Patent application title:

Methods for identifying genomic deletions

Publication number:

US20100003755A1

Publication date:
Application number:

11/825,118

Filed date:

2007-07-03

Abstract:

The genomic locus responsible for Van Buchem's disease is narrowed to an approximately 92 kb region of human chromosome 17 at 17q21. Individuals afflicted with or carriers of Van Buchem's disease exhibit a 52 kb deletion within this 92 kb region. Methods are provided that permit the differentiation between individuals homozygous for and therefore afflicted with Van Buchem's disease, individuals heterozygous for and therefore carriers of Van Buchem's disease, and individuals who are normal with respect to Van Buchem's disease. Also provided are general methodologies for the detection of a wide variety of large genomic deletions.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q1/6883 »  CPC main

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material

C12Q2600/156 »  CPC further

Oligonucleotides characterized by their use Polymorphic or mutational markers

C12N15/00 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor

Description

CROSS-REFERENCES TO RELATED APPLICATIONS

This application is a Continuation Under 35 U.S.C § 365 of co-pending International Application PCT/US01/23968, filed Jul. 30, 2001, which designates the U.S., and which claims priority to U.S. Provisional Patent Application No. 60/303,386, filed Jul. 6, 2001, and U.S. Provisional Patent Application No. 60/221,855, filed Jul. 28, 2000, which are incorporated herein by reference in their entirety.

BACKGROUND OF THE INVENTION

1. Field of the Invention

This invention relates generally to disease diagnosis and to the identification of disease carriers. More specifically, the present invention provides methods for identifying individuals who are afflicted with or carriers of diseases associated with one or more genomic deletion.

2. Description of the Related Art

Van Buchem's disease (VBD) is a rare autosomal recessive disorder that results in a bone dysplasia referred to as craniotubular hyperostosis. VBD was first described in 1962 as including osteosclerosis of the skull, mandible, clavicles, ribs, and diaphysis of the long bones beginning during puberty and, in some cases, leading to optic atrophy and perceptive deafness from nerve pressure. Van Buchem et al., Am. J. Med. 33:387-397 (1962).

More recently, additional occurrences of VBD have been reported. In 1988, Fryns et al. described a 7.5-year-old boy with VBD. This patient had presented at 2 months of age with left-side peripheral facial nerve palsy but had, at that time, no radiologically visible signs of sclerosis of the skull. Europ. J. Pediat. 147:99-100 (1988).

In 1997, Balemans et al. studied II VBD patients from a highly inbred and geophraphically isolated Dutch family. Each of these patients shared a common ancestor from 9 preceding generations. By applying a genome wide search for linkage using more than 300 microsatellite markers having an average spacing of 10 cM, these authors found a maximum lod score of 9.33 at theta=0.01 with marker D17S1299 and narrowed the assignment to a region of less than 1 cM between markers D17S1787 and D17S934. Am. J. Hum. Genet. 61(Suppl.):A12 (1997); See, also, Van Hul et al., Am. J. Hum. Genet. 62:391-399 (1998).

A related disease sclerosteosis is an autosomal semi-dominant disease that shares some of the clinical symptoms of VBD. The term “sclerosteosis” has been applied to a disorder similar to Van Buchem hyperostosis corticalis generalisata but differing in the radiologic appearance of the bone changes and in the presence of asymmetric cutaneous syndactyly of the index and middle fingers in many cases. In Handbuch der Kinderheilkunde 351-355 (Opitz, H. et al., Berlin: Springer (pub.), 1967). More specifically, this disease resembles VBD in that it comprises a progressive sclerosing bone dysplasia characterized by generalized osteosclerosis and hyperostosis of the skeleton, affecting mainly the skull and mandible thereby causing facial paralysis and hearing loss. In contrast to VBD, however, sclerosteosis is further characterized by gigantism and hand abnormalities.

The rare genetic mutation responsible for the sclerosteosis syndrome has been localized to the region of human chromosome 17 that encodes a novel member of the TGF-beta binding-protein family (one representative example of which is designated “hSOST”). In 1999, Balemans et al. assigned the locus for sclerosteosis to 17q12-q21 which is the same general region as the locus for VBD. Am. J. Hum. Genet. 64:1661-1669 (1999). Due to the clinical similarities between VBD and sclerosteosis, Beighton et al. suggested that these conditions might be caused by mutations within the same gene. Clin. Genet. 25:175-181 (1984). This hypothesis was further supported by the genetic experimentation later performed by Balemans et al. Supra.

Traditional methodologies for identifying genomic deletions such as, for example, restriction fragment length polymorphism (RFLP), fluorescence in situ hybridization (FISH) and Southern blotting permit the identification of individuals who are homozygous for a genomic deletion and, as a consequence, are afflicted with the associated genetic disease. Because these methods are time consuming and/or require high-quality DNA samples or live cells, they are of limited use in the identification of individuals who are heterozygous for and, therefore, carriers of a genetic disease. What is needed in the art are methods that permit the rapid identification of genetic disease carriers, which methods distinguish between individuals who are homozygous for a genomic deletion, individuals who are heterozygous for a genomic deletion and individuals who do not possess a given genomic deletion. As described in detail herein, the present invention fulfills this and other related needs.

BRIEF SUMMARY OF THE INVENTION

The present invention is directed generally to disease diagnosis and to the identification of disease carriers. More specifically, the invention disclosed herein provides methods for identifying chromosomal deletions that are associated with a disease phenotype. Particular methods within the scope of the present invention are directed to the identification of individuals who are afflicted with or carriers for the genomic deletion associated with Van Buchem's disease. By alternate embodiments, the present invention also provides methods having general utility in the detection of a wide variety of diseases characterized by genomic deletions.

The present invention provides, in one embodiment, methods for distinguishing between an individual who is homozygous for a genomic deletion, an individual who is heterozygous for a genomic deletion and an individual who is negative for a genomic deletion.

A first method comprises: (a) obtaining a sample of genomic DNA from an individual; (b) performing a first amplification reaction with a first oligonucleotide primer pair comprising a first oligonucleotide primer and a second oligonucleotide primer wherein the first oligonucleotide primer is complementary to the nucleotide sequence upstream of the genomic deletion and the second oligonucleotide primer is complementary to the nucleotide sequence downstream of said genomic deletion; (c) performing a second amplification reaction with a second oligonucleotide primer pair comprising a third oligonucleotide primer and a fourth oligonucleotide primer wherein the third oligonucleotide primer is complementary to the nucleotide sequence either upstream or downstream of the genomic deletion and the fourth oligonucleotide primer is complementary to the nucleotide sequence comprising the genomic deletion; and (d) detecting the product of the amplification reactions of (b) and (c).

By this first type method, a positive amplification reaction of (b) and a negative amplification reaction of (c) indicates an individual who is homozygous for the large genomic deletion; a positive amplification reaction of (b) and a positive amplification reaction of (c) indicates an individual who is heterozygous for the large genomic deletion; and a negative amplification reaction of (b) and a positive amplification reaction of (c) indicates an individual who is negative for the large genomic deletion.

A second method comprises: (a) obtaining a sample of genomic DNA from said individual; (b) performing an amplification reaction employing at least two oligonucleotide primer pairs in which an oligonucleotide primer is common to both said primer pairs, wherein a first primer pair has a first oligonucleotide primer complementary to a nucleotide sequence that flanks said genomic deletion upstream of said genomic deletion and a second oligonucleotide primer complementary to a nucleotide sequence that flanks said genomic deletion downstream of said genomic deletion, and a second primer pair has third oligonucleotide primer complementary to a nucleotide sequence within said genomic deletion and either said first or second oligonucleotide primer; and (c) detecting an amplified product of said amplification reaction.

By this second method, a positive amplification reaction of said first primer pair and a negative amplification reaction of said second primer pair indicates an individual that is homozygous for said large genomic deletion; a positive amplification reaction of said first primer and a positive amplification reaction of said second primer pair indicates an individual that is heterozygous for said large genomic deletion; and a negative amplification reaction of said first primer pair and a positive amplification reaction of said second primer pair indicates an individual that is negative for said large genomic deletion.

Both these methodologies will find utility in the detection of large genomic deletions comprising at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40 or 50 kb. By some embodiments, the presence of the large genomic deletion is indicative of an individual who is either afflicted with or a carrier of a genetic disease. The genetic disease is exemplified herein by Van Buchem's disease, but the methods are suitable for any disease characterized by large genomic deletions.

