US20120258090A1
2012-10-11
13/524,689
2012-06-15
The present invention relates to a method is provided for producing recombinant human thrombin from recombinant prothrombin using recombinant ecarin having the sequence SEQ ID NO 2 or a homologue thereof.
Get notified when new applications in this technology area are published.
C12N9/6418 » CPC main
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on peptide bonds (3.4); Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from non-mammals from snakes
A61P7/00 » CPC further
Drugs for disorders of the blood or the extracellular fluid
C12Y304/21005 » CPC further
Hydrolases acting on peptide bonds, i.e. peptidases (3.4); Serine endopeptidases (3.4.21) Thrombin (3.4.21.5)
A61P7/04 » CPC further
Drugs for disorders of the blood or the extracellular fluid Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
C12N15/63 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
C12N5/10 IPC
Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor Cells modified by introduction of foreign genetic material
A61K38/48 IPC
Medicinal preparations containing peptides; Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof; Enzymes; Proenzymes; Derivatives thereof; Hydrolases (3) acting on peptide bonds (3.4)
C12N15/52 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Genes encoding for enzymes or proenzymes
This application is a continuation (and claims the benefit of priority under 35 U.S.C. §120) of U.S. application Ser. No. 12/167,614, filed Jul. 3, 2008, which claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 60/948,207 (US) filed on Jul. 6, 2007, both of which are incorporated herein by reference in their entirety.
The present application relates to a method for producing recombinant human thrombin from recombinant prothrombin using recombinant ecarin.
Thrombin is a key enzyme in the coagulation cascade. By thrombin mediated proteolytic digestion of fibrinogen into fibrin monomer, a cascade reaction leading to clot formation is started. Clot formation is the first step in wound healing. In addition thrombin is a chemo attractant to cells involved in wound healing, and, the fibrin network formed act as a scaffold for collagen-producing fibroblasts, increases phagocytosis, promotes angiogenesis and binds growth factors thus further supporting the healing process. The rate of clot formation is dependent on the concentration of thrombin and fibrinogen. Because of the important function in clot formation thrombin has been utilised in a number of products intended for haemostasis and/or as tissue sealants or âgluesâ, both as stand-alone products (i.e. Thrombin-JMI) or in combination with fibrin or other compounds (i.e. Tisseel, Hemaseel, Crosseal). The potential fields of use are numerous; skin grafting, neuro surgery, cardiac surgery, toracic surgery, vascular surgery, oncologic surgery, plastic surgery, ophthalmologic surgery, orthopedic surgery, trauma surgery, head and neck surgery, gynecologic and urologic surgery, gastrointestinal surgery, dental surgery, drug delivery, tissue engineering and dental cavity haemostasis.
So far the thrombin in approved thrombin-containing products on the market is derived either from human or bovine plasma. Using plasma derived protein confers several disadvantages as limited availability and safety concerns such as risk for transmission of viruses and prions and the risk of triggering autoantibody formation (bovine products). Cases where antibody formation due to bovine thrombin exposure has lead to significant bleeding disorders are known.
In vivo thrombin is obtained from activation of prothrombin through the coagulation cascade. Activation through the coagulation cascade is dependent on the presence of a functional GLA-domain containing 8-10 glutamic residues converted to gamma-carboxyglutamate. In vitro, also incomplete gamma-carboxylated prothrombin can be converted to thrombin by the use of prothrombin activators such as ecarin. Ecarin, a snake venom derived from the Kenyan viper Echis carinatus is a procoagulant, a protease which cleaves human prothrombin between residues Arg320-IIe321 to generate meizothrombin. Further autocatalytic processing results in the formation of meizothrombin desF1 and then alpha-thrombin, which is the mature active form of thrombin.
An ideal commercial thrombin manufacturing process would use a recombinant thrombin precursor and a recombinant protease produced at high productivity without addition of animal-derived components. Further requirements would be robust performance, convenience and low cost.
A big obstacle for efficient recombinant human thrombin (rh-thrombin) has been to obtain high yields of prothrombin. Although extensive efforts have been spent, obtaining high yields of prothrombin under conditions suitable for production of biologicals has long remained a challenge. Yonemura et al. (J Biochem 135:577-582, 2004) have used recombinant GLA-domain-less prethrombin digested with recombinant ecarin to generate recombinant human thrombin. The productivity of prethrombin at process scale was 150-200 mg/L, which is a modest productivity for commercial scale production. Recombinant production of ecarin has also been described in WO 01/04146. In this publication generation of rh-thrombin is exemplified by conversion of recombinant prothrombin produced in COS cells by a recombinant ecarin produced from CHO cells. However, the exemplified methods are not suitable for large-scale production and animal-derived components are used.
Recombinant ecarin is produced as a prepro-protein that needs to be activated. Problems to efficiently activate the r-ecarin are described in both publications and the suggested activation procedures are far from optimal.
Thus there is a need for improved methods to obtain recombinant human thrombin. During our efforts to obtain improved productivity of gamma-carboxylated human prothrombin we made the surprising discovery that co-expression with gamma-glutamyl carboxylase (GGCX) vastly improved also the productivity of incompletely carboxylated prothrombin (see WO2005038019).
The present invention describes a process to efficiently produce human thrombin from recombinant prothrombin obtained by the expression method as described in WO2005038019. Recombinant carboxylated or incompletely carboxylated prothrombin combined with recombinant ecarin has not previously been used for manufacturing of recombinant thrombin. Further, the procedure for activating recombinant ecarin is new. The methods described would be suitable for large scale rh-thrombin manufacturing without the addition of animal-derived components.
According to a first aspect of the invention, a method is provided for producing recombinant human thrombin from recombinant prothrombin using recombinant ecarin having the sequence SEQ ID NO 2 or a homologue thereof.
According to a another aspect, a pharmaceutical composition is provided comprising a recombinant thrombin according to said method, in combination with pharmaceutically acceptable carriers, vehicles and/or adjuvants.
According to further aspect, an isolated DNA sequence is provided coding for recombinant ecarin according to SEQ ID NO 2 or a homologue thereof, having at least 80% identity to SEQ ID NO 2.
