Patent application title:

SYSTEMS AND METHODS FOR DIAGNOSING A PREDISPOSITION TO DEVELOP CANCER

Publication number:

US20140010802A1

Publication date:
Application number:

13/969,986

Filed date:

2013-08-19

Abstract:

Systems, methods, and computer readable media for diagnosing or characterizing a genetic predisposition to develop cancer, including cancers of the BAP1 cancer syndrome, are provided. Nucleic acids comprising a germline nucleic acid sequence encoding the BRCA1 associated protein 1 (BAP1) are sequenced or probed to determine if the nucleic acid sequence includes alterations that predispose a subject to develop cancer.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q1/6886 »  CPC main

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer

C12Q1/68 IPC

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Description

CROSS REFERENCE TO RELATED APPLICATIONS

This application is a continuation-in-part of PCT Application No. PCT/US2012/025578 filed on Feb. 17, 2012, and claims priority to U.S. Provisional Application No. 61/444,438, filed on Feb. 18, 2011, and U.S. Provisional Application No. 61/524,959, filed on Aug. 18, 2011, the contents of each application are incorporated by reference herein, in their entirety and for all purposes.

STATEMENT OF GOVERNMENT SUPPORT

The inventions described herein were made, in part, with funds obtained from the National Institutes of Health, Grant No. P01CA-114047. The U.S. government may have certain rights in these inventions

REFERENCE TO A SEQUENCE LISTING

This application includes a Sequence Listing submitted electronically as a text file named BAP1 Sequence Listing_ST25.txt, created on Aug. 16, 2013, with a size of 17,000 bytes. The Sequence Listing is incorporated by reference herein.

FIELD OF THE INVENTION

The invention relates generally to the field of cancer diagnostics. More particularly, the invention relates to methods for diagnosing a predisposition to develop a cancer, particularly the BAP1 cancer syndrome, including one or more of malignant mesothelioma, uveal melanoma, and cutaneous melanoma. The invention also relates to arrays, systems, polynucleotides, and polypeptides, which may be used for practicing diagnostic methods.

BACKGROUND OF THE INVENTION

Various publications, including patents, published applications, accession numbers, technical articles and scholarly articles are cited throughout the specification. Each of these cited publications is incorporated by reference, in its entirety and for all purposes, in this document.

About 27 million US workers were exposed to asbestos between 1940 and 1979, and many more thereafter, and more than 30 million US homes contain asbestos. Presently, malignant mesothelioma causes about 3,000 deaths/year in the U.S. and about 5,000 in Western Europe. Despite asbestos abatement efforts, malignant mesothelioma rates have remained stable in the U.S. since 1994 and are expected to increase by 5-10% per year in most European countries for the next 25 years. With increased urban development, exposure may also occur from disturbing asbestos- and erionite-containing soil. Moreover, a dramatic increase in malignant mesothelioma incidence is predicted in developing countries, where use of asbestos is increasing.

In the United States, the annual incidence of malignant mesothelioma varies from 1-2/106 in states with minimal asbestos exposure to 10-15/106 in states where large quantities of asbestos have been used. The observation that only about 5% of workers exposed to high doses of asbestos developed malignant mesothelioma and the clustering of malignant mesothelioma in certain families suggests that genetics influences mineral fiber carcinogenesis.

With exposure to mineral fibers such as asbestos linked to malignant mesothelioma, and with exposure to mineral fibers continuing, it is important to identify risk factors that may predispose a subject to develop malignant mesothelioma, particularly when the subject is exposed to mineral fibers in the environment. A knowledge of such risk factors may provide for interventions that may delay or prevent the onset of malignant mesothelioma.

SUMMARY OF THE INVENTION

The invention features methods for identifying alterations in the germline BRCA1 associated protein 1 gene (BAP1) that predisposes a subject having the alteration to develop cancer, and in particular, the BAP1 cancer syndrome and its associated cancers. The alterations preferably exclude the insertion of an adenine between positions 1318 and 1319 of the BAP1 cDNA sequence of Genbank Accession No. NM004656 (nucleotides 52,437,842 and 52,437,843 of human chromosome 3). One aspect of the methods comprises comparing the sequence of a nucleic acid encoding BAP1 determined from a tissue sample obtained from a subject with one or more reference nucleic acid sequences comprising one or more alterations in the BAP1 germline sequence associated with predisposing a subject to develop cancer, and determining whether the determined sequence has the alteration based on the comparison. The comparing step may be carried out using a processor programmed to compare nucleic acid sequences. The cancer is preferably the BAP1 cancer syndrome, and those cancers that comprise this syndrome include malignant mesothelioma, uveal melanoma, and cutaneous melanoma, among others.

One aspect of the methods comprises contacting a nucleic acid encoding BAP1 obtained from a subject with one or more polynucleotide probes having a nucleic acid sequence complementary to a BAP1 germline nucleic acid sequence having one or more alterations associated with predisposing a subject to develop cancer, and determining whether the one or more probes hybridized with the nucleic acid, for example, under stringent conditions. The hybridization may occur on a support such as an array, or in situ.

Methods for determining a predisposition to develop cancer, particularly the BAP1 cancer syndrome and any of its associated cancers are provided. In some aspects, the methods comprise determining the sequence of a nucleic acid encoding BRCA1 associated protein 1 (BAP1) obtained from a subject, comparing the determined sequence with one or more reference sequences comprising one or more nucleic acid sequences comprising one or more alterations in the BAP1 germline sequence associated with predisposing a subject to develop cancer. The alterations preferably exclude the insertion of an adenine between positions 1318 and 1319 of the BAP1 cDNA sequence of Genbank Accession No. NM004656 (nucleotides 52,437,842 and 52,437,843 of human chromosome 3). The comparison is preferably carried out using a processor programmed to compare determined sequences and reference sequences. The methods include diagnosing whether the subject has a predisposition to develop cancer based on the comparison. The cancer is preferably the BAP1 cancer syndrome, and those cancers that comprise this syndrome include malignant mesothelioma, uveal melanoma, and cutaneous melanoma, among others.

In some aspects, the methods comprise contacting a nucleic acid encoding BAP1 obtained from a subject with one or more polynucleotide probes having a nucleic acid sequence complementary to a BAP1 germline nucleic acid sequence having one or more alterations associated with predisposing a subject to develop cancer, provided that the alterations exclude the insertion of an adenine between positions 1318 and 1319 of the BAP1 cDNA sequence of Genbank Accession No. NM004656 (nucleotides 52,437,842 and 52,437,843 of human chromosome 3), determining whether the one or more probes hybridized with the nucleic acid, for example, under stringent conditions, optionally, identifying which of the one or more probes hybridized with the nucleic acid, and diagnosing whether the subject has a predisposition to develop cancer based on the determination of whether the probes hybridized with the nucleic acid. The probes may comprise a detectable label. Optionally, the methods may comprise treating the subject with a regimen capable of inhibiting the onset of the cancer. The cancer is preferably the BAP1 cancer syndrome, and those cancers that comprise this syndrome include malignant mesothelioma, uveal melanoma, and cutaneous melanoma, among others.

Isolated polynucleotides comprising a nucleic acid sequence, and the complement thereof, encoding the BAP1 protein and having at least one alteration that predisposes a subject to develop cancer, provided that the alteration is not an insertion of an adenine between positions 1318 and 1319 of the BAP1 cDNA sequence of Genbank Accession No. NM004656, are provided (nucleotides 52,437,842 and 52,437,843 of human chromosome 3). The polynucleotides may be a probe. The polynucleotides may comprise a detectable label. The polynucleotides may be affixed to a support. An array comprising a plurality of polynucleotides are also provided. Polypeptides encoded by the polynucleotides are also provided.

Systems for diagnosing a predisposition to develop cancer comprise a data structure comprising one or more reference nucleic acid sequences having one or more alterations in the germline BAP1 nucleic acid sequence associated with predisposing a subject to develop cancer, provided that the alteration is not an insertion of an adenine between positions 1318 and 1319 of the BAP1 cDNA sequence of Genbank Accession No. NM004656 (nucleotides 52,437,842 and 52,437,843 of human chromosome 3), and a processor operably connected to the data structure. The processor may be a programmable processor, and may be capable of comparing nucleic acid sequences. The processor may comprise a network connection. Computer readable media comprise executable code for causing a programmable processor to compare nucleic acid sequences of BAP1-encoding nucleic acids obtained from a subject with reference nucleic acid sequences. The cancer is preferably the BAP1 cancer syndrome, and those cancers that comprise this syndrome include malignant mesothelioma, uveal melanoma, and cutaneous melanoma, among others.

In some aspects, a system for determining a predisposition to develop BAP1 cancer syndrome comprises a data structure comprising one or more BRCA1 associated protein 1 (BAP1) germline nucleic acid sequences having one or more alterations in the germline nucleic acid sequence indicative of a predisposition to develop BAP1 cancer syndrome, provided that the one or more alterations exclude the insertion of an adenosine between nucleotides 52,437,842 and 52,437,843 of human chromosome 3, one or more BAP1 germline nucleic acid sequences that do not have the one or more alterations, and a processor programmed to compare sequences of nucleic acids encoding BAP1 obtained from a human being with the BAP1 germline nucleic acid sequences in the data structure.

Methods for inhibiting the onset of cancer in a subject having one or more alterations in the BAP1 germline sequence that predispose a subject to develop cancer, provided that the alteration is not an insertion of an adenine between positions 1318 and 1319 of the BAP1 cDNA sequence of Genbank Accession No. NM004656 (nucleotides 52,437,842 and 52,437,843 of human chromosome 3), comprise one or more of restoring the wild type germline nucleic acid sequence of the BAP1 gene in the subject, administering to the subject an effective amount of wild type BAP1 protein, and/or reducing or eliminating exposure of the subject to carcinogenic mineral fibers such as asbestos and erionite, and/or reducing exposure of the subject to ultraviolet radiation. The cancer is preferably the BAP1 cancer syndrome, and those cancers that comprise this syndrome include malignant mesothelioma, uveal melanoma, and cutaneous melanoma, among others.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1A and FIG. 1B show pedigrees of two families (W and L) with high incidence of malignant mesothelioma (MM). Pedigrees showing family members with a germline mutation in BAP1, as confirmed by both sequencing and linkage analyses (III-04, III-06, III-08, III-09, IV-17, IV-21, II-12, II-05, III-31, III-18, III-22) or by linkage analysis alone (i.e., no DNA was available for sequencing) (II-02, III-10, II-14, II-03, II-07, III-15); individuals without the mutation (I-01, II-01, III-03, II-02, III-20) and individuals for whom DNA was unavailable (I-02, I-01, II-18, II-19) are also shown. Presence or absence of germline BAP1 mutation is also indicated with + or − symbols, respectively. FIG. 1A shows a pedigree of family W, having 8 affected family members with cancer, including 5 with MM, indicating the presence or absence of germline mutation at BAP1 consensus splice acceptor site. FIG. 1B shows a partial pedigree of family L, having 14 members with cancer, including 7 with MM; showing the presence or absence of germline nonsense mutation. Uveal melanomas were observed in two patients, one of whom (L-III-18) also had MM, while the second had liver cancer. In family W, the presence of a breast cancer before age 45 and an ovarian cancer suggests that the BAP1 mutation is associated with a hereditary form of breast/ovarian cancer, as might be expected given BAP1's relationship with the breast/ovarian cancer susceptibility gene product, BRCA1. In family L, the skin cancers shown were squamous cell carcinomas. Available mesothelioma tumor specimens had germline splice site mutation and either somatic 25-bp deletion (W-III-04T), genomic alteration (W-III-06T), or loss of wild-type BAP1 allele (W-III-08T). A homozygous deletion of BAP1 was seen in mesothelioma specimen L-III-18T.

FIGS. 2A-2E show array-CGH (comparative genomic hybridization) analysis of two families with familial MM, and a splicing assay performed on DNA continuing the mutation seen in family W. FIG. 2A shows the results of array-CGH analysis of MM from family W and another from family L with rearrangements affecting BAP1. Tumor L-III-18T had focal deletion encompassing BAP1 within larger 3p deletion, while tumor W-III-06T showed an amplification junction within BAP1. FIG. 2B shows an electropherogram depicting the heterozygous germline BAP1 splice site mutation in family W. The same mutation was present in germline of all other affected cases but absent in unaffected family members. FIG. 2C shows an electropherogram of the 25-bp deletion within exon 4 of BAP1 in tumor W-III-04T. Most individual clones of PCR products of BAP1 genomic DNA contained either the somatic 25-bp deletion or the splice site mutation sequence, but not both. The deletion results in a frameshift and premature termination of BAP1. FIG. 2D shows a mini-gene expression construct used for the splicing assay (upper left). RT-PCR analysis revealed two BAP1 bands in 293T cells transfected with wild-type construct, but only the smaller band in cells transfected with mutant construct (upper right). Sequencing revealed that the larger band contained correctly spliced exons 6-8, while smaller band contained only exon 6 and exon 8 (bottom). FIG. 2E shows an electropherogram depicting BAP1 nonsense mutation (g. chr3:52,436,624 C>T) observed in germline DNA of affected members of family L. The resulting CAG>TAG stop codon causes a premature truncation at the carboxy-terminus leading to loss of the nuclear localization signal.