In further embodiments, the present invention provides a first method for identifying individuals who are afflicted with or carriers of Van Buchem's disease. This first method comprises (a) obtaining a sample of genomic DNA from an individual; (b) performing a first amplification reaction with a first oligonucleotide pair primer having a first oligonucleotide primer and a second oligonucleotide primer wherein the first oligonucleotide primer is complementary to the nucleotide sequence upstream of the 51,719 bp sequence depicted in SEQ ID NO:2 which sequence corresponds to nucleotides 5,798 through 57,516 of the 92,149 bp nucleic acid sequence depicted in SEQ ID NO:1 and the second oligonucleotide primer is complementary to the nucleotide sequence downstream of the 51,719 bp sequence depicted in SEQ ID NO:2; and (c) performing a second amplification reaction with a second oligonucleotide pair primer comprising a third oligonucleotide primer and a fourth oligonucleotide primer wherein the third oligonucleotide primer is complementary to the nucleotide sequence either upstream or downstream of the 51,719 bp sequence depicted in SEQ ID NO:2 and the fourth oligonucleotide is complementary to the nucleotide sequence within the 51,719 bp sequence depicted in SEQ ID NO:2; and (d) detecting the product of the amplification reactions of (b) and (c).

By this first method, a positive amplification reaction of (b) and a negative amplification reaction of (c) indicates an individual afflicted with Van Buchem's disease; a positive amplification reaction of (b) and a positive amplification reaction of (c) indicates an individual who is a carrier of Van Buchem's disease; and a negative amplification reaction of (b) and a positive amplification reaction of (c) indicates an individual that is neither afflicted with nor a carrier of Van Buchem's disease.

Exemplary first oligonucleotide primer pairs may be selected from the group consisting of 12952/VBspan1 (SEQ ID NO:84/SEQ ID NO:85), Span1F/Span1R (SEQ ID NO:86/SEQ ID NO:87), Span2F/Span2R (SEQ ID NO:88/SEQ ID NO:89) and Vbspan2/Vbspan1 (SEQ ID NO:104/SEQ ID NO:85). Exemplary second oligonucleotide pairs may be selected from the group consisting of 12952/Wt1R (SEQ ID NO:84/SEQ ID NO:90), Wt2F/Wt2R (SEQ ID NO:91/SEQ ID NO:92), Wt3F/Wt3R (SEQ ID NO:93/SEQ ID. NO:94) and VBspan2/VBint1 (SEQ ID NO:105/SEQ ID NO:102).

A second method comprises: (a) obtaining a sample of genomic DNA from said individual; (b) performing a polymerase chain reaction employing at least two oligonucleotide primer pairs in which an oligonucleotide primer is common to both said primer pairs, wherein a first primer pair has a first oligonucleotide primer that is complementary to a nucleotide sequence upstream of the 51,719 bp sequence provided in SEQ ID NO:2 and a second oligonucleotide primer that is complementary to a nucleotide sequence downstream of the 51,719 bp sequence provided in SEQ ID NO:2, and a second primer pair has a third oligonucleotide primer that is complementary to a nucleotide sequence within said genomic deletion and either said first or second oligonucleotide primer; and (c) detecting an amplified product of said amplification reaction.

By this second method, a positive polymerase chain reaction of said first primer pair and a negative polymerase chain reaction of said second primer pair indicates an individual afflicted with Van Buchem's disease; a positive polymerase chain reaction of said first primer pair and a positive polymerase chain reaction of said second primer pair indicates an individual that is a carrier of Van Buchem's disease; and a negative polymerase chain reaction of said first primer pair and a positive polymerase chain reaction of said second primer pair indicates an individual that is neither afflicted with nor a carrier of Van Buchem's disease.

Exemplary first oligonucleotide primer pair is selected from the group consisting of 12952/VBspan1 (SEQ ID NO:84/SEQ ID NO:85), Span1F/Span1R (SEQ ID NO:86/SEQ ID NO:87), Span2F/Span2R (SEQ. ID NO:88/SEQ ID NO:89), Wt2F/VBspan1 (SEQ ID NO:91/SEQ ID NO:85) and VBspan2/VBspan1 (SEQ ID NO:104/SEQ ID NO:85).

Still further embodiments of the present invention provide alternative methods for identifying individuals afflicted with Van Buchem's disease. Exemplary methods comprise the steps of performing an amplification reaction with a pair of oligonucleotides selected from the region between nucleotide 1 and nucleotide 51,719 of SEQ ID NO:2 wherein the absence of an amplification product indicates an individual homozygous for Van Buchem's disease. Exemplary oligonucleotide pairs are selected from the group consisting of Del1F/Del1R (SEQ ID NO:95/SEQ ID NO:96), Del2F/Del2R (SEQ ID NO:97/SEQ ID NO:98), and Del3F/Del3R (SEQ ID NO:99/SEQ ID NO:100).

Other embodiments provide methods for identifying an individual who is homozygous for Van Buchem's disease comprising the step of detecting a deletion in human chromosome 17 at 17q21 between nucleotide 5,798 and nucleotide 57,516 as depicted in SEQ ID NO:1.

By still other embodiments are provided methods for detecting an individual who is afflicted with or a carrier of Van Buchem's disease which methods comprise detecting the nucleotide sequence spanning the deletion breakpoint as depicted in FIG. 2 and SEQ ID NO:101. By these methods, the presence of a deletion breakpoint indicates an individual who is either afflicted with or a carrier of Van Buchem's disease. Exemplary nucleotide sequences spanning the deletion breakpoint comprise the nucleotide sequence 5′-ACCATGCCCGGCTAAT-3′ (SEQ ID NO:102); the nucleotide sequence 5′-CTACCATGCCCGGCTAATTIT-3′ (SEQ ID NO:103); and the nucleotide sequence 5′-TGGGATTACAGGTGCATGCTACCATGCCCGGCTAATTTTTTTGTA TTTTTTTAGTA-3′ (SEQ ID NO:101).

In still further embodiments of the present invention are provided isolated polynucleotides. Preferred polynucleotides comprise at least 10, 15, 20, 25, 30, 40, 50, 100, 250 or 500 contiguous nucleotides of the nucleic acid depicted in SEQ ID NO:1. Alternatively, isolated polynucleotides according to the present invention hybridize under moderately stringent conditions to the nucleic acid depicted in SEQ ID NO:1 or the complement thereof. Preferred moderately stringent conditions comprise 2×SSC, 0.1% SDS at 65° C.

Other embodiments provide isolated polynucleotides that comprise at least 10, 15, 20, 25, 30, 40, 50, 100, 250 or 500 nucleotides of one of the amplicons comprising the predicted exons within human chromosome 17 at 17q21 which amplicons are selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, and SEQ ID NO:17.

Still further embodiments of the present invention provide diagnostic kits for distinguishing between an individual who is homozygous for a large genomic deletion, an individual who is heterozygous for a large genomic deletion and an individual who is negative for a large genomic deletion.

A first kit comprises: (a) a first oligonucleotide primer pair comprising a first oligonucleotide primer and a second oligonucleotide primer, wherein said first oligonucleotide primer is complimentary to a nucleotide sequence upstream of said genomic deletion and said second oligonucleotide primer is complementary to a nucleotide sequence downstream of said genomic deletion; and (b) a second oligonucleotide primer pair comprising a third oligonucleotide primer and a fourth oligonucleotide primer wherein said third oligonucleotide primer is complementary to a nucleotide sequence either upstream or downstream of said genomic deletion and said fourth oligonucleotide primer is complementary to a nucleotide sequence within said genomic deletion. These types of diagnostic kit can further comprises instructions for distinguishing between an individual who is homozygous for a large genomic deletion, an individual who is heterozygous for a large genomic deletion and an individual who is negative for a large genomic deletion.

A second kit comprises: (a) a first primer pair having a first oligonucleotide primer that is complementary to a nucleotide sequence that flanks said genomic deletion upstream of said genomic deletion and a second oligonucleotide primer that is complementary to a nucleotide sequence that flanks said genomic deletion downstream of said genomic deletion; and (b) a second primer pair having a third oligonucleotide primer that is complementary to a nucleotide sequence within said genomic deletion and either said first or second oligonucleotide primer.