According to another aspect, a vector is provided comprising an isolated DNA sequence coding for recombinant ecarin according to SEQ ID NO 2 or a homologue thereof, having at least 80% identity to SEQ ID NO 2.
According to yet another aspect, a cell line is provided comprising a vector comprising an isolated DNA sequence coding for recombinant ecarin according to SEQ ID NO 2 or a homologue thereof, having at least 80% identity to SEQ ID NO 2.
FIG. 1. FII+GGCX construct (SEQ ID NO:1).
FIG. 2. Ecarin construct (SEQ ID NO:3).
FIG. 3. Example of a process outline for thrombin manufacturing.
FIGS. 4A-4C. Nucleotide sequence alignment of the nucleic acid sequence encoding recombinant ecarin (SEQ ID NO:2) used in the present invention and wild type ecarin nucleic acid sequence (SEQ ID NO:4).
FIG. 5. Amino acid sequence alignment of recombinant ecarin (encoded by SEQ ID NO:2) used in the present invention and wild type ecarin (both having the amino acid sequence of SEQ ID NO:5).
FIG. 6. Graph showing the activation of recombinant ecarin during cell death over time.
FIG. 7. Activation of recombinant ecarin in cell cultures over time, assayed by SDS-PAGE.
FIG. 8. Chromatogram from CIEX purification of rh-thrombin.
FIG. 9. Non-reduced SDS-PAGE analyses of fractions obtained by CIEX purification.
The invention consists in one part of a cell line derived by stable transfection with a vector (FIG. 1) encoding human prothrombin (FII) associated by suitable control sequences and human gamma-glutamyl carboxylase (GGCX) associated by suitable control sequences. Control sequences should be chosen so that prothrombin expression is in excess of the GGCX expression by at least a factor of 10. The host cell is preferably a eukaryotic cell. Typical host cells include, but are not limited to insect cells, yeast cells, and mammalian cells. Mammalian cells are particularly preferred. Suitable mammalian cells lines include, but are not limited to, CHO, HEK, NS0, 293, Per C.6, BHK and COS cells, and derivatives thereof. In one embodiment the host cell is the mammalian cell line CHO-S. The obtained prothrombin producing cell line is grown under culture conditions optimised for high yield of prothrombin disregarding gamma-carboxylation. Vitamin K may or may not be added to the growth medium.
It will be appreciated that the invention is not restricted to a particular prothrombin or gamma-glutamyl caboxylase or protein encoding sequence of one of these proteins to be co-expressed. Moreover, and in particular with respect to blood coagulation factors, numerous mutant forms of the proteins have been disclosed in the art. The present invention is equally applicable to prothrombin and gamma-glutamyl caboxylase mutant forms, including naturally occurring allelic variants, of the proteins as it is to wild-type sequence. In one embodiment the invention can be undertaking with any wild-type protein or one with at least 90%, preferably at least 95% sequence identity thereto. In another embodiment, sequences listed in Table 1 can be used.
| TABLE 1 | ||||
| CDNA | SPLICE | GENE | ||
| EMBL | VARIANTS | EMBL | ||
| PROTEIN | ACC# | (PROTEIN) | MUTATIONS | ACC# |
| Glutamate | BC013979 | 2; BC013979; | 1 SNP | U65896 |
| gamma | AF253530 | (EMBL# | ||
| carboxylase | U65896); | |||
| 2 SNPs | ||||
| (OMIM# | ||||
| 137167) | ||||
| Prothrombin | V00595 | 1; V00595 | approx. 100 | AF478696 |
| SNP's | ||||
| (EMBL# | ||||
| AF478696) | ||||
Each of these proteins, including their nucleic acid and amino acid sequences, are well known. Table 2 identifies representative sequences of wild-type and mutant forms of the various proteins that can be used in the present invention.
The term âgamma-glutamyl carboxylaseâ or âGGCXâ, as used herein, refers to a vitamin K dependent enzyme that catalyses carboxylation of glutamic acid residues.
GGCX enzymes are widely distributed, and have been cloned from many different species such as the beluga whale Delphinapterus leucas, the toadfish Opsanus tau, chicken (Gallus gallus), hagfish (Myxine glutinosa), horseshoe crab (Limulus polyphemus), and the cone snail Conus textile (Begley et al., 2000, ibid; Bandyopadhyay et al. 2002, ibid). The carboxylase from conus snail is similar to bovine carboxylase and has been expressed in COS cells (Czerwiec et al. 2002, ibid). Additional proteins similar to GGCX can be found in insects and prokaryotes such as Anopheles gambiae, Drosophila melanogaster and Leptospira with NCBI accession numbers: gi 31217234, gi 21298685, gi 24216281, gi 24197548 and (Bandyopadhyay et al., 2002, ibid), respectively. The carboxylase enzyme displays remarkable evolutionary conservation. Several of the non-human enzymes have shown, or may be predicted to have, activity similar to that of the human GGCX we have used, and may therefore be used as an alternative to the human enzyme.
Table 2 identifies representative sequences of predicted proteins homologous to human GGXC (sorted after species origin) that can be used in the present invention.
| TABLE 2 | |
| Data base accession | |
| Species | #/ID |
| Homo sapiens (man) | NM_000821.2 |
| HUMGLUCARB | |
| HUMHGCA | |
| BC004422 | |
| HSU65896 | |
| AF253530.1 | |
| Papio hamadryas (red baboon) | AC116665.1 |
| Delphinapterus leucas (white whale) | AF278713 |
| Bos taurus (bovine) | NM_174066.2 |
| BOVCARBOXG | |
| BOVBGCA | |
| Ovis aries (domestic sheep) | AF312035 |
| Rattus norvegicus (brown rat) | NM_031756.1 |
| AF065387 | |
| Mus musculus (mouse) | NM_019802.1 |
| AF087938 | |
| Opsanus tau (bony fishes) | AF278714.1 |
| Conus textile (molluscs) | AY0044904.1 |
| AF382823.2 | |
| Conus imperialis (molluscs) | AF448234.1 |
| Conus episcopatus (molluscs) | AF448233.1 |
| Conus omaria (molluscs) | AF448235.1 |
| Drosophila melanogaster (fruit fly) | NM_079161.2 |
| Anopheles gambiae (mosquito) | XM_316389.1 |
| Secale cereale (monocots) | SCE314767 |
| Triticum aestivum (common wheat) | AF280606.1 |
| Triticum urartu (monocots) | AY245579.1 |
| Hordeum vulgare (barley) | BLYHORDCA |
| Leptospira interrogans (spirochetes) | AE011514.1 |
| Streptomyces coelicolor (high GC Gram+ | SCO939109 |
| bacteria) | SCO939124 |
| AF425987.1 | |
| Streptomyces lividans (high GC Gram+ bacteria) | SLU22894 |
| Streptomyces viginiae (high GC Gram+ bacteria) | SVSNBDE |
| Micrococcus luteus (high GC Gram+ bacteria) | MLSPCOPER |
| Chlamydomonas reinhardtii (green algae) | AF479588.1 |
| Dictyostelium discoideum (slime mold) | AC115612.2 |
| Coturnix coturnix (birds) | AF364329.1 |
| Bradyrhizobium japonicum (α-protoebacteria) | AP005937.1 |
| Rhodobacter sphaeroides (α-proteobacteria) | RSY14197 |
| Sinorhizobium meliloti (α-proteobacteria) | RME603647 |
| AF119834 | |
| Mesorhizobium loti (α-proteobacteria) | AP003014.2 |
| Chromobacterium violaceum (ÎČ-proteobacteria) | AE016910.1 |
| AE016918.1 | |
| Pseudomonas aeruginosa (Îł-proteobacteria) | AE004613.1 |
| AF165882 | |
| Xanthomonas axonopodis(Îł-proteobacteria) | AE011706.1 |
| Human herpesvirus 8 | KSU52064 |
| KSU75698 | |
| AF305694 | |
| AF360120 | |
| AF192756 | |
Each of the above-identified GGCX proteins and GGCX proteins from other species can be used as the carboxylase enzyme in the present invention.
A second part of the invention is a cell line stably transfected with a polynucleotide encoding ecarin and associated control elements (FIG. 2). The ecarin encoding sequence may be optimised for expression in mammalian cells, but is not limited to such sequences. In one embodiment of the invention the sequence according to SEQ ID NO 2 or a homologue thereof is used to express ecarin. A homologue of
SEQ ID NO 2 coding for ecarin may have at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity to the sequence SEQ ID NO 2. The host cell is preferably a eukaryotic cell. Typical host cells include, but are not limited to insect cells, yeast cells, and mammalian cells. Mammalian cells are particularly preferred. Suitable mammalian cells lines include, but are not limited to, CHO, HEK, NS0, 293, Per C.6, BHK and COS cells, and derivatives thereof. In one embodiment the host cell is the mammalian cell line CHO-S.
In one embodiment prothrombin and ecarin are produced from cells originating from the same parent cell line. This cell line origin may be, but is not limited to, Chinese Hamster Ovary cells (CHO) including derivatives and NSO (myeloma BALB/c mouse) including derivatives. The purpose of using the same cell line background is to facilitate purification and evaluation of purity of the thrombin product.
In another embodiment ecarin and prothrombin are produced from different host cell line; i.e. CHO and NSO, respectively.
In one aspect of the invention use of recombinant ecarin is preferred as this facilitates detection of non-thrombin product derived components during the thrombin generation process and in the final thrombin product. In a second aspect recombinant ecarin is preferred due to reduced risk for exposure to allergenic or toxic components that may be present in ecarin derived from snake venom. In a third aspect ecarin from snake venom is not preferred due to batch variation and limited batch size of ecarin preparations.
The crude prothrombin and the crude ecarin are mixed and incubated under conditions that allow formation of thrombin, such as described in Example 3. Generated thrombin is then purified by methods described in Example 4 or by other methods known by persons skilled in the art. Alternatively prothrombin and/or ecarin can first be purified by methods known in the art and then mixed to obtain thrombin. Thrombin is then purified from non-product components.
An example of a suitable thrombin manufacturing process is outlined in FIG. 3.
A method is provided for producing recombinant human thrombin from recombinant prothrombin using recombinant ecarin having the sequence SEQ ID NO 2 or a homologue thereof. The recombinant ecarin can be expressed and secreted by a cell containing the gene comprising the nucleotide sequence SEQ ID NO 2 or a homologue thereof in CHO-S cells, which ecarin has an amino acid sequence equal to that of wild type ecarin.
In the above method the recombinant protrombin is subjected to recombinant ecarin, which recombinant ecarin can be isolated in active form after extra-cellular expression by CHO-S cells, said cells being left to apoptosis/necrosis for a time sufficient to activate said ecarin, whereupon a human recombinant thrombin is isolated.
The recombinant prothrombin can be produced by a cell-line comprising a prothrombin expressing gene having a nucleotide sequence comprising the sequence SEQ. ID. NO. 1 or an homologue thereof. A homologue of SEQ ID NO 1 coding for prothrombin may have at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity to the sequence SEQ ID NO 1. The recombinant prothrombin can be a mixture of fully carboxylated prothrombin and incompletely carboxylated prothrombin. In one embodiment, the recombinant prothrombin is a fully carboxylated prothrombin and in another embodiment, the recombinant prothrombin is an incompletely carboxylated prothrombin.
A further aspect of the invention relates to the recombinant thrombin obtained by the method according to the invention. A pharmaceutical composition can be designed comprising the recombinant thrombin obtained be the method according to the invention, in combination with pharmaceutically acceptable carriers, vehicles and/or adjuvants. The pharmaceutical composition can be in an applicable form.
In one embodiment thrombin produced by the described method can be used in the manufacturing of tissue sealants (âgluesâ) in combination with other proteins, i.e. fibrin originating from recombinant cells, transgenic animals or human plasma. In another embodiment thrombin produced by the described method can be used as a stand-alone product, freeze dried as single active component or in combination with a non-protein matrix, or, in solution as single active component or in combination with other active components.
Suitable mix-in components would be, but is not limited to, collagen, chitin, degradable polymers, cellulose, recombinant coagulation factors and fibrinogen from transgenic or recombinant sources.
