US20130131331A1
2013-05-23
13/671,118
2012-11-07
The present inventors discovered that although suppressing expression of the RecQ1 gene, a RecQ helicase family gene, shows suppressive effects on cell proliferation in cancer cells, such effects are not observed in human TIG3 cells (a normal diploid fibroblast cell line), which are normal cells. Hence, the present inventors discovered that siRNAs against RecQ1 gene have cancer cell-specific cell proliferation-suppressing effects that are mediated by suppression of the expression of said gene.
Get notified when new applications in this technology area are published.
C12N15/1137 » CPC main
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides against enzymes
C12N15/113 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
The present invention relates to compounds that suppress expression of RecQ1 genes, and particularly relates to cell proliferation inhibitors comprising siRNAs that exhibit the effect of suppressing expression of these genes.
Genes belonging to the RecQ DNA helicase family are widely present in organisms ranging from prokaryotes such as Escherichia coli (E. coli) to higher eukaryotes including humans. Conserved in the evolution process, these genes diversified along with the multicellularization of organisms. The E. coli RecQ gene was the first of the RecQ family genes to be discovered. This gene was identified as a gene participating in zygotic recombination and in the RecF pathway for UV damage repair (see Non-Patent Document 1). The E. coli RecQ gene has been revealed to have the function of suppressing incorrect recombinations (see Non-Patent Document 2). The budding yeast SGS1 gene and the fission yeast Rqh1 gene are the only known RecQ homologues in these yeasts. Both of these genes mainly suppress recombination and play important roles in genome stabilization (see Non-Patent Documents 3 and 4). Higher eukaryotes carry a number of RecQ homologues. In humans, there are five types of genes known to belong to the RecQ family: the RecQL1 (see Non-Patent Document 6), BLM, WRN, RTS, and RecQL5 genes. Of these five, the RTS gene (see Non-Patent Document 5 and Patent Documents 1 and 2) and the RecQL5 gene (see Non-Patent Document 5 and Patent Document 3) were identified by the present inventors. The BLM, WRN, and RTS genes respectively cause Bloom's syndrome (see Non-Patent Document 7), Werner's syndrome (see Non-Patent Document 8), and Rothmund-Thomson syndrome (see Non-Patent Document 9). These genes all play important roles in genome stabilization in cells.
In fibroblast cells and lymphocytic cell lines derived from patients with Werner's syndrome, chromosomal translocation and deletion, which are indexes for genome instability, have been reported to occur with high frequency (see Non-Patent Document 10). Chromosomal breakage and sister chromatid exchange (SCE) are frequently detected in cells derived from patients with Bloom's syndrome (see Non-Patent Document 11). Trisomies of human chromosome 2 and 8 are frequently found in lymphocytes derived from patients with Rothmund-Thomson syndrome (see Non-Patent Document 12). These findings suggest that the WRN helicase, BLM helicase, and RTS helicase encoded by the various causative genes of these three genetic diseases play important roles in genome stabilization in cells.
Telomere length abnormalities are seen in lymphocytic cell lines derived from patients with Werner's syndrome as compared to cell lines derived from normal healthy subjects (see Non-Patent Document 13). In addition, cell immortalization was not observed in lymphocytic cell lines derived from patients with Werner's syndrome, although about 15% of cell lines derived from normal healthy subjects were immortalized after passaging (see Non-Patent Document 14). This finding indicates that WRN helicase contributes to telomere structure maintenance, and is thus essential for the immortalization (canceration) of lymphocytic cell lines.
It has been suggested that WRN helicase is associated with homologous recombination-mediated repair, because the helicase forms foci in the nucleus in response to DNA-damaging agents, and these foci are co-localized with the single-stranded DNA-binding protein RPA (which is a WRN-binding protein) and with the recombination repair factor RAD51 (see Non-Patent Document 15). In addition, WRN helicase has been known to bind to the DNA-dependent protein kinase complex (DNA-PK) and to flap endonuclease 1 (FEN-1). By binding to DNA-PK, WRN helicase plays an important role in the processing of terminals generated by DNA double strand breaks, which are repaired in the pathway of non-homologous end joining (see Non-Patent Document 16). WRN helicase is believed to activate FEN-1 by binding to it, and to provide a site for precise reconstruction of the replication fork through homologous recombination by processing Okazaki fragments (see Non-Patent Document 17). The above findings suggest that WRN helicase plays an important role in DNA repair during DNA replication. BLM helicase is localized in the PML body, a specific structure found in the nucleus, and it binds to topoisomerase III (see Non-Patent Document 18). The helicase has the unwinding activity of the G-quadruplex structure, and thus is considered to contribute to telomere maintenance (see Non-Patent Document 19). Furthermore, the helicase has been reported to unwind the Holliday junction and to interact with the Rad51 protein (see Non-Patent Document 20). These findings suggest that BLM helicase cooperates with other DNA-metabolizing enzymes and plays an important role in recombinational DNA repair and telomere maintenance.