The genomic deletion mentioned can be associated with Van Buchem's disease. In which case one type of diagnostic kit for identifying a carrier of Van Buchem's disease comprises: (a) a first oligonucleotide primer pair comprising a first oligonucleotide and a second oligonucleotide wherein said first oligonucleotide is complementary to a nucleotide sequence upstream of the 51,719 bp sequence depicted in SEQ ID NO:2 and said second oligonucleotide is complementary to a nucleotide sequence downstream of the 51,719 bp sequence depicted in SEQ ID NO:2; and (b) a second oligonucleotide primer pair comprising a third oligonucleotide and a fourth oligonucleotide wherein said third oligonucleotide is complementary to either the nucleotide sequence upstream or downstream of said 51,719 bp sequence depicted in SEQ ID NO:2 and said fourth oligonucleotide is complementary to a nucleotide sequence within said 51,719 bp sequence depicted in SEQ ID NO:2. These diagnostic kits can further comprise instructions for identifying a carrier of Van Buchem's disease.

A second kit comprises: (a) a first oligonucleotide pair having a first oligonucleotide primer that is complementary to a nucleotide sequence upstream of the 51,719 bp sequence provided in SEQ ID NO:2 and a second oligonucleotide primer that is complementary to a nucleotide sequence downstream of the 51,719 bp sequence depicted in SEQ ID NO:2; and (b) a second oligonucleotide pair having a third oligonucleotide primer that is complementary to a nucleotide sequence within said 51,719 bp sequence provided in SEQ ID NO:2 and either said first or second oligonucleotide primer.

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF DRAWINGS

FIG. 1A illustrates results obtained from microsatellite typing and exon sequencing of the approximately 90 kb region between the MEOX1 and SOST genes within human chromosome region 17q21. FIG. 1B shows the about 53 bp genomic deletion as well as illustrates the nucleotide sequence spanning the deletion breakpoint (SEQ ID NO:101) in nucleic acid sequences obtained from individuals afflicted with Van Buchem's disease.

FIG. 2 illustrates expected results from the polymerase chain reactions utilizing exemplary oligonucleotide primer pairs in the first-described method, where the nucleic acid sample is obtained from an individual who is (1) a non-carrier for Van Buchem's disease; (2) heterozygous for, and therefore a carrier of, Van Buchem's disease; or (3) homozygous for, and therefore afflicted with, Van Buchem's disease.

FIG. 3 illustrates expected results from the polymerase chain reaction utilizing exemplary oligonucleotide primer pairs in the second-described method, where the nucleic acid sample is obtained from an individual who is (1) a non-carrier for Van Buchem's disease; (2) heterozygous for, and therefore a carrier of, Van Buchem's disease; or (3) homozygous for, and therefore afflicted with, Van Buchem's disease.

DETAILED DESCRIPTION OF THE INVENTION

As part of the present invention, it was discovered, through haplotype analysis of a number of VBD patients carrying recombinant chromosomes, that the VBD gene localized to a critical region of less than 1 Mb, between the polymorphic markers BP12574 (D17S2250) and JM6307 (D17S2253) (see Example 1). Further microsatellite typing, as well as characterization of the candidate genes within the 1 Mb region through exon sequencing, revealed a specific chromosomal aberration that segregated absolutely with VBD (see Example 3).

As discussed in detail in Example 3, two independent experimental approaches to identifying the VBD candidate region revealed the presence of a chromosomal deletion associated with VBD. First, the oligonucleotide pair D17S1789 (see FIG. 1 and Table 3) did not permit the PCR amplification of a DNA fragment from genomic DNA isolated from VBD patients but did facilitate the amplification of a fragment from normal individuals. Second, nucleotide sequencing and computational analysis, with the GENSCAN exon prediction algorithm of Burge et al., of a 92,149 bp fragment (SEQ ID NO:1) within the human 17q21 chromosomal locus revealed the presence of 15 putative exon sequences. J. Mol. Biol. 268:78-94 (1997). As presented in FIG. 1 and as discussed in detail in Example 3, 12 of these 15 exon fragments did not amplify from genomic DNA isolated from VBD-afflicted individuals.

In total, these results demonstrated for the first time the presence of a genomic deletion within human chromosome 17q21 that segregates absolutely with Van Buchem's disease. Furthermore, nucleotide sequencing of the region spanning the deletion breakpoint (SEQ ID NO:101) revealed that approximately 52 kb of contiguous genomic DNA is invariably deleted from chromosome 17 at position 17q21 in individuals afflicted with VBD. The sequence of the 52 kb region is presented herein as SEQ ID NO:2.

Isolated Polynucleotides

As noted above, the present invention provides isolated polynucleotides comprising at least 10, 15, 20, 25, 30, 40, 50, 100, 250, 500, 600, 700, 800 up to and including the 92,101 base pairs (bp) nucleotide sequence of human chromosome 17 at 17q21 disclosed herein as SEQ ID NO:1. Also provided by the present invention are isolated polynucleotides comprising at least 10, 15, 20, 25, 30, 40, 50, 100, 250, 500 bp up to and including the 52 kb sequence of 17q21 that is deleted in individuals who are either afflicted with or carriers of Van Buchem's disease (i.e. SEQ ID NO:2). As well, the present invention provides polynucleotides comprising at least 10, 15, 20, 25, 30, 40, 50, 100, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850 or 890 bp of any of the exons depicted in SEQ ID NOs: 3-17. Other embodiments of the present invention provide oligonucleotide probes of at least 10, 15, 20, 25, 30, 40, 50, 100, 250, 500, 600, 750, 1000, 1050, 1100, 1200 or 1300 that hybridize under moderately stringent conditions to the nucleotide sequence of SEQ ID NO:1 or complements thereto. Exemplary oligonucleotide probes according to the present invention include those designated herein by SEQ ID NOs:28-100.

As used herein, the phrase “isolated polynucleotide” refers to a DNA molecule that has been isolated free of total genomic DNA of a particular species. As will be understood by those skilled in the art, the isolated polynucleotides of the present invention can include genomic sequences, extra-genomic and plasmid-encoded sequences and smaller engineered gene segments that express, or may be adapted to express, proteins, polypeptides, peptides and the like. Such segments may be naturally isolated, or synthesized de novo.

Thus, “isolated,” as used herein, means that the polynucleotide is substantially separated away from other genomic sequences and that the polynucleotide does not contain large portions of unrelated coding DNA, such as large chromosomal fragments. Of course, this refers to the polynucleotide as originally isolated, and does not exclude genes or coding regions later added to the segment.

As will be recognized by the skilled artisan, isolated polynucleotides may be single-stranded or double-stranded, and may be DNA or RNA molecules. Additional coding or non-coding sequences may, but need not, be present within a polynucleotide of the present invention, and a polynucleotide may, but need not, be linked to other molecules and/or support materials.

It is also contemplated that the present invention encompasses polynucleotides having substantial identity to any of the sequences disclosed herein, for example the present invention encompasses those isolated polynucleotides comprising at least 50% or more sequence identity, preferably at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher, sequence identity compared to a polynucleotide sequence of this invention using the methods described herein, (e.g., BLAST, described in Altschul et al., J. Mol. Biol. 215:403-410 (1990)). For the purposes of this invention, a preferred method of calculating percent identity is the Smith-Waterman algorithm, using the following. Global DNA sequence identity must be at least 50% as determined by the Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular) using an affine gap search with the following search parameters: gap open penalty, 12; and gap extension penalty, 1.

In additional embodiments, the present invention provides isolated polynucleotides comprising various lengths of contiguous stretches of sequence identical to or complementary to one or more of the sequences disclosed herein. For example, isolated polynucleotides are provided by this invention that comprise at least about 10, 15, 20, 25, 30, 40, 50, 100, 250, 500, 600, 750, 1000, 1050, 1100, 1200 or 1300 or more contiguous nucleotides of one or more of the sequences disclosed herein.

The polynucleotides of the present invention, or fragments thereof, may be combined with other DNA sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably. It is therefore contemplated that a nucleic acid fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant DNA protocol.

In other embodiments, the present invention is directed to polynucleotides that are capable of hybridizing under moderately stringent conditions to a polynucleotide sequence provided herein, or a fragment thereof, or a complementary sequence thereof. Hybridization techniques are well known in the art of molecular biology. For purposes of illustration, suitable moderately stringent conditions for testing the hybridization of a polynucleotide of this invention with other polynucleotides includes hybridization in a solution of 2×SSC, 0.1% SDS, 1.0 mM EDTA (pH 8.0) at 65° C.

In still other embodiments of the present invention, the polynucleotide sequences provided herein may be employed as primers in the amplification methodology disclosed herein, infra. As such, it is contemplated that polynucleotides comprising at least about 10 nucleotides that have the same sequence as, or that are complementary to, a 10 nucleotide long contiguous sequence disclosed herein will find utility as an amplification primer. Longer contiguous identical or complementary sequences, e.g., those of about 15, 20, 25, 30, 40, 50, 100, 250, 500, 600, 750, 1000, 1050, 1100, 1200 or 1300 or more will also be of use in certain embodiments.