FIG. 3A and FIG. 3B show immunohistochemistry on mesotheliomas from L and W families revealing lack of BAP1 nuclear expression and only weak, focal cytoplasmic BAP1 staining. FIG. 3A shows SP-024, sporadic mesothelioma with wild-type BAP1; note the normal nuclear expression of BAP1. FIG. 3B shows W-III-04, FIG. 3C shows L-III-18, and FIG. 3D shows W-III-06, representing mesotheliomas from patients with germline BAP1 mutations: note lack of nuclear expression and weak cytoplasmic staining. All magnifications 400×. Bar=100 μm.

FIG. 4A and FIG. 4B show BAP1 truncating mutations and aberrant protein expression in sporadic mesothelioma tumor biopsies. FIG. 4A shows a schematic diagram of predicted truncations of BAP1 in four sporadic mesotheliomas harboring BAP1 mutations. Bracket at left indicates mutations in two different BAP1 alleles in tumor sample SP-015. NLS, nuclear localization signal at carboxy-terminus of BAP1. Frameshift sequences are shown as thinner gray bars. FIG. 4B shows an immunoblot analysis on whole tumor cell lysates of the same four sporadic mesotheliomas with somatic BAP1 mutations (lanes 2-5) and sporadic tumor lacking a BAP1 mutation (lane 1). Sporadic mesotheliomas with somatic BAP1 mutations show decreased expression of BAP1 compared to that seen in tumor without BAP1 mutation. Note that in mesotheliomas, whole tumor cell lysates inevitably contain some normal stromal cells that may be responsible for the faint BAP1 signal detected. Also note the presence of additional, faster-migrating BAP1 band in sample shown in lane 4 (SP-013), suggesting the presence of a truncated form of BAP1. The BAP1 protein products predicted in tumors SP-001 and SP-015 were not observed, suggesting nonsense-mediated mRNA decay. The mutation in tumor SP-018 results in a predicted protein product only 15 amino acids smaller, which presumably precludes detection of a small change in molecular weight compared to wild-type BAP1. GAPDH was used as a loading control.

FIG. 5 shows an electropherogram showing a possible germline BAP1 mutation observed in another family (not family W or L). The deletion/insertion mutation occurred at the end of exon 3, leading to a nonsense mutation (g.chr3:52,443,570-52,443,575 delTCAGGGinsA). The mutation causes a premature truncation of the BAP1 protein at the amino terminus.

FIG. 6A shows an immunoblot demonstrating frequent loss of detectable BAP1 expression in MM cell lines (top) and sporadic primary tumors (bottom). GAPDH was used as a loading control. FIG. 6B shows that re-expression of BAP1 in BAP1 deficient MM cells results in decreased colony-forming ability in clonogenic assays. This experiment demonstrates that the presence of wild type BAP1 suppresses tumor cell growth associated with the mutant form of BAP1.

FIG. 7 shows distribution of BAP1 germline mutations in families with BAP1 cancer syndrome reported to date. The figure depicts BAP1 protein and various domains, with symbols indicating locations of mutated amino acids. Symbols shown at each mutation site indicate existence of malignant mesotheliomas, uveal melanomas, and/or cutaneous melanomas/benign melanocytic lesions observed in the affected family or sporadic cases. Five of the families depicted showed all three of the major tumor types attributed to the BAP1 cancer syndrome; four families had both uveal melanoma and cutaneous melanoma and/or melanocytic lesions; three had malignant mesothelioma and uveal melanoma; and one had malignant mesothelioma and cutaneous melanoma and/or melanocytic lesions. Abbreviations: ASXL1/2, additional sex combs like proteins 1 and 2 interaction domain; BARD1, BRCA1-associated RING finger domain protein 1 interaction motif; BRCA1, BRCA1 interaction domain; HBM, HCF1-binding motif; NLS, nuclear localization signal; UCH, ubiquitin C-terminal hydrolase; ULD, UCH37-like domain.

FIG. 8A shows a family pedigree, with proband having a documented germline BAP1 nonsense mutation indicated by an arrow. FIG. 8B shows an electropherogram of BAP1 mutation of the proband. The nonsense mutation is predicted to lead to either nonsense-mediated decay of the BAP1 mRNA or a BAP1 protein truncation.

FIG. 9A-9B shows lentiviral shRNA mediated knockdown of BAP1 in MM cells. FIG. 9A shows Immunoblot demonstrating knockdown of BAP1 by lentiviral-shRNA in MSTO-211H cells. FIG. 9B shows a Western blot showing increased phospho-S6 protein levels (an indication of activation of upstream mTOR activation) after knockdown of BAP1 in MM cell lines MSTO-211H and Meso17. FIG. 9C shows a cell viability assay of MSTO-211H cells treated with increasing amounts of inhibitor ‘A’. Decreased cell viability upon knockdown with BAP1 shRNA was observed.

DETAILED DESCRIPTION OF THE INVENTION

Various terms relating to aspects of the present invention are used throughout the specification and claims. Such terms are to be given their ordinary meaning in the art, unless otherwise indicated. Other specifically defined terms are to be construed in a manner consistent with the definition provided in this document.

As used throughout, the singular forms “a,” “an,” and “the” include plural referents unless expressly stated otherwise.

The terms subject and patient are used interchangeably herein. A subject may be any animal, including mammals such as companion animals, laboratory animals, and non-human primates. Human beings are preferred.

A molecule such as a polynucleotide has been “isolated” if it has been removed from its natural environment and/or altered by the hand of a human being.

The terms alteration and mutation, particularly as concerns the BAP1 germline nucleic acid sequence, are used interchangeably herein.

Germline alterations include those found in the genetic material of germ cells, and may be heritable. Germline alterations do not include alterations that arise in somatic cells, the latter of which are not heritable. Germline alterations, particularly those concerning the BAP1 gene, are distinct from, and do not include somatic alterations in the BAP1 gene, except to the extent a somatic alteration in the BAP1 gene is identical to a germline alteration in the BAP1 gene.

Wild type includes that which is naturally-occurring, normal, or non-mutated.

A normal germline BAP1 gene or nucleic acid sequence preferably does not include any alterations that predispose a subject to develop cancer, including any cancer described or exemplified herein, including a BAP1 cancer syndrome, and including those cancers that are characteristic of or are otherwise mediated or enhanced by an abnormal or truncated BAP1 protein expressed as a result of alterations in the BAP1 germline gene sequence.

It has been observed in accordance with the invention that certain mutations, which include deletions, substitutions, rearrangements, and combinations thereof, in the germline nucleic acid sequence of the BRCA1 associated protein 1 (BAP1) gene predispose subjects having such mutations to develop cancer. Such germline alterations result in the expression of a truncated BAP1 protein product with reduced or non-functional biologic activity relative to normal, full length BAP1 protein, or result in nonsense-mediated decay of the mRNA transcribed from the altered germline DNA. The BAP1 protein includes various domains, including a ubiquitin C-terminal hydrolase domain, a BRCA1-associated RING finger domain protein 1 interaction motif, a BRCA1 interaction domain, an additional sex combs-like proteins 1 and 2 interaction domain, a nuclear localization signal, an HCF1-binding motif, and a UCH37-like domain (FIG. 7). The BAP1 protein resulting from a germline mutation in the BAP1 gene portion encoding any of these domains may thus be truncated at the specific domain in which the corresponding BAP1 germline mutation occurred. Germline mutations in the BAP1 gene may also result in degradation of the BAP1 mRNA transcribed from the mutated BAP1 gene.

It is believed that subjects having such germline mutations are predisposed to develop malignant mesothelioma, and it is believed that such subjects are predisposed to develop other cancers such as breast cancer, ovarian cancer, pancreatic cancer, kidney cancer, or skin cancer, including uveal melanoma and including cutaneous melanoma. It is believed that subjects having mutations in the germline sequence of BAP1 may be considered as having a cancer predisposition syndrome such that they are at risk of developing any one of a number of these or other cancers. The syndrome has become known in the art as the BAP1 cancer syndrome. For example, it is believed that some subjects may have a predisposition to develop a mesothelioma-melanoma syndrome. It is believed that malignant mesothelioma may dominate in cases where such subjects are exposed to carcinogenic mineral fibers in the environment. Accordingly, the invention features methods for identifying germline nucleic acid sequence alterations in BAP1 that predispose a subject to develop cancer, as well as methods for diagnosing predispositions to develop cancer. Any of the methods may be carried out in vivo, in vitro, or in situ.

In some aspects, methods for identifying an alteration in the germline BRCA1 associated protein 1 (BAP1) gene that predisposes a subject having the alteration to develop cancer relate to sequence comparisons. In some aspects, the methods generally comprise the steps of comparing the sequence of a nucleic acid encoding BAP1 obtained from a tissue sample obtained from a subject with one or more reference nucleic acid sequences comprising one or more alterations in the BAP1 germline sequence that predispose a subject to develop cancer, and determining whether the BAP1 sequence obtained from the subject has the alteration based on the comparison. The comparing step may be carried out using a processor programmed to compare nucleic acid sequences, for example, to compare the nucleic acid sequences obtained from the subject and the reference nucleic acid sequences. The methods may optionally include the step of determining the sequence of the nucleic acid encoding BAP1 obtained from the subject.

From the subject, the tissue sample may be from any tissue in which genomic DNA or a genomic DNA sequence may be obtained. Non-limiting examples include blood and buccal tissue. The methods may include the step of obtaining the tissue sample, and may include the step of obtaining the nucleic acid. The nucleic acid may be any nucleic acid that has, or from which may be obtained, the germline nucleic acid sequence encoding the BAP1 protein, or the complement thereof, or any portion thereof. For example, the nucleic acid may be chromosomal or genomic DNA, may be mRNA, or may be a cDNA obtained from the mRNA. The sequence of the nucleic acid may be determined using any sequencing method suitable in the art.

In some aspects, the methods for identifying an alteration in the germline BRCA1 associated protein 1 (BAP1) gene that predisposes a subject having the alteration to develop cancer include hybridization assays. For example, the methods generally comprise determining one or more alterations associated with predisposing a subject to develop cancer in the germline sequence of a nucleic acid encoding BAP1 in a tissue sample obtained from a subject. In one detailed aspect, the methods comprise the steps of contacting the nucleic acid obtained from the subject with one or more polynucleotide probes that have a nucleic acid sequence complementary to a BAP1 germline nucleic acid sequence having one or more alterations that predispose a subject to develop cancer, and determining whether the one or more probes hybridized with the nucleic acid encoding BAP1.

The probes may comprise a detectable label. The nucleic acid obtained from a subject may be labeled with a detectable label. Detectable labels may be any suitable chemical label, metal label, enzyme label, fluorescent label, radiolabel, or combination thereof. The methods may comprise detecting the detectable label on probes hybridized with the nucleic acid encoding BAP1. The probes may be affixed to a support, such as an array. For example, a labeled nucleic acid obtained from a subject may be contacted with an array of probes affixed to a support. The probes may include any probes described or exemplified herein.

In another detailed aspect, the hybridization may be carried out in situ, for example, in a cell obtained from the subject. For example, determining the one or more alterations may comprise contacting the cell, or contacting a nucleic acid in the cell, with one or more polynucleotide probes comprising a nucleic acid sequence complementary to a BAP1 germline nucleic acid sequence having one or more alterations that predispose a subject to develop cancer and comprising a detectable label, and detecting the detectable label on probes hybridized with the nucleic acid encoding BAP1. Detectable labels may be any suitable chemical label, metal label, enzyme label, fluorescent label, radiolabel, or combination thereof.

In any of the hybridization assays, the probes may be DNA or RNA, are preferably single stranded, and may have any length suitable for avoiding cross-hybridization of the probe with a second target having a similar sequence with the desired target. Suitable lengths are recognized in the art as from about 20 to about 60 nucleotides optimal for many hybridization assays (for example, see the Resequencing Array Design Guide available from Affymetrix: http://www.affymetrix.com/support/technical/byproduct.affx?product=cseq), though any suitable length may be used, including shorter than 20 or longer than 60 nucleotides. It is preferred that the probes hybridize under stringent conditions to the BAP1 germline nucleic acid sequence of interest. It is preferred that the probes have 100% complementary identity with the target sequence.