Of the five human proteins belonging to the RecQ DNA helicase family (RecQ1, BLM, WRN, RTS, and RecQ5), RecQ1, BLM, WRN, and RTS are expressed at negligible levels in resting cells, but are expressed at high levels in cells whose proliferation has been enhanced by transformation with viruses (see Non-Patent Document 21). Furthermore, when the carcinogenic promoter TPA is added to resting cells, the expression of RecQ1, BLM, WRN, and RTS is induced along with the induction of cell division (see Non-Patent Document 21). These findings suggest the importance of the RecQ DNA helicase family in cell proliferation.
Taken collectively, these findings suggest that the RecQ DNA helicase family members may be potential target molecules for anti-cancer therapy because the family members participate in genomic repair in cells (BLM, WRN and RTS) and also in the maintenance of telomere structure (BLM and WRN), that they play important roles in the immortalization of certain cells (WRN), and that their expression is induced following cell division (RecQ1, BLM, WRN and RTS).
However, even if a compound can suppress the proliferation of cancer cells, if it has similar proliferation-suppressing effects on normal cells, that compound cannot be expected to be a useful anticancer agent. So far, nothing is known concerning how compounds that suppress expression of RecQ1 genes act on normal cells, or whether such compounds have cancer cell-specific cell proliferation-suppressing effects.
[Patent Document 1] Japanese Patent Application No. H09-200387.
[Patent Document 2] Japanese Patent Application No. H11-11218.
[Patent Document 3] Japanese Patent Application No. H10-81492 (Japanese Patent Application Kokai Publication No. (JP-A) H11-276173 (unexamined, published Japanese patent application)).
[Non-Patent Document 1] Nakayama H, Nakayama K, Nakayama R, Irino N, Nakayama Y, Hanawalt P C, âIsolation and genetic characterization of a thymineless death-resistant mutant of Escherichia coli K12: identification of a new mutation (recQ1) that blocks the RecF recombination pathwayâ, Mol Gen Genet., 1984, Vol. 195, p. 474-480.
[Non-Patent Document 2] Hanada K, Ukita T, Kohno Y, Saito K, Kato J, Ikeda H, âRecQ DNA helicase is a suppressor of illegitimate recombination in Escherichia coliâ, Proc Natl Acad Sci USA., 1997, Vol. 94, p. 3860-3865.
[Non-Patent Document 3] Myung K, Datta A, Chen C, Kolodner R D, âSGS1, the Saccharomyces cerevisiae homologue of BLM and WRN, suppresses genome instability and homologous recombinationâ, Nat Genet., 2001, Vol. 27, p. 113-116.
[Non-Patent Document 4] Doe C L, Dixon J, Osman F, Whitby M C, âPartial suppression of the fission yeast rqh1(â) phenotype by expression of a bacterial Holliday junction resolvaseâ, EMBO J., 2000, Vol. 19, p. 2751-2762.
[Non-Patent Document 5] Kitao S, Ohsugi I, Ichikawa K, Goto M, Furuichi Y, Shimamoto A, âCloning of two new human helicase genes of the RecQ family: biological significance of multiple species in higher eukaryotesâ, Genomics., 1998, Vol. 54, p. 443-452.
[Non-Patent Document 6] Seki, M., Miyazawa, H., Tada, S., Yanagisawa, J., Yamaoka, T., Hoshino, S., Ozawa, K., Eki, T., Nogami, M., Okumura K., et al, âMolecular cloning of cDNA encoding human DNA helicase Q1 which has homology to Escherichia coli Rec Q helicase and localization of the gene at chromosome 12p12â, Nucleic Acids Res., 1994, Vol. 22, No. 22, p. 4566-4573.
[Non-Patent Document 7] Ellis N A, Groden J, Ye T Z, Straughen J, Lennon D J, Ciocci S, Proytcheva M, German J, âThe Bloom's syndrome gene product is homologous to RecQ helicasesâ, Cell, 1995, Vol. 83, p. 655-666.
[Non-Patent Document 8] Yu C E, Oshima J, Fu Y H, Wijsman E M, Hisama F, Alisch R, Matthews S, Nakura J, Miki T, Ouais S, Martin G M, Mulligan J, Schellenberg G D, âPositional cloning of the Werner's syndrome geneâ, Science, 1996, Vol. 272, p. 258-262.
[Non-Patent Document 9] Kitao S, Shimamoto A, Goto M, Miller R W, Smithson W A, Lindor N M, Furuichi Y, âMutations in RECQL4 cause a subset of cases of Rothmund-Thomson syndromeâ, Nat Genet., 1999, Vol. 22, p. 82-84.
[Non-Patent Document 10] Goto M, âHierarchical deterioration of body systems in Werner's syndrome: implications for normal ageingâ, Mech. Ageing Dev., 1997, Vol. 98, p. 239-254.
[Non-Patent Document 11] Ellis N A, German J, âMolecular genetics of Bloom's syndromeâ, Hum Mol Genet., 1996, Vol. 5, p. 1457-1463.
[Non-Patent Document 12] Lindor N M, Devries E M, Michels V V, Schad C R, Jalal S M, Donovan K M, Smithson W A, Kvols L K, Thibodeau S N, Dewald G W, âRothmund-Thomson syndrome in siblings: evidence for acquired in vivo mosaicismâ, Clin Genet., 1996, Vol. 49, p. 124-129.
