBF20042560, FCBBF20051220, FCBBF20054280, FCBBF20056370, FCBBF20064520, FCBBF20067810, FCBBF20071860, FCBBF20072650, FCBBF20076330, FCBBF30008470, FCBBF30010810, FCBBF30012350, FCBBF30012810, FCBBF30015940, FCBBF30019120, FCBBF30024750, FCBBF30028180, FCBBF30033050, FCBBF30039020, FCBBF30052180, FCBBF30054440, FCBBF30057290, FCBBF30062880, FCBBF30070770, FCBBF30071520, FCBBF30078290, FCBBF30083620, FCBBF30123470, FCBBF30170590, FCBBF30172550, FCBBF30175310, FCBBF30178730, FCBBF30190850, FCBBF30195640, FCBBF30199610, FCBBF30215060, FCBBF30225660, FCBBF30240960, FCBBF30242250, FCBBF30243640, FCBBF30247930, FCBBF30252520, FCBBF30252800, FCBBF30252850, FCBBF30262510, FCBBF30266780, FCBBF30266920, FCBBF30278630, FCBBF30279030, FCBBF30281880, FCBBF30284720, FCBBF30285280, FCBBF40001730, FCBBF40005480, HCHON20007380, HEART20072310, HHDPC20068620, HLUNG20023340, KIDNE20017130, KIDNE20028830, MESAN20014500, NT2RP70072690, NT2RP70137640, NTONG20067090, PLACE60004630, PROST20083600, PROST20189770, RECTM20003490, SKNSH20008190, SMINT20115880, SPLEN20169720, SPLEN20194050, SPLEN20284240, TESTI20083940, TESTI20213150, TESTI20254540, TESTI20265250, TRACH20118940, UTERU20145480, UTERU20146680, ASTRO20155290, BRAWH20030250, BRAWH20113430, BRAWH20122770, BRHIP20005340, BRHIP30001110, BRSTN20002200, CTONG20052900, CTONG20108210, DFNES20031920, FEBRA10001900, FEBRA20003210, FEBRA20007620, FEBRA20009090, FEBRA20010120, FEBRA20017050, FEBRA20018280, FEBRA20025270, FEBRA20025520, FEBRA20026110, FEBRA20026280, FEBRA20029860, FEBRA20034680, FEBRA20037260, FEBRA20040530, FEBRA20042190, FEBRA20052910, FEBRA20060610, FEBRA20072120, FEBRA20079310, FEBRA20082010, FEBRA20088360, FEBRA20090290, FEBRA20092890, FEBRA20093520, FEBRA20097310, FEBRA20113560, FEBRA20125070, FEBRA20132740, FEBRA20140100, FEBRA20161120, FEBRA20166540, FEBRA20167390, FEBRA20171380, FEBRA20176800, FEBRA20184330, FEBRA20192420, FEBRA20195820, FEBRA20196370, FEBRA20196630, FEBRA20197110, FEBRA20211710, FEBRA20214970, FEBRA20215500, FEBRA20216360, FEBRA20222040, FEBRA20223220, FEBRA20225040, FEBRA20226010, FEBRA20229560, FEBRA20229630, FEBRA20232850, FEBRA20235500, HCHON20040020, KIDNE20102650, NT2RP70037240, PEBLM20072960, PLACE60169420, SKMUS20003610, SMINT20026890, SMINT20033400, SPLEN20020070, SPLEN20079510, TESTI20001000, TESTI20094020, THYMU20027560, THYMU20180280, THYMU20271250, TRACH20003590, UMVEN10001560, UTERU20022940, UTERU20046640, UTERU20119060, UTERU20144640, UTERU20176130, ASTRO20008010, BRACE20276430, BRAMY20103570, BRAMY20120910, BRAMY20162510, BRAMY20196000, BRAWH20164460, BRCAN20273640, BRCOC20105100, BRHIP20198190, BRHIP20222280, BRHIP20254480, BRHIP30004570, CTONG20028410, CTONG20091080, CTONG20103480, CTONG20126070, CTONG20139340, DFNES20001530, HCHON20008150, HHDPC20001040, HLUNG20016330, HLUNG20017120, IMR3220002430, KIDNE20007210, KIDNE20021910, KIDNE20124400, MESAN10001260, MESAN20029400, MESAN20121130, MESAN20153910, NT2NE20159740, NT2NE20177520, NT2RI20086220, NT2RI20250750, NT2RP60000850, NT2RP70044280, NT2RP70056750, NT2RP70081610, NTONG20009770, OCBBF10000540, OCBBF10001750, OCBBF20006770, OCBBF20013890, OCBBF20019830, OCBBF20020150, OCBBF20020830, OCBBF20023570, OCBBF20028050, OCBBF20028650, OCBBF20029800, OCBBF20030280, OCBBF20030910, OCBBF20035930, OCBBF20037440, OCBBF20041680, OCBBF20045330, OCBBF20046120, OCBBF20046470, OCBBF20046690, OCBBF20048660, OCBBF20050770, OCBBF20051610, OCBBF20053430, OCBBF20053490, OCBBF20053730, OCBBF20054200, OCBBF20054760, OCBBF20060300, OCBBF20062140, OCBBF20062410, OCBBF20066390, OCBBF20071210, OCBBF20071840, OCBBF20072240, OCBBF20073540, OCBBF20074140, OCBBF20076220, OCBBF20079310, OCBBF20079460, OCBBF20081380, OCBBF20082830, OCBBF20085200, OCBBF20086400, OCBBF20086910, OCBBF20088140, OCBBF20088220, OCBBF20091150, OCBBF20100400, OCBBF20103130, OCBBF20104040, OCBBF20105570, OCBBF20107090, OCBBF20107920, OCBBF20108580, OCBBF20108630, OCBBF20109310, OCBBF20111770, OCBBF20116850, OCBBF20118970, OCBBF20120390, OCBBF20121390, OCBBF20122620, OCBBF20124360, OCBBF20127040, OCBBF20127140, OCBBF20127550, OCBBF20128120, OCBBF20129360, OCBBF20130910, OCBBF20132850, OCBBF20140890, OCBBF20145760, OCBBF20148280, OCBBF20151150, OCBBF20153340, OCBBF20153350, OCBBF20155060, OCBBF20164670, OCBBF20170690, OCBBF20173060, OCBBF20173250, OCBBF20178150, OCBBF20180840, OCBBF20186870, OCBBF20189560, PEBLM20044520, PEBLM20071880, PLACE60060420, PROST20047390, PUAEN20003740, SMINT20029760, SPLEN20008820, SPLEN20084600, SPLEN20095550, SPLEN20099700, SPLEN20140800, SPLEN20173510, SPLEN20211220, SPLEN20250170, STOMA20067800, TESTI20031270, TESTI20116830, TESTI20121550, TESTI20234140, TESTI20442760, THYMU20039810, THYMU20070360, TRACH20033230, TRACH20084720, BRACE20067430, BRAWH10000930, BRHIP20003120, BRSSN20152380, FEBRA20024100, FEBRA20027810, FEBRA20037500, FEBRA20082100, FEBRA20098460, FEBRA20144170, FEBRA20145780, FEBRA20233770, HHDPC10000830, MESAN20025190, MESAN20089360, NT2RI20048840, NT2RP70043480, OCBBF20032460, OCBBF20039250, OCBBF20049300, OCBBF20061720, OCBBF20078920, OCBBF20084660, OCBBF20087010, PROST20087700, PROST20153320, TRACH20135520, ADIPS20004250, ASTRO10001650, BRACE20056810, BRACE20059370, BRACE20106690, BRACE20210140, BRAWH20103290, BRAWH20121640, BRHIP20005530, BRHIP20217620, BRHIP20218580, BRHIP20238880, CTONG20075860, CTONG20129960, FCBBF10000240, FCBBF10000630, FCBBF10001150, FCBBF10004120, FCBBF10005740, FCBBF20075560, FCBBF30018550, FCBBF30025560, FCBBF30086440, FCBBF30090690, FCBBF30189490, FCBBF30233680, FCBBF30240020, HCHON20007510, HCHON20016650, HHDPC20095280, KIDNE20002520, KIDNE20009470, NT2RI20003480, NT2RI20055790, NT2RP70027380, NT2RP70032610, NT2RP70062230, OCBBF10001850, OCBBF20022900, OCBBF20026630, OCBBF20049840, OCBBF20059560, OCBBF20068490, OCBBF20071960, OCBBF20080410, OCBBF20094240, OCBBF20097720, OCBBF20108190, OCBBF20108430, OCBBF20126780, OCBBF20130110, OCBBF20139260, OCBBF20148730, OCBBF20149280, OCBBF20164050, OCBBF20173980, OCBBF20178880, OCBBF20180120, OCBBF20188730, PROST20057930, SPLEN20162680, SPLEN20211940, TESTI20184620, TESTI20211240, TESTI20369690, THYMU20141670, TRACH20028030, UTERU20099720, UTERU20135860, BRACE20057190, BRHIP20191860, BRHIP20214950, FCBBF10003670, FCBBF10004370, FCBBF30013770, FCBBF30095260, FCBBF30246230, FEBRA20002100, FEBRA20034360, FEBRA20095140, FEBRA20130190, FEBRA20204060, HCHON20008320, LIVER20028420, TRACH20111130, ASTRO20108190, BRACE20003070, BRACE20060550, BRAWH20004600, BRAWH20011710, BRAWH20016620, BRHIP10001740, BRSTN10000830, CTONG10000940, CTONG20150910, D30ST10002670, FCBBF10000380, FCBBF10000770, FCBBF10003770, FCBBF20059090, FCBBF30016320, FCBBF30016570, FCBBF30049550, FCBBF30083820, FCBBF30238870, FCBBF40001420, FEBRA10001880, FEBRA20004620, FEBRA20080810, FEBRA20086620, FEBRA20095880, HHDPC20034390, HLUNG10000550, NT2RI20023160, NT2RI20023910, NT2RI20025400, NT2RI20028470, NT2RI20054050, NT2RI20076290, NT2RI20091730, NT2RI20091940, NT2RP70036880, NT2RP70078420, OCBBF20047570, OCBBF20080050, OCBBF20125530, OCBBF20140640, TRACH20032720, TRACH20141240, UTERU20004240
The result of comparative analysis of cDNA libraries derived from fetal heart (FEHRT) and adult heart (HEART) showed that the genes whose expression levels were different between the two were the following clones (Table 49).
FEHRT20003250, OCBBF20189560, BRAWH20029630, CTONG20150910, HCHON20007510, HEART20003060, HEART20005410, HEART20021840, HEART20025980, HEART20034320, HEART20037810, HEART20049400, HEART20049410, HEART20049800, HEART20061950, HEART20063340, HEART20067870, HEART20067890, HEART20072310, HEART20074430, HEART20077670, HEART20089940, HEART20090000, HEART20095990, HLUNG10000550, HLUNG20017120, KIDNE20028390, KIDNE20028830, NTONG20029480, OCBBF10001750, PROST20127800, SKMUS20001980, SKMUS20003610, SMINT20026890, SMINT20121220, SMINT20122910, SMINT20183530, SPLEN20008740, SPLEN20027440, SPLEN20162680, STOMA20062290, TESTI20254220, THYMU20271250, TRACH20141240, UTERU20004240
The result of comparative analysis of cDNA libraries derived from fetal kidney (FEKID) and adult kidney (KIDNE) showed that the genes whose expression levels were different between the two were the following clones (Table 50).
ASTRO10001650, ASTRO20108190, BGGI120006160, BRACE20039040, BRACE20060550, BRAMY20102080, BRAWH20004600, BRAWH20125380, BRAWH20162690, BRHIP20115760, BRHIP20205090, BRHIP20238880, CTONG20052650, CTONG20108210, CTONG20128470, CTONG20133480, CTONG20139070, D90ST20000310, DFNES20001530, FCBBF10001820, FEBRA20002100, HCHON20008980, HCHON20016650, HLUNG20033780, KIDNE20002520, KIDNE20003940, KIDNE20006780, KIDNE20007210, KIDNE20007770, KIDNE20008010, KIDNE20009470, KIDNE20011170, KIDNE20011400, KIDNE20013730, KIDNE20017130, KIDNE20018730, KIDNE20018970, KIDNE20020150, KIDNE20021680, KIDNE20021910, KIDNE20021980, KIDNE20022620, KIDNE20024830, KIDNE20027250, KIDNE20027950, KIDNE20028390, KIDNE20028830, KIDNE20029800, KIDNE20067330, KIDNE20079440, KIDNE20096280, KIDNE20096470, KIDNE20100070, KIDNE20100840, KIDNE20101370, KIDNE20101510, KIDNE20102650, KIDNE20102710, KIDNE20104300, KIDNE20106740, KIDNE20107390, KIDNE20107500, KIDNE20107620, KIDNE20109730, KIDNE20109890, KIDNE20112000, KIDNE20115080, KIDNE20118580, KIDNE20120090, KIDNE20121880, KIDNE20122910, KIDNE20124400, KIDNE20125630, KIDNE20126010, KIDNE20126130, KIDNE20127100, KIDNE20127450, KIDNE20127750, KIDNE20130450, KIDNE20131580, KIDNE20132180, KIDNE20137340, KIDNE20138010, KIDNE20141190, KIDNE20144890, KIDNE20148900, KIDNE20163880, KIDNE20180710, KIDNE20181660, KIDNE20182690, KIDNE20186780, KIDNE20190740, LIVER20035110, MESAN20025190, NOVAR20000380, NT2RI20054050, NT2RP70043480, PROST20107820, PROST20123530, PROST20161950, PUAEN20030180, SKMUS20003610, SMINT20033400, TBAES20000590, TESTI20044310, TESTI20082330, TRACH20032720, UTERU20099720, BRACE20003070, BRCOC20031870, CTONG20125640, FCBBF30016320, HCHON20002260, HLUNG10000550, PROST20130530, SPLEN20169720, SPLEN20194050, KIDNE20028720
The result of comparative analysis of cDNA libraries derived from fetal lung (FELNG) and adult lung (HLUNG) showed that the genes whose expression levels were different between the two were the following clones (Table 51).
BRACE20096200, BRAWH20004600, BRAWH20030250, BRCAN20006390, BRCAN20280360, BRHIP20238880, CTONG10000940, CTONG20103480, CTONG20129960, CTONG20155180, FCBBF10001210, FEBRA20144170, FEBRA20197110, HHDPC20034390, HLUNG20016330, HLUNG20016770, HLUNG20017120, HLUNG20023340, HLUNG20033780, HLUNG20084390, IMR3220002430, LIVER20028420, NOVAR20000380, NT2RI20054050, NT2RI20091730, NT2RP70044280, OCBBF20020830, OCBBF20125530, PLACE60004630, PROST20057930, PROST20107820, PROST20185830, PUAEN20030180, SMINT20121220, SPLEN20002220, SPLEN20054290, SPLEN20128000, SPLEN20157300, SPLEN20176200, SPLEN20179180, SPLEN20211940, STOMA20013890, TBAES20000590, TESTI20094230, TESTI20184620, TESTI20334410, THYMU20000570, THYMU20039810, TRACH20007020, TRACH20141240, TRACH20183170, D90ST20033970, FELNG20002410, HCHON20016650, KIDNE20029800, OCBBF20145760, SPLEN20162680, TESTI20214250, TRACH20005400, HCHON20002260, HLUNG10000550, NT2RI20023910, SPLEN20008740
These genes are involved in regeneration of tissues and/or cells.
EXAMPLE 8 Expression Frequency Analysis by PCRSpecific PCR primers were prepared based on the full-length nucleotide sequences, and the expression frequency was analyzed by the ATAC-PCR method (Adaptor-tagged competitive PCR method: Nucleic Acids Research 1997, 25(22): 4694-4696; “DNA Micro-array and Advanced PCR Techniques”, Cell Technology, supplement, Eds., Muramatsu and Nawa (Shujunsha, 2000): 104-112). Inflammation-related genes can be identified by revealing the genes whose expression levels are altered depending on the presence of an inflammation-inducing factor. Then, by using THP-1 cell line, which is a cell line of monocyte line, and TNF-α, which is inflammation-inducing factor, suitable for this system, the genes whose expression levels are altered depending on the presence of the factors were searched for by the system.
THP-1 cell line (purchased from DAINIPPON PHARMACEUTICAL) was cultured to be confluent in RPMI1640 medium (sigma) containing 5% fetal calf serum (GIBCO BRL). Then, the medium was changed with the medium containing 10 ng/ml TNF-α (human recombinant TNF-α; Pharmacia Biotech), and the culture was continued at 37° C. under 5% CO2. After three hours, the cells were harvested, and total RNA was extracted from them by using ISOGEN reagent (Nippon Gene). The extraction was carried out according to the method in the document attached to ISOGEN reagent. In addition, total RNA was also extracted from the cells cultured without stimulation of TNF-α.
The genes involved in the onset of gastritis and gastroduodenal ulcer induced by the infection of Helicobacter pylori to the epithelia of stomach can be identified by revealing the genes whose expression levels are altered depending on co-culturing the cells with Helicobacter pylori. A recent study has suggested that various substances derived from Helicobacter pylori trigger the inflammation reaction. In particular, the members belonging to the family of genes called “cag pathogenicity island (cag PAI)” contribute to the activation of the NF-KB pathway (Gastroenterology 2000, 119: 97-108). Further, it has been found that cag PAI is involved in the onset of gastritis and the like by the study using an animal model (Journal of Experimental Medicine 2000, 192:1601-1610). Then, by using co-culture of a gastric cancer cell line with cag PAI-positive Helicobacter pylori (TN2), suitable for this system, the genes whose expression levels are altered depending on the presence of Helicobacter pylori were searched for by the system. Further, in order to study the involvement of cag PAI in the alterations of gene expression levels depending on the co-culture with Helicobacter pylori, the altered expression levels were compared between the cells co-cultured with a strain of Helicobacter pylori (TN2ΔcagE strain) having a mutation in cagE, which is one of the cag PAI genes, and the cag PAI-positive strain (TN2).
A gastric cancer cell line MKN45 (provided by the Cell Bank, RIKEN GENE BANK, The Institute of Physical and Chemical Research) was cultured to be confluent in RPMI1640 medium (sigma) containing 10% fetal calf serum (GIBCO BRL). Then, the medium was changed with the medium containing 100-fold excess (in terms of the number of cells or the number of colonies) of Helicobacter pylori (cag PAI positive strain (TN2) and cagE mutant (TN2ΔcagE): both were provided by Prof. Omata, Faculty of Medicine, The University of Tokyo), as compared with the number of the cancer cells. The culture was continued at 37° C. under 5% CO2. After three hours, the cells were harvested, and total RNA was extracted from them by using ISOGEN reagent (Nippon Gene). The extraction was carried out according to the method in the document attached to ISOGEN reagent. In addition, total RNA was also extracted from the cells cultured without Helicobacter pylori.
The analysis by the ATAC-PCR method was carried out basically according to “DNA Micro-array and Advanced PCR Techniques”, Cell Technology, supplement (Genome Science Series 1, Eds., Muramatsu and Nawa (Shujunsha, 2000): 104-112). Adapter ligation to the internal standard sample (sample to make the calibration curve for the clone of interest) and test sample was carried out in the two separate reaction systems indicated below. The combination of 6 types of adapters (AD-1, AD-2, AD-3, AD-4, AD-5 and AD-6: see the sequences indicated below) and the samples are as follows.
Reaction System A
AD1; internal standard, 10-fold
AD2; THP-1 cells, unstimulated
AD3; internal standard, 3-fold
AD4; THP-1 cells, TNF-α stimulation for one hour
AD5; THP-1 cells, TNF-α stimulation for three hours
AD6; internal standard, 1-fold
Reaction system B
AD1; internal standard, 1-fold
AD2; MKN45 cells, unstimulated
AD3; internal standard, 3-fold
AD4; MKN45 cells, co-cultured with TN2(Helicobacter pylori)
AD5; internal standard, 10-fold
AD6; MKN45 cells, co-cultured with TN2AcagE(cagE gene mutant)
Adapter Sequences:
| SEQ ID NO: 4887// | |
| 5′-GTACATATTGTCGTTAGAACGCG-3′ | |
| SEQ ID NO: 4888// | |
| 3′-CATGTATAACAGCAATCTTGCGCCTAG-5′ | |
| AD2; | |
| SEQ ID NO: 4889// | |
| 5′-GTACATATTGTCGTTAGAACGCGACT-3′ | |
| SEQ ID NO: 4890// | |
| 3′-CATGTATAACAGCAATCTTGCGCTGACTAG-5′ | |
| AD3; | |
| SEQ ID NO: 4891// | |
| 5′-GTACATATTGTCGTTAGAACGCGCATACT-3′ | |
| SEQ ID NO: 4892// | |
| 3′-CATGTATAACAGCAATCTTGCGCGTATGACTAG-5′ | |
| AD4; | |
| SEQ ID NO: 4893// | |
| 5′-GTACATATTGTCGTTAGAACGCGATCCATACT-3′ | |
| SEQ ID NO: 4894// | |
| 3′-CATGTATAACAGCAATCTTGCGCTAGGTATGACTAG-5′ | |
| AD5; | |
| SEQ ID NO: 4895// | |
| 5′-GTACATATTGTCGTTAGAACGCGTCAATCCATACT-3′ | |
| SEQ ID NO: 4896// | |
| 3′-CATGTATAACAGCAATCTTGCGCAGTTAGGTATGACTAG-5′ | |
| AD6; | |
| SEQ ID NO: 4897// | |
| 5′-GTACATATTGTCGTTAGAACGCGTACTCAATCCATACT-3′ | |
| SEQ ID NO: 4898// | |
| 3′-CATGTATAACAGCAATCTTGCGCATGAGTTAGGTATGACTAG-5′ |
The internal standard sample used for this assay was a mixture of total RNAs from tissues (or culture cells; all from UNITECH) of Fetal Brain, Testis, Trachea, and Spleen. RNA was prepared according to the standard method.
The sequences of primers specific to the genes and the names of clones of interest in the analysis are as follows. The gene specific primers were designed to produce the PCR products of 70 to 200 bp, which are derived from the adapter-containing cDNA. The sequence of adapter-specific primer (labeled with fluorescence (FAM)) used in the competitive PCR was GTACATATTGTCGTTAGAACGC (22 nucleotides; SEQ ID NO: 4899). PCR was basically carried out with a cycling profile of preheating at 94° C. for 3 minutes, and 35 or 40 cycles of denaturation at 94° C. for 30 seconds/annealing at 50° C. for 60 seconds/extension at 72° C. for 90 seconds.
The nucleotide sequences of clone specific primers used in the experiments
Clone name, primer sequence and SEQ ID NO are indicated below in this order. Each is demarcated by a double slash mark (//). For a clone for which a primer used in Reaction system A (THP-1 cells) was different from a primer used in Reaction system B (MKN45 cells), the sequence of each of the primers was shown.
| 3NB6920014080// | SEQ ID NO: 4900 | ||
| GTCCTGAAGGTAGATGCT// | |||
| ADRGL20013010// | SEQ ID NO: 4901 | ||
| GGAGGATAGAGCTTGGAG// | |||
| ADRGL20067670// | SEQ ID NO: 4902 | ||
| ATAAAACAGGACCAAGGA// | |||
| ADRGL20083310// | SEQ ID NO: 4903 | ||
| AAATAAGGCTAAAATGGAACT// | |||
| ASTRO20032120// | SEQ ID NO: 4904 | ||
| AGTGCTCCCAATTATCCG// | |||
| ASTRO20084250// | SEQ ID NO: 4905 | ||
| TAGAAAATATGCTGGGTG// | |||
| ASTRO20152140// | SEQ ID NO: 4906 | ||
| TCATTCTTCTCCCACAGC// | |||
| ASTRO20166810// | SEQ ID NO: 4907 | ||
| AGTTTTATTTCCAGGCTATC// | |||
| ASTRO20181690// | SEQ ID NO: 4908 | ||
| ATGGAGAACAGGACAGCT// | |||
| BLADE20004630// | SEQ ID NO: 4909 | ||
| CAAACATCAACCAGAGAA// | |||
| BRACE20006400// | SEQ ID NO: 4910 | ||
| TCCCAATCAGCTAAGGTC// | |||
| BRACE20019540// | SEQ ID NO: 4911 | ||
| CAGGTTATCGAGAGTTACAT// | |||
| BRACE20038480// | SEQ ID NO: 4912 | ||
| TCTGGTTGGATTTTGTGC// | |||
| BRACE20039040// | SEQ ID NO: 4913 | ||
| TGAACTTTGTGGTCTGGT// | |||
| BRACE20039440// | SEQ ID NO: 4914 | ||
| TGAACAGTGACATTTTAGG// | |||
| BRACE20052160// | SEQ ID NO: 4915 | ||
| AAGAATAAAAGGGACGAG// | |||
| BRACE20053630// | SEQ ID NO: 4916 | ||
| GTTTGATACAGATGATTAGGTTA// | |||
| BRACE20057620// | SEQ ID NO: 4917 | ||
| GGACAGGTAAGAACTAGGC// | |||
| BRACE20058810// | SEQ ID NO: 4918 | ||
| ATCATCTTTCCAATCCAG// | |||
| BRACE20060720// | SEQ ID NO: 4919 | ||
| GTACCACCTGACCTTCTG// | |||
| BRACE20060840// | SEQ ID NO: 4920 | ||
| AGAAGTTTTATCCCACATTT// | |||
| BRACE20061740// | SEQ ID NO: 4921 | ||
| (Reaction system A)// | |||
| TAACATAACCCTCCCGTC// | |||
| //(Reaction system B)// | SEQ ID NO: 4922 | ||
| ATAGTGGTGACGTTCCCC// | |||
| BRACE20062640// | SEQ ID NO: 4923 | ||
| TCTGTTGCTGAAGGAAAA// | |||
| BRACE20063780// | SEQ ID NO: 4924 | ||
| TCCTGTGTGCTATTTGAA// | |||
| BRACE20067430// | SEQ ID NO: 4925 | ||
| AATAACAGCAACTCCAGA// | |||
| BRACE20090440// | SEQ ID NO: 4926 | ||
| CCCAACATTACCAAAAGT// | |||
| BRACE20101700// | SEQ ID NO: 4927 | ||
| CAACATTTTCAAGCACTG// | |||
| BRACE20114780// | SEQ ID NO: 4928 | ||
| GATGTTGGGGTTTGGAAG// | |||
| BRACE20151320// | SEQ ID NO: 4929 | ||
| ACCAGCTGCCCATAGAAG// | |||
| BRACE20152870// | SEQ ID NO: 4930 | ||
| GAAGGCAAGATGGTAAGT// | |||
| BRACE20163150// | SEQ ID NO: 4931 | ||
| CATAGAGAAAGCGGGGAA// | |||
| BRACE20165830// | SEQ ID NO: 4932 | ||
| (Reaction system A)// | |||
| TCTCCCTGTTCTCTCTTT// | |||
| //(Reaction system B)// | SEQ ID NO: 4933 | ||
| TATGACCCAAACGCCTAG// | |||
| BRACE20201570// | SEQ ID NO: 4934 | ||
| CCTTCTCATCTAGCTTGC// | |||
| BRACE20210140// | SEQ ID NO: 4935 | ||
| TACTGATTGGGAAGCACT// | |||
| BRACE20223330// | SEQ ID NO: 4936 | ||
| GTTGAAATGCTTGAGCAC// | |||
| BRACE20224500// | SEQ ID NO: 4937 | ||
| ATTTAGAGCGCCATCCTT// | |||
| BRACE20229280// | SEQ ID NO: 4938 | ||
| CTGAGGGTAAAGGAAGGG// | |||
| BRACE20235400// | SEQ ID NO: 4939 | ||
| TTTTACGATTGCCTTTGC// | |||
| BRACE20266750// | SEQ ID NO: 4940 | ||
| TTAGGAGTGAAGACAGGA// | |||
| BRACE20267250// | SEQ ID NO: 4941 | ||
| GTGCAGTGATAAGTGGCT// | |||
| BRACE20269710// | SEQ ID NO: 4942 | ||
| AGGCAGGGAAAGTAGGGT// | |||
| BRALZ20018340// | SEQ ID NO: 4943 | ||
| AGGAGAGGCTTGAGGACT// | |||
| BRALZ20058880// | SEQ ID NO: 4944 | ||
| AAGGGACCAAAATGAGAG// | |||
| BRALZ20059500// | SEQ ID NO: 4945 | ||
| AACAGCCCTCTAATGAAA// | |||
| BRALZ20064740// | SEQ ID NO: 4946 | ||
| ACTCATGTTGCTCCACCT// | |||
| BRALZ20069760// | SEQ ID NO: 4947 | ||
| TATGTATGGCTTTGAGCA// | |||
| BRALZ20075450// | SEQ ID NO: 4948 | ||
| GCTGAAGAAATGTGCTGC// | |||
| BRALZ20088690// | SEQ ID NO: 4949 | ||
| ATCATAGTTGTACATACTTTGGC// | |||
| BRAMY20002770// | SEQ ID NO: 4950 | ||
| TTCTTTCCTGTAATAGTTGG// | |||
| BRAMY20004110// | SEQ ID NO: 4951 | ||
| AGCTATCTGTGAAAGTCCT// | |||
| BRAMY20060920// | SEQ ID NO: 4952 | ||
| (Reaction system A)// | |||
| TGCTGTCTCGTGATAAAG// | |||
| //(Reaction system B)// | SEQ ID NO: 4953 | ||
| TTTCTAATGGTTTGGCAC// | |||
| BRAM20103570// | SEQ ID NO: 4954 | ||
| (Reaction system A)// | |||
| TCAACAGTGCTTTTCCTT// | |||
| //(Reaction system B)// | SEQ ID NO: 4955 | ||
| GACTCTTCTCCAGGGTGC// | |||
| BRAMY20144620// | SEQ ID NO: 4956 | ||
| CACGCCATTCTGTTAAAA// | |||
| BRAMY20152110// | SEQ ID NO: 4957 | ||
| AATGGGCTAAATATTGCT// | |||
| BRAMY20162510// | SEQ ID NO: 4958 | ||
| GCAAATACAGGTAAATGACAG// | |||
| BRAMY20163250// | SEQ ID NO: 4959 | ||
| CAAGAGAAATTAAAGAAGACC// | |||
| BRAMY20163270// | SEQ ID NO: 4960 | ||
| (Reaction system A)// | |||
| TGCTTTCAACTGTCATTT// | |||
| //(Reaction system B)// | SEQ ID NO: 4961 | ||
| GAATGATGCCCGATGTAG// | |||
| BRAMY20168920// | SEQ ID NO: 4962 | ||
| GAATATCCCTGTGGAGTC// | |||
| BRAMY20178640// | SEQ ID NO: 4963 | ||
| AGTCTCACTCTATTGCCA// | |||
| BRAMY20184670// | SEQ ID NO: 4964 | ||
| AACGAATAGCAGGGTAGC// | |||
| BRAMY20204450// | SEQ ID NO: 4965 | ||
| GGTGACTTACTGGCTGCA// | |||
| BRAMY20210400// | SEQ ID NO: 4966 | ||
| AAGATTAACCATACAACAGAAA// | |||
| BRAMY20215230// | SEQ ID NO: 4967 | ||
| TGAACAAGAAACACCAGT// | |||
| BRAMY20218670// | SEQ ID NO: 4968 | ||
| AGGAGGCACGGTAACAAT// | |||
| BRAMY20229800// | SEQ ID NO: 4969 | ||
| GTCTTCTGTCTCATGGGG// | |||
| BRAMY20229840// | SEQ ID NO: 4970 | ||
| AAAGTTCATGAGGGGCTG// | |||
| BRAMY20231720// | SEQ ID NO: 4971 | ||
| CAGCACAAAATCAGTTAAA// | |||
| BRAMY20247280// | SEQ ID NO: 4972 | ||
| GGTTTAGATTTATGAGACAAGA// | |||
| BRAMY20261680// | SEQ ID NO: 4973 | ||
| GTTACTGCAGGGCTTCAG// | |||
| BRAMY20266850// | SEQ ID NO: 4974 | ||
| TGCATGGAATTAAGGAGT// | |||
| BRAMY20267130// | SEQ ID NO: 4975 | ||
| AATCTGTAAAATGGGAATAAG// | |||
| BRAMY20277140// | SEQ ID NO: 4976 | ||
| (Reaction system A)// | |||
| ATGAGATTGTGTTGTCCA// | |||
| //(Reaction system B)// | SEQ ID NO: 4977 | ||
| TTCCAGCATTTTCGTTTT// | |||
| BRAMY20280720// | SEQ ID NO: 4978 | ||
| (Reaction system A)// | |||
| TTCCCAAGTCCAGATTTT// | |||
| //(Reaction system B)// | SEQ ID NO: 4979 | ||
| CTGAGGAGCAGTGACAAG// | |||
| BRAWH10000930// | SEQ ID NO: 4980 | ||
| GGGAGAGAAGAGTCCTGC// | |||
| BRAWH20015350// | SEQ ID NO: 4981 | ||
| GCTATGAAGACAACCAAACT// | |||
| BRAWH20017010// | SEQ ID NO: 4982 | ||
| AGGAAGACATGGGTCAGC// | |||
| BRAWH20029630// | SEQ ID NO: 4983 | ||
| GGAGTATCACCATGTAAAGA// | |||
| BRAWH20100690// | SEQ ID NO: 4984 | ||
| (Reaction system A)// | |||
| AAATGAGCACTCCATTCC// | |||
| //(Reaction system B)// | SEQ ID NO: 4985 | ||
| AATGAGCACTCCATTCCC// | |||
| BRAWH20106180// | SEQ ID NO: 4986 | ||
| (Reaction system A)// | |||
| CATTTTATTGTCACCCAC// | |||
| //(Reaction system B)// | SEQ ID NO: 4987 | ||
| CCTTTAACAGCATCTCTAGTG// | |||
| BRAWH20107540// | SEQ ID NO: 4988 | ||
| GTTGAGCTATTTGCAGAG// | |||
| BRAWH20110660// | SEQ ID NO: 4989 | ||
| CTTAGCAACTTTCCACAC// | |||
| BRAWH20118230// | SEQ ID NO: 4990 | ||
| GTCAGAAAACTCACACCA// | |||
| BRAWH20122770// | SEQ ID NO: 4991 | ||
| AAGTTGATAGGGAAGGTTT// | |||
| BRAWH20126190// | SEQ ID NO: 4992 | ||
| ACCATGTGCTCAGAATCA// | |||
| BRAWH20132190// | SEQ ID NO: 4993 | ||
| TAAGATTCACACGGTGGA// | |||
| BRAWH20138660// | SEQ ID NO: 4994 | ||
| GATGGAAAATGTAAGGCT// | |||
| BRAWH20139410// | SEQ ID NO: 4995 | ||
| CCATCCTCTACACAGCAG// | |||
| BRAWH20155950// | SEQ ID NO: 4996 | ||
| (Reaction system A)// | |||
| CTCTCATTTTGGCTCTGC// | |||
| //(Reaction system B)// | SEQ ID NO: 4997 | ||
| CTACTCCACCTCTGCTGC// | |||
| BRAWH20158530// | SEQ ID NO: 4998 | ||
| AGTTTTCTGATGGCCTTG// | |||
| BRCAN20060190// | SEQ ID NO: 4999 | ||
| AGGTAGCCCCAGAGTCAC// | |||
| BRCAN20147880// | SEQ ID NO: 5000 | ||
| ACTCAGCAATCAGGTCCA// | |||
| BRCAN20273340// | SEQ ID NO: 5001 | ||
| AATTATGAGATAGGATGTTAGCT// | |||
| BRCAN20273640// | SEQ ID NO: 5002 | ||
| CTGCACCGATTTTATAGC// | |||
| BRCAN20275130// | SEQ ID NO: 5003 | ||
| CACTATCCAGACACACCT// | |||
| BRCAN20280210// | SEQ ID NO: 5004 | ||
| CACTGGATTTTCTTCACTT// | |||
| BRCAN20280400// | SEQ ID NO: 5005 | ||
| GGAAGGATAGCAGTTGAT// | |||
| BRCOC20021550// | SEQ ID NO: 5006 | ||
| TCCAAGCAGAGTTTTCAC// | |||
| BRCOC20037400// | SEQ ID NO: 5007 | ||
| CAAGTCTGTTCATCTGGT// | |||
| BRCOC20105100// | SEQ ID NO: 5008 | ||
| (Reaction system A)// | |||
| ACTTGAGGTTTCTTGGCA// | |||
| //(Reaction system B)// | SEQ ID NO: 5009 | ||
| GATTCTTCCCCGACTCAG// | |||
| BRHIP10001740// | SEQ ID NO: 5010 | ||
| GTACACACCTGCTCCCAC// | |||
| BRHIP20001630// | SEQ ID NO: 5011 | ||
| GGTCAGTAAGTGGTTGTG// | |||
| BRHIP20096170// | SEQ ID NO: 5012 | ||
| TTATTTTGGATGCCCCTG// | |||
| BRHIP20103090// | SEQ ID NO: 5013 | ||
| ACTCCAACAACCTTCATT// | |||
| BRHIP20105710// | SEQ ID NO: 5014 | ||
| TTTCAAGTATCCTCCCCA// | |||
| BRHIP20110800// | SEQ ID NO: 5015 | ||
| TAGAACTGCCTCCAACCC// | |||
| BRHIP20111200// | SEQ ID NO: 5016 | ||
| TACTGAACGGTGACTGGC// | |||
| BRHIP20118910// | SEQ ID NO: 5017 | ||
| ACAGGAAGGGGAAAGAGT// | |||
| BRHIP20129720// | SEQ ID NO: 5018 | ||
| GAGGAGAGTGAGAAGGGG// | |||
| BRHIP20143860// | SEQ ID NO: 5019 | ||
| AGGTCAGGAGAACAAGCC// | |||
| BRHIP20173150// | SEQ ID NO: 5020 | ||
| CTTTTGCAGAGTTTTCCT// | |||
| BRHIP20175420// | SEQ ID NO: 5021 | ||
| TCTCTAGGGCAAAACATT// | |||
| BRHIP20186120// | SEQ ID NO 5022 | ||
| (Reaction system A)// | |||
| AATTGATACGCAGGGGAG// | |||
| //(Reaction system B)// | SEQ ID NO: 5023 | ||
| AAGGTCAGTTGAAGTGCT// | |||
| BRHIP20194940// | SEQ ID NO: 5024 | ||
| TAGAGAAGGTGAGGCCAG// | |||
| BRHIP20196410// | SEQ ID NO: 5025 | ||
| GGCATAGAAGTAATCAGAGA// | |||
| BRHIP20207430// | SEQ ID NO: 5026 | ||
| AAGCTGAACCCCAATAAA// | |||
| BRHIP20218580// | SEQ ID NO: 5027 | ||
| GATTACCAGAACACAGCC// | |||
| BRHIP20233090// | SEQ ID NO: 5028 | ||
| GTCCATTTACCAACCGCT// | |||
| BRHIP20284800// | SEQ ID NO: 5029 | ||
| CACATCTTTACATTTATTGCTATT// | |||
| BRHIP30004880// | SEQ ID NO: 5030 | ||
| TCTTCTCGTAGGGCTTGA// | |||
| BRSSN20046570// | SEQ ID NO: 5031 | ||
| AAACACGAAATGGATGAA// | |||
| BRSSN20142940// | SEQ ID NO: 5032 | ||
| AGAATCAGAGAAGCCGGT// | |||
| BRSSN20152380// | SEQ ID NO: 5033 | ||
| ATACCCATTTCAGTTCCT// | |||
| BRSSN20176820// | SEQ ID NO: 5034 | ||
| CAGTCCCAATACAGCTCA// | |||
| BRSSN20187310// | SEQ ID NO: 5035 | ||
| (Reaction system A)// | |||
| CAATGACTAGTTTGTGCA// | |||
| //(Reaction system B)// | SEQ ID NO: 5036 | ||
| AAAGAAGCCAGGAAGATT// | |||
| BRTHA20046390// | SEQ ID NO: 5037 | ||
| ACATGGAGCCTGGTTTAG// | |||
| CD34C30004240// | SEQ ID NO: 5038 | ||
| TGGAAGATACGGATAACTC// | |||
| CD34C30004940// | SEQ ID NO: 5039 | ||
| (Reaction system A)// | |||
| ACCACTGTTCTCTGGTGC// | |||
| //(Reaction system B)// | SEQ ID NO: 5040 | ||
| CCACCACTGTTCTCTGGT// | |||
| COLON20043180// | SEQ ID NO: 5041 | ||
| TCGGATTGGGTTAAGGTC// | |||
| CTONG10000620// | SEQ ID NO: 5042 | ||
| CTCCATTCATCAGACCAC// | |||
| CTONG20014280// | SEQ ID NO: 5043 | ||
| TCCAAAAGACAGAACAGC// | |||
| CTONG20095270// | SEQ ID NO: 5044 | ||
| GTTTTGTTCCCTGCTCAC// | |||
| CTONG20095290// | SEQ ID NO: 5045 | ||
| AACACAGCTCAACAACTC// | |||
| CTONG20096750// | SEQ ID NO: 5046 | ||
| TGACTAAGCATGGAGACT// | |||
| CTONG20100240// | SEQ ID NO: 5047 | ||
| AGTCATAATCATCTTCCTCA// | |||
| CTONG20103480// | SEQ ID NO: 5048 | ||
| GGTGGAGTAATGTATATAACGTAA// | |||
| CTONG20105660// | SEQ ID NO: 5049 | ||
| CCATTAACACAAACCAAA// | |||
| CTONG20121010// | SEQ ID NO: 5050 | ||
| GGAAGATGGGACCTCAGT// | |||
| CTONG20128470// | SEQ ID NO: 5051 | ||
| TTGGGGTATCTTGGAGCT// | |||
| CTONG20138030// | SEQ ID NO: 5052 | ||
| GGCATAGAAGTAATCAGAGA// | |||
| CTONG20139070// | SEQ ID NO: 5053 | ||
| TCAAACCTCCTATCTTCTG// | |||
| CTONG20146970// | SEQ ID NO: 5054 | ||
| TTTTAATCCTCAGTACATTTTC// | |||
| CTONG20158150// | SEQ ID NO: 5055 | ||
| AAATAGGTTGATGTTGGC// | |||
| CTONG20186320// | SEQ ID NO: 5056 | ||
| TGACTTTGGCCCTTTACC// | |||
| CTONG20265130// | SEQ ID NO: 5057 | ||
| GGGTAGGTGCTAGAAATC// | |||
| D3OST20006540// | SEQ ID NO: 5058 | ||
| GGAGACCACACATAACAT// | |||
| D3OST20037970// | SEQ ID NO: 5059 | ||
| CACTGACGAAAGGGAAGA// | |||
| D9OST20031370// | SEQ ID NO: 5060 | ||
| CGACTTGCCAGACTCACT// | |||
| DFNES10001850// | SEQ ID NO: 5061 | ||
| GTGGCTCAAAGTAGGATT// | |||
| DFNES20031920// | SEQ ID NO: 5062 | ||
| CTTACTCCAACCCAGGCT// | |||
| FCBBF10005060// | SEQ ID NO: 5063 | ||
| TGCATGTTTTCTTCCTCA// | |||
| FCBBF20032970// | SEQ ID NO: 5064 | ||
| CCAGACACAACAATACCA// | |||
| FCBBF20035280// | SEQ ID NO: 5065 | ||
| (Reaction system A)// | |||
| ATACAATTTGTGCCTGTTA// | |||
| //(Reaction system B)// | SEQ ID NO: 5066 | ||
| CGGTAAGTAGTCTTCATGTG// | |||
| FCBBF20054280// | SEQ ID NO: 5067 | ||
| GGTGCATCTGTACTTGAA// | |||
| FCBBF20071860// | SEQ ID NO: 5068 | ||
| TGGAGGAGTAGTTATCAGTTG// | |||
| FCBBF30001840// | SEQ ID NO: 5069 | ||
| AGTGCTCCCAATTATCCG// | |||
| FCBBF30016320// | SEQ ID NO: 5070 | ||
| GGCTACTCAAGGACACAG// | |||
| FCBBF30016570// | SEQ ID NO: 5071 | ||
| AGGGATAAGATGGCAGGT// | |||
| FCBBF30033050// | SEQ ID NO: 5072 | ||
| TCCTGTACTCCTTTCCAT// | |||
| FCBBF30071520// | SEQ ID NO: 5073 | ||
| CAGGCATAAGAGGTGGCT// | |||
| FCBBF30083820// | SEQ ID NO: 5074 | ||
| CCTGTGTGATACCAAATACT// | |||
| FCBBF30215060// | SEQ ID NO: 5075 | ||
| CAGCCCCAATTACTAGAA// | |||
| FCBBF30251420// | SEQ ID NO: 5076 | ||
| AGCATGTACTGGGAAAGC// | |||
| FCBBF30252520// | SEQ ID NO: 5077 | ||
| AGGGATAAAGAATGCAAA// | |||
| FCBBF30262360// | SEQ ID NO: 5078 | ||
| GAGCTTCAGGGGCATTTA// | |||
| FCBBF30266920// | SEQ ID NO: 5079 | ||
| ATACGCAATTTTCAGACC// | |||
| FCBBF30278630// | SEQ ID NO: 5080 | ||
| AAAAGACAACGATGCCTG// | |||
| FCBBF30285280// | SEQ ID NO: 5081 | ||
| AAAGCAAAGTGATATAGGAGT// | |||
| FCBBF40001420// | SEQ ID NO: 5082 | ||
| ACATTTCAGTCCATTCAC// | |||
| FEBRA10001880// | SEQ ID NO: 5083 | ||
| TTGTCATGGTGGTAATCC// | |||
| FEBRA20010120// | SEQ ID NO: 5084 | ||
| GGACCAGACTCACAAATT// | |||
| FEBRA20017050// | SEQ ID NO: 5085 | ||
| TATACTAAAACCCAGCCA// | |||
| FEBRA20034360// | SEQ ID NO: 5086 | ||
| CGGCAGCTAGAAAACCTC// | |||
| FEBRA20037260// | SEQ ID NO: 5087 | ||
| CGTTGGTTTTCTGGACAC// | |||
| FEBRA20037500// | SEQ ID NO: 5088 | ||
| CTCGGGCAGGATTAACTC// | |||
| FEBRA20082100// | SEQ ID NO: 5089 | ||
| AGAAGATGCTAGGTTTGC// | |||
| FEBRA20095880// | SEQ ID NO: 5090 | ||
| AGCATGTACTGGGAAAGC// | |||
| FEBRA20167390// | SEQ ID NO: 5091 | ||
| GCTTATGTTGCAGTTTCA// | |||
| FEBRA20176800// | SEQ ID NO: 5092 | ||
| TCAGTTTCAGGGGTCAAG// | |||
| FEBRA20226010// | SEQ ID NO: 5093 | ||
| TCAGGGTATCAGCTTTCC// | |||
| HCASM10000500// | SEQ ID NO: 5094 | ||
| TGTGGTGACTTACTGCCT// | |||
| HCHON20002260// | SEQ ID NO: 5095 | ||
| CTCTCCAACAAACTGCAC// | |||
| HCHON20008980// | SEQ ID NO: 5096 | ||
| CTGCTGCCTTACACAACC// | |||
| HCHON20009350// | SEQ ID NO: 5097 | ||
| AGGTAATGAGGAATGCAC// | |||
| HCHON20010990// | SEQ ID NO: 5098 | ||
| GATTCCACCCTCAAGATT// | |||
| HCHON20011160// | SEQ ID NO: 5099 | ||
| CTCCTCCACGCTTGTTTT// | |||
| HCHON20015230// | SEQ ID NO: 5100 | ||
| CTTGGTCACAGTTTTCAT// | |||
| HCHON20022470// | SEQ ID NO: 5101 | ||
| CACACTTTCAATCCGAGG// | |||
| HCHON20035130// | SEQ ID NO: 5102 | ||
| GTGGAAGATGCTCGACTG// | |||
| HCHON20043590// | SEQ ID NO: 5103 | ||
| AGGATTAGGTATTGCTTCTC// | |||
| HCHON20067220// | SEQ ID NO: 5104 | ||
| TAAGGAAAACCCAACCAC// | |||
| HCHON20076500// | SEQ ID NO: 5105 | ||
| GAAAGACACCTGGCACAC// | |||
| HEART20021840// | SEQ ID NO: 5106 | ||
| GTACCCCAAAAGAAACAT// | |||
| HEART20067870// | SEQ ID NO: 5107 | ||
| GAACTATCTAATCACATGGG// | |||
| HEART20083640// | SEQ ID NO: 5108 | ||
| (Reaction system A)// | |||
| TCTTGATGTCTCCTGCCT// | |||
| //(Reaction system B)// | SEQ ID NO: 5109 | ||
| CTCGGCTGGAAGGTAAAA// | |||
| HHDPC10000650// | SEQ ID NO: 5110 | ||
| ACTGGTAAGATATGGGCA// | |||
| HHDPC20034390// | SEQ ID NO: 5111 | ||
| CTCTCCCAAACTCAGGTC// | |||
| HHDPC20095280// | SEQ ID NO: 5112 | ||
| TGACCCAAAGACATACTG// | |||
| HLUNG10000550// | SEQ ID NO: 5113 | ||
| GATTTACTTCCGGTTTCG// | |||
| KIDNE20018970// | SEQ ID NO: 5114 | ||
| AAGAGAATAAGGCTGGGC// | |||
| KIDNE20028720// | SEQ ID NO: 5115 | ||
| AACAAAATAAGGGGCCAG// | |||
| KIDNE20079440// | SEQ ID NO: 5116 | ||
| AAGTTCATCTGGGTGTGG// | |||
| KIDNE20096470// | SEQ ID NO: 5117 | ||
| ATCACCTGGAGAGCTTTG// | |||
| KIDNE20106740// | SEQ ID NO: 5118 | ||
| AGGGACACTGAGAACTGG// | |||
| KIDNE20120090// | SEQ ID NO: 5119 | ||
| GAAGCAGGGAAGTGTGAG// | |||
| KIDNE20127750// | SEQ ID NO: 5120 | ||
| GCTATTACACATTCTGCATT// | |||
| KIDNE20130450// | SEQ ID NO: 5121 | ||
| CAGCTACTTGGGACAGGA// | |||
| KIDNE20132180// | SEQ ID NO: 5122 | ||
| (Reaction system A)// | |||
| ACCAGCTCAGCAAGAACT// | |||
| //(Reaction system B)// | SEQ ID NO: 5123 | ||
| CTCTGACATGAACTGGTG// | |||
| KIDNE20141190// | SEQ ID NO: 5124 | ||
| CACATTGCCTAGAGAAAG// | |||
| KIDNE20148900// | SEQ ID NO: 5125 | ||
| ACAACAGCAGATGACTCG// | |||
| KIDNE20163880// | SEQ ID NO: 5126 | ||
| CAGTCACATCTCCCTTTA// | |||
| KIDNE20182690// | SEQ ID NO: 5127 | ||
| TCACTGTATCACCATCTG// | |||
| LIVER10004790// | SEQ ID NO: 5128 | ||
| TCCCTGCTAAGATGTTGA// | |||
| LIVER20011130// | SEQ ID NO: 5129 | ||
| GAGGTCAAGGACACACAG// | |||
| LIVER20038540// | SEQ ID NO: 5130 | ||
| (Reaction system A)// | |||
| AAGCAATGTGGCAGACTC// | |||
| //(Reaction system B)// | SEQ ID NO: 5131 | ||
| AGTGGGTTCTTTATCATTTT// | |||
| LIVER20055440// | SEQ ID NO: 5132 | ||
| GTTTGCCAGGGAATGTTT// | |||
| LIVER20062510// | SEQ ID NO: 5133 | ||
| GTAACGTGCTCTGAATGA// | |||
| LIVER20085800// | SEQ ID NO: 5134 | ||
| GCTCTGCTGTTTCTAATTT// | |||
| MAMGL10000830// | SEQ ID NO: 5135 | ||
| TCGATACGTGGAAGAATT// | |||
| MESAN20031900// | SEQ ID NO: 5136 | ||
| TCCCAAGGCTGTAGTTCA// | |||
| MESAN20121130// | SEQ ID NO: 5137 | ||
| AGCTTGTATCTAAATTCGTG// | |||
| MESAN20127350// | SEQ ID NO: 5138 | ||
| CAGAAGACAGGTTGCCAG// | |||
| MESAN20130220// | SEQ ID NO: 5139 | ||
| CCTAAGATTGGTCGTCCT// | |||
| MESAN20154010// | SEQ ID NO: 5140 | ||
| ATCCTGTCATCTTTTCGC// | |||
| MESAN20174170// | SEQ ID NO: 5141 | ||
| TGGCTAAGGTTCTCAGGA// | |||
| NOVAR10001020// | SEQ ID NO: 5142 | ||
| GGGTCAGTAAATCTAATGC// | |||
| NT2NE20053580// | SEQ ID NO: 5143 | ||
| CAAAACACAGAGTTATCAGAA// | |||
| NT2NE20089610// | SEQ ID NO: 5144 | ||
| TGCTGTCCTAGAAGAATAAA// | |||
| NT2NE20089970// | SEQ ID NO: 5145 | ||
| ACAATTATACTGGAAAAGCA// | |||
| NT2NE20146810// | SEQ ID NO: 5146 | ||
| GCTGAGACCTTTTGCTAG// | |||
| NT2NE20155110// | SEQ ID NO: 5147 | ||
| AGCCGAGGTTTTGAGTTA// | |||
| NT2NE20156260// | SEQ ID NO: 5148 | ||
| ACATTTGCACTGGAACTG// | |||
| NT2NE20158600// | SEQ ID NO: 5149 | ||
| CTCAGAAGCCCAGCAATT// | |||
| NT2NE20172590// | SEQ ID NO: 5150 | ||
| ACATCATAATCAAGCAGTAAA// | |||
| NT2NE20174920// | SEQ ID NO: 5151 | ||
| AGGACAGCAACAAGAGAG// | |||
| NT2NE20181650// | SEQ ID NO: 5152 | ||
| AGAGCTGATTTATACGCA// | |||
| NT2RI20005750// | SEQ ID NO: 5153 | ||
| AAGGAGTCTACGAAGCAC// | |||
| NT2RI20009870// | SEQ ID NO: 5154 | ||
| AAGATGACCCCGAGTTTG// | |||
| NT2RI20023160// | SEQ ID NO: 5155 | ||
| CATGCAAATAGAGGACTG// | |||
| NT2RI20040930// | SEQ ID NO: 5156 | ||
| CCATACTGTTCTCTGCTG// | |||
| NT2RI20046080// | SEQ ID NO: 5157 | ||
| CCGTAACTTTTATATGCCTG// | |||
| NT2RI20055790// | SEQ ID NO: 5158 | ||
| GCAAGAGCTACAGACAAA// | |||
| NT2RI20069730// | SEQ ID NO: 5159 | ||
| AGTGTGCAGAAATCCGTG// | |||
| NT2RI20203900// | SEQ ID NO: 5160 | ||
| AGCAGTAGCACAGCCTTA// | |||
| NT2RP70062230// | SEQ ID NO: 5161 | ||
| (Reaction system A)// | |||
| ACTCTAACACATTTGGCA// | |||
| //(Reaction system B)// | SEQ ID NO: 5162 | ||
| TATTAGTGTCAGCTGGCA// | |||
| NT2RP70102350// | SEQ ID NO: 5163 | ||
| (Reaction system A)// | |||
| ATAGGAGGTGTCATGCCC// | |||
| //(Reaction system B)// | SEQ ID NO: 5164 | ||
| TCTTTTGACCTACACTGC// | |||
| NT2RP70110860// | SEQ ID NO: 5165 | ||
| GGGGAAGGGAGTAAGGTC// | |||
| NT2RP70111320// | SEQ ID NO: 5166 | ||
| ACTTAGCATCCAGACCTC// | |||
| NT2RP70130020// | SEQ ID NO: 5167 | ||
| ATACTCTCTGCTCATGGA// | |||
| NT2RP70143480// | SEQ ID NO: 5168 | ||
| TTCTTGGCATCCTTCATT// | |||
| NT2RP70150800// | SEQ ID NO: 5169 | ||
| (Reaction system A)// | |||
| GAGGCTTGTCTAGGGGAA// | |||
| //(Reaction system B)// | SEQ ID NO: 5170 | ||
| GAACAAGGGATGCAGGAT// | |||
| NT2RP70157890// | SEQ ID NO: 5171 | ||
| (Reaction system A)// | |||
| TATGTGATGTTTTCCCCA// | |||
| //(Reaction system B)// | SEQ ID NO: 5172 | ||
| CTGCCTAAATAACACTGAAG// | |||
| NT2RP70169110// | SEQ ID NO: 5173 | ||
| CTGTCCTCATCTGTGCAT// | |||
| NT2RP70175670// | SEQ ID NO: 5174 | ||
| GGTAGAACGGGAAATCAT// | |||
| NT2RP70188020// | SEQ ID NO: 5175 | ||
| AGGTTTGAGTAGAGGGAA// | |||
| NT2RP70188710// | SEQ ID NO: 5176 | ||
| ATACAGCAGGGAAGAGGC// | |||
| NT2RP70190640// | SEQ ID NO: 5177 | ||
| CAATGTGTCTTCAGTTTCC// | |||
| NTONG20029480// | SEQ ID NO: 5178 | ||
| TCTTGATGTCTCCTGCCT// | |||
| NTONG20064840// | SEQ ID NO: 5179 | ||
| AAAGCCATCGTACACCAT// | |||
| NTONG20067090// | SEQ ID NO: 5180 | ||
| AATTCTTTAGCTCTGTTGC// | |||
| NTONG20070340// | SEQ ID NO: 5181 | ||
| ATCCACTGCCCCTTATCA// | |||
| NTONG20077560// | SEQ ID NO: 5182 | ||
| CTGCTAGAATACGCCTTA// | |||
| NTONG20083650// | SEQ ID NO: 5183 | ||
| CTCATAGTTCAAGGCAGC// | |||
| NTONG20090680// | SEQ ID NO: 5184 | ||
| GAGTAAGGTCGTAGTCAGTG// | |||
| OCBBF20005230// | SEQ ID NO: 5185 | ||
| GCAAGACCTACAGACAAA// | |||
| OCBBF20019380// | SEQ ID NO: 5186 | ||
| GTGGTCAGTGGAAAATGG// | |||
| OCBBF20020150// | SEQ ID NO: 5187 | ||
| GGGACAGTATGGCAGAGA// | |||
| OCBBF20020830// | SEQ ID NO: 5188 | ||
| GCTTGCCATAGGTGTACT// | |||
| OCBBF20039250// | SEQ ID NO: 5189 | ||
| TTTCAGCAGTTAAGTGTTTT// | |||
| OCBBF20041680// | SEQ ID NO: 5190 | ||
| TCAGAAGGTATGCCCACT// | |||
| OCBBF20047570// | SEQ ID NO: 5191 | ||
| ACCCTTATGTCAAACTGC// | |||
| OCBBF20051610// | SEQ ID NO: 5192 | ||
| TTTTCCTACCTGCAATGG// | |||
| OCBBF20054200// | SEQ ID NO: 5193 | ||
| GTCACAAGCCATACGTGC// | |||
| OCBBF20061720// | SEQ ID NO: 5194 | ||
| CAAAGTGGCCTAAACCCT// | |||
| OCBBF20062140// | SEQ ID NO: 5195 | ||
| CTGGGGAGATAAGAGCCT// | |||
| OCBBF20071960// | SEQ ID NO: 5196 | ||
| (Reaction system A)// | |||
| CTCAGTCACGCAATAGAT// | |||
| //(Reaction system B)// | SEQ ID NO: 5197 | ||
| TCTCTGGAAGGGAAAATT// | |||
| OCBBF20072320// | SEQ ID NO: 5198 | ||
| AAGAAGGAATGGGCACAC// | |||
| OCBBF20079310// | SEQ ID NO: 5199 | ||
| CAGTAGCAAAACCAGAGC// | |||
| OCBBF20081380// | SEQ ID NO: 5200 | ||
| GTGGAAGTGCCTGATGAG// | |||
| OCBBF20085200// | SEQ ID NO: 5201 | ||
| TACAGGGTCAGTTGGCAG// | |||
| OCBBF20094240// | SEQ ID NO: 5202 | ||
| ACACAATTCATCACTGCT// | |||
| OCBBF20107920// | SEQ ID NO: 5203 | ||
| GGTTGCTGTGAGTGCATT// | |||
| OCBBF20127040// | SEQ ID NO: 5204 | ||
| TAGAGGAGGCAGTAAGGG// | |||
| OCBBF20130110// | SEQ ID NO: 5205 | ||
| AGTGTCTATGGCTCTTCC// | |||
| OCBBF20139260// | SEQ ID NO: 5206 | ||
| GGGTGGTTCTGTTAGGAG// | |||
| OCBBF20164050// | SEQ ID NO: 5207 | ||
| TGCTGGAAATAATCGCTT// | |||
| OCBBF20178990// | SEQ ID NO: 5208 | ||
| TGAGTGTGGTGAAGATAGT// | |||
| OCBBF20180840// | SEQ ID NO: 5209 | ||
| AGAAACCTGAACGATGTC// | |||
| PEBLM10000240// | SEQ ID NO: 5210 | ||
| ATTACGATGCTTTGTTCA// | |||
| PEBLM20013120// | SEQ ID NO: 5211 | ||
| TAAAATTCTTGTGGTTGG// | |||
| PEBLM20024550// | SEQ ID NO: 5212 | ||
| TTGTGCCCTTAGAAAATC// | |||
| PEBLM20052820// | SEQ ID NO: 5213 | ||
| CCTGATAACCATGAATTG// | |||
| PEBLM20074370// | SEQ ID NO: 5214 | ||
| AGCATTTGGTTTTATACTGTTA// | |||
| PERIC20002140// | SEQ ID NO: 5215 | ||
| CGTTACCATCACAATTTCA// | |||
| PERIC20004780// | SEQ ID NO: 5216 | ||
| ACTTGAGCAGAGGAGAGC// | |||
| PLACE60003480// | SEQ ID NO: 5217 | ||
| ACTGGTATTTGCTGTGAA// | |||
| PLACE60136720// | SEQ ID NO: 5218 | ||
| AGGAACAGAGGCTACATC// | |||
| PLACE60155130// | SEQ ID NO: 5219 | ||
| GTCTAGCTGGGATGATGG// | |||
| PLACE60169420// | SEQ ID NO: 5220 | ||
| AAGACCCCGATAGAGAGC// | |||
| PLACE60181070// | SEQ ID NO: 5221 | ||
| CCTTCTTCAGTCTTGCAC// | |||
| PROST10004800// | SEQ ID NO: 5222 | ||
| AGTTTTGTTCACCCCTCC// | |||
| PROST20120160// | SEQ ID NO: 5223 | ||
| TAGAATGGTGGGAAGTGG// | |||
| PROST20144220// | SEQ ID NO: 5224 | ||
| TTAGTGGTCTGTTGATAGTTTT// | |||
| PROST20149160// | SEQ ID NO: 5225 | ||
| TTGGCCTTAGGTGAGTCC// | |||
| PROST20149250// | SEQ ID NO: 5226 | ||
| GGTACATAAGGAATCGCT// | |||
| PROST20151240// | SEQ ID NO: 5227 | ||
| (Reaction system A)// | |||
| ACTCTCGCTTCCTGTCAC// | |||
| //(Reaction system B)// | SEQ ID NO: 5228 | ||
| GACGGACCCTTGACATTA// | |||
| PROST20153320// | SEQ ID NO: 5229 | ||
| ACTGTGGAGAAGGAGGGA// | |||
| PROST20161950// | SEQ ID NO: 5230 | ||
| ATTTGACGTATCCATGCC// | |||
| PROST20189770// | SEQ ID NO: 5231 | ||
| TGGTAAGTGGTGGAAGCT// | |||
| PUAEN20003740// | SEQ ID NO: 5232 | ||
| CCAAAACAATAATCCAACAT// | |||
| PUAEN20011880// | SEQ ID NO: 5233 | ||
| AGCCGTTGTCATCATAGA// | |||
| PUAEN20015260// | SEQ ID NO: 5234 | ||
| ATTGGAAGTCCCTATGAT// | |||
| PUAEN20025680// | SEQ ID NO: 5235 | ||
| CTCCTCTGAAGTAGCTGC// | |||
| PUAEN20040670// | SEQ ID NO: 5236 | ||
| AATGGTTCTCTGGCTTGG// | |||
| PUAEN20045250// | SEQ ID NO: 5237 | ||
| CAAAATGGTTAAACACAAA// | |||
| PUAEN20078980// | SEQ ID NO: 5238 | ||
| AGAAAGGCACACAATAAA// | |||
| PUAEN20085150// | SEQ ID NO: 5239 | ||
| AATTTAGGGGAACTGAGTAC// | |||
| SKMUS20018230// | SEQ ID NO: 5240 | ||
| TTCGCTCTTATCACCCAG// | |||
| SKMUS20028210// | SEQ ID NO: 5241 | ||
| ACTTCCCTTGGAATTGCT// | |||
| SKMUS20031680// | SEQ ID NO: 5242 | ||
| CAGAAGAACAGGAGGCAC// | |||
| SKMUS20046670// | SEQ ID NO: 5243 | ||
| GCAACGTCTTACTGTGAA// | |||
| SKNSH20062340// | SEQ ID NO: 5244 | ||
| GACATTGACGTATTCTAACTG// | |||
| SKNSH20080430// | SEQ ID NO: 5245 | ||
| TACCCTCCGCTGTGTTAG// | |||
| SMINT20001760// | SEQ ID NO: 5246 | ||
| CTCCTCCAGCTCTTGTCC// | |||
| SMINT20013480// | SEQ ID NO: 5247 | ||
| GGCACGTTTTAATATACCAC// | |||
| SMINT20014580// | SEQ ID NO: 5248 | ||
| CCCTCCAGACAGTTCAAA// | |||
| SMINT20033400// | SEQ ID NO: 5249 | ||
| CGATGGGTAGGACTTAAA// | |||
| SMINT20047810// | SEQ ID NO: 5250 | ||
| (Reaction system A)// | |||
| CTCCTGACATTTCCTTTT// | |||
| //(Reaction system B)// | SEQ ID NO: 5251 | ||
| TAGGAAAAGAAGCAGGGC// | |||
| SMINT20051610// | SEQ ID NO: 5252 | ||
| AGTGAGGTTAGGGAAATATC// | |||
| SMINT20056210// | SEQ ID NO: 5253 | ||
| TATTCCTGTTTGATGGGG// | |||
| SMINT20060780// | SEQ ID NO: 5254 | ||
| TCTGTAATAGGGAGGTGTC// | |||
| SMINT20080540// | SEQ ID NO: 5255 | ||
| GAGGTACTTTTCAGACAGG// | |||
| SMINT20105000// | SEQ ID NO: 5256 | ||
| (Reaction system A)// | |||
| AAAATGAGGTTCAGTCCC// | |||
| //(Reaction system B)// | SEQ ID NO: 5257 | ||
| TCACCTCCCCATTAACTG// | |||
| SMINT20108530// | SEQ ID NO: 5258 | ||
| CACCCTCGTTTTCTTTAG// | |||
| SMINT20122850// | SEQ ID NO: 5259 | ||
| AGCTAAATCCACTGAGGT// | |||
| SMINT20122910// | SEQ ID NO: 5260 | ||
| GGACAGACTTGCAGAGAA// | |||
| SMINT20153530// | SEQ ID NO: 5261 | ||
| GGGCCTAGAGTGGAAGTG// | |||
| SMINT20161220// | SEQ ID NO: 5262 | ||
| AGAACCAGTCCAAGCCAT// | |||
| SMINT20163960// | SEQ ID NO: 5263 | ||
| TTGATAAAATAGAGCCCA// | |||
| SMINT20164770// | SEQ ID NO: 5264 | ||
| AGTGTGCAGAAATCCGTG// | |||
| SMINT20168570// | SEQ ID NO: 5265 | ||
| (Reaction system A)// | |||
| TGGTCCTCATGGTACAGC// | |||
| //(Reaction system B)// | SEQ ID NO: 5266 | ||
| ATGGCTGCTAGCTTGTCA// | |||
| SPLEN20008820// | SEQ ID NO: 5267 | ||
| CTGTCTGCCCTGAATCTT// | |||
| SPLEN20011410// | SEQ ID NO: 5268 | ||
| TTTTGGGACTGGAAGGAG// | |||
| SPLEN20013540// | SEQ ID NO: 5269 | ||
| TCACTCACACCAATCCTG// | |||
| SPLEN20019450// | SEQ ID NO: 5270 | ||
| TTCGTAAACATCTGGGCA// | |||
| SPLEN20022230// | SEQ ID NO: 5271 | ||
| AAGTTGCACCCAGACATC// | |||
| SPLEN20040600// | SEQ ID NO: 5272 | ||
| TCTTATTTCACAGTTTCCA// | |||
| SPLEN20076530// | SEQ ID NO: 5273 | ||
| CCCCACAGAACACTTACT// | |||
| SPLEN20111190// | SEQ ID NO: 5274 | ||
| AGACGTAGCAGCAACTCC// | |||
| SPLEN20126190// | SEQ ID NO: 5275 | ||
| TAGACCCAACCCTCACAC// | |||
| SPLEN20152760// | SEQ ID NO: 5276 | ||
| TGAGACGAATTGGTAAAA// | |||
| SPLEN20157300// | SEQ ID NO: 5277 | ||
| CTTGACATTTGCTCTCCA// | |||
| SPLEN20158990// | SEQ ID NO: 5278 | ||
| AAAACTGGGTCAAATAAAA// | |||
| SPLEN20163560// | SEQ ID NO: 5279 | ||
| TGCCCAGATAGAAAAGTG// | |||
| SPLEN20174260// | SEQ ID NO: 5280 | ||
| GGCCTTGTTGAATCTGAA// | |||
| SPLEN20211570// | SEQ ID NO: 5281 | ||
| CTCAACACAACTCCAAGC// | |||
| SPLEN20214580// | SEQ ID NO: 5282 | ||
| CCAAACGAATGTCAAGCT// | |||
| SPLEN20245300// | SEQ ID NO: 5283 | ||
| ATCTGCTCTTCATCCCTT// | |||
| SPLEN20279950// | SEQ ID NO: 5284 | ||
| CCTGTTCCTACACCGCAT// | |||
| SPLEN20280660// | SEQ ID NO: 5285 | ||
| GGCCAGACAGGAAGAGTT// | |||
| SPLEN20283650// | SEQ ID NO: 5286 | ||
| AAGTTGATGCTCCTGTTG// | |||
| SPLEN20329240// | SEQ ID NO: 5287 | ||
| (Reaction system A)// | |||
| TAACACATGGACTGCTGG// | |||
| //(Reaction system B)// | SEQ ID NO: 5288 | ||
| AAGGTAGGAAATGCCAGC// | |||
| STOMA20010250// | SEQ ID NO: 5289 | ||
| TTTTGACCATAAGCTCCT// | |||
| STOMA20032890// | SEQ ID NO: 5290 | ||
| CGAGAAATAACTAATACACCTG// | |||
| STOMA20048520// | SEQ ID NO: 5291 | ||
| GAGGGTGAAGCAGGTAGG// | |||
| STOMA20057820// | SEQ ID NO: 5292 | ||
| GGCATTTCCCTTGTATATT// | |||
| STOMA20062290// | SEQ ID NO: 5293 | ||
| CCGTGTATTCAGCTCCCT// | |||
| STOMA20076800// | SEQ ID NO: 5294 | ||
| TAAACGGGAATCAGGAAG// | |||
| TESTI20001170// | SEQ ID NO: 5295 | ||
| TTTCAGACATATCAAGTTCA// | |||
| TESTI20002780// | SEQ ID NO: 5296 | ||
| ATTCCAGCCATACGGTTA// | |||
| TESTI20004890// | SEQ ID NO: 5297 | ||
| AAAACCACAGGAAGAAAG// | |||
| TESTI20011200// | SEQ ID NO: 5298 | ||
| TACAAGTTCACCTGCATT// | |||
| TESTI20018230// | SEQ ID NO: 5299 | ||
| AACCACTCAGCAGAAAGA// | |||
| TESTI20035960// | SEQ ID NO: 5300 | ||
| TGTCCATAGAGCCAGTTA// | |||
| TESTI20038270// | SEQ ID NO: 5301 | ||
| GTTCTGTTGGAGGTGCTG// | |||
| TESTI20044230// | SEQ ID NO: 5302 | ||
| AGGTCTTTTGTGTGCTGA// | |||
| TESTI20046750// | SEQ ID NO: 5303 | ||
| GTAGTTGTCCTGCATGGC// | |||
| TESTI20060400// | SEQ ID NO: 5304 | ||
| GGCCAGGATACTACACTT// | |||
| TESTI20066770// | SEQ ID NO: 5305 | ||
| AACTGGCATTGGAGACCT// | |||
| TESTI20076850// | SEQ ID NO: 5306 | ||
| TTGGTTTGTGATGTTAAGT// | |||
| TESTI20083940// | SEQ ID NO: 5307 | ||
| TTTGTCTTCCGGTAGTTA// | |||
| TESTI20087620// | SEQ ID NO: 5308 | ||
| TGCCACTCTTGAAAACTC// | |||
| TESTI20098530// | SEQ ID NO: 5309 | ||
| TCCATTACACAACAGCCT// | |||
| TESTI20105720// | SEQ ID NO: 5310 | ||
| GGCAGACTTGTTTGAGCT// | |||
| TESTI20108720// | SEQ ID NO: 5311 | ||
| TAGTTCTGTTGAGGCCCC// | |||
| TESTI20123080// | SEQ ID NO: 5312 | ||
