US20140013466A1
2014-01-09
13/917,465
2013-06-13
ETP1 and ETP2 bind to EIN2 and modulate plant ethylene sensitivity.
Get notified when new applications in this technology area are published.
C12N15/82 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
The present patent application claims benefit of priority to U.S. Provisional Patent Application No. 61/162,469, filed Mar. 23, 2009, and U.S. patent application Ser. No. 12/729,760 filed Mar. 23, 2010, both of which are incorporated by reference.
In plants, ethylene (C2H4) is a regulator of various physiological and morphological responses, including inhibition of cell expansion, promotion of leaf and flower senescence, induction of fruit ripening and abscission, resistance to pathogen infection, and adaptation to stress conditions (Bleecker, A. B. and Kende, H., Annu. Rev. Cell. Dev. Biol., 16:1-18 (2000); Guo, H. and Ecker, J. R., Curr. Opin. Plant. Biol., 7:40-49 (2004)). The molecular dissection of ethylene signal transduction began with genetic screens based on the well-documented triple response phenotype of ethylene-treated etiolated Arabidopsis seedlings. Through these screens, many ethylene mutants have been obtained, including the ethylene insensitive mutants etr1, ein2, ein3, ein2 (Bleecker, A. B. et al., Science, 241:1086-1089 (1988); Guzman, P. and Ecker, J. R., Plant Cell, 2:513-523 (1990); Roman, G. et al., Genetics, 139:1393-1409 (1995)); the ethylene overproducing mutants eto1, eto2, eto3, and the ethylene constitutive response mutant ctr1 (Guzman, P. and Ecker, J. R., Plant Cell, 2:513-523 (1990); Kieber, J. J. et al., Cell, 72:427-441 (1993)). Initial studies of these mutants have revealed a mostly linear framework for the ethylene-signaling pathway, leading from ethylene perception at the membrane to transcriptional activation in the nucleus (Stepanova, A. N. and Ecker, J. R., Curr. Opin. Plant. Biol., 3:353-360 (2000); Chen, Y. F. et al., J. Biol. Chem., 277:19861-19866 (2002); Guo, H. and Ecker, J. R., Curr. Opin. Plant. Biol., 7:40-49 (2004)).
Ethylene is perceived by a family of membrane bound, endoplasmic reticulum-located receptors ETHYLENE RESPONSE1 (ETR1), ETHYLENE RESPONSE SENSOR1 (ERS1), ETHYLENE RESPONSE2 (ETR2), ETHYLENE INSENSITIVE4 (EIN4), and ETHYLENE RESPONSE SENSOR2 (ERS2), which are similar in sequence and structure to bacterial two-component histidine kinases (Chang, C. et al., Science, 262:539-544 (1993); Hua, J. et al., Plant Cell, 10:1321-1332 (1998); Kendrick, M. D. and Chang, C., Curr. Opin. Plant. Biol., 11:479-485 (2008)). Each receptor has an N-terminal membrane-spanning domain that binds ethylene with a copper cofactor provided by the RESPONSIVE TO ANTAGONIST1 (RAN1) copper transporter (Hirayama, T. et al., Cell, 97:383-393 (1999)). Briefly, in the absence of ethylene gas, the ethylene receptors repress downstream responses through interaction with CONSTITUTIVE TRIPLE RESPONSE1 (CTR1) (Gao, Z. et al., J. Biol. Chem., 278:34725-34732 (2003)), which is a member of Raf kinase family that also acts as a negative regulator of the downstream ethylene signaling pathway (Kieber, J. J. et al., Cell, 72:427-441 (1993)). In the presence of ethylene, the receptors stop repressing ethylene response through inactivation of CTR1. Additionally, EIN2 is de-repressed and positively regulates the levels of ETHYLENE INSENSITIVE3 (EIN3) and ETHYLENE INSENSITIVE3-LIKE1 (EIL1) the key transcription factors of ethylene signaling pathway, which results in the activation of transcription of ethylene responsive genes (Chao, Q. et al., Cell, 89:1133-1144 (1997); Solano, R. et al., Genes & Dev., 12:3703-3714 (1998)). Recently, numerous studies have expanded the linear view of ethylene signaling pathway. For instance, a new protein, REVERSION-TO-ETHYLENE SENSITIVITY) (RTE)), which is co-localized with the ethylene receptor ETR1, was identified as a positive regulator of ETR1 function, but the connection between RTE1 and ETR1 is still under investigation (Resnick, J. S. et al., Proc. Natl. Acad. Sci. U.S.A., 103:7917-7922 (2006); Solano, R. et al., Genes & Dev., 12:3703-3714 (1998); Dong, C. H. et al., Plant J., 53:275-286 (2008)). Additionally, a number of groups found that posttranscriptional regulation of protein levels is a key mechanism of modulating EIN3 activity by ethylene. Specifically, they found that ubiquitin/proteasome-mediated degradation negatively regulates ethylene responses by targeting EIN3 for turnover through two F-box proteins EIN3-BINDING F BOX PROTEIN) (EBF1) and EIN3-BINDING F BOX PROTEIN2 (EBF2) (Guo, H. and Ecker, J. R., Cell, 115:667-677 (2003); Potuschak, T. et al., Cell, 115:679-689 (2003); Gagne, J. M. et al., Proc. Natl. Acad. Sci. U.S.A., 101:6803-6808 (2004)). Interestingly, negative feedback regulation exists in this step of the ethylene signal-transduction pathway, in that EIN3 targets the promoter of EBF2 to control its expression level likely allowing fine-tuning of ethylene responses (Binder, B. M. et al., Plant Cell, 19:509-523 (2007); Konishi, M. and Yanagisawa, S., Plant J., 55:821-831 (2008)). Most recently, an alternative ethylene signaling pathway has been proposed that is based on studies of ethylene responses in Arabidopsis protoplasts (Varma Penmetsa, R. et al., Plant J., 55:580-595 (2008); Yoo, S. D. et al., Nature, 451:789-795 (2008)). Characterization of these genes/proteins has provided additional insight into the molecular mechanisms that may underlie the response of plants to ethylene gas.
EIN2 is an integral membrane protein with limited similarity in the N-terminus to mammalian NRAMP metal transporters, the <850 amino acid C-terminus of EIN2 is conserved in all the known EIN2 homologs of angiosperms (Varma Penmetsa, R. et al., Plant J., 55:580-595 (2008)). Interestingly, expression of a portion of the C-terminus (EIN2-CEND) is sufficient to constitutively activate ethylene and stress responses both in Arabidopsis (Alonso, J. M. et al., Science, 284:2148-2152 (1999)) and in Medicago (Mt) (Varma Penmetsa, R. et al., Plant J., 55:580-595 (2008)). Phenotypic, epistatic and biochemical analyses place EIN2 in a central position in ethylene signaling pathway (Roman, G. et al., Genetics, 139:1393-1409 (1995); Johnson, P. R. and Ecker, J. R., Annu. Rev. Genet., 32:227-254 (1998); Guo, H. and Ecker, J. R., Cell, 115:667-677 (2003)).
The present invention provides for transgenic plants with altered ethylene sensitivity. In some embodiments, the plants can have one or more expression cassette that results in ectopic or increased expression of an ETP1 or ETP2 polypeptide comprising an expression cassette. Expression of ETP1 or ETP2 will result in plants with reduced sensitivity to ethylene. Alternatively, in some embodiments, the invention will involve a plant with one or more expression cassettes which express a polynucleotide that reduced expression of an endogenous ETP1 and/or ETP2 polypeptide. For example, the expression cassette can express an siRNA, microRNA, antisense or sense construct, or a combination thereof (e.g., to form a dsRNA), such that endogenous ETP1 and/or ETP2 polypeptide expression is reduced or suppressed.
Accordingly, in some embodiments, the invention provides a plant comprising a heterologous recombinant expression cassette, wherein the plant has altered sensitivity to ethylene compared to a control plant lacking the expression cassette, the expression cassette comprising a promoter operably linked to a polynucleotide, which polynucleotide, when expressed, modulates expression of an ETP1 or ETP2 polypeptide, wherein modulated expression of the ETP1 or ETP2 polypeptide results in altered ethylene sensitivity.
In some embodiments, expression of the ETP1 and/or ETP2 polypeptide is increased compared to a control plant lacking the expression cassette, wherein the plant has reduced ethylene sensitivity compared to the control plant. In some embodiments, the polynucleotide encodes a polypeptide comprising an amino acid sequence substantially identical (e.g., at least 80%, 85%, 90%, 95% or 100% identical) to any of SEQ ID NOS:1-8 or 18-22.
In some embodiments, expression of the ETP1 and/or ETP2 polypeptide is decreased compared to a control plant lacking the expression cassette, wherein the plant has increased ethylene sensitivity compared to the control plant. In some embodiments, the polynucleotide comprises at least 20 (e.g., at least 50, 100, or 200) contiguous nucleotides, or the complement thereof, of a nucleic acid encoding any of SEQ ID NOS:1-8 or 18-22, such that expression of the polynucleotide inhibits expression of an endogenous ETP1 or ETP2 gene. In some embodiments, the polynucleotide comprises a sequence at least 80% identical to at least 100 contiguous nucleotides, or the complement thereof, of a nucleic acid encoding any of SEQ ID NOS:1-8 or 18-22. In some embodiments, the endogenous ETP1 or ETP2 gene encodes a polypeptide at least 80% identical to any of SEQ ID NOS:1-8 or 18-22, respectively. In some embodiments, the sequence is at least 95% identical to at least 100 contiguous nucleotides encoding any of SEQ ID NOS:1-8 or 18-22. In some embodiments, the sequence is 100% identical to at least 100 contiguous nucleotides encoding any of SEQ ID NOS:1-8 or 18-22. In some embodiments, the polynucleotide encodes an siRNA, antisense polynucleotide, a microRNA, or a sense suppression nucleic acid, thereby suppressing expression of an endogenous ETP1 or ETP2 protein. In some embodiments, the plant comprises at least two heterologous expression cassettes wherein expression from one expression cassette inhibits expression of an endogenous ETP1 and expression from a second expression cassette inhibits expression of an endogenous ETP2 gene.
The present invention also provides a method of making a plant as described above or elsewhere herein. In some embodiments, the method comprises introducing the expression cassette into a plurality of plants; and selecting a plant that expresses the polynucleotide from the plurality of plants. In some embodiments, the selecting step comprising selecting a plant that has altered ethylene sensitivity.
The present invention also provides a recombinant expression cassette comprising a promoter operably linked to a polynucleotide, which polynucleotide, when expressed in a plant, modulates expression of an endogenous ETP1 or ETP2 gene.
In some embodiments, expression of ETP1 and/or ETP2 is increased when the expression cassette is introduced into a plant compared to a control plant lacking the expression cassette, and wherein the promoter is heterologous to the polynucleotide. In some embodiments, the polynucleotide encodes a polypeptide substantially identical to any of SEQ ID NOS:1-8 or 18-22.
In some embodiments, expression of ETP1 and/or ETP2 is decreased when the expression cassette is introduced into a plant compared to a control plant lacking the expression cassette, and wherein the promoter is heterologous to the polynucleotide. In some embodiments, the polynucleotide comprises at least 20 (e.g., at least 50, 100, or 200) contiguous nucleotides, or the complement thereof, of a nucleic acid encoding any of SEQ ID NOS:1-8 or 18-22, such that expression of the polynucleotide inhibits expression of an endogenous ETP1 or ETP2 gene. In some embodiments, the endogenous ETP1 or ETP2 gene encodes a polypeptide at least 80% identical to any of SEQ ID NOS:1-8 or 18-22, respectively. In some embodiments, the polynucleotide comprises a sequence at least 80% identical to at least 100 contiguous nucleotides, or the complement thereof, of a nucleic acid encoding any of SEQ ID NOS:1-8 or 18-22. In some embodiments, the sequence is at least 95% identical to at least 100 contiguous nucleotides encoding any of SEQ ID NOS:1-8 or 18-22. In some embodiments, the sequence is 100% identical to at least 100 nucleotides encoding any of SEQ ID NOS:1-8 or 18-22.
The present invention also provides methods of identifying an agent that modulates the interaction of an ETP1 or ETP2-binding fragment of an EIN2 protein to ETP1 or ETP2. In some embodiments, the method comprises contacting a plurality of agents to the fragment in the presence of an ETP1 or ETP2 polypeptide under conditions such that the fragment would bind to the ETP1 or ETP2 polypeptide in the absence of the agents; determining whether the contacting step modulates binding of the fragment to the ETP1 or ETP2 polypeptide compared to the absence of the agents; and selecting an agent that modulates the interaction of an ETP1 or ETP2-binding fragment of an EIN2 protein to ETP1 or ETP2. In some embodiments, the ETP1 or ETP2 polypeptide is at least 80% identical to an of SEQ ID NOS:1-8 or 18-22. In some embodiments, the fragment comprises a polypeptide at least 80% (e.g., at least 95% or 100%) identical to amino acids 1047-1294 of Arabidopsis EIN2. In some embodiments, the method further comprises contacting the selected agent to a plant and determining the effect of the agent on an ethylene-effected phenotype. In some embodiments, the contacting step is performed as part of a yeast two-hybrid assay
Other inventions provided herein will be clear upon review of the rest of the specification and claims.
The term âpromoterâ or âregulatory elementâ refers to a region or sequence determinants located upstream or downstream from the start of transcription and which are involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. Promoters need not be of plant origin, for example, promoters derived from plant viruses, such as the CaMV35S promoter, can be used in the present invention.
The term âplantâ includes whole plants, shoot vegetative organs/structures (e.g. leaves, stems and tubers), roots, flowers and floral organs/structures (e.g. bracts, sepals, petals, stamens, carpels, anthers and ovules), seed (including embryo, endosperm, and seed coat) and fruit (the mature ovary), plant tissue (e.g. vascular tissue, ground tissue, and the like) and cells (e.g. guard cells, egg cells, trichomes and the like), and progeny of same. The class of plants that can be used in the method of the invention is generally as broad as the class of higher and lower plants amenable to transformation techniques, including angiosperms (monocotyledonous and dicotyledonous plants), gymnosperms, ferns, and multicellular algae. It includes plants of a variety of ploidy levels, including aneuploid, polyploid, diploid, haploid and hemizygous.
A polynucleotide sequence is âheterologous toâ a second polynucleotide sequence if it originates from a foreign species, or, if from the same species, is modified by human action from its original form. For example, a promoter operably linked to a heterologous coding sequence refers to a coding sequence from a species different from that from which the promoter was derived, or, if from the same species, a coding sequence which is different from naturally occurring allelic variants.
An âexpression cassetteâ refers to a nucleic acid construct, which when introduced into a host cell, results in transcription and/or translation of a RNA or polypeptide, respectively. Antisense constructs or sense constructs that are not or cannot be translated are expressly included by this definition.
An âETP1 or ETP2 polypeptideâ is a polypeptide substantially identical to any of SEQ ID NOs: 1-8 or 18-22, polypeptides encoded by Genbank Accession numbers 02g54240 (rice), E00121008 FBA3 (poplar), G125000065N (poplar), or ABD32500 (Medicago), or as otherwise described herein. ETP1 and ETP2 polypeptides are F-box proteins that bind to the C-terminal region of an EIN2 polypeptide, e.g., as described herein in a yeast two-hybrid assay. F-box proteins comprise an approximately 40-50 amino acid conserved F-box motif. See, e.g., Kipreos, et al., Genome Biol. 1:5 (2000) generally, and Figure 1 of Kipreos in particular.
An âEIN2 polypeptideâ is a polypeptide substantially identical to the Arabidopsis EIN2 polypeptide or an ortholog thereof.
The âethylene responseâ refers to a plant trait that is mediated by ethylene gas, including but not limited to germination, flower and leaf senescence, fruit ripening, fruit drop, leaf abscission, root nodulation, programmed cell death, responsiveness to stress, responsiveness to pathogen attack, and the âtriple responseâ of etiolated dicotyledoneous seedlings (e.g., inhibition of hypocotyl and root cell elongation, radial swelling of the hypocotyl, and exaggerated curvature of the apical hook). Ethylene causes developmental changes that result in fruit ripening. New enzymes are made because of the ethylene signal. These include hydrolases to facilitate break down of fruit components, amylases to accelerate hydrolysis of starch into sugar, pectinases to catalyze degradation of pectin, and so on. Ethylene increases the transcription of genes that are then transcribed and translated to make these enzymes. The enzymes then catalyze reactions to alter the characteristics of the fruit. Enzymes produced as a result of exposure to ethylene facilitate the ripening responses. Chlorophyll is broken down and sometimes new pigments are made so that the fruit skin changes color from green to red, yellow, or blue. Acids are broken down so that the fruit changes from sour to neutral. The degradation of starch by amylase produces sugar. This reduces the mealy (floury) quality and increases juiciness of the fruit. The breakdown of pectin by pectinase results in a softer fruit. Enzymes also break down large organic molecules into volatile smaller molecules which are detected as an aroma.
Fruit drop is related to fruit ripening. The fruit-ripening process described above, also occurs in a layer of cells in the pedicel near the point of attachment to the stem of the plant. This layer of cells in the pedicel is often called the abscission zone because this layer will eventually separate and the fruit will drop from the plant. The cells in this cross sectional layer in the pedicel receive the ethylene signal from the ripening fruit. Reception of the signal results in the production of new enzymes. The cells âripenâ and pectinases attack the cells of the abscission zone. When the cell connection have been sufficiently weakened, the weight of the fruit will cause it to fall from the plant.
Plant senescence is a genetically programmed process; it is the last phase of plant development and ultimately leads to death. Plant hormones such as ethylene and cytokinins play roles in the regulation of senescence.
One of skill in the art will appreciate that one can test for ethylene sensitivity in a plant in many ways. Increased or decreased ethylene sensitivity is determined in a plant comprising an expression cassette âcompared to a control plant lacking the expression cassette.â The control plant will be of the same species and will generally be isogenic compared to the plant comprising the expression cassette except for the absence of the expression cassette.
Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Add. APL. Math. 2:482 (1981), by the homology alignment algorithm of Needle man and Wunsch J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson and Lipman Proc. Natl. Acad. Sci. (U.S.A.) 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis.), or by inspection.
âPercentage of sequence identityâ is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
The term âsubstantial identityâ of polypeptide sequences means that a polypeptide comprises a sequence that has at least 25% sequence identity. Alternatively, percent identity can be any integer from 25% to 100%. Exemplary embodiments include at least: 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%. compared to a reference sequence using the programs described herein; preferably BLAST using standard parameters, as described below. Accordingly, ETP sequences of the invention include nucleic acid sequences encoding a polypeptide that has substantial identity to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8. ETP sequences of the invention also include polypeptide sequences having substantial identify to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8. One of skill will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning and the like. Polypeptides which are âsubstantially similarâ share sequences as noted above except that residue positions which are not identical may differ by conservative amino acid changes. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, aspartic acid-glutamic acid, and asparagine-glutamine.
Another indication that nucleotide sequences are substantially identical is if two molecules hybridize to each other, or a third nucleic acid, under stringent conditions. Stringent conditions are sequence dependent and will be different in different circumstances. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Typically, stringent conditions will be those in which the salt concentration is about 0.02 molar at pH 7 and the temperature is at least about 60° C.
The term âisolatedâ, when applied to a nucleic acid or protein, denotes that the nucleic acid or protein is essentially free of other cellular components with which it is associated in the natural state. It can be, for example, in a homogeneous state and may be in either a dry or aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein that is the predominant species present in a preparation is substantially purified.
FIG. 1. EIN2 is a short-lived protein whose accumulation is essential for ethylene responses. (A) EIN2 is a short half-life protein. Etiolated wild-type Col-0 seedlings grown in air supplied in the presence of 100 ÎŒM cyclohexamide (CHX) for different amounts of time. Total protein lysates were subjected to immunoblotting with EIN2 anti-serum. Coomassie blue staining of total membrane proteins was used as a lane loading control. (B) The protein level of EIN2 is stabilized by specific proteasome inhibitors. Total membrane protein extracts were derived from wild-type Col-0 etiolated seedlings treated with mock (1% DMSO), MG132 (50 ÎŒM), MG115 (50 ÎŒM) for one hour or 4 hrs, and used for immunoblot assays. (C) EIN2 accumulation is abolished by Ag+ treatment. Etiolated wild-type seedlings were grown on MS media without or with 100 ÎŒM AgNO3 for 3 days and treated with air or ethylene for the indicated amount of time. (D) EIN2 protein level is impaired in etr1-1 mutant seedlings and constitutively accumulates in ctr1-1 mutant seedlings. Wild-type Col-0, ctr1-1, etr1-1 and ein3-1eil1-1 mutant etiolated seedlings were grown on MS media in air for 3 days and subsequently treated with ethylene gas for the indicated amount of time. Western blotting using an anti-H+-ATPase antibody was used as a lane loading control.
FIG. 2. Two novel F-box proteins, ETP1 (EIN2 TARGETING PROTEIN1âSEQ ID NO:1) and ETP2 (EIN2 TARGETING PROTEIN2âSEQ ID NO:2) interact with EIN2-CEND (EIN2-C). (A) Alignment of ETP1 and ETP2 amino acid sequences generated with the ClustalW program. The positions of amino acid residues are indicated with numbers; asterisks and dots indicate identical and conserved amino acids, respectively. The putative F-box motif and the FBAâ1 (F-box protein associated) domain are indicated by arrow above the sequences (B) EIN2-CEND interact with ETP1 and ETP2 in yeast. Growth on selective plates lacking adenine, histidine, tryptophan with 20 mM 3-AT (âLeu, âTrp, âHis, +3AT) and on control plates lacking only tryptophan and leucine (âTrp, âLeu) is shown. (C) EIN2 interacts with ETP1 and ETP2 in vitro. GST-EIN2-CEND (GST-EIN2-C) fusion protein and GST alone protein were purified from E. coli. These proteins, as well as GST alone were assayed to pull-down with in vitro translated and HA-tagged ETP1 and ETP2 proteins. The same quantities of the GST fusion proteins (lower panel) and the same amount of HA tagged ETP1 or ETP2 (middle panel) were used as inputs. The HA-tagged ETP1 and ETP2 were detected by anti-HA antibody (upper panel). â+â indicates the addition of protein; âââ indicates the protein was not added. (D) EIN2 highly conserved CEND (EIN2-05) is sufficient to interact with ETP1 and ETP2 in yeast. The diagrams indicate different deletions of EIN2 CEND. â+â indicates interaction; âââ indicates no interaction. WB: western-blot.
FIG. 3. ETP1 and ETP2 are regulators of EIN2 levels. (A) qPCR analysis of ETP1 and ETP2 transcript levels in amiR-ETP1/ETP2 mutant plants. Total RNA was extracted from the leaves of 3-week-old light-grown plants. The data were normalized to the corresponding actin (input) controls. The data shown are the means±SD of three independent experiments. (B) EIN2 protein accumulates in amiR-ETP1/ETP2 mutant plants. (C) MYC-ETP1 or ETP2 accumulates in 35S::MYC-ETP1 or MYC-ETP2 transgenic plants, respectively. Wild-type Col-0 Arabidopsis plants were transformed with a binary vector carrying the MYC tag that fused with ETP1 or ETP2 open reading frame. Total proteins from 35S::MYC-ETP1 or MYC-ETP2 transgenic plants were subjected to immunoblotting with anti-MYC antibody. The same membranes were stripped and subjected to immunoblotting with an anti-tubulin antibody as loading control. (D) Overexpression of ETP2 causes reduction of EIN2 protein. Wild-type Col-0, and ETP2 overexpression plants grown on soil for 3 weeks and the total protein lysates from leaves were subjected to immunoblotting with EIN2 anti-serum. The same membrane was stripped and subjected to immunoblotting with an anti-H+-ATPase antibody as a lane loading control.
FIG. 4. Constitutive ethylene response phenotypes ETP1 or ETP2 knockdown plants support a function in ethylene signaling. (A) Ethylene response phenotype of 3-day-old etiolated seedlings of amiR-ETP1/ETP2 plants. The plants were grown on MS media supplied with (left panel) or without (right panel) 10 ΌM ACC in dark for 3 days. (B) Measurement of hypocotyl length of amiR-ETP1/ETP2 3-day-old etiolated seedlings. Each measurement is the average length (mean±standard error) of >10 hypocotyls. (C) Phenotype of five-week-old amiR-ETP1/ETP2 plants grown on soil. (D) amiR-ETP1/ETP2 mutant plants flower and silique morphology. The plants were grown on soil with 16 hours light and 8 hours dark, the flowers and siliques were photographed for 8-week-old plants or 10-week-old plants.
FIG. 5. Ethylene insensitive phenotypes ETP1 or ETP2 overexpression plants suggest a function in ethylene signaling. Phenotypes of 3-day-old etiolated seedlings over-expressing ETP1 (A) or ETP2 (C). Seedlings were grown on MS media supplemented without (upper panel) or with 10 ΌM ACC (lower panel) in dark for 3 days. Measurement of hypocotyl and root length for etiolated seedlings over-expressing ETP1 (B) or ETP2 (D). 3-day-old etiolated seedlings grown on the MS media supplemented with or without 10 ΌM ACC. Each measurement is the average length (mean±standard error) of >20 hypocotyls or roots.
FIG. 6. Ethylene plays a negative role in ETP1 and ETP2 protein expression. (A) Protein levels of MYC-ETP1 (upper panel) and MYC-ETP2 (lower panel) after various times of ethylene treatment. The total protein extracts were subjected to immunoblotting with anti-MYC antibody. The same membranes were stripped and re-probed with an anti-tubulin antibody. (B) The interaction of ETP1 and EIN2 is affected by ethylene. Total protein extracts from 35S::MYC-ETP1 transgenic plants with or without ethylene treatment were incubated with equal excessive amounts of 35S-methionine labeled EIN2-C2 protein from in vitro transcriptional/translational system, and subsequently immunoprecipitated with an anti-MYC antibody. The EIN2-C235S was detected by autoradiography. WB: western blot.
FIG. 7. The effect of ethylene on EIN2 protein accumulation. The abundance of EIN2 protein correlates with the triple response. Etiolated wild-type seedlings (Col-0) were grown on MS medium supplemented with 10 ÎŒM ACC or 10 ÎŒM AVG for 3 days. Total membrane protein extracts were subjected to immunoblot with EIN2 antiserum. H+-ATPase was used as a lane loading control.
FIG. 8. The most conserved domain of EIN2 is essential for the interaction of EIN2 and ETP1/ETP2. (A) Yeast strains which carried different combination of constructs (as indicated) were grown in SDâLeu/âTrp liquid medium overnight and subjected to SDâleu/âTrp/âHis/+3AT (20 mM) selective medium by the indicated start titer (OD600). (B) Expression of truncated forms of EIN2 protein in yeast. Yeast strains which carried different truncations of EIN2 and ETP1 or ETP2 were cultured in SDâLeu/âTrp liquid medium overnight and total protein lysates were separated by PAGE and subjected to blotting using anti-GAL4 DNA-binding domain (DB) antibody. The EIN2:GAL4 fusion proteins tested are indicated, Coomassie blue staining was used as a lane loading control.
FIG. 9. The alignment of EIN2 from different plant species (SEQ ID NOS:9-15). Alignment of EIN2 amino acid sequences from different species generated with the ClustalW program. The positions of amino acid residues are indicated with numbers; asterisks and dots indicate identical and conserved amino acids, respectively.
FIG. 10. Mutation of ETP1 Leads to Slightly Hypersensitive to Ethylene Phenotype. (A) Schematic representation of T-DNA insertions in the related F-box genes ETP1 and ETP2, respectively. Coding regions are indicated by boxes and non-coding regions are indicated by lines. F-box and FBAâ1 domains are colored yellow and green, respectively. A triangle represents a T-DNA insertion event and the positions are indicated. (B-C) Hypocotyl length measurement of etp1 and etp2 mutants. 3-day-old etiolated seedlings were grown on MS medium supplemented with or without 10 ÎŒM ACC. Each measurement is the average length (mean±standard error) of >20 hypocotyls. (D) ACC dosage response of etp1 and etp2 mutants. Etiolated seedlings were grown on MS medium supplemented with the indicated amount of ACC. Each measurement is the average length (mean±standard error) of >20 hypocotyls.
FIG. 11. EIN2 protein accumulates in amiR-ETP1/ETP2 mutant plants. Anti-EIN2 antibody specifically recognizes EIN2 protein in amiR-ETP1/ETP2 mutant plants. Total proteins from wild type (Col), ein2-5 or amiR-ETP1/ETP2 plants were subjected to PAGE, and immunoblotting with anti-EIN2 antibody. Coomassie blue staining was used as a lane loading control.
FIG. 12. Venn diagrams showing the overlap of genes up or down regulated in wild-type Col-0 plants treated with ethylene or amiR-ETP1/ETP2 plants. Both wild-type Col-0 ethylene treated and amiR-ETP1/ETP2 plants were first compared to an air treated control.
FIG. 13. The mRNA level of ETP1 and ETP2 were accumulated in 35S::MYC-ETP1/ETP2 transgenic plants. mRNA level of ETP1 (A) or ETP2 (B) were detected by RT-PCR using ETP1 or ETP2 specific primers (upper panel), and the relative density was quantified (lower panel). Total RNA was extracted from the leaves of 1-week-old dark-grown plants. The data were normalized to the corresponding tubulin (input) controls. The relative density quantification was done by software ImageGauge.
FIG. 14. The level of ETP1 and ETP2 mRNA is not regulated by ethylene. qPCR analysis of ETP1 (A) and ETP2 (B) transcript levels in wild type plants treated with ethylene for different time periods. Total RNA was extracted from the leaves of 1-week-old dark-grown plants. The data were normalized to the corresponding actin (input) controls. The data shown are the mean±SD of three independent experiments.
The present invention is based, in part, on the discovery that certain F-box proteins (ETP1 and ETP2) interact with Ein2 to regulate ethylene responses in plants. As described in the Examples, increased expression of ETP1 or ETP2 results in decreased ethylene sensitivity, whereas suppression of endogenous ETP1 and ETP2 expression results in plants with increased ethylene sensitivity. These discoveries can now be used to generate plants with increased or decreased ethylene sensitivity as desired.
Those of skill in the art are aware of numerous desirable characteristics associated with decreased ethylene sensitivity. For example, decreased ethylene sensitivity is useful to (a) protect flowers and plants from senescence or deterioration, including but not limited to, when shipped in closed containers, (b) increase the yields of plants by preventing flower abortion, fruit drop and abscission of desirable vegetative parts, and (c) improve the quality of turf by maintaining chlorophyll levels, increasing clipping yields, preventing leaf senescence and increasing disease resistance. Furthermore, a decrease in ethylene response can be used to delay disease developments, including but not limited to preventing of lesions and senescence and to reduce diseases in plants in which ethylene causes an increase in disease development, including but not limited to, in barley, citrus, Douglas fir seedlings, grapefruit, plum, rose, carnation, strawberry, tobacco, tomato, wheat, watermelon and ornamental plants. In some embodiments, decreased ethylene sensitivity is useful for inducing enhanced drought tolerance.
Those of skill in the art are also aware of numerous desirable characteristics associated with increased ethylene sensitivity. Notably, increased ethylene sensitivity can include increased fruit ripening. Thus, for example, ripening can be induced upon inducement of ETP1 or ETP2 expression.
Further, the inventors have found that EIN2 and ETP1 and ETP2 interact physically and that this interaction plays a role in ethylene responsiveness. Therefore, the invention provides for methods of identifying agents that increase or decrease this interaction, thereby allowing for agents that decrease or increase, respectively, ethylene sensitivity and ethylene responsiveness.
A. Use of Nucleic Acids of the Invention to Inhibit or Suppress Gene Expression
The invention provides methods for increasing ethylene sensitivity in a plant by suppressing expression of a nucleic acid molecule encoding an ETP1 and/or ETP2 polypeptide. In a transgenic plant of the invention, a nucleic acid molecule, or antisense, siRNA, microRNA, or dsRNA constructs thereof, encoding an ETP1 and/or ETP2 gene product, or fragment thereof, or encoding an ETP1 or ETP2 mRNA, or fragment thereof can be operatively linked to an exogenous regulatory element, wherein expression of the construct suppresses endogenous ETP1 and/or ETP2 expression. The invention provides, for example, a transgenic plant characterized by increased ethylene sensitivity or ethylene-independent induction of an ethylene triggered phenotype having an expressed nucleic acid molecule encoding an ETP1 and/or ETP2 gene product, or antisense, siRNA, microRNA, or dsRNA construct thereof, that is operatively linked to an exogenous constitutive regulatory element.
The ETP1 and/or ETP2 nucleic acid sequences of the invention can be used to prepare expression cassettes useful in a number of techniques, including inhibiting, suppressing or increasing, expression or for ectopic expression. A number of methods can be used to inhibit gene expression in plants. For instance, antisense technology can be conveniently used. To accomplish this, a nucleic acid segment from the desired gene is cloned and operably linked to a promoter such that the antisense strand of RNA will be transcribed. The expression cassette is then transformed into plants and the antisense strand of RNA is produced. In plant cells, it has been suggested that antisense RNA inhibits gene expression by preventing the accumulation of mRNA which encodes the enzyme of interest, see, e.g., Sheehy et al., Proc. Nat. Acad. Sci. USA, 85:8805-8809 (1988); Pnueli et al., The Plant Cell 6:175-186 (1994); and Hiatt et al., U.S. Pat. No. 4,801,340.
The antisense nucleic acid sequence transformed into plants will be substantially identical to at least a portion of the endogenous gene or genes to be repressed. The sequence, however, does not have to be perfectly identical to inhibit expression. Thus, an antisense or sense nucleic acid molecule encoding only a portion of an ETP1 and/or ETP2-encoding sequence can be useful for producing a plant in which an ETP1 and/or ETP2 expression is suppressed. The vectors of the present invention can be designed such that the inhibitory effect applies to other proteins within a family of genes exhibiting homology or substantial homology to the target gene.
For antisense suppression, the introduced sequence also need not be full length relative to either the primary transcription product or fully processed mRNA. Generally, higher homology can be used to compensate for the use of a shorter sequence. Furthermore, the introduced sequence need not have the same intron or exon pattern, and homology of non-coding segments may be equally effective. In some embodiments, a sequence of at least, e.g., 15, 20, 25 30, 50, 100, 200, or more continuous nucleotides (up to mRNA full length) substantially identical to an endogenous ETP1 or ETP2 mRNA, or a complement thereof, can be used.
Catalytic RNA molecules or ribozymes can also be used to inhibit expression of ETP1 and/or ETP2 genes. It is possible to design ribozymes that specifically pair with virtually any target RNA and cleave the phosphodiester backbone at a specific location, thereby functionally inactivating the target RNA. In carrying out this cleavage, the ribozyme is not itself altered, and is thus capable of recycling and cleaving other molecules, making it a true enzyme. The inclusion of ribozyme sequences within antisense RNAs confers RNA-cleaving activity upon them, thereby increasing the activity of the constructs.
A number of classes of ribozymes have been identified. One class of ribozymes is derived from a number of small circular RNAs that are capable of self-cleavage and replication in plants. The RNAs replicate either alone (viroid RNAs) or with a helper virus (satellite RNAs). Examples include RNAs from avocado sunblotch viroid and the satellite RNAs from tobacco ringspot virus, lucerne transient streak virus, velvet tobacco mottle virus, solanum nodiflorum mottle virus and subterranean clover mottle virus. The design and use of target RNA-specific ribozymes is described in Haseloff et al. Nature, 334:585-591 (1988).
Another method of suppression is sense suppression (also known as co-suppression). Introduction of expression cassettes in which a nucleic acid is configured in the sense orientation with respect to the promoter has been shown to be an effective means by which to block the transcription of target genes. For an example of the use of this method to modulate expression of endogenous genes see, Napoli et al., The Plant Cell 2:279-289 (1990); Flavell, Proc. Natl. Acad. Sci., USA 91:3490-3496 (1994); Kooter and Mol, Current Opin. Biol. 4:166-171 (1993); and U.S. Pat. Nos. 5,034,323, 5,231,020, and 5,283,184.
Generally, where inhibition of expression is desired, some transcription of the introduced sequence occurs. The effect may occur where the introduced sequence contains no coding sequence per se, but only intron or untranslated sequences homologous to sequences present in the primary transcript of the endogenous sequence. The introduced sequence generally will be substantially identical to the endogenous sequence intended to be repressed. This minimal identity will typically be greater than about 65%, but a higher identity might exert a more effective repression of expression of the endogenous sequences. Substantially greater identity of more than about 80% is preferred, though about 95% to absolute identity would be most preferred. As with antisense regulation, the effect should apply to any other proteins within a similar family of genes exhibiting homology or substantial homology.
For sense suppression, the introduced sequence in the expression cassette, needing less than absolute identity, also need not be full length, relative to either the primary transcription product or fully processed mRNA. This may be preferred to avoid concurrent production of some plants that are overexpressers. A higher identity in a shorter than full length sequence compensates for a longer, less identical sequence. Furthermore, the introduced sequence need not have the same intron or exon pattern, and identity of non-coding segments will be equally effective. Normally, a sequence of the size ranges noted above for antisense regulation is used.
Endogenous gene expression may also be suppressed by way of RNA interference (RNAi), which uses a double-stranded RNA having a sequence identical or similar to the sequence of the target gene. RNAi is the phenomenon in which when a double-stranded RNA having a sequence identical or similar to that of the target gene is introduced into a cell, the expressions of both the inserted exogenous gene and target endogenous gene are suppressed. The double-stranded RNA may be formed from two separate complementry RNAs or may be a single RNA with internally complementary sequences that form a double-stranded RNA. Although details of the mechanism of RNAi are still unknown, it is considered that the introduced double-stranded RNA is initially cleaved into small fragments, which then serve as indexes of the target gene in some manner, thereby degrading the target gene. RNAi is known to be also effective in plants (see, e.g., Chuang, C. F. & Meyerowitz, E. M., Proc. Natl. Acad. Sci. USA 97: 4985 (2000); Waterhouse et al., Proc. Natl. Acad. Sci. USA 95:13959-13964 (1998); Tabara et al. Science 282:430-431 (1998)). For example, to achieve suppression of the expression of a DNA encoding a protein using RNAi, a double-stranded RNA having the sequence of a DNA encoding the protein, or a substantially similar sequence thereof (including those engineered not to translate the protein) or fragment thereof, is introduced into a plant of interest. The resulting plants may then be screened for a phenotype associated with the target protein and/or by monitoring steady-state RNA levels for transcripts encoding the protein. Although the genes used for RNAi need not be completely identical to the target gene, they may be at least 70%, 80%, 90%, 95% or more identical to the target gene sequence. See, e.g., U.S. Patent Publication No. 2004/0029283. The constructs encoding an RNA molecule with a stem-loop structure that is unrelated to the target gene and that is positioned distally to a sequence specific for the gene of interest may also be used to inhibit target gene expression. See, e.g., U.S. Patent Publication No. 2003/0221211.
The RNAi polynucleotides may encompass the full-length target RNA or may correspond to a fragment of the target RNA. In some cases, the fragment will have fewer than 100, 200, 300, 400, 500 600, 700, 800, 900 or 1,000 nucleotides corresponding to the target sequence. In addition, in some embodiments, these fragments are at least, e.g., 50, 100, 150, 200, or more nucleotides in length. In some cases, fragments for use in RNAi will be at least substantially similar to regions of a target protein that do not occur in other proteins in the organism or may be selected to have as little similarity to other organism transcripts as possible, e.g., selected by comparison to sequences in analyzing publicly-available sequence databases.
Expression vectors that continually express siRNA in transiently- and stably-transfected have been engineered to express small hairpin RNAs, which get processed in vivo into siRNAs molecules capable of carrying out gene-specific silencing (Brummelkamp et al., Science 296:550-553 (2002), and Paddison, et al., Genes & Dev. 16:948-958 (2002)). Post-transcriptional gene silencing by double-stranded RNA is discussed in further detail by Hammond et al. Nature Rev Gen 2: 110-119 (2001), Fire et al. Nature 391: 806-811 (1998) and Timmons and Fire Nature 395: 854 (1998).
One of skill in the art will recognize that using technology based on specific nucleotide sequences (e.g., antisense or sense suppression, siRNA, microRNA technology, etc.), families of homologous genes can be suppressed with a single sense or antisense transcript. For instance, if a sense or antisense transcript is designed to have a sequence that is conserved among a family of genes, then multiple members of a gene family can be suppressed. Conversely, if the goal is to only suppress one member of a homologous gene family, then the sense or antisense transcript should be targeted to sequences with the most variance between family members.
Yet another way to suppress expression of an endogenous plant gene is by recombinant expression of a microRNA that suppresses a target (e.g., an ETP1 or ETP2 gene). Artificial microRNAs are single-stranded RNAs (e.g., between 18-25 mers, generally 21 mers), that are not normally found in plants and that are processed from endogenous miRNA precursors. Their sequences are designed according to the determinants of plant miRNA target selection, such that the artificial microRNA specifically silences its intended target gene(s) and are generally described in Schwab et al, The Plant Cell 18:1121-1133 (2006) as well as the internet-based methods of designing such microRNAs as described therein. See also, US Patent Publication No. 2008/0313773.
B. Use of Nucleic Acids of the Invention to Enhance Gene Expression
Nucleic acid sequences encoding all or an active part of an ETP1 or ETP2 polypeptide (including but not limited to polypeptides substantially identical to any of SEQ ID NOS:1-8 or 18-22, which when expressed decrease ethylene sensitivity) can be used to prepare expression cassettes that enhance, or increase endogenous, an ETP1 or ETP2 gene expression. Where overexpression of a gene is desired, the desired gene from a different species may be used to decrease potential sense suppression effects.
Any of a number of means well known in the art can be used to increase an ETP1 or ETP2 activity in plants. Any organ can be targeted, such as shoot vegetative organs/structures (e.g. leaves, stems and tubers), roots, flowers and floral organs/structures (e.g. bracts, sepals, petals, stamens, carpels, anthers and ovules), seed (including embryo, endosperm, and seed coat) and fruit. Alternatively, one or several an ETP1 or ETP2 genes can be expressed constitutively (e.g., using the CaMV 35S promoter).
One of skill will recognize that the polypeptides encoded by the genes of the invention, like other proteins, have different domains which perform different functions. Thus, the gene sequences need not be full length, so long as the desired functional domain of the protein is expressed.
In some embodiments, to use isolated sequences in the above techniques, recombinant DNA vectors suitable for transformation of plant cells are prepared. Techniques for transforming a wide variety of higher plant species are well known and described in the technical and scientific literature. See, for example, Weising et al. Ann. Rev. Genet. 22:421-477 (1988). A DNA sequence coding for the desired polypeptide, for example a cDNA sequence encoding a full length protein, will preferably be combined with transcriptional and translational initiation regulatory sequences which will direct the transcription of the sequence from the gene in the intended tissues of the transformed plant.
For example, for overexpression, a plant promoter fragment may be employed which will direct expression of the gene in all tissues of a regenerated plant. Such promoters are referred to herein as âconstitutiveâ promoters and are active under most environmental conditions and states of development or cell differentiation. Examples of constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcription initiation region, the 1âČ- or 2âČ-promoter derived from T-DNA of Agrobacterium tumefaciens, and other transcription initiation regions from various plant genes known to those of skill.
Alternatively, the plant promoter may direct expression of the polynucleotide of the invention in a specific tissue (tissue-specific promoters) or may be otherwise under more precise environmental control (inducible promoters). Examples of tissue-specific promoters under developmental control include promoters that initiate transcription only in certain tissues, such as fruit, seeds, or flowers. Examples of environmental conditions that may affect transcription by inducible promoters include anaerobic conditions, elevated temperature, or the presence of light.
If proper polypeptide expression is desired, a polyadenylation region at the 3âČ-end of the coding region should be included. The polyadenylation region can be derived from the natural gene, from a variety of other plant genes, or from T-DNA.
The vector comprising the sequences (e.g., promoters or coding regions) from genes of the invention can optionally comprise a marker gene that confers a selectable phenotype on plant cells. For example, the marker may encode biocide resistance, particularly antibiotic resistance, such as resistance to kanamycin, G418, bleomycin, hygromycin, or herbicide resistance, such as resistance to chlorosluforon or Basta.
In some embodiments, an ETP1 or ETP2 nucleic acid sequences of the invention are expressed recombinantly in plant cells to enhance and increase levels of an ETP1 or ETP2 polypeptides. Alternatively, antisense or other an ETP1 or ETP2 constructs are used to suppress an ETP1 or ETP2 levels of expression. A variety of different expression constructs, such as expression cassettes and vectors suitable for transformation of plant cells can be prepared. Techniques for transforming a wide variety of higher plant species are well known and described in the technical and scientific literature. See, e.g., Weising et al. Ann. Rev. Genet. 22:421-477 (1988). An ETP1 or ETP2 sequence coding for an ETP1 or ETP2 polypeptide, e.g., a cDNA sequence encoding a full length protein, can be combined with cis-acting (promoter) and trans-acting (enhancer) transcriptional regulatory sequences to direct the timing, tissue type and levels of transcription in the intended tissues of the transformed plant. Translational control elements can also be used.
The invention provides an ETP1 or ETP2 nucleic acid operably linked to a promoter that, in some embodiments, is capable of driving the transcription of the ETP1 or ETP2 coding sequence in plants. The promoter can be, e.g., derived from plant or viral sources. The promoter can be, e.g., constitutively active, inducible, or tissue specific. In construction of recombinant expression cassettes, vectors, transgenics, of the invention, a different promoters can be chosen and employed to differentially direct gene expression, e.g., in some or all tissues of a plant or animal. In some embodiments, as discussed above, desired promoters are identified by analyzing the 5âČ sequences of a genomic clone corresponding to an ETP1 or ETP2 gene as described here.
A. Constitutive Promoters
A promoter fragment can be employed that will direct expression of an ETP1 or ETP2 nucleic acid in all transformed cells or tissues, e.g. as those of a regenerated plant. The term âconstitutive regulatory elementâ means a regulatory element that confers a level of expression upon an operatively linked nucleic molecule that is relatively independent of the cell or tissue type in which the constitutive regulatory element is expressed. A constitutive regulatory element that is expressed in a plant generally is widely expressed in a large number of cell and tissue types. Promoters that drive expression continuously under physiological conditions are referred to as âconstitutiveâ promoters and are active under most environmental conditions and states of development or cell differentiation.
A variety of constitutive regulatory elements useful for ectopic expression in a transgenic plant are well known in the art. The cauliflower mosaic virus 35S (CaMV 35S) promoter, for example, is a well-characterized constitutive regulatory element that produces a high level of expression in all plant tissues (Odell et al., Nature 313:810-812 (1985)). The CaMV 35S promoter can be particularly useful due to its activity in numerous diverse plant species (Benfey and Chua, Science 250:959-966 (1990); Futterer et al., Physiol. Plant 79:154 (1990); Odell et al., supra, 1985). A tandem 35S promoter, in which the intrinsic promoter element has been duplicated, confers higher expression levels in comparison to the unmodified 35S promoter (Kay et al., Science 236:1299 (1987)). Other useful constitutive regulatory elements include, for example, the cauliflower mosaic virus 19S promoter; the Figwort mosaic virus promoter; and the nopaline synthase (nos) gene promoter (Singer et al., Plant Mol. Biol. 14:433 (1990); An, Plant Physiol. 81:86 (1986)).
Additional constitutive regulatory elements including those for efficient expression in monocots also are known in the art, for example, the pEmu promoter and promoters based on the rice Actin-1 5âČ region (Last et al., Theor. Appl. Genet. 81:581 (1991); Mcelroy et al., Mol. Gen. Genet. 231:150 (1991); Mcelroy et al., Plant Cell 2:163 (1990)). Chimeric regulatory elements, which combine elements from different genes, also can be useful for ectopically expressing a nucleic acid molecule encoding an ETP1 or ETP2 polynucleotide (Comai et al., Plant Mol. Biol. 15:373 (1990)).
Other examples of constitutive promoters include the 1âČ- or 2âČ-promoter derived from T-DNA of Agrobacterium tumefaciens (see, e.g., Mengiste (1997) supra; O'Grady (1995) Plant Mol. Biol. 29:99-108); actin promoters, such as the Arabidopsis actin gene promoter (see, e.g., Huang (1997) Plant Mol. Biol. 1997 33:125-139); alcohol dehydrogenase (Adh) gene promoters (see, e.g., Millar (1996) Plant Mol. Biol. 31:897-904); ACT11 from Arabidopsis (Huang et al. Plant Mol. Biol. 33:125-139 (1996)), Cat3 from Arabidopsis (GenBank No. U43147, Zhong et al., Mol. Gen. Genet. 251:196-203 (1996)), the gene encoding stearoyl-acyl carrier protein desaturase from Brassica napus (Genbank No. X74782, Solocombe et al. Plant Physiol. 104:1167-1176 (1994)), GPc1 from maize (GenBank No. X15596, Martinez et al. J. Mol. Biol. 208:551-565 (1989)), Gpc2 from maize (GenBank No. U45855, Manjunath et al., Plant Mol. Biol. 33:97-112 (1997)), other transcription initiation regions from various plant genes known to those of skill. See also Holtorf Plant Mol. Biol. 29:637-646 (1995).
B. Inducible Promoters
Alternatively, a promoter may direct expression of an ETP1 or ETP2 nucleic acid of the invention under the influence of changing environmental conditions or developmental conditions. Examples of environmental conditions that may effect transcription by inducible promoters include anaerobic conditions, elevated temperature, drought, or the presence of light. Such promoters are referred to herein as âinducibleâ promoters. For example, the invention incorporates the drought-inducible promoter of maize (Busk (1997) supra); the cold, drought, and high salt inducible promoter from potato (Kirch (1997) Plant Mol. Biol. 33:897-909).
Alternatively, plant promoters which are inducible upon exposure to plant hormones, such as auxins, are used to express the nucleic acids of the invention. For example, the invention can use the auxin-response elements E1 promoter fragment (AuxREs) in the soybean (Glycine max L.) (Liu (1997) Plant Physiol. 115:397-407); the auxin-responsive Arabidopsis GST6 promoter (also responsive to salicylic acid and hydrogen peroxide) (Chen (1996) Plant J. 10: 955-966); the auxin-inducible parC promoter from tobacco (Sakai (1996) 37:906-913); a plant biotin response element (Streit (1997) Mol. Plant Microbe Interact. 10:933-937); and, the promoter responsive to the stress hormone abscisic acid (Sheen (1996) Science 274:1900-1902).
Promoters that are inducible upon exposure to chemicals reagents applied to the plant, such as herbicides or antibiotics, can also be used to express the nucleic acids of the invention. For example, the maize In2-2 promoter, activated by benzenesulfonamide herbicide safeners, can be used (De Veylder (1997) Plant Cell Physiol. 38:568-577); application of different herbicide safeners induces distinct gene expression patterns, including expression in the root, hydathodes, and the shoot apical meristem. An ETP1 or ETP2 coding sequence can also be under the control of, e.g., a tetracycline-inducible promoter, e.g., as described with transgenic tobacco plants containing the Avena sativa L. (oat) arginine decarboxylase gene (Masgrau (1997) Plant J. 11:465-473); or, a salicylic acid-responsive element (Stange (1997) Plant J. 11:1315-1324; Uknes et al., Plant Cell 5:159-169 (1993); Bi et al., Plant J. 8:235-245 (1995)).
Other inducible regulatory elements include but are not limited to copper-inducible regulatory elements (Mett et al., Proc. Natl. Acad. Sci. USA 90:4567-4571 (1993); Furst et al., Cell 55:705-717 (1988)); tetracycline and chlor-tetracycline-inducible regulatory elements (Gatz et al., Plant J. 2:397-404 (1992); Roder et al., Mol. Gen. Genet. 243:32-38 (1994); Gatz, Meth. Cell Biol. 50:411-424 (1995)); ecdysone inducible regulatory elements (Christopherson et al., Proc. Natl. Acad. Sci. USA 89:6314-6318 (1992); Kreutzweiser et al., Ecotoxicol. Environ. Safety 28:14-24 (1994)); heat shock inducible regulatory elements (Takahashi et al., Plant Physiol. 99:383-390 (1992); Yabe et al., Plant Cell Physiol. 35:1207-1219 (1994); Ueda et al., Mol. Gen. Genet. 250:533-539 (1996)); and lac operon elements, which are used in combination with a constitutively expressed lac repressor to confer, for example, IPTG-inducible expression (Wilde et al., EMBO J. 11:1251-1259 (1992)). An inducible regulatory element useful in the transgenic plants of the invention also can be, for example, a nitrate-inducible promoter derived from the spinach nitrite reductase gene (Back et al., Plant Mol. Biol. 17:9 (1991)) or a light-inducible promoter, such as that associated with the small subunit of RuBP carboxylase or the LHCP gene families (Feinbaum et al., Mol. Gen. Genet. 226:449 (1991); Lam and Chua, Science 248:471 (1990)).
C. Tissue-Specific Promoters
Alternatively, the plant promoter may direct expression of the polynucleotide of the invention in a specific tissue (tissue-specific promoters). Tissue specific promoters are transcriptional control elements that are only active in particular cells or tissues at specific times during plant development, such as in vegetative tissues or reproductive tissues.
Examples of tissue-specific promoters under developmental control include promoters that initiate transcription only (or primarily only) in certain tissues, such as vegetative tissues, e.g., roots or leaves, or reproductive tissues, such as fruit, ovules, seeds, pollen, pistols, flowers, or any embryonic tissue. Reproductive tissue-specific promoters may be, e.g., ovule-specific, embryo-specific, endosperm-specific, integument-specific, seed and seed coat-specific, pollen-specific, petal-specific, sepal-specific, or some combination thereof.
Other tissue-specific promoters include seed promoters. Suitable seed-specific promoters are derived from the following genes: MAC1 from maize (Sheridan (1996) Genetics 142:1009-1020); Cat3 from maize (GenBank No. L05934, Abler (1993) Plant Mol. Biol. 22:10131-1038); vivparous-1 from Arabidopsis (Genbank No. U93215); atmyc1 from Arabidopsis (Urao (1996) Plant Mol. Biol. 32:571-57; Conceicao (1994) Plant 5:493-505); napA from Brassica napus (GenBank No. J02798, Josefsson (1987) JBL 26:12196-1301); and the napin gene family from Brassica napus (Sjodahl (1995) Planta 197:264-271).
A variety of promoters specifically active in vegetative tissues, such as leaves, stems, roots and tubers, can also be used to express the ETP1 or ETP2 nucleic acids of the invention. For example, promoters controlling patatin, the major storage protein of the potato tuber, can be used, see, e.g., Kim (1994) Plant Mol. Biol. 26:603-615; Martin (1997) Plant J. 11:53-62. The ORF 13 promoter from Agrobacterium rhizogenes which exhibits high activity in roots can also be used (Hansen (1997) Mol. Gen. Genet. 254:337-343. Other useful vegetative tissue-specific promoters include: the tarin promoter of the gene encoding a globulin from a major taro (Colocasia esculenta L. Schott) corm protein family, tarin (Bezerra (1995) Plant Mol. Biol. 28:137-144); the curculin promoter active during taro corm development (de Castro (1992) Plant Cell 4:1549-1559) and the promoter for the tobacco root-specific gene TobRB7, whose expression is localized to root meristem and immature central cylinder regions (Yamamoto (1991) Plant Cell 3:371-382).
Leaf-specific promoters, such as the ribulose biphosphate carboxylase (RBCS) promoters can be used. For example, the tomato RBCS1, RBCS2 and RBCS3A genes are expressed in leaves and light-grown seedlings, only RBCS1 and RBCS2 are expressed in developing tomato fruits (Meier (1997) FEBS Lett. 415:91-95). A ribulose bisphosphate carboxylase promoters expressed almost exclusively in mesophyll cells in leaf blades and leaf sheaths at high levels, described by Matsuoka (1994) Plant J. 6:311-319, can be used. Another leaf-specific promoter is the light harvesting chlorophyll a/b binding protein gene promoter, see, e.g., Shiina (1997) Plant Physiol. 115:477-483; Casal (1998) Plant Physiol. 116:1533-1538. The Arabidopsis thaliana myb-related gene promoter (Atmyb5) described by Li (1996) FEBS Lett. 379:117-121, is leaf-specific. The Atmyb5 promoter is expressed in developing leaf trichomes, stipules, and epidermal cells on the margins of young rosette and cauline leaves, and in immature seeds. Atmyb5 mRNA appears between fertilization and the 16 cell stage of embryo development and persists beyond the heart stage. A leaf promoter identified in maize by Busk (1997) Plant J. 11:1285-1295, can also be used.
Another class of useful vegetative tissue-specific promoters are meristematic (root tip and shoot apex) promoters. For example, the âSHOOTMERISTEMLESSâ and âSCARECROWâ promoters, which are active in the developing shoot or root apical meristems and are described by Di Laurenzio (1996) Cell 86:423-433; and, Long (1996) Nature 379:66-69, can be used. Another promoter is the 3-hydroxy-3-methylglutaryl coenzyme A reductase HMG2 gene promoter, whose expression is restricted to meristematic and floral (secretory zone of the stigma, mature pollen grains, gynoecium vascular tissue, and fertilized ovules) tissues (see, e.g., Enjuto (1995) Plant Cell. 7:517-527). Additional promoter examples include the kn1-related gene promoters from maize and other species that show meristem-specific expression, see, e.g., Granger (1996) Plant Mol. Biol. 31:373-378; Kerstetter (1994) Plant Cell 6:1877-1887; Hake (1995) Philos. Trans. R. Soc. Lond. B. Biol. Sci. 350:45-51. One such example is the Arabidopsis thaliana KNAT1 promoter. In the shoot apex, KNAT1 transcript is localized primarily to the shoot apical meristem; the expression of KNAT1 in the shoot meristem decreases during the floral transition and is restricted to the cortex of the inflorescence stem (see, e.g., Lincoln (1994) Plant Cell 6:1859-1876).
One of skill will recognize that a tissue-specific promoter may drive expression of operably linked sequences in tissues other than the target tissue. Thus, as used herein a tissue-specific promoter is one that drives expression preferentially in the target tissue, but may also lead to some expression in other tissues as well.
In another embodiment, an ETP1 or ETP2 nucleic acid is expressed through a transposable element. This allows for constitutive, yet periodic and infrequent expression of the constitutively active polypeptide. The invention also provides for use of tissue-specific promoters derived from viruses which can include, e.g., the tobamovirus subgenomic promoter (Kumagai (1995) Proc. Natl. Acad. Sci. USA 92:1679-1683; the rice tungro bacilliform virus (RTBV), which replicates only in phloem cells in infected rice plants, with its promoter which drives strong phloem-specific reporter gene expression; the cassava vein mosaic virus (CVMV) promoter, with highest activity in vascular elements, in leaf mesophyll cells, and in root tips (Verdaguer (1996) Plant Mol. Biol. 31:1129-1139).
DNA constructs of the invention may be introduced into the genome of the desired plant host by a variety of conventional techniques. For example, the DNA construct may be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or the DNA constructs can be introduced directly to plant tissue using ballistic methods, such as DNA particle bombardment. Alternatively, the DNA constructs may be combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector. The virulence functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria.
Microinjection techniques are known in the art and well described in the scientific and patent literature. The introduction of DNA constructs using polyethylene glycol precipitation is described in Paszkowski et al. EMBO J. 3:2717-2722 (1984). Electroporation techniques are described in Fromm et al. Proc. Natl. Acad. Sci. USA 82:5824 (1985). Ballistic transformation techniques are described in Klein et al. Nature 327:70-73 (1987).
Agrobacterium tumefaciens-mediated transformation techniques, including disarming and use of binary vectors, are well described in the scientific literature. See, for example Horsch et al. Science 233:496-498 (1984), and Fraley et al. Proc. Natl. Acad. Sci. USA 80:4803 (1983).
Transformed plant cells that are derived from any transformation technique can be cultured to regenerate a whole plant that possesses the transformed genotype and thus the desired phenotype. Such regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, optionally relying on a biocide and/or herbicide marker that has been introduced together with the desired nucleotide sequences. Plant regeneration from cultured protoplasts is described in Evans et al., Protoplasts Isolation and Culture, Handbook of Plant Cell Culture, pp. 124-176, MacMillilan Publishing Company, New York, 1983; and Binding, Regeneration of Plants, Plant Protoplasts, pp. 21-73, CRC Press, Boca Raton, 1985. Regeneration can also be obtained from plant callus, explants, organs, or parts thereof. Such regeneration techniques are described generally in Klee et al. Ann. Rev. of Plant Phys. 38:467-486 (1987).
The nucleic acids of the invention can be used to confer desired traits on essentially any plant. Thus, the invention has use over a broad range of plants, including species from the genera Asparagus, Atropa, Avena, Brassica, Citrus, Citrullus, Capsicum, Cucumis, Cucurbita, Daucus, Fragaria, Glycine, Gossypium, Helianthus, Heterocallis, Hordeum, Hyoscyamus, Lactuca, Linum, Lolium, Lycopersicon, Malus, Manihot, Majorana, Medicago, Nicotiana, Oryza, Panieum, Pannesetum, Persea, Pisum, Pyrus, Prunus, Raphanus, Secale, Senecio, Sinapis, Solanum, Sorghum, Trigonella, Triticum, Vitis, Vigna, and, Zea. Plants having an ethylene response, and thus those that have use in the present invention, include but are not limited to: dicotyledons and monocotyledons including but not limited to rice, maize, wheat, barley, sorghum, millet, grass, oats, tomato, potato, banana, kiwi fruit, avocado, melon, mango, cane, sugar beet, tobacco, papaya, peach, strawberry, raspberry, blackberry, blueberry, lettuce, cabbage, cauliflower, onion, broccoli, brussel sprout, cotton, canola, grape, soybean, oil seed rape, asparagus, beans, carrots, cucumbers, eggplant, melons, okra, parsnips, peanuts, peppers, pineapples, squash, sweet potatoes, rye, cantaloupes, peas, pumpkins, sunflowers, spinach, apples, cherries, plums, cranberries, grapefruit, lemons, limes, nectarines, oranges, peaches, pears, tangelos, tangerines, lily, carnation, chrysanthemum, petunia, rose, geranium, violet, gladioli, orchid, lilac, crabapple, sweetgum tree, maple tree, poinsettia, locust tree, oak tree, ash tree and linden tree.
As explained herein, ETP1 and ETP2 interact with the C-terminus of EIN2 and this interaction affects ethylene sensitivity. Accordingly, the present invention provides for methods of screening for agents that increase or decrease the interaction (e.g., binding) of ETP1 and ETP2 interact with the C-terminus of EIN2. For example, in some embodiments, a plurality of agents (e.g., in combination, separately in parallel, or in series) are contacted to a mixture comprising at least (1) A first member, i.e., the C-terminus (ETP1 and/or ETP2 binding region) of an EIN2 polypeptide, and (2) a second member, i.e., ETP1 and/or ETP2. Depending on the conditions of the assay, one can perform the assay under conditions in which the first and second member bind. In these conditions, one screens for agents that inhibit the binding of the members. Alternatively, the screen can be performed under conditions in which the two members do not bind together and the assay is used to identify agents that increase or induce binding of the members. Binding can be determined as desired in vitro, or in vivo.
Any ETP1 or ETP2 protein binding member can be used as desired and such proteins can optionally be fusion proteins, e.g., having tags, labels, etc. Similarly, any C-terminal region of an EIN2 protein having ETP-1 or ETP2 binding activity can be used, again optionally as a fusion protein, e.g., having tags, labels, etc.
Polypeptide Binding Assays
Optionally, preliminary screens can be conducted by screening for agents capable of binding to an ETP1, and ETP2, or a C-terminal portion of EIN2 capable of binding ETP1 or ETP2, as at least some of the agents so identified are likely to modulate EIN2/ETP1/2 binding.
Binding assays can involve contacting an ETP1, and ETP2, or a C-terminal portion of EIN2 with one or more test agents and allowing sufficient time for the protein and test agents to form a binding complex. Any binding complexes formed can be detected using any of a number of established analytical techniques. Protein binding assays include, but are not limited to, methods that measure co-precipitation or co-migration on non-denaturing SDS-polyacrylamide gels, and co-migration on Western blots (see, e.g., Bennet, J. P. and Yamamura, H. I. (1985) âNeurotransmitter, Hormone or Drug Receptor Binding Methods,â in Neurotransmitter Receptor Binding (Yamamura, H. I., et al., eds.), pp. 61-89. Other binding assays involve the use of mass spectrometry or NMR techniques to identify molecules bound to an ETP1, and ETP2, or a C-terminal portion of EIN2 or displacement of labeled substrates. The ETP1, and ETP2, or a C-terminal portion of EIN2 utilized in such assays can be naturally expressed, cloned or synthesized.
In addition, mammalian or yeast two-hybrid approaches (see, e.g., Bartel, P. L. et. al. Methods Enzymol, 254:241 (1995)) can be used to identify polypeptides or other molecules that interact or bind when expressed together in a cell. In some embodiments, agents that modulate the interaction of ETP1 and ETP2 with EIN2 are identified in a two-hybrid assay between an ETP1 or ETP2 and at least the C-terminal portion of EIN2, wherein an agent is identified as an agent that activates or enables binding of the two members. Thus, the two polypeptides bind in the presence, but not in the absence of the agent. Alternatively, the assay can be performed to identify agents that inhibit the binding of the two members.
Validation
Agents that are initially identified by any of the foregoing screening methods can be further tested to validate the apparent activity and/or determine other biological effects of the agent. In some cases, the identified agent is tested for the ability to effect plant ethylene sensitivity. A number of such assays and phenotypes are known in the art and can be employed according to the methods of the invention.
Solid Phase and Soluble High Throughput Assays
In the high throughput assays of the invention, it is possible to screen up to several thousand different agents in a single day. In particular, each well of a microtiter plate can be used to run a separate assay against a selected potential modulator, or, if concentration or incubation time effects are to be observed, every 5-10 wells can test a single modulator. Thus, a single standard microtiter plate can assay about 100 (e.g., 96) modulators. If 1536 well plates are used, then a single plate can easily assay from about 100 to about 1500 different compounds. It is possible to assay several different plates per day; assay screens for up to about 6,000-20,000 or more different compounds are possible using the integrated systems of the invention. In addition, microfluidic approaches to reagent manipulation can be used.
Agents
Member binding modulators can be any small chemical compound, or a biological entity, such as a protein (including, e.g., an antibody), sugar, nucleic acid or lipid. In some embodiments, the agents are small chemical molecules and/or peptides.
Essentially any chemical compound can be used as a potential modulator in the assays of the invention, although most often compounds that can be dissolved in aqueous or organic (especially DMSO-based) solutions are used. The assays can be designed to screen large chemical libraries by automating the assay steps and providing compounds from any convenient source to assays, which are typically run in parallel (e.g., in microtiter formats on microtiter plates in robotic assays). It will be appreciated that there are many suppliers of chemical compounds.
In some embodiments, high throughput screening methods involve providing a combinatorial chemical or peptide library containing a large number of potential therapeutic compounds (potential modulator compounds). Such âcombinatorial chemical librariesâ or âligand librariesâ are then screened in one or more assays, as described herein, to identify those library members (particular chemical species or subclasses) that display a desired characteristic activity. The compounds thus identified can serve as conventional âlead compoundsâ or can themselves be used as potential or actual therapeutics.
A combinatorial chemical library is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis, by combining a number of chemical âbuilding blocksâ such as reagents. For example, a linear combinatorial chemical library such as a polypeptide library is formed by combining a set of chemical building blocks (amino acids) in every possible way for a given compound length (i.e., the number of amino acids in a polypeptide compound). Millions of chemical compounds can be synthesized through such combinatorial mixing of chemical building blocks.
Preparation and screening of combinatorial chemical libraries is well known to those of skill in the art. Such combinatorial chemical libraries include, but are not limited to, peptide libraries (see, e.g., U.S. Pat. No. 5,010,175, Furka, Int. J. Pept. Prot. Res. 37:487-493 (1991) and Houghton et al., Nature 354:84-88 (1991)). Other chemistries for generating chemical diversity libraries can also be used. Such chemistries include, but are not limited to: peptoids (e.g., PCT Publication No. WO 91/19735), encoded peptides (e.g., PCT Publication WO 93/20242), random bio-oligomers (e.g., PCT Publication No. WO 92/00091), benzodiazepines (e.g., U.S. Pat. No. 5,288,514), diversomers such as hydantoins, benzodiazepines and dipeptides (Hobbs et al., Proc. Nat. Acad. Sci. USA 90:6909-6913 (1993)), vinylogous polypeptides (Hagihara et al., J. Amer. Chem. Soc. 114:6568 (1992)), nonpeptidal peptidomimetics with glucose scaffolding (Hirschmann et al., J. Amer. Chem. Soc. 114:9217-9218 (1992)), analogous organic syntheses of small compound libraries (Chen et al., J. Amer. Chem. Soc. 116:2661 (1994)), oligocarbamates (Cho et al., Science 261:1303 (1993)), and/or peptidyl phosphonates (Campbell et al., J. Org. Chem. 59:658 (1994)), nucleic acid libraries (see Ausubel, Berger and Sambrook, all supra), peptide nucleic acid libraries (see, e.g., U.S. Pat. No. 5,539,083), antibody libraries (see, e.g., Vaughn et al., Nature Biotechnology, 14(3):309-314 (1996) and PCT/US96/10287), carbohydrate libraries (see, e.g., Liang et al., Science, 274:1520-1522 (1996) and U.S. Pat. No. 5,593,853), small organic molecule libraries (see, e.g., benzodiazepines, Baum C&EN, January 18, page 33 (1993); isoprenoids, U.S. Pat. No. 5,569,588; thiazolidinones and metathiazanones, U.S. Pat. No. 5,549,974; pyrrolidines, U.S. Pat. Nos. 5,525,735 and 5,519,134; morpholino compounds, U.S. Pat. No. 5,506,337; benzodiazepines, U.S. Pat. No. 5,288,514, and the like).
Devices for the preparation of combinatorial libraries are commercially available (see, e.g., 357 MPS, 390 MPS, Advanced Chem Tech, Louisville Ky., Symphony, Rainin, Woburn, Mass., 433A Applied Biosystems, Foster City, Calif., 9050 Plus, Millipore, Bedford, Mass.). In addition, numerous combinatorial libraries are themselves commercially available (see, e.g., ComGenex, Princeton, N.J., Tripos, Inc., St. Louis, Mo., 3D Pharmaceuticals, Exton, Pa., Martek Biosciences, Columbia, Md., etc.).
The following examples are offered to illustrate, but not to limit the claimed invention.
In this study, we demonstrate that EIN2, the key positive regulator of ethylene signal transduction, is a short half-life protein and it undergoes rapid proteasome-mediated turnover. We also identify two F-box proteins, ETP1 and ETP2, as the key regulators of EIN2 protein stability, and through the regulation of EIN2 they negatively effect ethylene signal transduction. Overall, our results suggest ethylene responses are specifically modulated in an EIN2 protein level dependent manner, and reveal a complex interplay between ethylene, the regulation of ETP1/ETP2 F-box proteins, and subsequent targeting and degradation of EIN2 as essential for triggering appropriate ethylene responses in plants.
A previous study demonstrated that EIN2 mRNA is not altered in response to ethylene (Alonso, J. M. et al., Science, 284:2148-2152 (1999)). Here we have examined whether EIN2 may be subject to posttranscriptional regulation. We first tested its stability by western blotting after treatment with cyclohexamide (CHX), which inhibits de novo protein biosynthesis. We found that EIN2 levels dramatically decreased after 30 minutes of CHX treatment and remained barely detectable for the subsequent 2 hours (FIG. 1A). The rapid reduction of EIN2 protein levels indicates that EIN2 is a short-lived protein, with a half-life of Ë30 minutes or less. To further test whether the level of EIN2 is regulated by 26S proteasome-mediated protein turnover, we examined EIN2 protein levels from wild-type Col-0 etiolated seedlings treated with specific proteasome inhibitors MG115 or MG132 (Lee, D. H. and Goldberg, A. L., Trends Cell Biol., 8:397-403 (1998)). As shown in FIG. 1B, after 1 hr of MG132 or MG115 treatment, the accumulation of EIN2 protein markedly increased. Interestingly, this analysis also revealed the presence of higher molecular weight forms of the protein, suggesting that EIN2 might be modified, possibly by ubiquitinylation. These results suggested that EIN2 is a short half-life protein whose turnover is mediated by the proteasome.
Since EIN2 is a key regulator of the ethylene signaling pathway, we tested the effect of treatment with exogenous ethylene gas on EIN2 protein stability. To do this, we monitored the level of EIN2 protein in plants treated with ethylene (10 ppm) for increasing amounts of time with or without the presence of silver (Ag+), which is a potent inhibitor of ethylene action (Abeles, F. B. et al., Ethylene in plant biology, Academic Press, Inc, New York, N.Y. (2d ed, 1992)). We found that the level of EIN2 protein rapidly increased in response to ethylene treatment, but in the presence of silver ion, EIN2 protein accumulation was completely inhibited (FIG. 1C). In addition, to test the effect of ethylene on EIN2 protein, we monitored EIN2 levels in wild-type Col-0 seedlings grown on MS medium supplemented with either 1-aminocyclopropane-1-carboxylic acid (ACC), an ethylene precursor, or aminoethoxyvinylglycine (AVG), an inhibitor of ethylene biosynthesis. EIN2 protein was not present at detectable levels in the presence of AVG. In contrast, the level of EIN2 was elevated in the presence of ACC (FIG. 7), further suggesting that ethylene stabilizes EIN2 protein. To gain further insight into kinetics of EIN2 protein induction by ethylene, we examined EIN2 levels in different ethylene mutants. In wild-type Col-0 seedlings, the level of EIN2 protein increased in response to ethylene treatment (FIG. 1D). However, in etr1-1 mutant seedlings, EIN2 accumulation was not observed even with 30 hours ethylene treatment. In the contrast, the level of EIN2 was constitutively elevated in ctr1-1 mutant seedlings. Additionally, EIN2 levels were further increased in ctr1-1 mutant seedlings by ethylene treatment. In the ein3eil1 double mutant, EIN2 accumulation was similar to that seen for wild-type Col-0 seedlings (FIG. 1D). These results demonstrated that the accumulation of EIN2 protein is dramatically altered in the different ethylene response mutants. Specifically, the level of EIN2 protein is decreased in ethylene insensitive mutants, but increased in the ethylene constitutive response mutants. Taken together, the results demonstrate that EIN2 protein is stabilized and accumulates by the presence of exogenous ethylene gas. This accumulation of EIN2 is dependent on an intact ethylene signaling pathway upstream of EIN3/EIL1. Overall, these results suggest that EIN2 protein levels are positively correlated with the ethylene response.
Two Novel F-Box Proteins Interact with the C-Terminal End of EIN2
To further understand the posttranscriptional regulation of EIN2 levels, we performed a yeast two-hybrid screen to identify proteins that potentially interact with the EIN2-CEND. As a result, a novel F-box protein ETP1 (At3g18980, GB:Q9LJ68; GB:Q8LB99) was identified. Sequence analysis reveals the presence of a paralogous gene, ETP2 (At3g18910, GB:Q9LJ34), that is 50% identical to ETP1 at the amino acid sequence level (FIG. 2A). Therefore, we tested whether the ETP2 protein might also interact with EIN2-CEND. As shown in FIGS. 2B-C, both directed yeast two hybrid assays and pull down experiments demonstrated that EIN2-CEND was able to interact with both F-box proteins, ETP1 and ETP2.
We further characterized the domain of EIN2-CEND that interacts with ETP1 and ETP2. Based on the alignment of EIN2 proteins from different plant species (FIG. 9), a series of deletion mutants of EIN2-CEND was generated to map the region of EIN2 required for interaction with ETP1 and ETP2. As shown in FIG. 2D and FIGS. 8A-B, EIN2-CEND1 (EIN2-C1), EIN2-CEND3 (EIN2-C3), and EIN2-CEND5 (EIN2ÎC5) interact with both ETP1 and ETP2. In contrast, we found that the EIN2ÎCEND2 (EIN2ÎC2), EIN2ÎCEND3 (EIN2ÎC3) and EIN2ÎCEND4 (EIN2ÎC4) completely lost the ability to interact with EIN2 (FIGS. 8A-B). These results demonstrated that the most highly conserved region of EIN2 (EIN2-05), the last <250 amino acids (FIG. 9) is both necessary and sufficient for the interaction of EIN2 with ETP1 and ETP2. Additionally, these results suggested that other portions of EIN2-CEND are not essential for these interactions but may enhance them.
To test whether ETP1 and ETP2 are involved in the regulation of EIN2 protein turnover, we identified T-DNA insertion lines for mutants in both ETP1 and ETP2, etp1, etp2-1, etp2-2 (FIG. 10A) (Alonso, J. M. et al., Science, 301:653-657 (2003)). The response to ethylene of these mutant seedlings was tested. etp1 mutant seedlings manifested a slight ethylene hypersensitivity (FIG. 10D), while the ethylene response of etp2 mutant seedlings was similar to that of wild-type Col-0 (FIGS. 10B-C). Because of their sequence similarity, it is possible that ETP1 and ETP2 may function redundantly. To test this hypothesis, we utilized an amiRNA (Schwab, R. et al., Plant Cell, 18:1121-1133 (2006)) directed at knocking down the levels of both ETP1 and ETP2 mRNAs. A number of independent ETP1/ETP2 knock down (amiR-ETP1/ETP2) transgenic lines were isolated. As shown in FIG. 3A, the gene expression levels of ETP1 and ETP2 were significantly reduced in these knockdown lines to 15-30% of the level in wild-type Col-0 plants as measured by quantitative PCR (qPCR) analysis. Since we found that ETP1 and ETP2 were able to interact directly with EIN2, we investigated whether ETP1 and ETP2 might be involved in EIN2 regulation. To do this, we examined the level of EIN2 protein in amiR-ETP1/ETP2 plants. We found that EIN2 protein accumulation was greatly increased in amiR-ETP1/ETP2 plants compared to wild-type Col-0 plants (FIG. 3B and FIG. 11), suggesting that deficiency of ETP1 and ETP2 RNAs results in accumulation of EIN2 protein. To further illuminate the functions of ETP1 and ETP2 in the regulation EIN2 protein, we constructed transgenic plants containing either ETP1 or ETP2 under the control of the Cauliflower Mosaic Virus 35S promoter (35S), allowing constitutively high levels of expression for these two genes; the RNA levels of ETP1 and ETP2 were 5- to 10-fold increased in compare to wild type plants (FIG. 13). Compared to wild-type Col-0 plants, EIN2 protein levels were greatly reduced in plants over-expressing ETP1 or ETP2 (FIG. 3C). More interestingly, EIN2 accumulation was barely detectable in the ETP1 or ETP2 overexpressed seedlings even upon ACC treatment (FIG. 3D), suggesting that ethylene-dependent EIN2 accumulation is impaired by overexpression of ETP1 or ETP2. Taken together, these results demonstrate that ETP1 and ETP2 are negative regulators of EIN2 protein stability.
To better understand the molecular consequences of reduced ETP1/ETP2 RNA levels, we interrogated the transcriptome of wild-type Col-0 and amiR-ETP1/ETP2 plants before and after 4 hours of treatment with ethylene gas using Affymetrix ATH1 arrays. Total RNA was prepared from 3-week-old leaves of wild-type Col-0 and amiR-ETP1/ETP2 plants with or without 4 hours ethylene treatment. The microarray data revealed that about 40% of genes with significant changes in expression of amiR-ETP1/ETP2 knock-down lines compared to wild-type Col-0 plants overlapped with genes whose expression levels change in wild-type Col-0 plants upon ethylene treatment (FIG. 12), suggesting that ETP1 and ETP2 specifically affect numerous ethylene responsive genes. Therefore, we examined the ethylene response of amiR-ETP1/ETP2 three-day-old etiolated seedlings. When grown on MS medium, the amiR-ETP1/ETP2 seedlings manifested a typical constitutive ethylene response phenotype (FIGS. 4A-C). Interestingly, the amiR-ETP1/ETP2 seedlings still showed some response to exogenously added ethylene (FIG. 4B). This residual response may be a consequence of the remaining of ETP1 and ETP2 mRNA present in these knockdown lines or might also be due to redundancy of function for other members of this family of proteins.
As expected for plants that show a constitutive ethylene response phenotype, the adult amiR-ETP1/ETP2 plants had small rosettes and dwarfed growth habit, as well as displayed abnormal flowers whose gynoecium protrude from the unopened floral buds (FIG. 4C). The decreased level of ETP1 and ETP2 RNA in amiR-ETP1/ETP2 plants resulted in severe sterility, a phenotype that was also observed for plants that over-express EIN2-CEND (Alonso, J. M. et al., Science, 284:2148-2152 (1999)). Under our experimental growth conditions, wild-type plants typically produce about 40 seeds per silique. However, in amiR-ETP1/ETP2 plants most siliques produce no seed although a few siliques do produce 2-3 seeds with an average 20 seeds per plant. Overall, these results demonstrated in the absence of ETP1 or ETP2, plants manifest a constitutive ethylene responsive phenotype, suggesting that that ETP1 and ETP2 negatively regulate ethylene response through the degradation of EIN2.
To further confirm the function of ETP1 and ETP2 in the ethylene signaling pathway, we examined the ethylene response phenotype of 3-day-old etiolated seedlings over-expressing ETP1 or ETP2. As demonstrated in FIGS. 5A-B, overexpression of ETP1 resulted in a partial ethylene insensitive phenotype of the hypocotyl, while the roots of these plants did not show any difference in ethylene response compared to wild-type Col-0 seedlings. Interestingly, overexpression of ETP2 resulted in a strong ethylene insensitive phenotype both in roots and hypocotyls (FIGS. 5C, E). The ethylene insensitive phenotype displayed by plants over-expressing ETP2 is consistent with a greater reduction in EIN2 protein levels (FIG. 3D). These results demonstrate that over-expressing ETP1 or ETP2 results in significant ethylene insensitive phenotypes, which further suggests that ETP1 and ETP2 negatively regulate ethylene response through their regulation of EIN2 levels.
To better understand how ethylene gas regulates ETP1 and ETP2, the RNA expression of ETP1 and ETP2 was examined after different times of ethylene treatment. We found that the expression of ETP1 and ETP2 RNA was unaffected even with prolonged ethylene treatment (FIG. 14). Therefore, we further examined ETP1 and ETP2 protein levels upon different times of ethylene treatment. As shown in FIG. 6A, the protein levels of both ETP1 and ETP2 were down-regulated upon treatment with exogenous ethylene. In addition, a co-immunoprecipitation assay was used to examine the stability of the interaction between EIN2 and ETP1 upon ethylene treatment. An equivalent amount of S35-labeled EIN2-C2 from in vitro transcriptional/translational system was co-immunoprecipitated with anti-MYC antibody in the presence of total protein prepared from 35S::MYC-ETP1 transgenic plants treated with or without ethylene. As shown in FIG. 6B, the level of ETP1 protein was decreased by added ethylene, resulting in less EIN2 co-immunoprecipitating with ETP1. These findings suggest that ethylene may perturb the interaction between EIN2 and ETP1 through down-regulation of ETP1 protein levels, providing an additional layer of complexity of EIN2 regulation.
Our biochemical and genetic studies described here demonstrate ethylene responses in plants are facilitated by control of EIN2 protein turnover through the 26S proteasome pathway. Notably, the stability of EIN2 protein is decreased drastically in 30 minutes with CHX treatment. In contrast, EIN2 is stabilized and accumulates in the presence of specific proteasome inhibitors MG132 or MG115. The ubiquitin pathway has been shown to be important for degrading membrane proteins but in many cases, the proteasome is not involved. Instead the proteins are shuttled to the lysosome. However, this latter pathway is insensitive to MG132, indicating that EIN2 is a short half-life protein and the protein is subjected to proteasome-mediated protein degradation. In support of these findings, a recent study found that the EIN2 C-terminus was capable of interacting with the COP1/signalsome (Christians, M. J. et al., Plant J., 55(3):467-477 (2008)), however, the biochemical consequence of this interaction was not reported.
The ein2 null mutant completely loses ethylene response (Alonso, J. M. et al., Science, 284:2148-2152 (1999)). In contrast, over expression of EIN2-CEND causes many ethylene responsive phenotypes in adult plants (Alonso, J. M. et al., Science, 284:2148-2152 (1999)). Furthermore, the accumulation of EIN3 protein is completely blocked in the ein2 mutant (Guo, H. and Ecker, J. R., Cell, 115:667-677 (2003)). All of these studies have demonstrated that the EIN2 plays an irreplaceable function in the ethylene response pathway.
Since EIN2 mRNA levels are unaffected by treatment with exogenous ethylene (Alonso, J. M. et al., Science, 284:2148-2152 (1999)), we examined EIN2 protein levels in plants treated with ethylene and in various ethylene response mutants. We found that the constitutive ethylene responsive mutant ctr1 significantly over-accumulated EIN2 protein relative to wild type at all time points tested, while there was no detectable accumulation of EIN2 in the ethylene insensitive mutants etr1. Moreover, protein accumulation of EIN2 in ein3eil1 plants was much reduced compared to wild type plants upon the ethylene treatment. Additionally, we found that the level of EIN2 protein positively correlates with the ethylene response phenotypes, suggesting that plants respond rapidly to exogenous ethylene by adjusting the level of EIN2 protein through its turnover. According to the current model, when plants are grown in air (absence of ethylene), the negative regulator CTR1 actively represses ethylene responses. Genetics evidence demonstrated that EIN2 is the first positive regulatory factor downstream of CTR1 (Ecker, J. R., Science, 268:667-675 (1995); Guo, H. and Ecker, J. R., Curr. Opin. Plant. Biol., 7:40-49 (2004)), and our findings now demonstrate that EIN2 protein dramatically accumulates in the constitutive ethylene response mutant, ctr1, suggesting that of the accumulation of EIN2 results in the constitutive ethylene response phenotype of these plants. However, the connection between CTR1 and EIN2 is unknown. One possibility is that in the absence of ethylene, CTR1 may function in concert with other, yet-to-be identified protein(s) to prevent EIN2 from accumulating. Previous studies have shown that accumulation of EIN3 protein fully depends on the presence of EIN2 protein (Guo, H. and Ecker, J. R., Cell, 115:667-677 (2003)). We have found that EIN3 protein also accumulates in the amiR-ETP1/ETP2 knockdown plants where EIN2 accumulates (unpublished data), which offers additional evidence that the protein level of EIN2 is crucial for EIN3 stability and ethylene signaling. Interestingly, we found the protein level of EIN2 does not become saturated until after 4 hours of ethylene treatment, while EIN3 protein level is saturated after 1 hour of ethylene treatment (Guo, H. and Ecker, J. R., Cell, 115:667-677 (2003)). The molecular mechanism behind these differences is unclear. However, a question of major biological interest is to uncover the link between EIN2 and EIN3 in the ethylene signaling pathway, which may shed light on the differences in timing for accumulation of protein levels.
EIN2 is a ubiquitous protein and exists in all the plant species examined. Interestingly, an EIN2 homolog is even present in the algae, Chlamydomonas reinhardtii (Qiao and Ecker unpublished data). Through most of the plant species, EIN2-CEND is the most highly conserved domain (FIG. 9), suggesting this domain may be of high importance for ethylene signal transduction. Interestingly, one of the ein2 mutant alleles previously isolated carries a single substitution (A to C at 3943) mutation in the CEND of EIN2 still manifests a strong ethylene insensitive phenotype (Alonso, J. M. et al., Science, 284:2148-2152 (1999)). This mutant allele of EIN2 suggests that an intact EIN2-CEND is essential for maintaining normal EIN2 function in ethylene signaling.
To identify EIN2 interacting proteins and potentially fill in gaps within the ethylene signaling pathway, we used EIN2-CEND to perform a yeast two-hybrid screen. Among the potential interactors, an F-box protein, ETP1, was identified. Furthermore, both directed yeast two-hybrid and pull down experiments demonstrated that EIN2-CEND interacts with ETP1 and its Arabidopsis homolog ETP2. In addition, we demonstrated that the most highly conserved domain of the EIN2-CEND is necessary and sufficient for the interaction of EIN2 with ETP1 and ETP2, and this <250 amino acids of EIN2 may be essential for regulation of the ethylene response. Overall, these results suggest that the interaction between EIN2-CEND and ETP1 and ETP2 is crucial to a proper ethylene response in Arabidopsis, and this regulation through C-terminal interaction with F-box proteins mediating protein turnover is important for ethylene response in most if not all plant species.
In plants, there are about 700 F-box proteins (Gagne, J. M. et al., Proc. Natl. Acad. Sci. U.S.A., 99:11519-11524 (2002)), and they are involved in a plethora of biological processes, including plant hormone responses (Gray, W. M. et al., Nature, 414:271-276 (2001); Dharmasiri, N. et al., Nature, 435:441-445 (2005); Kepinski, S, and Leyser, O., Nature, 435:446-451 (2005); Xie, D. X. et al., Science, 280:1091-1094 (1998); Guo, H. and Ecker, J. R., Cell, 115:667-677 (2003); Potuschak, T. et al., Cell, 115:679-689 (2003); Fu, X. et al., Plant Cell, 16:1406-1418 (2004)), lateral root formation (Coates, J. C. et al., Proc. Natl. Acad. Sci. U.S.A., 103:1621-1626 (2006)), light signaling and clock control (Mas, P. et al., Nature, 426:567-570 (2003); Imaizumi, T. et al., Nature, 426:302-306 (2003); Imaizumi, T. et al., Science, 309:293-297 (2005)), pollen recognition and rejection (Sijacic, P. et al., Nature, 429:302-305 (2004); Qiao, H. et al., Plant Cell, 16:2307-2322 (2004); Qiao, H. et al., Plant Cell, 16:582-595 (2004)), and plant-pathogen interactions (Kim, H. S. and Delaney, T. P., Plant Cell, 14:1469-1482 (2002); Duyvesteijn, R. G. et al., Mol. Microbiol., 57:1051-1063 (2005); Van den Burg, H. A. et al., Plant Cell, 20:697-719 (2008)). Based on phylogenetic analysis, the super family of F-box proteins are divided into 20 groups (Gagne, J. M. et al., Proc. Natl. Acad. Sci. U.S.A., 99:11519-11524 (2002)). ETP1 and ETP2 belong to a novel subfamily of F-box protein of which little is known (Gagne, J. M. et al., Proc. Natl. Acad. Sci. U.S.A., 99:11519-11524 (2002)). Specifically, both ETP1 and ETP2 carry the F-box protein associated (FBAâ1) motif, which is different from typical protein interaction domains carried by most well known F-box proteins (Lechner, E. et al., Curr. Opin. Plant. Biol., 9:631-638 (2006)). We have found that the non-typical FBAâ1 domain interacts directly with EIN2, indicating that this region may play a role in recognition of its substrates, which in our case is EIN2 (data not shown). However, at this point we can not be certain that EIN2 is the only target of ETP1 or ETP2, and if other substrates might be recognized by different portions of the ETP proteins.
Our study provides compelling evidence that ETP1 and ETP2 are negative regulators of EIN2 protein levels, and the EIN2-ETP1/ETP2 interaction is central in controlling ethylene responses. First, ETP1 and ETP2 interact with EIN2 physically. Second, our genetic experiments of knocking-down gene expression of ETP1 and ETP2 simultaneously (amiR-ETP1/ETP2) demonstrates that plants lacking these two proteins manifest constitutive ethylene response phenotypes both in etiolated seedlings and adult plants. This phenotype is extremely strong although the amiR-ETP1/ETP2 plants are slightly larger than their ctr1 counterpart (data not shown). Strikingly, knocking down ETP1 and ETP2 expression also stunted growth and renders the plants partially sterile, which is similar to the phenotypes observed in the etr1/etr2/ein4/ers2 quadruple mutant (Hua, J. et al., Plant Cell, 10:1321-1332 (1998)) and the ebf1 ebf2 double mutant (Guo, H. and Ecker, J. R., Cell, 115:667-677 (2003); Potuschak, T. et al., Cell, 115:679-689 (2003)). In contrast, overexpression of ETP1 and ETP2 results in plants manifesting an ethylene insensitive phenotype. Third, our biochemical data demonstrates that the level of EIN2 is greatly increased in the ETP1/ETP2 knock-down (amiR-ETP1/ETP2) plants, but in ETP1 or ETP2 overexpression plants EIN2 does not accumulate upon treatment with ACC, suggesting that ETP1 and ETP2 suppress EIN2 protein accumulation. Fourth, genome-wide microarray analysis demonstrated that ethylene-inducible genes are significantly induced in amiR-ETP1/ETP2 plants compared to wild-type Col-0 plants. Finally, our study demonstrated that ethylene negatively regulates ETP1 protein level and this impairs the interaction between EIN2 and ETP1, which likely results in accumulation of EIN2 protein. Further biochemical studies of this highly conserved and essential integral membrane protein will be critical to uncover the mechanistic details governing its hormone signaling properties.
The Columbia ecotype (Col-0) was the parent strain for all mutant and transgenic lines used in this study. Arabidopsis seeds were surface-sterilized and plate on the MS medium (4.3 g MS salt, 10 g sucrose pH 5.7, 8 g bactoagar per liter). After 3-4 days cold (4° C.) treatment, the plates were wrapped in foil and kept in a 24° C. incubator before the phenotypes of seedlings were analyzed. For propagation, seedlings were transferred from plates to soil (Pro-mix-HP) and grown to maturity at 22° C. under a 16 hr light/8 hr dark cycles. Ethylene treatment of Arabidopsis seedlings grown on plates was performed in air-tight containers (AirGas) by flowing hydrocarbon-free air supplied with 10 parts per million (ppm) ethylene or treated with hydrocarbon-free air alone (Kieber, J. J. et al., Cell, 72:427-441 (1993)). For drug treatment, Arabidopsis etiolated seedlings were incubate with liquid MS medium for 3 hrs in dark in room temperature. Afterward, the seedlings were treated with MG132 (100 Όm), MG115 (100 Όm) or DMSO (0.1%) for various times prior to harvesting the tissue.
The coding region corresponding to residues 808 amino acid to 1294 amino acid of EIN2 protein was PCR amplified, purified from E. coli and used to raise polyclonal antibodies in rabbits. Immunoblot assays were performed as described (Guo, H. and Ecker, J. R., Cell, 115:667-677 (2003)) with minor modifications. Membrane proteins were extracted according to (Chen, Y. F. et al., J. Biol. Chem., 277:19861-19866 (2002)), protein samples were mixed with 2ĂSDS-PAGE sample buffer, heated at 90° C. for 3 min, cooled on ice for 2 min. The proteins were fractionated by 4-12% gradient Bis-Tris Novex precast gels (Invitrogen), transferred on to nitrocellulose filter and the blot was probed with anti-EIN2 or anti-H+-ATPase antibody (kindly provided by Dr. M. J. Chrispeels).
In vitro transcribed and translated S35 labeled EIN2-C2 proteins were generated according to the protocol of TNT Coupled Wheat Germ Extract Systems (Promega). Total protein extracts were prepared from MYC-ETP1 plants treated with or without ethylene. The same amount of S35 labeled EIN2-C2 was incubated with total protein extract from MYC-ETP1 plants treated with or without ethylene, anti-MYC antibody and IgG agarose at 4° C. overnight. The IgG agarose beads were washed by PBST for 6 times, and the proteins were eluted by 2ĂSDS-PAGE sample buffer, heated at 90° C. for 3 min, cooled on ice for 2 min. The proteins were fractionated by 4-12% gradient Bis-Tris Novex precast gels (Invitrogen). The presence of EIN2-C2S35 was detected by autoradiography.
The cDNA sequences of the EIN2, ETP1 and ETP2 (Yamada, K. et al., Science, 302:842-846 (2003)) and their derivatives were cloned into pAS2 LOXP or pACT2 LOXP vector (Clontech; H. Li and J. R. E., unpublished data and http://signal.salk.edu/pHOST.html). Yeast transformation, growth conditions, and interaction assays were performed according to the manufacturer's instructions (Clontech).
Knockdown of ETP1 and ETP2 using an amiRNA was carried out as described (Schwab, R. et al., Plant Cell, 18:1121-1133 (2006)) and (http://wmd.weigelworld.org/cgi-bin/mirnatools.pl). The oligonucleotides used for amiRNA construction are âTCTTTGAATAAACGGTCCCATâ (SEQ ID NO:16) and âTCTTTGAATAAACGGTGCCATâ (SEQ ID NO:17). The binary vector used was pCHF3, and contained the artificial microRNA backbone miR 319. The binary vector pKYLX7 was modified by inserting a loxP site and MYC tag in the MCS region (H. Li and J. R. E., unpublished data and http://signal.salk.edu/pHOST.html). The full length ORFs of ETP1 and ETP2 were cloned into pUNI15 vector at the NcoI/SaiI site (a gift from Dr. Stephen Elledge). An in vitro plasmid recombination reaction, catalyzed by Cre recombinase, was carried out between pUNI15 (containing F box cDNA sequence) and the modified pKYLX7 with Myc tag. The resulting plasmids that harbor ETP1 and ETP2 coding regions driven by CaMV 35S promoter were introduced into Agrobacterium strain GV3101 and subsequently transformed into Arabidopsis plants. Transgenic T1 plants were identified by selection for kanamycin resistance. The triple response phenotype was scored in T2 seedlings originated from individual transgenic T1 plants. Homozygous T3 seedlings were used for phenotype analysis and immunoblotting studies.
All RNA extractions were performed using the RNeasy Kit (Qiagen) per manufacturers instructions. cRNA synthesis, labeling, and hybridization to Arabidopsis ATH1 gene expression arrays (Affymetrix Inc) were performed according to manufacturer's recommendations except that the labeling reactions were scaled down by 50%. After hybridization, the arrays were scanned and the CEL files were used for further analysis. All normalization and quality controls were performed using the packages from the remote analysis computation for gene expression data (RACE, http://race.unil.ch) (Psarros, M. et al., Nucleic Acids Res, 33 (Web Server issue):W638 (2005)). After normalization, present, marginal, and absent flags, together with the intensity values converted from logarithmic to linear scales, were exported to GeneSpring GX (Agilent). Ethylene-regulated genes were selected using a linear model approach (Smyth, G. K., Stat Appl Genet Mol Biol, 3:3 (2004)) implemented in the limma package from BioConductor (Smyth, G. K., Stat Appl Genet Mol Biol, 3:3 (2004)). This analysis was done using the Remote Analysis Computation for Gene Expression (Psarros, M. et al., Nucleic Acids Res, 33 (Web Server issue):W638 (2005)). Genes that had a P value of <0.05 and a fold change between control and treatment or control and mutants experiments greater than 1.5 were selected. Finally, only genes that were present or marginal in both replicates in the treated (when selecting upregulated genes) or in the untreated (when selecting for down regulated genes) samples were further considered.
It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.
1. A plant comprising a heterologous recombinant expression cassette, wherein the plant has altered sensitivity to ethylene compared to a control plant lacking the expression cassette, the expression cassette comprising a promoter operably linked to a polynucleotide, which polynucleotide, when expressed, modulates expression of an ETP1 or ETP2 polypeptide, wherein modulated expression of the ETP1 or ETP2 polypeptide results in altered ethylene sensitivity.
2. The plant of claim 1, wherein expression of the ETP1 and/or ETP2 polypeptide is increased compared to a control plant lacking the expression cassette, wherein the plant has reduced ethylene sensitivity compared to the control plant.
3. The plant of claim 2, wherein the polynucleotide encodes a polypeptide comprising an amino acid sequence substantially identical to any of SEQ ID NOS:1-8 or 18-22.
4. The plant of claim 1, wherein expression of the ETP1 and/or ETP2 polypeptide is decreased compared to a control plant lacking the expression cassette, wherein the plant has increased ethylene sensitivity compared to the control plant.
5. The plant of claim 4, wherein the polynucleotide comprises at least 20 contiguous nucleotides, or the complement thereof, of a nucleic acid encoding any of SEQ ID NOS:1-8 or 18-22, such that expression of the polynucleotide inhibits expression of an endogenous ETP1 or ETP2 gene.
6. The plant of claim 5, wherein the polynucleotide comprises a sequence at least 80% identical to at least 100 contiguous nucleotides, or the complement thereof, of a nucleic acid encoding any of SEQ ID NOS:1-8 or 18-22.
7. The plant of claim 4, wherein the polynucleotide encodes an siRNA, antisense polynucleotide, a microRNA, or a sense suppression nucleic acid, thereby suppressing expression of an endogenous ETP1 or ETP2 protein.
8. The plant of claim 5, wherein the endogenous ETP1 or ETP2 gene encodes a polypeptide at least 80% identical to any of SEQ ID NOS:1-8 or 18-22, respectively.
9. The plant of claim 6, wherein the sequence is at least 95% identical to at least 100 contiguous nucleotides encoding any of SEQ ID NOS:1-8 or 18-22.
10. The plant of claim 6, wherein the sequence is 100% identical to at least 100 contiguous nucleotides encoding any of SEQ ID NOS:1-8 or 18-22.
11. The plant of claim 4, comprising at least two heterologous expression cassettes wherein expression from one expression cassette inhibits expression of an endogenous ETP1 and expression from a second expression cassette inhibits expression of an endogenous ETP2 gene.
12. A method of making a plant of claim 1, the method comprising
introducing the expression cassette into a plurality of plants; and
selecting a plant that expresses the polynucleotide from the plurality of plants.
13. The method of claim 12, wherein the selecting step comprising selecting a plant that has altered ethylene sensitivity.
14. A recombinant expression cassette comprising a promoter operably linked to a polynucleotide, which polynucleotide, when expressed in a plant, modulates expression of an endogenous ETP1 or ETP2 gene.
15. The expression cassette of claim 14, wherein expression of ETP1 and/or ETP2 is increased when the expression cassette is introduced into a plant compared to a control plant lacking the expression cassette, and wherein the promoter is heterologous to the polynucleotide.
16. The expression cassette of claim 15, wherein the polynucleotide encodes a polypeptide substantially identical to any of SEQ ID NOS:1-8 or 18-22.
17. The expression cassette of claim 14, wherein expression of ETP1 and/or ETP2 is decreased when the expression cassette is introduced into a plant compared to a control plant lacking the expression cassette, and wherein the promoter is heterologous to the polynucleotide.
18. The expression cassette of claim 17, wherein the polynucleotide comprises at least 20 contiguous nucleotides, or the complement thereof, of a nucleic acid encoding any of SEQ ID NOs: 1-8 or 18-22, such that expression of the polynucleotide inhibits expression of an endogenous ETP1 or ETP2 gene.
19. The expression cassette of claim 18, wherein the endogenous ETP1 or ETP2 gene encodes a polypeptide at least 80% identical to any of SEQ ID NOS:1-8 or 18-22, respectively.
20. The expression cassette of claim 18, wherein the polynucleotide comprises a sequence at least 80% identical to at least 100 contiguous nucleotides, or the complement thereof, of a nucleic acid encoding any of SEQ ID NOS:1-8 or 18-22.
21. The expression cassette of claim 21, wherein the sequence is at least 95% identical to at least 100 contiguous nucleotides encoding any of SEQ ID NOs: 1-8 or 18-22.
22. The expression cassette of claim 21, wherein the sequence is 100% identical to at least 100 nucleotides encoding any of SEQ ID NOs: 1-8 or 18-22.
23. A method of identifying an agent that modulates the interaction of an ETP1 or ETP2-binding fragment of an EIN2 protein to ETP1 or ETP2, the method comprising
contacting a plurality of agents to the fragment in the presence of an ETP1 or ETP2 polypeptide under conditions such that the fragment would bind to the ETP1 or ETP2 polypeptide in the absence of the agents;
determining whether the contacting step modulates binding of the fragment to the ETP1 or ETP2 polypeptide compared to the absence of the agents; and
selecting an agent that modulates the interaction of an ETP1 or ETP2-binding fragment of an EIN2 protein to ETP1 or ETP2.