The methods described herein, including the hybridization assays, whether carried out in vitro, on an array, or in situ, may be used to determine any alteration in the BAP1 germline nucleic acid sequence that has a known or suspected association with predisposing a subject to develop cancer, including any of those described or exemplified herein. In any of the methods described herein, the alterations may be, for example, a mutation in the germline nucleic acid sequence. Preferably, the alterations result in a gene encoding a truncated BAP1 protein and/or nonsense-mediated decay of the BAP1 mRNA transcribed from the altered germline gene. The mutation may comprise one or more nucleotide substitutions, an addition of one or more nucleotides in one or more locations, a deletion of one or more nucleotides in one or more locations, an inversion or other DNA rearrangement, or any combination thereof. A substitution may, but need not, change the amino acid sequence of the BAP1 protein. Any number of substitutions, additions, or deletions of nucleotides are possible. The alteration may occur in an intron, an exon, or both, including an alteration at or proximal to an exon-intron splice site.

The one or more alterations may be located in human chromosome 3, for example, at segment 3p21.1, and may be at a BAP1 locus in this segment. The alterations in the germline sequence preferably do not include an insertion of an A between positions 1318-1319 of the BAP1 cDNA as described by Harbour et al. (2010) Science 330:1410-3 (see, e.g., Genbank Accession No. NM004656) (the inserted A becomes nucleotide 1319, moving the wild type nucleotide at position 1319 to position 1320 and generating a stop codon). In this Harbour publication (Science, 330:1410-3), the germline alteration is an insertion of an A between nucleotides 52,437,842 and 52,437,843 of human chromosome 3 (the inserted A becomes nucleotide 52,437,843, moving the wild type nucleotide at position 52,437,843 to position 52,437,844 and generating a stop codon), thus, the alterations in the BAP1 germline sequence preferably do not include an insertion of an A between nucleotides 52,437,842 and 52,437,843 of human chromosome 3.

One non-limiting example of a particular alteration that may predispose a subject to develop cancer includes a C to T substitution in exon 16. The substitution may occur at position 52,436,624 of human chromosome 3. The substitution may occur in a polynucleotide comprising SEQ ID NO:9. The polynucleotide having the substitution may comprise SEQ ID NO:10, or a portion thereof. The substitution may occur in the polynucleotide at the position corresponding to position 16 of SEQ ID NOs:9 or 10. Thus, for example, in a polynucleotide comprising SEQ ID NO: 9 or 10, the substitution may occur in the polynucleotide in the SEQ ID NO: 9 or 10 portion and at the position corresponding to position 16 thereof.

One non-limiting example of a particular exon-intron splice site alteration that predisposes a subject to develop cancer includes an A to G substitution 2 nucleotides upstream of the 3′ end of Intron 6. The A to G substitution may occur at position 52,441,334 of human chromosome 3. The A to G substitution may occur in a polynucleotide comprising SEQ ID NO:1. The polynucleotide having the A to G substitution may comprise SEQ ID NO:2, or a portion thereof. The substitution may occur in the polynucleotide at the position corresponding to position 16 of SEQ ID NOs: 1 or 2, and may result in a polynucleotide comprising SEQ ID NO: 2, or portion thereof, with the G to A substitution at the position corresponding to position 16 of SEQ ID NO: 1. Thus, for example, in a polynucleotide comprising SEQ ID NO: 1 or 2 the substitution may occur in the polynucleotide in the SEQ ID NO: 1 or 2 portion and at the position corresponding to position 16 thereof. The A to G substitution may result in an aberrant splice site product lacking exon 7, which may comprise SEQ ID NO:8, or a portion thereof.

Another substitution includes a T to G substitution in Exon 9. The T to G substitution may occur at position 52,440,329 of human chromosome 3. The T to G substitution may occur in the polynucleotide at the position corresponding to position 17 of SEQ ID NO: 48, and may result in a polynucleotide comprising the sequence of SEQ ID NO: 46, or portion thereof, with the T to G substitution at the position corresponding to position 17 of SEQ ID NO: 46.

A non-limiting example of a particular exon-intron splice site alteration that predisposes a subject to develop cancer includes and a deletion of 5 nucleotides plus a substitution of 1 nucleotide at the 3′ end of Exon 3. The alterations may occur in a polynucleotide comprising SEQ ID NO:11. The deleted 5 nucleotides may occur among positions 52,443,570 to 52,443,575 (e.g., 52,443,570 to 52,443,574) of human chromosome 3, may comprise SEQ ID NO:13, and may comprise the nucleotides corresponding to positions 17-21 of SEQ ID NO:11. The substitution may comprise an A to G substitution at the position corresponding to position 22 of SEQ ID NO:11, and may occur at position 52,443,575 of human chromosome 3. The resultant nucleic acid sequence may comprise SEQ ID NO:12, or a portion thereof.

Nucleotide deletions may occur any where in the germline BAP1 gene. In some aspects, the alteration comprises a deletion of a C in Exon 13. The deletion of the C may occur at position 52,437,444 of human chromosome 3. The gene comprising the deletion of the C may comprise SEQ ID NO:16. In some aspects, the alteration comprises a deletion of four nucleotides from Exon 14. The four nucleotides may comprise the sequence TCAC, and may occur at positions 52,437,159 to 52,437,162 of human chromosome 3. The deleted 4 nucleotides may comprise the nucleotides corresponding to positions 23-26 of SEQ ID NO:17. The gene comprising the deletion of TCAC may comprise SEQ ID NO:18. In another example, the deletion may be the deletion of a T in Exon 4. The deletion of a T in Exon 4 may occur at position 52,442,605 in human chromosome 3.

One non-limiting example of a particular alteration that predisposes a subject to develop cancer, or that occurs as a somatic genetic change when a tumor forms, includes a deletion of 25 nucleotides in Exon 4. The deleted nucleotides may occur at positions 52,442,507 through 52,442,531 of human chromosome 3, may comprise SEQ ID NO:4, and may comprise the nucleotides corresponding to positions 17-41 of SEQ ID NO:3. The resultant nucleic acid sequence may comprise SEQ ID NO:5, or a portion thereof.

The reference nucleic acid sequences used in nucleic acid sequence comparison aspects may comprise one or more of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO: 46, or portion thereof having the variation from the wild type sequence. The reference nucleic acid sequences may also include wild type nucleic acid sequences or other nucleic acid sequences that do not include the cancer predisposition-associated alterations to serve as controls in the comparison, or for determinations that the subject does not have a germline nucleic acid sequence alteration that predisposes to develop cancer. Non-limiting examples of wild type nucleic acid sequences include SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, and SEQ ID NO: 48. Reference nucleic acid sequences having any portion of the sequence of these sequence identifiers may be used.

The polynucleotide probes used in nucleic acid hybridization aspects may comprise one or more of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:46 or portion thereof having the variation from the wild type sequence. The nucleic acid sequence of the probes may be complementary to SEQ ID NOs:2, 4, 5, 8, 10, 12, 13, or 46. Polynucleotide probes having a wild type BAP1 nucleic acid sequence, or otherwise not having any of the cancer predisposition-associated alterations may be used to serve as controls in hybridization assays, or for determinations that the subject does not have a germline nucleic acid sequence alteration that predisposes to develop cancer. Non-limiting examples of wild type nucleic acid sequences include SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, and SEQ ID NO: 48. The nucleic acid sequence of the probes may be complementary to SEQ ID NOs:1, 3, 6, 7, 9, 11, or 48. Probes having any portion of the sequence of these sequence identifiers, or complement thereof, may be used.

The methods for identifying an alteration in a germline BAP 1 nucleic acid sequence may be used in accordance with any alteration in the germline that predisposes a subject to develop any cancer. Preferably, the alteration predisposes a subject to develop the BAP1 cancer syndrome and any one or combination of its attendant cancers. BAP1 cancer syndrome may include any one or combination of malignant mesothelioma, uveal melanoma, and cutaneous melanoma. The BAP1 cancer syndrome may also include any one or combination of breast cancer, ovarian cancer, pancreatic cancer, kidney cancer, and skin cancer, in addition to any one or combination of malignant mesothelioma, uveal melanoma, and cutaneous melanoma. The alteration may predispose a subject to develop malignant mesothelioma upon exposure of the subject to a sufficient amount of mineral fibers, for example carcinogenic mineral fibers such as asbestos, erionite, refractory ceramic fibers, nanotubes, and other carcinogenic mineral fibers in the environment. The alteration may predispose a subject to develop uveal melanoma and/or cutaneous melanoma upon exposure of the subject to a sufficient amount of ultraviolet radiation, including from sunlight exposure.

The invention also features methods for diagnosing a predisposition to develop cancer, particularly the BAP1 cancer syndrome and any one or combination of its attendant cancers. In general, the diagnostic methods relate to the screening methods described above. In one aspect, the methods for diagnosing comprise the steps of determining the sequence of a nucleic acid encoding BAP1 obtained from a tissue sample obtained from a subject, comparing the determined sequence with one or more reference sequences comprising one or more alterations in the wild type BAP1 germline sequence that predispose a subject to develop cancer, and diagnosing the subject as having or not having a predisposition to develop cancer based on the comparison. Optionally, the one or more reference sequences may include one or more wild type BAP1 germline nucleic acid sequences. The comparing step may be carried out using a processor programmed to compare nucleic acid sequences, for example, the nucleic acid sequences determined from the subject and the reference nucleic acid sequences.

In one aspect, the methods for diagnosing comprise the steps of contacting a nucleic acid encoding BAP1 obtained from a tissue sample obtained from a subject with one or more polynucleotide probes comprising a nucleic acid sequence complementary to a BAP1 germline nucleic acid sequence having one or more alterations associated with predisposing a subject to develop cancer, determining whether the one or more probes hybridized with the nucleic acid, and diagnosing the subject as having or not having a predisposition to develop cancer based on the determination of whether the one or more probes hybridized with the nucleic acid. The methods may further comprise the steps of contacting a nucleic acid encoding BAP1 obtained from a tissue sample obtained from a subject with one or more reference polynucleotide probes having a nucleic acid sequence complementary to a wild type BAP1 germline nucleic acid sequence and determining whether the one or more reference polynucleotide probes hybridized with the nucleic acid. In cases where more than one probe (including reference probes) is contacted with the nucleic acid, the methods may further comprise the step of identifying which of the probes hybridized with the nucleic acid. The probes preferably hybridize to the BAP1 germline nucleic acid sequence under stringent conditions.

The hybridization may be carried out in vitro, and may be carried out using a support such as an array. For example, a nucleic acid obtained from a subject may be labeled and contacted with an array of probes affixed to a support. The probes may comprise DNA or RNA, and may comprise a detectable label. The hybridization may be carried out in situ, for example, in a cell obtained from the subject. For example, determining the one or more alterations may comprise contacting the cell, or contacting a nucleic acid in the cell with one or more polynucleotide probes comprising a nucleic acid sequence complementary to a BAP1 germline nucleic acid sequence having one or more alterations that predispose a subject to develop cancer and comprising a detectable label, and detecting the detectable label on probes hybridized with the nucleic acid. Detectable labels may be any suitable chemical label, metal label, enzyme label, fluorescent label, radiolabel, or combination thereof.

The methods for diagnosing, whether based on sequence comparison or probe hybridization, may further comprise the steps of treating the subject with a regimen capable of inhibiting the onset of the cancer. If, for example, it is determined that a subject harbors germline BAP1 alterations that predispose to the BAP1 cancer syndrome, including certain cancers such as malignant mesothelioma, uveal melanoma, cutaneous melanoma, and other melanocytic cancers, this subject could be engaged in early detection/resection, chemoprevention, and chemotherapeutic strategies and regimens. These steps may be included, for example, if it is determined that the subject has a predisposition to develop cancer, especially a predisposition to develop the BAP1 cancer syndrome and any one or combination of its attendant cancers.

The methods, whether based on sequence comparison or probe hybridization, may be used to diagnose a predisposition to any cancer, including the BAP1 cancer syndrome and any one or combination of its attendant cancers. BAP1 cancer syndrome may include any one or combination of malignant mesothelioma, uveal melanoma, and cutaneous melanoma. The BAP1 cancer syndrome may also include any one or combination of breast cancer, ovarian cancer, pancreatic cancer, kidney cancer, and skin cancer, in addition to any one or combination of malignant mesothelioma, uveal melanoma, and cutaneous melanoma. The methods may be used to diagnose a predisposition to develop malignant mesothelioma upon exposure to a sufficient amount of mineral fibers in the environment, for example, asbestos or erionite. The methods may be used to diagnose a predisposition to develop uveal melanoma and/or cutaneous melanoma upon exposure of the subject to a sufficient amount of ultraviolet radiation, including from sunlight exposure. Thus, the treatment regimen may be tailored to inhibit the onset of one or more of such cancers.