| (Reaction system A)// | |||
| CCTGTTTCTCTTCCTGAA// | |||
| //(Reaction system B)// | SEQ ID NO: 5313 | ||
| CTAAGTCCAGAAGCCTCG// | |||
| TESTI20128350// | SEQ ID NO: 5314 | ||
| ATACCATGCTCCAACACC// | |||
| TESTI20136100// | SEQ ID NO: 5315 | ||
| TTCACTTTTGTTCTCCAG// | |||
| TESTI20137670// | SEQ ID NO: 5316 | ||
| CCTCCACTCTTCCTGTTG// | |||
| TESTI20143240// | SEQ ID NO: 5317 | ||
| CTAAGAAGTCCTGGTTGG// | |||
| TESTI20143620// | SEQ ID NO: 5318 | ||
| (Reaction system A)// | |||
| TTTTGTCTGAATTTGGAA// | |||
| //(Reaction system B)// | SEQ ID NO: 5319 | ||
| TGTAGAAAGCCTAACCCC// | |||
| TESTI20156100// | SEQ ID NO: 5320 | ||
| ACTGGGCACATTCATAAA// | |||
| TESTI20161970// | SEQ ID NO: 5321 | ||
| GTTCTATGCCTTGAGCCT// | |||
| TESTI20168480// | SEQ ID NO: 5322 | ||
| AACTCTGGGTACCAACTT// | |||
| TESTI20168960// | SEQ ID NO: 5323 | ||
| CTCCCTCTCCTTTCCTCA// | |||
| TESTI20178160// | SEQ ID NO: 5324 | ||
| CGTTTTCTCGATGTCCAG// | |||
| TESTI20185810// | SEQ ID NO: 5325 | ||
| AACATTCCTTGCAGCTCA// | |||
| TESTI20199170// | SEQ ID NO: 5326 | ||
| AGAGTGAGCTGTGCCTTG// | |||
| TESTI20200260// | SEQ ID NO: 5327 | ||
| CCAAGACATACCCAGGCT// | |||
| TESTI20200710// | SEQ ID NO: 5328 | ||
| AATTGTGACAAGCAGCAG// | |||
| TESTI20202650// | SEQ ID NO: 5329 | ||
| TGTTCATGTCACTGGCTG// | |||
| TESTI20220100// | SEQ ID NO: 5330 | ||
| (Reaction system A)// | |||
| CTTCATAGGGCAGACTCC// | |||
| //(Reaction system B)// | SEQ ID NO: 5331 | ||
| GCTGTGAACTAGAGGGGC// | |||
| TESTI20224620// | SEQ ID NO: 5332 | ||
| GGAGAAACCGATGAAGAA// | |||
| TESTI20229600// | SEQ ID NO: 5333 | ||
| (Reaction system A)// | |||
| TTTAATAGTGCCCTGTGG// | |||
| //(Reaction system B)// | SEQ ID NO: 5334 | ||
| CTCTGGAATTTGCATTGA// | |||
| TESTI20230850// | SEQ ID NO: 5335 | ||
| CAAGACTATGGAGGGGAG// | |||
| TESTI20231920// | SEQ ID NO: 5336 | ||
| CTCCTCTTGCATTCTCCC// | |||
| TESTI20234140// | SEQ ID NO: 5337 | ||
| CCAGTTATATCCCCAAAA// | |||
| TESTI20234270// | SEQ ID NO: 5338 | ||
| CATAAAACCGAATAACTGAG// | |||
| TESTI20238000// | SEQ ID NO: 5339 | ||
| AGTGTTTGTGGGCATAGA// | |||
| TESTI20238610// | SEQ ID NO: 5340 | ||
| ACTTCAGACCTCCCTAGA// | |||
| TESTI20239510// | SEQ ID NO: 5341 | ||
| TTATTGAAGGAAAGCCGC// | |||
| TESTI20242990// | SEQ ID NO: 5342 | ||
| CCCTGCCTTCCCTATAGA// | |||
| TESTI20265250// | SEQ ID NO: 5343 | ||
| GGGAAATAGAGGAGTGAT// | |||
| TESTI20265370// | SEQ ID NO: 5344 | ||
| TGGTTTCAGATGTGCCTT// | |||
| TESTI20266740// | SEQ ID NO: 5345 | ||
| TGGAAGAACGAAAGAGCC// | |||
| TESTI20272390// | SEQ ID NO: 5346 | ||
| TCCAGGGTGTCGTAGAAG// | |||
| TESTI20275030// | SEQ ID NO: 5347 | ||
| GCACGTTAAGGACTGTTT// | |||
| TESTI20275620// | SEQ ID NO: 5348 | ||
| (Reaction system A)// | |||
| TGTGCCTGACTAGGTGAG// | |||
| //(Reaction system B)// | SEQ ID NO: 5349 | ||
| AAGGACAGGTGAGTGTGG// | |||
| TESTI20277360// | SEQ ID NO: 5350 | ||
| TGGAGTACAACCTGCATC// | |||
| TESTI20282540// | SEQ ID NO: 5351 | ||
| TGTCTGGTAGAGTTGCGG// | |||
| TESTI20284880// | SEQ ID NO: 5352 | ||
| TGATTTAATGAGTGGAACC// | |||
| TESTI20285830// | SEQ ID NO: 5353 | ||
| (Reaction system A)// | |||
| CATGTGACCTTCTCTGGC// | |||
| //(Reaction system B)// | SEQ ID NO: 5354 | ||
| CAGTTCTTTAGCCAGGGA// | |||
| TESTI20288110// | SEQ ID NO: 5355 | ||
| CCTTTTGTCTGATTCGTC// | |||
| TESTI20289850// | SEQ ID NO: 5356 | ||
| CCTTACCAAACTCATCCA// | |||
| TESTI20307540// | SEQ ID NO: 5357 | ||
| CGTGCATGAAAGTGAGTC// | |||
| TESTI20308600// | SEQ ID NO: 5358 | ||
| CTTCTCAATCATCAGGGA// | |||
| TESTI20311290// | SEQ ID NO: 5359 | ||
| TTCTCTGCACTCCTTGAT// | |||
| TESTI20317600// | SEQ ID NO: 5360 | ||
| GAGTGTCTGGCATGGTTA// | |||
| TESTI20319190// | SEQ ID NO: 5361 | ||
| AAGCTGGGATGATAAGGG// | |||
| TESTI20332420// | SEQ ID NO: 5362 | ||
| (Reaction system A)// | |||
| CTTCTTGGTGCTGCTTTT// | |||
| //(Reaction system B)// | SEQ ID NO: 5363 | ||
| GCAGATATGTTTGTGAGAG// | |||
| TESTI20335200// | SEQ ID NO: 5364 | ||
| AATAAACTACACCAGGGC// | |||
| TESTI20342430// | SEQ ID NO: 5365 | ||
| TCCTACGTTGAGTTGCCT// | |||
| TESTI20345060// | SEQ ID NO: 5366 | ||
| GTCCACTAGAAGAGGGTC// | |||
| TESTI20347300// | SEQ ID NO: 5367 | ||
| GAAAGCTGTCGTTAAGGT// | |||
| TESTI20357960// | SEQ ID NO: 5368 | ||
| AATGACAGGTGAGTGGGT// | |||
| TESTI20361140// | SEQ ID NO: 5369 | ||
| AATTCACCAGGCTGTGTG// | |||
| TESTI20369220// | SEQ ID NO: 5370 | ||
| (Reaction system A)// | |||
| TGGATTTGGAAGAGACCT// | |||
| //(Reaction system B) | SEQ ID NO: 5371 | ||
| //TTTGGGTGGAAGTAGAGA// | |||
| TESTI20369690// | SEQ ID NO: 5372 | ||
| GCTGGTTATTCACGTGGT// | |||
| TESTI20370020// | SEQ ID NO: 5373 | ||
| (Reaction system A)// | |||
| TGGTCATACTCACTGCCC// | |||
| //(Reaction system B)// | SEQ ID NO: 5374 | ||
| GACCTGGTCATACTCACTG// | |||
| TESTI20371030// | SEQ ID NO: 5375 | ||
| CTAAAGTCCAAAATGTGTAAGT// | |||
| TESTI20386230// | SEQ ID NO: 5376 | ||
| (Reaction system A)// | |||
| GCTAAGGTGCTATGAAGG// | |||
| //(Reaction system B)// | SEQ ID NO: 5377 | ||
| ACAGTAAAAGGGCAAGTG// | |||
| TESTI20391210// | SEQ ID NO: 5378 | ||
| AATACTCACATGCCAAGC// | |||
| TESTI20392090// | SEQ ID NO: 5379 | ||
| CTTGGTTACAGAGGACAG// | |||
| TESTI20392250// | SEQ ID NO: 5380 | ||
| ATTCCACTCTGCTCAAAG// | |||
| TESTI20392270// | SEQ ID NO: 5381 | ||
| CCTTGTTGTCCATGAGTC// | |||
| TESTI20401020// | SEQ ID NO: 5382 | ||
| CGTACACCACATAGCTGA// | |||
| TESTI20401430// | SEQ ID NO: 5383 | ||
| TGGTAGAAAGAGAGTCACAT// | |||
| TESTI20409440// | SEQ ID NO: 5384 | ||
| TAGAGCACGTTTCCCTGA// | |||
| TESTI20415640// | SEQ ID NO: 5385 | ||
| TCTGGAAAATGAGGGTTA// | |||
| TESTI20424000// | SEQ ID NO: 5386 | ||
| CCAGCTTTCTTCATCATC// | |||
| TESTI20424730// | SEQ ID NO: 5387 | ||
| AGGAGTGTGGCATAGTCA// | |||
| TESTI20425070// | SEQ ID NO: 5388 | ||
| AAAGCCATCAGACCTCAT// | |||
| TESTI20433130// | SEQ ID NO: 5389 | ||
| GTCCCATGATTTAGAACTC// | |||
| TESTI20438570// | SEQ ID NO: 5390 | ||
| CTGCACTAGCCTTTTCCA// | |||
| TESTI20443090// | SEQ ID NO: 5391 | ||
| GGAAGACAGGACCCAAGT// | |||
| TESTI20463520// | SEQ ID NO: 5392 | ||
| TGTTGGACTAGAGGGGAA// | |||
| TESTI20465520// | SEQ ID NO: 5393 | ||
| TCCAGGTCTCATTCTCTC// | |||
| TESTI20478010// | SEQ ID NO: 5394 | ||
| TCCCTATCAGACGACCAG// | |||
| TESTI20478180// | SEQ ID NO: 5395 | ||
| AAATCACCCTGCTTGTCA// | |||
| THYMU20029100// | SEQ ID NO: 5396 | ||
| AGAAGCCAGGGAAGAGGT// | |||
| THYMU20061700// | SEQ ID NO: 5397 | ||
| CTAGCTCTGAAGTGGCAT// | |||
| THYMU20095960// | SEQ ID NO: 5398 | ||
| (Reaction system A)// | |||
| TGAAGAGATTACCCAGGT// | |||
| //(Reaction system B)// | SEQ ID NO: 5399 | ||
| GGACTCTGTAGATGTAACTGA// | |||
| THYMU20111180// | SEQ ID NO: 5400 | ||
| (Reaction system A)// | |||
| TTCTGGGTAAGCCTGATT// | |||
| //(Reaction system B)// | SEQ ID NO: 5401 | ||
| CAAAGAATACCACAAATAGC// | |||
| THYMU20118060// | SEQ ID NO: 5402 | ||
| CCAAGGCTAAAGAGAGAG// | |||
| THYMU20130890// | SEQ ID NO: 5403 | ||
| (Reaction system A)// | |||
| AATCTCAAGGACCAGTTT// | |||
| //(Reaction system B)// | SEQ ID NO: 5404 | ||
| GACACAATGGACTCAAAA// | |||
| THYMU20142040// | SEQ ID NO: 5405 | ||
| ACAGAAGGCCACAGTCAG// | |||
| THYMU20142970// | SEQ ID NO: 5406 | ||
| CAAGGATACTGTGATGAAA// | |||
| THYMU20153160// | SEQ ID NO: 5407 | ||
| GGTGGTTAGGACATTTCTC// | |||
| THYMU20158250// | SEQ ID NO: 5408 | ||
| AAGGAGTGGATAGATGAATAG// | |||
| THYMU20187720// | SEQ ID NO: 5409 | ||
| TGGTTACAAAGTCACAGG// | |||
| THYMU20194360// | SEQ ID NO: 5410 | ||
| TTCACTTTTGTTTCCCAG// | |||
| THYMU20208300// | SEQ ID NO: 5411 | ||
| ATACCACTAAGGCCCAGG// | |||
| THYMU20226600// | SEQ ID NO: 5412 | ||
| GACTCTTTCAGCTGCTGC// | |||
| THYMU20239000// | SEQ ID NO: 5413 | ||
| CAAATGGACAGGAACTTA// | |||
| THYMU20253250// | SEQ ID NO: 5414 | ||
| (Reaction system A)// | |||
| AGAAAACCAGATAGGGCC// | |||
| //(Reaction system B)// | SEQ ID NO: 5415 | ||
| TAATGCAGGGAATGGAGT// | |||
| THYMU20272490// | SEQ ID NO: 5416 | ||
| CATTATACACACGACGAA// | |||
| THYMU20284120// | SEQ ID NO: 5417 | ||
| AAACCCACAGTGCTTCAT// | |||
| THYMU20286290// | SEQ ID NO: 5418 | ||
| AGTCCCTCTCATTTCCAG// | |||
| TKIDN10000010// | SEQ ID NO: 5419 | ||
| TGCCATAATTCTCCTTTT// | |||
| TRACH20005020// | SEQ ID NO: 5420 | ||
| GCTTTTCTCCTTCCATGA// | |||
| TRACH20032720// | SEQ ID NO: 5421 | ||
| CTACGCCCACTATATTCA// | |||
| TRACH20041830// | SEQ ID NO: 5422 | ||
| (Reaction system A)// | |||
| AGATACTGAGAATGAGCCT// | |||
| //(Reaction system B)// | SEQ ID NO: 5423 | ||
| TTTCCATGCCTACCCTTT// | |||
| TRACH20060150// | SEQ ID NO: 5424 | ||
| (Reaction system A)// | |||
| AGTCTCCTGCTGGCTAAG// | |||
| //(Reaction system B)// | SEQ ID NO: 5425 | ||
| GTCCCTTCTGTCTCCTGA// | |||
| TRACH20076760// | SEQ ID NO: 5426 | ||
| GTGGAAGTGCCTGATGAG// | |||
| TRACH20082780// | SEQ ID NO: 5427 | ||
| CTTTCACCTGGGATGGAT// | |||
| TRACH20091230// | SEQ ID NO: 5428 | ||
| AACATAGTCATTTCGTTCA// | |||
| TRACH20099340// | SEQ ID NO: 5429 | ||
| GAGCACTGTAAGAGCCAT// | |||
| TRACH20109650// | SEQ ID NO: 5430 | ||
| AAACATACCACGGAGAGA// | |||
| TRACH20115740// | SEQ ID NO: 5431 | ||
| TATGAGCACACGAGGTCC// | |||
| TRACH20134950// | SEQ ID NO: 5432 | ||
| AAGAGGGAACATCAGGCT// | |||
| TRACH20135520// | SEQ ID NO: 5433 | ||
| TTCTTGGGCTTTATGTGG// | |||
| TRACH20153810// | SEQ ID NO: 5434 | ||
| (Reaction system A)// | |||
| GCAGTGAGTCGTAGATGA// | |||
| //(Reaction system B)// | SEQ ID NO: 5435 | ||
| CTGCCTAGCCCTCTCACT// | |||
| TRACH20184490// | SEQ ID NO: 5436 | ||
| ACTGTGAAGAGCCTGTTG// | |||
| TSTOM20001390// | SEQ ID NO: 5437 | ||
| GGAATAGTAAGGACATAATGACA// | |||
| TSTOM20005690// | SEQ ID NO: 5438 | ||
| GGAACCTTTTGTAACCCT// | |||
| UMVEN10001560// | SEQ ID NO: 5439 | ||
| GCCACAACATCATTTTACTT// | |||
| UMVEN20003540// | SEQ ID NO: 5440 | ||
| AAGTAAAAGACATCGGCA// | |||
| UTERU20004240// | SEQ ID NO: 5441 | ||
| TACCTCCAGACTTTTGTG// | |||
| UTERU20046980// | SEQ ID NO: 5442 | ||
| AGGATGGGAAGAAGGTTT// | |||
| UTERU20055930// | SEQ ID NO: 5443 | ||
| GGATGAGTTGTGTGAAAA// | |||
| UTERU20068990// | SEQ ID NO: 5444 | ||
| CCAAGGCTAAAGAGAGAG// | |||
| UTERU20070810// | SEQ ID NO: 5445 | ||
| AAGTAGAGAATCCCAGCT// | |||
| UTERU20115740// | SEQ ID NO: 5446 | ||
| TTTATGATTGAGGGGACC// | |||
| UTERU20119060// | SEQ ID NO: 5447 | ||
| ACAGCATCCAATCAAAGA// | |||
| UTERU20124070// | SEQ ID NO: 5448 | ||
| ACATCTGGTGGAAGCATC// | |||
| UTERU20126880// | SEQ ID NO: 5449 | ||
| ACCTTAACCCCTCTTCCC// | |||
| UTERU20134910// | SEQ ID NO: 5450 | ||
| AAGGAAGCCAACTCATGC// | |||
| UTERU20146680// | SEQ ID NO: 5451 | ||
| ACCTTAACCCCTCTTCCC// | |||
| UTERU20176130// | SEQ ID NO: 5452 | ||
| TAGAAAGGGGTGGTGAGA// | |||
| UTERU20185230// | SEQ ID NO: 5453 | ||
| CGTTGAGAGCTTTTACAG// | |||
| UTERU20186740// | SEQ ID NO: 5454 | ||
| CCACTTTGAGAGAACCCT// |
The result of expression frequency analysis is shown in Table 52. The clones not shown in the table contain clones whose expression levels could not be measured because the levels were too low or the sizes of the PCR products were different from the expected. It was confirmed that the expression levels of IL-8 genes used as positive control genes were elevated.
The result obtained by the search for the genes whose expression levels were altered depending on the presence of TNF-α in culturing THP-1 cell, which is a human monocyte cell line, showed that the clones whose expression levels were elevated by twofold or more one or three hours after the stimulation (the clones whose expression levels were 0.1 or lower both before and after the stimulation were excluded), were ASTRO20152140,
BRACE20057620, BRACE20060720, BRACE20090440, BRACE20152870, BRACE20229280, BRAMY20002770, BRAMY20266850, BRAMY20280720, BRAWH20106180, BRAWH20122770, BRHIP20096170, BRHIP20111200, BRHIP20186120, BRHIP20194940, BRHIP20207430, BRSSN20152380, CTONG20095270, CTONG20100240, CTONG20158150,
CTONG20265130, D30ST20006540, D90ST20031370, FCBBF20071860, FCBBF30251420, FCBBF30252520, FCBBF40001420, FEBRA20017050, FEBRA20082100, HCHON20011160, KIDNE20141190, KIDNE20163880, KIDNE20182690, LIVER10004790, LIVER20038540, LIVER20085800, MESAN20130220, MESAN20174170, NT2NE20158600, NT2RI20005750, NT2RP70110860, NT2RP70169110, NT2RP70175670, NT2RP70188710, PERIC20002140, PLACE60155130, PROST20120160, PROST20149250, PROST20161950, PUAEN20015260, SKNSH20080430, SMINT20051610, SMINT20060780, SMINT20161220, SMINT20163960, SPLEN20101190, SPLEN20157300, SPLEN20163560, SPLEN20214580, SPLEN20279950, STOMA20048520, TESTI20076850, TESTI20087620, TESTI20108720, TESTI20220100, TESTI20239510, TESTI20266740, TESTI20342430, TESTI20370020, TESTI20391210, TESTI20401020, TESTI20415640, THYMU20130890, THYMU20286290, TRACH20060150, TRACH20099340, UTERU20004240, UTERU20068990, UTERU20119060.
On the other hand, in particular cases where the expression levels were relatively high in the unstimulated cells (the relative value was 1 or higher), the clones whose expression levels were decreased by twofold or more by the TNF-α stimulation (the clones whose expression levels were increased 1 or 3 hours after the stimulation were excluded) were
ASTRO20032120, ASTRO20084250, ASTRO20181690, BRACE20062640, BRACE20067430, BRACE20235400, BRALZ20018340, BRALZ20069760, BRALZ20075450, BRAMY20163270, BRAMY20204450, BRAMY20218670, BRAMY20229800, BRAWH10000930, BRAWH20107540, BRAWH20132190, BRAWH20158530, BRCAN20273340, BRHIP20105710, BRHIP20186120, BRSSN20176820, CTONG20095290, DFNES20031920, FCBBF30033050, FCBBF30071520, FCBBF30083820, HCHON20008980, HCHON20022470, HHDPC20034390, KIDNE20028720, KIDNE20079440, KIDNE20127750, KIDNE20148900, LIVER20011130, MAMGL10000830, MESAN20127350, NT2NE20181650, NT2RI20023160, NT2RP70102350, NT2RP70157890, NTONG20029480, OCBBF20020830, OCBBF20041680, OCBBF20061720, OCBBF20127040, OCBBF20139260, OCBBF20178990, PEBLM20013120, PLACE60003480, PLACE60181070, PROST20151240, PUAEN20003740, PUAEN20011880, PUAEN20078980, PUAEN20085150, SKNSH20080430, SMINT20001760, SMINT20047810, SMINT20108530, SPLEN20158990, SPLEN20283650, STOMA20010250, STOMA20057820, TESTI20060400, TESTI20161970, TESTI20275620, TESTI20369690, TESTI20386230, TESTI20392250, TESTI20409440, TESTI20424730, THYMU20095960, THYMU20111180, THYMU20226600, THYMU20253250, THYMU20272490, TRACH20153810, UTERU20176130, UTERU20186740.
These clones were thus revealed to be involved in the inflammation reaction induced by TNF-α.
The result obtained by the search for the genes whose expression levels were altered depending on co-culturing gastric cancer cell line MKN45 with cag PAI positive Helicobacter pylori (TN2), showed that the clones whose expression levels were elevated by twofold or more (the clones whose expression levels were 0.1 or lower both before and after the stimulation were excluded), were ADRGL20067670, BLADE20004630, BRACE20039040,
BRACE20151320, BRACE20229280, BRACE20235400, BRALZ20058880, BRAMY20060920, BRAMY20184670, BRAMY20218670, BRAMY20229800, BRCAN20147880, BRHIP20196410, BRHIP30004880, BRSSN20187310, CD34C30004940, CTONG20265130, DFNES20031920, FCBBF30278630, FCBBF40001420,
HHDPC20095280, KIDNE20130450, LIVER20011130, LIVER20038540, NT2NE20172590, NT2RP70169110, OCBBF20085200, OCBBF20180840, PEBLM10000240, PLACE60003480, PROST20120160, PROST20151240, PUAEN20011880, SKMUS20031680, SKNSH20080430, SMINT20056210, SMINT20105000, SPLEN20019450, SPLEN20211570, STOMA20048520, TESTI20004890, TESTI20083940, TESTI20168480, TESTI20239510, TESTI20308600, TESTI20478010, UTERU20126880.
Of these clones, the expression levels of ADRGL20067670,
BLADE20004630, BRACE20151320, BRACE20229280, BRACE20235400, BRALZ20058880, BRAMY20218670, BRAMY20229800, BRHIP20196410, BRHIP30004880, CD34C30004940, DFNES20031920, FCBBF30278630, FCBBF40001420, HHDPC20095280, KIDNE20130450, LIVER20011130, LIVER20038540, NT2NE20172590, NT2RP70169110,
PEBLM10000240, PROST20151240, PUAEN20011880, SKMUS20031680, SKNSH20080430, SMINT20056210, SMINT20105000, SPLEN20019450, SPLEN20211570, STOMA20048520, TESTI20168480, TESTI20308600, TESTI20478010, UTERU20126880 were not increased by the co-culture with the cagE mutant (TN2ΔcagE). There may be the possibility that the expression levels of the 34 clones are altered via the NF-κB pathway. Among them, the expression levels of BRACE20229280, FCBBF40001420, LIVER20038540, NT2RP70169110, SKNSH20080430, STOMA20048520 were also increased when human monocyte cell line THP-1 was stimulated with TNF-α.
On the other hand, in particular cases where the expression levels were relatively high in the unstimulated cells (the relative value was 1 or higher), the clones whose expression levels were decreased by twofold or more in the presence of Helicobacter pylori were ASTRO20032120, BRACE20090440,
BRACE20114780, BRALZ20064740, BRAMY20002770, BRAMY20210400, BRAMY20215230, BRAMY20247280, BRAMY20267130, BRAWH20029630, BRAWH20100690, BRAWH20118230, BRCOC20105100, BRHIP20218580, BRSSN20046570, CTONG20138030, CTONG20146970, CTONG20158150, D3OST20037970, FCBBF30001840,
FCBBF30033050, FEBRA20082100, HCHON20035130, HCHON20043590, HCHON20067220, NT2NE20174920, NT2RI20009870, NT2RI20023160, NT2RP70062230, NT2RP70130020, NTONG20070340, OCBBF20020150, OCBBF20094240, OCBBF20107920, PROST20144220, PROST20149160, PROST20153320, PUAEN20003740, PUAEN20025680, PUAEN20040670, SMINT20014580, SPLEN20101190, STOMA20076800, TESTI20087620, TESTI20098530, TESTI20123080, TESTI20161970, TESTI20234140, TESTI20288110, TESTI20357960, TESTI20391210, TESTI20424730, THYMU20158250, THYMU20226600, TRACH20005020, TRACH20134950, TRACH20184490, TSTOM20001390, UTERU20119060, UTERU20134910, UTERU20176130.
These clones are involved in gastritis or gastroduodenal ulcer.
| TABLE 3 | |||||
| CloneID | CD34C | D3OST | D6OST | D9OST | |
| ASTRO20001410 | 0 | 17.731 | 0 | 20.479 | |
| D3OST10001090 | 0 | 62.515 | 0 | 24.068 | |
| D3OST20036070 | 0 | 46.404 | 0 | 53.596 | |
| THYMU20039810 | 0 | 18.291 | 0 | 21.126 | |
| KIDNE20028720 | 0 | 0 | 38.385 | 46.259 | |
| BRAWH10000930 | 0 | 0 | 0 | 6.219 | |
| BRHIP20005340 | 0 | 0 | 0 | 4.615 | |
| CTONG20141650 | 0 | 0 | 0 | 64.925 | |
| D9OST20000310 | 0 | 0 | 0 | 63.705 | |
| D9OST20002780 | 0 | 0 | 0 | 100 | |
| D9OST20023970 | 0 | 0 | 0 | 37.837 | |
| D9OST20026730 | 0 | 0 | 0 | 19.695 | |
| D9OST20031370 | 0 | 0 | 0 | 100 | |
| D9OST20033970 | 0 | 0 | 0 | 38.536 | |
| D9OST20035800 | 0 | 0 | 0 | 93.047 | |
| D9OST20035940 | 0 | 0 | 0 | 100 | |
| D9OST20040180 | 0 | 0 | 0 | 100 | |
| FCBBF30018550 | 0 | 0 | 0 | 37.763 | |
| FCBBF30233680 | 0 | 0 | 0 | 33.084 | |
| KIDNE20102650 | 0 | 0 | 0 | 63.715 | |
| NT2RI20023160 | 0 | 0 | 0 | 10.811 | |
| PROST20107820 | 0 | 0 | 0 | 3.279 | |
| SKNSH20089400 | 0 | 0 | 0 | 25.857 | |
| SMINT20033400 | 0 | 0 | 0 | 39.619 | |
| CTONG20108210 | 0 | 0 | 47.973 | 0 | |
| D6OST20003580 | 0 | 0 | 95.4 | 0 | |
| D6OST20005070 | 0 | 0 | 100 | 0 | |
| ASTRO20155290 | 0 | 21.631 | 0 | 0 | |
| D3OST10002670 | 0 | 50.415 | 0 | 0 | |
| D3OST10002700 | 0 | 30.165 | 0 | 0 | |
| D3OST20006180 | 0 | 100 | 0 | 0 | |
| D3OST20006540 | 0 | 100 | 0 | 0 | |
| D3OST20007340 | 0 | 93.334 | 0 | 0 | |
| D3OST20013280 | 0 | 100 | 0 | 0 | |
| D3OST20024170 | 0 | 100 | 0 | 0 | |
| D3OST20024360 | 0 | 100 | 0 | 0 | |
| D3OST20037970 | 0 | 100 | 0 | 0 | |
| D3OST30002580 | 0 | 72.574 | 0 | 0 | |
| D3OST30002910 | 0 | 93.334 | 0 | 0 | |
| FCBBF10004120 | 0 | 22.594 | 0 | 0 | |
| NT2RI20001330 | 0 | 29.915 | 0 | 0 | |
| NTONG20009770 | 0 | 11.477 | 0 | 0 | |
| SPLEN20084600 | 0 | 30.589 | 0 | 0 | |
| SPLEN20140800 | 0 | 55.315 | 0 | 0 | |
| THYMU20169680 | 0 | 86.295 | 0 | 0 | |
| TRACH20141240 | 0 | 12.051 | 0 | 0 | |
| CD34C30001250 | 97.628 | 0 | 0 | 0 | |
| CD34C30003140 | 100 | 0 | 0 | 0 | |
| CD34C30004240 | 96.167 | 0 | 0 | 0 | |
| CD34C30004940 | 100 | 0 | 0 | 0 | |
| DFNES10001850 | 55.393 | 0 | 0 | 0 | |
| HHDPC20034390 | 21.364 | 0 | 0 | 0 | |
| NT2RI20091730 | 46.845 | 0 | 0 | 0 | |
| SKMUS20003610 | 44.913 | 0 | 0 | 0 | |
| SPLEN20225220 | 59.537 | 0 | 0 | 0 | |
| BRCOC20101230 | 46.01 | 0 | 0 | 14.772 | |
| TABLE 4 | |||||
| Clone ID | NT2RM | NT2RP | NT2RI | NT2NE | |
| CTONG20027090 | 62.349 | 0 | 0 | 0 | |
| CTONG20160560 | 57.22 | 0 | 0 | 0 | |
| NT2RP70032610 | 39.095 | 3.274 | 0 | 0 | |
| OCBBF20188730 | 39.876 | 0 | 0 | 0 | |
| SPLEN20162680 | 12.432 | 0 | 2.355 | 6.263 | |
| BRCOC20101230 | 0 | 2.64 | 3.981 | 3.97 | |
| BRHIP20005340 | 0 | 0.825 | 1.244 | 1.24 | |
| BRHIP20238880 | 0 | 2.66 | 7.355 | 2.667 | |
| FCBBF30016320 | 0 | 7.441 | 2.805 | 5.595 | |
| FEBRA20080810 | 0 | 6.827 | 5.147 | 2.566 | |
| FEBRA20225040 | 0 | 3.958 | 2.985 | 5.952 | |
| HCHON20008320 | 0 | 17.053 | 19.287 | 12.822 | |
| HHDPC20034390 | 0 | 0.613 | 1.387 | 0.922 | |
| HLUNG10000550 | 0 | 2.609 | 0.984 | 1.962 | |
| NT2RI20028470 | 0 | 9.076 | 6.843 | 4.549 | |
| NT2RI20054050 | 0 | 2.03 | 1.02 | 4.069 | |
| NT2RI20091730 | 0 | 2.688 | 2.027 | 4.042 | |
| NT2RP70078420 | 0 | 4.623 | 3.485 | 13.902 | |
| PUAEN20003740 | 0 | 2.314 | 0.582 | 1.16 | |
| THYMU20271250 | 0 | 0.431 | 0.651 | 1.297 | |
| BRACE20003070 | 0 | 8.516 | 4.281 | 0 | |
| BRACE20039040 | 0 | 6.248 | 4.711 | 0 | |
| BRAWH20004600 | 0 | 1.471 | 5.545 | 0 | |
| BRAWH20011710 | 0 | 8.931 | 2.245 | 0 | |
| BRCOC20121720 | 0 | 13.559 | 5.112 | 0 | |
| BRHIP20005530 | 0 | 12.387 | 9.34 | 0 | |
| D3OST10002700 | 0 | 6.227 | 4.695 | 0 | |
| HCHON20007380 | 0 | 7.176 | 5.411 | 0 | |
| HEART20072310 | 0 | 11.675 | 17.605 | 0 | |
| KIDNE20121880 | 0 | 21.519 | 16.225 | 0 | |
| MESAN20121130 | 0 | 14.219 | 10.721 | 0 | |
| NT2RI20022600 | 0 | 57.012 | 42.988 | 0 | |
| NT2RI20023160 | 0 | 1.932 | 1.457 | 0 | |
| NT2RI20086220 | 0 | 7.606 | 5.735 | 0 | |
| NT2RI20216250 | 0 | 45.928 | 34.63 | 0 | |
| NT2RP60000850 | 0 | 11.147 | 16.809 | 0 | |
| NT2RP70036880 | 0 | 1.78 | 5.367 | 0 | |
| NT2RP70043480 | 0 | 10.893 | 4.107 | 0 | |
| NT2RP70062230 | 0 | 10.183 | 7.678 | 0 | |
| NT2RP70081610 | 0 | 15.131 | 22.818 | 0 | |
| NT2RP70102350 | 0 | 84.14 | 15.86 | 0 | |
| NT2RP70130020 | 0 | 57.012 | 42.988 | 0 | |
| NT2RP70190640 | 0 | 30.952 | 23.338 | 0 | |
| OCBBF10001850 | 0 | 20.293 | 7.65 | 0 | |
| OCBBF20097720 | 0 | 5.676 | 4.28 | 0 | |
| OCBBF20173980 | 0 | 3.1 | 2.338 | 0 | |
| PEBLM20044520 | 0 | 3.253 | 2.453 | 0 | |
| SPLEN20173510 | 0 | 7.249 | 10.932 | 0 | |
| TRACH20007020 | 0 | 9.462 | 7.134 | 0 | |
| UTERU20065930 | 0 | 10.676 | 8.05 | 0 | |
| HCHON20022470 | 0 | 6.766 | 0 | 10.174 | |
| NT2NE20010490 | 0 | 21.179 | 0 | 31.847 | |
| NT2NE20174800 | 0 | 39.941 | 0 | 60.059 | |
| NT2NE20177520 | 0 | 28.292 | 0 | 42.542 | |
| PROST20087700 | 0 | 1.88 | 0 | 14.135 | |
| PROST20107820 | 0 | 0.586 | 0 | 2.644 | |
| SMINT20028820 | 0 | 6.998 | 0 | 10.523 | |
| TESTI20063830 | 0 | 9.768 | 0 | 14.689 | |
| ASTRO20125520 | 0 | 0 | 2.686 | 5.357 | |
| BRHIP30001110 | 0 | 0 | 1.86 | 3.71 | |
| HCHON20002260 | 0 | 0 | 0.733 | 1.461 | |
| HCHON20008150 | 0 | 0 | 5.075 | 20.242 | |
| KIDNE20002520 | 0 | 0 | 1.553 | 6.195 | |
| NT2NE20130190 | 0 | 0 | 33.397 | 66.603 | |
| NT2NE20158600 | 0 | 0 | 33.397 | 66.603 | |
| NT2RI20001330 | 0 | 0 | 4.656 | 9.286 | |
| NT2RI20025400 | 0 | 0 | 3.141 | 6.265 | |
| NT2RI20036670 | 0 | 0 | 33.397 | 66.603 | |
| NT2RI20048840 | 0 | 0 | 1.404 | 5.6 | |
| SKMUS20020840 | 0 | 0 | 11.346 | 22.628 | |
| BRACE20057190 | 0 | 0 | 0 | 10.763 | |
| BRACE20060550 | 0 | 0 | 0 | 14.499 | |
| BRACE20267250 | 0 | 0 | 0 | 66.449 | |
| BRAWH20107540 | 0 | 0 | 0 | 40.54 | |
| BRAWH20118230 | 0 | 0 | 0 | 78.374 | |
| CTONG20075860 | 0 | 0 | 0 | 21.782 | |
| CTONG20095290 | 0 | 0 | 0 | 22.915 | |
| FEBRA20086620 | 0 | 0 | 0 | 11.505 | |
| FEBRA20144170 | 0 | 0 | 0 | 1.957 | |
| FEBRA20196370 | 0 | 0 | 0 | 59.247 | |
| HLUNG20023340 | 0 | 0 | 0 | 33.313 | |
| NT2NE20003740 | 0 | 0 | 0 | 100 | |
| NT2NE20010050 | 0 | 0 | 0 | 84.719 | |
| NT2NE20010210 | 0 | 0 | 0 | 100 | |
| NT2NE20010400 | 0 | 0 | 0 | 56.184 | |
| NT2NE20015240 | 0 | 0 | 0 | 100 | |
| NT2NE20021620 | 0 | 0 | 0 | 44.305 | |
| NT2NE20043780 | 0 | 0 | 0 | 100 | |
| NT2NE20053580 | 0 | 0 | 0 | 75.239 | |
| NT2NE20068130 | 0 | 0 | 0 | 100 | |
| NT2NE20072200 | 0 | 0 | 0 | 100 | |
| NT2NE20074250 | 0 | 0 | 0 | 100 | |
| NT2NE20080170 | 0 | 0 | 0 | 100 | |
| NT2NE20089610 | 0 | 0 | 0 | 100 | |
| NT2NE20089970 | 0 | 0 | 0 | 100 | |
| NT2NE20108540 | 0 | 0 | 0 | 84.719 | |
| NT2NE20110360 | 0 | 0 | 0 | 100 | |
| NT2NE20118960 | 0 | 0 | 0 | 100 | |
| NT2NE20122430 | 0 | 0 | 0 | 76.57 | |
| NT2NE20124480 | 0 | 0 | 0 | 100 | |
| NT2NE20125050 | 0 | 0 | 0 | 66.449 | |
| NT2NE20131890 | 0 | 0 | 0 | 100 | |
| NT2NE20132170 | 0 | 0 | 0 | 100 | |
| NT2NE20142210 | 0 | 0 | 0 | 100 | |
| NT2NE20146810 | 0 | 0 | 0 | 100 | |
| NT2NE20152750 | 0 | 0 | 0 | 100 | |
| NT2NE20155110 | 0 | 0 | 0 | 100 | |
| NT2NE20156260 | 0 | 0 | 0 | 100 | |
| NT2NE20157470 | 0 | 0 | 0 | 100 | |
| NT2NE20159740 | 0 | 0 | 0 | 27.684 | |
| NT2NE20172590 | 0 | 0 | 0 | 100 | |
| NT2NE20174920 | 0 | 0 | 0 | 61.159 | |
| NT2NE20181650 | 0 | 0 | 0 | 100 | |
| NT2NE20183760 | 0 | 0 | 0 | 100 | |
| NT2NE20184900 | 0 | 0 | 0 | 84.719 | |
| NT2NE20187390 | 0 | 0 | 0 | 100 | |
| OCBBF20108430 | 0 | 0 | 0 | 53.98 | |
| RECTM20005100 | 0 | 0 | 0 | 10.923 | |
| SMINT20001760 | 0 | 0 | 0 | 50.667 | |
| SPLEN20169720 | 0 | 0 | 0 | 7.349 | |
| TESTI20265250 | 0 | 0 | 0 | 15.768 | |
| ASTRO10001650 | 0 | 0 | 8.055 | 0 | |
| ASTRO20033160 | 0 | 0 | 10.721 | 0 | |
| BRACE20011070 | 0 | 0 | 26.748 | 0 | |
| BRACE20039440 | 0 | 0 | 0.941 | 0 | |
| BRACE20151320 | 0 | 0 | 29.94 | 0 | |
| BRAMY20104640 | 0 | 0 | 40.041 | 0 | |
| BRAMY20137560 | 0 | 0 | 68.63 | 0 | |
| BRAMY20167060 | 0 | 0 | 9.007 | 0 | |
| BRAWH20028110 | 0 | 0 | 15.672 | 0 | |
| BRCAN20280360 | 0 | 0 | 4.387 | 0 | |
| BRCOC20004870 | 0 | 0 | 0.526 | 0 | |
| BRHIP20207990 | 0 | 0 | 9.197 | 0 | |
| BRHIP20217620 | 0 | 0 | 5.063 | 0 | |
| BRHIP20249110 | 0 | 0 | 67.372 | 0 | |
| BRSTN10000830 | 0 | 0 | 3.481 | 0 | |
| CTONG10000940 | 0 | 0 | 1.415 | 0 | |
| CTONG20004690 | 0 | 0 | 5.307 | 0 | |
| CTONG20050280 | 0 | 0 | 12.439 | 0 | |
| CTONG20105660 | 0 | 0 | 24.642 | 0 | |
| CTONG20125640 | 0 | 0 | 7.18 | 0 | |
| CTONG20133520 | 0 | 0 | 49.384 | 0 | |
| CTONG20186320 | 0 | 0 | 29.069 | 0 | |
| FCBBF10000770 | 0 | 0 | 1.472 | 0 | |
| FCBBF10002800 | 0 | 0 | 10.265 | 0 | |
| FCBBF10003770 | 0 | 0 | 19.652 | 0 | |
| FCBBF30018550 | 0 | 0 | 5.089 | 0 | |
| FCBBF30123470 | 0 | 0 | 3.989 | 0 | |
| FCBBF30246230 | 0 | 0 | 5.091 | 0 | |
| FEBRA20018280 | 0 | 0 | 9.887 | 0 | |
| FEBRA20095140 | 0 | 0 | 6.019 | 0 | |
| FEBRA20192420 | 0 | 0 | 58.974 | 0 | |
| HCHON20064590 | 0 | 0 | 19.614 | 0 | |
| HHDPC10000830 | 0 | 0 | 1.779 | 0 | |
| HLUNG20016770 | 0 | 0 | 6.385 | 0 | |
| HLUNG20033780 | 0 | 0 | 16.824 | 0 | |
| IMR3220002430 | 0 | 0 | 3.118 | 0 | |
| KIDNE20104300 | 0 | 0 | 17.33 | 0 | |
| MESAN20004570 | 0 | 0 | 7.197 | 0 | |
| MESAN20089360 | 0 | 0 | 14.459 | 0 | |
| NOVAR10000910 | 0 | 0 | 3.519 | 0 | |
| NT2RI20003480 | 0 | 0 | 32.207 | 0 | |
| NT2RI20005750 | 0 | 0 | 100 | 0 | |
| NT2RI20009870 | 0 | 0 | 100 | 0 | |
| NT2RI20023590 | 0 | 0 | 29.911 | 0 | |
| NT2RI20023910 | 0 | 0 | 11.79 | 0 | |
| NT2RI20025640 | 0 | 0 | 100 | 0 | |
| NT2RI20040930 | 0 | 0 | 100 | 0 | |
| NT2RI20041880 | 0 | 0 | 10.436 | 0 | |
| NT2RI20046080 | 0 | 0 | 6.723 | 0 | |
| NT2RI20050960 | 0 | 0 | 73.545 | 0 | |
| NT2RI20055790 | 0 | 0 | 17.054 | 0 | |
| NT2RI20056700 | 0 | 0 | 100 | 0 | |
| NT2RI20069730 | 0 | 0 | 100 | 0 | |
| NT2RI20076290 | 0 | 0 | 14.653 | 0 | |
| NT2RI20091940 | 0 | 0 | 5.358 | 0 | |
| NT2RI20198260 | 0 | 0 | 100 | 0 | |
| NT2RI20203900 | 0 | 0 | 100 | 0 | |
| NT2RI20207030 | 0 | 0 | 100 | 0 | |
| NT2RI20240080 | 0 | 0 | 61.866 | 0 | |
| NT2RI20244600 | 0 | 0 | 100 | 0 | |
| NT2RI20244960 | 0 | 0 | 100 | 0 | |
| NT2RI20250750 | 0 | 0 | 30.809 | 0 | |
| NT2RI20252550 | 0 | 0 | 62.102 | 0 | |
| NT2RI20273230 | 0 | 0 | 60.375 | 0 | |
| NTONG20067090 | 0 | 0 | 16.469 | 0 | |
| OCBBF10001750 | 0 | 0 | 13.09 | 0 | |
| OCBBF20047570 | 0 | 0 | 4.504 | 0 | |
| OCBBF20054760 | 0 | 0 | 8.495 | 0 | |
| OCBBF20059560 | 0 | 0 | 10.318 | 0 | |
| OCBBF20073540 | 0 | 0 | 3.651 | 0 | |
| OCBBF20125530 | 0 | 0 | 2.131 | 0 | |
| OCBBF20126780 | 0 | 0 | 12.535 | 0 | |
| OCBBF20127040 | 0 | 0 | 37.942 | 0 | |
| OCBBF20140890 | 0 | 0 | 35.863 | 0 | |
| SKMUS20003610 | 0 | 0 | 1.943 | 0 | |
| SKNSH20008190 | 0 | 0 | 4.523 | 0 | |
| SKNSH20080430 | 0 | 0 | 18.4 | 0 | |
| SMINT20144800 | 0 | 0 | 2.887 | 0 | |
| SPLEN20027440 | 0 | 0 | 4.053 | 0 | |
| SPLEN20095550 | 0 | 0 | 15.436 | 0 | |
| SPLEN20140800 | 0 | 0 | 8.61 | 0 | |
| TESTI20094020 | 0 | 0 | 16.66 | 0 | |
| TESTI20369690 | 0 | 0 | 6.529 | 0 | |
| TESTI20391770 | 0 | 0 | 7.531 | 0 | |
| TESTI20442760 | 0 | 0 | 17.235 | 0 | |
| TRACH20084720 | 0 | 0 | 5.703 | 0 | |
| TRACH20107710 | 0 | 0 | 61.866 | 0 | |
| TRACH20118940 | 0 | 0 | 16.16 | 0 | |
| UTERU20022940 | 0 | 0 | 9.896 | 0 | |
| ASTRO20108190 | 0 | 1.622 | 0 | 0 | |
| BGGI120006160 | 0 | 2.155 | 0 | 0 | |
| BRAMY20136210 | 0 | 70.518 | 0 | 0 | |
| BRAWH20016620 | 0 | 22.162 | 0 | 0 | |
| BRAWH20164460 | 0 | 20.968 | 0 | 0 | |
| BRCOC20144000 | 0 | 40.488 | 0 | 0 | |
| BRHIP20132860 | 0 | 82.532 | 0 | 0 | |
| BRSSN20146100 | 0 | 17.209 | 0 | 0 | |
| CTONG10000100 | 0 | 15.625 | 0 | 0 | |
| CTONG20103480 | 0 | 4.268 | 0 | 0 | |
| CTONG20108210 | 0 | 1.722 | 0 | 0 | |
| CTONG20139070 | 0 | 10.392 | 0 | 0 | |
| FCBBF10000240 | 0 | 10.583 | 0 | 0 | |
| FCBBF10000630 | 0 | 14.415 | 0 | 0 | |
| FCBBF20067810 | 0 | 30.502 | 0 | 0 | |
| FCBBF30010810 | 0 | 6.328 | 0 | 0 | |
| FCBBF30012810 | 0 | 49.073 | 0 | 0 | |
| FCBBF30013770 | 0 | 24.817 | 0 | 0 | |
| FCBBF30039020 | 0 | 56.608 | 0 | 0 | |
| FCBBF40001420 | 0 | 8.811 | 0 | 0 | |
| FEBRA10001880 | 0 | 5.044 | 0 | 0 | |
| FEBRA20082010 | 0 | 17.339 | 0 | 0 | |
| HHDPC20001040 | 0 | 4.459 | 0 | 0 | |
| KIDNE20021910 | 0 | 34.358 | 0 | 0 | |
| NT2RP60000770 | 0 | 15.492 | 0 | 0 | |
| NT2RP70010740 | 0 | 100 | 0 | 0 | |
| NT2RP70027380 | 0 | 27.748 | 0 | 0 | |
| NT2RP70037240 | 0 | 22.256 | 0 | 0 | |
| NT2RP70044280 | 0 | 16.256 | 0 | 0 | |
| NT2RP70045590 | 0 | 20.543 | 0 | 0 | |
| NT2RP70056750 | 0 | 7.009 | 0 | 0 | |
| NT2RP70063950 | 0 | 82.532 | 0 | 0 | |
| NT2RP70072690 | 0 | 56.608 | 0 | 0 | |
| NT2RP70077660 | 0 | 74.295 | 0 | 0 | |
| NT2RP70085440 | 0 | 100 | 0 | 0 | |
| NT2RP70105210 | 0 | 100 | 0 | 0 | |
| NT2RP70110860 | 0 | 100 | 0 | 0 | |
| NT2RP70111320 | 0 | 100 | 0 | 0 | |
| NT2RP70122910 | 0 | 100 | 0 | 0 | |
| NT2RP70125160 | 0 | 100 | 0 | 0 | |
| NT2RP70133740 | 0 | 100 | 0 | 0 | |
| NT2RP70134990 | 0 | 100 | 0 | 0 | |
| NT2RP70137290 | 0 | 100 | 0 | 0 | |
| NT2RP70137640 | 0 | 54.725 | 0 | 0 | |
| NT2RP70143480 | 0 | 100 | 0 | 0 | |
| NT2RP70147210 | 0 | 100 | 0 | 0 | |
| NT2RP70150800 | 0 | 100 | 0 | 0 | |
| NT2RP70157890 | 0 | 100 | 0 | 0 | |
| NT2RP70159960 | 0 | 100 | 0 | 0 | |
| NT2RP70169110 | 0 | 100 | 0 | 0 | |
| NT2RP70175670 | 0 | 100 | 0 | 0 | |
| NT2RP70179710 | 0 | 100 | 0 | 0 | |
| NT2RP70181970 | 0 | 100 | 0 | 0 | |
| NT2RP70188020 | 0 | 100 | 0 | 0 | |
| NT2RP70188710 | 0 | 100 | 0 | 0 | |
| NT2RP70192730 | 0 | 100 | 0 | 0 | |
| NT2RP70194450 | 0 | 100 | 0 | 0 | |
| NT2RP70195430 | 0 | 50.987 | 0 | 0 | |
| NT2RP70198350 | 0 | 2.512 | 0 | 0 | |
| NT2RP70203790 | 0 | 100 | 0 | 0 | |
| OCBBF20039250 | 0 | 4.016 | 0 | 0 | |
| OCBBF20080410 | 0 | 5.038 | 0 | 0 | |
| OCBBF20108190 | 0 | 30.231 | 0 | 0 | |
| OCBBF20108580 | 0 | 16.054 | 0 | 0 | |
| OCBBF20122620 | 0 | 34.956 | 0 | 0 | |
| OCBBF20130110 | 0 | 18.197 | 0 | 0 | |
| OCBBF20151150 | 0 | 43.004 | 0 | 0 | |
| OCBBF20189560 | 0 | 4.079 | 0 | 0 | |
| PROST10003220 | 0 | 57.613 | 0 | 0 | |
| TESTI20001720 | 0 | 20.618 | 0 | 0 | |
| TESTI20121550 | 0 | 15.444 | 0 | 0 | |
| TESTI20152460 | 0 | 28.533 | 0 | 0 | |
| TESTI20211240 | 0 | 13.774 | 0 | 0 | |
| TESTI20234140 | 0 | 39.241 | 0 | 0 | |
| UMVEN20003540 | 0 | 1.985 | 0 | 0 | |
| UTERU20006960 | 0 | 6.858 | 0 | 0 | |
| UTERU20094350 | 0 | 12.888 | 0 | 0 | |
| UTERU20164260 | 0 | 30.63 | 0 | 0 | |
| TABLE 5 | |||
| CloneID | BEAST | TBAES | |
| BRACE20039040 | 0 | 18.237 | |
| BRAMY20163250 | 0 | 26.506 | |
| BRCOC20031250 | 0 | 39.975 | |
| BRHIP20005340 | 0 | 2.408 | |
| BRHIP20217620 | 0 | 19.598 | |
| BRHIP30001110 | 0 | 7.202 | |
| FCBBF10000770 | 0 | 5.697 | |
| FCBBF30010810 | 0 | 18.471 | |
| FEBRA20080810 | 0 | 9.963 | |
| FEBRA20144170 | 0 | 3.798 | |
| FEBRA20196630 | 0 | 61.269 | |
| FEBRA20197110 | 0 | 14.875 | |
| HCHON20002260 | 0 | 11.347 | |
| HCHON20040020 | 0 | 5.523 | |
| HHDPC20034390 | 0 | 1.789 | |
| HLUNG10000550 | 0 | 3.808 | |
| NOVAR10000910 | 0 | 27.245 | |
| NT2RI20023160 | 0 | 11.28 | |
| NT2RI20054050 | 0 | 1.975 | |
| NT2RI20091730 | 0 | 7.846 | |
| OCBBF20188730 | 0 | 9.748 | |
| SMINT20144800 | 0 | 22.352 | |
| SPLEN20128000 | 0 | 2.403 | |
| SPLEN20171210 | 0 | 54.539 | |
| SPLEN20264110 | 0 | 80.173 | |
| TBAES20000590 | 0 | 84.801 | |
| TBAES20002550 | 0 | 100 | |
| TBAES20003150 | 0 | 100 | |
| TESTI20334410 | 0 | 15.439 | |
| TESTI20432750 | 0 | 62.244 | |
| TRACH20003590 | 0 | 20.978 | |
| TRACH20084720 | 0 | 11.037 | |
| UTERU20046640 | 0 | 11.937 | |
| BEAST20004540 | 100 | 0 | |
| SPLEN20008740 | 10.632 | 0 | |
| TABLE 6 | |||
| CloneID | CERVX | TCERX | |
| BGGI120006160 | 0 | 18.869 | |
| BRAMY20063970 | 0 | 59.264 | |
| BRHIP20218580 | 0 | 70.621 | |
| FEBRA20002100 | 0 | 14.918 | |
| SPLEN20162680 | 0 | 9.118 | |
| TESTI20214250 | 0 | 36.333 | |
| CTONG20105080 | 84.727 | 0 | |
| HCHON20015980 | 50.212 | 0 | |
| PROST20175290 | 52.453 | 0 | |
| TESTI20254220 | 51.293 | 0 | |
| THYMU20279750 | 82.6 | 0 | |
| TABLE 7 | |||
| CloneID | COLON | TCOLN | |
| ASTRO20001410 | 0 | 32.199 | |
| BRAWH20162690 | 0 | 27.951 | |
| CTONG20132220 | 0 | 79.674 | |
| HCHON20002260 | 0 | 17.098 | |
| NT2RI20001330 | 0 | 54.324 | |
| TCOLN20001390 | 0 | 100 | |
| 3NB6910001910 | 42.978 | 0 | |
| BRAMY20120910 | 41.689 | 0 | |
| BRAWH20004600 | 4.285 | 0 | |
| BRCOC20031250 | 39.895 | 0 | |
| BRCOC20031870 | 11.042 | 0 | |
| COLON10001350 | 100 | 0 | |
| COLON20043180 | 100 | 0 | |
| COLON20093370 | 100 | 0 | |
| FEBRA20002100 | 4.963 | 0 | |
| FEBRA20082010 | 16.836 | 0 | |
| FEBRA20197110 | 29.691 | 0 | |
| KIDNE20007770 | 53.588 | 0 | |
| KIDNE20013730 | 50.02 | 0 | |
| NT2RP70045590 | 59.84 | 0 | |
| OCBBF20078920 | 29.908 | 0 | |
| PROST20083600 | 12.636 | 0 | |
| SPLEN20011410 | 6.63 | 0 | |
| TRACH20084720 | 11.015 | 0 | |
| THYMU20271250 | 1.257 | 15.18 | |
| TABLE 8 | |||
| CloneID | NESOP | TESOP | |
| ASTRO20033160 | 0 | 20.183 | |
| ASTRO20125520 | 0 | 10.113 | |
| BRAMY20266850 | 0 | 16.957 | |
| BRAWH20164460 | 0 | 59.524 | |
| BRHIP20005340 | 0 | 9.367 | |
| BRHIP20191490 | 0 | 75.561 | |
| CTONG20095290 | 0 | 43.261 | |
| CTONG20143690 | 0 | 28.473 | |
| CTONG20161850 | 0 | 17.787 | |
| DFNES20001530 | 0 | 21.906 | |
| DFNES20071130 | 0 | 45.721 | |
| FCBBF30123470 | 0 | 15.017 | |
| FCBBF30175310 | 0 | 10.97 | |
| FEBRA20095140 | 0 | 45.326 | |
| HCHON20016650 | 0 | 10.558 | |
| MESAN20025190 | 0 | 31.731 | |
| NT2RI20028470 | 0 | 8.588 | |
| NT2RI20054050 | 0 | 1.921 | |
| NT2RP70036880 | 0 | 5.052 | |
| NTONG20009770 | 0 | 6.726 | |
| NTONG20064840 | 0 | 29.574 | |
| NTONG20076930 | 0 | 48.142 | |
| SMINT20042990 | 0 | 61.748 | |
| SPLEN20008820 | 0 | 12.019 | |
| SPLEN20128000 | 0 | 2.337 | |
| SPLEN20149110 | 0 | 7.218 | |
| STOMA20013890 | 0 | 39.515 | |
| TESOP20000900 | 0 | 100 | |
| TESOP20003120 | 0 | 66.097 | |
| TESOP20004000 | 0 | 100 | |
| TESOP20005270 | 0 | 70.604 | |
| TESOP20005690 | 0 | 100 | |
| TESTI20334410 | 0 | 7.508 | |
| THYMU20271250 | 0 | 2.449 | |
| TRACH20141240 | 0 | 7.062 | |
| UTERU20022940 | 0 | 12.42 | |
| NESOP10001080 | 100 | 0 | |
| NT2RI20023160 | 17.058 | 0 | |
| NTONG20013620 | 74.273 | 0 | |
| TRACH20077540 | 31.967 | 0 | |
| NTONG20015870 | 69.673 | 12.221 | |
| TABLE 9 | |||
| CloneID | KIDNE | TKIDN | |
| ASTRO20008010 | 0 | 3.776 | |
| ASTRO20181690 | 0 | 3.496 | |
| BRACE20111830 | 0 | 23.795 | |
| BRACE20152870 | 0 | 8.501 | |
| BRACE20237270 | 0 | 73.082 | |
| BRAMY20147540 | 0 | 5.185 | |
| BRAMY20286820 | 0 | 78.604 | |
| BRAWH20015350 | 0 | 12.794 | |
| BRAWH20096780 | 0 | 78.731 | |
| BRAWH20132190 | 0 | 35.86 | |
| BRAWH20182060 | 0 | 40.908 | |
| BRCAN20060190 | 0 | 13.906 | |
| BRCOC20004870 | 0 | 1.072 | |
| BRCOC20176520 | 0 | 51.098 | |
| BRHIP20000870 | 0 | 24.363 | |
| BRHIP20198190 | 0 | 32.096 | |
| BRHIP20233090 | 0 | 43.183 | |
| BRHIP30001110 | 0 | 3.79 | |
| BRSSN20015790 | 0 | 49.863 | |
| BRSTN20000580 | 0 | 8.929 | |
| CTONG10000940 | 0 | 1.442 | |
| CTONG20098440 | 0 | 66.526 | |
| CTONG20150910 | 0 | 6.012 | |
| CTONG20165050 | 0 | 66.526 | |
| DFNES20014040 | 0 | 38.579 | |
| DFNES20037420 | 0 | 38.579 | |
| FCBBF10000770 | 0 | 2.998 | |
| FCBBF30083820 | 0 | 39.87 | |
| FCBBF30247930 | 0 | 59.143 | |
| FEBRA20037500 | 0 | 6.758 | |
| FEBRA20072120 | 0 | 14.531 | |
| FEBRA20080810 | 0 | 2.621 | |
| FEBRA20086620 | 0 | 17.626 | |
| FEBRA20140100 | 0 | 59.757 | |
| FEBRA20144170 | 0 | 1.999 | |
| FEBRA20176800 | 0 | 35.198 | |
| HCHON20008320 | 0 | 13.096 | |
| HCHON20059870 | 0 | 36.909 | |
| HLUNG10000550 | 0 | 2.004 | |
| MESAN20106640 | 0 | 32.125 | |
| NT2RI20025400 | 0 | 6.399 | |
| NT2RI20076290 | 0 | 7.462 | |
| NT2RI20091940 | 0 | 3.638 | |
| OCBBF20019830 | 0 | 26.741 | |
| OCBBF20022900 | 0 | 37.332 | |
| OCBBF20039250 | 0 | 3.084 | |
| OCBBF20080050 | 0 | 11.755 | |
| OCBBF20097720 | 0 | 8.718 | |
| OCBBF20125530 | 0 | 4.341 | |
| OCBBF20130110 | 0 | 27.949 | |
| OCBBF20140640 | 0 | 5.056 | |
| OCBBF20173980 | 0 | 9.523 | |
| PANCR10000910 | 0 | 1.114 | |
| PROST20087700 | 0 | 2.887 | |
| PUAEN20044000 | 0 | 26.668 | |
| SPLEN20144520 | 0 | 68.029 | |
| SPLEN20160980 | 0 | 68.029 | |
| TKIDN10000010 | 0 | 41.198 | |
| TKIDN20004640 | 0 | 68.029 | |
| TKIDN20005210 | 0 | 55.069 | |
| TKIDN20030590 | 0 | 78.393 | |
| TKIDN20030620 | 0 | 100 | |
| TKIDN20047480 | 0 | 35.796 | |
| TRACH20003590 | 0 | 11.039 | |
| TRACH20028030 | 0 | 7.714 | |
| TRACH20183170 | 0 | 10.844 | |
| TRACH20184490 | 0 | 56.123 | |
| UMVEN20003540 | 0 | 3.049 | |
| UTERU20004240 | 0 | 3.144 | |
| UTERU20055930 | 0 | 12.464 | |
| ASTRO10001650 | 7.727 | 0 | |
| ASTRO20108190 | 2.346 | 0 | |
| BGGI120006160 | 3.117 | 0 | |
| BRACE20039040 | 9.038 | 0 | |
| BRAMY20102080 | 63.37 | 0 | |
| BRAWH20004600 | 2.128 | 0 | |
| BRAWH20125380 | 35.37 | 0 | |
| BRAWH20162690 | 4.596 | 0 | |
| BRHIP20115760 | 66.835 | 0 | |
| BRHIP20205090 | 65.282 | 0 | |
| CTONG20052650 | 65.178 | 0 | |
| CTONG20108210 | 2.491 | 0 | |
| CTONG20128470 | 6.004 | 0 | |
| CTONG20133480 | 19.179 | 0 | |
| CTONG20139070 | 7.516 | 0 | |
| D9OST20000310 | 16.47 | 0 | |
| DFNES20001530 | 11.162 | 0 | |
| FCBBF10001820 | 59.128 | 0 | |
| FEBRA20002100 | 4.929 | 0 | |
| HCHON20008980 | 35.524 | 0 | |
| HCHON20016650 | 5.38 | 0 | |
| HLUNG20033780 | 32.277 | 0 | |
| KIDNE20002520 | 2.979 | 0 | |
| KIDNE20003940 | 100 | 0 | |
| KIDNE20006780 | 100 | 0 | |
| KIDNE20007210 | 73.728 | 0 | |
| KIDNE20007770 | 19.958 | 0 | |
| KIDNE20008010 | 100 | 0 | |
| KIDNE20009470 | 8.811 | 0 | |
| KIDNE20011170 | 77.71 | 0 | |
| KIDNE20011400 | 100 | 0 | |
| KIDNE20013730 | 24.839 | 0 | |
| KIDNE20017130 | 54.019 | 0 | |
| KIDNE20018730 | 100 | 0 | |
| KIDNE20018970 | 100 | 0 | |
| KIDNE20020150 | 100 | 0 | |
| KIDNE20021680 | 100 | 0 | |
| KIDNE20021910 | 24.85 | 0 | |
| KIDNE20021980 | 100 | 0 | |
| KIDNE20022620 | 100 | 0 | |
| KIDNE20024830 | 100 | 0 | |
| KIDNE20027250 | 35.87 | 0 | |
| KIDNE20027950 | 100 | 0 | |
| KIDNE20028390 | 25.593 | 0 | |
| KIDNE20028720 | 1.993 | 0 | |
| KIDNE20028830 | 7.907 | 0 | |
| KIDNE20029800 | 10.988 | 0 | |
| KIDNE20067330 | 100 | 0 | |
| KIDNE20079440 | 35.045 | 0 | |
| KIDNE20096280 | 100 | 0 | |
| KIDNE20096470 | 100 | 0 | |
| KIDNE20100070 | 100 | 0 | |
| KIDNE20100840 | 100 | 0 | |
| KIDNE20101370 | 100 | 0 | |
| KIDNE20101510 | 100 | 0 | |
| KIDNE20102650 | 8.237 | 0 | |
| KIDNE20102710 | 100 | 0 | |
| KIDNE20104300 | 33.246 | 0 | |
| KIDNE20106740 | 100 | 0 | |
| KIDNE20107390 | 100 | 0 | |
| KIDNE20107500 | 74.264 | 0 | |
| KIDNE20107620 | 100 | 0 | |
| KIDNE20109730 | 100 | 0 | |
| KIDNE20109890 | 100 | 0 | |
| KIDNE20112000 | 100 | 0 | |
| KIDNE20115080 | 65.178 | 0 | |
| KIDNE20118580 | 100 | 0 | |
| KIDNE20120090 | 33.186 | 0 | |
| KIDNE20121880 | 62.256 | 0 | |
| KIDNE20122910 | 83.085 | 0 | |
| KIDNE20124400 | 6.171 | 0 | |
| KIDNE20125630 | 100 | 0 | |
| KIDNE20126010 | 100 | 0 | |
| KIDNE20126130 | 100 | 0 | |
| KIDNE20127100 | 33.012 | 0 | |
| KIDNE20127450 | 100 | 0 | |
| KIDNE20127750 | 100 | 0 | |
| KIDNE20130450 | 100 | 0 | |
| KIDNE20131580 | 63.24 | 0 | |
| KIDNE20132180 | 100 | 0 | |
| KIDNE20137340 | 100 | 0 | |
| KIDNE20138010 | 100 | 0 | |
| KIDNE20141190 | 49.697 | 0 | |
| KIDNE20144890 | 100 | 0 | |
| KIDNE20148900 | 100 | 0 | |
| KIDNE20163880 | 100 | 0 | |
| KIDNE20180710 | 49.105 | 0 | |
| KIDNE20181660 | 100 | 0 | |
| KIDNE20182690 | 100 | 0 | |
| KIDNE20186780 | 100 | 0 | |
| KIDNE20190740 | 100 | 0 | |
| LIVER20035110 | 28.683 | 0 | |
| MESAN20025190 | 16.169 | 0 | |
| NT2RP70043480 | 7.879 | 0 | |
| PROST20107820 | 1.696 | 0 | |
| PROST20123530 | 32.771 | 0 | |
| PROST20161950 | 20.387 | 0 | |
| PUAEN20030180 | 46.744 | 0 | |
| SKMUS20003610 | 3.728 | 0 | |
| SMINT20033400 | 10.243 | 0 | |
| TBAES20000590 | 5.253 | 0 | |
| TESTI20044310 | 29.162 | 0 | |
| TESTI20082330 | 45.847 | 0 | |
| TRACH20032720 | 12.917 | 0 | |
| UTERU20099720 | 12.351 | 0 | |
| TABLE 10 | |||
| CloneID | LIVER | TLIVE | |
| BRAWH20166790 | 83.525 | 0 | |
| CTONG20103480 | 15.35 | 0 | |
| HEART20005410 | 11.598 | 0 | |
| LIVER10001260 | 66.455 | 0 | |
| LIVER10004790 | 100 | 0 | |
| LIVER20002160 | 100 | 0 | |
| LIVER20011130 | 92.988 | 0 | |
| LIVER20011910 | 100 | 0 | |
| LIVER20028420 | 16.548 | 0 | |
| LIVER20035110 | 71.317 | 0 | |
| LIVER20035680 | 100 | 0 | |
| LIVER20038540 | 100 | 0 | |
| LIVER20045650 | 100 | 0 | |
| LIVER20055200 | 100 | 0 | |
| LIVER20055440 | 100 | 0 | |
| LIVER20059810 | 24.82 | 0 | |
| LIVER20062510 | 100 | 0 | |
| LIVER20064100 | 88.658 | 0 | |
| LIVER20064690 | 100 | 0 | |
| LIVER20075680 | 100 | 0 | |
| LIVER20080530 | 100 | 0 | |
| LIVER20084730 | 100 | 0 | |
| LIVER20085800 | 100 | 0 | |
| LIVER20087510 | 75.266 | 0 | |
| LIVER20091180 | 100 | 0 | |
| NTONG20063010 | 47.641 | 0 | |
| PROST20087700 | 6.762 | 0 | |
| PROST20107820 | 2.108 | 0 | |
| TRACH20005400 | 12.349 | 0 | |
| ASTRO20001410 | 0 | 10.441 | |
| ASTRO20125520 | 0 | 10.162 | |
| BRACE20152870 | 0 | 15.788 | |
| BRAMY20167060 | 0 | 34.076 | |
| BRAMY20181220 | 0 | 87.217 | |
| BRAMY20285160 | 0 | 81.346 | |
| BRCOC20001860 | 0 | 20.45 | |
| FEBRA20144170 | 0 | 3.712 | |
| HLUNG10000550 | 0 | 3.721 | |
| OCBBF20073540 | 0 | 6.907 | |
| OCBBF20088220 | 0 | 16.388 | |
| PLAGE60169420 | 0 | 26.895 | |
| SMINT20152940 | 0 | 54.735 | |
| SPLEN20242320 | 0 | 45.601 | |
| THYMU20000570 | 0 | 18.649 | |
| TRACH20077540 | 0 | 30.987 | |
| UTERU20055930 | 0 | 15.433 | |
| UTERU20065930 | 0 | 10.151 | |
| TABLE 11 | |||
| CloneID | HLUNG | TLUNG | |
| BRACE20096200 | 70.38 | 0 | |
| BRAWH20004600 | 2.238 | 0 | |
| BRAWH20030250 | 11.121 | 0 | |
| BRCAN20006390 | 61.519 | 0 | |
| BRCAN20280360 | 8.855 | 0 | |
| BRHIP20238880 | 1.35 | 0 | |
| CTONG10000940 | 1.428 | 0 | |
| CTONG20103480 | 6.495 | 0 | |
| CTONG20129960 | 10.709 | 0 | |
| CTONG20155180 | 48.707 | 0 | |
| FCBBF10001210 | 36.439 | 0 | |
| FEBRA20144170 | 1.98 | 0 | |
| FEBRA20197110 | 7.756 | 0 | |
| HCHON20002260 | 2.958 | 0 | |
| HHDPC20034390 | 0.933 | 0 | |
| HLUNG10000550 | 3.971 | 0 | |
| HLUNG20016330 | 29.367 | 0 | |
| HLUNG20016770 | 12.888 | 0 | |
| HLUNG20017120 | 12.093 | 0 | |
| HLUNG20023340 | 33.714 | 0 | |
| HLUNG20033780 | 33.957 | 0 | |
| HLUNG20084390 | 100 | 0 | |
| IMR3220002430 | 3.147 | 0 | |
| LIVER20028420 | 14.004 | 0 | |
| NOVAR20000380 | 2.278 | 0 | |
| NT2RI20023910 | 8.923 | 0 | |
| NT2RI20054050 | 2.059 | 0 | |
| NT2RI20091730 | 4.091 | 0 | |
| NT2RP70044280 | 12.369 | 0 | |
| OCBBF20020830 | 40.304 | 0 | |
| OCBBF20125530 | 4.302 | 0 | |
| PLACE60004630 | 28.618 | 0 | |
| PROST20057930 | 14.383 | 0 | |
| PROST20107820 | 0.892 | 0 | |
| PROST20185830 | 33.898 | 0 | |
| PUAEN20030180 | 12.294 | 0 | |
| SMINT20121220 | 12.822 | 0 | |
| SPLEN20002220 | 44.799 | 0 | |
| SPLEN20008740 | 1.788 | 0 | |
| SPLEN20054290 | 26.875 | 0 | |
| SPLEN20128000 | 1.253 | 0 | |
| SPLEN20157300 | 51.319 | 0 | |
| SPLEN20176200 | 18.8 | 0 | |
| SPLEN20179180 | 3.344 | 0 | |
| SPLEN20211940 | 12.373 | 0 | |
| STOMA20013890 | 21.183 | 0 | |
| TBAES20000590 | 5.527 | 0 | |
| TESTI20094230 | 59.311 | 0 | |
| TESTI20184620 | 10.365 | 0 | |
| TESTI20334410 | 8.049 | 0 | |
| THYMU20000570 | 4.974 | 0 | |
| THYMU20039810 | 1.915 | 0 | |
| TRACH20007020 | 14.4 | 0 | |
| TRACH20141240 | 3.786 | 0 | |
| TRACH20183170 | 10.745 | 0 | |
| ASTRO20108190 | 0 | 13.924 | |
| ASTRO20155290 | 0 | 38.341 | |
| BRHIP20096850 | 0 | 73.716 | |
| FEBRA20080810 | 0 | 14.654 | |
| MESAN20014500 | 0 | 59.68 | |
| SMINT20028820 | 0 | 60.089 | |
| SPLEN20162680 | 0 | 8.941 | |
| TABLE 12 | |||
| CloneID | NOVAR | TOVAR | |
| BGGI120006160 | 21.31 | 0 | |
| BRHIP20005340 | 8.158 | 0 | |
| BRHIP20191860 | 47.038 | 0 | |
| HHDPC20001040 | 44.094 | 0 | |
| NOVAR10000150 | 72.374 | 0 | |
| NOVAR10000910 | 46.155 | 0 | |
| NOVAR10001020 | 99.094 | 0 | |
| NOVAR20000380 | 14.805 | 0 | |
| NOVAR20003520 | 100 | 0 | |
| THYMU20271250 | 4.266 | 0 | |
| ASTRO20141350 | 0 | 75.66 | |
| BRAMY20157820 | 0 | 85.296 | |
| BRCOC20001860 | 0 | 64.79 | |
| HLUNG20016770 | 0 | 76.536 | |
| NT2RI20054050 | 0 | 12.229 | |
| NTONG20090600 | 0 | 60.694 | |
| PROST20087700 | 0 | 16.991 | |
| PUAEN20015860 | 0 | 62.197 | |
| SPLEN20029310 | 0 | 88.828 | |
| TOVAR20004760 | 0 | 49.428 | |
| TOVAR20005750 | 0 | 96.313 | |
| TRACH20079690 | 0 | 55.276 | |
| UTERU20004240 | 0 | 18.499 | |
| TABLE 13 | |||
| CloneID | STOMA | TSTOM | |
| BRACE20060840 | 0 | 65.917 | |
| FEBRA20052910 | 0 | 77.883 | |
| HCHON20002260 | 0 | 8.66 | |
| HLUNG10000550 | 0 | 11.625 | |
| NTONG20009770 | 0 | 21.112 | |
| PROST20107820 | 0 | 5.223 | |
| THYMU20039810 | 0 | 11.216 | |
| TSTOM10001860 | 0 | 100 | |
| TSTOM20001390 | 0 | 89.823 | |
| TSTOM20003150 | 0 | 48.943 | |
| TSTOM20005690 | 0 | 100 | |
| ASTRO20125520 | 10.059 | 0 | |
| BRACE20039040 | 17.642 | 0 | |
| BRAMY20124260 | 42.064 | 0 | |
| BRCOC20031870 | 10.704 | 0 | |
| BRHIP20191860 | 13.43 | 0 | |
| CTONG20128470 | 11.719 | 0 | |
| FEBRA20037500 | 12.423 | 0 | |
| HCHON20040020 | 5.343 | 0 | |
| HHDPC10000830 | 6.661 | 0 | |
| IMR3220002430 | 5.838 | 0 | |
| KIDNE20007770 | 12.986 | 0 | |
| NOVAR20000380 | 4.227 | 0 | |
| NT2RI20054050 | 1.91 | 0 | |
| NT2RI20091730 | 7.59 | 0 | |
| PROST20130530 | 20.156 | 0 | |
| SPLEN20149110 | 7.179 | 0 | |
| SPLEN20157880 | 32.942 | 0 | |
| STOMA20001830 | 100 | 0 | |
| STOMA20005390 | 100 | 0 | |
| STOMA20005670 | 100 | 0 | |
| STOMA20006400 | 100 | 0 | |
| STOMA20006780 | 100 | 0 | |
| STOMA20006860 | 100 | 0 | |
| STOMA20008880 | 100 | 0 | |
| STOMA20010250 | 100 | 0 | |
| STOMA20013890 | 39.303 | 0 | |
| STOMA20026880 | 100 | 0 | |
| STOMA20032890 | 100 | 0 | |
| STOMA20034770 | 100 | 0 | |
| STOMA20036460 | 100 | 0 | |
| STOMA20046680 | 100 | 0 | |
| STOMA20048520 | 100 | 0 | |
| STOMA20048840 | 100 | 0 | |
| STOMA20051200 | 85.988 | 0 | |
| STOMA20056640 | 100 | 0 | |
| STOMA20056670 | 100 | 0 | |
| STOMA20057820 | 91.236 | 0 | |
| STOMA20062130 | 100 | 0 | |
| STOMA20062290 | 40.913 | 0 | |
| STOMA20063250 | 100 | 0 | |
| STOMA20063980 | 100 | 0 | |
| STOMA20064470 | 100 | 0 | |
| STOMA20067800 | 59.113 | 0 | |
| STOMA20069040 | 100 | 0 | |
| STOMA20072690 | 100 | 0 | |
| STOMA20076800 | 100 | 0 | |
| STOMA20077450 | 100 | 0 | |
| STOMA20080500 | 100 | 0 | |
| STOMA20083610 | 100 | 0 | |
| STOMA20086140 | 100 | 0 | |
| STOMA20088380 | 100 | 0 | |
| STOMA20092530 | 100 | 0 | |
| STOMA20092560 | 100 | 0 | |
| STOMA20092890 | 39.042 | 0 | |
| TESTI20184620 | 19.231 | 0 | |
| TRACH20003590 | 40.588 | 0 | |
| TRACH20183170 | 19.936 | 0 | |
| PROST20083600 | 12.248 | 38.653 | |
| TRACH20068660 | 6.753 | 21.311 | |
| TABLE 14 | |||
| CloneID | UTERU | TUTER | |
| DFNES10001850 | 0 | 29.393 | |
| NT2RI20023910 | 0 | 18.073 | |
| SMINT20144800 | 0 | 35.406 | |
| SPLEN20162680 | 0 | 9.628 | |
| TOVAR20004760 | 0 | 50.572 | |
| TUTER20002830 | 0 | 100 | |
| ASTRO20008010 | 1.217 | 0 | |
| ASTRO20033160 | 10.555 | 0 | |
| ASTRO20058630 | 4.534 | 0 | |
| ASTRO20105820 | 20.644 | 0 | |
| ASTRO20108190 | 3.21 | 0 | |
| BRACE20039040 | 3.092 | 0 | |
| BRACE20057190 | 3.542 | 0 | |