[Non-Patent Document 13] Tahara H, Tokutake Y, Maeda S, Kataoka H, Watanabe T, Satoh M, Matsumoto T, Sugawara M, Ide T, Goto M, Furuichi Y, Sugimoto M, âAbnormal telomere dynamics of B-lymphoblastoid cell strains from Werner's syndrome patients transformed by Epstein-Barr virusâ, Oncogene, 1997, Vol. 15, p. 1911-1920.
[Non-Patent Document 14] Sugimoto M, Furuichi Y, Ide T, Goto M, âIncorrect us of âimmortalizationâ for B-lymphoblastoid cell lines transformed by Epstein-Barr virusâ, Virol., 1999, Vol. 73, p. 9690-9691.
[Non-Patent Document 15] Sakamoto S, Nishikawa K, Heo S J, Goto M, Furuichi Y, Shimamoto A, âWerner helicase relocates into nuclear foci in response to DNA damaging agents and co-localizes with RPA and Rad51â, Genes Cells., 2001, Vol. 6, p. 421-430.
[Non-Patent Document 16] Yannone S M, Roy S, Chan D W, Murphy M B, Huang S, Campisi J, Chen D J, âWerner syndrome protein is regulated and phosphorylated by DNA-dependent protein kinaseâ, J Biol Chem., 2001, Vol. 276, p. 38242-38248.
[Non-Patent Document 17] Brosh R M Jr, von Kobbe C, Sommers J A, Karmakar P, Opresko P L, Piotrowski J, Dianova I, Dianov G L, Bohr V A, âWerner syndrome protein interacts with human flap endonuclease 1 and stimulates its cleavage activityâ, EMBO J., 2001, Vol. 20, p. 5791-5801.
[Non-Patent Document 18] Johnson F B, Lombard D B, Neff N F, Mastrangelo M A, Dewolf W, Ellis N A, Marciniak R A, Yin Y, Jaenisch R, Guarente L, âAssociation of the Bloom syndrome protein with topoisomerase III alpha in somatic and meiotic cellsâ, Cancer Res., 2000, Vol. 60, p. 1162-1167.
[Non-Patent Document 19] Mohaghegh P, Karow J K, Brosh Jr R M Jr, Bohr V A, Hickson I D, âThe Bloom's and Werner's syndrome proteins are DNA structure-specific helicasesâ, Nucleic Acids Res., 2001, Vol. 29, p. 2843-2849.
[Non-Patent Document 20] Wu L, Davies S L, Levitt N C, Hickson I D, âPotential role for the BLM helicase in recombinational repair via a conserved interaction with RAD51â, J Biol Chem., 2001, Vol. 276, p. 19375-19381.
[Non-Patent Document 21] Kawabe, T., Tsuyama, N., Kitao, S., Nishikawa, K., Shimamoto, A., Shiratori, M., Matsumoto, T., Anno, K., Sato, T., Mitsui, Y., Seki, M., Enomoto, T., Goto, M., Ellis, N. A., Ide, T., Furuichi, Y., and Sugimoto, M., âDifferential regulation of human RecQ family helicases in cell transformation and cell cycleâ, Oncogene., 2000, Vol. 19, No. 41, p. 4764-4772.
The present invention was achieved in view of the above circumstances. An objective of the present invention is to provide cancer cell-specific cell proliferation inhibitors aimed at suppressing expression of RecQ1 helicase genes.
The expression level of the RecQ DNA helicase family was found to be significantly high in tumor cells and methods of screening for compounds that suppress tumor growth using the suppression of expression of RecQ DNA helicase family genes as an index are known. It has also been suggested that compounds suppressing RecQ helicase gene expression may suppress cancer cell growth (see Japanese Patent Application Kokai Publication No. (JP-A) 2000-166600 (unexamined, published Japanese patent application)).
However, the relationship between suppression of RecQ1 gene expression and cancer cell-specific cell proliferation suppression has until now been unknown.
Even if a certain compound is found to have cancer cell proliferation-suppressing effects, if it is unclear whether the compound has a proliferation-suppressing effect on normal cells, that compound would not be an effective pharmaceutical. This is because when such a compound also shows a proliferation-suppressing effect on normal cells, it carries the risk of side effects. In fact, to date, findings indicating that various anticancer agents have side effects have been reported (for example, Komarov P. G. et al., Science Vol. 285, 1733-1737, 1999; Kamarova E. A. and Gudkov A. V. Biochemistry (Moscow) Vol. 65, 41-48, 2000; Botchkarev V. A. Cancer Research Vol. 60, 5002-5006, 2000). If it is possible to develop pharmaceutical agents that have cancer cell-specific cell proliferation-suppressing effects and do not act on normal cells, these agents will be expected to be very useful anticancer agents with few side effects.