In some aspects, the treatment regimen comprises restoring the wild type germline nucleic acid sequence of BAP1 in the genomic DNA of the subject. In some aspects, the treatment regimen comprises administering to the subject an effective amount of wild type BAP1 protein. Alternatively, the treatment regimen may comprise modulating the expression or the biologic activity of a protein in a BAP1 cell signaling pathway whose expression or biologic activity is modulated by BAP1. In some aspects, the treatment regimen comprises administering to the subject an effective amount of a compound or pharmaceutical composition capable of delaying or inhibiting the onset of the cancer. In some aspects, the treatment regimen comprises administering to the subject an effective amount of a histone deacetylase inhibitor and/or a mTOR inhibitor. In some aspects, the treatment regimen comprises one or more of diet management, vitamin supplementation, nutritional supplementation, exercise, psychological counseling, social counseling, education, and regimen compliance management. In some aspects, the treatment regimen comprises preventing, reducing, or eliminating exposure of the subject to mineral fibers such as asbestos, erionite, refractory ceramic fibers, or nanotubes. In some aspects, the treatment regimen comprises preventing, reducing, or eliminating exposure of the subject to ultraviolet radiation, including ultraviolet radiation from sunlight. The treatment regimen may comprise targeting any imbalance in ubiquitination processes in susceptible tissues. The treatment regimen may comprise inhibiting RING1-dependent ubiquitination that normally counteracts the deubiquitinating activity of BAP1.

In the diagnostic methods, the tissue sample obtained from the subject may be from any tissue in which a genomic DNA sequence, particularly a germline genomic DNA sequence, may be obtained. Non-limiting examples include blood and buccal tissue. Germ cells may be obtained in some aspects. The methods may include the step of obtaining the tissue sample, and may include the step of obtaining the nucleic acid. The nucleic acid may be any nucleic acid that has, or from which may be obtained, the germline nucleic acid sequence encoding the BAP1 protein, or the complement thereof, or any portion thereof. For example, the nucleic acid may be chromosomal or genomic DNA, may be mRNA, or may be a cDNA obtained from the mRNA.

The diagnoses are based on determining alterations in the germline BAP1 nucleic acid sequence that predispose a subject having such alterations to develop cancer, including any of the alterations described or exemplified herein. The reference nucleic acid sequences and the probes are thus based on alterations that predispose to develop cancer.

The alterations may be, for example, a mutation in the germline BAP1 nucleic acid sequence such as a substitution, an addition of one or more nucleotides in one or more locations, a deletion of one or more nucleotides in one or more locations, or any combination thereof. The alteration may occur in an intron, an exon, or both, including an alteration at or proximal to an exon-intron splice site. The one or more alterations may be located in human chromosome 3, for example, at segment 3p21, and may be at a BAP locus in this segment such as the BAP1 locus in 3p21.1. The alterations in the germline sequence preferably do not include an insertion of an A between positions 1318-1319 of the BAP1 cDNA as described by Harbour et al. (2010) Science 330:1410-3 (see, e.g., Genbank Accession No. NM004656; SEQ ID NO:41) (the inserted A becomes nucleotide 1319, moving the wild type nucleotide at position 1319 to position 1320 and generating a stop codon; SEQ ID NO:42). In this Harbour publication (Science, 330:1410-3), the germline alteration is an insertion of an A between nucleotides 52,437,842 and 52,437,843 of human chromosome 3 (the inserted A becomes nucleotide 52,437,843, moving the wild type nucleotide at position 52,437,843 to position 52,437,844 and generating a stop codon), thus, the alterations in the BAP1 germline sequence preferably do not include an insertion of an A between nucleotides 52,437,842 and 52,437,843 of human chromosome 3.

One non-limiting example of a particular alteration that predisposes a subject to develop cancer includes a C to T substitution in Exon 16. The substitution may occur at position 52,436,624 of human chromosome 3. The substitution may occur in a polynucleotide comprising SEQ ID NO:9. The polynucleotide having the substitution may comprise SEQ ID NO:10, or a portion thereof. The substitution may occur in the polynucleotide at the position corresponding to position 16 of SEQ ID NOs:9 or 10.

One non-limiting example of a particular exon-intron splice site alteration that predisposes a subject to develop cancer includes an A to G substitution 2 nucleotides upstream of the 3′ end of Intron 6. The A to G substitution may occur at position 52,441,334 of human chromosome 3. The A to G substitution may occur in a polynucleotide comprising SEQ ID NO:1. The polynucleotide having the A to G substitution may comprise SEQ ID NO:2, or a portion thereof. The substitution may occur in the polynucleotide at the position corresponding to position 16 of SEQ ID NOs:1 or 2. The A to G substitution may result in an aberrant splice site product lacking exon 7, which may comprise SEQ ID NO:8, or a portion thereof.

Another substitution includes a T to G substitution in Exon 9. The T to G substitution may occur at position 52,440,329 of human chromosome 3. The T to G substitution may occur in the polynucleotide at the position corresponding to position 17 of SEQ ID NO: 48, and may result in a polynucleotide comprising the sequence of SEQ ID NO: 46, or portion thereof, with the T to G substitution at the position corresponding to position 17 of SEQ ID NO: 46.

Another non-limiting example of a particular exon-intron splice site alteration that predisposes a subject to develop cancer includes and a deletion of 5 nucleotides plus a substitution of 1 nucleotide at the 3′ end of Exon 3. The alterations may occur in a polynucleotide comprising SEQ ID NO:11. The deleted 5 nucleotides may occur at positions 52,443,570 to 52,443,575 of human chromosome 3, may comprise SEQ ID NO:13, and may comprise the nucleotides corresponding to positions 17-21 of SEQ ID NO:11. The substitution may comprise an A to G substitution at the position corresponding to position 22 of SEQ ID NO:11. The resultant nucleic acid sequence may comprise SEQ ID NO:12, or a portion thereof.

Nucleotide deletions may occur any where in the germline BAP1 gene. In some aspects, the alteration comprises a deletion of a C in Exon 13. The deletion of the C may occur at position 52,437,444 of human chromosome 3. In some aspects, the alteration comprises a deletion of four nucleotides from Exon 14. The four nucleotides may comprise the sequence TCAC, and may occur at positions 52,437,159 to 52,437,162 of human chromosome 3. In another example, the deletion may be the deletion of a T in Exon 4. The deletion of a T in Exon 4 may occur at position 52,442,605 in human chromosome 3.

One non-limiting example of a particular alteration that predisposes a subject to develop cancer includes a deletion of 25 nucleotides in Exon 4. The deleted nucleotides may occur at positions 52,442,507 through 52,442,531 of human chromosome 3, may comprise SEQ ID NO:4, and may comprise the nucleotides corresponding to positions 17-41 of SEQ ID NO:3. The resultant nucleic acid sequence may comprise SEQ ID NO:5, or a portion thereof.

The reference nucleic acid sequences used in nucleic acid sequence comparison aspects may comprise one or more of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO: 46, or portion thereof having the variation from the wild type sequence. The reference nucleic acid sequences may also include wild type nucleic acid sequences to serve as controls in the comparison, or for determinations that the subject does not have a germline nucleic acid sequence alteration that predisposes to develop cancer. Non-limiting examples of wild type nucleic acid sequences include SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, and SEQ ID NO: 48. Reference nucleic acid sequences having any portion of the sequence of these sequence identifiers may be used.

The polynucleotide probes used in nucleic acid hybridization aspects may comprise one or more of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:46 or portion thereof having the variation from the wild type sequence. The nucleic acid sequence of the probes may be complementary to SEQ ID NOs:2, 4, 5, 8, 10, 12, 13, or 46. Polynucleotide probes having a wild type nucleic acid sequence may be used to serve as controls in hybridization assays, or for determinations that the subject does not have a germline nucleic acid sequence alteration that predisposes to develop cancer. Non-limiting examples of wild type nucleic acid sequences include SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, and SEQ ID NO:48. The nucleic acid sequence of the probes may be complementary to SEQ ID NOs:1, 3, 6, 7, 9, 11, or 48. Probes having any portion of the sequence of these sequence identifiers, or complement thereof, may be used.

The invention also provides isolated polynucleotides comprising a germline nucleic acid sequence encoding the BAP1 protein and having one or more alterations that predispose a subject to develop cancer. The invention also provides isolated polynucleotides comprising a probe having a nucleic acid sequence complementary to a BAP1 germline nucleic acid sequence having one or more alterations that predispose a subject to develop cancer. Probes may have any number of nucleotide bases. The one or more alterations may be any of the alterations described or exemplified herein.

Polynucleotides include polyribonucleotides and polydeoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA, and include single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. Polynucleotides may have triple-stranded regions comprising RNA or DNA or both RNA and DNA, modified bases, unusual bases such as inosine, modified backbones, and enzymatic or metabolic modifications.

The alterations may comprise, for example, a mutation in the germline BAP1 nucleic acid sequence such as a substitution, an addition of one or more nucleotides in one or more locations, a deletion of one or more nucleotides in one or more locations, or any combination thereof. Preferably, the alterations result in a gene encoding a truncated BAP1 protein and/or nonsense-mediated decay of the BAP1 mRNA transcribed from the altered germline gene. The alteration may occur in an intron, an exon, or both, including an alteration at or proximal to an exon-intron splice site. The one or more alterations may be located in human chromosome 3, for example, at segment 3p21, and may be at a BAP locus in this segment such as the BAP1 locus in 3p21.1. The alterations in the germline sequence preferably do not include an insertion of an A between positions 1318-1319 of the BAP1 cDNA as described by Harbour et al. (2010) Science 330:1410-3 (see, e.g., Genbank Accession No. NM004656) (the inserted A becomes nucleotide 1319, moving the wild type nucleotide at position 1319 to position 1320 and generating a stop codon). In this Harbour publication (Science, 330:1410-3), the germline alteration is an insertion of an A between nucleotides 52,437,842 and 52,437,843 of human chromosome 3 (the inserted A becomes nucleotide 52,437,843, moving the wild type nucleotide at position 52,437,843 to position 52,437,844 and generating a stop codon), thus, the alterations in the BAP1 germline sequence preferably do not include an insertion of an A between nucleotides 52,437,842 and 52,437,843 of human chromosome 3.

An alteration that predisposes a subject to develop cancer may comprise a C to T substitution in Exon 16. The substitution may occur at position 52,436,624 of human chromosome 3. The polynucleotide may comprise the nucleic acid sequence of SEQ ID NO:9, or the complement thereof, or a portion thereof. The polynucleotide may comprise the nucleic acid sequence of SEQ ID NO:10, or the complement thereof, or a portion thereof. For detection of the mutation, the polynucleotide preferably has at least about 95%, and more preferably 100% sequence identity with the nucleic acid sequence of SEQ ID NO:9, or the complement thereof. For detection of the mutation, the polynucleotide preferably has at least about 95%, and more preferably 100% sequence identity with the nucleic acid sequence of SEQ ID NO:10, or the complement thereof.

Another alteration that predisposes a subject to develop cancer may comprise a T to G substitution in Exon 9. The T to G substitution may occur at position 52,440,329 of human chromosome 3. The polynucleotide may comprise the nucleic acid sequence of SEQ ID NO:46, or the complement thereof, or a portion thereof. The polynucleotide may comprise the nucleic acid sequence of SEQ ID NO: 48, or the complement thereof, or a portion thereof. For detection of the mutation, the polynucleotide preferably has at least about 95%, and more preferably 100% sequence identity with the nucleic acid sequence of SEQ ID NO:46, or the complement thereof.

An exon-intron splice site alteration that predisposes a subject to develop cancer may comprise an A to G substitution 2 nucleotides upstream of the 3′ end of Intron 6. The A to G substitution may occur at position 52,441,334 of human chromosome 3. The polynucleotide may comprise the nucleic acid sequence of SEQ ID NO:2, or the complement thereof, or a portion thereof. The polynucleotide may comprise the nucleic acid sequence of SEQ ID NO:1, or the complement thereof, or a portion thereof. The polynucleotide may comprise the nucleic acid sequence of SEQ ID NO:6, or the complement thereof, or a portion thereof. The polynucleotide may comprise the nucleic acid sequence of SEQ ID NO:7, or the complement thereof, or a portion thereof. The polynucleotide may comprise the nucleic acid sequence of SEQ ID NO:8, or the complement thereof, or a portion thereof. The polynucleotide may have at least about 95%, and more preferably 100% sequence identity with the nucleic acid sequence of SEQ ID NO:1, or the complement thereof. The polynucleotide may have at least about 95%, and more preferably 100% sequence identity with the nucleic acid sequence of SEQ ID NO:2, or the complement thereof. The polynucleotide may have at least about 95%, and more preferably 100% sequence identity with the nucleic acid sequence of SEQ ID NO:6, or the complement thereof. The polynucleotide may have at least about 95%, and more preferably 100% sequence identity with the nucleic acid sequence of SEQ ID NO:7, or the complement thereof. The polynucleotide may have at least about 95%, and more preferably 100% sequence identity with the nucleic acid sequence of SEQ ID NO:8, or the complement thereof.