Small polynucleotide segments or fragments may be readily prepared by, for example, directly synthesizing the fragment by chemical means, as is commonly practiced using an automated oligonucleotide synthesizer. Also, fragments may be obtained by application of nucleic acid reproduction technology, such as the PCR™ technology of U.S. Pat. No. 4,683,202 (incorporated herein by reference), by introducing selected sequences into recombinant vectors for recombinant production, and by other recombinant DNA techniques generally known to those of skill in the art of molecular biology. See, e.g., Ausubel et al. (eds.), Short Protocols in Molecular Biology (3rd Ed., John Wiley & Sons 1995).

Methodologies for Detecting Van Buchem's Disease Carriers

As noted above, the present invention provides methods for detecting carriers of Van Buchem's disease. More specifically, within certain embodiments, these methods permit the differentiation between individuals who are homozygous for, and therefore afflicted with, VBD; individuals who are heterozygous for, and therefore carriers of, VBD; and individuals who are normal with respect to VBD. As described in detail herein, infra, the presently disclosed methodology will find general utility in the detection of a wide variety of diseases associated with genomic deletions of any length.

The methodology according to the present invention relies, in part, on the inability of various DNA polymerases that are typically utilized in amplification reactions to amplify DNA fragments beyond a maximum nucleotide length. As discussed above, the genomic locus associated with Van Buchem's disease is associated with a large chromosomal deletion of approximately 52 kb at 17q21. Consequently, this deletion results in the juxtaposition of nucleotide sequences present in the genomic DNA of non-VBD-afflicted individuals that are normally separated by greater than 52 kb. Because DNA polymerases normally utilized for the amplification of DNA fragments cannot amplify a 52 kb fragment, a pair of oligonucleotide primers that bind to nucleotide sequences upstream or downstream of this 52 kb region will not permit the amplification of DNA from a non-VBD-afflicted individual. In contrast, however, the same pair of oligonucleotide primers will facilitate the amplification of a DNA fragment from genomic DNA isolated from either a VBD-afflicted individual or from a VBD carrier.

The figures illustrate the genomic DNA corresponding to human chromosome 17 at 17q21 between the MEOX1 gene and exon 4. The genomic DNA from non-VBD-afflicted individuals comprises a 52 kb fragment described above while genomic DNA from VBD-afflicted individuals lack this 52 kb region. FIGS. 2 and 3 also illustrate exemplary oligonucleotide primers that hybridize to various regions within the 7q21 locus. Oligonucleotide primers designated VBspan2 and VBspan1/12953, and 12952 and VBspan1/12953 hybridize to nucleotide sequences, on complementary strands, that flank this 52 kb region in normal genomic DNA and, consequently, that flank the deletion breakpoint in genomic DNA from VBD-afflicted individuals. Because of the intervening 52 kb fragment in normal genomic DNA, neither the VBspan2/VBspan1 oligonucleotide primer pair nor the 12952/12953 oligonucleotide primer pair will permit the amplification (e.g., by PCR; see infra) of a DNA fragment from non-VBD-afflicted individuals. In contrast, the VBspan2/VBspan1 oligonucleotide pair primer will facilitate the amplification of a 642 bp fragment, and the 12952/12953 oligonucleotide pair primer will facilitate the amplification of a 798 bp fragment from the DNA of a VBD-afflicted individual.

The methodology according to the present invention additionally permits the differentiation between an individual who is heterozygous for the 52 kb genomic deletion and therefore a carrier of VBD; an individual who is homozygous for the 52 kb genomic deletion and therefore afflicted with VBD; and an individual who is neither a carrier of nor afflicted with VBD. This is achieved by the performance of a second amplification reaction employing a second pair of oligonucleotide primers wherein a third oligonucleotide primer hybridizes to a region of the genomic DNA flanking, either upstream or downstream of, the 52 kb sequence and a fourth oligonucleotide primer hybridizes to a region of the genomic DNA within the 52 kb sequence.

Alternatively, this can be performed using a single multiplex reaction employing a second pair of oligonucleotide primers wherein a third oligonucleotide primer hybridizes to a region of the genomic DNA within the 52 kb sequence and the other oligonucleotide primer is one of the primers from the first oligonucleotide primer pair. Such an oligonucleotide pair is exemplified in FIG. 3 by the VBspan2/VBint1 (SEQ ID NO:104/SEQ ID NO:105) oligonucleotide pair (SEQ ID NO:91/SEQ ID NO:92). As depicted in FIG. 3, a PCR reaction employing this oligonucleotide pair will amplify a 720 bp DNA fragment from the genomic DNA from an individual who is neither afflicted nor a VBD-carrier and from the genomic DNA of a heterozygous VBD-carrier but will not amplify a DNA fragment from the genomic DNA of a homozygous VBD-afflicted individual.

The methodologies according to the present invention permit an alternative approach to differentiating between an individual who is heterozygous for the 52 kb genomic deletion and therefore a carrier of VBD; an individual who is homozygous for the 52 kb genomic deletion and therefore afflicted with VBD; and an individual who is neither a carrier of nor afflicted with VBD, as described in Examples 4 and 5.

In Example 4, this can be achieved using at least two amplification reactions. In Example 5, this can be achieved by the performance of a single multiplex amplification reaction employing at least two oligonucleotide primer pairs, in which one oligonucleotide is common to both pairs. Thus the amplification reaction includes three oligonucleotide primers in total.

Thus, by the present invention provides two methodologies that permit the identification of VBD carriers by allowing the differentiation between an individual who is homozygous for the 52 kb genomic deletion and, therefore, afflicted with VBD; an individual who is heterozygous for the 52 kb genomic deletion and, therefore, a carrier for VBD; and an individual who is normal with respect to the 52 kb deletion and, therefore, neither a carrier of nor afflicted with VBD.

While the present invention discloses the nucleotide sequences of specific exemplary oligonucleotide primers that may be utilized according to the methodologies disclosed herein, it will be apparent to the skilled artisan that alternative oligonucleotide primers may be designed based on the nucleotide sequence depicted in SEQ ID NO:1 which primers are entirely within the scope of the present invention. Thus, for example, suitable oligonucleotide primers according to the present invention include polynucleotides comprising at least 10, 15, 20, 25, 30, 40, 50, 60, 75, 90 or 100 contiguous nucleotides of the nucleic acid depicted in SEQ ID NO:1.

It will also be apparent to one skilled in the art that the choice of reaction conditions and DNA polymerases employed for performing the amplification reactions may be varied in accordance with such parameters as the nucleotide sequence of the oligonucleotide primers and the distance between the primer pairs. Exemplary conditions for 25 ul reactions according to the present methodologies include, but are not limited to, the following: 10 ng genomic DNA; 60 mM TrisHCl pH 7.5; 15 mM ammonium sulfate; 2.5 mM magnesium chloride; 0.4 mM dNTP; and 0.2 uM of each oligonucleotide primer. A typical amplification protocol involves an initial denaturation at 94° C. for 3 min.; 40 cycles of 94° C. for 1 min., 68° C. for 1 min. and 72° C. for 1 min.; and a final extension reaction at 72° C. for 5 min. Amplicons may be resolved by electrophoresis on a 1% agarose gel run in 1×TAE buffer and may be detected by staining with ethidium bromide. Further exemplary conditions for 50 μl reactions according to the present methodologies include, but are not limited to, the following: 20 ng genomic DNA, 0.4 μM each of VBspan1 and VBint1, 0.8 μM of VBspan2, 0.2 mM of each dNTP, 120 mM TrisHCl, pH 7.5, 30 mM ammonium sulfate, 5.0 mM magnesium chloride and 2.5 U Taq polymerase (Roche Molecular Biochemicals, Indianapolis, Ind.). A further typical amplification protocol involves an initial denaturation at 94° C. for 3 min, 40 cycles of 94° C. for 30 sec, 63° C. for 30 sec, 72° C. for 2 min and a final extension of 72° C. for 5 min. Amplicons may be resolved by electrophoresis on a 2.5% agarose gel run in 1×TAE buffer and may be detected by staining with ethidium bromide.

Genomic DNA may be isolated by standard procedures that are readily available to those of skill in the art. Representative methodology are provided, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratories, Cold Spring Harbor, N.Y., 1989) and in Ausubel et al. (eds.), Short Protocols in Molecular Biology (4th Ed., John Wiley & Sons 1999).