The present inventors carried out dedicated research to achieve the above-mentioned objectives. The expression of genes from the RecQ DNA helicase family is known to be increased in tumor cell systems (for example, cancer cells). The present inventors used siRNAs that exhibit the effect of suppressing expression of the RecQ1 gene, which belongs to the human RecQ helicase family genes, to examine the effect of suppressing RecQ1 gene expression on cancer cell proliferation. As a result, the present inventors discovered that, although suppressing the expression of the RecQ1 gene leads to observation of cell proliferation-suppressing effects in cancer cells, such effects are not seen in human TIG3 cells (normal diploid fibroblast cell line), which are normal cells. Hence, the present inventors discovered for the first time that a cancer cell-specific cell proliferation-suppressing effect is observed as a result of suppressing RecQ1 gene expression. Therefore, the RecQ1 gene may be a target molecule for excellent carcinostatic agents with few side effects. Furthermore, the present inventors succeeded in finding siRNA molecules with cancer cell-specific cell proliferation-suppressing effects. Pharmaceutical agents comprising such molecules are expected to be effective pharmaceuticals for treating cancers with few side effects.
As described above, many of the existing anticancer agents have side effects; therefore, it would be very difficult to predict in advance that a molecule having the effect of suppressing cancer cell proliferation will not act on normal cells, similarly to the siRNA molecules of the present application against the RecQ1 gene. Therefore, the siRNA molecules provided by the present invention have advantageous effects (cell proliferation-suppressing effects that are specific to cancer cells and do not affect normal cells) that cannot be predicted even by those skilled in the art.
Thus, the present invention relates to cancer cell-specific cell proliferation inhibitors that target RecQ1 helicase gene expression, and particularly relates to cancer cell-specific cell proliferation inhibitors comprising siRNAs with the effect of suppressing RecQ1 gene expression. More specifically, the present invention provides the following:
[1] a double-stranded RNA that can suppress the expression of an RecQ1 gene by an RNAi effect, wherein the RNA comprises a structure in which an RNA comprising the nucleotide sequence of any one of SEQ ID NOs: 1 to 32 or SEQ ID NOs: 40 to 43 and an RNA comprising a sequence complementary to said RNA are hybridized;
[2] the double-stranded RNA of [1], which comprises a structure in which one or more DNAs or RNAs overhang at an end;
[3] a DNA vector that can express an RNA comprising the nucleotide sequence of any one of SEQ ID NOs: 1 to 32 or SEQ ID NOs: 40 to 43;
[4] a cancer cell-specific cell proliferation inhibitor which comprises the RNA of [1] or [2], or the DNA of [3]; and
[5] an anticancer agent comprising the cancer cell-specific cell proliferation inhibitor of [4] as an active ingredient. The above-mentioned cancer cells preferably refer to human cancer cells (cancer cells of human origin).
Furthermore, the present invention relates to:
[6] a method for suppressing cell proliferation cancer cell-specifically (a method for treating a cancer), which comprises the step of administering the RNA of [1] or [2] or the DNA of [3] to an individual (a subject, test subject, patient, etc.); and
[7] a use of the RNA of [1] or [2] or the DNA of [3] in the production of a cancer cell-specific anticancer agent (a cancer cell-specific cell proliferation inhibitor).
FIG. 1 shows the nucleotide sequences of the siRNAs against RecQ1 gene that were used in the Examples. All of the sequences are RNAs, and the overhang sequence of all of the siRNAs is the deoxynucleotides âTTâ.
FIG. 2 shows the expression levels of the RecQ1 gene in HeLa cells into which siRNAs against the RecQ1 gene have been introduced.
FIG. 3 shows the survival rates of HeLa cells 96 hours after siRNAs against the RecQ1 gene have been introduced.
FIG. 4 is a graph showing results of introducing siRNAs against the RecQ1 gene into TIG3 cells, and then quantifying the expression of mRNAs 48 hours later by semi-quantitative RT-PCR. NS is a control siRNA. 15 and 24 are the SEQ ID NOs of siRNAs shown in FIG. 1. The gene expression obtained when a non-silencing siRNA was introduced was taken as 100%.
FIG. 5 is a graph indicating the survival rate of TIG3 cells 96 hours after introduction of siRNAs against the RecQ1 gene. NS is a control siRNA. 15 and 24 are the SEQ ID NOs of siRNAs shown in FIG. 1. The graph shows the number of cells when the number of cells after introduction of a non-silencing siRNA was taken as 100%.
FIG. 6 shows the evaluation results of the medicinal effect of the siRNAs against the RecQ1 gene. NT refers to untreated cancer-bearing mice.
The present inventors discovered that, by suppressing the expression of the RecQ1 gene, which belongs to the RecQ DNA helicase family genes, cell proliferation is suppressed cancer cell (tumor cell)-specifically. Further, the present inventors discovered RNA molecules that exhibit effective cancer cell-specific cell proliferation-suppressing effects through the suppression of RecQ1 gene expression by RNAi effects.
Therefore, firstly, the present invention provides RNAs (siRNAs and shRNAs) that can suppress RecQ1 gene expression by RNAi effects. Such RNAs have cancer cell-specific cell proliferation-suppressing effects. In the present invention, the term âcancer cell-specificâ refers to action against cancer cells but substantial inaction (not showing effective action) against normal cells. Cases in which the effect against normal cells is significantly less than the effect against cancer cells are also comprised in the term âcancer cell-specificâ of the present invention.
Those skilled in the art can readily obtain information on the nucleotide sequences of the RecQ1 genes of the present invention from public gene databases (for example, GenBank). Exemplary GenBank accession numbers of the genes described above are listed below:
RecQ1 gene: NMâ002907 (SEQ ID NO: 33), NMâ032941 (SEQ ID NO: 34), BC001052 (SEQ ID NO: 35), D37984 (SEQ ID NO: 36), and L36140 (SEQ ID NO: 37).