An exon-intron splice site alteration that predisposes a subject to develop cancer may comprise a deletion of 5 nucleotides plus a substitution of 1 nucleotide at the 3′ end of Exon 3. The deleted 5 nucleotides may occur among positions 52,443,570 to 52,443,575 of human chromosome 3. The polynucleotide may comprise the nucleic acid sequence of SEQ ID NO:3, or the complement thereof, or a portion thereof. The polynucleotide may comprise the nucleic acid sequence of SEQ ID NO:11, or the complement thereof, or a portion thereof. The polynucleotide may comprise the nucleic acid sequence of SEQ ID NO:12, or the complement thereof, or a portion thereof. The polynucleotide may have at least about 95% identity with the nucleic acid sequence of SEQ ID NO:11, or the complement thereof. The polynucleotide may have at least about 95%, and more preferably 100% sequence identity with the nucleic acid sequence of SEQ ID NO:12, or the complement thereof.

An alteration that predisposes a subject to develop cancer may comprise a deletion of 25 nucleotides in Exon 4. The deleted nucleotides may occur at positions 52,442,507 through 52,442,531 of human chromosome 3. The polynucleotide may comprise the nucleic acid sequence of SEQ ID NO:3, or the complement thereof, or a portion thereof. The polynucleotide may comprise the nucleic acid sequence of SEQ ID NO:4, or the complement thereof, or a portion thereof. The polynucleotide may comprise the nucleic acid sequence of SEQ ID NO:5, or the complement thereof, or a portion thereof. The polynucleotide may have at least about 95%, and more preferably 100% sequence identity with the nucleic acid sequence of SEQ ID NO:3, or the complement thereof. The polynucleotide may have at least about 95%, and more preferably 100% sequence identity with the nucleic acid sequence of SEQ ID NO:4, or the complement thereof. The polynucleotide may have at least about 95%, and more preferably 100% sequence identity with the nucleic acid sequence of SEQ ID NO:5, or the complement thereof.

The probes may comprise the nucleic acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, or SEQ ID NO: 46 or any portion of these sequences having the variation from the wild type sequence. The probes may comprise the complement of the nucleic acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, or SEQ ID NO:46 or any portion of these sequences having the variation from the wild type sequence. The probes may comprise a detectable label. Detectable labels may be any suitable chemical label, metal label, enzyme label, fluorescent label, radiolabel, or combination thereof.

The invention also features a support comprising a plurality of polynucleotides comprising a germline nucleic acid sequence, or portion thereof, encoding the BAP1 protein or portion thereof, and having one or more alterations that predispose a subject to develop cancer, and optionally, a plurality of polynucleotides comprising a wild type germline nucleic acid sequence encoding the BAP1 protein. The support may comprise an array. The polynucleotides may be probes. The probes may comprise the nucleic acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, or SEQ ID NO:46 or any portion of these sequences having the variation from the wild type sequence. The probes may comprise the complement of the nucleic acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, or SEQ ID NO:46 or any portion of these sequences having the variation from the wild type sequence.

The invention also features isolated polypeptides, including isolated proteins comprising a polypeptide having an amino acid sequence encoded by a polynucleotide comprising a germline nucleic acid sequence encoding the BAP1 protein and having one or more alterations that predispose a subject to develop cancer. Polypeptides include polymers of amino acid residues, one or more artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers. The polypeptides may comprise an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, or SEQ ID NO:46. Polypeptides include truncated BAP1 proteins, in which the truncation was caused by an alteration in the nucleic acid sequence encoding BAP1, which alteration is associated with a predisposition to develop cancer.

The invention also features systems for diagnosing a predisposition to develop cancer. In general, the systems comprise a data structure comprising one or more reference nucleic acid sequences having one or more alterations in the BAP1 germline sequence associated with predisposing a subject to develop cancer, and a processor operably connected to the data structure. Optionally, the data structure may comprise one or more wild type reference nucleic acid sequences, which have a wild type BAP1 germline sequence. The processor is preferably capable of comparing, and preferably programmed to compare determined nucleic acid sequences (for example, those determined from nucleic acids obtained from a subject) with reference nucleic acid sequences, including reference nucleic acid sequences that do not have the alterations.

In some preferred aspects, a system is for determining a predisposition to develop BAP1 cancer syndrome. The system comprises a data structure comprising one or more BRCA1 associated protein 1 (BAP1) germline nucleic acid sequences having one or more alterations in the germline nucleic acid sequence indicative of a predisposition to develop BAP1 cancer syndrome, provided that the one or more alterations exclude the insertion of an A between nucleotides 52,437,842 and 52,437,843 of human chromosome 3, one or more BAP1 germline nucleic acid sequences that do not have the one or more alterations, and a processor programmed to compare sequences of nucleic acids encoding BAP1 obtained from a human being with the BAP1 germline nucleic acid sequences in the data structure. The one or more alterations may encode a truncated BAP1 protein or result in the nonsense-mediated decay of BAP1-encoding mRNA transcribed from the altered germline nucleic acid sequence.

The one or more alterations preferably are located at segment 3p21 of human chromosome 3, and more preferably at the BAP1 locus in in human chromosome segment 3p21.1. The alterations preferably include, but are not limited to, a C to T substitution in Exon 16 of the BAP1 gene, an A to G substitution two nucleotides upstream of the 3′ end of Intron 6 of the BAP1 gene, a deletion of five nucleotides from and a substitution of one nucleotide at the 3′ end of Exon 3 of the BAP1 gene, a deletion of twenty five nucleotides in Exon 4 of the BAP1 gene, a deletion of a C in Exon 13 of the BAP1 gene, a deletion of four nucleotides from Exon 14 of the BAP1 gene, and a T to G substitution in Exon 9 of the BAP1 gene.

In some preferred aspects, a C to T substitution at Exon 16 occurs in the germline nucleic acid sequence at location corresponding to position 52,436,624 of human chromosome 3. In some preferred aspects, a A to G substitution occurs at a location in the germline nucleic acid sequence at a location corresponding to position 52,441,334 of human chromosome 3. In some preferred aspects, a deletion of five nucleotides occurs in the germline nucleic acid sequence at a location corresponding to positions 52,443,570 to 52,443,574 of human chromosome 3, and a substitution of one nucleotide in the 3′ end of Exon 3 is a G to A substitution and occurs in the germline nucleic acid sequence at a location corresponding to position 52,443,575 of human chromosome 3. In some preferred aspects, a deletion of twenty five nucleotides in Exon 4 occurs in the germline nucleic acid sequence at a location corresponding to positions 52,442,507 to 52,442,531 of human chromosome 3. In some preferred aspects, a deletion of a C in Exon 13 occurs in the germline nucleic acid sequence at a location corresponding to position 52,437,444 of human chromosome 3. In some preferred aspects, a deletion of four nucleotides from Exon 14 occurs in the germline nucleic acid sequence at a location corresponding to positions 52,437,159 to 52,437,162 of human chromosome 3. In some preferred aspects, a T to G substitution occurs in the germline nucleic acid sequence at a location corresponding to position 52,440,329 of human chromosome 3. In some preferred aspects, a a deletion of a T occurs in the germline nucleic acid sequence at a location corresponding to position 52,442,605 of human chromosome 3.

In some aspects, the data system comprises a nucleic acid array. The nucleic acid array may by any array described or exemplified herein.

The BAP1 cancer syndrome includes one or more of malignant mesothelioma, uveal melanoma, and cutaneous melanoma. The BAP1 cancer syndrome may include, in addition or instead of any combination of malignant mesothelioma, uveal melanoma, and cutaneous melanoma, one or more of breast cancer, ovarian cancer, pancreatic cancer, kidney cancer, and skin cancer.

The system may comprise an input for accepting determined nucleic acid sequences obtained from tissue samples from a subject. the system may comprise an output for providing results of a sequence comparison to a user such as the subject, or a technician, or a medical practitioner. Optionally, the system may comprise a sequencer for determining the sequence of a nucleic acid such as a nucleic acid obtained from a subject. Optionally, the system may comprise a detector for detecting a detectable label on a nucleic acid.

Optionally, the system may comprise computer readable media comprising executable code for causing a programmable processor to determine a diagnosis of the subject, for example whether the subject has a predisposition to develop a cancer such as breast cancer, ovarian cancer, pancreatic cancer, kidney cancer, skin cancer including uveal melanoma, or malignant mesothelioma, and/or a predisposition to develop malignant mesothelioma upon exposure to a sufficient amount of carcinogenic mineral fibers such as asbestos or erionite in the environment. The diagnosis may be based on the comparison of determined nucleic acid sequences with reference nucleic acid sequences. Thus, the system may comprise an output for providing a diagnosis to a user such as the subject, or a technician, or a medical practitioner. Optionally, the system may comprise computer readable media that comprises executable code for causing a programmable processor to recommend a treatment regimen for the subject, for example, a treatment regimen for preventing, inhibiting, or delaying the onset of a particular cancer, which cancer is preferably a cancer to which the subject is predisposed to develop on account of the presence of one or more alterations in the BAP1 germline nucleic acid sequence, including the BAP1 cancer syndrome and any of its attendant cancers. Optionally, the system may comprising executable code for causing the processor to calculate a risk score the human subject to develop one or more of malignant mesothelioma, breast cancer, ovarian cancer, pancreatic cancer, kidney cancer, cutaneous melanoma, or uveal melanoma based on a comparison of sequences of nucleic acids encoding BAP1 obtained from the subject with the BAP1 germline nucleic acid sequences in the data structure. A risk score may, for example, comprise a statistical likelihood of developing any such cancers as a result of the presence of one or more germline alterations in the subject's BAP1 gene.

In any of the systems, a computer may comprise the processor or processors used for determining information, comparing information and determining results. The computer may comprise computer readable media comprising executable code for causing a programmable processor to determine a diagnosis of the subject. The systems may comprise a computer network connection, including an Internet connection.

The invention also provides computer-readable media. In some aspects, the computer-readable media comprise executable code for causing a programmable processor to compare the nucleic acid sequence of BAP1 determined from a nucleic acid obtained from a tissue sample obtained from a subject with one or more reference nucleic acid sequences having one or more alterations in the BAP1 germline sequence associated with predisposing a subject to develop cancer. Optionally, the computer-readable media comprise executable code for causing a programmable processor to compare the nucleic acid sequence of BAP1 determined from a nucleic acid obtained from a tissue sample obtained from a subject with one or more wild type reference nucleic acid sequences having a wild type BAP1 germline sequence, or with one or more reference nucleic acid sequences that have a BAP1 germline sequence without any cancer predisposition-associated alterations. Optionally, the computer readable media may comprising executable code for causing the processor to calculate a risk score the human subject to develop one or more of malignant mesothelioma, breast cancer, ovarian cancer, pancreatic cancer, kidney cancer, cutaneous melanoma, or uveal melanoma based on a comparison of sequences of nucleic acids encoding BAP1 obtained from the subject with the BAP1 germline nucleic acid sequences in the data structure. A risk score may, for example, comprise a statistical likelihood of developing any such cancers as a result of the presence of one or more germline alterations in the subject's BAP1 gene. The computer readable media may comprise a processor, which may be a computer processor.

The reference nucleic acid sequences may comprise any of the one or more alterations described or exemplified herein. The alterations may be, for example, a mutation in the germline nucleic acid sequence such as a substitution, an addition of one or more nucleotides in one or more locations, a deletion of one or more nucleotides in one or more locations, or any combination thereof. The alteration may occur in an intron, an exon, or both, including an alteration at or proximal to an exon-intron splice site. The one or more alterations may be located in human chromosome 3, for example, at segment 3p21.1, and may be at a BAP1 locus in this segment. The alterations in the germline sequence preferably do not include an insertion of an A between positions 1318-1319 of the BAP1 cDNA as described by Harbour et al. (2010) Science 330:1410-3 (see, e.g., Genbank Accession No. NM004656; SEQ ID NO:41) (the inserted A becomes nucleotide 1319, moving the wild type nucleotide at position 1319 to position 1320 and generating a stop codon; SEQ ID NO:42).

The systems and computer readable media may be used in any of the methods described or exemplified herein, for example, methods for identifying alterations in the BAP1 gene, and methods for diagnosing a predisposition to develop cancer. For example, the systems and computer readable media may be used to facilitate comparisons of gene sequences, or to facilitate a diagnosis.