| BRACE20060840 | 3.661 | 0 | |
| BRACE20111830 | 7.667 | 0 | |
| BRACE20223330 | 10.589 | 0 | |
| BRAMY20266850 | 2.956 | 0 | |
| BRAWH20113430 | 8.367 | 0 | |
| BRAWH20126980 | 22.868 | 0 | |
| BRCOC20031870 | 0.938 | 0 | |
| BRCOC20107300 | 12.892 | 0 | |
| BRCOC20121720 | 6.71 | 0 | |
| BRCOC20155970 | 25.187 | 0 | |
| BRHIP20105710 | 18.366 | 0 | |
| BRHIP20191490 | 13.172 | 0 | |
| BRHIP20207990 | 12.072 | 0 | |
| BRHIP20217620 | 6.646 | 0 | |
| BRHIP20222280 | 10.898 | 0 | |
| BRHIP20238880 | 0.439 | 0 | |
| BRHIP20249110 | 11.054 | 0 | |
| BRSSN20018690 | 3.6 | 0 | |
| BRTHA20000570 | 51.819 | 0 | |
| CTONG10000940 | 0.464 | 0 | |
| CTONG10002770 | 24.668 | 0 | |
| CTONG20095290 | 7.541 | 0 | |
| CTONG20099380 | 23.863 | 0 | |
| CTONG20103480 | 6.336 | 0 | |
| CTONG20108210 | 2.557 | 0 | |
| CTONG20118250 | 10.239 | 0 | |
| CTONG20129960 | 3.482 | 0 | |
| CTONG20131560 | 24.668 | 0 | |
| CTONG20139070 | 2.571 | 0 | |
| CTONG20139340 | 8.273 | 0 | |
| CTONG20143690 | 4.963 | 0 | |
| CTONG20160560 | 2.372 | 0 | |
| D3OST30002580 | 22.242 | 0 | |
| FCBBF10000240 | 5.237 | 0 | |
| FCBBF10001820 | 10.114 | 0 | |
| FCBBF10003670 | 1.812 | 0 | |
| FCBBF10004120 | 2.308 | 0 | |
| FCBBF10005740 | 4.952 | 0 | |
| FCBBF30175310 | 1.912 | 0 | |
| FCBBF30240020 | 6.769 | 0 | |
| FCBBF30246230 | 6.682 | 0 | |
| FCBBF40001420 | 4.36 | 0 | |
| FEBRA20002100 | 0.843 | 0 | |
| FEBRA20004620 | 6.733 | 0 | |
| FEBRA20018280 | 6.489 | 0 | |
| FEBRA20025270 | 3.416 | 0 | |
| FEBRA20034360 | 6.63 | 0 | |
| FEBRA20037500 | 19.596 | 0 | |
| FEBRA20080810 | 0.845 | 0 | |
| FEBRA20082100 | 15.999 | 0 | |
| FEBRA20144170 | 1.288 | 0 | |
| FEBRA20225040 | 1.959 | 0 | |
| HCHON20002260 | 0.962 | 0 | |
| HCHON20007380 | 3.551 | 0 | |
| HCHON20015980 | 5.796 | 0 | |
| HCHON20016650 | 1.84 | 0 | |
| HCHON20022470 | 3.348 | 0 | |
| HCHON20040020 | 0.936 | 0 | |
| HCHON20076500 | 7.263 | 0 | |
| HEART20072310 | 11.555 | 0 | |
| HHDPC20034390 | 1.517 | 0 | |
| HLUNG10000550 | 1.937 | 0 | |
| HLUNG20016770 | 4.191 | 0 | |
| KIDNE20131580 | 21.635 | 0 | |
| LIVER20028420 | 9.107 | 0 | |
| MAMGL10000830 | 0.346 | 0 | |
| MESAN20171520 | 24.337 | 0 | |
| NOVAR10000150 | 3.622 | 0 | |
| NOVAR10000910 | 2.31 | 0 | |
| NT2NE20053580 | 24.761 | 0 | |
| NT2NE20159740 | 9.111 | 0 | |
| NT2NE20174920 | 20.127 | 0 | |
| NT2RI20023160 | 0.956 | 0 | |
| NT2RI20041880 | 3.425 | 0 | |
| NT2RI20054050 | 1.004 | 0 | |
| NT2RI20076290 | 2.404 | 0 | |
| NT2RI20273230 | 39.625 | 0 | |
| NT2RP60000770 | 30.666 | 0 | |
| NT2RP60000850 | 11.032 | 0 | |
| NT2RP70036880 | 0.881 | 0 | |
| NT2RP70043480 | 2.695 | 0 | |
| NT2RP70045590 | 10.166 | 0 | |
| NT2RP70056750 | 10.406 | 0 | |
| NT2RP70062230 | 5.039 | 0 | |
| NT2RP70081610 | 7.488 | 0 | |
| OCBBF10001750 | 8.591 | 0 | |
| OCBBF20006770 | 19.428 | 0 | |
| OCBBF20032460 | 11.672 | 0 | |
| OCBBF20039250 | 0.994 | 0 | |
| OCBBF20047570 | 2.956 | 0 | |
| OCBBF20054760 | 16.727 | 0 | |
| OCBBF20059560 | 3.386 | 0 | |
| OCBBF20068490 | 2.41 | 0 | |
| OCBBF20080050 | 3.787 | 0 | |
| OCBBF20094240 | 8.655 | 0 | |
| OCBBF20097720 | 1.404 | 0 | |
| OCBBF20103130 | 16.359 | 0 | |
| OCBBF20105570 | 43.708 | 0 | |
| OCBBF20140640 | 3.258 | 0 | |
| OCBBF20173980 | 3.068 | 0 | |
| OCBBF20180120 | 10.043 | 0 | |
| OCBBF20188730 | 6.611 | 0 | |
| OCBBF20189560 | 2.019 | 0 | |
| PEBLM20044520 | 6.439 | 0 | |
| PLACE60060420 | 6.493 | 0 | |
| PROST20087700 | 0.93 | 0 | |
| PROST20107820 | 0.29 | 0 | |
| PROST20149160 | 4.345 | 0 | |
| PROST20159240 | 8.082 | 0 | |
| PROST20176170 | 25.167 | 0 | |
| PROST20189770 | 15.499 | 0 | |
| PUAEN20003740 | 1.145 | 0 | |
| PUAEN20015860 | 3.406 | 0 | |
| SKMUS20003610 | 1.275 | 0 | |
| SKNSH20008190 | 5.937 | 0 | |
| SKNSH20080430 | 12.076 | 0 | |
| SMINT20026890 | 51.875 | 0 | |
| SMINT20029760 | 6.221 | 0 | |
| SMINT20068010 | 19.209 | 0 | |
| SMINT20110330 | 25.261 | 0 | |
| SMINT20121220 | 4.169 | 0 | |
| SPLEN20008390 | 10.886 | 0 | |
| SPLEN20011410 | 2.253 | 0 | |
| SPLEN20054290 | 17.478 | 0 | |
| SPLEN20128000 | 0.407 | 0 | |
| SPLEN20140800 | 5.651 | 0 | |
| SPLEN20145720 | 7.423 | 0 | |
| SPLEN20169720 | 4.837 | 0 | |
| SPLEN20179180 | 3.262 | 0 | |
| SPLEN20193110 | 57.827 | 0 | |
| SPLEN20194050 | 3.416 | 0 | |
| SPLEN20211940 | 8.047 | 0 | |
| SPLEN20212730 | 17.589 | 0 | |
| SPLEN20225220 | 1.691 | 0 | |
| TBAES20000590 | 1.797 | 0 | |
| TESTI20061110 | 24.59 | 0 | |
| TESTI20116830 | 38.615 | 0 | |
| TESTI20184620 | 3.37 | 0 | |
| TESTI20208710 | 64.596 | 0 | |
| TESTI20211240 | 6.816 | 0 | |
| TESTI20213580 | 40.357 | 0 | |
| TESTI20214250 | 4.107 | 0 | |
| TESTI20334410 | 2.618 | 0 | |
| TESTI20369130 | 24.204 | 0 | |
| TESTI20369690 | 4.285 | 0 | |
| TESTI20391770 | 4.943 | 0 | |
| THYMU20039810 | 2.491 | 0 | |
| THYMU20216840 | 58.853 | 0 | |
| THYMU20240710 | 39.309 | 0 | |
| TRACH20003590 | 3.557 | 0 | |
| TRACH20032720 | 4.419 | 0 | |
| TRACH20033230 | 2.123 | 0 | |
| TRACH20141240 | 3.693 | 0 | |
| TRAGH20149970 | 25.316 | 0 | |
| UMVEN10001860 | 0.63 | 0 | |
| UTERU20000740 | 62.692 | 0 | |
| UTERU20004240 | 1.013 | 0 | |
| UTERU20006290 | 100 | 0 | |
| UTERU20020010 | 40.126 | 0 | |
| UTERU20022940 | 2.165 | 0 | |
| UTERU20030570 | 3.085 | 0 | |
| UTERU20040610 | 100 | 0 | |
| UTERU20046640 | 4.048 | 0 | |
| UTERU20046980 | 100 | 0 | |
| UTERU20050690 | 64.596 | 0 | |
| UTERU20054460 | 24.816 | 0 | |
| UTERU20055330 | 100 | 0 | |
| UTERU20055930 | 4.016 | 0 | |
| UTERU20056010 | 3.04 | 0 | |
| UTERU20059050 | 100 | 0 | |
| UTERU20061030 | 100 | 0 | |
| UTERU20064000 | 15.228 | 0 | |
| UTERU20064860 | 51.819 | 0 | |
| UTERU20065930 | 3.522 | 0 | |
| UTERU20067050 | 100 | 0 | |
| UTERU20068990 | 100 | 0 | |
| UTERU20070040 | 24.856 | 0 | |
| UTERU20070810 | 17.449 | 0 | |
| UTERU20076390 | 100 | 0 | |
| UTERU20081300 | 53.896 | 0 | |
| UTERU20084260 | 26.26 | 0 | |
| UTERU20094350 | 12.756 | 0 | |
| UTERU20095380 | 40.674 | 0 | |
| UTERU20095400 | 100 | 0 | |
| UTERU20097760 | 100 | 0 | |
| UTERU20099720 | 16.901 | 0 | |
| UTERU20101240 | 100 | 0 | |
| UTERU20114100 | 100 | 0 | |
| UTERU20115740 | 100 | 0 | |
| UTERU20116570 | 100 | 0 | |
| UTERU20118110 | 100 | 0 | |
| UTERU20118970 | 100 | 0 | |
| UTERU20119060 | 16.267 | 0 | |
| UTERU20119680 | 100 | 0 | |
| UTERU20120310 | 53.896 | 0 | |
| UTERU20124070 | 29.356 | 0 | |
| UTERU20126880 | 51.568 | 0 | |
| UTERU20134910 | 13.929 | 0 | |
| UTERU20135860 | 7.858 | 0 | |
| UTERU20143980 | 100 | 0 | |
| UTERU20144640 | 16.101 | 0 | |
| UTERU20145480 | 39.231 | 0 | |
| UTERU20146310 | 100 | 0 | |
| UTERU20146680 | 39.231 | 0 | |
| UTERU20150870 | 100 | 0 | |
| UTERU20151980 | 100 | 0 | |
| UTERU20158300 | 58.853 | 0 | |
| UTERU20158800 | 100 | 0 | |
| UTERU20161570 | 100 | 0 | |
| UTERU20164260 | 15.158 | 0 | |
| UTERU20168220 | 19.178 | 0 | |
| UTERU20176130 | 12.264 | 0 | |
| UTERU20176320 | 64.596 | 0 | |
| UTERU20178100 | 100 | 0 | |
| UTERU20179880 | 100 | 0 | |
| UTERU20183640 | 53.896 | 0 | |
| UTERU20185230 | 40.126 | 0 | |
| UTERU20186740 | 100 | 0 | |
| UTERU20188110 | 100 | 0 | |
| UTERU20188810 | 100 | 0 | |
| BRAWH10000930 | 2.2 | 10.279 | |
| CT0NG20128470 | 2.054 | 38.378 | |
| UTERU20006960 | 3.394 | 63.416 | |
| TABLE 15 | |||
| CloneID | NTONG | CTONG | |
| ADRGL20018300 | 0 | 22.262 | |
| ASTRO20058630 | 0 | 14.161 | |
| ASTRO20072210 | 0 | 34.963 | |
| ASTRO20108190 | 0 | 5.013 | |
| BRACE20003070 | 0 | 2.194 | |
| BRACE20039040 | 0 | 4.829 | |
| BRACE20060720 | 0 | 36.712 | |
| BRACE20061050 | 0 | 39.515 | |
| BRACE20210140 | 0 | 11.034 | |
| BRACE20276430 | 0 | 26.828 | |
| BRAMY20152110 | 0 | 24.194 | |
| BRAMY20266850 | 0 | 4.616 | |
| BRAMY20271400 | 0 | 48.032 | |
| BRAWH10000930 | 0 | 3.436 | |
| BRAWH20004600 | 0 | 1.137 | |
| BRCAN20280360 | 0 | 4.497 | |
| BRCOC20004870 | 0 | 0.54 | |
| BRHIP20005340 | 0 | 5.1 | |
| BRHIP20005530 | 0 | 4.786 | |
| BRHIP20238880 | 0 | 2.741 | |
| BRSSN20146100 | 0 | 6.65 | |
| CTONG10000100 | 0 | 12.075 | |
| CTONG10000220 | 0 | 100 | |
| CTONG10000620 | 0 | 100 | |
| CTONG10000930 | 0 | 74.021 | |
| CTONG10000940 | 0 | 0.725 | |
| CTONG10001650 | 0 | 100 | |
| CTONG10002770 | 0 | 38.523 | |
| CTONG20002180 | 0 | 100 | |
| CTONG20004690 | 0 | 5.439 | |
| CTONG20009770 | 0 | 100 | |
| CTONG20014280 | 0 | 62.446 | |
| CTONG20027090 | 0 | 4.036 | |
| CTONG20028410 | 0 | 19.729 | |
| CTONG20038890 | 0 | 100 | |
| CTONG20049410 | 0 | 100 | |
| CTONG20050280 | 0 | 25.499 | |
| CTONG20052650 | 0 | 34.822 | |
| CTONG20052900 | 0 | 42.764 | |
| CTONG20075860 | 0 | 11.194 | |
| CTONG20076130 | 0 | 16.303 | |
| CTONG20077790 | 0 | 62.68 | |
| CTONG20082690 | 0 | 12.672 | |
| CTONG20085950 | 0 | 100 | |
| CTONG20091080 | 0 | 44.201 | |
| CTONG20091320 | 0 | 100 | |
| CTONG20092570 | 0 | 100 | |
| CTONG20092580 | 0 | 100 | |
| CTONG20092680 | 0 | 100 | |
| CTONG20092700 | 0 | 100 | |
| CTONG20093950 | 0 | 100 | |
| CTONG20095270 | 0 | 100 | |
| CTONG20095290 | 0 | 11.777 | |
| CTONG20095340 | 0 | 14.323 | |
| CTONG20096430 | 0 | 100 | |
| CTONG20096750 | 0 | 100 | |
| CTONG20097660 | 0 | 100 | |
| CTONG20098440 | 0 | 33.474 | |
| CTONG20099380 | 0 | 37.266 | |
| CTONG20099550 | 0 | 100 | |
| CTONG20099630 | 0 | 38.502 | |
| CTONG20100240 | 0 | 100 | |
| CTONG20101480 | 0 | 100 | |
| CTONG20103480 | 0 | 13.193 | |
| CTONG20105080 | 0 | 15.273 | |
| CTONG20105660 | 0 | 25.256 | |
| CTONG20106230 | 0 | 100 | |
| CTONG20106520 | 0 | 29.937 | |
| CTONG20108210 | 0 | 2.662 | |
| CTONG20114290 | 0 | 100 | |
| CTONG20114740 | 0 | 100 | |
| CTONG20118150 | 0 | 100 | |
| CTONG20118250 | 0 | 15.991 | |
| CTONG20119200 | 0 | 100 | |
| CTONG20120770 | 0 | 100 | |
| CTONG20121010 | 0 | 29.404 | |
| CTONG20121580 | 0 | 33.983 | |
| CTONG20124010 | 0 | 7.835 | |
| CTONG20124220 | 0 | 69.076 | |
| CTONG20124470 | 0 | 100 | |
| CTONG20124730 | 0 | 100 | |
| CTONG20125540 | 0 | 100 | |
| CTONG20125640 | 0 | 7.359 | |
| CTONG20126070 | 0 | 3.221 | |
| CTONG20127450 | 0 | 10.331 | |
| CTONG20128470 | 0 | 9.622 | |
| CTONG20129960 | 0 | 32.63 | |
| CTONG20131490 | 0 | 24.817 | |
| CTONG20131560 | 0 | 38.523 | |
| CTONG20132220 | 0 | 6.999 | |
| CTONG20133390 | 0 | 100 | |
| CTONG20133480 | 0 | 10.246 | |
| CTONG20133520 | 0 | 50.616 | |
| CTONG20136300 | 0 | 100 | |
| CTONG20138030 | 0 | 100 | |
| CTONG20139070 | 0 | 8.031 | |
| CTONG20139340 | 0 | 12.919 | |
| CTONG20139860 | 0 | 100 | |
| CTONG20140320 | 0 | 100 | |
| CTONG20140580 | 0 | 100 | |
| CTONG20141650 | 0 | 8.968 | |
| CTONG20146300 | 0 | 100 | |
| CTONG20147050 | 0 | 34.963 | |
| CTONG20149460 | 0 | 100 | |
| CTONG20149950 | 0 | 100 | |
| CTONG20153300 | 0 | 52.97 | |
| CTONG20153580 | 0 | 74.021 | |
| CTONG20155180 | 0 | 24.734 | |
| CTONG20155400 | 0 | 100 | |
| CTONG20156780 | 0 | 62.446 | |
| CTONG20158040 | 0 | 100 | |
| CTONG20158150 | 0 | 16.385 | |
| CTONG20158660 | 0 | 100 | |
| CTONG20159530 | 0 | 100 | |
| CTONG20160560 | 0 | 3.704 | |
| CTONG20161850 | 0 | 19.368 | |
| CTONG20162170 | 0 | 100 | |
| CTONG20163550 | 0 | 100 | |
| CTONG20164990 | 0 | 65.066 | |
| CTONG20165050 | 0 | 33.474 | |
| CTONG20186320 | 0 | 14.897 | |
| CTONG20200310 | 0 | 100 | |
| CTONG20265130 | 0 | 100 | |
| CTONG20267700 | 0 | 100 | |
| CTONG20273610 | 0 | 100 | |
| FCBBF10000240 | 0 | 12.268 | |
| FCBBF10005740 | 0 | 3.866 | |
| FCBBF30123470 | 0 | 4.088 | |
| FCBBF30233680 | 0 | 9.14 | |
| FEBRA20025270 | 0 | 5.334 | |
| FEBRA20037500 | 0 | 6.8 | |
| HCHON20002260 | 0 | 1.502 | |
| HCHON20007380 | 0 | 5.546 | |
| HCHON20007510 | 0 | 6.65 | |
| HCHON20015350 | 0 | 17.176 | |
| HCHON20040020 | 0 | 1.462 | |
| HHDPC20034390 | 0 | 0.474 | |
| HLUNG10000550 | 0 | 2.016 | |
| KIDNE20002520 | 0 | 3.184 | |
| KIDNE20009470 | 0 | 9.415 | |
| KIDNE20115080 | 0 | 34.822 | |
| KIDNE20127100 | 0 | 35.274 | |
| LIVER20028420 | 0 | 3.556 | |
| MESAN20029400 | 0 | 5.924 | |
| NT2RI20023160 | 0 | 1.493 | |
| NT2RI20023910 | 0 | 1.51 | |
| NT2RI20091730 | 0 | 4.155 | |
| NT2RP70043480 | 0 | 4.209 | |
| NT2RP70078420 | 0 | 3.572 | |
| NT2RP70081610 | 0 | 11.694 | |
| OCBBF20006770 | 0 | 30.34 | |
| OCBBF20059560 | 0 | 5.287 | |
| OCBBF20073540 | 0 | 1.871 | |
| OCBBF20094240 | 0 | 13.516 | |
| OCBBF20108580 | 0 | 12.407 | |
| PEBLM20044520 | 0 | 15.083 | |
| PEBLM20071880 | 0 | 16.259 | |
| PROST20107820 | 0 | 0.453 | |
| PUAEN20030180 | 0 | 6.243 | |
| SKNSH20008190 | 0 | 4.636 | |
| SMINT20023280 | 0 | 34.547 | |
| SMINT20089170 | 0 | 20.839 | |
| SPLEN20179180 | 0 | 5.094 | |
| TESTI20094020 | 0 | 17.075 | |
| TESTI20094230 | 0 | 30.119 | |
| TESTI20152460 | 0 | 22.051 | |
| TESTI20184620 | 0 | 5.263 | |
| TESTI20211240 | 0 | 10.645 | |
| TESTI20442760 | 0 | 8.832 | |
| THYMU20039810 | 0 | 0.973 | |
| TRACH20028030 | 0 | 11.644 | |
| TRACH20141240 | 0 | 1.923 | |
| TSTOM20003150 | 0 | 4.245 | |
| UTERU20004240 | 0 | 1.582 | |
| UTERU20055930 | 0 | 2.091 | |
| UTERU20065930 | 0 | 2.75 | |
| UTERU20119060 | 0 | 12.702 | |
| UTERU20124070 | 0 | 45.844 | |
| BRACE20039440 | 34.336 | 0 | |
| BRACE20068590 | 74.88 | 0 | |
| FCBBF30018550 | 20.639 | 0 | |
| IMR3220002430 | 6.323 | 0 | |
| KIDNE20028830 | 16.715 | 0 | |
| NT2RI20028470 | 9.251 | 0 | |
| NT2RI20054050 | 2.069 | 0 | |
| NT2RI20086220 | 23.258 | 0 | |
| NTONG20009770 | 7.245 | 0 | |
| NTONG20013620 | 25.727 | 0 | |
| NTONG20028070 | 86.921 | 0 | |
| NTONG20029480 | 32.729 | 0 | |
| NTONG20029700 | 100 | 0 | |
| NTONG20046140 | 43.643 | 0 | |
| NTONG20048060 | 51.123 | 0 | |
| NTONG20049910 | 100 | 0 | |
| NTONG20050620 | 100 | 0 | |
| NTONG20050860 | 100 | 0 | |
| NTONG20051530 | 58.314 | 0 | |
| NTONG20052650 | 100 | 0 | |
| NTONG20056570 | 100 | 0 | |
| NTONG20061870 | 100 | 0 | |
| NTONG20063010 | 40.505 | 0 | |
| NTONG20064400 | 100 | 0 | |
| NTONG20064840 | 31.857 | 0 | |
| NTONG20065010 | 100 | 0 | |
| NTONG20066460 | 100 | 0 | |
| NTONG20067090 | 66.789 | 0 | |
| NTONG20067830 | 20.865 | 0 | |
| NTONG20070200 | 100 | 0 | |
| NTONG20070340 | 52.247 | 0 | |
| NTONG20075220 | 100 | 0 | |
| NTONG20076930 | 51.858 | 0 | |
| NTONG20077560 | 49.744 | 0 | |
| NTONG20083650 | 100 | 0 | |
| NTONG20088620 | 100 | 0 | |
| NTONG20090600 | 20.536 | 0 | |
| NTONG20090680 | 100 | 0 | |
| NTONG20092290 | 100 | 0 | |
| NTONG20092330 | 100 | 0 | |
| OCBBF20068490 | 14.895 | 0 | |
| SKMUS20001980 | 23.281 | 0 | |
| SMINT20138900 | 67.622 | 0 | |
| SPLEN20008390 | 67.269 | 0 | |
| SPLEN20162680 | 3.184 | 0 | |
| UTERU20134910 | 86.071 | 0 | |
| ASTRO20155290 | 13.655 | 3.451 | |
| FEBRA20080810 | 10.438 | 1.319 | |
| NT2RP70032610 | 10.013 | 27.835 | |
| NT2RP70036880 | 5.442 | 16.504 | |
| NTONG20015870 | 17.552 | 0.554 | |
| OCBBF20188730 | 10.213 | 2.581 | |
| SMINT20122910 | 33.985 | 8.589 | |
| SPLEN20099700 | 37.585 | 9.499 | |
| TABLE 16 | |||||||||||||
| CloneID | FCBBF | FEBRA | OCBBF | BRACE | BRALZ | BRAMY | BRAWH | BRCAN | BRCOC | BRHIP | BRSSN | BRSTN | BRTHA |
| 3NB6910001910 | 0 | 0 | 0 | 0 | 0 | 0 | 6.122 | 0 | 0 | 6.426 | 0 | 0 | 0 |
| ADRGL- | 0 | 0 | 0 | 8.483 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 20018300 | |||||||||||||
| ASTRO20001410 | 0 | 0 | 0 | 0 | 0 | 3.06 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| ASTRO20033160 | 0 | 0 | 0 | 2.094 | 0 | 0 | 2.95 | 0 | 0 | 0 | 0 | 0 | 0 |
| ASTRO20058630 | 0 | 0 | 0 | 0 | 0 | 0 | 7.603 | 0 | 0 | 0 | 0 | 0 | 0 |
| ASTRO20064750 | 0 | 0 | 0 | 0 | 0 | 7.505 | 0 | 0 | 0 | 0 | 0 | 0 | 16.519 |
| ASTRO20100720 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 39.838 | 0 | 0 | 0 | 0 | 0 |
| ASTRO20141350 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 12.305 | 0 | 0 | 0 | 0 |
| ASTRO20145760 | 0 | 0 | 0 | 0 | 0 | 11.388 | 0 | 0 | 0 | 0 | 42.066 | 0 | 0 |
| ASTRO20181690 | 0 | 0 | 0 | 0 | 0 | 0.952 | 0 | 2.167 | 0 | 1.927 | 0 | 0 | 0 |
| BGGI120006160 | 0 | 0 | 0 | 1.269 | 0 | 0.901 | 0 | 2.051 | 0 | 0 | 0 | 3.224 | 0.991 |
| BRACE20006400 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20011070 | 0 | 0 | 0 | 10.447 | 53.184 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20019540 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20027620 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20037660 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20038000 | 0 | 0 | 0 | 38.906 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 30.394 |
| BRACE20038470 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20038480 | 0 | 0 | 0 | 38.787 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20038850 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20039440 | 0 | 0 | 0 | 0.367 | 0 | 2.086 | 0.518 | 1.188 | 1.834 | 0 | 1.927 | 1.867 | 0 |
| BRACE20039540 | 0 | 0 | 0 | 16.746 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20050900 | 0 | 0 | 0 | 52.057 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20051380 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20051690 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20052160 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20053280 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20053480 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20053630 | 0 | 0 | 0 | 10.086 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20054500 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20055180 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20057420 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20057620 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20057730 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20058580 | 0 | 0 | 0 | 14.668 | 0 | 0 | 41.331 | 0 | 0 | 21.084 | 0 | 0 | 22.917 |
| BRACE20058810 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 17 | |||||||||||||
| BRACE20060840 | 0 | 0 | 0 | 2.179 | 0 | 3.093 | 0 | 14.084 | 0 | 0 | 0 | 11.067 | 0 |
| BRACE20060890 | 0 | 0 | 0 | 54.983 | 0 | 0 | 16.309 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20061050 | 0 | 0 | 0 | 15.058 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20061740 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20062400 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20062740 | 0 | 0 | 0 | 41.329 | 0 | 58.671 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20063630 | 0 | 0 | 0 | 26.312 | 0 | 9.338 | 0 | 21.263 | 0 | 0 | 0 | 0 | 0 |
| BRACE20063780 | 0 | 0 | 0 | 38.787 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20063800 | 0 | 0 | 0 | 58.183 | 0 | 0 | 0 | 0 | 0 | 41.817 | 0 | 0 | 0 |
| BRACE20063930 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20064880 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20068590 | 0 | 0 | 0 | 7.211 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 11.267 |
| BRACE20069090 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20081720 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20082950 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20096200 | 0 | 0 | 0 | 13.619 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20096540 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20097320 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20101700 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20101710 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20106840 | 0 | 0 | 0 | 38.787 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20107530 | 0 | 0 | 0 | 13.239 | 0 | 0 | 0 | 0 | 66.077 | 0 | 0 | 0 | 20.684 |
| BRACE20108130 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20108880 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20109370 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20109830 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20114780 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20115450 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20115920 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20116110 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20116460 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20118380 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20121850 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20141080 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20142320 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20147800 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20148210 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 18 | |||||||||||||
| BRACE20148240 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20150310 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20151320 | 0 | 0 | 0 | 11.694 | 0 | 0 | 0 | 0 | 58.366 | 0 | 0 | 0 | 0 |
| BRACE20152870 | 0 | 0 | 0 | 1.63 | 0 | 0 | 0 | 0 | 8.135 | 0 | 0 | 0 | 2.547 |
| BRACE20153680 | 0 | 0 | 0 | 41.512 | 0 | 0 | 58.488 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20154120 | 0 | 0 | 0 | 17.282 | 0 | 0 | 12.174 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20163150 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20163350 | 0 | 0 | 0 | 9.897 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20165830 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20171240 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20172980 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20175870 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20177200 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20179340 | 0 | 0 | 0 | 13.12 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 33.326 | 0 |
| BRACE20185680 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20188470 | 0 | 0 | 0 | 13.846 | 0 | 0 | 39.016 | 0 | 0 | 0 | 0 | 0 | 21.634 |
| BRACE20190040 | 0 | 0 | 0 | 39.025 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 60.975 |
| BRACE20190440 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20192440 | 0 | 0 | 0 | 28.977 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20195100 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20201570 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20220300 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20223280 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20223330 | 0 | 0 | 0 | 12.602 | 0 | 0 | 17.756 | 0 | 0 | 18.115 | 0 | 0 | 19.69 |
| BRACE20224480 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20224500 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20228480 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20229280 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20230700 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20232840 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20235400 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20237270 | 0 | 0 | 0 | 14.013 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20238000 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20240740 | 0 | 0 | 0 | 45.981 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20248260 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20253160 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20253330 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 19 | |||||||||||||
| BRACE20257100 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20262930 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20262940 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20266750 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20267250 | 0 | 0 | 0 | 13.014 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20269200 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20269710 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20273890 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20274080 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20283920 | 0 | 0 | 0 | 7.236 | 0 | 0 | 0 | 0 | 18.058 | 0 | 37.945 | 36.76 | 0 |
| BRACE20284100 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20286360 | 0 | 0 | 0 | 37.993 | 48.354 | 0 | 0 | 0 | 0 | 13.653 | 0 | 0 | 0 |
| BRACE20287410 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRALZ20013500 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRALZ20014450 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRALZ20017430 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRALZ20018340 | 0 | 0 | 0 | 0 | 76.517 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 23.483 |
| BRALZ20054710 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRALZ20058880 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRALZ20059500 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRALZ20064740 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRALZ20065600 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRALZ20069760 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRALZ20073760 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRALZ20075450 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRALZ20075760 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRALZ20077900 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRALZ20077930 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRALZ20080310 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRALZ20088690 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY10001300 | 0 | 0 | 0 | 0 | 0 | 12.137 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY10001570 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20000520 | 0 | 0 | 0 | 0 | 39.13 | 21.823 | 0 | 0 | 0 | 0 | 0 | 39.047 | 0 |
| BRAMY20000860 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20002770 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20004110 | 0 | 0 | 0 | 4.399 | 0 | 18.735 | 0 | 0 | 0 | 12.647 | 23.069 | 0 | 0 |
| BRAMY20011140 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 20 | |||||||||||||
| BRAMY20025840 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20039260 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20045240 | 0 | 0 | 0 | 0 | 0 | 21.841 | 0 | 0 | 0 | 0 | 0 | 78.159 | 0 |
| BRAMY20054880 | 0 | 0 | 0 | 8.088 | 0 | 22.964 | 0 | 0 | 40.37 | 11.626 | 0 | 0 | 0 |
| BRAMY20060920 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20063970 | 0 | 0 | 0 | 0 | 0 | 2.83 | 0 | 6.443 | 0 | 2.865 | 10.452 | 0 | 0 |
| BRAMY20071850 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20102080 | 0 | 0 | 0 | 0 | 0 | 36.63 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20104640 | 0 | 0 | 0 | 15.639 | 0 | 33.302 | 11.017 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20110640 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20111960 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20116790 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20121190 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20121620 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20124260 | 0 | 0 | 0 | 0 | 0 | 6.228 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20134140 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20135900 | 0 | 0 | 0 | 0 | 0 | 43.537 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20136210 | 0 | 0 | 0 | 0 | 0 | 29.482 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20137560 | 0 | 0 | 0 | 0 | 0 | 19.026 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20144620 | 0 | 0 | 0 | 0 | 0 | 49.688 | 0 | 0 | 0 | 50.312 | 0 | 0 | 0 |
| BRAMY20147540 | 0 | 0 | 0 | 5.965 | 5.061 | 4.234 | 5.603 | 12.854 | 9.924 | 27.152 | 10.427 | 0 | 12.427 |
| BRAMY20148130 | 0 | 0 | 0 | 0 | 0 | 19.441 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20152110 | 0 | 0 | 0 | 0 | 0 | 13.088 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20153110 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20157820 | 0 | 0 | 0 | 0 | 0 | 7.891 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20160700 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20163250 | 0 | 0 | 0 | 0 | 0 | 3.796 | 11.304 | 0 | 0 | 3.844 | 0 | 0 | 4.178 |
| BRAMY20163270 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20167060 | 0 | 0 | 0 | 0 | 0 | 4.994 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20167710 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20168920 | 0 | 0 | 0 | 10.306 | 0 | 14.63 | 14.52 | 0 | 0 | 44.442 | 0 | 0 | 16.102 |
| BRAMY20170140 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20174550 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20178640 | 0 | 0 | 0 | 0 | 0 | 13.922 | 0 | 0 | 0 | 14.097 | 51.427 | 0 | 0 |
| BRAMY20181220 | 0 | 0 | 0 | 0 | 0 | 12.783 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20182730 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20183080 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 21 | |||||||||||||
| BRAMY20184670 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20195090 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20204450 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20205740 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20210400 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20211390 | 0 | 0 | 0 | 0 | 0 | 25.787 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20211420 | 0 | 0 | 0 | 38.011 | 0 | 26.981 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20213100 | 0 | 0 | 0 | 0 | 0 | 12.518 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20215230 | 0 | 0 | 0 | 0 | 0 | 21.367 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20217460 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20218250 | 0 | 0 | 0 | 0 | 0 | 66.389 | 0 | 0 | 0 | 33.611 | 0 | 0 | 0 |
| BRAMY20218670 | 0 | 0 | 0 | 25.113 | 0 | 35.65 | 0 | 0 | 0 | 0 | 0 | 0 | 39.237 |
| BRAMY20229800 | 0 | 0 | 0 | 0 | 0 | 15.383 | 30.533 | 0 | 54.084 | 0 | 0 | 0 | 0 |
| BRAMY20229840 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20230600 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20231720 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20240040 | 0 | 0 | 0 | 1.963 | 0 | 2.787 | 0 | 6.346 | 9.799 | 0 | 0 | 0 | 3.067 |
| BRAMY20245300 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20247110 | 0 | 0 | 0 | 0 | 0 | 12.354 | 0 | 0 | 43.436 | 0 | 0 | 44.21 | 0 |
| BRAMY20247280 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20248490 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20250240 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20250320 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20252180 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 9 | 0 | 0 | 0 | 0 |
| BRAMY20252720 | 0 | 0 | 0 | 0 | 0 | 47.605 | 0 | 0 | 0 | 0 | 0 | 0 | 52.395 |
| BRAMY20260910 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 9 | 0 | 0 | 0 | 0 |
| BRAMY20261680 | 0 | 0 | 0 | 0 | 0 | 32.33 | 32.087 | 0 | 9 | 0 | 0 | 0 | 35.583 |
| BRAMY20266850 | 0 | 0 | 0 | 0 | 0 | 2.497 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20267130 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20268990 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20270730 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20271400 | 0 | 0 | 0 | 0 | 0 | 51.968 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20273960 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20277140 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20277170 | 0 | 0 | 0 | 0 | 0 | 16.593 | 20.585 | 0 | 0 | 12.601 | 0 | 0 | 50.221 |
| BRAMY20280720 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20284910 | 0 | 0 | 0 | 0 | 0 | 36.15 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 22 | |||||||||||||
| BRAMY20285160 | 0 | 0 | 0 | 0 | 0 | 3.974 | 0 | 0 | 0 | 0 | 14.68 | 0 | 0 |
| BRAMY20285930 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20286820 | 0 | 0 | 0 | 0 | 0 | 21.396 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20002320 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20012390 | 0 | 0 | 0 | 0 | 0 | 0 | 7.296 | 0 | 0 | 0 | 27.156 | 0 | 8.091 |
| BRAWH20014920 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20015350 | 0 | 0 | 0 | 0 | 5.352 | 6.965 | 1.975 | 15.859 | 5.247 | 10.075 | 16.539 | 14.243 | 10.951 |
| BRAWH20015890 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20016660 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20016860 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20017010 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20018730 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20028110 | 0 | 0 | 0 | 0 | 31.162 | 17.379 | 8.624 | 0 | 0 | 17.598 | 0 | 0 | 9.564 |
| BRAWH20029630 | 0 | 0 | 0 | 8.469 | 0 | 0 | 11.932 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20064050 | 0 | 0 | 0 | 0 | 0 | 0 | 12.977 | 0 | 0 | 13.24 | 0 | 0 | 0 |
| BRAWH20075700 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20096780 | 0 | 0 | 0 | 0 | 0 | 0 | 21.269 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20100690 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20101360 | 0 | 0 | 0 | 0 | 0 | 26.605 | 26.404 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20103180 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20105840 | 0 | 0 | 0 | 0 | 0 | 0 | 30.356 | 69.644 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20106180 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20107540 | 0 | 0 | 0 | 7.94 | 0 | 0 | 11.186 | 0 | 0 | 0 | 0 | 40.334 | 0 |
| BRAWH20110660 | 0 | 0 | 0 | 0 | 0 | 0 | 21.178 | 0 | 0 | 0 | 78.822 | 0 | 0 |
| BRAWH20110790 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20110960 | 0 | 0 | 0 | 0 | 0 | 0 | 54.53 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20111550 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20112940 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20114000 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20117950 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20118230 | 0 | 0 | 0 | 0 | 0 | 0 | 21.626 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20122580 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20125380 | 0 | 0 | 0 | 0 | 0 | 0 | 10.145 | 0 | 0 | 0 | 18.88 | 0 | 0 |
| BRAWH20126190 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20126980 | 0 | 0 | 0 | 0 | 0 | 57.958 | 19.174 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20132190 | 0 | 0 | 0 | 0 | 35.004 | 9.761 | 19.375 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20137480 | 0 | 0 | 0 | 0 | 0 | 8.068 | 2.669 | 6.123 | 9.455 | 2.723 | 9.934 | 0 | 2.96 |
| TABLE 23 | |||||||||||||
| BRAWH20138660 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20139410 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20142340 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20147290 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20149340 | 0 | 0 | 0 | 0 | 0 | 0 | 35.975 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20155950 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20158530 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20160280 | 0 | 0 | 0 | 0 | 0 | 50.189 | 49.811 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20162690 | 0 | 0 | 0 | 0.936 | 0 | 1.328 | 1.318 | 3.025 | 4.67 | 0 | 4.907 | 0 | 0 |
| BRAWH20166790 | 0 | 0 | 0 | 6.839 | 0 | 0 | 9.636 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20171030 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20173050 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20182060 | 0 | 0 | 0 | 0 | 0 | 0 | 11.051 | 0 | 0 | 11.275 | 0 | 0 | 36.766 |
| BRAWH20185060 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRCAN10001490 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 56.874 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20003460 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20006200 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20006390 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 38.481 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20054490 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20060190 | 0 | 0 | 0 | 2.666 | 13.575 | 0 | 0 | 25.857 | 26.617 | 3.833 | 0 | 13.546 | 0 |
| BRCAN20064010 | 0 | 0 | 0 | 0 | 0 | 22.844 | 0 | 52.014 | 0 | 0 | 0 | 0 | 25.142 |
| BRCAN20071190 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 38.885 | 0 | 0 | 0 | 61.115 | 0 |
| BRCAN20091560 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20103740 | 0 | 0 | 0 | 0 | 0 | 30.516 | 0 | 69.484 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20124080 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20126130 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20143700 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20147880 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20216690 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20224720 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20237240 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20263400 | 0 | 0 | 0 | 10.726 | 54.604 | 0 | 0 | 34.67 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20273100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20273340 | 0 | 0 | 0 | 0 | 0 | 30.516 | 0 | 69.484 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20273550 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20275130 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20279700 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 |
| TABLE 24 | |||||||||||||
| BRCAN20280210 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20280400 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 60.666 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20283190 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 29.858 | 0 | 0 | 48.439 | 0 | 0 |
| BRCAN20283380 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20284600 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20285450 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 38.885 | 0 | 0 | 0 | 61.115 | 0 |
| BRCOC10000870 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20001860 | 0 | 0 | 0 | 4.222 | 0 | 0 | 0 | 0 | 10.537 | 0 | 0 | 0 | 0 |
| BRCOC20004040 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20004870 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.665 | 1.026 | 0 | 0 | 0 | 0.643 |
| BRCOC20006370 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20008160 | 0 | 0 | 0 | 0 | 0 | 0 | 22.014 | 0 | 77.986 | 0 | 0 | 0 | 0 |
| BRCOC20008500 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20020850 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20021550 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 75.977 | 0 | 0 | 0 | 0 |
| BRCOC20023230 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20026640 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20027510 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20031000 | 0 | 0 | 0 | 16.691 | 0 | 0 | 0 | 0 | 83.309 | 0 | 0 | 0 | 0 |
| BRCOC20031250 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 20.131 | 0 | 0 | 0 | 0 |
| BRCOC20031870 | 0 | 0 | 0 | 0.558 | 0 | 0 | 0.786 | 1.804 | 2.786 | 0 | 5.854 | 2.836 | 0 |
| BRCOC20035130 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20037320 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 75.977 | 0 | 0 | 0 | 0 |
| BRCOC20037400 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20041750 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 34.465 | 0 | 0 | 0 | 0 |
| BRCOC20055420 | 0 | 0 | 0 | 0 | 0 | 17.805 | 0 | 0 | 62.599 | 0 | 0 | 0 | 19.596 |
| BRCOC20059510 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20077690 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20090520 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20091960 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20093800 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20099370 | 0 | 0 | 0 | 0 | 0 | 16.189 | 0 | 0 | 56.917 | 16.392 | 0 | 0 | 0 |
| BRCOC20101230 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2.513 | 3.881 | 0 | 0 | 0 | 0 |
| BRCOC20107300 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 38.292 | 0 | 0 | 0 | 11.987 |
| BRCOC20110100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20114180 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20117690 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| TABLE 25 | |||||||||||||
| BRCOC20119960 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20121720 | 0 | 0 | 0 | 1.996 | 0 | 0 | 0 | 0 | 9.965 | 2.87 | 0 | 0 | 3.119 |
| BRCOC20122290 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20128130 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 39.306 | 60.694 | 0 | 0 | 0 | 0 |
| BRCOC20134480 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20135730 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20136750 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20144000 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 59.512 | 0 | 0 | 0 | 0 |
| BRCOC20147480 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20148330 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20155970 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 74.813 | 0 | 0 | 0 | 0 |
| BRCOC20158240 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRCOC20176520 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 48.902 | 0 | 0 | 0 | 0 |
| BRCOC20178560 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 | 0 |
| BRHIP10001290 | 0 | 0 | 0 | 0 | 0 | 49.688 | 0 | 0 | 0 | 50.312 | 0 | 0 | 0 |
| BRHIP20000870 | 0 | 0 | 0 | 0 | 23.781 | 6.632 | 0 | 0 | 0 | 13.429 | 24.496 | 0 | 7.299 |
| BRHIP20001630 | 0 | 0 | 0 | 0 | 0 | 0 | 37.398 | 0 | 0 | 38.155 | 0 | 0 | 0 |
| BRHIP20096170 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20096850 | 0 | 0 | 0 | 0 | 0 | 0 | 7.124 | 0 | 0 | 7.269 | 0 | 0 | 7.901 |
| BRHIP20103090 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20104440 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 47.917 | 0 | 0 | 52.083 |
| BRHIP20105710 | 0 | 0 | 0 | 21.859 | 0 | 15.515 | 0 | 0 | 0 | 31.42 | 0 | 0 | 0 |
| BRHIP20106100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20107440 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20111200 | 0 | 0 | 0 | 32.686 | 0 | 7.734 | 15.351 | 0 | 0 | 15.661 | 28.568 | 0 | 0 |
| BRHIP20115080 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 22.032 | 0 | 0 | 23.948 |
| BRHIP20115760 | 0 | 0 | 0 | 13.607 | 0 | 0 | 0 | 0 | 0 | 19.559 | 0 | 0 | 0 |
| BRHIP20118380 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20118910 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 60.949 | 0 | 0 | 0 |
| BRHIP20119330 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20121410 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 47.917 | 0 | 0 | 52.083 |
| BRHIP20123140 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20129720 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 47.917 | 0 | 0 | 52.083 |
| BRHIP20132860 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 17.468 | 0 | 0 | 0 |
| BRHIP20135100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20137230 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20139720 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| TABLE 26 | |||||||||||||
| BRHIP20140630 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 36.967 | 0 | 0 | 0 |
| BRHIP20142850 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20143730 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 34.432 | 0 | 0 | 37.426 |
| BRHIP20143860 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 55.026 | 0 | 0 | 0 |
| BRHIP20149540 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20153560 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20153600 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20167880 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20169680 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20169900 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20170100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 14.025 | 0 | 0 | 0 |
| BRHIP20173150 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20174040 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20175420 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20180140 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20183690 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20186120 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20186500 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20189980 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20190070 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20191490 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 11.267 | 0 | 0 | 0 |
| BRHIP20191770 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20194940 | 0 | 0 | 0 | 25.807 | 0 | 0 | 0 | 0 | 0 | 74.193 | 0 | 0 | 0 |
| BRHIP20195890 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20196410 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20205090 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 19.104 | 0 | 0 | 0 |
| BRHIP20207430 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20207990 | 0 | 0 | 0 | 3.592 | 0 | 15.298 | 5.061 | 0 | 0 | 36.143 | 0 | 0 | 5.612 |
| BRHIP20208420 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20208590 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20227080 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20230710 | 0 | 0 | 0 | 0 | 0 | 49.688 | 0 | 0 | 0 | 50.312 | 0 | 0 | 0 |
| BRHIP20232290 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 15.312 | 0 | 0 | 0 |
| BRHIP20233090 | 0 | 0 | 0 | 8.28 | 0 | 0 | 11.666 | 0 | 0 | 23.804 | 0 | 0 | 0 |
| BRHIP20234380 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 26.026 | 0 | 0 | 0 |
| BRHIP20236950 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 36.438 | 0 | 0 | 0 |
| BRHIP20238600 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| TABLE 27 | |||||||||||||
| BRHIP20238690 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 36.661 | 0 | 0 | 39.849 |
| BRHIP20240460 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 31.291 | 0 | 0 | 0 |
| BRHIP20243470 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20249110 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 9.456 | 0 | 0 | 0 |
| BRHIP20252450 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 47.666 | 0 | 0 | 0 |
| BRHIP20253660 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20277620 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20283030 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20284800 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP20285830 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 12.691 | 0 | 0 | 0 |
| BRHIP20285930 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRHIP30004880 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 | 0 |
| BRSSN10000920 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20013420 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20014260 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20015030 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20015790 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 50.137 | 0 | 0 |
| BRSSN20018690 | 0 | 0 | 0 | 2.142 | 0 | 0 | 0 | 6.925 | 0 | 0 | 11.235 | 0 | 6.695 |
| BRSSN20028570 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20038200 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20038410 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20039370 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20043040 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20046570 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 85.061 | 0 | 0 |
| BRSSN20046790 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 56.646 | 0 | 16.878 |
| BRSSN20046860 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20066110 | 0 | 0 | 0 | 0 | 0 | 21.304 | 0 | 0 | 0 | 0 | 78.696 | 0 | 0 |
| BRSSN20097020 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20101100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20105870 | 0 | 0 | 0 | 16.015 | 0 | 0 | 0 | 0 | 0 | 0 | 83.985 | 0 | 0 |
| BRSSN20105960 | 0 | 0 | 0 | 0 | 43.31 | 12.077 | 0 | 0 | 0 | 0 | 44.612 | 0 | 0 |
| BRSSN20108300 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20120810 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20121030 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20137020 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 33.606 | 0 | 35.308 | 0 | 0 |
| BRSSN20142940 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 34.652 | 0 | 0 |
| BRSSN20146100 | 0 | 0 | 0 | 5.068 | 0 | 3.597 | 0 | 0 | 0 | 10.927 | 13.288 | 0 | 11.878 |
| TABLE 28 | |||||||||||||
| BRSSN20151990 | 0 | 0 | 0 | 16.015 | 0 | 0 | 0 | 0 | 0 | 0 | 83.985 | 0 | 0 |
| BRSSN20159070 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20159820 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 60.467 | 0 | 0 |
| BRSSN20169050 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20176820 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20177570 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSSN20187310 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 0 | 0 |
| BRSTN20000580 | 0 | 0 | 0 | 3.424 | 0 | 2.431 | 0 | 33.205 | 25.637 | 0 | 8.978 | 17.396 | 0 |