General methodology for performing the polymerase chain reaction (PCR™) are described in detail in U.S. Pat. Nos. 4,683,195; 4,683,202 and 4,800,159, each of which is incorporated herein by reference in its entirety. Briefly, in PCR™, two primers are prepared which have sequences that are complementary to regions on opposite complementary strands of the target sequence. An excess of deoxynucleoside triphosphates is added to a reaction mixture along with a DNA polymerase (e.g., Taq polymerase; see, infra, for exemplary alternative polymerases). If the target sequence is present in a sample, the primers will bind to the target and the polymerase will cause the primers to be extended along the target sequence by adding on nucleotides. By raising and lowering the temperature of the reaction mixture, as indicated, supra, the extended primers will dissociate from the target to form reaction products, excess primers will bind to the target and to the reaction product and the process is repeated.

In addition to the polymerase chain reaction, it is contemplated that alternative amplification procedures that are readily available in the art may be employed in the methodology disclosed herein. For example, another suitable method for amplification is the ligase chain reaction (LCR) and is disclosed in Eur. Pat. Appl. Publ. No. 320,308: (incorporated herein by reference). Briefly, in LCR, two complementary probe pairs are prepared, and in the presence of the target sequence, each pair will bind to opposite complementary strands of the target such that they abut. In the presence of a ligase, the two probe pairs will link to form a single unit. By temperature cycling, as in PCR™, bound ligated units dissociate from the target and then serve as “target sequences” for ligation of excess probe pairs. For a related technique, see also, U.S. Pat. No. 4,883,750, incorporated herein by reference in its entirety.

Alternatively, other methods may be similarly employed in place of the polymerase chain reaction for amplification of nucleic acid sequences include the following: (1) Qbeta Replicase, PCT Intl. Pat. Appl. Publ. No. PCT/US87/00880; (2) the isothermal amplification method of Walker et al.; (3) strand displacement amplification (SDA); (4) repair chain reaction (RCR); (5) cyclic probe reaction (CPR); see, also, Great Britain Pat. Appl. No. 2 202 328, and in PCT Intl. Pat. Appl. Publ. No. PCT/US89/01025; (7) transcription-based amplification systems (TAS) Kwoh et al., 1989; PCT Intl. Pat. Appl. Publ. No. WO 88/10315; (8) Eur. Pat. Appl. Publ. No. 329,822; (9) PCT Intl. Pat. Appl. Publ. No. WO 89/06700; (10) “RACE” (Frohman, 1990); (11) “one-sided PCR” (Ohara, 1989). Each of these methods is incorporated herein by reference.

The choice of DNA polymerase to be employed in the polymerase chain or other amplification reaction can also be determined by the skilled artisan without undue experimentation. As discussed above, the major consideration in selecting an appropriate polymerase is the maximum length of DNA fragment that may be amplified. Such a determination may be achieved initially by reference to the guidelines set forth by the individual manufacturers and ultimately through empirical means by testing stepwise increases in the length of DNA fragment amplified. Additionally or alternatively, the precise reaction condition parameters such as, for example, salt concentration, divalent cation employed and reaction temperature may all be varied in order to adjust, as desired, the length of DNA fragment that may be amplified. The determination of optimal reaction parameters is wholly within the expertise of the skilled artisan.

Exemplary polymerases that may be employed in the present methodology include the various DNA polymerases, and variants thereof, isolated from thermostable bacteria such as the following: Taq, Vent and Deep Vent DNA polymerases (New England BioLabs; Beverly, Mass.); AdvanTaq™, AdvanTaq Plus™, and Advantage® 2 (Clontech; Palo Alto, Calif.); SuperTaq (Ambion; Austin, Tex.); Tth and Pwo polymerases (Roche Molecular Biochemicals; Indianapolis, Ind.); AmpliTaq (PE Biosystems; Foster City, Calif.); and Taq2000 and Pfu DNA polymerases (Stratagene; La Jolla, Calif.).

General Methods for Detection of Large Genomic Deletions

The methodology disclosed herein, supra, for the detection of the large genomic deletion associated with Van Buchem's disease and carriers thereof may be applied broadly, and therefore will find general utility, in the detection of a wide variety of diseases associated with large genomic deletions. In short, the present methods take advantage of the inability of commonly available DNA polymerases to amplify nucleic acid fragments above a certain maximum size when employed in a polymerase chain or other amplification reaction.

Thus, as noted above, the present invention provides general methodologies for distinguishing between an individual who is homozygous for a large genomic deletion, an individual who is heterozygous for a large genomic deletion and an individual who is negative for a large genomic deletion. These methods are discussed in detail in Examples 4 and 5.

As used herein, the phrase “large genomic deletion” refers to those deletions that result from the loss of a contiguous stretch of genomic DNA of such a length that it cannot be amplified in an amplification reaction as disclosed herein, supra. One skilled in the art will recognize, therefore, that the phrase “large genomic deletion” will vary depending on the precise reaction conditions and DNA polymerases employed in the amplification reactions. Generally, the phrase “large genomic deletion” may refer to deletions of at least 2 contiguous kilobases (kb) of genomic DNA. Alternatively, a “large genomic deletion” refers to deletions of at least 3, 4, 5, 6, 7, 8, 9, 10 or more contiguous kb of genomic DNA. Also included within the definition of “large genomic deletions” are deletions of at least 15, 20, 25, 30, 40 or 50 contiguous kb of genomic DNA.

EXAMPLES

The following experimental examples are offered by way of illustration, not limitation.

Example 1

The Van Buchem's Disease Locus Localizes to a Region of Less than 1 Mb

This example discloses that haplotype analysis of a number of Van Buchem's Disease patients carrying recombinant chromosomes localized the disease to a critical region of less than 1 Mb in a region between the polymorphic markers BP12574 (D17S2250) and JM6307 (D17S2253).

The Van Buchem's Disease region was previously localized to the ˜1 cM interval between polymorphic markers D17S1787 and D17S1861 on chromosome 17q12-21. To refine the interval further, genomic DNA samples were obtained from 15 affected individuals, 4 of whom had not been previously analyzed. A number of microsatellite markers from chromosome 17q12-21 were used to analyze the DNA samples. Patient DNA samples were genotyped using PCR amplification of polymorphic microsatellite markers. The microsatellite markers selected (see Table 1) are described in public databases or were developed using the SPUTNIK algorithm on sequence obtained from a BAC contig across the van Buchem disease/sclerosteosis region (Brunkow et al., Am. J. Hum. Genet. 68:577-584 (2001)), D17S1787 to D17S1861. PCR products were labeled with infrared IRDyes™ using an M13 tailing approach as described in Oetting et al., Genomics 30:450-458 (1995) and were resolved on a LiCor 4000 DNA sequencer. Allele determinations were made using the SAGA genotyping analysis software (University of Washington) or by a trained eye.

Using this large set of novel polymorphic markers derived from a BAC contig across the D17S1787 and D17S1861 interval, a large region of homozygosity across the disease locus was observed. Furthermore, all affected individuals (including 12-15) shared a common disease haplotype (Table 1). Individuals 2, 3, 6-8 and 12-15 were nonrecombinant across the entire D17S1787-D17S1861 interval, while individuals 1, 4, 5 and 9, 10, 11 carried recombinant chromosomes. Accordingly, the disease locus was refined to the <1 Mb region between BP12574 (D17S2250) and JM6307 (D17S2253) (see Table 1).

TABLE 1
Marker genotypes of affected individuals for selected markers at the van Buchem disease locus on chromosome 17q12-q21
CONSENSUS CONSENSUS
DUTCH VAN BUCHEM DISEASE GENOTYPES VBD SCLEROSTEOSIS
AFFECTED INDIVIDUAL HAPLOTYPE HAPLOTYPE
MARKER 1 4 5 9 10 11 (DUTCH) (AFRIKANER)
D17S1787 4 4 4 4 4 4 4 8 4 8 4 8 4 1
D17S2231 4 4 4 4 4 4 4 11  4 11  4 11  4 6
D17S1793 4 4 4 4 4 4 4 7 4 7 4 7 4 4
BP7060 11 11  11 11  11 11  11 12  11 12  11 12  11 11
BP7872 2 2 2 2 2 2 2 3 2 3 2 3 2 2
D17S855 6 6 6 6 6 6 6 8 6 8 6 8 6 7
BP12568 1 1 1 1 1 1 1 3 1 3 1 3 1 ND
BP12574 3 3 3 3 3 3 1 3 1 3 1 3 3 ND
(D17S2250)
BP12578 2 2 2 2 2 2 2 2 2 2 2 2 2 ND
BP6991 3 3 3 3 3 3 3 3 3 3 3 3 3 3
D17S1789 Δ Δ Δ Δ Δ Δ Δ 8
D17S951 1 1 1 1 1 1 1 1 1 1 1 1 1 3
SOST C C C C C C C T
JM6307 1 7 1 1 1 1 1 1 1 1 1 1 1 4
(D17S2253)
D17S2234 2 1 2 2 2 2 2 2 2 2 2 2 2 2
D17S1860 7 11  7 7 7 7 7 7 7 7 7 7 7 10
BP7129 2 6 2 2 2 2 2 2 2 2 2 2 2 4
BP7141 10 1 10 1 10 1 10 10  10 10  10 10  10 8
D17S2235 3 1 3 1 3 1 3 3 3 3 3 3 3 3
D17S1861 8 13  8 2 8 2 8 8 8 8 8 8 8 8