The invention also provides methods for inhibiting the onset of cancer in a subject having one or more alterations in the germline BAP1 nucleic acid sequence that predispose a subject to develop cancer. The methods may be used, for example, to inhibit the onset of the BAP1 cancer syndrome, or any one or more of the cancers that comprise the BAP1 cancer syndrome. In some aspects, the BAP1 cancer syndrome includes one or more of malignant mesothelioma, uveal melanoma, and cutaneous melanoma. The BAP1 cancer syndrome may include, in addition or instead of any combination of malignant mesothelioma, uveal melanoma, and cutaneous melanoma, one or more of breast cancer, ovarian cancer, pancreatic cancer, kidney cancer, and skin cancer.

In one aspect, the methods comprise restoring the wild type germline nucleic acid sequence of BAP1 in the genomic DNA of the subject, or otherwise removing the alteration(s) that predispose to BAP1 cancer syndrome development. The wild type germline nucleic acid sequence may be restored, or the alterations may be removed, for example, using any acceptable gene therapy technique. Restoring the wild type germline nucleic acid sequence may include, for example, reverting one or more alterations in the germline nucleic acid sequence to their wild type form. Reverting may include, for example, changing a substitution, adding back deleted nucleotides, or removing added nucleotides. The alterations may be those located to chromosome 3, and more particularly to chromosome segment 3p21, and preferably to the BAP1 locus in 3p21. The alterations may include the alterations described or exemplified herein.

In one aspect, the methods comprise administering to the subject an effective amount of wild type BAP1 mRNA or protein, or related mRNA or proteins along the BAP1 pathway. Preferably, the wild type BAP1 protein is active and is able to restore the normal biologic activity of BAP1 in the subject even in the presence of the defective BAP1 protein produced by the subject. Preferably, the wild type BAP1 protein is human BAP1 protein.

In some aspects, the methods comprise reducing or eliminating exposure of the subject to carcinogenic mineral fibers such as asbestos, erionite, refractory ceramic fibers, and nanotubes. For example, the subject may be counseled to avoid areas where carcinogenic mineral fibers are present naturally in the soil, or to avoid entering buildings, ships, and other structures where such mineral fibers are present in the building materials, or to avoid occupations that present a risk of exposure to such mineral fibers, such as asbestos removal occupations. The subject may be counseled to wear appropriate clothing or masks to avoid exposure to or inhalation of the mineral fibers. In some aspects, the methods comprise reducing or eliminating exposure of the subject to ultraviolet radiation, including ultraviolet radiation from sunlight. Thus, for example, the methods may comprises reducing exposure of the subject to sunlight, or at least sunlight ultraviolet radiation, for example, by use of sun screen and/or ultraviolet-filtering sunglasses.

The following examples are provided to describe the invention in greater detail. They are intended to illustrate, not to limit, the invention.

Example 1

Experimental Methods

Samples. Blood and tumor samples were obtained following institutional review board guidelines of the University of Hawaii. Genomic copy number analysis, using Agilent 244K Genomic DNA arrays, were performed as described in Timakhov R A et al. (2009) Genes Chromosomes Cancer 48:786-94, and Altomare D et al. (2009) Proc. Natl. Acad. Sci. USA 106:3430-5. Cloning of genomic PCR products, DNA sequencing and Western blot analysis were carried out using standard procedures. Numbering of locations of mutations as shown in the figures, or describes above, is based on the February 2009 human reference sequence (GRCh37/hg19) (see the Santa Cruz Genome Browser http://genome.ucsc.edu/cgi-bin/hgGateway).

Genetic Linkage studies. All available family members were genotyped using the Affymetrix Genome-Wide Human SNP Array 6.0. Prior to linkage analyses, familial relationships were checked and corrected using PLINK. Parametric linkage analyses based on a 0.2 cM single nucleotide polymorphism (SNP) map assume a rare dominant model with age-dependent liability classes modeling the expected change in penetrance for different age groups. This platform contains nearly 2 million probes for SNPs and copy number variants (CNV). Genotyping performed on all samples together using the BIRDSEED version 2 algorithm provided genotypes for 909,623 SNPs for quality control analyses. PLINK was used to remove SNPs with a minor allele frequency below 5% in HapMap CEU samples (race matched), SNPs monomorphic in the data, and SNPs with less than perfect call rates. PLINK was also used to verify relationships in the pedigrees, by generating estimates for the proportion of SNPs inherited identical by descent (IBD) among family members.

Cloning and Sequence Analysis. Multiple PCR products encompassing the entire BAP1 coding exons, adjacent intron sequences, and 5′ and 3′ untranslated regions were PCR amplified for sequencing. To evaluate the splice acceptor site mutation seen in family W, a PCR-based strategy was used to clone genomic BAP1 sequences encompassing exons 4-8 and intervening introns, including the intron 6 splice mutation. Primers incorporated a XhoI restriction site at the 5′ end and an EcoRI restriction site at the 3′end of the PCR product. Gel purified PCR products were cloned into pcDNA 3.1(−) plasmid (Invitrogen, Carlsbad, Calif.) using the two restriction sites. Individual clones were sequenced verified. Numbering of locations of mutations is based on the February 2009 human reference sequence (GRCh37/hg19).

DNA Copy Number Analysis. Oligonucleotide aCGH analysis was performed using 244K Human Genome CGH microarrays (G4411B) from Agilent Technologies (Santa Clara, Calif.). DNA (2-3 μg) from formalin-fixed, paraffin-embedded MM specimens was labeled using Agilent's Genomic DNA ULS Labeling Kit. ULS-Cy5- and ULS-Cy3-labeled DNA products were purified using Microcon YM-30 filtration devices. Appropriate ULS-Cy5- and ULS-Cy3-labeled DNA sample pairs were combined and mixed with human Cot-1 DNA, Agilent Blocking Agent and Hi-RPM Hybridization Buffer. Labeled target solution was hybridized to the microarray using SureHyb chambers. After hybridization and washing, microarrays were scanned using an Agilent microarray scanner. Data for individual features on the microarray were extracted from the scan image using Agilent's Feature Extraction (FE) Software. Output files were imported into Agilent's CGH data analysis software, DNA Analytics, for DNA copy number analysis.

Western Blot Analysis. Total cellular protein from human malignant mesothelioma cell lines was isolated by using cell lysis buffer supplemented with 2 mM PMSF (Cell Signaling Technology, Danvers, Mass.). Cell lysates were incubated on ice for 15 min, and cell debris was removed by centrifuging at 15,000×g for 15 min at 4° C. Protein concentration was determined by the Bradford method (Bio-Rad, Hercules, Calif.). For immunoblotting, samples (50 μg) were separated by Tris-Glycine-buffered SDS-PAGE gel (Invitrogen, Carlsbad, Calif.) and transferred to polyvinylidene difluoride membranes (Millipore, Billerica, Mass.). Immunoblots were incubated with primary antibodies at 4° C. overnight, followed by incubation with secondary antibody conjugated with horseradish peroxidase for 60 min at room temperature. Antibodies against BAP1 and GAPDH were from Santa Cruz Biotechnology (Santa Cruz, Calif.). Tumor cell lines used for immunoblotting were established from surgically resected primary human mesothelioma specimens.

Clonogenic Assay. Human malignant mesothelioma cell lines (2×105 cells) were seeded in 6-well plates and incubated at 37° C. overnight. Cells were transfected with 2 μg of wild-type BAP1 plasmid (OriGene, Rockville, Md.) or control vector by using Lipofectamine 2000 (Invitrogen). Forty-eight hours after transfection, the cells were selected by culturing in culture medium containing 400 μg/mL G418 (Invitrogen). Two weeks after selection, colonies were stained with Diff-Quik stain (Dade Behring, Newark, Del.) and counted.

Example 2

Experimental Results

Efforts were concentrated on two US MM-families, because it was possible to collect samples of interest from every member of these families. Moreover, members of these families were not occupationally exposed to asbestos nor exposed to erionite, thus removing the confounding factor of heavy exposure to a carcinogen known to cause MM. These two families had a high incidence of MM and various other cancers (FIG. 1A, B).

Samples from the ceiling, roof, tiles, driveways, and other surfaces of each of the houses where these families lived 20 or more years ago were collected and analyed (MM latency is 20-60 years from initial exposure). Traces of chrysotile, but not amphibole asbestos, were found in 5/5 homes where the L family lived, and of tremolite and chrysotile in 1/1 home where all affected members of family W lived for several years. Since asbestos becomes airborne when materials containing asbestos are disturbed, it is possible that family members were exposed.

Array-CGH analysis of two tumors (one per family) uncovered rearrangements affecting the BAP1 locus in 3p21.1. In one tumor (L-III-18T), a focal deletion encompassing BAP1 was seen within a larger deletion, while in the second (W-III-06T), an amplification junction occurred within the BAP1 locus (FIG. 2A).

The BAP1 gene in germline DNA from both families was sequenced, initially showing that six affected members (4 with MM; 2 with breast or renal cancer) examined from family W had the same inherited mutation, whereas 3 unaffected relatives did not (FIG. 1A). In addition, linkage analysis established that case W-III-10 (ovarian cancer) also has the mutated haplotype.

The mutation occurred at the intron 6/exon 7 boundary, with affected individuals having an A→G substitution at the −2 nucleotide consensus splice acceptor site (FIG. 2B). Such alterations often lead to exon skipping and pathogenic protein sequence changes. Tumor DNA was available in several cases, one of which (W-III-04T) showed a 25-bp deletion in exon 4 as well as the splice site mutation (FIG. 2C). The deletion resulted in a frameshift and premature termination of BAP1 (p.I72fsX7). Matched germline DNA did not contain the deletion, indicating that it was somatic in origin. Cloning of genomic PCR products encompassing exons 4-8 from tumor DNA suggested that the splice site mutation and deletion reside in different alleles, consistent with biallelic inactivation of BAP1. Transfection of mammalian cells with a genomic construct encompassing exons 6-8, and with the intron 6 splice site mutation, resulted in an aberrant splice product lacking exon 7 and a frameshift affecting the BAP1 nuclear ubiquitin carboxyl-terminal hydrolase (UCH) domain (FIG. 2D).

In family L, germline DNA from 3 MMs, 2 uveal melanomas, and 2 skin cancers exhibited a germline C/G to T/A transition in exon 16, creating a premature termination codon (p.Q684X) (FIG. 2E). The nonsense mutation results in premature termination of the nuclear localization signal located in the carboxy-terminus of BAP1. BAP1 mutations were not detected in two family members with prostate cancer, were not detected in one family member with non-Hodgkin's lymphoma, and not detected in three healthy spouses. Linkage analyses revealed that case II-03 (pancreatic cancer) was a mutation carrier.

Exome sequencing, using the Illumina HiSeq 2000 system, of germline DNA from two affected members of each family verified the splice site and nonsense mutations in family W and family L, respectively (not shown). Immunohistochemistry on mesotheliomas from L and W families revealed lack of BAP1 nuclear expression (FIG. 3).

Following the linking of BAP1 mutations to familial mesothelioma, BAP1 was sequenced (17 exons/introns/promoter) in 26 germline DNAs from sporadic mesothelioma patients. All of the patients had reported asbestos exposure to the treating physician, although these claims were not verified by lung content or mineralogical analyses. Two of 26 had BAP1 deletions: c.1832delC in exon 13 (p.P573fsX3) and c.2008-2011delTCAC in exon 14 (p.Y628fsX8) (Table 1). Both mutations result in a frameshift leading to a stop codon upstream of the region encoding the BAP1 nuclear localization signal (FIG. 2d). Upon an investigation as to whether anything was unique about these two patients, it was found that each had been treated for uveal melanoma 1 or 6 years before being diagnosed with mesothelioma. Of the remaining 24 sporadic mesotheliomas, none had uveal melanoma. Tumor DNA was available from 18 of the 26 sporadic mesothelioma patients: DNA sequencing revealed truncating BAP1 mutations in 4/18 (22%) tumors (FIG. 4A); BAP1 alterations in these tumors were supported by immunoblot analyses (FIG. 4B).