An example of an amino acid sequence of a protein encoded by a RecQ1 gene of the present invention is indicated in SEQ ID NO: 38.
The RecQ1 genes of the present invention typically include, but are not limited to, those derived from animals, more preferably those derived from mammals, and most preferably those derived from humans.
The RNAs of the present invention that can suppress the expression of RecQ1 genes by RNAi (RNA interference) effects (may be simply referred to as âthe siRNAs of the present inventionâ in this application) are more specifically, for example, RNAs comprising the nucleotide sequence of any one of SEQ ID NOs: 1 to 32. Furthermore, examples of preferred embodiments of the siRNAs of the present invention include double-stranded RNAs (siRNAs) that include RNAs comprising the nucleotide sequence of any one of SEQ ID NOs: 1 to 32 as one of the strands.
The present invention provides double-stranded RNAs which are RNAs (siRNAs) that can suppress RecQ1 gene expression by RNAi effects, and which comprise structures in which an RNA comprising the nucleotide sequence of any one of SEQ ID NOs: 1 to 32 and an RNA comprising a sequence complementary to this RNA are hybridized.
For example, the siRNAs of the present invention that comprise the nucleotide sequence of SEQ ID NO: 1 (5â˛-cuacggcuuuggagauaua-3â˛) may be RNA molecules structured as below:
(herein, âIâ indicates a hydrogen bond).
The above-mentioned RNA molecules that are structured such that one end is closed, for example, siRNAs comprising a hairpin structure (shRNAs), are also included in the present invention. Hence, molecules that can form an intramolecular double-stranded RNA structure are also comprised in the present invention.
For example, molecules such as 5â˛-cuacggcuuuggagauaua-3Ⲡ(SEQ ID NO: 1) (xxxx)n uauaucuccaaagccguag (SEQ ID NO: 39)-3Ⲡare also comprised in the present invention. (The aforementioned â(xxxx)nâ indicates a polynucleotide comprising any nucleotide and any number of sequences.)
Preferred embodiments of the siRNAs of the present invention are preferably double-stranded RNAs which are RNAs (siRNAs) that can suppress RecQ1 gene expression by RNAi effects, and which comprise a structure in which an RNA comprising the nucleotide sequence of any one of SEQ ID NOs: 1 to 32 and an RNA comprising a sequence complementary to this RNA are hybridized. Double-stranded RNAs structured such that, for example, there are one or more RNA additions or deletions at the end of such a double-stranded RNA are also comprised in the present invention. In such cases, the RNAs forming the double strand are preferably homologous to a partial sequence of a RecQ1 gene. The length of the region of the RNA forming a double strand in an siRNA of the present invention is ordinarily 15 to 30 bp, preferably 15 to 27 bp or so, more preferably 19 to 21 bp, and most preferably 19 bp (for example, an siRNA in which one of the strands is an RNA of any one of SEQ ID NOs: 1 to 32), but the length is not necessarily limited thereto.
All of the nucleotides in the siRNAs of the present invention are not necessarily required to be ribonucleotides (RNAs). Namely, in the present invention, one or more of the ribonucleotides composing the siRNAs may be corresponding deoxyribonucleotides. âCorrespondingâ means that the nucleotides have identical base species (adenine, guanine, cytosine, and thymine (uracil)), but that the structure of the sugar portion is different. For example, the deoxyribonucleotide corresponding to a ribonucleotide with adenine means a deoxyribonucleotide with adenine. In addition, the above âmoreâ is not limited to a particular number but preferably means a small number around two to five.
In general, the term âRNAiâ refers to a phenomenon where target gene expression is inhibited by inducing disruption of the target gene mRNAs. This disruption is caused by introducing into cells a double-stranded RNA that comprises, a) a sense RNA comprising a sequence homologous to a target gene mRNA sequence, and b) an antisense RNA comprising a sequence complementary to the sense RNA. While the precise RNAi mechanism remains unclear, it is thought that an enzyme called DICER (a member of the RNase III nuclease family) contacts the double-stranded RNA, degrading it into small fragments called âsmall interfering RNAsâ or âsiRNAsâ. The double-stranded RNAs of the present invention comprising the RNAi effects preferably refer to these siRNAs.
In a preferred embodiment of the present invention, the double-stranded RNAs are RNAs that can suppress RecQ1 gene expression by RNAi effects and that comprise a structure in which an RNA comprising the nucleotide sequence of any one of SEQ ID NOs: 1 to 32 and an RNA comprising a sequence complementary to this RNA are hybridized.
Furthermore, DNAs that allow the expression of the siRNAs (double-stranded RNAs) of the present invention are also included in the present invention. Specifically, the present invention provides DNAs (vectors) that allow the expression of double-stranded RNAs of the present invention. These DNAs (vectors) that allow the expression of double-stranded RNAs of the present invention are typically DNAs comprising a structure where a DNA encoding one strand of the double-stranded RNA and a DNA encoding the other strand of the double-stranded RNA are operably linked to a promoter. Those skilled in the art can readily prepare an above-described DNA of the present invention with common genetic engineering techniques. More specifically, expression vectors of the present invention can be prepared by appropriately inserting DNAs encoding RNAs of the present invention into various known expression vectors.