| BRSTN20005360 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 22.055 | 0 | 77.945 | 0 |
| BRTHA20000570 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 48.181 |
| BRTHA20004740 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 |
| BRTHA20046290 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 |
| BRTHA20046390 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 |
| BRTHA20046420 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 |
| CD34C30001250 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2.372 | 0 | 0 | 0 |
| CD34C30004240 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2.336 | 0 | 0 | 0 |
| CTONG10000100 | 0 | 0 | 0 | 0 | 0 | 6.532 | 0 | 0 | 0 | 0 | 0 | 0 | 7.19 |
| CTONG20004690 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 10.345 | 0 | 0 | 0 | 0 |
| CTONG20027090 | 0 | 0 | 0 | 1.538 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| CTONG20050280 | 0 | 0 | 0 | 14.575 | 0 | 0 | 6.845 | 0 | 0 | 0 | 0 | 0 | 7.591 |
| CTONG20076130 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 9.707 |
| CTONG20077790 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 37.32 |
| CTONG20095290 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 14.506 | 0 | 0 | 0 | 0 | 0 |
| CTONG20095340 | 0 | 0 | 0 | 16.375 | 0 | 0 | 0 | 0 | 0 | 23.537 | 28.623 | 0 | 8.528 |
| CTONG20099380 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 22.188 |
| CTONG20106520 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 35.648 |
| CTONG20118250 | 0 | 0 | 0 | 6.093 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| CTONG20121010 | 0 | 0 | 0 | 0 | 0 | 15.907 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| CTONG20127450 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5.659 | 0 | 0 | 0 |
| CTONG20128470 | 0 | 0 | 0 | 1.222 | 0 | 0 | 3.444 | 0 | 0 | 0 | 0 | 0 | 1.91 |
| CTONG20141650 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5.339 |
| CTONG20143690 | 0 | 0 | 0 | 2.954 | 0 | 0 | 0 | 0 | 0 | 4.246 | 0 | 0 | 0 |
| CTONG20153300 | 0 | 0 | 0 | 0 | 0 | 0 | 28.439 | 0 | 0 | 0 | 0 | 0 | 0 |
| CTONG20155180 | 0 | 0 | 0 | 0 | 0 | 0 | 26.559 | 0 | 0 | 0 | 0 | 0 | 0 |
| CTONG20158150 | 0 | 0 | 0 | 6.244 | 0 | 0 | 8.797 | 0 | 0 | 0 | 0 | 0 | 0 |
| CTONG20161850 | 0 | 0 | 0 | 3.69 | 0 | 2.619 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| CTONG20164990 | 0 | 0 | 0 | 0 | 0 | 0 | 34.934 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 29 | |||||||||||||
| CTONG20186320 | 0 | 0 | 0 | 5.677 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| D3OST10002700 | 0 | 0 | 0 | 0 | 0 | 7.81 | 0 | 0 | 9.153 | 0 | 0 | 0 | 0 |
| D6OST20003580 | 0 | 0 | 0 | 0 | 0 | 1.432 | 0 | 0 | 0 | 0 | 0 | 0 | 1.576 |
| D9OST20000310 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 16.736 | 0 | 0 | 0 | 0 |
| D9OST20035800 | 0 | 0 | 0 | 0 | 0 | 6.953 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| DFNES20010910 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 19.689 | 0 | 0 | 0 | 0 | 0 |
| DFNES20071130 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 7.411 |
| HCHON20002260 | 0 | 0 | 0 | 1.431 | 0 | 0 | 0.403 | 0.925 | 2.857 | 0.411 | 0 | 1.454 | 0 |
| HCHON20003220 | 0 | 0 | 0 | 0 | 0 | 0 | 10.98 | 0 | 0 | 0 | 0 | 0 | 0 |
| HCHON20010990 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2.783 | 0 | 0 | 3.025 |
| HCHON20015350 | 0 | 0 | 0 | 0 | 0 | 0 | 18.444 | 0 | 0 | 0 | 0 | 0 | 0 |
| HCHON20022470 | 0 | 0 | 0 | 1.993 | 10.144 | 0 | 5.615 | 0 | 9.945 | 2.864 | 0 | 0 | 9.34 |
| HCHON20067220 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 35.892 | 0 | 0 | 0 | 0 |
| HCHON20067700 | 0 | 0 | 0 | 0 | 0 | 0 | 2.822 | 0 | 0 | 0 | 0 | 0 | 0 |
| HEART20003060 | 0 | 0 | 0 | 9.616 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| HEART20005410 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3.07 | 4.74 | 0 | 0 | 0 | 0 |
| HEART20061950 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 9.669 | 0 | 0 | 0 |
| HEART20090000 | 0 | 0 | 0 | 7.336 | 0 | 0 | 0 | 23.712 | 0 | 0 | 0 | 0 | 0 |
| HHDPC10000650 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 27.988 | 0 | 0 | 0 |
| HHDPC20057940 | 0 | 0 | 0 | 0 | 0 | 8.015 | 0 | 0 | 0 | 8.116 | 0 | 0 | 8.821 |
| HLUNG20033780 | 0 | 0 | 0 | 6.571 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| KIDNE20011170 | 0 | 0 | 0 | 0 | 0 | 0 | 22.29 | 0 | 0 | 0 | 0 | 0 | 0 |
| KIDNE20027250 | 0 | 0 | 0 | 7.303 | 0 | 0 | 10.289 | 23.605 | 0 | 0 | 0 | 0 | 11.41 |
| KIDNE20104300 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 21.878 | 0 | 0 | 0 | 0 | 10.575 |
| KIDNE20107500 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 11.811 |
| KIDNE20122910 | 0 | 0 | 0 | 16.915 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| KIDNE20127100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 10.501 |
| KIDNE20180710 | 0 | 0 | 0 | 0 | 50.895 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| LIVER10001260 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 28.534 | 0 | 0 |
| LIVER20064100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 11.342 |
| LIVER20087510 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 9.629 |
| MAMGL10000830 | 0 | 0 | 0 | 0.206 | 0 | 0 | 0 | 0 | 0 | 0.296 | 0 | 0 | 0.321 |
| MESAN20031900 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 19.624 |
| MESAN20036460 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 23.021 |
| MESAN20106640 | 0 | 0 | 0 | 6.16 | 0 | 0 | 0 | 19.91 | 0 | 0 | 0 | 0 | 9.624 |
| MESAN20164090 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 38.222 | 0 | 0 | 0 | 0 | 0 |
| NOVAR10000150 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 10.757 | 0 | 0 | 0 | 0 |
| TABLE 30 | |||||||||||||
| NOVAR20000380 | 0 | 0 | 0 | 3.968 | 15.711 | 0.626 | 1.242 | 4.275 | 6.602 | 0 | 9.248 | 17.918 | 0 |
| NT2NE20010400 | 0 | 0 | 0 | 11.003 | 0 | 15.621 | 0 | 0 | 0 | 0 | 0 | 0 | 17.192 |
| NT2NE20010490 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 31.686 | 0 |
| NT2NE20021620 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 45.501 | 0 | 0 |
| NT2NE20122430 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 23.43 |
| NT2NE20125050 | 0 | 0 | 0 | 13.014 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| NT2NE20174920 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 18.714 |
| NT2RI20001330 | 0 | 0 | 0 | 1.819 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| NT2RI20023590 | 0 | 0 | 0 | 0 | 0 | 0 | 8.23 | 0 | 0 | 0 | 0 | 0 | 0 |
| NT2RI20041880 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 10.353 | 0 |
| NT2RI20046080 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 8.488 | 0 | 0 | 0 | 0 | 0 |
| NT2RI20216250 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 19.442 | 0 | 0 | 0 |
| NT2RI20252550 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 37.898 |
| NT2RP60000770 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 7.128 |
| NT2RP70045590 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 9.452 |
| NT2RP70063950 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 17.468 | 0 | 0 | 0 |
| NT2RP70195430 | 0 | 0 | 0 | 0 | 38.221 | 0 | 0 | 0 | 0 | 10.792 | 0 | 0 | 0 |
| NT2RP70198350 | 0 | 0 | 0 | 0 | 0 | 0 | 1.042 | 0 | 0 | 0 | 0 | 3.758 | 0 |
| NTONG20028070 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 13.079 |
| NTONG20046140 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 6.567 |
| NTONG20064840 | 0 | 0 | 0 | 3.068 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| NTONG20067830 | 0 | 0 | 0 | 0 | 0 | 2.853 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| NTONG20077560 | 0 | 0 | 0 | 4.791 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| PANCR10000910 | 0 | 0 | 0 | 0.214 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| PEBLM20024550 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 33.118 | 0 | 0 |
| PEBLM20052820 | 0 | 0 | 0 | 0 | 0 | 11.82 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| PEBLM20074370 | 0 | 0 | 0 | 0 | 21.543 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| PERIC20004780 | 0 | 0 | 0 | 7.727 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| PLACE50000660 | 0 | 0 | 0 | 0 | 0 | 18.438 | 0 | 0 | 0 | 0 | 0 | 32.991 | 0 |
| PLACE60079250 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 23.248 | 0 | 0 | 0 | 0 | 0 |
| PLACE60136720 | 0 | 0 | 0 | 0 | 0 | 27.825 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| PLACE60138830 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 38.39 |
| PROST20005670 | 0 | 0 | 0 | 0 | 0 | 14.432 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| PROST20050670 | 0 | 0 | 0 | 11.45 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 17.889 |
| PROST20107820 | 0 | 0 | 0 | 0 | 0 | 0 | 0.243 | 0 | 0 | 0 | 0 | 0 | 0 |
| PROST20111050 | 0 | 0 | 0 | 25.26 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| PROST20116600 | 0 | 0 | 0 | 16.676 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 31 | |||||||||||||
| PROST20120160 | 0 | 0 | 0 | 0 | 0 | 22.126 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| PROST20123530 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 33.893 | 0 |
| PROST20161950 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 21.086 | 0 |
| PROST20171280 | 0 | 0 | 0 | 0 | 0 | 8.119 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| PROST20175290 | 0 | 0 | 0 | 1.802 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2.815 |
| PROST20185830 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 33.325 | 0 |
| PROST20191640 | 0 | 0 | 0 | 0 | 0 | 0 | 3.687 | 0 | 0 | 0 | 0 | 0 | 0 |
| PUAEN20015860 | 0 | 0 | 0 | 2.027 | 0 | 0 | 0 | 0 | 0 | 2.913 | 0 | 0 | 0 |
| PUAEN20030180 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 12.086 | 3.717 |
| PUAEN20044000 | 0 | 0 | 0 | 0 | 0 | 7.259 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| PUAEN20078980 | 0 | 0 | 0 | 0 | 39.038 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| PUAEN20085150 | 0 | 0 | 0 | 13.781 | 0 | 0 | 0 | 0 | 0 | 9.905 | 0 | 0 | 21.533 |
| PUAEN20108240 | 0 | 0 | 0 | 11.155 | 0 | 26.393 | 5.239 | 0 | 0 | 16.034 | 0 | 0 | 11.619 |
| SKMUS20012010 | 0 | 0 | 0 | 0 | 0 | 1.795 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| SKNSH20062340 | 0 | 0 | 0 | 0 | 0 | 3.527 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| SMINT20013480 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 32.864 | 0 | 0 | 0 | 0 |
| SMINT20042990 | 0 | 0 | 0 | 6.406 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| SMINT20053300 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 51.332 | 0 | 0 |
| SMINT20076470 | 0 | 0 | 0 | 0 | 0 | 22.212 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| SMINT20092330 | 0 | 0 | 0 | 16.746 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| SMINT20101440 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 23.912 |
| SMINT20121220 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 12.384 | 0 | 0 | 0 | 3.877 |
| SMINT20121950 | 0 | 0 | 0 | 16.746 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| SMINT20122910 | 0 | 0 | 0 | 6.546 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| SMINT20130320 | 0 | 0 | 0 | 0 | 0 | 12.051 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| SMINT20131810 | 0 | 0 | 0 | 0 | 0 | 22.212 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| SMINT20144800 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5.628 | 0 | 5.913 | 0 | 0 |
| SMINT20163960 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 50.098 | 0 | 0 | 0 | 0 |
| SPLEN20002220 | 0 | 0 | 0 | 0 | 0 | 0 | 12.214 | 0 | 0 | 0 | 0 | 0 | 0 |
| SPLEN20008740 | 0 | 0 | 0 | 0 | 1.761 | 0 | 0.487 | 0 | 0 | 0 | 0 | 0 | 0 |
| SPLEN20011410 | 0 | 0 | 0 | 0.67 | 0 | 0 | 0 | 0 | 0 | 0.963 | 0 | 0 | 2.094 |
| SPLEN20016260 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 67.455 | 0 |
| SPLEN20027440 | 0 | 0 | 0 | 0 | 0 | 0 | 2.23 | 0 | 7.901 | 0 | 0 | 0 | 0 |
| SPLEN20029310 | 0 | 0 | 0 | 0 | 0 | 0 | 4.078 | 0 | 0 | 0 | 0 | 0 | 0 |
| SPLEN20033960 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 67.455 | 0 |
| SPLEN20054290 | 0 | 0 | 0 | 5.201 | 0 | 0 | 0 | 0 | 0 | 3.738 | 0 | 0 | 4.063 |
| SPLEN20126190 | 0 | 0 | 0 | 0 | 0 | 0 | 36.501 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 32 | |||||||||||||
| SPLEN20128000 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.784 | 0 | 0 | 0 | 0 | 0.379 |
| SPLEN20145720 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 22.047 | 0 | 0 | 0 | 6.902 |
| SPLEN20146450 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 68.148 | 0 | 0 |
| SPLEN20147110 | 0 | 0 | 0 | 0 | 0 | 0 | 2.652 | 0 | 0 | 0 | 0 | 0 | 0 |
| SPLEN20149110 | 0 | 0 | 0 | 0.749 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2.34 |
| SPLEN20157880 | 0 | 0 | 0 | 3.436 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5.368 |
| SPLEN20158900 | 0 | 0 | 0 | 28.977 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| SPLEN20171210 | 0 | 0 | 0 | 0 | 0 | 15.624 | 7.753 | 0 | 0 | 0 | 0 | 0 | 8.598 |
| SPLEN20179180 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3.23 | 0 | 0 | 0 | 0 |
| SPLEN20186430 | 0 | 0 | 0 | 0 | 0 | 0 | 36.501 | 0 | 0 | 0 | 0 | 0 | 0 |
| SPLEN20204170 | 0 | 0 | 0 | 9.907 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 50.331 | 15.479 |
| SPLEN20212730 | 0 | 0 | 0 | 0 | 0 | 0 | 14.747 | 0 | 0 | 0 | 0 | 0 | 16.354 |
| SPLEN20214580 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 38.93 |
| SPLEN20250390 | 0 | 0 | 0 | 28.977 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| STOMA20051200 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 14.012 |
| STOMA20062290 | 0 | 0 | 0 | 0 | 0 | 0 | 6.012 | 0 | 0 | 0 | 0 | 0 | 0 |
| STOMA20092890 | 0 | 0 | 0 | 4.072 | 0 | 0 | 5.737 | 0 | 0 | 0 | 0 | 0 | 0 |
| SYNOV20003970 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 48.614 | 0 | 0 | 0 |
| TESOP20005270 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 11.444 |
| TESTI10000940 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 22.629 | 0 | 0 | 0 | 0 | 0 |
| TESTI20001720 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 9.487 |
| TESTI20002720 | 0 | 0 | 0 | 6.872 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TESTI20004890 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 57.966 | 0 |
| TESTI20011200 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.986 | 0 | 0 | 0 |
| TESTI20035960 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 14.759 | 0 | 0 | 0 | 0 |
| TESTI20037560 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 11.634 |
| TESTI20044310 | 0 | 0 | 0 | 0 | 0 | 0 | 8.365 | 0 | 0 | 0 | 0 | 0 | 0 |
| TESTI20061110 | 0 | 0 | 0 | 14.633 | 0 | 0 | 0 | 47.3 | 0 | 0 | 0 | 0 | 0 |
| TESTI20063830 | 0 | 0 | 0 | 0 | 0 | 4.084 | 0 | 0 | 0 | 4.135 | 0 | 0 | 0 |
| TESTI20086210 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 35.791 | 0 | 0 | 0 | 0 |
| TESTI20152460 | 0 | 0 | 0 | 8.403 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TESTI20168960 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 43.832 | 0 | 0 | 0 |
| TESTI20170350 | 0 | 0 | 0 | 29.776 | 0 | 0 | 0 | 0 | 0 | 42.801 | 0 | 0 | 0 |
| TESTI20208400 | 0 | 0 | 0 | 11.599 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TESTI20213580 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 37.524 |
| TESTI20214250 | 0 | 0 | 0 | 1.222 | 0 | 0 | 1.722 | 0 | 0 | 0 | 0 | 0 | 1.909 |
| TESTI20254220 | 0 | 0 | 0 | 1.762 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 33 | |||||||||||||
| TESTI20258460 | 0 | 0 | 0 | 43.347 | 0 | 0 | 0 | 0 | 0 | 20.77 | 0 | 0 | 22.576 |
| TESTI20330310 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 34.12 |
| TESTI20334410 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2.434 |
| TESTI20366910 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 84.653 | 0 |
| TESTI20391770 | 0 | 0 | 0 | 5.883 | 0 | 0 | 16.578 | 0 | 0 | 21.141 | 0 | 0 | 18.384 |
| TESTI20432750 | 0 | 0 | 0 | 0 | 31.972 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TESTI20455620 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 84.653 | 0 |
| THYMU20000570 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1.504 |
| THYMU20058070 | 0 | 0 | 0 | 45.981 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| THYMU20066100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 30.115 |
| THYMU20075320 | 0 | 0 | 0 | 0 | 56.448 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| ThYMU20081490 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 6.532 |
| THYMU20100410 | 0 | 0 | 0 | 0 | 0 | 18.787 | 0 | 0 | 0 | 19.023 | 0 | 0 | 0 |
| THYMU20101920 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 57.08 |
| THYMU20108310 | 0 | 0 | 0 | 0 | 0 | 0 | 54.53 | 0 | 0 | 0 | 0 | 0 | 0 |
| THYMU20119390 | 0 | 0 | 0 | 45.981 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| THYMU20126900 | 0 | 0 | 0 | 0 | 0 | 3.915 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| THYMU20128260 | 0 | 0 | 0 | 0 | 0 | 22.315 | 22.147 | 0 | 0 | 22.595 | 0 | 0 | 0 |
| THYMU20169680 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 7.541 | 0 | 0 | 0 |
| THYMU20193640 | 0 | 0 | 0 | 29.854 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| THYMU20209590 | 0 | 0 | 0 | 7.868 | 0 | 0 | 11.085 | 25.432 | 0 | 0 | 0 | 0 | 12.293 |
| THYMU20235760 | 0 | 0 | 0 | 0 | 0 | 0 | 15.94 | 0 | 0 | 0 | 0 | 57.476 | 0 |
| THYMU20239430 | 0 | 0 | 0 | 0 | 0 | 0 | 54.53 | 0 | 0 | 0 | 0 | 0 | 0 |
| THYMU20240710 | 0 | 0 | 0 | 0 | 0 | 33.209 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| THYMU20253250 | 0 | 0 | 0 | 0 | 0 | 13.123 | 0 | 29.879 | 46.138 | 0 | 0 | 0 | 0 |
| THYMU20286290 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 20.303 |
| TKIDN10000010 | 0 | 0 | 0 | 7.899 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 12.342 |
| TKIDN20005210 | 0 | 0 | 0 | 0 | 0 | 0 | 29.753 | 0 | 0 | 15.178 | 0 | 0 | 0 |
| TKIDN20030590 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 21.607 | 0 | 0 | 0 |
| TRACH20005020 | 0 | 0 | 0 | 0 | 0 | 0 | 47.167 | 0 | 0 | 0 | 0 | 0 | 0 |
| TRACH20005400 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3.16 |
| TRACH20007020 | 0 | 0 | 0 | 5.573 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TRACH20019960 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 67.193 | 0 | 0 | 0 | 0 | 0 |
| TRACH20034840 | 0 | 0 | 0 | 38.787 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TRACH20079690 | 0 | 0 | 0 | 0 | 0 | 0 | 2.538 | 0 | 0 | 0 | 0 | 0 | 0 |
| TRACH20128110 | 0 | 0 | 0 | 5.533 | 28.17 | 0 | 0 | 17.886 | 0 | 0 | 0 | 0 | 34.582 |
| TRACH20149970 | 0 | 0 | 0 | 12.555 | 0 | 0 | 14.151 | 0 | 0 | 7.219 | 0 | 0 | 0 |
| TABLE 34 | |||||||||||||
| TRACH20183170 | 0 | 0 | 0 | 0 | 0 | 0 | 2.93 | 0 | 0 | 0 | 0 | 0 | 0 |
| UMVEN10001860 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.606 | 0 | 0 | 0 | 0 | 0 |
| UMVEN20003540 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1.89 | 2.918 | 0 | 0 | 2.97 | 0.913 |
| UTERU20000740 | 0 | 0 | 0 | 37.308 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| UTERU20030570 | 0 | 0 | 0 | 1.836 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 9.326 | 0 |
| UTERU20054460 | 0 | 0 | 0 | 0 | 75.184 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| UTERU20055930 | 0 | 0 | 0 | 1.593 | 0 | 3.393 | 4.49 | 0 | 0 | 0 | 4.178 | 4.047 | 4.979 |
| UTERU20056010 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5.848 | 0 | 2.601 | 0 | 0 | 0 |
| UTERU20064860 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 48.181 |
| UTERU20065930 | 0 | 0 | 0 | 1.048 | 0 | 5.951 | 2.953 | 0 | 0 | 1.506 | 0 | 0 | 3.275 |
| UTERU20070040 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 75.144 | 0 |
| UTERU20081300 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 46.104 | 0 | 0 | 0 |
| UTERU20084260 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 24.416 |
| UTERU20094350 | 0 | 0 | 0 | 0 | 0 | 5.388 | 26.737 | 0 | 0 | 16.367 | 0 | 0 | 5.93 |
| UTERU20120310 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 46.104 | 0 | 0 | 0 |
| UTERU20124070 | 0 | 0 | 0 | 0 | 0 | 24.8 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| UTERU20164260 | 0 | 0 | 0 | 0 | 0 | 0 | 12.709 | 0 | 0 | 0 | 0 | 0 | 14.093 |
| UTERU20168220 | 0 | 0 | 0 | 0 | 0 | 4.05 | 10.05 | 0 | 0 | 6.152 | 0 | 0 | 0 |
| UTERU20183640 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 46.104 | 0 | 0 | 0 |
| ASTRO20032120 | 27.675 | 0 | 0 | 10.632 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| ASTRO20125520 | 2.731 | 0 | 0 | 1.049 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1.639 |
| BRACE20039040 | 4.789 | 0 | 0 | 3.68 | 9.367 | 0 | 0 | 0 | 0 | 0 | 0 | 9.348 | 0 |
| BRACE20060720 | 36.414 | 0 | 0 | 13.99 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20062640 | 15.593 | 0 | 0 | 5.99 | 0 | 0 | 0 | 0 | 29.9 | 0 | 0 | 0 | 9.36 |
| BRACE20090440 | 18.536 | 0 | 0 | 7.121 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20099570 | 72.245 | 0 | 0 | 27.755 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20111830 | 11.876 | 0 | 0 | 22.812 | 0 | 6.477 | 0 | 0 | 0 | 13.116 | 0 | 0 | 14.257 |
| BRACE20142570 | 22.91 | 0 | 0 | 44.008 | 0 | 0 | 12.401 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20128270 | 16.614 | 0 | 0 | 0 | 0 | 9.061 | 8.993 | 0 | 31.859 | 0 | 33.472 | 0 | 0 |
| BRCAN20280360 | 4.46 | 0 | 0 | 0 | 8.724 | 4.865 | 0 | 5.539 | 0 | 2.463 | 0 | 0 | 0 |
| BRHIP20110800 | 64.423 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 35.577 | 0 | 0 | 0 |
| BRHIP20176420 | 47.719 | 0 | 0 | 0 | 0 | 13.013 | 12.915 | 0 | 0 | 26.353 | 0 | 0 | 0 |
| BRSSN20003120 | 19.877 | 0 | 0 | 7.636 | 0 | 21.682 | 10.759 | 0 | 0 | 0 | 40.045 | 0 | 0 |
| CTONG20105660 | 50.102 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| CTONG20124010 | 15.543 | 0 | 0 | 0 | 0 | 4.239 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| CTONG20133480 | 10.163 | 0 | 0 | 0 | 0 | 5.543 | 5.501 | 0 | 0 | 0 | 0 | 0 | 12.201 |
| CTONG20139070 | 7.966 | 0 | 0 | 4.591 | 0 | 2.172 | 2.156 | 0 | 0 | 0 | 0 | 0 | 2.391 |
| TABLE 35 | |||||||||||||
| CTONG20160560 | 3.674 | 0 | 0 | 0 | 0 | 0 | 3.977 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF10001210 | 18.354 | 0 | 0 | 0 | 0 | 10.01 | 0 | 0 | 35.196 | 0 | 0 | 0 | 0 |
| FCBBF10001550 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF10001710 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF10001820 | 15.666 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF10002430 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF10002700 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF10002800 | 10.435 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF10003220 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF10003740 | 73.865 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF10003760 | 78.7 | 0 | 0 | 0 | 0 | 0 | 21.3 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF10005060 | 34.365 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF10005460 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF10005500 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF20006780 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF20014270 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF20023700 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF20032970 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF20035280 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF20042170 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF20042560 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF20051220 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF20054280 | 72.245 | 0 | 0 | 27.755 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF20056370 | 5.134 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF20064520 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF20067810 | 11.69 | 0 | 0 | 0 | 0 | 6.376 | 0 | 0 | 0 | 0 | 0 | 0 | 7.017 |
| FCBBF20071860 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF20072650 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF20076330 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30008470 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30010810 | 9.702 | 0 | 0 | 1.864 | 9.488 | 2.646 | 0 | 0 | 0 | 0 | 0 | 0 | 5.824 |
| FCBBF30012350 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30012810 | 37.617 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30015940 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30019120 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30024750 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30028180 | 64.881 | 0 | 0 | 0 | 0 | 0 | 35.119 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 36 | |||||||||||||
| FCBBF30033050 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30039020 | 43.392 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30052180 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30054440 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30057290 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30062880 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30070770 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30071520 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30078290 | 20.784 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30083620 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30123470 | 4.055 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 7.775 | 0 | 8.169 | 0 | 2.434 |
| FCBBF30170590 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30172550 | 64.423 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 35.577 | 0 | 0 | 0 |
| FCBBF30175310 | 2.962 | 0 | 0 | 0 | 5.793 | 0 | 3.207 | 3.678 | 0 | 0 | 0 | 0 | 3.556 |
| FCBBF30178730 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30190850 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30195640 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30199610 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30215060 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30225660 | 64.881 | 0 | 0 | 0 | 0 | 0 | 35.119 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30240960 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30242250 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30243640 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30247930 | 29.517 | 0 | 0 | 11.34 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30252520 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30252800 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30252850 | 44.606 | 0 | 0 | 0 | 0 | 0 | 0 | 55.394 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30262510 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30266780 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30266920 | 29.977 | 0 | 0 | 11.517 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 58.507 | 0 |
| FCBBF30278630 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30279030 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30281880 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30284720 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30285280 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF40001730 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF40005480 | 27.002 | 0 | 0 | 10.374 | 0 | 14.727 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 17 | |||||||||||||
| HCHON20007380 | 5.501 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 11.082 | 0 | 0 |
| HEART20072310 | 8.949 | 0 | 0 | 0 | 0 | 4.881 | 0 | 0 | 0 | 4.942 | 0 | 0 | 0 |
| HHDPC20068620 | 13.827 | 0 | 0 | 0 | 0 | 7.541 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| HLUNG20023340 | 16.982 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| KIDNE20017130 | 28.625 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| KIDNE20028830 | 8.38 | 0 | 0 | 0 | 0 | 0 | 0 | 5.203 | 0 | 0 | 8.442 | 8.178 | 0 |
| MESAN20014500 | 5.328 | 0 | 0 | 6.141 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| NT2RP70072690 | 43.392 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| NT2RP70137640 | 20.975 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 11.583 | 0 | 0 | 0 |
| NTONG20067090 | 16.742 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| PLACE60004630 | 14.415 | 0 | 0 | 0 | 0 | 0 | 0 | 17.901 | 0 | 0 | 0 | 0 | 0 |
| PROST20083600 | 3.325 | 0 | 0 | 2.555 | 0 | 0 | 1.8 | 0 | 0 | 1.836 | 0 | 0 | 3.992 |
| PROST20189770 | 24.007 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 14.411 |
| RECTM20003490 | 7.826 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| SKNSH20008190 | 4.598 | 0 | 0 | 1.767 | 8.994 | 12.539 | 2.489 | 0 | 0 | 0 | 0 | 0 | 8.28 |
| SMINT20115880 | 34.363 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| SPLEN20169720 | 3.746 | 0 | 0 | 2.878 | 0 | 0 | 0 | 0 | 0 | 2.069 | 0 | 0 | 0 |
| SPLEN20194050 | 2.646 | 0 | 0 | 1.016 | 0 | 7.215 | 1.432 | 6.571 | 5.073 | 1.461 | 0 | 0 | 1.588 |
| SPLEN20284240 | 51.503 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TESTI20083940 | 73.865 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TESTI20213150 | 37.439 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TESTI20254540 | 20.808 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 12.49 |
| TESTI20265250 | 16.076 | 0 | 0 | 3.088 | 0 | 0 | 0 | 0 | 0 | 0 | 16.193 | 0 | 0 |
| TRACH20118940 | 32.856 | 0 | 0 | 0 | 0 | 8.96 | 0 | 0 | 0 | 0 | 0 | 32.063 | 0 |
| UTERU20145480 | 60.769 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| UTERU20146680 | 60.769 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| ASTRO20155290 | 0 | 9.237 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20030250 | 0 | 7.559 | 0 | 0 | 10.956 | 3.055 | 6.064 | 0 | 0 | 0 | 11.285 | 0 | 0 |
| BRAWH20113430 | 0 | 17.488 | 0 | 9.958 | 0 | 0 | 7.015 | 0 | 0 | 7.157 | 0 | 0 | 7.779 |
| BRAWH20122770 | 0 | 71.37 | 0 | 0 | 0 | 0 | 28.63 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRHIP20005340 | 0 | 0.853 | 0 | 0 | 0 | 0 | 0.342 | 0 | 0 | 0.349 | 0 | 0 | 0 |
| BRHIP30001110 | 0 | 2.552 | 0 | 0.727 | 3.699 | 2.063 | 0 | 2.349 | 3.627 | 3.133 | 3.81 | 3.691 | 3.406 |
| BRSTN20002200 | 0 | 8.553 | 0 | 0 | 0 | 20.742 | 0 | 7.871 | 0 | 10.501 | 0 | 37.113 | 15.219 |
| CTONG20052900 | 0 | 57.236 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| CTONG20108210 | 0 | 3.563 | 0 | 3.55 | 0 | 1.44 | 1.429 | 0 | 0 | 2.187 | 0 | 0 | 3.17 |
| DFNES20031920 | 0 | 7.467 | 0 | 0 | 0 | 3.018 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA10001900 | 0 | 19.812 | 0 | 0 | 0 | 0 | 0 | 18.233 | 0 | 0 | 0 | 0 | 0 |
| TABLE 38 | |||||||||||||
| FEBRA20003210 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20007620 | 0 | 15.507 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 22.43 | 0 |
| FEBRA20009090 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20010120 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20017050 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20018280 | 0 | 27.125 | 0 | 3.861 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20025270 | 0 | 7.139 | 0 | 0 | 0 | 2.886 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20025520 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20026110 | 0 | 54.171 | 0 | 0 | 0 | 0 | 21.73 | 0 | 0 | 0 | 0 | 0 | 24.098 |
| FEBRA20026280 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20029860 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20034680 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20037260 | 0 | 2.482 | 0 | 0.707 | 3.598 | 1.003 | 0 | 2.285 | 0 | 0 | 0 | 0 | 1.104 |
| FEBRA20040530 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20042190 | 0 | 70.959 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 29.041 | 0 | 0 | 0 |
| FEBRA20052910 | 0 | 9.04 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 13.076 | 0 |
| FEBRA20060610 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20072120 | 0 | 9.786 | 0 | 11.144 | 0 | 0 | 0 | 0 | 0 | 16.019 | 0 | 0 | 4.353 |
| FEBRA20079310 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20082010 | 0 | 5.978 | 0 | 0 | 0 | 0 | 2.398 | 0 | 0 | 0 | 0 | 0 | 2.659 |
| FEBRA20088360 | 0 | 79.225 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20090290 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20092890 | 0 | 34.98 | 0 | 0 | 50.703 | 0 | 0 | 0 | 0 | 14.316 | 0 | 0 | 0 |
| FEBRA20093520 | 0 | 70.959 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 29.041 | 0 | 0 | 0 |
| FEBRA20097310 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20113560 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20125070 | 0 | 18.603 | 0 | 0 | 26.964 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20132740 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20140100 | 0 | 40.243 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20161120 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20166540 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20167390 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20171380 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20176800 | 0 | 23.704 | 0 | 0 | 0 | 9.581 | 0 | 21.815 | 0 | 9.701 | 0 | 0 | 0 |
| FEBRA20184330 | 0 | 77.838 | 0 | 22.162 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20192420 | 0 | 20.225 | 0 | 5.758 | 0 | 0 | 0 | 0 | 0 | 8.277 | 0 | 0 | 0 |
| FEBRA20195820 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 39 | |||||||||||||
| FEBRA20196370 | 0 | 40.753 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20196630 | 0 | 21.712 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20197110 | 0 | 5.271 | 0 | 0 | 0 | 0 | 0 | 4.851 | 0 | 0 | 0 | 0 | 2.345 |
| FEBRA20211710 | 0 | 26.519 | 0 | 0 | 0 | 10.719 | 0 | 24.406 | 0 | 0 | 0 | 38.357 | 0 |
| FEBRA20214970 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20215500 | 0 | 77.838 | 0 | 22.162 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20216360 | 0 | 50.44 | 0 | 14.361 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20222040 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20223220 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20225040 | 0 | 4.094 | 0 | 0 | 0 | 0 | 0 | 3.768 | 11.636 | 0 | 0 | 0 | 0 |
| FEBRA20226010 | 0 | 77.838 | 0 | 22.162 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20229560 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20229630 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20232850 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20235500 | 0 | 40.825 | 0 | 0 | 59.175 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| HCHON20040020 | 0 | 1.957 | 0 | 0 | 0 | 1.582 | 0 | 0 | 0 | 0 | 0 | 0 | 1.741 |
| KIDNE20102650 | 0 | 5.89 | 0 | 0 | 0 | 0 | 2.363 | 0 | 0 | 0 | 0 | 0 | 0 |
| NT2RP70037240 | 0 | 23.02 | 0 | 26.217 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| PEBLM20072960 | 0 | 4.311 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| PLACE60169420 | 0 | 9.752 | 0 | 0 | 0 | 3.942 | 3.912 | 8.975 | 13.858 | 0 | 14.56 | 0 | 4.338 |
| SKMUS20003610 | 0 | 2.666 | 0 | 0 | 0 | 1.077 | 0 | 2.453 | 0 | 0 | 0 | 0 | 0 |
| SMINT20026890 | 0 | 2.93 | 0 | 10.012 | 0 | 1.184 | 4.702 | 0 | 0 | 0 | 0 | 0 | 1.304 |
| SMINT20033400 | 0 | 7.324 | 0 | 0 | 0 | 2.96 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| SPLEN20020070 | 0 | 47.573 | 0 | 0 | 0 | 19.229 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| SPLEN20079510 | 0 | 58.898 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TESTI20001000 | 0 | 48.295 | 0 | 0 | 0 | 39.041 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TESTI20094020 | 0 | 22.853 | 0 | 0 | 0 | 9.237 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| THYMU20027560 | 0 | 18.25 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| THYMU20180280 | 0 | 74.935 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| THYMU20271250 | 0 | 0.446 | 0 | 2.287 | 2.587 | 0.902 | 0.179 | 0.411 | 0 | 0 | 0 | 4.518 | 0.198 |
| TRACH20003590 | 0 | 7.434 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3.042 | 0 | 0 | 0 |
| UMVEN10001560 | 0 | 2.576 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| UTERU20022940 | 0 | 13.576 | 0 | 0 | 0 | 0 | 1.815 | 0 | 0 | 0 | 0 | 0 | 4.026 |
| UTERU20046640 | 0 | 4.23 | 0 | 0 | 0 | 1.71 | 1.697 | 0 | 0 | 0 | 0 | 0 | 1.882 |
| UTERU20119060 | 0 | 17 | 0 | 0 | 0 | 13.742 | 13.639 | 0 | 0 | 0 | 0 | 0 | 0 |
| UTERU20144640 | 0 | 33.653 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 50.246 | 0 | 0 |
| UTERU20176130 | 0 | 51.268 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 40 | |||||||||||||
| ASTR020008010 | 0 | 0 | 1.267 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20276430 | 0 | 0 | 17.893 | 10.223 | 0 | 0 | 0 | 33.045 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20103570 | 0 | 0 | 18.549 | 21.196 | 0 | 30.09 | 14.931 | 0 | 0 | 15.234 | 0 | 0 | 0 |
| BRAMY20120910 | 0 | 0 | 7.377 | 0 | 0 | 5.983 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20162510 | 0 | 0 | 8.934 | 5.104 | 25.986 | 43.477 | 0 | 16.499 | 0 | 0 | 0 | 0 | 0 |
| BRAMY20196000 | 0 | 0 | 30.091 | 0 | 0 | 8.135 | 16.148 | 0 | 0 | 0 | 0 | 0 | 8.954 |
| BRAWH20164460 | 0 | 0 | 10.808 | 0 | 0 | 0 | 8.7 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRCAN20273640 | 0 | 0 | 7.379 | 0 | 10.731 | 5.985 | 2.97 | 20.44 | 21.042 | 0 | 11.054 | 0 | 13.174 |
| BRCOC20105100 | 0 | 0 | 14.918 | 0 | 0 | 0 | 0 | 0 | 85.082 | 0 | 0 | 0 | 0 |
| BRHIP20198190 | 0 | 0 | 10.771 | 30.77 | 0 | 0 | 8.671 | 0 | 0 | 17.692 | 0 | 0 | 0 |
| BRHIP20222280 | 0 | 0 | 11.352 | 0 | 0 | 0 | 9.138 | 20.964 | 0 | 9.323 | 0 | 0 | 0 |
| BRHIP20254480 | 0 | 0 | 37.989 | 0 | 0 | 30.812 | 0 | 0 | 0 | 31.199 | 0 | 0 | 0 |
| BRHIP30004570 | 0 | 0 | 33.739 | 38.553 | 0 | 0 | 0 | 0 | 0 | 27.708 | 0 | 0 | 0 |
| CTONG20028410 | 0 | 0 | 26.318 | 15.036 | 0 | 0 | 21.185 | 0 | 0 | 10.807 | 0 | 0 | 0 |
| CTONG20091080 | 0 | 0 | 29.481 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 26.317 |
| CTONG20103480 | 0 | 0 | 2.2 | 7.541 | 0 | 1.784 | 3.542 | 4.063 | 0 | 1.807 | 6.591 | 0 | 3.927 |
| CTONG20126070 | 0 | 0 | 2.148 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5.754 |
| CTONG20139340 | 0 | 0 | 8.617 | 24.615 | 0 | 0 | 6.936 | 0 | 0 | 7.077 | 0 | 0 | 7.692 |
| DFNES20001530 | 0 | 0 | 3.977 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3.551 |
| HCHON20008150 | 0 | 0 | 3.469 | 0 | 0 | 2.814 | 2.793 | 0 | 0 | 0 | 10.394 | 0 | 0 |
| HHDPC20001040 | 0 | 0 | 4.596 | 1.313 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2.052 |
| HLUNG20016330 | 0 | 0 | 9.947 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| HLUNG20017120 | 0 | 0 | 4.096 | 0 | 35.74 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| IMR3220002430 | 0 | 0 | 2.132 | 1.218 | 0 | 1.729 | 0 | 0 | 0 | 2.626 | 0 | 0 | 0.951 |
| KIDNE20007210 | 0 | 0 | 26.272 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| KIDNE20021910 | 0 | 0 | 17.71 | 15.177 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 7.905 |
| KIDNE20124400 | 0 | 0 | 2.199 | 2.513 | 0 | 0 | 0 | 0 | 0 | 3.612 | 6.588 | 0 | 3.926 |
| MESAN10001260 | 0 | 0 | 2.218 | 7.605 | 0 | 0 | 1.786 | 0 | 0 | 3.644 | 0 | 0 | 1.98 |
| MESAN20029400 | 0 | 0 | 3.951 | 0 | 0 | 0 | 3.18 | 0 | 0 | 0 | 0 | 0 | 0 |
| MESAN20121130 | 0 | 0 | 7.329 | 0 | 0 | 0 | 0 | 0 | 0 | 6.019 | 0 | 0 | 6.543 |
| MESAN20153910 | 0 | 0 | 25.095 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| NT2NE20159740 | 0 | 0 | 18.979 | 21.687 | 0 | 7.697 | 0 | 0 | 0 | 0 | 0 | 0 | 8.471 |
| NT2NE20177520 | 0 | 0 | 29.166 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| NT2RI20086220 | 0 | 0 | 3.92 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 6.999 |
| NT2RI20250750 | 0 | 0 | 21.061 | 12.033 | 0 | 0 | 0 | 0 | 0 | 17.297 | 0 | 0 | 18.801 |
| NT2RP60000850 | 0 | 0 | 5.745 | 3.283 | 0 | 4.66 | 4.625 | 0 | 0 | 0 | 0 | 0 | 5.129 |
| NT2RP70044280 | 0 | 0 | 12.569 | 7.181 | 0 | 6.796 | 16.862 | 0 | 0 | 6.881 | 0 | 0 | 0 |
| TABLE 41 | |||||||||||||
| NT2RP70056750 | 0 | 0 | 7.226 | 8.256 | 0 | 5.861 | 11.633 | 0 | 0 | 8.901 | 0 | 0 | 3.225 |
| NT2RP70081610 | 0 | 0 | 15.599 | 4.456 | 0 | 0 | 0 | 0 | 0 | 6.405 | 0 | 0 | 0 |
| NTONG20009770 | 0 | 0 | 2.442 | 0 | 0 | 0 | 0 | 2.255 | 3.482 | 0 | 0 | 0 | 0 |
| OCBBF10000540 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF10001750 | 0 | 0 | 17.896 | 5.112 | 0 | 7.258 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20006770 | 0 | 0 | 20.236 | 0 | 0 | 16.413 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20013890 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20019830 | 0 | 0 | 8.974 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20020150 | 0 | 0 | 17.182 | 9.817 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 15.338 |
| OCBBF20020830 | 0 | 0 | 27.302 | 0 | 0 | 0 | 0 | 25.211 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20023570 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20028050 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20028650 | 0 | 0 | 65.522 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20029800 | 0 | 0 | 54.907 | 0 | 0 | 0 | 0 | 0 | 0 | 45.093 | 0 | 0 | 0 |
| OCBBF20030280 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20030910 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20035930 | 0 | 0 | 55.403 | 0 | 0 | 0 | 44.597 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20037440 | 0 | 0 | 52.585 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20041680 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20045330 | 0 | 0 | 25.025 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 74.975 | 0 | 0 |
| OCBBF20046120 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20046470 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20046690 | 0 | 0 | 54.907 | 0 | 0 | 0 | 0 | 0 | 0 | 45.093 | 0 | 0 | 0 |
| OCBBF20048660 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20050770 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20051610 | 0 | 0 | 54.907 | 0 | 0 | 0 | 0 | 0 | 0 | 45.093 | 0 | 0 | 0 |
| OCBBF20053430 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20053490 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20053730 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20054200 | 0 | 0 | 78.844 | 0 | 0 | 0 | 21.156 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20054760 | 0 | 0 | 5.808 | 0 | 0 | 4.71 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20060300 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20062140 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20062410 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20066390 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20071210 | 0 | 0 | 52.585 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20071840 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 42 | |||||||||||||
| OCBBF20072240 | 0 | 0 | 11.73 | 6.702 | 0 | 0 | 9.442 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20073540 | 0 | 0 | 1.248 | 0.713 | 0 | 1.012 | 3.014 | 2.305 | 0 | 0 | 0 | 0 | 1.114 |
| OCBBF20074140 | 0 | 0 | 59.836 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20076220 | 0 | 0 | 4.561 | 2.606 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20079310 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20079460 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20081380 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20082830 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20085200 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20086400 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20086910 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20088140 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20088220 | 0 | 0 | 2.961 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20091150 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20100400 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20103130 | 0 | 0 | 34.079 | 0 | 49.562 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20104040 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20105570 | 0 | 0 | 22.763 | 13.005 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20107090 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20107920 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20108580 | 0 | 0 | 33.1 | 4.728 | 0 | 0 | 13.322 | 0 | 0 | 20.388 | 0 | 0 | 0 |
| OCBBF20108630 | 0 | 0 | 55.216 | 0 | 0 | 44.784 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20109310 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20111770 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20116850 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20118970 | 0 | 0 | 21.447 | 0 | 0 | 17.395 | 0 | 0 | 61.158 | 0 | 0 | 0 | 0 |
| OCBBF20120390 | 0 | 0 | 9.527 | 3.266 | 0 | 7.727 | 26.074 | 0 | 0 | 31.296 | 0 | 0 | 22.111 |
| OCBBF20121390 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20122620 | 0 | 0 | 36.036 | 0 | 0 | 0 | 29.008 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20124360 | 0 | 0 | 59.836 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20127040 | 0 | 0 | 25.938 | 14.819 | 0 | 0 | 0 | 0 | 0 | 21.301 | 0 | 0 | 0 |
| OCBBF20127140 | 0 | 0 | 7.211 | 4.12 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20127550 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20128120 | 0 | 0 | 25.584 | 0 | 74.416 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20129360 | 0 | 0 | 55.403 | 0 | 0 | 0 | 44.597 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20130910 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20132850 | 0 | 0 | 63.64 | 36.36 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 43 | |||||||||||||
| OCBBF20140890 | 0 | 0 | 24.517 | 0 | 0 | 19.885 | 19.735 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20145760 | 0 | 0 | 4.539 | 2.593 | 0 | 0 | 0 | 0 | 0 | 3.728 | 0 | 0 | 4.052 |
| OCBBF20148280 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20151150 | 0 | 0 | 44.332 | 12.664 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20153340 | 0 | 0 | 65.522 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20153350 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20155060 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20164670 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20170690 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20173060 | 0 | 0 | 55.403 | 0 | 0 | 0 | 44.597 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20173250 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20178150 | 0 | 0 | 65.522 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20180840 | 0 | 0 | 16.434 | 9.389 | 0 | 4.443 | 4.41 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20186870 | 0 | 0 | 100 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20189560 | 0 | 0 | 2.102 | 3.604 | 0 | 1.705 | 0 | 0 | 0 | 0 | 0 | 0 | 1.877 |
| PEBLM20044520 | 0 | 0 | 5.03 | 1.916 | 0 | 2.72 | 10.797 | 0 | 0 | 12.393 | 0 | 0 | 5.987 |
| PEBLM20071880 | 0 | 0 | 10.845 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| PLACE60060420 | 0 | 0 | 6.763 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| PROST20047390 | 0 | 0 | 27.713 | 10.556 | 0 | 0 | 0 | 0 | 0 | 7.587 | 0 | 0 | 0 |
| PUAEN20003740 | 0 | 0 | 1.59 | 0.909 | 1.156 | 0.322 | 2.24 | 0 | 0 | 0.653 | 0 | 0 | 1.775 |
| SMINT20029760 | 0 | 0 | 6.48 | 0 | 0 | 0 | 10.432 | 0 | 0 | 5.322 | 0 | 0 | 0 |
| SPLEN20008820 | 0 | 0 | 2.182 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1.948 |
| SPLEN20084600 | 0 | 0 | 1.627 | 0 | 0 | 0 | 0 | 0 | 0 | 2.673 | 0 | 0 | 0 |
| SPLEN20095550 | 0 | 0 | 10.552 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 9.419 |
| SPLEN20099700 | 0 | 0 | 12.671 | 0 | 0 | 0 | 0 | 0 | 0 | 5.203 | 0 | 0 | 0 |
| SPLEN20140800 | 0 | 0 | 11.772 | 3.363 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| SPLEN20173510 | 0 | 0 | 7.473 | 2.135 | 0 | 0 | 9.023 | 0 | 9 | 0 | 11.195 | 0 | 6.671 |
| SPLEN20211220 | 0 | 0 | 20.261 | 0 | 0 | 0 | 0 | 0 | 0 | 33.279 | 0 | 0 | 18.087 |
| SPLEN20250170 | 0 | 0 | 41.66 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| STOMA20067800 | 0 | 0 | 10.791 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TESTI20031270 | 0 | 0 | 13.265 | 0 | 0 | 10.759 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TESTI20116830 | 0 | 0 | 40.221 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TESTI20121550 | 0 | 0 | 7.961 | 0 | 0 | 0 | 6.408 | 0 | 0 | 6.538 | 0 | 0 | 7.106 |
| TESTI20234140 | 0 | 0 | 5.057 | 2.889 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TESTI20442760 | 0 | 0 | 11.782 | 0 | 0 | 0 | 0 | 10.879 | 0 | 0 | 0 | 0 | 10.517 |
| THYMU20039810 | 0 | 0 | 0.649 | 0 | 0 | 0 | 0.522 | 0 | 1.85 | 2.664 | 0 | 0 | 0.579 |