TABLE 1
Summary of genetic and demographic data of cases in this study
MM Uveal
Sample Gen- Histol- Mela- Germline BAP1 Mutations Identified in
ID Agea der MM ogy noma Other Cancers Mutation Mesothelioma Specimens
L-II-05 82a F No No Squamous cell Exon 16 (52, 436, 624
ca. (skin) C > T-nonsense)
L-II-12 68a F No No Basal cell ca. Exon 16 (52, 436, 624
C > T-nonsense)
L-II-18 54d F No Yes Metastasis to (no DNA available)
liver
L-II-09 65d F Yes N.A. None None (no DNA available)
L-II-14 57d M Yes N.A. No None Exon 16 (52, 436, 624
C > T-nonsense)b
L-II-03 73d F No No Pancreatic ca. Exon 16 (52, 436, 624
C > T-nonsense)b
L-II-07 70d F Yes N.A. No None Exon 16 (52, 436, 624
C > T-nonsense)b
L-III-18 59 F Yes E Yes None Exon 16 (52, 436, 624 Exon 16 (52, 436, 624
C > T-nonsense) C > T-nonsense)c
L-III-22 63 F Yes E No None Exon 16 (52, 436, 624 N.D.
C > T-nonsense)
L-III-31 50 M Yes E No None Exon 16 (52, 436, 624 N.D.
C > T-nonsense)
L-II-02 86a M No No Prostate ca. None
L-III-15 81a F Yes N.A. No None Exon 16 (52, 436, 624
C > T-nonsense)b
L-III-20 59 M No No Prostate ca None
W-III- 58 M Yes E No None Intron 6 (52, 441, 334 Intron 6 (52, 441, 334
04 A > G-splice site) A > G-splice site);
Exon 4 (52, 442, 507-531
ATTGATGATGATATTGTGAATAACA
del) (SEQ ID NO: 4)
W-III- 50 F Yes E No None Intron 6 (52, 441, 334 Intron 6 (52, 441, 334
06 A > G-splice site) A > G-splice site)d
W-III- 58 F Yes E No None Intron 6 (52, 441, 334 Intron 6 (52, 441, 334
08 A > G-splice site) A > G-splice site)e
W-IV- 44 F Yes E No None Intron 6 (52, 441, 334 N.D.
21 A > G-splice site)
W-IV- 37 F No No Breast ca. Intron 6 (52, 441, 334
17 A > G-splice site)
W-III- 57 F No No Clear cell renal Intron 6 (52, 441, 334
09 cell ca. A > G-splice site)
W-II-01 92d M No No None None
W-II-02 36 F Yes N.A. No None Intron 6 (52, 441, 334
A > G-splice site)b
W-III- 57a M No No None None
01
W-III- 59a F No No None None
03
W-III- 59 F No No Ovarian ca. Intron 6 (52, 441, 334
10 A > G-splice site)b
SP-002 55 F Yes E Yes Leiomyosarcoma Exon 13 (52, 437, N.D.
444 C del)
SP-008 63 M Yes E Yes None Exon 14 (52, 437, N.D.
159-162 TCAC del)
SP-007 55 F Yes E No Basal cell ca. None N.D.
SP-011 63 M Yes B No Basal cell ca. None None
SP-015 82 M Yes E No Basal cell ca. None Exon 9 (52, 440, 352 G del)
Exon 13 (52, 437, 664 C del)
SP-026 66 M Yes B No Basal cell ca. None None
SP-020 75 M Yes E No Basal cell ca.; None None
Meningioma
SP-025 52 M Yes E No Basal cell ca.; None None
Squamous cell
ca. (skin)
SP-005 34 F Yes E No Breast ca.; None N.D.
Leiomyosarcoma
SP-010 69 F Yes E No Breast ca.; None N.D.
Bronchioalveolar
ca.; Pancreatic
ca.
SP-019 71 M Yes B No Colon ca. None None
SP-016 74 M Yes E No Colon ca.; None None
Prostate ca.
SP-004 62 F Yes B No Hairy cell None N.D.
leukemia
SP-003 64 M Yes E No Melanoma None N.D.
(skin)
SP-017 74 M Yes E No Melanoma None None
(skin)
SP-018 70 M Yes E No Prostate ca. None Exon 17 (52, 436,
398-399 CG del)
SP-013 70 M Yes B No Prostate ca. None Exon 16 (52, 436, 599-627
GCTCAGGAAGGTGAGGGGATGCGCTG
CTG del) (SRI ID NO: 14)
SP-021 61 M Yes E No Prostate ca. None None
SP-012 58 F Yes E No Squamous cell None None
ca. (skin)
SP-001 63 M Yes E No None None Exon 11 (52, 439, 219 C del)
SP-006 60 M Yes E No None None N.D.
SP-009 55 M Yes E No None None None
SP-014 60 M Yes E No None None None
SP-022 56 M Yes E No None None None
SP-023 53 F Yes B No None None None
SP-024 78 M Yes B No None None None
MM, malignant mesothelioma; ca., carcinoma; N.A., not available; N.D., not determined; E, epithelial MM histology; del, deletion; B, biphasic MM histology.
aAge at diagnosis. When this information was not available, either current age of patient who is still alive (e.g., 82a) or age at death (e.g., 92d) are indicated.
bPresence of mutation inferred based on the results of linkage analysis; all others were determined by DNA sequencing.
cAn aCGH analysis revealed a focal homozygous deletion (~218 kb in size) encompassing the entire BAP1 locus, indicating that at least a subset of tumor cells have loss of both mutant and wild-type BAP1 alleles.
daCGH analysis showed amplicon within 4 kb of BAP1 locus.
eDNA sequencing revealed absence of wild-type BAP1 allele

Germline DNA from one member of a family not from family W or family L had a 6-bp deletion in exon 3, which occurred in tandem with the substitution of a single nucleotide. With the substitution, there was a net loss of 5 bases. This dual alteration created a premature stop codon (FIG. 5).

Although tumor protein lysates were not available from these families, frequent loss of BAP1 expression was observed in MM cell lines and sporadic tumors (FIG. 6A). Re-expression of BAP1 in BAP1-deficient MM lines resulted in markedly decreased colony-forming ability in clonogenic assays (FIG. 6B), consistent with BAP1's known role in regulating cell proliferation and viability.

Losses of chromosome 3p21 occur frequently in MM suggesting that loss of one copy of 3p unmasks a mutant recessive allele on the remaining copy. The identification of deletions or other rearrangements of 3p21.1 in tumors from both families for which array-CGH or sequencing data were available is consistent with chromosome 3 alterations uncovering recessive BAP1 mutations.

Frequent somatic mutation of BAP1 was recently reported in metastasizing uveal melanomas, and one case had a germline mutation. The present findings indicate that hereditary alterations in BAP1 predisposes to both uveal melanoma and MM, and possibly to breast, ovarian and renal cell carcinoma, as well as to skin cancer.

In addition, and most importantly, the findings demonstrate the presence of germline BAP1 mutations in members of U.S. families that experience an extremely high incidence of mesothelioma, in spite of very modest exposure to asbestos; thus, the results point to BAP1 as the first reported gene that modulates mineral fiber carcinogenesis. Furthermore, it is shown that BAP1 mutations are associated with a novel hereditary cancer syndrome that predisposes to mesothelioma, uveal melanoma and potentially other cancers. The annual incidence of uveal melanoma is 5 7/106 in the U.S., similar to mesothelioma. Therefore, it is exceedingly unlikely that the occurrence of both malignancies in the same individual would occur by chance, e.g., if assumed that the two diseases are independent and the joint probability (estimated at 36 per trillion per year) follows a binomial distribution, then the likelihood of three (or more) cases appearing in the U.S. (population ˜310 million) per year is 2.3×10−7.

It is believed that in some individuals uveal melanoma, breast and ovarian cancer may be associated. It is believed that when carriers of BAP1 mutations are exposed to asbestos fibers, MM may predominate over other cancer types.

In family W, the presence of a breast cancer before age 45 and an ovarian cancer is consistent with the hypothesis that the BAP1 mutation is associated with a hereditary form of breast/ovarian cancer, as might be expected given BAP1's relationship with the breast/ovarian cancer susceptibility gene product, BRCA1. BAP1 was identified based on its binding to the RING finger domain of BRCA1 (Jensen D et al. (1998) Oncogene 16:1097-1112). It was found that BAP1 enhances BRCA1-mediated inhibition of breast cancer cell proliferation and proposed that BAP1 acts as a tumor suppressor in the BRCA1 growth control pathway. BAP1 exhibits tumor suppressor activity in cancer cells, and somatic BAP1 mutations have been reported in some breast and lung cancers (Jensen D et al. (1998) Oncogene 16:1097-1112; and, Wood L D et al. (2007) Science 318:1108-13). BAP1 regulates cell proliferation by deubiquitinating host cell factor-1, a cell-cycle regulator critical for BAP1-mediated growth regulation.

The identification of germline BAP1 mutations in high-risk MM families indicates that genetic factors play a major role in malignant mesothelioma and susceptibility to carcinogenic mineral fibers and suggest that the BAP1 pathway represents a novel target for preventive and therapeutic intervention in MM. The presence of other tumor types (breast, ovarian, melanoma, pancreatic, renal) in the families reported here, and the existence of germline BAP1 mutations in some uveal melanoma patients (FIG. 1B), suggest the existence of a BAP1-related cancer syndrome, in which MM may predominate possibly when mutation carriers are exposed to carcinogenic fibers. A search of the 1000 Genomes Project database revealed 7 individuals with BAP1 mutations that could alter BAP1 function, providing rationale for mutation screening and appropriate preventive measures in certain high-risk individuals, e.g., asbestos workers and communities along roads paved with gravel containing asbestos or erionite, individuals living in homes containing asbestos, and other environments where individuals may encounter exposure to carcinogenic mineral fibers.

These results provide the first demonstration that genetics influences the risk of mesothelioma, a cancer linked to mineral fiber carcinogenesis. As observed for BRCA1 and BRCA2, which account for only some hereditary breast carcinomas, it appears likely that in addition to BAP1, more genes will be found associated with elevated risk of mesothelioma. Indeed, among the 26 sporadic mesotheliomas studied—and excluding malignancies common in the 6th-8th decades of life, such as skin and prostate carcinomas—nine had been diagnosed with one or more additional tumors (Table 1). Seven of 26 were females, and 2/7 also had uterine leiomyosarcoma, a malignancy with an incidence of ˜10/106 per year in the U.S.; one of them had also uveal melanoma, an unlikely coincidence.

Example 3

BAP1 Nonsense Mutation c.723T>G and Truncated BAP1 Protein

Materials and Methods. Patients with malignant mesothelioma, uveal melanoma, and other cancer types were diagnosed at multiple different treating hospitals. Informed consent was obtained from the proband according to institutional guidelines of the treating center. DNA was isolated from blood using standard techniques.

Nine PCR products that encompassed the entire BAP1 coding exons, adjacent intron sequences, and 50 and 30 untranslated regions were amplified for sequencing. Polymerase chain reaction (PCR) primer pairs that were used to amplify the BAP1 gene for sequencing had artificial sequences at the 50 end to facilitate sequencing (preT7 and T3).

PFU Turbo (Stratagene/Agilent, Santa Clara, Calif.) was used according to the manufacturer's recommended protocol with the following conditions: 95° C. for 2 minutes; 45 cycles of 95° C. 30 seconds, 65° C. 30 seconds, and 72° C. 2 minutes; 72° C. for 10 minutes. PCR products were gel purified and Sanger-sequenced. cDNA and protein mutation nomenclature standardized by the Human Genome Variation Society (HGVS http://www.hgvs.org/mutnomen) was used to describe the BAP1 mutations observed using accession no. NM004656 as a reference.

Results. The proband's family consists of a large extended family from Western Canada of English/Irish and German descent, with the proband currently residing in Nova Scotia, Canada. The family pedigree is shown in FIG. 8A. Sequence analysis of blood DNA from the proband, who was diagnosed with uveal melanoma at age 40, revealed a nonsense mutation, c.723T>G (electropherogram shown in FIG. 8B), which led to a truncation of the BAP1 protein, p.Y241*, or nonsensemediated decay of the BAP1 mRNA. The subject had no known environmental exposures. The proband's father and paternal uncle each had multiple cancers, with the father being diagnosed with malignant mesothelioma and cutaneous melanoma, and the uncle having had a history of cutaneous melanoma, uveal melanoma, and lung cancer. In addition, the proband's grandmother was diagnosed with cutaneous melanoma at age 33. DNA samples from these latter three individuals were not available for analysis, as they were all deceased.

The family is not related to other reported BAP1 cancer syndrome families. The particular germline mutation is located in the coding region of the BAP1 protein, near the proximal half of the protein, and the mutation is predicted to lead to nonsense-mediated decay of the mRNA or a protein truncation. The odds of diagnosing uveal melanoma, cutaneous melanoma, and lung cancer in the paternal uncle in the pedigree shown in FIG. 8A also seem rather remote and suggest that germline BAP1 mutations may predispose multiple target tissues to malignant transformation.

The germline BAP1 mutation (A insertion) reported by Harbour (Science 330:1410-3) in a patient with uveal melanoma also occurred in the C-terminus of the BAP1 protein. However, it is believed that uveal melanoma can also occur in individuals with BAP1 mutations that reside outside the C-terminal region. It is believed that the mutation location does not have any bearing on the spectrum of cancer types observed in BAP1 cancer syndrome families, either for uveal melanoma, malignant mesothelioma, or cutaneous melanoma/melanocytic lesions. It is believed that differences in environmental exposures (e.g., carcinogenic minerals such as asbestos and erionite, as well as sunlight, ultraviolet radiation and other carcinogens), modifier gene variants, and/or differences in tissue-specific microRNA (miRNA) variants/expression levels are responsible for the specific disease manifestation observed in a given member of a BAP1 cancer syndrome family. Thus, a BAP1 mutation carrier may be preferentially predisposed to develop malignant mesothelioma, instead of another tumor type, as a result of the mesothelial cell-specific miRNA-mediated silencing of the remaining wild-type BAP1 allele.

Example 4

Determination if Molecular Targeting of the BAP1 Pathway has Significant Efficacy in Human Malignant Mesothelioma Cells with BAP1 Loss

If somatic BAP1 mutations confers an advanced tumorigenic phenotype to malignant mesothelioma cells through alterations in chromatin structure and gene transcription, such mutations are believed to result in tumor cells that are more susceptible to specific inhibitors impinging on the downstream BAP1 signaling pathway. Preliminary studies have demonstrated increased activation of the mTOR signaling pathway following BAP1 knockdown in malignant mesothelioma (MM) cells that express BAP1. This finding suggests that BAP1-deficient MM cells might be more susceptible to mTOR inhibitors. Thus, combining HDAC and mTOR inhibitors should have an additive or synergistic effect on tumor growth, which will be tested. In addition, alterations in phospho-proteins and changes in mRNA expression will be ascertained using phospho-kinase antibody arrays and expression microarrays, respectively, after knocking down BAP1 in human malignant mesothelioma cell lines.

It is hypothesized that loss of expression of BAP1 will lead to changes in important downstream signaling pathways that may make affected tumor cells more sensitive to specific small molecule inhibitors. As such, it is believed that a histone deacetylase (HDAC) and mTOR inhibitor combination will have additive or synergistic effects in BAP1-null malignant mesothelioma cells. It is believed that there will be clinically informative alterations in phospho-protein levels and/or mRNA expression as a result of BAP1 knockdown, which can be exploited to identify important signaling components that may be targeted therapeutically.

Creation of BAP1 knockdown cells. Malignant mesothelioma cells with wild-type BAP1 expression were identified through a combination of genomic DNA sequencing and Western blot analysis. Specifically, MM cell lines Meso 8, Meso 17, NCI-H2052 and MSTO-211H will be used for BAP1 knockdown studies. Lentiviral particles expressing shRNA against BAP1 were created using pLKO.1 constructs designed by The RNAi Consortium (TRC) and distributed through Sigma-Aldrich. The viruses were created following the standard protocol described by TRC. BAP1-positive (+/+) MM cells were infected with shGFP or shBAP1 viruses for 24 hr, and then mass selected with puromycin for 7 days. Three shRNA clones, designated #70, #71 and #74, were found to have the highest efficiency of BAP1 knockdown when analyzed by immunoblotting (FIG. 9A). Knockdown of BAP1 caused the MM cells to grow with a less “flattened” phenotype, an indication of possible changes in tumorigenic (e.g., stem-like) potential.

In vitro analysis of drug susceptibility. Short-term cultures of malignant mesothelioma cells stably expressing BAP1 shRNA will be used for testing drug sensitivity. A dual PI3K/mTOR inhibitor, GDC0980, developed by Genentech and obtained through Selleck Chemicals will be used. A phase 1 clinical trial demonstrated that this drug had anti-tumor effects in 3 MM patients. Whether the increased mTOR signaling observed in MM cells expressing BAP1 shRNA (FIG. 9B) will lead to increased sensitivity to GDC0980 will be tested. The efficacy of the HDAC inhibitor, vorinostat (Sigma-Aldrich), will also be tested on these same cell lines by comparing their sensitivity to MM cells infected with an shGFP control lentivirus.

Cells will be plated in replicates of 4 onto 96-well plates. The next day, the cells will be treated with increasing concentrations (5 nM to 10 μM) of either GDC0980 or vorinostat. After 4 days, cell viability and IC50 will be determined using MTS assays. In a parallel experiment, cell lysates will be collected at the same time point as for the MTS assay, and knockdown of BAP1 expression, phospho-S6 levels, and acetylated-histone H3 levels will be verified by immunoblotting.

The effect of combining the two drugs experimentally will be evaluated statistically after obtaining data to generate isobolograms to determine if these drug combinations have an additive or synergistic effect in the preclinical setting. The effectiveness of these two drugs in short term cultures of MM cells derived from ascites or tumors of Bap1-mutant mice will then be tested. In addition to MTS assays, the effectiveness of the single drugs and drug combination on apoptosis, cell cycle progression and invasiveness, will be assessed using standard assays (TUNEL, flow cytometry and Matrigel, respectively).

Analysis of altered signaling pathways and mRNA expression caused by BAP1 knockdown. Human phospho-kinase antibody arrays (R&D) will be used to detect changes in phosphorylated signaling proteins important in tumorigenesis that are associated with knockdown of BAP1 expression. For example, the arrays allow the simultaneous identification of changes in the phosphorylation status of AKT, p70 S6 kinase, ERK1/2, Src and FAK. Lysates from short-term cultures of three different BAP1-positive MM cells (MSTO-211H, Meso 17, NCI-H2052) stably expressing BAP1 shRNA (shGFP control vs shBAP1 #74) will be isolated and used to probe the arrays following the manufacturer's instructions. Changes in phosphorylation levels of proteins due to BAP1 knockdown will be confirmed using Western blots and antibodies specific for each phospho-protein. mRNA isolated from these same short term cultures will be used to identify differentially expressed genes associated with BAP1 knockdown, using Affymetrix expression arrays (U133 Plus 2.0). Expression changes of potentially interesting, differentially-regulated genes will be confirmed using real-time RT-PCR and Western blot analysis. Confirmed candidate phospho-protein and/or gene expression changes will be pursued as possible targets for small molecule inhibitors.

The two drugs proposed in this Example may not act synergistically. However, a large library of clinically relevant small molecule inhibitors in an in-house facility can be screened to identify other potential lead compounds that might have efficacy, either alone or in combination, in BAP1-deficient MM cells. Moreover, it was observed that an inhibitor (Inhibitor ‘A’) of proteins involved in the epigenetic histone codes, is differentially effective in inhibiting MM cells upon knockdown of BAP1 (FIG. 9C). Thus, if GDC0980 does not synergize with HDAC inhibition, other combinations may be tested, including ‘Inhibitor A’ and vorinistat.

The invention is not limited to the embodiments described and exemplified above, but is capable of variation and modification within the scope of the appended claims.

Claims

We claim:

1. A system for determining a predisposition to develop BAP1 cancer syndrome, comprising: a data structure comprising one or more BRCA1 associated protein 1 (BAP1) germline nucleic acid sequences having one or more alterations in the germline nucleic acid sequence indicative of a predisposition to develop BAP1 cancer syndrome, provided that the one or more alterations exclude the insertion of an A between nucleotides 52,437,842 and 52,437,843 of human chromosome 3; one or more BAP1 germline nucleic acid sequences that do not have the one or more alterations; and a processor programmed to compare sequences of nucleic acids encoding BAP1 obtained from a human being with the BAP1 germline nucleic acid sequences in the data structure.

2. The system of claim 1, wherein the one or more alterations encode a truncated BAP1 protein or result in nonsense-mediated decay of BAP1-encoding mRNA transcribed from the altered germline nucleic acid sequence.

3. The system of claim 1, wherein the one or more alterations are located at the BAP1 locus in in human chromosome segment 3p21.1.

4. The system of claim 1, wherein one or more alterations are selected from the group consisting of a C to T substitution in Exon 16 of the BAP1 gene, an A to G substitution two nucleotides upstream of the 3′ end of Intron 6 of the BAP1 gene, a deletion of five nucleotides from and a substitution of one nucleotide at the 3′ end of Exon 3 of the BAP1 gene, a deletion of twenty five nucleotides in Exon 4 of the BAP1 gene, a deletion of a C in Exon 13 of the BAP1 gene, a deletion of four nucleotides from Exon 14 of the BAP1 gene, a T to G substitution in Exon 9 of the BAP1 gene, and a deletion of a T in Exon 4 of the BAP1 gene.

5. The system of claim 4, wherein the C to T substitution at Exon 16 occurs in the germline nucleic acid sequence at location corresponding to position 52,436,624 of human chromosome 3.

6. The system of claim 4, wherein the A to G substitution occurs at a location in the germline nucleic acid sequence at a location corresponding to position 52,441,334 of human chromosome 3.

7. The system of claim 4, wherein the deletion of five nucleotides occurs in the germline nucleic acid sequence at a location corresponding to positions 52,443,570 to 52,443,574 of human chromosome 3, and the substitution of one nucleotide in the 3′ end of Exon 3 is a G to A substitution and occurs in the germline nucleic acid sequence at a location corresponding to position 52,443,575 of human chromosome 3.

8. The system of claim 4, wherein the deletion of twenty five nucleotides in Exon 4 occurs in the germline nucleic acid sequence at a location corresponding to positions 52,442,507 to 52,442,531 of human chromosome 3.

9. The system of claim 4, wherein the deletion of a C in Exon 13 occurs in the germline nucleic acid sequence at a location corresponding to position 52,437,444 of human chromosome 3.

10. The system of claim 4, wherein the deletion of four nucleotides from Exon 14 occurs in the germline nucleic acid sequence at a location corresponding to positions 52,437,159 to 52,437,162 of human chromosome 3.

11. The system of claim 4, wherein the T to G substitution occurs in the germline nucleic acid sequence at a location corresponding to position 52,440,329 of human chromosome 3.

12. The system of claim 4, wherein the deletion of a T in Exon 4 occurs in the germline nucleic acid sequence at a location corresponding to position 52,442,605 of human chromosome 3.

13. The system of claim 1, wherein the BAP1 cancer syndrome includes one or more of malignant mesothelioma, uveal melanoma, and cutaneous melanoma.

14. The system of claim 1, further comprising a computer network connection.

15. The system of claim 1, further comprising a sequencer for determining the sequence of the nucleic acids encoding BAP1 obtained from the subject.

16. The system of claim 1, further comprising an output for providing results of the comparison to a user.

17. The system of claim 1, wherein the germline nucleic acid sequences comprise genomic DNA, mRNA, or a cDNA obtained from mRNA.

18. The system of claim 1, further comprising executable code for causing the processor to calculate a risk score the human subject to develop one or more of malignant mesothelioma, breast cancer, ovarian cancer, pancreatic cancer, kidney cancer, cutaneous melanoma, or uveal melanoma based on a comparison of sequences of nucleic acids encoding BAP1 obtained from the subject with the BAP1 germline nucleic acid sequences in the data structure.

19. A method for identifying an alteration in the germline BRCA1 associated protein 1 (BAP1) nucleic acid sequence that predisposes a subject having the alteration to develop BAP1 cancer syndrome, comprising:

(a) determining the sequence of a nucleic acid encoding BAP1 in a tissue sample obtained from a human subject;

(b) entering the determined sequence from step (a) into the system of claim 1;

(c) causing the processor of the system to compare the determined sequence from step (a) with one or more of the BAP1 germline nucleic acid sequences in the data structure; and

(d) determining whether the determined sequence from step (a) has the alteration based on the comparison from step (c).

20. The method of claim 19, wherein the BAP1 cancer syndrome includes one or more of malignant mesothelioma, uveal melanoma, and cutaneous melanoma.

21. A method for determining whether a subject has a predisposition to develop BAP1 cancer syndrome, comprising:

(a) determining the sequence of a nucleic acid encoding BAP1 in a tissue sample obtained from a human subject;

(b) entering the determined sequence from step (a) into the system of claim 1;

(c) causing the processor of the system to compare determined sequence from step (a) with one or more of the BAP1 germline nucleic acid sequences in the data structure;

(d) determining whether the determined sequence from step (a) has one or more alterations in the BAP1 germline nucleic acid sequence indicative of a predisposition to develop BAP1 cancer syndrome based on the comparison from step (c); and optionally

(e) treating the subject with a treatment regimen capable of inhibiting development of BAP1 cancer syndrome, wherein the treatment regimen comprises one or more of administering to the subject an effective mount of BAP1 protein, reducing exposure of the subject to carcinogenic mineral fibers, and reducing exposure of the subject to ultraviolet radiation.

22. The method of claim 21, wherein the BAP1 cancer syndrome includes one or more of malignant mesothelioma, uveal melanoma, and cutaneous melanoma.