The potential fields of use for the tissue sealants (âgluesâ) are numerous; skin grafting, neuro surgery, cardiac surgery, toracic surgery, vascular surgery, oncologic surgery, plastic surgery, ophthalmologic surgery, orthopedic surgery, trauma surgery, head and neck surgery, gynecologic and urologic surgery, gastrointestinal surgery, dental surgery, drug delivery, tissue engineering and dental cavity haemostasis.
A further aspect of the invention relates to a method for obtaining coagulation by administering a therapeutically effective amount of a recombinant human thrombin obtained using the method according to the invention to a patient.
Another aspect of the present invention is an isolated DNA sequence according SEQ ID NO 2 or homologues thereof coding for a recombinant ecarin. A homologue of SEQ ID NO 2 coding for ecarin may have at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity to the sequence SEQ ID NO 2. SEQ ID NO 2 is a designed sequence that has been optimised for optimal expression. The sequence is particularly suited for expression in mammalian cell systems.
According to another aspect a vector comprising SEQ ID NO 2 or a homologue thereof is provided. Said vector can be designed to overexpress SEQ ID NO 2 or a homologue thereof and is operably linked to expression control sequences permitting expression of ecarin encoded by SEQ ID NO 2 or a homologue thereof. According to a third aspect a host cell comprising said vector is provided that is capable of expressing ecarin encoded by SEQ ID NO 2 or a homologue thereof. This host cell is preferably a eukaryotic cell. Typical host cells include, but are not limited to insect cells, yeast cells, and mammalian cells. Mammalian cells are particularly preferred. Suitable mammalian cells lines include, but are not limited to, CHO, HEK, NSO, 293, Per C.6, BHK and COS cells, and derivatives thereof. In one embodiment the host cell is the mammalian cell line CHO-S.
According to another embodiment of the present invention a polypeptide comprising an amino acid sequence encoded by SEQ ID NO: 2 or a homologue thereof and obtained by the method described in Example 2.
The sequence identity between two sequences can be determined by pair-wise computer alignment analysis, using programs such as, BestFit, PILEUP, Gap or FrameAlign. The preferred alignment tool is BestFit. In practise, when searching for similar/identical sequences to the query search, from within a sequence database, it is generally necessary to perform an initial identification of similar sequences using suitable algorithms such as Blast, Blast2, NCBI Blast2, WashU Blast2, FastA, or Fasta3, and a scoring matrix such as Blosum 62. Such algorithms endeavour to closely approximate the âgold-standardâ alignment algorithm of Smith-Waterman. Thus, the preferred software/search engine program for use in assessing similarity, i.e., how two primary polypeptide sequences line up is Smith-Waterman. Identity refers to direct matches, similarity allows for conservative substitutions.
The invention will be further described by means of the following examples which shall not be interpreted as limiting the scope of the appended claims.
The P1E2 cell line containing the construct PN32 shown in FIG. 1 having the nucleotide sequence SEQ ID NO: 1, was grown in a fermentor according to the method described in WO2005038019, using a protein and animal component free growth medium in order to produce prothrombin for use in thrombin manufacturing. The cells were grown either by batch or perfusion culture methods (Table 1) and the amount of prothrombin produced was measured by an ecarin assay. This ecarin assay was performed essentially as the Chromogenix assay (Mölndal, Sweden) using purified plasma-derived human prothrombin (Haematologic Technologies Inc., Vermont, USA) as standard.
| TABLE 1 |
| Examples of yield of prothrombin in experimental fermentor runs |
| Culture method & | Viable cells | Prothrombin | |
| Experiment ID | time | (million cells/mL) | mg/L |
| CC2LC (272-8) | Batch, 238 h | 5.9 | 281 |
| CC2LD (272-8) | Batch, 238 h | 6.2 | 276 |
| 326-11B | Perfusion, 259 h | 18 | 722 |
The fermentor experiments showed that both batch and perfusion culture methods can be used to produce prothrombin suitable for production of recombinant thrombin (Table 1). The share of fully carboxylated prothrombin obtained in these fermentor runs was about 55-87%, the rest being incompletely carboxylated prothrombin.
An ecarin encoding sequence having the nucleotide sequence SEQ ID NO: 2 optimised for expression in mammalian cells was synthesized and cloned into the Invitrogen vector pCDNA 3.1+(FIG. 2). An alignment of the nucleotide sequence of the recombinant ecarin used in the present invention to the sequence of wild type ecarin (GI:717090) is seen in FIG. 4. As can be seen in FIG. 5 this recombinant ecarin is 100% homologous to the amino acid sequence for wild type ecarin. This construct, AZ ecarin (SEQ ID NO. 3), was used to stably transfect CHO-S cells (Invitrogen). Ecarin is secreted by the host cell to the extra-cellular space, and in order to screen for ecarin producing clones, culture supernatant samples were removed and mixed with recombinant human prothrombin (rhFII) to a final concentration of 1 mg rhFII/L in assay buffer (50 mM Tris-HCl, pH 7.4 containing 0.1% BSA). This mix was incubated 20-40 minutes at 37° C. The thrombin generated by the action of ecarin present in the sample was then detected by adding a 1-2 mM solution of the chromogenic thrombin substrate S-2238 (Chromogenix, Mölndal). Colour development was monitored and stopped when suitable using 20% acetic acid. To estimate the activity of the recombinant ecarin produced, snake venom derived ecarin with a declared activity was purchased from Sigma and used as standard. The best producing cell line obtained produced up to 7000 U ecarin per litre culture in lab scale shaker cultures grown in animal component free medium.
The above method produces the recombinant ecarin as a pro protein Thus, activation by removal of the pro-part is necessary for optimal activity. To our surprise, we found that activation was most conveniently obtained by continued incubation of the culture for at least 7 days after the death of the ecarin producing cells (FIG. 6). The culture medium used was CD-CHO supplemented with HT-supplement, non-essential amino acids and Glutamax I (as recommended by Invitrogen for CHO-S), and growth conditions were shaker bottles at 37° C. in an atmosphere containing 5% carbon dioxide. Culture samples were assayed for activity as described above. As can be seen from FIG. 6, the activity of recombinant ecarin increased during the activation period.
Samples from culture supernatants were also separated by SDS-PAGE and blotted to nitrocellulose mebranes. Labelling of the membrane was performed with polyclonal rabbit serum directed towards the mature part of ecarin expressed as inclusion bodies in E. coli. âMâ indicates the molecular weight marker and numbers refer to day of sample collection. As can be seen from FIG. 7 the recombinant ecarin remains stable for more than a week after the death of the cells. Activation of ecarin may also take place at lower temperatures, for instance as low as room temperature, but will then require longer times for activation. Ecarin will remain stable for severable months in room temperature in the presence of dead host cells. The activity will increase gradually until it levels out. A decrease in activity has not been observed except in the presence of bacterial infections or high temperatures. Efforts to use trypsin for activation of ecarin were made, but were not successful.
The ecarin protease converts prothrombin to meizothrombin, an intermediate form of thrombin that has thrombin catalytic activity. Further processing into thrombin is achieved by auto-catalyses. To determine the estimated amount of ecarin culture needed for converting prothrombin into thrombin, we performed a series of test digests. Different amounts of ecarin-containing culture supernatants as obtained in Example 2, were mixed with 1 mg/ml prothrombin (as obtained in example 1) in PBS buffer (Cambrex). Incubation of the mixtures was done at 37° C. for 1-3 hours. Samples were then analysed by SDS-PAGE to identify the amount of recombinant ecarin needed for complete conversion of prothrombin into thrombin. By this procedure we found that the recombinant ecarin was very potent; one litre of ecarin culture supernatant at 7000 U/L is capable of complete conversion of 64 grams of prothrombin into thrombin in less than 3 hours at 37° C. Normally recombinantly produced prothrombin has to be purified in order to separate fully-carboxylated prothrombin from the incompletely carboxylated prothrombin. However this is not necessary for the present invention as the recombinant ecarin is able to efficiently activate both the fully carboxylated and the incompletely carboxylated prothrombins.
Thrombin obtained by the procedure described in example 3 was purified by cation-exchange chromatography (CIEX) using AKTA-FPLC (GE Healthcare) and an SP-Sepharose HP column (GE Healthcare) equilibrated with 25 mM sodium-phosphate buffer, pH 6.5. Ecarin-digested prothrombin prepared as in example 3 was adjusted to pH 6.2 and a conductivity of approximately 8 mS/cm. Thrombin was eluted with a 1M sodium chloride gradient in column equilibration buffer over 20 column volumes (FIG. 8). Selected fractions were analysed by SDS-PAGE (FIG. 9). Thrombin activity was confirmed by incubation with the chromogenic thrombin substrate S-2238 (Chromogenix, Mölndal).
To further analyse the obtained thrombin, kinetic parameters were determined using the chromogenic thrombin substrate S-2366 (Chromogenix). Activity was estimated by titration with hirudin. The rh-thrombin was for all parameters; Activity, Kkat and Vmax, similar to plasma-derived human a-thrombin from Haematologic Technologies Inc. (Vermont, USA).
Purified thrombin was also subjected to N-terminal sequencing: Reduced thrombin heavy and light polypeptide chains were separated by SDS-PAGE and blotted to Immobilon P membrane (Millipor). The excised bands were sequenced by the Edman degradation method. Heavy chain N-terminal first five amino acids were confirmed to be IVEGS, and the light chain five N-terminal amino acids were TFGS as expected.
Below are the sequences for SEQ ID NOS. 3, 2, and 1:
| SEQâIDâNO.â3 | |
| gacggatcgggagatctcccgatcccctatggtcgactctcagtacaatctgctctgatgccgcatagttaagccagtat | |
| ctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccg | |
| acaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacatt | |
| gattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataactta | |
| cggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaa | |
| cgccaatagggactttccattgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaagtgtat | |
| catatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttat | |
| gggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatggg | |
| cgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaat | |
| caacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggt | |
| ctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcactataggg | |
| agacccaagctggctagcgtttaaacttaagcttggtaccgagctcggatccactagtccagtgtggtggaattctgca | |
| gatatccaccatgatccagatcctgctggtgatcatctgcctggccgtgttcccctaccagggctgctccatcatcctggg | |
| cagcggcaacgtgaacgactacgaggtggtgtacccccagaaggtgaccgccctgcccaagggcgccgtgcagc | |
| agcccgagcagaaatacgaggacgccatgcagtacgagttcgaggtgaagggcgagcccgtggtgctgcacctg | |
| gagaagaacaaggagctgttcagcgaggactacagcgagacccactacagcagcgacgacagggagatcacc | |
| accaaccccagcgtggaggaccactgctactaccacggccggatccagaacgacgccgagagcaccgccagca | |
| tcagcgcctgtaatggcctgaagggccacttcaagctgagaggcgagacctacttcatcgagcccctgaagatcccc | |
| gacagcgaggcccacgccgtgtacaagtacgagaacatcgagaacgaggacgaggcccctaagatgtgtggcgt | |
| gacccaggacaactgggagagcgacgagcccatcaagaaaaccctgggcctgatcgtgcccccccacgagaga | |
| aagttcgagaagaagttcatcgaactggtggtcgtggtggaccacagcatggtgaccaagtacaacaacgacagca | |
| ccgccatcaggacctggatctacgagatgctgaacaccgtgaacgagatctacctgcccttcaacatcagagtggcc | |
| ctggtgggcctggagttctggtgtaacggcgacctgatcaacgtgaccagcaccgccgacgacaccctgcacagctt | |
| cggcgagtggagagccagcgacctgctgaaccggaagagacacgatcacgcccagctgctgaccaatgtgaccc | |
| tggaccactccaccctgggcatcaccttcgtgtacggcatgtgtaagagcgaccggagcgtggagctgatcctggact | |
| acagcaacatcaccttcaacatggcctacatcatcgcccacgagatgggccacagcctgggcatgctgcacgacac | |
| caagttctgtacctgtggcgccaagccctgtatcatgttcggcaaggagagcatccctccccctaaggagttcagcag | |
| ctgctcctacgaccagtacaataagtacctgctgaagtacaaccccaagtgtatcctggacccccccctgagaaagg | |
| acatcgccagccctgccgtgtgtggcaatgagatctgggaggagggcgaggagtgtgactgtggcagcccagccg | |
| actgtagaaacccctgctgtgatgccgccacctgtaagctgaagcctggcgccgagtgtggcaacggcgagtgctgt | |
| gacaagtgtaagatccggaaggccggcaccgagtgtagacccgccagggacgattgtgacgtggccgagcactgt | |
| accggccagagcgccgagtgccccagaaacgagttccagaggaacggccagccttgcctgaacaacagcggct | |
| actgctacaacggcgactgccccatcatgctgaaccagtgtatcgccctgttcagccccagcgccaccgtggcccag | |
| gacagctgcttccagagaaacctgcagggcagctactacggctactgtaccaaggagatcggctactacggaaag | |
| aggttcccctgtgcccctcaggacgtgaagtgtggcaggctgtactgcctggacaactccttcaagaaaaacatgagg | |
| tgtaagaacgactacagctacgccgacgagaacaagggcatcgtggagcccggcaccaagtgtgaggacggca | |
| aagtgtgtatcaaccggaagtgtgtggacgtgaacaccgcctactgatgagcggccgctcgagtctagagggcccgt | |
| ttaaacccgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccct | |
| ggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctg | |
| gggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgg | |
| gctctatggcttctgaggcggaaagaaccagctggggctctagggggtatccccacgcgccctgtagcggcgcatta | |
| agcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttctt | |
| cccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcggggcatccctttagggttccgatttagtgcttt | |
| acggcactcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgc | |
| cctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattct | |
| tttgatttataagggattttggggatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaattc | |
| tgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccaggcaggcagaagtatgcaaagcatgcatctc | |
| aattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaatt | |
| agtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgcccc | |
| atggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttt | |
| tttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcaagagacaggatgagg | |
| atcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgact | |
| gggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaa | |
| gaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgtt | |
| ccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcagga | |
| tctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatcc | |
| ggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtc | |
| gatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatg | |
| cccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctg | |
| gattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaaga | |
| gcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcg | |
| ccttcttgacgagttcttctgagcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccatcacga | |
| gatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcctccag | |
| cgcggggatctcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaataaagcaatagc | |
| atcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgt | |
| ataccgtcgacctctagctagagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattcc | |
| acacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgtt | |
| gcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagag | |
| gcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatc | |
| agctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaag | |
| gccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagca | |
| tcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctgga | |
| agctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcg | |
| ctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaacccccc | |
| gttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactgg | |
| cagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaac | |
| tacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctc | |
| ttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaagg | |
| atctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatg | |
| agattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaa | |
| cttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgac | |
| tccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagaccca | |
| cgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactt | |
| tatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgtt | |
| gccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcga | |
| gttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgca | |
| gtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagt | |
| actcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgc | |
| gccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctg | |
| ttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagc | |
| aaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcct | |
| ttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaat | |
| aggggttccgcgcacatttccccgaaaagtgccacctgacgtc// | |
| SEQâIDâNO.â2 | |
| atgatccagatcctgctggtgatcatctgcctggccgtgttcccctaccagggctgctccatcatcctgggcagcggcaa | |
| cgtgaacgactacgaggtggtgtacccccagaaggtgaccgccctgcccaagggcgccgtgcagcagcccgagcagaaat | |
| acgaggacgccatgcagtacgagttcgaggtgaagggcgagcccgtggtgctgcacctggagaagaacaaggagctgttc | |
| agcgaggactacagcgagacccactacagcagcgacgacagggagatcaccaccaaccccagcgtggaggaccactgcta | |
| ctaccacggccggatccagaacgacgccgagagcaccgccagcatcagcgcctgtaatggcctgaagggccacttcaagc | |
| tgagaggcgagacctacttcatcgagcccctgaagatccccgacagcgaggcccacgccgtgtacaagtacgagaacatc | |
| gagaacgaggacgaggcccctaagatgtgtggcgtgacccaggacaactgggagagcgacgagcccatcaagaaaaccct | |
| gggcctgatcgtgcccccccacgagagaaagttcgagaagaagttcatcgaactggtggtcgtggtggaccacagcatgg | |
| tgaccaagtacaacaacgacagcaccgccatcaggacctggatctacgagatgctgaacaccgtgaacgagatctacctg | |
| cccttcaacatcagagtggccctggtgggcctggagttctggtgtaacggcgacctgatcaacgtgaccagcaccgccga | |
| cgacaccctgcacagcttcggcgagtggagagccagcgacctgctgaaccggaagagacacgatcacgcccagctgctga | |
| ccaatgtgaccctggaccactccaccctgggcatcaccttcgtgtacggcatgtgtaagagcgaccggagcgtggagctg | |
| atcctggactacagcaacatcaccttcaacatggcctacatcatcgcccacgagatgggccacagcctgggcatgctgca | |
| cgacaccaagttctgtacctgtggcgccaagccctgtatcatgttcggcaaggagagcatccctccccctaaggagttca | |
| gcagctgctcctacgaccagtacaataagtacctgctgaagtacaaccccaagtgtatcctggacccccccctgagaaag | |
| gacatcgccagccctgccgtgtgtggcaatgagatctgggaggagggcgaggagtgtgactgtggcagcccagccgactg | |
| tagaaacccctgctgtgatgccgccacctgtaagctgaagcctggcgccgagtgtggcaacggcgagtgctgtgacaagt | |
| gtaagatccggaaggccggcaccgagtgtagacccgccagggacgattgtgacgtggccgagcactgtaccggccagagc | |
| gccgagtgccccagaaacgagttccagaggaacggccagccttgcctgaacaacagcggctactgctacaacggcgactg | |
| ccccatcatgctgaaccagtgtatcgccctgttcagccccagcgccaccgtggcccaggacagctgcttccagagaaacc | |
| tgcagggcagctactacggctactgtaccaaggagatcggctactacggaaagaggttcccctgtgcccctcaggacgtg | |
| aagtgtggcaggctgtactgcctggacaactccttcaagaaaaacatgaggtgtaagaacgactacagctacgccgacga | |
| gaacaagggcatcgtggagcccggcaccaagtgtgaggacggcaaagtgtgtatcaaccggaagtgtgtggacgtgaaca | |
| ccgcctactga | |
| SEQâIDâNO.â1 | |
| gacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtat | |
| ctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccg | |
| acaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacatt | |
| gattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataactta | |
| cggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaa | |
| cgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtat | |
| catatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttat | |
| gggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatggg | |
| cgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaat | |
| caacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggt | |
| ctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcactataggg | |
| agacccaagctggctagcgtttaaacttaagcttggtaccgagctcggatccactagtccagtgtggtggaattgccctt | |
| attcctcagtgacccaggagctgacacactatggcgcacgtccgaggcttgcagctgcctggctgcctggccctggct | |
| gccctgtgtagccttgtgcacagccagcatgtgttcctggctcctcagcaagcacggtcgctgctccagcgggtccggc | |
| gagccaacaccttcttggaggaggtgcgcaagggcaacctggagcgagagtgcgtggaggagacgtgcagctac | |
| gaggaggccttcgaggctctggagtcctccacggctacggatgtgttctgggccaagtacacagcttgtgagacagc | |
| gaggacgcctcgagataagcttgctgcatgtctggaaggtaactgtgctgagggtctgggtacgaactaccgagggc | |
| atgtgaacatcacccggtcaggcattgagtgccagctatggaggagtcgctacccacataagcctgaaatcaactcc | |
| actacccatcctggggccgacctacaggagaatttctgccgcaaccccgacagcagcaccacgggaccctggtgct | |
| acactacagaccccaccgtgaggaggcaggaatgcagcatccctgtctgtggccaggatcaagtcactgtagcgat | |
| gactccacgctccgaaggctccagtgtgaatctgtcacctccattggagcagtgtgtccctgatcgggggcagcagta | |
| ccaggggcgcctggcggtgaccacacatgggctcccctgcctggcctgggccagcgcacaggccaaggccctga | |
| gcaagcaccaggacttcaactcagctgtgcagctggtggagaacttctgccgcaacccagacggggatgaggagg | |
| gcgtgtggtgctatgtggccgggaagcctggcgactttgggtactgcgacctcaactattgtgaggaggccgtggagg | |
| aggagacaggagatgggctggatgaggactcagacagggccatcgaagggcgtaccgccaccagtgagtacca | |
| gactttcttcaatccgaggacctttggctcgggagaggcagactgtgggctgcgacctctgttcgagaagaagtcgctg | |
| gaggacaaaaccgaaagagagctcctggaatcctacatcgacgggcgcattgtggagggctcggatgcagagatc | |
| ggcatgtcaccttggcaggtgatgcttttccggaagagtccccaggagctgctgtgtggggccagcctcatcagtgacc | |
| gctgggtcctcaccgccgcccactgcctcctgtacccgccctgggacaagaacttcaccgagaatgaccttctggtgc | |
| gcattggcaagcactcccgcaccaggtacgagcgaaacattgaaaagatatccatgttggaaaagatctacatcca | |
| ccccaggcaagcactggcgggagaacctggaccgggacattgccctgatgaagctgaagaagcctgttgccttcagtg | |
| actacattcaccctgtgtgtctgcccgacagggagacggcagccagcttgctccaggctggatacaaggggcgggtg | |
| acaggctggggcaacctgaaggagacgtggacagccaacgttggtaaggggcagcccagtgtcctgcaggtggtg | |
| aacctgcccattgtggagcggccggtctgcaaggactccacccggatccgcatcactgacaacatgttctgtgctggtt | |
| acaagcctgatgaagggaaacgaggggatgcctgtgaaggtgacagtgggggaccctttgtcatgaagagcccctt | |
| taacaaccgctggtatcaaatgggcatcgtctcatggggtgaaggctgtgaccgggatgggaaatatggcttctacac | |
| acatgtgttccgcctgaagaagtggatacagaaggtcattgatcagtttggagagtagaagggcaattctgcagatatc | |
| cagcacagtggcggccgctcgagtctagagggcccgtttaaacccgctgatcagcctcgactgtgccttctagttgcca | |
| gccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgag | |
| gaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggat | |
| tgggaagacaatagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccagctggggct | |
| ctagggggtatccccacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgct | |
| acacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagct | |
| ctaaatcgggggctccctttagggttccgatttagtgctttacggcaccttcgaccccaaaaaacttgattagggctgtgg | |
| aatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattag | |
| tcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcag | |
| caaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctg | |
| actaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggag | |
| gcctaggcttttgcaaaaagctctctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcacta | |
| tagggagacccaagctggctagcgtttaaacttaagcttggtaccgagctcggatccactagtccagtgtggtggaatt | |
| gccctttccgcagagcaatggcggtgtctgccgggtccgcgcggacctcgcccagctcagataaagtacagaaaga | |
| caaggctgaactgatctcagggcccaggcaggacagccgaatagggaaactcttgggttttgagtggacagatttgtc | |
| cagttggcggaggctggtgaccctgctgaatcgaccaacggaccctgcaagcttagctgtctttcgttttctttttgggttctt | |
| gatggtgctagacattccccaggagcgggggctcagctctctggaccggaaataccttgatgggctggatgtgtgccg | |
| cttccccttgctggatgccctacgcccactgccacttgactggatgtatcttgtctacaccatcatgtttctgggggcactgg | |
| gcatgatgctgggcctgtgctaccggataagctgtgtgttattcctgctgccatactggtatgtgtttctcctggacaagac | |
| atcatggaacaaccactcctatctgtatgggttgttggcctttcagctaacattcatggatgcaaaccactactggtctgtg | |
| gacggtctgctgaatgcccataggaggaatgcccacgtgcccctttggaactatgcagtgctccgtggccagatcttca | |
| ttgtgtacttcattgcgggtgtgaaaaagctggatgcagactgggttgaaggctattccatggaatatttgtcccggcact | |
| ggctcttcagtcccttcaaactgctgttgtctgaggagctgactagcctgctggtcgtgcactggggtgggctgctgcttga | |
| cctctcagctggtttcctgctcttttttgatgtctcaagatccattggcctgttctttgtgtcctacttccactgcatgaattcccag | |
| cttttcagcattggtatgttctcctacgtcatgctggccagcagccctctcttctgctcccctgagtggcctcggaagctggt | |
| gtcctactgcccccgaaggttgcaacaactgttgcccctcaaggcagcccctcagcccagtgtttcctgtgtgtataaga | |
| ggagccggggcaaaagtggccagaagccagggctgcgccatcagctgggagctgccttcaccctgctctacctcct | |
| ggagcagctattcctgccctattctcattttctcacccagggctataacaactggacaaatgggctgtatggctattcctgg | |
| gacatgatggtgcactcccgctcccaccagcacgtgaagatcacctaccgtgatggccgcactggcgaactgggcta | |
| ccttaaccctggggtatttacacagagtcggcgatggaaggatcatgcagacatgctgaagcaatatgccacttgcct | |
| gagccgcctgcttcccaagtataatgtcactgagccccagatctactttgatatttgggtctccatcaatgaccgcttcca | |
| gcagaggatttttgaccctcgtgtggacatcgtgcaggccgcttggtcaccctttcagcgcacatcctgggtgcaacca | |
| ctcttgatggacctgtctccctggagggccaagttacaggaaatcaagagcagcctagacaaccacactgaggtggt | |
| cttcattgcagatttccctggactgcacttggagaattttgtgagtgaagacctgggcaacactagcatccagctgctgc | |
| agggggaagtgactgtggagcttgtggcagaacagaagaaccagactcttcgagagggagaaaaaatgcagttgc | |
| ctgctggtgagtaccataaggtgtatacgacatcacctagcccttcttgctacatgtacgtctatgtcaacactacagagc | |
| ttgcactggagcaagacctggcatatctgcaagaattaaaggaaaaggtggagaatggaagtgaaacagggcctct | |
| acccccagagctgcagcctctgttggaaggggaagtaaaagggggccctgagccaacacctctggttcagacctttc | |
| ttagacgccaacaaaggctccaggagattgaacgccggcgaaatactcctttccatgagcgattcttccgcttcttgttg | |
| cgaaagctctatgtctttcgccgcagcttcctgatgacttgtatctcacttcgaaatctgatattaggccgtccttccctgga | |
| gcagctggcccaggaggtgacttatgcaaacttgagaccctttgaggcagttggagaactgaatccctcaaacacgg | |
| attcttcacattctaatcctcctgagtcaaatcctgatcctgtccactcagagttctgaagggggccagatgttggaaggg | |
| caattcgagtctagagggcccgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactct | |
| tgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggtt | |
| aaaaaatgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgtgtgtcagttagggtgtggaaagtcccc | |
| aggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggc | |
| tccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccat | |
| cccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggcc | |
| gcctctgcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcccgggagc | |
| ttgtatatccattttcggatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcag | |
| gttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgt | |
| gttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggac | |
| gaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcggg | |
| aagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatcc | |
| atcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgc | |
| atcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcg | |
| cgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgc | |
| ctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgct | |
| atcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttac | |
| ggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcga | |
| aatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggctt | |
| cggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccccaac | |
| ttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattct | |
| agttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctctagctagagcttggcgtaatcatgg | |
| tcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagc | |
| ctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtg | |
| ccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcact | |
| gactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaa | |
| tcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgc | |
| gttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaa | |
| cccgacaggactataaagataccaggcgtttccccctggaagaccctcgtgcgctctcctgttccgaccctgccgctta | |
| ccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgta | |
| ggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgt | |
| cttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggt | |
| atgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgct | |
| ctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtttttt | |
| tgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctc | |
| agtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaa | |
| aatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctat | |
| ctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttacca | |
| tctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagc | |
| cggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctaga | |
| gtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtat | |
| ggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctcct | |
| tcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttact | |
| gtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccg | |
| agttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaa | |
| cgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactg | |
| atcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaat | |
| aagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgag | |
| cggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgac | |
| gtc// |
1. A method for producing recombinant human thrombin from recombinant prothrombin using recombinant ecarin having the sequence SEQ ID NO 2 or a homologue thereof.
2. A method according to claim 1, wherein the recombinant ecarin is being expressed and secreted by a cell containing the gene comprising the nucleotide sequence SEQ ID NO 2 or a homologue thereof in CHO-S cells, which ecarin has an amino acid sequence equal to that of wild type ecarin.
3. A method according to claim 1 or 2, wherein recombinant protrombin is subjected to recombinant ecarin, which recombinant ecarin was isolated in active form after extra-cellular expression by CHO-S cells, said cells being left to apoptosis/necrosis for a time sufficient to activate said ecarin, whereupon a human recombinant thrombin is isolated.
4. A method according to any of the preceding claims, wherein the recombinant prothrombin is produced by a cell-line comprising a prothrombin expressing gene having a nucleotide sequence comprising the sequence SEQ. ID. NO. 1.
5. A method according to any of the preceding claims, wherein the recombinant prothrombin is a mixture of fully carboxylated prothrombin and incompletely carboxylated prothrombin.
6. A method according to any of the preceding claims, wherein the recombinant prothrombin is a fully carboxylated prothrombin.
7. A method according to any of the preceding claims, wherein the recombinant prothrombin is an incompletely carboxylated prothrombin.
8. A recombinant thrombin obtained by the method according to any of the preceding claims.
9. A pharmaceutical composition comprising a recombinant thrombin according to claim 8, in combination with pharmaceutically acceptable carriers, vehicles and/or adjuvants.
10. A pharmaceutical composition according to claim 9, wherein the composition is in an applicable form.
11. An isolated DNA sequence encoding ecarin according to SEQ ID NO 2 or a homologue thereof, having at least 80% identity to SEQ ID NO 2.
12. An isolated DNA according claim 11, wherein the homologue has an identity of at least 90% to SEQ ID NO 2.
13. A vector comprising the isolated DNA sequence of any of the claims 11 to 12.
14. An amino acid sequence encoded by SEQ ID NO 2 or a homologue thereof.
15. A host cell comprising the vector of claim 13.
16. A host cell according to claim 15, wherein the host cell is a mammalian cell.