Generally, the double-stranded RNAs having an RNAi effect are double-stranded RNAs comprising a sense RNA, which comprises a sequence homologous to a continuous RNA region in the mRNA of a target gene whose expression is to be suppressed, and an antisense RNA, which comprises a sequence complementary to the sense RNA.
In general, since double-stranded RNAs with an overhang of several nucleotides on one end have strong RNAi effects, the double-stranded RNAs of the present invention preferably comprise an overhang of several nucleotides on an end. The length of the nucleotides forming the overhang as well as the sequence are not particularly limited. This overhang may be DNA or RNA. For example, the overhang preferably has two nucleotides. A double-stranded RNA comprising an overhang of, for example, TT (a thymine doublet), UU (a uracil doublet), or some other nucleotide (most preferably, a molecule comprising a double-stranded RNA of 19 nucleotides and an overhang of two nucleotides (TT)) can be suitably used in the present invention. The double-stranded RNAs of the present invention also include molecules in which the overhanging nucleotides are DNAs.
Examples of the siRNA molecules of the present invention where the nucleotides of the overhang portion are TT include molecules having TT added to their 3Ⲡside, such as the molecule indicated below:
The above-mentioned âdouble-stranded RNAs having an RNAi effect on RecQ1 genesâ of the present invention can be suitably produced by those skilled in the art based on the nucleotide sequences disclosed in the present description. Specifically, the double-stranded RNAs of the present invention can be produced based on the nucleotide sequence of any one of SEQ ID NOs: 1 to 32. If one of the strands has been determined (for example, a nucleotide sequence described in any one of SEQ ID NOs: 1 to 32), the nucleotide sequence of the other strand (the complementary strand) can be easily determined by those skilled in the art. siRNAs of the present invention can be suitably produced by those skilled in the art using commercially available nucleic acid synthesizers. Common custom synthesis services can also be used to synthesize desired RNAs.
Since the siRNAs of the present invention (for example, a double-stranded RNA molecule in which one of the strands has the nucleotide sequence of any one of SEQ ID NOs: 1 to 32) have cancer cell-specific cell proliferation-suppressing effects, the present invention provides cancer cell-specific cell proliferation inhibitors that comprise an siRNA of the present invention as an active ingredient.
If the cancer cell proliferation-suppressing effect in the present invention arises from the induction of apoptosis, the siRNAs of the present invention will be expected to be cancer cell-specific apoptosis-inducing agents.
The term âapoptosisâ generally refers to cell death actively induced by the cell itself under physiological condition. The morphological features of apoptosis include, for example, chromosome condensation in the cell nucleus, nuclear fragmentation, loss of microvilli on the cell surface, and cytoplasmic shrinkage. Thus, as used herein, the term âapoptosis-inducing effectâ refers to, for example, the effect of inducing in cells the above-described morphological features of apoptosis, but is not limited to those described above. One skilled in the art can appropriately assess whether or not apoptosis is being induced in cells.
For example, the present invention's apoptosis inducers specific for cancer cells are expected to be anticancer agents (carcinostatic agents) having apoptosis-inducing activity as their mechanism of action.
The present invention provides anticancer agents (pharmaceutical compositions for cancer therapy) that comprise a cancer cell-specific cell proliferation inhibitor of the present invention as an active ingredient.
Pharmaceutical agents of the present invention can be provided as a mixture with a pharmaceutically acceptable carrier. Such pharmaceutically acceptable carriers can include, but are not limited to, for example, detergents, excipients, coloring agents, flavoring agents, preservatives, stabilizers, buffers, suspensions, isotonizing agents, binders, disintegrating agents, lubricants, fluidizing agents, and correctives. Other conventional carriers can be also used appropriately.
The pharmaceutical agents of the present invention can be formulated by adding the above-indicated carriers as required and according to conventional methods. Specifically, such carriers include: light anhydrous silicic acid, lactose, crystalline cellulose, mannitol, starch, carmellose calcium, carmellose sodium, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, polyvinylacetaldiethylamino acetate, polyvinylpyrrolidone, gelatin, medium-chain fatty acid triglyceride, polyoxyethylene hydrogenated castor oil 60, saccharose, carboxymethyl cellulose, cornstarch, and inorganic salts.
The dosage forms for the agents described above include, for example, oral forms, such as tablets, powders, pills, dispersing agents, granules, fine granules, soft and hard capsules, film-coated tablets, pellets, sublingual tablets, and pastes; and parenteral forms, such as injections, suppositories, endermic liniments, ointments, plasters, and liquids for external use. Those skilled in the art can select the optimal dosage form depending on the administration route, subject, and such.
Viral vectors such as retroviruses, adenoviruses, and Sendai viruses and non-viral vectors such as liposomes can be used to administer DNAs expressing the siRNAs of the present invention that suppress the RecQ1 genes into living bodies. Alternatively, non-viral vectors such as liposomes, polymer micelles, or cationic carriers, may be used to administer synthetic siRNAs of the present invention that suppress the RecQ1 genes into living bodies. The administration methods include, for example, in-vivo and ex-vivo methods.