Example 2

Sclerosteosis and Van Buchem's Haplotypes are Distinct

To determine whether the Dutch van Buchem disease haplotype was related directly to the disease haplotype found in Afrikaner individuals affected with sclerosteosis, sclerosteosis DNA samples were typed with the same set of markers described in Example 1. These were then directly compared to the van Buchem disease DNA samples. The analysis showed marked differences between the two disease haplotypes (Table 1). In instances where the two disease chromosomes carried identical alleles at adjacent markers, true identity by descent (IBD) was unlikely, due either to the fact that one or the other shared allele was found at a high frequency (>0.50) in normal unaffected controls (not shown), or to the close spacing (i.e., <50 kb) between the markers. Finally, the van Buchem disease samples were typed for a single nucleotide polymorphism (SNP) specific for the Afrikaner SOST gene mutation. It was found that they all carried the normal “C” allele. These results indicate that van Buchem disease haplotype is distinct from sclerosteosis haplotype.

Example 3

Van Buchem's Disease is Caused by a Specific Chromosomal Deletion that Represents a Unique Identifier for the Disease Chromosome

This example discloses that patients afflicted with VBD have a chromosomal deletion of approximately 52 kb that is correlative of the disease phenotype.

Characterization of all the candidate genes within the 1 Mb region between polymorphic markers BP12574 (D17S2250) and JM6307 (D17S2253) revealed a specific chromosomal aberration that segregated absolutely with Van Buchem's disease. Two independent experimental approaches to identifying the VBD candidate region revealed the presence of a chromosomal deletion associated with VBD.

First, a publicly available oligonucleotide primer pair (i.e. the SSLP designated D17S1789; see FIG. 1A and Table 5) failed to PCR amplify a DNA fragment from genomic DNA obtained from VBD patients while permitting the amplification of a DNA fragment from genomic DNA obtained from normal individuals. As part of the present invention, the nucleotide sequence of a 92,101 bp stretch of genomic DNA from a normal individual, encompassing the D17S1789 amplified fragment, was obtained and is presented herein as SEQ ID NO:1.

Second, the 92 kb stretch of DNA was computationally analyzed, using the GENSCAN exon prediction algorithm, to identify putative exon sequences (Burge et al., J. Mol. Biol. 268:78-94 (1997)). PCR primer pairs corresponding to sequences flanking each exon were designed and tested in amplification reactions using as template the genomic DNA obtained from non-VBD-afflicted individuals and individuals afflicted with VBD.

FIG. 1A discloses the normal exon structure across the relevant chromosomal region between the Mox1 and SOST genes, as predicted by the GENSCAN exon prediction algorithm. Exons that amplified from both VBD and normal DNAs are indicated by the filled blocks (i.e. 1-4 and 26-28) while exons that failed to amplify from VBD DNA are indicated by the open blocks (i.e. 9-19). The location of the amplicons that include these exon sequences within the 92 kb nucleic acid of SEQ ID NO:1 and the respective SEQ ID NO assigned to each of the exon sequences as provided by the present invention are indicated in Table 2. The results of these amplification reactions using genomic DNA from VBD afflicted and nonafflicted individuals is summarized in Table 4.

TABLE 2
Amplicons Spanning Potential Exons Predicted by GENSCAN
Primers Location in
Amplicon Name Amplicon # (DMO#) SEQ ID NO: 1 SEQ ID NO
Gscn12.210A.09 19 12098/12104 14021-13436 SEQ ID NO: 17
Gscn12.210A.8 18 12097/12103 18353-17837 SEQ ID NO: 16
Gscn12.210A.7 17 12090/12096 18903-18334 SEQ ID NO: 15
Gscn12.210A.6 16 12089/12095 19556-18884 SEQ ID NO: 14
Gscn12.210A.5 15 12088/12094 19593-19063 SEQ ID NO: 13
Gscn12.210A.4 14 12087/12093 29498-28949 SEQ ID NO: 12
Gscn12.210A.3 13 12086/12092 33353-32666 SEQ ID NO: 11
Gscn12.210A.2 12 12085/12091 35036-34373 SEQ ID NO: 10
Gsch12.210A.1 11 12078/12084 36817-36212 SEQ ID NO: 9
Gscn12.668.08 10 12110/12116 49386-49957 SEQ ID NO: 8
Gscn12.668.07 9 12109/12115 50550-51151 SEQ ID NO: 7
Gscn12.668.06 4 9260/9261 58974-58394 SEQ ID NO: 6
Gscn12.668.05 3 12709/12710 58922-59740 SEQ ID NO: 5
Gscn12.668.04 2 12101/12107 67161-67717 SEQ ID NO: 4
Gscn12.668.03 1 12100/12106 75612-76103 SEQ ID NO: 3

In total, 16 fragments, corresponding to the SSLP (D17S1789) and at least 15 potential coding exons, were successfully amplified from genomic DNA obtained from non-VBD-afflicted individuals. In contrast, 12 of these 16 fragments did not amplify from genomic DNA obtained from individuals afflicted with VBD. These results revealed the presence of, and partially localized, a genomic deletion within human chromosome 17q21 in the locus associated with VBD (see FIG. 1A).

To better define the endpoints of this chromosomal deletion, additional PCR amplification reactions were performed with primers designed to amplify within the presumably non-coding regions located between the exons at either end of the VBD-specific deletion. The PCR primer pairs used and results obtained are summarized in Tables 3 and 4.

TABLE 3
Amplicons Corresponding to Non-coding Sequences Located within SEQ ID NO: 1
Primers Location in
Amplicon Name Amplicon # (DMO#) SEQ ID NO: 1 SEQ ID NO
5′moxA 25 12697/12698 1499-1018 SEQ ID NO: 27
5′moxB 24 12699/12700 2524-2065 SEQ ID NO: 26
5′moxC 23 12701/12702 5608-4939 SEQ ID NO: 25
5′moxD 22 12703/12704 8684-8249 SEQ ID NO: 24
5′moxE 21 12705/12706 11248-10880 SEQ ID NO: 23
D17S1789 20 1789for/rev 14257-14060 SEQ ID NO: 22
668intronD 8 12622/12623 51371-52377 SEQ ID NO: 21
668intronC 7 12624/12625 53062-54232 SEQ ID NO: 20
668intronB 6 12626/12627 55163-56398 SEQ ID NO: 19
668intronA 5 12628/12629 57103-58202 SEQ ID NO: 18

The deletion associated with VBD was further characterized by amplifying a fragment from VBD genomic DNA, using the PCR primer pair 9260/12702 (SEQ ID NO:30/SEQ ID NO:77), sub-cloning this fragment and sequencing it to completion. As disclosed in FIG. 2, the 9260/12702 primer pair spans the deletion identified in VBD afflicted individuals. The 2317 bp fragment obtained from PCR amplification comprised a deletion breakpoint flanked on both the 5′ and 3′ ends with normal genomic DNA sequences. Without being limited to any particular theory of the present invention, it is believed that these results indicate that the VBD aberration is a simple chromosomal deletion, with no other associated rearrangements. The nucleotide sequence spanning the deletion breakpoint is depicted in FIG. 1B and is provided in SEQ ID NO:101.

Comparison of the SEQ ID NO:101 with the 92,149 bp sequence obtained from non-VBD-afflicted individuals revealed that approximately 52 kb of contiguous genomic DNA is invariably deleted from chromosome 17 at position 17q21 in individuals afflicted with Van Buchem's disease. This deletion is not present in individuals who are non-carriers or not afflicted with Van Buchem's disease. The sequence of the 52 kb sequence is provided in SEQ ID NO:2.