| THYMU20070360 | 0 | 0 | 19.184 | 0 | 0 | 7.78 | 0 | 0 | 0 | 0 | 0 | 0 | 8.562 |
| TABLE 44 | |||||||||||||
| TRACH20033230 | 0 | 0 | 4.422 | 0 | 0 | 7.173 | 7.119 | 0 | 0 | 9.079 | 0 | 0 | 3.947 |
| TRACH20084720 | 0 | 0 | 3.898 | 1.114 | 0 | 0 | 0 | 0 | 5.558 | 0 | 0 | 0 | 8.7 |
| BRACE20067430 | 0 | 22.168 | 11.047 | 15.779 | 0 | 4.48 | 8.892 | 0 | 0 | 4.536 | 33.098 | 0 | 0 |
| BRAWH10000930 | 0 | 1.15 | 2.292 | 0.655 | 0 | 0 | 0.461 | 0 | 0 | 0 | 1.717 | 0 | 0.511 |
| BRHIP20003120 | 0 | 16.166 | 8.056 | 9.205 | 0 | 6.534 | 32.424 | 0 | 0 | 13.232 | 0 | 0 | 14.383 |
| BRSSN20152380 | 0 | 8.534 | 8.505 | 4.859 | 0 | 0 | 10.27 | 0 | 0 | 6.985 | 12.742 | 0 | 0 |
| FEBRA20024100 | 0 | 66.741 | 33.259 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20027810 | 0 | 17.057 | 25.5 | 43.707 | 0 | 6.894 | 6.842 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20037500 | 0 | 9.102 | 2.268 | 2.591 | 0 | 1.839 | 0 | 0 | 12.934 | 1.862 | 0 | 0 | 6.073 |
| FEBRA20082100 | 0 | 16.72 | 8.332 | 4.761 | 0 | 6.758 | 0 | 0 | 23.761 | 0 | 0 | 0 | 0 |
| FEBRA20098460 | 0 | 51.462 | 25.645 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 22.893 |
| FEBRA20144170 | 0 | 4.038 | 2.012 | 0.766 | 0 | 3.264 | 7.559 | 6.194 | 3.826 | 3.856 | 4.019 | 5.841 | 1.198 |
| FEBRA20145780 | 0 | 0 | 27.189 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20233770 | 0 | 19.338 | 9.637 | 0 | 28.03 | 0 | 15.515 | 0 | 27.481 | 0 | 0 | 0 | 0 |
| HHDPC10000830 | 0 | 2.44 | 2.432 | 1.389 | 0 | 1.972 | 0 | 2.246 | 0 | 0 | 3.643 | 0 | 2.171 |
| MESAN20025190 | 0 | 11.561 | 5.761 | 0 | 0 | 4.673 | 0 | 0 | 0 | 4.732 | 0 | 0 | 5.143 |
| MESAN20089360 | 0 | 9.917 | 4.942 | 5.647 | 0 | 12.025 | 3.978 | 0 | 0 | 4.059 | 0 | 0 | 0 |
| NT2RI20048840 | 0 | 11.556 | 0.96 | 0 | 0 | 0 | 0 | 0 | 0 | 0.788 | 2.876 | 0 | 0 |
| NT2RP70043480 | 0 | 5.634 | 16.844 | 0 | 0 | 0 | 0 | 0 | 8.006 | 0 | 0 | 0 | 0 |
| OCBBF20032460 | 0 | 24.396 | 24.315 | 0 | 0 | 9.861 | 9.786 | 0 | 0 | 19.969 | 0 | 0 | 0 |
| OCBBF20039250 | 0 | 2.077 | 1.035 | 0 | 3.011 | 1.679 | 0 | 0 | 0 | 0 | 0 | 3.004 | 0 |
| OCBBF20049300 | 0 | 25.873 | 12.893 | 0 | 0 | 0 | 0 | 23.811 | 0 | 0 | 0 | 37.423 | 0 |
| OCBBF20061720 | 0 | 13.071 | 13.027 | 0 | 0 | 5.283 | 0 | 12.029 | 18.574 | 0 | 19.515 | 0 | 0 |
| OCBBF20078920 | 0 | 21.239 | 5.292 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 15.36 | 0 |
| OCBBF20084660 | 0 | 42.651 | 10.627 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 31.84 | 0 | 0 |
| OCBBF20087010 | 0 | 27.016 | 40.389 | 0 | 0 | 10.92 | 21.675 | 0 | 0 | 0 | 0 | 0 | 0 |
| PROST20087700 | 0 | 1.945 | 2.907 | 7.197 | 0 | 3.93 | 4.68 | 0 | 0 | 6.367 | 2.903 | 2.813 | 3.46 |
| PROST20153320 | 0 | 6.425 | 3.202 | 27.441 | 0 | 2.597 | 10.31 | 0 | 18.262 | 5.259 | 0 | 0 | 0 |
| TRACH20135520 | 0 | 25.898 | 12.906 | 7.374 | 0 | 0 | 10.389 | 0 | 0 | 31.797 | 0 | 0 | 0 |
| ADIPS20004250 | 1.434 | 0 | 0.964 | 0 | 0 | 0 | 1.553 | 0 | 0 | 1.584 | 0 | 0 | 0 |
| ASTRO10001650 | 4.095 | 0 | 11.014 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20056810 | 3.689 | 0 | 4.961 | 14.879 | 0 | 13.076 | 16.971 | 4.581 | 0 | 20.37 | 7.431 | 7.199 | 3.321 |
| BRACE20059370 | 22.318 | 0 | 7.504 | 8.574 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20106690 | 11.777 | 0 | 31.677 | 9.049 | 0 | 0 | 19.124 | 0 | 0 | 6.504 | 0 | 0 | 7.069 |
| BRACE20210140 | 10.945 | 0 | 14.719 | 4.205 | 0 | 0 | 17.772 | 0 | 0 | 18.132 | 0 | 0 | 0 |
| BRAWH20103290 | 13.868 | 0 | 6.217 | 21.311 | 0 | 10.085 | 20.017 | 0 | 0 | 15.317 | 0 | 0 | 11.099 |
| BRAWH20121640 | 38.493 | 0 | 25.884 | 14.788 | 0 | 0 | 20.835 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 45 | |||||||||||||
| BRHIP20005530 | 4.747 | 0 | 12.769 | 1.824 | 0 | 2.589 | 2.57 | 0 | 0 | 5.243 | 0 | 0 | 2.85 |
| BRHIP20217620 | 5.147 | 0 | 3.461 | 7.91 | 0 | 0 | 8.358 | 0 | 0 | 11.369 | 0 | 0 | 3.09 |
| BRHIP20218580 | 6.182 | 0 | 8.314 | 4.75 | 0 | 3.372 | 3.346 | 0 | 0 | 3.414 | 0 | 0 | 0 |
| BRHIP20238880 | 0.68 | 0 | 3.2 | 2.089 | 0 | 1.854 | 2.208 | 1.688 | 1.303 | 0.751 | 1.369 | 2.653 | 4.488 |
| CTONG20075860 | 11.104 | 0 | 14.933 | 0 | 0 | 0 | 0 | 0 | 21.292 | 0 | 0 | 0 | 0 |
| CTONG20129960 | 5.394 | 0 | 7.255 | 0 | 0 | 0 | 2.92 | 0 | 0 | 0 | 0 | 0 | 6.476 |
| FCBBF10000240 | 8.112 | 0 | 10.91 | 0 | 0 | 6.637 | 6.587 | 0 | 0 | 6.72 | 0 | 7.916 | 0 |
| FCBBF10000630 | 11.049 | 0 | 7.43 | 0 | 0 | 6.026 | 11.962 | 0 | 0 | 6.102 | 0 | 0 | 0 |
| FCBBF10001150 | 37.553 | 0 | 25.252 | 14.427 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF10004120 | 3.575 | 0 | 7.212 | 0 | 0 | 0 | 5.806 | 0 | 0 | 0 | 0 | 0 | 2.146 |
| FCBBF10005740 | 7.67 | 0 | 15.473 | 2.947 | 0 | 10.458 | 8.303 | 0 | 7.354 | 6.353 | 0 | 0 | 4.604 |
| FCBBF20075560 | 16.883 | 0 | 11.353 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30018550 | 31.042 | 0 | 3.479 | 1.988 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30025560 | 59.793 | 0 | 40.207 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30086440 | 15.918 | 0 | 10.704 | 0 | 0 | 0 | 8.616 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30090690 | 8.273 | 0 | 5.563 | 6.357 | 0 | 22.561 | 17.913 | 0 | 0 | 4.569 | 0 | 0 | 34.763 |
| FCBBF30189490 | 52.288 | 0 | 17.58 | 0 | 0 | 0 | 0 | 0 | 0 | 14.438 | 0 | 0 | 15.693 |
| FCBBF30233680 | 4.533 | 0 | 6.096 | 0 | 0 | 0 | 7.361 | 0 | 0 | 2.503 | 0 | 0 | 2.721 |
| FCBBF30240020 | 10.485 | 0 | 28.201 | 16.112 | 0 | 5.718 | 5.675 | 0 | 0 | 0 | 0 | 0 | 0 |
| HCHON20007510 | 6.596 | 0 | 4.435 | 0 | 0 | 0 | 3.57 | 0 | 0 | 0 | 0 | 0 | 3.959 |
| HCHON20016650 | 2.851 | 0 | 5.751 | 2.191 | 0 | 9.329 | 0 | 0 | 0 | 6.297 | 0 | 0 | 0 |
| HHDPC20095280 | 12.007 | 0 | 8.074 | 4.613 | 0 | 0 | 0 | 0 | 0 | 6.631 | 0 | 0 | 14.415 |
| KIDNE20002520 | 1.579 | 0 | 6.37 | 1.213 | 0 | 3.444 | 6.837 | 0 | 6.055 | 3.488 | 0 | 3.082 | 2.843 |
| KIDNE20009470 | 9.338 | 0 | 9.419 | 0 | 9.132 | 0 | 2.527 | 0 | 0 | 0 | 0 | 0 | 2.803 |
| NT2RI20003480 | 16.371 | 0 | 44.033 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| NT2RI20055790 | 17.338 | 0 | 11.659 | 0 | 0 | 0 | 0 | 0 | 0 | 19.149 | 0 | 0 | 0 |
| NT2RP70027380 | 10.635 | 0 | 35.756 | 4.086 | 0 | 0 | 5.756 | 0 | 0 | 5.873 | 0 | 0 | 6.384 |
| NT2RP70032610 | 2.51 | 0 | 3.376 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| NT2RP70062230 | 7.806 | 0 | 10.498 | 17.994 | 0 | 0 | 4.225 | 0 | 0 | 8.622 | 15.726 | 0 | 0 |
| OCBBF10001850 | 15.555 | 0 | 31.379 | 0 | 0 | 0 | 4.21 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20022900 | 18.632 | 0 | 12.529 | 0 | 0 | 20.324 | 0 | 0 | 0 | 0 | 0 | 0 | 11.184 |
| OCBBF20026630 | 59.793 | 0 | 40.207 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20049840 | 44.001 | 0 | 29.587 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 26.412 |
| OCBBF20059560 | 5.245 | 0 | 3.527 | 6.045 | 10.258 | 5.721 | 0 | 6.513 | 0 | 0 | 10.566 | 0 | 3.148 |
| OCBBF20068490 | 3.734 | 0 | 7.532 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20071960 | 33.142 | 0 | 66.858 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20080410 | 7.723 | 0 | 2.597 | 0 | 0 | 0 | 4.18 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 46 | |||||||||||||
| OCBBF20094240 | 13.407 | 0 | 9.015 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20097720 | 4.351 | 0 | 5.851 | 6.686 | 0 | 7.119 | 9.42 | 2.702 | 4.172 | 12.014 | 0 | 4.246 | 1.306 |
| OCBBF20108190 | 23.173 | 0 | 15.583 | 8.903 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 13.91 |
| OCBBF20108430 | 27.517 | 0 | 18.503 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20126780 | 25.486 | 0 | 25.707 | 29.374 | 0 | 0 | 6.898 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20130110 | 13.949 | 0 | 9.38 | 0 | 0 | 22.823 | 0 | 0 | 0 | 7.703 | 0 | 0 | 0 |
| OCBBF20139260 | 22.924 | 0 | 77.076 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20148730 | 26.202 | 0 | 17.619 | 0 | 0 | 0 | 28.366 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20149280 | 59.793 | 0 | 40.207 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20164050 | 71.253 | 0 | 28.747 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20173980 | 2.376 | 0 | 9.588 | 1.826 | 0 | 3.888 | 9.005 | 0 | 4.557 | 6.562 | 4.788 | 0 | 4.28 |
| OCBBF20178880 | 31.476 | 0 | 21.165 | 0 | 0 | 0 | 17.037 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20180120 | 5.185 | 0 | 3.487 | 0 | 0 | 2.828 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20188730 | 5.12 | 0 | 5.164 | 0 | 0 | 0 | 1.386 | 0 | 0 | 2.828 | 0 | 0 | 4.61 |
| PROST20057930 | 7.245 | 0 | 4.872 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4.349 |
| SPLEN20162680 | 3.991 | 0 | 2.147 | 0.307 | 0 | 0.435 | 0 | 0 | 0 | 0 | 0 | 1.558 | 0.479 |
| SPLEN20211940 | 12.464 | 0 | 4.191 | 0 | 0 | 0 | 3.373 | 0 | 0 | 0 | 0 | 0 | 0 |
| TESTI20184620 | 5.221 | 0 | 7.021 | 0 | 0 | 5.695 | 2.826 | 0 | 0 | 0 | 0 | 0 | 9.401 |
| TESTI20211240 | 10.559 | 0 | 7.1 | 0 | 0 | 5.759 | 17.146 | 0 | 0 | 11.662 | 0 | 0 | 0 |
| TESTI20369690 | 19.913 | 0 | 8.927 | 2.55 | 0 | 0 | 7.186 | 0 | 0 | 3.666 | 0 | 0 | 3.984 |
| THYMU20141670 | 10.152 | 0 | 20.48 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 19.814 | 6.094 |
| TRACH20028030 | 7.7 | 0 | 2.589 | 2.958 | 0 | 4.199 | 0 | 0 | 0 | 0 | 23.268 | 7.514 | 0 |
| UTERU20099720 | 13.09 | 0 | 39.61 | 0 | 0 | 0 | 3.543 | 0 | 0 | 3.614 | 0 | 0 | 0 |
| UTERU20135860 | 24.344 | 0 | 8.185 | 0 | 0 | 0 | 0 | 0 | 23.341 | 13.444 | 0 | 0 | 0 |
| BRACE20057190 | 5.487 | 14.807 | 0 | 6.324 | 32.194 | 5.985 | 0 | 6.814 | 0 | 3.03 | 11.054 | 0 | 0 |
| BRHIP20191860 | 7.292 | 9.84 | 0 | 0 | 0 | 3.977 | 0 | 0 | 0 | 4.027 | 0 | 0 | 0 |
| BRHIP20214950 | 11.849 | 15.989 | 0 | 4.552 | 46.351 | 0 | 0 | 14.715 | 0 | 6.544 | 0 | 0 | 0 |
| FCBBF10003670 | 5.613 | 3.787 | 0 | 0 | 0 | 1.531 | 0 | 0 | 0 | 1.55 | 0 | 0 | 0 |
| FCBBF10004370 | 23.626 | 31.88 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30013770 | 19.023 | 25.669 | 0 | 0 | 0 | 0 | 10.297 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30095260 | 21.826 | 29.451 | 0 | 0 | 0 | 23.808 | 11.814 | 0 | 0 | 0 | 0 | 0 | 13.101 |
| FCBBF30246230 | 41.402 | 13.966 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 12.426 |
| FEBRA20002100 | 1.306 | 3.524 | 0 | 0 | 0 | 0 | 0.707 | 0 | 0 | 0.721 | 0 | 0 | 0 |
| FEBRA20034360 | 10.27 | 13.858 | 0 | 0 | 0 | 5.601 | 0 | 0 | 39.387 | 0 | 0 | 0 | 0 |
| FEBRA20095140 | 12.239 | 24.772 | 0 | 0 | 0 | 3.338 | 0 | 0 | 0 | 3.379 | 0 | 0 | 0 |
| FEBRA20130190 | 42.565 | 57.435 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FEBRA20204060 | 42.565 | 57.435 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 47 | |||||||||||||
| HCHON20008320 | 6.536 | 8.819 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| LIVER20028420 | 3.527 | 9.518 | 0 | 0 | 0 | 1.924 | 0 | 4.38 | 0 | 0 | 0 | 0 | 6.351 |
| TRACH20111130 | 8.722 | 23.539 | 0 | 3.351 | 0 | 0 | 0 | 0 | 0 | 4.817 | 0 | 0 | 5.236 |
| ASTRO20108190 | 6.215 | 3.355 | 6.687 | 6.686 | 0 | 3.39 | 4.037 | 0 | 2.384 | 4.119 | 0 | 0 | 0 |
| BRACE20003070 | 6.528 | 2.936 | 10.243 | 20.064 | 0 | 0 | 1.178 | 2.702 | 0 | 2.403 | 0 | 0 | 1.306 |
| BRACE20060550 | 7.391 | 4.987 | 2.485 | 4.259 | 0 | 2.016 | 4.001 | 0 | 0 | 0 | 0 | 0 | 2.218 |
| BRAWH20004600 | 2.255 | 1.521 | 1.516 | 9.097 | 0 | 1.23 | 1.831 | 1.4 | 2.162 | 1.245 | 4.543 | 0 | 4.061 |
| BRAWH20011710 | 3.423 | 4.619 | 15.345 | 9.644 | 0 | 9.334 | 6.176 | 1.417 | 0 | 1.89 | 2.299 | 0 | 4.794 |
| BRAWH20016620 | 8.494 | 34.385 | 5.712 | 3.263 | 0 | 0 | 4.598 | 0 | 16.288 | 0 | 0 | 0 | 5.099 |
| BRHIP10001740 | 9.366 | 25.278 | 6.298 | 3.598 | 0 | 5.108 | 0 | 0 | 17.961 | 5.173 | 0 | 18.281 | 5.622 |
| BRSTN10000830 | 4.718 | 1.592 | 4.759 | 1.36 | 0 | 1.93 | 0.638 | 0 | 2.262 | 1.303 | 0 | 2.302 | 0 |
| CTONG10000940 | 10.792 | 16.505 | 4.354 | 1.106 | 1.407 | 2.747 | 0 | 1.787 | 4.139 | 2.781 | 1.45 | 0 | 0.864 |
| CTONG20150910 | 3.001 | 2.024 | 2.018 | 0.576 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1.801 |
| D3OST10002670 | 7.978 | 10.765 | 5.365 | 0 | 0 | 0 | 0 | 9.907 | 0 | 0 | 0 | 15.57 | 0 |
| FCBBF10000380 | 20.755 | 28.007 | 41.87 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF10000770 | 19.451 | 22.208 | 13.079 | 0 | 0 | 0.816 | 0 | 0 | 0 | 0 | 0 | 0 | 0.898 |
| FCBBF10003770 | 39.957 | 26.958 | 13.434 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF20059090 | 11.53 | 15.558 | 31.013 | 4.43 | 0 | 0 | 6.241 | 0 | 0 | 19.102 | 0 | 0 | 6.921 |
| FCBBF30016320 | 2.852 | 3.848 | 13.424 | 1.096 | 0 | 0 | 0 | 3.542 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30016570 | 8.716 | 11.762 | 11.722 | 11.72 | 0 | 4.754 | 11.795 | 0 | 0 | 9.627 | 8.78 | 0 | 5.232 |
| FCBBF30049550 | 28.476 | 19.212 | 28.723 | 0 | 0 | 0 | 0 | 0 | 0 | 23.589 | 0 | 0 | 0 |
| FCBBF30083820 | 19.899 | 26.851 | 13.381 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF30238870 | 17.508 | 23.625 | 58.866 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF40001420 | 13.508 | 18.228 | 18.167 | 18.164 | 0 | 11.051 | 3.656 | 0 | 0 | 0 | 0 | 0 | 4.054 |
| FEBRA10001880 | 38.663 | 15.651 | 36.398 | 0 | 0 | 2.109 | 0 | 0 | 0 | 2.135 | 0 | 0 | 0 |
| FEBRA20004620 | 5.215 | 7.037 | 7.013 | 28.049 | 0 | 0 | 31.051 | 0 | 0 | 8.64 | 0 | 0 | 6.261 |
| FEBRA20080810 | 1.308 | 3.531 | 4.399 | 1.508 | 0 | 2.141 | 2.124 | 3.249 | 0 | 0.722 | 2.636 | 0 | 0 |
| FEBRA20086620 | 5.865 | 11.87 | 1.972 | 5.633 | 0 | 6.397 | 11.11 | 0 | 0 | 3.239 | 0 | 11.446 | 1.76 |
| FEBRA20095880 | 8.952 | 24.158 | 42.136 | 0 | 0 | 0 | 19.382 | 0 | 0 | 0 | 0 | 0 | 5.373 |
| HHDPC20034390 | 2.819 | 1.268 | 5.371 | 1.625 | 0 | 0.513 | 1.78 | 0 | 0 | 1.816 | 0.947 | 0 | 0.846 |
| HLUNG10000550 | 1 | 1.349 | 4.035 | 0 | 0 | 0 | 0 | 0 | 1.918 | 1.105 | 4.029 | 1.952 | 1.201 |
| NT2RI20023160 | 1.481 | 1.999 | 0.996 | 0.569 | 0 | 0 | 0 | 0 | 2.84 | 0.818 | 0 | 0 | 0.889 |
| NT2RI20023910 | 4.495 | 4.043 | 1.007 | 0 | 0 | 4.086 | 0 | 1.86 | 0 | 0 | 0 | 0 | 1.799 |
| NT2RI20025400 | 3.194 | 17.238 | 2.148 | 1.227 | 0 | 6.967 | 6.915 | 7.932 | 0 | 5.291 | 6.434 | 24.933 | 1.917 |
| NT2RI20028470 | 6.957 | 9.388 | 7.797 | 0 | 0 | 1.265 | 0 | 0 | 0 | 1.281 | 0 | 0 | 2.784 |
| NT2RI20054050 | 0.519 | 1.4 | 0.349 | 0.199 | 0 | 0 | 0.561 | 0 | 0 | 0.573 | 3.134 | 0 | 1.245 |
| NT2RI20076290 | 3.724 | 5.025 | 5.008 | 1.431 | 0 | 4.062 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| TABLE 48 | |||||||||||||
| NT2RI20091730 | 2.061 | 5.561 | 1.386 | 0 | 0 | 1.124 | 0 | 0 | 0 | 1.138 | 0 | 0 | 1.237 |
| NT2RI20091940 | 1.816 | 9.799 | 9.767 | 0 | 0 | 0.99 | 1.965 | 0 | 0 | 1.003 | 0 | 0 | 0 |
| NT2RP70036880 | 2.728 | 1.841 | 8.256 | 4.193 | 0 | 6.696 | 3.692 | 0 | 0 | 0 | 0 | 0 | 4.913 |
| NT2RP70078420 | 3.543 | 4.781 | 2.383 | 4.084 | 6.93 | 0 | 0 | 0 | 0 | 1.957 | 7.139 | 0 | 2.127 |
| OCBBF20047570 | 18.314 | 30.89 | 12.315 | 3.518 | 8.955 | 2.497 | 0 | 5.686 | 0 | 0 | 0 | 0 | 0 |
| OCBBF20080050 | 11.733 | 7.916 | 21.697 | 6.762 | 0 | 6.399 | 0 | 0 | 0 | 1.62 | 0 | 0 | 0 |
| OCBBF20125530 | 4.333 | 11.695 | 4.371 | 0 | 4.238 | 1.182 | 0 | 2.691 | 0 | 2.393 | 4.365 | 4.229 | 0 |
| OCBBF20140640 | 2.523 | 10.215 | 3.394 | 0 | 0 | 1.376 | 0 | 0 | 0 | 4.18 | 10.167 | 4.925 | 0 |
| TRACH20032720 | 6.845 | 9.236 | 9.205 | 2.63 | 0 | 11.2 | 3.705 | 8.5 | 13.125 | 3.78 | 0 | 0 | 4.109 |
| TRACH20141240 | 3.814 | 5.146 | 2.565 | 1.465 | 0 | 4.16 | 2.064 | 0 | 3.657 | 0 | 0 | 0 | 3.434 |
| UTERU20004240 | 3.138 | 4.234 | 1.055 | 3.014 | 3.069 | 0.856 | 1.699 | 3.897 | 3.009 | 0 | 0 | 3.062 | 0 |
| TABLE 49 | |||
| CloneID | FEHRT | HEART | |
| FEHRT20003250 | 100 | 0 | |
| OCBBF20189560 | 35.243 | 0 | |
| BRAWH20029630 | 0 | 79.6 | |
| CTONG20150910 | 0 | 5.418 | |
| HCHON20007510 | 0 | 23.818 | |
| HEART20003060 | 0 | 90.384 | |
| HEART20005410 | 0 | 53.555 | |
| HEART20021840 | 0 | 100 | |
| HEART20025980 | 0 | 100 | |
| HEART20034320 | 0 | 100 | |
| HEART20037810 | 0 | 100 | |
| HEART20049400 | 0 | 100 | |
| HEART20049410 | 0 | 63.375 | |
| HEART20049800 | 0 | 100 | |
| HEART20061950 | 0 | 63.227 | |
| HEART20063340 | 0 | 100 | |
| HEART20067870 | 0 | 100 | |
| HEART20067890 | 0 | 100 | |
| HEART20072310 | 0 | 32.316 | |
| HEART20074430 | 0 | 100 | |
| HEART20077670 | 0 | 100 | |
| HEART20089940 | 0 | 100 | |
| HEART20090000 | 0 | 68.952 | |
| HEART20095990 | 0 | 100 | |
| HLUNG10000550 | 0 | 3.611 | |
| HLUNG20017120 | 0 | 21.996 | |
| KIDNE20028390 | 0 | 48.974 | |
| KIDNE20028830 | 0 | 15.131 | |
| NTONG20029480 | 0 | 44.44 | |
| OCBBF10001750 | 0 | 48.053 | |
| PROST20127800 | 0 | 48.531 | |
| SKMUS20001980 | 0 | 21.074 | |
| SKMUS20003610 | 0 | 7.134 | |
| SMINT20026890 | 0 | 7.842 | |
| SMINT20121220 | 0 | 23.322 | |
| SMINT20122910 | 0 | 30.763 | |
| SMINT20183530 | 0 | 65.405 | |
| SPLEN20008740 | 0 | 3.252 | |
| SPLEN20027440 | 0 | 14.879 | |
| SPLEN20162680 | 0 | 2.882 | |
| STOMA20062290 | 0 | 40.108 | |
| TESTI20254220 | 0 | 16.559 | |
| THYMU20271250 | 0 | 3.582 | |
| TRACH20141240 | 0 | 6.886 | |
| UTERU20004240 | 0 | 5.666 | |
| TABLE 50 | |||
| CloneID | FEKID | KIDNE | |
| ASTRO10001650 | 0 | 7.727 | |
| ASTRO20108190 | 0 | 2.346 | |
| BGGI120006160 | 0 | 3.117 | |
| BRACE20039040 | 0 | 9.038 | |
| BRACE20060550 | 0 | 6.974 | |
| BRAMY20102080 | 0 | 63.37 | |
| BRAWH20004600 | 0 | 2.128 | |
| BRAWH20125380 | 0 | 35.37 | |
| BRAWH20162690 | 0 | 4.596 | |
| BRHIP20115760 | 0 | 66.835 | |
| BRHIP20205090 | 0 | 65.282 | |
| BRHIP20238880 | 0 | 1.283 | |
| CTONG20052650 | 0 | 65.178 | |
| CTONG20108210 | 0 | 2.491 | |
| CTONG20128470 | 0 | 6.004 | |
| CTONG20133480 | 0 | 19.179 | |
| CTONG20139070 | 0 | 7.516 | |
| D9OST20000310 | 0 | 16.47 | |
| DFNES20001530 | 0 | 11.162 | |
| FCBBF10001820 | 0 | 59.128 | |
| FEBRA20002100 | 0 | 4.929 | |
| HCHON20008980 | 0 | 35.524 | |
| HCHON20016650 | 0 | 5.38 | |
| HLUNG20033780 | 0 | 32.277 | |
| KIDNE20002520 | 0 | 2.979 | |
| KIDNE20003940 | 0 | 100 | |
| KIDNE20006780 | 0 | 100 | |
| KIDNE20007210 | 0 | 73.728 | |
| KIDNE20007770 | 0 | 19.958 | |
| KIDNE20008010 | 0 | 100 | |
| KIDNE20009470 | 0 | 8.811 | |
| KIDNE20011170 | 0 | 77.71 | |
| KIDNE20011400 | 0 | 100 | |
| KIDNE20013730 | 0 | 24.839 | |
| KIDNE20017130 | 0 | 54.019 | |
| KIDNE20018730 | 0 | 100 | |
| KIDNE20018970 | 0 | 100 | |
| KIDNE20020150 | 0 | 100 | |
| KIDNE20021680 | 0 | 100 | |
| KIDNE20021910 | 0 | 24.85 | |
| KIDNE20021980 | 0 | 100 | |
| KIDNE20022620 | 0 | 100 | |
| KIDNE20024830 | 0 | 100 | |
| KIDNE20027250 | 0 | 35.87 | |
| KIDNE20027950 | 0 | 100 | |
| KIDNE20028390 | 0 | 25.593 | |
| KIDNE20028830 | 0 | 7.907 | |
| KIDNE20029800 | 0 | 10.988 | |
| KIDNE20067330 | 0 | 100 | |
| KIDNE20079440 | 0 | 35.045 | |
| KIDNE20096280 | 0 | 100 | |
| KIDNE20096470 | 0 | 100 | |
| KIDNE20100070 | 0 | 100 | |
| KIDNE20100840 | 0 | 100 | |
| KIDNE20101370 | 0 | 100 | |
| KIDNE20101510 | 0 | 100 | |
| KIDNE20102650 | 0 | 8.237 | |
| KIDNE20102710 | 0 | 100 | |
| KIDNE20104300 | 0 | 33.246 | |
| KIDNE20106740 | 0 | 100 | |
| KIDNE20107390 | 0 | 100 | |
| KIDNE20107500 | 0 | 74.264 | |
| KIDNE20107620 | 0 | 100 | |
| KIDNE20109730 | 0 | 100 | |
| KIDNE20109890 | 0 | 100 | |
| KIDNE20112000 | 0 | 100 | |
| KIDNE20115080 | 0 | 65.178 | |
| KIDNE20118580 | 0 | 100 | |
| KIDNE20120090 | 0 | 33.186 | |
| KIDNE20121880 | 0 | 62.256 | |
| KIDNE20122910 | 0 | 83.085 | |
| KIDNE20124400 | 0 | 6.171 | |
| KIDNE20125630 | 0 | 100 | |
| KIDNE20126010 | 0 | 100 | |
| KIDNE20126130 | 0 | 100 | |
| KIDNE20127100 | 0 | 33.012 | |
| KIDNE20127450 | 0 | 100 | |
| KIDNE20127750 | 0 | 100 | |
| KIDNE20130450 | 0 | 100 | |
| KIDNE20131580 | 0 | 63.24 | |
| KIDNE20132180 | 0 | 100 | |
| KIDNE20137340 | 0 | 100 | |
| KIDNE20138010 | 0 | 100 | |
| KIDNE20141190 | 0 | 49.697 | |
| KIDNE20144890 | 0 | 100 | |
| KIDNE20148900 | 0 | 100 | |
| KIDNE20163880 | 0 | 100 | |
| KIDNE20180710 | 0 | 49.105 | |
| KIDNE20181660 | 0 | 100 | |
| KIDNE20182690 | 0 | 100 | |
| KIDNE20186780 | 0 | 100 | |
| KIDNE20190740 | 0 | 100 | |
| LIVER20035110 | 0 | 28.683 | |
| MESAN20025190 | 0 | 16.169 | |
| NOVAR20000380 | 0 | 2.166 | |
| NT2RI20054050 | 0 | 2.936 | |
| NT2RP70043480 | 0 | 7.879 | |
| PROST20107820 | 0 | 1.696 | |
| PROST20123530 | 0 | 32.771 | |
| PROST20161950 | 0 | 20.387 | |
| PUAEN20030180 | 0 | 46.744 | |
| SKMUS20003610 | 0 | 3.728 | |
| SMINT20033400 | 0 | 10.243 | |
| TBAES20000590 | 0 | 5.253 | |
| TESTI20044310 | 0 | 29.162 | |
| TESTI20082330 | 0 | 45.847 | |
| TRACH20032720 | 0 | 12.917 | |
| UTERU20099720 | 0 | 12.351 | |
| BRACE20003070 | 25.479 | 0 | |
| BRCOC20031870 | 34.023 | 0 | |
| CTONG20125640 | 85.462 | 0 | |
| FCBBF30016320 | 33.393 | 0 | |
| HCHON20002260 | 8.723 | 0 | |
| HLUNG10000550 | 11.709 | 0 | |
| PROST20130530 | 64.069 | 0 | |
| SPLEN20169720 | 43.864 | 0 | |
| SPLEN20194050 | 30.978 | 0 | |
| KIDNE20028720 | 12.368 | 1.993 | |
| TABLE 51 | |||
| CloneID | FELNG | HLUNG | |
| BRACE20096200 | 0 | 70.38 | |
| BRAWH20004600 | 0 | 2.238 | |
| BRAWH20030250 | 0 | 11.121 | |
| BRCAN20006390 | 0 | 61.519 | |
| BRCAN20280360 | 0 | 8.855 | |
| BRHIP20238880 | 0 | 1.35 | |
| CTONG10000940 | 0 | 1.428 | |
| CTONG20103480 | 0 | 6.495 | |
| CTONG20129960 | 0 | 10.709 | |
| CTONG20155180 | 0 | 48.707 | |
| FCBBF10001210 | 0 | 36.439 | |
| FEBRA20144170 | 0 | 1.98 | |
| FEBRA20197110 | 0 | 7.756 | |
| HHDPC20034390 | 0 | 0.933 | |
| HLUNG20016330 | 0 | 29.367 | |
| HLUNG20016770 | 0 | 12.888 | |
| HLUNG20017120 | 0 | 12.093 | |
| HLUNG20023340 | 0 | 33.714 | |
| HLUNG20033780 | 0 | 33.957 | |
| HLUNG20084390 | 0 | 100 | |
| IMR3220002430 | 0 | 3.147 | |
| LIVER20028420 | 0 | 14.004 | |
| NOVAR20000380 | 0 | 2.278 | |
| NT2RI20054050 | 0 | 2.059 | |
| NT2RI20091730 | 0 | 4.091 | |
| NT2RP70044280 | 0 | 12.369 | |
| OCBBF20020830 | 0 | 40.304 | |
| OCBBF20125530 | 0 | 4.302 | |
| PLACE60004630 | 0 | 28.618 | |
| PROST20057930 | 0 | 14.383 | |
| PROST20107820 | 0 | 0.892 | |
| PROST20185830 | 0 | 33.898 | |
| PUAEN20030180 | 0 | 12.294 | |
| SMINT20121220 | 0 | 12.822 | |
| SPLEN20002220 | 0 | 44.799 | |
| SPLEN20054290 | 0 | 26.875 | |
| SPLEN20128000 | 0 | 1.253 | |
| SPLEN20157300 | 0 | 51.319 | |
| SPLEN20176200 | 0 | 18.8 | |
| SPLEN20179180 | 0 | 3.344 | |
| SPLEN20211940 | 0 | 12.373 | |
| STOMA20013890 | 0 | 21.183 | |
| TBAES20000590 | 0 | 5.527 | |
| TESTI20094230 | 0 | 59.311 | |
| TESTI20184620 | 0 | 10.365 | |
| TESTI20334410 | 0 | 8.049 | |
| THYMU20000570 | 0 | 4.974 | |
| THYMU20039810 | 0 | 1.915 | |
| TRACH20007020 | 0 | 14.4 | |
| TRACH20141240 | 0 | 3.786 | |
| TRACH20183170 | 0 | 10.745 | |
| D9OST20033970 | 61.464 | 0 | |
| FELNG20002410 | 100 | 0 | |
| HCHON20016650 | 33.188 | 0 | |
| KIDNE20029800 | 67.783 | 0 | |
| OCBBF20145760 | 78.585 | 0 | |
| SPLEN20162680 | 9.292 | 0 | |
| TESTI20214250 | 37.027 | 0 | |
| TRACH20005400 | 30.64 | 0 | |
| HCHON20002260 | 8.672 | 2.958 | |
| HLUNG10000550 | 11.642 | 3.971 | |
| NT2RI20023910 | 34.882 | 8.923 | |
| SPLEN20008740 | 10.483 | 1.788 | |
| TABLE 52 |
| Alteration of the expression level of each clone due to |
| TNF-α stimulation to human monocyte cell line THP-1 and |
| alteration of the expression level of each clone due to co- |
| culture of gastric cancer cell line MKN45 with Helicobacter |
| pylori. ctl, TNF_1 h, and TNF_3 h |
| in the column of THP-1, respectively, |
| indicate the relative mRNA expression levels in |
| unstimulated THP-1, in the cell stimulated with 10 ng/mL TNF-α |
| for 1 hour, and in the cell stimulated with 10 ng/mL TNF-α for 3 |
| hours; ctl, Hp, and ΔcagE in the column of MKN45 indicate the |
| relative mRNA expression levels in MKN45 cultured without |
| Helicobacter pylori, in the cells co-cultured with cag PAI- |
| positive Helicobacter pylori (TN2) |
| (at a ratio of MKN45:TN2 = 1:100 |
| cells (colonies)) for 3 hours, and in the cells co- |
| cultured with the cagE mutant (TN2ΔcagE) (at a |
| ratio of MKN45:TN2ΔcagE = 1:100 cells |
| (colonies)) for 3 hours, respectively. |
| [ATAC-PCR] |
| THP-1 |
| Clone | TNF_1 | TNF_3 | MKN45 |
| Name | ctl | h | h | ctl | Hp | ΔcagE |
| 3NB6920014080 | 4 | 4 | 4.1 | |||
| ADRGL20013010 | 0.1 | 0.1 | 0.1 | 0.04 | 0.04 | 0.04 |
| ADRGL20067670 | 0 | 2.6 | 0 | |||
| ADRGL20083310 | 0.3 | 0.3 | 0.3 | |||
| ASTRO20032120 | 1.4 | 1.7 | 0.6 | 1.2 | 0 | 1 |
| ASTRO20084250 | 1.2 | 1.1 | 0.4 | 0.1 | 0.04 | 0.1 |
| ASTRO20152140 | 0.1 | 0.9 | 0.4 | 1.6 | 1.8 | 1.6 |
| ASTRO20166810 | 0.7 | 0.7 | 0.2 | 4.3 | 3.5 | 4.4 |
| ASTRO20181690 | 1.5 | 1.9 | 0.2 | 1.8 | 2.2 | 0.2 |
| BLADE20004630 | 3.3 | 2.9 | 2.2 | 0.3 | 0.8 | 0 |
| BRACE20006400 | 3.6 | 3.5 | 3.6 | |||
| BRACE20019540 | 0.7 | 0 | 0 | |||
| BRACE20038480 | 0.5 | 0.6 | 0.3 | 0.2 | 0.2 | 0.2 |
| BRACE20039040 | 2.5 | 2.2 | 2.3 | 0.1 | 0.7 | 1.1 |
| BRACE20039440 | 0.3 | 0.3 | 0.2 | |||
| BRACE20052160 | 2.7 | 2.3 | 1.9 | 1.3 | 0.8 | 1 |
| BRACE20053630 | 0.2 | 0.2 | 0 | 3.4 | 3 | 2.6 |
| BRACE20057620 | 0 | 3.7 | 0.5 | 0 | 0 | 0.3 |
| BRACE20058810 | 3.8 | 2 | 2.8 | 0.6 | 0 | 0.9 |
| BRACE20060720 | 0 | 1.3 | 0 | 0 | 0 | 0.04 |
| BRACE20060840 | 2.2 | 1.7 | 1.6 | 3.9 | 3.8 | 1.6 |
| BRACE20061740 | 1.9 | 2.1 | 2.7 | |||
| BRACE20062640 | 1.9 | 0.2 | 2.4 | 2.3 | 1.2 | 1 |
| BRACE20063780 | 0 | 0.1 | 0 | 0.4 | 0.2 | 0.2 |
| BRACE20067430 | 2.4 | 0 | 1.7 | 0.04 | 0 | 0 |
| BRACE20090440 | 1.1 | 1.8 | 2.2 | 1 | 0.5 | 1.3 |
| BRACE20101700 | 3.1 | 1.8 | 1.7 | 0.5 | 0.4 | 1 |
| BRACE20114780 | 1 | 1.5 | 0.6 | 1.2 | 0.4 | 0.2 |
| BRACE20151320 | 0 | 0 | 0.1 | 0.1 | 0.2 | 0 |
| BRACE20152870 | 0.6 | 1.3 | 1.5 | 0.4 | 0.3 | 0.3 |
| BRACE20163150 | 1.5 | 1.7 | 0.9 | 1.4 | 1.4 | 1.7 |
| BRACE20165830 | 2.6 | 4.9 | 3.3 | |||
| BRACE20201570 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRACE20210140 | 1.7 | 1.4 | 1 | 1 | 0.6 | 0.5 |
| BRACE20223330 | 0.1 | 0 | 0 | 0 | 0.1 | 0 |
| BRACE20224500 | 0.2 | 0 | 0.2 | 0 | 0 | 0.1 |
| BRACE20229280 | 0.2 | 0.04 | 0.4 | 0 | 2.1 | 0 |
| BRACE20235400 | 1.8 | 0.6 | 1 | 0.3 | 0.6 | 0.1 |
| BRACE20266750 | 1.8 | 2.1 | 1 | 1.3 | 1.1 | 0.9 |
| BRACE20267250 | 0.8 | 0.8 | 0 | |||
| BRACE20269710 | 0.9 | 0.9 | 0.7 | 0.4 | 0.2 | 0.1 |
| BRALZ20018340 | 1.1 | 1 | 0.5 | 0.3 | 0.4 | 0 |
| BRALZ20058880 | 1 | 3.1 | 2.5 | |||
| BRALZ20059500 | 1.7 | 1.5 | 2.3 | |||
| BRALZ20064740 | 1.9 | 2.8 | 1.2 | 8.9 | 0 | 0 |
| BRALZ20069760 | 1.3 | 0.4 | 0 | 0.04 | 0.04 | 0.04 |
| BRALZ20075450 | 1.3 | 0 | 0 | 0.04 | 0.04 | 0.04 |
| BRALZ20088690 | 1.8 | 1.4 | 1.5 | 0 | 0 | 1.6 |
| BRAMY20002770 | 0.8 | 2.4 | 0.3 | 1.2 | 0 | 0 |
| BRAMY20004110 | 0.8 | 0 | 0 | |||
| BRAMY20060920 | 0.3 | 11.8 | 12.2 | |||
| BRAMY20103570 | 0 | 0.1 | 0.1 | 0.6 | 0 | 0 |
| BRAMY20144620 | 0.7 | 0 | 0.9 | |||
| BRAMY20152110 | 1.8 | 1.7 | 1.2 | 2.5 | 2.3 | 0.8 |
| BRAMY20162510 | 0.1 | 0 | 0 | 0.7 | 0.7 | 0 |
| BRAMY20163250 | 3.4 | 4.2 | 2.4 | 2.2 | 1.5 | 0.9 |
| BRAMY20163270 | 3.8 | 0.7 | 4.5 | |||
| BRAMY20168920 | 2.4 | 2.5 | 2.2 | 0.2 | 0.04 | 0.1 |
| BRAMY20178640 | 1.7 | 1.6 | 1.9 | 0.9 | 1 | 0.5 |
| BRAMY20184670 | 0.4 | 0.3 | 0.2 | 0.04 | 0.2 | 0.6 |
| BRAMY20204450 | 3.6 | 3.6 | 1.6 | 0 | 0 | 0 |
| BRAMY20210400 | 0.5 | 0.5 | 0.5 | 1 | 0.2 | 0.9 |
| BRAMY20215230 | 1 | 0.7 | 1.1 | 1.9 | 0.8 | 1 |
| BRAMY20218670 | 1.6 | 0 | 1.5 | 0.2 | 2.6 | 0.1 |
| BRAMY20229800 | 5 | 3.9 | 0.5 | 1.4 | 4 | 1 |
| BRAMY20229840 | 0.04 | 0 | 0.04 | 0.3 | 0 | 0.2 |
| BRAMY20231720 | 1.1 | 1.3 | 1.6 | |||
| BRAMY20247280 | 3.5 | 2.2 | 1.9 | 2 | 0.7 | 0.5 |
| BRAMY20261680 | 5.2 | 4 | 3 | 3.5 | 3.2 | 2.5 |
| BRAMY20266850 | 0.4 | 4.4 | 6.9 | 2.2 | 2.9 | 2.7 |
| BRAMY20267130 | 13.7 | 0 | 0 | |||
| BRAMY20277140 | 3.3 | 2.5 | 3 | 0.7 | 0.8 | 0 |
| BRAMY20280720 | 0 | 9.8 | 1.1 | |||
| BRAWH10000930 | 2.6 | 1.3 | 1.9 | 0 | 0 | 0 |
| BRAWH20015350 | 0 | 0 | 0 | |||
| BRAWH20017010 | 0.9 | 0 | 0 | 0.6 | 0.2 | 0.9 |
| BRAWH20029630 | 1.9 | 2.4 | 1.8 | 1.4 | 0.2 | 0.04 |
| BRAWH20100690 | 3.2 | 0.9 | 0.8 | |||
| BRAWH20106180 | 0 | 2.7 | 0.5 | |||
| BRAWH20107540 | 2.1 | 1.3 | 0.8 | 1.1 | 1.1 | 0.6 |
| BRAWH20110660 | 1.7 | 2.1 | 2.4 | 1.4 | 1.4 | 0.9 |
| BRAWH20118230 | 0 | 0 | 0.04 | 2.3 | 0.9 | 1.9 |
| BRAWH20122770 | 0 | 0 | 0.8 | |||
| BRAWH20126190 | 0 | 0 | 0 | 0 | 0 | 0 |
| BRAWH20132190 | 2.2 | 2.2 | 1 | 1.8 | 1.5 | 0.4 |
| BRAWH20138660 | 3.3 | 2.2 | 2.1 | |||
| BRAWH20139410 | 0.9 | 1.7 | 0.2 | 2.1 | 1.9 | 0.7 |
| BRAWH20155950 | 1.5 | 1.8 | 1.5 | 0.9 | 0 | 0 |
| BRAWH20158530 | 58.9 | 19.3 | 41.1 | |||
| BRCAN20060190 | 0.2 | 0 | 0.2 | |||
| BRCAN20147880 | 0.3 | 0.3 | 0 | 0.5 | 1 | 1.3 |
| BRCAN20273340 | 2.8 | 3.5 | 0 | 0.3 | 0.3 | 0.3 |
| BRCAN20273640 | 0.3 | 0.4 | 0.2 | 0.7 | 0.8 | 0.3 |
| BRCAN20275130 | 3.9 | 3.6 | 2.3 | 0.2 | 0 | 0 |
| BRCAN20280210 | 0 | 0 | 0 | 0.8 | 0 | 0 |
| BRCAN20280400 | 3 | 3.6 | 2.6 | 1.8 | 1.7 | 1 |
| BRCOC20021550 | 0.7 | 0 | 0.2 | 0.3 | 0.3 | 0 |
| BRCOC20037400 | 1.5 | 1 | 1.2 | 0.1 | 0 | 0.2 |
| BRCOC20105100 | 3.8 | 1 | 1.5 | |||
| BRHIP10001740 | 0.8 | 0.7 | 0.9 | 0.4 | 0 | 0 |
| BRHIP20001630 | 0.5 | 0 | 0 | |||
| BRHIP20096170 | 0 | 0.4 | 0.3 | |||
| BRHIP20103090 | 1 | 1 | 1.3 | 0.9 | 0 | 0.7 |
| BRHIP20105710 | 1.5 | 0 | 1.9 | 0.7 | 0.7 | 0.9 |
| BRHIP20110800 | 1.9 | 2.7 | 2.2 | 0.8 | 0 | 0 |
| BRHIP20111200 | 0.3 | 0.9 | 1.1 | |||
| BRHIP20118910 | 0 | 0 | 0 | |||
| BRHIP20129720 | 0 | 0.1 | 0 | 0 | 0 | 0 |
| BRHIP20143860 | 6.2 | 5.3 | 6.7 | 3.6 | 2.7 | 2.4 |
| BRHIP20173150 | 0 | 0.04 | 0 | 0.9 | 1.6 | 2.8 |
| BRHIP20175420 | 2.4 | 2.4 | 2.5 | 0.6 | 0 | 0 |
| BRHIP20186120 | 1.2 | 2.9 | 0 | |||
| BRHIP20194940 | 0.04 | 0.7 | 0.3 | |||
| BRHIP20196410 | 1.7 | 2.6 | 1.8 | 0.9 | 2 | 1 |
| BRHIP20207430 | 0 | 0 | 0.2 | 0 | 0 | 0.1 |
| BRHIP20218580 | 1.1 | 1.8 | 0.9 | 1.2 | 0.6 | 0.3 |
| BRHIP20233090 | 2.8 | 1.5 | 1.8 | 0.5 | 0 | 0.4 |
| BRHIP20284800 | 2.3 | 1.5 | 1.7 | |||
| BRHIP30004880 | 0.04 | 0.2 | 0.04 | |||
| BRSSN20046570 | 2.5 | 2 | 1.7 | 2.6 | 1 | 1.2 |
| BRSSN20142940 | 0 | 0 | 0.04 | 1.2 | 1.3 | 1.2 |
| BRSSN20152380 | 0.5 | 1 | 0.7 | 0.04 | 0.04 | 0.04 |
| BRSSN20176820 | 1.2 | 0.5 | 0.04 | 1.5 | 1 | 1.4 |
| BRSSN20187310 | 2.5 | 9.6 | 27.6 | |||
| BRTHA20046390 | 2 | 2.1 | 2 | 3.2 | 3.2 | 2.4 |
| CD34C30004240 | 1 | 1.3 | 1.8 | 2 | 1.7 | 1.3 |
| CD34C30004940 | 0 | 2.9 | 0 | |||
| COLON20043180 | 7.2 | 6.6 | 7.2 | |||
| CTONG10000620 | 0.04 | 0.04 | 0.04 | |||
| CTONG20014280 | 0.4 | 0.5 | 0 | |||
| CTONG20095270 | 0 | 1.9 | 1.6 | 0 | 0 | 0 |
| CTONG20095290 | 1.5 | 0.5 | 0.8 | 0 | 0 | 0 |
| CTONG20096750 | 0 | 0.1 | 0 | 0 | 0 | 0 |
| CTONG20100240 | 0.2 | 0.8 | 0.04 | 0.2 | 0.04 | 0.04 |
| CTONG20103480 | 2.7 | 2.9 | 3.7 | 0 | 0.1 | 0 |
| CTONG20105660 | 7.2 | 4.3 | 3.7 | 3.1 | 2.8 | 3.1 |
| CTONG20121010 | 0 | 0 | 0 | 1.7 | 1.6 | 0 |
| CTONG20128470 | 0.8 | 1 | 1 | 0.2 | 0.3 | 0.2 |
| CTONG20138030 | 2.7 | 2.1 | 1.9 | 2.2 | 0.8 | 1.8 |
| CTONG20139070 | 2.4 | 2.3 | 2.2 | 0.9 | 0.4 | 1.1 |
| CTONG20146970 | 7 | 6.9 | 5.4 | 7.3 | 2.7 | 6.8 |
| CTONG20158150 | 0.2 | 3 | 0.4 | 1.6 | 0 | 1 |
| CTONG20186320 | 3.6 | 2.5 | 3.8 | 1.8 | 1.8 | 0.6 |
| CTONG20265130 | 1.2 | 2.2 | 6.3 | 0.8 | 6 | 20.3 |
| D3OST20006540 | 0.7 | 1.7 | 0.4 | 0.7 | 0.2 | 0.9 |
| D3OST20037970 | 2.7 | 2.7 | 1.7 | 1.9 | 0.6 | 1.3 |
| D9OST20031370 | 0.8 | 2.9 | 1.1 | 0.04 | 0.04 | 0.04 |
| DFNES10001850 | 0 | 0 | 0 | |||
| DFNES20031920 | 2.1 | 2.2 | 0.8 | 1.2 | 2.9 | 0.8 |
| FCBBF10005060 | 0.9 | 0 | 1 | |||
| FCBBF20032970 | 3.1 | 3.6 | 3.6 | 1.6 | 0.9 | 2 |
| FCBBF20035280 | 0 | 0 | 0 | |||
| FCBBF20054280 | 2 | 2 | 2.4 | |||
| FCBBF20071860 | 0.9 | 1.1 | 1.9 | 0 | 0 | 0.04 |
| FCBBF30001840 | 1 | 1.6 | 1.5 | 2.5 | 0 | 0 |
| FCBBF30016320 | 1 | 1.9 | 0.6 | 1.3 | 1.5 | 0.3 |
| FCBBF30016570 | 2.4 | 1.8 | 1.7 | 0.4 | 0.2 | 0.4 |
| FCBBF30033050 | 4.1 | 0 | 3.2 | 1 | 0 | 0.3 |
| FCBBF30071520 | 2 | 0 | 1.2 | |||
| FCBBF30083820 | 2.9 | 3.5 | 1.4 | 2.2 | 1.6 | 0.5 |
| FCBBF30215060 | 0.5 | 0.5 | 0.5 | |||
| FCBBF30251420 | 0 | 2.6 | 0 | 0.3 | 0.1 | 0.6 |
| FCBBF30252520 | 1 | 3.8 | 2.4 | 0.4 | 0 | 0 |
| FCBBF30262360 | 0.0 | 0.04 | 0.04 | |||
| FCBBF30266920 | 0.3 | 0.4 | 2 | |||
| FCBBF30278630 | 1.3 | 3.6 | 0 | |||
| FCBBF30285280 | 0 | 0 | 0 | 0 | 0 | 0 |
| FCBBF40001420 | 0.3 | 0.7 | 0.3 | 0.1 | 0.7 | 0.1 |
| FEBRA10001880 | 0.5 | 0.4 | 0.4 | 0.4 | 0.4 | 0.5 |
| FEBRA20010120 | 4.2 | 6.4 | 3.5 | 0.7 | 0 | 0 |
| FEBRA20017050 | 0 | 0.8 | 0.8 | 0.04 | 0 | 0 |
| FEBRA20034360 | 0.8 | 0.9 | 0.7 | 0.1 | 0.1 | 0.1 |
| FEBRA20037260 | 1.2 | 1.4 | 0.9 | |||
| FEBRA20037500 | 0.04 | 0 | 0.1 | 4.4 | 4 | 3.4 |
| FEBRA20082100 | 0.2 | 0.3 | 0.5 | 2.1 | 0.7 | 0.5 |
| FEBRA20095880 | 0.9 | 0 | 0.5 | 0.7 | 0.3 | 0.7 |
| FEBRA20167390 | 0.3 | 0 | 0 | 0.9 | 0.3 | 0.6 |
| FEBRA20176800 | 0.9 | 0 | 0 | 0.04 | 0 | 0 |
| FEBRA20226010 | 0.9 | 0.2 | 0.2 | 0 | 0 | 0 |
| HCASM10000500 | 2.7 | 2.7 | 3.1 | 0.9 | 0.8 | 0.4 |
| HCHON20002260 | 0.1 | 0 | 0 | 0.8 | 0.6 | 0.9 |
| HCHON20008980 | 1.8 | 2.4 | 0.2 | |||
| HCHON20009350 | 0 | 0 | 0 | |||
| HCHON20010990 | 0.3 | 0.3 | 0.3 | |||
| HCHON20011160 | 0.04 | 0.2 | 0.04 | |||
| HCHON20015230 | 2.6 | 2.3 | 2.4 | 1.2 | 1.7 | 0.6 |
| HCHON20022470 | 2 | 1.2 | 0.7 | 1.6 | 1.1 | 1.1 |
| HCHON20035130 | 1.9 | 2 | 2.4 | 1.3 | 0 | 2 |
| HCHON20043590 | 2.6 | 2.4 | 1.8 | 1.5 | 0.3 | 0.6 |
| HCHON20067220 | 1.5 | 2.1 | 2.3 | 2.1 | 0 | 0.9 |
| HCHON20076500 | 2.1 | 2.4 | 2.1 | 0 | 0.1 | 0 |
| HEART20021840 | 0.6 | 0.4 | 0 | |||
| HEART20067870 | 0 | 0 | 0 | 0 | 0 | 0 |
| HEART20083640 | 0.8 | 0.2 | 0.2 | |||
| HHDPC10000650 | 1.4 | 1.4 | 1.1 | 0.7 | 0.4 | 0.3 |
| HHDPC20034390 | 1.1 | 0.5 | 1.2 | 0.3 | 0.04 | 0.04 |
| HHDPC20095280 | 0.8 | 0.7 | 0.5 | 0 | 0.5 | 0 |
| HLUNG10000550 | 7.6 | 7 | 6.9 | 2.1 | 1.4 | 1 |
| KIDNE20018970 | 1.5 | 1.2 | 0.9 | 1.4 | 0.9 | 0.9 |
| KIDNE20028720 | 1.5 | 1.2 | 0 | |||
| KIDNE20079440 | 1.4 | 1.8 | 0 | |||
| KIDNE20096470 | 2.1 | 2.6 | 2.3 | 1.3 | 1 | 0.7 |
| KIDNE20106740 | 0.2 | 0.1 | 0 | 0 | 0 | 0 |
| KIDNE20120090 | 0.2 | 0 | 0 | |||
| KIDNE20127750 | 1.9 | 0.6 | 0.4 | |||
| KIDNE20130450 | 0.9 | 0.9 | 1.3 | 0.1 | 0.8 | 0.4 |
| KIDNE20132180 | 0.7 | 0 | 0 | |||
| KIDNE20141190 | 0.1 | 0.2 | 0 | 0.4 | 0.3 | 0 |
| KIDNE20148900 | 4.6 | 0 | 4.7 | |||
| KIDNE20163880 | 0.6 | 1.5 | 0 | 2.2 | 1.8 | 1.2 |
| KIDNE20182690 | 0.5 | 0.4 | 3.9 | 2.5 | 3.1 | 3.1 |
| LIVER10004790 | 1.5 | 3.3 | 1.6 | 0 | 0 | 0 |
| LIVER20011130 | 2.4 | 0.8 | 0 | 0.2 | 1.9 | 0.2 |
| LIVER20038540 | 0 | 5.1 | 0 | 1.2 | 4.9 | 0 |
| LIVER20055440 | 0.5 | 0.5 | 0.4 | 0.3 | 0.1 | 0.1 |
| LIVER20062510 | 1 | 1.1 | 1.2 | 0 | 0 | 0.9 |
| LIVER20085800 | 0 | 0.8 | 0.5 | |||
| MAMGL10000830 | 5.4 | 4.3 | 0.1 | 0.6 | 0.6 | 0.7 |
| MESAN20031900 | 0.7 | 0.3 | 0.4 | 0.1 | 0.1 | 0.1 |
| MESAN20121130 | 2.6 | 2.8 | 2.2 | 0.1 | 0.04 | 0.04 |
| MESAN20127350 | 1.6 | 0.7 | 0.3 | |||
| MESAN20130220 | 0.9 | 2.3 | 2.2 | |||
| MESAN20154010 | 2.6 | 2.2 | 2 | 2.9 | 2.4 | 2.5 |
| MESAN20174170 | 0 | 0 | 0.7 | 0 | 0 | 0 |
| NOVAR10001020 | 0.3 | 0.04 | 0.04 | |||
| NT2NE20053580 | 0.8 | 0 | 0 | |||
| NT2NE20089610 | 0.9 | 1.3 | 1.5 | 0.1 | 0.04 | 0.04 |
| NT2NE20089970 | 0.7 | 0 | 0 | 0 | 0 | 0 |
| NT2NE20146810 | 2.8 | 2.3 | 1.9 | |||
| NT2NE20155110 | 2.5 | 2.6 | 2.9 | |||
| NT2NE20156260 | 1.3 | 1.3 | 1.7 | 0.3 | 0.1 | 1 |
| NT2NE20158600 | 0.8 | 3.4 | 3 | |||
| NT2NE20172590 | 0 | 0.8 | 0 | |||
| NT2NE20174920 | 1.8 | 1 | 1.1 | 1.4 | 0 | 0 |
| NT2NE20181650 | 1 | 1.1 | 0.5 | 0.2 | 0.1 | 0.04 |
| NT2RI20005750 | 0 | 0.4 | 0 | 0.6 | 0.04 | 0.8 |
| NT2RI20009870 | 3 | 2.3 | 2.3 | 7.3 | 2.1 | 3.4 |
| NT2RI20023160 | 3.5 | 1.1 | 2.8 | 1.7 | 0.4 | 1.8 |
| NT2RI20040930 | 0.7 | 0.6 | 0.5 | 0.3 | 0.1 | 0.1 |
| NT2RI20046080 | 1.8 | 1.8 | 1.5 | 1.2 | 0.8 | 0.9 |
| NT2RI20055790 | 0.9 | 0.9 | 0.9 | 0.8 | 0.6 | 1 |
| NT2RI20069730 | 2.4 | 2.1 | 1.7 | 2.1 | 1.4 | 1.4 |
| NT2RI20203900 | 0 | 0 | 0 | 0 | 0 | 0 |
| NT2RP70062230 | 1.8 | 0 | 1.5 | |||
| NT2RP70102350 | 1.7 | 0.04 | 0.04 | |||
| NT2RP70110860 | 0 | 0 | 0.6 | 0 | 0 | 0 |
| NT2RP70111320 | 3.2 | 4.4 | 2.8 | |||
| NT2RP70130020 | 0 | 0 | 0 | 1 | 0 | 0.1 |
| NT2RP70143480 | 1.2 | 2 | 1.7 | 0.8 | 1.1 | 0.6 |
| NT2RP70150800 | 0.8 | 0.3 | 0.3 | |||
| NT2RP70157890 | 4.6 | 1.1 | 0.3 | 2.2 | 1.8 | 0 |
| NT2RP70169110 | 0.5 | 1.3 | 1.7 | 1 | 3.3 | 2.5 |
| NT2RP70175670 | 0.3 | 0.1 | 1.4 | 4.3 | 3.3 | 3.3 |
| NT2RP70188020 | 2.5 | 2.8 | 2.6 | 0 | 0 | 0 |
| NT2RP70188710 | 0 | 0.1 | 0.2 | 4.3 | 2.8 | 2.9 |
| NT2RP70190640 | 0.4 | 0.4 | 0.9 | |||
| NTONG20029480 | 3.1 | 0.7 | 2.2 | |||
| NTONG20064840 | 1.5 | 1 | 1 | |||
| NTONG20067090 | 2.5 | 2.1 | 2.3 | 0.4 | 0.1 | 0.2 |
| NTONG20070340 | 0.1 | 0 | 0 | 6.3 | 1.3 | 0.7 |
| NTONG20077560 | 0.5 | 0.5 | 0.5 | |||
| NTONG20083650 | 2.9 | 2.9 | 2.7 | 2.5 | 2.5 | 1.9 |
| NTONG20090680 | 2.1 | 2 | 2.4 | 2 | 1.3 | 1.6 |
| OCBBF20005230 | 1.7 | 1.3 | 2.3 | 0.9 | 0.7 | 0.7 |
| OCBBF20019380 | 0.6 | 0.6 | 0.5 | 0 | 0 | 0 |
| OCBBF20020150 | 4.2 | 3.2 | 3 | 1 | 0 | 0.6 |
| OCBBF20020830 | 2.7 | 2.7 | 1.3 | 4.4 | 2.3 | 2.1 |
| OCBBF20039250 | 1 | 1.2 | 0.9 | 0.4 | 0.1 | 0.5 |
| OCBBF20041680 | 1.4 | 0 | 0 | |||
| OCBBF20047570 | 0.04 | 0 | 0 | 0.3 | 0.2 | 0.6 |
| OCBBF20051610 | 0 | 0.04 | 0.04 | 0 | 0 | 0 |
| OCBBF20054200 | 0.4 | 0.3 | 0 | 0.04 | 0.04 | 0.04 |
| OCBBF20061720 | 1.3 | 2 | 0.2 | 0.7 | 1.2 | 0 |
| OCBBF20062140 | 3.3 | 3.1 | 5 | |||
| OCBBF20071960 | 0.1 | 0 | 0 | |||
| OCBBF20072320 | 0.04 | 0 | 0.04 | 0.04 | 0.04 | 0.04 |
| OCBBF20079310 | 0.04 | 0 | 0 | 0 | 0.04 | 1 |
| OCBBF20081380 | 6.3 | 6.1 | 5.1 | 0.8 | 0.4 | 0.6 |
| OCBBF20085200 | 0.1 | 0.5 | 1.3 | |||
| OCBBF20094240 | 0.9 | 1.5 | 1.6 | 1.1 | 0.3 | 0 |
| OCBBF20107920 | 2.9 | 2.9 | 2.6 | 2.6 | 0.7 | 0.3 |
| OCBBF20127040 | 1.4 | 1.3 | 0.5 | 0.2 | 0.04 | 0 |
| OCBBF20130110 | 3.2 | 2.4 | 1.8 | |||
| OCBBF20139260 | 2.1 | 0.7 | 0.2 | |||
| OCBBF20164050 | 0.3 | 0.3 | 0.2 | 0.2 | 0 | 0.04 |
| OCBBF20178990 | 2.1 | 0.7 | 0.2 | 0.9 | 0 | 0 |
| OCBBF20180840 | 3.7 | 2.7 | 3.1 | 0.1 | 0.3 | 0.3 |
| PEBLM10000240 | 2.1 | 2.2 | 1.6 | 0 | 0.3 | 0 |
| PEBLM20013120 | 3.3 | 0.5 | 3 | |||
| PEBLM20024550 | 0.1 | 0 | 0 | 3 | 2.2 | 0.7 |
| PEBLM20052820 | 1.9 | 2.1 | 2.2 | 1 | 0.6 | 0.8 |
| PEBLM20074370 | 0.9 | 0.9 | 1.7 | 3.7 | 3.1 | 3 |
| PERIC20002140 | 0.04 | 0.9 | 0.4 | 0.7 | 0.3 | 0.8 |
| PERIC20004780 | 0 | 0.04 | 0.1 | 0.04 | 0 | 0.04 |
| PLACE60003480 | 4.1 | 1.5 | 4.8 | 0.6 | 1.6 | 5.1 |
| PLACE60136720 | 0.5 | 0.7 | 0.7 | 0.6 | 0.7 | 0.2 |
| PLACE60155130 | 0.7 | 2.3 | 0 | |||
| PLACE60169420 | 1.2 | 1.4 | 1.6 | 0.6 | 0 | 0.8 |
| PLACE60181070 | 42.3 | 10 | 28.2 | |||
| PROST10004800 | 3.1 | 3.2 | 1.8 | |||
| PROST20120160 | 0 | 0.6 | 0 | 0 | 0.3 | 0.9 |
| PROST20144220 | 2.5 | 2.8 | 2.4 | 1.6 | 0.5 | 0.2 |
| PROST20149160 | 0.7 | 0 | 0.4 | 1.6 | 0.6 | 0.6 |
| PROST20149250 | 0 | 0.9 | 0.4 | 0 | 0 | 0 |
| PROST20151240 | 1.3 | 0.7 | 0 | 0 | 1.2 | 0 |
| PROST20153320 | 1.4 | 1.2 | 1.8 | 1.4 | 0.3 | 1.2 |
| PROST20161950 | 0 | 0 | 0.6 | 2.2 | 1.4 | 1.2 |
| PROST20189770 | 1.1 | 1.4 | 0.8 | 2.8 | 2.8 | 2.1 |
| PUAEN20003740 | 3.1 | 0.5 | 2.8 | 1.4 | 0.5 | 2.4 |
| PUAEN20011880 | 1.3 | 2.4 | 0.4 | 0.1 | 0.3 | 0 |
| PUAEN20015260 | 0.04 | 0.04 | 7.4 | |||
| PUAEN20025680 | 1.9 | 1 | 2.3 | 3.1 | 0.9 | 1.1 |
| PUAEN20040670 | 0.3 | 0.5 | 0.2 | 1.3 | 0.5 | 1 |
| PUAEN20045250 | 1.8 | 1.6 | 1.6 | 1.9 | 1.6 | 1.1 |
| PUAEN20078980 | 1.1 | 0.3 | 0.7 | 0.5 | 0 | 0.1 |
| PUAEN20085150 | 2 | 1 | 2.3 | 1.6 | 1.1 | 0.2 |
| SKMUS20018230 | 1.9 | 2.2 | 1.8 | 0.8 | 0.5 | 0.6 |
| SKMUS20028210 | 1.6 | 2.7 | 2.2 | 0 | 0 | 1.3 |
| SKMUS20031680 | 0.9 | 0 | 0 | 1.2 | 2.4 | 0.3 |
| SKMUS20046670 | 0.3 | 0.3 | 0.3 | |||
| SKNSH20062340 | 0.6 | 0.5 | 0 | |||
| SKNSH20080430 | 1.1 | 2.6 | 0.5 | 0 | 1.3 | 0 |
| SMINT20001760 | 1.8 | 1.5 | 0.7 | 0.3 | 0.1 | 0.3 |
| SMINT20013480 | 1.3 | 2.1 | 0.9 | |||
| SMINT20014580 | 2.7 | 2.1 | 1.4 | 1.2 | 0 | 0.6 |
| SMINT20033400 | 2.6 | 1.7 | 1.4 | |||
| SMINT20047810 | 2.2 | 0.7 | 0.5 | |||
| SMINT20051610 | 0.1 | 0.1 | 0.3 | 0.4 | 0.1 | 0.5 |
| SMINT20056210 | 0.9 | 1.8 | 0 | |||
| SMINT20060780 | 0.2 | 0.6 | 0.5 | 0.04 | 0.04 | 0.04 |
| SMINT20080540 | 0 | 0 | 0 | |||
| SMINT20105000 | 0 | 1.1 | 0.3 | |||
| SMINT20108530 | 1.3 | 1.5 | 0 | 0.04 | 0.04 | 0.04 |
| SMINT20122850 | 0.04 | 0.04 | 0.04 | 0.04 | 0.04 | 0.04 |
| SMINT20122910 | 0.3 | 0.3 | 0.3 | |||
| SMINT20153530 | 4.8 | 4.6 | 5.6 | 2.7 | 1.5 | 1.8 |
| SMINT20161220 | 8.5 | 6.2 | 19.5 | 2 | 1.1 | 1 |
| SMINT20163960 | 0.6 | 0.5 | 1.4 | 0 | 0 | 0 |
| SMINT20164770 | 2.4 | 2.1 | 1.6 | 1.8 | 1.2 | 1 |
| SMINT20168570 | 0 | 0 | 0 | |||
| SPLEN20008820 | 2.5 | 2.3 | 2.7 | 1.6 | 1.3 | 0.8 |
| SPLEN20011410 | 0.4 | 0.4 | 0.1 | |||
| SPLEN20013540 | 1.6 | 0.9 | 1.1 | 2.4 | 1.4 | 1.8 |
| SPLEN20019450 | 1 | 1.8 | 1.2 | 0.2 | 0.6 | 0.4 |
| SPLEN20022230 | 4.5 | 6.2 | 3.9 | 1.4 | 1.1 | 1.6 |
| SPLEN20040600 | 3.2 | 4.5 | 3.6 | 0 | 0 | 0 |
| SPLEN20076530 | 0.04 | 0.04 | 0.04 | 0 | 0 | 0 |
| SPLEN20101190 | 0.3 | 0.2 | 0.6 | 1.6 | 0 | 0 |
| SPLEN20126190 | 2.5 | 3.4 | 2.8 | 5.2 | 3.5 | 3.1 |
| SPLEN20152760 | 4.2 | 3 | 3.2 | 1.2 | 0.8 | 1.6 |
| SPLEN20157300 | 0.4 | 0.5 | 2.5 | |||
| SPLEN20158990 | 1.9 | 0.9 | 2.6 | 1.1 | 1.1 | 1.3 |
| SPLEN20163560 | 0.3 | 0.6 | 0.3 | 0 | 0 | 0 |
| SPLEN20174260 | 0.4 | 0 | 0 | 0.3 | 0.1 | 0.1 |
| SPLEN20211570 | 2.3 | 2.3 | 2.2 | 1 | 2.1 | 1.4 |
| SPLEN20214580 | 0.04 | 0.6 | 0.9 | 1.4 | 1.3 | 2.6 |
| SPLEN20245300 | 3.1 | 2.6 | 1.9 | 0.6 | 0 | 0.2 |
| SPLEN20279950 | 0.8 | 2.1 | 0.3 | |||
| SPLEN20280660 | 0.6 | 0.5 | 1 | 0 | 0 | 0 |
| SPLEN20283650 | 1.8 | 1 | 0.8 | 0.8 | 0 | 0 |
| SPLEN20329240 | 0.2 | 0 | 0 | |||
| STOMA20010250 | 2 | 0.9 | 1 | 0 | 0 | 0.7 |
| STOMA20032890 | 0.9 | 1.5 | 0.4 | |||
| STOMA20048520 | 0.04 | 2 | 0.4 | 0 | 0.9 | 0 |
| STOMA20057820 | 1.3 | 1 | 0 | 4.3 | 4.1 | 0 |
| STOMA20062290 | 0.4 | 0.6 | 0.4 | 0.3 | 0.3 | 0.2 |
| STOMA20076800 | 1.1 | 0.7 | 0.6 | 1.2 | 0.6 | 0.3 |
| TESTI20001170 | 0 | 0 | 0 | 0.8 | 0.6 | 0.7 |
| TESTI20002780 | 0 | 0 | 0 | |||
| TESTI20004890 | 1.1 | 0.7 | 0.6 | 0 | 0.2 | 0.4 |
| TESTI20011200 | 6.3 | 3.7 | 5.9 | 0.5 | 0.04 | 0.2 |
| TESTI20018230 | 0 | 0 | 0 | 0.04 | 0.04 | 0.04 |
| TESTI20035960 | 0.1 | 0 | 0 | 0.04 | 0.04 | 0.04 |
| TESTI20038270 | 0 | 0 | 0 | |||
| TESTI20044230 | 0 | 0 | 0 | 0.6 | 0.2 | 0.2 |
| TESTI20046750 | 0.4 | 0.04 | 0.04 | 1 | 0.8 | 0 |
| TESTI20060400 | 1.2 | 2 | 0.2 | 0.7 | 0.5 | 0.04 |
| TESTI20066770 | 0 | 0 | 0 | 0.04 | 0.04 | 0.04 |
| TESTI20076850 | 0 | 0.6 | 0 | 0.04 | 0.04 | 0.04 |
| TESTI20083940 | 0.9 | 1.5 | 1.4 | 0 | 1.2 | 1.3 |
| TESTI20087620 | 0.8 | 2.3 | 0.8 | 1.1 | 0.04 | 0.1 |
| TESTI20098530 | 5.3 | 1.2 | 0 | |||
| TESTI20105720 | 2.7 | 3.5 | 2.5 | 0.04 | 0.1 | 0.04 |
| TESTI20108720 | 0.04 | 1.5 | 1.1 | 2.5 | 2.1 | 1.8 |
| TESTI20123080 | 6 | 0 | 0 | |||
| TESTI20128350 | 1.4 | 1.6 | 0 | |||
| TESTI20136100 | 3.1 | 1.9 | 2.1 | |||
| TESTI20137670 | 0.4 | 0.4 | 0.4 | |||
| TESTI20143240 | 0.2 | 0.1 | 0.1 | 0.3 | 0.04 | 0.3 |
| TESTI20143620 | 0.04 | 0 | 0 | |||
| TESTI20156100 | 0.1 | 0.04 | 0.1 | |||
| TESTI20161970 | 1.2 | 0.7 | 0 | 1.1 | 0.4 | 1 |
| TESTI20168480 | 0.5 | 5.7 | 0.5 | |||
| TESTI20168960 | 0.5 | 0.5 | 0.5 | |||
| TESTI20178160 | 0.04 | 0.04 | 0.04 | 0.04 | 0.04 | 0.04 |
| TESTI20185810 | 0.9 | 0 | 0 | |||
| TESTI20199170 | 0.7 | 0 | 0 | 0.9 | 0.8 | 0 |
| TESTI20200260 | 0.3 | 0 | 0 | |||
| TESTI20200710 | 3.9 | 2.6 | 2.4 | 2.5 | 3.5 | 2.9 |
| TESTI20202650 | 0.04 | 0.04 | 0.04 | 1 | 1.2 | 0.3 |
| TESTI20220100 | 0 | 5.7 | 0 | |||
| TESTI20224620 | 0 | 0 | 1.5 | |||
| TESTI20229600 | 0 | 0 | 0 | |||
| TESTI20230850 | 0.04 | 0.04 | 0 | 0.04 | 0.04 | 0.04 |
| TESTI20231920 | 0.5 | 0.5 | 0.5 | |||
| TESTI20234140 | 1.8 | 0.3 | 0.3 | |||
| TESTI20234270 | 2.6 | 2.8 | 2.9 | 0.5 | 0.04 | 0.3 |
| TESTI20238000 | 0.2 | 0 | 0.04 | 0.04 | 0.04 | 0.04 |
| TESTI20238610 | 0.04 | 0.04 | 0.04 | |||
| TESTI20239510 | 0 | 0.2 | 0 | 0.04 | 0.2 | 1 |
| TESTI20242990 | 1.8 | 2.1 | 1.8 | 0 | 0 | 0 |
| TESTI20265250 | 2.1 | 1.6 | 1.9 | 1.5 | 0.8 | 0.4 |
| TESTI20265370 | 0.04 | 0.04 | 0.04 | 0.04 | 0.04 | 0.04 |
| TESTI20266740 | 0.2 | 0 | 0.7 | 0.04 | 0.04 | 0.04 |
| TESTI20272390 | 1.3 | 1.2 | 0.8 | 0.2 | 0.2 | 0.4 |
| TESTI20275030 | 0 | 0 | 0 | 0 | 0 | 0.3 |
| TESTI20275620 | 1.3 | 0.04 | 0.7 | |||
| TESTI20277360 | 0 | 0 | 0 | |||
| TESTI20282540 | 0.04 | 0 | 0.1 | 0.2 | 0.04 | 0.3 |
| TESTI20284880 | 0.4 | 0.2 | 0.1 | 0.04 | 0 | 0.1 |
| TESTI20285830 | 0.04 | 0.04 | 0.04 | |||
| TESTI20288110 | 1.2 | 0 | 0 | |||
| TESTI20289850 | 0.04 | 0 | 0 | 0.04 | 0.04 | 0.04 |
| TESTI20307540 | 0.6 | 0.8 | 0 | |||
| TESTI20308600 | 0.5 | 1.2 | 0.5 | |||
| TESTI20311290 | 0 | 0 | 0 | 0 | 0 | 0.7 |
| TESTI20317600 | 0 | 0 | 0 | 0.04 | 0.04 | 0.04 |
| TESTI20319190 | 0.2 | 0 | 0 | 0.04 | 0.04 | 0.3 |
| TESTI20332420 | 0.6 | 0.1 | 0.9 | |||
| TESTI20335200 | 0.9 | 1.4 | 0.9 | |||
| TESTI20342430 | 0 | 2.8 | 0 | 0.6 | 0.6 | 0.5 |
| TESTI20345060 | 0.1 | 0 | 0.04 | |||
| TESTI20347300 | 0.9 | 0.6 | 1.4 | 0.04 | 0 | 0 |
| TESTI20357960 | 1 | 1 | 1.7 | 2.7 | 1.3 | 1.7 |
| TESTI20361140 | 0.04 | 0.04 | 0.04 | 0.2 | 0 | 0 |
| TESTI20369220 | 0.04 | 0.04 | 0.04 | |||
| TESTI20369690 | 1.5 | 0 | 1.3 | 1.3 | 1.4 | 1 |
| TESTI20370020 | 0.4 | 1.7 | 0.1 | |||
| TESTI20371030 | 1.3 | 1.3 | 1 | 0.8 | 0.5 | 0.5 |
| TESTI20386230 | 2 | 0.2 | 0.3 | |||
| TESTI20391210 | 0.6 | 2.3 | 4.9 | 3.1 | 0 | 2.4 |
| TESTI20392090 | 0 | 0 | 0.04 | 0.04 | 0.04 | 0.7 |
| TESTI20392250 | 9.3 | 7.8 | 3.8 | |||
| TESTI20392270 | 1.8 | 1.4 | 1.6 | 1.1 | 1.6 | 1.1 |
| TESTI20401020 | 0.2 | 0.5 | 0.8 | 0 | 0 | 0 |
| TESTI20401430 | 4.3 | 4.8 | 4.3 | |||
| TESTI20409440 | 1.4 | 0.5 | 0.3 | 0.5 | 0 | 0.3 |
| TESTI20415640 | 0.8 | 2.5 | 1 | 0 | 0 | 0 |
| TESTI20424000 | 0.2 | 0.04 | 0.04 | 0 | 0 | 0 |
| TESTI20424730 | 1.8 | 0.7 | 2.9 | 3.8 | 0 | 3.3 |
| TESTI20425070 | 2.3 | 2.4 | 2.6 | 1.9 | 1.4 | 1.2 |
| TESTI20433130 | 0 | 0 | 0 | |||
| TESTI20438570 | 0.8 | 0.6 | 0.6 | 0.8 | 0.6 | 1.2 |
| TESTI20443090 | 0.1 | 0.1 | 0.1 | 0.3 | 0.5 | 0.6 |
| TESTI20463520 | 0 | 0 | 0 | |||
| TESTI20465520 | 0.6 | 0.6 | 0.5 | 0.2 | 0 | 0.1 |
| TESTI20478010 | 0.9 | 1.7 | 0.7 | 0 | 0.3 | 0 |
| TESTI20478180 | 0.04 | 0.04 | 0.04 | 0.04 | 0 | 0 |
| THYMU20029100 | 1.9 | 1.2 | 2.3 | 2 | 2.9 | 2.5 |
| THYMU20061700 | 0 | 0 | 0 | 0.7 | 0.2 | 0.2 |
| THYMU20095960 | 2.9 | 2.4 | 0.5 | |||
| THYMU20111180 | 1.1 | 0.6 | 0.5 | 0 | 0 | 0 |
| THYMU20118060 | 0.2 | 0 | 0.2 | 0.04 | 0.04 | 0.04 |
| THYMU20130890 | 0.6 | 1.3 | 3.3 | |||
| THYMU20142040 | 1 | 1.1 | 0.7 | 1.3 | 1.1 | 1 |
| THYMU20142970 | 4 | 3.5 | 3.8 | 1.6 | 2 | 0.6 |
| THYMU20153160 | 1 | 0.7 | 1 | 0.1 | 0.1 | 0.04 |
| THYMU20158250 | 10.4 | 7 | 5.5 | 1.1 | 0 | 0 |
| THYMU20187720 | 3.2 | 3.2 | 2.8 | 2.4 | 2.2 | 2.3 |
| THYMU20194360 | 1.8 | 2.1 | 1.7 | 0.4 | 0.3 | 1.3 |
| THYMU20208300 | 1.9 | 1.9 | 1.6 | 0.3 | 0.2 | 0.3 |
| THYMU20226600 | 3 | 0 | 1.4 | 1.1 | 0.3 | 2.6 |
| THYMU20239000 | 2.1 | 2.3 | 2.8 | 1.4 | 0.8 | 1.1 |
| THYMU20253250 | 1.1 | 0.3 | 0.3 | |||
| THYMU20272490 | 2.7 | 1.4 | 0.6 | 0.04 | 0.04 | 0.04 |
| THYMU20284120 | 3.8 | 4.1 | 4 | 0.4 | 0.04 | 0.5 |
| THYMU20286290 | 0 | 2.1 | 0.4 | 3.1 | 2.5 | 1.7 |
| TKIDN10000010 | 2.2 | 2.2 | 2.5 | 1.2 | 1 | 1.1 |
| TRACH20005020 | 0 | 0 | 0 | 2.8 | 0.9 | 0.5 |
| TRACH20032720 | 0.1 | 0 | 0 | 0.6 | 0.04 | 0.1 |
| TRACH20041830 | 0.8 | 0.2 | 0.9 | |||
| TRACH20060150 | 0.2 | 0.9 | 2 | |||
| TRACH20076760 | 5.1 | 4.9 | 4.5 | 0.6 | 0.5 | 0.4 |
| TRACH20082780 | 0 | 0 | 0 | |||
| TRACH20091230 | 0.4 | 0 | 0.2 | 2.1 | 1.1 | 1.2 |
| TRACH20099340 | 1.8 | 3.8 | 4.9 | 1.9 | 2.5 | 0.9 |
| TRACH20109650 | 3.5 | 3.3 | 3.5 | 3.7 | 3.7 | 3.4 |
| TRACH20115740 | 0.04 | 0.04 | 0.04 | |||
| TRACH20134950 | 5.6 | 5 | 4 | 3.5 | 1.2 | 1.9 |
| TRACH20135520 | 1 | 0.9 | 0.6 | 0.9 | 0.9 | 0.5 |
| TRACH20153810 | 2.1 | 0 | 0 | |||
| TRACH20184490 | 2.2 | 3.2 | 2.8 | 1.6 | 0 | 0 |
| TSTOM20001390 | 1.5 | 2.1 | 1.8 | 2.5 | 0.4 | 2.5 |
| TSTOM20005690 | 1.3 | 0.8 | 1.1 | 0.3 | 0 | 0.1 |
| UMVEN10001560 | 2.4 | 2.6 | 3.3 | 0.6 | 0 | 0.04 |
| UMVEN20003540 | 5.2 | 3.9 | 4.9 | 3.1 | 2.4 | 2.8 |
| UTERU20004240 | 0.04 | 0.2 | 0.1 | 0.04 | 0 | 0.04 |
| UTERU20046980 | 0 | 0 | 0 | |||
| UTERU20055930 | 2.5 | 3.6 | 2.9 | 2.3 | 1.6 | 2.5 |
| UTERU20068990 | 0.04 | 1.3 | 0.04 | 0.1 | 0 | 0 |
| UTERU20070810 | 2.7 | 1.9 | 2.4 | 1.9 | 1.3 | 1.1 |
| UTERU20115740 | 3.1 | 3.2 | 5 | 2.3 | 1.9 | 0 |
| UTERU20119060 | 0.8 | 1.9 | 0 | 1.9 | 0.3 | 1.6 |
| UTERU20124070 | 2 | 2.7 | 1.8 | 2.8 | 2.1 | 1.8 |
| UTERU20126880 | 0 | 2.2 | 0.1 | |||
| UTERU20134910 | 2.5 | 2.7 | 2.3 | 2.9 | 1.4 | 1.3 |
| UTERU20146680 | 0 | 0.1 | 0 | 0.5 | 0 | 0.04 |
| UTERU20176130 | 2.9 | 1.3 | 1.6 | 1.9 | 0.6 | 0.8 |
| UTERU20185230 | 3.1 | 3.2 | 1.8 | 1.6 | 1.1 | 0.6 |
| UTERU20186740 | 1.9 | 1.4 | 0.7 | 0.04 | 0 | 0 |
Data obtained by the homology search for full-length nucleotide sequences and deduced amino acid sequences.
In the result of the search shown below, both units, aa and bp, are used as length units for the sequences to be compared.
Each data includes Clone name, Definition in hit data, P value, Length of sequence to be compared, Homology, and Accession number (No.) of hit data. These items are shown in this order and separated by a double-slash mark, //.
3NB6910001910//ALANYL-TRNA SYNTHETASE (EC 6.1.1.7) (ALANINE—TRNA LIGASE) (ALARS).//3.10E-20//392aa//24%//067323
3NB6920014080
3NB6920014590//HOMEOBOX PROTEIN DLX-6.//1.00E-91//226aa//78%//Q98877
ADIPS10000640//Homo sapiens synaptic glycoprotein SC2 (SC2) mRNA, complete cds.//1.60E-169//303aa//100%//AF222742
ADIPS20004250//ZINC FINGER PROTEIN OZF.//6.60E-27//223aa//32%//Q15072
ADRGL10001470//CYTOCHROME P450 11B1 PRECURSOR (EC 1.14.15.4) (CYPXIB1) (P450C11) (STEROID 11-BETA-HYDROXYLASE).//1.60E-38//84aa//98%//P15538
ADRGL20000640
ADRGL20011190//spectrin, beta, non-erythrocytic 1 [Homo sapiens].//1.00E-36//250aa//38%//NP—003119
ADRGL20012870
ADRGL20013010
ADRGL20013520
ADRGL20018300//KINESIN LIGHT CHAIN (KLC).//1.20E-207//566aa//70%//Q07866
ADRGL20018540
ADRGL20028570//Rattus norvegicus MG87 mRNA, complete cds.//2.90E-69//250aa//53%//AF095741
ADRGL20035850//CYTOCHROME P450 17 (EC 1.14.99.9) (CYPXVII) (P450-C17) (STEROID 17-ALPHA-HYDROXYLASE/17,20 LYASE).//7.30E-52//99aa//100%//P05093
ADRGL20044590
ADRGL20048330//Mus musculus mRNA for granuphilin-a, complete cds.//0//673aa//89%//AB025258
ADRGL20061930//transposon-derived Buster1 transposase-like protein//6.00E-65//500aa//33%//NP—067034
ADRGL20067670
ADRGL20068170
ADRGL20068460
ADRGL20073570
ADRGL20076360
ADRGL20078100//NADPH:ADRENODOXIN OXIDOREDUCTASE PRECURSOR (EC 1.18.1.2) (ADRENODOXIN REDUCTASE) (FERREDOXIN-NADP(+) REDUCTASE).//3.10E-147//276aa//99%//P22570
ADRGL20083310
ASTRO10001650//DREBRIN E.//4.80E-293//540aa//99%//Q16643
ASTRO20001410
ASTRO20005330
ASTRO20008010//ZINC FINGER PROTEIN 85 (ZINC FINGER PROTEIN HPF4) (HTF1).//6.00E-57//143aa//70%//Q03923
ASTRO20012490
ASTRO20027430//RAS SUPPRESSOR PROTEIN 1 (RSU-1) (RSP-1 PROTEIN) (RSP-1).//2.20E-18//178aa//34%//Q15404
ASTRO20032120
ASTRO20033160//BRAIN MITOCHONDRIAL CARRIER PROTEIN-1.//2.70E-125//291aa//80%//095258
ASTRO20055750//Human elastin gene, exon 1.//2.70E-293//654aa//88%//M17282
ASTRO20058630
ASTRO20064750//Homo sapiens BM-003 mRNA, complete cds.//6.10E-69//214aa//64%//AF208845
ASTRO20072210//PERIAXIN.//2.10E-25//87aa//56%//Q63425
ASTRO20084250//Ciona savignyi mRNA for PEM-3, complete cds.//3.50E-56//154aa//64%//AB001769
ASTRO20100720
ASTRO20105820//ACTIN INTERACTING PROTEIN 2.//2.60E-111//392aa//56%//P46681
ASTRO20106150//H. sapiens mRNA for calpain-like protease.//1.80E-291//473aa//98%//Y10552
ASTRO20108190//TUBERIN (TUBEROUS SCLEROSIS 2 PROTEIN).//5.30E-278//513aa//100%//P49815
ASTRO20111490
ASTRO20114370//Mus musculus SMAR1 mRNA, complete cds.//1.30E-213//461aa//89%//AF235503
ASTRO20114610
ASTRO20125520//dnaj protein [Schizosaccharomyces pombe]//7.80E-37//260aa//38%//CAB59885
ASTRO20130500//UBIQUITIN-ACTIVATING ENZYME E1.//2.70E-157//815aa//42%//Q29504
ASTRO20136710
ASTRO20138020
ASTRO20141350//Mus musculus mRNA for granuphilin-b, complete cds.//7.40E-12//169aa//30%//AB025259
ASTRO20143630
ASTRO20145760//TUBULIN—TYROSINE LIGASE (EC 6.3.2.25) (TTL).//1.60E-14//233aa//27%//P38584
ASTRO20152140
ASTRO20155290
ASTRO20166810
ASTRO20168470//ZINC FINGER PROTEIN 135.//4.80E-103//289aa//59%//P52742
ASTRO20173480
ASTRO20181690//oocyte-specific protein P100//1.60E-70//554aa//36%//S23468
ASTRO20190390
BEAST20004540
BGGI110000240
BGGI110001930
BGGI120006160//isomerase-like protein [Arabidopsis thaliana].//1.00E-52//187aa//47%//BAB00076
BLADE20003400//ZINC FINGER PROTEIN 177.//2.50E-33//205aa//38%//Q13360
BLADE20003890//ZINC FINGER PROTEIN 135.//1.50E-264//471aa//95%//P52742
BLADE20004630
BNGH420088500
BRACE20003070//Rattus norvegicus neurabin mRNA, complete cds.//2.30E-40//172aa//46%//U72994
BRACE20006400
BRACE20011070//Mus musculus F-box protein FBX15 mRNA, partial cds.//9.60E-142//471aa//56%//AF176530
BRACE20019540
BRACE20027620//CYTOSOLIC ACYL COENZYME A THIOESTER HYDROLASE, INDUCIBLE (EC 3.1.2.2) (LONG CHAIN ACYL-COA THIOESTER HYDROLASE) (LONG CHAIN ACYL-COA HYDROLASE) (CTE-I) (LACH2) (ACH2).//2.70E-148//423aa//65%//088267
BRACE20037660
BRACE20038000//MAP kinase phosphatase [Drosophila melanogaster].//3.80E-83//426aa//42%//BAA89534
BRACE20038470//Rattus norvegicus neurexophilin 4 (Nph4) mRNA, complete cds.//1.70E-57//109aa//98%//AF042714
BRACE20038480//Human SEC14L mRNA, complete cds.//2.60E-93//179aa//99%//D67029
BRACE20038850
BRACE20039040
BRACE20039440//Drosophila melanogaster CHARYBDE (charybde) mRNA, complete cds.//6.50E-17//142aa//35%//AF221109
BRACE20039540//MHC class I chain-related gene A protein [Homo sapiens]//2.00E-116//246aa//90%//NP—000238
BRACE20050900
BRACE20051380
BRACE20051690
BRACE20052160//Xenopus laevis bicaudal-C (Bic-C) mRNA, complete cds.//2.10E-13//208aa//30%//AF224746
BRACE20053280//Mus musculus Pdz-containing protein (Pdzx) mRNA, complete cds.//5.20E-63//223aa//64%//AF229645
BRACE20053480//Mus musculus erythroblast macrophage protein EMP mRNA, complete cds.//1.70E-133//145aa//97%//AF263247
BRACE20053630//BRITTLE-1 PROTEIN PRECURSOR.//1.20E-24//208aa//31%//P29518
BRACE20054500
BRACE20055180
BRACE20056810
BRACE20057190//NUCLEOPLASMIN.//5.20E-42//215aa//45%//PO5221
BRACE20057420
BRACE20057620//EUKARYOTIC TRANSLATION INITIATION FACTOR 4E (EIF-4E) (EIF4E) (MRNA CAP-BINDING PROTEIN) (EIF-4F 25 KDA SUBUNIT).//1.00E-22//60aa//73%//P48597
BRACE20057730//toxin sensitivity protein KTI12 homolog//1.10E-10//173aa//26%//A64492
BRACE20058580//Homo sapiens HCMOGT-1 mRNA for sperm antigen, complete cds.//2.10E-178//358aa//96%//AB041533
BRACE20058810
BRACE20059370//PROTEIN 4.1 (BAND 4.1) (P4.1).//6.70E-52//400aa//32%//P11171
BRACE20060550//ANKYRIN HOMOLOG PRECURSOR.//1.30E-14//139aa//44%//Q06527
BRACE20060720
BRACE20060840
BRACE20060890//ZINC FINGER PROTEIN ZIC4 (ZINC FINGER PROTEIN OF THE CEREBELLUM 4).//4.00E-131//264aa//87%//Q61467
BRACE20061050
BRACE20061740
BRACE20062400
BRACE20062640//HYPOTHETICAL 93.7 KDA PROTEIN F48E8.6 IN CHROMOSOME III.//9.10E-90//343aa//45%//Q09568
BRACE20062740
BRACE20063630
BRACE20063780
BRACE20063800
BRACE20063930
BRACE20064880//POLY(RC) BINDING PROTEIN 2 (PUTATIVE HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN X) (HNRNP X) (CTBP) (CBP).//1.80E-129//207aa//81%//Q61990
BRACE20067430
BRACE20068590//HYPOTHETICAL ZINC FINGER PROTEIN KIAA0961.//2.70E-155//504aa//56%//Q9Y2G7
BRACE20069090
BRACE20081720
BRACE20082950
BRACE20090440
BRACE20096200//Homo sapiens sir2-related protein type 7 (SIRT7) mRNA, complete cds.//1.00E-162//305aa//99%//AF233395
BRACE20096540
BRACE20097320
BRACE20099570
BRACE20101700
BRACE20101710
BRACE20106690
BRACE20106840//Rattus norvegicus partial mRNA for CRM1 protein.//9.00E-59//120aa//100%//AJ238278
BRACE20107530//Rattus norvegicus putative peroxisomal 2,4-dienoyl-CoA reductase (DCR-AKL) mRNA, complete cds.//1.70E-48 //108aa//91%//AF044574
BRACE20108130//Homo sapiens RAB-like protein 2B (RABL2B) mRNA, complete cds.//1.60E-43//92aa//100%//AF095352
BRACE20108880//MALEYLACETOACETATE ISOMERASE (EC 5.2.1.2) (MAAI) (GLUTATHIONE TRANSFERASE ZETA 1) (EC 2.5.1.18).//5.90E-11//27aa//100%//043708
BRACE20109370
BRACE20109830
BRACE20111830
BRACE20114780
BRACE20115450
BRACE20115920//RHO-GTPASE-ACTIVATING PROTEIN 4 (RHO-GAP HEMATOPOIETIC PROTEIN C1) (P115) (KIAA0131).//9.70E-73//291aa//52%//P98171
BRACE20116110
BRACE20116460//ATP SYNTHASE DELTA CHAIN, MITOCHONDRIAL PRECURSOR (EC 3.6.1.34).//1.00E-20//48aa//100%//P30049
BRACE20118380
BRACE20121850
BRACE20136240
BRACE20141080
BRACE20142320
BRACE20142570
BRACE20147800
BRACE20148210
BRACE20148240//Gsp1p [Saccharomyces cerevisiae].//1.00E-05//75aa//35%//NP—013396
BRACE20150310
BRACE20151320//Drosophila melanogaster Oregon R cytoplasmic basic protein (deltex) mRNA, complete cds.//6.10E-35//202aa//41%//U09789
BRACE20152870
BRACE20153680//Rattus norvegicus putative four repeat ion channel mRNA, complete cds.//4.10E-107//209aa//99%//AF078779
BRACE20154120//Shb=Src homology 2 protein//2.60E-23//79aa//48%//AAB29780
BRACE20163150
BRACE20163350//MYELIN PO PROTEIN PRECURSOR.//8.20E-08//92aa//33%//P20938
BRACE20165830
BRACE20171240
BRACE20172980//translation initiation factor eIF3 [Schizosaccharomyces pombe]//5.60E-06//136aa//30%//CAB11250
BRACE20175870
BRACE20177200//RAN-SPECIFIC GTPASE-ACTIVATING PROTEIN (RAN BINDING PROTEIN 1) (RANBP1).//9.90E-32//63aa//100%//P34022
BRACE20179340
BRACE20185680//ACETYL-COENZYME A SYNTHETASE (EC 6.2.1.1) (ACETATE—COA LIGASE) (ACYL-ACTIVATING ENZYME).//1.40E-16//94aa//40%//Q01576
BRACE20188470//ATP-binding cassette, sub-family A member 8//1.70E-115//457aa//50%//NP—009099
BRACE20190040
BRACE20190440
BRACE20192440//TRANSLATION INITIATION FACTOR IF-3.//1.20E-09//161aa//26%//P47438
BRACE20195100
BRACE20201570
BRACE20210140
BRACE20220300
BRACE20223280
BRACE20223330
BRACE20224480
BRACE20224500
BRACE20228480
BRACE20229280
BRACE20230700
BRACE20232840//ATP-binding cassette, sub-family E, member 1//0//560aa//75%//NP—002931
BRACE20235400
BRACE20237270//Human WW domain binding protein-2 mRNA, complete cds.//6.10E-21//50aa//88%//U79458
BRACE20238000
BRACE20240740
BRACE20248260//H. sapiens PR264 mRNA.//1.50E-13//78aa//48%//X62447
BRACE20253160//putative trna-splicing endonuclease subunit [Schizosaccharomyces pombe]//1.10E-11//148aa//32%//CAA21061
BRACE20253330//Homo sapiens Na+/H+ exchange regulatory co-factor (NHERF) mRNA, complete cds.//5.50E-88//157aa//99%//AF036241
BRACE20257100//transcription factor (SMIF gene)//2.00E-37//110aa//94%//NP—060873
BRACE20262930
BRACE20262940
BRACE20266750
BRACE20267250
BRACE20269200
BRACE20269710
BRACE20273890//Human phosphotyrosine independent ligand p62B B-cell isoform for the Lck SH2 domain mRNA, partial cds.//5.70E-25//100aa//65%//U46752
BRACE20274080
BRACE20276430//Homo sapiens. retinoblastoma-associated protein RAP140 mRNA, complete cds.//4.70E-106//203aa//100%//AF180425
BRACE20283920
BRACE20284100//Homo sapiens beta-dystrobrevin (BDTN) mRNA, complete cds.//7.20E-121//237aa//100%//AF022728
BRACE20286360
BRACE20287410
BRALZ20013500//Homo sapiens prostate stem cell antigen (PSCA) mRNA, complete cds.//3.30E-06//122aa//32%//AF043498
BRALZ20014450
BRALZ20017430//H. sapiens mRNA for protein phosphatase 5.//1.70E-41//99aa//87%//X89416
BRALZ20018340//H. sapiens mRNA for glutamine transaminase K.//4.70E-93//114aa//98%//X82224
BRALZ20019660
BRALZ20054710//Mus musculus mRNA for cysteine and histidine-rich protein (Chrp gene).//1.70E-163//280aa//99%//AJ251516
BRALZ20058880
BRALZ20059500
BRALZ20064740
BRALZ20065600
BRALZ20069760
BRALZ20073760//MONOCYTE TO MACROPHAGE DIFFERENTIATION PROTEIN.//8.40E-41//76aa//69%//Q15546
BRALZ20075450
BRALZ20075760
BRALZ20077900//anaphase-promoting complex 1; meiotic checkpoint regulator//3.00E-91//190aa//92%//NP—073153
BRALZ20077930//Xenopus laevis 4g2 mRNA, complete cds.//1.20E-191//501aa//71%//AF182319
BRALZ20080310
BRALZ20088690
BRAMY10001300//Homo sapiens MAGE-E1b mRNA, complete cds.//5.40E-78//140aa//97%//AB040528
BRAMY10001570
BRAMY20000520//HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEINS C1/C2 (HNRNP C1 AND HNRNP C2).//7.10E-70//293aa//53%//P07910
BRAMY20000860
BRAMY20002770
BRAMY20004110
BRAMY20011140
BRAMY20025840//H. sapiens mRNA from TYL gene.//7.10E-103//198aa//98%//X99688
BRAMY20039260
BRAMY20045240
BRAMY20054880//Rattus norvegicus KPL2 (Kpl2) mRNA, complete cds.//1.40E-43//155aa//59%//AF102129
BRAMY20060920//reduced in osteosclerosis transporter//1.50E-09//60aa//53%//NP—112471
BRAMY20063970
BRAMY20071850
BRAMY20102080
BRAMY20103570
BRAMY20104640//Mus musculus mRNA for serine/threonine protein kinase.//1.80E-140//345aa//75%//AJ250840
BRAMY20110640
BRAMY20111960
BRAMY20112800
BRAMY20116790
BRAMY20120910//GRG PROTEIN (ESP1 PROTEIN) (AMINO ENHANCER OF SPLIT) (AES-1/AES-2).//1.60E-97//188aa//100%//Q08117
BRAMY20121190
BRAMY20121620//Mus musculus kinesin light chain 2 (Klc2) mRNA, complete cds.//1.80E-256//500aa//85%//AF055666
BRAMY20124260//Rattus norvegicus transmembrane receptor Unc5H2 mRNA, complete cds.//2.80E-286//554aa//92%//U87306
BRAMY20134140//ATPase, H+ transporting, lysosomal (vacuolar proton pump) 9 kD//4.60E-29//52aa//59%//NP—003936
BRAMY20135900//CELLULAR APOPTOSIS SUSCEPTIBILITY PROTEIN.//2.00E-07//146aa//23%//P55060
BRAMY20136210
BRAMY20137560
BRAMY20144620
BRAMY20147540
BRAMY20148130
BRAMY20152110
BRAMY20153110//TRYPTOPHAN 5-MONOOXYGENASE (EC 1.14.16.4) (TRYPTOPHAN 5-HYDROXYLASE).//8.50E-58//201aa//58%//Q92142
BRAMY20157820//PUTATIVE KINESIN-LIKE PROTEIN C2F12.13.//1.10E-90//341aa//50%//014343
BRAMY20160700
BRAMY20162510//MELANOMA-ASSOCIATED ANTIGEN B2 (MAGE-B2 ANTIGEN) (DAM6).//1.30E-33//209aa//35%//015479
BRAMY20163250
BRAMY20163270
BRAMY20167060
BRAMY20167710
BRAMY20168920
BRAMY20170140
BRAMY20174550//Homo sapiens ATP-binding cassette protein M-ABC1 mRNA, nuclear gene encoding mitochondrial protein, complete cds.//0//648aa//98%//AF047690
BRAMY20178640
BRAMY20181220
BRAMY20182730
BRAMY20183080
BRAMY20184670//Homo sapiens mRNA for ALEX1, complete cds.//6.40E-14//139aa//27%//AB039670
BRAMY20195090
BRAMY20196000
BRAMY20204450
BRAMY20205740
BRAMY20210400//Homo sapiens thyroid hormone receptor-associated protein complex component TRAP150 mRNA, complete cds.//2.80E-16//141aa//39%//AF117756
BRAMY20211390//seven in absentia (Drosophila) homolog 1 [Homo sapiens]//3.70E-156//282aa//99%//NP—003022
BRAMY20211420//Homo sapiens mRNA for LAK-4p, complete cds.//3.00E-31//224aa//33%//AB002405
BRAMY20213100//Xenopus laevis Mi-2 histone deacetylase complex protein 66 mRNA, complete cds.//2.10E-66//394aa//44%//AF171099
BRAMY20215230
BRAMY20217460//Homo sapiens cardiac voltage gated potassium channel modulatory subunit mRNA, complete cds, alternatively spliced.//3.70E-81//158aa//98%//AF295530
BRAMY20218250//putative four repeat ion channel [Rattus norvegicus]//0//588aa//99%//AF078779
BRAMY20218670
BRAMY20229800
BRAMY20229840
BRAMY20230600
BRAMY20231720
BRAMY20240040//Homo sapiens suppressor of white apricot homolog 2 (SWAP2) mRNA, complete cds.//3.20E-301//642aa//90%//AF042800
BRAMY20242470//CORONIN-LIKE PROTEIN P57 (CORONIN 1A).//1.60E-70//210aa//66%//P31146
BRAMY20245300//Homo sapiens putative prostate cancer susceptibility protein HPC2/ELAC2 mRNA, complete cds.//0//737aa//99%//AF304370
BRAMY20247110//Mus musculus semaphorin cytoplasmic domain-associated protein 3A (Semcap3) mRNA, complete cds.//6.00E-117//366aa//63%//AF127084
BRAMY20247280
BRAMY20248490
BRAMY20250240
BRAMY20250320
BRAMY20252180
BRAMY20252720//Homo sapiens mRNA for thioredoxin reductase II alpha, partial cds.//1.60E-84//161aa//99%//AB019694
BRAMY20260910//Homo sapiens zinc finger DNA binding protein 99 (ZNF281) mRNA, complete cds.//0//811aa//99%//AF125158
BRAMY20261680
BRAMY20266850//Homo sapiens oxidation protection protein (0XR1) mRNA, complete cds.//4.50E-57//193aa//56%//AF309387
BRAMY20267130
BRAMY20268990
BRAMY20270730//Fugu rubripes zinc finger protein, isotocin, fatty acid binding protein, sepiapterin reductase and vasotocin genes, complete cds.//7.80E-155//398aa//66%//U90880
BRAMY20271400//RHO-GUANINE NUCLEOTIDE EXCHANGE FACTOR(RHOGEF) (RIP2).//0//946aa//80%//P97433
BRAMY20273960
BRAMY20277140
BRAMY20277170//VOLTAGE-GATED POTASSIUM CHANNEL PROTEIN KV3.2 (KSHIIIA).//1.00E-290//538aa//97%//P22462
BRAMY20280720
BRAMY20284910
BRAMY20285160//COMPLEMENT C3 PRECURSOR [CONTAINS: C3A ANAPHYLATOXIN].//1.90E-79//148aa//100%//P01024
BRAMY20285930
BRAMY20286820
BRAWH10000930
BRAWH20002320//Manduca sexta death-associated small cytoplasmic leucine-rich protein SCLP mRNA, complete cds.//3.50E-18//167aa//31%//AF250910
BRAWH20004600//Mus musculus mRNA for NAKAP95, complete cds.//8.40E-184//336aa//84%//AB028921
BRAWH20011710//cytoplasmic linker 2//1.60E-96//316aa//59%//NP—034120
BRAWH20012390//Trichomonas vaginalis mRNA for centrin (ce1 gene).//4.70E-14//153aa//28%//AJ249457
BRAWH20012410
BRAWH20014920
BRAWH20015350
BRAWH20015890
BRAWH20016620//Homo sapiens mRNA for MOK protein kinase, complete cds.//3.40E-82//160aa//99%//AB022694
BRAWH20016660
BRAWH20016860
BRAWH20017010//Homo sapiens testes development-related NYD-SP22 mRNA, complete cds.//1.00E-23//56aa//92%//AF367474
BRAWH20018730//HYPOTHETICAL 56.4 KDA PROTEIN IN SRS2-SIP4 INTERGENIC REGION.//1.90E-46//503aa//31%//P47026
BRAWH20028110//Homo sapiens actin-binding double-zinc-finger protein (abLIM) mRNA, complete cds.//9.40E-168//416aa//61%//AF005654
BRAWH20029630//Homo sapiens bet3 (BET3) mRNA, complete cds.//2.40E-47//96aa//100%//AF041432
BRAWH20030250
BRAWH20064050//FIBULIN-1, ISOFORM C PRECURSOR.//6.30E-42//337aa//33%//P23144
BRAWH20075700//ZINC FINGER PROTEIN ZFP-1 (MKR1 PROTEIN).//1.60E-159//332aa//84%//P08042
BRAWH20096780//ZINC FINGER PROTEIN 184 (FRAGMENT).//5.00E-140//514aa//52%//Q99676
BRAWH20100690
BRAWH20101360
BRAWH20103180
BRAWH20103290//GUANINE NUCLEOTIDE EXCHANGE FACTOR DBS (DBL'S BIG SISTER) (MCF2 TRANSFORMING SEQUENCE-LIKE PROTEIN) (KIAA0362) (FRAGMENT).//0//756aa//99%//015068
BRAWH20105840//HYPOTHETICAL 27.0 KDA PROTEIN IN SPOOA-MMGA INTERGENIC REGION.//1.70E-21//156aa//32%//P54527
BRAWH20106180
BRAWH20107540
BRAWH20110660
BRAWH20110790
BRAWH20110960//Homo sapiens mRNA for 26S proteasome subunit p40.5, complete cds.//1.50E-175//378aa//90%//AB009398
BRAWH20111550
BRAWH20112940//POLYPEPTIDE N-ACETYLGALACTOSAMINYLTRANSFERASE (EC 2.4.1.41) (PROTEIN-UDP ACETYLGALACTOSAMINYLTRANSFERASE) (UDP-GALNAC:POLYPEPTIDE, N-ACETYLGALACTOSAMINYLTRANSFERASE) (GALNAC-T1).//1.10E-59//369aa//36%//Q07537
BRAWH20113430//COLD-INDUCIBLE RNA-BINDING PROTEIN (GLYCINE-RICH RNA-BINDING PROTEIN CIRP) (A18 HNRNP).//9.30E-52//104aa//96%//Q14011
BRAWH20114000//GLUTAMATE DEHYDROGENASE 1 PRECURSOR (EC 1.4.1.3) (GDH).//5.90E-233//426aa//98%//P00367
BRAWH20117950//LIVER CARBOXYLESTERASE PRECURSOR (EC 3.1.1.1) (PROLINE-BETA-NAPHTHYLAMIDASE).//1.80E-78//364aa//42%//Q29550
BRAWH20118230//BONE MORPHOGENETIC PROTEIN 7 PRECURSOR (BMP-7) (OSTEOGENIC PROTEIN 1) (OP-1).//7.60E-74//85aa//98%//P18075
BRAWH20121640//transporter protein; system N1 Na+ and H+-coupled glutamine transporter//1.00E-106//450aa//61%//NP—006832
BRAWH20122580
BRAWH20122770
BRAWH20125380//DIHYDRODIPICOLINATE SYNTHASE (EC 4.2.1.52) (DHDPS).//6.40E-15//121aa//35%//Q57695
BRAWH20126190
BRAWH20126980
BRAWH20128270//BH3 INTERACTING DOMAIN DEATH AGONIST (BID).//2.70E-100//195aa//99%//P55957
BRAWH20132190//Homo sapiens putative N-acetyltransferase Camello 2 (CML2) mRNA, complete cds.//1.80E-17//110aa//44%//AF185571
BRAWH20137480//actin binding LIM protein 1//2.80E-70//181aa//55%//NP—006710
BRAWH20138660//Homo sapiens stonin 2 mRNA, complete cds.//1.50E-171//322aa//99%//AF255309
BRAWH20139410
BRAWH20142340
BRAWH20147290
BRAWH20149340//GUANINE NUCLEOTIDE RELEASING PROTEIN (GNRP) (P140 RAS-GRF).//4.10E-129//290aa//83%//P28818
BRAWH20155950
BRAWH20158530
BRAWH20160280
BRAWH20162690
BRAWH20164460//TAT-BINDING HOMOLOG 7.//1.60E-95//366aa//54%//P54816
BRAWH20166790
BRAWH20171030//Homo sapiens putative helicase RUVBL mRNA, complete cds.//2.80E-209//324aa//100%//AF218313
BRAWH20173050
BRAWH20182060
BRAWH20185060
BRCAN10001490//chromobox homolog 6//2.10E-40//82aa//100%//NP—055107
BRCAN20003460//outer arm dynein intermediate chain 1//5.60E-57//159aa//49%//T02761
BRCAN20006200
BRCAN20006390
BRCAN20054490//Sus scrofa mRNA for 54 kDa vacuolar H(+)-ATPase subunit, beta isoform.//1.00E-117//229aa//96%//AJ223758
BRCAN20060190
BRCAN20064010
BRCAN20071190//FAF1 PROTEIN (FAS-ASSOCIATED FACTOR 1).//4.00E-225//433aa//96%//P54731
BRCAN20091560//Xenopus laevis mRNA for Nfr1, complete cds.//1.20E-256//605aa//77%//D86491
BRCAN20103740//P2X PURINOCEPTOR 7 (ATP RECEPTOR) (P2×7) (PURINERGIC RECEPTOR) (P2Z RECEPTOR).//2.20E-18//60aa//78%//Q99572
BRCAN20124080
BRCAN20126130
BRCAN20143700
BRCAN20147880
BRCAN20216690
BRCAN20224720//PROTOPORPHYRINOGEN OXIDASE (EC 1.3.3.4) (PPO).//4.40E-132//254aa//100%//P50336
BRCAN20237240
BRCAN20263400
BRCAN20273100
BRCAN20273340
BRCAN20273550
BRCAN20273640//lymphocyte specific formin related protein//3.00E-80//350aa//56%//NP—062653
BRCAN20275130
BRCAN20279700//Homo sapiens copine I mRNA, complete cds.//2.10E-32//82aa//68%//U83246
BRCAN20280210//H. sapiens HZF10 mRNA for zinc finger protein.//3.30E-54//219aa//49%//X78933
BRCAN20280360//Homo sapiens phosphatidic acid phosphohydrolase type-2c mRNA, complete cds.//8.20E-22//213aa//28%//AF047760
BRCAN20280400
BRCAN20283190//CHROMODOMAIN-HELICASE-DNA-BINDING PROTEIN 1 (CHD-1).//1.20E-131//235aa//99%//014646
BRCAN20283380//Mus musculus mRNA for serine hydrolase protein, isoform 2 (serh1 gene).//6.50E-45//103aa//80%//AJ245737
BRCAN20284600
BRCAN20285450
BRCOC10000870
BRCOC20001860//Homo sapiens endoplasmic reticulum alpha-mannosidase I mRNA, complete cds.//6.30E-154//282aa//99%//AF145732
BRCOC20004040//Rattus norvegicus sphingosine 1-phosphate receptor Edg-8 (Edg-8) mRNA, complete cds.//4.80E-108//265aa//81%//AF233649
BRCOC20004870
BRCOC20006370//PUTATIVE SURFACE GLYCOPROTEIN C210RF1 PRECURSOR (C210RF3).//4.00E-67//144aa//88%//P53801
BRCOC20008160//Homo sapiens mRNA for actin binding protein ABP620, complete cds.//4.20E-155//777aa//40%//AB029290
BRCOC20008500//Human ras inhibitor mRNA, 3′ end.//4.60E-229//428aa//100%//M37190
BRCOC20020850
BRCOC20021550//Rattus norvegicus mRNA for Nadrin, complete cds.//1.90E-56//247aa//55%//AB042827
BRCOC20023230
BRCOC20026640
BRCOC20027510//RAS SUPPRESSOR PROTEIN 1 (RSU-1) (RSP-1 PROTEIN) (RSP-1).//2.20E-18//178aa//34%//Q15404
BRCOC20031000
BRCOC20031250//TRIOSEPHOSPHATE ISOMERASE (EC 5.3.1.1) (TIM).//7.10E-38//92aa//82%//P48500
BRCOC20031870
BRCOC20035130//14-3-3 PROTEIN EPSILON (MITOCHONDRIAL IMPORT STIMULATION FACTOR L SUBUNIT) (PROTEIN KINASE C INHIBITOR PROTEIN-1) (KCIP-1) (14-3-3E).//1.00E-29//71aa//88%//P42655
BRCOC20037320//PUTATIVE IMPORTIN BETA-4 SUBUNIT (KARYOPHERIN BETA-4 SUBUNIT).//5.00E-75//937aa//26%//060100
BRCOC20037400
BRCOC20041750
BRCOC20055420//GLYCYLPEPTIDE N-TETRADECANOYLTRANSFERASE 2 (EC 2.3.1.97) (PEPTIDE N-MYRISTOYLTRANSFERASE 2) (MYRISTOYL-COA:PROTEIN N-MYRISTOYLTRANSFERASE 2) (NMT 2).//7.90E-229//421aa//99%//060551
BRCOC20059510//B. taurus myosin IB mRNA, complete CDS.//1.40E-29//117aa//53%//Z22852
BRCOC20074760//CDC4-LIKE PROTEIN (FRAGMENT).//4.50E-90//366aa//48%//P50851
BRCOC20077690
BRCOC20078640
BRCOC20090520
BRCOC20091960//CDC42-binding protein kinase beta (DMPK-like) [Homo sapiens]//1.50E-71//140aa//100%//NP—006026
BRCOC20093800
BRCOC20099370//Homo sapiens SPG protein (SPG) mRNA, complete cds.//0//576aa//97%//AF302154
BRCOC20101230////7.40E-32//227aa//35%//
BRCOC20105100
BRCOC20107300//Homo sapiens GTT1 mRNA, complete cds.//3.60E-44//90aa//98%//AF270647
BRCOC20110100
BRCOC20114180
BRCOC20117690
BRCOC20119960
BRCOC20121720
BRCOC20122290
BRCOC20128130
BRCOC20134480
BRCOC20135730
BRCOC20136750
BRCOC20144000//DNA REPAIR PROTEIN RAD8.//5.50E-14//111aa//36%//P36607
BRCOC20147480
BRCOC20148330
BRCOC20155970
BRCOC20158240
BRCOC20176520//Rattus norvegicus mRNA for type II brain 4.1, complete cds.//2.30E-127//269aa//79%//AB032827
BRCOC20178270//ZINC FINGER PROTEIN 83 (ZINC FINGER PROTEIN HPF1).//4.90E-101//272aa//64%//P51522
BRCOC20178560//PINCH PROTEIN (PARTICULARY INTERESTING NEW CYS-HIS PROTEIN).//9.50E-130//247aa//85%//P48059
BRHIP10001290//Homo sapiens GalNAc-T9 mRNA for UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase, complete cds.//1.10E-108//299aa//63%//AB040672
BRHIP10001740
BRHIP20000870
BRHIP20001630
BRHIP20003120//Homo sapiens reticulon gene family protein (RTN3) mRNA, complete cds.//2.20E-92//190aa//98%//AF059524
BRHIP20005340//GAMMA-INTERFERON-INDUCIBLE PROTEIN IFI-16 (INTERFERON-INDUCIBLE MYELOID DIFFERENTIATION TRANSCRIPTIONAL ACTIVATOR).//2.10E-157//407aa//77%//Q16666
BRHIP20005530//UBIQUITIN-ACTIVATING ENZYME E1 1.//1.00E-59//318aa//41%//Q02053
BRHIP20096170//Homo sapiens cellular repressor of E1A-stimulated genes CREG mRNA, complete cds.//9.70E-35//174aa//39%//AF084523
BRHIP20096850//ALANINE AMINOTRANSFERASE (EC 2.6.1.2) (GLUTAMIC-PYRUVIC TRANSAMINASE) (GPT) (GLUTAMIC—ALANINE TRANSAMINASE).//1.60E-166//423aa//69%//P25409
BRHIP20103090//VACUOLAR ATP SYNTHASE SUBUNIT AC45 PRECURSOR (EC 3.6.1.34) (V-ATPASE AC45 SUBUNIT).//2.00E-12//82aa//47%//P40682
BRHIP20104440
BRHIP20105710
BRHIP20106100//GAR2 PROTEIN.//1.50E-19//199aa//31%//P41891
BRHIP20107440
BRHIP20110800
BRHIP20111200
BRHIP20115080//DYNAMIN 2 (DYNAMIN UDNM).//4.80E-63//123aa//95%//P39054
BRHIP20115760
BRHIP20118380
BRHIP20118910
BRHIP20119330//ZINC FINGER PROTEIN 91 (ZINC FINGER PROTEIN HTF10) (HPF7).//6.80E-207//651aa//54%//Q05481
BRHIP20121410
BRHIP20123140
BRHIP20129720
BRHIP20132860//Homo sapiens rhophilin-like protein mRNA, complete cds.//5.40E-144//298aa//93%//AF268032
BRHIP20135100
BRHIP20137230//Homo sapiens mRNA for paralemin.//1.70E-37//352aa//35%//Y16278
BRHIP20139720
BRHIP20140630
BRHIP20142850
BRHIP20143730
BRHIP20143860
BRHIP20149540
BRHIP20153560
BRHIP20153600//Xenopus laevis RRM-containing protein SEB-4 mRNA, complete cds.//1.50E-72//148aa//93%//AF223427
BRHIP20167880//Mus musculus left-right dynein (Lrd) mRNA, complete cds.//8.10E-22//119aa//54%//AF183144
BRHIP20169680
BRHIP20169900
BRHIP20170100
BRHIP20173150
BRHIP20174040//CGMP-DEPENDENT 3′,5′-CYCLIC PHOSPHODIESTERASE (EC 3.1.4.17) (CYCLIC GMP STIMULATED PHOSPHODIESTERASE) (CGS-PDE).//0//857aa//99%//000408
BRHIP20175420//Mus musculus partial mRNA for stretch responsive protein 278 (sr278 gene).//6.60E-36//170aa//50%//AJ250191
BRHIP20176420//HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEINS C1/C2 (HNRNP C1 AND HNRNP C2).//9.30E-68//292aa//52%//P07910
BRHIP20179200
BRHIP20180140
BRHIP20183690
BRHIP20186120
BRHIP20186500
BRHIP20189980//FLAGELLAR WD-REPEAT PROTEIN PF20.//2.90E-41//210aa//46%//P93107
BRHIP20190070
BRHIP20191490//interferon, alpha-inducible protein 27//2.60E-36//92aa//95%//NP—005523
BRHIP20191770
BRHIP20191860//TRANSCRIPTION FACTOR 4 (IMMUNOGLOBULIN TRANSCRIPTION FACTOR 2) (ITF-2) (SL3-3 ENHANCER FACTOR 2) (SEF-2).//0//569aa//99%//P15884
BRHIP20194940//Homo sapiens A-kinase anchoring protein 220 mRNA, complete cds.//1.30E-23//190aa//37%//AF176555
BRHIP20195890//FORKHEAD BOX PROTEIN D2 (FORKHEAD-RELATED PROTEIN FKHL17) (FORKHEAD-RELATED TRANSCRIPTION FACTOR 9) (FREAC-9).//9.10E-07//104aa//31%//060548
BRHIP20196410
BRHIP20198190
BRHIP20205090
BRHIP20207430
BRHIP20207990
BRHIP20208270
BRHIP20208420
BRHIP20208590
BRHIP20214950
BRHIP20217620
BRHIP20218580//Mus musculus betaPix-b mRNA, complete cds.//5.10E-100//196aa//94%//AF247654
BRHIP20222280//ZINC FINGER PROTEIN 85 (ZINC FINGER PROTEIN HPF4) (HTF1).//1.70E-217//505aa//75%//Q03923
BRHIP20227080
BRHIP20230710
BRHIP20232290
BRHIP20233090
BRHIP20234380
BRHIP20236950
BRHIP20238600//WD-REPEAT PROTEIN SAZD.//3.30E-95//182aa//99%//Q12788
BRHIP20238690
BRHIP20238880
BRHIP20240460
BRHIP20243470//GALECTIN-3 (GALACTOSE-SPECIFIC LECTIN 3) (MAC-2 ANTIGEN) (IGE-BINDING PROTEIN) (35 KDA LECTIN) (CARBOHYDRATE BINDING PROTEIN 35) (CBP 35) (LAMININ-BINDING PROTEIN) (LECTIN L-29).//1.10E-16//114aa//42%//P38486
BRHIP20249110//hexokinase 1//0//912aa//71%//NP—000179
BRHIP20252450//Mus musculus Syne-1B mRNA, partial cds.//1.40E-159//980aa//33%//AF281870
BRHIP20253660//Rattus norvegicus mRNA for Proline Rich Synapse Associated Protein 1A (ProSAP1A gene).//1.90E-120//239aa//92%//AJ249562
BRHIP20254480
BRHIP20277620
BRHIP20283030//CADHERIN-RELATED TUMOR SUPPRESSOR PRECURSOR (FAT PROTEIN).//1.40E-88//881aa//29%//P33450
BRHIP20284800
BRHIP20285830//TYPE III INTERMEDIATE FILAMENT.//8.20E-10//88aa//35%//P23729
BRHIP20285930//Homo sapiens IL-1 receptor accessory protein mRNA, complete cds.//3.30E-08//104aa//32%//AF029213
BRHIP30001110
BRHIP30004570//P-SELECTIN PRECURSOR (GRANULE MEMBRANE PROTEIN 140) (GMP-140) (PADGEM) (CD62P) (LEUKOCYTE-ENDOTHELIAL CELL ADHESION MOLECULE 3) (LECAM3).//3.60E-32//281aa//31%//Q01102
BRHIP30004880//H. sapiens mRNA for titin protein (clone hh1-hh54).//9.60E-85//812aa//26%//X90568
BRSSN10000920
BRSSN20003120//METABOTROPIC GLUTAMATE RECEPTOR PRECURSOR.//7.00E-08//257aa//22%//P91685
BRSSN20006340
BRSSN20013420//histone deacetylase 6 [Homo sapiens] //0//811aa//99%//NP—006035
BRSSN20014260//RIBONUCLEASE INHIBITOR.//1.70E-10//195aa//29%//P29315
BRSSN20015030
BRSSN20015790//ORNITHINE DECARBOXYLASE (EC 4.1.1.17) (ODC).//9.00E-102//352aa//53%//P00860
BRSSN20018690//Homo sapiens NY-REN-25 antigen mRNA, partial cds.//9.30E-41//88aa//100%//AF155103
BRSSN20021600//RING CANAL PROTEIN (KELCH PROTEIN).//3.60E-59//510aa//31%//Q04652
BRSSN20028570
BRSSN20038200//RAL GUANINE NUCLEOTIDE DISSOCIATION STIMULATOR-LIKE 2 (RALGDS-LIKE FACTOR) (RAS-ASSOCIATED PROTEIN RAB2L).//3.90E-18//458aa//25%//015211
BRSSN20038410
BRSSN20039370//ZINC FINGER PROTEIN 7 (ZINC FINGER PROTEIN KOX4) (ZINC FINGER PROTEIN HF. 16).//2.50E-38//94aa//52%//P17097
BRSSN20043040
BRSSN20046570
BRSSN20046790//ZINC FINGER PROTEIN 135.//8.60E-81//231aa//60%//P52742
BRSSN20046860
BRSSN20066110//Homo sapiens mRNA for mucolipidin, short form (ML4 gene).//1.70E-26//121aa//49%//AJ293659
BRSSN20097020
BRSSN20101100//GRG PROTEIN (ESP1 PROTEIN) (AMINO ENHANCER OF SPLIT) (AES-1/AES-2).//2.50E-10//70aa//51%//Q08117
BRSSN20105870
BRSSN20105960
BRSSN20108300
BRSSN20117990
BRSSN20120810//SERINE PROTEASE HEPSIN (EC 3.4.21.-) (TRANSMEMBRANE PROTEASE, SERINE 1).//9.80E-144//254aa//100%//P05981
BRSSN20121030
BRSSN20137020
BRSSN20142940
BRSSN20146100//ADENYLATE CYCLASE, OLFACTIVE TYPE (EC 4.6.1.1) (ADENYLATE CYCLASE TYPE III) (ATP PYROPHOSPHATE-LYASE) (ADENYLYL CYCLASE).//0//389aa//90%//P21932
BRSSN20151990
BRSSN20152380
BRSSN20159070
BRSSN20159820
BRSSN20169050
BRSSN20176820//Mus musculus p300 transcriptional cofactor JMY mRNA, complete cds.//8.50E-297//640aa//89%//AF201390
BRSSN20177570
BRSSN20187310//ANKYRIN 1 (ERYTHROCYTE ANKYRIN) (ANKYRIN R) (ANKYRINS 2.1 AND 2.2).//3.20E-26//306aa//30%//P16157
BRSTN10000830
BRSTN20000580
BRSTN20002200
BRSTN20005360//TRANSLATION INITIATION FACTOR IF-2.//1.20E-07//205aa//26%//060841
BRTHA20000570
BRTHA20004740//HYPOTHETICAL 41.6 KDA PROTEIN IN IMP1-HLJ1INTERGENIC REGION (RF1095).//1.60E-16//310aa//27%//P28625
BRTHA20046290//NOVEL ANTIGEN 2 (NAG-2) (TSPAN-4).//7.30E-84//153aa//100%//014817
BRTHA20046390
BRTHA20046420 CD34C30001250 CD34C30003140 CD34C30004240//H. sapiens graf gene.//1.10E-140//270aa//100%//Y10388 CD34C30004940
COLON10001350//IG ALPHA-1 CHAIN C REGION.//1.70E-196//353aa//99%//P01876
COLON20043180
COLON20093370
CTONG10000100//GUFA PROTEIN.//2.10E-31//156aa//45%//Q06916
CTONG10000220//Mus musculus cerebellar postnatal development protein-1 (Cpd1) mRNA, partial cds.//1.80E-101//220aa//90%//U89345
CTONG10000620
CTONG10000930
CTONG10000940//CYCLIN-DEPENDENT KINASE 6 INHIBITOR(P18-INK6) (CYCLIN-DEPENDENT KINASE 4 INHIBITOR C) (P18-INK4C).//7.20E-13//131aa//35%//Q60772
CTONG10001650
CTONG10002770//PLECTIN.//2.00E-49//284aa//28%//P30427
CTONG20002180
CTONG20004690//CYTOCHROME B561 (CYTOCHROME B-561).//2.80E-50//101aa//100%//P49447
CTONG20009770//26S PROTEASOME REGULATORY SUBUNIT S2 (P97) (TUMOR NECROSIS FACTOR TYPE 1 RECEPTOR ASSOCIATED PROTEIN 2) (55.11 PROTEIN).//0//908aa//99%//Q13200
CTONG20014280//Xenopus laevis fizzy1 mRNA, complete cds.//2.00E-82//479aa//38%//AF034578
CTONG20027090
CTONG20028410
CTONG20038890
CTONG20049410
CTONG20050280//ZINC FINGER PROTEIN ZFP-36 (FRAGMENT).//8.00E-149//490aa//55%//P16415
CTONG20052650//BYSTIN.//5.10E-60//120aa//99%//Q13895
CTONG20052900//FASCIN (ACTIN BUNDLING PROTEIN).//7.30E-257//437aa//98%//Q16658
CTONG20075860//Homo sapiens mRNA for SPIN protein.//3.90E-123//204aa//69%//Y14946
CTONG20076130//ZINC FINGER PROTEIN 185 (LIM-DOMAIN PROTEIN ZNF185) (P1-A).//1.10E-158//327aa//89%//015231
CTONG20077790
CTONG20082690
CTONG20085950//ZINC FINGER PROTEIN 191.//5.80E-91//346aa//53%//014754
CTONG20091080//HOMEOBOX PROTEIN DLX-1.//1.00E-54//134aa//84%//Q64317
CTONG20091320
CTONG20092570//Rattus norvegicus neural membrane protein 35 mRNA, complete cds.//1.00E-55//300aa//49%//AF044201
CTONG20092580
CTONG20092680//Rattus norvegicus protein associating with small stress protein PASS1 (Pass1) mRNA, complete cds.//1.40E-11//98aa//40%//AF168362
CTONG20092700//Mus musculus transcriptional repressor RP58 (rp58) mRNA, complete cds.//6.60E-18//162aa//35%//AF140224
CTONG20093950//Mus musculus zfh-4 mRNA for zinc-finger homeodomain protein 4, complete cds.//0//473aa//90%//AB024499
CTONG20095270
CTONG20095290
CTONG20095340//PROBABLE CATION-TRANSPORTING ATPASE WO8D2.5 IN CHROMOSOME IV (EC 3.6.1.-).//3.90E-134//500aa//37%//Q27533
CTONG20096430
CTONG20096750
CTONG20097660
CTONG20098440
CTONG20099380
CTONG20099550//TRICHOHYALIN.//4.20E-16//534aa//25%//Q07283
CTONG20099630
CTONG20100240//Mus musculus radial spokehead-L protein (Rshl1) mRNA, complete cds.//1.60E-185//520aa//63%//AF329192
CTONG20101480
CTONG20103480
CTONG20105080
CTONG20105660
CTONG20106230
CTONG20106520//THREONINE SYNTHASE (EC 4.2.99.2).//6.70E-77//347aa//40%//Q42598
CTONG20108210
CTONG20114290//PUTATIVE IMPORTIN BETA-4 SUBUNIT (KARYOPHERIN BETA-4 SUBUNIT).//1.30E-75//937aa//27%//060100
CTONG20114740//Homo sapiens NY-REN-57 antigen mRNA, partial cds.//1.70E-37//72aa//100%//AF155114
CTONG20118150//HYPOTHETICAL 100.6 KDA TRP-ASP REPEATS CONTAINING PROTEIN C1672.07 IN CHROMOSOME III.//2.10E-150//910aa//36%//014053
CTONG20118250//CARBONIC ANHYDRASE (EC 4.2.1.1) (CARBONATE DEHYDRATASE).//3.30E-88//257aa//62%//Q92051
CTONG20119200//Homo sapiens NY-REN-57 antigen mRNA, partial cds.//1.00E-18//41aa//100%//AF155114
CTONG20120770
CTONG20121010//ZINC FINGER PROTEIN 29 (ZFP-29).//7.80E-131//380aa//58%//Q07230
CTONG20121580//KINESIN-LIKE PROTEIN KIF1A.//3.50E-148//395aa//59%//P33173
CTONG20124010
CTONG20124220//STEROL REGULATORY ELEMENT BINDING PROTEIN-1 (SREBP-1) (STEROL REGULATORY ELEMENT-BINDING TRANSCRIPTION FACTOR 1).//0//691aa//98%//P36956
CTONG20124470
CTONG20124730
CTONG20125540//PTB-ASSOCIATED SPLICING FACTOR (PSF).//6.90E-07//144aa//29%//P23246
CTONG20125640//60S ACIDIC RIBOSOMAL PROTEIN PO (L10E).//7.50E-137//306aa//89%//P05388
CTONG20126070
CTONG20127450//H. sapiens mRNA for Ndr protein kinase.//4.50E-11//37aa//89%//Z35102
CTONG20128430//Human non-lens beta gamma-crystallin like protein (AIM1) mRNA, partial cds.//8.40E-127//616aa//40%//U83115
CTONG20128470
CTONG20129960//Mus musculus F-box protein FBX18 mRNA, partial cds.//0//905aa//92%//AF184275
CTONG20131490
CTONG20131560//NEUROBLAST DIFFERENTIATION ASSOCIATED PROTEIN AHNAK (DESMOYOKIN) (FRAGMENTS).//0//632aa//99%//Q09666
CTONG20132220
CTONG20133390//ZINC FINGER PROTEIN 135.//1.00E-139//416aa//57%//P52742
CTONG20133480
CTONG20133520//ZINC FINGER PROTEIN 228.//1.50E-163//670aa//50%//Q9UJU3
CTONG20136300
CTONG20138030
CTONG20139070
CTONG20139340
CTONG20139860//Homo sapiens nasopharyngeal carcinoma susceptibility protein LZ16 mRNA, complete cds.//3.50E-17//162aa//36%//AF121775
CTONG20140320
CTONG20140580//HepA-related protein//8.80E-61//345aa//42%//NP—054859
CTONG20141650
CTONG20143690
CTONG20146300
CTONG20146970
CTONG20147050
CTONG20149460//RING CANAL PROTEIN (KELCH PROTEIN).//1.20E-56//556aa//27%//Q04652
CTONG20149950
CTONG20150910
CTONG20153300//H. sapiens mRNA for tre oncogene (clone 210).//4.80E-214//259aa//78%//X63546
CTONG20153580//Homo sapiens leucine-rich repeats containing F-box protein FBL3 mRNA, complete cds.//4.80E-37//326aa//28%//AF186273
CTONG20155180
CTONG20155400
CTONG20156780//Rattus norvegicus PGC1 mRNA for PPAR gamma coactivator, complete cds.//1.80E-72//176aa//46%//AB025784
CTONG20158040//UDP-N-ACETYLGLUCOSAMINE PYROPHOSPHORYLASE (EC 2.7.7.23) (ANTIGEN X) (AGX) (AGX-1) (SPERM-ASSOCIATED ANTIGEN 2).//4.90E-126//376aa//61%//Q16222
CTONG20158150
CTONG20158660//Rattus norvegicus mRNA for seven transmembrane receptor, complete cds.//5.90E-99//632aa//36%//AB019120
CTONG20159530//GLYPICAN-1 PRECURSOR.//3.40E-118//222aa//100%//P35052
CTONG20160560
CTONG20161850
CTONG20162170
CTONG20163550
CTONG20164990
CTONG20165050
CTONG20186320//RING CANAL PROTEIN (KELCH PROTEIN).//3.70E-19//290aa//26%//Q04652
CTONG20200310//mitotic control protein dis3 homolog//1.20E-113//655aa//36%//JE0110
CTONG20265130
CTONG20267700
CTONG20273610
D3OST10001090
D3OST10002670
D3OST10002700
D3OST20006180//Drosophila melanogaster slingshot mRNA, complete cds.//9.20E-114//358aa//56%//AB036834
D3OST20006540
D3OST20007340
D3OST20013280//ARP2/3 COMPLEX 16 KDA SUBUNIT (P16-ARC).//1.10E-48//103aa//99%//015511
D3OST20024170
D3OST20024360//Homo sapiens neuroendocrine differentiation factor mRNA, complete cds.//4.70E-35//80aa//100%//AF219226
D3OST20024520
D3OST20036070
D3OST20037970
D3OST20038560
D3OST30002580
D3OST30002910
D6OST20003580//H. sapiens mRNA for aminopeptidase P-like.//7.40E-70//103aa//99%//X95762
D6OST20004450
D6OST20005070
D9OST20000310
D9OST20002780
D9OST20015470//Mus musculus MPS1 gene and mRNA, 3′end.//4.60E-147//329aa//79%//L20315
D9OST20023970//CARTILAGE GLYCOPROTEIN-39 PRECURSOR (GP-39) (39 KDA SYNOVIAL PROTEIN) (YKL-40) (CHITINASE-3 LIKE 1).//1.30E-17//44aa//90%//P36222
D9OST20026730//Homo sapiens caspase recruitment domain protein 7 mRNA, complete cds.//2.40E-141//524aa//40%//AF298548
D9OST20031370//Homo sapiens mRNA for partial putative TCPTP-interacting protein (ptpip5 gene).//3.40E-39//176aa//48%//AJ242719
D9OST20033970//ZINC FINGER PROTEIN 91 (ZINC FINGER PROTEIN HTF10) (HPF7).//2.50E-152//541aa//52%//Q05481
D9OST20035800
D9OST20035940//BRAIN MITOCHONDRIAL CARRIER PROTEIN-1.//9.10E-93//216aa//80%//095258
D9OST20040180//OLFACTORY RECEPTOR-LIKE PROTEIN OLF4.//1.20E-106//301aa//64%//Q95157
DFNES10000030
DFNES10001850
DFNES20001530//ATAXIN 7 (SPINOCEREBELLAR ATAXIA TYPE 7 PROTEIN).//2.30E-25//98aa//57%//015265
DFNES20010910
DFNES20014040//TRICHOHYALIN.//1.70E-17//380aa//26%//P37709
DFNES20025880
DFNES20031920//Drosophila melanogaster mRNA for fucosyltransferase homologue (FucTB gene).//8.40E-18//133aa//36%//AJ302046
DFNES20037420//G1 TO S PHASE TRANSITION PROTEIN 1 HOMOLOG (GTP-BINDING PROTEIN GST1-HS).//1.00E-274//499aa//99%//P15170
DFNES20055270
DFNES20071130//PHOSPHOTRIESTERASE RELATED PROTEIN (PARATHION HYDROLASE-RELATED PROTEIN).//4.40E-141//233aa//86%//Q60866
DFNES20082800
FCBBF10000240
FCBBF10000380
FCBBF10000630//Homo sapiens huntingtin interacting protein HYPB mRNA, partial cds.//3.70E-16//36aa//100%//AF049610
FCBBF10000770//Homo sapiens REC8 mRNA, partial cds.//6.10E-266//528aa//96%//AF132734
FCBBF10001150//Homo sapiens protocadherin beta 14 (PCDH-beta14) mRNA, complete cds.//4.10E-308//717aa//79%//AF152493
FCBBF10001210//Homo sapiens mRNA for SHPS-1, complete cds.//6.90E-22//135aa//43%//D86043
FCBBF10001550
FCBBF10001710//ZINC FINGER PROTEIN 83 (ZINC FINGER PROTEIN HPF1).//1.90E-131//397aa//59%//P51522
FCBBF10001820//CITRATE LYASE BETA CHAIN (EC 4.1.3.6) (CITRASE) (CITRYL-COA LYASE SUBUNIT) (EC 4.1.3.34).//3.70E-32//294aa//27%//053078
FCBBF10002430
FCBBF10002700
FCBBF10002800
FCBBF10003220
FCBBF10003670//QUEUINE TRNA-RIBOSYLTRANSFERASE (EC 2.4.2.29) (TRNA-GUANINE TRANSGLYCOSYLASE) (GUANINE INSERTION ENZYME).//2.60E-195//308aa//100%//P54578
FCBBF10003740
FCBBF10003760
FCBBF10003770//Homo sapiens mRNA for GRIP1 protein.//0//572aa//99%//AJ133439
FCBBF10004120
FCBBF10004370//ZINC FINGER PROTEIN 33A (ZINC FINGER PROTEIN KOX31) (KIAA0065) (HA0946) (FRAGMENT).//3.30E-96//292aa//52%//Q06730
FCBBF10005060//CELLULAR RETINALDEHYDE-BINDING PROTEIN (CRALBP).//8.40E-51//260aa//41%//P10123
FCBBF10005460//Mus musculus putative neuronal cell adhesion molecule (Punc) mRNA, complete cds.//9.20E-275//484aa//94%//AF026465
FCBBF10005500
FCBBF10005740//MITOCHONDRIAL CARRIER PROTEIN YMC2 PRECURSOR.//1.10E-27//194aa//38%//P38087
FCBBF20006780
FCBBF20014270//ACYL-COA-BINDING PROTEIN (ACBP) (DIAZEPAM BINDING INHIBITOR) (DBI) (ENDOZEPINE) (EP).//1.40E-34//85aa//81%//P45882
FCBBF20023700
FCBBF20032970
FCBBF20035280
FCBBF20042170//Homo sapiens NIBAN mRNA, complete cds.//1.90E-177//345aa//100%//AB050477
FCBBF20042560
FCBBF20049300//NEURONAL OLFACTOMEDIN-RELATED ER LOCALIZED PROTEIN PRECURSOR (NOEL) (1B426B).//7.70E-64//187aa//63%//Q62609
FCBBF20051220
FCBBF20054280
FCBBF20056370
FCBBF20059090//ZINC FINGER PROTEIN 44 (ZINC FINGER PROTEIN KOX7) (FRAGMENT).//2.00E-08//96aa//34%//P15621
FCBBF20064520//HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEINS C1/C2 (HNRNP C1 AND HNRNP C2).//5.50E-70//293aa//53%//P07910
FCBBF20067810//SPOOB-ASSOCIATED GTP-BINDING PROTEIN.//1.30E-51//275aa//42%//P20964
FCBBF20068820//ZINC FINGER PROTEIN 83 (ZINC FINGER PROTEIN HPF1).//1.50E-74//216aa//62%//P51522
FCBBF20071860
FCBBF20072650
FCBBF20075560
FCBBF20076330
FCBBF30001840
FCBBF30007680//Homo sapiens general transcription factor 2-I (GTF2I) mRNA, alternatively spliced product, complete cds.//4.80E-56//141aa//72%//AF038968
FCBBF30008470
FCBBF30010810//ZINC FINGER PROTEIN 85 (ZINC FINGER PROTEIN HPF4) (HTF1).//7.10E-173//436aa//70%//Q03923
FCBBF30012350//CALCIUM/CALMODULIN-DEPENDENT PROTEIN KINASE TYPE II GAMMA CHAIN (CAM-KINASE II GAMMA CHAIN) (EC 2.7.1.123) (CAMK-II, GAMMA SUBUNIT).//8.80E-143//291aa//92%//P11730
FCBBF30012810//Homo sapiens ubiquitin-specific processing protease mRNA, complete cds.//1.10E-123//450aa//49%//AF229438
FCBBF30013770//Rattus norvegicus dnchc2 mRNA for cytoplasmic dynein heavy chain, complete cds.//0//806aa//93%//AB041881
FCBBF30015940//Chlamydomonas reinhardtii dhc1 gene for 1-alpha dynein heavy chain.//4.90E-228//831aa//52%//AJ243806
FCBBF30016320
FCBBF30016570
FCBBF30018550//Homo sapiens putative zinc finger protein mRNA, complete cds.//9.40E-90//560aa//35%//AF251039
FCBBF30019120
FCBBF30024750//SEMAPHORIN 4F PRECURSOR (SEMAPHORIN W) (SEMA W).//2.00E-73//129aa//100%//095754
FCBBF30025560//NERVOUS-SYSTEM SPECIFIC OCTAMER-BINDING TRANSCRIPTION FACTOR N-OCT 3 (BRAIN-SPECIFIC HOMEOBOX/POU DOMAIN PROTEIN 2) (BRN-2 PROTEIN) [CONTAINS: N-OCT 5A; N-OCT 5B].//4.30E-171//203aa//100%//P20265
FCBBF30028180
FCBBF30033050
FCBBF30039020//GROWTH-ARREST-SPECIFIC PROTEIN 2.//1.80E-68//194aa//64%//043903
FCBBF30049550//ANKYRIN 2 (BRAIN ANKYRIN) (ANKYRIN B) (ANKYRIN, NONERYTHROID).//0//1016aa//99%//Q01484
FCBBF30052180
FCBBF30054440
FCBBF30057290//Homo sapiens GIOT-4 mRNA for gonadotropin inducible transcription repressor-4, complete cds.//8.90E-258//642aa//68%//AB021644
FCBBF30062880
FCBBF30070770
FCBBF30071520
FCBBF30078290
FCBBF30083620//PLEXIN 4 PRECURSOR (TRANSMEMBRANE PROTEIN SEX).//5.80E-146//344aa//77%//P51805
FCBBF30083820//Homo sapiens C2H2 (Kruppe1-type) zinc finger protein mRNA, complete cds.//1.50E-14//142aa//38%//AF159567
FCBBF30086440
FCBBF30090690//Homo sapiens HT017 mRNA, complete cds.//8.60E-54//311aa//38%//AF225421
FCBBF30095260
FCBBF30123470
FCBBF30129630//ZINC FINGER PROTEIN 85 (ZINC FINGER PROTEIN HPF4) (HTF1).//9.50E-98//228aa//73%//Q03923
FCBBF30170590
FCBBF30172550
FCBBF30175310//ETHANOLAMINEPHOSPHOTRANSFERASE (EC 2.7.8.1) (ETHPT).//2.10E-38//401aa//28%//P22140
FCBBF30178730
FCBBF30189490
FCBBF30190850//E-SELECTIN PRECURSOR (ENDOTHELIAL LEUKOCYTE ADHESION MOLECULE 1) (ELAM-1) (LEUKOCYTE-ENDOTHELIAL CELL ADHESION MOLECULE 2) (LECAM2) (CD62E).//6.10E-30//275aa//31%//P16581
FCBBF30195640//Homo sapiens ALR-like protein mRNA, complete cds.//9.10E-188//331aa//99%//AF264750
FCBBF30199610
FCBBF30215060
FCBBF30225660
FCBBF30233680
FCBBF30238870//PROTEIN KINASE C-BINDING PROTEIN NELL2 PRECURSOR (NEL-LIKE PROTEIN 2).//O//641aa//99%//Q99435
FCBBF30240020
FCBBF30240960//ZINC FINGER PROTEIN 136.//8.30E-131//338aa//65%//P52737
FCBBF30242250
FCBBF30243640//PROTEIN ARGININE N-METHYLTRANSFERASE 2 (EC 2.1.1.-).//6.40E-53//102aa//100%//P55345
FCBBF30246230//Homo sapiens C2H2 (Kruppe1-type) zinc finger protein mRNA, complete cds.//7.10E-17//141aa//40%//AF159567
FCBBF30246630//H. sapiens mRNA for ZYG homologue.//4.80E-60//562aa//29%//X99802
FCBBF30247930//Rattus norvegicus clone C42 CDK5 activator-binding protein mRNA, complete cds.//2.70E-73//162aa//87%//AF177477
FCBBF30250730//TRICHOHYALIN.//1.30E-10//240aa//27%//P22793
FCBBF30251420
FCBBF30252520//Homo sapiens bicaudal-D (BICD) mRNA, alternatively spliced, partial cds.//2.50E-47//103aa//98%//U90030
FCBBF30252800//NDRG1 PROTEIN (DIFFERENTIATION-RELATED GENE 1 PROTEIN) (DRG1) (REDUCING AGENTS AND TUNICAMYCIN-RESPONSIVE PROTEIN) (RTP) (NICKEL-SPECIFIC INDUCTION PROTEIN CAP43).//1.30E-134//260aa//97%//Q92597
FCBBF30252850//Mus musculus peripherial benzodiazepine receptor associated protein (Pap7) mRNA, complete cds.//2.90E-46//185aa//50%//AF022770
FCBBF30262360
FCBBF30262510
FCBBF30266780
FCBBF30266920
FCBBF30278630
FCBBF30279030//Homo sapiens BNPI mRNA for brain-specific Na-dependent inorganic phosphate cotransporter, complete cds.//2.40E-120//222aa//100%//AB032436
FCBBF30281880//regulator of G-protein signalling 7 [Homo sapiens].//2.00E-05//100aa//33%//NP—002915
FCBBF30284720
FCBBF30285280
FCBBF40001420
FCBBF40001730//GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT-LIKE PROTEIN 12.3 (P205) (RECEPTOR OF ACTIVATED PROTEIN KINASE C 1) (RACK1).//4.20E-120//265aa//84%//P25388
FCBBF40005480
FEBRA10001880//Homo sapiens serine/threonine kinase mRNA, complete cds.//4.60E-106//344aa//53%//AF005046
FEBRA10001900
FEBRA20002100//D-XYLOSE-PROTON SYMPORTER (D-XYLOSE TRANSPORTER).//2.00E-13//159aa//27%//052733
FEBRA20003210
FEBRA20004620//RAP1 GTPASE ACTIVATING PROTEIN 1 (RAP1GAP).//1.50E-46//208aa//43%//P47736
FEBRA20007620//PUTATIVE PRE-mRNA SPLICING FACTOR ATP-DEPENDENT RNA HELICASE SPBC16H, 5.10; C.//2.30E-126//692aa//39%//042945
FEBRA20009090
FEBRA20010120//CLEAVAGE STIMULATION FACTOR, 64 KDA SUBUNIT (CSTF 64 KDA SUBUNIT) (CF-1 64 KDA SUBUNIT).//1.10E-73//137aa//97%//P33240
FEBRA20017050
FEBRA20018280
FEBRA20018690//ZINC FINGER PROTEIN 44 (ZINC FINGER PROTEIN KOX7) (FRAGMENT).//2.00E-08//96aa//34%//P15621
FEBRA20024100//Rattus norvegicus myosin heavy chain Myr 8 mRNA, complete cds.//0//863aa//78%//AF209114
FEBRA20025270
FEBRA20025520