The present invention also comprises the above-described pharmaceutical compositions having cancer cell-specific cell proliferation-suppressing effect. Ultimately, the doses of the pharmaceutical agents or pharmaceutical compositions of the present invention can be appropriately determined by a physician considering the type of dosage form, administration method, patient's age, weight, symptoms, and so on.
The types of cancers for which a cell proliferation-suppressing effect is expected in the present invention are not particularly limited, but examples include breast cancers, lung cancers, osteosarcomas, cervical cancers, fibrosarcomas, ovarian teratocarcinomas, embryonal cancers, bladder cancers, chronic myeloid leukemias, acute lymphoblastic leukemias, glioblastomas, liver cancers, glioblastomas, melanomas, kidney cancers, pancreatic cancers, stomach cancers, prostate cancers, and such.
Furthermore, the present invention relates to methods for suppressing cancer cancer cell-specifically (cancer cell-specific methods for treating cancer) and methods for suppressing cell proliferation cancer cell-specifically, which comprise the step of administering an RNA or DNA of the present invention or a pharmaceutical agent of the present invention to individuals (for example, patients) or to cellular tissues (cancer cell tissues and such). The individuals in the methods of the present invention are preferably humans, but are not particularly limited thereto, and they may be non-human animals.
In general, administration to individuals can be carried out by methods known to those skilled in the art, examples of which include intra-arterial injection, intravenous injection, and subcutaneous injection. Although the dosage varies depending on the weight and age of the subject (patient and such), the administration method, and so on, suitable dosages can be appropriately selected by those skilled in the art.
Moreover, the present invention relates to the uses of the RNAs or DNAs of the present invention, or to uses of the pharmaceutical agents of the present invention, in the production of cancer cell-specific cell proliferation inhibitors or anticancer agents.
All prior art references cited herein are incorporated by reference into this description.
The present invention will be described in detail below with reference to Examples, but is not to be construed as being limited thereto.
HeLa cells (human cervical cancer cells) were used as human cancer cells, and TIG3 cells (normal diploid fibroblast cells) were used as normal human cells. HeLa cells and TIG3 cells were cultured at 37° C. under 5% CO2 using Dulbecco's modified Eagle's medium containing 10% fetal bovine serum and 50 Οg/mL gentamicin.
Thirty-two siRNAs against RecQ1 gene were designed according to the method of Elbasher et al. (Elbasher, M. S. et al. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494-498 (2001)) and the method of Reynolds et al. (Reynolds A. et al., Rational siRNA design for RNA interference. Nat. Biotechnol. 3, 326-30 (2004)). FIG. 1 shows each of the siRNA sequences. The siRNAs were synthesized at Qiagen.
(1) Suppression of RecQ1 Gene Expression by siRNAs
Cells were plated onto 24-well plates at a density of 0.8-1.5Ă104 cells/well 24 hours before transfection, and siRNAs were transfected under the condition of 20-50% confluency. 10 pmol of siRNA was transfected per well using Oligofectamine (Invitrogen) or Lipofectamine 2000 (Invitrogen) following the manufacturer's protocol. Expression of the RecQ1 gene mRNA 24 hours after introduction of siRNA was quantified using Taqman PCR. Specifically, total RNA was extracted from cells at 24 hours after siRNA transfection using an RNeasy Mini Kit (Qiagen). ABI PRISM 7000 Sequence Detection System (Applied Biosystems) was used for quantitative PCR. RT-PCR primers for the RecQ1 gene and β-actin gene, and TaqMan probes were purchased from Applied Biosystems. RT-PCR reactions were performed using a QuantiTect Probe RT-PCR Kit (Qiagen) according to the manual. Expression of RecQ1 mRNA was quantitatively compared using 13-actin as a standard. The expression level of the RecQ1 gene mRNA in cells into which control siRNAs that do not affect RecQ1 gene expression had been transfected was defined as 100%, and the RecQ1 mRNA expressions in cells into which each siRNA had been introduced were compared.
siRNA transfection was performed under the same conditions as described above, and 96 hours later, viable cells were measured using a viable cell count reagent SF (Nakalai Tesque). The experiment was carried out at N=3, and average values were calculated. The viable cell count of cells into which control siRNA that does not affect RecQ1 gene expression was introduced was defined as 100%, and the viable cell counts for cells into which each siRNA was introduced were calculated.
Using HeLa cells, which are human cervical cancer cells, the effects on cell proliferation of suppression of RecQ1 gene expression by siRNAs were investigated. As a result of individually transfecting the 32 types of siRNAs against the RecQ1 gene into HeLa cells, a gene expression-suppressing effect of 70% or more was observed for all of the siRNAs (FIG. 2). Under such conditions, when the number of viable HeLa cells after 96 hours was compared to that of the NS-siRNA-treated group, a proliferation suppression of 30% or more was observed in all of the siRNA-treated groups (FIG. 3).
Next, the effects on the proliferation of normal cells were investigated using TIG3 cells. When the siRNAs of SEQ ID NOs: 15 and 24, which showed strong proliferation-suppressing effects in HeLa cells, were individually introduced into TIG3 cells, each of them suppressed RecQ1 gene expression by approximately 70% (FIG. 4). Under such conditions, when the number of viable TIG3 cells after 96 hours was compared to that of the NS-siRNA-treated group, no effect on the proliferation of TIG3 cells was recognized (FIG. 5).