TABLE 4
Amplification Results Obtained from VBD Affected
and Unaffected Genomic DNA Samples
PCR Results
Primers VBD
Amplicon Name Amplicon # (DMO#) Affected Unaffected
Mox1.03 28 12158/12164 + +
Mox1.02 27 12157/12163 + +
Mox1.01 26 12265/12156 + +
5′moxA 25 12697/12698 + +
5′moxB 24 12699/12700 + +
5′moxC 23 12701/12702 + +
5′moxD 22 12703/12704 − +
5′moxE 21 12705/12706 − +
D17S1789 20 1789for/rev − +
gscn12.210A.09 19 12098/12104 − +
gscn12.210A.8 18 12097/12103 − +
gscn12.210A.7 17 12090/12096 − +
gscn12.210A.6 16 12089/12095 − +
gscn12.210A.5 15 12088/12094 − +
gscn12.210A.4 14 12087/12093 − +
gscn12.210A.3 13 12086/12092 − +
gscn12.210A.2 12 12085/12091 − +
gscn12.210A.1 11 12078/12084 − +
gscn12.668.08 10 12110/12116 − +
gscn12.668.07 9 12109/12115 − +
668intronD 8 12622/12623 − +
668intronC 7 12624/12625 − +
668intronB 6 12626/12627 − +
668intronA 5 12628/12629 − +
gscn12.668.06 4 9260/9261 + +
gscn12.668.05 3 12709/12710 + +
gscn12.668.04 2 12101/12107 + +
gscn12.668.03 1 12100/12106 + +

TABLE 5
Polynucleotide Sequences Derived from
SEQ ID NO:1
Primer Nucleotide
Name Sequence (5′-3′) SEQ ID NO
  1789for ATTGGCCTGGCTTCTG SEQ ID NO: 28
(5522)
  1789rev GGCTGGAGCAGGGACT SEQ ID NO: 29
(5524)
  9260 TCCTGTGATCGCATTGAGAC SEQ ID NO: 30
  9261 CCCTGCCATTCTGGATAGTTT SEQ ID NO: 31
12078 CAGTGGCTTTATTTTCCTAA SEQ ID NO: 32
12084 GAAGCTTCTCCATGTTCTTA SEQ ID NO: 33
12085 GTCTAAAAATGAAGAAGGCA SEQ ID NO: 34
12086 TTAAGTGACTTGTCCGAGAT SEQ ID NO: 35
12087 CAACTCAATCTTTTGGTGTT SEQ ID NO: 36
12088 AAATCAGATTCAAGCAGTGT SEQ ID NO: 37
12089 TCTTAACTGTCTTTTCAGAC SEQ ID NO: 38
12090 ATTGTTTCATTTTACCCTCA SEQ ID NO: 39
12091 GCCATAAAATCAGGATAATG SEQ ID NO: 40
12092 TGCCTAGAACATTCTGGTAT SEQ ID NO: 41
12093 CAAAGTGGCTCTGATTATTT SEQ ID NO: 42
12094 GGATCTCCTACGTACTGCTA SEQ ID NO: 43
12095 TGAGGGTAAAATGAAACAAT SEQ ID NO: 44
12096 AAAGACACTGCAGAGAAAAG SEQ ID NO: 45
12097 CTTTTCTCTGCAGTGTCTTT SEQ ID NO: 46
12098 GAGACCTCTCCTCTTTGAAT SEQ ID NO: 47
12100 GGTTTCAACTAGTTCTGGTG SEQ ID NO: 48
12101 CTAGGGCTTAGAAGTTTCCT SEQ ID NO: 49
12103 ACTCCTAGAACCCTAAAGGA SEQ ID NO: 50
12104 GTATCACCAGTGAAGTTGGT SEQ ID NO: 51
12106 GATAAATGGATATGGCAAAG SEQ ID NO: 52
12107 GGTTTATAATTTGCAACCAG SEQ ID NO: 53
12109 ATTCCCTAAGAGATTTGTCC SEQ ID NO: 54
12110 GAGAGGACAAACATTCAAAC SEQ ID NO: 55
12115 TTTAGACCTATCACTCCCAA SEQ ID NO: 56
12116 CTACTGGGACAAACCATTAC SEQ ID NO: 57
12156 AGAGAGGGTGAGTAACTTCC SEQ ID NO: 58
12157 AATAAAAGAAAGTTTGGGGT SEQ ID NO: 59
12158 GCAGAGTGCTTTTAGAACAT SEQ ID NO: 60
12163 AGGTGGAGGTTACAGTAAGA SEQ ID NO: 61
12164 AAGCAGTATCTCTGAAGCTG SEQ ID NO: 62
12265 CCTTTTCTTGGTTCAGATAA SEQ ID NO: 63
12622 ACGGTGTACACATTTGGTTAG SEQ ID NO: 64
12623 CGGATATTTGTCTGTGATACG SEQ ID NO: 65
12624 ACCGTGCAGAGGTAGATGGTA SEQ ID NO: 66
12625 CCAGTGGAAGAGACAGGTGA SEQ ID NO: 67
12626 GAGCTGAGATCGCACCACTT SEQ ID NO: 68
12627 CAACACGACATGGAATGGACT SEQ ID NO: 69
12628 CACAGCTGGAGACATGTTACA SEQ ID NO: 70
12629 AGGGTTCACACCATATCAGAA SEQ ID NO: 71
12697 ACGCTGCTGTTAAGGTCCA SEQ ID NO: 72
12698 TGCCAATTAGCCACACTCTTC SEQ ID NO: 73
12699 GTGCAAAGTGCCTTACACAG SEQ ID NO: 74
12700 GAGGTTAGACGGGTCTGAGTT SEQ ID NO: 75
12701 TGGCAGGCAGTAGTAACTCTG SEQ ID NO: 76
12702 CTGGGATTACAGGTGTCTGG SEQ ID NO: 77
12703 TGAGCTGTTCCCACACCACAT SEQ ID NO: 78
12704 TCAGGACGTTGCACTTTGACA SEQ ID NO: 79
12705 GAATGCTGGATGTGGATTGAG SEQ ID NO: 80
12706 GAGCAGAAGGCCTTGACTGA SEQ ID NO: 81
12709 GCCTTCAGTTTGTCCCGTTCT SEQ ID NO: 82
12710 CGCGAGGTCAGGAGTTCGAT SEQ ID NO: 83
12952 CCACTGAACAGGGCACAAGAT SEQ ID NO: 84
VBspan1/ GAATTACTGGCTGAGGCAACC SEQ ID NO: 85
12953
Span1F GCCTGCGCTTACATAGT SEQ ID NO: 86
Span1R AGGCGGGCGGATCACAAGGTC SEQ ID NO: 87
Span2F GGCTCACTGCAACCTCCACCTA SEQ ID NO: 88
Span2R AACCAAACAAGCCAGCAATCACTC SEQ ID NO: 89
Wt1R TGGGAGGCTGAGGCAAGAGAAT SEQ ID NO: 90
Wt2F ACTGGGCCTGGGATGTAT SEQ ID NO: 91
Wt2R AAAAATTGGCTGGGTGTGG SEQ ID NO: 92
Wt3F CAGGCTGGAGTGCAATGGTGTG SEQ ID NO: 93
Wt3R TGGGAGGCTGAGGCAAGAGAAT SEQ ID NO: 94
Del1F CTCACTGCAGCCTCAACTCG SEQ ID NO: 95
Del1R TAGCAGAAGGGGGAAGGGGGAACG SEQ ID NO: 96
Del2F GACGGTGTACACATTTGGTTAGTT SEQ ID NO: 97
Del2R GCACAGTTACATCCGCCTTATCGT SEQ ID NO: 98
Del3F TGCAGACACCCAGAGAAGACGACT SEQ ID NO: 99
Del3R TGGACCCTGCCCTCACGATGGA SEQ ID NO: 100
VBspan2 TACTACTGGGCCTGGGATGTA SEQ ID NO: 104
VBint1 TAGAGAAAGACCTCGTTATTGG SEQ ID NO: 105

Example 4

First Methodology for Identification of Van Buchem's Disease Carriers by Detection of a 52 kb Genomic Deletion

This example discloses a methodology for distinguishing individuals who are afflicted with or carriers of Van Buchem's disease as well as from individuals who are normal with respect to the 52 kb deletion. The methodology is based on the observation that the large, i.e. 52 kb genomic deletion that correlates absolutely with Van Buchem's disease may be identified by amplification of the region encompassing the deletion breakpoint.

The deletion on the Van Buchem's disease chromosomal locus 17q21 results in the apposition of DNA sequences normally separated by approximately 52 kb. A PCR assay specific for the deleted chromosome was developed. Starting with the sequence of the 2.3 kb VBD-specific fragment that includes the deletion endpoints, primers were designed to span the endpoints and yield a 400-800 bp amplicon from VBD DNA but would not, because of the presence of the 52 kb genomic fragment, permit the amplification of any fragment from normal, non-carrier genomic DNA samples.