FEBRA20026110//ZINC FINGER PROTEIN 91 (ZINC FINGER PROTEIN HTF10) (HPF7).//1.10E-217//810aa//48%//Q05481
FEBRA20026280
FEBRA20027810
FEBRA20029860
FEBRA20034360
FEBRA20034680//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//5.60E-93//481aa//35%//P51523
FEBRA20037260
FEBRA20037500
FEBRA20040530//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//3.30E-115//335aa//54%//P51523
FEBRA20042190
FEBRA20052910
FEBRA20060610
FEBRA20072120
FEBRA20079310
FEBRA20080810//Rattus norvegicus mRNA for peptide/histidine transporter, complete cds.//1.30E-107//239aa//87%//AB000280
FEBRA20082010//ZINC FINGER PROTEIN 195.//0//482aa//99%//014628
FEBRA20082100
FEBRA20086620//NEURONAL OLFACTOMEDIN-RELATED ER LOCALIZED PROTEIN PRECURSOR (NOEL) (1B426B).//3.80E-165//453aa//65%//Q62609
FEBRA20088360//ALPHA-ADAPTIN C (CLATHRIN ASSEMBLY PROTEIN COMPLEX 2 ALPHA-C LARGE CHAIN) (100 KDA COATED VESICLE PROTEIN C) (PLASMA MEMBRANE ADAPTOR HA2/AP2 ADAPTIN ALPHA C SUBUNIT).//5.60E-05//58aa//53%//P17427
FEBRA20090290
FEBRA20092890//Rattus norvegicus neural cell adhesion protein BIG-2 precursor (BIG-2) mRNA, complete cds.//0//697aa//93%//U35371
FEBRA20093520
FEBRA20095140
FEBRA20095880
FEBRA20097310//Human Hsp27 ERE-TATA-binding protein (HET) mRNA, complete cds.//0//597aa//97%//U72355
FEBRA20098460
FEBRA20111460
FEBRA20113560//R. norvegicus mRNA for DRM protein.//5.10E-65//157aa//80%//Y10019
FEBRA20125070
FEBRA20130190//UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3//8.20E-65//345aa//42%//NP—055071
FEBRA20132740//Homo sapiens mRNA for CDEP, complete cds.//3.70E-16//40aa//92%//AB008430
FEBRA20140100//RER1 PROTEIN.//3.20E-106//196aa//99%//015258
FEBRA20144170//RIBOSOMAL PROTEIN S6 KINASE II ALPHA 2 (EC 2.7.1.-) (S6KII-ALPHA 2) (P90-RSK 2) (RIBOSOMAL S6 KINASE 3) (RSK3) (PP90RSK3).//1.30E-269//495aa//99%//Q15349
FEBRA20145780
FEBRA20161120
FEBRA20166540
FEBRA20167390//Mus musculus ST6GalNAc V mRNA for GD1 alpha synthase, complete cds.//9.40E-64//134aa//91%//AB030836
FEBRA20171380//ZINC FINGER PROTEIN 33A (ZINC FINGER PROTEIN KOX31) (KIAA0065) (HA0946) (FRAGMENT).//6.30E-127//415aa//48%//Q06730
FEBRA20174410//Mus musculus mRNA for nuclear protein ZAP, complete cds.//2.30E-193//543aa//69%//AB033168
FEBRA20176800
FEBRA20184330//Rattus norvegicus glutamate receptor interacting protein 2 (GRIP2) mRNA, complete cds.//8.10E-72//161aa//88%//AF072509
FEBRA20192420
FEBRA20195820//ZINC FINGER PROTEIN 132.//2.60E-47//134aa//63%//P52740
FEBRA20196370
FEBRA20196630//RNA helicase-related protein//0//317aa//100%//NP—031398
FEBRA20197110
FEBRA20204000
FEBRA20204060
FEBRA20211710
FEBRA20214970
FEBRA20215500//Mus musculus Nulp1 (nulp1) mRNA, complete cds.//1.80E-38//146aa//64%//U94988
FEBRA20216360
FEBRA20222040
FEBRA20223220//Homo sapiens mRNA for fibulin-4.//9.20E-110//202aa//100%//AJ132819
FEBRA20225040//high-glucose-regulated protein 8//1.40E-110//514aa//51%//NP—057342
FEBRA20226010
FEBRA20229560
FEBRA20229630
FEBRA20232850
FEBRA20233770//NEURONAL PAS DOMAIN PROTEIN 2 (NEURONAL PAS2) (MEMBER OF PAS PROTEIN 4) (MOP4).//6.30E-62//164aa//81%//Q99743
FEBRA20235500//P3 PROTEIN.//5.20E-74//391aa//39%//P09131
FEBRA20237640//Rattus norvegicus neurabin mRNA, complete cds.//9.10E-29//172aa//46%//U72994
FEHRT20003250//PHOSPHATIDYLINOSITOL 4-KINASE ALPHA (EC 2.7.1.67) (PI4-KINASE) (PTDINS-4-KINASE) (PI4K-ALPHA).//2.20E-146//269aa//100%//P42356
FELNG20002410
HCASM10000500//TOPOISOMERASE 1-RELATED PROTEIN TRF5.//3.70E-09//193aa//22%//P48561
HCHON10001760//histone deacetylase 5//1.00E-133//320aa//67%//NP—005465
HCHON20000380
HCHON20001560//TRANSCRIPTION FACTOR-LIKE PROTEIN MORF4.//7.20E-116//235aa//93%//Q9Y690
HCHON20002260
HCHON20003220//10-FORMYLTETRAHYDROFOLATE DEHYDROGENASE (EC 1.5.1.6) (10-FTHFDH) (FBP-CI).//2.30E-302//731aa//72%//P28037
HCHON20003440//Homo sapiens cyclin-D binding Myb-like protein mRNA, complete cds.//1.30E-64//155aa//87%//AF084530
HCHON20007380//Homo sapiens mRNA for HELG protein.//3.90E-129//331aa//76%//AJ277291
HCHON20007510//rab6 GTPase activating protein (GAP and centrosome-associated)//O//765aa//62%//NP—036329
HCHON20008150
HCHON20008180
HCHON20008320//ZINC FINGER PROTEIN 135.//2.20E-130//345aa//62%//P52742
HCHON20008980
HCHON20009350
HCHON20009560//ZINC FINGER PROTEIN 74.//1.50E-22//113aa//46%//Q16587
HCHON20010990
HCHON20011160
HCHON20014970
HCHON20015230//Homo sapiens nuclear pore-associated protein (NPAP60L) mRNA, complete cds.//1.40E-78//158aa//97%//AF107840
HCHON20015350//PUTATIVE RRNA METHYLTRANSFERASE SPB1 (EC 2.1.1.-).//1.90E-117//771aa//36%//P25582
HCHON20015980//Homo sapiens integrin alpha 11 subunit precursor (ITGA11) mRNA, complete cds.//1.00E-227//419aa//99%//AF137378
HCHON20016040//INSULIN-LIKE GROWTH FACTOR BINDING PROTEIN 3 PRECURSOR (IGFBP-3) (IBP-3) (IGF-BINDING PROTEIN 3).//2.00E-21//45aa//97%//P17936
HCHON20016650//Mus musculus seven-pass transmembrane receptor precursor (Celsr1) mRNA, complete cds.//6.20E-27//343aa//27%//AF031572
HCHON20022470
HCHON20035130//ZINC FINGER PROTEIN 22 (ZINC FINGER PROTEIN KOX15) (FRAGMENT).//1.10E-18//64aa//56%//P17026
HCHON20036420//Homo sapiens mRNA for PED phosphoprotein.//1.30E-64//130aa//100%//Y13736
HCHON20036760
HCHON20040020//TNF-INDUCIBLE PROTEIN CG12—1.//8.80E-40//302aa//36%//095236
HCHON20043590
HCHON20059870//Hypothetical protein.//4.20E-204//667aa//56%//AL163279
HCHON20064590//ALPHA-2-MACROGLOBULIN PRECURSOR (ALPHA-2-M).//5.00E-38//654aa//27%//P01023
HCHON20067220
HCHON20067700//Homo sapiens gremlin mRNA, complete cds.//5.70E-76//106aa//99%//AF045800
HCHON20068410//Drosophila melanogaster microtubule associated protein (asp) mRNA, complete cds.//8.10E-47//803aa//27%//U95171
HCHON20068710
HCHON20074820
HCHON20076500
HCHON20086720//INSULIN-LIKE GROWTH FACTOR BINDING PROTEIN 3 PRECURSOR (IGFBP-3) (IBP-3) (IGF-BINDING PROTEIN 3).//4.10E-113//205aa//100%//P17936
HCHON20097490//dedicator of cyto-kinesis 1//1.00E-154//860aa//37%//NP—001371
HCHON20100740//LACTADHERIN PRECURSOR (MILK FAT GLOBULE-EGF FACTOR 8) (MFG-E8) (HMFG) (BREAST EPITHELIAL ANTIGEN BA46) (MFGM) [CONTAINS: MEDIN].//1.60E-205//363aa//99%//Q08431
HEART20003060//BASIGIN PRECURSOR (LEUKOCYTE ACTIVATION ANTIGEN M6) (COLLAGENASE STIMULATORY FACTOR) (EXTRACELLULAR MATRIX METALLOPROTEINASE INDUCER) (EMMPRIN) (5F7) (CD147 ANTIGEN).//1.30E-132//248aa//100%//P35613
HEART20005410
HEART20017730//ANKYRIN 2 (BRAIN ANKYRIN) (ANKYRIN B) (ANKYRIN, NONERYTHROID).//2.40E-25//368aa//30%//Q01484
HEART20021840
HEART20025980//Homo sapiens smoothelin large isoform L2 (SMTN) mRNA, complete cds.//9.00E-152//223aa//97%//AF064238
HEART20034320//ENDOGLUCANASE Z PRECURSOR (EC 3.2.1.4) (ENDO-1,4-BETA-GLUCANASE) (THERMOACTIVE CELLULASE) (AVICELASE I).//1.20E-64//480aa//32%//P23659
HEART20037810
HEART20049400
HEART20049410//Homo sapiens cerberus-related protein (CER1) gene, complete cds.//1.10E-12//144aa//29%//AF090189
HEART20049800
HEART20061950//Homo sapiens mRNA for myopodin.//1.30E-28//327aa//35%//AJ010482
HEART20063340
HEART20067870
HEART20067890
HEART20072310
HEART20074430
HEART20077670//Mus musculus mRNA for E-MAP-115 protein.//1.70E-50//363aa//41%//Y15197
HEART20083640//Mus musculus Xin mRNA, complete cds.//3.10E-63//272aa//58%//AF051945
HEART20089940
HEART20090000//Rattus norvegicus PIPP mRNA for proline-rich inositol polyphosphate 5-phosphatase, complete cds.//0//639aa//91%//AB032551
HEART20095990
HHDPC10000650
HHDPC10000830//HYPOTHETICAL 24.9 KDA PROTEIN C16C10.7 IN CHROMOSOME III.//1.50E-23//56aa//60%//Q09463
HHDPC20001040
HHDPC20006920
HHDPC20014320//ADAM 12 PRECURSOR (EC 3.4.24.-) (A DISINTEGRIN AND METALLOPROTEINASE DOMAIN 12) (MELTRIN ALPHA).//1.20E-14//139aa//38%//043184
HHDPC20030490//LIPOPOLYSACCHARIDE-INDUCED TUMOR NECROSIS FACTOR-ALPHA FACTOR (LPS-INDUCED TNF-ALPHA FACTOR) (P53-INDUCED PROTEIN 7).//1.90E-69//134aa//95%//Q99732
HHDPC20031130//Kruppel-type zinc finger (C2H2) [Homo sapiens]//3.30E-196//607aa//57%//NP—005806
HHDPC20034390
HHDPC20034720//CHLORIDE INTRACELLULAR CHANNEL PROTEIN 4 (INTRACELLULAR CHLORIDE ION CHANNEL PROTEIN P64H1).//1.50E-121//213aa//99%//Q9Y696
HHDPC20057420//Mus musculus proline-rich protein (Bprp) mRNA, complete cds.//5.40E-45//143aa//69%//AF085348
HHDPC20057940
HHDPC20064600//SUPPRESSOR PROTEIN SRP40.//8.00E-05//175aa//24%//P32583
HHDPC20068620//Ig kappa chain precursor V region (0-81VL)-human (fragment)//8.10E-06//132aa//31%//S22658
HHDPC20084140//Homo sapiens polyadenylate binding protein-interacting protein-1 (PAIP1) mRNA, complete cds.//8.10E-12//230aa//23%//AF013758
HHDPC20091140//Homo sapiens gremlin mRNA, complete cds.//2.20E-60//105aa//100%//AF045800
HHDPC20091780//coagulation factor V (proaccelerin, labile factor)//2.00E-26//170aa//40%//NP—000121
HHDPC20092080//INSULIN-LIKE GROWTH FACTOR BINDING PROTEIN 3 PRECURSOR (IGFBP-3) (IBP-3) (IGF-BINDING PROTEIN 3).//3.30E-100//185aa//94%//P17936
HHDPC20095280
HLUNG10000550
HLUNG20016330//Homo sapiens actin filament associated protein (AFAP) mRNA, complete cds.//6.70E-130//531aa//49%//AF188700
HLUNG20016770
HLUNG20017120//PEPTIDE CHAIN RELEASE FACTOR 2 (RF-2).//8.40E-11//82aa//40%//Q53915
HLUNG20023340//Mus musculus SLM-1 (Slm1) mRNA, complete cds.//8.80E-141//270aa//95%//AF098796
HLUNG20033780//Rho guanine nucleotide exchange factor 5//6.00E-60//440aa//38%//NP—005426
HLUNG20084390
IMR3220002430//CHROMATIN ASSEMBLY FACTOR 1 P48 SUBUNIT (CAF-1 P48 SUBUNIT) (RETINOBLASTOMA BINDING PROTEIN P48) (RETINOBLASTOMA-BINDING PROTEIN 4) (MSI1 PROTEIN HOMOLOG).//7.10E-09//303aa//24%//Q09028
KIDNE20002520//glutamyl tRNA synthetase homolog//9.90E-156//290aa//100%//T00743
KIDNE20003940//RENAL SODIUM-DEPENDENT PHOSPHATE TRANSPORT PROTEIN 2 (SODIUM/PHOSPHATE COTRANSPORTER 2) (NA(+)/PI COTRANSPORTER 2) (RENAL SODIUM-PHOSPHATE TRANSPORT PROTEIN 2) (RENAL NA+-DEPENDENT PHOSPHATE COTRANSPORTER 2).//1.80E-151//582aa//51%//Q06496
KIDNE20006780
KIDNE20007210//Xenopus laevis mRNA for RPA interacting protein alpha (ripalpha gene).//8.30E-17//104aa//47%//AJ243177
KIDNE20007770//CARCINOEMBRYONIC ANTIGEN CGM6 PRECURSOR(NONSPECIFIC CROSS-REACTING ANTIGEN NCA-95) (ANTIGEN CD67) (CD66B ANTIGEN).//1.20E-17//326aa//27%//P31997
KIDNE20008010//Homo sapiens mRNA for putative protein kinase (WNK1 gene).//2.50E-25//460aa//29%//AJ296290
KIDNE20009470
KIDNE20011170
KIDNE20011400
KIDNE20013730
KIDNE20017130//Oreochromis niloticus sex-determining protein DMO mRNA, complete cds.//5.10E-43//252aa//43%//AF203490
KIDNE20018730
KIDNE20018970
KIDNE20020150//HEAT SHOCK 70 KDA PROTEIN 1 (HSP70.1) (HSP70-1/HSP70-2).//9.90E-251//458aa//98%//P08107
KIDNE20021680//SHORT CHAIN 3-HYDROXYACYL-COA DEHYDROGENASE PRECURSOR (EC 1.1.1.35) (HCDH).//7.10E-141//273aa//98%//Q16836
KIDNE20021910//Homo sapiens MRS1 mRNA, complete cds.//2.30E-30//339aa//27%//AF093239
KIDNE20021980
KIDNE20022620//like-glycosyltransferase//8.50E-253//633aa//70%//NP—004728
KIDNE20024830//Homo sapiens copine I mRNA, complete cds.//1.30E-46//134aa//47%//U83246
KIDNE20027250//ZINC FINGER PROTEIN 41 (ZFP-41) (CTFIN92) (FRAGMENT).//3.80E-55//105aa//91%//Q02526
KIDNE20027950//ZINC FINGER PROTEIN 7 (ZINC FINGER PROTEIN KOX4) (ZINC FINGER PROTEIN HF.16).//2.40E-40//82aa//100%//P17097
KIDNE20028390//GALACTOSE-1-PHOSPHATE URIDYLYLTRANSFERASE (EC 2.7.7.10).//6.00E-70//85aa//90%//P43424
KIDNE20028720//Mus musculus Ac39/physophilin mRNA, complete cds.//2.70E-130//345aa//68%//U21549
KIDNE20028830
KIDNE20029800
KIDNE20067330
KIDNE20079440
KIDNE20096280
KIDNE20096470
KIDNE20100070//Rattus norvegicus kidney-specific protein (KS) mRNA, complete cds.//1.20E-253//572aa//77%//AF062389
KIDNE20100840
KIDNE20101370//GOLGIN-95.//3.40E-20//76aa//68%//Q08379
KIDNE20101510//UROMODULIN PRECURSOR (TAMM-HORSFALL URINARY GLYCOPROTEIN) (THP).//0//519aa//95%//P07911
KIDNE20102650
KIDNE20102710//Mus musculus mRNA for Shank3b protein (shank3 gene).//1.20E-81//203aa//71%//AJ245904
KIDNE20104300
KIDNE20106740
KIDNE20107390//Homo sapiens CHRAC17 (CHRAC17) mRNA, complete cds.//1.50E-40//105aa//86%//AF226077
KIDNE20107500
KIDNE20107620//Rattus norvegicus protein kinase WNK1 (WNK1) mRNA, complete cds.//8.70E-140//266aa//74%//AF227741
KIDNE20109730//Mus musculus orphan transporter isoform B9 (Xtrp2) mRNA, alternatively spliced, complete cds.//8.70E-34//103aa//65%//AF075266
KIDNE20109890//Rattus norvegicus TGF-beta resistance-associated protein (TRAG) mRNA, complete cds.//2.60E-141//774aa//37%//AF305813
KIDNE20112000
KIDNE20115080//Homo sapiens mRNA for hNBL4, complete cds.//6.20E-115//226aa//96%//AB030240
KIDNE20118580//actin interacting protein [Arabidopsis thaliana].//5.00E-34//140aa//56%//CAB16815
KIDNE20120090
KIDNE20121880//Mus musculus claudin-19 mRNA, partial cds.//6.10E-97//193aa//95%//AF249889
KIDNE20122910
KIDNE20124400//Homo sapiens mRNA for ALEX1, complete cds.//1.10E-18//167aa//28%//AB039670
KIDNE20125630
KIDNE20126010
KIDNE20126130
KIDNE20127100//Drosophila melanogaster Diablo (dbo) mRNA, complete cds.//1.10E-10//254aa//26%//AF237711
KIDNE20127450
KIDNE20127750//Homo sapiens partial mRNA for transport-secretion protein 2.1 (TTS-2.1 gene).//6.50E-45//178aa//46%//AJ278475
KIDNE20130450
KIDNE20131580//Homo sapiens mRNA for LAK-4p, complete cds.//1.80E-111//211aa//100%//AB002405
KIDNE20132180
KIDNE20137340//HYPOTHETICAL 49.1 KDA PROTEIN C11D3.06 IN CHROMOSOME I.//5.80E-13//149aa//30%//Q10085
KIDNE20138010
KIDNE20141190
KIDNE20144890
KIDNE20148900
KIDNE20163880
KIDNE20180710
KIDNE20181660
KIDNE20182690//Homo sapiens mRNA for RERE, complete cds.//3.50E-222//401aa//99%//AB036737
KIDNE20186780
KIDNE20190740//Rattus norvegicus SNIP-b mRNA, complete cds.//6.70E-20//51aa//92%//AF156982
LIVER10001260
LIVER10004790
LIVER20002160//HEAT SHOCK COGNATE 71 KDA PROTEIN.//0//585aa//95%//P11142
LIVER20011130//Homo sapiens F-box protein FBL9 mRNA, partial cds.//5.50E-107//210aa//99%//AF176701
LIVER20011910
LIVER20028420
LIVER20035110
LIVER20035680
LIVER20038540
LIVER20045650
LIVER20055200//Homo sapiens leucocyte immunoglobulin-like receptor-8 (LIR-8) mRNA, complete cds.//2.50E-43//132aa//71%//AF025534
LIVER20055440//Homo sapiens Rho GAP p190-A mRNA, complete cds.//2.90E-101//195aa//98%//AF159851
LIVER20059810//UDP-GLUCOSE 4-EPIMERASE (EC 5.1.3.2) (GALACTOWALDENASE) (UDP-GALACTOSE 4-EPIMERASE).//1.60E-15//39aa//100%//Q14376
LIVER20062510
LIVER20064100//Ciona intestinalis mRNA for myoplasmin-C1, complete cds.//2.90E-14//167aa//26%//D42167
LIVER20064690//PLASMA SERINE PROTEASE INHIBITOR PRECURSOR (PCI) (PROTEIN C INHIBITOR) (PLASMINOGEN ACTIVATOR INHIBITOR-3) (PAI3).//1.70E-146//319aa//89%//P05154
LIVER20075680
LIVER20080530//Drosophila melanogaster forked mRNA for large Forked protein, complete cds.//1.10E-11//198aa//32%//D21203
LIVER20084730
LIVER20085800
LIVER20087060//Mus musculus putative purine nucleotide binding protein mRNA, complete cds.//2.70E-233//619aa//70%//U44731
LIVER20087510
LIVER20091180
MAMGL10000830//Drosophila melanogaster L82B (L82) mRNA, complete cds.//3.00E-27//231aa//38%//AF125385
MESAN10001260//Drosophila melanogaster Crossveinless 2 (CV-2) mRNA, complete cds.//6.50E-104//628aa//35%//AF288223
MESAN20004570//MEDIAN BODY PROTEIN.//3.00E-07//343aa//23%//Q08014
MESAN20014500//Drosophila melanogaster Dispatched (dispatched) mRNA, complete cds.//1.60E-46//225aa//37%//AF200691
MESAN20025190//Mus musculus cell cycle checkpoint control protein Mrad9 gene, complete cds.//7.30E-19//43aa//97%//AF045662
MESAN20027090
MESAN20029400
MESAN20031900//Homo sapiens mRNA for zinc-binding protein (Rbcc728 gene).//2.90E-161//724aa//43%//AJ272269
MESAN20035290
MESAN20036460
MESAN20038510
MESAN20089360
MESAN20101140//PINCH PROTEIN (PARTICULARY INTERESTING NEW CYS-HIS PROTEIN).//2.30E-25//52aa//98%//P48059
MESAN20103120//Homo sapiens sodium/calcium exchanger NCKX3 (SLC24A3) mRNA, complete cds.//4.10E-66//289aa//37%//AF169257
MESAN20106640
MESAN20115970
MESAN20121130
MESAN20125860//MELANOTRANSFERRIN PRECURSOR (MELANOMA-ASSOCIATED ANTIGEN P97).//1.30E-40//81aa//100%//P08582
MESAN20127350//myelin expression factor-3//2.80E-15//227aa//29%//JE0163
MESAN20130220//Homo sapiens testis-specific chromodomain Y-like protein (CDYL) mRNA, alternatively processed, complete cds.//2.10E-126//319aa//63%//AF081258
MESAN20132110
MESAN20136110//Ciona savignyi mRNA for PEM-3, complete cds.//1.90E-85//236aa//65%//AB001769
MESAN20138450
MESAN20139360
MESAN20141920//Human ovarian cancer downregulated myosin heavy chain homolog (Doc1) mRNA, complete cds.//0//691aa//97%//U53445
MESAN20152770
MESAN20153910
MESAN20154010//Homo sapiens mRNA for putative ribulose-5-phosphate-epimerase, partial cds.//9.10E-60//69aa//100%//AJ224326
MESAN20157080
MESAN20161590
MESAN20164090
MESAN20171520//Homo sapiens TNF intracellular domain-interacting protein mRNA, complete cds.//9.30E-30//198aa//40%//AF168676
MESAN20174170//REGULATOR OF G-PROTEIN SIGNALING 4 (RGS4) (RGP4).//1.80E-39//80aa//98%//P49798
MESAN20182090
MESAN20186700
NESOP10001080
NOVAR10000150
NOVAR10000910//COLORECTAL MUTANT CANCER PROTEIN (MCC PROTEIN).//6.00E-199//392aa//98%//P23508
NOVAR10001020
NOVAR20000380
NOVAR20003520
NT2NE20003740
NT2NE20010050
NT2NE20010210
NT2NE20010400//Homo sapiens GLO13 mRNA, complete cds.//2.90E-51//223aa//60%//AF267859
NT2NE20010490//ZINC FINGER PROTEIN 85 (ZINC FINGER PROTEIN HPF4) (HTF1).//1.30E-194//464aa//72%//Q03923
NT2NE20015240
NT2NE20021620//Saccharomyces cerevisiae Vps9p (VPS9) gene, complete cds.//1.00E-13//250aa//24%//U20373
NT2NE20043780
NT2NE20053580
NT2NE20068130//CELL SURFACE GLYCOPROTEIN 1 PRECURSOR (OUTER LAYER PROTEIN B) (S-LAYER PROTEIN 1).//2.50E-34//377aa//40%//Q06852
NT2NE20072200
NT2NE20074250
NT2NE20080170//HUNTINGTIN-ASSOCIATED PROTEIN-INTERACTING PROTEIN (DUO PROTEIN) (KALIRIN) (PAM COOH-TERMINAL INTERACTOR PROTEIN 10) (P-CIP10).//6.60E-57//661aa//27%//P97924
NT2NE20089610
NT2NE20089970//ZINC FINGER PROTEIN 91 (ZINC FINGER PROTEIN HTF10) (HPF7).//1.60E-29//77aa//81%//Q05481
NT2NE20108540
NT2NE20110360
NT2NE20118960//DOLICHYL-DIPHOSPHOOLIGOSACCHARIDE-PROTEIN GLYCOSYLTRANSFERASE 63 KDA SUBUNIT PRECURSOR (EC 2.4.1.119) (RIBOPHORIN II).//9.30E-274//562aa//94%//P04844
NT2NE20122430//GLYOXYLATE-INDUCED PROTEIN.//7.70E-25//144aa//38%//P30147
NT2NE20124480
NT2NE20125050//Gallus gallus mRNA for avena, complete cds.//5.80E-199//468aa//84%//AB017437
NT2NE20130190
NT2NE20131890
NT2NE20132170//Rattus norvegicus lysosomal amino acid transporter 1 mRNA, complete cds.//3.70E-97//357aa//52%//AF361239
NT2NE20142210//SINGLE-MINDED HOMOLOG 2 (SIM TRANSCRIPTION FACTOR) (MSIM).//3.00E-24//660aa//26%//Q61079
NT2NE20146810
NT2NE20152750
NT2NE20155110
NT2NE20156260
NT2NE20157470//COMPLEMENT C2 PRECURSOR (EC 3.4.21.43) (C3/C5 CONVERTASE).//6.60E-138//256aa//100%//P06681
NT2NE20158600//erythroid ankyrin-Synechocystis sp. (strain PCC 6803).//7.00E-13//160aa//31%//S74626
NT2NE20159740
NT2NE20172590
NT2NE20174800
NT2NE20174920
NT2NE20177520//Guinea pig mRNA for decay-accelerating factor (isoform GDab-SEC), complete cds.//1.70E-15//273aa//28%//D49421
NT2NE20181650//Shb=Src homology 2 protein//2.90E-36//115aa//43%//AAB29780
NT2NE20183760
NT2NE20184900//Mus musculus mRNA for transcription factor CA150b, complete cds.//8.60E-29//98aa//55%//AB023485
NT2NE20187390
NT2RI20001330//Homo sapiens KE03 protein mRNA, partial cds.//3.40E-103//339aa//57%//AF064604
NT2RI20003480//GLYPICAN-2 PRECURSOR (CEREBROGLYCAN) (HSPG M13).//1.80E-261//581aa//82%//P51653
NT2RI20005750//Rattus norvegicus GTP-binding protein REM2 (Rem2) mRNA, complete cds.//8.90E-139//272aa//95%//AF084464
NT2RI20009870//lunatic fringe precursor [Mus musculus]//5.50E-123//237aa//91%//U94351
NT2RI20022600
NT2RI20023160
NT2RI20023590
NT2RI20023910//Homo sapiens TMTSP mRNA for transmembrane molecule with thrombospondin module, complete cds.//0//480aa//96%//AB044385
NT2RI20025400//Mouse mRNA for P24 protein, complete cds.//9.70E-94//196aa//91%//D83206
NT2RI20025640
NT2RI20028470
NT2RI20036670
NT2RI20040930//MITOCHONDRIAL CARRIER PROTEIN YMC2 PRECURSOR.//1.10E-27//194aa//38%//P38087
NT2RI20040990//ANKYRIN 2 (BRAIN ANKYRIN) (ANKYRIN B) (ANKYRIN, NONERYTHROID).//2.40E-25//368aa//30%//Q01484
NT2RI20041880//MYOSIN HEAVY CHAIN, NONMUSCLE TYPE A (CELLULAR MYOSIN HEAVY CHAIN, TYPE A) (NMMHC-A).//8.10E-10//322aa//21%//P35579
NT2RI20046080
NT2RI20048840//GUANINE NUCLEOTIDE-BINDING PROTEIN G(I), ALPHA-2 SUBUNIT (ADENYLATE CYCLASE-INHIBITING G ALPHA PROTEIN).//2.10E-171//316aa//100%//P04899
NT2RI20050960//Homo sapiens p53 regulated PA26-T2 nuclear protein (PA26) mRNA, complete cds.//5.40E-164//496aa//61%//AF033120
NT2RI20054050//Drosophila melanogaster Abnormal X segregation (Axs) gene, complete cds.//2.40E-83//487aa//37%//AF101361
NT2RI20055790
NT2RI20056700//NEURONAL OLFACTOMEDIN-RELATED ER LOCALIZED PROTEIN PRECURSOR (NOEL) (1B426B).//3.40E-237//439aa//97%//Q62609
NT2RI20069730
NT2RI20076290
NT2RI20086220
NT2RI20091730
NT2RI20091940//CORNICHON-LIKE PROTEIN.//9.70E-73//159aa//81%//035089
NT2RI20198260
NT2R1 20203900
NT2RI20207030
NT2RI20216250
NT2RI20240080//SMALL GLUTAMINE-RICH TETRATRICOPEPTIDE REPEAT-CONTAINING PROTEIN.//1.30E-86//311aa//58%//043765
NT2R120244600//Homo sapiens mRNA for sphingosine-1-phosphatase (ORF1).//2.60E-50//273aa//36%//AJ293294
NT2RI20244960
NT2RI20250750
NT2RI20252550
NT2RI20273230//PUTATIVE HELICASE YGR271W.//1.10E-14//152aa//38%//P53327
NT2RP60000770//Homo sapiens mRNA for ZAC zinc finger protein.//5.80E-179//325aa//98%//AJ006354
NT2RP60000850//Bos taurus RPGR-interacting protein-1 (RPGRIP1) mRNA, complete cds.//2.10E-139//751aa//38%//AF227258
NT2RP70010740
NT2RP70027380//N-CHIMAERIN (NC) (N-CHIMERIN) (ALPHA CHIMERIN) (A-CHIMAERIN).//7.40E-31//203aa//36%//P15882
NT2RP70032610//ALPHA ENOLASE (EC 4.2.1.11) (2-PHOSPHO-D-GLYCERATE HYDRO-LYASE) (NON-NEURAL ENOLASE) (NNE) (PHOSPHOPYRUVATE HYDRATASE).//4.40E-180//387aa//88%//P06733
NT2RP70036880//Gtpase activating protein for Ypt1p; Gyp1p [Saccharomyce scerevisiae].//2.00E-66//250aa//50%//NP—014713
NT2RP70037240//H. sapiens E-MAP-115 mRNA.//1.10E-79//475aa//41%//X73882
NT2RP70043480//ZINC FINGER PROTEIN 93 (ZINC FINGER PROTEIN HTF34) (FRAGMENT).//0//588aa//91%//P35789
NT2RP70044280//CTD-BINDING SR-LIKE PROTEIN RA4 (FRAGMENT).//1.20E-11//190aa//31%//095104
NT2RP70045590//PUTATIVE ENDONUCLEASE C1F12.06C (EC 3.1.-.-).//3.60E-34//246aa//36%//Q10348
NT2RP70056750
NT2RP70062230//NEUROFILAMENT TRIPLET H PROTEIN (200 KDA NEUROFILAMENT PROTEIN) (NF-H).//2.50E-29//622aa//29%//P19246
NT2RP70063950//PUTATIVE RHO/RAC GUANINE NUCLEOTIDE EXCHANGE FACTOR(RHO/RAC GEF) (FACIOGENITAL DYSPLASIA PROTEIN HOMOLOG).//4.90E-13//417aa//26%//P52734
NT2RP70072690
NT2RP70075240
NT2RP70077660
NT2RP70078420//Drosophila melanogaster Centaurin Gamma 1A (ceng1A) mRNA, complete cds.//1.00E-120//700aa//40%//AF254741
NT2RP70080850
NT2RP70081610//Mus musculus 101F6 protein mRNA, complete cds.//5.20E-52//214aa//50%//AF131206
NT2RP70085440
NT2RP70102350//Mus musculus mRNA for Olig3 bHLH protein, complete cds.//1.90E-134//257aa//98%//AB038698
NT2RP70105210
NT2RP70110860
NT2RP70111320
NT2RP70122910
NT2RP70125160
NT2RP70130020
NT2RP70133740//SECRETORY CARRIER-ASSOCIATED MEMBRANE PROTEIN 2.//2.60E-136//267aa//94%//015127
NT2RP70134990
NT2RP70137290
NT2RP70137640
NT2RP70143480
NT2RP70147210
NT2RP70150800
NT2RP70157890//zinc finger protein 267; zinc finger (C2H2) [Homo sapiens]//1.60E-125//228aa//99%//NP—003405
NT2RP70159960//Rattus norvegicus p135 SynGAP mRNA, partial cds.//4.80E-60//177aa//69%//AF053938
NT2RP70169110
NT2RP70175670
NT2RP70179710
NT2RP70181970
NT2RP70188020
NT2RP70188710
NT2RP70190640
NT2RP70192730//LYSOSOMAL ACID LIPASE/CHOLESTERYL ESTER HYDROLASE PRECURSOR (EC 3.1.1.13) (LAL) (ACID CHOLESTERYL ESTER HYDROLASE) (STEROL ESTERASE) (LIPASE A) (CHOLESTERYL ESTERASE).//3.00E-181//323aa//99%//P38571
NT2RP70194450
NT2RP70195430//PUTATIVE NADP-DEPENDENT OXIDOREDUCTASE IN TEHB-RHSE INTERGENIC REGION (EC 1.-.-.-).//1.10E-57//349aa//38%//P76113
NT2RP70198350//HEPATOMA-DERIVED GROWTH FACTOR (HDGF).//2.60E-111//213aa//98%//P51858
NT2RP70203790
NTONG20009770//NEUROLYSIN PRECURSOR (EC 3.4.24.16) (NEUROTENSIN ENDOPEPTIDASE) (MITOCHONDRIAL OLIGOPEPTIDASE M) (MICROSOMAL ENDOPEPTIDASE) (MEP).//1.30E-304//599aa//92%//P42675
NTONG20013620//Homo sapiens hydroxysteroid sulfotransferase SULT2B1b (HSST2) mRNA, complete cds.//9.10E-82//151aa//100%//U92315
NTONG20015870//KERATIN, TYPE II CYTOSKELETAL 4 (CYTOKERATIN 4) (K4) (CK4).//3.30E-132//489aa//54%//P19013
NTONG20028070//CYR61 PROTEIN PRECURSOR (GIG1 PROTEIN) (INSULIN-LIKE GROWTH FACTOR-BINDING PROTEIN 10).//1.60E-65//133aa//92%//000622
NTONG20029480//Mus musculus Xin mRNA, complete cds.//7.20E-93//409aa//54%//AF051945
NTONG20029700//Homo sapiens laminin alpha 3b chain mRNA, partial cds.//6.60E-230//425aa//92%//AF005258
NTONG20046140//Homo sapiens mRNA for. MNK1, complete cds.//5.70E-89//177aa//98%//AB000409
NTONG20048060
NTONG20049910
NTONG20050620
NTONG20050860
NTONG20051530//KUPFFER CELL RECEPTOR.//6.30E-85//391aa//45%//P70194
NTONG20052650//Gallus gallus Xin mRNA, complete cds.//5.40E-146//768aa//40%//AF051944
NTONG20056570//CORONIN-LIKE PROTEIN P57.//2.20E-121//356aa//62%//Q92176
NTONG20061870
NTONG20063010//Mus musculus EF-9 mRNA, partial cds.//1.70E-78//154aa//92%//U72678
NTONG20064400//REPETIN.//2.20E-107//446aa//50%//P97347
NTONG20064840//Mus musculus slp1 mRNA for synaptotagmin-like protein 1, complete cds.//2.60E-128//258aa//90%//AB050741
NTONG20065010
NTONG20066460//Mus musculus Gd mRNA for gasdermin, complete cds.//8.30E-207//446aa//88%//AB033595
NTONG20067090//Mus musculus mRNA for Sh3y11, complete cds.//2.00E-63//136aa//91%//D85926
NTONG20067830//ANKYRIN 1 (ERYTHROCYTE ANKYRIN) (ANKYRIN R) (ANKYRINS 2.1 AND 2.2).//1.10E-24//227aa//34%//P16157
NTONG20070200//ZINC FINGER PROTEIN 83 (ZINC FINGER PROTEIN HPF1).//1.30E-134//352aa//65%//P51522
NTONG20070340//collagen alpha 1(IX) chain//1.50E-43//220aa//45%//S42617
NTONG20075220//Rattus norvegicus SNIP-a mRNA, complete cds.//1.80E-121//436aa//41%//AF156981
NTONG20076930//ALPHA-1-INHIBITOR III PRECURSOR.//1.20E-124//513aa//47%//P14046
NTONG20077560
NTONG20083650
NTONG20088620//Homo sapiens genethonin 3 mRNA, partial cds.//4.90E-202//390aa//99%//AF177292
NTONG20090600//SYNAPSIN I (BRAIN PROTEIN 4.1).//2.10E-07//198aa//29%//P17600
NTONG20090680
NTONG20092290
NTONG20092330//BESTROPHIN (VITELLIFORM MACULAR DYSTROPHY PROTEIN) (TU15B).//1.40E-135//414aa//59%//076090
OCBBF10000540//Mus musculus rjs (rjs) mRNA, complete cds.//4.00E-14//105aa//36%//AF061529
OCBBF10001750//Mus musculus mRNA for sprouty-4, complete cds.//1.50E-159//300aa//92%//AB019280
OCBBF10001850//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//8.90E-166//605aa//51%//P51523
OCBBF20005230
OCBBF20006770//TREACLE PROTEIN (TREACHER COLLINS SYNDROME PROTEIN).//2.50E-287//693aa//84%//Q13428
OCBBF20013890
OCBBF20019380//seizure related gene 6//6.00E-170//336aa//90%//NP—067261
OCBBF20019830
OCBBF20020150
OCBBF20020830//Homo sapiens Pumilio 1 (PUMH1) mRNA, complete cds.//0//814aa//99%//AF315592
OCBBF20022900//Homo sapiens SCHIP-1 mRNA, complete cds.//2.80E-250//469aa//99%//AF145713
OCBBF20023570
OCBBF20026630
OCBBF20028050//Homo sapiens B2 gene partial cDNA, clone B2E.//7.70E-38//246aa//33%//AJ002220
OCBBF20028650//DOSAGE COMPENSATION REGULATOR (MALE-LESS PROTEIN) (NO ACTION POTENTIAL PROTEIN).//1.40E-50//160aa//47%//P24785
OCBBF20029800
OCBBF20030280//Rattus norvegicus hfb2 mRNA, complete cds.//5.20E-63//175aa//68%//AF031483
OCBBF20030910//PUROMYCIN-SENSITIVE AMINOPEPTIDASE (EC 3.4.11.-) (PSA).//2.90E-146//279aa//98%//P55786
OCBBF20032460
OCBBF20035930//BETA-SOLUBLE NSF ATTACHMENT PROTEIN (SNAP-BETA).//7.80E-135//264aa//96%//P81126
OCBBF20037440//ZINC-FINGER PROTEIN HT2A (72 KDA TAT-INTERACTING PROTEIN).//2.10E-08//80aa//40%//Q13049
OCBBF20039250//Homo sapiens breast cancer metastasis-suppressor 1 (BRMS1) mRNA, complete cds.//2.20E-55//188aa//56%//AF159141
OCBBF20041680
OCBBF20045330
OCBBF20046120//zinc finger protein 16 (KOX 9)//1.00E-131//350aa//59%//NP—008889
OCBBF20046470//ARFAPTIN 1.//5.80E-114//229aa//97%//P53367
OCBBF20046690//PROBABLE CATION-TRANSPORTING ATPASE WO8D2.5 IN CHROMOSOME IV (EC 3.6.1.-).//4.20E-105//249aa//39%//Q27533
OCBBF20047570
OCBBF20048660
OCBBF20049300//ZINC FINGER PROTEIN 184 (FRAGMENT).//7.10E-141//566aa//45%//Q99676
OCBBF20049840//Homo sapiens mRNA for neurabin II protein.//4.90E-166//808aa//47%//AJ401189
OCBBF20050770//CARNITINE O-PALMITOYLTRANSFERASE I, MITOCHONDRIAL LIVER ISOFORM (EC 2.3.1.21) (CPT I) (CPTI-L).//3.10E-211//653aa//56%//P32198
OCBBF20051610
OCBBF20053430//Mus musculus MAST205 protein kinase mRNA, complete cds.//0//498aa//94%//U02313
OCBBF20053490//MANNOSE-6-PHOSPHATE ISOMERASE (EC 5.3.1.8) (PHOSPHOMANNOSE ISOMERASE) (PMI) (PHOSPHOHEXOMUTASE).//1.10E-24//52aa//100%//P34949
OCBBF20053730//85 KDA CALCIUM-INDEPENDENT PHOSPHOLIPASE A2 (EC 3.1.1.4) (IPLA2) (CAI-PLA2).//0//636aa//91%//060733
OCBBF20054200//DEVELOPMENTAL PROTEIN SEVEN IN ABSENTIA.//1.10E-27//97aa//54%//P21461
OCBBF20054760//SERINE/THREONINE PROTEIN KINASE RIP (EC 2.7.1.-) (CELL DEATH PROTEIN RIP) (RECEPTOR INTERACTING PROTEIN).//4.00E-122//230aa//97%//Q13546
OCBBF20059560//Homo sapiens (clone D320) C219-reactive peptide mRNA, partial cds.//6.70E-39//140aa//62%//L34688
OCBBF20060300
OCBBF20061720
OCBBF20062140
OCBBF20062410
OCBBF20063320
OCBBF20066390//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//8.90E-63//173aa//65%//P51523
OCBBF20068490//Mus musculus RW1 protein mRNA, complete cds.//4.60E-40//310aa//37%//AF060565
OCBBF20071210//M-PHASE PHOSPHOPROTEIN 9 (FRAGMENT).//1.80E-96//184aa//100%//Q99550
OCBBF20071840//ZINC FINGER PROTEIN 135.//1.00E-139//416aa//57%//P52742
OCBBF20071960//Coturnix coturnix japonica qMEF2D gene.//6.50E-06//124aa//31%//AJ002238
OCBBF20072240//Homo sapiens candidate tumor suppressor protein DICE1 mRNA, complete cds.//7.60E-165//354aa//83%//AF097645
OCBBF20072320
OCBBF20073540//Homo sapiens p30 DBC mRNA, complete cds.//4.00E-65//146aa//91%//AF293335
OCBBF20074140
OCBBF20076220
OCBBF20078920//Homo sapiens zinc-finger helicase (hZFH) mRNA,-complete cds.//3.10E-67//152aa//92%//U91543
OCBBF20079310
OCBBF20079460
OCBBF20080050//RTOA PROTEIN (RATIO-A).//3.50E-07//191aa//32%//P54681
OCBBF20080410//ZINC FINGER PROTEIN 43 (ZINC PROTEIN HTF6).//6.90E-145//445aa//51%//P28160
OCBBF20081380
OCBBF20082830//NDRG1 PROTEIN (DIFFERENTIATION-RELATED GENE 1 PROTEIN) (DRG1) (REDUCING AGENTS AND TUNICAMYCIN-RESPONSIVE PROTEIN) (RTP) (NICKEL-SPECIFIC INDUCTION PROTEIN CAP43).//3.10E-190//282aa//99%//Q92597
OCBBF20084660
OCBBF20085200
OCBBF20086400//Mus musculus ADP-ribosylation factor-like membrane-associated protein (Arm1) mRNA, complete cds.//2.10E-114//244aa//87%//AF205936
OCBBF20086910//Mus musculus mSox5L mRNA, complete cds.//9.30E-253//528aa//91%//AB006330
OCBBF20087010
OCBBF20088140
OCBBF20088220
OCBBF20091150
OCBBF20094240
OCBBF20097720
OCBBF20100400
OCBBF20103130
OCBBF20104040
OCBBF20105570
OCBBF20107090//Homo sapiens protocadherin 68 (PCH68) mRNA, complete cds.//2.60E-77//359aa//49%//AF029343
OCBBF20107920
OCBBF20108190//ZINC FINGER PROTEIN ZFP-36 (FRAGMENT).//2.90E-151//429aa//61%//P16415
OCBBF20108430//GUANINE NUCLEOTIDE-BINDING PROTEIN G(I), ALPHA-2 SUBUNIT (ADENYLATE CYCLASE-INHIBITING G ALPHA PROTEIN).//2.10E-171//316aa//100%//P04899
OCBBF20108580//APICAL-LIKE PROTEIN (APXL PROTEIN).//1.00E-196//376aa//100%//Q13796
OCBBF20108630//ATP-BINDING CASSETTE, SUB-FAMILY A, MEMBER 1 (ATP-BINDING CASSETTE TRANSPORTER 1) (ATP-BINDING CASSETTE 1).//1.00E-63//268aa//46%//P41233
OCBBF20109310
OCBBF20111770
OCBBF20116850//Mus musculus Islr(immunoglobulin superfamily containing leucine-rich repeat) mRNA, complete cds.//2.10E-88//285aa//57%//AB024538
OCBBF20118970
OCBBF20120390//SODIUM-DEPENDENT PROLINE TRANSPORTER (FRAGMENT).//0//636aa//100%//Q99884
OCBBF20121390//RING CANAL PROTEIN (KELCH PROTEIN).//7.80E-28//220aa//31%//Q04652
OCBBF20122620
OCBBF20124360//Homo sapiens mRNA for Misshapen/NIK-related kinase MINK-1, complete cds.//2.70E-98//185aa//100%//AB035698
OCBBF20125530//Mus musculus PRAJA1 (Praja1) mRNA, complete cds.//3.60E-110//281aa//77%//U06944
OCBBF20126780
OCBBF20127040//Drosophila melanogaster woc gene, exons 1-11.//1.10E-09//284aa//24%//AJ276394
OCBBF20127140//GUANINE NUCLEOTIDE-BINDING PROTEIN G(I)/G(S)/G(T) BETA SUBUNIT 1 (TRANSDUCIN BETA CHAIN 1).//5.50E-63//119aa//100%//P04901
OCBBF20127550
OCBBF20128120//Mus musculus mmDNAJA4 mRNA for mmDj4, complete cds.//1.20E-205//397aa//93%//AB032401
OCBBF20129360//1-PHOSPHATIDYLINOSITOL-4,5-BISPHOSPHATE PHOSPHODIESTERASE DELTA 1 (EC 3.1.4.11) (PLC-DELTA-1) (PHOSPHOLIPASE C-DELTA-1) (PLC-III).//1.00E-130//461aa//36%//P51178
OCBBF20130110
OCBBF20130910
OCBBF20132850//Homo sapiens brain tumor associated protein NAG14 (NAG14) mRNA, complete cds.//3.80E-24//399aa//27%//AF196976
OCBBF20139260
OCBBF20140640
OCBBF20140890
OCBBF20145760//GLYPICAN-1 PRECURSOR.//3.40E-118//222aa//100%//P35052
OCBBF20148280//Mus musculus mlt 1 gene, complete cds.//1.70E-151//502aa//63%//AB032418
OCBBF20148730//RING CANAL PROTEIN (KELCH PROTEIN).//2.90E-43//509aa//26%//Q04652
OCBBF20149280//Mus musculus WAVE-1 mRNA, complete cds.//4.30E-07//210aa//29%//AF290877
OCBBF20151150
OCBBF20153340//Rattus norvegicus cytosolic sorting protein PACS-1a (PACS-1) mRNA, complete cds.//0//701aa//93%//AF076183
OCBBF20153350//G PROTEIN PATHWAY SUPPRESSOR 2 (GPS2 PROTEIN).//1.20E-49//103aa//99%//Q13227
OCBBF20155060//CADHERIN-RELATED TUMOR SUPPRESSOR PRECURSOR (FAT PROTEIN).//1.90E-67//307aa//37%//P33450
OCBBF20164050
OCBBF20164670
OCBBF20170690
OCBBF20173060
OCBBF20173250
OCBBF20173980//Homo sapiens RCC1-like G exchanging factor RLG mRNA, complete cds.//3.70E-211//531aa//70%//AF060219
OCBBF20178150//Plasmodium falciparum ADA2-like protein gene, partial cds.//2.20E-19//322aa//27%//AF184590
OCBBF20178880//1′-CIS RETINOL DEHYDROGENASE (EC 1.1.1.105) (11-CIS RDH).//3.90E-37//101aa//78%//Q92781
OCBBF20178990
OCBBF20180120//Hbmo sapiens sodium-dependent high-affinity dicarboxylate transporter (NADC3) mRNA, complete cds.//1.50E-272//320aa//89%//AF154121
OCBBF20180840
OCBBF20186870
OCBBF20188730
OCBBF20189560 PANCR10000910//ATP-binding cassette, sub-family A member 8//2.00E-17//230aa//30%//NP—009099
PEBLM10000240
PEBLM10000710//leptin receptor//2.10E-29//69aa//91%//U66496
PEBLM20013120//Homo sapiens rhotekin mRNA, partial cds.//4.10E-25//164aa//36%//AF290512
PEBLM20024320//zinc resistance protein homolog//3.80E-28//139aa//45%//T27544
PEBLM20024550
PEBLM20040150
PEBLM20042900
PEBLM20044520//PAB-DEPENDENT POLY(A)-SPECIFIC RIBONUCLEASE SUBUNIT PAN2 (EC 3.1.13.4) (PAB1P-DEPENDENT POLY(A)-NUCLEASE).//2.40E-54//331aa//39%//P53010
PEBLM20052820//PROTEIN PHOSPHATASE 2C HOMOLOG 3 (EC 3.1.3.16) (PP2C-3).//7.60E-09//96aa//36%//Q09173
PEBLM20060310
PEBLM20060360//ZINC FINGER PROTEIN 33A (ZINC FINGER PROTEIN KOX31) (KIAA0065) (HA0946) (FRAGMENT).//5.10E-12//57aa//56%//Q06730
PEBLM20060490//polymerase (RNA) III (DNA directed) (39 kD) [Homo sapiens]//1.50E-72//143aa//100%//NP—006457
PEBLM20071880
PEBLM20072960
PEBLM20074370
PEBLM20075980//Mus musculus immunoglobulin scavenger receptor IgSR mRNA, complete cds.//2.30E-69//285aa//52%//AF302046
PEBLM20078320//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//2.00E-184//543aa//59%//P51523
PEBLM20085760//Homo sapiens mRNA for TOLLIP protein.//1.10E-106//153aa//98%//AJ242972
PERIC10000250//DNA TOPOISOMERASE III BETA-1 (EC 5.99.1.2).//1.20E-138//271aa//94%//095985
PERIC20002140
PERIC20003860
PERIC20003870//Mus musculus transcriptional activator alpha-NAC (Naca) gene, complete cds.//1.20E-152//956aa//43%//U48363
PERIC20004220
PERIC20004780//Rattus norvegicus Jun dimerization protein 1 (jdp-1) gene, complete cds.//2.00E-15//73aa//49%//U53450
PLACE50000660//PROTEIN ARGININE N-METHYLTRANSFERASE 1 (EC 2.1.1.-).//1.60E-12//200aa//27%//Q63009
PLACE60003480//Rattus norvegicus protein associating with small stress protein PASS1 (Pass1) mRNA, complete cds.//4.60E-119//255aa//82%//AF168362
PLACE60004630
PLACE60060420//60S RIBOSOMAL PROTEIN L44 (L36A).//1.70E-29//58aa//100%//P09896
PLACE60079250//Homo sapiens mRNA for actin binding protein ABP620, complete cds.//0//979aa//61%//AB029290
PLACE60086400
PLACE60119750
PLACE60121080
PLACE60136500
PLACE60136720
PLACE60138830
PLACE60153220
PLACE60155130
PLACE60161600
PLACE60169420
PLACE60177140//PROSTACYCLIN RECEPTOR (PROSTANOID IP RECEPTOR) (PGI RECEPTOR).//9.90E-135//257aa//99%//P43119
PLACE60181070
PLACE60187690
PLACE60188340
PROST10003220//HOMEOBOX PROTEIN HOX-A2.//5.00E-69//139aa//95%//043364
PROST10004800
PROST20005050
PROST20005670
PROST20021010
PROST20024890
PROST20029270
PROST20047270
PROST20047390//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//5.70E-52//427aa//31%//P51523
PROST20050670
PROST20052280
PROST20057930
PROST20059040
PROST20066880//Mus musculus zinc finger protein 276 C2H2 type (Zfp276) mRNA, complete cds.//9.80E-101//192aa//94%//AF178935
PROST20079500
PROST20083600//Bos taurus pyruvate dehydrogenase phosphatase regulatory subunit precursor, mRNA, complete cds.//1.40E-101//243aa//83%//AF026954
PROST20087700
PROST20097950
PROST20100460//Homo sapiens secretory mucin MUC6 (MUC6) mRNA, partial cds.//3.10E-216//421aa//98%//U97698
PROST20104000//SPLICEOSOME ASSOCIATED PROTEIN 62 (SAP 62) (SF3A66).//1.40E-20//128aa//39%//Q62203
PROST20107820//Human C3f mRNA, complete cds.//9.90E-140//252aa//100%//U72515
PROST20111050
PROST20112970
PROST20114390
PROST20116600
PROST20120050
PROST20120160
PROST20121900
PROST20123530
PROST20127400
PROST20127800
PROST20130530
PROST20132600
PROST20133270
PROST20144220
PROST20146010
PROST20149160
PROST20149250
PROST20151240
PROST20152460
PROST20153320
PROST20159240//Homo sapiens Opa-interacting protein OIP2 mRNA, partial cds.//1.10E-19//46aa//100%//AF025438
PROST20161950//Mus musculus RalGDS-like protein 3 mRNA, complete cds.//8.30E-88//205aa//85%//AF237669
PROST20164440
PROST20166680
PROST20168290
PROST20169800//CYTOCHROME P450 4F2 (EC 1.14.13.30) (CYPIVF2) (LEUKOTRIENE-B4 OMEGA-HYDROXYLASE) (LEUKOTRIENE-B4 20-MONOOXYGENASE) (CYTOCHROME P450-LTB-OMEGA).//6.30E-188//507aa//66%//P78329
PROST20170980
PROST20171280//hematopoietic zinc finger//2.00E-70//380aa//50%//NP—038894
PROST20175290
PROST20176170//Homo sapiens ENIGMA protein mRNA, complete cds.//2.60E-156//270aa//98%//AF265209
PROST20178360
PROST20185830//NITROGEN REGULATORY PROTEIN AREA.//5.50E-07//141aa//28%//013412
PROST20189770//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//5.00E-155//459aa//53%//P51523
PROST20191640//Mus musculus UbcM4-interacting protein 4 mRNA, complete cds.//1.50E-91//279aa//57%//AF360998
PUAEN10000850
PUAEN20003740
PUAEN20011880//Mus musculus mRNA for MIWI (piwi), complete cds.//2.70E-190//670aa//51%//AB032604
PUAEN20015260//Rattus norvegicus inositol polyphosphate multikinase (Ipmk) mRNA, complete cds.//2.40E-111//246aa//85%//AY014898
PUAEN20015860//Mus musculus PDZ-RGS3 protein mRNA, complete cds.//1.50E-205//469aa//82%//AF350047
PUAEN20018820//C-ETS-2 PROTEIN.//7.90E-261//469aa//99%//P15036
PUAEN20025680
PUAEN20027580
PUAEN20030180//CARBONIC ANHYDRASE XII PRECURSOR (EC 4.2.1.1) (CARBONATE DEHYDRATASE XII) (CA-XII) (TUMOR ANTIGEN HOM-RCC-3.1.3).//7.60E-148//259aa//95%//043570
PUAEN20040670//Mus musculus neuronal protein 4.1 mRNA, complete cds.//0//733aa//93%//AF061283
PUAEN20044000
PUAEN20045110
PUAEN20045250
PUAEN20051100//Mus musculus otogelin mRNA, complete cds.//2.60E-89//368aa//43%//U96411
PUAEN20052470
PUAEN20055020//Homo sapiens goodpasture antigen-binding protein (COL4A3BP) mRNA, complete cds.//0//624aa//1.00%//AF136450
PUAEN20078980//faciogenital dysplasia homolog//1.00E-19//200aa//39%//NP—032027
PUAEN20081230
PUAEN20083140//Homo sapiens SWAP-70 mRNA, complete cds.//2.70E-280//451aa//99%//AF210818
PUAEN20085150
PUAEN20108240//Drosophila melanogaster ankyrin 2 (Ank2) mRNA, complete cds.//5.00E-22//200aa//35%//AF190635
RECTM10001410
RECTM20003490
RECTM20005100
SALGL10001710//Homo sapiens mRNA for C110RF25 gene.//1.80E-88//455aa//41%//AJ300461
SKMUS20001980//Mus musculus N-RAP mRNA, complete cds.//1.40E-63//141aa//88%//U76618
SKMUS20003610//PUTATIVE MITOCHONDRIAL CARRIER PROTEIN PET8.//7.40E-59//274aa//47%//P38921
SKMUS20007010//VESTIGIAL PROTEIN.//2.70E-14//209aa//32%//Q26366
SKMUS20007800//PROSTAGLANDIN TRANSPORTER (PGT) (MATRIN F/G).//4.20E-47//274aa//36%//Q00910
SKMUS20011640
SKMUS20012010
SKMUS20016220//Mus musculus N-RAP mRNA, complete cds.//1.80E-85//352aa//47%//U76618
SKMUS20018230//Homo sapiens MYPT2 mRNA, complete cds.//8.10E-13//107aa//40%//AB003062
SKMUS20018500//Homo sapiens t(3;5)(q25.1;p34) fusion gene NPM-MLF1 mRNA, complete cds.//2.30E-131//268aa//94%//L49054
SKMUS20020840
SKMUS20021530//Homo sapiens SPG protein (SPG) mRNA, complete cds.//1.50E-278//506aa//99%//AF302154
SKMUS20024750//RAS SUPPRESSOR PROTEIN 1 (RSU-1) (RSP-1 PROTEIN) (RSP-1).//3.90E-21//203aa//33%//Q15404
SKMUS20028210
SKMUS20028400//Mus musculus YIP1B (Yip1b) mRNA, complete cds.//2.90E-53//142aa//74%//AF217188
SKMUS20029200//Homo sapiens ASB-1 protein mRNA, complete cds.//1.20E-45//302aa//39%//AF156777
SKMUS20031680
SKMUS20046670
SKMUS20048970//ACTIN, ALPHA SKELETAL MUSCLE (ALPHA-ACTIN 1).//8.00E-181//263aa//99%//P02568
SKMUS20049030//H. sapiens mRNA for nebulin.//3.50E-148//286aa//99%//X83957
SKMUS20077400
SKMUS20084740
SKNMC20006220
SKNSH20008190//ZINC FINGER PROTEIN 133.//2.80E-165//503aa//56%//P52736
SKNSH20020540
SKNSH20028660
SKNSH20031740
SKNSH20034660
SKNSH20051940
SKNSH20062340
SKNSH20063040//Homo sapiens tetraspan NET-4 mRNA, complete cds.//1.00E-20//177aa//41%//AF065389
SKNSH20080430
SKNSH20087770
SKNSH20089400//Homo sapiens Rad51-interacting protein mRNA, complete-cds.//2.20E-172//292aa//93%//AF006259
SKNSH20091970
SMINT20001760//ZINC FINGER PROTEIN 83 (ZINC FINGER PROTEIN HPF1).//1.40E-37//138aa//37%//P51522
SMINT20005410
SMINT20008240
SMINT20009840//IG KAPPA CHAIN V-II REGION GM607 PRECURSOR (FRAGMENT).//9.00E-54//117aa//90%//P06309
SMINT20011140
SMINT20011580
SMINT20011990
SMINT20013480
SMINT20014580
SMINT20015590
SMINT20022020
SMINT20023280
SMINT20024570//tektin A1//6.90E-26//124aa//45%//M97188
SMINT20026890//SMOOTHELIN.//3.10E-278//611aa//88%//P53814
SMINT20028820//Homo sapiens mRNA for F5-2, complete cds.//2.40E-83//162aa//98%//AB020739
SMINT20029760
SMINT20033170
SMINT20033400
SMINT20035690
SMINT20040860
SMINT20042990
SMINT20047810
SMINT20049090//Homo sapiens mRNA for partial putative mitogen-activated protein kinase kinase kinase.//2.20E-32//69aa//98%//AJ242724
SMINT20050750//SPARC PRECURSOR (SECRETED PROTEIN ACIDIC AND RICH IN CYSTEINE) (OSTEONECTIN) (ON) (BASEMENT MEMBRANE PROTEIN BM-40).//4.20E-111//259aa//82%//P09486
SMINT20051610//Mus musculus ES18 mRNA, complete cds.//6.90E-235//485aa//88%//AF083929
SMINT20053300//Homo sapiens hepatocellular carcinoma-associated antigen 59 mRNA, complete cds.//7.00E-20//44aa//100%//AF218421
SMINT20053870
SMINT20056210
SMINT20058000
SMINT20060780
SMINT20065960
SMINT20068010
SMINT20071400
SMINT20073650//IG ALPHA-1 CHAIN C REGION.//7.90E-197//353aa//100%//P01876
SMINT20076470
SMINT20080540
SMINT20089170
SMINT20092330
SMINT20092720
SMINT20095050
SMINT20098320
SMINT20100680
SMINT20101440//Human cisplatin resistance associated alpha protein (hCRA alpha) mRNA, complete cds.//1.70E-96//182aa//100%//U78556
SMINT20102780//NICOTINATE PHOSPHORIBOSYLTRANSFERASE (EC 2.4.2.11) (NAPRTASE).//5.30E-05//123aa//33%//P18133
SMINT20103690
SMINT20105000
SMINT20105330//BETA-GALACTOSIDASE PRECURSOR (EC 3.2.1.23) (LACTASE) (ACID BETA-GALACTOSIDASE).//1.00E-54//138aa//78%//P16278
SMINT20106290//FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE (EC 3.2.2.23) (FAPY-DNA GLYCOSYLASE).//7.00E-07//214aa//32%//050606
SMINT20106720//Homo sapiens mRNA for immunoglobulin lambda heavy chain.//3.30E-235//477aa//89%//Y14737
SMINT20108530
SMINT20109970
SMINT20110330
SMINT20110660//Homo sapiens mammalian inositol hexakisphosphate kinase 2 (IP6K2) mRNA, complete cds.//1.20E-33//68aa//100%//AF177145
SMINT20112730//IG ALPHA-1 CHAIN C REGION.//1.70E-196//353aa//99%//P01876
SMINT20115880//Kruppe1 associated box (KRAB) zinc finger 1 [Rattus norvegicus]//1.50E-42//211aa//45%//NP—062566
SMINT20121220//MYOSIN HEAVY CHAIN, NONMUSCLE TYPE B (CELLULAR MYOSIN HEAVY CHAIN, TYPE B) (NMMHC-B).//1.00E-18//493aa//24%//P35580
SMINT20121950//HYPOTHETICAL 70.2 KDA PROTEIN C22E12.10C IN CHROMOSOME I.//5.70E-16//90aa//45%//Q10361
SMINT20122850
SMINT20122910//Mus musculus StAR-related protein 1-4E mRNA, partial cds.//1.50E-77//170aa//82%//AY007808
SMINT20127350//U1 SMALL NUCLEAR RIBONUCLEOPROTEIN 70 KDA (U1 SNRNP 70 KDA) (SNRP70).//3.50E-14//186aa//32%//P08621
SMINT20127930//IG ALPHA-1 CHAIN C REGION.//7.90E-197//353aa//100%//P01876
SMINT20130320//Rattus norvegicus MHC class II transactivator type IV (CIITA) mRNA, complete cds.//2.50E-33//645aa//26%//AF251307
SMINT20131810
SMINT20132280
SMINT20136130//IG LAMBDA CHAIN C REGIONS.//4.00E-51//105aa//95%//P01842
SMINT20138900//DESMIN.//7.20E-203//425aa//94%//P17661
SMINT20144430//IG LAMBDA CHAIN V-I REGION BL2 PRECURSOR.//3.80E-55//130aa//83%//P06316
SMINT20144800//Human zinc finger protein zfp6 (ZF6) mRNA, partial cds.//1.60E-139//354aa//70%//U71363
SMINT20144890
SMINT20152940//Mus musculus ATP-dependent zinc metalloprotease (Afg311) mRNA, complete cds; nuclear gene for mitochondrial product.//1.10E-52//75aa//84%//AF329695
SMINT20153260//EXTRACELLULAR MATRIX PROTEIN 1 PRECURSOR (SECRETORY COMPONENT P85).//3.50E-274//476aa//98%//Q16610
SMINT20153530
SMINT20154540//CHLORINE CHANNEL PROTEIN P64.//1.10E-135//419aa//68%//P35526
SMINT20155180//Homo sapiens GBAS (GBAS) mRNA, complete cds.//6.70E-115//142aa//97%//AF029786
SMINT20157450
SMINT20158100
SMINT20161220
SMINT20162860
SMINT20163960
SMINT20164400
SMINT20164770
SMINT20168570//Homo sapiens mRNA for stabilin-1 (stab1 gene).//5.50E-61//128aa//98%//AJ275213
SMINT20173190
SMINT20173240
SMINT20174360//RHYTHMICALLY EXPRESSED GENE 2 PROTEIN (DREG-2).//6.90E-24//242aa//28%//Q94915
SMINT20177360//SPLICING FACTOR, ARGININE/SERINE-RICH 2 (SPLICING FACTOR SC35) (SC-35) (SPLICING COMPONENT, 35 KDA) (PR264 PROTEIN).//6.40E-37//82aa//92%//P30352
SMINT20178550
SMINT20179740//IG MU CHAIN C REGION.//8.50E-248//454aa//99%//P01871
SMINT20183530//GCN20 PROTEIN.//5.50E-118//410aa//52%//P43535
SMINT20190170//IG ALPHA-1 CHAIN C REGION.//8.50E-199//353aa//100%//P01876
SMINT20191420//AMP DEAMINASE 1 (EC 3.5.4.6) (MYOADENYLATE DEAMINASE) (AMP DEAMINASE ISOFORM M).//5.40E-214//401aa//97%//P23109
SMINT20191530//PUTATIVE ATP-DEPENDENT RNA HELICASE DBP73D.//5.00E-85//547aa//42%//P26802
SMINT20192000
SPLEN10000830
SPLEN20000640
SPLEN20002220
SPLEN20003070
SPLEN20006070//ANKYRIN 1 (ERYTHROCYTE ANKYRIN) (ANKYRIN R) (ANKYRINS 2.1 AND 2.2).//1.50E-81//788aa//30%//P16157
SPLEN20008390//Human placenta (Diff48) mRNA, complete cds.//4.60E-108//337aa//60%//U49187
SPLEN20008740//IMPORTIN ALPHA SUBUNIT (KARYOPHERIN ALPHA SUBUNIT) (SERINE-RICH RNA POLYMERASE I SUPPRESSOR PROTEIN).//5.50E-12//490aa//22%//Q02821
SPLEN20008820
SPLEN20011410//RHO-GTPASE-ACTIVATING PROTEIN 1 (GTPASE-ACTIVATING PROTEIN RHOGAP) (RHO-RELATED SMALL GTPASE PROTEIN ACTIVATOR) (CDC42 GTPASE-ACTIVATING PROTEIN) (P50-RHOGAP).//1.50E-21//183aa//34%//Q07960
SPLEN20013540
SPLEN20016260
SPLEN20019450
SPLEN20020070
SPLEN20021660//GAMMA-GLUTAMYLTRANSPEPTIDASE PRECURSOR (EC 2.3.2.2) (GAMMA-GLUTAMYLTRANSFERASE) (GGT).//9.00E-23//167aa//33%//P07314
SPLEN20022230
SPLEN20023140
SPLEN20026950//POSSIBLE GLOBAL TRANSCRIPTION ACTIVATOR SNF2L2 (SNF2-ALPHA).//0//766aa//81%//P51531
SPLEN20027440//ANKYRIN 2 (BRAIN ANKYRIN) (ANKYRIN B) (ANKYRIN, NONERYTHROID).//6.10E-25//368aa//30%//Q01484
SPLEN20029310
SPLEN20031600
SPLEN20032040
SPLEN20032190
SPLEN20033960
SPLEN20039240//HEAT SHOCK 70 KDA PROTEIN 1 (HSP70.1) (HSP70-1/HSP70-2).//9.80E-112//213aa//100%//P08107
SPLEN20040600
SPLEN20054290//Fugu rubripes zinc finger protein, isotocin, fatty acid binding protein, sepiapterin reductase and vasotocin genes, complete cds.//4.20E-180//448aa//71%//U90880
SPLEN20076530
SPLEN20077500//Mus musculus Niban mRNA, complete cds.//1.30E-39//351aa//31%//AB049355
SPLEN20079260//ZINC FINGER PROTEIN 132.//6.30E-117//320aa//61%//P52740
SPLEN20079510
SPLEN20084600//RING CANAL PROTEIN (KELCH PROTEIN).//5.20E-58//558aa//29%//Q04652
SPLEN20095410//ZINC FINGER PROTEIN 184 (FRAGMENT).//6.50E-83//236aa//58%//Q99676
SPLEN20095550
SPLEN20095810
SPLEN20097330
SPLEN20099700//TAT-BINDING HOMOLOG 7.//1.50E-142//553aa//48%//P54816
SPLEN20101190
SPLEN20103950//40S RIBOSOMAL PROTEIN S17.//7.10E-22//49aa//100%//P06584
SPLEN20106250
SPLEN20117660//Homo sapiens BCL-6 corepressor (BCOR) mRNA, complete cds; alternatively spliced.//1.30E-38//139aa//61%//AF317391
SPLEN20118300//Rattus norvegicus amino acid transport system A3 (Ata3) mRNA, complete cds.//1.70E-20//210aa//28%//AF295535
SPLEN20119810
SPLEN20121750//Danio rerio uridine kinase mRNA, complete cds.//1.60E-29//130aa//50%//AF195851
SPLEN20126190
SPLEN20128000//Xenopus laevis XMAB21 (Xmab-21) mRNA, complete cds.//6.80E-12//287aa//24%//AF040992
SPLEN20129610
SPLEN20140800//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//1.20E-145//586aa//47%//P51523
SPLEN20141360
SPLEN20141990
SPLEN20142100//Rattus norvegicus alpha D integrin mRNA, complete cds.//7.10E-37//105aa//76%//AF021334
SPLEN20143180//Mus musculus EWS/FLI1 activated transcript 2 (EAT-2) mRNA, complete cds.//2.50E-45//132aa//65%//AF020263
SPLEN20144520
SPLEN20145720//Rattus norvegicus nuclear GTPase PIKE mRNA, complete cds.//2.00E-24//120aa//45%//AF280816
SPLEN20146450//H. sapiens mRNA for plakophilin 2a and b.//1.20E-08//87aa//42%//X97675
SPLEN20146690
SPLEN20147110//cyclin-E binding protein 1//0//580aa//58%//NP—057407
SPLEN20147390//ZINC FINGER PROTEIN 136.//1.40E-105//417aa//49%//P52737
SPLEN20149110
SPLEN20149190
SPLEN20149240//Cricetulus longicaudatus arginine N-methyltransferase p82 isoform mRNA, complete cds, alternatively spliced.//3.50E-259//525aa//86%//AF336043
SPLEN20150940//Mus musculus histone deacetylase mHDA1 mRNA, complete cds.//4.20E-187//550aa//51%//AF006602
SPLEN20151210//protein tyrosine phosphatase, non-receptor type 13(AP0-1/CD95 (Fas)-associated phosphatase)//3.00E-25//250aa//29%//NP—006255
SPLEN20152610
SPLEN20152760
SPLEN20157300
SPLEN20157880//Homo sapiens Ig superfamily receptor LNIR precursor, mRNA, complete cds.//1.70E-05//137aa//29%//AF160477
SPLEN20158900
SPLEN20158990
SPLEN20160450//Homo sapiens mRNA for Hrs, complete cds.//5.60E-28//59aa//100%//D84064
SPLEN20160690
SPLEN20160980
SPLEN20162680//NUCLEAR PROTEIN SNF7.//4.20E-11//189aa//25%//P39929
SPLEN20163560
SPLEN20165310//Homo sapiens mRNA for immunoglobulin lambda heavy chain.//4.90E-230//477aa//88%//Y14737
SPLEN20166270
SPLEN20167200//Mus musculus MPS1 gene and mRNA, 3′end.//1.50E-15//46aa//84%//L20315
SPLEN20169220
SPLEN20169720
SPLEN20170310//Homo sapiens Asef mRNA for APC-stimulated guanine nucleotide exchange factor, complete cds.//8.40E-95//305aa//62%//AB042199
SPLEN20171210
SPLEN20171470
SPLEN20171890
SPLEN20172120
SPLEN20173510//Xenopus laevis putative N-terminal acetyltransferase mRNA, complete cds.//3.90E-210//413aa//66%//AF247679
SPLEN20174260
SPLEN20176200
SPLEN20179180//Homo sapiens EH domain containing 2 (EHD2) mRNA, complete cds.//1.10E-181//340aa//94%//AF181263
SPLEN20179810//Mus musculus pecanex 1 mRNA, complete cds.//3.80E-131//534aa//51%//AF096286
SPLEN20181810//Mus musculus faciogenital dysplasia protein 2 (Fgd2) mRNA, complete cds.//6.60E-68//144aa//86%//AF017368
SPLEN20186430//PROBABLE G PROTEIN-COUPLED RECEPTOR APJ.//2.20E-163//226aa//96%//P35414
SPLEN20193110
SPLEN20194050//Homo sapiens HOTTL protein mRNA, complete cds.//9.50E-135//264aa//93%//AF078842
SPLEN20198110
SPLEN20204170
SPLEN20211220
SPLEN20211570
SPLEN20211940
SPLEN20212730//CALPAIN 2, LARGE [CATALYTIC] SUBUNIT (EC 3.4.22.17) (CALCIUM-ACTIVATED NEUTRAL PROTEINASE) (CANP) (M-TYPE).//1.70E-137//265aa//98%//P17655
SPLEN20212950
SPLEN20213830
SPLEN20214400
SPLEN20214580//Mus musculus mdg1-1 mRNA, complete cds.//1.40E-16//39aa//94%//AF190624
SPLEN20222270//Mus musculus adaptor protein (Dokl) mRNA, complete cds.//1.10E-42//123aa//61%//AF179242
SPLEN20225220
SPLEN20242320
SPLEN20242730
SPLEN20243830//TRANSCRIPTION INITIATION FACTOR TFIID 135 KDA SUBUNIT (TAFII-135) (TAFII135) (TAFII-130) (TAFII130).//4.70E-38//98aa//87%//000268
SPLEN20245300//ADP-ribosylation factor binding protein GGA1//3.00E-39//120aa//76%//NP—037497
SPLEN20249560
SPLEN20250170//PUTATIVE RHO/RAC GUANINE NUCLEOTIDE EXCHANGE FACTOR(RHO/RAC GEF) (FACIOGENITAL DYSPLASIA PROTEIN HOMOLOG).//1.40E-51//488aa//27%//P52734
SPLEN20250390//CALPAIN 1, LARGE [CATALYTIC] SUBUNIT (EC 3.4.22.17) (CALCIUM-ACTIVATED NEUTRAL PROTEINASE) (CANP) (MU-TYPE).//3.00E-55//115aa//94%//P07384
SPLEN20252190//ZINC FINGER PROTEIN 135.//6.00E-89//303aa//52%//P52742
SPLEN20261440
SPLEN20264110
SPLEN20267650//ZINC FINGER PROTEIN 184 (FRAGMENT).//5.20E-90//410aa//45%//Q99676
SPLEN20273950
SPLEN20279950
SPLEN20280660
SPLEN20283650//Mus musculus ras activator RasGRP (Rasgrp) mRNA, complete cds.//9.80E-54//182aa//57%//AF106070
SPLEN20284240//Homo sapiens hOBDPF mRNA for osteoblast differentiation promoting factor, complete cds.//9.80E-93//177aa//98%//AB048363
SPLEN20292950//ATP-binding cassette, sub-family A member 8//3.30E-211//469aa//64%//NP—009099
SPLEN20293800
SPLEN20303970
SPLEN20304950//Homo sapiens CAGH32 mRNA, partial cds.//9.60E-44//86aa//98%//U80743
SPLEN20305620//DIHYDROOROTATE DEHYDROGENASE PRECURSOR (EC 1.3.3.1) (DIHYDROOROTATE OXIDASE) (FRAGMENT).//3.60E-59//124aa//96%//Q02127
SPLEN20329240
STOMA20001830//IG ALPHA-1 CHAIN C REGION.//2.10E-196//353aa//99%//P01876
STOMA20005390//IG ALPHA-1 CHAIN C REGION.//7.90E-197//353aa//100%//P01876
STOMA20005670//Homo sapiens mRNA for immunoglobulin lambda heavy chain.//1.90E-216//478aa//83%//Y14737
STOMA20006400//Homo sapiens IGHG3 gene for immunoglobulin heavy chain gamma 3 constant region, 4-exon hinge, isolate Lib-A2.//8.40E-214//377aa//100%//AJ390247
STOMA20006780
STOMA20006860//Homo sapiens TOB3 mRNA, complete cds.//1.80E-74//159aa//97%//AF343078
STOMA20008880//MYOCILIN PRECURSOR (TRABECULAR MESHWORK-INDUCED GLUCOCORTICOID RESPONSE PROTEIN).//1.00E-196//405aa//91%//Q99972
STOMA20010250//Homo sapiens RNA-binding protein (RBMS3) mRNA, complete cds.//7.70E-46//116aa//86%//AF023259
STOMA20013890
STOMA20026880
STOMA20032890//ZINC FINGER PROTEIN CKR1.//5.80E-30//162aa//38%//P30373
STOMA20034770//IG ALPHA-1 CHAIN C REGION.//4.40E-196//353aa//99%//P01876
STOMA20036460
STOMA20046680//FOSB PROTEIN (G0/G1 SWITCH REGULATORY PROTEIN 3).//4.10E-14//36aa//100%//P53539
STOMA20048520
STOMA20048840
STOMA20051200
STOMA20056640//Ig lambda chain V region//6.80E-54//150aa//73%//S23626
STOMA20056670//IG ALPHA-1 CHAIN C REGION.//7.90E-197//353aa//100%//P01876
STOMA20057820
STOMA20062130//IG KAPPA CHAIN V-III REGION HAH PRECURSOR.//3.10E-53//129aa//80%//P18135
STOMA20062290
STOMA20063250//TRANSCRIPTION FACTOR COE3 (EARLY B-CELL FACTOR 3) (EBF-3) (OLF-1/EBF-LIKE 2) (OE-2) (O/E-2).//7.50E-50//105aa//93%//008791
STOMA20063980
STOMA20064470//PLACENTAL RIBONUCLEASE INHIBITOR (RIBONUCLEASE/ANGIOGENIN INHIBITOR) (RAI) (R1).//3.60E-14//262aa//30%//P13489
STOMA20067800
STOMA20069040
STOMA20072690
STOMA20076800
STOMA20077450//UBIQUITIN-ACTIVATING ENZYME E1 (A1S9 PROTEIN).//2.70E-228//430aa//97%//P22314
STOMA20080500//ATP-binding cassette, sub-family A, member 7, isoform a//1.00E-297//538aa//94%//NP—061985
STOMA20083610//IG ALPHA-1 CHAIN C REGION.//7.90E-197//353aa//100%//P01876
STOMA20086140
STOMA20088380//IG ALPHA-1 CHAIN C REGION.//2.10E-196//352aa//100%//P01876
STOMA20092530//Homo sapiens mRNA for immunoglobulin lambda heavy chain.//3.10E-239//477aa//91%//Y14737
STOMA20092560
STOMA20092890
SYNOV20001520//Homo sapiens kappa 1 immunoglobulin light chain mRNA, complete cds.//5.50E-107//236aa//86%//AF113887
SYNOV20001730//Human (hybridoma H210) anti-hepatitis A IgG variable region, constant region, complementarity-determining regions mRNA, complete cds.//2.60E-226//479aa//86%//M87789
SYNOV20002510//Homo sapiens IGHG3 gene for immunoglobulin heavy chain gamma 3 constant region, 4-exon hinge, isolate Kp-25.//6.60E-214//377aa//100%//AJ390254
SYNOV20002790//Human (hybridoma H210) anti-hepatitis A IgG variable region, constant region, complementarity-determining regions mRNA, complete cds.//1.30E-238//476aa//91%//M87789
SYNOV20002970//Human (hybridoma H210) anti-hepatitis A IgG variable region, constant region, complementarity-determining regions mRNA, complete cds.//7.00E-226//476aa//86%//M87789
SYNOV20003970
SYNOV20004260//Homo sapiens mRNA for immunoglobulin lambda heavy chain.//1.10E-225//477aa//86%//Y14737
SYNOV20007000//Human (hybridoma H210) anti-hepatitis A IgG variable region, constant region, complementarity-determining regions mRNA, complete cds.//4.00E-239//478aa//91%//M87789
SYNOV20008240//Human (hybridoma H210) anti-hepatitis A IgG variable region, constant region, complementarity-determining regions mRNA, complete cds.//4.10E-237//479aa//90%//M87789
SYNOV20009230//IG ALPHA-1 CHAIN C REGION.//7.90E-197//353aa//100%//P01876
SYNOV20010880//Human (hybridoma H210) anti-hepatitis A IgG variable region, constant region, complementarity-determining regions mRNA, complete cds.//1.60E-233//476aa//89%//M87789
SYNOV20011110//Human (hybridoma H210) anti-hepatitis A IgG variable region, constant region, complementarity-determining regions mRNA, complete cds.//6.90E-235//476aa//89%//M87789
SYNOV20013000//Ig gamma=immunoglobulin heavy chain [rats, humanized lympholytic MoAb CAMPATH-1H, mRNA, 1465 nt].//7.70E-220//472aa//86%//S79307
SYNOV20013560//Homo sapiens mRNA for immunoglobulin lambda heavy chain.//1.40E-234//477aa//89%//Y14737
SYNOV20013900//Homo sapiens mRNA for immunoglobulin kappa heavy chain.//3.50E-231//476aa//89%//Y14735
SYNOV20017080
SYNOV30001840
TBAES20000590
TBAES20002550//AMINOPEPTIDASE B (EC 3.4.11.6) (ARGINYL AMINOPEPTIDASE) (ARGININE AMINOPEPTIDASE) (CYTOSOL AMINOPEPTIDASE IV) (AP-B).//2.10E-310//586aa//89%//009175
TBAES20003150//CYTOCHROME P450 4A1 (EC 1.14.15.3) (CYPIVA1) (LAURIC ACID OMEGA-HYDROXYLASE) (P450-LA-OMEGA 1) (P452).//1.40E-82//323aa//44%//P08516
TBAES20003770//SPERM-SPECIFIC ANTIGEN 2 (CLEAVAGE SIGNAL-1 PROTEIN) (CS-1).//1.90E-122//249aa//97%//P28290
TCOLN20001390
TESOP20000900
TESOP20003120
TESOP20004000//CATHEPSIN B PRECURSOR (EC 3.4.22.1) (CATHEPSIN B1) (APP SECRETASE).//3.30E-111//194aa//98%//P07858
TESOP20005270//MONOAMINE-SULFATING PHENOL SULFOTRANSFERASE (EC 2.8.2.1) (SULFOTRANSFERASE, MONOAMINE-PREFERRING) (M-PST) (THERMOLABILE PHENOL SULFOTRANSFERASE) (TL-PST) (PLACENTAL ESTROGEN SULFOTRANSFERASE) (CATECHOLAMINE-SULFATING PHENOL SULFOTRANSFERASE) (HAST3).//3.40E-47//92aa//100%//P50224
TESOP20005690//Mus musculus p53 apoptosis-associated target (Perp) mRNA, complete cds.//2.30E-53//113aa//91%//AF249870
TESTI10000940
TESTI20001000//FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE (EC 3.2.2.23) (FAPY-DNA GLYCOSYLASE).//7.80E-06//238aa//28%//P74290
TESTI20001170
TESTI20001720
TESTI20002720//TUBULIN-TYROSINE LIGASE (EC 6.3.2.25) (TTL).//1.70E-18//237aa//29%//P38584
TESTI20002780//ADENYLATE CYCLASE (EC 4.6.1.1) (ATP PYROPHOSPHATE-LYASE) (ADENYLYL CYCLASE).//1.90E-11//140aa//36%//P08678
TESTI20004890
TESTI20011200
TESTI20017950
TESTI20018230
TESTI20023510
TESTI20029930
TESTI20030310
TESTI20030890
TESTI20031270//TUMOR NECROSIS FACTOR, ALPHA-INDUCED PROTEIN 1, ENDOTHELIAL (B12 PROTEIN).//7.30E-52//146aa//71%//Q13829
TESTI20031810
TESTI20035960//VEGETATIBLE INCOMPATIBILITY PROTEIN HET-E-1.//1.70E-67//329aa//40%//Q00808
TESTI20036380//DRA PROTEIN (DOWN-REGULATED IN ADENOMA).//6.40E-46//243aa//35%//P40879
TESTI20037560
TESTI20038270
TESTI20039400//EBNA-1 NUCLEAR PROTEIN.//3.60E-43//298aa//43%//P03211
TESTI20041690//TRANSCRIPTION INTERMEDIARY FACTOR 1-BETA (KRAB-A INTERACTING PROTEIN) (KRIP-1).//1.00E-12//341aa//21%//Q62318
TESTI20044230//Mus musculus testis-specific Y-encoded-like protein (Tspyl1) mRNA, complete cds.//1.70E-94//291aa//64%//AF042180
TESTI20044310//RAS SUPPRESSOR PROTEIN 1 (RSU-1) (RSP-1 PROTEIN) (RSP-1).//6.70E-06//118aa//32%//Q15404
TESTI20046750
TESTI20057750
TESTI20060400//Columba livia mRNA for 5′-nucleotidase.//3.80E-115//328aa//66%//AJ131243
TESTI20061110//Xenopus laevis katanin p60 mRNA, partial cds.//1.80E-170//489aa//66%//AF177942
TESTI20063830//Drosophila melanogaster nuclear fallout (nuf) mRNA, nuf-1 allele, complete cds.//2.10E-34//371aa//29%//AF045015
TESTI20066670//probable acyl-CoA dehydrogenase//1.90E-72//222aa//60%//D75616
TESTI20066770
TESTI20067200//PRE-B-CELL LEUKEMIA TRANSCRIPTION FACTOR-3 (HOMEOBOX PROTEIN PBX3).//4.20E-132//352aa//71%//P40426
TESTI20076850
TESTI20082330//helicase II homolog//4.10E-44//775aa//25%//T13889
TESTI20083200//Homo sapiens mitogen-activated protein kinase phosphatase x (MKPX) mRNA, complete cds.//1.00E-41//131aa//58%//AF165519
TESTI20083940
TESTI20086210
TESTI20087620
TESTI20088220//ZINC FINGER PROTEIN 91 (ZINC FINGER PROTEIN HTF10) (HPF7).//8.50E-175//633aa//48%//Q05481
TESTI20094020
TESTI20094120
TESTI20094230//Strongylocentrotus purpuratus tektin A1 mRNA, complete cds//4.50E-64//252aa//50%//M97188
TESTI20094470//ETS-RELATED PROTEIN 71 (ETS TRANSLOCATION VARIANT 2).//1.40E-183//318aa//99%//000321
TESTI20098350
TESTI20098530
TESTI20102800
TESTI20105720
TESTI20108720//PROTEIN PHOSPHATASE 2C BETA ISOFORM (EC 3.1.3.16) (PP2C-BETA) (IA) (PROTEIN PHOSPHATASE 1B).//3.30E-49//249aa//46%//P36993
TESTI20110280
TESTI20112940
TESTI20114070
TESTI20116650
TESTI20116830//Homo sapiens liprin-beta2 mRNA, partial cds.//8.20E-17//50aa//92%//AF034803
TESTI20121550//NUCLEOPORIN-LIKE PROTEIN RIP (REV INTERACTING PROTEIN) (REV/REX ACTIVATION DOMAIN-BINDING PROTEIN).//1.60E-152//363aa//85%//P52594
TESTI20122310
TESTI20123080
TESTI20123560
TESTI20127760
TESTI20128350
TESTI20129150
TESTI20129220
TESTI20130010//ZINC FINGER PROTEIN 84 (ZINC FINGER PROTEIN HPF2).//2.10E-63//173aa//65%//P51523
TESTI20130120
TESTI20135660
TESTI20136100//ZINC/CADMIUM RESISTANCE PROTEIN.//3.70E-12//101aa//35%//P20107
TESTI20136710
TESTI20136990
TESTI20137370
TESTI20137670
TESTI20143240
TESTI20143390//Mus musculus testicular condensing enzyme (AMAC1) mRNA, complete cds.//1.60E-51//123aa//79%//AF016712
TESTI20143620
TESTI20148000//PROTEIN DISULFIDE ISOMERASE (PDI) (EC 5.3.4.1) (PROLYL 4-HYDROXYLASE BETA SUBUNIT) (CELLULAR THYROID HORMONE BINDING PROTEIN) (RETINA COGNIN) (R-COGNIN).//2.80E-75//493aa//34%//P09102
TESTI20152460//ML02 PROTEIN.//9.60E-42//170aa//40%//Q09329
TESTI20155900
TESTI20156100//KRUPPEL-LIKE FACTOR 4 (EPITHELIAL ZINC-FINGER PROTEIN EZF).//2.30E-32//254aa//32%//043474
TESTI20157100
TESTI20157520
TESTI20159140
TESTI20161970
TESTI20164100
TESTI20168480//H. sapiens mRNA for titin protein (clone hh1-hh54).//6.30E-48//393aa//31%//X90568
TESTI20168630
TESTI20168960
TESTI20169960
TESTI20170350
TESTI20171020
TESTI20178160
TESTI20179320
TESTI20183370
TESTI20184620//OXYSTEROL-BINDING PROTEIN.//6.20E-27//181aa//28%//P16258
TESTI20185650//Xenopus laevis ubiquitin-like fusion protein mRNA, complete cds.//2.90E-129//543aa//46%//L08474
TESTI20185810
TESTI20189410//Mus musculus axotrophin mRNA, complete cds.//7.50E-43//142aa//57%//AF155739
TESTI20192280
TESTI20192800//Homo sapiens nasopharyngeal carcinoma susceptibility protein LZ16 mRNA, complete cds.//2.40E-23//164aa//41%//AF121775
TESTI20193360
TESTI20194300
TESTI20194810
TESTI20197940
TESTI20199170
TESTI20199750//TRICHOHYALIN.//8.80E-59//547aa//30%//P37709
TESTI20200260
TESTI20200710//Mus musculus epithelial protein lost in neoplasm-a (Eplin) mRNA, complete cds.//4.40E-40//212aa//42%//AF307844
TESTI20202650
TESTI20203440
TESTI20204450//M. musculus of DNA encoding DNA-binding protein.//1.90E-58//477aa//32%//Z54200
TESTI20208400//PROLIFERATING-CELL NUCLEOLAR ANTIGEN P120 (PROLIFERATION-ASSOCIATED NUCLEOLAR PROTEIN P120).//1.70E-16//181aa//33%//P46087
TESTI20208710
TESTI20209460
TESTI20209810
TESTI20209990
TESTI20211160
TESTI20211220
TESTI20211240
TESTI20213150
TESTI20213580
TESTI20214250//MITOCHONDRIAL CARRIER PROTEIN PMT.//1.10E-34//242aa//36%//P32332
TESTI20215990//Homo sapiens leucine-rich repeats containing F-box protein FBL3 mRNA, complete cds.//1.10E-39//375aa//28%//AF186273
TESTI20216370//LIVER CARBOXYLESTERASE PRECURSOR (EC 3.1.1.1) (ES-MALE) (ESTERASE-31).//1.50E-60//164aa//68%//Q63880
TESTI20220100
TESTI20220650
TESTI20224620
TESTI20226230//Rattus norvegicus KPL2 (Kpl2) mRNA, complete cds.//8.90E-111//371aa//59%//AF102129
TESTI20226490
TESTI20229600//Drosophila melanogaster SP2353 mRNA, complete cds.//8.30E-117//607aa//33%//AF239610
TESTI20230250
TESTI20230850//CIRCADIAN LOCOMOTER OUTPUT CYCLES KAPUT PROTEIN (MCLOCK).//1.00E-23//186aa//30%//008785
TESTI20231920
TESTI20231940//Human OB binding protein-2 (OB-BP2) mRNA, complete cds.//4.60E-14//140aa//36%//U71383
TESTI20232140//1-PHOSPHATIDYLINOSITOL-4,5-BISPHOSPHATE PHOSPHODIESTERASE DELTA 1 (EC 3.1.4.11) (PLC-DELTA-1) (PHOSPHOLIPASE C-DELTA-1) (PLC-III) (FRAGMENT).//2.50E-90//388aa//47%//P10895
TESTI20234140
TESTI20234270
TESTI20234360//PEPTIDYL-PROLYL CIS-TRANS ISOMERASE NIMA-INTERACTING 1 (EC 5.2.1.8).//5.90E-66//128aa//98%//Q13526
TESTI20237520//poly(A)-specific ribonuclease (deadenylation nuclease)//1.10E-34//311aa//26%//NP—002573
TESTI20238000
TESTI20238610//MELANOMA-ASSOCIATED ANTIGEN B1 (MAGE-B1 ANTIGEN) (MAGE-XP ANTIGEN) (DAM10).//6.80E-69//268aa//51%//P43366
TESTI20239470
TESTI20239510//ubiquitin specific protease 6//5.60E-43//182aa//50%//NP—004496
TESTI20240090
TESTI20241530
TESTI20241920
TESTI20242830
TESTI20242990
TESTI20244190//Homo sapiens IGHG3 gene for immunoglobulin heavy chain gamma 3 constant region, 4-exon hinge, isolate Lib-A2.//8.40E-214//377aa//100%//AJ390247
TESTI20244760
TESTI20249990//ATAXIN 7 (SPINOCEREBELLAR ATAXIA TYPE 7 PROTEIN).//7.30E-49//388aa//37%//015265
TESTI20254220
TESTI20254540//Homo sapiens hepatocellular carcinoma-associated antigen 59 mRNA, complete cds.//1.60E-100//197aa//98%//AF218421
TESTI20254860//TUMOR SUPPRESSOR PROTEIN DCC PRECURSOR.//1.20E-35//564aa//28%//P70211
TESTI20255820
TESTI20258460//Homo sapiens OSBP-related protein 4 mRNA, complete cds.//8.20E-196//369aa//99%//AF323731
TESTI20262330
TESTI20262910
TESTI20265250
TESTI20265370
TESTI20265970
TESTI20266740//Homo sapiens topoisomerase-related function protein (TRF4-1) mRNA, partial cds.//2.70E-105//278aa//71%//AF089896
TESTI20269570
TESTI20271850
TESTI20272060
TESTI20272390
TESTI20272960//Mus musculus gene for odorant receptor MOR83, complete cds.//3.30E-84//306aa//50%//AB030894
TESTI20275030
TESTI20275620
TESTI20277360
TESTI20278200
TESTI20278400//INTRACELLULAR PROTEIN TRANSPORT PROTEIN USO1.//2.50E-11//604aa//21%//P25386
TESTI20280980
TESTI20282540
TESTI20284880
TESTI20285830
TESTI20288110
TESTI20288910//Mus musculus endophilin II mRNA, complete cds.//2.10E-110//225aa//92%//U58885
TESTI20289850
TESTI20291310
TESTI20291620
TESTI20291960//RHOMBOID PROTEIN (VEINLET PROTEIN).//2.00E-40//230aa//38%//P20350
TESTI20294700
TESTI20297850
TESTI20301360
TESTI20303220//Rattus norvegicus neural cell adhesion protein BIG-2 precursor (BIG-2) mRNA, complete cds.//0//807aa//94%//U35371
TESTI20303360
TESTI20303420
TESTI20305540//M. musculus mRNA for IB3/5-polypeptide.//1.30E-183//684aa//56%//X79131
TESTI20305560
TESTI20307540
TESTI20307700
TESTI20308600
TESTI20309170//Mucor circinelloides crgA gene for carotenoid regulatory protein.//3.10E-41//198aa//40%//AJ250998
TESTI20310070
TESTI20311290
TESTI20314180//TRYPSIN I-PI PRECURSOR (EC 3.4.21.4).//2.10E-25//86aa//40%//Q90627
TESTI20316870//Homo sapiens mRNA for cartilage-associated protein (CASP).//4.90E-106//199aa//99%//AJ006470
TESTI20317600
TESTI20318090//ZINC FINGER PROTEIN 135.//2.00E-56//208aa//50%//P52742
TESTI20319190
TESTI20320440//THIOREDOXIN.//4.30E-32//103aa//63%//P50413
TESTI20320670//Rattus norvegicus mRNA for type A/B hnRNP protein p40.//2.20E-170//337aa//91%//AJ238854
TESTI20326810//RAN-SPECIFIC GTPASE-ACTIVATING PROTEIN (RAN BINDING PROTEIN 1) (RANBP1).//2.00E-33//66aa//100%//P34022
TESTI20327680
TESTI20327740
TESTI20328280
TESTI20330310
TESTI20332420//Mus musculus cell cycle checkpoint control protein Mrad9 gene, complete cds.//5.80E-20//246aa//28%//AF045662
TESTI20333000
TESTI20333950
TESTI20334410//Sus scrofa RNA helicase (RHIV-1) mRNA, complete cds.//4.40E-58//281aa//33%//AF181119
TESTI20335050//Homo sapiens cell cycle checkpoint protein CHFR mRNA, complete cds.//6.00E-188//333aa//99%//AF170724
TESTI20335200//BILIARY GLYCOPROTEIN 1 PRECURSOR (BGP-1) (ANTIGEN CD66) (CD66A ANTIGEN).//8.10E-20//87aa//50%//P13688
TESTI20336410
TESTI20337100
TESTI20342430
TESTI20343070
TESTI20343570//TRIPEPTIDYL-PEPTIDASE II (EC 3.4.14.10) (TPP II) (TRIPEPTIDYL AMINOPEPTIDASE).//2.00E-75//201aa//75%//P29144
TESTI20345060
TESTI20347180//Mus musculus membrane protein TMS-2 mRNA, complete cds.//6.00E-35//186aa//41%//AF181685
TESTI20347300
TESTI20347740
TESTI20347770
TESTI20351830
TESTI20352620//PROACTIVATOR POLYPEPTIDE PRECURSOR [CONTAINS: SAPOSIN A (PROTEIN A); SAPOSIN B (SPHINGOLIPID ACTIVATOR PROTEIN 1) (SAP-1) (DISPERSIN) (SULFATIDE/GM1 ACTIVATOR); SAPOSIN C(CO-BETA-GLUCOSIDASE) (A1 ACTIVATOR) (GLUCOSYLCERAMIDASE ACTIVATOR) (SPHINGOLIPID ACTIVATOR PROTEIN 2) (SAP-2); SAPOSIN D (PROTEIN C) (COMPONENT C)].//1.30E-52//240aa//44%//P07602
TESTI20355020//Drosophila sp. Hls (hls) mRNA, complete cds.//9.80E-30//416aa//28%//S79915
TESTI20357750
TESTI20357930
TESTI20357960
TESTI20358980//Volvox carteri mRNA for hydroxyproline-rich glycoprotein (HRGP gene).//2.90E-37//155aa//50%//AJ242540
TESTI20361140
TESTI20366910//Homo sapiens mRNA for thioredoxin reductase II beta, complete cds.//2.00E-233//442aa//93%//AB019695
TESTI20367360
TESTI20368330//M-PHASE INDUCER PHOSPHATASE 3 (EC 3.1.3.48).//2.10E-258//473aa//99%//P30307
TESTI20369130
TESTI20369220
TESTI20369650//Homo sapiens mRNA for HsGAK, complete cds.//2.40E-269//493aa//99%//D88435
TESTI20369690
TESTI20370020
TESTI20370550
TESTI20370810//Homo sapiens mRNA for LAK-4p, complete cds.//1.10E-74//385aa//38%//AB002405
TESTI20371030//TIP ELONGATION ABERRANT PROTEIN 1 (CELL POLARITY PROTEIN TEA1).//7.80E-23//243aa//29%//P87061
TESTI20371060
TESTI20373820
TESTI20375340//1-PHOSPHATIDYLINOSITOL-4,5-BISPHOSPHATE PHOSPHODIESTERASE DELTA 1 (EC 3.1.4.11) (PLC-DELTA-1) (PHOSPHOLIPASE C-DELTA-1) (PLC-III) (FRAGMENT).//4.80E-68//273aa//45%//P10895
TESTI20377230
TESTI20378190//ZINC FINGER PROTEIN 91 (ZINC FINGER PROTEIN HTF10) (HPF7).//2.30E-114//323aa//52%//Q05481
TESTI20378450
TESTI20380650
TESTI20381040
TESTI20382750//Homo sapiens hook1 protein (HOOK1) mRNA, complete cds.//2.60E-96//195aa//99%//AF044923
TESTI20383880//Homo sapiens gamma cysteine string protein mRNA, partial cds.//6.50E-61//109aa//100%//AF368277
TESTI20385960//Homo sapiens mRNA for RET finger protein-like 3.//4.80E-156//288aa//100%//AJ010232
TESTI20386230
TESTI20386440
TESTI20388580
TESTI20390260
TESTI20390410
TESTI20391130
TESTI20391210
TESTI20391770
TESTI20392090
TESTI20392250//Homo sapiens VAV-3 protein mRNA, complete cds.//9.80E-145//268aa//98%//AF067817
TESTI20392270
TESTI20392760//PROTEIN PHOSPHATASES PP1 REGULATORY SUBUNIT SDS22.//5.70E-22//226aa//31%//P36047
TESTI20393530//MITOCHONDRIAL PHOSPHATE CARRIER PROTEIN PRECURSOR (PTP).//9.00E-34//105aa//68%//P12234
TESTI20396130
TESTI20397760//POTENTIAL PHOSPHOLIPID-TRANSPORTING ATPASE IIB (EC 3.6.1.-).//1.60E-109//221aa//90%//P98195
TESTI20400940//CENTROMERIC PROTEIN E (CENP-E PROTEIN).//4.70E-16//669aa//23%//Q02224
TESTI20401020//Oryctolagus cuniculus peroxisomal Ca-dependent solute carrier mRNA, complete cds.//5.80E-64//234aa//56%//AF004161
TESTI20401280
TESTI20401430
TESTI20404240//INTERFERON-RELATED DEVELOPMENTAL REGULATOR 2 (SKMC15 PROTEIN).//4.60E-36//46aa//93%//Q12894
TESTI20406420
TESTI20408150
TESTI20408970//NUCLEAR ENVELOPE PORE MEMBRANE PROTEIN POM 121 (PORE MEMBRANE PROTEIN OF 121 KDA) (P145).//4.30E-16//264aa//30%//P52591
TESTI20409440
TESTI20409890//GCD14 PROTEIN.//2.30E-46//263aa//40%//P46959
TESTI20413300
TESTI20415170
TESTI20415640
TESTI20416640//CHOLINE/ETHANOLAMINE KINASE [INCLUDES: CHOLINE KINASE (EC 2.7.1.32) (CK); ETHANOLAMINE KINASE (EC 2.7.1.82) (EK)].//2.10E-77//139aa//100%//Q9Y259
TESTI20417300//DYNEIN BETA CHAIN, CILIARY.//6.80E-129//552aa//45%//P39057
TESTI20419560
TESTI20420620//TRANSCRIPTION INITIATION FACTOR TFIID 70 KDA SUBUNIT (TAFII-70) (TAFII-80) (TAFII80).//0//526aa//99%//P49848
TESTI20421490
TESTI20422640
TESTI20423020
TESTI20424000
TESTI20424730
TESTI20425070
TESTI20427830
TESTI20428060
TESTI20429280
TESTI20429580
TESTI20432750//Mus musculus pantothenate kinase 1 beta (panKlbeta) mRNA, complete cds.//9.70E-165//363aa//82%//AF200357
TESTI20432820//ZINC FINGER PROTEIN 43 (ZINC PROTEIN HTF6).//1.00E-173//403aa//75%//P28160
TESTI20433130
TESTI20436560//LAMIN C.//9.20E-235//453aa//99%//PO2546
TESTI20438570//Homo sapiens nolp mRNA, complete cds.//2.70E-43//146aa//60%//AB017800
TESTI20438660
TESTI20441940//Human K-Cl cotransporter (hKCC1) mRNA, complete cds.//5.50E-139//264aa//99%//U55054
TESTI20442760//Homo sapiens Ig-like membrane protein (IGSF3) mRNA, complete cds.//0//545aa//93%//AF031174
TESTI20443090//DNA REPAIR PROTEIN RAD51 HOMOLOG 4 (R51H3) (TRAD).//2.70E-68//141aa//100%//075771
TESTI20444130
TESTI20444180
TESTI20447540
TESTI20449200//METABOTROPIC GLUTAMATE RECEPTOR 7 PRECURSOR.//9.00E-173//313aa//99%//Q14831
TESTI20451710
TESTI20451990
TESTI20455090//KERATIN, TYPE I CYTOSKELETAL 18 (CYTOKERATIN 18) (K18) (CK 18).//1.20E-76//199aa//80%//P05783
TESTI20455620//HEAT SHOCK-RELATED 70 KDA PROTEIN 2 (HEAT SHOCK 70 KDA PROTEIN 2).//4.80E-218//336aa//99%//P54652
TESTI20456110//52 KDA RO PROTEIN (SJOGREN SYNDROME TYPE A ANTIGEN (SS-A)) (RO(SS-A)).//9.40E-75//382aa//43%//P19474
TESTI20458190
TESTI20463520
TESTI20463580//UBIQUITIN CARBOXYL-TERMINAL HYDROLASE 4 (EC 3.1.2.15) (UBIQUITIN THIOLESTERASE 4) (UBIQUITIN-SPECIFIC PROCESSING PROTEASE 4) (DEUBIQUITINATING ENZYME 4) (UBIQUITOUS NUCLEAR PROTEIN HOMOLOG).//1.50E-17//190aa//28%//Q13107
TESTI20465350//2′,3′-CYCLIC NUCLEOTIDE 3′-PHOSPHODIESTERASE (EC 3.1.4.37) (CNP) (CNPASE).//2.20E-123//231aa//100%//P09543
TESTI20465520
TESTI20465690//Homo sapiens Borg4 mRNA, complete cds.//2.00E-152//235aa//99%//AB042237
TESTI20467210//Homo sapiens mRNA for HELG protein.//2.00E-166//368aa//83%//AJ277291
TESTI20467320//Mus musculus WAVE-1 mRNA, complete cds.//1.20E-111//233aa//88%//AF290877
TESTI20467970
TESTI20468630
TESTI20471410//PROTEIN PHOSPHATASE 2C ALPHA ISOFORM (EC 3.1.3.16) (PP2C-ALPHA) (IA) (PROTEIN PHOSPHATASE IA).//1.30E-210//382aa//99%//P35813
TESTI20471470
TESTI20471530
TESTI20472120
TESTI20473420
TESTI20473830//Columba livia mRNA for 5′-nucleotidase.//2.00E-14//75aa//49%//AJ131243
TESTI20477920
TESTI20478010
TESTI20478180
TESTI20478850
TESTI20479300
THYMU10005360//Human T cell receptor beta chain (TCRB) mRNA, VNDNJC region, 5′end.//1.20E-130//270aa//91%//L07294
THYMU10005540//Homo sapiens mRNA for immunoglobulin lambda heavy chain.//1.20E-237//479aa//90%//Y14737
THYMU20000570
THYMU20011950
THYMU20015210
THYMU20018190
THYMU20023380//Homo sapiens m6A methyltransferase (MT-A70) gene, complete cds.//1.20E-38//86aa//100%//AF014837
THYMU20027560
THYMU20029100
THYMU20032870
THYMU20039810//MPS1 protein//2.60E-283//646aa//77%//152603
THYMU20045120
THYMU20058070
THYMU20061700
THYMU20066100
THYMU20070360
THYMU20075320
THYMU20081490//Homo sapiens ICB-1 mRNA, complete cds.//1.50E-23//267aa//33%//AF044896
THYMU20095960
THYMU20100410
THYMU20101610
THYMU20101920
THYMU20105190//MYOSIN I ALPHA (MMI-ALPHA).//7.50E-54//282aa//45%//P46735
THYMU20106710//Homo sapiens T-cell receptor alpha delta locus from bases 501613 to 752736 (section 3 of 5) of the Complete Nucleotide Sequence.//1.20E-54//113aa//98%//AE000660
THYMU20108310//Mouse NCBP-29 mRNA for PW29, complete cds.//7.70E-93//102aa//99%//D49429
THYMU20111180
THYMU20111420
THYMU20111830//protease, serine, 16 (thymus)//1.40E-129//175aa//98%//NP—005856
THYMU20114470
THYMU20115850
THYMU20118060
THYMU20118520//Xenopus laevis ubiquitin-like fusion protein mRNA, complete cds//3.00E-42//109aa//77%//L08475
THYMU20119390
THYMU20122730//target of mybl (chicken) homolog//1.00E-122//233aa//100%//NP—005479
THYMU20126900//UDP-GLUCOSE 6-DEHYDROGENASE (EC 1.1.1.22) (UDP-GLC DEHYDROGENASE) (UDP-GLCDH) (UDPGDH).//1.40E-229//341aa//99%//060701
THYMU20128070
THYMU20128260
THYMU20130890//40S RIBOSOMAL PROTEIN S16.//1.90E-28//125aa//57%//P17008
THYMU20141670
THYMU20142040//WISKOTT-ALDRICH SYNDROME PROTEIN HOMOLOG (WASP).//2.60E-12//155aa//32%//P70315
THYMU20142970
THYMU20143270//Homo sapiens HSNFRK (HSNFRK) mRNA, complete cds.//5.40E-171//321aa//100%//AF226044
THYMU20147770//Homo sapiens mRNA for immunoglobulin lambda heavy chain.//5.40E-235//477aa//89%//Y14737
THYMU20153160
THYMU20158250
THYMU20159430//IG ALPHA-1 CHAIN C REGION.//7.90E-197//353aa//100%//P01876
THYMU20161640//Mus musculus p53 apoptosis-associated target (Perp) mRNA, complete cds.//1.40E-92//188aa//89%//AF249870
THYMU20162190
THYMU20169680//DIACYLGLYCEROL KINASE, ZETA (EC 2.7.1.107) (DIGLYCERIDE KINASE) (DGK-ZETA) (DAG KINASE ZETA).//1.40E-64//124aa//99%//Q13574
THYMU20172150//CORONIN-LIKE PROTEIN P57 (CORONIN 1A).//1.60E-49//96aa//100%//P31146
THYMU20173980
THYMU20180280//RED PROTEIN (RER PROTEIN) (IK FACTOR) (CYTOKINE IK).//2.60E-40//83aa//96%//Q13123
THYMU20186390
THYMU20186730
THYMU20187720
THYMU20193640//HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN L (HNRNP L).//1.70E-82//157aa//99%//P14866
THYMU20194360
THYMU20194420
THYMU20195990
THYMU20201980//Mus musculus faciogenital dysplasia protein 2 (Fgd2) mRNA, complete cds.//2.90E-122//259aa//86%//AF017368
THYMU20202890//PROTEIN KINASE CLK3 (EC 2.7.1.-).//1.10E-204//367aa//99%//035492
THYMU20204160
THYMU20204990
THYMU20208300
THYMU20209590//DYNAMIN 2.//2.10E-189//363aa//97%//P50570
THYMU20215090
THYMU20215970
THYMU20216840
THYMU20222890
THYMU20226600
THYMU20228540
THYMU20229220
THYMU20232090//SYNTAXIN BINDING PROTEIN 2 (UNC-18 HOMOLOG 2) (UNC-18B).//2.10E-54//112aa//99%//Q15833
THYMU20235760
THYMU20239000//collagen alpha 1(XI) chain//1.70E-37//579aa//33%//S18251
THYMU20239430
THYMU20240710//Halocynthia roretzi mRNA for HrPET-3, complete cds.//5.60E-54//155aa//44%//AB029335
THYMU20241210//Homo sapiens mRNA for nuclear protein, NP220, complete cds.//2.00E-58//117aa//100%//D83032
THYMU20241850//HLA CLASS II HISTOCOMPATIBILITY ANTIGEN, DX BETA CHAIN PRECURSOR.//4.40E-141//261aa//100%//P05538
THYMU20246840
THYMU20247480//ZINC FINGER PROTEIN 135.//1.20E-97//191aa//90%//P52742
THYMU20250420
THYMU20251890
THYMU20253250
THYMU20255570
THYMU20255720
THYMU20259090
THYMU20265300
THYMU20271250
THYMU20272490
THYMU20277390
THYMU20279750
THYMU20283790
THYMU20284120
THYMU20286290
THYMU20286320
TKIDN10000010//translocase of inner mitochondrial membrane 23 (yeast) homolog//6.30E-67//133aa//98%//NP—006318
TKIDN20004640//GALACTOKINASE 2 (EC 2.7.1.6).//5.10E-99//200aa//97%//Q01415
TKIDN20005210
TKIDN20030590
TKIDN20030620
TKIDN20047480//MITOGEN-ACTIVATED PROTEIN KINASE 12 (EC 2.7.1.-) (EXTRACELLULAR SIGNAL-REGULATED KINASE 6) (EC 2.7.1.-) (ERK6) (ERK5) (STRESS-ACTIVATED PROTEIN KINASE-3) (MITOGEN-ACTIVATED PROTEIN KINASE P38 GAMMA) (MAP KINASE P38 GAMMA).//2.20E-52//104aa//100%//P53778
TOVAR20004760
TOVAR20005750
TRACH20002870//CLAUDIN-6.//1.30E-27//175aa//42%//Q9Z262
TRACH20003590//CYTOCHROME P450 4A4 (EC 1.14.14.1) (CYPIVA4) (PROSTAGLANDIN OMEGA-HYDROXYLASE) (P450-P-2).//1.50E-138//493aa//49%//P10611
TRACH20005020
TRACH20005400//Mus musculus GTPase Rab37 (Rab37) mRNA, complete cds.//3.30E-109//223aa//93%//AF233582
TRACH20007020//TRICHOHYALIN.//5.60E-24//532aa//23%//P37709
TRACH20016210//ALPHA-(1,3)-FUCOSYLTRANSFERASE (EC 2.4.1.65) (GALACTOSIDE 3-L-FUCOSYLTRANSFERASE) (FUCOSYLTRANSFERASE 6) (FUCT-VI).//5.00E-192//254aa//99%//P51993
TRACH20019960//SODIUM/POTASSIUM-TRANSPORTING ATPASE ALPHA-1 CHAIN PRECURSOR (EC 3.6.1.37) (SODIUM PUMP) (NA+/K+ ATPASE).//9.50E-185//410aa//84%//P05023
TRACH20027840
TRACH20028030//Mus musculus mmDNAJA4 mRNA for mmDj4, complete cds.//8.50E-205//397aa//92%//AB032401
TRACH20029540
TRACH20032720
TRACH20033230//MALTOSE PERMEASE.//1.20E-10//197aa//23%//Q45632
TRACH20034840//SKIN SECRETORY PROTEIN XP2 PRECURSOR (APEG PROTEIN).//5.90E-14//342aa//28%//P17437
TRACH20037360
TRACH20041830//Aedes triseriatus putative disulfide-isomerase mRNA, partial cds.//3.10E-29//134aa//47%//AF306866
TRACH20042920//Human C3f mRNA, complete cds.//7.80E-195//381aa//89%//U72515
TRACH20048450//PROTEIN K4 (PROTEIN K3).//4.70E-57//431aa//32%//P18377
TRACH20050040//PUTATIVE SURFACE GLYCOPROTEIN C210RF1 PRECURSOR (C210RF3).//8.50E-74//177aa//74%//P53801
TRACH20056980
TRACH20057690//RAC-BETA SERINE/THREONINE KINASE (EC 2.7.1.-) (RAC-PK-BETA) (AKT2 KINASE).//8.80E-22//48aa//100%//P31751
TRACH20060150
TRACH20067620//N-ACETYLLACTOSAMINIDE BETA-1,6-N-ACETYLGLUCOSAMINYLTRANSFERASE (EC 2.4.1.150) (N-ACETYLGLUCOSAMINYLTRANSFERASE) (1-BRANCHING ENZYME) (IGNT).//8.20E-76//145aa//92%//Q06430
TRACH20068660//Mouse 19.5 mRNA, complete cds.//1.00E-55//263aa//41%//M32486
TRACH20068700//Homo sapiens adaptor protein CIKS mRNA, complete cds.//1.50E-232//572aa//79%//AF272151
TRACH20069180//Homo sapiens IGHG3 gene for immunoglobulin heavy chain gamma 3 constant region, 4-exon hinge, isolate Lib-A2.//1.00E-213//377aa//100%//AJ390247
TRACH20076740//FOLATE-LIKE TRANSPORTER DJ206D15.1 ON CHROMOSOME 1 (FRAGMENT).//1.00E-61//276aa//46%//060779
TRACH20076760
TRACH20077540//DXS8237E PROTEIN (FRAGMENT).//6.00E-96//189aa//95%//P98175
TRACH20079690//ZINC FINGER PROTEIN 136.//1.50E-113//368aa//58%//P52737
TRACH20082780
TRACH20084720//METHIONYL-TRNA SYNTHETASE, MITOCHONDRIAL (EC 6.1.1.10) (METHIONINE-TRNA LIGASE) (METRS).//8.50E-90//525aa//38%//074634
TRACH20085400//Mus musculus immunoglobulin scavenger receptor IgSR mRNA, complete cds.//1.30E-89//384aa//47%//AF302046
TRACH20085830//CYTOCHROME P450 4A8 (EC 1.14.14.1) (CYPIVA8) (P450-KP1) (P450-PP1).//3.70E-247//508aa//87%//P24464
TRACH20091230
TRACH20092680
TRACH20096610//LAMIN A (70 KDA LAMIN).//1.70E-77//164aa//93%//P02545
TRACH20099340
TRACH20105870//EUKARYOTIC TRANSLATION INITIATION FACTOR 4 GAMMA (EIF-4-GAMMA) (EIF-4G) (EIF4G) (P220).//9.20E-95//204aa//92%//Q04637
TRACH20107710
TRACH20109650
TRACH20111130
TRACH20115740
TRACH20118940
TRACH20121380//REGULATOR OF G-PROTEIN SIGNALING 14 (RGS14) (FRAGMENT).//7.60E-144//308aa//92%//043566
TRACH20128110//Rattus norvegicus TM6P1 (TM6P1) mRNA, complete cds.//2.10E-87//187aa//88%//AF186469
TRACH20128230//Homo sapiens IGHG3 gene for immunoglobulin heavy chain gamma 3 constant region, 4-exon hinge, isolate Lib-A2.//9.60E-213//377aa//99%//AJ390247
TRACH20134950
TRACH20135520
TRACH20136710//IG LAMBDA CHAIN V-II REGION NIG-84.//2.20E-43//112aa//75%//P04209
TRACH20139820//SIGNAL RECOGNITION PARTICLE 68 KDA PROTEIN (SRP68).//3.70E-48//107aa//92%//Q00004
TRACH20140820
TRACH20141240//Mus musculus G21 protein mRNA, complete cds.//6.10E-26//60aa//93%//AF131207
TRACH20145440
TRACH20147250
TRACH20149970//Rattus norvegicus Ca2+-dependent activator protein (CAPS) mRNA, complete cds.//2.30E-205//512aa//74%//U16802
TRACH20153810
TRACH20154860//RETINOIC ACID RECEPTOR ALPHA (RAR-ALPHA).//8.90E-221//443aa//92%//P10276
TRACH20162860//NADH-UBIQUINONE OXIDOREDUCTASE SUBUNIT B14.5B (EC 1.6.5.3) (EC 1.6.99.3) (COMPLEX I-B14.5B) (C1-B14.5B).//1.80E-39//80aa//98%//095298
TRACH20163170//HOMEOBOX PROTEIN MEISI.//1.50E-131//238aa//100%//000470
TRACH20164980//ZINC FINGER PROTEIN 184 (FRAGMENT).//1.50E-163//488aa//56%//Q99676
TRACH20167220
TRACH20168350
TRACH20169800
TRACH20180840
TRACH20183170//Rattus norvegicus Sprague-Dawley SM-20 mRNA, complete cds.//1.60E-75//215aa//61%//U06713
TRACH20184490//Homo sapiens mRNA for zinc finger protein (ZNF304 gene).//3.20E-111//477aa//46%//AJ276316
TRACH20187180
TRACH20190240//Homo sapiens mRNA for fibulin-4.//1.00E-98//179aa//97%//AJ132819
TSTOM10001860
TSTOM20001390
TSTOM20003150
TSTOM20005690//kelch (Drosophila)-like 3 [Homo sapiens]//5.60E-211//399aa//98%//NP—059111
TUTER20002830//Homo sapiens transformer-2-beta (SFRS10) gene, alternatively spliced products, complete cds.//4.70E-122//253aa//90%//AF057159
UMVEN10001560//Anthocidaris crassispina mRNA for outer arm dynein light chain 1, complete cds.//1.90E-24//119aa//47%//AB010055
UMVEN10001860//N-CHIMAERIN (NC) (N-CHIMERIN) (ALPHA CHIMERIN) (A-CHIMAERIN).//5.90E-25//180aa//33%//P30337
UMVEN20000690
UMVEN20003540
UTERU20000740//Human fusion protein mRNA, complete cds.//4.90E-47//97aa//100%//M82829
UTERU20004240//CGI-96 protein//2.10E-39//108aa//81%//NP—056518
UTERU20006290
UTERU20006960//endoplasmic reticulum resident protein 58//5.90E-51//150aa//63%//NP—076994
UTERU20020010
UTERU20022940//Human (p23) mRNA, complete cds.//2.80E-80//147aa//99%//L24804
UTERU20030570//CHLORIDE CHANNEL PROTEIN CLC-KB (CLC-K2).//3.00E-252//469aa//99%//P51801
UTERU20040610
UTERU20046640//Mus musculus ldlBp (LDLB) mRNA, complete cds.//0//839aa//83%//AF109377
UTERU20046980//Mus musculus mRNA for thrombospondin type 1 domain, complete cds.//7.30E-117//232aa//87%//AB016768
UTERU20050690
UTERU20054460
UTERU20055330
UTERU20055480
UTERU20055930
UTERU20056010
UTERU20059050
UTERU20061030
UTERU20064000
UTERU20064860//GLUCOAMYLASE S1/S2 PRECURSOR (EC 3.2.1.3) (GLUCAN 1,4-ALPHA-GLUCOSIDASE) (1,4-ALPHA-D-GLUCAN GLUCOHYDROLASE).//1.50E-29//595aa//28%//P08640
UTERU20065930//GTP-RHO BINDING PROTEIN 1 (RHOPHILIN).//6.10E-131//489aa//48%//Q61085
UTERU20067050
UTERU20068990
UTERU20070040
UTERU20070810
UTERU20076390
UTERU20081300
UTERU20084260
UTERU20094350
UTERU20095380
UTERU20095400
UTERU20097760//OVCA2=candidate tumor suppressor [human, fetal brain, Peptide, 120 aa]//6.00E-30//66aa//95%//AAB36422
UTERU20099720//Homo sapiens mRNA for SPIN protein.//6.50E-72//186aa//79%//Y14946
UTERU20101240
UTERU20114100
UTERU20115740//Human PMS2 related (hPMSR3) gene, complete cds.//1.00E-43//84aa//98%//U38979
UTERU20116570//Homo sapiens actin-binding double-zinc-finger protein (abLIM) mRNA, complete cds.//4.80E-163//468aa//71%//AF005654
UTERU20118110
UTERU20118970
UTERU20119060
UTERU20119680
UTERU20120310//Rattus norvegicus rexo70 mRNA, complete cds.//1.50E-65//178aa//78%//AF032667
UTERU20124070
UTERU20126880
UTERU20134910
UTERU20135860
UTERU20143980
UTERU20144640//ACID CERAMIDASE PRECURSOR (EC 3.5.1.23) (ACYLSPHINGOSINE DEACYLASE) (N-ACYLSPHINGOSINE AMIDOHYDROLASE) (AC) (PUTATIVE 32 KDA HEART PROTEIN) (PHP32).//1.90E-166//243aa//100%//Q13510
UTERU20145480//Homo sapiens ZK1 mRNA for Kruppel-type zinc finger protein, complete cds.//4.40E-213//673aa//57%//AB011414
UTERU20146310//DIACYLGLYCEROL KINASE ETA (EC 2.7.1.107) (DIGLYCERIDE KINASE) (DGK-ETA) (DAG KINASE ETA).//4.50E-242//485aa//92%//Q64398
UTERU20146680
UTERU20150870
UTERU20151980//DUAL SPECIFICITY PROTEIN PHOSPHATASE 8 (EC 3.1.3.48) (EC 3.1.3.16) (DUAL SPECIFICITY PROTEIN PHOSPHATASE HVH-5).//5.20E-15//248aa//31%//Q13202
UTERU20158300
UTERU20158800//P-SELECTIN GLYCOPROTEIN LIGAND 1 PRECURSOR (PSGL-1) (SELECTIN P LIGAND) (CD162 ANTIGEN).//2.20E-185//384aa//95%//Q14242
UTERU20161570//PROBABLE G PROTEIN-COUPLED RECEPTOR RTA.//2.70E-141//303aa//85%//P23749
UTERU20164260
UTERU20168220//AIG1 PROTEIN.//7.70E-16//145aa//35%//P54120
UTERU20176130//Mus musculus zinc finger protein 289 (Zfp289) mRNA, complete cds.//4.00E-143//297aa//94%//AF229439
UTERU20176320//DNA REPAIR PROTEIN RAD18.//1.10E-40//333aa//32%//P53692
UTERU20178100
UTERU20179880
UTERU20183640//SEMAPHORIN 3B PRECURSOR (SEMAPHORIN V) (SEMA V).//1.20E-69//135aa//100%//Q13214
UTERU20185230//Human androgen-induced prostate proliferative shutoff associated protein (AS3) mRNA, complete cds.//1.90E-255//571aa//80%//U95825
UTERU20186740
UTERU20188110//Rattus norvegicus cytosolic sorting protein PACS-1a (PACS-1) mRNA, complete cds.//4.10E-157//315aa//97%//AF076183
UTERU20188810
1-14. (canceled)
15. A polynucleotide selected from the group consisting of the following (a) to (g): (a) a polynucleotide comprising a protein-coding region of the nucleotide sequence of any one of SEQ ID NOs: 1 to 2443;
(b) a polynucleotide encoding a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 2444 to 4886;
(c) a polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 2444 to 4886, wherein, in said amino acid sequence, one or more amino acids have been substituted, deleted, inserted, and/or added, and wherein said nucleotide sequence encodes a polypeptide functionally equivalent to a polypeptide comprising the selected amino acid sequence;
(d) a polynucleotide hybridizing to a polynucleotide comprising the nucleotide sequence of any one of SEQ ID NOs: 1 to 2443, wherein said nucleotide sequence encodes a polypeptide functionally equivalent to a polypeptide encoded by the selected nucleotide sequence;
(e) a polynucleotide comprising a nucleotide sequence encoding a partial amino acid sequence of a polypeptide encoded by the polynucleotide according to any one or (a) to (d); (f) a polynucleotide comprising a nucleotide sequence having at least 70% identity to the nucleotide sequence of any one of SEQ ID Nos: 1 to 2443; and
(g) a polynucleotide comprising sequences having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOs: 1 to 2443.
16. A polypeptide encoded by the polynucleotide of claim 15, or a partial peptide thereof.
17. An antibody binding to the polypeptide or the peptide of claim 16.
18. A method for immunologically assaying the polypeptide or the peptide of claim 16, said method comprising the steps of contacting the polypeptide or the peptide with the antibody binding to said polypeptide or said peptide, and observing the binding between the two.
19. A vector comprising the polynucleotide of claim 15.
20. A transformant carrying the polynucleotide of claim 15 or a vector comprising said polynucleotide.
21. A transformant carrying the polynucleotide of claim 15 or a vector comprising said polynucleotide in an expressible manner.
22. A method for producing a polypeptide or a peptide, said method comprising the steps of culturing the transformant of claim 21 and recovering an expression product.
23. An oligonucleotide comprising at least 15 nucleotides, said oligonucleotide comprising a nucleotide sequence complementary to the nucleotide sequence of any one of SEQ ID NOs: 1 to 2443 or to a complementary strand thereof.
24. A method for synthesizing the polynucleotide of claim 15, said method utilizing an oligonucleotide, which comprises a nucleotide sequence complementary to the nucleotide sequence of any one of SEQ ID NOs 1 to 2443 or to a complementary strand thereof, and comprises at least 15 nucleotides.
25. A method for detecting the polynucleotide of claim 15, said method utilizing an oligonucleotide, which comprises a nucleotide sequence complementary to the nucleotide sequence of any one of SEQ ID NOs: 1 to 2443 or to a complementary strand thereof, and comprises at least 15 nucleotides.
26. An antisense polynucleotide against the polynucleotide of claim 15 or a part thereof.
27. A method for detecting the polynucleotide of claim 15, said method comprising the following steps of:
(a) incubating a target polynucleotide with an oligonucleotice under hybridizable conditions, wherein said oligonucleotide comprises a nucleotide sequence complementary to the nucleotide sequence of any one of SEQ ID NOs: 1 to 2443 or to a complementary strand thereof, and comprises at least 15 nucleotides, and
(b) detecting hybridization of the target polynucleotide with the oligonucleotide.
28. A database of polynucleotides and/or polypeptides, said database comprising information on at least one of the nucleotide sequences of SEQ ID NOs: 1 to 2443 and/or on at least one of the amino acid sequences of SEQ ID NOs: 2444 to 4886.