These results proved that RecQ1-siRNA strongly inhibits the proliferation of cancer cells, but hardly affects the proliferation of normal cells.
The sequences of the siRNAs and 27 mer dsRNA used in the animal studies are shown below:
| TABLEâ1â |
| SEQUENCESâOFâSIRNASâAGAINSTâRECQ1âUSED |
| INâANIMALâSTUDIES |
| siRNAâsequence | ||
| 24 | GGGCAAUCAGGAAUCAUAUâ(SEQâIDâNO:â24) | |
| 33 | GCUUGAAACUAUUAACGUAâ(SEQâIDâNO:â40) | |
| 34 | UAAGACCACAGUUCAUAGAâ(SEQâIDâNO:â41) | |
| 35 | GUUAUCCAUCAUUCAAUGAâ(SEQâIDâNO:â42) | |
The overhang sequence of all of the siRNAs is the deoxynucleotides âTTâ.
The 27 mer dsRNA sequence against RecQ1 used in animal studies
| (SEQâIDâNO:â43) |
| 36 | GGAAAAGUUCAGACCACUUCAGCUUGA |
The RecQ1 gene expression levels in HeLa cells treated with the above RecQ1-siRNAs are the following:
| TABLE 2 | |
| Gene expression level | |
| 33 | â3% | |
| 34 | 19% | |
| 35 | 18% | |
| 36 | â6% | |
| NS | 100%â | |
The present inventors also examined whether proliferation inhibition of tumor cells by siRNAs against RecQ1 helicase will also occur in cancer-bearing animal models. The siRNAs and 27 mer dsRNA against the RecQ1 gene shown above were used.
Male BALB/cA nude mice were purchased from CLEA Japan, Inc. A549 cells (5Ă106 cells/0.1 mL) were subcutaneously transplanted into the back of nude mice (seven weeks old). siRNA administration began on the eighth day after tumor cell transplantation. With regard to RecQ1-siRNA, 22 Îźg of siRNA with phosphorylated 5Ⲡend was mixed with 5 Îźg of polyethylenimine (molecular weight of 10,000, Wako) in 50 ÎźL of physiological saline. This mixture was subcutaneously injected six times, once every three days (on days 8, 11, 14, 17, 20, and 23), into the uppermost part of the solid tumor. The tumor volume was measured using calipers. The equation for calculating tumor volume was LĂW2/2. Herein, L is the major axis and W is the minor axis of the tumor. Statistical significance of the tumor volume was analyzed using t-tests.
As a result, all RecQ1-siRNAs suppressed tumor growth, but NS-siRNA (an siRNA which does not affect the expression of human and mouse genes), which was similarly mixed with polyethylenimine, had no effect and tumor volume increased (FIG. 6). Mice administered with a mixture of RecQ1-siRNA and polyethylenimine did not show a reduction in weight compared to non-cancer-bearing mice, which indicated that this treatment does not have serious side effects.
The studies by the present inventors revealed that silencing of RecQ1 helicase expression causes suppression of tumors in cancer-bearing animal models.
Even if a certain compound is found to have the effect of suppressing cancer cell proliferation, use of that compound as a pharmaceutical is difficult when it is unclear whether it also has the effect of suppressing the proliferation of normal cells. This is because when such a compound also shows cell proliferation-suppressing effect on normal cells, it carries with it the risk of side effects. Hence, if the cell proliferation-suppressing effect is not cancer cell-specific, it would ordinarily be difficult to actually use the compound as a pharmaceutical. The pharmaceutical agents of the present invention (nucleic acids having RNAi effects) can be said to be very practical and highly effective pharmaceutical agents, since their cell proliferation-suppressing effect is cancer cell-specific.
The various embodiments described above can be combined to provide further embodiments. All of the U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications and non-patent publications referred to in this specification and/or listed in the Application Data Sheet are incorporated herein by reference, in their entirety. Aspects of the embodiments can be modified, if necessary to employ concepts of the various patents, applications and publications to provide yet further embodiments.
These and other changes can be made to the embodiments in light of the above-detailed description. In general, in the following claims, the terms used should not be construed to limit the claims to the specific embodiments disclosed in the specification and the claims, but should be construed to include all possible embodiments along with the full scope of equivalents to which such claims are entitled. Accordingly, the claims are not limited by the disclosure.
1. A double-stranded RNA that can suppress the expression of an RecQ1 gene by an RNAi effect, wherein the RNA comprises a structure in which an RNA comprising the nucleotide sequence of SEQ ID NO: 40 and an RNA comprising a sequence complementary to said RNA are hybridized.
2. The double-stranded RNA of claim 1, which comprises a structure in which one or more DNAs or RNAs overhang at an end.
3. A DNA vector that can express an RNA comprising the nucleotide sequence of SEQ ID NO: 40.
4. A cancer cell-specific cell proliferation inhibitor which comprises the RNA of claim 1 or 2, or the DNA of claim 3.
5. An anticancer agent comprising the cancer cell-specific cell proliferation inhibitor of claim 4 as an active ingredient.