As illustrated in FIG. 2, the following oligonucleotide primer pairs were used to amplify chromosomal DNA within the locus 17q21 from individuals who are afflicted with or carriers of VBD: Primer Nos. 12952 and 12953 hybridize within the region upstream and downstream, respectively, of the 52 kb genomic region deleted in VBD-afflicted individuals and amplify a 798 bp fragment when the 52 kb region is deleted; Primer Nos. Wt2F and Wt2R hybridize upstream of and within, respectively, the 52 kb genomic region deleted in VBD-afflicted individuals and amplify a 473 bp fragment in the absence of the deletion; Primer Nos. 9261 and 9260 hybridize within the region downstream of the 52 kb genomic region deleted in VBD-afflicted individuals and amplify a 581 bp fragment in all cases.

The VBD diagnostic was designed such that individuals who are homozygous for the 52 kb deletion and therefore afflicted with VBD may be differentiated from individuals who are heterozygous for the 52 kb deletion and therefore carriers of VBD as well as individuals who are normal with respect to the 52 kb deletion. Two separate PCR reactions were performed on the individual to be tested. In the first, a primer pair spanning upstream and within the VBD deletion (i.e. the Wt2F/Wt2R oligonucleotide primer pair) yielded an amplicon from normal non-carriers and heterozygous carriers. In the second reaction, primers which span the 52 kb deletion (i.e. the 12952/12953 oligonucleotide primer pair) yielded an amplicon from heterozygous VBD carriers and homozygous patients. A primer pair spanning a region unaffected by the 52 kb genomic deletion (i.e. the 9260/9261 oligonucleotide primer pair) was included as a positive control for the PCR reactions.

The following reaction conditions were used for amplification of 400 to 800 bp nucleic acid fragments using as template genomic DNA isolated from patients who are afflicted with or carriers of Van Buchem's disease: 25 ul reactions included 10 ng genomic DNA; 60 mM TrisHCl, pH 7.5; 15 mM Ammonium Sulfate; 2.5 mM Magnesium Chloride; 0.4 mM each of dATP, dCTP, dGTP and dTTP; 0.2 μM each of Primer Nos. Wt2F and Wt2R, or 12952 and 12953, or 9260 and 9261. The fragments (473, 798, and 581 bp, respectively) were amplified by the following protocol: Denaturation at 94° C. for 3; 40 cycles of 94° C. for 1 minute, 68° C. for 1 minute and 72° C. for 1 minute; final extension at 72° C. for 5 minutes. The amplified nucleic acid fragments were resolved on a 1% agarose gel using 1×TAE buffer. DNA bands were visualized with ethidium bromide staining.

The results are summarized in FIG. 2. The summary shows that nucleic acid fragments amplified in all PCR reactions containing the 9260/9261 oligonucleotide primer pair regardless of the source of genomic DNA template. The 12952/001 oligonucleotide primer pair amplified a nucleic acid fragment from non-VBD afflicted individuals and individuals who are heterozygous for and therefore carriers of VBD but did not amplify a nucleic acid fragment from individuals who are homozygous for and therefore afflicted with VBD. The 12952/12953 oligonucleotide primer pair amplified a nucleic acid fragment from individuals who are heterozygous for and therefore carriers of VBD and from individuals who are homozygous for and therefore afflicted with VBD but did not amplify a nucleic acid fragment from non-VBD afflicted individuals.

These results demonstrated that a first methodology presented herein permit the differentiation between an individual who is homozygous for the 52 kb genomic deletion and therefore afflicted with VBD, an individual who is heterozygous for the 52 kb genomic deletion and therefore a carrier of VBD and an individual who does not bear the 52 kb genomic deletion and is therefore normal with respect to VBD.

Example 5

Second Methodology for Identification of Van Buchem's Disease Carriers by Detection of a 52 kb Genomic Deletion

This example discloses a second methodology for identifying individuals who are afflicted with or carriers of Van Buchem's disease as well as from individuals who are normal with respect to the 52 kb deletion. The methodology is based on the observation that the large, i.e. 52 kb genomic deletion that correlates absolutely with Van Buchem's disease may be identified by amplification of the region encompassing the deletion breakpoint.

As illustrated in FIG. 3, the following oligonucleotide primer pairs were used to amplify chromosomal DNA within the locus 17q21 from individuals who are afflicted with or carriers of VBD: Primers VBspan2 and VBspan1 hybridize upstream and downstream, respectively, to a region that flanks the 52 kb genomic region deleted in VBD-afflicted individuals and amplify a 642 bp fragment when the 52 kb region is deleted. Primer VBint hybridizes within the 52 kb genomic region which is deleted in VBD-afflicted individuals and with primer VBspan2 amplify a 720 bp fragment in the absence of the deletion.

The VBD diagnostic was designed such that individuals who are homozygous for the 52 kb deletion and therefore afflicted with VBD may be differentiated from individuals who are heterozygous for the 52 kb deletion and therefore carriers of VBD as well as individuals who are normal with respect to the 52 kb deletion.

A single multiplexed PCR reaction was performed on the individual to be tested. The pair of oligonucleotide primers span the 52 kb deletion (i.e. the VBspan1/VBspan2 oligonucleotide primer pair) yielded an amplicon from heterozygous VBD carriers and homozygous patients. The second pair of oligonucleotide primers pair spanning upstream and within the VBD deletion (i.e. the VBspan2/VBint1 oligonucleotide primer pair) yielded an amplicon from normal non-carriers and heterozygous carriers. A primer pair spanning a region unaffected by the 52 kb genomic deletion (i.e. the 9260/9261 oligonucleotide primer pair) was included as a positive control for the PCR reactions.

The following reaction conditions were used for amplification of 400 to 800 bp nucleic acid fragments using as template chromosomal DNA isolated from patients who are afflicted with or carriers of Van Buchem's disease: 50 μl reactions include 20 ng genomic DNA, 0.4 μM each of Vbspan1 and Vbint1, 0.8 μM of VBspan2, 0.2 mM of each dNTP, 120 mM TrisHCl, pH 7.5, 30 mM ammonium sulfate, 5.0 mM magnesium chloride and 2.5 U Taq polymerase (Roche Molecular Biochemicals, Indianapolis, Ind.). The fragments (642 and 720 bp) were amplified by the following protocol: Denaturation at 94° C. for 3 min, 40 cycles of 94° C. for 30 sec, 63° C. for 30 sec, 72° C. for 2 min and a final extension of 72° C. for 5 min. The amplified nucleic acid fragments were resolved on a 2.5% agarose gel using 1×TAE buffer. DNA bands were visualized with ethidium bromide staining.

The results are summarized in FIG. 3. The summary shows that nucleic acid fragments amplified in all PCR reactions containing the 9260/9261 oligonucleotide primer pair regardless of the source of genomic DNA template. The VBspan2/VBint1 oligonucleotide primer pair amplified a nucleic acid fragment from non-VBD afflicted individuals and individuals who are heterozygous for and therefore carriers of VBD but did not amplify a nucleic acid fragment from individuals who are homozygous for and therefore afflicted with VBD. The VBspan2/VBspan1 oligonucleotide primer pair amplified a nucleic acid fragment from individuals who are heterozygous for and therefore carriers of VBD and from individuals who are homozygous for and therefore afflicted with VBD but did not amplify a nucleic acid fragment from non-VBD afflicted individuals.

These results demonstrated that a second methodology presented herein permit the differentiation between an individual who is homozygous for the 52 kb genomic deletion and therefore afflicted with VBD, an individual who is heterozygous for the 52 kb genomic deletion and therefore a carrier of VBD and an individual who does not bear the 52 kb genomic deletion and is therefore normal with respect to VBD in a single multiplexed amplification reaction.

In providing the forgoing description of the invention, citation has been made to several references that will aid in the understanding or practice thereof. All such references are incorporated by reference herein.

From the forgoing, it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.

Claims

1-40. (canceled)

41. A method for regulating expression of a SOST gene, comprising expressing a SOST protein product of a SOST coding sequence in the presence of at least one SOST gene regulatory sequence, wherein the SOST gene regulatory sequence comprises a polynucleotide which comprises a nucleic acid sequence of SEQ ID NO:2, or a complementary sequence thereto.

42. The method of claim 41 wherein the at least one SOST gene regulatory sequence is comprised within genomic DNA.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: